RNA-Protein Complexes and Interactions: Methods and Protocols (Methods in Molecular Biology, 2666) [2nd ed. 2023] 107163190X, 9781071631904

Citation preview

Methods in Molecular Biology 2666

Ren-Jang Lin  Editor

RNA-Protein Complexes and Interactions Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by step fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

RNA-Protein Complexes and Interactions Methods and Protocols Second Edition

Edited by

Ren-Jang Lin Beckman Research Institute, Center for RNA Biology and Therapeutics, Irell & Manella Graduate School of Biological Sciences, Duarte, CA, USA

Editor Ren-Jang Lin Beckman Research Institute, Center for RNA Biology and Therapeutics Irell & Manella Graduate School of Biological Sciences Duarte, CA, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic) ISBN 978-1-0716-3190-4 ISBN 978-1-0716-3191-1 (eBook) https://doi.org/10.1007/978-1-0716-3191-1 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2016, 2023 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Dedication To my family, for their unwavering love and support, and to City of Hope, for the resources and freedom that make this project a reality.

v

Preface RNA: Because without protein, we’d just be a bunch of lonely nucleotides— Unknown

RNA-protein complexes play a crucial role in many cellular processes. The study of these complexes and the understanding of the interactions between RNAs and proteins and the dynamics of these interactions have been a central focus of biological research. The identification and characterization of RNA-protein complexes can provide insights into the molecular mechanisms that govern cell function and development, which have led to the discovery of new disease-causing mechanisms and therapeutic targets. In recent years, advances in technologies and techniques have allowed for the study of RNA-protein interactions at an unprecedented level of detail. This book presents a collection of methods and techniques used to study RNA-protein complexes, interactions, and RNA localization. They are meticulously written with detailed step-by-step instructions to aid researchers across multiple disciplines in biological research. The 22 chapters in this book cover a wide range of techniques, including simple methods for detecting modified RNAs, techniques for analyzing gene expression patterns and RNA localization, methods for measuring interactions between tRNAs and their modifying enzymes, and techniques for probing RNA structure and RNA-protein interactions in vivo and in vitro. As we proceed through the book, we will see how these various techniques are used to study different aspects of RNA-protein complexes and interactions, and how they can be applied to different organisms and cell types. The chapters in this book are organized to address topics such as RNA modification and localization, RNA-protein interactions, RNP assembly and purification, and other related topics. This organization allows for a clear progression of information and a deeper understanding of the field. RNA modification and localization Chapter 1 describes a simple method for the detection of Wybutosine-modified tRNA/ Phe_GAA as a readout of retrograde tRNA nuclear import and re-export, using HCl/Aniline cleavage and non-radioactive Northern hybridization. Another important aspect of RNA analysis is the localization of RNA in cells, which is covered in Chapter 2 that describes the analysis of gene expression patterns and RNA localization by fluorescence in situ hybridization in whole mount Drosophila testes. RNA-protein interaction Biophysical techniques such as electrophoretic mobility shift assay (EMSA) and microscale thermophoresis (MST) are discussed in Chapter 3, while biochemical methods such as Fe(II)-EDTA cleavage and nuclease footprinting are covered in Chapter 4. Chapters 5, 6, and 7 describe the use of SHAPE to probe RNA structure and RNA-protein interactions in vitro and in vivo. Additionally, Chapters 8 and 9 describe the use of native RNA immunoprecipitation (RIP) and in vivo cross-linking and co-immunoprecipitation to study protein-RNA interactions.

vii

viii

Preface

RNP assembly and purification Chapter 14 describes the in vitro reconstitution of pseudouridylation catalyzed by human box H/ACA ribonucleoprotein particles, and Chapter 15 describes the arresting of spliceosome intermediates at various stages of the splicing pathway. Additionally, Chapter 16 describes the streamlined purification of RNA-protein complexes using UV crosslinking and RNA antisense purification, and Chapter 17 describes the MS2-MBP based affinity purification of nucleus- or cytoplasm-localized lncRNA-protein complexes formed in vivo. R-loop, chromatin, extracellular vesicles, and SELEX The book also covers a variety of other topics related to RNA biology, including R-loop formation, RNA-chromatin interactions, and the isolation and characterization of extracellular vesicles and exosomes. Chapter 19 describes the detection of R-loop formation using a plasmid-based in vitro transcription assay, and Chapter 20 describes methods to study RNA-chromatin interactions. Lastly, Chapters 21 and 22 cover the challenges for studying and isolating extracellular vesicles from cell-conditioned media, and the evolution of cell-type-specific RNA aptamers via live cell-based SELEX. The methods and protocols are useful for studying and analyzing the various issues commonly encountered by researchers in the field of RNA. For example: RNA-protein complexes formed inside the cell One method for purifying these complexes is UV crosslinking followed by antisense RNA oligos. Crosslinking fixes the complexes and preserves the interactions between the RNA and protein before purification. Another method is to tag the endogenous protein with MS2-MBP and to purify by amylose affinity. This technique uses a specific tag to pull out the protein of interest, along with any associated RNA. Tag with FLAG is another alternative. Cellular trafficking and localization One method is through biochemical separation of different cellular compartments. Another method is through the detection of location-specific RNA modification marks. In situ RNA-PLA and in situ hybridization are also techniques that can be used to study cellular localization of RNA-protein interactions. Measurement of RNA-protein interactions This can be done through various techniques such as electrophoretic mobility shift assay (EMSA) and microscale thermophoresis (MST), providing information on the strength and specificity of the interactions. Fe(II)-EDTA cleavage and nuclease footprinting, SHAPE, RIP, CLIP, CLASH, ribosome profiling, and RNA-PLA are other techniques that can be used to measure RNA-protein interactions. RNA-protein co-immunoprecipitation One application of this technique is for tRNA localization, which can provide information on the location of the tRNA within the cell. Another application of this technique is for the detection of native RIP, which can be used to identify and quantify specific RNA-protein interactions. Additionally, the technique can be used to study the interactions between microRNA and Ago protein.

Preface

ix

Assembly of RNA-protein complexes in lysates One example of an assembly is the H/ACA snoRNP, which is a complex involved in the modification of RNA. Another example is the spliceosomes, which are complexes involved in the removal of introns from RNA. RNA interactions with cellular components RNA-chromatin interaction, the detection of R-loop formation, the analysis of extracellular vesicles and exosomes, and cell-based SELEX to identify cell-type-specific RNA aptamers are also covered in the book. It is important to note that the field is constantly evolving, and new techniques are continuously being developed. This book can only cover a selection of the methods, but I hope that the techniques presented here will prove useful in your own research and that it will encourage further exploration of the fascinating world of RNA-protein interactions. I would like to extend my heartfelt appreciation to the authors of this book for their invaluable contributions. Their hard work and dedication have resulted in a valuable resource for researchers and students in the field of RNA-protein complexes and interactions. I am particularly grateful to the editor of the Methods in Molecular Biology series, John M. Walker, for his trust and support in inviting me to be an editor for the third time, following two previous method books on the same topic. I would also like to acknowledge the publisher staff for their patience and tireless efforts in bringing this book to fruition. Their support and guidance throughout the process have been invaluable in ensuring that the book is of the highest quality. Their dedication to the project has made it possible to deliver a comprehensive and informative book on this topic. Special thanks to ChatGPT for providing suggestions and assistance in writing the preface. Finally, I would like to express my gratitude to the readers of this book for taking the time to engage with the material. It is through their interest and curiosity that books like this can come to life and contribute to the advancement of knowledge in the field of RNA-protein complexes and interactions. Center for RNA Biology and Therapeutics, Beckman Research Institute, Duarte, CA, USA

Ren-Jang Lin

Contents Dedication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 A Simple Method for the Detection of Wybutosine-Modified tRNAPheGAA as a Readout of Retrograde tRNA Nuclear Import and Re-export: HCl/Aniline Cleavage and Nonradioactive Northern Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Regina T. Nostramo and Anita K. Hopper 2 Analysis of Gene Expression Patterns and RNA Localization by Fluorescence in Situ Hybridization in Whole Mount Drosophila Testes . . . . . . . . Jaclyn M. Fingerhut and Yukiko M. Yamashita 3 Electrophoretic Mobility Shift Assay (EMSA) and Microscale Thermophoresis (MST) Methods to Measure Interactions Between tRNAs and Their Modifying Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andrzej Chramiec-Gła˛bik, Michał Rawski, Sebastian Glatt, and Ting-Yu Lin 4 Mapping of RNase P Ribozyme Regions in Proximity with a Human RNase P Subunit Protein Using Fe(II)-EDTA Cleavage and Nuclease Footprint Analyses. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Phong Trang, Adam Smith, and Fenyong Liu 5 SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kaushik Saha and Gourisankar Ghosh 6 Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kaushik Saha and Gourisankar Ghosh 7 Analysis of RNA-Protein Interaction Networks Using RNP-MaP . . . . . . . . . . . . . Kaushik Saha and Gourisankar Ghosh 8 Native RNA Immunoprecipitation (RIP) for Precise Detection and Quantification of Protein-Interacting RNA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mai Baker, Rami Khosravi, and Maayan Salton 9 In Vivo Cross-Linking and Co-Immunoprecipitation Procedure to Analyze Nuclear tRNA Export Complexes in Yeast Cells . . . . . . . . . . . . . . . . . . Kunal Chatterjee and Anita K. Hopper 10 Identify MicroRNA Targets Using AGO2-CLASH (Cross-linking, Ligation, and Sequencing of Hybrids) and AGO2-CLIP (Cross-Linking and Immuno-Precipitation) in Cells with or Without the MicroRNA of Interest Depleted. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mitsuo Kato 11 Ribosomal Profiling by Gradient Fractionation of Cell Lysates . . . . . . . . . . . . . . . Nimisha Bhattarai, Bo Cao, Shelya X. Zeng, and Hua Lu

xi

v vii xiii

1

15

29

55

69

81 95

107

115

137 149

xii

12

13

14

15

16

17

18

19

20

21

22

Contents

Global Assessment of Protein Translation in Mammalian Cells Using Polysome Fractionation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jingrong Zhao and Sika Zheng Fluorescent In Situ Detection of RNA–Protein Interactions in Intact Cells by RNA-PLA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tianqi Li, Wei Zhang, and Mingyi Xie In Vitro Reconstitution of Pseudouridylation Catalyzed by Human Box H/ACA Ribonucleoprotein Particles . . . . . . . . . . . . . . . . . . . . . . . . . . Hironori Adachi, Jonathan L. Chen, Qiangzong Yin, Pedro Morais, and Yi-Tao Yu Arresting Spliceosome Intermediates at Various Stages of the Splicing Pathway . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chi-Kang Tseng and Soo-Chen Cheng Streamlined Purification of RNA–Protein Complexes Using UV Cross-Linking and RNA Antisense Purification . . . . . . . . . . . . . . . . . . . . . . . . . Nhu Trang, Tong Su, Simone Hall, Nada Boutros, Bobby Kong, Calvin Huang, and Colleen A. McHugh MS2-MBP-Based Affinity Purification of Nucleus- or Cytoplasm-Localized lncRNA–Protein Complexes Formed In Vivo . . . . . . . . . . . Shuai Hou, Weijie Wang, Tian Hao, and Haixin Lei RNA and Protein Interactomes of an RNA-Binding Protein Tagged with FLAG Epitopes Using Combinatory Approaches of Genome Engineering and Stable Transfection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sze Cheng, Meeyeon Park, and Jeongsik Yong Detecting R-Loop Formation Using a Plasmid-Based In Vitro Transcription Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lei Shen and Yanzhong Yang Methods to Study RNA–Chromatin Interactions . . . . . . . . . . . . . . . . . . . . . . . . . . . Kiran Sriram, Yingjun Luo, Naseeb K. Malhi, Aleysha T. Chen, and Zhen Bouman Chen Challenges for Studying and Isolating Extracellular Vesicles from Cell-Conditioned Media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andrew R. Chin Evolution of Cell-Type-Specific RNA Aptamers via Live Cell-Based SELEX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Alberto Herrera, Jiehua Zhou, Min-sun Song, and John J. Rossi

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

157

165

177

193

213

231

247

265 279

299

317 347

Contributors HIRONORI ADACHI • Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester, NY, USA MAI BAKER • Department of Biochemistry and Molecular Biology, The Institute for Medical Research Israel–Canada, Hebrew University–Hadassah Medical School, Jerusalem, Israel NIMISHA BHATTARAI • Department of Biochemistry & Molecular Biology and Cancer Center, Tulane University School of Medicine, New Orleans, LA, USA NADA BOUTROS • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA BO CAO • Xavier University of Louisiana College of Pharmacy, New Orleans, LA, USA KUNAL CHATTERJEE • Department of Molecular Genetics, Center for RNA Biology, The Ohio State University, Columbus, OH, USA; Department of Biology, Wittenberg University, Springfield, OH, USA ALEYSHA T. CHEN • Department of Diabetes Complications and Metabolism, Arthur Riggs Diabetes Metabolism Research Institute and Beckman Research Institute, City of Hope, Duarte, CA, USA JONATHAN L. CHEN • Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester, NY, USA ZHEN BOUMAN CHEN • Department of Diabetes Complications and Metabolism, Arthur Riggs Diabetes Metabolism Research Institute and Beckman Research Institute, City of Hope, Duarte, CA, USA; Irell and Manella Graduate School of Biological Sciences, Beckman Research Institute, City of Hope, Duarte, CA, USA SOO-CHEN CHENG • Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China SZE CHENG • Department of Biochemistry, Molecular Biology and Biophysics, University of Minnesota Twin Cities, Minneapolis, MN, USA ANDREW R. CHIN • Sean N. Parker Center for Allergy and Asthma Research at Stanford University, Stanford, CA, USA ANDRZEJ CHRAMIEC-GŁA˛BIK • Malopolska Centre of Biotechnology (MCB), Jagiellonian University, Krakow, Poland JACLYN M. FINGERHUT • Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Department of Biology, Cambridge, MA, USA; Howard Hughes Medical Institute, Cambridge, MA, USA GOURISANKAR GHOSH • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA SEBASTIAN GLATT • Malopolska Centre of Biotechnology (MCB), Jagiellonian University, Krakow, Poland SIMONE HALL • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA TIAN HAO • Institute of Cancer Stem Cell, Dalian Medical University, Dalian, China ALBERTO HERRERA • Center for RNA Biology and Therapeutics, Beckman Research Institute of City of Hope, Duarte, CA, USA; Irell and Manella Graduate School of Biological Sciences, Beckman Research Institute of City of Hope, Duarte, CA, USA

xiii

xiv

Contributors

ANITA K. HOPPER • Department of Molecular Genetics, Center for RNA Biology, The Ohio State University, Columbus, OH, USA SHUAI HOU • Institute of Cancer Stem Cell, Dalian Medical University, Dalian, China CALVIN HUANG • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA MITSUO KATO • Department of Diabetes Complications and Metabolism, Arthur Riggs Diabetes & Metabolism Research Institute, Beckman Research Institute of City of Hope, Duarte, CA, USA RAMI KHOSRAVI • Department of Biochemistry and Molecular Biology, The Institute for Medical Research Israel–Canada, Hebrew University–Hadassah Medical School, Jerusalem, Israel BOBBY KONG • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA HAIXIN LEI • Institute of Cancer Stem Cell, Dalian Medical University, Dalian, China TIANQI LI • Department of Biochemistry and Molecular Biology, University of Florida, Gainesville, FL, USA TING-YU LIN • Malopolska Centre of Biotechnology (MCB), Jagiellonian University, Krakow, Poland FENYONG LIU • School of Public Health, University of California, Berkeley, CA, USA; Program in Comparative Biochemistry, University of California, Berkeley, CA, USA HUA LU • Department of Biochemistry & Molecular Biology and Cancer Center, Tulane University School of Medicine, New Orleans, LA, USA YINGJUN LUO • Department of Diabetes Complications and Metabolism, Arthur Riggs Diabetes Metabolism Research Institute and Beckman Research Institute, City of Hope, Duarte, CA, USA NASEEB K. MALHI • Department of Diabetes Complications and Metabolism, Arthur Riggs Diabetes Metabolism Research Institute and Beckman Research Institute, City of Hope, Duarte, CA, USA COLLEEN A. MCHUGH • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA PEDRO MORAIS • ProQR Therapeutics, Leiden, The Netherlands; Research and Development, Pharmaceuticals, Bayer AG, Wuppertal, Germany REGINA T. NOSTRAMO • Department of Molecular Genetics, Center for RNA Biology, The Ohio State University, Columbus, OH, USA MEEYEON PARK • Department of Biochemistry, Molecular Biology and Biophysics, University of Minnesota Twin Cities, Minneapolis, MN, USA MICHAŁ RAWSKI • Malopolska Centre of Biotechnology (MCB), Jagiellonian University, Krakow, Poland JOHN J. ROSSI • Center for RNA Biology and Therapeutics, Beckman Research Institute of City of Hope, Duarte, CA, USA; Irell and Manella Graduate School of Biological Sciences, Beckman Research Institute of City of Hope, Duarte, CA, USA KAUSHIK SAHA • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA MAAYAN SALTON • Department of Biochemistry and Molecular Biology, The Institute for Medical Research Israel–Canada, Hebrew University–Hadassah Medical School, Jerusalem, Israel LEI SHEN • Department of Cancer Genetics and Epigenetics, Beckman Research Institute, City of Hope National Cancer Center, Duarte, CA, USA

Contributors

xv

ADAM SMITH • Program in Comparative Biochemistry, University of California, Berkeley, CA, USA MIN-SUN SONG • Center for RNA Biology and Therapeutics, Beckman Research Institute of City of Hope, Duarte, CA, USA KIRAN SRIRAM • Department of Diabetes Complications and Metabolism, Arthur Riggs Diabetes Metabolism Research Institute and Beckman Research Institute, City of Hope, Duarte, CA, USA; Irell and Manella Graduate School of Biological Sciences, Beckman Research Institute, City of Hope, Duarte, CA, USA TONG SU • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA NHU TRANG • Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, USA PHONG TRANG • School of Public Health, University of California, Berkeley, CA, USA CHI-KANG TSENG • Graduate Institute of Microbiology, National Taiwan University, College of Medicine, Taipei, Taiwan, Republic of China WEIJIE WANG • Institute of Cancer Stem Cell, Dalian Medical University, Dalian, China; Institute of Pediatrics, Children’s Hospital of Fudan University, Shanghai, China MINGYI XIE • UF Health Cancer Center, University of Florida, Gainesville, FL, USA YUKIKO M. YAMASHITA • Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Department of Biology, Cambridge, MA, USA; Howard Hughes Medical Institute, Cambridge, MA, USA YANZHONG YANG • Department of Cancer Genetics and Epigenetics, Beckman Research Institute, City of Hope National Cancer Center, Duarte, CA, USA QIANGZONG YIN • Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, MA, USA JEONGSIK YONG • Department of Biochemistry, Molecular Biology and Biophysics, University of Minnesota Twin Cities, Minneapolis, MN, USA YI-TAO YU • Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester, NY, USA SHELYA X. ZENG • Department of Biochemistry & Molecular Biology and Cancer Center, Tulane University School of Medicine, New Orleans, LA, USA WEI ZHANG • Department of Genetics, Yale University School of Medicine, New Haven, CT, USA JINGRONG ZHAO • Division of Biomedical Sciences, Center for RNA Biology and Medicine,, University of California, Riverside, CA, USA SIKA ZHENG • Division of Biomedical Sciences, Center for RNA Biology and Medicine,, University of California, Riverside, CA, USA JIEHUA ZHOU • HitGen Inc., Chengdu, China

Chapter 1 A Simple Method for the Detection of Wybutosine-Modified tRNAPheGAA as a Readout of Retrograde tRNA Nuclear Import and Re-export: HCl/Aniline Cleavage and Nonradioactive Northern Hybridization Regina T. Nostramo and Anita K. Hopper Abstract tRNAs are highly mobile molecules that are trafficked back and forth between the nucleus and cytoplasm by several proteins. However, characterization of the movement of tRNAs and the proteins mediating these movements can be difficult. Here, we describe an easy and cost-effective assay to discover genes that are involved in two specific tRNA trafficking events, retrograde nuclear import and nuclear re-export for yeast, Saccharomyces cerevisiae. This assay, referred to as the hydrochloric acid (HCl)/aniline assay, identifies the presence or absence of a unique modification on tRNAPheGAA called wybutosine (yW) that requires mature, spliced tRNAPheGAA to undergo retrograde nuclear import and subsequent nuclear re-export for its addition. Therefore, the presence/absence of yW-modified tRNAPheGAA serves as a readout of retrograde nuclear import and nuclear re-export. This simple assay can be used to determine the role of any gene product in these previously elusive tRNA trafficking events. Key words Hydrochloric acid, Aniline, Northern blot, tRNA retrograde nuclear import, tRNA re-export, Wybutosine, Yeast

1

Introduction In eukaryotic cells, tRNAs are trafficked back and forth between the nucleus and the cytoplasm. These movements are required for the maturation of primary tRNA transcripts into mature tRNAs, which function as essential adaptor molecules in protein synthesis. The trafficking of tRNAs within the cell consists of three main steps (Fig. 1) [reviewed in [1]]. The first is primary export of tRNAs from the nucleus, where they are transcribed, to the cytoplasm. Second, tRNAs undergo retrograde nuclear import, which relocates them back to the nucleus. Finally, tRNAs are re-exported back to the cytoplasm. Understanding subcellular trafficking of tRNAs and its regulation, as well as the proteins involved in these

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

1

2

Regina T. Nostramo and Anita K. Hopper Nucleus 5’ Ex

3’ Ex

Cytoplasm Mitochondria

Primary Export

Intron

pre-tRNAPhe

Retrograde Import Cm

Trm7

Gm

Spliced tRNAPhe

Trm5 m1G

Re-export

Tyw1 Tyw3 yW

Tyw2 Tyw4

Fig. 1 Maturation of tRNAPheGAA in Saccharomyces cerevisiae. The maturation of tRNAPheGAA in S. cerevisiae includes the sequential addition of several modifications. Since many of the enzymes that catalyze the addition of these modifications display either nuclear or cytoplasmic localization, tRNAPheGAA must undergo trafficking between these two compartments to become fully mature. After tRNAPheGAA is transcribed in the nucleus, it undergoes multiple processing events and modifications (not shown), resulting in pre-tRNAPheGAA, which contains a 5′ and 3′ exon (black lines) separated by an intron (orange line). Pre-tRNAPheGAA is exported to the cytoplasm in the first trafficking event called primary nuclear export. Once in the cytoplasm, pre-tRNAPheGAA is transported to the surface of the mitochondria where its intron is spliced, and the 5′ and 3′ exons are ligated together. Spliced tRNAPheGAA is a substrate for the enzyme Trm7, which methylates positions 32 (Cm) and 34 (Gm) (pink). Next, spliced tRNAPheGAA is trafficked back to the nucleus in a step called retrograde nuclear import. Spliced tRNAPhe Phe GAA (but not intron-containing tRNA GAA) is a substrate for the nuclearlocalized enzyme Trm5, which methylates G at position 37 (m1G) (green). In the final event of its maturation, tRNAPheGAA is re-exported from the nucleus to the cytoplasm where it is modified sequentially by the Tyw1-4 enzymes, resulting in the addition of wybutosine (yW) at position 37 (blue). Therefore, any spliced tRNAPheGAA containing the yW modification must have undergone both retrograde nuclear import and nuclear re-export and can thus serve as a readout of these two trafficking events. (Reproduced from Ref. 4 with permission from Oxford Journals)

processes, has and continues to shed light on the physiological and pathophysiological roles of tRNAs in the cell [2–4]. The first tRNA trafficking event, primary nuclear export, is perhaps the most well-studied of the three. This is because in organisms like budding and fission yeast a subset of tRNAs possess introns, which are spliced on the surface of the mitochondria immediately following primary nuclear export by exporters such as Los1 [5–7]. Therefore, any intron-containing tRNA that has had

HCl/Aniline Assay for tRNAPheGAA Nuclear Import and Re-export

3

its intron removed must have undergone primary export from the nucleus to the cytoplasm. This would be reflected by a decrease in the size of the tRNA, which can be easily detected by Northern blot analysis [8]. To this end, a genome-wide screen using this approach identified three novel proteins (Mex67, Mtr2, and Crm1) that are involved in the primary export of tRNA in yeast, in addition to the canonical tRNA exporter Los1 [2, 9]. Understanding of the two subsequent tRNA trafficking events, specifically retrograde nuclear import and nuclear re-export, however, is not as complete. While the size of intron-containing tRNAs decreases upon primary export and subsequent intron splicing, there is no size change in tRNAs upon retrograde import and re-export. Additionally, tracking tRNA movement by other means like tagging can be complicated given the lack of a 3’ UTR, addition of an amino acid to the 3′ end, and the critical importance of tRNA tertiary structure in mediating its function. Additionally, fractionating the cytoplasm and nucleus in particular organisms, such as Saccharomyces cerevisiae, is extremely difficult and not amenable to genome-wide screens. Therefore, to address this issue, we developed a simple assay that allows for the identification of gene products involved in tRNA retrograde nuclear import and re-export. This assay takes advantage of a specific modification, wybutosine (yW), that occurs exclusively on tRNAPheGAA in S. cerevisiae and requires both retrograde nuclear import and nuclear re-export for its addition [10]. The process of tRNAPheGAA maturation in S. cerevisiae, culminating in the addition of the yW modification, begins with its transcription in the nucleus (Fig. 1). Once transcribed, this primary tRNA undergoes 5′ leader and 3′ trailer removal and 3’ CCA addition, resulting in the formation of pre-tRNAPheGAA. Pre-tRNAPheGAA is then exported to the cytoplasm and localized to the surface of the mitochondria for intron splicing by the splicing endonuclease complex [3, 5, 6]. This spliced tRNAPheGAA is now a substrate for the cytoplasmic methyltransferase, Trm7, which methylates positions 32 (Cm32) and 34 (Gm34) [11]. These modifications, particularly Gm34, are prerequisites for the later addition of the yW modification. The tRNA then undergoes retrograde nuclear import, where it is now a substrate for the nuclear-localized methyltransferase Trm5, which methylates G at position 37 (m1G37) [12]. Trm5 only recognizes spliced tRNAPheGAA and not intron-containing tRNAPheGAA [13, 14], and therefore, the presence of this modification is indicative of prior primary nuclear export and retrograde nuclear import. Finally, the m1G37-modified tRNAPheGAA is re-exported to the cytoplasm where it is sequentially modified by the enzymes Tyw1, Tyw2, Tyw3, and Tyw4, resulting in a wybutosine-modified tRNAPheGAA [15]. Thus, any tRNAPheGAA containing the yW modification is evidence of a tRNA that has undergone all three trafficking events.

4

Regina T. Nostramo and Anita K. Hopper A. yW-modified tRNAPhe

HCl

Aniline

tRNAPhe lacking yW

HCl

Aniline

B.

Fig. 2 The effects of sequential treatment of tRNAPheGAA with HCl and aniline. (a) Treatment of fully mature tRNAPheGAA containing the wybutosine (yW) modification (green) with HCl elicits the removal of the yW base, leaving an abasic site (AP site; gray unfilled circle). Subsequent treatment with aniline causes scission of the RNA chain at the AP site, resulting in the splitting of the tRNA into a 5′ and 3′ half. (b) Treatment of tRNAPheGAA lacking the yW modification with HCl does not elicit AP site formation, and therefore, no RNA chain scission occurs in response to subsequent aniline treatment

Given the ability of the yW modification to be used as a readout of retrograde nuclear import and re-export, we developed an easy, cost-effective assay, herein called the hydrochloric acid (HCl)/aniline assay, to detect the presence of this modification [4]. The basis for this assay stems from research conducted in the late 1960s and 1970s demonstrating that mild acid treatment of tRNAPheGAA containing yW results in removal of the yW base without cleaving the sugar-phosphate backbone, creating an abasic site [16, 17]. Cleavage of the sugar-phosphate backbone at this abasic site can then be achieved by incubation with aniline at a low pH via a β-elimination reaction [18]. Given that the yW modification is located at nucleotide position 37, the last nucleotide of the 5′ exon, this results in cleavage of tRNAPheGAA into 5′ and 3′ half-sized fragments (Fig. 2a). This drastic change in size can be visualized by Northern blot analysis (Fig. 3, lanes 3 vs. 4). Thus, any mature tRNAPheGAA that is cleaved following sequential HCl and aniline treatment is indicative of a tRNA that has undergone both retrograde nuclear import and nuclear re-export. Conversely, any tRNAPhe GAA lacking the yW modification would remain intact following sequential HCl and aniline treatment (Fig. 2b). For example, cells lacking Tyw1, the enzyme that catalyzes the first step in the conversion of m1G37 of tRNAPheGAA to yW, do not contain the yW modification and therefore do not display tRNA cleavage following sequential HCl and aniline treatment when visualized by Northern blot (Fig. 3, lanes 1 vs. 2). The HCl/aniline assay can thus be used to detect gene products that play a role in the retrograde nuclear import or re-export steps, as the lack of tRNAPheGAA cleavage following HCl and aniline treatment in a strain deficient in a specific gene product would indicate the role of this gene product in either tRNAPheGAA

HCl/Aniline Assay for tRNAPheGAA Nuclear Import and Re-export

tyw1Δ

5

mtr10Δ

WT

-

+

-

+

+

HCl

+

+

+

+

+

Aniline

1

2

3

4

5

Fig. 3 Northern blot analysis of tRNAPheGAA treated with HCl and aniline. Small RNAs were isolated from wild-type (WT), tyw1Δ, or mtr10Δ cells and subjected to sequential treatment with HCl and aniline. Northern blot analysis was performed using a DIG-labeled tRNAPheGAA 5′/3′ exon probe. For all strains, no tRNAPheGAA strand cleavage was observed when treated with aniline only (lanes 1 and 3). Conversely, nearly all of the tRNAPheGAA was cleaved in WT cells subjected to sequential HCl/aniline treatment (lane 4). This cleavage was absent in tyw1Δ cells (lane 2), which lack the Tyw1 enzyme needed for the synthesis of yW. In cells lacking Mtr10, a protein involved in the retrograde nuclear import of tRNAPheGAA, cleavage of the tRNA was greatly inhibited as compared to WT cells (lane 5). The detected RNAs correspond to mature (M; 76 nts), 5′ exon (5′ Ex; 37 nts), or 3′ exon (3′ Ex; 39 nts) tRNAPheGAA. Mature tRNAPheGAA migrates on the gel as two bands. Since two of the ten copies of this gene differ by a single nucleotide substitution in both the 5′ and 3′ exons, this dual migration pattern may be due to these substitutions or to under-modification of the tRNA. 5S rRNA levels (121 nts) were measured by Northern blot and serve as a loading control

maturation (as with tyw1Δ cells) or the retrograde nuclear import or re-export processes. For example, Mtr10 is a member of the β-importin family and has previously been shown to function in the import of tRNAs under conditions of amino-acid deprivation [19]. Using the HCl/aniline assay, Mtr10 was also shown to function in the constitutive retrograde nuclear import of tRNAPheGAA, as mature, uncleaved tRNAPheGAA levels are increased in mtr10Δ cells following sequential HCl and aniline treatment, as compared to wild-type cells (Fig. 3, lanes 4 vs. 5) [4].

6

Regina T. Nostramo and Anita K. Hopper

When using the HCl/aniline assay for the identification of novel proteins involved in the retrograde nuclear import or re-export of tRNAPheGAA, a second step, such as fluorescence in situ hybridization (FISH) analysis, will be needed to differentiate between these two processes. For gene products that are involved in retrograde nuclear import of tRNAPheGAA, cytoplasmic accumulation of the tRNA would be observed upon gene deletion/inactivation. Conversely, nuclear accumulation would be observed if the defect occurred in the nuclear re-export step [19]. Overall, the value the HCl/aniline assay will add to the field of tRNA biology is immense. Currently, this assay has been used to identify a constitutive role of Mtr10 in the retrograde import of tRNAPheGAA and to confirm a role of Ssa2 in this process under conditions of amino acid deprivation [4], as previously reported [20]. Additionally, this assay was able to demonstrate that Mex67 and Crm1 are required for the re-export of tRNAPheGAA, whereas the canonical tRNA exporters, Los1 and Msn5, are not [4]. Overall, use of the HCl/aniline assay will lead to the identification and characterization of additional gene products involved in the retrograde tRNA nuclear import and re-export processes and deepen our understanding of the role of tRNA trafficking in cell biology.

2

Materials All solutions should be prepared in filter sterilized double distilled water (ddH2O). Reagents should be stored at room temperature, unless otherwise indicated.

2.1 HCl/Aniline Assay

1. Stock HCl solution: Dilute 37% (w/w) hydrochloric acid 100 fold in water. 2. Working HCl solution: In a 1.5 mL microcentrifuge tube, mix 975 μL water and 25 μL of the stock HCl solution. 3. Working aniline solution (0.5 M aniline, pH 4.5): Add 8.2 mL water to a 15 mL tube. Then add 910 μL aniline (ACS grade; ≥ 99.5%) and 795 μL glacial acetic acid. Cap and flip the tube several times to mix. Wrap the tube in foil to protect from light. This solution should be prepared just before use (see Notes 1 and 2). 4. 5 mM potassium hydroxide (KOH). 5. 100% ethanol: Store at 4 °C. 6. 3 M sodium acetate, pH 5.2. 7. GlycoBlue coprecipitant (15 mg/mL; Invitrogen): This reagent consists of a blue dye covalently linked to glycogen, which coprecipitates with RNA. GlycoBlue enhances precipitation of low quantities of RNA and also increases the visibility of the RNA pellet during RNA precipitation.

HCl/Aniline Assay for tRNAPheGAA Nuclear Import and Re-export

2.2 Gel Electrophoresis

7

1. 10% polyacrylamide: In a 1 L beaker, add 424.2 g urea to 300 mL water and stir on a heating plate until dissolved, but be careful not to bring to a boil. Remove from heat and allow to cool at room temperature for 5–10 min. After the solution is slightly cooled but still warm, add 250 mL 40% acrylamide/bis solution (19:1), 100 mL 10× TBE (see #5 below for recipe) and bring to 1 L with water. Filter sterilize, cover with foil and store at 4 °C. 2. Ammonium persulfate (APS): 10% solution in water (see Note 3). 3. N,N,N,N′-Tetramethyl-ethylenediamine (TEMED): Store at 4 °C. 4. 10% polyacrylamide, 8 M urea gel: In a 50 mL conical tube, combine 35 mL 10% polyacrylamide, 300 μL 10% APS and 22.5 μL TEMED. Prepare just before casting gel. 5. 10× TBE Running buffer: In a 1 L beaker, dissolve 108 g Tris base, 55 g boric acid and 7.5 g EDTA, disodium salt in 800 mL water. Stir with heat until dissolved. Bring to 1 L with water. When ready to use, prepare 1× TBE by adding 100 mL 10× TBE to 900 mL water (see Note 4). 6. 2× Loading Dye: Combine 24 g urea, 2 mL 0.5 M EDTA (pH 8.0) and 0.1 mL 1 M Tris buffer (pH 7.5). Adjust the volume to 50 mL with water. Then add 0.05 g of xylene cyanol and 0.05 g bromophenol blue. Store at 4 °C. 7. Gel electrophoresis apparatus.

2.3 Transfer and UV Cross Linking

1. 50× TAE transfer buffer: In a 1 L beaker, dissolve 242 g Tris base and 18.61 g EDTA, disodium salt in 700 mL water and stir until dissolved. Add 57.1 mL glacial acetic acid, and adjust the volume to 1 L. When ready to use, prepare 1× TAE by adding 20 mL 50× TAE to 980 mL water (see Note 4). 2. Hybond N+ nylon membrane. 3. Spectrolinker XL-100 UV cross-linker: RNAs can be fixed to the Hybond N+ nylon membrane by UV cross-linking at an energy dosage of 120 millijoules/cm2. 4. Transfer apparatus.

2.4 DIG-Labeled Probes

1. tRNAPheGAA 5′/3′ exon probe: 5’ CGAACACAGGACCTC CAGATCTTCAGTCTGGCGCTCTCCC 3’ This 40 nt oligo is complementary to 20 nts of the 3′ end of the 5′ exon and 20 nts of the 5′ end of the 3′ exon of tRNAPheGAA in Saccharomyces cerevisiae.

8

Regina T. Nostramo and Anita K. Hopper

2. tRNAPheGAA 5′ exon probe: 5’ CAACTGAGCTAAGTCCGC 3’ This oligo is complementary to the 18 nts at the 5′ end of the 5′ exon of tRNAPheGAA in Saccharomyces cerevisiae. 3. tRNAPheGAA 3′ exon probe: 5’ TGCGAACTCTGTGGATCGAACACAGGACCT 3’ This oligo is complementary to the 30 nts at the 3′ end of the 3′ exon of tRNAPheGAA in Saccharomyces cerevisiae. 4. 5S rRNA probe: 5’ GCACCTGAGTTTCGCGTATGGT 3’ This oligo is complementary to 5S rRNA in Saccharomyces cerevisiae and can be used as a control for equal gel loading (see Note 5). 5. DIG Oligonucleotide Tailing Kit, second generation (Roche): DIG-label the 3′ end of the probes listed above using DIG-dUTP/dATP by first adding 1 μL of 100 μM oligo to 9 μL dH2O, and then adding reagents #1–5, according to the manufacturer’s protocol. After incubation at 37 °C for 15 min, stop the reaction by adding 0.8 μL of 0.5 M EDTA, pH 8.0. One labeling reaction yields a total volume of 20.8 μL DIG-labeled probe, which is enough probe for about 20 blots (1 μL DIG-labeled probe per blot). DIG-labeled probes should be stored at -20 °C. 2.5 Northern Blot Hybridization and Detection of DIGlabeled Probes

1. Hybridization tubes. 2. Hybridization oven (rotisserie). 3. 20× saline-sodium citrate (SSC) buffer: In a 1 L beaker, combine 175.3 g NaCl and 77.4 g sodium citrate. Add 800 mL water and pH with 12 N HCl to 7.0. Bring to 1 L. 4. Prehybridization buffer: 5× saline-sodium citrate (SSC), 0.1% (w/v) N-lauroylsarcosine, 0.02% (w/v) sodium dodecyl sulfate (SDS), 1% (w/v) Roche Blocking Reagent (see Note 6). 5. Wash buffer 1: 2× SSC containing 0.1% SDS. 6. Wash buffer 2: 0.1 M Maleic acid, 0.15 M NaCl, pH 7.5, 0.3% Tween 20. 7. Blocking buffer: 1% (w/v) Roche Blocking Reagent, 0.1 M Maleic acid, 0.15 M NaCl, pH 7.5. 8. Anti-DIG antibody conjugated with alkaline phosphatase (Roche, Cat. #11093274910). 9. 1× Detection buffer: 0.1 M Tris-HCl, 0.1 M NaCl, pH 9.5. 10. Hybridization bags. 11. CDP-STAR: Disodium 2-chloro-5-(4-methoxyspiro (1,2-dioxetane-3,2′-(5′-chloro) tricyclo [3.3.1.13,7]decan)-4yl)-1-phenyl phosphate (Roche, Cat. #12041677001).

