Modern Forensic Tools and Devices: Trends in Criminal Investigation [1 ed.] 1119760410, 9781119760412

Citation preview

Modern Forensic Tools and Devices

Scrivener Publishing 100 Cummings Center, Suite 541J Beverly, MA 01915-6106 Publishers at Scrivener Martin Scrivener ([email protected]) Phillip Carmical ([email protected])

Modern Forensic Tools and Devices Trends in Criminal Investigation

Edited by

Deepak Rawtani

School of Pharmacy, National Forensic Sciences University, Gandhinagar, India

and

Chaudhery Mustansar Hussain Department of Chemistry and Environmental Science, New Jersey Institute of Technology, Newark, USA

This edition first published 2023 by John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, USA and Scrivener Publishing LLC, 100 Cummings Center, Suite 541J, Beverly, MA 01915, USA © 2023 Scrivener Publishing LLC For more information about Scrivener publications please visit www.scrivenerpublishing.com. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, except as permitted by law. Advice on how to obtain permission to reuse material from this title is available at http://www.wiley.com/go/permissions. Wiley Global Headquarters 111 River Street, Hoboken, NJ 07030, USA For details of our global editorial offices, customer services, and more information about Wiley products visit us at www.wiley.com. Limit of Liability/Disclaimer of Warranty While the publisher and authors have used their best efforts in preparing this work, they make no rep­ resentations or warranties with respect to the accuracy or completeness of the contents of this work and specifically disclaim all warranties, including without limitation any implied warranties of merchant-­ ability or fitness for a particular purpose. No warranty may be created or extended by sales representa­ tives, written sales materials, or promotional statements for this work. The fact that an organization, website, or product is referred to in this work as a citation and/or potential source of further informa­ tion does not mean that the publisher and authors endorse the information or services the organiza­ tion, website, or product may provide or recommendations it may make. This work is sold with the understanding that the publisher is not engaged in rendering professional services. The advice and strategies contained herein may not be suitable for your situation. You should consult with a specialist where appropriate. Neither the publisher nor authors shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages. Further, readers should be aware that websites listed in this work may have changed or disappeared between when this work was written and when it is read. Library of Congress Cataloging-in-Publication Data ISBN 978-1-119-76041-2 Cover image: Pixabay.Com Cover design by Russell Richardson Set in size of 11pt and Minion Pro by Manila Typesetting Company, Makati, Philippines Printed in the USA 10 9 8 7 6 5 4 3 2 1

Contents Preface xix 1 Computer Forensics and Personal Digital Assistants Muhammad Qadeer, Chaudhery Ghazanfer Hussain and Chaudhery Mustansar Hussain 1.1 Introduction 1.1.1 Computer and Digital Forensics 1.2 Digital Forensics Classification 1.3 Digital Evidence 1.4 Information Used in Investigation to Find Digital Evidence 1.5 Short History of Digital/Computer Forensics 1.6 The World of Crimes 1.6.1 Cybercrimes vs. Traditional Crimes 1.7 Computer Forensics Investigation Steps 1.8 Report Generation of Forensic Findings Through Software Tools 1.9 Importance of Forensics Report 1.10 Guidelines for Report Writing 1.11 Objectives of Computer Forensics 1.12 Challenges Faced by Computer Forensics References 2 Network and Data Analysis Tools for Forensic Science Shrutika Singla, Shruthi Subhash and Amarnath Mishra 2.1 Introduction 2.2 Necessity for Data Analysis 2.2.1 Operational Troubleshooting 2.2.2 Log Monitoring 2.2.3 Data Recovery 2.2.4 Data Acquisition

1 2 2 3 8 8 10 12 12 15 17 18 18 19 20 20 23 23 25 25 25 25 25 v

vi  Contents 2.3 Data Analysis Process 2.3.1 Acquisition 2.3.2 Examination 2.3.3 Utilization 2.3.4 Review 2.4 Network Security and Forensics 2.5 Digital Forensic Investigation Process 2.5.1 Data Identification 2.5.2 Project Planning 2.5.3 Data Capture 2.5.4 Data Processing 2.5.5 Data Analysis 2.5.6 Report Generation 2.6 Tools for Network and Data Analysis 2.6.1 EnCase Forensic Imager Tool 2.6.2 Cellebrite UFED 2.6.3 FTK Imager Tool 2.6.4 Paladin Forensic Suite 2.6.5 Digital Forensic Framework (DFF) 2.6.6 Forensic Imager Tx1 2.6.7 Tableau TD2U Forensic Duplicator 2.6.8 Oxygen Forensics Detective 2.6.9 SANS Investigative Forensic Toolkit (SIFT) 2.6.10 Win Hex 2.6.11 Computer Online Forensic Evidence Extractor (COFEE) 2.6.12 WindowsSCOPE Toolkit 2.6.13 ProDiscover Forensics 2.6.14 Sleuth Kit 2.6.15 CAINE 2.6.16 Magnet RAM Capture 2.6.17 X-Ways Forensics 2.6.18 WireShark Tool 2.6.19 Xplico 2.6.20 e-Fensee 2.7 Evolution of Network Data Analysis Tools Over the Years 2.8 Conclusion References

26 26 26 26 26 26 27 28 28 29 29 29 29 29 30 31 31 32 32 32 32 33 33 33 34 34 34 35 35 35 36 36 36 36 37 37 38

Contents  vii 3 Cloud and Social Media Forensics 41 Nilay Mistry and Sureel Vora 3.1 Introduction 42 3.2 Background Study 42 3.2.1 Social Networking Trend Among Users 42 3.2.2 Pros and Cons of Social Networking and Chat Apps 43 3.2.3 Privacy Issues in Social Networking and Chat Apps 44 3.2.4 Usefulness of Personal Information for Law Enforcements 45 3.2.5 Cloud Computing and Social Media Applications 45 3.2.5.1 SaaS Model 45 3.2.5.2 PaaS Model 46 3.2.5.3 IaaS Model 46 3.3 Technical Study 46 3.3.1 User-Agent and Its Working 46 3.3.2 Automated Agents and Their User-Agent String 47 3.3.3 User Agent Spoofing and Sniffing 47 3.3.4 Link Forwarding and Rich Preview 47 3.3.5 WebView and its User Agent 48 3.3.6 HTTP Referrer and Referring Page 48 3.3.7 Application ID 48 3.4 Methodology 49 3.4.1 Testing Environment 49 3.4.2 Research and Analysis 49 3.4.2.1 Activities Performed 51 3.4.2.2 Information Gathered 52 3.4.2.3 Analysis of Gathered Information 53 3.4.3 Activity Performed - Opening the Forwarded Link 59 3.5 Protection Against Leakage 60 3.6 Conclusion 60 3.7 Future Work 61 References 61 4 Vehicle Forensics Disha Bhatnagar and Piyush K. Rao 4.1 Introduction 4.1.1 Motives Behind Vehicular Theft 4.1.1.1 Insurance Fraud 4.1.1.2 Resale and Export 4.1.1.3 Temporary Transportation

65 65 67 67 67 68

viii  Contents 4.1.1.4 Commitment of Another Crime 68 4.2 Intervehicle Communication and Vehicle Internal Networks 68 4.3 Classification of Vehicular Forensics 70 4.3.1 Automative Vehicle Forensics 71 4.3.1.1 Live Forensics 71 4.3.1.2 Post-Mortem Forensics 71 4.3.1.3 Physical Tools for Forensic Investigation 73 4.3.2 Unmanned Aerial Vehicle Forensics (UAV)/Drone Forensics 74 4.3.2.1 Methodology 74 4.3.2.2 Steps Involved in Drone Forensics 75 4.3.2.3 Challenges in UAV Forensics 76 4.4 Vehicle Identification Number 76 4.4.1 Placement in a Vehicle and Usage of a VIN 77 4.4.2 Vehicle Identification 78 4.4.2.1 Federal Motor Vehicle Safety Certification Label 79 4.4.2.2 Anti-Theft Label 79 4.4.2.3 Stamping on Vehicle Parts 79 4.4.2.4 Secondary and Confidential VIN 79 4.5 Serial Number Restoration 79 4.5.1 Restoration Methods 80 4.5.1.1 Chemical Etching 80 4.5.1.2 Electrolytic Etching 81 4.5.1.3 Heat Treatment 81 4.5.1.4 Magnetic Particle Method 81 4.5.1.5 Electron Channeling Contrast 81 4.6 Conclusion 81 References 82 5 Facial Recognition and Reconstruction Payal V. Bhatt, Piyush K. Rao and Deepak Rawtani 5.1 Introduction 5.2 Facial Recognition 5.3 Facial Reconstruction 5.4 Techniques for Facial Recognition 5.4.1 Image-Based Facial Recognition 5.4.1.1 Appearance-Based Method 5.4.1.2 Model-Based Method 5.4.1.3 Texture-Based Method 5.4.2 Video-Based Facial Recognition

85 86 86 87 88 89 89 90 90 91

Contents  ix 5.4.2.1 Sequence-Based Method 5.4.2.2 Set-Based Method 5.5 Techniques for Facial Reconstruction 5.5.1 Manual Method 5.5.2 Graphical Method 5.5.3 Computerized Method 5.6 Challenges in Forensic Face Recognition 5.6.1 Facial Aging 5.6.2 Face Marks 5.6.3 Forensic Sketch Recognition 5.6.4 Face Recognition in Video 5.6.5 Near Infrared (NIR) Face Recognition 5.7 Soft Biometrics 5.8 Application Areas of Facial Recognition 5.9 Application of Facial Reconstruction 5.10 Conclusion References

91 92 92 93 94 94 95 96 97 97 98 99 99 100 101 102 102

6 Automated Fingerprint Identification System 107 Piyush K. Rao, Shreya Singh, Aayush Dey, Deepak Rawtani and Garvita Parikh Abbreviations 108 6.1 Introduction 108 6.2 Ten-Digit Fingerprint Classification 110 6.3 Henry Faulds Classification System 110 6.4 Manual Method for the Identification of Latent Fingerprint 111 6.5 Need for Automation 112 6.6 Automated Fingerprint Identification System 112 6.7 History of Automatic Fingerprint Identification System 113 6.8 Automated Method of Analysis 113 6.9 Segmentation 114 6.10 Enhancement and Quality Assessment 115 6.11 Feature Extraction 117 6.12 Latent Fingerprint Matching 118 6.13 Latent Fingerprint Database 120 6.14 Conclusion 120 References 121 7 Forensic Sampling and Sample Preparation Disha Bhatnagar, Piyush K. Rao and Deepak Rawtani 7.1 Introduction

125 126

x  Contents 7.2 Advancement in Technologies Used in Forensic Science 7.3 Evidences 7.3.1 Classification of Evidences 7.3.1.1 Direct Evidence 7.2.1.2 Circumstantial Evidence 7.4 Collection of Evidences 7.4.1 Sampling Methods 7.5 Sample Preparation Techniques for Analytical Instruments 7.5.1 Conventional Methods of Sample Preparation 7.5.2 Solvent Extraction 7.5.2.1 Distillation 7.5.2.2 Acid Digestion 7.5.2.3 Solid Phase Extraction 7.5.2.4 Soxhlet Extraction 7.5.3 Modern Methods of Sample Preparation 7.5.3.1 Accelerated Solvent Extraction 7.5.3.2 Microwave Digestion 7.5.3.3 Ultrasonication-Assisted Extraction 7.5.3.4 Microextraction 7.5.3.5 Supercritical Fluid Extraction 7.5.3.6 QuEChERS 7.5.3.7 Membrane Extraction 7.6 Conclusion 7.7 Future Perspective References 8 Spectroscopic Analysis Techniques in Forensic Science Payal V. Bhatt and Deepak Rawtani 8.1 Introduction 8.2 Spectroscopy 8.2.1 Spectroscopy and its Applications 8.3 Spectroscopy and Forensics 8.4 Spectroscopic Techniques and their Forensic Applications 8.4.1 X-Ray Absorption Spectroscopy 8.4.1.1 Application of X-Ray Absorption Spectroscopy in Forensics 8.4.2 UV/Visible Spectroscopy 8.4.2.1 Application of UV/Vis Spectroscopy in Forensics 8.4.3 Atomic Absorption Spectroscopy

126 127 127 127 127 129 130 133 134 134 135 135 136 137 138 138 138 139 139 142 143 143 144 144 145 149 150 150 153 155 156 156 157 159 160 162

Contents  xi 8.4.3.1 Application of Atomic Absorption Spectroscopy in Forensics 8.4.4 Infrared Spectroscopy 8.4.4.1 Application of Infrared Spectroscopy in Forensics 8.4.5 Raman Spectroscopy 8.4.5.1 Application of Raman Spectroscopy in Forensics 8.4.6 Electron Spin Resonance Spectroscopy 8.4.6.1 Application of Electron Spin Resonance Spectroscopy in Forensics 8.4.7 Nuclear Magnetic Resonance Spectroscopy 8.4.7.1 Application of Nuclear Magnetic Resonance Spectroscopy in Forensics 8.4.8 Atomic Emission Spectroscopy 8.4.8.1 Application of Atomic Emission Spectroscopy in Forensics 8.4.9 X-Ray Fluorescence Spectroscopy 8.4.9.1 Application of X-Ray Fluorescence Spectroscopy in Forensics 8.4.10 Fluorescence Spectroscopy 8.4.10.1 Application of Fluorescence Spectroscopy in Forensics 8.4.11 Phosphorescence Spectroscopy 8.4.11.1 Application of Phosphorescence Spectroscopy in Forensics 8.4.12 Atomic Fluorescence Spectroscopy 8.4.12.1 Application of Atomic Fluorescence Spectroscopy in Forensics 8.4.13 Chemiluminescence Spectroscopy 8.4.13.1 Application of Chemiluminescence Spectroscopy in Forensics 8.5 Conclusion References 9 Emerging Analytical Techniques in Forensic Samples Disha Bhatnagar and Piyush K. Rao 9.1 Introduction 9.2 Separation Techniques 9.2.1 Chromatography

163 165 166 167 168 171 172 173 174 176 177 178 179 181 182 183 184 186 187 188 189 190 190 199 199 200 200

xii  Contents 9.2.1.1 Gas Chromatography 202 9.2.2 Liquid Chromatography 208 9.2.3 Capillary Electrophoresis 211 9.3 Mass Spectrometry 213 9.4 Tandem Mass (MS/MS) 219 9.5 Inductively Coupled Plasma-Mass Spectrometry 220 9.6 Laser Ablation–Inductively Coupled Plasma-Mass Spectrometry 221 9.7 Conclusion 222 References 223 10 DNA Sequencing and Rapid DNA Tests 225 Archana Singh and Deepak Rawtani 10.1 Introduction 226 10.1.1 DNA Sequencing 226 10.1.2 DNA Profiling Analysis Methods 228 10.1.3 The Rapid DNA Test 228 10.2 DNA – The Hereditary Material 230 10.2.1 DNA – Structure and Genetic Information 230 10.3 DNA Sequencing 231 10.3.1 Maxam and Gilbert Method 232 10.3.2 Chain Termination Method or Sanger’s Sequencing 233 10.3.3 Automated Method 235 10.3.4 Semiautomated Method 235 10.3.5 Pyrosequencing Method 236 10.3.6 Clone by Clone Sequencing Method 237 10.3.7 The Whole-Genome Shotgun Sequencing Method 237 10.3.8 Next-Generation DNA Sequencing 238 10.4 Laboratory Processing and DNA Evidence Analysis 238 10.4.1 Restriction Fragment Length Polymorphism 239 10.4.2 Polymerase Chain Reaction (PCR) 239 10.4.3 Short Tandem Repeats (STR) 241 10.4.4 Mitochondrial DNA (mt-DNA) 241 10.4.5 Amplified Fragment Length Polymorphism (AFLP) 242 10.4.6 Y-Chromosome 242 10.5 Rapid DNA Test 243 10.5.1 The Evolution of the Rapid DNA Test 244 10.5.2 Rapid DNA Instrument 245

