Visualizing Microbiology: A Healthy Perspective 9781119252078, 9781119252030

Citation preview

Includes ORION

Adaptive Practice

An easy way to help students learn, collaborate, and grow. Designed to engage today’s student, WileyPLUS Learning Space will transform any course into a vibrant, collaborative, learning community.

Photo credit: Sam Edwards/Getty Images

Identify which students are struggling early in the semester.

Facilitate student engagement both in and outside of class.

Measure outcomes to promote continuous improvement.

Educators assess the real-time engagement and performance of each student to inform teaching decisions. Students always know what they need to work on.

Educators can quickly organize learning activities, manage student collaboration, and customize their course.

With visual reports, it’s easy for both students and educators to gauge problem areas and act on what’s most important.

www.wileypluslearningspace.com

VISUALIZING M I C R O B I O L O G Y: A Healthy Perspective

Rodney Anderson, Ph.D. Ohio Northern University Linda Young, Ph.D. Ohio Northern University

Credits VICE PRESIDENT AND DIRECTOR EXECUTIVE EDITOR EXECUTIVE MARKETING MANAGER SENIOR CONTENT MANAGER SENIOR PRODUCTION EDITOR SENIOR DESIGNER TEXT AND ILLUSTRATION DEVELOPER ASSOCIATE PRODUCT DESIGNER DEVELOPMENT EDITOR ASSISTANT EDITOR EDITORIAL ASSISTANT SENIOR PHOTO EDITOR

Petra Recter Ryan Flahive Clay Stone Svetlana Barskaya Patricia McFadden Tom Nery Rebecca Heider Lauren Elfers Melissa Whelan Carolyn Thompson Mili Ali Mary Ann Price

COVER CREDITS Clockwise from top: Main Image: Staphylococcus bacteria in trachea: Juergen Berger/ Science Source, Courtesy Lydia-Marie Joubert, Ph.D., Curtis E. Young, Ph.D., Curtis E. Young, Ph.D., Wim van Egmond/Science Source Images This book was printed and bound by Quad Graphics Versailles. The cover was printed by Quad Graphics Versailles. Founded in 1807, John Wiley & Sons, Inc. has been a valued source of knowledge and understanding for more than 200 years, helping people around the world meet their needs and fulfill their aspirations. Our company is built on a foundation of principles that include responsibility to the communities we serve and where we live and work. In 2008, we launched a Corporate Citizenship Initiative, a global effort to address the environmental, social, economic, and ethical challenges we face in our business. Among the issues we are addressing are carbon impact, paper specifications and procurement, ethical conduct within our business and among our vendors, and community and charitable support. For more information, please visit our website: www.wiley.com/go/citizenship. Copyright © 2017 John Wiley & Sons, Inc. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, scanning or otherwise, except as permitted under Sections 107 or 108 of the 1976 United States Copyright Act, without either the prior written permission of the Publisher, or authorization through payment of the appropriate per-copy fee to the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers, MA 01923 (website: www.copyright.com). Requests to the Publisher for permission should be addressed to the Permissions Department, John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030-5774, (201) 748-6011, fax (201) 748-6008, or online at: www.wiley. com/go/permissions. Evaluation copies are provided to qualified academics and professionals for review purposes only, for use in their courses during the next academic year. These copies are licensed and may not be sold or transferred to a third party. Upon completion of the review period, please return the evaluation copy to Wiley. Return instructions and a free-of-charge return shipping label are available at: www.wiley.com/ go/returnlabel. If you have chosen to adopt this textbook for use in your course, please accept this book as your complimentary desk copy. Outside of the United States, please contact your local representative. The inside back cover will contain printing identification and country of origin if omitted from this page. In addition, if the ISBN on the back cover differs from the ISBN on this page, the one on the back cover is correct ISBN 978-1-119-25207-8 (BRV) ISBN 978-1-119-25203-0 (EVALC) Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1

Preface Why Visualizing Microbiology? Microbiology is a fascinating discipline. Not only do microorganisms affect every aspect of health, they also play a foundational role in every ecosystem on Earth. Whether a student is learning microbiology to become a medical care provider working to improve patient health, a businessperson manufacturing healthy food products, or an environmental scientist striving to maintain a healthy planet, understanding the role of microorganisms is critical. Visualizing Microbiology is intended to meet the unique needs of students taking their first course in general microbiology. Its emphasis on the relationship of microorganisms to health makes it of particular interest to courses that primarily serve students planning for a career in the allied health sciences. Visualizing Microbiology will cultivate in the reader an appreciation for the complexity, scope, and dynamic nature of the science of microbiology. The pedagogy and organization of Visualizing Microbiology is based on decades of research into the effective use of visuals in learning. The animations, videos, figures, and photos are designed to explain, present, and organize new information in a way that promotes greater retention and stimulates critical thinking. This is especially important in a course about microorganisms, which are too small to see and for which students have no context. All visuals are tightly integrated with accompanying text to create a highly engaging learning experience that encourages students to develop rich mental images of the microbial world. Visualizing Microbiology seeks to optimize learning outcomes with distinctive features that inspire students to step beyond basic memorization to attain a mastery that helps them visualize how such small organisms can have such a great influence on health and the environment. Our integration of engaging images, straightforward text, and emphasis on practical applications helps students understand the vast diversity of microorganisms and then learn how they will apply these concepts when they become practicing professionals. Real-life Case Studies are told as engaging stories that enhance understanding and application of concepts in a clinical context. The Microbiologist’s Toolbox highlights key laboratory diagnostic techniques, What a Microbiologist Sees puts microorganisms into an everyday perspective (see photo and graph), and Clinical Applications introduces the latest research into microbiology applications in health care. Every chapter is rich with critical thinking opportunities, as students are prompted to answer questions along with each visual. All of these features facilitate Correlation of oral body temperature in adults and bacterial growth rate student engagement and are especially useful to 120 those planning careers as medical professionals. 100

105.6

104.5

103

100

Body temperature (°F)

86% 80

60

55%

40

36% 22%

20

0 68° F

98.6° F

104.5° F

106

Bacterial growth rate

Section 10.2 highlights the first-line defenses of your immune system, including fever. Because students typically see fever as a medical problem, the What a Microbiologist Sees feature clearly connects increasing body temperature with declining pathogen growth. Additionally, the required data analysis in this feature provides students with a guided opportunity to practice their critical thinking skills.

98.6 100%

0% Normal

Fever

Ideal pathogen fighting

Beneficial fever

Initiate treatment

Damage

Harmful fever

Preface  v

Teaching and Learning Environment: WileyPlus Learning Space

their course of study and future careers. The subjects of the videos – nursing professors, nursing students, recent graduates, and practicing nurses and heath care providers – briefly introduce the chapter content and provide context and relevance for why the material presented is important, with a personal touch.

What is WileyPLUS Learning Space? It’s a place where students can learn, collaborate, and grow. Through a personalized experience, students create their own study guide while they interact with course content and work on learning activities.

In the text, a feature box called The Microbiologist’s Toolbox puts additional clinical focus on diagnostic tools and laboratory techniques. An online video accompanies this feature in every chapter. The video introduces students to important and relevant laboratory techniques.

WileyPLUS Learning Space combines adaptive learning functionality with a dynamic new e-textbook for your course—giving you tools to quickly organize learning activities, manage student collaboration, and customize your course so that you have full control over content as well as the amount of interactivity between students.

 CLEX Practice Exams offer 30 multiple-choice • N questions that allow students to prepare for the NCLEX exam in relation to the chapter content.

Instructors can: • Assign activities and add your own materials • G  uide students through what’s important in the e-textbook by easily assigning specific content • Set up and monitor collaborative learning groups • Assess student engagement • B  enefit from a sophisticated set of reporting and diagnostic tools that give greater insight into class activity Learn more at www.wileypluslearningspace.com. If you have questions, please contact your Wiley representative.

What do students receive with WileyPLUS Learning Space? • A  digital version of the complete textbook with integrated media and quizzes.  he ORION personalized practice adaptive learning • T module that maximizes study time. • Interactive Case Studies are available in every chapter to augment critical thinking. Students are presented with a patient experiencing a collection of symptoms and then embark on a diagnostic process through a series of decisions to confirm the responsible pathogen and course of treatment. Chapter Opening Videos draw in the student and highlight why the upcoming chapter material is relevant to

vi  VISUALIZING MICROBIOLOGY

• G  lossary and Flashcards include key term flashcards with definitions for self-study as well as multiple-choice quizzes.  eb Resources offer links to additional online resources • W for further research and discovery.

What do instructors receive with WileyPLUS Learning Space? Pre-created teaching materials and assessments help instructors optimize their time: • Every chapter contains a Lecture PowerPoint Presentation, prepared by Lara Kingeter, Tarrant County College, with a combination of key concepts, figures and tables, and examples from the textbook. • T  he Test Bank, prepared by Jacqueline Spencer, Thomas Nelson Community College, is available in a Word document format or through Respondus. The questions are available to instructors to create and print multiple versions of the same test by scrambling the order of all questions found in the Word version of the test bank. This allows users to customize exams to fit their unique classroom by altering or adding new problems. The test bank has over 100 multiple choice, true-false, text entry, and essay questions per chapter. Each question has been linked to a specific, student learning outcome, and the correct answer provided with section references to its source in the text. Gradebook: WileyPLUS provides instant access to reports on trends in class performance, student use of course materials, and progress toward learning objectives.

Reviewers of Visualizing Microbiology Reviewers Cindy Anderson; Mt. San Antonio College Lisa Anderson; California State University – San Bernardino Lois Anderson, Minnesota State University – Mankato Michael Angell; Eastern Michigan University Aaron Baxter; Grand Valley State University Barbara Beck; Rochester Community and Technical College Jennifer Bess; Hillsborough Community College Emily Booms; Northeastern Illinois University James Bretz; Montgomery County Community College Linda Bruslind; Oregon State University Bradley Christian; McClennan Community College Georgia Christian; Horry-Georgetown Technical College Frank Cruz; Georgia State University Jessica DeGraff; Gloucester County College Jessica DiGirolamo; Broward College Jason Furrer: University of Missouri Kathy Germain; Southwest Tennessee Community College Julianne Grose; Brigham Young University – Provo Wendy Hadley: Allan Hancock College Steven Hecht; Grand Valley State University Dale Horeth; Tidewater Community College Julie Huggins; Arkansas State University Syana Jahangiri; Folom Lake College Seema Jejurikar; Bellevue College Margaret Kincaid; University of Missouri – Kansas City Ruhul Kuddus; Utah Valley University Gitanjali Kundu; Brookdale Community College Rachael Leonard; Community College of Allegheny County Terri Lindsey; Tarrant County College Suzanne Long; Monroe Community College Sergei Markov; Austin Peay State University John McKillip; Ball State University Kristen Mitchell; Boise State University Catherine Murphy; Ocean County College Marcia Pierce; Eastern Kentucky University Pamela Rich; University of Akron Brenden Rickards; Rowan College – Gloucester City Meredith Rodgers; Wright State University David Roillins; Prince Georges Community College Samuel Schwarlose; Amarillo College

Heather Seitz; Johnston County Community College Jack Shurley; Idaho State University Lori Smith; American River College Sherry Steward; Navarro College Wendy Trzyna; Marshall University John Whitlock; Hillsborough Community College Patty Wilber; Central New Mexico Community College Michael Witty; Florida Southwestern State Community College Kelly Worden; Red Rocks Community College Floyd Wormley: The University of Texas at San Antonio Mark Zelman; Aurora University Class Testers Carroll Bottoms; Collin College Michael Buoni; Delaware Technical Community College Seema Endley: Collin College Gina Holland; Sacramento City College Jeba Inbarasu; Metropolitan Community College Dianne Jedlicka; Columbia College Malda Kocache; George Mason University Marcia Pierce; Eastern Kentucky University Louisa Schmid; Tyler Junior College Jack Shurley; Idaho State University Lori Smith; American River College Meredith Rodgers; Wright State University Jacqueline Spencer: Thomas Nelson Community College Marcia Watkins; Eastern Kentucky University Contributors Donna Balding: Middle Georgia State University Evelyn Biluk, Chippewa Valley Technical College Cliff Boucher; Tyler Junior College Michael Buoni; Delaware Technical Community College Daniel Combs; Ohio Northern University Jessica DiGirolamo; Broward College Kami Fox; Ohio Northern University Megan D. Gamble; University of South Carolina Julianne Grose; Brigham Young University – Provo Lara Kingeter; Tarrant Community College Andrea Rediske; University of Central Florida Jacqueline Spencer; Thomas Nelson Community College Lisa Walden; Ohio Northern University Curtis Young; The Ohio State University

Preface  vii

Special Thanks We would like to thank the kindness and patience of our spouses and family members whose support made this book possible. Words are insufficient to express how grateful we are for their constant encouragement and ongoing understanding. A project of this scope required many more hours away from them than we ever imagined. During this time, they picked up the slack at home without complaint so we had more time to write. Their willingness to help us see this project through was inspiring and provided us with the perseverance and drive needed to write Visualizing Microbiology. Thank you all so very much. Dr. Young extends special thanks to Ken Blanchard (Executive Director of the NW Ohio Literacy Council) and Laura Ball (ABLE/GED Coordinator of Lima City Schools) for providing her with office space at the Lima Adult Learning Center during her sabbatical. She is not only grateful for the energized environment in which to write, but also for the lasting friendships she developed with these dedicated educators. Additionally, she would like to acknowledge Kristina M. Edington, BSMT, MT(ASCP), who served as the Director of the Microbiology Unit of the New Vision Medical Laboratory during Dr. Young’s professional retraining. She is very grateful to Kris and her industrious, knowledgeable staff of clinical microbiologists for their professional input and strong support of allied health education. Their contributions were invaluable to the development of the clinical components of this text. We also appreciate the expertise provided by our ONU colleagues who developed the various video vignettes. Dr. Kami Fox (DNP, CNP Pediatric Nurse Practitioner, Associate Professor, Director and Chair of Nursing) was responsible for crafting the chapter opener videos. Professor Lisa Walden (MEd, MLS(ASCP)CM, Director of the West Central Ohio Medical Laboratory Science Program at Ohio Northern University) created the toolbox videos, demonstrated the clinical techniques, and provided cultures and media for photos. The directing, filming, and editing of the Visualizing videos were skillfully performed by Daniel Combs (BA Broadcast Communications; Multimedia Specialist and Social Media Manager). Thank you all for your contributions to this important component of Visualizing Microbiology. The help and expertise provided by the team at Wiley & Sons, Inc. has been invaluable. For their on-going encouragement, tremendous patience, attention to detail, and creative input, we would like to extend our special thanks to: Deena Cloud (Line Editing), Lauren Elfers (Associate Product Designer), Ryan Flahive (Executive Editor), Rebecca Heider (Text and Illustration Developer), Kathy Naylor (Art Development), Nancy Perry (Manager, Product Development Global Education), Mary Ann Price (Senior Photo Editor), Sherrill Redd (Aptara Project Manager), Bonnie Roth (Senior Editor, Biology Global Education), Clay Stone (Executive Marketing Manager), and Kevin Witt (Acquisitions Editor). Additionally, we are very grateful to our many content reviewers, as their valuable suggestions have significantly enhanced this text, and to our classroom reviewers for providing practical feedback maximizing the effective use Visualizing Microbiology with undergraduates.

viii  VISUALIZING MICROBIOLOGY

About the Authors Rodney P. Anderson Rodney P. Anderson received his Ph.D. in Biological Sciences from the University of Iowa in 1989. His doctoral work centered on protein synthesis mechanisms in E. coli. After graduate school, he began his academic career at Ohio Northern University where he continues to teach and conduct research with undergraduates in the Department of Biological and Allied Health Sciences. He teaches microbiology for majors and allied health students as well as courses in general biology, genetics, and epidemiology. Dr. Anderson has been actively involved in microbiology education. He has been a past President of ASM’s Conference on Undergraduate Education, which developed the core curriculum for undergraduate microbiology courses, and has organized and spoken at a number of education division symposia at ASM’s General Meeting. Outreach activities have included Microbial Discovery Workshops for High School science instructors and doing discovery science activities at local elementary schools. He is an author of two books published by ASM press: Outbreak and The Invisible ABCs.

Linda M. Young Linda M. Young earned her Ph.D. in Botany at The Ohio State University in 1988. Her research focusing on signal transduction in root gravitropism was supported by NASA. She continued these studies with undergraduate assistance when she joined the faculty of Ohio Northern University, a student-centered institution that emphasizes effective instruction as a faculty member’s principal responsibility. She enjoys teaching both freshman and advanced-level biology courses. Dr. Young served 7 years as the Assistant Dean of the Getty College of Arts and Sciences, which allowed her the opportunity to implement several programs to assist students in academic difficulty, ease freshman transition into college, and support the endeavors of high-achieving students. Although initially educated as a plant/cell physiologist, changing departmental needs led to her retraining. Consequently, Dr. Young now also teaches Microbiology for Allied Health Sciences (nursing) and Introduction to Microbiology (majors). Her research has also changed and now targets infection control issues and the ethnobotanical basis of antibiosis. Drs. Young and Anderson have previously coauthored Case Studies in Microbiology: A Personal Approach published by John Wiley & Sons, Inc. She has also coauthored the laboratory manual used for general botany at ONU.

Preface  ix

Brief Contents Preface

1 2 3 4 5 6 7 8 9 10 11 12

Microbial World T  he Biochemistry of Macromolecules

Microscopy

Prokaryotic Organisms

Eukaryotic Organisms V  iruses and Other Infectious Particles

iii

2

26

60

82

112

Microbial Pathogenesis

366

Antimicrobial Agents

398

Epidemiology and Infection Control

434

Diseases of the Respiratory System

462

Diseases of the Skin and Eyes

496

Diseases of the Nervous System 532

146

Metabolism

178

M  icrobial Genetics and Genetic Engineering

210

Microbial Growth and Control

3 1 14 15 16 17 18 19 20 21 22

242

Diseases of the Cardiovascular and Lymphatic Systems

562

Diseases of the Gastrointestinal System 598

Diseases of the Urogenital System

632

Environmental and Industrial Microbiology

670

Innate Immunity

274

Appendix 702 A: Answers to Self-Tests B: Physiological Reference Ranges 705

Adaptive Immunity

304

Glossary

708

Index

726

Vaccination, Immunoassays, and Immune Disorders

x  VISUALIZING MICROBIOLOGY

334

Contents Microbial World

1.1  The Microbes •  A Brief Survey of the Microbial World •  The Dominant Form of Life on Earth

2 4 5 6

1.2  The Conflicts 8 •  Growth and Control of Microbes 8 •  The Role of the Immune System 10 ■■ What a Microbiologist Sees: Wrestling and the Spread of Skin Pathogens 10 •  Pathogenesis 11 •  Antimicrobial Drugs 12 1.3  Infectious Disease 13 13 •  Epidemiology and Healthy Practices •  Host Defenses and Microbial Pathogenesis Strategies 14 ■■ The Microbiologist’s Toolbox: MALDI TOF Mass Spectrometry 15 •  Infectious Disease Statistics 16 ■■ Case Study: Vaccination: A Casualty of War 17

Christine L. Case

1.4  Microbial Ecology and Commercial Applications •  The Importance of Environmental Microbes •  The Industrial Use of Microorganisms ■■ Clinical Application: Pasteurization

18 18 19 20

2

The Biochemistry of Macromolecules

26

2.1 Proteins 28 •  The Four Levels of Protein Structure 28 •  Protein Diversity and Function 34 ■■ What a Microbiologist Sees: The Effect of Modified Tertiary Binding on Protein Structure 34 2.2 Enzymes •  Enzyme Action •  Factors Influencing the Rate of Enzyme Activity

35 36

2.3 Carbohydrates •  Simple and Complex Carbohydrates •  The Functional Diversity of Carbohydrates ■■ Clinical Application: Rapid Glycogen Breakdown in a Diabetic Patient in Shock

40 41 41

37

42

2.4 Lipids 43 •  The Structural Classes of Lipids 43 ■■ Case Study: Acne—A Bacterial Interaction with Skin Oils 44 •  Lipid Functions 47 ■■ The Microbiologist’s Toolbox: Ziehl-Neelsen Acid-Fast Staining of Mycolic Acid Cell Walls 48 2.5  Nucleic Acids 49 •  The Structures of DNA and RNA 49 •  Nucleic Acid Functions 52 Rendered by Robert Campbell in the laboratory of Roger Tsien, University of California, San Diego.

1

Contents  xi

3

Microscopy

60

3.1  Principles of Microscopy 62 •  Magnification 63 •  Resolution 64 3.2  Microscopy Used for Clinical Diagnosis •  Bright-field Microscopy •  Dark-field Microscopy •  Fluorescence Microscopy ■■ The Microbiologist’s Toolbox: The Direct Fluorescent Antibody Assay 3.3  Microscopy Used for Research Investigations •  Light Microscopy ■■ What a Microbiologist Sees: Differential Interference Contrast Microscopy •  Electron Microscopy •  Nanoprobe-based Microscopy

65 65 66 67 67 68 68 70 70 72

Graham Matthews

3.4  Specimen Preparation and Staining 72 •  Basic Staining Procedures 72 ■■ Case Study: Diagnosing Gonorrhea Using Gram Staining 74 ■■ Clinical Application: Diagnosing Tuberculosis Using Acid-fast Staining 75 •  Special Staining Procedures 75

4

Prokaryotic Organisms

4.1  The Prokaryote’s Place in the Living World •  Sustaining Life ■■ What a Microbiologist Sees: Prokaryotes— The Dominant Form of Life on Earth •  Symbiotic Relationships

82

84 84 85 86

4.2  Bacterial Cell Shapes and Arrangements 87 •  Bacterial Shapes 87 •  Bacterial Arrangements 87 4.3  The Bacterial Cell Wall •  Cell Wall Structure •  Gram-Positive and Gram-Negative Cell Walls •  Atypical Cell Walls ■■ Case Study: A Walking Pneumonia Outbreak at a University

89 89 91 92 93

4.4  External Structures of Bacterial Cells 94 •  The Glycocalyx 94 •  Fimbriae and Pili 94 •  Flagella 95 ■■ The Microbiologist’s Toolbox: The Flagella Stain 97 4.5  Internal Structures of Bacterial Cells 97 •  The Plasma Membrane 98 •  The Nucleoid 99 •  Ribosomes 99 •  Plasmids, Inclusion Bodies, and Membranous Structures 100 •  Endospores 101 ■■ Clinical Application: Endospore-forming Bacteria 101 4.6  Prokaryotic Evolution and Classification 103 •  The Tree of Life 103 •  The Clinical Classification of Prokaryotes 105

xii  VISUALIZING MICROBIOLOGY

Gary E. Kaiser, Ph.D.

5.5  The Fungi 129 •  General Characteristics and Unique Features 129 ■■ The Microbiologist’s Toolbox: The Growth of Fungal Specimens on Sabouraud 131 Dextrose Agar •  A Survey of Fungi 131 •  Pathogenic Fungi 133 ■■ What a Microbiologist Sees: The Morphological Plasticity of Candida 134

5

5.6  The Helminths 135 •  General Characteristics and Unique Features 135 •  A Survey of Helminths 135 •  Pathogenic Helminths 135 ■■ Case Study: Cravings 138

Eukaryotic Organisms

5.1  The Eukaryotic Cell •  Cell Size •  The Eukaryotic Organelles

112

5.7  The Arthropods 139 •  A Survey of Arthropods 139 •  Pathogenic Arthropods and Arthropod Vectors 139

114 114 114

5.3  The Algae 122 •  General Characteristics and Unique Features 122 •  A Survey of Algae 122 ■■ Clinical Application: Agar—The Ideal Solid 124 Medium for Bacterial Culture •  Pathogenic Algae 124 5.4  The Protozoans 125 •  General Characteristics and Unique Features 125 •  A Survey of Protozoans 126 •  Pathogenic Protozoans 128

David M. Phillips/Science Source Images

5.2  The Origins of Eukaryotic Organelles and Organisms 120 •  The Autogenous and Endosymbiotic Hypotheses 120 •  Eukarya: A Classification Overview 120

Contents  xiii

6.1  Viral Structure and Classification •  The Structure of Viruses •  The Classification of Viruses

146 148 148 150

6.2  Viral Replication Cycles 153 •  Viruses Replicating in Animal Cells 153 ■■ The Microbiologist’s Toolbox: Presumptive Diagnosis of a Viral Infection Using CPE Analysis 158 •  Viruses Replicating in Bacterial Cells 158 6.3  Viruses and Human Health •  The Clinical Cultivation of Viruses •  The Impact of Viral Infections ■■ Case Study: H1N1 in Young Adults •  Viruses, Recurrent Infections, and Cancer ■■ What a Microbiologist Sees: Connecting Symptoms with the Progression of HIV 6.4  Prevention and Treatment of Viral Infections •  The Prevention of Viral Infections ■■ Clinical Application: Mandatory Flu Vaccines for Health Care Providers •  Antiviral Therapies •  Viral Influences on Bacterial Infections

160 160 160 161 162 163 164 164 164 165 166

Douglas Jordan/CDC

6.5  Viruslike Microbes 170 •  Viroids 170 •  Satellites 170 •  Prions 171

xiv  VISUALIZING MICROBIOLOGY

7

Metabolism

178

7.1  The Role of Energy in Life •  Basic Energy Principles •  Energy and Chemical Reactions ■■ The Microbiologist’s Toolbox: Identifying Bacteria by Metabolic Differences

180 180 180 182

7.2  Energy Production Principles 182 •  Oxidation-Reduction Reactions 182 •  ATP 183 7.3  Glycolysis and Fermentation 186 •  Glycolysis 186 •  Fermentation 188 ■■ Clinical Application: The Clinical Importance 189 of Alcohol Throughout History 7.4  Aerobic Cellular Respiration 190 •  Pyruvate Oxidation and the Citric Acid Cycle 190 •  The Electron Transport System 192 •  Lipid and Protein Catabolism 194 ■■ What a Microbiologist Sees: The Deepwater Horizon Oil Spill–Microbial Bioremediation 195 •  Integrated Metabolic Pathways 196 7.5 Photosynthesis •  Reactions of Photosynthesis ■■ Case Study: A Metabolic Imbalance in Grand Lake St. Mary’s •  Chemosynthesis in Bacteria

196 197 202 202

Courtesy Irina Olenina

6

Viruses and Other Infectious Particles

8

Microbial Genetics and Genetic Engineering

8.1  DNA as the Genetic Material •  DNA Structure and Functions •  DNA Replication in Bacteria

210 212 212 214

8.2  From DNA to Protein 215 •  Transcription 215 •  Translation 217

8.4  Regulation of Gene Expression •  Transcriptional Control •  Pre- and Posttranscriptional Control

225 225 226

8.5  Recombinant DNA Technology 228 •  Recombinant DNA Tools and 228 Gene Cloning ■■ The Microbiologist’s Toolbox: Gel Electrophoresis 229 •  Applications of Recombinant DNA Technology 230 ■■ What a Microbiologist Sees: Manipulating the Bacterial Genome for Agricultural Benefits 232 •  Ethical and Safety Concerns 233 8.6 Genomics •  DNA Sequencing •  Genomic Analysis •  Applications of Genomics ■■ Clinical Application: Screening for Genetic Diseases—BRCA1 Mutation

234 234 234 236 236

N. Watson and L. Thompson, MIT

8.3  Sources of Genetic Variation 219 •  Mutation 219 •  Recombination 222 •  Transposition 224 ■■ Case Study: The Spread of a Drug-resistance Gene 224

9

Microbial Growth and Control 240

9.1  Requirements for Microbial Growth •  Energy Sources •  Physical Requirements ■■ Case Study: Foodborne Illness from HomePrepared Fermented Tofu •  Chemical Requirements

244 244 244 245 247

9.2  Bacterial Reproduction and Growth 249 •  Cell Division 249 •  Growth Rate of Bacteria 250 •  Phases of Growth 251 •  Methods of Quantifying Bacterial Growth 252 ■■ The Microbiologist’s Toolbox: Dilution Plating 253

Contents  xv

9.3  Laboratory Growth of Microorganisms •  Obtaining a Pure Culture •  Growth Media ■■ What a Microbiologist Sees: Biofilm Formation on Teeth •  Bacteria That Cannot Be Cultured

254 254 254

9.4  Microbial Cultures in Clinical Practice •  Specimen Collection •  Specimen Analysis

260 260 260

258 258

9.5  Controlling Microbial Growth 263 •  Physical Methods 263 •  Radiation 264 •  Chemical Methods 266 ■■ Clinical Application: Alcohol-Based Hand Sanitizers in Health Care Settings 267

10

Innate Immunity

274

10.1  An Introduction to Immunity •  The Benefits and Consequences of the Immune Response •  Innate Versus Adaptive Immunity •  The Basic Anatomy of the Immune System

276

10.2  First-Line Defense Mechanisms •  Physical Defenses ■■ What a Microbiologist Sees: The Benefits of Fever ■■ Case Study: No Spicy Food for Me! •  Chemical Defenses

282 282

276 276 278

283 284 285

10.3  Innate Cellular Defense Mechanisms 286 •  Hematopoiesis 286 •  Leukocytes 287 ■■ The Microbiologist’s Toolbox: The Differential Count 289 •  Phagocytosis 290 •  Inflammation 290

Biophoto Associates/Science Source Images

Courtesy Ken Colwell

10.4  Protein-Mediated Defense Mechanisms 294 •  The Complement Pathways 294 •  Interferons 294 •  Miscellaneous Proteins with Antimicrobial Action 296

xvi  VISUALIZING MICROBIOLOGY

304

11.1  Introduction to Adaptive Immunity 306 •  Hallmarks of Adaptive Immunity 306 •  Antigens and Immunogenicity 306 ■■ Clinical Application: Conjugate Vaccines 308 •  Lymphocyte Maturation and Clonal Selection 308 •  The Major Histocompatibility Complex 311 ■■ What a Microbiologist Sees: Transplant Rejection 312 11.2  Cell-mediated Responses •  T-cell Categories •  Antigen Processing and Presentation •  The T-cell Receptor Complex and Associative Recognition

313 313 315

11.3  T-cell Activation •  Early Stages of T-cell Activation •  Completion of T-cell Activation ■■ Case Study: The Mantoux Test

317 317 318 318

11.4  Antibody-mediated Responses •  Basic Antibody Structure ■■ The Microbiologist’s Toolbox: The Coagulase Agglutination Assay •  Immunoglobulin Classes and Their Specific Functions

320 320

316

321 322

12.1  Vaccines and Vaccination •  A Brief History of Vaccination •  Modern Vaccines •  Vaccines and Public Health •  Vaccine Safety and Misconceptions

336 336 336 339 342

12.2 Immunoassays •  Monoclonal Antibodies ■■ The Microbiologist’s Toolbox: Human Monoclonal Antibody Therapy for Non-Hodgkin’s Lymphoma •  Types of Immunoassays

343 343

345 346

12.3 Hypersensitivities 350 •  Type I Hypersensitivity 350 •  Type II Hypersensitivity 352 ■■ What a Microbiologist Sees: Fetal Rh Incompatibility 353 •  Type III Hypersensitivity 354 •  Type IV Hypersensitivity 355 12.4  Autoimmune Diseases and Immunodeficiencies 356 •  Autoimmune Diseases 356 •  Immunodeficiencies 357 ■■ Clinical Application: Bone Marrow Transplants for Immunodeficient Patients 358 ■■ Case Study: Prioritizing Immunizations 359

NatUlrich/Shutterstock

11.5  B-cell Activation 323 •  B-cell Receptors and Pathogen Binding 323 •  Antibody Production and Clonal Expansion 325 •  B-cell Effector Mechanisms 327

12

Vaccination, Immunoassays, 334 and Immune Disorders

© Norma Jean Gargasz/Alamy Stock Photo

11

Adaptive Immunity

Contents  xvii

13

Microbial Pathogenesis

366

13.1  Entering and Adhering to the Host •  Microbial Reservoirs •  Portals of Entry and Exit •  Adhering to Host Cells

368 368 369 370

13.2  Transmission of Microbes •  Modes of Transmission ■■ Case Study: The Cholera Epidemic in Goma, Zaire •  Horizontal and Vertical Transmission

372 372

13.3  Bypassing Host Defenses •  Evading Immune Attack •  Altering Pathogen Antigens •  Damaging the Host Immune System

376 376 378 380

374 374

13.4  Damaging Host Tissues 381 •  Direct Damage 381 •  Enzymes 382 •  Endotoxins 382 •  Exotoxins 384 ■■ Clinical Application: Toxoid-based Vaccines 385 •  Immunopathy 387 ■■ The Microbiologist’s Toolbox: Analysis of Hemolysis on Blood Agar 388

Mukul P. Agarwal and Vishal Sharma Clinical Images: Purpura fulminans caused by meningococcemia CMAJ January 12, 2010 182:E18; published ahead of print October 26, 2009, doi:10.1503/cmaj.090103

13.5  Factors Influencing Disease Outcomes 389 •  Host Factors 389 ■■ What a Microbiologist Sees: Stress and Infection 390 •  Microbial Factors 391

xviii  VISUALIZING MICROBIOLOGY

14

Antimicrobial Agents

14.1  Principles of Antimicrobial Chemotherapy •  The Discovery and Development of Antimicrobial Agents •  Choosing the Best Antimicrobial Agent ■■ The Microbiologist’s Toolbox: The Broth Dilution Test

398

400 400 402 404

14.2  Antibacterial Agents 406 •  Inhibitors of Cell Wall Synthesis 406 •  Inhibitors of Protein Synthesis 409 •  Inhibitors of Nucleic Acid Synthesis 410 •  Agents That Target the Bacterial Plasma Membrane 412 •  Antimycobacterial Agents 412 ■■ Clinical Application: The Fight Against 412 Drug-Resistant Tuberculosis 14.3  Antiviral Agents •  Inhibitors of Virus Entry •  Inhibitors of Viral Nucleic Acid Synthesis •  Inhibitors of Viral Protein Synthesis •  Inhibitors of Viral Assembly and Release

415 416 417 418 418

14.4  Antifungal and Antiparasitic Agents •  Antifungal Agents •  Antiparasitic Agents ■■ Case Study: Problems with Malaria Medication in Mozambique

419 420 421

14.5  Antimicrobial Drug Resistance •  Principles of Drug Resistance •  Mechanisms of Drug Resistance •  Human Factors Contributing to Antimicrobial Resistance ■■ What a Microbiologist Sees: LivestockAssociated Drug-Resistant S. aureus

425 425 426

423

427 428

Hans Newman/microbiologyinpictures.com

15.4  Health Care–associated Infections 446 •  Common Health Care-Associated Infections 446 ■■ Clinical Application: Reducing the Risk of Bloodstream Infections 447 •  Surgical Site Infections 447 •  CAUTIs 450 •  PICC Line Infections 450 •  CLABSIs 451 15.5  Preventing Pathogen Spread in Health Care Settings 451 •  Hand Hygiene 451 •  Universal and Standard Precautions and PPE 453 •  Screening 454 ■■ The Microbiologist’s Toolbox: MRSA Screening Procedures in the Clinical Laboratory 455 •  Isolation Procedures 456

15

Epidemiology and Infection Control

434

15.2  Epidemiological Surveillance •  Prevalence, Incidence Rates, and Mortality Rates ■■ What a Microbiologist Sees: Antibioticimpregnated Bone Cement •  Epidemic Curves •  Disease Surveillance 15.3  Epidemiological Studies and Clinical Trials •  Case-Control and Cohort Studies •  Clinical Trials ■■ Case Study: A Foodborne Outbreak Among Inmates at a County Jail

Courtesy Ken Colwell

15.1  Epidemiology and Public Health 436 •  Early Epidemiological Successes 436 •  Significant Accomplishments of Epidemiology 436 438 438 439 441 441 442 442 443 444

16

Diseases of the Respiratory 462 System

16.1  The Conflicts •  Host Defenses •  Microbial Pathogenic Strategies •  Normal Microbiota

464 464 464 465

Contents  xix

16.2  Bacterial Diseases of the Respiratory System 466 •  Diphtheria 466 •  Pertussis 467 •  Tuberculosis 468 ■■ Case Study: Whooping Cough Outbreak 469 16.3  Viral Diseases of the Respiratory System 472 •  The Common Cold 472 •  Influenza 473 ■■ What a Microbiologist Sees: Unpredictable Behavior 476 16.4  Diseases of the Respiratory System 477 Caused by Multiple Pathogens •  Sinusitis and Otitis Media 477 •  Pharyngitis 479 ■■ The Microbiologist’s Toolbox: Diagnosis of Strep Throat 481 •  Laryngitis, Croup, Tracheitis, and Epiglottitis 482 •  Bronchitis and Bronchiolitis 483

Biophoto Associates/Science Source Images

16.5 Pneumonia 483 ■■ Clinical Application: Sputum Samples 484 •  General Characteristics of Pneumonia 484 •  Epidemiology of Pneumonia 485 •  Causes of Pneumonia 486 •  Emerging Pathogens 488

17

Diseases of the Skin and Eyes

17.1  The Conflicts •  Host Defenses •  Microbial Pathogenic Strategies •  Normal Microbiota

496 498 498 498 501

17.2  Bacterial Diseases of the Skin 502 •  Staphylococcal and Streptococcal Skin Diseases 502 ■■ The Microbiologist’s Toolbox: Mannitol Salt Agar—A Versatile Selective/Differential Medium 505 •  Pseudomonal Skin Diseases 505 •  Miscellaneous Bacterial Skin Diseases 506 17.3  Viral Diseases of the Skin 508 •  Pediatric Viral Rashes 508 ■■ Clinical Application: Improving Hand-Hygiene Compliance with Technology 509 •  Shingles 512 •  Warts 513 •  Smallpox 514 17.4  Fungal, Protozoan, and Arthropod Diseases of the Skin •  Fungal Skin Diseases ■■ What a Microbiologist Sees: Oral Thrush and Immune System Status •  Protozoan Skin Diseases •  Arthropod Skin Diseases ■■ Case Study: Kindergarten Contact

516 516 517 517 519 520

17.5  Diseases of the Eye 521 •  Host Defenses and Microbial Pathogenic Strategies 522 •  Conjunctivitis 522 •  Other Eye Diseases 523

xx  VISUALIZING MICROBIOLOGY

■■ The Microbiologist’s Toolbox: India Ink Staining of CSF for Cryptococcus 552 •  Toxoplasmosis 552

18

Diseases of the Nervous System

18.1  The Conflicts •  Host Defenses •  Microbial Pathogenic Strategies

532 534 534 534

18.2  Bacterial Diseases of the Nervous System 536 •  Bacterial Meningitis 536 •  Tetanus 540 •  Botulism 540 ■■ Clinical Application: Clinical Use of 541 Botulism Toxin •  Hansen’s Disease (Leprosy) 543 18.3  Viral Diseases of the Nervous System 543 •  Viral Meningitis 543 ■■ Case Study: Viral Meningitis in a High School Student 544 •  Encephalitis 545 •  Polio 547 ■■ What a Microbiologist Sees: Polio Eradication 547 •  Rabies 548 •  Other Viral Diseases of the Nervous System 550 18.4  Fungal and Protozoan Diseases of the Nervous System •  Fungal Meningitis

MedicImage/Alamy Stock Photo

© American Academy of Pediatrics

18.5  Prion Diseases of the Nervous System 554 •  Animal Spongiform Encephalopathies 554 •  Human Prion Diseases 554

551 551

19

Diseases of the Cardiovascular and Lymphatic Systems

19.1  The Conflicts •  Host Defenses •  Microbial Pathogenic Strategies

562 564 564 564

19.2  Sepsis and Cardiac Diseases 566 •  Sepsis 566 •  Cardiac Diseases 569 ■■ The Microbiologist’s Toolbox: The Blood Culture 571 19.3  Bacterial Diseases of the Cardiovascular and Lymphatic Systems 572 •  Brucellosis 572 •  Anthrax 574 •  Lyme Disease 575 •  Plague 577 •  Other Bacterial Diseases 580

Contents  xxi

19.4  Viral Diseases of the Cardiovascular and Lymphatic Systems 581 •  Leukocyte-associated Cardiovascular and Lymphatic Diseases 581 ■■ What a Microbiologist Sees: The Diagnosis of Mononucleosis 582 •  Viral Hemorrhagic Diseases 583 •  Hepatitis 585 ■■ Clinical Application: HIV Status and the Spread of Hepatitis 586 587 587 588 590

James Gathany/CDC Public Health Image Library

19.5  Protozoan and Helminthic Diseases of the Cardiovascular and Lymphatic Systems •  Systemic Protozoan Diseases ■■ Case Study: The Kissing Bug •  Systemic Helminthic Diseases

604 606 606

20.3  Bacterial Diseases of the Lower GI Tract 607 •  Diseases Caused by Salmonella 607 •  Diarrheagenic E. coli Infections 608 •  Campylobacteriosis 608 •  Shigellosis 608 ■■ The Microbiologist’s Toolbox: Preparing and Analyzing a Fecal Culture 609 •  Cholera 610 612 •  Opportunistic Diseases 20.4  Viral Diseases of the GI System 614 •  Cold Sores 614 •  Mumps 614 •  Viral Gastroenteritis 615 ■■ Case Study: A Norovirus Outbreak Among Nurses 616 •  Hepatitis A and Hepatitis E 617 20.5  Protozoan Diseases of the GI System 618 •  Giardiasis 618 •  Amoebic Dysentery 618 •  Cryptosporidiosis 619

Diseases of the Gastrointestinal System

20.6  Helminthic Diseases of the GI System 620 •  Trematode Infections 620 •  Cestode Infections 621 •  Nematode Infections 622 598

20.1  The Conflicts •  Host Defenses •  Microbial Pathogenic Strategies •  Normal Microbiota

600 600 600 600

20.2  Bacterial Diseases of the Mouth and Upper GI Tract •  Dental Caries •  Gingivitis and Periodontal Disease

602 602 603

xxii  VISUALIZING MICROBIOLOGY

David M. Martin, M. D./ Science Source Images

20

■■ What a Microbiologist Sees: Oral Hygiene for Patients with Ventilators •  Peptic Ulcer Disease •  Staphylococcus aureus Food Intoxication

21

Diseases of the Urogenital 632 System

21.1  The Conflicts •  Host Defenses •  Microbial Pathogenic Strategies •  Normal Microbiota

634 634 634 636

21.3  Bacterial Diseases of the Reproductive 643 Systems •  Prostatitis 643 •  Chlamydia 643 •  Gonorrhea 645 ■■ The Microbiologist’s Toolbox: The Challenge of Culturing Neisseria gonorrhoeae 646 •  Pelvic Inflammatory Disease 646 •  Syphilis 648 21.4  Viral Diseases of the Reproductive Systems •  Genital Warts ■■ Clinical Application: Winning the War on Cervical Cancer •  Genital Herpes •  Molluscum Contagiosum 21.5  HIV and AIDS •  An Emerging Infection •  HIV Replication and Pathogenicity •  HIV Diagnosis, Treatment, and Outlook

650 650 652 652 653 654 655 657 658

21.6  Fungal and Protozoan Diseases of the Reproductive Systems 660 •  Vaginal Yeast Infections 660 •  Trichomoniasis 662

Dr. P. Marazzi/Science Source Images

21.2  Bacterial Diseases of the Urinary System 637 •  Cystitis 637 ■■ What a Microbiologist Sees: Cranberry Juice for UTI Prevention 639 •  Pyelonephritis 640 ■■ Case Study: Pyelonephritis in a Toddler 641 •  Leptospirosis 641

22

Environmental and Industrial Microbiology

670 22.1  Microbial Ecology 672 •  The Ecological Hierarchy 672 •  Microbes in Earth’s Ecosystems 674 •  Biofilms 676 ■■ Clinical Application: A Potential New Therapy for Medical Biofilm Elimination 677 22.2  Biogeochemical Cycles 678 •  The Nitrogen Cycle 679 •  The Carbon Cycle 680 •  The Phosphorus Cycle 681 ■■ What a Microbiologist Sees: Habitat for Acidophiles 683 •  The Sulfur Cycle 683 22.3 Bioremediation •  Microorganisms Used in Bioremediation •  Sewage Treatment •  Freshwater Treatment

684 685 685 687

Contents  xxiii

22.4  Microorganisms Used in Manufacturing 687 •  Products of Biotechnology 687 •  Food Production 688 ■■ Case Study: Bacon Beer 691

Ugo Pisani Massamormile-Travel Photographer/Getty Images

22.5  Safe Product Processing and Packaging 692 •  Food Safety Regulations 692 •  Chemical and Physical Controls in Food Production 693 •  Canning 694 ■■ The Microbiologist’s Toolbox: The Autoclave 696 •  Microbial Control in Health Care Settings 696

xxiv  VISUALIZING MICROBIOLOGY

Appendix A: Answers to Self-Tests Appendix B: Physiological Reference Ranges

702

Glossary

708

Index

726

705

1

Microbial World WHEN THE SMALLEST ARE THE LARGEST

M

icrobiology is unique among the life sciences for several reasons. First, the subjects studied are invisible without magnification. Most microorganisms are less than 0.1 mm in size (see the photo) and a formidable challenge to investigate. Second, despite their small size, microorganisms are Earth’s dominant life form. Countless microorganisms live in and on other, larger organisms. The average adult human is composed of approximately 1 × 1013 cells but is inhabited by 1 × 1014 microbes (see the photo). Finally, the astonishing diversity of microbes allows them to occupy all environmental niches, from polar ice fields

to tropical rainforests. Life on Earth is sustained by the myriad interactions of diverse microbial species that enrich the environment and protect us from disease. In this text, you will become familiar with different kinds of microbes, their structures and physiology, and their ecological roles. You will explore the interactions of microbes with our immune systems and the infectious diseases that can result.

Courtesy Lydia-Marie Joubert, PhD

This imaging technique visualizes the microbial community, or biofilm, shown in green, growing on a hand that has been washed using an antimicrobial soap.

CHAPTER OUTLINE 1.1 The Microbes  4 • A Brief Survey of the Microbial World • The Dominant Form of Life on Earth

Finally, we will examine the roles of microbes in modern biotechnology and in maintaining a healthy environment. These tiny organisms with their amazing diversity and overwhelming population sizes make the study of microbiology an enormous but exciting undertaking.

This colorized scanning electron micrograph of various bacterial species helps us investigate the otherwise invisible world of microorganisms.

1.2 The Conflicts  8 • Growth and Control of Microbes • The Role of the Immune System ■ What a Microbiologist Sees: Wrestling and the Spread of Skin Pathogens • Pathogenesis • Antimicrobial Drugs 1.3 Infectious Disease  13 • Epidemiology and Healthy Practices • Host Defenses and Microbial Pathogenesis Strategies ■ The Microbiologist’s Toolbox: MALDI TOF Mass Spectrometry • Infectious Disease Statistics ■ Case Study: Vaccination: A Casualty of War 1.4 Microbial Ecology and Commercial Applications  18 • The Importance of Environmental Microbes • The Industrial Use of Microorganisms ■ Clinical Application: Pasteurization

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 4 ❑ p. 8 ❑ p. 13 ❑ p. 18 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

Analyze key features

❑ Microbiology InSight, p. 7 ❑ What a Microbiologist Sees, p. 10 ❑ Process Diagram, p. 11 ❑ The Microbiologist’s Toolbox, p. 15 ❑ Case Study, p. 17 ❑ Clinical Application, p. 20 ❑ Stop: Answer the Concept Checks before you go on. p. 6 ❑ p. 12 ❑ p. 17 ❑ p. 20 ❑

Scimat/Science Source Images

End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What’s happening in this picture? ❑ Complete the Self-Test and check your answers.

 

3

1. 1

The Microbes

LEARNING OBJECTIVES How big is small? Because microorganisms are in­ visible, we have no simple way to put their sizes in per­ spective but comparison with larger objects can help (Figure 1.1). The infectious particles are the smallest and simplest of the microbes. They range in size from 20 to 450 nm for viruses, which consist of genetic material wrapped in protein; viroids, microbe A microorwhich consist of only RNA; and prions, which ganism; an organism are composed of only visible only with the protein. The funda­ cell The smallest aid of a microscope. mental unit of life is living structure. microbiology The the cell, and the cel­ study of microscopic lular microbes are truly living organisms. The organisms. smallest cellular microbes are about 0.1 μm.

1. Compare and contrast the size and complexity of the three major groups of microorganisms. 2. Describe three ways in which microbes can be considered the dominant form of life on Earth.

T

he microbial world consists of a di­ verse group of organisms and in­ fectious agents that share a single feature—they are microscopic in size, and therefore, they are called microorganisms, or microbes. The field of ­microbiology explores a vast array of structures, functions, and interactions in these organisms.

Kovaleva_Ka/Shutterstock

1 μm

Salvador Garcia Gil/Shutterstock

the diameter of a single cell of a Staphylococcus aureus bacterium

Matthew J. Arduino, DRPH/CDC

the diameter of a red blood cell

10 μm

How many of the bacteria Staphylococcus aureus will fit across the head of the pin? a. 10  c. 1000 b. 100  d. 10,000

the height of a child

1m

the diameter of a garden pea

1 cm the diameter of a softball

10 cm the length of a school bus

10 m the height of Mt. Everest

Isaac Anderson

A sk Yo u rs e l f

FCG/Shutterstock

1 mm

MaxyM/Shutterstock

the diameter of a pin head

Palenque/Shutterstock

Relating invisibly tiny microbes to visible everyday items is a helpful way to initiate a study of microbiology because it provides clear points of size reference.

If a virus was the size of the period at the end of this sentence, then ___________________ would be as big as ___________________.

Baris Simsek/Getty Images, Inc.

Putting microbial size into perspective • Figure 1.1

10 km

1,000,000,000 μm = 1,000,000 mm = 100,000 cm = 1000 meters = 1 km

4  CHAPTER 1  Microbial World

The principal categories of microbes • Figure 1.2 The microbial world is divided into three categories based on their cellular nature. a. Noncellular microbes The smallest and most structurally simple microbes are infectious particles such as this Lyssavirus, which causes rabies. Only 180 nm long, the bullet-shaped virus consists of RNA surrounded by a protein coat.

ViralZone, SIB Swiss Institute of Bioinformatics

Microbial size (small)

Peplomer

Genetic material (RNA) Protein coat

b. Prokaryotic microbes Streptococcus pneumoniae is a true living microorganism. Although still relatively simple, prokaryotes, which include all bacteria, possess internal structures, a plasma membrane, and usually a cell wall, making them much larger and more structurally complex than infectious particles. Microbial size (medium) Genetic material Capsule (nucleoid) ~1 μ m

Cell wall

Microbial size (large)

Undulating membrane

Genetic material (nucleus) Flagellum

~35 μ m

180 nm

Microbial complexity (simple)

c. Eukaryotic microbes Eukaryotes make up the largest and most complex cell type. Eukaryotic cells compose plants, animals, fungi, algae, and protozoans, such as the Trypanosoma brucei shown here. Eukaryotic microbes possess intricate intracellular structures, including a nucleus, that perform diverse processes, and the cells are often motile.

Microbial complexity (moderate)

Microbial complexity (intricate)

A sk Yo u rs e l f Cells that contain a nucleus are ____. Cells that lack a nucleus are ____.

A Brief Survey of the Microbial World The most significant separation of groups within the microbial world is between the noncellular microbes and cellular microbes. Viruses, viroids, and prions are the noncellular microbes. These biochemical infectious agents use host cell machinery to replicate but are not technically alive (Figure 1.2a). All truly living things are made up of either prokaryotic cells or eukaryotic cells. All cells possess an outer boundary known as the plasma membrane that controls the selective movement of substances into and out of the cell. Prokaryotic cells (Figure 1.2b) range in size from 0.1 to 5 μm. In addition to the plasma membrane, many proprokaryotic cell karyotes also possess an exterior A cell lacking a discell wall for additional support tinct nucleus and membrane-bound and protection. Although proorganelles. karyotic cells are structurally simple, they contain numerous intracellular components that carry out diverse biochemical processes. An important prokaryotic intracellular structure is the nucleoid. This large loop of DNA in the

cytoplasm contains the genes essential for life. In addition, some prokaryotic cells possess plasmids, or small rings of DNA. Plasmid genes are considered to be accessory genes as they are often beneficial but not required for survival. Reproduction in prokaryotes is uncomplicated. It occurs by binary fission in which the microbes replicate their DNA (nucleoid and plasmids) then pinch in two. Prokaryotic microbes are subdivided into two categories based on fundamental differences in their cellular components and molecular characteristics. The Archaea include organisms able to tolerate extreme environments, such as the conditions found on Earth four billion Archaea A domain years ago. Archaean adaptations of microscopic, to harsh, primordial habitats single-celled pro­correlate with their emergence as karyotic organisms Earth’s first organisms. Today that are genetically they can be found thriving in the distinct from bacteria intense heat of a geyser, the salty and generally live Dead Sea, and the tremendous in extreme environpressure of the ocean floor. ments or produce Achaeans are also abundant in methane. The Microbes  5

marine environments and flourish in the gut of rumi­ nants, such as cows. Some archaeans produce gases that are deadly to most other organisms. For example, Methan­ osarcina generates methane and Caldicellulosiruptor releases hydrogen. The Bacteria are the more familiar group of prokary­ otic microbes. They include many different disease-causing bacteria, as well as those that play Bacteria A domain positive roles in the health of the of genetically distinct environment and in industrial microscopic, singlemicrobiology processes. In Chap­ celled prokaryotic ter 4 we will examine the specific organisms that do not features of prokaryotic cells then have a membraneaddress their roles in infection, bound nucleus and environmental health, and indus­ inhabit virtually all try in Chapters 16–22. environments. Eukaryotic cells are approxi­ mately 10–100 times larger than eukaryotic cell their prokaryotic counterparts A cell possessing a true nucleus and (Figure  1.2c). They may or may membrane-bound not possess a cell wall exterior organelles. to their plasma membrane, but they all contain a variety of com­ plex intracellular structures known as organelles. Each organelle performs specific functions necessary for cell survival. Usually the most prominent organelle is the nucleus, which consists of an aggregation of DNA sur­ rounded by two protective layers of membrane. The nu­ cleus functions as the control center of the cell. Eukaryotic microbes include microscopic organ­ isms that may possess qualities associated with macro­ scopic fungi, plants, or animals. Molds and yeasts are microscopic fungi. The Fungi are a large group of eu­ karyotic organisms. Unlike any other group of organ­ isms, fungal cells are surrounded by cell walls made up of a substance called chitin. Fungi play a valuable ecological role as decomposers, breaking down the re­ mains and wastes of other organisms. However, they can also act as human pathogens, agents that can cause disease. Certain groups of algae are unicellular or mi­ croscopic multicellular organisms with limited cell differentiation. Like plants, they are photosynthetic, producing the glucose and oxygen used by many other organisms. Unicellular organisms with the animallike characteristics of food consumption and locomo­ tion are known as protozoans. Many are free-living microbes, but others infect humans and cause deadly

1. Why are infectious particles not considered living microorganisms?

6  CHAPTER 1  Microbial World

disease. Finally, ­microbiologists study many species of worms, or ­helminths. Although most of these organ­ isms are visible to the naked eye, their eggs and juvenile stages are microscopic, so they are included in the field of microbiology. The characteristics of the diverse eu­ karyotic microbes will be described in Chapter 5, and their roles as pathogens and industrially valuable assets will be discussed in Chapters 16–22.

The Dominant Form of Life on Earth An amazing aspect of life on Earth is that the tiniest organisms have the greatest role in shaping the nature of Earth’s biosphere. Micro­ biologists have estimated the biosphere All the size of Earth’s bacterial popula­ living things on the tion at five million trillion tril­ planet plus the nonlion (5  ×  1030) cells. This easily living components of makes bacteria the most abun­ their environments. dant organisms on the planet (Figure 1.3a). Using current DNA technologies, scien­ tists have conservatively estimated that there are from 10 million to 1 billion species of bacteria. With so many kinds of microbes, it is not surprising that they have adapted to occupy all biological niches on the planet (Figure 1.3b). Bizarre and exotic microbial habitats in­ clude geysers, deep-sea vents, and carnivorous plants. Microorganisms routinely live in and on animals as dif­ ferent as polar bears, bioluminescent fishes, and insects. Prokaryotic microbes, the first life forms, evolved ap­ proximately 3.8 billion years ago (Figure 1.3c). They flourished in Earth’s primitive oceans, where the water served as a natural filter for the high levels of damaging ultraviolet (UV) radiation from the sun. As competition for food resources increased, the first photosynthetic mi­ croorganisms appeared. These microbes, the blue-green algae, were able to convert solar energy into glucose, which they could use as their energy source. Oxygen, re­ leased into the atmosphere as a by-product of photosyn­ thesis, made possible the evolution of aerobic organisms and the generation of Earth’s ozone layer. The ozone layer, high in the stratosphere, screens out some of the UV radiation from the sun, making terrestrial life pos­ sible. If not for its shielding capacity, any organisms leav­ ing the UV-filtering water for life on land would sustain DNA damage.

2. How did the oxygen generated by photosynthetic blue-green algae significantly influence the evolution of life on Earth?

Microbiology InSight  Earth’s principal life forms 

•  Figure 1.3

✓ The Planner

a. The most abundant

b. The most diverse

To put the unfathomable number of invisible bacteria into better perspective, compare it to the amount of common macroscopic organisms. All nonbacterial life on Earth is calculated at 560 billion tons of biomass, which is slightly less than the total mass of bacteria on the planet, even in a conservative estimation.

Microbes are impressive in their thorough colonization of every part of Earth, from high in the atmosphere to deep in the soil and all points in between. Clouds are filled with many of the same bacteria found on plants and in soil.

Relative abundance of bacteria Total dry biomass (tons)

1012 Ruminant animals have a complex digestive system containing billions of microorganisms that help digest the vegetation they consume.

1010 8

10

106 104

Bacteria associated with clover roots convert N2 gas into usable forms to promote plant growth.

102

ia er ct

ct ba on

Ba

ia er

ps ro C Al

ln

Li

H

ve

um

st

an

oc

s

k

100

Wessner, Dave. Microbiology, 1e; from figure 17.28, page 585. © 2013. Wiley

By any measure—sheer numbers, species diversity, habitat variety, time of existence, or influence on the evolution of life—microbes are the dominant form of life on Earth.

Type of organism

c. The most influential An abbreviated timeline of Earth’s evolutionary history shows that microbes were not only the first life forms but also that their activities made possible the eventual evolution of aerobic organisms, including all terrestrial life. Developing ozone (O3) layer in the stratosphere reflects some harmful UV radiation

O2

OH

OH HO OH Wessner, Dave. Microbiology, 1e; figure 1.17, page 21. © 2013. Wiley

Stromatolites–columns of blue-green algae and rock

Chemical reactions generate molecules needed for life. Earth forms 4.5 billion years ago

T h i n k C ri ti c al l y

First prokaryotic cells arise.

The evolution of photosynthetic blue-green algae leads to oxygen production. O2 interacting with UV light in the stratosphere produces ozone to shield Earth’s surface from excess solar UV radiation.

Earth’s timeline

How did the origination of photosynthetic microbes, such as blue-green algae, influence the evolution of other life on Earth?

Wessner, Dave. Microbiology, 1e; from figure 3.19, page 97. © 2013. Wiley

CH2OH O

UV radiation penetrating the ozone layer

UV light reflected by the ozone layer

Aerobic eukaryotic life evolves. High O2 levels allow increased ATP production.

Terrestrial life emerges as ozone layer matures.

Present day

1. 2

The Conflicts

LEARNING OBJECTIVES 1. Compare and contrast the everyday use of disinfectants and antiseptics. 2. Discuss the innate and adaptive immune responses that protect you from infection. 3. Outline the five basic steps of pathogenesis, highlighting the possible interactions between the pathogen and host.

M

icrobial interactions are foundational to the study of microbiology. Some microor­ ganisms interact with our physical environ­ ment, for example, certain bacteria add usable nitrogen to the soil whereas others break down organic wastes. Microbes often interact with each other, competing for resources or swapping genetic material. Of special interest to us are microbial interac­ tions involving larger organisms, including humans. These relationships may be mutually beneficial, but they can also lead to infection, food spoilage, or habitat contamination and are, therefore, best described as con­ flicts. In Chapters 16–21 we will discuss microbial infec­ tions associated with each major body system. These chapters outline struggles between microbial strategies and system-specific host defenses. In Chapter 22 we will analyze conflicts between humans and microorganisms involving damage to our food and natural resources.

Growth and Control of Microbes Because many microbes are pathogenic, it is impera­ tive to know how their growth is promoted and how to inhibit it.

Growth and identification of microbes  In a clinical setting, a specimen collected from a patient is sent to the laboratory for culture so any pathogens present can be quickly culture The cultivagrown for accurate identification tion of microorgan(Figure 1.4a). Most culture or isms or other cells in growth media contain a blend of an artificial medium carbohydrates, proteins, and vi­ containing nutrients. tamins, plus buffer to maintain an appropriate pH and salts for osmotic balance. The composition of clinical growth media can be varied to encourage cultivation of some microbial species and suppress growth of others. The addition of indicator dyes even allows some media to distinguish certain bac­ terial species.

8  CHAPTER 1  Microbial World

4. Explain the concept of antibiosis by reviewing its accidental discovery and its connection to host/pathogen conflicts.

Rate of growth and microbial population size can also be determined in the laboratory. Bacteria demonstrate a consistent growth pattern. Because they grow by binary fission, a bacterial population increases slowly at first. As each generation doubles the population size, the growth rate soon increases exponentially. A large bacterial popu­ lation in culture depletes its nutritional reserves and ac­ cumulates secreted waste products, eventually leading to diminished growth. Population size frequently correlates with the sever­ ity of an infection and can be determined in many ways (Figure 1.4b). Direct counting of microbes using a mi­ croscope and gridded slide is simple and accurate but tedious. Most modern laboratories use sophisticated, ex­ pensive instruments to rapidly obtain growth data. Once pathogen identification and population size have been determined, medical professionals can intervene to halt growth and cure the infection.

Control of microbial growth Controlling microbial growth requires manipulation of various factors associ­ ated with a given microorganism’s nutritional and en­ vironmental tolerance ranges. For efficient culture of common pathogens, the microbes are provided with optimal food resources and their ideal temperature. The oxygen and carbon dioxide levels are adjusted depend­ ing on the microorganism’s atmospheric requirements, and appropriate moisture and pH levels are fine-tuned. Conversely, modifying any or all of these parameters can dramatically decrease growth if they are outside of the microbe’s tolerance range. A common example of this practice is refrigeration of food. Most contaminating microbes responsible for food spoilage grow rapidly at warmer temperatures but slow their reproduction as the temperature drops. Another method of controlling microbial growth is the application of toxic chemicals. Selective toxicity re­ fers to a chemical that will poison the pathogen without harming the host. Antiseptics are chemicals that are mild enough to safely apply to living tissues but capable of selectively damaging any microorganisms living there.

Microbial identification and quantification • Figure 1.4 Microbiologists use a variety of methods to identify the microorganisms present in a specimen. The success of microbial growth control is confirmed by determining the number of microorganisms present before and after treatment. b. Common microbial quantification methods Directly counting microorganisms under a microscope, indirectly determining their population size with a spectrophotometer, and using automated cell-counting devices are methods routinely employed by microbiologists to quantify microbes.

Cover slip

Bacterial suspension

© Martin Rotker/Phototake

Wessner, Dave. Microbiology, 1e, figure 6.15, page 184. © 2013. Wiley

a. Microbial identification methods Cell staining, biochemical testing, and assays using the specificity of antibodies quickly provide a microbiologist with the clues necessary to identify microbes.

Bacterial suspension Petroff-Hauser counting chamber

Using a special gridded slide under the microscope, the number of bacterial cells in this sample can be directly counted. The color and morphology of a gram-stained specimen give clues to its identity.

Turbidity is indirect evidence of bacterial growth in broth.

Linda Young

Curtis E. Young, Ph.D

Spectrophotometer

Ken Colwell

Using a spectrophotometer, the number of bacteria in this tube can be determined as a measure of turbidity.

Culturing a specimen on media containing colorful indicator dyes reveals the basic metabolic processes that may be species specific.

Mixture of labeled and unlabeled cells in fluid Cells move through narrow tube one at a time.

Type of fluorescence is detected.

Positive charge

+

Negative charge

–

Charge matching the fluorescence is applied to cell.

No charge – – – – –

This antibody-based assay causes a clumping reaction, or agglutination, when it positively identifies a species-specific feature.

A sk Yo u rs e l f Of the techniques illustrated, results are given automatically by the _____ and the _____.

Cell population 1

+ +

– –

+

–

+ ++ +

– –– –

Unlabeled population

+ + + + +

Cell sorter

Cell population 2

Wessner, Dave. Microbiology, 1e; figure B15.1, page 494. © 2013. This material is reprinted with permission by John Wiley & Sons, Inc.

Mauro Fermariello/ScienceSource

–

Laser

A fluorescence-activated cell sorter is a fully automated technique for counting cells using a laser and fluorescent dyes.

To kill microbes living on inanimate surfaces, harsher substances known as disinfectants are used (see What a Microbiologist Sees).

The Role of the Immune System Your immune system is specifically designed to face pathogenic conflicts, fighting effectively on multiple levels to maintain your good health. Innate immune responses are complex processes involving proteins and blood cells that protect the host against invading microorganisms. Leukocytes, or white blood cells (WBCs), are specialized to fight infection. Some WBCs

engulf and degrade microorganisms, others lyse in­ fected host cells, and still others eliminate pathogens via inflammation. True immunity is the result of adaptive immune responses, ac­ immunity The tions that are highly specific to a ability to resist future infections caused by given pathogen and, with a mem­ pathogens previously ory component, become stron­ encountered by the ger with subsequent encounters. host and targeted Adaptive responses are medi­ for immediate ated by a type of WBC known as destruction by the lymphocytes. Some lymphocytes immune system. secrete pathogen-specific attack

What a Microbiologist Sees ✓

The Planner

Wrestling and the Spread of Skin Pathogens kills many skin bacterial species, thus reducing the load of potential pathogens that could cause an infection. Mats should be disinfected with powerful chemicals such as bleach after every practice and meet. Studies monitoring bacterial abundance on wrestling mats during tournaments show a 3.5-fold increase in contamination after only 2 hours of competition (Figure b). Wrestlers are exposed to many potential pathogens as microbial mat numbers continue to climb for the first 6 hours of competition before leveling off. For this reason, mat disinfection every couple of hours during a tournament is also recommended. These microbial growth control practices are crucial for preventing the spread of skin pathogens through wrestling.

a.  Wrestlers are at risk for skin infections due to pathogen exposure from direct skin contact and contaminated mats.

b.  The number of contaminating bacteria on a wrestling mat correlates directly with the duration of the competition.

Tim Vaughn

Relative bacterial abundance on wrestling mat

Spectators at a wrestling match are engrossed in the physical action of the competition, but what a microbiologist sees is a scenario requiring microbial growth control. Microorganisms covering the skin are easily transferred from one wrestler to another due to direct contact while grappling (Figure a). Not only is the wrestling mat contaminated with these same microbes, but it is also exposed to the microorganisms exhaled as wrestlers breathe heavily and to those tracked onto the surface from shoes. To minimize the risk of wrestlers acquiring skin infections, microbial growth control is managed using chemical agents. Wrestlers are encouraged to shower with antiseptic products containing chlorhexidine gluconate. This compound effectively

3 2.5 2 1.5 1 0.5 0

0

2

4

6

8

10

Duration of wrestling competition (in hours)

Inte rp re t th e D a ta According to the graph, in 10 hours of wrestling, the number of bacteria on the wrestling mat increased by about _____. a. 200%  b. 300%  c. 500%  d. 600%

Hand hygiene •  Figure 1.5

✓ The Planner

To prevent pathogen transmission, especially in a medical setting, hands must be correctly washed with soap and water then thoroughly dried before meals, after using the toilet, when visibly soiled, and before and after patient contact.

1 Wet hands and apply enough soap to form a good lather. Using a circular motion, rub hands and palms together.

Pathogenesis The development of an infectious disease, or pathogenesis, represents the conflict between humans and microorgan­ isms. Regardless of the pathogen and the illness it causes, the same series of steps are followed: pathogen entry into host, pathogen attachment, thwarting immune defenses, host damage, and pathogen exit. Many pathogens enter a host through body openings such as the mouth or nose, but pathogens also enter through breaks in the protective barrier of the skin. Once inside, a microbe must anchor securely to host tissues to prevent removal by one of the body’s many washing mechanisms. Because the host immune system will recognize a microbial invader and initiate an attack against it, many microorgan­ isms have evolved elaborate strategies for either overcom­ ing or evading this assault. Microbe-altered gene expression in a host and secretion of enzymes, toxins, and by-products by a large number of pathogens are directly responsible for causing infection symptoms. If the host sustains too much damage, the pathogen will need to exit the dying host and infect another host to continue its own survival. By understanding the five steps of pathogenesis, medical professionals can intervene, disrupting one or more stages and blocking infection. One of the best ways to prevent entry is to reduce microbial populations by antisepsis and disinfection. Simple hand hygiene, when consistently and correctly practiced, is the single best way to stop pathogen transmission between individuals. Acceptable methods of hand hygiene include the use of alcohol-based gels, unless spore-forming pathogens are a concern, and thorough washing with antimicrobial soap and water (Figure 1.5). This will be a recurrent theme in Chapters 16–21 as we discuss infections affecting the various body systems. In addition, to prevent attachment and help your immune system eliminate pathogens prior to symptom onset, physicians may prescribe prophylactic antimicrobial medications. Some of these medications can even bind to secreted bacterial toxins, neutralize them, and stop their damaging effects.

2 Clean the tops of hands by scrubbing the palm of one over the back of the other and then switching hand positions. Interlocks fingers loosely, sliding palms up and down to clean finger webbing.

3 Clean knuckles by making a fist and rubbing them side to side on your palm. Use a circular motion to cleanse thumbs.

4 After rubbing fingertips in a circular motion on the palms, rinse with clean water and dry hands thoroughly using the towel to turn off the faucet.

Th in k Cr it ica lly In step 1 you are instructed to wet your hands, apply soap, and generate a good lather. How would following the hand-washing regimen without using soap affect hand antisepsis?

The Conflicts  11

Process Diagram

proteins called antibodies, whereas other lymphocytes can directly destroy infected host cells. Understanding how the immune system generates an adaptive response has led to one of the greatest medical breakthroughs of the twentieth century—vaccination, which involves the administration of a pathogen that has been made harmless. This process primes the immune system so the initial contact with the active pathogen triggers an overwhelming attack by the im­ mune system. The result is immunity without the individual ever suffering from infection. The basic concepts of innate and adaptive immunity will be discussed in Chapters 10 and 11. In Chapter 12 we will examine immune disorders and several practical applications of immune function.

Antimicrobial Drugs

Antibiosis • Figure 1.6

The concept of selective toxicity is most important when administering antimicrobial medications to pathogen-infected patients. To kill invading microbes without injuring the host requires targeting features that are unique to the pathogen. Most often these are structures or enzymes that are essential for microbial growth, metabolism, or reproduction but are not pres­ ent in or essential to the host. Because bacteria are prokaryotic, they demonstrate significant cellular differences from the eukaryotic cells of humans. This provides drug designers with multiple pathogen-specific targets to exploit. Killing fungal and protozoan pathogens is usually more challenging than killing bacteria because those microbes are eukaryotic and share cellular similarities with humans. Viruses are perhaps the toughest microbes to eliminate because they are intracellular pathogens and therefore are difficult to target without also killing the host cells. A community of microorganisms involves a com­ plex set of interactions between different microbial spe­ cies. Because the organisms in a community all occupy the same habitat, they must compete with neighboring species for food, water, and space. Some microbes are especially well adapted for acquiring their needed re­ sources. They eliminate the competition by secreting chemicals toxic to other community members. These microbes establish a zone of growth inhibition around themselves where only they can access the resources, which gives them a tremendous survival advantage. The concept of controlling microbial growth by the use of chemicals was accidentally discovered in 1928 by Alexander Fleming, who observed fungal contamination in one of his staphylococcal cultures in the laboratory. Fleming specifically noted that the bacteria did not grow near the fungus, almost as though an inhibitory substance were being secreted from it (Figure 1.6). After identify­ ing the fungus as Penicillium notatum, Fleming grew the mold on agar to collect any secretions. As Fleming pre­ dicted, many bacterial species, including Staphylococcus, Streptococcus, and Neisseria, were unable to grow in the presence of the fungal secretions he named penicillin. The effect of the Penicillium mold on bacteria is an ex­ ample of antibiosis, an interaction between two organ­ isms that harms one of them. In 1941 work performed by Howard Florey and Ernst Chain led to the first clinical trials of penicillin for treating staphylococcal infections in humans. The research efforts of these three scientists resulted in the mass production of this new antibiotic compound, which was responsible for saving the lives of countless wounded soldiers who would have otherwise succumbed to septic wounds during World War II. Today many different types of antimicrobial drugs are available to fight infections. Although these therapies are

The observation that naturally secreted chemicals from one microorganism can control the growth of competing microbial species served as the inspiration for modern antibiotic therapy.

12  CHAPTER 1  Microbial World

Staphylococcus aureus

Penicillium notatum

Christine L. Case

Zone of growth inhibition

Th in k Cr it ica lly How can you determine from the photo which microbe is producing the growth-inhibiting chemical?

often highly effective, there are important considerations for their use. If an infection is self-limiting or likely to be controlled by the host’s immune system, physicians will not usually prescribe an antimicrobial medication. This action prevents the sometimes significant side effects of chemotherapies and saves money. It also minimizes un­ necessary pathogen exposure to drugs, which reduces development of resistant strains. When a more serious infection warrants administration of antimicrobial drugs, physicians will use information provided by a clinical mi­ crobiology laboratory to prescribe the drug(s) to which the pathogen is most sensitive.

1. What environmental and nutritional factors are most important in controlling microbial growth? 2. What two features are demonstrated by an adaptive immune response? 3. How does the host sustain damage during pathogenesis? 4. Why is it more difficult to develop selectively toxic drugs to treat viral and fungal infections than it is to develop drugs for bacterial infections?

1.3

Infectious Disease

LEARNING OBJECTIVES 1. Describe how epidemiological and infectioncontrol practices can prevent large-scale outbreaks of disease. 2. Compare and contrast the strategies of host defenses and microbial pathogenesis.

3. Discuss the global impact of infectious illnesses, including both previously controlled infections and emerging diseases.

e practice numerous activities to limit the growth of dangerous microorganisms, rely on our immune systems to target and elimi­ nate invading pathogens, and treat infected patients using drugs with selective toxicity. Although these are impressive control measures, patho­ gens routinely overcome or evade our defensive practices to cause infectious disease.

Modern epidemiological studies help public health workers develop effective disease prevention and treat­ ment programs by establishing a surveillance-based protocol for infection prediction. When an outbreak of infectious disease does occur, epidemiologists use their expertise and vast databases to analyze patterns of pathogen spread, implement interventions to disrupt the chain of transmission, and minimize morbidity and mortality. Many of these same epidemiological practices are em­ ployed by the infection control department in hospitals to minimize health care-associated infections (HAI). Because of the health careunique nature of a hospital com­ associated munity, additional protocols are infection (HAI) routinely implemented to prevent An infection acquired pathogen transmission between while receiving patients and caregivers. Approxi­ treatment at a mately 3.5–4 billion cases of HAIs medical facility; also are reported annually (Table  1.1), known as a nosocoresulting in almost 100,000 deaths. mial infection. This human suffering correlates with a staggering price tag, estimated at between $10 and $45 billion a year. Medicare and Medicaid do not reim­ burse for costs related to HAIs, which has motivated most health care facilities to improve their infection control measures.

W

Epidemiology and Healthy Practices Epidemiology investigates the geographic distribution of

an illness and monitors population data to help prevent spread of disease. Two important measures are morbidity rate, the epidemiology The incidence rate of all diseases in a science that studies population, and mortality rate, the patterns of disthe number of deaths per num­ ease in populations to detect the source ber of cases in a given area over a and control the given time. These rates contribute spread of disease to an understanding of disease prevalence and informed re­ sponses to outbreaks. Microbiology is a major compo­ nent of epidemiology, but the discipline also requires a working knowledge of physiology, anatomy, statistics, psy­ chology, ecology, immunology, and sociology.

Common health care-associated infections  Table 1.1 Type of infection

Frequency (%)

Common HAI culprits

Urinary tract infections (UTIs)

40

E. coli, Enterococcus spp., Pseudomonas aeruginosa

Surgical site infections (SSIs)

19

Staphylococcus epidermidis, Staphylococcus aureus, E. coli, Pseudomonas aeruginosa, Enterobacter spp., Enterococcus spp.

Respiratory infections

15

Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter spp., Pseudomonas aeruginosa, Streptococcus pneumoniae

Skin infections

 8

Staphylococcus aureus, Pseudomonas aeruginosa, E. coli

Sepsis

 6

Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa, Enterobacter spp., Enterococcus spp.

Miscellaneous other infections

12

Clostridium difficile, vancomycin-resistant Enterococcus (VRE)

Infectious Disease  13

Thorough, consistent hand washing (see again Fig­ ure 1.5) is the single most important step in breaking the chain of pathogen transmission. However, its effectiveness is significantly diminished by carelessness and insufficient washing time. Nurses report a 40% noncompliance rate with hand-hygiene protocols. This problem occurs with surgeons as well. A recent study of 125 orthopedic surgeons found that 35% scrubbed for less than 2 minutes prior to operating. The mean scrub time was 2.5 minutes, and 100% of the surgeons failed to scrub for the full 5 minutes necessary to remove the 99.99% of transient and detach­ able skin microbiota to best prevent surgical site infections. Patients are protected from HAIs by routine screen­ ings for antibiotic-resistant bacteria, such as methicillinresistant Staphylococcus aureus (MRSA). Pathogen trans­ mission is dramatically reduced by strict housekeeping practices with daily disinfection of frequently touched surfaces and patient-dedicated personal hygiene prod­ ucts. Special laundry collection and sanitizing measures minimize pathogen spread and performance of invasive out-patient procedures is restricted to designated rooms subjected to rigorous decontamination practices. Immune-compromised patients are placed in pro­ tective environment isolation. Coupled with meticulous cleansing by all participating health care providers and special antiseptic preparation of the procedure site, these precautions usually result in a positive infection control outcome. Health care providers are protected from patient pathogens by the correct, consistent use of personal protective equipment (PPE). The need for gloves, gown, apron, goggles, and/or masks should be assessed based on the level of infection risk associated with performing a specific procedure. Any task involving potential contact with body fluids should be considered high risk. In the 1980s the CDC developed a safety action plan known as universal precautions to protect health care workers dur­ ing a time of rapidly rising rates of blood-borne patho­ gen infections. The details of universal precautions are outlined in Chapter 15. As you review the infections de­ scribed in Chapters 16–21, identify how their transmission is minimized by following these practices consistently.

Host Defenses and Microbial Pathogenesis Strategies Humans have evolved multilevel defense systems to protect against microbial invasion. To emphasize the importance of host defenses in preventing infection, Chapters 16–21 each begin with an examination of system-specific protec­ tive strategies. There are also more general defenses, for example, physical defenses that include the skin and mu­ cous membranes as well as washing actions such as tearing, sweating, and urination. Fever elevates body temperature

14  CHAPTER 1  Microbial World

above the tolerance range of many microbes, thereby slow­ ing their growth. Chemical defenses consist of acidic secre­ tions, salty perspiration, and pathogen-degrading enzymes. Other diverse biological defenses are also used. Phago­ cytic neutrophils, the most numerous type of leukocyte, engulf and eliminate pathogens. Normal microbiota are the typically nonpathogenic microorganisms adapted to live in and on us. Because they are outstanding competi­ tors for space, nutrients, and other resources within their microhabitats, it is challenging for transient, pathogenic microbes to become established and initiate infection. An example of this type of biological defense is represented by the dominant growth of E. coli in the intestines, suppressing the expansion of pathogenic Clostridium difficile (C. diff). However, when a patient receives a strong antibiotic to cure a bacterial infection, much of the gut microbiota is elimi­ nated as collateral damage. C. diff forms endospores, or resistant, thick-walled asexual spores that develop inside some bacteria and protect them from antibiotic damage. After antibiotic therapy is discontinued, the C. diff endo­ spores can germinate and reproduce rapidly because their principal competitors are gone. If the population of this toxin-secreting pathogen is allowed to increase, the patient develops severe diarrheal disease. The normal microbiota may suppress the growth of rival microbes by toxin secretion, which makes more re­ sources available for them. A final example of protection offered by normal microbiota is their ability to alter the pH of their environment. Fermentation by Lactobacillus results in acid production that lowers vaginal pH below the tolerance range of Candida albicans, reducing the risk of yeast infections. Cutaneous fungal infections are like­ wise minimized as normal skin residents, such as Staphy­ lococcus epidermidis and Micrococcus luteus, metabolize oily secretions into acids. Rapidly evolving microorganisms often develop adapta­ tions that permit them to avoid or overcome host defenses. Some microorganisms possess specialized surface proteins that securely attach them to host cells despite washing ac­ tions. Other microorganisms routinely change the proteins expressed on their surfaces. This protein modulation ren­ ders previously secreted antibodies useless, allowing the microorganism to survive when, days later, the immune system generates antibodies to the new surface proteins. Many bacteria secrete enzymes that degrade antibodies, or they may form clotlike coverings that hide them from WBCs. Because of these pathogenesis tactics, microorgan­ isms regularly invade humans and overcome host defenses, leading to illness. The first step in diagnosing and treat­ ing an infection is accurate identification of the pathogen (see The Microbiologist’s Toolbox). Once the culprit is known and its susceptibility, or responsiveness to specific antibiot­ ics, determined, health care providers can treat the patient and prevent the spread of infection to others.

T he M icrobiologist ’ s T oolbo x

✓ The Planner

MALDI TOF Mass Spectrometry Rapid microbial identification is key to effective patient treatment. Traditional procedures can take 24–48 hours, a delay that could prove deadly to a patient suffering from a rapidly spreading infection. But a modified form of mass spectrometry, a technique for molecular identification based on size and charge differences, can identify pathogens in 1 hour. Matrix-assisted laser desorption ionization time of flight (MALDI TOF) mass spectrometry requires application of one specimen colony to a test plate. When inserted in the instrument, a laser superheats the specimen, volatilizing microbial proteins. The time needed for these molecules of different size and

charge to reach a detector at the end of the test chamber is recorded and converted into a spectrum (Figure a). Each spectrum is unique, like a fingerprint. Comparison of the patient sample spectrum with those in the instrument database allows rapid, accurate microbial identification. Comparison of MALDI TOF and traditional methods indicate enhanced accuracy with the new technology (Figure b). The $45,000–60,000 cost of the equipment is offset by savings in laboratory supplies, technician time, and high-volume testing. Consequently, hospitals worldwide are adding this new tool to their laboratories.

Adapted from Ayyadurai S et al. (2010). Rapid identification and typing of Yersinia pestis and other Yersinia species by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. BMC Microbiol.;10:285. doi: 10.1186/1471-2180-10-285. http://creativecommons.org/licenses/by/2.0

a. Spectra generated by MALDI TOF

b. A comparison of MALDI TOF benefits and limitations Benefits

Limitations

1-minute sample preparation

No antibiotic susceptibility data provided

High automated throughput

No direct specimen testing (except urine samples)

Safe–low pathogen exposure risk

Difficulty distinguishing closely related microbial species

Cost effective

Difficulty identifying sporulating microbes

Superior accuracy/reproducibility

Equipment costs

Highly adaptable

Maintenance costs

Single-colony specimen use Green technology

T h i n k C ri ti c al l y What is the most serious shortcoming of results from this type of spectrophotometer?

Mortality associated with the top global infections • Figure 1.7 One-third of all deaths are due to infection, with the majority of this mortality associated with diseases of the respiratory system, diarrheal diseases, and HIV/AIDS. (Data retrieved from The World Health Organization, The Centers for Disease Control, and The Global Health Policy Center, 2014–2015.) Infections responsible for greatest global mortality Dengue fever 22,000 Measles

145,700

Pertussis

195,000

Infections

Malaria

627,000

Hepatitis B

780,000

Tetanus

800,000

HIV

In t e r p r e t t h e Da t a

1,500,000

Diarrheal disease

1,900,000

Lower respiratory infections

3,100,000 0

1

2 (Millions) Annual global deaths

Infectious Disease Statistics When normal microbiota move to body sites other than their normal ones or pathogens acquire host access, infectious disease occurs. The symptoms that characterize a specific infection are often the result of microbial reproduction and their secreted metabolic by-products. Globally, one in three deaths is due to in­ fectious disease. AIDS, diarrheal diseases, and lower respiratory infections (Figure 1.7) are the top three infections worldwide, killing almost 7 million people every year. In lower-income countries, the death rate from in­ fectious disease is significantly higher than in the United States. This correlates with poor hygiene standards and a lack of routine medical care. Four in every ten deaths in developing nations is a child under age 15. More than half die of infection, with malaria, tuberculosis, AIDS, diarrheal disease, and pneumonia being most prevalent. Another poverty-associated factor contributing to high infectious disease rates in these countries is the inabil­ ity to rebuild damaged infrastructure following natural disasters or war. Contaminated water supplies due to demolished treatment facilities correlate with deadly

16  CHAPTER 1  Microbial World

3

Of the top infectious disease killers, there are vaccines available for measles, pertussis, hepatitis B, and tetanus. If everyone were vaccinated, by what percent would the annual deaths from infectious disease decrease?

cholera outbreaks. In addition, the ability to administer routine preventive medical care is lost during crisis situ­ ations. Vaccination rates drop dramatically as refugees evacuate their homes, leading to a resurgence of infec­ tious diseases that were once well controlled (see the Case Study). Additionally, new illnesses, or emerging infectious diseases (EIDs), are developing. EIDs occur for a variety of reasons: • Misuse of antibiotics encourages microbial resistance • Modern transportation increases risk of microbial transmission • Humans intrude into new habitats that harbor en­ demic pathogens • Microbes continue to evolve Notable recent EIDs include AIDS, Ebola hemorrhagic fever, MRSA infections, the novel H1N1 influenza pan­ demic of 2009, MERS (Middle East respiratory syn­ drome), and most recently an outbreak of Zika virus disease. These and many other infectious diseases will be described in Chapters 16–21.

Case Study Amy thought today’s class would be a dry lecture about a disease that had been eliminated decades ago by effective immunization programs. But now she stared in disbelief at photos taken just weeks earlier of children suffering the crippling effects of polio (Figure a). In particular, the instructor told them that Syrian children were at increased risk of polio infection.

Jose Pereira

a. A Middle Eastern girl who suffered a previous polio infection.

1. What is the key symptom of polio? After epidemiology class, Amy had some questions for Dr. Kier. “I know you’ve taught us that polio is still endemic in ­Afghanistan, Pakistan, and Nigeria, but why are Syrain children getting sick? They don’t live in the countries where the virus is still routinely found,” Amy asked. “That’s a great question, but it doesn’t have a single, simple answer,” Dr. Kier replied. “Let’s look at the transmission of the polio virus.”

Dr. Kier began, “You’re right. Modern Syrian cities provide these health benefits to their citizens, but many Syrian children are now refugees living in camps with thousands of other Syrians fleeing their war-torn country. Think about those new living conditions. Do you see why infection risk increased?” 4. Review your answer to question 2, and identify these transmission modes within the likely conditions of a refugee camp. Amy persisted, “But what about immunization to polio? Why doesn’t that protect Syrian refugee children?” “One of the many casualties of war is the maintenance of effective preventive medical programs. As a result of large groups leaving permanent residences, vaccination schedules are disrupted and many children are never immunized against polio,” he replied. “There must be something that can be done to prevent polio from spreading to other children in the refugee camp,” Amy said with clear concern. “The World Health Organization (WHO) and the United Nations Children’s Emergency Fund (UNICEF) have deployed hundreds of workers to the camps to administer polio vaccines (Figure b). Because it’s impossible to keep good medical records under these conditions, every tent is marked above the entry when all of its residents have received the vaccine. This has really improved polio immunization rates and will hopefully help prevent further outbreaks,” said Dr. Kier. b. A young refugee receiving her polio vaccine.

Khalid Mohammed/AP Images

Vaccination: A Casualty of War

✓ The Planner

Investigate: 2. How is the polio virus usually transmitted? Is it very contagious? 3. Who is at greatest risk of acquiring a polio infection? “I understand the common transmission modes, but if a Syrian child lives in an urban setting with good sanitation and access to medical care, then why is he at high risk of infection?” Amy responded.

1. How can health care providers protect themselves from pathogens when working with infected patients?

5. How is the polio vaccine administered? Identify a benefit of this method.

2. How does the normal microbiota protect the host from infection? 3. What is the leading cause of death from infectious disease? Infectious Disease  17

Microbial Ecology and Commercial Applications 1. 4

LEARNING OBJECTIVES 1. Describe three ways that the chemical reactions of microbes can positively affect environmental conditions. 2. Explain the roles of microorganisms in the generation of some industrial products and in the spoilage of other commercial goods. tudents are well aware of the connection be­ tween microbes and human health, but they are often surprised to find microbiology is also a crucial part of maintaining a healthy planet. At the global level, microorganisms participate in recycling and remediation processes neces­ sary for maintaining the environment. Microbes are also used in agriculture and in commercial food production. With modern biotechnology, microorganisms are used in the production of drugs and alternative fuels, again link­ ing them with health at both the human and global levels.

S

The Importance of Environmental Microbes Microorganisms are the basic recyclers of the planet. There are fixed amounts of mineral nutrients on our

planet for all organisms to use and reuse. Microbes ­perform chemical reactions that result in the decompo­ sition of dead organisms, releasing minerals from the remains back into the environment for reuse. Microbial degradation of wastes returns organic material to the environment through processes such as composting, landfill management, and sewage treatment. Microbial recycling operates on a large scale, involving intricate chemical interactions between the living and nonliving aspects of the environment. These processes are known as ­biogeochemical cycles and are responsible for effec­ tively changing unusable forms of carbon, sulfur, and ni­ trogen in the physical environment into chemical forms that can be used by living organisms. When these cycles are in balance, the environment contains sufficient nutri­ ents to support complex communities. Agricultural communities are a special focus of en­ vironmental microbiology. The unique relationship be­ tween the bacterium Rhizobium and leguminous plants, such as soybeans and peanuts, is the basis of crop rotation. When this soil microbe infects legume roots, a symbiotic relationship is established that is mutually beneficial (Figure 1.8a). Rhizobium receives nourishment from the carbohydrates stored in the roots, and it converts at­ + mospheric N2 into NO− 3 or NH 4. These nitrogenous forms

Symbiotic relationships between microbes and plants • Figure 1.8 Mutually beneficial relationships between microbes and plants can enhance host acquisition of key nutrients, significantly promoting growth.

a. The Rhizobium-legume relationship Legume root nodules are packed with Rhizobium that convert unusable N2 gas into usable nitrogenous compounds that are incorporated into plant molecules for augmented growth.

Root nodule Rhizobium infected cells

18  CHAPTER 1  Microbial World

Rhizobium

are transported throughout the plant to be incorporated into essential molecules. Because they are ­generated in abundance, the excess nitrogenous compounds are released into the soil, enriching it to support a different crop the next year without the addition of fertilizer. Many plants benefit from a symbiotic relationship with fungi associated with their roots. A hypha (plural hyphae) is one of the long, fine filaments that compose the basic fungal body and has a tremendous surface area in contact with the soil and tips directly entering root cells (Figure 1.8b). The result is an enhanced ability of the plant to acquire water and nutrients from the soil because both roots and hyphae are participating in uptake. In addition, hyphae routinely secrete acids into the soil that increase the solubility of soil phosphorous. Improved plant absorption of this hardto-acquire nutrient has a positive influence on flowering. Many environmental microorganisms are involved in habitat remediation. The tremendous diversity of chemical reactions that microorganisms can perform allows some species to use unusual chemical compounds, even ones considered pollutants. An example of microbial bioremediation was the activity of oil-eating bacteria in the Gulf of Mexico. When crude oil spewed from the damaged Deepwater Horizon rig for 87 days in 2010, these prokaryotes helped reduce the amount of oil in the water and return the habitat to health. Other microbe-environment interactions will be described in detail in Chapter 22.

The Industrial Use of Microorganisms Commercial applications of microbial activity can also facilitate the health of humans and habitats. b. The mycorrhizae-root relationship The fungal mycorrhizae have an enormous surface area, and they acquire large quantities of water and nutrients, especially phosphorous, from the soil.

To maintain a healthy environment by minimizing the environmental impact of burning fossil fuels, intensive research into alternative fuel types is under way. Among the promising options for future fuels are bacterial conversion of grains to ethanol for gasoline supplementation or microbial generation of clean-burning gases such as hydrogen and methane. More environmentally friendly commercial applications of microbial activity will be discussed in Chapter 22. Bioreactors, devices to encourage the rapid proliferation of specific microbial species, are used to grow large amounts of ­bacteria with special properties, such as the ability to generate a valuable metabolic by-product. Examples of such by-products include vitamins, alcohol, and citric acid used as a food preservative. Genetically modified microorganisms are routinely used for the production of pharmaceutical products, including antibiotics, insulin, and other synthetic hormones. Human health is promoted by the mass production of safe foods, many of which involve microbial activity. The use of yeast for the production of bread, beer, and wine is the earliest form of biotechnology. Fermented beverages prepared by early humans contained sufficient alcohol to kill many of the potential pathogens contaminating the water supplies and represented a safer alternative for consumption. Other commonly prepared foods and beverages requiring microbial activity include: yogurt, cheese, kefir, sauerkraut, buttermilk, and pickles. Microbial secretions give these foods their characteristic flavors and textures. Finally, sometimes commercial food preparation practices focus on eliminating microorganisms because their presence can lead to spoilage or illness. This is Hypha

Arbuscule

Mycorrhizal root

Vesicle Hyphae

A sk Yo u rs e l f The long, thin filaments found extending from mycorrhizal roots are _____.

Microbial Ecology and Commercial Applications   19

Clinical Application a.

Diseases caused by bacterial contamination of unpasteurized milk

Review Figure 1.7, and answer this question. Which of the microbes listed in Figure a could contribute to the statistics shown in the graph in Figure 1.7?

Bacterial pathogen

Related illness

Brucella abortus

Brucellosis

Campylobacter jejuni

Gastroenteritis

Corynebacterium diphtheriae

Diphtheria

Coxiella burnetii

Q fever

Escherichia coli

Gastroenteritis

Listeria monocytogenes

Listeriosis

Mycobacterium bovis

Gastroenteritis; tuberculosislike illness

Salmonella typhimurium

Gastroenteritis

Shigella spp.

Gastroenteritis with bloody diarrhea

Staphylococcus aureus

Gastroenteritis

Streptococcus pyogenes

Scarlet fever

Yersinia enterocolitica

Gastroenteritis; mimics appendicitis

Documented outbreaks associated with unpasteurized milk, U.S. (1993–2006) 16 14 12

350 300

10

250

8

200

6

150

4

100

2

50

0

usually accomplished by applying high pressure, heat (see the Clinical Application), chemical preservatives, or ionizing radiation. Coupled with aseptic packaging, large quantities of food can be safely prepared and distributed. Microbiology investigates the most abundant and di­ verse creatures on our planet. Their coevolution with hu­ mans results in complex physiological interactions. It also results in conflicts when hosts defend themselves against pathogen invasion. Special public health practices and epidemiological surveillance serve to protect us against microbial infection, but sometimes pathogens success­ fully cause disease. Medical personnel strive to quickly identify the culprit so effective treatment can be initiated and health restored. The link between microbiology and

20  CHAPTER 1  Microbial World

400

KEY Outbreaks Illnesses

1993 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006

Individuals affected

Pu t It To g e th e r

Number of outbreaks

In the 19th century, Louis Pasteur devised a method of heat-treating foods to kill microorganisms responsible for spoilage. His process was originally developed to destroy mold that contaminated grapes destined for wine production. Today pasteurization is used on dairy products, among other things. Short-time, high-temperature heat treatment kills harmful microbes in raw milk (Figure a) without affecting nutrition or taste. Approximately 20% of all food-borne infections in the United States involve consumption of unpasteurized dairy products, often causing gastroenteritis with resulting diarrheal disease. These 9.5 million unnecessary illnesses lead to 600 deaths annually. Many people mistakenly believe raw milk is a healthier, more natural option than pasteurized milk. This leads to more than 5 related outbreaks annually, or higher than expected occurrences of an illness (Figure b). Consequently, pasteurization is clinically significant because it dramatically reduces food-borne illnesses, b. especially in children and immune-compromised patients.

0

Year

Frederick J. Angulo, Jeffrey T. LeJeune, Päivi J. Rajala-Schultz. Unpasteurized Milk: A Continued Public Health Threat. Clinical Infectious Diseases. Copyright © 2009, Oxford University Press.

Pasteurization

✓ The Planner

health extends to the study of the activities of microor­ ganisms in the environment and commercial microbial applications.

1. How are microorganisms involved in enriching the nitrogen content of soil for improved agricultural production? 2. What practices are routinely used to reduce spoilage of commercially produced food products and to prevent disease transmission?

The Planner

✓

Summary

1.1

 The Microbes  4

• Microbiology is the study of microbes, including noncellular infectious agents, such as nonliving viruses and living, cellular microorganisms, such as bacteria. • The two basic types of cells are prokaryotic cells, which do not contain a nucleus, and eukaryotic cells, which contain a membrane-bound nucleus. The Archaea are prokaryotic microbes that live in diverse habitats, including many extreme environments. They were the first living things. The Bacteria are prokaryotic microbes that include bacteria (see the diagram). Bacteria are the most abundant and diverse group of organisms in the biosphere. All organisms other than the Archaea and Bacteria are made up of eukaryotic cells. Eukaryotic microbes include molds and yeasts, which are fungi; protozoans, which are unicellular, usually motile organisms; and photosynthetic algae. Helminths, or worms, are also eukaryotic pathogens, but usually only the egg stage is microscopic.

The principal categories of microbes: Prokaryotic microbes  •  Figure 1.2

• The immune system fights infections. Innate immune responses involve leukocytes, which engulf and destroy pathogens, and processes such as inflammation. Immunity is host resistance to a previously encountered pathogen due to adaptive immune responses that rapidly destroy the invader. These responses are performed by different groups of lymphocytes and include the secretion of antibodies as well as direct lymphocyte binding to infected host cells. Vaccination prepares the immune system to attack a specific pathogen, producing immunity without causing the disease. Pathogenesis, the development of an infectious disease, involves the following five steps: pathogen entry into the host, pathogen attachment, thwarting host immune defenses, host damage, and pathogen exit from the host. • The first antibiotic, penicillin, was discovered accidentally when it was noted that there was a zone of inhibition between bacteria and a mold colony growing on the same agar plate (see the photo). The inhibition of bacterial growth by a substance secreted by the mold is an example of antibiosis.

Antibiosis  •  Figure 1.6 Staphylococcus aureus

1.2

 The Conflicts  8 Penicillium notatum

Christine L. Case

Zone of growth inhibition

• In clinical microbiology labs, specimens from patients are cultured, or grown in artificial media. Cultures are useful for identification of the microbes and diagnosis of infections. Control of microbial growth is accomplished by regulating temperature, oxygen and carbon dioxide levels, and pH. Microbial growth is also limited by selective toxicity, exposure to chemicals that poison the pathogen but not the host, and by the use of antiseptics and disinfectants.

Summary  21

1.3

1.4

• Epidemiology includes the study of the geographic distribution of a disease, morbidity rate and mortality rate, as well as other data. Infectious diseases acquired in hospitals are called health care-associated infections (HAIs). Practices used to minimize infection rates in health care settings include screening for antibiotic-resistant bacteria; using personal protective equipment (PPE); and following universal precautions, including frequent, correct hand washing to avoid contamination with pathogens.

• In the environment, microbes are involved in the biogeochemical cycles that change unusable forms of carbon, sulfur, and nitrogen into chemical forms that can be used by living organisms. Some microbes also have beneficial relationships with plants, supplying them with nutrients and water. When certain bacterial species live inside root nodules (see the diagram), their conversion of nitrogen gas into usable nitrates acts to fertilize the plant.

 Microbial Ecology and Commercial Applications 18

 Infectious Disease 13

• Host physical defenses against infection include: the skin and mucous membranes, the washing actions of tearing, sweating, and urination; fever; acidic and salty secretions; and pathogen-degrading enzymes. The normal microbiota make it difficult for pathogens to become established on the body.

Symbiotic relationships between microbes and plants   •  Figure 1.8

• Infectious disease is responsible for one-third of all deaths globally and the top three deadly infections are: lower respiratory tract infections, diarrheal diseases, and HIV/AIDS. In developing countries, malaria and tuberculosis also cause many deaths, especially in children. In addition to the long-known infectious diseases, there are emerging infectious diseases (EIDs), which are occurring for a variety of reasons. These diseases include Ebola, MRSA, novel H1N1 influenza, MERS, and Zika virus disease. Protection against some infectious diseases, such as polio, is provided by vaccination (shown in the photo).

Khalid Mohammed/AP Images

Case Study: Vaccination: A Casualty of War

• Special microbes are used commercially for the synthesis of vitamins, alcohol, and citric acid, and the production of pharmaceuticals, including antibiotics, insulin, and other hormones.

Key Terms • adaptive immune response  10 • algae 6 • antibiosis 12 • antiseptic 8 • Archaea 5 • Bacteria 6 • binary fission  5 • biogeochemical cycle  18 • bioreactor 19 • biosphere 6 • cell 4 • culture 8 • disinfectant 10 22  CHAPTER 1  Microbial World

• endospore 14 • eukaryotic cell  6 • Fungi 6 • helminth 6 • hypha 19 • immunity 10 • innate immune response  10 • leukocyte 10 • lymphocyte 10 • microbe 4 • microbiology 4 • normal microbiota  14 • nucleoid 5

• nucleus 6 • organelle 6 • pathogen 6 • pathogenesis 11 • penicillin 12 • plasma membrane  5 • plasmid 5 • prion 4 • prokaryotic cell  5 • protozoan 6 • viroid 4 • virus 4

Medical Terms • emerging infectious disease (EID)  16 • epidemiology 13 • health care-associated infection (HAI) 13

• morbidity rate  13 • mortality rate  13 • personal protective equipment

• universal precautions  14 • vaccination 11

(PPE) 14

Critical and Creative Thinking Questions 1. Describe practices you routinely perform to stop or control the growth of microbes.

4. Describe measures used by health care providers to avoid exposure to infectious diseases. 5. Examine the graph and explain why the number of outbreaks of raw milk infection does not directly correlate with the number of individuals affected.

14 12

400

KEY Outbreaks Illnesses

350 300

10

250

8

200

6

150

4

100

2

50

0

1993 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 Year

Individuals affected

3. Explain the relationship between antibiosis and antibiotics.

16 Number of outbreaks

2. Explain how the immune system fights microbes and prevents infectious diseases.

Documented outbreaks associated with unpasteurized milk, U.S. (1993–2006)

0

What is happening in this picture?

emin kuliyev/Shutterstock

This clinical microbiologist is inoculating patient specimens onto different types of liquid and solid growth media to encourage their rapid growth.

T h i n k C ri ti c al l y 1. Why is this step essential in curing a patient’s infection? 2. Why is the microbiologist handling the patient specimens in the hood?

What is happening in this picture?  23

Self-Test (Check your answers in Appendix A.)

1.  Prokaryotic and eukaryotic cells all have _____. a. a nucleus

6.  What bacterial features are being used to facilitate specimen identification in this micrograph?



b. prions



a. the color of the Gram stain



c. a cell wall



b. the shape of the bacterial cells



d. infectious particles



c. the arrangement of the bacterial cells



e. a plasma membrane



d. the number of bacterial cells



e. Answers a, b, and c are correct.

2.  What can you say about the microorganism in the drawing?

a. It is prokaryotic.



b. It is eukaryotic.



c. It is noncellular.



d. It is a bacterium.



e. It is an alga. © Martin Rotker/Phototake



Nucleus

3.  Review the Microbiology InSight, Figure 1.3, and answer this question. Why is the ozone layer so important to terrestrial life forms?

a. It absorbs excess oxygen.



b. It absorbs carbon dioxide.



c. It protects them from harmful UV radiation.



d. It holds water vapor.



e. It reacts with carbon dioxide to release oxygen.

4.  Review What a Microbiologist Sees, and answer this question. Which of the following are NOT recommended for preventing infections during wrestling matches?

a. Wrestlers should shower with antiseptics containing chlorhexidine gluconate.



b. Wrestling mats should be disinfected with chlorhexidine gluconate.



c. Wrestling mats should be disinfected with bleach.



d. Wrestling mats should be disinfected every couple of hours during a tournament.



e. Shoes should not be worn on wrestling mats.

5.  The instrument that can determine the number of bacteria in a sample by measuring the cloudiness of the liquid is a _____.

a. cell sorter



b. spectrophotometer



c. cell counter



d. chromatograph



e. microscope

24  CHAPTER 1  Microbial World

7.  Which of the following is NOT a natural immune system mechanism for fighting pathogens?

a. engulfing pathogens



b. inflammation



c. lysing infected host cells



d. vaccination



e. production of antibodies

8.  The development of an infectious disease is called _____.

a. inflammation



b. an adaptive immune response



c. pathogenesis



d. an innate response



e. an immune response

9.  Selective toxicity refers to the use of drugs that _____.

a. kill pathogens but not host cells



b. kill both pathogens and host cells



c. damage pathogens but do not kill them



d. damage host cells but do not kill them



e. damage both pathogens and host cells but do not kill them



a. are intracellular pathogens



b. do not have a plasma membrane



c. are not found in host cells



d. are found in all the cells of the body



e. are extracellular pathogens

11.  Fungal infections are more difficult to treat than bacterial infections because _____.

a. fungal cells secrete antibiotics



b. fungal cells have plasma membranes



c. fungi are resistant to antibiotics



d. fungal cells, like human cells, are eukaryotic



e. fungal cells, like human cells, are prokaryotic

17.  According to the graph, what percentage of annual global deaths from infectious disease is caused by diarrheal diseases and lower respiratory tract infections?

a. about 55%



b. about 75%



c. about 35%



d. about 25%



Infections responsible for greatest global mortality Dengue fever 22,000 e. about 85% Measles 145,700 Pertussis 195,000 Malaria 627,000 Hepatitis B 780,000 Tetanus 800,000 HIV 1,500,000 Diarrheal disease 1,900,000 Lower respiratory infections 3,100,000 3 0 1 2 (Millions) Annual global deaths Infections

10.  Viruses are difficult to eliminate from the body because they _____.

12.  Which of the following would be part of an epidemiological study?

a. determining the number of people who are sick with a given disease in a population



b. determining the average age of the sick people in a population

18.  What is the major advantage for the plant in the symbiotic relationship in the diagram?



c. determining whether the disease was more prevalent in one sex rather than being about evenly divided between the two



a. It protects the roots from rocks in the soil.



b. It keeps the roots from freezing in the winter.



d. determining how the disease was spread





e. All of these might be part of a study.

c. It greatly increases the surface area for the absorption of water and nutrients.



d. It provides more surface area for photosynthesis.



e. It enables the plant to get rid of excess oxygen.

13.  Health care-associated infections are acquired _____.

a. in hospitals



b. at home



c. in forests



d. around lakes and streams



e. in schools

Mycorrhizal root

14.  The most common health care-associated infections are _____.

a. blood infections



b. respiratory infections



c. urinary tract infections



d. surgical site infections



e. eye infections

15.  Personal protective equipment (PPE) protects _____.

a. patients from health care-associated infections



b. patients from biohazards



c. health care providers from patient pathogens



d. clinical microbiologists from pathogens in patient specimens



e. All of these are correct.

16.  Review The Microbiologist’s Toolbox, and answer this question. The spectra shown are like fingerprints for the bacteria because they depend on the _____.

Hyphae

19.  Review the Clinical Application, and answer this question. In the outbreaks illustrated, the greatest number of people was sickened by ingestion of unpasteurized milk in _____.

a. 1997



b. 2000



c. 2001



d. 2005



e. 2006

20.  Review What is happening in this picture? and answer this question. Identify the PPE worn by this microbiologist.



a. size and charge of the bacterial proteins



a. lab coat



b. structure of bacterial carbohydrates



b. gloves



c. charge on bacterial lipids



c. mask



d. structure of bacterial lipids



d. safety glasses



e. size of bacterial carbohydrates



e. Answers a, b, and c are correct.

Self-Test  25

2

The Biochemistry of Macromolecules CONFIRMING GENE PRESENCE WITH GLOW-IN-THE-DARK PROTEINS

I

nvestigators have created transgenic felines to advance the understanding of HIV infection in humans by studying cats afflicted with feline immunodeficiency virus (FIV), an HIV equivalent.

Rendering of a green fluorescent protein (GFP) molecule showing the location of the fluorophore and its encapsulating barrel structure. GFP’s structure and internal components are responsible for its fluorescence.

When inserted into the fertilized eggs of cats, the TRIMCyp gene from rhesus monkeys blocks FIV action, preventing infection. To ensure that the genetic transfer worked and that it was safe to expose an experimental cat to FIV, the investigators attached the gene for green fluorescent protein (GFP) extracted

Rendered by Robert Campbell in the laboratory of Roger Tsien, University of California, San Diego.

from jellyfish to the rhesus monkey gene for disease resistance. GFP structure resembles a short tube or β-barrel (see the photo) as the linear protein chain folds back and forth. Within the barrel is a short portion of the chain that absorbs blue and UV light and fluoresces green. Because genes for GFP and FIV resistance were inserted together, the presence of the protein coded by one indirectly confirmed the presence of the protein coded by the other. In this way, GFP acted as a reporter or visible sign that the resistance factor proteins were being produced (see the photo). Biochemistry studies the interactions of macromolecules in living systems, such as the proteins and genetic material just discussed. Throughout this chapter, you will learn more about basic biochemistry and how it influences the survival of microorganisms as well as the health of humans and our environment.

CHAPTER OUTLINE 2.1 Proteins 28 • The Four Levels of Protein Structure • Protein Diversity and Function ■ What a Microbiologist Sees: The Effect of Modified Tertiary Binding on Protein Structure 2.2 Enzymes 35 • Enzyme Action • Factors Influencing the Rate of Enzyme Activity 2.3 Carbohydrates 40 • Simple and Complex Carbohydrates • The Functional Diversity of Carbohydrates ■ Clinical Application: Rapid Glycogen Breakdown in a Diabetic Patient in Shock 2.4 Lipids 43 • The Structural Classes of Lipids ■ Case Study: Acne—A Bacterial Interaction with Skin Oils • Lipid Functions ■ The Microbiologist’s Toolbox: Ziehl-Neelsen Acid-Fast Staining of Mycolic Acid Cell Walls 2.5 Nucleic Acids  49 • The Structures of DNA and RNA • Nucleic Acid Functions

Courtesy of Roger Y. Tsien, Department of Pharmacology, Department of Chemistry & Biochemistry, University of California, San Diego

Chapter Planner

This transgenic kitten sports green fluorescent fur and claws when exposed to blue light, indicating the successful insertion of the jellyfish GFP and monkey genes into the cat genetic material.

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 28 ❑ p. 35 ❑ p. 40 ❑ p. 43 ❑ p. 49 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

Analyze key features

❑ What a Microbiologist Sees, p. 34 ❑ Process Diagram, p. 36 ❑ p. 38 ❑ ❑ Clinical Application, p. 42 ❑ Case Study, p. 44 ❑ The Microbiologist’s Toolbox, p. 48 ❑ Microbiology InSight, p. 52 ❑ Stop: Answer the Concept Checks before you go on. p. 35 ❑ p. 39 ❑ p. 42 ❑ p. 49 ❑ p. 53 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What’s happening in this picture? ❑ Complete the Self-Test and check your answers.

 

27

2. 1

Proteins

LEARNING OBJECTIVES Interactions between the resulting macromolecules are the basis of life.

1. Describe the four levels of protein structure, indicating how each influences the overall configuration of the macromolecule. 2. Discuss protein diversity, relating maintenance of structure to general protein function.

The Four Levels of Protein Structure

The term protein is derived from a Greek word meaning “first place,” which hints at the importance of this polymer class. Proteins are abundant biological macroroteins, carbohydrates, lipids, and nucleic molecules, making up at least 50% of the dry acids are the four classes of macpolymer A large weight of a cell, and their tremendous strucromolecules that compose all ormolecule produced tural diversity translates into a wide range of ganisms (Figure 2.1). Each class by the joining of functions (Figure 2.2). The structural diveris characterized by specific many similar or sity of proteins accounts for their ability to monomers, or building blocks, that are joined identical monomers. perform so many different functions. together by polymer-specific covalent bonds.

P

The principle macromolecule classes • Figure 2.1 The complex, varied structures of the macromolecules composing all organisms are built by joining together smaller chemical building blocks, or monomers.

a. Proteins Proteins are composed of amino acid monomers that may form helices that pack together, creating diverse globular structures responsible for many cellular functions.

aa aa aa

aa

b. Carbohydrates H Simple sugars, or monosaccharides, such as the glucose units shown here, are the monomers used to build carbohydrates.

aa aa aa

aa

aa aa

Monomer

CH2OH O H OH H H

H

H O

OH

CH2OH O H OH H H

H

OH

Monomer

Monomer

c. Lipids

H

This fat is made by attaching three large fatty acid monomers to a three-carbon alcohol, glycerol.

O

H

C

O

H

C

O

H

C

O

C

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH

CH2

CH

CH2

CH2

CH2

O C

CH2

CH2

CH2

CH2

CH2

CH2

CH2

O C

CH2

CH2

CH2

CH2

CH CH

CH2

CH

2

H

CH

2

CH

2

O–

2

—

d. Nucleic acids

N N

H

H

1´

—

H

HN

2´

—

O 1´

4´

O

H2N

H

5´

CH2

3´

CH2

3´

2´

O

4´

3´

2´

H

H

CH2

3´

1´

O HN N

N

CH3

O N

28  CHAPTER 2  The Biochemistry of Macromolecules

NH2

2´

1´

H

N

2

CH

2

NH2

N N

CH

N

Deoxyribose sugar O

O N

CH2 O

—

—

5´

4´

H

O

5´

O

—

—

H

—

P O

H

O

O

— O

P

P

4´

CH

2

5´ end

5´

H

O

— O

3´ end

H

O

O–

O–

OH

—

Monomer

CH

2

O

O

O– —

The nucleotides used to construct nucleic acids are complex, three-part monomers.

P

O

Phosphate group

CH

A sk Yo u r se lf Carbohydrates are polymers composed of repeating _____ monomers. a. amino acid  b. monosaccharide  c. fatty acid  d. nucleotide

The diversity of protein function • Figure 2.2 The overwhelming structural diversity of proteins accounts for their ability to perform so many different essential functions. Protein function

Example

Enzymes—speed up biochemical reactions

β-galactosidase speeds the digestion of milk sugar, or lactose.

Product

Substrate

Enzyme Defense—protect host from infection using antibodies

Antibodies produced by the immune system bind pathogens, initiating their destruction.

Hormones—control physiological processes

Insulin facilitates cellular uptake of glucose for use as fuel and maintains a consistent blood glucose level.

Receptors—receive and respond to molecular signals

Extracellular molecules binding to G-protein-linked receptors act as messages, with the receptor relaying the signal inside the cell.

Antigen binding sites

G-protein receptor Signal Chemical message

Ovalbumin is the protein found in the clear liquid of eggs, which is used as stored food for the developing chick if the egg is fertilized.

Structural support—provide supportive building material

Collagen provides support to the skin; wrinkles appear due to collagen weakening with age.

Transport—deliver substances throughout organism

Hemoglobin is the protein in red blood cells responsible for transporting oxygen throughout the body.

Contraction—permit movement

Myosin is a contractile protein whose sliding action in muscle cells is responsible for muscle contraction.

Genetic regulation—modulate gene expression

CREB is a DNA-binding protein used to turn on or off genes.

A sk Yo u rs e l f Which proteins are involved in host protection against pathogens? a. insulin  b. antibodies  c. actin  d. hemoglobin

Wessner, Dave. Microbiology, 1e, figure 11.7b, page 334. © 2013. Wiley

Storage—maintain host nutrient supply

RNA polymerase DNA Activator protein Transcription

composition, that distinguishes one amino acid from another. Amino acids are grouped according to whether their R group is acidic, basic, nonpolar, or uncharged polar (Figure 2.3b). R groups may be a single atom, such as a hydrogen, or consist of chains or ring structures.