HCl/Aniline Assay for tRNAPheGAA Nuclear Import and Re-export

3

9

Methods

3.1 HCl/Aniline Assay

1. Prepare one 1.5 mL microcentrifuge tube for each sample. On ice, mix 10 μg of RNA with water to a volume of 30 μL. 2. Add 20 μL of working HCl solution to each tube, bringing the final volume to 50 μL. 3. To induce wybutosine base excision, incubate tubes at 37 °C for 3 h (see Note 7). 4. Neutralize the HCl-treated RNA solutions by adding 11.38 μL of 5 mM KOH and keep on ice (see Note 8). 5. Prepare minus (-) HCl controls for each sample by mixing 1955.04 ng RNA and water to a volume of 12 μL in a 2 mL microcentrifuge tube. Keep on ice (see Notes 9 and 10). 6. Preheat a heating block to 60 °C. 7. Prepare 0.5 M aniline, pH 4.5 (see Note 11). 8. Label a 2 mL microcentrifuge tube for each HCl-treated sample (see Note 10). To each tube, add 12 μL 0.5 M aniline, pH 4.5, and 12 μL neutralized, HCl-treated RNA. For -HCl samples, add 12 μL aniline directly to the RNA prepared in step 5. 9. Incubate samples at 60 °C for 20 min to induce chain scission at abasic sites. 10. Briefly centrifuge samples, then add the following in order: 451 μL water, 47.5 μL 3 M sodium acetate pH 5.2, 1410 μL ice cold 100% ethanol, and 1 μL of 15 mg/mL GlycoBlue coprecipitant (see Note 12). Flip the tubes several times to mix and store at -80 °C for at least 1 h or overnight to precipitate the RNA. 11. Centrifuge samples for 20 min at 4 °C at 15,000 rpm (microcentrifuge). 12. Preheat a water bath to 55 °C. 13. After centrifugation, a small blue pellet should be visible. Remove as much supernatant as possible. Wash pellet in 1 mL cold 70% ethanol. Centrifuge for 5 min at 4 °C at 15,000 rpm. 14. Remove 70% ethanol. Quick centrifuge the samples and remove all remaining ethanol with gentle suction using a 10 μL pipette tip, being careful not to aspirate the pellet (see Note 13). 15. Allow samples to sit at room temperature with the caps open to air dry for 10–15 min. 16. Add 20 μL water to each tube. Quick spin the samples to ensure the pellet is in the water. Incubate at 55 °C for 10 min. Quick spin again. 17. Add 20 μL of 2× northern loading dye to each tube of 20 μL of RNA. At this point, the samples can be stored at -80 °C.

10

3.2

Regina T. Nostramo and Anita K. Hopper

Northern Blot

1. Prepare a 10% polyacrylamide gel by combining 35 mL 10% polyacrylamide solution, 300 μL 10% ammonium persulfate, and 22.5 μL TEMED in a 50 mL conical centrifuge tube. Flip upside down a few times to mix and cast gel within a 16 cm × 18 cm × 1.5 mm gel cassette with 15-well or 24-well comb. Allow approximately 45 min for the gel to solidify. 2. Add 1× TBE to the gel apparatus and clean out the wells to remove any unpolymerized polyacrylamide using a needle and syringe. 3. Heat the samples at 85 °C for 5 min. Load 20 μL per lane. Electrophorese at 4 °C at 50 V for approximately 18 h, until the dye front is about 1 inch from the bottom of the gel. 4. Following electrophoresis, gently pry the gel plates open, allowing the gel to remain on the bottom plate. Cut off the wells of the gel and just below the dye front. Gently rinse the gel with water to remove any gel fragments that could interfere with the transfer step. 5. Cut a piece of Hybond N+ nylon membrane to the size of the gel. Cut a small piece off the top left corner of the membrane. Assemble the transfer cassette in a plastic container containing 1× TAE buffer. In order, add one foam pad, three sheets of filter paper, the membrane (with the cut corner oriented at the top left), the gel (with lane 1 on the left), three more sheets of filter paper, and another foam pad. Seal the cassette and insert into a transfer apparatus containing 1× TAE buffer. Transfer at 15 V for 15 min, then 0.6 A for 2 h at 4 °C. 6. After the transfer, disassemble the cassette and dry the membrane on a piece of filter paper for a few minutes. Orient the membrane with the RNA side facing up (the cut corner should be at the top left). Then UV cross-link the front of the membrane at an energy dosage of 120 millijoules/cm2. Flip the membrane over and UV cross-link the back of the membrane. At this point, the membrane can be stored dry in plastic wrap at -20 °C. 7. Place the membrane in a hybridization tube with 10 mL prehybridization buffer, with the RNA side facing the center of the hybridization tube. Assure that the membrane is not overlapping itself. Place the tube in a rotisserie hybridization oven and incubate at 37 °C for 30 min with rotation. (see Notes 14 and 15). 8. Replace the pre-hybridization buffer with hybridization buffer, which is 10 mL prehybridization buffer containing 1 μL tRNAPheGAA DIG-labeled oligo. Any of the tRNAPheGAA oligos

HCl/Aniline Assay for tRNAPheGAA Nuclear Import and Re-export

11

listed in Subheading 2.4 can be used in this step. Each of these tRNAPheGAA oligos hybridizes to different parts of tRNAPheGAA (5′ exon, 3′ exon or 5′/3′ exon junction) yielding slightly different detection patterns. See Supplemental Fig. 1C in Nostramo and Hopper (2020) for a comparison of the detection patterns that are observed using each of these probes. Since the 5′/3′ exon junction probe will detect both halves of the cleaved tRNAPheGAA, quantitation is easier when using either the 5′ or 3′ exon only probes. Incubate the membrane at 37 °C overnight with rotation. 9. Remove hybridization buffer (see Note 16). Wash the membrane four times with 15 mL Wash Buffer 1 for 10 min each. Perform the first three washes at 37 °C with rotation. During the fourth wash, turn the temperature of the hybridization oven down to room temperature. The remaining steps should all be performed at room temperature. 10. Discard Wash Buffer 1 and equilibrate the membrane in 10 mL Wash Buffer 2 for 3 min with rotation. 11. Discard Wash Buffer 2 and incubate the membrane in 10 mL Blocking Buffer for 30 min with rotation. 12. Discard the Blocking Buffer, and add 10 mL fresh Blocking Buffer containing 1:10,000 dilution of anti-DIG antibody conjugated to alkaline phosphatase. Incubate with rotation for 30 min. 13. Discard the antibody solution, and wash the membrane twice with 15 mL Wash Buffer 2 for 15 min each with rotation. 14. Discard Wash Buffer 2, and equilibrate the membrane in 10 mL Detection Buffer for 3 min with rotation. 15. Discard the Detection Buffer, and place the membrane on the bottom layer of a hybridization bag. Add 1 mL of CDP-STAR to the membrane and cover with the top layer of the bag. Seal using a heat sealer, avoiding air bubbles. Store the membrane in the dark for 5–10 min. 16. Image the membrane in a Chemiluminescence imager (see Note 17). 17. After imaging, place the membrane back into a hybridization tube and wash twice with 15 mL Wash Buffer 1 at 37 °C for 15 min each with rotation (see Note 18). 18. To measure 5S rRNA levels, repeat steps 8–16 using 1 nM DIG-labeled oligo for 5S rRNA (see Note 19).

12

4

Regina T. Nostramo and Anita K. Hopper

Notes 1. Aniline is very hygroscopic. After opening, the aniline should be tightly sealed, wrapped in Parafilm, and stored at 4 °C. When stored in this manner, the aniline is good for at least 6 months. 2. The pH of the solution will be 4.5 and does not need to be adjusted. 3. APS should be made fresh just before use, or it can be prepared and frozen at -20 °C in aliquots. Do not reuse after thawing. 4. After use, this buffer can be stored at 4 °C and used for two additional times. 5. Detection of 5S rRNA as a loading control should be performed using hybridization of the indicated probe to the membrane, rather than by standard ethidium bromide staining of the gel. Staining of the gel with ethidium bromide following HCl and aniline treatment leads to a smear in the gel, making the 5S rRNA band difficult to see. 6. For blocking, it is important to use the Roche Blocking Reagent supplied in the Roche DIG Block and Wash Buffer Set, which is supplied as a 10× solution. In our hands, the Roche Blocking Reagent that can be purchased in powdered form and reconstituted to form a 10× solution did not work well, yielding high background levels. 7. Incubation at 37 °C for 3 h is sufficient for near complete removal of the wybutosine base. 8. At this point, RNA can be stored at -80 °C for later treatment with aniline. 9. The -HCl controls are prepared in this way in order to conserve RNA, since in the next step only a portion of the HCl-treated RNA will be used. Alternatively, -HCl samples can be prepared exactly as above for +HCl samples. 10. In this step, a 2 mL microcentrifuge tube and not a 1.5 mL microcentrifuge tube is required. This is to ensure that the aniline can be adequately diluted and removed following RNA precipitation. 11. The working aniline solution should be prepared just prior to use. 12. GlycoBlue coprecipitant is needed to help precipitate the low quantities of RNA and to visualize the RNA pellet after precipitation in ethanol. 13. It is important to remove as much liquid as possible since any residual aniline will not easily dry.

HCl/Aniline Assay for tRNAPheGAA Nuclear Import and Re-export

13

14. During the prehybridization, hybridization, and detection steps, assure that the membrane is kept wet in order to avoid high nonspecific background signals. 15. If a rotisserie hybridization oven is not available, the membrane can be placed in a glass dish with the RNA side facing down and incubated on an orbital platform shaker at the appropriate temperature. 16. Hybridization buffer can be stored at -20 °C for up to 1 year and reused once. 17. Typically, an exposure time of 2–3 min is sufficient to detect a strong signal. 18. Alternatively, the membrane can be stored in the heat-sealed hybridization bag with the CDP-Star reagent at -20 °C for at least a year. For all steps after prehybridization, the membrane should be kept wet. Do not let the membrane dry or store dry. 19. For 5S rRNA, typically an exposure time of 30–60 s is sufficient to detect a strong signal.

Acknowledgments This work was supported by funding from the National Institutes of Health [grant number GM122884 to A.K.H.]. References 1. Chatterjee K, Nostramo RT, Wan Y, Hopper AK (2018) tRNA dynamics between the nucleus, cytoplasm and mitochondrial surface: location, location, location. Biochim Biophys Acta Gene Regul Mech 1861:373–386 2. Chatterjee K, Majumder S, Wan Y, Shah V, Wu J, Huang HY, Hopper AK (2017) Sharing the load: Mex67-Mtr2 cofunctions with Los1 in primary tRNA nuclear export. Genes Dev 31:2186–2198 3. Wan Y, Hopper AK (2018) From powerhouse to processing plant: conserved roles of mitochondrial outer membrane proteins in tRNA splicing. Genes Dev 32:1309–1314 4. Nostramo RT, Hopper AK (2020) A novel assay provides insight into tRNAPhe retrograde nuclear import and re-export in S. cerevisiae. Nucleic Acids Res 48:11577– 11588 5. Yoshihisa T, Ohshima C, Yunoki-Esaki K, Endo T (2007) Cytoplasmic splicing of tRNA in Saccharomyces cerevisiae. Genes Cells 12: 285–297

6. Yoshihisa T, Yunoki-Esaki K, Ohshima C, Tanaka N, Endo T (2003) Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria. Mol Biol Cell 14:3266–3279 7. Hellmuth K, Lau DM, Bischoff FR, Kunzler M, Hurt E, Simos G (1998) Yeast Los1p has properties of an exportin-like nucleocytoplasmic transport factor for tRNA. Mol Cell Biol 18:6374–6386 8. Wu J, Huang HY, Hopper AK (2013) A rapid and sensitive non-radioactive method applicable for genome-wide analysis of Saccharomyces cerevisiae genes involved in small RNA biology. Yeast 30:119–128 9. Wu J, Bao A, Chatterjee K, Wan Y, Hopper AK (2015) Genome-wide screen uncovers novel pathways for tRNA processing and nuclearcytoplasmic dynamics. Genes Dev 29:2633– 2644 10. Ohira T, Suzuki T (2011) Retrograde nuclear import of tRNA precursors is required for

14

Regina T. Nostramo and Anita K. Hopper

modified base biogenesis in yeast. Proc Natl Acad Sci U S A 108:10502–10507 11. Guy MP, Podyma BM, Preston MA, Shaheen HH, Krivos KL, Limbach PA, Hopper AK, Phizicky EM (2012) Yeast Trm7 interacts with distinct proteins for critical modifications of the tRNAPhe anticodon loop. RNA 18: 1921–1933 12. Droogmans L, Grosjean H (1987) Enzymatic conversion of guanosine 3′ adjacent to the anticodon of yeast tRNAPhe to N1-methylguanosine and the wye nucleoside: dependence on the anticodon sequence. EMBO J 6:477–483 13. Pintard L, Lecointe F, Bujnicki JM, Bonnerot C, Grosjean H, Lapeyre B (2002) Trm7p catalyses the formation of two 2’-Omethylriboses in yeast tRNA anticodon loop. EMBO J 21:1811–1820 14. Jiang HQ, Motorin Y, Jin YX, Grosjean H (1997) Pleiotropic effects of intron removal on base modification pattern of yeast tRNAPhe: an in vitro study. Nucleic Acids Res 25:2694–2701

15. Noma A, Kirino Y, Ikeuchi Y, Suzuki T (2006) Biosynthesis of wybutosine, a hyper-modified nucleoside in eukaryotic phenylalanine tRNA. EMBO J 25:2142–2154 16. Ladner JE, Schweizer MP (1974) Effects of dilute HCl on yeast tRNAPhe and E. coli tRNA1fMet. Nucleic Acids Res 1:183–192 17. Thiebe R, Zachau HG (1968) A specific modification next to the anticodon of phenylalanine transfer ribonucleic acid. Eur J Biochem 5: 546–555 18. Burrows CJ, Muller JG (1998) Oxidative nucleobase modifications leading to strand scission. Chem Rev 98:1109–1152 19. Shaheen HH, Hopper AK (2005) Retrograde movement of tRNAs from the cytoplasm to the nucleus in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 102:11290–11295 20. Takano A, Kajita T, Mochizuki M, Endo T, Yoshihisa T (2015) Cytosolic Hsp70 and co-chaperones constitute a novel system for tRNA import into the nucleus. eLife 4:e04659

Chapter 2 Analysis of Gene Expression Patterns and RNA Localization by Fluorescence in Situ Hybridization in Whole Mount Drosophila Testes Jaclyn M. Fingerhut and Yukiko M. Yamashita Abstract Researchers have used RNA in situ hybridization to detect the presence of RNA in cells and tissues for approximately 50 years. The recent development of a method capable of visualizing a single RNA molecule by utilizing tiled fluorescently labeled oligonucleotide probes that together produce a diffraction-limited spot has greatly increased the resolution of this technique, allowing for the precise determination of subcellular RNA localization and relative abundance. Here, we present our method for single molecule RNA fluorescence in situ hybridization (smFISH) in whole mount Drosophila testes and discuss how we have utilized this method to better understand the expression pattern of the highly unusual Y-linked genes. Key words RNA fluorescence in situ hybridization, RNA localization, Single molecule RNA fluorescence in situ hybridization, Gene expression, RNA quantification

1

Introduction Cells can be largely defined by their transcriptomes, but knowing what RNAs are expressed in a certain cell type is just the tip of the iceberg. For example, just because an RNA is present in a cell does not mean that it is being actively translated or otherwise utilized. The ability to visualize a single RNA species within a cell can reveal a multitude of information, including whether it is strongly or weakly expressed and whether it has a distinct subcellular localization, such as to a specific ribonucleoprotein (RNP) granule. Visualizing a single RNA species within a tissue can tell RNA’s story over developmental time from initiation of transcription to eventual translation and degradation. RNA fluorescence in situ hybridization (RNA FISH) allows us to explore these types of questions. Since it was first utilized, RNA in situ hybridization has become increasingly sensitive and specific. Initially, such experiments relied on radiolabeled cDNA probes [1, 2]; however, this method was

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

15

16

Jaclyn M. Fingerhut and Yukiko M. Yamashita

plagued by low spatial resolution and the difficulties associated with working with radioactive materials. Fluorescence-based methodologies were later applied, which relied on the conjugation of heptanes (e.g., biotin) or fluorophores to modified cDNA or RNA probes [3]. These methods also lacked sensitivity, and low abundance RNAs could easily be missed. Recently, methodologies were developed that have allowed researchers to visualize a single RNA molecule (referred to as single molecule RNA FISH or smFISH) and precisely localize that molecule within a cell [4–6]. smFISH methods generally rely on either signal amplification or direct detection. Signal amplification is largely an extension of previous fluorescence-based methods with improved specificity and sensitivity [7–9]. Compared to direct detection methods, signal amplification is a better choice for short transcripts and for utilizing polymorphisms to differentiate between alleles [8, 10]. In our work on RNA expression and localization in the Drosophila testis [11, 12], we have made use of the direct detection method, in which a pool of oligonucleotide probes, each conjugated with a dye or fluorophore, creates a diffraction limited spot when hybridized to the target RNA that is easily detectable above background (Fig. 1) [5, 6]. While off-target binding of probes is minimized though the use of probe design software, the off-target binding of one probe within the pool is not sufficient to produce detectable signal, reducing the number of false positives [5, 6]. Additionally, the number of probes used is high enough such that even if not all bind to every target, the signal will be sufficient for detection,

Fig. 1 Direct detection single molecule RNA fluorescence in situ hybridization (smFISH). The direct detection method for smFISH relies on the use of many fluorescently conjugated short oligonucleotides (black line with blue star) that all bind to the target RNA (gray curved line). In the cell, signal from these oligonucleotides will appear as diffraction limited spots

RNA FISH in Drosophila Testes

17

reducing false negatives [5, 6]. The drawbacks to the direct detection methods are that (1) the target RNA must be long enough to bind a sufficient number of fluorescent probes and (2) the signal produced can be weak, and sensitive imaging systems may be required. For visualizing multiple target RNAs simultaneously, the direct detection method is ideal as each pool of oligonucleotides can be conjugated with a different dye/fluorophore. RNAs are not always evenly distributed within the cytoplasm. smFISH allows researchers to determine whether an RNA of interest is polarized within a cell or whether it localizes to a specific subcellular compartment. These asymmetries are of great biological importance [13]. For example, asymmetric RNA localization in oocytes and embryos is critical for proper development of the organism [14]. Additionally, during cell division, asymmetric RNA localization can help specify daughter cell fate, such as in the division of Drosophila neuroblasts [15, 16]. Moreover, actin mRNAs localize to the leading edge to help facilitate cell migration [17, 18]. RNAs can be enriched in RNP granules for storage via translational repression or for processing, among other purposes. The sensitivity of smFISH is sufficient to detect whether a particular RNA is located within a specific sub-compartment of an RNP granule, which could have important implications for its eventual fate [12, 19–22]. These specific localizations can be confirmed by combining smFISH with immunofluorescence staining using antibodies to mark these cellular compartments [6, 12, 23]. The colocalization of an RNA with its RNA-binding protein(s) could also be shown in this manner. Some RNAs are robustly expressed while others may only have a few transcripts present per cell. Using smFISH, the number of transcripts per cell can be easily quantified, and the effect of various perturbations on gene expression levels can be assessed [24]. This data could nicely complement large-scale RNA sequencing methods. Within a tissue, the expression level of a single RNA in different cell types could also be assessed. We have applied the power of smFISH to the study of a set of highly unusual genes in whole mount Drosophila testes, which allowed us to gain tremendous insight into the expression of these genes over developmental time [11, 12]. The Drosophila testis is an excellent model for gene expression studies because, within a single tissue, every stage of germ cell development from germline stem cells to mature sperm can be seen simultaneously. Additionally, the testis is spatiotemporally organized with the earliest germ cells at one end and mature sperm at the other [25], making it easy to follow the expression of a single gene during germ cell differentiation (Fig. 2a). The genes we have focused on are the Y-linked fertility genes. They encode axonemal dynein motor proteins essential for sperm motility [26–28], and they are highly unusual as they are among the largest genes known, spanning over 4 Mb [29– 31]. This is due to the presence of satellite DNA (short tandem

18

Jaclyn M. Fingerhut and Yukiko M. Yamashita

Fig. 2 Single molecule RNA fluorescence in situ hybridization (smFISH) to follow gene expression over developmental time. (a) Top: Diagram of Drosophila spermatogenesis: Early germ cells (blue) reside at one end of the testis and undergo several founds of mitotic division before becoming spermatocytes (green). Spermatocytes develop over 80–90 h (depicted by darkening of the green color) before initiating the meiotic divisions. Middle: RNA FISH visualizing expression of the large Y-linked gene kl-3 in single spermatocyte nuclei (yellow dashed line) at different stages of spermatocyte development. Early exon (blue), intron (green), late exon (red), DAPI (white), nuclei of neighboring cells (white dashed line), and cytoplasmic mRNA granules (yellow arrows). Bar: 10 μm. Bottom: Diagram of the Y-linked gene kl-3. Exons (vertical rectangles), introns (black line), intronic satellite DNA repeats (dashed line), and regions of kl-3 targeted by RNA FISH probes (colored bars). (This figure is partially reproduced from Fingerhut et al., 2019 under a Creative Commons License (CC BY 4.0) [11]). (b) Diagram of a spermatocyte (nucleus, cytoplasm, and DNA in shades of gray) showing the organization of early exon (blue), intron (green), and late exon (red) transcripts in the nucleus and mRNA granules in the cytoplasm

repeats arrayed in vast tracks of 100’s of kilobases to several megabases) within the introns as the coding regions are only around 14 kb [32–35]. We designed pools of smFISH probes targeting different regions of these genes (one set targeting an early exon and another targeting a late exon) [11]. We also used a single fluorescently labeled oligonucleotide to target transcript from the satellite DNA in the introns (Fig. 2a). Using these probe sets, we could follow the expression of these genes over time and have elucidated

RNA FISH in Drosophila Testes

19

the “life story” of these transcripts [11]. This story begins in early spermatocytes (cells in meiosis I prophase) where we detect transcript from only the early exon probes. Spermatocyte development takes 80–90 h [36], and as spermatocytes mature, we start to detect the intron transcript and finally the late exon transcript. In late spermatocytes, we detect mRNA (both exon probe sets without signal from the intron probe) in RNP granules in the cytoplasm (Fig. 2). There are three large Y-linked axonemal dynein genes, and we detect mRNAs from all three in these granules and can also detect sub-compartmentalization of these mRNAs within the granules [12] (Fig. 3a, b). We identified a protein marker for these granules (Pontin, which is necessary for the assembly of these RNP granules [12]) by combining smFISH with antibody staining (Fig. 4).

Fig. 3 Single molecule RNA fluorescence in situ hybridization (smFISH) to analyze the subcellular localization of RNAs. (a) smFISH against transcripts from the Y-linked genes kl-3, kl-5, and kl-2 in spermatocytes. Each transcript has distinct nuclear localization and all three colocalize in ribonucleoprotein (RNP) granules in the cytoplasm. kl-3 (blue), kl-2 (green), kl-5 (red), DAPI (white), RNP granules (yellow arrows), spermatocyte nuclei (yellow dashed line), and nuclei of neighboring cells (white dashed line). Bar: 10 μm. (b) An enlarged RNP granule. smFISH allows for analysis of sub-compartmentalized mRNA localization within RNP granules. kl-3 (blue), kl-2 (green) and kl-5 (red). Bar: 1 μm. (c) smFISH shows the polarized localization of RNP granules within an elongating spermatid cyst. kl-3 (blue), kl-2 (green), kl-5 (red), DAPI (white) and spermatid cyst (cyan dashed line). Bar: 25 μm. (This figure is reproduced from Fingerhut and Yamashita, 2020 under a Creative Commons License (CC BY-NC-SA 4.0) [12])

20

Jaclyn M. Fingerhut and Yukiko M. Yamashita

Fig. 4 Analysis of RNA/protein colocalization by single molecule RNA fluorescence in situ hybridization (smFISH) combined with immunofluorescent staining. (a, b) Immunofluorescent staining for Pontin protein and smFISH for kl-3 and kl-5 mRNAs in a spermatocyte (a) and within an ribonucleoprotein (RNP) granule (b). Pontin (green), kl-3 (blue), kl-5 (red), DAPI (white), spermatocyte nuclei (yellow dashed line), nuclei of neighboring cells (white dashed line), and RNP granules (yellow arrows). Bar: 10 μm (a) or 1 μm (b)

As germ cells enter into the meiotic divisions, we observe these RNP granules seemingly segregating such that each haploid spermatid receives a RNP granule. Drosophila sperm are among the longest in the animal kingdom, reaching 1.9 mm in length [37, 38]. smFISH allowed us to see that these RNP granules become highly polarized as spermatids elongate, staying near the very distal end of the cell (Fig. 3c), which we showed is important for the axonemal dynein motor proteins to properly incorporate into the axoneme [12]. The story of these mRNAs ends with the dissociation of these RNP granules, which correlates with the accumulation of axonemal dynein protein and the presumed degradation of the mRNAs. Here, we present our method for RNA FISH in whole mount Drosophila testes and also extend this method to the simultaneous detection of RNA and protein.

2

Materials Prepare all solutions using RNase free reagents. This includes all starting solutions as well as pipette tips and collection tubes. As much as possible, keep all materials (e.g., tube racks, collection tubes, and pipette tips) used for RNA FISH separate from materials used in other procedures, and only access these materials during the RNA FISH procedure to prevent accidental contamination with RNases.

RNA FISH in Drosophila Testes

21

1. Fixative: 4% formaldehyde in 1× phosphate-buffered saline (PBS). It is made from 16%, methanol-free, ultrapure EM grade formaldehyde and 10× PBS (1.37 M NaCl, 0.027 M KCl, 0.08 M Na2HPO4, 0.02 M KH2PO4, pH 7.4) diluted in ultrapure distilled water. Store 1 mL aliquots at -20 °C. 2. 1× PBS: 10× PBS diluted in ultrapure distilled water. Store at room temperature. 3. Seventy percent ethanol: We dilute 200 proof ethanol in ultrapure distilled water. Store at room temperature. 4. Oligonucleotide probes: We use fluorescently conjugated short oligonucleotide probes to visualize RNAs (see Subheading 3.2 for information on probe design). We are primarily interested in two types of RNAs: (1) RNAs derived from protein coding genes and (2) RNAs derived from highly repetitive regions of the genome, such as satellite DNAs. In order to visualize RNAs from protein coding genes, we utilize direct detection smFISH technologies, such as the Stellaris RNA FISH method by Biosearch Technologies, Inc. By this method, we obtain pools of fluorescently conjugated oligonucleotides for each transcript of interest. These probes sets are kept at stock concentrations of 100 μM in 1 M Tris–HCl pH 7.4, diluted to working concentrations of 10 μM in ultrapure distilled water, and used at a final concentration of 100 nM in hybridization buffer. To visualize satellite DNA transcripts, we use a single fluorescently conjugated oligonucleotide at stock concentrations of 10 μM in 1 M Tris–HCl pH 7.4, diluted to working concentrations of 5 μM in ultrapure distilled water, and used at a final concentration of 50 nM in hybridization buffer. 5. Hybridization buffer: 2× saline-sodium citrate (SSC, 20 stock solution contains 3 M NaCl, 0.3 M Na3C6H5O7), 10% dextran sulfate, 1 mg/mL Escherichia coli tRNA, 2 mM ribonucleoside vanadyl complex, 0.5% UltraPure bovine serum albumin (BSA), and 10% formamide in ultrapure distilled water. Store at -20 °C. (see Note 1). 6. Wash buffer: 2× SSC and 10% formamide in ultrapure distilled water. Store at room temperature or 4 °C. 7. Blocking buffer: 1× PBS, 0.05% UltraPure BSA, 50 μg/mL E. coli tRNA, 10 mM ribonucleoside vanadyl complex, 0.2% Tween-20 in ultrapure distilled water. Make fresh (see Note 2). 8. 1× PBST: 1× PBS with 0.2% Tween-20 in ultrapure distilled water. Store at room temperature. 9. Desired primary antibodies and appropriate AlexaFluorconjugated secondary antibodies (see Note 3). 10. VECTASHIELD (DAPI).

with

4′,6-diamidino-2-phenylindole

22

Jaclyn M. Fingerhut and Yukiko M. Yamashita

11. Stereomicroscope equipped for fly sorting and dissection. 12. Dissection dishes and forceps. 13. 1.5 mL tubes and 50 mL conical tubes. 14. Nutating 3D platform mixer. 15. Water bath. 16. Microscope slides and cover slips. 17. Widefield fluorescent or confocal microscope with the appropriate filters/lasers to match the dyes used, a sensitive camera (e.g., a cooled CCD), a high numerical aperture (NA) objective, and appropriate image capture and analysis software.

3 3.1

Methods Fly Husbandry

3.2 RNA FISH Probe Design

Flies are raised on standard Bloomington medium at 25 °C and assayed at the desired age. For standard RNA FISH in the Drosophila testis, we typically dissect 1- to 5 day-old adults. However, we have applied this method to a variety of larval and adult tissues [39, 40], and fly age should be determined by experimental question. As mentioned above, we primarily use RNA FISH to visualize transcripts from either single copy genes or highly repetitive regions of the genome. For single-copy genes, we have utilized the Stellaris system by Biosearch Technologies, Inc., which makes use of a pool of up to 48 short (18–22 bp) fluorescently tagged oligonucleotides that bind along the transcript of interest to produce a diffraction limited spot easily seen by conventional microscopy methods. Biosearch Technologies, Inc.’s Stellaris® RNA FISH Probe Designer, which is available online at www.biosearchtech.com/ stellarisdesigner, lets the user specify the target sequence, allowing you to design probes against specific exons (to address questions surrounding transcriptional timing or to target specific splice isoforms) and/or introns, or avoid designing a probe in a certain region (such as an exon–exon junction). The designer software screens for common sequences (across all organisms and within your organism of choice) and avoids designing in those regions. It also contains a masking level feature that allows the user to control the stringency to help avoid off-target background noise (see Notes 4 and 5). The designer also lets you control the probe length (18–22 bp) and the spacing between probes. An ideal probe set will contain the maximum number of probes (48, see Note 6). Biosearch Technologies, Inc. also offers a wide variety of dyes and modifications to allow for multiplexing or additional downstream applications (see Note 7). When designing your probes, also

RNA FISH in Drosophila Testes

23

consider what controls are necessary for your experiments—they provide predesigned ship-ready sets for common positive controls, such as housekeeping genes or RNA pol II, and you can design/ order a set against a target not present in your sample as a negative control if an efficient RNAi line or mutant strain is not available. To visualize transcripts originating from repetitive regions of the genome, we utilize a single ~30 bp oligonucleotide. The repetitive nature of the target sequence allows for sufficient signal amplification. Many of the repeats of interest to us are 5 bp satellite DNA repeats. For these repeats, our oligo is a 6 mer of the repeat conjugated with a dye or fluorophore, such as Alexa-488, Cy3, or Cy5 (see Note 8). These oligonucleotides can also be easily multiplexed. We order these probes HPLC purified. 3.3

RNA FISH

All solutions listed are RNase free (see Subheading 2). Before starting, clean your workspace and all materials, such as pipettes, tube racks, and nutators, with either 70% ethanol or a commercial reagent (such as RNase Zap) to remove RNase contamination. 1. Dissect testes (or other tissue of interest) in 1× PBS, and collect them in a 1.5 mL tube containing 1 mL of 1× PBS. Dissections should be completed within 30 min. 2. Aspirate off the 1× PBS and add 1 mL of fixative. Place the tube on a nutator, and incubate for 30 min at room temperature. 3. Remove the fixative and wash the testes twice, 5 min per wash, with 1 mL of 1× PBS on a nutator. 4. Remove the 1× PBS and add 1 mL of 70% ethanol. Place the tubes in an RNase free container and incubate overnight at 4 ° C on a nutator (see Notes 9 and 10). 5. Add the appropriate volume of probe solution to hybridization buffer to achieve the desired final probe concentration and pipette to mix (see Subheading 2, step 4 for final probe concentration recommendations based on probe type and Note 11). Prepare 100 uL of this mixture per sample. 6. Aspirate the ethanol and add 1 mL of wash buffer. Let this nutate for 3 min and sit for 2 min at room temperature. 7. Aspirate the wash buffer and add 100 μL of hybridization solution containing the probe(s) (see Notes 11 and 12). 8. Seal the tube with parafilm and incubate overnight in a 37 °C water bath. Ensure the sample is protected from light. 9. Add 1 mL of wash buffer without first removing the hybridization solution. Incubate at 37 °C for 30 min. Continue to protect from light (see Note 13). 10. Aspirate off the wash buffer + hybridization solution and wash one more time with 1 mL of wash buffer at 37 °C for 30 min in the dark (see Note 14).

24

Jaclyn M. Fingerhut and Yukiko M. Yamashita

11. Remove the wash buffer and add VECTASHIELD mounting media with DAPI. Samples can be stored at 4 °C or imaged immediately (see Notes 15 and 16). 3.4 Combining RNA FISH with Protein Localization

Protein markers are often needed to better characterize the location of an RNA within a cell (e.g., to discern whether the RNA colocalizes with a specific type of RNP granule) or to assess translational timing (e.g., RNA synthesis and translation could occur at different developmental times, indicating the presence of additional layers of gene expression regulation), among other applications. If the fly strain dissected contains a fluorescently tagged transgene, we typically skip the overnight ethanol permeabilization step (Subheading 3.3, step 4 above) and proceed directly to the hybridization as ethanol can denature fluorophores (see Note 10). If instead you wish to use antibody staining to visualize your protein(s) of interest alongside your RNA(s) of interest, an immunofluorescent staining procedure can be included between steps 4 and 5 in the above protocol. 1. Remove the ethanol and rinse with 100 μL of 1× PBS three times. 2. Wash with 1 mL of 1× PBST three times for 5 min each on a nutator. 3. Aspirate off the 1× PBST and add 100 μL of blocking buffer. Incubate at 37 °C for 30 min (see Note 17). 4. Remove the blocking buffer and add 100 μL of primary antibody diluted in blocking buffer. Incubate at 37 °C for 1 h (see Note 18). 5. Remove the primary antibody and wash three times with 1 mL of 1× PBST for 5 min each on a nutator. 6. Aspirate the 1× PBST and incubate in 100 μL of blocking buffer for 5 min at 37 °C. 7. Remove the blocking buffer and incubate in 100 μL of secondary antibody diluted in blocking buffer for 30 min at 37 °C (see Note 18). 8. Wash three times with 1 mL of 1× PBST for 5 min each on a nutator. 9. Remove the wash buffer and refix the tissue by adding 500 μL of fixative and incubating for 10 min at room temperature while rocking. 10. Aspirate the fixative and wash twice with 1 mL 1× PBS for 5 min each on a nutator. 11. Continue with the RNA FISH procedure starting from Subheading 3.3, step 5 above.

RNA FISH in Drosophila Testes

4

25

Notes 1. The dextran sulfate takes time to dissolve. Mixing by pipetting or vortexing is messy and results in bubbles and loss of buffer. We have found that it is best to leave the solution on a nutator at room temperature until completely dissolved or at 4 °C overnight. 2. Blocking buffer could be stored at -20 °C; however, we have found that making this fresh before each experiment greatly improves the staining quality of both the immunofluorescence and the subsequent RNA FISH when some antibodies, potentially dirtier ones, are used. 3. Not all antibodies work well in combination with RNA FISH. This may be partially dependent on how the antibody is prepared (how pure the serum is and whether it contains abundant RNases). If possible, use purified antibodies, but if this is not possible, such as for custom-made antibodies, using fresh blocking buffer, which contains a high concentration of ribonucleoside vanadyl complex to inhibit ribonucleases, and minimizing antibody incubation times have typically yielded sufficient quality results. 4. A masking level of 5 is the most stringent. We always start here and only lower the masking level if the designer is unable to generate a sufficient number of probes. 5. If your gene of interest has a paralog, it is recommended that you align the generated probes against the paralogous sequence to ensure specificity. 6. Biosearch Technologies, Inc., recommends at least 25 probes for each set, although in our experience the necessary minimum number of oligos depends on transcript abundance. We have had success with sets containing as few as eight oligos for highly expressed transcripts. If the default parameters do not yield the recommended maximum of 48 oligos, it is best to try different oligo lengths and spacing to increase the probe number first, then try lowering the masking level while being mindful that this could increase off target binding (and therefore background noise). The more probes you can get, the better the sensitivity and specificity. 7. We have had very good results with the Quasar dyes, which are similar to Cy3 and Cy5. In our experience, the Fluorescein dye works in cases where the RNAs are enriched within a specific location within the cell, such as within an RNP granule, but the autofluorescence of the testis limits the detection of diffuse single transcripts for probes sets conjugated with this dye. We frequently multiplex Fluorescein with Quasar 570 and Quasar 670.