Contents  xiii 10.5.3 Methodology of Rapid DNA 10.6 Conclusion and Future Aspects References

250 250 251

11 Sensor-Based Devices for Trace Evidence 265 Aayush Dey, Piyush K. Rao and Deepak Rawtani 11.1 Introduction 266 11.2 Immunosensors in Forensic Science 267 11.2.1 Direct Immunosensing Strategies 268 11.2.1.1 Surface Plasmon Resonance 268 11.2.1.2 Electrochemical Impedance Spectroscopy 274 11.2.1.3 Piezoelectric Immunosensors 275 11.2.2 Indirect Immunosensing Strategies 276 11.2.2.1 Optical Immunosensors 276 11.2.2.2 Electrochemical Immunosensors 280 11.3 Genosensors and Cell-Based Biosensors in Forensic Science 282 11.4 Aptasensors in Forensic Science 283 11.4.1 Forensic Applications of Aptasensors 287 11.5 Enzymatic Biosensors in Forensic Science 288 11.5.1 Applications of Enzymatic Biosensors for Trace Evidence Analysis 289 11.6 Conclusion 289 References 290 12 Biomimetic Devices for Trace Evidence Detection 299 Manika and Astha Pandey 12.1 Introduction 300 12.2 Tools or Machines for Biomimetics 301 12.3 Methods of Biomimetics 302 12.4 Applications 302 12.4.1 Detection of Trace Evidences 302 12.4.1.1 Biomimetic Sniffing 302 12.4.1.2 L-Nicotine Detection 307 12.4.1.3 TNT Detection 307 12.4.2 Hybrid Materials to Medical Devices 309 12.4.2.1 Smart Drug Delivery Micro and Nanodevices 309

xiv  Contents 12.4.2.2 Nanodevices for Combination of Therapy and Theranostics 12.4.2.3 Continuous Biosensors for Glucose 12.4.2.4 Electro-Active Lenses 12.4.2.5 Smart Tattoos 12.5 Challenges for Biomimetics in Practice 12.6 Conclusion References 13 Forensic Photography Aayush Dey, Piyush K. Rao and Deepak Rawtani 13.1 Introduction 13.2 Forensic Photography and Its Purpose 13.3 Modern Principles of Forensic Photography 13.4 Fundamental Rules of Forensic Photography 13.4.1 Rule Number 1. Filling the Frame Space 13.4.2 Rule Number 2. Expansion of Depth of Field 13.4.3 Rule Number 3. Positioning the Film Plane 13.5 Camera Setup and Apparatus for Forensic Photography 13.6 The Dynamics of a Digital Camera 13.6.1 Types of Digital Cameras 13.6.2 Sensor Architecture 13.6.2.1 Full Frame 13.6.2.2 Frame Transfer 13.6.2.3 Interline Architecture 13.6.3 Spectral Response 13.6.4 Light Sensitivity and Noise Cancellation 13.6.5 Dynamic Range 13.6.6 Blooming and Anti-Blooming 13.6.7 Signal to Noise Ratio 13.6.8 Spatial Resolution 13.6.9 Frame Rate 13.7 Common Crime Scenarios and How They Must be Photographed 13.7.1 Photography of Road Traffic Accidents 13.7.2 Photography of Homicides 13.7.3 Arson Crime Scenes 13.7.4 Photography of Print Impressions at a Crime Scene 13.7.5 Tire Marks and Their Photography 13.7.6 Photography of Skin Wounds

310 310 311 311 311 312 314 315 316 316 318 319 319 320 321 321 322 323 324 324 325 325 325 326 326 326 326 327 327 327 328 329 330 330 331 331

Contents  xv 13.8 Conclusion References 14 Scanners and Microscopes Aayush Dey, Piyush K. Rao and Deepak Rawtani 14.1 Introduction 14.2 Scanners in Forensic Science 14.2.1 Three-Dimensional Laser Scanners 14.2.1.1 Benefits of Three-Dimensional Laser Scanners 14.2.1.2 Drawbacks of Three-Dimensional Laser Scanners 14.2.1.3 Applications in Forensic Science 14.2.2 Structured Light Scanners 14.2.2.1 Applications in Forensic Science 14.2.3 Intraoral Optical Scanners 14.2.3.1 Applications in Forensic Science 14.2.4 Computerized Tomography Scanner 14.2.4.1 Applications in Forensic Science 14.3 Microscopes in Forensic Science 14.3.1 Light Microscopes 14.3.1.1 Compound Microscope 14.3.1.2 Comparison Microscope 14.3.1.3 Polarizing Microscope 14.3.1.4 Stereoscopic Microscope 14.3.2 Electron Microscopes 14.3.2.1 Scanning Electron Microscope 14.3.2.2 Transmission Electron Microscope 14.3.3 Probing Microscopes 14.3.3.1 Atomic Force Microscope 14.4 Conclusion References

332 332 335 336 337 338 338 338 339 341 341 342 342 343 343 344 345 345 347 348 348 349 349 350 350 350 355 356

15 Recent Advances in Forensic Tools 361 Tatenda Justice Gunda, Charles Muchabaiwa, Piyush K. Rao, Aayush Dey and Deepak Rawtani 15.1 Introduction 362 15.1.1 Recent Forensic Tool: Trends in Crime Investigations 363 15.1.2 Recent Forensic Device 364 15.2 Classification of Forensic Tools and Devices 364

xvi  Contents 15.2.1 Forensic Chemistry 365 15.2.1.1 Sensors 365 15.2.1.2 Chromatographic Techniques 368 15.2.1.3 Gas Chromatography–Mass Spectrometer (GC-MS) 369 15.2.1.4 High-Performance Liquid Chromatography (HPLC) 370 15.2.1.5 Liquid Chromatography (LC/MS/MS) Rapid Toxicology Screening System 370 15.2.1.6 Fourier Transform Infrared (FTIR) Spectroscopy 372 15.2.1.7 Drug Testing Toxicology of Hair 372 15.2.2 Question Document and Fingerprinting 373 15.2.2.1 Electrostatic Detection Analysis (ESDA) 374 15.2.2.2 Video Spectral Comparator 375 15.2.2.3 Fingerprinting 376 15.2.3 Forensic Physics 377 15.2.3.1 Facial Recognition 377 15.2.3.2 3D Facial Reconstruction 378 15.2.3.3 Arsenal Automated Ballistic Identification System (ABIS) 378 15.2.3.4 Audio Video Aided Forensic Analysis 379 15.2.3.5 Brain Electrical Oscillations Signature (BEOS) 379 15.2.3.6 Phenom Desktop Scanning Electron Microscope (SEM) 379 15.2.3.7 X-Ray Spectroscopy EDX 380 15.2.3.8 Drones/UAVs 380 15.2.4 Forensic Biology 382 15.2.4.1 Massive Parallel Sequencing (MPS) 384 15.2.4.2 Virtopsy 384 15.2.4.3 Three-Dimensional Imaging System 385 15.3 Conclusion and Future Perspectives 385 References 386 16 Future Aspects of Modern Forensic Tools and Devices Swathi Satish, Gargi Phadke and Deepak Rawtani 16.1 Introduction 16.2 Forensic Tools 16.2.1 Emerging Trends in Forensic Tools

393 394 395 396

Contents  xvii 16.2.2 Future Facets of Forensic Tools 16.2.2.1 Analytical Forensic Tools 16.2.2.2 Digital Forensic Tools 16.3 Forensic Devices 16.3.1 Emerging Trends in Forensic Devices 16.3.2 Future Aspects of Forensic Devices 16.4 Conclusion References

397 397 399 403 403 404 409 410

Index 415

Preface Technology has played a pivotal role in advancing forensic science over the years, particularly in modern-day criminal investigations. In recent years, significant advancements in forensic tools and devices have enabled investigators to gather and analyse evidence more efficiently than ever. Modern Forensic Tools and Devices: Emerging Trends in Criminal Investigations is a comprehensive guide to the latest technologies and techniques used in forensic science. This book covers a wide range of topics, from computer forensics and personal digital assistants to emerging analytical techniques for forensic samples. A section of the book provides detailed explanations of each technology and its applications in forensic investigations, along with case studies and real-life examples to illustrate their effectiveness. The book starts with an introduction to forensic science, providing an overview of its history, significance, and current state. It then delves into the aforementioned topics, exploring each in-depth, including the latest advancements, emerging trends, and future prospects. The editors have carefully researched each topic, combining the latest research and case studies from around the world to provide readers with a complete understanding of the subject matter. One critical aspect of this book is its focus on emerging trends in forensic science. The book covers new technologies such as cloud and social media forensics, vehicle forensics, facial recognition and reconstruction, automated fingerprint identification systems, and sensor-based devices for trace evidence, to name a few. Its thoroughly detailed chapters expound upon spectroscopic analytical techniques in forensic science, DNA sequencing, rapid DNA tests, bio-mimetic devices for evidence detection, forensic photography, scanners, microscopes, and recent advancements in forensic tools. The book also provides insights into forensic sampling and sample preparation techniques, which are crucial for ensuring the reliability

xix

xx  Preface of forensic evidence. Furthermore, the book explains the importance of proper sampling and the role it plays in the accuracy of forensic analysis. In addition to discussing the latest technologies, the book also looks toward the future of forensic science. It provides an overview of the potential advancements in forensic tools and devices and the impact they could have on criminal investigations. Overall, Modern Forensic Tools and Devices: Emerging Trends in Criminal Investigations is an essential resource for forensic scientists, law enforcement officials, and anyone interested in the advancements in forensic science. It offers a comprehensive overview of the latest technologies and techniques used in forensic investigations and highlights the potential impact of these advancements on the field. The Editors April 2023

1 Computer Forensics and Personal Digital Assistants Muhammad Qadeer1, Chaudhery Ghazanfer Hussain1 and Chaudhery Mustansar Hussain2* 1

Computer Science and Technology, Department of Education, Punjab, Pakistan 2 Department of Chemistry and Environment Science, New Jersey Institute of Technology, Newark, NJ, USA

Abstract

Across the world organizations and corporates are spending huge budget on information security as increasing security risks. Spreading usage of computers and mobile devices such as PDAs, smart phones is generating opportunities for business and creating a lot of benefits for organizations. On the other side they are posing new challenges for policing cybercrimes. Digital forensic a new science has been introduced to handle cyber and digital crimes. The forensic science deals with digital crimes as well as crimes involving digital devices like computers, PDAs etc. Most of the processes are being automated due to rapid development and advancement of digital computing and communication technologies. With increasing of information and internet technologies confidential information is stored on computer based systems and majority of people share their information on popular social media networks such as Twitter, Instagram, Facebook, Linkedin, Youtube, etc. There is a significant growth in crimes in the whole world due to the progression of communication and information technology. Criminals convict like kidnapping, murders, extortion, drug dealing, gambling, robbery, sexual assault, cyber terrorism, weapon dealing, economic crimes, and criminal hacking such as theft of computer files, Web defacements through computers and mobile digital devices. So, these technologies have to become an important part of forensic sciences. By using of scientific knowledge and procedures to pursue, find, analyze, and preserve evidence of a crime to present well in a court are forensic sciences or criminalistics. The matching of DNA, comparing finger prints and examining body are the latent evidences to analyze and recovery in a crime and these are *Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (1–22) © 2023 Scrivener Publishing LLC

1

2  Modern Forensic Tools and Devices major concern of forensic sciences. Computer and other digital devices such as personal digital assistant have the great serving position in forensics to support justice today. Digital evidences through these devices to ensure truth have become significant part a legal process. So, the analysis of computer forensics and personal digital assistant has great importance and its analytical research is necessary to a part of this chapter. Keywords: Cyber forensics, criminal investigations, digital evidences, child abusing, criminal behaviors, geographical boundaries, internet gambling, court of law, pro-active investigation, ICT – Information and Communication Technology

1.1 Introduction Computer forensics or cyber forensics is the branch of digital measureable science which can identify and measure the computerized storage media. Its goal is to search out computerized media carefully in a forensically concrete basis for detecting, recuperating, distinguishing, investigating, protecting and presenting realities about the data related to an event or crime committed [1]. In a court, computer-based criminological confirmation may be presented as a standard requirement for digital probe. It needs that the data must be real, admissible, dependably acquired. Different nations apply variety of rules to practice the recuperation of digital probe. For instance in UK, analysts recurrently follow guidelines of Association of Chief Police Officers that support them to assure the honesty and credibility of proof. The considered rules are broadly acknowledged in British courts. The central and state governments both have a great contribution in the Information and Communication Technology (ICT) for improving their working.

1.1.1 Computer and Digital Forensics Computer forensic is the part of digital forensics and it can be defined as: “The process of identification, extraction, documentation, and preservation of digital evidence which may be used by the court of law is referred as digital forensics.”

It is a complete science of discovering the evidences about crimes from all types of digital devices like computers, servers of different kinds, PDAs (personal digital assistants), networks, or mobile phones and networks. It provides opportunity to forensic teams with the latest digital tools and best techniques to solve complicated cases related today’s digital world. It also

Computer Forensics  3 helps to identify, inspect, analyze, and preserve the evidence found from various electronic digital devices. Different commercial organizations have been using computer or digital forensics in diverse types of cases like industrial espionage, intellectual property theft, fraud investigations, employment disputes, inappropriate internet and email use in workplaces, bankruptcy investigations, forgeries related matters and issues related to the regulatory compliance. As digital forensics or computer forensics is the need of time it has a list of advantages and disadvantages as well. Advantages are as it helps the investigators or companies to collect worthy information from computers and networks relevant to an event or case. It can ensure integrity of the investigation system as well as computer and network related systems. It can produce evidence which can be presented in front of court of justice that may lead toward punishment of the culprit. It can efficiently track down the cybercriminals from anywhere in the world. It can help in protecting the valuable time and money of institutions, organization even states. It permits to accumulate, extract, process, and interpret the factual digital evidence to prove criminal action in the court of justice. The draw backs of the digital or computer forensics are that evidence found from digital devices is not accepted as a whole in the court. However, it is must be proved that there is not any kind of tampering, the production and storage of electronic records are an extremely expensive matter, legal practitioner must have enough knowledge computer to understand and present digital evidence. There always need of an authentic and convincing evidence is to be produced, If the tools used in digital forensics are not compatible to the specified standards, then the evidence may be disapproved or rejected by justice in the law court, if investigating officers have lack of computer or technical knowledge may not depict the desired results [2].

1.2 Digital Forensics Classification i) Computer Forensics Examining computer systems in scientific manners to identify, analyze, present, preserve, and recover the facts related to an offense is computer forensics. The major part of computer to store data is different kinds of disks such as hard disk, compact disk, floppy disk (old medium). So in a part of computer forensics, disk forensics is given a great focus and importance. “Disk forensics is the extraction of the data from storage media by examining the active, deleted, or modified files.”

4  Modern Forensic Tools and Devices Another major part of computer is memory which stores data temporarily in computer on different steps. So, its forensics can be sometime necessary part of investigation. Disk image is formed as bit-stream which is extracted physically. It plays an essential role in forensic investigation. It may be extracted from the computers and smart mobile devices. Currently images of disk data are broadly used by forensics investigators for conserving the activities, maintaining the data integrity and custody chain while aiding in access to possibly valuable data [3]. The disk images are ultimately sector to sector copies of the residing data. They can be named as “snapshot” and included allocated files, file names, file created dates and other metadata related to the volume of the disk. Upon the time of creation, data is stored as a sole file or set of files depending on application used, the simple action of turning on the device or booting up system can result in change of data and possibly destruction of some files. It includes modifications in metadata and some supplementary features of the original data objects like character encoding, byte order, file sizes, file system information, MAC (modified, accessed, created/changed) and permissions. Because of this, programs which can manipulate the image use low level input/output operations without intervention of the host operating systems. At the present time free and commercial solutions are available such as FTK Imager or Macintosh Disk Utility for such purposes [4]. “Memory Forensics deals with collecting and examining data from memories such as system cache, registers, RAM in the raw form then carving that data from raw dump.”

