Acta Biotechnologica: Volume 9, Number 4 1989 [Reprint 2021 ed.] 9783112581940, 9783112581933

Citation preview

Acta Biitertniliiica •

Journal of microbial, biochemical and bioanalogous technology

Akademie-Verlag Berlin ISSN 0138-4988 Acta Biotech noi., Berlin 9 (1989) 4, 299-392

Volume 9 • 1989 • Number 4

Instructions to Authors

1. Only original papers that have not been published previously will be accepted. Manuscripts may be submitted in English (in duplicate). The name of the institute (with the full address) from which the manuscript originates should be stated below the name(s) of the author(s). The authors are responsible for the content of their contributions. 2. Original papers should not exceed 20 typewritten pages (double spaced), including references, tables and figures; short original communications may contain a maximum of six typewritten pages. 3. Each paper should be preceded by a summary. 4. Latin names of species as well as passages to be printed in italics for greater emphasis should be marked by a waving line. Please use only units and symbols of the Si-system. 5. Tables may be used to shorten the text or to make it more comprehensible. They should be numbered consecutively throughout the text and be supplied with a brief heading. They should not appear in the text, but should be written on separate sheets. 6. The numbers and sizes of illustrations should be limited to a minimum, they should be numbered consecutively and be quoted on separate sheets. Line drawings, including graphs and diagrams, should be drawn in black ink. Half-tone illustrations should be presented as white glossy prints. Figure legends are to be typed in sequence on a separate sheet. The back of each sheet should bear the name(s) of the author(s). 7. References listed at the end of the contribution should contain only works quoted in the text. They should be numbered in the order in which they are first mentioned in the text. Please give surnames and initials of all authors, the name of the journal abbreviated according to "Chemical Abstracts — List of Periodicals", volume number, year of publication, issue number or month, first page number. Books are to be cited with full title, edition, volume number, page number, place of publication, publisher and year of publication. 8. Notes to the text may be presented as footnotes on the same page. 9. 50 offprints are free of charge. Additional ones may be ordered on payment. 10. The author will receive two galley proofs for correction. They are to be returned to the managing editor (Dr. Dimter, Permoserstr. 15, DDR-7050 Leipzig) as soon as possible.

Atta NiMMIHÌH Journal of microbial, biochemical and bioanalogous technology

Edited by the Institute of Biotechnology of the Academy of Sciences of the G.D.R., Leipzig and by the Kombinat of Chemical Plant Construction Leipzig—Grimma by M. Ringpfeil, Berlin and G. Vetterlein, Leipzig

Editorial Board : D. Meyer, Potsdam P. Moschinski, Lodz A. Moser, Graz M. D. Nicu, Bucharest Chr. Panayotov, Sofia L. D. Phai, Hanoi H. Sahm, Jülich W. Scheler, Berlin R. Schulze, Halle B. Sikyta, Prague G. K . Skryabin, Moscow M. A. Urrutia, Habana

1989

A. A. Bajev, Moscow M. E. Beker, Riga H. W. Blanch, Berkeley S. Fukui, Kyoto H. G. Gyllenberg, Helsinki G. Hamer, Zurich J . Hollo, Budapest M. V. Ivanov, Moscow P. Jones, El Paso F. Jung, Berlin H. W. D. Katinger, Vienna K. A. Kalunyanz, Moscow J . M. Lebeault, Compiègne

Number 4

Managing Editor :

L. Dimter, Leipzig

Volume 9

A K A D E M I E - V E R L A G

•

B E R L I N

"Acta Biotechnologica" publishes original papers, short communications, reports and reviews from the whole field of biotechnology. The journal is to promote the establishment of biotechnology as a new and integrated scientific field. The field of biotechnology covers microbial technology, biochemical technology and the technology of synthesizing and applying bioanalogous reaction systems. The technological character of the journal is guaranteed by the fact that papers on microbiology, biochemistry, chemistry and physics must clearly have technological relevance. Terms of subscription for the journal "Acta Biotechnologica" Orders can be sent — in the GDR: to Postzeitungsvertrieb or to the Akademie-Verlag Berlin, Leipziger Str. 3—4, P F 1233, DDR-1086 Berlin; — in the other socialist countries: to a book-shop for foreign languages literature or to the competent news-distributing agency; — in the FRG and Berlin (West): to a book-shop or to the wholesale distributing agency Kunst und Wissen, Erich Bieber oHG, Postfach 102844, D-7000 Stuttgart 10; — in the other Western European countries: to Kunst und Wissen, Erich Bieber GmbH, General Wille-Str. 4, CH-8002 Zürich; — in other countries: to the international book- and journal-selling trade, to Buchexport, Volkseigener Außenhandelsbetrieb der DDR, P F 160, DDR-7010 Leipzig, or to the Akademie-Verlag Berlin, Leipziger Str. 3 - 4 , P F 1233, DDR-1086 Berlin. Acta Biotechnologica Herausgeber: Institut für Biotechnologie der AdW der DDR Permoserstr. 15, DDR-7010 Leipzig (Prof. Dr. Manfred Ringpfeil) und VEB Chemieanlagenbaukombinat Leipzig—Grimma, Bahnhofstr. 3 - 5 , DDR-7240 Grimma, (Dipl.-Ing. Günter Vetterlein) Verlag: Akademie-Verlag Berlin, Leipziger Straße 3—4, P F 1233, DDR-1086 Berlin; Fernruf: 2236201 und 2236229; Telex-Nr.: 114420; Bank: Staatsbank der DDR, Berlin, Konto-Nr.: 6836-26-20712. Redaktion: Dr. Lothar Dimter (Chefredakteur), Martina Bechstedt, Käthe Geyler, Permoserstr. 15, DDR-7050 Leipzig; Tel.: 2392255. Veröffentlicht unter der Lizenznummer 1671 des Presseamtes beim Vorsitzenden des Ministerrates der Deutschen Demokratischen Republik. Gesamtherstellung: VEB Druckhaus „Maxim Gorki", DDR-7400 Altenburg. Erscheinungsweise: Die Zeitschrift „Acta Biotechnologica" erscheint jährlich in einem Band mit 6 Heften. Bezugspreis eines Bandes 198,— DM zuzüglich Versandspesen; Preis je Heft 33,— DM. Der gültige Jahresbezugspreis für die DDR ist der Postzeitungsliste zu entnehmen. Bestellnummer dieses Bandes: 1094/9/4. Urheberrecht: Alle Rechte vorbehalten, insbesondere der Übersetzung. Kein Teil dieser Zeitschrift darf in irgendeiner Form — durch Photokopie, Mikrofilm oder irgendein anderes Verfahren — ohne schriftliche Genehmigung des Verlages reproduziert werden. — All rights reserved (including those of translation into foreign languages). No part of this issue may be reproduced in any form, by photoprint, microfilm or any other means, without written permission from the publishers. © 1989 by Akademie-Verlag Berlin. Printed in the German Democratic Republic. AN (EDV) 18520 03000

Acta Biotechnol. 9 (1989) 4, 301—316

Akademie-Verlag Berlin

Molecular Basis of Biodegradation of Chloroaromatic Compounds SANGODKAR 1 , U . M . X . , ALDRICH 1 , T . L . , HATIGLAND 1 , R . A . , JOHNSON 1 , J . , ROTHMEL 1 , R . K . , CHAPMAN 2 , P . J . , CHAKRABARTY 1 *, A . M .

1 2

Department of Microbiology and Immunology, University of Illinois at Chicago, College of Medicine, Chicago, Illinois 60612 (U.S.A.) Microbial Ecology and Biotechnology, Environmental Research Laboratory, U.S.EPA, Gulf Breeze, Florida 32561 (U.S.A.)

Summary Chlorinated aromatic hydrocarbons are widely used in industry and agriculture, and comprise the bulk of environmental pollutants. Although simple aromatic compounds are biodegradable by a variety of degradative pathways, their halogenated counterparts are more resistant to bacterial attack and often necessitate evolution of novel pathways. An understanding of such evolutionary processes-is essential for developing genetically improved strains capable of mineralizing highly chlorinated compounds. This article provides an overview of the genetic aspects of dissimilation of chloroaromatic compounds and discusses the potential of gene manipulation to promote enhanced evolution of the degradative pathways.

Introduction Haloaromatic compounds are produced in vast amounts by the chemical industry for use as solvents, lubricants, plasticizers, and insulators as well as for use as herbicides and pesticides. The massive amount of these synthetic xenobiotics released into the environment over the past several decades, has triggered the natural microflora to evolve metabolic pathways for dissimilating some of these chemicals [1]. Naturally occurring halogenated compounds are not uncommon [2] and might well be of importance in the adaptation of microorganisms to utilize halogenated xenobiotics. Indeed, it is possible to isolate pure bacterial cultures from nature capable of metabolizing simple chlorinated compounds as their sole source of carbon and energy [3]. In most cases, the biochemical or genetic basis of such degradation is not well understood, although there are a few cases where the biodegradative pathways have been delineated and the respective genes carefully studied. In this article we describe the current state of our knowledge of the genetic basis of biodégradation of many such compounds, and discuss evolutionary aspects of acquiring the novel biodegradative pathways. Their implications for constructing microbial strains that can efficiently degrade a wide range of recalcitrant chloroaromatics are also discussed. * To whom correspondence should be addressed.

1*

302

Acta Biotechnol. 9 (1989) 4

Genetics of 3-Chlorobenzoate Degradation The most detailed understanding concerning the organization and regulation of degradative genes for halogenated compounds has come from studies of the dissimilation of 3-chlorobenzoate (3Cba) and 2,4-dichlorophenoxyacetic acid (2,4-D) [4, 5, 6]. The genes involved in degradation of 3Cba have been shown to be plasmid-encoded in two different Pseudomonas species, viz. plasmid pAC25 in P. putida [7, 8, 10] and plasmid p W R l in Pseudomonas sp. B13 [11]. Fig. 1 shows the mechanism of 3Cba metabolism in Pseudomonas [12,13]. The enzymes required for the conversion of 3Cba to 3-chlorocatechol (3Clc) are chromosomally-encoded in P. putida and are believed to be the same as those needed for benzoate degradation. The genes encoding 3Cba degradation therefore have an obligatory dependence on host genes. The plasmid pAC27 encodes a chloro-

& C00H

MINOR ROUTE /

I. II ^ ^ C l 3Cba

MAJOR ROUTE \

IBENZOATE QIOXYGENASel

HOOC

CHROMOSOMAL

OH

OH

CI

PLASMID 3Clc

2-Chloromuconate

COOH HOOC

^

CH2C00H

COOH

trans-Dienelactone

eis - Oienelactone Maleylaeetate

MALEYLACETATE REDUCTASE

•

P L A S M I D OR CHROMOSOMAL?