26

Jaclyn M. Fingerhut and Yukiko M. Yamashita

8. These oligos work very well for both DNA and RNA FISH applications. 9. The ethanol serves to weakly permeabilize the tissue, which is all the permeabilization needed for the short oligo probes to enter the tissue. 10. Ethanol can denature fluorophores. If your tissue contains a fluorescently tagged transgene, this step can be omitted—we have not had any issue with the probes being unable to diffuse into the tissue. We have noticed that the expression pattern of the RNA within a nucleus can look slightly different when this step is omitted, but only for repetitive transcripts. It is possible that these highly repetitive RNAs adopt complex secondary structures that in turn interact with the ethanol during permeabilization. Be sure to know what your RNA expression pattern looks like under standard RNA FISH conditions before omitting this step. We have not noticed any differences in expression pattern for our smFISH probes with and without ethanol permeabilization. 11. When pipetting the hybridization solution, cut the end off of your pipette tip as the hybridization buffer is viscous. When adding the hybridization solution and probe mixture to your tissue, pipette to mix, again with a cut pipette tip, which also prevents damage to the tissue. You should be able to see the tissue suspended in the hybridization solution. Failure to mix the tissue with the hybridization solution could result in poor or no hybridization. 12. Testes often stick to the sides and inside the cap of the 1.5 mL tubes. Use some of the wash buffer and a pipette to wash them down to the bottom of the tube. If sticking becomes a large issue, 0.1% Tween-20 can be added to the wash buffer. 13. The hybridization solution is too viscous to remove without also removing the testes. Diluting it with wash buffer for 30 min both washes the sample and allows the hybridization solution to be removed. 14. Additional washes can be added if there is high background present during imaging. 15. We have kept samples for several months at 4 °C with no decrease in signal quality. 16. We typically image using a Leica STELLARIS 8 or SP8 confocal microscope with a 63× oil immersion objective lens (NA = 1.4), but it is important to note that this is not the recommended method for imaging smFISH samples. As confocal microscopy relies on point illumination, which limits the focal plane and restricts out of focus light, it can reduce the sensitivity of low-light imaging, which can include smFISH

RNA FISH in Drosophila Testes

27

depending on expression level of the target gene. A traditional widefield fluorescence microscope could yield brighter signal at the sacrifice of some resolution. 17. We seal the tubes with parafilm prior to all incubations in a water bath to prevent any accidental contamination. 18. Antibody incubation times will need to be optimized for each antibody. We have used anywhere from 30 min at 37 °C to overnight at 4 °C. Keep in mind see Note 3 when deciding what incubation times to try. References 1. Gall JG, Pardue ML (1969) Formation and detection of RNA-DNA hybrid molecules in cytological preparations. Proc Natl Acad Sci U S A 63(2):378–383. https://doi.org/10. 1073/pnas.63.2.378 2. Harrison PR, Conkie D, Paul J, Jones K (1973) Localisation of cellular globin messenger RNA by in situ hybridisation to complementary DNA. FEBS Lett 32(1):109–112. https:// doi.org/10.1016/0014-5793(73)80749-5 3. Singer RH, Ward DC (1982) Actin gene expression visualized in chicken muscle tissue culture by using in situ hybridization with a biotinated nucleotide analog. Proc Natl Acad Sci U S A 79(23):7331–7335. https://doi. org/10.1073/pnas.79.23.7331 4. Femino AM, Fay FS, Fogarty K, Singer RH (1998) Visualization of single RNA transcripts in situ. Science 280(5363):585–590. https:// doi.org/10.1126/science.280.5363.585 5. Raj A, Tyagi S (2010) Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol 472:365–386. https://doi.org/10.1016/ S0076-6879(10)72004-8 6. Raj A, van den Bogaard P, Rifkin SA, van Oudenaarden A, Tyagi S (2008) Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods 5(10):877–879. https://doi.org/10.1038/nmeth.1253 7. Kerstens HM, Poddighe PJ, Hanselaar AG (1995) A novel in situ hybridization signal amplification method based on the deposition of biotinylated tyramine. J Histochem Cytochem 43(4):347–352. https://doi.org/10. 1177/43.4.7897179 8. Larsson C, Grundberg I, Soderberg O, Nilsson M (2010) In situ detection and genotyping of individual mRNA molecules. Nat Methods 7(5):395–397. https://doi.org/10.1038/ nmeth.1448 9. Pare A, Lemons D, Kosman D, Beaver W, Freund Y, McGinnis W (2009) Visualization of individual Scr mRNAs during Drosophila

embryogenesis yields evidence for transcriptional bursting. Curr Biol 19(23):2037–2042. https://doi.org/10.1016/j.cub.2009.10.028 10. Lu J, Tsourkas A (2009) Imaging individual microRNAs in single mammalian cells in situ. Nucleic Acids Res 37(14):e100. https://doi. org/10.1093/nar/gkp482 11. Fingerhut JM, Moran JV, Yamashita YM (2019) Satellite DNA-containing gigantic introns in a unique gene expression program during Drosophila spermatogenesis. PLoS Genet 15(5):e1008028. https://doi.org/10. 1371/journal.pgen.1008028 12. Fingerhut JM, Yamashita YM (2020) mRNA localization mediates maturation of cytoplasmic cilia in Drosophila spermatogenesis. J Cell Biol 219(9). https://doi.org/10.1083/jcb. 202003084 13. Medioni C, Mowry K, Besse F (2012) Principles and roles of mRNA localization in animal development. Development 139(18): 3263–3276. https://doi.org/10.1242/dev. 078626 14. Kumano G (2012) Polarizing animal cells via mRNA localization in oogenesis and early development. Develop Growth Differ 54(1): 1 – 1 8 . h t t p s : // d o i . o r g / 1 0 . 1 1 1 1 / j . 1440-169X.2011.01301.x 15. Broadus J, Fuerstenberg S, Doe CQ (1998) Staufen-dependent localization of prospero mRNA contributes to neuroblast daughtercell fate. Nature 391(6669):792–795. https://doi.org/10.1038/35861 16. Li P, Yang X, Wasser M, Cai Y, Chia W (1997) Inscuteable and Staufen mediate asymmetric localization and segregation of prospero RNA during Drosophila neuroblast cell divisions. Cell 90(3):437–447. https://doi.org/10. 1016/s0092-8674(00)80504-8 17. Lawrence JB, Singer RH (1986) Intracellular localization of messenger RNAs for cytoskeletal proteins. Cell 45(3):407–415. https://doi. org/10.1016/0092-8674(86)90326-0

28

Jaclyn M. Fingerhut and Yukiko M. Yamashita

18. Mingle LA, Okuhama NN, Shi J, Singer RH, Condeelis J, Liu G (2005) Localization of all seven messenger RNAs for the actinpolymerization nucleator Arp2/3 complex in the protrusions of fibroblasts. J Cell Sci 118 (Pt 11):2425–2433. https://doi.org/10. 1242/jcs.02371 19. Lee C, Occhipinti P, Gladfelter AS (2015) PolyQ-dependent RNA-protein assemblies control symmetry breaking. J Cell Biol 208(5):533–544. https://doi.org/10.1083/ jcb.201407105 20. Trcek T, Grosch M, York A, Shroff H, Lionnet T, Lehmann R (2015) Drosophila germ granules are structured and contain homotypic mRNA clusters. Nat Commun 6: 7 9 6 2 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / ncomms8962 21. Niepielko MG, Eagle WVI, Gavis ER (2018) Stochastic seeding coupled with mRNA selfrecruitment generates heterogeneous Drosophila germ granules. Curr Biol 28(12): 1872–1881. e1873. https://doi.org/10. 1016/j.cub.2018.04.037 22. Moon SL, Morisaki T, Khong A, Lyon K, Parker R, Stasevich TJ (2019) Multicolour single-molecule tracking of mRNA interactions with RNP granules. Nat Cell Biol 21(2): 162–168. https://doi.org/10.1038/s41556018-0263-4 23. Khong A, Matheny T, Jain S, Mitchell SF, Wheeler JR, Parker R (2017) The stress granule transcriptome reveals principles of mRNA accumulation in stress granules. Mol Cell 68(4):808–820 e805. https://doi.org/10. 1016/j.molcel.2017.10.015 24. Kwon S (2013) Single-molecule fluorescence in situ hybridization: quantitative imaging of single RNA molecules. BMB Rep 46(2): 65–72. https://doi.org/10.5483/bmbrep. 2013.46.2.016 25. Fuller MT (1993) Spermatogenesis. In: Bate M, Arias AM (eds) The development of Drosophila melanogaster, vol 1. Cold Spring Harbor Laboratory Press, New York, pp 71–148 26. Hardy RW, Tokuyasu KT, Lindsley DL (1981) Analysis of spermatogenesis in Drosophila melanogaster bearing deletions for Y-chromosome fertility genes. Chromosoma 83(5):593–617 27. Goldstein LS, Hardy RW, Lindsley DL (1982) Structural genes on the Y chromosome of Drosophila melanogaster. Proc Natl Acad Sci U S A 79(23):7405–7409 28. Carvalho AB, Lazzaro BP, Clark AG (2000) Y chromosomal fertility factors kl-2 and kl-3 of Drosophila melanogaster encode dynein heavy chain polypeptides. Proc Natl Acad Sci U S A

97(24):13239–13244. https://doi.org/10. 1073/pnas.230438397 29. Bonaccorsi S, Pisano C, Puoti F, Gatti M (1988) Y chromosome loops in Drosophila melanogaster. Genetics 120(4):1015–1034 30. Gatti MP, S. (1983) Cytological and genetic analysis of the Y chromosome of Drosophila melanogaster. Chromosoma 88:349–373. https://doi.org/10.1007/BF00285858 31. Pimpinelli S, Bonaceeorsi J, Gatti M, Sandler L (1986) The peculiar genetic organization of Drosophila heterochromatin. Trends Genet 2: 17–20 32. Lohe AR, Hilliker AJ, Roberts PA (1993) Mapping simple repeated DNA sequences in heterochromatin of Drosophila melanogaster. Genetics 134(4):1149–1174 33. Hoskins RA, Smith CD, Carlson JW, Carvalho AB, Halpern A, Kaminker JS, Kennedy C, Mungall CJ, Sullivan BA, Sutton GG, Yasuhara JC, Wakimoto BT, Myers EW, Celniker SE, Rubin GM, Karpen GH (2002) Heterochromatic sequences in a Drosophila wholegenome shotgun assembly. Genome Biol 3(12):RESEARCH0085 34. Carvalho AB (2002) Origin and evolution of the Drosophila Y chromosome. Curr Opin Genet Dev 12(6):664–668 35. Peacock WJ, Lohe AR, Gerlach WL, Dunsmuir P, Dennis ES, Appels R (1978) Fine structure and evolution of DNA in heterochromatin. Cold Spring Harb Symp Quant Biol 42(Pt 2):1121–1135 36. Chandley AC, Bateman AJ (1962) Timing of spermatogenesis in Drosophila melanogaster using tritiated thymidine. Nature 193:299– 300 37. Tates AD (1971) Cytodifferentiation during spermatogenesis in Drosophila melanogaster: an electon microsope study. Rijksuniversiteit, Leiden 38. Tokuyasu KT (1975) Dynamics of spermiogenesis in Drosophila melanogaster. VI. Significance of "onion" nebenkern formation. J Ultrastruct Res 53(1):93–112. https:// doi.org/10.1016/s0022-5320(75)80089-x 39. Warsinger-Pepe N, Li D, Yamashita YM (2020) Regulation of nucleolar dominance in Drosophila melanogaster. Genetics 214(4): 991–1004. https://doi.org/10.1534/genet ics.119.302471 40. Lu KL, Nelson JO, Watase GJ, WarsingerPepe N, Yamashita YM (2018) Transgenerational dynamics of rDNA copy number in Drosophila male germline stem cells. elife 7. https://doi.org/10.7554/eLife.32421

Chapter 3 Electrophoretic Mobility Shift Assay (EMSA) and Microscale Thermophoresis (MST) Methods to Measure Interactions Between tRNAs and Their Modifying Enzymes Andrzej Chramiec-Gła˛bik, Michał Rawski, Sebastian Glatt, and Ting-Yu Lin Abstract The Elongator complex is a unique tRNA acetyltransferase; it was initially annotated as a protein acetyltransferase, but in-depth biochemical analyses revealed its genuine function as a tRNA modifier. The substrate recognition and binding of the Elongator is mainly mediated by its catalytic Elp3 subunit. In this chapter, we describe protocols to generate fluorescently labeled RNAs and outline the principles underlying electrophoretic mobility shift assays (EMSA) and microscale thermophoresis (MST). These two methods allow qualitative and quantitative examinations of the binding affinity of various tRNAs toward the homologs of Elp3 from various organisms. The rather qualitative results from EMSA analyses can be nicely complemented by MST measurements allowing precise determination of the dissociation constant (KD). We also provide detailed notes for users to mitigate potential ambiguities and technical pitfalls during the procedures. Key words Biophysical measurements, In vitro transcription, Fluorescent, Nonradioactive isotope labeling, tRNA, Elongator, EMSA, MST

1

Introduction Currently, more than 170 modifications of RNA nucleotides have been discovered, and they greatly expand the capacity of nucleic acids by a variety of chemically added functional moieties [1]. Modifications occur on various RNAs, such as tRNAs, rRNAs, or mRNAs. They affect RNA stability, secondary structures, base pairing, and contribute to the biological functions of individual RNAs [2]. For instance, the modifications on the 34th or 37th position in the tRNA anticodon stem loop are crucial for fine-tuning translation [3]. In detail, these modifications provide additional bonds between the tRNA and its cognate or near-cognate codon in the ribosome during the decoding process.

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

29

30

Andrzej Chramiec-Gła˛bik et al.

Although the Elongator complex was originally annotated as a protein acetyltransferase [4], it is now recognized as the enzyme responsible for the 5-carboxy-methyl-uridine (cm5U34) modification of “wobble uridines” [5, 6]. The evolutionarily conserved Elongator complex exists in all eukaryotes, harboring two copies of each of its six subunits (Elp1–6). Elp3, the catalytic center, accommodates the tRNA substrates and catalyzes the reaction with the support of other requisite subunits [7, 8]. Interestingly, Elp3 homologs are also present in some bacteria, viruses, and archaea, while the other Elongator subunits are absent from their genomes [6]. Purification of the eukaryotic Elongator is difficult, and it is hard to obtain sufficient amounts of purified complex for biochemical analyses. On the other hand, archaeal and bacterial Elp3 proteins show much better solubility and can be efficiently produced in heterologous organisms, which facilitates biochemical studies of the underlying tRNA modification reaction [6, 9, 10]. To understand RNA substrate selectivity and specificity of the protein, several standard methods for interaction studies can be performed, such as filter binding analysis [11], fluorescent polarization [12], Biacore/surface plasmon resonance [13], isothermal titration calorimetry (ITC) [14, 15], electrophoretic mobility shift assay (EMSA) [7, 16], and ultraviolet (UV) cross-linking and immunoprecipitation (CLIP) [17]. ITC is a biophysical method that measures the exchange of heat (e.g., heat generation or absorption), when a molecule comes in contact with its binding partner [14]. However, ITC requires large quantities (i.e., several milligrams of purified protein and the RNA of interest) and is thus a considerable material-consuming method. On the other hand, EMSA requires relatively small reaction volume compared to ITC. In EMSA, the reaction usually is prepared in less than 20 μL reaction volumes and requires less sample [16]. The principle of EMSA is based on the separation of the samples via a polymerized gel under native non-denaturing conditions. The free nucleic acid and the nucleic acid-protein complex show different mobilities as the former runs faster and the latter migrates slower. The mobility retardation of the nucleic acid-protein complex is contributed by many factors, such as an increase in mass or a decrease in charge density. EMSA can determine affinities and binding stoichiometries that involve multiple binding sites or cooperative binding events. Furthermore, to enhance the detection sensitivity and quantitative analysis, the nucleic acid molecule is predominantly radioisotope labeled with 32P using T4 polynucleotide kinase. Recently, the use of multifluorescence-labeled DNA in EMSA has been widely applied [9, 18]. Additionally, the high sensitivity of fluorescence labeling can be easily measured using an imaging system without safety requirements related to radioactive substances. CLIP is a relatively recent technique that combines the in vivo UV cross-linking and immunoprecipitation and followed by

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

31

high-throughput sequencing. Recently, several approaches have been implemented to improve the resolution and provide kinetic parameters for RNA-protein interaction, such as enhanced CLIP [19] and kinetic KIN-CLIP [20], respectively. The methods enable the transcriptome-wide analysis of RNA-protein interactions with high positional resolution and specificity. While ITC and EMSA can reveal in vitro interactions, CLIP globally maps the in vivo proteinRNA interaction sites [21]. For instance, a recent study employed CLIP to identify the RNA binding sites of YTHDC1, a N6-methyladenosine (m6A) binder, and used ITC to reveal the sequence selectivity of YTHDC1 [22]. Apart from these gold standard methods mentioned above, we use a relatively newly developed method called microscale thermophoresis (MST) [23]. This method can be employed to measure molecular interactions as a function of both temperature and binding partner concentration. In detail, an infrared source is used to locally increase the temperature of the sample and create a thermooptical gradient. This induces two parallel effects, namely (a) temperature-related intensity change of fluorescence (TRIC) and (b) thermophoresis as the molecules move through the temperature gradient [24]. The technique allows to monitor and analyze the state of molecules, including unbound and RNA-bound state. The principle is based on the temperature-dependent fluorescence changes due to molecular size, charge, and conformation of biomolecules. These changes in turn enable a quantitative measurement of binding affinity. Furthermore, MST measurements are performed in aqueous solutions, which can match “native” biological conditions. By using fluorescently labeled samples, the required sample quantity for the MST measurements is further reduced. In addition, MST has no restrictions on molecular mass and is, therefore, suited even for large molecular assemblies, like ribosomes [25]. A bacteriophage RNA polymerase-driven in vitro transcription reaction is a standard method [26, 27] to produce the RNA of interest for these kinds of interaction assays. The T7, T3, and SP6 phage RNA polymerases are commonly used for this purpose. Because each RNA polymerase has its own specific promoter sequence, the DNA template should consist of the enzyme-specific promoter sequence followed by the DNA-encoded sequence of interest. The template can be further cloned into a vector backbone (e.g., pUC plasmids) to preserve the gene and allow large-scale template amplification in bacteria. When the DNA templatecontaining plasmid is used for the in vitro transcription, the precise length of the RNA product needs to be defined by DNA linearization. The principle of in vitro transcription is to synthesize RNA in the 5′!3′ direction while incorporating unlabeled, radiolabeled, or other modified ribonucleotides depending on the downstream applications. During a “run-off reaction,” the T7 RNA polymerase

32

Andrzej Chramiec-Gła˛bik et al.

Scheme 1 The workflow of protein-RNA interaction investigation

is often found to generate abortive transcripts due to the premature termination close to the 3′ end of templates. If the homogeneity of the 3′ end of the RNA transcripts is strictly required, purifying the full-length RNA by denaturing polyacrylamide gel electrophoresis is recommended. Alternatively, introducing a hammerhead ribozyme at the 3′ end of the RNA of interest could serve the same purpose of preserving the fidelity of the 3′ end [28]. Due to the cleavage in cis activity of the ribozyme, the RNA of interest will be released with a homogenous 3′ end [29], but this approach requires the subsequent separation of the product from the stoichiometric ribozyme in the sample. In this chapter, we will describe the details of producing tRNAs of interest, EMSA, and MST assays (Scheme 1). The RNA production protocol involves three major steps, namely (a) the preparation of a DNA template that contains the sequence of RNA of interest, (b) the T7-driven in vitro transcription, and (c) the RNA purification. Our most common strategy for producing RNA transcripts is based on directly using the templates produced by polymerase chain reaction (PCR), which saves time by circumventing the cloning procedure. Once the RNA has been made, it is purified using a weak ion exchange chromatography (e.g., DEAE) step, followed by a refolding step and a final gel filtration (e.g., Superdex 75 Increase) step to obtain the homogenous materials and to remove RNA aggregates. Ion exchange chromatography, such as a DEAE column, offers a rapid way to separate the desired transcripts from T7 RNA polymerase, unincorporated NTPs, and the DNA template [30]. Of note, we do not introduce a ribozyme in the 3′ end of transcripts because the length of tRNAs is 73–83 nt, which is similar to known ribozymes, such as the HDV ribozyme (67 nt). Hence, the use of a ribozyme would create additional difficulties in

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

33

separating the target transcripts from the ribozyme in the downstream purification protocol (e.g., gel filtration or gel extraction). In addition, we have no structural or biochemical indications that minor heterogeneities of the 3′ end of tRNAs would influence the interaction with Elp3 and/or Elongator. Our approach allows to easily produce fluorescently labeled versions of the tRNAs by incorporation of labeled CTPs. By using only minor ratios (e.g., 5%) of fluorescently labeled CTP during the in vitro transcription and due to stochastic nature of incorporation, the dye is equally distributed throughout the RNA products, and no site-directed bias would influence the analyses. Foremost, the production procedure is straightforward and easily scalable, which is advantageous in comparison to site-specific labeling methods [31]. Furthermore, the fluorescently labeled method can fully replace the traditional radioisotope labeling strategy, which is beneficial for radioisotope-free working environments and work safety procedures. It makes experiments faster, safer, and reduces demands for highly specialized equipment and infrastructure. With the workflow mentioned above, we were able to generate numerous tRNA transcripts. Several subsequent investigations using EMSA and MST have produced very valuable scientific insights and provided quantitative information [8, 9]. Thanks to the high sensitivity readout and low quantity of proteins required in the MST method, it is now possible to perform an in-depth biochemical analysis on the interaction of Elp3 or the Elp123 subcomplex with tRNAs (Fig. 1) [32, 33].

Fig. 1 Illustration of Elongator’s tRNA binding ability. Top: various tRNA types are depicted by different colors. Bottom: every Elp subunit is indicated. Elp3 is the catalytic subunit, and its two functional domains (KAT and rSAM) are as labeled. The bound tRNA is colored in black

34

2

Andrzej Chramiec-Gła˛bik et al.

Materials Reagents are prepared using analytical grade materials and ultrapure double-distilled water (ddH2O). Buffers for purification are filtered, degassed, and stored at 4 °C. Be cautious of RNase or DNase contamination, and wear gloves during the entire procedure. The buffers that contain dithiothreitol (DTT) should be prepared freshly before each use.

2.1 Materials for Preparing DNA Templates

1. Thermocycler. 2. DNA polymerase for precision PCR (e.g., Thermo Scientific Phusion High-Fidelity DNA Polymerase). 3. dNTP mix: Mix 25 μL of 100 mM dATP, 25 μL of 100 mM dCTP, 25 μL of 100 mM dGTP, 25 μL of 100 mM dTTP (e.g., Thermo Scientific), and add 900 μL of ddH2O. Vortex and spin. The solution is then aliquoted and stored at -20 °C. 4. Gene-specific primers (high-performance liquid chromatography [HPLC]-grade purified). 5. PCR buffer (e.g., 5× Phusion HF buffer from Thermo Scientific Phusion High-Fidelity DNA Polymerase). 6. Spectrophotometer (e.g., Thermo Scientific NanoDrop 2000). 7. Tabletop centrifuge. 8. A 37 °C incubator. 9. Agarose gel casting tray (10.5 × 6 cm) and big-tooth comb. 10. 2% agarose gel: Weigh 1.2 g of agarose (e.g., BioShop, Biotechnology Grade) and dissolve in 60 mL of ddH2O in a 250 mL Erlenmeyer flask. Heat up the solution using microwave for 1 min (do not overboil) and stir until the agarose is dissolved. Cool down the flask slowly (do not overcool otherwise the gel will solidify). Add 6 μL of DNA staining reagent (e.g., Invitrogen SYBR Safe DNA Gel Stain) and mix thoroughly. Cast the gel in a gel casting tray. 11. 1× Tris-acetate-EDTA (TAE) buffer (pH 8.0): 40 mM Trisacetate, 1 mM ethylenediaminetetraacetic acid (EDTA) (e.g., VWR Life Science, UltraPure Grade). 12. 6× DNA loading dye: 10 mM M Tris–HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, and 60 mM EDTA (e.g., Thermo Scientific). 13. Horizontal electrophoresis gel tank. 14. Power supply. 15. Ethidium bromide solution: add one drop of 0.5% ethidium bromide solution (e.g., Carl Roth, Ethidium bromide solution

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

35

0.5% in dropper bottle) to a glass bottle filled with 100 mL of ddH20. Mix and aliquot necessary amount to immerse a gel in a plastic box. Protect from light. 16. Gel extraction kit (e.g., Thermo Scientific GeneJET Gel Extraction Kit). 17. UV box with 365 nm wave-length. 2.2 In Vitro Transcription (IVT)

1. 1 M dithiothreitol (DTT): Weigh 1.54 g of dithiothreitol and dissolve in 10 mL of ddH2O. Filter the solution through 0.2 μm syringe filter. Aliquot into 1.5 mL microcentrifuge tubes and store at -20 °C. 2. 2 M Tris–HCl (pH 8.0): Weigh 242.28 g of Tris base and dissolve in 800 mL of ddH2O. Use 12 M HCl to adjust to the desired pH. Adjust to 1 L with ddH2O. 3. 20× IVT buffer: 800 mM Tris–HCl (pH 8.0), 100 mM DTT, 20 mM Spermidine, 0.2% Triton X-100. Prepare at room temperature and store the reagent at -20 °C. 4. T7 RNA polymerase (e.g., Thermo Scientific Bacteriophage T7 RNA polymerase). 5. Pyrophosphatase (e.g., Thermo Scientific Pyrophosphatase, Inorganic). 6. RNasin RNase inhibitor (e.g., Promega). 7. 100 mM 5-Propargylamino-CTP-Cy5 (e.g., Jena Bioscience). 8. ATP, CTP, GTP and UTP 100 mM solutions (e.g., Thermo Scientific). 9. DNase I, RNase-free (e.g., Thermo Scientific). 10. 20 mM NTP for MgCl2 concentration optimization: Mix 50 μL of 100 mM ATP, 50 μL of 100 mM CTP, 50 μL of 100 mM GTP, 50 μL of 100 mM UTP (e.g., Thermo Scientific) and add 800 μL of ddH2O. Vortex and spin. The solution is then aliquoted and stored at -20 °C. 11. Mini cooler.

2.3 RNA Purification Using Fast Performance Liquid Chromatography (FPLC)

1. Chromatography system (e.g., Cytiva) or detector-coupled peristaltic pump. 2. Weak anion exchange column (e.g., HiTrap DEAE FF 1 mL). 3. Gel filtration column (e.g., Superdex 75 Increase 10/300 GL). 4. 1 M HEPES, pH 7.5: 238 g of HEPES in 800 mL of ddH2O. Use 5 M NaOH to adjust to the desired pH. Adjust to 1 L with ddH2O. 5. 5 M NaCl: Weigh 292.2 g of NaCl, add ddH2O to dissolve and adjust volume to 1 L.

36

Andrzej Chramiec-Gła˛bik et al.

6. 3 M KCl: Weigh 223.7 g of KCl, add ddH2O to dissolve and adjust volume to 1 L. 7. Buffer A for DEAE column: 20 mM HEPES (pH 7.5) and 50 mM NaCl. 8. Buffer B for DEAE column: 20 mM HEPES (pH 7.5) and 2000 mM NaCl. 9. Elution buffer for S75 column: 20 mM HEPES (pH 7.5), 150 mM NaCl and 5 mM DTT. 2.4 Denaturing Urea PAGE Analysis and Visualization

1. 10× TBE buffer: Weigh 121.1 g Tris base, 61.8 g boric acid, 7.4 g EDTA and add ddH2O to dissolve and adjust volume to 1 L. There is no need to adjust pH. Store at room temperature (RT). 2. 8 M urea solution: Weigh 480.48 g urea and add ddH2O to dissolve and adjust volume to 1 L. Store at RT and avoid light. 3. 10% APS solution: Weigh 10 g ammonium persulfate and add ddH2O to dissolve and adjust volume to 0.1 L. Aliquot in 1.5 mL reaction tubes and store at -20 °C. 4. 10% polyacrylamide urea gel (6 mL for 1 gel): 0.6 mL of 10× TBE, 1.5 mL of 40% 19:1 acrylamide/bis-acrylamide, 3.85 mL of 8 M urea, 50 μL of 10% APS, 3 μL of TEMED. 5. A vertical electrophoresis system, including glass plates (10.1 × 8.2 in cm for spacer plates (0.75 mm thick) and 10.1 × 7.3 in cm for short plates), a buffer tank, electrode assembly, lid with power cables and a mini cell buffer dam (e.g., Bio-Rad). 6. A power supply (e.g., Bio-Rad, PowerPac™ Basic). 7. Sucrose solution: Weigh 500 mg of sucrose and dissolve in 650 μL of ddH2O and heat at 70 °C with shaking. 8. RNA size marker (e.g., New England Biolabs, Low Range ssRNA Ladder). 9. 6× RNA loading dye: 200 μL of sucrose solution, 250 mg urea, 0.01% bromophenol blue and 100 μL of ddH2O. Dissolve at 70 °C with shaking. Store at 4 °C. 10. Gel imager (e.g., BioRad, ChemiDoc).

2.5

RNA Annealing

1. 10× annealing buffer: 200 mM HEPES (pH 7.5), 500 mM KCl, 500 mM NaCl. Store at RT. 2. Thermocycler.

2.6 Nucleic Acid Precipitation

1. 0.5 M ethylenediaminetetraacetic acid (EDTA), pH 8.0: 186.1 g of EDTA in 800 mL of ddH2O. Use 5 M NaOH to adjust the pH to 8.0. Adjust to 1 L with ddH2O.

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

37

2. 3 M sodium acetate (NaOAc), pH 5.2: 408.3 g of sodium acetate•3H2O in 800 mL of ddH2O. Use glacial acetic acid to adjust to the desired pH. Adjust to 1 L with ddH2O. 3. 1 M MgCl2: 20.33 g of MgCl2•6H2O, add ddH2O to dissolve and adjust volume to 100 mL. 4. 96% ethanol. 5. 100% 2-propanol. 2.7 Enzyme–RNA Interaction Assay

1. 2× Reaction buffer: 40 mM HEPES, pH 7.5, 300 mM NaCl and 10 mM DTT. 2. Fluorescently labeled tRNAs. 3. 3 K centrifugal filter devices (e.g., Amicon Ultra-0.5). 4. Serial titration of proteins at varying concentrations.

2.8

EMSA

1. Tris/Glycine running buffer: 3.3 g Tris, 14.4 g glycine, 150 mg DTT and adjust volume to 1 L with ddH2O. 2. Six percent tris-glycine acrylamide native gel (10 mL): 2 mL of 30% acrylamide mix (37.5:1 acrylamide/bis-acrylamide), 3 mL of 50% sucrose, 1 mL of 10× TBE, 100 μL of APS and 10 μL of TEMED and adjust volume to 10 mL with ddH2O. 3. Fifty percent glycerol: 50 μL of 100% glycerol and 50 μL of 2× Reaction buffer (see Subheading 2.7, step 1). 4. Tracking dye: 0.01% bromophenol blue. 5. A power supply (e.g., Thermo Fisher, PowerEase™ Touch 350 W Power Supply). 6. An adjustable vertical gel system, providing the flexibility of running gels in lengths from 145 to 280 mm (e.g., CBS Scientific). 7. A set of glass plates with size of 165 (wide) × 145 (height) (mm) (e.g., CBS Scientific). 8. One comb for 165 mm wide (0.75 mm thick) with 20 or 30 wells (e.g., CBS Scientific). 9. A set of 0.75 mm spacer with 145 or 280 mm in length (e.g., CBS Scientific). 10. One Gel Wrap® gasket for gel casting (0.75 mm thick) (e.g., CBS Scientific). 11. A set of spring clamps (e.g., CBS Scientific).

2.9

MST

1. Glass capillaries (NanoTemper Technologies Monolith NT.115 Capillaries or Monolith NT.115 Premium Capillaries). 2. Monolith NT.115 instrument (NanoTemper Technologies).

38

Andrzej Chramiec-Gła˛bik et al.

3. Small tubes for sample preparation: 0.2 mL PCR tubes (e.g., Thermo Scientific) or any small volume microwell plates (e.g., Greiner, microplate, 384 wells, F-bottom).

3

Methods When preparing reactions with RNAs, always take extra caution to avoid any potential RNase contamination. Wear gloves and keep RNA containing samples on ice whenever possible.

3.1 DNA Template Preparation

3.1.1 Primer Design for Single Construct Assembly (60–300 nt)

We use Primerize [34], an automated primer assembly of DNA templates, which is a rapid and cost-effective way to produce the DNA templates via PCR (Scheme 2). It requires at least one pair of primers, and longer DNA template may need multiple primer pairs for the reaction. In case of producing tRNAs, only one pair of primers is needed in most cases. Due to its longer length, tRNASer is an exception and requires two pairs of primers. 1. The primers are generated using https://primerize.stanford. edu/ with default settings [35]. This automatically includes the T7 promoter sequence to avoid the mistake of leaving out this sequence in the ordered primer (see Note 1). 2. Order primers with highest HPLC grade (i.e., after HPLC purification).

Scheme 2 Flow chart of making DNA templates by multiple polymerase chain reaction (PCR). (a) The overall pipeline of DNA template assembly. (b) Schemes of using one or two pairs of primers for different tRNA genes. In PCR1b, external primers are labeled as black while the internal primers are green

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

39

Table 1 PCR1a ingredients Materials

(μL)

5× PCR buffer

10

10 mM dNTP mix

1

100 μM forward primer

2

100 μM reverse primer

2

0.02 U/μl DNA polymerase

0.5

ddH2O

Up to 50

Table 2 PCR1a settings Steps

Time (Sec)

Temp (°C)

Cycle

Initial denaturation

30

98

1

Denaturing Annealing/elongation

10 30

98 72

Final elongation

600

72

35a 1

a

25–35 cycles are recommended

3.1.2 PCR Assembly of DNA Template

1. Prepare the PCR1a on ice (Table 1), and use the thermocycler settings for a two-step PCR (Table 2; see Note 2). 2. If using two pairs of primers is required, prepare the PCR1b according to Tables 3 and 4 (see Note 3). 3. Resolve the PCR product in a 2% agarose gel. Fill the horizontal electrophoresis gel tank with 1× TAE buffer. Mix the PCR product (50 μL) with 8 μL of 6× DNA loading dye and load into two wells (each well volume is 30 μL). Perform the electrophoresis at 100 V for 30 min until the dye front reaches the end of the gel to obtain optimal separation. 4. Visualize the DNA using the UV box at long wavelength (365 nm). The DNA bands with correct sizes are cut and further extracted using a commercial gel extraction kit. 5. Prepare PCR2 (Table 5) on ice with the purified PCR1a or PCR1b product as a DNA template and use the thermocycler settings same as Table 2 (two-step PCR) or Table 4 (three-step PCR if the Tm is lower than 69 °C) (see Note 4). 6. Resolve 5 μL of the PCR product in a 2% agarose gel: same as in step 3. Visualize the DNA using the UV box. Carefully check if the size of the band is as expected.

40

Andrzej Chramiec-Gła˛bik et al.

Table 3 PCR1b ingredients Materials

(μL)

5× PCR buffer

10

10 mM dNTP mix

1

100 μM external forward primer

2

100 μM external reverse primer

2

1 μM internal forward primer

2

1 μM internal reverse primer

2

0.02 U/μl DNA polymerase

0.5

ddH2O

Up to 50

Table 4 PCR1b settings Steps

Time (Sec)

Temp (°C)

Cycle

Initial denaturation

30

98

1

Denaturing Annealing Elongation

10 30 30

98 a 72

Final elongation

600

72

35ba 1

a

It is usually between 60 and 64 °C. b 25–35 cycles are recommended.

Table 5 PCR2 ingredients Materials

(μL)

5× PCR buffer

10

10 mM dNTP mix

1

10 μM (external) forward primer

2

10 μM (external) reverse primer

2

10–15 ng DNA template

X

0.02 U/μl DNA polymerase

0.5

ddH2O

Up to 50

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction 3.1.3 Perform DNA Precipitation

41

1. Transfer the remaining PCR product to a 1.5 mL tube. 2. Add 1/10 volume of 3 M NaOAc (pH 5.2) and 2.5 volume of ice cold 96% EtOH. 3. Mix the solution via inverting the tube several times. 4. Leave it at -80 °C for at least 1 h (o/n if possible). 5. Centrifuge at 21,000 g at 4 °C for 30 min; carefully remove the supernatant by decanting. 6. Wash the pellet with 250 μL of ice-cold 70% EtOH; carefully remove the supernatant by decanting. 7. Air dry. The DNA pellet should be opaque and dried within a few minutes. Do not overdry. Add 40 μL of ddH2O to dissolve the DNA. 8. Measure DNA concentration using a spectrophotometer. To obtain sufficient quantity of DNA template (10 μg), we usually perform five reactions for PCR2.

3.2 Run-Off In Vitro Transcription 3.2.1 In Vitro Transcription Reaction

Protect 5-propargylamino-CTP-Cy5 reagent from light. Protect the reaction from light at all steps after the addition of 5-propargylamino-CTP-Cy5. The optimal concentration of MgCl2 may vary depending on the RNA of interest. A pretest (20 μL) should be carried out to find out the optimal condition and concentration (10–50 mM of MgCl2) (see Note 5). 1. Thaw nucleotides (ATP, CTP, 5-Propargylamino-CTP-Cy5, GTP, UTP) on ice. Keep thawed 20× IVT buffer at room temperature. T7 RNA polymerase should be kept in a -20 ° C mini cooler at all times. 2. Assemble the reaction (250 μL) at room temperature in 1.5 mL reaction tube (Table 6). 3. Mix reaction by pipetting gently. 4. Incubate at 37 °C for 16 h (or overnight).

3.2.2 Remove DNA Template

1. Add 247 μL of ddH2O and 3 μL of DNase I (RNase free). Incubate for 1 h at 37 °C. 2. Add 50 μL (1/10 of the total reaction volume) of 0.5 M EDTA. 3. Proceed with DEAE purification (see Subheading 3.3.1) immediately or store at -20 °C.

3.2.3 Denaturing Urea PAGE Analysis and Visualization

1. To check tRNA quality, take 2 μL of tRNA sample and add 1 μL of 6× RNA loading dye (optional: addition of extra 4 μL ddH2O could help improve the sharpness of the resulting RNA band on the gel). 2. Boil samples at 95 °C for 5 min and leave them on ice.

42

Andrzej Chramiec-Gła˛bik et al.

Table 6 IVT ingredients Materials

(μL)

20× IVT buffer

12.5

DNA template

X

MgCl2

Y

RNasin

5

Pyrophosphatase

5

100 mM ATP

18.75

100 mM UTP

18.75

100 mM GTP

18.75

100 mM CTP

15

100 mM 5-propargylamino-CTP-Cy5

3.75

T7 RNA polymerase (0.6 U/μl)

7.5

ddH2O

Up to 250

X: DNA quantity ranging 10–25 μg Y: ranging 10–50 mM

3. Assemble a denaturing urea gel to the electrophoresis apparatus and fill the chambers with 1× fresh TBE buffer. Flush the wells with TBE buffer using a syringe. 4. Pre-run the gel at 180 V for 10 min and wash wells thoroughly with 1× TBE buffer using a syringe to remove nonpolymerized acrylamide. 5. Apply samples and the RNA size marker (5 μL) and run the electrophoresis at 180 V for 40 min. 6. Soak the gel in the ethidium bromide solution for 5 min. 7. Visualize the gel using a gel imager with proper filters: UV channel for RNA marker and Cy5 fluorescence channel for Cy5-labeled RNA samples (see Note 6). 3.3 RNA Purification Using an Ion Exchange Column

For general column settings, follow recommended standard settings for 1 mL HiTrap DEAE FF, which can be found in column ¨ KTA system’s UNICORN software. handling section on A

3.3.1 Purification Using a DEAE Ion Exchange Column

¨ KTA pure chromatography system 1. Perform purification on A with the use of single 1 mL HiTrap DEAE FF column (see Note 7). 2. Mount the column and equilibrate with DEAE buffer A.

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

43

Fig. 2 The tRNA purification profile of the DEAE column. The elution profile contains the signals of 280 nm (blue line) and 254 nm (red line). The salt gradient is shown in gray line. The eluted peaks are as labeled: (1) Unincorporated NTPs; (2) DNA fragments and contaminants; (3) tRNA of interest. Gel image inset: fractions (from the marked peak) were resolved in a 10% urea denaturing gel and imaged using a gel imager with the Cy5 channel. The RNA marker was stained using EtBr solution and visualized using the EtBr channel. The two images are merged using the gel imager software. The color is converted to gray scale for clarity

3. Apply the RNA-containing solution to the column via the sample loop (1 mL). 4. Elute RNA using a stepwise gradient elution with the following settings: 0% buffer B for 10 column volume (CV), 0–30% buffer B for 30 CV, 100% buffer B for 7 CV. Set fixed fractionation volume to 2 mL. 5. Check the elution fractions on a denaturing urea PAGE (Fig. 2) (see Subheading 3.2.3: taking 2 μL of each fraction and add 1 μL of 6× RNA loading dye). 6. Pool the desired fractions and perform precipitation. 7. Add 1/10 volume of 3 M NaOAc (pH 5.2) and 2.5 volume of 100% 2-propanol to the sample and mix via inverting the tube for several times. 8. Precipitate at -20 °C overnight. 9. Centrifuge at 21,000 g at 4 °C for at least 20 min; carefully remove the supernatant by decanting or pipetting. 10. Wash the pellet with 1 mL of 70% ethanol. 11. Centrifuge at 21,000 g at 4 °C for 5 min; carefully remove the supernatant by decanting or pipetting.

44

Andrzej Chramiec-Gła˛bik et al.

12. Air dry. The RNA pellet should be opaque and dried within a few minutes. Do not overdry. 13. Add 90 μL of ddH2O to dissolve the RNA and proceed to re-annealing of tRNA. 3.3.2 Refolding/ Annealing of tRNA

1. Add 10 μL of 10× annealing buffer to the purified RNAs. 2. Perform annealing in a thermocycler using the following settings: 80 °C for 2 min followed by gradually decreasing temperature. This can be set using the down ramp function: 80 °C to 25 °C at -0.4 °C/40 s. 3. Add 1 mM MgCl2 and 1 mM DTT.

3.4 Purification of the Homogenous Form of RNA of Interest

For general column settings, follow the recommended standard settings for Superdex 75 Increase (see Note 8), which can be ¨ KTA systems’ UNICORN found in column handling section on A software. ¨ KTA Pure chromatography system 1. Perform purification on A with the use of Superdex 75 Increase column. 2. Mount the column and equilibrate the column with S75 Elution buffer. 3. Apply the RNA-containing solution to the column via the sample loop (500 μL). 4. Perform isocratic elution with S75 Elution buffer (1 CV). 5. Start collecting fractions from 0.2 CV. Set fixed fractionation volume to 0.5 mL. 6. Check the eluted fractions (2 mL/fraction) on a denaturing urea PAGE (Fig. 3) (see Subheading 3.2.3: taking 2 μL of each fraction and add 1 μL of 6× RNA loading dye). 7. Pool the desired fractions and use the Amicon Ultra-0.5 3 K centrifugal filter devices to concentrate the sample (see Note 9). 8. Measure RNA concentration using a spectrophotometer at 260 nm.

3.5

EMSA

1. Prepare samples (proteins and tRNA) in a 10 μL reaction. Keeping the necessary reaction volume minimal can help improve the sharpness of the bands. Titration of protein concentration is necessary to determine the optimal interaction conditions against a constant concentration of the binding partner. The mixed samples are then incubated at room temperature for 30 min (see Note 10). Afterward, add 2 μL 50% glycerol (prepared in the same incubation buffer) to facilitate the loading. It is suggested to omit the loading dye as it can affect/disrupt the interaction (see Note 11).