Analysis of the volatile memory is considered a noteworthy part of digital investigation due to compulsory formation of digital evidence over memory such as RAM, cache or registers. Nothing can be written on any disk without using memory. Witty, SQL Slammer, and Code Red are common examples of the worms, their existence form an evident in RAM and not on disk. The acquirement of data is the first steps in any incident handling executed in the containment phase. A renowned incident handling guide highlights the importance of digital evidence acquisition based on volatile order in timely manner [5]. An approach to implement open source tool of the Volatility framework as an extension to detect characteristics and the presence of any hypervisor used the Intel VT-x technology. It supports nested virtualization analysis and it is able to suppose the hierarchy of numerous hypervisors and virtual machines. Ultimately, a tool by manipulated these techniques can recreate

Computer Forensics  5 the virtual machine address space to support any volatility plugin which allows analysts to reuse their codes for analysis [6]. ii) Personal Digital Assistants and Mobile devices Forensics The inspection and analysis mobile devices such as PDAs, mobile phone, tabs, and laptops are also considered in forensics. It helps in retrieving data from PDAs, phones, SIM contacts, call logs, outgoing and incoming SMS/ MMS, Audios, videos calls, and messages [7]. Mobile phone technology has been using in criminal activity since invention. In the crime such as terrorism it was being used as undetected communication tool in the beginning. Terrorists could prevent their communications from being traced through simply using snatched, stolen or prepaid mobile devices (phones or PDAs). The terrorists who attacked by bombs in 2004 on trains in Madrid used this technique in organizing these attacks. The criminals organized their crime groups by using various prepaid mobile phones during their daily operations. They discard these phones after use. When telecommunication mass retention including fixed telephone and mobile phone and electronic data communications were debated in the European Parliament in 2005, the members of this political organization passionately argued about the measures which could be avoided easily by criminals [8]. Mobile devices such as personal data assistants (PDAs), mobile phones, and laptops may provide valuable evidence which can support the civil and criminal investigations. These devices can guide investigators and prosecutors. Additionally, they can be considered as same or different from desktop or mini computers. We examine the techniques and processes for collecting and identifying evidences from these devices without tainting or altering. Furthermore, the analysis of tools and techniques used in them which can be a part of computer forensics investigations. PDAs and mobile phones both have been used in crimes since last two or three decades but currently most of the PDAs are functioning as mobile phones too. Consequently, their use in unlawful activities also has been cumulating. So, they can be a major part of the digital investigations in several ways. They are also becoming targets of attacks of malicious software and hackers. In 2004 Cabir a well-known worm hit the mobile phone software. It was displaying a message on mobile phone screen frequently and required to accept some offers or options to use the mobile phone. Skulls Trojan horse attacked the Symbian an operating system and prevented the mobile applications from running. They also replaced the icons of applications with crossbones or skull. Duts virus hit Windows CE operating systems that

6  Modern Forensic Tools and Devices required a positive response of the user to the message displayed on screen of the system; the affirmative response then allowed Duts to spread to the files on mobile devices running Windows CE. One more “Curse of Silence” virus targeted the mobile devices, which sent a text message to unsuspecting users. After receiving the message users became unable to receive Short Message Service (SMS) or Multimedia Messaging Service (MMS) [9]. Some models of mobile phone were able to work properly after factory reset but that depended upon their operating system. Moreover, worms like “Duh” and “ikee” were used against expensive mobile phones such as iPhones. These worms pursue to build botnet and steal user’s personal and secret data, such as passwords and banking information [10]. Criminals may clone the cell phones to different private networks and communicate which was burden of proof on the victims. The cloning may occur when the device identity is copied to the suspect’s phone or device. For cloning an existing device or mobile phone, two data pieces are stolen for using by the suspect: the electronic serial number (ESN) and the mobile identification number (MIN). In the case, the operatives of a Colombian drug cartel cloned the phone number of the U.S. Drug Enforcement Agency (DEA) and made phones calls within Colombia. Authorities discovered it after finding a large unusual numbers of calls to Colombia and reviewing the phone bills. Mobile phone has also become a tool for cyber bullying. When one student in a school does not like the victim passes the victim’s number to other bullies, bullying occurs in the school by phone calls or text. Subsequently, the victim is humiliated [11]. The SIM and mobile forensics are state of the art tools to acquire, examine and report data including Cell Seizure, MOBILedit! Forensic, GSM.XRY, TULP 2G, Forensic Card Reader, ForensicSIM, SIMCon, and SIMIS. An observation is that most of the information such as the SMS/EMS and IMSI could be retrieved by these tools [7]. iii) Network forensics Network forensics is the sub-branch of a contemporary digital forensics. It is associated with monitoring and examining of the traffic on computer network for gathering information to develop legal evidence. It is a comparatively novel type in forensic science but its popularity is growing due to internet in offices and homes that means computing is networkcentric now and data is available outside the disks. Network forensics handles dynamic and volatile information. It is pro-active investigation because traffic on a network is transmitted and lost in lost in moments. Generally two types of network exist on ground wired and wireless. This division of network makes some forensics distinction in wired and wireless

Computer Forensics  7 network. The wired network forensics is to deal the tools and techniques needed to collect and analyze the information from wired network traffic and the aim of wireless forensics is to propose the tools and techniques compulsory for collecting and analyzing the data from the traffic on wireless network. Network forensics usually has dualistic use. The first use of network forensics is related to security, it involves the monitoring of a network for anomalous data traffic and finding intrusions. Attacker may erase log files on a conceded host; the network-based evidence may be the only evidence available for investigation and forensic analysis. The second use is relates to the law enforcement. The case analysis of the traffic captured from network may include the tasks such as transferred files reassembling, keywords searching and parsing the human communication like chats sessions or emails. Two algorithmic systems are mostly used to data from network; a brute force “catch it as you can” and a more intelligent “stop look listen” method. Netfox detective is a novel network forensics analysis tool available as open-source [12]. iv) Email forensics Email is one of the major tools of communication today and it is top positioned since invention of information and communication technologies. It is considered weak against increasing numbers of cybercrimes. Forensics provides the insight about the e-mails, policies, architecture of email system through investigation techniques used by forensic investigators. Many organizations implement certain standard e-mail policies but it is not enough to prevent and handle digital crimes. There is a big need to monitor the email system to prevent and control digital crimes. Some prominent techniques and tools are available through which experts can collect and examine data about suspected email accounts for the purposes of investigation that can be produced as evidence in the court of law [13]. Some of these software tools are Xtraxtor, OST Viewer, Advik Email Forensic, Systools MailPro, Advik MBOX. Xtraxtor is specifically developed to extract e-mail addresses, messages and contact numbers from multiple file formats. OST Viewer is another versatile utility that allows previewing and examining OST file in a one-piece manner. With OST Email Viewer software investigators can easily view OST file data including email messages, contact list, calendar etc. without any e-mail software such as Outlook installation. It permits the investigator to view OST file even password protected, corrupt, encrypted without any trouble [14].

8  Modern Forensic Tools and Devices

1.3 Digital Evidence “Data or information stored on digital storage devices of computer or mobile devices that is seized by law enforcement agency of a state as a part of criminal investigations is named as digital evidence.”

Digital evidence is usually associated with a crime conducted with the help of digital devices credit card or money transfer frauds or child abusing or pornography. The evidence stored in binary codes and can be transferred from computer storage drives, smart phones or other electronic devices. It is presentable in a court of law by forensic responders. This evidence may include data files images audios or videos on computers, mobile phones or on emails of a suspect, which can be critical to track their location and intent of crime [15].

1.4 Information Used in Investigation to Find Digital Evidence Mobile devices are rated as smart devices because of their high processing speed and huge storage capacities which may able to store a bulk of valuable information as digital evidence for investigation of crimes or incidents. Following different types of information may be retrieved from mobile phones or PDAs used in investigation but not limited to: • Personal notes, digital diary, memo pads. • List of attending events, appointments, calendar marks, datebook and reminders. • Tasks to accomplish which is normally called “To-do list”. • The dialed numbers, the numbers from which calls were received, missed calls, and the dates and times of these calls. • Messages such as SMS, MMS (can include text and image, video, and/or sound), EMS (Enhanced multimedia messages). • Data can be collected from service provider. • Contacts list in the phone book which usually contains names, phone numbers (home, work and/or mobile), home addresses, email addresses. • Emails account which contains data such as emails sent, received and draft stored in PDA, or cell phone. • Voice mail account data of the user is also valuable.

Computer Forensics  9 • Web browsing data accessed through the mobile phone or PDA. Photographs, Images, sounds, or audio files, audio recordings, and video clips can be stored in the storage or memory card. Memory cards are additional storage media that allows user to store additional data or files beyond the built-in storage capacity of device and provide an avenue for sharing data between compatible devices. • Applications for examples programs used to view and create documents, spread sheets, and presentations. • Subscriber identifiers which may be used for authentication of the user to verify the services secured to an account or a network. • The personal identification number (PIN) and financial information (e.g., debit and credit card numbers) in PDA or mobile phone. • Investigator may use the personal unlock key (PUK). The PUK is unique to each subscriber identity module (SIM) card. The SIM card stores information identifying the subscriber to a particular network. • International mobile equipment identifier (IMEI) uniquely identifies mobile devices phones and matches them to subscribers. IMEI number is requested when a service provider wants to determine whether a mobile phone has been stolen or not. IMEIs may be manipulated easily by the users, or manufacturers may assign multiple times these numbers. Accordingly, the accurate mobile terminals identification and subscribers base on these numbers might be difficult. • Most service providers do not use IMEI numbers to identify the users of mobile phone they use the international mobile subscriber identity (IMSI) number assigned by provider and stored on the customer’s chip (SIM) card. • Today data related to the location of an individual can be retrieved from mobile devices. Smart phones or PDAs pinpoint the user’s location with some feet difference because GPS (Global Positioning System) functionality has been included in most of them. GPS navigation system can record the home address, work address, and other areas of a user to which he/she travels. Additionally, Google gives mapping capabilities which allow the mobile phone or PDA user to pinpoint the locations of his or her contacts.

10  Modern Forensic Tools and Devices • Some popular company’s phones like Motorola Droid have a feature that enables other users to find the exact locations of their Droid-user friends as long as their phones are turned on. This capability can prove enormously useful in cases of missing children, as long as the phone of child remains on the law enforcement authorities can identify the child location. This feature can be useful if Motorola Droid phone has been stolen. The Droid tracking feature can also be used to trunk individuals. • Most of the PDAs and smart phones have digital image and video capabilities and the images or recordings of crime evidence, victims and accomplices may be stored in them. A well-known example of usage involved Robert P. Hanssen an agent of the FBI who received a sentence of life in prison for selling secrets to Moscow, “used his Palm-III (PDA) to keep track of his schedule to pass information to his Russian contacts [16].

1.5 Short History of Digital/Computer Forensics The target readers are computer forensic examiners, system administrators and managers, analysts, students, business professionals, law enforcement personnel, and someone who involved in computer security. Computer or digital crimes are understood as criminal acts in which computer or digital devices are the objects of offence or tools for commission. Firstly, computer appeared in the 1940s, and rapid technology development followed by different computer offences. In the mid-60s Donn B. Parker an information security researcher and consultant noticed that: “When people enter the computer centers they left their ethics at the door”. In 1966 the first criminally prosecuted case was recorded in Texas, USA and resulted in five year sentence. However a bulk of offences is unreported till now, never prosecuted and unknown subsequently to the public. Annual Computer Crime and Security Surveys conducted by the CSI/FBI depict that between 1999-2006 30% to 45% responders did not report computer intrusion due to fear of negative publicity. In the era of 1970 to 1990 personal computers became relatively common and low-priced. Individuals parallel to the businesses arose to use them in their daily routines; subsequently law enforcement agencies observed the arrival of a new class of crime: individual level crimes related to the computer. By the 1990s law enforcement agencies had become aware of crimes related to computers

Computer Forensics  11 in technological advanced countries and had developed the systems to investigate and prosecute such activities. Numerous research centers and scientific groups were designed; the software industry started to work over and offer the various specialized tools to aid in investigation of computer and digital crimes. For clear understanding crimes related to computer can be classified in three major classes: Computer centered crimes, Computer assisted crimes, Incidental computer crimes. First of them are the activities to target the computer systems, computer networks, storage media and other devices of the computers. The activities involved hacking passwords, damaging, changing data, disturbing functions of devices, changing contents over websites etc. Second class depicts the use of computers as a tool to assist in criminal activities where the use of computers is not essential (e.g. child abusing and pornography). It can be realized as a new way to commit the conventional crimes. Third class of criminal activities is that in which the use of computer systems is incidental such as computerized accounting used to keep records of drug transferring. The use computer is to replace conventional tools like bookkeeping ledger in the form of a paper book replaced by accounting software. On the hand various tests through computers were used by courts to determine the merits of evidence presented [17]. Some important milestones of Digital Forensics from its history are here: • First Hans Gross (1847–1915) used the scientific study to head criminal investigations. • In 1892 Juan Vucetich, an Argentine chief police officer, created the first method of recording the fingerprints of individuals on file. • Sir Francis Galton a British anthropologist initiated the fingerprints observations as a means of identification in 1880’s. • FBI set up a laboratory in 1932 to offer forensics services to the agents of all field and to the other law authorities across the USA. • The first computer based crime was acknowledged in 1978 in the Computer Crime Act of Florida. • The computer forensics term was firstly used in academic literature in 1992. • International Organization on Computer Evidence (IOCE) as an institution for computer based forensics and investigation was formed in 1995. • The First FBI Regional Computer Forensic Laboratory established in 2000.

12  Modern Forensic Tools and Devices • In 2002, Scientific Working Group on Digital Evidence (SWGDE) published the first book about digital forensic called “Best practices for Computer Forensics”. • Simson Garfinkel recognized issues which was facing the digital investigations in 2010.

1.6 The World of Crimes An offense which merits public condemnation and punishment, generally by the mode of fine or detention is a crime. Criminal offense is generally prosecuted by the State, while it is typically up to an individual to take an action to a court in state. The individual may begin criminal proceedings, but it is rare. Some matters (like assault) can be both civil and criminal wrongs at same time. The police may prosecute for that, the victim can take civil action for recovering money or any other compensation for injury may be suffered. The expansion in computer, internet, and mobile technologies is spawning newer criminal behaviors and creating diversified environments for criminals to commit technology based crimes which are named as cybercrimes. “The criminal activities through computers, internet, mobile digital devices and other related technologies or use of these devices and technologies in committing of crimes are known as cybercrimes.”

Technology specific crimes have taken a huge space in criminal world and they are not possible without the use of digital devices such as computers, PDAs (mobile technologies) and internet technologies. Traditional crimes are also being committed with the assistance of these technologies as well. So, digital and internet technologies have raised the range of crimes [18].

1.6.1 Cybercrimes vs. Traditional Crimes Cybercrimes deviate from traditional crimes in different ways. Major difference is that the traditional crimes are committed in a specific geographical location but cybercrimes have no geographical boundaries because internet facilitates criminals to the individuals, institutions and businesses across the world. The other difference of ease and speed in crime commitment. The computational and communication technologies not only created easiness but also amplified the speed to conduct the criminal

Computer Forensics  13 activities. Before these technologies era if someone wanted to rob a bank, he/she had to commit it in the routine operation or working hours and if someone wanted to steal money from a financial institution, had to wait for closing hours. In both activities physical involvement was necessary. But now due to online activities physical restrictions do not applied longer and billions of dollars can be robbed or stolen through online hacking accounts or related activities remotely from banks, companies or other financial institutions within minutes. Correspondence among the individuals has exponentially increased due to these faster technologies. It also raised fake and fraud communication among people such as fake e-mails, messages, advertisements, videos and audios which are also criminal activities and can be part or as a whole cybercrimes [19]. In the past theft of information was difficult because it was presented on papers and stealing papers was a physical act and involved risks but in these days by hacking of computer, PDAs or e-mail accounts through some keywords any type of information can be stolen without any hard physical participation. Social media such as Instagram, Facebook, Twitter, MySpace made easier this type of access. Social networking was safe and secure in its early days but at this time it has become a risky chapter. The National Academy of Science quoted: “The modern thief can steal more with computer than a gun. Tomorrow’s terrorist may be able to damage more with keyboard than with a bomb.”

