Host-Fungal Interactions: Methods and Protocols (Methods in Molecular Biology, 2260) 107161181X, 9781071611814

This volume provides readers with essential protocols for dissecting the host-fungus interaction, and engages researcher

205 38 6MB

English Pages 253 [246] Year 2021

Report DMCA / Copyright

DOWNLOAD PDF FILE

Table of contents :
Preface
Contents
Contributors
Chapter 1: Diminished Expression Alleles for Analysis of Virulence Traits and Genetic Interactions in Candida albicans
1 Introduction
2 Materials
2.1 Strains and Plasmids
2.2 Solutions
2.3 Supplies
3 Methods
3.1 Construction of Diminished Expression (DX) Mutants
3.1.1 Isolation of C. albicans Genomic DNA as PCR Template for Promoter DNA Amplification
3.1.2 Transformation into S. cerevisiae of Gapped Vector Plasmid and PCR Product Bearing Promoter Sequence to Construct Promot...
3.1.3 Amplification of a URA3 Gene Replacement Marker for Deletion of First Allele of Gene of Interest (GOI)
3.1.4 Introduction of the URA3 Gene Replacement Marker PCR Product into C. albicans BWP17 by Transformation (Adapted from)
3.1.5 Colony PCR to Confirm Homologous Integration of the URA3 Gene Replacement Marker
3.1.6 Replace the Endogenous Promoter of the Second GOI Allele with the DX Promoter
3.1.7 Construction of His+ Prototrophic Strains
3.1.8 Construction of Complemented Strains
3.2 Construction of Double Mutants
3.2.1 Construction of an Unmarked Deletion of GOI1
3.2.2 Introduction and Recycling of URA3-dpl200 Marker into C. albicans by Transformation
3.2.3 Colony PCR to Confirm for Loss of One Wild-Type Allele of GOI1
3.2.4 Deletion of the Second Allele of GOI1
3.2.5 Construction of the DX Mutation
3.2.6 Construction of His+ Prototrophic Strains
3.2.7 Construction of Complemented Strains
3.3 Construction of Triple Mutants
3.3.1 Construction of CaCas9 Expression Cassette
3.3.2 Construction of sgRNA Scaffold and SNR52 Promoter Cassettes
3.3.3 Construction of sgRNA Expression Cassette
3.3.4 Construction and Introduction of Gene Deletion Repair Construct Using Plasmid pNAT
4 Notes
References
Chapter 2: Serological Proteome Analysis for the Characterization of Secreted Fungal Protein Antigens
1 Introduction
2 Materials
2.1 Isolation of Secreted Proteins
2.2 Isoelectric Focusing (IEF) and 2D-Gel Electrophoresis
2.3 Electrophoretic Transfer/Wet Blot
2.4 Immunodetection
2.5 Master Gel
3 Methods
3.1 Isolation of Secreted Proteins
3.2 Isoelectric Focusing
3.3 2D-Gel Electrophoresis
3.4 Electrophoretic Transfer/Wet Blot
3.5 Immunodetection
3.6 Master Gel
3.7 Data Analysis
4 Notes
References
Chapter 3: Identification of Host Receptors for Fungi Using Whole Cell Affinity Purification
1 Introduction
2 Materials
2.1 Biotin and Octyl Glucoside
2.2 Affinity Purification
2.3 Western Blotting
3 Methods
3.1 Biotinylation and Isolation of Host Cell Membrane Proteins
3.2 Affinity Purification of Proteins that Bind to C. albicans
3.3 Western Blotting
4 Notes
References
Chapter 4: CRISPR-Cas9-Mediated Gene Silencing in Cultured Human Epithelia
1 Introduction
2 Materials
2.1 Construction of the CRISPR/Cas9 Plasmids
2.2 Transfection
2.3 Cell Selection and Propagation
2.4 Confirmation and Storage
3 Methods
3.1 Design of CRISPR/Cas9 Guides (Fig. 2)
3.2 Generation of the CRISPR/Cas9 Plasmids
3.3 CRISPR/Cas9 Plasmid Transfection into Lung Epithelial Cells
3.4 Cell Selection and Propagation
3.5 Confirmation of Knockout by Western Blot Analysis
4 Notes
References
Chapter 5: Analysis of Epithelial Cell Responses to Microbial Pathogens
1 Introduction
1.1 Western Blotting: Epithelial Cell Signaling
1.2 TransAm ELISA: Transcription Factor Activation
1.3 Quantitative Reverse Transcriptase PCR (qRT-PCR): Gene Expression
1.4 ELISA: Cytokine Responses
1.5 Luminex: Cytokine Responses
1.6 Cell Damage: Lactate Hydrogenase (LDH) Release
2 Materials
2.1 Western Blotting: Epithelial Cell Signaling
2.1.1 Cell Lysis
2.1.2 SDS-PAGE
2.1.3 Electrotransfer
2.2 TransAm ELISA: Transcription Factor Activation
2.3 qRT-PCR: Gene Expression
2.3.1 Sample Preparation
2.3.2 Assessment of RNA Quantity and Quality
2.3.3 cDNA Synthesis
2.3.4 qPCR
2.4 ELISA: Cytokine Responses
2.5 Luminex: Cytokine Responses
2.6 Cell Damage: Lactate Hydrogenase (LDH) Release
3 Methods
3.1 Western Blotting: Epithelial Cell Signaling
3.1.1 Sample Lysis and Preparation
For Adherent Cells
For Suspension Cells
3.1.2 Western Blot: Sample Preparation
3.1.3 12% SDS-PAGE and Transfer
3.1.4 Wet Transfer to Nitrocellulose Membrane
3.1.5 Western Blotting
3.2 TransAm ELISA: Transcription Factor Activation
3.2.1 Preparation of Nuclear Extract
3.2.2 DNA Binding ELISA
3.3 qRT-PCR: Gene Expression
3.3.1 RNA Lysis Procedure for Adherent Cells
3.3.2 RNA Extraction and DNase Treatment
3.3.3 Assessment of RNA Quantity and Quality
3.3.4 cDNA Synthesis
3.3.5 Quantitative PCR
3.3.6 qRT-PCR Primer Design: Gene of Interest and Reference Gene
3.3.7 qRT-PCR Analysis (Relative Quantitation)
3.4 ELISA: Cytokine Responses
3.4.1 Sample Collection
3.4.2 Protocol
3.5 Luminex: Cytokine Responses
3.5.1 Sample Collection
3.5.2 Preparing the Wash Buffer
3.5.3 Preparation of Calibrator Diluent RD5K or Calibrator Diluent RD6-40
3.5.4 Reconstitution of Standard Cocktails 1 and 2
3.5.5 Preparing the Standard Dilutions
3.5.6 Preparing and Adding the Diluted Microparticle Cocktail (SeeNote 7)
3.5.7 Adding the Samples and Standards
3.5.8 Preparing the Diluted Biotin Antibody Cocktail
3.5.9 Washing Step 1
3.5.10 Adding the Diluted Biotin Antibody Cocktail
3.5.11 Prepare and Warm Up the Machine
3.5.12 Washing Step 2
3.5.13 Preparing and Adding the Streptavidin
3.5.14 Calibrate the Machine
3.5.15 Set Up Protocol on Machine
3.5.16 Washing Step 3
3.5.17 Run Protocol
3.5.18 Shut Down
3.6 Cell Damage: Lactate Hydrogenase (LDH) Release
3.6.1 Sample Collection
3.6.2 Standard Curve Preparation
3.6.3 LDH Measurement
3.6.4 Calculating Results
4 Notes
References
Chapter 6: Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells Using Differential Fluorescent Staining a...
1 Introduction
2 Materials
2.1 Fungal Strains, Culturing, and Harvesting
2.2 Immortalized Human AECs, Culturing, and Processing
2.3 IFC Equipment and Staining
3 Methods
3.1 Culture and Seeding of Cultured Human AECs
3.2 Culture, Harvesting, Preparation of Af and Viable Counts
3.3 Infection of Human AECs with Af
3.4 Processing of Infected Human AECs for IFC
3.5 IFC Acquisition of Af-AECs Data Using the INSPIRE Software
3.6 Semiautomated Analysis of Af Uptake by AECs Using the IDEAS Internalization Wizard
3.7 Data Analysis of AECi Across Experimental Replicates: Background Subtraction and Correction Based on the Coefficient of In...
3.8 Analysis of AEC Apoptosis and Necrosis Using the IDEAS Software
3.9 Data Analysis of Live, Apoptotic, Late Apoptotic, and Necrotic AEC Across Experimental Replicates: Background Subtraction ...
3.10 Single-Cell Comparison of Uptake and Infection Outcomes of a DeltapacC Isolate and the Respective Parental Isogenic Strain
3.11 Conclusions
4 Notes
References
Chapter 7: Fungal Bioreporters to Monitor Outcomes of Blastomyces: Host-Cell Interactions
1 Introduction
1.1 A Fluorescent Bioreporter to Track Blastomyces Killing in the Lung
1.1.1 Origin of the Blastomyces DsRed Strain
1.1.2 Applications of the DsRed-Based B. dermatitidis Bioreporter
2 Materials
2.1 Staining DsRed-B. dermatitidis Yeast Cells with Uvitex, Subsequent to Application/Infection
2.2 Staining DsRed-B. dermatitidis Yeast Cells with Uvitex, Prior to Application/Infection
3 Methods
3.1 Uvitex Staining of Blastomyces Yeast
3.1.1 Benefits and Caveats of Uvitex Staining Prior to or Ensuing Experimental Challenge
3.1.2 Suggestions for Flow Cytometric Analysis
3.2 Procedure for Uvitex Post-Staining of B. dermatitidis Yeast Cells in Lung Samples
3.3 Staining DsRed-B. dermatitidis Yeast Cells with Uvitex, Prior to Application/Infection
References
Chapter 8: Fungal Bioreporters to Monitor Outcomes of Aspergillus: Host-Cell Interactions
1 Introduction
1.1 Fluorescent Bioreporters to Track the Viability of and Regulated Cell Death Processes in Aspergillus Conidia in the Lung
1.1.1 Origin of the Aspergillus DsRed and Histone 2A::Monomeric RFP Strains
1.1.2 Applications of the DsRed and Histone-2A::RFP A. fumigatus Strains as Probes of Conidial Uptake and Killing in the Murin...
1.2 Assays That Combine FLARE Conidia with Measurements of Apoptotic-Like Regulated Cell Death
2 Materials
2.1 Generation of FLARE Conidia Using DsRed or H-RFP A. fumigatus Strains
2.2 Apoptosis-Like RCD Assays
3 Methods
3.1 Procedure for Preparation of A. fumigatus FLARE Conidia
3.2 Downstream Applications
3.3 Procedure for Apoptosis-Like RCD Assays with H-RFP Conidia
3.3.1 Detection of Fungal Caspase-Like Activity
3.3.2 Detection of DNA Double-Strand Breaks (TUNEL Assay)
References
Chapter 9: Candida albicans Interaction with Oral Epithelial Cells: Adhesion, Invasion, and Damage Assays
1 Introduction
2 Materials
2.1 Reagents
2.2 Equipment
3 Methods
3.1 Cell Culture
3.2 Prepare Candida Cells
3.3 Infection
3.4 Fixing Samples
3.5 Stainings
3.5.1 ConcanavalinA Staining: Only for Invasion Samples
3.5.2 Calcofluor White Staining: for Both Adhesion and Invasion Samples
3.6 Mounting Samples
3.7 Evaluation of Adhesion
3.8 Evaluation of Invasion
3.9 Damage Assay
4 Notes
References
Chapter 10: Experimental Evolution of Candida by Serial Passaging in Host Cells
1 Introduction
2 Materials
2.1 Reagents
2.2 Equipment
3 Methods
3.1 Cell Culture (See Note 4)
3.2 Prepare Candida Cells (See Note 7)
3.3 Initial Infection
3.4 Serial Passaging
3.5 Storing Candida as a ``Frozen Fossil Record´´ (See Note 13)
3.6 Continuous Supply of Confluent Cell Cultures
3.7 Competition Experiment
3.7.1 Prepare Original Wild Type and Evolved Strain
4 Notes
References
Chapter 11: Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to Fungi in Immune Cells
1 Introduction
2 Materials
2.1 Mammalian Cell Culture and Retroviral Transduction
2.2 Growing and Harvesting A. fumigatus Conidia
2.2.1 Growing and Harvesting A. fumigatus Conidia
2.2.2 Cell Labeling, Phagocytosis Assay, and Flow Cytometry
2.3 Euthanasia and Dissection of Mice (See Note 10)
2.4 Generation of Bone Marrow-Derived Macrophages
2.5 Inducing and Harvesting of Thioglycollate-Elicited Peritoneal Macrophages
2.6 Isolation of Alveolar Macrophages
2.7 Enzyme-Linked Immunosorbent Assay (ELISA) to Measure Cytokine Production
3 Methods
3.1 Cell Culture and Passage
3.1.1 RAW264.7 Cells
3.1.2 Plat-E Retroviral Packaging Cell Line
3.2 Retrovirus-Mediated Transduction of RAW264.7 Cells
3.2.1 Transfection of Plat-E Cells
3.2.2 Retroviral Transduction of RAW264.7 Cells
3.3 Isolation and Generation of Bone Marrow-Derived Macrophages (BMDMs)
3.4 Isolation of Thioglycollate (thio)-Elicited Macrophages (See Notes 10 and 20)
3.5 Isolation of Alveolar Macrophages
3.6 Harvesting and FITC-Labeling of A. fumigatus Conidia (See Note 25)
3.7 Macrophage Labeling and Plating (See Note 26)
3.8 Measuring Phagocytosis and Inflammatory Responses to Fungi
3.8.1 Phagocytosis Assay
3.8.2 Analysis of Phagocytosis Using Flow Cytometry
3.9 Enzyme-Linked Immunosorbent Assay (ELISA) to Determine Pro-inflammatory Cytokine Production in Response to Fungal Particles
3.9.1 RAW264.6 Cells TNF-α ELISA
4 Notes
References
Chapter 12: Measuring In Vivo Neutrophil Trafficking Responses During Fungal Infection Using Mixed Bone Marrow Chimeras
1 Introduction
2 Materials
2.1 Animals
2.2 Generating Bone Marrow Chimeric Mice
2.3 Tissue Preparation
2.3.1 Preparation of Peripheral Blood
2.3.2 Preparation of Solid Organs
2.4 Flow Cytometry Analysis
3 Methods
3.1 Isolation and Preparation of Bone Marrow
3.2 Generation of Mixed Bone Marrow Chimeric Mice
3.3 Determination of Bone Marrow Engraftment in Mixed Chimeric Mice
3.4 Fungal Infection
3.5 Tissue Preparation
3.5.1 Digestion and Preparation of Solid Organs (Kidney, Liver, Spleen, Lung)
3.5.2 Preparation of Brain Tissue
3.6 Flow Cytometry Analysis
3.6.1 Expected Results and Example Scenarios
4 Notes
References
Chapter 13: Detection of Low Oxygen Microenvironments in a Murine Model of Invasive Pulmonary Aspergillosis Using Pimonidazole
1 Introduction
2 Materials
3 Methods
4 Notes
References
Chapter 14: Murine Models of Hematopoietic Cell Transplantation to Investigate Fungal Infections
1 Introduction
2 Materials
2.1 Mouse Strains
2.2 Immunoconditioning
2.3 Bone Marrow Isolation
2.4 T-Cell Isolation
3 Methods
3.1 Selection of Donor Murine Line
3.2 Immunoconditioning
3.2.1 TBI
3.2.2 Chemotherapy
3.3 Bone Marrow (BM) Isolation (see Note 5)
3.4 Graft Manipulation (Optional)
3.5 T-Cell Isolation
3.6 Hematopoietic Cell Transplant
4 Notes
References
Chapter 15: A Murine Model for Chronic A. fumigatus Airway Infections
1 Introduction
2 Materials
2.1 2X YPD-Agar
2.2 PBS-T
2.3 Mineral Oil
2.4 Collagenase
2.5 Complete RPMI (cRPMI)
3 Methods
3.1 Preparing Conidia
3.2 Preparation of Agar Beads
3.3 Infection
3.4 Lung Digest/Fungal Burden
3.4.1 Lung Digest
3.4.2 Fungal Burden
3.5 Ex Vivo Cytokine Production
3.6 Histology
4 Notes
References
Chapter 16: Automated Quantitative Analysis of Airway Epithelial Cell Detachment Upon Fungal Challenge
1 Introduction
2 Materials
2.1 Aspergillus fumigatus Strains and Epithelial Cell Line
2.2 Aspergillus Complete Media (ACM) Agar
2.3 Supplemented RPMI (sRPMI)
2.4 Phosphate Buffered Saline (PBS)
2.5 Triton X
2.6 Formaldehyde
2.7 DAPI (4′,6-Diamidino-2-Phenylindole)
2.8 Fluorescence Microscopy
2.9 Software
3 Methods
3.1 Growing Epithelial Cells
3.1.1 Preparing the Cells
3.1.2 Preparing the Plate
3.2 Preparing A. fumigatus Conidia
3.3 Infecting A549 Monolayer
3.4 Fixing and Staining
3.5 Automated Imaging and Quantification
3.5.1 Automated Multi-well Imaging
3.5.2 Automated Image Processing and Quantification
3.5.3 Data Processing
4 Notes
References
Index
Recommend Papers

Host-Fungal Interactions: Methods and Protocols (Methods in Molecular Biology, 2260)
 107161181X, 9781071611814

  • 0 0 0
  • Like this paper and download? You can publish your own PDF file online for free in a few minutes! Sign Up
File loading please wait...
Citation preview

Methods in Molecular Biology 2260

Elaine Bignell Editor

Host-Fungal Interactions Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Host-Fungal Interactions Methods and Protocols

Edited by

Elaine Bignell MRC Centre for Medical Mycology, University of Exeter, Exeter, UK

Editor Elaine Bignell MRC Centre for Medical Mycology University of Exeter Exeter, UK

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1181-4 ISBN 978-1-0716-1182-1 (eBook) https://doi.org/10.1007/978-1-0716-1182-1 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Infectious disease is a complex phenotype resulting from multiple host and pathogen activities. In order to derive a detailed mechanistic understanding of causal events occurring during disease, a holistic approach which considers the host-pathogen interaction from the molecular, cellular, tissue, organ, and whole animal perspectives is required. State-of-the-art technologies are illuminating our understanding of disease processes and, coupled with high-throughput approaches applied to assay development and mathematical modeling of infection, the community is edging ever closer to a highly granular molecular and cellular understanding of disease. This edition is intended to equip the reader with an essential suite of protocols for dissecting the host-fungus interaction and is predominantly aimed at informing the researcher engaged in the study of mammalian disease. Fungal disease poses a very significant threat to human life and overall health. Most frequently emerging as a consequence of immune dysfunction, fungal infections have undermined the utility of advanced clinical practices for several decades now and in an era of novel biologic therapies, and an aging population we face a new dawn of risk factors for contracting them. The problem of fungal disease is relatively new and therefore understudied. More problematic, it is critically under-recognized and under-researched, and the global community of skilled practitioners of medical mycology remains tiny compared to those of other disciplines/diseases. A major asset to the study of fungal diseases has been the collegiality of a highly interconnected network of scientists working in the field, many of whom have donated time and the benefit of immense expertise to this venture. The product is a compendium of protocols which will aid the current generation of emerging leaders in this field on their journey of establishing research in a challenging area of science. I am grateful to everyone who has contributed and waited patiently for the content to become assembled and printed. It is a testament to the power of team science that the field can come together to deliver such communal resource. Exeter, UK

Elaine Bignell

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 Diminished Expression Alleles for Analysis of Virulence Traits and Genetic Interactions in Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Carol A. Woolford and Aaron P. Mitchell 2 Serological Proteome Analysis for the Characterization of Secreted Fungal Protein Antigens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Juliane Macheleidt and Olaf Kniemeyer 3 Identification of Host Receptors for Fungi Using Whole Cell Affinity Purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Quynh T. Phan and Scott G. Filler 4 CRISPR-Cas9-Mediated Gene Silencing in Cultured Human Epithelia . . . . . . . . Sara Gago, Nicola L. D. Overton, and Paul Bowyer 5 Analysis of Epithelial Cell Responses to Microbial Pathogens . . . . . . . . . . . . . . . . . Spyridoula Nikou, Jemima Ho, Olivia Hepworth, Nicole Ponde, Ruth Dickenson, Jonathan P. Richardson, and Julian R. Naglik 6 Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells Using Differential Fluorescent Staining and Imaging Flow Cytometry. . . . . . . . . Margherita Bertuzzi and Gareth J. Howell 7 Fungal Bioreporters to Monitor Outcomes of Blastomyces: Host–Cell Interactions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jeffrey Scott Fites, Neta Shlezinger, Tobias M. Hohl, and Bruce S. Klein 8 Fungal Bioreporters to Monitor Outcomes of Aspergillus: Host–Cell Interactions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Neta Shlezinger, Jeffrey Scott Fites, Bruce S. Klein, and Tobias M. Hohl 9 Candida albicans Interaction with Oral Epithelial Cells: Adhesion, Invasion, and Damage Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Selene Mogavero and Bernhard Hube 10 Experimental Evolution of Candida by Serial Passaging in Host Cells . . . . . . . . . Katja Graf, Bernhard Hube, and Sascha Brunke 11 Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to Fungi in Immune Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Patawee Asamaphan, Gordon D. Brown, and Janet A. Willment 12 Measuring In Vivo Neutrophil Trafficking Responses During Fungal Infection Using Mixed Bone Marrow Chimeras . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rebecca A. Drummond and Michail S. Lionakis

vii

v ix

1

15

27 37 49

83

111

121

133 145

155

179

viii

13

14

15 16

Contents

Detection of Low Oxygen Microenvironments in a Murine Model of Invasive Pulmonary Aspergillosis Using Pimonidazole . . . . . . . . . . . . . . . . . . . . Nora Grahl, Caitlin H. Kowalski, and Robert A. Cramer Murine Models of Hematopoietic Cell Transplantation to Investigate Fungal Infections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jorge Amich A Murine Model for Chronic A. fumigatus Airway Infections . . . . . . . . . . . . . . . . Benjamin Ralph and Donald C. Sheppard Automated Quantitative Analysis of Airway Epithelial Cell Detachment Upon Fungal Challenge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sayema Rahman, Darren D. Thomson, and Margherita Bertuzzi

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

197

207 215

225

241

Contributors JORGE AMICH • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility, The University of Manchester, Manchester, UK PATAWEE ASAMAPHAN • Medical Research Council Centre for Medical Mycology at the University of Aberdeen, Aberdeen Fungal Group, Institute of Medical Sciences, Foresterhill, Aberdeen, UK; MRC-University of Glasgow Centre for Virus Research, Glasgow, UK MARGHERITA BERTUZZI • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility Building, The University of Manchester, Manchester, UK; Lydia Becker Institute of Immunology and Inflammation, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, The University of Manchester, Manchester, UK PAUL BOWYER • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility, The University of Manchester, Manchester, UK GORDON D. BROWN • Medical Research Council Centre for Medical Mycology at the University of Aberdeen, Aberdeen Fungal Group, Institute of Medical Sciences, Foresterhill, Aberdeen, UK; MRC Centre for Medical Mycology, University of Exeter, Exeter, UK SASCHA BRUNKE • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena, Germany ROBERT A. CRAMER • Department of Microbiology and Immunology, Geisel School of Medicine, Dartmouth, Hanover, NH, USA RUTH DICKENSON • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK REBECCA A. DRUMMOND • Fungal Pathogenesis Section, Laboratory of Clinical Immunology and Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA; Institute of Immunology and Immunotherapy, Institute of Microbiology and Infection, University of Birmingham, Birmingham, UK SCOTT G. FILLER • Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, Torrance, Torrance, CA, USA; Lundquist Institute for Biomedical Innovation at Harbor-UCLA Medical Center, Torrance, CA, USA; David Geffen School of Medicine at UCLA, Los Angeles, CA, USA JEFFREY SCOTT FITES • Department of Pediatrics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, WI, USA; Fungal Pathogenesis Section, Laboratory of Clinical Immunology and Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA SARA GAGO • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility, The University of Manchester, Manchester, UK KATJA GRAF • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena, Germany NORA GRAHL • Department of Microbiology and Immunology, Geisel School of Medicine, Dartmouth, Hanover, NH, USA

ix

x

Contributors

OLIVIA HEPWORTH • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK JEMIMA HO • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK TOBIAS M. HOHL • Infectious Disease Service, Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, NY, USA; Immunology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, NY, USA GARETH J. HOWELL • Flow Cytometry Core Facility, Faculty of Biology, Medicine and Health, University of Manchester, Manchester, UK BERNHARD HUBE • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena, Germany BRUCE S. KLEIN • Department of Pediatrics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, WI, USA; Department of Internal Medicine, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, WI, USA; Department of Medical Microbiology and Immunology, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, WI, USA OLAF KNIEMEYER • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena, Germany CAITLIN H. KOWALSKI • Department Microbiology and Immunology, Geisel School of Medicine, Dartmouth, Hanover, NH, USA MICHAIL S. LIONAKIS • Fungal Pathogenesis Section, Laboratory of Clinical Immunology and Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA JULIANE MACHELEIDT • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena, Germany AARON P. MITCHELL • Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA SELENE MOGAVERO • Department of Microbial Pathogenicity Mechanisms, Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena, Germany JULIAN R. NAGLIK • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK SPYRIDOULA NIKOU • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK NICOLA L. D. OVERTON • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility, The University of Manchester, Manchester, UK; Clinical Biomarker Centre, CRUK Manchester Institute, The University of Manchester, Manchester, UK QUYNH T. PHAN • Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Cente, Torrance, CA, USA; Lundquist Institute for Biomedical Innovation at Harbor-UCLA Medical Center, Torrance, CA, USA NICOLE PONDE • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK

Contributors

xi

SAYEMA RAHMAN • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility, The University of Manchester, Manchester, UK BENJAMIN RALPH • Department of Microbiology and Immunology, McGill University, Montre´ al, QC, Canada; Program in Infectious Diseases and Immunology in Global Health, Centre for Translational Biology, The Research Institute of the McGill University Health Center (RI-MUHC), Montre´al, QC, Canada JONATHAN P. RICHARDSON • Centre for Host-Microbiome Interactions, Faculty of Dentistry, Oral & Craniofacial Sciences, King’s College London, London, UK DONALD C. SHEPPARD • Department of Microbiology and Immunology, McGill University, Montre´al, QC, Canada; Program in Infectious Diseases and Immunology in Global Health, Centre for Translational Biology, The Research Institute of the McGill University Health Center (RI-MUHC), Montre´al, QC, Canada; McGill Interdisciplinary Initiative in Infection and Immunity (MI4), McGill University, Montre´al, QC, Canada NETA SHLEZINGER • Infectious Disease Service, Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, NY, USA; The Robert H. Smith Faculty of Agricultural, Food & Environment, The Hebrew University of Jerusalem, Rehovot, Israel DARREN D. THOMSON • Manchester Fungal Infection Group, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, Core Technology Facility, The University of Manchester, Manchester, UK JANET A. WILLMENT • Medical Research Council Centre for Medical Mycology at the University of Aberdeen, Aberdeen Fungal Group, Institute of Medical Sciences, Foresterhill, Aberdeen, UK; MRC Centre for Medical Mycology, University of Exeter, Exeter, UK CAROL A. WOOLFORD • Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA

Chapter 1 Diminished Expression Alleles for Analysis of Virulence Traits and Genetic Interactions in Candida albicans Carol A. Woolford and Aaron P. Mitchell Abstract Here we present a protocol of interest to those who want to look at the functional consequences of decreasing expression of essential genes constitutively as well as being able to study the regulatory pathways of that essential gene by also deleting one or two additional genes. This allows epistasis relationships to be determined. Key words Candida albicans, Essential genes, CRISPR deletions, Epistasis

1

Introduction We wanted to assign biological processes to essential genes to develop screens for growth inhibitors of Candida albicans. A number of methods have been used in C. albicans to reduce essential gene activity. Most of these permit growth under a permissive condition and allow functional assays after expression of the gene is reduced due to the addition or removal of a nutrient or small molecule (reviewed in [1, 2]). We decided to take an alternative approach—delete one allele of the essential gene and replace the endogenous promoter of the second allele with a weak constitutive promoter. When we tried this on 15 different protein kinase/ kinase-related genes, most of which are deemed essential, many of the genes were now expressed at less than 10% of the WT expression level [3]. Several of these diminished expression (DX) protein kinases showed aberrant filamentation under non-inducing conditions. In order to look at epistasis with filamentation regulators, double mutants were isolated by creating unmarked deletions of various canonical biofilm regulators in combination with a DX mutation. A triple mutant was also constructed, by deleting a second biofilm regulator marked with a NAT cassette, through a transient CRISPR Cas9 system [4]. These protocols provide a novel

Elaine Bignell (ed.), Host-Fungal Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2260, https://doi.org/10.1007/978-1-0716-1182-1_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Carol A. Woolford and Aaron P. Mitchell

Fig. 1 Construction of diminished expression (DX) mutants for the study of essential gene functions in C. albicans. Schematic overview of DX mutant construction whereby one allele of an essential gene is deleted and the endogenous promoter of the second allele replaced with weak constitutive promoter. Epistasy to other regulatory mutations can be studied by double mutant construction, via creation of unmarked deletions in relevant genes of interest in combination with a DX mutation. Triple mutants can also be constructed via further gene replacement mediated through a transient CRISPR Cas9 system [4]. These protocols provide a novel way to study mutant phenotypes of essential genes as well as being able to ascribe epistasis relationships in regulatory pathways by using previously published methods to create double and triple mutants

way to study mutant phenotypes, presented in Fig. 1, of essential genes as well as being able to ascribe epistasis relationships in regulatory pathways by using previously published methods to create double and triple mutants.

2

Materials

2.1 Strains and Plasmids

1. S. cerevisiae arg4 mutant strain (CW672). 2. S. cerevisiae his1 mutant strain (BJ2698). 3. C. albicans BWP17 (ura3::imm434/ura3::imm434 iro1/iro1:: imm434 his1::hisG/his1::hisGarg4/arg4) [5] (see Note 1). 4. pRSARG4ΔSpe plasmid, for gap repair transformations [5]. 5. pGEMURA3 plasmid, for amplifying URA3 gene to be used as a selectable marker [5].

Diminished Essential Gene Expression

3

6. pDDB78 plasmid, a vector expressing HIS1 and used for complementation purposes [6]. 7. pDDB57 plasmid, expressing the recyclable URA3-dpl200 marker used for construction of unmarked gene deletions [7]. 8. pV1093 plasmid, source of the CaCas9 cassette containing an ENO1 promoter, the CaCas9 ORF, and a CYC1 terminator [8]. 9. pNAT plasmid, for amplifying the gene for nourseothricin resistance, used as a selectable marker [4]. 2.2

Solutions

1. TENTS: 10 mM Tris, pH 8.0, 1 mM EDTA, 100 mM NaCl, 2% Triton X-100, 1% SDS. 2. 7.5 M ammonium acetate: Dissolve 57.81 g ammonium acetate in water to a final volume of 100 ml. 3. 70% ethanol: Mix 70 ml 100% ethanol plus 30 ml sterile water. 4. TE pH 7.5: 10 mM Tris–HCl, 1 mM EDTA. 5. LiAc/TE pH 7.5: 0.1 M LiAc, 10 mM Tris–HCl, 1 mM EDTA. 6. 50% PEG4000 in LiAc/TE for S. cerevisiae transformation: Measure 2 g PEG4000 into 18  150 mm glass tubes and autoclave. These are good for long-term storage. When needed for transformation, add 2.2 ml LiAc/TE pH 7.5 and melt in boiling water bath. Vortex to mix cool to and keep at 30  C until needed. 7. SOS: 1 M Sorbitol (4 ml of 2 M), 0.325 YPD (2.6 ml of 1), 6.5 mM CaCl2 (1.04 ml of 50 mM), sterile H2O (0.4 ml). 8. PLATE for C. albicans transformation: 8 ml 50% w/v PEG3350, 1 ml 10  TE (100 mM Tris–HCl, 10 mM EDTA, pH 7.5), 1 ml 1 M LiAc. For 50% w/v PEG3350 dissolve 50 g PEG3350 in 100 ml (final volume) of distilled water, heat gently, and filter sterilize after mixing. 9. YPD (liquid and solid): 2% dextrose, 2% Bacto peptone, 1% Bacto yeast extract, 2% Bacto agar—only for solid media. 10. CSM-arg, CSM-ura, CSM-arg-ura, CSM-his solid media (1 L): 0.67% Difco yeast nitrogen base without amino acids, appropriate CSM drop out media (CSM-arg or CSM-ura or CSMarg-ura or CSM-his), 2% Bacto agar, water to 900 ml. Autoclave, let cool to 60  C. Add 100 ml of filter sterilized 20% dextrose. Add 1 ml of 80 mg/ml filter sterilized uridine to CSM -arg or -his media. 11. CSM-ura + 5-FOA (1 L): Dissolve 1 g of 5-FOA (5-Fluoroorotic acid monohydrate, 98%) in 200 ml of distilled water on stir plate with heat (65 ). This takes at least 1 h to dissolve. Let cool to 37  C and filter sterilize. Meanwhile prepare 0.67%

4

Carol A. Woolford and Aaron P. Mitchell

Difco yeast nitrogen base without amino acids, CSM-ura, 2% Bacto Agar, water to 700 ml. Autoclave and let cool to 60  C. Add the filter-sterilized 5-FOA solution with steady stirring, 100 ml of filter-sterilized 20% dextrose (prewarmed to 37  C), 1 ml of 80 mg/ml filter-sterilized uridine. 12. YPD + nourseothricin (NAT) (200 μg/ml) (1 L): 2% dextrose, 2% Bacto peptone, 1% Bacto yeast extract, 2% Bacto agar. Autoclave and after cooling to 60  C add 0.5 ml of 400 mg/ ml filter-sterilized clonNAT. 2.3

Supplies

1. Glass beads, acid-washed (425–600 μm). 2. RNase A, DNase, and protease-free. 3. NruI, NotI, and EcoRI restriction enzymes. 4. Yeast plasmid miniprep kit to extract plasmid DNA from S. cerevisiae. 5. E. coli plasmid miniprep kit. 6. PCR purification kit. 7. Ex Taq Polymerase. 8. Platinum Taq DNA Polymerase High Fidelity. 9. Deoxyribonucleic acid solution from calf thymus. 10. Primers.

3

Methods

3.1 Construction of Diminished Expression (DX) Mutants

Promoter selection guidelines: Select promoters of genes whose expression levels are unmodulated by conditions you are interested in studying. Select promoters of several weakly expressed genes in case the diminished level of expression of the essential gene you are studying causes lethality. The promoters for the genes PGA5 (ORF19.3693), PGA42 (ORF19.2907), and ORF19.7606 were selected for their varying expression levels and being unregulated between kidney infection models, planktonic 30  C growth in YPD, and growth in hyphal inducing Spider media [3] (see Note 2). PCR primer design: Oligonucleotide sequences designed to include approximately 1000 bp of the promoter region unless another gene lies in that region. Only 400 bp of the promoter region of PGA5 were selected for that reason. PCR primers for the PGA5 promoter are: (a) (50 ) vector adaptor sequence_PGA5 PROMOTER SEQUENCE 400 BP UP OF ATG (30 ) F agagataccttgtactacaatactagtCCTTCTTCTTAAGGGGATATACTAATTTTA. (b) (50 ) vector adaptor sequence_DIRECTLY UPSTREAM OF PGA5 ATG REV SEQ (30 ) R tttcccagtcacgacgtt GATGGAT TAAGATGATTGATTGTGATGATT.

Diminished Essential Gene Expression

5

The PCR primers for the additional promoters include the PGA5 reverse promoter sequence as an adaptor (see Note 3): PCR primers for the PGA42 promoter are: (a) (50 ) vector adaptor sequence_PGA42 PROMOTER SEQUENCE 950 BP UP OF ATG (30 ) F agagataccttgtactacaatactagtGTGGTATAGTTTGCCTTTCTTTTTGAATAC. (b) (50 ) vector adaptor sequence_DIRECTLY UPSTREAM OF PGA5 ATG REV SEQ_31bp upstream of PGA42 ATG (30 ) R tttcccagtcacgacgtt GATGGATTAAGATGATTGATTGTGAT GATTgtgaatcttaatatctctaattcatttttg. PCR primers for the ORF19.7606 promoter are: (a) (50 ) vector adaptor sequence_ORF19.7606 PROMOTER SEQUENCE 950 BP UP OF ATG (30 ) F agagataccttgtactacaatactagtGTTTGTAAAAAGAAACAAGTATGGAAGAAT. (b) (50 ) vector adaptor sequence_DIRECTLY UPSTREAM OF PGA5 ATG REV SEQ_31bp upstream of ORF19.7606 ATG (30 ) R tttcccagtcacgacgtt GATGGATTAAGATGATT GATTGTGATGATTttagtaaaaaacgaatgaacagtttgagtt. 3.1.1 Isolation of C. albicans Genomic DNA as PCR Template for Promoter DNA Amplification

Spin down 5 ml of an overnight 30  C YPD culture: 1811  g for 3 min. Aspirate supernatant and add 500 μl TENTS. Transfer resuspended cells to microfuge tube containing 200 μl of sterile acid-washed glass beads. Add 500 μl of phenol:chloroform:isoamyl alcohol (25:24:1) and vortex for 2 min. Spin tube at 18.8K  g at 4  C for 10 min. Transfer aqueous phase to new microfuge tube and add 1 ml of 100% ethanol. Place at 20  C for at least 1 h. Spin tube at 18.8K  g at 4  C for 10 min. Aspirate supernatant and resuspend pellet in 200 μl TE. Add 2 μl of 5 mg/ml RNase A and incubate for 30 min at room temperature. Add 60 μl of 7.5 M NH4OAc and 500 μl of 100% ethanol and mix by inversion. Place at 20  C for at least 30 min. Spin tube at 18.8K  g at 4  C for 5 min and decant supernatant. Add 1 ml of 70% ethanol to pellet and spin tube at 18.8K  g at 4  C for 5 min. Remove ethanol and allow pellet to air dry. Resuspend pellet gently in 50 μl of TE. Use 1 μl of a 1:20 dilution as template for PCR. PCR amplification is performed to obtain promoter product (Platinum Taq). Cycling conditions are 94  C/2 min  1 cycle; 94  C/30 s, 54  C/30 s, 68  C/ 1 min  35 cycles; 68  C/3 min  1 cycle; 4  C hold.

3.1.2 Transformation into S. cerevisiae of Gapped Vector Plasmid and PCR Product Bearing Promoter Sequence to Construct Promoter Template Plasmid (Adapted from [9])

Inoculate 5 ml of YPD with an arg4 strain and grow overnight at 30  C. Dilute culture into 50 ml of fresh YPD at an OD600 of 0.2 and grow at 30  C for three doublings (approximately 100 min doubling time). Spin cells at 3220  g for 5 min at room temperature. Wash cell pellet with 10 ml LiAc/TE and spin as before. Aspirate supernatant and resuspend pellet in 0.5 ml LiAc/TE.

6

Carol A. Woolford and Aaron P. Mitchell

For gap repair transformations: 1 μl of NotI-digested pRSArg4ΔSpe vector DNA (from a 15 μl digest of 5 μl miniprep DNA) and 10–20 μl of PCR product. Include minus DNA and digested vector DNA as control samples. Add 280 μl of 50% PEG4000 in LiAc/TE, mix by inverting 4–6 times, and incubate at 30  C for 45 min. Add 43 μl of DMSO and invert to mix 4–6 times. Heat shock at 42  C for 5 min. Add 1 ml of H2O, invert to mix, spin for 8 s at top speed in microfuge, and remove supernatant carefully. Resuspend in 0.2 ml SOS and plate on CSM-arg media, and incubate 30  C for 3 days. Plasmid DNA is extracted from Arg+ transformants using Zymo Research Yeast Plasmid Miniprep II Kit as directed by manufacturer. Transform by electroporation, 4 μl of plasmid DNA into E. coli. Isolate plasmid DNA from E. coli transformants and check for presence of insert in vector by restriction digest (see Note 4). 3.1.3 Amplification of a URA3 Gene Replacement Marker for Deletion of First Allele of Gene of Interest (GOI)

Design PCR primers for amplification of URA3 marker from pGEMURA3. PCR primers have homology to a) 100 bp upstream of the ATG of gene of interest and b) 100 bp downstream of the stop codon, each followed by homology to adaptor sequences of pGEMURA3. (a) Forward (50 ): (100 bp upstream of ATG)_TTTCCCAGTCAC GACGTT (30 ). (b) Reverse (50 ): (reverse complement of 100 bp downstream of stop codon)_GTGGAATTGTGAG CGGATA (30 ). Amplification conditions for URA3 marker, using 1 μl of 1:100 dilution of pGEMURA3 DNA for template, are 94  C/ 5 min  1 cycle; 94  C/1 min, 56  C/2 min, 72  C/ 3 min  30 cycles; 72  C/5 min  1 cycle; 4  C hold.

3.1.4 Introduction of the URA3 Gene Replacement Marker PCR Product into C. albicans BWP17 by Transformation (Adapted from [5])

Grow a 5 ml overnight YPD culture at 30  C. Add cells to flask with 50 ml YPD such that OD600 ¼ 0.2. Incubate the 50 ml culture at 30  C until OD600 reaches ~0.8 (takes approximately 3.5 h). Pour culture into a 50 ml conical tube and centrifuge at low speed (~1578  g) for 5 min, at RT. Discard supernatant and wash cell pellet by gently resuspending in 5 ml of sterile H2O (do not vortex). Centrifuge at low speed for 5 min and discard the supernatant. Resuspend the cell pellet in 500 μl of LiAc/TE. To set up the transformation reactions, add the following to a microfuge tube: 100 μl of cell suspension, 10 μl of 10 mg/ml calf thymus DNA (that was previously boiled for 10 min and immediately iced until use), and 25 μl of a PCR reaction which contains the URA3 marker used for deletion of the gene. Mix gently. Incubate for 30 min at 30  C without shaking. Add 700 μl of freshly made PLATE, mix and incubate overnight at 30  C without shaking.

Diminished Essential Gene Expression

7

Heat shock the cell mixture at 44  C for 15 min. Spin cells down for 30 s at 0.9  g at RT and aspirate the supernatant. Wash the cell pellet by resuspending in 1 ml of YPD. Spin cells down for 30 s at 0.9  g and aspirate the supernatant. Resuspend the cells gently in 100 μl of YPD and plate on selective plates (CSM-ura). Incubate at 30  C for a few days [2, 3] until colonies are large enough to use for colony PCR. 3.1.5 Colony PCR to Confirm Homologous Integration of the URA3 Gene Replacement Marker

The Forward detect primer is designed to hybridize at the GOI locus, between 200–500 bp upstream of the ATG. The Reverse detect primer is designed to hybridize to the URA3 marker: (50 ) ACCACTCCATTCCCAGTGAC (30 ). The PCR product size ¼ (900 bp (URA3 portion) + (distance of the Forward detect primer to the ATG)). Put together the PCR reaction without Ex Taq enzyme. Add a part of the colony using a plastic Pipetman tip and amplify using the following conditions: 94  C/5 min; hold at 94  C and add enzyme; 94  C/2 min  1 cycle; 94  C/1 min, 52  C/1 min, 72  C/1.5 min  35 cycles; 72  C/5 min  1 cycle; 4  C hold.

3.1.6 Replace the Endogenous Promoter of the Second GOI Allele with the DX Promoter [3]

First amplify (including 100 bp of GOI promoter sequence) the DX promoter sequences that were inserted into pRSARG4ΔSpe. Because of the PGA5 adaptor sequence added to each of the promoters, a single set of primers can be used to amplify any of the three promoters for driving expression of GOI. (a) Forward primer: (50 ) (100 bp upstream sequence of GOI within 500 bp of ATG, in the forward direction)_(GTGTGG AATTGTGAGCGGATA ) [this is pRSARGΔSpe vector sequence upstream of the ARG4 gene] (30 ). (b) Reverse primer: (50 ) (reverse complement of first 100 nucleotides of GOI ORF)_(GATGGAT TAAGATGATTGATTGT GATGATT [this is the reverse complement of the 30 bp adaptor sequence for promoters from 30 bp upstream of PGA5 ORF to 1 bp upstream of PGA5 ORF]) (30 ). Using Platinum Taq, PCR amplify using the following conditions: 94  C/2 min  1 cycle; 94  C/30 s, 54  C/30 s, 68  C/ 3.5 min  35 cycles; 68  C/6 min  1 cycle; 4  C hold. Product sizes are PGA5 2500 bp, PGA42 and ORF19.7606 ~ 3000 bp, and include the ARG4 selection marker. The promoter products are individually transformed into the C. albicans heterozygous deletion strain (Δgoi1::URA/GOI) as described in Subheading 3.1.4. Plate on CSM-arg-ura plates. Streak at least six transformants on same media to check by colony PCR (as described in Subheading 3.1.5). Two colony PCR checks are performed, including the WT strain as a control.

8

Carol A. Woolford and Aaron P. Mitchell

First check for the presence of the promoter sequence using (a) a forward primer designed to hybridize to the promoter adaptor sequence(50 )AATCATCACAATCAATCATC TTAATCCATC(30 ) and (b) a reverse primer designed to hybridize to an internal sequence in the GOI ORF, at 300–500 bp from the ATG. Next, check for the absence of a WT allele using the forward primer used in Subheading 3.1.5 and the reverse primer hybridizing to an internal sequence in the GOI ORF, as described directly above. 3.1.7 Construction of His+ Prototrophic Strains

Digest plasmid pDDB78 with NruI (5 μl miniprep DNA in a 10 μl digest). Transform into Arg+ Ura+ DX strain as in Subheading 3.1.4 (using 5 μl of the digested plasmid DNA instead of the PCR product), selecting on CSM-his.

3.1.8 Construction of Complemented Strains

Complemented strains can be constructed (adapted from [10]) by introduction of gap repair-mediated construction of a complementing plasmid. To construct the plasmid, primers are designed to hybridize to GOI-proximal sequence, at about 1500 bp upstream and 300 bp downstream of the ORF. GOI-specific primer sequence should be approximately 60 bp in length and should additionally bear adaptor sequences to the plasmid pDDB78 to direct in vivo recombination at the his1 locus of BWP17-derived strains. (a) Forward primer: (50 ) CAATTTCACACAGGAAACAGCTAT GACCATGATTACGCCAAGCT _(60mer upstream genespecific sequence) (30 ). (b) Reverse primer: (50 ) GTCGACCATATGGGAGAGCTCC CAACGCGTTGGATGCATAG_(reverse complement 60mer downstream gene-specific sequence) (30 ). Using C. albicans wild-type genomic DNA (Subheading 3.1.1) as template, amplify the wild-type GOI using complementing primers according to the following cycling conditions, using Platinum Taq: 94  C/2 min  1 cycle; 94  C/30 s, 54  C/30 s, 68  C/ X min  35 cycles; 68  C/(X + 3) min  1 cycle; 4  C hold. Extension time depends on the size of the complementing amplicon you would expect for GOI (1 min/kb). Construction of the complementing plasmid is performed by gap repair. Digest plasmid pDDB78 with EcoRI and NotI. Cotransform complementing PCR product (20 μl) with 1.5 μl of a 15 μl digest containing 5 μl plasmid DNA into a his1 S. cerevisiae mutant strain. Follow Subheading 3.1.2 for transformation and extraction of the complementing plasmid. The plasmid is then digested with NruI (5 μl miniprep DNA in a 10 μl digest) and transformed into the mutant strain as in Subheading 3.1.4 (using 5 μl of the digested plasmid DNA instead of a PCR product), selecting on CSM-his.

Diminished Essential Gene Expression

9

3.2 Construction of Double Mutants

Construction of double mutants is performed sequentially by first using a recyclable URA3 marker to create an unmarked deletion of a nonessential gene (GOI1), followed by construction of the DX mutation of an essential second gene (GOI2). His+ prototrophs and/or complementing strains can be subsequently constructed, if desired, as described in Subheadings 3.1.7 and 3.1.8.

3.2.1 Construction of an Unmarked Deletion of GOI1

Primers are designed for constructing an unmarked deletion of GOI1 [11] using the URA3-dpl200 marker in pDDB57. This URA3 marker contains homologous sequences that promote its excision by homologous recombination under negative selection. PCR primers have homology to 100 bp upstream of the ATG or to 100 bp downstream of the stop codon followed by homology to adaptor sequences of pDDB57. (a) Forward (50 ) (100 bp upstream of ATG) TTTCCCAGTCAC GACGTT (30 ). (b) Reverse (50 ) (reverse complement of 100 bp downstream of stop codon) GTGGAATTGTGAG CGGATA (30 ). Amplification conditions (Ex Taq) for URA3-dpl200 marker using 1 μl of 1:100 dilution of pDDB57 DNA for template: 94  C/ 5 min  1 cycle; 94  C/1 min, 54  C/2 min, 72  C/ 3 min  30 cycles; 72  C/5 min  1 cycle; 4  C hold.

3.2.2 Introduction and Recycling of URA3-dpl200 Marker into C. albicans by Transformation

The PCR product is transformed into BWP17 as in Subheading 3.1.4. Select transformants on CSM-ura. Grow transformants for 2–3 days at 30  C before performing URA3 marker excision by recombination as follows: Pick 12 individual single colonies and inoculate into 2 ml YPD media. Grow 20–24 h at 30  C with shaking. Pipette 10 μl of the overnight culture onto one-fourth of a CSM-ura + 5-FOA plate (4 transformants per plate). Spread using bent 200 μl plastic pipette tip. Incubate 2 days at 30  C. Pick one colony from each of the 12 quadrants and streak for singles on YPD plates. Grow for 2 days at 30  C and then check for heterozygotes by colony PCR (see below).

3.2.3 Colony PCR to Confirm for Loss of One Wild-Type Allele of GOI1

Design a forward primer hybridizing 200–500 bp upstream of the start codon and two reverse primers: (1) hybridizing 150–300 bp downstream of the stop codon and (2) an ORF internal primer hybridizing in the region 100–300 bp downstream of the start codon. The product size ¼ 813 bp (URA3 portion) + distance of forward and downstream reverse primers to GOI1. The loop out product size ¼ 500 bp + distance of forward and downstream reverse primers. Put together the PCR reaction without Ex Taq enzyme. Add a part of the colony using a plastic pipette tip and use the following cycling conditions: 94  C/5 min  1 cycle; hold at 94  C, add enzyme; 94  C/2 min  1 cycle; 94  C/1 min, 50  C/

10

Carol A. Woolford and Aaron P. Mitchell

1 min, 72  C/X min  35 cycles; 72  C/(X + 3) min  1 cycle; 4  C hold. 72  C extension time depends on length of PCR product you would expect for GOI1 (1 min/kb). 3.2.4 Deletion of the Second Allele of GOI1

The unmarked homozygous mutant is generated by repeating Subheadings 3.2.1–3.2.3. The absence of GOI1 is confirmed by colony PCR using the forward primer and the internal reverse primer. The 72  C extension time in Subheading 3.2.3 should be shortened to 1 min.

