Language of Terror : How Neuroscience Influences Political Speech in the United States 9781442235830, 9781442235823

Citation preview

LA NGUAGE OF TERROR

LA NGUAGE OF TERROR

How Neuroscience Influences Political Speech in the United States Wesley Kendall, Joseph M. Siracusa, and Kevin Noguchi

ROWMAN & LITTLEFIELD Lanham • Boulder • New York • London

Published by Rowman & Littlefield A wholly owned subsidiary of The Rowman & Littlefield Publishing Group, Inc. 4501 Forbes Boulevard, Suite 200, Lanham, Maryland 20706 www.rowman.com Unit A, Whitacre Mews, 26-34 Stannery Street, London SE11 4AB Copyright © 2015 by Wesley Kendall, Joseph M. Siracusa, and Kevin Noguchi All rights reserved. No part of this book may be reproduced in any form or by any electronic or mechanical means, including information storage and retrieval systems, without written permission from the publisher, except by a reviewer who may quote passages in a review. British Library Cataloguing in Publication Information Available Library of Congress Cataloging-in-Publication Data Library of Congress Cataloging-in-Publication Data Available ISBN 978-1-4422-3582-3 (cloth : alk. paper) -- ISBN 978-1-4422-3583-0 (electronic)

TM The paper used in this publication meets the minimum requirements of American National Standard for Information Sciences Permanence of Paper for Printed Library Materials, ANSI/NISO Z39.48-1992.

Printed in the United States of America

CONTENTS

Preface

vii

1 Introduction to Genetic Predispositions and the Politics of Terror

1

2 Genes, Media, and the Government in the National Narrative on Terror

29

3 The Criminalization of Language

63

4 Genetic Predisposition, Religious Belief, and Psychological Operations in the War on Terror

103

Conclusion

139

Selected Bibliography

143

Index

147

About the Authors

155

v

PREFACE

What is this book about? This book, in essence, is about America. A relatively young country, America’s identity has been cast by war; after announcing its tumultuous birth to the world with a gunshot at Concord, it has been riven by perpetual conflict ever since. Early westward expansion and the fulfillment of Manifest Destiny would see America at war with all the leading European powers, seizing land from indigenous Americans and decimating their entire population with guns, germs, and steel. Sundered by a bloody civil war, a fledgling America endured a crisis over the right to enslave labor, a fight that shed the blood of thousands of its native sons and slaves. Although the North claimed victory, both sides would savagely simmer, as tinder ready for the spark. Much later, with a devastating detonation, the nuclear bombs over Hiroshima and Nagasaki were a resounding declaration; after a mere one hundred fifty years of life, a fully grown America was now the most powerful war maker in history. Following World War II, the United States has been busy; it has been involved in over fifty foreign military actions and has established over fifty military bases abroad from which to project the global power of America. With a massive federal budget, the largest free-market economy in the world, and a colossal military-industrial complex, President Eisenhower’s prophetic speech regarding the influence of a privatized war machine on American politics and society would resonate more alarmingly with each successive decade. On 9/11, America was historically, economically, and socially primed for a protracted war on terror. vii

viii

P REFA CE

The culture and language of America reflects its violent past: children are reared on military-themed toys; popular movies and art glorify war; education directs students to the histories of violent conquests; and communities blithely revere the service of their military heroes. The words of war permeate American civil society, and after 9/11 these words of war were amplified by the language of terror. Common words such as “honor,” “duty,” “service,” and “loyalty” have become imbued with nationalistic and military significance and have been conferred a burnished status that evokes emotion in many audiences. Other words, formerly benign or irrelevant to war, became subsumed into the national nomenclature of a fearful mythology that wars perpetuate; “infidel,” “torture,” “kidnapping,” and “Muslim” are words that saw their previous meanings distorted in the war narrative, decontextualized to reduce their meanings to a baser form, with their association only contained within the terrorism milieu. Americans became the “infidel” to an ungodly “Muslim” religion that condoned murder, “kidnapping,” and “torture.” In the warped lexicon of the language of terror, it was seen as a lawful matter of course that the predominantly Christian U.S. military would conduct “enhanced interrogation” methods on “terrorist” subjects covertly whisked off of the world’s streets and obtained through practices of “extraordinary rendition.” Understanding the war on terror, and the language of terror which this war has spawned, is the object of this book. The use of language, and its interpretation, is largely predicated upon a complex biochemical process. Thoughts that are expressed as language originate in the transmission of neurochemicals between neurons that reside within the folds of gray matter that comprise our brains. The neurochemical patterns that provide us with thoughts are all orchestrated by genetic conductors that determine how and what amount of neurotransmitter should be released to send a message or to respond to one. Our brains are a veritable symphony of synaptic connections, and the cascade of chemical notes that encompass our thoughts can be influenced not only by the conductor but by the reception of the audience. Just as enthusiastic applause can invigorate a performance, social and environmental factors can also shape how language is received, interpreted, and acted upon. This book will also examine the genetic foundations of language and explore how genetic predispositions can influence the perception of terror-related communications.

PRE FACE

ix

Why is this book important? This book is important and timely for a number of crucial reasons. The recent developments in neuroscience research, as well as medical technologies that have vastly contributed to its growth, have helped to further our understanding of the genetic and neurochemical components of personality, ideology, and motivation, making a book on the science of language and war timely. As medical technologies that help us understand the biological processes of cognitive thought advance, the technologies of military arsenals evolve, enabling the killing of humans in the war on terror to be more efficient and cost-effective, making a book on the impacts of war rhetoric important; the civilian control of the U.S. military rests upon the informed consent of a knowledgeable electorate, and policies of war that implement weapons capable of mass destruction must be made with delicate deliberation. Another issue of critical importance that supports this book’s publication and readership is the current atmosphere of political division in the United States and the need to understand the origins of the philosophical recalcitrance between political parties that creates impasse and obstruction, effectively vitiating progress in the war on terror; coming to terms with any scientific explanation for the current political dysfunction would supply a diagnosis to the psychological malady that has afflicted a political paralysis on the nation’s governing bodies. If all policy makers, combined with the electorates they serve, were to understand the biological mechanisms that influence their political thoughts and attitudes and identify logical errors made in environments of stress or sentiment, which lead to flawed judgments in war policy, rational thought may prevail over emotional reaction. Indeed, rational thought may be considered the nemesis of war. This book is important because it proposes that in order to avert war, a critical self-examination of the thoughts that give way to war must be undertaken. What are the intentions of the authors? Many of the subjects under scrutiny by the authors of this book are the hallowed institutions of American culture, and any criticism of those honored organizations evokes instant peals of outrage and condemnation by institutional proponents. Lest we be remiss, and leave the gentle reader to infer that our intentions were purposefully to inspire provocation, let us be clear: your intuition obliges. In the tradition of the Socratic gadfly,

x

P REFA CE

scholarship should serve to not only edify and elucidate but to also be provocative and compelling. Although many revered institutions are the subject of critical consideration (such as the military, the media, the government, and the church), the author’s intention is to simply promote debate and contribute to the popular and scholarly discussion. As will be reiterated in the following chapters, the science is in its nascent stages, and no definitive evidence has yet been uncovered that closes the door on the debate regarding what factors shape the totality of our political, religious, or ideological beliefs. The intention of selecting cases that will unquestionably spur dispute is that they serve as an intellectual exercise, rather than as an assertion of categorical proof. Although the facts of the cases are well established, and the science that underlies each case rigorously well researched, the reader may find it challenging to completely detach emotionally and render impartial judgment on the merits of each case dispassionately. The authors would urge readers to remember the overarching theme of the book; visceral emotions aroused by speech are often irrational responses elicited by deeper, possibly genetic, impulses. In reading this book’s more controversial chapters, cast a critical eye on the substance and disengage moralistic emotion from the style. As this book will argue, triggering emotional morality is the cornerstone of language distortion in the war on terror. The cerebral challenge of divorcing emotion from reason only demonstrates the contention that logical judgments are often clouded by more obscure factors in contemplating policies in the war on terror. Who are the authors? A novel element of this book is the multidisciplinary approach inherent in the unique qualifications of its contributing authors. The notion that political language crafted by U.S. policy makers and interpreted by its citizens concerning America’s war on terror is influenced by historical, biological, and genetic processes is a multifaceted proposition that lends itself to a diverse analysis. This book brings together an imminent American historian, a political scientist trained in the law, and a professor of neuroscience from one of America’s most prestigious medical schools. Together, they view the evidence through a unique lens of professional perspective, and the case analyses bear the indelible imprint of their signature contributions.

PRE FACE

xi

CLOSING NOTE To conclude, the authors would like to sincerely express their gratitude to the many researchers in the areas of political science, genetics, history, and neurobiology whose past efforts have greatly informed and enhanced this book, as well as those who may draw future inspiration from this work and continue to contribute to a rapidly evolving area of inquiry. The importance of understanding the intersections between our genetically heritable personality characteristics and those ideologies acquired through social and environmental factors, and how those traits influence the narrative in the war on terror, cannot be understated. Violent ideation and the seeds of war may be sown into the very fabric of our DNA, and understanding the biological loom that weaves together the genetic threads of our conscious minds can help us avoid the destructive impulses that lead us into war.

1 INTRODUCTION TO GENETIC PREDISPOSITIONS AND THE POLITICS OF TERROR

“In our time, political speech and writing are largely the defense of the indefensible.” —George Orwell

Across the arc of American political history, words have been spoken and heard that have been designed to inform or obfuscate, enlighten or obscure, to quell or to incite. Many who have spoken these words were masters of communication, trained in the subtle art of crafting a finely tuned linguistic appeal that would resonate with their intended audience. Many of the listeners, unbeknownst to either the listener or speaker, were already genetically predisposed to the intended reaction programmed by their very DNA to respond to these emotional verbal cues. Terms such as war, liberty, and freedom have attained such lofty heights in the American political lexicon that their usage operates like a psychic skeleton key, unlocking defense mechanisms ordinarily possessed by a critical mind and triggering a visceral emotional response in the listener, leading to an abandon of reason, which could ultimately lead to a rush to war. The studies in the extant literature that discuss the use of propaganda to incite fear and motivate action are ubiquitous, but in agreement. Throughout the course of history, effective propagandists have deftly manipulated large populations with false facts and flowery language. Literature in neuroscience and psychology is equally compelling in its treatment of the genealogical and biochemical explanations that underpin the belief systems of 1

2

CHA P TER 1

the receptive listener who is the subject of this propaganda. However, when political masters fashion language to serve a particular end, that same language will inevitably come into conflict with some future end, and intellectual conflict ensues. The most powerful words are those that are absolute. Words like evil, immoral, and monster are so unequivocal by their very definition that their usage must be applied consistently. When the language of war is used inconsistently, applied to enemies today who become friends tomorrow, this paradoxical communication can create cracks in the cognitive mind. Political speech that creates ambiguities also creates cognitive dissonance, which refers to the listener’s ability to hold competing ideas simultaneously in the mind. The question is how this cognitive dissonance impacts policy choices, most particularly when it comes to war. How do policy consumers, namely the public, logically evaluate policy choices on issues as grave as war and terrorism if the waters of political discourse are muddied by ambiguities in language? This book will explore the answers. This book will cast a critical eye on the methods of communication used by politicians to convey ideas of war and terror and persuade the public to embrace their view of the world. It will examine the physical and psychological underpinnings regarding the receptivity of listeners to verbal persuasion and how these receptive listeners can be manipulated and controlled. This book will further consider the consequences of creating a political environment with multiple political languages based upon the subjective use of malleable terms and how the use of language that creates policy ambiguities impacts policy dialogue in the United States. A qualitative case study analysis will be employed to examine events where conflicting political language is used, in an attempt to determine how this cognitive dissonance impacts policy choices. Essentially, this book undertakes a study of the consequences of using mixed messages in communicating policy ideas to a public already fearful, distrustful, and wholly skeptical of the government that once again proposes launching itself into the breach of the newly branded war. This book posits that different segments of the U.S. electorate respond to political speech regarding terrorism in predictable ways and are manipulated by policy makers’ rhetoric into making illogical or counterintuitive electoral choices. Recent theoretical developments in biopolitical neuropsychology, which examines how the human brain reacts to expressions

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

3

of political ideology, indicate that the population is largely divided into two increasingly polarized groups: conservatives and liberals. The research indicates that these opposing groups are neurologically hardwired to respond to political speech according to their respective genetic predispositions. This book will examine how the human brain reacts to expressions of political ideology regarding terrorism. It will then apply these reactions to specific forms of political communication by policy makers, many of which are deliberately designed to elicit a desired response in creating support for the policy makers’ agenda. This book will make a unique contribution to a multidisciplinary body of academic research fields, such as political theory, linguistics, and neuroscience, by considering the impact of speech on both domestic and international policy considerations. This book is incredibly timely, as the confluence of biopolitics and neuroscience is in its infancy, and no author has taken a booklevel multidisciplinary approach to this new subject. A historian, a political scientist, and a neuroscientist all collaborating on how political speech is processed biologically and impacts legal and political policies in the United States is a complete novelty in the literature. This book is at the cutting edge of this important subject. It takes a multiphase qualitative case study approach, using a primary case study (e.g., the case of Luis Posada Carriles, the CIA-funded Cuban exile responsible for the 1976 bombing of a Cuban airliner that killed 73 people), contrasted with a secondary comparative cross case analysis (e.g., the case of Mohamed al-Megrahi, the Libyan intelligence officer convicted in 2001 of the Pan Am Flight 103 airliner bombing that killed 270 people over Lockerbie, Scotland), and illustrates by comparative analysis how similar acts accompanied by starkly different political language can create cognitive dissonance in the minds of the electorate and impact policy choices. This analysis will involve examining the content of the speech, how speech is assimilated by different political groups, and how the speech is ultimately acted upon by the consumers of the information, namely, the electorate. In summary, this book embarks upon an unprecedented academic collaboration in the interdisciplinary literature: a historian, a political scientist/lawyer, and a neuroscientist evaluating the biochemical processes of speech assimilation, and its consequences on legal and political policy.

4

CHA P TER 1

RESEARCH DESIGN U.S. policy makers must make calculations on the impact of charged language used in communicating ideas concerning their positions on issues involving terrorism and can craft specific language to appeal to a reactionary segment of the population to elicit a desired response based upon the electorate’s inherent predispositions, effectively circumventing logical debate on issues concerning policies toward terrorism and war. The research design of this book intends to test how those calculations can be finely calibrated to manipulate the predispositions of a targeted audience and how successful this brand of manipulation can be. The qualitative methodology this book will employ will be a case study approach based upon trace process analysis, grounded in neuroscience research, which will illuminate the biochemical causes of individual reactions to political speech. The case study method of analysis will take a bifurcated approach, first discussing the neurological mechanisms responsible for assimilation of political speech and its impact on decision making, then conducting an exhaustive examination of a particular case or event that tests these neurological explanations, which may be extrapolated out to create larger generalizations about systemic behavior. 1 Each case under evaluation will be thoroughly and extensively dissected, and the singular event occurrences derived from this process will be used to create observations that will be assimilated into a testable model. Process tracing, a method that is used to trace the linkages between causes and outcomes in individual cases, will be employed to examine observations made in a case study analysis and will aid in refining causal inference. 2 The process-tracing tests are an invaluable instrument in bolstering explanatory hypotheses in qualitative research, and assess causal process observations (CPOs, which are essentially diagnostic pieces of evidence used in the study) by subjecting these observations to vigorous analytical testing within-case to establish causal relationships between observations. 3 The merging of empirical neuroscience research findings with historical data through the prism of a qualitative case study technique is unprecedented in the literature and will create a novel contribution across disciplines. The validity of the inferential assertions drawn from the process-tracing tests will be further tested by an elite interview process, a form of non-probability sampling that uses the data taken from elite actors within

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

5

the system who have participated in the event, and are essential sources that can provide detailed insights with unparalleled acumen regarding the validity of the hypothesis, and can confirm or reject these hypotheses based upon firsthand knowledge. Elite interviews are an innovative tool, not widely used, that allows the researcher to corroborate data culled from other sources, establish policy makers’ attitudes, and make deeper inferences about broader population decision making and validate theoretical assumptions incorporated into the research model. 4 The elite interviewing compiled for this book consists of accounts taken from individuals who had direct involvement in the events that comprise the case study. The data taken from the elite interviews will serve as complement and validation, or rejection and rejoinder, to my individual hypotheses, a novel approach to political analysis. Cases will be selected that exemplify the use of propaganda in an attempt to further the policy agenda, subjected to a robust and rigorous case analysis, and then contrasted to a comparative cross case analysis using a fact-similar event with a different policy outcome. Interviews will be conducted with participants of the event to further elucidate causative factors. This research design model will test the following research question: Can contradictory political speech that creates cognitive dissonance impact electoral behavior? To answer the question of whether policy choices can impact or manipulate electoral behavior, the question will be rigorously tested with multiple case analysis studies supplemented by relevant statistical analysis and public opinion polls. Shifts in polling figures subsequent to political rhetoric regarding a particular issue would be strongly indicative of success in the use of political rhetoric and can be an accurate metric to gauge the success of deliberate political language usage. The sources used to measure shifts in approval ratings will consist of a number of preeminent polling resources, such as the Gallup poll. These targeted shifts will be corroborated by those interviews to either bolster or refute inferential assumptions regarding causation.

6

CHA P TER 1

CREATION OF POLITICAL LANGUAGE Theories abound regarding when man acquired the faculty of speech, and this diversity of opinion continues to be the subject of heated debate among linguists today. Some theorists contend that the ability to communicate orally is such a sophisticated muscular operation that it’s impossible to conceive that this facility developed quickly. But some theorists, such as Noam Chomsky, articulated the theory known as discontinuity, which avers that the ability to speak occurred almost overnight. Chomsky argues a chance mutation occurred instantaneously within a single individual, and this random genetic mutation spread throughout their offspring and ultimately conferred upon a growing population the ability to speak. 5 Some theorists opined that speech was first used to mimic the sounds of nature, express feelings of pleasure or pain, or possibly even create a verbal analogue to physical movement in order to communicate actions in the dark. 6 Some linguists have even argued that language was developed in order to effectively block communication, separating members of one tribe from another in order to prevent or deter conflict. 7 Irrespective of its original development, the biological foundation for speech can be found in the descended larynx, also found in other animals that are capable of vocalization. 8 This anatomical structure runs the full length of the vocal tract and has the ability to expand or contract to produce sounds that other humans recognize as language. Although humans have been communicating with each other for millennia and possess a nearly perfect anatomical apparatus in which to voice those communications, humans have, unfortunately, been markedly inept in evolving a system of communication that is clear, unmistakable, and free of ambiguities. The inherent complexities of language tend to lend themselves to misunderstanding, misinterpretation, and occasionally mischievousness. Although some people may lack the ability to speak clearly, others may use the innate subjectivity and the vagaries of language in order to intentionally and deliberately mislead and misinform. This is especially true when it comes to political speech, where success in speech is not measured merely by the efficacy in communication but rather whether the communication elicits the desired response. This desire to politically provoke essentially incentivizes ambiguity and lack of clarity. Succinct and concise language leaves little room for political maneuverability and is generally eschewed in favor of vague and amor-

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

7

phous language that diminishes understanding, and, according to Orwell, “this reduced state of consciousness, if not indispensable, is at any rate favorable to political conformity.” 9 In Orwell’s mind “political language has to consist largely of euphemism, question begging, and sheer cloudy vagueness”; 10 he cites as prime examples instances of what he refers to as doublespeak, or words that mean the opposite of their usual meaning: the pacification of a village means to destroy it, or the elimination of unreliable elements means the summary execution of political opponents. We can see contemporaneous equivalents in words like collateral damage or ethnic cleansing, pleasant-sounding words that mask the atrocity behind the acts committed. When these mendacious forms of communication become systematized, reducing language to a means to deliberately dissemble and deceive the masses into believing specious political assertions, we commonly call it propaganda. The historical origin of the word propaganda finds itself firmly rooted in the lexicon of the Catholic Church, which in 1622 created a bureaucratic organ known as the Congretio Propaganda, a wing of the church devoted exclusively to “propagating the faith,” or promoting Catholic ideology in foreign non-Catholic nations. 11 While the definitions of propaganda are as varied as its applications, the definition by Richard Alan Nelson seems most encompassing and holds: Propaganda is neutrally defined as a systematic form of purposeful persuasion that attempts to influence the emotions, attitudes, opinions, and actions of specified target audiences for ideological, political or commercial purposes through the controlled transmission of one-sided messages (which may or may not be factual) via mass and direct media channels. A propaganda organization employs propagandists who engage in propagandism—the applied creation and distribution of such forms of persuasion. 12

Although propaganda was originally conceived as a means of espousing the Catholic faith, the word has evolved, being used historically in various contexts ranging from the objective dissemination of information (the distribution of medical information as part of a government campaign to reduce the spread of communicable diseases, for example) to more nefarious contexts involving the circulation of patently false information under the guise of fact (Nazi propaganda regarding Jewish hygiene, for example). 13 In the modern political nomenclature, propaganda

8

CHA P TER 1

has assumed decidedly negative connotations, but in the language of American law, propaganda falls into two categories—overt and covert. According to the Government Accountability Office, overt propaganda is a more benign form of advertising, whose purpose of persuasion is selfevident (a logging company advertising paper in a magazine). 14 Covert propaganda, however, is defined as persuasive messaging cloaked in a pernicious veil of factual authority (a logging company producing and supplying high school environmental textbooks that disparage environmental regulation and promote logging of old-growth forests). The primary distinction to be made between advocacy that advances an argument of a particular perspective and that of covert propaganda would lie in the opacity of the message or the true identity of the messenger. Language of advocacy promotes honest, spirited discussion, whereas the language of propaganda effectively conceals its true intent behind words designed to deceive. However, this book concerns itself primarily with the application of propaganda in a war and terrorism context, and in this its history is storied. Propaganda has existed for millennia, dating back to ancient Egypt when pharaohs would erect monuments as testaments to their triumphs in wartime and to memorialize acts of brutality committed upon their enemies and glorify their dynastic reign. 15 Language itself has been the critical component of effective propaganda, and without the ability to distort the meaning of language and words, imbuing them with double meaning, euphemism and fallacy propaganda would be much more difficult to manufacture. Confucius adamantly believed that the fragile fabric of society depended upon honest threads of communication and that when this tapestry would begin to fray, Chinese society would ultimately deteriorate. When Confucius presciently said, “The correct use of language leads to the correct behavior of people,” it’s hard to imagine he could have conceived of the technological advances that have enabled the mass distribution of incorrect language and its subsequently deleterious impact on people globally. 16 Machiavelli, an influential progenitor of political propaganda and an astute observer of the human condition said, Everyone admits how praiseworthy it is in a prince to keep faith, and to live with integrity and not with craft. Nevertheless our experience has been that those princes who have done great things have held good faith of little account, and have known how to circumvent the intellect

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

9

of men by craft, and in the end have overcome those who have relied on their word. 17

If the long history of political speech tells us anything at all, it should be that those who have been privy to the political machinations of the most successful political operatives are all in accord; propaganda is inextricably intertwined with human speech. The question then turns to one of delivery and what the most effective medium of delivering covert messages designed to befuddle and confuse is. Propaganda has become more complex since the days of pharaonic hieroglyphs and the papal bulls of the de Medici family. News media and the Internet have revolutionized the consumption of propaganda irrevocably. Five hundred years ago our perception of the world was shaped and informed by the limited sources of information available within our immediate surroundings and largely acquired directly. Political beliefs and ideological convictions were assiduously collected locally and formed the foundation of our political outlook. Today, people are inundated with “news” from such a wide variety of propagandists that sifting through the dross and dreck of this bombardment to scrutinize each piece of information and determine its authenticity would be an onerous burden, and largely cost prohibitive (assuming you wish to work and have avocations outside of determining how to categorize each purveyor of communication). Even as early as eighty years ago, it has been noted, the vast majority of Western civilization understood the world around it by the knowledge received from newspaper and radio reports, and modern-day societies have become increasingly dependent on third- or fourth-hand interpretations of events occurring throughout the world. 18 When events occur with far-reaching political import and are reported and witnessed live (such as a presidential address or congressional hearing), these reports are invariably accompanied by punditry and political commentary that informs the viewer how she should place the event into different perspectives, such as historical context and political significance. Even the editorial discretion exercised in determining what news is covered can express ideological bias and create the inverse of propaganda, the withholding of information to skew perception of its relevancy. As news organizations have increasingly surrendered their journalistic mandate to expose the truth in favor of acquiescing to authoritarian voices in the government (particularly in times of crisis, such as war or after acts of terror), governmental adminis-

10

CHA P TER 1

trations (in particular the executive branches of government) have increasingly dominated the way in which the discussion around war is framed and how information is disseminated. 19 An example of how the government can deftly frame an issue regarding terrorism and lure a complacent media into propaganda complicity would be the messaging from the Bush White House around the events of 9/11 and the media’s response. 20 In the wake of the 9/11 attacks, just hours after the towers fell, members of the Bush administration were framing the event in a criminal context, saying the perpetrators must be “punished” and “brought to justice.” 21 The language evokes images of police action, courts, trials, and constitutional procedures. Abruptly, the language frame was shifted away from a criminal act involving apprehension of suspects to words of war. However, the framing was discordant, even to some within the administration itself. Donald Rumsfeld conceded that this event did not fit our preconceptions of a traditional war; stateless aggressors, with no defined geographic battleground nor opposing armies or diplomatic negotiations. To bolster the issue framing as credible, metaphorical words of war were subtly infused into the terrorist narrative. George W. Bush spoke of “smoking them out of their holes,” a dehumanizing metaphor that attempts to equate enemies with animals, a technique Hitler had often used when speaking of Jews. Rumsfeld referred to “drying up the swamp they live in,” connoting again the lowly depths of our enemy’s perfidy. 22 Branding our enemy as “evil” is also propagandistic imagery that can have a visceral resonance, especially with conservative or religious voters, who tend to have a very polarized view of good and evil and eschew principles such as moral relativism. To be “evil” suggests that no compromise is possible without sacrificing closely cherished ideals and that the enemy must be innately beyond redemption. “Evil” is the enemy of the “good,” so to engage in battle with this enemy, you define yourself as the “good” when you become its opponent. You must be good, in order to fight evil. These metaphorical expressions are commonplace in war propaganda, and indeed approach the formulaic. According to Pratkanis and Aronson, counterterrorism “fear persuasion” is most effective when it accomplishes the following: “(1) it scares the hell out of people, (2) it offers a specific recommendation for overcoming the fear arousing event, (3) the recommended action is perceived as effective for reducing the threat, and (4) the message recipient believes that he or she can perform the recom-

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

11

mended action.” 23 In a country horrified by the attacks of 9/11, the outcome of a propaganda campaign recommending a military response to a country steeped in the glorification of war and possessing the most powerful military on the planet seems, in retrospect, to be a foregone conclusion. However, the deeper, more profound question yet remains: Why do certain people respond in such predictable ways to this messaging? Previous studies persuasively demonstrate that responses to political language are deeply ingrained and largely premised upon a moral compass. According to Green et al., reactions to political propaganda are inherent and based upon a code of morality. 24 Shermer contends that humans do not deliberately reason their way to a political conclusion; they react with the moral intuition that they subsequently justify through a complex process of intellectualization. 25 This illogical approach could be succinctly stated as beginning with the conclusion and then, through torturous logical circumvention, bolstering that conclusion by amassing disparate facts to support one’s moral intuition. According to Jonathan Haidt, these moral intuitions are derived from ancient tribal taboos that have served to protect and preserve the clan one belongs to. 26 An example would be the ostensibly natural aversion to an act of incest. Although our ancestral forebears did not understand the genetic disadvantages of procreation with a close relative, the sense of visceral disgust associated with incest became heritable among humans and gradually incorporated into an ingrained moral compass. According to Joshua Greene in his book Moral Tribes, “the core of morality is a suite of psychological capacities that enable us to get along in groups.” 27 However, the groups that Greene’s research envisages are small tribal clans who developed a close affinity and unwavering commitment to close members of the clan and, by extension, a natural distrust of members outside the clan who may pose an existential threat to the continuation of the clan’s genetic line. The inherent dispositions that have been genetically encoded into our DNA and comprise the moral codes that inculcate a sense of community and protection of the clan’s most vulnerable members in defense of outside intrusion have worked well throughout the eons to protect and propagate small tribal clans but begin to disintegrate when these clans are integrated into the larger globalized community. This instinct to protect members of the local clan also operates to instinctively reject that which is deemed foreign. According to Shermer, when clans began to develop intertribal relationships and move away

12

CHA P TER 1

from the hunter-gatherer lifestyle and established agrarian or artesian communities, two distinct systems evolved to manage social control and instill political harmony in large tribal collectives: religion and government. 28 Although Greene has noted that humans have evolved complex emotions such as empathy and gratitude that serve to reinforce the cohesion of the small clan and foster cooperation among clan members, when smaller groups begin to coalesce into a larger collective, moral behaviors can be challenged by issues involving free-riding members that exist on the periphery of the clan’s existence. These external challenges can reverse the code of morality that is instilled to generate empathy for other clan members and generate antipathy toward outsiders, creating an “us versus them” mentality that would later evolve into ethnocentrism and nativist mentalities. When extended members do not contribute proportionally to the clan’s survival, cooperation may turn to competition. In smaller clans free rider issues can be successfully resolved through social control, such as moral shaming. However, the issues of disparate personal member input become unwieldy when groups reach a certain numerical size, at which point social control and political harmony must be established by either government or religion. According to Haidt, there are certain psychological constants that are inherently ingrained and dictate which form of social control an individual gravitates toward; he enumerates five universal systems that enable one to categorize individuals based upon their moral proclivities. 29 As will be discussed in detail in future chapters, those who exhibit a preference for attributing moral authority to a higher unseen power, mystical in origin, omniscient and omnipresent, tend to gravitate toward the conservative end of the spectrum. Individuals endowed with a preference to confer upon their fellow man the authority to adjudicate disputes and punish trespassers tend to entrust government to enforce social order. These divisions that began as tribal tensions become genetically encoded as moral imperatives, ultimately manifesting themselves as political affiliations. These moralistic divisions are reflected in how we process information and assimilate political language. This sense of morality has evolved to advance the interests of the clan, to engender empathy, and to ensure members of the tribe care for one another, but unfortunately our genes have not yet evolved to further the interests of facilitating global cooperation or promoting world peace. Simply put, our brains have evolved beyond our genes.

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

13

THE SCIENCE OF POLITICS The continuous disasters of man’s history are mainly due to his excessive capacity and urge to become identified with a tribe, nation, church or cause, and to espouse its credo uncritically and enthusiastically, even if its tenets are contrary to reason, devoid of self-interest and detrimental to the claims of self-preservation. We are thus driven to the unfashionable conclusion that the trouble with our species is not an excess of aggression, but an excess capacity for fanatical devotion. —Arthur Koestler

In the quote above, Koestler was emphasizing that ideology can be a powerful motivating force, even if it runs contrary to one’s own beliefs. Nowhere is this concept better exemplified than in politics. One only needs to look at the use of nationalism to justify the Nazi persecution of the Jews or the U.S. internment of Japanese Americans during World War II. Thus, one important question is how the political machine is such a potent motivational force. Is political ideology only influenced by learning and environment, or does biology or genetics play a significant role? Interestingly, science is often confronted with similar nature versus nurture questions. This has led to the development of several powerful tools to dissect these two possibilities. These same methods are just now being used to examine biological underpinnings of political behavior. Therefore, in this chapter, we will discuss this nascent field of biopolitics. 30 Since neuroscience methods can often be difficult to understand, we will attempt to provide an illustrative example of how each technology can be used before describing how they are used to study biopolitics.

TWIN STUDIES In the 1960s, the predominant view was that political convictions were the product of learning, environment, and personal experience. However, as these ideas were empirically tested, it has become abundantly clear that biology and even genetics may play a much larger role than once thought. Historically, the first indications of this were studies showing that families exhibited marked similarities in political beliefs. Initially, it was naturally assumed that these similarities were the product of the close social interaction and inherently similar environment shared by any family.

14

CHA P TER 1

However, closer examination revealed biology may play a much larger role than initially believed. The first indications of this were twin studies that examined differences in political beliefs between fraternal and identical twins. Scientists often use twin studies to examine whether genetic inheritance plays a role in a disease. For instance, Huntington’s disease is an often-fatal inherited neurodegenerative disease that leads to motor impairment and cognitive decline. While studying the disease, scientists noticed that identical twins (who share an identical genome) both developed Huntington’s disease together, whereas fraternal twins (who share only approximately 50 percent of their genes) often did not. Therefore, it was concluded that Huntington’s was an inherited disorder. However, there is no reason that twin studies can only be used to study disease. Thus, many of the early biopolitical studies focused on twins. This scientific paradigm takes advantage of two facts. First, twins share a very similar social environment, thereby reducing differences caused by learning and personal experience. Second, different types of twins can vary in their genetic similarity. Since fraternal twins develop from the fertilization of two different eggs, they share on average 50 percent of their genes. However, identical twins develop from the division of a single fertilized egg, resulting in an identical genome. Therefore, if a characteristic such as political conviction were genetically influenced, one would expect identical twins to show more similarity than fraternal twins, even if they were brought up in a similar environment. The results of these studies strongly suggested that there was a surprisingly strong genetic influence on political beliefs (Eaves et al., 1999; Martin et al., 1986). Interestingly, closer examination revealed that the differences in political attitudes did not exist prior to young adulthood but instead formed during early adulthood when individuals left the parental home (Hatemi et al., 2009). This suggests that during childhood and adolescence, political beliefs were strongly influenced by the family environment. However, as young adults left and developed independent lives, this lack of familial environment allowed genetic predispositions to influence their political beliefs. While these initial twin studies were provocative, there are some criticisms inherent in all twin studies (Hatemi et al., 2010). For instance, there is evidence that identical twins are treated more similarly than fraternal twins, which may result in a higher concordance in political traits. It can also be argued that the birth of twins is a rare event, leading to unique circumstances and, as a result, one cannot generalize their studies

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

15

to the general population. Finally, it is also important to realize that these studies also show that genetics cannot explain all variance in political beliefs. If this were true, all identical twins would exhibit the same political ideology.

POLITICAL IDEOLOGY AND PHYSIOLOGICAL RESPONSE Despite the criticism of twin studies, they were one of the first indications that political attitudes could be influenced by more than just environment and learning. As time progressed, interest in the burgeoning field of biopolitics has led others to examine this idea in different ways. One of the best-known studies was published in the prestigious journal Science. In this article (Oxley et al., 2008), the authors found that subjects with protective political attitudes were much more likely to exhibit physiological responses associated with emotional arousal following exposure to sudden noises or seeing visually threatening images. The authors explicitly state that protective political policies should not be labeled “conservative” or “liberal.” However, it is easy to see that their list of protective policies all align with conservative issues. For example, protective policies include support for military spending, warrantless searches, the death penalty, the Patriot Act, obedience, patriotism, the Iraq War, school prayer, and biblical truth. Other examples include opposition to pacifism, immigration, gun control, foreign aid, compromise, premarital sex, gay marriage, abortion rights, and pornography. Regardless, why would people with these “protective policies” be more emotionally arousable? If political attitudes are the result of experience and careful thought, why would it be correlated with such an automated reflexive response? The authors hypothesize that these automated reactions are thought to be regulated by the limbic system, a primitive part of the human brain involved in emotion. In particular, they suggest this emotional arousability may be related to the amygdala, a limbic structure involved in processing emotions (particularly fear). They go on to state that “given that political and social attitudes are heritable and that the amygdala activity also has been traced to genetics, genetic variation relevant to amygdala activity could affect both physiological responses to threat and political attitudes bearing on threats to the social order.” As a result, an individual who is more easily emotionally aroused may be predisposed to protective political

16

CHA P TER 1

policies. To be fair, the authors are careful not to declare a causal relationship between these two things. However, this may explain how people who differ in political views would harbor physiological responses that reflexively responded in such disparate ways. Interestingly, subsequent research has validated this general finding. For instance, Smith et al. (2011) found people with conservative views had larger involuntary physiological responses to disgusting images.

THE NEUROANATOMY OF POLITICAL IDEOLOGY More recently, the advent of new technologies has allowed studies to become more sophisticated, allowing one to correlate political attitudes with brain structure or even the functioning brain. One technological breakthrough is magnetic resonance imaging (MRI), which uses strong magnetic fields to image the living brain. While many of us have had an MRI to diagnose a medical problem, it is especially effective at imaging the brain by providing excellent contrast between gray matter (where neurons are located) and white matter (containing nerve fibers that connect neurons). Unlike many other technologies such as the CAT scan or X-rays, the MRI does not produce ionizing radiation that can damage tissue and DNA. As a result, there are fewer ethical barriers to using these technologies on research subjects. While it is easy to view the brain as an amorphous blob of gel, it is actually the most highly organized organ in the body. Specific structures are dedicated to processing distinct types of information in a highly structured design. For instance, different regions are specialized to process memory formation, sensory perception, motor movement, or vision. However, while these brain regions are distinct, they can grow or shrink with use. In the same way exercising can cause a muscle to grow, constantly using a particular brain region to learn a novel skill can cause it to undergo a corresponding structural change. For example, children undergoing musical instruction for a fifteen-month period had their brains imaged by MRI. When compared to a control group (which participated in a music class with no instrument training), children who underwent musical training had significantly larger brain volumes in regions associated with playing an instrument. This included regions of the motor cortex controlling hand movement, regions that help coordinate movements between different sides of the body, and cortical regions,

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

17

which process auditory information (Hyde et al., 2009). As a result, it appears musical instruction can lead to structural change in brain regions associated with that behavior. Based on these findings, it would make sense to examine whether political attitudes also exhibited structural brain changes. In 2011, Kanai et al. had subjects self-report their political attitudes on a five-point scale that varied from “very liberal” to “very conservative.” They then used MRI imaging to estimate the volumes of several brain structures thought to be related to political ideology. Research has found that liberals are more accepting of conflicts (which occur more often in progressive views) and better able to deal with them using alternative strategies. As a result, the anterior cingulate cortex was measured since it is involved in conflict monitoring and the ability to tolerate uncertainty (Amodio et al., 2007). Additionally, conservatives are much more likely to perceive a threat or feel anxiety when faced with uncertainty (Jost et al., 2007). As mentioned before, the amygdala is involved in fear processing. For instance, people with larger amygdalae (plural of amygdala) tend to be more sensitive to fear (van der Plas et al., 2010) but people with selective amygdalar damage have been found to be severely impaired in their ability to recognize fear in other people (R. Adolphs et al., 1995; Ralph Adolphs et al., 2005). Therefore, due to the higher arousability of conservatives, amygdalar size was examined also. When Kanai et al. (2011) measured these two structures, they found liberalism positively correlated with anterior cingulate size and conservatism was positively correlated with the right amygdala (but not the left). While it may seem strange conservatism correlated with the right amygdala only, functional lateralization of the brain is not necessarily surprising. Most know that a majority of people process language in the left brain hemisphere or that motor movement is controlled by the contralateral (opposite side) motor cortex. Similarly, stimulation of the right amygdala more consistently evokes negative emotions such as fear or sadness, whereas the left amygdala can produce both negative and positive emotions (Lanteaume et al., 2007). Ultimately, it is not surprising that there are structural brain differences in liberals and conservatives. After all, behaviors are the result of the processing of information in the nervous system. The surprising thing is that these differences can be detected by using crude measures such as regional brain volume. Even more intriguing is whether these differences in structure prime the indi-

18

CHA P TER 1

vidual toward different ideologies and, if they do, to what degree are they the result of environment/experience or genetically predetermined.