The monomers that make up proteins are nitrogencontaining compounds called amino acids. The 20 different types of amino acids all contain an amino group (NH2) and an acid, or carboxyl group (COOH) (Figure 2.3a). It is the R group, or side chain of variable chemical

Amino acids • Figure 2.3 Amino acids differ from one another in the makeup of their R groups.

a. General structure All amino acids consist of a hydrogen atom, an amino group, a carboxyl group, and an R group. H H 2N

O

C

C OH

R

Amino group

Carboxyl group

Variable side chain

b. The building blocks of proteins Amino acids are categorized according to whether their R group is acidic, basic, nonpolar, or uncharged polar. Amino acids are designated using either a three-letter or single-letter abbreviation. Acidic side chains Acidic H side chains O H2N H C C O H2N CH C C OH 2 OH CH C 2 O O− C O O− Aspartic acid Asp/Dacid Aspartic Asp/D Basic side chains Basic side H chains O H2N H C C O H2N CH C C OH 2 OH CH CH22 CH CH2

H2N H2N

H H C

O C O C C OH CH 2 OH CH CH2 2

CH C 2 O O− C − Glutamic O Oacid Glu/E Glutamic acid Glu/E

H

H2N H2N

2

CH NH2 NH C +H N NH2− 2 C +H N NH2− 2 Arginine Arg/R Arginine Arg/R

30  CHAPTER 2  The Biochemistry of Macromolecules

O H C C O C C OH CH 2 OH CH CH22 CH CH2 2

CH CH22 CH NH2+

H

O H C C O C C OH CH 2 OH CH C 2 HN CH C HN CH HC NH+

H2N H2N

HC

NH+

3

NH3+ Lysine Lys/K Lysine Lys/K

Histidine His/H Histidine His/H

To build any polymer, a reaction called dehydration synthesis must occur between adjacent monomers. With

help from an enzyme, a molecule of water is extracted from neighboring functional groups and a covalent bond forms between them. If this process occurs repeatedly, a

polymer is produced. Conversely, polymers are degraded into individual monomers through hydrolysis, or the breaking of a covalent bond by the addition of a water molecule. Amino acids are joined when dehydration synthesis occurs between the carboxyl group of one amino

b. The building blocks of proteins (continued ) Nonpolar side chains H H2N

C

C

H

O OH

H H2N

H2N

C

C

O

CH3 Isoleucine Ile/I

HN

C

C

CH2 CH2 CH2

OH

H H2N

O OH

H H2N

C

C

CH2

C

C

O

OH CH CH3 CH3

Alanine Ala /A

OH CH CH3 CH2

H

C

CH3

Glycine Gly/G H

C

O

H H2N

C

C

CH2

Valine Val/V

Leucine Leu/L H

O

H2N

OH

C

C

CH2 SH

S CH3 Methionine Met/M

Cysteine Cys/C

H2N

C

C

CH2

O OH

H H2N

C

C

CH2

OH

CH CH3 CH3

CH2

H

O

O OH

O OH

Uncharged polar side chains H H2N

N Proline Pro/P

Phenylalanine Phe/F

H Tryptophan Try/W

C

C

CH2 O

C

O OH

NH2

Asparagine Asn/N

H H2N

C

C

CH2

O OH

H H2N

C

C

CH2

CH2

OH

C O NH2 Glutamine Gln/Q

Serine Ser/S

O OH

Uncharged polar side chains H H2N

C

C

CH2 O

C

O OH

NH2

Asparagine Asn/N

H H2N

H2N

C

C

C

CH2

OH

H H2N

C

C

CH2

CH2

OH

C O NH2 Glutamine Gln/Q

Serine Ser/S

H

A sk Yo u rs e lOf

C

O

H H2N

C

C

O OH

H H2N

C

C

CH OH

O OH

H H2N

C

C

O OH

CH3

Threonine Thr/ T

OH Tyrosine Tyr/ Y

O

What two functional groups characterize ALL amino acids? OH OH CH and carboxyl groups  b. amino and aldehyde groups a. amino OH CH3 c. carboxyl and methyl groups  d. carboxyl and amide groups

Threonine Thr/ T

OH Tyrosine Tyr/ Y

Proteins  31

Dehydration synthesis and hydrolysis • Figure 2.4 Dehydration synthesis is used to build polymers, whereas hydrolysis digests them.

a. Dehydration synthesis Dehydration synthesis removes a molecule of water between two reactants, in this case, amino acids, joining them together to initiate polymer production. Peptide bond H H2N

C

C

H Glycine H H2N

C

C

H

H

O

H2N

OH

C

C

CH2 OH Serine H

OH O 2

H2N

OH

C

C

CH2

H2O

O OH

H

O

H

H

H2N C

C

N

C

H

O OH

C

O

OH CH2 Peptide OHbond

H

O

HDipeptide H

H2N C

C

N

C

C

CH2

H

O OH

OH OH H O H H H H Glycine Serine H Dipeptide O O O The addition of water to this dipeptide cleaves the peptide bond, digesting the molecule H O 2 H2N C C H2N C C N C C N C C into amino acids, its monomeric units. OH OH OH H CH2 H CH2 H

b. Hydrolysis

H OH 2O Dipeptide H O H H H2N C H

C

N

C

C

CH2

O OH

OH Dipeptide

Glycine H H2N

C

C

H

O

H

OH

H

Glycine

OH Serine H N

C

C

CH2

O OH

OH Serine

T h in k Cri ti c a l l y

If dehydration synthesis occurred at the carboxyl terminus of a protein at the same rate that hydrolysis occurred at its amino terminus, what would happen to the number of amino acids composing the polypeptide?

acid and the amino group of an adjacent one. An H atom is removed from one reactant and an OH from the other forming H2O (Figure 2.4a). A bond called a peptide bond forms between the carbon and the nitrogen, yielding a dipeptide. As this process continues, the growing chain of amino acids, called a polypeptide, has an amino terminus and a carboxyl terminus. This macromolecule can be digested when hydrolysis breaks peptide bonds, releasing the amino acids (Figure 2.4b). Protein structure is complex and is characterized by specific features at four different levels: 1. The sequence of amino acids is the primary structure of a protein (Figure 2.5a). 2. The secondary structure involves the formation of intramolecular hydrogen bonds between amino and carboxyl groups of the peptide backbone. This, in turn, initiates folding into either an α-helix or a β-sheet (Figure 2.5b). 3. As part of the tertiary structure, bonds between R groups fold the polypeptide chain into a stable,

32  CHAPTER 2  The Biochemistry of Macromolecules

three-dimensional conformation (Figure 2.5c). The different bond types involved in folding include electrostatic attractions (ionic bonds and hydrogen bonds) between acidic, basic, and polar R groups, as well as covalent bonds resulting from the interaction of sulfhydryl groups to produce disulfide bridges. Nonpolar R groups are hydrophobic, or unable to interact with water molecules. These amino acids fold to the interior of the protein, where they participate in hydrophobic interactions and water is excluded. 4. The quaternary structure of a protein involves two or more polypeptides that are joined together with non­ covalent bonds and that function as a unit (Figure 2.5d). The polypeptides may be identical or different, generating immense structural and functional diversity. Each subsequent level above the primary level ultimately depends on the initial amino acid sequence. For this reason, it is possible to enter the amino acid sequence of a newly discovered protein into a database to determine its most likely three-dimensional conformation.

The four levels of protein structure • Figure 2.5 The three-dimensional conformation of a functional protein results from a series of complex molecular interactions. Peptide backbone Amino H2N terminus

Gly

b. The secondary structure The secondary structure of a protein is either an α-helix or a β-sheet.

Tyr

H

O

H

H

O

H

H

O

H

H

O

H

H

O

H

H

O

H

H

C

C

N

C

C

N

C

C

N

C

C

N

C

C

N

C

C

N

C

R

R

R

Val

Glu Leu Phe

R R Amino acid sequence

Cys

His

Ser

Ile

Asn Met

α-helix R H

H

C

O

N O

C O

R C

CO

H

C

N

H

C

C N CH R R

O

O

R C

C

C N

H

N

H

H

C

C

H

C RO

H

N

O C CH

H

R N C

H

N

C

R

Ball-and-stick model C

C

C N

N

C C

C N C

Cys Phe...

C

C

C

C

N C

N C

O

7.0 Å

Hydrogen bonds

Ball-and-stick model

C

N

N

C

C C N

C

C

N C

Lys

O CCN R C

H

H

H

Gln

H

N

C

C

H

Ala

β-sheet H

N R

Thr

Carboxyl terminus

OH

R

R

Ile

O

C

C

N C

N

C

N

R

R

R

C

C

C

C

N

C

N

C

N

C

N

R C C

C

N

C

C

C

C

R

R

R

R

N

Peptide backbone

Peptide backbone

Ribbon model Forms transmembrane regions of proteins such as transporters and receptors.

Ribbon model Forms rigid structural components of protein cores.

c. The tertiary structure

Karp, Gerald. Cell and Molecular Biology: Concepts and Experiments, 7th Edition, figures 2.30 b, c and 2.31 b, c, page 56. Wiley

a. The primary structure The primary structure of a protein is determined by the amino acid sequence.

d. The quaternary structure The quaternary structure of a protein involves the joining of two or more polypeptides.

The tertiary structure of a protein is a result of bonds between R groups that fold the polypeptide chain into a stable, three-dimensional conformation. ***Hydrogen bond

O H O H N C OH O C C C C N N H C C O CH2 H O C H O H R H2C CH2 C – O O O H N C C N N C + O H NH3 CH2 C C O H S O C H H H H CH2 H H H CH2 C CH2 N R C H O S H C C N C C N C H C S N H N CH2 H O CH2 O HO C CH O C 2 C CH2 CH2 CH2 O C N R C H CH2 O O + N CH2 H NH H C 3 N H N – CH C CH R H O H 2 C O C C H C H CH3 CH3 H C CH C O O O N H C C C O H CH3 CH3 CH3 N H C H N H C R C O C O H H C H C N H CH2 N H N C O CH2 H O C C O C H H N H C C O CH3 O H C – C N C C O CH O O R H3C C N C H H 3 C CH2 N C N O R O O R C N O R CH2 H C H C C N C C N C H H CH2 H H H H H CH R

*Disulfide bond

****Hydrophobic interactions

H C

O

H

H

H

Homodimer – The enzyme superoxide dismutase is composed of two identical polypeptides joined together, one rotated 180°.

α-subunits

H

+

NH3

A sk Yo u rs e l f ____________ is the first level of protein structure that demonstrates three-dimensional structure.

β-subunits Heterotetramer – Hemoglobin is composed of four polypeptide chains; two identical α-subunits and two identical β-subunits.

Black, Jacquelyn G. and Laura J. Microbiology: Principles and Explorations, 9th Edition; figure 2.19a, page 43. © 2015. Wiley

**Ionic bond

Protein Diversity and Function The amount of structural diversity in proteins is astounding. No one knows the precise number of different types of proteins, but a simple mathematical equation can accurately reflect the possibilities. Any one of 20 amino acids can potentially occupy any position within a protein. If the total number of amino acids in the primary structure is known, the number of possible proteins that

could be formed can be calculated using the expression 20n, where n represents the number of amino acids in the polypeptide. For example, for a protein of 300 amino acids, then 20300, or 10390, different structures could be generated. For a protein to function normally, the intra- and intermolecular bonds must remain intact (see What a Microbiologist Sees). Changes in environmental conditions

What a Microbiologist Sees ✓

The Planner

The Effect of Modified Tertiary Binding on Protein Structure

Keratin polypeptide strands

S

b.

1. Numerous ous disulfide disu bridges provide stable tertiary structure to keratin.

T h in k Cri ti c a l l y

t ra

in

a.

Curler

2. The shape of the protein is physically distorted by wrapping around a curler.

What would happen if a hairdresser forgot to apply the agent that broke the disulfide bridges?

salon. A strong chemical able to break disulfide bridges is applied to the hair, which is then wrapped around curlers to achieve the desired shape. Next the hair is treated with an agent that allows the disulfide bridges to re-form (Figure b). A similar procedure can be performed to straighten curly hair.

Curtis E. Young, Ph.D

The many differences in human hair are obvious to all and are genetically determined, but a microbiologist looking at this photo of two young friends (Figure a) sees the underlying reason for the contrast. Human hair is composed of the protein α-keratin. The secondary structure of this protein is an α-helix and, because this polypeptide consists of approximately 14% cysteine residues, the tertiary structure includes numerous stabilizing disulfide bridges. Two α-keratin strands twist together in a left-handed direction to form the coiled coil characteristic of this protein’s quaternary structure. Continued twisting together of these filaments produces the ropelike supercoils that are called hair. At the molecular level, the difference between straight hair and curly hair is the positioning of disulfide bridges that maintain the protein’s stable structure. Because these covalent bonds are very hard to break, using a curling iron or hot rollers to curl straight hair or straighten curly hair produces only temporary results. The heat is insufficient to break the disulfide bridges holding the α-keratin in a straight configuration. To achieve longlasting curly (or straight) hair requires biochemistry at the beauty

3. Adding a reducing agent (alkaline thioglycolate) breaks the disulfide bridges, allowing the protein strands to slide past each other and relieve the curler strain.

4. Applying an oxidizing agent (“neutralizer”) reestablishes the disulfide bridges but in new positions between the strands, stabilizing the new, curled conformation.

may break the hydrogen bonds and disulfide bridges that maintain the secondary and tertiary structures of a protein, resulting in a modified conformation and loss of function known as denaturation. High temperatures or changes in pH or solute concentration are usually to blame for protein denaturation. Because these conformational changes are often irreversible, denaturation can prove deadly at the cellular and organismic levels. Although polypeptide function is as diverse as its structure, most proteins use the same basic mechanism of action—they bind to another molecule. Any substance that participates in intermolecular binding is called a ligand. The affinity of a ligand for binding a protein depends on the type of bonds formed. The overall strength of protein–ligand binding is determined by the number of bonds formed and the degree of complementary topography between the binding surfaces (Figure 2.6).

Protein–ligand binding • Figure 2.6 The strength of protein–ligand binding is determined primarily by the number of chemical bonds formed between two well-matched surfaces. With a good match between the binding surfaces, numerous attractive forces can form, resulting in high binding strength of protein and ligand. Binding strength

Strong

Moderate

Poor

1. Why does primary protein structure ultimately determine the other three structural levels? 2. How is protein-ligand binding affected if the pH drops from neutral to acidic conditions?

2 .2

Th in k Cr it ica lly

How is the process that is described here similar to the use of superglue to bind two surfaces together?

Enzymes

LEARNING OBJECTIVES 1. Explain how an enzyme lowers the activation energy barrier to catalyze a biochemical reaction.

2. Identify factors influencing enzyme activity, explaining how each affects reaction rate.

ost chemical reactions in living organisms can occur spontaneously but at a rate too slow to sustain life. In a chemistry lab, reaction rate can be increased by adding heat. Because heat can denature proteins, organisms must rely on another method to boost reaction rates. Consequently, one of the most important protein functions is their ability to act as enzymes, or catalysts to speed up biochemical reactions. Because hydrolysis reactions enzyme A highly release energy as they degrade selective protein polymers, macromolecule digescatalyst that speeds tion is essential for cell survival. up chemical reacHowever, these spontaneous reactions without being tions run very slowly because polyconsumed. mers are structurally stable. By

converting the polymer to a more reactive state, an enzyme lowers the activation energy (Ea ), or the minimum amount of start-up energy needed to begin a chemical reaction. Consequently, the rate of reaction is greatly increased. Enzymes safely accomplish this task in living things. The diverse structure of proteins allows enzymes to not only target specific biochemical reactions for catalysis but also to regulate their speed, generating sufficient product without wasting cellular resources. To the microbiologist, a thorough knowledge of enzyme function is essential for understanding antibiotic action, or the use of drugs to control bacterial infections. For example, penicillin kills bacteria by inhibiting the enzyme they need to build their cell wall and ciprofloxacin interferes with enzymes involved in prokaryotic DNA replication.

M

Enzymes  35

Enzyme Action

interest has been accomplished, and the enzyme is ready to use again. The interaction between an enzyme and its substrate accounts for the extreme specificity of enzymes. For example, the enzyme sucrase hydrolyzes the substrate sucrose into the products glucose and fructose. Sucrose and lactose are similar in size and shape, but only the sucrose can enter the active site of sucrase and react. If lactose is provided as an alternative substrate, the sucrase is unable to hydrolyze the molecule. To hydrolyze lactose requires a different enzyme, β-galactosidase, which has an active site that specifically accommodates this substrate. In other words, one enzyme is typically specialized to perform only one reaction. To better comprehend enzyme–substrate specificity, examine Table 2.1. Note that most enzymes are easy to identify because their names end with the suffix -ase and frequently suggest the reaction they catalyze.

Process Diagram

In an enzyme-mediated reaction, the substances acted on by the enzyme are called substrates. The size, shape, and charge of a substrate complement a cleft in an enzyme called the active site (Figure 2.7, step 1) allowing them to fit together much like a key in a lock. When the enzyme and substrate bind (step 2), induced fit distorts the substrate to a highly reactive transition state, essentially lowering the Ea. In addition, some of the enzyme–substrate induced fit The binding energy contributes dislight conformational rectly to catalysis, again reducing change in an enzyme the Ea (step 3). Substrate is now following substrate readily converted into product, binding to correctly which is released from the active orient the substrate site because its size, shape, and and promote rapid charge are no longer compleconversion to product. mentary (step 4). The reaction of

✓ The Planner

Enzyme action • Figure 2.7 Enzyme–substrate binding decreases the Ea barrier, facilitating conversion to product.

− − −S − + +

1 The size, shape, and charge of substrate complements the active site, facilitating entry. +

P −

+ +

+ +

Active site

− − −

+

2 Energy in bonds between substrate and active site is used to reduce the Ea.

Enzyme

+ +

+ −S − + + −+ +− + − − −

+ + − − −

4 Product is released, allowing the enzyme to be reused.

+ − − + S + −+ +− + −

Enzyme

+ Substrate

Enzyme

T h in k C ri ti c a l l y

−

−

Substrate Complex

Why is the mechanism of enzyme action, which releases the enzyme unchanged at the end of a reaction, so important to cell function?

36  CHAPTER 2  The Biochemistry of Macromolecules

3 Induced fit distorts substrate into a highly reactive transition state also lowering the Ea.

Enzyme

+

Product

Selected enzymes and the reaction they catalyze  Table 2.1 Enzyme

Reaction catalyzed

Aldolase

Cleaves fructose-1, 6-bisphosphate in glycolysis

Amylase

Digests amylose (starch)

β-galactosidase

Cleaves terminal galactose units

Catalase

Degrades H2O2 into water and oxygen

DNA ligase

Joins two DNA strands together

DNA polymerase

Joins nucleotides together during DNA replication

Hexokinase

Adds a phosphate group to glucose in glycolysis

Lysozyme

Degrades the peptidoglycan of bacterial cell walls

Phosphoenol pyruvate carboxylase

Removes the carboxyl group from phosphoenol pyruvate in C4 photosynthesis

Primase

Synthesizes an RNA primer to initiate DNA replication

Ribulose-1,5-bisphosphate carboxylaseoxygenase

Adds CO2 to ribulose-1, 5-bisphosphate in photosynthesis

Sucrase

Hydrolyzes sucrose

Factors Influencing the Rate of Enzyme Activity Although many enzymes successfully catalyze reactions unassisted, some are more efficient when working with a molecular partner. A prosthetic group is a nonpeptide molecule that binds to a protein and enhances its function. Prosthetic groups for enzymes are either cofactors (inorganic ions) or coenzymes (small organic molecules) (Table 2.2). When an enzyme is coupled with a prosthetic group, it is known as an apoenzyme and the whole complex is called a holoenzyme. Another factor that affects the rate of enzymecatalyzed reactions is temperature. Because adding heat energy to a system increases the speed of the system’s molecules, raising the temperature increases the frequency of enzyme–substrate collision. Consequently, slight temperature elevations can speed up enzymatic reactions. Large temperature increases break the internal bonds responsible for an enzyme’s secondary and tertiary structures, denaturing the protein. The rate of an enzymatic reaction is also influenced by the concentrations of the enzyme and substrate. The higher the concentrations of substrate or enzyme, the greater likelihood for their collision, binding, and reacting. Constitutive enzymes are always present in fairly constant amounts regardless of substrate concentration because their activity is essential for cell survival. The enzymes responsible for glucose degradation leading to energy production are good examples of constitutive enzymes. Conversely, regulated enzymes vary in their concentration with substrate availability. Regulated enzyme

production is induced with increasing substrate availability or repressed with decreasing substrate amounts. The result is controlled reaction rates to maximize production without wasting cellular resources. Selected prosthetic groups  Table 2.2 Common prosthetic groups of enzymes

Role in catalysis

Cofactors Ca2+

Allosteric enzyme regulation

Cu2+

Oxidation and reduction

Fe2+

Oxidation and reduction

Mn2+

Oxidation and reduction

Zn2+

Facilitation of NAD+ binding

Coenzymes Biotin

CO2 transfer

Coenzyme A

Acyl group transfer

FADH2

Oxidation and reduction

Folic acid

Transfer of single carbon groups

NADH, NADPH

Oxidation and reduction

Vitamin B1

Aldehyde transfer

Vitamin B12

Methyl group transfer

Enzymes  37

Competitive enzyme inhibition requires an inhibitor molecule similar in size, shape, and charge to the substrate. The substrate and inhibitor compete for active site access, and altering the concentrations of these molecules controls enzyme activity (Figure 2.8a). When the substrate concentration builds up, the relative concentration of the

Process Diagram

When an adequate supply of product is available, continuing its enzymatic generation to excess would squander cellular supplies. Most reactions are highly regulated and occur only when a product is needed. This level of enzyme control is accomplished by reversible inhibitors, molecules that temporarily block enzyme action.

✓ The Planner

Reversible regulation of enzyme activity • Figure 2.8 Controlling the rate of enzymatic reactions is key to conserving host resources.

a. Competitive enzyme inhibition If an inhibitor molecule ­mimics the substrate, the two will compete for access to the enzyme’s active site. Competitive enzyme inhibition S

S

I

I

S Active site

Enzyme

S

S

I

1 A high concentration of inhibitor makes it the superior competitor for the active site.

Substrate and inhibitor have similar size, shape, and charge, allowing both access to the active site.

I

I

I 2 With inhibitor blocking substrate access to the active site, enzyme activity stops.

I

S

S

S

S

S

S

S

S

3 The ratio of substrate to inhibitor increases. I

I

I

P

P

I 4 The substrate becomes the better competitor for the active site, restoring enzyme activity.

S

Reversal of inhibition

b. Noncompetitive enzyme inhibition Distorting the active site by binding an inhibitor in an ­allosteric position also ­prevents substrate entry, ­shutting down product ­generation. Noncompetitive enzyme inhibition S

Active site Allosteric site

Enzyme

S 1 Application of inhibitor to the allosteric site alters the active site conformation, preventing substrate entry.

I

Noncompetitive enzyme inhibition is overcome by removing the inhibitor from the ___________ site.

38  CHAPTER 2  The Biochemistry of Macromolecules

P

I

S I

A sk Yo u rs e l f

2 Without the substrate entering the active site, enzyme activity stops.

3 Removal of the inhibitor from the allosteric site restores active site conformation. S 4 Enzyme activity resumes.

Reversal of inhibition

P

Negative feedback inhibition loop • Figure 2.9 Inhibiting the initial enzyme in a biochemical pathway affects all subsequent reactions in the pathway, allowing tight regulation of the overall process.

Enzyme 2

Enzyme 1 Allosteric site

Active site

Substrate A

Final product/ Allosteric inhibitor

Enzyme 1

Enzyme 2 Product 1/ Substrate B

Product binding to the allosteric site alters active site conformation, preventing substrate binding and inhibiting the pathway.

Final product/ Allosteric inhibitor

Product 2/ Substrate C

Product 1/ Substrate B

Substrate A

Enzyme 1

Product 2/ Substrate C

Enzyme 3

Enzyme 3

A sk Yo u rs e l f What would happen if the point of Product 2/Substrate C could bind the allosteric site of Enzyme 1? a. The conformation of the Enzyme 1 active site would be altered. b. Enzyme 1 would be inactivated. c. The pathway would be inhibited a step sooner. d. All of these are true.

inhibitor is decreased. This makes the substrate the better competitor for the active site, and the reaction rate increases. As product accumulates and substrate levels fall, the relative concentration of the inhibitor increases. With the inhibitor now more likely to be occupying the active site, the rate of product formation declines. Another convenient way to control enzyme activity is through noncompetitive enzyme inhibition. When an inhibitor molecule binds a remote position on the enzyme called the allosteric site, the conformation of the active site is changed. With the active site distorted, substrate fails to bind and enzyme activity stops

(Figure  2.8b). Removal of the inhibitor restores the active site to its original shape, and enzymatic reactions resume. Most biochemical reactions occur as part of a pathway, a series of interrelated processes. This actually facilitates enzyme regulation. If the final product of a pathway serves as a noncompetitive inhibitor of the enzyme initiating the process, then all of the subsequently linked enzymatic reactions are terminated before product levels become excessive (Figure 2.9). This mechanism, known as a negative feedback inhibition loop, allows precise control of biochemical processes to conserve host resources.

1. Why are enzyme-driven reactions very specific?

2. How does competitive enzyme inhibition differ from noncompetitive enzyme inhibition? Enzymes  39

Carbohydrates

2. 3

LEARNING OBJECTIVES 1. Describe three factors influencing carbohydrate structure.

C

2. Explain the primary functions of carbohydrates.

of CH2O. Carbohydrates are polymers made up of monosaccharides, or simple sugars, joined together by dehydration synthesis to form larger, more complex carbohydrates. The covalent bonds that link the monomers of a carbohydrate are called glycosidic links.

arbohydrates are very important to all organisms as fuel sources and structural components. As the name suggests, carbohydrates are composed of carbon, hydrogen, and oxygen. They have a general structural formula

Carbohydrate characteristics • Figure 2.10 Carbohydrate diversity is influenced by a variety of factors.

a. Types of monosaccharides Carbohydrates can contain many different monosaccharides. Monosaccharides are often described by the number of carbons they contain. Although they are frequently written in chain form, most monosaccharides exist in ring form in solution.

H

H

C

CH2OH

O

C

O

O

C

H

C

OH

HO

C

H

H

C

OH

H

C

OH

H

C

OH

H

C

OH

H

C

OH

H

C

OH

CH2OH

H

CH2OH H

O H OH

H

H

OH

HO

H OH

CH2OH

Triose (3C) Pentose (5C) Hexose (6C) Many monosaccharides, such as glucose, exist in both straight-chain and ring forms.

b. Variation in number and arrangement of monosaccharides The number and arrangement of monosaccharides in a carbohydrate are enormously diverse.

Glycosidic link CH2OH

CH2OH

O

H HO

H OH

H

H

OH

H

O

H O

H OH

H

H

OH

H OH

A disaccharide is composed of two linked simple sugars joined with a glycosidic link.

H HO

CH2OH O H OH H

H

CH2OH O H OH

H O

OH

H

H

H O

OH

CH2OH O H OH H

H O

OH

A trisaccharide is composed of three linked simple sugars. CH2OH O O OH

CH2OH O

CH2OH O

CH2OH O O OH Amylose

HOCH2

HOCH2

O

HOCH2

CH2 O

O

O

O

O

O

O OH

O

O

O OH

HOCH2

HOCH2

O O

Glycogen A polysaccharide is composed of many linked simple sugars and can be a straight chain, such as amylose, or a branched molecule, such as glycogen.

40  CHAPTER 2  The Biochemistry of Macromolecules

longer simple sugar chains are called polysaccharides. A final feature that diversifies carbohydrates is the substitution of various functional groups for the usual hydroxyl groups on the monosaccharides (Figure 2.10c).

Simple and Complex Carbohydrates Many monosaccharides exist in both a straight-chain and a more stable ring form. Monosaccharides are usually categorized based on the number of carbons they contain (Figure 2.10a). Carbohydrate diversity depends on the monomers present, the length of the polymer, and whether the monomer chain is straight or branched (Figure 2.10b). Chain length is easily determined by the polymer prefix when only a few units are joined together such as for disaccharides (double sugars), trisaccharides (triple sugars), and so forth. Medium-length carbohydrates ranging in size from three to approximately 20 monomers are known as oligosaccharides, whereas

The Functional Diversity of Carbohydrates Polysaccharides are outstanding energy storage resources because hydrolysis of their many glycosidic links releases energy needed for life processes. Starch in plants and glycogen in mammals are two examples of carbohydrates

c. Functional group substitution Substituting different functional groups for hydroxyl groups on a monosaccharide produces new carbohydrates with new functions. 6

CH2OH H

O H OH

H

HO

H

H 4

OH

H

OH Glucose

HO

CH2OH O 5 H OH H 3

H

OH 1

2

H

NH C

O

CH3

Curtis E. Young, Ph.D

Kaan Ates/Getty Images

N-acetylglucosamine

Glucose can polymerize to form the energy-storing starch found in potatoes.

N-acetylglucosamine polymerizes to form the tough exoskeleton of arthropods such as insects.

Pu t I t To g e t h e r

Review Figure 2.4, and answer this question. The monomers of carbohydrates are joined by dehydration synthesis. How similar is this reaction to the reaction that joins amino acids together in proteins? a. Not at all—the components of these two kinds of compounds are different. b. Somewhat similar in that they both add an H and OH to the existing compounds. c. Very similar in that they both involve the removal of an H and OH from the reacting molecules and the formation of a bond between the remaining atoms. d. Similar in that they both involve the removal of one water molecule and the addition of another one to the reacting molecules.

Carbohydrates  41

Clinical Application

✓ The Planner

Rapid Glycogen Breakdown in a Diabetic Patient in Shock Insulin and glucagon, two pancreatic hormones, are responsible for regulating blood glucose levels (Figure a). Insulin facilitates the movement of glucose from the blood into the body cells, thereby decreasing blood glucose levels. Glucagon promotes glycogen hydrolysis, providing a glucose source to elevate blood glucose concentration. Because type I diabetics cannot produce insulin, they attempt to control blood glucose levels by injecting precise

hormone doses that correlate with the carbohydrate content of their meals. If too much insulin is inadvertently administered, life-threatening hypoglycemia, or diabetic shock, leads to seizure and unconsciousness. This emergency can be reversed by injecting a dose of glucagon, which rapidly hydrolyzes glycogen in the liver (Figure b). Immediate mobilization of this carbohydrate resource returns blood glucose levels to normal, leading to patient recovery from diabetic shock.

a. A relatively steady blood glucose level is maintained by

b. An unconscious diabetic patient experiencing severe hypoglycemia can be revived by quickly dissolving freeze-dried glucagon in sterile saline and injecting the mixture into a major muscle group.

insulin secretion following a meal and by glucagon release to mobilize carbohydrate reserves when needed.

Alpha cells Glucagon

5. High blood glucose stimulates insulin production.

Beta cells Insulin

2. Glucagon acts on liver cells and muscle cells.

6. Insulin acts on body cells, causing them to take in glucose.

3. Glucose is released by liver and muscle cells, raising blood glucose.

7. Blood glucose level falls.

4. Blood glucose continues to rise above homeostatic value.

8. Blood glucose level drops below homeostatic value.

T h in k Cri ti c a l l y

Predict what would happen if an emergency dose of glucagon were administered to a person with a normal blood glucose level.

used for energy (see the Clinical Application). Polysaccharides also serve as structural materials. Cellulose composes the rigid cell walls of plants, and chitin is the primary material in an insect’s shell-like exoskeleton. Unlike storage carbohydrates that are easily broken down to provide energy, structural carbohydrates have a slightly modified glycosidic link that is much tougher to degrade, making them excellent supporting materials.

42  CHAPTER 2  The Biochemistry of Macromolecules

© Phanie/Alamy Stock Photo

Ireland, Kathleen A. Visualizing Human Biology, 4e; figure 17.14, page 488. © 2012. Wiley

1. Low blood glucose stimulates glucagon production.

Emergency glucagon kit

Syringe filled with Vial of freeze-dried sterile saline glucagon for mixing with sterile saline

1. What bond type joins monosaccharides in polysaccharides? 2. What are the major functions of polysaccharides?

Lipids

2 .4

LEARNING OBJECTIVES will address the most biologically relevant lipids: triglycerides, phospholipids, and steroids.

1. Diagram the basic structure of a triglyceride, phospholipid, and steroid to highlight their hydrophobic natures. 2. Compare the functions of triglycerides, phospholipids, and steroids.

L

The Structural Classes of Lipids Triglycerides are a form of lipid composed of three fatty acids joined to a glycerol molecule, a

ipids are a diverse group of hydrocarbons

that include fats, waxes, and sterols, all of which are insoluble in water. Their hydrophobic nature is essential for their numerous functions. Although some lipids are composed of multiple monomers, the polymeric function of this macromolecule class often results from their aggregating via hydrophobic interactions. This section

three-carbon sugar alcohol. Dehydration synthesis covalently links a fatty acid to each carbon of the glycerol with an ester bond (Figure 2.11).

fatty acid A hydrocarbon chain of variable carbon number with a terminal carboxyl group that participates in the formation of an ester bond with glycerol to generate fats and oils.

Basic triglyceride structure • Figure 2.11 A triglyceride is formed by the bonding of three fatty acids (the monomers) to a glycerol molecule.Triglyceride diversity results from the presence of different fatty acid monomers. Glycerol

Fatty acid (myristic acid)

H H

C

OH

H

C

OH

H

C

OH

H

HO

O

H

H

H

H

H

H

H

H

H

H

H

H

H

C

C

C

C

C

C

C

C

C

C

C

C

C

C

H

H

H

H

H

H

H

H

H

H

H

H

H

H2O

Fatty acid Myristic acid Pentadecanoic acid Palmitic acid Palmitoleic acid Heptadecanoic acid Stearic acid Oleic acid Linoleic acid Linolenic acid Nondecanoic acid Arachidonic acid

H

Dehydration synthesis

Ester bond H H

C

O

H

C

OH

C

OH

H

O

H

H

H

H

H

H

H

H

H

H

H

H

H

C

C

C

C

C

C

C

C

C

C

C

C

C

C

H

H

H

H

H

H

H

H

H

H

H

H

H

Repeat 2x

H H H

C

C

C

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

O

C

CH2

C

16 16 17

0 1 0

18 18 18 18 19

0 1 2 3 0

20

4

O

C

CH2

CH2

CH2

CH3

Myristic acid CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH2

CH

CH2

CH2

CH2

CH2

CH2

CH2

CH3

Steric acid

O H

Number of double bonds 0 0

O O

O H

Monoglyceride

H

Number of carbons 14 15

CH2

CH

CH2

CH2

CH2

CH2

CH2

CH CH

Triglyceride CH

2

H KEY H C same as CH2

CH

2

Oleic acid

CH

2

CH

2

CH

2

CH

2

H

In te rp re t th e D ata Of arachidonic acid and linolenic acid, which has the highest percentage of unsaturation?

CH

2

CH

3

Dehydration synthesis between three fatty acids and a glycerol molecule produce a triglyceride. Tremendous structural diversity is possible using varying combinations of different fatty acids. The various fatty acid monomers differ in length and the number of multiple bonds they contain. Fatty acids containing one or more multiple bonds are said to be unsaturated, whereas those composed of only single bonds are saturated (Figure 2.12). A saturated fatty acid cannot add any more hydrogen atoms. An unsaturated fatty acid containing double bonds can add two hydrogens at each double bond, or three hydrogens at a triple bond. An important feature of multiple bonds in a fatty acid is the kink they put in the hydrocarbon chain. The result of the kink is especially obvious in a comparison of fats and oils. Because the fatty acids found in the triglycerides

of a solid fat are saturated, these hydrophobic molecules have straight chains that can associate very closely to form a dense, solid substance. Oils are liquid triglycerides because their kinked, unsaturated fatty acids prevent the triglycerides from packing closely together. The result is a less dense substance that is liquid at room temperature (see the Case Study). Because saturated fats are solids, diets high in these lipids elevate heart disease risk. Plaques formed in blood vessels from these abundant saturated fats can occlude coronary circulation, causing a heart attack. Consequently, patients consuming a heart-healthy diet should read product labels to assure a low ratio of saturated to unsaturated fats. Savvy consumers should be aware that the term partially-hydrogenated unsaturated fats is a misleading way of saying the product contains saturated fats and thus is not a healthy choice.

Case Study

✓ The Planner

Acne—A Bacterial Interaction with Skin Oils

44  CHAPTER 2  The Biochemistry of Macromolecules

a. A young patient suffering from symptoms of acne vulgaris

Dr. Harout Tanielian/Science Source Images

Dr. James completed Meredith’s annual sports physical examination and signed off on the necessary paperwork for her to play varsity tennis. As she gave Meredith the completed forms, Dr. James asked,“Meredith, I don’t recall you having noticeable acne at your last appointment; have these blemishes recently worsened?” Feeling relieved by the opportunity to address this concern, Meredith nodded and responded, “Over the last year, the number of blackheads and pimples has steadily increased on my face (Figure a) and also on my shoulders and back. Sometimes they are even painful and I can’t cover the redness with makeup. I wash my face all the time and I just can’t scrub my zits away!” “Good hygiene is important in minimizing acne symptoms because it does reduce the number of bacteria causing the infection. However, there are many interrelated factors to consider,” replied Dr. James. “My acne is an infection?” Meredith asked with surprise. “You mean like a cold?” “No, not like a cold. That’s caused by a virus. Your acne is the result of a particular species of bacteria that live in hair follicles and sebaceous glands of teens and adults. They secrete lipases that break down your sebum, which is primarily a mixture of triglycerides and waxes. The by-products of these metabolic reactions are one of the causes of the inflammatory redness associated with acne,” Dr. James explained.

1. What skin symptoms that characterize acne are present in the photo? 2. Use your knowledge of triglyceride and wax structure to identify the products made when they are hydrolyzed by lipase. 3. Why might these by-products irritate the skin leading to the redness seen in acne patients? 4. Investigate: What bacterial species is most often responsible for causing acne?

Saturated versus unsaturated fatty acids • Figure 2.12 The presence of multiple bonds within a fatty acid chain bends the molecule and influences the ability of triglycerides to associate with one another. Triglyceride symbol

Triglycerides composed of straight-chain, saturated fatty acids can pack closely together, forming dense, solid fats.

Triglycerides composed of bent-chain, unsaturated fatty acids are spaced apart, resulting in lighter, liquid oils.

T hi nk C ri ti c al l y

After comparing the structures of saturated and unsaturated in triglycerides, explain why a diet high in saturated fatty acids may lead to cardiovascular disease.

Bobby Strong / CDC

b. The most common causative agent of acne as it appears after Gram staining

5. Describe the shape and arrangement of these bacterial cells when viewed under a microscope. “Dr. James,” Meredith said with exasperation, “what can I do to make this go away? It’s so embarrassing; I don’t want people to see me looking like this. I don’t know why I’m getting more pimples now. This really wasn’t a problem last year.” “First of all, let me reassure you that you are not the only 16-year-old girl with acne. Approximately 90% of young adults suffer with this problem. Given that your case has become

severe, I am going to prescribe both an oral antibiotic and a topical medication, which should control the infection and greatly reduce your symptoms,” Dr. James said. “I remember going through this when I was your age, and I understand that acne can make you feel self-conscious.” “But, Dr. James,” Meredith replied with encouragement, “your skin looks great! How did you get rid of your acne?” “My pediatrician also prescribed appropriate antibiotics for me . . . and then, I also finished growing up. Acne is usually hardest to control in young adults because of the onset of androgen secretion, the sex hormones produced in high amounts during puberty that direct your development into an adult. These lipidbased hormones promote excess sebum production. Can you see how this would promote acne symptoms in your age group?” Dr. James asked. “Here are your prescriptions. Follow the directions for their use exactly. And I want to see you for a follow-up appointment in 6 weeks. I think you will be looking much better and feeling great about yourself. Good luck with your tennis season!” 6. Dr. James made a point of talking with Meredith about her concerns regarding her appearance due to acne. As a future health care provider, how could you help this type of patient cope with the emotional aspects of this infection? 7. What lipid category contains androgens? What specific androgens are guiding Meredith’s development?

Lipids  45

Phospholipid and steroid structure • Figure 2.13 Despite their very different structures, phospholipids and steroids are both primarily hydrophobic molecules.

a. The components of a phospholipid Phospholipids can be generated when the third fatty acid of a triglyceride is replaced by a phosphate group. H H

H

C

C

O

O

O

H

H

H

H

H

H

H

H

H

H

H

H

H

C

C

C

C

C

C

C

C

C

C

C

C

C

C

H

H

H

H

H

H

H

H

H

H

H

H

H

O

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H

C

C

C

C

C

C

C

C

C

C

C

C

C

C

C

C

C

C

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H

H Hydrophobic nonpolar region H

H O− H

C H

O

P O

O

H

H

C

C

H

H

H

C +

H

HH

N

C

C

HH

H Phospholipid symbols

H Hydrophilic polar region Phospholipids are composed of 2 hydrophobic fatty acids and a hydrophilic phosphate group attached to a glycerol resulting in an amphipathic molecule.

b. A phospholipid bilayer The bilayer formed by amphipathic phospholipids is an ideal material for biological membranes. The hydrophobic fatty acids interact, forming the inside of the two-layered membrane. The hydrophilic phosphate groups associate with watery environments on either side of the hydrophobic layer.

c. A steroid carbon skeleton Four hydrocarbon rings fuse together to form a basic steroid. Addition of functional groups and a side chain results in structural diversity. CH3 CH2 CH2 CH3 CH3

Water molecules C

CH3 A

B

HO Cholesterol

A sk Yo u rs e l f How does a phospholipid molecule differ from a triglyceride? a. It has phosphate groups bonded to glycerol where a triglyceride has fatty acids. b. The glycerol is bonded to two phosphate groups and one fatty acid. c. It has a phosphate group instead of a fatty acid on the third carbon of the glycerol. d. It consists of three phosphate groups bonded to three fatty acids and does not contain glycerol.

46  CHAPTER 2  The Biochemistry of Macromolecules

CH

CH2 CH CH3

D

Phospholipids, another vitally important group of lipids, consist of a triglyceride with a phosphate group substituted for a fatty acid at the third position (Figure  2.13a). Although this seems a minor structural change, it has a major effect on molecular function. Because most of the phospholipid is a hydrocarbon, the molecule is still predominantly hydrophobic. However, the heavy negative charge of the phosphate group makes this region very hydrophilic, or attracted to water. Molecules with both hydrophilic and hydrophobic regions are said to be amphipathic. Because they are amphipathic, phospholipids can interact simultaneously with hydrophobic and hydrophilic substances. When placed in an aqueous environment, such as a cell, phospholipids spontaneously form a bilayer so the hydrophobic tails avoid conplasma tact with water (Figure 2.13b). membrane A The plasma membrane that selectively permeable surrounds cells acts as a semibarrier composed of permeable barrier, controlling proteins and a phosthe passage of molecules into pholipid bilayer that the cell from the watery extracelseparates the interior lular matrix and out of the cell of the cell from the cytosol. Phosfrom its watery exterior. pholipids spontaneously arrange cytosol The cell themselves as a bilayer to form (cyto-) solution (-sol), this barrier because of their dual or the aqueous chemical characteristics. A bilayer medium that supis a stable conformation because ports all internal celthe fatty acid tails face each other lular structures. on the inside of the bilayer. The hydrophilic phosphate groups face outward where they interact with water molecules outside and inside the cell.

Just as fatty acid composition influences triglyceride density, it similarly affects membrane behavior. Membrane phospholipids usually contain some unsaturated fatty acids. The kink in the hydrocarbon chains once again acts to space them apart, allowing enhanced molecular motion that leads to the fluid nature of membranes. The structure of steroids is completely different from that of triglycerides and phospholipids in that they consist of four fused hydrocarbon rings (Figure 2.13c). Structural diversity results from substituting different functional groups on the steroid carbon skeleton, modifying the attached side chain, or using the carbon skeleton as a precursor for enzymatic conversion to other types of molecules. Cholesterol is a common steroid. When present in appropriate amounts, it plays a vital role in plasma membrane function. If an individual consumes a diet high in cholesterol, this lipid, like triglycerides, can elevate the risk of heart disease by contributing to the formation of obstructive plaques in coronary arteries (Figure 2.14).

Lipid Functions Both fats and oils are excellent energy storage molecules. Many animals also have a layer of fat under the skin as insulation to prevent the loss of body heat and as a protective cushion for vital internal organs.Triglycerides that have a hydroxyl group on their fatty acids are known as waxes. Their hydrophobic nature makes waxes an ideal waterproof coating. On the exterior of plants and animals, a cuticle, or wax layer, prevents desiccation by inhibiting evaporation. A waxy coating on the feathers of water fowl prevents water penetration, keeping the birds afloat. A waxy compound, mycolic acid, is found

The effect of elevated cholesterol levels on coronary arteries • Figure 2.14 A normal coronary artery permits unobstructed blood flow (left), whereas plaque formation due to high cholesterol levels impairs coronary circulation by partially occluding the vessel (right). If a blockage results, the patient will suffer a heart attack.

Normal artery

Obstructed artery

Biophoto Associates/Photo Researchers, Inc.

Biophoto Associates/Photo Researchers, Inc.

Plaque

Th in k Cr it ica lly

Why is this patient at risk of a heart attack if the artery is only partially obstructed?

Lipids  47

T he M icrobiologist ’ s T oolbo x

✓ The Planner

Ziehl-Neelsen Acid-Fast Staining of Mycolic Acid Cell Walls The Ziehl-Neelsen protocol, also known as heat treatment, is an important tool for staining and identifying pathogens that have mycolic acid in their cell wall. Infections caused by Mycobacterium tuberculosis, Mycobacterium leprae, and Nocardia spp. are routinely diagnosed using this differential staining technique. Because the mycolic acid layer is thick and hydrophobic, these bacteria are hard to stain with routine differential procedures. To force stain into the waxy mycolic acid layer, carbol fuchsin is applied to a fixed specimen and heated for 5 to 8 minutes. As the stain boils, it penetrates the heat-softened

mycolic acid of these bacteria, as well as the walls of other microbes, dyeing them all bright red (Figure a). A 30-second rinse with acid alcohol quickly flushes the stain from standard bacterial cell walls. Because the decolorizer can’t penetrate the mycolic acid layer, it remains bright red. In other words, the bacteria are acid fast. Finally, counterstaining with methylene blue differentiates the non-acid fast bacterial species from the red, acid-fast microbes (Figure b). Clinical microbiologists reviewing specimens stained in this manner can easily identify acid-fast pathogens, facilitating patient diagnosis and treatment.

a. Ziehl-Neelsen differential staining of acid-fast bacteria requires heating the carbol fuchsin to force the dye into the otherwise impervious mycolic acid cell wall. 1. Carbol fuchsin is applied to a fixed bacterial smear and heated to drive the stain into mycolic acid cell walls.

2. The slide is washed with an acid-alcohol decolorizer to remove stain from any bacteria lacking a mycolic acid cell wall.

3. Methylene blue is applied as a counterstain to give contrast to the decolorized cells.

Microscope slide

Reagent bottles Acid alcohol

Alcohol lamp

If viewed under the microscope now, only the acid-fast bacteria would appear red.

Microscope field of view

If viewed under the microscope now, the bacteria would all appear red.

Methylene blue

If viewed under the microscope now, the non-acid fast bacteria would take up the counterstain and appear blue.

Acid fast bacteria retain carbol fuchsin after decolorizing and counterstaining.

Acid-fast bacteria stained with carbol fuchsin

▲

b. Because their thick hydrophobic mycolic acid cell walls retain carbol fuchsin, following an acid-alcohol decolorizing treatment, these pathogens are easily distinguished by microscopic examination.

Suppose a microbiologist ­forgets to counterstain a specimen containing acid-fast and non-acid fast bacteria. How would she distinguish the acid-fast pathogens from other, contaminating microorganisms?

48  CHAPTER 2  The Biochemistry of Macromolecules

PTD/Phototake

T h in k Cri ti c a l l y

in the cell walls of some bacterial species. Because of its hydrophobic nature, mycolic acid is hard for antibiotics to penetrate, making these bacteria difficult to treat and even to stain for examination (see The Microbiologist’s Toolbox).

Diverse steroid functions are associated with modifications of their attached functional groups (Table 2.3). In addition, the steroid skeleton can serve as a precursor molecule that is chemically altered to acquire new functions.

The functional diversity of steroids and their derivatives  Table 2.3 Steroid

Function

Cholesterol

A component of the plasma membrane essential for regulating membrane fluidity

Cortisol

A stress hormone that functions to increase blood glucose levels

Estradiol

A hormone directing the development of female secondary sexual characteristics and regulating the menstrual cycle

Lycopene

A plant antioxidant that protects against excess sun damage; colors fruits, promoting seed dispersal

Progesterone

A hormone that prepares the body for conception and maintains pregnancy

Prostaglandins

Signal molecules affecting pain sensitivity, platelet aggregation, vasoconstriction, and more

Testosterone

A hormone directing development of male secondary sexual characteristics

Vitamin A

A vitamin that promotes good vision and acts as a hormonelike growth factor for epithelial cells

Vitamin D

A vitamin essential for good bone health

1. What structural features are shared by triglycerides and phospholipids?

2 .5

2. What chemical characteristics of phospholipids make them suitable components of plasma membranes?

Nucleic Acids

LEARNING OBJECTIVES 1. Compare and contrast the structures of DNA and RNA. he final class of biological polymers is nucleic acids. Although nucleic acids are long-chain macromolecules composed of only five different types of monomers, an almost unlimited number of unique polymers can be generated. For this reason, nucleic acids are ideal for the storage and transfer of genetic information.

T

The Structures of DNA and RNA There are two types of nucleic acids: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA contains

2. Explain how the genetic information stored in DNA is converted into a protein.

deoxyribonucleic acid (DNA) A self-replicating polynucleotide that encodes an organism’s hereditary information.

ribonucleic acid (RNA) A polynucleotide essential for gene expression.

the stored hereditary information that is copied into RNA molecules and used to direct protein synthesis. Both are composed of monomers known as nucleotides. Nucleic acid monomers are complex, three-part molecules. Each is composed of a nitrogenous (nitrogen-containing) base, a pentose (a five-carbon sugar), and a phosphate group (Figure 2.15a). The nitrogenous base may be either a single-ring pyrimidine Nucleic Acids  49

or a double-ring purine. In DNA, cytosine and thymine are the pyrimidines, whereas in RNA, ­cytosine and uracil are the pyrimidines. In both DNA and RNA, the purines are adenine and guanine. In DNA nucleotides, the pentose is deoxyribose, a pentose that is missing an oxygen on its number two carbon when compared with the ribose associated with RNA nucleotides. The phosphate group is always attached to the number five carbon of the pentose. Polynucleotides form when the phosphate group of one nucleotide is covalently bonded to the number three carbon of the pentose in the adjacent monomer

(Figure 2.15b). These phosphodiester bonds generate a linear molecule with a backbone of repeating ­pentose and phosphate units. This structural arrangement makes it easy to distinguish between the two ends of the nucleic acid. Because the number three carbon of the first pentose and the number five carbon on the last are unbound, the termini of nucleic acids are designated as the 3′ and 5′ ends, respectively. The associated nitrogenous bases bind to the number one carbon of each pentose. Because nucleic acids are polar molecules, they readily participate in hydrogen bond formation. Stable configurations result when hydrogen bonds form between

Nucleic acid structure • Figure 2.15 A comparison of DNA and RNA at different structural levels.

a. Nucleotide structure Nucleotides consist of a nitrogenous base, a pentose, and a phosphate group. Phosphate group O– O

P

Pentoses

OH

O

OH

H

H

H

C

O

N

C C

O H

H

H Cytosine (C)

OH OH Ribose

H

NH2

OH

O H

H

H

N

C

C

O

N

H

O

C

N C

N

+

P Pentose Nucleotide

50  CHAPTER 2  The Biochemistry of Macromolecules

Base

C

N C

H

N

NH2 C C

CH3 N H

H

C C

C

C

N

C C

N C N H

Adenine (A)

H

H

H Uracil (U)

Pentose

N

C

H

O

+

C

C

Guanine (G)

H Thymine (T)

OH H Deoxyribose

P

N

O

CH2OH

H

C

N

H

H

Purines

NH2

CH2OH

O–

Pyrimidines

Base

H

nitrogenous bases (Figure 2.15c). In the two strands of nucleotides that make up a DNA molecule, bases are paired in a complementary fashion with a purine always bonding to a pyrimidine on an adjacent strand. Specifically, adenine always pairs with thymine via two hydrogen bonds, and guanine always pairs with cytosine via three hydrogen bonds. The result is a stable structure that resembles a ladder with parallel pentose-phosphate rails and base-pair rungs. As additional intramolecular bonding occurs, the DNA assumes its double-helix conformation. Although RNA is a singlestranded polymer, internal base pairing may occur, giving the molecule a three-dimensional structure. Because RNA substitutes uracil for thymine, the adenines associate with

uracils as internal complementary base pairing leads to complex RNA structures. When an adenine nucleotide acquires two additional phosphate groups, a molecule of adenosine ­triphosphate (ATP) is produced. The bond attaching the terminal phosphate group is easily broken by hydrolysis because the electrostatic repulsion of these negatively charged adjacent functional groups makes it unstable.When the bond is broken, 7.3 kcal/mol of energy is released that can be used by the cell for numerous activities. Because ATP is such a versatile form of chemical energy, it is sometimes called the cell’s energy currency. The details of ATP production and use are described in Chapter 7.

b. The sugar-phosphate backbone The formation of phosphodiester bonds between the phosphate group on the fifth carbon of one pentose and the third carbon of the adjacent pentose generates a long chain.

c. Linear structure comparison Complementary base pairing leads to the double helix of DNA and the internal bonding of a single RNA strand. Sugar-phosphate backbone

5´ end N

N

O–

O

Pentose

4´

H

T C G C

A G C G

T G

A C

1´ 3´

O

H

2´

CH3

HN

H

O

O

N

5´

O–— P— O—CH

2

O

T

O 1´

3´

2´

NH2

H

DNA

O

O

C

G A C G U

H bonds

N

H

C U G C A

A G

4´

H Wessner, Dave. Microbiology, 1e; figure 7.4a, page 208. © 2013. Wiley

T C

NH2

5´

O–— P— O—CH2 O

Phosphate

A G

N

N

RNA

N

5´

O–— P— O—CH2 O

Phosphodiester bonds

O

4´

H

1´ 3´

2´

H

N

N

H

HN

N O

O

5´

O–— P— O—CH2 O

O

4´

H

1´ 3´

2´

H

H

H2 N

A sk Yo u r se lf Significant structural differences between DNA and RNA are that DNA _____. a. has two strands to RNA’s one strand b. contains thymine whereas RNA contains uracil c. contains three purine nucleotides to RNA’s two purine nucleotides d. Both a and b are correct.

OH

3´ end

Nucleic Acids  51

Microbiology InSight  DNA replication and information transfer 

•  Figure 2.16

The complementary base pairing and double-helix structure of DNA are uniquely suited to its functions of storing and transferring genetic information.

Wessner, Dave. Microbiology, 1e; figure 1.17, page 21. © 2013. Wiley

5´ Transcribed DNA strand

3´ T A C T T C A A A A T C ·· ·· ··· ·· ·· ··· ·· ·· ·· ·· ·· ··· A T G A A G T T T T A G

5´

3´ Transcription 3´ mRNA

5´

New strands

A U G A A G U U U U A G

Original strand

Double-stranded DNA

Original strand

Double-stranded DNA

Nucleic Acid Functions Genetic material must accomplish two important functions. First, it must be self-replicating so copies of the coded information are available whenever new cells are generated. Second, it must allow the rapid transfer of information within the cell so that metabolic activities are coordinated for maximum efficiency. The complementary base pairing of DNA lends itself to rapid, accurate replication when a cell is ready to divide. If DNA is untwisted and the hydrogen bonds between base pairs are broken by enzymes, the molecule separates into two strands. Each strand can serve as a template, or pattern, for the synthesis of its complementary half (Figure 2.16a), resulting in two identical DNAs. This mechanism is described as semiconservative replication because each of the new DNA molecules consists of one original strand and one new strand. Once a cell contains two copies of its hereditary material, it can divide and both daughter cells will receive an identical

52  CHAPTER 2  The Biochemistry of Macromolecules

Wessner, Dave. Microbiology, 1e; figure 7.16, page 217. © 2013. Wiley

a. DNA replication Precise DNA replication occurs using complementary base pairing to generate two molecules of DNA, each composed of one original and one new strand. In this way, new cells receive an exact copy of the parent genetic material, which makes them clones of the original cell.

Double-stranded DNA

b. Transcription Complementary base pairing allows the information stored in the base sequence of DNA to be copied into the base sequence of messenger RNA. The mRNA passes out of the nucleus into the cytoplasm, where the information stored in its base sequences can be used in protein synthesis.

copy of the genetic information. DNA is an excellent example of the relationship of structure and function—its structure allows it to make an identical copy of itself. A gene is a sequence of bases in a strand of DNA that contains the genetic code for the synthesis of a specific protein. To initiate protein synthesis, special enzymes untwist the appropriate region of the DNA, break the hydrogen bonds between base pairs, and expose the sequence of coded information. A, C, G, and U ­ribonucleotides, or nucleotides containing the five-carbon sugar ribose, pair with the exposed DNA base template. C and G ribonucleotides pair with G and C nucleotides on the DNA. Uracil substitutes for thymine in RNA, so A on the DNA pairs with U ribonucleotides, and T on the DNA pairs with A ribonucleotides. Enzymes join the ribonucleotides together, forming a strand of messenger RNA (mRNA), which contains the genetic information copied from DNA. The process that forms mRNA is called t­ ranscription (Figure 2.16b).

✓ The Planner DNA 5´

3´ A T G T G G A T T C G C T A G ·· ·· ··· ·· ··· ··· ·· ·· ·· ··· ··· ··· ·· ·· ··· T A C A C C T A A G C G A T C

3´

c. Translation

5´

Information stored in mRNA consists of sequences of three bases that code for specific mRNA amino acids. Protein diversity associated with different base sequences creates genetically unique individuals, making translation the ultimate expression of the information Polypeptide chain stored in the DNA.

U

A T G T G G A T T C G C T A G ·· ·· ··· ·· ··· ··· ·· ·· ·· ··· ··· ··· ·· ·· ··· T A C A C C T A A G C G A T C

UUU

3´

5´

5´

U

3´

Met

Trp

Ile

Arg

Stop codon

Second position UUU

C

A

A UAU

G UGU

Phe (F) Tyr (Y) genetic Cys (C) The consequences of an error in copying UUC UCC UAC UGC (S)messenger RNA would information in DNA Ser into UUA UCA UAA Stop UGA Stop Leu on___. (L) depend UUG UCG UAG Stop UGG Trp (W) a. how many bases were affected and which ones CUUthey were. CCU CAU CGU His (H) CUC CCC CAC CGC in the sequence the mistake is found. b. where Leu (L) Pro (P) Arg (R) CUA CAA CGA c. what aminoCCA acid the substituted sequence Gln (Q) CUGcoded for. CCG CAG CGG A ll of these could be true. d.  AUU ACU AAU AGU AUC

Ile (I)

AUA AUG

ACC ACA

Met

ACG

Thr (T)

AAC AAA AAG

Asn (N) Lys (K)

AGC AGA AGG

Ser (S)

Arg (R)

U C A G U C A G U C A G

GUC

C

Trp

C

Phe (F)

Ile

Arg

Stop codon

UAU

UCC

UAC

UCA

Ser (S)

G

Tyr (Y)

UGU UGC

UAA

Stop

UGA

UAG

Stop

UGG

CUU

CCU

CAU

CUC

CCC

CAC

CUA

Leu (L)

AUC

CCA

Pro (P)

CCG

AUU

A

A

UCU

UCG

Leu (L)

CUG

G

ACC ACA

CAA CAG

ACU Ile (I)

AUA

AAU Thr (T)

AAC AAA

ACG

AAG

GUU

GCU

GAU

GUC

GCC

GAC

GUA GUG

GCU GAU directs the GGU synthesisUof a information in mRNA Asp (D) C GCC GAC GGC G protein, Val a (V)process called Ala (A) translation. Translation Gly (G) is apA GUA GCA GAA Glu (E) GGA propriately named in that it converts information coded G GUG GCG GAG GGG in the nucleotides of a nucleic acid into the amino acids of a protein, much like translating information from Codon one language to another. The sequence of nucleotides in the mRNA is decoded into an amino acid sequence using a genetic code table (Figure 2.16c). Every three bases in the mRNA correspond to a specific amino acid for use in protein synthesis. By performing transcription and translation, the information encoded in an organism’s DNA can be expressed as a specific protein. A detailed description of these processes can be found in Chapter 8. The complexity of life begins at the simplest chemical level. Bonding different types of atomic building blocks together is the first step in generating molecules essential for life. More sophisticated atomic aggregations GUUThe

UUA

AUG

Third position

First position

U

C UCU

Met

Codon

Met

Val (V)

GCA GCG

Ala (A)

GAA GAG

His (H) Gln (Q)

Asn (N) Lys (K)

Asp (D) Glu (E)

U C A Stop Trp (W) G Cys (C)

CGU CGC CGA

Arg (R)

CGG AGU AGC AGA AGG

Ser (S) Arg (R)

GGU GGC GGA

Gly (G)

GGG

U C A G U C A G U C A G

Wessner 1e, figure 7.23, page 223. © 2013. Wiley

produce the monomers used to assemble the four major categories of biochemical polymers. Interactions between proteins, carbohydrates, lipids, and nucleic acids are ultimately responsible for initiating and maintaining the intricate processes of life. These basic chemical concepts will be revisited regularly in upcoming chapters and applied to the structure and life functions of diverse microorganisms.

1. What bases pair in DNA replication, and what bases pair in mRNA synthesis? 2. How does the complementary base pairing in DNA facilitate its replication? Nucleic Acids  53

Third position

Polypeptide chain

UUC UUG

A U G U G G A U U C G C U A G

mRNA

3´ A U G U G G A U U C G C U A G

Second position

3´

First position

Wessner 1e, figure 7.30, page 229. © 2013. Wiley

DNA 5´

U u rs e l f A sk Yo

5´

The Planner

✓

Summary

2.1

  Proteins 28

• Proteins, the most structurally complex category of biochemical polymer, are made up of 20 different amino acids (see the diagram). Proteins have four levels of structure from the primary structure, the linear sequence of amino acids, to the three-dimensional quaternary structure in which polypeptides combine.

Amino acids  •  Figure 2.3 H H 2N

C

C

R Amino group Variable side chain

O OH Carboxyl group

• Arranging 20 different amino acids in varying sequences can generate an enormous number of functional proteins. Among their many functions, proteins act as enzymes and hormones, and they make up the contractile fibers of muscles and the oxygen-carrying hemoglobin of red blood cells. Protein function requires maintenance of their three-dimensional conformation to bind specific ligands.

2.2

  Enzymes 35

• As shown in the diagram, in enzyme action the substrate binds to the active site of an enzyme. Induced fit distorts the substrate into its most reactive state, which lowers the activation energy (Ea) and allows rapid conversion to product.

Enzyme action  •  Figure 2.7

+

P −

Substrate + +

Active site

• Carbohydrates are made up of monosaccharides bonded together by dehydration synthesis to form straight or branched chains of different lengths. Many carbohydrates are polymers of glucose, a six-carbon sugar that typically exists in a stable ring form and is the energy source for many organisms. Monosaccharides link together to form chains of variable lengths, including oligosaccharides (up to about 20 monosaccharides) and polysaccharides, which have longer chains. • Polysaccharides, such as glycogen, are the major energy storage compounds because the glycosidic links that connect the monomers release energy when broken. Other polysaccharides, such as chitin, are structural materials, such as the exoskeletons of arthropods (see the diagram). Cellulose is a polysaccharide that makes up the cell walls of plants.

Carbohydrate characteristics: Functional group substitution  •  Figure 2.9 6

− − −

3

H

OH 1

2

+ − − + + −+ S+− + − − −

54  CHAPTER 2  The Biochemistry of Macromolecules

H

NH

CH3 + − − + S + −+ +− + − − −

+ +

HO

CH2OH O 5 H OH H

C

Enzyme + +

  Carbohydrates 40

4

− − −

+

2.3

H

− − −+S+− + +

• Regulating the rate of enzyme activity allows precise control of biochemical processes to conserve host resources. Reaction rate can be influenced by cofactors, coenzymes, and environmental conditions such as temperature and pH. Competitive enzyme inhibition decreases reaction rate because inhibitors compete with the substrate for access to the active site. In noncompetitive enzyme inhibition, inhibitors bind allosteric sites, altering active site shape to prevent substrate entry. When the product of a series of biochemical reactions acts as an allosteric inhibitor of the initial enzyme, the negative feedback inhibition loop regulates reaction rate.

O

2.4

  Lipids 43

• Lipids are a structurally diverse group of compounds, including fats, waxes, and steroids, which are united by their hydrophobic nature. Triglycerides are composed of glycerol and three fatty acids. Phospholipids are structurally similar to triglycerides except that a phosphate group replaces the third fatty acid. Steroids are characterized by their four-ring carbon skeleton. Modification of functional groups in steroid molecules is responsible for their diverse functions. • Triglycerides such as fats and oils serve as energy-storage molecules. Waxes form waterproof protective layers on plant leaves and on the feathers of birds. Phospholipids are amphipathic molecules that form a bilayer that makes up biological membranes, as shown in the diagram. Steroids, such as cholesterol, are also found in the plasma membranes of cells, which controls the passage of molecules out of the cytosol. Other steroids function as hormones, and still others are vitamins.

Phospholipid and steroid structure: A phospholipid bilayer  •  Figure 2.13 Water molecules

2.5

  Nucleic Acids 49

• Nucleic acids are polymers specialized for the storage and transfer of coded information. The nucleic acids are DNA (deoxyribonucleic acid), a double-stranded, helical molecule (shown in the diagram), and RNA (ribonucleic acid), a single-stranded molecule. DNA carries the hereditary information that is passed from one generation to the next in the form of a gene. DNA has the ability to replicate—make copies of itself—through semiconservative replication. The information in DNA is copied into RNA then used to direct protein synthesis.

Nucleic acid structure: Linear structure comparison  •  Figure 2.15

A G T C G C T

T C A G C G A

• Both DNA and RNA are made up of monomers called nucleotides that consist of a nitrogenous base, a pentose, and a phosphate group. Deoxyribonucleotides are structurally slightly different from ribonucleotides. Both DNA and RNA have four types of nucleotides, which differ in the kind of nitrogenous base present, either a pyrimidine or a purine. • When the information in DNA is copied into RNA, the DNA strands separate and one of the strands serves as a template for the formation of a messenger RNA (mRNA) strand. In the bonding between the DNA and RNA nucleotides, C on the DNA bonds with a G ribonucleotide, G bonds with C, and T bonds with A. An A on the DNA strand bonds with a U ribonucleotide. The genetic information that is copied from DNA to RNA during transcription is in the sequence of the nucleotides of these molecules. During translation, the sequence of every three mRNA nucleotides is decoded to a specific amino acid used for protein synthesis.

Summary  55

Key Terms • activation energy (Ea) 35 • active site  36 • adenosine triphosphate (ATP)  51 • allosteric site  39 • amino acid  30 • amphipathic 46 • apoenzyme 37 • carbohydrate 40 • coenzyme 37 • cofactor 37 • competitive enzyme inhibition  38 • constitutive enzyme  37 • cytosol 46 • dehydration synthesis  31 • denaturation 35 • deoxyribonucleic acid (DNA)  49 • dipeptide 32 • enzyme 35 • ester bond  43 • fatty acid  43 • gene 52

• glycerol 43 • glycosidic link  40 • holoenzyme 37 • hydrolysis 31 • hydrophilic 46 • hydrophobic 32 • induced fit  36 • ligand 35 • lipid 43 • messenger RNA (mRNA)  52 • monomer 28 • monosaccharide 40 • negative feedback inhibition loop  39 • noncompetitive enzyme inhibition  39 • nucleic acid  49 • nucleotide 49 • oligosaccharide 41 • peptide bond  32 • phosphodiester bond  50 • plasma membrane  46 • polymer 28

• polypeptide 32 • polysaccharide 41 • prosthetic group  37 • protein 28 • purine 49 • pyrimidine 49 • R group  30 • regulated enzyme  37 • reversible inhibitor  38 • ribonucleic acid (RNA)  49 • ribonucleotide 52 • saturated 44 • semiconservative replication  52 • substrate 36 • template 52 • transcription 52 • translation 53 • triglyceride 43 • unsaturated 44 • wax 47

Critical and Creative Thinking Questions 1. Predict what would happen to the conformation of a protein if five lysines were replaced with alanines. Explain your answer. 2. Succinate dehydrogenase is an enzyme that converts the substrate succinate into the product fumarate. Sodium malonate is a molecule very similar in size, shape, and charge. What will occur if succinate dehydrogenase is exposed to an increasing concentration of sodium malonate?

5. Examine the diagram and use it to identify the amino acid sequences translated from the following mRNA transcripts. Explain this outcome. Transcript #1: AUGCAGCGCGGGACC Transcript #2: AUGCAACGAGGCACA Second position U UUU

3. What is the value for an athlete of carbing-up, or eating a large meal with high carbohydrate content, the night before a major competition?

First position

Tyr (Y)

UGC

Stop

UGA

Stop

UGG

CUU

CCU

CAU

CUC

CCC

CAC

CUA

AUC

Leu (L)

Ile (I)

AUA AUG

GUC GUA GUG

Codon

UCA

CCA

Met

Pro (P)

CAG

ACU

AAU

ACC

AAC

Thr (T)

GCC GCA GCG

AAA AAG

ACG

GAU

GCU Val (V)

CAA

CCG

ACA

GUU

56  CHAPTER 2  The Biochemistry of Macromolecules

UAC UAG

AUU

G

Ser (S)

UAA

Leu (L)

CUG

A

UCC

G UGU

UCG

UUA UUG

C

Phe (F)

A UAU

Ala (A)

GAC GAA GAG

His (H) Gln (Q)

Asn (N) Lys (K)

Asp (D) Glu (E)

U C A Stop Trp (W) G Cys (C)

CGU CGC CGA

Arg (R)

CGG AGU AGC AGA AGG

Ser (S) Arg (R)

GGU GGC GGA GGG

Gly (G)

U C A G U C A G U C A G

Third position

4. Triglycerides and phospholipids have similar structures, with the substitution of a phosphate group for a fatty acid at the third position being the distinguishing difference. Why does this single structural difference prevent triglycerides from serving the same function as phospholipids in building membranes?

U

UUC

C UCU

What is happening in this picture?

Valentina Proskurina/Shutterstock

Protein structure is crucial for its function. When environmental factors denature protein structure, such as the denaturation of ovalbumin when this egg is cooked, a corresponding loss of function usually occurs.

T h i n k C ri ti c al l y 1. What change is caused by the denaturation of ovalbumin? 2. Is this denaturation reversible? 3. Identify a medical condition in which protein denaturation may occur, compromising patient health.

Self-Test (Check your answers in Appendix A.)

1.  Proteins and carbohydrates are_____.

3.  The structure in the diagram is a(n) _____.



a. monomers

a. β-sheet



b. dimers

b. α-helix



c. polymers



c. primary level of protein



d. tertiary structures



d. quaternary level of protein



e. quaternary structures



e. disulfide bridge

2.  What is the R group in the amino acid diagram?

a. H



b. COOH



c. NH2



d. CH3

e. =O H H2N



C

C

CH3

O OH

4.  In which level of protein structure are disulfide bridges found?

a. primary



b. secondary



c. tertiary



d. quaternary



e. All levels of protein structure use disulfide bridges.

Self-Test  57

5.  _____ are the monomers joined with _____ bonds to form proteins.

10.  Review the Clinical Application, and answer this question. In a normal person, excess blood glucose is _____.



a. Nucleotides; phosphodiester



a. removed by the pancreas and broken down



b. Nucleotides; peptide



b. removed by the liver and stored as glycogen



c. Monosaccharides; glycosidic



c. taken up by body cells through the action of insulin



d. Amino acids; glycosidic



d. a and c are correct



e. Amino acids; peptide



e. b and c are correct

6.  Protein denaturation can occur as a result of _____.

a. dramatically increasing the temperature

11. Lipids are a structurally diverse group of compounds unified by their _____.



b. increasing the pH



a. hydrophobic nature



c. altering solute concentration



b. ability to form enantiomers



d. decreasing the pH



c. use as structural material



e. All of these actions can lead to protein denaturation.



d. incorporation of three phosphate groups into each molecule



e. phosphodiester bonds

7. Review What a Microbiologist Sees, and answer this question. What structural change occurs when hair is chemically treated to make it curly?

12.  The membrane structure shown in the diagram is a(n)_____.

a. sugar-phosphate backbone



a. The primary protein structure is destroyed.



b. phospholipid bilayer



b. The intramolecular hydrogen bonding needed to generate an α-helix is blocked.



c. amino acid bilayer



c. The secondary protein structure is altered.



d. double helix



d. Disulfide bridges are broken and re-formed in a new conformation.



e. polysaccharide



e. The quaternary protein structure is modified by the interaction of additional polypeptide units.

8.  Review the Process Diagram, Figure 2.7, and answer this question. Enzyme action in converting substrate to product _____.

a. is highly specific due to precise binding of the substrate to the active site

13.  The chemical structure shown in the diagram is a _____.



b. occurs rapidly because the substrate is in a highly reactive transition state



a. protein



b. nucleotide



c. steroid



d. carbohydrate



e. sugar



c. occurs rapidly because the Ea of the reaction is lowered



d. can occur repeatedly because enzymes are reusable



e. All of these describe enzymatic conversion of substrate to product.

CH3 CH2 CH2 CH3

9.  Cellulose is an excellent structural carbohydrate because _____.

a. its phosphodiester bonds are very difficult to break



b. its beta glycosidic links are very difficult to break



c. its hydrophobic nature attracts surrounding water molecules, reinforcing its structure



d. its extensive branching allows neighboring cellulose molecules to intertwine



e. it has amino groups instead of the hydroxyl groups found in other carbohydrates

58  CHAPTER 2  The Biochemistry of Macromolecules

CH3 CH3

HO

CH

CH2 CH CH3

14. Review The Microbiologist’s Toolbox, and answer this question. What color are the bacteria in a specimen after exposure to carbol fuchsin?

a. The acid-fast bacteria are red; the rest are colorless.



b. The acid-fast bacteria are blue; the rest are colorless.



c. They are all blue.



d. They are all red.



e. They are all colorless.

15. Which of the following statements does NOT apply to DNA structure?

17. The process by which DNA makes an exact copy of itself is _____.

a. transcription



b. translation



c. denaturation



d. semiconservative replication



e. allosteric interaction

18. Review the Microbiology InSight, Figure 2.14, and answer this question. The process by which the genetic information in DNA is copied into RNA is _____, and the process by which the genetic information is RNA is used to make proteins is _____.



a. DNA nucleotides contain the pentose deoxyribose.



b. The nitrogenous base in a DNA nucleotide is adenine, ­uracil, guanine, or thymine.



a. translation; transcription



b. transcription; translation



c. DNA is a double-stranded, helical molecule.



c. transcription; replication



d. The backbone of a DNA molecule is composed of sugars and phosphate groups.



d. replication; translation



e. translation; replication



e. All of the statements accurately describe the structure of DNA.

19. The genetic information of DNA is specifically encoded in its _____.

16.  The parts of a nucleotide in the diagram are_____.



a. sugar–phosphate backbone



a. glucose, pentose, and RNA



b. phosphodiester bonds



b. phosphate group, glucose, and base



c. nucleotide sequences



c. purine, pyrimidine, and base



d. amino acid sequences



d. phosphate, purine, and pyrimidine



e. quaternary structure



e. pentose, phosphate group, and base

20.  The genetic information in DNA is copied into_____.

a. amino acids



b. nucleotides



c. phosphate groups



d. messenger RNA



e. nitrogenous bases

Self-Test  59

3

Microscopy

The eye of a giant waterflea, Leptodora kindtii. This image of a living specimen magnified 160 times was taken using a differential interference contrast microscope.

THE EYES OF MICROBIOLOGY

M

icroscopes give us a window into the microbial world, allowing us to see organisms that are otherwise invisible to us. Some of the organisms we see through the lens of a microscope are unlike anything we find in the macroscopic world. In an ordinary pond, there are invisible grasslands of algae that are grazed by protozoans. These, in turn, may be stalked and engulfed by predatory, microscopic crustaceans, such as the giant waterflea shown in

Wim van Egmond/Science Source Images

the photo. These ecological relationships are merely several among myriads in the hidden world of microorganisms. In this chapter, you will learn about different kinds of microscopes ranging from compound light microscopes, such as those typically used in a microbiology laboratory, to highly sophisticated electronic instruments that can magnify images millions of times.You will also learn the basic techniques for preparing specimens for microscopic examination. Because many microorganisms are transparent, this requires the application of colorful dyes. Not only does staining make it easier to visualize many microbes, but some stain protocols can distinguish bacteria genera by highlighting cell wall differences or the presence of special features associated with pathogen virulence.

CHAPTER OUTLINE 3.1 Principles of Microscopy  62 • Magnification • Resolution 3.2 Microscopy Used for Clinical Diagnosis  65 • Bright-field Microscopy • Dark-field Microscopy • Fluorescence Microscopy ■ The Microbiologist’s Toolbox:The Direct Fluorescent Antibody Assay 3.3 Microscopy Used for Research Investigations  68 • Light Microscopy ■ What a Microbiologist Sees: Differential Interference Contrast Microscopy • Electron Microscopy • Nanoprobe-based Microscopy 3.4 Specimen Preparation and Staining  72 • Basic Staining Procedures ■ Case Study: Diagnosing Gonorrhea Using Gram Staining ■ Clinical Application: Diagnosing Tuberculosis Using Acid-fast Staining • Special Staining Procedures

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 62 ❑ p. 65 ❑ p. 68 ❑ p. 72 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

Analyze key features

❑ Microbiology InSight, p. 63 ❑ The Microbiologist’s Toolbox, p. 67 ❑ What a Microbiologist Sees, p. 70 ❑ Process Diagram, p. 73 ❑ ❑ Case Study, p. 74 ❑ Clinical Application, p. 75 ❑ Stop: Answer the Concept Checks before you go on. p. 64 ❑ p. 68 ❑ p. 72 ❑ p. 76 ❑

GI/Tom Grill/Getty Images

End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What is happening in this picture? ❑ Complete the Self-Test and check your answers.

 

61

3. 1

Principles of Microscopy

LEARNING OBJECTIVES

1. Explain how microscopes magnify.

2. Describe the factors that affect the resolution of an image.

T

he field of microbiology is a relatively new discipline compared with biology, the general study of living things. It was not until the mid-1600s that the first unicellular organisms were observed. The diameter of a typical Staphylococcus bacterial cell is approximately 1 μm, which is only one-millionth (10−6) of a meter (see Remember This! ). It must be magnified about 1000× to be clearly visible. This magnification required the technical expertise to make high-quality lenses (Figure 3.1). In addition, someone had to be curious enough to magnify objects and then recognize living organisms where none were expected to exist. Remember This!  To familiarize yourself with the metric measurements used in biology and to gain a better perspective of microbe size, review Figure 1.1.

In the past several decades, the field of microscopy has continued to advance, and scientists can now image molecules in their natural states and even view their participation in chemical reactions. Microscopes are both routine tools in clinical and teaching labs and also dynamic, magnification The cutting-edge research instruratio of the size of the ments. In this section, you will image to the size of learn about the basic principles the object. of microscopy and how different kinds of clinical and research mi- resolution The croscopes work. As described in degree to which a the next sections, the two quali- microscope is able ties necessary for a microscope to produce separate to form a useful image of a small images of objects object are magnification and that are very close together. resolution.

A history of microscopy • Figure 3.1

The first compound microscope is thought to have been invented by Dutch spectacle makers Hans and Zacharias Jansen. 1590

1665 1676

Science Source Images

British scientist Robert Hooke published his Micrographia, in which he first used the term cells to describe plant cells, such as these cork cells, which he thought looked similar to the small rooms monks stayed in.

1850s

Birgit Reitz-Hofmann/ Shutterstock



Nuclear pore complex

Ernst Ruska developed the electron microscope, which uses a beam of electrons, rather than light, to produce a magnified image, achieving magnification of up to about 10 million times.

Eric Betzig, Stefan Hell, and William Moerner received the 2014 Nobel Prize in Chemistry for developing the stimulated emission depletion (STED) form of super-resolved microscopy, which allows biologists to visualize individual molecules within living cells.

1931

2014

By the mid-1800s compound light microscopes were of similar design and could produce an image the quality of which was nearly that of most of today’s compound light microscopes.

1986

Gerd Binnig and Heinrich Roher received Nobel Prize in Physics for their development of the scanning tunneling microscope, which is capable of imaging individual atoms.

A sk Yo u rs e l f When did compound light microscopes become about as good as they are today? a. in the mid-1600s  b. in the mid-1700s  c. in the mid-1800s  d. in the mid-1900s

Image courtesy of IBM Research–Zurich

”Jaansen Microscope” by Alan Hawk, National Museum of Health and Medicine

Dr. Jeremy Byrgess/ Science Source Images

The Dutch microscopist Antonie van Leeuwenhoek crafted his own lenses, which are thought to have been able to magnify up to 500 times. He is considered the father of microbiology for making the first observations of single-celled organisms, which he called animalcules.

Reprinted from Biophysical Journal, Volume 105 issue 1, L01-L03, (July 2013). Göttfert et al.,

Tom Hollyman/Science Source Images

Over the centuries, microscopy developed as a scientific field as biologists investigated tissues and microorganisms and as technological developments produced more powerful and more precise microscopes that use subatomic particles rather than light to produce an image.

Microbiology InSight  Using a compound light microscope 

b. Magnification is determined by dividing the image size by the object size. Although these two images are a similar size, the deer tick has been magnified 9.6 times and the Paramecium has been magnified 110 times.

1.1

1

0

Actual size (μm)

200

▲ a. A compound light microscope focuses light on the specimen through a condenser lens. Both the objective and ocular lenses magnify the specimen. An iris diaphragm, which has an opening of adjustable size, controls the light intensity.

Image size 10 mm 2.2 cm = = 9.6X Actual size 1 cm * 2.3 mm

Paramecium caudatum, a microbe found in pond water

100

0

Object outlined Low resolution of with large balls image of object

2.2

1.1

0

Image size (cm)

Lenses magnifying image and focusing light on specimen

0

M. I. Walker/Science Source Images

Magnification =

Illuminator

Compound light microscope

A female deer tick (Ixodes), the tick that carries the Lyme disease pathogen 2.2 2 Image size (cm)

Actual size (mm)

Ocular lens

Objective lens Stage to hold specimen Iris diaphragm Condenser lens

✓ The Planner

Kent Wood/Science Source Images

Microscopes must both magnify a specimen and clearly resolve the image to be effective tools for a microbiologist.

•  Figure 3.2

Wavelength Red

▲

Magnification = Image size == 10,000 μm * 2.2 cm == 110X Actual size 200 μm 1 cm

Violet

Object Wavelength Object outlined Higher resolution with small balls of image of object

Magnification Because by definition microorganisms are too small to see with our eyes alone, we must magnify them to view them. Light microscopes use different types and numbers of lenses to produce a magnified image of the specimen. A compound light microscope (Figure 3.2a) uses a condenser lens to focus light onto a specimen and the iris diaphragm adjusts the intensity of the light reaching it. Light passing through the glass microscope slide and thin specimen next enters an objective lens. The curvature of this lens bends, or refracts, the light, magnifying the

c. The wavelength of light affects the resolution of the magnified image. Shorter wavelengths give a clearer image. In a simple analogy, outlining an object with different-sized balls creates an image; the smaller the balls, the clearer the representation of the object’s outline.

In t e r p r e t t h e Da t a If the image of the Paramecium is 15 cm in height, what is the magnification of the object?

specimen. A small mirror redirects the light through the ocular lens, where it again bends and magnifies the specimen before it is directed to the eye for image viewing. Because magnification is determined by the degree of lens curvature and the physics of how light refracts when it passes from one medium to another, there are physical limits on how much an object can be magnified using a single glass lens and a visible light source. The maximum practical limit is approximately 400×, where × is the ratio of the image size divided by the actual size of the object (Figure 3.2b). Given the technology of the 17th Principles of Microscopy  63

century, it was amazing that Antonie van Leeuwenhoek was able to make a handmade, single-lens m ­ icroscope with the ability to magnify 300× and see bacteria and protozoans. The modern compound microscope enhances magnification by increasing the number of lenses used. In determining magnification with a compound microscope, the total magnification is that of the objective lens multiplied by that of the ocular lens. As a result, there is a significant increase in total magnification.

Resolution A second key property for microscopes is the resolution, or clarity, of the image. Simply increasing magnification without also producing a clearer image does not provide any additional detail, regardless of the larger size. To increase image resolution with a light microscope, it is important to understand the wavelike nature of light. White light is composed of seven colors of light, each of which is characterized by different wavelengths, the distance from one crest to the adjacent crest. From the longest to the shortest wavelengths, these colors are: red, orange, yellow, green, blue, indigo, and violet light. Resolution, or resolving power (RP), can be quantified by the formula RP = 𝜆/2NA, where 𝜆 is the wavelength of light used and NA is the numerical aperture of the lens system, a measure of light r­ efraction by the lens system. The RP of a microscope is directly related to the wavelength refraction The bending of light of light used (Figure 3.2c). when it passes Short wavelengths improve imfrom one medium age detail; therefore, the clarity into another of the image can be enhanced medium of different by using a violet filter, which procomposition. vides a shorter wavelength light source. The resolution limits of refractive a light microscope determined index A quantitative by the nature of light and by the measure of the glass lenses are about 0.2 μm. In bending of a ray other words, structures that are of light as it passes separated by less than 0.2 μm apthrough the interface pear as a single structure. between two media with different Resolution is also affected compositions. by characteristics of the lens system that include the refractive index of the medium that the light is passing through. The greater the refractive index, the better the RP and the greater the amount of detail that can be seen in the image. Consequently, magnification and

1. How do you calculate the total magnification of a compound microscope?

resolution can be increased by immersion oil A placing immersion oil on the transparent oil with a slide and using an oil immersion refractive index that objective lens (Figure 3.3). The is approximately the immersion oil has the same refrac- same as the glass in tive index as glass, which means the microscope slide that the light passes directly into and objective lens. the objective lens without refracting away and being lost. Because the refractive index of immersion oil is approximately 50% greater than that of air, adding immersion oil to a slide and using an immersion oil lens can increase both the magnification and the resolution of a light microscope. The magnification of a microscope increases from approximately 450× to approximately 1000×, with a proportional increase in image resolution.

Oil immersion • Figure 3.3 The use of immersion oil works because the refractive index of the oil is the same as the glass in the slide and objective lens. Oil immersion lenses reduce refractive light loss and allow enhanced resolution with higher magnification. Microscope objective lens

Lens

Refracted and reflected Coverslip light rays lost to lens

Air

Oil

Unrefracted light rays enter lens

Slide Specimen Light source

A sk Yo u r se lf The light path, in order, from the source to the objective lens of the microscope is through the_____ . a. slide, oil, specimen, cover glass, air, lens b. slide, specimen, air, cover glass, oil, lens c. slide, specimen, cover glass, oil, lens d. slide, specimen, cover glass, lens, oil

2. Why is the resolving power of a microscope as important as its magnification?

3 .2

Microscopy Used for Clinical Diagnosis

LEARNING OBJECTIVES 1. Describe the different kinds of bright-field microscopes and their clinical applications.

2. Explain how dark-field microscopy works. 3. Explain how fluorescence microscopy works.

or practical purposes, we can categorize microscopes into two functional groups: those used primarily for clinical diagnosis and those used primarily for research purposes. Clinical microscopes are designed for quick analysis of a specimen to aid in disease diagnosis. They give instant images of the microorganism being viewed; they do not require highly specialized facilities or technicians to run and maintain them, and specimens can be quickly prepared for viewing. Because of these requirements, various kinds of light microscopes are the preferred tools for microbial diagnostics in clinical settings (Table 3.1).

bacterial external structures. Bright-field microscopy is also used for the identification of eukaryotic pathogens. Viewing fungal reproductive structures and protozoan cellular morphology allows for pathogen recognition. Bright-field microscopy has a few disadvantages. Although some microbes have a natural color, such as the green pigment found in photosynthetic algae, many microorganisms are transparent. Therefore, staining is often required to give the specimens enough contrast to be seen. However, staining has the potential to alter the structure of the microbe, so it is a possible disadvantage to the process. Bright-field microscopy also has limits for magnification and resolution. Light microscopes used in clinical microbiology labs can produce sharp images at magnifications up to approximately 1000×. This means that a 10-μm eukaryotic microbe, such as a mold or a protozoan, would appear to be about 10 mm in size or roughly the diameter of a dime. A 1-μm bacterium would have an image size of 1 mm or about the tip of your pen. The image of a 0.10-μm virus would be only 0.10 mm in size, which is too small to see. This simple analysis shows that with light microscopy, the images of very small specimens can show only a limited amount of detail of eukaryotic cell anatomy or bacterial morphology.

F

Bright-field Microscopy Bright-field microscopy, the first type of microscopy

students learn, is simple to use (Figure 3.4a) and appropriate for most disciplines bright-field requiring microscopic investimicroscopy A type gation. In clinical microbiology of light microscopy in labs, it is routinely used to exa­ which light is passed mine specimens, such as stained through a specimen bacteria, to determine their overthat is stained to proall morphology. Special staining vide contrast. techniques are used to highlight

A comparison of microscopy commonly used in clinical diagnosis  Table 3.1 Type of clinical microscopy

Principles

Advantages/disadvantages

Bright-field microscopy

Bright-field microscopy is the simplest, most common type of microscopy. Light transmitted from below the specimen results in the bright-field background.

Bright-field microscopy is easy to use, but specimens must usually be thin, fixed, and stained to provide contrast.

Dark-field microscopy

Dark-field microscopy produces a bright image against a dark background. An opaque disk blocks the light source from directly entering the objective lens. Light scattered off the surface of the specimen is refracted into the objective lens and forms an image of the specimen.

Dark-field microscopy allows visualization of live and hard-to-stain specimens, but generally only highlights surfaces of microorganisms.

Fluorescence microscopy

Fluorescence microscopy produces an image by exciting fluorescent molecules within the sample. The molecules absorb energy from the ultraviolet light and reemit it in the visible wavelength, making the fluorescent portions of the specimen visible.

Fluorescence microscopy can be used as a highly sensitive diagnostic tool when fluorescent dyes are coupled with monoclonal antibodies. Visualization of specimens is limited to fluorescent molecules within the specimens.

Microscopy Used for Clinical Diagnosis  65

Microscopy commonly used in clinical microbiology • Figure 3.4 The different kinds of microscopes used in clinical microbiology laboratories can produce images of a wide variety of pathogenic microbes.

a. Bright-field microscopy The light source provides a bright background. Glass lenses (objective and ocular lenses) magnify the image of the specimen. Specimens are stained to provide the contrast needed for visualization.

b. Dark-field microscopy An opaque disk between the light source and condenser lens blocks light from directly entering the objective lens and creates a dark background. The condenser lens and mirrors allow light to be refracted off specimen surfaces and enter the lenses to be magnified.

c. Fluorescence microscopy After the visible light source is turned off, an ultraviolet (nonvisible) light source is used to excite fluorescent molecules in the specimen, which absorb energy and reemit it as visible light.

Eye

Eye Eye

Ocular Ocular lens Ocular lens lens

Eye

Science Source Images

Scott Camazine/Phototake

Eye of Science/Science Source Images

Borrelia burgdorferi Yersinia pestisYersinia Borrelia burgdorferi Borrelia burgdorferi Yersinia pestispestis Staphylococcus aureus Staphylococcus Staphylococcus aureus aureus

Eye Eye

Eye Eye Visible light from Visible light from Visible light from fluorescent specimen fluorescent specimen fluorescent specimen Ocular Ocular lens Ocular lens lens Exciter Exciter filter Exciter filter filter

Eye

Ocular Ocular lens Ocular lens lens

UV Objective Objective lensObjective lens lens

Specimen

Specimen Specimen

Objective Objective lensObjective lens lens

Specimen

Specimen Specimen

Ultraviolet Ultraviolet Ultraviolet UV UV (nonvisible) (nonvisible) (nonvisible) light source light source light source

Objective Objective lensObjective lens lens

Specimen

Specimen Specimen

Condenser Condenser lens Condenser lens lens

Condenser Condenser lens Condenser lens lens Opaque Opaque disk Opaque disk disk

Condenser Condenser lens Condenser lens lens

source Light source Light Light source

source Light source Light Light source

source Light source Light Light source

Th in k Cr it ica lly Why is the background dark in fluorescence microscopy?

Dark-field Microscopy Dark-field microscopy was named for the

black background that surrounds the illuminated specimen. A dark-field microscope has a black disk that blocks the light from passing directly through the specimen and entering the objective lens. The specimen is seen against the black background because some light is reflected off surfaces of the specimen into the objective lens (Figure 3.4b).This type of microscopy was traditionally used to

66  CHAPTER 3  Microscopy

dark-field microscopy A type of light microscopy in which light coming from an angle is scattered off the specimen and reflected into the objective lens so that the image appears light against a dark background.

produce images of very thin bacteria, such as Treponema pallidum, the causative agent of syphilis. Such microbes are difficult to see using bright-field microscopy and show better against a dark field. The advantages of dark-field microscopy are that it doesn’t require staining of the specimen, it can be used on live specimens, and it allows visualization of very thin organisms. The disadvantage is that it only provides an image of specimen surfaces that refract the light.

Fluorescence Microscopy

fluorescence microscopy A type

by directly binding fluorescent dyes to molecules within the specimen or by conjugating, or attaching, them to other substances that bind microscope combined with a laser that pro- of light microscopy molecular targets within the microbe. Fluoduces ultraviolet light. Initially, the specimen used for the examirescent dyes are often attached to antibodies, is viewed with white light using typical bright- nation of naturally fluwhich are proteins produced by cells of the imfield microscopy. The light is then turned off orescent specimens mune system and capable of binding to precise and the ultraviolet light source is activated. or specimens stained with fluorescent dyes. targets. Monoclonal antibodies are antibodies Where necessary, the specimen is treated with identical target specificity and binding afwith a fluorescent dye that absorbs ultraviolet finity resulting from special manipulations of immune light energy and reemits light in the visible wavelength cells being grown in the laboratory. These highly spe(Figure  3.4c). Because the source of visible light is cific monoclonal antibody–dye conjugates can be used turned off, the fluorescent portion of the specimen as identification tools in diagnostic microbiology, as with glows brightly against a dark background. With thick the direct fluorescent antibody (DFA) assay (see The specimens, not all of the fluorescing molecules are in the same plane, and the image may appear blurry. Microbiologist’s Toolbox) when they bind to specific pathoSome microbial specimens naturally contain fluogens and fluorescently signal their presence. Fluorescein rescent molecules and autofluoresce. Others must be and rhodamine are two of the most commonly used fluostained with fluorescent dyes. This can be accomplished rescent dyes and glow green and red, respectively. Fluorescence microscopy uses a bright-field

T he M icrobiologist ’ s T oolbo x

✓ The Planner

The Direct Florescent Antibody Assay Compound light microscopes can be used to identify viruses and bacteria smaller than 0.2 μm in size—below the normal limits of visualization. This is accomplished with a DFA assay, which uses a monoclonal antibody bound to a fluorescent dye (Figure a). After the specimen has been firmly fixed to the slide, it is stained with a fluorescent dye conjugated with monoclonal antibody. The slide

a.

b.

Rabies virus

is then rinsed with buffer (Figure b). If the pathogen is present in the specimen, the antibody will remain bound to the slide; otherwise, it will be washed off by the buffer. The presence of the pathogen, even one that is too small to be seen by itself, can be detected by the appearance of glowing dots in the specimen when it is viewed under a fluorescence microscope (Figure c). A specimen containing tissue infected with rabies virus is fixed to the slide.

Monoclonal antibody Fluorescent dye

Unique protein

The specimen is stained with the fluorescent monoclonal antibody. The slide is rinsed with buffer.

Rabies virus tagged with fluorescent antibody

The slide is examined using a fluorescence microscope.

A sk Yo u r se lf

courtesy Los Angeles County Public Health Laboratory

c.

DFA showing rabies-positive brain sample

How does a DFA assay allow the detection of some microbes that are normally too small to see with a light microscope? a. It makes the specimens large enough to be seen without a microscope. b. It causes them to fluoresce under a fluorescence microscope. c. It turns them a bright red so they are visible. d. It causes them to precipitate out of solution.

Molecular biologists have combined recombinant DNA technology, a bioluminescent protein isolated from a jellyfish, and fluorescence microscopy to analyze molecular processes in cells. Green fluorescent protein was isolated from the Pacific Ocean jellyfish Aequorea victoria. It has since been genetically engineered

to fold and be photostable at 37°C, making it a useful tool for molecular biologists to monitor protein expression and localization in living cells. Color variants of green fluorescent protein have even allowed researchers to evaluate interactions between proteins within living cells.

1. What is one disadvantage of bright-field microscopy? 2. What advantages does dark-field microscopy have compared with bright-field microscopy?

3. How are monoclonal antibodies used with fluorescence microscopy?

Microscopy Used for Research Investigations 3. 3

LEARNING OBJECTIVES 1. Identify the different types of light microscopy used for research, describing for each the principle of image production and the benefits provided. 2. Compare and contrast transmission and scanning electron microscopy image production and the advantages/disadvantages of each method.

3. Explain how the use of a nanoprobe in scanning tunneling microscopy and atomic force microscopy can generate detailed images at the molecular level.

esearch microscopy can be extremely complex and push the limits of technology. These microscopes are used to investigate the structure and function of living things in the greatest possible detail; they are also used in chemistry and physics investigations. Research microscopes can be classified according to how they generate a magnified image. Light microscopes use visible light and glass lenses to magnify the image of a specimen. Electron microscopes use an electron beam instead of light and electromagnets instead of glass lenses to achieve much greater magnification and resolution than light microscopy. Nanoprobe microscopes use extremely fine probes to scan the surface of a specimen. The movement of the probes generates an image of the specimen surface. These microscopes and their advantages and disadvantages are introduced in Table 3.2.

types of even more specialized light microscopes have­ additional advantages for examining living specimens. Confocal microscopy was developed to correct a limitation of fluorescence microscopy. With fluorescence microscopes, the entire specimen is illuminated, with ultraviolet light causing all fluorescent molecules in the microscopic field to glow whether they are in the focal plane or not. Confocal microscopes illuminate an image one focal plane at a time and then reassemble the combined images into a three-dimensional picture. Super-resolution microscopy is a kind of fluorescence-based light microscopy in which the resolution limit of 200 nm in typical light microscopes is lowered to less than phase contrast 10 nm. Extending fluorescence microscopy A type microscopy to achieve extremely of light microscopy sharp resolutions depends on criti- in which changes cal properties intrinsic to some in the phase of light passing through a fluorescent molecules. Other microscopes, such as transparent specithose used in phase contrast men are converted to changes in brightmicroscopy, convert differences ness of the image. in refractive indices found in

R

Light Microscopy The basic types of bright-field, dark-field, and fluorescence microscopes discussed in the prior sections are also used for research investigations. However, several other

68  CHAPTER 3  Microscopy

A comparison of research microscopy  Table 3.2 Type of research microscopy

Principle

Advantages/disadvantages

Confocal microscopy

Generates three-dimensional images by assembling scanned regions in different focal planes using fluorescence microscopy.

Fluorescent dyes can be used to visualize a threedimensional image of an entire microbe or the dyes can be linked to other molecules to bind to a specific microbial structure to analyze its organization.

Super-resolution microscopy

Two closely spaced fluorescent sources are imaged separately. The separate images are then reassembled in a computer to circumvent the diffraction limit.

Super-resolution microscopy has an advantage over other types of light microscopy because of its greater image resolution. It also has advantages over electron microscopy in that it allows the analysis of whole, or live, cells.

Phase contrast microscopy

Enhances the contrast of structures of cells without staining by converting differences in refractive indices to differences in light intensity.

Living microbes can be seen without the risk of altering their structure as a result of staining.

Differential interference contrast microscopy

Enhances contrast of cells without staining by converting differences in refractive indices to differences in color by using prisms and multiple light beams.

Details of living specimens can be seen in color without staining and have a three-dimensional appearance.

Transmission electron microscopy

An electron beam passes through an ultrathin specimen and is focused by electromagnetic lenses to provide extreme magnification and detailed resolution. Images can be seen on a on a phosphorescent screen or viewed with a specialized camera.

Transmission electron microscopy can provide high magnification and resolution to reveal the ultrastructure of microbes. Transmission electron microscopes require extensive, expensive sample preparation before slicing into ultrathin sections.

Scanning electron microscopy

An electron beam scans the surface of a specimen to produce a three-dimensional image of the specimen. Electrons that are scattered off the surface are captured and converted to a three-dimensional– appearing image of the specimen.

A scanning electron microscope provides a threedimensional view of surface anatomy and can relatively quickly scan large areas of a specimen. Scanning electron microscopy requires extensive, expensive specimen preparation.

Scanning tunneling microscopy

An electrically charged nanoprobe is scanned over the surface of a metal-coated specimen to measure the changes in voltage, which are then processed to produce an image.

The extreme high resolution for scanning tunneling microscopes makes it possible to image individual atoms within materials.

Atomic force microscopy

An atomic force microscope uses a probe that is scanned over the surface of a specimen, and very small displacements of the probe, which are magnified by a laser, deflect off the probe’s surface. The magnified laser signal is collected and processed by a detector to construct an image.

Atomic force microscopes can observe biological specimens directly without extensive sample preparation that may introduce artifacts. The process of scanning a sample is slow, and the sampling area is small relative to scanning electron microscopy.

different parts of living specimens into differences in light intensity or color, making the normally transparent living specimens easy to see. Phase contrast ­microscopy changes differences in the refractive index of light as it passes through a specimen into differences in light intensity by using specialized filters. This occurs because

the waves of light passing through the specimen and the background light waves are now out of sync with one another. When the crests and troughs of light rays do not align, they have undergone a phase shift. As a result, structures inside of cells are seen without the staining needed in typical bright-field microscopy. Microscopy Used for Research Investigations   69

What a Microbiologist Sees ✓

The Planner

Differential Interference Contrast Microscopy This micrograph shows a detailed image of a ciliated protozoan called a Stentor. The image has pseudo three-dimensional relief shading (Figure a), so a microbiologist will recognize that it was made with a differential interference contrast (DIC) microscope. A DIC microscope can produce a high-contrast image of what would be a transparent biological specimen when

viewed with a bright-field microscope. This can be accomplished because, as light passes through a living specimen, there are changes in the phases of the light rays. Microbiologists also consider the physical characteristics, including the size of a specimen, to determine what general type of microorganism they are observing (Figure b).

a.  DIC micrograph of Stentor, a trumpet-shaped protozoan commonly found in freshwater lakes and streams

b.  Size ranges of viruses, microorganisms, and cells 10 nm

100 nm

1 µm

10 µm

100 µm

1 mm

Scale

Graham Matthews

Algae-containing vacuole

50 μm

Typical size range

Viruses

General rule

~100 nm

Bacteria

Protozoans Plant and animal cells

~1 µm

~10+ µm

Food vacuole

In t e r p r e t t h e Da t a Peristome cilia to sweep food into oral groove

Differential interference contrast microscopy converts differences in refractive index to different colors of light using prisms to provide contrast without staining; however, the image it generates is more three-dimensional (What a Microbiologist Sees).

Electron Microscopy Electron microscopes differ from light microscopes in that they use an electron beam and electromagnetic lenses rather than visible light and glass lenses. Electron microscopes can produce images of cell organelles and viruses, structures not ordinarily visible with light microscopes. In principle, the functioning of an electron microscope is analogous to that of a light microscope (Figure  3.5a and Figure 3.5b), with the electron beam replacing visible light. Because the wavelength of the electron beam is about 100,000× shorter than visible light, the detail in an image from an electron microscope is much greater than that from a light microscope (see the micrographs with

70  CHAPTER 3  Microscopy

1. Estimate the size of the Stentor. 2. What is the approximate size of the algae-containing food vacuole?

Figures 3.5a and b). Magnetic lenses bend the electron beam in the same manner as glass lenses bend the light in a light microscope. However, magnification is much greater with an electron microscope—up to 50 million times. Because electrons cannot be seen with a human eye, an image is produced on a phosphorescent screen or photographic plate. Images can also be processed through a chargecoupled device camera. The camera converts incoming photons to electrical charges, which are then processed into high-quality digital images. Microbiology researchers use transmission electron transmission electron microscopy (TEM) to investigate the ultrastructure of microbes be- microscopy cause their features are too small (TEM) A type of to see with a light microscope. electron microscopy The primary disadvantage of elec- in which the electron tron microscopy is that the sample beam passes through a very thin preparation is extensive and exspecimen. pensive. The biological specimens

A comparison of electron microscopy and light microscopy • Figure 3.5 Transmission electron microscopes operate on principles analogous to light microscopes, but offer the greater resolution needed to produce images of the smallest microbes, including viruses, bacteria, and protozoans, such as Plasmodium (shown in the micrographs). Scanning electron microscopes combine high magnification and resolution with three-dimensional surface detail.

Dr. Cecil H. Fox/Science Source Images

a. Bright-field microscopy In bright-field microscopy, a condenser lens focuses the light on the specimen, and light passes through the specimen. Magnification of the image occurs when visible light is refracted as it passes through the objective and ocular glass lenses.

b. Transmission electron microscopy In transmission electron microscopy, a magnetic condenser lens focuses the electron beam on the specimen, and the beam passes through the very thin specimen section. Magnification occurs when a pair of electromagnetic lenses (the condenser and objective lenses) alters the path of the electron beam.

c. Scanning electron microscopy In scanning electron microscopy, the electron beam moves over the surface of the specimen rather than passing through it. The photomultiplier detects secondary electrons scattered off the surface of the metal-coated specimen, which are processed using a computer algorithm into a three-dimensional image visible on the view screen.

Electron gun generating a beam of electrons

Light micrograph of Plasmodium-infected erythrocytes

Electromagnetic condenser lens Specimen

Electromagnetic lenses

Electromagnetic objective lens

Scanning circuit

Eye

Ocular lens

Projector lens

Primary electrons View screen Photomultiplier

Secondary electrons

Metal-coated specimen

View screen

Condenser lens

Light source

TEM of Plasmodiuminfected erythrocytes

Juergen Berger/Science Source Images

Specimen

Dr. Tony Brain/Science Source Images

Science Source Images

Objective lens

Freeze fracture TEM of Plasmodium-infected erythrocyte

SEM of Plasmodium-infected erythrocytes

Pu t I t To g e ther

Review Section 3.2 Microscopy Used for Clinical Diagnosis, and answer this question. Transmission electron microscopes can be useful in clinical diagnosis because of _____. A disadvantage of the technique is that it requires _____.

must be ­stabilized by chemically crosslinking molecules together before slicing them into ultrathin sections using a diamond knife (Figure 3.5b). Contrast is imparted to the specimen by staining with harsh chemicals such as osmium tetroxide, uranyl acetate, and lead acetate. Some TEM specimens undergo cryofixation, in which the specimen

is frozen. After freezing, specimens are fractured to reveal internal structures, such as membranes and proteins. The frozen sample typically fractures at and between phospholipid bilayers. Once fractured, the specimen is coated with metal, which allows it to be viewed and to provide an analysis of the membrane surfaces (Figure 3.5b). Microscopy Used for Research Investigations   71

Scanning electron microscopy (SEM) produces a three-dimensional image of a specimen (Figure 3.5c). Electrons scattered off the specimen surface are recorded by a secondary receptor that converts the properties of the signals received to differences in light intensity to give a topographical image of the specimen.

Nanoprobe-based Microscopy

scanning electron microscopy (SEM) A type of electron microscopy in which an electron beam moves over the surface of a specimen and the electrons that are reflected off the specimen are measured by a detector to generate an image that appears threedimensional.

Nanoprobe microscopes produce images with a probe that moves over the surface of the specimen. As the probe travels up and down over the surface, its movement is recorded and used to generate an image of the specimen’s surface. Nanoprobe microscopes use extremely small diamond- or metal-tipped probes. The tips are only 1–50 nm in diameter and come to a point, which in some cases is only one molecule in size. Nanoprobe microscopes can magnify objects hundreds of millions of times, allowing them to form images of even single molecules (Table 3.2). Scanning tunneling microscopy (STM) (Table 3.2) uses electrically charged nanoprobes that move near the

3. 4

metal-coated surface of a specimen. As the probe passes over the surface, there are small changes in voltage that are processed to produce an image with extreme magnification and resolution. The charge associated with the probe can even be used to manipulate atoms and arrange them on a surface. Atomic force microscopy (AFM) uses a fine-tipped probe that is dragged across the surface of a specimen, such as a protein. The extremely small movements of the probe are amplified to produce an image. The heights of various structures can be differentiated by color-coding portions of the image.

1. Which light microscopes used for research use fluorescent dyes? 2. Which forms of electron microscopy provide three-dimensional images? 3. Which forms of microscopy can visualize individual molecules?

Specimen Preparation and Staining

LEARNING OBJECTIVES 1. Describe the preparation and basic staining techniques used to make a slide of bacterial specimens. 2. Describe special staining techniques and how they are used. living specimen can be quickly prepared for viewing by suspending it in a suitable medium (water, buffer, or growth medium) on a glass microscope slide and placing a coverslip over it. Viewing living specimens allows microbiologists to observe their movements, feeding, and responses to stimuli. Some microbes are so large that a cover slip can damage them. Such microbes are viewed using the hanging drop method, in which a drop of liquid is suspended under a coverslip that is then placed on a depression microscope slide, which has a dip in the center so that the drop hangs free. The first step in preparing microbial cells for staining is making a smear. A suspension of bacterial cells is applied to a microscope slide, gently spread over the surface using an in oculating loop, and allowed to air

A

dry. To prevent the cells from being washed off, they are fixed to the slide surface by a process that denatures their proteins, making them sticky. Bacterial proteins are denatured either by passing the slide quickly over the flame of a Bunsen burner or by dipping the slide in 95% methanol. After fixation, the microbes can be stained with dyes appropriate for analysis.

Basic Staining Procedures Most microbial specimens are nearly transparent and thus need to be stained before being viewed using brightfield microscopy. Dyes used for staining microbes are organic compounds that have different colors and may have different affinities for specific cell structures.

Simple staining  Simple staining involves using a single dye to color the microbe. The chemical properties of the dye determine its color and the parts of the microbe it stains. In positive staining, the dye stains molecules within the microbe, making it visible against the clear background. Dyes used to directly stain cellular microbes are usually salts composed of charged, colored ions. If

the colored ion is positively charged in solution, the dye is considered a basic stain and will adhere by weak ionic bonds to the negative charges on the DNA and the surface proteins of the cells. Methylene blue and crystal violet are basic dyes commonly used to stain bacteria. Bacterial surfaces are typically negatively charged because of the associated acidic carbohydrates and glycoproteins. Because of repulsion from like ionic charges, acidic dyes can be used to stain the background around the bacteria without staining the organism. This technique is known as negative staining because the microbe appears clear against a darkly stained background. Nigrosin is a black dye used as a negative stain for bacteria. Negative staining is also used to help identify capsules around eukaryotic microbes such as the pathogenic yeast Cryptococcus neoformans.

Differential staining  Differential staining differs from simple staining in that it requires the application of multiple dyes. The combination of dyes is used to differentiate one cell type or cellular structure from another. Differential staining technique first colors all of the cells using a primary dye. Only cells with specific wall features will retain the primary dye when the specimen is treated

with a decolorizing agent. Application of a secondary stain or counterstain provides color to decolorized cells. As a result, one type of cells is stained the color of the primary stain and the other type is stained the color of the counterstain.This technique allows the two cell types to be easily distinguished under the microscope. The Gram stain is the most commonly used differential stain in microbiology. The Gram-staining procedure was discovered by accident by Hans Christian Gram in 1884. It Gram stain A was soon realized that the proce- method for differential dure distinguished between two staining that distinbasic types of bacteria. Bacteria guishes between with thick layers of peptidoglycan bacteria with a thick in the cell wall stain purple and peptidoglycan layer are called gram positive. Bacteria in their cell walls and with thin layers of peptidoglycan those with a thin layer. in the cell wall and an outer membrane stain red and are called gram negative. To perform a Gram stain (Figure 3.6), crystal violet is applied as the primary stain to a fixed bacterial smear for 30–60 seconds, allowing dye molecules to penetrate the ­ istilled peptidoglycan in the cell wall. After washing with d

The Gram-staining procedure is a differential staining process. 1 A suspension of bacterial cells is applied to the slide, spread with an inoculating loop, and allowed to dry. 2 The cells are fixed to the slide using heat or chemicals. 3

4 Gram’s iodine is applied for 1 minute and rinsed off.

6 The basic dye safranin is applied for 1 minute and rinsed off.

e. Gram-positive bacteria Courtesy of Larry Stauffer, Oregon State Public Health Laboratory/CDC

Microscope field of view

5 Ethanol is dripped onto the slide for ~15 seconds and then rinsed until no additional purple color is lost.

Biophoto Associates/ Science Source Images

3 The basic dye crystal violet is applied for 1 minute and rinsed off.

d. Safranin, a light red dye that a. Crystal violet, the primary b. Gram’s iodine, the c. A short rinse with ethanol, acts as the counterstain, stain, colors all bacterial mordant, interacts with which is the decolorizer, colors the DNA of all the cells. cells with peptidoglycan crystal violet to form removes the crystal violet– Cells that had lost the crystal in their cell walls. insoluble complexes. iodine complexes from bacteria with the thin layers of violet–iodine complex now stain red. Those that retained peptidoglycan. Bacteria with thick layers of peptidoglycan the crystal violet–iodine T h i n k C ri ti c al l y In the Gram-staining process, retain the dyes trapped there. complexes remain the much f. Gram-negative bacteria darker purple color.

why are cells fixed before they are stained?

Specimen Preparation and Staining  73

Process Diagram

✓ The Planner

The Gram-staining procedure • Figure 3.6

water, Gram’s iodine is applied to the specimen as a mordant, or chemical that fixes the dye as an insoluble compound. The slide is rinsed with distilled water before ethanol is briefly added as a decolorizer and the specimen is again washed. In gram-positive cells, the small gaps in the peptidoglycan in the wall close as the cell becomes dehydrated from the ethanol treatment, trapping the insoluble crystal violet–iodine complexes in the cell. In gram-negative cells, ethanol dissolves the outer lipopolysaccharide layer, allowing the purple dye to quickly be rinsed out of the cell. Counterstaining with safranin dyes the DNA of all bacterial cells red. This makes the gramnegative cells that lost their primary stain visible while the gram-positive cells still remain dark purple. The Gram-staining technique is the most important first step in identification of bacteria. The results of the Gram stain—whether the bacteria are gram-positive or gram-negative—also inform physicians which classes of antibiotics will most likely be successful in treating a

bacterial infection. As such, it is a key diagnostic tool in ­microbiology. See the Case Study for an example situation in which a physician would use a Gram stain. The cells walls of several genera of bacteria contain a waxlike lipid called mycolic acid and, as a result, are impermeable to many chemicals. For this reason, they are resistant to the disinfectants and antibiotics that kill most other bacteria, and also to Gram-staining reagents. Acid-fast staining was developed to visualize these organisms and distinguish them from bacteria that lack mycolic acid in their cell walls (gram-positive or gram-negative bacteria). In acid-fast staining, a smear of bacteria is fixed to a slide and the specimen is flooded with carbol fuchsin, a dark red dye containing 5% phenol. The slide is heated and the stain boiled for 5 minutes. The high temperature and phenol facilitate penetration of the dye through the heat-softened waxy cell walls of these bacteria as well as the walls of other microbes, staining them all bright red. The rinsed slide is then cooled and decolorized with an

Case Study

✓ The Planner

For almost a week, Tom experienced painful urination. Suspecting a urinary tract infection, he increased his consumption of water and added a daily glass of cranberry juice to his diet, having read on the internet that was helpful. He routinely saw Dr. Nelson for annual check-ups, but today Tom made an unplanned visit to his physician as he was alarmed to discover he now also had penile pus discharge. Dr. Nelson took a swab of the pus and sent it to the laboratory for a Gram stain and other tests. Review: 1. How is a Gram stain done? 2. What types of bacteria are stained differently in the Gram stain?