3.2.5 Construction of the DX Mutation

The DX mutation of GOI2 is constructed by deletion of one allele and swapping the promoter of the second allele as in Subheadings 3.1.4–3.1.6.

3.2.6 Construction of His+ Prototrophic Strains

His+ prototrophs are constructed as in Subheading 3.1.7.

3.2.7 Construction of Complemented Strains

Complemented strains are constructed as in Subheading 3.1.8.

3.3 Construction of Triple Mutants

Perform unmarked deletion of GOI1-construct as in Subheadings 3.2.1–3.2.4. Deletion of GOI2 is achieved via transient CRISPRCas9 system [4, 8].

3.3.1 Construction of CaCas9 Expression Cassette

Amplify 5.5 kb CaCas9 cassette containing an ENO1 promoter, the CaCas9 ORF, and a CYC1 terminator from pV1093 using the following primers: CaCas9/for (30 ).

(50 ) ATCTCATTAGATTTGGAACTTGTGGGTT

CaCas9/rev (50 )TTCGAGCGTCCCAAAACCTTCT(30 ). Use 50 ng template DNA and Ex Taq enzyme and perform cycling as follows: 94  C/1 min  1 cycle; 94  C/30 s, 58  C/1 min, 72  C/ 5 min  30 cycles; 72  C/6 min  1 cycle. 4  C hold. Purify the PCR product and determine concentration. 3.3.2 Construction of sgRNA Scaffold and SNR52 Promoter Cassettes

GOI2 single-guide RNA sequence selected from the Candida albicans CRISPR target sequence database provided by [8]. sgRNA-R (50 )ACAAATATTTAAACTCGGGACCTGG(30 ). sgRNA_GOI-F (50 )(GOI2 target without PAM) GTTTTA GAGCTAGAAATAGCAAGTTA AA(30 ). SNR52-F (50 )AAGAAAGAAAGAAAACCAGGAGTGAA(30 ). SNR52_GOI2-R (50 )(reverse complement of GOI2 target without PAM)CAAATTAAAAA TAGTTTACGCAAGTC(30 ).

Diminished Essential Gene Expression

11

Amplify sgRNA scaffold using sgRNA/R and sgRNA_GOI2/F primers. Amplify SNR52 promoter region using SNR52/F and SNR52_GOI2/R primers. Use 50 ng pV1093 as template and Ex Taq enzyme and the following cycling conditions: 94  C/1 min  1 cycle; 94  C/30 s, 58  C/1 min, 72  C/ 1 min  30 cycles; 72  C/3 min  1 cycle. 4  C hold. SNR52 amplicon 1480 bp; sgRNA amplicon 1035 bp. Purify the PCR products and determine concentration. 3.3.3 Construction of sgRNA Expression Cassette

Join the two amplicons by fusion PCR (product size ~2500 bp). Use 1:1 molar ration for SNR52::sgRNA amplicons. The total DNA amount of the two should be between 100 and 1000 ng in a 25 μl reaction containing 1x Ex Taq buffer, 320 μM dNTPs, and 0.25 μl Ex Taq DNA Polymerase using the following cycling conditions: 94  C/2 min  1 cycle; 94  C/30 s, 58  C/10 min, 72  C/ 5 min  10 cycles;72  C/10 min  1 cycle; 4  C hold. Do not purify the PCR product. Nested PCR of the fusion PCR product using 1 μl as template (product size 1305 bp) (Ex Taq) and the following cycling conditions: SNR52/N (50 )GCGGCCGCAAGTGATTAGACT(30 ). sgRNA/N (50 )GCAGCTCAGTGATTAAGAGTAAAGATGG(30 ), 94  C/1 min  1 cycle; 94  C/30 s, 58  C/1 min, 72  C/ 1 min  30 cycles; 72  C/5 min; 4  C hold. Purify the PCR product and determine concentration.

3.3.4 Construction and Introduction of Gene Deletion Repair Construct Using Plasmid pNAT [4]

PCR primers have homology to 100 bp upstream of the ATG or to 100 bp downstream of the stop codon of GOI2 to be deleted followed by homology to adaptor sequences of pNAT. Forward (50 )(100 bp upstream of ATG) TTTCCCAGTCAC GACGTT(30 ). Reverse (50 ) (reverse complement of 100 bp downstream of stop codon) GTGGAATTGTGAGCGGATA (30 ). Use 50 ng of template plasmid pNAT and the following cycling conditions (product size 1443 bp): 94  C/1 min  1 cycle; 94  C/ 30 s, 58  C/1 min, 72  C/2 min  30 cycles; 72  C/5 min  1 cycle; 4  C hold. Purify the PCR products and determine concentration. Transform into strain with unmarked deletion of first gene (Subheadings 3.2.1–3.2.4) via method of Subheading 3.1.4 with modifications below. Use 1 μg Cas9 cassette, 1 μg sgRNA nested

12

Carol A. Woolford and Aaron P. Mitchell

cassette, and 3 μg repair construct. Allow an outgrowth period before plating on YPD + 200 μg/ml NAT, after spinning down cells in Subheading 3.1.4. Resuspend cells in 1 ml YPD and incubate at 30  C with shaking for 2 h. Spin cells down for 30 s at 0.9  g and aspirate the supernatant. Resuspend the cells gently in 100 μl YPD and plate on selective plates (YPD + NAT media) and incubate 30  C a few days [2, 3] until colonies are large enough to use for colony PCR. Colony PCR (Subheading 3.1.5) to check for homozygous deletion of gene and replacement with NAT marker. Forward detect primer: Designed for GOI2, located in the region 200–500 bp upstream of the ATG. Reverse detect primer: Designed in the NAT marker: NAT rev (50 )TCAATGGTGGATCAACTGGAACTTC(30 ). Product size is 684 bp (NAT portion) + distance of the Forward detect primer to the ATG. Confirm absence of GOI2 by colony PCR using the Forward detect primer and an internal GOI2 reverse primer. Downstream manipulations of the double mutant might include: DX mutation of a third gene (as in Subheadings 3.1.1– 3.1.6), construction of His+ prototrophs (as in Subheading 3.1.7), and construction of complemented strains (as in Subheading 3.1.8).

4

Notes 1. The multiple auxotrophies present in BWP17 allow the use of three markers when constructing deletion strains. The URA3 and ARG4 cassettes present on pGEMURA3 and pRSARG4ΔSpe are unlikely to integrate at their endogenous loci in this strain. Thus those markers can be directed to deleting the two alleles of the GOI. The HIS1 marker from pDDB78 will recombine at its endogenous locus and can be used to direct the integration of a complementing gene fragment [5]. 2. Expression levels of PGA5prom < PGA42prom < ORF19.7606prom. There were essential genes where no transformants were obtained unless using the ORF19.7606 promoter. 3. The concatenation of the 30 bp PGA5 promoter-specific nucleotide adaptor to the amplicons of the other promoters allows the use of a single set of PCR primers for subsequent amplification of any of the three promoters from the pRSARG4ΔSpederived plasmids for a given essential gene. 4. A HindIII restriction digest can be used to differentiate between the parent pRSARG4ΔSpe plasmid and transformants which have promoter inserts.

Diminished Essential Gene Expression

13

Acknowledgments We thank Manning Huang for design of the experimental flowchart. This work was supported by NIH grants R21 AI100270 (A.P.M.) and R01 AI067703 (A.P.M.). Protocol first published in Woolford et al. [3]. References 1. Eckert SE, Muhlschlegel FA (2009) Promoter regulation in Candida albicans and related species. FEMS Yeast Res 9(1):2–15 2. Xu QR, Yan L, Lv QZ, Zhou M, Sui X, Cao YB, Jiang YY (2014) Molecular genetic techniques for gene manipulation in Candida albicans. Virulence 5(4):507–520 3. Woolford CA, Lagree K, Xu W, Aleynikov T, Adhikari H, Sanchez H, Cullen PJ, Lanni F, Andes DR, Mitchell AP (2016) Bypass of Candida albicans filamentation/biofilm regulators through diminished expression of protein kinase Cak1. PLoS Genet 12(12):e1006487 4. Min K, Ichikawa Y, Woolford CA, Mitchell AP (2016) Candida albicans gene deletion with a transient CRISPR-Cas9 system. mSphere 1(3): e00130–e00116 5. Wilson RB, Davis D, Mitchell AP (1999) Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181(6):1868–1874 6. Spreghini E, Davis DA, Subaran R, Kim M, Mitchell AP (2003) Roles of Candida albicans Dfg5p and Dcw1p cell surface proteins in

growth and hypha formation. Eukaryot Cell 2 (4):746–755 7. Wilson RB, Davis D, Enloe BM, Mitchell AP (2000) A recyclable Candida albicans URA3 cassette for PCR product-directed gene disruptions. Yeast 16(1):65–70 8. Vyas VK, Barrasa MI, Fink GR (2015) A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Sci Adv 1(3):e1500248 9. Agatep R, Kirkpatrick RD, Parchaliuk DL, Woods RA, Gietz RD (1998) Transformation of Saccharomyces cerevisiae by the lithium acetate/single-stranded carrier DNA/polyethylene glycol protocol. Technical Tips Online 3(1):133–137 10. Blankenship JR, Fanning S, Hamaker JJ, Mitchell AP (2010) An extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog 6(2):e1000752 11. Ganguly S, Mitchell AP (2012) Mini-blastermediated targeted gene disruption and marker complementation in Candida albicans. Methods Mol Biol 845:19–39

Chapter 2 Serological Proteome Analysis for the Characterization of Secreted Fungal Protein Antigens Juliane Macheleidt and Olaf Kniemeyer Abstract Defining the humoral immune response to infectious agents is important for gaining insights into infectious diseases and the response of the immune system. It can further aid development of serodiagnostic tests, discovery of vaccine antigen candidates, and immuno-epidemiological research. During the last three decades, serological proteome analyses (SERPAs) have played a significant role in characterizing the antibody response of humans or animals to fungal pathogens. SERPA combines 2D-gel electrophoresis with Western blotting. The introduction of multiplexing approaches by means of fluorescent dyes has greatly improved the reliability of the 2D technique and has boosted also the qualitative capabilities of the SERPA approach. In this chapter, we detail a SERPA protocol using fungal extracellular proteins from a fungal culture, here as an example the mold Aspergillus fumigatus. Key words SERPA, Serological proteome analysis, Humoral response, Antibody, Immunoglobulin, Western blot, Immunoproteomics, Fungal pathogens, Aspergillus fumigatus, Secretome

1

Introduction The humoral response to an infection refers to an adaptive immune defense mechanism that is mediated by antibody-secreting B lymphocytes. Antibodies (immunoglobulins) are able to specifically recognize and neutralize invading pathogens. The analysis of the humoral response against infectious agents is important for the understanding of host–pathogen mechanisms, the establishment of diagnostic tools, and the development of vaccines. Early studies relied heavily upon SDS-PAGE and sandwich ELISAS for the detection of seroreactive antigens. Nowadays, protein/peptide microarrays and serological proteome analysis (SERPA) methods are used to evaluate the antibody response in humans or animals (reviewed in [1–4]). The SERPA method was first applied to detect tumor antigens [5, 6], but later it was successfully adapted to infection biology [7]. SERPA can be described as a combination of 2D-gel electrophoresis with Western blotting (Fig. 1) and is

Elaine Bignell (ed.), Host-Fungal Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2260, https://doi.org/10.1007/978-1-0716-1182-1_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

15

16

Juliane Macheleidt and Olaf Kniemeyer

Fig. 1 Workflow illustrating the SERPA method. Protein antigens used for Western blotting were prepared from the supernatant of an A. fumigatus culture. Proteins were separated by 2D-gel electrophoresis and transferred to PVDF membranes by tank blotting. Membranes were probed with patient serum and detected Western blot signals were aligned with protein-stained membranes. Proteins of interest are excised, tryptically digested, and identified by mass spectrometry

carried out as follows: The antigen used is usually a whole cell lysate or a subproteome fraction, e.g., the secretome. The proteins are separated by 2D-gel electrophoresis, which starts with the isoelectric focusing of proteins in the first dimension and continues with SDS electrophoresis in the second dimension. Afterwards, the proteins are transferred from 2D gels to a nitrocellulose or PVDF membrane by blotting. The membranes are probed with serum from a patient with an infection or a healthy control. Conjugated secondary antibodies are employed to visualize antigen–antibody reactions based on colorimetric, fluorescence, or chemiluminescence detection. A second preparative 2D gel is run and stained (e.g., with Coomassie) in parallel. Then the captured

Serological Proteome Analysis of Extracellular Protein

17

immunoblotting signals are aligned with the protein spots of the preparative gel. The assignment of antibody signals with antigen spots can be facilitated by additional staining of the proteins on the membrane after transfer. The immunoreactive proteins are excised from the preparative 2D gel, tryptically digested, and subsequently identified by mass spectrometry (see also [8]). The SERPA method is still one of the most popular immunoproteomics methods, since it provides relative high sensitivity and it can be carried out in any laboratory with the appropriate equipment. An additional advantage is that posttranslational modification states of protein antigens are captured by the analysis [4]. Admittedly, SERPA has also some disadvantages. The method is restricted to protein antigens that are amenable to 2D-gel electrophoresis and excludes low abundance, hydrophobic, membrane proteins, and proteins with extreme isoelectric points. Furthermore, the precise assignment of Western blot signals to protein spots is not free from errors [9]. However, protocols have been established to improve the matching of Western blot signals with protein spots. Dutoit-Lefevre et al. [10] established a multiplexing approach (fluorescence-based bidimensional immunoproteomic approach) by using fluorescent dyes to detect the antigenic map, the proteomic map, and selected landmark proteins. Landmark proteins are detected by monoclonal antibodies directed against selected proteins and are used as anchors to ease spot matching between the 2D immunoblot and the proteomic map generated by total protein staining. Kusch et al. [11] took a different approach and improved the matching of immunoblot signals with the corresponding protein spots by partial immunoblotting, which allows tracking back the antigen signal to the corresponding spot on the original gel. The workflow described here makes also use of a multiplexing approach using different fluorescent dyes exemplified by the secreted protein antigens of a fungal culture. In our laboratory, this protocol was developed specifically for screening patient sera for A. fumigatus-specific protein antigens. Aspergillus fumigatus is a ubiquitously distributed filamentous fungus, which can cause diseases ranging from allergic responses to chronic, but also lifethreatening, invasive infections [12]. Several studies have described IgG- or IgE-reactive protein antigens of A. fumigatus in patients with allergic diseases or invasive infections. Most of these SERPAbased studies focused on fractions from the cell wall, the cytosol, or the secretome (reviewed in [13]). The aim of most studies was to detect protein antigens which may have the potential to be used for clinical diagnosis or immunotherapy. Whether and how immunoglobulins modify the course of a fungal infection is hitherto a largely unexplored field and needs further research efforts [14].

18

2

Juliane Macheleidt and Olaf Kniemeyer

Materials

2.1 Isolation of Secreted Proteins

1. Miracloth (Calbiochem).

2.2 Isoelectric Focusing (IEF) and 2D-Gel Electrophoresis

1. Rehydration buffer (RB): 7 M urea, 2 M thiourea, 4% (w/v) CHAPS, 0.002% (w/v) bromophenol blue. Dissolve not above 37  C and store aliquots at 20  C.

2. Sample buffer: 7 M urea, 2 M thiourea, 4% (w/v) CHAPS, 20 mM Tris. Dissolve at 37  C and store aliquots at 20  C.

2. Cy3 dye for protein labeling (e.g., SERVA Lightning Sci3) (see Note 1). 3. SERVALYT carrier ampholytes 3–10 Iso-Dalt for 2D electrophoresis (SERVA Electrophoresis GmbH). 4. Immobilized pH gradient (IPG) strips, pH 4–7, 11 cm (e.g., Immobiline DryStrip pH 4–7, GE Healthcare Life Sciences) (see Note 2). 5. Cover Fluid for IPG strips. 6. Precut electrode pads. 7. IEF system (e.g., Ettan IPGphor 3 IEF system, GE Healthcare Life Sciences). 8. Equilibration buffer: 30% (v/v) glycerol, 6 M urea, 75 mM Tris–HCl pH 8.8, 2% (w/v) SDS, 0.002% (w/v) bromophenol blue. Store aliquots at 20  C. 9. DTT solution: 1% (w/v) DTT in equilibration buffer. 10. IAA solution: 2.5% (w/v) iodoacetamide (IAA) in equilibration buffer. 11. Precast polyacrylamide gels for 2D-gel electrophoresis (e.g., AnykD™ Criterion™ TGX™ Precast Midi Protein Gel, Bio-Rad Laboratories). 12. SDS buffer: 2.5 mM Tris, 19.2 mM glycine, 0.01% (w/v) SDS. Prepare as 10 stock solution. 13. Agarose sealing solution: 0.5% (w/v) agarose, 0.002% (w/v) bromophenol blue in SDS buffer. Heat until agarose is completely dissolved. Solution can be stored at RT (solid). 14. Criterion Dodeca cell (Bio-Rad).

2.3 Electrophoretic Transfer/Wet Blot

1. Transfer buffer: 125 mM Tris, 960 mM glycine, 0.25% (w/v) SDS, 10% (v/v) methanol. Buffer can be prepared and stored as 5 stock solution without methanol. Add methanol directly before use (see Note 3). 2. Low fluorescence PVDF membrane (e.g., Immobilon-FL PVDF, 0.45 μm) (see Note 4). 3. Blotting paper, thickness 0.75 mm.

Millipore

Serological Proteome Analysis of Extracellular Protein

19

4. Wet/tank blotting system including power supply and a cooling element (e.g., Trans-Blot Cell, Bio-Rad Laboratories). 5. Human IgG. 2.4 Immunodetection

1. BlueBlock PF 10 blocking solution (SERVA Electrophoresis GmbH) (see Note 5). 2. Serum samples (the method is compatible with sera from humans or animals). 3. 10 Tris-buffered saline (TBS): 3 M NaCl, 200 mM Tris. Adjust with HCl to pH 8.0. 4. TBS-T: 1 TBS with 0.1% (v/v) Tween 20. 5. Antihuman IgG-Alexa 647 conjugated secondary antibody (e.g., Alexa Fluor® 647-AffiniPure F(ab0 )2 Fragment Goat Anti-Human IgG (H + L), Jackson ImmunoResearch) (seeNote 1).

2.5

Master Gel

1. Fixing solution: 40% (v/v) methanol, 7% (v/v) acetic acid. 2. Staining stock solution: 2% (v/v) o-phosphoric acid (85%), 10% (w/v) ammonium sulphate, 0.1% (w/v) Coomassie Brilliant Blue G-250. Completely dissolve o-phosphoric acid and ammonium sulphate in water. Then, add Coomassie dye under constant stirring. Prepare staining stock solution at least 2 h before use.

3

Methods All procedures are carried out at room temperature unless otherwise stated. Protect fluorescent dyes and fluorescence antibodies from light. Ensure appropriate safety precautions are followed and follow the waste disposal guidelines.

3.1 Isolation of Secreted Proteins

1. Harvest the supernatant of a fungal culture by filtering through Miracloth. 2. Add 1% (v/v) 100 mM PMSF dissolved in isopropanol and 1% (v/v) 100 mM EDTA to the culture supernatant to inhibit protease activity. 3. Add 20% (w/v) TCA and 0.3% (w/v) DTT and let the proteins precipitate overnight at 4  C (see Note 6). 4. Centrifuge the sample for 30 min at 30,000  g and 4  C. 5. Remove the supernatant and dissolve the pellet in the residual supernatant. 6. Transfer the complete sample to 2 ml tubes. 7. Centrifuge for 20 min at 20,000  g and 4  C. Remove the supernatant.

20

Juliane Macheleidt and Olaf Kniemeyer

8. Wash the pellets with 2 ml 20  C cold 90% (v/v) acetone. Centrifuge for 20 min at 20,000  g and 4  C and remove the supernatant. 9. Repeat step 8. 10. Air-dry the pellet for 5–10 min at RT (see Note 7). 11. Add 100 μl sample buffer to each tube and dissolve the pellets by vortexing and pipetting up and down. 12. Sonicate samples for 10 min in an ultrasonic bath. 13. Freeze samples for 1 h at 80  C and thaw them again at RT. 14. If the pellet is not dissolved, repeat step 13 up to three times. 15. Centrifuge the samples for 20 min at 20,000  g at RT. 16. Unite all supernatants, containing the secreted proteins, in one reaction tube and determine the protein concentration according to standard procedures. 17. Store proteins at 80  C. 3.2 Isoelectric Focusing

1. Per strip, label secreted proteins with Cy3 dye by diluting 80 μg secreted proteins to a volume of 100 μl with RB and adjust pH to 8.5 using 0.2 M NaOH with a pH indicator strip (see Note 8). 2. Add 0.5 μl 1 mM Cy3 dye dissolved in DMF and incubate for 30 min on ice in the dark. 3. Stop the reaction by adding 1 μl 10 mM lysine. 4. Add 0.8% (v/v) SERVALYT carrier ampholytes and DTT to a final concentration of 10 mM. 5. Add RB to a final volume of 200 μl. 6. Samples can be directly loaded on the IPG strip or stored at 80  C. 7. Load the protein sample on an IPG strip by applying 200 μl protein sample to a strip holder and put the IPG strip with the gel side down into the protein sample. 8. Cover the strips with Cover Fluid. 9. Allow rehydration loading of the strips overnight (or at least for 6 h) in the dark (see Note 9). 10. Position the ceramic manifold on the IEF system. 11. Place the IPG strips in the ceramic manifold as indicated on the IEF system for 11 cm strip length. Position the IPG strips with the gel side facing up. 12. Wet precut electrode pads with approximately 150 μl water and put them at the ends of the IPG strips slightly overlapping with the gel on the strip (approximately 3 mm). 13. Position the electrodes.

Serological Proteome Analysis of Extracellular Protein

21

14. Pour approximately 110 ml Cover Fluid on the manifold to cover all IPG strips. Close the IEF system. 15. Set and run the following IEF program: 300 V gradually for 3 h, 600 V gradually for 4 h, 1000 V gradually for 3 h, 8000 V gradually for 4 h, hold 8000 V until 20,000–48,000 Vh are reached (see Note 10). Stop program. 16. Directly continue or store strips at 80  C until use. 3.3 2D-Gel Electrophoresis

1. Incubate up to four IPG strips each for 20 min in 25 ml DTT solution and afterwards for 20 min in 25 ml IAA solution with gentle shaking. 2. Unpack precast gels and remove any liquid from the slots using small pieces of blotting paper. 3. Heat agarose sealing solution in the microwave until it forms a liquid lacking visible agarose clumps. 4. Briefly dip IPG strip in SDS buffer before placing in the designated gel slot. The gel side of the IPG strip is oriented to the front, the (+) end of the strip to the right, and the () end to the marker slot on the left (see Note 11). 5. Make sure the strip has contact to the gel and no air bubbles have formed between gel and IPG strip. 6. Seal the IPG strip on the gel by covering with approximately 0.5–1 ml agarose sealing solution using a plastic Pasteur pipette (see Note 12). Allow the agarose to solidify. 7. Put the gels in the Criterion Dodeca cell (Bio-Rad Laboratories) and fill the cell with 1 SDS buffer until the indicated filling line is reached. Also fill the upper buffer chamber of the gels. Assemble the cell and the power supply. 8. Run the gels at 200 V for approximately 35–40 min until the bromophenol blue reaches the end of the gel. 9. Image the gels with an appropriate imager equipped with the relevant filter (e.g., Amersham Typhoon Biomolecular Imager, GE Healthcare Life Sciences) (see Note 13).

3.4 Electrophoretic Transfer/Wet Blot

1. Per gel, cut one PVDF membrane and two filter papers to the size of the gel. 2. Prepare transfer buffer. 3. Equilibrate the gels in transfer buffer with methanol for 15–60 min under gentle agitation (see Note 14). 4. Activate membrane for 15 s in methanol (see Note 15) and allow them to equilibrate in transfer buffer for at least 5 min. Store it in transfer buffer until use. 5. Put the opened cassette in a container with transfer buffer.

22

Juliane Macheleidt and Olaf Kniemeyer

6. Assemble the gel sandwich by placing a pre-wetted fiber pad, a pre-wetted sheet of filter paper, the equilibrated gel, the activated PVDF membrane, a second sheet of pre-wetted filter paper, and the other pre-wetted fiber pad. When placing the PVDF membrane on the gel, make sure to remove any air bubbles that may have formed (see Note 16). 7. Close the cassette and place it into the tank. 8. Put the cooling coil in a free slot of the tank. 9. Fill the tank with transfer buffer. Add a magnetic stir bar. 10. Place the tank onto a magnetic stirrer. Finish assembly of all components. 11. Start transfer for 1 h at 0.4 A with active cooling to 15  C and stirring at approximately 400 rpm (seeNote 17). 12. When the transfer is finished, put the PVDF membrane in methanol for 15 s and let it air-dry (see Note 18). Keep the membrane protected from light. 13. While the membrane is drying, spot 0.05 μg human IgG and 0.1 μg secreted protein sample in one corner of the membrane (see Note 19). 14. When the membrane is completely dry, image the total protein with an appropriate imager equipped with the relevant filter (e.g., Amersham Typhoon Biomolecular Imager, GE Healthcare Life Sciences) (see Note 20). 3.5 Immunodetection

1. Activate dried membranes for 30 s–60 s in methanol. 2. Block membranes with blocking solution for 1 h at RT with gentle agitation. 3. Add patient sera diluted 1:200 in blocking solution to the membranes and incubate overnight at 4  C with gentle agitation (see Note 21). 4. Wash three times with TBS-T for 5 min each. 5. Incubate membranes in blocking solution with anti-human IgG Alexa 647 conjugate (dilution 1:2000) for 1 h (see Note 22). 6. Wash as in step 4. 7. Incubate membranes in methanol for 15 s and allow them to air-dry completely before scanning (see Note 23). Keep membranes protected from light. 8. Scan the membranes with an appropriate imager equipped with the needed filters (e.g., Amersham Typhoon Biomolecular Imager, GE Healthcare Life Sciences).