^LC U OI O H

Y

CH2C00H

P-Ketoadipate

Fig. i. Mechanism of 3-chlorobenzoate degradation in Pseudomonas sp. B13 [12,13, 107]. The contribution of chromosomally and plasmid encoded enzymes is shown [4, 7, 8,105]. Structures of diols as drawn are intended to show only their relative stereochemistry

SANGODKAR,

U. M. X.,

T. L. et al., Molecular Basis of Chloroaromatic Degradation

ALDBICH,

303

catechol degradative pathway consisting of three enzymes which convert 3Clc to maleylacetate. Reduction of maleylacetate to /S-ketoadipate and the metabolism of /3-ketoadipate may also require the participation of chromosomal genes, as there is no evidence for a gene encoding maleylacetate reductase on pAC27 [4]. All three of the known chlorocatechol (clc) genes from plasmid pAC27 are clustered on a 4.2-kb B g l l l fragment (Fig. 2). There is an adjoining 385-bp B g l l l segment t h a t contains the promoter for t h e structural genes carried on the 4.2-kb segment [8]. The complete nucleotide sequence of these two fragments has been determined and the organization of the three genes encoding the three critical enzymes — pyrocatechase I I (chlorocatechol dioxygenase), cycloisomerase I I (chloromuconate lactonizing enzyme) and hydrolase I I (dienelactone hydrolase) has been delineated (Fig. 2). I t should be emphasized t h a t similar enzymes, differing in substrate specificity, are involved in the degradation of the natural nonchlorinated compound, catechol, through the ortko fission pathway [9]. These are cate5 00H r ri

(p

?H

ii

_ CI

3-Chlorobenzoate

COOH ,00 COOH COOH COOH B i f l co COOH S COOH ^ / C00l^_ s —SSS^CI 'ci ^ C)'•^^

^ ««^Cl 3-Chlorocatechol

2-Chloro-ci_s,cjs- Dienelacmuconate tone

_dcA_

t—i

qSc Bq

1

B

elcB

n

H S

(orf3j

1—i P

P

Maleylacetate

.

t

p-Ketoodipate

dcD

r

S

0.5 kbp Fig. 2. Organization of plasmid pAC27-encoded chlorocatechol degradative (clc) genes involved in the dissimilation of 3Cba. A simplified version of chlorocatechol is shown. Steps A, B, and D are mediated by clcA, clcB, clcD, respectively encoding pyrocatechase II, muconate lactonizing enzyme II, and hydrolase II. The location of the promoter is indicated by the arrowhead. The initiation codon of clcB overlaps with the stop codon of clcA. The restriction sites are as follows: Bg, Bglll; Sc, SacII; B, BamHI; H, Hindlll; S, Sail; P, PstI

chol 1,2-dioxygenase (pyrocatechase I), c»s,as-muconate lactonizing enzyme (cycloisomerase I), and /9-ketoadipate enol-lactone hydrolase (hydrolase I). The catechol degradative enzymes are chromosomally encoded and at least the first two have a high degree of specificity towards their respective substrates [5,11]. I n contrast, the pAC27-encoded pyrocatechase I I and cycloisomerase I I have broader substrate specificities, and can act on both chlorinated and nonchlorinated substrates. Hydrolase I I , however is quite specific for dienelactone and has no activity towards /5-ketoadipate enol-lactone [13]. I t appears t h a t pyrocatechase I I and cycloisomerase I I may have evolved from the corresponding chromosomally encoded-enzymes, as supported by their broad substrate specificity as well as the high degree of amino acid sequence homology between plasmid and chromosomal enzymes [4]. The hydrolase I I enzyme is considerably different from hydrolase I as indicated by dissimilar NH 2 -terminal amino acid sequences, although there is close resemblance in the amino acid sequence neighboring what might be a n active site cysteine residue [14,15]. The complete nucleotide sequence of the 385-bp and the 4.2-kb B g l l l fragments of the plasmid pAC27 revealed four major open reading frames (ORFs) [8]. The first initiates 23-bp downstream from the 5' B g l l l end of the 4.2-kb segment. N-terminal amino acid sequence analysis of purified pyrocatechase I I , isolated from E. coli cells harboring the cloned 4.2-kb Segment under the tac promoter, agreed with the predicted amino acid

304

Acta Biotechnol. 9 (1989) 4

sequence from the deoxyribonucleotide sequence, and the total amino acid composition of the purified protein agreed with that predicted from the DNA [8]. Thus this ORF was designated as the clcA gene. The termination codon for clcA at base 1182 overlaps the initiation codon of a second major ORF, which by agreement with N-terminal amino acid sequence analysis and the total amino acid composition of the purified protein has been designated as the clcB gene, encoding cycloisomerase II. A third major ORF follows clcB, with possible initiation codons at bases 2320 and 2464, but no polypeptide for this ORF has been detected in E. coli maxicells, nor has any enzyme function been identified. The N-terminal amino acid sequence of the translated fourth ORF matched the N-terminal sequence of purified hydrolase I I from Pseudomonas sp. B13, and this ORF has therefore been designated as the clcD gene [8]. The clcABD gene cluster behaves typically as an operon. There is a single promoter for all three genes and no known transcription termination signals in between the genes. In addition when the operon is placed downstream of the tac promoter, in the broad host range plasmid pMMB22, the clcABD gene cluster directs the synthesis of all three enzymes in both E. coli and in P. putida only on induction with isopropyl-/?-D-thiogalactoside. This suggests that the cluster is regulated as a single unit under the control of a single promoter. The promoter appears to be under positive control, since the 4.2-kb Bglll fragment allows slow growth on 3Cba only upon amplification in the absence of the activator gene [16]. Similar amplification of the corresponding pWRl plasmid DNA fragment, is observed when Psevdomonas sp. B13 cells are grown on 3Cba [17]. Little information is available on the structure of Psevdomonas promoters. Psevdomonas degradative genes differ from E. coli in their promoter region as first shown by I N O U Y E et al. [18], who failed to find the E. coli consensus sequences at the —10 and —35 sites of the xylCAB operon involved in xylene and toluene degradation. The requirement for sequences located upstream of the —10 and —35 regions, for positively controlled plasmid-encoded degradative genes, has been observed [19]. These upstream regions often display a great deal of secondary Structure as shown for the xylCAB operon containing two palindromic AT-rich sequences [18]. A homologous region upstream from the nah and sal promoters is required for activation of transcription from both promoters [20, 21].'It has been shown that the nahR regulatory protein binds to this upstream sequence and in the presence of the inducer salicylate activates transcription. A similar mode of regulation is operative in the expression of the xyl (xylene/toluene) genes on the TOL plasmid [22]. Transcription of the clcABD operon, is also under positive control. The regulatory gene clcR appears to be divergently oriented on the opposite strand upstream of the clc structural genes. The nucleotide region directing the binding of the clcR protein, however, has not been defined. Recently, a number of Psevdomonas promoter regions have been sequenced and at least two different consensus sequences for P. putida have been proposed, as shown in Fig. 3 [23, 24, 25]. Promoter analysis by D E R E T I C et al. [24] has classified Psevdomonas genes under two major groups: those having sequence homology to the E. coli S70 recognition site (TTGACA-17 bp-TATAAT) and those having sequence homology to the E. coli 660 consensus (GG-10 bp-GC) sequence. Comparison of the DNA sequence 5' to the transcriptional initiation site of positively regulated operons hag revealed a third consensus sequence, as shown in Fig. 3. The clcABD promoter contains the consensus nucleotides proposed by D E R E T I C et al. [24] to be important for positive regulation. I t is interesting to note that a highly conserved adenine in the E. coli —10 region, which seems important for positively regulated E. coli promoters [26], is also conserved for positively regulated Psevdomonas promoters. Evidence in our laboratory concerning the catBC promoter, suggests the involvement of this adenine in Psevdomonas positively regu : lated promoters. In addition a number of other nucleotides in both the —10 and —35 region affects promoter strength (Aldrich et al., Mol. Gen. Genet., in press).

SANGODKAR, LT. M. X., ALDRICH, T. L. et al., Molecular Basis of Chloroaromatic Degradation

-40 clcABD nahA nahG

-30

+1

- 1 0

-20

ACCGCATGACACGCGAATCTTAGCATTCATGTTTGAAGCAC ATTGACAAATAAAAAGCACGCTCACCATCATCGCGAATAC TGTATTTATÇAATATTGTTTGCTÇCGTTATCGTTATTAACA

xylCAB

TCGGTATAAGÇAATGGCATGGCGGTTGCTAGCTATACGAGA

xylDEGF

ATGGOTATCTÇTAGAAAGGCCTACÇCCTTAGGCTTTATGCA

catBC

ATATTGGACGGCTATCAGGGTCTCGCGCAATCCTTGAACAA

algD

ACGGCCGGAAÇTTCCCTCGCAGAGAAAAÇATCCTATCACCG

toxA

CTTCCGCTCCÇCGCCAGCCTCCCCGCATÇCCGCACCCTAGA

E. cóli consensus

305

*

TATAAT

TTGAÇA

A

E. coli PRCS P. pulida consensus P. putida consensus Pseudomonas PRCS

A-AGGC-T

T

GCAATA

A

AA-AAATGGTAAATAT C

T A

T

A

Fig. 3. Comparison of the promoter for the clcABD operon with other positively regulated prokaryotic promoters. Underlined nucleotides are common to four or more of the promoter sequences shown including the clcABD sequence. The E. coli consensus sequence, positively regulated conserved sequences for E. coli [26], two consensus sequences for P. putida [23, 25] and the proposed positively regulated consensus sequence for Pseudomonas [24] are shown. The asterisk indicates an adenine conserved in most of the promoters analyzed