Biophoto Associates/Photo Researchers, Inc.

Diagnosing Gonorrhea Using the Gram Stain

3. What is the key step in the Gram stain that distinguishes between two different cell types? Explain why.

4. Describe the shape of the gram-negative bacteria shown in the photo.

The laboratory reported gram-negative bacteria arranged inside the leukocytes of the pus sample. Other tests confirmed the pathogen was Neisseria gonorrhoeae, indicating Tom had the sexually transmitted infection gonorrhea.

Dr. Nelson called Tom to explain the laboratory results and told him that he was required to report cases of gonorrhea to the Public Health Service. He indicated that Tom should expect a follow-up call so that his sexual partners, who may be infected with the pathogen but not yet showing symptoms, can be tested and treated if necessary. Dr. Nelson was confident that Tom would get the prompt and appropriate treatment he needed. Investigate: 5. Name an antibiotic that could be effective for an uncomplicated case of gonorrhea.

Clinical Application

✓ The Planner

Acid-fast stain of a sputum saple

Dr. George P. Kubica/CDC

b.

a­ cidified alcohol solution. Dye rapidly washes out of cells with typical peptidoglycan-containing cell walls. However, the decolorizer can’t penetrate cell walls containing mycolic acid, trapping the carbol fuchsin inside these cells. Such bacteria are referred to as acid-fast bacteria because the acidified decolorizer is unable acid-fast Refers to remove the red dye. Finally, to bacteria resistant counterstaining with methylene to decoloration by blue makes the non–acid-fast bacacid solutions during teria visible, but cannot penetrate the acid-fast staining the acid-fast cells (see Remember process as a result This!). See the Clinical Application of a layer of mycolic for an example of how acid-fast acid in the cell wall. staining is used in diagnosis. Remember This!  For a visual review of this staining technique, review The Microbiologist’s Toolbox in Section 2.4.

a.

Epidemic curve of tuberculosis outbreak in Duval County, Florida 40 Confirmed (70) Probable (22) 35 Suspected (7) 30

Number of cases

A tuberculosis outbreak affected 99 homeless people in Florida. Most of those infected by Mycobacterium tuberculosis were drug abusers or were mentally ill (Figure a). The outbreak began with a schizophrenic man who sought treatment on four different occasions; however, he was never evaluated for respiratory infections until his last hospitalization. Microscopy of a sputum smear revealed acid-fast, rod-shaped bacteria, which confirmed a pulmonary tuberculosis diagnosis (Figure b). Although the man began appropriate antibiotic therapy, he was noncompliant with treatment and was subsequently transferred to an isolation unit for involuntary treatment. Tests showed that 14 residents of the shelter where he had previously stayed were also infected. Because these residents interacted with others, the pathogen continued to spread through the community.

25 20 15 10 5 0

2004

2005

2006

2007 2008 Count year

2009

2010

2011

Graph from Joseph S. Cavanaugh, M.D.; Krista Powell, M.D., M.P.H.; Ozzie J. Renwick; Kevin L. Davis; Aaron Hilliard, Ph.D.; Cynthia Benjamin; Kiren Mitruka, M.D., M.P.H., “An Outbreak of Tuberculosis Among Adults With Mental Illness.” Am J Psychiatry 2012;169:569-575.

Diagnosing Tuberculosis Using Acid-fast Staining

In t e r p r e t t h e Da t a If the trend shown in the graph continued, how many confirmed and probable cases would you expect in 2014?

Special Staining Procedures Special techniques are used to stain bacterial structures to aid in identifying unknown species. These techniques can use simple or differential staining procedures. Several important special staining techniques include endospore staining, capsule staining, and flagella staining.

Endospore staining The presence of endospores, which are resistant asexual spores that develop inside some bacteria, can be an important diagnostic tool. One important endospore-forming pathogen, Clostridium difficile, has become a major cause of infections acquired at a health care facility and a significant concern for infection control. Endospore staining is a differential staining procedure. Because endospores are impermeable to most stains, heat is used to drive malachite green into the endospore. The green stain is rinsed Specimen Preparation and Staining  75

Special staining procedures • Figure 3.7 Bacteria characterized by features such as endospores, capsules, or flagella can be quickly identified by using special staining techniques designed to highlight these structures.

b. Capsule staining The capsules of this Klebsiella pneumoniae specimen are highlighted by the repulsion of the negative charges on both the nigrosin dye and the capsules.

Endospore

Vegetative cell

Capsule

c. Flagella staining The flagella on these cells of Proteus vulgaris are visible because multiple layers of stain and mordant have been applied to thicken the fine structures.

Flagella

Richard J. Green/Science Source

Gary E. Kaiser, Ph.D.

Malachite green was boiled on this smear of Bacillus megaterium to force the dye through the thick wall of the endospore, and the cell was counterstained with red safranin dye.

© Carolina Biological Supply Company/Phototake

a. Endospore staining

As k Your s e l f How does the image produced by capsule staining differ from that produced by flagella staining? a. The stain turns the capsule white and the flagella red. b. The capsule is visible without any stain but the flagella aren’t. c. The flagella are visible without a stain but the capsule isn’t. d. The capsule isn’t stained, but the background is. The flagella are stained, but the background isn’t.

from the rest of the cell with a decolorizer that is unable to penetrate the endospore. Counterstaining with safranin produces a red vegetative cell with a green endospore (Figure 3.7a). The presence of endosporeforming bacteria in a patient specimen poses special treatment problems because they are impervious to most antibiotics.

Capsule staining  Bacteria with a polysaccharide coating, or capsule, around their cell walls can be identified by the technique of capsule staining. A negative staining technique highlights these capsules because nonionic, acidic, or basic dyes will not adhere to them. Mixing an acidic dye, such as nigrosin, with a bacterial suspension and preparing a smear, stains only the background. The negatively charged capsule repels the dye, producing a clear zone surrounding the bacteria (Figure 3.7b). Capsules are clinically important because they enhance the disease-causing ability of a microbe.

76  CHAPTER 3  Microscopy

Flagella staining  Many bacteria are motile and use one or more hairlike, rotary protein filaments for locomotion. Called a flagellum (plural, flagella), this structure is stained (Figure 3.7c) because it is too thin to see with a light microscope. However, flagella can be visualized after they are coated with a thick layer of a dye. The dye used includes a mordant to fix the stain on the flagella. This allows the flagella to be coated with enough layers of dye to become visible. Determination of the presence, location, and number of flagella is an important identification tool for some groups of bacteria.

1. What structural differences do the Gram stain and acid-fast staining procedures detect? 2. Which special staining procedure involves differential staining?

The Planner

✓

Summary

3.1

3.3

• Magnification of images is accomplished using glass or electromagnetic lenses or sensitive scanning probes. Depending on the microscope, images can be magnified more than 100 million times.

• Confocal microscopy uses lasers to excite fluorescent dyes within specific focal planes and then assembles them into a three-dimensional image. Super-resolution microscopy is a variation of fluorescence microscopy that can achieve nanometer-level resolution by using technology to precisely locate fluorescent emissions from the specimen. Phase contrast and differential interference contrast microscopy use the principles of light microscopy but convert differences in refractive indices in the specimen into differences in light intensity. As a result, they can be used to view unstained, living specimens.

  Principles of Microscopy  62

• Resolution provides the clarity and detail to the magnified image (see the diagram). The smaller the structures that can be resolved, the greater the clarity of the image. Refraction is the bending of light waves when they pass from one medium to another medium with a different refractive index. With a light microscope, resolution is increased by using shorter wavelengths of light and immersion oil, which has a higher refractive index than air.

How a microscope works  •  Figure 3.2

Low resolution of image of object

• In transmission electron microscopy (TEM) electromagnets act as lenses, focusing a beam of electrons that pass through the ultrathin specimen section, as shown in the micrograph. The image produced has a very high magnification and resolution. In scanning electron microscopy (SEM), an electron beam passes over the surface of the specimen, scattering electrons that are detected and used to produce a three-dimensional image of the specimen surface at high magnification and resolution.

Principles of electron microscopy  •  Figure 3.4

 icroscopy Used for M Clinical Diagnosis  65

• Different types of light microscopes are used in a clinical laboratory. Bright-field microscopy is used for routine applications such as examining clinical specimens. • Dark-field microscopy is used to view very thin spirochete bacteria. • Fluorescence microscopy can aid in diagnosis when used with fluorescently tagged monoclonal antibodies that bind only to a unique pathogen, as shown in this rabies-positive brain sample.

• Nanoprobe-based microscopes use extremely sensitive probes to scan the sample and produce an image of the surface. Both scanning tunneling microscopes (STM) and atomic force microscopes (AFM) can produce images of individual molecules.

courtesy Los Angeles County Public Health Laboratory

The Microbiologist’s Toolbox: The Direct Florescent Antibody Assay

Science Source Images

3.2

Higher resolution of image of object

Microscopy Used for Research Investigations  68

Summary  77

Specimen Preparation and Staining  72

• Simple staining uses a single dye to make visible the specimen fixed to the slide. Positive staining binds stains such as methylene blue or safranin to charged molecules in the specimen. Negative staining uses stains, such as nigrosin, which are repelled by the specimen and stain the background. • Differential staining, such as Gram staining or acid-fast staining (shown in the micrograph), can involve a primary stain that stains all the cells in a specimen and a counterstain that stains cells that have had the primary stain removed by a decolorizing agent. With a Gram stain, gram-positive cells stain purple, and gram-negative cells stain pink. Acid-fast bacteria, which have mycolic acid in their cell walls, stain bright red with carbol fuchsin. The stain is retained in the cells after a wash with an acidified decolorizer that removes the stain from cells with peptidoglycan cell walls.

Clinical Application: Diagnosing Tuberculosis Using Acid-fast Staining

Dr. George P. Kubica/CDC

3.4

• Endospore staining, capsule staining, and flagella staining are special techniques used to make these bacterial structures visible. These techniques can be used in identifying bacteria isolated from a sample.

Key Terms • acid-fast 75 • acid-fast staining  74 • atomic force microscopy (AFM)  72 • bright-field microscopy  65 • capsule 76 • confocal microscopy  68 • dark-field microscopy  66 • differential interference microscopy 70 • differential staining  73 • direct fluorescent antibody (DFA) assay 67 • endospore 75

• fixed 72 • flagellum (plural flagella)  76 • fluorescence microscopy  67 • gram negative  73 • gram positive  73 • Gram stain  73 • hanging drop method  72 • immersion oil  64 • magnification 62 • mordant 74 • negative staining  73 • phase contrast microscopy  68

• positive staining  72 • refraction 64 • refractive index  64 • resolution 62 • scanning electron microscopy

(SEM) 72 • scanning tunneling microscopy (STM) 72 • simple staining  72 • smear 72 • super-resolution microscopy  68 • transmission electron microscopy (TEM) 70

Critical and Creative Thinking Questions

a. What is the density of proteins embedded in the membrane of the bacteria Staphylococcus aureus?



b. How rapidly does the contractile vacuole fill and empty in different species of the protozoa Paramecium?



c. How does the conformation of DNA change when an RNA molecule binds to it?

2. Could you add a third 10× lens to a compound microscope that normally magnifies an object 400× so that it now magnifies 4000×? If so, why isn’t this done? 3. How is the image of an unstained bacterial specimen from a dark-field microscope similar to a negative-stained bacterial specimen from a bright-field light microscope?

4. How are the Gram staining and acid-fast staining techniques similar? 5. If light from the bulb is blocked by an opaque disk, why does a dark-field micrograph appear as shown? Borrelia burgdorferi

Scott Camazine/Phototake

1. Analyze the following research questions and determine which type of microscopy would be most appropriate to use. Explain your reasoning.

What is happening in this picture? If this were a picture of a macroscopic structure, you might be tempted to guess this was a stop-action picture of tennis balls being thrown into some gooey substance. However, this is a micrograph of spherical pathogenic bacteria. The amorphous mass engulfing the bacteria is a group of specialized cells, leukocytes, which help fight off microbial pathogens that could otherwise cause disease.

Science Source Images

T h i n k C ri ti c al l y Observe the overall details of the micrograph closely to determine what type of microscope was used to take this micrograph. How can you tell?

Self-Test (Check your answers in Appendix A.)

1.  Image size divided by actual size is a measure of ______.

a. resolution



b. refractive index

4.  If a light microscope has a 10× ocular lens and a 40× objective lens, how large will the image of an amoeba 15 μm in diameter appear?



c. magnification



a. 150 μm



d. numerical aperture



b. 600 μm



e. focal length



c. 1.5 mm



d. 6.0 mm



e. 750 μm

2.  As resolution ______ the clarity of the image ______.

a. increases; increases



b. decreases; decreases



c. decreases; increases



d. decreases; stays the same



e. increases; stays the same

3.  Review the Microbiology InSight, Figure 3.2, and answer this question.

With a compound microscope, light intensity is controlled by adjusting the ______.



a. condenser lens



b. focus knob



c. stage



d. iris diaphragm



e. ocular lens

5.  Light is ______ when it passes from one medium to another with a different optical density.

a. refracted



b. resolved



c. magnified



d. focused



e. Both b and d are correct.

Self-Test  79

6.  In the diagram, the light entering the oil ______.

8.  Review What a Microbiologist Sees, and answer this question.



a. is bent more than the light passing through air





b. is reflected back toward the source

The three-dimensional aspect of the Stentor image is created by ______.



c. is not refracted



a. the use of dyes



d. cannot pass through it





e. is reflected and refracted

b. changes in the phases of light as it passes through the specimen



c. coating of the specimen with metals



d. the type of glass in the eyepiece of the microscope



e. the large size of the specimen

9.  In which type of microscope does the specimen appear against a black background because of light being reflected off the surface of the specimen into the objective lens?

Oil



a. differential interference microscope



b. confocal microscope



c. dark-field microscope



d. super-resolution microscope



e. bright-field microscope

10.  A fluorescent dye absorbs the energy from ______ and emits light in the visible spectrum.

7.  The diagram depicts the structure of a ______.

a. bright-field microscope



b. dark-field microscope



c. fluorescence microscope



d. confocal microscope



e. phase contrast microscope Eye Ocular lens

Objective lens



a. an electron beam



b. another fluorescent dye



c. ultraviolet light



d. phalloidin



e. fluorescein

11.  Review The Microbiologist’s Toolbox, and answer this question.

A positive test for a pathogen produced by a(n) ______ dye conjugated to a ______ shows as glowing spots when viewed with a(n) ______ microscope.



a. acid; fluorescent antibody; dark-field



b. basic; polyclonal antibody; bright-field



c. neutral; fluorescent antibody; confocal



d. fluorescent; monoclonal antibody; fluorescence



e. acid; monoclonal antibody; electron

12.  Which microscope generates a three-dimensional image and converts differences in refractive indexes in a specimen to differences in color as the result of using prisms?

a. phase contrast microscope



b. differential interference contrast microscope



c. confocal microscope



d. dark-field microscope

Condenser lens



e. Both a and c are correct.

Light source

13.  A(n) ______ microscope is a variation of a fluorescence microscope that uses point illumination and scanning to produce a three-dimensional image.

Specimen

80  CHAPTER 3  Microscopy



a. scanning electron



b. scanning tunneling



c. atomic force



d. differential interference contrast



e. confocal

14.  A transmission electron microscope uses ______ for lenses and a(n) ______ to form the image.

18.  Review the Process Diagram, Figure 3.6, and answer this question.



a. electromagnets; nanoprobe





b. glass; nanoprobe

Place the listed chemicals in the correct order for Gram staining: safranin, iodine, ethanol, crystal violet



c. electromagnets; electron beam



a. crystal violet, safranin, ethanol, iodine



d. glass; electron beam



b. iodine, safranin, ethanol, crystal violet



e. electron beams; electromagnets



c. iodine, crystal violet, safranin, ethanol



d. crystal violet, iodine, ethanol, safranin



e. crystal violet, iodine, safranin, ethanol

15.  The image in this photo was made by ______ that ______.

a. an electron beam; passed through prisms



b. an electron beam; passed through the specimen

19.  Review the Clinical Application, and answer this question.



c. light; passed through prisms





d. light; passed through the specimen

Tuberculosis is caused by Mycobacterium tuberculosis, a(n) ______ bacterium.



e. an electron beam; scattered off the specimen surface



a. non–acid-fast



b. gram-positive



c. gram-variable



d. gram-negative



e. acid-fast

16.  Scanning tunneling microscopy and atomic force microscopy are fundamentally different from other types of microscopy because they ______.

a. use a nanoprobe that scans the surface of the specimen to produce an image



b. use a scattered electron beam to produce an image



c. assemble an image from light defracted off the surface of the specimen by prisms



d. only work on living specimens



e. Both b and d are correct.



a. nuclei



b. bacteria



c. red blood cells



d. endospores



e. crystal violet

Gary E. Kaiser, Ph.D.

Juergen Berger/Science Source Images

20.  The green-stained structures in the micrograph are ______.

17.  Staining procedures that use multiple dyes are called ______.

a. simple staining



b. negative staining



c. differential staining



d. acidic staining



e. mordant staining

Self-Test  81

4

Prokaryotic Organisms

The Staphylococcus aureus bacteria growing on the cilia of human nasal epithelial cells make up part of our personal prokaryotic world.

BENEFICIAL BACTERIA

P

rokaryotes, which include bacteria, are the smallest, simplest, single-celled organisms. Most people equate bacteria with pathogens, but only a small fraction of these microorganisms cause human disease. In fact, the extensive bacterial community living in and on us (see the photo) composes our normal microbiota, which can protect us from infection. Because these well-established microbes are better competitors for resources, they J. Berger/Photo Researchers

CHAPTER OUTLINE

often prevent pathogens from colonizing our bodies. Microbiota also improve our health by aiding digestion and producing vitamins. Other beneficial prokaryotic roles include bioremediation, or the use of unique bacterial enzymes to degrade environmental contaminants. Bacteria increase soil fertility, enhancing agriculture yields, and are used to manufacture foods such as cheese, yogurt, pickles, and chocolate. Alterations of bacterial genomes create microbes that make environmentally friendly pesticides, biofuels, and medications. Currently, investigators are experimenting with biocryptography, or the use of bacteria to store hack-proof data, text, and videos. Microbiologists estimate that for every one pathogenic bacterium, there are 30,000 beneficial ones. Because less than 1% of prokaryotes can be grown in a laboratory (see the photo) and a much smaller fraction have been characterized, a wealth of bacterial benefits await discovery. This chapter will survey the structures that enable prokaryotes to adapt to a myriad of different environments. It will also summarize prokaryotic evolution, classification, and how prokaryotes have changed the chemical and physical makeup of the planet.

4.1 The Prokaryote’s Place in the Living World  84 • Sustaining Life ■ What a Microbiologist Sees: Prokaryotes— The Dominant Form of Life on Earth • Symbiotic Relationships 4.2 Bacterial Cell Shapes and Arrangements  87 • Bacterial Shapes • Bacterial Arrangements 4.3 The Bacterial Cell Wall  89 • Cell Wall Structure • Gram-Positive and Gram-Negative Cell Walls • Atypical Cell Walls ■ Case Study: A Walking Pneumonia Outbreak at a University 4.4 External Structures of Bacterial Cells  94 • The Glycocalyx • Fimbriae and Pili • Flagella ■ The Microbiologist’s Toolbox: The Flagella Stain 4.5 • • • •

Internal Structures of Bacterial Cells  97 The Plasma Membrane The Nucleoid Ribosomes Plasmids, Inclusion Bodies, and Membranous Structures • Endospores ■ Clinical Application: Endospore-forming Bacteria

4.6 Prokaryotic Evolution and Classification  103 • The Tree of Life • The Clinical Classification of Prokaryotes

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 84 ❑ p. 87 ❑ p. 89 ❑ p. 94 ❑ p. 97 ❑ p. 103 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

R Parulan Jr./Getty Images, Inc.

Analyze key features

Staphylococcus aureus is frequently grown in the clinical laboratory because, when it breaches the skin, it causes many serious infections.

❑ What a Microbiologist Sees, p. 85 ❑ Microbiology InSight, p. 88 ❑ Case Study, p. 93 ❑ The Microbiologist’s Toolbox, p. 97 ❑ Process Diagram p. 98 ❑ p. 102 ❑ ❑ Clinical Application, p. 101 ❑ Stop: Answer the Concept Checks before you go on. p. 86 ❑ p. 88 ❑ p. 93 ❑ p. 97 ❑ p. 103 ❑ p. 106 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What is happening in this picture? ❑ Complete the Self-Test and check your answers.  

83

4. 1

The Prokaryote’s Place in the Living World

LEARNING OBJECTIVES

1. Describe the roles of prokaryotes in sustaining life.

P

rokaryotes are small, unicellular organisms that lack a distinct nucleus and complex membrane-bound organelles. Their cellular makeup is distinctly different from the cells of eukaryotes—the plants, animals, and fungi of the prokaryote Bacmacroscopic world and the micro- teria and archaea; scopic protozoans (Table 4.1). a small, unicellular From a clinical perspective, both organism that typically lacks a distinct prokaryotes and microbial eunucleus and complex karyotes can act as pathogens. membrane-bound However, because of their signifiorganelles. cantly different cellular compositions, correspondingly different eukaryote An drug therapies must be used to organism consistcure these infections. Bacterial in- ing of one or more fections are treated by adminis- cells containing a tering drugs designed to target nucleus and complex prokaryote-specific structures to membrane-bound prevent host damage. To protect organelles, including the host while curing an infection plants, animals, fungi, and protists. caused by a eukaryotic microbe,

2. Explain the symbiotic interactions prokaryotes can have with other living organisms. medications typically must selectively damage features unique to the specific pathogen. Prokaryotic microbes are the dominant form of life on Earth (see What a Microbiologists Sees). The two types of prokaryotic cells—archaea and bacteria—are widely distributed and live in nearly every possible environment on the planet. The total prokaryotic biomass is 10,000 times greater than the biomass of all humans currently living on Earth. Incredibly, there are about 10 million times more archaea in the oceans than there are stars in the visible universe, and there are 10 times more bacteria living in and on us than there are cells in our bodies.

Sustaining Life The activities of prokaryotes sustain all life on the planet in today’s world. Photosynthetic bacteria along with plants and marine algae produce glucose and O2, which are used by aerobic organisms. Additionally, prokaryotes are the only organisms capable of nitrogen fixation, the enzymatic process by which atmospheric N2, which cannot be used by other living organisms, is converted into usable nitrogencontaining organic compounds. On land, bacteria living

A comparison of prokaryotic and eukaryotic cells  Table 4.1 Feature

Prokaryotes

Eukaryotes

Size

0.2–5 μm

10–100+ μm

Genetic material

Genetic information carried by DNA in one nucleoid or circular chromosome; may contain plasmids carrying accessory genes

Genetic information carried by DNA in several linear chromosomes

Protein synthesis

70S ribosomes

80S ribosomes

Cell wall

Structurally complex, composed of peptidoglycan

Absent or structurally simple, composed of cellulose, chitin, and silica

DNA organization

No membrane-bound nucleus

True membrane-bound nucleus

Organelles

No true membrane-bound organelles

Many complex membrane-bound organelles

Cell division

Replicate by binary fission, a simple cell division process that separates copied nucleoids into daughter cells

Replicate by mitosis/meiosis, complex processes to precisely separate many copied chromosomes into daughter cells

Example

Escherichia coli

Euglena gracilus

84  CHAPTER 4  Prokaryotic Organisms

What a Microbiologist Sees ✓

The Planner

Prokaryotes—The Dominant Form of Life on Earth Examine Figure a and identify the various forms of life in this community. The list of organisms compiled by most people would include the plants, aquatic creatures in the pond, the boy, and the cow. But at the top of a microbiologist’s list would be the invisibly small prokaryotes. What a microbiologist sees is the dominant form of life on Earth. As Figure b shows, prokaryotic microbes are the most numerous of all life forms. They also demonstrate the greatest species diversity. It is estimated that there are about

1000 times more bacterial species than animal species on Earth. The number of archaean species is reported as TBD, or as yet to be determined, because their diversity is so great that we do not yet have an accurate count. Finally, prokaryotic microbes occupy every imaginable habitat. In addition to the number of prokaryotes living in the locations indicated in Figure a, many survive deep underground or flourish in extreme environments such as boiling hot geysers, crude oil–polluted water, and deep sea vents.

a.b.

1 X 104/m3 in water vapor X 1012/m2

5 on leaves

5 X 1014 in rumen

Rumen

X 1010

1 in mouth

1 X 1012 on skin

1 X 1014 in intestine

Organism group

Estimated number of species

Plants

    500,000

Fungi

   1,500,000

Protists

   1,000,000

Animals*

   6,000,000

Bacteria

1,000,000,000

Archaea

TBD

*Insects and mites make up approximately 40% of animal species.

1 X 1012/m3 in pond

3 X 1015/m3 in top soil

6 X 1013/m2 on soil surface

Th in k Cr it ica lly According to Figure a, there are approximately 10,000 times more bacteria living in your intestines than in your mouth. Why does such a difference exist between two locations in the same person?

within the roots of certain types of plants generate NH4+ that the plant can use to synthesize proteins and nucleic acids. This process not only benefits the plant, but also the nitrogen-fixing bacteria receive nutrients stored in the roots. Without microbial nitrogen fixation, plant life on the planet would run out of usable nitrogen in about a week. If the plants died, then the herbivores, or plant-consuming animals, would starve and the food web would unravel. Prokaryotes also sustain life by helping cows and other grazing animals break down the cellulose in the

plants they eat. They have specialized chambers in their stomachs that culture prokaryotic microbes that digest much of the plant material, making these nutrients available to the animal. Prokaryotes are also critical components of biogeochemical cycles that allow chemicals such as carbon, phosphorus, and sulfur to cycle between the living and nonliving worlds. Clearly, prokaryotes are a foundational component of the food webs on which much of the life on the planet depends. The Prokaryote’s Place in the Living World  85

Symbiotic Relationships For about 2 billion years, until eukaryotes evolved, prokaryotes were the only living things on Earth. As a result, eukaryotic microbes evolved in a soup of prokaryotic competitors. When eukaryotic organisms developed into multicellular forms, it was done in the constant presence of prokaryotes growing on and in them. This type of relationship in which one organism lives in or on another is called symbiosis. In these relationships, one organism is generally supplied with food, oxygen, a safe living environment, or some other necessary factor. Symbiotic relationships benefit one of the species involved, but can be classified into types depending on how the other species in the relationship is affected. In a symbiotic relationship between a prokaryotic organism and a macroscopic organism, the prokaryotic organism always benefits, with different effects on the other organism. In mutualism, both species benefit; in c ­ ommensalism, one species benefits and the other species is neither harmed nor benefited; and in parasitism, one species benefits and the other species is harmed (Figure 4.1). Bacteria can live on and in humans without causing significant benefit or harm, a commensal relationship. Because

normal microbiota are important in inhibiting the growth of bacterial pathogens, this relationship is often considered mutualistic. However, when tissues are damaged by illness or injury, these bacteria may also cause infections, resulting in a parasitic relationship. Bacteria that live on and in humans have all different types of symbiotic relationships. Bacteria that live on our skin can at times have a commensal relationship with no significant benefit to us. However, bacteria that live in our large intestine can at times have an important role in inhibiting the growth of bacterial pathogens; hence, that relationship is often mutualistic. Bacterial pathogens do cause harm when they damage tissues and cause illness. Such bacteria are considered parasites.

1. How does nitrogen fixation by bacteria help to sustain life? 2. How do commensal, mutualistic, and parasitic relationships each affect the host organism?

Symbiotic relationships • Figure 4.1 Symbiotic relationships do not necessarily fit into discrete classes, but form a continuum from relationships that are mutually essential to those that are so harmful as to be fatal to the host.

a. Mutualism Both partners in this form of symbiosis thrive. Rhizobium performs nitrogen fixation, providing usable nitrogen that the bean converts into essential molecules. Protected inside the nodule, Rhizobium receives nutrients and water from the bean roots.

b. Commensalism In this symbiosis, one partner benefits while the other is unaffected. Enterococcus faecalis flourishes in the warm, nutrientrich large intestine. However, because its population size is relatively low compared with other gut microbes, it has no significant impact on the host.

c. Parasitism While one partner benefits in this symbiotic relationship, the other is injured, sometimes fatally. Agrobacterium tumefaciens invades normal plants cells, converting them into tumor cells specially designed for the conversion of plant nutrients into molecules that serve as a bacteria-exclusive energy source.

Root nodule Rhizobium Benefit to host

Neutral interaction

Harm to host

Rhizobium forms root nodules, which fix N2 in beans.

Enterococcus faecalis grows in the large intestine.

Agrobacterium tumefaciens causes crown gall disease.

T h in k Cri ti c a l l y Fibrobacter succinogenes digests cellulose in the rumen of a cow. What type of symbiotic relationship do you think they have and why?

86  CHAPTER 4  Prokaryotic Organisms

4 .2

Bacterial Cell Shapes and Arrangements

LEARNING OBJECTIVES 1. Describe the common shapes of bacterial cells. 2. Identify the different bacterial arrangements, how they form, and their clinical significance. acteria can have different arrangements depending on how they adhere to one another after cell division. The size range for bacteria is usually 0.2 to 2.0 μm in diameter and 2 to 8 μm in length (Figure 4.2a). However, Mycoplasma gallicepticum is known as an ultramicrobacterium because, at 200 to 300 nm in diameter, it is substantially smaller than most bacteria. On the other end of the size spectrum, Thiomargarita namibiensis, reported to be the largest bacterial species at 750 μm, is visible to the naked eye.

B

Bacterial Shapes Because there are so many bacterial species, it is not surprising that they demonstrate variable forms. The three common shapes of bacteria are coccus (plural cocci), or spherical; bacillus (plural bacilli), or cylindrical; and spiral (Figure 4.2b). Each of these basic shapes demonstrates some species-specific modifications. For example, the two cocci that compose Streptococcus pneumoniae are slightly angular or diamond-shaped. Cocci can also be modified to be chubby ovals or flattened circles. Bacilli range in width from slender to thick; their ends may be angular or rounded; they can be cylindrical or flat; and, although they are usually straight rods, vibrios curve, resembling elbow macaroni. Spiral bacteria are elongated bacilli that coil into flexible spirochetes or rigid helical spirilla. Some bacterial species deviate from the standard morphologies. Fusiform cells are exaggerated bacilli with distinctly tapered tips. Other bacilli resemble a club, having one swollen end. Filamentous bacterial forms may be straight chains or branched, looking similar to fungi. Appendaged bacteria are characterized by the presence of bumplike projections. Pleiomorphism describes slight shape variations of bacterial cells of the same species. These morphological modifications may represent differences in individual genetic makeup, nutrition, or environmental factors. Because the characteristic form of a bacterial cell is maintained by the presence of its cell wall, anything that affects this supportive surrounding structure can influence shape. Mycoplasma species are noted for their variable cell shapes because members of this genus lack cell walls.

Bacterial Arrangements Bacterial morphology is also characterized by the speciesspecific grouping or arrangement of cells (Figure 4.2c). In addition to single cells, common arrangements include pairs (described by the prefix diplo-), chains (strepto-), and clusters (staphylo-). Some bacterial species form flattened sets of four (tetrads) or three-dimensional packets of eight (sarcinae). Short stacks of bacilli can also group to resemble Chinese character writings and are known as palisades (Figure 4.2d). The various bacterial arrangements occur when the daughter cells resulting from cell division in different planes remain attached to each other. Although the terms listing the descriptions of the shapes and groupings of different types of bacteria are relatively straightforward, they can sometimes be confusing because these same names are used for certain genera designations. For example, streptococcus is the general term for any group of bacteria that is coccusshaped and grouped in chains. However, there is also a genus named Streptococcus that contains several important pathogenic microorganisms. As you read through future material, it will be important to notice whether terms such as staphylococcus, bacillus, and vibrio are lowercase (simply descriptive) or uppercase and italicized (referring to a particular genus of bacteria). Because specific sizes, shapes, and arrangements characterize bacterial species, microscopic analysis in the clinical laboratory to determine these features is often used as the first step in pathogen identification (Figure 4.2d). When a patient specimen is received in the laboratory, it is Gram stained (see Remember This! ) for morphological analysis. These results, coupled with the type of patient specimen, can be diagnostic or at least suggest follow-up testing for accurate determination. For example, if gram-negative diplococci are found in a type of white blood cells called neutrophils from a sample of penile discharge, then Neisseria gonorrhoeae is identified, the patient diagnosed with gonorrhea, and the appropriate antibiotic therapy initiated. The ability of clinical microbiologists to correlate bacterial morphology with particular pathogens is essential for positive patient outcomes. Remember This!  Gram staining is a foundational skill in microbiology. This differential staining technique reveals key cell wall variations between bacterial species and highlights cell morphology. Refer to Figure 3.6 to review the steps and outcomes of the Gram staining procedure.

Bacterial Cell Shapes and Arrangements  87

Microbiology InSight  Bacterial

morphology 

Bacterial species are characterized by their size, shape, and arrangement. These features can often be used to identify the bacterial genus presumptively, facilitating diagnosis and allowing for rapid initiation of patient therapy.

✓ The Planner

•  Figure 4.2

Mycoplasma pneumoniae

Streptococcus pneumoniae

Thiomargarita namibiensis

Smallest size 0.2 μ m

Typical size 1.0 μ m

Largest size 750 μ m

a. Bacterial size The range of different sizes of bacteria is dramatic, with an approximately 4000× difference in diameter between the smallest and largest bacterial species. Some species such as Mycoplasma pneumoniae are as small as a large virus, whereas Thiomargarita namibiensis can be seen without a microscope. Most bacteria of clinical significance, such as Streptococcus pneumoniae, are approximately 1 μm in diameter.

Basic shapes

b. Bacterial shapes and arrangements Most bacteria are coccus, bacillus, or spiral shaped, but tremendous variations on these forms also exist. In addition to variety in shape, cell division in different planes results in various bacterial arrangements when daughter cells remain attached. The names for different morphologies describe their shapes and groupings, as shown in the smaller table.

Term

Meaning

Term

bacillus

staff

diplo-

double

vibrio

wave

strepto-

twisted chain

spirillum

coil

staphylo-

cluster

Cocci

Bacillus

Spiral

kemel

tetrad

group of four

spirochete

coiled hair

sarcinae

bundle

Unusual

Bacilli

Vibrio

Fusiform bacilli

Coccobacilli

Spirilla

Club-shaped rods

Single

Bacterial arrangements

Spirochete

Diplococci

Diplobacilli

Streptococci

Streptobacilli

Meaning

coccus

Bacterial shapes Coccus

Groupings

c. The clinical significance of bacterial morphology Examination of a Gram-stained patient specimen for morphological determination is often the first step in diagnosis. For example, a sputum specimen containing gram-positive, club-shaped rods in a palisade arrangement strongly suggests the pathogen Corynebacterium diphtheriae and a patient suffering from diphtheria, a serious respiratory infection. Characteristic palisade arrangement

Pairs

Chains Staphylococci

Filamentous

Tetrads

Hyphal morphology

3D packets Sarcinae

1. What is the structure of a bacterium described as a coccobacillus?

Appendaged bacteria

A sk Yo u r se lf How would you describe rod-shaped bacteria linked together to form long chains? a. staphylococci c. streptococci b. staphylobacilli d. streptobacilli

2. How do tetrads differ from sarcinae?

4 .3

The Bacterial Cell Wall

LEARNING OBJECTIVES 1. Diagram the peptidoglycan structure of cell walls. 2. Differentiate between the structures of grampositive and gram-negative cell walls. early all bacterial species possess a cell wall, which provides support and protection for the cell and determines cell shape. A cell wall prevents cell lysis, or bursting. Bacteria living in freshwater are in a hypotonic environment, a medium with a solute osmosis The moveconcentration that is lower than ment of water through that found inside the cell. As a rea semipermeable sult, water spontaneously diffuses membrane from a into the cell by the process of solution of lower solosmosis (Figure 4.3). Cell walls ute concentration into prevent cell lysis by resisting the a solution of higher pressure from the osmosis of water solute concentration. into a cell.

N

3. Describe the cell walls of acid-fast bacteria and the structure of wall-less bacteria.

Cell Wall Structure Peptidoglycan, the primary com-

peptidoglycan A ponent of bacterial cell walls, con- network of polysacsists of peptides linked to sugars charide and peptide called glycans. Bacteria are classi- chains that make up fied into two main groups based the primary compoon the chemical composition nent of bacterial cell of the peptoglycan in their cell walls. walls: gram-positive bacteria and ­gram-negative bacteria. The basic peptidoglycan unit consists of a disaccharide composed of N-acetylglucosamine (NAG) and N-acetylmuramic acid (NAM), modified glucose molecules. In the

The role of the cell wall in preventing osmotic lysis • Figure 4.3 As water flows into a bacterium with a cell wall, the cell wall expands by about 25%, but does not rupture. Because the plasma membrane is delicate and nonelastic, a bacterium without a cell wall will rupture in response to increased internal pressure and the cell will die.

Solutes Bacterium with cell wall

Cell expansion but no cell lysis

H2O Cell wall

Cell in an isotonic environment (equivalent solutes inside and outside the cell)

Introduction into hypotonic environment (low solute concentration outside the cell)

Water diffuses into the cell by osmosis, increasing internal pressure.

Solutes Bacterium without cell wall Plasma membrane

H2O

Cell lysis

T h i n k C ri ti c al l y In which direction would water flow for a cell placed in a hypertonic solution (one with a higher solute concentration than the cell contents), and what would happen to the cell contents?

The Bacterial Cell Wall  89

The structure of peptidoglycan • Figure 4.4 Peptidoglycan is composed of disaccharides linked to peptide chains. It provides the physical strength to maintain the structural integrity of the cell.

a. Peptidoglycan monomer The peptidoglycan monomer is synthesized sequentially inside the cell beginning with the disaccharide, which is then linked to the amino acid chains and transported across the membrane.

NAM

Pentaglycine crossbridge

NAG Tetrapeptide side chain

b. Crosslinking of glycan chains After peptidoglycan monomers are joined together enzymatically to form glycan chains, the strands are crosslinked to form a three-dimensional network. Gram-positive bacterial species accomplish this by joining adjacent tetrapeptide side chains with pentaglycine cross bridges, whereas gram-negative species bind the tetrapeptides directly together. Peptidoglycan from gram-positive cell

Peptidoglycan from gram-negative cell

Glycan chains

Pentaglycine crossbridge between tetrapeptide side chains

Direct link between tetrapeptide side chains

A s k Yo u r s e lf NAG is linked to _____ . a. NAM b. the pentaglycine crossbridge

cytoplasm, a tetrapeptide side chain attaches to NAM before the disaccharide subunit is transported across the plasma membrane (Figure 4.4a). The sugar subunits are joined together enzymatically outside the cell to form glycan chains typically 20 to 30 units long. Next, the glycan chains are linked together to form a sheet. Gram-positive bacteria join the glycan chains together using pentaglycine crossbridges between the tetrapeptide side chains (Figure 4.4b). The crossbridges are enzymatically attached to the number three position on one tetrapeptide and the number four position on the other tetrapeptide. In gram-negative bacteria, a covalent bond directly joins adjacent tetrapeptide side chains at the number three and four positions. In this way, the associated peptidoglycan chains can form rings to encompass the cell. Further crosslinking joins adjacent rings and chains to form a three-dimensional coating that surrounds the cell.

90  CHAPTER 4  Prokaryotic Organisms

c. the tetrapeptide side chain d. Both a and b are correct.

There is free diffusion of molecules through the peptidoglycan layer. Small molecules and globular proteins diffuse through spaces in the peptidoglycan. The pores result from incomplete crosslinking between the glycan chains. Pharmaceutical chemists use their knowledge of peptidoglycan cell wall structure to develop effective antibiotics. For example, vancomycin inhibits peptidoglycan synthesis by preventing the transport of disaccharide subunits outside the cell for assembly into the cell wall. Penicillin binds to the enzyme responsible for joining the crossbridges between tetrapeptides. This inactivates the enzyme, preventing cell wall synthesis and leading to bacterial death. Another antibacterial compound that targets peptidoglycan is the lysozyme secreted in tears, mucus, and sweat. This naturally occurring compound cleaves the peptidoglycan chain at specific intervals, weakening the wall and allowing osmotic lysis.

Gram-Positive and Gram-Negative Cell Walls In addition to the structural differences in the chemical composition of the peptidoglycan just discussed, grampositive bacteria have a thick layer of peptidoglycan, and gram-negative bacteria have a thin layer of peptidoglycan. These differences in cell wall structure play an important role in distinguishing bacterial species in the lab. Gram-positive bacteria stain dark purple or violet after Gram staining because of the thick layers of peptoglycan in the cell wall. In contrast, gram-negative bacteria stain pink or red because of the thin layer of peptidoglycan (see Remember This!). Remember This!  The Gram stain is used to identify gram-positive bacteria and gram-negative bacteria. If necessary, review the Gram staining procedure from Section 3.3 before continuing.

Gram-positive cell walls In the cell walls of grampositive bacteria, the peptidoglycan consists of 6 to 12 layers of glycan sheets and measures 70- to 80-nm thick.

There is a space between the plasma membrane and the peptidoglycan known as the inner wall zone. This space serves as reservoir for metabolites for cell wall synthesis. Chains of teichoic acids weave through the peptidoglycan (Figure 4.5a). This polymer is composed of sugar-phosphate subunits called wall teichoic acids and lipoteichoic acids. Wall teichoic acids attach to cell wall NAMs, whereas lipoteichoic acids attach to phospholipids in the plasma membrane. Teichoic acid strands often have additional sugars and alanines attached along their sides. Extending beyond the surface of the cell wall, teichoic acid strands compose approximately 60% of the carbohydrate component of a gram-positive cell wall. Teichoic acids perform many functions, including the regulation of cation flow through the thick layer of peptidoglycan and the maintenance of cell shape. In some pathogenic streptococci, teichoic acids enable the bacteria to attach to the host tissues. The negative charge from the phosphate groups of teichoic acid repels negatively charged phagocytic cells (cells able to engulf microbes), allowing some pathogens to avoid immune attack. Teichoic acids are also linked to regulation of cell growth and division and enhanced survival when

Bacterial cell wall structure • Figure 4.5 The key structural component of both gram-positive and gram-negative bacteria is peptidoglycan. However, there are several significant differences between the two cell types.

Wall teichoic acid Lipoteichoic acid

Peptidoglycan layers

a. The gram-positive cell wall Gram-positive bacteria have cell walls consisting of several layers of peptidoglycan interwoven with chains of teichoic acids.

Inner wall zone

Porin

b. The gram-negative cell wall Gram-negative bacteria have cell walls that consist of one or only a few layers of peptidoglycan and an outer membrane with porin proteins and lipopolysaccharides in the outer layer.

Periplasmic space

O-oligosaccharide Lipopolysaccharide (endotoxin) Outer membrane Lipid A

Plasma membrane

A sk Yo u rs e l f In gram-negative bacteria, the outer membrane, unlike the plasma membrane, contains _____ and _____ .

Plasma membrane

Peptidoglycan layer

The Bacterial Cell Wall  91

microbes are subjected to elevated temperatures and solutes. Because teichoic acids are such an important cell wall component, pharmaceutical chemists are developing antibiotics to target teichoic acid synthesis to induce fatal bacterial cell wall damage.

Gram-negative cell walls In gram-negative bacteria, the peptidoglycan layer is made up of one to three layers of glycan sheets and is only 3- to 7-nm thick. There are no teichoic acids, and crosslinkage between glycan strands occurs directly between tetrapeptide side chains (Figure 4.4b). The gram-negative cell wall includes an outer membrane (Figure 4.5b), a unique lipid bilayer anchored to the peptidoglycan by lipoproteins. The outer layer is mostly composed of a lipopolysaccharide (LPS) and the inner layer is composed of phospholipids. The LPS has two basic components—the external o-oligosaccharide and the membrane-bound lipid A. The o-oligosaccharide is anchored to a core polysaccharide that attaches to the lipid A. It extends beyond the outer membrane and its exact sugar composition can be used to distinguish different gram-negative bacterial species. The o-oligosaccharide is functionally similar to teichoic acid. The lipopolysaccharide is toxic and is called the endotoxin. It is released upon cell lysis and is an important determinant of pathogenicity. The outer membrane has embedded porin proteins that allow small metabolites, such as sugars, amino acids, and nucleotides, to pass through the outer membrane (Figure 4.5b). Without porins, these metabolites would have to be actively transported across both the plasma membrane and the outer membrane, doubling the cell’s energy costs to bring nutrients into the cell. The outer membrane also pinches off small microvesicles that contain autolysin, an enzyme that degrades the peptidoglycan of unrelated bacteria. The enzyme is also released when nutrients are scarce. Competing bacteria are destroyed because they can’t repair their cell walls rapidly when nutrients are limited, and the gram-negative bacteria can use nutrients released from the killed cells for survival. Autolysin also plays a role in regulating bacterial growth and consequently is a current target of antibiotic research. The thin peptidoglycan layer of gram-negative bacteria is located between the outer membrane and plasma membrane in the periplasmic space (Figure 4.5b). This region is about 10-nm thick and contains the periplasm, a gellike material composed of proteins that bind amino acids, sugars, vitamins, and ions as well as components needed for cell wall synthesis and enzymes that detoxify chemicals. Differences in cell structure make gram-negative cells more susceptible to lysis. Gram-negative bacteria can withstand about three atmospheres of pressure. The thicker layer of peptidoglycan found in gram-positive cell walls can

92  CHAPTER 4  Prokaryotic Organisms

withstand about 25 atmospheres of pressure before rupturing (Figure 4.3). Although their peptidoglycan layer is thinner, gram-negative bacteria are well protected by the selective permeability of their outer membrane. Any molecules too large to move through porins are excluded from entering the bacterium by the barrierlike outer membrane. This is clinically significant because gram-negative bacteria are resistant to large antibiotics such as vancomycin that cannot pass through the porins.

Atypical Cell Walls Although most bacteria have either a gram-positive or gram-negative cell wall, several groups have diverged during evolution and now differ significantly from their gram-positive ancestors. Bacteria with atypical cell walls include the acid-fast bacteria and the wall-less bacteria.

Acid-fast bacteria Acid-fast bacteria have a cell wall made of a thick layer of peptidoglycan similar to grampositive cells. However, the peptidoglycan is linked to disaccharides that are attached to mycolic acids, which are long-chain fatty acids. The sugar/mycolic acid layer is then overlaid with a hydrophobic layer high in lipids. Porins are required to transport small hydrophilic molecules through the acid-fast cell wall. The combination of mycolic acids and lipids make the bacteria impermeable to many chemicals; consequently, the cells hold fast to the primary dye used in the acid-fast staining procedure (see Remember This!). The cell wall composition also makes these bacteria highly resistant to many antibiotics and disinfectants. Remember This!  The acid-fast stain is used to identify acid-fast bacteria from non–acid-fast bacteria. If necessary, review the acid-fast staining procedure from Section 3.3 before continuing.

Wall-less bacteria Wall-less bacteria include the Ureaplasmas, which cause urogenital infections, and the Mycoplasmas, which cause walking pneumonia (see the Case Study). Because these bacteria lack a cell wall, they can only survive in isotonic environments (ones with solute concentrations the same as that of their cytoplasm) or they risk osmotic lysis. By living inside the cells of the organisms they infect, the wall-less bacteria receive the protection normally provided by a cell wall. Because they are wall-less, these bacteria have undefined shapes. Most are shaped like cocci, but there are elongated and irregular forms as well. With a diameter of approximately 300 nm, the wallless bacteria are also some of the smallest bacteria. They also have very small genomes, with some consisting of only 500 genes—too small to actually code for all the enzymes needed for life. As a result, these organisms must acquire some of their enzymes and nutrients from their host.

Case Study A Walking Pneumonia Outbreak at a University

✓ The Planner

b. An electron micrograph of Mycoplasma pneumoniae cells

© BSIP SA/Alamy

Working as an epidemiologist with the Georgia Department of Public Health, Janet completed her final assessment of the walking pneumonia outbreak that occurred during fall semester 2012 at the Georgia Institute of Technology (Figure a). She was relieved that the largest pneumonia outbreak at a U.S. university in 35 years was finally over.

a. The number of Mycoplasma pneumoniae cases among

Number of cases

students at Georgia Institute of Technology in 2012 16 14 12 10 8 6 4 2 0

3. Why do the Mycoplasma bacteria shown have such unusual cell shapes? 4. Predict the effectiveness of treating a Mycoplasma infection with penicillin, an antibiotic that inhibits cell wall synthesis. Aug 4 Aug 18 Sep 1 Sep 15 Sep 29 Oct 13 Oct 27 Nov 10 Nov 24

Week of illness onset (Data from: Mycoplasma pneumoniae Outbreak at a University — Georgia, 2012. (2013, August 2). Retrieved July 10, 2015, from http://www.cdc.gov/mmwr/ preview/mmwrhtml/mm6230a2.htm#Fig.)

1. How long did the outbreak last? 2. How many total students were diagnosed? When the physician at the university health center called Janet in October reporting a sudden increase in students presenting with sore throat, fever, headache, fatigue, and a dry cough that sometimes occurred as violent spasms, she immediately suspected the infectious culprit to be Mycoplasma pneumoniae (Figure b). She knew this extremely small, wall-less bacterium was easily transmitted via respiratory droplets from coughs and sneezes by people living and working in crowded places, like a university. This mild form of pneumonia occurs most often in people younger than age 35 and is sometimes called walking pneumonia because patients are usually still able to function.

1. How does the cell wall prevent cell lysis? 2. How are the glycan chains linked into threedimensional structures?

Janet collaborated with the university health center staff to test respiratory samples from the affected students and quickly confirmed M. pneumoniae as the causative agent. To curtail the outbreak, Janet and school administrators implemented an outreach campaign to alert the university community and educate them on healthy practices to minimize pathogen transmission in the college setting. Investigate: 5. Should Janet’s prevention plan include administering a vaccine against walking pneumonia? Using a survey to assess the effectiveness of their outreach campaign, Janet was pleased that 79% of the students who were aware of the outbreak reported following her recommendations to reduce infection spread. She was frustrated, however, to discover that 54% of the campus was completely unaware of the outbreak, putting them at high risk both for acquiring the infection and for serving as a pathogen reservoir that could extend the outbreak. 6. What methods of communication do you think would be the most effective means of reaching college students with this vital information?

3. What environmental adaptations enable Mycoplasma to survive without a cell wall? The Bacterial Cell Wall  93

4. 4

External Structures of Bacterial Cells

LEARNING OBJECTIVES 1. Describe the structure and functions of the glycocalyx and capsule. 2. Describe the structure and functions of fimbriae and pili. 3. Explain the structure and functions of flagella. s bacteria evolved, natural selection produced variants that were better adapted for survival in new and changing environments. Over time, specialized structures evolved that provided selective advantages to new species of bacteria. Specialized structures located outside the plasma membrane and cell wall interact directly with the environment. These structures have functions that expand a bacterium’s potential habitat or enable it to survive during unfavorable environmental conditions. They include the glycocalyx, fimbriae and pili, and flagella (Figure 4.6).

A

The Glycocalyx The bacterial glycocalyx generally consists of a network of simple polysaccharide chains layered just outside the cell wall, making it the glycocalyx The outermost coating for those extracellular carbohybacteria that possess it. If the drate and glycoproglycocalyx is gellike and firmly tein coating produced attached to the cell, it is known by some bacteria. as a capsule. If it is more fluid and loosely attached, it is known as a slime layer. These structures can protect a cell from desiccation or enable it to colonize a new niche. For example, Streptococcus mutans synthesizes a sticky capsule that enables it to adhere to the enamel surface of a tooth. Because cells of S. mutans and other bacterial species attach to the teeth,

External structures of a bacterial cell • Figure 4.6

they form dental plaque, an oral biofilm, or microbial community. Synthesis of the bacterial capsule requires the breakdown of the sugar sucrose. Sucrose can also be fermented to acid that can damage the enamel and cause tooth decay. Capsules also a allow bacteria to avoid phagocytosis. Different variants of S. pneumoniae that can synthesize a capsule are pathogenic, but those that are unable to make a capsule do not cause disease.

Fimbriae and Pili Many bacterial species have hairlike structures composed of the protein pilin that extend from the surface, called fimbriae and pili. A fimbria (plural fimbriae) is a straight, stiff, short filament that is 6 to 7 nm in diameter (Figure 4.7). Fimbriae are numerous, with approximately 100 to 400 per cell and function in bacterial attachment to surfaces. They can be found on both grampositive and gram-negative bacteria. A pilus (plural pili) is a longer, thicker appendage found on the surface of all gram-negative bacteria and on a few gram-positive bacteria. Some pili are essential for attaching bacterial pathogens to host cells and initiating infection. For example, N. gonorrhoeae attaches to the cells of the mucosal lining of the reproductive tract with proteins found on the tips of the pili that bind to receptors on a host cell. As a result, the pathogen is not washed away by vaginal secretions or urination. A conjugative pilus is longer and cells have fewer of them (approximately one to six per cell) than common pili. A conjugative pilus forms a fragile hollow tube that can connect to another bacterium of the same or a closely related species (Figure 4.7). This allows the transfer of genetic material from the pilus-forming cell to the recipient cell. Still other pili function in motility. The tip of a Glycocalyx Common pili/fimbriae

The external structures of bacterial cells include the glycocalyx, pili and fimbriae, and flagella. The glycocalyx protects the cell, whereas the pili and fimbriae help in adherence, and flagella contribute to motility.

A sk Yo u rs e l f Between the pilus and the flagellum, which structure is not anchored to the plasma membrane?

94  CHAPTER 4  Prokaryotic Organisms

Flagellum

Plasma membrane Peptidoglycan

Capsule

Conjugative pilus

Most bacteria possess numerous fimbriae that encourage their adhesion to various surfaces, including host cells, which facilitates infection. The longer conjugative pilus joins two Escherichia coli cells allowing the transfer of genetic material.

A sk Yo u rs e l f

Fimbriae

The multiple hairlike extensions of the bacterial cell used for attachment are _____ , and the long extension used for the transfer of genetic material is a _____ .

pilus adheres to a surface then shortens, causing the cell to be dragged forward. As the process is repeated, the cell advances in an irregular manner called twitching motility.

Flagella Motility is an important evolutionary adaptation for most bacteria. The ability to move enables a bacterium to

Karsten Schneider/Science Source

A comparison of fimbriae and pili • Figure 4.7

potentially find a new microenvironment with additional resources for growth. For pathogenic bacteria, motility allows migration to sites where they can more easily avoid host defenses. Flagella are the most common bacterial structure for motility. A flagellum (plural flagella) is a stiff, helical, protein filament that rotates to propel a bacterium through its liquid environment. The numbers and arrangements of flagella differ with the species (Table 4.2).

Common flagellar arrangements  Table 4.2 Flagellar arrangement

Description

Example

Monotrichous

A single flagellum at the end of the cell

Vibrio cholera, a water contaminant

Amphitrichous

A single flagellum or a tuft of flagella at both ends of the cell

Helicobacter pylori, the pathogen responsible for gastric ulcers

Lophotrichous

A tuft of flagella at the end of the cell

Alcaligenes faecalis, a common intestinal resident

Peritrichous

An all-over, random flagellar arrangement

E. coli, the dominant intestinal resident

External Structures of Bacterial Cells  95

A flagellum is made up of three parts: the filament, a hook, and a basal body (Figure 4.8a). The long, hollow, helical filament made of the protein flagellin is 5 to 10 μm long and attached to a hook, or flexible connector. The hook anchors the flagellum to the basal body, a structure embedded in the cell wall and plasma membrane. It consists of a rod attached to four rings in a gram-negative bacterium and two rings in a gram-positive bacterium. The basal body is the molecular motor that rotates the filament at a rate of 300 revolutions/second using energy derived from the diffusion of a hydrogen ion gradient. Bacterial movements in response to specific stimuli are called taxes (singular taxis). Some bacteria exhibit chemotaxis, a response to a chemical gradient, or phototaxis, a response to variable light intensity. In chemotaxis, receptors on the bacterial surface bind to the chemical, which initiates a chain of chemical reactions that affect the direction of the flagellar rotation. When the flagella rotate counterclockwise, bacteria with polar flagella and peritrichous flagella run, or move forward. When the flagella rotate clockwise, bacteria with polar flagella move in reverse, and those with peritrichous flagella tumble in random directions. Binding attractant chemicals such as galactose or oxygen send internal signals favoring counterclockwise rotation and chemotactic progress. As the bacterium gets

closer to the attractant chemical source, it has longer run times and fewer tumbles. The binding of repellant chemicals, such as toxins, triggers clockwise rotation and runs away from the chemical. Run times decrease and tumbles are more frequent as the bacterium successfully avoids the repellent (Figure 4.8b). Because both chemotactic and phototactic responses are composed of a series of runs and tumbles, there are small random movements, but the net movement is directional. In one group of bacteria, the spirochetes, two flagella are assembled within the periplasmic space between the outer membrane and the plasma membrane. These two internal flagella, termed axial filaments, are anchored at the end of the cell by a basal body. As the axial filaments rotate, they cause the entire cell to move forward with a corkscrewlike motion. This enables spirochetes to move through viscous mucous that impairs the movement of externally flagellated bacteria. The presence of axial filaments or standard flagella correlates with increased bacterial virulence because these motile pathogens are better able to invade host tissues. Because flagellated microbes are often clinically significant, microbiologists can use their presence, number, and arrangement for bacterial identification (see The Microbiologist’s Toolbox), the first step in determining antimicrobial therapy.

The structure and function of bacterial flagella • Figure 4.8 Most bacteria possess one or more hairlike projections, or flagella, that permit locomotion.

a. Flagellar structure The long flagellar filament attaches to the curved hook region and rotates rapidly when the rings and rod of the basal body spin, using energy released from the diffusion of a hydrogen ion gradient.

b. Negative chemotaxis This peritrichous bacterium coordinates the rotation of its flagella to run (swim) away from repellent chemicals. Despite periodic tumbles as the flagella temporarily rotate in the opposite direction, the net result is movement away from a harmful substance. Chemotaxis Tumble

Flagellum Hook Run Outer membrane

Basal body

Peptidoglycan

Periplasm

Plasma membrane Rod

Rings

96  CHAPTER 4  Prokaryotic Organisms

Repellant gradient

Th in k Cr it ica lly 1. If the bacterial cell in part b had encountered an attractant chemical like galactose rather than a toxin, how would its swim pattern differ? 2. How would its flagellar movement differ?

T he Microbiologist ’ s T oolbo x

✓ The Planner

The Flagella Stain

Gary E. Kaiser, Ph.D.

Although their flagella can be several times the length of a bacterial cell, they are too thin (15- to 20-nm thick) to be seen with a light microscope. Flagella must be coated with special stains to increase their diameter or they must be viewed with an electron microscope. Simple staining procedures use a mordant to form an insoluble compound that binds to the flagella, increasing their diameter and giving them color. The thickened and stained flagella can then be viewed with a light microscope (see the Figure). This staining technique is a useful tool for the microbiologist because it allows analysis of flagellar arrangement. This is clinically significant because flagellar arrangement can be used for pathogen identification and correlates with the microbe’s ability to spread within the host.

Pu t I t To g e ther

Review Table 4.2, and answer this question. The special staining of this bacterial specimen demonstrates a _____ flagellar arrangement.

1. How does the presence of a capsule enhance bacterial survival?

4 .5

A light micrograph showing clearly stained flagella of Salmonella spp.

2. How do pili move bacterial cells? 3. How do flagella move bacterial cells?

Internal Structures of Bacterial Cells

LEARNING OBJECTIVES 1. Describe the plasma membrane. 2. Explain the functions of the nucleoid. 3. Describe the ribosomes. 4. Describe the plasmids, inclusion bodies, and other internal organelles of bacterial cells. 5. Describe the endospores. he interior of bacterial cells is filled by the fluid cytoplasm. The cytoplasm is the reservoir of all the cell’s water-soluble metabolites and the location of the cell’s internal structures. It is a mixture of soluble inorganic ions, metabolic

T

cytoplasm The gellike solution of water and inorganic and organic substances that fills the cell; contains all the internal cell structures.

precursors, and macromolecules. Metabolites diffuse through the cytoplasm to carry out the chemical processes of life. Several filamentous cytoskeletal proteins add to the viscosity of the cytoplasm. These proteins function in determining cell shape and positioning internal structures. The chemical makeup of the cytoplasm also determines cellular pH and the osmotic pressure a cell experiences in its environment. The cytoplasm is viscous enough that the rate of diffusion of a protein is about 10 times slower in the cytoplasm than in water. This reduced rate of diffusion is probably a significant factor in limiting the size of prokaryotic cells. The most significant internal structures of bacterial cells include the plasma membrane, nucleoid, and ribosomes. Although prokaryotic cells are very small, they also contain a variety of other specialized structures, many of which adapt the microbe to a specific habitat. Internal Structures of Bacterial Cells  97

Process Diagram

✓ The Planner

Transport across the bacterial plasma membrane • Figure 4.9 The hydrophobic tails of the fatty acids of the phospholipid bilayer serve as a barrier to the diffusion of small polar metabolites across the plasma membrane. Steroids help to provide fluidity to the membrane. Integral membrane proteins regulate the passage of some substances across the phospholipid bilayer. 1 Simple diffusion Simple diffusion is a passive transport process in which a molecule passes directly across the membrane down its concentration gradient with no expenditure of cell energy.

2 Facilitated diffusion Facilitated diffusion is a passive transport process in which a molecule crosses the membrane down its concentration gradient with the aid of permease. Steroid

Water

Hydrophilic heads ATP

Cytoplasm

Aquaporin

Th in k Cri ti c a l l y the membrane?

Peripheral membrane proteins

Hydrophobic tails/fatty acid molecules

Integral membrane proteins

Phospholipid bilayer

3 Active transport Active transport is an energy-requiring process in which a transport protein pumps a molecule across the membrane against its concentration and/or electrical gradient.

Why are the steroids oriented as they are pictured in

The Plasma Membrane All living cells have a plasma membrane, also called a cell membrane, that separates the cell’s internal components from its environment. This membrane is a fluid phospholipid bilayer with embedded proteins. The plasma membranes of bacterial cells differ slightly in structure from those of eukaryotic cells. They contain different steroids to promote fluidity and have a significantly higher proportion of proteins that participate in enzymatic reactions, signaling, and transport, shown in Figure 4.9. Overall membrane function, however, is the same. It functions to regulate the passage of material into and out of the cell. The phospholipid bilayer serves as a general permeability barrier and traps ions, polar metabolites, and macromolecules inside the cell, but allows free diffusion of small hydrophobic molecules such as methane or ethylene. O2 and CO2 are small and nonpolar and therefore diffuse freely across the membrane. Water is small but polar. Aquaporins, a special class of proteins, form small pores in the membrane that aid in the diffusion of water through the plasma membrane. Other small molecules can be excluded from moving across the membrane.

98  CHAPTER 4  Prokaryotic Organisms

For example, because hydrogen ions are charged, they cannot diffuse through the bilayer and a hydrogen ion gradient can exist across the membrane. Because hydrogen ions carry a charge, this chemical gradient also produces an electrical gradient. The electrical gradient across the membrane can store energy similar to a battery. Passive transport is diffusion of small, nonpolar molecules across the membrane down their concentration gradients. To diffuse polar molecules across the membrane requires assistance from transmembrane channels, or permeases, and is known as facilitated diffusion. This spontaneous transport process allows many extracellular molecules that the cell could use as energy sources or as building blocks to diffuse across the plasma membrane at rates fast enough for cell survival and growth. When metabolites must move against their concentration gradients to enter or leave the cell, active transport processes are used. Active transport is an energy-requiring process that couples the movement of molecules or ions across the membrane with the hydrolysis of adenosine triphosphate (ATP) or the flow of another molecule down its concentration or electrical gradient.

In addition to transport proteins, the plasma membrane also contains important enzymes and enzyme complexes. These are responsible for running the biochemical reactions essential for bacterial survival. Other plasma membrane proteins serve as receptors, binding the pathogen to the surface of a host cell or participating in cellular communication. When proteins extend completely through the phospholipid bilayer, they are known as integral membrane proteins. Peripheral membrane proteins are associated with only one side of the phospholipid bilayer.

The Nucleoid In prokaryotes, the nucleoid is the region that contains the chromosome, which carries the cell’s genetic material. Nearly all bacteria have a single nucleoid The DNAcircular bacterial chromosome containing region of that contains their genetic inforthe prokaryotic cell. mation. It ranges from about 0.5 to 10 million base pairs in length, bacterial making the DNA 100× to 1000× chromosome In longer than the cell itself. To fit, the prokaryotes, the cirthin DNA is in a highly folded and cular DNA-containing twisted state. Because the DNA is structure that holds the organism’s so condensed, transcription of the genetic information. DNA into RNA only occurs at the outer surface of the nucleoid. Entranscription The vironmental factors and even the process by which the process of transcription lead to congenetic information stant twisting and supercoiling of in DNA is copied into the bacterial chromosome. This exRNA; the RNA molposes different genes at the surface ecule is synthesized of the nucleoid, where they have using a DNA template. an opportunity to be transcribed. Chromosomes need about 800 genes to synthesize essential enzymes and produce the structural components of the cell. However, bacterial chromosomes have thousands of genes, allowing bacteria to adapt to changes in their environment. For a soil bacterium, there are significant daily

and seasonal changes in temperature, pH, osmolarity, and nutrient sources. All of these different conditions require changes in metabolism and gene regulation to optimize growth and competition with other soil microbes. Consequently, the cell needs many more genes than just those essential for survival in a single environment.

Ribosomes Ribosomes are the smallest functional structures in bacterial cells, measuring only 70 Svedberg units (70S) in size. A Svedberg unit (S) is a measure of structure size based on its rate of travel in a tube subjected to high centrifugal force, therefore considering both ribosome A small mass and shape so the units are not particulate structure additive. Consequently, the two composed of riboparts of the ribosome, the small somal RNA (rRNA) 30S subunit and the large 50S sub- and proteins that is unit, come together to make a full- the site of protein sized, but different-shaped, 70S synthesis.  ribosome (Figure 4.10a). Bacterial ribosomes have translation The process by which about 50 different ribosomal proproteins are syntheteins (r-proteins) in their two subsized by ribosomes units, which are assembled on a from information conribosomal RNA (rRNA) scaffold- tained in mRNA. ing. There are three rRNAs (16S rRNA, 23S rRNA, and 5S rRNA), which have enzymatic activity and catalyze the assembly of amino acids into proteins by the process of translation (Figure 4.10b). The r-proteins stabilize the rRNA structure, unwind the messenger RNA (mRNA), and provide docking sites for regulatory proteins. In addition to the mRNA and ribosomes, transfer RNAs and other translational protein factors are required. Protein synthesis is a major cell process and determines how fast it can grow. In rapidly growing cultures of Escherichia coli, there are 200,000 ribosomes per cell and protein synthesis consumes about 90% of the ATP produced by the cell.

Bacterial ribosomes • Figure 4.10 Bacterial ribosomes are found in the cytoplasm, where they use information in the genetic sequences in messenger RNA (mRNA) to code for the amino acid sequences of proteins. ribosome is composed mostly of rRNA with many smaller r-proteins embedded in or attached to the surface.

Harry Noler/Center for Molecular Biology of RNA University of California, Santa Cruz

a. A bacterial

r-proteins

50S subunit

30S subunit rRNA

b. This simplified diagram of the actual structure of the ribosome shown in Figure a shows the general shape of a 70S ribosome bound to mRNA and synthesizing a protein.

Growing protein 50S subunit mRNA 30S subunit

A sk Yo u r se lf This figure does not show a necessary component of protein synthesis. This component is the _____. a. rRNA   b. riboproteins   c. tRNA   d. amino acids

Bacterial inclusion bodies  Table 4.3 General function

Inclusion

Specific use

Storage of carbon/energy polymers

PHA (poly-ß-hydroxyalkanoate)

Serves as carbohydrate source for synthesis of ATP and metabolic intermediates

Glycogen

Serves as carbohydrate source for synthesis of ATP and metabolic intermediates

Polyphosphate granules

Provides phosphorus used in synthesis of ATP, other nucleotides, and nucleic acids

Sulfur granules

Required for the synthesis of some amino acids and proteins

Carboxysome

Stores rubisco, which acts in CO2 fixation in autotrophic bacteria

Enterosome

Uses enzymes to degrade toxic compounds

Trapping gas

Gas vesicle

Confers buoyancy for aquatic cyanobacteria

Magnetotaxis

Magnetosome

Directs swimming by interaction with the magnetic field to direct bacterial attachment to the appropriate substrate

Photosynthesis

Thylakoid

Converts CO2 into glucose

Storage of molecules needed for biosynthesis

Storage of enzymes

Plasmids, Inclusion Bodies, and Membranous Structures In addition to the chromosome, many bacteria carry plasmids, which are extrachromosomal genetic elements. Plasmids range from one plasmid A small, cirto hundreds of genes and from cular, DNA molecule one to hundreds per cell. The that replicates indegenes on plasmids generally give pendently of the bacthe bacteria a selective advantage terial chromosome. in unusual environments. For example, it is common to find plasmids in Pseudomonas bacteria that have been isolated from soil polluted from an oil spill. The proteins produced by the plasmids help the bacteria break down petroleum products. Other soil bacteria carry antibiotic resistance genes that give them

a survival advantage in their communities. Plasmids with such genes are common in health care systems. Plasmids are also key tools in molecular biology and gene cloning.

Inclusion bodies  Inclusion bodies are generally small cytoplasmic structures whose composition and function varies with bacterial species (Table 4.3). Often they act as a inclusion body molecular stockpile, storing sub- A cytoplasmic stances needed by the cell (Figure aggregate that often 4.11a). Inorganic chemicals such consists of stored as calcium, sulfur, or phosphate materials. can be stored as cystoplasmic granules in the cytoplasm. Organic polymers such as glycogen serve as energy-storage compounds because they can be degraded for ATP production.

Inclusion bodies • Figure 4.11

store the principle enzyme needed to initiate photosynthetic reactions.

Pu t It To g e th e r

Carboxysomes

Review Table 4.3, and answer this question. What type of inclusion body buoys cyanobacteria up to receive sufficient light for initiation of photosynthesis in thylakoids and use of CO2-fixing enzymes in the carboxysomes?

b. Thylakoids are stacked, flattened membranous sacs with the appropriate proteins embedded to run photosynthesis.

Thylakoids

Reproduced with permission from Miller SR et al. PNAS 2005, 102:850-855

a. Carboxysomes

Tsai Y, Sawaya MR et al. (2007) Structural Analysis of CsoS1A and the Protein Shell of the Halothiobacillus neapolitanus Carboxysome. PLoS Biol 5(6): e144. doi:10.1371/journal. pbio.0050144

Inclusion bodies are a diverse group of prokaryotic intracellular structures.

Inclusion bodies have many other functions.

Magnetosomes allow bacteria to respond to Earth’s

magnetic field and swim downward until encountering an appropriate substrate for attachment. Gas vesicles provide buoyancy so aquatic photosynthetic bacteria float in the water column at a depth where they receive optimal light intensity. Although bacteria typically lack membranebound internal structures, some photosynthetic bacteria that have evolved simple membranous compartments to localize chemical reactions and increase the surface area of membrane-based reaction centers (Figure 4.11b). These structures, called thylakoids, organize the enzymes and electron transport proteins needed for the light reactions of photosynthesis. Similar internal membrane structures are found in bacteria that obtain their energy from the oxidation of inorganic chemicals, such as hydrogen sulfide or reduced iron, rather than from light.

Endospores Several genera of bacteria can produce dormant cells known as endospores that are highly resistant to harsh environmental conditions. Not only can endospores survive temperature extremes, they are unaffected by exposure to ultraviolet radiation, toxins, antibiotics, and desiccating conditions. Bacillus and Clostridium are the most clinically significant genera of endospore forming bacteria. Different species of these microbes are responsible for causing infections such as anthrax, food poisoning, gas gangrene, botulism, and tetanus. Because their thick protective walls are resistant to disinfectants and antibiotics, it is critical to prevent endospore contamination in medical settings (see the Clinical Application). All surgical instruments and indwelling devices must be sterilized by heat plus pressure

Clinical Application

a. Clostridium difficile, a common hospitalacquired pathogen, forms endospores. Endospores

Biomedical Imaging Unit, Southampton General Hospital/Science Source Images

Although not many pathogenic bacteria form endospores, those that do are very difficult to treat because they are only susceptible to antibiotics when actively growing as vegetative cells. One endospore-forming pathogen, Clostridium difficile (Figure a), is a common hospital-acquired pathogen. It doesn’t cause disease in healthy individuals, but if the normal bacteria in the large intestine are killed by long-term, broad-spectrum antibiotic therapy, C. difficile is still able to survive and grow. As a result, it can cause pseudomembranous colitis (Figure b),

colitis, or significant damage to the intestinal mucosa, occurs when C. difficile endospores germinate and thrive in the gut.

David M. Martin, M. D./Science Source Images

b. Pseudomembranous

a type of bloody diarrhea that is very difficult to treat. Although antibiotics can work, therapy is long, expensive, and recurrence rates are high (Figure c). The most successful treatment strategies are those that restore the normal intestinal microbiota.

c. Percent failure and/or recurrence of infection after vancomycin treatment 60 50 Percentage (%)

Endospore-forming Bacteria

✓ The Planner

40 30 20 10 0

1980 1981 1983 1984 1985 1986 1989 1992 1994 1996 2005 Year of study

(Data from: Aslam, S., Hamill, R., & Musher, D. (n.d.). Treatment of C. difficile–associated disease: Old therapies and new strategies. The Lancet Infectious Diseases, 549–557.)

In t e r p r e t t h e Da t a 1. What year was the lowest failure and/or recurrence rate for treating Clostridium difficile–associated diarrhea? 2. What year was the highest rate?

Internal Structures of Bacterial Cells  101

Process Diagram

✓ The Planner

Endospore formation • Figure 4.12 In bacteria, vegetative cells reproduce by binary fission. Some bacterial species can also undergo sporulation. Vegetative cell

6b When environmental conditions are

favorable, the endospore germinates, releasing a new vegetative cell.

1 Nucleoid replication occurs. Spore septum

Free endospore

2a Formation of a cell wall

2b A plasma membrane ingrowth,

between the two nucleoids completes binary fission.

or spore septum, encloses a small amount of cytoplasm and a copy of the nucleoid, forming a forespore.

5b Lysis of the original

cell releases the endospore.

Spore coat

Forespore 3a Daughter cells

separate.

3b Peptidoglycan layers

are laid down between the membrane layers of the spore septum.

4b A thick, protective

protein spore coat forms outside of the peptidoglycan layers.

Peptidoglycan layers

a. Vegetative cell reproduction Under favorable conditions, a vegetative cell grows and divides normally.

b. Sporulation When harsh environmental conditions are encountered, an endospore forms. The endospore contains a copy of the nucleoid, ribosomes, RNA, and enzymes. Its contents are partitioned off from the rest of the cell by an ingrowth of plasma membrane, which is then surrounded by peptidoglycan and a tough spore coat.

A sk Yo u rs e l f In the first step of bacterial sporulation, the _____ . a. endospore is released from the cell b. DNA is replicated

c. chromosome is surrounded by a tough cortex and spore coat d. plasma membrane encompasses the DNA

in an autoclave or by treatment with gamma radiation. Only drastic practices such as these are able to damage the endospore wall, allowing destruction of the cell within. Alcohol-based gels are ineffective at decontaminating the hands of health care providers, who are encouraged to wash with soap and water to physically remove endospores. Under favorable conditions, bacterial cells grow and reproduce by binary fission (Figure 4.12a). However, when normal vegetative bacterial cells encounter a harsh environment, metabolically inactive endospores form. The process of sporulation, which takes about 6 to 8 hours, begins with the invagination of the plasma membrane

102  CHAPTER 4  Prokaryotic Organisms

(Figure 4.12b). Known as a spore septum, this membrane ingrowth encloses a small amount of cytoplasm, a newly replicated nucleoid, ribosomes, RNA, and enzymes. Layers of peptidoglycan are deposited between the double layer of the spore septum, forming a resistant cortex. Next, a thick, protective protein coat forms outside of the peptidoglycan layers to produce the spore wall. Inside the developing endospore, calcium dipicolinate dehydrates the cell. Because DNA and proteins are only vulnerable when in solution, this practice protects these enclosed molecules when the endospore is exposed to extreme heat. The mature endospore is released when the original cell lyses.

When the endospore encounters water and other favorable conditions, such as suitable temperatures and appropriate nutrients, it germinates. The enzymes within the endospore degrade the cortex and spore coat, allowing the uptake of water and nutrients. It takes about 1.5 hours to revive the dormant cell, which then grows and reproduces by the vegetative cycle (Figure 4.12a). Because one endospore develops into just one new vegetative cell, sporulation is not a reproductive process, but a highly effective survival mechanism. In fact, endospores are so resistant they can be freeze-dried and dispersed by the explosion of a bomb and still remain infectious. Endospores of Bacillus anthracis, which causes a lethal form of anthrax when the spores are inhaled, have been turned into a bioweapon. Endospores have been germinated into growing cells after being frozen in ice for 10,000 years and after being fossilized in amber for 25 million years. Endospores are so heat resistant that they

4 .6

can be boiled without being killed. As a result, food products must be canned under high temperatures and pressures to kill endospores and prevent foodborne illness.

1. Why are the various membrane proteins needed to regulate the movement of materials into and out of a cell? 2. Why are most of the genes on the bacterial chromosome considered nonessential? 3. What substances, besides rRNA, are needed at the ribosomes for protein synthesis? 4. Why are plasmids important for the survival of some bacterial pathogens? 5. Why are endospores a health care problem?

Prokaryotic Evolution and Classification

LEARNING OBJECTIVES 1. Explain the early evolution of the three domains of life.

2. Describe how bacteria and archaea are classified.

o one knows whether, billions of years ago, life evolved on Earth once or multiple times, but by analyzing the many characteristics shared by all living things, it appears that all life descended from a common ancestral cell. This ancestor had a plasma membrane that regulated the passage of materials into and out of the cell and nucleic acids for genetic information. It also used ATP as an energy source and had evolved basic metabolic pathways probably similar to those that we see in cells today. Evolution has given rise to millions of different prokaryotic organisms. To understand how these living organisms relate to each other, it is necessary to classify them into groups based on their structures and biochemical makeup. In this section, you will discover theories on how life evolved and how the early tree of life split into the major groups of prokaryotic organisms, along with current schemes used for classifying bacteria.

different organisms can reveal the evolutionary connections between them. The nucleotide sequence in Bacteria A domain the gene that codes for the 16S of prokaryotic organrRNA of the small ribosomal subisms that do not unit has been used to establish have a membranethe evolutionary relationships be- bound nucleus and tween all prokaryotic organisms. inhabit virtually all Some regions within this gene environments. evolve very slowly and maintain sufficient similarity to make com- Archaea A domain

N

The Tree of Life Over the past 3.8 billion years, countless diverse organisms have evolved, including millions of microbial species. The sequence of nucleotides in DNA holds a wealth of information about an organism’s evolutionary history. A comparison of the nucleotide sequences of

parisons between the most distantly related organisms. Other gene regions change relatively rapidly so even closely related organisms show genetic differences. Comparison of 16S rRNA gene sequences demonstrated that prokaryotes include two distinct lineages—the Bacteria and the Archaea. The third primary lineage of living things, the Eukarya, diverged from the Archaea and includes all eukaryotic organisms. The Bacteria, Archaea, and Eukarya are the domains of

of prokaryotic organisms that do not have a membrane-bound nucleus, are genetically distinct from bacteria, and can exploit extreme environments or produce methane.

Eukarya A domain of organisms that have cells with a membrane-bound nucleus and complex organelles.

Prokaryotic Evolution and Classification  103

Bacterial classification • Figure 4.13 Because bacterial classification is especially challenging, multiple organization schemes are used to highlight the evolutionary relationships between organisms, providing valuable information to microbiologists.

a. The tree of life

BACTERIA

Because all living things share certain fundamental features, there was most likely one common ancestor of all modern living organisms. On the evolutionary tree, organisms that are distantly related to one another are separated by long distances; closely related organisms are placed on short branches with adjacent or common nodes. Here, related organisms are shown in the same color.

ARCHAEA

EUKARYA

Animals Green Methanogens Slime filamentous Entamoebae molds bacteria Extreme Fungi Extreme Gramthermophiles halophiles positive Plants bacteria Ciliates Proteobacteria Flagellates

Cyanobacteria

Trichomonads

Bacteroides Thermatoga

Microsporidia Diplomonads Common ancestor

b. Taxonomic classification of bacteria based on genetic comparisons of 16S rRNA gene sequences Phylum

Genus name

General properties

Actinobacteria

Mycobacterium

Acid-fast pathogen

Propionibacterium

Anaerobic propionic acid producer

Streptomyces

Antibiotic-producing filamentous bacteria

Aquificae

Aquiflex

Hyperthermophilic, chemoautotrophic bacteria

Bacteroidetes

Bacteroides

Obligate anaerobe; significant component of intestinal flora

Cytophaga

Gliding locomotion

Chlamydia

Intracellular pathogen

Chlamydiae Chlorobi

Chlorobium

Green sulfur bacteria perform anoxygenic photosynthesis

Chloroflexi

Chloroflexus

Green nonsulfur bacteria that perform anoxygenic photosynthesis

Cyanobacteria

Synechococcus

Widespread, abundant blue-green alga that performs oxygenic photosynthesis

Deinococcus-Thermus

Deinococcus

Highly resistant to radiation and/or heat

Firmicutes

Lactobacillus

Lactic acid producer; component of normal vaginal microbiota

Staphylococcus

Component of normal skin microbiota; may be pathogenic

Clostridium

Anaerobic, endospore-forming pathogen

Planctomycetes

Planctomyces

Possess a holdfast to facilitate attachment following budding; lack peptidoglycan in cell walls

Proteobacteria

Bdellovibrio

Predatory bacteria

Pseudomonas

Opportunistic pathogen

Escherichia

Dominant component of intestinal flora

Myxococcus

Soil microbe that forms swarming aggregations

Agrobacterium

Cause of tumor-like growth in plants

Rickettsia

Intracellular pathogen

Neisseria

Pathogenic and commensal diplococci

Spirochetes

Treponema

Spirochetes motile by axial filaments

Leptonema

Aquatic and soil microbe

Tenericutes

Mycoplasma

Gram positive, low guanine + cytosine

Thermotogae

Thermatoga

Hyperthermophilic, chemoautotrophic bacteria

104  CHAPTER 4  Prokaryotic Organisms

A sk Yo u r se lf Which of the following groups are most closely related? a. flagellates and spirochetes b. animals and methanogens c. ciliates and slime molds d. cyanobacteria and extreme halophiles

because it allows rapid pathogen identification for diagnosis (Figure 4.14). The species is the fundamental unit of classification in biology. Its meaning is clearly defined for macroscopic plants, fungi, and animals that reproduce sexually. For these organisms, a species is a group of actually or potentially interbreeding populations. However, this definition fails for prokaryotes, which reproduce asexually through binary fission rather than sexually. A prokaryotic species is more accurately described as a group of genetically similar individuals that are adapted for life in similar environments. An issue is how genetically similar different prokaryotes need to be to be considered members of the same species. At present, it is generally accepted that members of a bacterial species show a 70% or greater DNA relatedness as measured by DNA hybridization studies and a less than 5% variation in the amount of G and C in their DNA. They also show a clear phenotype distinction from other species. Approximately 10,000 prokaryotic species have been identified, but microbiologists estimate 10 million species as a full count of total prokaryotic diversity. Because of this broad diversity, a simple genus and species classification probably couldn’t describe important genetic variants within a species. Therefore, it is sometimes

life—the three main branches on the evolutionary tree of life proposed by Carl Woese (Figure 4.13a). Today, microbial organisms, especially those that can’t be grown in the lab, are routinely classified by their 16S rRNA sequence. A traditional classification scheme based on phylum, class, order, family, genus, and species (Figure 4.13b) was integrated with the tree of life strategy by nonclinical microbiologists. This allows DNA sequence analysis to determine phylogenetic relationships among different bacterial species and their organization using a phylogenetic tree. This branching diagram depicts the evolutionary relationships among various groups based on their implied descent from a common ancestor. Organisms whose gene sequence indicates they shared a common ancestor are located on the same branch of the tree. The length of the lines between nodes is proportional to the evolutionary distance.

The Clinical Classification of Prokaryotes Early classification schemes for prokaryotes were based primarily on cell shape and Gram-stain reaction. This type of system is still used by clinical microbiologists

Practical classification of bacteria for clinical use • Figure 4.14 Bacteria can be grouped for rapid pathogen identification for medical diagnoses using cell shape and arrangement, followed by analysis of biochemical properties of the specimens. Gram positive

Bacilli

Gram negative

Cocci

Do not form endospores

Bacilli

Form chains

Aerobic

Streptococcus

Pseudomonas

Listeria Form endospores

Anaerobic Clostridium

Aerobic or facultative anaerobic

Form clusters

Anaerobic

Staphylococcus

Bacteroides

Unusual walls

Bacillus Acid-fast Mycobacterium

Cocci

Spirochetes

Neisseria

Borrelia Leptospira Treponema

Facultative anaerobic Bordetella Brucella Campylobacter Escherichia Haemophilus Legionella Salmonella Shigella Yersinia

Wall-less Mycoplasma

A sk Yo u rs e l f Which of these bacteria is gram-negative and facultatively anaerobic—Bordetella or Bacillus?

Prokaryotic Evolution and Classification  105

necessary to characterize a bacterial species by recognizing multiple subspecies, or groups of individuals of a particular species that demonstrate consistent, identifiable variations. A subspecies can be further subdivided into different strains to highlight smaller, but important genetic differences. The taxonomic rules for designating strains are not closely regulated. Serotypes are strains that can be identified by the response of specific antibodies to bacterial surface molecules. For example, most species of E. coli are harmless bacteria that live in the large intestine of animals. However, there are many different strains and several different serotypes that are pathogenic. One such serotype, E. coli 0157:H7, causes bloody diarrhea and has a mortality rate of 50% for young children.

The Planner

Clearly, from an evolutionary prospective, prokaryotes are very successful organisms. They demonstrate amazing diversity that allows them to colonize almost every habitat on the planet in large numbers. Because of their ability to affect human well-being and environmental health, these microbes will be the focus of many upcoming chapters.

1. Why are 16S rRNA sequences used to determine phylogenetic relationships between bacteria? 2. Why is it not possible to define bacterial species in the same manner as animals?

✓

Summary

4.1

 he Prokaryote’s Place T in the Living World  84

• Prokaryotes are small, unicellular organisms that lack a distinct membrane-bound nucleus and complex membranous organelles. They have a single circular chromosome. The cells of eukaryotes are larger and more complex, with a membrane-bound nucleus containing multiple linear chromosomes and complex membrane-bound organelles. • Nitrogen fixation and photosynthesis performed by prokaryotes sustain life on Earth. Their activities are also essential for the biogeochemical cycles. • As eukaryotes evolved, they developed relationships with the prokaryotes that lived on or in them. Such relationships are called symbiosis. Many of the symbiotic relationships between humans and the prokaryotes are examples of mutualism, in which both partners thrive. An example of mutualism is when bacteria fix nitrogen in plants (see the diagram). Commensalism and parasitism are two other types of symbiotic relationships.

4.2

 acterial Cell Shapes and B Arrangements 87

• The size range for bacteria is usually 0.2 to 2.0 μm in diameter and 2 to 8 μm in length. • Bacterial shape is determined by the cell wall structure. Common bacterial shapes are the coccus (see the diagram), which is spherical; bacillus, which is cylindrical; and spiral. Other forms may be club-shaped, filamentous, or appendaged. Pleiomorphism describes the slight shape variations among bacterial cells of the same species.

Bacterial morphology  •  Figure 4.2b

Symbiotic relationships: Mutualism  •  Figure 4.1a

Root nodule Rhizobium

106  CHAPTER 4  Prokaryotic Organisms

• When bacteria don’t separate after undergoing binary fission, they form groupings including pairs (described by the prefix diplo-), chains (strepto-), and clusters (staphylo-). Some bacterial species form sets of four (tetrads) or packets of eight (sarcinae). Microscopic determination of bacterial shape and arrangement is often the first step in pathogen identification.

The Bacterial Cell Wall  89

• The bacterial cell wall prevents cell lysis by resisting pressure from osmosis when the microbe is in a hypotonic environment. • Peptidoglycan is the primary structural component of bacterial cells. Peptidoglycan is composed NAG and NAM joined together to form a disaccharide. • Gram-positive bacteria have a thick layer of peptidoglycan with molecules of teichoic acids weaving through it. Teichoic acids enable pathogenic bacteria to attach to host tissues, regulate cell division, and avoid engulfment by phagocytic cells. • The cell wall of gram-negative bacteria (see the diagram) consists of a thin layer of peptidoglycan and an outer membrane. Porins in the outer membrane allow free diffusion of small metabolites. The outer membrane has lipopolysaccharides (LPS) on the outer surface; the lipid A portion of the LPS is the endotoxin, whereas the o-oligosaccharide portion functions much like teichoic acids.

Bacterial cell wall structure: The gram-negative cell wall  •  Figure 4.5

4.4

External Structures of Bacterial Cells  94

• The glycocalyx and capsules are polysaccharide coatings firmly attached to a bacterial cell that can enable some pathogenic bacteria to attach to tissues to avoid phagocytosis. • Fimbriae and pili (see the micrograph) are used to attach to surfaces, for twitching motility, or during conjugation.

A comparison of fimbriae and pili  •  Figure 4.7 Conjugative pilus

Fimbriae

Eye of Science/Science Source Images

4.3

• Flagella and axial filaments are long protein polymers driven by basal body motors that function in motility. Movement in response to a chemical gradient is called chemotaxis. Movement in response to varying light intensity is called phototaxis.

Porin

4.5

Internal Structures of Bacterial Cells  97

• The plasma membrane, which is found in all cells, controls the passage of materials into and out of the cell, which is filled with cytoplasm. Materials move into and out of the cell by passive transport, facilitated diffusion, and active transport. • Acid-fast bacteria have a thick layer of peptidoglycan surrounded by a sugar/mycolic acid layer that is overlaid with lipids. Acid-fast bacteria are highly impermeable to most antibiotics and disinfectants. Wall-less bacteria do not have a regular cell shape. They are the smallest and simplest selfreplicating bacteria.

• The nucleoid is the region of the bacterial cell that contains the genetic material, usually a circular chromosome of DNA. The bacterial chromosome codes for the proteins needed to build the structural components of the cell and the enzymes needed for cell metabolism. The information in DNA is copied into RNA by the process of transcription.

Summary  107

• The ribosome is the smallest organelle of the cell. It is made of approximately 50 r-proteins and three different rRNAs (see the photo). Ribosomes are the sites of protein synthesis. The process by which the information in RNA is used to synthesize proteins is called translation.

Harry Noler/Center for Molecular Biology of RNA University of California, Santa Cruz

Bacterial ribosomes  •  Figure 4.10 r-proteins

4.6

Prokaryotic Evolution and Classification 103

• The sequences of 16S rRNA genes have been used to construct a tree of life (see the diagram) to depict early evolutionary of connections between living organisms.

Bacterial classification  •  Figure 4.13 50S subunit

Bacteria

Archaea

30S subunit rRNA

• Plasmids are small, circular self-replicating DNA molecules that carry extrachromosomal genetic information in bacteria. They are important tools in molecular biology and gene cloning. Inclusion bodies often store material for the bacterial cell. They include glycogen and polyhydroxyalkanoate granules, carboxysomes, enterosomes, and gas vesicles. A few groups of bacteria have membrane-bound organelles including thylakoids used in photosynthesis, and magnetosomes, which direct cells into sediments. • Endospores, which form by the process of sporulation, are highly resistant, metabolically inactive cells produced by several genera of bacteria. Under favorable conditions, endospores can germinate into growing vegetative cells.

• Members of the kingdom Bacteria are traditionally classified based on their shapes, Gram-stain reactions, and physical features. More recent genetic analysis has made it possible to classify bacteria according to their phylogenetic relationships, allowing construction of a phylogenetic tree. Phylogenetic trees have also been developed for the kingdoms Archaea and Eukarya.

Key Terms • acid-fast 92 • active transport  98 • Archaea 103 • axial filament  96 • bacillus 87 • Bacteria 103 • bacterial chromosome  99 • basal body  96 • biogeochemical cycle  85 • capsule 94 • cell wall  87 • chemotaxis 96 • coccus 87 • commensalism 86 • conjugative pilus  94

• cytoplasm 97 • domain 103 • endospore 101 • Eukarya 103 • eukaryote 84 • facilitated diffusion  98 • fimbria 94 • flagellum 95 • gas vesicle  101 • glycocalyx 94 • gram-negative 89 • gram-positive 89 • inclusion body  100 • lipid A  92 • lipopolysaccharide (LPS)  92

108  CHAPTER 4  Prokaryotic Organisms

• magnetosome 101 • mutualism 86 • nitrogen fixation  84 • nucleoid 99 • o-oligosaccharide 92 • osmosis 89 • parasitism 86 • passive transport  98 • peptidoglycan 89 • periplasmic space  92 • phototaxis 96 • phylogenetic tree  105 • pilus 94 • plasmid 100 • porin 92

• prokaryote 84 • ribosome 99 • serotype 106 • species 105 • spiral 87 • sporulation 102 • strain 106 • subspecies 106 • symbiosis 86 • teichoic acid  91 • thylakoid 101 • transcription 99 • translation 99

Critical and Creative Thinking Questions 1. Streptococcus mutans can initiate tooth decay. What type of symbiotic relationship would S. mutans have in a person who brushes and flosses their teeth regularly?

5. Explain how this diagram shows why both membrane proteins and energy are required for active transport.

2. From an evolutionary perspective, would you expect ribosomal proteins or ribosomal RNA to catalyze amino acid polymerization? 3. Of the thousands of genes on the chromosome of most bacteria, why are only approximately 800 considered essential? 4. Why is regulating the osmotic pressure of the cytoplasm a critical activity for the cell?

ATP

What is happening in this picture?

Courtesy Tanja Bosak, MIT

The photo shows a green mat that is actually a thick layer of photosynthetic bacteria submerged beneath the surface of the water. The bubble coming off the bacterial mat contains oxygen produced by photosynthesis, the same process that occurred on Earth about 3.6 billion years ago. In the early history of Earth, photosynthetic bacteria contributed oxygen to the atmosphere, making the evolution of eukaryotic life possible; today, the same bacteria help sustain that life.

T h i n k C ri ti c al l y What causes the pointed projections on the surface of the cyanobacterial mat?

What is happening in this picture?  109

Self-Test (Check your answers in Appendix A.)

1.  Review What a Microbiologist Sees, and answer this question.

6.  What type of environment would cause the cell change shown in the diagram?

 Relative to eukaryotic organisms, prokaryotes have the ______.



a. isotonic



a. greatest numbers of individuals



b. high salt concentration



b. greatest species diversity



c. hypertonic



c. most diverse habitats



d. high sugar concentration



d. greatest biomass



e. hypotonic



e. All of these are correct.

2.  Nitrogen fixation is the process by which ______.

a. plants break down NO2 and release O2



b. bacteria incorporate nitrogen from the air into organic compounds



c. plants synthesize organic compounds from nitrogen in the air



d. bacteria break down amino acids



e. plants break down amino acids

Cell expansion but no cell lysis

H2O

Introduction into hypotonic

Water diffuses into the cell

7.  In this diagram of(low peptidoglycan, the by aqua structures are environment solute osmosis, increasing concentration cell) internal pressure. ______ and theoutside purplethe structures are ______.

3.  ______ is a symbiotic relationship in which the host is ______.



a. glycan chains; crossbridges



a. Mutualism; harmed



b. tetrapeptide side chains; glycan chains



b. Commensalism; not harmed



c. N-acetylmuramic acid; crossbridges



c. Parasitism; not harmed



d. glycan chains; teichoic acids



d. Commensalism; benefitted



e. lipid A; glycan chains



e. Parasitism; benefitted

4.  The processes by which elements such as carbon and sulfur are moved between the living and nonliving worlds are known as ______.

a. biogeochemical cycles



b. mutualism



c. symbiosis



d. commensalism



e. parasitism

5.  Review the Microbiology InSight, Figure 4.2, and answer this question.

8.  Teichoic acids in the bacterial cell wall ______.

a. are also known as exotoxin



The cell morphology and arrangement in which the bacteria look like a bunch of grapes is ______.



b. regulate cation flow



c. prevent cell lysis



a. spirochete



d. regulate gene expression



b. streptobacillus



e. anchor flagella



c. staphylococcus

9.  Which of the following is true of bacterial cell walls?



d. diplobacillus



a. Gram-positive cell walls include an outer membrane.



e. coccobacillus



b. Gram-negative cell walls include an inner wall zone.



c. Gram-positive cell walls are made up of one to three layers of glycan sheets.



d. Gram-positive cell walls contain lipoproteins.



e. Gram-negative cell walls contain lipopolysaccharide

110  CHAPTER 4  Prokaryotic Organisms

10.  ______ have a thick layer of peptidoglycan covered with a sugar/mycolic acid layer that is overlaid with a hydrophobic layer high in lipids.

a. Acid-fast bacteria



b. Gram-positive bacteria



c. Gram-negative bacteria



d. Archaea



e. Wall-less bacteria

15.  Which bacterial structures are correctly paired with their functions?

a. flagella: form a bridge during conjugation



b. endospores: store nutrients for the cell



c. plasmids: synthesize proteins



d. capsules: anchor flagella



e. fimbriae: aid in attachment of the cell to surfaces

16.  Review The Microbiologist’s Toolbox, and answer this question.

11.  Flagella found within the cells of some bacteria are called ______.

a. conjugative pili

Bacterial flagella are ______ to be seen so they must be ______ and ______ to be visualized.



b. fimbriae



a. too short; lengthened; colored



c. internal flagella



b. too thin; lengthened; stained



d. axial filaments



c. too thin; coated; stained



e. inclusion bodies



d. too thick; shortened; colored



e. too short; lengthened; bleached

12.  In the diagram, the transport process numbered 1 is ______ and 2 is ______.

a. active transport; facilitated diffusion

17.  The small circular DNA molecules found in some bacteria are ______.



b. facilitated diffusion; active transport



a. inclusion bodies



c. simple diffusion; facilitated diffusion



b. plasmids



d. active transport; passive transport



c. nucleoids



e. facilitated diffusion; passive transport



d. ribosomes



e. endospores

18.  Review the Clinical Application, and answer this question. 1

2



Pseudomembranous colitis is caused by ______.

a. Clostridium difficile



b. Streptococcus mutans



c. Aquifex



d. Bacillus



e. Pseudomonas

19.  In this diagram of bacterial cell differentiation, the indicated structure is a(n) ______.

a. flagellum



b. capsule

13.  Protein synthesis is carried out by ______ and ______ at the ______.



c. glycocalyx



d. inclusion body



a. DNA; fatty acids; ribosomes



e. endospore



b. RNA; lipopolysaccharides; nucleoid



c. plasmids; RNA; nucleoid



d. RNA; proteins; ribosomes



e. DNA; RNA; ribosomes

14.  Structures within bacterial cells that store nutrients, enzymes, or other needed materials include ______.

20.  Bacteria and archaea differ in their ______.

a. ribosome size



a. endospores and gas vesicles



b. need for a cell walls



b. ribosomes and endospores



c. type of cell reproduction



c. magnetosomes and permeases



d. basic 16S rRNA sequence



d. glycan sheets and ribosomes



e. chromosome structure



e. carboxysomes and enterosomes

Self-Test  111

5

Eukaryotic Organisms EUKARYOTIC CELL EVOLUTION

F

The brilliant color of a flamingo’s plumage comes from consuming a diet rich in the red-orange pigments found in blue-green algae, brine shrimp, and diatoms.

112  

malven57/Shutterstock

or more than 2 billion years, prokaryotic microorganisms flourished in the diverse habitats of early Earth. Then changing environmental conditions and limited resources facilitated the evolution of a new type of cell with better-adapted features. The emergence of eukaryotic cells approximately 1.7 billion years ago led to the generation of numerous species of new microbes as well as the eventual evolution of complex multicellular organisms, including humans. Knowledge of eukaryotic microorganisms is critical to our understanding of both environmental and personal health. The diatoms shown in the photo are a major component of phytoplankton, the mostly microscopic, photosynthetic organisms that form the foundation of aquatic food webs. Without them, other organisms, such as these flamingos, could not live in aquatic habitats. These same eukaryotic cells are also responsible for the survival of all oxygen-breathing organisms. When they perform photosynthesis, they use solar energy to synthesize glucose, releasing oxygen as a by-product. Some eukaryotic microorganisms are human pathogens, however, and cause a variety of diseases. For all of these reasons, the well-being of our planet and our individual health is tied to our interactions with eukaryotic microorganisms. This chapter will describe the more complex structure of eukaryotic cells and survey eukaryotic microorganisms briefly.

CHAPTER OUTLINE 5.1 The Eukaryotic Cell  114 • Cell Size • The Eukaryotic Organelles 5.2 The Origins of Eukaryotic Organelles and Organisms  120 • The Autogenous and Endosymbiotic Hypotheses • Eukarya: A Classification Overview 5.3 The Algae 122 • General Characteristics and Unique Features • A Survey of Algae ■ Clinical Application: Agar—The Ideal Solid Medium for Bacterial Culture • Pathogenic Algae 5.4 • • •

The Protozoans 125 General Characteristics and Unique Features A Survey of Protozoans Pathogenic Protozoans

5.5 The Fungi 129 • General Characteristics and Unique Features ■ The Microbiologist’s Toolbox: The Growth of Fungal Specimens on Sabouraud Dextrose Agar • A Survey of Fungi • Pathogenic Fungi ■ What a Microbiologist Sees: The Morphological Plasticity of Candida 5.6 The Helminths 135 • General Characteristics and Unique Features • A Survey of Helminths • Pathogenic Helminths ■ Case Study: Cravings 5.7 The Arthropods 139 • A Survey of Arthropods • Pathogenic Arthropods and Arthropod Vectors

Frans Lanting/National Geographic Creative

Chapter Planner

Diatoms are easily identified under the microscope by the presence of their intricately sculpted silica cell walls.

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 114 ❑ p. 120 ❑ p. 122 ❑ p. 125 ❑ p. 129 ❑ p. 135 ❑ p. 139 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

Analyze key features

❑ Microbiology InSight p. 115 ❑ p. 118 ❑ ❑ Process Diagram p. 121 ❑ p. 127 ❑ p. 136 ❑ ❑ Clinical Application, p. 124 ❑ The Microbiologist’s Toolbox, p. 129 ❑ What a Microbiologist Sees, p. 134 ❑ Case Study, p. 138 ❑ Stop: Answer the Concept Checks before you go on. p. 119 ❑ p. 122 ❑ p. 125 ❑ p. 128 ❑ p. 134 ❑ p. 138 ❑ p. 140 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answers What is happening in this picture? ❑ Complete the Self-Test and check your answers.

5. 1

The Eukaryotic Cell

LEARNING OBJECTIVES 1. Explain why the surface-area-to-volume ratio of cells determines maximum cell size and is important for cell metabolism. 2. Describe the major organelles of eukaryotic cells and their functions. lthough small, eu- organelle A small karyotic cells are typi- structure within a cally 10 to 100 times eukaryotic cell that larger than prokary- performs a specific otic cells. Another function. key feature that distinguishes eunucleus The DNAkaryotic from prokaryotic cells is containing control the presence of numerous center of the cell. membrane-bound organelles capable of complex, coordinated functions. The nucleus is the most prominent of these structures. Organisms whose cells contain a membrane-bound nucleus are known as eukaryotes, which means “true nucleus.” Rapid evolution of this cell type resulted in the impressive diversity of eukaryotic organisms discussed in this chapter.

A

Cell Size Most eukaryotic cells are 10 to 100 μm in diameter. The upper limit of cell size is determined by the rate of transport across the plasma membrane (see Remember This!). To maintain metabolic reactions, extracellular nutrients must continuously shuttle into the cell and waste products must leave. Consequently, the amount of plasma membrane available for transport is crucial to cell survival.

bigger cells, so a favorable surface-area-to-volume ratio is maintained. Long, thin projections of the plasma membrane can significantly increase a cell’s surface area with only a minimal change in volume; these are a common modification in cells specialized for high levels of transport. The organelles of eukaryotic cells also provide membrane surfaces for a variety of functions and divide the cell interior into a system of internal compartments.

The Eukaryotic Organelles The adage “form follows function” is true of the organelles of eukaryotic cells. Each type of organelle is structurally suited to accomplish a specific task. Eukaryotic plant and animal cells share many of the same principal organelles, with a few exceptions (Figure 5.1).

The nucleus In a microscopic examination of a cell, the nucleus (see the enlarged image in Figure 5.1) is usually the most obvious intracellular structure. It contains most of the cell’s chromatin, the loosely packaged DNA. Through DNA replication and gene transcription (see Remember This!), the nucleus functions as the cell’s control center. It is protected by the nuclear envelope, a double layer of membrane perforated by nuclear pore ­complexes that regulate the movement of molecules into and out of the nucleus. All eukaryotic cells contain at least one nucleolus within the nucleus. The nucleolus consists of tightly packaged DNA containing multiple copies of the genes that code for the production of ribosomal RNA.

Remember This!  The plasma membrane is a selectively permeable barrier that defines the boundary of a cell. Review plasma membrane structure in Section 4.5 to fully appreciate its role in molecular transport.

Remember This!  The duplication of genetic material and the transfer of the information it contains via transcription are key to the nuclear coordination of cellular functions. Review Figure 2.16a and b to refresh your understanding of these key concepts.

The surface area of a structure changes with the square of its linear dimensions, but the volume changes with the cube of its linear dimensions; therefore, the surface area increases at a lesser rate than the volume. This geometric analysis demonstrates that a small object, such as a cell, has a greater surface area relative to its volume than a larger object. Because the amount of surface area determines a cell’s capacity for transport through the plasma membrane, small cells can support the activity in their interiors better than large cells. The need for maximal surface area is also reflected in eukaryotic cell number, shape, and internal structure. Large organisms are composed of more cells rather than

The ribosomes  The ribosomal RNA (rRNA) produced by the nucleolus exits the nucleus through nuclear pore complexes. It then combines with specific proteins and forms 80S ribosomes. These tiny particulate organelles are composed of a large (60S) and a small (40S) subunit. Ribosomes are described using Svedburg units (S), which reflect the effect of particle size, shape, and density on their rate of sedimentation in a liquid medium. Because the shape of an intact ribosome differs from that of its individual subunits, the additive Svedburg values of the large and small subunits (60S + 40S) do not describe their sedimentation rate when combined (80S).

114  CHAPTER 5  Eukaryotic Organisms

Microbiology InSight  An overview of eukaryotic organelles 

•  Figure 5.1

✓ The Planner

Eukaryotic cell structure provides an example of the relationship between form and function. Organelles that occur only in animal cells are highlighted in pink, whereas those that occur only in plants are highlighted in green. Rough endoplasmic reticulum (RER) Involved in production of proteins to be Smooth secreted from the cell and protein endoplasmic modification reticulum (SER) Performs lipid biosynthesis, small molecule modification, and calcium storage Bound ribosomes

Chloroplast (plants and algae only) Site of photosynthesis, the production of ATP and glucose from water and carbon dioxide using light energy Outer chloroplast envelope

Nucleus Cellular control center composed of chromatin Fret

Inner chloroplast envelope

Nuclear pore complexes

Nucleolus

Stroma

Chromatin

Granum

Thylakoid

Nuclear envelope

a. This animal cell highlights the extensive number and kinds of organelles that work together to accomplish molecular synthesis, energy acquisition and release, cell growth, and reproduction. ANIMAL CELL Flagella

b. Although plant cells contain almost all the same organelles as animal cells, there are some differences. Plant cells possess chloroplasts, which convert water and carbon dioxide into glucose and ATP through photosynthesis, and a large central vacuole that stretches the cell during growth. Nucleus

Microtubule

Nucleolus

Centrioles

Rough ER Bound ribosomes Plasma membrane Golgi apparatus

Cytosol (pH~7.2)

Lysosome

Central vacuole

PLANT CELL

Cell wall

Chloroplast Smooth ER

Mitochondrion

Peroxisome

Free ribosomes

Smooth ER

Intermediate filaments Microfilaments

Microtubule Cytosol (pH~7.2)

Cristae Tubulin subunits

Cisternae

Matrix 70S ribosomes

Vesicles

Outer mitochondrial membrane

Mitochondrion Site of aerobic respiration, production of ATP from the breakdown of glucose

Forming face

Maturing face

Microtubules Tubulin tubes that comprise flagella, cilia, and centrioles, guide transport of Golgi vesicles, and orient microfibrils in plant cell walls

Golgi apparatus Participates in protein refinement, sorting, and transport

A sk Yo u rs e l f Which organelles possess double membranes? a. the mitochondrion b. the chloroplast

c. the nucleus d. All of the above possess double membranes.

Ribosomes exist in two different cellular locations, where they perform protein synthesis. Ribosomes floating free in the cytoplasm generate proteins used within the cell. Those attached to the membranes of the endoplasmic reticulum generate secretory proteins, which are packaged in vesicles and undergo further modification before they are released or secreted from the cell.

Exocytosis and endocytosis Exocytosis is the process by which large materials leave the export of cellular cell. Endocytosis is the process by which they products by vesicle enter the cell (Figure 5.2). In exocytosis, vesifusion with the cles fuse with the plasma membrane, and their plasma membrane. contents are emptied outside the cell. endocytosis The In endocytosis, extracellular macromolecules import of extracellular are often engulfed by the invagination of the materials by plasma plasma membrane to form endocytotic vesicles. membrane invaginaWhen these vesicles fuse with a lysosome, an tion to form vesicles. enzyme-containing sac, acid hydrolases degrade The endoplasmic reticulum  Many ribosomes the macromolecular contents to monomers. Sometimes are attached to flattened membranes of the endoplasmic other cells, including bacteria, are engulfed by endocytosis. reticulum (ER) (see the enlarged image in Figure 5.1), Their subsequent enzymatic destruction makes this transa mazelike network of interconnected membranes with port mechanism an effective means of cellular protection. a large intracellular surface area. The ER with attached The ingestion of large particles by endocytosis is called ribosomes is called the rough endoplasmic reticulum ­phagocytosis, which means “cell eating.” The endocytosis (RER). The membrane-bound ribosomes synthesize proof fluid is called pinocytosis, or cell drinking. teins that pass into the RER lumen where enzymes begin modifying them. The process ends when the rounded Lysosomes  In addition to processing proteins, the Golgi edges of RER membranes pinch off to form protein-filled apparatus also generates primary lysosomes, which are vesicles that travel to the Golgi apparatus. small spherical sacs loaded with acid hydrolases. These The portion of the ER without attached ribosomes is digestive enzymes function only within the lysosome, the smooth endoplasmic reticulum (SER). This part of where the pH is approximately 5. When macromolecules the network has a distinctly tubular appearance. Many difor small cells such as bacteria are taken in via endocytosis, ferent enzymes in the SER membranes allow this organelle the newly formed vesicle, or phagosome, fuses with a lysoto perform lipid biosynthesis, hydrolyze large molecules, some, creating a secondary lysosome. In the secondary and modify small molecules. The relatively large volume lysosome, the contents of the vesicle are exposed to the of the SER lumen allows the storage of large quantities of degrading action of the hydrolytic lysosomal enzymes. calcium, which is essential for sending intracellular signals. This process allows the recycling of monomers and provides protection against bacterial pathogens. The Golgi apparatus The Golgi apparatus (see the exocytosis The

enlarged image in Figure 5.1), resembles a stack of floating pancakes; it is a series of small, flattened membranous sacs with tiny amounts of cytoplasm between them. Surrounding the margins of each cisterna, or sac, are numerous vesicles. Close observation of the Golgi structure reveals that it is polar. The cisternae of the forming face consist of straight sacs parallel to one another or with a slight convex curvature. They are always oriented closest to the RER and receive the vesicles filled with crude proteins. While these proteins interact with the Golgi enzymes, the addition of sugar units and significant protein refolding may occur. The modified proteins are once again loaded into a vesicle, launched from the edge of one Golgi cisterna, and transported to a neighboring cisterna for exposure to a new set of enzymes to continue the modification process. Eventually, the proteins arrive at the maturing face of the Golgi. In this portion of the organelle the cisternae are distinctly concave and curved toward the plasma membrane. Many of the vesicles released from the maturing face of the Golgi travel to and fuse with the plasma membrane, emptying their protein cargo outside the cell. This process is called exocytosis.

116  CHAPTER 5  Eukaryotic Organisms

Peroxisomes  Although they are similar in size and shape to lysosomes, peroxisomes are distinguished by their oxidase enzyme content. Peroxisomes collect toxic metabolic by-products, such as hydrogen peroxide, and degrade them into harmless water and oxygen using the enzyme catalase. Vacuoles  Vacuoles are saclike organelles found in many types of cells, but they vary in size and function with cell type (Table 5.1). The endomembrane system  The membranous organelles discussed so far participate in the transport of materials into and out of eukaryotic cells or are involved in the enzymatic modification of these molecules. All of these structures, including the plasma membrane, nuclear envelope, endoplasmic reticulum, Golgi apparatus, lysosomes, peroxisomes, and vacuoles, either directly touch one another or indirectly maintain contact through vesicle transport. Consequently, these interconnected membranous, intracellular compartments, collectively referred to as the endomembrane system, represent both a structural and functional component of eukaryotic cells.

Exocytosis and endocytosis • Figure 5.2 Vesicular transport is the mechanism by which cellular products move out of the cytoplasm and extracellular materials move into it. KEY

Plasma membrane Extracellular macromolecule

RER

Exocytosis Endocytosis

Secondary lysosome

Nucleus

Primary lysosome with acid hydrolases Crude protein

Phagosome Endocytosis As the plasma membrane invaginates, extracellular material is enclosed within a vesicle and moved into the cell.

Golgi apparatus Exocytosis Vesicles containing Golgi-modified proteins fuse with the plasma membrane, releasing their contents into the extracellular space.

Protein refinement

Bacterial cell

If identical starting polypeptides follow different transport paths through the Golgi apparatus, will the final glycoprotein products secreted from the cell be identical? Explain your answer.

Secretory vesicle

Secreted refined protein

Mitochondria and chloroplasts Two other important organelles are the mitochondrion (plural mitochondria) and the chloroplast (see the enlarged images in Figure 5.1). Although most eukaryotic cells contain mitochondria, chloroplasts are found only in plant and algal cells. Both mitochondria and chloroplasts have a double membrane, 70S ribosomes, and a nucleoid. They are similar in size, and both can divide by binary fission. Mitochondria generate adenosine triphosphate (ATP) by extracting stored energy from the chemical bonds of glucose during cellular respiration. Chloroplasts harvest solar energy and transform it into chemical energy via photosynthesis. Both of these complex metabolic processes are discussed in Chapter 7. The cytoskeleton  Three different fibrous protein structures make up the cytoskeleton, a protein-based network

Th in k Cr it ica lly

that functions in cell support and movement. Actin microfilaments are the smallest of the cytoskeletal components and consist of two intertwined protein strands. They are involved in muscle contraction, maintenance of cell shape, and cytoplasmic streaming, or the stirring of cellular contents. Intermediate filaments are sturdy, ropelike structures with a 10-nm diameter. They usually consist of proteins such as keratin or vimentin and provide support for the cell, resist tension, and anchor cellular structures in fixed positions. Microtubules (see the enlarged image in Figure 5.1), which are made of polymerized tubulin subunits, are the largest of the fibrous organelles. They perform a variety of functions, including locomotion, chromosome separation, directed vesicle transport, and organized deposition of cell wall material. Centrioles are short, cylindrical structures made of microtubules arranged in

Vacuole variation  Table 5.1 Vacuole type

Organism

Function

Relative size

Food vacuole

Animals and protozoans

Nutrient acquisition

Small

Contractile vacuole

Protozoans

Discharge of excess water to prevent cell rupture

Small to moderate

Central vacuole

Plants

Lysosome activity

Very large

Aiding growth through turgor pressure generated by water in the vacuole Regulation of cytoplasm pH Storage of pigments and small molecules

The Eukaryotic Cell  117

Microbiology InSight  An overview of the external features of eukaryotic cells 

•  Figure 5.3

Specialized structures are associated with the exterior of eukaryotic cells. Many of the key differences between animal and plant cells involve the external structures.

a. The side-by-side comparison of an animal and a plant cell emphasizes the differences in their exterior structures, the major difference being the cell wall of plant cells. Flagella

ANIMAL CELL

PLANT CELL

Microvilli

Pseudopodia

Cell wall

Plasmodesma

b. This summary table details the external structures of algae, protozoan, and plant and animal cells. Extracellular structure

Cell type

Distinguishing features

Function(s)

Cell wall

Plant

Cellulose cables impregnated with lignin (plant), calcium carbonate, silica dioxide, or cellulose depending upon protozoan or algal species

Support

Integrated collagen fibers and proteoglycans

Cellular signaling

Protozoan Algal Extracellular matrix (ECM)

Animal

Structure

Protection

Adherence to adjacent cells Increasing negative charge on cell surface

Flagellum

Animal

Cilium

Plant Protozoan

9 + 2 Microtubule arrangement within a hairlike structure

Locomotion Feeding

Algal

nine triplets, giving the organelle a pinwheel-like appearance. They participate in cell division.