POLITICAL IDEOLOGY AND BRAIN FUNCTION While an MRI provides a static image of the brain, a functional MRI (fMRI) can detect dynamic changes in blood flow in the brain (hemodynamics). It accomplishes this by taking advantage of differences in magnetism between oxygenated and deoxygenated blood. Since active brain regions need more oxygen, an fMRI provides an indirect measure of functional brain activity. An example of this is a recent study done in traumatic brain injury patients in a persistent vegetative state (people with no purposeful voluntary behavioral responses to stimulation) (Monti et al., 2010). The authors hypothesized that these patients may have some level of consciousness but the lack of motor control to meaningfully respond. Therefore, patients or normal control subjects were asked questions while being scanned but told to answer by either imagining playing tennis or navigating streets of a city. No verbal communication was allowed. Since imagining either task activates different parts of the brain, the fMRI can peer into what regions are activated and use these scans to identify a response. By simply interpreting the brain activation patterns in fMRI scans, the normal controls could answer each question with 100 percent accuracy. Amazingly, fMRI scans revealed that a small number of persistent vegetative state patients were also able to reliably answer questions. This indicates that, despite the inability to behaviorally react in a meaningful manner, these patients maintained cognitive awareness. It also exemplifies how an fMRI can literally peer into the working brain and inform us about its function. Political scientists have used this same technology to examine the functioning mind of liberals and conservatives. For instance, in a recent study (Amodio et al., 2007), subjects selfrated themselves on a scale varying from “extremely liberal” to “extremely conservative.” While such a measure may seem simplistic, it explains 85 percent of the statistical variance in presidential voting behaviors. The subjects were then tested on an error-detection task that is thought to be dependent on the anterior cingulate cortex. As described previously, this region is involved in conflict monitoring and the ability to tolerate uncertainty often seen in people with liberal views. Next, subjects had fMRI

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

19

scans taken while performing a “Go/No Go” task. In this test, subjects frequently responded to a “Go” stimulus in a certain manner. However, a small percentage of the time, a different “No Go” stimulus was presented requiring them to make a different response. Since the subjects habituated to the more frequent “Go” stimulus, the presentation of a rare “No Go” stimulus produced a conflict. As mentioned previously, the anterior cingulate aids us in dealing with uncertainty and conflict. As a result, the fMRI detected activation of this structure when the “No Go” stimulus was presented and its magnitude measured using scalp electrodes. The results found that the more liberal the subject, the more functional the cingulate structure, leading to fewer behavioral errors when confronted with conflicting information and a preference for liberal views.

POLITICAL IDEOLOGY AND GENETICS Genome Wide Analysis In this final section, we will look at whether specific genes might influence political ideology. The most comprehensive study ever done on this was by Hatemi et al. (2011). In this study, they took DNA samples from over thirteen thousand individuals and administered a test to determine how liberal/conservative they were. While it would be nice to sequence each subject’s genome, human DNA is composed of over three billion base pairs. As a result, it would be impractical (and unnecessary) to sequence all 39 trillion base pairs contained within all participants. One thing that makes whole genome sequencing unnecessary is that the majority of our genome is identical. As a result, they can use a method called “genome wide analysis” to only focus on highly variable (i.e., polymorphic) regions that naturally differ among individuals. In the Hatemi et al. (2011) study, they focused on a specific type of polymorphism called a “microsatellite.” Microsatellites are short sequences within DNA that repeat in a manner that differs among individuals. So, for example, if the repeating microsatellite sequence is a (C)ytosine, (A)denine, and (G)uanine, one person may have three repeating sequences (i.e., CAGCAGCAG), whereas another may have seven repeating sequences (i.e., CAGCAGCAGCAGCAGCAGCAG). The number of microsatellite sequences often has no known effect. However, in other cases, the effects

20

CHA P TER 1

can be devastating. For instance, Huntington’s disease is caused when a specific microsatellite CAG repeat occurs too much. While more repeats lead to a worse prognosis, people with over forty CAG repeats typically have full penetrance for the disease. While microsatellites can differ substantially among people, they are inherited (along with the number of repeats) from our parents. As a result, the unique number of microsatellite repeats we inherit are used as markers for DNA fingerprinting and paternity testing. However, Hatemi et al. (2011) used microsatellites as a marker for a particular gene region. This is helpful because genes located close to each other on the same chromosome tend to be inherited together. As a result, if a particular microsatellite shows up more often in conservatives, then it is more likely that a gene in that region influences this political ideology. In the Hatemi study, the microsatellites revealed four regions that appeared to significantly differ based on different political beliefs. Unfortunately, this does not tell us what particular gene in that region is influencing the trait (if it exists at all). However, this linkage analysis design gives researchers a much smaller genetic region to focus on for candidate genes, which can be used to great effect. For instance, a very similar method was first used to determine that the mutation for Huntington’s disease was located on a specific region of chromosome 4 (Gusella et al., n.d.). Since genetics techniques were still primitive back then, it still took ten years for this mutation’s exact location to be determined (Group, 1993). Luckily, with the sequencing of the human genome, we know which genes are located within these regions. Therefore, Hatemi et al. were able to speculate which genes within these four regions may influence political ideology. Remarkably, many of these regions contained genes related to a neurotransmitter called “glutamate” and a specific type of glutamate receptor called “N-Methyl-D-Aspartate (NMDA).” Glutamate is the most common excitatory neurotransmitter in the brain and NMDA is one of several receptors it can bind to. Interestingly, we know disruptions of NMDA neurotransmission can dramatically affect behavior. For example, ketamine and phencyclidine (i.e., PCP, angel dust) are two drugs of abuse that specifically block the NMDA receptor. Depending on the dose of drug taken, effects can vary from euphoria to psychosis (a disordered state seen in mental diseases such as schizophrenia and bipolar disorder) (Noguchi, 2001). Hatemi et al. (2011) mentioned that the administration of ketamine can lead to inflexibility in a commonly used psychiatric card-sorting task. This may suggest conser-

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

21

vatives exhibit less NMDA stimulation than liberals. Unfortunately, it is difficult to speculate on what exactly these linkage results mean. We just know there are regions containing genes involved with the NMDA receptor that may (or not) be involved. Even if we knew this was true, we would not know if these genetic polymorphisms increase or decrease stimulation to this receptor. Ultimately, this study was an important first step in determining genes related to political ideology. Future research should focus on the genes within these four regions to try to narrow down which ones may be related to political ideology. On a more cautionary note, it is worth mentioning that people often associate genetic differences with racial differences. However, this research does not suggest one race is biased toward one political leaning or the other. In fact, all the subjects in this research were Caucasian by design. This was probably done purposefully to get a more homogeneous population, which would reduce noise (i.e., genetic variance) in the data. As a result, these findings only suggest some genes can influence political ideology within a particular race rather than among different races. Dopamine and Politics The above study used genome wide analysis to screen the entire genome for genes possibly related to political ideology. The great advantage of genome wide analysis is that markers for the entire genome are screened for differences. However, an alternative method (called the “candidate gene approach”) uses a more hypothesis-driven approach to screen for genes. In this method, researchers come up with candidate genes based on prior knowledge and selectively test for differences in the DNA. This approach is much simpler in that only a small number of genes need to be looked at, rather than markers for the entire genome. In this book, we will reference a candidate gene study looking at a dopamine receptor subtype called DRD4-7R (Settle, Dawes, Christakis, and Fowler, 2010). However, before going into this research, we should first review the role dopamine plays in the brain’s reward centers. One of the first studies suggesting dopamine plays a role in reinforcement was a seminal paper by Olds and Milner (1954). In this study, the researchers surgically implanted an electrode in the septal brain region of a rat and allowed it to move freely in a maze. When the rat moved to a specific region of the maze, the septal region was stimulated by passing an electrical current through the im-

22

CHA P TER 1

plant. While the authors thought this stimulation would be aversive, the animal actually preferred it. Next, instead of placing the rat in a maze, scientists placed it in a cage with a lever that allowed the rodent to selfstimulate the electrode. By placing the electrode in specific places in the brain, they could literally make rodents addicted to lever pressing. Animals were recorded lever pressing at up to seven thousand times per hour (Olds, 1958). In another experiment that tested how addicting this stimulation was, animals were allowed a short time each day to get a whole day’s worth of food or self-stimulation. Each time, the rodent chose selfstimulation: as a result, the experiment had to be stopped before the animals died of starvation. In one case, the experimenters placed a food pellet on the lever for self-stimulation. Instead of eating the food, the malnourished rat batted the pellet out of the way before frantically pressing the lever. It was eventually discovered that the most rewarding selfstimulation was causing dopamine to be released in a region of the brain called the nucleus accumbens. This dopamine release is thought to be a mechanism through which naturally rewarding behaviors are reinforced in the brain. Therefore, it may be no surprise that many of the most addicting drugs (such as cocaine, amphetamine, and methamphetamine) directly increase dopamine neurotransmission in the nucleus accumbens. In addition, all other addictive drugs indirectly cause this same effect. As a result, it is thought that many drugs of abuse short-circuit this natural reward mechanism, thereby tricking the brain into reinforcing addictive behavior. Once dopamine is released, it can bind to one of at least five dopamine receptor subtypes, which can produce different effects once stimulated. The dopamine receptor subtype D4 (DRD4) is of particular interest since it may influence political ideology. DRD4 is highly expressed in the limbic system of the brain (a region that includes the nucleus accumbens and is known to be involved in emotion, motivation, and memory) (Defagot, Malchiodi, Villar, and Antonelli, 1997; Ebstein et al., 1996). Interestingly, the DRD4 receptor gene has several polymorphic variants that have been discovered. Like microsatellites, the DRD4 receptor gene contains a specific sequence (48 base pairs long) that can repeat in a manner that differs among individuals (Mayseless, Uzefovsky, Shalev, Ebstein, and Shamay-Tsoory, 2013). Ordinarily these 48 base pairs can repeat between two and eleven times within the gene. Since this gene codes for the dopamine receptor, each additional repeat will cause more amino

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

23

acids to be added to the receptor protein structure, which can alter its physiological effects when stimulated. Importantly, people have focused a lot of attention on the DRD4-7R dopamine receptor allele. The DRD47R allele contains seven repeats (hence 7R) of the 48-base-pair sequence. This produces a dopamine receptor that is less sensitive to dopamine neurotransmission when compared to other DRD4 receptors (Asghari et al., 1995). As a result, people with this allele may need more dopamine stimulation to produce the same effect. Importantly, the DRD4-7R allele has been correlated with several behavioral characteristics. For instance, people harboring the DRD4-7R allele have been found to have a personality that is more novelty seeking (Cloninger et al., 1993; Ebstein et al., 1996). Novelty seekers are often described as more open, exploratory, and less likely to tolerate monotony (Settle et al., 2010). Therefore, this increased novelty-seeking behavior may increase dopamine stimulation of the less sensitive DRD4-7R receptor. Consistent with this hypothesis, people suffering from Attention Deficit/Hyperactivity Disorder (ADHD) are more likely to harbor the DRD4-7R allele (Swanson et al., 2000). ADHD is a psychiatric disorder characterized by problems with attention, hyperactivity, and impulsivity. However, some have suggested that ADHD may be like an extreme case of novelty seeking where abnormal impulsive and inattentive behaviors are performed to increase dopamine stimulation on the DRD4-7R allele. Predictably, the pharmacological ADHD treatments of choice are stimulants (like Ritalin and Adderall) that are designed to increase dopamine neurotransmission. However, not all people harboring the DRD4-7R allele suffer from ADHD. In normal people, the openness to experience in novelty seekers is also a trait commonly linked to liberalism. As a result, researchers have looked for links between the DRD4-7R allele and political ideology. They found that, among people with the DRD4-7R allele, the more friends one had in adolescence, the more likely one was to be liberal (Settle et al., 2010). It was suggested that the number of friends was important because this may open one to a broader variety of viewpoints. Therefore, the openness to experience in novelty seekers may be nullified if one is culturally isolated, with a limited number of friends.

24

CHA P TER 1

SUMMARY OF THE SCIENCE OF POLITICS In summary, the last fifty years has seen a dramatic shift in opinion regarding the biological underpinnings of political ideology. Early on, researchers believed political beliefs were primarily the result of learning from our environment. However, more recently it has become apparent that biology and even genetics are important determining influences. Much of this research was generated through the invention of novel techniques and technology (originally used in other fields) that have only recently been adapted to studying biopolitics. Ultimately, this field is truly in its infancy and it will be exciting to see how this field evolves in the future. Finally, it is important to realize that a single gene or brain structure does not determine one’s political ideology. Indeed, since the concept of liberal and conservative changes over time it would be impossible for us to evolve this quickly. Ultimately, our political beliefs are a complex interaction between our environment (education, culture, social interactions) and the ability of our inherent biological design to collect, interpret, and process that information into beliefs. Alternatively, our biology may influence more general effects such as emotional arousal, fear, and novelty seeking that could sway a person to one end of the political spectrum or the other. In fact, by adapting strategies that are most effective, adept politicians have always been taking advantage of this fact (often without their own knowledge). Ultimately, the purpose of biopolitics is to dissect what those biological processes are.

CONCLUSION Recent studies conducted by neuroscientists, political scientists, and law professors have shown how genetically inherited moral cores can skew our perception of information and impact how we assimilate political language. Ingrained moral and cognitive bias has been demonstrated to exist in a number of different forms, which can result in rejection of objectively factual statements, the revision of factually incorrect or erroneous statements as true, and the reinforcement of erroneous statements in the face of contradictory evidence. One such study by Dan Kahan (Motivated Numeracy and Enlightened Self-Government) suggested that

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

25

cognitive political bias could even interfere with an individual’s ability to perform basic mathematical calculations. 31 In Kahan’s experimental study, subjects were asked to interpret mathematical tables concerning two different issues: the efficacy of a particular skin cream in treating topical rashes and the ability of a gun control law to reduce violent crime. Subjects who had disclosed their political position as opposing gun control were unable to properly interpret the mathematical tables with the results that suggested gun control laws were effective in reducing violent crime but had no trouble correctly calculating the figures in the skin cream table. Incidental observation that compounded the import of the study’s suggestion that moral or cognitive bias skews how individuals process political language was that those subjects who possessed advanced mathematical skills had a higher likelihood that their political views intruded upon their mathematical ability. Brendan Nyhan has conducted several studies that indicate a strongly held moral core can result in blatant confirmation bias in which erroneous beliefs become ostensibly more calcified when confronted with contradictory facts. 32 Some of the studies’ findings include the reinforcement of the belief that weapons of mass destruction were found in Iraq, after the subjects were confronted with irrefutable evidence to the contrary, and research subjects who continue to express disapproval of President Obama’s handling of the economy, asserting that unemployment had increased, after being shown graphs proving the opposite. In 2004 an fMRI study conducted by Drew Westen that examined neuroimaging results from a brain scan conducted on thirty men examined their neural response when listening to self-contradictory remarks by both U.S. presidential candidates. 33 Proponents of each respective candidate were dismissive of the political gaffe made by their candidate while being markedly critical in their assessment of his opponent’s error. The most fascinating finding in the study concerned the inactivity of the dorsolateral prefrontal cortex, most closely associated with the brain’s ability to conduct high-level reasoning, and the increased activity of the orbital frontal cortex, which processes emotion. This study strongly suggests that the brain’s ability to conduct analytical reasoning is impaired or subordinated by an emotional moral core that interferes with our ability to think rationally. It is this conflict between the logical and illogical mind (the reasoning and the emotional brain) and the impact of the tension between the two on our ability to assimilate political language that is the subject of

26

CHA P TER 1

this book. Over the course of the next several chapters, this book will explore in qualitative case study analysis how these disparate messages are assimilated by the brain and the brain’s response and how this impacts public policy choices.

NOTES 1. George, Alexander. Case Studies and Theory Development in Social Sciences, Cambridge, MA: MIT Press (2005). 2. Collier, David. Rethinking Social Inquiry: Diverse Tools, Shared Standards, Rowman & Littlefield (2004). 3. Schulte-Mecklenbeck, Michael. “The Role of Process Data in the Development and Testing of Process Models of Judgment and Decision Making,” Judgment and Decision Making 8 (2010): 733–39. 4. Tansey, Oisin, “Process Tracing and Elite Interviewing: A Case for NonProbability Sampling,” Political Science and Politics 40 (2007): 4. 5. Chomsky, N. Powers and Prospects: Reflections on Human Nature and the Social Order, London: Pluto Press (1996), p. 30. 6. Zammito, John H. Kant, Herder, and the Birth of Anthropology, Chicago: University of Chicago Press (2002). 7. Müller, F. M. The Theoretical Stage, and the Origin of Language. Lecture 9 from Lectures on the Science of Language. Reprinted in R. Harris (ed.), The Origin of Language. Bristol, UK: Thoemmes Press (1996 [1861]), pp. 7–41. 8. Hauser, M. D.; Chomsky, N.; and Fitch, W. T., “The Faculty of Language: What Is It, Who Has It, and How Did It Evolve?” Science 298 (2002): pp. 1569–79. 9. “Politics and the English Language,” the essay of George Orwell. First published April 1946 by/in Horizon, London. 10. Ibid, page 4. 11. MacCaffrey, James, History of the Catholic Church from the Renaissance to the French Revolution, vol. I, London (1915), p. 199. 12. Nelson, Richard Alan, A Chronology and Glossary of Propaganda in the United States, (1996), pp. 232–33. 13. Cunningham, Stanley, B. The Idea of Propaganda: A Reconstruction. Westport, CT: Praeger (2002). 14. General Accounting Office, Letter to the Chairman of Senate Committee on Small Business, B-223098 (October 10, 1986). 15. Sampsell, Bonnie M. “The Statuary of Tuthmosis III.” The Ostracon 15, no. 2 (2004): 8–13.

GE N E T I C PRE DI SPOSI T I ONS A ND THE P OLITICS OF TERROR

27

16. As quoted in Carmichael, Michael, “Propaganda and the Politics of Perception Global Research,” March 12, 2007. 17. Machiavelli, Nicolo. The Prince, Chapter XVIII, Concerning The Way In Which Princes Should Keep Faith. 18. Lippmann, Walter, Public Opinion. New York: Harcourt Brace (1922). 19. Nacos, Brigitte L. The Press, Presidents, and Crises, Columbia University Press (1990). 20. Lakoff, George. ‘War on Terror,’ Rest In Peace. Rockridge Institute, February (2006). 21. Lakoff, George, “Metaphors of Terror,” 2001 essay, available online at http://www.press.uchicago.edu/sites/daysafter/911lakoff.html. 22. Ibid. 23. Pratkanis, A. R. and Aronson, E. Age of Propaganda: The Everyday Use and Abuse of Persuasion (rev. ed.). New York: W. H. Freeman & Co. (2001). 24. Donald Green; Palmquist, Bradley, and Schickler, Eric. Partisan Hearts and Minds: Political Parties and the Social Identities of Voters. New Haven, CT: Yale University Press (2002). 25. Shermer, Michael, The Believing Brain: From Ghosts and Gods to Politics and Conspiracies—How We Construct Beliefs and Reinforce Them as Truths, Times Books (2011). 26. Haidt, Jonathan, The Righteous Mind: Why Good People Are Divided by Politics and Religion, Pantheon Press (2012). 27. Joshua Greene, Moral Tribes: Emotion, Reason, and the Gap Between Us and Them. New York: Penguin (2013). 28. Shermer, page 232. 29. Haidt, Jonathan, “The Emotional Dog and Its Rational Tail: A Social Intuitionist Approach to Moral Judgment.” Psychological Review 108, no. 4 (2001): 814–34, cited in Shermer, page 239. 30. We will define biopolitics as the interdisciplinary study examining the biological influences on political behavior. Unfortunately, biopolitics has been defined different ways with some definitions including racist or anti-Semitic themes. 31. Kahan, Dan M.; Peters, Ellen; Dawson, Erica Cantrell; and Slovic, Paul, “ Motivated Numeracy and Enlightened Self - Government,” Yale Law School, Working Paper 116 (2013) . 32. Nyhan, Brendan; Reifler, Jason, “When Corrections Fail: The Persistence of Political Misperceptions.” Political Behavior 32, no. 2: 303–30. doi:10.1007/ s11109-010-9112-2 (2010), retrieved 4 July 2014. 33. Westen, Drew; Blagov, Pavel S.; Harenski, Keith; Kilts, Clint; Hamann, Stephan, “Neural Bases of Motivated Reasoning: An fMRI Study of Emotional Constraints on Partisan Political Judgment in the 2004 U.S. Presidential Elec-

28

CHA P TER 1

tion,” Journal of Cognitive Neuroscience (Massachusetts Institute of Technology) 18, no. 11: 1947–1958 (2006).

2 GENES, MEDIA, AND THE GOVERNMENT IN THE NATIONAL NARRATIVE ON TERROR

When the axe entered the woods, the trees were heard to remark “at least the handle is one of us.” —Turkish proverb

According to principles of evolutionary psychology, people are inclined to identify distinct patterns in their observation of the world (such as the recurrence of repeated terrorist alerts broadcast on national television by American media) and respond by associative behaviors in regard to these perceived patterns, based upon genetically predisposed perspectives on possible threats they may encounter in the immediate future. Messaging from media that influence public behavior is often crafted to serve the interests of an information society largely driven by profit motive and increasingly divorced from journalist ethics and neglectfully receptive to semiotic issue framing propounded by government officials. This ostensible symbiosis between government and media, the former seeking to manipulate popular perception based upon political motivation, and the latter driven by producing sensationalistic and fearful narratives that drive corporate media revenues, can produce flawed self-serving information that the public consumer will interpret in an equally flawed manner, based upon a genetic predisposition that skews his compass of perception. This chapter will begin by elucidating the biological, psychological, and genetic factors that determine how individuals interpret patterns of speech, and based upon genetic predisposition, respond to those patterns. 29

30

CHA P TER 2

It will further consider how media outlets and governments fashion policy statements and media reports to play upon and manipulate these phenomena of patterned recognition to achieve a desired result, namely, the media’s interest in driving ratings and revenue coupled with the government’s interest in formulating a political narrative that advances particular policy interests. This policy analysis will be followed by the case study examination that assesses two disparate cases involving government, the media, and terrorism and how message framing joined with the genetic predispositions of a fearful public can impact policy choices.

PATTERNICITY Over the course of millions of years, humans have developed a system of pattern recognition as a primitive defense mechanism to identify threats. The ability to discern through the physical senses whether a pattern of movement in far-off brush is the product of natural forces or a deadly predator has served humankind effectively over the trajectory of their evolutionary development. 1 These patterns of identification and inherent cognitive recognition of potential threats have left psychological artifacts that continue in our cognitive functioning today but produced mixed benefits. Imagine a man, imbued with these archaic psychological constructs that first originated on the savannas of Africa, responding to an elevation in terrorist alert level and confronted with what he is told is an imminent threat of terrorist strikes. 2 If he believes this threat and takes what he believes to be sensible precautions to avert the danger and it is ultimately revealed that the alert was a false alarm, this man has made what psychologists refer to as a “Type I” error in cognition, or a false-positive— believing something is real when it is in fact false. 3 This man’s experience with the terrorist warning has identified a nonexistent threat, but he suffers little more than a possible inconvenience as a result of his error. However, if the same man is unable to recognize the pattern in terror alert warnings and disregards the threat, which on this occasion happens to be real, he has made a Type II error in cognition or a false-negative, believing something is false when it is in fact real. The consequences of this cognitive error may be the man’s death, thereby effectively eliminating him from the human gene pool. Over the course of millennia, natural selection would clearly favor those humans who are more prone to mak-

GE N E S, M E DI A, AN D T H E GOVERNMENT

31

ing Type I errors of circumspection and will treat less favorably humans whose genetic makeup would compel them into making Type II cognitive errors. 4 The ability to successfully make these associations and to correctly identify patterns that are more conducive to long-term survival have been the most successful type of associative learning, and a process Shermer refers to as “patternicity”: the tendency to find coherence in patterns that discern the meaningful from the meaningless. Unfortunately, humans have not developed the ability to accurately distinguish between true and false patterns and therefore have not developed systems to identify errors in cognition and thereby thwart or avoid negative consequences as a result of misidentification. The innately human compulsion to identify patterns and attempt to predict future events gave rise to early superstitious belief systems, such as organized religion (and ultimately led to ideological adherence to certain political parties or movements). Although this pattern-recognition system has helped us survive, procreate, and develop social institutions, and because false patterns and Type II errors in cognition don’t always result in death, and natural selection lends itself to all associative survival tactics, a genetic residual persists into the present day that still allows cognitive errors of the Type II variety to perpetuate. The only corrective measure for overcoming Type II cognitive errors occurs in the application of scientific methodology to objective observation. However, the psychological structures that facilitate cognitive error are indelibly embedded in our genetic makeup. These systems of patternicity, once they are entrenched genetically and reinforced through positive observation-oriented affirmation, become deeply ingrained but not irreversible. Studies by Catania and Cutts indicate that through rigorous reinforcement of causal relationships and observation, false patterns of superstition and false cognitive associations can be defeated, and an individual can be inculcated with the ability to correctly identify proper causal associations and relationships. 5 Patternicities are psychological constructs that are generated as products of both nature and nurture and are not arbitrary in origin. Genetic disposition coupled with environmental context creates a locus of receptivity, which can be grounded in either an internal or external perspective. Psychologists refer to this cognitive phenomenon as an individual’s locus of control. Those who possess an internal locus of control are more selfconfident and strongly believe that they control their immediate surroundings and are responsible for events that occur outside their person.

32

CHA P TER 2

Persons who possess an external locus of control believe themselves to be the objects of random circumstance and subject to the vagaries of those around them and largely suffer feelings of insecurity. Individuals possessed of an internal locus of control tend to be more critical of others around them and skeptical of their motives; they are less inclined to blithely endorse the established authorities of government and religion, and eschew all things superstitious. Those who have an external locus of control are inclined to be more deferential to authority (religious and political) and trusting in their rectitude of purpose and display an inclination to embrace the mystical and paranormal. A person’s locus of control, biologically predicated upon genetic predisposition, will act as a determinative factor in their ability to assimilate patterns in messaging regarding threats of terrorism, and it will greatly determine their individual response. The contemplation of patternicity and its implications to issue framing in media communication and the government’s role in confronting terrorism has been explored previously by Jennifer Whitson. 6 When considering the prevalence of unfounded conspiracy theories promoted within media and the information society (primarily the Internet) and how patternicity could impact the perception of a terrorist event, Whitson stated that “we saw an unstable environment caused by the terrorist attacks that led directly and almost instantly to the generation of the conspiracy theories.” 7 About how cognitive psychological constructs premised on biological predisposition occurring within a mental context could promote misidentification of observed patterns, Whitson said that “it may be that even though we were told immediately that it was Al Qaeda, there was a terrible uncertainty about the future, a sense of loss of control leading to the search for hidden patterns, which the 9/11 truthers think they found.” 8 The establishment of an illusory correlation, or perception, of a causal relationship between variables where none is present will be the subject of examination in the remainder of this chapter, which focuses on the susceptibility of individuals (given their environmentally instilled locus of control operating as an extension of genetically established systems of patternicity, which will dictate how they respond) to messaging regarding terrorism from the media and the government, which seek to craft messaging, promote a particular political agenda, or increase ratings and revenue.

GE N E S, M E DI A, AN D T H E GOVERNMENT

33

MEDIA FRAMING OF TERRORISM The public, as consumers of information, rely largely on media actors to report accurately, edit appropriately, and contextualize with subtlety the events occurring daily that will inform them as citizens as to how to properly discharge their obligations as constituents in voting for policies that advance the interests of the republic. Journalists, operating under the aegis and protection of the U.S. Constitution, labor under an ethical duty to investigate, vet, and corroborate governmental pronouncements and communicate political edicts objectively and without political taint. The government, in particular the executive branch, shoulders the onus of conducting the diplomatic negotiations with foreign nations, informing the public of policy decisions, and orchestrating military responses to national threats. Historically, these two public organs of democracy often operated at cross-purposes in fulfilling the constitutionally envisioned system of checks and balances that a free press and accountable government were imagined to fulfill. However, as recent scholarship strongly suggests, a confluence of interests between an increasingly corporatized media and a more muscular executive branch set on exceeding the scope of its constitutional authority have begun to act in concert to achieve disparate but complementary objectives. This portion of the chapter will conduct a critical examination of this relationship and attempt to determine whether the media have become complacent vehicles for the propagation of government messaging on terrorism and whether government has usurped the role of an objective media by co-opting the institution’s ethical code to advance its own agenda.

A PRIMER ON THE SCHOLARLY LITERATURE REGARDING MEDIA AND GOVERNMENT AND ISSUE FRAMING The contextual perspective in which news outlets report terrorism insinuates a frame into the journalistic narrative in which integral assumptions concerning the object of the reportage will establish subtle parameters in the reader’s mind and can be a powerfully suggestive form of implication. According to Entman, shortly after the terrorist attack on 9/11 the Bush administration asserted the inevitability of a military response by promoting an issue frame that used ideological dimensions to advance a unilater-

34

CHA P TER 2

al foreign policy in the promotion of national unity. 9 According to Seth Lewis and Stephen Reese, issue frames are an indispensable tenet of political communication and effectively shape public opinion through use of symbols and persuasive language and serve as the quintessential instrument through which public officials influence the public. 10 According to the authors, “framing is an exercise in power” and any attempt to quantify the full extent of government influence on media reporting would involve an analysis of the receptivity of journalists to adopting frames propounded by government institutions. 11 Previous analysis regarding how political rhetoric can be incorporated into media framing, and the role played by journalists in facilitating the issue framing promoted by government sources, discovered that editorial boards covering the war on terror were: 1) transmitting the frame as shorthand for administration policy, 2) redefining the policy as an uncontested thing, and 3) naturalizing the frame as a taken-for-granted worldview. Reese’s analysis reaffirms the contention that a complacent media that abandons its constitutional remit to act as a check on government, coupled with a government aggressively pursuing a politically expedient agenda, can result in distorted and biased issue-framing practices on behalf of journalists. 12 After the terrorist attacks of 9/11, the Bush administration’s response to these acts and the media’s role in promoting the Bush doctrine exemplify and illustrate the concept of issue framing, as well as provide a natural point of departure for discussion regarding the communication of propaganda and ways in which it is processed by the public. Although the “war on terror” as an expression originated within the Reagan administration and was used to classify Middle Eastern and Latin American statesupported terrorism, the phrase was adopted by President Bush subsequent to the 2001 Al Qaeda attacks. 13 Framing the attacks as “a monumental struggle of good versus evil” President Bush requested that exceptional powers be vested within the office of the executive, conferring power to implement a broad range of policies from tax cuts to the Patriot Act. 14 The moralistic framing of the 9/11 attacks as acts of war provided sufficient justification for preemptive military action and general curtailment of civil liberties domestically. The American media uncritically adopted the war on terror frame largely without offering scrutiny as to its legitimacy. No newspapers of note offered editorial admonition advocating any caution in the run-up to war with Afghanistan; in fact, many were vociferously promoting a military response and adopting much of the

GE N E S, M E DI A, AN D T H E GOVERNMENT

35

pro-war rhetoric proffered by the Bush administration itself. In a subsequent act of self-flagellation, many editorial contributors would later castigate themselves for their failure to offer a more critical evaluation of the Bush administration’s arguments and evidence in support of the war on terror. 15 However, frames are more than mere psychological constructs that encapsulate meaning; they form a system of instrumentality used by power brokers to shape reality and, through deft manipulation by political and media elites, can be used to reinforce political agendas, deeply embedding them within social structures to convey a natural sense of normalcy. This comprehensive organization of information is based loosely on abstract principles of the ideological struggle that creates a galvanizing sense of nationalism, which is persistent and promoted through symbolism. An emblematic example of the system of media information organization using potent forms of symbolism can be found in the image of George W. Bush in the wake of 9/11, standing in the smoking ruins of the World Trade Center and surrounded by groups of patriotic first responders in an image of iconographic emotion: “I can hear you, the rest of the world hears you! And the people! And the people who knocked these buildings down will hear all of us soon!” 16 This portentous tableau illustrates the issue framing of an ideological struggle forging nationalism in the crucible of terror, the president astride the charred remains of a symbol of America’s economic might shouting bellicose threats into a bullhorn. This image was replayed incessantly to the public and reinforced the issue framing advanced by the Bush administration. According to Lewis’s study, journalists who participated in the reporting of 9/11 mostly concede that they had adopted policies proposed by the administration without providing contextual analysis and media and almost invariably embraced Bush’s preferred phraseology that also reified and naturalized the policy, making it an uncontested system of discourse. 17 While the motives for issue framing regarding terrorism on the part of the government seem abundantly self-evident (interest in promoting the administration’s political agenda, controlling political messaging to reduce the likelihood of critical scrutiny, communicating threats effectively to the enemy, etc.), the motivations of the media corresponding to those of the government’s interests bear addressing in this chapter. A multitude of studies has shown irrefutably that reports on terrorism increase overall viewership, which in turn drives ratings and profitability. Stories of ter-

36

CHA P TER 2

rorism in U.S. media typically are framed to contain theatrically dramatic elements involving tragedy, action, heroes, and blood. Analysis of media prior to 9/11 suggests that popular culture in America has long glorified acts of violence and crime, and mainstream media outlets were financially incentivized to provide the public exactly what they wanted. In addition, an increasingly corporatized mass media empire (Fox News, CNN, and MSNBC) is controlled more frequently by executives hailing from the hallowed halls of corporate America than by career journalists, resulting in a more emphatic focus on the bottom line and increasing revenue, rather than a strict adherence to the ethics of the profession of journalism. 18 The media have effectively framed issues related to terrorism not only in a way deferential to governmental authority (which also happens to exercise regulatory oversight over the business of news and hence its profitability) but in a manner sensationally alluring to an American culture enthralled with acts of violence and terror, and conditioned to respond emotionally to stories of personal tragedy. The result is a media product that expands upon the personal, attempts to assign blame to the guilty, engages in duplicative displays of shocking images, and plays to demagoguery, fearmongering, and general hysteria. To achieve this end, media use issue framing to endow certain issues with saliency and set an agenda conducive to its own ends. Muslims and Arabs are routinely categorized as purveyors of petroleum or potential terrorists; media rarely add any contextual insight into cultural or socioeconomic conditions that may be relevant to issues of terrorism. In contrast to the myopic perspective media casts on Muslims and Arabs, victims of terrorism are often portrayed as heroes and martyrs and their individual tragedies replayed ad nauseam. The repetition of these individual tragedies are broadcast incessantly until the ratings dictate their discontinuance. Objectivity and professional detachment have been largely absent in the wake of 9/11 regarding coverage of issues of terrorism, which have been often met with emotional vitriol and forceful political punditry. According to Altheide, 9/11 was exploited by the media and politicians to advance fearful ideologies that involved the electronic surveillance of workplaces, neighborhoods, and human bodies. 19 Indeed, terrorists themselves have become incredibly astute at manipulating the interests of corporate media by inducing the media into broadcasting sensational violence in order to elevate ratings, and by extension promote the agenda of terrorists. Without the complicity of the media, Altheide argues, the “im-

GE N E S, M E DI A, AN D T H E GOVERNMENT

37

pact is arguably wasted, remaining narrowly confined to the immediate area of the attack rather than reaching the wider target audience that the terrorist violence is actually aimed.” 20 Attracting the attention of the media is not only the gateway to an audience terrorists hope to influence but also a forum in which to broadcast their successes to allies and warn potential enemies as well as explicate the logic behind their actions. 21 In this form, the media ironically serves the purpose of diminishing the power asymmetry that exists between the terrorists and the states that they oppose and validates their attempt to obtain some moral equivalency and legitimize their political struggle. As Ayman al Zawahihri said, “Al Qaeda is in a battle, and more than half of this battle is taking place in the battlefield of the media.” 22 And the media, for its part, is more than interested in perpetuating this battle between states and terrorists; and in fact it has a fiduciary obligation to its shareholders to ensure that the battle continues to rage, without a winner, for the foreseeable future. In summation, humankind has been endowed with a genetically embedded mechanism with which to identify and recognize distinct patterns and observations. This ability, acquired over millions of years of evolutionary biology, largely determines how we assimilate and process information and assign value to threats. This primitive defense mechanism is still functional in contemporary society and has the inadvertent effect of producing false-positive cognitive errors which can skew or distort our ability to accurately process temporary threats and properly evaluate situational circumstances and avoid errors in cognitive thought. In processing information regarding terrorism, these vestigial mechanisms can act as predictors for the myriad ways in which we process information, and interacting within social and environmental contexts can produce behavioral responses to media cues regarding terrorism. These media cues are largely products of issue frames formulated by governmental agencies, primarily within the executive branch, to achieve certain political goals and promote national security agendas. The media, largely complicit in aiding governments to frame issues in order to shape reality, are moreover incentivized by reaping financial profit and are unconcerned with adherence to journalistic ethical concerns. An aggressive militaristic government, combined with avaricious profit-motivated media, creates a detriment to an unsuspecting public interested only in acquiring objective information to make informed policy choices at the polls. The following

38

CHA P TER 2

case study analysis will attempt to illustrate the real consequences theoretically explicated above.