Genetic Basis of 2,4-D Biodégradation Phenoxy alkanoic acids such as 2,4-D and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) have been among the most widely used herbicides. A number of reports have provided information on the degradation of 2,4-D [4, 5, 6, 27, 28], whereas literature on microbial degradation of 2,4,5-T is rather sparse due to lack of systems available for study until recently. Intermediates in the degradation of 2,4-D degradation by Pseudomonas sp. and a number of enzymes involved in the degradation of 3,5-dichlorocatechol have long been established [27]. The pathway for 2,4-D degradation by Pseudomonas sp. appears to be similar to the Arthrobacter sp. pathway except for the presence of a few additional metabolic products [29, 30]. In Aspergillus niger, however, the degradation of 2,4-D occurs through dechlorination prior to ring cleavage [31]. Plasmid involvement in the degradation of 2,4-D was first described by P E M B E R T O N and F I S H E R [28]. Subsequently, 2,4-D degrading transmissible plasmids were found among many naturally occurring soil bacteria [32]. Plasmids pJP2 and pJP4 belong to the incP3 and incPl incompatibility groups, respectively, and both plasmids are self transmissible. A complete physical map of p J P 4 has been established and some of the catabolic genes have also been mapped by transposon mutagenesis [33, 39]. Degradation of 2,4-D in Alcdligenes eutrophus JMP134 is initiated by a monooxygenase which catalyses cleavage of the ether-linked sidechain [34, 35, 36] and the resulting 2,4-dichlorophenol is hydroxylated to 3,5-dichlorocatechol [37, 38]. Subsequent catabolism of 3,5-dichlorocatechol is effected by three additional enzymes encoded by plasmid pJP4, with activities isofunctional to those of pyrocatechase I I , cycloisomerase I I and hydrolase I I involved in degradation of 3Clc. These enzymes degrade the 3,5-dichlorocatechol derived from 2,4-D [6] (Fig. 4). Since

306

Acta Biotechnol. 9 (1989) 4 O.CH2COOH

OH

OH

|Ajr-Cl ifdA^ f ^ 0 1 tfdB^ HOys^-CI 2,4-D S ^ 2A . -DICHL0R0PHEH0L CI MONOOXYGENASE n CI CI HYDROXYLASE 3,5-Dichlorocctechol 2,4-Dichlorophenol 2,4-D 3,5 - DICHLOROCATECHOL1-2, - DO IXYGEN AS E

tfdC COOH

2,4-DichloroCOOH if cc cis.cis-muconate a X A tfdO L- rr 124,D -ICHLOROMUCONATE | CYCLOISOMERASE trons-2-Chlorodienelactone COOH

trans-CHLORODE l NE LACTONE ISOMERASE

tfdF cis-2-Chlorodiene- CK lactone

® CHLORODIENELACTONE HYDROLASE

Chloromaleylacetate

COOH CH2COOH

|}-Ketoadipate CHLOROMALEYL ACETATE REDUCTASE

Pig. 4. Proposed pathway for the degradation of 2,4-D by Alcaligenes eulraphus JMP134 (pJP4) [6, 34—40]. Enzymes shown in boxes are known to be encoded by plasmid pJP4 and appear to be isofunctional to the corresponding enzymes of 3Clc degradation. The gene designations are those described by DON et al. [6]

the chlorodienelactone hydrolase of strain JMP 134 fails to hydrolyse the iraras-2-chloro4-carboxymethylene butenolide (iraws-chlorodienelactone), sole product of cycloisomerization of 2,4-dichloromuconate, it has been suggested that a iraras-chlorodiene isomerase is required to form the readily hydrolysable cis isomeric lactone [6, 40]. Such an enzyme activity was recently described by S C H W I E N et al. [41] in Psevdomonas B13 where it plays no obvious role in the degradation of 3Cba. The presence of pJP4 allows host cells with chromosomally encoded benzoate oxygenases to utilize 3Cba, although the rate of such degradation is very low apparently due to regulatory constraints which must be overcome by genetic rearrangements before plasmid pJP4 can allow rapid growth on 3Cba [16]. As with the Clc pathway there is as yet no evidence to show that the terminal reductase step is plasmid-encoded. Evidence has been obtained for a regulatory gene (tfdR) exerting negative control on the synthesis of the 2,4-D monooxygenase (tfdA gene product) and other enzymes of the 2,4-D pathway coded by plasmid pJP4. This gene is deleted in spontaneous mutants

SANGODKAB,

U. M. X., ALDRICH,

T.

L. et al., Molecular Basis of Chloroaromatic Degradation 307

selected for their ability to grow with phenoxyacetic acid evidently so that constitutive expression of tfdA can catalyse formation of phenol from the noninducing growth substrate. ( H A B K E R , A., O L S E N , R . H . , and S E I D L E R , R . , personal communication.) Genetics of Degradation of 2,4,5-T in Pseudomonas

cepacia

AC1100

Unlike 2,4-D, 2,4,5-T is poorly biodegradable and persists for long periods in the environment. Pseudomonas cepacia AC1100 grows readily with 2,4,5-T, and was isolated after longterm selection in a chemostat in the presence of 2,4,5-T as the major source of carbon and energy [42, 43]. Because of its active role in depleting as much as 90% of 2,4,5-T from contaminated soils [44, 45], this strain might be useful for environmental studies involving the use of microorganisms for soil decontamination of this pollutant. Besides having acquired the ability to utilize both 2,4,5-T and 2,4,5-trichlorophenol (2,4,5-TCP) as carbon sources, P. cepacia AC1100 evidently has the capacity to completely dechlorinate a number of chlorophenols, including pentachlorophenol, without utilizing them as carbon sources [46,47]. Moreover, its degradative abilities have been selected for by in vivo rather than in vitro techniques. In an effort to identify and localize AC1100 genes associated with 2,4,5-T degradation, transposon insertion mutagenesis with Tn5 was used to generate mutants blocked in 2,4,5-T degradation [48]. Our present understanding of the 2,4,5-T degradative pathway is derived from the studies of one such mutant, P. c&pacia PT88, which was characterized further. When grown on glucose in presence of 2,4,5-T, PT88 accumulated a bright red compound in the medium. Extraction of culture supernatants, after dithionite reduction, yielded material which was analyzed by GC/MS after conversion to acetate derivatives. In addition to the expected acetate ester of 2,4,5-TCP, acetate derivatives of two other phenols were identified, namely, 2,5-dichlorohydroquinone (DCHQ) and 5-chloro-l,2,4-trihydroxybenzene or 5-chloro-2-hydroxyhydroquinone (CHQ). The compound responsible for the bright red color which has a ¿max 493 nm at neutral pH, is identified as 5-chloro-2-hydroxy-l,4-benzoquinone, an autoxidation product of CHQ [49] (Fig. 5). CHQ therefore appears to be a metabolite of 2,4,5-T arising by displacement of two of the chlorine substituents of 2,4,5-TCP by hydroxyl groups. Mutant PT88 evidently has a lesion in a gene or genes whose product is required for further metabolism of CHQ. Since such a mutation makes the cells phenotypically 2,4,5-T - , it is clear that CHQ must be an obligatory intermediate of 2,4,5-T degradation. PT88 has proved useful in our studies of the genes encoding12,4,5-T degradation. By mobilizing a cosmid-clone bank of the AC1100 genome into mutant PT88 (CHQ - ) we isolated a hybrid cosmid, pUSl, carrying a 25 kb insert, which complemented the mutation to 2,4,5-T + (CHQ+). The 25 kb insert originated from the chromosomal and not plasmid DNA of AC1100. In strain PT88, carrying pUSl, the 2,4,5-T+ phenotype was restored by providing a functional gene(s), which we designate as chq. This segment harbors the gene(s) for the metabolism of CHQ [50]. The specific region of DNA required for restoration of the CHQ + phenotype was mapped and further defined to a 4.3 kb segment. A 290 bp fragment encoding putative regulatory sequences of the chq gene was also located [51]. Plasmid pUS1029 carries the cloned 4.3 kb fragment (Fig. 5). Further genetic analysis is being directed towards defining the specific gene or genes i.e. chqA, chqB, etc., on this segment. At this stage we do not know what particular function or functions must be provided to complement the defect in CHQ metabolism in PT88. We have, however, detected more than one polypeptide encoded-by this fragment [unpublished results] and are currently investigating whether all the chq genes are under the control of a single promoter, as found in our earlier studies of the chlorocatechol pathway [8].

308

Acta Biotechnol. 9 (1989) 4 chq GENE(S)| %iRRR

|

IRI H R

R

5Kb

|

iRft |

pUS1 •-..

u 1 uH H H' X X H '"•••• fliLi

pUS1029 C C Bg

Xh P P

chq 0-CH2-C00H OH

OH

t

Ct

J^yJ CI 1 It S-T 1

J^fmetabolii]^ f^f^™ "»tabolizin^ enzymes Q^y-^ enzymes ^ CI OH 2 i 5-TCP CHQ M (COLORLESS) 1 autooxidation T at pH 7.0

Jr

0 5-CHLORO-2-HYDROXY-1,4" BENZOQUINONE (RED) Fig. 5. Genetics of degradation of 2,4,5-T in AC1100. Broken arrows indicate unidentified conversions. Bold arrow indicates the nonenzymatic reaction occurring because of a block in CHQ metabolism in PT88. Hatched bars represent cloned AC1100 chromosomal DNA complementing PT88. Arrows in pUSl and pUS1029 show the direction of transcription of chq gene(s). Hyphenated bar in pUS1029 shows the deletion. The restriction sites are as follows: B, BamHI; Bg, Bglll; C, Clal; H, Hindlll; P, PstI; R, EcoRI; S, Sail; X, Xbal; Xh, Xhol

Instability oï 2,4,5-T Degradative Capability in AC1100 I t has been documented that AC1100 cells can spontaneously lose their 2,4,5-T degradative capability at high frequencies when grown in the absence of this compound [43]. I n soil treatment studies AC1100 cells with 2,4,5-T degradative capability rapidly disappeared from the soil samples once the 2,4,5-T levels diminished [44]. While not verified, it is reasonable to suggest that the instability of the 2,4,5-T degradative genes in AC1100 may have contributed significantly to this disappearance. Several mechanisms can be envisioned as potential causes for the instability of AC1100's 2,4,5-T degradative phenotype. One obvious possibility is that 2,4,5-T determinants are located on a plasmid that is lost through segregation. The chq gene, however, is on the chromosome. Other possibilities include legitimate or illegitimate recombination events related to the presence of repeated Sequences or transposable elements. A number of these sequences have been identified in other strains of P. cepacia such as strain 249 and it may be significant to note that this organism also appears to undergo spontaneous mutations at a high frequency [52]. I n view of the implications of instability of AC1100, for potential application in waste treatment processes as well as its possible relationship to the mechanism(s) by which