Computer, mobile, and internet technologies help in commission of crimes as well as provide information about crimes. Different evidence sources about certain crimes such as child pornography, drugs dealings through these technologies are also available over the globe. Drug dealers may use encrypted e-mail messages to deal in prohibited and illegal substances. They arrange meetings to distribute the substances, exchange recipes to make new drugs through restricted chat rooms. Dangerous criminals who engaged in organized crimes or terrorism may store their targets and evidences to access them and commit crime. Criminals also upload and download information about their crimes, weapon constructions, and techniques to do crimes. Nowadays cookbooks and handbooks which provide logistical information about all these activities are also available on internet and helpful in major crimes are being committed in all over the world today. The logistical information about mechanical and chemical weapon construction, bomb and bullets making guidelines, sniper trainings, establishing bunkers, secret houses and training campus are drawn or shared trough internet [20].

14  Modern Forensic Tools and Devices

Terrorism “Terrorism is an act of creating fear among common people by using of illegal means. It is done for threatening to humanity. It takes in person or group spreading violence, burglaries, riots, kidnappings, rapes, bombings, fighting, etc. It is an act of cowardice.”

Two types of terrorism is common in this era one is the political terrorism which generates panic on an outsized scale and the other is criminal terrorism which is kidnapping, rapes, bombings, fighting etc. Both of the types are involving the use of technologies. Political terrorism is more crucial than criminal because it is done by and well-trained personalities. It becomes challenging for law enforcing agencies to control and arrest the people in time. However, the information technology experts in agencies are playing a vital role to control this type of terrorism. Criminal terrorism is more focused form of terrorism to control by the law enforcement agencies because it is caused to physical killing and damaging the people and losing assets of the nations. Because in modern era terrorists of all the types are using technologies such as computers, mobiles, digital and communication technologies so agencies are also updating their technological skills, upgrading their crime counter systems and trying to make safe the globe.

Organized Crimes “The criminal activities performed and controlled by powerful people on a large scale through a planned way are organized crimes.”

Organized crimes are the form of corruption which are committed and maintained by political leaders through public officials. The use of intimidation, force, or threats to protect its operations is very common. Different organized criminal groups use computer and internet technologies to communicate each other and conduct their illegal business activity. This business activity can create ephemeral form of  organization  where the Internet is used to link up reprobates to commit the offline crime, after that they dissipate to form new alliances. All processes like this are performed through technologies. On the other side law enforcement agencies and judiciary systems are also involving computer, other digital technologies to control and counter these types of crimes and corruptions.

Internet Gambling Internet gambling or online gambling is a kind of gambling conducted on the internet. Real money online gambling over the globe through different

Computer Forensics  15 sites has grown. The first gambling Web site launched in the mid-1990s and rose in popularity, mainly in United States. Numerous websites on the internet provide services for treating money illegally such as gambling on different events, political activities and sports. A huge number of websites are providing services for such activities on payments. They provide paid accounts (user id and password) for doing games on events to the users [21].

1.7 Computer Forensics Investigation Steps Four different procedural steps are involved in computer related forensics investigation i.e. acquisition, identification, evaluation and presentation. In Figure 1.1, we have step wise simpler and understandable view of forensic steps.

Acquisition This step involves retrieval, collection, and documentation of evidence which sets the direction for investigators to do what in investigation process. Forensic specialist prepare a comprehensive documentation which cover all aspects related to the investigation such as some queries about evidence are cover like who found the evidence, where from evidence was collected, when was collected the evidence etc. Computer forensic experts may collect evidence in different ways such as:

Acquisition

Identification

Evaluation

Presentation

Figure 1.1  Forensics investigation steps.

16  Modern Forensic Tools and Devices • Onsite searching the computers or digital devices • Storage devices are captured and detail examined onsite or offsite • Computer and other digital and storage devices can be seized so that their content can be retrieved and reviewed offsite for evidence collection. Onsite search puts direct impact in which investigators directly approach to the digital devices to get evidence on the other hand offsite search refers to the actions taken outside, away or later on for investigation. Offsite investigation may have more ambiguities than onsite investigation due to some reasons like mismatch, failure, or lack of negligence of investigators. If search for investigation can be easily done onsite, there is not any justification to seize computer or other digital devices for offset search. But in some special cases where involve large storage, complex software applications and hardware factors there offsite search is inevitable [22].

Identification In this step investigators identify the origin of evidence, significance of the origin. Investigators explain different aspect, point out facts in each aspect and document them in the manner so they can help to reach realities. Evidence is interpreted from different perspectives and contexts and elaborated to make easier to understand. It is viewed at both logical context and physical environment of the evidence lactation. If evidence data resides on digital storage media such as hard disk drive, flash drives then it is extracted through keywords or file craving methods. File craving is the method of searching files on the basis of different identifiers like headers, footer and footnotes etc. sometime cybercriminals delete the data which can become evidence later on, damage media or corrupt files and folders, investigators recover this data or files containing data through different ways [22].

Evaluation Evidence data retrieved during investigation is analyzed for estimation of its significance and relevance to the case is evaluation. Digital Evidence indicates the suspects of crime and victim. It sets the direction in which case is solved in right way and right time. Investigators do their best to

Computer Forensics  17 determine who, where, when, why and how crime was committed based on retrieved digital evidence. Conclusion from the evidence is drawn which support proceeding of policy violations of the company or institution. Prosecution in criminal court or civil lawsuits present well examined reliable digital evidence [23].

Presentation In this step data after evaluation is reported in convenient to understand format so that outside parties can easily understand and evaluate the evidence. For better presentation, investigators should good presenters or they call aid of professional presenters. Data should be able in the testified form so that is must be able to defend the case in court. Stand operating procedures should be followed to handle evidence data for its better validity in court or against dimensioning party. Evidence data handling reflect the abilities and qualifications of investigators. This data depict findings about case to the lawyers, judges, administrative persons, officials, and corporate managers to reach the right decision. The custody claims (chronological records of evidence) may be challenged at any stage [24].

1.8 Report Generation of Forensic Findings Through Software Tools With the help of numerous software tools, the log files of forensics analysis activities can be generated and reports of these activities can be created to provide appropriate information from findings about the a case. Although these reports focus on “what found” and “from where it found”, ruminate that it is the charge of report writer to make clear the significance of the recovered evidence. If there is a need to define any limitation or uncertainty that is applied on findings it must be written in report. These log and reports are normally in plain text, sheet, or HTML format. A report writer can use package such as Microsoft office or custom built software like inventory application of an organization for writing activity. For instance the management at Super Bicycles, Inc. needs to know the unauthorized and authorized applications on computer of an employee to ensure that everyone is complaining with software licensing. Autopsy for Windows can be used for finding evidence and generation of finding’s report [25].

18  Modern Forensic Tools and Devices

1.9 Importance of Forensics Report The investigators or forensic experts write a report for communication about the results of forensic analysis and examination of computers, digital mobile devices, and network systems. This forensic report presents digital evidence to support further investigation that can be admissible in the court of law, at any administrative hearing, or in any affidavit to maintenance issuing a search warrant or an arrest. The report may also offer justification to collect more evidences and can be used at a probable cause of hearing, as the evidence in a magnificent jury hearing or an indication hearing in the criminal or civil cases. Furthermore, if any employer has to investigate misconduct of an employee, a report has to be designed on the basis of disciplinary action. Besides the facts presenting the report can communicate expert opinion. The report should be first testimony in a case. It must be expected that report can be examined and cross-examined. The opposing counsel may be looking for an opportunity to attack over facts presented, whether determined them by self or taken out from the other reports or expected testimony of some other witnesses. What facts can affect opinion and what facts don’t? The expert witness should be aware that lawyer uses services called deposition banks (libraries), which store examples of expert witnesses’ previous testimony. Although information in reports are not specific but it should be deposition notice or subpoena so that it can include the information like Cause number, location and Date of the deposition, Name of the deponent (the person testifying at deposition), there is not any requirement to include details of previous testimony in a report, although it should be summarized key points of testimony for the future reference and could be kept transcripts of former testimony, if that is obtainable [26].

1.10 Guidelines for Report Writing The client for report may be a detective, or an attorney, or an investigator would define the mission or goal mission of investigation. All of the reports should be started by stating goal or mission which is frequently to find facts related to the subject, recovering of significant documents, or to recuperate certain types of files, names of files, and dates and times. Clear definition of goals can reduce cost and time of the examination.

Computer Forensics  19 It is exclusively important by increasing size, number of hard drives and the complexity of networks. Before beginning to write, identification of audience and purpose of the report must be clear which can help to emphasis on particulars. If the audience is little bit technical, reporter should dedicate part of the report for educating them about technical issues. It can be done with a conventional paragraphs may be available in hands, although stock definitions should be updated periodically. In the writing of an investigation report the law requires an expert who utilizes knowledge related to the occurrence or system; opinions must be stated by response to hypothetical questions asked by the expert to witness for expressing an opinion based on suppositious facts without referring to a particular situation or system. In this respect the expert witness (forensics investigator) differs from an ordinary witness. He/she sees or hears the incident in dispute and gives evidence with solid opinion based on professional experience and acquaintance, even if that may never have seen the data, system or sight. The investigator summarizes the findings to identify the systems examined, tools used, and he/she has seen. State the evidence identified, preservation or protection accesses have handed down. The subsequent list indicates additional items to include the report: Abstract the date and estimated cost for completion of effort, identify the tentative conclusion rather than that of preliminary conclusion and identify areas which may be used for further investigation for getting confirmation from attorney for the scope of examination [26].

1.11 Objectives of Computer Forensics The major Computer forensics objectives are to retrieve, analyze and preserve the computer data in such a way that is can help the investigation teams for presenting it as evidence in court of law. • It supports to assume the motives behind the offense and individuality of main culprit. • It guides to design the procedures at a suspected scene of the crime that helps to ensure that the evidence taken from digital media is not corrupted. • It ensures recovering deleted data files from removed partitions of digital media for extracting and validates the evidence.

20  Modern Forensic Tools and Devices • Helps in identifying the evidence speedily, and permits to estimate the possible impact of the malevolent activity happening with victim • To produce computer or digital forensics report a major part of the whole investigation process. • The chain of custody preserves the evidence in computer forensics.

1.12 Challenges Faced by Computer Forensics The use of computers, digital devices like PDAs, and internet is increasing exponentially day by day the major challenges faced are: • Various hacking tolls are easily available in these days and in coming future they seem to be accessible freely. • Physical evidences are becoming rare which making difficult the prosecution. • The huge storage amount in Terabytes, Petabytes is making difficult the investigation jobs. • All technological changes require the up gradation or changes in solutions of forensics [27].

References 1. Shrivastava, G., Sharma, K., Khari, M., Zohora, S.E., Role of cyber security and cyber forensics in India. In Handbook of Research on Network Forensics and Analysis Techniques (pp. 143–161). IGI Global, 2018. 2. Sadiku, M.N., Tembely, M., Musa, S.M., Digital forensics. Int. J. Adv. Res. Comput. Sci. Softw. Eng., 7, 4, 274–276, 2017. 3. Woods, K., Lee, C.A., Garfinkel, S., Extending digital repository architectures to support disk image preservation and access, in: Proceedings of the 11th Annual International ACM/IEEE Joint Conference on Digital Libraries, pp. 57–66, June 2011. 4. Veloso, J.M.N., Automated Support Tool for Forensics Investigation on Hard Disk Images, Doctoral Dissertation, NOVA University of Lisbon, 2020. 5. Aljaedi, A., Lindskog, D., Zavarsky, P., Ruhl, R., Almari, F., Comparative analysis of volatile memory forensics: Live response vs. memory imaging, in: 2011 IEEE Third International Conference on Privacy, Security, Risk and Trust and 2011 IEEE Third International Conference on Social Computing, IEEE, pp. 1253–1258, October 2011.

Computer Forensics  21 6. Graziano, M., Lanzi, A., Balzarotti, D., Hypervisor memory forensics, in: International Workshop on Recent Advances in Intrusion Detection, Springer, Berlin, Heidelberg, pp. 21–40, October 2013. 7. Thing, V.L., Ng, K.Y., Chang, E.C., Live memory forensics of mobile phones. Digit. Investig., 7, S74–S82, 2010. 8. Segell, G.M., Intelligence methodologies applicable to the Madrid train bombings, 2004. Int. J. Intell. Counterintell., 18, 2, 221–238, 2005. 9. Prasad, R. and Rohokale, V., Bluetooth communication, in: Cyber Security: The Lifeline of Information and Communication Technology, pp. 161–173, Springer, Cham, 2020. 10. Qamar, A., Karim, A., Chang, V., Mobile malware attacks: Review, taxonomy & future directions. Future Gener. Comput. Syst., 97, 887–909, 2019. 11. Mohan, V., Cell phone cloning: Techniques, preventions and security measures. Int. J. Phys. Soc. Sci., 9, 7, 1–11, 2019. 12. Pluskal, J., Breitinger, F., Ryšavý, O., Netfox detective: A novel open-source network forensics analysis tool. Forensic Sci. Int.: Digit. Investig., 35, 301019, 2020. 13. Devendran, V.K., Shahriar, H., Clincy, V., A comparative study of email forensic tools. J. Inf. Secur., 6, 2, 111, 2015. 14. Khan, M.Z., Husain, M.S., Shoaib, M., Introduction to email, web, and message forensics, in: Critical Concepts, Standards, and Techniques in Cyber Forensics, pp. 174–186, IGI Global, AMU, India, 2020. 15. Freeman, L., Digital evidence and war crimes prosecutions: The impact of digital technologies on international criminal investigations and trials. Fordham Int. Law J., 41, 283, 2017. 16. Hayes, D.R., A Practical Guide to Computer Forensics Investigations, Pearson Education, United Kingdom, 2015. 17. Huebner, E., Bem, D., Bem, O., Computer forensics–past, present and future. Inf. Secur. Tech. Rep., 8, 2, 32–46, 2007. 18. Mohammed, S., An introduction to digital crimes. Int. J. Found. Comput. Sci. Technol., 5, 13–24, 2015. 19. Zhang, Y., Xiao, Y., Ghaboosi, K., Zhang, J., Deng, H., A survey of cybercrimes. Secur. Commun. Netw., 5, 4, 422–437, 2012. 20. National Institute of Justice (NIJ), US Department of Justice, Office of Justice Programs, & United States of America, Electronic Crime Scene Investigation: A Guide for First Responders, National Institute of Justice, U.S. Department of Justice, Washington, DC, 2008. 21. Maras, M.H., Computer Forensics: Cybercriminals, Laws, and Evidence, Jones and Bartlett Learning, Burlington, MA, USA, 2015. 22. Luttgens, J.T., Pepe, M., Mandia, K., Incident Response & Computer Forensics, Nikkei BP. Inc, USA, April 2016. 23. Okereafor, K. and Djehaiche, R., A review of application challenges of digital forensics. IJSSST, 21, 2, 35–1, 2020.

22  Modern Forensic Tools and Devices 24. Wickramasinghe, S. and Hettiarachchi, S., Use of Computer Forensics and Its Implications, Horizon Campus, Malabe, Sri Lanka, 2016. 25. Nelson, B., Phillips, A., Steuart, C., Guide to Computer Forensics and Investigations, Cengage Learning, Boston, MA, 2014. 26. Brannick, M.E., Guidelines for Forensic Report Writing: Helping Trainees Understand Common Pitfalls to Improve Reports, University of Denver, USA, 2015. 27. Bouafif, H., Kamoun, F., Iqbal, F., Marrington, A., Drone forensics: Challenges and new insights, in: 2018 9th IFIP International Conference on New Technologies, Mobility and Security (NTMS), IEEE, pp. 1–6, February 2018.