Serological Proteome Analysis of Extracellular Protein

3.6

Master Gel

23

1. Prepare a 2D gel as described in Subheadings 3.2 and 3.3. 2. Fix the gel for at least 1 h (maximum overnight) in fixing solution. 3. Add methanol to a final concentration of 20% (v/v) to the staining stock solution. 4. Stain the gel overnight in staining solution with methanol. 5. Wash the gel with 25% (v/v) methanol for 30 min. 6. Wash the gel with fresh 25% (v/v) methanol for 1 h. 7. Scan the gel. 8. Identify proteins of interest by appropriate methods [15].

3.7

Data Analysis

1. Use software appropriate for 2D-gel image analysis, e. g., DECODON Delta2D. 2. Mark and label all spots on the master gel. 3. For each immunoblot, warp the membrane with the signal of the secondary antibody to the membrane with the total protein signal. Warp the membrane with the total protein to the gel with the total protein. Warp the gel to the master gel. 4. Transfer spots and labels from the master gel to the membrane with the signal of the secondary antibody. A signal of the secondary antibody on the membrane can now be connected to a certain protein on the master gel.

4

Notes 1. The fluorescent dyes mentioned in the protocol are just suggestions. Make sure that the fluorescent signals used can be properly separated from each other. If signals are spectrally separable, a multiplexing approach can be set up, e. g., by using an additional fluorescence-conjugated secondary antibody. 2. Length and pH range of the IPG strip should be individually determined for each protein sample. The strip length also depends on the used gels and vice versa. 3. SDS in the transfer buffer increases the elution of proteins from the gel and thereby improving the transfer to the membrane. On the other hand, it discourages binding of proteins to the membrane while methanol removes SDS and enhances the binding. This is why the best SDS and methanol concentrations have to be determined individually for each protein sample. In general, when transferring a complex mixture of proteins, it is impossible to meet the ideal conditions for each individual protein. Rather, the combination of SDS and methanol

24

Juliane Macheleidt and Olaf Kniemeyer

showing the best overall transfer efficiency should be determined. Usually, SDS concentrations range from 0.025–0.1% (w/v) and methanol concentrations vary from 0–20% (v/v). 4. Both PVDF and nitrocellulose are suitable membranes for immunoblot applications, but PVDF membranes show higher binding capacity, stronger protein binding, and are more persistent than nitrocellulose membranes. Furthermore, methanol can be omitted in the transfer buffer when using PVDF membranes. When fluorescent dyes and/or fluorescenceconjugated antibodies are applied, a low fluorescence membrane should be used. A pore size of 0.45 μm is usually sufficient for immunoblotting; however, low-molecular-weight proteins might pass through the membrane. In this case, a 0.2 μm membrane might be applied. It is recommended to test different types of membranes and pore sizes to find the most suitable combination for your protein samples. 5. The appropriate blocking reagent needs to be assessed for each protein sample. Since one blocking reagent will probably not be equally suitable for all proteins on the 2D gel, the one with the best overall performance should be chosen. 6. It is recommended to freeze-dry large sample volumes before TCA precipitation. 7. Do not allow the pellet to dry completely, since it will be otherwise difficult to redissolve it. 8. Setting the pH to 8–9 is crucial for a successful labeling reaction. Instead of setting the pH in the final protein sample, the pH of the RB can already be adjusted. Carefully follow the manufacturer’s instructions for the dye used for detection. Protocols might differ from the method described here. 9. Rehydration loading is especially advantageous for short IPG strips. For longer strips and for basic pH ranges, cup loading might be more appropriate. 10. The program used for IEF depends on the strip length and pH range as well as on the sample used and therefore needs to be adapted accordingly. 11. If necessary, a protein standard suitable for Western blot transfer can be applied. To monitor the molecular weight markers on the final immunoblot, a standard for fluorescence detection needs to be chosen. When handling the standard, try to avoid a carryover of the protein standard to the gel slot, which contains the IPG strip. Otherwise marker signals will be detectable across the whole gel and membrane. 12. Make sure that the agarose sealing solution is not too hot when sealing the IPG strip on the gel.

Serological Proteome Analysis of Extracellular Protein

25

13. It is also possible to image the gels after the equilibration step described in Subheading 3.4, step 3. 14. Proper equilibration of the gel is necessary, especially when a transfer buffer with methanol is used. Methanol shrinks the gel, but must be avoided during electrophoretic transfer. Allow the gel to equilibrate until it reaches its final size. 15. PVDF membranes must always be activated with methanol before use. If the membrane gets dry during the procedure, it needs to be activated in methanol again. 16. The PVDF membrane should stay wet during the assembly. Removing air bubbles is crucial since they will prevent protein transfer. Use a roller, glass rod, or serological pipette to roll out air bubbles that are located between gel and membrane. 17. Transfer conditions have to be assessed for each protein sample. To do so, a second membrane can be placed behind the first one. This allows monitoring how much protein passes through the first membrane and how much stays in the gel. Again, when working with complex protein samples, the conditions with the best overall performance should be chosen: the majority of proteins bind to the first membrane while only a low amount passes through or stays in the gel. Cooling and stirring of the transfer buffer is required to keep conditions constant. Overheating of the buffer reduces its buffering capacity and changes the electric field strength and, consequently, the efficiency of protein transfer. On the other hand, cooling the transfer buffer below 10  C might result in SDS precipitation. 18. A short incubation of the membrane in methanol accelerates its drying. This step can also be omitted, but this will increase the drying time. The drying step fixes proteins to the membrane, but is not absolutely necessary. 19. These positive controls can be omitted, but are extremely useful when working with patient sera for the following reason: Before the experiment it is entirely unclear whether the patient serum contains significant amounts of antibodies directed against any of the proteins separated on the gel. Furthermore, proteins on the 2D gel are denatured, which causes the loss of conformational epitopes that are recognized by patient antibodies. The applied IgG serves as a control for the secondary anti-IgG antibody, while the native secreted proteins are used to check whether patient antibodies bind to the tested proteins. The drying of the membrane after application of the controls leads to the fixation of spotted proteins. 20. To image the membrane at this step is highly recommended to verify efficiency of the electrophoretic transfer. Dried PVDF membranes can be stored.

26

Juliane Macheleidt and Olaf Kniemeyer

21. The dilution of patient sera strongly depends on the expected quantities of IgG antibodies and the available amount of sera. Dilutions of 1:100 to 1:1000 can be used as starting dilutions to assess the most suitable concentration. 22. Optimal dilution of the secondary antibody has to be assessed for every experiment. Fluorescent antibodies usually require lower dilutions than antibody labels for chemiluminescence detection. Suitable dilution ranges can be previously checked by dot blot experiments. 23. Dry membranes can be stored for longer time periods. References 1. Tjalsma H, Schaeps RM, Swinkels DW (2008) Immunoproteomics: from biomarker discovery to diagnostic applications. Proteomics Clin Appl 2(2):167–180. https://doi.org/10. 1002/prca.200780012 2. Burbelo PD, Ching KH, Bush ER, Han BL, Iadarola MJ (2010) Antibody-profiling technologies for studying humoral responses to infectious agents. Expert Rev Vaccines 9 (6):567–578. https://doi.org/10.1586/erv. 10.50 3. Wang Y, Yang J, Li Z, Yang S (2014) Evolution of the strategies for screening and identifying human tumor antigens. Curr Protein Pept Sci 15(8):819–827 4. Ganesan V, Ascherman DP, Minden JS (2016) Immunoproteomics technologies in the discovery of autoantigens in autoimmune diseases. Biomol Concepts 7(2):133–143. https://doi.org/10.1515/bmc-2016-0007 5. Prasannan L, Misek DE, Hinderer R, Michon J, Geiger JD, Hanash SM (2000) Identification of beta-tubulin isoforms as tumor antigens in neuroblastoma. Clin Cancer Res 6(10):3949–3956 6. Klade CS, Voss T, Krystek E, Ahorn H, Zatloukal K, Pummer K, Adolf GR (2001) Identification of tumor antigens in renal cell carcinoma by serological proteome analysis. Proteomics 1(7):890–898. https://doi.org/ 10.1002/1615-9861(200107)1:73.0.CO;2-Z 7. Klade CS (2002) Proteomics approaches towards antigen discovery and vaccine development. Curr Opin Mol Ther 4(3):216–223 8. Fulton KM, Twine SM (2013) Immunoproteomics: current technology and applications. Methods Mol Biol 1061:21–57. https://doi. org/10.1007/978-1-62703-589-7_2 9. Broker BM, van Belkum A (2011) Immune proteomics of Staphylococcus aureus.

Proteomics 11(15):3221–3231. https://doi. org/10.1002/pmic.201100010 10. Dutoit-Lefevre V, Dubucquoi S, Launay D, Sobanski V, Dussart P, Chafey P, Broussard C, Duban-Deweer S, Vermersch P, Prin L, Lefranc D (2015) An optimized fluorescence-based bidimensional immunoproteomic approach for accurate screening of autoantibodies. PLoS One 10(7):e0132142. https://doi.org/ 10.1371/journal.pone.0132142 11. Kusch K, Uecker M, Liepold T, Mobius W, Hoffmann C, Neumann H, Werner HB, Jahn O (2017) Partial immunoblotting of 2D-gels: a novel method to identify post-translationally modified proteins exemplified for the myelin acetylome. Proteomes 5:1. https://doi.org/ 10.3390/proteomes5010003 12. Paulussen C, Hallsworth JE, Alvarez-Perez S, Nierman WC, Hamill PG, Blain D, Rediers H, Lievens B (2017) Ecology of aspergillosis: insights into the pathogenic potency of Aspergillus fumigatus and some other Aspergillus species. Microb Biotechnol 10(2):296–322. https://doi.org/10.1111/1751-7915.12367 13. Kniemeyer O, Ebel F, Kruger T, Bacher P, Scheffold A, Luo T, Strassburger M, Brakhage AA (2016) Immunoproteomics of Aspergillus for the development of biomarkers and immunotherapies. Proteomics Clin Appl 10 (9–10):910–921. https://doi.org/10.1002/ prca.201600053 14. Casadevall A, Pirofski LA (2012) Immunoglobulins in defense, pathogenesis, and therapy of fungal diseases. Cell Host Microbe 11 (5):447–456. https://doi.org/10.1016/j. chom.2012.04.004 15. Shevchenko A, Tomas H, Havlis J, Olsen JV, Mann M (2006) In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat Protoc 1(6):2856–2860. https:// doi.org/10.1038/nprot.2006.468

Chapter 3 Identification of Host Receptors for Fungi Using Whole Cell Affinity Purification Quynh T. Phan and Scott G. Filler Abstract Receptors on endothelial and epithelial cells often recognize molecules that are expressed by fungi, and only a limited number of these receptors have been identified to date. Here, we describe a method for identifying novel host cell receptors for fungi that uses intact organisms to precipitate biotin-labelled host cell membrane proteins, which are then detected by immunoblotting with an anti-biotin antibody. Presented here is the method to use for identification of membrane proteins that bind to C. albicans. Key words Fungi, Endothelial cells, Epithelial cells, Receptor, Invasion, Immunoblotting

1

Introduction During infection, pathogenic fungi typically interact with two general types of host cells, myeloid cells such as neutrophils, macrophages, dendritic cells, and lymphocytes, and normally nonphagocytic host cells such as endothelial and epithelial cells. Myeloid cell receptors frequently recognize conserved ligands that are expressed on the surface of multiple microorganisms, and it is probable that the majority of these receptors have already been identified. By contrast, the fungal receptors on endothelial and epithelial cells often recognize molecules that are expressed by a limited number of fungi, and only a limited number of these receptors have been identified to date. Discovering these receptors provides insight into the pathogenesis of infection because they often mediate pathogenic interactions of fungi with host cells, such as host cell invasion and fungal-induced host cell damage [1–7]. Furthermore, host cell receptors for fungi are potential therapeutic targets. Here, we describe a method for identifying novel host cell receptors for fungi that uses intact organisms to precipitate biotin-labeled host cell membrane proteins, which are then

Elaine Bignell (ed.), Host-Fungal Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2260, https://doi.org/10.1007/978-1-0716-1182-1_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

27

28

Quynh T. Phan and Scott G. Filler

detected by immunoblotting with an anti-biotin antibody. This approach was modified from a method developed by Isberg and Leong [8]. It has been used to identify N-cadherin as the endothelial cell receptor for Candida albicans [4], E-cadherin and a heterodimer composed of the epidermal growth factor receptor and HER2 as the epithelial cellreceptors for C. albicans [3, 6], integrin α5β1 as the endothelial and epithelial cell receptor for Aspergillus fumigatus [1], and GRP78 as the endothelial and epithelial cell receptor for Rhizopus oryzae and other members of the Mucorales family [2]. Presented here is the method to use for identification of membrane proteins that bind to C. albicans.

2

Materials All reagents should be prepared and stored at room temperature (unless otherwise indicated). All tissue culture materials and reagents should be sterile and pyrogen-free. The solutions are prepared in nanopure water. Make sure to follow all waste disposal regulations when disposing potentially hazardous waste. We do not routinely add azide to the reagents.

2.1 Biotin and Octyl Glucoside

1. 37  C tissue culture incubator with 5% CO2. 2. Host cells: Endothelial cells or epithelial cells grown in a monolayer to >95% confluency in 75 cm2 tissue culture flasks. Typically, three flasks are processed at once. 3. Dulbecco’s phosphate buffered saline with calcium and magnesium (DPBS++). Cool ~200 ml to 4  C on ice and warm ~200 ml to 37  C in a water bath. 4. 0.2 M PMSF: Add 174.19 mg PMSF to 5 ml of 100% ethanol. Vortex and warm to 37 C until completely dissolved. Aliquot into small volumes and store at 20 C. Before use, warm the tube to 37 C to dissolve the PMSF. Just before the 5.8% octyl glucoside is to be used, add 5 μl of PMSF to it (see Note 1). 5. Octyl glucoside: Store at 20  C. 6. 5.8% octyl glucoside: Add 0.058 g octyl glucoside to 1 ml DPBS++, mix, and store on ice. Prepare on the day of the experiment. Just before use, add 10 μl protease inhibitor cocktail (Sigma-Aldrich) and 5 μl PMSF. 7. Biotin solution: Add 7.5 mg of Sulfo-NHS-LC-Biotin to DPBS++ to reach a final concentration of 0.5 mg/ml (5 ml of biotin solution for each 75 cm2 tissue culture flask). Prepare on the day of the experiment (see Note 2). 8. Cell scrapers. 9. Refrigerated table-top centrifuge with a swinging bucket rotor.

Host Receptors for Fungi

29

10. Ultracentrifuge with a fixed angle rotor for 5 ml tubes (e.g., Type 90 Ti rotor) (see Note 3). 11. Ultracentrifuge tubes: Thin walled, polypropylene (5 ml). 12. Centrifuge tube (50 ml conical polypropylene; weight and record the weight). 13. Microcentrifuge tubes (sterile 1.5 ml). 14. Bradford dye reagent. 15. 1 mg/ml BSA: Add 1 mg BSA to 1 ml DPBS and store at 20  C. 16. Spectrophotometer to measure protein concentration. 2.2 Affinity Purification

1. C. albicans. 2. YPD broth: Add 5 g Bacto yeast extract, 10 g Bacto peptone, and 10 g dextrose to 500 ml of nanopure water. Autoclave for 15 min at 21 psi and allow to cool. Store at room temperature. 3. RPMI 1640 medium, prewarmed to 37  C in a sterile 1000 ml glass Erlenmeyer flask. 4. Disposable 500 ml filter system with a 0.2 μm filter. 5. Sterile 18  150 mm glass test tube. 6. Sterile 10  100 mm glass test tube. 7. 50 ml centrifuge tubes. 8. 1.5 ml microcentrifuge tubes. 9. Dulbecco’s phosphate buffered saline without calcium and magnesium (DPBS). 10. 1.5% octyl glucoside: Add 0.15 g octyl glucoside to 10 ml DPBS++, mix, and store on ice. Prepare on the day of the experiment. Just before use, add 100 μl protease inhibitor cocktail (Sigma-Aldrich) and 50 μl PMSF. 11. 6 M Urea: Add 360 mg of urea to 640 μl of 1.5% octyl glucoside and vortex, warm to 37  C to dissolve. Store at room temperature. Just before use, add 10 μl protease inhibitor cocktail (Sigma-Aldrich) and 5 μl PMSF. 12. 6 SDS sample buffer. 13. 90  C heating block. 14. 37  C shaking incubator.

2.3

Western Blotting

1. 10% precast tris-glycine polyacrylamide gel. 2. Mini Gel Electrophoresis apparatus with power supply. 3. Pre-stained Kaleidoscope protein standards. 4. PVDF Immobilon-P Transfer Membrane, pore size 0.45 μM (Millipore; Cat. No. IPVH00010).

30

Quynh T. Phan and Scott G. Filler

5. Whatman filter paper 3 (GE Healthcare Life Services; Cat. No. 1004-917). 6. Tris/Glycine/SDS running buffer: Add 100 ml of 10 Tris/ Glycine/SDS running buffer (Bio-Rad Cat. No. 161-0772) to 900 ml nanopure water. 7. Tris/Glycine transfer buffer: Add 100 ml of 10 Tris/Glycine buffer (Bio-Rad Cat. No. 161-0771) to 800 ml nanopure water, then add 100 ml of methanol. Place the buffer on ice to keep cold. 8. Washing buffer TBST: (contains 50 mM Tris, 150 mM NaCl pH 7.4, 0.05% Tween 20. For 1 L of TBST, add 100 ml of 10 tris-buffered saline to 900 ml of nanopure water, and 500 μl of Tween 20. 9. Impulse sealer. 10. 5% milk TBST: add 5 g of nonfat dry milk to 100 ml of TBST. 11. Mouse monoclonal anti-biotin antibody (Sigma-Aldrich; clone BN34; Cat. No. B7652). 12. Horseradish peroxidase-labeled goat anti-mouse IgG crossed adsorbed secondary antibody (Thermo Fisher Scientific; Cat. No. G-21040). 13. Enhanced luminescence kit (Thermo Fisher; SuperSignal West Dura Substrate, Cat. No. 34075). 14. Digital gel imager.

3

Methods Carry out all procedures at room temperature unless otherwise specified.

3.1 Biotinylation and Isolation of Host Cell Membrane Proteins

1. Aspirate the tissue culture medium from the 75 cm2 tissue culture flasks containing the host cells and rinse cells twice with 5 ml of warm DPBS++ (see Note 4). 2. Add 5 ml of 0.5 mg/ml biotin solution to each flask. Place in 5% CO2 incubator at 37  C for 12 min. 3. Aspirate the biotin solution and rinse each flask three times with 4 ml ice cold DPBS++. 4. Add 3 ml of DPBS++ to each flask and detach the cells using the cell scraper. Using a sterile 10 ml pipet, transfer the cells from all flasks to the pre-weighed 50 ml centrifuge tube. 5. Rinse each flask with an additional 3 ml of cold DPBS++ and add to the pre-weighed 50 ml centrifuge tube. 6. Centrifuge the 50 ml tube at 200  g for 5 min at 4  C.

Host Receptors for Fungi

31

7. Aspirate the supernatants. Save the cell pellet. 8. Weight the centrifuge tube with the cell pellet. Subtract the weight of the tube before adding cells to determine the weight of the pellet. 9. Assume that the density of the cell pellet is 1 mg/ml. Add an equal volume of the 5.8% octyl glucoside with protease inhibitors to the cell pellet. 10. Incubate the cell pellet–octyl glucoside mixture on ice for 20 min. Transfer mixture to a sterile 1.5 ml microcentrifuge tube and vortex gently every 5 min. 11. Centrifuge the tube containing the cell pellet–octyl glucoside mixture at l6,000  g for 5 min at 4  C in a microcentrifuge. Collect the supernatant and transfer to the ultracentrifuge tube. 12. Centrifuge for 1 h at 4  C at 40,000 rpm (100,000  g). 13. Collect supernatant, which contains the membrane proteins, and transfer to a sterile 1.5 ml microcentrifuge tube. Place the tube on ice. 14. Measure the protein concentration using Bradford dye assay. To do so, make a standard curve using 1 mg/ml BSA as indicated in the table below. Dilute the membrane proteins 1:5 in sterile nanopure water (add 1 μl of membrane proteins to 4 μl of water) before determining the concentration in the assay. Standard curve Sample ID

BSA Blank 1 μg

BSA 2 μg

BSA 3 μg

BSA 4 μg

Sample Membrane proteins

1 mg/ml BSA (μl)

0

1

2

3

4

0

Membrane proteins (μl)

0

0

0

0

0

2

Nanopure H2O (μl)

800

799

798

797

796

798

Bradford dye (μl)

200

200

200

200

200

200

15. Vortex the mixture above, wait for 5 min. 16. Measure the optical density of each sample at 595 nm. 17. Calculate concentration of each protein sample using the standard curve constructed with BSA (see Note 5). 18. Aliquot proteins into 1.5 ml microfuge tubes at 250 μg per tube and store at 80  C until use.

32

Quynh T. Phan and Scott G. Filler

3.2 Affinity Purification of Proteins that Bind to C. albicans

1. The night before the experiment, inoculate a colony of C. albicans into 5 ml of YPD broth in a 50 ml centrifuge tube. Partially tighten the cap and secure it with a piece of tape. Incubate overnight at 30  C in a shaking incubator. 2. The next morning, centrifuge the tube containing the C. albicans culture at 1000  g in a table-top centrifuge, decant the supernatant, and resuspend the cell pellet in 10 ml of PBS. 3. Repeat step 2. 4. Centrifuge the cells a third time and resuspend the cells in 10 ml of PBS. 5. Dilute the C. albicans cells 1:100 in PBS (10 μl of cell suspension in 990 μl PBS) and count the number of cells with a hemacytometer. 6. Using prewarmed RPMI 1640 broth, make up 300 ml of a suspension containing 3  106C. albicans cells per ml in a sterile 1000 ml glass Erlenmeyer flask. 7. Incubate in 37  C shaker for 1.5 h until the length of the germ tubes is about four times the width of a yeast cell. 8. Collect the germ tubes by pouring them into the 500 ml filter system and then applying a vacuum. Allow the medium to pass through the filter until a few milliliters are left. Make sure that the organisms are not filtered to dryness. Rinse the organisms by passing 10 ml of PBS to filter system twice. 9. Add 3 ml of PBS to organisms, mix well, and transfer to the sterile 18  150 mm glass test tube (see Note 6). Dilute 1:100 in PBS and count with a hemacytometer. 10. Calculate the volume of germ tube suspension required to obtain 2  108 germ tubes. For example, if the germ tube suspension contains 8  107 organisms per ml, one would need 2  108/8  107 ¼ 2.5 ml of the suspension. Add this volume of cells to a sterile 13  100 glass test tube. 11. Place the glass test tube inside of a 50 ml polypropylene centrifuge tube and centrifuge at 1000  g in a table-top centrifuge. 12. Decant the supernatant. 13. Resuspend pellet in 0.5 ml PBS and transfer to a 1.5 ml microfuge tube. Centrifuge in a microfuge at 16,000  g for 30 s and discard supernatant. Place organisms on ice. 14. Calculate the amount and concentration of octyl glucoside that must be added to membrane proteins to achieve 0.5 ml volume containing 250 μg of membrane protein in a final octyl glucoside concentration of 1.5%. Sample calculation: if the concentration of membrane proteins (which are in 5.8% octyl glucoside) is 8.3 μg/μl, then 250 μg/8.3 μg/ml ¼ 0.03 ml of the membrane preparation will be needed. Therefore,

Host Receptors for Fungi

33

0.470 ml (0.50–0.030 ml) must be added to the sample to increase the volume to 0.50 ml. Next, determine the concentration of octyl glucoside that must be in the 0.470 ml to achieve a final octyl glucoside concentration of 1.5%. Sample calculation: the octyl glucoside concentration ¼ ((1.5% * 0.50 ml)  (5.8% * 0.03 ml))/ 0.47 ml ¼ 1.23%. Thus, add 0.47 ml of 1.23% octyl glucoside to 0.03 ml of membrane protein. 15. Add 0.50 ml of the diluted membrane proteins in 1.5% octyl glucoside to the microfuge tube containing the C. albicans and vortex to resuspend the organisms. 16. Incubate on ice for 60 min. Vortex every 10–15 min. 17. Centrifuge in a microcentrifuge at 3,300  g for 5 min at 4 C. 18. Aspirate the supernatant. 19. Add 0.50 ml of 1.5% octyl glucopyranoside with protease inhibitors to each pellet. 20. Vortex and centrifuge at 3,300  g for 5 min at 4 C. 21. Discard supernatant and wash again two more times. 22. Aspirate the supernatant. 23. Resuspend pellet in 0.030 ml of 6 M urea and incubate on ice for 20 min. Vortex every 3 min. 24. Centrifuge at 3,300  g for 5 min at 4 C. 25. Collect supernatant, add 6 μl 6 SDS sample buffer, mix, and place in a 90 C heating block for 2 min. Store at 20 C until ready to perform SDS-PAGE. 26. For loading control, add 6 μl 6 SDS sample buffer to 0.030 ml of 0.5 μg/μl biotinylated protein (¼15 μg). Boil for 2 min. Store at 20  C until ready to perform SDS-PAGE. 3.3

Western Blotting

1. Place 10% mini gel into the electrophoresis apparatus. Fill the gel box with 1 SDS/Tris/glycine buffer. 2. Load 10 μl kaleidoscope marker into the first well of the gel using a micropipette with a gel loading tip. 3. Load the entire amount of each samples into successive wells. 4. Skip one lane, then load 20 μl (¼10 μg) the total membrane protein sample as a positive control. 5. Run gel at 100 V for 10 min, then increase the voltage to 130 V. Run gel for 1–2 h until the blue dye reaches to the bottom of the gel (seeNote 7). 6. Remove the cell from the electrophoresis apparatus. 7. Cut the PVDF membrane to the size to the gel (see Note 8). Wet the membrane with 10 ml of 100% methanol and then rinse with 1 Tris/glycine transfer buffer.