SANGODKAR, U. M. X., ALDRIOH, T. L. et al., Molecular Basis of Chloroaromatic Degradation

309

AC1100 may have originally acquired 2,4,5-T degradative ability, the genetic basis for spontaneous loss of 2,4,5-T degradative ability has been a subject of on-going investigation in our laboratories. A number of spontaneous mutants have been isolated by plating AC1100 colonies from nonselective media [53]. As summarized in Tab. 1, these mutants can be differentiated on the basis of their growth characteristics and metabolite accumulation in minimal medium containing 2,4,5-T plus glucose as well as by their ability to be complemented by a genomic library of wild type AC 1100 DNA sequences [54]. These observations suggest that multiple unlinked 2,4,5-T determinants may be independently susceptible to spontaneous mutational events in AC1100. Tab. 1. Characteristics of spontaneous 2,4,5-T - mutants of AC 1100 Mutant class1

Growth on 2,4,5-T + glucose

2,4,5-T Metabolite accumulation2

Complemented with AC1100 genomic library

A

+

+

B C AD AB AC BC

±

DCHQ CHQ 2,4,5-TCP Hone similar to class similar to class similar to class similar to class

1

2

+ +

± + +

—

A B C C

+ — — — —

The mutant classes, AB, AC and BC contain organisms that originally had the characteristics of class indicated by the first letter but later, apparently through additional mutational events, acquired the characteristics of the class indicated by the second letter. In each case, however, they were no longer complemented by the genomic library of wild type AC1100. Class AD describes spontaneous mutants derived from class A which retain the properties of that class but are no longer complemented DCHQ, 2,5-dichIorohydroquinone; CHQ, 5-chloro-l,2,4-trihydroxybenzene; 2,4,5-TCP, 2,4,5-trichlorophenol

Previous studies, on the other hand, have shown that AC1100 contains at least one highly repeated DNA sequence designated R S I 100 [48] and have provided nucleotide sequence evidence that this DNA has several properties common to insertion sequence elements [4, 55]. Recent experiments in our laboratories have demonstrated homology between R S I 100 and cosmid pUSl which complements the class A mutants. Homology to a second nonoverlapping cosmid that complements the as yet uncharacterized class C mutants is also observed. These results indicate that copies of R S I 100 are located in proximity to at least two unlinked 2,4,5-T determinants in the AC1100 genome. Studies are currently in progress to further localize these sequences with respect to the 2,4,5-T genes in these cosmids as well as to determine their possible role in causing spontaneous mutations.

Biodégradation of Chlorinated Biphenyls, Chlorophenols and Chlorobenzenes Polychlorinated biphenyls (PCBs) are known to be degraded in the environment by both weathering and microbial processes [56]. A number of workers have shown that PCBs can be decomposed by pure cultures of microorganisms and naturally occurring

310

Acta Biotechnol. 9 (1989) 4

microbial populations [57—61]. FURUKAWA et al. [62, 63] have reported the dissimilation of 33 pure isomers of chlorinated biphenyls to corresponding chlorobenzoic acids using a strainof Acinetobacter sp. Subsequently, the role of transmissible plasmids in the total mineralization of environmental pollutants such as mono- or dichlorobiphenyls was demonstrated by FURUKAWA and CHAKRABARTY [64]. They characterized a plasmid, p K F l , that allowed conversion of various chlorinated biphenyls to the corresponding chlorinated benzoic acids, however no further conversion could take place. By employing in vivo genetic transfer of chlorobenzoate degradative plasmid they demonstrated that the combined growth of bacterial strains harboring p K F l and pAC27 or pAC31 allowed total mineralization of 4-chloro- and 3,5-dichloro-biphenyl, which could not be accomplished by any of the parent strains [64]. The P. putida strain carrying pAC31 degraded 3,5-dichlorobenzoate (3,5Dcb), and was derived from a 4-chlorobenzoate (4Cba) utilizing strain carrying pAC27. Both strains harbored a region of the TOL plasmid in their chromosomes [7] (see later). A gene cluster encoding the catabolism of biphenyl and PCB was recently cloned from the chromosomal DNA of Pseudomonas pseudoalcaligenes KF707 [65]. The cloned DNA fragment contained at least three structural genes including bphA (encoding biphenyl dioxygenase), bphB (encoding dihydrodiol dehydrogenase) and bphC (encoding 2,3-dihydroxy-biphenyl dioxygenase [230HBP oxygenase]). 2 3 0 H B P oxygenase is a key enzyme of biphenyl and PCB catabolism. The nucleotide sequence of bphC is established and the gene product identified as having a molecular weight of 260,000 [66, 67]. Degradation of a broad and unusual spectrum of PCBs including many tetra- and pentachlorobiphenyls and several hexachlorobiphenyls by Alcaligenes eutrophus H850 [68, 69], and Pseudomonas strain LB400 [70] is being investigated [71]. Almost all the halophenols are toxic to biological systems and are mostly persistent. Few reports on microbial degradation of tri- and tetrachlorophenols are available [46, 72, 73]. The 2,4,5-T degrading P. cepacia AC1100 produces 2,4,5-TCP as an intermediate. Conversion of 2,4,5-T to 2,4,5-TCP is catalyzed by a constitutively expressed enzyme whereas the enzymes for the metabolism of 2,4,5-TCP are induced by 2,4,5-TCP itself [3, 47, 74]. Identification of CHQ as an intermediate of 2,4,5-TCP metabolism in strain AC1100 has been described earlier [49, 51] (Fig. 5). KARNS et al. [46] have demonstrated that AC1100 also dechlorinates a wide range of di-, tri- and most notably pentachlorophenol (PCP). Degradation of PCP has been described by many workers [ 7 2 — 8 3 ] . The PCP-degrading bacterial strain K C - 3 , isolated by CHTJ and KIRSCH [72], was found to degrade 2,3,4,6-tetrachlorophenol (2,3,4,6-TeCP), 2,3,5,6-TeCP, 2,3,5-TCP, 2,3,6-

TCP and 2,4,6-TCP without lag when cells were preincubated in presence of PCP [73]. The strain Bhodococcus cMorophenolicus PCP-1, isolated from a bioreactor, is capable of degrading several chlorophenols and chlorinated guaiacols besides utilizing PCP [ 8 4 — 8 6 ] . Although the complete dissimilatory pathway for PCP is not yet established, this bacterium must possess one or more different mechanisms to remove all five chlorines of PCP prior to ring cleavage since 1,2,4-trihydroxybenzene was detected as one of the intermediates along with trichlorohydroquinone [87, 88], Trichlorohydroquinone was also implicated in the metabolism of PCP by a Flavobacterium sp. [82]. The genetic aspects of degradation of PCP have not, yet been investigated in detail. However the ability of PCP-degrading strains to remove all chlorine substituents is indicative of a broad dechlorinating potential that could be exploited in construction of improved bacteria that could efficiently dechlorinate a wide range of chloroaromatics. Chlorobenzenes, another significant class of chloroaromatics, are widely used as solvents, degreasers, and intermediates in the synthesis of dyes and pesticides [89]. Biodegradative pathways of chlorobenzene [90], 1,2-dichlorobenzene [91], 1,3-dichlorobenzene [92], and 1,4-dichlorobenzene [93] have been studied using pure cultures of bacteria. The most common catabolic pathways for chlorobenzenes involve conversion of the parent mole-

SANGODKAR,

U. M. X.,

ALDRICH,

T. L. et al., Molecular Basis of Chloroaromatic Degradation

311

cules to chlorocatechols initiated by the action of a dioxygenase [90, 91]. Development of novel strains having chlorobenzene degrading ability has also been the focus of attention [94], Evolution of Degradative Capabilities of Bacteria Questions as to how microorganisms develop the ability to degrade synthetic chlorinated aromatic compounds such as chlorobenzoates, chlorophenols, and chlorinated phenoxyacetates and how these abilities are spread through microbial populations are still open. Several "models have been postulated for microbial evolution of genes coding for the ability to degrade aromatic compounds. One of these models involves gene duplication followed by divergence. Evidence for this mechanism has been presented for evolution of the nylB gene, involved in the degradation of nylon precursors [95]. Another model has been proposed to explain gene divergence which may allow the evolution of dissimilatory genes such as clcA and clcB genes [4] by repeated recombinational events between misaligned DNA segments [96]. Double crossovers in this model permit basepair substitutions with no significant alteration of the translational reading frame, thus allowing for more rapid and dramatic gene variations than could be caused by multiple point mutations. The module theory proposes evolution of complete degradative pathways by a sequential assembly of distinct steps involved [97]. Another way of acquiring a new phenotype is by deregulation and enhanced expression of a cryptic gene. In this case the parental strain possesses the appropriate genes but they are either not expressed, or expressed at an inadequate level. Genes may become cryptic in natural microbial populations as a result of the accumulation of deleterious mutations in the absence of any selective pressure to retain their activity. If a cryptic gene could be maintained in the genome, it might be brought into activity under new selective pressures. The significance of cryptic genes in microbial evolution has been reviewed earlier [98—100]. One important class of DNA elements involved in the evolution of novel degradative pathways are repeated sequences and transposable elements such as insertion sequences (IS). The RS-I and RS-II type of repeated sequences have been shown to be associated with genes encoding degradation of synthetic compounds like 6-aminohexanoic acid cyclic dimer [101]. Strains of P. cepacia utilize a greater number of organic compounds than any other pseudomonad studied. Recently it has been shown by L E S S I E and his coworkers that IS elements in P. cepacia strain 249 are involved in rearrangements of the DNA of the cryptic plasmid pTGLl [52, 102]. These investigators estimated that there are at least twelve different transposable elements in the P. cepacia genome. The rearrangements were shown to be due to transpositions, deletions and homologous recombinations of the IS elements contributing to the versatility of the pseudomonads. Additionally, S C O R D I L I S et al. [103] have discovered that five transposable elements in P. cepacia can activate expression of the /?-lactamase gene of the broad host range plasmid pRPl. Construction of Strains with Broader Biodegradative Potentials In vivo manipulation of bacteria has led to many interesting results. In our laboratory the transfer of pJP2 and pJP4 to a 2,4,5-T degrading and nalidixic acid-resistant mutant of P. cepacia AC1100 resulted in the construction of new strains IY43 and IY25, capable of utilizing both 2,4-D and 2,4,5-T as growth substrates [104]. AC1100 itself was developed after prolonged enrichment in a chemostat containing mixed cultures