External cell structures  The structures found on the outer surfaces of eukaryotic cells serve specialized functions and tend to be specific to the cell type. Figure 5.3

118  CHAPTER 5  Eukaryotic Organisms

provides an overview of these structures and their functions in eukaryotic plant and animal cells. Most extracellular structures provide support, protection, and adherence to adjacent cells, or they are used for locomotion. You will notice that some of these structures are also found in the cells of algae and protozoans.

✓ The Planner

Extracellular structure

Cell type

Distinguishing features

Function(s)

Intercellular junctions

Animal

  Tight junctions

Meshlike anchoring proteins

Formation of almost impenetrable seal

  Gap junctions

Cytoplasmic channels

Communication and transport

 Desmosomes

Protein fasteners

Adherence sites between adjacent cells

Plant

Sticky calcium pectate glue between adjacent cell walls

Cellular adhesion

 Membrane projections (including microvilli)

Animal

Fingerlike membrane extension

Increasing membrane surface area for enhanced transport

 Pseudopodia

Protozoan

Transient, amorphous membrane extensions

Locomotion and food acquisition

Plasmodesmata (pl.) (plasmodesma, sing.)

Plant

Plasma membrane-lined channels through walls of adjacent cells

Transport and communication

Middle lamella

Structure

Plasma membrane projections Plant

Th i n k Cr it ica lly

Gap junctions permit intercellular molecular transport in animal cells, and plasmodesmata permit it in plant cells. Which of these protein channels is longer and why?

1. What factor determines the upper limit of cell size?

2. Which three fibrous organelles comprise the cytoskeleton? The Eukaryotic Cell  119

The Origins of Eukaryotic Organelles and Organisms 5. 2

LEARNING OBJECTIVES 1. Explain the origins of membrane-bound organelles according to the autogenous and endosymbiont hypotheses. 2. Explain the criteria used to develop phylogenetic trees for the eukaryotes. wo hypotheses explain the development of the membrane-bound organelles that make eukaryotic cells so much more complex than their prokaryotic ancestors. These are the autogenous and endosymbiotic hypotheses. Phylogenetic trees have been developed to show the origins of eukaryotic organisms and their relationships.

T

The Autogenous and Endosymbiotic Hypotheses

force for the evolution of these organelles was intense competition between prokaryotic cells for acquisition of limited resources. As larger prokaryotic cells scavenged for nourishment, they incorporated smaller prokaryotic cells into their primitive food vacuoles and digested them. However, if a purple, nonsulfur bacterium engulfed by a larger prokaryotic host cell were not digested, the host could benefit substantially from the presence of a bacterium capable of performing aerobic cellular respiration. A mutualistic symbiosis could be established with the host benefitting from the availability of some of the ATP generated by the engulfed bacterium and the bacterium benefitting from its now-protected position. Over time, such a relationship likely evolved from endosymbiosis to a eukaryotic cell containing organelles with ATP-generating capacity. There is strong support for the endosymbiotic origin of mitochondria. The protein composition of the outer and inner mitochondrial membranes is diverse, a characteristic suggesting they had different origins. Additionally, mitochondria share many bacterial features. They are approximately 1- to 3-μm long, a size similar to a bacillus-shaped bacterial cell. As with bacteria, mitochondria contain a nucleoid and 70S ribosomes, and they can undergo binary fission. The endosymbiotic hypothesis offers an explanation for the origin of chloroplasts as well as mitochondria. By engulfing a photosynthetic prokaryote, a host cell would again benefit by establishing a mutualistic relationship that allows it to share the excess glucose and ATP produced by the protected endosymbiont. Chloroplasts share the same bacterial features as mitochondria, and photosynthetic prokaryotes and chloroplasts also demonstrate common pigmentation, carbohydrate storage materials, and internal membrane arrangements.

The nucleus is the defining structure of a eukaryotic cell and likely originated when the plasma membrane of a prokaryotic ancestor invaginated in the vicinity of the nucleoid (Figure 5.4). As this process continued, the nucleoid was pushed to the interior of the cell and was surrounded gradually by a double layer of protective membrane. Because the nuclear envelope arose in a piecemeal fashion, nuclear pore complexes formed at sites where the coalescing, invaginated membranes failed to join together. The pores allow the movement of molecules into and out of the nucleus, but this movement is tightly regulated, enhancing the protective role of the nuclear envelope. Continued elaboration of the invaginated plasma membrane probably resulted in membranous extensions into the cytoplasm that later became the endoplasmic reticulum. These internalized membranes pinched off vesiclelike structures that, with modification, became the Golgi apparatus, Eukarya: A Classification Overview lysosomes, and peroxisomes. With numerous modifications to membrane proteins, these primitive compartments gradAnalysis of small subunit (SSU) rRNA genes is an invaluually acquired the specialized functions of the endomemable method for determining the extent of evolutionary brane system. This explanation for the origins of organelles relationship between organisms that appear to be morwith single membranes represents a self-generated, or dophologically distinct. In Chapter 4, you saw the power of it-yourself, process and thus is known as the autogenous this technique in classifying prokaryotes using sequence hypothesis (Figure 5.4 steps 1–4). comparisons of 16S rRNA genes. Eukaryote endosymbiosis The endosymbiotic hypothesis (steps 5–8) classification involves the comparison of the is the generally accepted explanation for the ori- The relationship 18S rRNA gene sequences. These studies ingins of mitochondria and chloroplasts. The term between two organdicate that the major eukaryotic groups—aniendosymbiosis describes two organisms living isms in which one mals, fungi, and plants—are monophyletic; lives inside the other together, one inside the other (endo = inside; that is, the members of each group descended to their mutual benefit. sym = together; bio = living). The likely driving from a single ancestor.

120  CHAPTER 5  Eukaryotic Organisms

The autogenous hypothesis describes the evolution of the membrane-bound nucleus and the organelles of the endomembrane system. The endosymbiotic hypothesis describes the evolution of mitochondria and chloroplasts.

Ancestral prokaryotic cell

Ribosomes

Autogenous origination of organelles bound by a single membrane

Plasma membrane

Developing ER

Forming nuclear envelope

Nucleus

Nucleoid 1 Plasma membrane invagination pushes the nucleoid toward the center of the cell and begins to enclose it.

2 Continued plasma membrane invagination with subsequent folding forms the nuclear envelope and ER.

3 Vesicles pinching off from newly formed ER serve as precursors to the Golgi apparatus, lysosomes, and peroxisomes of the endomembrane system. Nuclear pore complex

ER

Golgi precursor

Golgi apparatus

Endosymbiotic origination of the chloroplast

Endosymbiotic origination of the mitochondrion

5 Engulfment of aerobic bacteria initiates a mutualistic endosymbiosis. 4 Following numerous evolutionary modifications of the primitive internal compartments, the organelles of the endomembrane system develop their functional roles.

Purple nonsulfur bacterium

7 As with the origin of mitochondria, engulfment of a photosynthetic prokaryote initiates a mutualistic endosymbiosis. 6 The endosymbiotic relationship of aerobic bacteria within a host evolves into the mitochondria of a eukaryotic cell.

Lysosome

Peroxisome

Photosynthetic prokaryotes 8 The engulfed photosynthetic prokaryote evolves into the chloroplast, forming a phototrophic eukaryotic cell.

Chloroplast

Mitochondrion

A sk Yo u r se lf Name three organelles whose evolution is not explained by the autogenous and endosymbiotic hypotheses.

The eukaryotic microbes are more challenging to organize in an evolutionary scheme. For example, protozoans are eukaryotic microbes possessing the animal-like features of locomotion and food consumption. Despite these common characteristics suggesting shared ancestry between organisms such as Entamoeba, Plasmodium, and Giardia, SSU rRNA analysis indicates that the protozoans are a diverse

group that likely evolved from a variety of ancestral organisms and emerged at different times. This same dilemma arises when trying to classify algae. Although diatoms and dinoflagellates are all photosynthetic eukaryotic microorganisms sharing a similar habitat, SSU rRNA analysis suggests a lack of evolutionary relationship between these organisms and even different times of origination. The Origins of Eukaryotic Organelles and Organisms  121

Process Diagram

✓ The Planner

The origins of membrane-bound organelles • Figure 5.4

Classification of eukaryotic microbes was further complicated when researchers attempted to verify their phylogenetic organization based on 18S rRNA gene sequence analysis by comparing the sequences of other highly conserved genes. A conserved gene has an almost identical base sequence when compared between species because the protein it codes for is essential for survival, making mutation deadly. When eukaryotic classification based on conserved gene sequences was performed, the results suggested that a single common ancestral population gave rise to all major groups of eukaryotic microorganisms as well as to animals, fungi, and plants. Clearly, additional investigation is necessary to accurately determine the evolutionary relationships among the organisms of this complex, diverse domain. Given that scientists are still debating the exact taxonomic position of specific eukaryotic organisms, studying

5. 3

The Algae

LEARNING OBJECTIVES 1. Describe the structures of algae and their major role in nature. 2. Outline the major algal groups. 3. Describe the pathogenic algae and the disorders they cause. raditionally, organalgae A generic isms referred to as term applied to saltalgae are classified water and freshwain the kingdom Pro- ter photosynthetic tista. Algae live pri- organisms that share marily in saltwater and freshwater the defining feature habitats. Because of their sheer of simple gameteabundance, the algae collectively containing structures represent the principal photosyn- lacking a protective thetic organisms on Earth. Conse- jacket of cells. quently, their contribution to the phytoplankton environment and global health is The mostly microimmense. Glucose generated by scopic, photosyntheir photosynthetic activity is the thetic organisms that foundation of the food web of form the foundation Earth’s largest ecosystem, the of aquatic food webs oceans. In the oceans, microscopic and produce much algae make up phytoplankton. of the oxygen in the Oxygen released by photosynthe- atmosphere. sis is necessary for all aerobic respiration and even protects terrestrial organisms from damaging ultraviolet radiation via the ozone layer. Algal impact on personal health is minimal because relatively few species are potential pathogens.

T

122  CHAPTER 5  Eukaryotic Organisms

their phylogenetic relationships can be challenging. Because this text addresses microbiology and its connection with environmental and personal health, the remainder of this chapter will focus only on eukaryotic organisms that influence these parameters.

1. How did the membrane-bound nucleus of eukaryotic cells arise? 2. What is the major difference between the phylogenetic tree based on analysis of the 18S rRNA gene and the phylogenetic tree based on other, highly conserved genes?

General Characteristics and Unique Features Morphological diversity is typical of the algae. Algal structure includes simple unicellular organisms and aggregates that form colonial species. Multicellular algal species form straight or branching filaments, sheets, or elaborate, three-dimensional structures. Algae range in size from microscopic to more than 100 m in length. Most algae are found in saltwater or freshwater habitats, but some species are adapted for life in the soil, clouds, Antarctic ice fields, and even the backsides of polar bears. All algal species except for members of the red algae have at least one motile stage in their lifecycle. Although most algal cells possess a cell wall, the composition of the wall varies. An attribute of algae shared only with land plants is their ability to perform photosynthesis. Despite extreme diversity in their chloroplast features, all algae use chlorophyll a as their primary photosynthetic pigment. Depending on the algal species, a chloroplast can contain a variety of additional pigments that enhance light absorption at different wavelengths and produce the myriad of colors associated with these organisms.

A Survey of Algae Analysis of the 18S rRNA sequence data shows that most algal groups are unrelated, thus complicating the classification of the domain Eukarya. To simplify your study of their overwhelming diversity, Table 5.2 presents a brief overview of the major algal groups. You can compare different kinds of algae by focusing on body plan modifications and the special features associated with each group.

A brief survey of the major algal divisions  Table 5.2 Algal group

Body plan

Distinguishing features

Representative organism

Euglenoids

Unicells

Have multiple chloroplasts

Euglena

Have a stigma, or pigment cluster, that can monitor light intensity Have the ability to alter their shape Contain chlorophylls a and b Dinoflagellates

Unicells

Are a major component of phytoplankton

Ceratium

Have perpendicular flagella Contain a high concentration of reddish orange carotenoid pigments Have ornate cellulosic walls often with appendages Show a whirling swim pattern Contain chlorophylls a and c Diatoms

Unicells

Are a principle component of phytoplankton

Gomphenema

Have frustules, ornate glass cell walls Sedimented frustules used as filtration material and polish Contain chlorophylls a and c Golden algae

Unicells Colonial forms

Are biflagellated with flagella of different lengths

Synura

Undergo cyst formation to survive harsh conditions Contain chlorophylls a and c

Brown algae

Filaments Plantlike with structures resembling roots, stems, and leaves

Contain a high concentration of brown pigment fucoxanthin

Postelsia

Found in temperate, marine habitats Include kelps, the largest photosynthetic organisms Algin is extracted from walls Contain chlorophylls a and c

Red algae

Unicells

No flagellated cells

Filaments

Possess specialized pigment clusters to efficiently absorb light at great depths

Sheets composed of tightly packed filaments

Green algae

Chondrus

Source of carrageenan and agar Contain chlorophylls a and d

Unicells

Greatest morphological diversity

Filaments

Greatest habitat diversity

Colonial forms

Land plant ancestors

Sheets

Contain chlorophylls a and b

Coleochaete

Plantlike forms

The Algae  123

Clinical Application

✓ The Planner

Agar—The Ideal Solid Medium for Bacterial Culture Agar extracted from the cell walls of red algae has tremendous clinical value as a solidifying agent in bacterial culture media. Growing microorganisms on solid media allows analysis of distinctive colony morphologies (see the Figure). This facilitates the species identification needed for determining effective patient therapy. Agar is an ideal solid medium for bacterial culture because it is not digested by microorganisms growing on its surface, and

it remains solid up to 100°C, so it does not melt in an incubator. By adding agar to many mixtures of nutrients, pH indicators, and antibiotics, clinical microbiologists have developed an extensive repertoire of solid media on which to grow patient specimens, speeding diagnosis.

Ken Colwell

E. coli

Trypticase soy agar with 5% sheep red blood cells is an enriched solid medium that typically serves as a growth control in the clinical laboratory. When a mixed specimen is inoculated on this solid medium, differences in colony morphology are easily distinguished.

Staphylococcus epidermidis

T hi nk C ri ti c a l l y How can you differentiate between colonies of Escherichia coli and colonies of Staphylococcus epidermidis growing on trypticase soy agar with blood agar?

Dinoflagellates, diatoms, and the golden algae are microscopic forms with similar pigmentation. Diatoms and dinoflagellates are especially abundant, representing the principal components of phytoplankton. Euglenoids possess the same photosynthetic pigments as the green algae, but are unrelated. Strong molecular data and structural evidence support the hypothesis that a green algal ancestor most likely gave rise to land plants. All green algae and land plants share the same chloroplast pigmentation, store carbohydrate as starch, contain many of the same detoxifying enzymes, and use a microtubulebased structure known as a phragmoplast to keep daughter nuclei separated while a new cell wall is synthesized during cell division. Both brown and red algae have economic significance because they are routinely consumed for their high nutritional value in Asian cultures. Cell wall extracts, such as algin from brown algae and carrageenan from red algae, are used by food manufacturers to thicken and smooth

124  CHAPTER 5  Eukaryotic Organisms

products such as cake frosting, pudding, and ice cream. Microbiologists use agar, another extract from the cell walls of red algae, to solidify media for microbial growth (see the Clinical Application).

Pathogenic Algae Very few algae are human pathogens, and in most cases they cause intoxication (illness from a toxin or poison) rather than infection. The best-known example of algal intoxication is paralytic shellfish poisoning, which occurs during dinoflagellate population explosions known as red tides. The water becomes a vivid reddish shade because of the large number of colorful algae present. Filter feeders, such as clams, oysters, and scallops, concentrate dinoflagellate-secreted saxitoxin, an alkaloid neurotoxin, when they consume the algae. Although the shellfish themselves are not affected by

the toxin, when they are harvested and consumed by humans, temporary muscle paralysis results and can impair breathing if the diaphragm is affected. Another form of algal intoxication is ciguatera, also known as fish food poisoning. When humans consume fish that have accumulated ciguatoxin secreted by dinoflagellates, gastrointestinal and neurological symptoms develop and may persist for weeks to years. Amnesic shellfish poisoning is caused by the neurotoxin domoic

acid, which is secreted by some diatoms. Consumption of contaminated fish and shellfish can cause short-term memory loss, motor weakness, cardiac arrhythmia, and brain damage; it can even be fatal. Human protothecosis is the only true algal infection. It typically presents with cutaneous symptoms when the green alga Prototheca wickerhamii enters its host through an abrasion. Because of low pathogen virulence, infections are exceedingly rare.

1. What is the primary photosynthetic pigment found in all algae? 2. What algal group served as ancestral stock for the evolution of land plants?

3. How does an intoxication differ from an infection?

5 .4

The Protozoans

LEARNING OBJECTIVES 1. Describe the structural specializations of the different groups of protozoans. 2. Describe the basic characteristics of amoebas, ciliates, flagellates, and apicomplexans.

3. Name the major pathogenic protozoans and the diseases they cause.

he term protozoan means “first animal” (proto = first; zoo = animal) and refers to a diverse group of microorganisms that, like the algae, are classified in the Kingdom Protista. This eclectic collection of eukaryotes has been especially challenging for scientists to arrange in a phylogenetic tree.

flagellum (plural flagella) is a long, hairlike organelle that extends from the cell. Its wavelike motion pulls the cell through its medium. Structurally similar to flagella, a cilium (plural cilia) is much shorter. Cilia are generally present over much of the surface of the cell. The synchronous movement of the cilia propels the cell. A pseudopodium (plural pseudopodia) is a transient plasma membrane extension into which the cytoplasm flows. The result is a slow, crawling movement. The common feature of protozoan lifecycles is complexity, often involving multiple hosts and containing a parasitic stage. A comparison of the reproductive lifecycles of various protozoan species reveals that some alternate between a cyst stage and a trophozoite stage. The cyst is a thick-walled, dormant cell that can survive periods of harsh environmental conditions. When conditions improve, the resistant cell wall thins and ruptures, releasing the trophozoite. The trophozoite stage is often motile and specialized for feeding. If environmental conditions again deteriorate, the trophozoite generates a resistant cell wall and converts back to the cyst form. Protozoans usually transfer from one host to another as cysts.

T

protozoan A generic term used to describe a unicellular eukaryotic organism that exhibits the animal-like characteristics of food consumption and locomotion.

General Characteristics and Unique Features For single-celled organisms, protozoans show a high degree of specialization. Some protozoans live in host organisms either as mutualistic endosymbionts or as disease-causing parasites. Other specializations determine how the protozoan acquires its nourishment or moves through its habitat. Flagella, cilia, and pseudopodia are common protozoan locomotion mechanisms. A

The Protozoans  125

A Survey of Protozoans With more than 20,000 species, it is hard to survey the protozoans without becoming overwhelmed by their diversity. Thus, for convenience, we have organized the major groups presented in this section according to the method of trophozoite locomotion (Table 5.3).

Apicomplexans  The apicomplexans are nonmotile protozoans named for their apical complex of organelles designed for penetrating the host cells they parasitize. The adult stage secretes enzymes to perform extracellular digestion followed by nutrient absorption. Sexual reproduction is an especially complex process involving multiple hosts. Asexual reproduction of these organisms is responsible for serious host illnesses. The apicomplexan Plasmodium spp. causes malaria, which is the fifth-ranked global killer (Figure 5.5). The cycle of fever, chills, and sweats that characterizes malaria results as asexually produced merozoites rupture infected red blood cells and continue the infection by invading other red blood cells.

Amoebas  The amoebas use pseudopodia for locomotion. This cytoplasmic streaming into cell extensions also occurs in phagocytosis, allowing free-living saltwater and freshwater amoeba to engulf and feed on bacteria or decaying organic material in benthic sediment. Some parasitic species inhabit the oral cavity or intestines of animals. Many free-living forms are protected by an ornate, perforated cell wall made of calcium carbonate or silica. Ciliates  This protozoan group is named for the abundant cilia they possess. Not only is this a highly effective means of locomotion, but cilia are also used to propel water laden with nutrients and bacteria toward an oral groove. This funnel-like structure channels food for efficient phagocytosis. Ciliates may be free-living in aquatic habitats, participate in mutualistic endosymbiosis, or live as intestinal parasites in humans and domestic animals.

A brief survey of the major protozoan categories  Table 5.3 Protozoan group

Mode of locomotion

Distinguishing features

Representative organism

Apicomplexans

Nonmotile

Possess apical organelle complex for host cell penetration

Toxoplasma gondii

Significant human pathogens

Amoebas

Pseudopodia

May possess ornate cell walls

Entamoeba histolytica

Component of benthic microbial community

Ciliates

Cilia

Diverse body plans

Balantidium coli

Cilia also used for feeding

Flagellates

Flagella

Possess unique intracellular structures Significant human pathogens

126  CHAPTER 5  Eukaryotic Organisms

Giardia lamblia

The causative agent of malaria, Plasmodium spp., is an apicomplexan with a complex lifecycle that alternates between human and mosquito hosts. Characterized by cycles of fever and chills that correspond to pathogen release from the patient’s red blood cells (RBCs), malaria victims suffer from severe anemia.

Sexual reproduction

8 The infected mosquito continues to spread the pathogen by biting a new uninfected host.

Asexual reproduction

1 An infected female Anopheles mosquito bites a host, releasing sporozoites into the bloodstream. Sporozoites

7 Sexual reproduction occurs in the mosquito’s gut with new sporozoites migrating to the salivary glands.

2 After arriving in the liver, sporozoites divide producing thousands of merozoites. Liver

Merozoites Salivary glands 3 Merozoites released by liver cells enter the bloodstream.

Ring trophozoites 40° Chills

Zygote

Female Anopheles mosquito 6 Gametocytes are acquired by a feeding mosquito.

T h i n k C ri ti c al l y and why?

Gametocytes

37°

Sweats Fever

Body temperature (°C)

5 Alternatively, some merozoites convert into male and female gametocytes.

4 In the erythrocytic phase, the merozoite develops into a ring trophozoite and divides rapidly producing more merozoites. Cell rupture releases new merozoites to infect other RBCs and continue the process.

What measures would be effective in preventing the transmission of malaria

Flagellates  There are three principal categories of flagellated protozoans: diplomonads, parabasalids, and kinetoplastids. Diplomonads are an ancient anaerobic group that live exclusively as intestinal parasites and acquire their energy through fermentation. They are characterized

by two equal-sized nuclei and a mitochondrial remnant that lacks components required for aerobic respiration. Parabasalids are intestinal and urogenital parasites. They are distinguished by the presence of a small structure near the nucleus that enhances Golgi function. Parabasalids The Protozoans  127

Process Diagram

✓ The Planner

The lifecycle of Plasmodium spp. • Figure 5.5

Common pathogenic protozoans and the body systems they infect  Table 5.4 Systems most often affected

Pathogenic protozoan

Infection

Key symptoms

Skin and eyes

Acanthamoeba spp.

Amoebic keratitis

Corneal ulceration, blindness

Leishmania spp.

Cutaneous leishmaniasis

Skin ulceration

Naegleria fowleri

Primary amoebic meningoencephalitis

Fatal destruction of brain tissue

Trypanosoma brucei

African sleeping sickness

Extreme fatigue and fatal neurological damage

Trypanosoma cruzi

Chagas disease

Congestive heart failure

Babesia microti

Babesiosis

Fever/chills/sweats, piercing headaches

Toxoplasma gondii

Toxoplasmosis

Nervous system

Cardiovascular and lymphatic systems

Gastrointestinal system

Genitourinary system

Typical

Asymptomatic or flulike symptoms

Gestational

Significant fetal damage, stillbirth

Plasmodium spp.

Malaria

Cycles of fever and chills, severe anemia, high mortality in children

Entamoeba histolytica

Amoebic dysentery

Ulceration of intestinal mucosa

Balantidium coli

Balantidiasis

Colon perforation possible

Giardia lamblia

Giardiasis

Persistent diarrhea, flatulence, nutrient malabsorption

Leishmania spp.

Visceral leishmaniasis

Liver and spleen swelling

Cryptosporidium hominis

Cryptosporidiosis

Abdominal cramping, diarrhea

Cyclospora cayetanensis

Cyclosporiasis

Abdominal cramping, diarrhea

Trichomonas vaginalis

Trichomoniasis

Profuse, yellow-green vaginal discharge, foul odor

perform fermentation and generate hydrogen gas in a modified, mitochondrionlike structure. Kinetoplastids are named for the DNA-containing structure called the kinetoplast found in the cell’s single, enormous mitochondrion. A flap of plasma membrane, folded across the middle of the cell, encloses their single flagellum, producing an undulating structure for effective locomotion. Many members of the kinetoplastid group live in freshwater and feed on bacteria, but some are significant human pathogens.

Pathogenic Protozoans Many protozoans are human pathogens. Some species are obligate parasitic endosymbionts that damage the host as they complete their lifecycle. Numerous other free-living protozoans do not require a human host for their reproduction, but they can still cause illness when

128  CHAPTER 5  Eukaryotic Organisms

accidentally introduced into the body. Table 5.4 provides a brief review of the most notorious protozoan pathogens. Diseases caused by protozoans will be covered in greater detail in the discussion of the system they most often affect in Chapters 16 through 21.

1. Which lifecycle stage of protozoans is specialized for feeding and locomotion? 2. What feature is used for classifying protozoans given that molecular data describing their evolutionary relationships are conflicting? 3. Which protozoan pathogen affects more than one human organ system?

5 .5

The Fungi

LEARNING OBJECTIVES 1. Identify the different fungal body plans. 2. Describe the characteristics of the major fungal groups. 3. Name the major fungal pathogens and the diseases they cause.

he members of the Kingdom Fungi are the closest relatives to animals, having diverged 1.5 billion years ago. Analysis Fungi The kingof 18S rRNA has dom that includes been helpful for establishing evo- an abundant group lutionary relationships among of microscopic members of this kingdom that and macroscopic have recently diverged. However, eukaryotic organas previously discussed, this isms characterized method of analysis suffers from by a cell wall of some shortcomings and certain chitin. aspects of fungal phylogeny are still in flux.

T

General Characteristics and Unique Features Despite the diversity of this kingdom, fungi share several common traits. They acquire their nourishment by secreting hydrolytic enzymes onto a surrounding substrate, digesting it, and absorbing the monomers. Such organisms are known as saprobes, and they serve the vitally important function of decomposing organic matter. Fungal decomposers keep the environment clean by the recycling of nutrients, but they are also problematic as food spoilers. Most fungi are aerobic, but some species are facultative anaerobes. They can tolerate low pH, moisture levels, and temperature (see The Microbiologist’s Toolbox) and are found in terrestrial and aquatic habitats as well as in symbiotic relationships. Fungal cells possess a wall composed of chitin, a complex carbohydrate that consists of N-acetylglucosamine monomers (see Remember This!). The plasma membrane of fungal cells also contains a distinguishing molecule, the steroid ergosterol. Fungi are economically important as food and as a source of pharmaceutical products, and are also pathogens of both humans and crop plants. Remember This!  Figure 4.4a describes N-acetylglucosamine as a component of bacterial cell walls. Review its role as a structural component before continuing.

T h e Micro b iologi s t ’ s T ool b o x

✓ The Planner

Growth of Fungal Specimens on Sabouraud Dextrose Agar

Candida albicans E. coli

Ken Colwell

Culturing a sample of a suspected fungal pathogen can be very challenging for the clinical microbiologist because it usually includes contaminating bacteria. If the specimen is applied to a standard growth medium, such as trypticase soy agar with 5% sheep red blood cells, the faster-growing bacteria outcompete the fungi for resources and effectively inhibit fungal growth. The key to culturing clinical specimens to detect pathogenic fungi is to use a selective medium that inhibits bacterial growth. Sabouraud dextrose agar, commonly known as Sab, is the medium most often used for this purpose. Sab contains dextrose as an energy source and peptone to provide sufficient nitrogen. The pH is adjusted to 5.6, which is low enough to inhibit the growth of many bacteria without interfering with fungal growth. The antibiotic gentamicin is sometimes added to the medium to inhibit the growth of contaminating gram-negative bacteria (see the Figure). Sab, with its supplies of dextrose and nitrogen, its low pH, and bacteria-inhibiting antibiotic, allows slower-growing fungi to flourish and be identified accurately so the patient can be prescribed the correct treatment.

Sabouraud dextrose agar is designed to enhance the growth of fungi and suppress the growth of bacteria from a mixed specimen. Note that there is substantially more Candida albicans growing on the plates than the contaminating Escherichia coli.

A sk Yo u r se lf In the culture shown, the bright, circular colonies are _____ , whereas the pale, cloudy growth is _____ .

The Fungi  129

Fungal body plans • Figure 5.6 Fungi exist in a variety of different morphologies.

a. Unicells

b. Hyphae Hyphae are straight or branched fungal filaments that contain a variable number of nuclei, depending on the species.

SCIMAT/Science Source Images

David M. Phillips/Science Source Images

The simplest fungi are yeasts, which are single-celled organisms.

c. Mycelium

Curtis E. Young, Ph.D

Eye of Science/Science Source Images

Hyphae sometimes weave together to form a macroscopic body, or mycelium.

T h in k Cri ti c a l l y squeeze it?

Why does a fresh mushroom feel spongy when you

Although it is estimated that there are more than 1.5 million fungal species, there are only three principal fungal body plans, or morphologies: unicellular, hyphae, and mycelium (Figure 5.6). Yeasts are simple unicellular fungi, whereas most fungi are composed of delicate, cellular filaments each called a hypha (plural hyphae). Hyphal cells grow by lengthening from the tips, and they can contain one or many haploid nuclei, depending on the species. When these microscopic hyphae tightly intertwine, the resulting

130  CHAPTER 5  Eukaryotic Organisms

mycelium The structure produced by tightly intertwined hyphae to form a macroscopic mass comprising the vegetative body of most fungi.

mycelium forms the body of com-

monly recognized fungi such as mushrooms and bracket fungi. Occasionally, unicellular yeasts reproduce asexually by a process known as budding. If the daughter cells do not separate from the parent cell, budding leads to the production of a chain of cells, or a pseudohypha.

A Survey of Fungi The Kingdom Fungi includes more than 100,000 identified species with diverse body plans, habitats, and reproductive modes. You can compare the features of the predominant fungal groups by examining Table 5.5. The three best known fungal classes are organized by features associated with sexual reproduction. Zygomycetes are called the conjugating fungi because two different hyphae each contribute a 1N cell to produce a zygote. During sexual reproduction, Ascomycetes use a saclike structure or ascus and Basidiomycetes use a clublike structure or basidium. The Glomeromycetes are a less well-known fungal group, but they are critical for the health of our planet. These microorganisms form a mycorrhiza (plural mycorrhizae), an intimate association with the roots of 80% of seed plants. Because hyphae enhance water and nutrient uptake from the soil and roots

provide stored carbohydrates, both the fungal and plant partners of the mutualistic relationship benefit. Lichens represent another example of fungal symbiosis. Many fungal species form a mutualistic relationship with blue-green or green algae (Figure 5.7a). With a photosynthetic endosymbiont, the fungi clearly benefit from an abundant carbohydrate supply. If a nitrogenfixing blue-green alga, such as Anabaena or Nostoc, is the photosynthetic partner, the fungus receives the added benefit of ample nitrogen in a usable form. The algae are protected from desiccation because the extensive mycelium absorbs water from the environment and simultaneously shields them to prevent evaporation. Also, the acids secreted by the fungal component degrade the substrate on which the lichen lives, often a rock. This process increases the amount of soluble mineral nutrients available for absorption, especially phosphorus.

A brief survey of the major fungal groups  Table 5.5 Fungal group

Morphology

Habitat

Distinguishing features

Representative organism

Chytridiomycetes

Unicellular

Freshwater

Chytridium confervae

Small colonies with hyphae

Terrestrial

Reproduce using flagellated zoospores

Multinucleate hyphae

Terrestrial

Zygomycetes

Oldest members of the Kingdom Fungi

Sexual conjugation when two 1N hyphae of different mating strains interact

Rhizopus stolonifera

Thick-walled zygospore is only 2N stage Food spoilers Decomposers Ascomycetes

Basidiomycetes

Unicellular

Freshwater

Asexual budding in yeast

Cup-shaped mycelia

Terrestrial

Sexual ascospores form in saclike ascus following interaction of two hyphae of different mating strains

Diverse mycelial forms, including puffballs, bracket fungi, and mushrooms

Terrestrial

Sexual basidiospores form in club-shaped basidium following interaction of two different hyphae

Candida albicans

Armillariella tabescens

Dikaryotic hyphae possess two associated 1N nuclei Decomposers

The Fungi  131

Lichens • Figure 5.7 With more than 13,500 species, lichens represent a very successful mutualistic symbiosis of fungi and algae.

a. Lichen endosymbiosis A layer of photosynthetic algae under a protective hyphal surface absorbs light energy and generates glucose. Hyphae extending from the lower layer absorb water and nutrients essential for the survival of both partners. Surface layer (fungal hyphae)

Fungal hyphae interwoven with algae Loosely woven hyphae Bottom layer (fungal hyphae)

Curtis E. Young, Ph.D

b. Lichen body plans Lichens typically demonstrate one of three morphologies, depending on the fungal species involved. Crustose lichens are flat and scaly, fruticose lichens are a network of fine aerial branches, and foliose lichens resemble leaves with curled margins.

Crustose–flat, scaly, and often colorful

Fruticose–a branched network

Foliose–leaflike appearance

P u t I t To g ether

Review Section 5.1 The Eukaryotic Cell, and answer the following question. Lichens contain blue-green or green algae within their mycelium. Do they represent an example of the endosymbiotic hypothesis in action? a. Yes, the algal cells will eventually evolve to form chloroplasts within the fungal hyphae. b. Yes, and a completely new type of organelle will be produced that is able to generate usable nitrogen. c. No, because the mycelium already possesses mitochondria and does not need a chloroplast for energy. d. No, because the algae are living within the mycelium but not within the fungal cells.

The overall morphology of lichens is variable and depends on the fungal species involved in the partnership. Their body plans are typically classified as crustose, fruticose, or foliose (Figure 5.7b). Lichens grow very slowly, but they can survive in many harsh habitats including the tundra, tree trunks, and even bare rock. Although the

132  CHAPTER 5  Eukaryotic Organisms

process takes thousands of years, lichens are essential for the erosion of rock into rudimentary topsoil. Lichens are also the principal food resource of grazing reindeer. Additionally, environmental biologists use them as extremely sensitive air quality indicators. In fact, in 1986, they monitored arctic lichens to determine the extent of

air pollution caused by the catastrophic explosion of the Chernobyl nuclear power plant in what was then the Soviet Union.

Pathogenic Fungi A significant number of fungi are pathogens, some of them deadly. Infection by Chytridiomycetes (chytrids) has been the cause of a global decline in amphibians, and an enormous number of field crops succumb annually to fungal pathogens. Humans are also subject to fungal attack, often with fatal outcomes. Fungal infections are especially difficult to treat in humans because the pathogen, like the host, is eukaryotic. As a result, antifungal drugs must target aspects of the fungal pathogen that are unique to fungi. Medicines affecting ergosterol in the plasma membrane or chitin in the cell wall are appropriate because human cells lack these components, but they are essential for fungal survival. Table 5.6 indicates that most body systems are susceptible to spore A reproductive fungal infection. The respiratory cell that can withstand harsh environmental system is at greatest risk for fungal conditions and faciliinfection because fungi often retates dispersal. produce using airborne spores,

which are unavoidably inhaled. Fungal infections of the skin are also quite common, because this organ is regularly in contact with airborne fungal spores that can enter the body through small abrasions. Most fungal infections are opportunistic, managing to evade immune defenses and grow unchecked. Opportunistic fungal infections can also result when a patient’s immune system is impaired or a normal defense mechanism is compromised by an environmental change. One notoriously opportunistic fungal pathogen is Candida albicans, which normally resides in 80% of the human population. This simple yeast is usually found in a woman’s vagina in low numbers because the normally low pH limits fungal growth. However, when a woman takes an antibiotic for a bacterial infection, the drug also kills the acid-secreting Lactobacillus in the vagina, leading to an elevated pH. This change in internal environment triggers rapid Candida growth with a subsequent morphology change (see What a Microbiologist Sees) and an opportunistic vaginal yeast infection. Vaginitis and other fungal infections are covered in more detail in Chapters 16 through 21 along with the system they most commonly affect.

Common fungal pathogens and the body systems they infect  Table 5.6 System most often affected

Pathogenic fungus

Infection

Key symptoms

Respiratory system

Aspergillus fumigates

Aspergillosis

Necrotic pneumonia

Blastomyces dermatitidis

North American blastomycosis

Cough, chest pain

Coccidioides immitis

Coccidioidomycosis

Cough, weight loss

Cryptococcus neoformans

Cryptococcosis

Cough, chest pain, difficulty breathing

Histoplasma capsulatum

Histoplasmosis

Cough, bloody sputum, weight loss

Pneumocystis jiroveci

Pneumocystis pneumonia

Pneumonia, AIDS-defining illness

Candida albicans

Candidiasis/thrush

Erythema, lesions, white coating

Epidermophyton spp.

Tinea

Erythema, hair loss, nail damage

Malassezia furfur

Dermatitis

Dandruff

Coccidioides immitis

Coccidioidomycosis

Stiff neck, headache, seizure

Cryptococcus neoformans

Cryptococcosis

Stiff neck, headache, seizure, coma

Amanita spp.

Mushroom poisoning

Cramping, diarrhea, renal failure

Claviceps purpura

Ergotism

Gangrene in limbs, hallucinations

Candida albicans

Vaginal yeast infection

Thick white discharge, erythema

Skin

Microsporum spp. Trichophyton spp.

Nervous system

Gastrointestinal system

Genitourinary system

The Fungi  133

What a Microbiologist Sees ✓

The Planner

The Morphological Plasticity of Candida In the biology classroom, students often must identify organisms, usually by recognizing a collection of key morphological features. Consequently, students reviewing the three fungal images in Figure a would logically conclude they were examining three different species. However, a microbiologist would see the phenomenon of plasticity, or the ability of an organism to alter its physical appearance. Many fungal species, including Candida, respond to changes in the environment with modifications in morphology. Alterations in pH, temperature, and available nutrients can trigger this plasticity (Figure b). For a clinical microbiologist, it is im-

portant to know fungal morphology at the time the specimen was collected from the patient because strong evidence suggests a link between virulence and fungal form. The standard unicellular yeast morphology is associated with either a nonpathogenic condition or with fungal dissemination in the bloodstream. The filamentous forms—either hyphae or pseudohyphae—are invasive, actively penetrating patient tissues and colonizing organs. Knowledge of the morphology of the specimen allows clinical microbiologists to determine the seriousness of a patient’s infection accurately based on the virulence demonstrated by fungal morphology.

Yeast YeastYeast

courtesy Peter Sudbery

courtesy Peter Sudbery

courtesy Peter Sudbery

a. The three Candida morphologies

Pseudohyphae Pseudohyphae Pseudohyphae

Hypha Hypha Hypha

b. The effect of environmental factors on Candida morphology Yeast morphology

pH

Temperature (°C)

Other environmental influences

Unicellular

4.0

107 cells/ml

Pseudohyphae

6.0

  35

Low nitrogen levels Low iron levels High phosphate levels

Hyphae

7.0

  37

N-acetylglucosamine available Low iron levels

(Data from: Sudbery, Peter. “The Distinct Morphogenic States of Candida Albicans.” TRENDS IN MICROBIOLOGY. Elsevier, 2004. Web. 02 July 2015.)

1. What steroid is unique to fungal plasma membranes? 2. How do fungi obtain nutrients?

134  CHAPTER 5  Eukaryotic Organisms

In t e r p r e t t h e Da t a Examine the middle photo of Figure a. This pseudohyphal Candida albicans specimen came from a vaginal swab. 1. What is the approximate pH of the patient’s vagina? 2. Is this patient suffering from an infection?

3. Why are fungal infections more difficult to treat than bacterial infections?

5 .6

The Helminths

LEARNING OBJECTIVES are relatively simple, lacking most specialized organs; others have well-developed organ systems. Evolutionarily, the worm body plan has been highly successful; zoologists estimate that there are at least 52,000 extant species. In addition to tremendous species diversity, worms also demonstrate impressive abundance. Helminths are prevalent in saltwater, freshwater, and damp terrestrial habitats, but it is their adaptations for parasitic lifestyles with humans that most interest microbiologists.

1. Describe the characteristics of helminths, including their habitats and whether they are free living or parasitic. 2. Differentiate the classes of helminths, including their structures and lifecycles. 3. Name the major pathogenic helminths and the diseases they cause. lthough worms, or helminth A general helminths, are part term for a worm, of a thorough mi- most of which are crobiology curricu- >1-mm long and lum, some can grow well-adapted to up to 20 m long—hardly microor- diverse habitats, ganisms. The term worm refers to including life as a animals demonstrating a thin, human parasite. elongated body plan and bilateral symmetry. This eclectic group of organisms has an ancient origin: a bilaterally symmetrical ancestor that dates back 575 million years.

A

A Survey of Helminths As with the other organisms surveyed in this chapter, the diversity of worms is amazing. Again, although many of these organisms are environmentally important, this section will focus on the parasitic worms that negatively affect human health.

Flatworms  The flatworms, or Platyhelminthes, have very thin, elongated bodies. All cells are close to water either in the worm’s environment or in their highly branched gastrovascular cavity (Figure 5.8). This body plan facilitates the diffusion of dissolved nutrients and oxygen across the body surface and eliminates the need for specialized structures for circulation and gas exchange.

General Characteristics and Unique Features In addition to their bilateral symmetry, worms are invertebrates, animals that lack a backbone. Some worm species

The basic body plan of a flatworm • Figure 5.8 This figure shows the DORSAL VIEW morphology and anatomy of Eyespot Dugesia, also known as a planarian. This free-living, freshwater flatworm is an indicator of good environmental Protruding health because pharynx planarians prefer Opening to unpolluted habitats. Digestive system

CROSS-SECTION VIEW

Gastrovascular cavity

VENTRAL VIEW

Ovary

Circular Longitudinal muscles muscles Testis

Flame cell

Penis

pharynx

Oviduct Eyespot Nerve cord

Brain

Nervous system

Epidermis Sperm duct

Genital pore Reproductive system

Th in k Cr it ica lly

Why would planarians need a clean environment to thrive?

The Helminths  135

Process Diagram

✓ The Planner

Lifecycle of Schistosoma mansoni • Figure 5.9 The complex lifecycle of Schistosoma includes free-swimming and parasitic stages in multiple hosts. 5 Cercariae, also produced in the snail, are released into the water. 4 Two generations of sporocysts are produced in the snail.

6 The swimming infective cercariae penetrate the skin of a human host encountered in the contaminated water. Stages within the human phase 7 Cercariae shed their forked tail and develop into schistosomulae.

3 Swimming miracidia penetrate specific snail intermediate hosts. 8 The schistosomulae migrate through several tissues and stages to their residence in the veins of the intestines or bladder, where they develop into adults.

2 Under optimal conditions the eggs hatch and release miracidia.

Stages within the water phase

1 Eggs are eliminated with feces or urine and contaminate water.

Only two classes of Platyhelminthes, the Cestoda and Trematoda, are endoparasitic in humans and thus of interest to microbiologists. Tapeworms, or cestodes, class Cestoda, possess an anterior scolex, which is a structure with hooks and suckers specialized for attachment to the host intestine. Surprisingly, the scolex lacks a mouth. Because the long, flat body of a tapeworm has a large surface area and because it is bathed in the digested nutrients in the host’s intestine, food molecules diffuse directly across the worm’s body surface so a gastrovascular cavity is unnecessary. Behind the scolex is a ribbonlike strand of proglottids, which are small, flat segments containing the organs for sexual reproduction. Proglottids are released from the worm and travel out of the host’s body with feces. If the feces contaminate the food and/or water of intermediate hosts, such as cows and pigs, these animals become infected. A larval form typically encysts in the muscle of the intermediate host and is transferred back to humans when they consume undercooked meat.

136  CHAPTER 5  Eukaryotic Organisms

A sk Yo u r se lf 1. The stage of the schistosome lifecycle that enters a snail is the _____ . 2. The stages that occur within the snail are _____ . 3. The stage that leaves the snail is the _____ .

Flukes, or trematodes, class Trematoda, have both anterior and posterior suckers with a blind, bifurcated intestinal tract. This class is represented by Schistosoma spp., a trematode whose complex lifecycle involves transmission to humans through intact skin rather than ingestion (Figure 5.9). Free-living, fork-tailed larvae known as cercariae can rapidly penetrate through the skin of a person who has contact with contaminated water (step 6). After losing their tails, the newly formed schistosomulae migrate to the lungs and liver and in 6 to 8 weeks mature to adult worms by feeding on blood in vessels of the portal and mesenteric plexus (step 8). Patients will experience chills, muscle aches, diarrhea, difficulty breathing, chest and abdominal pain, and enlargement of the liver and spleen. After mating with a male, females lay eggs that pass into urine or feces; the eggs can then contaminate freshwater and hatch into ciliated larvae. The larvae penetrate an intermediate snail host and multiply asexually. When the free-living, fork-tailed cercariae emerge from the snail, they can reinitiate the cycle of infection.

Annelids  Annelids, the segmented worms such as earthworms, have more sophisticated organ systems than flatworms. The class Hirudinea, the leeches, is of interest to microbiologists because they can parasitize humans. The leech secretes an anesthetic as it makes an incision in the skin so the host is unaware of its presence. Next, the leech obtains a blood meal by releasing hirudin, an anticoagulant that overcomes the host’s protective clotting mechanism. After gorging on blood and increasing its body size up to 10-fold, the satiated leech releases and can survive for months without another meal. Sometimes physicians therapeutically apply leeches to their patients. Hirudin secretion can speed healing by increasing the flow of oxygenated blood to wound sites and the removal of blood by feeding leeches can reduce pain from postoperative venous engorgement. Nematodes  Nematodes are unsegmented and covered by a tough cuticle. They are distinguished from members of the Platyhelminthes by their round rather than flattened body plan. These extremely abundant roundworms are excellent decomposers and thus play a vital role in maintaining a clean environment. Caenorhabditis elegans is an especially important species because it has been used as a model research organism, providing valuable information about cellular communication. However, there are also many parasitic nematode species that are responsible for agricultural losses and human morbidity.

Pathogenic Helminths Although most helminth species are free-living, a significant number of gastrointestinal endoparasites are transmitted to humans by accidental ingestion of fecescontaminated food or water. People at greatest risk for these infections live in tropical and subtropical areas that lack water and sanitation facilities. Estimates suggest that this group of people numbers 1 billion worldwide. Poor basic hygiene can also predispose a patient to infection. Because toddlers regularly put things in their mouths and their hand hygiene may be questionable, this group is also at risk for the oral-fecal transmission of an infection by parasitic worms, such as pinworms caused by Enterobius vermicularis. Table 5.7 provides a summary of common pathogenic helminths and the systems they typically infect. Some gastrointestinal pathogenic worms have other transmission modes. When soil has been contaminated with feces containing the eggs of parasitic worms, the larvae can penetrate the surface of skin in contact with the soil. Threadworm infections caused by Strongyloides stercoralis and hookworm infections caused by Ancylostoma duodenale or Necator americanus enter human hosts in this way. Once inside, these worms migrate to the intestines and can absorb considerable nutrients, diverting them from the host. The result is significant malnutrition despite an appropriate diet (see the Case Study). More details about infections caused by helminths are given in Chapters 16 through 21.

Common pathogenic helminths and the body systems they infect  Table 5.7 Site most often affected

Pathogenic helminth

Infection

Key symptoms

Eyes

Loa loa

Loiasis

Localized swelling of the dermis and subdermal tissues, eye pain as worms migrate

Onchocerca volvulus

River blindness

Blindness

Toxocara canis

Toxocariasis

Swelling around the eyes, retinitis, impaired vision

Schistosoma spp.

Schistosomiasis

Cough, difficulty breathing; enlarged spleen, liver, and lymph nodes

Wuchereria bancrofti

Elephantiasis

Extreme edema of lower extremities

Circulatory and lymphatic systems Gastrointestinal system

Ancylostoma duodenale

Hookworm infection

Foot rash, diarrhea, lethargy, anemia, and pica

Ascaris lumbricoides

Ascariasis

Cough, fatigue, weight loss, vomiting, diarrhea

Clonorchis sinensis

Clonorchiasis

Abdominal pain, anorexia, fatigue, weight loss

Diphyllobothrium latum

Fish tapeworm infection

Fatigue, weakness, diarrhea, cramping

Echinococcus granulosus

Echinococcosis

Abdominal pain, nausea, cough, allergic reaction

Enterobius vermicularis

Pinworm infection

Intense anal itching, disrupted sleep

Fasciola hepatica

Liver fluke infection

Abdominal pain, malaise, liver enlargement

Necator americanus

Hookworm infection

Foot rash, diarrhea, lethargy, anemia, and pica

Strongyloides stercoralis

Strongyloidiasis

Cough, rash, abdominal pain, diarrhea, vomiting

Taenia spp.

Tapeworm infection

Mild gastrointestinal distress, complications include appendicitis and worm cysts in the brain

Trichinella spp.

Trichinosis

Cramping, diarrhea, muscle pain, light sensitivity

The Helminths  137

Case Study Cravings As a nursing student, Kelsey went to a clinic in Amarillo, Texas on a service trip with her school. Her work there with the refugees primarily from Central America broadened her view of nursing and her knowledge of diseases not commonly encountered in the United States. Working alongside Anna, a nurse mentor, Kelsey noticed that many of the patients coming to the clinic suffered from the same symptoms: mild diarrhea, abdominal cramps, lethargy, and a rash on their feet (see the Figure).

✓ The Planner

stick,” Isabel said, pulling a gnawed small branch from her pocket. Anna led Kelsey out of the exam room to consult. “Isabel is experiencing the urge to eat nonfood items, or pica. Why would Isabel demonstrate this symptom that we didn’t see in our other patients?” asked Anna. Kelsey answered, “She looks very malnourished compared with the others, and pica usually manifests in people not receiving adequate nutrition. Like the others, I think Isabel has a gastrointestinal parasite. What were the results of her blood test and stool analysis? Does the infection cause additional symptoms when the patient is pregnant?”

Dr P. Marazzi/Science Source Images

3. Why would malnutrition be more prominent in Isabel than in the other patients?

1. Describe the appearance of the foot rash. 2. What does the foot rash symptom suggest about this gastrointestinal infection? Why would refugees from Central America be more likely to experience this illness than individuals from the United States? One day, Anna and Kelsey examined Isabel, a 17-year-old woman who, in addition to presenting with diarrhea, fatigue, and a rash on her feet, was 7 months’ pregnant and appeared severely malnourished. “Isabel, are you still taking your prenatal vitamins and eating all of the foods I recommended?” Anna asked her patient. Isabel nodded yes and said, “I eat plenty. I’m hungry all the time. This baby gives me terrible cravings. Sometimes I’m not satisfied unless I eat mud, but today, I’ve been chewing on this

1. Why doesn’t the immune system eliminate endoparasitic worm infections? 2. Which worm phylum has the fewest specialized organ systems?

138  CHAPTER 5  Eukaryotic Organisms

Anna replied, “When I checked Isabel’s blood, I found her erythrocyte count was low and her eosinophil count was elevated. I also discovered some tiny ovoid structures in her stool specimen.” Kelsey said, “From her gastrointestinal symptoms and the results of her lab work, it sounds as though Isabel has a hookworm infection.” Investigate: 4. a) What does an elevated eosinophil count suggest? b) Why might Isabel demonstrate anemia if she suffers from hookworms? c) What is the connection between anemia and pica? d) What are the ovoid structures found in the stool specimen? 5. REVIEW: What organism causes a hookworm infection? How does a hookworm infection cause gastrointestinal symptoms? “Exactly,” Anna replied. “Unsanitary conditions contaminate the soil with the parasite’s eggs. Hookworm larvae living in the soil penetrate the skin to gain access to a human host and most of our patients are barefoot. A dose of mebendazole will cure Isabel’s worm infection, but what would you recommend to help Isabel avoid reinfection?” Kelsey replied, “Because sanitation is much better in the United States, Isabel’s risk of reinfection is already reduced. She should be encouraged not to go barefoot and return to the clinic if her foot rash comes back.”

3. What is the best way to prevent infection by gastrointestinal parasitic worms?

5 .7

The Arthropods

LEARNING OBJECTIVES 1. Compare and contrast the body plans and habitats of the Cheliceriformes and Hexapoda.

2. Identify diseases vectored to humans by arthropods and the arthropods that vector them.

oologists consider the phylum Arthropoda to be the most evolutionarily successful group of animals. Dating back 535 million years, arthropods are adapted to almost all habitats on our planet. Their species diversity is staggering, estimated to represent at least 60% of all animals. With such tremendous variation, it is not surprising that arthropods are also the most abundant animals, numbering about 1018 organisms currently living. The secret to arthropod success is their unique body plan. Their jointed appendages can be used for locomotion, feeding, defense, sensory perception, and even reproduction. A tough external structure, or exoskeleton, made of protein and chitin protects the animal, which is usually composed of three segments—the head, thorax, and abdomen.

Cheliceriformes     Cheliceriformes possess chelicerae, fangs or pincers used in feeding and for defense. They lack antennae, have four pairs of walking legs, and two principal body segments, the cephalothorax and abdomen. Some species have a pair of pedipalps, anterior appendages that assist with feeding and sensory perception. Members of this group include mites, scorpions, spiders, and ticks. Mites and ticks parasitize many organisms, including humans, whereas scorpions and spiders are free-living hunters.

Z

A Survey of Arthropods Given the extent of arthropod diversity, it would be impossible to survey this phylum thoroughly in a microbiology textbook. Of the four arthropod subphyla, only two, Cheliceriformes and Hexapoda, play a significant role as human pathogens or infection vectors. Consequently, this section will describe only those subphyla.

Hexapoda  The Hexapoda includes the insects, a group with fossils dating from 416 million years. They are characterized by the three-part body plan, three pairs of jointed appendages, compound eyes, and a pair of antennae. Insects are found in almost all habitats—saltwater (rare), freshwater, terrestrial, and aerial—and they thrive as ectoand endoparasites of other organisms.

Pathogenic Arthropods and Arthropod Vectors Although very few arthropods are human pathogens, some species are responsible for several skin infections (Figure 5.10). These pathogens are ectoparasites, or animals that live and feed on the surface of their host.

True arthropod pathogens • Figure 5.10 Most arthropods associated with infection serve as vectors, whereas these four act directly as pathogens.

a. The causative agent of scabies, the pathogenic mite Sarcoptes scabiei, is designed for burrowing under skin.

b. Pediculus humanus capitis is the insect responsible for a head lice infection. It can securely grip hair shafts with its jointed appendages.

c. Pediculus humanus corporis is a louse that directly infests a human host to cause a body lice infection. It can also vector other infections to the host such as trench fever, relapsing fever, and epidemic typhus.

d. Pthirus pubis is a louse that uses its pincerlike appendages to attach and remain attached to the host. For this reason, a pubic lice infection is sometimes referred to as crabs.

Th i n k Cr it ica lly

The true arthropod pathogens are all ectoparasites. How do the organisms shown in this figure prevent being dislodged from the host surface?

The Arthropods  139

Common arthropod parasites and vectors  Table 5.8 Arthropod type

Role

Arthropod species

Infection

Tick

Vector

Ixodes spp.

Babesiosis

Amblyomma americanum

Ehrlichiosis

Mite

Parasite

Ixodes scapularis, Ixodes pacificus

Lyme disease

Sarcoptes scabiei

Scabies

Insect: flea

Vector

Xenopsylla cheopis

Plague

Insect: fly

Vector

Phlebotomus spp.

Leishmaniasis

Chrysops spp.

Loiasis

Glossina palpalis

Trypanosomiasis

Chrysops spp.

Tularemia

Simulium spp.

Onchocerciasis

Insect: kissing bug

Vector

Triatoma infestans

Chagas disease

Insect: louse

Parasite

Pediculus humanus corporis

Body lice

Pediculus humanus capitas

Head lice

Pthirus pubis

Pubic lice/crabs

Pediculus humanus corporis

Epidemic typhus

Pediculus humanus corporis

Relapsing fever

Vector

Insect: mosquito

Vector

Pediculus humanus corporis

Trench fever

Aedes aegypti, Aedes albopictus

Dengue fever

Aedes spp., Culista spp.

Eastern equine encephalitis

Aedes spp., Anopheles spp., Culex spp.

Filariasis

Anopheles spp.

Malaria

Culex spp.

St. Louis encephalitis

Culex spp.

Western equine encephalitis

Aedes spp., Culex spp.

West Nile encephalitis

Aedes aegypti

Yellow fever

Aedes aegypti, Aedes albopictus

Zika virus disease

Sarcoptes scabiei is a burrowing mite that causes the intense itching associated with scabies. Infestations of head lice, body lice, and pubic lice are the other types of true arthropod infections suffered by humans. More commonly, insect and arachnid species are vectors that carry the microorganisms responsible for tremendous morbidity worldwide (Table 5.8). For example, arthropods transmit the protozoan vector An insect or that causes malaria, the bacterium other organism that that causes plague, the virus that carries a diseasecauses West Nile encephalitis, and causing microorganthe helminth that causes African ism between hosts. sleeping sickness. Another way arthropods can vector disease to humans is via mechanical transmission. A classic example of this transmission mode is a fly visiting a garbage dump or landing on animal feces and then walking across human food and transferring the bacteria from its feet. In some cases, consumption of the tainted food leads to a gastrointestinal infection. Recently, another type of arthropod-vectored infection has been

140  CHAPTER 5  Eukaryotic Organisms

increasing in prevalence. Some patients with methicillinresistant Staphylococcus aureus abscesses report the infection developed following a bee sting or spider bite, suggesting vector transmission of the bacterial pathogen. It should now be clear that studying microbiology requires a thorough understanding of the structures and functions of the eukaryotic cell. Not only are we composed of this sophisticated cell type, but so are numerous microorganisms. Although some eukaryotic microbes are important for maintaining the health of the environment, others are significant human pathogens.

1. Which subphylum contains organisms with the most jointed walking legs? 2. Which arthropod species acts as a pathogen directly and can also vector other infections?

The Planner

✓

Summary

5.1

 The Eukaryotic Cell  114

• Eukaryotic cells are 10 to 100 times larger than prokaryotic cells. The upper limit of eukaryote cell size is determined by the ability of the plasma membrane to transport adequate nutrients to fulfill the nutritional requirements of the cell. This is a challenge because cell volume increases faster than surface area, limiting the size of most eukaryotic cells to a 100 μm diameter. • Eukaryotic cells possess numerous specialized structures, both within the cell and on the cell surface. The internal membranebound organelles perform specific cellular functions and include: the nucleus (cell control center), nuclear envelope (protection of genetic material), nucleolus (ribosome synthesis), ribosomes (protein synthesis), RER (production of secretory proteins), and SER (detoxification and lipid synthesis). • The Golgi apparatus (shown in the diagram) is an organelle involved in the processing of proteins undergoing exocytosis. Materials acquired by endocytosis are degraded by lysosome enzymes. Cellular energy needs are met by the action of the mitochondria and, in plant cells, also the chloroplast. The actin microfilament (cytoplasmic streaming), intermediate filament (cellular support), and microtubule (chromosome separation) compose the proteinaceous network of the cytoskeleton. Exterior structures such as a cell wall provide support, protection, and adherence.

An overview of eukaryotic organelles: The Golgi apparatus  •  Figure 5.1

5.2

 The Origins of Eukaryotic Organelles and Organisms  120

• Strong evidence supports the derivation of eukaryotic cells from primitive prokaryotes. The autogenous hypothesis explains the origination of the nucleus (shown in the diagram) and organelles bound by a single membrane, whereas the endosymbiotic hypothesis explains the derivation of organelles bound by a double membrane. The term endosymbiosis describes two organisms living together, one inside the other.

The origins of membrane-bound organelles  •  Figure 5.4

• Determining the evolutionary relationships among eukaryotic organisms is complicated. Sequence analysis of the 18S rRNA gene has provided valuable insights into the relatedness of organisms, but these results are complicated by the subsequent analysis of other highly conserved genes.

5.3

  The Algae  122

• The algae demonstrate tremendous diversity in body plan, cell wall composition, size, and habitat. Although all of these organisms are photosynthetic and use chlorophyll a, they also exhibit diversity in chloroplast size, number, and color. • The euglenoids, dinoflagellates, diatoms, and golden algae are all microscopic algal forms. Diatoms and dinoflagellates are the principal components of phytoplankton. There are numerous microscopic forms of brown, red, and green algae, as shown by the diagram of the Coleochaete. However, many algae are larger and have more complex body plans. In addition to the economic importance of these algal groups, the green algae are the likely ancestors of land plants.

A brief survey of the major algal divisions  •  Table 5.2

• Protothecosis is one of the few infections caused by algae, and it is rare. However, several algal species cause intoxication-based illnesses. Consumption of shellfish or fish contaminated with toxins from dinoflagellates and diatoms can result in disorders such as paralytic shellfish poisoning, ciguatera, and amnesic shellfish poisoning.

5.4

 The Protozoans  125

• Protozoans are single-celled eukaryotic organisms with the animal-like behaviors of food consumption and locomotion. Some have complex lifecycles involving multiple hosts and alternating between a resistant cyst form and a motile, feeding trophozoite stage.

Summary  141

• Because evolutionary relationships among protozoan groups are complicated, organisms are often identified by features such as unique cell components, ornate walls, and variable morphologies. Mode of locomotion characterizes the amoebae (pseudopodia), ciliates (cilia), and flagellates (flagella); the apicomplexans are nonmotile. • The protozoans represent significant human pathogens. Various amoeboid species are associated with deadly encephalitis and serious gastrointestinal infections. Flagellated species can cause gastrointestinal and sexually transmitted infections as well as fatal systemic infections such as African sleeping sickness and Chagas disease. • Apicomplexans cause many notable human illnesses, including malaria, babesiosis, and toxoplasmosis, which is caused by Toxoplasma gondii, shown in the diagram.

A brief survey of the major protozoan categories  •  Table 5.3

reproduction. The Ascomycetes (ascus) and Basidiomycetes (basidium) are named for the structures bearing their spores for sexual reproduction. The Glomeromycetes are represented by mycorrhizae, symbiotic associations of fungi and plant roots. Lichens exhibit mutualistic symbiotic relationships between fungi and photosynthetic organisms, such as green algae. • Numerous fungi are pathogenic. Candida albicans is a common yeast that opportunistically causes vaginitis, thrush, ulcerative keratitis, and even blood infections. Pneumonia caused by Pneumocystis jiroveci, another common opportunistic fungal pathogen, is considered an AIDS-defining illness.

5.6

 The Helminths  135

• The long, thin, bilaterally symmetric body plan of helminths (see the diagram) is evolutionarily ancient and highly successful in terms of both species diversity and abundance. In addition to many free-living species, numerous worms have adapted to life as human parasites and represent significant global morbidity.

5.5

The basic body plan of a flatworm  •  Figure 5.8 Eyespot

 The Fungi  129

• Fungi are saprobes that maintain environmental health by decomposing complex macromolecules, thereby facilitating nutrient recycling. They are characterized by chitin in their cell walls and ergosterol in their plasma membranes. Many fungi are unicellular (see the photo) and reproduce by asexual budding. Other fungi demonstrate a hyphal body plan. When many hyphae pack together to form a macroscopic fungus, the structure is known as a mycelium.

Brain Nerve cord

Nervous system

David M. Phillips/Science Source Images

Fungal body plans: Unicells  •  Figure 5.6

• There are four classes of fungi. The Chytridiomycetes are the oldest fungal group and reproduce with flagellated zoospores. The Zygomycetes, also known as the conjugating fungi, use airborne spores for both sexual and asexual

142  CHAPTER 5  Eukaryotic Organisms

• Cestodes (tapeworms) and trematodes (flukes) are two classes of parasitic worms in the phylum Platyhelminthes (flatworms). Annelids (earthworms and leeches) include segmented worms with more highly developed organ systems than flatworms. The most abundant worms are the nematodes, (roundworms). Members of this phylum have proved beneficial as a model research organism and harmful as both human and agricultural pathogens. • Tapeworms, pinworms, and hookworms are common worms that infect the gastrointestinal system, causing significant global morbidity. Life-threatening systemic infections, such as schistosomiasis, and sight-threatening infections, such as river blindness and loa loa, are also caused by helminthic pathogens.

5.7

  The Arthropods  139

• Based on species diversity and abundance, arthropods are the most successful group of animals. They possess a jointed exoskeleton of protein and chitin to provide support and protection and have evolved complex organ systems. Two arthropod subphyla contain members that act as human pathogens or vector infection. The Cheliceriformes are named for their specialized feeding structure, the chelicerae. This group includes the ancient horseshoe crab as well as spiders, mites, scorpions, and ticks. Named for their six walking legs, the Hexapoda are the insects, the most diverse group of animals.

• Many arthropod species serve as vectors spreading bacteria, helminthes, protozoans, and viruses. The result is widespread global illness. The only actual arthropod pathogens are lice and the mite that causes scabies, shown in the diagram.

True arthropod pathogens: Scabies  •  Figure 5.10

Key Terms • actin microfilament  117 • agar 124 • algae 122 • apicomplexan 126 • autogenous

hypothesis 120 • budding 130 • centriole 117 • cestode 136 • chlorophyll a 122 • chloroplast 117 • chromatin 114 • cilium 125 • cisterna 116 • cyst 125 • cytoplasmic streaming  117 • cytoskeleton 117 • diplomonad 127 • endocytosis 116

• endomembrane system 116

• endoplasmic

reticulum (ER)  116

• endosymbiosis 120 • endosymbiotic hypothesis 120

• eukaryote 114 • exocytosis 116 • flagellum 125 • forming face  116 • Fungi 129 • Glomeromycetes 131 • Golgi apparatus  116 • helminth 135 • hypha 130 • intermediate filament  117 • kinetoplastid 128 • lichen 131

• lysosome 116 • maturing face  116 • microtubule 117 • mitochondrion 117 • monophyletic 120 • mycelium 130 • mycorrhiza 131 • nematode 137 • nuclear envelope  114 • nuclear pore complex  114 • nucleolus 114 • nucleus 114 • organelle 114 • parabasalid 127 • peroxisome 116 • phagocytosis 116 • phytoplankton 122 • pinocytosis 116 • Platyhelminthes 135

• proglottid 136 • protozoan 125 • pseudohypha 130 • pseudopodium 125 • ribosomal RNA (rRNA)  114 • ribosome 114 • rough endoplasmic reticulum (RER)  116 • saprobe 129 • schistosomula 136 • scolex 136 • smooth endoplasmic reticulum (SER)  116 • spore 133 • trematode 136 • trophozoite 125 • vacuole 116 • vector 140

Critical and Creative Thinking Questions 1. When cells are treated with the chemical deoxycholate in the research laboratory, ribosomes are dislodged from the RER. Examine the ER in this drawing and explain how you could still distinguish the RER from the SER in a deoxycholate-treated cell.

it contains a new kind of organelle surrounded by a single membrane. Some biologists claim the organelle originated via the autogenous hypothesis, whereas others believe it represents endosymbiotic uptake followed by digestion of the interior membrane. As you analyze this new organelle, what features would you look for to help determine its origin?

2. Review the cytoplasmic pH in Figure 5.2 and the description of primary lysosome function. Explain how the cell is protected if a lysosome ruptures and spills its contents of acid hydrolases into the cytoplasm.

5. Why must apicomplexan pathogens be vectored to a host by an arthropod?

3. Imagine this scenario: Researchers have discovered a new algal species, and cell biologists are especially excited because

6. Describe how the fungal mechanism for obtaining nutrients correlates with their role in the nutrient recycling.

4. The red algae lack flagellated cells. Describe how this would affect sexual reproduction.

Critical and Creative Thinking Questions  143

coloroftime/Getty Images

Eli_Asenova/Getty Images, Inc.

What is happening in this picture? Application of acrylic fingernails is a fast, easy way to beautify hands. However, the rate of fingernail infections has been increasing with the popularity of acrylic nails.

Th in k Cr it ica lly 1. Why would application of an acrylic fingernail promote onychomycosis, the fungal nail infection shown in the photo? 2. How could people wearing acrylic nails minimize the risk of this infection?

Self-Test (Check your answers in Appendix A.)

1.  The upper limit of eukaryotic cell size is primarily determined by _____ .

5.  The cytoskeletal structures responsible for chromosome separation during cell division are ______.



a. the surface area of plasma membrane



a. microtubules



b. the presence of a cell wall



b. proteoglycans



c. water availability



c. microfibrils



d. information encoded in the nucleoid



d. actin microfilaments



e. All of these determine eukaryotic cell size.



e. intermediate filaments

2.  Protein modification takes place in the ______.

a. 80S ribosomes

6.  The diagram indicates that the nuclear envelope originated ______.



b. lysosome





c. nucleus

a. as a whole structure, complete with pores



b. by the endocytosis of a purple nonsulfur bacterium



c. by the invagination of the plasma membrane



d. by nucleoid duplication



e. Two of these are correct.



d. Golgi apparatus



e. cytoplasmic vesicles

3.  As shown in the diagram, both mitochondria and chloroplasts ______.

Ribosomes Plasma membrane

Nucleoid



a. have two membranes



b. possess 80S ribosomes



c. are approximately the same size



d. have a true nucleus

7.  The algal group that most likely served as ancestral stock for the evolution of land plants is the ______.



e. Both a and c are correct.



a. euglenoids



b. dinoflagellates



c. golden algae



d. red algae



e. green algae

8.  What are the principal components of phytoplankton? 4.  Lysosomes contain ______.



a. euglenoids, green algae, and diatoms



a. lysozyme



b. green algae and diatoms



b. acid hydrolases



c. diatoms and dinoflagellates



c. ribosomes



d. dinoflagellates, euglenoids, and green algae



d. catalase



e. diatoms and brown algae



e. Lysosomes have all of these enzymes.

9.  Review the Clinical Application, and answer this question.  Which of the following are characteristics of agar that make it a suitable medium for bacterial culture?

15.  The organism shown in the diagram is a(n) ______.

a. fungus



b. bacteria



a. It is a solid at room temperature.



c. mold



b. It can be mixed with nutrients.



d. lichen



c. It melts in an incubator.



e. alga



d. It can be used with a pH indicator.



e. Answers a, b, and d are correct.

10.  Review the Process Diagram, Figure 5.5, and answer this question.

16.  ______ are excellent decomposers.

a. Zygomycetes and Basidiomycetes

 ______ are the phase of Plasmodium that is responsible for sexual reproduction during a malaria infection.



b. Euglenoids



c. Basidiomycetes



a. Merozoites



d. Zygomycetes



b. Sporozoites



e. All of these are decomposers.



c. Gametocytes



d. Trophozoites



a. cellulose



e. Merozoites and trophozoites



b. lignin



c. chitin



d. ergosterol



e. peptidoglycan

11.  Trichomonas vaginalis is a sexually transmitted, flagellated protozoan that is classified as a ______.

a. diplomonad



b. kinetoplastid



c. parabasalid



d. radiolarian



e. dinoflagellate

12.  Pseudohyphae are a fungal form that ______.

a. is invasive and suggests a pathogenic fungal strain



b. is associated with low pH



c. is more common when nutrients are plentiful



d. develops at low temperatures



e. All of these pertain to pseudohyphae.

13.  Review The Microbiologist’s Toolbox, and answer this question.  Sabouraud dextrose agar is used to grow ______ pathogens because it is a ______ medium.

17.  Fungal cell walls contain ______.

18.  Review What a Microbiologist Sees, and answer this question.  Which of the following would be an accurate conclusion from your observation of Candida albicans in a patient specimen demonstrating the hyphal morphology?

a. The fungus is behaving pathogenically and actively penetrating patient tissues.



b. The fungal specimen has been incubated at 37°C.



c. The fungal specimen was grown on a medium with an acidic pH.



d. The fungus is behaving pathogenically and growing at 37°C.



e. Options a, b, and c are all accurate conclusions based on specimen morphology.

19.  Review the Case Study, and answer this question.  Identify the transmission mode that results in infection with hookworms, a gastrointestinal parasite.



a. algal; carbohydrate



b. fungal; selective



a. contact with soil contaminated with larvae



c. bacterial; nonselective



b. oral-fecal route



d. helminthic; selective



c. vectored by mosquitoes



e. protozoan; nonselective



d. consumption of undercooked meat



e. Hookworms can be transmitted by all of these methods.

14.  The organism shown in the photo is a(n) ______.

a. algae



b. lichen



a. an endoskeleton



c. bracket fungus



b. jointed appendages



d. bacteria colony



c. their marine habitat



e. yeast



d. radial symmetry



e. All of these are arthropod features.

20.  Arthropoda are distinguished by ______.

Self-Test  145

6

Viruses and Other Infectious Particles VIRAL IMPACT ON PLANTS AND HUMANS

W

Voisin/Phanie/Science Source Images

Nigel Cattlin/Science Source Images

hat do the yellow spots on these tomato leaves have in common with the red spots on this toddler (see the photos)? The spots are symptoms of a viral infection. Viruses are ever-present infectious particles capable of attacking diverse life forms from bacteria to mammals. Because of their intimate association with the genomes of the host cells they invade, viruses have significantly influenced the course of evolution. Long before Louis Pasteur hypothesized the existence of this smallest group of microbes, people feared their impact. Devastating viral epidemics of smallpox and poliomyelitis terrified our ancestors just as the rampant spread of AIDS has alarmed the modern human population. Because of their rapid mutation rates, new viruses are continually generated, and these may result in even more frightening and potentially deadly infections. Recent examples of lethal emerging viral infections that jeopardize humans include hemorrhagic fevers, Zika virus, and a novel form of the swine flu. Because these infectious particles can affect almost all organisms, this chapter will describe viral structure, replication, and origins so we can better understand their clinical impact.

CHAPTER OUTLINE 6.1 Viral Structure and Classification  148 • The Structure of Viruses • The Classification of Viruses 6.2 Viral Replication Cycles  153 • Viruses Replicating in Animal Cells ■ The Microbiologist’s Toolbox: Presumptive Diagnosis of a Viral Infection Using CPE Analysis • Viruses Replicating in Bacterial Cells 6.3 Viruses and Human Health  160 • The Clinical Cultivation of Viruses • The Impact of Viral Infections ■ Case Study: H1N1 in Young Adults • Viruses, Recurrent Infections, and Cancer ■ What a Microbiologist Sees: Connecting Symptoms with the Progression of HIV 6.4 Prevention and Treatment of Viral Infections  164 • The Prevention of Viral Infections ■ Clinical Application: Mandatory Flu Vaccines for Health Care Providers • Antiviral Therapies • Viral Influences on Bacterial Infections 6.5 • • •

Viruslike Microbes  170 Viroids Satellites Prions

Chapter Planner

✓

Scott Camazine/Alamy

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 148 ❑ p. 153 ❑ p. 160 ❑ p. 164 ❑ p. 170 ❑ ❑ Read the text and study all visuals.

The human papilloma virus is representative of basic viral structure.

Answer any questions.

Analyze key features

❑ Process Diagram p. 154 ❑ p. 156 ❑ p. 159 ❑ p. 167 ❑ ❑ The Microbiologist’s Toolbox, p. 158 ❑ Case Study, p. 161 ❑ Microbiology InSight, p. 168 ❑ What a Microbiologist Sees, p. 163 ❑ Clinical Application, p. 164 ❑ Stop: Answer the Concept Checks before you go on. p. 152 ❑ p. 159 ❑ p. 163 ❑ p. 169 ❑ p. 172 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What is happening in this picture? ❑ Complete the Self-Test and check your answers.  

147

6. 1

Viral Structure and Classification

LEARNING OBJECTIVES 1. Describe the basic molecular composition and shapes of viruses. 2. Identify the main characteristics used to classify viruses.

S

tructurally a virus is virus An infectious exceptionally simple; particle composed it consists of a nu­ of only proteins and cleic acid core sur- nucleic acids. rounded by a protein coat. Because viruses lack most obligate standard cellular structures and intracellular biochemical features, they cannot pathogen An infeccarry out the basic functions tious agent capable associated with living things. of replication only They cannot perform metabolic within a host cell, where it can evade reactions or reproduce outside the immune system ­ bligate of a host cell; they are o and avoid many intracellular pathogens. All antimicrobial drugs. viruses are exceptionally small, ranging in size from 20 to 450 nm (see Remember This!). Because of their minimal structure and size, viruses are better described as infectious particles than organisms. Remember This!  It is easier to relate to something we can’t see because of its small size when we compare it to everyday items that we can see. Put viral size in perspective by reviewing Figure 1.1.

The origins of viruses are a mystery. One theory suggests they developed during the precellular period of Earth’s history as RNA molecules with catalytic activity. Some of these autocatalytic RNA molecules acquired a protein coat and coevolved with cellular life forms, becoming the first viruses. Another possible explanation for viral evolution is the regression of prokaryotic cells that gradually lost most of their genetic material and the associated functions, forcing them to exist as obligate intracellular parasites. Finally, alteration of host genetic material into self-replicating infectious particles may explain viral origins. Although some evidence exists to support each of these theories of virus origination, scientists still lack a definitive answer.

The Structure of Viruses As was just described, viruses are extremely small and consist of nucleic acid wrapped in protein.

Viral nucleic acids Viral nucleic acids can be DNA or RNA, but not both. Either type of nucleic acid core, or viral genome, can be single stranded (s/s) or double stranded (d/s) (Table 6.1). When the genetic material is single-stranded RNA that undergoes translation directly to produce viral proteins, it is referred to as positive-sense (+) RNA. This RNA is similar to messenger RNA, which carries the code for protein synthesis from DNA to ribosomes. Negative-sense (−) RNA must be converted into a complementary RNA strand prior to translation.

Nucleic acid

Number of strands

Example

Infection

DNA

Double stranded

Poxivirus

Smallpox

DNA

Single stranded

Parvovirus

Fifth disease/slapped cheeks disease

RNA

Double stranded

Reovirus

Gastroenteritis

RNA

Single stranded

Rhabdovirus

Rabies

148  CHAPTER 6  Viruses and Other Infectious Particles

Images courtesy of ViralZone, SIB Swiss Institute of Bioinformatics. www.expasy.org/viralzone Related publication: Hulo C, de Castro E, Masson P, Bougueleret L, Bairoch A, Xenarios I, Le Mercier P. ViralZone: a knowledge resource to understand virus diversity. Nucleic Acids Res. 2011 Jan;39(Database issue):D576-82.

Viral genomes  Table 6.1

Viral shapes • Figure 6.1 Capsomeres self-assemble to produce three principal viral morphologies.

a. Helical nucleocapsid One of the simplest capsid forms attaches capsomeres to the coiled viral genetic material, producing a springlike, or helical, shape.

b. Polyhedral nucleocapsid This roundish morphology is achieved by the piecing together of 20 triangular subunits composed of capsomeres. Protein peplomers attach to the capsid at capsomere junctions.

c. Complex nucleocapsid The most sophisticated of the viral morphologies is composed of a polyhedral head region and a helical tail portion. It often resembles a spaceship, like the Lunar Excursion Module of Apollo 11.

Genetic material Capsomeres

Head

Tail sheath Tail

Plate Protein peplomers

Pins

Tail fibers

A sk Yo u rs e l f The viral shape that appears to require the greatest number of capsomeres is _____.

The minimal nature of viral structure extends to genome size, which is reduced compared to cellular organisms. Viral genome size varies from only four genes in the hepatitis B virus to approximately 2300 genes in the Pandoravirus. In addition to the genome, some viral cores also contain enzymes necessary for replication, including proteases, polymerases, and reverse transcriptase.

The capsid and envelope The nucleic acid core of a virion is surrounded by the capsid, a protective protein coat that facilitates attachment to host cells and determines viral virion A complete, shape. Together, the viral genome infectious viral partiand the capsid are referred to cle, consisting of RNA or DNA surrounded as a nucleocapsid. Capsids are by a protein capsid made from protein subunits called and, when applicable, capsomeres. Some capsids are an envelope. composed of identical capsomeres, whereas other viral species require several different protein types for capsid construction. The number of capsomere types and their arrangement is used in viral classification and identification. Capsomere self-assembly results in three major virus shapes: helical, polyhedral, and complex. Helical capsids are

simplest to construct. Capsomeres join in a long, ribbonlike structure that curls tightly to form a solid cylinder into which the genome is inserted (Figure 6.1a). Helical viruses include filovirus and lyssavirus, which cause the deadly infections Ebola and rabies, respectively. Most of the polyhedral capsids are constructed from triangular patches. Formed from clustered capsomeres, the triangles assemble to produce an icosahedron, or 20-sided structure, which encloses the viral genome (Figure  6.1b). Rhinovirus is an example of a polyhedral virus and causes the common cold. Complex capsids represent a combination of helical and polyhedral morphologies. An icosahedron head contains the genetic material and is attached to a tail region consisting of a plate, pins, tail fibers, and a bar-shaped, helical structure known as a sheath (Figure 6.1c). The structures of the tail region are used for host attachment. These unusually shaped viruses are often bacteriophage bacteriophages, or viruses capa- A virus that infects bacterial cells; also ble of infecting bacteria. Some viruses are also sur- known as a phage. rounded by an envelope that forms from pieces of host cell membrane as the virus is released. The envelope helps protect the virus from the host Viral Structure and Classification  149

immune system. However, enveloped viruses are more easily destroyed during sterilization processes because their membrane coating is damaged by heat, detergents, and drying. The presence or absence of an envelope influences the entry and exit strategies a virus uses to infect a host cell. Viruses that lack an envelope are described as naked viruses. Projecting from either the nucleocapsid or the envelope are peplomers, or protein or glycoprotein spikes that function in the attachment of the virus to the host cell.

The Classification of Viruses As discussed in Chapter 4, biological classification of macroscopic organisms uses the ability of populations

to reproduce sexually as an important criterion for placing organisms into specific taxa. Because viruses cannot reproduce on their own and are not considered true organisms, standard classification schemes are inadequate for organizing this group. However, virologists need a classification virologist A microsystem to facilitate viral identifica- biologist specializing tion and to allow accurate commu- in the study of viruses. nication about viruses. The International Committee on the Taxonomy of Viruses (ICTV) was established in 1966 for this purpose. Presently the ICTV recognizes 108 viral families that have been used to classify more than 5000 different

Major human viral pathogens • Figure 6.2 The table groups diverse viral pathogens typically associated with human morbidity to emphasize specific aspects of their structure. It also associates them with the infections they cause.

a. The RNA viruses

Genome and capsid features

Viral family and size

Single stranded (+) sense

Viral morphology

Significant genera

Associated infection

Calciviridae 35-40 nm

Hepatitis E virus

Hepatitis

Norovirus

Gastroenteritis

Picornaviridae 28-30 nm

Enterovirus

Poliomyelitis

Naked nucleocapsid

Single-stranded (+) sense

Hepatitis A virus

Short-term hepatitis

Rhinovirus

Common cold

Coronaviridae 80-160 nm

Coronavirus

SARS

Flaviviridae 40-50 nm

Flavivirus

Yellow fever

Hepatitis C virus

Chronic hepatitis

Pestivirus

Bovine diarrheal disease

Lentivirus

Acquired immunodeficiency syndrome (AIDS)

Oncornavirus

Tumor production

Alphavirus

Arthritis, encephalitis

Rubivirus

Rubella

Envelope

Retroviridae 100 nm

Togaviridae 60-70 nm

150  CHAPTER 6  Viruses and Other Infectious Particles

Images courtesy of ViralZone, SIB Swiss Institute of Bioinformatics. www.expasy.org/viralzone Related publication: Hulo C, de Castro E, Masson P, Bougueleret L, Bairoch A, Xenarios I, Le Mercier P. ViralZone: a knowledge resource to understand virus diversity. Nucleic Acids Res. 2011 Jan;39(Database issue):D576-82.

Although all of these pathogens possess an RNA genome, their genetic material may be single stranded and either (+) sense or (−) sense, or it may be double stranded. Comparing viral families with naked nucleocapsids versus envelopes also underscores viral diversity.

viruses based on similarity in genetic makeup, chemical composition, replication method, host range, and overall structure. Members of the same viral species must share a common genome and the ability to infect the same hosts, or host range. Using these criteria, the full ICTV classification of the virus that causes AIDS is family: Retroviridae; genus: Lentivirus; species: human immunodeficiency virus (HIV). Figure 6.2 provides examples of important viruses in each family along with the infections they cause. Visual representations of their external morphology and/or internal structures help distinguish between these diverse pathogens. To highlight their distinctive features, the

viruses are initially grouped by genome composition: RNA (Figure 6.2a) or DNA (Figure 6.2b). Singlestranded RNA viruses are subdivided into (+) sense or (−) sense genomes. These RNA viruses can be compared to the double-stranded RNA members of the Reoviridae family. Likewise, the single-stranded DNA of members of the Parvoviridae family can be compared to their doublestranded DNA counterparts. Note that the outer covering of each viral family is identified as either a naked nucleocapsid or an enveloped pathogen. To review your knowledge of basic viral structure and the details of their replication cycles, as well as integrate this information with your understanding of the clinical

a. RNA viruses (continued ) Genome and capsid features

Viral family and size

Single stranded (-) sense

Viral morphology

Significant genera

Associated infection

Arenaviridae 110-130 nm

Arenavirus

Lymphocytic choriomeningitis

Bunyaviridae 90-120 nm

Nairovirus

Crimean-Congo hemorrhagic fever

Hantavirus

Hantavirus pulmonary syndrome (HPS)

Phlebovirus

Rift Valley fever

Deltaviridae 32 nm

Hepatitis D virus

Delta hepatitis

Filoviridae 80 nm

Filovirus

Marburg and Ebola hemorrhagic fevers

Orthomyxoviridae 100-200 nm

Influenza virus (A, B, C)

Influenza

Paramyxoviridae 150-200 nm

Morbillivirus

Measles

Rubulavirus

Mumps

Rhabdoviridae 70-180 nm

Lyssavirus

Rabies

Reoviridae 70 nm

Coltivirus

Colorado tick fever

Pneumovirus

Pneumonia/bronchiolitis

Reovirus

Gastroenteritis

Rotavirus

Gastroenteritis

Double stranded Naked nucleocapsid

A sk Yo u rs e l f Which viral families can cause hemorrhagic fevers?

Images courtesy of ViralZone, SIB Swiss Institute of Bioinformatics. www.expasy.org/viralzone Related publication: Hulo C, de Castro E, Masson P, Bougueleret L, Bairoch A, Xenarios I, Le Mercier P. ViralZone: a knowledge resource to understand virus diversity. Nucleic Acids Res. 2011 Jan;39(Database issue):D576-82.

Envelope

(continued)

Viral Structure and Classification  151

b. The DNA viruses The DNA viruses may also be characterized by whether they have a single- or double-stranded genome and whether they have a naked nucleocapsid or an envelope.

Genome and capsid features

Viral family and size

Single stranded Naked nucleocapsid

Double stranded Naked nucleocapsid

Double stranded Envelope

Viral morphology

Significant genera

Associated infection

Parvoviridae 18-25 nm

Parvovirus B19

Fifth disease/slapped cheeks disease

Adenoviridae 70-90 nm

Mastadenovirus

Pneumonia, cystitis, conjunctivitis, gastroenteritis

Papillomaviridae 40-57 nm

Papillomavirus

Warts, cervical cancer

Polyomaviridae 45 nm

Polyomavirus

Respiratory infections, tumor production

Hepadnaviridae 40-45 nm

Hepatitis B virus

Serum hepatitis

Herpesviridae 120-200 nm

Cytomegalovirus

Mononucleosis

HHV-6, HHV-7

Roseola

Poxiviridae 200-350 nm

HSV-1, HSV-2

Herpes (oral and genital)

HHV-3

Chickenpox, shingles

Molluscipoxvirus

Molluscum contagiosum

Orthopoxvirus

Cowpox, smallpox

Images courtesy of ViralZone, SIB Swiss Institute of Bioinformatics. www.expasy.org/viralzone Related publication: Hulo C, de Castro E, Masson P, Bougueleret L, Bairoch A, Xenarios I, Le Mercier P. ViralZone: a knowledge resource to understand virus diversity. Nucleic Acids Res. 2011 Jan;39(Database issue):D576-82.

b. DNA-based viruses

A sk Yo u rs e l f What is the only family to possess a single-stranded DNA genome? a. Reoviridae  b. Adenoviridae  c. Hepadnaviridae  d. Parvoviridae

impact of viruses, take time to compare and contrast the viral families in Figure 6.2. For example, hepatitis A, hepatitis B, and hepatitis C are caused by viruses in the Picornaviridae, Hepadnaviridae, and Flaviviridae families, respectively. Figure 6.2 indicates they are all polyhedral, similar in size, and infect liver cells, which can lead to serious morbidity. Despite these similarities, differences in their peplomer morphology, genome types, and external covering influence viral transmission modes and pathogenesis. Take time now to identify these differences and consider how they impact the progression of each type of hepatitis infection. Throughout the text, you will see these pathogen images as we discuss the infections

152  CHAPTER 6  Viruses and Other Infectious Particles

they cause. Studying Figure 6.2 will help you better appreciate how the structural details of specific viruses relate to their clinical impact.

1. What functions does the protein capsid serve in a naked virus? 2. Why is the classification scheme for macroscopic organisms inadequate for viruses?

6 .2

Viral Replication Cycles

LEARNING OBJECTIVES 1. Describe the five basic steps of the virus replication cycle and the variations in the cycles of DNA and RNA viruses. 2. Compare and contrast the lytic and lysogenic cycles of a bacteriophage. iruses demonstrate an amazing ability to infect almost all living things. As obligate intracellular parasites, viruses use the metabolic machinery of host cells to accomplish their own replication. All viruses follow a similar five-step sequence discussed in the next section.

V

Viruses Replicating in Animal Cells Viral replication in animal cells follows the usual five steps: adsorption, cytosol penetration, biosynthesis, selfassembly, and release.

Adsorption  The first step in the invasion of an animal host cell is adsorption, the attachment of the virus to a host cell. Because peplomers on the virus surface must

precisely complement receptors on the host plasma membrane, each type of virus can infect cells only from certain species, its host range. This adsorption restriction prevents human illness by many viruses that cause infection in other organisms. For instance, even with close contact, the feline leukemia virus (FeLV) cannot be transmitted from cat to human because our cells lack the appropriate viral receptor, thereby blocking adsorption and subsequent infection. When multiple species share similar surface receptors, viral host range is expanded. The influenza A virus demonstrates this phenomenon when avian and human strains are transmitted to pigs. In some cases viral range is restricted to certain tissues within a specific host because only these cells possess the correct receptor. This is known as a viral tropism. For example, HIV binds to CD4, a protein receptor unique to the surface of human helper T cells (TH) (Figure 6.3). Because this protein receptor on helper T cells is an essential component in the mechanism used to activate immune responses, its use as the HIV docking site allows not only infection of the cell, but ultimately compromises the host’s ability to fight disease.

Viral tropism • Figure 6.3 The specificity of virus surface proteins determines which host cells can be infected, as demonstrated by the binding of HIV peplomers to the CD4 receptors unique to helper T cells. Plasma membrane

Helper T cell, TH CD4 receptor protein

The matrix is a protein layer surrounding the HIV capsid.

Cone-shaped capsid

The HIV genome is composed of two single RNA strands.

Receptors in the plasma membrane of TH cells activate other immune cells upon binding. Here, they act as HIV-binding sites.

Envelope Peplomers embedded in the HIV envelope

A sk Yo u r se l f Why does HIV bind specifically to helper T cells? a. The virus envelope can fuse only with the helper T cell plasma membrane. b. The receptor proteins on the helper T cell are complementary to the virus surface proteins. c. The peplomers on the virus fuse with the helper T cell plasma membrane. d. The helper T cell immediately engulfs the virus.

Viral Replication Cycles  153

viruses must produce mRNA for translation into proteins for synthesizing new capsids.

Cytosol penetration  Penetration, or the way in which an adsorbed virus enters the host cell cytosol, varies significantly between naked and enveloped viruses. Adsorption of a naked virus to a host cell surface may trigger invagination of the host cell plasma membrane, engulfing the pathogen, which is enclosed in a vesicle. Acidification of the vesicle coupled with the action of hydrolytic enzymes accomplish the uncoating of the virus, breaking down the capsid and releasing the viral genetic material into the cytosol. Adsorption of an enveloped virus to a host cell surface puts the virus envelope and the host cell plasma membrane in contact so they fuse, releasing the nucleocapsid into the cytosol, where it is then uncoated.

Self-assembly  The regulation of self-assembly is still poorly understood. As viral proteins accumulate, the capsomeres coalesce to begin forming the hulls of new capsids. Recently synthesized viral genomes are sorted into the developing capsids along with any necessary enzymes. Once fully assembled, the cycle is completed with the release of the viral progeny from the host cell to initiate the infective sequence in neighboring cells. Release  The new virus particles leave the host cell either by lysis (bursting) of the cell or by budding. Naked nucleocapsids are liberated by host cell lysis resulting from the formation of transmembrane pores that permit the influx of small molecules, leading to the osmotic uptake of water. Nucleocapsids that will be enveloped are released by budding, the process by which they acquire the

Process Diagram

Biosynthesis  The nucleic acid replication phase is the most diverse process in viral replication. Viruses can be grouped into distinct categories based on the relationship between their genome type and mRNA production. Regardless of the mechanisms or pathways involved, all

The replication cycle for adenovirus, a double-stranded DNA virus • Figure 6.4

✓ The Planner

Adenovirus genome production and virion self-assembly within the host cell nucleus highlights the replication cycle features unique to DNA viruses. 1 Peplomers adsorb the virus to host surface proteins, promoting cell penetration via membrane invagination.

2 Following capsid degradation, the viral DNA genome is released into the cytoplasm.

Host surface receptors

DNA genome

Capsid Nucleus

Nucleus

Peplomers Host cell Adenovirus, a doublestranded DNA virus

Invagination of the plasma membrane pulls the virus inside the host cell.

Nuclear pore mRNA Transcription 3 Viral DNA replication produces multiple copies of new genomes, while transcription generates viral mRNA. Viral DNA replication Host DNA

154  CHAPTER 6  Viruses and Other Infectious Particles

surrounding membrane. The nucleocapsids bind to the interior of the plasma membrane. When the nucleocapsid pushes outward, the fluid membrane completely surrounds it, forming the viral envelope. Because this portion of the host membrane expresses viral proteins made during the biosynthesis stage, the envelope is complete with characteristic peplomers. Budding is completed when the host plasma membrane pinches off, releasing the new enveloped virus.

DNA virus replication cycles  Although all viruses follow the same basic five steps for replication, DNA and RNA viruses have notable differences in the biosynthesis and self-assembly stages. The replication of adenovirus, a naked, double-stranded DNA virus, begins in the usual way with adsorption by peplomer binding to host surface receptors (Figure  6.4, step 1). Membrane invagination brings the pathogen into the cell, where the viral genome is released into the cytoplasm. For DNA viruses such as

4 The mRNA is translated into viral proteins in the cytoplasm using host ribosomes.

adenovirus, their genomes now move into the host nucleus for replication. The original viral DNA is also transcribed into mRNA using host RNA polymerase (step  3). Viral mRNA leaves the nucleus for translation into viral proteins using host ribosomes in the cytoplasm. The newly synthesized viral proteins return to the nucleus, where they aggregate, forming capsomeres (step 5). Self-assembly of virions occurs as capsomeres come together, generating capsids that are loaded with the newly synthesized viral DNA genomes. Virions leave the nucleus and travel to the inner surface of the plasma membrane. The release stage of a DNA virus replication cycle occurs in a usual manner as the adenovirus progeny emerge from the host cell by rupturing the plasma membrane. They attach to the surfaces of neighboring cells and repeat the process. Throughout the replication cycle, expression of adenovirus regulatory genes allows the infected host cell to elude detection by the immune system (discussed further in Chapter 10).

5 Viral proteins enter the nucleus and assemble to form the capsid, which loads with the viral genome to generate new virions.

Nuclear pore Peplomer

mRNA

Capsomere proteins

New viral protein

Assembled virion in the nucleus

Host DNA

6 The host cell dies as virions exit the nucleus, move to the plasma membrane and are released by lysis to infect neighboring host cells.

T h i n k C ri ti c al l y

Why does translation of viral mRNA occur in the cytoplasm whereas transcription and self-assembly occur within the nucleus?

Viral Replication Cycles  155

Process Diagram

RNA virus replication cycles  In contrast to the replication of DNA viruses, RNA viruses perform biosynthesis and self-assembly in the cytoplasm of the host cell (Figure 6.5). Because the RNA viral genome can be double stranded, (+) sense single stranded, or (−) sense single stranded, the details of replication and protein synthesis vary. Each strand of a (d/s) RNA genome acts as a template to build new genomes and as mRNA for the construction of viral proteins (Figure 6.5a). When the genome is (+) sense single-stranded RNA, it can be directly translated into new viral proteins

(Figure 6.5b). A viral RNA polymerase is used to generate a (−) sense strand of RNA to serve as a template for the production of new (+) sense genomes. In some viruses, this (−) sense template can also be translated into different proteins. A (−) sense RNA genome functions as the template for the production of (+) sense RNA strands. These can be used to generate numerous copies of complementary (−) sense genomes or directly translated into new viral proteins (Figure 6.5c). Although HIV is a (+) sense single-stranded RNA virus, it does not replicate as described in Figure 6.5b.

✓ The Planner

RNA virus replication cycles • Figure 6.5

Most RNA viruses perform genome replication and protein synthesis in the cytoplasm of the host cell. The exact manner in which these processes occur can vary among viruses because their genomes may be double-stranded RNA, (+) sense single-stranded RNA, or (−) sense single-stranded RNA.

1 Peplomers adsorb the viruses to host surface proteins.

Peplomer

2 Cell penetration occurs by membrane invagination of naked viruses and the fusion of enveloped viruses to the plasma membrane. Viruses are uncoated.

Rhinovirus – (+) sense single-stranded RNA

Host surface receptor

Invagination of the plasma membrane pulls the virus inside the host cell.

Capsid Peplomer

Nucleus Peplomer Rotavirus – double-stranded RNA

Host cell Capsid

Envelope Influenza A virus – (–) sense single-stranded RNA

Nucleus RNA genome release into cytoplasm.

Envelope fusion with host plasma membrane moves capsid inside cell.

KEY Double-stranded RNA (+) sense single-stranded RNA (–) sense single-stranded RNA

T h in k C ri ti c a l l y

Why is it possible for the RNA viruses to replicate in the host cell cytoplasm when the DNA viruses must replicate in the host cell nucleus?

156  CHAPTER 6  Viruses and Other Infectious Particles

This RNA virus is considered a retrovirus because it uses an enzyme, reverse transcriptase, to copy the information in its RNA genome into double-stranded DNA. This viral DNA then inserts into a TH cell genome, where it is transcribed and translated in the typical manner. It is the insertion of the viral DNA into the host genome that is responsible for the lifelong infection caused by this pathogen. Following self-assembly, the virus undergoes a brief maturation period. Shortly after budding, the virus particles become fully infectious and cause continued destruction of host TH cells and of the immune system.

a. Biosynthesis in double-stranded RNA viruses Double-stranded RNA viruses, like rotavirus, use both nucleic acid strands as templates to create more viral genomes and for translation into new viral proteins.

Cytopathic effects    Because cytopathic effect host metabolic and molecular (CPE) The visible pathways are interrupted dur- evidence of host cell ing viral replication, cytopathic damage caused by a effects (CPEs), or intracellular viral infection. damage, occur and eventually lead to cell death. Host cell damage caused by virus replication is usually responsible for the symptoms associated with specific viral infections. Certain types of CPEs are indicative of infection by particular viral pathogens. Consequently, clinical microbiologists use CPE

b. Biosynthesis in (+) sense single-stranded RNA viruses Rhinovirus is an example of a virus with a (+) sense RNA genome that acts directly as mRNA for the production of new viral proteins. A viral RNA polymerase generates a (−) sense RNA strand that serves as a template to make a large number of new complementary (+) sense genomes.

c. Biosynthesis in (−) sense singlestranded RNA viruses Once the (−) sense RNA strand in a virus such as the influenza A virus is used to generate complementary (+) sense strands of RNA, these can be used as genome templates and for translation into new viral proteins.

3 The biosynthesis stage requires production of both new viral RNA and proteins. The details of replication depend on the specific type of RNA the virus possesses. a.

b.

c.

Proteins Nucleus

Nucleus Proteins

Genomes

Nucleus Genomes Proteins

Genomes

4 Once new genomes and proteins are generated, self-assembly and release occur. Viral release via host cell lysis

Nucleus The envelope is applied as the virus buds from the cell.

Viral Replication Cycles  157

T he M icro b iologist ’ s T ool b o x Presumptive Diagnosis of a Viral Infection Using CPE Analysis

A sk Yo u r se lf

Dr. Craig Lyerla/CDC; DR DIANA HARDIE, UCT/Science Source Images; Luis M. de la Maza, Ph.D. M.D./Phototake; Ed Uthman/Wikimedia Commons; CNRI/Science Source Images; From Leboffe and Pierce A PHOTOGRAPHiC ATLAS FOR THE MICROBIOLGY LABORATORY © 2011 Figure 12.17

Viral infection results in pathogen-specific host cell damage (see the Figure), which is used by microbiologists as a diagnostic tool to identify specific illnesses. A trained clinician can make a presumptive determination of the viral pathogen based on the specific CPE observed. Cytopathic effect

Virus

Syncytium formation— a continuous mass created by the merger of adjacent cells

RSV

Multinucleated cells

Herpes simplex virus

✓ The Planner

Match these terms with their definitions: 1. syncytium a. An enlarged nucleus. 2. inclusion bodies b. The presence of more than one nucleus. 3. nucleomegaly c. Dark, oval spots in the cell. 4. multiple nuclei d. Formed by the merger of adjacent cells.

Example

Cytopathic effect

Virus

Cell enlargement

Reovirus

Example

Syncytium Cell enlargement

Normal uninfected cell

Multiple nuclei

Nucleomegaly— abnormal enlargement of the nucleus

CMV

Nucleomegaly

Inclusion bodies— aggregate bodies made up of damaged cells, organelles, and/or clumps of capsid proteins

Cell rounding— changing from flat and spreading to spherical

CMV

Adenovirus

Spherical shape change in infected cells

Inclusion bodies

to identify the virus responsible for infection (see The Microbiologist’s Toolbox).

Viruses Replicating in Bacterial Cells Animals are not the only organisms vulnerable to virus attack. Bacteriophages, like animal viruses, are quite variable and may possess genomes of single- or double-stranded DNA or RNA. Most phages have complex morphologies that specialize them for bacterial cell infection (Figure 6.6). Although the host cells vary, bacteriophages follow the same five basic steps for reproduction as viruses that infect eukaryotic cells: adsorption, cytosol penetration, biosynthesis, self-assembly, and release. Proteins on the tail fibers bind to host cell receptors to accomplish adsorption. Once the bacteriophage is anchored to the host cell, lysozyme associated with the tail fibers degrades the peptidoglycan in the bacterial cell wall, weakening the wall. When the sheath region contracts, the viral genome moves from the capsid into the host. This process is much like injection of a drug with a syringe. Because cell penetration is

158  CHAPTER 6  Viruses and Other Infectious Particles

accomplished without the capsid entering the host cell, there is no uncoating step. Once inside the host cell, the viral genome generates mRNA for translation into viral proteins and produces copies of the genetic material. For a brief period, the infected cell contains viral components but no intact virions. This interval is known as the eclipse period. Fol- lytic cycle A viral replication cycle that lowing self-assembly, the new bactereleases new virions riophages lyse the host cell plasma by bursting the host membrane, break down the cell cell. wall with lysozyme, and escape to repeat this process with nearby lysogenic cycle host cells. Viral replication that A replication cycle in ends with rupture of the host cell which virus DNA inteplasma membrane during release grated into the host of the virus particles is referred to genome is duplicated during cell divisions as a lytic cycle. The lytic cycle contrasts with until a stimulus trigthe lysogenic cycle, in which vi- gers its excision and the lytic replication ral reproduction does not cause cycle is initiated. the immediate rupture of the host

Detailed structure of the T2 bacteriophage • Figure 6.6

Head

The unique structure of this pathogen facilitates its infection of a bacterial host cell. The lysozyme-tipped tail fibers weaken the peptidoglycan cell wall, making genome injection easier when the sheath contracts.

Collar Nucleic acid

Contractile sheath Tail fibers tipped with lysozyme

Contracted sheath

Baseplate

Cell wall

T h i n k C ri ti c al l y

Which step in the infection process of a T2 bacteriophage requires the most specialized structural adaptation? Why?

Host bacterial cell E. coli

cell (Figure 6.7). In the lysogenic cycle, the linear viral genome enters the bacterial cell and combines with the host cell circular DNA. Now known as a prophage, the viral DNA is essentially latent within the host, but it replicates every time the bacterial cell undergoes binary fission. The result is the rapid spread of a recombinant genome throughout the bacterial population. Eventually the viral DNA exits the host genome and initiates a lytic cycle. The trigger for bacteriophage DNA excision, or induction, may be contact with specific chemicals, exposure to ultraviolet

(UV) radiation, reduced host cell nutrition, or some other unknown stimuli.

1. What are the basic differences in the replication cycles of (+) sense and (−) sense RNA viruses? 2. What triggers induction during the lysogenic cycle?

When bacteriophage λ infects an E. coli cell, replication can occur by the lytic cycle or by the lysogenic cycle. 1 E. coli is infected by bacteriophage . 2b Prophage produced as viral DNA integrates into host genome.

4a Host lysis releases new bacteriophages to repeat process.

3a Viral self-assembly produces new virions.

Lytic cycle

3b Phage DNA replicates with host genome.

Nucleoid

5b Process repeats indefinitely

2a Viral DNA directs production of new viral proteins and genomes.

6 Prophage induction triggers switch to lytic cycle.

A sk Yo u rs e l f Which bacteriophage replication cycle has the potential to produce more viral progeny?

Lysogenic cycle

4b Binary fission rapidly produces a large clone population of E. coli, each with a copy of viral DNA.

Process Diagram

✓ The Planner

Lytic versus lysogenic cycles • Figure 6.7

6. 3

Viruses and Human Health

LEARNING OBJECTIVES 1. Evaluate the use of eggs, living animals, and cell cultures for cultivating animal viruses. 2. Compare and contrast the impact of various viral infections on human health.

3. Describe the role of a provirus in recurrent infections and malignancy development.

ecause most human infections are caused by viruses, these pathogens have major clinical significance. Although these illnesses are usually acute, some viral species are associated with recurrent and chronic infections, whereas still other viruses transform normal host cells into cancerous ones. The first step in diagnosing patients suffering from these diseases is to accurately identify the pathogen using specialized viral cultivation techniques.

The Impact of Viral Infections

B

The Clinical Cultivation of Viruses Viral cultivation for clinical analysis is challenging because these obligate intracellular pathogens replicate only within host cells. Some human viruses can be grown in alternative hosts such as mice, rats, rabbits, guinea pigs, nonhuman primates, and occasionally insects. After the host animal is injected with the viral specimen, it is monitored for signs of infection or euthanized to examine tissues for pathogen-specific CPEs. A more convenient, host-specific method of viral cultivation is the use of cell culture. In this technique animal tissue is treated with enzymes to separate cells, which are then suspended in sterile nutrient media. When poured into a Petri plate, the cells form a confluent sheet, one cell layer thick. After introduction of a viral specimen, infected cultured cells are identified by macroscopic CPEs such as cell clumping or the formation of clear patches, or plaques, due to cell lysis. Because viral cultivation in live animals and in cell culture is expensive and complicated, most hospital microbiology laboratories send their patient specimens to a reference laboratory for analysis. These enormous regional testing facilities are specially equipped to perform viral cultivation and identification on a large scale. Because molecular techniques like polymerase chain reaction provide fast, accurate viral identification, the popularity of culture is declining. However, specialized laboratories are also used to grow viruses inside embryonated eggs for the purpose of generating antiviral vaccines. This technique is described in Section 12.1.

160  CHAPTER 6  Viruses and Other Infectious Particles

Even though smallpox, polio, and measles have been eradicated in many parts of the world, the most frequent pathogen type is still viruses. The most prevalent viral infection is the common cold. Although colds are usually blamed on rhinovirus, dozens of different viruses can cause the symptoms associated with this familiar infection. A cold is uncomfortable but usually self-limiting. The economic impact of the common cold is estimated at more than $40 billion annually in lost work productivity and treatment costs. Influenza is the second-most common viral infection. Every year 3 to 5 million cases of severe flu are reported, resulting in 250,000 to 500,000 deaths worldwide. Approximately three times a century, a pandemic, or major global outbreak, dramatically increases these numbers. In 1918 the H1N1 strain of influenza A virus caused a pandemic responsible for 20 to 50 million deaths, with a case fatality rate of greater than 2.5%. Although very young and elderly patients usually have the highest influenza mortality rates, H1N1 infection was unusual in its ability to quickly kill young, otherwise healthy adults. Almost 90 years later, this same patient cohort was again disproportionately affected by influenza. The 2009 swine flu pandemic was caused by a slightly different strain of this virus, known as novel H1N1 (see the Case Study). The Centers for Disease Control and Prevention (CDC) estimates that 43 to 89 million U.S. cases of novel H1N1 resulted in about 274,000 hospitalizations and 18,300 deaths, or a case fatality rate of approximately 0.004%. The common cold and influenza impact human health significantly because of the large number of people infected annually. However, even rare viruses can have a impact due to the fear generated by their sensational symptoms and high mortality rates. Examples of these types of viral infections include recent outbreaks of Middle East respiratory syndrome (MERS) in Saudi Arabia caused by a coronavirus known as MERS-CoV and pediatric acute respiratory tract infections in the U.S. caused by Enterovirus D68. Both of these infections represent pandemics because the pathogens have spread globally. However, although patients may progress rapidly to respiratory failure, the total number of affected individuals is low.

Case Study

✓ The Planner

H1N1 in Young Adults

Investigate: 2. What is the novel H1N1 influenza virus?

As the semester came to a close, college freshman Marla Jenkins started feeling run down and developed a cough. She took an over-the-counter cold medication to relieve her symptoms. I hope I’ll feel well enough to study for my last two finals after the drugs kick in, Marla thought. Marla’s medicine did little to alleviate her discomfort, and she felt progressively worse throughout the day. By bedtime she had a headache, chills, muscle aches, fatigue, and a noticeably worse cough with a temperature of 102.9°F (39.4°C). Marla took two ibuprofen tablets before lying down for the night. Marla didn’t make it to her remaining final examinations. Her alarm went off at 7 a.m., but Marla didn’t stir despite the blaring noise. Tiffany, her roommate, called to Marla but received no response. When she failed to shake Marla awake, Tiffany phoned 911. When Marla finally awoke, she found herself in the intensivecare unit (ICU) of a hospital with her worried parents by her bedside. They were talking to Dr. Sheldon, an infectious-diseases specialist, who told them her lab results were positive for the novel H1N1 influenza virus.

3. What do the H and the N stand for? “But Marla is young and healthy!” exclaimed her mother. Dr. Sheldon continued, “Viral infections usually have their greatest impact on the very young or the very old because their immune systems are weakest. But this virus seems to have a different pattern.”

b. A comparison of 2006 and 2009 influenza morbidity by age cohort 2009–10 rates

Age cohorts (in years)

65+

2006–07 rates

50–64

18–49

5–17

a. The novel H1N1 influenza A virus 0–4 0

5

10

15

% morbidity Peplomers

Douglas Jordan/CDC

Genome

1. How many types of peplomers are found on the surface of the novel H1N1 influenza virus? “Marla is extremely ill,” Dr. Sheldon explained to the Jenkins family. “Contrary to what most people think, the flu is not always a simple illness. Flu, like any pulmonary infection, may lead to life-threatening complications that require professional medical intervention.” “How long do I have to stay in the hospital?” Marla asked nervously. “I have two final exams to take today. Can’t you just give me some medicine and send me back to school?”

(Data from Update: Influenza Activity—United States, August 30, 2009— March 27, 2010, and Composition of the 2010—11 Influenza Vaccine. (2010, April 16). Retrieved December 13, 2014, from http://www.cdc.gov/ mmwr/preview/mmwrhtml/mm5914a3.htm?s_cid=mm5914a3_e; (2009, December 24). Retrieved December 13, 2014, from http://www.cdc.gov/flu/ weekly/weeklyarchives2009-2010/weekly50.htm)

4. What age groups are most strongly affected by this strain of influenza virus? Are these results surprising? Explain. Over the next 24 hours, Marla’s condition continued to deteriorate. Despite oxygen administration, Marla’s blood oxygen saturation levels declined. Her heartbeat was rapid, her fingernail beds looked blue, and she had difficulty breathing, even when resting. As Marla slipped into respiratory failure, she was intubated and placed on a ventilator. Marla required mechanical ventilation for 27 days before she recovered sufficiently to breathe unassisted. After a month in the ICU, Marla was discharged to complete her recuperation at home. 5. What major complication of an influenza virus infection did Marla experience?

Viruses and Human Health  161

One recent example of a rare viral infection causing significant global impact is Ebola. Although Ebola outbreaks have periodically occurred in Africa beginning in the 1970s, the most recent outbreak is the largest (Figure 6.8a) and is caused by the most lethal subtype of the virus, with an average mortality rate of 78%. This outbreak began in December 2013 when a two-year-old boy in a remote region of West Africa near the borders of Guinea, Sierra Leone, and Liberia contracted the disease from an unknown source. Early spread of the epidemic was enhanced by traditional burial practices during which community members touch the body of the deceased. The funeral of one traditional healer in Sierra Leone was linked to more than 300 deaths. Preventing the spread of Ebola is challenging in these countries because of lack of education, mistrust of the government, and poor health care infrastructure (Figure 6.8b), including insufficient personal protective equipment (PPE) for medical personnel. In today’s world of fast international travel, a regional outbreak can have an impact around the world. During the 2014 outbreak, Ebola spread to multiple countries outside of West Africa, including the United States.

Spread of the virus to health care workers in the United States and Spain demonstrated how difficult it is to protect those caring for patients in later stages of the disease even with the best equipment and facilities available.

Viruses, Recurrent Infections, and Cancer When lysogeny occurs with viruses that infect eukaryotic cells, the viral DNA incorporated into the host cell DNA is known as a provirus. With the viral DNA in provirus form, the host’s immune system cannot target it for elimination. Because no viral proteins are being expressed in the cell membrane, the host immune system is not triggered to produce either antibodies or specific killing lymphocytes to fight the invading pathogens. The viral DNA can spread throughout a population of cells unchecked while it hides in the host cell’s DNA. This constitutes a latent infection. When induced, the expression of the viral genome may result in the reactivation of a previous infection. For example, years after the occurrence of chickenpox, induction of the latent varicella-zoster provirus leads to the

The impact of an Ebola outbreak • Figure 6.8 Although Ebola virus infections are rare, when outbreaks of Ebola virus disease occur, they have a major impact on human health because of the high mortality rate.

a. The history and distribution of Ebola outbreaks

Guinea

30,000

Sierra Leone Liberia Gabon

1976–77

DRC

RC

1994–96 2001–05 2007–08 2014 1000 km

b. The estimated impact of delaying interventions on the daily number of patients with Ebola disease over time in Liberia during 2014–15 The model predicts the daily number of new Ebola disease cases based on being able to increase monthly the percentage of patients hospitalized in Ebola treatment units. Delaying implementation of effective Ebola treatment units is expected to significantly affect the expected peak number of new daily Ebola cases.