CASE STUDY The following case study, complemented by a comparative cross case analysis, will explore governmental attempts to use, deliberately or without stated intention, issue framing in presenting ideas through mainstream media to manipulate perceptions of terrorist events to engender preferred policy preferences in citizens who are genetically predisposed to certain types of messaging. The cases will examine two incidents involving airline bombings, the U.S. government’s disparate responses to each attack, and the resulting impact the U.S. executive administration messaging had, and whether factors involving cognitive dissonance influenced policy choices among conservative and liberal constituencies. Historical Case Context: Abdel Basset Ali Mohamed al-Megrahi On December 21, 1988, at roughly 31,000 feet above Lockerbie, Scotland, a brick of Semtex plastic explosives, carefully concealed inside a hidden radio stored within a black hard-shell Samsonite suitcase loaded into an aluminum cargo hold container and later learned to be marked “AVE 4041 PA,” was detonated. 23 This relatively small detonation made a twenty-inch hole in the fuselage that, at stratospheric heights, quickly tore the skin from the frame of the aircraft, plunging Pan Am Flight 103 tens of thousands of feet to the ground below, killing all 259 passengers and crew on board and eleven unfortunate people on the ground in Lockerbie. 24 It was immediately hailed as Britain’s worst air disaster in history. Over the course of the next several months, the ensuing investigation conducted by the British Department for Transport Air Accidents Investigation Branch and the U.S. Federal Bureau of Investigation collected evidence from the airliner that spanned a debris field covering hundreds of square miles of Scottish countryside. Investigators determined, based upon reconstruction of the fuselage and various aluminum cargo hold containers, that AVE 4041 PA was the container that held the bomb that brought down Pan Am Flight 103. 25 Investigators quickly traced the ori-

GE N E S, M E DI A, AN D T H E GOVERNMENT

39

gin of AVE 4041 PA to a flight that originated in Malta, connected through Frankfurt, Germany, and ultimately arrived at Heathrow before departing for New York at 6:00 PM. 26 The Crash Pan Am Flight 103, named Clipper Maid of the Seas, was delivered to the airline in February 1970 and at the time of the crash was eighteen years old, having accumulated 75,000 hours of flying time, and was operating the transatlantic leg of the flight originating in Frankfurt. Passengers for New York boarded at Heathrow in London, with interline baggage, departing at 6:25 PM. 27 At 7:01 PM, Flight 103 approached the Scottish coast at Solway Firth and appeared on radar traveling at a ground speed of 499 miles per hour. At 6:58 PM, the flight made two-way radio contact with Shanwick Oceanic air control, at which point the oceanic route clearance was transmitted to the aircraft. Flight 103 never acknowledged Shanwick’s transmission and shortly afterward disappeared from the radar. 28 At 7:02:50 PM, the cockpit voice recorder recorded a loud sound, and radar echoes the same moment indicated the plane had separated into five sections that. eight seconds after the explosion, had spread to an area of 1.9 square kilometers. 29 Investigators from the FAA later determined that the crash was caused by an explosion on the left side of the aircraft that blew a twenty-inch hole in the lower fuselage. 30 The voice recorder, which was recovered by investigators, recorded a 180-millisecond hissing noise as Flight 103’s communication center was destroyed. At 31,000 feet the air pressure differential sheared the nose off the aircraft into the starboard wing, severing the number 3 engine. 31 The fuselage pitched forward until it reached 19,000 feet, at which point its plummet to the earth became vertical. As it continued its descent, the fuselage began to break up, igniting 2,000 pounds of fuel, which upon impact destroyed several houses. 32 The investigation by local law enforcement authorities, in conjunction with the FBI, collected more than 15,000 witness statements and 10,000 pieces of debris, which were reconstructed by air accident investigators who ultimately determined, through the examination of baggage tags, the location of the explosion, an air cargo container. Fragments of the suitcase that were identified as containing the bomb that brought down Flight 103 contained bomb components glued into circuit boards and a radio cassette player, along with children’s clothes deter-

40

CHA P TER 2

mined to have been made in Malta. The clothes inside the suitcase were traced back to Tony Gauci, a Maltese storekeeper. Gauci was interviewed a total of twenty-three times, in which he gave inconsistent testimony regarding the appearance of the purchaser as well as the date of purchase; he later identified Abdel Basset Ali Mohamed al-Megrahi, a Libyan airport security officer working in Malta, by photograph, as the man who purchased the clothes linked to the bombing. 33 The fragment of the circuit board allegedly found within the wreckage was identified as one also found in the possession of a Libyan intelligence agent who had been arrested previously for carrying bomb-making materials. 34 The timer with the bomb was allegedly linked to a Swiss manufacturer, Mebo, which had supplied timers to Libya in the past. Based on this evidence, in November 1991 al-Megrahi was indicted by the U.S. attorney general and the Scottish Lord Advocate, along with codefendant Fhimah, for the bombing of Pan Am Flight 103. 35 Libya refused extradition to a foreign state but offered to try the defendants in Tripoli if incriminating evidence could be produced proving their guilt. This offer was roundly rejected by Scottish and American officials. Only after the international community proposed sanctions on Libya did Colonel Gadhafi ultimately relent and concede to a compromise that would allow the defendants to be tried in the Netherlands under Scottish law. On April 5, 1999, al-Megrahi was arrested and formally charged at Camp Zeist and placed on trial. 36 The Trial The trial at Camp Zeist of al-Megrahi for the murder of 259 passengers and crew aboard Pan Am Flight 103 and the eleven residents of Lockerbie killed on the ground by the aircraft’s debris was presided over by three judges and one nonvoting judge. Both defendants denied all charges. The Libyan defendants were represented by British counsel as well as given access to a Libyan attorney. The trial began on May 3, 2000. Evidence against the Libyans largely revolved around testimony from Tony Gauci, the Maltese shopkeeper who identified al-Megrahi as the purchaser of clothes linked to the suitcase allegedly containing the bomb, and testimony from timer-component manufacturer Mebo’s owner, Edwin Bollier, and his employee Ulrich Lumpert. 37 However, blatant inconsistencies in testimony proffered by all key witnesses, coupled with what would later be revealed as troubling improprieties in the handling of

GE N E S, M E DI A, AN D T H E GOVERNMENT

41

critical evidence, would slowly begin to cast grave doubts on the subsequent judicial findings of the Camp Zeist court inquiry. Tony Gauci The clothes located in the suitcase determined to hold the bomb that brought down Flight 103 were identified as Maltese in origin and manufactured by a clothing company named Yorkie and traced back to a shop, Mary’s House, owned by Tony Gauci, who held a unique standing order supplied by Yorkie. During police interviews, Gauci was uncertain about the identity of the purchaser and gave contradictory statements about the purchaser’s age and appearance. Gauci was also unclear as to the precise date the clothes were purchased. 38 As was proved in court, al-Megrahi was in Malta only on December 7. Placing him in Malta on that precise day became a prosecutorial imperative. Unfortunately, Tony Gauci’s testimony created doubts as to the exact day the clothes from his shop were purchased. Gauci testified that the day the clothes were purchased, the Christmas lights in Malta were not on when al-Megrahi visited the shop, and he was unsure whether it was raining when the purchase was made. Subsequent inquiries revealed that the Christmas lights were in fact on, on December 6. 39 This inconsistent testimony by Tony Gauci makes alMegrahi’s purchase of the children’s clothes found in the baggage on December 7 impossible. Further complicating this contradictory testimony is the fact that Scottish police failed to disclose to the defense additional witness testimony placing Libyan men of a different physical description making a purchase of children’s clothes on a different day at Gauci’s shop. An additional disclosure failure by the prosecution, further undermining the credibility of the criminal investigation, was an official report that stated that on April 9, 1999, four days before Gauci identified al-Megrahi in a lineup, Gauci claimed to have seen a picture of al-Megrahi in a magazine article that connected him to the bombing. 40 This prior exposure to al-Megrahi’s image in connection with the bombing created the potential for prejudice and distortion of a witness’s objective ability to identify a suspect, a disclosure that legally should have been divulged to the defense. When asked during trial whether Gauci could identify the purchaser of the children’s clothes at his shop, he identified al-Megrahi stating, “He’s the man on the side. He resembles him a lot.” 41

42

CHA P TER 2

Several years after the trial, Lord Advocate Lord Fraser of Carmyllie referred to Tony Gauci as “not quite the full shilling.” 42 This brand of criticism would continue unabated for years by other members of the Lockerbie prosecution team, as well as family members of Flight 103, who continue to express sincere reservations as to the true culprits of the crime. Professor Robert Black, a prominent scholar of Scottish law who designed the nonjury trial system that Gadhafi ultimately acquiesced to, referred to al-Megrahi’s conviction as “the most disgraceful miscarriage of justice in Scotland for 100 years.” 43 Further improprieties regarding the handling and maintaining of evidence further underscore Professor Black’s misgivings. Mebo Mebo (a contraction of Meister and Bollier), a Swiss manufacturer of circuit boards, became a provider of critical evidence at the trial, which ultimately led to al-Megrahi’s conviction, but also furnished the basis for subsequent appeals and increasing scrutiny of the validity of evidence and potential tampering. In January of 1989, a scorched shirt collar was discovered by investigators in the field of debris where most of the cargo container identified as holding the bomb that destroyed Flight 103 was found. Investigators were able to extract shards of a Toshiba radio and pieces of the circuit board that were embedded in the collar. Scottish police were unable to identify the origin of the circuit board, labeled as evidence item PT/35B. However, in June 1990 the CIA and FBI matched the circuit board to a timer, allegedly used previously during the coup attempt in West Africa, that was being held in the CIA archives. 44 It was asserted by the FBI that PT/35B was part of an MST-13 timer unit, a part that could be specifically sourced to a customized Mebo contract with the Libyan military. 45 Shortly thereafter, al-Megrahi, who had served previously as a Tripoli airport control manager also assigned to Libyan intelligence, began to fall under suspicion. Mebo, cooperating with the joint investigation by the CIA and FBI, provided control samples from original circuit boards that had been manufactured by a subcontracting company named Thuring. 46 At the trial, expert technical witnesses would claim that the Thuring samples were indistinguishable from those found in the debris of Flight 103. The veracity of this testimony would later be called into question.

GE N E S, M E DI A, AN D T H E GOVERNMENT

43

At the trial, employee Ulrich Lumpert positively identified the fragment of the circuit board as identical to those supplied to the Libyan military. However, Edwin Bollier testified that Scottish police had shown him a fragment of a brown eight-ply circuit board, which had never been supplied to Libya, but then during trial was asked to identify the green nine-ply circuit board that Mebo had in fact supplied to Libya. 47 This inconsistent presentation of evidence was an avenue of discrepancy that Bollier attempted to address during his testimony but was prevented from doing by trial judge Lord Sutherland. In 1991 he would later publicly state that he was offered $4 million from the FBI to testify that the fragment of circuit board recovered from the Flight 103 crash site was part of an MST-13 timer manufactured exclusively for Libya. 48 Providing further damage to the collective testimony of Mebo employees, on July 18, 2007, Ulrich confessed to perjuring himself at trial. In a sworn statement, Ulrich admitted to stealing an MST-13 circuit board from Mebo and supplying it to “an official person investigating the Lockerbie case.” 49 Referring to the FBI’s investigation of the crash, former FBI scientist Fred Whitehurst referred to the FBI laboratory that conducted the investigation as itself a “crime scene.” 50 Not only had scientific reports regarding the circuit board fragments been altered but the fragments themselves had never been forensically tested for explosives. Thomas Thurman, the leader of the forensic investigation into the crash of Flight 103, conceded that it was the “only real piece of evidence against Libya.” 51 Notwithstanding contradictory testimony and questionable evidence, the judges at Camp Zeist on January 31, 2001, announced their verdict. “There is nothing in the evidence which leaves us with any reasonable doubt as to the guilt of the first accused and accordingly we find him guilty of the remaining charges in the indictment as amended.” 52 AlMegrahi was sentenced to life in prison, while his codefendant was found not guilty and released. Without the stolen timer, al-Megrahi would likely have enjoyed the same results as his codefendant, as FBI task force chief Richard Marquise said later, “It would be a very difficult case to prove (without the timer). . . . I don’t think we would ever have had an indictment.” 53

44

CHA P TER 2

Postconviction Process In 2001, shortly after his conviction, al-Megrahi was transferred to Barlinnie Prison, and then in February 2005 to Greenock Prison where he began a protracted process of judicial appeal. On March 14, 2002, judges at Camp Zeist denied all of al-Megrahi’s grounds for appeal. 54 On September 23, 2003, al-Megrahi applied to the Scottish Criminal Cases Review Commission, arguing that his conviction was the result of a miscarriage of justice. 55 On June 28, 2007, the review commission concurred with al-Megrahi’s assertion, granting al-Megrahi leave to appeal his conviction. 56 The claims that al-Megrahi alleged in his appeal included failure of the prosecution to disclose relevant evidence related to witness testimony and evidence collection, payments received by witnesses to secure their testimony, and the theft of sample evidence later purported to be actual evidence during the trial. However, before the merits of al-Megrahi’s appeal were to be considered, medical circumstances intervened. On September 23, 2008, al-Megrahi was diagnosed with prostate cancer and on December 19 an online petition was circulated seeking compassionate release for al-Megrahi, based upon his terminal illness. 57 On August 4, 2009, the Cabinet Secretary for Justice in Scotland, Kenny McCaskill, heard al-Megrahi’s appeal for compassionate release in Greenock Prison. This appeal was supported not only by oncologists who examined and treated al-Megrahi but also by Scottish politicians, such as Tam Dalyell, who referred to al-Megrahi as a scapegoat and victim of a miscarriage of justice, and also by Nelson Mandela and the Church of Scotland, who were unified in their call for compassionate release. 58 On August 20, 2009, McCaskill announced that he would grant release on passionate grounds, citing al-Megrahi’s imminent death from prostate cancer, the prediction based on a medical report to the justice secretary conducted by Dr. Andrew Fraser (supplemented by medical assessments conducted by three prominent oncologists hired by Libyan authorities). Following this announcement, al-Megrahi boarded a chartered flight to Tripoli where he was welcomed back to Libya, as the U.S. press corps referred to it, “as a hero.” 59 Al-Megrahi subsequently died on May 20, 2012, at the age of sixty in Tripoli, Libya, finally succumbing to complications of prostate cancer.

GE N E S, M E DI A, AN D T H E GOVERNMENT

45

CASE ANALYSIS Political Analysis of Statements, Issue Framing, and the Media In the months and years following the Flight 103 bombing, U.S. politicians proactively responded to shifts in political imperatives by evolving a fluid issue-framing narrative that, with the complicit assistance of U.S. media outlets, allowed U.S. politicians to effectively shape perceptions of the Pan Am bombing to suit contemporary political expediencies. As the following segment will amply demonstrate, news media had assumed the role of information propagators for the sitting administration, eagerly bending to the will of White House or State Department issue framers. As the following analysis will indicate, the public responds in predictable ways to the contrived messaging advanced by administration and media; inferential assumptions based upon genetic predispositions discussed earlier in the chapter will be further bolstered by polling data that reaffirms this hypothesis. Upon his arrival in Tripoli following his compassionate release, alMegrahi was excoriated in the U.S. media as having received a “hero’s welcome.” 60 U.S. politicians were quick to roundly criticize the al-Megrahi release, expressing anger and dismay in equal measure. President Obama weighed in early on the controversy stating, “I think all of us here in the United States were surprised, disappointed and angry about the release.” 61 U.S. Secretary of State Hillary Clinton referred to the judgment as “absolutely wrong,” while Attorney General Eric Holder opined that there was “no justification for releasing this convicted terrorist whose actions took the lives of 270 individuals.” 62 Robert Mueller, the FBI director who had undertaken the role of chief investigator of the Flight 103 bombing, said he was “outraged by this decision, blithely defended on the grounds of compassion” which was “detrimental to the cause of justice.” 63 Taking their cue from the administration, op-ed columns across the country resounded with indignation. A salvo in the New York Times accused Scotland of opening old wounds, stating that “for many Americans his release rekindled the agony and anguish of loss and provoked questions about the notions of compassion and justice used by Scotland to justify its decision.” 64 The Los Angeles Times was equally chastising, stating that “McCaskill’s blinkered interpretation of compassion took no

46

CHA P TER 2

account of the enormity of Megrahi’s crime or his refusal to acknowledge his guilt.” 65 Upon the heels of this coordinated barrage of political and media disapproval, American citizens began to weigh in. Citizens were “outraged and dismayed,” calling al-Megrahi’s compassionate release “an absolutely disgusting disgrace.” 66 Unfortunately, the issue-framing position adopted by the current administration and popular mass media is in stark departure from the message framing twenty years earlier, shortly after the bombing of Flight 103. It was largely believed in the media and U.S. and UK intelligence communities, as well as shared by executive administrations, that the bombing of Flight 103 was retaliatory in nature. Several months before the Pan Am flight on July 3, 1988, the U.S.S. Vincennes, the missile cruiser stationed in the Persian Gulf assisting Saddam Hussein in his conflict with Iran, shot down Iranian Air Flight 655, killing 290 civilians. 67 The captain of that naval vessel, Will Rogers, returned to the United States several months later and was hailed as a hero in the media. The New York Times headline proclaims, “For Crew of Cruiser that Downed Iranian Airliner It’s a Warm Homecoming”; indeed, Rogers was awarded the Legion of Merit for the destruction of the civilian airliner. 68 Almost six months later, Pan Am 103 was destroyed over Lockerbie, and U.S. officials quickly deduced Iranian organization and financing. In a leaked memo from the U.S. Defense Intelligence Agency, officials stated that the bombing was “devised, authorized and financed” by an Iranian interior minister, in an operation contracted out to the Popular Front for the Liberation of Palestine (PFLP) General Command for a price of $1 million. 69 This conclusion was bolstered by a concurrent German investigation that discovered that the PFLP was involved in previous similar attacks and had been observed by intelligence agents scouting the Frankfurt airport prior to the bombing. 70 Corporate media outlets in the United States, including the Washington Post, New York Times, and Wall Street Journal, repeatedly echoed these administration conclusions. But the political winds began to change. The PFLP was headquartered in Syria, which became critical in the negotiation of the release of U.S. hostages in Lebanon, and Iran began to play a pivotal part in assisting with the Gulf War against Iraq in the early 1990s. According to journalist Paul Foot, “The evidence against the PFLP which has been carefully put together . . . was quietly but firmly junked.” 71 The CIA sought a new villain for the focus of the investigation, quickly arriving at Colonel

GE N E S, M E DI A, AN D T H E GOVERNMENT

47

Moammar Gaddafi; the CIA quickly recalibrated witness testimony and manufactured new evidence and gradually shifted the issue-framing narrative. The media in the United States compliantly obeyed. Although media in the United States treated al-Megrahi’s ultimate conviction in 2001 with obsequious deference and solemn concurrence with the judgment of the court, other news outlets across the world gave voice to unsubtle criticism. The Scotsman and BBC News both interviewed expert observers, who referred to the conviction as “totally incomprehensible” and “the most disgraceful miscarriage of justice.” 72 Upon al-Magrehi’s release, media in the United States was possessed of an unbridled interest in the suffering of the victims’ families, and none of the media revisited the merits of the case, problems with evidence, or grounds for appeal or for legitimate claims of innocence.

PSYCHOLOGICAL-BIOPOLITICAL RESPONSE AND POTENTIAL FOR COGNITIVE DISSONANCE As the neuroscience research discussed previously strongly suggests, cognitive responses to threats can be largely based on illusory correlations drawn from the false perception of causal relationships; these cognitive responses themselves are predicated upon a genetically oriented locus of control, which skews our ability to assess threats and essentially divides us into two distinct political camps, conservatives or progressives. This collective, but bifurcated, compass of ideological orientation serves as a psychological lodestone, accurately predicting to which political pole our thoughts will gravitate. As the al-Megrahi case above demonstrates, the government acting in tandem with media can craft an issueframed messaging apparatus that can effectively reverse the polarity of ideology by playing to those genetically encoded response systems. These heritable systems that determine cognitive responses to threats can be predictably massaged to elicit false-positives and create a basis for perceived patterns of behavior that are nonexistent, patterns that can create cognitive errors that media and the government, acting in concert by manipulating issue frames, can exploit to appeal to individual predispositions to making certain errors and manipulate preferences to suit political need. The al-Megrahi case illustrates how genetic factors influence perceptions of threat and can cause people to act irrationally, disre-

48

CHA P TER 2

garding facts to reject incontrovertible truths. Issue framing of propaganda by government and media is used to induce false-positive errors by making use of genetically coded systems of primitive defense that inspire primordial trepidation and fear to impel the rejection of prudent policy preferences. In al-Megrahi’s case, the political expedient of recruiting Iran and Syria into another war with Iraq (which was itself based upon disinformation, as will be discussed in chapters subsequently) was paramount to serving the interests of justice and an innocent man vilified and perpetrators allowed to remain free and concomitantly perverting the very definition of justice. This perversion was possible through a genetically compliant populace, an unscrupulous media focused on ratings, and a government interested in pursuing policy irrespective of the moral outcome. These media frames can conflict and create cognitive dissonance in the minds of voters, 82 percent of whom, according to a Rasmussen poll, disagreed with al-Megrahi’s compassionate release (with 63 percent following al-Megrahi’s case and only 10 percent disagreeing), 73 which leads to further distrust of intellectual explanations, driving more people to further trust their instincts instead of malleable facts that may ostensibly change, should the facts become politically inconvenient. This erosion of confidence in government and trust in the balance of power promotes anarchical thought in which conspiracy theories thrive and prosper. In the following comparative cross-case analysis, the Posada case illustrates how this distrust of power, coupled with the government’s discursive use of the facts and abetted by the agency of a complicit media, can result in torturous logical language to justify paradoxical policies that an otherwise well informed public would adamantly disagree with.

COMPARATIVE CROSS CASE ANALYSIS The following analysis, involving the case of Luis Posada Carriles, illustrates the dual nature in which government issue framing, operating in tandem with media, can starkly depart from well-established policy messaging and create cognitive dissonance. The Posada case demonstrates how American vested interests largely determine policy preferences, and, although ideological messaging is couched in normative terms, these contradictory messages can ultimately create cognitive dissonance in the minds of American citizens. As we will see in the Posada case, legal and

GE N E S, M E DI A, AN D T H E GOVERNMENT

49

logical inconsistencies only become reconcilable through tortured logic and facile distinctions that ultimately undermine the credibility of both the government and media. This comparative analysis will examine how the government attempts to square this awkward circle, how the media in the main abet this contradictory messaging, and how the people respond to this strategic and rhetorical divergence from prior policy. As with the primary case above, statements from politicians, media members, and the public will be interpreted and polling statistics used as quantitative indicia of support. Posada was born in Cuba in 1928, studied chemistry at the University of Havana, and eventually worked at the Firestone Tire and Rubber Company. 74 Opposing the Cuban revolution of 1959 led by Fidel Castro, upon Castro’s rise to power Posada was a prisoner in a military detention camp before seeking political asylum in Mexico. 75 By 1961 Posada had sought refuge in the United States where he received training by the CIA, joined their Brigade 2506, and aided in orchestrating the failed invasion of Cuba at the Bay of Pigs. Following the debacle at the Bay of Pigs, Posada continued to train with the CIA, learning tactics in sabotage and explosives at the U.S. Army’s Fort Benning between March 1963 and March 1964, where he graduated as a second lieutenant commanding officer in a Ranger Battalion. 76 Having received special training in demolition skills and clandestine and guerrilla warfare, he came into the employ of the CIA as an asset and later informer, becoming deeply involved in a number of CIA covert actions. 77 Posada’s role in the CIA, exhaustively substantiated by declassified documents from both the FBI and the CIA, revolved around training insurrectionist groups to infiltrate Cuba as well as other Latin American countries to create political instability. This treasure trove of documents, discussed in detail below, outlines how Posada was involved in planning and organizing political assassinations, acts of terrorism, drugs and arms smuggling, and the orchestration of political coups as well as showing his responsibility for the bombing of Cubana Airlines Flight 455, the only midflight terrorist bombing in history to occur in the Western Hemisphere, which took the lives of 73 passengers. Notwithstanding the fact of these wanton acts of political violence and organized crime (the veracity of which have been corroborated by intelligence sources within the United States as well as by brazen admissions by Posada himself), through political maneuvering Posada has never been held accountable by the

50

CHA P TER 2

U.S. government and, by means of political posturing, has been hailed a hero and a freedom fighter in many precincts of the political conservative movement in the United States. This narrative has been largely reinforced by the media, with some notable exceptions. The details of Posada’s career at the CIA can be found in declassified CIA and FBI reports compiled in an online repository by the National Security Archive at George Washington University. 78 Several of Posada’s earliest terrorist plots, which occurred while Posada was on the CIA payroll in the mid-1960s, involved acts of sabotage and explosives. On July 7, 1965, an FBI report titled “Intention of Cuban Representative in Exile to Blow up a Cuban or Soviet Vessel in Veracruz, Mexico” summarized intelligence that stated that Luis Posada had received funding from outside the CIA to sabotage ships in Mexico and that “100 pounds of C-4 explosives and detonators” had been acquired by Posada to fulfill the mission. 79 On July 13, 1965, FBI cable reports, acquired from the CIA, indicated that a number of terrorist operations, including the bombing of a Soviet library in Mexico City, had been documented and that they involved Posada. 80 On May 17, 1965, FBI documents connected Posada in a plot to unseat the Guatemalan government and reported that U.S. Customs agents forced Posada to surrender a cache of weapons, including explosives and napalm. 81 On October 7, 1976, a secret intelligence report titled “Suspected Bombing of Cubana Airlines DC-8 near Barbados” indicated that a CIA agent in Venezuela interviewed a confidential source, who identified Posada as responsible for the bombing, and stated that “the source all but admitted that Posada and [Orlando] Boesch had engineered the bombing of the airline.” 82 An FBI report dated November 2, 1976, “Bombing of Cubana Airlines DC 8 near Barbados West Indies October 6, 1976,” stated that the CIA interviewed an informant, known as Monkey Morales, who detailed two meetings in which planning for the bomb attack took place, both of which Posada attended. 83 The report quoted Morales as saying, “Some people in the Venezuelan government are involved in this airplane bombing” and also quoted Morales as saying that, after the Cuban jetliner was bombed, one of the perpetrators called co-conspirator Boesch and stated that “a bus with 73 dogs went off a cliff and all got killed.” 84 Orlando Boesch and Posada, often cited in CIA reports as close associates and co-conspirators, were acquainted through several different organizations. In 1968, the CIA began to suspect Posada was involved in

GE N E S, M E DI A, AN D T H E GOVERNMENT

51

cocaine trafficking and questioned Posada on his “unreported association with gangster elements.” 85 Posada subsequently moved to Venezuela (reportedly carrying CIA weapons including grenade fuses) and assumed the role of Chief of Operations for the Venezuelan Directorate of Services for Intelligence and Prevention, or DISIP. 86 Boesch, living in Venezuela, also vehemently opposed to Castro’s communist rule of Cuba, had been recently released from prison after serving five years for a bazooka attack on a Polish ship bound for Cuba. In 1976, on July 11, Posada and Boesch attended a meeting in Santo Domingo where a number of anti-Castro splinter organizations coalesced into the Coordination of United Revolutionary Organizations (CORU). 87 Shortly after their inaugural convention on September 21, 1976, a car-bomb assassination in Washington, D.C., killed Chilean human rights activist Orlando Letelier. CORU is widely believed to have plotted the assassination, with a CIA report quoting Boesch as boasting, “Now that our organization has come out of the Letelier job looking good, we are going to try something else.” 88 This report was overheard by a CIA informant who had attended a $1,000-aplate fundraiser to support the activities of CORU in Caracas. The money was put to immediate use. Several weeks later on October 6, 1976, two bombs were detonated in the lavatory of Cubana Airlines Flight 455, which crashed into the Caribbean a few minutes later, killing all passengers on board. Many of the passengers killed were some of the most talented athletes in the Caribbean, many of them teenagers. Twentyfour members of the Cuban Olympic fencing team were killed, which had recently competed and received all gold medals in a Central American and Caribbean championship. In recorded interrogations obtained by the FBI of two suspects later arrested by Venezuelan authorities revealed that a tube of Colgate toothpaste packed with plastic explosives was attached to a detonator and left on the plane during a stopover in Barbados. 89 The two men, who delivered sworn affidavits, Hernan Lozando and Freddie Lugo, claimed to have been paid a total of $24,000 to plant the explosive device on Flight 455. 90 The suspects quickly implicated Posada; it was later determined that both were employed by Posada’s Venezuelan investigation company as photographers. In a U.S. State Department Bureau of Intelligence and Research report to U. S. Secretary of State Henry Kissinger, the CIA had reported that a source in Venezuela had divulged an overheard conversation with Posada, who reportedly said, “We’re going to hit a Cuban airplane” and “Or-

52

CHA P TER 2

lando has the details.” 91 This conversation was reported to have occurred days before the plane was bombed. Shortly after the attack, both Boesch and Posada were arrested for the bombing. Posada escaped from prison in 1985, and Boesch was released in 1987 and returned to the United States illegally. Boesch was detained by authorities for immigration charges and was set to be deported. However, through the direct intervention of Jeb Bush, Boesch received a reprieve that allowed him to remain in the United States and was issued an administrative pardon in 1990 by President Bush, 92 despite the U.S. Department of Justice adamantly rejecting this petition, stating that Boesch had been “resolute and unwavering in his advocacy of terrorist violence.” 93 Posada’s life after the Flight 455 bombing was also to be marked by a lack of accountability, facilitated covertly by the United States government and aided by complicit media. After Posada escaped from Venezuela (CIA reports indicate Posada bribed his way out of prison), on August 18, 1985, fifteen days later, he was aboard a shrimp boat headed to Aruba. From Aruba he boarded an airplane to Costa Rica before relocating to El Salvador where he became engaged by the CIA once more in the illegal war against the Sandinistas in Nicaragua, later referred to in congressional investigations as the “Contra Wars,” or alternately, the “Iran Contra” scandal. 94 In Nicaragua, Posada (using the alias Ramon Medina) served as deputy to Felix Rodriguez, the CIA operative responsible for the assassination of Che Guevara in 1967. 95 Posada was on the CIA payroll earning $3,000 a month to coordinate the airlift of military arms and supplies, for Colonel Oliver North, to the Contras, a paramilitary organization backed by the Reagan administration, which opposed the leftwing Sandinista government. 96 However, Posada’s presence in Nicaragua did not go unnoticed, and when an arms supply flight was shot down, which had a U.S. Contra operative on board, the involvement of Posada and Rodriguez became public. His presence drawing undue publicity, Posada worked for several years in San Salvador as an advisor to the police force before moving on to Guatemala, becoming the leader of the secret intelligence agency for the Guatemalan president. In this new role, he coordinated a spy operation that included “the most sophisticated surveillance equipment in the government.” 97 This role proved incredibly dangerous, and on February 26, 1990, Posada was shot while sitting in his car in Guatemala City. 98 Posada believed Cuban agents were behind the attack, and after his hospi-

GE N E S, M E DI A, AN D T H E GOVERNMENT

53

talization (his medical bills paid by U.S. Maj. Gen. Richard Secord, according to Posada’s memoirs), Posada disappeared. 99 Posada resurfaced in 1997 when CIA reports implicated him in a series of terrorist bombings in Cuba that left eleven Cubans wounded and one Italian, Fabio Dicelmo, dead. In a 1998 taped interview with Anna Louise Bardach, Posada stated, “The Italian was in the wrong place at the wrong time, but I sleep like a baby.” 100 On November 17, 2000, Posada was arrested for plotting the assassination of Fidel Castro and was found in possession of two hundred pounds of explosives. 101 Upon discovering the plot Castro, who had not visited the country since 1959, described Posada on television as “a cowardly man totally without scruples.” 102 However, in August 2004 outgoing Panamanian president Moscoso issued a pardon for Posada, rejecting accusations that the Bush administration had pressured her to release Posada, instead arguing, “I knew that if these men stayed here they would be extradited to Cuba and Venezuela, and there they were surely going to kill them there.” 103 Ironically, at the time of her statement, the most egregious acts of torture being committed in Cuba were arguably occurring in Guantanamo Bay, under the auspices and supervision of the American military and CIA. Although the U.S. government declined to condemn the actions of Posada, it was widely believed in the Latin world that the pardon was politically motivated. Julia Sweig, an expert on Cuba, stated that the pardon “reeks of political and diplomatic cronyism.” 104 Following the pardon, Venezuela and Cuba immediately severed all diplomatic ties with Panama. The United States, for its part, stridently objected to any insinuation that political pressure had been brought to bear to influence the outcome of Posada’s case. According to State Department spokesman Adam Ereli, “We never lobbied the Panamanian government to pardon anyone involved in this case, and leave it to the government of Panama to discuss the action.” 105 The avowed absence of U.S. influence became subsequently suspect when a recorded cell phone message, from the Panamanian president to the U.S. ambassador to Panama, was leaked to the press. The president is heard to say, “Ambassador, good morning. This is the president to inform you that the four Cubans were already pardoned last night and have left the country, three are on their way to Miami and the other, well, in an unknown direction. Goodbye. A hug.” 106

54

CHA P TER 2

In 2005 Posada submitted a petition seeking political asylum in the United States. On May 3 the Venezuelan Supreme Court requested that the United States extradite Posada to face criminal charges related to the Cuban airliner bombing. 107 On May 17, it was reported in the Miami Herald that Posada had been detained by the Department of Homeland Security for immigration violations related to alleged lies told to immigration officers regarding his role in the attacks on hotels, bars, and restaurants in the Havana area, as well as perjury charges related to statements made about his precise method of entry into the United States. 108 His presence in the United States was immediately denounced by Cuban President Fidel Castro, who led hundreds of thousands of Cubans to a U.S. diplomatic office in Havana, demanding that the United States extradite Posada. 109 In his speech, Castro pointedly accused the United States of subjecting Cuba to decades of terrorism, arguing that anti-Cuban terrorists such as Posada “always acted under the orders of the government and special services of the United States” and that the bombing committed by Posada was “financed by U.S. government” through the intermediary Cuban American National Foundation established by U.S. president Ronald Reagan in 1981. 110 This speech was greeted by raucous chants among those in the crowd, who repeatedly shouted, “Bush, you fascist, capture the terrorist.” 111 As noted above, on September 28, 2005, the U.S. immigration-court judge ruled that Posada was not subject to extradition, on the grounds that he could face torture or execution in either Venezuela or Cuba. 112 Venezuelan and Cuban authorities immediately denounced what they couched as U.S. hypocrisy in prosecuting the war on terror and pursuing the Bush Doctrine by conducting unapologetic preemptive attacks on sovereign nations that dared to harbor terrorists. “Let’s see if a country that invades others, that bombs cities in Iraq and Afghanistan, grants asylum to this terrorist,” said Venezuelan president Hugo Chavez. 113 Even more trenchantly, Max Lesnik, leader of Alianza Martiana, a pro-Castro CubanAmerican organization, said in a news conference, “Imagine Osama bin Laden saying he is in [the Miami suburb of] Hialeah, and he is going to place an asylum claim.” 114 Many observers considered the refusal to extradite Posada as a violation of UN Security Council Resolution 1373 of September 2001, which states that countries are not permitted to grant safe haven to any persons involved in past or present terrorist activities. In October of 2005, in the

GE N E S, M E DI A, AN D T H E GOVERNMENT

55

final declaration of the XV Ibero-American Summit in Salamanca, the demand was made to “extradite or judge the man responsible for the terrorist blowing up of a plane of Cubana aviation in October 1976, which caused the death of 73 innocent civilians.” 115 On April 19, 2007, Posada was released on bail, escorted to Miami, and placed on house arrest pending trial. On May 8, 2007, U.S. District Judge Kathleen Cardone dismissed all immigration charges and lambasted U.S. immigration officers for “fraud, deceit and trickery” in conducting Posada’s immigration interview. 116 This ruling was overturned by the Fifth Circuit Court of Appeals, which insisted that Posada be tried for immigration violations and added an additional charge of obstruction of a U.S. investigation into “international terrorism.” 117 Posada was not charged in the Cuban airliner bombing. During Posada’s trial, his defense attorneys painted a very patriotic public image of Posada as a freedom fighter and a defender of American liberties against the threat of communism. Felipe Millan, Posada’s defense counsel, rhetorically asks, “How can you call someone a terrorist who allegedly committed acts on your behalf?” 118 According to Mr. Millan, referring to the violent acts committed by Posada to stem the menacing tide of encroaching communism as terrorism “would be the equivalent of calling Patrick Henry or Paul Revere or Benjamin Franklin a terrorist.” 119 Legal motions submitted by Posada disclose a more insidious trial tactic: “The defendant’s CIA relationship, stemming from his work against the Castro regime through his anti-Communist activities in Venezuela and Central America, are relevant and admissible to his defense.” 120 Posada’s motions to compel production of evidence further compelled the court to instruct the government to declassify documents that would demonstrate the “involvement, knowledge, acquiescence and complicity [of the US government] in sabotage or bombings in Cuba,” as well as any “documents reflecting orders to the defendant to maintain secrecy not to disclose his relationship or information regarding his activities on behalf of the US government or any of its agencies.” 121 The brazen threat to expose classified information related to past CIA covert actions in South and Central America in which Posada was directly involved and the United States directly complicit was a shrewd legal strategy that ultimately paid dividends. Posada was found not guilty on all charges and released. “What happened here should serve as an example

56

CHA P TER 2

for justice in my country, Cuba, which is unfortunately in the hands of a dictator,” Posada said upon his release. 122

CROSS CASE ANALYSIS One who shelters a terrorist, is a terrorist. —President George W. Bush

The Posada case exemplifies the theory that policy choices shaped by fear of the communist threat to the United States government can supersede terrorist threats posed by others (particularly Cuban nationals) and exemplifies how terrorism is contextualized and reinterpreted against others we don’t like by rationalizing behavior as laudable simply because it was committed in the service of a self-perceived noble cause. In a Bendixen poll of Cuban Americans, 60 percent held a positive view of Posada, even after evidence of the bombing was widely distributed among Cuban communities in America, with one respondent saying of Posada, “This gentleman is a fighter. I do not believe he is a saint, but I also do not believe he is a terrorist.” 123 The cognitive inability to intellectually maintain two disparate and competing ideas simultaneously is a definitive trait of cognitive dissonance (the ability being absent in conservatively oriented individuals, who notably possess an external locus of control) and is clearly in evidence in the response to allegations against Posada. Much as the term “torture” was redefined under the Bush administration and words such as “waterboarding” were subsumed in the lexicon as “aggressive interrogation” and political kidnapping as “extraordinary rendition,” terrorist acts committed against perceived enemies are recouched and dismissed as unimportant, or alternately, justified as warranted action against dictators by “freedom fighters.” The rationalization employs an inconsistent logic that rejects the dispassionate imposition of judicial principles in favor of an arbitrary system that applies an ad hoc legal standard based on political or economic interests, devalues and undermines basic tenets of judicial fairness and erodes confidence in the law, and diminishes the government’s ability to equitably enforce policy. This capricious approach to foreign affairs also irreparably damages U.S. interests abroad and undermines U.S. ability to project an image as a bastion of democracy that is accountable to an educated citizenry. Rather, it projects an image of a citizenry enraptured by delusional passions,

GE N E S, M E DI A, AN D T H E GOVERNMENT

57

fomented by false information provided by government, and inflamed by rhetoric delivered by a media dominated by a class of professional political pundits (as opposed to journalists) that has suspended its ability to cast a critical pessimistic eye on information and vet facts with circumspection but instead responds to cleverly disguised cues that appeal directly to a baser visceral instinct, genetic in origin and reactionary in nature. Conducting good-faith diplomacy with a powerful nation that is acting irresponsibly and undemocratically entails certain risks that many may prefer to forgo and effectively denies America the option of exercising intelligent diplomacy. Concerning the precarious position America occupies at present, regarding its power and prestige in the face of global criticism of the prosecution of its “war on terror,” the Iranian poet Rumi wrote presciently, “Step away from the edge of the roof, you are drunk, and quickly approaching the end.”