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

45

Fig. 3 The gel filtration profile of the in vitro transcribed tRNA. The elution profile contains the signals of 280 nm (blue line) and 254 nm (red line). Gel image inset: fractions (from the marked peak) were resolved in a 10% urea denaturing gel and imaged using a gel imager with the Cy5 channel. The RNA marker was stained using EtBr solution and visualized using the EtBr channel. The two images are merged using the gel imager software. The color is converted to gray scale for clarity

2. During the incubation period, pre-run the gel at 10 V/cm of gel length for 30 min in the cold room with pre-cooled running buffer. Replace the buffer with fresh running buffer in the gel chamber. Wash wells thoroughly using a needle with a syringe to remove nonpolymerized acrylamide. 3. Carefully load samples, and avoid introducing air bubbles. 4. Loading tracking dye in an unused well will allow one to visualize the dye front during electrophoresis and can provide a useful relative measure of the run length. 5. Run the electrophoresis at 10 V/cm of gel length. Reduce the voltage if the gel heats up during electrophoresis.

46

Andrzej Chramiec-Gła˛bik et al.

Fig. 4 RNA-protein interaction and complex formation assays. Methanocaldococcus infernus Elp3 (MinElp3) full length (FL), MinElp3 N-terminus truncation (Δ1–68), and MinElp3 N-terminus (1–77) were tested for their binding abilities toward the tRNASer. (a) Proteins were prepared in a serial dilution (six concentrations), and the concentrations are listed on top of the gel. The Cy5-labeled tRNAs (20 ng) were mixed with proteins in a 10 μL reaction volume, and the mixture was subjected to incubation as stated in the method. The samples (10 μL mixture with 2 μL loading buffer) were resolved in a 6% native gel and visualized using a gel imager with the proper channel for Cy5 signal detection. Free RNA and RNA-protein complex are as indicated. (b) Proteins were prepared in a serial dilution (16 concentrations). The Cy5-labeled tRNAs (200 nM) were mixed with proteins in a 20 μL reaction volume, and the mixture was subjected to incubation as stated in the method. The samples (10 μL) were loaded to capillaries and subjected to MST measurement using the RED detection channel for Cy5 signal detection (medium MST and 80% LED excitation power), and the KD are shown in the inset

6. Stop the electrophoresis when the dye front is at the position of ¾ of the gel. 7. Visualize the signals using a gel imager with a proper wavelength filter (Fig. 4a). 3.6

MST

3.6.1 Screening of Capillaries and Optimization of the Buffer Conditions

MST measurements are performed using the Monolith NT.115 instrument (Scheme 3). The reaction is prepared in PCR tubes in 20 μL volume. To avoid surface absorption, the use of PCR tubes or low-volume microwell plates is highly recommended. All MST measurements are operated using the automated MO.Control software (NanoTemper Technologies), and it notifies the users regarding the data qualities, including fluorescence check, capillary check, and sample quality. The data analyses are then carried out using the automated MO.AffinityAnalysis software (NanoTemper Technologies). 1. All samples are applied to glass capillaries. Depending on the biophysical properties of the macromolecules and complexes, parts of the samples might stick to the glass surface of the capillary and thus reduce the detectable signals. Therefore,

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

47

Scheme 3 The principle of microscale thermophoresis (MST) measurement. (a) Top: a cartoon presentation of MST measurements. Samples (containing a mixture of fluorescent-labeled binding partner [constant concentration] and nonfluorescent-binding ligand [serial dilution]) are loaded in capillaries, and an LED (red detector: 600–650 nm; blue detector: 460–490 nm) is applied to the fluorescent samples. Bottom: an illustration of the temperature related intensity changes (TRIC) in unbound and bound states (red: fluorescent-labeled binding partner; black: nonfluorescent-binding ligand) upon Infrared (IR) state changes (off: black square; on: red square). In addition, the fluorescent-labeled binding partners have weaker fluorescent intensity when they are excited by IR. (b) Top: Typical MST trace. The fluorescent intensity changes are recorded over time.

48

Andrzej Chramiec-Gła˛bik et al.

different types of capillaries, with or without polymer treatment (see Note 12), should be tested to identify the most suitable ones for the respective measurements. In our case, we used premium capillaries, which gave a symmetrical peak during the scanning. 2. Alternatively, addition of 0.05% Tween 20 or other detergent should be considered. Furthermore, different buffer conditions, such as Tris or HEPES, should be tested for optimal conditions in pre-experiments (see Note 12). 3. Perform a capillary scan with the default settings. Analyze the signals using the analysis software. Only the average minimum to maximum noise of four units or less is acceptable as a good range of sample quality. 3.6.2 Determination of the Concentration of the Fluorescently Labeled Molecule

1. 5–200 nM of the fluorescently labeled RNAs are used. Check the fluorescence intensity using the scan at 50% LED power of the suited LED. The fluorescence count should be in a range between 200 and 1500. 2. The sample concentration could be adjusted based on the fluorescence count. Alternatively, the LED power can be varied between 15% and 95%.

3.6.3 Sample Preparation for MST Measurements

1. Typically, twofold serial dilutions of protein (16 concentrations) in 1× Reaction buffer are performed in 10 μL volume. The highest concentration of protein should be roughly 20 times higher than the expected KD (see Note 13). 2. The tRNA is prepared at a constant concentration (see Subheading 3.6.2) and 10 μL of which are aliquoted into each tube (see Note 14). At the end of the incubation time for RNA-protein complex formation, apply samples (10 μL) to capillaries and perform the MST measurement using the MO. Control software (Fig. 4b) (see Note 15). ä Scheme 3 (continued) The IR is usually switched on after 5 s, and the IR continuously excites the samples for further 20 s. Typically, 16 capillaries/ samples are measured and plotted. For clarity, the bound (red), intermediate (gray), and unbound (black) traces are presented as each single line. The fluorescence value before (F0) and after (F1) IR excitement in MST traces are indicated. Bottom: the normalized fluorescence (Fnorm) is calculated as the ratio of F0 and F1 from MST traces and plotted against the ligand concentrations. The interaction strength of the binding partner and the ligand is calculated from the fitted curve using the MO.AffinityAnalysis software. The bound (red), intermediate (gray), and unbound (black) data points are color coded. Noise is defined as the mean value from the unbound data points. When the noise range is less than 1/3 of the amplitude of binding signals, it gives good signal-to-noise ratio

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

4

49

Notes 1. The addition of the T7 sequence feature can be turned off in the case of choosing other transcription promoters or seeking fragments for gene assembly. 2. We checked the annealing temperature using the Thermo Fisher Scientific Tm calculator (https://www.thermofisher. com/pl/en/home/brands/thermo-scientific/molecular-biol ogy/molecular-biology-learning-center/molecular-biologyresource-library/thermo-scientific-web-tools/tm-calculator. html). If the primer annealing temperature is higher than 69 ° C, both annealing and extension steps can be combined, as the two-step PCR, and 72 °C should be used. 3. For the first trial, choosing the minimum annealing temperature for the reaction is recommended. If there is mis-primed PCR product, increasing the Tm may reduce mis-priming. 4. Sometimes PCR1 produces multiple PCR products. Performing the PCR2 step can amplify the extracted product from PCR1 step to facilitate acquiring larger amount of DNA template. In addition, this approach is cost efficient as it lowers the primers usage (10 μM primer concentration is needed instead of 100 μM for external primers). Therefore, we employ the PCR2 step as a standard procedure in routine tRNA production pipeline. 5. We performed pretests to find the optimal MgCl2 concentration for each tRNA production. The MgCl2 concentration provided (40 mM) is the optimal condition for most of our tRNAs with few exceptions that only required 10 mM of MgCl2. 6. If very little or no RNA product is detected, the presence of RNase contamination or a poor-quality DNA template is most likely the problem. In case of DNA template quality, contaminants such as ethanol carried over from the DNA purification might cause the failure of the in vitro transcription reaction. Cleaning up of the DNA template by re-precipitation in ethanol can solve the contaminant problem. If there is an RNase contamination, the standard procedure is to identify the RNase contamination resources (e.g., Thermo Fisher RNaseAlert Lab Test Kit), eliminate/inhibit RNase activity (e.g., RNase inhibitor), and operate the RNA production with caution (e.g., treating water and buffer with DEPC or other RNase inactivating reagent [e.g., Thermo Fisher RNAsecure reagent] and using pipettes dedicated for RNA production). 7. We routinely perform the tRNA purification using an automated chromatography system as it is easy to use a pump to

50

Andrzej Chramiec-Gła˛bik et al.

control the flow rate and monitor the sample loading and elution profile. Alternatively, tRNA purification by the DEAE column can be performed with a peristaltic pump or by manual operation with syringes. 8. Superdex 75 Increase gel filtration column has higher selectivity for improved performance compared with its predecessor Superdex 75. Using the Superdex 75 Increase column is ideal for obtaining homogenous monomeric tRNAs. For longer species (e.g., tRNASer: 83 nt), where the elution volume is close to the void, we recommend using a Superdex 200 Increase column for better separation. 9. In our cases, 1.5 mL eluted samples can be concentrated down to 50–100 μL by centrifuging in the concentrator at 14,000 g for a total of 40 min (every 5 min, refill with the tRNA sample, mix well, and repeat centrifugation). Final RNA concentration should be typically between 500 and 5000 ng/μL. 10. The binding equilibrium condition is sample-dependent. Normally, incubation at room temperature for 15–30 min is sufficient. In some cases, performing the incubation on ice can be advantageous and is recommended. 11. Some molecular systems, such as the interaction of iron regulatory proteins and iron responsive elements in mRNAs, are not disturbed by the tracking dye, and thus, the tracking dye can be included in the loading dye to facilitate visualization during loading. 12. Capillaries for Monolith NT.115 instrument is only available at NanoTemper Technologies. There are two types of capillaries available: (a) regular and (b) premium. In principle, the fluorescence peak profile of the labeled molecule in the regular capillary should give a symmetrical peak shape. If the peak is asymmetrical, such as with additional shoulders, it suggests the molecule has a sticking effect to the capillary. To test the premium capillary or improve the buffer composition (different buffers or with additional bovine serum albumin [BSA; e.g., 0.1–0.5 mg/mL] or detergent [e.g., up to 0.05% Tween-20]) is highly recommended. 13. We typically start the protein titration at 10–20 μM as the expected KD of tRNA to Elongator complex is around 1–2 μM. Performing twofold titrations for 16 data points gives the protein concentration range between 0.0006 and 20 μM to cover enough data points from the baseline to saturation in the binding curve. A different titration strategy could be applied, such as 1:3 or 1:0.3. 14. To avoid an unwanted buffer dilution effect, it is highly recommended to prepare and dilute protein and tRNA into the same buffer, for instance, performing buffer exchange of tRNA solution to 1× Reaction buffer.

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction

51

15. Start the measurement with the default setting of 20% MST power. Increase the MST power, if necessary, to obtain the best signal to noise ratio. If MST power is not defined in the measurement setting, the automated MO.Control software will determine the MST power during measurement.

Acknowledgments We thank Ros´cisław Krutyhołowa, Mikołaj Sokołowski and Jakub Nowak for vivid discussion and suggestions. This work was supported by the NCN grant 2019/35/D/NZ1/02397 to TL and the TEAM TECH CORE FACILITY/2017-4/6 grant from the Foundation for Polish Science (ACH, MR and SG). References 1. Boccaletto P, Machnicka MA, Purta E, Piatkowski P, Baginski B, Wirecki TK, de Crecy-Lagard V, Ross R, Limbach PA, Kotter A, Helm M, Bujnicki JM (2018) MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic Acids Res 46(D1):D303–D307. https://doi.org/ 10.1093/nar/gkx1030 2. Barbieri I, Kouzarides T (2020) Role of RNA modifications in cancer. Nat Rev Cancer 20(6): 303–322. https://doi.org/10.1038/s41568020-0253-2 3. Krutyhołowa R, Zakrzewski K, Glatt S (2019) Charging the code—tRNA modification complexes. Curr Opin Struct Biol 55:138–146. https://doi.org/10.1016/j.sbi.2019.03.014 4. Wittschieben BØ, Otero G, de Bizemont T, Fellows J, Erdjument-Bromage H, Ohba R, Li Y, Allis CD, Tempst P, Svejstrup JQ (1999) A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol Cell 4(1):123–128. https://doi.org/10.1016/s1097-2765(00) 80194-x 5. Huang B, Johansson MJ, Bystrom AS (2005) An early step in wobble uridine tRNA modification requires the Elongator complex. RNA 11(4):424–436. https://doi.org/10.1261/ rna.7247705 6. Selvadurai K, Wang P, Seimetz J, Huang RH (2014) Archaeal Elp3 catalyzes tRNA wobble uridine modification at C5 via a radical mechanism. Nat Chem Biol 10(10):810–812. https://doi.org/10.1038/nchembio.1610 7. Glatt S, Letoquart J, Faux C, Taylor NM, Seraphin B, Muller CW (2012) The Elongator subcomplex Elp456 is a hexameric RecA-like

ATPase. Nat Struct Mol Biol 19(3):314–320. https://doi.org/10.1038/nsmb.2234 8. Glatt S, Zabel R, Kolaj-Robin O, Onuma OF, Baudin F, Graziadei A, Taverniti V, Lin TY, Baymann F, Seraphin B, Breunig KD, Muller CW (2016) Structural basis for tRNA modification by Elp3 from Dehalococcoides mccartyi. Nat Struct Mol Biol 23(9):794–802. https:// doi.org/10.1038/nsmb.3265 9. Lin TY, Abbassi NEH, Zakrzewski K, Chramiec-Glabik A, Jemiola-Rzeminska M, Rozycki J, Glatt S (2019) The Elongator subunit Elp3 is a non-canonical tRNA acetyltransferase. Nat Commun 10(1):625. https://doi. org/10.1038/s41467-019-08579-2 10. Paraskevopoulou C, Fairhurst SA, Lowe DJ, Brick P, Onesti S (2006) The Elongator subunit Elp3 contains a Fe4S4 cluster and binds S-adenosylmethionine. Mol Microbiol 59(3): 795–806. https://doi.org/10.1111/j. 1365-2958.2005.04989.x 11. Rio DC (2012) Filter-binding assay for analysis of RNA-protein interactions. Cold Spring Harb Protoc 2012(10):1078–1081. https:// doi.org/10.1101/pdb.prot071449 12. Wilson GM (2005) RNA folding and RNA-protein binding analyzed by fluorescence anisotropy and resonance energy transfer. In: Reviews in fluorescence 2005, Reviews in fluorescence, pp 223–243. https://doi.org/10. 1007/0-387-23690-2_10 13. Katsamba P (2002) Kinetic studies of RNA– protein interactions using surface plasmon resonance. Methods 26(2):95–104. https://doi. org/10.1016/s1046-2023(02)00012-9 14. Feig AL (2007) Applications of isothermal titration calorimetry in RNA biochemistry and

52

Andrzej Chramiec-Gła˛bik et al.

biophysics. Biopolymers 87(5–6):293–301. https://doi.org/10.1002/bip.20816 15. Samatanga B, Clery A, Barraud P, Allain FH, Jelesarov I (2017) Comparative analyses of the thermodynamic RNA binding signatures of different types of RNA recognition motifs. Nucleic Acids Res 45(10):6037–6050. https://doi.org/10.1093/nar/gkx136 16. Hellman LM, Fried MG (2007) Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions. Nat Protoc 2(8):1849–1861. https://doi.org/10.1038/ nprot.2007.249 17. Ule J, Jensen K, Mele A, Darnell RB (2005) CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods 37(4):376–386. https://doi.org/ 10.1016/j.ymeth.2005.07.018 18. Steiner S, Pfannschmidt T (2009) Fluorescence-based electrophoretic mobility shift assay in the analysis of DNA-binding proteins. In: Plant signal transduction, Methods in molecular biology, pp 273–289. https:// doi.org/10.1007/978-1-59745-289-2_18 19. Van Nostrand EL, Pratt GA, Shishkin AA, Gelboin-Burkhart C, Fang MY, Sundararaman B, Blue SM, Nguyen TB, Surka C, Elkins K, Stanton R, Rigo F, Guttman M, Yeo GW (2016) Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat Methods 13(6):508–514. https://doi.org/10.1038/nmeth.3810 20. Sharma D, Zagore LL, Brister MM, Ye X, Crespo-Hernandez CE, Licatalosi DD, Jankowsky E (2021) The kinetic landscape of an RNA-binding protein in cells. Nature 591(7848):152–156. https://doi.org/10. 1038/s41586-021-03222-x 21. Lee FCY, Ule J (2018) Advances in CLIP technologies for studies of protein-RNA interactions. Mol Cell 69(3):354–369. https://doi. org/10.1016/j.molcel.2018.01.005 22. Xu C, Wang X, Liu K, Roundtree IA, Tempel W, Li Y, Lu Z, He C, Min J (2014) Structural basis for selective binding of m6A RNA by the YTHDC1 YTH domain. Nat Chem Biol 10(11):927–929. https://doi. org/10.1038/nchembio.1654 23. Wienken CJ, Baaske P, Rothbauer U, Braun D, Duhr S (2010) Protein-binding assays in biological liquids using microscale thermophoresis. Nat Commun 1(1):100. https:// doi.org/10.1038/ncomms1093 24. Gupta AJ, Duhr S, Baaske P (2018) Microscale thermophoresis (MST). Encycl Biophys:1–5.

https://doi.org/10.1007/978-3-642-359439_10063-1 25. Wild K, Juaire KD, Soni K, Shanmuganathan V, Hendricks A, Segnitz B, Beckmann R, Sinning I (2019) Reconstitution of the human SRP system and quantitative and systematic analysis of its ribosome interactions. Nucleic Acids Res 47(6):3184–3196. https:// doi.org/10.1093/nar/gky1324 26. Go¨ßringer M, Helmecke D, Ko¨hler K, Scho¨n A, Kirsebom LA, Bindereif A, Hartmann RK (2014) Enzymatic RNA synthesis using bacteriophage T7 RNA polymerase. In: Handbook of RNA biochemistry, pp 1–28. https:// doi.org/10.1002/9783527647064.ch1 27. Slater RJ (1987) In vitro transcription. In: Techniques in molecular biology, pp 203–227. https://doi.org/10.1007/978-14615-9799-5_12 28. Mo¨rl M, Hartmann RK (2014) Production of RNAs with homogeneous 5′- and 3′-ends. In: Handbook of RNA biochemistry, pp 29–44. h t t p s : // d o i . o r g / 1 0 . 1 0 0 2 / 9783527647064.ch2 29. Schurer H, Lang K, Schuster J, Morl M (2002) A universal method to produce in vitro transcripts with homogeneous 3′ ends. Nucleic Acids Res 30(12):56e. https://doi.org/10. 1093/nar/gnf055 30. Easton LE, Shibata Y, Lukavsky PJ (2010) Rapid, nondenaturing RNA purification using weak anion-exchange fast performance liquid chromatography. RNA 16(3):647–653. https://doi.org/10.1261/rna.1862210 31. Solomatin S, Herschlag D (2009) Methods of site-specific labeling of RNA with fluorescent dyes. In: Biophysical, chemical, and functional probes of RNA structure, interactions and folding: part B. methods in enzymology, pp 47–68. https://doi.org/10.1016/s0076-6879(09) 69003-0 32. Dauden MI, Jaciuk M, Weis F, Lin TY, Kleindienst C, Abbassi NEH, Khatter H, Krutyholowa R, Breunig KD, Kosinski J, Muller CW, Glatt S (2019) Molecular basis of tRNA recognition by the Elongator complex. Sci Adv 5(7):eaaw2326. https://doi.org/10. 1126/sciadv.aaw2326 33. Kojic M, Gawda T, Gaik M, Begg A, SalernoKochan A, Kurniawan N, Jones AA, Droz˙dz˙yk K, Kos´cielniak A, ChramiecGła˛bik A, Hediyeh-zadeh S, Kasherman M, Shim WJ, Sinniah E, Genovesi L, Abrahamsen R, Fenger C, Madsen C, Cohen J, Fatemi A, Stark Z, Lunke S, Lee J, Hansen J, Boxill M, Keren B, Marey I,

Biophysical Methods to Measure tRNA and Modifying Enzyme Interaction Saenz M, Brown K, Alexander S, Mureev A, Batzilla A, Davis M, Piper M, Bode´n M, Burne T, Palpant N, Moller ES, Glatt S, Wainwright B (2021) Elp2 mutations perturb the epitranscriptome and lead to a complex neurodevelopmental phenotype. Nat Commun 12: 2678. https://doi.org/10.1038/s41467021-22888-5 34. Tian S, Yesselman JD, Cordero P, Das R (2015) Primerize: automated primer assembly

53

for transcribing non-coding RNA domains. Nucleic Acids Res 43(W1):W522–W526. https://doi.org/10.1093/nar/gkv538 35. Tian S, Das R (2017) Primerize-2D: automated primer design for RNA multidimensional chemical mapping. Bioinformatics 33(9):1405–1406. https://doi.org/10.1093/ bioinformatics/btw814

Chapter 4 Mapping of RNase P Ribozyme Regions in Proximity with a Human RNase P Subunit Protein Using Fe(II)-EDTA Cleavage and Nuclease Footprint Analyses Phong Trang, Adam Smith, and Fenyong Liu Abstract Ribonuclease P (RNase P), which may consist of both protein subunits and a catalytic RNA part, is responsible for 5′ maturation of tRNA by cleaving the 5′-leader sequence. In Escherichia coli, RNase P contains a catalytic RNA subunit (M1 RNA) and a protein factor (C5 protein). In human cells, RNase P holoenzyme consists of an RNA subunit (H1 RNA) and multiple protein subunits that include human RPP29 protein. M1GS, a sequence specific targeting ribozyme derived from M1 RNA, can be constructed to target a specific mRNA to degrade it in vitro. Recent studies have shown that M1GS ribozymes are efficient in blocking the expression of viral mRNAs in cultured cells and in animals. These results suggest that RNase P ribozymes have the potential to be useful in basic research and in clinical applications. It has been shown that RNase P binding proteins, such as C5 protein and RPP29, can enhance the activities of M1GS RNA in processing a natural tRNA substrate and a target mRNA. Understanding how RPP29 binds to M1GS RNA and enhances the enzyme’s catalytic activity will provide great insight into developing more robust gene-targeting ribozymes for in vivo application. In this chapter, we describe the methods of using Fe(II)-ethylenediaminetetraacetic acid (EDTA) cleavage and nuclease footprint analyses to determine the regions of a M1GS ribozyme that are in proximity to RPP29 protein. Key words Ribonuclease P (RNase P), Ribozyme, Catalytic RNA, RNA-protein interaction, Nuclease mapping, Gene targeting

1

Introduction Antisense DNA and RNA molecules are promising gene-targeting technology for specific reduction of gene expression [1, 2]. The discovery of catalytic RNAs (ribozymes) created an entire new field of biology from great enthusiasm in understanding the general mechanistic activity of these ribozymes to developing them into specific gene-targeting enzymes [3, 4]. For example, both hammerhead and hairpin ribozymes were engineered to specifically target

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_4, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

55

56

Phong Trang et al.

both viral and cellular mRNAs [5, 6]. Compared to other antisense tools, a ribozyme possesses unique attributes in which it can process multiple copies of substrates and degrade them irreversibly. Thus, ribozymes have the potential to be useful in both basic and clinical research, such as studies of gene function during viral infection and antiviral gene therapy [1, 2]. External guide sequences (EGSs) are sequence-specific RNA molecules that can bind in antisense manner to a target mRNA and recruit ribonuclease P (RNase P) or its catalytic RNA subunit (e.g., M1 ribozyme) to cleave the target RNA. RNase P functions to remove a 5′ leader sequence from tRNA precursors (pre-RNA) and several other small RNAs [7–9]. In Escherichia coli, RNase P consists of a catalytic RNA subunit (M1 RNA) and a protein subunit (C5 protein) [10, 11]. In human cells, RNase P is composed of a RNA subunit, H1 RNA, and at least ten protein subunits, which include RPP29 protein [11, 12]. Similar to C5 protein, RPP29 binds to M1 RNA and enhances its cleavage activity in vitro. RNase P utilizes a unique substrate recognition mechanism in which the enzyme recognizes a part of the common tertiary structure of the pre-tRNA substrates and, therefore, can cleave more than 70 different pre-tRNA molecules of different sequences within a single cell (e.g., pre-tRNAala, pre-tRNAtyr, etc.) [13–15]. All these substrates can fold into a structure similar to the top portion of a pre-tRNA molecule (i.e., a 5′ leader sequence, an acceptorstem like structure, and a 3′ CCA sequence). Deletion analyses of a tRNA substrate have shown that a minimal mRNA substrate containing a structure similar to the acceptor stem and T stem, the 3′ CCA sequence, and the 5′ leader sequence of a pre-tRNA molecule can be processed efficiently by M1 RNA [8, 16]. Thus, in principle, a custom-designed EGS molecule that can bind complementarily to an mRNA and form a structure resembling a portion of the natural tRNA substrates recognizable by RNase P will be subjected to specific cleavage by RNase P and M1 ribozyme [7, 9]. EGSs have been designed to suppress gene expression in bacteria and mammalian cells [17–22] with the aid of either RNase P or M1 RNA. To increase the targeting efficiency, the EGS can conjugate to M1 RNA (e.g., to the 3′ end) to create a sequence-specific ribozyme, M1GS RNA [9, 23]. M1GS RNAs have also been shown to be effective in processing and cleaving mRNA substrates that bound complementarily with the guide sequences in vitro and inhibited gene expression in mammalian cells and in animals [24– 26]. Our laboratory has investigated the mechanism by which the M1GS ribozyme cleaves its mRNA substrates [27–30]. Moreover, we have engineered M1GS RNAs to target the overlapping mRNA region of two human cytomegalovirus (HCMV) capsid proteins, the capsid scaffolding protein (CSP) and assemblin, which are

Interaction of an RNase P Ribozyme with a Human Protein

57

essential for viral capsid formation and infection [31, 32]. The engineered M1GS ribozymes (e.g., M1-C1) greatly reduced the expression levels of viral CSP and assemblin and inhibited HCMV growth in human cells [31]. Thus, M1GS RNA has great potential for gene-targeting applications [9]. Additional studies will be needed to advance RNase P ribozymes as a tool for basic research and clinical applications. One of the most important issues is to increase the enzymatic activity and sequence specificity of M1GS ribozyme in cultured cells and in vivo [9]. Studies have been performed to understand the catalytic mechanism of RNase P and M1 ribozyme in order to increase their cleavage activity [10, 11, 15]. M1 RNA has been well studied, and the model for its secondary structure has been established [13, 33]. The three-dimensional structures of M1 RNA and several other RNase P catalytic RNAs were determined using structural biology approaches [34–36]. Furthermore, the function of C5 protein in facilitating M1 RNA catalytic activity has been extensively studied, and the three-dimensional structures of C5 protein and its homolog in several bacteria have been determined [37– 39]. The structures of several RNase P holoenzymes, which contain both the RNA subunit and protein subunits, have also been investigated [15, 36, 37, 39]. Recent studies on the interactions between M1 RNA and C5 protein indicated that C5 protein functions to stabilize M1 RNA active conformation, enhance enzyme substrate interaction, strengthen substrate specificity, and increase the catalytic activity of M1GS ribozyme [15, 29, 40]. Furthermore, it has been shown that M1GS RNA can interact with cellular proteins, including human RNase P binding proteins [12, 23, 41–43]. For example, human protein RPP29, a protein subunit of human RNase P, can bind to M1 RNA and enhance M1 RNA activity to cleave pre-tRNA substrates [12, 41–43]. Our recent studies showed that RPP29 can increase M1GS ribozyme activity to cleave a HCMV CSP mRNA sequence in vitro by more than tenfold. Human cellular proteins’ interactions with M1GS RNA are believed to stabilize the ribozyme and enhance its activity leading to increased inhibition of gene expression in cells [9]. Several reviews covering the function of C5 protein and its interaction with M1 RNA to achieve cleavage of a natural tRNA substrate have been published [11, 15, 33, 44]. This chapter focuses on using RNase mapping analyses and Fe(II)-ethylenediaminetetraacetic acid (EDTA) cleavage to study the RNA–protein interaction between M1 RNA and human RPP29 protein to understand how RPP29 protein increases the activity of M1GS RNA in cleaving an mRNA substrate.

58

2

Phong Trang et al.

Materials

2.1 Chemicals and Solutions

1. 5 M NaCl. 2. 5 M NaOH. 3. 8 M urea. 4. 0.5 M EDTA. 5. 1 M MgCl2. 6. 1 M Tris–HCl, pH 8.0. 7. 1 M Tris–HCl, pH 7.5. 8. 1 M Tris–HCl, pH 7.0. 9. 10× TBE: 0.89 M Tris–borate, 10 mM EDTA. 10. 5% nondenaturing polyacrylamide gels in 1× TBE. 11. 8% denaturing polyacrylamide gels (acrylamide/bisacrylamide 29:1) that contain 7 M urea in 1× TBE. 12. 4% denaturing polyacrylamide gels (acrylamide/bisacrylamide 29:1) that contain 7 M urea in 1× TBE. 13. Diethyl pyrocarbonate (DEPC)-treated H2O: Double-distilled water is mixed with 0.1% diethylpyrocarbonate (DEPC) (Sigma) and stirred overnight. The DEPC is inactivated by autoclaving for 20 min. 14. γ-[32P]ATP (3000 Ci/mmol) (Perkin Elmer). 15. [32P]pCp (3000 Ci/mmol) (Perkin Elmer). 16. [32P]-labeled nucleotides (Perkin Elmer). 17. 1 M dithiothreitol (DTT). 18. Tris-saturated phenol (pH 6.8) (Therma Fisher). 19. 100 mM Thiourea (Sigma). 20. Chloroform/isoamyl alcohol (24:1).

2.2 Solutions and Buffers

1. Buffer A: 50 mM Tris–HCl, pH 7.5, 100 mM NH4Cl, 100 mM MgCl2, 4% polyethylene glycol (PEG, Molecular Weight 8000). 2. Buffer B: 50 mM Tris–HCl, pH 7.5, 100 mM NH4Cl, 10 mM MgCl2. 3. 10× folding buffer C: 500 mM Tris–HCl, pH 7.5, 1000 mM NH4Cl, and 100 mM MgCl2. 4. Alkaline lysis buffer: 50 mM Na2CO3, pH 9.2, 1 mM EDTA. 5. 2× RNA dye solution: 8 M urea, 20 mM EDTA, 0.25 mg/mL bromophenol blue (BPB), 0.25 mg/mL xylene cyanol FF (XCFF).

Interaction of an RNase P Ribozyme with a Human Protein

2.3 Enzymes and Reagents

59

1. RNasin RNase inhibitor (Promega). 2. T7 RNA Polymerase in vitro transcription system, 5× transcription buffer (Promega). 3. (NH4)2Fe(SO4)2 (Sigma). 4. Polymerase chain reaction (PCR) system including 10× PCR buffer, 25 mM MgCl2, four 10 mM dNTP (deoxyribonucleotide 5′-triphosphate), Taq DNA polymerase (Promega). 5. RNase V1 (Thermo Fisher Scientific). 6. RNase T1 (Thermo Fisher Scientific). 7. S1 nuclease (Promega, Madison, WI). 8. Calf intestine alkaline phosphatase (CIAP) (5000 units/mL) and 10× CIAP buffer (New England Biolabs). 9. T4 polynucleotide kinase and 10× kinase buffer (New England Biolabs). 10. T4 RNA ligase and ligase buffer (New England Biolabs). 11. Thin-layer chromatographic (TLC) plate (silica gel UV256) (Thermo Fisher Scientific).

2.4 RPP29 Protein, RNAs, and Plasmids

1. M1 RNA clone (plasmid FL117) [31]. 2. PCR primers. 3. RPP29 protein (purified as described previously [42, 45]. 4. [32P]-labeled csp38 RNA substrate.

2.5

Equipment Items

1. Automated thermal cycler. 2. Molecular Dynamics PhosphorImager and phosphorimager screens (GE Healthcare). 3. Oligonucleotide synthesis facility. 4. Electrophoresis equipment items. 5. Ultraviolet (UV) lamp.

3

Methods

3.1 Generation of M1GS Ribozyme 3.1.1

DNA Template

The DNA template for generation of M1 ribozyme is constructed using PCR with plasmid FL117 (wild-type M1 cloned into pUC19 vector) [31] as the DNA template and the following oligonucleotides as the primers: 1. 5′ primer (AF25) 5′ GGAATTCTAATACGACTCACTATAG 3′ (containing the T7 promoter sequence). 2. 3′ primer (M1CSP3) 5′ CCCGCTCGAGAAAAAATGGTGT CCGGATGGGAGCGTTATGTGGAATTGTG 3′.

60

Phong Trang et al.

Add the following sequentially: 10 μL 10 PCR buffer (Mg2+ free); 2 μL 10 mM deoxyadenosine 5′-triphosphate (dATP); 2 μL 10 mM deoxythymidine 5′-triphosphate (dTTP); 2 μL 10 mM deoxyguanosine 5′-triphosphate (dGTP); 2 μL 10 mM deoxycytidine 5′-triphosphate (dCTP); 8 μL 25 mM MgCl2; 100 pmol 5′ primer (AF25); 100 pmol 3′ primer (M1CSP3); 1 μg FL117 plasmid; 1 μL Taq DNA polymerase; and PCR-grade water to a final reaction volume of 100 μL. PCR amplification of the DNA template is performed using the following amplification program: Denaturing for 2 min at 94 °C; 30 cycles of denaturing for 2 min at 94 °C, annealing for 1 min at 47 °C, extension for 1 min at 72 ° C, and final extension for 10 min at 72 °C. The PCR DNA products are separated in 5% polyacrylamide gels under nondenaturing conditions. The gel parts that contain the separated PCR products are cut and isolated. The PCR products are purified from the gel parts and used as the template for the in vitro transcription synthesis of the ribozymes (see Note 1). 3.1.2 Synthesis of M1GS Ribozyme

The M1GS ribozyme is synthesized by in vitro transcription. 1. 4 μL (2 μg) M1 DNA from PCR reaction; 8 μL 5× transcription buffer; 4 μL 100 mM DTT; 4 μL 10 mM adenosine 5′-triphosphate (ATP); 4 μL 10 mM guanosine 5′-triphosphate (GTP); 4 μL 10 mM cytosine 5′-triphosphate (CTP); 4 μL 10 mM uridine 5′-triphosphate (UTP); 4 μL H2O; 1 μL RNasin (5 U/μL); 2 μL T7 RNA polymerase. 3. Incubate the reaction mixture at 37 °C for 4 h or overnight. 2. Add an equal volume of 2× RNA dye solution and load onto 8% polyacrylamide-7 M urea gels. 3. Place the gel on a thin-layer chromatographic (TLC) plate (silica gel UV256). Visualize RNA bands by briefly shadowing with a shortwave ultraviolet (UV) lamp. Extract RNA from the excised gel slice by the crush-soak method using DEPC-treated water (see Note 2).

3.2 Ribozyme Activity Assay—In Vitro Cleavage of an mRNA Substrate by M1GS RNA With and Without RPP29 Protein 3.2.1 M1GS Cleavage of Substrate csp38 In Vitro Without Rpp29

For M1GS ribozyme cleavage of the CSP mRNA substrate csp38 in vitro in the absence of Rpp29 [31]: 1. Mix 10 nM of M1GS ribozyme that has been allowed to fold properly (see Note 3) and 10 nM of [32P]-labeled csp38 mRNA (see Note 4), 1 μL of 10× buffer A, and water in a final volume of 10 μL. 2. Incubate the reaction mixture at 37 °C for 30 min. 3. Terminate the reaction by adding 10 μL of 2× RNA dye solution and 1 μL of phenol. Incubate at 90 °C for 2 min. Load onto an 8% polyacrylamide-7 M urea gel and electrophorese for 1–2 h.

Interaction of an RNase P Ribozyme with a Human Protein

61

4. Expose the gel to a phosphor screen and scan with a PhosphorImager (see Note 5). 3.2.2 M1GS Ribozyme Cleavage of Substrate csp38 In Vitro with RPP29

1. Mix 1 nM of M1GS that has been allowed to fold properly (see Note 3) and 10 nM of RPP29 protein and incubate the mixture at 37 °C under the normal physiological temperature for 5 min to allow binding. Then add to the mixture 10 nM of 32 P-labeled csp38 mRNA, 1 μL of 10× buffer B, and water in a final volume of 10 μL. 2. Incubate the reaction mixture at 37 °C for 30 min. 3. Terminate the reaction by adding 10 μL of 2× RNA dye solution and 1 μL of phenol. Incubate at 90 °C for 2 min. Load onto an 8% polyacrylamide-7 M urea gel. 4. Expose the gel to a phosphor screen and scan with a PhosphorImager (see Note 5).

3.3 Nuclease Cleavage Footprint Analysis to Determine the Regions of M1GS RNA Potentially in Close Contact with RPP29 Protein

Dephosphorylate M1GS ribozyme by adding the following (final reaction volume is 30 μL):

3.3.1 Dephosphorylation of M1GS Ribozyme

Incubate at 37 °C for 1 h. Bring the volume to 100 μL with DEPC H2O. The RNA samples are extracted using phenol and chloroform, followed by ethanol precipitation.

3.3.2 5′ End Labeling with γ-[32P] ATP

Perform 5′-end labeling with γ-[32P] ATP by adding the following:

1. 3 μL of 10× CIAP buffer. 2. 27 μL of M1GS RNA and water (at least 20 pmol). 3. 0.5 μL of RNasin. 4. 1 μL of CIAP.

1. 2 μL of 10× T4 polynucleotide kinase buffer. 2. 10 μL of dephosphorylated M1GS RNA from Subheading 3.3.1 (at least 10 pmol and water). 3. 3 μL of γ-[32P] ATP (at least 10 pmol). 4. 1 μL of RNasin. 5. 1 μL of T4 polynucleotide kinase. 6. 5 μL of DEPC H2O. Incubate the mixture at 37 °C for 1 h. Add 20 μL of 2× RNA dye, load on 4% denaturing polyacrylamide gel, and extract the [32P]-labeled M1 RNA as above (see Notes 2 and 3).

3.3.3 3′ End Labeling with [32P]-pCp

Perform 3′-end labeling with [32P]-pCp (reaction volume of 15 μL) by adding the following: 1. 5 μL 3× T4 RNA ligase buffer. 2. 1 μL of 100 mM ATP.

62

Phong Trang et al.

3. 5 μL of dephosphorylated M1GS RNA from Subheading 3.3.1 (at least 10 pmol). 4. [32P]-pCp. 5. 1 μL of T4 RNA ligase. Incubate the reaction at 4 °C for 16 h. Add 30 μL of 2× RNA dye, load on 4% denaturing polyacrylamide gel, and purify as above (see Note 3). 3.3.4

RNase Mapping

RNase mapping is carried out in the following steps: 1. Either 5′ or 3′ end-labeled M1GS ribozyme (about 10,000 cpm per sample) is incubated in a volume of 10–20 μL (see Note 6) in buffer A (in the absence of Rpp29 protein) and in buffer B containing 0.25 μM Rpp29 protein (in the presence of Rpp29 protein, with the ribozyme and Rpp29 ratio of 1:10) for 30 min at 37 °C. 2. Add 0.5 μL of a diluted RNases T1, V, or S1 to the incubated mixture (see Note 7), and the reactions are incubated for various length of time at 37 °C: T1 for 8 min; V for 10 min; S1 for 30 min. 3. The reactions are stopped by adding phenol (50 μL) and chloroform (50 μL). The aqueous phase containing the RNA samples is recovered from the phenol/chloroform extraction step by microcentrifugation. 4. Precipitate the RNA using ethanol and resuspend it in 6 μL of DEPC H2O and 6 μL of 2× RNA dye. Run the samples on 8% denaturing acrylamide gels along with T1 and A control (see below). Dry gel and expose it to a phosphor screen and scan with a PhosphorImager (see Note 8).