312

Acta Biotechnol. 9 (1989) 4

which harbored a variety of degradative plasmids [43]. Pseudomonas sp. strain B13 [105] is another strain that can transfer the chlorocatechol degradative genes to many other Pseudomonas strains since the genes allowing degradation of chlorocatechols are borne on the transmissible plasmidpWRl. However, this strain is incapable of utilizing 4Cba or 3,5Dcb evidently because the chromosomally-encoded benzoate oxygenase lacks the appropriate breadth of specificity. R E I N E K E and KNACKMUSS [106] and HARTMANN et al. [107] showed that it was possible to transfer the TOL plasmid to strain B13 and select, under continuous cultivation, variants of strain B13 that could use not only 4Cba but also 3,5Dcb as sole source of carbon and energy. These variants had acquired this ability at the expense of losing the TOL-encoded catechol 2,3-dioxygenase. CHATTERJ E E and CHAKRABARTY [7] followed the same procedure and isolated similar variants from their 3Cba+ P. putida strain AC858 harboring the plasmid pAC25. Growth of AC858 in a chemostat in the presence of cells harboring the TOL plasmid allowed emergence of cells that could also utilize 4Cba. Such 4Cba+ cells harbored plasmid pAC27 which resulted by deletion of a 11 kb fragment from pAC25. The cells showed transposition of a segment of the TOL plasmid onto their chromosome to provide the broader specificity of toluate dioxygenase. SCHWIEN and SCHMIDT [108] showed that transfer of chlorocatechol degradative genes from Pseudomonas sp B13 to Alcaligenes strain A7, which was capable of growing on phenol, allows the exconjugant A7-2 to utilize all three isomeric chlorophenols, substrates which are not utilized by either of the parents. Similar plasmid transfer to salicylate degrading Pseudomonas sp WR401 allowed exconjugant to grow on 3-, 4-, and 5-chlorosalicylate [105, 109]. This kind of gene transfer or hybrid construction has also led to the isolation of strains capable of degrading chloroanilines [110]. The construction of a mixed culture utilizing 4-chloro- and 3,5-dichlorobiphenyls has been previously mentioned [64]. KROCKEL and FOCHT [94] designed an experiment on the assumption that if two organisms together, but not separately, possess the catabolic enzymes for complete mineralization of a substrate, then it should be possible to construct a recombinant strain that will grow with that substrate as its sole carbon source. Using P. putida R5-3, able to grow on benzoate and toluene and P. alcaligenes C-0, able to utilize benzoate and 3Cba, in a three stage-chemostat, they isolated P. putida CB1-9 which was capable of growing on chlorobenzene and 1,4-dichlorobenzene. Although the genetic contribution of P. alcaligenes C-0 in the evolution of the resultant "recombinant" strain was not clearly defined, it was assumed to have emerged by a phenomenon called progenitive manifestation of a rare event. In vitro genetic engineering offers a very powerful means of accelerating the evolution of biological activities and has considerable potential for constructing microorganisms that can degrade environmental pollutants. For this purpose complete insight into the genetics of new degradative pathways and availability of the cloned genetic information specifying the enzymes involved in their degradation is essential. LEHRBACH et al. [ I L L ] cloned the xylD (now xylXYZ) and xylL genes of the TOL plasmid into Pseudomonas B13 and isolated strains utilizing 4Cba and 3,5Dcb. Cloning of nahG, the gene encoding salicylate hydroxylase, from plasmid NAH7 [112] and transfer of this gene into Psevdomonas B13 allowed this organism to completely mineralize three chlorosalicylate isomers [ 1 1 1 ] . In another application of in vitro recombination techniques the catabolic pathway for alkylbenzoates, specified by the TOL plasmid of Pseudomonas was restructured to produce a pathway capable of processing a new substrate, 4-ethylbenzoate [ 1 1 3 ] . ROJO et al. [ 1 1 4 ] have recently succeeded in combining critical enzymes from five different catabolic pathways of three distinct soil bacteria into a functional ortho cleavage route for degradation of methyl phenols and methyl benzoates. In this new bacterium the problems of having enzymes of both ortho and meta cleavage pathways present, were reconciled by developing alternative pathways for methyl- and chlorosubstituted intermediates, which were formed after ortho cleavage.

SANGODKAB,

U. M. X.,

ALDRIOH,

T. L. et al., Molecular Basis of Chloroaromatic Degradation

313

Concluding Remarks Dioxygenases play a major role in the oxidation of aromatic compounds. The key intermediates formed during the bacterial oxidation of many aromatic compounds are catechol or protocatechuate. Similarly, chlorine-substituted catechols appear to be crucial intermediates in the degradation of many chloroaromatic compounds which are metabolized by an analogous set of reactions carried out by the broad substrate specific enzymes, pyrocatechase I I and cycloisomerase i l . The genetic basis of chlorocatechol oxidation has been a subject of study in our laboratory. I t is interesting to note that the clc genes are clustered and are controlled by a single promoter. By transferring the clc genes into strains utilizing other aromatic compounds or by transferring appropriate genetic material into strains carrying the clc gene cluster, it is possible to construct strains that can mineralize a wider range of chloroaromatic compounds. Although chlorocatechols in general appear to be the key intermediates in the degradation of chloroaromatics, from the investigation of degradative pathways for PCP and 2,4,5-T, formation of hydroquinone type intermediates is apparent. I t appears therefore, that even though the clc gene products may have broad specificity there are limitations to the number and position of chlorine substituents accommodated by their catalytic action. Identification of hydroxyhydroquinone and CHQ as intermediates during the degradation of PCP and 2,4,5-T respectively, suggests that natural microorganisms have evolved the capability to remove chlorine atoms from the multichlorinated aromatic molecules without having to cleave the ring. Such removal can lead to introduction of extra hydroxy] groups. Molecular genetic approaches for the analysis and manipulation of degradative genes have been utilized at an ever-increasing rate in recent years. Indeed, it is possible to construct strains with novel hybrid pathways through a patchwork assembly of different pathway segments recruited from different microbes. In this context the availability of cloned chlorohydroxyhydroquinone metabolizing genes appear^ promising. One might envisage the use of these genes, in a manner similar to those from the clc cluster, without the necessity of evolving degradative enzymes for the cleavage of the aromatic ring, to bring about the mineralization of polychlorinated aromatic compounds. Also, in view of the capabilities of P. cepacia AC1100 to effect dechlorination of a number of chloroaromatic compounds, its genetic material has obvious utility in further attempts to assemble complete degradative pathways for the dissimilation of such recalcitrant compounds. Acknowledgements This work was supported by Public Health Service Grant ES 04050-3 from the National Institute of Environment Health Sciences and by Cooperative Agreement, CR 812911-01 from the U.S. Environmental Protection Agency, Office of Research and Development awarded to AMC and partly by U . S . EPA grant CR 812660 to PJC. Drs. H. PRITCHARD and P. R. SFERRA are project Officers. Received October 13, 1988

References CHAKRABARTY, A. M.: In "Biodégradation and Detoxification of Environmental Pollutants" (Ed. A. M. CHAKRABARTY), C R C Press, Boca Raton, Florida, 1982, 127. [2] STJIDA, J. P., D E B E R N A R D I S , J. F.: Lloydia 36 (1973), 107.

[1]

324

Acta Biotechnol. 9 (1989) 4-,

[ 3 ] GHOSAL, D . , YOTJ, I.-S., CHATTERJEE, D . K . , CHAKRABARTY, A . M . : Science 2 2 8 ( 1 9 8 5 ) , 1 3 5 . [ 4 ] FRANTZ, B . , ALDRICH, T . , CHAKRABARTY, A. M . : Biotechnol. Adv. 5 ( 1 9 8 7 ) , 8 5 . [ 5 ] R E I N E K E , W . : I n "Microbial Degradation of Organic Compounds" (Ed. D. T . GIBSON),

Marcel Dekker, New York, 1984, 319. J . , KNACKMUSS,

[ 6 ] D O N , R . H . , WEIGHTMAN, A . 85. '

Bacteriol.

H . - J . , TIMMIS, K . N . : J .

161 (1985),

[7] CHATTERJEE, D . K . , CHAKRABARTY, A . M. : Mol. G e n . G e n e t . 1 8 8 (1982), 279. [ 8 ] FRANTZ, B . , CHAKRABARTY, A. M . : [9] ORNSTON, L . N . , Y E N , W . - K . : In [10]

Proc. Natl. Acad. Sei. U.S.A. 8 4 ( 1 9 8 7 ) , 4 4 6 0 . "Biodegradation and Detoxification of Environmental Pollutants" (Ed. A. M. CHAKRABARTY), CRC Press, Boca Raton, 1982, 105. CHATTERJEE, D . K . , KELLOGG, S . T . , HAMADA, S . , CHAKRABARTY, A . M . : J . Bacteriol. 1 4 6

(1981), 639. [ 1 1 ] R E I N E K E , W . , KNACKMUSS, H . - J . : J . Bacteriol. 1 4 2 ( 1 9 8 0 ) , 4 7 6 . [12] WEISSHAAR, M.-P., F R A N K L I N , F . C. H., R E I N E K E , W . : J . Bacteriol. [ 1 3 ] SCHMIDT, E . , KNACKMUSS, H . - J . : Biochem. J . 1 9 2 ( 1 9 8 0 ) , 3 3 9 . [ 1 4 ] N G A I , K . - L . , SCHLOMANN, M . , KNACKMUSS, H . - J . , ORNSTON, L . N . : J . 699. [ 1 5 ] FRANTZ, B . , N G A I , K . - L . , CHATTERJEE, D . K . ,

169 (1987), 394. Bacteriol.