2 Network and Data Analysis Tools for Forensic Science Shrutika Singla1, Shruthi Subhash1 and Amarnath Mishra2* Amity Institute of Forensic Science, Amity University Noida, Uttar Pradesh, India 2 Lloyd Institute of Forensic Science, Knowledge Park - II, Greater Noida, Uttar Pradesh, India 1

Abstract

With the advancing technologies and innovative networking ideas, Internet has totally eradicated the physical platform that existed before. This utilization of networking has broken down all the records with rapidly expanding technology, but this utilization of web is correspondent to the ratio of cybercrimes. Crimes operated with the help of computer systems can be manipulated and exploited in various ways as there are plenty of people having expertise in computer handling. So, one should implement a possible way to prevent or eradicate it. Network forensics is a sub branch of digital forensics that basically regulates analysis of network traffic to the collaboration of information, evidence collection and detects any cyber-attacks. The aim of this work is to study the need of data analysis and the tools for data analysis in digital forensics. Keywords:  Digital forensic, forensic tools, cloud computing, cybercrimes, data extraction

2.1 Introduction Digital forensics is amongst the old fields that deals with the analysis and acquisition of data found on individual computers, especially laptops, PC’s, workstations, and servers. Data remains in non-volatile state in the hard disk and in the main memory. Speaking of data, the term data refers to small pieces of digitalized information which is in a specified *Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (23–40) © 2023 Scrivener Publishing LLC

23

24  Modern Forensic Tools and Devices format. The increasing demand of computers for personal as well as professional purpose and ever-increasing popularity of connections have doubled up the requirement of tools that can particularly analyze ­never-ending supply of data from many sources [1] Data can be collected as well as reassigned by illustration, data may be stored or transferred by standard PC framework (e.g., desktops, laptops, servers), networking equipment (e.g., firewalls, routers), personal digital collaborators (PDA), CDs, DVDs, hard drives, backup tapes, flash memory, thumb drives, and hop drives. Numerous customer hard wares can likewise be utilized to stock up data; for instance- video games, computerized sound players, cell phones and advanced video recorders [2]. This expanding array of information sources has relieved to prod the advancement, evolution and clarification store of data analysis tools and techniques. This has evoked the acknowledgement that such tools and techniques can be used for many aims, such as reconstructing PC security episodes, investigating functional issues and recovering from inadvertent framework harm and accidental system damage. Application of scientific knowledge for criminal justice systems is characterized as Forensic science. Digital forensics, additionally referred as Network forensics, has several definitions [3]. It deals with differentiation, examination and assessment of digital evidence via application of science whilst keeping the integrity of the data and maintaining a proper chain of custody. Network forensics exploits same tools and techniques like data analysis, but latter does not incorporate the fundamentals for protecting the integrity of whole data gathered and also does not secure a chain of custody and other evidence protection activities [4]. Nowadays many crimes are occurring digitally and to solve those crimes digital forensic is important. Crime does not means the physical attack on the system but the attack using network packets and server has become a threat to the real world [5]. Digital forensic is not only used for crime resolution, but it also helps in regular monitoring of the network, analysis of upcoming threat and troubleshooting. There are many tools that have been designed to solve the problems related to digital forensics [6]. In many cases, data might be deleted from the storage device. Digital forensic tools also helps in restoring the deleted and corrupted data to work upon it [7]. In this chapter we are going to study the need of

Network and Data Analysis Tools  25 data analysis and its steps, network security and tools used in digital forensics.

2.2 Necessity for Data Analysis The following mentioned are the purposes of computer and network data analysis [8]:

2.2.1 Operational Troubleshooting Trouble shooting issues like tracking down the digital and actual area of a host with a mistaken organization, auditing current framework and application arrangements can be done with the help of numerous information analytical tools and techniques.

2.2.2 Log Monitoring Various tools and procedures can help with observation of log, for example, examining log passages and connecting log sections across different frameworks. This can help with incident handling, recognizing strategy infringement, reviewing and different endeavors.

2.2.3 Data Recovery One can easily recover lost data from PC systems with the help of various tools. Data which has been unintentionally or intentionally buried, overwritten or in any case altered. Amount of the data that can be recovered depends upon varying situations.

2.2.4 Data Acquisition Various tools can be used to extract data from hosts that are being revived. For example, when a client leaves a particular company where he used to work, then the data from the client can be acquired and shifted in such an action that the information is mandatory in case the data is needed for any purposes in the future. The workstations media would then be able to eliminate all of the first client’s information.

26  Modern Forensic Tools and Devices

2.3 Data Analysis Process The data analysis process is composed of the following phases.

2.3.1 Acquisition The principal stage is obtaining information from the potential sources of pertinent information, following systems that protect the trustworthiness of the information. For instance, acquisition is normally acted in a timely designed manner because of the probability of losing data such as current organization associations [8].

2.3.2 Examination Examinations include utilizing mechanized strategies to filter through enormous measure of procured information, extracting and distinguishing information of particular interest.

2.3.3 Utilization The following stage is announcing the consequences of the assessment, which may incorporate the activities utilized in the assessment and suggestions for development [8]. The convention of the utilization step fluctuates incredibly relying upon the circumstances greatly depending on the situation.

2.3.4 Review Survey performing audits of cycles and practices within the context of the current undertaking can recognize strategy shortcomings, procedural blunders and different issues that should be tended to. Examples picked up during the survey stage ought to be fused into future information investigations.

2.4 Network Security and Forensics Network security deals with the detection and prevention of the bug and virus attack in any system (Figure. 2.1) [8]. It includes detection of firewalls and use of anti-virus tools. Nowadays, attackers have become skillful and

Network and Data Analysis Tools  27 • helps in determining the current state of network and network packets being received and delivered

Real-Time Monitoring Threat IntelligenceEvent Correlation

• helps in determining any new threat associated with any event going on in the network or from different network source

In-depth Analysis of Possible Threat

• helps in determining the origin and source of threat that has been/will be received by the system

Troubleshooting

• helps in solving many problems related to the system and network

Figure 2.1  Network security and forensics.

Acquisition

Examination

Utilization

Review

Figure 2.2  Computer and network data analysis process.

knowledgeable, due to which by using different tools and sources, one is not able to detect the bug in the system. This make it more important to work on network security to identify the attacker and to improve the condition of systems. Network security helps in collection and detection of data packets that are derived from different sources to analyze those and to prevent future attacks [8]. Not only network forensic determine the attackers, but it also helps in real-time monitoring, threat intelligence-event correlation, in-depth analysis of possible threat and troubleshooting as explained in Figure 2.2.

2.5 Digital Forensic Investigation Process Digital Forensic is a sub- type of forensic science which deals with the crime and events in digital form [9]. It helps in collecting, preserving and analyzing he digital evidences obtained from the crime scene such as laptops, PCs, tablets, mobile devices, etc. It also involves the step or report formation to present in the court of law [10]. The result of digital forensic is

28  Modern Forensic Tools and Devices Data Identification

Project Planning

Data Capture

Data Display

Data Analysis

Data Processing

Report Generation

Figure 2.3  Digital forensic investigation process.

very important legally, which makes the forensic scientists to follow certain steps to present the report in court of law [11]. During earlier days, the investigation process was divided according to different classification. According to one study, the process is divided into 4 steps-acquisition, identification, evaluation and admission as evidence [12]. According to other study, the complete process is divided into identification, preservation, collection, examination, analysis, presentation and decision [13]. In this chapter, the steps for solving digital forensic cases involves Data Identification, Project Planning, Data Capture, Data Processing, Data Analysis, Data Display and Report Generation (Figure 2.3). These steps are briefly explained in the following section.

2.5.1 Data Identification It is of most extreme significance to the forensic experts to decide and record what legal power exists for the securing and assessment of the devices just as any constraints put on the media before the assessment [14].

2.5.2 Project Planning The analyst will recognize how in-depth the assessment should be based on the information mentioned. The objective of the assessment has a

Network and Data Analysis Tools  29 critical effect in choosing the tools and procedures to look at the devices [15].

2.5.3 Data Capture For example cell phones are expected to convey by means of cell phone networks, Bluetooth, Infrared and Wi-Fi’s. At the point when the device is connected to a network new information is added to the phone via approaching calls, messages, and application information, which changes the proof present on the gadget [8].

2.5.4 Data Processing Once the information or the data is gathered, the actual handling starts. Physical acquisition is the favored strategy as it separates the raw memory information, and the gadget is ordinarily powered off during the acquisition cycle [16].

2.5.5 Data Analysis For instance all image records ought to be hashed after procurement to ensure information stays unaltered. If file system extraction is upheld, the analyst removes the file system and processes hashes for the extracted documents. Afterward, any independently extracted record hash is determined and checked against the first worth to confirm its integrity. Any inconsistency in a hash should be reasonable [17].

2.5.6 Report Generation The forensic expert is needed to report all through the assessment cycle as contemporaneous notes identifying with what was finished during the procurement and assessment. When the experts finish the examination, the outcomes should go through some type of peer-review to guarantee the information is checked and the examination is finished [18].

2.6 Tools for Network and Data Analysis Tools are the equipment used for the collection and analysis of digital evidence from the crime scene. These are used by the programmers and cyber

30  Modern Forensic Tools and Devices forensic investigators to know the source of the evidence. These tools are also used to find out the discrepancies in the evidence found at the crime scene. Digital evidence can be obtained from digital devices such as laptops, mobile phones, hard disks, pen drives, SD cards, CCTVs, etc. Tools can be used for free which are available on the browser and can also be bought for commercial use [18]. Before analyzing any digital evidence, it is very important to collect the evidence and to extract the data from the source such as images, emails, PDFs, and many others. Evidence is collected by the forensic investigators, also known as first responder who visits the crime scene. It is very important for forensic investigator to collect and preserve the evidence as it is, without any disturbance in the data. Extraction of data is a crucial step which needs proper attention of the investigator. Not only visible data, but deleted data can also be extracted from the evidence. Extraction of data requires tools. Tool selection is a crucial step in any digital forensic investigation because it involves proper extraction and analysis of data without leakage of any information to other devices and applications. Tools can be in the form of hardware or software which may be available commercially or can be available on any open source which can be used by anyone. For a proper and truthful result, it is very important to select the tool specially designed for a purpose. It would be great to choose commercial tool as that will be then used only by the investigators and they also have more value in market. After extraction of data, analysis of data is done which helps in solving a criminal case. This step involves the examination of data, report making and presentation of report in court of law. Depending on the type of the digital evidence, tools can vary [19]. In this section, we will study about different tools used in digital forensic for the analysis of digital evidence.

2.6.1 EnCase Forensic Imager Tool EnCase Forensic Imager Tool is flexible and used for complete investigation for network and data analysis. It can be used to obtain data from different devices including mobile phones, tablets, windows, iOS, and many others [20]. It is used extensively as it is to preserve the uniqueness of evidence and follow the ethics of crime scene investigation without releasing any information to other authority [21].

Network and Data Analysis Tools  31 This tool works on the copy of the original data made by itself from the digital evidence obtained. The authenticity of the data is proved by using Hash Value. It breaks down the data in parts and the analyze it, followed by publishing the result. About 85% of the industries including banks, govt. offices and merchandise stores use this tool for analysis of data [22].

2.6.2 Cellebrite UFED UFEDs (Universal Forensic Extraction Devices) have been developed by Cellebrite for the examination of digital evidence found in digital forensic cases. This tool consists of personalized kit including laptops, operating software, data cables, etc. [22]. This tool can be considered as all-in-one tool as it can do the function of extraction of data, its collection, making copies of data, decoding, analysis and report making. This tool can be used in different range of digital devices including mobile phones, tablets, and many more. It is highly efficient tool as it can detect malware and other viruses, if present in the data containing evidence. It can easily remove passwords so that the matter of the device such as contacts, emails, messages, media memory, call logs are easily accessible. It can also cope the data of SIM Card so that mobile phones and tablets can be kept in no- network zone and analysis can be continued [23].

2.6.3 FTK Imager Tool FTK Imager tool is manufactured by Access Data Group. FTK Tools is used extensively over the globe including courts as it could be used for all types of devices including mobile phones, iOS, tablets, PCs and laptops. It gives faster results as compared to other tools and can also store big amount of data or a data derived from any organization for analysis [24]. FTK imager tool could be run with the help of a pen drive or hard disk in any PC. It allows complete analysis of data without harming it. It is widely used by banks to locate debit and credit card numbers. It can also be used to compare the images, if they are from same source or from different source by comparing the hash values [25].

32  Modern Forensic Tools and Devices

2.6.4 Paladin Forensic Suite Paladin Forensic Suite was developed with the idea of Ubuntu so that analysis in forensic science can be made easy. Paladin Tool provides an easy way to search videos and images in the digital devices. It has been classified on the basis of categories being searched on like Social Media Analysis, Video Examination, Image Detection Tools, and others. It is very useful tool for extraction and obtaining the volatile data which may include the Random-Access Memory and also the browsing history of the web browser and copying them to various storage devices such as USB devices. It can be used in different Operating Systems like iOS windows, Android window and also Linux [26].

2.6.5 Digital Forensic Framework (DFF) DFF investigation tool has been created on an altered Application Programming interface with an open source. It can extract data that has been deleted from USB and other storage devices. It can also derive web browse history data if deleted and can also extract letter drops from Microsoft [27].

2.6.6 Forensic Imager Tx1 This tool is a hardware tool which is used widely for cloning and duplication of the data found in digital evidences. Forensic Imager Tx1 provides an easy way for a forensic investigator to handle digital evidences found at the crime scene. It can be used for other storage devices such as USB and also for drive connections including PCIe, SAS, etc. It can also clone data to other destinations up to four. Forensic Imager Tx1 is faster as compared to other devices and imaging in 2-3 devices can be done simultaneously using this tool [28].

2.6.7 Tableau TD2U Forensic Duplicator Tableau TD2U Forensic Duplicator is also a hardware tool which has high proficiency for forensic imaging. It is cheap and multi- functional. It can do the function of cloning from disk-to-disk, cloning from disk-to-other storage devices, wiping data, verification of hash values, checking of empty disk.

Network and Data Analysis Tools  33 It is used in various industries due to its various characteristics such as high wiping speed up to 25–30 GB per minute; it can image SATA and USB devices; it can create as much copies of digital evidences and at a faster rate [29].

2.6.8 Oxygen Forensics Detective Oxygen Forensics Detective is a tool which was manufactured for the derivation of data from different sites including Google storage and other Google applications, cloud backups, SIM cards, SD cards, etc. It has been useful in digital forensic science for solving many digital crimes and for the same reason it is being used by law enforcement agencies, army personnel and police officials. It can decrypt the encrypted applications and devices to extract data including images, videos and contacts at different sites such as windows, iOS and Linux. It also plays an important role in biometric identification of individual in electronic devices [30].

2.6.9 SANS Investigative Forensic Toolkit (SIFT) SIFT Tool is mostly used by investigators at national and international levels. It is a collection of free tools that is used to examine digital evidences in forensic science. It is available publicly with no cost, anyone can use these tools. The major advantage of this tool is that it can do live examination of the evidences and can prepare report in very less time. It helps in providing tools which can perform in- depth investigation of systems. It can detect malwares and other bugs if present in any device. It can be used in any of the system including iOS, windows, Linux, and Ubuntu and it can also carry different formats of digital evidence such as raw format (DD) and E01 [31].