3.3.5

T1 Control

For T1 control, a partial digestion of RNA sample with RNase T1 under denaturing conditions is performed: Add 5′- or 3′-labeled M1GS RNA substrate (about 50,000 cpm) to 20 μL of 0.5× RNA dye buffer as a denaturing buffer. Add 2 μL of a 1:10 dilution of RNase T1 to the solution, incubate for 5–10 min at 50 °C, and put on ice immediately (see Note 9). The sample is now ready for gel electrophoresis. This serves as a control for the reference of the nucleotide position of M1GS RNA in the gel.

3.3.6 Alkaline Hydrolysis Control

For the alkaline hydrolysis control (A control): Make a nucleotide size ladder by alkaline hydrolysis of the RNA substrate. 1. Dry 1 μL of each 3′ and 5′ end-labeled M1GS RNA (about 100,000 cpm each) in a SpeedVac (see Note 10). 2. Resuspend dried sample into 20 μL of alkaline lysis buffer. Resuspend well and transfer to another Eppendorf tube (see Note 11).

Interaction of an RNase P Ribozyme with a Human Protein

63

3. Incubate at 95–100 °C for 7 min. 4. The samples are precipitated in ethanol and resuspended in 20 μL of 1× RNA dye. 3.4 Fe(II)-EDTAMediated Mapping of the M1GS RNA Regions Potentially Interacting with RPP29 Protein

The Fe(II)-EDTA mapping technique has been used extensively to study the tertiary structures of the group I intron ribozyme and RNase P RNA and M1 RNA–tRNA interactions [29, 46]. The cleavage of nucleic acids by this method is largely independent of base identity or secondary structure. Therefore, Fe(II)-EDTA mapping can be used to probe the tertiary interaction of M1GS RNA and RPP29 protein [29, 46]. 1. Either 3′ or 5′ end-labeled M1GS ribozyme is incubated in a volume of 10–20 μL in the absence and presence of RPP29 protein (ribozyme and RPP29 molar ratio of 1:10) (buffer A or B) for 30 min at 37 °C. 2. The mixture is then added with 2.5 mM DTT, 2 mM (NH4)2Fe(SO4)2, and 4 mM EDTA using 10× stock solutions (25 mM DTT, 20 mM (NH4)2Fe(SO4)2, 40 mM EDTA). 3. The entire mixture is incubated for 60 min at 37 °C. 4. 1 μL of thiourea (100 mM) is added to the mixture to stop the reaction. 5. The samples are processed with phenol/chloroform extraction, and then ethanol is precipitated and resuspended in 10 μL DEPC H2O and 10 μL of 2× RNA dye. 6. Load and run the samples along with T1 and A control on 8% denaturing acrylamide gel. 7. Dry the gel and expose it to a phosphor screen and scan with a PhosphorImager (see Note 8).

4

Notes 1. The DNA bands are visualized with ethidium bromide (EtBr) staining. The gel slices that contain the DNAs are crushed in an Eppendorf tube with a minihomogenizer bar and then soaked in DNase-free water for 30 min at room temperature. Microcentrifugation is used to separate the PCR DNA product fractions in the soaked tube from the crushed gel slices. We extract the DNA-containing supernatants with phenol/chloroform solutions twice, and then, the PCR DNA products are precipitated in the presence of ethanol. We usually recover at least 50% of the DNAs using this extraction procedure. 2. Because RNA is extremely sensitive to degradation, this gel-running step should be completely RNase free. We recommend that DEPC-treated water is used for the entire

64

Phong Trang et al.

gel-running process including making the gel and preparing the running buffer. We use denaturing gels containing 8 M urea to separate and purify the M1GS ribozymes that are in vitro synthesized by T7 RNA polymerase. The gel slices that contain the ribozyme fractions are crushed in an Eppendorf tube with a minihomogenizer bar and then soaked in RNase-free water for 20 min in ice. Precautions should be taken to avoid degradation of RNA as a result of RNase contamination. Since most RNases do not require divalent cations, we do not recommend to soak the gel crush with TE buffer. We use microcentrifugation to separate the M1GS ribozyme fractions in the soaked tube from the crushed gel slices. We extract the ribozyme-containing supernatants with phenol/chloroform solutions twice, and then, the ribozymes are precipitated in the presence of ethanol. The RNA samples are resuspended in folding buffer C (~10–50 μL). We usually get a yield of at least 50% of the RNA samples. 3. Properly folded ribozymes that are enzymatically active are needed for the in vitro cleavage assays. Furthermore, in order to study the interactions of RPP29 with functional ribozymes with an active conformation, we use properly folded ribozymes in the RNase mapping and Fe(II)- EDTA footprinting analyses. We resuspend the ribozyme in 1× folding buffer C, incubate the mixture at 65 °C for 5 min, and then allow folding to occur by gradually lowering the temperature to 37 °C. This treatment will allow most ribozyme to fold into proper active conformations. 4. RNA substrate csp38 is synthesized and radiolabeled by in vitro transcription in the presence of α-[32P]-GTP, with the PCR DNA products as the template, following the procedure described previously [19, 31]. 5. Because substrate csp38 is internally radiolabeled, cleavage of the RNA substrate by the RNase P ribozyme generates two cleavage products that are detected using a phosphorimager [31]. As RPP29 enhances the M1GS cleavage reaction, more cleavage products are observed in the presence of RPP29 than in the absence of RPP29. 6. Because M1GS ribozyme is more than 370 nucleotides long, we use both the 3′ and the 5′ end-labeled ribozymes in our analysis to cover the full-length M1GS RNA sequence. Furthermore, we use 4–10% polyacrylamide gels containing 8 M urea in the analysis. 7. We dilute RNase T1, V, and S1 in the buffers used for RNase digestion (buffers A and B) to 1:10, 1:100, and 1:1000 for use in the reaction. We also dilute the RNases into DEPC-treated water prior to their use. The RNase dilution varies to

Interaction of an RNase P Ribozyme with a Human Protein

65

correspond to the incubation time the user prefers: low concentrations for longer incubation times and vice versa. The starting concentrations of the nucleases we used range from 2 units/μL to 50 units/μL. 8. If the regions of the ribozymes are bound to the RPP29 protein, they will be protected from digestion of nucleases and Fe(II)-EDTA cleavage. In our experiments, less cleavage by the nucleases and Fe(II)-EDTA is found in the regions of the ribozymes that are bound by RPP 29. By comparing the levels of cleavage at a ribozyme region by the nuclease and Fe (II)-EDTA in the absence and presence of RPP29, we hope to determine if this region is in close proximity to the protein. 9. Placing the reaction on ice immediately is necessary to stop the RNase T1 digestion. This digestion sample can be reused if it is stored at 4 °C. 10. We usually generate alkaline hydrolysis controls using both 5′ and 3′ end-labeled M1GS RNA in order to obtain excellent size markers for experiments with the 5′ and 3′ end-labeled ribozymes, respectively. 11. This step is necessary to remove excess salt that may precipitate in the original tube.

Acknowledgments We are grateful to Hao Gong, Eduardo Lujan, and Isadora Zhang for critical comments, reagents, and technical assistance. This research has been supported by a start-up fund from the University of California at Berkeley. Conflict of Interest Statement The authors declare that all authors declare no competing financial interests.

References 1. Burnett JC, Rossi JJ (2012) RNA-based therapeutics: current progress and future prospects. Chem Biol 19(1):60–71. https://doi.org/10. 1016/j.chembiol.2011.12.008 2. Setten RL, Rossi JJ, Han SP (2019) The current state and future directions of RNAi-based therapeutics. Nat Rev Drug Discov 18(6): 421–446. https://doi.org/10.1038/s41573019-0017-4 3. Guerrier-Takada C, Gardiner K, Marsh T, Pace N, Altman S (1983) The RNA moiety of ribonuclease P is the catalytic subunit of the

enzyme. Cell 35(3 Pt 2):849–857. https:// doi.org/10.1016/0092-8674(83)90117-4 4. Kruger K, Grabowski PJ, Zaug AJ, Sands J, Gottschling DE, Cech TR (1982) Selfsplicing RNA: autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena. Cell 31(1):147–157. https:// doi.org/10.1016/0092-8674(82)90414-7 5. Sarver N, Cantin EM, Chang PS, Zaia JA, Ladne PA, Stephens DA, Rossi JJ (1990) Ribozymes as potential anti-HIV-1 therapeutic

66

Phong Trang et al.

agents. Science 247(4947):1222–1225. https://doi.org/10.1126/science.2107573 6. Yu M, Ojwang J, Yamada O, Hampel A, Rapapport J, Looney D, Wong-Staal F (1993) A hairpin ribozyme inhibits expression of diverse strains of human immunodeficiency virus type 1. Proc Natl Acad Sci U S A 90(13):6340–6344. https://doi.org/10. 1073/pnas.90.13.6340 7. Altman S (1995) RNase P in research and therapy. Biotechnology (N Y) 13(4):327–329. https://doi.org/10.1038/nbt0495-327 8. Forster AC, Altman S (1990) External guide sequences for an RNA enzyme. Science 249(4970):783–786. https://doi.org/10. 1126/science.1697102 9. Kim K, Liu F (2007) Inhibition of gene expression in human cells using RNase P-derived ribozymes and external guide sequences. Biochim Biophys Acta 1769(11–12):603–612. https://doi.org/10.1016/j.bbaexp.2007. 09.001 10. Evans D, Marquez SM, Pace NR (2006) RNase P: interface of the RNA and protein worlds. Trends Biochem Sci 31(6):333–341. https://doi.org/10.1016/j.tibs.2006.04.007 11. Gopalan V, Vioque A, Altman S (2002) RNase P: variations and uses. J Biol Chem 277(9):6759–6762. https://doi.org/10. 1074/jbc.R100067200 12. Jarrous N (2017) Roles of RNase P and its subunits. Trends Genet 33(9):594–603. https://doi.org/10.1016/j.tig.2017.06.006 13. Altman S, Kirsebom L, Talbot S (1993) Recent studies of ribonuclease P. FASEB J 7(1):7–14. https://doi.org/10.1096/fasebj.7.1.7916700 14. Frank DN, Pace NR (1998) Ribonuclease P: unity and diversity in a tRNA processing ribozyme. Annu Rev Biochem 67:153–180. https://doi.org/10.1146/annurev.biochem. 67.1.153 15. Mondragon A (2013) Structural studies of RNase P. Annu Rev Biophys 42:537–557. https://doi.org/10.1146/annurev-biophys083012-130406 16. McClain WH, Foss K, Schneider J, GuerrierTakada C, Altman S (1987) Suppressor and novel mutants of bacteriophage T4 tRNA (Gly). J Mol Biol 193(1):223–226. https:// doi.org/10.1016/0022-2836(87)90640-1 17. Guerrier-Takada C, Li Y, Altman S (1995) Artificial regulation of gene expression in Escherichia coli by RNase P. Proc Natl Acad Sci U S A 92(24):11115–11119. https://doi. org/10.1073/pnas.92.24.11115 18. Guerrier-Takada C, Salavati R, Altman S (1997) Phenotypic conversion of drug-

resistant bacteria to drug sensitivity. Proc Natl Acad Sci U S A 94(16):8468–8472. https:// doi.org/10.1073/pnas.94.16.8468 19. Jiang X, Chen YC, Gong H, Trang P, Lu S, Liu F (2012) Ribonuclease P-mediated inhibition of human cytomegalovirus gene expression and replication induced by engineered external guide sequences. RNA Biol 9(9):1186–1195. https://doi.org/10.4161/rna.21724 20. Kawa D, Wang J, Yuan Y, Liu F (1998) Inhibition of viral gene expression by human ribonuclease P. RNA 4(11):1397–1406. https://doi. org/10.1017/s1355838298980918 21. McKinney JS, Zhang H, Kubori T, Galan JE, Altman S (2004) Disruption of type III secretion in Salmonella enterica serovar Typhimurium by external guide sequences. Nucleic Acids Res 32(2):848–854. https://doi.org/10. 1093/nar/gkh219 22. Yuan Y, Hwang ES, Altman S (1992) Targeted cleavage of mRNA by human RNase P. Proc Natl Acad Sci U S A 89(17):8006–8010. https://doi.org/10.1073/pnas.89.17.8006 23. Liu F, Altman S (1995) Inhibition of viral gene expression by the catalytic RNA subunit of RNase P from Escherichia coli. Genes Dev 9(4):471–480. https://doi.org/10.1101/ gad.9.4.471 24. Bai Y, Gong H, Li H, Vu GP, Lu S, Liu F (2011) Oral delivery of RNase P ribozymes by Salmonella inhibits viral infection in mice. Proc Natl Acad Sci U S A 108(8):3222–3227. https://doi.org/10.1073/pnas.1014975108 25. Bai Y, Trang P, Li H, Kim K, Zhou T, Liu F (2008) Effective inhibition in animals of viral pathogenesis by a ribozyme derived from RNase P catalytic RNA. Proc Natl Acad Sci U S A 105(31):10919–10924. https://doi.org/ 10.1073/pnas.0804922105 26. Trang P, Lee M, Nepomuceno E, Kim J, Zhu H, Liu F (2000) Effective inhibition of human cytomegalovirus gene expression and replication by a ribozyme derived from the catalytic RNA subunit of RNase P from Escherichia coli. Proc Natl Acad Sci U S A 97(11): 5812–5817. https://doi.org/10.1073/pnas. 100101797 27. Hsu AW, Kilani AF, Liou K, Lee J, Liu F (2000) Differential effects of the protein cofactor on the interactions between an RNase P ribozyme and its target mRNA substrate. Nucleic Acids Res 28(16):3105–3116. https://doi.org/10.1093/nar/28.16.3105 28. Kilani AF, Liu F (1999) UV cross-link mapping of the substrate-binding site of an RNase P ribozyme to a target mRNA sequence. RNA

Interaction of an RNase P Ribozyme with a Human Protein 5(9):1235–1247. https://doi.org/10.1017/ s1355838299990672 29. Kim JJ, Kilani AF, Zhan X, Altman S, Liu F (1997) The protein cofactor allows the sequence of an RNase P ribozyme to diversify by maintaining the catalytically active structure of the enzyme. RNA 3(6):613–623 30. Trang P, Hsu AW, Liu F (1999) Nuclease footprint analyses of the interactions between RNase P ribozyme and a model mRNA substrate. Nucleic Acids Res 27(23):4590–4597. https://doi.org/10.1093/nar/27.23.4590 31. Bai Y, Li H, Vu GP, Gong H, Umamoto S, Zhou T, Lu S, Liu F (2010) Salmonellamediated delivery of RNase P-based ribozymes for inhibition of viral gene expression and replication in human cells. Proc Natl Acad Sci U S A 107(16):7269–7274. https://doi.org/10. 1073/pnas.0912813107 32. Dunn W, Chou C, Li H, Hai R, Patterson D, Stolc V, Zhu H, Liu F (2003) Functional profiling of a human cytomegalovirus genome. Proc Natl Acad Sci U S A 100(24): 14223–14228. https://doi.org/10.1073/ pnas.2334032100 33. Kazantsev AV, Pace NR (2006) Bacterial RNase P: a new view of an ancient enzyme. Nat Rev Microbiol 4(10):729–740. https:// doi.org/10.1038/nrmicro1491 34. Kazantsev AV, Rambo RP, Karimpour S, Santalucia J Jr, Tainer JA, Pace NR (2011) Solution structure of RNase P RNA. RNA 17(6): 1159–1171. https://doi.org/10.1261/rna. 2563511 35. Krasilnikov AS, Yang X, Pan T, Mondragon A (2003) Crystal structure of the specificity domain of ribonuclease P. Nature 421(6924): 7 6 0 – 7 6 4 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / nature01386 36. Reiter NJ, Osterman A, Torres-Larios A, Swinger KK, Pan T, Mondragon A (2010) Structure of a bacterial ribonuclease P holoenzyme in complex with tRNA. Nature 468(7325):784–789. https://doi.org/10. 1038/nature09516 37. Kazantsev AV, Krivenko AA, Harrington DJ, Carter RJ, Holbrook SR, Adams PD, Pace NR (2003) High-resolution structure of RNase P protein from Thermotoga maritima. Proc Natl Acad Sci U S A 100(13):7497–7502. https://doi.org/10.1073/pnas.0932597100

67

38. Stams T, Niranjanakumari S, Fierke CA, Christianson DW (1998) Ribonuclease P protein structure: evolutionary origins in the translational apparatus. Science 280(5364):752–755. https://doi.org/10.1126/science.280. 5364.752 39. Tsai HY, Masquida B, Biswas R, Westhof E, Gopalan V (2003) Molecular modeling of the three-dimensional structure of the bacterial RNase P holoenzyme. J Mol Biol 325(4): 661–675. https://doi.org/10.1016/s00222836(02)01267-6 40. Niranjanakumari S, Stams T, Crary SM, Christianson DW, Fierke CA (1998) Protein component of the ribozyme ribonuclease P alters substrate recognition by directly contacting precursor tRNA. Proc Natl Acad Sci U S A 95(26):15212–15217. https://doi.org/10. 1073/pnas.95.26.15212 41. Mann H, Ben-Asouli Y, Schein A, Moussa S, Jarrous N (2003) Eukaryotic RNase P: role of RNA and protein subunits of a primordial catalytic ribonucleoprotein in RNA-based catalysis. Mol Cell 12(4):925–935. https://doi.org/ 10.1016/s1097-2765(03)00357-5 42. Reiner R, Alfiya-Mor N, Berrebi-Demma M, Wesolowski D, Altman S, Jarrous N (2011) RNA binding properties of conserved protein subunits of human RNase P. Nucleic Acids Res 39(13):5704–5714. https://doi.org/10. 1093/nar/gkr126 43. Sharin E, Schein A, Mann H, Ben-Asouli Y, Jarrous N (2005) RNase P: role of distinct protein cofactors in tRNA substrate recognition and RNA-based catalysis. Nucleic Acids Res 33(16):5120–5132. https://doi.org/10. 1093/nar/gki828 44. Hsieh J, Andrews AJ, Fierke CA (2004) Roles of protein subunits in RNA-protein complexes: lessons from ribonuclease P. Biopolymers 73(1):79–89. https://doi.org/10.1002/bip. 10521 45. Jarrous N, Altman S (2001) Human ribonuclease P. Methods Enzymol 342:93–100. https:// doi.org/10.1016/s0076-6879(01)42538-9 46. Celander DW, Cech TR (1991) Visualizing the higher order folding of a catalytic RNA molecule. Science 251(4992):401–407. https:// doi.org/10.1126/science.1989074

Chapter 5 SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro Kaushik Saha and Gourisankar Ghosh Abstract Selective 2′ hydroxyl acylation analyzed by primer extension (SHAPE) is used to distinguish between the levels of flexibility of nucleotides regulated by base pairing or protein binding. In this method, a reagent reacts with the 2′ hydroxyl group to form an adduct, which is then detected by reverse transcription reaction. The number of RNA molecules with an adduct at a specific nucleotide position indicates the SHAPE reactivity of that nucleotide. Here, we describe the method for probing the structure of an RNA in a protein-free or a protein-bound state by in vitro SHAPE. Key words Selective 2′ hydroxyl acylation analyzed by primer extension (SHAPE), RNA structure, RNA–protein interaction, Sequencing gel, RNA end-labeling, Phosphorimaging, Reverse transcription

1

Introduction RNA structure plays a pivotal role in the functionalities of RNA [1]. A variety of chemical approaches have been successfully used to probe the structure of RNA [2]. In SHAPE, the reactivity of the reagent is independent of the nucleotide identity and correlates well with the local nucleotide flexibility [3], which, in turn, is regulated by either base pairing or protein binding. Once the RNA is reacted with the SHAPE reagent, the reactive nucleotides are identified by reverse transcription. The nucleotide that has formed an adduct upon reaction with the SHAPE reagent acts as a reverse transcriptase drop off site, thus, producing a truncated cDNA. Each of the truncated cDNAs is then quantified, and the level of accumulated RT stops at each nucleotide position indicates the SHAPE reactivity of that nucleotide. The cDNAs can be quantified in one of three ways. First, they can be resolved on a sequencing gel and quantified. However, the limited resolution per primer (~100 nucleotides) and manual handling of each step make this technique highly

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_5, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

69

70

Kaushik Saha and Gourisankar Ghosh

demanding in terms of time required to perform the experiment and analysis. Resolution of the cDNAs using capillary electrophoresis is more streamlined but requires expensive capillary electrophoresis apparatus. The cDNAs can also be quantified by massively parallel sequencing of the truncated cDNAs, which is limited by multistep library preparation involving adapter ligation and low read-count. In contrast to synthesis of truncated cDNAs, a lenient reverse transcription condition can be used to introduce mutations at the reacted nucleotides followed by deep sequencing of the amplicons obtained from the mutated cDNAs. The latter method, known as SHAPE-MaP (SHAPE by mutational profiling) [4], provides a high-throughput method for SHAPE analysis for a large number of RNAs. However, the latter method requires basic bioinformatic skills to run the mutation-counting pipeline on Ubuntu. In our laboratory, we observed that both the electrophoretic method [5] and the next-generation sequencing-based mutational profiling [6] produce comparable results. In this chapter, we will discuss the method for SHAPE using sequencing gel. In another chapter, we will discuss in-cell SHAPE using the SHAPEMaP technique, which can also be applied to in vitro SHAPE.

2

Materials Only use ultrapure water with a resistance of at least 18.0 Ω for all procedure. For working with RNA, all solutions and reagents must be free from RNase contamination. Use barrier tips for pipetting. RNA should be stored in nonalkaline buffer or water at -80 °C.

2.1

RNA Folding

1. 500 mM EDTA adjusted to pH 8.0 with NaOH, filtersterilized and autoclaved (see Note 1). 2. 5 M NaCl, filter-sterilized and autoclaved. 3. 1 M MgCl2, filter-sterilized and autoclaved. 4. 1 M HEPES-NaOH, pH 7.5, filter-sterilized, stored in the dark at 4 °C (HEPES solution is light-sensitive). 5. 13% Poly (vinyl chloride) (PVA, Sigma P-8136) solution, autoclaved and stored at -20 °C.

2.2

SHAPE Assay

1. A wide variety of SHAPE reagents are now developed; a significant proportion of which are available commercially. 1-Methyl-7-nitroisatoic anhydride (1 M7, Sigma 908,401), 2-Methylnicotinic acid imidazolide (NAI, Sigma 913,839), and N-Methylisatoic anhydride (NMIA, Sigma 129,887) are three of the most commonly used SHAPE reagents. All three reagents work well in vitro [7]. Of these reagents, 1 M7 exhibits a fast turnover while NMIA and NAI a slow turnover.

SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro

71

Therefore, 1 M7 may be more suitable for examining a dynamic process while NMIA or NAI for examining thermodynamically stable structural features. 2. Anhydrous dimethyl sulfoxide (DMSO) (see Note 2). 3. 1,4-dithiothreitol (DTT) (if using NAI). 4. 9 M urea solution. 5. Proteinase K (20 mg/mL) (New England Biolabs) (if examining interactions with a protein). 6. Glycogen solution (20 mg/mL) prepared from solid glycogen (Thermo Fisher Scientific, AAJ1644514) and stored at -20 °C. 7. 3 M sodium acetate, pH 5.2, filtered and autoclaved. 8. An RNA purification kit (e.g., Monarch RNA cleanup kit, New England Biolabs, T2030L). 9. Nanodrop spectrophotometer (Thermo Fisher Scientific). 2.3 Reverse Transcription

1. Superscript III (Thermo Fisher Scientific) or Super RT (Biobharati Life science) (we found both enzymes to have comparable activities. 2. PAGE-purified (a value-added service provided by most nucleic acid synthesis companies) reverse transcription primers (~20nt) spaced ~75 nucleotides apart on the RNA starting from the 3′ end of the RNA (see Note 3). 3. γP32-ATP (6000 mCi/mmol, 10 μCi/μL) (see Note 4). 4. T4 polynucleotide kinase and 10× kinase buffer (New England Biolabs). 5. 10 mM dNTP mix (a mix of 10 mM dATP, dTTP, dCTP, and dGTP). 6. RNase Inhibitor (40 U/μL) (New England Biolabs or Thermo Fisher Scientific or Biobharati Life Science). 7. Sephadex G25 disposable columns (e.g., Illustra MicroSpin G-25 Columns, Cytiva, 27,532,501). 8. Deionized formamide (conductivity: 19–34 μS/cm, for example, Thermo Fisher Scientific, 4,311,320). 9. Formamide dye (95% deionized formamide, 0.5 mM EDTA, trace level bromophenol blue, trace level xylene cyanol). 10. Microcentrifuge. 11. Heat block. 12. Thermocycler. 13. Vortexer/whirlmixer fitted with a microfuge tube holder, for example, Vortex Genie (Scientific Industries, SI-0236) fitted with a Microtube Foam Insert (Scientific Industries, 504-0234-00).

72

Kaushik Saha and Gourisankar Ghosh

2.4 Sequencing Gel and Imaging

1. Sequencing gel apparatus with ~0.4 mm spacer and combs and 0.17 mm flat-head gel-loading tips. The sequencing gel apparatus can be obtained from Fisher Scientific (FB-SEQ-3545) or CBS Scientific (SG-400-20). Flat-head gel-loading tips can be obtained from USA Scientific (1022-2610) or Biopioneer (GSO1735). 2. 40% solution of acrylamide and bis-acrylamide monomers in 29:1 ratio (see Note 5). 3. 10× Tris-borate-EDTA (TBE) buffer (108 g Tris, 55 g boric acid, 40 mL 0.5 M EDTA, pH 8.0 to 1 L water)—filtered and autoclaved. 4. Freshly prepared 10% ammonium persulfate solution (see Note 6). 5. N,N,N′,N′-Tetramethylethylenediamine (TEMED). 6. A siliconizing solution, such as Sigmacote (Sigma SL2-25ML). 7. Solid urea. 8. Microwave oven. 9. Stir plate. 10. Small stir bar. 11. 100 mL glass beaker. 12. 100 mL measuring cylinder. 13. A heat- and liquid-resistant adhesive tape, such as 3 M 471 adhesive tape. 14. Extra-large binder clips. 15. Clear plastic wrap. 16. Storage phosphor screen (35 × 43 cm) (Cytiva, 28,956,475) and exposure cassette (Cytiva, 63,003,545). 17. Phosphorimager (e.g., Typhoon, Cytiva). 18. Ludlum general purpose radioactivity survey meter fitted with a pancake detector. 19. Scintillation counter. 20. Scintillation liquid. 21. Scintillation vials.

3 3.1

Methods SHAPE Assay

1. Prepare two samples for each SHAPE measurement—one to be treated with the SHAPE reagent dissolved in DMSO and the other with the vehicle (DMSO).

SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro

73

2. Prepare 250 μL RNA solution in 5 mM EDTA, pH 8.0 and 50 mM NaCl. For RNA transcribed in vitro, up to 800 nM RNA solution may be prepared. For RNA extracted from cells, a lower concentration may be used (see Note 7). 3. Incubate the solution at 95 °C for 3 min and then immediately place on ice. Leave the tube on ice for at least 5 min. 4. Add 1.25 μL 1 M MgCl2 to the tube to neutralize EDTA. 5. Add the buffer ingredients (20 mM HEPES, pH 7.5, 250 mM NaCl, 4 mM MgCl2, 0.3% PVA) to the RNA solution. If SHAPE assay for testing protein binding is being performed, the desired concentration of protein should be added. In the latter case, RNA also needs to be mock-treated with the protein-storage buffer as a control. Adjust the final reaction volume to 1 mL. RNA concentration in the reaction mixture should be empirically determined, in particular when its interaction with a protein is being examined. For protein-free in vitro-transcribed RNA, 100 nM is a good starting concentration for RNA. At this concentration, a reaction carried out in 1 mL volume will produce enough treated RNA to optimize the reverse transcription reaction (see Notes 8 and 9). 6. Freshly prepare a stock solution of the SHAPE reagent in DMSO. 1 M7 or NMIA can be prepared at 100 mM and NAI at 2 M (see Note 10). 7. Transfer 950 μL RNA solution to 50 μL 100 mM SHAPE reagent and mix immediately. The concentration of SHAPE reagent for optimal level of reactivity should be empirically determined for each RNA. 5 mM 1 M7 or NMIA or 100 mM NAI is a good starting point. Parallelly, another aliquot of the RNA solution should also be transferred to the same volume of DMSO and mixed immediately. 8. Incubate the RNA at 37 °C for 75 s for 1 M7, 22 min for NMIA, or 15 min for NAI. While first two reagents are selfquenching, NAI needs to be quenched by adding DTT to a final concentration of 125 mM (see Note 11). 9. If protein is added, add 9 M urea solution up to a final concentration of 1.5 M after SHAPE reaction is complete. Then, add 100 μg of proteinase K per 1 mL reaction, mix, and incubate at 37 °C for 30 min. 10. Next, add one-tenth volume of 3 M sodium acetate pH 5.2 (final concentration 0.3 M) and mix. Eighty micrograms of glycogen per milliliter of reaction may also be added to facilitate RNA precipitation. Finally, aliquot the solution into three equal portions (~366 μM) and add 2.5 times volume of ethanol. (see Note 12). Mix well and incubate at -20 °C for at least 1 h.

74

Kaushik Saha and Gourisankar Ghosh

11. Next, centrifuge the reaction at top speed at 4 °C. Discard the supernatant up to the last drop. 12. Dissolve the pellet in 30 μL water. There is no need to air-dry or wash with chilled 70% ethanol. Purify the RNA by Monarch RNA cleanup kit. 13. Measure the RNA concentration using a spectrophotometer, preferably a Thermo Fisher Scientific Nanodrop, since Nanodrop uses only 1 μL of sample for accurate absorbance measurement, thus, conserving sample. 14. Store the RNA at -80 °C. 3.2 5′-End Labeling of Reverse Transcription Primers

1. Combine the following in a single tube: 12 μL water, 10 pmol primer, 2–4 μL γP32 ATP, 2 μL 10× kinase buffer, 1 μL 100 mM DTT, 2 μL T4 polynucleotide kinase (10 U/mL), and water up to 20 μL volume. (see Notes 13 and 14). 2. Incubate the reaction at 37 °C for 30 min on a heat block. 3. Stop the reaction by adding EDTA to 1 mM (1 μL 20 mM EDTA) and then heating to 65 °C for 10 min. Add 29 μL water to the reaction to make the reaction volume 50 μL, the minimum volume required for Illustra spin columns. 4. For preparing the Illustra spin columns, centrifuge the fresh columns after breaking the seal at 735 × g for 1 min at room temperature and discard the flow-through. Thereafter, transfer the column to a fresh microfuge tube, dispense the radioactive sample onto the resin bed, and centrifuge the column for 2 min at the same speed to collect the purified end-labeled DNA. 5. Measure radioactivity of 1 μL of DNA by scintillation counting.

3.3 Reverse Transcription

1. For reverse transcription with each primer, 500–1000 cpm primer should be used, depending on the efficiency of reverse transcription from that primer. 2. Mix the following in a 0.2 mL PCR tube: X μL primer, 2 pmol RNA, 3 μL dNTP (10 mM each), water up to 15 μL. 3. Incubate the tube in a thermocycler at 65°C for 5 min and then ramp down the temperature to 4 °C as quickly as possible. Leave it at 4 °C for at least 5 min. 4. Collect the liquid at the bottom of the tube by brief centrifugation. Do not centrifuge PCR tubes at a speed higher than 6000 rpm to avoid rupture of the thin wall. 5. Then add the following to the tube: 2.25 μL water, 6 μL 5× first strand buffer, 3 μL 0.1 M DTT, and 0.75 μL RNase inhibitor. 6. Mix contents gently and then add 3 μL reverse transcriptase, mix again, and place the tube on ice immediately (see Note 15).

SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro

75

7. Incubate reaction at 45°C for 1 min, at 50°C for 50 min, and then at 65°C for 10 min. 8. While the reaction is going on, make a mastermix of 2 μL 3 M sodium acetate +0.05 μL glycogen (20 mg/mL) per tube and aliquot in 1.03 μL and 2.05 μL volume to 1.5 mL tubes (see Notes 16 and 17). 9. After reverse transcription is complete, briefly centrifuge the tubes to collect the liquid at the bottom of the PCR tubes. Then aliquot the reaction into 9.5 μL and 19 μL volume into two microfuge tubes containing 1.03 μL and 2.05 μL sodium acetate + glycogen mix, respectively. 10. After mixing the reaction with the salt, add 28 μL ethanol to the tube containing 9.5 μL reaction and 55 μL ethanol to the tube containing 19 μL reaction, and tap to mix. 11. Precipitate reactions at -20°C overnight, and the next morning, pellet cDNA from both tubes and air-dry. The dry pellet can be temporarily stored at -20 °C. 3.4 Polyacrylamide Gel—Pouring, Running, and Exposure

1. Salianize the inner surface of the shorter glass plate with Sigmacote by adding dropwise 1 mL of Sigmacote across the entire surface and gently wiping the plate with a piece of paper towel or Kimwipe in a small circular motion. 2. Let the plate air-dry and then wipe it down similarly with 70% ethanol. Let the plate air-dry again before assembling. 3. Pour the sequencing gels at least 3 h before running. Assemble the glass plates with the spacers inside. All edges excluding the top should be sealed with a heat-and liquid-resistant adhesive tape (e.g., 3 M 471). 4. Prepare 12% acrylamide gel solution by adding 24 mL 40% monomer mix, 8 mL 10× TBE, 33.6 g urea to a beaker, and water up to the 70 mL mark. Then, heat the solution by microwaving for 40 s and stir until urea is dissolved. Then, chill the solution at 4 °C until temperature of the liquid drops. 5. Then add 500 μL 10% APS solution and 22 μL TEMED, stir briefly, pour the liquid into a 100 mL measuring cylinder, make the volume up to 80 mL with water, pour the liquid back to the beaker, and mix by stirring more. 6. Pour the gel solution using a serological pipet gently by holding the assembled glass plates at an angle of 45°. Avoid trapping air bubbles inside the gel. If air bubbles get trapped, avoid the corresponding well. After the gel solution is poured, lay the assembled glass plates flat (liquid will not come out through the top opening due to surface tension) and insert the comb, again without trapping any air bubble. Place clear plastic wrap over the comb and the surrounding area, and place extra-large

76

Kaushik Saha and Gourisankar Ghosh

binder clips clamping down the glass plates onto the comb. Place additional binder clips to clamp down the glass plates onto the spacers. 7. Resuspend the pellet obtained from 9.5 μL reaction in 5 μL formamide dye by vortexing for 1 h. 8. Then, heat the samples for 3 min at 95°C. Flush the wells to remove accumulated urea with a syringe connected to a needle. Load samples onto the 12% gel. Let the gel run until bromophenol blue reaches the bottom of the gel. 9. After the gel run is finished, carefully pry open the glass plates, cover the gel with clear plastic wrap without trapping any air bubbles under it, and store the gel in a dark shielded place. 10. Blank the phosphor screen and then lay over the screen on the top of the gel. Place two ~1 kg books at the two ends of the phosphor screen. Expose overnight. 11. Next day, prepare 8% acrylamide gel by mixing 16 mL 40% monomer mix, 8 mL 10× TBE, 33.6 g urea, 500 μL 10% APS, and 22 μL TEMED. Cast the gel as in steps 1–6. 12. Resuspend the pellet from 19.5 μL reaction in 10 μL formamide dye, and load 5 μL of it onto the 8% gel. Let the gel run until xylene cyanol migrates 14 cm. Then, load the remaining 5 μL in an unused well, and let the gel run until xylene cyanol from the second batch of samples migrates to 28 cm. Expose as described in steps 9 and 10. 3.5 Data Collection and Data Analysis

1. Scan the phosphor screen in Typhoon phosphor imager and save the raw (.gel) file. 2. Open the raw file with Fiji [8]. 3. Densitometrically quantify the bands in groups of 15–50 nucleotides maintaining sufficient overlaps between two consecutive groups. There may be 100–150 well-resolved bands under each primer (Fig. 1). 4. Then, normalize the values based on the band intensities in the overlapping segments. Same principle should be applied when normalizing band intensities between two gels (e.g., 12% and 8% or 8% long run and 8% short run). 5. Subtract the band intensity values of the DMSO-treated control RNA from that of the SHAPE-reagent-treated RNA to obtain the raw SHAPE reactivity profiles. Then, divide all raw SHAPE reactivity values obtained with a primer by the average of the top 10% values excluding the high-value outliers to obtain the processed values [9]. Raw SHAPE reactivity values that are ≥1.5 times the median of all values for a primer— capped at top 5% of all band intensity values in each primer

SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro

77

Fig. 1 Images representing reverse transcription products for measuring in vitro SHAPE reactivity of human β-globin IVS1 pre-mRNA in protein-free state and SRSF1-bound state. (a) 12% 29:1 0.35 mm gel resolving reverse transcription products obtained with primer βg-RT1 from β-globin treated with DMSO (lane 1), NMIA (lane 2), SRSF1 and DMSO (lane 3), SRSF1 and NMIA (lane 4), with primer βg-RT2 (lanes 5, 6, 7, 8), with βgRT3 (lanes 9, 10, 11, 12). (b) 8% gel resolving reverse transcription products obtained with primer βg-RT1 from β-globin treated with DMSO (lane 1), NMIA (lane 2), SRSF1 and DMSO (lane 3), SRSF1 and NMIA (lane 4), with primer βg-RT2 (lanes 5, 6, 7, 8), with βg-RT3 (lanes 9, 10, 11, 12); lanes 13–24 contain more of the same samples as lanes 1–12 in the same order, but the samples were loaded onto the gel after xylene cyanol dye of lanes 1–12 migrated 12.5 cm; then the gel was continued to run until the xylene cyanol dye of lanes 13–24 migrated 28 cm

series as the number of bands obtained with each primer is small, about 100–150—are considered outliers. This normalizes the values between the primers, and hence, the SHAPE reactivity of nucleotides in the overlapping region between two consecutive primers should be similar. 6. When analyzing protein-free RNAs, upload the SHAPE reactivity profile to RNAstructure [10] as a tab-delimited file. Select the appropriate temperature, slope, and intercept. The two latter values may have to be optimized, but the values of

78

Kaushik Saha and Gourisankar Ghosh

2.6 and -0.8, respectively, are good starting points. Check the compatibility between specific slope and specific intercept values described previously [11]. RNAstructure generates multiple secondary structure models based on the SHAPE reactivity. Generally, the lowest energy model is selected although under certain circumstances, available biochemical knowledge about the RNA molecule must be considered for choosing the model with the highest level of accuracy. 7. A dot-bracket file may be generated using RNAstructure for the model of choice, which then can be used in VARNA [12] to draw visually appealing RNA secondary structure models. VARNA also allows color-coding the RNA nucleotides according to their SHAPE reactivity.

4

Notes 1. For solutions made in the laboratory, we recommend that all solutions be filtered with 0.22 μM filter to remove particulate contaminants before autoclaving as the particulate contaminants may lead to nucleation and precipitation upon longterm storage. Alternatively, commercially available RNase free solutions may be procured. 2. DMSO is a hygroscopic liquid. Contamination of DMSO with water will reduce effectiveness of the SHAPE reagent, particularly the ones with a short half-life like 1 M7. 3. It may require multiple trials to find the reverse primer that produces a high level of cDNA. Single-stranded DNA can be stored in water at 100 μM concentration in aliquots, and multiple freeze-thaw cycle should be avoided. 4. P32, a radioactive element, emits β-radiation, which is an ionizing radiation. Therefore, all works must be performed behind a certified β-radiation shield. Appropriate PPE must be worn by the worker. Care should be taken to detect and clean any potential cross-contamination of working or walking surfaces, or appliances. After work is done, whole body of the worker should be checked with a Ludlum Geiger Counter. The disposal of the radioactive material should follow institutional and legal guidelines. 5. Acrylamide is a neurotoxin; therefore, in addition to wearing the appropriate PPE, care must be taken to contain any spill or cross-contamination of surfaces. 6. The activity of ammonium persulfate solution decreases over time even when stored at 4 °C. For sensitive applications like sequencing gel, a freshly prepared ammonium sulfate solution is recommended.