169 (1987),

ORNSTON, L . N . , CHAKRABARTY,

A.M.:

J . Bacteriol. 169 (1987), 704. [16]

GHOSAL, D . , Y O U , I . - S . , CHATTERJEE, D. K , , CHAKRABARTY, A. M . : Proc. Natl. Acad. Sei. U.S.A. 82 (1985), 1638. [ 1 7 ] RANGNEKAR, V . : J . Bacteriol. 1 7 0 ( 1 9 8 8 ) , 1 9 0 7 . [18] I N O U Y E , S., E B I N A , Y., NAKAZAWA, A., NAKAZAWA, T . : Proc. Natl. Acad. Sei. U.S.A. 81 (1984), 1688. [19] FRANTZ, B., CHAKRABARTY, A. M.: I n "The Bacteria: The Biology of Pseudomonas" (Ed. J . R. SOKATCH), Vol. 10, Academic Press, New York, 1986, 295. [20] SCHELL, M. A.: Proc. Natl. Acad. Sei. U.S.A. 83 (1986), 369.

[21] SCHELL, M. A., WENDER, P . E . : J . Bacteriol. 166 (1986), 9.

[22] INOUYE, S., NAKAZAWA, A., NAKAZAWA, T.: Proc. Natl. Acad. Sei. U.S.A. 84 (1987), 5182. [ 2 3 ] MERMOD, N . , LEHRBACH, P . R . , R E I N E K E , W . , TIMMIS, K . N . : E M B O J . 3 ( 1 9 8 4 ) , 2 4 6 1 .

[24] DERETÏC, V., GILL, J . F . , CHAKRABARTY, A. M . : B i o / T e c h n o l o g y 5 (1987), 469. [ 2 5 ] I N O U Y E , S . , ASAI, Y . , NAKAZAWA, A . , NAKAZAWA, T . : J .

Bacteriol.

166 (1986), 739.

[26] RAIBAUD, 0 . , SCHWARTZ, M . : A n n . R e v . G e n e t . 78 (1984), 173. [27] EVANS, W.C.,SMITH, B . S . W . , FERNLEY, H . N . , DAVIES, J . I . : B i o c h e m . J . 122 (1971), 543. [ 2 8 ] PEMBERTON, J . M . , F I S H E R , P . R . : Nature (London) 2 6 8 (1977), 732. [ 2 9 ] SHARPEE, K . W . , D U X B U R Y , J . M., ALEXANDER, M.: Appl. Microbiol. 2 6 ( 1 9 7 3 ) , 4 4 5 .

[30] TIEDJE, J . M., DUXBURY, J . M., ALEXANDER, M., DAWSON, E . : J . Agric. F o o d C h e m . 17

(1969), 1021. [ 3 1 ] S H A I L U B H A I , ' K . , SAHASRABUDHE, S . R . , VORA, K . A . , M O D I , V . V . : F E M S 18 (1983), 279. [ 3 2 ] D O N , R . H . , PEMBERTON, J . M . : J . Bacteriol. 1 4 6 ( 1 9 8 1 ) , 6 8 1 .

Microbiol. Lett.

[33] WEIGHTMAN, A . J . , DON, R . H . , LEHRBACH, P . R . , TIMMIS, K . N . : I n " G e n e t i c C o n t r o l of

Environmental Pollutants" (Eds. G. S. York, 1984, 47.

OMENN

and A.

HOLLAENDER)

Plenum Press, New

[34] GAMAR, Y . , GAUNT, J . K . : B i o c h e m . J . 122 (1971), 527. [35] [36] [37] [38]

T I E D J E , J . M . , ALEXANDER, M . : J . Agric. Food Chem. 1 7 ( 1 9 6 9 ) , 1 0 8 0 . STREBER, W . R . , TIMMIS, K . N . , Z E N K , M . H . : J . Bacteriol. 1 6 9 ( 1 9 8 7 ) , 2 9 5 0 . L I U , T . , CHAPMAN, P . J . ; F E B S Lett 1 7 3 ( 1 9 8 4 ) , 3 1 4 . B E A D L E , T. A., SMITH, A. R. W . ; Eur. J . Biochem. 3 5 ( 1 9 7 3 ) , 3 8 6 .

[39] CHAUDHRY, G. R., HUANG, G. H . : J . Bacteriol. 170 (1988), 3897. [40] P I E P E R , D. M., R E I N E K E , W., E N G E S S E R , K . - H . , KNACKMUSS, H . - J . : Arch. Microbiol. 150 (1988), 95. [ 4 1 ] SCHWIEN, U . , SCHMIDT, E . , KNACKMUSS, H . - J . , R E I N E K E , W . : Arch. Microbiol. 1 5 0 ( 1 9 8 8 ) , 7 8 . [ 4 2 ] CHAKRABARTY, A . M., K A R N S , J . S . , K I L B A N E , J . J., CHATTERJEE, D . K . : I n "Genetic Manipulation: Impact on Man and Society" (Eds. W. A R B E R , K . ILLMENSEE, W. J . P E A COCK, P. STARLINGER), Cambridge Univ. Press, Cambridge, 1984, 43. [ 4 3 ] K I L B A N E , J . J . , CHATTERJEE, D . K . , K A R N S , J . S . , K E L L O G G , S . T . , CHAKRABARTY, A . M . :

Appl. Environ. Microbiol. 44 (1982), 72.

SANGODKAR,

[44]

U. M. X., A L D R I C H , T. L. et al., Molecular Basis of Chloioaromatic Degradation

CHATTERJEE,

(1982), 514.

D. K., Kir,BANE, J. J.,

CHAKRABARTY,

[ 4 5 ] K I L B A N E , J . J . , CHATTERJEE, D . K . , CHAKRABARTY,

315

A. M. : Appi. Environ. Microbiol. 44 A. M. : Appi. Environ. Microbiol.

45

(1983), 1697.

[46] [47] [48]

[49] [50]

[51] [52]

J . S . , K I L B A N E , J . J., D U T T A G U P T A , S . , C H A K R A B A R T Y , A. M. : Appi. Environ. Microbiol. 46 (1983), 1176. K A R N S , J . S., K I L B A N E , J . J., C H A T T E R J E E , D. K., C H A K R A B A R T Y , A. M. : In "Genetic Control of Environmental Pollutants" (Eds. G . S . O M E N N , A . H O L L A E N D E R ) , Plenum Press, New York, 1984, 3. T O M A S E K , P., F R A N T Z , B., C H A T T E R J E E , D. K . , C H A K R A B A R T Y , A. M. : In "Biotechnology for Solving Agricultural Problems" (Eds. P. C . A U G U S T I N E , H. D . D A N P O R T H , M. R. B A K S T ) , Martinus Nijhoff Publishers, Dordrecht, Netherlands, 1986, 355. C H A P M A N , P. J., S A N G O D K A R , U . M. X., C H A K R A B A R T Y , A.M.: Abstr. Ann. Mtg. Soc. Environ. Toxicol. Chem. Florida, 1987, 127. S A N G O D K A R , U . M. X . , C H A K R A B A R T Y , A. M. : Abstr. Ann. Mtg. Amer. Soc. Microbiol. Miami, 1988, 207. S A N G O D K A R , U . M. X . , C H A P M A N , P. J., C H A K R A B A R T Y , A . M. : Gene 71 (1988), 267. G A F F N E Y , T. D., L E S S I E , T. G . : J . Bacteriol. 169 (1987), 224. KARNS,

[ 5 3 ] HAUGLAND, R . A . , SANGODKAR, U . M . X . , CHAKRABARTY, A . M . , TOMASEK, P . H . , SFERRA,

P. R. : In "Land Disposal, Remedial Action, Incineration and Treatment of Hazardous Waste", EPA/600/9-87-015, U.S. Environmental Protection Agency, Washington, D.C. 1987, 388. [ 5 4 ] SANGODKAR,

U. M. X.,

CHAPMAN,

P. J.,

HAUGLAND,

R . A.,

CHAKRABARTY,

A.M.:

In

"Environmental Biotechnology: Reducing Risks from Environmental Chemicals Through Biotechnology" (Ed. G . S . O M E N N ) , Vol. 45, Plenum Press, New York, 1987, 461. [ 5 5 ] TOMASEK, P . H . , FRANTZ, B . , SANGODKAR, U . M . X . , A. M.:

[56] [57]

[58] [59] [60]

[61] [62] [63] [64]

[65] [66] [67]

Gene

[70] [71] [72]

[73] [74]

CHAKRABARTY,

K.: In "Biodegradation and Detoxification of Environmental Pollutants" (Ed. A. M. C H A K R A B A R T Y ) , CRC Press, Boca Raton, Florida, 1982, 33. A H M E D , M., F O C H T , D . D . : Can. J . Microbiol. 1 9 ( 1 9 7 3 ) 4 7 . C L A R K , R. R., C H I A N , E. S. K., G R I F F I N , R. A.: Appi. Environ. Microbiol. 37 (1979), 680. M A S S E , R . , M E S S I E R , F . , P E L O Q U I N , L . , A Y O T T E , C . , S Y L V E S T R E , M.: Appi. Environ. Microbiol. 47 ( 1 9 8 4 ) 9 4 7 . F U R U K A W A , K . , M A T S U M U R A , F . : J . Agric. Food Chem. 2 4 ( 1 9 7 6 ) , 2 5 1 . T U C K E R , E. S 1 ., S A E G E R , V. W., H I C K S , O.: Bull. Environ. Contam. Toxicol. 14 (1975), 705. F U R U K A W A , K., T O N O M U R A , K., K A M I B A Y A S H I , K.: Appi. Environ. Microbiol. 35 (1978), 223. F U R U K A W A , K . , T O M I Z U K A , N., K A M I B A Y A S H I , A.: Appi. Environ. Microbiol. 38 (1979), 301. F U R U K A W A , K., C H A K R A B A R T Y , A. M.: Appi. Environ. Microbiol. 4 4 ( 1 9 8 2 ) , 6 1 9 . F U R U K A W A , K., M I Y A Z A K I , T.: J. Bacteriol. 166 (1986), 392. F U R U K A W A , K., A R I M U R A , N., M I Y A Z A K I , T.: J . Bacteriol. 169 (1987), 427. F U R U K A W A , K., A R I M U R A , N.: J . Bacteriol. 169 (1987), 924.

FURUKAWA,

[68] BEDARD,

[69]

HAUGLAND, R . A . ,

7 6 (1989), 227.