2.6.10 Win Hex This tool is very helpful in digital forensic investigation for recovery of actual data in its original format that has been tempted earlier. Win Hex tool can be used to extract data from various devices including hard disk, floppy disk, CD-ROM, USBs, RAM and even from windows and Linux. It can analyze and compare files side by side. It can also be used for big sized files and it is easy to use. It gives result quicker.

34  Modern Forensic Tools and Devices It can wipe confidential data from storage devices without pirating the privacy of the device.

2.6.11 Computer Online Forensic Evidence Extractor (COFEE) COFEE is a live analysis tool which has been created by Microsoft to help law enforcement agencies only to solve crimes related to digital forensics. Till now, this tool is not available to local public. It consists of different programs and an interface which help in collecting data and it is stored in an external storage device, for example USB drive. This tool will start running whenever the USB is inserted in the device. This tool can derive data from the device without making any changes in the original data and applications. It can be used on different platforms, including Windows, Linux and Unixn [32].

2.6.12 WindowsSCOPE Toolkit WindowsSCOPE toolkit is available in both software and hardware forms. It is a memory based forensic analysis tool which extract the deleted and dumped file from storage devices. It extracts data using reverseengineering phenomenon. It can extract data from physical memory as well as running software. It can also detect malwares and viruses in any operating systems. It is an advanced tool which is used in more than 20 countries of the globe including Europe, USA, and China [33].

2.6.13 ProDiscover Forensics ProDiscover Forensic Tool is widely used among law enforcement agencies and corporate offices for the cases related to cybercrimes. It is highly efficient in decrypting the files and important information from the device. It duplicates the original data to work upon and to protect it. This tool makes easy for the investigator to search the suspected data in the device. Raw format images can be verified and exported. Comments and suggestions could be added while examining any digital evidence to make the report more efficient and clearer. It can be used in Mac, windows and

Network and Data Analysis Tools  35 Linux. This tool is being used in more than 70 countries over the globe [34].

2.6.14 Sleuth Kit Sleuth Kit along with Autopsy helps in analysis of evidences in digital forensics. It can recover images and other files such as contacts, call logs, messages and many more from the disk storage and analyze them, which is followed by the formation of report. It can also categorize different files according to their type which makes it easy to search the data required. It also helps in searching files and other folders according to their storage path or location. Sleuth Toolkit is an efficient kit to work on emails and images. It also make analysis of image an easy task by providing the thumbnail to the images being shown [35].

2.6.15 CAINE Computer Aided Investigative Environment (CAINE) is a Linux-based open-source software that provides an easy tool in digital forensic investigations (collection and preservation of evidences, examination and analysis, and at last report formation). It is highly proficient in obtaining data from Random Access Memory of a device. It provides a graphical interface which is user-friendly [36].

2.6.16 Magnet RAM Capture Magnet RAM is a tool freely available to public. It can easily extract the data from the memory of the digital devices including computers and tablets to analyze them. This tool has small memory that means forensic analyst can use this tool by lowering the expanded memory of the data. It can receive and send the data in raw format. This tool can be used in different versions of windows – Windows 7, 8, 10, XP, etc. The major advantage of this tool is that it can extract the data from RAM easily which include encrypted files and data, passwords, activities done on the device, malware and bugs information, browsing data history and network connections, and many more [37].

36  Modern Forensic Tools and Devices

2.6.17 X-Ways Forensics X-way Forensic tool is used for the duplication of data in the storage devices and its imaging. It is much faster tool as compared to others as it can search dumped files at a higher rate. It is a portable software which can be used if present in any external drive such as USB drive. It does not need installation, if present in USB drive. And if installed, it gets downloaded in very less time. Data can be read in the raw format (.dd) using this tool. This tool could be used in different windows including windows 7, 8, 10, XP, 2008, 2012, 2016, Windows Vista and many more [38].

2.6.18 WireShark Tool WireShark is an open-source tool which is used for network analysis. It is used for solving problems in network packets. It can also analyze and verify another network traffics that pass through any electronic device. Files and data in any format could be read with the help of this tool. Even compressed files can also be analyzed. This tool also helps an investigator to focus on a specific problem by searching them with the help of keywords. This tool also helps in analyzing live data, for example from internet, transfer applications (Bluetooth), SD cards, etc. It could be used in different platforms including Linux, windows and iOS [39].

2.6.19 Xplico Xplico is an open-source forensic tool which is used for analysis and documentation of data. There is no size limit of data and files to be analyzed with this tool. Xplico supports a variety of protocol such as HTTP (Hyper Text Markup Language), TCP (Transmission Control Protocol), SMTP (Simple Mail Transfer Protocol), and many more. The result could be taken out in SQL database and in other formats. Live data analysis could be done using this tool [40].

2.6.20 e-Fensee Fense tool is very helpful in digital forensics as it helps investigator to extract files from the user’s or suspected electronic devices with ease.

Network and Data Analysis Tools  37 It can also detect malwares and any ethical violating, if happening in the device. Live data could be analyzed. It can also derive data from the internet, RAM and other locations. It is highly efficient, and one can analyze more than one file at a single time using this tool [41].

2.7 Evolution of Network Data Analysis Tools Over the Years Experts can deal numerous circumstances most successfully by examining individual information or data sources and afterwards, corresponding events among them. The procedures and cycles for securing and analyzing various kinds of information sources are generally unique. Numerous applications have information caught in information records, operating systems, and network traffic. Associations ought to know about the specialized and calculated intricacy of analysis. A solitary occasion can create records on wide range of information sources and produce more data than experts can practically survey. Data sources and produce more information than analysts can feasibly review. Tools such as SEM can help investigators by uniting data from numerous data sources in a single place [42].

2.8 Conclusion With the advancement in digital era, most of the data are being saved on clouds and other such platforms. Cloud computing data is a big challenge in forensic due to its big size and no specific location for storage of data. Also, with this digitalization, crimes in the field are increasing day by day. Digital evidences can be found anywhere and in no defined form. It may include emails, contact logs, photographs, videos, browsing data history etc. To analyze these data, it must be extracted in its original form. Digital forensic investigators are facing problems in extracting data that has been encrypted or deleted at any moment. Digital Forensic Tools are being used for the derivation of data from the digital source, their duplication and analysis. These tools also help in detecting malignant threat to the network and its origin.

38  Modern Forensic Tools and Devices

References 1. Kent, K., Chevalier, S., Grance, T., Dang, H., Guide to Integrating Forensic Techniques into Incident Response, 2006, doi: 10.6028/NIST.SP.800-86. 2. Introduction to Network Forensics, 2019, doi: 10.2824/995110. 3. Awasthi, D., Network forensic analysis with effecient preservation for SYN attack. Int. J. Comput. Appl., 46, 24, 2012. doi: 10.5120/7123-9708. 4. Ludwig, W., A Road Map for Digital Forensic Research, 2001. 5. Kessler, G.C. and Casey, E., Digital Evidence and Computer Crime: Forensics Science, Computers and the Internet, 2nd ed, p. 690, Elsevier Academic Press, Amsterdam, 2004. Crim. Justice Rev., 32, 3, 280–282, Sep. 2007. doi: 10.1177/0734016807304840. 6. Roger, M.K., DCSA: Applied digital crime scene analysis, in: Handbook of Information Security, 2006. 7. Kohn, M., Olivier, M., Eloff, J., Framework for a digital forensic investigation. Inf. Syst. Secur. Assoc., 2006. 8. Dykstra, J. and Sherman, A.T., Acquiring forensic evidence from infrastructure-as-a-service clout computing:Exploring and evaluating tools, trust, and techniques. Digit. Investig., S90–S98, 2012. doi: https://doi.org/10.1016/j. diin.2012.05.001. 9. Selamat, S.R., Yusof, R., Sahib, S., Mapping process of digital forensic investigation framework, 2008. [Online]. Available: https://www.semanticscholar. org/paper/Mapping-Process-of-Digital-Forensic-Investigation-Selamat-Yus of/59b1f192f757116061cca0d115deb40b64ab43b2. 10. Reith, M., Carr, C., Gunsch, G., An examination of digital forensic models. IJDE, 2002. [Online]. Available: https://www.semanticscholar. org/paper/An-Examination-of-Digital-Forensic-Models-Reith-Carr/ c73f47d8385f452dfd25bbaab754874b65594ccd. 11. Carrier, B.D., A Hypothesis Based Approach to Digital Forensic Investigations, 2006, [Online]. Available: https://www.cerias.purdue.edu/assets/pdf/bibtex_ archive/2006-06.pdf. 12. Pollitt, M., Computer forensics: An approach to evidence in cyberspace, in: National Information Systems Security Conference, pp. 487–491. 13. Palmer, G., A Road Map for Digital Forensic Research, 2001. 14. Baryamureeba, V. and Tushabe, F., The Enhanced Digital Investigation Process Model, 2004, [Online]. Available: https://dfrws.org/wp-content/ uploads/2019/06/2004_USA_pres-the_enhanced_digital_investigation_ process_model.pdf. 15. Beebe, N. and Clark, J.G., A hierarchical, objectives-based frameworkfor the digital investigation process, 2004. 16. Carrier, B. and Safford, E.H., An Event-Based Digital Forensic Investigation Framework, 2004. 17. Carrier, B. and Safford, E.H., Getting physical with the Digital Investigation Process, 2003.

Network and Data Analysis Tools  39 18. Ambhire, V.R. and Meshram, B.B., Digital forensic tools. IOSR J. Eng., 2, 3, 392–398, 2012. [Online]. Available: http://iosrjen.org/Papers/vol2_issue3/ D023392398.pdf. 19. Sanap, V.K. and Mane, V., Comparative study and Simulation of Digital Forensic Tools, 2015. 20. Garber, L., Computer Forensics: High-Tech Law Enforcement, 2001, doi: https://doi.ieeecomputersociety.org/10.1109/MC.2001.10008. 21. UFL Research Repository, . https://repository.uel.ac.uk/. 22. Tara, H. and Mishra, A., A comparative study of digital forensic tools for data extraction from electronic devices. J. Punjab Acad. Forensic Med. Toxicol., 21, 1, 97–104, 2021. 23. Pyramid Cyber Security, . https://pyramidcyber.com/. 24. Powell, A. and Haynes, C., Social media data in digital forensics investigations, in: Digital Forensic Education, pp. 281–303, 2020, doi: 10.1007/978-3-030-23547-5_14. 25. Forensic Toolkit (FTK). https://www.esecforte.com/products/ftk-forensictool-kit/. 26. InfoSec Resources, . https://resources.infosecinstitute.com/. 27. Dimitriadis, A., Kulvatunyou, B., Nenad, I., Mavridis, I., D4I digital forensics framework for reviewing and investigating cyber attacks. NIST, 2019. [Online]. Available: https://www.nist.gov/publications/d4i-digital-forensicsframework-reviewing-and-investigating-cyber-attacks. 28. Digital Intelligence, . https://digitalintelligence.com/. 29. Fulcrum Management, . https://fulcrum.net.au/. 30. Oxygen Forensics, . https://www.oxygen-forensic.com/en/. 31. SANS Investigative Forensic Toolkit. https://linuxhint.com/sans_investigative_ forensics_toolkit/. 32. Computer Online Forensic Evidence Extractor. https://www.experts.com/ articles/cofee-and-the-state-of-digital-forensics-by-dr-frederick-b-cohen. 33. WindowsScope Toolkit, . https://www.windowsscope.com/products/. 34. ProDiscover Forensics, . https://www.prodiscover.com. 35. The Sleuth Kit, . https://www.sleuthkit.org/sleuthkit/desc.php. 36. CAINE Live, . https://www.caine-live.net. 37. Magnet Forensics, . [Online]. Available: https://www.magnetforensics.com. 38. X-ways Forensics, . [Online]. Available: http://www.x-ways.net. 39. Wireshark Tools, . [Online]. Available: https://www.wireshark.org. 40. Xplico, . https://www.xplico.org/about. 41. e-fense, . https://www.e-fense.com. 42. Hazarika, B.B. and Medhi, S.P., Survey on real time security mechanisms in network forensics. Int. J. Comput. Appl., 151, 2, 2016. doi: http://dx.doi. org/10.5120/ijca2016911676.

3 Cloud and Social Media Forensics Nilay Mistry* and Sureel Vora School of Forensic Sciences, National Forensic Sciences University (Ministry of Home Affairs, GOI), Near Police Bhawan, Gandhinagar, Gujarat, India

Abstract

The use of social networking is changing its shape by gradually transitioning towards social network chat (SNC) applications. The rise in usage of smartphone-based SNC applications has significantly raised users’ concern for security and privacy. SNC applications privacy and settings are different than the classic web privacy settings. These differences can result in sensitive information leakage. This paper focuses on identifying what sensitive information can be obtained by persuading the users to forward or open the forwarded unknown/malicious URL links in nine different SNC apps. Four Android phones and four Apple iPhones having different versions of latest Operating Systems were used in the analysis. From the results, it was found that certain device information (like model no, model name, OS version), user information (like IP address, ISP, network operator, geolocation), app information (like version, name) can easily be obtained from these apps. Such private information is likely to be misused by attackers in profiling of users. Certain information like IP address and geolocation can be useful for law enforcement agencies in electronic surveillance of criminals or suspects. Our research also identifies what users and developers can do to prevent such leakage. Keywords:  Social networking apps, social chat apps, privacy, cyber security, android, iPhone

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (41–64) © 2023 Scrivener Publishing LLC

41

42  Modern Forensic Tools and Devices

3.1 Introduction “Social networking” is one of the most widely used terms in our daily life. This term can be defined as a process of communication that allows people to interact and share information with each other and develop professional or social contacts using internet. There are various social networking and chat (SNC) apps available on the internet. Some of the most widely used are Facebook, LinkedIn and Twitter. Users around the world are now using SNC to not only connect with friends but also to connect with brands and share content. According to statistics revealed by Statista [1], Social media usage is one of the most popular online activities. In 2020, over 3.6 billion people were using social media worldwide, a number projected to increase to almost 4.41 billion in 2025. However, with the increased use of these applications, users’ concern for privacy is also increasing [2]. The applications can provide certain private information of user far more than it is required. Some of the private information can help attackers to create mobile specific application specific exploits or identify the current location of the user. Such information can even be put to good use by law enforcement agencies in identifying information about the criminal or suspect. This paper aims to focus on increasing user awareness and show investigators what device, application and user information can be obtained from nine different SNC apps.

3.2 Background Study 3.2.1 Social Networking Trend Among Users Social networking services can be divided into three types based on their focus namely socializing services (e.g. Facebook), networking services (e.g. LinkedIn) and social navigation services (e.g. Goodreads) [3]. Social networks provide a platform to people for sharing common interests across geographical borders to connect with each other easily. It also allows the companies to craft their business and advertisements to target specific audience. It helps in building a private community for readers and viewers to share collaborate and discuss a range of topics [4]. In recent years, there is a paradigm shift in the way people communicate with each other on social media. Chat messaging is gradually becoming the new social media. In one of the public Q&A sessions held in 3 November 2014, Mark Zuckerberg said that “Messaging is one of

Cloud and Social Media Forensics  43 Messaging Apps Have Surpassed Social Networks

Global monthly active users for the top 4 messaging apps and social networks

Big 4 Messaging Apps

Big 4 Social Networking Apps 3,000

2,000

Millions

2,500

1,500 1,000

4Q11 1Q12 2Q12 3Q12 4Q12 1Q13 2Q13 3Q13 4Q13 1Q14 2Q14 3Q14 4Q14 1Q15 2Q15 3Q15 4Q15 1Q16 2Q16

500

Source: Companies, BI intelligence

0

BI INTELLIGENCE

Figure 3.1  Social networks vs. messaging apps. (Source: BI Intelligence).

the few things that people do more than social networking.” Families use WhatsApp groups rather than Facebook. Chat applications are found to have higher retention rates and usage rates than most mobile apps. In a report by BI Intelligence [5] they indicated that the use of chat messaging apps has surpassed the use of social networking apps as shown in Figure 3.1. This figure compares the active users of WhatsApp, Facebook Messenger, WeChat, Viber with the active users of Facebook, LinkedIn, Twitter and Instagram. Social chat applications enable one-to-one or one-to-many interactions in a fast and cost-free manner. One reason for the widespread popularity of these apps among young generation is due to their emergence as free alternative to SMS [6]. These apps enable the users to chat over Wi-Fi free of cost or with very less impact on mobile data. Additional features that made them popular are stickers or GIFs for conveying messages in a non-verbal manner, exchange of videos, images, and documents, performing financial transactions or shop via these applications. Hotels have started to use these apps to interact with customers more easily and enable faster check-ins. People have also started to order food through these applications.