NOTES 1. The concept of patternicity was conceived and pioneered by Michael Shermer in his seminal work, The Believing Brain, cited above. 2. Shermer, p. 62. 3. Shermer, pp. 67–71. 4. Ibid. 5. Catania, A. C. and Cutts, D. “Experimental control of superstitious responding in humans,” Journal of the Experimental Analysis of Behavior 6 (1963): 203–8, as cited in Shermer, p. 67. 6. Interview with Whitson in Shermer, p. 81. 7. Ibid. 8. Ibid. 9. Entman, Robert, “Cascading Activation: Contesting the White House’s Frame After 9/11,” Political Communication 20 (2003): 415–32. 10. Lewis, Seth and Reese, Stephen, “Framing the War on Terror: The Internalization of Policy in the US Press,” Journalism, Sage Publication 10, no. 6 (2009): 777–97, DOI: 10.1177/1464884909344480. 11. Ibid. 12. Ibid. 13. Lewis, Seth and Reese, Stephen, "What Is the War on Terror? Framing Through the Eyes of Journalists," J&MC Quarterly 86, no. 1, (Spring 2009): 85–102. 14. Ibid.

58

CHA P TER 2

15. Ibid. 16. Impromptu speech given at ground zero available online at: http://transcripts.cnn.com/TRANSCRIPTS/0109/14/se.55.html. 17. Ibid. 18. Ibid. 19. Altheide, David L., Terror Post 9/11 and the Media. New York: Peter Lang (2009). 20. Ibid. 21. Nacos, Brigitte, Mass-Mediated Terrorism: The Central Role of the Media in Terrorism and Counterterrorism. Lanham, MD: Rowman and Littlefield (2002). 22. Seib, Philip and Janbek, Dana M., Global Terrorism and New Media. London: Routledge (2001). 23. “Report on the Accident to Boeing 747-121, N739PA at Lockerbie, Dumfriesshire, Scotland on 21 December 1988” (PDF), at http://www.aaib.gov.uk/ cms_resources/dft_avsafety_pdf_503156.pdf, retrieved March 4, 2014 . 24. Report No: 2/1990—“Report on the Accident to Boeing 747-121, N739PA, at Lockerbie, Dumfriesshire, Scotland on December 21, 1988,” archived at http://www.aaib.gov.uk/publications/formal_reports/ 2_1990_n739pa.cfm, retrieved on March 4, 2014. 25. Ibid. 26. Ibid. 27. Ibid. 28. Ibid. 29. Ibid. 30. Ibid. 31. Ibid. 32. Ibid. 33. Townsend, Mark, “Evidence Casts Fresh Doubt on Who Brought Down Flight 103,” The Observer, June 17, 2007, archived at http:// www.theguardian.com/uk/2007/jun/17/politics.lockerbie1, retrieved March 5, 2014. 34. Fitzgerald, Alastair, Air Crash Investigations: Lockerbie, the Bombing of Pan-Am Flight 103, Lulu.com Publishing (2006). 35. Ibid. 36. Ibid. 37. Ibid. 38. Loftus, Elizabeth, “Eyewitness Testimony in the Lockerbie Bombing Case, Memory 21, no. 5 (2013): 584–90. 39. Ibid. 40. Ibid.

GE N E S, M E DI A, AN D T H E GOVERNMENT

59

41. Ibid. 42. Roy, Kenneth, “Lord Fraser and the Unanswered Questions,” Scottish Review (June 25, 2013). 43. Goodenough, Patrick, “Lockerbie May Prove Uncomfortable for Obama Administration,” CNSNews, archived at http://cnsnews.com/news/article/lockerbie-probe-may-prove-uncomfortable-obama-administration, retrieved on March 6, 2014. 44. Fitzgerald, pp. 228–34. 45. Ibid. 46. Ibid. 47. Ibid. 48. Ibid. 49. Ibid. 50. Ibid. 51. Ibid. 52. “What the Judges Said,” BBC News, January 31, 2001, archived at http:// news.bbc.co.uk/2/hi/1146642.stm, retrieved on March 7, 2014. 53. Fitzgerald, p. 231. 54. “News Release: Abdelbaset Ali Mohmed Al Megrahi.” Scottish Criminal Cases Review Commission. June 28, 2007, retrieved March 8, 2014. 55. “14 Days to Launch Appeal.” BBC News. March 14, 2002, retrieved March 8, 2014. 56. “Lockerbie Bomber in Fresh Appeal.” BBC News. October 11, 2007, retrieved March 8, 2014. 57. “Abdelbaset al-Megrahi Dead: A Timeline of the Lockerbie Case,” The Independent, May 20, 2012, retrieved April 9, 2014. 58. Dalyell, Tom, “The Lockerbie Scapegoat,” The Spectator, August 15, 2002, retrieved April 9, 2014. 59. McDonald, Alistair, “Lockerbie Bomber Megrahi Is Dead at 60: Prostate Cancer Claims Only Person Convicted in Deadly Jet Attack, Nearly Three Years After Early Release From Prison,” Wall Street Journal, May 20, 2012, retrieved April 9, 2014. 60. Ibid. 61. Winnett, Robert, “David Cameron Orders Release of Secret Lockerbie Bomber Documents.” Daily Telegraph (London). Archived from the original on August 11, 2010, retrieved April 9, 2014. 62. The Lockerbie Case: A commentary on the case of Abdelbaset al-Megrahi, convicted of the murder of 270 people in the Pan Am 103 disaster, compiled from The Herald and archived at http://lockerbiecase.blogspot.com/2009/08/media-reaction-to-abandonment-of-appeal.html, retrieved on April 9, 2014.

60

CHA P TER 2

63. “The Full Letter from the FBI Director on the Lockerbie Bomber Release.” Daily Telegraph (London). August 2, 2009, retrieved April 9, 2014. 64. Burns, John F. “Abdel Basset Ali al-Megrahi.” New York Times, retrieved April 9, 2014. 65. “Lockerbie Terrorist’s Release Is an Ugly Act of ‘Mercy.’” Los Angeles Times. August 21, 2009, retrieved April 9, 2014. 66. “Terminally Ill Lockerbie Bomber Lands in Libya.” CNN. August 20, 2009, retrieved April 9, 2014. 67. “PAN AM Flight 103,” Defense Intelligence Agency, DOI 910200, p. 49/ 50. 68. Rienhold, Robert, “Crew of Cruiser That Downed Iranian Airliner Gets a Warm Homecoming,” New York Times, October 25, 1988, retrieved April 9, 2014. 69. Ibid. note 67. 70. Barkham, Patrick, “Lockerbie Conspiracies: From A to Z,” The Guardian. April 7, 1999, retrieved April 9, 2014. 71. Foot, Paul, “Lockerbie: The Flight from Justice,” Archived online in PDF at www.sacc.org.uk/sacc/docs/lockerbie_flight_from_justice.pdf, retrieved on April 9, 2014. 72. “Architect of Lockerbie Trial Vows to Fight for an Appeal,” The Scotsman. October 1, 2014, retrieved April 9, 2014. 73. Poll data archived online at www.realclearworld.com/blog/polls/, retrieved April 9, 2014. 74. Bardach, Ann Louise and Rohter, Larry, “A Bomber’s Tale: Decades of Intrigue.” New York Times, July 13, 1998, retrieved April 9, 2014. 75. Candiotti, Susan, “Alleged Anti-Castro Terrorist Posada Arrested,” CNN, 2008, retrieved April 9, 2014. 76. Bardach, Ann Louise, Cuba Confidential: Love and Vengeance in Miami and Havana. Random House, (2002), pp. 180-223. 77. Ibid. 78. National Security Archive Electronic Briefing Book No. 153, archived at http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/, retrieved on April 9, 2014. 79. Document archived at http://www2.gwu.edu/~nsarchiv/NSAEBB/ NSAEBB153/19650707.pdf, retrieved on April 10, 2014. 80. http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/19650713.pdf. 81. http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/19650517.pdf. 82. http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/19761008.pdf. 83. http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/19761102.pdf. 84. Ibid. 85. http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/19780816.pdf.

GE N E S, M E DI A, AN D T H E GOVERNMENT

61

86. Ibid. 87. Ibid. 88. Ibid. 89. Ibid. 90. Ibid. 91. Kissinger’s State Department Bureau of Intelligence and Research Briefing is archived at http://www2.gwu.edu/~nsarchiv/NSAEBB/NSAEBB153/ 19761018.pdf. 92. Rohr, Monica, “Bosch Granted Deportation Reprieve, Sun Sentinel News, June 28, 1989. 93. Smith, Wayne, “Who Is a Terrorist?” Sun Sentinel News, May 31, 2002. 94. Ibid. note 85. 95. Ibid. 96. Ibid. 97. Marquis, Christopher, “Shooting Deepens Mystery of Itinerant Spy,” Miami Herald, May 13, 1990. 98. Ibid. 99. Ann Louise Bardach and Larry Rohter, “A Bomber’s Tale: Taking Aim At Castro,” New York Times, July 12, 1998. 100. Ibid. 101. Ibid. note 76. 102. Ibid. 103. “U.S. Denies Role in Cuban Exiles’ Pardon: Panama Frees 4 Convicted in Plot To Kill Castro,” Washington Post, August 27, 2004. 104. Ibid. 105. Kessler, Glenn, “U.S Denies Role in Cuban Exiles Pardon, Washington Post, August 27, 2004, archived at http://www.washingtonpost.com/wp-dyn/articles/A36924-2004Aug26.html. 106. Ibid. 107. “National Briefing.” New York Times. April 27, 2006, retrieved February 17, 2009. “A Cuban militant accused of masterminding the 1976 bombing of a Cuban airliner has applied to become an American citizen, his lawyer said Tuesday. The man, Luis Posada Carriles, has been jailed in El Paso on immigration charges since May. Mr. Posada, a former C.I.A. operative and a fervent opponent of President Fidel Castro, is accused by Cuba and Venezuela of plotting the 1976 bombing while living in Venezuela. He has denied involvement in the bombing, which killed 73 people. Mr. Posada escaped from a Venezuelan prison in 1985 while awaiting retrial on the airline bombing charges, and Venezuela has formally sought his extradition.”

62

CHA P TER 2

108. Corral, Oscar, “Posada Speaks to Herald,” Miami Herald, May 17, 2005, archived at http://www.miamiherald.com/2005/05/17/79747/flashback-posadaspeaks-to-herald.html. 109. Ibid. 110. Diaz, Madeline, “U.S. Arrests Suspect in Terror Attack on Cuban Plane, Hotels,” Sun Sentinel, May 18, 2005. 111. Ibid. 112. “Judge Throws Out Charges against Anti-Castro Militant,” CNN, May 8, 2007. 113. "Castro, Chavez Set for Talks on Terror Suspect Posada in US, Energy, Trade," Petro Energy Information Network, April 27, 2005, archived at http:// www.shana.ir/en/newsagency/print/51131. 114. Morris, Ruth, “Cuban Terror Suspect Asylum Bid Poses Dilemma for U.S.,” Sun Sentinel, May 7, 2005. 115. “Washington still fears Dominican ex guerrilla, now 80,” Dominican Today, March 3, 2010, archived at http://www.dominicantoday.com/dr/local/ 2010/3/15/35104/print. 116. Goodnough, Abby, “Legal Victory by Cuban Exile Brings Both Glee and Rage,” New York Times, May 10, 2007, archived at http://www.nytimes.com/ 2007/05/10/us/10miami.html?fta=yand_r=0. 117. “Cuban Militant Luis Posada Carriles to Stand Trial in U.S.,” Los Angeles Times, August 15, 2008. 118. Bond, Brittany, “Washington and Miami’s Favorite Terrorist,” Counterpunch.org, December 28, 2006, archived at http://www.counterpunch.org/2006/ 12/28/washington-and-miami-s-favorite-terrorist/. 119. Ibid. 120. Ibid. 121. Ibid. 122. Carroll, Rory, “Cuba Denounces Acquittal of Former CIA Agent Luis Posada a Farce,” The Guardian, April 10, 2011. 123. Diaz, Madeline, “Exiles in South Florida Support Posada,” Sun Sentinel, May 24, 2005.

3 THE CRIMINALIZATION OF LANGUAGE

Those who give up their liberty for more security, neither deserve liberty nor security. —Benjamin Franklin Islamic governments . . . are established as they have been by pen and gun, by word and bullet, by tongue and teeth. —Al Qaeda training manual

In the horrifying wake of the Al Qaeda attacks on 9/11, the American legal calculus used previously to formulate the delicate balance between protection of constitutional free speech and the preservation of national security interests was dramatically recalibrated. Free speech rights, along with other constitutionally protected liberties largely related to privacy, were increasingly seen as luxurious entitlements that belonged to an earlier and safer epoch of American history, and many people were prepared (and genetically predisposed) to willingly sacrifice these freedoms on the altar of national security. The U.S. government, reeling from its failure to deter and prevent the initial attacks (with subsequent investigations suggesting an executive, as well as intelligence community, failure) responded in swift, reactionary style by passing legislative measures and instituting policies that would lead to the criminalization of language in America. Laws that would veil investigations in secrecy, prosecute citizens for tenuous connections to unknown groups, intimidate media into complicity with government, and alienate international allies by global systems of surveillance would reweave the fabric of American civil soci63

64

CHA P TER 3

ety and change language from a cherished right to be exercised openly to a tool used to incriminate and condemn. This chapter examines the history of free speech in America, its place in U.S. constitutional democracy, how exigencies related to external threats have been managed by the United States in the past, and how the media have adapted to those changes. It will consider the psychobiological theories that seek to explain how language is processed biochemically in the brain and how genetics can determine an individual’s response to language (in particular, how dopamine interactions in the brain affect language interpretation, especially concerning speech related to crime, and how these chemical processes are heritable). We will then undertake an analysis of laws in America that have sought to criminalize speech and the impact these laws have had on media, and ultimately individuals, and how their genetic predispositions have factored into their respective responses. In the comparative case-analysis segment, several case studies will explore how the use of language has been criminalized for those who support America’s recognized enemies, but also how those same laws have been left unused against those engaged in the same acts of support but have been used for those politically aligned with U.S. interests. Finally, this discordancy in the American approach to the criminalization of speech will be the basis for an analysis of the potential creation of cognitive dissonance in the minds of voters and how these inconsistencies impact policy preferences.

THE HISTORY OF FREE SPEECH IN THE UNITED STATES Balancing Freedom of Speech with Security Enshrined in the First Amendment to the U.S. Constitution, the freedom of speech is undeniably one of the most revered rights bestowed upon citizens by the framers of the Constitution and integral to the functioning of a vibrant democracy. The ability to participate in an open society by voicing support for, or inveighing against, the policies of government comprises an essential part of the system of checks and balances necessary to ensure political transparency and accountability. Free speech gives citizens an opportunity to both speak and listen and is central to informing the populace about the moral and political choices it must

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

65

make. The media, as the vaunted “Fourth Estate” of government, occupy a unique space in this political prism and have a constitutionally protected mandate to shine a penetrating light into areas of government and expose corruption, inefficiencies, and weaknesses. However, this freedom is not absolute. It is incumbent upon the state to regulate and restrict language that may do harm to individuals (such as libelous or defamatory statements) or create civil panic (speech that creates the imminent threat of harm, shouting “Fire!” in a crowded theater being a common example). As John Stuart Mill once famously noted, the right to wildly swing your arms is not absolute, and “your rights end where his nose begins.” 1 The pivotal question is about when that infringement occurs and who decides what speech is an infringement and thus should be regulated, and on what grounds. After the attacks of 9/11, this perennial question surfaced again. The fear of future attacks had indelibly shaped the public discourse and contributed to the current policies that have deeply curtailed free speech rights. Fear, recent neuroscience research informs us, can trigger a complex cascade of neurochemicals that can not only impact our reaction to speech but also our reaction to having our freedom of speech suppressed. Although our understanding of this area of bioscience is nascent, the impact of fear on policies involving speech in the history of the United States has been much analyzed and represents a curiously recurring pattern. This historical cycle is explored below. The United States has recently taken strident steps in suppressing free speech in regard to terrorism, but reaching back into its relatively distant history, one can find ample precedent for the current chapter in American repression. Beginning with the Alien and Sedition Acts of 1798, 2 continuing through to the World War I era Espionage Act, 3 to the Red Scare–inspired Subversive Activities Control Act of 1950, 4 statutes that have criminalized speech and encouraged loyalty and subservience to the state in the interests of security all make up a common conceptual thread running through U.S. federal statutes for over two hundred years. In considering several of these acts within the historical and political context in which they were enacted and the consequences that followed the implementation of these regressive measures, we will provide some illuminating perspectives on the current iteration of laws designed to hinder or suppress speech and discourage the open marketplace of ideas that all democracies require in order to thrive.

66

CHA P TER 3

Early U.S. History of Free Speech In 1798, America was on the precipice of war. France was becoming a looming threat, and the Federalist Party introduced the Alien and Sedition Acts to quell perceived unpatriotic sentiment. “Any false, scandalous and malicious writing” that impugned the integrity of Congress or the president and that would cast either office “into contempt or disrepute” and engender the “hatred of the good people of the United States, or to stir up sedition” was a crime punishable with imprisonment. 5 Aggressive prosecution under this statute created a pervasive atmosphere of mistrust and fear and led to so many outrageous convictions that John Adams’s administration, which wielded such a heavy hand in the service of protecting national security, was promptly ousted in the next presidential election by Thomas Jefferson, who referred to the acts as “a nullity as absolute and palpable as if Congress had ordered us to fall down and worship a golden image.” 6 Unfortunately, America had only begun to embark upon its long history of falling down to the idolatry of the fearful state, and the sophistication of the imagery conjured to induce this worship would later make Jefferson’s golden image pale in comparison. President Abraham Lincoln, during the long and bloody Civil War, effectively suppressed political speech by suspending the writ of habeas corpus and imprisoning tens of thousands of suspected Confederate sympathizers for ostensibly undermining the war effort by exercising free speech in voicing opposition to the war. After the U.S. Supreme Court held Lincoln’s suspension of the writ unconstitutional in Ex Parte Merrymen, 7 Lincoln (along with the U.S. military) ignored the court’s legal ruling and obtained a written opinion from Attorney General Edward Bates that supported the writ’s suspension. 8 As Andrew Jackson, Lincoln’s presidential predecessor, once purportedly remarked (in noting the inability of the court within the U.S. system of government to enforce its judicial edicts), “John Marshall [Supreme Court justice] has made his decision, now let’s see him enforce it.” 9 This blatant disregard, indeed malicious contempt, for that hallowed document, which the administration was espousing a profound interest in protecting by going to war, would establish a portentous pattern over the coming years when future governments sought to paradoxically envelop America in protection while excoriating American citizens in punishment. As in the Civil War, the same burning questions would remain: Who is the real American, and

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

67

whose speech deserves protection, and whose deserves punishment? The answer, history would seem to indicate, depends not always upon ideology but upon political expedients. Lincoln’s unremitting desire to win the war was the expedient that justified his abandonment of the Constitution. While history would prove this expedient politically popular, neuroscience would suggest it is also genetically prescient. Succinctly stated, presidents are enabled by the populace to sacrifice constitutional protections if they are based upon expedients that appeal to genetic impulses related to individual fears of, for example, war, crime, sex, or external threats to social cohesion. Political appeals to these visceral fears became even more explicit during World War I. After the sinking of the Lusitania in May 1915, the United States found itself embroiled in a global conflict, and fears regarding the infiltration of America by foreign subversives at the beginning of World War I become a prevailing interest among politicians and citizens. With the threatening clouds of the Russian Revolution gathering on the historical horizon, speech that was deemed to create any agitation was forcefully suppressed under the 1917 Espionage Act. “If there should be any disloyalty, it will be dealt with with the firm hand of stern repression,” said an unequivocating President Woodrow Wilson. 10 The Espionage Act was the instrument of this American repression, making it a crime to make any statements that could be construed to “promote the success of its enemies,” or “cause insubordination, disloyalty or mutiny.” 11 The act created a sharp departure from the earlier Sedition Act, in that it did not allow the truth of the statement to be the basis of a defense, making honest criticism of government policies a criminal offense. 12 In an effort to thwart public dissension that might have arisen regarding clear encroachments to constitutionally protected speech, the Wilson administration established the Committee on Public Information to reinforce the fear of America’s enemies and instill boundless fealty to the state. The attorney general exhorted all “loyal Americans” to spy on neighbors whose behavior aroused suspicion and immediately report them to the Department of Justice. 13 Many overzealous citizens, their patriotic fervor amplified by their genetically inculcated fear, started to take more drastic measures: bugging neighbors’ phones, burglarizing houses, and absconding with financial and medical records to subject them to rigorous scrutiny before delivering them to authorities. The courts were largely lenient on these transgressors, who defended their actions as concerned citizens

68

CHA P TER 3

acting at the behest of the attorney general. 14 Assertions of free speech violations were generally considered as unpatriotic and creating civil unrest, and speech critical of government was nothing short of a crime. By 1918, with the passage of the Sedition Act, the climate for free speech tolerance was to become much more hostile. The Sedition Act criminalized all language that was “unpatriotic or disloyal” irrespective of whether any harm may be the consequence of the speech. Any members of Congress who took objection to the act became vilified as enemies of the state and suspected of treasonous sympathies. One notable subject of the prosecution under the act was Eugene Debs, former presidential candidate and Socialist Party member, whose statement in a public address earned him a ten-year prison sentence. “You need to know that you are fit for something better than slavery and cannon fodder,” Debs solemnly intoned. 15 Invoking an earlier argument that weighed heavy with political resonance, Debs posited that the war draft was tantamount to involuntary servitude and a violation of the Thirteenth Amendment to the U.S. Constitution. This vocal opposition to the war was adjudged to be criminal speech under the Sedition Act and worthy of suppression and incarceration. The fear revolving around the Red Scare and the spread of communist control over the United States would continue unabated into the 1950s when it would reach an ignominious crescendo. Under the Subversive Activities Control Act, passed by Congress in 1950, the Subversive Activities Control Board was created and authorized to declare any organization that resisted registration of political affiliation as “Communist.” 16 By law, Communist organizations, or members thereof, were prohibited from working in government or defense firms and could be detained for suspicion of involvement in future acts of espionage. Those suspects detained under the act had no right to judicial review or to challenge the evidence used as grounds for their detention. 17 Senator Joseph McCarthy, a rabid anticommunist, terrified the public into a fearful state of existential dread, believing the threat of a communist takeover of the United States to be imminent, and members of the Communist Party to have infiltrated every organ of U.S. government. This fear (compounded by the reality of China’s Communist Revolution and Russia’s ascension to nuclear statehood) permeated the highest levels of government; and the Supreme Court was not immune. In Dennis v. United States, Justice Frankfurter, when addressing the extent of First

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

69

Amendment protections of free speech and the conditions of their curtailment, opined that “the right of a government to maintain its existence— self-preservation—is the most pervasive aspect of sovereignty.” 18 Although self-preservation may indeed strongly mitigate in favor of abdicating certain constitutional protections regarding free speech (which obviously could not be enjoyed if the country ceased to exist), Benjamin Franklin’s quote, given at the outset of this chapter, still lingers uncomfortably in the mind: “Those who give up their liberty for more security, neither deserve liberty nor security.” Contemporary Free Speech in America and the Evolution of Speech Criminalization In 1969, the U.S. Supreme Court issued a tide-turning judicial opinion in the case of Brandenburg v. Ohio that reversed years of content-oriented speech suppression and established a new precedent for future disputes concerning the use of political language. 19 Before Brandenburg, speech that advocated the overthrow of government or that criticized U.S. policies of war was subject to criminal prosecution. Under the ruling in Brandenburg, “the constitutional guarantees of free speech and free press do not permit a State to forbid or proscribe advocacy of the use of force or of law violation, except where such advocacy is directed to inciting or producing imminent lawless actions and is likely to incite or produce that action.” 20 The Brandenburg precedent held that the speaker must intend his language to create imminent harm and prohibited the state from imposing any restriction that would curb political speech, or even speech that advocated terrorist action in general, as long as it didn’t incite an imminent threat of harm. 21 This opinion attempted to diminish potential abuses by the state against political enemies and to minimize the injury to free speech for proponents of radical ideas that may be susceptible to popular suppression. The court under Brandenburg found itself extending a shield of protection over those who express sentiments of subversion or words that undermine the legitimacy of state policies. However, the will within government to suppress speech remained strong. Although the traditional statutory tools of suppression had been repealed or held unconstitutional, the fearful impulse that allowed constitutional protections to be discarded still coursed through the body politic and was responsive to other avenues of repression sought out by government.

70

CHA P TER 3

Although Brandenburg precluded the state from restricting the use of language that contained offensive or subversive speech, circumventing this rule to indirectly impose criminal sanctions for using language (in particular, speech that involved support for terrorism) would involve some legal creativity. 22 Under a strict interpretation of Brandenburg, there was little room for state discretion in outlawing any speech that supported terrorism; indeed, the Ninth Circuit Court of Appeals has held that no person is “prohibited from advocating the goals of the foreign terrorist organizations, espousing their views, or even being members of such groups. They can do so without fear of penalty right up to the line established by Brandenburg v. Ohio.” 23 However, the court in Reno made an important legal distinction when it further opined that “advocacy is always protected under the First Amendment whereas making donations is protected only in certain contexts.” 24 The door to suppressing free speech through an outright prohibition of content-oriented language was closed to the state, but the window was left open to indirectly penalize those whose speech could be considered as a lending of material support to an organization labeled “terrorist” by the U.S. government. Under 18 USC 2339A-B, “material support” can be judicially interpreted as “any property, tangible or intangible, or service, including currency or monetary instruments or financial securities, financial services lodging, training expert advice or assistance, safe houses, false documentation or identification, communications equipment.” As we will discuss in this chapter’s case study analysis, this statutory provision has been held to apply the definition of “material support” to individuals using broadcasting technology to transmit and deliver messages (in the form of television programming) to cable customers in the United States, under the theory that the company was providing a service to a designated terrorist organization by communicating their speech. This broad conception of material support, and its application by the courts to speech, has expanded in scope over the years, and its aggressive prosecution by the government has had an indelible impact on free speech protections in the United States, making a criminal act of language that was once protected under the Constitution. It logically follows that making the simple facilitation of information tantamount to providing material support to a terrorist organization (and foisting upon anyone who transmits a message or simply posts a link to a terrorist communiqué the dreadful onus of defending that action in a criminal investigation) will have a clear chilling effect on free

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

71

speech. The brunt of this chilling effect will fall upon those who frequently use technology to communicate political speech; and with the media occupying the vanguard of communication technology usage, they would naturally fall at the forefront of the effect. With the government wielding the blunt threat of criminal prosecution for those who give voice to organizations the state designates as terrorist, the media can be cowed into compliance, and through fear of criminal investigation, self-censor their communications to avoid government attention (or totally abdicate their role as critical observer and become an extension of government, simply relaying without scrutiny all information provided to them). The biological impulse of fear (e.g., fear of the terrorist threat, fear of government suppression or investigation) that may shape the media’s message will further motivate the response of individuals who receive the information and the process through which they discern its import. How the media respond to this threat of criminal action, and how the public perceive the threats communicated to it, is the subject of the following pages.

COUNTERTERRORISM LAWS AND THE MEDIA The inherent conflict between the interests of government and the media stems from the respective goals of each institution: the government’s interests in protecting and preserving the state (often through methods that must remain secret) and the media’s interests in communicating information to ensure transparency in government and protecting democracy from the encroachment of the state upon the rights of its citizens (often accomplished through the exposing of government secrets). Although both institutions purportedly serve the interests of the people to whom they’re beholden (i.e., the electorate/consumers of information), their own interests may occasionally operate at cross-purposes. This innate tension between government and media forms the bulwark of democracy, ensures protection against the corruption of power, and creates a system of accountability necessary to any functioning democratic state. This natural tension has historically shifted during crises, which at times required the temporary suspension of the critical aspects of media in order to foster consensus and facilitate action in the interests of the self-preservation of the state. As noted above, in times of war the United States has imposed rigid restrictions on speech to control dissent or prevent the overthrow of

72

CHA P TER 3

the government, but following the abatement of hostilities, the media (and the public) have regained free speech rights granted under the Constitution. In the war against terrorism being currently waged by America (arguably perpetual in its duration), the question of how the media manage to balance their continued compliance with the state’s demands of servility to the exigencies of a continuous existential threat (with its competing demands to serve its constitutional mandate to report on the actions of the state) points to a conflict that impacts the core of free speech rights in the United States: What are we entitled to know, and what is legal for us to say? The complex levels of secrecy that shroud the war on terror create a dense cloud of legal obscura that make ascertaining which speech is lawful increasingly difficult. This judicial ambiguity (described in more detail below), coupled with threats of criminal action, has made the prospect of exercising free speech among members of the media a dangerous proposition. Journalists and whistleblowers have received more attention from prosecutors for revealing information they considered vital to informing the global debate on terror and less attention from courts interested in protecting free speech and the public’s right to know. The discussion below outlines the methods government has successfully used to discourage the media from providing information to the public and the concomitant impact on free speech. As the subsequent case studies will suggest, the question of whether the delicate democratic balance between security and free speech is being properly weighed by the courts, or whether government has placed a heavy thumb on the scales of justice, is a timely question that urgently merits discussion.

METHODS OF GOVERNMENT SUPPRESSION AND MEDIA When media outlets and individual journalists (from Fox News to Julian Assange) investigate and publish information related to national security interests, a panoply of laws governs the way this information is treated as well as the reporting journalist. Traditional legal methods of coercion used by government against journalists (e.g., threats of being held in contempt of court for refusing to reveal sources) are timeworn tools that are still in ardent use. However, laws related to the handling and dissemination of information regarding terror investigations in particular, as well as laws that control the publication of evidence being used in current or

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

73

pending trials, highly regulate the flow of this information and create a veritable legal minefield for intrepid journalists willing to test the boundaries of First Amendment protections. A host of legal methods of media suppression, both direct and indirect, are at the disposal of courts and government agencies seeking to dissuade communication of information related to the war on terror. Aggressive use of requests to produce documents held in the possession of the journalist, the power to detain journalists for questioning, limiting (or forbidding entirely) the accessibility of judicial hearings, and the lack of legal understanding of the intricacies of counterterrorism laws themselves can all serve to discourage media reporting on the war on terror. 25 This tight control of information can effectively slant the narrative to serve the interests of government by permitting only the selective release of information that reflects positively on government actions and by obscuring incidents that may prove disastrously revealing, under the guise of protecting national security. If law enforcement authorities have reasonable grounds to suspect that a journalist has possession of documents that are deemed relevant to a terror investigation, they may issue a notice to produce those documents under pain of prosecution. 26 This far-reaching power can compromise the integrity of a reporter’s source and undermine the relationship of confidentiality journalists rely upon to secure the cooperation of a source, who may feel threatened with personal reprisal for disclosing evidence that may incriminate powerful government officials, who would be impacted by the source’s divulgement. 27 The possibility that this relationship could be subjected to investigative scrutiny would have a chilling effect on the journalist’s ability to cultivate sources and could be used further as a measure to intimidate journalists who are naturally averse to government intrusion into their professional lives. Under the Obama administration, revealing the use of subpoenas by the U.S. Justice Department when conducting a criminal investigation into twenty Associated Press (AP) reporters to track the journalists’ phone calls had an immediate chilling effect. According to Washington Post journalist Dana Milbank, the intrusion into his professional privacy was as flagrant an assault on civil liberties as anything done by George W. Bush’s administration and it uses technology to silence critics in a way Richard Nixon could only have dreamed of. To treat a reporter as a criminal for doing his job—seeking out information the government

74

CHA P TER 3

doesn’t want made public—deprives Americans of the First Amendment freedom on which all other constitutional rights are based. 28

In short, the power of the government to order the production of documents in a terror investigation can be used to discourage disclosure of information regarding government impropriety, which can have a detrimental effect on the debate of terror policy. Law enforcement agencies conducting a terror investigation can also seek warrants to question or detain persons who authorities have reasonable grounds to suspect have information regarding a terrorist threat. 29 Refusing to answer law enforcement questions during interrogation, or disclosing the existence of the secret investigation itself, can be a crime punishable by imprisonment. 30 This measure has a chilling effect on a journalist’s ability to guarantee their source anonymity and erodes the foundation of trust reporters require to conduct investigations into potential government wrongdoing in the war on terror. 31 This method of intimidation can compel a recalculation in judgment regarding the risks of reporting and create a disincentive to aggressive journalistic reportage. Regarding the AP investigation noted above, the New York Times editorial board wrote, “With the decision to label a Fox News television reporter a possible ‘co-conspirator’ in a criminal investigation of a news leak, the Obama administration has moved beyond protecting government secrets to threatening fundamental freedoms of the press to gather news.” 32 The government’s ability to question and detain journalists in the course of a terror investigation can be utilized to devastating effect to suppress the free speech of the journalist and deny the public the right to information necessary to intelligently weigh policy considerations. In a trial where charges have been laid against anyone accused of an offense regarding their handling of terror-related information (which they may have possessed or communicated), if the evidence upon which the state makes its claim is considered to be sensitive to national security interests, the state may withhold this evidence from disclosure by the defendant journalist. 33 The effect of making prosecutorial evidence secret, even from the lawyers representing the journalist, is that lawyers who are completely unaware of the circumstances and nature of the alleged offenses must make arguments on behalf of their clients. Criminal trials cloaked in a veil of secrecy present a distinct legal disadvantage to the journalist, who may be wholly oblivious to the very grounds upon

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

75

which the criminal charges are based, which diminishes their ability to aid in their own defense. 34 Failing to allow journalists to confront the evidentiary information upon which they stand accused impairs their capacity to defend their right to carry out a constitutional mandate and provide the public with essential information about the war on terror. Secretive trials against journalists can be used by the judiciary to harmful effect by repressing the free speech of journalists investigating government. The pervasive secrecy of terror investigations is compounded by the complexity of counterterrorism laws that the government seeks to enforce. Journalists themselves are woefully underprepared to understand the legal nuances of statutory counterterrorism laws, precisely how they are applied, and at what point they are in violation of the law. Lawyers whom journalists rely upon to defend them in cases involving alleged violations are also frequently navigating through uncharted waters or may be reluctant to get embroiled in a case in which documents related to national security may be in the journalist’s possession; the lawyers may even believe that simply viewing the documents may expose him or her to criminal liability. In an interview with a journalist who was attempting to confer with counsel regarding the legal status of terror-related documents that the journalist had come into possession of, the lawyer’s response to the journalist’s inquiry was telling: “I can’t look at those documents. I’m not talking to [that journalist]. I’ll go to jail for five years.” 35 The lack of intimate familiarity with antiterrorism laws and how the law is judicially applied in courts that frequently consider evidence in secret, coupled with the perceived threat of criminal prosecution for lawyers handling documents involving national security, combine to create a profoundly chilling effect on the gathering of information necessary for conducting an investigation into the government’s prosecution of the war on terror and on creating accountability for antiterror policies. On balance, the government possesses multiple methods for instilling fear into the process of conducting journalism and effectively suppressing free speech in the media: fear among government employees interested in exposing wrongful government behavior who are silenced by the apprehension of detection by law enforcement and possible future recrimination; fear among journalists who are frightened by the prospect of becoming the target of a criminal investigation themselves and confronting the very real possibility of imprisonment for uncovering sensitive informa-

76

CHA P TER 3

tion; and fear among attorneys who approach cases involving national security and the First Amendment rights of journalists with a sense of wary trepidation believing that they, too, may become ensnared in an investigation that could result in heavy fines and incarceration. This palpable fear of government persecution felt by whistleblowers, journalists, and lawyers acts in concert to deter the media from fulfilling their obligation to the public to provide accurate information objectively, without discrimination. Self-censorship born of fear warps the message that the public relies upon when making electoral choices in respect to policy on the war against terrorism. This distorted message is received and assimilated by the public based in part on biochemical processes that shape the perception of putative threats and then dictate a response predicated upon visceral intuition. The biopolitics of the media’s interpretation of government efforts to criminalize speech and the consequences of joining a flawed or incomplete representation of the facts surrounding the war on terror with the subtle vagaries of genetically predisposed perceptions of terrorist threats are the subject of this chapter’s following segment.

THE BIOPOLITICS OF SPEECH CRIMINALIZATION It is worthy of remark that a belief constantly inculcated during the early years of life, whilst the brain is impressible, appears to acquire almost the nature of an instinct; and the very essence of an instinct is that it is followed independently of reason. —Charles Darwin, The Descent of Man, 1871

There are scientific theories that posit that human behavior and political ideology are partially genetic in origin and that certain chemicals present in the brain are central to our systems of belief and can act in tandem with environmental factors to predict how certain people will respond to politically charged language. One neurochemical in particular, dopamine, has been the focus of intense research exploring the extent to which biochemicals influence behavior and affect individual political outlook. Further research has examined how specific genes regulate the neurochemical balance in the brain and instill behavioral characteristics often associated with liberal or conservative views and can accurately identify political orientation. Additional research has discovered that there is a strong connection between elevated dopamine levels in the brain and the addictive

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

77

need to exercise power over others, coupled with a concomitant lack of empathy and openness to foreign ideas. The authors of this book contend that these genetic precursors that control the neurochemical environment in which belief systems originate provide incentives to government to enact laws that criminalize speech and inculcate fear in order to maintain political control, consequently establishing divisions in the electorate based upon its genetic predispositions: conservatives acting within their inherent impulse to exert control (albeit vicariously) over others by supporting restrictive government policies regarding the war on terror that limit liberties or liberals’ impulse to view the policies critically with an openness that allows room for opposing ideas. Although the genetic origin of these respective political ideologies (and the psychological locus of control [internal and external] that distinguishes the two systems of belief) has been discussed in previous chapters, the present chapter will examine specific genetics that earlier research has strongly indicated play a decisive role in creating a neurochemical basis for political behavior and how variants of certain genes impact the response to the criminalization of speech.