SHAPE to Probe RNA Structure and RNA–Protein Interactions In Vitro

79

7. We did not observe any significant differences in SHAPE reactivity based upon the concentration used for RNA refolding. 8. Reducing agents quench SHAPE reagents. Therefore, DTT should not be used in the reaction mixture, which will be probed with a SHAPE reagent. When an added protein needs to be reduced for its functionality, 1 mM 2-mercaptoethanol and a SHAPE reagent with a long half-life like NMIA or NAI should be used. 9. A SHAPE adduct may form near the 3′ end of a selected reverse transcription primer, which will strongly inhibit reverse transcription from the selected primer. That is why, it is important to optimize the reverse transcription reaction with the treated RNA rather than the untreated RNA. 10. SHAPE reagent solution should be prepared fresh, particularly for the reagents with short half-lives (e.g., 1 M7). 11. The incubation temperature depends on the property of the macromolecules being studied. However, at lower temperature, the reaction rate of SHAPE reagent goes down, while at higher temperature, it goes up. Accordingly, the time of reaction of the RNA with the SHAPE reagent must be adjusted. 12. The volume of ethanol added is 2.5 times of the total volume of the solution after addition of sodium acetate and glycogen. 13. Some reverse transcription primers may be less efficient, and therefore, they have to be labeled with a higher level of radioactivity. 14. Add water first while setting up the reaction. 15. It is critical not to let the tube sit at room temperature with the enzyme in it, or it will produce cDNAs of random lengths from RNA molecules that are not sufficiently denatured, jeopardizing the quantitative relationship among the cDNAs of various lengths. 16. Since the volume of glycogen to be added to each tube is 0.05 μL, making a mastermix for ten or more tubes is the only way to accurately measure the glycogen volume. For example, a mastermix for ten tubes will require 0.5 μL glycogen, which is measurable with a pipette. 17. Having too much glycogen in the cDNA solution will reduce the sharpness of the bands on the sequencing gel.

Funding National Institute of General Medical Sciences [R01GM085490] to GG.

80

Kaushik Saha and Gourisankar Ghosh

References 1. Dethoff EA, Chugh J, Mustoe AM, Al-Hashimi HM (2012) Functional complexity and regulation through RNA dynamics. Nature 482(7385):322–330. https://doi. org/10.1038/nature10885 2. England WE, Garfio CM, Spitale RC (2021) Chemical approaches to analyzing RNA structure transcriptome-wide. Chembiochem 22(7):1114–1121. https://doi.org/10.1002/ cbic.202000340 3. Merino EJ, Wilkinson KA, Coughlan JL, Weeks KM (2005) RNA structure analysis at single nucleotide resolution by selective 2′-hydroxyl acylation and primer extension (SHAPE). J Am Chem Soc 127(12): 4223–4231. https://doi.org/10.1021/ ja043822v 4. Smola MJ, Rice GM, Busan S, Siegfried NA, Weeks KM (2015) Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis. Nat Protoc 10(11):1643–1669. https://doi. org/10.1038/nprot.2015.103 5. Saha K, England W, Fernandez MM, Biswas T, Spitale RC, Ghosh G (2020) Structural disruption of exonic stem–loops immediately upstream of the intron regulates mammalian splicing. Nucleic Acids Res 48(11): 6294–6309. https://doi.org/10.1093/nar/ gkaa358 6. Saha K, Fernandez MM, Biswas T, Joseph S, Ghosh G (2021) Discovery of a pre-mRNA structural scaffold as a contributor to the mammalian splicing code. Nucl Acids Res 49:7103. https://doi.org/10.1093/nar/gkab533

7. Busan S, Weidmann CA, Sengupta A, Weeks KM (2019) Guidelines for SHAPE reagent choice and detection strategy for RNA structure probing studies. Biochemistry 58(23): 2655–2664. https://doi.org/10.1021/acs. biochem.8b01218 8. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A (2012) Fiji: an opensource platform for biological-image analysis. Nat Methods 9:676–682 9. McGinnis JL, Duncan CD, Weeks KM (2009) High-throughput SHAPE and hydroxyl radical analysis of RNA structure and ribonucleoprotein assembly. Methods Enzymol 468:67–89. https://doi.org/10.1016/s0076-6879(09) 68004-6 10. Mathews DH (2014) RNA secondary structure analysis using RNAstructure. Curr Protoc Bioinformatics 46:12.16.11–12.16.25. https:// doi.org/10.1002/0471250953.bi1206s46 11. Deigan KE, Li TW, Mathews DH, Weeks KM (2009) Accurate SHAPE-directed RNA structure determination. Proc Natl Acad Sci U S A 106(1):97–102. https://doi.org/10.1073/ pnas.0806929106 12. Darty K, Denise A, Ponty Y (2009) VARNA: interactive drawing and editing of the RNA secondary structure. Bioinformatics 25:1974– 1975

Chapter 6 Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP Kaushik Saha and Gourisankar Ghosh Abstract The functional roles of RNAs are often regulated by their structure. Selective 20 hydroxyl acylation analyzed by primer extension (SHAPE) and dimethyl sulfate (DMS) base reactivity can be employed to investigate the flexibility of nucleotides and correlate it to the constraints imparted by base-pairing and/or proteinbinding. In vivo, a multitude of proteins could bind an RNA molecule, regulating its structure and function. Hence, to obtain a more comprehensive view of the RNA structure–function relationship in vivo, it may be required to characterize both the RNA structure and the RNA-protein interaction network. In this chapter, we describe methods for characterizing the in vivo nucleotide flexibility of RNA in cells by SHAPE-MaP (SHAPE by Mutational Profiling) and DMS-MaP. In another chapter, we will discuss the characterization of RNA-protein interaction network by RNP-MaP. Key words SHAPE-MaP, DMS-MaP, SHAPEMapper, DREEM, RNA structure

1

Introduction Secondary and tertiary structural features of RNAs play critical roles in their functionalities [1–6]. The structure may be regulated by RNA-protein interactions [4, 5, 7] or transcription elongation rate [8]. Neither the RNA structure nor the RNA-protein interactions can be accurately predicted de novo. Selective 20 hydroxyl acylation analyzed by primer extension (SHAPE) is used to interrogate the flexibility of any of the four major ribonucleotides within an RNA molecule, which may be constrained by either base-pairing or protein-binding. The cell permeability and in vivo reactivity of SHAPE reagents for in vivo RNA-structure probing have been studied in detail [9]. Overall, although SHAPE reagent 2-methylnicotinic acid imidazolide (NAI), which interrogates all four ribonucleotides, has been a reagent of choice so far, the nucleobase-specific reagent dimethyl sulfate (DMS), which inter-

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_6, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

81

82

Kaushik Saha and Gourisankar Ghosh

rogates only A and C, provides a significantly higher signal-to-noise ratio in the MaP assay. Recently, a novel SHAPE reagent, 2-aminopyridine-3-carboxylic acid imidazolide (2A3), has been introduced, which exhibits a significantly greater signal-to-noise ratio compared to NAI [10]. However, both NAI and 2A3 require a long contact time with the cells (15–20 min) and, thus, may not be suitable for probing the flexibility of nucleotides involved in highly dynamic processes. On the other hand, contact time of cells with DMS could be as short as 3–5 min. Additionally, codes for segregating nucleotides that comutate in the same RNA molecules are available (DREEM and RingMapper), which allow segregation of flexibilities of specific nucleotides into different conformational/compositional states [11, 12]. The principle of SHAPE is described in another chapter. Briefly, the structure-probing reagent forms adducts with the nucleotides that are not constrained by basepairing or protein-binding. By the mutation profiling (MaP) method, the target RNA is converted to cDNA under special reverse transcription conditions, which allows incorporation of mutations at the site of the adduct formation (Fig. 1a). Then the target cDNA is amplified by limited cycle polymerase chain reaction (PCR) simultaneously adding Illumina adapter sequences at the 50 and 30 termini. This DNA is then deep sequenced, often in multiplex. Finally, mutations at each nucleotide position are then counted using a pipeline, which is then used to calculate the reactivity of each nucleotide. The MaP strategy permits analysis of target RNAs of either high or low abundance [13] since in this strategy the target can be amplified by PCR.

2

Materials Only use ultrapure water with a resistance of at least 18.0 Ω for all procedures. For working with RNA, all solutions and reagents must be free from RNase contamination. Use barrier tips for pipetting. RNA should be stored in nonalkaline buffer or water at 80  C. For the SHAPE assay, Escherichia coli (strain K12 and others), HeLa, Jurkat, B lymphoblasts, mouse embryonic stem cells, and mouse myoblast cells are reported to work well with NAI [13]. HEK293 cells are reported to work well with 2A3 only [8, 9]. The pH of cell growth medium is important since SHAPE chemistry works within the range of 7.4–8.3 [14]. For most mammalian cells and E. coli, the standard growth media are within this range. While normally DMS modifies only A and C, at pH 8.0, it modifies all four nucleotides [12]. However, caution must be exercised before changing the pH of the growth medium since it might affect the cellular physiology in an unpredictable way.

Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP

83

Fig. 1 Principle of SHAPE-MaP/DMS-MaP. (a) In the single-stranded region, different nucleotides of the same RNA species get modified in different RNA molecules, which are marked by a mutation by the reverse transcriptase in different cDNA molecules. In two-step limited cycle PCR, Illumina adapters and the dual indexes (for multiplexed sequencing) are added at the termini. The violet region indicates the position of the index sequences (b) i7 and i5 (i.e., forward and reverse) primers showing standard Illumina adapters. The violet segment is replaced with the sequence of the specific index used

84

Kaushik Saha and Gourisankar Ghosh

2.1 In Vivo Probing with NAI (for SHAPEMaP)

1. Dulbecco’s Modified Eagle’s Medium (Corning 10-013-CV). 2. Phosphate-buffered saline (PBS) (Corning 21-040-CM). 3. Commercially available treated [15] 35 mm dish or six-well plate for cell culture. 4. 2 M 2-methylnicotinic acid imidazolide (NAI) solution in DMSO (Sigma 03-310). 5. Anhydrous dimethyl sulfoxide (DMSO). 6. Freshly prepared 1 M solution of 1,4-dithiothreitol (DTT). 7. 37  C cell culture incubator.

2.2 Preparation of Denatured Control (for SHAPE-MaP)

1. 1 M HEPES-NaOH, pH 8.0, filtered and stored at 4  C in the dark. 2. 500 mM EDTA-NaOH solution, pH 8.0, filtered and autoclaved. 3. 10 Denatured control (DC) buffer (500 mM HEPESNaOH, pH 8.0 and 40 mM EDTA-NaOH, pH 8.0). 4. Highly deionized formamide (conductivity: 19–34 μS/cm, Thermo Fisher Scientific 4311320) 5. RNA Cleanup kit (Monarch, New England Biolabs).

2.3 In Vivo Probing with DMS (for DMSMaP)

1. Dulbecco’s Modified Eagle’s Medium (Corning 10-013-CV). 2. Phosphate-buffered saline (Corning 21-040-CM). 3. Treated 35 mm dish or six-well plate for cell culture. 4. Dimethyl sulfate (DMS) (Sigma D186309). 5. 2-mercaptoethanol. 6. Fume hood. 7. 37  C cell culture incubator.

2.4 RNA Extraction (for SHAPE-MaP and DMS-MaP)

1. TRIzol reagent (Thermo Fisher Scientific 15596018) 2. Chloroform. 3. Isopropanol. 4. Glycogen solution (20 mg/mL) prepared from solid glycogen (Thermo Fisher Scientific, AAJ1644514). 5. Prechilled 75% ethanol. 6. 200 proof ethanol. 7. DNase I and 10 DNase I buffer (New England Biolabs). 8. Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) solution (Thermo Fisher Scientific15593031) (see Note 1). 9. 3 M sodium acetate, pH 5.2, filtered and autoclaved. 10. Prechilled microcentrifuge.

Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP

85

11. Microcentrifuge at room temperature. 12. Orbital shaker or rocker. 13. Heat block set at 37  C. 14. 20  C freezer 15. Nanodrop spectrophotometer (Thermo Fisher Scientific) 2.5 Reverse Transcription (for SHAPE-MaP)

1. Superscript II (Thermo Fisher Scientific). 2. 1 M MnCl2 solution (Thermo Fisher Scientific BP541-100) 3. 1 M Tris–HCl solution, pH 8.0, filtered and autoclaved. 4. 3 M Potassium chloride solution, filtered and autoclaved. 5. Freshly prepared 1 M DTT solution. 6. 10 mM dNTP mix. 7. 2.5 MaP buffer (125 mM Tris–HCl pH 8.0, 187.5 mM KCl, 15 mM MnCl2, 25 mM DTT, and 1.25 mM dNTP mix) (prepared freshly immediately before use). 8. RNase Inhibitor (New England Biolabs or Thermo Fisher Scientific or Biobharati Life Science). 9. Anchored poly (20-nt long).

dT

(20-mer)

or

gene-specific

primer

10. Thermocycler. 2.6 Reverse Transcription (for DMS-MaP)

1. Thermostable group II intron reverse transcriptase III (TGIRT-III, Ingex) (see Note 2). 2. 5 First-strand buffer from Superscript II kit. 3. Freshly prepared 1 M DTT solution. 4. 10 mM dNTP mix. 5. Anchored poly (20-nt long).

dT

(20-mer)

or

gene-specific

primer

6. RNase inhibitor. 7. Thermocycler. 8. RNase H (New England Biolab). 2.7 Library Preparation (for SHAPE-MaP and DMSMaP)

1. Pfu DNA polymerase. 2. Primers for amplifying the target cDNA with partial Illumina adapter (Fig. 1b). 3. Dual index primers (see Note 3). 4. Agarose. 5. TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA pH 8.0). 6. Submarine gel electrophoresis system.

86

Kaushik Saha and Gourisankar Ghosh

7. DNA gel extraction kit (Monarch, New England Biolabs) (see Note 4). 8. Qubit Fluorometer. 9. Facility for MiSeq sequencing. 2.8 Data Analysis (for SHAPE-MaP and DMS-MaP)

1. Computer with Ubuntu operating system or Windows/Mac computer with virtually installed Ubuntu operating system through Oracle VM virtual box. 2. SHAPEMapper 2.0 (clone from: https://github.com/WeeksUNC/shapemapper2.git). 3. DREEM Pipeline (clone from: https://git.codeocean.com/ capsule-6175523.git).

3

Methods

3.1 In Vivo SHAPE Treatment (for SHAPEMaP)

1. Grow HeLa cells in 35 mm plate or six-well plate up to 80% confluency (see Note 5). 2. Aspirate the medium out of the plate; wash the cells with 1 mL PBS prewarmed to 37  C. 3. Gently cover the cells with freshly prepared 1 mL DMEM solution containing 100 mM NAI (from 2 M stock in DMSO) (i.e., + sample) or equal level of vehicle (DMSO) (i.e., – sample) and incubate at 37  C for 15 min (see Note 6). 4. The SHAPE reagent is then quenched by adding 1 mL 1 M DTT solution to the plate and gently mixing it (see Note 7). 5. Aspirate the medium and proceed to the RNA extraction steps (Subheading 3.3).

3.2 In Vivo DMS Treatment (for DMSMaP)

1. Grow and wash the cells as in Subheading 3.1 (steps 1–2). 2. Gently cover the cells with freshly prepared 1 mL 2% DMS solution in DMEM and incubate the plate at 37  C for 4 min. (see Note 8). 3. Aspirate the medium and wash the cells with prechilled PBS containing 30% 2-mercaptoethanol twice (see Note 9). 4. Aspirate PBS and proceed to RNA extraction steps (Subheading 3.3). 5. Although having denatured or untreated control is not deemed critical for DMS-MaP experiments [16], we recommend having at least the untreated control for comparison, particularly for in vivo samples (see Note 10).

Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP

3.3 RNA Extraction (for SHAPE-MaP and DMS-MaP)

87

1. Cover the well with 1 mL TRIzol and gently rock for 5 min. 2. Transfer the liquid from the well to a microfuge tube, add 200 μL chloroform, shake vigorously, and let it sit at room temperature for 15 min. 3. Centrifuge at top speed at 4  C for 10 min. 4. Transfer the aqueous phase (450–500 μL) to a fresh tube without disturbing the interphase and add 1 μL 20 mg/ml glycogen (see Note 11). 5. Add equal volume of isopropanol, mix gently, and incubate at room temperature for 10 min. 6. Centrifuge the tube at 4  C at top speed for 15 min. 7. Discard the supernatant, wash the pellet with prechilled 75% ethanol, air-dry the pellet, and dissolve it in 89 μL nuclease-free water. 8. Add 10 μL of 10 DNase I buffer to it, mix, then add 1 μL DNase I, mix, and incubate at 37  C for 30 min. 9. Add 100 μL phenol:chloroform:isoamyl alcohol to the RNA solution, shake vigorously to mix, and centrifuge at room temperature for 1 min. 10. Transfer the top aqueous phase to a fresh tube, add 100 μL of chloroform, shake vigorously to mix, and centrifuge for 1 min at top speed at room temperature. 11. Transfer 90 μL from the top aqueous phase to a fresh tube, add 9 μL of 3 M sodium acetate pH 5.2 and 1 μL of glycogen, tap to mix, then add 250 μL ethanol, and tap to mix. 12. Incubate the mixture at 20  C for at least 1 h, centrifuge the tube at top speed at 4  C, discard the supernatant, wash the pellet with prechilled 75% ethanol, air-dry the pellet, dissolve the pellet in 30 μL nuclease-free water, and then measure the concentration of the total RNA in Nanodrop (see Note 12).

3.4 Preparation of Denatured Control (for SHAPE-MaP)

1. Place DNase I-treated total RNA obtained from untreated cells in 50% highly deionized formamide, and 1 DC buffer in 100 μL volume, and mix well by pipetting up and down. 2. Place 5 μL of 2 M NAI in a clean tube; do not heat the reagent. 3. Incubate the RNA solution at 95  C for 1 min to denature the RNA. 4. Add 95 μL of denatured RNA to the NAI-containing tube, mix well, and incubate at 95  C for 5 min. 5. Place the DC reaction tube on ice. 6. Purify by Monarch RNA clean up kit.

88

Kaushik Saha and Gourisankar Ghosh

3.5 Reverse Transcription (for SHAPE-MaP)

1. Mix 100 ng total RNA with 10 pmol gene-specific primer or 500 ng anchored poly (dT)20 in 10 μL volume in a PCR tube. 2. Place the tube in a thermocycler, heat at 65  C for 5 min, then quickly ramp down the temperature to 4  C, and leave at 4  C for 5 min. 3. Then add 8 μL freshly prepared 2.5  MaP buffer, mix by pipetting up and down, then add 1 μL Superscript II and 1 μL RNase inhibitor, mix, and place the tube immediately on ice (see Note 13). 4. Transfer the tube to the thermocycler preset at 42  C and incubate for 3 h followed by incubation at 70  C for 15 min to inactivate the enzyme. After that, ramp down to 4  C. 5. Add 1 μL 60 mM EDTA to the reverse transcription reaction to chelate manganese (see Note 14).

3.6 Reverse Transcription (for DMS-MaP)

1. Mix 1 μL 5 μM gene-specific primer or 1 μL 0.25 μg/μL poly (dT)20, 1 μL 50 ng/μL total RNA, and 3 μL water in a PCR tube. 2. Incubate the mixture at 65  C for 5 min in a thermocycler and quickly ramp down to 4  C. Leave the tube(s) at 4  C for 5 min. 3. Add the following and mix: 0.5 μL water, 2 μL 5 First-strand buffer (Superscript), and 0.5 μL 100 mM DTT. Then, add 0.5 μL RNase inhibitor and 0.5 μL TGIRTIII and mix by pipetting. Incubate the reaction at room temperature for 10 min. 4. Add 1 μL 10 mM dNTP, mix well, and place immediately on ice. 5. Transfer the tube to a thermocycle preset at 57  C and incubate for 1.5 h. Then, incubate the samples at 80  C for 5 min to inactivate the enzyme and ramp down to 4  C. 6. Add 1 μL RNase H and incubate the samples at 37  C for 20 min to digest the RNA hybridized to the DNA and store the RNA at 80  C.

3.7 Library Preparation (for SHAPE-MaP and DMSMaP)

1. PCR amplify the target cDNA with gene-specific primers in chimera with partial Illumina adapter as shown in Fig. 1 using 1 μL cDNA preparation as the template in a 50 μL reaction. The number of PCR cycles should be empirically determined in such a way that after gel extraction, at least 100 ng DNA is obtained. The primer should have 15 nt complementary to the target DNA and 15 nt complementary to Illumina adapter. 2. The PCR product is analyzed by agarose gel and purified by gel extraction using Monarch gel extraction kit. 3. Amplify the PCR product with index primers (eight cycles). We recommend using 100–500 ng of template in the second

Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP

89

round of PCR carried out in 50 μL volume. The index primer should contain 15 nt long segment complementary to the partial Illumina adapter used in step 1. 4. Gel-purify the PCR product of correct size and measure the concentrations by Qubit fluorometer. 5. Combine multiple samples in equimolar ratio (final Illumina adapter concentration should be 5–10 nM) for MiSeq pairedend sequencing, which can be submitted to a sequencing core facility. 6. Make sure to have the instrument configured to output demultiplexed adapter-trimmed reads in FastQ format. 3.8 Data Analysis (for SHAPE-MaP)

1. Download SHAPEMapper 2.0 [17] from Github repository on an Ubuntu platform. 2. Generate a fasta (.fasta) file for the target sequence. Make sure to use only T and no U in the sequence. Bioedit software (https://bioedit.software.informer.com/) on Windows or Mac may be used to generate the fasta file. 3. In the fasta file, use lowercase letter to demarcate the priming sites within the sequence. 4. Create a SHAPEMapper data directory, and move the fasta file there. 5. Add the SHAPEMapper script directory to the path; (the $ sign indicates the command prompt in the Ubuntu terminal—do not include it in the command line). $export PATH=$PATH:/path/to/shapemapper-2.1.5

6. Switch to the SHAPEMapper data directory. $cd /path/to/SHAPE_data_directory

7. Then execute SHAPEMapper. It is not necessary to unzip the fastq files. $shapemapper --target Sample.fasta --name Sample --out Sample_output_directory --min-depth 5000 -overwrite

--verbose

--modified

--R1

SHAPE_R1.

fastq.gz --R2 SHAPE_R2.fastq.gz --untreated --R1 DMSO_R1.fastq.gz --R2 DMSO_R2.fastq.gz --denatured --R1 DC_R1.fastq.gz --R2 DC_R2.fastq.gz --correctseq --R1 DMSO_R1.fastq.gz --R2 DMSO_R2.fastq.gz target option indicates the fasta file, name the name of output files, out the output directory, min-depth effective read depth (recommended 5000 [18]), modified treated

90

Kaushik Saha and Gourisankar Ghosh

RNA sequence files, R1 and R2 sequence files containing left and right mates, untreated DMSO-treated samples, denatured control or DC denatured control, and correct-seq the sequencing read with minimal modifications (dedicated untreated samples or DMSO-treated samples). 3.9 Data Analysis (for DMS-MaP)

1. Ubuntu operating system with Python 3 is recommended 2. If you do not have Anaconda Python installation, install Miniconda using Ubuntu terminal $curl -O https://repo. an acon da. com/ mini cond a/Mi nic onda 3-la test Linux-x86_64.sh $sh Miniconda3-latest-Linux-x86_64.sh

3. Then, set up the appropriate channels for Bioconda. $conda config --add channels defaults $conda config --add channels bioconda $conda config --add channels conda-forge

4. Install Bowtie 2. $conda install -c bioconda bowtie2

5. Prepare a .fasta file of the reference sequence (RefName. fasta) with Bioedit containing the reference sequence and transfer it to Ubuntu. 6. Generate index of reference sequence. $bowtie2-build RefName.fasta RefName

7. Rename the FastQ files as follows: SampleName_mate_1 and SampleName_mate_2

8. Then, run DREEM. $Python3 Run_DREEM.py path/to/input/files path/ to/output/files SampleName RefName N1 N2 --fastq N1 and N2 are the positions of the first and the last nucleotide of the sequence to be included in the analysis and is used to eliminate the primer annealing sites at the 50 and 30 termini of the RNA.

9. The value of the untreated samples should be zero at all positions except for at where the nucleotides are naturally modified in vivo (e.g., methylation of adenosine).

Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP

4

91

Notes 1. Overlay the phenol solution with 10 mM Tris–HCl, pH 8.0 to prevent its oxidation that causes it to turn pink. 2. Superscript II has been shown not to be as effective as TGIRTIII for DMS-MaP. 3. Index primers are required to label each sample when multiple samples are deep sequenced in one lane in multiplex. Unique dual index (UDI, e.g., Truseq or Nextera by Illumina) primers can be used for all sequencing platforms. Combinatorial dual index (CDI, e.g., NEBNext from New England Biolabs) can be used if MiSeq amplicon sequencing platform is used. CDIs are cheaper than UDIs because the same i5 primers can be combined with multiple i7 primers and vice versa to uniquely label each sample. On the other hand, UDIs involve a unique i5 and a unique i7 primer for each sample. 4. In our experience, usage of Monarch gel extraction kit produces minimally denatured PCR product in comparison to other gel extraction kits we have used. Since Qubit, which is used for DNA quantification for deep sequencing, measures double-stranded DNA concentrations, having minimally denatured PCR products generates the most accurate result. 5. SHAPE or DMS-MaP can also be performed with other cell types. Cells may also be transiently transfected with a plasmid of choice before in vivo RNA structure probing. 6. If reagent permeation into the adherent cell appears to be weak as evident from the low mutation count in the RNA, cells may have to be suspended in liquid (PBS or medium) before mixing with the SHAPE reagent. 7. All mixing inside the well must be carried out gently in order to avoid dislodging the adherent cells. 8. DMS is highly toxic and, thus, must be handled inside a fume hood. After adding DMS-containing solution to the tissueculture dish, cover the dish with its lid before transferring it to an incubator to prevent inhalation of DMS. 9. DMS causes detachment of some cells; therefore, this washing step—required to quench and eliminate DMS—must be carried out as gently as possible to avoid further loss of cells. 10. In our experience, deep-sequencing data obtained from untreated RNAs reverse transcribed by TGIRT-III and analyzed by DREEM pipeline exhibit zero reactivity at all nucleotide positions. Exceptions are possible if the RNA is naturally modified (e.g., methylation of an adenosine residue).

92

Kaushik Saha and Gourisankar Ghosh

11. TRIzol protocol also allows extraction of protein from the same lysate after RNA extraction for usage in Western blotting. Please refer to the TRIzol protocol provided by Thermo Fisher Scientific for further details. 12. For probing the structure of low abundance RNA, depletion of rRNA using an rRNA depletion kit is recommended. 13. Reverse transcriptase may reverse transcribe at room temperature. To prevent truncated cDNAs being synthesized from RNAs hybridized at room temperature, the mix should be placed immediately on ice before transferring to 42  C thermocycler. 14. Contamination of Mg2+ in PCR mix with Mn2+ may cause error-prone PCR. References 1. Spitale RC, Flynn RA, Zhang QC, Crisalli P, Lee B, Jung JW, Kuchelmeister HY, Batista PJ, Torre EA, Kool ET, Chang HY (2015) Structural imprints in vivo decode RNA regulatory mechanisms. Nature 519:486–490 2. Ding Y, Tang Y, Kwok CK, Zhang Y, Bevilacqua PC, Assmann SM (2014) In vivo genomewide profiling of RNA secondary structure reveals novel regulatory features. Nature 505: 696–700 3. Rouskin S, Zubradt M, Washietl S, Kellis M, Weissman JS (2014) Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature 505(7485): 7 0 1 – 7 0 5 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / nature12894 4. Saha K, England W, Fernandez MM, Biswas T, Spitale RC, Ghosh G (2020) Structural disruption of exonic stem–loops immediately upstream of the intron regulates mammalian splicing. Nucleic Acids Res 48(11): 6294–6309. https://doi.org/10.1093/nar/ gkaa358 5. Saha K, Fernandez MM, Biswas T, Joseph S, Ghosh G (2021) Discovery of a pre-mRNA structural scaffold as a contributor to the mammalian splicing code. Nucleic Acids Res 49(12):7103–7121. https://doi.org/10. 1093/nar/gkab533 6. Mustoe AM, Busan S, Rice GM, Hajdin CE, Peterson BK, Ruda VM, Kubica N, Nutiu R, Baryza JL, Weeks KM (2018) Pervasive regulatory functions of mRNA structure revealed by high-resolution SHAPE probing. Cell 173(1):181–195.e118. https://doi.org/10. 1016/j.cell.2018.02.034

7. Cle´ry A, Krepl M, Nguyen CKX, Moursy A, Jorjani H, Katsantoni M, Okoniewski M, Mittal N, Zavolan M, Sponer J, Allain FH (2021) Structure of SRSF1 RRM1 bound to RNA reveals an unexpected bimodal mode of interaction and explains its involvement in SMN1 exon7 splicing. Nat Commun 12(1): 428. https://doi.org/10.1038/s41467-02020481-w 8. Saldi T, Riemondy K, Erickson B, Bentley DL (2021) Alternative RNA structures formed during transcription depend on elongation rate and modify RNA processing. Mol Cell 81(8):1789–1801.e1785. https://doi.org/ 10.1016/j.molcel.2021.01.040 9. Busan S, Weidmann CA, Sengupta A, Weeks KM (2019) Guidelines for SHAPE reagent choice and detection strategy for RNA structure probing studies. Biochemistry 58(23): 2655–2664. https://doi.org/10.1021/acs. biochem.8b01218 10. Marinus T, Fessler AB, Ogle CA, Incarnato D (2021) A novel SHAPE reagent enables the analysis of RNA structure in living cells with unprecedented accuracy. Nucleic Acids Res 49(6):e34. https://doi.org/10.1093/nar/ gkaa1255 11. Tomezsko PJ, Corbin VDA, Gupta P, Swaminathan H, Glasgow M, Persad S, Edwards MD, McIntosh L, Papenfuss AT, Emery A, Swanstrom R, Zang T, Lan TCT, Bieniasz P, Kuritzkes DR, Tsibris A, Rouskin S (2020) Determination of RNA structural diversity and its role in HIV-1 RNA splicing. Nature 582(7812):438–442. https://doi.org/ 10.1038/s41586-020-2253-5

Chemical Probing of RNA Structure In Vivo Using SHAPE-MaP and DMS-MaP 12. Mustoe AM, Lama NN, Irving PS, Olson SW, Weeks KM (2019) RNA base-pairing complexity in living cells visualized by correlated chemical probing. Proc Natl Acad Sci U S A 116(49):24574–24582. https://doi.org/10. 1073/pnas.1905491116 13. Smola MJ, Weeks KM (2018) In-cell RNA structure probing with SHAPE-MaP. Nat Protoc 13(6):1181–1195. https://doi.org/10. 1038/nprot.2018.010 14. McGinnis JL, Dunkle JA, Cate JH, Weeks KM (2012) The mechanisms of RNA SHAPE chemistry. J Am Chem Soc 134(15): 6617–6624. https://doi.org/10.1021/ ja2104075 15. Barker SL, LaRocca PJ (1994) Method of production and control of a commercial tissue culture surface. J Tissue Cult Methods 16(3):

93

1 5 1 – 1 5 3 . h t t p s : // d o i . o r g / 1 0 . 1 0 0 7 / BF01540642 16. Zubradt M, Gupta P, Persad S, Lambowitz AM, Weissman JS, Rouskin S (2017) DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo. Nat Methods 14:75–82 17. Busan S, Weeks KM (2018) Accurate detection of chemical modifications in RNA by mutational profiling (MaP) with ShapeMapper 2. RNA 24(2):143–148. https://doi.org/10. 1261/rna.061945.117 18. Siegfried NA, Busan S, Rice GM, Nelson JA, Weeks KM (2014) RNA motif discovery by SHAPE and mutational profiling (SHAPEMaP). Nat Methods 11(9):959–965. https:// doi.org/10.1038/nmeth.3029

Chapter 7 Analysis of RNA-Protein Interaction Networks Using RNP-MaP Kaushik Saha and Gourisankar Ghosh Abstract RNA-protein interactions regulate a myriad of biological functions through formation of ribonucleoprotein complexes. These complexes may consist of one or more RNA-protein interaction network(s) providing additional layers of regulatory potential to the RNA. Moreover, since the protein-binding also regulates local and global structure of the RNA by structurally remodeling the latter, it is important to correlate RNA nucleotide flexibility with the site of protein-binding. We have discussed methods for chemical probing of structure of the RNA in the protein-free and protein-bound states in the preceding chapters. In this chapter, we describe a ribonucleoprotein mutational profiling (RNP-MaP) method for probing RNA-protein interaction networks. Key words RNP-MaP, NHS-diazirine, UV cross-linking, Mutational profiling, Next-generation sequencing, RNA-protein interactions

1

Introduction Ribonucleoprotein mutational profiling (RNP-MaP) for de novo experimental characterization of the RNA-protein interaction network is only recently described [1]. In RNP-MaP strategy, NHSdiazirine (succinimidyl 4,4′-azipentanoate, SDA), a cell-permeable crosslinking reagent, readily crosslinks the RNA-binding amino acid residues with the RNA nucleotide to which it interacts upon activation by a long-wavelength ultraviolet (UV) light. After cell lysis and digestion of the cross-linked proteins, the short peptide adducts are identified by a relaxed fidelity reverse transcription system. By the mutation profiling (MaP) method, the target RNA is converted to cDNA under special reverse transcription conditions, which allows incorporation of mutations at the site of the adducts (Fig. 1a). While RNP-MaP does not identify the protein that interacts with the RNA, it identifies the RNA-protein interaction network based on correlated cross-linking sites across different

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_7, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

95

96

Kaushik Saha and Gourisankar Ghosh

Fig. 1 Principle of RNP-MaP. (a) After digestion of the cross-linked proteins, different nucleotides retain peptide adducts, which are marked by a mutation by the reverse transcriptase in cDNA molecules. In two-step limited cycle PCR, Illumina adapters and the dual indexes (for multiplexed sequencing) are added at the termini. The violet region indicates the position of the index sequences (b) i7 and i5 (i.e., forward and reverse) primers showing standard Illumina adapters. The violet segment is replaced with the sequence of the specific index used

Analysis of RNA-Protein Interaction Networks Using RNP-MaP

97

molecules within a population of an RNA species. If identification of the RNA-bound protein is required, Selective 2′ hydroxyl acylation analyzed by primer extension (SHAPE)-MaP and RNP-MaP may be followed by mass spectrometry or eCLIP (enhanced CrossLinking and ImmunoPrecipitation) [2]. Here, we describe the method for RNP-MaP.

2

Materials

2.1 In Vivo CrossLinking

1. SDA (NHS-diazirine, succinimidyl (Thermo Fisher Scientific PI26167).

4,4′-azipentanoate)

2. Dimethyl sulfoxide (DMSO). 3. 100 mM SDA in DMSO (freshly prepared before use) (see Notes 1 and 2). 4. 1 M Tris–HCl, pH 8.0, filtered and autoclaved. 5. Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, 10010). 6. UVP 1000CL (Analytik Jena) crosslinker fitted with 365 nm light-emitting lamps. 2.2 Proteinase K Digestion and RNA Extraction

1. 1 M Tris–HCl, pH 8.0, filtered and autoclaved. 2. 3 M KCl, filtered and autoclaved (see Note 3). 3. 1 M MgCl2, filtered and autoclaved. 4. 5 M NaCl, filtered and autoclaved. 5. 1 M dithiothreitol (DTT), freshly prepared before use. 6. Triton X-100. 7. 5 M NaCl, filtered and autoclaved. 8. 0.5 M Na-EDTA, pH 8.0, filtered and autoclaved. 9. 10% sodium dodecyl sulfate (SDS) solution. 10. Cytoplasmic lysis buffer (20 mM Tris–HCl pH 8.0, 10 mM KCl, 1.5 mM MgCl2, 1 mM DTT, 0.1% Triton X-100). 11. Proteinase K (20 mg/mL, New England Biolabs). 12. Proteinase K lysis buffer (40 mM Tris–HCl pH 8.0, 200 mM NaCl, 20 mM EDTA, 1.5% SDS, 0.5 mg/mL of proteinase K), add proteinase K before use. 13. 25:24:1 phenol:chloroform:isoamyl alcohol, pH 8.0 (Thermo Fisher Scientific 15593031) (see Note 4). 14. Chloroform. 15. Glycogen solution (20 mg/mL) prepared from solid glycogen (Thermo Fisher Scientific, AAJ1644514) and stored at -20 °C.

98

Kaushik Saha and Gourisankar Ghosh

16. 3 M sodium acetate, pH 5.2, filtered and autoclaved. 17. 200 proof ethanol. 18. DNase I and 10× DNase I buffer (New England Biolabs). 19. Cell scraper. 20. Prechilled centrifuge. 21. Heating block set at 37 °C. 22. RNA clean-up kit (Monarch, New England Biolabs). 23. Nanodrop spectrophotometer (Thermo Fisher Scientific). 2.3 MaP Reverse Transcription

1. Superscript II (Thermo Fisher Scientific). 2. 10 mM dNTP mix. 3. RNase Inhibitor (New England Biolabs or Thermo Fisher Scientific or Biobharati Life Science). 4. Gene-specific reverse transcription primer (20-nt long). 5. 1 M MnCl2 (Thermo Fisher Scientific, BP541-100). 6. Betaine (Thermo Fisher Scientific, AAJ77507AB). 7. 2.22× MaP buffer (111 mM Tris–HCl pH 8.0, 167 mM KCl, 13.3 mM MnCl2, 22 mM DTT, 2.22 M betaine), freshly prepared before use. 8. Thermocycler.

2.4 Sequencing Library Preparation for Mutational Profiling

1. Pfu DNA polymerase. 2. Primers for amplifying the target cDNA with partial Illumina adapter (Fig. 1b). 3. Dual index primers (see Note 5). 4. Agarose. 5. TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA pH 8.0). 6. Submarine gel electrophoresis system. 7. DNA gel extraction kit (Monarch, New England Biolabs) (see Note 6). 8. Qubit Fluorometer. 9. Facility for MiSeq sequencing.

2.5

Data Analysis

1. Computer with Ubuntu operating system or Windows/Mac computer with virtually installed Ubuntu operating system through Oracle VM virtual box. 2. SHAPEMapper 2.0 (clone from: https://github.com/WeeksUNC/shapemapper2.git).

Analysis of RNA-Protein Interaction Networks Using RNP-MaP

3

99

Methods

3.1 In Vivo CrossLinking

1. Wash cells grown in six-well plates once with PBS pre-equilibrated at 37 °C (see Note 7). 2. Add 900 μL PBS and 100 μL 100 mM SDA to the cells. 3. Mix gently and incubate at 37 °C for 10 min in the dark. 4. As a negative control, also overlay cells in a well with 900 μL PBS + 100 μL DMSO, that is, the vehicle, and incubate for 10 min at 37 °C in the dark. 5. Add 111 μL of 1 M Tris–HCl, pH 8.0 at the end of the reaction to quench SDA. 6. Wash cells once with 1 mL PBS (see Note 8). 7. Overlay the cells with 400 μL PBS in a well. 8. Then expose SDA-treated and DMSO-treated cells to 3 J/cm2 of 365-nm-wavelength UV light at a distance of 4 inches from the lamps on ice.