3.2.2 Pros and Cons of Social Networking and Chat Apps Today Information Communication Technology changes its definition from big wired infrastructures/framework to small handy devices.

44  Modern Forensic Tools and Devices These smart digital devices are having capability to reach to other users via SNC apps over wireless connectivity [7]. Use of these applications started with fun and ended with serious offences like gender switching, fake profiling, stalking, bullying etc. In such offenses users adopt to morph their information and target the victims or group of victims. People may use it to know more about someone they like, or to create a virtual relationship with them. People can use these applications to interact with people having similar interests or get information to help them to pursue their interests. It helps introvert people to express their personal feelings via these applications. It can be used to send private information easily [8]. People can also use these applications to harm other people like gathering personal information, bank details by misusing this information. These apps can be misused by predators or bullies. The pictures, videos sent over these applications can be misused by others or to hurt the sentiment of others.

3.2.3 Privacy Issues in Social Networking and Chat Apps The rise in the usage of SNC applications has also significantly raised privacy concerns for the users [3]. Many of the advertising companies rely on gathering personally identifiable information about users which raises the privacy concerns [9]. Malicious URLs can be forwarded along with attractive messages and the users can be tricked to open such URLs in order to gather user’s private information. The personal information obtained in such a way, can be used for cyber bullying, location disclosure, social profiling. Location, device and application information can be used by advertisers to target their advertisements and generate revenue [10]. Location information can assist advertisers in displaying content according to the local preferences or local language. Phone or application specific content can be displayed by advertisers using the relevant information of phone or application. The Internet Protocol (IP) address, an identifier for a computer or device on a TCP/IP network, can be used to track the location of the user. This location information can be misused to harm the user physically or use it against the user. The smart phone information such as OS version and name, phone’s model number and name, browser and application information such as version number and name can be used for creating and injecting exploits [11].

Cloud and Social Media Forensics  45

3.2.4 Usefulness of Personal Information for Law Enforcements The SNC applications can be useful for law enforcement agencies to track and locate suspects, criminals, threats against company or nation through intelligence gathering. The IP address can be used to identify the location of the criminal/suspect. The phone information such as model number and android operating system version can be used in profiling the suspect/ criminal or can be combined along with other information to nab them [12].

3.2.5 Cloud Computing and Social Media Applications Today users equipped with high speed internet for sharing of massive data from one device to another devices. Typical data sharing model working on the concept of information communication technology where the locally stored data can be used to share over the network [13]. In such scenario the user of the digital device must have to access the digital device where the data stored locally, so as an example if user stored his/her data on office computer then to share the same data user must have physical access of that machine from the office. To cope up with such scenario the Cloud computing technology can be used. Cloud Computing technology is used storing, processing and sharing the data on device independent platform. Cloud computing technology can able to host the data over remote location, so user can access that data from any devices. Cloud computing can be divided into three parts that is Software as a Service (SaaS), Platform as a Service (PaaS) and Infrastructure as a Service (IaaS).

3.2.5.1 SaaS Model This cloud computing technology enabled model is providing user to use any software without installing it into local devices, so user can store, process and share the data in any application without installing of that application in the local devices. In such model application can be used remotely from anywhere and anytime. E.g. Social Network applications like Facebook [14], Instagram, Twitter and many more never hold any type of data in user device, the application data is stored remotely on a cloud servers and user can fetch the data from any device at any point of time.

46  Modern Forensic Tools and Devices

3.2.5.2 PaaS Model This cloud computing enabled model is mainly used for specific platform requirements for the users. Like user wanted to use different type of operating system, different types of applications, different types of hosted application on different environments etc. can be utilized using PaaS model. In social media when the data shared or uploaded by the user should be stored over database so the stored data can be fetched by user anytime, such data may be stored on different database platforms. PaaS model can be used to store the data of social network in different types of databases and different other platforms.

3.2.5.3 IaaS Model To purchase the hardware along with licensed software for enterprise level application is required very huge budget. This cloud computing enabled model is providing the customized infrastructure and computing resources like Processing power, memory, storage etc. for running the enterprise level application with very small cost. Social Network applications are having huge users’ traffic, to develop the infrastructure for separate services provided by the social networks costs more. Most of the social networks are providing free services to users for sharing the data. Such services required a greater number of resources and computing infrastructure. IaaS can solve such issues and can also utilized custom infrastructure and resources pool for social network in different traffic condition.

3.3 Technical Study 3.3.1 User-Agent and Its Working Whenever a user requests content on the web, the application sends a “User Agent” header which gives information about which operating system and application you are using. This User-Agent string is usually used for requesting content from the server. The web server uses this User-Agent string to select the most suitable content based on the request and known capabilities of that device, operating system, application, and the particular version of client application. In RFC 1945 [15] this concept of user-agent is built into the HTTP standard to avoid particular user agent limitations. An example of user agent string is Mozilla/5.0 (Windows NT 10.0; WOW64; Trident/7.0; rv: 11.0) like Gecko [16].

Cloud and Social Media Forensics  47

3.3.2 Automated Agents and Their User-Agent String Certain applications use automated agents to preview the forwarded link. Twitter and LinkedIn are two such examples. By convention, the word bot is usually embedded in the user agent string of these automated agents. An example of user agent string of an automated agent of Google is Googlebot/2.1 (+http://www.google.com/bot.html) [16].

3.3.3 User Agent Spoofing and Sniffing Web sites are usually designed in such a way that they tailor their content based on the browser or application detected by them. They often include a piece of code to detect the user agent string of the application or browser and adjust the design of requested page accordingly. Attackers can spoof their user agent to mask their identity [11]. Spam bots which are computer programs designed to assist in the sending of spam and web scrapers which are programs designed to extract data from web pages both often use spoofed user agents. Certain download managers can also change this string. User-agent can be sniffed to get information about the operating system and application/browser of the user. The user-agent string sent by a browser also contains information to denote that it is also compatible with the browser it is reporting in user-agent string. This denotes that the content will be rendered in a similar way for the compatible browser as well. For example, the user agent for Chrome 63.0 is Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/63.0.3239.132 Safari/537.36. “Safari/537.36” indicates that Chrom3 (version 63.0) is compatible with the Safari browser (version 537.36). Including such information about compatible browsers in the user-agent string makes user-agent sniffing a bit difficult task.

3.3.4 Link Forwarding and Rich Preview When we forward a link in some of the applications like WhatsApp, Facebook Messenger they try to visit the website using their web crawlers which are internet bots that systematically browses the website and read the Meta tags from the HTML source of the page. A small website preview may also appear which are known as Rich Previews [17]. Such previews give the user an idea of what the link is about before even opening it.

48  Modern Forensic Tools and Devices When links are visited for rich preview the application sends a request which also contains the user-agent string to view the meta-tags of the page. This user-agent string can be sniffed in order to obtain possible information about the application. Certain applications use automated agents to preview the link and obtain the meta-tags [18]. This can be found out from the user-agent string of that particular application.

3.3.5 WebView and its User Agent WebView is a view that displays web pages inside the application itself. It can be considered as a browser wrapped inside an application. In applications, such as Hangouts, when we tap on a shared link the application makes use of the WebView component of the phone to render the link instead of making the user to open the link in the browser. Most application’s WebViews send User-Agent strings similar to a regular browser and also include information that identifies the application. This string may also include user’s private information which can be sniffed and can be misused. Since Android 4.4 the WebView component is based on the Chromium open source project and also shares the same rendering engine as Chrome browser for Android [19]. For iOS different available WebViews are UIWebView, SFSafariViewContrroller, WKWebView [20].

3.3.6 HTTP Referrer and Referring Page HTTP referrer is an HTTP header field [21]. When a user requests for content on web, the request generated by the application includes a field called as HTTP referrer that identifies the URI from where the resource is being requested. In most common cases, it indicates the URL of the previous web page also called as referring page from where the user came to the current web page. This helps websites or web servers to identify from where the users are visiting them.

3.3.7 Application ID Every Android app has a unique application ID [22] that looks like a Java package name and is used to uniquely identify the app on the device and in Google Play Store. The future updates of the app should always have the same application ID as the original version otherwise it is treated as a different app in Google Play Store.

Cloud and Social Media Forensics  49

3.4 Methodology The main purpose of this research is to find whether any private information such as IP address or device information can be obtained by persuading the user to forward/open certain links or not. If yes than it can be very useful for enforcement agencies to track a criminal/suspect using IP address and date/time and to get their device information. This research does not consider the use of VPN or proxy services or applications as it will hide the actual IP address. Various chat messaging apps, certain social networking apps and mobile browsers were used for conducting the research. The research was conducted on rooted and non-rooted Android phones as well as on iPhones. The method for gathering information such as IP address, phone or application information is fairly simple. A link was generated by using http://iplogger.org [23]. This link was then shortened using URL Shortener and the newly generated URL was then either forwarded/ opened in various SNC depending on the features of the application. The information that was collected included IP address, date/time of interacting with the link and user-agent string. This string was then manually examined and also searched on https://deviceatlas.com/device-data/ user-agent-tester [24] to gather additional information about browser, phone or application.

3.4.1 Testing Environment Three different smart phones with different model and OS versions were used. Table 3.1 lists the phones used and their versions. Table 3.2 lists the applications and their versions used as of writing the paper. These applications were either downloaded from Google Play Store or App Store for android and iPhone devices respectively.

3.4.2 Research and Analysis The research was done in three stages: 1. Activities performed 2. Information gathered 3. Analysis of gathered information

50  Modern Forensic Tools and Devices Table 3.1  Mobile phones and OS version. Model name

Model no.

Company

OS version

Root/Jailbreak

One Plus 5

A5000

One Plus

Android 8.0

No

Fire 5

Q386

Micromax

Android 6.0

No

Samsung J7 Pro

J730GM

Samsung

Android 8.0

Yes (Root)

Moto G5S Plus

XT1804

Motorola

Android 7.1

Yes (Root)

iPhone

X

Apple

iOS 11.2.2

No

iPhone

6

Apple

iOS 10.3.3

No

iPhone

7

Apple

iOS 11

Yes (Jailbreak)

iPhone

5S

Apple

iOS 10.3.3

Yes (Jailbreak)

Table 3.2  Applications used for analysis (with versions and device installed on). Mobile applications used

Device/s installed on (version of installed application)

Chrome Browser

FA (63.0.3239.111)

Firefox Browser

FA (57.0.4)

Safari

iPhone 6, iPhone 5S (10.0), iPhone X, iPhone 7 (11.0)

WhatsApp

FA (2.18.15), FI (2.18.11)

WhatsApp Business

FA (2.8.13)

Hike

FA (5.4.15), FI (5.4.2)

Hangouts

FA (23.0.172956998), FI (21.0.0)

Twitter

FA (7.28.0), FI (7.14)

LinkedIn

FA (4.1.126), FI (9.1.61)

Telegram

FA (4.7.1), FI (4.7.1)

Snapchat

FA (10.23.11.0), FI (10.23.11.0)

Facebook Messenger

FA (148.0.0.20.381), FI (146.0.0.38.135)

“FA” will represent all four Android Phone models (A5000, Q386, J730GM, XT1804).

Cloud and Social Media Forensics  51

3.4.2.1 Activities Performed Table 3.3 shows the activities performed on each application in all the three devices. For every application mentioned in Table 3.2 and devices mentioned in Table 3.1 two major activities were performed namely forwarding the link generated by iplogger.org and opening this forwarded link using the chat feature of the applications. Activity Performed – Forwarding the Link (For all the three devices) 1. For applications, (namely WhatsApp, WhatsApp Business, Hike, LinkedIn, Telegram, Snapchat, Facebook Messenger) a rich preview was displayed while forwarding the link in chat. Table 3.3  Activities performed on each application. Application

Activities performed

Devices

Opened

WhatsApp Hike LinkedIn Telegram Snapchat Facebook Messenger WhatsApp Business

Forwarding the link

FA, FI

As Rich Preview

Twitter Hangouts

Forwarding the link

FA, FI

No rich preview

WhatsApp WhatsApp Business

Opening the forwarded link

FA, FI

In web browser

Hike Hangouts Twitter LinkedIn Telegram Snapchat Facebook Messenger

Opening the forwarded link

FA, FI

In WebView

“FA” will represent all four Android Phone models (A5000, Q386, J730GM, XT1804). “FI” will represent all four Apple iPhone models (X, 6, 7, 5S).

52  Modern Forensic Tools and Devices 2. For applications, (namely Hangouts and Twitter) no rich preview was displayed while forwarding the link in chat. Activity Performed – Opening the Forwarded Link (For All the Three Devices) 1. For applications, (namely Hike, Hangouts, Twitter, LinkedIn, Telegram, Snapchat, Facebook Messenger) the forwarded link in chat was opened in the WebView of the respective application. 2. For applications WhatsApp and WhatsApp Business, the forwarded link in chat was opened inside the web browser of the devices. For all android phones, the link was opened in in regular browsing mode (Chrome and Firefox), in incognito mode (Chrome) and private browsing mode (Firefox). For all iPhones, the link was opened in regular browsing mode and private browsing mode of Safari only.

3.4.2.2 Information Gathered After performing the activities mentioned above for all the applications the data generated by iplogger.org was gathered as mentioned below. Figure 3.2 shows an entry recorded by iplogger.org for Android phone (One Plus 5 – A5000). Figure 3.3 shows an entry recorded by iplogger.org for iPhone (iPhone X). These entries were recorded while opening the forwarded link inside the WebView of LinkedIn app. The information gathered includes Date/Time, IP address, Internet Service Provider (ISP), Referring pages, Country, City and User-Agent string. Date and time refer to the timestamp of performing the activities mentioned in Table 3.3. The referring page refers to the URL from where the iplogger link was requested. Device identification refers to the user agent string sent in the request by the application. There was only one case when no data was recorded by iplogger.org. 1. For Hangouts, while forwarding the link in all the devices.

Figure 3.2  Entry Recorded in iplogger for Android Phone (One plus 5) (Source: iplogger. org).

Cloud and Social Media Forensics  53

Figure 3.3  Entry recorded in iplogger for iPhone (iPhone X) (Source: iplogger.org).

3.4.2.3 Analysis of Gathered Information In the third stage, the gathered information was analyzed to evaluate information relevant to our research topic. Data gathered from iplogger.org for all the activities performed was analyzed except for the two cases mentioned above. The IP address obtained was uploaded on https://www.iplocation.net [25] to extract geolocation information from different geolocation providers in order to get more accurate results. The user-agent string obtained from iplogger.org was analyzed manually and also uploaded on https://deviceatlas.com/device-data/ user-agent-tester [24] in order to get more detailed information from the user-agent string. Table 3.4 and Table 3.5 show the relevant information obtained from the data generated by iplogger.org for both the activities (forwarding the link and opening the forwarded link) respectively. Date/time refers to the timestamp of performing the activities. Figure 3.4 and Figure 3.5 compares the percentage of private information leaked by various SNC applications in both Android and iPhone devices for both the activities respectively [26]. This percentage is calculated on the total number of information obtained from iplogger.org from both the activities. Activity Performed – Forwarding the Link 1. For applications, (WhatsApp, WhatsApp Business), which supports the feature of rich preview and doesn’t use automated agents for scanning the link, the user agent string sent by the application, public IP address and ISP of the user were obtained. The user agent string for all the devices contained the word “WhatsApp” which indicated the app name. The app version was given after the word “WhatsApp”. The user-agent sent from android devices contained letter ‘A’ and user-agent sent from iPhone contained letter ‘i’. 2. For Hangouts, which doesn’t support the feature of rich preview, no details (which includes public IP address, ISP, date/ time, user agent) were obtained.