34

Quynh T. Phan and Scott G. Filler

8. Cut two pieces of Whatman filter paper to the size of the gel. 9. Fill the transfer tank with 1 Tris/glycine transfer buffer. Place the frozen gel block into the transfer tank. 10. Place the transfer cassette into a clean container filled with 100 ml transfer buffer. Place the anode side at the bottom of the tray. Create a stack consisting of sponge, filter paper, gel, PVDF membrane, filter paper, and sponge in this order. Smooth out the stack with a roller to remove bubbles. Close the transfer cassette. 11. Place the transfer cassette to the transfer tank. Place the transfer tank into an ice bucket and fill with ice (see Note 9). 12. Transfer protein at 100 V for 75–90 min while monitoring the current (see Note 10). 13. Remove PDVF membrane from transfer apparatus and seal inside a plastic bag with the impulse sealer, leaving a corner of the bag unsealed for adding the blocking buffer. 14. Add 10 ml of 5% milk in TBST to the plastic bag and seal with impulse sealer. Incubate at room temperature for 1 h on shaker. 15. Transfer membrane to new plastic bag. 16. Add 10 ml of 1:5000 anti-biotin antibody in 5% milk TBST and seal. Incubate at room temperature for 1 h on shaker. 17. Transfer membrane to a small tray (see Note 11). 18. Wash by adding 10–15 ml TBST to the membrane and incubating it at room temperature for 5 min on shaker. 19. Repeat step 18. 20. Incubate membrane in the tray with 10 ml of the horseradish peroxidase-labeled goat anti-mouse secondary antibody diluted 1:5000 (2 μl of horseradish peroxidase-labeled goat anti mouse IgG to 10 ml 5% milk TBST). 21. Incubate at room temperature on shaker for 1 h. 22. Wash membrane twice with 10–15 ml TBST and then transfer to a new plastic bag. 23. Prepare SuperSignal West Dura substrate solution right before developing the membrane. Mix 1 ml of solution A with 1 ml solution B. Add the enhanced chemiluminescence substrate mixture to the membrane and incubate for 2–4 min. Use paper towel to wipe the excess substrate (see Note 12). 24. Image blot using a digital imager.

Host Receptors for Fungi

4

35

Notes 1. Once the PMSF has been defrosted, keep it at room temperature. Do not place the tube on ice because precipitation will occur. PMSF breaks down within 30 min after being added to an aqueous solution. 2. It may be necessary to verify that biotinylation does not interfere with interaction of the fungus with the host cell. To test for this possibility, biotinylate the surface proteins of the host cells, but do not scrape the cells from the plate. Instead, compare the interactions of the fungus with biotinylated host cells and non-biotinylated host cells. If biotinylation with Sulfo-NHSBiotin is found to interfere with the host cell interaction, consider trying a biotin preparation with a longer linker, such as Sulfo-NHS-LC-LC-Biotin. 3. Turn on ultracentrifuge and allow it to cool to 4  C prior to use. 4. To avoid having the cells dry out in between rinses, process each flask in series, with a 3 min interval between flasks. 5. The typical protein yield for 3, 75 cm2 flasks is about 1000 μg, depending on the host cell type and the degree of confluency. 6. When working with C. albicans germ tubes in the absence of octyl glucoside, use glass tubes to reduce the number of organisms that adhere to the walls of the vessel. Also avoid excessive vortexing as this will induce clumping of the organisms. 7. The duration and voltage for running the samples may need to be adjusted depending on the molecular masses of the proteins that are being separated. 8. Be careful not to touch the PDVF membrane with your fingers to avoid contamination with unwanted proteins. Wear gloves and handle the membrane with forceps. 9. It is important to keep the transfer tank cool during the transfer. Otherwise the gel may melt and adhere to the blot. One approach to keeping the apparatus cool is to perform the protein transfer in a 4  C cold room. 10. Even though the blot is transferred at constant voltage, the amperage will change, depending on the temperature of the buffer. If the current exceeds 500 mA, add more ice around the transfer tank to cool it down. 11. The primary antibody can be collected and stored at 4  C for reuse. 12. If brown bands become visible on the blot before the image is captured, this indicates that too much biotinylated protein is present. To correct this, load the gel with a smaller amount of sample.

36

Quynh T. Phan and Scott G. Filler

Acknowledgement This work was supported by NIH grants R01AI124566 and R01DE022600 to S.G.F. References 1. Liu H, Lee MJ, Solis NV, Phan QT, Swidergall M, Ralph B, Ibrahim AS, Sheppard DC, Filler SG (2016) Aspergillus fumigatus CalA binds to integrin a5b1 and mediates host cell invasion. Nat Microbiol 2:16211 2. Liu M, Spellberg B, Phan QT, Fu Y, Lee AS, Edwards JE Jr, Filler SG, Ibrahim AS (2010) The endothelial cell receptor GRP78 is required for mucormycosis pathogenesis in diabetic mice. J Clin Invest 120:1914–1924 3. Phan QT, Myers CL, Fu Y, Sheppard DC, Yeaman MR, Welch WH, Ibrahim AS, Edwards JE, Filler SG (2007) Als3 is a Candida albicans invasin that binds to cadherins and induces endocytosis by host cells. PLoS Biol 5:e64 4. Phan QT, Fratti RA, Prasadarao NV, Edwards JE Jr, Filler SG (2005) N-cadherin mediates endocytosis of Candida albicans by endothelial cells. J Biol Chem 280:10455–10461

5. Liu Y, Mittal R, Solis NV, Prasadarao NV, Filler SG (2011) Mechanisms of Candida albicans trafficking to the brain. PLoS Pathog 7: e1002305 6. Zhu W, Phan QT, Boontheung P, Solis NV, Loo JA, Filler SG (2012) EGFR and HER2 receptor kinase signaling mediate epithelial cell invasion by Candida albicans during oropharyngeal infection. Proc Natl Acad Sci U S A 109:14194–14199 7. Swidergall M, Solis NV, Lionakis MS, Filler SG (2018) EphA2 is an epithelial cell pattern recognition receptor for fungal b-glucans. Nat Microbiol 3:53–61 8. Isberg RR, Leong JM (1990) Multiple beta 1 chain integrins are receptors for invasin, a protein that promotes bacterial penetration into mammalian cells. Cell 60:861–871

Chapter 4 CRISPR-Cas9-Mediated Gene Silencing in Cultured Human Epithelia Sara Gago, Nicola L. D. Overton, and Paul Bowyer Abstract CRISPR/Cas9 technology enables rapid and efficient genome editing in a variety of experimental systems. Genome editing using CRISPR/Cas9 has become an increasingly popular genetic engineering tool due to (1) an extensive array of commercial ready-to-use CRIPSR/Cas9 systems, (2) improved efficiency of cell delivery, and (3) the possibility to do multigene editing. Here, we describe a method to introduce single gene disruption in lung bronchial epithelial cells. This approach can be used to study host factors important for pathogen interaction or to identify and study genetic markers determining susceptibility to fungal disease. Key words CRISPR/Cas9, Genome editing, Host–fungi interaction

1

Introduction The ability to easily and efficiently make targeted modifications of the genome in mammalian cells has transformed basic science, biotechnology, and medicine in the last few years. The discovered CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and the associated CRISPR-genes (Cas) allows for ease of genome manipulation, achievable at a low cost [1]. The basic CRISPR/Cas9 system integrates three elements, the nuclease Cas9, the crRNA array that encodes the guide RNA (generally a single guide RNA), and an auxiliary trans-activating crRNA (tracrRNA) that facilitates the processing of the crRNA array. The guide RNA together with Cas9 will form a ribonucleoprotein complex which will target a 20 bp DNA region complementary to the guide [2]. In the widely used CRIPSR-Cas9 systems derived from Streptococcus pyogenes, the target DNA must precede a 50 -NGG PAM sequence [3]. The guide RNA will program the Cas9 endonuclease to create a double-strand break at the targeted genomic location leading to a truncation on the DNA sequences which can been repaired either by nonhomologous end-joining

Elaine Bignell (ed.), Host-Fungal Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2260, https://doi.org/10.1007/978-1-0716-1182-1_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

37

38

Sara Gago et al.

Guide RNA binding to target region

Target

DNA 1

2 Cas9 binding to guide RNA

3

Double strand DNA cung

4 Cut Repair

Nonhomologous end-joining

Loss of funcon

Homologous Direct Recombinaon

Repair Template

Gene Replacement

5

Fig. 1 Mechanistic overview of CRISPR/Cas9 mutagenesis

which introduces missense mutations leading to early truncation of the protein or, by homology-directed repair in the presence of a sequence which works as a repair template (Fig. 1) [4–6]. Here, we describe a CRIPSR/Cas9 deletion protocol for use in immortalized lung epithelial cells facilitating the study of host

CRISPR/Cas9, Genome Editing, Host-Pathogen Interaction

39

factors modulating the response against fungal pathogens upon infection. This method can be extrapolated to other cell lines to study many mechanistic aspects of host defenses against fungal pathogens. This method was originally developed in human embryonic kidney (HEK 293FT) and human stem cell (HUES9) lines [1]. However, it has been similarly applied to other cell types and organisms including humans, mice, zebrafish, or Drosophila [5–9]. Human 16HBE bronchial epithelial cells are grown on 24-well plates until confluence is 90%. Cells are then transfected with an allin-one CRISPR/Cas9 plasmid targeting the selected genomic region using a lipid vehicle. Forty-four hours after transfection, transfected cells are selected, clonally expanded in culture, and validated by western blot analysis. The successfully genome edited clones can be used for downstream applications in fungal challenge experiments.

2

Materials

2.1 Construction of the CRISPR/Cas9 Plasmids

1. Linearized CRISPR/Cas9 Vector (Invitrogen A21174) (see Note 1). 2. Oligonucleotides forward and reverse at 200 μM for guide RNA construction (see Note 2). 3. 10 oligonucleotide annealing buffer (100 mM Tris–HCl, pH 8.0; 10 mM EDTA, pH 8.0; 1 M NaCl) (see Note 3). 4. DNAse-free water (see Note 3). 5. 1.5 ml sterile microcentrifuge tubes. 6. 95  C heat block. 7. Ligation Buffer (250 mM Tris–HCl, pH 7.6; 50 mM MgCl2; 5 mM ATP; 5 mM DTT; 25% (w/v) polyethylene glycol-8000) (see Note 3). 8. One Shot TOP10 Competent E. coli (see Note 4). 9. S.O.C. Medium (2% w/v tryptone, 0.5% w/v yeast extract, 10 mM NaCl, 2.5 mM KCl2, MgCl2 10 mM, 10 mM MgSO4, Glucose 20 mM). Prepare a solution containing the tryptone, yeast extract, NaCl, and KCl2 at the concentrations indicated. Sterilize at 121  C. Then add the sterile MgCl2, Mg SO4, and glucose solutions (see Note 5). 10. LB ampicillin (100 μg/ml) agar plates. LB agar is prepared according to the manufacturer’s instructions (Sigma, L3147) and sterilized at 121  C. When media temperature reaches 50  C, add the ampicillin. 11. LB Broth ampicillin (100 μg/ml). LB is prepared according to the manufacturer’s instructions (Sigma, L3022) and sterilized

40

Sara Gago et al.

at 121  C. When media temperature reaches 50  C, the ampicillin is added at a 100 μg/ml final concentration. 12. 42  C heat block. 13. 37  C incubator, static and shacking. 14. Glycerol. 15. Kit for plasmid miniprep (QIAprep Spin Miniprep Kit, Qiagen, 27104) and plasmid midiprep (QIAGEN Plasmid Midi Kit, Qiagen, 12143). 2.2

Transfection

1. Purified CRISPR/Cas9 plasmids. 2. 16HBE bronchial epithelial cells (see Note 6). 3. Lipofectamine 3000 Transfection Reagent (Thermo Fischer Scientific L3000001). 4. Cell culture 24-well plastic plates. 5. Minimum Essential Medium Eagle (MEM) should be supplemented with 10% FBS, 1% L-glutamine and 1% PenStrep. 6. Opti-MEM Reduced Serum Medium (Thermo Fischer Scientific 31985062). 7. Cell culture incubator (37.5% CO2). 8. 1.5 ml microcentrifuge tubes.

2.3 Cell Selection and Propagation

1. Fluorescence-activated cell sorter (FACs) buffer. 2. 96-well cell culture plastic plates. 3. 24-well cell culture plastic plates. 4. T25 and T75 cell culture vented flasks. 5. Supplemented MEM.

2.4 Confirmation and Storage

1. T25 cell culture flasks. 2. Cell scraper. 3. DMSO. 4. Protein extraction buffer.

3

Methods Carry out all procedures at room temperature in a class II safety cabinet unless otherwise specified. Decontaminate cabinet (end equipment to be used within) before and after with 70% ethanol. For cell culture, incubate at 37  C in 5% CO2 unless otherwise stated. Cell culture media should be warmed up to 37  C prior to use. Minimize the time cells are out the incubator.

CRISPR/Cas9, Genome Editing, Host-Pathogen Interaction

41

1. Select a target region

5` TGACTTGGATCCTGAGGTATTGG 3´

2. Choose a target sequence of 20 nucleodes adjacent to a –NGG PAM sequence (red) and look for off target effects.

5` TGACTTGGATCCTGAGGTATGTTTT 3`

3. Add –GTTTT (Green) to the 3´end of the target sequence without the PAM sequence

5` ATACCTCAGGATCCAAGTCACGGTG 3`

4. Boom strand oligo is reverse complement of the target sequence with the -CGGTG tail at the 3`end of the oligonucleode (pink)

5` TGACTTGGATCCTGAGGTATGTTTT 3` 5` GTGGCACTGAACCTAGGACTCCATA 3`

5. Annealing the two singe-stranded oligonucleodes results in a doublé strandend oligo (CRISPR RNA guide) with compable ends for cloning in the CRISPR vector

Fig. 2 Design of CRISPR/Cas9 guides 3.1 Design of CRISPR/Cas9 Guides (Fig. 2)

CRISPR guides design is performed following the manufacturer’s instructions for the GeneArt CRISPR Nuclease OFP Reporter Kit (Invitrogen A21174). A schematic of the process is shown in Figs. 1 and 2. 1. Identify all 20 bp regions within 50 bp of the intended genomic target that are adjacent to a NGG proto-spacer adjacent motif (PAM) on the 30 end by using the sequence analysis software CHOPCHOP (e.g., http://chopchop.cbu.uib.no/) (see Note 7). 2. Select a target region which contains lower significant homology to other genes to diminish possible off-target effects and increase efficiency (see Note 8). Target sequences can be designed in sense or antisense and in either exons or introns while meeting the PAM requirements in 30 . 3. To enable directional cloning of the double strands oligonucleotides into the vector; add GTTT to the 30 end of the oligonucleotide without including the PAM region. 4. The bottom strand oligonucleotide should be reverse complement of the target sequence, but CGGTG should be added to the 30 end of the oligonucleotide (see Note 9). 5. Order lyophilized HPLC purified oligonucleotides from your supplier and store them at room temperature until use.

3.2 Generation of the CRISPR/Cas9 Plasmids

The aim of this step is to generate double-stranded oligonucleotides targeting the intended genomic region to facilitate their cloning into the CRISPR plasmid. This step is performed following the GeneArt CRISPR Nuclease OFP Reporter Kit (Invitrogen A21174) manufacturer’s instructions with some modifications.

42

Sara Gago et al.

1. Dilute lyophilized oligonucleotides at 200 μM in DNAse-free sterile water. 2. Set the annealing reaction (20 μl) at room temperature to create the double-stranded CRISPR RNA guide containing both oligonucleotides: (a) 5 μl of each forward and reverse strand oligonucleotides at 200 μM (50 mM final concentration) and 2 μl of the 10 annealing buffer (1 final concentration). (b) 13 μl of DNAse-free sterile water. (c) Incubate the tubes at 95  C for 4 min in a thermocycler and then, allow the reaction mixture to cool to 25  C for 10 min (see Note 10). 3. Dilute the annealed oligonucleotides to a 5 nM working solution by performing two 100-fold serial dilutions. Prepare the dilutions on ice (see Note 11). 4. Prepare 20 μl of the ligation reaction at room temperature. Add the following reagents to a clean microcentrifuge tube in order: l

4 μl of 5 ligation buffer.

l

2 μl of the linearized CRISPR vector.

l

2 μl of the annealed oligonucleotides at 5 nM.

l

11 μl of DNAse-free water.

l

1 μl of T4 ligase (1 (Weiss) U/μl).

Mix the reaction by pipetting up and down, and incubate at room temperature for 10 min (see Note 3). 5. Thaw one vial of E. coli One Shot TOP10 cells competent cells on ice, and once the cells are thawed, add 3 μl of the ligation reaction. Mix by tapping the tube and incubate on ice for 10 min (see Note 4). 6. Incubate the cells for 30 s at 42  C and then transfer the tube to ice (see Note 12). 7. Add 250 ml of room temperature SOC medium and incubate 1 h at 37  C. 8. Spread 50 μl from the transformation into two LB–Ampicillin plates and incubate overnight at 37  C. 9. Pick 1–10 ampicillin resistant colonies and culture them in liquid LB–ampicillin at 37  C overnight (16 h maximum). 10. Perform plasmid purification using a plasmid purification kit (see Note 13) and sequence using U6 primer (50 -GGACTAT CATATGCTTACCG-30 ). 11. For the positive clones, perform plasmid Midi Prep and store them in LB-glycerol 20% at 80  C.

CRISPR/Cas9, Genome Editing, Host-Pathogen Interaction

3.3 CRISPR/Cas9 Plasmid Transfection into Lung Epithelial Cells

43

Resurrect a vial of 16HBE bronchial epithelial cells passage 5–6 from liquid nitrogen around 2 weeks before doing the experiment. Transfection should be done at a passage Save Template. 9. In the Setting panel, name the current sample, define the location for the file to be saved, and set the acquisition to 8000 centered single cells in-focus (see Note 17). 10. Acquire data for each sample three times (technical replicates). 11. As indicated at the top of the Setting panel, return the current sample. 12. Load the following sample, modify sample name as needed, and repeat the acquisition of each sample in technical triplicates. 3.6 Semiautomated Analysis of Af Uptake by AECs Using the IDEAS® Internalization Wizard

The IDEAS® software is designed for IFC image and data analysis using hundreds of parameters (such as fluorescence intensity and location, cell shape and texture plus other morphometric and photometric features) and allows to visually inspect every cell acquired, to perform comprehensive population statistics and to prepare graphs and images for publication. For detailed instructions on how to operate the software, please refer to https://www.amnis. com/software. As an alternative to manual gating, the IDEAS® internalization wizard (under the Guided analysis Tab) allows a more rapid and semiautomated interrogation of the collected data, based on the initial parameterization with the single-stain controls described in Subheading 3.3. Briefly, the internalization wizard works on single, in-focus cell images and generates data relating to the degree of fluorescence present within the boundary of the cell. Initially, the cell event is identified from the background via thresholding as described in Subheading 3.5 but total cell masks in IDEAS® are more stringent than that in the acquisition software INSPIRE®. This total cell area of the image is then eroded by 2–3 pixels all around the perimeter so that it represents the area of the cell inside the cell surface. This mask, which now becomes a limiting boundary for the analysis, is then placed on the tdTomato image and used to generate further image information on intracellular fluorescent spores. 1. Process the centered single cells in-focus using the IDEAS® internalization wizard and according to their tdT max pixel and intensity (tdT, Channel 3). The max pixel feature identifies the brightest pixel intensities within a given channel and is a more optimal matrix for identifying spot localized signal accumulation within or on a selected cell, as in the case of attached or internalized A1160+/tdT spores. 2. Gate complexes containing A1160+/tdT and A549 cells (Af– AEC complexes) as the events showing maximum max pixel and intensity on the tdT channel (on the y- and x-axes, respectively, Channel 3) (Fig. 3a).

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

95

Fig. 3 Semiautomated gating strategy and respective IFC images with the IDEAS® internalization wizard for the analysis of AECs infected with tdT-expressing Af strains (in this particular example, A549 cells infected with A1160+/tdT for 6 h). (a) Af–AEC complexes and (b) A549 cells which have Af on their surface (AECa) or inside (AECi)

3. Plot Af–AEC complexes according to size (Area on Channel 1) and integrated (or total) fluorescence intensity for CW (referred to as “Intensity” in the IDEAS® software, on the yaxes, Channel 7). CW+ and CW gating identifies respectively A549 cells which have Af on their surface (AECa) or inside (AECi) (Fig. 3b) (see Note 18). 3.7 Data Analysis of AECi Across Experimental Replicates: Background Subtraction and Correction Based on the Coefficient of Infection

To calculate the number of AECs which have Af inside (AECi) and statistically compare different isolates or time points of infection, it is recommended to acquire 8000 centered, in-focus, single cells for each sample (strain and/or time point) in technical triplicates. It is also recommended to repeat each sample on three different occasions (biological triplicates), including an uninfected A549 control sample, which will be used for background normalization. While infection of A549 monolayers is set to be carried out with a standard spore number, the fungal inoculum will be slightly different among replicates due to experimental variability. In order to be able

96

Margherita Bertuzzi and Gareth J. Howell

A

B AECi on 8,000 centred single-cells in focus TR1 TR2 TR3 Background Uninfected A1 A2 A3 BKG1=AVERAGE(A1;A2;A3) BR1 A1160+/tdT 6 hrs

B1

A1160+/tdT 12 hrs C1

Uninfected BR2 A1160+/tdT 6 hrs A1160+/tdT 12 hrs

Uninfected BR3

A1160+/tdT

6 hrs

A1160+/tdT 12 hrs

B2

B3

Background subtraction for uninfected TR1 TR2 TR3 Uninfected A4 = A1-BKG1 A5 = A2-BKG1 A6 = A3-BKG1 BR1 A1160+/tdT 6 hrs

C2 C3

TR1 TR2 TR3 Background D1 D2 D3 BKG2=AVERAGE(D1;D2;D3) E1

E2

E3

F1

F2

F3

H2 H3

I1

I2

TR1 TR2 TR3 D4 = D1-BKG2 D5 = D2-BKG2 D6 = D3-BKG2

Uninfected BR2 A1160+/tdT 6 hrs

E4 = E1-BKG2 E5 = E2-BKG2 E6 = E3-BKG2

A1160+/tdT 12 hrs F4 = F1-BKG2 F5 = F2-BKG2 F6 = F3-BKG2

TR1 TR2 TR3 Background G1 G2 G3 BKG3=AVERAGE(G1;G2;G3) H1

B4 = B1-BKG1 B5 = B2-BKG1 B6 = B3-BKG1

A1160+/tdT 12 hrs C4 = C1-BKG1 C5 = C2-BKG1 C6 = C3-BKG1

BR3

I3

Uninfected

TR1 TR2 TR3 G4 = G1-BKG3 G5 = G2-BKG3 G6 = G3-BKG3

A1160+/tdT

H4 = H1-BKG3 H5 = H2-BKG3 H6 = H3-BKG3

6 hrs

A1160+/tdT 12 hrs

I5 = I2-BKG3

I6 = I3-BKG3

D Normalisation based on Coefficient of Infection (COI) COI TR1 TR2 TR3 Uninfected 1 UN1 = A4*1 UN2 = A5*1 UN3 = A6*1 BR1 A1160+/tdT 6 hrs

COI1 WT6.1 = B4* COI1

WT6.2 = B5* COI1

WT6.3 = B6* COI1

A1160+/tdT 12 hrs COI1 WT12.1 = C4* COI1 WT12.2 = C5* COI1 WT12.3 = C6* COI1

Uninfected BR2 A1160+/tdT 6 hrs

COI 1

TR1 UN4 = D4*1

COI2 WT6.4 = E4* COI2

TR2 UN5 = D5*1

TR3 UN6 = D6*1

WT6.5 = E5* COI2

WT6.6 = E6* COI2

A1160+/tdT 12 hrs COI2 WT12.4 = F4* COI2 WT12.5 = F5* COI2 WT12.6 = F6* COI2 TR2 UN8 = G5*1

TR3 UN9 = G6*1

WT6.8 = H5* COI3

WT6.9 = H6* COI3

12 hrs COI3 WT12.7 = I4* COI3 WT12.8 = I5* COI3

WT12.9 = I6* COI3

Uninfected BR3 A1160+/tdT 6 hrs A1160+/tdT

COI 1

TR1 UN7 = G4*1

COI3 WT6.7 = H4* COI3

No. AECi on 8,000 centred single-cells in focus

C

I4 = I1-BKG3

**** **** 600

****

400 200 0

UN -200

A1160+/tdT A1160+/tdT 6 hrs 12 hrs

Fig. 4 Quantification of the uptake of tdT-expressing Af by AECs. (a) AECi background (BKG) is calculated based on the average (AVG) of the uninfected (UN) technical triplicates (TR) for each biological replicate (BR). (b) AECi background values are subtracted from all AECi values for the respective biological replicates. (c) Background subtracted-AECi values are corrected based on the respective coefficient of infection. (d) Quantification of AECi after 6 and 12 h of infection of A549 monolayers with A1160+/tdT (in technical and biological replicates). GraphPad Prism was used to interpret data and p values were calculated using an ordinary one-way ANOVA and Tukey’s multiple comparison test. Error bars show the Standard Deviation (SD). * p  0.05, **p  0.01, ***p  0.001, ****p  0.0001

to compare the datasets collected in biological and technical triplicates, it is therefore also necessary to normalize the data acquired based on the deviance of the actual inoculum from the expected inoculum for each replicate. The actual inoculum used for infection is measured as described in Subheadings 3.2, steps 5 and 6, while the deviance of the actual inoculum from the expected inoculum (106 spore/mL) is defined as coefficient of infection (COI) and measured as described in Subheadings 3.2, steps 7 and 8. The example for the calculation of AECi provided in Fig. 4 shows the quantification of the uptake of A1160+/tdT after 6 and 12 h of infection of A549 monolayers, whereby the normalization across replicates is performed as follows: 1. For each biological replicates, calculate the average of the number of false-positive AECi signals detected in the uninfected technical triplicates (background) (Fig. 4a).