D . L.,

WAGNER,

R. E.,

BRENNAN, M . J . ,

HABERL, M. L.,

BROWN, J . F . ,

Jr.:

Appi. Environ. Microbiol. 63 (1987), 1094. B E D A R D , D. L., H A B E R L , M. L., M A Y R. J., B R E N N A N , M. J . : Appi. Environ. Microbiol. 53 (1987), 1103. B O P P , L. H.: J. Ind. Microbiol. 1 (1986), 23. S I N G H , S . , H I G S O N , F. K., N A D I M , L. M., G I B S O N , D. T.: Proc. Ann. Res. Symp. Treatment of Hazardous Waste. U.S. EPA, Cincinnati, 1988. C H U , J . I . , K I R S C H , E. J . : Appi. Microbiol. 2 3 ( 1 9 7 2 ) , 1 0 3 3 . C H U , J . I., K I R S C H , E. J.: Dev. Ind. Microbiol. 14 (1973), 264. K A R N S , J . S., D U T T A G U P T A , S . , C H A K R A B A R T Y , A. M. : Appi. Environ. Microbiol. 4 6 ( 1 9 8 3 ) , 1182.

[75]

H A K U L I N E N , R., S A L K I N O J A - S A L O N E N , M. S . , S A X E L I N , M.-L.: Proc. Ass. Pulp Paper Ind., Environ. Conf., TAPPI Press, Atlanta, 1981, 197. [76] M U R T H Y , N. B. K . , K A U F M A N , D. D., F R I E S , G. F . : Environ. Sci. Health B 1 4 (1979), 1 . [77] Moos, L. P., K I R S C H , E. J., W U K A S C H , R. F., G R A D Y , C. P. L.: Water Res. 17 (1983), 1575. [78] S U Z U K I , T.: J . Environ. Sci. Health B 12 (1977), 113. 2

Acta Bioteohnol. 9 (1989) 4

Acta Biotechnol. 9 (1989) 4

316 [79] [80] [81] [82] [83]

WATANABE, I.: Soil Sci. Plant Nutr. 19 (1973), 109. WATANABE, I. : Soil Biol. Biochem. 9 (1977), 99. STANLAKE, G. J., F I N N , R. K.: Appi. Environ. Microbiol. 44 (1982), 1421. STEIERT, J . G . , CRAWFORD, R. L.: Biochem. Biophys. Res. Commun. 141 (1986), S T E I E R T , J . G . , PIGNATELLO, J . J., CRAWFORD, R. L. : Appi. Environ. Microbiol.

907.

825. 53 (1987),

[ 8 4 ] APAJALAHTI, J . H . A . , K A R P A N O J A , P . , SALKINOJA-SALONEN, M . S . : Int. J . Syst. Bact. 3 6 (1986), 246. [ 8 5 ] HAGGBLOM, M., APAJALAHTI, J . H . A . , SALKINOJA-SALONEN, M. S . : Appi. Microbiol. Biotechnol. 2 4 ( 1 9 8 5 ) , 3 9 7 . [86] APAJALAHTI, J . H.A., SALKINOJA-SALONEN, M. S . : Appi. Microbiol. Biotechnol. 25 (1986),

62.

[87] [88]

APAJALAHTI, J . H. A . , SALKINOJA-SALONEN, M. S . : J . Bacterid. 169 (1987), 675. APAJALAHTI, J . H. A . , SALKINOJA-SALONEN, M. S.: J . Bacteriol. 169 (1987), 5125. [89] HARRIS, J . , COONS, S., BYRNE, M . , FIKSEL, J . , GOYER, M . , WAGNER, J . , WOOD, M . : A n Exposure and Risk Assessment for Dichlorobenzenes. EPA 4 4 0 / 4 - 8 1 - 0 1 9 . Office of Water

Regulations and Standards, U.S. Environmental Protection Agency, Washington, D.C.

[ 9 0 ] R E I N E K E , W . , KNACKMUSS, H . - J . : Appi. Environ. Microbiol. 4 7 ( 1 9 8 4 ) , 3 9 5 . [91] H A I G L E R , B. E., N I S H I N O , S . P., SPAIN, J . C.: Appi. Environ. Microbiol. 54 (1988) 294. [ 9 2 ] D E B O N T , J . M. A., VORAGE, M. J . A. W . , HARTMANS, S . , VAN DEN T W E E L , W . J . J . : Appi. Environ. Microbiol. 52 ( 1 9 8 6 ) 6 7 7 .

[93] [94] [95] [96] [97] [98]

SPAIN, J . C., N I S H I N O , S . F.: Appi. Environ. Microbiol. 53 (1987) 1010. K R O C K E L , L., FOCHT, D. D.: Appi. Environ. Microbiol. 53 (1987) 2470. NEGORO, S., NAKAMUBA, S., OKADA, H . : J . Bacteriol. 1 5 8 ( 1 9 8 4 ) 4 1 9 . ORNSTON, L . N., Y E H , W . - K . : Proc. Natl. Acad. Sci. U.S.A. 76 ( 1 9 7 9 ) 3 9 9 6 . F R A N K L I N , F . C . H . , BAGDASARIAN, M . , BAGDASABIAN, M . M . , TIMMIS, K . N. : Acad. Sci. U.S.A. 7 8 ( 1 9 8 1 ) 7 4 5 8 . H A L L , B. G . : In "Microorganisms as Model Systems for Studying Evolution" MORTLOCK), Plenum Press, New York, 1 9 8 4 , 1 6 5 .

Proc. Natl. (Ed. R. P.

[99] Li, W.-H. : Mol. Biol. Evol. 1 (1984) 212. [100] CLARKE, P. H. : In "The Bacteria : The Biology of Pseudomonas" (Ed. J . R. SOKATCH), " Vol. 10, Academic Press, New York, 1986, 71. [101] NEGORO, S., TANIGUCHI, T . , KANAOKA, M., K I M U R A , H., OKADA, H. : J . Bacteriol. 155 (1983), 22.

[102] [103] [104]

L E S S I E , T. G . , G A F F N E Y , T.: In "The Bacteria: The Biology of Pseudomonas" (Ed. J . R . SOKATCH), Vol. 10, Academic Press, New York, 1986, 439. SCORDILIS, G . E., R E E , H., L E S S I E , T. G.: J . Bacteriol. 169 (1987), 8. GHOSAL, D., Yotr, I.-S., CHATTERJEE, D. K., CHAKBABARTY, A. M. : In "Plasmids in Bacteria" (Eds. D . R . H E L I N S K I , S. N. COHEN, D . B . CLEWELL, D . A. JACKSON, A. H O L L A E N -

DER), Plenum Press, New York, 1985, 667.

[ 1 0 5 ] R E I N E K E , W . , W E S S E L S , S . W . , R U B I O , M . A . , LATORBE, J . , SCHWIEN, U . , SCHMIDT, E . , SCHLOMANN, M., KNACKMUSS, H.-J.: FEMS Microbiol. Lett. 1 4 ( 1 9 8 2 ) , 2 9 1 . [106] R E I N E K E , W . , KNACKMUSS, H.-J.: Nature (London) 2 7 7 (1979), 3 8 5 . [ 1 0 7 ] HARTMANN, J . , R E I N E K E , W . , KNACKMUSS, H . - J . : Appi. Environ. Microbiol. 8 7 ( 1 9 7 9 ) , 4 2 1 . [108] SCHWIEN, U., SCHMIDT, E. : Appi. Environ. Microbiol. 44 (1982), 33. [ 1 0 9 ] R U B I O , M. A . , E N G E S S E B , K . - H . , KNACKMUSS, H . - J . : Arch. Microbiol. 1 4 5 ( 1 9 8 6 ) , 1 1 6 . [ 1 1 0 ] K I L B A N E , J . J . , CHAKRABARTY, A . M . : In "Genetic Control of Environmental Pollutants" (Eds. G. S . OMENN, A . H O L L A E N D E R ) , Plenum Press, New York, 1 9 8 4 , 3 7 3 . [ 1 1 1 ] LEHRBACH, P . R . , Z E Y E R , J., R E I N E K E , W . , KNACKMUSS, H.-J., TIMMIS, K . N . : J . Bacte-

[112]

riol. 158 (1984), 1025.

Y E N , K . - M . , GUNSALUS, I. C . : Proc. Natl. Acad. Sci. U.S.A. 79 ( 1 9 8 2 ) , 8 7 4 . [ 1 1 3 ] RAMOS, J . L . , WASSERFALLEN, A . , R O S E , K . , TIMMIS, K . N . : Science 235 ( 1 9 8 7 ) , 5 9 3 . [ 1 1 4 ] R O J O , F . , P I E P E R , D . H . , E N G E S S E R , K . - H . , KNACKMUSS, H . - J . , TIMMJS, K . N . : Science (1987), 1395.

238

Akademie-Verlag Berlin

Acta Biotechnol. 9 (1989) 4, 317—324

Biosynthesis of Protein by Microscopic Fungi in Solid State Fermentation. III. The Effect of Different Cultivation Methods and Various Media on Protein Biosynthesis by Aspergillus oryzae A. or. 11 CZAJKOWSKA, D . , ILNICKA-OLEJNICZAK,

0.