New Ebola cases per day

Gire SK et. al. (2014) “Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak” Science 345 (6202) 1369-1372] Reprinted with permission from AAAS

Over the past 40 years, relatively small Ebola outbreaks have occurred in and around Gabon and the Democratic Republic of the Congo. However, a large epidemic emerged in 2013–14, centered in Guinea, Sierra Leone, and Liberia.

25,000

cases

10,646 15,000 3,408

10,000 5,000 8/1

1000

Inte rp re t th e D a ta Approximately how many Ebola cases were diagnosed during the 1976 outbreak? a. 100  b. 550  c. 850  d. 1250

162  CHAPTER 6  Viruses and Other Infectious Particles

25,847

Start November 22

20,000

0 100

Start September 23 Start October 23

9/1

10/1

11/1 Date

12/1

1/1

What a Microbiologist Sees ✓

The Planner

Connecting Symptoms with the Progression of HIV

Review Figure 6.3 and answer this question. Why is the binding of HIV to helper T cells such a serious health problem? a. It activates other immune responses. b. It blocks the activation of other immune responses. c. It causes the T cells to divide. d. It causes mutations in the T cells.

shingles, a painful, vesicular skin infection. Because the virus can reactivate repeatedly, patients can suffer more than one bout of shingles. The herpes simplex viruses (HSV) 1 and 2 are well known for their ability to cause recurrent infections, leading to a chronic illness, which is characterized as a long-lasting or persistent infection. The HSV-1 provirus remains latent in the cells of the trigeminal nerve of the face but periodically reactivates, producing vesicles on the lips that ulcerate, resulting in cold sores. In some patients HSV-1 reactivation leads to vision-threatening herpetic eye infections. HSV-2 causes genital herpes infections, which are characterized by periodic eruptions of painful vesicles that burst, resulting in ulcer formation. Treatment with antiviral drugs may reduce the severity and duration of outbreaks, but HSV infection is lifelong.

National Cancer Institute

b. 107

1200 Death

Initial HIV symptoms; distribution of HIV to lymphoid organs

1000 Cell population (cells/μl)

Pu t I t To g e ther

a.

106

Opportunistic infections, Kaposi’s sarcoma

800

105

600

104

400

Symptom onset as TH population 103 crashes

200

Asymptomatic latent phase corresponds to reduced viral load in plasma

3

6 9 12 Weeks

2

4

6

8

10

HIV plasma population (RNA copies/ml)

Before the AIDS epidemic, Kaposi’s sarcoma was a rare malignancy affecting connective tissue. This cancer is caused by infection with the human herpes virus 8 (HHV-8), which is usually subdued by the immune system. Characteristic purplish tumors only emerge in infected immune-compromised individuals, such as patients coinfected with HIV (Figure a). But how can an HIV infection lead to the development of cancer? A microbiologist sees a link between immune function failure, viral infection, and malignancy development. The immune system can eliminate nonself, or foreign cells in the body by targeting unfamiliar molecules on the cell surface. Both virusinfected cells and cancer cells produce nonhost glycoproteins on their surfaces, making them foreign cells. In a healthy person, these cells are destroyed by the immune system. Failure of the immune system means that neither microbial pathogens nor malignant cells are destroyed, allowing the malignant cells to develop into life-threatening cancers. Because HIV targets helper T cells (TH), which are responsible for coordinating all immune responses, AIDS patients are at high risk of acquiring both infectious diseases and malignancies. When Kaposi’s lesions appear, microbiologists know the peripheral TH cell population of an AIDS patient has crashed, marking the progression of HIV infection (Figure b).

102 12

Years Time after infection

Sometimes proviruses can convert a normal cell into a malignant one. These oncoviruses, or tumor causing viruses may be responsible for more than 20% of human cancers (see What a Microbiologist Sees).

1. How are viruses grown in cell culture? 2. What are the two most common viral infections? 3. How can viral infection lead to a chronic illness? Viruses and Human Health  163

6. 4

Prevention and Treatment of Viral Infections

LEARNING OBJECTIVES 1. Describe effective ways to prevent viral infections. 2. Explain the challenges associated with treating viral infections.

3. Describe the different ways that viral infections can influence bacterial infections.

lthough antiviral therapies are often successful, they may have serious side effects. In addition, inappropriate treatment of viral infections with antibiotics has greatly contributed to the evolution of drug-resistant bacteria. Immunization is the preferred clinical action as it prevents many viral infections, even some malignancies, and doesn’t promote antibiotic resistance.

immunization programs has drastically reduced the number of viral infections that claimed countless lives only a century ago (see the Clinical Application). Public service announcements, school policies, and medical personnel promote participation in these programs while county health departments ensure the accessibility and affordability of immunizations. Another extremely effective weapon in the fight against viral infection is educational programming designed to modify behaviors that increase the risk of virus contact. Sometimes these practices are simple, such as teaching children to wash their hands before eating. The routine use of alcohol gel for hand sanitization

A

The Prevention of Viral Infections Maintaining good health is always preferable to curing an illness. The implementation of highly successful

Clinical Application

✓ The Planner

Mandatory Flu Vaccines for Health Care Providers

Inte rp re t th e D a ta Of the physicians, nurses, and staff, which group had the highest percentage of workers to get immunized?

164  CHAPTER 6  Viruses and Other Infectious Particles

Healthcare workers in the NICU receiving influenza vaccine 90 Vaccinated

80

Refused vaccination

70 60 Percentage

In 2011 the Association of Professionals in Infection Control and Epidemiology recommended influenza vaccination for all health care personnel because preexposure immunization effectively prevents annual epidemics. A hospital immunization program successfully encouraged influenza vaccination for parents of children in the neonatal intensive care unit (NICU). Immunization of 93% of previously unvaccinated parents reduced risk of newborn influenza exposure. Vaccine was also available to hospital personnel, leading to a 26% immunization increase among the NICU staff and a corresponding reduction in morbidity. One-third of health care providers declined vaccination (see the Figure) with nurses most often refusing because of injection fear and physicians questioning vaccine effectiveness. These data emphasize the need for continued education of medical personnel to enhance immunization compliance and reduce influenza infection.

50 40 30 20 10 0

Physician

Nurse

Staff

The mechanism of action and side effects of representative antiviral medications  Table 6.2 Mechanism of viral inactivation

Drugs

Side effects

Fuzeon

Injection site irritation, bruising

Amantidine

Insomnia, blurred vision, GI upset, dry mouth

Tamiflu

GI upset

Relenza

Dizziness, susceptibility to secondary infections

Acyclovir

Rash, headache, GI upset

Ribavirin

Anemia, birth defects

Azidothymidine

Bone marrow suppression, fatigue, GI upset

Famciclovir

Dizziness, headache, GI upset

Nelfinivir

Diarrhea, body fat redistribution, cardiac risk

Indinavir

Anemia, hepatitis, kidney damage, body fat redistribution, cardiac risk

  Integrase inhibitor

Elvitegravir

Abnormal dreams, cloudy urine, GI upset

  Reverse transcriptase inhibitors

Lamivudine

Fatigue, fatty liver, GI upset

Azidothymidine

Bone marrow suppression, fatigue, GI upset

Nevirapine

Fatigue, GI upset

Tamiflu

GI upset

Rimantidine

Insomnia, blurred vision, GI upset, dry mouth

Entry inhibitors

Nucleotide analogs

Enzyme inhibitors   Protease inhibitors

Egress inhibitors

Antiviral Therapies

targets for attack. The rapid mutation occurs because viral nucleic acid replication is fast but often inaccurate, which leads to the production of a large number of mutant variants in an infected individual. Consequently viruses often develop drug resistance, and drugs designed with high pathogen specificity quickly become obsolete. As viruses are obligate intracellular pathogens, effective antiviral drugs must usually enter the host cell to function. Launching a general attack within the host cell can lead to collateral damage, so virus-specific features must be selected for assault. Antiviral therapies that focus on specific stages of viral replication can minimize inadvertent host damage. Most antiviral medications (Table 6.2) function in one of four ways:

When preventive measures fail and viral infections occur, there are surprisingly few drug therapies available to combat these pathogens. This shortcoming is the result of two major problems: 1) the rapid mutation rate in viruses, and 2) a limited number of virus-specific

1. preventing viral entry of host cell 2. disrupting replication of the viral genome 3. inhibiting the activity of viral enzymes 4. preventing the release of new virions.

when soap and water are unavailable is a relatively recent healthful practice to reduce viral spread. Covering a cough or sneeze using the crook of the arm prevents the release of airborne respiratory pathogens and avoids the hand contamination that results from the traditional hand-over-the-mouth practice. Other behavioral changes are more sophisticated, such as implementing nationwide campaigns to educate adults on safe sex practices. Health care providers are trained to protect themselves from blood-borne viruses by practicing universal precautions, such as consistent use of PPE including gloves and masks.

Prevention and Treatment of Viral Infections  165

Viral entry inhibitors may prevent adsorption by blocking peplomer–receptor binding or interfere with envelope fusion to the plasma membrane. The use of nucleotide analogs, or drugs that mimic the nucleotides needed to build new viral genomes, effectively block replication. Interfering with the activity of enzymes needed for genome replication or virion maturation prevents production of new infectious viruses, whereas exit inhibitors prevent envelope application and host cell lysis. Although antiviral medications have dramatically reduced morbidity, most cause significant side effects, ranging from life-threatening bone marrow suppression to the irritation of fatigue, headache, and gastrointestinal discomfort. An unusual side effect of protease inhibitors is the redistribution of body fat that occurs with long-term use. The resulting increase in the patient’s abdominal girth corresponds to an increase in cholesterol levels and risk of cardiovascular disease. The actions and side effects of antiviral drugs will be discussed in greater detail in Chapter 14.

Viral Influences on Bacterial Infections Lysogenic bacteriophages, or temperate phages, are very common. Because viral genome replication can occur more efficiently via host binary fission than by the lytic cycle, this reproductive mechanism is evolutionarily favored. There can be clinical consequences to lysogeny for a person infected with bacteria carrying temperate phages with toxin-producing genes. On prophage insertion, the host bacterium may express an altered phenotype known as lysogenic conversion, which is caused by certain bacteriophage genes. This new phenotype can represent enhanced virulence due to toxin production (Table 6.3) and can lead to significant tissue damage in patients infected with converted bacteria. Although antibiotic therapy may effectively eliminate the now pathogenic bacteria, the symptoms of the infection are toxinmediated and usually require additional treatment with specific antitoxins to provide relief.

Another clinically significant aspect of bacteriophage activity is specialized transduction. During prophage excision, part of the bacterial genome is also extracted, replicated, and packaged into the new virions for transfer to the next host (Figure 6.9). Because this bacterial DNA may include a gene that codes for drug-degrading enzymes, specialized transduction can permit the rapid spread of antibiotic resistance in a bacterial population. (For more information on this topic, refer to Chapter 8.) antibiotic Bacteriophages can also be resistance The used to attack certain bacteria. phenomenon in Phage therapy uses specific bacwhich bacteria can teriophages to target a given bac- grow in the presterial species for destruction. If ence of an antibiotic appropriate bacteriophages are to which they were administered to a patient suffer- once sensitive. ing from a bacterial infection, the rapidly replicating viruses can quickly decimate the bacterial population, which grows at a much slower rate. Once the pathogenic bacteria have been eliminated, the targetspecific phages have no way to continue reproducing and are destroyed by the patient’s immune system. Phage therapy is inexpensive, has few side effects, spares normal bacterial microbiota, and is highly effective. Other benefits of phage therapy include elimination of pathogens with antibiotic resistance or sequestered in a protective biofilm. Auto-dosing refers to bacteriophage replication following administration and is responsible for achieving full efficacy with a single dose. Despite these obvious advantages, phage therapy is not yet approved for human use in the United States. Because many viral infections are self-limiting, drug therapy is not always necessary. Many patients lack the patience to rely on their immune system to eliminate a viral infection. They don’t realize that antibiotics are only effective against bacterial pathogens because these drugs were designed to attack specific prokaryotic targets. Because viruses are acellular pathogens and lack these targets, antibiotics are useless for treatment of a viral infection.

Lysogenic conversion influencing bacterial virulence via toxin production  Table 6.3 Bacterial host

Illness

Toxin-mediated symptoms

Clostridium botulinum

Botulism

Flaccid paralysis

Corynebacterium diphtheriae

Diphtheria

Pharyngeal pseudomembrane

Escherichia coli

Hemolytic uremic syndrome

Bloody diarrhea, gastroenteritis

Streptococcus pyogenes

Toxic shock syndrome

Rash, extreme hypotension

Vibrio cholerae

Cholera

Rice-water diarrhea

166  CHAPTER 6  Viruses and Other Infectious Particles

Bacteriophage activity can cause the rapid spread of a new gene through a bacterial population. This phenomenon becomes medically important if the phages are transferring genes for antibiotic resistance.

Viral DNA Nucleoid

ER gene 1 Lysogenic propagation of viral DNA takes place in an E. coli host with an erythromycin resistance gene (ER).

2 Inaccurate viral DNA excision includes ER gene from host genome.

3 Viral replication occurs.

4 New virions self-assemble.

5 Host lysis releases virions carrying modified DNA.

6 Infection of new E. coli host transfers ER gene resulting in its lysogenic conversion. ER gene Viral DNA

A sk Yo u rs e l f In specialized transduction the resistance gene comes from the _____. a. virus  b. bacteriophage  c. bacterial genome  d. human host cell

7 Binary fission of converted cell generates a large population of erythromycin-resistant E. coli.

Prevention and Treatment of Viral Infections  167

Process Diagram

✓ The Planner

Specialized transduction • Figure 6.9

Microbiology InSight  The costs of poor

antibiotic stewardship 

•  Figure 6.10

Treating viral infections with antibiotics comes with a high price tag because indiscriminant antibiotic use leads to the development of drug-resistant bacterial pathogens. 400

a. The costs are staggering for the extended hospital stays and additional drug/surgical therapies to eliminate infections caused by multidrug-resistant (MDR) pathogens generated by irresponsible antibiotic use.

Cost of 8 million additional hospital days $32 billion

Rate per 1000 visits

Costs associated with antibiotic-resistant infections in the U.S.

CDC campaign for appropriate antimicrobial use begins

300

200

Societal costs $35 billion

Excess healthcare costs $20 billion

(Data from Rosenthal, E. (2013, December 2). As Hospital Prices Soar, a Stitch Tops $500. Retrieved December 10, 2014, from http://www. nytimes.com/2013/12/03/health/as-hospital-costs-soar-single-stitchtops-500.html?pagewanted=all&_r=2&; (n.d.).

100

1993– 1995– 1997– 1999– 2001– 2003– 2005– 2007– 1994 1996 1998 2000 2002 2004 2006 2008 Period

b. To slow the evolution of drug-resistant pathogens, the CDC launched a Campaign for Appropriate Antibiotic Use in 1995, encouraging health care providers to prescribe antibiotics more responsibly. Over the next decade, the antibiotic prescription rate in patients 14 years old and younger declined 24% with the number of antibiotic courses per 1000 office visits dropping from more than 300 to 229.

Facts about Antibiotic Resistance. (n.d.). Retrieved April 13, 2015, from http://www.idsociety.org/AR_Facts. Antibiotic-Resistant Infections Cost the U.S. Healthcare System in Excess of $20 Billion Annually. (n.d.). Retrieved December 10, 2014, from http://www.prnewswire.com/news-releases/ antibiotic-resistant-infections-cost-the-us-healthcare-system-in-excessof-20-billion-annually-64727562.html.)

If an antibiotic is prescribed for a virus infection, the consequences are more significant than just money wasted on an ineffective treatment (Figure 6.10). Whenever an antibiotic is administered, the drug not only eliminates the bacterial pathogen but also damages the patient’s normal bacterial microbiota. Because normal microbiota represent a highly efficient host defense mechanism, their unnecessary destruction by an inappropriately prescribed antibiotic increases an individual’s vulnerability to pathogen attack. Antibiotic use also has associated side effects.

168  CHAPTER 6  Viruses and Other Infectious Particles

Annually, 142,000 people are rushed to emergency departments for adverse antibiotic reactions. Of these serious medical problems, approximately 70,000 were caused by unnecessarily prescribed medications. Because more than half of hospital patients receive antibiotics, in 2014 the CDC recommended implementation of an Antibiotic Stewardship Program (ASP) in all acute care facilities. ASPs demonstrating the greatest success share two features: strong leadership and multidepartment integration. Evidence supported assigning a single

✓ The Planner

▲

c. Antibiotic therapy may damage most of

the normal gut microbiota, allowing the spore-former Clostridium difficile to survive as the dominant bacterial species. This toxin-secreting pathogen causes intestinal damage known as pseudomembranous colitis. The morbidity and mortality costs of this antibiotic-induced infection is more than 250,000 U.S. patients annually, with 14,000 fatalities.

David M. Martin, M.D./Science Source Images

A sk Yo u rs e l f Which of the following drug-resistant pathogens poses the greatest potential threat? a. methicillin-resistant Staphylococcus aureus  b. Clostridium difficile c. DR-Streptococcus pneumoniae d. vancomycin-resistant Enterococcus

Pathogen threat level

Interpretation

Examples

Urgent

Potential to become widespread; need immediate public health attention to identify infections and minimize transmission

Clostridium difficile, Carbapenem-resistant Enterobacteriaceae, *DR-Neisseria

Serious

Not presently urgent but will worsen to that level without public health intervention via monitoring and prevention actions

**MDR-Acinetobacter, DR-Campylobacter, DR-Candida, ***ESBL-producing bacteria, Vancomycin-resistant Enterococcus, DR-Streptococcus pneumoniae, Methicillinresistant Staphylococcus aureus, ****MDR/XDR-Mycobacterium tuberculosis

Concerning Pathogens cause serious illness but have a low threat of resistance development; require monitoring for rapid response in the event of an outbreak

Vancomycin-resistant Staphylococcus aureus, Erythromycin-resistant Streptococcus pyogenes, Clindamycin-resistant Streptococcus agalactiae

*Drug resistant; **Multi-drug resistant; ***Extended spectrum β-lactamase; ****Extensively-drug resistant

d. To safeguard the public from the evolution of more drug-resistant pathogen species, the CDC and World Health Organization (WHO) employ epidemiologists and clinical microbiologists to collect and analyze data on the prevalence and virulence of bacteria. This information is used to assess infection risk to allocate intervention funds and minimize pathogen transmission. (Data from Antibiotic Resistance Threats in the United States, 2013, p. 21. Retrieved December 10, 2014, from http://www.cdc.gov/drugresistance/threat-report-2013/pdf/ar-threats-2013-508.pdf.)

physician as ASP leader. All successful ASPs coordinated education of hospital teams as well as patients regarding best practices for antibiotic use. To solve the problem of misuse outside a hospital setting, health care providers are encouraged to handle patient/parent requests for antibiotics to treat viral infections as a teachable moment. Although it may initially take time to provide the necessary education, ultimately the patient receives the best possible medical care, and the evolution of drug-resistant bacterial strains is minimized.

1. What is the most effective way to prevent a viral infection? 2. What are common targets of antiviral drugs? 3. How does unnecessary exposure of normal microbiota to antibiotics lead to the evolution of multidrug-resistant bacteria? Prevention and Treatment of Viral Infections  169

Viruslike Microbes

6. 5

LEARNING OBJECTIVES 1. Describe viroid structure, routes of host cell infection, replication, and symptoms of infection. 2. Compare and contrast the structures and replication strategies of satellite viruses and virusoids, providing an example of each.

3. Describe normal prion structure, indicating where it is located and how the misfolded form acts as a pathogen to cause neurodegeneration.

here are several kinds of infectious particles that are even simpler than viruses. Some are physically similar to a standard virus but lack the ability to replicate in a host cell without assistance from a so-called helper virus. Other infectious particles consist of just nucleic acid (RNA) or just protein.

isolated only from plants, where their presence may be completely asymptomatic or devastating (Figure 6.11). Recent evidence indicates that viroids disrupt host ability to process mRNA, resulting in impaired protein synthesis and survival. Various viroid transmission routes are possible. When present in the pollen or egg cells of a plant, viroids pass from one generation to the next in the seeds. To cross the protective cellulose wall of plant cells, viroids take advantage of insects with piercing mouthparts, such as aphids. Another effective method of cell wall penetration is plant abrasion from the use of contaminated agricultural equipment.

T

Viroids Viroids are ribonucleotides approximately 300–400 bases long. These single-stranded, predominantly circular RNAs possess considerable internal base pairing, which results in a three-dimensional structure that is highly resistant to attack by host cell RNases, or RNA-degrading enzymes. The viroid genome does not code for any protein and resides inside the nucleolus of the host cell. Unlike RNA viruses, which reproduce in the host cytosol, viroids replicate within the nucleus or chloroplast. Viroids have been

Satellites Satellites are single-stranded RNA of 500–2000 nucleotides. They include satellite viruses and virusoids. Satellite viruses are unable to reproduce without assistance from

The effects of viroid infection in plants • Figure 6.11 The small, 3-D RNA strands of viroids, like peach latent mosaic viroid (PLMV) are devastating plant pathogens responsible for damaging leaves, stems, and fruits.

T h in k Cri ti c a l l y

PLMV infection directly damages fruit. How does viroid infection of leaves also indirectly reduce peach yield?

170  CHAPTER 6  Viruses and Other Infectious Particles

William M. Brown Jr/Bugwood.org

b. PLMV infection can mar the appearance of fruit and diminish its value.

H.J. Larsen/Bugwood.org

Healthy leaf

Infected leaves

a. PLMV causes extensive damage to the leaves of peach trees.

Prion structure • Figure 6.12 Prions exist in two different conformations known as PrPc and PrPsc, the normal and misfolded prion configurations, respectively.

a. Normal prion, PrPc

b. Misfolded prion, PrPsc

Primarily located in the plasma membrane of neurons, PrPc is largely composed of alpha helices, which result in a globular three-dimensional conformation. This prion form protects against ageassociated dementia.

Due to the presence of beta sheets, PrPsc is a relatively flat protein with an extremely stable overall conformation. Misfolded prions trigger the cell death responsible for the spongiform brain tissue characteristic of these infections.

Alpha helix

A.

Beta pleated sheet

B.

T h i n k C ri ti c al l y

Knowing that protein denaturation requires a change in 3-D conformation, examine the structure shown in part b, and determine why the PrPsc misfolded protein is almost impossible to denature even when treated with harsh chemicals, extreme heat, or altered pH.

the genome of a helper virus that simultaneously infects the host cell. For example, adeno-associated virus (AAV) can code for the production of its capsid but needs the helper virus to copy its genome. A virusoid requires a helper virus both to copy its genome and to produce a capsid. The delta agent that simultaneously infects liver cells with the hepatitis B virus (HBV) is a virusoid and is responsible for significantly increasing the severity of the disease.

Prions Another group of subviral infectious particles is the prions, a name derived from proteinaceous infectious particles. Prions consist solely of prion An extremely protein (Figure 6.12a). They are small infectious parbest known for causing mad cow ticle composed only disease, one of the transmissible of protein. spongiform encephalopathies (TSEs) found in mammals. These neuro-degenerative disorders result in neuronal loss, ultimately leading to the

spongelike appearance of the brain tissue. Prion infection can be acquired by prion consumption, or it may be inherited. Spontaneous prion infections have also been documented. Presently there is no cure for TSEs, and the causative prions are highly resistant to treatments with UV radiation, formaldehyde, and extremely high temperatures. This is likely due to their simple yet highly stable conformation (Figure 6.12b). As a result, treatments that easily denature other proteins are ineffective against the prions. The normal conformation of a PrPc, or prion protein, occurs on the plasma membrane of many mammalian cells and is particularly abundant in neurons. It appears to have a protective function, guarding the brain against degeneration and age-associated dementia. PrPsc, the misfolded version of the protein, acts as an infectious agent. When it comes in contact with PrPc, a conformational change occurs that converts the normal protein into the misfolded prion form. This may occur by direct contact with the PrPsc, or the prion may activate enzymes to modify the shape of the PrPc. The result is Viruslike Microbes  171

Major features of viruslike microbes  Table 6.4 Feature

Viruses

Satellites

Viroids

Prions

Nucleic acid

s/s; d/s DNA/RNA

s/s RNA

s/s RNA

Absent

Protein capsid

Present

Present

Absent

Absent

Protein

Present

Present

Absent

Present

Helper virus assistance

Not typically needed; some smaller viruses need assistance (parvoviruses)

Yes

No

No

Yes Yes Yes

Yes Yes Yes

No Yes No

No No No

Bacteria Animals Plants

Bacteria Animals Plants

Plants

Mammals

Inactivation:  Heat   UV radiation   Denaturing chemicals Host organisms

another misfolded prion protein capable of interacting with other normal PrPc proteins and converting them to the PrPsc form. Essentially a domino effect has been initiated. Cell death ultimately results in the development of the spongiform brain tissue characteristic of these infections. Table 6.4 summarizes viruses, satellites, viroids, and prions. The streamlined size and structure of these infectious particles is truly deceptive as these smallest of pathogens have a major clinical impact.

The Planner

1. How does the physical structure of a viroid differ from that of a virus? 2. What are the replication challenges of a satellite virus and a virusoid? 3. How does prion structure correlate with its ability to withstand harsh treatments?

✓

Summary

6.1

Viral Structure and Classification  148

• Virologists study viruses, or virions, which are obligate intracellular parasites that are much smaller than cells such as bacteria. Although there is variation in viral structure, as the diagram shows, all viruses have a core of singlestranded or double-stranded DNA or RNA surrounded by a protein capsid, made up of capsomeres. Many viruses Head also have a phospholipid bilayer envelope acquired from their host cell. Tail sheath Tail

Viral shapes: Complex nucleocapsid  •  Figure 6.1

Plate Pins

Tail fibers

172  CHAPTER 6  Viruses and Other Infectious Particles

• The International Committee on Taxonomy of Viruses classifies viruses into more than 100 different families based on shared biochemical and structural features, as well as host range.

6.2

Viral Replication Cycles  153

• All viruses go through the same basic steps to replicate. The first step is adsorption in which peplomers on the viral surface attach to receptors on the host cell surface. Cytosol penetration involves entry of the virus into the host cell and uncoating of the viral genetic material. The viral nucleic acid is then used to code for viral proteins and new copies of the viral genome. After self-assembly of the components, new virus particles are released from

The replication cycle for adenovirus, a double-stranded DNA virus  •  Figure 6.4

• Viruses that infect bacteria are called bacteriophages. Bacteriophages replicate using either the lytic cycle or the lysogenic cycle to integrate their DNA into the bacterial chromosome forming a prophage. During the lysogenic cycle, binary fission spreads the viral genome throughout the bacterial population. The lytic cycle is again initiated when a stimulus triggers induction, or the excision of the prophage.

6.3

• Inappropriate use of antibiotics to treat viral infections has many adverse outcomes, including the spread of antibiotic resistance and the destruction of normal microbiota, which can make systems more vulnerable to infections such as the intestinal infection by Clostridium difficile shown in the photo. During induction, specialized transduction removes bacterial DNA carrying drug-resistant genes. Phage infection of new hosts rapidly spreads the antibiotic resistance. A positive outcome of viral infection is the use of phage therapy, which uses bacteriophages to target pathogenic bacteria to alleviate a host infection.

The costs of poor antibiotic stewardship  •  Figure 6.10

Viruses and Human Health  160

• Viruses can be cultivated for clinical analysis in host animals or in cell culture. They are routinely grown in embryonated eggs for the production of antiviral vaccines. • Viruses have an enormous clinical impact on the human population. Colds and influenza (shown in the diagram) are the most common infections and annually sicken a significant portion of the population. Rare viruses such as Ebola infect far fewer patients but have high mortality rates.

Peplomers

Douglas Jordan/CDC

Case Study: H1N1 in Young Adults

Genome

• Antiviral agents are difficult to develop because viruses use host cell machinery to replicate, and thus, no drug therapy is available for most virus-caused diseases. When antiviral agents are administered, they must target replication cyclespecific features to minimize host damage while effectively curtailing pathogen replication.

David M. Martin, M.D./Science Source Images

the cell by lysis (shown in the diagram) or by budding. Cytopathic effects (CPEs) occur during replication and eventually lead to the death of host cells.

6.5

Viruslike Microbes 170

• Several infectious agents are structurally less complex than viruses. Viroids are significant plant pathogens that consist of small segments of RNA only. • Satellite viruses and virusoids are composed of both genetic material and protein capsids, but they require a helper virus to replicate. • Prions consist of protein only and when misfolded (as shown in the diagram) can cause disease in a number of different mammals.

• Because some viral genomes can insert into host DNA as proviruses, induction can lead to recurrent or chronic illnesses. In addition, provirus insertion in the form of oncoviruses may cause malignancy in a previously healthy host cell.

6.4

Prevention and Treatment of Viral Infections 164

• Virus-caused diseases are best controlled by prevention using vaccination or behavioral methods to avoid infection.

Beta pleated sheet

Prion structure  •  Figure 6.12 Summary  173

Key Terms • adsorption  153 • antibiotic resistance  166 • bacteriophage  149 • budding  154 • capsid  149 • capsomere  149 • chronic illness  163 • cytopathic effect (CPE)  157 • eclipse period  158 • envelope  149 • host range  151 • induction  159 • latent infection  162

• lysis  154 • lysogenic conversion  166 • lysogenic cycle  158 • lytic cycle  158 • negative-sense (−) RNA  148 • nucleocapsid  149 • obligate intracellular pathogen  148 • oncovirus  163 • penetration  154 • phage therapy  166 • positive-sense (+) RNA  148 • prion  171 • prophage  159

• provirus  162 • retrovirus  157 • reverse transcriptase  157 • satellite virus  170 • self-assembly  154 • specialized transduction  166 • temperate phage  166 • uncoating  154 • virion  149 • viroid  170 • virologist  150 • virus  148 • virusoid  171

Critical and Creative Thinking Questions

a. W  hat family of viruses is the smallest? Describe the genome of viruses in this family. Perform an Internet search of viruses of this family. What diseases are associated with infection by these pathogens?



b. What family of viruses is the largest? Describe the genome of viruses in this family. Perform an Internet search of viruses of this family. What diseases are associated with infection by these pathogens?



c. Identify a viral pathogen in Figure 6.2 that has infected you. Describe the size, shape, and genome of this pathogen.

2. Why is the classification of viruses important? 3. Why is it more difficult to develop an antiviral drug than it is to develop an antibacterial agent? 4. What is the minimum number of genes a virus needs to replicate? 5. Compare the treatment of a bacterial infection with bacteriophages to treatment with an antibiotic. Which therapy would you expect to be less toxic?

174  CHAPTER 6  Viruses and Other Infectious Particles

6. Examine the graph in Figure 6.8b and determine the approximate decrease in daily morbidity that could result if an Ebola treatment unit were available by November 7, 2015, rather than waiting until 2 weeks later on November 22, 2015. Explain how you determined your result. 30,000 New Ebola cases per day

1. Study Figure 6.2 and answer the following questions.

Start September 23 Start October 23

25,000

25,847

Start November 22

20,000 10,646 15,000 3,408

10,000 5,000 0

8/1

9/1

10/1

11/1 Date

12/1

1/1

7. Vancomycin is one of our most effective antibiotics against Staphylococcus aureus infections, and yet Figure 6.10d ranks methicillin-resistant Staphylococcus aureus as a serious pathogenic threat whereas vancomycin-resistant Staphylococcus aureus is only rated as concerning. Explain this apparent discrepancy.

What is happening in this picture?

© Carolina Biological SupplyCompany/Phototake

The Petri dish shown here is an example of a clinical procedure known as a plaque assay. The dish has been inoculated with a lawn, or monolayer, of cells, some of which are virally infected. Following a brief incubation period, obvious clear zones called plaques develop.

T h i n k C ri ti c al l y 1. Use your knowledge of viral replication cycles to identify the cause of the plaque formation shown in the figure. 2. Why are some plaques larger than others?

Self-Test (Check your answers in Appendix A.)

1.  Viruses are made up of ______.

a. carbohydrates and fats

4.  Place the steps of the viral replication cycle in the correct order.



b. nucleic acids and carbohydrates



  1 penetration



c. fats and proteins



  2 self-assembly



d. carbohydrates and proteins



  3 replication



e. proteins and nucleic acids



  4 release



  5 adsorption

2.  The building blocks of capsids are ______,



a. 1-3-5-4-2



a. helper viruses



b. 5-3-1-2-4



b. envelopes



c. 5-1-3-2-4



c. capsomeres



d. 2-1-3-5-4



d. viroids



e. 5-3-4-2-1



e. prions

3.  The International Committee on the Taxonomy of Viruses classifies viruses based on their ______.

a. genetic makeup



b. chemical composition



c. overall structure



d. b and c



e. a, b, and c

Self-Test  175



a. penetration

9.  Which of the following is NOT a cellular change that could result from a viral infection?



b. adsorption



a. decrease in size



c. self-assembly



b. multiple nuclei



d. lysis



c. inclusion bodies

e. uncoating



d. nucleomegaly



e. syncytium

5.  The viral structure indicated by the arrow functions in ______.



10.  The structures in the diagram labeled X and Y are the ______ and ______ of the bacteriophage.

a. base plate; head



b. contractile sheath; tail fibers



c. collar; base plate



d. contractile sheath; collar



e. tail fibers; nucleic acid core

6.  The uncoating of a virus is done by ______.

a. enzymes



b. the envelope



c. RNase



d. helper viruses



e. peplomers

X

Y

7.  Review the Process Diagram, Figure 6.5, and answer this question.

A comparison of the DNA and RNA viruses shows that ______.



a. RNA viruses replicate in the host cell nucleus using host RNA polymerase



b. the replication cycles are identical



c. RNA viruses do not use host cell RNA polymerases to replicate



d. the genome of DNA viruses replicates in the host cell nucleus using host cell RNA polymerase



e. self-assembly of both virus types occurs in the nucleus

8.  Review The Microbiologist’s Toolbox, and answer this question.

An alteration in the appearance of host cells as a result of viral infection is known as a(n) ______.



a. prion effect



b. cytopathic effect



c. inclusion



d. adsorption



e. immunodeficiency

176  CHAPTER 6  Viruses and Other Infectious Particles

11.  Viral replication that ruptures the host plasma membrane during release occurs in a(n) ______.

a. temperate cycle



b. phage cycle



c. lytic cycle



d. lysogenic cycle



e. eclipse cycle

12.  ______ occurs when a host bacterium expresses an altered phenotype as a result of prophage insertion.

a. Temperate conversion



b. The eclipse period



c. DNA excision



d. Lysogenic conversion



e. Specialized transduction

13.  A prophage is formed when ______. a. a virus enters a bacterial cell

17.  Identify the pathogen: The infectious agent that caused the appearance of this peach is a ______.



b. the helper virus coinfects the host cell



a. viroid



c. viral DNA is incorporated into bacterial circular DNA



b. satellite



c. prion



d. the new viruses bud from the host cell



d. virus



e. the new viruses become infectious



e. helper virus

William M. Brown Jr/Bugwood.org



14.  Review What a Microbiologist Sees, and answer this question.

Because HIV targets TH cells for destruction, ______.



a. the immune system can’t coordinate its defensive responses



b. infected individuals are particularly vulnerable to opportunistic infections



c. the population of TH cells in peripheral circulation declines

18.  ______ need a helper virus to reproduce both their genome and their capsid.

a. Viroids b. Satellite viruses



d. infected individuals are more susceptible to malignancies such as Kaposi’s sarcoma



c. Prions



e. All of these are associated with HIV infection.



d. Viruses



e. Virusoids

15.  Review the Clinical Application, and answer this question.

What aspect of influenza infection makes it particularly important for health care workers to be immunized?

19.  Identify the pathogen: The infectious particle shown in the diagram can cause ______ in mammals.



a. Influenza is not contagious before the symptoms appear.



a. influenza



b. Influenza is contagious before the symptoms appear.



b. herpes

c. Health care workers are more likely to get the flu than their patients.



c. hepatitis B



d. mad cow disease



d. Influenza often has no symptoms.



e. chickenpox



e. Influenza is only contagious sometimes, but there is no way of knowing when.



16.  Review the Microbiology InSight, Figure 6.10, and answer this question.

Multidrug-resistant (MDR) pathogens have emerged primarily because of ______.



a. rapid viral mutation rates



b. rapid prion transmission



c. the misuse of antibiotics to treat nonbacterial infections



d. contaminants in bottled drinking water



e. the emergence of viroids

Beta pleated sheet

20.  Review What is happening in this picture? and answer this question.

A Petri dish is inoculated with a monolayer of cells, some of which are infected by viruses. After incubation, viral lysis of these cells forms clear zones known as ______.



a. inclusion bodies



b. prions



c. syncytia



d. plaques



e. virions

Self-Test  177

7

Metabolism CELLULAR FUEL

M

odern combines powerfully churning across golden fields are a common autumn scene in America’s heartland. Mechanized agriculture produces and harvests 73 million acres of corn annually, with each acre yielding more than 140 bushels. A principal nutritional component of corn is the simple sugar glucose, which is made by photosynthesis and essentially stores solar energy in its covalent bonds. Just as farmers harvest the grain containing glucose, cells can harvest the bond energy stored within the glucose (see the equation) and use this energy for their life processes. This key chapter focuses on cellular energy transformations, including those typically found in microorganisms. As you learn how useable forms of energy are produced, how stored energy is released, and how energy participates in chemical reactions, you will recognize the similarities of these complex microbial processes with the overall practices of agriculture—production, harvest, and distribution.

Modern agricultural practices physically harvest grain to fuel our population. Cellular respiration harvests chemical energy to power cellular processes.

C6H12O6 + 6O2 → 6CO2 + 6H2O

+

The complex reactions converting the chemical energy stored in glucose into adenosine triphosphate (ATP) are summarized by the equation for cellular respiration.

© Design Pics Inc./Alamy Stock Photo

38 ATP

CHAPTER OUTLINE 7.1 The Role of Energy in Life  180 • Basic Energy Principles • Energy and Chemical Reactions ■ The Microbiologist’s Toolbox: Identifying Bacteria by Metabolic Differences 7.2 Energy Production Principles  182 • Oxidation-Reduction Reactions • ATP 7.3 Glycolysis and Fermentation  186 • Glycolysis • Fermentation ■ Clinical Application: The Clinical Importance of Alcohol Throughout History 7.4 Aerobic Cellular Respiration  190 • Pyruvate Oxidation and the Citric Acid Cycle • The Electron Transport System • Lipid and Protein Catabolism ■ What a Microbiologist Sees: The Deepwater Horizon Oil Spill–Microbial Bioremediation • Integrated Metabolic Pathways 7.5 Photosynthesis 196 • Reactions of Photosynthesis ■ Case Study: A Metabolic Imbalance in Grand Lake St. Mary’s • Chemosynthesis in Bacteria

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 180 ❑ p. 182 ❑ p. 186 ❑ p. 190 ❑ p. 196 ❑ ❑ Read the text and study all figures and visuals. Analyze key features

❑ Process Diagram p. 181 ❑ p. 187 ❑ p. 190 ❑ p. 191 ❑ p. 192 ❑ p. 199 ❑ p. 201 ❑ ❑ The Microbiologist’s Toolbox, p. 182 ❑ Clinical Application, p. 189 ❑ Microbiology InSight, p. 194 ❑ What a Microbiologist Sees, p. 195 ❑ Case Study, p. 202 ❑ Stop: Answer the Concept Checks before you go on. p. 182 ❑ p. 185 ❑ p. 189 ❑ p. 196 ❑ p. 203 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What’s happening in this picture? ❑ Complete the Self-Test and check your answers.  

179

7.1

The Role of Energy in Life

LEARNING OBJECTIVES

particular type or quality. Chemi- adenosine cal energy, such as that provided triphosphate by the compound adenosine (ATP) A molecule triphosphate (ATP), is considered composed of adea high-quality form of energy be- nosine and three cause it is easily convertible to adjacent phosphate other energy forms and can be groups that is able to ne definition of energy is the ability to do used to drive almost any cellular release 7.3 kcal/mol work or the capacity to cause change. All process. For example, cells can of energy when organisms require energy to live, and the transform ATP into the mechani- hydrolyzed. processes by which they acquire and use cal motion of a flagellum or the that energy are complex. Energy is basic to heat needed to maintain a normal body temperature. all the reactions of an organism’s metabolism. (ATP and its role in cellular metabolism are dismetabolism The cussed in Section 7.2.) In contrast, heat, the ranAs we saw in Section 2.2, enzymes are crucial dom motion of molecules, is a low-quality form catalysts that lower the activation energy bar- sum total of the chemical reactions of kinetic energy and not used to drive cellular rier and thereby speed up these reactions. necessary for the life processes. It cannot be converted into other of an organism. forms of energy by physiological processes and Basic Energy Principles excess heat causes protein denaturation. Energy exists in two principal forms: kinetic and potential. Kinetic energy is the energy of motion. Potential Energy and Chemical Reactions energy is stored energy associated with position. It may be the energy of a chemical bond, a concentration gradiChemical reactions, including metabolic reactions, eient, or a charge imbalance. The two forms of energy are ther release energy or require an input of energy. Reacinterconvertible. tions that release energy are exergonic reactions, and Cells require a continuous supply of energy to reactions that require the addition of energy are enderlive. The energy must be in useable quantities and of a gonic reactions (Figure 7.1).

1. Describe potential and kinetic energy and the compound most used for energy in cells. 2. Explain exergonic reactions as they relate to catabolism and endergonic reactions as they relate to anabolism.

O

Exergonic and endergonic reactions • Figure 7.1 Chemical reactions either release energy or require an input of energy to proceed.

a. Exergonic reactions These reactions are energy-releasing, spontaneous processes characteristic of catabolic reactions. C6H12O6 + 6O2 → 6CO2 + 6H2O +

b. Endergonic reactions These reactions are energy-consuming, nonspontaneous processes characteristic of anabolic reactions. Solar energy

38 ATP

+ 6CO2 + 6H2O → C6H12O6 + 6O2 Glucose

Potential energy of molecules

Potential energy of molecules

Glucose

Energy

Reactants

Products

Pu t I t To g e t h e r

Energy

Reactants

Products

Review the section Basic Energy Principles, and answer this question. How does the potential energy of the substrate compared to the product change in the course of an endergonic reaction? a. It increases and then decreases.  b. It decreases.  c. It increases.  d. It remains the same.

Metabolic reactions are catalyzed by enzymes. Induced fit reduces the activation energy needed for substrate conversion to product. − − −S −

2 The energy from the bonds between substrate and the active site reduce the Ea barrier.

+ +

+ +

3 The Ea barrier is also reduced as induced fit distorts the substrate into a highly reactive transition state.

+ −S − + + −+ +− + − − −

+ + − − −

+ − − + S + −+ +− + −

Enzyme

1 Substrate dimensions and charge complement the active site, facilitating entry.

−

−

P

+ +

+ +

4 The product is released from the active site so the enzyme can be reused.

− − −

T h i n k C ri ti c al l y

Predict the affinity of a substrate for the active site of its enzyme if their dimensions are complementary and both are positively charged. Explain your reasoning.

catabolism Metabolic reactions in which a large molecule is degraded to smaller components with the release of bond energy; often enzyme mediated.

anabolism Metabolic reactions in which a large molecule is synthesized from smaller subunits with an input of energy, which is stored in chemical bonds; often enzyme mediated.

The set of metabolic pathways in a cell that break down molecules into smaller units is catabolism. These molecules contain a large amount of potential energy stored in their chemical bonds and are oxidized to release energy and produce ATP (Figure 7.1a). The set of metabolic pathways that construct molecules from smaller units is anabolism (Figure 7.1b). These synthetic processes require energy. Many of the reactions of cellular metabolism, though exergonic, run very slowly because of an activation energy (Ea) barrier.

For these reactions to proceed fast enough to sustain life, reaction-specific enzymes are needed to lower the activation energy barrier and speed the conversion of reactant to product (Figure 7.2). As the substrate binds to the active site, bonds are stressed so that the necessary chemical reactions occur more rapidly. This distortion of the substrate into a highly reactive transition state is known as induced fit (see Remember This! ). Additionally, the energy stored in the bonds formed between the substrate and active site is used to lower the Ea and speed substrate conversion to product. When product is released from the active site, the enzyme is ready for immediate reuse. Remember This!  A thorough understanding of enzyme activity is essential before studying cellular metabolism. Before continuing your reading of this chapter, review the information on enzyme activity in Section 2.2.

The Role of Energy in Life  181

Process Diagram

✓ The Planner

Enzymatic conversion of substrate to product •  Figure 7.2

T he M icrobiologist ’ s T oolbo x

✓ The Planner

Identifying Bacteria by Metabolic Differences Control No inoculum

E. coli

A. faecalis

Linda Young

To treat a patient suffering from a bacterial infection effectively, the clinical laboratory must identify pathogens quickly and accurately so the correct antibiotic can be prescribed. Microbiologists rely on metabolic differences demonstrated by bacterial growth on specially designed media for accurate pathogen identification. Bacteria can catabolize different reactants, depending on their enzyme complements. In the course of the reactions, the release of acidic or basic by-products can alter the pH of the growth medium. Oxidative-fermentative (OF) glucose basal medium contains glucose, peptone, and the pH indicator bromthymol blue. When Escherichia coli and Alcaligenes faecalis, two gram-negative bacteria of similar appearance, are inoculated into this green medium, both grow but they use different metabolic processes (see the Figure). E. coli catabolizes the glucose and generates acidic by-products that lower the pH and turn the medium yellow. A. faecalis uses a different set of enzymes to catabolize peptone and produces basic by-products that raise the pH and turn the medium blue.

The pH indicator in the medium shows differences in the metabolic activities of the bacterial species in the inoculum.

Th in k Cr it ica lly

You have prepared OF lactose basal medium and inoculated it with E. coli. After incubation, you find that the media has turned yellow. What can you conclude about the bacterium’s ability to catabolize this carbohydrate?

Some metabolic reactions are common to all living organisms, whereas other biochemical processes are unique to certain groups. Metabolic diversity is especially impressive in microorganisms such as bacteria (see The

Microbiologist’s Toolbox). The remainder of this chapter will focus on major metabolic processes and highlight several biochemical reactions that distinguish medically significant bacterial species.

1. How is the energy stored in chemical bonds made useable to cells?

2. Why do anabolic processes require an input of energy to run?

7.2

Energy Production Principles

LEARNING OBJECTIVES 1. Outline the role of oxidation-reduction reactions in metabolic processes.

2. Explain the processes that generate ATP and the role of ATP in cellular metabolism.

nergy transformations are an integral component of metabolism. Despite the diversity of metabolic reactions, cells use only a few basic pathways to generate the energy needed for life. These ATP-generating pathways include substrate-level phosphorylation and chemiosmosis, which are associated with the processes of cellular respiration and photosynthesis.

Oxidation-Reduction Reactions

E

Organic molecules have energy stored in the covalent bonds between their atoms. When a cell needs energy to power endergonic reactions, the bonds between atoms in certain compounds are broken and energy is released. The challenge is harnessing this energy so that it is available in a useable form and not wasted as heat.

When a chemical bond in a reactant is broken and an electron is lost, the molecule has undergone an oxidation reaction. This freed electron, with its associated energy, can be acquired by another molecule in a reduction reaction. In this way, energy extracted from one compound can be transferred to another oxidationcompound. Because oxidation reduction (redox) and reduction reactions always reaction Any chemoccur concurrently, the overall ical reaction in which process is known as an oxidationelectrons removed reduction (redox) reaction. The from one molecule coenzyme oxidized nicotinamide are transferred to adenine dinucleotide (NAD+) is another molecule. a common participant in redox coenzyme A nonreactions (Figure  7.3). NAD+ protein organic molcan be reduced to NADH when it ecule that associates accepts an electron from another with an enzyme and molecule, which then, in turn, is facilitates its activity. oxidized. NADH, like ATP, is an

activated carrier, a compound that stores and transfers energy either as high-energy electrons or as chemical groups.

ATP ATP is a high-energy compound that serves as the source of energy used to drive most endergonic cellular activities. Hydrolysis of ATP releases 7.3 kcal/mol of energy, which can run endergonic reactions, perform active transport, power locomotion, or even fuel the glow of bioluminescence. ATP also serves as a source of phosphate groups. ATP hydrolysis liberates both energy and a phosphate group that can be added to a reactant. The phosphate group is transferred from ATP to another molecule by an enzyme called a kinase. Phosphorylation of molecules can act as a cellular signaling mechanism, serve as a metabolic regulatory method, or generate new molecular binding sites.

The role of NAD+ in redox reactions • Figure 7.3 NAD+ serves as an activated carrier as it shuttles electrons from one molecule to another via redox reactions. NAD+ (oxidized form) H

HC

O–

O

CH2

P

O

O O–

P

O

O

CH2

C +

N

O C

C

H ..

NH2

HC

CH

2

O CH CH CH

CH

OH

OH

O CH CH CH

CH

OH

OH

e–

+

H+

N N

C C

C

N

N

C

O C

NH2

CH

R

NH2

HC

HC

C

H

Brit Finucci/Getty Images

HC

NADH (reduced form)

2 e– + H+

N CH

Lose electrons oxidized

Gain electrons reduced

T h i n k C ri ti c al l y

When NAD+ is reduced by the addition of two electrons, it is written as NADH. Why has a hydrogen ion been added to the activated carrier? (Hint: View this reaction in steps, considering the form of the NAD at each step.)

LEO says GER is a common mnemonic device for remembering the direction of electron movement in redox reactions.

Energy Production Principles  183

by the addition of the phosphate groups, an endergonic reaction.

Structure of ATP  As shown in Figure 7.4a, ATP is composed of adenine, ribose, and three phosphate groups. Because the bonds between the phosphate groups are high in energy, ATP hydrolysis is an exergonic reaction and provides much of the energy needed for cell metabolism (Figure 7.4b). The phosphate groups can be removed one at a time. Removal of the terminal phosphate group produces adenosine diphosphate (ADP), and removal of the last two phosphate groups produces adenosine monophosphate. ATP is regenerated

Mechanisms of ATP production In the course of metabolic reactions, ATP is broken down to ADP, which then regenerates ATP. ATP is produced by substrate-level phosphorylation, oxidative phosphorylation, and photophosphorylation. In substrate-level phosphorylation, an enzyme transfers a high-energy phosphate group to ADP to make

Adenosine triphosphate (ATP) • Figure 7.4 Adenine

The structure of ATP is ideally suited for its function as a source of energy for biochemical reactions.

NH2 C

N Phosphate groups O

O

O– P

O

O–

H

C

N

C

C

C

N

H

N

O

P

O

O–

P

O

O–

CH2 O C H

a. ATP structure

H

H

C

C

OH

ATP consists of the nitrogenous base adenine, a ribose, and three adjacent phosphate groups.

C H

OH

Ribose Adenosine Adenosine monophosphate - AMP Adenosine diphosphate - ADP

b. ATP function Because of the heavy negative charge on these functional groups, repulsion of the terminal phosphate facilitates its hydrolysis and causes the release of 7.3 kcal/mol of energy that can perform work when the bond is broken.

Adenosine triphosphate - ATP

ATP + H2O → ADP + Pi + 7.3 kcal/mol NH2 C

N

H2O H O O– P O–

O O

P O–

C

NH2 N

C

C

C

N

P O–

H

N

O O

H H+ + O– P

CH2 O C H

C

H

H

C

C

OH

OH

O

O–

H + O

P O–

C

O

P O–

O

Th in k Cr it ica lly

C

C

N

H

N

+

CH2

Energy

O C H

H

N

C

O

O

O O

C

N

C

H

H

C

C

OH

OH

H

What is the function of the water molecule in the equation shown in the diagram?

184  CHAPTER 7 Metabolism

Substrate-level phosphorylation • Figure 7.5 The exergonic removal of a phosphate group from phosphoenolpyruvate occurring in close proximity to the endergonic addition of a phosphate to ADP is a good example of reaction coupling to provide the energy necessary to make ATP. It is a spontaneous process. Phosphoenolpyruvate

P P

Phosphoenolpyruvate

P + P P

ADP

P

+ P

ADP

Enzyme 1

Enzyme 2

Pyruvate kinase

Pyruvate + P

This exergonic reaction releases 14.3 kcal/mol of energy.

P P P

This endergonic reaction consumes 7.3 kcal/mol of energy.

ATP

Pyruvate + P P P

ATP

Coupled reactions are a net exergonic process, releasing 7.0 kcal/mol of energy.

A sk Yo u r se lf Identify the reactants and products in substrate-level phosphorylation.

ATP using a high-energy substrate to drive the process in a coupled reaction. During a coupled reaction, energy released by an exergonic process is used to power an endergonic reaction that produces ATP or another useful compound (Figure 7.5). In this scenario, phosphoenolpyruvate (PEP) and ADP serve as substrates for pyruvate kinase, an enzyme able to perform the exergonic removal of a phosphate group from PEP and its endergonic transfer to ADP. Because more energy is released by the exergonic reaction than is consumed by the endergonic one, the coupled reactions represent a net exergonic process, allowing the spontaneous production of pyruvate and ATP. In oxidative phosphorylation, a complex series of redox reactions generates large quantities of activated carriers, such as NADH and FADH2, cellular which is a related coenzyme. The respiration A energy stored in these activated complex series of carriers is used for the phosphorredox reactions that ylation of ADP to produce ATP. degrade nutrient molOxidative phosphorylation is the ecules, such as glucore of cellular respiration. ATP cose, in the presence production from photosynthesis of oxygen to generoccurs by photophosphorylation. ate large quantities Absorption of photons, packets of ATP. of light energy, triggers a series of redox reactions that ultimately results in the production of ATP. Oxidative phosphorylation and photophosphorylation share an essential component, chemiosmosis, or the conversion of potential energy stored in a hydrogen ion gradient into ATP as the hydrogen ions diffuse across

a membrane. Formation of the gradient begins as a series of redox reactions occurring in membrane-associated molecules that act as electron carriers. Because the adjacent carrier always has a higher electron affinity, the transfer of electrons occurs spontaneously. The energy released by this exergonic process is used to perform the work of pumping hydrogen ions across the membrane, generating potential energy in the form of an electrochemical gradient of hydrogen ions. Chemiosmosis occurs in the cristae of mitochondria, the thylakoid membranes of chloroplasts, and the plasma membranes of aerobic bacteria. The potential energy of the electrochemical hydrogen ion gradient is harvested using the intramembrane protein ATP synthase to drive the endergonic phosphorylation of ADP. Because ATP synthase couples the energy released by the spontaneous diffusion of hydrogen ions down the electrochemical gradient with the phosphorylation of ADP, it is also called coupling factor. In this manner, the simple chemical processes of oxidation-reduction and reaction-coupling can be used to generate rapidly the large amounts of ATP necessary to sustain cellular activity.

1. How do redox reactions allow energy to be extracted from a hydrolyzed chemical bond? 2. What key process is shared by both oxidative phosphorylation and photophosphorylation? Energy Production Principles  185

7.3

Glycolysis and Fermentation

LEARNING OBJECTIVES 1. Compare and contrast the energy-consuming and energy-releasing reactions of glycolysis. 2. Explain how fermentation can produce a variety of different end-products.

C

atabolic reactions degrade molecules, releasing the potential energy stored in chemical bonds. To release this energy safely and to maximize its usefulness, the process takes place in multiple, stepwise reactions. Molecules whose stored energy can be released for use are referred to as fuels. The best fuels are highly reduced molecules from which high-energy electrons can be stripped during oxidation and transferred to activated carriers. The major fuel molecule for cells is glucose, and in many cases, other molecules are converted to glucose before they are catabolized. Most of the reactions that provide energy for life processes involve the complete oxidation of glucose (Figure 7.6a), a highly exergonic process that releases 686 kcal/ mol of glucose. In cells, it is performed in a series of reactions so much of the energy can be harvested to drive the endergonic production of numerous ATP molecules. If glucose were oxidized in a single step by combustion, the same large amount of energy would be released in the form of heat, which cannot be used by cells (Figure 7.6b). Another reason that glucose catabolism is performed in

multiple, small steps is the reduction in activation energy necessary to accomplish the task. Each individual reaction has a low activation energy barrier that is overcome easily by an enzyme, whereas single-step glucose degradation via combustion requires a large energy input, usually in the form of fire. The catabolic reactions of cellular respiration, beginning with glycolysis, provide aerobic cells with energy in the form of ATP that they need for life.

Glycolysis Harvesting energy from glucose glycolysis A series involves three metabolic pathof 10 enzymeways: glycolysis, followed by either mediated catabolic fermentation or cellular respira- reactions that occur tion. Glycolysis means sugar split- in the cytoplasm and ting, and the process oxidizes a degrade glucose into single glucose into two pyruvate two molecules of molecules. Additionally, there is a pyruvate and genernet production of two ATP via sub- ate two NADH molstrate-level phosphorylation and ecules and two ATP two NAD+ molecules are reduced molecules. to two NADH molecules. Glycolysis is a universal process. All organisms from archaea to humans perform this series of biochemical reactions to extract energy from glucose (Figure 7.7).

Glucose oxidation • Figure 7.6 Glucose is the principal fuel molecule catabolized by cells for energy to make ATP.

a. C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + Glucose

b.

38 ATP

Energy from glucose = 686 kcal/mol available to do work Free energy

Energy input

Activation energy: Small barriers can be overcome with enzymes.

C6H12O6 + 6 O2

Activation energy: High barrier requires fire to overcome.

Glucose

Energy stored in activated carriers can be used for ATP production.

Energy released as useless heat

Energy output

a. Complete glucose oxidation A highly exergonic reaction, glucose catabolism liberates 686 kcal/mol. b. A comparison of glucose oxidation practices When glucose is oxidized in a single step, an enormous activation energy barrier must be overcome and the energy is released as wasteful, potentially damaging heat. The small activation energy barriers in multistep glucose oxidation are overcome by enzymes, and the energy harvested is stored in activated carriers.

A sk Yo u r se lf Stepwise glucose oxidation via catabolism

6 CO2 + 6 H2O

Direct glucose combustion

Are the reactants and products the same in the direct combustion of glucose and in the stepwise oxidation of glucose?

✓ The Planner

Glycolysis is the initial series of glucose-oxidizing reactions performed by all cells to generate ATP. C

a. The energy-consuming reactions Two ATP molecules are invested to prepare the hexose for enzymatic cleavage into two trioses.

C O

Glucose

C

C C C

ATP

Hexokinase

ADP C

P

C O

Glucose-6-phosphate

C

C C C

Phosphohexose isomerase P

C

Fructose-6-phosphate

C

O

C

ATP

C C

Phosphofructokinase

P

C

Fructose-1, 6-bisphosphate

C

Dihydroxyacetone phosphate

C P

O

C

C

P

Aldolase

4 Fructose-1,6-bisphosphate is cleaved into two, three-carbon molecules with a phosphate group on the first carbon.

Triose isomerase

5 The products of fructose-1,6-bisphosphate cleavage undergo isomerization.

C

C O C C

2 2 NAD+

P

P

Triose phosphate dehydrogenase

2 NADH C

1, 3-bisphosphoglycerate ADP

P

C C

P

Phosphoglycerate kinase

ATP O

3-phosphoglycerate

C O C C

2X

3 A phosphate group from a second ATP is transferred to the first carbon of fructose-6-phosphate.

C

C

C O

Glyceraldehyde-3-phosphate

2 Glucose-6-phosphate is rearranged to form the isomer fructose-6-phosphate.

C

ADP

b. The energy-generating reactions Triose oxidation yields two molecules of NADH and substrate-level phosphorylation generates four ATP molecules.

1 A phosphate group from ATP is transferred to the sixth carbon of glucose.

P

Phosphoglyceromutase O

2-phosphoglycerate

C O C

P

6 A phosphate group binds to the third carbon of both molecules, which are then oxidized, transferring electrons to two molecules of NAD+ reducing them to two molecules of NADH. 7 Substrate-level phosphorylation transfers a phosphate group from each 1, 3-bisphosphoglycerate molecule to ADP generating two ATP. Energy input now equals energy output. 8 The phosphate groups on the third carbon of 3-phosphoglycerate are transferred to the second carbon forming two molecules of 2-phosphoglycerate.

C

Enolase

2 H2O O

Phosphoenol pyruvate ADP

C O C

P

C

Pyruvate kinase

T h i n k C ri ti c al l y

How would glycolysis be affected by a deficiency of NAD+ in cells?

ATP O

Pyruvate

9 Each 2-phosphoglycerate loses a molecule of water forming two high-energy phosphenol pyruvates.

C O C O C

10 Substrate-level phosphorylation generates two ATP by transferring a phosphate group from each phosphoenol pyruvate to two ADP. There is now a net energy yield of two ATP.

Glycolysis and Fermentation  187

Process Diagram

Glycolysis: The common metabolic pathway • Figure 7.7

The continuous reduction of NAD+ eventually results in its shortage, which curtails glycolysis and impairs ATP production. To overcome this problem, cells must participate in additional metabolic pathways to regenerate their NAD+ stockpile. Cells do this by performing either fermentation or oxidative phosphorylation.

Fermentation Fermentation does not require oxygen. Therefore, many microorganisms that live in anaerobic, or oxygen-free, conditions obtain their energy via glycolysis followed by

fermentation. Depending on the fermentation A substrates and enzymes present, series of metabolic fermentation can yield many dif- reactions that catabferent end products. However, olize sugars into the most familiar products are gases, acids, and alcohol and lactic acid. other by-products Saccharomyces, or common while regenerating baker’s yeast, is a good example NAD+ consumed of a microorganism that per- during glycolysis. forms alcoholic fermentation (Fig­ure  7.8a). In this two-step process, a three-carbon pyruvate is ultimately converted into a two-carbon ethanol

Fermentation • Figure 7.8 Under anaerobic conditions, alcoholic or lactic acid fermentative reactions regenerate the dwindling pool of NAD+ and permit continued ATP production via glycolysis. Net reactions of glycolysis

C

2 NAD+

C

Pyruvate O

2 NADH

O

C

C C

2

C

ADP

2 NAD+

Ethanol C

Alcohol fermentation

Glucose C C

O

2

C

(Hydrolysis)

Carbon dioxide 2 O

O

C

O

Saccharomyces

C

a. Alcoholic fermentation Glycolysis-generated pyruvate molecules are reduced by NADH in a two-step process that yields NAD+, ethanol, and carbon dioxide. This process, which is an important step in the production of bread and beer, is performed by the yeast Saccharomyces.

FPO

Beer

Net reactions of glycolysis 2 NAD+

Pyruvate O

2 NADH

O

C

C C

C C

ATP

O

C

O

2 NADH Acetaldehyde

Dzmitry Shpak/Getty Images, Inc.

2

C

J. Forsdyke/Gene Cox/ Science Source Images

Glucose

2

C

ADP

C

O

C

O

C

ATP

Bobby Strong/CDC

Bloomberg/Getty Images

2 NADH 2 NAD+ Lactic acid O

Lactic acid fermentation Lactic acid fermenting bacteria are used to make many commercial products like yogurt and kefir.

188  CHAPTER 7 Metabolism

2

C

O

C

O

C

b. Lactic acid fermentation Using only one step to reduce pyruvate to lactic acid, this fermentative process also restores NAD+ for continued glycolysis. Lactic acid fermentation by Lactobacillus during yogurt production results in its tangy flavor.

Lactobacillus

Th in k Cr it ica lly

If alcoholic fermentation occurs as bread dough rises, why doesn’t bread contain alcohol?

Clinical Application

✓ The Planner

The Clinical Importance of Alcohol Throughout History Today, alcohol is still used to prevent infection. Before a minor invasive procedure such as an injection or finger-stick, skin is degermed by rubbing with an isopropanol-soaked pad to remove contaminants and kill many microorganisms left behind (Figure b). Increased awareness of the importance of hand hygiene has also resulted in the widespread use of alcoholbased hand sanitizers.

a. This piece of ancient Egyptian art depicts the consumption of alcohol.

b. Before monitoring blood glucose levels using a lancet, diabetic patients degerm their finger by cleansing with a small pad containing 70% isopropyl alcohol.

© AS400 DB/Corbis Images

Archeological evidence suggests the mastery of beer brewing was present in many ancient cultures. The Egyptians used yeast for fermenting wheat, barley, and millet to make beerlike beverages (Figure a). Beside its enjoyable effects, beer was also consumed because it was safer to drink than water. When tainted water was used to make an alcoholic beverage, the ethanol killed many of the contaminating pathogens and reduced infectious disease.

A patient with diabetes needs to check his blood glucose level, but has run out of isopropanol cleansing pads. He substitutes alcohol gel for antisepsis. Is this an appropriate substitution? Why or why not?

molecule plus carbon dioxide. The release of carbon dioxide gas is good evidence of alcoholic fermentation as demonstrated by rising bread dough and the foamy head on beer. Historians believe yeast fermentation was the first use of biotechnology: the intentionally produced ethanol plays an important role in infection prevention both in the ancient world and now (see the Clinical Application). The enzyme complements of bacteria such as Streptococcus, Lactobacillus, and Bacillus are different from those of yeast and consequently use a different fermentative pathway to reduce glycolysis-generated pyruvate and replenish the cell’s NAD+ stores. Lactic acid is produced by these organisms in a single step (Figure 7.8b) in the process known as lactic acid fermentation. As with alcoholic fermentation, humans have used microorganisms that perform these reactions to make different food products such as yogurt and some cheese varieties. Even with faster, deeper breathing during strenuous exercise, oxygen levels are quickly depleted by working

Linda Young

T h i n k C ri ti c al l y

Lancet

Glucometer

Blood glucose test strips

muscle cells, creating temporary anaerobic conditions. This requires them to perform lactic acid fermentation to regenerate NAD+ and continue ATP production via glycolysis. The burning sensation in muscles during an intense workout results from irritation caused by hydrogen ions released from accumulating lactic acid. When activity levels return to normal, adequate oxygen levels are restored to muscle tissues, lactic acid is catabolized, and muscle cells again perform cellular respiration.

1. Why is glucose catabolism a multistep process when its potential energy could be liberated in a single step? 2. What is the principal function of fermentation in anaerobic microorganisms? Glycolysis and Fermentation  189

7.4

Aerobic Cellular Respiration

Learning Objectives 1. Describe the overall reactions of pyruvate oxidation and the citric acid cycle. 2. Explain the reactions of the electron transport system. 3. Describe the catabolism of lipids and proteins 4. Explain how the metabolic pathways for carbohydrates, lipids, proteins, and nucleic acid intersect. s the concentration of oxygen in early Earth’s atmosphere continued to increase, some microbes evolved new metabolic pathways that permitted them to use this new resource for enhanced ATP production. Oxidative phosphorylation continues the degradation of glucose started in glycolysis and simultaneously regenerates the NAD+ consumed. When glucose is completely oxidized to water and carbon dioxide in the presence of oxygen, its electrons reduce activated carriers that ultimately participate in the redox reactions of chemiosmosis. The end result of this metabolic pathway is the generation of 38 molecules of ATP from a single glucose—a 19-fold increase in energy production over fermentation pathways. In eukaryotic cells, these reactions occur in the mitochondrial matrix and cristae. In prokaryotic cells, oxidative phosphorylation takes place in the cytoplasm and on infoldings of the plasma membrane.

Process Diagram

A

Pyruvate Oxidation and the Citric Acid Cycle The first step in this aerobic pathway is pyruvate oxidation. Pyruvate dehydrogenase is a large enzyme complex that accomplishes this and the two steps that follow (Figure  7.9). The pyruvate generated by glycolysis loses a carboxyl, or acid, functional group (COOH) forming acetate and the by-product, carbon dioxide (step 1). During this oxidation, NAD+ is reduced to NADH, storing the energy of the electrons for later use (step 2). Finally, coenzyme A (CoA) is added to acetate to form acetyl CoA (step 3). This is the substrate that initiates the reactions of the citric acid cycle, so the three-step pyruvate oxidation pathway links glycolysis with this process. Because two pyruvate molecules were produced during glycolysis, these reactions run twice, generating a net outcome of two molecules each of acetyl CoA, citric acid cycle/ Krebs cycle A carbon dioxide, and NADH. The citric acid cycle (Figure cyclic series of bio7.10), also known as the Krebs chemical reactions cycle after the biochemist Hans in which acetyl CoA Krebs, who elucidated the process, is oxidized to carbon releases energy from the acetyl CoA dioxide and water, and NADH, FADH2, through a series of four oxidation and a small amount reactions (steps 3, 5, 7, and 9). The of ATP are generated. energy released from acetyl-CoA

✓ The Planner

Pyruvate oxidation • Figure 7.9 Pyruvate dehydrogenase

Using the enzyme complex pyruvate dehydrogenase, both molecules of pyruvate are oxidized in a three-step process, resulting in two molecules of NADH, two molecules of carbon dioxide, and two molecules of the substrate needed to initiate the citric acid cycle, acetyl CoA.

A sk Yo u rs e l f The substances released by the breakdown of pyruvate are: a. CO2 and FADH2 b. acetyl-CoA, NADH, and CO2 c. H2O, CO2, and 2e− d. acetyl-CoA and FADH2

190  CHAPTER 7 Metabolism

Pyruvate O

2

2 Electrons from the oxidized pyruvate reduce NAD+ to NADH. 2 NAD+

C

O

C

O

2 NADH

C

1 Pyruvate is decarboxylated to generate acetate Carbon dioxide and carbon dioxide, which is released 2 O C O as a byproduct.

Acetate O

2

C C

Acetyl CoA Coenzyme A

O

S

H

2 C 3 Coenzyme A covalently binds to acetate forming acetyl CoA.

O C

S

CoA

The citric acid cycle harvests the maximum amount of energy stored in acetyl CoA by generating NADH, FADH2, and ATP. Note that the cycle runs twice to accommodate the two pyruvates produced by glycolysis.

1 The 2-carbon acetyl group is transferred from acetyl CoA to the 4-carbon oxaloacetate generating 6-carbon citrate, the first stable product of the cycle. Acetyl CoA O C

C

S

CoA

Oxaloacetate

Malate

O

O

C

O

C

Citrate synthase

C C

O

O

O

O

C

C

C

O

C

O

O

2 Citric acid is isomerized to isocitrate. Ac on

O

Isocitrate

C

C

C

C

O

C

O

O

O

O

O

NAD+ NADH

Citric acid cycle

O O

O C

O

Oxalosuccinate

C

C

C

C

C

O

C

O

C

O

O

ate e cin as Suc rogen yd deh

7 The oxidation of succinate generates fumerate and the activated carrier, FADH2.

O

FADH2

Carbon dioxide O

FAD O C C

C

Coenzyme A

S

H Carbon dioxide

C O

O

ATP ADP + Pi

Su cc syn inyl-C o the tase A 6 A phosphate group displaces coenzyme A and is then transferred to ADP forming ATP by substrate-level phosphorylation.

O C

O O

C C C

O

S

CoA

C

NAD+ NADH

O

te tara oglu nase t e k e α drog dehy

Succinyl CoA

O

O

O O

O

C

Succinate

C

3 A hydroxyl group on isocitrate is oxidized to a carbonyl generating oxalosuccinate.

O

C

O

C C C

O

C

O

de Iso hy cit dr rat og e en ase

Fumerate

O

C C

H2O

C

O

te Isocitraenase drog dehy

Fume rase

C

+

C

C

8 The addition of water to fumerate attaches a hydroxyl group creating malate.

O

H

NAD+

O

C

C

S

NADH

d

O

Coenzyme A

se ita

9 The last oxidative step of the citric acid cycle regenerates oxaloacetate and reduces another molecule of NAD+. te ase ala en M rog yd eh

Citric acid

O

4 Unstable oxalosuccinate is decarboxylated forming α-ketoglutarate and releasing carbon dioxide as a by-product.

α-ketoglutarate

O

Coenzyme A

S

H

5 The oxidation of α-ketoglutarate reduces NAD+, releases carbon dioxide as a by-product, and produces succinyl CoA with the addition of coenzyme A.

A sk Yo u r se lf If a cell completely oxidizes 10 molecules of glucose, how much FADH2 will be produced by the citric acid cycle?

is transferred to electrons in activated carriers such as NADH (steps 3, 5, and 9) and FADH2 (step 7). More carbon dioxide is released as a by-product (steps 4 and 5), and small amounts of ATP are generated via substrate-level

phosphorylation (step 6). The cycle regenerates the initial reactant, oxaloacetate (step 9). Because two pyruvates are oxidized to acetyl CoA, the citric acid cycle runs twice for every glucose molecule that undergoes glycolysis. Aerobic Cellular Respiration  191

Process Diagram

✓ The Planner

The citric acid cycle • Figure 7.10

The Electron Transport System

A new rotor subunit is now positioned to bind with the next hydrogen ion that enters the ATP synthase. As this process continues, the rotor makes a complete rotation, moving the hydrogen ion to the opposite side of the membrane in the process. In this way—binding, rotating, and releasing—the hydrogen gradient diffuses across the cristae and converts its potential energy into mechanical energy. The stalk attached to the rotor turns within the enzymatic head region of ATP synthase. The paddlelike portion of the stalk physically contacts the three enzymatic head subunits, resulting in conformational changes. This causes the ADP and phosphate groups in the active sites to react, producing ATP. One complete rotation of the stalk can generate three molecules of ATP. In this way, large amounts of ATP are generated chemiosmotically. When glycolysis is followed by the citric acid cycle and the ETS, the combined reactions are referred to as cellular respiration. This complicated aerobic process was

✓ The Planner

The electron transport system and chemiosmotic ATP production  • Figure 7.11

The passage of electrons from oxidized NADH and FADH2 through electron carriers releases enough energy to pump hydrogen ions across the membrane and generate a gradient. Diffusion of hydrogen ions through ATP synthase converts the potential energy of the gradient first into mechanical energy and then into the chemical energy of ATP. 2 Energy released by electron transport through the carrier complexes is used to shuttle hydrogen ions across the membrane and generate an electrochemical gradient. H+ H

+

H+

H+

H+ H+

III e–

e–

Q

H+

II 2 NADH 2 NAD+

H+

1 After oxidation, NADH delivers electrons to the NADH dehydrogenase complex.

What would happen if two NADH molecules were substituted for the two FADH2 molecules?

192  CHAPTER 7 Metabolism

e–

H+ +

H

H+

Cytochrome c

H+

H+

e–

c

H+

H+

H+

H+

IV

H+

e– O2

e–

2 FADH2 2 FAD

NADH dehydrogenase complex

T h in k C ri ti c a l l y

e–

H+

H+

H+

H+

H+

H+

Ubiquinone

I Membrane

H+

H+

H+

ATP synthase

Process Diagram

The last portion of this aerobic series of reactions is the pathway that requires oxygen. The activated carriers produced by the citric acid cycle are oxidized when they deliver electrons to a chain of membrane-bound carriers known as the electron transport system (ETS) (Figure 7.11 step 1). The ensuing redox reactions generate a hydrogen ion gradient (step 2). electron Because oxygen has the strongest transport system electron affinity, it acts as the final (ETS) A series of electron acceptor in aerobic memembrane-bound tabolism and is reduced to water proteins with increas(step 3). ing electron affinity As a hydrogen ion from the that participate in gradient enters ATP synthase, it redox reactions to binds to a rotor subunit, causing a generate a hydrogen small conformational change that ion gradient across rotates the protein in a clockwise the membrane. direction (Figure 7.11 step  4).

H+

Cytochrome b-c1 complex Succinate dehydrogenase

Cytochrome oxidase complex

O2 + 4 H+ → 2 H2O C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + 38

ATP

3 The aerobic step of cellular respiration is the reduction of oxygen to water in the cytochrome oxidase complex; oxygen serves as the final electron acceptor.

H+ 4 ATP synthase uses energy from the hydrogen-ion gradient to produce ATP by chemiosmosis.

Total ATP production from cellular respiration • Figure 7.12 The total amount of ATP generated from one molecule of glucose undergoing cellular respiration is determined by the combined contributions of substrate-level phosphorylation and activated carrier reduction. Process

ATP

NADH

FADH2

Glycolysis

2

2

0

Pyruvate oxidation

0

2

0

Citric acid cycle

2

6

2

Totals

4

10

2

A net of four ATP are made directly by substrate-level phosphorylation.

In te rp re t th e D ata How many molecules of NADH are generated during glycolysis and pyruvate oxidation?

4 ATP

Each NADH oxidation generates a sufficient H+ gradient to produce three ATP.

3 × 10 NADH = 30 ATP

Each FADH2 oxidation generates a sufficient H+ gradient to produce two ATP.

2 × 2 FADH2 = 4 ATP

4 ATP + 30 ATP + 4 ATP = 38 ATP Maximum energy yield of cellular respiration

strongly favored by natural selection because cells capable of performing it harvest 19 times more energy from the same glucose molecule. The approximate energy yield can be calculated by determining the amount of ATP generated by substrate-level phosphorylation and the number of activated carriers that were reduced. Four molecules of ATP are made directly in cellular respiration— two from glycolysis and one for each of the two turns of the citric acid cycle (Figure 7.12). During cellular respiration, 10 molecules of NADH and two of FADH2 are also produced (Figures 7.10 and 7.11). NADH delivers its electrons to the first carrier of the ETS (Figure 7.11). As these electrons participate in redox reactions, the energy they release is sufficient to pump enough hydrogen ions across the membrane that the diffusion of these hydrogen ions (protons) back across the membrane through ATP synthase causes one complete stalk rotation and yields three ATP molecules. FADH2 reduces the second complex of the ETS. Although these electrons also undergo redox reactions, by starting midway through the system they contribute less energy to pumping hydrogen ions across the membrane. Because

they contribute fewer hydrogen ions to the gradient, when these protons are diffused through ATP synthase, only two ATP molecules are made. By recognizing the different contributions of NADH and FADH2 to the strength of the hydrogen ion gradient, biochemists can assign an ATP conversion factor to each activated carrier (Figure 7.12). If each NADH contributes enough protons to the hydrogen ion gradient to permit the chemiosmotic production of three ATP, these 10 activated carriers have the potential to generate 30 molecules of ATP. FADH2 has the chemiosmotic potential to make two molecules of ATP. Because two of these activated carriers are produced from the two turns of the citric acid cycle, they are responsible for producing an additional four ATP. Summing the contributions of substrate-level phosphorylation (four ATP molecules) and electron transport initiated by NADH (30 ATP molecules) and FADH2 (four ATP molecules), cellular respiration can potentially convert the energy stored in one glucose into 38 ATP molecules. If cellular respiration is running in a eukaryotic cell, some of the ATP generated is used to transport NADH Aerobic Cellular Respiration  193

Microbiology InSight  Cellular

respiration 

✓ The Planner

•  Figure 7.13

Aerobic respiration is a three-part process that, in the presence of oxygen, completely oxidizes a molecule of glucose to carbon dioxide and water and generates large amounts of ATP.

a. Glycolysis

b. The citric acid cycle After conversion of pyruvate to acetyl CoA, the oxidation process is completed by the citric acid, or Krebs, cycle. The cycle is completed twice to accommodate both pyruvates, an additional two ATP, eight NADH, and two FADH2 molecules are produced; six carbon dioxides are released as by-products.

ATP production begins with glycolysis, a series of reactions in which a glucose molecule is oxidized to two pyruvate molecules, and two NADH and two ATP are generated. Glucose 2

ATP

Fructose-1, 6-phosphate

Citric acid

Oxaloacetate

NADH

Isocitrate

Malate

Glyeraldehyde-3-phosphate 2 NADH

2X

Fumerate

ATP

The citric acid cycle 2X

FADH2 ATP

NADH Oxalosuccinate

Succinate Pyruvate α-ketoglutarate

ATP Succinyl CoA

NADH

c. The electron transport system (ETS) NADH and FADH2 produced by the citric acid cycle reduce intramembrane electron carriers and a series of redox reactions begins that generates a hydrogen ion gradient. ATP synthase transports hydrogen ions, which causes conformational changes in the enzyme that enhance binding of ADP and a phosphate group to the active site for rapid conversion to ATP.

H+ H+

H+

H+

H+ H+ III e–

II NADH

NAD+

H+

e–

Q

H+

FADH2

H+

H+

H+

H+

I e–

H+

H+

e–

H+

H+

H+ H+

H+

c

H+

H+

H+

e– O2

H+

H+ H+

IV e–

e– FAD

H+

H+

H+

Membrane-bound electron carriers

T h in k Cri ti c a l l y

ATP

ATP

Six molecules of carbon dioxide are released as by-products of the reactions of cellular respiration. What was the original source of the carbon molecules in this product? H+

from glycolysis into mitochondria for use in the ETS. Consequently, the net ATP available for other cellular work is slightly less than in prokaryotes because they lack this organelle. Regardless, the oxidation of glucose in glycolysis and the citric acid cycle followed by electron transport concluding with the reduction of oxygen (Figure 7.13) yields significantly more ATP than anaerobic processes.

Lipid and Protein Catabolism In addition to glucose catabolism, most cells possess enzymes that permit the degradation of other fuel molecules with their stored bond energy used for ATP production. Highly reduced molecules are especially good fuels because they are easily oxidized to generate reduced activated carriers. These carriers can then participate in the ETS; chemiosmotic ATP production results.

Fatty acids are catabolized by a series of reactions, known as beta-oxidation, that liberate a significant amount of energy for ATP production. Protein catabolism with subsequent amino acid degradation can also supply energy for cells. In many cases, the alternative fuel molecules are converted to glucose and used in cellular respiration. The reactions of lipid and protein catabolism are outside the scope of this text and are best

discussed in detail in a biochemistry course. However, the diversity of microbial catabolism is extensive and a microbe’s biochemical profile can be used for identification purposes. Additionally, these more specialized catabolic reactions are the basis of bioremediation, the use of unique microbial enzymes to degrade toxic, contaminating materials and restore environmental health (see What a Microbiologist Sees).

What a Microbiologist Sees ✓

The Planner

The Deepwater Horizon Oil Spill—Microbial Bioremediation One of the greatest human-caused environmental catastrophes occurred on April 20, 2010, with an explosion on the Deepwater Horizon oil rig. Eleven people were killed, 17 workers were injured, and countless marine organisms died as millions of barrels of oil spewed into the Gulf of Mexico over the course of 84 days. As the enormous oil slick resulting from the continuous underwater plume reached the coastline, wildlife refuges were decimated, beaches fouled, fishing industries devastated, and tourism ruined (Figure a).

a. A radar image from May 2, 2010 of the Deepwater Horizon oil spill moving toward the Delta National Wildlife Refuge.

However, some microbiologists saw an opportunity for oileating marine bacteria to flourish. Because hydrocarbons regularly escape from underground reservoirs in the Gulf, some of the naturally occurring microbial flora have evolved enzymes for oil catabolism. These microorganisms usually represent a tiny fraction of the Gulf’s microbial community. But adding 800 million liters of oil to their habitat provided a food resource that encouraged explosive population growth and the opportunity for bioremediation of the polluted waters. Post-spill investigations noted significant differences between water samples collected inside and outside the oil plume (Figure b). Bacterial populations increased when an oil food resource was available to support them. Decreased oxygen saturation levels of the water verified increased activity of aerobic bacteria. Innovative molecular biology techniques identified members of the Oceanospirillales order of bacteria as the predominant oil-degrading species. Their amazing catabolism decreased the size of the plume by half every 3 days. This natural bioremediation eliminated most of the oil dispersed in the Gulf waters 2 weeks after the well was successfully capped, significantly reducing environmental damage.

ESA

b. The oil plume resulting from thousands of barrels spewing into the Gulf daily for almost 3 months.

U.S. Geological Survey

Delta National Wildlife Refuge Oil venting from Deepwater Horizon well

Feature

Sample within oil plume

Sample outside of oil plume

Microbial density

100,000 cells/ml

1000 cells/ml

Species diversity

Low

High

Oxygen saturation levels of the water

37–59%

67%

Th in k Cr it ica lly Given that the number of bacteria/ml increases within the plume, why does the species diversity remain low?

Aerobic Cellular Respiration  195

Integrated Metabolic Pathways The major metabolic pathways discussed in this chapter have focused on the role of glucose in energy production. This simple sugar also participates in many other biochemical reactions. For example, some nonphotosynthetic organisms can generate glucose from pyruvate by a process called gluconeogenesis. Animal cells store excess glucose as glycogen, a branched polysaccharide, whereas plant cells store surplus glucose as starch, a straight-chain polysaccharide. Plant cells also use glucose in the synthesis of cellulose microfibrils, which are deposited in the cell walls (see Remember This!). Bacterial cells convert glucose into fructose6-phosphate, which is a precursor of N-acetylglucosamine (NAG) and N-acetylmuramic acid (NAM) used in peptidoglycan cell walls. Remember This!  Starch and cellulose are both straight-chain glucose polymers generated by plant cells. Glycogen is a branching glucose polymer used for storing energy. Review the difference between straight and branched polymers of glucose in Figure 2.9b.

In addition to the amphibolism of carbohydrate metabolism, or the interconnecting of anabolic and catabolic pathways, cells must also synthesize and degrade amino acids and proteins, fatty acids and lipids, and nucleotides and nucleic acids. Following are some examples of other metabolic pathways and their interrelations: • Pyruvate, 3-PGAL, and acetyl CoA from glycolysis and pyruvate oxidation can be shunted into a variety of other pathways to generate amino acid precursors. •  Oxaloacetate and α-ketoglutarate amination The from the citric acid cycle often parenzymatic addition of ticipate in amination reactions to an amine group to a generate aspartate and glutamate. molecule. Glutamate can then enzymatically

7.5

transfer its amine group to other molecules to generate most of the other 20 amino acids needed to for protein synthesis. The transfer of an amine group from an amino acid to another molecule is called transamination. • Both 3-PGAL and acetyl CoA can serve as substrates in reactions leading to the production of fatty acids, which are needed for the synthesis of triglycerides and phospholipids. • Other pathways can use 3-PGAL to begin synthesis of nucleotides. Because nucleotides contain nitrogen, amino acids usually serve as their precursors. The metabolic machinery of cells is amazing. All organisms practice common metabolic methods such as glycolysis and yet vast diversity allows a microbiologist to identify microbial species by their signature biochemical pathways. Although a thorough understanding of cellular metabolism would require an extensive biochemistry curriculum, you are now well prepared to understand basic cellular processes as they relate to upcoming topics on personal and global health.

1. What are the end-products of pyruvate oxidation and the citric acid cycle? 2. How much ATP is produced by the ETS? 3. What are the end-products of protein and lipid metabolism? 4. How do the metabolic pathways for lipids and proteins connect to the pathways for carbohydrate metabolism?

Photosynthesis

LEARNING OBJECTIVES 1. Trace the path of electron transport during the light reactions of photosynthesis and the steps in the reduction of carbon dioxide to glucose and the regeneration of ribulose-1, 5-bisphosphate (RuBP). 2. Explain the kinds of compounds that serve as energy sources for chemoautotrophs and chemoheterotrophs.

A

nabolic reactions are endergonic, requiring the input of energy to synthesize complex molecules from simpler subunits. The reactions of photosynthesis are the most

important anabolic reactions. The glucose synthesized by photosynthesis using solar energy serves as the basis of the food webs in almost every photosynthesis ecosystem. A complex series Photosynthesis is the source of chemical reacof the glucose and oxygen used tions that use energy by aerobic organisms for ATP from sunlight for the production. The reactions of reduction of carbon photosynthesis occur in the chlodioxide to glucose, roplasts of eukaryotic cells and releasing oxygen as a the thylakoids of prokaryotic cells by-product; occurs in (see Remember This!). The process plants and algae. originated approximately 3.4 to

3.6 billion years ago. With the addition of photosynthetic oxygen to the atmosphere, life on Earth changed forever as aerobic organisms evolved and the formation of an ultraviolet light-absorbing ozone layer allowed organisms to colonize the land without solar radiation damage. Remember This!  Chloroplasts are found only in plant and algal cells and are thought to have originated by endosymbiosis. These organelles demonstrate great plasticity, converting into specialized storage structures to accommodate a cell’s changing needs. Review the structure of chloroplasts in Figure 5.1. This will give you a better understanding of the upcoming discussion of their functions.

Reactions of Photosynthesis Because the reduction of carbon dioxide to glucose through photosynthesis is extremely complex, biochemists attempt to simplify the study of the process by dividing the

reactions into two sets: the light reactions and the dark reactions. The light reactions, or light-dependent reactions, trap solar energy and convert it into chemical energy. This is accomplished by an assortment of pigments (colored, light-absorbing molecules), electron transport carriers, and enzymes. The dark reactions, or light-independent reactions, can occur in the presence or absence of light. They use the chemical energy generated in the light reactions to synthesize glucose enzymatically.

Photosynthetic pigments and photosystems The primary photosynthetic pigment, chlorophyll a, initiates the light reactions by absorbing a photon, or packet of light energy. The bluish-green chlorophyll a preferentially absorbs photons of red and blue wavelengths. Chlorophyll a consists of the colored portion of the molecule that absorbs light and a tail that anchors the pigment securely in the thylakoid membrane (Figure 7.14a).

Photosynthetic pigments • Figure 7.14 The light reactions of photosynthesis are driven by photons of light absorbed by chlorophyll a and accessory pigment molecules.

CH2 CH

Chromophore— the light-absorbing portion of a pigment

C

H3C

In the cyclic portion of the chlorophyll a molecule an alternating sequence of single and double bonds, known as conjugated double bonds, facilitate the transfer of absorbed energy. The attached hydrophobic tail inserts into the thylakoid membrane to anchor the molecule in position.

C

C

N

N

C

C

N

H

C

N

C

Mg

C

H

C

C HC

H3C

a. Chlorophyll a structure

CH3

H C

C

CH

C

C C

C

CH2

HC

CH2

C

CH2CH3

C C C

CH3

Conjugated double bond system

O

O

O O

C

CH3

O CH2 CH

Hydrophobic tail— anchors the pigment in the thylakoid membrane

H3C

C H2C

H3C

HC H 2C

H3C

HC H 3C

H3C

HC

T h i n k C ri ti c al l y

If the structure of chlorophyll a is suited for absorbing photons while positioned within the thylakoid membrane, how would the structure of a non–membrane-bound pigment differ?

CH2 CH2 CH2 CH2 CH2 CH3

b. Photosystem structure To maximize light-harvesting efficiency, hundreds of molecules of chlorophyll a, chlorophyll b, and carotenoids are packed tightly together into a unit known as a photosystem. Each photosystem possesses a centrally positioned chlorophyll a that serves as the reaction center to initiate electron transport.

CH2

Inserts into photosystem

Stroma

P680

Light Core antenna Light harvesting pigments harvesting complex complex

Thylakoid membrane Thylakoid lumen

Photosystem II

Photosynthesis  197

Because of the extremely endergonic nature of photosynthesis, pigments are clustered together to form a photosystem, which maximizes photon absorption. In plants, the overall pigment arrangement embedded in the thylakoid resembles a bull’s eye (Figure 7.14b). The photosystem core consists of approximately 300 chlorophyll a and b molecules (Table 7.1). These molecules are surrounded by the antenna pigments, a chlorophyll/carotenoid mixture, and then flanked by carotenoid-rich pigment clusters known as light-harvesting complexes. Sequestered within the center of the photosystem, a designated chlorophyll a molecule initiates the light reactions when it absorbs a photon. This special chlorophyll a is the reaction center. Accessory pigments enhance photosynthetic efficiency by absorbing additional photons. Chlorophylls b, c, and d are structurally similar to chlorophyll a and also absorb blue and red photons. Carotenoids are red, orange, yellow, and brown pigments that absorb photons of different wavelengths, maximizing the light energy available for photosynthesis. However, their principal function is as antioxidants to protect chlorophyll from oxidation by superoxide anions. These strong oxidizing agents are accidentally produced from oxygen and can irreversibly strip electrons from chlorophyll, bleaching

the pigment. This problem is avoided by carotenoid interaction with superoxide anions, which renders them harmless. Finally, phycobilins are algal accessory pigments that form a globular structure called a phycobilosome. Once anchored on the thylakoid membrane next to chlorophyll a, these pigments absorb photons of different colors and funnel the energy to adjacent chlorophyll a molecules via their conjugated double bond system. Phycobilins are also protective antioxidants. Two different types of photosystems are involved in the light reactions: photosystem I and photosystem II. Although the proportions of chlorophyll b and carotenoids vary slightly, their overall pigment composition is similar. Reaction centers, however, are strikingly different between the two photosystems. In photosystem I, a special pair of chlorophyll a molecules acts as the reaction center known as P700, because they maximally absorb red photons with a wavelength of 700 nm. P680, the reaction center in photosystem II, is composed of a single chlorophyll a that preferentially absorbs red photons with a wavelength of 680 nm.

The light reactions The light reactions of photosynthesis begin when an electron in the P680 reaction center absorbs a photon of energy, either directly or

Accessory photosynthetic pigments  Table 7.1 Pigment

Color

Role

Example organisms

  Chlorophyll a

Bluish green

Primary photosynthetic pigment

All land plants, algae

  Chlorophyll b

Olive green

Enhance light absorption

Plants, green algae, euglenoids

  Chlorophyll c

Bluish green

Enhance light absorption

Diatoms, dinoflagellates, brown algae

  Chlorophyll d

Yellowish green

Enhance light absorption

Red algae

  Lycopene

Orangish red

Enhance light absorption; antioxidant

Land plants

  Carotene

Bright yellow

Enhance light absorption; antioxidant

Land plants, green algae, euglenoids

  Fucoxanthin

Brown

Enhance light absorption; antioxidant

Diatoms, brown algae

  Violaxanthin

Yellow

Enhance light absorption; antioxidant

Land plants, green algae, diatoms

  Allophycocyanin

Royal blue

Enhance light absorption; antioxidant

Red algae, cyanobacteria

  Phycocyanin

Teal

Enhance light absorption; antioxidant

Red algae, cyanobacteria

  Phycoerythrin

Red

Enhance light absorption; antioxidant

Red algae, cyanobacteria

Chlorophylls

Carotenoids

Phycobilins

198  CHAPTER 7 Metabolism

The light reactions of photosynthesis, also known as noncyclic photophosphorylation, are a series of redox reactions within the thylakoid membrane that generates a strong hydrogen ion gradient for chemiosmosis. 7 Diffusion of the sizable hydrogen ion gradient through ATP synthase generates large quantities of ATP. H+ 1 Photons of red and blue light are absorbed by photosystem II and the energy transferred to P680.

4 During electron transport hydrogen ions are transported into the thylakoid lumen, contributing to the gradient.

Thylakoid membrane

P680

e–

e–

ATP

ATP

NADP+ NADPH

2 Redox reactions begin as the reaction center is oxidized when an excited electron is ejected. H+

e–

6 Photosynthetic redox reactions conclude with the production of NADPH.

Stroma pH~8

e–

cyt b6

Fe-S

Fe-S

P700

H+ H+

e– cyt f H2O

2 H+

2

e–

½ O2

Hill reaction 3 The Hill reaction splits water providing a source of electrons to reduce P680. Oxygen is released as a by-product and accumulating hydrogen ions form a gradient.

H+

H+

H+

H+

e– H+

Thylakoid lumen pH~4-5

H+ 5 Reaction center P700 is reduced by + H H+ an electron from P680 when light absorption by photosystem I H+ H+ triggers more electron transport.

6 CO2 + 6 H2O → C6H12O6 + 6 O2

Th in k Cr it ica lly

How would photophosphorylation be affected if the Hill reaction that splits water ceased?

transferred from the other pigments within photosystem II (Figure 7.15 step 1). The electron that absorbs the solar energy moves to an excited state and is physically ejected from the molecule, oxiexcited state The dizing the reaction center. This elevation in energy begins a series of redox reactions level of an electron within the thylakoid membrane above its ground (step 2). When the electron state, the result of from P680 arrives at photosysthe absorption of tem I, it reduces P700, which was energy. similarly oxidized a split second earlier (step 5). These electrons ultimately reduce nicotinamide adenine dinucleotide phosphate (NADP+) to NADPH, a phosphorylated version of the activated carrier NADH (step 6). To continue this process, oxidized P680 must be reduced. Using an enzyme complex associated with the

bottom of photosystem II and extending into the thylakoid lumen, water molecules are split. This process, known as the Hill reaction: (1) liberates oxygen, which is released as a by-product; (2) generates hydrogen ions, which decrease the pH of the thylakoid lumen; and (3) releases electrons that reduce P680 to its original condition (Figure 7.15 step 2). As more photons are absorbed, more redox reactions can occur in the thylakoid membrane supplying the energy needed to pump hydrogen ions inside to generate a huge gradient. Diffusion of the H+ ion gradient through ATP synthase produces large amounts of ATP, which can be used to drive the dark reactions (Figure 7.15, step 7). Because the linear electron transport pathway of the light reactions is ultimately responsible for the chemiosmotic addition of a phosphate group to ADP, the process is often referred to as noncyclic photophosphorylation. Photosynthesis  199

Process Diagram

✓ The Planner

Noncyclic photophosphorylation • Figure 7.15

Carbon fixation • Figure 7.16 Inorganic carbon dioxide from the atmosphere is converted into organic molecules of the plant. 2 The process concludes as the unstable 6-carbon intermediate splits into 2 molecules of 3-PGA.

1 Carbon fixation begins when CO2 is converted into organic material using RuBPase. O

C

+

O

Carbon dioxide

C

O

C

O

C

O

C

O

C

O

P

O RuBPase

C O

P

Ribulose-1,5-bisphosphate

C

O

C

O

C

O

C

O

C

O

P (Hydrolysis)

2

C

O

C

O

C

O

P

O P

3-phosphoglycerate

Unstable 6-carbon intermediate

A sk Yo u rs e l f On hot summer afternoons, plants close the microscopic pores in the leaves used for gas exchange to prevent evaporative losses that lead to wilting. How does this survival mechanism affect carbon fixation? a. The rate of carbon fixation increases. b. The rate of carbon fixation decreases. c. The rate of carbon fixation is unchanged. d. The effect on carbon fixation depends on the humidity.

of the Calvin cycle are beyond the scope of this text, a The dark reactions  The dark reactions of photosynthegood general understanding of the procedure is possible sis are endergonic reactions that use the chemical energy by simply counting the carbon atoms of the reactants of ATP and the reducing power of NADPH generated dur(Figure 7.17a). ing the light reactions. The overall outcome of the dark Glucose is a six-carbon sugar, so the Calvin cycle reactions is the reduction of carbon dioxide to glucose. must run six times to fix a sufficient number of carbon The first step in the dark reactions is carbon fixation, dioxides for the synthesis of the final product (Figure or the incorporation of inorganic carbon dioxide into an 7.17b). After this fixation step, 36 carbon atoms particorganic molecule (Figure 7.16). Using the enormous ipate in the Calvin cycle reactions. The splitting of six enzyme complex ribulose-1, 5-bisphosphate carboxylase6-carbon unstable intermediates generates 12 molecules oxygenase (RuBPase) found in the stroma of chloroplasts of 3-PGA (12 molecules × 3 carbons/3-PGA = 36 carin plants or within the cytoplasm of photosynthetic bacbons) (step 2). Their reduction by NADPH to 3-PGAL is teria, carbon dioxide and the five-carbon sugar RuBP are a key step because 3-PGAL is a versatile substrate (steps 3 combined. The six-carbon sugar produced is not glucose, and 4). Two of these molecules are diverted to produce a but an unstable intermediate compound that immediglucose (step 5) (2 molecules × 3 carbons/3-PGAL = 6 ately splits in half, generating two molecules of 3-phoscarbons), the end-product of photosynthesis. phoglycerate (3-PGA). Because the first stable The remaining 10 molecules of 3-PGAL (10 product of the dark reactions is a three-carbon Calvin cycle A molecules × 3 carbons/3-PGAL = 30 carsugar, the process is sometimes referred to as light-independent cycle of photosynbons) are enzymatically rearranged to yield C3 photosynthesis. thetic reactions that six molecules of RuBP, the five carbon initial The reduction of carbon dioxide to glusubstrate (6 molecules × 5 carbons/RuBP = cose and the simultaneous regeneration of convert carbon dioxRuBP require ATP and NADPH from the light ide into glucose using 30 carbons) (steps 6 and 7). Clearly, the cycle has been completed by conserving these 30 reactions and a collection of stromal enzymes. ATP and NADPH carbons while a six-carbon glucose has been This process, which includes carbon fixation, produced by the light reactions. generated. is called the Calvin cycle. Although the details

200  CHAPTER 7 Metabolism

Using the ATP and NADPH generated in the light reactions, carbon dioxide is reduced enzymatically to glucose during the Calvin cycle.

6 CO2 + 6 H2O → C6H12O6 + 6 O2 Glucose 6 cycles x 1 carbon/CO2 = 6 carbons 6 cycles x 5 carbons/RuBP = 30 carbons

The complex reactions of the Calvin cycle can be simplified by counting the carbon atoms of the principal reactants.

Twelve 3-carbon 3-PGAs = 36 carbons Reduction Twelve 3-carbon 3-PGALs = 36 carbons

Six 5-carbon RuBPs = 30 carbons

7 More ATP from the light reactions is used to regenerate RuBP from ribulose-5-bisphosphate and begin the cycle again.

H

C

OH

H

C

OH

CH2O

Ten 3-PGALs = 30 carbons

C

Two 3-PGALs = 6 carbons

O

P

CH2O

O

RuBPase

–O

C

OH

C

O

C

OH

C

H

P

CH2O

P

2 The 6-carbon unstable intermediates split into two molecules of 3-PGA. O

P

Six unstable 6-carbon intermediates

6 ADP

C

H

O– OH

C

P

CH2O

ATP

Twelve 3-PGA

CH2OH C

O

H

C

OH

The Calvin cycle

H

C

OH

(6 turns/glucose produced)

CH2O

1 glucose = 6 carbons

1 Carbon fixation occurs as RuBPase combines CO2 and RuBP to generate an unstable 6-carbon intermediate.

Six CO2 O

Six RuBP

6

36 carbons

Six 6-carbon unstable intermediates = 36 carbons Hydrolysis

a. Tracking CO2 through the Calvin cycle

b. The reactions of the Calvin cycle To generate one molecule of glucose, the Calvin cycle must run six times. Using NADPH and ATP made during the light reactions, enzyme-mediated reactions produce 12 molecules of 3-PGAL. This versatile substrate can be used for glucose synthesis and CH2O to regenerate the RuBP that was C O consumed initially.

Carbon fixation

12

3 3-PGA is phosphorylated using ATP from the light reactions to produce 1, 3-bisphosphoglycerate.

ATP

12 ADP

P

Six ribulose-5-phosphate

O H

C C

O OH

CH2O 12 NADPH H H

C C

12 NADP+

O OH

CH2O 5 Two molecules of 3-PGAL are diverted from the Calvin cycle and further processed to make glucose, the ultimate product of photosynthesis.

P

Twelve 1,3-bisphosphoglycerate

P Ten 3-PGAL 6 The remaining ten 3-PGAL molecules begin a complex series of structural rearrangements beginning with dephosphorylation.

P

4 Using NADPH generated in the light reactions, 1, 3-bisphosphoglycerate is reduced to 3-PGAL. 12 P

P

Twelve 3-PGAL

CH2O H

Two 3-PGAL HO

O

H OH

H

H

OH

One glucose

H OH

Th in k Cr it ica l l y

What would happen if the two molecules of 3-PGAL diverted for glucose production were redirected back into the Calvin cycle?

Photosynthesis  201

Process Diagram

✓ The Planner

The Calvin cycle • Figure 7.17

Case Study

✓ The Planner

A Metabolic Imbalance in Grand Lake St. Mary’s floated across the lake, even though it was peak vacation season. As a lone speedboat zoomed past, Keith noticed its motor churning up lime green-colored water. A closer inspection revealed a foamy, green mat of scum clinging to the shore, with a few dead fish washed up (see Figures a and b).

a. The cyanobacterial bloom has dramatically reduced the recreational value of Grand Lake because advisories recommend against swimming, drinking, or touching the water.

b. The metabolic activities of an extremely large cyanobacterial population deplete the oxygen levels of the water, leading to fish kills.

c. Planktothrix agardhii is the dominant species of cyanobacteria polluting Grand Lake St. Mary’s.

Compare the overall equations for cellular respiration and photosynthesis (Figures 7.7 and 7.16) and notice that these are reciprocal reactions. The water split during the Hill reaction of photosynthesis supplies the oxygen necessary to complete electron transport in cellular respiration. The interaction of these two metabolic pathways is an excellent example of the delicate biochemical balance necessary for global health. An imbalance between these reciprocal processes can result in environmental damage, such as lake eutrophication (see the Case Study). This condition occurs when elevated levels of nutrients stimulate the growth of cyanobacteria, leading to their overabundance.

202  CHAPTER 7 Metabolism

Courtesy Irina Olenina

Ohio EPA

Jeff Hinckley/The Columbus Dispatch

In the first week of July, Keith arrived at his grandparents’ summer cottage on Grand Lake St. Mary’s in Celina, OH, with his two best friends from college, Kevin and Aidan. Keith was stunned at how the lake had changed in the 10 years since he had last been there. No swimmers splashed in the water and hardly any boats

As the aerobic cyanobacteria deplete the water’s dissolved oxygen levels, fish suffocate and die, diminishing environmental health.

Chemosynthesis in Bacteria Not all organisms acquire their energy for anabolism from cellular respiration or photosynthesis. Some organisms obtain their energy from chemosynthesis, the process in which other organic compounds or inorganic minerals are oxidized to extract energy for anabolism. Most bacteria are chemosynthetic organisms. Chemoautotrophs use carbon dioxide as their primary

Walking along the shore and studying the green scum, Aidan called out, “I think I know what’s going on here. This looks like there was a population explosion of a specific type of algae in the lake. This scummy layer is characteristic of a cyanobacterial bloom.” “Why did we bring the environmental studies major on our vacation?” Kevin said jokingly to Keith. “I don’t care if the lake is a little greener than usual. Let’s get some trunks on and put the jet-ski in the water.” “Whoa!” Aidan called out. “We need to find out what’s going on before we get in the water. Some cyanobacteria produce toxins, and we don’t need to get sick on vacation.”

3. Why would toxin secretion limit fish consumption? When Keith wondered aloud how this happened, Aidan used his environmental biology background to explain, “The lake has undergone eutrophication, a condition that occurs when elevated levels of nutrients stimulate the growth of cyanobacteria. An overabundance of these microorganisms depletes the water’s dissolved oxygen levels. Do you remember the dead fish that washed ashore? They suffocated because the aerobic algae are using up too much of the oxygen in the water.”

1. Look at the photos. Why is the water so green?

4. How would cyanobacterial photosynthesis affect the oxygen levels of the lake?

2. Review: What are cyanobacteria? What might cause a tremendous increase in their growth?

5. Aidan indicated that aerobic cyanobacteria are using up oxygen in the water. How are they doing this?

Later, Aidan struck up a conversation with a local man to get some information about the condition of Grand Lake. The gentleman reported that for 4 years, Grand Lake has been overgrown with a cyanobacterium called Planktothrix, which secretes the liver toxin, microcystin (Figure c). This year, toxin levels more than doubled, and advisories were posted against drinking the water or coming in contact with the green foamy scum. “So swimming and jet-skiing are off, but we can still take out the canoe, right?” Kevin asked. “Yeah, we can do anything that doesn’t involve direct contact with the water,” Aidan replied. “So we can still go fishing. Man, there is nothing like fresh grilled lake perch,” Keith exclaimed. “Actually,” Aidan stalled, “we need to limit how much fish we eat because of possible toxin problems.”

6. Identify the microbial imbalance in Grand Lake that has led to the oxygen depletion.

carbon source and reduced inorganic compounds such as ammonia, hydrogen sulfide, carbon monoxide, and elemental sulfur as their energy resource. Nitrosomonas, Thiobacillus, and Pseudomonas are bacterial chemoautotrophs whose metabolic activity is vital to the appropriate recycling of nutrients within the environment, which will be addressed in Chapter 22. Chemoheterotrophs use organic compounds as their carbon supply and often extract energy for anabolism from the electrons of the hydrogen atoms of the same molecule. Glucose is usually the preferred molecule to serve as both carbon and energy source.

“How did excess nutrients end up in the lake?” Keith asked. “Look around,” Aidan laughed. “You’re in rural Ohio. Just beyond the lake it’s one cornfield after another.” “So?” Keith and Kevin replied in unison. “So, fertilizers applied to fields are rich in nitrogen, phosphorus, and potassium—minerals to promote the growth of crop plants. Because all the reed beds were removed as the lake was developed, the fertilizer is not removed when runoff from heavy rains washes fertilizer straight into the lake. Then those same minerals promote the growth of the cyanobacteria,” Aidan informed his friends.

Common examples of chemoheterotrophs include diverse organisms such as Escherichia coli and humans. We will expand on the topic of energy use by microorganisms in Section 9.1.

1. How are the net equations for photosynthesis and cellular respiration related? 2. How do chemoautotrophs obtain energy? Photosynthesis  203

✓

The Planner

Summary

7.1

 The Role of Energy in Life  180

• Energy, the ability to do work, is required by all organisms to run their metabolism. The two principal forms of energy are potential energy, or stored energy, and kinetic energy, the energy of motion. • The degradative processes of catabolism are exergonic. They are energy releasing (as shown in the diagram) and spontaneous. The construction processes of anabolism are endergonic. They are energy consuming and nonspontaneous.

Potential energy of molecules

Exergonic and endergonic reactions: Exergonic reactions  •  Figure 7.1

• Substrate-level phosphorylation is a common enzymatic process in which a high-energy phosphate group is transferred from one molecule to ADP, generating an ATP. This coupling of an exergonic reaction with an endergonic reaction is a highly effective strategy for making ATP. • Oxidative phosphorylation and photophosphorylation are complex redox pathways that generate large quantities of activated carriers for future ATP production. When the redox reactions of these two processes occur within a membrane, small amounts of energy are used to pump hydrogen ions to one side of the membrane, creating a gradient. Diffusion of H+ ions through ATP synthase converts their potential energy into mechanical energy and then into large quantities of ATP. ATP synthase couples hydrogen ion diffusion with ATP generation.

7.3

  Glycolysis and Fermentation  186

Energy

Reactants

• Glucose is an excellent fuel molecule, liberating 686 kcal/mol of energy on complete oxidation. With enzyme-controlled stepwise oxidation, its potential energy can be efficiently harvested to generate two molecules of ATP and two molecules of NADH. This series of glucose oxidations occurs in all organisms.

Products

7.2

  Energy Production Principles  182

• Potential energy stored in the chemical bonds of molecules can be efficiently extracted via oxidation-reduction (redox) reactions. The molecule is oxidized as an electron is stripped away, but reduction transfers that electron, and its associated energy, to another molecule such as the coenzyme NAD+. The energy stored in this reduced activated carrier can later be used for adenosine triphosphate (ATP) production (shown in the diagram).

• Under anaerobic conditions, continuous glycolysis alone would quickly deplete the cell’s NAD+ pool. The NAD+ supply is replenished by different types of fermentation, including lactic acid fermentation (shown in the diagram). The pyruvates generated in glycolysis are reduced by NADH. Fermentation regenerates NAD+ and can yield products such as ethanol or lactate.

Fermentation: Lactic acid fermentation  •  Figure 7.8 Pyruvate O

2

C

O

C

O

C

2 NADH

Adenosine triphosphate (ATP): Structure  •  Figure 7.4

2 NAD+

Adenine NH2 C

N Phosphate groups O O– P O–

O O

P O–

H

C

Lactic acid

C

C

N

N

O O

P O–

O

N

C

H

2

C

O

C

O

C

O

CH2 O C H

H

H

C H

C

C

OH

OH

Ribose

7.4

  Aerobic Cellular Respiration  190

• When oxygen is available, aerobic organisms follow glycolysis (see the diagram) with the citric acid cycle, or Krebs cycle, and the electron transport system (ETS). The citric acid cycle completes the oxidation of glucose, generates many activated carriers, and releases carbon dioxide as a by-product. The redox reactions of the ETS generate a hydrogen-ion gradient for the chemiosmotic production of ATP. Collectively, glycolysis, the citric acid cycle, and the ETS are known as cellular respiration.

Cellular respiration: Glycolysis  •  Figure 7.13 Glucose 2

ATP

Fructose-1, 6-phosphate

Glyeraldehyde-3-phosphate 2 NADH

2X

ATP

ATP Pyruvate

• In addition to glucose, numerous other biomolecules can be degraded as fuels. Proteins and fats are regularly broken down to make ATP and activated carriers. Other integrated biochemical reactions, such as amino acid production via amination, regenerate these catabolized macromolecules. The tremendous metabolic diversity demonstrated by these processes can be used by microbiologists to identify certain bacterial species. • In addition to the major metabolic pathways of cellular respiration and photosynthesis, cells perform countless other reactions. Many times, the product or by-product of one pathway serves as the substrate of another and allows the integration of catabolism and anabolism of carbohydrates, proteins, lipids, and nucleic acids.

7.5

 Photosynthesis 196

• The reactions of photosynthesis had a profound impact on the evolution of life on Earth. The oxygen created as a by-product of the process generated the ultraviolet-filtering ozone layer and favored the evolution of organisms able to perform cellular respiration. • The light reactions of photosynthesis harvest solar energy using photosystems (see the diagram) composed of chlorophyll a plus accessory pigments. The type of accessory pigment and its arrangement in the thylakoid varies with species. • A chlorophyll a electron moves to an excited state by absorbing light energy, triggering electron transport in the thylakoid membrane and the generation of a hydrogen ion gradient for chemiosmosis. The redox reactions also produce NADPH. Photosystem II harvests photons to initiate the light reactions.

Photosynthetic pigments  •  Figure 7.14 CH2 CH

C

H3C

C

C

N

N

C

C

N

H

C

N

C

Mg

C

H

C

C HC

H3C

CH3

H C

C

CH

C

C

C

C

C

C

CH2

HC

C

CH2 C O

CH2CH3

CH3

O

O

C O O

CH3

CH2 CH H3C

C H2C

CH2 CH2

H3C HC • The dark reactions of CH2 H2C photosynthesis convert the CH2 previously made ATP and H3C HC CH2 NADPH into glucose by H3C reducing carbon dioxide. CH2 H3C HC This process is initiated CH3 by carbon fixation or the incorporation of inorganic carbon dioxide into organic 3-PGA. The Calvin cycle continues as ATP and NADPH reduce this substrate into 3-PGAL, which can be used to make glucose and regenerate cycle intermediates.

• Some organisms obtain energy by chemosynthesis, in which oxidation of organic or inorganic compounds provides the electrons. Chemoautotrophs obtain energy from inorganic compounds; chemoheterotrophs obtain energy from organic compounds.

Summary  205

Key Terms • adenosine triphosphate (ATP)  180 • alcoholic fermentation  188 • amination 196 • amphibolism 196 • anabolism 181 • anaerobic 188 • ATP synthase  185 • bioremediation 195 • Calvin cycle  200 • carbon fixation  200 • carotenoid 198 • catabolism 181 • cellular respiration  185 • chemiosmosis 185 • chemoautotroph 202 • chemoheterotroph 203 • chemosynthesis 202 • chlorophyll a 197

• citric acid cycle  190 • coenzyme 183 • coupled reaction  185 • dark reaction  197 • electron transport system (ETS)  192 • endergonic reactions  180 • energy 180 • enzyme 180 • eutrophication 202 • excited state  199 • exergonic reaction  180 • fermentation 188 • gluconeogenesis 196 • glycolysis 186 • kinetic energy  180 • Krebs cycle  190 • lactic acid fermentation  189 • light reaction  197

• metabolism 180 • noncyclic

photophosphorylation 199 • oxidation reaction  183 • oxidation-reduction (redox) reaction 183 • oxidative phosphorylation  185 • photon 185 • photophosphorylation 185 • photosynthesis 196 • photosystem 198 • phycobilin 198 • potential energy  180 • pyruvate dehydrogenase  190 • reduction reaction  183 • substrate-level phosphorylation 185 • transamination 196

Critical and Creative Thinking Questions 1. Explain why glycolysis is considered an exergonic process if it consumes two molecules of ATP. 2. What part of the alcoholic fermentation pathway shown in the diagram is key to keeping glycolysis running? Pyruvate O

Acetaldehyde

C

O

C

C

O

C

C

O

NADH

NAD+

Ethanol C

O

C

Carbon dioxide O

C

O

3. Pyruvate dehydrogenase is a large enzyme complex. Why is a multicomponent enzyme used for the oxidation of pyruvate to acetyl CoA? 4. When the electron transport system is operating in the mitochondria, the hydrogen ion gradient difference across the cristae is approximately 1.5 pH units. When photophosphorylation triggers intramembrane redox reactions, the hydrogen ion concentration gradient difference across the thylakoid is approximately 3.5 to 4 pH units. If chemiosmosis occurs, which organelle will generate more ATP? Why?