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

97

2. Subtract the background value obtained from all experimental AECi values, including the uninfected technical triplicates (Fig. 4b). 3. Correct for variances in the infectious inoculum by multiplying the number of AECi obtained for each infected sample by the respective coefficient of infection (COI) as calculated from Subheadings 3.2, steps 5–8 (see Note 19) (Fig. 4c). 4. Visual representation and statistical analysis of the quantification of the uptake of A1160+/tdT after 6 and 12 h of infection of A549 monolayers (with technical and biological replicates) show that internalization of A1160+/tdT (on 8000 centered single A549 cells in-focus analyzed) occurs at both time points of infection, but A1160+/tdT uptake is significantly higher after 6 h of infection than that measured after 12 h of infection ( p  0.0001) (Fig. 4d). 3.8 Analysis of AEC Apoptosis and Necrosis Using the IDEAS® Software

1. In the Gating and analysis area, plot centered single cells in-focus based on the florescence intensity of the necrotic dye TO-PRO3 (on the y-axis, Channel 11) and the apoptotic dye Anx-FITC (on the x-axis, Channel 2) signals, by taking as references the single-stain controls described at the beginning of Subheading 3.3. This allows the separation of A549 cells which are live (Live AECs, Anx-FITC/To-PRO3), apoptotic (Apoptotic AECs, Anx-FITC+/To-PRO3), late apoptotic (Late apoptotic AECs, Anx-FITC+/To-PRO3+), or necrotic (Necrotic AECs, Anx-FITC/To-PRO3+) (Fig. 5a). 2. To identify live, apoptotic, late apoptotic, and necrotic AECa, apply the gating described in Subheading 3.7, step 1, to the population of W-AECa defined in Subheading 3.6, step 3 (Fig. 5b). 3. To identify live, apoptotic, late apoptotic, and necrotic AECi, apply the gating described in Subheading 3.7, step 1, to the population of W-AECi defined in Subheading 3.6, step 3 (Fig. 5b).

3.9 Data Analysis of Live, Apoptotic, Late Apoptotic, and Necrotic AEC Across Experimental Replicates: Background Subtraction and Correction Based on the Coefficient of Infection

Similar to Subheading 3.7, to calculate the number of live, apoptotic, late apoptotic, and necrotic AEC following interaction with Af and statistically compare different isolates or time points of infection, it is recommended to acquire each sample in technical and biological triplicate. The example provided in Fig. 6 shows the quantification of live (Anx-FITC/To-PRO3) AECs and AECi following infection with A1160+/tdT for 16 h (with technical and biological replicates), whereby the background normalization and COI-correction across replicates is performed as follows (see Note 20):

98

Margherita Bertuzzi and Gareth J. Howell

Fig. 5 Manual gating strategy and respective IFC images for the analysis of apoptosis and cell death of AECs infected with tdT-expressing Af (in this particular example, A549 cells infected with A1160+/tdT for 16 h). (a) A549 cells are gated as live (Anx-FITC/To-PRO3), apoptotic (Anx-FITC+/To-PRO3), late apoptotic (Anx-FITC+/To-PRO3+), or necrotic (Anx-FITC/To-PRO3+). (b) Representative IFC images of a necrotic A549 cell which has adherent Af attached to its surface (Necrotic-AECa) and apoptotic A549 cell which contains intracellular Af spore (W-AECi)

1. For each biological replicates, calculate the average of the number of live AECi, apoptotic, late apoptotic, or necrotic obtained in the uninfected technical triplicates (background live, background apoptotic, background late apoptotic, background necrotic) (Fig. 6a). 2. Subtract the background values obtained to the respective AECi values, including the uninfected technical triplicates (Fig. 6b). 3. Multiply the number of AECs and background subtracted AECi (Subheading 3.7, steps 1 and 2) for each sample for the respective coefficient of infection (COI) as calculated from Subheading 3.2, steps 5–8 (Fig. 6c).

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

A Live Uninfected Apoptotic AEC Late apoptotic Necrotic Live AEC +/tdT Apoptotic A1160 Late apoptotic 16 hrs Necrotic Live Uninfected Apoptotic AECi Late apoptotic Necrotic Live AECi +/tdT Apoptotic A1160 Late apoptotic 16 hrs Necrotic

TR1 A1 B1 C1 D1 E1 F1 G1 H1 I1 J1 K1 L1 M1 N1 O1 P1

B Live Apoptotic Uninfected AEC Late apoptotic Necrotic Live +/tdT AEC A1160 Apoptotic 16 hrs Late apoptotic Necrotic Live Uninfected AECi

Apoptotic Late apoptotic Necrotic Live

AECi A1160+/tdT Apoptotic 16 hrs Late apoptotic Necrotic

TR2 A2 B2 C2 D2 E2 F2 G2 H2 I2 J2 K2 L2 M2 N2 O2 P2

TR3 A3 B3 C3 D3 E3 F3 G3 H3 I3 J3 K3 L3 M3 N3 O3 P3

On 8,000 centred single-cells in focus BR1 BR2 AECi uninfected AECi uninfected backgrounds TR1 TR2 TR3 backgrounds A4 A5 A6 B4 B5 B6 C4 C5 C6 D4 D5 D6 E4 E5 E6 F4 F5 F6 G4 G5 G6 H4 H5 H6 BKG1(AL)=AVG(I1;I2;I3) I4 I5 I6 BKG2(AL)=AVG(I4;I5;I6) BKG1(APO)=AVG(J1;J2;J3) J4 J5 J6 BKG2(APO)=AVG(J4;J5;J6) BKG1(LAPO)=AVG(K1;K2;K3) K4 K5 K6 BKG2(LAPO)=AVG(K4;K5;K6) BKG1(NEC)=AVG(L1;L2;L3) L4 L5 L6 BKG2(NEC)=AVG(L4;L5;L6) M4 M5 M6 N4 N5 N6 O4 O5 O6 P4 P5 P6

TR1 A7 B7 C7 D7 E7 F7 G7 H7 I7 J7 K7 L7 M7 N7 O7 P7

TR2 A8 B8 C8 D8 E8 F8 G8 H8 I8 J8 K8 L8 M8 N8 O8 P8

99

BR3 AECi uninfected TR3 backgrounds A9 B9 C9 D9 E9 F9 G9 H9 I9 BKG3(AL)=AVG(I7;I8;I9) J9 BKG3(APO)=AVG(J7;J8;J9) K9 BKG3(LAPO)=AVG(K7;K8;K9) L9 BKG3(NEC)=AVG(L7;L8;L9) M9 N9 O9 P9

Subtraction for AECi uninfected backgrounds BR1 BR2 TR1 TR2 TR3 TR1 TR2 TR3 TR1 A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 C5 C6 C7 D1 D2 D3 D4 D5 D6 D7 E1 E2 E3 E4 E5 E6 E7 F1 F2 F3 F4 F5 F6 F7 G1 G2 G3 G4 G5 G6 G7 H1 H2 H3 H4 H5 H6 H7 I1(B) = I1I2(B) = I2I3(B) = I3I4(B) = I4I5(B) = I5I6(B) = I6I7(B) = I7BKG1(AL) BKG1(AL) BKG1(AL) BKG2(AL) BKG2(AL) BKG2(AL) BKG3(AL) J1(B) = J1- J2(B) = J2- J3(B) = J3- J4(B) = J4J5(B) = J5J6(B) = J6- J7(B) = J7BKG1(APO) BKG1(APO) BKG1(APO) BKG2(APO) BKG2(APO) BKG2(APO) BKG3(APO) K1(B) = K1- K2(B) = K2- K3(B) = K3- K4(B) = K4- K5(B) = K5- K6(B) = K6- K7(B) = K7BKG1(LAPO) BKG1(LAPO) BKG1(LAPO) BKG2(LAPO) BKG2(LAPO) BKG2(LAPO) BKG3(LAPO) L1(B) = L1- L2(B) = L2- L3(B) = L3- L4(B) = L4L5(B) = L5L6(B) = L6- L7(B) = L7BKG1(NEC) BKG1(NEC) BKG1(NEC) BKG2(NEC) BKG2(NEC) BKG2(NEC) BKG3(NEC) M1(B) = M1- M2(B) = M2- M3(B) = M3- M4(B) = M4- M5(B) = M5- M6(B) = M6- M7(B) = M7BKG1(AL) BKG1(AL) BKG1(AL) BKG2(AL) BKG3(AL) BKG2(AL) BKG3(AL) N1(B) = N1- N2(B) = N2- N3(B) = N3- N4(B) = N4- N5(B) = N5- N6(B) = N6- N7(B) = N7BKG1(APO) BKG1(APO) BKG1(APO) BKG2(APO) BKG2(APO) BKG2(APO) BKG3(APO) O1(B) = O1- O2(B) = O2- O3(B) = O3- O4(B) = O4- O5(B) = O5- O6(B) = O6- O7(B) = O7BKG1(LAPO) BKG1(LAPO) BKG1(LAPO) BKG2(LAPO) BKG2(LAPO) BKG2(LAPO) BKG3(LAPO) P1(B) = P1- P2(B) = P2- P3(B) = P3- P4(B) = P4- P5(B) = P5- P6(B) = P6- P7(B) = P7BKG1(NEC) BKG1(NEC) BKG1(NEC) BKG2(NEC) BKG2(NEC) BKG2(NEC) BKG3(NEC)

BR3 TR2 A8 B8 C8 D8 E8 F8 G8 H8 I8(B) = I8BKG3(AL) J8(B) = J8BKG3(APO) K8(B) = K8BKG3(LAPO) L8(B) = L8BKG3(NEC) M8(B) = M8BKG3(AL) N8(B) = N8BKG3(APO) O8(B) = O8BKG3(LAPO) P8(B) = P8BKG3(NEC)

TR3 A9 B9 C9 D9 E9 F9 G9 H9 I9(B) = I9BKG3(AL) J9(B) = J9BKG3(APO) K9(B) = K9BKG3(LAPO) L9(B) = L9BKG3(NEC) M9(B) = M9BKG3(AL) N9(B) = N9BKG3(APO) O9(B) = O9BKG3(LAPO) P9(B) = P9BKG3(NEC)

Fig. 6 Quantification of the outcome of the interaction of tdT-expressing Af by AECs with respect to host survival (Live, AL; Apoptotic, APO; Late apoptotic, LAPO; Necrotic, NEC). (a) AECi background (BKG) is calculated based on the average of the uninfected technical triplicates (UN) for each biological replicate (BR) and viability outputs, i.e., survival, apoptosis, late apoptosis, or necrosis. (b) Background values are subtracted from the respective AECi values according to the respective biological replicate and viability output, i.e., survival, apoptosis, late apoptosis, or necrosis. (c) AEC and background subtracted-AECi values are corrected based on the respective COI. (d) COI-corrected number of live AEC (Anx-FITC/To-PRO3) are expressed as the percentage of the total COI-corrected AEC analyzed and COI-corrected number of live AECi (Anx-FITC/To-PRO3) as to the percentage of the total COI-corrected AECi analyzed. (e) Percentage of live uninfected AECs and live AECs and AECi after 16 h of infection of A549 monolayers with A1160+/tdT calculated on the total of AECs analyzed (in technical and biological triplicates). GraphPad Prism was used to interpret data and p values were calculated using an ordinary one-way ANOVA and Tukey’s multiple comparison test. Error bars show the Standard Deviation (SD). *p  0.05, **p  0.01, ***p  0.001, ****p  0.0001

4. For each sample, sum up the number of COI-normalized (Subheading 3.7, step 3) live AEC, apoptotic, late apoptotic, or necrotic and express the number of live AEC as a percentage of the total COI-normalized AEC (Fig. 6d). 5. For each sample, sum up the number of COI-normalized (Subheading 3.7, step 3) live AECi, apoptotic, late apoptotic, or necrotic and express the number of live AEC as a percentage of the total COI-normalized AEC (Fig. 6d).

100

Margherita Bertuzzi and Gareth J. Howell

C

Normalisation based on Coefficient of Infection (COI) BR1 BR2 TR1 TR2 TR3 COI TR1 TR2 TR3 A1(C) A2(C) A3(C) A4(C) A5(C) A6(C) 1 = A1* 1 = A2* 1 = A3* 1 1 = A4* 1 = A5* 1 = A6* 1 B1(C) B2(C) B3(C) B4(C) B5(C) B6(C) 1 = B1* 1 = B2* 1 = B3* 1 1 = B4* 1 = B5* 1 = B6* 1 C1(C) C2(C) C3(C) C4(C) C5(C) C6(C) 1 = C1* 1 = C2* 1 = C3* 1 1 = C4* 1 = C5* 1 = C6* 1 D1(C) D2(C) D3(C) D4(C) D5(C) D6(C) 1 = D1* 1 = D2* 1 = D3* 1 1 = D4* 1 = D5* 1 = D6* 1 E1(C) E2(C) E3(C) E4(C) E5(C) E6(C) COI1 = E1*COI1 = E2*COI1 = E3*COI1 COI2 = E4*COI2 = E5*COI2 = E6*COI2 F1(C) F2(C) F3(C) F4(C) F5(C) F6(C) COI1 = F1*COI1 = F2*COI1 = F4*COI1 COI2 = F4*COI2 = F5*COI2 = F6*COI2 G1(C) G2(C) G3(C) G4(C) G5(C) G6(C) COI1 = G1*COI1 = G2*COI1 = G3*COI1 COI2 = G4*COI2 = G5*COI2 = G6*COI2 H1(C) = H2(C) H3(C) H4(C) H5(C) H6(C) COI1 H1*COI1 = H2*COI1 = H3*COI1 COI2 = H4*COI2 = H5*COI2 = H6*COI2 I1(C) I2(C) I3(C) I4(C) I5(C) I6(C) 1 = I1(B)* 1 = I2(B)* 1 = I3(B)* 1 1 = I4(B)* 1 = I5(B)* 1 = I6(B)* 1 J1(C) J2(C) J3(C) J4(C) J5(C) J6(C) 1 = J1(B)* 1 = J2(B)* 1 = J3(B) * 1 1 = J4(B) * 1 = J5(B)* 1 = J6(B)* 1 K1(C) K2(C) K3(C) K4(C) K5(C) K6(C) 1 = K1(B)* 1 = K2(B)* 1 = K3(B)* 1 1 = K4(B)* 1 = K5(B)* 1 = K6(B)* 1 L1(C) L2(C) L3(C) L4(C) L5(C) L6(C) 1 = L1(B)* 1 = L2(B)* 1 = L3(B)* 1 1 = L4(B)* 1 = L5(B)* 1 = L6(B)* 1 M1(C) = M2(C) = M3(C) = M4(C) = M5(C) = M6(C) COI1 M1(B)*COI1 M2(B)*COI1 M3(B)*COI1 COI2 M4(B)*COI2 M5(B)*COI2 = M6(B)*COI2 N1(C) = N2(C) = N3(C) = N4(C) = N5(C) = N6(C) COI1 N1(B)*COI1 N2(B)*COI1 N3(B)*COI1 COI2 N4(B)*COI2 N5(B)*COI2 = N6(B)*COI2 O1(C) = O2(C) = O3(C) = O4(C) = O5(C) = O6(C) COI1 O1(B)*COI1 O2(B)*COI1 O3(B)*COI1 COI2 O4(B)*COI2 O5(B)*COI2 = O6(B)*COI2 P1(C) = P2(C) = P3(C) = P4(C) = P5(C) = P6(C) COI1 P1(B)*COI1 P2(B)*COI1 P3(B)*COI1 COI2 P4(B)*COI2 P5(B)*COI2 = P6(B)*COI2 COI

Live Uninfected AEC

Apoptotic Late apoptotic Necrotic Live

AEC A1160+/tdT Apoptotic 16 hrs Late apoptotic Necrotic Live Uninfected AECi

Apoptotic Late apoptotic Necrotic Live

AECi A1160+/tdT Apoptotic 16 hrs Late apoptotic Necrotic

COI 1 1 1 1 COI3 COI3 COI3 COI3 1 1 1 1 COI3 COI3 COI3 COI3

BR3 TR1 TR2 A7(C) A8(C) = A7* 1 = A8* 1 B7(C) B8(C) = B7* 1 = B8* 1 C7(C) C8(C) = C7* 1 = C8* 1 D7(C) D8(C) = D7* 1 = D8* 1 E7(C) E8(C) = E7*COI3 = E8*COI3 F7(C) F8(C) = F7*COI3 = F8*COI3 G7(C) G8(C) = G1*COI1 = G8*COI3 H7(C) H8(C) = H7*COI3 = H8*COI3 I7(C) I8(C) = I7(B)* 1 = I8(B)* 1 J7(C) J8(C) = J7(B)* 1 = J8(B)* 1 K7(C) K8(C) = K7(B)* 1 = K8(B)* 1 L7(C) L8(C) = L7(B)* 1 = L8(B)* 1 M7(C) = M8(C) = M7(B)*COI3 M8(B)*COI3 N7(C) = N8(C) = N7(B)*COI3 N8(B)*COI3 O7(C) = O8(C) = O7(B)*COI3 O8(B)*COI3 P7(C) = P8(C) = P7(B)*COI3 P8(B)*COI3

Conversion of the COI-corrected number of Live AEC/AECi to the percentage of the total COI-corrected AEC/AECi BR1 BR2 BR3 TR1 TR2 TR3 TR1 TR2 TR3 TR1 TR2

D Uninfected AEC

AEC A1160+/tdT 16 hrs

AECi A1160+/tdT 16 hrs

% Live AEC/ Total AEC

TR3

T(UN)1 = T(UN)2 = T(UN)3 = T(UN)4 = T(UN)5 = T(UN)6 = T(UN)7 = T(UN)8 = T(UN)9 = SUM(A1(C);B1( SUM(A2(C);B2( SUM(A3(C);B3( SUM(A4(C);B4( SUM(A5(C);B5( SUM(A6(C);B6( SUM(A7(C);B7( SUM(A8(C);B8( SUM(A9(C);B9( Total C);C1(C);D1(C)) C);C2(C);D2(C)) C);C3(C);D3(C)) C);C4(C);D4(C)) C);C5(C);D5(C)) C);C6(C);D6(C)) C);C7(C);D7(C)) C);C8(C);D8(C)) C);C9(C);D9(C)) UN1 = % UN2 = % UN3 = % UN4 = % UN5 = % UN6 = % UN7 = % UN8 = % UN9 = % Live A1(C)/T(UN)1 A2(C)/T(UN)2 A3(C)/T(UN)3 A4(C)/T(UN)4 A5(C)/T(UN)5 A6(C)/T(UN)6 A7(C)/T(UN)7 A8(C)/T(UN)8 A9(C)/T(UN)9 T(AEC)1 = T(AEC)2 = T(AEC)3 = T(AEC)4 = T(AEC)5 = T(AEC)6 = T(AEC)7 = T(AEC)8 = T(AEC)9= SUM(E1(C);F1(C SUM(E2(C);F2(C SUM(E3(C);F3(C SUM(E4(C);F4(C SUM(E5(C);F5(C SUM(E6(C);F6(C SUM(E7(C);F7(C SUM(E8(C);F8(C SUM(E9(C);F9(C Total );G1(C);H1(C)) );G2(C);H2(C)) );G3(C);H3(C)) );G4(C);H4(C)) );G5(C);H5(C)) );G6(C);H6(C)) );G7(C);H7(C)) );G8(C);H8(C)) );G9(C);H9(C)) AEC1 = % AEC2 = % AEC3= % AEC4 = % AEC5 = % AEC6 = % AEC7 = % AEC8 = % AEC9 = % Live E1(C)/T(AEC)1 E2(C)/T(AEC)2 E3(C)/T(AEC)3 E4(C)/T(AEC)4 E5(C)/T(AEC)5 E6(C)/T(AEC)6 E7(C)/T(AEC)7 E8(C)/T(AEC)8 E9(C)/T(AEC)9 T(AECi)1 = T(AECi)2 = T(AECi)3 = T(AECi)4 = T(AECi)5 = T(AECi)6 = T(AECi)7 = T(AECi)8 = T(AECi)9 = SUM(M1(C);N1( SUM(M2(C);N2( SUM(M3(C);N3( SUM(M4(C);N4( SUM(M5(C);N5( SUM(M6(C);N6( SUM(M7(C);N7( SUM(M8(C);N8( SUM(M9(C);N9( Total C);O1(C);P1(C)) C);O2(C);P2(C)) C);O3(C);P3(C)) C);O4(C);P4(C)) C);O5(C);P5(C)) C);O6(C);P6(C)) C);O7(C);P7(C)) C);O8(C);P8(C)) C);O9(C);P9(C)) AECi2 = % AECi3 = % AECi4 = % AECi5 = % AECi6= % AECi7 = % AECi8 = % AECi9 = % AECi1 = % Live M1(C)/T(AECi)1 M2(C)/T(AECi)2 M3(C)/T(AECi)3 M4(C)/T(AECi)4 M5(C)/T(AECi)5 M6(C)/T(AECi)6 M7(C)/T(AECi)7 M8(C)/T(AECi)8 M9(C)/T(AECi)9

150

E

TR3 A9(C) = A9* 1 B9(C) = B9* 1 C9(C) = C9* 1 D9(C) = D9* 1 E9(C) = E9*COI3 F9(C) = F9*COI3 G9(C) = G9*COI3 H9(C) = H9*COI3 I9(C) = I9(B)* 1 J9(C) = J9(B)* 1 K9(C) = K9(B)* 1 L9(C) = L9(B)* 1 M9(C) = M9(B)*COI3 N9(C) = N9(B)*COI3 O9(C) = O9(B)*COI3 P9(C) = P9(B)*COI3

** **

100

50

0

AEC UN

AEC AECi A1160+/tdT A1160+/tdT 16 hrs 16 hrs

Fig. 6 (continued)

6. Visual representation and statistical analysis of the quantification of live AECs and AECi following A549 infection with A1160+/tdT for 16 h (with technical and biological replicates) show that infection of A549 monolayers with A1160+/tdT for 16 h causes a significant decrease in the number of live AECs observed, compared to uninfected monolayers (Fig. 6e). This supports previously published findings indicating that A. fumigatus infection of A549 cells causes damage and

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

101

disaggregation of the epithelial monolayers [11]. However, compared to uninfected monolayers, there is no significant difference in the number of live AECi observed after 16 h of infection (Fig. 6e), indicating that, at the time points analyzed here, Af uptake is not the major driver of A549 apoptosis and/or necrosis. 3.10 Single-Cell Comparison of Uptake and Infection Outcomes of a ΔpacC Isolate and the Respective Parental Isogenic Strain

A. fumigatus mutants lacking the transcription factor PacC have been demonstrated to be attenuated in their ability to cause damage to A549 monolayers and for virulence in leukopenic mice [11]. Furthermore, indirect quantification using a modified nystatin protection assay has shown that ΔpacC mutants are less efficiently internalized by AECs relative to the respective parental isolates [11]. In order to validate the potential of our novel IFC singlecell approach to identify, quantify, and analyze individual Af–AECs complexes, we compared uptake, stoichiometry, and infection outcomes of a ΔpacCA1160+ mutant genetically modified to constitutively express tdTomato (ΔpacCA1160+/tdT) with the respective parental isolate (Fig. 7). 1. Perform infection of A549 monolayers with the ΔpacCA1160+/ tdT and A1160+/tdT for 6, 12, and 16 h as described in Subheadings 3.1–3.4 and acquire IFC data as described in Subheading 3.5 in biological and technical triplicates. 2. Follow data analysis and normalization outlined in Subheading 3.7 and compare uptake of ΔpacCA1160+/tdT and A1160+/tdT at 6 and 12 h of infection. Compared to uninfected A549 monolayers, both strains show a statistically significant difference ( p  0.0001) in the number of AECi observed (on 8000 centered single cells in-focus analyzed); however, no significant difference in the number of AECi is observed when directly comparing ΔpacCA1160+/tdT and A1160+/tdT at 6 or 12 h of infection (Fig. 7a). As this is apparently in contradiction with previously published data demonstrating that ΔpacC mutants are less efficiently internalized by AECs relative to the respective parental isolates [11], the stoichiometry of uptake for the ΔpacCA1160+/tdT and A1160+/tdT is compared at 6 h postinfection. 3. Visual examination of the AECi images obtained using the IDEAS® software as from analysis in Subheading 3.6 is carried out in order to record the number of ΔpacCA1160+/tdT and A1160+/tdT spores contained by each AECi after 6 h of infection of A549 monolayers. 4. For both isolates, express the data collected at Subheading 3.9, step 3, as the percentage of AECi containing one or more than one Af spore relative to the total number of AECi analyzed. The percentage of AECi containing a single Af spore is

102

Margherita Bertuzzi and Gareth J. Howell

A

****

ns

600

****

100

ns

% AECi/ Total AECi

No. AECi on 8,000 centred single-cells in focus

B

400

200

0

80 60 40 20 0

6 hrs

12 hrs

6 hrs

1 Af >1 Af

12 hrs

ΔpacC

A1160+/tdT

A1160+/tdT

A1160+/tdT

****

160 120 80 40 0

A1160+/tdT

*** % Live AEC/ Total AEC

200

ΔpacC A1160+/tdT

ΔpacC A1160+/tdT

D No. spores for 100 AECi

C

1 Af >1 Af

**

100

50

0

UN

A1160+/tdT ΔpacC

A1160+/tdT

Fig. 7 Single-cell comparison of uptake and infection outcomes of ΔpacCA1160+/tdT and A1160+/tdT by AECs. (a) Quantification of AECi after 6 and 12 h of infection of A549 monolayers with ΔpacCA1160+/tdT and A1160+/tdT. (b) Percentage of AECi containing one or more than one Af spore relative to the total number of AECi analyzed for A549 infections with the two isolates for 6 h. (c) Number of Af spores internalized by 100 AECi after 6 h of infection. (d) Percentage of live AECs after 16 h of infection of A549 monolayers with the two isolates calculated on the total of AECs analyzed. Data (in biological and technical triplicates) was interpreted using GraphPad Prism and p values were calculated using an ordinary one-way ANOVA and Tukey’s multiple comparison test. Error bars show the Standard Deviation (SD). *p  0.05, **p  0.01, ***p  0.001, ****p  0.0001

significantly higher when A549 cells where infected with the ΔpacCA1160+/tdT mutant compared to A549 infection with A1160+/tdT (Fig. 7b). Conversely, the percentage of AECi containing more than one Af spore is significantly higher when A549 cells where infected with A1160+/tdT compared to A549 infection with the ΔpacCA1160+/tdT mutant (Fig. 7b). These findings indicate that, although the number of AECi is comparable among infections with the two isolates, AECi internalize less avidly the ΔpacCA1160+/tdT spores.