3.2 Protease Digestion and RNA Extraction

1. Scrape the cells, transfer them to a microfuge tube, and centrifuge at 1000 × g for 5 min at 4 °C, wash them once with 400 μL PBS, and resuspend in 400 μL cytoplasmic lysis buffer. 2. Lyse the cells with agitation for 10 min at 4 °C. 3. Centrifuge the lysate at 1500 × g for 5 min at 4 °C to precipitate the nuclei; remove the supernatant to a fresh tube and store on ice, resuspend the pellet with 20 mM Tris–HCl pH 8.0, 10 mM KCl, 1.5 mM MgCl2, 1 mM DTT; incubate for 2 min at 4 °C; and centrifuge at 1500 × g for 5 min at 4 °C. Use 500 μL buffer for samples from six-well plate. 4. Resuspend the nuclei in 400 μL proteinase K lysis buffer. 5. Similarly, to 282 μL cytoplasmic extract from step 3, add 16 μL 1 M Tris–HCl pH 8.0, 16 μL 5 M NaCl, 16 μL 0.5 M EDTANaOH pH 8.0, 60 μL 10% SDS, and 10 μL Proteinase K. 6. For proteolysis, incubate the samples at 37 °C for 2 h. 7. Add equal volume of phenol:chloroform:isoamyl alcohol to 400 μL digested nuclear extract from step 4 and digested cytoplasmic extract from step 5, mix vigorously, and centrifuge for 1 min at top speed at room temperature. 8. Transfer the top aqueous phase to a fresh tube, add equal volume of chloroform, mix vigorously, and centrifuge for 1 min at top speed. 9. Transfer the top aqueous phase to a fresh tube, add 80 μg/mL glycogen and 300 mM sodium acetate pH 5.2 (final concentrations), mix, add 2.5× volume 200 proof ethanol, incubate at -20 °C for at least 1 h, centrifuge at top speed at 4 °C, remove

100

Kaushik Saha and Gourisankar Ghosh

the supernatant up to the last droplet, wash the pellet with chilled 75% ethanol, air-dry the pellet, and resuspend in 89 μL water. 10. Add 10 μL 10× DNase I buffer and 1 μL DNase I to the nucleic acid solution from step 9 and incubate at 37 °C for 30 min. 11. Purify the RNA solution from step 10 further by Monarch RNA clean-up kit, measure RNA concentration in the Nanodrop spectrophotometer, and store at -80 °C. Either lysate may produce 100–300 ng total RNA. 3.3 MaP Reverse Transcription

1. 10 pmol of gene-specific primer, 100 ng of RNA from Subheading 3.2, step 11 and 0.5 μL 10 mM dNTP mix are mixed in a PCR tube in 10 μL volume. 2. Incubate the PCR tube at 70 °C for 5 min in a thermocycler, and then, quickly ramp down the temperature of the thermocycler block to 4 °C. Leave the tubes at 4 °C for 5 min. 3. Add 9 μL of 2.22× MaP buffer, and incubate the mixture at 25 °C for 2 min. 4. Add 1 μL of Superscript II reverse transcriptase and incubate the tube at 25 °C for 10 min and at 42 °C for 90 min followed by cycling ten times between each of 2-min incubation at 42 °C and that at 50 °C. Finally, the reaction is heated at 70 °C for 10 min and then cooled down to 4 °C (see Note 9). 5. Add 1 μL 120 mM EDTA to 20 μL reverse transcription reaction to neutralize Mn2+.

3.4 Two-Step PCR for Small RNA MaP Libraries and Deep Sequencing

1. PCR amplify the target cDNA with gene-specific primers in chimera with partial Illumina adapter as shown in Fig. 1 using 1 μL cDNA preparation as the template in a 50 μL reaction. The number of PCR cycles should be empirically determined in such a way that after gel extraction at least 100 ng DNA is obtained. The primer should have 15 nt complementary to the target DNA and 15 nt complementary to Illumina adapter. 2. The PCR product is analyzed by agarose gel and purified by gel extraction using Monarch gel extraction kit. 3. Amplify the PCR product with index primers (eight cycles). We recommend using 100–500 ng of template in the second round of PCR carried out in 50 μL volume. The index primer should contain 15 nt long segment complementary to the partial Illumina adapter used in step 1. 4. Gel-purify the PCR product of correct size and measure the concentrations by Qubit fluorometer. 5. Combine multiple samples in equimolar ratio (final Illumina adapter concentration should be 5–10 nM) for MiSeq pairedend sequencing, which can be submitted to a sequencing core facility.

Analysis of RNA-Protein Interaction Networks Using RNP-MaP

101

6. Make sure to have the instrument configured to output demultiplexed adapter-trimmed reads in FastQ format. 3.5 Mutation Counting and RNPMaP Analysis

1. Download SHAPEMapper 2.0 [3] from Github repository on an Ubuntu platform. 2. Generate a fasta (.fasta) file for the target sequence. Make sure to use only T and no U in the sequence. Bioedit software (https://bioedit.software.informer.com/) on Windows or Mac may be used to generate the fasta file. 3. In the fasta file, use lowercase letter to demarcate the priming sites within the sequence. Eliminate an additional five nucleotides upstream of the reverse transcription primer by setting an additional 5-nt upstream of the RT primer sequence to lowercase letters in the Fasta file. 4. Create a SHAPEMapper data directory and move the fasta file there. 5. Add the SHAPEMapper script directory to the path; (the $ sign indicates the command prompt in the Ubuntu terminal— do not include it in the command line). $export PATH=$PATH:/path/to/shapemapper-2.1.5

6. Switch to the SHAPEMapper data directory. $cd /path/to/SHAPE_data_directory

7. Then, execute SHAPEMapper. It is not necessary to unzip the fastq files. $shapemapper --target Sample.fasta --name Sample --out Sample_output_directory --min-depth 5000 -overwrite

--verbose

--modified

--R1

Sample_R1.

fastq.gz --R2 Sample_R2.fastq.gz --untreated --R1 DMSO_R1.fastq.gz --R2 DMSO_R2.fastq.gz target option indicates the fasta file, name the name of output files, out the output directory, min-depth effective read depth (recommended 5000 [4]), modified treated RNA sequence files, R1 and R2 sequence files containing left and right mates, and untreated DMSO-treated samples.

8. Calculate the per-nucleotide mutation frequencies by dividing the number of mutation events by the effective read depth for both SDA-treated and DMSO-treated samples using the information available in the “profile.txt” file generated by ShapeMapper 2. This and the remainder of the operations stated in this section may be carried out in Microsoft Excel.

102

Kaushik Saha and Gourisankar Ghosh

9. Calculate RNP-MaP reactivity for each nucleotide position by dividing the cross-linked mutation frequency by the uncrosslinked mutation frequency. 10. Identify the “true” RNP-MaP sites, which fulfill all three conditions indicated below: (a) Cross-linked samples must exhibit at least 50 more mutation events in the cross-linked samples compared to the uncross-linked samples (b) Site reactivities must exceed nucleotide-specific empirical thresholds. To obtain the threshold values for each of the four types of nucleotides, multiply the standard deviations of reactivities of each nucleotide group (U, A, C, or G) with 0.59 for U, 0.29 for A, 0.93 for C, and 0.78 for G, and add this value to the median reactivity of each nucleotide group. (c) The Z-factor for the reactivities of each significantly reactive nucleotide must be greater than 0, where Z =1-

2:575ðσ treated þ σ untreated Þ jMutation ratetreated - Mutation rateuntreated j pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi σ = ðMutation rateÞ= ðreadsÞ

11. An example of in vitro RNP-MaP analyses on AdML pre-mRNA in complex with U1 snRNP alone, SRSF1 alone, and both SRSF1 and U1 snRNP can be found in our most recent publication [5]. 3.6 RNP-MaP Correlation

In this section, we describe a method to identify the mutations that co-occur or do not co-occur in a single RNA molecule to identify different RNA-protein interactions networks. 1. Download Ringmapper [6] from Github repository onto Ubuntu operating system. 2. Switch to the Download directory where the zipped file is downloaded. $cd ~/Downloads

3. Unzip the downloader directory. $unzip Ringmapper-master.zip

4. Copy the directory.

Ringmapper-master

directory to the HOME

5. Switch to the Ringmapper-master directory.

Analysis of RNA-Protein Interaction Networks Using RNP-MaP

103

$cd ~/Ringmapper-master

6. Compile Cython routine. $python3 setup.py build_ext --inplace

7. Display the options. $./ringmapper.py --help

8. Run Ringmapper. $./ringmapper.py

--fasta

Filename.fasta

--un-

treated Untreated_parsed.mut --window 3 -–mincorrdistance 4 inputfile treated_parsed.mut outputfile path/to/output/file Filename.fasta is the fasta file containing the sequence;

files are outputs of ShapeMapper 2. For this analysis, a minimum read depth of 10,000 is required. Pairs of windows exhibiting G-statistic >20 are considered significantly correlated. The correlations may be visualized with arcplot.py (github.com/Weeks-UNC/arcPlot). parsed.mut

9. In our data, we did not find any alternative conformations of AdML pre-mRNA with alternative contacts with the protein components [5].

4

Notes 1. A calibrated analytical balance with a readability up to 0.1 mg should be used for weighing SDA because it is expensive and comes in a very small amount. 2. SDA is highly sensitive to long wavelength UV light but only somewhat sensitive to normal light. Therefore, both the powder and the solution should be protected from direct light as practicable as possible, but a dark room is not required to perform these experiments. 3. For solutions made in the laboratory, we recommend that all solutions be filtered with 0.22 μM filter to remove particulate contaminants before autoclaving as the particulate contaminants may lead to nucleation and precipitation upon longterm storage. Alternatively, commercially available RNase-free solutions may be procured.

104

Kaushik Saha and Gourisankar Ghosh

4. Overlay the phenol solution with 10 mM Tris–HCl pH 8.0 during storage to prevent its oxidation, which causes the solution to turn pink. 5. HEK293 cells grown in six-well plate in Dulbecco’s Modified Eagle Medium (DMEM) (Corning Mediatech 10-013-CV) supplementaed with 10% fetal bovine serum grown up to 80% confluency may be used for this analysis. 6. Index primers are required to label each sample when multiple samples are deep sequenced in one lane in multiplex. Unique dual index (UDI, e.g., Truseq or Nextera by Illumina) primers can be used for all sequencing platforms. Combinatorial dual index (CDI, e.g., NEBNext from New England Biolabs) can be used if MiSeq amplicon sequencing platform is used. CDIs are cheaper than UDIs because the same i5 primers can be combined with multiple i7 primers and vice versa to uniquely label each sample. On the other hand, UDIs involve a unique i5 and a unique i7 primer for each sample. 7. In our experience, usage of Monarch gel extraction kit produces minimally denatured PCR product in comparison to other gel extraction kits we have used. Since Qubit, which is used for DNA quantification for deep sequencing, measures double-stranded DNA concentrations, having minimally denatured PCR products generates the most accurate result. 8. If the cells are detached from the plate during treatment, centrifuge them at 1000 × g for 3 min after addition of the quencher; wash once with PBS. 9. Temperature cycling is used to facilitate the denaturation of the RNA at the higher temperature and renaturation of the enzyme at the lower temperature. The presence of betaine improves the enzyme renaturation efficiency. This method improves the cDNA synthesis efficiency. This is particularly effective for Superscript II, which has an optimal temperature of action at 42 °C, which may not be sufficiently denaturing for several secondary structural elements within the RNA [7]. References 1. Weidmann CA, Mustoe AM, Jariwala PB, Calabrese JM, Weeks KM (2021) Analysis of RNA-protein networks with RNP-MaP defines functional hubs on RNA. Nat Biotechnol 39(3): 347–356. https://doi.org/10.1038/s41587020-0709-7 2. Van Nostrand EL, Pratt GA, Shishkin AA, Gelboin-Burkhart C, Fang MY, Sundararaman B, Blue SM, Nguyen TB, Surka C, Elkins K, Stanton R, Rigo F, Guttman M, Yeo GW (2016) Robust

transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat Methods 13:508–514 3. Busan S, Weeks KM (2018) Accurate detection of chemical modifications in RNA by mutational profiling (MaP) with ShapeMapper 2. RNA 24(2):143–148. https://doi.org/10.1261/rna. 061945.117 4. Siegfried NA, Busan S, Rice GM, Nelson JA, Weeks KM (2014) RNA motif discovery by SHAPE and mutational profiling (SHAPE-

Analysis of RNA-Protein Interaction Networks Using RNP-MaP MaP). Nat Methods 11(9):959–965. https:// doi.org/10.1038/nmeth.3029 5. Saha K, Ghosh G (2021) U1 snRNP regulates early spliceosome assembly by disrupting the interaction between SR proteins and the pre-mRNA. Biorxiv. https://doi.org/10.1101/ 2021.1112.1101.470860 6. Mustoe AM, Lama NN, Irving PS, Olson SW, Weeks KM (2019) RNA base-pairing complexity in living cells visualized by correlated chemical probing. Proc Natl Acad Sci U S A 116(49):

105

24574–24582. https://doi.org/10.1073/ pnas.1905491116 7. Carninci P, Nishiyama Y, Westover A, Itoh M, Nagaoka S, Sasaki N, Okazaki Y, Muramatsu M, Hayashizaki Y (1998) Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full length cDNA. Proc Natl Acad Sci U S A 95(2):520–524. https://doi.org/10.1073/ pnas.95.2.520

Chapter 8 Native RNA Immunoprecipitation (RIP) for Precise Detection and Quantification of Protein-Interacting RNA Mai Baker, Rami Khosravi, and Maayan Salton Abstract Proteins with either RNA or DNA-binding motifs were shown to bind RNA. Immunoprecipitation of such proteins using antibodies and identification of the RNA-binding molecules is called RNA immunoprecipitation (RIP). The RNA precipitated with the studied protein can be detected by real-time polymerase chain reaction (PCR), microarray or sequencing. Here, we detail a method for native immunoprecipitation, without cross-linking, to isolate protein-RNA complexes followed by subsequent extraction and quantification of the co-purified RNA. Key words Native RNA immunoprecipitation, RNA-binding protein, Antibody, RNA extraction, Real-time PCR

1

Introduction Elucidating the interface between proteins and nucleic acids holds the key to understanding many aspects of gene expression regulation. Following the discoveries of DNA-bound proteins, which reconstruct our knowledge of epigenetics, was the realization that there is a second layer of RNA binding to chromatin structures [1]. RNA molecules have specific characteristics that enable them to form condensates, which allow for enrichment of specific molecules in specific microenvironments within the cell [2]. Hence, studying the dynamics of protein-RNA interaction in response to the cell’s changing environment can lead us to discover novel cellular regulation processes. One of the main tools to study protein-RNA interaction is immunoprecipitation of a protein followed by monitoring the RNA molecules that bind to it. This method is called RNA immunoprecipitation (RIP). Immunoprecipitation of the protein of interest can be followed by a genome-wide technique such as microarray (RIP-Chip) or sequencing (RIP-seq) [3]. These are

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_8, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

107

108

Mai Baker et al.

Fig. 1 Schematic representation of the protocol

hypothesis-free approaches used for discovery of RNA molecules that bind to the protein studied. A hypothesis-driven approach will quantify a specific RNA molecule following RIP by the use of semiqPCR or real-time polymerase chain reaction (PCR.) These methods can be used to compare different perturbations either by mutating the protein immunoprecipitated or changing the cellular environment [4–7]. Prior to the immunoprecipitation process, cells can be crosslinked to strengthen weak connections between proteins and RNA. The disadvantage of cross-linking is a reduction of antigen accessibility, which will decrease the efficiency of the antibody used for immunoprecipitation. In addition, cross-linking might lead to artifactual linking between proteins and RNA that are not present in the native state. For these reasons, it is important to begin RIP calibrations without cross-linking, which is the protocol we detail here (Fig. 1).

2

Materials RNA is susceptible to degradation by RNases, which are very stable and ubiquitous enzymes. Since RNases can still be active after autoclaving, this protocol calls for RNase-free sterile, disposable plasticware. In addition, always wear clean gloves and refrain from touching contaminated surfaces or equipment.

Native RNA Immunoprecipitation (RIP) for Precise Detection. . .

2.1

Cell Culture

109

1. Cells: MCF7 cell line (ATCC Number: HTB-22). 2. Media: Dulbecco’s Modified Eagle’s Medium (DMEM, Sartorius) supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/mL penicillin, and 10 mg/mL streptomycin (Sartorius). 3. PBS: Dulbecco’s Phosphate-Buffered Saline without Calcium and Magnesium (Sartorius). 4. Cell scraper (Corning®). 5. Molecular Biology Grade Water, DNase and RNase-free (Sartorius).

2.2 Cell Lysis and RIP

Prepare all solutions using molecular biology grade water and analytical grade reagents (see Note 1). Prepare and store all reagents at 4  C (unless indicated otherwise). 1. 1 M Tris–HCl, pH 7.5 (HyLabs): weigh 121.1 g Tris–HCl and add water to a volume of 900 mL. Mix and adjust pH with 12 N HCl (Millipore Sigma). Make up to 1 L with water. 2. 0.5 M EDTA (HyLabs): add 186.1 g of disodium EDTA to 800 mL of water. Stir vigorously on a magnetic stirrer. Adjust the pH to 8.0 with 10 M NaOH (Millipore Sigma). Make up to 1 L with water. 3. 1 M NaCl solution: weigh 5.844 g NaCl (molecular weight 58.44, Bio-Lab), and transfer into 100 mL of water, mix, and store at room temperature. 4. Lysis buffer: 50 mM Tris–HCl, pH 7.5, 0.5% NP-40 (IGEPAL, Millipore Sigma), 1 mM EDTA, 150 mM sodium chloride (NaCl, Bio-Lab). To prepare the lysis buffer, add: 2.5 mL, 1 M Tris–HCl, pH 7.5; 250 μL 100% NP-40 (or its analog IGEPAL); 7.5 mL 1 M NaCl solution; 0.1 mL 0.5 M EDTA, pH 8; make up to 50 mL with water and mix well. 5. Mammalian Protease Inhibitor Cocktail (Sigma). 6. Rnase inhibitor, Rnasin (Hylabs). 7. Q700 Sonicator (Qsonica). 8. Protein A/G Biotechnology).

PLUS-Agarose

beads

(Santa

Cruz

9. Antibodies: anti-hnRNP M (4 μg, sc-20002) (see Note 2). 2.3 RNA Extraction, Purification, and Quantification

1. RNA extraction kit: GENEzol TriRNA Pure Kit (Geneaid). 2. cDNA kit: qScript® cDNA Synthesis kit (QuantaBio). 3. PCR machine: C1000 touch thermal cycler (Bio-Rad). 4. Real-time PCR reagent: iTaq Universal SYBR® Green Supermix (Bio-Rad). 5. Real-time PCR machine: CFX96 Real-Time PCR Detection System (Bio-Rad).

110

3

Mai Baker et al.

Methods Carry out all procedures on ice unless otherwise specified.

3.1

Cell Harvesting

Each RIP reaction requires 4  106 cells. 1. Grow cells to a maximum confluency of 70%. 2. Use an extra plate for each condition to count cells in parallel to the plate to be harvested. This is important to ensure the RIP is conducted using the same number of cells for all perturbations. 3. Harvest cells by transferring the plate directly from the incubator onto ice. Aspirate the media and wash cells twice directly on the plate with ice cold PBS. Add 5 mL PBS, scrape cells and transfer to a 15 mL tube. Repeat the process by adding 5 mL PBS to the plate to collect as many cells as possible. Centrifuge at 300  g for 7 min at 4  C. 4. Discard the supernatant, repeat centrifugation for 1 min at 300  g, and carefully aspirate all the supernatant. At this stage, the cell pellet can be stored at

3.2

Cell Lysis

80  C until use.

1. Prepare 1 mL of lysis buffer by adding 10 μL of mammalian protease inhibitor cocktail and 25 μL from 40 U/μL RNase inhibitor (see Note 3). Add 0.5 mL of lysis buffer to 4  106 cells. Pipette gently without introducing bubbles and incubate on ice for 30 min (see Note 4). Transfer lysed cells to sonication tubes. Sonicate at 4  C with six cycles of 5 s, interrupted by 30 s of rest (see Note 5). 2. Centrifuge at 16,000  g, for 20 min at 4  C to remove the insoluble fraction. 3. Transfer the supernatant (cell lysate) to a clean tube. 4. Transfer 10% of the cell lysate (50 μL) to a clean tube to use as input.

3.3 Immunoprecipitation of Protein-RNA Complex

1. Add 20 μL of protein A/G agarose beads (Santa Cruz Biotechnology) to an empty tube. Wash beads twice by adding 1 mL lysis buffer (no inhibitors added) and centrifuge at 300  g for 1 min (see Note 6). 2. Resuspend the beads in 100 μL of lysis buffer (no inhibitors added), and add 5 μg of the antibody of interest and the negative control to the tubes (see Note 7). 3. Incubate with rotation for 2 h at 4  C to allow the antibody to bind the beads. 4. Centrifuge the tubes at 300  g for 1 min and remove the supernatant.

Native RNA Immunoprecipitation (RIP) for Precise Detection. . .

111

5. Add 600 μL of lysis buffer (no inhibitors added) and 400 μL of the cell lysate to each tube. 6. Incubate with rotation for 2–4 h in 4  C. 7. Centrifuge the tubes at 300  g for 1 min and remove the supernatant. 8. Wash four times using 1 mL of lysis buffer (see Note 3). 3.4

RNA Purification

Extract RNA using a spin column kit such as QIAGEN’s RNeasy kit (QIAGENE) or GENEzol TriRNA Pure Kit (Geneaid). 1. Add 350 μL from kit’s lysis buffer directly to the beads. 2. For example: RLT buffer from QIAGEN’s RNeasy kit or TRIzol for TRIzol purification kits such as GENEzol TriRNA Pure Kit from Geneaid. 3. Vortex briefly and incubate with shaking at room temperature for 5 min. 4. Centrifuge the tubes at 300  g for 1 min and move the supernatant to a clean tube. Continue according to the kit’s instructions. Make sure to use a kit with DNase treatment. 5. Elute the RNA with 30 μL of RNase-free water.

3.5

cDNA Synthesis

1. Use the purified RNA as a template to synthesize cDNA. Use the maximum volume allowed by the cDNA kit. 2. For example, use 15 μL when using qScript cDNA Synthesis Kit. 3. When ready to prepare the real-time plate dilute the cDNA samples 1:2 with RNase-free water. Following dilution of the cDNA, the volume of the sample is 40 μL.

3.6

Real-Time PCR

Quantification of the RNA molecule binding the protein immunoprecipitated is done by comparing it to the amount in the input. For this comparison, a standard curve will be generated (Fig. 2 and see Note 8). Standard curve: 1. Make serial dilutions of each input sample 1:2, 1:10, 1:50, 1: 250. 2. For the real-time protocol follow the instruction of the supermix (see Note 9), perform triplicates for each sample. 3. Make sure a single product is produced by monitoring the dissociation curve. There should be a single peak at a melting temperature (Tm) greater than 75  C. 4. Calculate average Ct of triplicates. 5. Use standard curve to calculate the sample’s amount relative to input (Fig. 2).

112

Mai Baker et al.

Fig. 2 Standard curve generated from Ct of the input serial dilution. The higher the concentration of the template the lower the Ct. The RIP RNA amount is extrapolated from its Ct using the standard curve

6. Use the real-time machine software such as Bio-Rad’s CFX Maestro software to plot the Ct-values against the logarithm of the dilution factors. The software uses the linear regression slope to identify the concentration of unknown immunoprecipitated RNA samples from their Ct-values relative to the input.

4

Notes 1. Prepare all solutions using RNase-free molecular biology grade water and analytical grade reagents in RNase-free sterile, disposable plasticware. Since RNases are stable in autoclave, we refrain from this step and add RNase-inhibitors to the lysis buffer. 2. The suitability of the antibody to immunoprecipite the protein of interest needs to be studied using Western blot in SDS-PAGE. It is also possible to conduct immunoprecipitation for RIP and Western blot in parallel. In this case, conduct the experiment with double the amount of antibody and cells and store input and immunoprecipitation samples to compare using Western blot [5].

Native RNA Immunoprecipitation (RIP) for Precise Detection. . .

113

3. Lysis buffer supplemented with inhibitors should be used only when added directly to the pellet. The use of lysis buffer for beads and complex washing should only be supplemented with RNase inhibitor at a tenth of the manufacturer’s recommended concentration (2.5 μL from 40 U/μL RNase). 4. During cell lysate preparations, occasionally gently mix the lysis mixture by pipetting to allow for even cell lysis. Look under the microscope to validate that the cells have been lysed. 5. Following cell lysis, with no sonication, and long centrifugation, we observe a pellet with a viscous consistency. This pellet consists of the chromatin-bound fraction and the cell membranes. If your complex is in this fraction, it will hinder your results. To release the complex, we shear the DNA using sonication. However, sonicating cells without the use of a cross-linker should be done very gently to make sure the protein-RNA complex stays intact. It is important to calibrate the sonication step to minimize the sonication time. An indicator for the sonication rate is the viscous nature of the pellet following the centrifugation step. An appropriate sanitation rate is the rate that is just enough to decrease the viscosity of the pellet. Calibration of the sonication can begin with six cycles of 5 s ON and 30 s OFF. 6. Different types of beads can be used based on the immunoglobulin isotype and species. For the most part, mouse monoclonal antibodies bind stronger to protein G, and rabbit polyclonal antibodies bind to both protein G and protein A. In our protocol, we recommend using both types of beads by mixing an equal amount of each. 7. As a negative control, use a nonspecific IgG antibody corresponding to the primary antibody source. The negative control can set the threshold of background unspecific binding especially with very abundant RNA molecules. A positive control can also be used and depends on one’s knowledge of the specific RNA molecule binding partners. In our experiments, we use CD44 intron 8 as a positive control for HNRNPM binding [5] as was reported before [8]. 8. An important point to keep in mind when planning such an experiment is that the perturbation of the cells should not change the amount of the protein or RNA molecules we are studying. A drastic change in protein or RNA abundance can introduce bias, which will make it difficult to precisely compare samples. 9. For each reaction, use 10 μL of iTaq Universal SYBR Green Supermix (Bio-Rad) containing dNTPs, MgCl2, DNA polymerase, and SYBR green dye; add 2.5 μL (300–500 nM) of forward primer, 2.5 μL (300–500 nM) of reverse primer, 2 μL of cDNA, and 3 μL molecular biology grade water.

114

Mai Baker et al.

References 1. Li X, Fu XD (2019) Author correction: Chromatin-associated RNAs as facilitators of functional genomic interactions. Nat Rev Genet 20(9):562 2. Tauber D, Tauber G, Parker R (2020) Mechanisms and regulation of RNA condensation in RNP granule formation. Trends Biochem Sci 45(9):764–778 3. Jayaseelan S, Doyle F, Tenenbaum SA (2014) Profiling post-transcriptionally networked mRNA subsets using RIP-Chip and RIP-Seq. Methods 67(1):13–19 4. Salton M, Voss TC, Misteli T (2014) Identification by high-throughput imaging of the histone methyltransferase EHMT2 as an epigenetic regulator of VEGFA alternative splicing. Nucleic Acids Res 42(22):13662–13673 5. Siam A, Baker M, Amit L, Regev G, Rabner A, Najar RA, Bentata M, Dahan S, Cohen K,

Araten S, Nevo Y, Kay G, Mandel-Gutfreund Y, Salton M (2019) Regulation of alternative splicing by p300-mediated acetylation of splicing factors. RNA 25(7):813–824 6. Salton M, Lerenthal Y, Wang SY, Chen DJ, Shiloh Y (2010) Involvement of Matrin 3 and SFPQ/NONO in the DNA damage response. Cell Cycle 9(8):1568–1576 7. Baker M, Petasny M, Bentata M, Kay G, Engal E, Nevo Y, Siam A, Dahan S, Salton M (2020) KDM3A regulates alternative splicing of cell-cycle genes following DNA damage. bioRxiv:2020.02.26.965970 8. Xu Y, Gao XD, Lee JH, Huang H, Tan H, Ahn J, Reinke LM, Peter ME, Feng Y, Gius D, Siziopikou KP, Peng J, Xiao X, Cheng C (2014) Cell type-restricted activity of hnRNPM promotes breast cancer metastasis via regulating alternative splicing. Genes Dev 28(11):1191–1203

Chapter 9 In Vivo Cross-Linking and Co-Immunoprecipitation Procedure to Analyze Nuclear tRNA Export Complexes in Yeast Cells Kunal Chatterjee and Anita K. Hopper Abstract tRNAs are small noncoding RNAs that are predominantly known for their roles in protein synthesis and also participate in numerous other functions ranging from retroviral replication to apoptosis. In eukaryotic cells, all tRNAs move bidirectionally, shuttling between the nucleus and the cytoplasm. Bidirectional nuclearcytoplasmic tRNA trafficking requires a complex set of conserved proteins. Here, we describe an in vivo biochemical methodology in Saccharomyces cerevisiae to assess the ability of proteins implicated in tRNA nuclear export to form nuclear export complexes with tRNAs. This method employs tagged putative tRNA nuclear exporter proteins and co-immunoprecipitation of tRNA-exporter complexes using antibodyconjugated magnetic beads. Because the interaction between nuclear exporters and tRNAs may be transient, this methodology employs strategies to effectively trap tRNA-protein complexes in vivo. This pulldown method can be used to verify and characterize candidate proteins and their potential interactors implicated in tRNA nuclear-cytoplasmic trafficking. Key words Co-immunoprecipitation, Formaldehyde-cross-linking, Western blot, RT-PCR, RTqPCR, Primary tRNA nuclear export, tRNA retrograde nuclear import, tRNA nuclear re-export

1

Introduction In eukaryotic cells, all tRNAs move bidirectionally between the nucleus and the cytoplasm; these movements function in some of the steps to process primary tRNA transcripts into mature, functional tRNAs and also serve for tRNA quality control [1]. These bidirectional tRNA movements through the nuclear pores consist of three main steps (Fig. 1) (reviewed in [2]). (1) Newly transcribed and partially processed nuclear tRNAs are exported to the cytoplasm in a step called primary tRNA nuclear export. (2) Retrograde nuclear import constitutes the second tRNA trafficking step, which relocates cytoplasmic tRNAs to the nucleus both constitutively and in response to environmental stresses. (3) tRNAs that were

Ren-Jang Lin (ed.), RNA-Protein Complexes and Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2666, https://doi.org/10.1007/978-1-0716-3191-1_9, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

115

116

Kunal Chatterjee and Anita K. Hopper

Free intron (4) Retrograde tRNA nuclear import

Fig. 1 Bidirectional nuclear-cytoplasmic shuttling of tRNAs in yeast cells. The diagram depicts tRNA nuclearcytoplasmic movement for tRNAs encoded by intron-containing tRNA genes. (1) Precursor tRNAs are transcribed with 5′ leader and 3′ trailer sequences that are removed by RNase P and 3′ end processing enzymes, respectively. (2) End-processed intron-containing pre-tRNAs are exported to the cytoplasm by at least three nuclear exporters: Los1, Mex67-Mtr2, and Crm1. (3) The introns are removed by the tRNA splicing endonuclease complex that is located on the mitochondrial surface; free introns are efficiently destroyed. (4) Cytoplasmic tRNAs are imported back to the nucleus via the tRNA retrograde nuclear import step. (5) tRNAs are returned to the cytoplasm by the tRNA nuclear re-export step. Blue lines indicate exons; red lines indicate the intron and the 5′-leader and 3′-trailer sequences

imported into the nucleus return to the cytoplasm by the tRNA nuclear re-export step. Each of the three steps of tRNA nuclearcytoplasmic movements are evolutionarily conserved [3–5]. With recent discoveries of the roles of tRNAs in multiple human diseases [6], it is important to identify the gene products involved in tRNA biogenesis and subcellular traffic and to understand the regulation of these steps. The best-described exporter participating in primary tRNA nuclear export is the conserved β-importin family member Los1 (Exp-t in vertebrates, Xpot in Schizosaccharomyces pombe and PAUSED in plants) [7–13]. Los1, like other β-importins, binds and exports cargo via a mechanism that is dependent on the GTPase Ran (Reviews [14–16]), [7, 13, 17–21]. However, Los1 and its orthologs are nonessential in all organisms tested, including haploid human cancer cell lines [10, 12, 22–25], indicating that there are parallel tRNA nuclear export pathways. Also, no ortholog

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

117

of Los1 has been identified in Drosophila sp., and a recent study discovered that Los1-independent tRNA nuclear export pathways exist in Trypanosomatids [26, 27]. To identify tRNA nuclear exporters working in parallel to Los1, a genome-wide screen was conducted, and it identified three candidate proteins (Mex67, Mtr2, and Crm1) to be involved in the tRNA primary nuclear export step in yeast, Saccharomyces cerevisiae [28, 29]. The screen utilized northern hybridization to assess the cellular levels of individual end-processed, intron-containing pre-tRNAs upon individual deletion/mutation of nearly all yeast open reading frames (ORFs) [28]. In budding and fission yeast, although pre-tRNA 5′ and 3′ end maturation occur in the nucleus (Review [30]), tRNA splicing takes place on the surface of mitochondria [31–33], so the accumulation of end-processed, introncontaining pre-tRNAs may indicate an inability of those pre-tRNAs to access mitochondrial splicing machinery due to faulty nuclear export. Employing RNA fluorescence in situ hybridization (FISH), Mex67, Mtr2, and Crm1 temperature-sensitive (ts) mutants were further shown to accumulate tRNAs in the nucleus when mutant cells were incubated at the nonpermissive growth temperature [28, 29]. However, neither northern analyses nor RNA FISH can distinguish whether these proteins function directly or indirectly in tRNA nuclear export. To function as a bona fide tRNA nuclear exporter, the candidate tRNA nuclear exporter must interact with tRNA in vivo to form nuclear export complexes. Therefore, we developed a methodology that allows for the isolation of tRNA-nuclear export complexes formed in vivo [34]. The method employs formaldehyde cross-linking and immunopurification of candidate tagged tRNA nuclear exporter proteins via magnetic beads conjugated with antibodies specific to the tags (Fig. 2). It is imperative to assure that tagging does not affect the function of tRNA nuclear exporters. This can be accomplished by assessing the consequences of the tags on cellular viability, growth rate, and pre-tRNA splicing [29, 33]. The formaldehyde crosslinking and immunopurification assay can be performed either by over-expressing the tagged putative nuclear exporter protein from a multi-copy plasmid [20, 29] or by expressing the protein from its endogenous chromosomal locus (Chatterjee et al. [36], in revision). We prefer to perform the formaldehyde cross-linking and immunopurification assay utilizing endogenously expressed proteins for three reasons: (i) over-expression of certain putative tRNA nuclear exporter proteins, like Crm1, is detrimental to cell growth (Chatterjee et al. [36], in revision); (ii) over-expression of tRNA nuclear exporters may incorrectly assess the efficiencies of nuclear exporter interactions with tRNAs. For example, we reported that the heterodimeric Mex67-Mtr2 complex substitutes for Los1 in yeast cells when over-expressed ~fivefold, but not when expressed at endogenous levels [29]; (iii) over-expression of proteins may lead to cellular mislocalization [33].

118

Kunal Chatterjee and Anita K. Hopper

Ran Exporter Nucleus

tRNA

Cryo-lysis Cross -linking

Yeast-cell pellet

Yeast cell Nucleus

Cell-grindate

Liquid N2 Reverse Cross-linking

Protein isolation

Lysate Filtration

Binding. 30 min, 4∘C

Washing

Reverse Cross-linking

RNA isolation

Sypro-ruby + Western blot

RT-PCR + RT-qPCR

Antibody coupled magnetic beads

Fig. 2 Strategy for the in vivo cross-linking co-immunoprecipitation process. Cross-linked yeast cells co-expressing tagged putative tRNA nuclear exporters are harvested, lysed by cryo-milling and stored at 80 °C. The powdered cells are mixed with extraction buffer, centrifuged, and filtered. After incubation with anti- green fluorescent protein (GFP) antibody-conjugated magnetic beads, RNP complexes are isolated via a magnet, washed, uncross-linked, eluted under denaturing conditions, and protein and RNA components are analyzed (Figure modified from Oeffinger et al. [35])

To obtain tRNA-exporter complexes, which do not dissociate during isolation, two strategies have been adopted. The first strategy is to employ formaldehyde cross-linking. Formaldehyde treatment results in formation of covalent bonds between RNA and protein as well as between interacting proteins, thus, stabilizing transient interactions between the tRNA and nuclear exporter proteins and their putative adaptors. This strategy is especially effective for maintaining tRNA binding to nuclear exporters like the Mex67Mtr2 heterodimer, which is not a β-importin complex and does not employ the RanGTP-RanGDP nuclear-cytoplasmic gradient for tRNA nuclear export. The second strategy combines formaldehyde cross-linking and inhibition of RanGTP hydrolysis to RanGDP (Fig. 2). Since Los1 and Crm1 are β-importins, they bind their RNA cargoes in the presence of guanosine triphosphate (GTP) bound form of Ran. Dissociation of exportins from their cargos results from the hydrolysis of RanGTP to RanGDP. Therefore, inhibition of hydrolysis of

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

119

RanGTP to RanGDP results in the nuclear exportins remaining associated with cargo. Thus, a nonhydrolyzable RanGTP (Gsp1G21V)-locked mutant construct is employed to maintain export complexes. In contrast, a predominantly guanosine diphosphate (GDP) bound Ran will prevent exportin-cargo complex formation [37], and thus, a RanGDP (Gsp1-T24N)-locked mutant construct expressed in yeast cells serve as an internal negative control. Since expression of Ran-locked mutant proteins results in dominant lethality [38], Ran constructs encoding RanGTP-locked or RanGDP-locked mutants should be expressed from inducible promoters for a limited time. It is also important to verify whether the subcellular distributions of the exportins are maintained for the duration of Ran mutant protein induction, as prolonged expression of RanGTP-locked mutant has been shown to alter the subcellular distribution of β-importin tRNA nuclear exporters [34]. Cross-linked yeast cells expressing tagged exporter proteins and, when appropriate, the Ran-locked mutants are harvested and cryogenically ground using a planetary ball mill cell following the well-established protocol from the Rout lab (http://lab.rockefeller. edu/rout/pdf/protocols/Cryogenic_Disruption_of_Yeast_Cells_ PM100.pdf) [35]. Manipulation of the yeast cell “grindates” at very low temperatures (ranging from -80 °C during storage to 196 °C when cooled in liquid nitrogen) prevents ribonucleoprotein particles (RNP) of interest from being degraded by proteases and/or nucleases. The resultant lysates containing the tagged exporter proteins cross-linked to RNA are then bound and subsequently immunopurified by anti-tag antibody coated magnetic beads (see Notes 1 and 2). The co-immunoprecipitation fractions are divided into two pools—one for protein and the other for RNA analyses. The pulldown protein fractions are heated to reverse cross-linking, and then, the proteins are resolved on polyacrylamide gels for staining and Western blot analyses. Protein staining assesses enrichment of proteins with the anticipated molecular weight of tagged exporters, as shown in Fig. 3a. The identity of the enriched proteins observed by protein stain are verified by Western blots using antibody against the tags (Fig. 3b). Moreover, for pull-down experiments using β-importins, successful co-immunoprecipitations should show substantial co-enrichment of Ran as determined by the employment of anti-Ran (Gsp1) antibodies (Fig. 3b). In contrast, the level of Ran co-purifying with tRNA exporters in GDP-locked form should be low. The identity of the RNAs that co-purified with the tagged tRNA nuclear exporters are revealed by analyzing the RNA fractions using reverse transcription polymerase chain reaction (RT-PCR) (Fig. 3c–f). For those yeast tRNAs that are encoded by intron-containing tRNA genes, the primary tRNA nuclear exporter proteins must bind intron-containing tRNAs. To identify whether

120 A

Kunal Chatterjee and Anita K. Hopper B Western Blot

Sypro Ruby Crm1-GFP Ran Ran GTP GDP

Crm1-GFP

260

C

Crm1-GFP Ran Ran GTP GDP

WT Ran GTP

WT Ran GTP

260

Crm1-GFP Ran GTP

Ran GDP

WT

-RT

Ran GTP

125 100 75

Crm1-GFP

160 125

160

RT-PCR

125 100 75

Intron-containing pre-tRNAIleUAU

110

D 75 50 25

80

70 60

75 50 25 Spliced tRNAIleUAU

E 50 40

100 75 50

38

Mitochondrial tRNAIleGAU

30

Ran

30

20

F 125 125 100 100 75 75

125 100 75 TLC1 RNA

M

1

2

3

M

1

2

3

1

2

3

M

Fig. 3 In vivo co-immunoprecipitation assay to identify tRNA pulled down by tagged tRNA nuclear exporters. (a) SYPRO® RUBY staining of proteins enriched by immunoprecipitation employing anti-tag antibody-conjugated magnetic beads. Lane M: Molecular size markers. Lane 1: yeast cells co-expressing green fluorescent protein (GFP)-tagged Crm1 and RanGTP (Gsp1-G21V) locked-mutant. Lane 2: yeast cells co-expressing GFP-tagged Crm1 and RanGDP (Gsp1-T26N) locked-mutant Lane 3: BY4741 yeast cells expressing RanGTP-locked mutant. (b) Western blot analyses to confirm the identities of the proteins enriched and stained in (a). Note: (a) and (b) are two separate gels. Lane M: Molecular size markers. Lane 1: yeast cells co-expressing GFP-tagged Crm1 and RanGTP (Gsp1-G21V) locked-mutant. Lane 2: yeast cells co-expressing GFP-tagged Crm1 and RanGDP (Gsp1-T26N) locked-mutant Lane 3: BY4741 yeast cells expressing RanGTP -locked mutant. (c–f) Reverse transcription polymerase chain reaction (RT-PCR) analyses of RNAs co-immunoprecipitated with RNA nuclear exporters: (c) intron-containing tRNA; (d) spliced tRNA; (e) mitochondrial tRNA; (f) TLC1 RNA; Lane 1: yeast cells co-expressing GFP-tagged Crm1 and RanGTP (Gsp1-G21V) locked-mutant. Lane 2: yeast cells co-expressing GFP-tagged Crm1 and RanGDP (Gsp1-T26N) locked-mutant. Lane 3: BY4741 yeast cells expressing RanGTP -locked mutant. Lane M: Molecular size markers. Diagrams of primers utilized for RT-PCR reactions are indicated next to panels (c–f). Black boxes: exons; gray box: intron sequences; slash: splice junction

unspliced pre-tRNAs co-enrich with immunoprecipitated proteins, reverse transcription reactions (RT) are performed on RNAs obtained after reversing the formaldehyde covalent cross-links; these reactions employ reverse primers complementary to the intron sequences of the tRNAs, followed by PCR reactions using the same reverse primer as used in RT reaction and a forward primer that corresponds to sequences in the 5′ exon (Fig. 3c). For studies of protein members of the β-importin family, the RT-PCR assay should demonstrate robust enrichment of intron-containing pre-tRNA with the tRNA nuclear exporter in the presence of RanGTPlocked mutant but not in cells expressing GDP-locked mutants (Fig. 3c). For conducting assays with tRNA nuclear exporters that are not members of the β-importin family such as the heterodimeric Mex67-Mtr2, a tagged, mutated form of the protein, mex67-5 [39], previously shown to display tRNA nuclear export defects [29], can be employed as a negative control.