206  CHAPTER 7 Metabolism

5. Why is ATP synthase also known as coupling factor? 6. Some cellular respiration-generated ATP is used to transport molecules into the mitochondria so the net ATP yield/glucose is less than 38 for these cells. Why is this not applicable to bacteria? 7. If photosynthesis is driven by solar energy, why can the Calvin cycle run without it? 8. If you were monitoring glucose production in the chloroplast of a green alga and determined that 591,312 molecules of glucose were made in one minute, how many times did the Calvin cycle run in those 60 seconds? 9. How would a magnesium deficiency affect photosynthetic efficiency? 10. W  hich of the chemical structures shown would be the better fuel? Why? O

O

C

O

C

O

C

O

C

What is happening in this picture?

Karl Ammann/Nature Picture Library

This elephant calf is eating fresh dung produced by its mother. This common elephant practice is essential for establishing the intestinal flora in this young herbivore so it can successfully digest plants as it transitions from nursing to grazing.

T h i n k C ri ti c al l y 1. What principal fuel molecule is acquired by grazing? 2. Based on your understanding of metabolism from this chapter, explain the mutualistic relationship between the baby elephant and the bacteria.

Self-Test (Check your answers in Appendix A.)

1.  Which scenario represents the greatest potential energy?

2.  ATP is considered a better energy source than heat for driving metabolic reactions because ______.



a. a skier at the top of the beginner slope





b. a skier at the top of the expert slope

a. it can be easily converted into other forms of energy as needed



c. a skier at the bottom of the mountain



b. it can be used with almost all energy-requiring reactions



d. a skier riding the ski lift



c. heat can denature cellular proteins



e. a skier moving rapidly down the slope



d. Options a and c are correct.



e. Options a, b, and c are correct.

Self-Test  207



a. exergonic and spontaneous

7.  Review the Process Diagram, Figure 7.7, and answer this question.



b. endergonic and spontaneous





c. exergonic and nonspontaneous

The enzyme responsible for cleaving fructose-1,6-bisphosphate into two 3-carbon molecules is ______.



d. endergonic and nonspontaneous



a. triose isomerase



e. Both a and b are correct.



b. RuBPase



c. aldolase



d. pyruvate dehydrogenase



e. enolase

Potential energy of molecules

3.  The reaction shown in the diagram is ______.

8.  Yeast performs fermentation under ______ conditions to regenerate an adequate supply of ______.

Energy

Reactants

Products



a. acidic; alcohol



b. acidic; carbon dioxide



c. aerobic; NAD+



d. anaerobic; NAD+



e. anaerobic; NADP+

4.  Of the two reactions shown in the diagram, reaction 1 is ______, reaction 2 is ______, and together, the reactions are said to be ______.

9.  Review the Clinical Application, and answer this question.

Why is alcohol still important in modern health care?



a. endergonic; exergonic; aerobic



a. It works well in killing pathogens on the skin.



b. endergonic; exergonic; coupled



b. It is used in water purification.



c. endergonic; exergonic; chemiosmotic



c. It kills pathogens ingested with food.



d. exergonic; endergonic; chemiosmotic



d. It kills pathogens in the blood.



e. exergonic; endergonic; coupled



e. It is used to kill pathogens during in food processing.

Reaction 1 Phosphoenol Pyruvate

Reaction 2 P P

P

ADP

Enzyme 1

+ P

10.  Examine the reaction of pyruvate oxidation shown in the diagram. The molecule that is reduced is ______.

Pyruvate + P

Enzyme 2

P P P

ADP

5.  Review the use of glucose basal media in The Microbiologist’s Toolbox, and answer this question.



a. NAD+



b. carbon dioxide



c. NADH



d. water



e. acetate

If a microbiologist inoculated a tube of this medium with Haemophilus influenzae, incubated it for 24 hours, and observed a clear, green medium, she would conclude that this bacterial species ______.



a. secretes acidic by-products as it grows



b. secretes basic by-products as it grows



c. secretes both acidic and basic by-products as it grows



d. secretes no by-products as it grows



e. fails to grow in OF glucose basal media

6.  Which of the following statements is FALSE regarding the complete oxidation of glucose by a cell during aerobic respiration?

a. It occurs in many small steps to minimize activation energy barriers.



b. It occurs in many small steps so energy extracted can be efficiently stored in activated carriers.



c. It releases 686 kcal/mol of energy.



d. The initial reaction releases a large amount of heat.



e. It requires oxygen.

Pyruvate O

2

Acetate 2 NAD+

C

O

C

O

2 NADH

O

2

C C

C

Carbon dioxide 2

O

C

O

O

11.  Which of the products of pyruvate oxidation enters the citric acid cycle?

a. CO2



b. acetate



c. acetyl CoA



d. NAD+



e. pyruvic acid

12.  Review the citric acid cycle in Process Diagram, Figure 7.12, and answer this question.

16.  Which pigment structure shown in the diagram anchors chlorophyll a into the thylakoid membrane?

CH2 CH

C

H3C

a. centrally chelated magnesium atom b. conjugated chromophore



c. hydrophobic chromophore



d. hydrophobic phytol tail



e. conjugated phytol tail

C

C

N

N

C

C

N

N

C

C

H

C

CH2

HC

C

a. 6; 7; 8; 9

CH2



b. 6; 8; 10; 12

CH



c. 6; 7; 11; 12



d. 8; 9; 10; 11



How is the energy from redox reactions used to move hydrogen ions across the membrane by chemiosmosis?

C O

C

CH3

O

O

O O CH3

C

H3C

H2C HC

H3C

H2C HC

H3C

17.  The primary function of carotenoids, the orange accessory pigments, is ______.

C

C



13.  Review part c of the Microbiology InSight, Figure 7.13, and answer this question.

C

C

CH2

CH2CH3

CH

C

H

Which four steps in the citric acid cycle involve oxidation reactions?

e. 9; 10; 11; 12

C

Mg





C

C HC

H3C

CH3

H C

C

H3C H3C

HC

CH2 CH2 CH2 CH2 CH2 CH2 CH3



a. It opens a channel allowing the free flow of hydrogen ions.



b. It attracts the hydrogen ions by adding negative charge to the membrane.



a. light harvesting for photosynthesis



c. It causes conformational changes in the carrier proteins, which push the hydrogen ions to the other side.



b. generation of a hydrogen ion gradient



c. prevention of chlorophyll a photo oxidation



d. It deprotonates buffers.



d. initiation of electron transport



e. It denatures the protein carriers allowing hydrogen ions to leak across the membrane.



e. reduction of FAD

18.  The important by-product of the Hill reaction is ______.

14.  Review What a Microbiologist Sees, and answer this question.



a. oxygen



b. electrons



Naturally occurring oil-degrading bacteria exist in the Gulf of Mexico because ______.



c. hydrogen ions



a. hydrocarbons are an abundant food resource in marine habitats



d. water



e. protons



b. natural oil seeps from underground reservoirs led to the evolution of species able to use this carbon source

19.  ______ is the enzyme responsible for the carbon fixation step that initiates the Calvin cycle.



c. oil dissolves more easily in salt water than freshwater promoting bacterial growth



a. Triose isomerase



b. RuBPase



c. Aldolase



d. Pyruvate dehydrogenase



e. Enolase



d. they are a fluke of evolution



e. all bacteria possess oil-degrading enzymes because they are essential for survival

15.  Which of the following processes can use pyruvate as a substrate?

20.  What function does NADPH serve in the Calvin cycle?



a. gluconeogenesis



a. oxidation of carbon dioxide



b. alcoholic fermentation



b. reduction of 1, 3-bisphosphoglycerate to 3-PGAL



c. lactate fermentation



c. pyruvate oxidation to acetyl CoA



d. oxidation to acetyl CoA



d. oxaloacetate reduction to citrate



e. All of these processes use pyruvate as a substrate.



e. 3-PGA oxidation to 3-PGAL

Self-Test  209

8

Microbial Genetics and Genetic Engineering FOUR NUCLEOTIDES AND A UNIVERSE OF POSSIBILITIES

I

n living organisms, the genetic information is stored in the sequence of nucleotides of DNA of the cells. DNA consists of two entwined and connected strands of nucleotides that are identical except that each

ORGANISM Prochlorococcus marinus subsp. Pastoris str. CCMP1986 Bacteria; Cyanobacteria; Prochlorales; Prochlorococcaceae; Prochlorococcus. REFERENCE 1 (bases 1 to 1657990)

John Bavosi/Science Source

The DNA sequence of one of the smallest free-living bacteria, the cyanobacteria Prochlorococcus marinus, has the potential to code for an almost unlimited number of features.

contains one of four different nitrogen-containing bases: A, T, G, C. The almost unlimited combinations of bases in DNA provide all the diversity needed for the different genes of an organism. For example, the most abundant photosynthetic marine organism, Prochlorococcus, is one of the smallest free-living bacteria (see the photo) and has 1.6 million base

ORIGIN 1 actcacaaaaattgtgtttagataaagtttttttttaatgttgaaaaatttaaatagtgt tatagattacctaaagtaaaaagtcttaggatttctcagactggcagatcaatttttgaa attttaattcaatgatcaaagcttcatgtctcccttaaaaactgaatacttaaaatatgc aaaagcactttgtgtaatgttcaacaatccaatactaagaaaaagttttgatgccggcaa gtaataatttatcaaataccctttataagtttgatgtcttgcttgatataggtagtcata ccaacgctttttcttatttagatggtgataatctcggagtagaaattggagatattgttt cagtaagacttaagggaagactcttgaatgggctaacgatttctaaaagtccttttttaa agacagataaaaataaaaaagattttgatgaagaatctaattttgaatatttatctatac aaagtattgtccaaaaaaaagtgattcaagattggtggagagaatggttggaggatctag ctttattttatcgggtaactagtttgaaaatgtttaaaacagctttcccccctggatgga ttggtaaacataaaaaattatctcaaaattttaaatatcaaatatggatcgaatctcaaa tagatttagaatttaataatgatgacttaacaaaaagagaactttcattaataaatatat tgcgtcttaaagggaaatggcaaagcgaattattaaggtttggttttaattccacaatta taaattcaatggtgaataaaaaactactaataaaggctaaaagaaaaaaaatagttagta ccaaattaagttcttttaaaaatgattgtattaaattaaaaagaccaaatcttactcagg aacaaaaaaaaatatatggggaaatgcaagagatgcgacccggagatgtctgtttgctat ggggagaaacaggttcaggaaaaacagaaatttatatgagaatggctgaagatcaactac ttaataaaaagagctgtctaatgctggctccagaaattggcttaattcctcaacttattg atagattcagtaaaagatttcaaaatgaggtttttgaatatcacagtaattgttcttcga ggcatagaactttagtttggaaaaagataatagatgaagatgaacctcttattgttattg ggacaaggtccgcagtattccttcctatacagaatttaggcttaataattatggatgaag aacatgacgtttcatataagcaagacagcccaatgccttgttacgatgcgagggatgtcg ctcttgaaagagtaaaaagaaatccagcaaagctaatttttggaagtgcaactccatcaa tgacaacttggaaaagagttgtttttgaaaaaaagtttaagatgctgagaatgaaagaaa gaatatctcgtactgaaataccggaaatcaaagttgttgatatgcgttgtgaatttaaaa agggtaatacaaaaatcttttgtggcgaattattagaattaatttctcagcttaaagaga atcaggaacaagcaatagttttgattcctagaagggggtataacggttttctaagctgta gaaattgtggatttattataaattgccctaattgtgatgtacctttatctgttcatgcag gctcaaaaggtaaaaagtggcttagctgtcactggtgtgatcataaagcaaaagttatca atacttgtccagattgtgaatcaaaggcctttaagccttttggtattggtactcaaaggg ttattgaattcttgaataatgaatttcctgaactgaggttacttcgttttgatagagata ccacctcaggcaaagatggtcatagaaatattctttcaaagttttctaatggaaatgcag atatccttgtagggacccaaatgttagcgaaaggtattgatattcctaatgttactcttt ctgtggttattgccgcagatggattacttcatcgcccagatatttcagctgaagaaaaat cattacaattatttctacaattagccggcagagcaggtagagctaaaaaatcaggaaagg ttatctttcaaacgtataaaccaagtcatcctgtgctttcctatctcaaaaatagaaatt acgagggatttttacatgaaagctctaaattaagaaaagatgcaaaactttttccttttt gtaaagtatgccttttaaagatttctgggaaaaacttcgaacttactgaaataactgcga ccaagctagcgaaatatatgataagtttttgtaaagataataagtggacagtaattggtc ctgctccaagtttaattgcaaaggttggtaataaatttaggtggcaaatattaatacatg gcccagagaattcggaattccctcttcctgataggtctgatctttggcaaaaaattccaa aaaatgtgtttttatcaattgatctgaatccagtagagttatagctaattagatggaagt

CHAPTER OUTLINE pairs in their genome. In comparison, an oak tree’s genome has 750 million base pairs, whereas the human genome is twice as large, with approximately 3 billion base pairs. With a genome only the size of Prochlorococcus, it would still be possible to make 41,600,000 = 10960,000 different sequences of DNA. As a result, even the information stored in the DNA of one of the smallest microbes is sufficient to produce a universe of genetic possibilities and can account for the abundant diversity we see in living things. This chapter will review DNA structure and function, highlight microbial gene expression, explore the latest DNA-based biotechnologies, and explain how genomics can serve as a powerful tool for everything from cancer diagnosis to analysis of evolutionary relationships.

8.1 DNA as the Genetic Material  212 • DNA Structure and Functions • DNA Replication in Bacteria 8.2 From DNA to Protein  215 • Transcription • Translation 8.3 Sources of Genetic Variation  219 • Mutation • Recombination • Transposition ■ Case Study: The Spread of a Drug-resistance Gene 8.4 Regulation of Gene Expression  225 • Transcriptional Control • Pre- and Posttranscriptional Control 8.5 Recombinant DNA Technology  228 • Recombinant DNA Tools and Gene Cloning ■ The Microbiologist’s Toolbox: Gel Electrophoresis • Applications of Recombinant DNA Technology ■ What a Microbiologist Sees: Manipulating the Bacterial Genome for Agricultural Benefits • Ethical and Safety Concerns 8.6 Genomics 234 • DNA Sequencing • Genomic Analysis • Applications of Genomics ■ Clinical Application: Screening for Genetic Diseases—BRCA1 Mutation

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 212 ❑ p. 215 ❑ p. 219 ❑ p. 225 ❑ p. 228 ❑ p. 234 ❑ ❑ Read the text and study all figures and visuals.

Answer any questions.

N. Watson and L. Thompson, MIT

Analyze key features

❑ Microbiology InSight, p. 212 ❑ Process Diagram p. 214 ❑ p. 218 ❑ p. 221 ❑ p. 222 ❑ p. 231 ❑ ❑ Case Study, p. 224 ❑ The Microbiologist’s Toolbox, p. 229 ❑ What a Microbiologist Sees, p. 232 ❑ Clinical Application, p. 236 ❑ Stop: Answer the Concept Checks before you go on. p. 215 ❑ p. 219 ❑ p. 224 ❑ p. 226 ❑ p. 233 ❑ p. 236 ❑ End of chapter

❑ ❑ ❑ ❑

Review the Summary and Key Terms. Answer the Critical and Creative Thinking Questions. Answer What is happening in this picture? Complete the Self-Test and check your answers.

 

211

Microbiology InSight

DNA as the Genetic Material 8. 1

The structure of DNA is ideally suited to store genetic information, transfer it from one generation to the next, and convert it into RNA and proteins.

LEARNING OBJECTIVES 1. Describe the structure and functions of DNA. 2. Outline the steps in DNA replication, including the enzymes involved. enetic material has three fundamental functions: 1) store information for the biochemical and structural components of the organism; 2) replicate so that the information can be passed from one generation to the next; and 3) generate genetic variation to provide the diversity that allows a population to survive environmental change.

G

a. DNA replication With enzyme assistance, the DNA double helix unwinds and the strands separate. The exposed nucleotide bases of each strand serve as templates for the synthesis of new, complementary strands. Chromosomal DNA Transcription

Replication

DNA template strand

DNA Structure and Functions DNA molecules are made up of two strands of nucleotides twisted together into a spiral, or double helix. The strands are held together by base pairs, the formation of hydrogen bonds between the four nitrogen-containing bases found in the nucleotides of DNA. This base pairing is said to be complementary because adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The genetic information is stored in the sequence of the bases in the DNA strands. This hereditary information is copied into RNA and then used in protein synthesis. Table 8.1 compares the features of DNA and RNA.

Newly synthesized strands of DNA

All the genetic information an organism contains is its genome. Discrete regions of the genome that are used in the synthesis of RNA and possibly proteins are called genes. The genes are the units of heredity that

A comparison of DNA and RNA  Table 8.1 Feature

DNA

RNA

Nitrogenous bases

Adenine, guanine, cytosine, thymine

Adenine, guanine, cytosine, uracil

Pentose sugar

Deoxyribose

Ribose

Number of strands

2

1

Functions

Self-replication Genetic material of all organisms Genetic material of some viruses

Protein synthesis Genetic material of some viruses Comprises viroids

Basic structure C G A CC U G CC A T C A G C G AC T C A GC A A GG T CG G C T GG A C GGU A G T C G C TA T T DNA

DNA

RNA

Two strands twisted to form a double helix, which is held together by base pairing

C U G C A G A C G U RNA Single-stranded but can also form double-stranded regions resulting from regions of base pairing

DNA and information transfer  b. RNA transcription Transcription converts the hereditary information from a DNA code to an equivalent RNA code. Using complementary base pairing, the genetic information in DNA is copied into RNA, which passes from the nucleus to the cytoplasm. 5´

A U G G C G U U G U U U A U G G

c. Protein synthesis At the ribosome, the genetic information encoded in the RNA is used to synthesize protein, the ultimate product of a gene. Ribosome mRNA

RNA polymerase C

C

RNA AAA

E

5´

DNA template strand

P

A

Translation

TT

Polypeptide chain

C

C

TA

C G G C C G

TA

G A GC C U

CC G G

G T C T A A

Ala

G GCC T

T

5´

G T A AC T

3´

✓ The Planner

•  Figure 8.1

f-Met

Ala

Leu

Phe

Met

Anticodon

Locally unwound segment of DNA

Aminoacyl-tRNA Amino acids

A sk Yo u rs e l f The molecule that contains the information needed to translate a nucleic acid sequence into an amino acid sequence is ______.

f-Met

Ala Phe Ala

Ala

Ala f-Met

Leu

are passed from parents to offspring. Most genes are lofor the production of a new strand (Figure 8.1a). This cated on chromosomes, threadlike structures of DNA that means that once DNA has been replicated, a genome is contain the hereditary information that is passed to the available for both daughter cells generated during cell next generation. In eukaryotes, these are linear structures division, allowing genetic information to be passed to the with associated proteins, whereas in prokaryotes, the nunext generation. cleoid contains the circular bacterial chromosome. Some The second way DNA can transfer information is bacteria possess small, self-replicating rings of DNA called through information flow from DNA to RNA to protein. Information transfer during DNA replication and plasmids, which bear accessory genes that code for featranscription is straightforward in that a single nucleotures including antibiotic resistance. tide in DNA codes for a single nucleotide The genetic makeup of an organism is its messenger RNA in a DNA or RNA strand. In transcription genotype. The observable characteristics that (mRNA) An RNA result from the genotype are the phenotype, (Figure 8.1b), the hereditary information in or the expression of the information encoded molecule whose DNA is copied into messenger RNA (mRNA). nucleotide sequence in the DNA. Gene expression is the conversion During translation (Figure 8.1c), the infordetermines the amino of information in the sequence of nucleotides mation in mRNA is used to make protein, and acid sequence of a contained in DNA into a specific nucleotide the molecular language changes from a nuprotein. sequence in an RNA molecule or an amino cleotide sequence to an amino acid sequence. acid sequence in a protein. Each gene consists codon A set of three The nucleotide sequence of RNA is read in of a different order and number of base pairs. consecutive nucleosets of three nucleotides, or codons, which tides that either speciNot all the DNA contained in the genome is designate specific amino acids to be incorpofies a particular amino expressed. rated into a forming protein. The amino acid DNA structure allows information transfer acid to be added to sequence of a protein determines its overall in two ways. First, because of complementary a forming protein or structure and function. Many proteins funcbase pairing, when a DNA molecule is un- acts as a stop signal tion as enzymes to control the metabolism of zipped, each strand can serve as a template for protein synthesis. the cell. DNA as the Genetic Material  213

DNA Replication in Bacteria

Process Diagram

DNA replication of the circular bacterial chromosome begins at one site called the origin site where the DNA helix separates at the replication fork. During DNA synthesis, replication proceeds in both directions as the replication forks rapidly migrate around the chromosome in opposite directions. The two replication forks will meet and synthesis will stop at the termination site. Through this process, the original parent chromosome becomes two daughter chromosomes. DNA replication is known as a semiconservative replication process because the newly synthesized DNA molecules consist of one old strand and one new strand. Speed is a key property of bacterial replication, along with accuracy. The high speed is necessary to complete replication of the bacterial chromosome and coordinate it with cell division. About 1000 nucleotides are incorporated per second, so it takes about 40 minutes to completely replicate a typical bacterial chromosome. The bacterium Escherichia coli enhances its growth rate by beginning a second round of DNA replication before completing the first. In this way, the genome received by a daughter cell is already partially copied so the division process continues rapidly. As a result, under optimal conditions, an E. coli bacterial cell can divide every 20 minutes. Eukaryote genomes are much larger than a typical bacterial genome and the replication machinery is slower (approximately 50 nucleotides/ second). However, the eukaryote genome can replicate in several hours because DNA synthesis begins at thousands of sites simultaneously. These basic differences in replication processes and the structure of the enzymes make it possible

DNA replication enzymes in E. coli  Table 8.2 Enzyme

Function

DNA helicase

Unwinds double-stranded DNA

DNA gyrase

Removes supercoils as DNA strands unwind

Single-stranded binding protein

Binds to the DNA single strands and prevents them from reattaching

Primase

Synthesizes RNA primer

DNA polymerase III

Polymerizes nucleotides to synthesize DNA; DNA proofreading

DNA polymerase I

Removes RNA primers and replaces them with nucleotides

DNA ligase

Links Okazaki fragments together

to target bacterial replication machinery with antimicrobial agents without harming eukaryotic DNA synthesis. The enzymes needed to replicate DNA fall into two basic categories. One group is the unwinding enzymes responsible for separating the parent strands; the other group is the enzymes that link nucleotides together to form the newly synthesized strands (Table 8.2). Figure 8.2 gives a more detailed picture of the role of the different enzymes involved in DNA replication. The DNA replication process described here is that of E. coli, a bacterium whose molecular biology has been well characterized, but the same basic process is found in most microorganisms.

✓ The Planner

DNA replication • Figure 8.2 DNA helicase and DNA gyrase unwind the DNA strands while DNA polymerases and DNA ligase link nucleotides together to form new DNA.

3 Primase synthesizes a short RNA primer onto the single-stranded DNA.

5´ Lagging strand

5´ DNA helicase 1 DNA helicase unwinds the strands of the DNA.

The enzyme that joins DNA fragments together on the lagging strand is ____.

DNA polymerase I

Primase 3´

A sk Yo u rs e l f

5 On the lagging strand, DNA polymerase I removes the RNA primers and replaces them with DNA.

Single-stranded binding protein

RNA primer Movement of replication fork Leading strand 3´

3´ DNA ligase 6 The DNA fragments on the lagging strand are joined by DNA ligase to make one complete DNA strand. Primase 5´ 3´

DNA polymerase III

2 Single-stranded binding protein attaches to the DNA, preventing it from reattaching to the other parent strand.

214  CHAPTER 8  Microbial Genetics and Genetic Engineering

4 DNA polymerase III synthesizes the new DNA using the nucleotide code in the template strand.

growing chain. Because the two strands are oriented in opposite directions, this results in one strand of DNA (the leading strand) being synthesized continuously and the other strand (the lagging strand) having to be synthesized in pieces, called Okazaki fragments, that are later linked back together. On the lagging strand, DNA polymerase I removes the RNA primers and replaces them with DNA. The resulting segments of DNA are known as Okazaki fragments. These fragments are then linked together by the enzyme ligase to form the new DNA strand (steps 5 and 6).

DNA replication begins when DNA helicase breaks hydrogen bonds to separate the DNA helix and unwinds the strands to expose the template strand for DNA synthesis at the replication fork (Figure 8.2 step 1). DNA gyrase removes extra twists, or supercoils, ahead of the replication fork. As the strands are separated, single-stranded binding proteins bind to the separated strands of DNA to prevent them from reattaching to each other (step 2). As a new template is exposed, new nucleotides are added following the base-pairing rules. The polymerases that link the nucleotides together cannot initiate DNA synthesis using a single-stranded DNA template. Therefore, primase synthesizes a short RNA primer onto the single-stranded DNA that forms a short double-stranded region with the template DNA (step 3). Next, DNA polymerase III joins nucleotides to the RNA primer following the code in the template (step 4). Polymerases can only incorporate nucleotides in the 5-to3′ direction; that is, the new nucleotide bonds to the 3′ OH group of the deoxyribose of the last nucleotide in the

8 .2

1. How does an organism’s phenotype differ from its genotype? 2. Why is DNA on the lagging strand synthesized in segments?

From DNA to Protein

LEARNING OBJECTIVES information is copied into RNA, which is then used to determine the sequence of amino acids in a protein.

1. Explain how the genetic information encoded in DNA is copied into RNA by transcription. 2. Describe translation, including the initiation, elongation, and termination steps in protein synthesis.

T

Transcription The information coded in the nucleotide sequence of DNA is copied into RNA through the process of transcription. The portion of a gene that is the template for the RNA is flanked by promoter and terminator sequences (Figure 8.3). The promoter regions serve as binding

he genetic information in an organism’s DNA is used in the synthesis of proteins. The information for protein synthesis is coded in the nucleotide sequence of the DNA. This P

Transcription • Figure 8.3

KEY

RNA polymerase binds to the promoter sequence on the DNA and copies the template strand. Transcription stops at the terminator site.

DNA coding strand 5´

3´

3´

5´

RNA polymerase DNA coding strand

A sk Yo u rs e l f In the process of transcription, adenine on the DNA strand bonds with ______.

T

Regulatory protein-binding site Promoter/terminator sequence Gene sequence DNA

DNA template strand

5´

DNA template strand 3´

AGT CCG T T A AGACC T T A A ·· ··· ·· ··· ··· ··· ·· ·· ·· ·· ··· ·· ··· ··· ·· ·· ·· ·· T CAGGC A A T T C TGGA A T T

Transcription mRNA

5´ AGUCCGUUA AGACCUUA A

From DNA to Protein  215

sites for enzyme factors that bind the RNA polymerase complex to the DNA, separate the strands of DNA, and select the template strand. The DNA strand not used as the template for RNA synthesis is called the coding strand because it has the same sequence as the RNA strand that will be synthesized. The terminator contains sequences that bind factors to stop the transcription process and dissociate the polymerase complex. In addition to mRNA, the other transfer RNA major types of RNA are transfer (tRNA) Small RNA RNA (tRNA) and ribosomal RNA molecules that link to (rRNA) (Table 8.3). Other signifia specific amino acid cant RNAs (microRNAs, small in the cytoplasm and nuclear RNAs, and interference attach it to the formRNAs) have important functions ing polypeptide chain in RNA processing in eukaryotes at the ribosome. and in gene regulation. Bacterial mRNAs vary in size ribosomal RNA but average about 1000 nucleo(rRNA) RNA that tides in length and code for profunctions as a structural component of teins that average 300 amino acids the ribosome and in in size. One basic difference beprotein synthesis. tween the structure of mRNA of bacteria and eukaryotes is that in eukaryotes the RNA transcript is normally longer and is heavily modified. Before a eukaryotic mRNA is transported out of the nucleus and coded into a protein, it is processed by chemically modifying the 5′ end (capping), removing large sections from the middle of the RNA and linking the pieces back together (splicing), and often by adding hundreds of adenosine residues to the 3′ end (poly (A) tail addition). Transfer RNAs are small relative to mRNAs and rRNAs. They range from approximately 70 to

Types of RNA  Table 8.3 Name

Function(s)

Messenger RNA (mRNA)

Coding molecules translated into proteins

Transfer RNA (tRNA)

Involved in translation; charged with amino acids

Ribosomal RNA (rRNA)

Structural components of ribosomes

MicroRNA (miRNA)

Various regulatory functions

approximately 100 nucleotides in length. Although the exact sequence of nucleotides is different among the different types of tRNA, the basic structures of all tRNAs are similar, even between different species of organisms (Figure 8.4). One end of a tRNA molecule carries a specific amino acid. The other end has a sequence of three nucleotides, the anticodon, which pairs with a specific codon on the mRNA. The amino acid attached to the tRNA becomes part of the forming polypeptide chain, and the tRNA is released to pick up another amino acid. Transfer RNAs are the links between the nucleic acid code of the mRNA codons and the amino acid sequence of a protein. Attaching an amino acid to the tRNA requires an aminoacyl-tRNA synthetase molecule that recognizes unique features on each kind of tRNA, thereby ensuring that the correct amino acid is attached to the tRNA. The process is highly specific and requires energy in the form of adenosine triphosphate (ATP).

Transfer RNA structure • Figure 8.4

5´

All tRNAs have the same basic L shape, with the amino acid attachment site at the 3′ end. The other end of the molecule has an RNA loop that contains the anticodon.

Hydrogen-bonded base pairs 3´ Amino acid attachment site

Ribose-phosphate backbone

A sk Yo u rs e l f The anticodon of tRNA interacts with the ______. a. codon on mRNA b. ATP for reaction energetics c. backbone on rRNA d. amino acid

Anticodon loop

216  CHAPTER 8  Microbial Genetics and Genetic Engineering

Anticodon

The genetic code • Figure 8.5 Each codon in mRNA specifies either the incorporation of a particular amino acid into the forming polypeptide chain or termination of the chain. The one-letter symbols for the amino acids are given in parentheses after the standard three-letter abbreviations. Second letter C UAU

UCU

UUU

A

First (5´) letter

UGC

C

Ser (S) UCA

UAA

UUG

UCG

UAG

CUU

CCU

CAU

UUA

C

Cys (C)

UAC

UCC

UUC

U

UGU

Tyr (Y)

Phe (F) U

G

Leu (L)

Leu (L)

His (H)

Pro (P)

UGA UGG

CAA

CCA

CUG

CCG

CAG

AUU

ACU

AAU

Gln (Q)

Ile (I)

ACC ACA

AUA

Thr (T)

Met (M) (initiator)

GUU

CGG

G

AGU AGC

AAA

AGA

AAG

GCU

GAU

C Arg (R)

A

AGG

G

GGU

U

Asp (D) GGC

GAC

Gly (G)

Ala (A)

Val (V)

U Ser (S)

AAC

ACG

GCC

GUC G

C A

Lys (K) AUG

G

CGA

Asn (N) AUC

A

U

CGU

Arg (R)

CUA

A

Stop (terminator) Trp (W)

CGC

CAC

CCC

CUC

Stop (terminator) Stop (terminator)

Third (3´) letter

U

GUA

GCA

GAA

GUG

GCG

GAG

C

GGA

A

GGG

G

Glu (E)

Th in k Cr it ica lly Given that there are 61 different codons that code for amino acids (Figure 8.5), you might expect there to be 61 different types of tRNAs. However, the anticodons on the tRNAs do not always form traditional base pairs with the codon. The third base pair in the codon-anticodon interaction can wobble around, allowing certain nucleotides to form multiple base pairs. As a result, only 32 tRNAs are required to pair with all 61 amino acid coding codons. However, most organisms typically have approximately 50 different kinds of tRNAs.

Translation Translation is the process by which information in the nucleotide sequence of mRNA is translated into the order of amino acids in a new protein molecule. Information flow from RNA to protein is necessarily more complex than from DNA to RNA. There are only four different nucleotides in an RNA polymer, whereas there can be 20 different amino acids in a polypeptide chain. As a result, the

= Polypeptide chain initiation codon = Polypeptide chain termination codon

Why do all proteins start with the same amino acid?

sequence of nucleotides in mRNA is read in sets of three codons. There are 64 (43) different codons (Figure 8.5). As a result, the genetic code is redundant, meaning that in most cases there is more than one codon for an amino acid. Among the 64 codons are codons that start translation (AUG) and stop translation (UAA, UAG, or UGA). The ribosomes coordinate the translation process and catalyze the necessary chemical reactions to link the amino acids together (see Remember This!). For all living organisms, protein synthesis can be divided into three stages: initiation, elongation, and termination. The basic process for each step is similar for Bacteria, Archaea, and Eukarya. Bacterial protein synthesis is described here because understanding bacterial protein synthesis is important for understanding how many antibiotics and antibacterial agents function. Remember This!  For a thorough review of the 70S ribosome structure, examine Section 4.5 and study Figure 4.10.

From DNA to Protein  217

Process Diagram

✓ The Planner

Translation • Figure 8.6

Codon-anticodon matching occurs at the A site and the growing amino acid chain is enzymatically transferred from the tRNA in the P site. The mRNA is then advanced one codon, moving the empty tRNA to the E site, the tRNA with the peptide chain to the P site, and opening the A site. The process repeats as a new complementary tRNA binds to the codon in the A site.

E

5´

P

A

3´

Ala

KEY

f-Met

A E

5´

P

A

Ala

Ser

P

A

U

G

C

3´

1 Aminoacyl-tRNA selection An aminoacyl-tRNA is selected to bind to an empty A site based on a complementary codon-anticodon interaction.

3´

2 Peptide transfer The peptide on the tRNA in the P site is transferred to the amino acid on the aminoacyl-tRNA in the A site.

3´

3 Translocation The mRNA moves in the 5´ to 3´ direction to the next codon. All tRNAs move to the next site. The tRNA in the E site dissociates from the ribosome.

f-Met

Ser

E

5´

Ala

Ser

f-Met

E

5´

Ala

P

A

Ser

f-Met

A sk Yo u rs e l f The binding of an aminoacyl-tRNA during the elongation cycle of protein begins at the ribosome _____ site.

218  CHAPTER 8  Microbial Genetics and Genetic Engineering

During the initiation of protein synthesis, the 30S ribosomal subunit binds with the mRNA and a unique tRNA that carries a methionine amino acid attached to it. This specialized tRNA is used only to begin protein synthesis. AUG is the codon that signals the start of protein synthesis and it codes for the amino acid methionine. Consequently, proteins normally begin with methionine. The AUG start codon is appropriately located on the ribosome by interactions between the 5′ end of the mRNA and the 16S rRNA that is a structural part of the 30S subunit. The 30S ribosome subunit, the mRNA, and the special initiator tRNA complex then bind with the 50S ribosome to form the 70S ribosome, which is ready to begin the elongation stage of protein synthesis. The 70S ribosomes have several important functional sites (Figure 8.6). The A site is where an aminoacyl-tRNA (tRNA with an amino acid bound to it) binds to the ribosome. It can be considered the site where the accuracy of protein synthesis is determined (A site for aminoacyl-tRNA and accuracy). The P site on the ribosome is the site where peptidyl–tRNA (tRNA with a peptide linked to it) is parked before it transfers its peptide to the aminoacyl-tRNA (P site for peptidyl–tRNA parking site). There is also an E site on the ribosome. The E site is where an unacylated tRNA (empty tRNA or a tRNA without an amino acid attached) exits the ribosome. During elongation, the aminoacyl-tRNA with a complementary anticodon is selected at the A site (Figure 8.6 step 1). The peptide is then transferred to make a peptidyl– tRNA with a peptide that is one amino acid longer (step 2). The final step of the elongation cycle is translocation. In this step, the mRNA slides through the ribosome so that the codons are moved one step in the 5′ direction. As a result, the peptidyl–tRNA is translocated to the P site and a new codon is moved into an open A site that is now ready to receive the next aminoacyl-tRNA. During this process, an unacylated tRNA is also dissociated from the ribosome (step 3). This opens up the A site and the process repeats for each new codon that enters the A site. Termination of protein synthesis occurs when a stop codon enters the A site. There is

no aminoacyl-tRNA with a complementary anticodon to a stop codon; however, a release factor binds to the A site and initiates the process of termination. The protein that was being synthesized is released from the peptidyl– tRNA in the P site. It is now able to carry out its cellular function. The ribosome, mRNA, and tRNA molecules are separated and then recycled to synthesize a new protein. Compared with DNA synthesis, protein synthesis is a slow process, with only 5 to 20 amino acids being linked together per second. However, the rate of protein production can be increased by polyribosomal complexes,

8 .3

where a single mRNA is translated by multiple ribosomes at the same time.

1. How does RNA polymerase recognize the beginning and end of a gene? 2. Why do aminoacyl-tRNAs only bind to one site on the ribosome?

Sources of Genetic Variation

LEARNING OBJECTIVES approximately 10−9 errors per base pair incorporated; that is, the replication machinery produces an error about once in every 1 billion base pairs synthesized. The range varies significantly depending on the DNA sequence. The high accuracy of the replication complex is due to its ability to accurately select the complementary nucleotide for incorporation into the growing DNA chain combined with the proofreading activity of DNA polymerase III, which reevaluates each nucleotide after involution is the process that produces change corporation. If evaluated as a mismatch, the nucleotide is in the inherited traits in populations of livremoved and a new nucleotide is incorporated. Additioning things. For evolution to occur, there ally, cells have a number of repair systems specifically for must be genetic diversity within a populathe purpose of identifying errors or damage in DNA and tion. Genetic diversity can be produced by repairing them. Consequently, the DNA passed from one mutation or recombination. generation to the next is an accurate copy of the original except for rare, unrepaired mutations. Mutation In addition to spontaneous mutations, mutations can be induced by chemical mutagens or by radiation, Mutation is the only source of new genetic material. both of which can be used to kill microbes. Spontaneous mutations are rare errors that Chemical mutagens (Table 8.4) either alter occur spontaneously during replication of a mutation A change the structure of purines or pyrimidines so that microbe’s genetic information. They are in- in the nucleotide they no longer pair with their normal compleevitable because the DNA replication process is sequence of the mentary base, or they add a functional group not perfect. The accuracy of DNA replication is genetic material.

1. Describe three different types of mutations. 2. Construct a table that lists three different methods and mechanisms for horizontal gene transfer in bacteria. 3. Explain how transposons produce genetic variation.

E

Selected chemical mutagens  Table 8.4 Class

Source

Polyaromatic hydrocarbons

Carbon-containing fuels; cigarette smoke; meat cooked at high temperatures

Aromatic amines

Pesticides on foods, tobacco smoke and diesel engine exhaust, and potential workplace exposures in rubber, textile, and dye industries

Nitrosamines/nitrosamides

By-products of the manufacture of some cosmetics, pesticides, and most rubber products

Alkylating agents

Anticancer drugs and chemical weapons, such as mustard gas

Chlorinated hydrocarbons

Dioxins, produced when organic matter is burned in the presence of chlorine; some insecticides, such as DDT

Formaldehyde

Embalming fluids and volatile gases from paints, floor finishes, and cigarette smoke

Sources of Genetic Variation  219

to the nucleotide that distorts its structure, causing errors during replication or repair. Radiation can damage DNA by creating reactive ions that chemically alter nucleotides. Reactive ions are produced by ionizing radiation caused by gamma rays or by alpha or beta particles released during radioactive decay. Nonionizing radiation, such as ultraviolet (UV) light, also causes mutations. UV light causes thymine dimers to form in the DNA, which can lead to mutations if not correctly repaired (Figure 8.7). Mutations can be categorized based on the numbers of base pairs affected and the potential severity of the mutations on the protein coded for by the gene. Point mutations involve the substitution, addition, or deletion

of a single base. Their effect can vary from no change to loss of function of the protein. A point mutation can be: 1) a silent mutation, which has no effect on protein structure; 2) a missense mutation, which changes one amino acid in the protein produced; 3) a nonsense mutation, which changes a codon for an amino acid to a termination codon; or 4) a frameshift mutation, where the addition or deletion of a base pair causes the reading frame in the mRNA to shift so that all amino acids coded downstream from the mutation are altered. Chromosomal mutations, which occur when a large segment of DNA is altered, have more serious effects than point mutations because they can affect the expression of many genes.

Repair of mutations induced by ultraviolet light • Figure 8.7 Thymine dimers are induced between adjacent thymine residues by UV light.

a. Photolyase activity Photolyase repairs DNA directly by breaking bonds to remove thymine dimers. 5´

3´ TGCC T T AGA T ·· ··· ··· ··· ·· ·· ·· ··· ·· ·· ACGGAA T C T A

5´

3´

5´

Thymine dimer 5´

b. Nucleotide excision repair This multistep repair process uses an endonuclease to cut the DNA backbone near the thymine dimer, then removes the affected bases as well as those immediately flanking the damaged area. Following complementary base pairing, DNA polymerase I joins nucleotides together to fill in the gap and DNA ligase connects the repaired piece of DNA to the original strand. 3´ TGCC T T AGA T ·· ··· ··· ··· ·· ·· ·· ··· ·· ·· ACGGAA T C T A

UV light T=T

3´

3´

5´

TGCC AGA T ·· ··· ··· ··· ·· ··· ·· ·· ACGGAA T C T A

3´

UV light

5´ 5´

5´

T=T TGCC AGA T ·· ··· ··· ··· ·· ··· ·· ·· ACGGAA T C T A

3´

5´

3´

5´

T

G

C

3´

3´

3´

A

5´

G

T T ·· ·· ACGGAA T C T A

5´

TGCC T T AGA T ·· ··· ··· ··· ·· ·· ·· ··· ·· ·· ACGGAA T C T A

3´

5´

KEY

5´

Endonuclease

3´ TGCC T T AGA T ·· ··· ··· ··· ·· ·· ·· ··· ·· ·· ACGGAA T C T A

Photolyase 3´

5´

DNA polymerase I 5´ DNA ligase

T h in k Cri ti c a l l y

Which process requires more cellular energy, photolyase repair or nucleotide excision repair? Why?

3´ TGCC T T AGA T ·· ··· ··· ··· ·· ·· ·· ··· ·· ·· ACGGAA T C T A

3´

T A T= C

5´

C

A

G

3´

3´

T=T TGCC AGA T ·· ··· ··· ··· ·· ··· ·· ·· ACGGAA T C T A

5´

A compound’s mutagenic potential is determined by incubating a strain of histidine-requiring Salmonella with the test chemical. 1 Enzymes are isolated from rat liver.

2 A solution of the potential mutagen is prepared.

3 Salmonella histidine-requiring mutants are grown.

7 The bacteria are spread on the agar medium containing a trace of histidine.

4 The enzymes and the potential mutagen are mixed.

5 The enzymes and bacteria are mixed.

Filter paper disk

6 The bacteria and enzymes are spread on agar medium containing a trace of histidine.

8 The disk with the enzymes and the potential mutagen is placed in the experimental plate.

Control plate

Experimental plate

9 The plates are incubated at 37°C.

Spontaneous his+ reversion mutants

10 Compare the number of colonies on the control plate relative to the test plate to evaluate whether the test chemical causes mutations.

Filter paper soaked in potential mutagen

His+ reversion mutants induced by the mutagen

Th in k Cr it ica lly

Why is it necessary to count the colonies present on the control plate?

A standard biological assay, the Ames test, has been developed to assess the mutagenic potential of various chemical compounds. The Ames test can detect most carcinogens by their mutagenic properties (Figure  8.8). The test is often used as one of the initial screens in the development of drugs to eliminate potential carcinogens. It uses strains of the bacterium Salmonella typhimurium that require histidine for growth

because of mutations in genes for histidine synthesis. The histidine-requiring strains have either frameshift or missense mutations so mutagens that act by using different mechanisms can be identified. The method tests the capability of a mutagen to produce reversion mutations (or back mutations), which cause reversion to the original phenotype so that the cells can again grow without the addition of histidine. Sources of Genetic Variation  221

Process Diagram

✓ The Planner

The Ames test • Figure 8.8

Recombination Recombination occurs when genetic material from two different sources is combined. This occurs routinely in sexually reproducing organisms when the genetic material from the two parents combines during fertilization to form the zygote. Bacteria don’t reproduce sexually, but the acquisition of genetic material from other organisms does occur, a process known as horizontal gene transfer. New genetic material introduced into the bacterial cell is incorporated into the cell’s genome. There are three methods for horizontal gene transfer in bacteria: transformation, conjugation, and transduction (Figure 8.9). 1. Transformation occurs when transformation a bacterium acquires DNA The uptake and from its environment and inincorporation of DNA corporates it into its genome from the environment (Figure 8.9a). Bacteria that into the DNA of a can take in DNA from the enbacterium. vironment and incorporate it into their genome are said to be competent. Transformation is a common way for Staphylococcus aureus, a pathogen that causes boils and abscesses, to acquire genes from other microbes. 2. Conjugation occurs between conjugation The bacteria of the same species temporary joining or closely related species. It together of two requires formation of a sex pibacterial cells to copy lus, which physically connects DNA from the donor the cells. Genes that code for cell to the recipient a sex pilus are carried on a cell. plasmid, the fertility factor, or F plasmid. Copied genetic information can be transmitted through the connection from the donor cell to the attached recipient (Figure 8.9b). Conjugation is the most frequent method for horizontal gene transfer and commonly occurs among gram-negative bacteria, especially in the gastrointestinal tract. 3. During transduction, a bactransduction The terium acquires DNA from transfer of DNA from another bacterium via a bacteone bacterium to riophage. Generalized transducanother by a bactetion carries random segments riophage. of the host chromosome (Figure 8.9c), whereas specialized transduction carries only specific portions of the host chromosome from the region where viral DNA routinely inserts into the bacterial genome. Generalized transduction is rarely involved in moving genes between bacteria naturally; however, it is often used in the laboratory to create strains of bacteria with desired characteristics. In the natural world, bacteriophages do, however, leave DNA sequences behind that enhance movement of chromosomal gene sequences onto plasmids.

Horizontal gene transfer mechanisms in bacteria • Figure 8.9 Horizontal gene transfer in bacteria occurs when DNA from one organism is acquired by another organism and recombined into the new host’s genetic material.

a. Transformation A competent bacterial cell, one expressing a DNA receptor and specialized proteins to transport the DNA across the membrane on its surface, binds a piece of DNA in the environment, transports it inside the cell and incorporates the new genetic material into its genome. a+

Competent bacterium

DNA from donor cell

a– Receptor protein

Recipient chromosome

1 DNA from the donor cell binds to DNA receptor proteins on the recipient cell.

a+

a–

2 Introduced DNA is integrated into the chromosome by recombination.

a–

a+

Replaced recipient strand will be digested. Transformed bacterium

A sk Yo u r se lf

222  CHAPTER 8  Microbial Genetics and Genetic Engineering

List the processes that can play a role in the spread of a favorable genetic mutation from one bacterium to another.

b. Conjugation The formation of a sex pilus between adjacent bacterial cells permits transfer of chromosomal or plasmid DNA between them. F+ donor cell

c. Transduction During the replication cycle of bacteriophages, host DNA may be excised along with the viral genome and packaged into a newly formed virion. This DNA is transferred to the genome of a second bacterial host during a second phage infection.

F– recipient cell

Sex pilus

Bacteriophage

F factor

Donor chromosome

Bacterium Bacterial DNA 1 The bacterium is infected with phage DNA.

Recipient chromosome 1 Sex pili pull the cells together, a mating bridge is formed.

Origin site

Replication

Mating bridge provides channel between cells.

2 One strand of the F plasmid is transferred into the recipient, and replication occurs in both the donor and recipient cells, forming double-stranded DNA molecules.

Phage DNA 2 Phage enzymes fragment the host genome, and the phage replicates.

3 Phage DNA is packaged. Host cell DNA may be erroneously packaged.

4 Cell lysis occurs, releasing mature phages. Replication 3 Completion of F plasmid transfer results in two F+ bacteria.

Sex pilus

F+ cell

F+ cell

Sex pilus

4 Any other genes that are carried on the F plasmid, such as antibiotic resistance genes, are also transferred.

5 When a phage containing the previous host’s DNA infects a new host, it inserts that bacterial DNA into the recipient cell.

6 DNA from the first bacterial cell is recombined into the chromosome of the new host cell.

Sources of Genetic Variation  223

Process Diagram

✓ The Planner

Case Study

✓ The Planner

The Spread of a Drug-resistance Gene A Rhode Island resident (patient 1) travelled to Cambodia, where she was diagnosed with spinal cord compression and was hospitalized from December 20 to 30. She had an indwelling catheter placed during her medical care and was given multiple antibiotics. On January 6, she returned to Rhode Island and was hospitalized for lymphoma. She underwent chemotherapy and required prolonged bladder catheterization and was given more than 20 different antibiotics during her treatment. On March  4, a urine culture grew carbapenemase-producing Klebsiella pneumoniae containing the New Delhi metallo-betalactamase (NDM) gene.

a. A plasmid showing the NDM gene and clusters of drugresistance genes

NDM-carrying plasmid

The drug-resistance gene NDM was first reported in a patient who had been hospitalized in New Delhi, India, in 2007. Resistant bacteria carrying NDM are of particular concern because NDM resistance genes are usually encoded on plasmids that harbor multiple resistance gene clusters and are transmitted easily to other genera of bacteria (Figure a).

KEY Antibiotic resistance gene and direction of transcription New Delhi metallo-beta-lactamase gene Location of an insertion sequence Plasmid DNA Regions of DNA inserted into plasmid

Transposition A transposon is a segment of DNA that is capable of independently replicating itself and inserting the copy into a new position within the same chromosome or another chromosome or plasmid. Transposons contain genetic sequences known as insertion sequences that are essential for transposon movement. Transposition is caused by the movement of a transposon from one genetic location to another in a cell. Transposition of a transposon combines both recombination and mutation. Transposition is a recombination event in that genetic information is being recombined into a new site. If a transposon moves from the chromosome to a plasmid, it can then be more easily transferred to other cells during conjugation. Transposition can also cause mutation if a transposon inserts into a new site that disrupts a gene, causing its inactivation.

Center for Disease Control and Prevention

1. How does antibiotic therapy reveal the presence of drugresistant bacteria?

Transposons often carry one or more antibiotic resistance genes. As a result, transposons are important genetic elements for moving and combining antibiotic resistance genes onto plasmids. This enables plasmids to accumulate multiple drug-resistance genes, leading to multidrug-resistant pathogens (see the Case Study).

1. How does UV light cause mutations? 2. Why are horizontal gene transfer and recombination important for the rapid evolution of bacteria? 3. Why is the movement of transposons important in the development of multidrug-resistant pathogens?

224  CHAPTER 8  Microbial Genetics and Genetic Engineering

2. Review: How did some Klebsiella bacteria probably acquire the NDM gene and the multidrug resistance characteristic shown in the diagram? 3. What does the abundant amount of insertion sequences imply about the how the plasmid acquired the many other drug-resistance genes? K. pneumoniae is a gram-negative, bacillus-shaped pathogen that is often resistant to antibiotics. Although found in the normal flora of the mouth, skin, and intestines, it can cause destructive infections in people with a weakened immune system including persons with diabetes, alcoholism, malignancy, and chronic obstructive pulmonary disease. The pathogen is normally transmitted to other patients by hands or material contaminated with feces. Patient 2, one of seven patients on the same unit at the time of this patient’s stay, also grew multidrug-resistant K. pneumoniae from a rectal swab specimen collected March 30. It was genetically identical to the first isolate and contained the NDM gene. A study of contacts between hospital personnel was completed to determine possible sources for spread of the pathogen. Those who potentially had direct contact with patient 1 were screened to determine who also had contact with patient 2 (Figure b).

8 .4

b. Contact with patient 1

Contact with patient 2

Physicians

+

−

Nurse practitioners

+

−

Nursing staff

+

+

Janitorial staff

+

−

Food service staff

+

−

Family/visitors

+

−

Position

(Data from Hardy EJ et al. (2012) Carbapenem-Resistant Enterobacteriaceae Containing New Delhi Metallo-Beta-Lactamase in Two Patients — Rhode Island. MMWR 61(24):446-448.)

4. Based on the information in the table, propose a theory on how the NDM gene was spread in the hospital.

Regulation of Gene Expression

LEARNING OBJECTIVES 1. Explain how gene expression in bacteria can be regulated by control of the transcription process. 2. Describe four posttranscriptional sites at which gene regulation can occur. ome genes are always turned on (expressed) because they are required for the basic maintenance of cellular functions under normal conditions. Other genes are regulated and are turned on and off as the environment changes in order to maximize growth opportunities or conserve resources for the microbe. The following material will present an overview of how microbes regulate gene expression during initiation of transcription and at other, nontranscriptional control points.

S

Transcriptional Control Much of the known regulation of gene expression occurs during the initiation of transcription. All genes begin with a promoter sequence in which the RNA polymerase complex binds to initiate transcription. Genes with a terminator sequence stop transcription. Regulated genes also have sites for regulatory proteins to bind. Most of these regulatory protein-binding sites are near the promoter where RNA initiation takes place, but some are located after the terminator sequence. Regulatory proteins binding to these sites can still affect transcription initiation because the DNA molecule is thin and flexible, and the DNA protein complex can loop back to interact with the RNA polymerase complex. Regulation of Gene Expression  225

Genes coding for proteins that regulate gene expression are often expressed continuously, which is called constitutive gene expression. These regulatory proteins can control genes by binding to regulatory sequences to either inhibit or enhance transcription. Regulatory proteins that inhibit transcription are called repressors. Regulatory proteins that promote transcription are known as activators. Cellular metabolites affect the activity of the repressors and activators. These metabolites alter the DNA-binding properties of repressors and activators so their ability to affect transcription rates is changed. For example, inducers are small metabolites that inactivate repressors and turn on gene expression. The combination of repressors, activators, and key regulatory metabolites turns genes on and off, depending on the metabolic needs of the cell. In some cases, it is advantageous for a microbe to coordinate the expression of a set of genes that have a common function. For example, multiple enzymes may be needed to synthesize a single essential amino acid. Therefore, the cell conserves resources with a single regulatory protein that controls the expression of many related structural genes, genes that code for enzymes. Bacteria coordinate the synthesis of multiple genes with operons, sets of genes controlled by a single promoter. These genes are transcribed together into a single mRNA. The single mRNA codes for multiple proteins that are all typically required in the same metabolic pathway. The paradigm for transcriptional control of an operon in bacteria is the control of the lac operon in E. coli. This system coordinates the expression of enzymes needed to transport lactose into the cell and break it down into glucose and galactose (Figure 8.10a), which can be used in glycolysis (see Remember This!). The lac operon has both a repressor and an activator system. The lac repressor is synthesized constitutively by the regulatory gene. When no lactose is present, the repressor binds tightly to a regulatory sequence called the operator and inhibits the binding of the RNA polymerase complex, blocking transcription of the structural genes that code for the enzymes that metabolize lactose (Figure 8.10b). In the presence of lactose, the repressor is inactivated, resulting in transcription of the lac operon genes into a single mRNA. From this mRNA, enzymes necessary to metabolize lactose are synthesized so that the lactose is rapidly metabolized (Figure 8.10c). Remember This!  Glycolysis is the most universal energy-producing pathway used by living organisms. It begins with simple sugars such as glucose. If necessary, review material from Section 7.3 before continuing.

The activator protein system is superimposed on the repressor protein system to enable the cell to conserve resources when both lactose and glucose are present.

If glucose is present in abundance, it is unnecessary to produce enzymes to break down lactose to make more glucose. Therefore, a second regulatory gene responds to the glucose concentration. It produces a protein complex that binds near the promoter of the lac operon to enhance transcription only when glucose concentrations are low. The net result of a repressor and activator system is approximately 1000× difference in enzyme activity between the fully inhibited (no lactose and high glucose concentration) and fully expressed (high lactose concentration and no glucose) states.

Pre- and Posttranscriptional Control In eukaryotes, genes can be regulated before transcription by controlling DNA packaging. Both DNA and the histone proteins that package the DNA can be modified by adding or removing chemical groups such as methyl groups or acetyl groups. As a result, the DNA can be loosely coiled (allowing transcription) or tightly coiled (preventing transcription). Regulation of gene expression can also occur after transcription is complete. Additional points for gene regulation after transcription include RNA processing, including mRNA capping, RNA splicing, and polyadenylation. These mRNA processing events only are found in eukaryotes. Capping modifies the 5′ end of the mRNA and is required for translation initiation. The spliceosome is the organelle that scans the primary transcription product, cuts out portions of the mRNA coded by introns, and splices together the portions of the mRNA coded by exons. Introns are portions of a gene that code for parts of an mRNA that are removed during splicing. Exons are portions of a gene that code for the parts of an mRNA that are spliced together. Also, in eukaryotes, RNA must be transported to the cytoplasm, which provides another opportunity for regulating gene expression. In the cytoplasm, messenger RNA can be degraded or protein synthesis blocked by the binding of small RNA molecules (microRNAs) to the mRNA. The final point for gene regulation occurs after protein synthesis is complete. Proteins may need to be processed to an active form by addition of a functional group or by cleavage. Proteins can also be tagged for degradation or inactivated by chemical modification.

1. How does the repressor protein enable E. coli to conserve resources? 2. What sites do eukaryotes have for gene regulations that are not found in prokaryotes?

226  CHAPTER 8  Microbial Genetics and Genetic Engineering

Gene regulation in the lac operon • Figure 8.10 The genes controlling lactose metabolism are regulated in E. coli.

a. Lactose is a disaccharide that is metabolized by E. coli when

Lactose

energy sources, such as glucose, are unavailable.

Lac permease

ADP + P Lactose Lactose Glucose + Galactose β-galactosidase ATP

b. When the inducer lactose is not present, the genes coding for lactose-metabolizing enzymes cannot be transcribed because the repressor binds tightly to the operator sequence. P

Regulatory gene

T

P

Structural genes

T

Repressor

c. When the inducer lactose is present, the repressor is inactivated, the structural genes are transcribed, and β-galactosidase and lac permease are produced. P

Regulatory gene

T

Repressor

Lactose

Lactose inactivates the repressor. Transcription and protein synthesis is initiated.

P O

Structural genes

β-galactosidase

Lac permease

T

Transacetylase

A sk Yo u r se lf β-galactosidase metabolizes lactose to ____. a. glucose only c. permease b. galactose only d. glucose and galactose

Regulation of Gene Expression  227

8. 5

Recombinant DNA Technology

LEARNING OBJECTIVES 1. Explain how enzymes and vectors are used to make a genetically engineered DNA molecule. 2. Describe four practical applications of recombinant DNA technology. 3. Explain the ethical and safety concerns associated with recombinant DNA technology. esearchers combine DNA from various sources with replicating DNA molecules using recombinant DNA technology, also called genetic engineering. The DNA is then introduced into a host organism, which allows the new gene combinations to be amplified and expressed. recombinant There are no limits to the types of DNA technology genetic material that can be reThe creation in a labcombined because the basic oratory of new DNA chemical structure of DNA is the sequences produced same for all living things. The folby combining genetic lowing material provides an overmaterial from multiple view of recombinant DNA sources. technology and its applications.

R

Recombinant DNA Tools and Gene Cloning Recombinant DNA technology was developed from biochemical techniques for purifying and identifying proteins and nucleic acids and from the application of enzymes isolated from bacteria that are used to destroy viral DNA. Combining these techniques from very different

fields of research has revolutionized nearly every field of biology, including the field of microbiology.

Restriction enzymes and gene splicing  To splice together DNA from two different sources, the DNA must be cut at a specific site and then the desired pieces must be isolated. Restriction enzymes are used to cut the DNA at specific nucleotide sequences (Table 8.5). These sequences are typically palindromic, which means they are the same when read backward or forward. DNA fragments are isolated using gel electrophoresis, a technique that uses an electric current to move DNA through a gel matrix. The fragments of DNA are separated based on size (see The Microbiologist’s Toolbox). After the DNA is cut, a short region of singlestranded DNA is left. The single-stranded region can serve as a sticky end to join to another fragment of DNA cut with the same enzyme. Once the ends are joined together, sugar-phosphate backbones are linked using DNA ligase to form a recombinant DNA molecule. Cloning vectors Gene cloning cloning The prorefers to the production of many cess of producing a identical copies of a recombinant group of genetically gene. Cloning vectors are geneti- identical genes, cells, cally engineered, self-replicating or organisms. DNA molecules designed to carry a DNA sequence that a researcher desires to clone. They can be viruses, plasmids, or artificial chromosomes, depending on the size of the DNA to be studied and the host cell in which it will be expressed. Cloning vectors all have several features in common. Cloning vectors must replicate within the host cell; therefore, they contain an origin sequence recognized by the DNA replication machinery

Selected restriction enzymes  Table 8.5 Restriction enzyme

Source

Restriction site

EcoRI

Escherichia coli

5´

Cleavage result 3´

5´

GAAT TC CT TAAG

3´ BamHI

Bacillus amyloliquefaciens

5´

5´

3´

3´

5´

GGA T CC CC T AGG

3´ HindIII

Haemophilus influenzae

5´

5´

3´

3´

5´

SmaI

Serratia marcescens

5´

3´

3´

5´

CCCGGG GGGCCC

3´

3´

3´

3´

AGC T T A

5´ 3´ C GGGCC

5´

GA TCC G

5´

A T T CGA

5´

AATTC G

5´

G CCT AG

A AGC T T T T CGA A

3´

3´ G CTTAA

CCGGG C

5´

T he Microbiologist ’ s T oolbo x

✓ The Planner

Gel Electrophoresis Gel electrophoresis is a technique used to separate mixtures of DNA, RNA, or proteins according to molecular size. The molecules to be separated are moved through a porous gel by an electrical field. The gels can be made of agarose or polyacrylamide, depending on the type and size of the molecules to be isolated. Small molecules travel through the pores more rapidly than larger molecules, resulting in their separation by size. For separating DNA using an agarose gel (see the Figure),

the DNA is dissolved in a pH 8 buffer so that the phosphate groups have a negative charge and cause the DNA to be pulled toward the positively charged end of the gel. The loading buffer also has a greater density than that of the electrophoresis buffer so that DNA samples settle to the bottoms of the wells in the gel. Marker dyes are added to help follow the progress of the DNA through the gel. The DNA itself is typically stained with dyes that can be visualized under UV light.

Agarose gel

1. An agarose gel is submerged in a pH 8 buffer in an electrophoresis chamber. Agarose gel

DNA solutions

Platinum wire electrode Buffer

2. DNA mixed with a loading buffer is added to the wells in the agarose gel and an electric current is run through the gel to complete the electrophoresis. + electrode

– electrode

Dye Power supply

4. Marker DNA, DNA fragments of known sizes, are typically placed at the ends of the gel (columns 1 and 8 in the photo) and are used to size the fragments of test DNA. 1

2

3

4

5

6

7

8

3000 bp (base pairs) 2000 bp 1500 bp 1200 bp 3. The gel is stained and photographed 1000 bp under UV illumination. 900 bp 800 bp 700 bp 600 bp 500 bp 400 bp

A sk Yo u r se lf What is the approximate size of the largest and the smallest DNA fragments isolated in the gel?

Recombinant DNA Technology  229

of the desired host. They also have a multiple cloning site. This short sequence contains dozens of sites where restriction enzymes can cut the vector, thus providing the researcher with the best opportunity for being able to cut the desired DNA sequence and splice it successfully into the vector. Finally, vectors normally have selectable genes. These genes enable the researcher to screen for host cells that acquired the vector and also to ensure that the vector has acquired the desired inserted DNA sequence. After the gene and cloning vectors are isolated and cut with appropriate restriction enzymes, they are linked into a single recombinant molecule using DNA ligase before being introduced into a new host cell. Introducing the recombinant vector into the host cell can be done by a variety of techniques. Some techniques are relatively simple (for example, heat shock to make bacteria capable of taking up DNA by transformation), whereas others are relatively complex (for example, DNA-coated metal microparticles fired by a gene gun to introduce genes into plant cells). As the host cell divides, the DNA can be replicated billions of times.

Cloning a eukaryotic gene  Cloning a eukaryotic gene to have its protein expressed in a bacterial cell requires isolating the mRNA that produces the desired protein and converting the mRNA sequence into a DNA sequence. This is necessary because a eukaryotic gene contains introns that must be removed before it is inserted into a bacterial host cell because bacteria cannot splice introns out of RNA. Researchers create a gene free of introns by isolating the spliced mRNA product produced from the gene. A DNA copy of this spliced mRNA is made using reverse transcriptase (see Remember This!) to make a complementary DNA (cDNA). The cDNA can then be inserted into a suitable vector used for cloning to form a recombinant DNA molecule. The cloning vector contains a selectable gene, such as an antibiotic resistance gene, so that the few cells that receive the recombinant vector can be selected from those that did not. In addition, cloning vectors have a mechanism for detecting successful insertion of the cDNA into the vector. Many vectors use portions of the lac operon to detect the insertion of the cDNA into the cloning vector. When the cDNA is successfully inserted, it disrupts the β-galactosidase gene so that it cannot degrade a substrate placed in the growth medium and turn the growing bacterial colony blue. As a result, cells that have received a recombinant plasmid remain white in color. Figure 8.11 outlines the steps involved in cloning a eukaryotic gene into a bacterial cell to produce a protein product. Remember This!  RNA is reverse-transcribed to DNA by the retroviral enzyme reverse transcriptase. If necessary, review this material in Section 6.2 before continuing.

Applications of Recombinant DNA Technology There are numerous benefits that have resulted from the practical application of recombinant DNA technology. It has been applied primarily in the fields of medicine, agriculture, and forensics as well as continuing to be a fundamental tool for biological research.

Medicine and pharmacology  The primary contribution of recombinant DNA technology to the field of medicine is in the diagnosis and treatment of diseases that are not gene based. DNA-based tests are used to rapidly and accurately identify viruses and bacteria that are otherwise difficult to visualize or culture. Molecular techniques can also be used to determine drug-resistance profiles in pathogenic microorganisms, which aids in determining appropriate drug therapy. Many useful pharmaceutical proteins are being produced through recombinant DNA technology. Human genes have been cloned in bacteria so that human proteins can be expressed and harvested. For example, human insulin that is produced in bacteria and then biochemically purified is used to treat diabetes. Similarly, tissue plasminogen activator, an enzyme that dissolves blood clots and is administered to minimize damage following a heart attack or stroke, is produced in genetically engineered bacteria. Industrial chemistry  Production of industrial enzymes has been improved using recombinant DNA technology. Industrial enzymes are used in detergents, textile treatments, paper production, and the food industry. For example, production of a thermostable α-amylase from Bacillus licheniformis was increased 26× by cloning the gene on a high-expression plasmid. Agriculture  Recombinant DNA technology has been used to make genetically modified organisms (GMOs) that have had a significant impact on agriculture. Genetic engineering of animals is expensive and has mostly been limited to research and the development of transgenic animals for the production of pharmaceutical proteins needed in large quantities. For example, transgenic goats produce the human protein antithrombin, which is used to treat individuals with a rare blood clotting disorder. Genetic engineering has also been used to develop herbicide- and pest-resistant crop plants. In the United States, most corn, soybeans, and canola crops are genetically engineered. Herbicide resistance makes it easier to kill weeds without harming the crop plants. Pest resistance results from inserting pesticidal genes into the plant itself

230  CHAPTER 8  Microbial Genetics and Genetic Engineering

Eukaryotic genes can be expressed in bacteria by isolating the spliced mRNA and then using reverse transcriptase to make a cDNA copy. In this example, the cDNA is inserted into a plasmid-cloning vector and transformed into E. coli. Cells containing the recombinant plasmid are identified by using a blue/white colony screening system based on the activity of β-galactosidase coded by the plasmid. Gene controlling β-galactosidase expression Plasmid vector mRNA

5´ AGUCCGUUA AGACCUUA A

3´ 1 Spliced mRNA of the desired gene is isolated.

Ampicillin resistance gene

2 The mRNA is reverse-transcribed to a double-stranded cDNA using reverse transcriptase.

3 Appropriate restriction enzymes digest the plasmid vector and cDNA to give complementary sticky ends.

cDNA Plasmid vector cut with restriction enzyme

4 The sticky ends of the purified vector and cDNA attach and are linked with DNA ligase to form a recombinant DNA molecule.

Recombinant plasmid containing cDNA insertion

6 When transformed cells are spread onto specialized growth plates, only cells that are ampicillin resistant grow. Cells containing the recombinant plasmid are white. Those with the original plasmid with no gene insert are blue.

E. coli

No β-galactosidase expressed Ampicillin resistance expressed

White colony

Courtesy Trevor Charles

Blue colony

5 The recombinant plasmid is transformed into E. coli cells.

Transformed E. coli cells growing on growth medium with ampicillin and a substrate that turns blue in the presence of β-galactosidase

Th i n k Cr it ica lly

The presence of blue and white colonies tells you if your gene insert was successful, but how could you discover whether there was a transformation of a plasmid into the cell at all? Explain.

Recombinant DNA Technology  231

Process Diagram

✓ The Planner

Gene cloning  • Figure 8.11

What a Microbiologist Sees ✓

The Planner

Manipulating the Bacterial Genome for Agricultural Benefits When comparing root damage caused by European corn borer larvae, a microbiologist sees a triumph of modern bacterial genetics (Figure a). Feeding by these caterpillars significantly reduces yield of corn plants because their root base is destroyed. Entomologists rate the level of insect damage on a scale of 0 to 3, with 0 being no damage and 3 representing root decimation. Effective caterpillar control can be accomplished with pesticide application as seen in Figure b. Pesticide treatment reduces the mean node injury rate to 0.26 from 1.99 in control corn, an almost 8× improvement in root health. Although the addition of pesticides decreases root damage, it increases the cost of production. Excessive use of pesticides may also harm the environment.

The Bt delta endotoxin is a protein produced by Bacillus thuringiensis (Bt), a common soil bacterium. The endotoxin kills Lepidoptera (butterfly) larvae, especially European corn borer caterpillars. By extracting the gene for this protein plus its promoter from Bt and inserting them into the corn genome, a GMO is created. The roots of these plants are toxic to insect pests. Because the endotoxin is specific to this pest, it doesn’t harm other animals. Analysis of root health in Bt corn shows a mean node injury rating of 0.02, which is 10× better than with pesticide application! Because of its safety and effectiveness, growing Bt corn is the preferred way to control crop pest damage by root worms.

Curtis E. Young, Ph.D

Curtis E. Young, Ph.D

a. European corn borer larvae cause significant root damage, negatively affecting yield and even plant survival, whereas Bt corn roots are protected by endotoxin produced from the insertion of a bacterial gene.

Bt corn Node injury rating 0.01

Control corn Node injury rating 2.1

b. The roots of control corn plants sustain heavy damage by larval feeding (1.99 rating), which can be reduced with pesticide application (0.26 rating) and essentially prevented in the two tested GM strains of Bt corn (0.02 rating). (Data from Rice, M.E., Oleson, J.D., and Tollefson, J.J. (2007) Evaluation of Corn Rootworm Hybrids. Integrated Crop Management News Dec 10:286-287.)

Agricultural product

A comparison of product effectiveness in reducing larval-feeding corn root damage Pesticide treatment GMO strain #1 GMO strain #2 Control 0

0.5 1 1.5 Mean node injury rating (0-3 scale)

2

Th in k Cr it ica lly

Why would having a toxin specific for lepidopteran larvae be more efficient at killing corn borer larvae than spraying a general pesticide?

232  CHAPTER 8  Microbial Genetics and Genetic Engineering

Paternity testing • Figure 8.12 Genetic profiles of DNA isolated from a mother, her son, and a potential father can be used to establish paternity. Partial results of a DNA profile are shown here.

Th in k Cr i t i ca l l y

DeLuca/ONU

From the paternity data shown, can you exclude the man from being the father of this child?

(see What a Microbiologist Sees). The primary concern about eating genetically modified (GM) foods is the potential for hypersensitivity reactions. For people with food allergies, the primary mode of treatment is avoidance of the affecting food types. As a result, many GM foods are labeled so individuals can avoid the risks of an unknown potential allergen. Only a small number of specific proteins is thought to induce food hypersensitivity, including milk, peanuts, fish, soy, and shellfish. As a result, genes coding for allergens from these organisms are not used to make GM foods. Additionally, regulatory bodies evaluate GM foods before allowing them to be sold. The end result is that GM foods are eaten safely by hundreds of millions of people daily. However, because of fear of potential health concerns, some countries ban the import of GM foods.

Forensics  Each person has a unique genetic profile or DNA fingerprint (except identical twins). Forensic scientists analyze 13 different regions in the human genome that show significant variation within the human population. These are regions where short tandem repeats (STRs) are found. STRs are sections of the DNA where two to five base-pair sequences are repeated in tandem units from several times to dozens of times. By combining the probabilities of having each specific combination of STRs at the 13 different STR sites analyzed, a unique DNA fingerprint is determined (Figure 8.12). These can be used in criminal investigations to help establish guilt or innocence, in paternity determination, and for identification of deceased individuals.

Ethical and Safety Concerns Safety and ethical considerations are particularly important for the research community in the field of microbiology because we investigate microbes that are or could potentially become human pathogens. In most countries, grant-funded research requires that recombinant DNA research be designed with potential safety issues clearly identified. Research labs are designed for the appropriate biosafety risk and personnel are adequately trained. Designated safety personnel enforce these features. Nevertheless, important debates regularly arise concerning the ethics of some research. In the United States, personnel in the Food and Drug Administration, the Department of Agriculture, the Environmental Protection Agency, and the National Institutes of Health oversee and implement public policies on recombinant DNA technologies.

1. Why are sticky ends an important feature of DNA cleavage by restriction enzymes? 2. Which applications of recombinant DNA technology are controversial? 3. Why is it important to regulate recombinant DNA technology? Recombinant DNA Technology  233

8. 6

Genomics

LEARNING OBJECTIVES 1. Explain the basic processes of DNA sequencing. 2. Describe information needed for genome analysis. 3. Outline the applications of genomics. he Human Genome Project began in 1990 as the first great undertaking in the field of genomics. It took researchers approxi- genomics A mately 15 years to branch of genetics that maps and sequence the first human gesequences genomes, nome of approximately 3 billion organizes and interbase pairs. Technology has since prets the results, and improved so that current high- applies the data to throughput, rapid sequencing the fields of biology methods can sequence more than and medicine. 50 billion base pairs per day at a cost of approximately 3¢ per 1 million bases sequenced. Sequencing DNA rapidly and inexpensively is straightforward enough that reading the entire genome of a microbe or an entire community of microbes is simply a matter of isolating DNA, mailing it to a sequencing center, and waiting a few weeks for the results. The real challenges for today’s microbiologists are 1) to develop important scientific questions to investigate that can take full advantage of the new powerful sequencing technology and 2) to interpret the billions of As, Ts, Cs, and Gs that make up the genome of an organism or a metagenome, the combined genomes of hundreds or possibly thousands of organisms in a community of microbes. This section will outline current DNA sequencing technology, how bioinformatics are used to analyze genomes, and some practical applications of the field of genomics.

T

DNA Sequencing DNA sequencing is used to determine the precise order of nucleotides within a DNA molecule. The basic principle used in current DNA sequencing technology (nextgeneration or nextgen sequencing) is to replicate the DNA to be sequenced. However, after the addition of each new nucleotide, synthesis is stopped, the sequence of the new nucleotide is read, and then synthesis is resumed. Nextgen sequencing technologies can rapidly sequence entire genomes; however, the process requires that large genomes of DNA be fragmented into short pieces of DNA before the actual sequencing process occurs. Once the

genomic DNA is fragmented, the sequencing process can be repeated rapidly on hundreds of thousands of small DNA fragments simultaneously. Even though the nextgen sequencing process can sequence billions of bases in a day, it can only read DNA fragments smaller than 150 bps in length. Therefore, after sequencing, specialized computing software reassembles the short sequences into the original genome-length sequence. This process of breaking apart multiple copies of a large sequence into smaller random parts, sequencing the shorter fragments, and then reassembling the original sequence by aligning the overlapping sequences is termed shotgun sequencing.

Genomic Analysis The fields of molecular biology and genetics investigate the roles of single genes and sets of related genes in cell metabolism or in the development of an organism. Genomics, in contrast, analyzes the structure and function of an entire genome and its interrelated metabolic cellular pathways. With advances in DNA sequencing technology, there are now thousands of sequenced genomes to analyze and compare. Genomic analysis begins with sequencing the DNA of the organism. To validate and link the millions of assembled fragments from shotgun sequencing, sequences are compared to all other known sequences found in the GenBank sequence database, a collection of all publicly available DNA sequences maintained at the National Institutes for Health. This is needed to assemble similar sequences using homology principles. Unique sequences are the most difficult to assemble computationally. After an organism’s sequence is completely assembled, it is annotated using clues developed from the field of molecular biology. For example, the most common promoter type in bacteria is that which regulates the genes that code for the foundational structural components and enzymes required for growth and reproduction of the cell. The promoters for these genes typically share the same set of sequences located 5′ (upstream) of the transcript start site. These shared consensus sequences are TTGACA, located at approximately −35, and TATAAT, located at approximately −10, relative to the transcript start site and spaced 15–21 base pairs apart. Sequences such as promoters and flanking terminators are used to identify genes within the DNA sequence. In a similar way, protein-coding sequences are found by identifying the 16S ribosomal RNA-binding site,

234  CHAPTER 8  Microbial Genetics and Genetic Engineering

The functional analysis of an organism’s genome • Figure 8.13

McLeod et al., 2004: Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae. Journal of Bacteriology. 2004; 186(17): 5842–5855. Reproduced/amended with permission from American Society for Microbiology

A graphical analysis of the sequenced genome of Rickettsia typhi, the causative agent of endemic typhus, shows genes color-coded by functional category. The outer two circles show the predicted coding regions on the plus and minus strands. The shaded region illustrates the chromosomal inversion with respect to Rickettsia prowazekii, the causative agent of epidemic typhus. Cell structure Cell processes Central dogma

Pseudogene Transport Virulence

Unknown ncRNA tRNA

Energy metabolism

Regulation

rRNA

Energy metabolism

RNA

No match

base pairs

AUG initiation codon, and a termination codon. These protein-coding sequences can be compared with sequences currently contained in GenBank. From an evolutionary perspective, those proteins with similar sequences have a similar structure and function. The data can then be used to generate an overview of the function of the organism’s genome or a comparison between genomes (Figure 8.13). Analysis of entire genomes has revealed that much of the genetic information in microbial pathogens is for traits that enable the pathogen to survive the defenses of their human hosts. Pathogens must attach to host tissues, avoid host defenses, and damage host tissues to cause disease. Given the complexity of the defenses of the innate and acquired immune systems, it’s not surprising that hundreds of a bacterium’s genes are devoted to these tasks for it to survive long enough to be passed to a new host. Comparison of the genomes of pathogens

A sk Yo u r se lf On this gene map, there are sections where large chunks of the same color are present. These might represent _____ . a. promoters b. operators c. regulatory genes d. operons

has shown that genetic islands of genes related to an organism’s pathogenicity are commonly shared between pathogens as well. It is often very difficult to grow prokaryotes in the laboratory. Consequently, it is now more common to analyze the genetic information of a microbial community to learn about its biology than to try to grow the microbes directly. The types of microbes in a community can be determined by first amplifying the rRNA genes using the polymerase chain reaction (PCR), a technique to enzymatically amplify a specific segment(s) of DNA. All the rRNA genes are then sequenced. Organisms are identified by comparing their DNA with sequences in GenBank. Many bacteria found in a community are unique. The interactions between organisms within the community can be investigated by characterizing all the biochemical pathways found in the community by studying their genes in an analysis termed metabolomics. Genomics  235

Clinical Application

✓ The Planner

Screening for Genetic Diseases—BRCA1 Mutation

National Cancer Institute

Studies on large families in which there was an obvious hereditary basis for breast cancer identified the first gene associated with breast cancer, BRCA1. This gene gives a woman an average 65% lifetime risk for breast cancer and a 39% lifetime risk for ovarian cancer. The risk is increased or decreased depending on a family history of cancer or the presence of other genes that increase the risk of breast cancer. Because of her family history of breast cancer and her genetic

profile showing she has the BRCA1 gene, the actress Angelina Jolie decided to undergo a double mastectomy. Without having the prophylactic mastectomy, she stated that she had an 87% chance of developing breast and a 50% chance of developing ovarian cancer. BRCA1 codes for a protein involved in DNA repair. The cancer-causing mutations in BRCA1 are mostly frameshifts, nonsense, and splice site mutations (see the Figure).

BRCA1 gene

In t e r p r e t t h e Da t a Mutation types

What type of mutations are the least frequent causes of breast cancer? Nonsense/Frameshift

Missense

Splice-site

Applications of Genomics Genomic analyses are not an abstract advancement in the field of molecular biology. They can have a very practical and personal impact on each of us.

Medicine and pharmacology Genomics have been applied to the study of many different aspects of health and disease, including earlier detection of genetic predispositions to disease and pharmacogenomics or the analysis of how individuals’ genetic makeup influences their response to drugs. Additionally, the Human Microbiome Project has been analyzing the role microbes have in maintaining human health and causing disease. In a field known as predictive medicine, molecular biologists have characterized specific alleles that increase a person’s risk for a number of different genetically influenced diseases. Polygenic traits and disease risk have complex interactions with the environment and a person’s lifestyle. Disease-related alleles can be identified using mail-order kits that analyze the DNA in a saliva sample. The gene profiles evaluate approximately 200 of the most common genetic diseases and conditions. The accurate evaluations of risk and potential lifestyle modifications that may be recommended are best assessed with a trained medical professional (see the Clinical Application). The Human Microbiome Project is a National Institutes of Health–funded project that began in 2009 to characterize the microbiome of humans at different body locations. The objective of the project was to evaluate

the microbiome in healthy and diseased individuals and demonstrate there are opportunities to improve human health through monitoring or manipulating the human microbiome. Current research indicates the microbiome may impact a number of conditions such as obesity, metabolic syndrome, type 2 diabetes, and irritable bowel syndrome. Future research challenges will involve developing methods to manipulate the makeup of human microbial communities in ways that impact disease.

Energy and environmental applications  Since 1994, the Department of Energy has funded genomic research to identify microbes that could be useful in environmental remediation, toxic waste reduction, biofuel production, or industrial processing. Additionally, projects seek to better understand the tightly linked biological processes driving the carbon cycle and regulating atmospheric carbon dioxide levels.

1. Why is it necessary to reassemble millions of short DNA sequences to completely sequence an organism’s genome? 2. How are organisms identified during genomic sequencing? 3. How could genomic analysis of the human microbiome potentially improve health?

236  CHAPTER 8  Microbial Genetics and Genetic Engineering

The Planner

✓

Summary

8.1

DNA as the Genetic Material  212

• DNA contains the code for hereditary information in its sequence of base pairs. In the process of transcription, the information coded in the DNA is copied into RNA, which is synthesized from the DNA template. Messenger RNA (mRNA) contains a set of codons that are translated into proteins at the ribosomes. • Chromosomes are copied during semiconservative replication. Each strand of DNA is replicated quickly and accurately by a host of polymerases, helicases, and other enzymes, shown in the diagram. The polymerases synthesize DNA unidirectionally (5′ to 3′), which dictates that the leading strand is synthesized continuously, whereas the lagging strand is synthesized in short segments.

DNA replication   •  Figure 8.2 DNA polymerase I

• Translation is the conversion of the nucleotide sequence in mRNA into the amino acid sequence of a protein. Identification of each kind of amino acid is based on groups of three codons in the mRNA sequence by the anticodon on the tRNA. Ribosomes, made of ribosomal proteins and rRNAs, compose the translation machinery. The mRNA slides through a set of ribosome sites where tRNAs can interact and place the correct amino acid onto the growing peptide chain.

8.3

Sources of Genetic Variation  219

• DNA sequences can vary because of rare mutations, which are changes in the nucleotide sequence of DNA. Spontaneous mutations occur naturally during replication. Mutations can also be induced by chemical mutagens or radiation. Point mutations can range in affect from minor silent mutations to drastic frameshift mutations.

DNA helicase

DNA polymerase III

8.2

forming protein via the interaction between its anticodon and a codon. Messenger RNA contains the code for the amino acid sequence of a new protein. In eukaryotes, mRNA is typically processed by capping, splicing, or tailing before it is able to carry out its function.

From DNA to Protein  215

• Transcription is the copying of the hereditary information from a gene in DNA into different types of RNA, shown in the diagram.

• Horizontal gene transfer in bacteria involves recombination of DNA from different sources. Transformation is the acquisition of free DNA from the environment. Conjugation uses sex pili to transfer DNA between a donor bacterium and a recipient bacterium. Transduction occurs when bacteriophages transfer DNA from one bacterium to another, as shown in the diagram.

Horizontal gene transfer mechanisms in bacteria: Transduction  •  Figure 8.9

Transcription  •  Figure 8.3 DNA coding strand 5´

3´

3´

5´

RNA polymerase

DNA template strand

• Ribosomal RNA (rRNA) forms structural components of the ribosomes. Each kind of transfer RNA (tRNA) carries a particular amino acid and places it where directed in a newly

• Transposons move from one genetic location to another within a cell. In the process, they may cause mutation. They may also enable a single plasmid to accumulate multiple antibiotic resistance genes.

Summary  237

Regulation of Gene Expression  225

• Gene expression happens at many levels. All genes have a promoter and terminator sequence in which transcription machinery binds to start and stop the process. Regulatory proteins, such as repressors or activators, promote or inhibit gene expression. • In bacteria, many genes are found in coordinated segments known as operons. Operons allow for many gene products to be coregulated and expressed simultaneously. As illustrated in the diagram, in the lac operon of E. coli, the expression of the structural genes is primarily controlled by the repressor protein binding to the operator sequence to block transcription.

Gene regulation in the lac operon  •  Figure 8.10

ATP

ADP + P

Lactose Lactose Glucose + Galactose β-galactosidase

8.5

8.6

Genomics 234

• Genomics aims to map and sequence genomes to understand gene interactions and potential genetic therapeutics. • The data for genomics studies are generated from DNA sequencing reactions, which gives the exact order of base pairings in the DNA, as shown in the diagram. This allows researchers to compare sequences with each other or with databases to predict gene functions.

The functional analysis of an organism’s genome  •  Figure 8.13

Recombinant DNA Technology  228 base pairs

• Recombinant DNA technology is the creation in a laboratory of new combinations DNA sequences produced by combining genetic material from multiple sources. Gene cloning allows researchers to create billions of copies of the recombinant gene. • Several enzymes are critical for genetic engineering. Restriction enzymes allow DNA to be cut at specific sites. Ligases are used to link pieces of the cut DNA back together into desired sequences. DNA sequences and complementary DNAs (cDNAs) are often inserted into cloning vectors, such as plasmids (see the diagram), viruses, or artificial chromosomes. These vectors Plasmid have selectable genes, multiple cloning vector sites, and genes that allow a researcher to identify vectors that have received the desired genetic insertion.

Gene cloning  •  Figure 8.11 • Recombinant DNA technology has been used medically in gene therapy to create corrected versions of mutant host genes. In agriculture, it has been used to create genetically modified organisms (GMOs), which have increased production and generated some controversy. Forensics studies

McLeod et al., 2004: Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae. Journal of Bacteriology. 2004; 186(17): 5842–5855. Reproduced/amended with permission from American Society for Microbiology

8.4

use the unique DNA profile for each human to solve crimes or identify DNA sources. In pharmacology and biochemistry, researchers have moved genes into alternative hosts where their expression provides large quantities of proteins and products that would otherwise be scarce.

• Nextgen DNA sequencing rapidly reads short sequences of DNA. These short DNA sequences can then assembled into an entire genome sequence using shotgun sequencing. • A major advantage to using genomics to study microorganisms is that researchers no longer need to cultivate organisms. Any microorganism in which DNA can be isolated can now be studied. This can even be used to compare biochemical pathways in the analysis of metabolomics. • Genomics has widespread applications, including the field of predictive medicine, which aims to analyze a patient’s genetic diseases or conditions through DNA analysis such as those found in breast cancer. Pharmacogenomics seeks to understand the relationship between genetic makeup and responses to different drugs. Genomics is also used in the search for new genes and biochemical pathways to identify new energy and environmental applications.

238  CHAPTER 8  Microbial Genetics and Genetic Engineering

Key Terms • activator 226 • Ames test  221 • anticodon 216 • base pair  212 • chromosome 213 • cloning 228 • cloning vector  228 • codon 213 • complementary DNA

(cDNA) 230 • conjugation 222 • exon 226 • frameshift mutation  220 • gene 213

• genetically modified

organism (GMO)  230 • genome 213 • genomics 234 • genotype 213 • horizontal gene transfer  222 • inducer 226 • intron 226 • messenger RNA (mRNA) 213 • missense mutation  220 • mutation 219 • nonsense mutation  220 • operator 226

• operon 226 • phenotype 213 • plasmid 213 • point mutation  220 • promoter 215 • recombinant DNA

technology 228 • repressor 226 • restriction enzyme  228 • reversion mutation  221 • ribosomal RNA (rRNA)  216 • semiconservative replication 214 • shotgun sequencing  234

• silent mutation  220 • spliceosome 226 • spontaneous mutation  219 • structural gene  226 • terminator 215 • transcription 213 • transduction 222 • transfer RNA (tRNA)  216 • transformation 222 • translation 213 • translocation 218 • transposon 224

Critical and Creative Thinking Questions 1. Explain the term wobble in relation to codon-anticodon pairing. What benefit does wobble base pairing provide?

3. Review the Clinical Application. What are some benefits and potential detriments of genetic screening?

2. Culturing the causative agent of tuberculosis is very difficult because Mycobacterium tuberculosis grows so slowly on agar plates and may carry many antibiotic resistance genes. Using the information in this chapter, describe how you might diagnose a patient with tuberculosis.

4. Genetic counseling is a growing field in medicine. Think about what you learned in this chapter. What kinds of services might a genetic counselor provide? What techniques might a genetic counselor use?

What is happening in this picture? A clue as to what is happening in this picture comes from the colors in the dot array. The colors result from different fluorescent dyes labeling a specific short sequence of DNA. A series of these short DNA probes with the dyes are washed over a complete regular array of DNA nanoballs composed of fragmented pieces of an entire human genome. The pattern of colored spots produced after each probe binds is used to determine the DNA sequence in a process called sequencing by hybridization. Machines using this technology can process 350 complete human genomes per run.

T h i n k C ri ti c al l y

Does every DNA nanoball have a fluorescent dye-labeled DNA bound to it? Explain why or why not.

nantela/Getty Images

Self-Test (Check your answers in Appendix A.)

1.  The process shown in the diagram is ______.

a. replication

6.  During DNA replication, the lagging strand is replicated in short pieces known as ______.



b. transcription



a. RNA primase fragments



c. translation



b. Okazaki fragments



d. recombination



c. replicons



e. transformation



d. leading strands



e. promoters

7.  The section of the tRNA shown in blue is best described as the ______.

2.  Which of the following nitrogen-containing bases would NOT be found in a molecule of RNA?

a. adenine



b. cytosine



c. guanine



d. thymine



e. uracil



a. codon



b. backbone



c. noncoding region



d. unpaired region



e. anticodon

3.  Because a newly synthesized DNA molecule consists of one old strand and one new strand, DNA replication is described as ______.

a. semiconservative



b. conservative

8.  The primary enzyme needed in the continuous replication of DNA in the 5′ to 3′ direction is ______.



c. transcriptive



a. DNA polymerase I



d. dispersive



b. DNA polymerase III



e. recombinatory



c. DNA gyrase

4.  Review the Microbiology InSight, Figure 8.1, and answer this question.



d. primase



e. helicase



The process of ______ copies DNA, ______ makes an RNA molecule from a DNA template, and ______ assembles amino acids into proteins using the information from the RNA sequence.

9.  Analysis of a bacterial protein shows it contains 400 amino acids. What is the minimum number of nucleotides present in the gene for this protein?



a. replication; translation; transcription



a. 100



b. transcription; replication; translation



b. 400



c. replication; transcription; translation



c. 1200



d. translation; transcription; replication



d. 4000



e. translation; replication; transcription



e. 80,000

5.  Replication of DNA begins at the ______.

10.  A sequence error that occurs randomly during replication is known as a(n) ______.



a. start codon



b. promoter



a. spontaneous mutation



c. operator



b. nonsense mutation



d. origin site



c. reversion mutation



e. termination site



d. sense mutation



e. induced mutation

240  CHAPTER 8  Microbial Genetics and Genetic Engineering

11.  As bacterial DNA replicates, a point mutation occurs in which an A nucleotide is changed to a C nucleotide. Although the mutation changes the codon sequence, it does not change the resulting amino acid in the protein. This would best be described as a ______.

a. nonsense mutation



b. missense mutation



c. splicing site mutation



d. frameshift mutation



e. silent mutation

12.  The Ames test evaluates the ______.

15.  Restriction enzymes typically cut sequences at sites such as the one shown in the diagram that ______.

a. are random DNA sequences



b. do not leave sticky ends



c. are random RNA sequences



d. are palindromic



e. are double-stranded RNA sequences



a. cloning vector



b. polymerase chain reaction



b. drug sensitivity of a bacterium



c. sequencing reaction



c. ability of a bacterium to transfer its genetic information by conjugation



d. ligase reaction



e. restriction digestion



d. ability of a virus to infect a bacterium



e. genetic information of an organism’s genome

13.  Review the Process Diagram, Figure 8.9, and answer this question.

The type of horizontal gene transfer that involves a physical connection between two bacterial cells is ______.

3´ GGA T CC CC T AGG

3´

17.  Review What a Microbiologist Sees, and answer this question.

The yield of corn in a field infested by the European corn borer larvae is ______.



a. increased by pesticide application



b. decreased if the corn is genetically modified with the Bt delta endotoxin gene



a. transformation



b. transduction



c. decreased by pesticide application



c. conjugation





d. recombination

d. increased if the corn is genetically modified with the Bt delta endotoxin gene



e. expression



e. Both a and d are correct.

14.  Based on the diagram of the lac operon, which of the following statements is correct?

a. When lactose is absent, the lac operon is on.



b. Lactose inhibits the DNA-binding activity of the repressor protein.



c. When β-galactosidase is present, the operon is off.



d. Lactose is a repressor of the lac operon.



e. RNA polymerase blocks transcription of the structural genes. P

Regulatory gene

18.  The use of chain-terminating nucleotides to terminate chain elongation at various points is the basis for ______.

a. gel electrophoresis



b. restriction digestion



c. gene cloning



d. ligation reactions



e. DNA sequencing

19.  Review The Microbiologist’s Toolbox, and answer this question.

DNA is pulled toward the ______ end of an agarose gel because it is dissolved in a pH 8 buffer so all the phosphate groups have ______.



a. positively charged; a negative charge



b. negatively charged; a positive charge



c. positively charged; no charge



d. negatively charged; no charge



e. neutral end; no charge

T

20.  Review the Clinical Application, and answer this question. Repressor

Lactose



5´

16.  A microbiologist designs an experiment to transfer a gene from a pathogenic bacterium into a laboratory strain of Escherichia coli to discover whether the gene confers virulence. One method for transferring the gene into E. coli would be to use a ______.

a. ability of a chemical to induce mutations in a gene in Salmonella



5´



What is the function of BRCA1?



a. DNA repair



b. RNA repair



c. protein repair



d. protein synthesis



e. a restriction enzyme

9

Microbial Growth and Control RAPID GROWTH OF MICROBES

A

Courtesy of University of the West of England, Bristol

  human egg is fertilized and, a short 38 weeks later, a baby is born. This timespan represents the period of most rapid growth for human cells. During these 9 months, a human goes from one cell to hundreds of billions of cells, from a fertilized egg weighing a millionth of a gram to a baby weighing about 3 kg. Although this growth rate is rapid for humans, it is very slow compared with the growth rate of microbes. For example, if one bacterial cell could grow under consistently favorable conditions, it would form a mass the size of a newborn infant in just 17 hours. However, typically, as the bacterial cells multiply, conditions become increasingly less favorable, and the growth rate slows. When microbiologists refer to microbial growth, they are normally referring to an increase in the number of individuals in a population, not to an increase in the size of the individual microbes. Microbial growth requires raw materials, energy, and genetic blueprints to produce new microbes and increase population size. This chapter analyzes the requirements for microbial growth, how we use that knowledge to grow microbes in the lab for identification, and the physical and chemical methods we use to control it.

Bioluminescent bacteria produce their own light as they grow.

CHAPTER OUTLINE 9.1 Requirements for Microbial Growth  244 • Energy Sources • Physical Requirements ■ Case Study: Foodborne Illness from Home-Prepared Fermented Tofu • Chemical Requirements 9.2 Bacterial Reproduction and Growth  249 • Cell Division • Growth Rate of Bacteria • Phases of Growth • Methods of Quantifying Bacterial Growth ■ The Microbiologist’s Toolbox: Dilution Plating 9.3 Laboratory Growth of Microorganisms  254 • Obtaining a Pure Culture • Growth Media ■ What a Microbiologist Sees: Biofilm Formation on Teeth • Bacteria That Cannot Be Cultured

Dr. Kari Lounatmaa/Science Source Images

9.4 Microbial Cultures in Clinical Practice  260 • Specimen Collection • Specimen Analysis

A colorized scanning electron micrograph shows growing Lactobacillus, beneficial bacteria found in the human gastrointestinal and reproductive systems.

9.5 Controlling Microbial Growth  263 • Physical Methods • Radiation • Chemical Methods ■ Clinical Application: Alcohol-Based Hand Sanitizers in Health Care Settings

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 244 ❑ p. 249 ❑ p. 254 ❑ p. 260 ❑ p. 263 ❑ ❑ Read the text and study all figures and visuals.

Answer any questions.

Analyze key features

❑ ❑ ❑ ❑ ❑ ❑ ❑

Case Study, p. 245 Microbiology InSight, p. 249 Process Diagram p. 251 ❑ p. 262 ❑ The Microbiologist’s Toolbox, p. 253 What a Microbiologist Sees, p. 258 Clinical Application, p. 267 Stop: Answer the Concept Checks before you go on. p. 248 ❑ p. 254 ❑ p. 259 ❑ p. 263 ❑ p. 268 ❑

End of chapter

❑ ❑ ❑ ❑

Review the Summary and Key Terms. Answer the Critical and Creative Thinking Questions. Answer What is happening in this picture? Complete the Self-Test and check your answers.

  243

9. 1

Requirements for Microbial Growth

LEARNING OBJECTIVES 1. Describe the energy sources used by microbes. 2. Explain the physical requirements for microbial growth, including pH, temperature, and osmolarity.

3. Describe the chemical requirements for microbial growth.

icrobes require a constant supply of energy to make adenosine triphosphate (ATP), which, in turn, is the source of energy for the metabolic processes necessary to produce new cells (see Remember This!). A microbe must also have a habitat for reproduction that is within the range of the physical and chemical parameters that allow for metabolic function. In a laboratory, this habitat is provided through a culture. Physical requirements include appropriate acidity culture The culti(pH), temperature, and osmolarvation of cells in an ity, whereas chemical requireartificial medium conments involve levels of oxygen taining nutrients. and other essential elements.

The eukaryotic algae are also photoautotrophs. Ancestors of green algae evolved into present-day vascular plants. Photoheterotrophs use light as an energy source and organic acids as a carbon source. These include a small group of green and purple nonsulfur bacteria. Other microbes are chemotrophs, which obtain their energy by oxidation of organic or inorganic compounds. Most chemotrophs are chemoheterotrophs and obtain their carbon from organic molecules in the environment. For example, soil bacteria, molds, and protozoa feed on decaying plant detritus. Pathogenic microbes are chemoheterotrophs that use organic molecules from the human body as nutrient sources. A small group of chemotrophs, known as chemoautotrophs, oxidize inorganic molecules, such as Fe+2 or SO4=, as energy and electron sources. CO2 is used as a carbon source. The role of these microbes in the recycling of nutrients is discussed in Chapter 22.

M

Remember This!  Bacterial cells synthesize ATP using several different metabolic pathways. Examine Figures 7.13 and 7.15 to review the key pathways to produce ATP: glycolysis, fermentation, respiration, and photosynthesis.

Energy Sources Microbes are classified by the source of energy they use for growth (Table 9.1). The two basic sources of energy for microbial growth are light energy and chemical energy. Microbes that use light energy are classified as phototrophs. Most phototrophs are photoautotrophs, which means that they obtain the carbon they need to build macromolecules from CO2. Photoautotrophs include the photosynthetic bacteria or cyanobacteria. Modern evolutionary analysis indicates some ancestral cyanobacteria developed a symbiotic relationship with ancestral eukaryotic cells and evolved into chloroplasts.

Physical Requirements The physical environment affects the rate at which a microbe will grow or whether a microbe can grow. Common physical parameters considered for microbial growth include pH, temperature, and osmolarity.

pH  The acidity level (pH) of the environment is one factor in microbial growth. Most bacteria live in soil, aquatic or benthic habitats (muds at the bottom of aquatic habitats), or in or on macroscopic living things. These environments typically have a pH range of 6.5 to 7.5, and microbes have adapted to grow best within this range. At pH levels much higher or lower than normal, key metabolic processes fail and the microbe stops growing.

Classification of living microorganisms by energy and carbon source  Table 9.1 Energy source

Carbon source

Classification

Example

Light

Organic molecules Inorganic molecules

Photoheterotroph Photoautotroph

Rhodobacter Anabaena

Chemicals

Organic molecules Inorganic molecules

Chemoheterotroph Chemoautotroph

Staphylococcus Acidithiobacillus ferrooxicans

244  CHAPTER 9  Microbial Growth and Control

Case Study

✓ The Planner

Foodborne Illness from Home-Prepared Fermented Tofu Cultures of stool specimens revealed Clostridium botulinum (Figure b). The same pathogen was found in the fermented tofu samples, which had a pH of 6.8. Environmental conditions that facilitate endospore germination and growth of C. botulinum include a pH greater than 4.6, anaerobic conditions, low salt or sugar content, and temperatures above 4°C (39.2°F). b.

Endospore inside bacterium

CAVALLINI JAMES/BSIP/Science Source Images

In early November, LeNa, a 67-year-old Asian-American woman, made a fermented tofu at home using a traditional recipe she learned in Taiwan. She started with commercially packaged tofu purchased at a retail market. She boiled the tofu, which kills bacterial cells quickly but not endospores. The tofu was towel dried and cut it into cubes. The cubes were placed in a bowl, covered with plastic wrap, and stored at room temperature for about 2 weeks. The tofu was then transferred to glass jars with chili powder, salt, white cooking wine, vegetable oil, and chicken bouillon to marinate at room temperature for several more days. The fermented tofu was stored at room temperature before being eaten. LeNa and her 75-year-old husband ate the fermented tofu for several days; however, LeNa ate more than her husband. After several days, LeNa began to suffer from double vision. Six days later, when she visited her doctor, he noticed additional facial paralysis (Figure a). LeNa also complained of dizziness, drooling, and difficulty swallowing. Further examination indicated sluggish tongue movement, slurred speech, and weakness in her right arm. LeNa’s husband reported 3 days of worsening double vision, dizziness, and difficulty swallowing. On physical examination, he also had sluggish tongue movement.

Arch Plast Surg. 2015 Jul;42(4): 461-468.

a.

2. Which cells would have survived in the tofu after boiling? INVESTIGATE: 3. Name the disease that is affecting this couple. 4. What are the early signs and symptoms of the disease? 5. In general, how is this disease normally prevented?

1. Describe the paralysis seen in the photos.

Both patients were admitted to an intensive care unit, administered botulinum antitoxin, and recovered after hospitalization for more than 1 week.

Very few bacteria can grow in acidic environments, which is why humans have been preventing spoilage in foods with the acids produced during fermentation for millennia. Cheese, yogurt, pickles, sauerkraut, and several other foods are preserved by lowering the pH through fermentation (see the Case Study). Some bacteria and archaea have adapted to survive in acid environments. These acidloving prokaryotes, or acidophiles, can grow at a pH as

low as 1. For example, Acidithiobacillus ferrooxicans lives in pyrite deposits, metabolizes iron and sulfur, and produces sulfuric acid. The acid can lead to major pollution of waterways from acidic mine drainage, but it can also be used advantageously to extract metal from ores through a process known as bleaching. Molds and yeasts generally can grow over a broader pH range than bacteria, and their optimum pH is more acidic, usually ranging between pH 5 to 6. Requirements for Microbial Growth  245

The effect of temperature on the growth of a bacterial culture • Figure 9.1 Bacterial growth rates change with temperature, and different species have different optimum growth temperatures.

a. Growth rate as a function of temperature The growth rate of Enterobacter sakazakii was determined in infant formula milk at various temperatures to determine the minimum, optimum, and maximum growth temperatures. (Source: Adapted from Iversen, C., Lane, M., Forsythe, S. J. (2004) The growth profile, thermotolerance and biofilm formation of Enterobacter sakazakii grown in infant formula milk. Let Appl Microbiol 38:378–382.)

Growth rate (min–1)

0.06 0.05 0.04 Maximum growth temperature

Minimum growth temperature

0.02 0.01 0

0

10

20 30 Temperature (°C)

40

Optimum growth temperature (°C)

120

Optimum growth temperature

0.03

b. The classification of microbes based on optimum growth temperature All microbes show a similar pattern of growth at different temperatures, but they can be classified into different groups based on their optimum growth rate.

100

Hyperthermophiles

80

60

40

Thermophiles

Mesophiles

20

0

50

Psychrophiles

–20

Inte rp re t th e D a ta Based on the diagram in part b, how would you classify the microbe shown in part a according to its temperature optimum?

Temperature  Microbial growth occurs within limits of low and high temperatures. The minimum growth temperature is the lowest temperature at which growth can occur. As the temperature increases, the growth rate of the microorganisms—the number of cells produced per unit of time—also increases (Figure 9.1a) until the optimum growth temperature, the maximum growth rate for a given set of conditions, is reached. As the temperature increases above the optimum, growth rates often rapidly decease until growth stops at the maximum growth temperature, the highest temperature at which growth can occur because of the denaturation of cellular enzymes. These physical parameters vary for differing growth conditions and different species of microbes. Microorganisms can be superficially classified based on their range of growth temperatures and optimum growth temperature (Figure 9.1b). The psychrophiles are microbes whose optimum growth rate is below 15°C. Psychrophiles that do not grow at room temperature are generally restricted to their natural habitats in polar ice or deep oceans. These are rarely pathogens. In contrast, facultative psychrophiles will grow at room temperature

246  CHAPTER 9  Microbial Growth and Control

and are a problem for food spoilage because they can ruin refrigerated foods. Mesophiles, microbes whose optimum growth rate is between 15°C and 50°C, are the most common type of microbe we encounter because our habitat has the same temperature range as the mesophiles. The beneficial and harmful microbes that live in and on us are mesophiles. These microbes generally have very rapid growth rates near 37°C, our body temperature. Thermophiles have an optimum growth temperature above 50°C. Bacteria important in decaying plant material in compost piles are thermophiles. As organic matter decays, temperatures rise to more than 50°C, allowing thermophiles to dominate the community of organisms in the compost ecosystem. Extreme thermophiles grow at temperatures greater than 80°C. They are normally associated with volcanic activity and live in hot springs and geysers or at deep sea hydrothermal vents.

Osmolarity  The total concentration of solute particles in the surrounding water, or its osmolarity, is another factor in microbial growth. For most microbes, the best

environment for growth is isotonic, where the concentration of all dissolved solutes is the same inside and outside the cell. Because the cell membrane of a living microorganism is selectively permeable, polar and charged solutes must be transported across the membrane using protein carriers. Water, however, moves freely into and out of the cell. When a cell is in a hypotonic environment, with a lower concentration of solutes than inside the cell, water flows into the cell as a result of osmosis (see Remember This!). Microbes in freshwater must be able to withstand this flow of water from an increased osmotic pressure or the cell will lyse, or burst. For bacteria, fungi, and algae, the tough cell wall that encases the cell prevents lysis. Protozoans often contain a contractile vacuole that expels excess water and prevents cell lysis.

Chemical components of the bacterium Escherichia coli  Table 9.2 Element

Remember This!  One key function of the bacterial cell wall is to resist the osmotic pressure caused by water entering the cell in a hypotonic environment. Reread Section 4.3 and examine Figure 4.3 to review the process of osmosis and its effects on bacteria.

Chemical Requirements In addition to an appropriate pH, temperature, and osmolarity, microbes must also have a habitat that supplies the chemical materials needed for their metabolic and reproductive processes. About 70% of any living cell is water, which is the solvent in which salts, metabolites, and macromolecules are dissolved. The fundamental components of cells include compounds made of carbon, hydrogen, oxygen, nitrogen, phosphorus, and sulfur; several different ions; and trace elements. As an example, Table 9.2 shows the elemental components of Escherichia coli.

Carbon  Carbon is needed for the synthesis of the carbon skeletons of macromolecules. In autotrophs, carbon is acquired by carbon fixation, the metabolic pathway in which carbon from CO2 is incorporated into organic molecules. Photoautotrophs use light energy to drive the

Carbon (C)

47

Oxygen (O)

20

Nitrogen (N)

14

Hydrogen (H)

8

Phosphorous (P)

3

Sodium (Na)

2

Potassium (K)

2

Chlorine (Cl)

2

Sulfur (S)

1

Magnesium (Mg)

0.7

Iron (Fe)

0.2

Calcium (Ca)

0.05 *

0.3

Trace elements *

An environment with a high solute concentration is also lethal to most microorganisms. Cells lose water through osmosis in a hypertonic environment where the concentration of all dissolved solutes is greater outside than inside the cell. This results in plasmolysis, or the shriveling of the cell. In microorganisms with a cell wall, plasmolysis causes the cell membrane to separate from the rigid cell wall, inhibiting the cell’s growth. Some microbes called halophiles have adapted to environments with high concentrations of dissolved solutes. For example, a common skin pathogen, Staphylococcus aureus, survives in nasal mucus that inhibits the growth of most bacteria. Extreme halophilic bacteria can grow in environments containing 20% to 30% salt, such as the Great Salt Lake or the Dead Sea.

% Dry mass

Cobalt (Co), copper (Cu), zinc (Zn), molybdenum (Mo).

Source: Neidhardt F., Ingraham J., and Schaechte M. (1990) Physiology of the Bacterial Cell: A molecular approach. Sinauer Associates Inc.

energy-requiring process of carbon fixation. Bacterial chemoautotrophs also fix carbon, but they use energy released from the oxidation of inorganic chemicals such as Fe+3. Chemotrophs obtain carbon from the organic molecules in the nutrients they take in.

Nitrogen  Bacteria are the only living organisms that can convert atmospheric N2 to a biologically useful form. This process is known as nitrogen fixation. N2 from the atmosphere is converted to NH4+, which can be used in cellular metabolism to make amino acids and nitrogencontaining bases. Bacteria synthesize approximately 85% of all fixed nitrogen. The rest is produced during the making of fertilizer or by natural processes, such as lightning strikes. Without nitrogen-fixing bacteria, most life on Earth would end within weeks. Oxygen  The growth of bacteria can be significantly affected by the absence or presence of oxygen in their environment and whether their respiratory pathways are anaerobic or aerobic (see Remember This!). During metabolism at normal oxygen concentrations, superoxide free radicals (O2−) are formed in small amounts. These radicals oxidize DNA and proteins, causing sufficient damage to kill the cell. Many bacteria produce one or more enzymes that prevent damage from oxidizing agents. Superoxide dismutase (SOD) and catalase prevent the accumulation of damaging oxidizing chemicals: O2− + O2− + 2H+ SOD H2O2 + O2 2H2O2 Catalase

2 H2O + O2

Requirements for Microbial Growth  247

Growth pattern of bacteria in semisolid cultures with varying concentrations of oxygen • Figure 9.2 In a semisolid growth medium, an oxygen gradient develops with a decreasing oxygen concentration toward the bottom of the tube. The growth pattern seen after a small amount of bacteria was stabbed into the medium can be used to evaluate the oxygen metabolism of the bacteria.

Bacterial growth

Obligate aerobes only grow at the top of the tube, where the oxygen level is highest.

Microaerophiles grow best at the lower oxygen levels lower down in the test tube.

Facultative anaerobes can grow without oxygen lower in the test tube, but grow better at the top.

The growth of bacteria depends on the presence of these enzymes and oxygen and whether the bacteria are aerobic or anaerobic (Figure 9.2). Obligate aerobes require a constant supply of oxygen for aerobic respiration. Microaerophiles require oxygen, but grow best at low oxygen concentrations. Facultative anaerobes are capable of both aerobic and anaerobic respiration. They grow faster when oxygen is present, but in the absence of oxygen, they can grow using fermentation. Aerotolerant anaerobes grow in anaerobic environments using fermentation, but they can also survive with slow growth in environments containing molecular oxygen. Obligate anaerobes lack enzymes that degrade the toxic by-products produced when living in an oxygen environment. Therefore, they can grow only in an anaerobic environment. Remember This!  Aerobic respiration requires oxygen as a final electron acceptor during oxidative phosphorylation. Cells using a fermentation pathway do not require oxygen. As necessary, review this material from Section 7.4 to understand how oxygen can affect the metabolism of cellular microbes.

Ions and micronutrients  Cells also require ions and micronutrients. Sulfur and phosphorus ions are structural components of macromolecules. Phosphorus is primarily found in ATP and the sugar-phosphate backbone that makes up nucleic acids. Sulfur is a component of several amino acids found in proteins. Sulfur and phosphorus can be obtained as dissolved ions (HPO4=, SO4=). Other ions primarily regulate osmotic balance. For example, K+, Na+, and C1− have important roles in regulating osmotic balance as the extracellular environment changes.

248  CHAPTER 9  Microbial Growth and Control

Aerotolerant anaerobes grow throughout the test tube because oxygen has no effect on their growth rate.

Obligate anaerobes only grow at the bottom of the test tube, where there is no oxygen.

A sk Yo u r se l f Which class of bacteria is least affected by oxygen concentrations?

Micronutrients are ions and growth factors needed in very small amounts. Micronutrients generally act as cofactors to activate critical enzymes in the cell. For example, iron is an essential component of the reaction centers of membrane-bound proteins in the electron transfer chain. Mg2+, Ca2+, Cu2+, and Mn2+ are also important enzyme cofactors. For many bacteria, iron acquisition is a key rate-limiting factor for their growth. Because Fe+3 has very low solubility, very little of it is available to microbes. Therefore, microbes synthesize a diverse group of chemicals known as siderophores that scavenge iron from iron oxides and iron hydroxides in their mineral state by forming a soluble Fe+3 complex with the siderophore. The iron-coupled siderophore is then transported back into the cell where the Fe+3 is released. Pathogenic bacteria also produce siderophores to acquire Fe+3 from host body cells. To prevent bacterial growth, body cells produce several ironbinding proteins that have a higher affinity for Fe+3 than most bacterial siderophores (discussed in Chapter 10).

1. How do chemoautotrophs acquire the energy they need for growth? 2. What type of organism grows optimally at low pH? 3. How does a typical bacterium acquire iron from its environment?

9 .2

Bacterial Reproduction and Growth

LEARNING OBJECTIVES

Evolutionary success is determined by whether a cell’s genetic information is sufficient for the cell to survive and pass the genetic information on to the next generation. From this perspective, cell division is the most important microbial activity.

1. Describe binary fission in bacteria. 2. Explain the rate of bacterial growth. 3. Describe the phases of a bacterial growth curve. 4. Compare and contrast methods for quantifying viable cell density and total cell density.