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

103

5. Alternatively, for both isolates, express the data collected at Subheading 3.9, step 3, as the number of Af spores internalized by 100 AECi. In accordance with published findings [11] and with observations captured at Subheading 3.9, step 4, when comparing the number of spores internalized by 100 AECi, ΔpacCA1160+/tdT spores are internalized significantly less than the isogenic parental isolate (Fig. 7c). 6. Quantify infection outcomes following infection of A549 monolayers with ΔpacCA1160+/tdT and A1160+/tdT at 16 h of infection as described in Subheadings 3.8 and 3.9. Infection of A549 monolayers with A1160+/tdT for 16 h causes a significant decrease in the number of live AECs observed compared to uninfected monolayers. However, there is no detectable reduction in the number of live AECs observed following infection with the ΔpacCA1160+/tdT isolate (Fig. 7d), supporting previous findings reporting that ΔpacC mutants are attenuated in their ability to cause damage to A549 monolayers [11]. 3.11

Conclusions

We have developed and hereby described a novel single-cell approach based on differential fluorescent staining and state-ofthe-art IFC to identify, quantify, and analyze individual host–pathogen complexes from cultured AECs infected with A. fumigatus spores. By comparing the uptake and infection outcomes of a noninvasive and attenuated ΔpacC isolate and the respective parental isogenic strain, we have showed the multiple applications and high versatility of the novel approach described, which could be easily adapted to study uptake of any fluorescently labeled microbe by any professional or nonprofessional phagocyte. Our single-cell approach allows the quantification and the comparison of (1) rates and stoichiometry of Af uptake by A549 cells at different time points, for different strains, in different conditions (for example, in the presence of chemical- or antibody-mediated blockers of specific receptors of interest or antimicrobial drugs) and (2) outcomes of the Af–AECs interaction with respect to host survival, apoptosis, and cell death. While supporting high-throughput single-cell analysis, a current limitation of the IFC technology is that it is unable to perform cell sorting on the samples; therefore, conventional FACS technologies have to be applied instead to recover specific individual cells and enable downstream single-cell genomics on cells that have internalized Af. A further caveat of the IFC assay presented is that single-cell analyses are carried out after cells have been forcibly extracted from the multidimensional cellular community of the in vitro platform utilized. While processing of the samples is executed in the most conservative way as possible, by limiting the procedure time, maintaining the samples on ice when possible, and manipulating the cells gently, the preparation of the IFC samples could slightly alter the AF–AECs interaction itself and

104

Margherita Bertuzzi and Gareth J. Howell

the outcomes thereof. To overcome this limitation, we would normally combine IFC outputs with those obtained using differential fluorescent microscopy analyses, thereby removing the need of dissociating the monolayers for flow cytometry, but still retaining lower throughput capacity. In recent times, we have however coupled differential fluorescent microscopy of in vitro infected AECs with microfluidics systems to develop a high-throughput alternative for in situ analysis of the AF–AECs interactions.

4

Notes 1. The progenitor of the tdTomato fluorescent isolates used in this study, namely A1160+ [25] is included in the first experiment performed to determine the IFC gating strategy. 2. If encountering problems with dissolving the glucose in water, warm up the 50% glucose solution in the microwave for 30 s and then continue mixing. If needed, repeat the step in the microwave once more, but do not bring the solution to boil to avoid caramelization. 3. In light of DMSO toxicity, the two-step preparation of Cytochalasin D we described reduces the percentage of DMSO coming into contact with A549 cells to 0.001%. Concentrations of DMSO >1% are toxic for cultured cells and concentrations between 0.1% and 0.5% often decrease the proliferation of cultured cells, causing changes in morphology, such as rounding and shrinking. By diluting DMSO to 0.001%, toxicity risks are avoided, as well as the need of adding an extra control with A549 cells incubated with DMSO–Cytochalasin D. 4. An inverted bright-field microscope can be used to check that the adherent cells have detached during the incubation with trypsin–EDTA. Detaching cells are round and will be floating, in contrast with immobile and rhomboid-shaped adherent AECs. Alternatively, high turbidity of the suspension upon visual examination indicates efficient detachment of the AECs. 5. The addition of sDMEM dilutes the trypsin–EDTA, and the FBS present in the sDMEM neutralizes the enzymatic activity of trypsin, which upon long incubation times is otherwise toxic for mammalian cells. 6. For the first experiment, it is recommended to seed three 6-well plates in order to perform all the necessary controls to determine the IFC gating strategy. These controls include A549 cells (1) infected with the A. fumigatus strain A1160+, which does not express the tdTomato fluorophore, (2) cells pretreated for 1 h with Cytochalasin D at a final concentration of 0.2 μM with and without infection with A1160+/tdT, and

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

105

(3) cells treated for 6 h with Staurosporine at a final concentration of 1 μM with and without infection with A1160+/tdT. Once IFC settings have been determined, the following experiments performed with a single 6-well plate allow the comparison of two A. fumigatus strains, in this case A1160+/tdT and ΔpacCA1160+/tdT, at a set time point and with the appropriate uninfected control. If more A. fumigatus strains or time points are to be tested, additional 6-well plate(s) ought to be prepared and two wells ought to be allocated for each additional strain/ time point to test. 7. The manufacturer suggests a 20  106 cells/mL concentration for the IFC samples. However, in light of the large size of epithelial cells, we opted for an ideal sample concentration of 5  106 cells/mL and therefore we chose to prepare two wells for each condition. Starting from Subheading 3.4, the samples in these two wells will be pooled, stained, and analyzed together. As each 6-well plate contains two wells to pool for each experimental condition, the final number of samples for each 6-well plate will be three. 8. The two strains tested do not require the addition of antibiotic or supplementation to the media, but for other strains this might be required. Check A. fumigatus culturing requirements before starting the experiments as both ACM and sDMEM might require adjustments. If adjustments to sDMEM are necessary, it is important to assess how these adjustments affect (1) the viability of AECs and (2) the interaction of AECs with A. fumigatus spores. 9. Two T25 flasks are prepared to plate each of the strain to use in order to (1) obtain enough spores for the experiment and (2) be able to visually examine the fungus growing on the flasks with respect to abnormal and irregular pigmentation and septation so to exclude possible contaminations. If one of the two flasks is looking irregular, it is discarded and spores are collected only from the other flask. 10. Pretreatment of cells with Cytochalasin D. One hour before infection with A. fumigatus strains, remove sDMEM from the appropriate wells and replace with 1.8 mL of fresh pre-warmed sDMEM media containing 0.2 μM Cytochalasin D. Incubate for 1 h at 37  C, 5% CO2. At the time of infection, for each well not to be infected with A. fumigatus, add 200 μL of sDMEM and incubate for 6 h at 37  C, 5% CO2. For each well to be infected with A. fumigatus, add 200 μL of the A1160+/tdT 106 spore/mL suspension. Tilt gently the 6-well plate to assure equal distribution of the spores across the wells. Incubate for 6 h at 37  C, 5% CO2.

106

Margherita Bertuzzi and Gareth J. Howell

11. Treatment with Staurosporine. At the time of infection with A. fumigatus strains, remove sDMEM from the appropriate wells and replace with 1.8 mL of fresh pre-warmed sDMEM media containing 1 μM Staurosporine. 2 μL of the 1 mM Staurosporine suspension must be added to 1.8 mL of sDMEM. Then, depending on whether the sample will be infected with A. fumigatus or not, 200 μL of spore suspension in sDMEM or sDMEM will be added, respectively. This will give a final reaction volume of 2 mL and bring the final concentration of Staurosporine to 1 μM. For each well not to be infected with A. fumigatus, add 200 μL of sDMEM and incubate for 6 h at 37  C, 5% CO2. For wells to be infected with A1160+/tdT, add 200 μL of the A1160+/tdT 106 spore/mL suspension. Tilt gently the 6-well plates to assure equal distribution of the spores across the wells. Incubate for 6 h at 37  C, 5% CO2. 12. If the experiment comprises more than one 6-well plate, the Staining mix should be the same for all the samples to stain to limit experimental variability. 13. The concentration of each component of the staining mix and the setting of each IFC laser have been determined according to the manufacturer’s specifications and experimental titration in in vitro infection control experiments. These controls include A549 cells (1) infected with the progenitor isolate A1160+ which does not express the tdTomato fluorophore, (2) cells pretreated with the inhibitor of actin polymerization Cytochalasin D, and (3) cells treated with the inducer of apoptosis Staurosporine. 14. It is crucial not to leave the staining mix for longer than 10 min. Although cells are impermeant upon short incubation times, CW will become internalized by cells after longer incubation times and will therefore stain the intracellular fungus too. 15. Once switched on, the INSPIRE® software takes about 45 min to initiate and calibrate. The samples to test are in this case not fixed, therefore it is crucial to start the cytometer and the INSPIRE® software in advance, in order to avoid degradation of the samples. Furthermore, samples should be stored on ice and in the dark, while waiting to be processed on the cytometer. 16. Originally, one of the limitations of the IFC technology was the reduction in spatial resolution compared to fluorescent microscopy. This has been resolved by the introduction of an extended depth of focus option and the MultiMag option with 60 objective, which results in a 0.3 μM pixel size sensitivity.

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . .

107

17. While in conventional IFC experimentation, the number of events acquired is 5000, in this experiment the number of events acquired is at least 8000 in order to be able to perform statistical analysis of spore uptake, a relatively rare event. The choice of the number of events to acquire impacts on the speed at which each sample will be analyzed, so it has to be carefully considered. In a time-course analysis of live samples, for example, processing of the samples might be stacked in time to avoid deterioration of the live sample while waiting for the sample to be loaded and acquired. Fixed samples or live samples which are not requiring high-scale acquisition can be loaded in 96-well plate format to facilitate the acquisition. 18. While the method described was optimized to quantify the number of AECi in an accurate and reproducible way, we observed a constant underestimation in the number of AECa, when comparing our single-cell IFC approach with conventional differential fluorescence microscopy on intact A549 monolayers infected with A. fumigatus. The underestimation of the number on AECa in single-cell IFC experiment was attributed to the dissociation of the A549 monolayers by trypsin which caused the detachment of a portion of the A. fumigatus spores from the surface of AECs. Gentler processing of the infected A549 monolayers can be achieved using alternative dissociation reagents such as TrypLE™ Express (Thermo Fisher Scientific) or StemPro™ Accutase™ (Gibco), but a certain reduction in the number of AECa is always detectable. Conventional differential fluorescence microscopy on intact A549 monolayers infected with A. fumigatus is therefore recommended when the precise number of AECa has to be determined. 19. The coefficient of infection is set as 1 for the uninfected samples. Each technical replicate for the same strain will have the same coefficient of infection. A biological replicate is included in the analysis only if the coefficient of infection is within 0.5 and 2, which represent infections with an actual amount of Af spores which is respectively double and half of the predicted infectious inoculum. Within this interval, Af uptake by AECs has been demonstrated to follow a linear trend, as indicated in Fig. 8. 20. For simplicity, the example describes the data analysis for live (Anx-FITC/To-PRO3) AECs and AECi; however, the same procedure could be performed to perform the statistical analysis of apoptotic (Anx-FITC+/To-PRO3), late apoptotic (Anx-FITC+/To-PRO3+), or necrotic (Anx-FITC/ToPRO3+) AECs and AECi.

108

Margherita Bertuzzi and Gareth J. Howell

No. AECi before COI normalisation

500

400

300

200

100

0 0.0

0.5

1.0

1.5

2.0

2.5

COI

Fig. 8 Uptake of spores tdT-expressing Af by AECs follows a linear trend when the coefficient of infection is comprised between 0.5 and 2 (in this particular example, A549 cells infected with Af for 6 h; correlation analysis was performed using nonlinear regression **p ¼ 0.0042)

Acknowledgments This work was supported by grants to Prof. Elaine M. Bignell (University of Manchester) from the Medical Research Council (G0501164, MR/L000822/1 and MR/M02010X/1), the Biotechnology and Biological Sciences Research Council (BB/G009619/1) and the Wellcome Trust (WT093596MA) and the Chelsea and Westminster Healthcare National Health Service Trust Charity, to M.B. from Imperial College London (Division of Investigative Sciences PhD Studentships) and Fungal Infection Trust and to E.M.B. and M.B. from a University of Manchester Medical Research Council Discovery Award (MC_PC_15072). References 1. Bertuzzi M, Hayes GE, Bignell EM (2019) Microbial uptake by the respiratory epithelium: outcomes for host and pathogen. FEMS Microbiol Rev 43:145–161 2. Bertuzzi M, Hayes GE, Icheoku UJ, van Rhijn N, Denning DW, Osherov N, Bignell EM (2018) Anti-aspergillus activities of the respiratory epithelium in health and disease. J Fungi 4:8 3. Muskavitch MA, Barteneva N, Gubbels MJ (2008) Chemogenomics and parasitology: small molecules and cell-based assays to study infectious processes. Comb Chem High Throughput Screen 11:624–646

4. Helaine S, Thompson JA, Watson KG, Liu M, Boyle C, Holden DW (2010) Dynamics of intracellular bacterial replication at the single cell level. Proc Natl Acad Sci U S A 107:3746–3751 5. Toma C, Okura N, Takayama C, Suzuki T (2011) Characteristic features of intracellular pathogenic Leptospira in infected murine macrophages. Cell Microbiol 13:1783–1792 6. Bailo N, Cosson P, Charette SJ, Paquet VE, Doublet P, Letourneur F (2014) Defective lysosome maturation and Legionella pneumophila replication in Dictyostelium cells mutant

Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells. . . for the Arf GAP ACAP-A. J Cell Sci 127:4702–4713 7. Haridas V, Ranjbar S, Vorobjev IA, Goldfeld AE, Barteneva NS (2017) Imaging flow cytometry analysis of intracellular pathogens. Methods 112:91–104 8. Barteneva NS, Fasler-Kan E, Vorobjev IA (2012) Imaging flow cytometry: coping with heterogeneity in biological systems. J Histochem Cytochem 60:723–733 9. Basiji DA (2016) Principles of Amnis imaging flow cytometry. Methods Mol Biol 1389:13–21 10. Wasylnka JA, Moore MM (2002) Uptake of Aspergillus fumigatus conidia by phagocytic and nonphagocytic cells in vitro: quantitation using strains expressing green fluorescent protein. Infect Immun 70:3156–3163 11. Bertuzzi M, Schrettl M, Alcazar-Fuoli L et al (2014) The pH-responsive PacC transcription factor of Aspergillus fumigatus governs epithelial entry and tissue invasion during pulmonary aspergillosis. PLoS Pathog 10:e1004413 12. Han X, Yu R, Zhen D, Tao S, Schmidt M, Han L (2011) β-1,3-Glucan-induced host phospholipase D activation is involved in Aspergillus fumigatus internalization into type II human pneumocyte A549 cells. PLoS One 6:e21468 13. Wasylnka JA, Moore MM (2003) Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J Cell Sci 116:1579–1587 14. Oosthuizen JL, Gomez P, Ruan J, Hackett TL, Moore MM, Knight DA, Tebbutt SJ (2011) Dual organism transcriptomics of airway epithelial cells interacting with conidia of Aspergillus fumigatus. PLoS One 6:e20527 15. Gomez P, Hackett TL, Moore MM, Knight DA, Tebbutt SJ (2010) Functional genomics of human bronchial epithelial cells directly interacting with conidia of Aspergillus fumigatus. BMC Genomics 11:358 16. Osherov N (2012) Interaction of the pathogenic mold Aspergillus fumigatus with lung epithelial cells. Front Microbiol 3:346 17. Sheppard DC, Filler SG (2014) Host cell invasion by medically important fungi. Cold Spring Harb Perspect Med 5:a019687

109

18. Croft CA, Culibrk L, Moore MM, Tebbutt SJ (2016) Interactions of Aspergillus fumigatus conidia with airway epithelial cells: a critical review. Front Microbiol 7:472 19. Liu H, Lee MJ, Solis NV, Phan QT, Swidergall M, Ralph B, Ibrahim AS, Sheppard DC, Filler SG (2016) Aspergillus fumigatus CalA binds to integrin α5β1 and mediates host cell invasion. Nat Microbiol 2:16211 20. Chaudhary N, Datta K, Askin FB, Staab JF, Marr KA (2012) Cystic fibrosis transmembrane conductance regulator regulates epithelial cell response to Aspergillus and resultant pulmonary inflammation. Am J Respir Crit Care Med 185:301–310 21. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY (2004) Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22:1567–1572 22. Christian DA, Koshy AA, Reuter MA, Betts MR, Boothroyd JC, Hunter CA (2014) Use of transgenic parasites and host reporters to dissect events that promote interleukin-12 production during toxoplasmosis. Infect Immun 82:4056–4067 23. Dupont CD, Christian DA, Selleck EM et al (2014) Parasite fate and involvement of infected cells in the induction of CD4+ and CD8+ T cell responses to Toxoplasma gondii. PLoS Pathog 10:e1004047 24. Konradt C, Ueno N, Christian DA et al (2016) Endothelial cells are a replicative niche for entry of Toxoplasma gondii to the central nervous system. Nat Microbiol 1:16001 25. Rizzetto L, Giovannini G, Bromley M, Bowyer P, Romani L, Cavalieri D (2013) Strain dependent variation of immune responses to A. fumigatus: definition of pathogenic species. PLoS One 8:e56651 26. Pontecorvo G, Roper JA, Hemmons LM, Macdonald KD, Bufton AW (1953) The genetics of Aspergillus nidulans. Adv Genet 5:141–238 27. Berkova N, Lair-Fulleringer S, Femenia F et al (2006) Aspergillus fumigatus conidia inhibit tumour necrosis factor- or Staurosporineinduced apoptosis in epithelial cells. Int Immunol 18:139–150

Chapter 7 Fungal Bioreporters to Monitor Outcomes of Blastomyces: Host–Cell Interactions Jeffrey Scott Fites, Neta Shlezinger, Tobias M. Hohl, and Bruce S. Klein Abstract Fluorescence-based techniques enable researchers to monitor physiologic processes, specifically fungal cell viability and death, during cellular encounters with the mammalian immune system with single event resolution. By incorporating two independent fluorescent probes in fungal organisms either prior to, or ensuing experimental infection in mice or in cultured leukocytes, it is possible to distinguish and quantify live and killed fungal cells to interrogate genetic, pharmacologic, and cellular determinants that shape host–fungal cell outcomes. This chapter reviews the techniques and applications of fluorescent fungal reporters of viability, with emphasis on the North American endemic dimorphic fungus, Blastomyces dermatitidis. Key words Fluorescent reporters, Host-Blastomyces interactions

1

Introduction North American endemic dimorphic fungi are geographically restricted to specific habitats. For example, Blastomyces dermatitidis, the causative agent of blastomycosis, is endemic to the St. Lawrence and northern Mississippi river systems in North America [1]. Blastomycosis can occur in immune competent individuals and in particular in individuals with defects in cell-mediated immunity, e.g., HIV/AIDS patients. In human tissue, B. dermatitidis grows as a large yeast cell with a characteristic broad-based budding pattern, while in the environment the fungus grows as a mold. The molecular and cellular events that underlie fungal cell uptake and killing in the lung can be characterized and quantified using fluorescent reporter isolates which incorporate both a genetically encodable fluorophore (i.e., a monomeric red fluorescent

Jeffrey Scott Fites and Neta Shlezinger contributed equally with all other contributors. Elaine Bignell (ed.), Host-Fungal Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2260, https://doi.org/10.1007/978-1-0716-1182-1_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

111

112

Jeffrey Scott Fites et al.

protein (RFP)) that emits fluorescence when fungal cells are viable, but loses fluorescence when fungal cells are killed [2–4], thereby acting as a sensor of fungal cell viability, and a second tracer fluorophore that acts as an invariant signal independent of fungal cell viability. This design enables researchers to distinguish fungusengaged leukocytes from bystander leukocytes and to trace and enumerate both RFP+ live fungal cells and RFP nonviable fungal cells in infected tissues and host cells. The tracer fluorophore can be added either prior to or ensuing experimental infection; in the case of B. dermatitidis lung infection, the latter process can counter the problem of tracer dilution during fungal cell division. The recent development of a fluorescent C. neoformans reporter of viability, based on mCherry expression, suggests that techniques described herein may be adapted to a broader range of human pathogenic fungi [5]. The ensuing sections describe the origin, applications, and protocols for Blastomyces fluorescent reporters of fungal cell viability. 1.1 A Fluorescent Bioreporter to Track Blastomyces Killing in the Lung 1.1.1 Origin of the Blastomyces DsRed Strain

1.1.2 Applications of the DsRed-Based B. dermatitidis Bioreporter

Blastomyces dermatitidis ATCC strain 26199 was transformed via Agrobacterium tumefaciens-mediated gene transfer to express DsRed-Express under the control of the Aspergillus nidulans Gpd promoter [4]. Loss of DsRed fluorescence correlated with loss of viability when yeasts were exposed to increased concentrations of H2O2. DsRed fluorescence was also heat sensitive. Because B. dermatitidis yeasts replicate during infection, dividing yeast may lose signal as infection proceeds in vivo. Thus, instead of biotinylating yeast and staining with a fluorescent-conjugated streptavidin prior to infection, yeast can be stained ex vivo with Uvitex-2B, which binds to cell wall chitin (Fig. 1) [6]. The DsRed B. dermatitidis strain has been used to investigate the interplay of host and pathogen signals and downstream effects on phagocytes on the front line of antifungal immunity. The initial work with the B. dermatitidis DsRed viability reporter strain investigated the effects of a fungal aminopeptidase, dipeptidyl peptidase IV (DppIV), on antifungal immunity [4]. By introducing DsRed expression in wild-type and DppIV-silenced B. dermatitidis, Sterkel and colleagues showed that DppIV impaired fungal killing by neutrophils and other phagocytes in the lung. DsRed B. dermatitidis was further used to specify how vaccine immunity promotes fungal killing behavior of neutrophils and alveolar macrophages [7]. The role of NF-κB signaling in the lung epithelium was also shown to be important in early signaling events that effect phagocyte killing of B. dermatitidis [8]. DsRed fungi have the power to resolve killing by many leukocyte populations. A recent study using DsRed-expressing strains of both A. fumigatus and B. dermatitidis interrogated the antifungal immunity conveyed by a small neutrophil subset, the neutrophil–dendritic cell hybrid, a

Blastomyces Bioreporters

C

Alive

A

113

40000

60000

35000

50000

MFI

25000 20000

30000

Dead

20000 10000 0 0.001

DsRed

15000

Uvitex

10000

CFU

5000

0.01

0.1

CFU

30000 40000

0 10

1

[H O ] (M)

B

DsRed

Bright Field

D

Uvitex

Uvitex

105 104 10

3

10

2

Dead Yeast Live Yeast

Leukocytes alone

0 10 µm

10 µm

10 µm

0 10

2

10

3

10

4

10

5

DsRed

Fig. 1 DsRed-Blastomyces dermatitidis reports yeast viability. (From Cell Host Microbe. 2016 Mar 9;19 (3):361–374. Reprinted in part with permission from Cell Press.) (a) Images of live (top) or heat-killed (bottom) B. dermatitidis showing the loss of DsRed fluorescence in dead yeast. (b) Uvitex treatment (cell wall stain) allows tracking of DsRed yeast after loss of viability and DsRed fluorescence. (c) Presence of DsRed fluorescence correlates with viability as shown by CFU (colony forming units) after incubation of yeast with H2O2 for 30 min; Uvitex fluorescence was resistant to H2O2 treatment. (d) Tracking B. dermatitidis killing in vivo; a concatenated plot of murine lungs after infection with DsRed yeast and staining with Uvitex ex vivo. All yeast stained with Uvitex, dead yeast lost DsRed fluorescence while live yeast retained DsRed fluorescence

leukocyte population with features of both neutrophils and dendritic cells [9]. Neutrophil–dendritic cell hybrids comprise only a small fraction of leukocytes, but when fungal killing was tracked in vivo, these leukocytes were much better than classical neutrophils at killing fungi. These studies collectively demonstrate that DsRed is a powerful tool for probing host immunity and the effects of immune evasion.