DOPAMINE AND POLITICAL BELIEF The human brain contains approximately one hundred billion neurons, which branch out to form roughly a thousand trillion synaptic connections with other surrounding neurons in the brain to create a staggeringly complex electrochemical system of consciousness. 36 Information is passed from one neuron to the next through a biochemical sequence involving the exchange of chemical transmitter substances (CTS) that control the electrical impulses that flow across the synaptic spaces between neurons. The passage of these signals from one neuron to another collectively results in the internal communication of thoughts and sensations, such as pain, pleasure, or belief. Of the many types of neurotransmitters that occur in the brain, dopamine is a more common type, known as a catecholamine. 37 Dopamine acts like the key to the lock of the neuron, opening the door to electrical transmission, and facilitates the signal from one neuron to the next. If the brain experiences a shortage of dopamine (e.g., as does a patient with Parkinson’s disease), that person will lose motor control and begin to shake. An excess of dopamine in the

78

CHA P TER 3

brain has exactly the opposite effect; the person will enter into a hyperalert manic state. 38 The chemical balance of dopamine within the brain can have a profound impact on a person’s emotional state and, consequently, on their system of political belief. As Al-Rodhan observes, people make decisions largely based upon emotion, and he characterizes human judgments as “emotional amoral egoism” and asserts that people make choices based upon perceived selfinterests, circumstances, and survival. 39 However, emotions themselves are not immaterial and are predicated upon neurochemical processes. Dopamine is an integral chemical component of the process of acquiring beliefs, of how we evaluate potential rewards and costs when making judgments, and ultimately of which political affiliation we ascribe to. As Shermer points out, dopamine is the biochemical most closely identified with belief, is a key element of association learning, and underlies humans’ capacity to infer meaning from observed patterns (whether or not these patterns later prove correct, as discussed in earlier chapters). The human ability to discern patterns is derived from dopamine’s facility to act as reinforcement to behaviors that deserve reward. Dopamine stimulates a pleasure response to reinforce behaviors associated with survival, such as achievement through risk taking that results in acquiring food (or money or votes). The reward system, explained by the operant conditioning theory advanced by Skinner, has proved beneficial to species’ survival and is referred to by Al-Rodhan as the “neurochemical gratification principle.” 40 However, humans will develop a desire for dopamine itself and seek to satisfy their needs by engaging in riskier behavior simply to stimulate greater releases of the neurochemical, leading to addictive behaviors, such as gambling, as well as flawed judgments, such as joining dangerous groups that heighten dopamine reinforcement (not limited to gangs or terrorist organizations; other groups, such as law enforcement or the military, also offer a more socially acceptable source of dopamine generation). Al-Rodhan has also noted the connection between higher levels of dopamine, which lead to increasingly addictive and risky behavior, and an emotional detachment that can create a mentality of ruthlessness, which in persons of political power can remove self-restraint and engender a belief that they are guided by a spiritual force in their political judgments. 41 President George W. Bush, for example, believed that God wanted America to elect him president. 42 The addictive properties of attaining higher levels of political power can have an equally deleterious

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

79

effect, and, as Robertson observes, “Submissiveness and dominance have their effects on the same reward circuits of the brain as power and cocaine. Baboons low down on the dominance hierarchy have lower levels of dopamine in key brain areas, but if they get ‘promoted’ to a higher position, then dopamine rises accordingly.” 43 His conclusion on how this addiction to power impacts politics is succinctly summed up in the title of his article: “Like Baboons, Our Elected Leaders Are Literally Addicted to Power.” This system of behavioral biochemical reinforcement, whether in political leaders or members of the public, eventually coalesces into a coherent system of beliefs, and based upon losses suffered and rewards gained, values are created that collectively create a system of political attitudes. The chemical profile contained within our brains that constitutes our belief system is itself produced by a genetic blueprint, which acts as a template to guide the chemical construction of political affinities. On balance, the differences in belief fall along a familiar line: those who embrace belief, and those who are skeptical. A seminal study of the relationship between dopamine and belief was conducted by Brugger and Mohr, and it found that those who have high levels of dopamine are more inclined to magical thinking and finding patterns of meaning in unconnected events. 44 They further found that the subjects in their study were more susceptible to false-positive errors in cognition if they were given the drug L-dopa, which increased the levels of dopamine in the brain. The study suggests that those who have elevated levels of dopamine suspend their ability to exercise skepticism and become more inclined to believe something in the absence of proof. 45 Simply put, the higher the level of dopamine present in the brain the more likely an individual will find meaning in meaningless occurrences and, consequently, become more prone to Type I cognitive errors. Shermer finds this relationship between increased levels of dopamine and heightened incidence of false-positive errors as a problem of patternicity, and argues that dopamine (in excessive rates) impairs the brain’s ability to detect a true signal of danger in the background noise your brain continuously processes, while simultaneously creating permanent neural connections for false-positives, ensuring that the errors are more likely to persist into the future. The ability of elevated dopamine levels to induce illogical thinking and entrench false beliefs neurologically, encouraging the perception of nonexistent patterns in unconnected events, makes individuals

80

CHA P TER 3

with high concentrations of dopamine more receptive to government messaging regarding the criminalization of speech and incapable of challenging received information with scrutiny. The formative influence of dopamine on human beliefs and its action on the neural processes involved in critical thought and the shaping of systems of political preferences was further reinforced by a study at the UCLA Brain Mapping Center, which used fMRI brain scans to find that the brain itself is naturally hardwired to more readily accept a statement as true than contemplate its falsity, suggesting that we are predisposed to belief and credulous of falsity. This research ostensibly supports what Shermer refers to as “Spinoza’s conjecture”: “Belief comes quickly and naturally, skepticism is slow and unnatural, and most people have a low tolerance for ambiguity.” 46 This intuitive sense, which humans seemingly possess, to instinctively embrace as true statements that have not been duly verified, rejects basic principles of evidentiary epistemology that begin with the assumption of falsity. Instead of following the lead of science and transcending the fallibilities of the human mind, most government institutions fervently disavow the skepticism of those who challenge the rhetorical accuracy of statements made regarding issues of free speech and the war on terror as “unpatriotic” or even “traitorous.” The urge to resist, or embrace, this rush to groundless belief can be found in each person’s genetic code. In a study conducted by Settle and Dawes at the University of California, San Diego, research into genetic variants that contribute to the shaping of political attitudes identified a specific gene, the D4 dopamine receptor gene (DRD4), as a gene that regulates dopamine activity in the brain and examined, in particular, how a certain allele of this gene (7R) can influence certain types of social activity commonly understood as indicative of “liberalism.” 47 The 7R allele of DRD4 has been associated with novelty-seeking behavior, which is recognized as an inclination toward “openness,” a character trait noted frequently among individuals who espouse liberal or progressive political views. 48 What the study identifies as an “openness to experience” that is encoded onto the DRD4 gene is a personality attribute that is both positively linked to liberal political ideology and negatively related to political conservatism generally, sociocultural conservatism specifically. People noted for their inclination toward novelty seeking and openness to experience have a low tolerance for monotony and are more impulsive and exploratory. Those scoring low

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

81

on a scale of openness are more disposed to rule following and tend to be more rigid in their beliefs and loyal to their affiliations. 49 This study, which matched the genetic information of two thousand participants from the National Longitudinal Study of Adolescent Health with their social networks, hypothesized that the DRD4 7R genetic predisposition would operate in a social context to engender specific political ideologies. As the authors of the study note, we “can no longer afford to view ideology as a strictly social construct, perfectly malleable and completely subject to historically changing circumstances.” 50 Indeed, the scientific evidence is mounting that our genes, and the neurochemical processes they grandly orchestrate, are hugely determinative in forming the delicate tissue of our political beliefs and ideological attitudes. Our genetically encoded receptivity to speech, whether we are open to novel ideas or rigidly adhere to loyally cherished beliefs, can impact the way in which we process information regarding the criminalization of language. The evidence compiled within the body of empirical studies referenced above would suggest that liberals, who are classified as possessing cognitive character traits that enable open-mindedness and foster skepticism and encourage the challenging of authority, might be more prone to rejecting the government narrative supporting the suspension of free speech rights to obtain the promise of security and enforce antiterror laws. Conversely, those persons of a more conservative mindset, genetically endowed with an inclination to belief, predisposed to obey authority, and averse to behavior that may be seen as disloyal or nonconformist, may accept without scrutiny the government’s assertion that liberties must be sacrificed for the common good of maintaining law and order and punishing transgressors who inveigh against the state. Those in the media and government are equally susceptible to the same genetic predispositions and make judgments and exercise authority regarding the criminalization of language and the suppression of free speech based upon a moral compass that is heavily influenced by the same genetic determinants that inform the public’s receptivity to counterterrorism policy pronouncements and to the precise way those messages are communicated. As the case study analysis below will explore, the application of the biopolitical research to the issues surrounding the criminalization of language should lend an edifying aspect to how genetic predispositions operate to impact political judgments in real world events.

82

CHA P TER 3

COMPARATIVE CASE STUDY ANALYSIS What greater crime can an orator be charged with than that his opinions and his language are not the same? —Demosthenes

Throughout the course of American history, the sanctity of cherished constitutional rights has been sacrificed to the necessity of security. During times of war, leaders have rallied popular support around the notion that to secure America’s lasting ideals of freedom and liberty, certain freedoms and liberties must be temporarily suspended. The freedom of speech in America, and by judicial extension the freedom of the media to report views divergent from those of government, has undergone a significant historical evolution since the country’s founders wrote the First Amendment to the Constitution. Under Brandenburg, the content of a person’s speech is no longer subject to legal restriction, and words that endorse or support terrorism are lawful insofar as they do not incite immediate harm. However, the government has adeptly circumvented the prohibitions of Brandenburg by creatively enforcing counterterror laws designed to thwart the “material support” of terrorism by engaging in a novel judicial interpretation of “support,” and has been effectively suppressing speech by criminalizing language in the media and among individuals by investigating and prosecuting those who allegedly run afoul of these amorphous laws. Neuroscience research strongly indicates that the political belief systems that politicians, members of the media, law enforcement, and the public use to make judgments regarding terror policy and criminalization of speech are profoundly influenced by their genetic makeup. An individual’s perception of threats that may color their judgment on policy choices is based upon a genetic patternicity that may be the product of cognitive error, and their acceptance or rejection of counter-terror laws that criminalize language may be largely based upon genetic predisposition. Furthermore, research into the addictive properties of dopamine levels in the brain suggests that political leaders who exercise the power to restrict political language are biologically incentivized to coalesce their power by suppressing speech and quashing dissent. In brief, the impulse to limit political speech and the urge to resist this limitation both originate from the same genetic location. How these variant ideologies are ex-

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

83

pressed, and the consequences of conflicting political messaging in the real world, is the subject of the following case analyses. The cases below will examine how the public responds when the laws that criminalize speech (more specifically, laws that prohibit the material support of terrorism) are applied discriminatorily: speech as material support in a cause against the U.S. government and the U.S. government itself engaging in material support of terrorism. The first case involves the owner of a cable television company who was charged with giving support to Hezbollah, an Iranian-supported political party listed as a terrorist organization by the U.S. government, by facilitating the transmission of the organization’s television broadcasts from Lebanon to American customers in New York. The second cross case comparative analysis will consider the U.S. government’s support, material and vocal, of the Mujahedeen e-Khalq (MEK), an anti-Iranian group listed as a terrorist organization that has admitted to the assassinations of Americans abroad and has been engaged in a covert war against the present Iranian government. The cross case analysis will focus specifically on members of the government who have entered into contractual relationships for providing political support and lobbying efforts on behalf of MEK in the United States. The analysis will explore the impact on the public perception of terror policy in the context of conflicting or contradictory messages and whether cognitive dissonance creates shifts in public policy preferences. To paraphrase Demosthenes, the case studies ask if the public holds government oratorically accountable when its opinions and language are not the same. Javed Iqbal Javed Iqbal, a Pakistani-born man in his forties who had lived in America for twenty-five years, owned a Brooklyn-based satellite television company, known as HDTV Corp., which provided broadcasting services to other companies, government offices, and individual customers and was registered with the Federal Communications Commission. 51 Of the many satellite broadcasts offered by HDTV, the transmission of one in particular was to raise the intense interest of the FBI: a Lebanese television station affiliated with Hezbollah, known as “Al-Manar.” Roughly five months after Al-Manar was listed by the U.S. Treasury Department as a “Specially Designated Global Terrorist Entity” and part of an “Iran-

84

CHA P TER 3

funded Hezbollah terrorist network,” Iqbal was arrested on charges of providing material support to a terrorist organization. 52 According to a press release issued by the U.S. Attorney for the Southern District of New York, the federal jurisdiction where Iqbal was prosecuted, Hizballah (“Party of God”) is a Lebanese-based organization whose stated mission is the establishment of a fundamentalist Islamic state and the destruction of the State of Israel. Hizballah regards the United States as its enemy in this struggle and has pursued its mission through, among other things, attacks on civilian targets. Hizballah operates a television station in Lebanon known as Al-Manar (“the beacon”) to cultivate support, including raising funds and recruiting volunteers for attacks. 53

The charge of providing material support arose out of Iqbal’s admission that “between approximately September 2005 and August 2006 he provided satellite transmissions to Al-Manar, in exchange for thousands of dollars in payments from Al-Manar.” 54 On December 23, 2008, Iqbal pleaded guilty to charges in an arranged plea agreement and received six years in prison. In February 2004, a paid informant swore in an affidavit given to the FBI that Iqbal’s company, HDTV, was selling access to Al-Manar satellite broadcasts. 55 Following the sworn affidavit, the informant was able to record Iqbal offering Al-Manar programming, in addition to other Arab networks. In July, the informant scheduled the installation of the satellite system in his New York apartment, which the FBI had under surveillance. 56 A technician from HDTV installed the system, but the Al-Manar channel was not available. By August, the informant was still unable to receive Al-Manar broadcasts from HDTV. After complaining to Iqbal about the absence of Al-Manar programming, the informant was finally told that an Israeli bombing of the station had interrupted all broadcasting services. 57 The following week, Iqbal was arrested. Al-Manar, a television station founded in Beirut, Lebanon, and in operation since 1991, was granted a license to broadcast in 1997 by the Lebanese Cabinet at the behest of Syrian president Hafiz Al-Asad. 58 In 2004, Al-Manar boasted an estimated fifteen million viewers worldwide. Much of Al-Manar’s programming consists of international press coverage, music videos, dramas, and talk shows. 59 The talk shows and music videos are the most incendiary form of programming and are the basis for

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

85

many of the allegations of propagandizing terrorism leveled against AlManar. The talk shows tend to support views advocating the overthrow of Israel and the repudiation of Western ideology; the music videos glorify martyrdom, vilify Israel and the United States, and portray modern Zionism as a form of terrorism (particularly aggression against the Palestinian state). 60 However, the Committee to Protect Journalists, an organization dedicated to preventing violence against media, concluded that Al-Manar “does not appear, based on a monitoring of its broadcasts today, to be serving any discernible military function, according to CPJ’s analysis,” 61 and Human Rights Watch denounced Israeli air attacks against the station (one of which resulted in a suspension of Iqbal’s broadcast to the FBI informant) as a violation of international law, claiming that “it is unlawful to attack facilities that merely shape civilian opinion.” 62 In contrast to Human Rights Watch, the FBI and the federal judiciary did not view Al-Manar as a benign media organization seeking to communicate news and political commentary but rather as the public relations arm of Hezbollah, an Iranian-supported political party listed as a terrorist organization by the U.S. government. The government also refused to recognize Iqbal’s facilitating the transmission of Al-Manar’s programming to American viewers as free speech activity protected by the Constitution but rather as the providing of material support to a designated terrorist organization, and therefore a criminal act that warranted prosecution. First Amendment arguments proffered to the court by Iqbal’s proponents fell on deaf ears. Mustapha Ndusa, Iqbal’s attorney, referred to the charges as “completely ridiculous” and said that “core First Amendment values—speech and the right to publish news and information” were being encroached upon; he averred that no precedent existed for criminal charges being laid under U.S. law for the mere act of facilitating access to foreign news broadcasts. 63 Donna Lieberman, representing the ACLU, expressed grievous reservations about free speech restrictions and found the charges against Iqbal to “raise serious First Amendment concerns.” 64 Al-Manar simply “broadcast their ideas,” according to an argument advanced by lawyer Joshua Dratel, and should be accordingly protected under the Supreme Court holding in Brandenburg, which prohibits restrictions of content-oriented speech. 65 The prosecution in Iqbal’s case took a starkly different tack in its interpretation of Iqbal’s actions in regard to the applicable law and discarded the invocation of free speech protections to exonerate Iqbal from criminal liability. The assistant U.S.

86

CHA P TER 3

attorneys prosecuting Iqbal, Eric Snyder and David Leibowitz, argued that it was not Iqbal’s speech that was under judicial scrutiny; rather, it was his conduct, in his capacity as HDTV’s operator, and the money earned by Al-Manar through subscription payments, facilitated by Iqbal, that formed the factual basis for criminal charges of providing material support of a terrorist organization. 66 The prosecution was quick to point out in court that the indictment against Iqbal never alluded to the content of Al-Manar’s broadcast programming (only to its designation as a terrorist organization by the Treasury Department) or the money exchanged between Al-Manar and Iqbal and that Al-Manar operated as a fundraising entity for Hezbollah in Lebanon. Judge Berman, the federal district court judge overseeing the case, concurred with the prosecution, stating that, in his opinion, “I don’t think the case is about content,” and “I don’t think it’s about protected speech or advocacy. I don’t think it’s about defendants’ right to say what they wish, write what they wish, to publish what they wish or even broadcast what they wish.” 67 Even if the money transferred to Al-Manar is only used to support programming designed to inform viewers, the legal theory the government propounds to justify prosecutions such as Iqbal’s is that by channeling this money to support the broadcast activity at Al-Manar, it reduces the financial burden on Hezbollah, which then liberates financial resources that could then be diverted and used to coordinate terrorist attacks. 68 This specious legal theory of budgetary enlargement that finds that any money transferred to any organization with a tertiary terrorist affiliation is tantamount to providing material support for terrorism can have widespread ramifications, not only for transacting business but for making donations to charitable and humanitarian organizations that may have tenuous relationships with groups the United States deems terrorist. Further complications arise, as we will discuss in the following cross case comparative analysis, when the donors happen to be the officials within the U.S. government. The tortured logic of this legal theory was applied in an even broader context in the case of Holder v. Humanitarian Law Project (HLP), in which the Supreme Court found that offering legal advocacy in “coordination” with a terrorist organization could constitute material support and was therefore criminal speech. 69 The Humanitarian Law Project was providing legal advice regarding peaceful dispute-resolution techniques and methods of appeal to international organizations for humanitarian relief,

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

87

such as the United Nations, to Partiya Karkeran Kurdistan, a group designated as a terrorist organization by the United States. The court further prohibited the HLP from offering its guidance to international aid organizations on how to present claims for tsunami relief and advice on negotiating peace accords to the Liberation Tigers of Tamil Eelam, another group designated as a terrorist organization by the United States. 70 Although, in its decision, the court acknowledged that its ruling limited freedom of expression (by banning assistance to humanitarian groups motivated solely by reducing the strife caused by conflict and aiding people facing extreme existential crises), it remained unmoved in its desire to defeat terror by criminalizing speech that could redound in some esoteric way to the indirect benefit of groups considered terrorist by the United States. “Such support frees up other resources within the organization that may be put to violent ends. It also importantly helps lend legitimacy to foreign terrorist groups—legitimacy that makes it easier for the groups to persist, to recruit members, and to raise funds—all of which facilitate more terrorist attacks.” 71 The court, unfortunately, failed in its judicial opinion to offer any compelling evidence, empirical or anecdotal, to support its theoretical contention that terrorist organizations have ever financed terrorist attacks by shifting resources, as the result of humanitarian aid or advice, that such groups have managed to burnish their image through associations with humanitarian groups who seek to distribute aid and expertise during times of crisis, or that they have somehow parlayed this advice into a recruitment tool. The sole basis for the court’s insistence that free speech must be curtailed was ostensibly premised upon thwarting a theoretical future harm that outweighs all humanitarian or charitable benefits: benefits whose tangible contributions to those suffering in war-torn and disaster-stricken countries could be measured in lives saved, meals provided, and peace brokered. The lower courts in the United States have continued to expand the contextual scope of material support as well as broaden the meaning of “coordination” with a terrorist organization under the Humanitarian Law Project precedent, which allows the criminalization of speech if done at the direction or coordination of a group designated by the United States as terrorist. That was the case against Tarek Mehanna, who was charged in Massachusetts with providing material support to terrorists (namely Al Qaeda) by translating jihadi texts from Arabic and then aiding in their dissemination by “coordination” as defined under the Humanitarian Law

88

CHA P TER 3

Project case. However, these translations were never done in coordination with Al Qaeda, and according to a petition filed by Mehanna’s attorney seeking to overturn his sixteen-year prison sentence, his conviction “rested entirely upon Mehanna’s translation and dissemination of texts that he selected as expressive of his political or religious views. This core First Amendment activity was not commissioned, directed, paid for by, performed in concert with, or presented to a foreign terrorist organization.” 72 In the HLP case, which established the expansion of material support to include coordination, the word was never clearly defined. However, the court did state in its opinion that its ruling did not apply to speech that “independently advocat[es] for a cause.” 73 The government, in seeking to extend the applicability of material support, was arguing for the most expansive interpretation of coordination to further prosecute speech and enlarge the scope of language criminalization. This prosecutorial aggression was anticipated by the three dissenters in HLP, who argued presciently in their dissent that the coordination expansion of material support would lead to prosecutions for protected speech, which would ultimately chill freedom of expression protected under the First Amendment. The prosecution in Mehanna’s case argued that, because he expressed sympathies for Al Qaeda, encouraged “people to engage in jihad,” and posted his translations online, he was providing a service to the terrorist group. 74 Mehanna’s lawyers argued, in their petition seeking judicial review of Mehanna’s conviction, that “the government’s case rested on Mehanna’s expressions of moral support for a foreign terrorist organization, and his interactions, on the Internet, with persons with whom he shared views.” 75 Mehanna’s lawyers sought a review based upon a judicial error in jury instruction, the judge telling the jury that they could decide as a factual matter whether Mehanna’s actions were “coordinated” with Al Qaeda. 76 Having heard from the prosecution that Mehanna had traveled to Yemen to seek training from Al Qaeda and to enlist in jihad against the American military in Iraq, the jury found Mehanna guilty, sentencing him to sixteen years of incarceration for providing material support to a terrorist organization. Analysis In the years following 9/11, a confluence of events and circumstances in America coalesced into the creation of a political and cultural environ-

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

89

ment conducive to the suppression of speech and the criminalization of language. Historically, the United States has weathered periods of hostility to the freedom of expression, and although certain political groups had sought to advance their own policy agenda by silencing their critics through the imposition of then lawful limitations on their ability to freely voice their opinions, these restrictions on speech were later lifted after the threat to security dissipated. After the Supreme Court’s decision in Brandenburg and content-oriented prohibitions on speech were deemed unconstitutional, the government has been slowly and surreptitiously eroding freedom of speech through enforcement of counterterrorism laws initially designed to prevent the material support of organizations committing acts of terrorism. However, during the same period of aggressive escalation in speech suppression in America, the threat of terrorist attacks has declined precipitously. The explanation for the historically unprecedented steady growth of increased legal limitation on free speech and the decreasing threat of violence through terrorist attack, which would ostensibly justify the gradual encroachment of civil liberties, can be partially found in the political exploitation of genetic predispositions. Neuroscience research indicates that political leaders trying to gain power or attain political advantage derive gratification from maintaining higher levels of dopamine, which results in an emotionally detached sense of empathy, divine thinking, and a need to defeat opponents seeking to challenge their authority; this mental state is conducive to behavior that would suppress opposition and confer political benefits by outlawing speech and intimidating opponents or, alternately, strengthen one’s image as a tough politician to appeal to a particular constituency. The correspondingly higher levels of dopamine in the brain compound the likelihood of cognitive errors, as well as perpetuating the neurological continuation of a political belief system by embedding these beliefs through synaptic reinforcement, which makes one resistant to acknowledging previous errors in cognitive thought. The impulse to exert control by suppressing speech and criminalizing language is not reserved to the political elite but lies within anyone operating socially with an external locus of control: from the president of the United States to a state governor, a mayor, a chief of police, a manager of a restaurant, or a parent of a small family. The genetic factors that govern the manner in which people react to the social world around them, their openness to different ideas or their innate rejection of anything new and beyond their previous understanding, indelibly

90

CHA P TER 3

inform how they respond to laws that criminalize speech. Those who are amenable to the enactment and punitive enforcement of laws that suppress speech and criminalize language tend to defer to rigid cultural norms, espouse deference and loyalty to authority, and are slow to engage in critical thought that may cast the motivation of those in power into skepticism. Furthermore, those with a genetic predisposition to conservative thought quickly galvanize opinion against those who may be seen as disloyal to their group and embrace an absolutist tendency that promotes an “us versus them” mentality that can exacerbate divisions. The genetic divisions that delineate politically conservative ideology are often embroidered in a “right versus wrong” ethos that makes mending these divisions and finding common interests of compromise exceedingly difficult. The genetically progressive instinct is noted in the Settle and Dawes study, which points out that a higher degree of openness and acceptance of new ideas can in fact work at cross-purposes in attempts to achieve political détente, or even the desire for media objectivity. The desire to be open to, and entertaining of, ideas born of ignorance and prejudice only lends false credibility to those ideas (e.g., discussions regarding climate change or gun control, both emotionally charged political debates where science and statistics clearly favor one side of the policy debate, but each is accorded equal weight). In the wake of Iqbal’s case, and its successive judicial progeny, the opinion persistently advanced by proponents of speech suppression is that we are embroiled in a perpetual battle with militant Islamic extremists who are determined to strike at any given moment, and speech that in any way gives them aid, comfort, or even a voice via translation poses an existential threat that requires the suspension of constitutional liberties. This spurious argument is not borne out by the facts, and the government’s actions to criminalize speech are disproportionate to the threat it poses: terrorist attacks on the United States coordinated with foreign terrorist groups in the years following 9/11 are nonexistent; the number of reports related to terrorism in the media has declined in the last five years (although as a subject, terrorism coverage in the media is also disproportionate to the number of deaths it causes, an example being the number of deaths associated with food poisoning in the United States, which kills thousands more Americans every year than terrorism but receives a paltry fraction of the coverage). But in stark contrast to this heartening trend, and against logic, historical precedent, and judicial prudence the number of criminal prosecutions for speech

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

91

legally construed as material support is increasing, and the number of cases that have sought to expand the definition of material support and coordination is increasing. This broad trend toward the criminalization of language is the consequence of the calculated manipulation of conservative fear born of genetic impulse, coupled with the progressive instinct to remain tolerant of foreign ideas, even those that may lead to sacrifices in liberties. Conservative politicians have constituencies comprised mainly of individuals with an external locus of control, making them inclined to obedience to authority, inclined to fear those who pose a threat to the security of their group, and repulsed by the possibility of foreign intrusion into their social organization; they avowedly maintain the intellectual purity of the ideological precepts of their politics. Research has shown that activating this reactionary core of conservative voters energizes Republican voters and enhances electoral turnout; thus, inciting this type of fear triggered by genetic impulse will be politically rewarding. For progressives, pursuing a muscular stance on the criminalization of speech helps to politically evade the perennial accusation of fecklessness (and being labeled as weak on law enforcement and terrorism) and defeat the conservative conflation of Democrats’ First Amendment arguments for free speech protection with disloyalty and dissension (e.g., witness the debate on flag burning and free speech protections). President Obama and Attorney General Eric Holder, embracing the earlier cases of material support, further suggest that genetic predispositions are only partially determinative in how policies are formulated; social and political factors cannot be discounted, and political opportunism is more likely to be acting in concert with (or in opposition to) genetic impulses. However, the cross case study below explores what the consequences are when the government shifts its support for behavior it has previously condemned as material support for terror, advocating the same support for activities of terror waged against our enemies. The case study considers how the need for a political expedient to advance the vested interests of the country, using actions vilified before as nefarious acts of terror, may foment the potential for contradictory messaging. With inconsistent ideological justifications for comparable actions (regarding the need to criminalize speech as supportive of terrorism when it is threatening to prevailing American political sentiment and endorsing speech that sponsors terrorism against our enemies), the possibility of creating cognitive dissonance in the minds of the electorate grows exponentially.

92

CHA P TER 3

Mujahedeen e-Khalq The Mujahedeen e-Khalq (MEK), also known as People’s Mojahedin Organization of Iran, formerly designated for fifteen years as a terrorist organization (delisted in 2012 by the Obama administration), is a dissident group that seeks the overthrow of the current Iranian government. 77 Long aligned with Saddam Hussein in Iraq’s protracted conflict with the Iranian nation, MEK has been headquartered in Iraq for dozens of years, operating cross-border incursions into Iran; MEK’s presence in Iraq was once invoked by President Bush, in 2003, as a justification for invasion, citing Iraq’s “sheltering” of MEK as tantamount to state sponsorship of international terrorism. 78 Bush certainly had ample grounds for labeling MEK an international terrorist group, and its links to political violence are abundant, having executed terrorist attacks, assassinations, kidnappings, and espionage against both Iran and the United States. In addition to a spate of kidnappings and assassinations of U.S. diplomats and military personnel (including the attempted kidnapping of U.S. ambassador Douglas MacArthur II), 79 MEK’s admitting to the brutal murders of three American contractors working for Rockwell International was documented in a report authored by Lincoln Bloomfield, a former Department of Defense official. 80 MEK operatives are also believed to be responsible for coordinated assassinations of Iranian nuclear scientists, covert plots widely understood as funded by Israel and the United States. 81 The delisting of MEK coincides with shifting political support for an organization now perceived as instrumental in achieving a counterbalance in the Middle East, undermining Iranian power in a region where U.S. influence is seen as waning and Iranian power ascendant. Political and media figures within the United States have lent vociferous support to the delisting of MEK as a designated terrorist organization, receiving funds in exchange for their political backing. 82 This cross case comparative analysis will examine the criminal liability associated with statements by American officials that appear to violate the prohibition on providing material support through coordinated efforts with designated terrorist groups and consider the ideological implications of endorsing terrorist actions perpetrated by the MEK against U.S. enemies in the context of past ethical repudiation of the same acts when directed by Muslims toward U.S. interests. Furthermore, this contradictory messaging engenders cognitive dissonance in the minds of the electorate and gives impetus to changes in

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

93

policy preferences regarding the war on terror and the credibility of government communications. The historical credentials of MEK as a terrorist organization stretch back into the 1970s, when the contractors for Rockwell International mentioned above were killed in Iran, along with three military officers. 83 During the 1979–1980 Iran hostage crisis, MEK publicly lauded the decision to take hostages at the U.S. Embassy. In 1981 MEK bombed the political headquarters of the Islamic Republic Party in Tehran killing seventy people. Between 1998 and 2001, MEK has assumed responsibility for over a dozen attacks on Iranian civilian and military targets, and Elaine Sciolino reported that, although the MEK leadership publicly denounced the Al Qaeda attacks on 9/11, the destruction of the World Trade Center towers was jubilantly celebrated in private (MEK has been linked in previous reporting to Sheik Abdul Rahman, the convicted mastermind of the first bombing attack on the towers). 84 With a history of terrorist atrocities committed against Americans as well as Iranians, and a brazen penchant for claiming public credit for barbarous acts condemned by earlier presidents and used as justification for the preemptive invasion of a sovereign nation, enlisting political support among American officials for MEK and proposing the organization be delisted as a terrorist group would seem a dauntingly insurmountable endeavor. It would prove to be easier than expected. In a 2009 Brookings Institution paper titled “Which Path to Persia?,” advocates of supporting the MEK as a U.S. proxy force to unseat the clerical leadership in Iran outlined an audacious plan: a coordinated public relations campaign to change the image of MEK from terrorist organization to pro-American ally in the struggle to introduce democracy in Iran. 85 MEK’s record of opposition to the current Iranian government and its record of successful attacks and effective espionage (in 2002 it provided the U.S. intelligence community with information that led to the discovery of a secret uranium enrichment plant) made it an arguably invaluable partner in the battle against Islamic extremism, and advocates argued that the benefits of an alliance justified its removal from America’s list of terrorist organizations. Once delisted, the United States would be legally unconstrained to provide direct support to MEK’s activities against the Iranian regime. Although the report failed to mention that the United States (along with Israel) was already engaged in covertly supplying the MEK with provisions in its attacks against Iran, government offi-

94

CHA P TER 3

cials began to accept payments from MEK to politically support their agenda of delisting. “The U.S. State Department needs to de-list the MEK immediately!” thundered former U.S. Ambassador Mitchell Reiss in April, 2011. 86 “Delisting MEK is clearly the right thing to do. It’s way past time to do that,” echoed former Joint Chiefs Chairman General Richard Myers. 87 Former Homeland Security Advisor to George W. Bush, Fran Townsend, interviewed on CNN, referred to Iran’s behavior as “an act of war,” while failing to mention the funds she had received from MEK as a paid advocate. 88 These MEK spokespersons, having received thousands of dollars in compensation for their ringing endorsement of the newly discovered rectitude of MEK’s purpose, included political luminaries from both parties in the United States: Democrat and former presidential candidate Howard Dean, former New York City Republican mayor Rudy Giuliani, and prominent attorney Alan Dershowitz. 89 Politicians are not the only target of MEK largesse; Carl Bernstein of the Washington Post has been retained for his strident advocacy as well. The MEK campaign to enlist public figures to support its political objective of delisting as a terrorist organization (and legitimize its eligibility for increased military funding) was a carefully orchestrated plot that “has seen large sums of money directed at three principal targets: members of Congress, Washington lobby groups and influential former officials.” 90 These payments had not gone unnoticed. The Treasury Department opened an investigation into payments received by MEK beneficiaries, including former FBI Director Louis Freeh and former U.S. Attorney General Michael Mukasey. Washington attorney Eric Ferrari remarked, “People were asking a lot of questions. Why were they not being investigated? How are they getting away with this?” 91 Lawyers for the MEK argued that individuals who received payments from MEK for political support were engaging in speech protected by the First Amendment, notwithstanding MEK’s status as a terrorist organization. “Now that may be a fine line—it may even be a Byzantine line to draw. But, it is a line, and it is an important one, because it goes to the question as to whether American citizens have the right to speak their minds,” argued attorney Steven Schneebaum. 92 This familiar argument raises the more trenchant question of whether this fine line only protectively encircles language spoken in support of terrorist groups who commit acts that favor American interests and punishes any language that falls outside this fine

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

95

line—a malleable line that may be easier to define in relation to its movement, as opposed to its permanency. As investigations into payments from MEK to various American officials proceeded apace, Iranian’s concerned about MEK influence on U.S. politics was adamant: “They are still on the terrorist list. The laws still apply. It is illegal in every sense of the word to support them now,” exclaimed Trita Parsi of the National Iranian American Council. 93 While estimates of the dollar amount paid to MEK supporters, who offered speaking and lobbying services on their behalf, varied between $15,000 and $30,000 a speech, a deeper question was where precisely the generous financial support originated. 94 MEK, which was based for twentyfive years in Camp Ashraf, an Iraqi refugee camp, hardly had the necessary resources to fund such an extensive media relations and lobbying campaign. From 1980 to 2003, MEK was funded by Saddam Hussein, providing Iraq with various military and terrorist services, fighting with Iraqi forces against the Ayatollah in the Iraq-Iran War, and suppressing Kurdish and Shia insurrections within Iraq. 95 However, after the fall of Hussein, and being branded an international terrorist organization, MEK sources of revenue were strained. Reports indicated that one of MEK’s primary sources of income resided in services provided to the State of Israel, where, unnamed U.S. officials have asserted, the Israeli Mossad had trained and paid MEK operatives to conduct terror operations inside Iran, most notably car bombings against nuclear scientists, such as Mostafa Roshan, director of Iran’s Natanz uranium enrichment facility, who was assassinated in Tehran by two assailants on motorcycles who attached a magnetic bomb to Roshan’s car. 96 Israel would neither deny nor confirm its involvement in the attack. If the sources of MEK funding are true, the implications are staggering; money earned by MEK from terrorist attacks committed against Iran was being used to purchase support for an organization that sought additional U.S. funding to carry out further terrorist attacks against Iran. Thus widening the fine line into a yawning chasm, it would be difficult to reconcile the acceptance of funds from MEK with the exercise of free speech, under the definition of material support articulated by the Supreme Court. However, as the United States in September 2012 delisted MEK as a terrorist organization, the grounds for conducting the investigations into MEK contributions to public figures seem to have become a moot issue to prosecutors, and no charges were ever pursued. “Given that U.S. officials have recently acknowl-

96

CHA P TER 3

edged that the MEK is still conducting terrorism in Iran, where is the evidence MEK has abandoned terrorism?” asked National Iranian American Council policy director Jamal Abdi, commenting on the delisting of MEK as a terrorist organization. “The multi-million dollar lobbying campaign undertaken by the MEK and its supporters seems to have paid off.” 97 In fact, Abdi’s remarks understate the import and implication of the MEK contributions and their successful efforts to delist their organization as a terrorist group. The MEK case illustrates a number of troubling comparative disparities when considered in contrast to the Iqbal case and its progeny, and strongly indicates that counterterror laws that criminalize speech are being implemented discriminatorily. As detailed in the Iqbal case study, law enforcement agencies and the courts have been eager to expansively interpret material support of terrorism to include any actions or financial contributions conducted in coordination with a terrorist organization, even if those actions facilitated humanitarian relief and aided in the resolution of violent conflict. Courts have even returned convictions (with lengthy sentences of incarceration) for simply translating and publishing texts from Arabic into English, absent any contact or coordination with a terrorist group. The aggressive prosecution of the actions described in the Iqbal case study clearly establishes the government’s intent to criminalize any speech (whether broadly construed in the form of charitable donation, legal advice, or translation activity) that provides even a vague intangible possibility of voicing support for a cause considered as anti-American in its message. However, the MEK comparative case study proves that the U.S. government will desist in prosecuting (or even investigating) speech that satisfies all the legal criteria for constituting material support for a terrorist organization, if the acts of terror are directed against purported American enemies (with the added bonus of lucrative speaking fees for political supporters). The elastic approach the U.S. justice system has taken to defining terrorism (and the material support thereof), categorizing only the speech of its enemies as those of terror, and lionizing the same language spoken in the name of U.S. interests as protected speech under the Constitution is a contemptible debasement of the Constitution itself. Discriminatory application of counterterror laws and the malleable treatment of the term “terrorism” render the term, as well as the law, meaningless. Once the law has been stripped of its meaning, and terms have been massaged and bent to serve the political

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

97

will of those who speak on payment from terrorists, the law no longer serves its people. A democracy with laws that no longer serve its people ceases to be a democracy.