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

121

Since in yeast, pre-tRNA splicing occurs on the cytoplasmic surface of mitochondria after the primary tRNA nuclear export process [31], a nuclear exporter will be implicated in tRNA re-export step if it is able to bind the spliced form of a tRNA encoded from an intron-containing tRNA gene (Fig. 1, Arrow #5). Using a reverse primer complementary to sequences spanning the 5′ and 3′ exon junction and a forward primer corresponding to the 5′ exon (Fig. 3d), the RT-PCR can assess whether spliced tRNA co-immunoprecipitate with a tRNA nuclear exporter in the tRNA re-export step. Using this strategy, all the three nuclear exporters (Los1, Mex67-Mtr2, and Crm1) in yeast have been shown to form nuclear export complexes for both the tRNA primary and the tRNA re-export steps ([20, 29] and Chatterjee et al., 2022, in revision) (Fig. 3c,d). Various other controls are included in RT-PCR experiments to validate the co-enrichment of unspliced and spliced tRNAs with the various nuclear exporters. Since nuclear-cytoplasm shuttling proteins such as Los1, the Mex67-Mtr2 heterodimer, and Crm1 are not known to associate with the mitochondrial matrix in vivo, mitochondrial-encoded tRNAIleGAU has been employed as negative control to assess contaminating RNAs that may co-purify with the protein that has been enriched. To detect low levels of mitochondrial RNAs, RT-PCR reactions are amplified by increasing the number of PCR cycles or by increasing the reverse primer concentrations used in reverse transcription reactions. For β-importin such as Crm1, equivalent low levels of mitochondrial tRNAIleGAU in the pull-down fractions from cells with exportins and Ran in the GTP-locked form as well as the GDP-locked form document that there are equivalent very low levels of contamination from the mitochondrial compartment in the co-IP enrichments (Fig. 3e). For non β-importins like Mex67-Mtr2, equivalent low levels of mitochondrial tRNAIleGAU should be observed in the pull-down fractions from cells with functional exportins and the nonfunctional mutant form of the protein, demonstrating equivalent background contamination in both the pull-down fractions. Previously characterized RNA cargoes exported by individual tRNA exporters can be amplified from the pull-down total RNA fractions and thereby serve as positive controls. For example, TLC1, a known noncoding RNA, cargo for the Crm1 nuclear exporter [40], was found to bind to green fluorescent protein (GFP)-tagged Crm1 expressing Ran in the GTP-locked but not Ran in the GFP-locked form [40] (Fig. 3f). Overall, the potential of the in vivo co-immunoprecipitation methodology to contribute to the field of tRNA biology is extensive. For example, we demonstrated that individual tRNA nuclear exporters exhibit tRNA family preferences for nuclear export and that there is cooperation among the three nuclear exporters to maintain the cytoplasmic pool of tRNAs (Chatterjee et al., 2022, in revision).

122

Kunal Chatterjee and Anita K. Hopper

The formaldehyde cross-linking and immunopurification assay can also be utilized to assess whether potential candidate participate in the tRNA retrograde import. For example, co-IP studies of Mtr10 revealed that this putative nuclear importer may not be directly involved in the tRNA retrograde import step, despite a host of genetic and cytological data suggesting otherwise [20, 41, 42]. Overall, use of the in vivo cross-linking and co-immunoprecipitation method will not only lead to the discovery of novel tRNAprotein interactions, but it should lead to the identification and characterization of additional proteins involved in various aspects of tRNA biology.

2

Materials

2.1 Formaldehyde Cross-Linking and Cryolysis of Yeast Cells

1. Yeast cells expressing tagged tRNA nuclear export proteins. Cells, expressing tagged tRNA nuclear exporters utilizing the Ran gradient for tRNA nuclear export such as Los1 and Crm1 are transformed with a single-copy plasmid (pRS415, Leu+) encoding either the RanGTP (Gsp1-G21V)-locked mutant or the RanGDP (Gsp1-T24N)-locked mutant protein, expressed from an inducible Gal promoter. Transformation of yeast cells with Ran-locked mutants is not necessary while performing co-immunoprecipitation assays with non-karyopherin tRNA nuclear exporters such as Mex67-Mtr2. 2. 1.35 L of synthetic defined media lacking appropriate selectable nutrients and containing 2% Raffinose (final concentration) as the carbon source. Dissolve 9.0 g of yeast nitrogen base without amino acids (DIFCO), 1.74 of amino acid premix without uracil (or 1.66 g of amino acid premix without uracil and leucine, where applicable), and 27 g of Raffinose (Thermo Fisher Scientific) in 900 mL double-distilled water. Adjust volume to 1.35 L. 3. 20% galactose stock solution (only for cultures that require galactose-mediated induction of Ran mutants). Dissolve 100 g of galactose to 350 mL of autoclaved double-distilled water with very gentle heating; adjust volume to 500 mL. 4. 37% Formaldehyde stock solutions (Fisher BioReagents). 5. 2 M Glycine stock solution. Dissolve 75 g of glycine in 400 mL of autoclaved double-distilled water; adjust the volume to 500 mL. 6. Resuspension buffer. 20 mM HEPES, pH 7.5, and 1.2% polyvinylpyrrolidone (PVP). Dissolve 2.383 g of HEPES and 6.0 g PVP in 500 mL of autoclaved double-distilled water. Adjust the pH to 7.5 using 1 N NaOH. Add the following solutions to the volume of buffer to be used.

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

123

• 1:100 dilution of PIC (Protease inhibitor cocktail IV, Millipore Sigma). • 1:100 dilution of Solution P (Stock solution: 90 mg of PMSF +500 μL of Pepstatin A dissolved in 4.5 mL of 100% Ethanol). • 1:1000 dilution of 1 M Dithiothreitol (DTT), stored at -20 °C. • PIC, Solution P, and DTT should be added just before use. 2.2 CoImmunoprecipitation

All buffers and solutions should be ice-cold before use, unless indicated otherwise. 1. 1 M HEPES, pH 7.4. 2. 1 M KOAc. 3. 1 M MgCl2. 4. 5 M NaCl. 5. TritonX 100. 6. 10% Tween 20 solution. Dissolve 100 mL of Tween 20 solution in 800 mL of autoclaved double-distilled water with gentle stirring. Adjust volume to 1 L. 7. 1 M DTT solution. Dissolve 1.54 g of DTT in 10 mL of autoclaved double-distilled water. Filter sterilize. Store at -20 °C as 1 mL aliquots. 8. 100 μg/μL Heparin Solution. 9. 40 mM of GTP stock solution: Add 40 μL of 100 mM GTP (stored at -20 °C) to 60 μL of autoclaved double-distilled water. 10. Extraction buffer: 20 mM HEPES, pH 7.4, 110 mM KOAc, 40 μM MgCl2,100 mM NaCl, 0.5% Triton, 0.1% Tween-20, 0.05 mM DTT, 0.24 μg/μL Heparin Sodium,1:1000 dilution of protease inhibitor cocktail set IV (EMD Millipore), 1:1000 dilution of Solution P (see Subheading 2.1), 1:1000 dilution of Antifoam A (prevents foam formation while dissolving aqueous systems containing protein), and 1:5000 dilution of RNase inhibitor (RNaseOUT, Invitrogen). This is made by combining 1 mL of 1 M HEPES, pH 7.4, 5.5 mL of 1 M KOAc, 1 mL of 5 M NaCl, and 2 μL of 1 M MgCl2 in 25 mL of autoclaved double-distilled water. Mix. Add 2.5 mL of 10% Triton X-100 solution, 500 μL of 10% Tween20 solution, 2.5 μL of 1 M DTT solution, 120 μL of 100 μg/μL Heparin solution. Mix. Just before use, add 50 μL of Solution P, 50 μL of PIC, 50 μL of antifoam A, and 10 μL of RNaseOUT ™ Recombinant RNase Inhibitor. Adjust volume to 50 mL (see Note 3).

124

Kunal Chatterjee and Anita K. Hopper

11. Wash buffer A: 20 mM HEPES, pH 7.4, 110 mM KOAc, 40 μM MgCl2, 0.5% Triton, 0.1% Tween-20, 0.05 mM DTT, 0.24 μg/μL of Heparin Sodium,1:1000 dilution of protease inhibitor cocktail set IV (EMD Millipore), 1:1000 dilution of Solution P, 1:1000 dilution of Antifoam A and 1:5000 dilution of RNase inhibitor (RNaseOUT). Mix 1 mL of 1 M HEPES, pH 7.4, 5.5 mL of 1 M KOAc, and 2 μL of 1 M MgCl2 in 25 mL of autoclaved double-distilled water. Add 2.5 mL of 10% Triton X-100 solution, 500 μL of 10% Tween20 solution, 2.5 μL of 1 M DTT solution, 120 μL of 100 μg/μL Heparin solution. Mix. Just before use, add 50 μL of Solution P, 50 μL of PIC, 50 μL of antifoam, and 10 μL of RNaseOUT™ Recombinant RNase Inhibitor. Bring volume to 50 mL. 12. Wash Buffer B: 0.1 M NH4OAc, 0.1 mM MgCl2, 0.02% Tween-20. Add 100 μL of 1 M NH4OAc and 1 μL of 1 M MgCl2 to 5 mL autoclaved double-distilled water. Mix. Add 20 μL of 10% Tween 20, volume to 10 mL with autoclaved double-distilled water. 13. Protein elution buffer: 0.5 M NH4OH, 0.5 mM EDTA. Add 690 μL of 7.4 M NH4OH and 10 μL of 0.5 M EDTA in 9.3 mL of autoclaved double-distilled water to make a total volume of 10 mL working solution. Protein elution buffer should be made just before use. 14. RNA elution buffer: 50 mM Tris-HCl, pH 7.4,10 mM EDTA, 1% SDS, 10 mM DTT. Add 1 mL of 10% SDS solution to 8 mL autoclaved double-distilled water. Mix. Add 500 μL of 1 M Tris–HCl, pH 7.4, 200 μL of 0.5 M EDTA, pH 8.0 solution, and 100 μL of 1 M DTT solution. Bring volume to 10 mL. 15. Proteinase K (20 mg/mL) (NEB). 16. Phenol saturated with Tris buffer (pH 4.4) (Fisher Scientific). 17. 100% ethanol (Store at 4 °C). 18. Glycoblue precipitant 15 mg/mL (Ambion). 19. 70% ethanol (Store at 4 °C). 20. 1.6 μm Whatman GD/X sterile glass microfiber syringe filter (Sigma Aldrich). 2.3 Gel Electrophoresis of Proteins

1. 4–12% NuPAGE Novex Bis-Tris precast gels (Life Technologies) or equivalent gel systems. 2. NuPAGE™ MOPS SDS Running Buffer stock solution (Life Technologies). Add 25 mL of stock solution to 475 mL double-distilled water, mix. Store at 4 °C. Add 1.25 mL of NuPAGE™ Antioxidant (Life Technologies) before electrophoresis.

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

125

3. 4× LDS protein-loading buffer: Lithium dodecyl sulfate (LDS), pH 8.5, SERVA Blue G250 and phenol red (Invitrogen). 4. 1 M DTT solution (Dissolve 1.54 g of DTT in 10 mL of autoclaved double-distilled water. Filter sterilize. Store at 20 °C as 1 mL aliquots). 5. Novex™ Sharp Unstained Protein Standard (Invitrogen) or equivalent for protein stain. 6. Chameleon® Duo Pre-stained Protein Ladder (LI-COR Biosciences) or equivalent for Western blot. 2.4

Protein Staining

1. SYPRO® RUBY Protein Gel Stain (Molecular Probes). 2. Fix solution: 50% methanol, 7% acetic acid. Add 500 mL of reagent grade methanol and 70 mL of reagent grade acetic acid to 430 mL double-distilled water, for a final volume of 1 L. Mix. 3. Wash solution: 10% methanol, 7% acetic acid. Mix 100 mL of reagent grade methanol and 70 mL of reagent grade acetic acid to 830 mL with double-distilled water for a final volume of 1 L. Mix.

2.5

Western Blot

1. PVDF membrane (BIORAD). 2. Western blot transfer buffer: 0.025 M Tris–HCl, 0.192 M glycine, 20% methanol. Mix 6.04 g of Tris, 37.6 g of glycine, and 400 mL of reagent grade methanol with 1.5 L doubledistilled water, after mixing, bring total volume to 2 L with double-distilled water. 3. Tris-buffered saline (TBS; 1×): 120 mM NaCl, 20 mM Tris– HCl, pH 7.4. Add 20 mL of 1 M Tris-HCl, pH 7.4 stock solution, and 24 mL of 5 M NaCl stock solution and bring up volume to 1 L with double-distilled water. 4. TBS containing 0.1% Tween-20 (TBST). Use 995 mL of 1× TBS from recipe above. Add 5 mL of 20% Tween20 solution for a total volume of 1 L. 5. Blocking solution: 5% milk in TBST. Dissolve 5 g of nonfat instant dry milk in 100 mL of TBST buffer. Store at 4 °C. 6. Anti-GFP/Protein A antibody (Mouse) (AbCam). 7. Anti-Ran primary antibody (AbCam). 8. IR dye tagged anti-IgG secondary antibodies (LI-COR Biosciences) (or Horse radish peroxidase conjugated secondary antibodies, if employing Chemiluminescence (AbCam)). 9. Filter paper (Cytiva). 10. Horse-radish Peroxidase (HRP) substrate (Pierce).

126

Kunal Chatterjee and Anita K. Hopper

2.6 RT-PCR and RTqPCR

1. TURBO DNA-free™ Kit (Invitrogen) containing DNase enzyme, buffer, and DNase inactivation agent to terminate DNase activity. 2. Phenol, saturated with TE Buffer (pH 4.4) (Fisher Scientific). 3. 100% ethanol. 4. GlycoBlue Scientific).

precipitant

(15

mg/mL)

(Thermo

Fisher

5. 4× Superscript III Reverse Transcriptase First strand buffer (Invitrogen). 6. 100 mM DTT solution (Invitrogen). 7. Superscript III Reverse Transcriptase Enzyme (Invitrogen). 8. RNaseOUT™ Recombinant RNase Inhibitor (Invitrogen). 9. 5× GoTaq Flexi Polymerase Buffer (Promega). 10. 25 mM MgCl2 (Promega). 11. 10 mM dNTP Mix. 12. 5× GoTaq Flexi Polymerase enzyme (Promega). 13. PowerUp SYBR Green Master Mix. 14. Oligonucleotide primers for tRNA analyses. In choosing primers for tRNA analyses, the following are considered: (a) To detect unspliced tRNAs, reverse primers are designed to hybridize to tRNA introns and forward primers bind to the 5′ exons. (b) To detect spliced tRNAs, the reverse primers are designed to hybridize to sequences spanning tRNA splice junction and forward primers bind to the 5′ exons. (c) The primers shall be at least 18 bases in length, with a preferable GC content between 40% and 60% and less than 10 °C difference in melting temperature between the primer pairs. (d) Regions in tRNA sequences that have modified nucleotides such as m22G can inhibit or slow the progress of Reverse Transcriptase enzyme [1, 43]. To avoid such problems, the reverse probe sequence can include this region so that the modified nucleotide is “covered” or the position of the probe should be complementary to positions such that RT extension does not encounter such modified nucleotides. For example, we provide the primer sequences employed for RT-PCR and RT-qPCR reactions for unspliced and spliced tRNAIIle le UAU, mitochondrial tRNA GAU and TLC1 RNA (Table 1).

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

127

Table 1 Primer sequences for RT-PCR and RT-qPCR reactions Primer Name

Sequence

Ivy 1 Forward primer for 5′ exon of tRNAIleUAU

5′-GCTCGTGTAGCTCAGTGGTTAG-3′

IVY3 Reverse primer for intron of tRNAIleUAU

5′-CTTTAAAGGCCTGTTTGAAAG-3′

IVY149 Reverse primer for splice junction of tRNAIleUAU

5′-ACGGTCGCGTTATAAGCACGA-3′

KC107 Forward primer for mitochondrial tRNAIleGAU

5′-GAAACTATAATTCAATTGGTT-3′

KC108 Reverse primer for mitochondrial tRNAIleGAU

5′-TGGTGAAACTAACAGG-3′

KC057 Forward primer for TLC1 RNA

5′- AAGCCTACCATCACCACACC -3′

KC058 Reverse primer for TLC1 RNA

5′- AAACAGCGAACTCGTGCAAA -3′

2.7 Agarose Gel Electrophoresis

1. 10× TBE buffer. Dissolve 108 g Tris and 55 g Boric acid in 900 mL distilled water. Add 40 mL 0.5 M Na2EDTA, pH 8.0. Bring volume to 1 L. 2. 2% Agarose Gel. 2.0 g Agarose is dissolved in 10 mL of 10× TBE buffer and 90 mL of double-distilled water. 3. 25 bp ladder (Promega).

3

Methods

3.1 In Vivo CrossLinking

1. Inoculate from glycerol stocks (stored at -70 °C) of yeast cells expressing tagged tRNA nuclear exporters (and RanGTP/ GDP-locked mutants, where applicable) in 10 mL of appropriate selection media containing 2% raffinose as the carbon source. Incubate for a day in a shaker incubator at 30 °C until 0.4–0.6 OD600 (see Note 4). 2. Inoculate ~7.5 × 107 cells to 1.35 L of appropriate selective media containing 2% raffinose and incubated at 30 °C until 0.4–0.6 OD600. This takes approximately 16 to 18 h. 3. Add 150 mL of 20% galactose solution to the cultures (final volume 1.5 L, 2% final concentration) to induce expressions of the RanGTP-locked or RanGDP-locked proteins for 1 h at 30 ° C. This step is only applicable for cells expressing tRNA exporters that are β-importins like Los1 and Crm1 and RanGTP/ GDP-locked mutants.

128

Kunal Chatterjee and Anita K. Hopper

4. Add 12.1 mL of 37% Formaldehyde stock solution (0.3% final concentration) into the cultures to induce chemical crosslinking of RNA and protein. 5. After 30 min, quench extra formaldehyde by adding of 49.5 mL of 2 M glycine solution to a final concentration of 66 mM. Incubate for 10 min. 6. Harvest cells and generate cell pellet noodles using the protocol from the Rout lab (see Note 5). The cells can be stored at -80 °C at this point for a few months. 7. Cryogenically lyse the frozen cells using a planetary ball mill following the protocol from Rout lab (see Note 6). The powdered cells can be stored at -80 °C. 3.2 Immunoprecipitation of tRNATagged Export Complexes

1. Suspend 0.5 mg of frozen, ground cells in 4.5 mL of extraction buffer. 2. Add 1.25 μL of 40 mM of GTP to the extracts from tagged export proteins and from untagged WT cells that contain RanGTP-locked constructs. 3. Preclear lysates by centrifugation at 3000 × g at 4 °C for 10 min. 4. While the lysates are being centrifuged, equilibrate 30 μL of antibody-conjugated magnetic beads (per sample) twice with equivalent amount of binding buffer. 5. The soluble extract (supernatant) was further clarified by passing through a 1.6 μm GD/X sterile glass microfiber syringe filter. 6. Transfer 50 μL of the total lysate into fresh 1.5 mL microcentrifuge tubes and flash freeze in liquid nitrogen. Store tubes at -80 °C. 7. Incubate the remainder of the lysate (~ 4.4 mL) with the 30 μL equilibrated antibody-conjugated magnetic beads (from step 4) at 4 °C for 30 min on a nutator. 8. Collect beads with a magnet, wash six times with 1 mL of ice-cold Wash Buffer A and once with 1 mL ice-cold Wash Buffer B. The beads are suspended into 1 mL Wash Buffer B and divided into two equal fractions of 500 μL. 9. 500 μL of one bead fraction is employed for protein extraction. Collect beads with a magnet. 10. To elute the proteins, incubate the beads with 1 mL of freshly prepared protein elution buffer for 20 min at room temperature in 1.5 mL microcentrifuge tubes. 11. Transfer the eluant into a fresh 1.5 mL tightly capped microcentrifuge tube and flash freeze in liquid nitrogen. Before freezing, puncture a small hole on the cap of the tubes.

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

129

12. Lyophilize eluates overnight employing a Speed Vac. 13. Suspend the lyophilized pellets in 50 μL of autoclaved doubledistilled water, intermittently keeping the tubes on ice while suspending. 3.3 SYPRO® RUBY Staining

1. Mix 5 μL of total lysate (frozen in Subheading 3.2, step 6) with 5 μL of 4× LDS protein-loading buffer containing 50 mM DTT and 10 μL of autoclaved double-distilled water. Heat at 95 °C for 30 min to disassemble the putative complexes crosslinked by formaldehyde in a total volume of 20 μL. 2. For protein staining using SYPRO® RUBY (Molecular probes), mix 15 μL of immunoprecipitated protein samples (Subheading 3.2 step 13) with 5 μL of 4× LDS protein-loading buffer containing freshly added 50 mM DTT and heat at 95 °C for 30 min. Put samples on ice. Add 5 μL of Novex prestained protein ladder (or equivalent) in a separate well from wells with 20 μL co-immunoprecipitated protein samples and lysates. 3. Resolve the protein samples employing 4–12% NuPAGE Novex Bis-Tris precast gels or equivalent and 1× NuPAGE™ MOPS SDS Running Buffer containing antioxidant at 200 V for 45 min in a cold room (4 °C). 4. For gels containing protein samples for SYPRO® RUBY staining, after electrophoresis, pry the plastic gel plates open. Cut off the wells of the gel and just below the dye front. 5. Place the gel into a clean container with 100 mL of the Fix solution (see Subheading 2.4) and agitate on an orbital shaker for 30 min. Repeat once with fresh Fix solution. Pour off the used Fix solution. 6. Add 60 mL of SYPRO® RUBY gel stain. Agitate on an orbital shaker overnight. 7. Transfer the gel to a clean container and rinse with 100 mL of the Wash solution (see Subheading 2.4) for 30 min. This washing step minimizes background staining irregularities and stain speckles on the gel. 8. Rinse gel in double-distilled water a minimum of two times for 5 min to prevent possible corrosive damage to the imager before imaging. 9. Visualize gels using a 300 nm UV transilluminator (see Note 7).

3.4 Western Blot of Immunoprecipitated Proteins

1. Mix 5 μL of immunoprecipitated protein extracts (from Subheading 3.2, step 13) in 5 μL of 4× LDS protein-loading buffer containing freshly added 50 mM DTT and 10 μL of autoclaved double-distilled water and heat at 95 °C for 30 min. Put samples on ice.

130

Kunal Chatterjee and Anita K. Hopper

2. Resolve the protein samples employing 4–12% NuPAGE Novex Bis-Tris precast gels or equivalent and 1× NuPAGE™ MOPS SDS Running Buffer containing antioxidant at 200 V for 45 min in a cold room (4 °C). 3. After electrophoresis, pry the plastic gel plates open. Cut off the wells of the gel and just below the dye front. Remove any gel fragments that could interfere with the subsequent transfer step. 4. Cut a piece of PVDF membrane to the size of the gel. Cut a small piece off the top left corner of the membrane. Assemble the transfer cassette in a glass container containing 1× Transfer buffer. The order of assembly on the transfer cassette is as follows: one foam pad, three sheets of filter paper (cut approximately to the same size as the membrane), the membrane (with the cut corner oriented at the top left), the gel, three more sheets of filter paper, and another foam pad to form a supported “gel sandwich.” Seal the cassette. The cassette is placed vertically in a tank between platinum wire electrodes, and the tank is filled with transfer buffer. Transfer electrophoretically at 0.3 A for 1 h at 4 °C. 5. Following transfer of proteins to PVDF membrane, disassemble the cassette. Orient the membrane with the protein side facing up (the cut corner should be at the top left). It is very important that the blot does not dry at this point. 6. Place the membrane in a clean container and submerge membrane with 10 mL of blocking solution for 1 h at room temperature on an orbital shaker with gentle mixing. 7. After 1 h, pour off blocking solution and rinse membrane with 10 mL of 1× TBST for 5 min. 8. Add 10 mL of 1× TBST solution containing 0.5% milk and manufacturer recommended dilutions of primary antibodies to the membrane. Incubate for 1 h at room temperature on an orbital shaker with gentle mixing. 9. Pour off antibody solution and wash membrane three times with 1× TBST solution for 5 min each on an orbital shaker with gentle mixing at room temperature. 10. Incubate the membrane with 1× TBST solution containing 0.5% milk and manufacturer’s recommended dilutions of InfraRed Dye tagged secondary antibodies (LICOR) or horse radish conjugated secondary antibodies (Abcam) for 1 h at room temperature on an orbital with gentle shaking. 11. Pour off antibody solution and wash membrane three times with 1× TBST solution for 5 min each on an orbital with gentle shaking at room temperature.

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes

131

12. If using LI-COR ODYSSEY platform machine for imaging, rinse membrane twice with 1× TBS for 5 min each on an orbital with gentle shaking at room temperature as residual Triton X100 can damage the machine. 13. After step 12, the gel can be imaged immediately if using LI-COR ODYSSEY platform machine. If gel is imaged by chemiluminescence, the blot can be imaged after addition of HRP substrate, according to manufacturer’s instruction. 3.4.1 RT-PCR Analysis of Co-Immunoprecipitated RNA

1. The second bead fraction from Subheading 3.2, step 8 is used to obtain co-immunoprecipitated RNA. Collect the magnetic beads suspended in Wash Buffer B at 4 °C using a magnet and resuspend the beads in 200 μL of RNA elution buffer, followed by 70 °C incubation for 45 min. 2. Incubate samples with 1 μL of Proteinase K (20 mg/mL) for 30 min at 30 °C. 3. Extract enriched RNAs using 200 μL of acid phenol pH 4.4. Briefly vortex, centrifuge at 7840 × g for 10 min at 4 °C. 4. Carefully collect supernatant in a fresh 2 mL autoclaved microcentrifuge tube and precipitate RNA with 600 μL of ice-cold 100% EtOH and 0.5 μg of GlyoBlue coprecipitant, overnight at -80 °C. 5. Collect RNA pellet by centrifuging at 17,860 × g, for 10 min at 4 °C. A tiny blue pellet should be visible after centrifugation. 6. Carefully remove and discard supernatant without disturbing the pellet and wash the pellet with 600 μL of ice-cold 70% ethanol solution. 7. Centrifuge at 17,860 × g, for 10 min at 4 °C. 8. Carefully remove and discard supernatant without disturbing the pellet. 9. Air-dry the tubes at room temperature for 10 min to remove residual ethanol. 10. Add 43 μL of autoclaved double-distilled water to the tubes and gently tap to dissolve the pellet. 11. Incubate the tubes at 55 °C in a water bath for 15 min. Briefly spin to collect condensate. Put tubes on ice. 12. Add 5 μL of Turbo DNase buffer and 2 μL of Turbo DNase in each tube. Incubate tubes at 37 °C for 30 min. 13. Add 5 μL of DNase inactivation reagent and incubate at room temperature for 5 min with intermittent tapping. 14. Centrifuge samples at 7840 × g for 90 s. 15. Carefully transfer supernatant to a fresh tube. 16. Measure total RNA concentration using a NanoDrop microvolume spectrophotometer (Thermo Fisher Scientific) or equivalent machine (see Notes 8 and 9).

132

Kunal Chatterjee and Anita K. Hopper

17. Prepare samples for reverse transcription reactions: In a 1.5 mL tight capped micro-centrifuge tube, add 10 ng of co-immunoprecipitated total RNA, 1 μL of 2 μM of reverse primer (specific to the tRNA specific sequences as described in Subheading 2.7), 1 μL of 10 mM dNTP solution and adjust volume to 13 μL with autoclaved double-distilled water (see Note 9). 18. Heat tubes at 65 °C for 5 min. Chill on ice for 5 min. Briefly centrifuge to collect condensate. 19. To each tube, add 4 μL of 5× First strand buffer, 1 μL of 0.1 M DTT, 1 μL RNaseOUT™ Recombinant RNase Inhibitor and 1 μL of Superscript III reverse transcriptase to make a total volume of 20 μL. Mix gently. Incubate tubes at 42 °C for 1 h. 20. After 1 h, briefly centrifuge the tubes to collect condensate. 21. Inactivate the reaction by incubating the tubes at 70 °C for 15 min. Briefly centrifuge the tubes to collect condensate. 22. Prepare for PCR reaction: In a 0.2 mL PCR tube, mix 5 μL of GoTaq® DNA Polymerase buffer, 1 μL each of forward and reverse primers (specific to the tRNA species of interest, see step 23, Fig. 3e), 3 μL of 25 mM MgCl2, 1 μL of 10 mM dNTP, 1 μL of GoTaq® DNA Polymerase (5u/μL), 1 μL of cDNA and 12 μL of autoclaved double-distilled water for a total volume of 25 μL. 23. Example primer sets and PCR conditions are as follows: (i) For unspliced pre-tRNAIleUAU: 2 min at 95 °C; 27 cycles of 30 s at 95 °C, 20 s at 52 °C, and 20 s at 72 °C; 30 s at 72 °C; 2 picomoles of primer sets IVY1 and IVY3. (ii) For spliced tRNAIleUAU, 2 min at 95 °C; 25 cycles of 30 s at 95 °C, 20 s at 52 °C, and 20 s at 55 °C; 30 s at 72 °C; 2 picomoles of primer set IVY1 and IVY149. (iii) For mitochondria encoded tRNAIleGUA, 2 min at 95 °C; 35 cycles of 30 s at 95 °C, 20 s at 43 °C, and 20 s at 72 °C; 30 s at 95 °C; 10 picomoles of forward and reverse primers. For pull-down reactions involving GFP-tagged exporters, 2 picomoles of forward and reverse primers are used. (iv) For TLC1 RNA, 2 min at 95 °C; 30 cycles of 30 s at 95 °C, 20 s at 57 °C, and 20 s at 72 °C; 2 picomoles of forward and reverse primers. 24. After PCR, resolve 15 μL of PCR products on a 2% Agarose gel at 100 V for 1.5 h. Apply 2.5 μL of 25 bp DNA step ladder in a separate well to serve as molecular size markers. 25. Image resolved the UV-transilluminator.

products

by

employing

a

Assay to Trap In Vivo Yeast tRNA-Nuclear Export Complexes 3.4.2 RT-qPCR Analysis of Co-Immunoprecipitated RNA

133

1. For RT-qPCR, in a 96 well-plate, 1 μL of 100-fold diluted cDNA (performed in triplicates and obtained in step 21 of Subheading 3.4.1 after completion of reverse transcription reaction) was added to 5 μL of the PowerUp SYBR Green Master Mix and 0.4 μL each of the same forward and reverse primers as were employed for the RT-PCR reactions. Bring volume to 10 μL/well with 3.2 μL autoclaved double-distilled water. 2. No-template controls are included for all primer sets by adding all components described in step 22 except cDNA. No-RT controls are analyzed for each sample with each primer set. 3. Standard curves are prepared with tenfold serial dilutions of gel-extracted, RT-PCR products as templates to determine the concentrations of co-immunoprecipitated RNAs (see Note 11). 4. The samples are analyzed by employing in Quant Studio 3 (Applied Biosystems) or equivalent machine. The RT-qPCR conditions were as follows: (a) Hold Stage: 2 min 30 s at 50 °C, 20 s at 95 °C; (b) PCR Stage: 40 cycles of 1 s at 95 °C, 20 s at 60 °C; and (c) Melt curve stage: 1 s at 95 °C, 20 s at 60 °C, 1 s at 95 °C. A melt curve analysis verifies specific amplification of the target.

4

Notes 1. Beads should be used within 3 months of conjugation. 2. Co-immunoprecipitation assays performed with exporters with different tags may have differential background contaminating RNAs and proteins. 3. Mix all the salt components with autoclaved double-distilled water before adding detergent components. Adding Triton X100 and Tween 20 in concentrated solutions of KOAc and NaCl will lead to precipitation of detergent. 4. Yeast cells expressing tagged β-importins such as Los1 or Crm1 are cotransformed with a plasmid encoding galactose-regulated RanGTP or RanGDP-locked mutant constructs. It is important that the cultures are maintained 10 min at 4 °C. 22. Dump supernatant and add 70% ethanol and mix well. 23. Spin 15,000 rpm in a microcentrifuge for >10 min at 4 °C. 24. Dump supernatant and air dry at room temperature. 25. Dissolve RNA in 10 μL nuclease-free water. The RNA can be stored at -80 °C. 3.1.2 RNA Ligation and Sequencing (See Note 8)

1. Ligate RNAs (miRNA 3’end in hybrid products) with the first 3′ adapter (5′- AUCUCGUAUGCCGUCUUCUGCUUG 3′) using T4 RNA ligase 2, Truncated (NEB) at 22 °C for 1 h in 10 μL (200 μL microtube). 2. Heat at 70 °C for 2 min and transfer on ice. 3. Add 1ul of the second 5′ adapter (5′-GUUCAGAGUUCUA CAGUCCGACGAUC-3′), 1ul of T4 RNA ligase (NEB), and 1 μL of 10 mM ATP. Incubate at 20 °C for 1 h (see Note 9). 4. Reverse-transcribe the RNAs to single-stranded cDNA using Superscript II reverse transcriptase (Invitrogen) with RT-Primer (5′-CAAGCAGAAGACGGCATACGA-3′) at 44 ° C for 1 h. Use 4 μL adaptor-ligated RNA reaction in 10 μL reverse transcription (RT) reaction. 5. Amplify by PCR (12 cycles) using Phusion DNA Polymerase (Finnzymes Thermo Scientific) with primers (5′-CAAGCAGAAGACGGCATACGA-3′; 5′-AATGATACGGC GACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3′). Use 10 μL RT reaction in 50 μL PCR reaction. 6. Subject the constructed library to next-generation sequencing (101 bp paired-end sequencing on HiSeq 2500 platform) (see Note 8).

3.1.3 CLASH Data Analysis

1. Merge reads aligned to either mouse whole genome or RNA transcripts. 2. Identify the reads partially aligned to mature miRNA (miRbase) and/or mRNA sequences using blast program (https:// blast.ncbi.nlm.nih.gov). 3. Select chimeric reads with miRNAs of interest (Fig. 1 left side). 4. Confirm alignment (complementarity) of miRNAs and target RNAs. 5. Confirm the absence of the hybrid sequences (chimeric reads) in miRNA KO cells. 6. Confirm the higher expression of targets in miR-KO cells by RNA-seq (IGV track in Fig. 2c) and qPCR [20, 25]. 7. Confirm if the targets are direct target by target 3’UTR luciferase reporter assay [18, 25].

Identify MicroRNA Targets Using AGO2-CLASH (Cross-linking, Ligation, and. . .

143

A Confirm absence of miRNA in miR KO cells WT RNA

KO379 RNA WT IP RNA

KO379 IP RNA miRNA

B Confirm target 3UTR enrichment in WT cells WT IP RNA KO IP RNA Refseq

C Confirm higher target expression in miR KO cells WT RNA KO RNA Refseq Confirm by qPCR Confirm by target 3UTR luciferase reporter

Fig. 2 Confirmation of potential candidate RNAs. (a) Confirm specific absence of miR-379 (but not miR-411) in miR-379KO cells by next-generation sequencing (NGS) of RNAs or AGO2-IP-RNAs from wild-type (WT) or knockout (KO) cells. Visualized by Integrative Genomics Viewer (IGV, https://software.broadinstitute. org/software/igv/). (b) An example of enrichment of potential target RNA 3’UTR in AGO2-IP-RNAs from WT cells but not miR KO cells (IGV). (c) Confirm higher expression of target RNA in miR KO cells compared to WT cells (IGV). RNA expression and enrichment in AGO2-IP can also be confirmed by conventional qPCR. Optionally, identified targets can be confirmed by 3’UTR luciferase reporter analysis 3.2 AGO2-IP (AGO2CLIP) (Fig. 1 Right Side)

The procedure is same as AGO2-CLASH (Subheading 3.1.1) but without ligation steps 9 and 10.

3.2.1 Cross-Linking and RNA Isolation 3.2.2

RNA Sequencing

3.2.3 AGO2-CLIP Data Analysis

The procedure is same as Subheading 3.1.2. 1. Obtain potential miRNA targets (genomic locations) on mm10 predicted by miRanda/mirSVR, miRDB and starBase v2.0 [26–28]. Identify potential targets by comparing with the AGO2-CLASH data.

144

Mitsuo Kato

2. Extend the 5′ end of each target 100 bp in length (including target region, TAR and non-target region, NT3UTR). 3. Calculate log2 (TAR/NT3UTR). 4. Select targets with enrichment (KO)/enrichment (WT)