Institute of Fermentation Industry Department of Technical Microbiology and Biochemistry Rakowiecka 36,02532 Warszawa, Poland

Summary The effect of the culture method in solid medium and the influence of starch-containing raw materials on the yield of fungal protein biosynthesis were studied. Three procedures (laboratory bioreactor method, tray method and pile method) gave satisfactory results. Protein yields amounted to 5.0—5.9 g/100 g of starting medium d.m. upon utilization of 20.9—24.1 g carbohydrates. The procedure involving the use of a fermenter with a mixer afforded protein yields by about 50% lower as compared with the three above-mentioned procedures, and therefore it requires technical improvement. As a result of fungal culture using various starch-containing raw materials, the protein content in post-culture products increased by 46—88%, as compared with starting medium. The contents of 13 amino acids (including some exogenous ones which increased by 52 — 82%) in post-culture products substantially rose (by 34—63%). The post-culture products exhibited proteolytic activity (1260-3500 HU/g of d.m.). The kind of the source of starch evidently influenced protein biosynthesis. Media based on potatoes afforded the greatest increases in protein (5.8—5.9 g/100 g of starting medium d.m.), and those containing coarse rye meal and milling by-products — the smallest ones (4.5—4.6 g/100 g of starting medium d.m.). Introduction The two earlier papers of this series [1, 2] have informed about selection of Aspergillus strains for enrichment of starch-containing materials in protein, and about optimization of cultivation of the selected Aspergillus oryzae A. or. 11 strain for protein biosynthesis in solid state fermentation ( S S F ) . The present paper describes the effect of different cultivation methods and various media on protein biosynthesis. Materials and Methods Microorganism, Use was made of the strain Aspergillus oryzae A. or. 11 selected in preliminary studies [ i ] as being optimal for enrichment of starch-containing raw materials in protein. The inoculum was obtained after 10-day culture of this strain on solid inoculation medium 2*

Acta Biotechnol. 9 (1989) 4

318

(32% of wheat bran, 8% of dry beet pulp, moisture about 65%, pH about 6.5). The medium overgrown by the mycelium and spores was combined with a 0.1% Tween 80 solution (one part of medium and three parts of the Tween solution), whereupon it was thoroughly stirred. After decantation of the spore-containing liquid, the latter was used as inoculum (50 cm 3 of liquid per 1000 g of experimental medium, this corresponding to 1 —4 X 109 spores per 1000 g of this medium). Media The experimental media contained — in different proportions — potatoes (cut into chips and cooked), coarse rye meal, milling and groat-manufacture by-products, dry beet pulp and straw of various cereals (cut into pieces about 0.5 cm in length). Moisture content was between 55 and 65%. The media were sterilized for 45 min at 120°C. Inorganic salts and urea were without sterilization added to the media. Total nitrogen and total phosphorus were used in an amount of 2.1 and 0.8 g, respectively, per 100 g of starch-containing raw materials d.m. (NH 4 ) 2 S0 4 and urea (60 and 40%, respectively, of total nitrogen) were applied as nitrogen source. K H 2 P 0 4 was the source of phosphorus. Culture

Conditions

The strain Aspergillus oryzae A. or 11 was cultivated by the following four procedures: 1: Culture'in a laboratory bioreactor [3]. The thickness of the experimental medium layer in culture tube was about 12 cm, this corresponding to about 25 g of medium per tube. 2. Culture on perforated trays (surface of about 4 dm 2 each) located in an air-conditioned culture chamber (capacity of about 0.5 m 3 ). Air temperature and humidity were adjusted according to the growth phase of fungus. The fungus was cultivated in a thin (2.0—2.5 cm) layer of experimental medium. This culture method was also applied on a microtechnical scale, using perforated trays of an about 80 dm 2 surface 3. Culture in a cylindrical, glass fermenter (capacity of about 25 dm3) with a paddle mixer. The revolution rate of the mixer was about seven revolutions per minute. Atmospheric air was used to aerate the culture. The experimental medium + inoculum accounted for about 50% of the fermenter's capacity. Stirring of this mixture was started at the 12th h of culture, and was continued until completion of fungus cultivation. 4. Culture in a pile of experimental medium. Initial dimensions of the pile: breadth — 30 cm, length — 250 cm and thickness — 20 cm. No aeration was applied. When the temperature within the pile rose (14—16 h of culture), the medium was thoroughly mixed and scattered to form a thinner pile (about 4.0—4.5 cm thick). This two-step procedure prevented overheating of medium. In case of all four procedures it was attempted to maintain a temperature of 30—35 °C, being optimal for Aspergillus oryzae A. or. 11 growth. In the first and second procedure the culture was aerated with 160—180 dm 3 of air/h X 1000 g of experimental medium. In the third procedure a greater amount of air was introduced (370 dm 3 of air/h x 1000 g of medium) to prevent overheating of medium. In all procedures the duration of culture was 20—22 h. Analytical

Methods

For evaluation of the yield of protein biosynthesis the contents of protein and carbohydrates in experimental media d.m. and in post-culture products d.m. were measured.

CZAJKOWSKA, D . , ILNICKA-OLEJNICZAK, O.,

Solid State Fermentation

319

The following determinations were performed: — protein nitrogen was determined by K J E L D A H L ' S method, after previous removal of (NH 4 ) 2 S0 4 and urea by extraction with distilled water [2], — total carbohydrates (expressed as glucose) were assayed colorimetrically by the method using DNS, after 3-h acid hydrolysis of samples at 100 °C, — protein in vitro digestibility was estimated by the pepsin method, — cellulose was assayed by K U R S C H N E R - H O F F E R method [ 4 ] , — glucoamylase activity (GA) was determined by the NOVO method modified by K U J A W S K I [5], — the activity of proteolytic enzymes ( H U ) was estimated by ANSON'S method using hemoglobin as substrate [6], — amino acids present in the hydrolyzates obtained by acid hydrolysis of protein were determined by gas chromatography according to G E H R K E , as modified by KTTBACKA [7]. Results The Effect of the Cultivation Procedure in Solid Medium on Protein Biosynthesis In this set of experiments the medium contained coarse rye meal, dry beet pulp, (NH 4 ) 2 S04, urea and K H 2 P 0 4 . The moisture content of medium differed in dependence on the cultivation procedure used. In the first, second and fourth procedure the optimal moisture level of 6 0 — 6 5 % [2] was applied. In the third procedure on technical grounds it was necessary to lower the moisture content to 5 6 — 5 8 % ; namely, this thickening of medium as well as an addition of straw helped to prevent formation of big lumps. The first procedure afforded the highest protein yield — about 6.0 g/100 g of starting medium d.m., as compared with the second and fourth procedure, providing protein yields lower by about 10 and 15%, respectively (Tab. 1). This was due to partial drying Tab. 1. The effect of the culture method of Aspergillus oryzae A. or. 11 in solid medium on protein biosynthesis Culture method

Net protein yield [g/100 g of starting medium d.m.]

Utilization of total carbohydrates [g/100 g of starting medium d.m.]

Protein yield calculated as % against carbohydrates utilized

Enzymic activity [U/g of postculture products d.m.] HU

GA

1. Laboratory bioreactor

5.9

22.4

26.3

1230

24

2. Tray method

5.5

24.1

22.8

1180

18

3. Fermenter with a paddle mixer

2.5

12.2

20.7

1090

16

4. Pile method

5.0

20.9

23.9

1370

20

Medium for procedures 1, 2, 4: coarse rye meal - 80% dry beet pulp — 20% coarse rye meal - 75% dry beet pulp — 20% straw of various cereals - 5 % Moisture of medium: 62—64% (procedures 1, 2, 4); 56—58% (procedure 3) Medium for procedure 3 :

320

Acta Biotechnol. 9 (1989) 4

up of the top layer of medium, and even to overheating of its inner layer, especially in the fourth procedure. The high protein yields calculated as percentages against the carbohydrates used (22.8 to 26.3%), obtained by the first, second and fourth procedure, indicate that the second (tray) and fourth (pile) procedure could be applied for commercial production of protein. The third procedure (fermenter with paddle mixer) was inferior, since the protein yield was by more than 50% lower, as compared with the remaining procedures. Ineffective utilization of carbohydrates testified to slowing down of fungal growth, perhaps owing to an adverse effect of stirring and/or of other factors. I t may be that the use of a more perfect fermenter equipped with devices controlling all parameters of culture would increase its applicability for protein biosynthesis. As concerns the activities of glucoamylase and proteolytic enzymes, all four procedures afforded closely similar activity levels. The Effect of Starch-Containing Raw Materials on Protein

Biosynthesis

In these experiments the second (tray) procedure was applied on a microtechnical scale. Five experimental media were compared (Tab. 2). The five media differed only in the starch-containing raw materials, whereas the moisture level, pH, nitrogen and phosphorus levels were identical. The kind of the Source of starch evidently influenced the yield of protein biosynthesis. Although protein yields calculated as percentages against the carbohydrates utilized were much the same for all five media, the increase in protein resulting from fungal growth was dissimilar. Media based on potatoes afforded the greatest increases in protein (5.8—5.9 g/100 g of starting medium d.m.), and those containing coarse rye meal and milling by-products — the smallest ones (4.5—4.6/100 g of starting medium d.m.). The protein content of the starting experimental media remained within the range of 9.6—15.7% of d.m., whereas this content in the post-culture products was between 16.1-22.9% of d.m. Unfortunately, at the same time the content of cellulose in the post-culture products exceeded the initial one, because the fungal biomass contained about 20% of this carbohydrate and owing ot the strain's inability to degrade cellulose. The post-culture products displayed enzymic activities. As concerns the proteolytic activity, its level depended on the kind of medium; the medium containing groat-manufacture by-products and dry beet pulp afforded the highest proteolytic activity (about 3500 HU). Special precautions are not required to achieve air sterility during fungal culture in solid media. The rapidly growing Aspergillus oryzae strain prevented the development of bacteria and other fungi in case of cereal raw materials; only upon use of potatoes, sporadic bacterial infections occurred. The Effect of Starch-Containing Raw Material on the Amino Acid Composition of Protein of Post-Culture Products Comparison of the cumulative contents of 13 amino acids (Tab. 3) indicates that these contents in all post-culture products exceeded the level present in starting medium by 34—63%. As concerns the respective values for exogenous amino acids, they amounted to 5 2 - 8 2 % . The percentages of each amino acid in protein of fungal biomass obtained upon use of three experimental media were calculated (with consideration of the increase in protein yield) — (Fig. 1). The amino acid composition of fungal protein depended on the com-

CzAJKOWSKA, D., I l n i o k a - O l e j n i c z a k ,

O., S o l i d S t a t e

œ o o S 00 > O Js o f i

&

ce fH M fi

œ

c e «O i>

I

I

S Ì2

5 0

10 S -rt oo

a

œ

a

ft g j ft

s

t>

en œ t-i (N --H

© o ^ tao œ fi £ ' 3 h ä B i i S Q oq

ID I

I

O œ -d

3 0

1 a>

ft ¿S 'S

fi o

o Ph

S

O

o -g

. ^ ti 4) fc u O o 43 fe h o ® o ©

00

® m

o

i h T* 00 o o N N « J rt

00

o

IO

co i>

co »o en

oò IN

O en

I

fi

sq

(N

t> Ci O O 00

I

I

O IM IO

o ^

I

I

TS fi

Oí ÍO

io

IH

li

ft ti

o

œ .o**« 13 œ

I t l a

s ä

i - 3 g £ GG o

IO KS en « • H t ;

a t3

a

O

-d

05 Ji

s a

á

g

I

cS

I

h

fi §

»1-1

8 á

P § '—'"tí

D

O "S S 3 fcl O © PH H O

i3 O -g fi P V w CQ ' I O ft H

o

o 'S

n

=3

A

o «

13

"H >> ° ° 'S

oo »o

g