2

Materials

2.1 Staining DsRedB. dermatitidis Yeast Cells with Uvitex, Subsequent to Application/Infection

Uvitex-2B (Polysciences, Warrington, PA)

1. Phosphate-buffered saline (PBS). 2. FACS buffer (PBS with 0.5% bovine serum albumin).

114

Jeffrey Scott Fites et al.

3. BD Cytofix/Cytoperm™ buffer (BD Biosciences, San Jose, CA). 4. BD Perm/Wash buffer (BD Biosciences), dilute 10 stock to 1 in water. 5. 2% paraformaldehyde buffer (dilute paraformaldehyde stock in PBS). Uvitex Stock Preparation

6. Resuspend Uvitex powder in PBS at 1 mg/mL. It may take some time to completely dissolve Uvitex powder. 7. Filter sterilize Uvitex stock; this is necessary for some applications. 8. Stocks can be stored at 4  C for months and 20  C for years. Uvitex can fall out of solution at 1 mg/mL after time; vortex the stock well before diluting. 2.2 Staining DsRedB. dermatitidis Yeast Cells with Uvitex, Prior to Application/ Infection

3

1. Uvitex-2B (Polysciences, Warrington, PA), filter sterilize after reconstituting. 2. Phosphate-buffered saline (PBS), sterile. 3. In PBS, dilute stock Uvitex (see Protocol I) concentration to a concentration 100-fold higher than desired for staining if desired staining concentration is lower than 10 μg/mL (Table 1).

Methods

3.1 Uvitex Staining of Blastomyces Yeast

Staining of Blastomyces yeast can be performed at various points in experimental protocols. It is not absolutely necessary to utilize the post-staining with Uvitex option for all experimental applications. Short-term (80%, otherwise reduce the sonication setting. References 1. Fisher KJ, Lang GI (2016) Experimental evolution in fungi: an untapped resource. Fungal Genet Biol 94:88–94 2. Burke MK, Rose MR (2009) Experimental evolution with Drosophila. Am J Physiol Regul Integr Comp Physiol 296:R1847–R1854 3. Lang GI, Desai MM (2014) The spectrum of adaptive mutations in experimental evolution. Genomics 104:412–416 4. Hill JA, Ammar R, Torti D et al (2013) Genetic and genomic architecture of the evolution of resistance to antifungal drug combinations. PLoS Genet 9:e1003390 5. Huang M, Mcclellan M, Berman J et al (2011) Evolutionary dynamics of Candida albicans

during in vitro evolution. Eukaryot Cell 10:1413–1421 6. Brunke S, Seider K, Fischer D et al (2014) One small step for a yeast--microevolution within macrophages renders Candida glabrata hypervirulent due to a single point mutation. PLoS Pathog 10:e1004478 7. Wartenberg A, Linde J, Martin R et al (2014) Microevolution of Candida albicans in macrophages restores filamentation in a nonfilamentous mutant. PLoS Genet 10:e1004824 8. Seider K, Brunke S, Schild L et al (2011) The facultative intracellular pathogen Candida glabrata subverts macrophage cytokine production and phagolysosome maturation. J Immunol 187:3072–3086

Chapter 11 Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to Fungi in Immune Cells Patawee Asamaphan, Gordon D. Brown, and Janet A. Willment Abstract Phagocytosis and cytokine production are important processes by which innate immune cells, especially professional phagocytes such as neutrophils and macrophages, control and regulate immunity to fungi. These cellular responses are initiated when conserved pathogen components, known as pathogenassociated molecular patterns (PAMPs), are recognized by pattern-recognition receptors (PRRs), which include members of the C-type lectin receptor (CLR) family that are able to bind to fungal cell wall-derived carbohydrates. Phagocytosis and cytokine production can be quantitatively examined by flow cytometry and enzyme-linked immunosorbent assay (ELISA), respectively, using in vitro based assays with primaryderived murine cells and cell lines. Here, we describe a flow cytometry-based method using transduced cell lines to assess the ability of CLRs to mediate internalization, using A. fumigatus conidia and the β-1,3 glucan receptor, Dectin-1 (CLEC7A), as an example. The use of ELISA-based assays to measure cytokine production by immune cells that are induced in response to fungi and methods for isolating and culturing primary macrophages from various murine tissues are described. Key words Phagocytosis, C-type lectin receptors, Dectin-1, A. fumigatus, Fungi, RAW264.7 cells, Bone marrow-derived macrophages, Peritoneal macrophages, Alveolar macrophages, Inflammatory responses, TNF

1

Introduction The immune system is continually exposed to many microbes, including ubiquitous organisms found in the environment such as Aspergillus fumigatus (A. fumigatus) and Cryptococcus neoformans (C. neoformans) [1]. To protect the host against infection, the immune system must not only prevent infection but do so in a controlled manner so as to restrict any pathology which could be harmful to the host. Phagocytosis and cytokine production are key early mechanisms induced in response to microbial invasion and are essential for protection of the host. Phagocytosis, carried out primarily by “professional phagocytes” such as macrophages and neutrophils, involves a number of coordinated events: the initial receptor-ligand binding, internalization, phagosome maturation,

Elaine Bignell (ed.), Host-Fungal Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 2260, https://doi.org/10.1007/978-1-0716-1182-1_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

155

156

Patawee Asamaphan et al.

and microbial killing [2]. Upon pathogen recognition by innate immune cells, concurrent induction of cytokine and chemokine secretion leads to the recruitment and activation of other inflammatory cells such as monocytes and neutrophils, which help instruct the development of adaptive immunity and ultimately the resolution of infection [2]. Professional phagocytes are equipped with several types of PRRs to sense and induce cellular responses to invading microbes. Along with Toll-like receptors (TLRs) and soluble PRRs, membrane-bound C-type lectin-like receptors (CLRs) are an important class of PRRs that have been shown to be essential in providing protection against pathogenic fungi [3, 4]. Membrane-bound CLRs are structurally similar; they possess integral cytoplasmic tails or associate with adaptor proteins which mediate the intracellular signaling, a transmembrane region, and an extracellular region containing one or more carbohydrate recognition domains [5–7]. CLRs recognize carbohydrates and structures from a diverse range of fungal species [5]. Some notable examples of CLRs that play a role in immunity to fungi include Dectin-1, Dectin-2, Mannose receptor, and DC-SIGN. These CLRs have been shown to recognize and are involved in the phagocytosis of fungal particles [2, 8–11]. Here, using Dectin-1 as an example of a phagocytic receptor, we describe in detail, a flow cytometry-based approach to quantify the internalization of fungal particles (the rodlet-less ΔrodA A. fumigatus conidia in our example) using transduced RAW264.7 macrophage-like cell lines (see Fig. 1 for schematic overview of the process). Furthermore, we describe an ELISA protocol for the assessment of cytokines (detecting the secretion of TNF-α as an example) which are produced in response to fungi. While we only describe phagocytosis and cytokine production as readouts in this chapter, these assays can be adapted to measure other responses such as the respiratory burst and microbial killing. To complement the use of transfected cell lines, it is always advisable to verify results using primary macrophages, derived from wild-type and receptor knockout mice, or use receptor-specific inhibitors (see Note 1). Primary macrophages can be generated from progenitor cells in the bone marrow (bone marrow-derived macrophages; BMDMs), through the use of peritoneal inflammatory agents such as thioglycollate (thio-elicited macrophages), or directly isolated from organs such as the lungs (alveolar macrophages) [12, 13]. Thus, we furthermore describe methods to isolate alveolar macrophages, peritoneal macrophages, and to generate BMDMs [12, 13]. While the methodology described is aimed at quantifying CLR-mediated phagocytosis and cytokine production in response to fungi, the same methods could be adapted to study these responses for any receptor–microbe interaction.

+DMSO +cytoD

Wash then 30 mins at 37 oC

pFB-neo vector

Incubation with inhibitor

Dectin-1

Dectin-1

4

pFB-neo vector

Cell labelling

DMSO +cytoD

7

5

157

Dectin-1

pFB-neo vector

pFB-neo vector

3

Dectin-1

Dectin-1

pFB-neo vector

Dectin-1

2

1

pFB-neo vector

Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to. . .

+DMSO +cytoD Conidia binding at 4 oC

6

Anti-Fc

Add Fc Dectin-1

Unlabelled cells Labelled cells

Analyse data by flow cytometry

FITC labelled conidia Cell stain Fc Dectin-1 Anti-Fc antibody

Fig. 1 Schematic overview of the phagocytosis assay. RAW264.7 cells overexpressing Dectin-1 or control cells (pFB-neo vector) are (1) fluorescently labeled and (2) plated overnight (16–20 h) at 37 C and then pretreated with either cytochalasin D or the equivalent amount of DMSO vehicle as a control. (3) Cells were then incubated with FITC-labeled conidia at 4 C. (4) Unbound conidia are then removed by washing with complete media and replaced with pre-warmed complete DMEM and incubated for 30 min at 37 C. (5) Cells are then detached and transferred to 12  75 mm flow cytometer tubes. (6) Fungal particles that are not internalized were distinguished from those that are internalized by counterstaining with Fc-Dectin-1. The presence of bound Fc-Dectin-1 is then detected with anti-human IgG Fc allophycocyanin (described in Fig. 3). (7) Finally, phagocytosis was analyzed by flow cytometry

158

2

Patawee Asamaphan et al.

Materials

2.1 Mammalian Cell Culture and Retroviral Transduction

1. Complete DMEM medium: DMEM medium supplemented with 10% (v/v) heat-inactivated fetal calf serum (FCS), 100 units/mL penicillin, 0.1 mg/mL streptomycin, 25 mM HEPES, and 2 mM L-glutamine (see Note 2). 2. RAW264.7 cells (ATCC TIB-71). 3. Plat-E ecotropic retroviral packaging cell line (Cell Biolabs). 4. Cells are cultured at 37 C, in 5% CO2 and 80% humidity unless otherwise specified. 5. Lidocaine–EDTA: (4 mg/mL Lidocaine, 10 mM EDTA in PBS) (see Note 3). 6. Cell-lifting solution: TrypLE express (see Note 4). 7. pFB-neo vector (Agilent Technologies) encoding the receptor of interest cloned upstream of a selectable resistance marker, for example, neomycin (neo): Cloning/sub-cloning of any PRR of interest into the pFB-neo vector can be performed using standard molecular biological methods. Please refer to Addgene (https://www.addgene.org/vector-database/2718/) for the pFB-neo plasmid sequence. For uncharacterized receptors it is advised to add an epitope tag, as a translational fusion to the extracellular region of the receptor, to monitor its expression. In this chapter, we use the influenza hemagglutinin (HA)tagged murine Dectin-1 as an example [14] (see Note 5). 8. FuGENE 6 transfection reagent (other non-liposomal transfection reagents can also be used). 9. PBS, Ca2+ and Mg2+ free throughout this chapter, although some CLRs do require Ca2+ for binding. 10. 5 mg/mL polybrene (hexadimethrine bromide): Dissolved in H2O, filter sterilized, and stored at 4 C. 11. 1 mg/mL tunicamycin: Dissolved in DMSO. Aliquot the solution and store at 20 C. 12. 0.4% (w/v) trypan blue: Dissolved in PBS.

2.2 Growing and Harvesting A. fumigatus Conidia 2.2.1 Growing and Harvesting A. fumigatus Conidia

1. Solidified potato dextrose agar (sPDA) flask slants: (39 g/L in distilled H2O) potato dextrose agar (see Note 6). 2. A. fumigatus grown on sPDA (see Note 7). 3. A. fumigatus harvesting buffer: 0.05% Tween 80 in PBS. 4. 40 μm cell strainer. 5. Hemocytometer.

Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to. . . 2.2.2 Cell Labeling, Phagocytosis Assay, and Flow Cytometry

159

1. PBS. 2. eFluor 450 cell-tracking dye. 3. Flow cytometry buffer (FACS buffer): 0.5% BSA, 5 mM EDTA, and 2 mM NaN3 in PBS. 4. Recombinant Fc-Dectin-1 (Dectin-1 C-type lectin-like domain and stalk region fused to the human IgG Fc portion): Use at 5 μg/mL in staining buffer (3% BSA, 5 mM EDTA in PBS). Full details of how to generate and purify Fc-Dectin-1 are described in Graham et al. [15] (see Note 8). 5. Fluorescent-labeled secondary antibody to human IgG such as allophycocyanin (APC)-labeled donkey anti-human IgG. Other fluorochromes may be used provided the fluorescent emission spectrum does not overlap with the cell-tracking dye and the FITC-labeled conidia. Have single stains as controls to set up the flow cytometry compensation panel. 6. Fix solution: 2% formaldehyde diluted in PBS. 7. Fluorescein isothiocyanate (FITC) stock solution (5 mg/mL FITC in DMSO) (see Note 9). 8. 0.05 M pH 9 carbonate/bicarbonate buffer: Dissolve one tablet of carbonate/bicarbonate in 100 mL distilled water. This will yield a 0.05 M solution. 9. FITC working solution: Make 10 mL of 100 μg/mL FITC working solution by dissolving the FITC stock solution from step 7 in 0.05 M carbonate/bicarbonate buffer. Make a fresh FITC working solution each time. 10. Cytochalasin D: Stock solution 5 mM in DMSO. Store at 20 C in aliquots. 11. Lidocaine–EDTA: (4 mg/mL Lidocaine, 10 mM EDTA in PBS) (see Note 3).

2.3 Euthanasia and Dissection of Mice (See Note 10)

1. 8–12 weeks old C57BL/6 or BALB/c mice. 2. Sterile PBS (for peritoneal and alveolar macrophage isolations, supplement PBS with 10 mM EDTA). 3. Harvesting of bones and peritoneal macrophages: Humanely euthanize the mouse with rising carbon dioxide levels and cervical dislocation. 4. For harvesting alveolar macrophages: Injection of terminal anesthetic intraperitoneal and confirmation of death following institutional guidelines. 5. 70% ethanol. 6. Sterile surgical scissors and forceps. 7. Dissecting board (a polystyrene box lid is sufficient) and pins.

160

Patawee Asamaphan et al.

2.4 Generation of Bone Marrow-Derived Macrophages

1. RPMI 1640 media without additives for harvesting the bone marrow. 2. Sterile forceps and scissors. 3. 70% ethanol. 4. Macrophage culture medium: RPMI 1640 media supplemented with 10% (v/v) heat-inactivated FCS, 100 units/mL penicillin, 0.1 mg/mL streptomycin, and 2 mM L-glutamine, 25 mM HEPES and 15% L-cell conditioned medium (see below) or 0.5–1.5 ng/mL recombinant M-CSF (see Note 2). 5. L-cell conditioned medium: grow mouse L929 fibroblast cell line in Modified Eagle’s Medium (MEM), supplemented with 5% (v/v) heat-inactivated FCS, 100 units/mL penicillin, 0.1 mg/mL streptomycin, and 2 mM L-glutamine, 25 mM HEPES in T175 flasks. Harvest the cells using a cell-lifting solution when confluent and reseed the cells at a 1 in 10 dilution in fresh MEM growth media. Collect the conditioned medium into 50 mL tubes and centrifuge at 1200  g (2500 rpm) for 10 min. Filter through a 0.45 μm filter and store in aliquots at 80 C until required. 6. Lidocaine–EDTA (4 mg/mL Lidocaine, 10 mM EDTA in PBS) (see Note 3). 7. 70 μm cell strainers, 21G needles, and 10 mL syringes. 8. 15 cm bacterial plastic (BP) petri dishes.

2.5 Inducing and Harvesting of Thioglycollate-Elicited Peritoneal Macrophages

1. Macrophage culture medium: RPMI 1640 media supplemented with 10% (v/v) heat-inactivated FCS, 100 units/mL penicillin, 0.1 mg/mL streptomycin, 2 mM L-glutamine, 25 mM HEPES (see Note 2). 2. 24-well tissue culture plates. 3. Sterile PBS (37 C). 4. Thioglycollate medium: 3% thioglycollate broth made with 15 g of Brewer’s complete thioglycollate broth medium in 500 mL distilled water in a 1 L Erlenmeyer flask. Dissolve by heating and remove from heat after the powder has dissolved (the solution should turn brown to red). Autoclave for 20 min at 121 C, and age the solution for 1–2 months in the dark at room temperature before use. Aging will increase the yield of inflammatory cells. Aliquot into 25 or 50 mL bottles and store at 20 C. Prior to use, ensure that the broth is not cloudy and contaminated. 5. Inject 1 mL of thioglycollate medium using a syringe and 26G needle into the peritoneal cavity of 8–12-week-old mice 4 days prior to assay (see Note 10). 6. Carbon dioxide for humane euthanasia of mice.

Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to. . .

161

7. Peritoneal cell recovery solution: Cold PBS with 10 mM EDTA, approximately 5 mL/mouse/wash carefully injected into the exposed peritoneal cavity. 8. 70 μm cell strainers. 9. Turk’s solution: 1% acetic acid and 0.01% gentian dye (dilute from a 1% solution) in dH2O. 10. Hemocytometer. 2.6 Isolation of Alveolar Macrophages

1. Macrophage culture medium: RPMI 1640 supplemented with 10% (v/v) heat-inactivated FCS, 100 units/mL penicillin, 0.1 mg/mL streptomycin, 2 mM L-glutamine, 25 mM HEPES (see Note 2). 2. PBS with 10 mM EDTA. 3. Sterile PBS. 4. Turk’s solution: 1% acetic acid and 0.01% gentian dye (dilute from a 1% solution) in dH2O. 5. 70 μm cell strainers. 6. 18G cannula, scissors, and forceps. 7. Hemocytometer.

2.7 Enzyme-Linked Immunosorbent Assay (ELISA) to Measure Cytokine Production

3

RAW264.7 cells and primary macrophages can be stimulated for a range of time periods with fungal particles to examine cytokine production. To measure cytokines, in this case TNF-α, any commercially available ELISA kits can be used. Lipopolysaccharide (LPS) can be diluted in sterile PBS to 1 mg/mL and stored in aliquots at 20 C. For inducing TNF-α, stimulation of macrophages with LPS (1 ng–100 ng/mL) or Zymosan A (25 particles/cell) (see Note 9) can be used as controls.

Methods

3.1 Cell Culture and Passage 3.1.1 RAW264.7 Cells

1. RAW264.7 (ATCC TIB-71) cells are maintained in T75 flask (75 cm2) at 37 C with 5% CO2 in complete DMEM. Media, PBS, and Lidocaine–EDTA should be brought to room temperature before use (see Note 11). 2. To passage or subculture RAW264.7 cells, first discard the media and wash the cells with PBS. 3. Discard the PBS and add 5 mL of Lidocaine–EDTA buffer and incubate at 37 C for 10 min (see Note 12). 4. Add 5 mL of complete DMEM to wash the detached cells to the bottom of the flask and transfer the cells to a 15 mL falcon tube. 5. Centrifuge the cells at 300  g for 5 min at 4 C.

162

Patawee Asamaphan et al.

6. Discard the supernatant and resuspend the pellet in 1 mL complete DMEM. 7. Subculture the cells by placing 1/10th of the cell suspension and adding it to 15 mL complete DMEM in a T75 flask. 8. pFB-neo transduced cells should be maintained under 0.4 mg/ mL Geneticin (G418) selection. 3.1.2 Plat-E Retroviral Packaging Cell Line

1. Plat-E ecotropic cells are maintained in complete DMEM, with the addition of 1 μg/mL puromycin and 10 μg/mL blasticidin to ensure high virion particle production. 2. To passage Plat-E cells, first discard the media and wash the cells with PBS. 3. Discard the PBS and add 5 mL of cell-lifting solution to the cells. Incubate at 37 C for 5 min. 4. Add 5 mL complete media to neutralize the trypsin in the celllifting solution and transfer the cells to a 15 mL falcon tube. 5. Centrifuge the tube at 300  g for 5 min at 4 C. 6. Discard the supernatant and resuspend the pellet in 1 mL complete DMEM. 7. Subculture the cells by placing 1/10th of the cell suspension into a new T75 flask containing 15 mL complete DMEM with 1 μg/mL puromycin and 10 μg/mL blasticidin (see Note 13).

3.2 RetrovirusMediated Transduction of RAW264.7 Cells

3.2.1 Transfection of Plat-E Cells

There are two steps to generate RAW264.7 cells stably expressing the receptor of interest. First, a retrovirus packaging cell line, in this case Plat-E cells, are transiently transfected with a pFB-neo vector expressing the receptor or a control vector, which lacks an insert. The virion particles, containing the packaged RNA encoding for the receptor and neomycin resistance, produced by the Plat-E cells are then harvested from the supernatant. Second, the virion particles are added to RAW264.7 cells to allow transduction and subsequent stable random integration of the receptor expression cassette into the genomic DNA. See Fig. 2 for an overview of the transfection and transduction process (see Note 14). 1. On the day before transfection, seed the Plat-E cells at 1  106 cells/well in a 6-well plate in complete DMEM (without puromycin and blasticidin) (see Note 15). 2. The next day, replace the culture medium with 2 mL fresh complete DMEM (without puromycin and blasticidin). Make up a solution of 94 μL DMEM (without FCS or supplements) and add 6 μL of FuGENE 6 transfection reagent directly into the DMEM. Incubate the mixture at room temperature for 5 min and then add 1 μg of pFB-neo or pFB plasmid DNA containing the receptor of interest. The mixture is then incubated at room temperature for 15 min (see Note 16).

Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to. . .

163

Retroviral transduction of RAW cells pFB-neo vector

pFB-neo Dectin-1

Transfection of plasmid DNA

Plat-E cell line Harvest the media, add polybrene, and transduce dividing cells

RAW264.7 cells Place cells under G418 selection and culture resistant cells.

Cell line - (geoMFI)

RAW 264.2 - (342)

counts

RAW pFB-neo – (419) RAW pFB-neo Dectin-1 - (3844) Anti-HA

Fig. 2 Schematic representation of the generation of stable RAW264.7 cell lines expressing Dectin-1 using retroviral transduction. pFB-neo plasmid encoding for a HA-tagged Dectin-1, or pFB-neo plasmid (vector-only control), is transfected into the Plat-E viral packaging cell line. The Plat-E cells produce virion particles containing RNA, encoding for the gene(s) of interest and a selectable resistance (neo) gene, and reverse transcriptase. Supernatant from the Plat-E cells, containing the virion particles, is harvested and added to RAW264.7 cells to be transduced. Cells are then placed under antibiotic selection (G418 or Geneticin) to select for stable integration of the reverse-transcribed viral RNA into the host genome. The relative Dectin-1 receptor expression levels of a Dectin-1 overexpressing cell line (red histogram, quantified via geometric mean fluorescence intensity (geoMFI) of an anti-HA antibody stain), and of untransduced cells (grey histogram) or FB-neo only transduced cells (black histogram) can be examined by flow cytometry

164

Patawee Asamaphan et al.

3. Slowly pipette the transfection mixture dropwise onto the PlatE cells and gently mix the media. 4. Incubate the cells overnight at 37 C, 5% CO2. 5. On the following day, transfer the transfected Plat-E cells into a 32 C incubator with 5% CO2 and incubate overnight to ensure high virion titer. 6. After the 32 C incubation, harvest the virion-containing media, pass the supernatant through a 0.45 μm pore filter, and add polybrene to 5 μg/mL immediately before use (see Note 17). 3.2.2 Retroviral Transduction of RAW264.7 Cells

1. On the day before transduction with the virion-containing supernatant, plate 5  105 RAW264.7 cells/per well in a 6-well plate. Incubate the cells overnight at 37 C, 5% CO in complete DMEM. 2. On the next day, discard the media and replace with fresh complete DMEM. A minimum of 2 h prior to transfection add tunicamycin to 0.2 μg/mL and incubate the cells at 37 C. This step is very important (see Note 18). 3. After 2 h, add 1.5 mL of the virion supernatant (with polybrene added) to the RAW264.7 cells. 4. Centrifuge the 6-well plate for 90 min at 1200  g (2500 rpm) at 25 C. 5. Incubate the cells overnight at 37 C. 6. Remove the media and add 3 mL of fresh media with appropriate selection antibiotic. For pFB-neo vectors, use G418 (400 μg/mL). After 3–4 days, ~95% of the untransduced cells will die. This is normal, and the dead cells should be removed by aspiration or pipetting (see Note 19). 7. Check for DNA integration by extracting the genomic DNA using a commercially available kit followed by PCR amplification with pFB-retro (50 -GGCTGCCGACCCCGGGGGTGG30 ) and pFB-neo (50 - GCCAGGTTTCCGGGCCCTCAC -30 ) primers. Extract the PCR product using a commercially available PCR Clean-Up kit and sequence the fragments using the same primers. 8. Check receptor expression levels by flow cytometry using antibodies specific for your receptor of interest or for a tagged epitope present on the protein (Fig. 2). 9. To maintain high levels of expression, cells should be routinely maintained in complete DMEM supplemented with 400 μg/ mL G418.

Quantifying Receptor-Mediated Phagocytosis and Inflammatory Responses to. . .

3.3 Isolation and Generation of Bone Marrow-Derived Macrophages (BMDMs)

165

1. This procedure typically yields 2–6  107 BMDMs per two femurs (see Notes 10 and 20). 2. Remove the skin from the hind leg, dislocate the femur from the hip socket, and remove the whole leg from the body. Carefully, without snapping the bones, separate the femur from the tibia and then the foot from the tibia. Place both the femur and tibia in RPMI 1640 unsupplemented media on ice before use to maintain the viability of cells. 3. Remove as much muscle and skin as possible using sterile scissors and forceps. 4. Soak the intact bones for