CONCLUSION American history has been a cosignatory of speech constrictions, and balancing the need for security and preserving the safety of the state with the constitutional freedoms of speech and expression that contribute to a vibrant democracy has been an arduous challenge for the country and its government. The judicial pendulum has swung precariously during tumultuous times of war, suppressing speech in the interests of staving off the threat of foreign incitement to insurrection or to discourage the spread of political sentiment that could lead to unrest during times of turmoil. Throughout American history, these threats have been exploited by political opportunists to attain advantage, promote an agenda, or suppress a minority. These impulses to acquire power, and the public’s response to language used to exert control through the calculated evocation of external threats, are predicated largely on genetic predisposition. Conservatives, who possess an external locus of control, are more inclined to suspend disbelief, are less skeptical, more loyal, and given to trust authority. Liberals are more genetically prone to challenge received knowledge, are more critical of authority, and are not subject to belief absent evidence. Conservatives therefore, in the main, are more susceptible to accepting the rationale that justifies prohibitions on speech as posing threats to the security of the nation, whereas liberals are more skeptical and require a higher degree of proof to be swayed in their policy preferences. In the case study analysis we examined events in which the criminalization of speech was aggressively prosecuted against political minorities in America who held unpopular views and were largely labeled in the conservative press as constituting an existential threat to American ideological principals, and contrasted this with a case in which the same behavior was committed by U.S. proponents of a terror group that directed its attacks against an American enemy and was dismissed by the U.S. government. The case study analysis suggests that inconsistent and contradictory messaging undermines the validity of the law, erodes confidence in the equitable application of counterterror laws specifically, and

98

CHA P TER 3

creates the potential for cognitive dissonance in the minds of the electorate that can impact policy choices.

NOTES 1. Posner, Richard, Sex and Reason, Harvard University Press (1994). 2. The Sedition Act and the Alien Friends Act expired in 1800 and 1801, respectively. The Alien Enemies Act remains in force as 50 USC Sections 21–24. 3. 18 U.S.C. § 792 et seq. 4. 50 U.S.C. ch. 23, subch. I. 5. Ibid note 2. 6. Quote found in Letter to Abigail Adams, July 22, 1804. 7. 17 F. Cas. 144 (C.C.D. Md. 1861) (No. 9487). 8. Rollin C. Hurd, A Treatise on the Right of Personal Liberty and on the Writ of Habeas Corpus, revised with notes by Frank H. Hurd (Albany, 1876). 9. Hobson, Charles, The Great Chief Justice: John Marshal and the Rule of Law, University of Kansas Press (1996). 10. Ebeling, Richard, The Failure of America’s Foreign Wars, Future of Freedom Foundation (1996). 11. Ibid note 3. 12. Donahue, Laura, “Terrorist Speech and the Future of Free Expression,” Cardozo Law Review 27 (2005): 234. 13. Ibid. 14. Ibid. 15. Ibid. 16. Ibid. 17. Ibid. 18. 341 U.S. 494 (1951). 19. 89 S. Ct. 1827 (1969). 20. Ibid. 21. Schwartz, Bernard, “Holmes Versus Hand: Clear and Present Danger or Advocacy of Unlawful Action?,” Supreme Court Review (1995): 237. 22. Healy, Thomas, “Brandenburg in a Time of Terror,” Notre Dame Law Review 84 (2009): 656. 23. Holder v. Humanitarian Law Project , 561 U.S. 1 (2010). 24. Ibid. 25. McNamara, Lawrence, “Counter-Terrorism Laws: How they Affect Media Freedom and News Reporting,” Journalism Testing Legal Boundaries: Me-

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

99

dia Laws and Reporting of Arab News, Arab Media Centre, University of Westminster (June 20, 2008). 26. Cited from “Report on Revised Media Guidelines.” Attorney General selected publications. US Dept of Justice. July 12, 2013, retrieved May 4, 2014. The Privacy Protection Act of 1980 (PPA), 42 U.S.C. § 2000aa, generally prohibits the search or seizure of work product and documentary materials held by individuals who have a purpose to disseminate information to the public. The PPA, however, contains a number of exceptions to its general prohibition, including the “suspect exception,” which applies when there is “probable cause to believe that the person possessing such materials has committed or is committing a criminal offense to which the materials relate,” including “the receipt, possession, or communication of information relating to the national defense, classified information, or restricted data” under enumerated code provisions. See 42 U.S.C. §§ 2000aa(a)(\) and (b)(\). Under current Department policy, a Deputy Assistant Attorney General may authorize an application for a search warrant that is covered by the PPA, and no higher level reviews or approvals are required. 27. Matt Smith and Joe Johns (May 14, 2013). “AP Blasts Feds for Phone Records Search.” CNN, retrieved May 15, 2013. 28. Dana Milbank (May 21, 2013). “In AP, Rosen Investigations, Government Makes Criminals of Reporters.” Washington Post, retrieved July 16, 2013. 29. Espionage Act of 1917, 18 U.S.C. § 792 et seq. 30. “Reporters Covering Occupy Wall Street Being Targeted for Arrest Nationwide,” archived at http://www.washingtonsblog.com/2011/11/reporters-covering-occupy-wall-street-are-being-targeted-for-arrest-nationwide.html, retrieved on April 10, 2014. 31. Aamer Madhani and Kevin Johnson (May 21, 2013). “Are Justice Department Leak Probes Causing a Chill?,” USA Today, retrieved June 1, 2013. 32. The Editorial Board (May 21, 2013). “Another Chilling Leak Investigation.” New York Times, retrieved July 16, 2013. 33. United States v. Reynolds, 73 S. Ct. 528, 1953, A seminal case in which the court recognized the State Secrets Privilege, which expands presidential power by allowing the lawful withholding of evidence if the release of information undermines military secrecy and thereby threatens national security. 34. Ibid note 25. 35. Ibid. 36. Shermer, Michael, The Believing Brain: From Ghosts and Gods to Politics and Conspiracies—How We Construct Beliefs and Reinforce Them as Truths, Times Books (2011), pp. 113-37. 37. Ibid. 38. Ibid.

100

CHA P TER 3

39. Nayef R. F. Al-Rodhan, “‘Emotional Amoral Egoism:’ A Neurophilosophical Theory of Human Nature and Its Universal Security Implications,” LIT Verlag (January 11, 2008). 40. Ibid. 41. Ibid. 42. Tremblay, Rodrique, The New American Empire, Infinity Publishing (1st edition) (2004). 43. Robertson, Ian, “Like Baboons, Our Elected Leaders Are Literally Addicted to Power,” The Telegraph, August 26, 2012, archived at http:// www.telegraph.co.uk/science/9228257/Like-baboons-our-elected-leaders-areliterally-addicted-to-power.html, retrieved on April 10, 2014. 44. Brugger, P. and Mohr, C., “The Paranormal Mind: How the Study of Anomalous Experiences and Beliefs May Inform Cognitive Neuroscience,” Cortex 44, no. 10 (2008), as cited in Shermer, p. 119. 45. Ibid. 46. Ibid. 47. Settle, J., Dawes, C., Christakis, N., and Fowler, J., “Friendships Moderate an Association between a Dopamine Gene Variant and Political Ideology,” Journal of Politics 72, no. 4 (2010). 48. Ibid. 49. Ibid. 50. Ibid. 51. Williams, Timothy, “New York Man Charged with Enabling Hezbollah Television Broadcasts,” New York Times, August 25, 2006, archived at http:// www.nytimes.com/2006/08/25/nyregion/25tv.html?_r=0, retrieved on April 12, 2014. 52. Ibid. 53. Release titled “Staten Island Satellite Television Operator Pleads Guilty to Providing Material Support to Hizbollah TV Station,” United States Attorney’s Office for the Southern District of New York, December 23, 2008. 54. Ibid. 55. Pincus, Walter, “New Yorker Arrested for Providing Hezbollah TV Channel,” Washington Post, August 26, 2006, archived at http:// www.washingtonpost.com/wp-dyn/content/article/2006/08/24/ AR2006082401461.html, retrieved on April 14, 2014. 56. Ibid. 57. Ibid. 58. Jorisch, Avi, “Beacon of Hatred: Inside Hizballah's Al-Manar Television.” Washington Institute for Near East Policy (2004). 59. Ibid. 60. Ibid.

T H E CRI M I N ALI Z AT I ON OF LA NGUA GE

101

61. Saul, Ben, Research Report for the Australian Communications and Media Authority, Titled International Approaches to Regulating Al-Manar Television and other Terrorist Related Content, 2011, archived at http://www.acma. gov.au/webwr/_assets/main/lib310780/intntl_approaches-regulation-al-manar_ tv_and_terrorism-related_content.pdf. 62. “Questions and Answers on Hostilities Between Israel and Hezbollah,” Human Rights Watch, August 2, 2006, archived at http://www.hrw.org/en/news/ 2006/08/01/questions-and-answers-hostilities-between-israel-and-hezbollah. 63. Ibid note 55. 64. Ibid. 65. Ibid. 66. Ibid. 67. Ibid. 68. Holder v. Humanitarian Law Project, U.S. Supreme Court Brief Filed by the U.S. Solicitor General, Docket Nos. 08-1498 and 09-89, archived at http:// www.justice.gov/osg/briefs/2009/3mer/2mer/2008-1498.mer.aa.html, retrieved on April 20, 2014. 69. 561 U.S. 1 (2010). 70. Barak-Erez, Daphne and Scharia, David, “Freedom of Speech, Support for Terrorism, and the Challenge of Global Constitutional Law,” Harvard National Security Journal 2 (2011): 1. 71. 561 U.S. 1 (2010). 72. "U.S. Citizen Petitions Supreme Court Saying Terrorist Support Conviction Violates First Amendment Rights," Georgetown Security Law Brief, March 14, 2014, archived at http://www.securitylawbrief.com/main/2014/03/us-citizenpetitiones-supreme-court-saying-terrorist-support-conviction-violates-firstamendment-rig.html, retrieved April 20, 2014. 73. 561 U.S. 1 (2010). 74. Pyetranker, Innokenty, “Sharing Translations or Supporting Terror? An Analysis of Tarek Mehanna in the Aftermath of Holder v. Humanitarian Law Project,” American University National Security Law Brief 2, no. 2 (2012), archived at http://digitalcommons.wcl.american.edu/nslb/vol2/iss2/3, retrieved on April 20, 2014. 75. Ibid. 76. Ibid. 77. Masters, Jonathan, “Backgrounder on the Mujahedeen e-Khalq,” Council on Foreign Relations, 2012, archived at http://www.cfr.org/iran/mujahadeen-ekhalq-mek-aka-peoples-mujahedin-iran-pmoi/p9158, retrieved on April 20, 2014. 78. Greenwald, Glenn, “Five Lessons from the De-listing of MEK as a Terrorist Group, A Separate Justice System for American Muslims, the US Embrace

.

102

CHA P TER 3

of Terrorism, and Other Key Political Facts Are Highlighted,” The Guardian, September 23, 2012, archived at http://www.theguardian.com/commentisfree/ 2012/sep/23/iran-usa, retrieved April 20, 2014. 79. Bill, James A., The Eagle and the Lion. Yale University Press (1989), p. 181. 80. Carlucci, Tony, “American-Killing Terror Cult: US Delists Mujahedeen e-Khalq (MEK),” Global Research (September 22, 2012), archived at http:// www.globalresearch.ca/american-killing-terror-cult-us-delists-mujahedeen-ekhalq-mek/5305673?print=1, retrieved on April 20, 2014. 81. Ibid. 82. Ibid. 83. Ibid 84. Ibid. 85. Ibid. 86. “United States/Iran: U.S. Investigates American Support of Iranian Dissident Group,” Thai News Service, May 17, 2012, archived at www.newsawy.com/goto.php?id=1953852200, retrieved on April 20, 2014. 87. Ibid. 88. Ibid. 89. Shane, Scott, “Iranian Dissidents Convince U.S. to Drop Terror Label,” New York Times, September 21, 2012, archived at http://www.nytimes.com/ 2012/09/22/world/middleeast/iranian-opposition-group-mek-wins-removalfrom-us-terrorist-list.html?pagewanted=all, retrieved on April 20, 2014. 90. McGreal, Chris, “MEK Decision: Multimillion-Dollar Campaign Led to Removal from Terror List, Revealed: The Steady Flow of Funds to Members of Congress, Lobbying Firms and Former Officials in Support of Iranian Group,” The Guardian, September 21, 2012, archived at http://www.theguardian.com/ world/2012/sep/21/iran-mek-group-removed-us-terrorism-list, retrieved on April 20, 2014. 91. Ibid. 92. Ibid. 93. Tovrov, Daniel, “MEK Pays US Officials, But Where Do The Iranian Exiles Get Their Money?,” International Business Times, March 29, 2012, archived at http://www.ibtimes.com/mek-pays-us-officials-where-do-iranianexiles-get-their-money-214388, retrieved on April 20, 2014. 94. Ibid. 95. Ibid. 96. Ibid. 97. Abdi’s statement is available on the National Iranian American Council website at http://www.niacouncil.org/mek-delisting-is-a-gift-to-the-regime-adisaster-for-the-iranian-people-and-the-u-s/, retrieved April 20, 2014.

4 GENETIC PREDISPOSITION, RELIGIOUS BELIEF, AND PSYCHOLOGICAL OPERATIONS IN THE WAR ON TERROR

A great deal of intelligence can be invested in ignorance when the need for illusion is deep. —Saul Bellow, To Jerusalem and Back, 1976

Millennia ago, on the eve of mankind’s ignorance and before the first light of the dawn of civilization’s enlightenment, humans struggled in the quest to find answers to existential questions. In the early attempts to uncover the meaning behind the cycle of the seasons and the rotation of the burning orb in the sky and to assign some rationality to the seemingly chaotic nature of life on Earth, humans began to develop systems of belief through patterned observations to explain the unknown world that they occupied. The need to understand this early world, filled with danger and violence, was the same need that compelled man to survive. This need, the will to live and to propagate, is a need that is encoded in our very DNA. This genetic incentive impelled humans to recognize patterns in the world around them and to seek meaning in those patterns in order to predict future events; the benefit of comprehending the migratory patterns of foraging deer to hunt or recognizing agrarian patterns that determined the most auspicious time to plant would have been the difference between life and death. A human’s ability to assemble these observations of the natural world, and derive benefits through discerning the patterns of its operation, would confer an advantage that would contribute to his suc-

103

104

CHA P TER 4

cess, and through the process of natural selection his offspring would then inherit those same traits that enabled their father to survive. It has been suggested that this early genetic impulse to understand the world, which programmed mankind for survival, would also give rise to beliefs based upon observations that would eventually evolve into organized religion. The need for early nomadic tribes to survive required the formation of social solidarity, repelling external threats and enforcing a moral code among members. Nascent forms of pagan mythology distilled the fears of a horrifyingly unknown world into a mystical system of beliefs that gave order to the universe. This numinous order would provide an emotional stability and physical security that would ensure the continuation of early mankind’s existence, but the innate desire to seek spiritual answers would later enfeeble future mankind’s ability to escape the irrationality of supernatural ideas. This chapter concerns itself with the calculated manipulation of mankind’s faith in organized religion; the inducement of belief (Muslim or Christian) to enforce a social order, repulse an outside threat, and command deference to authority by melding the military with the Almighty. The use of spiritualism and the language of religion as a tool of war is multifaceted; it lends a righteous dignity to the slaughtering of the other and, in some religions, the promise of eternal reward for the killing of an enemy in a holy war. Imbuing war with religious import also casts the enemy in absolutist terms, undeserving of sympathy and denied humanity; they are “evil” and beyond redemption. Conflating the political and diplomatic with the religious also diminishes the opportunity for peaceful rapprochement; we don’t negotiate with “Islamofascists” or the “Christian Infidel,” we simply kill them. Waging holy war also conveniently shifts accountability away from the state aggressor; when military policy is endorsed by God, the politician who orders the soldier to pull the trigger can step out of the line of fire by invoking the mysteries of God’s plan when failed invasions and lost lives demand an accounting. For the above reasons, the use of religion in fomenting war has become increasingly popular among nation-states, and has been used to devastating effect. This chapter will further consider how language can be used as an instrument of religious coercion, through its use in propaganda and, in particular, psychological operations directed at both a nation’s enemies and its own population. Propaganda, as discussed in previous chapters, is the deliberate manufacture of language designed to shape public opinion.

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

105

Propaganda is often used in war, either to bolster domestic support for military action or, in the enemy, to discourage opposition or incite revolt against its government. Some propaganda used in wartime can be categorized as language used in psychological operations, or “Psy Ops.” This particular type of propaganda is generally used by the military in warfare and is aimed at achieving a desired psychological effect on an enemy’s values, beliefs, emotions, and behavior. Unlike loosely defined “propaganda,” Psy Ops are intended to be used by the U.S. military only against foreign states and persons, and it is an express violation of American law to target the domestic population with psychological operations. The case study segments of this chapter will examine how religious propaganda and Psy Ops have been used in the U.S. war in Iraq to distort perceptions, engender fear and hatred, enlist support for war based upon spiritual motivations, and diminish the potential for peace by establishing irreconcilable divisions among nations and religions. The first case will explore religious propaganda used in the U.S. to foment and justify war and then its use in Iraq during and after the war to ostensibly quell possible Muslim uprisings against the U.S. occupation and to undermine religious affinities (which are inextricably tied to political affiliation) to sow divisions among Iraqi political groups. The second case study will focus on U.S. military Psy Ops directed toward a domestic American target in promoting the war in Afghanistan: the U.S. Congress. During the American war in Afghanistan, soldiers who specialized in conducting psychological operations in warfare were ordered to target congressmen responsible for funding the war through congressional appropriation during their visits to Iraq to review military progress. This comparative cross case study will consider how the use of Psy Ops against Congress may impact the public perception of the use of propaganda and whether the two conflicting case studies create cognitive dissonance in the minds of voters that could impact policy preferences. In short, this chapter explores how a person’s genetic predisposition to belief in a higher power may be turned against them; as Jean Anouilh once adroitly noted: “Propaganda is a soft weapon; hold it in your hands too long, and it will move about like a snake, and strike the other way.”

106

CHA P TER 4

THE GOD GENE: HOW HUMANS ARE GENETICALLY PROGRAMMED TO EMBRACE SPIRITUAL BELIEF Mankind is extraordinarily inclined to religiosity; 84 percent of the world’s population belongs to one of approximately 10,000 organized religions currently being practiced, with Christianity (which can be further subdivided into 34,000 denominations) comprising the bulk of the world’s faithful, at roughly two billion people. 1 America, self-proclaimed as the most progressive, scientifically sophisticated country in the world, paradoxically boasts one of the highest concentrations of religious affiliation, with 92 percent of Americans expressing a belief in God. 2 With such an abundance of belief, the question of the origin of religious inclination has been a subject examined by many, with some finding that specific genes that control neurochemical balances in the brain can be linked to the belief in God and other researchers claiming that, although a biological explanation of belief is most likely, identifying a particular gene that alone inculcates the impulse to seek spiritual enlightenment is beyond current scientific methods of proof. All of the prominent theories of the biological origins of religion are considered below and then later contemplated in relation to the use of religion in propaganda and Psy Ops used by the U.S. military. Shermer points to three integral aspects of evidence to establish a biological basis for spiritual belief: evolutionary theory, comparative world religions, and behavioral genetics. Extrapolating from Darwinian evolution, Shermer posits that mankind developed religious beliefs as a mechanism to promote tribal mythologies that would perpetuate altruism, encourage conformity to the social order of the group, and ensure commitment to their collective interests, thereby enhancing the likelihood of the group’s survival. Essentially, this theory is the evolutionary equivalent of adhering to the old adage “United we stand, divided we fall.” Evidence for this theory of religion can be seen in what Shermer refers to as “human universals”: shared traits possessed by all humans. These human universals can be divided into two categories, general and specific. 3 General universals are exemplified by shared traits, for example, the common use of tools, feeling the same emotions like love and hate, and sharing similar grammar across different languages. Specific universals, which are closely associated with a belief in God, would include universally shared traits such as anthropomorphizing animals (myths involving

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

107

talking frog princes or the blue Indian elephant god, Ganesh), rituals surrounding death (American Indians’ sky burial), and supernatural beliefs regarding misfortune and fortune (from the black cat to the fortune cookie). 4 These shared traits regarding religiously related observances, all occurring within a diversity of cultures over time, suggest a genetic predisposition in their expression across boundaries of race, continent, and culture. Further evidence for the biological basis of spiritual belief can be derived from a comparative study of world religions. Over the course of the last ten thousand years of world history, mankind has invented ten thousand different religions and roughly one thousand gods. making every religious believer an atheist for hundreds of gods, save his own. 5 A comparative analysis of all religious mythologies can lend statistical insight into the likelihood of religion’s origin as a possible amalgamation of different historical myths, woven together over time and across ecclesiastical traditions that may be based upon a genetic precursor. Analogous to human universals, the use of religious mythologies, like man’s shared trait of using common grammar, demonstrates that the shared linguistic trait of religious mythology indicates the presumption of a genetic predisposition toward belief. An examination of the commonalties in mythical beliefs spanning different religions reveals narrative symmetries hard to dismiss as coincidence and provides ample evidence of a shared trait of supernatural belief, giving weight to the argument of a genetic origin for belief in the spiritual. Several examples of a shared mythical narrative that creates a commonality indicative of a genetic origin would be the flood myths in religious tradition as well as virgin births among messiahs and their resurrection after death. 6 In the Epic of Gilgamesh, written in 1800 BC, Utnapishtim was told by the Babylonian god Ea to build an ark in the shape of a cube, gather one pair of each animal, and load them on board the ship to weather a celestial storm sent by other gods to decimate life on Earth. Mortal virgin women, divinely impregnated by a god and issuing forth immaculately conceived messiahs, are also a common theme throughout different religious traditions. Dionysus, the Greek god of wine, was born to a virgin mother and later resurrected from the dead; he was said to possess the miraculous ability to turn water into wine. 7 Both stories precede their biblical progeny by over a thousand years. Following the death of Jesus, a comparatively obscure savior from Asia Minor named Appo-

108

CHA P TER 4

lonius was witnessed walking through doors and raising his followers from the dead. After he fled Roman accusations of witchcraft and suffered a less publicized demise, his followers insisted his ephemeral form had risen to the heavens after giving a few parting words to his acolytes. 8 The commonalties seen across different religious chronicles suggest the expression of a universally shared human trait, the genetically predisposed impulse to believe in a supreme power. Some researchers believe this genetic instinct can be precisely traced to one particular gene; they refer to it as the “God Gene.” Dean Hamer, a geneticist and director of the Gene Structure and Regulation Unit at the National Cancer Institute in the United States, propounded the theory that certain people are born with an inherent tendency toward spiritualism in his 2005 book The God Gene: How Faith Is Hardwired into Our Genes. 9 Hamer’s research identified VMAT2 (vesicular monoamine transporter 2) as a gene that could contribute to inducing feelings often associated with mystical thinking and the belief in God. VMAT2 is a protein membrane that facilitates the transport of dopamine in the brain and was previously identified by Robert Cloninger as a gene that influences spirituality on a scale quantified by self-transcendence. 10 Cloninger measures self-transcendence using three separate scalable factors: self-forgetfulness (the tendency to become completely absorbed in an activity, such as reading the Bible); transpersonal identification (a feeling of connection with the universe); and mysticism (an openness to things that exist beyond evidentiary proof, clairvoyance for example). Cloninger argued that these three scalable metrics, acting in concert, could quantify a personal tendency toward spiritual belief. This work was expanded upon by Nick Martin, an Australian atheist, and Lindon Eaves, a British lay preacher, who found that this tendency toward spirituality was genetic and estimated its heritability to be around 40–50 percent. Tim Spector, professor of genetic epidemiology at King’s College, London, finds this percentage “quite high given how tricky it is to measure” and that the studies “demonstrate our variable but innate inherited sense of spirituality.” 11 Hamer believes that a variant of VMAT2 that is connected to heightened self-transcendence opens the neurochemical pathways to flood the brain with higher levels of dopamine. As discussed in earlier chapters, dopamine levels in the brain have been positively correlated with an increased proclivity to belief and the suspension of skeptical thought and critical reasoning skills. Hamer argues that the dopamine-

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

109

induced feelings of self-transcendence are the genetic basis for the human belief in God. Hamer’s work, however, is not without detractors, in the scientific community as well as the religious. In Scientific American, Carl Zimmer contended that the VMAT2 gene only accounted for a miniscule percentage of the overall variance of self-transcendent scores, 12 and P. Z. Myers, while conceding its importance in regulating neurotransmitter activity, quipped, “one thing it’s not is a ‘God gene.’” 13 But Hamer’s most piquant criticisms have come from more orthodox precincts. Anglican priest John Polkinghorne denounced Hamer’s work, saying, “The idea of a God gene goes against all my personal theological convictions. You can’t cut faith down to the lowest common denominator of genetic survival. It shows the poverty of reductionist thinking.” 14 Be that as it may, from Galileo’s time to deGrasse Tyson’s, religious leaders have been forced to revise and adjust dogmatic apostolic principles to conform to irrefutable scientific proofs. And while the complex operation of neurochemical pathways in the brain may be more opaque than the orbital pathways of the planets, science continues its inexorable march toward a more finite understanding of the world that surrounds us, while organized religion seems stoically poised to block that path, vaunting the moral value of a possessing faith in the unknowable. This intransigent loyalty to orthodox opinion would seem to further reinforce the findings of the previous chapter; those genetically inclined to belief, and who resist skepticism, cannot be swayed in their faith by evidence. Interestingly, Hamer himself is careful not to speculate on the existence of God. Hamer responded to his clerical critics: “Religious believers can point to the existence of God genes as one more sign of the creator’s ingenuity—a clever way to help humans embrace a divine presence.” 15 Irrespective of the origin of belief, there is one clever way that spiritual belief has been used throughout the course of human history: to manipulate those who have it. The methods by which spiritual belief has been exploited to create divisions, spread fear, and spark war are discussed below.

110

CHA P TER 4

THE USE OF PSYCHOLOGICAL OPERATIONS IN WAR This conception of guerrilla warfare as political war turns Psychological Operations into the decisive factor of the results. The target, then, is the minds of the population, all the population: our troops, the enemy troops and the civilian population. This book is a manual for the training of guerrillas in psychological operations, and its application to the concrete case of the Christian and democratic crusade. . . . CIA: PSYCHOLOGICAL OPERATIONS IN GUERRILLA WARFARE A tactical manual for the revolutionary. First published by the U.S. Central Intelligence Agency and distributed to the Contras in Central America.

The science and art of influencing the mind to achieve political and military objectives is an ancient one. Sun Tzu, master Chinese tactician, wrote that the crucial element that determines the outcome in war is the exertion by leaders of a moral influence over those they govern, and “that which causes the people to be in harmony with their leaders so that they will accompany them in life and unto death without fear of mortal peril” will lend those leaders heavy advantage in war. 16 Psychological operations, defined as “the planned use of communications to influence human attitudes and behavior,” which can harmoniously implant a disconcern for death with a fealty to the designs of the directors of war, can be most effective in commanding obedience during state hostilities. 17 According to Colonel Alfred Paddock, former commander of the Fourth PSYOP Group at Fort Bragg and director of psychological operations in the Office of the U.S. Secretary of Defense, Psy Ops can be used to “unite, inform and bolster the morale” of war supporters and, when targeting groups that are neutral in the war, it can “be used to support military objectives by developing cooperative attitudes and behavior in the targeted group.” 18 The instrumentality of religion in service of achieving the goals of Psy Ops campaigns has been used by many different nations to obtain obsequious deference to powers bent on initiating wars, galvanizing moral support in the waging of wars, and sowing disunity to win wars. Propa-

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

111

ganda (discussed extensively in previous chapters), the deliberate crafting of messages to influence target audiences to shape their beliefs and opinions and affect behavior, is a common tool in the Psy Ops arsenal. However, under Executive Order S-1233, Department of Defense Directive S3321.1 and National Security Decision Directive 130, psychological operations conducted by any soldier in the U.S. military that targets U.S. citizens within the borders of the United States is illegal and strictly prohibited. This chapter explores the relatively recent expansion of Christian indoctrination within the U.S. military and seeks to determine if the systemic and exponential growth of programmatic proselytization can be viewed as a psychological operation; the chapter will also consider the concomitant impact of this exploitation (which may be based on genetic predisposition) of belief upon the perception of policies related to the war on terror. Although no documents are publicly available that would indicate that the U.S. military has a formal program of Christian indoctrination, this chapter’s case study will evaluate the mathematical magnitude of the increase in Christian programs within the military, the consequences soldiers face for refusing to embrace Christianity, the forceful messaging from military leadership, and the consequential changes among soldiers’ beliefs and attitudes—to determine whether a de facto program of Christian indoctrination in the U.S. military exists and if it can be inductively concluded that a psychological operation directed at American troops to shape their beliefs and emotions through the methodical manipulation of their belief in a Christian god is in effect. This primary case analysis will be contrasted with the comparative cross case study that considers a fully documented military Psy Ops program that was directed toward U.S. citizens and targeted members of Congress. In the case analysis, we will attempt to ascertain the relative strength and effectiveness of the two programs, their impact on policy preferences among voters, and whether any negative impacts could create uncertainty or cognitive dissonance regarding terror policy in the U.S.

112

CHA P TER 4

CASE STUDY Christian Indoctrination in the United States Military as Propaganda in a Psychological Operation In the United States, Christian and military indoctrination begin at a young age, and although historically their systems of influence have been deployed separately, more recently the two have enjoyed a confluence in implementation and can now be seen as operating increasingly in tandem to achieve a magnified effect. The merging of military culture with religious doctrine jointly reinforces the legitimacy of both institutions but pushes both to the precipice of constitutional prohibitions regarding the separation of church and state. This provision was intended to protect against the insidious encroachment by the state on religious freedoms and avoid the risk of discriminatory practices by government that would infringe upon citizens’ rights. And although many have voiced concerns that the relationship between the military and the Christian church has begun to create the appearance of legal and moral impropriety, the shared benefits accruing to each institution, coupled with each one’s undeniable importance in the lives of Americans, has made them collectively impervious to criticism. However, concerns that the indoctrination of U.S. military personnel has grave consequences outside of American constitutional concerns have equal resonance. The propagation of a U.S.–Christian-military hegemony that seeks to impose its faith outside the United States, especially in territories occupied by the U.S. military, threatens to create an international perception of America as a country motivated more by global evangelism (converting non-Christians into the faith) and less by eliminating the threat of terrorism. This perception of the U.S. military, a Bible in one hand and a rifle in the other, undermines the U.S. mission militarily and diplomatically in the war on terror. Arguably, Christian indoctrination of the military works at cross-purposes, not only in a constitutional context domestically but in an international relations context globally. The case study segment of this chapter examines how military and religious indoctrinations occur, how their messaging systems have been effectively combined, how systematically compounded communications have shaped belief and behavior among soldiers, and how these molded beliefs impact the war on terror.

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

113

Early-Age Military and Christian Indoctrination in the United States At an early age, the influence of the U.S. military on the impressionable minds of American youth is on ubiquitous display, lining the shelves of toy retailers across the country. “My first recruiting officer was G.I. Joe (a military action figure manufactured by Hasbro for young boys),” claimed Michael Prysner, an aerial intelligence specialist and Iraq War veteran serving in the U.S. Army Reserve. 19 Nick Turse, author of The Complex: How the Military Invades Our Everyday Lives, observed that the close connection between toy manufacturers, the U.S. military, and defense contractors was a kinship largely unnoticed by the public. Only later would I learn just how enmeshed G.I. Joe’s manufacturer, Hasbro, was with the military. One instance of this close association came to me in 2003 when the Department of Defense shared the specifications for their Future Force Warrior concept with the toy company, even before awarding the contract to General Dynamics. More important these days are its ties to video game manufacturers. 20

The video game marketed for Microsoft’s X-Box console, “Close Combat: First to Fight,” was originally designed by a civilian contractor, Destineer Studios, as training software for the U.S. Marines, then repackaged and sold to young American consumers. “The game is typical of an emerging trend that has melded the video game industry (and the entertainment industries more broadly) with the U.S. military in a set of symbiotic relationships that literally immerse civilian gamers in a virtual world of war. . . . When they are old enough to enlist, these kids find themselves using video game-like controllers to pilot real military vehicles.” Turse’s conclusion that video game play desensitizes players to acts of violence, dehumanizes enemies, and prepares children for the horrors of war is not theoretical conjecture. Kristopher Goldsmith, an Iraq veteran concurs, saying in an interview that “video games and movies, especially recent ones, make death and dismemberment seem like ordinary things” and that games manufactured for U.S. children under the direction of the military glorify military service and extol the virtues of war; he says that the youth who play these games do “not idolize them for standing up for their country but just for wearing the uniform and being a tough guy. It’s a sign of masculinity that a lot of young boys and young

114

CHA P TER 4

men want to achieve.” 21 Research regarding the impact of violent video games on the propensity of players to engage in actual violence is inconclusive, but studies have found that violent games rated for mature players do diminish nonviolent strategies and levels of empathy toward victims of violence and increase a positive outlook on aggression. 22 However, the potential for games to act as tools of communication, promoting ideological values and instilling a favorable attitude toward the U.S. military, is compelling, and the evidence shows it to be equally effective. The U.S. military’s “symbiotic relationship” with toy manufacturers and video game designers creates a covert platform of communication in which the military can convey a finely crafted message indirectly to American youth, espousing the valor of military service and instilling cultural beliefs through complex narrative plotlines and visual images that will persist into adulthood. This subtle form of communication, the shaping of perceptions through gameplay and inculcating beliefs through an engrossing medium involving untold hours of video game exposure, is a method of propaganda that has proven effective. Goldsmith enlisted as an eighteen-year-old fresh from high school, eager to reach the front lines in the Iraq War. “I was still under the influence of the media and its terrorism paranoia, and seriously believed that somewhere in the deserts of Iraq were thousands of WMD.” 23 Unfortunately, the reality of the war in Iraq, in contrast to the virtual world of the video game, would ultimately provide a less satisfying denouement. However, Goldsmith’s motivation for enlisting in the military, the origin of his “terrorism paranoia,” and the role of propaganda in cultivating this fear will be the subject of future discussion in this chapter. The use of video games to indoctrinate American youth is not limited to the military. In 2006, the Christian publishing company Tyndale House began marketing a video game based on Tim LaHaye’s serialized novels entitled “Left Behind.” 24 The Left Behind series is an apocryphal end-ofdays chronicle of future events in an imagined Christian apocalypse, torn from the biblical pages of Revelation. In the video game adaptation, Left Behind: Eternal Forces, “Left Behind Christian Converts” who are survivors of the rapture and who are left stranded on Earth after all Christian souls have been elevated to Heaven are equipped with military-grade automatic assault weapons and issued sacred instructions: to kill all nonChristians they can find who are occupying the game’s ground zero, New York City. 25 In this urban battlefield, the player’s mission is to either

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

115

convert all “non-Christians” (Muslim, Jew, Catholic, homosexual, or even those heathenish New Yorkers who support the separation of church and state) into the holy fold of Christianity, or to violently slaughter those considered unsuitable to ascend to the Kingdom of Heaven. The game was released late in 2006, “just in time for the holidays,” according to the manufacturer’s promotional releases, and garnered immediate interest. 26 Although the release of Left Behind: Eternal Forces was opposed by some moderate factions of the Christian community who denounced the video game as a distorted product of fringe Christian fundamentalist philosophy, the efficacy of using the video game as a means of communicating a message to shape perception and to promote Christian ideology to young pliable minds (as well as to desensitize players to violence against those who practice other religions and to weaken compassion for the suffering of those who are putative enemies) is well established. According to a seminal neuroscience study conducted by Koepp, dopamine levels in the brain increased twofold during video game play. 27 Using positron emission tomography, brain scans revealed that subjects engaged in playing a tank-driving video game displayed increased dopamine release signals in the dorsal striatum and nucleus accumbens. 28 The scientific indication that video game playing triggers dopamine emissions, creating pleasure sensations (arguably at addictive levels), and can be used as an effective heuristic tool to disseminate propaganda is further bolstered by research conducted by neurologist Judy Willis. Willis’s research finds that the same hardwired physiological responses that dopamine facilitates, which promoted survival in early humans, now functions as a reward system well suited to achieving educational objectives that could be incorporated into teaching curricula in primary schools. 29 The perpetual feedback loop that video games provide (constant rewards and penalties for making correct or incorrect judgments) triggers dopamine responses that can reinforce desired behaviors or beliefs. In Left Behind: Eternal Forces, the thrill of earning bonus points for killing a homosexual, or the disappointment in receiving a penalty for showing compassion in sparing the life of a Muslim who refuses to convert, represents a repetitious cycle of behavioral reinforcement that can shape beliefs incrementally and can be used as a medium to communicate values and instill convictions about the real world, using the virtual world of video games as a proxy. The subtle, nuanced messages delicately crafted into video game play by the military through their relationship with toy companies and soft-

116

CHA P TER 4

ware manufacturers, or by religious organizations through their association with publishing companies, work through identical genetic means to achieve the same ultimate end: utilizing a form of media that triggers biochemical responses in the brains of young Americans to introduce and reinforce messages that advance the respective institutional agendas, which have become inextricably intertwined in recent years. Video games, neuroscience research strongly suggests, create a communications platform that efficiently activates specific dopamine responses in the brain that can be used to impart precise meaning through positive reinforcement, and whose interactivity allows for long hours of engrossing instruction. As Turse noted above, upon reaching adulthood, and with fully entrenched neural networks supporting the aggrandizement of U.S. military moral primacy, soldiers enlist with an established neurological foundation receptive to more overt forms of indoctrination. The following pages in this chapter examine how Christian ideology has become engrained into military training and explore whether this form of communication, which seeks to shape moral character, rises to the systemic level of propaganda, or more specifically, a psychological operation within the U.S. military.