Cell Division

o reproduce, a bacterium must synthesize or obtain all the components for a new cell. This typically means translating more than 2 million protein molecules from approximately 2000 different genes. The cell must also synthesize enough peptidoglycan to construct a new cell wall to prevent osmotic lysis and make or import sufficient metabolites, cofactors, and ions for cellular metabolism. All the additional materials mean that the cell grows in size before dividing.

Bacteria divide by binary fission. binary fission Compared with reproduction in The asexual reproeukaryotic cells, binary fission is duction process of relatively simple because bacteria prokaryotes whereby do not have a nucleus or multiple a cell, after growth, linear chromosomes to partition divides into two equal to the daughter cells. Bacterial cell daughter cells. division basically requires three processes: replication of the chromosome, partitioning of the daughter chromosomes into the new cells (Figure 9.3a), and binary fission, the division of the two cells (Figure 9.3b).

bacteria  

•  Figure 9.3

The process of bacterial binary fission requires replication of the chromosome, partitioning of the daughter chromosomes into the two new cells, and separation of the cells. This simple process results in rapid, exponential growth of bacterial populations.

b. DNA replication

A bacillus-shaped bacterium undergoes binary fission.

and chromosome segregation DNA replication begins at the origin site and rapidly migrates to opposite sides of the cell. DNA replication is completed at the termination site in the middle of the cell.

CNRI/Science Source Images

a. Binary fission

A sk Yo u rs e l f Where does the contractile protein ring form in the cell?

Termination of replication site Ring of contractile proteins Septum formation

Origin of replication site

✓ The Planner c. Cell separation The presence of the nucleoid inhibits formation of a contractile protein ring. After chromosome replication is complete, the contractile ring forms in the center of the cell. The protein ring assembly and contraction is integrated with septum formation. John Beckwith

Microbiology InSight  Cell division in

Dr. Kari Lounatmaa/Science Source Images

T

DNA replication begins and proceeds bidirectionally. The two beginning sites of replication attach to proteins associated with the cytoskeleton and are moved to opposite sides of the cell while the rest of the chromosome is replicated. After the replication of the genetic material in the nucleoid, a ring of contractile proteins forms in the center of the cell (Figure 9.3c). Because this ring of proteins is inhibited by the presence of the nucleoids, it only forms once the chromosomes have replicated and the two nucleoids are largely restricted to opposite sides of the cell. Septum formation is driven by the assembly and contraction of the ring of contractile proteins in the center of the cell.

Exponential increase in cell numbers during binary fission   Table 9.3 Number of generations

Growth Rate of Bacteria As bacteria divide by binary fission, cell numbers double with each division, increasing exponentially. Each successive division is known as a generation. Exponential cell growth for cell division can be described by the growth equation Nt = N0 2δ where Nt is the number of cells at any given time (t); N0 is the number of cells at t = 0; and δ is the number of generations or the number of times the cell has divided. So if you started with one cell, after three generations, there would be eight cells present in the culture: 8 = (1)23. The time it takes for a cell to grow and divide into two cells is the generation time (τ). δ, the number of generations, is equal to t/τ where τ is the generation time and t is time. Under favorable conditions (such as on warm food left out after a meal), rapidly growing bacteria such as E. coli can grow with a generation time of 20 minutes. Initially, this doesn’t appear very impressive. After an hour, one cell would divide three times and produce eight cells. However,

Cell number (expressed as an exponent)

Number of cells

Time (minutes)

0

20

1

0

1

2

1

2

20

2

22

4

40

3

23

8

60

4

24

16

80

⋮

⋮

⋮

⋮

20

220

1,048,576

400

δ

2δ

Nt

t

as exponential growth continued, the numbers would increase dramatically. In less than 7 hours, more than a million cells would be produced (Table 9.3). After 24 hours, it would fill the volume of more than 40 freight cars of a train. However, this rate of growth would never occur for 24 hours, because although bacterial populations can grow very quickly under favorable conditions, they don’t grow quickly for long periods because they rapidly use up available nutrients or cause the buildup of waste products that make the environment unfavorable for rapid growth. The growing number of cells in a population can be followed by measuring the cell density at different times. Cell populations growing exponentially generate a linear function when the log of the cell density is plotted as a function of the time (Figure 9.4). The generation time of the cells can be calculated from this growth curve by

Exponential growth of a bacterial population • Figure 9.4 E. coli cell density was measured as a function of time and plotted on logarithmic (blue) and linear (red) scales. 9.0

1,000,000,000 800,000,000 700,000,000

8.6

600,000,000 500,000,000

8.4

400,000,000

8.2

300,000,000

8.0 7.8

0

50

100

150 Time (min)

Log (cell density)

200,000,000

Cell density (cells/ml)

100,000,000

200

250

250  CHAPTER 9  Microbial Growth and Control

Cell density (cells/ml)

Log (cell density)

900,000,000

Slope = (log 2)/τ; = 0.0034 min–1; τ = 88 min

8.8

In t e r p r e t t h e Da t a Roughly how long did it take for the population to reach half a billion cells?

Log10 viable cell/mL (colony-forming units/mL)

Without a continuous input of nutrients and removal of wastes, a bacterial population will go through a series of defined phases.

Exponential (or log) phase

Lag phase 9.0

8.0

The growth rate reaches a constant maximum value for the given conditions. 2

Stationary phase 3 The population consumes available nutrients and critical waste products collect.

Death phase

4 Cells often undergo morphological changes or lysis during the death phase.

7.0 Cells alter their metabolism to adapt to the new environment. 6.0 1 Hours

Days Time

Pu t I t To g e ther

Review Section 9.1 Requirements for Microbial Growth, and answer this question. For a culture to remain in the exponential growth phase, it would require the constant supply of _____ and _____ and the constant removal of _____ .

determining the slope of the line. For the growth of the bacterial population shown in Figure 9.4, the slope is 0.0034 minute−1. Solving for τ, the generation time is 88 minutes. The rapid growth of bacterial cells is enables them as a population to quickly generate genetic diversity even though they reproduce by binary fission rather than using sexual reproduction. Binary fission is a type of asexual reproduction that produces two genetically identical daughter cells except when spontaneous mutations take place. As seen in Table 9.3, a single bacterium that has a 20-minute generation time will grow to more than 1 million cells in 400 minutes. Given that a typical bacterial cell has about 5 million base pairs in its genome, and DNA mutations occur at approximately 1 × 10−6 base pairs copied, the population of 1 million bacterial cells would be expected to contain about 5 million mutations. Consequently, the population as a whole can have significant genetic diversity.

Phases of Growth When bacteria are introduced into a new environment, they often go through phases of growth. This is seen clearly when cell density of a population is measured at regular intervals. Four phases of bacterial growth are seen (Figure 9.5). During the lag phase, the initial period

after introduction into a new environment, there is no increase in cell number. The length of the lag phase can vary from an hour to several days. The exponential growth phase, or log phase, is a period of logarithmic increase in cell number. During this period, the generation time reaches a constant minimum value for the given environmental conditions for the particular bacteria. Bacteria are most sensitive to antibacterial agents during the log phase because many agents act on enzymes used by actively growing cells. During the stationary phase, cell numbers no longer increase and the metabolic activities of the cells change significantly as they adapt to conditions that are no longer favorable for growth. The stationary phase can last for hours or weeks. Cells in the stationary phase eventually die. When the number of cell deaths exceeds the number of new cells formed, the death phase begins. Death phase is exponential, but not at a constant rate, so some cells can survive for long periods after the stationary phase. For industrial purposes, it is desirable to keep a bacterial population in exponential growth so that it can continuously and rapidly produce a desired product. This can be done using a specialized apparatus called a chemostat, which continuously adds fresh growth medium and drains off the spent medium to allow the cells to keep growing exponentially. Bacterial Reproduction and Growth  251

Process Diagram

✓ The Planner

Growth phases of a bacterial population • Figure 9.5

Using direct count to determine bacterial cell density • Figure 9.6 A drop of bacterial culture is added to the slide and spreads out evenly, with excess fluid flowing into the side channels. A cover slip is placed on top so that a fixed volume is trapped between the etched square and the cover slip. The number of cells in each square is divided by the volume of fluid trapped under the cover slip to determine the cell density.

Bacterial suspension

A sk You r se lf

Cover slip

To determine cell density using a Petroff-Hausser chamber, you must know the number of _____ and the volume of _____ under the grid.

Bacterial suspension Petroff-Hauser counting chamber

Methods of Quantifying Bacterial Growth The density of microbes growing in a population can be measured in many different ways.

The direct count One common method is a direct count, which involves counting cells directly using a microscope and a specialized slide. This slide, known as a Petroff-Hausser chamber, traps a fixed volume of fluid under the cover slip and over a grid inscribed on the surface of the slide. By counting the number of cells within the grid and dividing by the known volume trapped under that area of the grid, the cell density, or number of cells/ml, is determined (Figure 9.6). Spectrophotometry  A rapid method for determining cell density indirectly is to measure the apparent

absorbance using a spectrophotometer set at a wavelength that is absorbed minimally by the growth medium, but scattered maximally by the cells (Figure 9.7). The apparent absorbance is caused by the turbidity, the cloudiness of the culture caused by large numbers of bacteria. For bacteria in nutrient broth, the wavelengths used are typically between 550 nm and 600 nm. When photons passing through the spectrophotometer are scattered by the bacteria, they are not read by the photodetector. As a result, the greater the cell density, the higher the apparent absorbance. The absorbance readings can be calibrated using techniques that determine the actual cell densities. Although both the direct count using a microscope and the indirect estimate using a spectrophotometer are techniques for rapidly determining cell density, they have the inherent problem of not being able to distinguish between living and dead bacterial cells.

Using spectrophotometry to determine bacterial cell density • Figure 9.7 Light of a selected wavelength and intensity (I0) strikes the sample. After some of the photons are scattered by the bacterial cells, fewer photons remain to be detected (It). The transmittance measures the ratio of It/I0; the absorbance measures –log (It/I0).

Mechanisms to focus light and select wavelength

% transmittance I0

It

∞

Light source

Sample

2

Photodetector

A sk Yo u rs e l f In interpreting the results of spectrophotometry, _____ is the ratio of the intensity of light that passes straight through the sample to the intensity of light that initially strikes the sample.

252  CHAPTER 9  Microbial Growth and Control

Absorbance Meter

T he M icrobio l ogist ’ s T oo l bo x

✓ The Planner

Dilution Plating Serial dilutions are often used in determining the number of bacterial cells in a dense culture. The culture can be easily diluted by factors of 10 in a series of sterile broths (Figure a). In the spread plate method, a small (0.10-ml) sample of the diluted culture is aseptically smeared over the surface of a sterile agar plate (Figure b). Only a small sample can be used because it must dry rapidly on the agar surface. In the pour plate method, a 1.0-ml sample of a dilution is mixed with melted agar cooled to approximately 45°C, then poured into a Petri dish, allowed to solidify, and incubated (Figure c). After an overnight incubation, bacterial colonies are counted. The colonies are created by colony-forming units (cfus), presumably single cells that have produced millions of identical cells, which can now be seen as a visible colony. Because a colony

was ultimately derived from a single cell, any cultures derived solely from a single colony are considered pure cultures. The bacterial density of the original culture is determined by dividing the number of colonies by the volume plated and the dilution. For example, Pour plate method 25 colonies  1 ml * 1/10,000

= 2.5 × 105 cfu/ml

Spread plate method 21 colonies    = 2.1 × 105 cfu/ml 0.10 ml * 1/1,000

0.1 mL

Original culture 1 mL

1 mL

1 mL

1 mL 1 mL

Solid agar medium

Incubation

Spread plate method

Bacterial colonies on surface

9 mL broth 9 mL broth 9 mL broth 9 mL broth 1:10 1:100 1:1000 1:10,000 dilution dilution dilution dilution

A sk Yo u rs e l f Which of the following techniques could be used in determining the number of cells in a dense culture? a. serial dilution b. spectrophotometry c. the pour plate method d. All of these techniques could be used.

Dilution plating Pure isolated colonies can be produced and quantified using dilution plating, including the pour plate or spread plate technique. Both methods require dilution of a microbial culture followed by growth of the microbes on agar plates. The microbes are diluted to the point where only 20 to 200 microbes will grow on the agar medium. This number makes it easier to isolate and count the individual colonies and to identify the colony types based on their morphology. Spread plate methods simply require the dispersion of the diluted sample over the surface of agar. However, as colonies grow, they may overlap, producing contaminated

Incubation 9 mL of molten agar medium

Pour plate method

Bacterial colonies on surface and in agar

colonies. The pour plate method traps most colonies in the agar, which is more likely to prevent them from growing together, but the melted agar must remain above 40°C until mixed with the microbes. It is then poured into a Petri dish to solidify. As a result, temperature-sensitive microbes may be killed. In addition, growth within the agar itself may lower the availability of oxygen and inhibit the growth of oxygen-sensitive microbes. Because dilutions can be done quantitatively, these techniques are used to determine the viable cell density of a culture (see The Microbiologist’s Toolbox). Dilution plating doesn’t give accurate counts for microbes that grow in pairs, filaments, or Bacterial Reproduction and Growth  253

The filtration method • Figure 9.8 In this assay for the presence of E. coli in water samples, water to be tested is passed through a filter with 0.45-μm pores that trap bacteria. The thin filter is placed on top of EMB agar, which selects for fecal coliforms, gramnegative, and lactose-fermenting bacteria. These bacteria grow with a green metallic sheen.

Membrane filter Filter support

A sk Yo u rs e l f The steps in testing for E. coli in a water sample include _____ . a. serial dilutions b. filtration c. use of a selective medium d. both b and c

To vacuum

100 ml of water sample for testing Transfer membrane to growth medium

Incubate at 37°C overnight

Colonies with a green metallic sheen indicate contamination by fecal bacteria.

clusters that are not easily separated into individual cells. When this occurs, a colony is formed from more than one cell and the true cell density is underestimated. As a result, the density determined from dilution methods followed by growth on agar plates is expressed in colony-forming units (cfus) per milliliter rather than cells per milliliter to reflect more accurately what is actually measured.

to allow the colonies to grow. This method is commonly used with selective and differential agar to test for the presence of E. coli in water samples (Figure 9.8).

Filtration  At times, microbial cell density is too low to be measured accurately using dilution plating, microscopy, or absorbance. It is then necessary to use a method that allows the microbes to be concentrated before plating to determine the viable cell count. This can be done conveniently by membrane filtration. Filters with pores smaller than bacteria trap bacteria on their surface as fluid passes through. The thin filter can then be placed on an agar plate permitting nutrients to diffuse up through the filter

1. How does cytokinesis occur in bacteria? 2. Why don’t bacterial populations grow exponentially for long periods? 3. Why do bacteria stop growing during the stationary phase? 4. What are the advantages and disadvantages of the pour plate method versus the direct count method using a Petroff-Hausser chamber?

9. 3

Laboratory Growth of Microorganisms

LEARNING OBJECTIVES 1. Describe the principles involved in growing and isolating pure cultures in growth media in a laboratory. 2. Compare and contrast chemically defined and complex growth media. 3. Explain how selective, differential, and enrichment media are used to isolate desired microbes from mixed cultures.

T

he ability to isolate and grow a microorganism in the laboratory makes the identification for medical purposes possible and the study of its structure and physiology easier. It also allows for in vitro testing of

potential antimicrobial agents against pathogenic organisms. Although most microbes cannot currently be grown in the laboratory, we have learned a significant amount about the basics of how to cultivate microbes in laboratory media. Microbes are grown in a laboratory setting in a growth medium, an artificial liquid or gel containing nutrients designed to meet the microbes’ specific growth requirements. Growth in the medium is initiated by placing an inoculum, a small sample of microorganisms, into the growth medium to produce a culture. The growth medium that receives the inoculum needs to be sterile initially so the culture grows only the desired microbes. Microbial samples for growth can come from a patient specimen or from environmental samples.

Obtaining a Pure Culture

Growth Media

Microbes naturally grow in complex communities. To identify and study a single type of microbe, such as a bacterial pathogen, it is necessary to first isolate it from the other microbes with which it grows. As an isolated bacterial cell divides, it grows into a colony, a visible mass of cells descended from a single cell. Because the colony is derived from a single ancestor, it is a pure culture. A pure culture from a sample containing a mixed population of microbes can be obtained by the streak plate method (Figure 9.9). For bacteria and fungi, a sterile inoculation loop is used to spread a mixed population of microbial cells across the surface of an agar plate containing appropriate nutrients for growth. As this is done, the cells become separated as they drop off the loop one at a time. The streak plate method works well when the microbes to be purified are present in high concentrations. To use streak plate isolation for samples in which microbes are at low concentrations, the numbers must first be increased by growth. Once isolated, pure cultures can be put into fresh media for further growth and analysis or into a storage medium and frozen at −80°C for long-term storage.

A growth medium contains nutrients as well as chemicals to balance osmolarity and pH to the ideal parameters for the bacteria being grown. Particular growth media are selected based on the type of microbe being grown. In broad terms, a growth media can be classified by their physical or chemical properties. They can be further delineated based on their intended function.

Physical properties  Physically, the medium can be a liquid, a broth, or a semisolid. Broths are water-based media with various nutrients added. Broth cultures are grown in capped tubes or flasks. A semisolid medium is a broth with a solidifying agent added to it. Agar is the most widely used solidifying agent. It is a complex polysaccharide isolated from red algae. It remains semisolid to approximately 80°C and resists digestion by bacterial enzymes. Agar is also the best solid medium for growing bacteria. Solid cultures are grown on sterile agar with the agar and nutrients poured into a sterile Petri dish, a shallow round glass or plastic dish with a flat overlapping lid.

The streak plate method • Figure 9.9 A mixed culture of cells is streaked over a zone on the surface of growth medium using an inoculating loop. A second sterile inoculating loop is used to continue streaking some of the first inoculated cells across the agar. After additional zones of streaking, the cells within the culture have been separated and grow into single colonies.

Streak 1

Streak 2 Streak 3

A sk Yo u r se lf Streak 3

Streak 1

Streak 4

Streak 4

courtesy Ken Colwell

Streak 2

What practical purpose is served by the streak plate method? a. It separates the cells in a mixed culture so that pure colonies grow from single bacterial cells. b. It yields many colonies. c. It produces colonies mixed throughout the agar. d. All cells of a particular type clump together to form colonies.

Laboratory Growth of Microorganisms  255

Components of common laboratory growth media  Table 9.4 M9 broth (chemically defined) *Component

LB broth (complex)

Blood agar (complex)

Amount per l (g)

Component

Amount per l (g)

Component

Amount per l (g)

Na2HPO4

6.0

Tryptone**

10.0

Sheep blood

5.0

KH2PO4

3.0

Yeast extract

5.0

Peptone***

15.0

NaCl

0.5

NaCl

5.0

Liver digest

2.5

NH4Cl

1.0

Yeast extract

5.0

NaCl

5.0

Agar

15.0

*After autoclaving, a sterile solution of a carbohydrate source is added to a final concentration of 1%, MgSO4 to 4.0 mM and CaCl2 to 0.2 mM. **A mixture of peptides formed by the digestion of casein, a protein isolated from milk. ***A mixture of peptides formed from an enzymatic digest of animal protein.

Chemical properties of growth media   In terms of their chemical properties, media are classified as either chemically defined or complex. Table 9.4 presents the chemical components of some common laboratory growth media. A chemically defined medium is one in which the concentrations of all the components are known. The medium contains a carbon and an energy source, a pH buffer to balance H+ concentration, and various salts to maintain osmotic balance and provide sources of phosphorous, nitrogen, sulfur, and trace elements such as Ca+2, Mg+2, and Fe+3. Other trace elements are supplied as contaminants in the water. Some organisms may need amino acids, vitamins, or other organic growth factors added to the medium. A complex medium has extracts from yeast, meat, plants, or digests of proteins that provide the nutrients needed for bacterial and fungal growth. In contrast to chemically defined media, the exact chemical concentrations of these components are not known. Proteins digested into soluble peptides and amino acids by enzymes often provide the carbon and energy source as well as the nitrogen and sulfur sources. Vitamins, other organic growth factors, a phosphorus source, and trace elements are typically provided by meat or yeast extracts. For example, yeast cells are lysed and yeast extract, the watersoluble fraction that has been dried and powdered, is used in making complex growth media. Luria-Bertani (LB) broth is a complex medium with nutrients whose exact chemical makeup is unknown. Blood agar (agar enriched with sheep or horse blood) is a nutrient-rich medium that also contains vitamins, iron, and organic growth factors. It is commonly used in clinical microbiology labs to grow most bacterial pathogens. Media to enhance the growth of specific microbes  The general purpose of growth media is to promote the growth of a broad spectrum of microbes. Some

256  CHAPTER 9  Microbial Growth and Control

microbes require special treatment to grow. Fastidious microorganisms require growth factors not found in growth media routinely used in medical microbiology labs. For example, Haemophilus influenzae, which causes respiratory infections, is grown on chocolate agar. This medium is a variant of blood agar that contains blood that has been slowly heated to 80°C for 5 minutes to release nutrients that would not otherwise be available to the bacteria. An enrichment medium contains nutrients or components designed to enhance the growth of one group of microbes without specifically inhibiting the growth of others. These media are usually used to isolate microbes that are rare in a population and might be overgrown by others in a nonenriched culture. For example, a minimal medium may be supplemented with a pollutant from a waterway to isolate bacteria that grow rapidly by digesting and breaking down the pollutant. When bacteria from the waterway are added to the medium, those bacteria that are most efficient at using the pollutant as a carbon and energy source may outgrow other bacteria found in the water.

Selective and differential media  Selective and differential media are used to isolate or identify organisms from a mixed culture. Selective media are used to inhibit the growth of unwanted microorganisms in a mixed culture. Typically this involves inhibiting the growth of normal microbiota so that potential pathogens can be discovered. For example, modified Thayer-Martin agar is used to select for Neisseria gonorrhoeae (Figure 9.10a), the gramnegative pathogen that causes the sexually transmitted infection gonorrhea. The medium contains chocolate agar to grow fastidious organisms, but it also contains antimicrobial agents to inhibit the growth of normal microbiota that would be found in the vagina. Vancomycin inhibits the growth of gram-positive bacteria, colistin and trimethoprim inhibit the growth of gram-negative bacteria from

feces, and nystatin inhibits the growth of fungi. Identification of the pathogen and diagnosis of gonorrhea is possible because N. gonorrhoeae is one of the few microbes taken from this site that will grow on this medium. Differential media make it possible to distinguish between two different types of bacteria. For example, blood agar can be used to differentiate between bacteria that produce different types of enzymes that damage erythrocytes. Streptococcus pyogenes, the bacteria that cause strep throat,

lyse blood cells to form a clear halo around the colony. Streptococcus pneumoniae, bacteria that cause respiratory infections, affect the structure of heme so that the color of the blood agar around the colony changes from red to green (Figure 9.10b). Most media used in medical microbiology labs combine selective and differential features to isolate pathogens from the mixed population of normal microbiota contained in many specimens. For example, there are

Selective and differential growth media • Figure 9.10 Selective and differential media are important for isolating and identifying pathogenic bacteria from mixed populations in specimens.

Modified Thayer-Martin medium Modified Thayer-Martin medium with with Neisseria Neisseriagonorrheae gonorrheae

Chocolate agar mixed bacterial growth Chocolate agarwith with mixed bacterial from vagina growth from vagina

Bacterial colony

Greenish-brown halo

Clear halo

Courtesy Curtis E. Young Ph.D

Blood agar is a differential media that makes it possible to distinguish between β-hemolytic bacteria, which produce a clear halo around the colony, and α-hemolytic bacteria, which produce a greenish-brown halo around the colony.

Bacterial colony

Courtesy Curtis E. Young, Ph.D

b. Differential media

Renelle Woodall/CDC

Modified Thayer-Martin medium is a selective medium that contains a rich chocolate agar base. Chocolate agar alone provides a rich nutrient source for the unselected growth of the normal microbiota of the vagina. However, this selective medium contains added antimicrobial agents to inhibit the growth of unwanted microbes. As result, only N. gonorrhoeae grows from a vaginal specimen from a patient with gonorrhea.

courtesy of Dr. James Fishback, Department of Pathology, University of Kansas Medical Center

a. Selective media

Blood β-hemolytic colonies of Bloodagar agarshowing showing β-hemolytic clonies Streptococcus pyogenes of Streptococcus pyogenes

Blood agar α-hemolytic colonies of Blood agarshowing showing α-hemolytic Streptococcus pneumoniae colonies of Streptococcus pneumoniae

CNRI/Science Source Images

MacConkey agar is both selective and differential. The selectivity is provided by bile salts and dyes, which inhibit gram-positive bacterial growth. A pH-sensitive dye differentiates between bacteria by changing color under acid conditions so that the fermentation of lactose to acid end products by E. coli causes colonies to turn pink. Pathogens such as Salmonella, which do not ferment lactose, remain white.

Biophoto Associates/Science Source

c. Selective and differential media

MacConkey agar showing pink colonies of Escherichia coli

MacConkey agar showing white colonies of Salmonella enterica MacConkey agar showing white colonies of Salmonella enterica

A sk Yo u rs e l f Modified Thayer-Martin medium is _____ in color. Blood agarpink is _____ . of MacConkey agar showing colonies Escherichia coli

What a Microbiologist Sees Biofilm Formation on Teeth that far exceed their capabilities as individual bacteria. For instance, microbial biofilms are naturally tolerant of antibacterial doses up to 1000 times greater than doses that can kill the same species of bacteria that are living outside of a biofilm community. To study interactions between species within the plaque biofilm community, the growth of different bacteria was measured with saliva as the sole nutrient source. Biofilm formation was measured by visualizing bacteria that adhered to the glass sides of the flow chamber. Results from the study showed that the species Veillonella adhered to the glass chamber but did

a. Plaque growing on teeth as a biofilm

b. Scanning electron micrograph demonstrating the presence of mixed species biofilm in a chronic wound

CNRI/Science Source Images

Plaque on tooth

hundreds of different species of bacteria in a feces sample, and the pathogen to be identified is usually present in only a very small fraction of the total population. To help distinguish potential pathogens from the normal microbiota, a selective and differential medium is used. MacConkey agar contains bile salts and crystal violet that inhibit the growth of most gram-positive bacteria in feces. Gram-negative bacteria that can ferment lactose produce an acidic fermentation product that changes a colorless pH indicator to a pink color. These pink colonies are normally E. coli, the most abundant gram-negative bacteria in the normal microbiota of feces (Figure 9.10c). Gramnegative bacteria that do not ferment lactose grow using the peptone in MacConkey agar as a carbon and energy source and do not produce acid. As a result, the colonies remain their normal white color. Nonlactose-fermenting gram-negative bacilli found in feces are often Salmonella or Shigella, pathogenic bacteria that cause diarrhea. Therefore, screening MacConkey agar for pink colonies

258  CHAPTER 9  Microbial Growth and Control

James GA, Swogger E, Wolcott R, et al. Biofilms in chronic wounds. Wound Repair Regen. 2008 Jan-Feb;16(1):page 42, Figure 1D. Reprinted with permission from John Wiley and Sons.

If you look closely at your own teeth, you may see plaque buildup near the gum line (Figure a). You know from your dentist that plaque can damage tooth enamel, leading to decay. Microbiologists know that plaque is a complex biofilm of bacteria that adheres tightly to your teeth. A biofilm is a group of microorganisms that are stuck onto a surface by being embedded within a self-produced gluelike matrix. Biofilms can be as thin as a few cell layers or thousands of layers thick, depending on the environmental conditions (Figure b). Bacteria that that live in biofilm communities exhibit unique disease-causing ability, survival strategies, and resistance to antibacterial drugs

can initially be used to identify water samples that are contaminated with feces as indicated by the presence of E. coli. Alternatively, screening for white colonies isolated from a feces sample can serve as an initial screen for identifying Salmonella or Shigella infections.

Bacteria That Cannot Be Cultured Although growing bacteria in the laboratory has enabled researchers to explore the microbial world for decades, not all bacteria grow on laboratory growth media. If the density of bacteria from human feces is determined using a microscope and the bacteria are then grown on nutrient agar under aerobic conditions, only about 10% of the bacteria seen under the microscope actually form colonies. Approximately 30% of the bacteria seen under the microscope will form colonies under anaerobic conditions because many anaerobes live in the gastrointestinal tract. Only approximately 0.1% to 10% of the

✓ The Planner

c. A confocal micrograph showing Veillonella initiating biofilm formation but not growing significantly after 18 hours of incubation

d. Population density changes following 4 hours and 18 hours of incubation of Veillonella with other plaque-forming bacteria 1 × 106 *

Biovolume (μm3)

Periasamy S and Kolenbrander PE (2010) Central Role of the Early Colonizer Veillonella sp. in Establishing Multispecies Biofilm Communities with Initial, Middle, and Late Colonizers of Enamel. J Bact 192 (12):2925-2972.

not grow significantly after 18 hours of incubation (Figure c). However, when paired with other bacteria, Veillonella not only grew, but enhanced the growth of other species (Figure d). The results support the idea that Veillonella is important for establishing multispecies communities for the formation of dental plaque.

Veilonella shows little growth after 18 hours.

4 hours 18 hours

1 × 105 *

1 × 104

1 × 103

Veilonella adheres to the slide after 4 hours.

*

Streptococcus Veillonella Fusobacterium nucleatum oralis *Statistically significant increases in bacterial growth

(Adapted from Periasamy, S. and Kolenbrander, P.E (2010) Central Role of the Early Colonizer Veillonella sp. in Establishing Multispecies Biofilm Communities with Initial, Middle, and Late Colonizers of Enamel. J Bact 192 (12):2925-2972.)

In te rp re t th e D ata Which bacterial species showed the greatest increase in growth from 4 to 18 hours in the biochamber?

bacteria present in samples from soil and aquatic environments will grow in a lab. The remaining bacteria are currently unculturable because researchers have not yet found the right nutritional and environmental conditions to grow them in the laboratory. This means that most of the bacterial world is yet to be discovered and characterized. A second reason that bacteria may not grow in a laboratory culture is because their growth and survival may depend on other members of their community. Such tightly linked communities are often found in biofilms, complex communities of microorganisms that adhere to a solid surface by a matrix. Within these biofilms, the waste products of one microbe’s metabolism may serve as the primary nutrient source of another. In addition, organisms near the top of the biofilm may use oxygen and create a microaerophilic or anaerobic environment needed by microbes in the lower levels of the biofilm. Examples of biofilms include films of

bacteria used to treat wastewater in sewage treatment plants, dental plaque growing on your teeth (see What a Microbiologist Sees), and films of bacteria that can infect implanted devices, such as catheters and artificial joints.

1. Why is a culture started from a single colony isolated from a streak plate considered a pure culture? 2. Why are protein digests added to complex media? 3. How does MacConkey agar make it possible to differentiate between E. coli and Salmonella? Laboratory Growth of Microorganisms  259

9. 4

Microbial Cultures in Clinical Practice

LEARNING OBJECTIVES 1. Describe how specimens are obtained from different body sites.

2. Explain how microbial specimens are analyzed using cultures and other processes.

o far we have been examining the laboratory techniques involved in culturing microbes. Now we turn to the question of how the lab culture relates to patient care in terms of specimen collection and diagnosis. When physicians suspect an infectious microbe is causing an illness, they often need a specimen from the affected area to make an accurate diagnosis and determine an appropriate treatment plan. It is the function of clinical microbiology labs to determine if the patient’s illness is caused by a microbe, and if so, to identify the microbe. For many microbes, it is also necessary to determine the antimicrobial susceptibility profile so therapy can be targeted. Clinicians need the results from specimen analysis to be accurate and clinically relevant. To accomplish this, specimens must be properly collected, transported, and analyzed.

significant interpretive skills because clinical microbiologists must decide on the appropriate processing pathways and interpret the results relative to the patient’s disease. For example, the presence of an opportunistic pathogen may not be significant unless the patient is immune compromised and the clinical features of the disease are consistent with known damage caused by the pathogen.

S

Specimen Collection Proper specimen collection and management is one of the keys to accurate laboratory diagnosis and confirmation, and it can directly affect patient care and outcomes. As a result, it influences patient length of stay and hospital costs. Specimens can be taken from almost any body site. It is preferable to obtain an actual specimen, such as a body fluid or tissue sample, rather than a swab of a specimen (Figure 9.11). Swabs pick up extraneous microbes, hold extremely small volumes of the specimen, and make it difficult to get bacteria or fungi away from the swab fibers and onto media for growth and analysis. For accurate results, it is important to use an appropriate storage medium for specimens and to transport specimens quickly. Problems arise if normal microbiota overgrow and obscure the pathogen before testing or if the pathogen dies.

Specimen Analysis A primary goal of medical microbiology labs is to identify the pathogens found in a specimen. Laboratory tests are used to detect the pathogen in cultures or by other techniques or through the patient’s immune response to the infection. The identification of the pathogen requires

260  CHAPTER 9  Microbial Growth and Control

Culture methods  Some microorganisms must be grown in culture on selective and/or differential growth media to be identified. Afterward, potential pathogens are selected and screened using rapid biochemical tests. An interim report with a preliminary identification of the pathogen can be completed within 1 day. Purified colonies are then loaded into automated systems that run an array of tests that complete the identification and antibiotic sensitivity profile. From delivery of a bacterial specimen to the lab until the final report takes 2–3 days. Fungi typically grow more slowly than bacteria so the final identification of a fungus can take up to 2 weeks. Molds are identified by the characteristics of their colonies and the microscopic morphology of their sporing structures. Yeasts can be identified by their colony characteristics and growth requirements. Nonculture techniques Nonculture techniques can usually be completed in approximately 15 minutes to approximately 8 hours, so they are finished the same day the specimen arrives in the laboratory. These tests analyze the specimen for its microbial products or genetic information, and the specimen is also viewed by microscopy. Microbial products include components of the cell such as cell wall antigens or extracellular toxins. Tests kits use highly specific antibodies targeted to proteins, glycoproteins, or carbohydrates produced by the microbe. In an enzyme-linked immunosorbent assay (ELISA), a color change indicating a positive test is initiated by an enzyme associated with the antibody that binds to the pathogen’s product. An ELISA for S. pyogenes, which causes strep throat, detects a cell wall glycoprotein known as the group A antigen. ELISAs are also used on fecal samples being screened for Clostridium difficile toxins A and B, which cause severe diarrhea. Other types of antibody-based tests include agglutination tests and direct fluorescent antibody assays.

Specimen sampling • Figure 9.11 Specimens need to be collected in such a way as to minimize or exclude normal microbiota, and they need to be stored and transported so that tests in the lab can be successfully completed.

a. Culturettes are used to transport routine

Ruptured pustule Culturette

specimens taken from surfaces, including wounds, skin, upper respiratory tract, and genitals. Transport tubes contain a gel that allows for better recovery of pathogens. Samples to be used for rapid nonculture assays are placed in tubes with a broth that won’t affect the tests.

b. Biopsy samples, stool samples, sputum samples, and urine samples are placed in sterile containers with secure lids for transport. They are refrigerated to prevent microbial growth, which could adversely affect analysis.

Punch biopsy of skin

Sterile capped container

c. Aspirates are better specimens for deep

Needle aspirate of abcess

Syringe

d. Blood samples are taken using aseptic techniques to avoid sample contamination. One sample bottle is incubated aerobically and one anaerobically. Blood culture bottles are monitored regularly for bacterial growth.

Venipuncture to obtain blood sample

Blood culture bottle

e. Cerebrospinal fluid (CSF) is removed after carefully antisepsis of the skin. CSF is placed in four sterile tubes. Microbiology analysis is performed on the second tube to avoid potential contamination with normal skin flora in the first tube. Prompt delivery to the lab is crucial for rapid analysis and to prevent loss of fastidious organisms.

Lumbar puncture to obtain CSF

Sterile capped tubes

infections. Syringes are often used for collecting fluids or purulent specimens. Air is normally expelled to preserve anaerobes.

Th i n k Cr it ica lly

Of the specimens collected in this figure, which one(s) would not normally contain microbes? Explain why this is significant for diagnosis.

Microbial Cultures in Clinical Practice  261

(Figure 9.12). PCR uses a specialized thermostable DNA polymerase enzyme isolated from bacteria that grow in hot springs. It does not denature at high temperatures. After 25 cycles, more than 1 million copies (225) of the target DNA have been synthesized. Even though the specimen DNA contains human DNA and potentially DNA from microbes of the normal microbiota, the PCR amplifies the target DNA from the pathogen because of the binding specificity of the primers. The DNA is amplified to such a high concentration that it constitutes the majority of the DNA in the sample. After amplification by PCR, DNA is separated by size using gel electrophoresis. A positive test for the pathogen is indicated by the presence of the amplified target DNA from the pathogen. Other, more technical, methods have also been developed that eliminate the extra time-consuming step of gel electrophoresis.

✓ The Planner

The polymerase chain reaction (PCR)  • Figure 9.12

1 The sample is heated to 95°C, denaturing the DNA. 2 Cooling to 55°C allows the primers to bind to the pathogen DNA.

3 At 72°C, the thermostable DNA polymerase extends the primers to copy the pathogen DNA.

4 The cycle of heating, cooling, and polymerization is repeated, resulting in a doubling of the DNA sequence targeted by the primers.

5 Each subsequent cycle doubles the copies of pathogen DNA.

95°C

55°C

KEY Pathogen DNA PCR-amplified DNA

72°C

Cycle 2

Primers

Lane M is DNA size marker; Lanes 1-4 are clinical specimens

The specimen used for PCR contains a mixture of nucleic acids from the host, other microbes (not shown), and, potentially, from the pathogen. If the pathogen’s DNA is present in the sample, cycles of heating, annealing, and polymerization will amplify the sequence targeted by the primers and that segment of the pathogen’s DNA will be increased to the point where it constitutes the overwhelming majority of the DNA in the sample.

T Hadzhiolova1, S Pavlova1, R Kotseva. 2008. “Laboratory investigation of the first suspected human cases of infection with avian influenza A(H5N1) virus in Bulgaria.” Eurosurveillance, Volume 13, Issue 30

Process Diagram

Some molecular techniques can detect gene sequences unique to pathogenic microorganisms. The use of these techniques has expanded significantly since the development of the polymerase polymerase chain chain reaction (PCR), a process reaction (PCR) A for amplifying (copying) specific technique for amplishort DNA sequences. The first fying specific DNA part of the PCR involves primers, sequences in vitro. which are short, single-stranded DNA sequences that target complementary genetic sequences found only in the genetic material of the pathogen. The primers will not react with human DNA or with the genetic material of other microbes. The second part of the PCR is a three-step cyclic process: amplification of the targeted pathogen DNA using repeated cycles of heating, recombination of the DNA in double-stranded form following separation by heat (annealing), and polymerization

Cycle 3

6 After amplification by PCR, DNA can be separated by size using gel electrophoresis. A positive test for the pathogen is indicated by a band of the amplified target DNA from the pathogen. A negative test does not show this band.

In t e r p r e t t h e Da t a Which of the clinical specimens evaluated for the presence of a microbial pathogen’s DNA were positive?

PCR analysis is a highly sensitive technique that allows the detection of extremely low concentrations of pathogen DNA. PCR is also very specific and can accurately show the presence or absence of the pathogen in a specimen. In addition, it can be used to detect viruses with RNA genomes by first using the enzyme reverse transcriptase to make a DNA copy of the virus RNA. As a result, the PCR assay has become the preferred method for the identification of a number of microbial pathogens. The Centers for Disease Control and Prevention (CDC) also uses pulse-field gel electrophoresis analysis to compare the gross DNA genetic structure of bacterial isolates when analyzing different strains of a bacterial pathogen. In doing so, they can link specific bacterial strains to an outbreak of a disease. Protozoans and helminths do not have to be cultured. They can be identified by direct microscopic examination

9 .5

of an infected specimen. Common pathogenic viruses are identified by detecting viral antigens or by PCR-based tests. In some viral infections, the only tests available are immunological assays that evaluate the concentration of antibodies to the virus in a person’s serum; the presence of antibodies only indicates that the person has been previously infected with the virus. However, a high concentration of antibodies followed by a significant drop after 2 weeks indicates a person is recovering from an acute infection by the virus.

1. Why is it preferable to obtain an actual specimen rather than a swab? 2. Why is the PCR assay highly accurate for identifying a specific pathogen?

Controlling Microbial Growth

LEARNING OBJECTIVES 1. Describe the common physical methods used to control microbial growth. 2. Explain how radiation is used to control microbial growth. 3. Describe the applications and mechanisms of action of chemicals used to control microbial growth.

infection occurs, chemotherapeutic agents such as antibiotics are used to kill the microbe (discussed in Chapter 14). In the food industry, a variety of physical and chemical means including nontoxic chemical preservatives are used to inhibit the growth of microbes and prevent the rapid spoilage of food. The following sections discuss how physical and chemical methods and radiation are used to control microbial growth.

icrobiologists and those involved in health care fields need to understand the methods used for controlling the growth of microbes to limit the growth of microbes sterilization Any or remove them for personal and process that elimipublic health and safety. In the nates or destroys all health care setting, infection con- microbes. trol is paramount. The most strindisinfection The gent level of infection control is process of applying sterilization, which uses heat, ra- a chemical to nondiation, chemicals, or physical living objects to kill methods to destroy or remove all potentially infectious microbes. Physical items can un- microbes. dergo disinfection, where microbes capable of infection are antisepsis The destroyed or removed. Before process of using a medical procedures, human skin chemical on living undergoes antisepsis to reduce tissues, such as the skin, to kill potentially the risk of infection before invainfectious microbes. sive procedures are done. If an

Physical Methods

M

Physical methods for controlling microbial growth include the use of high and low temperatures, filtration, fermentation, drying, and high osmolarity. The specific method used depends both on the type of microbe involved and the material on which it is found.

Heating  Heating is an effective way to kill living microbes and to inactivate infectious agents such as viruses. Heating works primarily by breaking the hydrogen bonds that stabilize the tertiary structure of proteins and nucleic acids. Boiling has long been a common way to provide safe drinking water. Boiling water for one minute is sufficient to kill or inactivate most pathogenic microbes. To sterilize a liquid, however, boiling is insufficient because there are endospore-forming bacteria that can survive boiling water treatment. Steam under high pressure can be used for sterilization. The high pressure forces the hot water vapor into endospores, denaturing their proteins. In microbiology labs Controlling Microbial Growth  263

Physical methods for controlling the growth of microorganisms • Figure 9.13 High and low temperatures and filtration are physical methods for controlling microbial growth.

Health Protection Agency/Science Source Images

a. Steam heating Autoclaves use steam under high pressure generated by a boiler to kill microbes. The autoclave is designed to replace dry air with saturated steam, which can be used to sterilize heatresistant materials and liquids.

b. Pasteurization Milk is often pasteurized by first being passed for 15 seconds through pipes heated by hot water to 72°C and then rapidly cooled to 4°C. The process kills 99.999% of bacteria present and significantly extends the shelf life of the product. Heating unit

From holding tank

Cooling unit

To packaging

c. Filtration

© Timothy Epp/Alamy Stock Photo

To provide safe drinking water, devices have filters with pore sizes smaller than 0.45 μm to trap disease-causing microbes. Filtration can also be used to sterilize heat-sensitive liquids.

264  CHAPTER 9  Microbial Growth and Control

and in a wide variety of health care settings, autoclaves, devices used to sterilize material using steam under high pressure at or above 121°C, are often used to sterilize laboratory glassware, solutions, medical supplies, and infectious wastes (Figure 9.13a). Alternatively, sterilization of solid, temperature-insensitive materials such as laboratory glassware and stainless steel can be completed by heating in an oven to 170°C for 2 hours. Liquids for consumption that are sensitive to high temperatures can be pasteurized. In pasteurization, the liquid is heated for a short time to kill most of the microbes that would cause rapid spoilage of the product and to reduce the number of potential pathogens (Figure 9.13b). For example, the CDC states that unpasteurized milk is responsible for nearly three times more hospitalizations than any other foodborne source of infection. Milk is pasteurized using a process known as high temperature, short time pasteurization, which heats the milk to 72°C for 15 to 30 seconds and then cools it. As a result, the pathogens are killed and the shelf life when refrigerated is extended from several days to several weeks.

Cooling  Cold is also used to inhibit microbial growth. Low temperatures reduce the kinetic energy available to drive enzymatic reactions, causing metabolism and growth to slow or stop. Refrigeration stores food at approximately 4°C and greatly slows the growth of the mesophilic bacteria that often spoil food. Storing foods in a freezer (usually −20°C) stops the growth of microbes because metabolite diffusion is inhibited by the frozen cytoplasm. In addition, ice crystals can kill cells by shearing cell membranes. Therefore, freezing can preserve food for long periods. Microbiologists use freezing at −80°C to store microbial cultures for long periods. Cryoprotectants, such as glycerol or dimethyl sulfoxide, are added to the cell cultures before freezing to prevent the formation of ice crystals that could damage cells. Filtration  Temperature-sensitive solutions can be sterilized by passing them through a filter that has pores too small for microbes to pass through (Figure 9.13c). Filters to block most bacteria and all eukaryotic microbes have pore sizes smaller than 0.45 μm. The removal of viruses requires ultrafiltration with pore sizes reduced to 10 to 100 nm. Ultrafiltration occurs under high pressure and has slow flow rates because of the extremely small pore size. Filtration can be used to sterilize small amounts of liquid solutions that need to be added to defined laboratory media.

A sk Yo u r se lf Which of the physical methods described for controlling microbial growth requires the smallest and least sophisticated equipment?

Fermentation  Fermentation has been used for thousands of years to preserve foods. It was developed as a practical solution to meet daily survival needs without any knowledge of microbes. Today we know that fermentation of fruit, vegetables, and dairy products does more than add flavor or help to preserve food for longer periods of time. The acidity resulting from microbial fermentations lowers the pH, which inhibits the growth of many of the bacteria and fungi that cause food to spoil. Desiccation  Other methods used to control microbial growth focus on desiccation—removing the water microbes need for growth. This includes practices such as increasing solution osmolarity, which causes water to leave cells and results in cell death. Heavily salting meat and fish preserves the food. Fruit can be preserved as jellies and jams, which concentrate the sugars and inhibit bacterial growth. The drying of fruits and meats prevents the growth of bacteria as long as the material remains dry.

Radiation Various forms of electromagnetic radiation can be used to control microbial growth. Both ultraviolet and ionizing radiation are bactericidal. Ultraviolet (UV) radiation is electromagnetic radiation with wavelengths between 200 and 400 nm and is below the visible spectrum of light. Ionizing radiation is electromagnetic radiation with wavelengths from 0.01 to 0.1 nm. It includes X-rays and gamma rays.

UV radiation  Nucleic acids absorb UV radiation strongly at 260 nm to 280 nm. When DNA absorbs radiation at these wavelengths, it can induce the formation of thymine dimers (two adjacent thymine residues in the same DNA strand become covalently linked together). Thymine dimers, if not repaired, block DNA replication. Cells can repair normal levels of DNA damage from UV radiation in the environment (see Section 8.3). However, overwhelming DNA damage can occur when additional UV radiation is added, and this cannot be repaired. UV radiation is used to disinfect surfaces because it has little penetrating power. It is also used in laminar flow biosafety hoods to inhibit to the growth of bacteria in which cell or tissue culture is being done (Figure 9.14a). UV radiation has more recently been used to disinfect water sources because it does not contribute residual chemicals to alter the taste of water. Ionizing radiation Ionizing radiation can be used to sterilize temperature-sensitive materials. Ionizing radiation has significant penetrating power so it can be used to sterilize solid materials and liquids. Gamma rays cause breaks in double-stranded DNA that overwhelm the cell’s repair system and kill the cell or inactivate the virus. Gamma irradiation by a cobalt-60 source has widespread use in the pharmaceutical and medical supply industry. Although gamma irradiation can be used safely in the food industry to increase the shelf life of foods that otherwise spoil because of microbial growth, this process is not widely used and requires labeling (Figure 9.14b).

Use of radiation to control microbial growth • Figure 9.14 Different types of radiation are used to control microbial growth.

a. Ultraviolet radiation Ultraviolet radiation can be used to kill microbes in water, air, and on surfaces. It is used in biosafety cabinets to help prevent the contamination of surfaces and cultures with unwanted microorganisms.

b. Ionizing radiation Ionizing radiation such as X-rays is used to kill microbes in food. The ionizing radiation kills microbes by damaging DNA. Shielded radiation room

R. Maisonneuve/Science Source Images

Conveyor system

Radiation source

Th in k Cr it ica lly

Based on these diagrams, which type of radiation appears to be least dangerous for humans? Why do you think so?

Selected classes of chemicals used to control microbial growth  Table 9.5 Class of chemical agent

Type of use

Mechanism of action

General activity

Does not inhibit

Alcohols Ethanol; methanol

Antiseptic

60% to 90% solutions rapidly denature proteins and plasmolyze cells

Broad-spectrum antimicrobial agents

Endospores and hepatitis A virus

Soaps Hand soap

Cleaning

Lower surface tension to make physical removal of microbes easier

Alkalis can inhibit the growth of some bacteria

Most microbes

Surfactants Cationic and anionic detergents

Sanitizing utensils; cleaning laundry

Dissolve lipids and disrupt cell membranes

Antibacterial

Endospores and most viruses

Halogens Iodine; iodophors; chlorine

Disinfectants and antiseptics

Disrupt and oxidize protein and nucleic acid structure

Broad-spectrum antimicrobial agents with rapid action

Require prolonged contact to kill endospores

Oxidizing agents H2O2

Antiseptics

Oxidation of membrane lipids, DNA, and proteins

Broad-spectrum bactericidal agent

Requires extended time to destroy viruses and endospores

Phenols and phenolics Orthophenylphenol; triclosan

Disinfectants and antiseptics

Loss of membrane structure or function; inhibition of fatty acid synthesis

Broad-spectrum antimicrobial agents

Endospores and nonenveloped viruses

Biguanides Chlorhexidine

Disinfectants and antiseptics

Disrupt cell membranes

Broad-spectrum antibacterial and antiyeast agent

Nonenveloped viruses

Quaternary ammonium compounds Benzethonium chloride

Disinfectants

Disrupt cell membranes; denature essential proteins

General antimicrobial agents

Endospores, Pseudomonas, some other gram-negative bacteria, and nonenveloped viruses

Alkylating agents Formaldehyde; glutaraldehyde; ethylene oxide gas

Chemical sterilants

Alkylation of proteins and nucleic acids

Preserve biological specimens; sterilize heat-sensitive medical equipment

None

Chemical Methods Chemicals that can kill or inhibit microbial growth can be classified by their function or structure. Functionally, chemicals are grouped into sterilants, disinfectants, and antiseptics. The primary function of all these chemicals is to kill or inhibit the growth of microbes. They differ in their toxicity to human tissues and whether they need to be used in highly controlled and restricted settings. Commonly used classes of chemicals used to control microbial growth for public health purposes include alcohols, surfactants, halogens, oxidizing agents, phenolics, quaternary ammonium compounds, and alkylating agents (Table 9.5).

266  CHAPTER 9  Microbial Growth and Control

Alcohols  Ethyl alcohol and isopropyl alcohol in 60% to 90% solutions in water are rapidly bactericidal against vegetative forms of bacteria (see the Clinical Application). They are also tuberculocidal, fungicidal, and virucidal; however, they do not destroy bacterial endospores. Alcohols work by denaturing proteins. Both gram-negative and gram-positive pathogens are typically killed within 10 seconds. Ethanol also quickly inactivates most common viruses with the exception of hepatitis A virus and polio virus. Soaps and surfactants  Cleaning is the removal of soil and organic material using water with soaps or detergents

and/or enzymatic products. Cleaning is often required before antisepsis, disinfection, or sterilization because organic material can interfere with the action of these chemicals. Cleaning is routinely done manually. Soaps and detergents are used to aid in the physical removal of bacteria. The friction of rubbing removes bacteria and debris, which become trapped in the suds that are

rinsed off. Alkali and sodium are normally included in soaps. The increase in pH kills several species of bacteria and destroys influenza viruses. Because of the time required to wash hands correctly, wearing nitrile gloves or using a 70% alcohol gel rubbing solution are often used to reduce the spread of microbes through direct contact.

Clinical Application

✓ The Planner

Alcohol-Based Hand Sanitizers in Health Care Settings Analysis shows that using an alcohol-based solution is from approximately 2 to 20 times more effective at decreasing bacterial contamination on hands than soap and water (Figure a). The alcohol can be delivered as a gel or foam (Figure b). A small amount is rubbed over the hands until they are dry. As a result, there is no need for a sink or paper towels to dry hands.

An additional benefit is that use of hand sanitizers requires less time than an effective hand washing. Given the number of times health care workers wash their hands during a day (about seven times per hour), using an alcohol rub saves about 40 minutes per 8-hour work period.

a. The effectiveness of removing and/or killing bacteria varies depending on the agent used during hand cleansing.

b. The use of alcohol-based foam hand sanitizers are a rapid and highly effective method of killing most microbial pathogens.

(Data from Ayliffe, G.A.J., Babb, J.R., Davies, J.G., Lilly, H.A. (1988) Hand disinfection: a comparison of various agents in laboratory and ward studies. J Hosp Inf 11:226–243.)

99.9

99

90

0

Soap

4% 7.5% chlorhexidine povidonegluconate iodine surgical scrub

62% ethanol foam

70% isopropanol gel

I n terpret the D ata What mean percent of reduction in bacterial numbers was found for the most effective agent?

Paul Velgos/Getty Images

Mean % reduced (log scale)

99.99

Controlling Microbial Growth  267

Some detergents are known as surfactants, or surface acting agents, because they bind to the surface of insoluble molecules, allowing them to dissolve in water and be washed away. Surfactants are bactericidal because they disrupt cell membranes. They are used to sanitize food utensils and launder clothes. Anionic detergents (negatively charged) are less effective in killing bacteria than cationic detergents (positively charged) because they can be repelled by the negative charge associated with the surface of the bacteria.

Halogens  Chlorine and iodine are halogens. These elements have long been used as antiseptics and disinfectants. Chlorine has multiple inhibitory effects on microbes. It oxidizes sulfhydryl groups, disrupting the structure of proteins; it oxidizes respiratory components, decreasing ATP production; and it breaks DNA strands. Low concentrations (less than 5 ppm) of free available chlorine kill vegetative bacteria in seconds. A 10% household bleach solution (approximately 5000 ppm free chlorine) is sufficient to kill 106 C. difficile endospores in less than 10 minutes. C. difficile can cause bloody diarrhea and is a common health care-associated pathogen. Bromine is sometimes used to replace chlorine in indoor pools and hot tubs because it does not give off the strong odor that chlorine does. Iodine is used as a topical antiseptic. Its microbicidal activity results from disruption of protein and nucleic acid structures. As with iodine, povidone-iodine is microbicidal, but it is nonstaining, relatively nontoxic, and nonirritating. Iodine solutions are rapidly bactericidal and virucidal but require prolonged contact to kill fungi and bacterial spores. Oxidizing agents  Oxidizing agents work by producing destructive free radicals that oxidize membrane lipids, DNA, and proteins. Although many bacteria produce catalase or SOD to break down O2− and H2O2, the concentration of the free radicals produced overwhelms the bacteria’s ability to prevent the lethal damage. Hydrogen peroxide (3%) can be used as an antiseptic but is quickly inactivated by catalase released from injured tissues. It is a stable and effective disinfectant used on soft contact lenses, ventilators, and endoscopes. Although hydrogen peroxide can kill all types of microbes, including bacterial endospores, it requires time to do so. A 3% solution of H2O2 requires 150 minutes to kill 106 Bacillus spores and approximately 7 minutes to inactivate rhinovirus. Peroxides are strong oxidizing agents that are used for industrial and agricultural disinfection. For example, peroxodisulfuric acid is used in agriculture to control the spread of animal viral diseases such as footand-mouth disease and avian influenza.

268  CHAPTER 9  Microbial Growth and Control

Phenolics  Phenol was the first antiseptic and disinfectant used by Joseph Lister during his pioneering work to develop aseptic surgery in the late 1800s. Today, numerous chemical derivatives of phenol are commonly used as hospital disinfectants. The primary mode of action of phenolic disinfectants is to inactivate essential enzymes and to damage cell membranes, causing loss of essential metabolites. Phenolics, when used on surfaces, retain their antimicrobial activity for several days. Generally, phenolics are microbicidal but not sporicidal and may not be effective at inactivating some common viruses. Orthophenylphenol, the active agent in Lysol, is a common disinfecting agent. Chlorhexidine gluconate, a chlorinated phenolic, is often used in surgical scrubs. Triclosan, which consists of two fused phenol rings, has been incorporated into antibacterial soaps as well as plastic materials such as cutting boards and children’s toys. This has raised concern that its widespread presence will select for drug-resistant mutants. Quaternary ammonium compounds   Quaternary ammonium compounds are widely used disinfectants in conjunction with cleaning to disinfect patient rooms and some care equipment. However, their effectiveness is inhibited by cotton found in cloth or gauze pads. Also, some gramnegative bacteria show significant resistance. The bactericidal action is due to disruption of the cell membrane and denaturation of essential cell proteins. Alkylating agents Glutaraldehyde is used to sterilize heat-sensitive medical equipment such as specialized tubing. Formaldehyde is used in preparation of several viral vaccines and to preserve anatomical specimens. Ethylene oxide, which is toxic, can be used to sterilize items that are heat sensitive and moisture sensitive such as rubber goods and plastics used for catheters, intravenous lines, and tubing. Because these materials can absorb the ethylene oxide, they must undergo a lengthy aeration process to remove residual gas. All these chemical sterilants inactivate microbes by alkylation of proteins and nucleic acids. This prevents normal metabolism and nucleic acid replication.

1. Why does using an autoclave at 121°C kill bacteria in a shorter time than an oven at 170°C? 2. How do UV and ionizing radiation damage cells? 3. Which chemicals can be used to sterilize heatsensitive material?

The Planner

✓

Summary

9.1

Requirements for Microbial Growth 244

Cell division in bacteria: Binary fission  •  Figure 9.3

• Depending on their sources of energy, organisms are classified as photoautotrophs, photoheterotrophs, chemoheterotrophs, or chemoautotrophs.

The effect of temperature on the growth of a bacterial culture  •  Figure 9.1 Optimum growth temperature

Growth rate (min–1)

0.06 0.05 0.04 0.03

Maximum growth temperature

Minimum growth temperature

0.02 0.01 0

0

10

20 30 Temperature (°C)

40

50

• The chemical requirements of microbes include carbon, hydrogen, oxygen, nitrogen, phosphorus, sulfur, sodium, potassium, chlorine, magnesium, iron, calcium, and trace elements. Depending on their use or nonuse of oxygen, microbes are classified as obligate aerobes, microaerophiles, facultative anaerobes, aerotolerant anaerobes, and obligate anaerobes.

9.2

Bacterial Reproduction and Growth 249

CNRI/Science Source Images

• Most organisms are found in environments with pH between 6.5 and 7.5. However, acidophiles thrive in acid environments. As shown in the graph, most microbes thrive within a certain temperature range with a minimum growth temperature, optimum growth temperature, and maximum growth temperature. Depending on their optimum temperature, microbes are classified as psychrophiles, mesophiles, thermophiles, or extreme thermophiles. Halophiles are adapted to high-salt environments.

• The time needed for the production of two cells from one cell is the generation time. Bacterial populations grow exponentially as long as they have the needed resources. • The phases of bacterial growth in a new culture are the initial lag phase, in which there is no increase in cell numbers; the exponential growth phase, in which the number of cells increases exponentially; the stationary phase, in which cell numbers stop increasing and conditions become less favorable for growth; and the death phase, in which the cells ultimately die off. • Population growth can be measured in various ways, including a Petroff-Hausser chamber where the number of cells on a grid is counted directly. A spectrophotometer can be used to indirectly measure cell density in a broth. Pure isolated colonies can be produced from diluted samples by the pour plate method or the spread plate method and the colonies counted directly. For microbes that grow in pairs, filaments, or clusters colonies are formed from more than one cell so the density found from dilution plating is given in colony-forming units (cfus). Where the bacterial cell density is very low, filtration methods are used to measure cell density.

9.3

Laboratory Growth of Microorganisms 254

• Bacterial cultures are grown on a sterile growth medium with specific nutrients added. The initial sample of microbes is the inoculum and the resulting growth is the culture.

• Bacteria reproduce asexually by binary fission, shown in the photo, which includes the replication of the chromosome, partitioning of the two daughter chromosomes, and separation of the cells.

Summary  269

• The streak plate method, shown in the drawing, is used to obtain a colony of cells descended from a single bacterial cell. When the colony is derived from a single cell, it is a pure culture.

The streak plate method  •  Figure 9.9

• Some specimens to be analyzed are cultured first and then subjected to a variety of biochemical tests, including their antibiotic sensitivities. Other, nonculture, tests include analysis of microbial products and genetic material, the enzymelinked immunosorbent assay (ELISA), and microscopic examination. The polymerase chain reaction (PCR) is used to amplify large amounts of a specific DNA sequence from the pathogen for analysis.

9.5 • Growth media can be a liquid, a broth, or a semisolid medium formed with a solidifying agent such agar. Solid cultures are grown in Petri dishes. • A chemically defined medium is one in which all the components and their concentrations are known. A complex medium contains extracts from yeast, meat, or plants that provide nutrients needed by bacteria and fungi. Specialized growth media can be used to grow fastidious microorganisms that require growth factors not found in most media. Enrichment media enhance the growth of one group of microbes. Selective media are used to inhibit the growth of unwanted microorganisms; differential media make it possible to distinguish between different types of bacteria. • Biofilms are communities of organisms embedded in a nonliving matrix that adhere to solid surfaces. They grow in interdependent communities and can complicate treatment of some infectious diseases.

9.4

Controlling Microbial Growth  263

• The most stringent level of infection control is sterilization, which removes all microbes. Disinfection kills or removes microbes capable of infection from physical items, whereas antisepsis kills or removes them from human skin. Nontoxic chemical preservatives are used to inhibit microbial growth in food. • Physical methods for controlling microbial growth include heating and cooling, filtration, fermentation, desiccation, and increased osmolarity. Autoclaves use steam to sterilize equipment. Pasteurization involves heating a liquid for consumption for a short time in a specialized unit (see the diagram). Desiccation includes such methods as salting meats, preserving fruits as jams and jellies by means of adding sugar, and drying fruits and meats.

Physical methods for controlling the growth of microorganisms: Pasteurization  •  Figure 9.13 Heating unit

Cooling unit

Microbial Cultures in Clinical Practice 260

• Specimens for analysis must be properly collected (such as through a lumbar puncture as shown in the drawing), stored, and transported to assure accurate results.

Specimen sampling  •  Figure 9.11 Lumbar puncture to obtain CSF

From holding tank

To packaging

• Both ultraviolet (UV) radiation and ionizing radiation are used to control microbial growth. UV wavelengths are absorbed by DNA and cause more damage than the cell can repair. Ionizing radiation, such as gamma radiation, is used to sterilize temperature-sensitive materials. It causes breaks in double-stranded DNA. • Chemicals that can kill microbes or inhibit microbial growth are called disinfectants, antiseptics, and sterilants. Classes of chemical that control microbial growth include soaps, surfactants, alcohols, halogens, oxidizing agents, phenols, phenolics, quaternary ammonium compounds, and alkylating agents.

270  CHAPTER 9  Microbial Growth and Control

Key Terms • acidophile 245 • aerotolerant anaerobe  248 • agar 255 • antisepsis 263 • autoclave 264 • binary fission  249 • biofilm 259 • broth 255 • chemically defined medium 256 • chemoautotroph 244 • chemoheterotroph 244 • colony 255 • colony-forming unit (cfu)  254 • complex medium  256

• culture 244 • death phase  251 • differential medium  257 • disinfection 263 • enrichment medium  256 • enzyme-linked immuno-

sorbent assay (ELISA)  260 • exponential growth phase 251 • facultative anaerobe  248 • fastidious microorganism 256 • generation time  250 • growth medium  254 • halophile 247 • inoculum 254

• ionizing radiation  265 • lag phase  251 • maximum growth

temperature 246 • mesophile 246 • microaerophile 248 • minimum growth temperature 246 • obligate aerobe  248 • obligate anaerobe  248 • optimum growth temperature 246 • pasteurization 264 • Petri dish  255 • photoautotroph 244 • photoheterotroph 244

• polymerase chain reaction (PCR) 262 • pour plate method  253 • preservative 263 • psychrophile 246 • pure culture  255 • selective medium  256 • spread plate method  253 • stationary phase  251 • sterilization 263 • streak plate method  255 • surfactant 268 • thermophile 246 • ultraviolet (UV) radiation 265

Critical and Creative Thinking Questions 1. Why would thermophiles dominate the community of microorganisms during composting?

6. What information is provided by the readings on this meter? How are they used to calculate cell density in a medium?

2. What would the equation for growth by binary fission be if a cell divided into three daughter cells instead of two?

% transmittance

3. If conditions are favorable for rapid growth, why is there no increase in cell number during the lag phase? 4. Why do bacteria often grow more slowly in a chemically defined medium than in a complex medium? 5. If UV radiation damages DNA, why aren’t all bacteria that are exposed to sunlight destroyed?

∞

T h i n k C ri ti c al l y Why are the different colors grouped together in bands?

Absorbance

7. Can antiseptics be used as disinfectants? Can disinfectants be used as antiseptics?

What is happening in this picture? An array of colors can often be seen within and around the hot springs at Yellowstone National Park. The colors come from bacterial pigments. Their colors produce some of the most impressive features of Geyser Basin and make what would be a barren landscape a striking facet of the park.

2

Paul Chesley/Getty Images

Self-Test (Check your answers in Appendix A.)

1.  Organisms that grow using light as an energy source and CO2 as a carbon source are called ______.

5.  Which of the following does NOT occur in binary fission in bacteria?



a. chemotrophs



a. chromosome replication



b. chemoheterotrophs



b. mitosis



c. chemoautotrophs



c. septum formation



d. photoautotrophs



d. cytokinesis

e. photoheterotrophs



e. partitioning of chromosomes



2.  Chemoheterotrophs obtain the carbon they need from ______.

a. carbon dioxide dissolved in water



b. carbon dioxide in the air



c. organic molecules in the environment



d. inorganic molecules in the environment



e. pure carbon in the environment

6.  Review the Microbiology InSight, Figure 9.3, and answer this question.

The contractile protein ring in the bacterial cell ______.



a. forms in the middle of the cell following completion of DNA replication



b. is involved in the process of splitting a dividing bacterial cell into two daughter cells

3.  As shown on the diagram, at what temperature range do mesophiles grow best?



c. is composed of a filamentous contractile protein



d. is involved with septum formation



a. between 55 and 75°C



e. All of these are correct.



b. between 10 and 55°C



c. between 80 and 110°C



d. between −15 and 10°C



e. between −15 and 55°C

7.  Calculate how many generations and how long would it take for one cell to become more than 1000 cells for a bacterial population in the exponential growth phase and with a generation time of 30 minutes.

a. 5 generations, 2.5 hours



b. 30 generations, 15 hours



c. 10 generations, 5 hours



d. 15 generations, 7.5 hours

Hyperthermophiles



e. 20 generations, 10 hours

Thermophiles

8.  When bacteria are introduced into a new environment, they often go through four phases of growth. The phase in which the number of cells stops increasing is the ______.

Optimum growth temperature (°C)

120

100

80

60

40

Mesophiles

20

0

Psychrophiles



a. lag phase



b. death phase



c. exponential phase



d. stationary phase



e. log phase

4.  The bacteria growing only at the bottom of a test tube are most likely ______.

9.  If the volume of fluid trapped under the double-lined square in the diagram was 1 × 10−5 ml and 11 cells were counted within the square, how many cells per ml were present in the original sample?



a. obligate aerobes



a. 1.7 ×106



b. microaerophiles



b. 1.1 ×105



c. facultative anaerobes



c. 1.0 ×105



d. aerotolerant anaerobes



d. 2.0 ×106



e. obligate anaerobes



e. 1.1 ×106

–20

272  CHAPTER 9  Microbial Growth and Control

10.  Review The Microbiologist’s Toolbox, and answer this question.

15.  Ionizing radiation kills microbes by ______.

a. immobilizing cells

Why are serial dilutions used with both the pour plate and spread plate methods of plating?



b. breaking down nutrients



c. bursting cells walls



d. causing breaks in double-stranded DNA



e. bursting cell membranes



a. Without dilution the colonies would not be separated from one another and they would be difficult to count and identify.



b. Using serial dilutions concentrates bacteria so that they can form colonies.

16.  Surfactants kill bacteria by ______.



c. Using serial dilutions makes it possible to identify the nonliving cells in the original sample.



a. breaking DNA strands apart



b. inactivating enzymes



d. Without dilution most of the bacteria would die before the colonies formed on the agar.



c. digesting sugars



e. It does not harm temperature-sensitive microbes.



d. breaking down protein structure



e. disrupting cell membranes

11.  Review What a Microbiologist Sees, and answer this question.

The study of biofilms on teeth showed that ______.



a. only a pure colony of Veillonella can cause cavities



b. dental plaque formation requires a multispecies community



c. biofilms can only form on teeth



d. biofilms contain only living cells



e. biofilms protect the teeth

12.  The plating method shown in the diagram is called the ______ method.

a. pour plate



b. dilution plating



c. spread plate



d. MacConkey



e. streak plate

17.  Review the Clinical Application, and answer this question.

In practice, alcohol-based hand sanitizers have been found to be more effective than soaps because they ______.



a. kill more microbes



b. don’t require water



c. don’t require towels



d. take less time to use



e. All of these are correct.

18.  Commonly used antiseptics include halogens, such as ______ and oxidizing agents, such as ______.

a. iodine; phenol



b. iodine; hydrogen peroxide



c. chlorine; triclosan



d. phenol; hydrogen peroxide



e. triclosan; phenol

19.  Heat-sensitive materials can be sterilized with ______ and ______ . 13.  The item shown in the diagram is used to transport routine specimens taken from surfaces, including wounds, skin, upper respiratory tract, and genitals.



a. ethylene oxide; hydrogen peroxide



b. phenol; soap



a. specimen bottle



c. soap; detergents



b. culturette



d. glutaraldehyde; ethylene oxide



c. culture plate



e. alcohol; hydrogen peroxide



d. blood culture bottle



e. test tube

20.  Review What is happening in this picture? and answer this question.

The area closest to the hot springs is probably populated by ______.



a. hyperthermophiles

14.  ELISA tests use ______ to bind microbial products.



b. mesophiles



a. antibodies



c. thermophiles



b. sugars



d. psychrophiles



c. cell membranes



e. mesophiles or thermophiles



d. cell walls



e. antigens

Self-Test  273

10 Innate Immunity

MULTILEVEL DEFENSES FOR GOOD HEALTH

Y

our body defends itself against pathogens with multilevel defense mechanisms coordinated by your immune system. One of the most basic defenses is intact skin, which acts as an effective pathogen barrier. When this barrier is damaged and permits microbial invasion, a more sophisticated level of protection is needed, such as circulating white blood cells, which attack invading pathogens. More advanced immune actions engage when Jaykayl/Getty Images

CHAPTER OUTLINE these initial protective measures fail: inflammation localizes infections, specialized signaling molecules communicate instructions for immune function, and microbe-ingesting leukocytes secure pathogeninfiltrated tissues (see the photo). Top-level defenses consist of targeted adaptive immune responses that become more vigorous with repeated pathogen exposures. The overall result is good host health with only periodic infections. In this chapter, you will begin your basic introduction to immunity and the immune system by examining the initial defenses responsible for maintaining health. These innate immune functions emphasize infection prevention, the first goal of any health care provider.

10.1 An Introduction to Immunity  276 • The Benefits and Consequences of the Immune Response • Innate Versus Adaptive Immunity • The Basic Anatomy of the Immune System 10.2 First-Line Defense Mechanisms  282 • Physical Defenses • What a Microbiologist Sees: The Benefits of Fever • Case Study: No Spicy Food for Me! • Chemical Defenses 10.3 Innate Cellular Defense Mechanisms  286 • Hematopoiesis • Leukocytes • The Microbiologist’s Toolbox: The Differential Count • Phagocytosis • Inflammation 10.4 Protein-Mediated Defense Mechanisms  294 • The Complement Pathways • Interferons • Miscellaneous Proteins with Antimicrobial Action

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 276 ❑ p. 282 ❑ p. 286 ❑ p. 294 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

Analyze key features

Science Source Images

❑ Microbiology InSight, p. 279 ❑ What a Microbiologist Sees, p. 283 ❑ Case Study, p. 284 ❑ The Microbiologist’s Toolbox, p. 289 ❑ Process Diagram p. 291 ❑ p. 292 ❑ p. 295 ❑ p. 297 ❑ ❑ Stop: Answer the Concept Checks before you go on. p. 281 ❑ p. 286 ❑ p. 293 ❑ p. 298 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What is happening in this picture? ❑ Complete the Self-Test and check your answers.

The close contact of this phagocyte and bacterial cells allows pathogen recognition and destruction.

 

275

10. 1

An Introduction to Immunity

LEARNING OBJECTIVES 1. Contrast the benefits and negative consequences of immune system activity. 2. Compare and contrast innate and adaptive immune responses. 3. Describe the structures and functions of immune system tissues and organs.

I

mmunology examines the molecular and cellular interactions between a host and introduced foreign molecules. Because immunity often represents a struggle between the host and a pathogen, warfare terms are applied to describe the conflict. immunity The abilImmunitas is the Latin term for the ity to resist future protection of Roman senators infections caused by from prosecution while in office. pathogens previously Eventually, the term was adapted encountered by the to refer to the protection from dishost and targeted for ease that results when the host sucimmediate destruccessfully fights off a pathogen. tion by the immune Because any good battle plan system. includes multiple layers of defense, host immunity demonstrates three highly effective strategies. First-line defenses are nonspecific tactics such as physical blockades and chemical deterrents. Nonspecific defensive strategies are always the same regardless of the invading pathogen. Examples include the skin and mucous membrane barriers that prevent pathogen entry and the acidic or antimicrobial secretions that chemically inactivate them. If these defenses are breeched, secondline cellular defenses are activated to contain and consume pathogens. Adaptive responses are the third-line,

fail-safe defenses of the immune system. These tactics are pathogen specific, rapid, and very complex. They are the principal topic of Chapter 11.

The Benefits and Consequences of the Immune Response Although infection is a major cause of death for people of all ages, your immune system typically maintains your good health despite constant exposure to pathogens. Immunity may be acquired in different ways and have varying durations (Table 10.1). Surprisingly, some immune reactions can cause significant undesirable consequences. Although designed to attack foreign invaders, immune system dysfunction can result in an assault on host tissues, a condition described as an autoimmune response (Section 12.5). Type  1 diabetes and multiple sclerosis are examples of serious autoimmune illnesses. Another adverse effect of immune system activity is the rejection of life-saving grafts or transplanted organs as the newly introduced tissues are recognized as foreign and attacked. Finally, allergic reactions represent an immune response known as hypersensitivity. Allergic responses can range from an annoying runny nose to deadly anaphylaxis.

Innate Versus Adaptive Immunity The immune system identifies normal, healthy cells by monitoring the proteins and glycoproteins expressed on their plasma membranes. These cell surface markers allow the immune system to distinguish between self and nonself macromolecules and attack foreign pathogens. Once an invader has been identified, the immune system

The four principal forms of immunity  Table 10.1 Form of immunity

Description/acquisition

Duration

Examples

Natural passive immunity

Spontaneous transfer of immune proteins from one person to another

Temporary

Transplacental transfer of maternal immune proteins to a developing fetus Neonatal consumption of immune proteins in breast milk

Natural active immunity

Spontaneous activation of immune cells by pathogen exposure

Lifelong

Specific disease protection following recovery from infection by that pathogen

Artificial passive immunity

Medical transfer of immune cells or proteins from one person to another

Temporary

Injection of antivenom Administration of immune-active cells to destroy cancer cells

Artificial active immunity

Medical stimulation of immune cells to trigger their activation without pathogen exposure

Lifelong

Administration of a vaccine

276  CHAPTER 10  Innate Immunity

Innate versus adaptive immunity  Table 10.2 Type of immunity

Defenses

Innate immunity

First-line defenses Physical defenses

Chemical defenses

Genetic defenses

Examples

Barriers impede pathogen invasion

Skin Mucous membranes Eyelids and lashes

Washings prevent pathogen attachment

Tears Saliva Perspiration Urination Vaginal secretions

Temperature inhibits bacterial growth

Fever

Acids denature microbial proteins

Gastric secretions Sebaceous secretions Normal microbiota secretions

Salts desiccate bacteria and lysozyme degrades bacterial cell walls

Perspiration Tears Mucus

Variable surface receptors prevent pathogen attachment

Any cell surface

Phagocytes engulf pathogens and release cytokines

Dendritic cells Neutrophils Macrophages

Lymphocytes induce apoptosis and release cytokines

Natural killer cells

Proteins lyse pathogens, promote phagocytosis, enhance inflammation, protect against viral infection, and activate macrophages

Complement Interferon-γ

Lymphocytes secrete antibodies, activate macrophages, and lyse infected cells

B cells T cells

Second-line defenses Cellular defenses

Chemical defenses

Adaptive immunity

Third-line defenses Cellular defenses

has two principal types of defensive actions: innate immune responses and adaptive immune responses. Innate immune responses are nonspecific actions described as first- and second-line defenses, whereas highly specific adaptive immune responses are considered third-line defenses (Table 10.2). Innate immunity involves immediate reactions to the presence of foreign macromolecules in the host. The speed of these responses is exinnate immunity plained by the presence of all necNonspecific, immediessary reaction components prior ate actions of the to infection. The same protective host immune system mechanisms are consistently emthat prevent infection ployed at the same intensity rewithout conferring gardless of the type of intruder or immunity. how often it invades the host.

The first line of defense of the immune system comprises a combination of physical, chemical, and genetic safeguards. Physical barriers include the skin and mucous membranes, which are protective surfaces that prevent environmental pathogens from entering the host. Another physical defense is fever, which limits bacterial growth, and washing actions, such as tearing and perspiration, which dislodge microorganisms trying to attach to the host. Chemical protection consists of secretions containing high salt concentrations to desiccate pathogens, lysozyme to degrade bacterial cell walls, and acids to denature microbial proteins. Genetic incompatibility represents another first-line defense because some pathogens must bind to a particular glycoprotein receptor on host cells to initiate infection, and individuals with a different genetic makeup who do not produce the receptor are not susceptible. An Introduction to Immunity  277

The second line of defense of the immune system is nonspecific cellular and chemical attacks. Examples include phagocytes (pathogen-ingesting cells) and blood proteins such as complement. Many second-line defense chemicals function as mediators, or endogenous molecules that activate or modify the function of target proteins and/or cells. Cytokines are small signaling proteins secreted by white blood cells and used to coordinate the activity of immune cells. Numerous cytokines and chemical mediators interact to synchronize the events of inflammation for the nonspecific elimination of pathogens. When pathogens overcome innate responses, adaptive immunity provides a third line of defense. These responses are characterized by both memory, the ability to respond more vigorously every time a particular pathogen is encountered, and specificity, the ability to recognize and react only to a given pathogen. These third-line defense mechanisms provide lifelong pathogen protection and are directed lymphocyte The by B cells, which are a type of second most prevalymphocyte that matures in the lent type of white bone marrow, and T cells, which blood cell, which is are lymphocytes that mature in capable of recognizthe thymus. The details of adaping and eliminating tive immunity will be discussed pathogens. in Chapter 11.

The Basic Anatomy of the Immune System Describing the anatomy of the reproductive or excretory system is easy because each consists of several discrete organs whose functions are coordinated to accomplish specific processes. It is much more challenging to characterize the immune system because it integrates components of the circulatory system, lymphatic system, and reticuloendothelial system (RES). This complex multisystem assemblage is essential for the production and transport of immune-active cells and their products throughout the body. The efficient transport of immune cells makes possible the surveillance and intercellular communication vital to locating and neutralizing pathogens.

Immune system components The circulatory system is composed of an elaborate network of vessels that carry blood throughout the body (Figure 10.1a). The heart pumps the blood through the system. Arteries and arterioles carry blood away from the heart to tiny capillary networks that infiltrate tissues. Following the movement of nutrients from the blood to the tissues and wastes from the tissues to the blood, the blood flows into venules and then veins on its return to the heart. Plasma, the liquid portion of blood, consists mostly of water with hundreds of

278  CHAPTER 10  Innate Immunity

dissolved chemicals. The chemicals include proteins (albumin, globulins), gases (carbon dioxide, oxygen), nutrients (glucose, amino acids), salts (sodium, calcium, chloride), and hormones (insulin, thyroid hormones). Suspended in the plasma are the blood cells, which include oxygen-carrying erythrocytes, or red blood cells, immuneactive leukocytes, or white blood leukocyte A type of cells, and tiny platelets that are blood cell involved in responsible for clotting. A more immune responses; detailed description of blood cell also known as a function and development is pre- white blood cell. sented in Section 10.3. Like the circulatory system, the lymphatic system includes an intricate network of fluid-filled vessels (Figure  10.1b). The brain, eyes, testes, and placenta have few, if any, associated lymphatic vessels and are referred to as immune-privileged sites. Access to immune-active cells is extremely limited in these tissues because an immune response would render the organs dysfunctional. Most other tissues are permeated with lymphatic vessels of variable size that parallel blood vessels. Fluid that leaks from the blood, called interstitial fluid, bathes the body tissues, where it picks up cellular debris and potential pathogens. Interstitial fluid diffuses into lymph capillaries and travels through increasingly larger vessels. Foreign materials and pathogens are filtered out of the lymph by the many lymph nodes. The cleansed, clear to whitish lymph containing proteins, dissolved salts, and abundant leukocytes is returned to the circulatory system by emptying into the left or right subclavian vein. The RES, also known as the mononuclear phagocyte system (MPS), harbors a diverse collection of phagocytic cells associated with pathogen elimination in specific body locations (Figure 10.1c). Although they demonstrate some morphological variations, all of these different phagocytes patrol the indicated tissues, engulfing any pathogens they encounter. Their tissue migration is facilitated by the reticulum of connective tissue fibers, which serves as a conduit between organs and tissues. In this way, the phagocytes contribute to the surveillance and protective functions of the immune system. Finally, the phagocytic activity of RES cells also processes ingested pathogens to expedite their recognition by cells of the adaptive immune system. Because the circulatory, lymphatic, and reticuloendothelial systems share many of the same cell types, proteins, and transport routes, the immune system is truly an integrated physiological network. At the microscopic level (Figure 10.1d), immune-active cells travel in blood and lymphatic vessels throughout the body; they pass out of these conduits and move in interstitial fluid and along reticular fibers, where they ingest invading pathogens. The cells reenter the blood and/or lymphatic vessels, conveying pathogens to secondary lymphoid organs for optimal stimulation of the appropriate cells for maximal host protection.

Microbiology InSight  The anatomy of the immune system 

✓ The Planner

•  Figure 10.1

The immune system is a multisystem, integrated network of organs, tissues, and cells that defend the host from invading pathogens and foreign matter.

a. The circulatory system

b. The lymphatic system The lymphatic system consists of a network of fluid-filled vessels and specialized organs, tissues, and cells.

In addition to nutrients, oxygen, and wastes, the circulatory system also transports immune-active leukocytes.

Tonsils

Heart

c. The reticuloendothelial system Tissue-specific phagocytic cells composing the RES patrol for pathogens along the body’s extensive network of connective tissue fibers. Phagocytic cell type

Location

Monocytes

Blood

Neutrophils

Blood

Alveolar macrophages

Lungs

Dendritic cells

Lymph nodes, thymus

Microglial cells

Central nervous system

Kupffer cells

Liver

Langerhans cells

Skin

General macrophages

Bone marrow, lymph nodes, spleen, thymus, and miscellaneous connective tissues

Phagocyte morphology

Thymus Thoracic duct

Spleen GALT

Appendix Bone marrow

Lymph nodes

Lymphatic vessels

KEY Veins Arteries Lymphatic vessels

d. The microscopic-level design of the immune system The integrated structure of the immune system is especially evident at the microscopic level as the unique cellular interplay maximizes host protection with immune-active cells strategically placed for pathogen interception and destruction. Interstitial fluid

Tissue cell

Blood Venule Dendritic cell B cell

Macrophage Lymphatic capillary

Lymph T cell Arteriole Reticuloendothelium Neutrophil

Monocyte

Blood

Blood capillary

A sk Yo u rse lf A _____ capillary is closed at one end, whereas a _____ capillary is open at both ends.

Key organs of the lymphatic system  Table 10.3

Biophoto Associates/Science Source Images

Primary lymphoid organs

Bone marrow: Site of blood cell production and B cell development

Thymus: Site of T   cell selection and differentiation

Secondary lymphoid organs White pulp

Lymphatic vessel

Red pulp

Spleen: filters pathogens from the blood

Lymphatic vessel

Lymph node: Filters antigens from the lymph

Appendix

Tonsil

Peyer’s patches

Mucosal-associated lymphoid tissues (MALT): Lymphoid tissue positioned to confront and eliminate pathogens the host encounters via eating and breathing

280  CHAPTER 10  Innate Immunity

Primary lymphoid organs  The primary lymphoid organs of the lymphatic system, the bone marrow and the thymus, have key protective functions. These organs are the sites where B lymphocytes (B cells) and T lymphocytes (T cells) differentiate into mature immune cells capable of recognizing antigens (Table 10.3). Because lymphocyte maturation was first studied in birds, B cells get their name from the bursa of Fabricius, the avian organ where this process occurs. The structure is absent in humans, but the fetal liver and bone marrow act as bursa equivaantigen Any foreign lents. T cells are also named for molecular configuration that generates their site of maturation, the thyan adaptive immune mus. The thymus is a pale grayish, response; an bilobed organ located between antibody-generating the lungs high in the thoracic cavsubstance. ity. It is protected by an exterior connective tissue capsule. Inside macrophage is the cortex, a layer of immature, A highly efficient densely packed, rapidly dividing phagocytic cell that thymocytes, or immature T cells, develops from the and macrophages. In addition differentiation of a to pathogen removal, macromonocyte moving phages can activate lymphocytes into host tissues. for adaptive responses. Maturing cortical thymocytes express T-cell receptors (TCRs) on their plasma membranes that are specific for binding a single antigen type. These cells move to the interior of the thymus, an area called the medulla, where they can interact with macrophages, dendritic cells, and dendritic cell The epithelial cells. Medullary thymoprincipal phagocytic cell type with cytes able to bind nonself antibranched cytoplasgens complete maturation under mic projections that the influence of thymosin, a colfunctions in innate lection of proteinaceous thymic immunity to directly hormones. Next, these functional eliminate ingested T cells are exported to circulation pathogens and in where they will eventually launch adaptive immunity to adaptive responses against invadactivate lymphocytes. ing microorganisms. Secondary lymphoid organs  The secondary lymphoid organs are distributed throughout the body and are populated by mature lymphocytes exported from the bone marrow and thymus. They provide strategic sites for the

1. How is active immunity artificially acquired? 2. What cells participate in the second-line defenses of an innate response?

lymphocyte–antigen interactions leading to adaptive immunity. The spleen and lymph nodes are the principal secondary lymphoid organs. They bring antigens and lymphocytes together by filtering them out of the blood and lymph. The structure of the spleen is specialized for antigen trapping and interaction with immune cells. The spleen is composed of two anatomically distinct regions: red pulp and white pulp. The red pulp processes blood by degrading old and dying red blood cells and storing red blood cells and platelets; it also removes potential pathogens from the blood. The white pulp, which functions in immunity, consists of a cylindrical aggregation of lymphoid cells around each arteriole. It is here that antigen–lymphocyte interactions occur as pathogens are filtered from the blood. Resident macrophages rapidly engulf, or phagocytize, these microorganisms and communicate with surrounding lymphocytes, which triggers the maturation of B cells into plasma cells secreting ­antibody proteins. Lymph nodes are small, bean-shaped, encapsulated structures dispersed along lymphatic vessels throughout the body. They antibody A trap more than 97% of circulating Y-shaped protein bacteria from pathogen-contami- secreted by mature nated lymph in lymphatic vessels. B lymphocytes, or The fluid percolates through the plasma cells, that specifically binds to lymphocyte-rich nodes, allowing and neutralizes antiantigen–lymphocyte interactions. gens, such as those Pathogen-activated lymphocytes found on pathogens. are then exported throughout the body via lymphatic vessels. Mucosa-associated lymphoid tissue (MALT) is also considered a secondary lymphoid organ because it also functions to bring pathogens and lymphocytes together, triggering immune responses. These tissues are essentially clusters of lymphocytes and macrophages, partially enclosed with connective tissue capsules and associated with mucosal surfaces. MALT is found in both the respiratory system (in the form of BALT, bronchial-associated lymphoid tissue) and in the gastrointestinal system (in the form of GALT, gut-associated lymphoid tissue) and includes the appendix, Peyer’s patches, tonsils, and adenoids. Because breathing and eating provide ideal opportunities for pathogens to enter the body, this lymphoid tissue is precisely placed to maximize host defense. As with the spleen and lymph nodes, antigen–lymphocyte interactions in the MALT trigger adaptive immune responses.

3. What three body systems must collaborate to generate a functional immune system? An Introduction to Immunity  281

10. 2

First-Line Defense Mechanisms

LEARNING OBJECTIVES 1. Explain how the three major innate physical defenses inhibit pathogen access to the host. 2. Compare and contrast the external and internal chemical defenses of innate immunity.

T

he first-line defenses of the immune system are nonspecific mechanisms that block pathogen attachment or entry, including physical defenses, such as barriers or washing actions, and chemical defenses, such as exposure to lysozyme or other antimicrobial compounds.

Physical Defenses Physical defense mechanisms against pathogens can be categorized as barriers, washing, and heat (Table 10.4).

Barriers  Among the barriers, the epidermis, basement membrane, and dermis of your skin provide a formidable, triple-layered impediment against the entry of environmental pathogens to interior tissues. Also, the epidermis is reinforced with keratin, a sturdy, waterproof protein; adjacent cells are connected with tight junctions, a network of sealing proteins that prevents microbial penetration between cells; and constant cell generation in lower skin layers causes sloughing of the epidermis and any associated pathogens. Vulnerable structures such as the eyes have special physical protection such as the eyelids and lashes. Because pathogens enter your body with the air you breathe and the food you eat, internal pathogen barriers are essential. Nose hairs filter contaminants to safeguard

the respiratory system. Mucous membranes secrete copious amounts of slimy mucus that physically blocks microbial attachment to the membrane surfaces. The blood–brain barrier prevents pathogens in the blood from invading the brain. Tightly connected endothelial cells lining the brain capillaries regulate the transport of material into the brain, restricting pathogen access.

Washing  Another highly effective physical defense mechanism is strategic washing actions. Sweat dislodges skin microbes and tears can wash away foreign matter that gets past the eyelids and lashes and into the eye. Microorganisms entering the mouth may be washed into the stomach as the tongue wipes contaminated saliva from oral surfaces for swallowing. Gastrointestinal pathogens can be expelled by vomiting and/or diarrhea. The ciliary escalator of the respiratory system is responsible for sweeping the debris-laden layer of mucus up and out of the trachea (Table 10.4). Potential contaminants are then either coughed out or swallowed, where digestive enzymes and stomach acid destroy them. Sneezing clears contaminants from the sinuses explosively, whereas a runny nose more slowly discharges pathogens. Flagellated bacteria swimming up the urethra are usually washed away by regular urination before they can reach their destination, the urinary bladder, and mucus discharge flushes microorganisms from the vagina. Heat  A final physical defense mechanism is heat. Although an extremely high fever is cause for concern, slight to moderate body temperature elevation effectively halts bacterial reproduction (see What a Microbiologist Sees). Because host conditions exceed the optimum temperature for bacterial growth, fever facilitates immune responses.

Physical defenses: Barriers versus washing actions  Table 10.4 Barrier mechanisms Blood-brain barrier Eyelids and eyelashes Nasal hairs Skin (see the diagram)

Invading bacteria

Tight junctions Keratinized cells Triple-layer barrier design Epidermis Basement membrane Dermis

Washing mechanisms Coughing Diarrhea Salivation Sneezing Sweating

Tearing Urination Vaginal secretions Vomiting Ciliary escalator   (see the diagram) Invading bacteria Mucus layer Cilia Mucus in goblet cell Basement membrane Connective tissue

What a Microbiologist Sees ✓

The Planner

The Benefits of Fever The three Petri plates in Figure a show a clear correlation of bacterial growth with incubation temperature. Savvy biology students may note that increasing growth reflects heat-enhanced enzyme activity until denaturation occurs, inhibiting further bacterial reproduction. However, what a microbiologist sees is that the growth pattern represents pathogen reaction to fever, an innate immune response. The in vitro reduction of bacterial growth with elevated incubation temperature mirrors microbial survival in vivo as body temperature rises. Defined as an oral temperature of 99.6°F or higher, fever slows pathogen growth, increases production of infection-fighting white blood cells, and enhances secretion of interferons, an antiviral defense mechanism. Consequently, a microbiologist recognizes body temperature elevation as the trigger for activating a combination of effective antimicrobial defenses leading to pathogen reduction and faster recovery.

Although fever is often considered dangerous, ideal pathogen-fighting temperature is 102–103°F (Figure b). Although the National Institutes of Health recommend medical intervention for infants and immune-compromised patients at rectal temperatures of 100.4°F or higher (When Your Baby or Infant has a Fever: MedlinePlus Medical Encyclopedia [n.d.]. Retrieved October 15, 2015), it is unnecessary for most patient cohorts until oral temperature reaches 104.5°F or greater. Fever relief is typically accomplished by administering temperature-reducing medications such as acetaminophen or ibuprofen, increasing fluid consumption, applying cool compresses, soaking in a tepid bath, and wearing lightweight clothing. Clearly, fever is a simple mechanism for initiating multiple innate immune responses and speeding recovery.

a. Plates of chocolate agar were inoculated with Staphylococcus

68° F

b. Relative bacterial growth rates are

104.5° F

Correlation of oral body temperature in adults and bacterial growth rate

correlated with clinically significant fever levels. (Data from Small, P., Täuber, M., Hackbarth, C., & Sande, M. (1986). Influence of body temperature on bacterial growth rates in experimental pneumococcal meningitis in rabbits. Infection Immunity, 484–487.

120

100

98.6 100%

105.6

104.5

103

100

Body temperature (°F)

86% 80

60

55%

40

36% 22%

20

T h i n k C ri ti c al l y

If continued reduction in bacterial growth correlates with increasing fever as shown in Figure b, why is ~103°F considered the ideal pathogen-fighting temperature?

106

Bacterial growth rate

Retrieved July 26, 2015, from http://www.ncbi.nlm.nih. gov/pmc/articles/PMC261024/)

98.6° F

courtesy Ken Colwell

epidermidis and incubated at the indicated temperatures to show the effect of this physical defense mechanism on bacterial growth.

0

0% Normal

Fever

Ideal pathogen fighting

Beneficial fever

Initiate treatment

Damage

Harmful fever

First-Line Defense Mechanisms  283

Case Study Jack was thankful he had declined the offer of spicy Mexican food with his coworkers. The pain was worse, burning from his navel to his breastbone. It always peaked at night and when he was hungry. “It’s just the stress from work,” Jack told himself. Jack chewed up a handful of Tums, and made toast and tea for his late dinner. Despite the antacids and bland meal, Jack’s gastric distress intensified. Two hours later, Jack vomited and was terrified to see bright red blood mixed in with his regurgitated toast. He drove immediately to the hospital. After examining Jack, Dr. McAfee said, “You have all the symptoms of a gastric ulcer: persistent burning belly pain worsening at night, weight loss, and nausea. Your experience tonight plus the dark stools you reported means the ulcer is bleeding. I’m going to order a test to confirm this diagnosis so we can get you started on antibiotics.” Jack responded with surprise. “You said I had an ulcer, not an infection. What do I need antibiotics for?” Dr. McAfee explained that most gastric ulcers are the result of a bacterial infection (Figure a). As the microorganism thrives in the mucus layer protecting the stomach surface, its activity can weaken the coating. Sensitive stomach tissues are exposed to both acid and the bacteria, which degrade the lining and cause ulcer formation.

Eye of Science/Science Source

a. Helicobacter pylori, the microbe that causes most gastric ulcers

In the morning, Jack underwent an endoscopy, a procedure involving the insertion of a tube with a tiny camera down the esophagus and into the stomach. After directly viewing the damaged lining, the physician performed a biopsy by collecting a small tissue sample near the ulcer and examining it. At his follow-up appointment, the physician explained that Jack’s CLO test was positive, indicating that his ulcer was caused by infection (Figure b). His biopsied tissue was inserted into a small container of urea agar mixed with the pH indicator, phenol red. Bacteria infecting the tissue used urease to convert the urea into carbon dioxide and ammonia, raising the pH and changing the indicator from yellow to hot pink.

b. The CLO test packet courtesy Halyard Health

No Spicy Food for Me!

✓ The Planner

3. Examine the CLO test packet in Figure b. Does the indicator show the pH as acidic or basic? How do you know? Jack’s physician wrote a prescription for 2 weeks of antibiotics plus Protonix, a drug to inhibit acid pumps in his stomach. The doctor explained that the infecting bacteria can also raise the pH in the stomach just as they did in the CLO test. Gastric tissues compensate by secreting more acid, which in turn aggravates the ulcer. “So doctor, if the excess acid can destroy my stomach lining, why doesn’t it kill the infecting bacteria?” Jack asked. “This bacterial species is adapted to the harsh conditions of your stomach and capable of withstanding the low pH that kills most other pathogens,” answered the doctor. “Finish your prescriptions and you’ll be in good shape…remember, stress and spicy food can aggravate an ulcer, but the bacteria caused it.”

1. Which microorganism is infecting Jack and causing his gastric ulcer? Describe its morphology.

4. INVESTIGATE: Which antibiotic was likely prescribed to treat Jack’s ulcer?

2. REVIEW: What is the pH of the stomach acid irritating the lining of Jack’s stomach?

5. What microorganisms compose the normal microbiota of the stomach? Why?

284  CHAPTER 10  Innate Immunity

Chemical Defenses Some pathogens succumb to the chemical weapons of innate immune responses. Skin secretions and mucus contain lysozyme, a peptidoglycan-degrading enzyme that weakens bacterial cell walls normal so that internal pressure causes microbiota The cell lysis. The high salt concencommunity of microtration of sweat and mucus desicorganisms that are cates most pathogens. Microbes adapted to living in not adapted to living in the gasand on body sites trointestinal tract perish because of the host and that of the extremely acidic (pH < 2) provide protecenvironment (see the Case Study), tion for the host by digestive enzymes, and emulsifycompetitively excluding action of bile. ing pathogens and On your skin, acid-sensitive destroying them with microbes are inhibited by the their metabolic low pH produced by the normal secretions. microbiota that metabolize oily

secretions into acidic by-products. In the large intestine, dense populations of well-adapted normal microbiota inhibit pathogen growth by outcompeting them for nutrients and by secreting small, antimicrobial proteins. In 2008, the National Institutes of Health (NIH) initiated a project to characterize the microorganisms living in and on humans and to determine how the composition of this microbial community varies between sickness and health. Known as the Human Microbiome Project, it dispelled the long-accepted belief that staphylococcal species were the predominant members of normal skin microbiota. The Human Microbiome Project demonstrated that the skin bacterial community is composed of 62% Pseudomonas and 20% Janthinobacterium. Only about 5% of our normal microbiota is made up of staphylococcal species. The study also verified that the composition of normal microbiota changes with developmental stages, environmental conditions, and overall health (Figure 10.2).

The variability of normal microbiota • Figure 10.2

Toddler

Infant

65-80 years

>100 years

Healthy

Obese

KEY Firmicutes Bacteroidetes Actinobacteria Proteobacteria Other

Age

courtesy Linda Young courtesy Linda Young

Adult

courtesy Linda Young

Geriatric

Alistair Berg/Getty Images

The normal microbiota responsible for our biological defense against infection vary greatly in composition and location throughout our lifetime. Nutritional quality and quantity can dramatically influence the makeup of your microbial community as can unhealthy conditions, including obesity.

Healthy

Malnourished

In t e r p r e t t h e Da t a

Breast-fed

Formula-fed

As you age, which bacterial group becomes a significantly greater proportion of your normal microbiota? a. Firmicutes c. Actinobacteria b. Bacteroides d. Proteobacteria

First-Line Defense Mechanisms  285

Studies of gut microbiota suggest fluctuation in its amount and composition is clinically significant for several reasons. First, the development and maintenance of a diverse bacterial community correlates with immune system maturation. The complexity of gut microbiota increases from birth through age 5 and remains essentially constant throughout adulthood. The principal change observed during development is a dramatic increase in the ratio between Firmicutes and Bacteroidetes. In old age, there is a rise in Actinobacteria levels reminiscent of infancy. Because immune competence matures during childhood, provides protection through adulthood, but declines with age, researchers hypothesize that the fluctuations of gut microbiota in the earliest and latest stages of life correlate with the increased infection rates seen in these patients. Consequently, physicians modulate the gut microbiota of geriatric patients medically to resemble the community associated with younger adults,

leading to reduced infection risk and improved overall health. Because aggressive cancer treatments cause significant collateral damage to both healthy tissues and gut microbiota, some physicians now harvest and store a sample of their patient’s normal gut microbiota for reinoculation following chemotherapy and/or radiation. This practice correlates with shortened posttreatment recovery times. Finally, studies connecting an increased rate of autoimmune disorders with diminished microbiota quantity and diversity emphasize the importance of a robust gut community. The healthy protocols of improved sanitation and appropriate antibiotic use practiced for the past 75 or more years may be reducing the amount and complexity of infant microbiota. As a result, immune system development may be negatively influenced leading to enhanced risk of acquiring an autoimmune disease.

1. How can pathogens trapped in the mucus of the respiratory system be killed?

2. How can the normal microbiota decrease the pH of the skin and effectively kill pathogens?

10. 3

Innate Cellular Defense Mechanisms

LEARNING OBJECTIVES 1. Outline the development of red blood cells, leukocytes, and mast cells. 2. Describe the morphology and function of each of the five leukocyte types.

3. Explain the process of phagocytosis including the five different intracellular killing mechanisms used to eliminate pathogens. 4. Correlate the inflammation symptoms of heat, edema, redness, and pain with the cellular events of the process.

f physical and chemical mechanisms fail to prevent pathogen invasion, second-line defenses engage to protect the host. These protective features include cellular defense mechanisms in which leukocytes participate directly as well as protein-mediated defense mechanisms, discussed in the next section. Although still nonspecific, the activities of white blood cells and immune-active proteins are fast and effective.

of leukocyte origination and maturation is essential for comprehending their complex roles in immunology. All circulating blood cells, including leukocytes, are produced in the bone marrow by the process of hematopoiesis (Figure  10.3). Approximately 1 in 2000 bone hematopoiesis marrow cells is a pluripotent he- The differentiation of matopoietic stem cell that acts as pluripotent stem cells a precursor to all blood cell types. into the diverse cells These cells lack the usual surface of the blood. proteins associated with specific types of mature blood cells. When they undergo cell division, stem cells generate lymphoid progenitors, myeloid progenitors, or more stem cells.

I

Hematopoiesis Because leukocytes mediate immune responses, anything that impedes their production will negatively affect immunity. Therefore, a thorough understanding

286  CHAPTER 10  Innate Immunity

Hematopoietic blood cell production • Figure 10.3 Under the influence of cytokines, pluripotent hematopoietic stem cells in the bone marrow can differentiate into erythrocytes, platelets, and leukocytes. Pluripotent hematopoietic stem cell

Lymphoid progenitor

B lymphoblast

NK cell

Erythroblast

Megakaryoblast

Myeloblast

Monoblast

Mast cell

Bone marrow

T lymphoblast

Myeloid progenitor

Tissues

Peripheral distribution

Reticulocyte

(Differentiates in thymus) T cells

Megakaryocyte

(Differentiate in bone marrow) B cells

NK cells

Erythrocytes

Platelets

Basophils

Eosinophils E

B

Neutrophils

Monocytes

N

Blood Macrophage Dendritic cell

Secondary lymphoid organs and blood

T h i n k C ri ti c al l y

How would exposure to a chemical that selectively destroyed lymphoid progenitors affect a person’s immune system?

While in the bone marrow, lymphoid progenitors’ exposure to specific cytokines influences their differentiation into T lymphoblasts, B lymphoblasts, and immature natural killer (NK) cells, which participate in the demise of virus-infected and malignant cells. T lymphoblasts leave the bone marrow and move to the thymus for maturation and positive selection. B lymphoblasts complete maturation in the bone marrow, and NK cells mature in the bone marrow, lymph nodes, or thymus. Myeloid progenitors are influenced by a different set of cytokines resulting in the generation of cells that ultimately produce blood cells. These immature cells include: erythroblasts, which give rise to red blood cells;

Tissues

megakaryoblasts, which give rise to platelets; monoblasts, which give rise to monocytes; and myeloblasts, which further differentiate to give rise to neutrophils, eosinophils, and basophils. The myeloid progenitor also gives rise to the mast cells found in tissues.

Leukocytes White blood cells, found in the blood, lymph, and throughout the body tissues, compose approximately 1% of the total blood volume of a healthy adult. The five principal types of leukocytes perform a variety of defensive functions and are characterized by distinctive morphologies when treated with a mixture of dyes known as Innate Cellular Defense Mechanisms  287

Wright stain (Table 10.5). The proportion of the different leukocyte types in a blood sample is an important diagnostic tool (see The Microbiologist’s Toolbox). Leukocytes are divided into two groups. Granulocytes, which include neutrophils, eosinophils, and basophils, contain obvious cytoplasmic granules used for host defense. Agranulocytes, which are represented by lymphocytes and monocytes, also contain cytoplasmic granules, but the granules are so tiny that extreme magnification is

needed to see them. Nuclear morphology correlates with granule presence. Mature granulocytes are distinguished by a lobed nucleus and are often called polymorphonuclear cells (PMNs). Agranulocytes have a more typical rounded nucleus.

Neutrophils  Neutrophils are the most abundant type of leukocyte. With 1011 neutrophils produced daily, they compose 50% to 70% of circulating white blood cells.

A comparison of leukocyte morphology and function  Table 10.5 % in healthy adult

Size (𝛍m)

Basophil

0.5–1

Eosinophil

Cell type

Primary functions

Life span

12–15

Bi- or tri-lobed nucleus; coarse blue histamine granules in blue cytoplasm

Mediation of allergic responses

A few hours– days

1–4

10–12

Bi-lobed nucleus; large orange-red granules in pink-red cytoplasm

Mediation of defenses against worms

8–12 days

Neutrophil

50–70

10–15

3–5 lobed nucleus; numerous fine lavender granules in tannish cytoplasm

Mediation of respiratory burst following phagocytosis

6 hours– 8 days

Lymphocyte

20–40

8–15

Large, round, dark purple nucleus with light blue sliver of cytoplasm; 3 principal forms: B cells, T cells, NK cells

Production of antibodies Destruction of virusinfected and tumor cells Prevention of autoimmune reactions

Weeks– years

Monocyte

2–7

7.5–10

Large, bean-shaped dark purple staining nucleus with moderate amounts of lavender cytoplasm

Development of tissue macrophages

Hours– days

Biophoto Associates/ Science Source Images

Agranulocytes

Biophoto Associates/ Science Source Images

Biophoto Associates/ Science Source Images

Biophoto Associates/ Science Source Images

Biophoto Associates/ Science Source Images

Granulocytes

Special features

288  CHAPTER 10  Innate Immunity

T he M icrobiologist ’ s T oolbo x

✓ The Planner

The Differential Count

a. This blood smear is being prepared for use in a differential white blood cell count.

the blood completely across the small slide edge. Quickly pulling the second slide forward makes a thin smear of blood across the original slide (Figure a). Once dry, the blood smear is treated with Wright stain to highlight leukocyte morphological features under the light microscope (Figure b). The stained blood smear is scanned to observe 100 leukocytes. The number of each type is noted and their proportion of the total leukocyte population determined.

b. This Wright-stained blood smear shows the characteristic appearance of red blood cells and leukocytes under a light microscope.

a.

b.

c.

Blood

d.

e.

Steve Gschmeissner/SPL/Getty Images

A differential count provides information about the relative numbers of the five different types of circulating leukocytes. Because each cell type performs a specific immune function, altered leukocyte proportions can assist physicians in diagnosing patients’ conditions. To perform a differential white blood cell count, called a diff, a drop of blood is placed at one end of a microscope slide. The short edge of a second slide is placed on the surface of the first slide and slowly backed into the droplet. Capillary action pulls

Pu t It To g e t h e r

Review Table 10.5, and answer this question. Using the table as a guide for distinguishing the five principal leukocyte types, identify the cells labeled a–e in the blood smear shown in Figure b.

It is normal to find approximately 3% of neutrophils in their immature form where the nucleus appears as a C-shaped band. Known as stabs or bands, they are easily distinguished from mature neutrophils commonly called segs because of their highly segmented nucleus. The principal function of neutrophils is the phagocytosis of pathogens.

Eosinophils  The bright red granules of a Wright-stained eosinophil consist of lysozyme, major basic protein, many digestive enzymes, and chemicals that participate in an inflammatory response. These substances are especially effective against helminthic pathogens and participate in allergic responses. When histamine granules

are released from basophils, they increase vascular permeability, which facilitates the movement of leukocytes into tissues at the site of infection. Histamine release is also associated with immediate allergic responses. Although not related to basophils, nonmotile mast cells anchored in connective tissue at specific body sites also possess histamine granules and function similarly as a result.

Lymphocytes  In addition to their predominance in the primary and secondary lymphoid organs, lymphocytes are the second most prevalent leukocyte in circulation and may compose 10% of the total number of white blood cells in adults. Lymphocytes recognize antigens and Innate Cellular Defense Mechanisms  289

mediate various effector mechanisms, or pathogen-eliminating processes. To maximize effectiveness, lymphocytes differentiate into five classes, each with associated functions. B cells mature into antibody-secreting plasma cells. T cells usually mature into either helper T lymphocytes (TH cells) capable of activating multiple effector mechanisms, or into cytotoxic T lymphocytes (TC cells) responsible for directly killing targeted cells. Some T lymphocytes develop into regulatory T cells (TREG cells) that moderate the intensity of immune responses to prevent host tissue damage. NK cells participate in innate immunity and can directly kill target cells. All other lymphocyte types engage in adaptive, third-line defense mechanisms, which are covered in detail in Chapter 11. NK cells, macrophages, dendritic cells, and neutrophils function by recognizing pathogen-associated molecular patterns (PAMPs), which are highly conserved molecular arrangements common on the surfaces of many pathogens. PAMPs include lipoteichoic acid and lipid A in the cell walls of both gram-positive and gramnegative bacteria. Pathogen recognition occurs when receptors on these cells bind to the PAMPs of targets, such as cells infected with viruses, intracellular bacteria, or tumor cells. The receptors involved are a type of pattern recognition receptor (PRR). PRRs are strategically placed within cells to maximize effective binding of PAMPs. For example, Toll-like receptors (TLRs) are located in both the plasma membrane and phagosome membrane, NOD-like receptors are found in the cytosol, and complement is a soluble receptor in the serum. The binding of PRRs to PAMPs leads to the intracellular signaling responsible for pathogen elimination. In the case of NK cells, the effector mechanism used is granule exocytosis. The protein perforin and the protease granzyme are the major components of NK cell cytoplasmic granules. Perforin forms membrane pores that facilitate the entry of granzymes into the target cell. Granzyme triggers a sequence of events resulting in apoptosis, or programmed cell death in which the cell shrinks, fragments, and is quickly phagocytized, so its contents do not spill out causing host damage.

Monocytes  The last type of leukocyte is the phagocytic monocyte, which moves into tissues and matures into macrophages. Macrophages found in specific locations in the body are designated by special names: alveolar macrophages in the lungs, microglial cells in the central nervous system, and Kupffer cells in the liver. The adaptive macrophage functions of cytokine production and antigen presentation will be described in Chapter 11.

Phagocytosis White blood cells engulf invading pathogens that they encounter during their wandering patrol of body tissues.

290  CHAPTER 10  Innate Immunity

Phagocytosis, or cell eating, is carried out by neutro-

phils, monocytes, macrophages, and dendritic cells. To facilitate phagocytosis, microbial PAMPs, such as fimbrin, may bind directly to PRRs, such as TLRs, on the phagocyte surface (Figure 10.4, step 1). In addition, many microorganisms undergo opsonization, a process in which their surface becomes covered by molecules known as opsonins. Common opsonins include C-reactive protein, mannose-binding lectin, and antibodies, or immunoglobulins (Ig). Sometimes opsonins are secreted PRRs, such as C3b, binding to PAMPs on the pathogen surface. Because there are diverse opsonins, they can interact with a variety of phagocyte surface receptors, enhancing effectiveness. Also, opsonins on the microbes bind surface receptors on the phagocytes with high affinity, triggering invagination of the phagocyte plasma membrane and pathogen engulfment (step 2). The resulting intracellular vesicle, called a phagosome, is the site of pathogen destruction. A variety of intracellular killing mechanisms destroy the engulfed pathogen (steps 4a, b, and c). Phagosome acidification to pH 4 inactivates most microorganisms and promotes the activity of acid hydrolases added during lysosome fusion. In the merged phagosome and lysosome, now known as a phagolysosome, enzymatic degradation of the pathogen wall leads to destruction by cell lysis. Lysis also results when pore formation occurs from the addition of defensin proteins to the phagolysosome. When sufficient oxygen is available in host tissues, neutrophils initiate what is known as a respiratory burst (step 4d), which kills engulfed pathogens by oxidizing their proteins and lipids. This is accomplished by generating the strong oxidant, hydrogen peroxide. Although the hydrogen peroxide can begin pathogen oxidation, the neutrophil cytoplasmic granules may combine it with chlorine to produce hypochlorite, the same strong oxidant found in bleach. Phagocytic cells can also oxidatively destroy engulfed microbes using enzyme-generated nitric oxide (step 4e). The freely diffusible nitric oxide moves into the phagolysosome, where it interacts with superoxide anions to produce peroxynitrite radicals, which destroy the pathogen.

Inflammation Phagocytosis is an integral part of the physiological process known as inflammation, or redness, heat, swelling, and pain in response to tissue injury from physical trauma, chemical damage, or pathogen attack. Inflammation can also be triggered by exposure to allergens or by autoimmune responses. Inflammation serves the important functions of 1. rapidly mobilizing an army of phagocytic cells and directing them to the injury site,

Opsonins on the surface of the pathogen bind to receptors on the surface of the phagocyte, facilitating pathogen engulfment and the activation of various killing mechanisms in the phagocyte.

Gram-negative bacillus

Surface antigen

1 Pathogen PAMPs join directly to surface receptors on the phagocytic cell or bind opsonins to facilitate attachment to surface receptors. Antibody

Fc receptor

Plasma membrane of phagocytic cell 2 Pathogen binding triggers plasma membrane invagination leading to engulfment.

Pathogen

Receptor Lysosomes

3 The engulfed pathogen resides in a phagosome.

Phagosome

4 One or more intracellular killing mechanisms is activated.

a. Acidification

b. Enzymatic degradation

c. Loss of membrane integrity due to defensin activity

d. Oxidation with ROS

e. Oxidation with RNS

Defensins NO + O2– → ONOO–

H+ Phagolysosome

NO Citrulline

Phagocyte oxidase iNOS

Arginine 5 Debris is formed as intracellular killing mechanisms destroy the engulfed pathogen and is expelled by exocytosis.

T h i n k C ri ti c al l y

Some patients suffer from a deficiency of C3b. How would phagocytosis differ in these patients?

Debris

Innate Cellular Defense Mechanisms  291

Process Diagram

✓ The Planner

Phagocytosis • Figure 10.4

Process Diagram

✓ The Planner

An acute inflammatory response • Figure 10.5 Orchestrated by chemical mediators and phagocytes, inflammation contains invading microbes, minimizes the impact of their secreted toxins, maximizes their clearance from the tissues by phagocytosis, and initiates tissue repair. Bacteria Inflammatory mediators

Mast cell

1 Inflammatory mediators are released when bacteria invade tissues through an abrasion.

Blood vessel

Heat Redness

2 Mast cells secrete additional proinflammatory molecules, including histamine. The resulting vasodilation leads to the redness and heat associated with inflammation.