CHRISTIAN INDOCTRINATION AS PROPAGANDA IN THE U.S. MILITARY See, in my line of work you got to keep repeating things over and over and over again for the truth to sink in, to kind of catapult the propaganda. —George W. Bush

Catapults, as George W. Bush noted in the above quotation, have been used to broadcast propaganda for centuries, literally and figuratively. Tamerlane, a Mongol khan reigning in thirteenth-century Asia and founder of the Timurid Dynasty, was renowned for catapulting human heads into the center of enemy encampments to spread a terrifying message of brutality (as well as spreading rampant disease). In 2005, under the Bush administration, retired military heads (coached by the Pentagon in media relations) were lobbed into the U.S. media amid criticisms of the wars mismanagement to act as a “media Trojan Horse—an instrument intended to shape terrorism coverage from inside major TV and radio networks,”

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

117

according to a New York Times investigative report. 30 Whether messages of propaganda are obvious and bloody or erudite and refined, statements designed to further a cause or serve a political purpose can be used to indoctrinate an individual into a system of beliefs. Indoctrination, defined simply as “teaching someone to fully accept the ideas, opinions, and beliefs of a particular group and to reject other competing ideas,” has been increasingly used to indoctrinate military personnel into Christianity. 31 Although no documentary evidence of a systematic campaign of Christian indoctrination (i.e., a large-scale programmatic blueprint of universal military indoctrination) within the military exists, this chapter contemplates several components of religious instruction within the military in order to inductively reason whether a de facto program of indoctrination does exist. The elements weighed in this chapter to ascertain the magnitude of the Christian message and its concomitant impact on military culture, and by extension the cultures that interact with the U.S. military (e.g., occupied countries, countries in which U.S. military installations are situated, countries receiving humanitarian aid from the U.S. military), are the following: the amount of taxpayer money invested in Christian programs and personnel within the military, compared to the expenditure of other religions’ activities; the volume and nature of the Christian programs being offered to military servicemen (volume referring to the number, nature referring to whether the programs are compulsory or voluntary or whether disproportionate benefits accrue to participation that may be discriminatory in their implementation); statements made by high-ranking officers that may contribute to shaping the bureaucratic culture of the military and create a more permissive or restrictive attitude toward the enforcement of religious tolerance; and the behavior of military personnel after undergoing training. Each of these criteria will be evaluated below, and an analysis will be conducted to determine if it can be inductively concluded that a system of Christian indoctrination exists within the U.S. military; it will further explore the consequences of a system of religious indoctrination in a military institution in relation to the war on terror. Monetary Investment in Christian-Oriented Military Programs The level of importance the United States assigns to its military forces can be seen clearly in the amount of funding the military receives from

118

CHA P TER 4

the government; 42 to 57 percent of total estimated tax revenue is directed to the military, an amount seven times larger than the military budget of China. The United States and its allies comprise three-quarters of the world’s military spending (with the United States spending the lion’s share). 32 This extraordinarily high level of investment ensures that the American military has the appropriate resources to fulfill the missions given to it by executive mandate and congressional action and would include activities such as protecting the borders of the United States from foreign incursion, maintaining maritime safety for the benefit of international commerce, projecting global security through the operation of its foreign military bases, and waging war to advance the interests of the state. Correspondingly, the amount of funding the military devotes to religious programs is likewise indicative of the significance it assigns to the religious practices of its members and, for public policy purposes, should be tied to a specific, measurable outcome to determine its value to taxpayers, who fund religious activities for military members. However, a precise accounting has proven elusive in the aggregate, as funds for certain religious purposes are largely managed at the base level, and would require Freedom of Information requests to be submitted to each of the over seven hundred military installations that offer religious services. In an effort to calculate the cost of taxpayer-funded religious activities in the military, and to determine whether the programs comport to constitutional requirements as well as government regulations (regarding prohibitions for federal contractors in discriminatory hiring practices based upon religion), the Military Religious Freedom Foundation (MRFF) began to compile figures regarding Department of Defense spending on religious activities. 33 This segment of the chapter derives much of the data assembled by the MRFF to ascertain the enormity of the U.S. military’s investment in religious activities and, by logical extension, to assess the importance the military assigns to the value of religious instruction and communication to its servicemen. The MRFF study focuses exclusively on the promotion of religious activities by contractors awarded agreements authorized by the Department of Defense to provide Christian services to military members and their families. It does not include expenses assumed directly by the department, such as increased numbers of chaplains or chapels (which incidentally have increased; the prestigious Air Force Academy chaplain staff has grown 300 percent in the last ten years, while the cadet population

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

119

has decreased by 25 percent; opulent mega-churches such as the $30 million Fort Hood chapel continue to be built). 34 Many of the contracted services for Christian programs uncovered by the MRFF report fell under the rubric of the army’s massive $125 million “Comprehensive Soldier Fitness” program, which included a mandatory “Spiritual Fitness” test. 35 Although the army contends that the test was not religious in nature, the founder of MRFF, Mikey Weinstein, received over six thousand complaints from soldiers, many of whom argued that they failed the test because they were not “spiritual” enough. 36 The army pioneered the use of the Spiritual Fitness regimen, but its adoption into all branches of the military was widespread by 2007; it was actively being used to promote Christianity through a variety of programs and events. Evangelical Christian musical concerts, where attendance was often compulsory, were routinely held on military bases and comprised a large military expenditure to contracting Christian artists and talent agencies. One concert series in 2010, the “Commanding Generals Spiritual Fitness Concert Series” at Fort Eustis and Fort Lee in Virginia, only included Christian musical performers, who were collectively awarded $678,470 under a Department of Defense Blanket Purchase Agreement. 37 The concerts consisted of Christian-themed music accompanied by laser light shows of large crosses illuminating the stage, with songs interspersed with readings of biblical verse by performers. Soldiers who didn’t attend the concert were punished for their absence. However, a catchy Christian tune, inspirational verses, and a spectacular laser light show are not the only military means of communicating a spiritual message. The seeds of marital discord also present an opportunity to cultivate Christian ideology and nurture the growth of divine belief among U.S military personnel. According to an army spokesperson, the Strong Bonds program receives $30 million a year in Department of Defense funding to host retreats for military families, with contracts indicating that over fifty of the designated locations are exclusively Christian. 38 The Oakridge Camp and Retreat Center, often used by the army’s Fort Sill members, has reaped over $500,000 in Department of Defense contracts for hosting over sixty retreats for military families. 39 The Oakridge Camp requires all employees to be avowed Christians, and their employment application asks their views on abortion and homosexuality. Furthermore, Oakridge’s guest guidelines make clear they are not a hotel, but a Christian camp, and that all visiting groups are required to

120

CHA P TER 4

attend an “Oakridge Orientation” where “prayer will be offered for all groups at every meal in Jesus’ name.” 40 The Oakridge example is emblematic of a broader trend toward military evangelism, with other Christian camps holding Department of Defense contracts to provide counseling, motivational speakers, and Christian performances—camps such as Williamsburg Christian Retreat Center, the Peninsula Baptist Association’s Eastover Retreat Center, and the American Baptist Church’s Canonicus Camping and Conference Center, which have earned hundreds of thousands of Department of Defense dollars hosting Spiritual Fitness events for different branches of the military. Although it is against federal contracting regulations to award a government contract to a company that discriminates in its hiring practices on the basis of religion (as well as a violation of the constitutional provision enforcing the separation of church and state to pay a private organization to require government employees to profess their faith in a particular religion to avail themselves of well-earned benefits), the large investment of money by the Department of Defense in the evangelization of U.S. military personnel strongly indicates that the military places a high value on inculcating faith among service members. 41 The vast amounts of defense appropriations to Christian-oriented contractors uncovered by MRFF are staggeringly disproportionate; the programs offered by contractors are pervasively evangelical in the scope of their content and heavily skewed in spiritual delivery. In addition, the compulsory nature of the military’s Spiritual Fitness and Strong Bonds programs suggests that the military perceives faith as requisite to service and enforces systems of belief through rigorous communication and coercion. The following segment of this chapter examines how the military’s investment in Christian programs is communicated and channeled through military leadership and whether messaging from the military elite serves to reinforce the Christian ideological instruction provided by contractors. As leadership shapes an institution’s culture and values, statements and actions by high-ranking military figures will indicate a level of coordination and further bolster the contention that the promotion of Christian ideology within the military is the consequence of a collaborative endeavor.

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

121

THE ROLE OF MILITARY LEADERSHIP IN PROMOTING CHRISTIAN PROPAGANDA I will support and defend the Constitution of the United States against all enemies, foreign and domestic . . . —Military Oath of Office Military professionals must remember that religious choice is a matter of individual conscience. Professionals, especially commanders, must not take it upon themselves to change or coercively influence the religious views of subordinates. —Religious Toleration, Air Force Code of Ethics

The military oath of office that requires obedience to the Constitution and the code of ethics exhortation to practice religious tolerance are conceptually interconnected, impressing upon soldiers the constitutional necessity of observing the separation of church and state. The structured discipline and hierarchical nature of the military chain of command accords great power and deference to military leaders in shaping the beliefs of subordinates as well as the ability to project public policy messages through statements that could be interpreted by those outside the military, including U.S. citizens and the international community. However, soldiers have a duty to reject orders that are unconstitutional and must place their loyalty to country and their sworn defense of the Constitution above feelings of personal faith. Military personnel serving overseas and interacting with foreign cultures occupy a quasi-ambassadorial role, and the sensitivity to other religious practices that is enshrined in the Constitution and forms a fundamental precept of U.S. constitutional democracy can have a meaningful impact on perceptions of U.S. policy abroad. This segment of the chapter explores messages and commands issued by military leaders to subordinates regarding spiritual belief that may create ethical and constitutional violations, as well as a tension between a soldier’s duty to faith and to country, and ultimately explores whether these statements are indicative of a larger propaganda campaign within the military that seeks to instill religious belief in its members. Although most military commanders eschew public pronouncements of faith, a burgeoning shift in attitudes among some military leaders suggests that the historical reticence to espouse spiritual views has eroded considerably. In April 2004 during the U.S. Air Force Academy orientation, new cadets and their families were ushered into the campus chapel,

122

CHA P TER 4

where they were addressed by Major Warren Watties, who with ten other evangelical chaplains (chaplains of other faiths were not permitted entry into the chapel, and one Lutheran Air Force chaplain, MeLinda Morton, was relegated to the choir loft to observe) aggressively proselytized cadets by encouraging them to attend Bible studies, later admonishing the same cadets to return to their tents and inform their tent-mates that if they refused to accept Jesus as their savior, they would “burn in hell.” 42 The Academy commandant, Brigadier General Johnny Weida, often included biblical passages in his e-mail communication with cadets, and invented a “chant and response” with evangelical cadets; when General Weida shouted, “Airpower!” cadets would reply, “Rock, Sir!”—making reference to the biblical parable about Jesus building his house upon a rock. 43 A Yale Divinity School investigation into abuses at the Air Force Academy revealed in a report that widespread evangelical pressure was placed on cadets to conform their beliefs to a fundamentalist brand of Christianity. The Academy initially denied allegations of Christian indoctrination, then in the face of media scrutiny attempted to assign blame for the evangelical comments and programs to a visiting chaplain. The speaker of the hellfire comments to cadets, Watties, was later named Air Force Chaplain of the Year; in his acceptance speech, he boasted of baptizing soldiers in Saddam Hussein’s swimming pool (an act that would seem antithetical to religious toleration and, in a Muslim country occupied by the U.S. military, tantamount to overt provocation). 44 Air Force Lutheran chaplain Morton, who had cosigned the Yale report on Academy abuses, was ordered by superiors to condemn the report, which she refused to do, and eventually resigned in protest. The air force is not the only branch of the U.S. military that has highranking evangelical Christians prone to making their sentiments on personal faith a matter of military dogma (and public record) as well as deriding those who hold different beliefs. In full U.S. Army regalia, Major General William Boykin embarked upon a series of speaking engagements at American churches shortly after the Yale–Air Force Academy investigation revealed rampant evangelical proselytization directed at cadets and began championing his own view of Christian superiority. Commenting upon remarks regarding the hunt for a Muslim leader in Mogadishu, Boykin was heard to say from the church pulpit, “He went on CNN and he laughed at us, and he said, ‘They’ll never get me because Allah will protect me. Allah will protect me.’ Well, you know what? I knew my

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

123

God was bigger than his. I knew my God was a real God and his was an idol.” He also referred to himself as “God’s Warrior” and that “America is a Christian nation.” 45 Public pressure from Boykin’s comments led to an investigation by the inspector general of the Department of Defense, General Joseph Schmitz (whose evangelical bona fides are on prominent display in the book Blackwater), who concluded that Boykin had committed no ethical breaches and permitted him to be promoted and to oversee the military prisons in Abu Ghraib and Guantanamo as well as to coordinate the extraordinary renditions of terror suspects. Other examples of military leaders imposing spiritual belief upon soldiers and cadets in training abound, but all illustrate a common theme: the subordination of the soldier to a fundamentalist Christian credo. A brief list of statements that make abundantly clear the military’s interest in promoting Christian ideology follows and offers further evidence of a concerted effort to evangelize that emanates from the highest ranks of different service branches: Air Force Academy football coach Fisher DeBerry posting a locker-room banner reading “I’m a Christian first and last. . . . I am a member of Team Jesus Christ”; 46 forced team prayers during practice in the Academy baseball team under coach Mike Hutcheon; Air Force Brigadier General Cecil Richardson saying that “we reserve the right to evangelize the unchurched”; 47 Major General Jack Catton, who suggested that religious beliefs are superior to a serviceman’s military oath and advised military officers subordinate to him on which political candidates they should vote for, stating that there are “not enough Christians in Congress”; 48 Army Brigadier General Robert Caslen, who was recorded saying that “we are the aroma of Christ here in the Pentagon”; 49 Lieutenant Colonel Ralph Kauzlarich stating that the atheist family members of servicemen killed in war can never attain peace because they don’t ascribe to heavenly beliefs and only see their dead family member as “worm-dirt.” 50 The prevalence and pervasive character of evangelical communications issued by high-ranking military officers and chaplain staff, occurring in increasingly public forums, coupled with the notable absence of enforced compliance with military ethical codes that protect against the potential for religious discrimination and violations of the Constitution, further reinforce the presumption that high-level coordination among military leaders exists to propagandize religion and promote the evangelization of the military. Strident comments on faith by high-ranking officers

124

CHA P TER 4

(which indelibly shape the culture of U.S. military forces, create ethical and constitutional violations that go uncorrected by the military chain of command, and ultimately result in the offenders’ promotions to higher rank) leave little doubt that a systemic program is in place to indoctrinate soldiers into Christianity, cast derision on other competing systems of religious belief, and exclude from service those who refuse to conform to the prevailing Christian ideology. The next segment of this chapter will examine the impact this aggressive form of religious indoctrination has on members of the military, public perception of their performance and institutional integrity, as well as perceptions of the international community.

THE IMPACT OF CHRISTIAN MILITARY PROPAGANDA Although humans are genetically inclined to seek solace in spirituality, this predisposition is not wholly determinative, and social and environmental factors also contribute to the formation of an individual’s belief system. As the research above makes plain, the social and professional hierarchy of the military works to shape an environment conducive to exploiting the genetic tendencies toward belief in the spiritual through evangelical messaging, which is designed to enforce rigid moral codes within the military, secure devotional loyalty to military leadership by conflating obedience to God and country, and dispassionately objectify enemies as inhuman and evil “infidels” worthy of slaughter (as well as promoting the conflation of “Muslim” and “terrorist”). Using language to instill a mind-set that aggressively encourages conformity to a proposed ideology, actively rejects beliefs that are inconsistent with this ideology, and foments the marginalization of others who are outside this religious assembly is the very definition of propaganda. To the soldier residing within an environment permeated by the rapturous joy of evangelical fellowship, and cowed by the derisive denunciations bellowed from all quarters toward those who are non-Christian, the desire to adapt is strong. This segment of analysis considers how the bellicose language of religion has impacted soldiers in the U.S. military, has affected those who are connected to the military’s mission, and has contributed to changes in the perception of U.S. policies regarding the war on terror.

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

125

Imposing a system of beliefs that brooks no tolerance for compromise, and views the world through a lens of absolutism, is naturally discriminatory by operation. In the U.S. war against terror, where people and nations are cast as “with us, or against us” or as “good or evil,” a pattern of internal discrimination is an expected corollary. Religious discrimination in the U.S. military against its own personnel, or against potential recruits, diminishes the military’s effectiveness in the field, erodes the morale of those in service, undermines public confidence in the military, and is illegal and unconstitutional. Army Specialist Jerry Hall, an atheist turret gunner serving his second tour of duty in Iraq, was denied promotion for his lack of belief, received death threats from fellow soldiers, and was finally forced to resign from the army for shunning the Christian faith. Zachari Klawonn, a Muslim specialist in the army, was repeatedly harassed by other soldiers and his Koran destroyed, and he was ordered by superior officers not to pray or fast according to Islamic custom. 51 A former marine complained that half of the eight military chaplains he spoke with referred to Mormonism as “Satanic” and attempted to convert him to evangelical Christianity. According to Ambassador Joe Wilson, the chaplain’s role “is to minister to spiritual needs. You don’t proselytize. It’s a workplace violation.” 52 However, Mikey Weinstein of the MRFF, which has handled thousands of harassment and discrimination complaints filed by military personnel, is more strident about the ramifications of Christian propaganda in the military. “There is systematic misogyny, anti-Semitism and Islamophobia in the military,” Weinstein contends, concluding, “This is a national security threat.” 53 Establishing a religious order in the military that discriminates not only violates the law and the Constitution but, by precluding or discouraging the recruitment of Muslim soldiers (especially for positions in translation and intelligence) or denying promotion to qualified soldiers who don’t express the requisite level of “spiritual fitness,” the military weakens its capacity to effectively fight the war on terror it continues to wage. Religious discrimination in the military also corrodes the public trust of an institution tasked with ensuring the protection of state security and preserving world order. More profoundly, religious discrimination, like racial prejudice, imparts an odious taint upon the reputation and integrity of the entire institution, which undercuts its credibility as an organization dedicated to upholding the democratic ideals extolled by the American people, and is antithetical to fulfilling the military oath of

126

CHA P TER 4

office to defend the Constitution. The travails of religious persecution under the yoke of colonial England that prompted the drafting of the U.S. Constitution and its prohibitions against the establishment of a state religion prove past is prologue and should offer an edifying lesson in American history for those in control of Christian propaganda in the U.S. military. Unfortunately, as the neuroscience research suggests, once firmly implanted, certain beliefs become intractably embedded in the mind and are incapable of being dislodged, absent some jolt to the conscience that would impel a reassessment. To require a resounding shock on the order of magnitude of the one that England’s King George III received when America declared its independence will hopefully be unnecessary to prompt a reevaluation of Christian indoctrination practices within the U.S. military. The evangelical Christian proselytization by the military is not confined to its own members, and the extensive pattern of Christian programs directed toward those residing in occupied territories (largely in Muslim countries) suggests a broadly supported and widely coordinated campaign of religious conversion that may alienate those otherwise disposed to support U.S. policies in the region and may obstruct any meaningful progress diplomatically or militarily in the war on terror. The U.S. military’s Christian sermonizing to local people creates a diversion (in money and man-hours) from the military mission and objectives, weakens the ability to win the “hearts and minds” of the citizens whose cooperation they seek, confuses the purpose of U.S. foreign policy, and ultimately erodes support for the mission against terror (which becomes increasingly perceived as a war against Islam, both domestically and abroad). This segment examines how American policies in the war on terror have become entangled with U.S. military Christian propaganda, possibly distorting the perception of American objectives and altering the narrative by framing terrorism as a struggle between competing religions. In short, it will consider the consequences of introducing the program-oriented Christian propaganda imposed on U.S. troops to the Muslim countries they occupy. U.S. president George W. Bush, when referring to the war in Iraq as a “crusade,” may have been speaking on the colloquial margins of metaphorical allusion, but many of his supporters received his message with an ear finely tuned to the subtle channels of religious propaganda. A Christian Crusade to cleanse the scourge of Islam throughout the Muslim

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

127

world had just begun to infiltrate the military mind-set. For the Military Ministry of the Campus Crusade for Christ, with organizational sites at each U.S. military academy and locations at every basic training facility, their mission is succinct: “Evangelize and Disciple All Enlisted Members of the U.S. Military,” and “transform our culture through the U.S. military” and “build Christian military leaders and influence our nation for Christ.” 54 The organization’s penultimate objective is “transforming the nations of the world through the militaries of the world.” 55 The number of related Christian groups dedicated to the spiritual conversion of “unchurched” countries through the influential force of U.S. military might is large and its membership strong. The Officers Christian Fellowship boasts fifteen thousand members occupying 80 percent of U.S. military bases, all of whom vow to use their positions as American officers to promote a “spiritually transformed military, with ambassadors for Christ in uniform.” 56 The mission statements of these organizations, which urge military officers and personnel serving in foreign countries to act as religious ambassadors, concisely encapsulate the necessity for the constitutional prohibition against the establishment of a state religion. By encouraging military officers to supersede the dictates of the U.S. State Department and usurp the authority of the president by crafting their own foreign policy based upon extreme religious edict, the military undermines national security by threatening to blow a hole in the hull of the ship of state that they purportedly seek to protect. By countermanding the president’s foreign policies in the war on terror, and effectively destabilizing civilian control of the military, the Christian organizations that promote evangelical propaganda within the U.S. military set events in motion that could establish a religious-military tyrannical government that the country’s founders feared and cast America into a callous image of the radical form of Islam that spawned the war on terror after the horrible tragedy of 9/11. The battlefield consequences of Christian propaganda, on the minds of U.S. soldiers in Muslim countries, on the tongues of diplomats conducting foreign relations, and in the sentiments of the populations of countries occupied by the U.S. military, have been made visible in recent events. In Samarra the words “Jesus killed Mohammed” were painted in Arabic on the side of a Bradley fighting vehicle being driven through the Iraqi city, inciting the hatred of local people whom the military was also encouraging to cooperate in the occupation. 57 Military weapons, with biblical quo-

128

CHA P TER 4

tations inscribed into the gun sights, were issued to soldiers in the field and used in battle, and referred to by troops as “Jesus rifles” (and subsequently became the subject of multiple complaints). 58 To further bolster the overt message of religious superiority to Iraqi Muslims, the military added a more nuanced approach: the distribution of over two million Arabic-language Bibles to the Iraqi people by more than forty military chaplains. A military chaplain in Afghanistan went beyond dispensing Bibles to Muslims and began sermonizing Afghan troops directly, imploring them to “get right with Jesus,” solemnly intoning that they had approximately two thousand days until Christian judgment would be heaped upon them. 59 Colonel Gary Hensley, the chief army chaplain for Afghanistan, was not content with the effects of simply sermonizing Afghans; standing amid stacks of translated Bibles in a Bagram chapel, he ordered the soldiers to disperse, go forth and “hunt people for Jesus.” 60 This exhortation by a senior military officer to his soldiers to “hunt” Muslims for “Jesus” in a war-ravaged country occupied by the U.S. military is emblematic of the evangelical conflation of military duty and religious obligation that warps the perception of purpose among soldiers, disfigures the official foreign policy of the American state, and misshapes the perception of U.S. intentions globally. Christian propaganda originally devised for direct communication within the U.S. military, which has been effective in galvanizing soldiers in Christian fraternity, solidifying loyalty to military leadership, and righteously emboldening soldiers in the face of hostility from an unholy enemy, has essentially been unartfully repackaged by the military for the non-Christian consumer. The tangible results of this policy are statistically revealing: an exponential increase in religious harassment and discrimination complaints filed by U.S. military personnel; a precipitous decline in cooperation by Iraqi and Afghani citizens with the military effort in the war on terror; evangelization by Christian military personnel used as a recruitment tool by terrorists; and the sharp fall in support among nations globally, and Muslim countries in particular, for continued prosecution of the U.S. war against terrorism. Increasingly viewed as a religious contest, secular approval for the war has waned and has significantly diminished the moral high ground once occupied by the United States and effectively devalued the global political currency held by the U.S. that could have been strategically exchanged for international cooperation. In sum, the propaganda that was arguably deployed successfully to indoctrinate

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

129

American troops in the Christian religion at home met with disastrous results when implemented abroad in Muslim countries.

CONCLUSION This chapter’s primary case study considered how genetic predispositions that incline individuals toward embracing systems of belief interact with social and professional environments within the U.S. military to make soldiers more receptive to communications regarding the Christian faith. It further explored how Christian programs have been intentionally engineered to exploit these genetic inclinations, using carefully crafted language to appeal to spiritual belief, encouraging conformity of thought by offering rewards for religious adherence, and punishing those who refused to accept the prevailing Christian ideology. This chapter’s case study established that the calculated method of the military’s communications, which aggressively inspired belief in a specific religious philosophy and urged the rejection of beliefs counter to those promoted, effectively shaped the belief systems of soldiers and constituted a form of religious propaganda. This propaganda was operationalized during wartime, directed at soldiers and the citizens of occupied countries to shape and control behavior in a widely orchestrated form of propaganda dissemination, and although no formal psychological operation has been proven to exist, this chapter’s case study strongly indicates that military leadership created a de facto operation, which was in place and designed to instill Christian beliefs among soldiers and citizens alike during a period of conflict, as well as discussing the results of religious propaganda usage. The cross case comparative analysis that follows will examine a documented military Psy Op that was illegally directed toward influencing American citizens, and their views on the war in Afghanistan, and will juxtapose the results with the foregoing case analysis.

COMPARATIVE CROSS CASE ANALYSIS Propaganda is to a democracy what the bludgeon is to a totalitarian state. —Noam Chomsky, Media Control: The Spectacular Achievements of Propaganda, 1997

130

CHA P TER 4

A crude instrument, totalitarian regimes that have wielded the bludgeon of state violence have been historically overthrown by democracy, often in the throes of bloody revolution. Violence begetting violence, states that seek to control rebellious civilian populations through brutality eventually succumb themselves to a similar fate. However, totalitarian states were no strangers to the dark arts of propaganda, and arguably reared during its infancy what democracies would perfect into maturity. From the Egyptian pharaoh’s defacement of the statuary of previous rulers to Stalin’s erasing images in official state photographs of party members who fell from favor, totalitarian governments were adept at psychological communication but would resort to violence when unable to harness more effective means of persuasion. With an increasingly sophisticated media apparatus at their disposal, governments in democracies like the United States can retain control of civilization populations, in the face of overwhelming majorities who disapprove of government’s performance and policies, by inundating citizens with propaganda messaging that effectively shapes their beliefs about any given issue (e.g., terrorism, the economy, climate change, gun control, etc.). Gore Vidal poignantly remarked, “As societies grow decadent, the language grows decadent, too. Words are used to disguise, not to illuminate, action: you liberate a city by destroying it. Words are used to confuse, so that at election time people will solemnly vote against their own interests.” In a technologically decadent society, where words are as malleable as memes, propaganda can be virtually indistinguishable from fact. Only when the contours of reality cannot be shaped by the specter of fiction will democracies lose control of the message and revert to the bludgeon. In criminalizing language, the United States has shown itself to be precariously close to reaching for the stanchion of the state and prepared to use propaganda to cloak its actions in the holy vestments of evangelical sanctity. The following case study explores the consequences of the state turning this psychological operation upon itself: the military conducting a Psy Op on members of Congress in the war on terror, being fought at the time in Afghanistan. The Department of Defense (DoD) defines the purpose of “Psychological Operations” as activities designed to “influence foreign audience perception and subsequent behavior as part of approved programs in support of USG policy and military objectives.” 61 The DoD differentiates Psy Ops from its public affairs operations, intended to “provide truthful, timely, accurate information” to American and international audiences. 62

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

131

The crucial distinction between Psy Ops and DoD public affairs information is found in both the ends and the means; Psy Ops can distort truth to cause disruption, whereas public relations must be forthright and informative. DoD policy clearly states that “US PSYOP forces will not target U.S. citizens at any time, in any location globally, or under any circumstances.” 63 This DoD policy is consistent with a long line of legislative authority. The National Security Act of 1947 “drew a bright line” between foreign and domestic intelligence operations to guard against civil liberty violations by the military or intelligence agencies. The SmithMundt Act of 1948 authorized funding propaganda operations abroad, but explicitly restricted that the product of such campaigns “shall not be disseminated within the United States, its territories, or possessions.” In the Consolidated Appropriations Act of 2010 Congress was more specific in imposing limitations on the use of propaganda, with Section 720 providing that “no part of any appropriation contained in this or any other Act shall be used directly or indirectly, including, private contractor, for publicity or propaganda purposes within the United States not heretofore authorized by Congress.” And although the line of the law may seem rigidly unyielding in protecting Americans from encroachment upon their civil liberties, the military has been deftly bending this line in its intelligence operations during the war on terror and punishing those who would threaten to expose these operations. In 2011, a report surfaced that revealed that Lieutenant General William Caldwell, a three-star general overseeing the training of the Afghan army, had issued orders to “Intelligence Operations” (IO) officers to design Psy Ops programs targeting congressional delegations (CODELs in the military idiom) in order to covertly manipulate their perception of the war in Afghanistan, which at that point was approaching its ten-year anniversary, given rapidly declining public support among Americans. According to Lieutenant Colonel Michael Holmes, IO unit leader at Camp Eggers in Kabul, General Caldwell wanted a detailed dossier on each visiting member of Congress, which could then be used to “refine our messaging” and provide a “deeper analysis of the pressure points we could use to leverage the delegation for more funds.” 64 Put more bluntly, General Caldwell’s chief of staff asked Lieutenant Colonel Holmes in an e-mail, “How do we get these guys to give us more people? . . . What do I have to plant inside their heads?” 65 With admitted reservations, and fearing violation of the law, Lieutenant Colonel Holmes acquiesced to orders

132

CHA P TER 4

and began compiling background assessments on senators the general would be meeting with; he was asked to attend these meetings and take notes on the senators’ language and behavior without disclosing the nature of his involvement in the discussion or the purpose of his note taking. According to military analyst John Pike, “Putting your propaganda people in a room with senators doesn’t look good. . . . Any decent propaganda operator would tell you that.” 66 Irrespective of the optics, having military IO propagandists target U.S. senators was a costly enterprise, and given the dismal public support for any continued Afghan war expense, the $6 million in taxpayer funds that were required to deploy Holmes and his team of propaganda specialists for one year in Afghanistan would hardly bear the scrutiny of public exposure, let alone the judicial scrutiny of its putative illegality. In March 2010, after being issued a direct order to conduct a propaganda operation against “all DV visits” (DV being an acronym for Distinguished Visitor), an order that was to “take priority over all other duties” and effectively shift the target of Holmes’s propaganda talents away from the Taliban and onto U.S. senators, Holmes e-mailed his concerns to Captain John Scott, a lawyer with the army’s Judge Advocate General’s (JAG) office. 67 Scott concurred with Holmes, writing in response, “The short answer is that IO doesn’t do that. . . . [Public Affairs] works on the hearts and minds of our own citizens and IO works on the hearts and minds of the citizens of other nations. While the twain do occasionally intersect, such intersections, like violent contact during a soccer game, should be unintentional.” 68 Unfortunately, the ensuing violence to Holmes’s career in the wake of his JAG disclosure was not unintentional. On Scott’s legal advice, Holmes refused to follow Caldwell’s orders, and the order was later rewritten to comport with Scott’s legal opinion on the use of propaganda targeting U.S. citizens. Several weeks following the rewritten order, Holmes discovered that he was under investigation, ordered by Caldwell’s chief of staff, Colonel Joe Buche, for a number of nefarious infractions, including going off base in civilian clothes, consuming alcohol, and the excessive use of Facebook. 69 After receiving a reprimand for his conduct, and believing that the investigation was retaliatory, Holmes filed a complaint with the DoD’s Inspector General. Several months later, Holmes was told he would be accorded no protections as a whistleblower

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

133

because JAG lawyer Scott was not “designated to receive such communications.” 70 While a chastened Holmes was permitted to quietly serve out the remainder of his tour in Afghanistan, Caldwell and his command were working diligently to circumvent what little attention Holmes had drawn to the covert mission of IO targeting American civilians and, indeed, to broaden the scope of IO activities. The circumvention of IO propaganda restrictions was itself ironically facilitated by a clever piece of propaganda: simply changing the name of the unit from “Information Operation Cell” to “Information Engagement Cell.” The new cell would “engage in activities for the sole purpose of informing and educating U.S., Afghan and international audiences. . . .” 71 Essentially, the IO propaganda shop at Camp Eggers had changed the name on the company sign from “propaganda” to “public relations,” and declared itself open to the world. Illegal military propaganda programs that target the U.S. civilian population are not without precedent and are occurring with heightened frequency. Reports have uncovered programs that involve a joint DoD-FBI investigation into veterans who have returned to the United States from overseas service, only to become the subject of inquiry and suspected of posing a potential “domestic terrorism threat,” as well as an air force program using fake identities on social networking websites. 72 Within the confluence of online interconnectedness, social media, and sophisticated surveillance technology, the U.S. military is poised to develop more complex forms of propaganda based upon detailed personal information collected online from Americans who have no idea that they have become the targets of a psychological operation. Whistleblowers within the military intelligence units who report unconstitutional behavior are accorded no protections, and the government has been taking an increasingly draconian stance with regard to their security. By offering a shield to those who conduct illegal propaganda, breaching the public trust and violating the Constitution, and punishing those who seek accountability for the loss of American liberties, a chilling message is sent to those who desperately seek to fulfill their military oath of office: on the scales of justice, an individual’s constitutional rights are outweighed by the security of the state. Nonetheless, the calculus that weighs the precise number of civil liberties that must be forfeited to amass proper balance with state security has yet to be designed, and, indeed, the secrecy of such programs implies that this weighing occurs in the dark.

134

CHA P TER 4

CONCLUSION Throughout eons, mankind developed a spiritual insight into nature that, through the process of evolutionary biology, became a distinguishing characteristic of the human species: the intelligence to conceive God. Genetically predisposed to discern patterns in natural events, mankind perfected over thousands of generations a genetic code that would instill the inclination toward belief in the supernatural and would allow man to benefit from his belief by forming stronger community and familial bonds and to avert unwarranted risks posed by nature. A robust system of spiritual beliefs would also spur group cohesiveness and aid in protecting the group from outside threats; by designing a spiritually oriented moral code, man could encourage group conformity to the demands of their collective society and ensure the survival of the clan and the continuation of the species. Neuroscience research strongly indicates that this tendency to believe is heritable, and an individual’s propensity for belief is genetic in origin. However, the research also suggests that social and environmental factors play key roles in the construction of belief systems. The social pressures of convention may form environments that can be the crucible in which beliefs are forged and strengthened. And although the science demonstrates a genetic predisposition to belief, this inclination can be manipulated through societal forces to either enhance or weaken this genetic tendency. In the first case study, this chapter explored the effective use of propaganda in the tightly controlled social confines of the U.S. military to fortify belief in Christianity in order to achieve a number of aims: improve morale, lend a numinous authority to military power, and instill loyalty to leadership objectives by conflating the military with the religious. The pervasiveness of Christian programs in the U.S. military, coupled with the punitive nature of nonconformity and the highlevel organization of military leaders in promoting religious adherence, made this brand of propaganda rise to a level of intensity that was tantamount to a psychological operation. But leaving the assignment of a Psy Op definition aside, the behavior appears to be in violation of the U.S. Constitution’s separation of church and state, as well as the military’s code of ethics and religious tolerance. The second case study further examined the use of propaganda by the U.S. military directed illegally against members of the U.S. Senate. Psy Ops conducted by the army against visiting senators to influence their congressional votes on war

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

135

spending, which was a clear violation of the law, demonstrated the utter lack of accountability for those in military positions of power as well as the lack of protections accorded to whistleblowers who seek to fulfill their oath of office and defend the U.S. Constitution from abuse; it further illustrated the weight given to state security over the civil liberties of American citizens. On balance, this chapter has sought to elucidate the genetic component of the propaganda of spiritual belief and examine the ways in which divine inspiration, which once brought man together in communion and safeguarded the propagation of the species, has been used as a cynical tool of manipulation, controlling others through exploiting a genetic impulse to believe in a higher power. In narrow cultural environments (e.g., the U.S. military) this method of propaganda has been effective, but the introduction of this brand of propaganda to cultures that have an ingrained resistance (e.g., Muslim countries) has met with disaster.

NOTES 1. Shermer, Michael, The Believing Brain: From Ghosts and Gods to Politics and Conspiracies- How We Construct Beliefs and Reinforce Them as Truths, Times Books, (2011), pp. 164–87. 2. Ibid. 3. Ibid. 4. Ibid. 5. Ibid. 6. Ibid. 7. Ibid. 8. Ibid. 9. Hamer, Dean, The God Gene: How Faith Is Hardwired into Our Genes, Doubleday (2004). 10. Tierney, John, (February 13, 2012). “What’s New? Exuberance for Novelty Has Benefits.” New York Times, retrieved December 16, 2013. 11. Spector, Tim, “What Twins Reveal about the Science of Faith: Studies of Twins Suggest that Faith Is Influenced by Genes,” Popular Science August 8, 2013, archived at http://www.popsci.com/science/article/2013-08/what-twins-reveal-about-god-gene, retrieved on April 15, 2014. 12. Zimmer, Carl, “Faith-Boosting Genes: A Search for the Genetic Basis of Spirituality,” Scientific American (2004).

136

CHA P TER 4

13. Myers, P. Z. “No God, and No ‘God Gene,’ Either,” Pharyngula, February 13, 2005, retrieved January 29, 2012. 14. “Geneticist Claims to Have Found ‘God Gene’ in Humans,” Washington Times, November 14, 2004, archived at http://www.washingtontimes.com/news/ 2004/nov/14/20041114-111404-8087r/, retrieved on April 22, 2014. 15. Ibid. 16. Post, Jerrold, “Psychological Operations and Counterterrorism,” Joint Force Quarterly 37 (2004): 105. 17. Forest, James, Countering Terrorism and Insurgency in the 21st Century, Praeger Publishing (2007). 18. Paddock, Alfred, Political Warfare and Psychological Operations: Rethinking the U.S. Approach, National Defense University Press in cooperation with National Strategy Information Center (1989). 19. Jamail, Dahr, “Militarizing the Homeland,” Truthout Archives, August 6, 2009, archived at http://www.truth-out.org/archive/item/85485-militarizing-thehomeland, retrieved April 20, 2014. 20. Ibid. 21. Ibid. 22. Anderson, Craig A. and Dill, Karen E. “Video Games and Aggressive Thoughts, Feelings, and Behavior in the Laboratory and in Life,” Journal of Personality and Social Psychology 78, no. 4. 23. Ibid note 19. 24. Berlet, Chip, “Groups Join to Condemn Left Behind: Eternal Forces,” Talk to Action website, November 28, 2006, archived at http://www.talk2action. org/story/2006/11/28/103213/26, retrieved on April 20, 2014. 25. Ibid. 26. Ibid. 27. Koepp, M. and Gunn, N., “Evidence for Striatal Dopamine Release During a Video Game,” Nature 393 (1998): 266. 28. Ibid. 29. Willis, Judy, Research-Based Strategies to Ignite Student Learning, ASCD Publishing (2006). 30. Barstow, David, Behind TV Analysts, The Pentagons Hidden Hand, New York Times, April 20, 2008, archived at http://www.nytimes.com/2008/04/20/us/ 20generals.html?pagewanted=all, retrieved on April 21, 2014. 31. “Indoctrination” definition provided by Merriam-Webster Dictionary, and available at http://www.merriam-webster.com/dictionary/indoctrinate, retrieved on April 20, 2014. 32. Shah, Anup, World Military Spending Database, Last Updated June 30, 2013, archived at http://www.globalissues.org/article/75/world-militaryspending, retrieved on April 20, 2014.

GE N E T I C PRE DI SPOSI T I ON, RELIGIOUS BELIEF, A ND P SY OP S

137

33. The research conducted by MRFF can be found on the organization’s website, http://www.militaryreligiousfreedom.org/. 34. Antoon, David, “The Evangelical Takeover of the Military,” October 5, 2007, Alternet, archived at http://www.alternet.org/story/67385/the_evangelical_ christian_takeover_of_the_military, retrieved on April 20, 2014. 35. Leopold, Jason, “Army’s ‘Spirtual Test’ Comes under Fire,” Truthout, January, 5, 2011, archived at http://www.truth-out.org/news/item/268:army %E2%80%99s-%E2%80%9Cspiritual-fitness%E2%80%9D-test-comes-underfire, retrieved April 21, 2014. 36. Ibid. 37. Ibid. 38. Rodda, Chris, “How Much Money Could the Department of Defense Save if It Stopped Trying to Save Souls?,” Huffington Post, August 19, 2011, archived at http://www.huffingtonpost.com/chris-rodda/how-much-money-could-the_b_931436.html, retrieved on April 21, 2014. 39. Ibid. 40. Ibid. 41. Ibid. 42. Ibid note 34. 43. Ibid. 44. Ibid. 45. Ibid. 46. Ibid. 47. Ibid. 48. Ibid. 49. Ibid. 50. Ibid. 51. Glain, Stephen, “Backward, Christian Soldiers,” Truthout, February 10, 2011, archived at http://www.truth-out.org/backward-christian-soldiers67658, retrieved on April 21, 2014. 52. Quinn, Sally, “U.S. Military Should Put Religious Freedom at the Front,” Washington Post, April 26, 2013, archived at http://www.washingtonpost.com/ national/on-faith/us-military-should-put-religious-freedom-at-the-front/2013/04/ 26/c1befcea-ade2-11e2-8bf6-e70cb6ae066e_story.html?wpisrc=nl_headlines, retrieved on April 23, 2014. 53. Ibid. 54. Parco, James, Attitudes Aren’t Free: Thinking Deeply About Diversity in the U.S. Armed Forces, Air University Press (2011). 55. Ibid. 56. Ibid.

138

CHA P TER 4

57. Rose, Hewitt, “The Threat of an Evangelized U.S. Military,” Institute for Science and Human Values, archived at http://www.google.com.vn/url?sa=t& rct=j&q=&esrc=s&source=web&cd=7&cad=rja&uact=8&ved=0CFQQFjAG& url=http%3A%2F%2Finstituteforscienceandhumanvalues.com%2Farticles%2F Word%2520Docs%2Freligious%2520discrimination%2520military.docx& ei=1ITDU_uGEIapkAWn9IHYAQ& usg=AFQjCNGYmA83WxZWO2iUd3eJ780gD4o_3A& sig2=hQeMQNAAVepCxlVTSddelg&bvm=bv.70810081,d.dGI, retrieved April 25, 2014. 58. Ibid. 59. Ibid. 60. Ibid. 61. DoD policies on the use of IO are all archived on the DoD Policy website, http://atsdio.defense.gov/, retrieved on April 25, 2014. 62. Ibid. 63. Ibid. 64. Hastings, Michael, “Another Runaway General: Army Deploys Psy-Ops on U.S. Senators,” Rolling Stone, February 23, 2011, archived at http://www. rollingstone.com/politics/news/another-runaway-general-army-deploys-psy-opson-u-s-senators-20110223, retrieved April 29, 2014. 65. Ibid. 66. Ibid. 67. Ibid. 68. Ibid. 69. Ibid. 70. Ibid. 71. Ibid. 72. ACLU Letter to Congress, titled “U.S. Intelligence Operations Targeting Members of Congress,” February 28, 2011, archived at https://www.aclu.org/ national-security/aclu-asks-congress-investigate-military-use-psyops-memberscongress, retrieved April 29, 2014.

CONCLUSION

Political language . . . is designed to make lies sound truthful and murder respectable, and to give an appearance of solidity to pure wind. —George Orwell The American people are the ones who choose their government by way of their own free will, a choice which stems from their agreement to its policies. Thus the American people have chosen, consented to, and affirmed their support for the Israeli oppression of the Palestinians. . . . This is why the American people cannot be not innocent of all the crimes committed by the Americans and Jews against us. . . . Allah, the Almighty, legislated the permission and the option to take revenge. Thus, if we are attacked, then we have the right to attack back. Whoever has destroyed our villages and towns, then we have the right to destroy their villages and towns. —Osama Bin Laden, in an editorial published in 2002 in The Guardian justifying attacks on American civilians, and particularly the killing of 2,999 people in the September 11, 2001, terrorist attacks. On some basic level, you forfeit your right to be called civilians when you freely elect members of a terrorist organization as statesmen, invite them to dinner with blood on their hands and allow them to set up shop in your living room as their base of operations. At that point you begin to look a lot more like conscripted soldiers than innocent civilians. And you have wittingly made yourself targets. —Thane Rosenbaum, in a 2014 editorial in the Wall Street Journal justifying the killing of 1,518 Palestinian children by the Israeli Defense Force in attacks following the second Palestinian intifada in September 2000.

Juxtaposing the second and third quotations above perfectly illustrates Orwell’s conception of political language as words that give “the appearance of solidity to pure wind” and provides an encapsulation of this book’s central thesis: political language as words of war can distort logic and fashion ideological justification for killing any enemy, and the effective use of language in war can be easily transformed from the mouth of any enemy and repurposed for use against them. War propaganda, like guns, is not discriminating in who handles it; just as a soldier trains to fire a weapon, a politician becomes adept at discharging rhetoric that can be 139

140

CONCLUSION

exponentially more deadly. In the quote above, Bin Laden relies upon the complicity of the American public in endorsing policies that led to the slaughter of innocent Palestinians to justify the terror attacks on civilians on 9/11. Rosenbaum invokes the same complicity among Palestinians who have supported Hamas at the ballot box to rationalize the killing of their children in Israel’s attacks on Gaza. The logic that underlies this political language is not only identical but appeals to the same audience of individuals genetically predisposed to abandon logic and embrace emotional argument. Radical Muslim fundamentalists, who are willing to discard reason and accept a logically fallacious argument that discounts the humanity of an ostensibly Christian-American enemy, may operate under the same genetic impulse as the fervent Jewish Zionist who is eager to paint all Palestinians with the same bloody ideological brush. This fearful rush to collective condemnation and the adoption of the same rhetorical justifications that they once roundly excoriated as intellectually disingenuous may very well be a reaction impelled by neurochemical responses that could have a genetic origin. This book posits, through neuroscience research and individual case study analyses, that our genetic predispositions contribute significantly to how we process language in the war on terror and affect how the public perceives war policies; it ultimately impacts how individuals support those policies. In short, our motivation to go to war may be instinctive and found deep in our DNA. The case studies explored in this book further indicate that when conflicts in rhetorical language occur, as in the above example, certain individuals possess the ability to maintain a state of cognitive dissonance and hold two competing ideas simultaneously, while others cannot. The neuroscience research, supported by this book’s case analyses, suggests that those who would be classified as holding liberal or progressive views are more tolerant toward cognitive dissonance, while those who hold conservative outlooks are less accepting of logical conflict. To use the Bin Laden/Rosenbaum examples, progressives would be more likely to consider both arguments objectively, weigh them equally in merit, identify the logical commonalties, and evaluate each assertion dispassionately. Conservatives would tend to view the assertions contextually, rejecting any logical argument that issues from an untrusted source and aligning their rationality to the arguments of their allies, irrespective of logical inconsistencies, conflicts, or similarities to arguments they have rejected previously. In polls, conservatives have supported the Israeli aggression

CON C LU SI ON

141

against Palestinians overwhelmingly and would likely reject any putative logical connection between arguments made by Bin Laden and Rosenbaum in defense of violent attacks on civilians. Progressives have been more critical of Israel and more sympathetic to Palestinians and have recognized the logical repetition in Rosenbaum’s argument. The neuroscience research discussed in this book indicates that progressives are more inclined toward a full and measured consideration of political statements, while conservatives tend to respond with a more reactionary impulse, and that these political inclinations are a biochemical product of our genetic predispositions. In sum, we make political decisions in a social environment using our brain, our brain is a complex organ that processes political language by using neurotransmitters, and neurotransmitters are controlled by our genes; therefore our genes, at least in part, contribute to how we think and act in a social and political context. The evolution of political beliefs, from the early emergence of patternicity that enabled humans to identify patterns in nature and gave them a distinct advantage in relation to both predators and competitors to the political language used today to galvanize support for terror policies or to foment war, is also the evolution of man. Mankind has evolved, in language and behavior as well as in body and in mind. The historical, technological, political, and linguistic evolution that has shaped humans’ destiny occurred in tandem with their physical evolution. However, in recent years the technological and political evolution of man’s social environment has created an increasingly sophisticated world that has outpaced and evolved beyond man’s ability to accurately assess threats and benefits. The behavioral tools humans developed to identify risks and thwart existential threats in their early evolution are strained to distraction when presented with the communications deluge that is contemporary media. Discerning truth from falsity becomes a daunting task, and the opportunity for distortion and manipulation grows for political actors willing to unscrupulously engage in propaganda, indoctrination, and war. In America, political language as words of war has been used to tremendous effect. And although the research suggests that some people may be more genetically predisposed to suspending rationality and more receptive to reactionary political pronouncements, the pervasive social pressures of a militarized society (that controls a massive global militaryindustrial complex that profits hugely from the war on terror and invests heavily in the war’s narrative) make policy decisions in the war difficult

142

CONCLUSION

for all American citizens. The authors of this book hope that it offers an opportunity for readers to reflect upon their own political policy choices and the motivations, latent or overt, that activate their preferences and color their perspectives. While many of the tangible forces that help shape political views can be seen and their influence weighed and measured, our genetic impulses are only beginning to be understood and brought to light. A more profound understanding of what motivates our political behavior will lend insight into the process of political actions and add a new dimension to policy deliberations. In essence, this book posits that, through understanding the neuroscience that underlies political thought, we can further advance the ancient Socratic maxim that should give pause in political consideration: Above all, know thyself.

SELECTED BIBLIOGRAPHY

BOOKS Altheide, David L. Terror Post 9/11 and the Media. New York: Peter Lang (2009). Brady, Henry E. and David Collier. Rethinking Social Inquiry: Diverse Tools, Shared Standards, Lanham, MD: Rowman & Littlefield (2004). Chomsky, N. Powers and Prospects: Reflections on Human Nature and the Social Order. London: Pluto Press (1996). Cunningham, Stanley B. The Idea of Propaganda: A Reconstruction. Westport, CT: Praeger (2002). Ebeling, Richard. The Failure of America’s Foreign Wars, Future of Freedom Foundation (1996). Fitzgerald, Alastair. Air Crash Investigations: Lockerbie, the Bombing of Pan-Am Flight 103, Lulu.com Publishing (2006). Forest, James. Countering Terrorism and Insurgency in the 21st Century, Westport, CT: Praeger Publishing (2007). George, Alexander. Case Studies and Theory Development in Social Sciences,” Cambridge, MA: MIT Press (2005). Green, Donald. Partisan Hearts and Minds: Political Parties and the Social Identities of Voters. New Haven, CT: Yale University Press (2002). Greene, Joshua. Moral Tribes: Emotion, Reason, and the Gap Between Us and Them, New York: Penguin (2013). Haidt, Jonathan. The Righteous Mind: Why Good People Are Divided by Politics and Religion, New York: Pantheon Press (2012). Hamer, Dean. The God Gene: How Faith Is Hardwired into Our Genes, New York: Doubleday (2004). Hobson, Charles. The Great Chief Justice: John Marshall and the Rule of Law, Lawrence: University of Kansas Press (1996). Hurd, Rollin. A Treatise on the Right of Personal Liberty and on the Writ of Habeas Corpus, revised with notes by Frank H. Hurd, Albany: W. C. Little (1876). Lakoff, George. “War on Terror, Rest In Peace,” Rockridge Institute (February 2006). Lippmann, Walter. Public Opinion, New York: Harcourt Brace (1922). MacCaffrey, James. History of the Catholic Church from the Renaissance to the French Revolution, Vol. I, London (1915). Machiavelli, Nicolo. The Prince, Chapter XVIII, "Concerning The Way In Which Princes Should Keep Faith." 143

144

SELECTED BIBLIOGRA P HY

Nacos, Brigitte L. The Press, Presidents, and Crises, New York: Columbia University Press (1990). Nacos, Brigitte. Mass-Mediated Terrorism: The Central Role of the Media in Terrorism and Counterterrorism. Lanham, MD: Rowman & Littlefield (2002). Nelson, Richard. A Chronology and Glossary of Propaganda in the United States, Westport, CT: Greenwood Press (1996). Paddock, Alfred. Political Warfare and Psychological Operations: Rethinking the U.S. Approach, National Defense University Press in cooperation with National Strategy Information Center (1989). Parco, James and David A. Levy. Attitudes Aren’t Free: Thinking Deeply about Diversity in the U.S. Armed Forces, Maxwell AFB, AL: Air University Press (2011). Posner, Richard. Sex and Reason, Cambridge, MA: Harvard University Press (1994). Pratkanis, A. R. and E. Aronson. Age of Propaganda: The Everyday Use and Abuse of Persuasion (rev. ed.). New York: W. H. Freeman & Co. (2001). Seib, Philip and Dana M. Janbek. Global Terrorism and New Media, London: Routledge (2001). Shermer, Michael. The Believing Brain: From Ghosts and Gods to Politics and Conspiracies— How We Construct Beliefs and Reinforce Them as Truths, New York: Times Books (2011). Tremblay, Rodrique. The New American Empire, Haverford, PA: Infinity Publishing (2004). Willis, Judy. Research-Based Strategies to Ignite Student Learning, Alexandria, VA: ASCD Publishing (2006). Zammito, John H. Kant, Herder, and the Birth of Anthropology, Chicago: University of Chicago Press (2002).

ARTICLES Anderson, Craig, “Video Games and Aggressive Thoughts, Feelings, and Behavior in the Laboratory and in Life.” Journal of Personality and Social Psychology 78, no. 4. Brugger, P. and C. Mohr. “The Paranormal Mind: How the Study of Anomalous Experiences and Beliefs May Inform Cognitive Neuroscience.” Cortex 44, no. 10, 2008. Catania, A. C. and D. Cutts. “Experimental Control of Superstitious Responding in Humans.” Journal of the Experimental Analysis of Behavior 6 (1963): 203–08. Donahue, Laura. “Terrorist Speech and the Future of Free Expression.” Cardozo Law Review 27 (2005): 234. Entman, Robert. “Cascading Activation: Contesting the White House’s Frame After 9/11,” Political Communication, 20 (2003):415–32. Haidt, Jonathan. “The Emotional Dog and Its Rational Tail: A Social Intuitionist Approach to Moral Judgment.” Psychological Review 108, no. 4 (October 2001):814–34. Hauser, M. D., N. Chomsky, and W. T. Fitch. “The Faculty of Language: What Is It, Who Has It, and How Did It Evolve?” Science 298 (2002): 1569–79. Healy, Thomas. “Brandenburg in a Time of Terror.” Notre Dame Law Review 84 (2009): 656. Kahan, Dan M., Ellen Peters, Erica Cantrell Dawson, and Paul Slovic. “Motivated Numeracy and Enlightened Self-Government” Yale Law School, Working Paper 116 (2013). Koepp, M. and N. Gunn. “Evidence for Striatal Dopamine Release During a Video Game.” Nature 266 (1998): 393. Lewis, Seth and Stephen Reese. “Framing the War on Terror: The Internalization of Policy in the US Press,” Journalism, Sage Publication 10, no. 6: 777–97. DOI: 10.1177/ 1464884909344480. Lewis, Seth and Stephen Reese. “What Is the War on Terror? Framing Through the Eyes of Journalists.” J&MC Quarterly 86, no. 1, (Spring 2009): 85–102. McNamara, Lawrence, “Counter-Terrorism Laws: How They Affect Media Freedom and News Reporting.” Journalism Testing Legal Boundaries: Media Laws and Reporting of Arab News, Arab Media Centre, University of Westminster (June 20, 2008).

SE LE CT E D B I B LI OG RAPH Y

145

Müller, F. M. “The Theoretical Stage, and the Origin of Language.” Lecture 9 from Lectures on the Science of Language. Reprinted in R. Harris (ed.), The Origin of Language. Bristol, UK: Thoemmes Press (1996 [1861]): 7–41. Nayef R. F. Al-Rodhan, ‘Emotional Amoral Egoism’: A Neurophilosophical Theory of Human Nature and its Universal Security Implications. LIT Verlag (January 11, 2008). Nyhan, Brendan and Jason Reifler. “When Corrections Fail: The Persistence of Political Misperceptions.” Political Behavior 32 no. 2: 303–30. DOI:10.1007/s11109-010-9112-2 (2010), retrieved July 4, 2014. Post, Jerrold. “Psychological Operations and Counterterrorism.” Joint Force Quarterly 37 (2004): 105. Schulte-Mecklenbeck, Michael. “The Role of Process Data in the Development and Testing of Process Models of Judgment and Decision Making.” Judgment and Decision Making 8 (2010): 733–39. Schwartz, Bernard. “Holmes Versus Hand: Clear and Present Danger or Advocacy of Unlawful Action?” Supreme Court Review 1995: 237. Settle, J., C. Dawes, N. Christakis, and J. Fowler. “Friendships Moderate an Association between a Dopamine Gene Variant and Political Ideology” Journal of Politics 72, no. 4 (2010). Tansey, Oisin. “Process Tracing and Elite Interviewing: A Case for Non-Probability Sampling.” Political Science and Politics 40 (2007): 4. Westen, Drew, Pavel S. Blagov, Kieth Harenski, Clint Kilts, and Stephen Hamann. “Neural Bases of Motivated Reasoning: An fMRI Study of Emotional Constraints on Partisan Political Judgment in the 2004 U.S. Presidential Election.” Journal of Cognitive Neuroscience (Massachusetts Institute of Technology) 18, no. 11 (2006): 1947–58. Zimmer, Carl, “Faith-Boosting Genes: A Search for the Genetic Basis of Spirituality.” Scientific American. (2004).

INDEX

Abdi, Jamal, 96 absolute words, 2 acceptance, 88 addiction, 21, 78 ADHD. See Attention Deficit/ Hyperactivity Disorder advocacy: as free speech, 70; legal, as “material support” of terrorism, 86–87; propaganda vs., 8 Afghanistan, 34, 105, 128, 131–133 Air Force Academy, 121–122, 123 Alianza Martiana, 54 Alien and Sedition Act of 1798, 65, 66 Alien Enemies Act, 98n2 Alien Friends Act, 98n2 Al-Manar (Lebanese television station), 83–86 Al Qaeda, 63, 87–88. See also Bin Laden, Osama; September 11 attacks ambiguity, 2, 6, 80 amygdala, 15, 16 Anouilh, Jean, 105 anterior cingulate cortex, 16, 18 Appolonius, 107 approval ratings, 5 Arabs, in media, 35 Asad, Hafiz Al-, 84 Attention Deficit/Hyperactivity Disorder (ADHD), 22 Bardach, Anna Louise, 53

Bay of Pigs invasion, 49 belief: dopamine and, 77–81, 88; from early years of life, 76; evidence and, 97; evolution of, 141; facts contradictory to, 25; genes and, 19; predisposition to, 80, 81; shaping of, x. See also ideology; religion belief systems, 103–104 Bellow, Saul, 103 Bernstein, Carl, 94 bias, 24, 25 Bin Laden, Osama, 139. See also Al Qaeda biopolitics, 13; defined, 27n30; of speech criminalization, 76–77; twin studies in, 13 Black, Robert, 42 Bloomfield, Lincoln, 92 Boesch, Orlando, 50 Bollier, Edwin, 40, 43 Boykin, William, 122–123 Brandenburg v. Ohio, 69–70, 82, 85 Brookings Institution, 93 Buche, John, 132 Bush, George H. W., 52 Bush, George W., 10, 56, 78, 92, 116, 126 Bush doctrine, 34 Caldwell, William, 131–133 candidate gene approach, 21 Cardone, Kathleen, 55 Caslen, Robert, 123 147

148

Castro, Fidel, 53, 54 casual process observations (CPOs), 4 catecholamine, 77. See also dopamine Catholic Church, 7 Catton, Jack, 123 Central Intelligence Agency (CIA), 46, 49, 50, 51, 55, 110 Chavez, Hugo, 54 chemical transmitter substances (CTS), 77. See also dopamine China, 68 Chomsky, Noam, 6, 129 Christianity: evangelical, 121–126; as military propaganda, 112–129; in musical performances for military, 119–120; “Psy Ops” and, 111–115; video games and, 114–115. See also religion CIA. See Central Intelligence Agency Civil War, 66 clans, 11–12 Clinton, Hillary, 45 Cloninger, Robert, 108 “Close Combat: First to Fight” (video game), 113–114 cognitive bias, 24 cognitive dissonance, 2, 5, 47, 48 cognitive errors, 30, 31, 79 collateral damage, 6 commentary, 9 Committee on Public Information, 67 Committee to Protect Journalists, 85 communication. See language; political communication; speech Communism, 68 comparative religion, 107. See also religion confirmation bias, 25 conflict: anterior cingulate cortex and, 16, 18; conservative outlook and, 141; liberals as more accepting of, 16 Confucius, 7 Congress, military propaganda and, 131–133 Congretio Propaganda, 7 conservatives, 2; amygdala in, 16; belief inclination of, 81; conflict and, 141; criminalization of speech and, 88; emotions and, 15; liberty curtailment

INDEX

and, 81; N-Methyl-D-Aspartate in, 19; speech criminalization and, 97; threats and, 16 Consolidated Appropriations Act of 2010, 130 conspiracy theories, 32 contempt of court, 72 Contras, 110 “Contra Wars”, 52 Coordination of United Revolutionary Organizations (CORU), 50 CORU. See Coordination of United Revolutionary Organizations CPOs. See casual process observations criminalization of language: biopolitics of, 76–77; case studies, 82–97; in Civil War, 66; conservativism and, 88; freedom vs. security in, 64–65; history of, 65–69; Humanitarian Law Project case and, 86–88; in Iqbal case, 83–86; media and, 70–76; in Red Scare, 68–69; terrorism and, 70–71; in World War I, 67–68. See also free speech Cuba, 48–56 Cuban Airlines Flight 455, 49, 50, 51, 54, 55, 56, 61n107 Cuban American National Foundation, 54 Dalyell, Tam, 44 Darwin, Charles, 76 Dean, Howard, 94 DeBerry, Fisher, 123 Debs, Eugene, 68 decision making: emotions in, 78; neurotransmitters and, 141 Demosthenes, 82 Dennis v. United States, 68–69 Dershowitz, Alan, 94 The Descent of Man (Darwin), 76 Dicelmo, Fabio, 53 Dionysus, 107 discontinuity, 6 discrimination: criminalization of speech and, 83, 96; religious, in military, 125–126 dominance, 79 dopamine, 21–22, 76–81, 82, 88, 108 dorsolateral prefrontal cortex, 25 doublespeak, 6

I N DE X

Dratel, Joshua, 85 DRD4-7R, 21, 22, 80 Ea (Babylonian god), 107 Eaves, Lindon, 108 Egypt, 8 Eisenhower, Dwight D., vii elite interview process, 4 emotional arousal, ideology and, 15 emotions: conservative ideology and, 15; in decision making, 78; dopamine and, 78; issue framing and, 35, 36; language and, 1; mythology and, 104; propaganda and, 7; “Psy Ops” and, 105; reasoning and, 25. See also fear Epic of Gilgamesh, 107 epistemology, 80 Ereli, Adam, 53 Espionage Act, 65, 67 ethnic cleansing, 6 evangelicalism, 121–126. See also Christianity; religion evangelism, 112 evidence, disclosure of, 74 “evil”, 10 evolution: of language, 6; of political belief, 141; religion and, 106; of threat identification, 30 evolutionary psychology, 29 Ex Parte Merrymen, 66 false-negative, 30 false-positive, 30, 79 falsity, bias against, 80 fear: amygdala and, 16; conservative ideology and, 91; criminalization of speech and, 65, 66–68, 75–76; free speech and, 65; issue framing and, 35–36; military enrollment and, 110, 114; mythology and, 104; physiology of, 15; in Sun Tzu, 110. See also emotions “fear persuasion”, 10 Federalist Part, 66 Ferrari, Eric, 94 First Amendment, 64. See also free speech flood myths, 107 fMRI. See functional magnetic resonance imaging

149

Foot, Paul, 46 Frankfurter, Felix, 68–69 Franklin, Benjamin, 63 Fraser, Andrew, 44 “freedom fighters”, 56 Freeh, Louis, 94 free riders, 11 free speech: advocacy and, 70; Brandenburg v. Ohio case and, 69–70; in Civil War, 66; contemporary, 69–71; fear and, 65; history of, 64–71; importance of, 64; intent and, 69; in Iqbal case, 85; “material support” of terrorism and, 70; media and, 65; whistleblowers and, 75; in World War I, 67. See also criminalization of language friendships, in adolescence, ideology and, 22 functional magnetic resonance imaging (fMRI), 18, 80 Gaddafi, Moammar, 46 Gauci, Tony, 39, 40, 41–42 genetics: belief and, 19; of dopamine receptors, 22; ideology and, 19–22; religion and, 106–109 genome wide analysis, 19–21 G.I. Joe (toy), 113 Gilgamesh, 107 Giuliani, Rudy, 94 glutamate, 19 The God Gene: How Faith is Hardwired into Our Genes (Hamer), 108 Goldsmith, Kristopher, 113, 114 “good”, 10 government: emergence of, 11; as enforcer of social order, 12; Iranian Air Flight 655 and, 46; issue framing by, 10, 38–57; journalism and, 9; locus of control and, 31; media and, symbiosis of, 29, 33; media and suppression methods of, 72–76; military funding by U.S., 117; Pan Am Flight 103 and, 38–47; whistleblowers in, 75 Government Accountability Office, 7 Green, Joshua, 11 guerrilla warfare, 110 Guevara, Che, 52

150

Gulf War, 46 habeas corpus, 66 Haidt, Jonathan, 11 Hamer, Dean, 108, 109 Hensley, Gary, 128 Hezbollah, 83, 84 HLP. See Humanitarian Law Project (HLP) Holder, Eric, 45 Holder v. Humanitarian Law Project, 86–88 Holmes, Michael, 131–133 holy war, 104 Humanitarian Law Project (HLP), 86–88 “human universals”, 106 Huntington’s disease, 13, 19 Hussein, Saddam, 46, 95, 122 Hutcheson, Mike, 123 ideology: adolescent friendships and, 22; brain function and, 18–19; dopamine and, 22, 76–81; emotional arousal and, 15; genetics and, 19–22; motivation and, 13; neuroanatomy of, 16–18; physiology and, 15–16. See also belief; conservatives; liberals indoctrination, 116. See also propaganda inflexibility, 19 intellectualization, of moral belief, 11 interviews, elite, 4 intuition, moral, 11 Iqbal, Javed, 83–86, 88 Iran, 92–97 “Iran Contra” scandal, 52 Iran hostage crisis, 93 Iranian Air Flight 655, 46 Iraq, 92, 95 Iraq War, 25, 105, 114, 122, 126 Israel, 84, 85, 92, 95, 139 issue framing: case studies, 38–57; cognitive dissonance and, 48; fear and, 35–36; by government, 10, 33; in Iranian Air Flight 655, 46; by media, 33–47; morality and, 34; normalcy and, 35; in Pan Am Flight 103 bombing, 38–47; symbolism and, 35. See also propaganda

INDEX

Jefferson, Thomas, 66 journalism, propaganda and, 9. See also media Kahan, Dan, 24 Kauzlarich, Ralph, 123 ketamine, 19 Klawonn, Zachari, 125 Koestler, Arthur, 13 LaHaye, Tim, 114 language: absolute, 2; ambiguity in, 2, 6; concise, 6; emotions and, 1; evolution of, 6; manipulation and, 2; in propaganda, 1, 8; religion and, 104; of war, viii, 2. See also criminalization of language; free speech; political communication larynx, 6 lateralization, of brain, 16 Lebanon, 46 “Left Behind: Eternal Forces” (video game), 114–115 “Left Behind” novels, 114 Leibowitz, David, 86 Lesnik, Max, 54 Letelier, Orlando, 51 Lewis, Seth, 33 liberals, 2; as accepting of conflict, 16; adolescent friendships and, 22; anterior cingulate cortex in, 16, 18; criminalization of speech and, 81; DRD4 gene and, 22, 80; skepticism of, 81, 97 Liberation Tigers of Tamil Eelam, 87 Lieberman, Donna, 85 limbic system, 15, 22 Lincoln, Abraham, 66 locus of control, 31, 88 Lozando, Hernan, 51 Lugo, Freddie, 51 Lumpert, Ulrich, 40, 43 Lusitania sinking, 67 MacArthur, Douglas II, 92 Machiavelli, Niccolò, 8 magical thinking, 79 magnetic resonance imaging (MRI), 16, 18

I N DE X

Al-Manar (Lebanese television station), 83–86 Mandela, Nelson, 44 manipulation: belief and, 134; of Congress, 131; criminalization of language and, 91; by government, 29; issue framing and, 35, 47; language and, 2; propaganda and, 1; religion and, 111 Marquise, Richard, 43 Marshall, John, 66 Martin, Nick, 108 masculinity, 113–114 “material support,” of terrorism, 70, 82, 83–91, 92–97 McCarthy, Joseph, 68 McCaskill, Kenny, 44 media: counterterrorism laws and, 71–72; criminalization of language and, 70–76; as “Fourth Estate”, 65; free speech and, 65; government and, symbiosis of, 29, 33; government suppression methods and, 72–76; government whistleblowers and, 75; Iranian Air Flight 655 and, 46; issue framing by, 33–57; Muslims and Arabs in, 35; Pan Am Flight 103 and, 38–47; professional privacy of, 73–78; source anonymity and, 74; terrorism and ratings in, 35, 36; terrorism as framed by, 33. See also journalism Megrahi, Abdel Basset Ali Mohamed al-, 38–47 Mehanna, Tarek, 87–88 MEK. See Mujahedeen e-Khalq microsatellites, 19 Milbank, Dana, 73–78 military-industrial complex, vii Military Ministry of the Campus Crusade for Christ, 126 Military Oath of Office, 121 Military Religious Freedom Foundation (MRFF), 117–118 Mill, John Stuart, 65 Millan, Felipe, 55 Morales, Monkey, 50 morality: bias and, 24, 25; confirmation bias and, 25; group living and, 11; issue framing and, 34; political affiliations and, 12; political communication and, 11; reason and, 25

151

Mormonism, 125 Morton, MeLinda, 121, 122 motivation, ideology and, 13 MRFF. See Military Religious Freedom Foundation MRI. See magnetic resonance imaging Mueller, Robert, 45 Mujahedeen e-Khalq (MEK), 83, 92–97 Mukasey, Michael, 94 music, 16 musical groups, Christian, 119–120 Muslims: in media, 35; in U.S. military, 125–126 Myers, P. Z., 109 Myers, Richard, 94 mysticism, 108 mythology, 104 nationalism, 13 National Security Act of 1947, 130 Ndusa, Mustapha, 85 Nelson, Richard Alan, 7 neuroplasticity, 16 neurotransmitters. See chemical transmitter substances; dopamine Nicaragua, 52 9/11 . See September 11 attacks NMDA. See N-Methyl-D-Aspartate N-Methyl-D-Aspartate (NMDA), 19 normalcy, issue framing and, 35 North, Oliver, 52 novelty-seeking personality, 22, 80 nucleus accumbens, 22 Nyhan, Brendan, 25 Oakridge Camp and Retreat Center, 119–120 Obama, Barack, 25, 45, 73, 74 objectivity, 36 observation, 103 Officers Christian Fellowship, 126 openness, 22, 80, 88 operant conditioning, 78 orbital frontal cortex, 25 Orwell, George, 1, 6, 139 outsiders, 11 Paddock, Alfred, 110

152

Palestine, 139. See also Popular Front for the Liberation of Palestine Pan Am Flight 103, 38–47 Parsi, Trita, 95 Partiya Karkeran Kurdistan, 87 Patriot Act, 34 patternicity, 30–32, 57n1 patterns: dopamine and, 78, 79; responses to, 29 persistent vegetative state, 18 persuasion, fear and, 10 PFLP. See Popular Front for the Liberation of Palestine physiology, ideology and, 15–16 Pike, John, 132 political communication: morality and, 11; Orwell on, 6; responses to, 11; success in, 6. See also propaganda Polkinghorne, John, 109 polling, 5 polymorphisms, 19 Popular Front for the Liberation of Palestine (PFLP), 46 Posada Carriles, Luis, 48–56, 61n107 power, as addictive, 78–79 PPA. See Privacy Protection Act of 1980 Privacy Protection Act of 1980 (PPA), 99n26 process tracing, 4 propaganda: advocacy vs., 8; in ancient Egypt, 8; Bush on, 116; Christianity as, in military, 112–129; covert, 7; defined, 7; emotions and, 7; evolution of term, 7; fear and, 10; journalism and, 9; language in, 1, 8; origin of term, 7; overt, 7; in “Psy Ops”, 105; religion and, 104; toys as military, 113–114. See also issue framing; political communication protective politics, 15 Prysner, Michael, 113 “Psy Ops”, 105, 110–115, 130–134 punditry, 9 Al Qaeda, 63, 87–88. See also Bin Laden, Osama; September 11 attacks race, genetics and, 19 Rahman, Sheik Abdul, 93

INDEX

Reagan, Ronald, 54 Red Scare, 68 Reese, Stephen, 33 reinforcement, dopamine and, 21 Reiss, Mitchell, 94 religion: comparative, 107; discrimination based on, in military, 125–126; emergence of, 11, 103–104; evolution and, 106; flood myths in, 107; genetics and, 106–109; language and, 104; locus of control and, 31; in military budget, 117; pattern identification and, 31; political affiliation and, 12; “Psy Ops” and, 110–111; social order and, 106; in United States, 106; universals and, 106; war and, 104. See also Christianity research design, 4–5 reward, 21, 78 Richardson, Cecil, 123 risky behavior, 78 Rodriguez, Felix, 52 Rogers, Will, 46 Rosenbaum, Thane, 139 Roshan, Mostafa, 95 rule following, 81 Rumsfeld, Donald, 10 Schmitz, Joseph, 123 Schneebaum, Steven, 94 science, of politics, 13 Sciolino, Elaine, 93 Scott, John, 132 Secord, Richard, 53 Sedition Act, 68, 98n2 self-forgetfulness, 108 self-stimulation, 21 self-transcendence, 108 sensationalism, 35 September 11 attacks: Bush and, 34; conspiracy theories about, 32; government framing of, 10, 33; government reaction to, 63; military response to, 33–35; Mujahedeen eKhalq and, 93; symbolism and, 35. See also terrorism Shermer, Michael, 57n1, 106 skepticism, 79, 81, 97 Skinner, B. F., 78 Smith-Mundt Act of 1948, 130

I N DE X

Snyder, Eric, 86 Spector, Tim, 108 speech, evolution of, 6. See also free speech Spinoza’s conjecture, 80 “Spiritual Fitness” test, in U.S. military, 119 State Secrets Privilege, 99n33 subjectivity, 6 Subversive Activities Control Act, 65, 68 Subversive Activities Control Board, 68 Sun Tzu, 110 superstition, 31 Sweig, Julia, 53 symbolism, 35 Syria, 46 taboo, 11 Tamerlane, 116 Tamil Tigers, 87 terrorism: advocacy of, as free speech, 70; “material support” of, 70, 82, 83–91, 92–97; media framing of, 33, 33–47; media ratings and, 35, 36. See also Cuban Airlines Flight 455; Pan Am Flight 103; September 11 attacks threats: belief systems and, 104; cognitive responses to, 37, 47, 82; conservative ideology and, 16; counterterrorism laws and, 72; fear and, 71; fear persuasion and, 10; media framing and, 33; patterns and identification of, 30; physiological responses to, 15–16 To Jerusalem and Back (Bellow), 103 Townsend, Fran, 94 toys, military indoctrination and, 113–114 trace process analysis, 4. See also process tracing transcendence, 108 transpersonal identification, 108

153

Turse, Nick, 113 twin studies, 13–15 Type I cognitive error, 30, 79 Type II cognitive error, 30, 31 United States v. Reynolds, 99n33 universals, 106 Venezuela, 51–55, 61n107 Vidal, Gore, 130 video games, 113–115 Vincennes, U.S.S., 46 VMAT2 gene, 108, 109 vocalization, 6 war: language of, viii, 2; “Psy Ops” in, 110–111; religion and, 104 war on terror: Christianity and, 125, 126; media suppression and, 73, 74; military industrial complex and, 141; “Psy Ops” and, 130; secrecy in, 71; skepticism and, 80 Watties, Warren, 121 Weida, Johnny, 121 Weinstein, Mikey, 119, 125 Westen, Drew, 25 whistleblowers, 71, 75, 133, 135 Whitehurst, Fred, 43 Whitson, Jennifer, 32 Willis, Judy, 115 Wilson, Joe, 125 Wilson, Woodrow, 67 World War I, 65, 67 World War II, 13 X-Box (video game console), 113–114 Zawahiri, Ayman al, 36 Zimmer, Carl, 109

ABOUT THE AUTHORS

Wesley Kendall is a law lecturer at the University of the South Pacific in Vanuatu. Trained in the United States as a lawyer, he earned his PhD in international relations from the Royal Melbourne Institute of Technology University and authored the book The Death Penalty and Diplomacy, How Foreign Nations and International Organizations Influence U.S. Policy (2013). Joseph M. Siracusa is professor of human security and international diplomacy and deputy dean of global and language studies at the Royal Melbourne Institute of Technology University, Australia. American-born, he is the author and co-author of many books, including Nuclear Weapons: A Very Short Introduction (2008); America and the Cold War, 1941–1991: A Realist Interpretation, 2 volumes (with Norman A. Graebner and Richard Dean Burns, 2010); and A Global History of the Nuclear Arms Race: Weapons, Strategy, and Politics, 2 volumes (with Richard Dean Burns, 2013). Kevin K. Noguchi received his PhD in behavioral neuroscience at the University of California, Los Angeles, before becoming an assistant professor of psychiatry at Washington University Medical School in St. Louis. His research interests primarily focus on drug-induced neuropathology with an emphasis on the safety of drugs in the developing brain and the neurotoxicity produced by drugs of abuse.

155