Vasodilation

3 Inflammatory mediators increase expression of endothelial adhesion molecules, which promotes diapedesis. 4 Increased capillary permeability allows fluid to infiltrate the tissue, enhancing diapedesis and initiating the edema characteristic of inflammation.

Bloodflow Rolling

Activation

Adherence Transendothelial migration

Neutrophil Chemotactic factor

Opsonization occurs

5 Interactions between compounds at the injury site prevent spread of infection and encourage pathogen elimination.

Exudate dilutes effect of bacterial toxins

Blood vessel lining Migration of neutrophil along concentration gradient of chemotactic molecules

Edema

Phagocyte chemotaxis Fibrin mesh slows pathogen spread, enhancing phagocytosis.

Enhanced phagocytosis Exudate

KEY Scar

6 Macrophages and lymphocytes clear the area of pus and inflammatory debris and mend damaged tissues.

Neutrophil

Inflammatory mediators Proinflammatory molecules including histamine Chemotacic factor C3b

Th in k Cr it ica lly

How would diapedesis be affected if inflammatory mediators were not produced?

2. containing and eliminating any invading pathogens, and 3. repairing tissue damage to facilitate resumption of normal function. An acute inflammatory response persists for only a few days and depends primarily on neutrophils and monocytes to eliminate the invading foreign microbe or material. Chronic inflammation continues for months to years and preferentially uses lymphocytes, monocytes, and plasma cells. Additionally, inflammation can damage host tissues because of the actions of oxidants and hydrolytic enzymes during active phagocytosis. However, these seemingly detrimental symptoms signal the various steps in the ultimately beneficial elimination of pathogens by the inflammatory response. A common example of acute inflammation is the healing of an infected skin abrasion (Figure 10.5). Initiated by the release of inflammatory mediators from invading pathogens, damaged tissues, and host cells (step  1), local mast cells secrete histamine and other proinflammatory molecules triggering vasodilation, or the widening of blood vessels due to relaxation of their smooth muscle. This process enhances blood flow to the injured region and leads to the heat and redness characteristic of inflammation (step 2; Table 10.6). Under the influence of inflammatory mediators, the expression of adhesion molecules increases on endothelial surfaces. As a result, arriving monocytes and neutrophils can firmly attach to vessel walls, flatten, and easily squeeze between adjacent cells due to histamine modification of the tight junctions (step 3). Following diapedesis, these phagocytes target the infection site by chemotaxis and initiate pathogen diapedesis The elimination. passage of leukoHistamine and other inflamcytes between intact matory mediators increase capilendothelial cells and lary permeability, allowing fluids into surrounding tissues. to infiltrate surrounding tissues. The exudate formed from plasma leaving the blood vessels contains varying amounts of complement, antibodies, albumin, fibrinogen, and antibacterial proteins (step 4). Serous exudate is clear, whereas opaque pus results when exudate contains numerous phagocytes and cellular debris. Although edema and pain result from fluid infiltration of infected tissues, ideal edema Swelling conditions for pathogen eliminaresulting from tion are established (step 5). The abnormal fluid accumulation. exudate dilutes bacterial toxins to minimize host damage and fibrin in the exudate forms a pathogen-trapping meshwork to prevent infection spread. A large phagocyte population arises at the infection site as fluids leaving circulation

The functions associated with specific inflammatory molecular mediators  Table 10.6 Function

Molecular mediator

Vasodilation

Histamine, interleukin-1(IL-1), tumor necrosis factor-α (TNF-α), leukotrienes, nitric oxide, prostaglandins

Increased capillary permeability

Histamines, leukotrienes, platelet activating factor

Increased expression of endothelial adhesion molecules

IL-1, TNF-α

Leukocyte chemotaxis

IL-1, IL-8, TNF-α, interferon-γ (IFN-γ), platelet activating factor

Fever elevation

IL-1, TNF-α, IFN-γ

Enhanced C-reactive protein production

IL-1, IL-6, TNF-α

promote diapedesis. Effectiveness of phagocytosis is improved by the presence of opsonins in the exudate. Once the infection has been controlled, molecular inhibitors diminish the inflammatory response and initiate tissue repair (step 6). An intact protective barrier is soon in place to guard against future microbial invasions, although there may be a loss of function when scar tissue forms. If the inflammatory response does not resolve as described, it signals the persistence of a microorganism in either a viable or inert state. This dysfunctional, chronic inflammatory process continues indefinitely and involves lymphocytes, macrophages, and plasma cells. It typically leads to a pathologic condition resulting in continuing host damage. Examples of chronic inflammation include organ-specific infections such as hepatitis, abscess development, and granuloma production. To alleviate chronic inflammation, surgeons may excise the tissue containing the persistent microbe or administer glucocorticoids, which inhibit production of proinflammatory molecules. Perhaps the only medical value of chronic inflammation has been its role as a contraceptive method, in that it is the functional basis of an intrauterine device.

1. How is a neutrophil produced from a pluripotent hematopoietic stem cell? 2. Which leukocytes are also granulocytes? 3. What is the relationship between opsonization and the killing of pathogens by phagocytosis? 4. What is the role of inflammatory edema in diapedesis? Innate Cellular Defense Mechanisms  293

10. 4

Protein-Mediated Defense Mechanisms

LEARNING OBJECTIVES 1. Compare and contrast the alternative, lectin, and classical complement pathways. 2. Describe how interferons impede a viral infection.

3. Outline the functions of siderophores, ionophores, and cytokines in innate host defense.

variety of protective proteins act as nonspecific, second-line defenses. Some proteins are capable of directly lysing bacterial cells or interfering with viral replication cycles. Other proteins coordinate the activity of immune cells involved in both innate and adaptive responses.

C3b fragment are produced. C3a is a powerful mediator of inflammation, whereas C3b fragments bind to most bacteria (Figure 10.6, step 1). C3b accurately recognizes bacterial surfaces for binding by their lack of sialic acid, a monosaccharide typically associated with eukaryotic cells. In a series of coordinated events, additional complement proteins attach to the surface-bound C3b, forming enzyme complexes. Known as convertases, these enzyme complexes generate more complement protein fragments (Figure 10.6 steps 2–4), including C3a, C5a, and C5b. The C3a and C5a stimulate inflammation. C5a is also strongly chemotactic for neutrophils and causes their increased expression of C3b receptors to promote effective phagocytosis via opsonization (see Section 10.3). The C5b inserts into the bacterial membrane, binds with C6, C7, and C8, forming a new complex that (step 5) initiates assembly of the membrane attack complex (MAC). The MAC is a transmembrane tube made of hydrophobic C9 proteins. With the selective permeability of the membrane damaged, cations rush into the pathogen and turgor pressure builds, resulting in osmotic cell lysis (step 6). The lectin pathway is an important strategy for activating the protective defenses of the complement system when the alternative pathway fails. Because some bacteria, such as Neisseria meningitidis, which causes meningitis, express sialic acid on their surface, C3b cannot bind to trigger activation of the alternative pathway. However, lectins, or carbohydrate-binding proteins, attach to mannose-containing PAMPs on this pathogen, which initiates a different series of reactions leading to the production of C5b. Although the lectin branch of the complement cascade is activated differently than the alternative branch, the remaining steps of the process are identical.

A

The Complement Pathways The complement system is composed of numerous inactive proteins that circulate in the blood and in the interstitial fluid that bathes the tissues. Complement binding complement to microbes or to antibodies system A series of attached to microbes initiates a more than 30 serum pathway, or series of events, that and surface proteins converts specific complement recruited to compleproteins into enzyme complexes ment the immune capable of cleaving other comactivity of antibodies plement proteins. As these fragand phagocytes by mented complement proteins sequentially activating enzymes used to systematically bind to the pathobuild a transmemgen, they ultimately generate a brane tube causing transmembrane tube that results osmotic rupture of in bacterial lysis. Although a dethe pathogen. structive process, it rarely causes host damage because it includes safeguards. The pathway can be fully activated only when pathogen binding occurs, which prevents complement activation in the absence of infection. Additionally, host cells possess regulatory surface proteins able to inhibit complement activation. There are three different complement cascades: classical, alternative, and lectin pathways. Although all three pathways mediate pathogen lysis, each is activated differently. In the classical system, antibody binding to bacterial surface antigens initiates the pathway, which represents an adaptive immune response (covered further in Chapter 11). The alternative and lectin pathways are true innate immune responses because they bind complement proteins directly to bacterial PAMPs to trigger activation. Activation of the alternative pathway begins with C3, the most abundant complement protein. As the protein slowly degrades, a small C3a fragment and a larger

294  CHAPTER 10  Innate Immunity

Interferons Interferons (IFNs) are a large family of glycoprotein cytokines named primarily for their ability to interfere with viral rep- interferon (IFN) A lication cycles, thereby providing signal protein made host cell protection. IFN-α and and secreted by host IFN-β are known as type 1 inter- cells in response to ferons and are the principal mole- pathogen presence; cules responsible for this antiviral launches a variety of defense. IFN-γ is better known for immune reactions.

Activated by spontaneously generated C3b binding to pathogen surfaces, the alternative complement pathway is a series of enzymatic events that boost inflammation, enhance neutrophil chemotaxis, promote phagocytosis, and lyse pathogens. Ba

Factor B Factor D

C3 convertase

C3

Properdin

C3a C3b 1 Initial complement binding events lead to the activation of C3 convertase.

Bacterial plasma membrane

C3b

Bb

2 Enzymatic cleavage of C3 by C3 convertase produces C3a and C3b. C3a C3

C5

C5a

C5 convertase

C6

C6 C5b C7

C8

C7

Bb

C3b

Bb

C3b

Properdin

C3b

3 C3a promotes inflammation. C3b binding to complex generates C5 convertase.

C5 4 Cleavage of C5 by C5 covertase produces C5a and C5b. C5a promotes inflammation. C5b inserts into microbial plasma membrane.

C5b C3b

Bb

C3b

5 C5b binds with C6, C7, and C8 forming a new complex that attaches to the pathogen surface and initiates assembly of the membrane attack complex. C8

C9

C6 C5b C7

C8

C9

Cell wall lysis

C6 C5b C7

C8

6 The pore formed by the MAC allows fluid to rush inside, resulting in osmotic cell lysis.

Membrane attack complex (MAC)

courtesy Daniel Nelson Ph.D.

Properdin

C3

Properdin

C3b

Th i n k Cr it ica lly

How would the alternative complement pathway be affected in a patient suffering from a C5 deficiency?

Protein-Mediated Defense Mechanisms  295

Process Diagram

✓ The Planner

The alternative complement pathway • Figure 10.6

Principal roles of interferons  Table 10.7 Interferon type

Produced by

Effects

IFN-α

Dendritic cells, fibroblasts, lymphocytes, macrophages, virus-infected cells

Phagocyte stimulation; NK cell activation; tumor suppression; induction of antiviral state

IFN-β

Dendritic cells, fibroblasts, lymphocytes, macrophages, virus-infected cells

B- and T-cell maturation; enhanced inflammation; tumor suppression; induction of antiviral state

IFN-γ

T cells

Inhibition of cancer cell growth; stimulation of B cells; macrophage activation; enhanced phagocytosis; TH1 cell activation

suppressing the growth of cancer cells and promoting inflammation (Table 10.7). Viral infection of host cells triggers a change in gene expression, resulting in the rapid production and secretion of type 1 IFNs (Figure 10.7, step 1). When IFNs bind to receptors on the surface of uninfected neighboring cells, they induce an antiviral state by modifying the cell’s gene expression (steps 2 and 3). In an antiviral state, the host cell produces a variety of enzymes known as antiviral proteins. These proteins can degrade viral RNA, inhibit viral protein synthesis, impede virion self-assembly, and deter viral gene expression (step 4). Because protective antiviral proteins are present at the time of viral invasion, the well-defended host cell not only survives, but also curtails viral spread as virion replication stops. Additionally, type 1 IFNs enhance the cytotoxicity of NK cells, promoting elimination of virusinfected cells before their release of new virions. Researchers have experimented with administering IFNs to patients to exploit their ability to effectively control viral infections, enhance macrophage killing of phagocytized pathogens, and suppress growth of malignant cells, but with limited success. Because IFNs are unstable, they are only effective in treating short-term viral infections, such as the common cold. They do not remain functional long enough to control chronic infections and are unable to stop viral replication in previously infected cells. Side effects of IFN therapy range from the discomforts of headache, fatigue, nausea, and vomiting to dangerous toxicity of the heart, liver, and kidneys to deadly bone marrow suppression. Clinical trials with IFNs produced using recombinant DNA techniques demonstrate a dramatic decrease in therapy side effects. Patients suffering from hepatitis B, hepatitis C, or genital herpes have benefited from recombinant IFN (rIFN) therapy. Another promising antiviral effect of rIFN is delayed onset of AIDS in HIVpositive patients. Anticancer effects have been noted in patients with hairy cell leukemia, malignant myeloma, and Kaposi’s sarcoma. Unexpected benefits of rIFN therapy include improvements in patients with multiple sclerosis, Crohn’s disease, osteoporosis, and rheumatoid arthritis.

296  CHAPTER 10  Innate Immunity

Miscellaneous Proteins with Antimicrobial Action Several other protein categories play a protective role against host infection. Their diverse mechanisms of action limit bacterial nutrient acquisition, destroy selective membrane permeability, or coordinate dozens of other innate and adaptive immune responses via efficient intercellular communication. Both host and bacterial cells require the micronutrient iron. This important cation serves many functions, including roles as a cofactor and component of the electron transport system. Several types of iron-binding host proteins (Table 10.8) sequester the nutrient, limiting its availability to invading bacteria and hampering their growth. Pathogen-secreted siderophore proteins have a higher affinity for iron than most host proteins. The result is a competition between the two proteins to acquire iron. If the siderophore successfully scavenges iron from host proteins, it binds to a receptor on the bacterial surface to deliver its essential cargo. Numerous small antimicrobial peptides (16 to 45 amino acids long) are secreted by epithelial cells, neutrophils, NK cells, and some T cells. They bind to the membranes of fungi, bacteria, and some enveloped viruses to function as pore formers. With the control of membrane permeability impaired, ion diffusion results in osmotic cell lysis. Defensins and protegrins are two common examples of such antimicrobial proteins.

Host iron-binding proteins for reduced pathogen growth  Table 10.8 Host iron-binding protein

Location

Ferritin

Most host cells

Hemoglobin

Red blood cells

Lactoferrin

Milk, saliva

Transferrin

Blood, interstitial fluid

When IFNs secreted by a virus-infected cell bind to receptors on uninfected neighboring cells, a signal is sent to alter gene expression and fortify the cells against impending viral attack.

IFN 1 Viral infection induces the host cell to express IFNs.

2 Secreted IFNs bind receptors on uninfected neighboring cells. 3 Receptor binding signals expression of protective antiviral proteins. Antiviral proteins

4 New virions released from the originally infected cell invade neighboring cells.

5 Antiviral proteins use multiple mechanisms to protect the host from viral infection.

Blocks viral protein synthesis Degrades viral mRNA

Inhibits virion assembly

Th in k Cr it ica lly

How would the course of a viral infection be affected if host cells lacked IFN receptors?

Protein-Mediated Defense Mechanisms  297

Process Diagram

✓ The Planner

The antiviral state • Figure 10.7

A representative sample of key cytokines and their principal effects  Table 10.9 Cytokine

Principal effect(s)

Bradykinin

Vasoactive molecule; increases vascular permeability

Granulocyte-colony stimulating factor (G-CSF)

Maturation of granulocytes

Histamine

Vasoactive molecule; increases vascular permeability

Interleukin-1

Leukocyte activation; fever induction

Interleukin-2

Proliferation and activation of B cells, T cells, and NK cells

Interleukin-3

Triggers maturation of all hematopoietic lineages

Interleukin-4

T-cell and mast-cell proliferation; B-cell IgE secretion; regulates macrophage activity

Interleukin-5

Eosinophil activation; B-cell proliferation and IgA secretion

Interleukin-6

Plasma cell proliferation; synthesis of acute phase proteins

Interleukin-10

B-cell stimulation; macrophage inhibition

Interleukin-12

T-cell differentiation; enhanced NK cell cytotoxicity

Interferons (IFN)

Induce antiviral state; tumor suppression; macrophage activation

Leukotrienes

Stimulate smooth muscle contraction; increase vascular permeability

Lymphotoxins

Neutrophil activation; fever induction; synthesis of acute phase proteins; enhanced inflammation

Monocyte-colony stimulating factor (M-CSF)

Maturation of monocytes

Osteoprotegerin

Inhibits osteoclast differentiation

Platelet activating factor (PAF)

Promotes platelet aggregation and degranulation; enhances inflammation

Prostaglandins

Stimulate inflammation

Serotonin

Neurotransmitter; stimulates smooth muscle contraction

Transforming growth factors (TGF)

Inhibition of B cells, T cells, and macrophages

Tumor necrosis factors (TNF)

Neutrophil activation; fever induction; synthesis of acute phase proteins; enhanced inflammation

Finally, hundreds of secreted cytokines (Table 10.9) released by a variety of cell types coordinate both innate and adaptive immune processes. They may act locally or systemically, triggering short-term or sustained responses. As an abbreviated listing of the most important cytokines, Table 10.9 is designed to be a study reference as you learn about the more cytokine-mediated responses of the immune system in Chapters 11 and 12. The immediate, nonspecific, and consistent actions of innate immune responses provides tremendous host protection against infection. Most potential pathogens are deterred by the chemical and physical barriers of the first-line defenses. If necessary, second-line defenses such as phagocytosis, inflammation, and the activity of antimicrobial proteins effectively eliminate invaders. Pathogens surviving these defenses will be attacked by the

298  CHAPTER 10  Innate Immunity

highly specific adaptive immune mechanisms described in the next chapter.

1. How do the activation mechanisms for the alternative and lectin complement pathways define them as innate immune responses? 2. How does type 1 IFN induction of the antiviral state specifically protect a host cell from viral infection? 3. What bacterial adaptation evolved to limit the effectiveness of host iron-binding proteins in inhibiting their growth?

✓

Summary

10.1

10.2

An Introduction to Immunity 276

• The immune system provides highly effective protection from disease that can be acquired in four different ways: natural passive immunity is passed from mother to infant; natural active immunity develops after surviving an initial infection; artificial passive immunity arises from anti serum injections; and artificial active immunity results from vaccination. • The two major kinds of immunity are innate immunity and adaptive immunity. The first-line defenses of the innate system serve as rapid and general protection against many pathogens. Second-line defenses include the elimination of pathogens via phagocytes and inflammation directed by cytokine release. Although very effective, the innate system has no memory capacity and reacts with a consistent intensity for each response. In contrast, the third-line defenses of the adaptive immune system are slower to mount an initial response, but once adaptive immune cells are activated, their response is highly specific and incredibly powerful. The adaptive system produces a memory response on subsequent exposures. • Organs and tissues of the immune system are categorized as primary and secondary lymphoid structures. The thymus, a critical primary lymphoid organ, is located in the thoracic cavity and is responsible for the maturation of T cells. The bone marrow serves the corresponding function for B cells, which secrete defensive proteins known as antibodies. The spleen, lymph nodes, and mucosa-associated lymphoid tissue (MALT) are the major secondary lymphoid tissues. The white pulp of the spleen is a site of immune interactions. The small, bean-shaped lymph nodes dispersed along lymphatic vessels (see the diagram) are sites of interactions between antigens and immune cells, such as macrophages and dendritic cells, allowing rapid responses. Finally, the MALT is ideally positioned to contact pathogens in the respiratory and gastrointestinal systems and launch an immune response.

The anatomy of the immune system: The lymphatic system  •  Figure 10.1

Lymphatic capillary

Blood capillary

First-Line Defense Mechanisms 282

• Barriers are the first line of defense for innate immune responses. They are nonspecific ways of blocking or trapping antigens attempting to enter the host. When intact, skin barriers (such as epidermis, dermis, and basement membranes) block antigens from deeper tissues, and mucous membranes (found in the nasopharynx and gastrointestinal tracts) block attachment of antigens to internal surfaces. The blood–brain barrier serves to limit access of circulating antigens to the central nervous system. Numerous washing actions (such as tearing and urination) sweep antigens away from host tissues. Finally, if an infection results, fever slows bacterial growth (see the photo), allowing time for an adaptive response to eliminate pathogens.

What a Microbiologist Sees: The Benefits of Fever

98.6° F

104.5° F

courtesy Ken Colwell

The Planner

• The host also produces chemical first-line defenses. Some chemicals generate inhospitable conditions for pathogens, such as skin oils lowering the pH and sweat causing desiccation. Secretions such as gastric fluids, mucus, and saliva have growth-inhibiting pH levels and high salt concentrations, and they also contain proteases for the enzymatic degradation of antigens. Competition for resources by normal microbiota as well as their secretions represent biological defenses and also inhibit pathogen growth.

10.3

Innate Cellular Defense Mechanisms 286

• All circulating blood cells, including those involved in immune responses, are produced in the bone marrow by the process of hematopoiesis. Repeated divisions of stem cells generate precursors to all blood cell types. Those lymphoblasts maturing in the thymus become T cells, whereas those completing maturation in the bone marrow become B cells. Natural killer (NK) cells can mature in the bone marrow, thymus, or lymph nodes.

Summary  299

• Leukocytes consist of five major cell types (labeled a–e in the micrograph), grouped into two categories: granulocytes (neutrophils, eosinophils, and basophils) and agranulocytes (monocytes and lymphocytes). These cells serve important functions such as antigen recognition and initiation of pathogen-eliminating effector mechanisms including phagocytosis and inflammation. Pathogens are also eliminated by apoptosis when pattern recognition receptors (PRRs), such as Toll-like receptors (TLRs), bind to pathogen-associated molecular patterns (PAMPs) found on microbial surfaces.

The Microbiologist’s Toolbox: The Differential Count

10.4

Protein-Mediated Defense Mechanisms 294

• The complement system is a series of biochemical cascades that work through the stepwise accumulation of numerous proteins. The alternative pathway is one of three complement pathways, each associated with a different starting point. Despite initial variations, each pathway produces the key enzyme complexes, C3 convertase and C5 convertase. Ultimately, the three pathways converge as C5 convertase directs the formation of the MAC (see the diagram), which is inserted into the pathogen, leading to its lysis.

The alternative complement pathway  •  Figure 10.6 a.

b.

C6

C7

C8

Steve Gschmeissner/SPL/Getty Images

C9

c.

d.

e.

• A major action of innate immune cells is the opsonization, or enhanced phagocytosis, of antigens. Intracellular killing molecules and mechanisms cooperate to destroy antigens engulfed within a phagosome. The major mechanisms for intracellular killing are: 1) acidic inactivation, which helps incapacitate pathogens; 2) enzymatic degradation, to break down pathogen cell walls; 3) pore formation, to lyse pathogen cells; 4) respiratory burst, to oxidize proteins and lipids; and 5) reactive nitrogen species oxidation, which produces chemical species involved in further antigen breakdown. • Inflammation involves the activation and mobilization of immune cells to an area of injury or infection and causes redness, heat, swelling, and pain. Although it causes discomfort, edema from vasodilation promotes diapedesis of neutrophils to enhance pathogen phagocytosis in the infected tissues. Plasma exudate, containing many immune molecules, initiates other effector mechanisms and reduces pathogen spread as fibrin forms a meshlike trap within the affected tissue. Macrophage activity removes pus and promotes healing as inflammation resolves.

300  CHAPTER 10  Innate Immunity

C6

C6 C5b

C6

C5b C7

C8

C5b C7

C8

C7

C8

C9

Membrane attack complex (MAC)

• Interferons (IFNs) are secreted by a virus-infected cell and cause changes in uninfected neighboring cells, stimulating them to enter an antiviral state. These uninfected cells can now degrade viral RNA, inhibit viral protein synthesis, hinder virion self-assembly, and suppress viral gene expression. Interferons also suppress cancer cells, promote inflammation, and enhance NK cell toxicity. • The immune system produces many antimicrobial proteins that serve protective functions. To combat bacterial mechanisms that scavenge molecules essential for replication (such as bacterial siderophores for iron), the host system sequesters nutrients in a variety of storage molecules (such as heme and lactoferrin). Small, antimicrobial proteins, such as defensins, open pores in microbial membranes. The production of cytokines (such as interleukins and interferons) by immune cells helps to coordinate responses against the invaders and produce an optimal immune response.

Key Terms • adaptive immunity  278 • agranulocyte 288 • alternative pathway  294 • antibody 281 • antigen 281 • antimicrobial peptide  296 • apoptosis  290 • B cell  278 • basophil  289 • complement system  294 • cytokine  278 • dendritic cell  281 • diapedesis  293 • effector mechanism  290 • eosinophil  289

• granulocyte  288 • hematopoiesis  286 • histamine  289 • immunity  276 • immunology  276 • innate immunity  277 • interferon (IFN)  294 • lectin pathway  294 • leukocyte  278 • lymphocyte  278 • macrophage  281 • mast cell  289 • monocyte  290 • natural killer (NK) cell  287 • neutrophil  288

• normal microbiota  285 • opsonization  290 • pathogen-associated molecular pattern (PAMP)  290 • pattern recognition receptor (PRR) 290 • phagocyte  278 • phagocytosis  290 • phagosome  290 • plasma cell  281 • siderophore  296 • stem cell  286 • T cell  278 • toll-like receptor (TLR)  290

Medical Terms • edema 

293

• inflammation 

290

Critical and Creative Thinking Questions 1. List the two major kinds of immune responses, and briefly compare and contrast them in terms of their speed and specificity of response.

4. Identify the cell in this diagram and explain how it would be more useful than a phagocytic cell in combating a helminth infection.

3. Chronic granulomatosis disease (CGD) is caused by a mutation that affects the respiratory burst pathway. What process would this mutation disrupt? What would be the outcome of CGD on the immune response?

Biophoto Associates/ Science Source Images

2. Imagine this: A patient is brought to the emergency department following a motor vehicle accident. The abdominal trauma from the accident caused the spleen to rupture so that it had to be removed in a splenectomy. Explain what impact this might have on future immune responses for this patient.

5. Review the Process Diagram, Figure 10.5. Explain how the innate immune system recognizes bacterial antigens.

What is happening in this picture?

T h i n k C ri ti c al l y 1. What is the striking abnormality in this blood smear stained for a differential count? 2. How will this impact the patient’s ability to fight infection? 3. Hypothesize a cause for this condition.

Ray Simons/Science Source Images

Performing a differential count on a Wright-stained blood smear provides key insights regarding patient health.

Self-Test (Check your answers in Appendix A.)

1.  People who have had chickenpox will NOT likely get it again because the immune system helps remember the virus and generate resistance. This type of immunity would best be categorized as ______.

a. passive natural immunity



b. active natural immunity



c. passive artificially acquired immunity



d. active artificially acquired immunity



e. autoimmunity

7.  First-line physical defenses include all of the following except ______.

a. fever



b. skin



c. urination



d. lysozyme



e. phagocytosis

8.  The process in which many different lineages of immune cells develop from a single progenitor cell type is known as ______.

2.  Antigens are best defined as ______.



a. creationism



a. substances that generate an immune response



b. predetermination



b. proteins the immune system produces



c. hematopoiesis



c. a cell type included in the innate immune system



d. stem cell differentiation



d. proteins on the surface of a bacterium



e. clonal expansion



e. Y-shaped proteins that bind and neutralize foreign molecules

3.  The cells of the immune system ______.

9.  The cell types shown in the diagram that mark the stages in the development of monocytes are the hematopoietic stem cell, the myeloid progenitor, and the ______.



a. are transported along fibers of the RES and within the vessels of the circulatory and lymphatic systems



a. reticulocyte



b. only attack lymphatic pathogens



b. monoblast



c. remain stationary after exiting the circulation



c. myeloblast



d. are all phagocytic



d. megakaryoblast



e. are compartmentalized into three distinctive body systems to prevent their interaction



e. mast cell

Myeloid progenitor

Monoblast

4.  Review the Microbiology InSight, Figure 10.1, and answer this question. The RES ______.

a. includes oxygen-carrying erythrocytes



b. includes different types of phagocytes



c. functions only in the digestive system



d. Both a and b are correct.



e. Both b and c are correct.

5.  The immune structure shown in the diagram is a _____ .

a. lymphatic vessel



b. lymphocyte



c. lymph node



d. leukocyte



e. bursa of Fabricius

Monocyte

10.  Review What a Microbiologist Sees, Figure b, and answer this question. A pediatric patient is brought to the emergency department with a high fever of 102.5°F, which was not reduced after giving acetaminophen. What is an appropriate statement to the parents?

6.  Which of the following is NOT considered a secondary lymphoid organ?



a. “I want to reassure you that fever can be a beneficial response.”



a. bone marrow



b. “Fever indicates the immune system is responding.”



b. the spleen



c. “Fever limits the growth of pathogens.”



c. lymph nodes





d. mucosa-associated lymphoid tissue (MALT)

d. “We will monitor for any further fever increase, as this could become detrimental.”



e. Peyer’s patches



e. All of these statements are appropriate for this situation.

11.  Review The Microbiologist’s Toolbox, and answer this question. In the micrograph of the Wright-stained blood smear for cell differential (Figure b), the best identification of the cell marked d is as a ______.

a. eosinophil



b. monocyte



c. lymphocyte



d. basophil



e. neutrophil



b. neutrophil



c. basophil



d. monocyte



e. lymphocyte

Biophoto Associates/ Science Source Images

a. eosinophil



a. increasing vasodilation



b. stimulating immune cell production



c. increasing phagocytosis processes



d. serving as host iron-binding proteins



e. inhibiting immune cell functions

17.  In the next-to-last step of the alternative pathway shown in the diagram, the major event is ______.

12.  The cell in this micrograph is a(n) ______.

16.  Which of the following is NOT a function of cytokine molecules?



a. production of C3 convertase



b. formation of the membrane attack complex



c. C5 cleavage



d. binding of factor B to C3



e. C3 cleavage C5a



a. granzyme



b. perforin



c. histamine



d. opsonin



e. hydrogen peroxide

Properdin

13.  Imagine this: A patient comes to his primary care physician with seasonal pollen allergies. His symptoms can be classified as a hypersensitivity immune reaction, often mediated by mast cells, basophils, or other granulocytes releasing the highly inflammatory molecule ______.

C5b C3b

Bb

C3b

14.  Review the Process Diagram, Figure 10.5, and answer this question. Indicate the correct order of events during an inflammatory response.

18.  Which of the following is/are outcome(s) of activation of the complement pathway?



1. Neutrophils undergo diapedesis.



2. Damaged tissues are repaired.



3. Histamine secretion triggers vasodilation, heat, and redness.



4. Enhanced phagocytosis eliminates pathogens.



5. Increased capillary permeability leads to edema.



6. Inflammatory mediators are released by invading bacteria.



a. 3-6-2-5-4-1



b. 3-6-5-4-1-2



c. 6-3-1-5-4-2



d. 6-5-4-1-2-3



e. 5-6-4-2-3-1

15.  A(n) _____________ represents a medical benefit of chronic inflammation.

a. intrauterine device



b. CLO test



c. siderophore



d. Both b and c are correct.



e. Answers a, b, and c are correct.



a. activation of immune mechanisms



b. increasing inflammation



c. destruction of pathogens



d. Both a and c are correct.



e. All of these are correct.

19.  Which cytokine helps induce host cells into an antiviral state?

a. ficolins



b. siderophores



c. leukotrienes



d. tumor necrosis factors



e. interferons

20.  Which antimicrobial protein is correctly matched with its function?

a. TNF inhibits inflammation.



b. Defensin limits pathogen access to iron and other nutrients.



c. Siderophores act as pore formers.



d. Histamine promotes vascular permeability.



e. All of the antimicrobial proteins are correctly matched with their functions.

Self-Test  303

11 Adaptive Immunity

NatUlrich/Shutterstock

PREPARATION AND ADAPTIVE IMMUNITY

I

n many situations, the key to success is preparation. This is the basis of the adaptive immunity that allows a mother to care for her rubella-infected child without fear of being reinfected herself. Adaptive immune responses rely on the generation of a pathogen-specific lymphocyte army (see the photo) following the host’s initial exposure to the microorganism. When the same pathogen subsequently enters the host, it is eliminated by these superior lymphocyte forces and host health is maintained with no sign

CHAPTER OUTLINE of infection. This quick pathogen destruction is known as immunity. This chapter will emphasize how B and T lymphocytes encounter pathogenic antigens, generate target-specific armies, and deploy appropriate attack mechanisms to win the war against infection. Characterized by memory and specificity, the third-line defenses of your immune system are truly formidable.

11.1 Introduction to Adaptive Immunity  306 • Hallmarks of Adaptive Immunity • Antigens and Immunogenicity ■ Clinical Application: Conjugate Vaccines • Lymphocyte Maturation and Clonal Selection • The Major Histocompatibility Complex ■ What a Microbiologist Sees: Transplant Rejection 11.2 • • •

Cell-mediated Responses  313 T-cell Categories Antigen Processing and Presentation The T-cell Receptor Complex and Associative Recognition

11.3 T-cell Activation  317 • Early Stages of  T-cell Activation • Completion of  T-cell Activation ■ Case Study: The Mantoux Test 11.4 Antibody-mediated Responses  320 • Basic Antibody Structure ■ The Microbiologist’s Toolbox: The Coagulase Agglutination Assay • Immunoglobulin Classes and Their Specific Functions 11.5 • • •

B-cell Activation  323 B-cell Receptors and Pathogen Binding Antibody Production and Clonal Expansion B-cell Effector Mechanisms

Chapter Planner

Science Source Images

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 306 ❑ p. 313 ❑ p. 317 ❑ p. 320 ❑ p. 323 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

Analyze key features

❑ ❑ ❑ ❑ ❑ ❑ ❑

Clinical Application, p. 308 Process Diagram p. 309 ❑ p. 310 ❑ p. 314 ❑ What a Microbiologist Sees, p. 312 Case Study, p. 318 The Microbiologist’s Toolbox, p. 321 Microbiology InSight, p. 326 Stop: Answer the Concept Checks before you go on. p. 312 ❑ p. 317 ❑ p. 319 ❑ p. 323 ❑ p. 328 ❑

End of chapter

Lymphocyte armies, such as these T cells, overwhelm invading pathogens and establish host immunity.

❑ ❑ ❑ ❑

Review the Summary and Key Terms. Answer the Critical and Creative Thinking Questions. Answer What is happening in this picture? Complete the Self-Test and check your answers.

  305

11.1

Introduction to Adaptive Immunity

LEARNING OBJECTIVES 1. Describe the hallmarks of adaptive immunity. 2. Explain the factors that contribute to immunogenicity. 3. Connect the production of lymphocyte antigen receptors with pathogen elimination via clonal selection. 4. Compare and contrast the major histocompatibility class molecules. hen pathogens overcome innate defenses, a host can still fight infection with adaptive immunity, the third line of defense. Directed by white blood cells called lymphocytes, adaptive adaptive responses usually result immunity Highly in  lifelong protection against the specific, lymphocytepathogen. mediated defenses Adaptive immunity consists that demonstrate, of cell-mediated responses, in with subsequent which T cells eliminate a patho- pathogen expogen threat directly, and antibody- sure, an enhanced response that results mediated responses, in which antibodies secreted by mature B in lifelong immunity. cells eliminate a pathogen threat cell-mediated indirectly. Antibodies are Y-shaped response An adapproteins secreted by mature B cells tive immune response that specifically bind and neutral- directed by T cells. ize antigens, such as those found on pathogens. Because antibodies antibodycirculate in the blood and lymph, mediated which are referred to as humors, response An adapthese defenses are also called hu- tive immune response directed by antibodies. moral responses.

W

Features and benefits of adaptive immunity 

Hallmarks of Adaptive Immunity Adaptive responses demonstrate specificity The their specificity by targeting unique ability of an adaptive microbial antigens for precise immune response pathogen assault. Consequently, an to recognize and attack that is effective against one react only to a given microbial species has no effect on pathogen. a species with different surface antigens. The memory component of memory The abilan adaptive response ensures that a ity of an adaptive more vigorous offensive is launched immune response to react more vigorwith each subsequent pathogen ously every time a exposure. Increased response efparticular pathogen is fectiveness is due to an enhanced encountered. number of participating lymphocytes plus improved attack strategies. Table 11.1 summarizes the features and benefits of adaptive immune responses.

Antigens and Immunogenicity All adaptive responses begin with the binding of a foreign antigen to a proteinaceous receptor on the surface of a T or B cell. The specific portion of a macromolecular antigen that binds and triggers an adaptive immune response is an epitope. The epitope associates with a receptor in a lock-and-key epitope The portion fashion. Because the same epitope of a macromolecule can exist on many different anti- recognized by a gens and because many different lymphocyte recepreceptors are present, this mecha- tor and used to nism allows adaptive responses to initiate an adaptive immune response; hundreds of millions of different also referred to as a molecular configurations, emphadeterminant. sizing the extraordinary specificity of third-line defenses.

Table 11.1

Feature

Benefits

Specificity

The adaptive immune response targets unique molecular configurations to customize effective killing mechanisms.

Memory

The adaptive immune response is enhanced with each reexposure to an antigen as the number of lymphocytes increases and their attraction to the antigen grows stronger.

Genetic diversity

A vast lymphocyte repertoire distinguishes between 109 and 1011 different molecular configurations.

Effector specialization

Maximum efficiency is achieved by switching attack mechanisms at various stages of infection.

Self-limitation

Extremely tight system feedback maintains homeostasis, prevents resource waste, and limits collateral host damage from excessively vigorous immune responses.

Self-tolerance

Lymphocyte maturation involves the elimination of autoreactive cells to prevent host damage.

Chemical features influencing immunogenicity • Figure 11.1 Factors that promote antigen binding to an immune cell receptor enhance its immunogenicity, or overall ability to trigger a strong adaptive response. High

Immunogenicity

Low

a. Molecular size Antigens must be large enough for complete receptor binding to activate an adaptive response. Antigen Large antigens have high levels of bond formation with a receptor, resulting in high immunogenicity.

Small antigens form minimal bonds with a receptor, resulting in low immunogenicity.

Bonds Receptor

Receptor

b. Multiple epitopes Antigens that possess several distinctive epitopes are more immunogenic because they can initiate multiple different, yet highly specific, adaptive responses by binding to different lymphocytes. Epitope 2 Epitope 3

Epitope 1

Epitope 4 Antigen

Antigen

Antigens that possess multiple epitopes can bind to different lymphocytes, resulting in high immunogenicity.

Antigens that possess a single epitope have low immunogenicity because they bind only one lymphocyte.

Lymphocytes

c. Molecular complexity Complex molecular structures are more difficult to degrade enzymatically than repetitive polymers that are easily digested into small, nonimmunogenic fragments.

Antigen

Antigen

Complex antigens maintain their shape better, resulting in high immunogenicity.

Enzyme action

Repetitive polymers are easily degraded, resulting in low immunogenicity.

Antigen

Ask Yo u r s e lf Which would be more immunogenic: one large, complex antigen or many small simple ones?

The ability of a given antigen to provoke an adaptive response is its immunogenicity. Any chemical features that promote antigen–receptor binding enhance immunogenicity. One factor that affects immunogenicity is antigen size. Antigens that cause strong immune responses

have a molecular weight of at least 10,000 atomic mass units. This size effect occurs because large molecules can fully associate with receptor binding sites (Figure 11.1a). In contrast, small antigens are less immunogenic, which is why diabetic patients can usually inject porcine insulin Introduction to Adaptive Immunity  307

Clinical Application

✓ The Planner

Conjugate Vaccines Although the polysaccharide capsule of Streptococcus pneumoniae is easily degraded into haptens, it can still be used to produce a highly effective vaccine against this pathogen. Microbial sugar fragments are bound covalently to a larger protein molecule, or carrier, to generate a new complex foreign macromolecule (see the Figure). Injection of this conjugated antigen into a host allows the microbial sugar fragments to act as epitopes for launching an adaptive response specifically against S. pneumoniae. The carrier protein creates a molecule large enough to bind completely with the lymphocyte antigen receptor. Immunizations produced in this way are known as conjugate vaccines and are an example of how microbiologists use their understanding of immunogenicity to prevent infection.

Conjugation of a hapten and a carrier protein produces a highly immunogenic antigen that can be used to prevent infection through vaccination. Individually, the hapten and the carrier protein are unable to bind to the receptor. Hapten Carrier protein Receptor Conjugation of hapten and carrier protein New complex antigen with high immunogenicity

T h in k Cri ti c a l l y

What would happen to vaccine effectiveness if a host enzyme cleaved the injected conjugate antigen into separate hapten and protein molecules? Why?

without causing an adaptive immune response. Although the pig version of insulin is foreign in the human body, the protein is too small to be immunogenic. Molecules that have multiple regions able to bind to lymphocytes with different antigen specificities have increased immunogenicity (Figure 11.1b). As a result, complex molecules are usually more immunogenic than simpler ones. Complex molecules include proteins, glycoproteins, lipoproteins, nucleoproteins, and many of the multipart bacterial carbohydrates such as the lipopolysaccharide. These molecules maintain their distinctive shape well, facilitating immunogenic binding. Highly repetitive macromolecules are less immunogenic because they are easily digested to fragments too small for binding (Figure 11.1c). This is why polymers such as DNA and glycogen (see Remember This! ), although large, do not elicit immune responses. Some molecules produced by enzymatic digestion are haptens that are too small to elicit an immune response. Despite this limitation, small molecules can still be used to make vaccines (see the Clinical Application).

308  CHAPTER 11  Adaptive Immunity

Receptor

Remember This!  Review the Clinical Application in Section 2.3 to see how polymer digestion yields monomers too small to act as effective antigens.

Lymphocyte Maturation and Clonal Selection Adaptive immune responses result when mature lymphocytes are selected for rapid cell division by specifically binding an antigen.

Lymphocyte maturation  The ability of T and B cells to generate adaptive immune responses develops as they mature in the primary lymphoid organs. Lymphocyte maturation steps are similar between T and B cells and involve specific checkpoints to guarantee only the production of cells with useful antigen receptors. The nature of these receptors will be discussed in Sections 11.3 and 11.5. Under the influence of specific cytokines, immature T cells in the thymus and immature B cells in the bone marrow divide rapidly (Figure 11.2 step 1). These cells begin expression of different antigen receptors on their

surfaces. Segments of the genes coding for lymphocyte receptors undergo extensive splicing and rearrangement to generate the diversity of receptors needed for the specificity of adaptive responses to so many potential epitopes. It has been estimated that approximately 1018 different receptors can be coded for by this random shuffling of gene segments. At the first checkpoint, cells failing to express a functional receptor are eliminated by apoptosis (step 2). At the second checkpoint, the antigen receptors on immature T and B cells are exposed to a myriad of molecular configurations in a type of screening activity known as positive selection to ensure that only useful ones have been generated. Lymphocytes that survive positive selection complete maturation and patrol the body for effective pathogen surveillance (step 4). Some of the receptors generated bind strongly to selfantigens, macromolecules that are normally expressed on the surface of host cells. The release of such autoreactive

lymphocytes from the bone marrow or thymus would severely damage the host by inappropriately launching an attack against healthy host tissues. When an immune system malfunction allows this to happen, these selfdestructive immune responses cause autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, and multiple sclerosis, which will be discussed in Section 12.3. This potential problem is usually averted at the second checkpoint by negative selection (Figure 11.2 step 5), which alters or eliminates autoreactive lymphocytes. By altering gene expression, the autoreactive receptor of an immature B cell can be modified to prevent self-antigen recognition, allowing completion of lymphocyte maturation. However, most autoreactive immature T and B cells are eliminated by apoptosis in a process known as clonal deletion. The successful elimination of autoreactive lymphocytes during maturation is responsible for maintaining immune tolerance of self-antigens.

Checkpoints in T- and B-cell maturation are responsible for generating lymphocytes with pathogen-specific receptors to participate in adaptive immunity while simultaneously maintaining tolerance of self-antigens.

Immature lymphocyte in bone marrow or thymus 1 Cytokines stimulate the proliferation of immature lymphocytes and the expression of different antigen receptors.

Checkpoint #1

2 Lymphocytes expressing receptors continue maturation while apoptosis eliminates lymphocytes failing to express receptors at the first checkpoint. Immature lymphocyte failing to express an antigen receptor

Immature lymphocytes expressing antigen receptors

Apoptosis

Checkpoint #2

Foreign antigen

T h i n k C ri ti c al l y

If proliferating immature lymphocytes were exposed to a drug that inhibits protein synthesis, what would happen at the first checkpoint?

4 Lymphocytes binding useful antigens complete maturation, undergoing positive selection.

3 Maturing lymphocytes are screened against numerous antigens.

Self-antigen

5 Autoreactive lymphocytes undergo clonal deletion via apoptosis.

Apoptosis

Process Diagram

✓ The Planner

Lymphocyte maturation • Figure 11.2

Process Diagram

✓ The Planner

Clonal selection and expansion • Figure 11.3 Pathogen binding to an antigen receptor on a lymphocyte initiates rapid cell division, resulting in the production of a lymphocyte army for pathogen destruction, plus a secondary army of memory cells for future protection.

Attacking pathogens

Variable antigen receptors

1 Pathogen invasion of host leads to clonal selection as a preprogrammed receptor encounters its specific epitope. Lymphocyte clones are generated during the positive selection phase of development, resulting in a repertoire of diverse antigen receptors.

2 The epitope-selected clone undergoes rapid cell division, producing an enormous lymphocyte army with the same epitope specificity.

3a Some cells differentiate

into a formidable force of pathogen-specific effector lymphocytes.

3b The remaining cells act as

memory cells, disseminating throughout the body and poised to instantly bind and respond to a repeat pathogen invasion.

Effector cells

Memory cells

4 Cytokine secretion leads to activation of pathogen-eliminating mechanisms directed by lymphocytes. • Antibody production • Eosinophil activation • Increased inflammation • Lysis of virus-infected cells • Destruction of malignant cells • Transplant rejection • Phagocyte activation

A s k Yo u r s e lf Receptors on lymphocytes bind with _____ on the antigen, which stimulates the lymphocytes to undergo mitosis, producing _____ and _____ .

310  CHAPTER 11  Adaptive Immunity

Clonal selection Clonal selection occurs when a mature lymphocyte encounters an epitope that binds specifically to its genetically preprogrammed antigen receptor. The selected lymphocyte rapidly clonal selection undergoes mitosis, generating The binding of epian army of genetically identical topes to a genetically lymphocytes, or clones (Figure preprogrammed 11.3, steps 1 and 2). This process lymphocyte receptor, is known as clonal expansion. triggering the prolifWhen clonal expansion occurs in eration of identical a lymph node, the organ becomes pathogen-fighting enlarged and tender as it fills with and memory cells. a clone army. Some of the clones memory cell A lymdifferentiate, forming pathogenphocyte generated specific T and B lymphocytes that during clonal expancan quickly eliminate the infecsion that persists in a tion (step 3a). The cells that do quiescent condition not become effector lymphocytes until encountering the form a slightly smaller army of dispathogen, when it iniseminated memory cells that are tiates a rapid attack. prepared to respond rapidly upon subsequent pathogen invasion. Production of this specialized lymphocyte army begins with clonal selection and accounts for both the specificity and memory of the adaptive responses discussed in the rest of this chapter.

The Major Histocompatibility Complex In addition to T and B lymphocyte receptors, molecules that play a key role in adaptive immune responses are

those encoded by the major histocompatibility complex (MHC). The MHC is a collection of

major histocompatibility complex (MHC) A set

genes with many allelic variations of genes that code that are codominantly expressed. for surface proteins The result is the production of serving as individual MHC proteins that vary greatly beidentification marktween individuals. It is estimated ers and that particithat more than 1013 possible MHC pate in the binding proteins can be generated. necessary for T-cell There are three classes of activation. MHC molecules that participate in various immune actions (Table 11.2). Class I and class II MHC molecules serve two key functions. First, they act as self-identification markers. Because these molecules are highly immunogenic, they are responsible for T-cell–mediated rejection of transplanted tissues if the self-markers are not identical on the donor and recipient cells (see What a Microbiologist Sees). Class I and class II MHC molecules also play a crucial role in T-cell activation by interacting with T-cell receptors (TCRs) in a highly specialized manner. This process requires the binding of an antigen fragment to the cleft at the top of the class I and II MHC molecules. Known as a neoantigen, this complex of MHC molecule and antigen fragment fits precisely into the correct TCR because they are uniquely designed to recognize selfmarkers. The detailed process of generating a neoantigen and activating a T cell will be described in Sections 11.2 and 11.3.

Characterization of major histocompatibility complex molecules  Table 11.2 MHC class

Location

Functions

Structure

I

Surface of all nucleated cells

Binds fragments of intracellular antigens for display to T cells, resulting in activation Serves as a self-identification marker

II

Surface of phagocytic cells

Binds fragments of phagocytized antigens for display to T cells, resulting in activation Serves as a self-identification marker

III

In plasma and lymph

Comprises components of complement system (C2, C4a, C4b, Bb) Promotes inflammation (TNF)

C4b

Introduction to Adaptive Immunity  311

What a Microbiologist Sees ✓

The Planner

Transplant Rejection

a. The swollen, hemorrhagic appearance of this kidney is typical of the T-cell damage associated with transplant rejection.

b. Transplant patients possessing a high proportion of T cells that interact with class I MHC molecules and that express high levels of the surface protein CD45RC are at highest risk of rejection.

T h in k Cri ti c a l l y

Predict the result of administering an increasing dose of a new drug that functions as a competitive inhibitor of CD45RC to transplant recipients.

1. What are the two most important features of an adaptive immune response? 2. Why is lipopolysaccharide from the outer membrane of a gram-negative bacterium a highly immunogenic antigen?

312  CHAPTER 11  Adaptive Immunity

Kidney rejection rate

The CD45RC protein is an enzyme that can participate in the early stages of T-cell activation. It is hypothesized that T cells expressing high levels of the enzyme are rapidly activated by foreign class I MHC molecules and vigorously attack the donor tissue. Hosts whose T cells express low levels of the enzyme demonstrate lower rejection rates because their T cells activate more slowly and/or less fully. These data highlight the necessity of accurately matching class I MHC molecules between donor and host tissues as well as monitoring host T-cell levels of CD45RC to prevent normal protective immune responses from destroying potentially life-saving transplants.

From the University of Alabama at Birmingham Department of Pathology PEIR Digital Library © (http://peir.net).

When viewing this necrotic kidney removed because of acute rejection, most people would consider the transplant operation a total failure (Figure a). But what a microbiologist sees is a highly successful adaptive immune response. Transplanted tissues bear MHC molecules, or identity markers. If these molecules differ from those of the tissue recipient, then host T cells recognize the transplanted MHCs as foreign and attack them. Recent studies indicate that adaptive responses leading to rejection are most likely to occur against mismatched class I MHC molecules. Also, when host T cells express a high level of the surface protein CD45RC, the rejection rate is significantly elevated (31.4%) relative to patients whose T cells express low levels of the protein (5.6%) (Figure b).

Most reliable host predictor of kidney transplant rejection 40% 30% 20% 10% 0%

High expression

Low expression

Relative level of CD45RC expression on class I MHC binding T cells (Data from: Ordonez, L., Bernard, I., Chabod, M., Augusto, J. F., Lauwers-Cances, V., Cristini, C., Cuturi, M. C., Subra, J. F., Saoudi, A. A higher risk of acute rejection of human kidney allografts can be predicted from the level of CD45RC expressed by the recipients’ CD8 T cells. 2013 Jul 24;8(7):e69791. doi: 10.1371/journal. pone.0069791. Print 2013. Retrieved August 22, 2015, from http://www.ncbi.nlm. nih.gov/pubmed/23894540)

3. How does an invading pathogen trigger the adaptive response that leads to its elimination? 4. How do class I and class II MHC molecules facilitate the initiation of an adaptive immune response?

11.2

Cell-mediated Responses

LEARNING OBJECTIVES 1. Characterize the effector mechanisms used by T cells. 2. Compare antigen processing in cytosol and phagosomes. 3. Describe the role of a TCR and coreceptor in the antigen recognition that leads to intracellular signaling.

C

ell-mediated responses are carried out by T  cells. During lymphocyte maturation, T  cells differentiate into subsets to offer broader protection to the host.

T-cell Categories T-cell categories can be distinguished by the surface proteins that act as coreceptors, assisting TCRs with antigen binding and T-cell activation (Table 11.3). The type of interleukin (IL), or leukocyte-secreted cytokine, produced by a T cell can also be used to identify its category. T-cell–secreted ILs mediate immune responses, stimulate the proliferation and differentiation of B and T cells, and activate B cells, macrophages, and other leukocytes. Helper T (TH) cells comprise approximately 65% of the T-cell population. Because all TH cells possess CD4, a surface glycoprotein that acts as an adhesion and signaling coreceptor, they are also known as CD4+ cells. Along

A comparison of the major T-cell subsets  Table 11.3 T-cell subset

Coreceptor

Cytokines secreted

Function(s)

Helper T 1 (TH1) cell

CD4

Interferon-γ

Activates macrophages Stimulates IgG production

Helper T 2 (TH2) cell

Interleukin-4

Causes mast cell degranulation

Interleukin-5

Activates eosinophils and macrophages

Interleukin-13

Effects on host defenses Eliminates intracellular pathogens

Role in pathology Chronic infection tissue damage Autoimmune diseases

Fights helminthic infections

Allergies

Attacks extracellular bacteria and fungi

Inflammatory autoimmune diseases

Modulates immune responses to prevent host damage

Inflammatory bowel disease

Induces apoptosis in foreign cells

Reduced activity with chronic antigen exposure

Stimulates IgE production Increases mucus production (enhances barrier functions) Helper T 17 (TH17) cell

Interleukin-17

Promotes inflammation

Interleukin-22

Enhances neutrophil and monocyte activity Enhances production of antimicrobial peptides

Regulatory T (TR) cell

CD4

Tumor growth factor-β Interleukin-10

Inhibits autoimmunity Limits destruction of normal microbiota Regulates inflammation levels Recruits neutrophils

Cytotoxic T (TC) cell

CD8

Interferon-γ

Activates macrophages Eliminates virus-infected cells, cancer cells, and foreign cells

Cell-mediated Responses   313

Process Diagram

✓ The Planner

Antigen-processing pathways • Figure 11.4 Antigen-processing pathways correlate with the location of the foreign protein.

Invading HIV virus

Plasma membrane of virus-infected host cell

CD4

T cell

CD8 coreceptor TCR

Coreceptor 1 A virus infects the host cell.

a. Processing of cytosolic proteins Foreign proteins from viruses, intracellular bacteria, or malignancy are degraded by a proteasome for association with class I MHC molecules.

Viral RNA

Class I MHC molecule vProtein

2 The viral genome synthesizes viral proteins that serve as cytoplasmic antigens.

3 Proteolytic cleavage of viral antigens produces peptide fragments. 5 The neoantigen is displayed on the host plasma membrane, allowing binding to the TCR and CD8 coreceptor of a T cell.

Proteosome

Viral peptide fragments

Class I MHC molecule

4 The processed antigen binds the cleft of a class I MHC molecule, forming a neoantigen.

with the TCR, CD4 binds to class II MHC molecules coupled with antigen fragments displayed on the surface of pathogen-engulfing phagocytes. This joint binding event amplifies the intracellular message sent to the cytoplasm, triggering secretion of appropriate cytokines. Regulatory T (TR) cells, formerly known as suppressor T cells, also possess CD4 coreceptors. This T-cell subset functions as a safety net for the host to prevent excessive immune responses that could damage host tissues and organs. TR cells are responsible for shutting down attack mechanisms following pathogen elimination and for preventing autoimmune attacks. The only prominent T-cell subset lacking the CD4 coreceptor is the cytotoxic T (TC) cell. Because they possess the CD8 glycoprotein instead, they are also known as CD8+ cells. CD8 functions as a coreceptor as it and the TCR bind to class I MHC molecules coupled with antigen fragments.

314  CHAPTER 11  Adaptive Immunity

Endoplasmic reticulum Neoantigen

This permits TC cells to bind to most host cells, including those that are virus-infected, malignant, or foreign. The association between TC cells and host cells mediates the release of perforin and granzyme, triggering apoptosis of the impaired or inappropriate cell in much the same way as a natural killer (NK) cell functions. The final T-cell subset, natural killer T (NKT) cells, is extremely small. These cells received their name because they share several common surface glycoproteins with NK cells. They have very limited epitope diversity but can specifically target lipid antigens. For this reason, they can mediate immune responses against pathogens, such as Mycobacterium tuberculosis, that possess a lipid-rich mycolic acid wall. Additionally, NKT cells appear to coordinate adaptive responses via cytokine secretion. This T-cell subset is currently the subject of intense investigation to elucidate their other immune functions.

T cell Exogenous antigen (pathogen, vaccine, or debris)

1 A phagosome engulfs an extracellular antigen.

CD4 coreceptor

TCR

Lysosome 2a Fusion of a lysosome with the phagosome

provides enzymes for antigen degradation in the phagolysosome. Phagolysosome

Antigen

2b A transport vesicle

b. Processing of phagocytized proteins When extracellular pathogens are engulfed by phagocytes, protein degradation occurs in a phagosome and the resulting antigen fragments bind with class II MHC molecules.

buds from the ER carrying a class II MHC molecule.

4 The neoantigen is displayed on the APC plasma membrane, allowing binding to the TCR and CD4 coreceptor of a T cell.

Neoantigen

3 When the vesicle containing a class II MHC molecule fuses with the phagolysosome, a processed antigen binds the cleft, forming a neoantigen.

Endoplasmic reticulum Class II MHC molecules

A sk Yo u r se lf A neoantigen is formed from a _____ bound to a _____ .

Antigen Processing and Presentation Adaptive responses are generated against a pathogenic epitope rather than the entire microorganism. For a T cell to be activated for pathogen assault, it must be exposed only to the appropriate molecular configuration, usually a protein fragment, not the whole microbe. This is accomplished by antigen processing, the enzymatic degradation of a foreign macromolecule, such as a protein, into a small fragment that activates an immune response. There are two different antigen-processing pathways, depending on whether the foreign protein is free in the host cell cytoplasm or is enclosed in a phagosome. Antigenic proteins are usually found in the host cell cytoplasm (Figure 11.4a) because of infection with viruses or intracellular bacteria, such as Listeria monocytogenes. Foreign cytosolic proteins may also result from overexpression of genes in malignant cells. Phagocytosis of materials from

the extracellular environment is another way antigenic proteins can be acquired (Figure 11.4b). In that case, the foreign protein is contained in a membrane-bound structure, the phagosome. The processing pathway used to degrade the foreign protein into a T-cell–activating epitope depends on whether the protein is in the cytosol or in a phagosome. Proteasomes are tubelike protein complexes with protease activity. The proteasome recognizes foreign proteins, unfolds them, and threads the protein through the enzymatic tube for cleavage (Figure 11.4a step 3). The resulting peptide fragments, or processed antigens, pass through the endoplasmic reticulum and bind to a cleft in a class I MHC molecule forming a neoantigen, or new combination protein (step 4). The highly immunogenic neoantigen moves to the plasma membrane where it simultaneously binds to a TCR and a CD8 coreceptor, initiating T-cell recognition and activation (step 5). Cell-mediated Responses   315

Host cells also acquire internal foreign proteins as a result of pathogen phagocytosis by antigen-presenting cells (APCs) (Figure 11.4b step 1). The most common types of APCs are B cells, macantigen-presentrophages, and dendritic cells. ing cell (APC) Because of their effective engulfA cell capable of ment of extracellular pathogens engulfing extracellular (see Remember This!), foreign antigens, processing proteins are quickly sequestered them, and presenting within phagosomes that fuse with them for T-cell binda lysosome, initiating enzymatic ing to trigger the inidegradation or processing. Protiation of an adaptive teolytic enzymes, such as cathepresponse. sins, trim these proteins into peptide fragments appropriate for insertion into class II MHC molecules (step 2a). Remember This!  Phagocytosis of pathogens is an integral part of initiating an adaptive immune response. Examine Figure 10.4 to review the essential steps of phagocytosis and extend your understanding of this mechanism to its role in antigen processing.

Class II MHC molecules are synthesized in the endoplasmic reticulum of APCs and travel to a phagolysosome containing processed antigen. The class II MHC molecule binds with the processed antigenic protein forming a neoantigen (Figure 11.4b step 3). When the neoantigen moves to the plasma membrane for display to TH cells (step 4), T-cell activation is initiated.

The T-cell Receptor Complex and Associative Recognition The processed, presented antigen binds to a TCR and initiates an adaptive response (Figure 11.5). The core of TCRs is composed of two glycoprotein chains covalently linked by an extracellular disulfide bridge. Each peptide possesses a constant region and a variable region. As the names imply, the amino acid sequence in the constant region is similar among all TCRs. However, the variable regions differ greatly between TCRs and are responsible for recognizing a diverse set of processed antigens. Each chain also possesses a hydrophobic transmembrane region and a short hydrophilic tail extending into the cytoplasm.

The T-cell receptor • Figure 11.5 T cells have an α/β chain dimer that recognizes and binds processed presented antigens, a coreceptor such as CD4, and CD3 and zeta chains. Associative recognition plus coreceptor binding facilitate signal transduction leading to T-cell activation. CD4 coreceptor

TCR Variable region Class II MHC molecule

Constant region

Variable region β

α

CD3

Constant region CD3

APC ε

Neoantigen

γ

δ

ε

TH cell

Extracellular space

Plasma membrane

ξ

ξ

Cytoplasm Disulfide bridge

Enzyme binding domains for intracellular signaling

As k Your s e l f The ability of the TCR to recognize an enormous number of different antigens depends on _____ . a. CD4 coreceptors c. variable regions in the extracellular space b. variable regions extending into the cytosol d. CD3 constant regions

316  CHAPTER 11  Adaptive Immunity

CD3 is a dimer found on all mature T cells. A pair of CD3s associates on either side of the TCR and is essential for transmitting a message into the cytosol when antigen has bound to the T cell. Antigen binding to the TCR causes a conformational, or shape, change in the receptor, which in turn modifies the associated CD3s. Because the CD3s have slightly longer cytosolic tails than the TCR, they can more effectively send a message into the cytoplasm. The conformational changes expose domains, or regions, used for enzyme binding. Like CD3s, the two zeta (𝛇) chains that associate with the TCR have long cytosolic domains. Consequently, antigen binding of the TCR causes conformational changes in the zeta proteins and exposure of even more enzymebinding sites. All of these binding sites are needed for enzymes that facilitate the early stages of T-cell activation. CD8 associates with the TCR on T cells destined to interact with processed cytosolic antigens presented by class I MHC molecules (Figure 11.4a). This provides an excellent method for activating an adaptive response against intracellular infections. Because most host cells are susceptible to these pathogens and class I MHC molecules are present on the surfaces of all nucleated cells, there is T-cell attack capability for almost every scenario. CD4 associates with the TCR on most other T cells (Figure 11.4b) and allows interaction with engulfed, processed antigens presented by class II MHC molecules found on B cells, dendritic cells, and macrophages. CD8 and CD4 act as coreceptors in the process of antigen binding and recognition. The TCR binds

11.3

specifically to both the processed antigen displayed in the peptide-binding cleft and to portions of the class I MHC molecule holding it, an event known as associative recognition. The TCR is only able to recognize the antigen when it is associated with the appropriate MHC molecule. A secondary binding event during antigen recognition is needed to initiate internal signaling. This occurs when an extracellular CD8 domain binds with the class I MHC molecule. The conformational change resulting from class I MHC attachment triggers modifications of the long cytosolic domains of the CD3 and 𝛇 chains. This part of the TCR now participates in a complex series of reactions to generate an intracellular signal. A similar process occurs when an APC displays antigen-loaded class II MHC molecules for binding to T cells with CD4 coreceptors. Following initial antigen binding, CD4 associates with the class II MHC molecule. The association of so many protein-binding pairs at the attachment site between a T cell and an APC intensifies signaling, which leads to T-cell activation.

1. Which T-cell subsets can activate macrophages? 2. How does processing a foreign cytosolic protein differ from processing a phagocytized foreign protein? 3. What does a CD8 coreceptor bind to?

T-cell Activation

LEARNING OBJECTIVES 1. Describe T-cell changes occurring immediately after associative recognition and coreceptor binding have initiated activation.

2. Outline the process that converts an activated T cell into a transient army of effector cells and a long-lasting army of memory cells.

hallmark feature of T-cell activation is the unique binding of the TCR to a neoantigen. It is the combination of associative recognition plus coreceptor binding that initiates the correct activation signal leading to a cell-mediated adaptive response.

surface protein composition within hours of antigen recognition, reflecting modifications in gene expression. These changes begin by promoting T-cell retention in lymphoid organs to allow the cytokine exposure necessary to continue the activation process. Later, there is enhanced migration of T cells to peripheral sites of injury and infection and T-cell secretion of cytokines to promote the effector functions of APCs. The most impressive change associated with T-cell activation is the transient production of IL-2. As IL-2

A

Early Stages of T-cell Activation The process of T-cell activation has been best elucidated for TH cells. Investigators note substantial alteration in

T-cell Activation  317

is secreted by the T cell, it binds with high binding strength and attraction, or affinity, to IL-2 receptors on the T-cell surface. IL-2/receptor binding inhibits apoptosis, controls the function of regulatory T cells, and, most importantly, drives the cells into the final stages of activation.

Completion of T-cell Activation IL-2 signaling ultimately triggers clonal expansion, a period of explosive T-cell division resulting in the production of a multitude of genetically identical cells. Following clonal expansion, the number of T cells specific for a given epitope climbs from only 1 in 106 to as much as one in every three lymphocytes. Produced in only 1 week, this epitope-specific army is ready for differentiation into effector T cells, leading to rapid pathogen elimination. TH1 and TH2 cells act as effectors by activating macrophages and eosinophils, increasing mucosal secretions, and elevating inflammatory responses. In addition, cells infected with intracellular pathogens are specifically targeted for lysis by TC effector cells. Effector cells are short-lived because their highly specific killing mechanisms readily eliminate infecting microbes. Despite a dramatic decline in the postinfection T-cell population, the host is not vulnerable to reinfection. The T cells not differentiating into effectors following clonal expansion remain as memory cells and comprise an epitope-specific, but slightly smaller, army of 1 in 103 to 104 lymphocytes. When these cells, which are dispersed systemwide, encounter a repeat intruder, the processes of T-cell activation, proliferation, and effector/memory cell differentiation instantly begin (see the Case Study). Consequently, the invaders are eliminated so rapidly that the host never experiences the symptoms of infection. It is the maintenance of host health during subsequent pathogen exposures that is known as immunity and is directly due to the memory and specificity components of adaptive responses. With each successive encounter with a given pathogen, the number of epitope-specific memory cells grows. Their stem cell–like nature results in a slow self-renewal process, which further contributes to the gradual enlargement of the memory cell pool. Sheer numbers are not the only mechanism memory cells use to eliminate invaders. Genome analysis indicates a rearrangement and assemblage of several key genes needed for T-cell activation. This genomic repositioning enhances the rate of transcription, leading to especially fast production of effector T cells after subsequent pathogen exposures.

318  CHAPTER 11  Adaptive Immunity

The Mantoux Test The summer orientation for freshmen nursing students at Ohio Northern University gave Elena a chance to meet her academic advisor, register for fall semester classes, and mingle with her future classmates. At the concluding session, Elena was given a form with instructions to have her family physician verify the results of her Mantoux test and return the document when school started. As Elena was wondering what a Mantoux test was, La’Davia, the student next to her, leaned over and asked exactly that. “I have no idea,” said Elena. “It must be important if they won’t let us start the nursing program without it.” The girls were startled as Dr. Woodfield came up behind them and said, “It is important! I overheard your conversation and I thought you might have some questions. The Mantoux test is used to determine whether you’ve got tuberculosis. If you’re infected, of course, we want to get you treated so you’re healthy… but we also want to be sure you don’t infect any of your future patients. That’s why you need your Mantoux test now.” “Tuberculosis!” the girls responded in unison. “No one gets that anymore,” Elena replied. “Yeah, we’re not even coughing,” said La’Davia. “It sounds like you know a little bit about this deadly disease, but you’re missing some important details,” said Dr. Woodfield. Investigate: 1. What pathogen causes tuberculosis? 2. How is it spread? 3. What are the signs of infection? “Although the incidence of tuberculosis (TB) is lower in the United States than in other parts of the world (Figure a), TB is second only to AIDS as the greatest infectious disease killer globally. Every year 8.5 million people become infected and more than 1 million die of this disease. Did you know TB is the third leading cause of death in women ages 15 to 44?”

Case Study

5. After examining the photo, define the term subcutaneous.

Incidence*

Population (in millions)

China

105

1340

India

157

1210

United States

4

310

Russia

77

140

South Africa

918

51

*Number of new cases per 100,000 population

4. Why do you think South Africa has a much higher tuberculosis incidence than China when China has a much larger population than South Africa? “I guess I see why we need to be tested,” said a surprised Elena. “Is this a blood test?” “No,” Dr. Woodfield responded. “The Mantoux test involves subcutaneously injecting a tiny amount of tuberculin or purified protein derivative (PPD) on the subject’s inner forearm (Figure b). This harmless material is derived from the pathogen that causes TB. If the patient has been exposed to the microbe, then the immune system will launch a vigorous attack. Within a couple of days, a bump called an induration forms at the injection site (Figure c). If this bump filled with immune active cells is more than 5 mm in diameter, then the Mantoux test is positive for TB. Because uninfected patients lack memory TH cells against this pathogen, they will not be able to respond to the injection and no bump forms.”

© PTD/Phototake

b. The Mantoux test is performed by subcutaneously injecting PPD in the patient’s inner forearm.

1. How does IL-2 influence the early stages of T-cell activation?

“What are memory cells and how are they connected to the Mantoux test?” asked a confused La’Davia. “Oh, I think I know this,” said Elena. “We talked about the immune system in my AP Bio class this year. The foreign PPD would be engulfed, partially degraded, and presented on the surface of a phagocyte so it can bind to a memory TH cell. The memory cell secretes chemicals called cytokines that recruit more phagocytes to the antigen injection site where they work to eliminate the foreign material.” 6. REVIEW: Finish answering La’Davia’s question: What is a memory cell? c. An induration filled with immune-active cells develops approximately 48 hours after PPD injection in patients with past exposure to the tuberculosis pathogen.

Mark Thomas/Science SourceImages

a. Incidence of tuberculosis for selected countries*

Country

✓ The Planner

7. How large is the induration in Figure c and what does this indicate about whether this patient has been exposed to the tuberculosis pathogen? “Not bad,” Dr. Woodfield replied. “Immunology is a very complicated subject. You’ll study it during your sophomore physiology class. As you learn more about how your body defends itself against pathogen invasion, you’ll discover other diagnostic tests that are based on immunologic principles.” As the students finished their conversation and said their goodbyes, Dr. Woodfield called after Elena and La’Davia, “Enjoy the rest of your summer ladies, and I’ll see you back here in the fall with your test results….and ladies, this is the only test I want to see you fail!”

2. How do memory T cells prevent illness with subsequent pathogen exposure? T-cell Activation  319

11.4

Antibody-mediated Responses

LEARNING OBJECTIVES 1. Diagram the basic structure of an antibody molecule, labeling any associated region-specific functions.

2. Compare and contrast the structures of the five immunoglobulin classes with their specific functions.

here are three classes of molecules that recognize antigens and participate in immune responses. In the previous sections, we explored the roles of TCRs and MHC molecules in antigen binding. Now we turn our attention to the third class of antigen-binding molecules, antibodies, the first antigen-binding molecules discovered. They demonstrate the greatest ability to distinguish between similar epitopes, the strongest antigen-binding affinity, and the widest range of determinant specificity. Antibodies can be membrane-bound or free-floating in the body fluids. Membrane-bound antibodies serve as antigen receptors on B cells. Free antibodies are prevalent in plasma, colostrum, mucosal secretions, and interstitial fluid and can attach to specific phagocyte receptors. They bind antigen throughout the body and trigger the following antibody-mediated reactions:

Basic Antibody Structure

T

• • • • •

Directly neutralize pathogens and/or their exotoxins Activate the classical complement pathway Promote opsonization Activate mast cells Trigger cell lysis

The study of antibodies and the reactions in which they participate is known as serology because these glycoproteins were first detected in serum. Their basic structure, and consequently their function, was principally elucidated by serum electrophoresis and partial enzymatic degradation experiments. These early investigations associated antibodies with the γ-globulin class of blood proteins. For this reason and because of their involvement in immune responses, antibodies are also referred to as immunoglobulins (Ig). Antibodies are symmetrical, Y-shaped molecules composed of two identical halves (Figure 11.6). Each antibody consists of four polypeptide chains. Two of the chains have identical sequences that are approximately 200 amino acids long; the remaining two glycoprotein chains share a common amino acid sequence that is 400 to 500 residues long. Because of the significant size difference, the shorter chains are known as the light chains (L chains) and the longer chains are the heavy chains (H chains). One L chain and one H chain are held together by a disulfide bridge and numerous hydrophobic interactions. The two H chains are joined together by

Antibody structure • Figure 11.6

Antigen-binding sites

Antibodies are Y-shaped symmetrical molecules with a variable region that binds antigen and a constant region that activates pathogen elimination mechanisms.

Amine termini Variable region

Light chain S

S

S S S

S

Hinge region

A sk Yo u rs e l f Which of the following is true of antibody structure? a. The variable region has two light chains and two heavy chains. b. The light chains are bound together by disulfide bridges. c. Antigen binding takes place in the constant region. d. The hinge region is formed by bridges between the light chains.

320  CHAPTER 11  Adaptive Immunity

Constant region

Heavy chain

Carboxy termini

FC

T h e M icrobio l ogist ’ s T oo l bo x

✓ The Planner

The Coagulase Agglutination Assay a. Anticoagulase antibodies conjugated to colored latex microbeads bind coagulase on the surface of Staphylococcus aureus in this agglutination assay designed to rapidly identify this pathogen. Coagulase

Anticoagulase antibodies

Latex bead Staphylococcus aureus

Agglutination is the production of visible clumps when particulate antigens are combined with their specific antibodies in the laboratory. This simple reaction is a powerful tool used by clinical microbiologists to identify bacteria quickly so effective antibiotic therapy can be initiated. The coagulase assay is an agglutination test routinely performed in clinical microbiology laboratories to confirm the presence of Staphylococcus aureus in a culture. Coagulase is an enzyme produced on the surface of S. aureus to help the pathogen evade host immune attack. When a suspension of colored latex microbeads with anticoagulase antibodies conjugated to their surfaces is mixed with a bacterial sample from a patient culture (Figure a), rapid antibody-antigen binding occurs if the suspected specimen is S. aureus. When the anticoagulase antibodies bind to their bacterial antigens, the attached beads undergo agglutination, providing a visually distinct identification of the pathogen (Figure b).

Agglutination

T h i n k C ri ti c al l y

If this procedure were repeated exactly as described with a Staphylococcus epidermidis specimen, would agglutination occur? Explain.

one or more disulfide bridges producing a hinge region. This portion of the antibody is quite rigid, but the two prongs and the stem are exceedingly flexible, which facilitates antigen binding. The antigen-binding sites are at the flexible ends of the prongs. The H and L chains are oriented such that their amine termini are directed toward the prongs and their carboxy termini point toward the stem. There is significant sequence variation at the amine termini of the L and H chains when comparing antibody molecules. Known as the variable region, the tips of the two antibody prongs demonstrate extreme specificity and affinity for antigen binding, which explains the sequence variation of the site. They are referred to as antigen-binding fragments (Fab). The tremendous diversity of antigen binding is

Negative test

Positive test

Mauro Fermariello/Science Source Images

b. As the colored beads pull together because of antibodyantigen interactions, obvious clumps, or agglutination, appears.

accomplished by integrating hypervariable regions with highly conserved framework regions. This design positions the correct antibody amino acids needed for antigen binding as well as placing other amino acid sequences appropriately for induced fit. The resulting 20 × 30 Å Fab cleft can carry out specific and strong antigen binding. Not only does this amazing binding specificity result in effective pathogen elimination, it also provides microbiologists with a powerful diagnostic tool (see The Microbiologist’s Toolbox). The amino acid sequences in the constant regions of antibodies are very similar, no matter what antigen they bind. The end of the antibody stem is known as the crystallizable fragment (FC) because homology here is so great that the molecules crystallize under experimental Antibody-mediated Responses   321

conditions. The similarity in the constant regions of antibodies suggests the constant region must be needed for an important function, such as activating antibody-mediated effector mechanisms.

Immunoglobulin Classes and Their Specific Functions The constant region of an antibody is involved in effector activity. Because there are several types of antibody-mediated pathogen attack strategies, there are different kinds of constant regions. These correspond to the five different types of H chains that define the five Ig classes (Table 11.4). The H chain classes are designated as IgG, IgA, IgM, IgE, and IgD. The constant region of all antibodies in

each Ig class is same regardless of the antibody specificity. The constant region differences between Ig classes reflect subtle structural modifications that correlate with their ability to initiate different responses. Immunoglobulin G (IgG) antibodies are the most prevalent in circulation and are responsible for effector actions such as opsonization, complement fixation, and toxin neutralization. IgG is the only antibody class capable of crossing the placenta during gestation to confer passive immunity to the developing fetus from the mother. This borrowed immune function serves to protect neonates for the first few months of life as their own naïve immune systems develop. Immunoglobulin A (IgA) antibodies are found in minimal amounts in circulation as monomers, but have

The five classes of immunoglobulins  Table 11.4 IgG

IgA

IgM

IgE

IgD

Typical # Igs

1

2

5

1

1

# Ag binding sites

2

4

10

2

2

Approximate molecular weight

150,000

420,000

900,000

200,000

180,000

Relative proportion in serum

80%

13%

6%

0.002%

1%

Special features

Crosses placenta; fixes complement; neutralizes toxins; opsonization; antibody-mediated cell lysis; long-term immunity

Secreted antibody found in tears, saliva, sweat, mucus, and colostrum

“First responder” Ig; B-cell receptor; fixes complement

Fights parasitic worm infections; allergic responses

B-cell receptor

Associated peptides

None

J chain; secretory component

J chain

None

None

Basic form

KEY Disulfide bridge J chain Secretory component

322  CHAPTER 11  Adaptive Immunity

the highest overall rate of production. This paradox is explained by IgA’s protective role in body secretions. Thus, they are found in high concentrations in tears, mucus, and breast milk, for example. Usually, two IgA molecules are connected by a small polypeptide called the J chain (joining piece). The addition of the polypeptide secretory component protects this dimeric Ig from proteases in secretions. This is especially important for the IgA secreted in the colostrum component of breast milk. Because the colostrum is exposed to an infant’s digestive enzymes, the secretory component maintains the protective value of the IgA, allowing the infant to benefit from maternal passive immunity. Immunoglobulin M (IgM) antibodies are the largest of the antibody molecules because they are secreted as pentamers. Five Ig molecules are held together in a radial arrangement using a J chain and disulfide bridges, producing an enormous protein with 10 antigenbinding sites. This structure makes IgM the ideal first responder. By secreting IgM at infection onset when large numbers of pathogens are present, its enhanced antigen-binding ability can quickly neutralize an overwhelming bacterial invasion. As the number of pathogens declines because of IgM activity, isotype class switching frequently occurs. In class switching, an activated B cell continues to secrete antibodies of the same specificity, but the H chain changes from one class to another. Class switching changes the mechanism used for pathogen elimination. When switching from IgM to IgG, there is also enhanced antigen binding. Although IgM has 10 antigen-binding sites, their affinity is low. This makes the molecule very effective at high pathogen concentrations but useless for finding and eliminating a small number of persisting microorganisms. IgG has only two antigen

11.5

binding sites, but its affinity for the same epitope is substantially higher than IgM. This feature permits IgG to efficiently find and bind the remaining pathogens for total infection elimination. Immunoglobulin D (IgD) antibodies have one principal function. Along with IgM, they serve as surface immunoglobulins (sIgs) or antigen receptors on B cells. Once an epitope has bound to the receptor, it initiates signal transduction, leading to B cell activation so an effective antibody-mediated response can be launched to eliminate the invading microorganisms. Like IgD, immunoglobulin E (IgE) antibodies are normally found in trace amounts in the circulation. Elevated serum levels of IgE signal either a parasitic worm infection or an allergic response. The FC portion of IgE binds receptors on mast cells and basophils, triggering their degranulation. Although the powerful chemical mediators released promote inflammation to control infections, including those caused by parasitic worms, they also act as a double-edged sword. The rapid release of histamine during IgE binding of basophils can cause bronchial constriction and vasodilation, leading to the breathing difficulties and plunging blood pressure associated with anaphylactic shock.

1. How many heavy chains compose a molecule of IgM? 2. Which antibody class can cross the placenta to provide immunity to a developing fetus?

B-cell Activation

LEARNING OBJECTIVES 1. Describe the structure of a B-cell receptor, indicating how it is uniquely designed for antigen binding and signal transduction. 2. Outline the process of B-cell activation, indicating how it generates host immunity.

3. Identify the principal antibody-mediated effector mechanisms, explaining how each effectively eliminates pathogens.

he diverse immunoglobulin classes previously described are secreted by plasma cells, or B cells fully activated by antigen binding. Because B cells can bind unprocessed antigens, they are especially effective at eliminating extracellular pathogens.

B-cell Receptors and Pathogen Binding

T

B cells, like T cells, have a receptor complex composed of some proteins that bind and recognize the antigen and others that generate an intracellular signal leading to activation. The core of a B-cell receptor (BCR) has a surface B-cell Activation  323

The B-cell receptor and coreceptor complexes • Figure 11.7 Antigen recognition and signal transduction in B cells often require both an antigen-binding receptor complex and a coreceptor complex. Epitope Microbe C3d

Disulfide bridge

B-cell plasma membrane Monomeric IgM receptor Enzyme-binding domain

a. The B-cell receptor This collection of surface proteins consists of a surface immunoglobulin (either IgM or IgD) and an Igα/Igβ complex. When numerous sIg receptors are crosslinked by a multivalent antigen (one with several sites that can bind antibodies), signal transduction occurs, leading to B cell proliferation and differentiation.

CR2

b. The B-cell coreceptor Because most antigens are univalent, signal transduction only occurs if the pathogen simultaneously binds both the sIg and the CR2 coreceptor.

Pu t It To g e t h e r

Review Figure 11.4, and answer this question. Which of the following is true of BCRs and TCRs? a. TCRs and BCRs bind only processed antigens. b.TCRs have TCR and CD3; BCRs have IgM plus Igα and Igβ chains. c. The antigen-binding regions of TCRs and BCRs are in the cytosol. d. Both TCR and BCR complexes bind antigen presented by APCs.

IgM or IgD antibody for specific epitope binding (Figure 11.7a). However, when expressed on the surface of a B cell, these Igs possess a short hydrophobic transmembrane region and cytosolic tails consisting of only three amino acids—much too short to effectively signal antigen binding to the Fab portion of the receptor. Consequently, the signaling function is performed by the two additional molecules associated with the complex, Igα and Igβ (Figure 11.7a). Each of these polypeptides possesses a short hydrophobic transmembrane region and longer cytosolic tails bearing an enzyme-binding site. The Igα and Igβ chains are joined with an extracellular disulfide bridge and associate noncovalently with the sIg receptor. Some pathogens possess multiple identical epitopes, allowing the crosslinking of many sIg receptors when they bind to a B cell. It is thought that the numerous conformational changes caused by this collective binding

324  CHAPTER 11  Adaptive Immunity

Recruited membrane proteins

Igα Igβ

event start a series of reactions in the Igα/Igβ cytosolic domains that generate an intracellular activation signal. More commonly, the epitope of a monovalent pathogen binds to a single sIg. Without the crosslinking event, another strategy must be used to trigger signal transduction. In this situation, the sIg-bound antigen simultaneously associates with the CR2 coreceptor (Figure 11.7b). The CR2 coreceptor binds to C3d, a complement protein generated during innate responses that spontaneously attaches to bacterial cells. This binding event recruits other membrane proteins and triggers the reactions in Igα/Igβ cytosolic domains that produce an intracellular activation signal. Note that in this activation scenario an innate response facilitates initiation of an adaptive response. Ultimately, regardless of the mechanism used to initiate signaling, transcription factors are generated, inducing expression of genes essential for B-cell activation.

Antibody Production and Clonal Expansion Most antigens are T-dependent antigens, which means they require TH cell assistance for full B-cell activation. Because B cells can act as APCs, the antigen bound to the BCR is internalized, processed, associated with a class II MHC molecule, and presented to an appropriate TH cell (Figure 11.8). The B and TH cells join together via three binding events: the class II MHC molecule presents processed antigen to the TCR, the CD40 binds with CD40L, and the B7 molecules associate with CD28. The conjoined cells stimulate changes in each other. The B cell greatly increases expression of its receptors specific for TH cell–generated cytokines. The TH cell initiates secretion of IL-2, IL-5, and IL-6, the cytokines collectively known as B-cell growth factors. Under the influence of these cytokines, the activated B cell undergoes rapid proliferation generating an army of clones. Under the influence of still other cytokines known as B-cell differentiation factors, some of the B-cell progeny differentiate into plasma cells. The cytokines trigger enlargement of the differentiating plasma cell A B cell and a significant increase mature, antibodyin the volume of its rough endosecreting B cell. plasmic reticulum in preparation for secreting large numbers of antibodies. The sIg receptors and class II MHC molecules disappear from the surface of differentiating B cells. Most plasma cells initiate IgM secretion; many later undergo class switching to maximize the diverse effector activity of the antibody-mediated response. This transition to a different antibody class that maintains the same specificity and affinity of the original is a complicated molecular process. As with T cells, not all members of the clone army differentiate into antibody-producing plasma cells. The

undifferentiated B cells express high-affinity sIg receptors, enter a quiescent phase, and function as memory cells. Subsequent pathogen exposures are met with instantaneous B-cell activation, proliferation, differentiation, and antibody production, leading to immunity. Successive pathogen encounters lead to the increasing size of the memory B-cell army. B cells can also be activated by T-independent antigens. These antigens are characterized by repetitive epitopes, such as the carbohydrates in bacterial capsules. Because the many epitopes from one bacterium can simultaneously bind many BCRs, an intracellular activation signal is generated without assistance from T-cell cytokine stimulation. In humans, B-cell responses to T-independent antigens are infrequent, tend to be weak, and fail to generate memory cells. The affinity of a single antibody to its epitope involves hydrogen bonding, van der Waals forces, and hydrophobic interactions. Some responding plasma cells generate low-affinity antibodies, whereas other plasma cells secrete antibodies that rapidly, securely bind their epitope. Because high-affinity antibodies are able to find, bind, and eliminate antigens even when present at extremely low concentrations, pathogen clearance is improved if the quality of the antisera is enhanced. This is accomplished in two ways. First, somatic mutation can lead to the generation of antibodies with the same specificity but significantly increased epitope attraction. Also, when subsequent pathogen exposure occurs, the initial number of invading pathogens is typically very low. Therefore, only the memory B cells with the highest affinity sIg receptors will bind the pathogen, activate, and secrete antibodies with a correspondingly high affinity. The overall result of these two processes is affinity maturation, or the production of antisera with increasingly higher pathogen affinity and consequently, a more efficient pathogen elimination.

TH cell interaction with an antigen-binding B cell • Figure 11.8 Following three specific binding events between a B and TH cell, the proliferation and differentiation of the B cell begins.

Cytokine receptor

slg receptor CD40

CD40 ligand

TH cell

B cell T-cell receptor

Class II MHC molecule with processed antigen

A sk Yo u rs e l f In the course of B cell activation, the TH cell and the B cell are bound together by _____ , _____ , and _____ .

B7

Proliferation Antibodies secreted

CD28 Plasma cells

Chemical signal Cytokine

Cytokines IL-2, IL-5, IL-6

B-cell Activation  325

Microbiology InSight  Primary and secondary antibodymediated responses and the development of lifelong ✓ The Planner immunity  •  Figure 11.9

Whether initiated by pathogen invasion or vaccination, a primary antibody-mediated response generates memory B cells needed for immunity. A secondary antibody-mediated response represents the memory aspect of adaptive immunity. Whether naturally or artificially acquired, this active immunity in a host provides lifelong infection protection. Plasma (mature B) cells

Plasma (mature B) cells Activated B cells

Enlarged memory cell population

Activated B cells IgG

IgM

Memory B cell

a. When comparing a primary and secondary antibodymediated response at the cellular level, both trigger B-cell activation, proliferation, and differentiation, resulting in antibody secretion. However, a primary response helps the host recover from illness because of their initial pathogen encounter, whereas a secondary response provides protection by rapidly activating memory B cells upon subsequent pathogen exposures.

Naïve B cell IgM

IgG Total

Antigen Initial antigen exposure

Subsequent antigen exposure

Antibody titer

Total IgG

IgG IgM

0

IgM

7

0 3 Days after antigen exposure

Primary response

30+

b. These cellular responses correlate precisely with antibody production and host health. An infected host begins to recover after 5 to 7 days because of the steadily increasing antibody titers and the switch from IgM to IgG production. When the pathogen is encountered in the future, immediate release of very high levels of IgG annihilates invaders preventing infection and maintaining host health.

Secondary response

BSIP/UIG/Getty Images

© David Gee/Alamy Stock Photo

c. If the first host encounter with the

Initial attenuated pathogen exposure triggers a primary response without illness.

Initial virulent pathogen exposure results in illness as a primary response develops. The secondary response triggered by subsequent pathogen exposure provides immunity to infection.

pathogen is by vaccination, the attenuated antigen introduced initiates the usual cellular and serological responses without the concurrent infection. However, when these same responses are due to an initial virulent pathogen exposure, they restore the patient to health. A secondary response results in the active immunity protecting this older child from her sister’s chickenpox infection.

A sk Yo u r se lf The long-term success of a vaccination depends on the development of _____ .

The levels of antibody producprimary response tion vary throughout the host’s The production of life, with the most significant dif- antibody in response ference occurring between the to the first contact primary response to an antigen with an antigen. and the secondary response to the same antigen (Figure 11.9). secondary Following initial exposure, patho- response The rapid genic antigens are processed by elevation of antibody specific B cells and presented to titer following a secthe appropriate TH cells. Clonal ond exposure to an antigen. expansion of the B cells, plasma cell differentiation, and antibody secretion occur within approximately 5 days. During this time, the host has experienced the symptoms associated with infection. As the titer, or concentration, of circulating antibodies begins to rise, pathogen elimination restores the host to health. Because an army of memory B cells was generated during the primary response, antibody secretion begins immediately upon subsequent pathogen exposure. With so many cells participating in the secondary response, the titer produced is substantially higher during the secondary

Antibody effector mechanisms • Figure 11.10

response. This memory component of the immune system is the basis of naturally acquired active immunity. However, the memory and specificity features of this type of adaptive immune response are also the foundation of artificially acquired active immunity, or vaccination. This practice is recognized as the greatest public health achievement of the last century and will be discussed in detail in Chapter 12.

B-cell Effector Mechanisms Antibodies mediate remarkably diverse effector mechanisms to kill invading pathogens and are even capable of preventing the establishment of infection. Because some antibodies (such as IgM and IgG) circulate throughout your body and others (IgA) are secreted on all moist surfaces, they encounter their specific pathogen easily. By attaching to surface epitopes, antibodies block pathogen adsorption and subsequent infection of your cells. Likewise, antibodies binding to pathogen-secreted toxins block their attachment to receptors, preventing host injury. Antibody attachment to a harmful antigen to prevent its damaging effects is called neutralization (Figure 11.10).

Opsonization The FC portion of antibodies binding to microbial epitopes attaches to receptors on phagocytic cells, promoting rapid engulfment.

FC receptor

Antibodies use a variety of different strategies to eliminate pathogens.

Inflammation C3b receptor

C3b

Complement activation Once activated by IgM or IgG binding a pathogen surface, the classical complement pathway triggers C3a- and C5a-enhanced inflammation, C3b opsonization, and microbial lysis.

Opsonization Lysis Peplomers

Granzyme release

A sk Yo u rs e l f What two types of molecules promote opsonization?

Neutralization Antibody binding to pathogens and toxins blocks their attachment to host receptors, preventing infection and tissue damage.

LPS toxin

Apoptosis

Antibody-dependent cell-mediated cytotoxicity After antibodies attach specifically to an infected host cell, their FC regions bind receptors on NK cells, triggering the release of granzymes to mediate host cell death.

B-cell Activation  327

IgG promotes pathogen opsonization in two ways. First, as antibodies bind the microbial surface, they mask its negative charge, which is typically responsible for the electrostatic repulsion between bacteria and phagocytic cells. Second, antibodies attached to the pathogen bind with high affinity to the IgG FC receptors on the surface of phagocytic cells. This tethering action guarantees pathogen engulfment and destruction (Figure 11.10). The classical complement pathway is activated by the binding of C1 to one molecule of IgM or two molecules of IgG attached to a microbial surface. Although this method of pathway activation differs from the alternative (see Remember This!) and lectin pathways of the innate immune system, the outcome is the same—pathogen lysis (Figure 11.10). Additionally, C3b attachment to microbial surfaces encourages opsonization by subsequently binding to C3b receptors on phagocytes. Last, C3a and

C5a fragments serve to enhance inflammation, further improving pathogen elimination.

1. Which protein serves as the B-cell coreceptor? 2. What is the role of TH cells in B-cell activation and differentiation?

3. How does antibody neutralization prevent toxin damage to host tissues?

The Planner

Remember This!  Review Section 10.4 for an overview of the reactions of the alternative complement cascade that also leads to the formation of a membrane attack complex and cell lysis.

A final antibody effector mechanism is antibodydependent cell-mediated cytotoxicity (ADCC) (Figure 11.10). Antibodies binding to antigens on a virus-infected cell can also bind receptors on an NK cell and trigger release of their cytoplasmic granules. These granzymes enter the infected cell, destroy intracellular pathogens, and initiate apoptosis. Neutrophils, macrophages, and eosinophils can also participate in antibody-dependent cell-mediated cytotoxicity, depending on the immunoglobulin class involved.

✓

Summary

11.1

Introduction to Adaptive Immunity 306

• Adaptive immunity involves specific lymphocyte-mediated defenses that result in lifelong immunity. B cells are responsible for antibody-mediated responses, in which antibodies bind to and neutralize antigens. T cells direct cell-mediated responses. Both types of immune response are marked by specificity (they target particular microbial antigens) and memory (subsequent exposure to the same antigens elicits a faster and stronger response). • Large, complex antigens have greater immunogenicity because they can more fully bind with lymphocyte receptors and antibodies, as shown in the diagram. The portion of the antigen that binds is an epitope.

Chemical features influencing immunogenicity: Molecular size •  Figure 11.1

Antigen Bonds Receptor

328  CHAPTER 11  Adaptive Immunity

Receptor

• When an epitope binds to a lymphocyte, the lymphocyte undergoes repeated mitotic divisions, producing large numbers of identical lymphocytes, or clones, in a process known as clonal expansion. Positive selection during lymphocyte maturation ensures the generation of lymphocytes able to patrol the body and defend against pathogens, while negative selection eliminates nonfunctional and autoreactive lymphocytes. When antigen activated, some of these cells develop into pathogen-specific effector lymphocytes that eliminate the invading microbes. The rest develop into memory cells that remain inactive until stimulated by the same pathogen during a subsequent exposure to initiate a rapid counterattack. This series of events is known as clonal selection. • The major histocompatibility complex (MHC) is a set of genes that code for surface proteins that serve as selfidentification markers. Class I and class II MHC molecules are found on different types of cells involved in T-cell activation.

Cell-mediated Responses  313

• In cell-mediated immune responses, T cells attack pathogens. The different kinds of T cells vary in their surface proteins and in the cytokines they secrete. Types of T cells include helper T (TH) cells, the most prevalent T cell type; regulatory T (TR) cells, which prevent excessive immune responses, cytotoxic T (TC) cells, which can bind to most host cells and trigger apoptosis; and natural killer T (NKT) cells, which target lipid antigens. • In antigen processing, foreign macromolecules are degraded enzymatically into small fragments that stimulate the immune response. Host cells can acquire internal foreign proteins as a result of viral infection or the phagocytosis of pathogens by antigen-presenting cells (APCs). The pathogen is degraded by enzymes into immunogenic peptide fragments that combine with a class I or class II MHC molecule and move to the plasma membrane, where they are displayed, as shown in the diagram. The presented antigen binds with the T-cell receptor complex (TCR), initiating an adaptive response.

11.3

T-cell Activation  317

• Changes in TH surface proteins begin within hours of antigen recognition, preparing the cell for subsequent activation steps. The secretion of IL-2 and its high-affinity binding to IL-2 receptors during the early stages of activation inhibit apoptosis, moderate TR function, and drive the T cell into the final activation stages. • The later stages of T-cell activation are characterized by clonal expansion. The generation of short-lived effector cells rapidly eliminates pathogens, usually by TC cell lysis. The remaining army of memory cells is responsible for immunity if a repeat pathogen encounter occurs. Their response is what causes an induration (shown in the photo) as the positive response to the Mantoux test for tuberculosis infection.

Case Study: The Mantoux Test

Mark Thomas/Science SourceImages

11.2

Antigen-processing pathways: Processing of cytosolic proteins  •  Figure 11.4

The neoantigen is displayed on the host plasma membrane, allowing binding to the TCR and CD8 coreceptor of a T cell.

11.4

Antibody-mediated Responses 320

• In antibody-mediated immune responses, antibodies, or immunoglobulins (Ig), produced by mature B cells attack pathogens. These antigen-binding molecules consist of four polypeptide chains in the form of a Y-shaped molecule. The lengths of the two sets of chains are such that the shorter chains are called the light chains (L chains) and the longer chains are the heavy chains (H chains). • In associative recognition, the TCR binds to a neoantigen or the processed antigen combined with a MHC molecule. The binding of the extracellular CD8 coreceptor with the loaded class I MHC molecule initiates internal signaling. When an APC displays an antigen-loaded class II MHC molecule, a CD4 coreceptor associates with the class II MHC molecule.

• There are five classes of antibodies depending on the makeup of their heavy (H) chains: immunoglobulin G (IgG), shown in the diagram, immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin E (IgE), and immunoglobulin D (IgD). As the number of pathogens declines, class switching occurs, in which the B cell secretes antibodies of the same specificity, but with a different H chain.

The five classes of immunoglobulins: IgG Table 11.4 Summary  329

11.5

B-cell Activation  323

• B-cell activation begins with antigen binding to a receptor composed of a molecule of surface IgM or IgD plus an Igα/Igβ complex used to initiate intracellular signaling. CR2 may act as a coreceptor, attaching to C3d on the pathogen and intensifying intracellular signaling. • T-dependent antigens require assistance from a TH cell for full B-cell activation. When the B cell presents processed antigen to the TH cell, the TH cell secretes cytokines that bind to receptors on the B cell, triggering clonal proliferation. Characterized by repetitive epitopes, T-independent antigens can simultaneously bind many B-cell receptors, triggering an intracellular signal without TH cell assistance. Some activated B cells differentiate into plasma cells, the mature, antibody-secreting cells, shown in the diagram. The remaining B cells function as memory cells that respond to subsequent pathogen exposure with immediate activation,

leading to antibody production. The first exposure to an antigen initiates the primary response. Subsequent exposures elicit the secondary response.

Primary and secondary antibody-mediated responses and the development of lifelong immunity  •  Figure 11.9

• Antibodies demonstrate diverse effector mechanisms for efficient pathogen elimination. These include: antibody neutralization, opsonization, activation of the classical complement pathway, and antibody-dependent cellmediated cytotoxicity.

Key Terms • adaptive immunity  306 • affinity  317 • affinity maturation  325 • antibody-mediated response  306 • antigen-binding fragment (Fab)  321 • antigen-binding site  321 • antigen-presenting cell (APC)  316 • associative recognition  317 • CD3  317 • CD4  313 • CD8  314 • cell-mediated response  306 • class switching  323 • clonal deletion  309 • clonal expansion  311 • clonal selection  311 • clone  311 • constant region  316 • CR2  324

330  CHAPTER 11  Adaptive Immunity

• crystallizable fragment (FC)  321 • cytotoxic T (TC) cell  314 • epitope  306 • hapten  308 • heavy chain (H chain)  320 • helper T (TH) cell  313 • hinge region  321 • immunogenicity  307 • immunoglobulin (Ig)  320 • immunoglobulin A (IgA)  323 • immunoglobulin D (IgD)  323 • immunoglobulin E (IgE)  323 • immunoglobulin G (IgG)  322 • immunoglobulin M (IgM)  323 • interleukin  313 • light chain (L chain)  320 • lymphocyte  306 • major histocompatibility complex (MHC)  311

• memory  306 • memory cell  311 • natural killer T (NKT) cell  314 • negative selection  309 • neoantigen  311 • neutralization  327 • plasma cell  325 • positive selection  309 • primary response  327 • proteasome  315 • regulatory T (TR) cell  314 • secondary response  327 • serology  320 • specificity  306 • T-dependent antigen  325 • T-independent antigen  325 • variable region  316 • zeta (ζ) chain  317

Critical and Creative Thinking Questions 1. The specificity of the immune system is amazing when you consider how many possible molecules it can recognize. How is this huge variety of cells and antibodies created and why is it clinically significant?

4. There are many different proteins on the TH cell membrane surface. Create a table identifying each different protein and its associated function(s). 5. The diagram shows the structure of an antibody. What aspect of antibody structure accounts for its specificity in combining with antigens?

2. What might be the effect of a mutation that inserts or deletes nucleotides in the genes that determine the structure of MHC molecules? 3. Some people suffer from disorders in which the immune system attacks body tissues, causing ongoing damage. Some of these diseases don’t appear until adulthood. How might this happen?

What is happening in this picture?

Th i n k C ri ti c al l y 1. What classic mononucleosis symptom do you observe? 2. Use your knowledge of adaptive immune response and explain why a patient with mononucleosis would demonstrate this symptom. 3. Knowing that mononucleosis is caused by the Epstein-Barr virus, predict whether the adaptive response against this virus will be primarily antibody- or cell-mediated. Explain.

Dr. M.A. Ansary/Science Source Images

This photo shows a patient suffering from a mononucleosis infection.

Self-Test (Check your answers in Appendix A.)

1.  Adaptive immunity is mediated by _____ and _____, which demonstrate _____ and _____.

2.  Antigens like the one in the diagram elicit the strongest adaptive responses because they have _____.



a. macrophages; monocytes; phagocytosis; proteolysis



a. a single epitope and complex structure



b. neutrophils; macrophages; the respiratory burst; phagocytosis



b. low molecular weight, simple structure, and two epitopes



c. B lymphocytes; T lymphocytes; opsonization; phagocytosis



c. high molecular weight, complex structure, and a single epitope



d. B lymphocytes; T lymphocytes; specificity; memory



d. high molecule weight, complex structure, and multiple epitopes



e. phagocytes; erythrocytes; proteolysis; opsonization



e. one epitope and many repeating sequences

Antigen

Self-Test  331

3.  Review the Clinical Application, and answer this question.

7.  Proteins in the plasma membrane that identify cells as self are products of the _____.

Why does an effective Streptococcus pneumoniae immunization need to be a conjugated vaccine?



a. major histocompatibility complex



a. Because capsule proteins are too large to be immunogenic.



b. proteasome complex



b. Because capsule proteins are haptens.



c. immunoglobulin complex



c. Because capsule polysaccharides readily degrade losing immunogenicity.



d. memory cells



e. All of these are correct.



d. Because the capsule polysaccharides are complex antigens.



e. Because only conjugated vaccines are effective against gram-positive bacteria.

8.  Review Figure b in What a Microbiologist Sees, and answer this question.

The risk of transplant rejection is increased when the _____.

4.  Identify the process(es) occurring in lymphocyte maturation as shown in the diagram.



a. transplanted tissue contains class I MHC molecules that match the host’s



a. unique receptors develop





b. lymphocytes lacking receptors undergo apoptosis

b. host T cells that interact with class I MHC molecules express high levels of CD45RC



c. autoreactive lymphocytes undergo apoptosis



c. transplanted cells express low levels of CD45RC



d. a and b occur





e. a, b, and c all occur

d. host class II MHC molecules don’t match those of the transplant



e. host T cells express low levels of CD45RC

Checkpoint #1

9.  Cell-mediated responses are carried out by _____; antibodymediated responses are carried out by _____ and _____.

a. B lymphocytes; T lymphocytes; antibodies



b. macrophages; T lymphocytes and antibodies



c. T lymphocytes; macrophages; neutrophils



d. B lymphocytes; macrophages; T lymphocytes



e. T lymphocytes; B lymphocytes; antibodies

10.  T cells that eliminate intracellular infections are _____.

5.  Cells that attack self-antigens _____.



a. regulatory T cells



b. helper T cells



c. suppressor T cells



d. cytotoxic T cells



e. regulatory T and suppressor T cells

11.  Review the Process Diagram, Figure 11.4, and answer this question.

The enzymatic breakdown of antigenic proteins found in the cytosol occurs in the _____.

b. are eliminated gradually during childhood



a. proteasome



c. do not cause damage in the body



b. phagolysosome



d. are eliminated by foreign epitopes



c. autosome



e. are enclosed in phagosomes



d. lysosome



e. ribosome



a. are eliminated during lymphocyte development



6.  Review the Process Diagram, Figure 11.3, and answer this question.

The two pathways for the differentiation of the cloned lymphocytes produce _____.



a. B cells and antibodies



b. effector lymphocytes and antibodies



c. effector lymphocytes and memory cells



d. T cells and MHC molecules



e. B cells and MHC molecules

332  CHAPTER 11  Adaptive Immunity

12.  Proteins from extracellular pathogens engulfed by phagocytes are broken down in _____ that have fused with _____.

a. phagosomes; proteasomes



b. lysosomes; proteases



c. proteasomes; autosomes



d. proteasomes; lysosomes



e. phagosomes; lysosomes

13.  Phagocytized antigens are prepared for presentation to T cells by _____.

18.  The B-cell receptor can be made up of _____.

a. IgM, Igα, Igβ



a. neutrophils



b. CR2



b. enzymatic degradation



c. Igα, Igβ



c. fusion with class II MHC molecules



d. IgD



d. Both b and c are correct.



e. All of these may compose the BCR.



e. All of these are involved in antigen presentation to T cells.

14.  In the diagram, the leader points to the _____.

19.  In the diagram, the T-cell receptor is bound to a _____ with _____ on the B cell.



a. CD4 coreceptor



a. sIg; processed antigen



b. class II MHC molecule



b. class I MHC molecule; soluble antigen



c. processed antigen



c. class II MHC molecule; processed antigen



d. zeta chains



d. class II MHC molecule; soluble antigen



e. CD3 polypeptides



e. class I MHC molecule; cytokine

APC

TH cell

15.  Review The Microbiologist’s Toolbox, and answer this question.

Can the coagulase agglutination assay be adapted to identify other microbial pathogens? Why?



a. No, because only anticoagulase antibodies can be conjugated to the latex beads.



b. No, because only Staphylococcus aureus bears a unique surface antigen such as coagulase.



c. Yes, because most bacteria bear coagulase on their surfaces and will give a positive reaction.



d. Yes, as long as the antibodies conjugated to the latex beads are specific for binding to a surface antigen on the pathogen of interest, agglutination will occur when they combine.



e. Yes, because coagulase is present on the surface of all staphylococcal species.

16.  On an antibody molecule, the region that shows the highest affinity for antigen binding is the _____.

B cell

20.  Review the Microbiology InSight, Figure 11.9, and answer this question.

On day three of a primary immune response, _____.



a. IgM levels reach their peak concentration



b. IgG levels begin to rise



c. IgG levels are equivalent to day three IgG levels during a secondary response



a. FC region



b. hinge region



d. mature plasma cells reach peak level



c. constant region



e. Both a and b are correct.



d. variable region



e. carboxyl termini

17.  The diagram illustrates the structure of _____. a. IgM b. IgA c. IgE d. IgD e. IgG

Self-Test  333

12

Vaccination, Immunoassays, and Immune Disorders MODERN VACCINE OPTIONS

A

n impending immunization triggers extreme anxiety in more than 10% of adults and is often responsible for apprehension and tears at the pediatrician’s office. Because a fear of needles

is often cited as the reason for avoiding life-saving vaccines, new, pain-free means of immunization are being developed. For example, genetically altered bananas can now confer immunity against infections such as hepatitis B and cholera (see the photo).

Blend Images/Getty Images

This chapter will focus on applications of immunology as well as immune disorders. Vaccination primes the immune system so that the initial contact with a pathogen leads to immunity without causing an infection. A variety of different tests, known as immunoassays, are performed in clinical and research laboratories, using antibodies for specific antigen identification and quantification. Abnormal immune responses include: overreaction to harmless antigens, diminished immune activity, and attack of autoantigens resulting in various disease states.

CHAPTER OUTLINE 12.1 • • • •

Vaccines and Vaccination  336 A Brief History of Vaccination Modern Vaccines Vaccines and Public Health Vaccine Safety and Misconceptions

12.2 Immunoassays  343 • Monoclonal Antibodies ■ The Microbiologist’s Toolbox: Human Monoclonal Antibody Therapy for Non-Hodgkin’s Lymphoma • Types of Immunoassays 12.3 Hypersensitivities  350 • Type I Hypersensitivity • Type II Hypersensitivity ■ What a Microbiologist Sees: Fetal Rh Incompatibility • Type III Hypersensitivity • Type IV Hypersensitivity 12.4 Autoimmune Diseases and Immunodeficiencies  356 • Autoimmune Diseases • Immunodeficiencies ■ Clinical Application: Bone Marrow Transplants for Immunodeficient Patients ■ Case Study: Prioritizing Immunizations

Chapter Planner

✓

❑ Study the picture and read the opening story. ❑ Scan the Learning Objectives in each section: p. 336 ❑ p. 343 ❑ p. 350 ❑ p. 356 ❑ ❑ Read the text and study all figures and visuals. Answer any questions.

anekoho/Shutterstock

Analyze key features

These genetically modified bananas growing at a medical research facility highlight an innovative modern method of immunization used to provide lifelong protection against many potentially deadly infections.

❑ Process Diagram p. 337 ❑ p. 344 ❑ p. 348 ❑ p. 351 ❑ p. 354 ❑  Microbiology InSight, p. 340 ❑ ❑ The Microbiologist’s Toolbox, p. 345 ❑ What a Microbiologist Sees, p. 353 ❑ Clinical Application, p. 358 ❑ Case Study, p. 359 ❑ Stop: Answer the Concept Checks before you go on. p. 343 ❑ p. 349 ❑ p. 355 ❑ p. 360 ❑ End of chapter

❑ Review the Summary and Key Terms. ❑ Answer the Critical and Creative Thinking Questions. ❑ Answer What is happening in this picture? ❑ Complete the Self-Test and check your answers.

 

335

12. 1

Vaccines and Vaccination

LEARNING OBJECTIVES 1. Outline the history of vaccination. 2. Explain the different kinds of modern vaccines. 3. Describe the importance of vaccination in public health.

4. Discuss vaccine safety and problems caused by misinformation about vaccine safety.

he most important application of modern immunology has been the implementation of vaccination programs that have dramatically reduced global morbidity. This relatively simple method of altering an immune response is responsible for protecting countless lives and saving vaccination The billions of health care dollars. An- administration of a tibiotic treatment of bacterial in- nonvirulent antigen to fections usually yields a positive stimulate an adaptive outcome, but many other types of response such that pathogens cannot be effectively subsequent exposure treated once they initiate illness. to a related pathogen Because it is important to prevent triggers immunity, these infections, several practices or a protective sechave been developed to alter the ondary response; activity of the immune system and synonymous with immunization. provide protection.

structure between the two viruses, allowing the immune system to launch a secondary attack on the smallpox virus if the host had previously been exposed to the cowpox virus. A vaccine is the immunogenic material used to induce artificially acquired active immunity (Figure 12.1) and the term is used today to honor Jenner’s work because vacca is Latin for cow. In 1980, the World Health Organization declared the eradication of smallpox because of ongoing improvements in the smallpox vaccine coupled with international immunization, or vaccination, programs.

T

A Brief History of Vaccination The Chinese practiced administration of artificially acquired active immunity more than 3000 years ago. Scabs from the pustules of smallpox patients were collected, ground, and inhaled or rubbed into a scratch to expose a person to a weakened or attenuated form of the deadly variola virus. Known as variolation, this practice usually caused a brief, mild illness followed by lifelong immunity to smallpox. Centuries later the practice spread to the west, where it was modified because of its two principal drawbacks: (1) about 1% of variolated patients developed full-blown smallpox and died, and (2) variolated individuals were fully infectious during their mild illness and represented an epidemic risk. The most significant changes to the variolation process were made by Edward Jenner, an English physician who noted that milkmaids who had previously had a cowpox infection demonstrated immunity to smallpox. Cowpox is a mild illness marked by a low-grade fever and temporary lesions on the hands, whereas smallpox carries a high mortality rate. Therefore, Jenner attempted to prevent smallpox by inoculating people with cowpox. The inoculations were successful, and his experiments resulted in the first safe form of artificially acquired active immunity. His success was due to similarities in

Modern Vaccines Today, vaccines are available to prevent infections that claimed many lives less than a century ago. Vaccine preparations vary greatly depending on the nature of the pathogen involved. However, successful vaccines: • activate both humoral and cell-mediated responses • provide a long-term memory response for lifetime immunity • protect fully against all aspects of pathogen infection • cause minimal side effects or discomfort • are easy to administer, require minimal doses, and do not need boosters • are affordable • are stable suspensions that store well for extended periods. Notice that these features address both the protection of the host and the practical issues of vaccine administration. An effective vaccine is of little value if people refuse immunization because of dangerous side effects, the inconvenience of a multidose injection schedule, or prohibitive cost. Also, the cohort that often most needs protection offered by vaccinations lives in underdeveloped regions. If the vaccine suspension is only stable when refrigerated, then it becomes impractical for remote locations, where it will likely spoil before it can be injected. There are different kinds of vaccines depending on whether the agent is live or inactivated, whole or fragmented, chemically treated, or combined with other agents.

336  CHAPTER 12  Vaccination, Immunoassays, and Immune Disorders

Injection of a weakened form of the pathogen triggers the production of memory cells, allowing prompt elimination of the virulent pathogen when the host is later infected. Vaccination

Attenuated virus

Memory cells

1 An attenuated viral pathogen is injected, activating the immune system and generating memory cells.

Immunity

Virulent virus

Memory cells

2 Virulent form of pathogen infects vaccinated patient, causing memory cells to launch a rapid pathogen attack.

3 Pathogen destruction maintains host health.

Th in k Cr it ica lly

If the host is infected a second time with the virulent form of the pathogen, will that person still be immune? Explain your answer.

Live attenuated vaccines  A live attenuated vaccine is a preparation containing the live whole agent in a weakened or less virulent form. Attenuation results from treating a pathogen growing in culture with specific chemicals or radiation. These treatments can induce mutations that minimize pathogen virulence while maintaining its immunogenicity. In preparing vaccines against viruses, the viruses are cultured in embryonated chicken eggs. In this system, viral replication is indicated by embryo death, injury to embryonic cells, and/or damage to the embryonic membranes. In preparing vaccines against bacteria, the bacteria are grown in nutrient-rich broths. When an adequate population of these microorganisms has been generated,

they are extracted from culture, purified, and prepared for injection. The advantage of a live vaccine formulation is that it mimics most closely a natural infection. The attenuated microorganisms, often viruses, replicate in host cells, elevating their population numbers to levels substantially larger than the initial vaccine dose. This generates an extremely strong primary immune response and establishes lifelong immunity. Live attenuated vaccines are not recommended for patients who are immune compromised, or having a weakened immune system, because they will be unable to generate a sufficient primary immune response to establish immunity. The major drawback of live attenuated vaccines is the small possibility that the Vaccines and Vaccination  337

Process Diagram

✓ The Planner

The connection between vaccination and immunity • Figure 12.1

Advantages and disadvantages of live vaccines  Table 12.1 Advantages

Disadvantages

• Reproduction of viable agents causes infection without illness and triggers a natural primary response.

• Live vaccines require special storage to maintain live cells.

• Live vaccines usually provide lifetime protection against infection.

• Live vaccines cannot be used for immune-compromised or pregnant patients.

• Fewer doses and boosters are required because the agent in live vaccines can reproduce and stimulate the immune system.

• In rare instances,* an attenuated, nonvirulent pathogen can mutate, regenerating a fully virulent strain that causes disease and is transmissible to other people.

• Live vaccines produce extremely strong cell-mediated responses. *For example,