54  Modern Forensic Tools and Devices

Table 3.4  Information obtained from the activity of forwarding the link. Forwarding the link WhatsApp

WhatsApp business

Hike

FA

FI

FA

FI

FA

App Version

ü

ü

ü

ü

App Name

ü

ü

ü

ü

ü

ü

ü

ü

Data

FI

Twitter

LinkedIn Snapchat Telegram Hangouts

Facebook messenger

FA FI

FA

FI

FA

FI

FA

FI

FA

FI

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

FA

FI

App Build Version App Language OS Name OS Version OS Build Number Device Model No. Device Model Name Device Resolution (Continued)

Cloud and Social Media Forensics  55

Table 3.4  Information obtained from the activity of forwarding the link. (Continued) Forwarding the link WhatsApp

WhatsApp business

Hike

FA

FI

FA

FI

FA

Date/Time

ü

ü

ü

ü

ü

User’s ISP

ü

ü

ü

ü

User’s public IP Address

ü

ü

ü

ü

Country/City of User

ü

ü

ü

ü

Data

Twitter

LinkedIn Snapchat Telegram Hangouts

Facebook messenger

FI

FA FI

FA

FI

FA

FI

FA

FI

FA

FI

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

FA

FI

Device Manufacturer Network Operator ü

56  Modern Forensic Tools and Devices

Table 3.5  Information obtained from the activity of opening the forwarded link. Opening the forwarded link Data WhatsApp

WhatsApp business Hike

Twitter

LinkedIn Snapchat

Telegram Hangouts

Facebook messenger

FA

FA

FA FI

FA

FA

FA

FI

App Version

FI

FI

FA FI

FI

FA

FI

FI

FA

FI

ü

ü

App Name

ü

ü

App Build Version

ü

App Language

ü

Browser Name

ü

ü

ü

ü

Browser Version

ü

ü

ü

ü

Web View Name

ü

Web View Version

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

OS Name

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

OS Version

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

OS Build Number

ü

ü

ü

ü

ü

ü

ü

ü

ü (Continued)

Cloud and Social Media Forensics  57

Table 3.5  Information obtained from the activity of opening the forwarded link. (Continued) Opening the forwarded link Data WhatsApp

WhatsApp business Hike

Twitter

LinkedIn Snapchat

Telegram Hangouts

Facebook messenger

FA

FA

FA FI

FA FI

FA

FA

FA

FI

ü

ü

ü

ü

ü

ü

ü

Device Model No.

ü

Device Model Name

ü

FI

FI

ü ü

ü

ü

ü

ü

ü

ü

ü

FI

FA

FI

ü ü

ü

FI

ü ü

ü

FA

FI

ü ü

ü

ü

Device Resolution Device Manufacturer

ü

Network Operator

ü

Date/Time

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

User’s ISP

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

User’s public IP Address

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

Country/City of User

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

ü

40 35 30 25 20 15 10 5 0

FA

Ha Fa ng ce ou bo ts ok M es se ng er

gr am Te le

n

Sn ap ch at

dI Lin ke

itt er Tw

ke

FI

Hi

W ha ts W Ap ha p ts Ap p Bu sin es s

Percentage

58  Modern Forensic Tools and Devices

SNC Apps

Figure 3.4  Percentage of private information leaked for activity of forwarding the link.

80 70 60 50 40 30 20 10 0

Ha Fa ng ce ou bo ts ok M es se ng er

Te le gr am

at Sn

ap

ch

In ed nk Li

Tw

itt

er

FA

Hi ke

W ha ts W Ap ha p ts Ap p Bu sin es s

Percentage

Opening the forwarded link

SNC Apps

Figure 3.5  Percentage of private information leaked for activity of opening the forwarding the link.

3. For applications, (namely Twitter, LinkedIn, Telegram, Snapchat, Facebook Messenger) which supports the feature of rich preview and use automated agents for scanning the link, the user agent string of the automated agent, public IP address and ISP of the server where automated agent application is stored were obtained. User’s public IP address and ISP were not found. The user-agents of Telegram, Snapchat, LinkedIn and Twitter contained the words “TelegramBot”, “s~snapchatproxy”, “LinkedInBot” and “Twitterbot” respectively which helped in identifying the application names.

FI

Cloud and Social Media Forensics  59 4. For application (namely Hike) which supports the feature of rich preview, the user agent obtained was of the server instead of the user. User’s public IP address and ISP were not found.

3.4.3 Activity Performed – Opening the Forwarded Link 1. For applications, (namely WhatsApp and WhatsApp Business) which does not have the feature of WebView, the forwarded link was opened in regular browser and the user agent sent by the browser along with the public IP address and ISP of the user were obtained. The user-agent sent by Chrome browser for the device A5000 contained the words “Android 8.0.0”, “A5000”, “Build/ OPR6”, “Chrome/63.0.3239.111” which indicated OS name (Android) and version (8.0.0), device model no, OS build number (OPR6) and browser name (Chrome) and version respectively. The user-agent sent by Safari browser in iPhone X contained the words “iPhone”, iPhone OS 11_2_2”, “Safari/604.1” which indicated device model name, OS name and version, browser name and version respectively 2. For applications, (namely Hike, Hangouts, Twitter, LinkedIn, Telegram, Snapchat, Facebook Messenger) the forwarded link was opened in WebView of the application and the user agent sent by WebView along with public IP address and ISP of the user were obtained. A referring page “android-app://com.google.android.talk” was obtained from iplogger when the forwarded link was opened in Hangouts for both the android devices.com.google.android.talk is the application ID for Hangouts. This information can be used to determine the app name. Similar referring pages containing the application ID were obtained while opening the forwarded links in LinkedIn (android-app://com.linkedin. android) and Telegram (android-app://org.telegram.messenger) apps for both the android devices. The user-agent sent by Twitter app for iPhone contained the string “Twitter for iPhone”. The user-agent sent by Facebook Messenger in device A5000 contained the words “FB_IAB/MESSENGER”, “FBAV/148.0.0.20.381” which indicated app name and version respectively. FB_IAB stands for Facebook in-app browser which indicated the use of WebView component for opening the link. The user-agent sent by Facebook Messenger in iPhone

60  Modern Forensic Tools and Devices contained the words “FBAN/MessengerForiOS”, “FBAV/146.0.0.38.135”, “FBBV/46154306” “FBDV/iPhone10,3”, “FBMD/iPhone”, “FBSN/iOS”, “FBSV/11.2.2”, “FBCR/’’’’’’’’’’’’’’’’”, “FBLC/en_GB” which indicated the app name, app version, build version, device model no(10,3 is an identifier for iPhone X), device model name (iPhone), OS name (iOS), OS version (11.2.2), network operator and app language (British English) respectively.

3.5 Protection Against Leakage In this research, we demonstrated what private information can be leaked by making the users forward or open specially crafted unknown URL links from 9 different SNC apps [27]. Users can minimize the leakage of such private information by copying the URL links and manually opening them in the phone’s browser instead of directly opening them via the WebView of the application [28]. In the purview of guidelines and privacy issues raised in Section 5.5.3 of RFC 7231 [4], the developers should include only the application name and version (if required) combined with the WebView useragent inside the user-agent field of HTTP requests. Developers should avoid long and detailed user-agent fields as it can lead to unsolicited profiling of user or fingerprinting of browser/application [29]. In particular, user’s private information such as device model name, device manufacturer, device model no, device resolution, application’s preferred language, network operator should never be included [30]. For example, the developer of an app called XYZ (version 3.2) can append the string [XYZ/v3.2] to the default WebView user-agent string. OS manufacturers can also implement a feature where the app name and version of the invoking app is automatically appended to the default WebView user-agent string.

3.6 Conclusion The research was aimed to focus on identifying what private information could be obtained from SNC apps and it was achieved. From the research, it was clear that majority of the apps have certain problems from a user privacy perspective. The user information such as IP address, ISP, device information such as device model no, OS version, browser and application information such as version, name can be easily obtained from majority of SNC apps. Such private information can be misused by hackers in creating

Cloud and Social Media Forensics  61 exploits for the device by obtaining the application and device information along with the IP address of the user. The results obtained were similar for both rooted and non-rooted android phones. Also, the results were similar for both jailbroken and non-jailbroken devices. Certain information that was obtained in android phones were not obtained in iPhone and vice-versa. For mobile browsers, the results were same in regular and incognito/private browsing modes. The most private information was obtained from Facebook Messenger app. The other conclusion drawn from the research is that such information can be useful from the perspective of law enforcement agencies. From IP address or by contacting ISP the geolocation of criminals/suspects can be found out using the timestamp of interaction with the link. The device information can be used along with other information while profiling the criminal or suspect.

3.7 Future Work Similar research work can be done for other social network chat applications available in the market, and for other phones having operating systems like Windows, Symbian, or Blackberry. Also, other methodologies can be created or implemented to obtain more in-depth sensitive private information.

References 1. Tankovska, H., Number of social media users 2025. [WWW document]. Statista, 2021. https://www.statista.com/statistics/278414/­number-of-worldwidesocial-network-users/ (accessed 3.16.21). 2. De, S.J. and Imine, A., Privacy Risk Analysis of Online Social Networks, Synthesis Lectures on Information Security, Privacy, and Trust, vol. 10, pp. 1–109, Springer, Cham, Switzerland, 2020, https://doi.org/10.2200/ s01056ed1v01y202009spt024. 3. Wikipedia, Social networking service [WWW document], 2020a. https:// en.wikipedia.org/wiki/Social_networking_service (accessed 3.16.21). 4. Fielding, R. and Reschke, J., RFC 7231-Hypertext Transfer protocol (HTTP/1.1): Semantics and Content [WWW Document], Internet Engineering Task Force, USA, 2014, https://tools.ietf.org/html/rfc7231 (accessed 3.16.21). 5. Business Insider, Viber transitions to platform and adds e-commerce feature [WWW Document], 2017. https://www.businessinsider.com/viber-

62  Modern Forensic Tools and Devices transitions-to-platform-adds-e-commerce-feature-2017-2?IR=T (accessed 3.16.21). 6. IEEE, IEEE computer society social networking. IEEE Secur. Priv., 17, 9, 2019. https://doi.org/10.1109/MSEC.2019.2922087. 7. Patil, S. and Kobsa, A., Enhancing privacy management support in instant messaging. Interact. Comput., 22, 206–217, 2010. https://doi.org/10.1016/j. intcom.2009.10.002. 8. Li, Y., Li, Y., Yan, Q., Deng, R.H., Privacy leakage analysis in online social networks. Comput. Secur., 49, 239–254, 2015. https://doi.org/10.1016/j. cose.2014.10.012. 9. Shamim, Issues of privacy in social networking sites. Int. J. Sci. Res. Comput. Sci. Eng. Inf. Technol., 3, 2456–3307, 363–367, 2018. https://doi.org/10.32628/ CSEIT1838101. 10. Shibchurn, J. and Yan, X., Information disclosure on social networking sites: An intrinsic–extrinsic motivation perspective. Comput. Hum. Behav., 44, 103–117, 2015. https://doi.org/10.1016/j.chb.2014.10.059. 11. Srivastava, A. and Geethakumari, G., Privacy preserving solution to prevent classification inference attacks in online social networks. Int. J. Data Sci., 4, 31–44, 2019. https://doi.org/10.1504/IJDS.2019.098357 12. Kausar, F. and Al Beladi, S.O., A comparative analysis of privacy preserving techniques in online social networks. Trans. Networks Commun., 3, 60–70, 2015. https://doi.org/10.14738/tnc.32.854. 13. Willits, R., Personally identifiable information does not always include a name. Recruiting Retaining Adult Learners, 22, 10–11, 2020. https://doi. org/10.1002/nsr.30645. 14. Ayaburi, E.W. and Treku, D.N., Effect of penitence on social media trust and privacy concerns: The case of Facebook. Int. J. Inf. Manage., 50, 171–181, 2020. https://doi.org/10.1016/j.ijinfomgt.2019.05.014. 15. Nielsen, H.F., Berners-Lee, T., Fielding, R.T., Hypertext Transfer Protocol – HTTP/1.0. RFC 1945, RFC Editor, USA, 1996. 16. Wikipedia, User agent [WWW document], 2020b. https://en.wikipedia.org/ wiki/User_agent (accessed 3.16.21). 17. Oosterhof, R., How to optimize your site for rich previews | Medium [WWW document], 2015. https://medium.com/@richardoosterhof/how-to-­ optimize-your-site-for-rich-previews-527ed13a6d69 (accessed 3.16.21). 18. Chang, W. and Wu, J., Privacy-preserved data publishing of evolving online social networks. J. Inf. Priv. Secur., 12, 14–31, 2016. https://doi.org/10.1080/ 15536548.2016.1143765. 19. Google, WebView for android-chrome developers [WWW document], 2020. https://developer.chrome.com/docs/multidevice/webview/overview/ (accessed 3.16.21). 20. Siva, B. and Shoerio, M., User privacy protection in personalised web search. Int. J. Sci. Res., 5, 1595–1596, 2013. https://doi.org/10.21275/v5i6. NOV164569.

Cloud and Social Media Forensics  63 21. Wikipedia, HTTP referer-wikipedia [WWW document], 2020c. https:// en.wikipedia.org/wiki/HTTP_referer (accessed 3.16.21). 22. Developers, Set the application ID | Android developers [WWW document], 2020. https://developer.android.com/studio/build/application-id (accessed 3.16.21). 23. IP Logger, IP logger URL shortener-log and track IP addresses [WWW document], 2020. https://iplogger.org/ (accessed 3.16.21). 24. Device Atlas, User agent tester [WWW document], 2020. https://deviceatlas. com/device-data/user-agent-tester (accessed 3.16.21). 25. IPlocation, Where is my IP location? (geolocation) [WWW document], 2020. https://www.iplocation.net/ (accessed 3.16.21). 26. Ananthula, S., Abuzaghleh, O., Alla, N.B., Chaganti, S.P., Kaja, P.C., Mogilineedi, D., Measuring privacy in online social networks. IJSPTM, 4, 1–9, 2015. https://doi.org/10.5121/ijsptm.2015.4201. 27. Mvungi, B. and Iwaihara, M., Associations between privacy, risk awareness, and interactive motivations of social networking service users, and motivation prediction from observable features. Comput. Hum. Behav., 44, 20–34, 2015. https://doi.org/10.1016/j.chb.2014.11.023. 28. Chang, H.-J., Social networking friendships: A cross-cultural comparison of network structure between myspace and wretch. Cult. Sci. J., 3, 87–96, 2010. https://doi.org/10.5334/csci.34. 29. Ali, R.M. and Alsaad, S.N., Instant messaging security and privacy secure instant messenger design, in: IOP Conference Series: Materials Science and Engineering, Institute Phys. Publishing, vol. 881, 012117, 2020. https://doi. org/10.1088/1757-899X/881/1/012117. 30. Mark, W. and Victoria, W., Self-censorship in social networking sites (SNSs)– privacy concerns, privacy awareness, perceived vulnerability and information management. J. Inf. Commun. Ethics Soc, 17, 375–394, 2019. https://doi. org/10.1108/JICES-07-2018-0060.

4 Vehicle Forensics Disha Bhatnagar1 and Piyush K. Rao2* School of Forensic Sciences, National Forensic Sciences University (Ministry of Home Affairs, GOI), Near Police Bhawan, Gandhinagar, Gujarat, India 2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University (Ministry of Home Affairs, GOI), Near Police Bhawan, Gandhinagar, Gujarat, India 1

Abstract

The modern technology-driven world has now been shifting from our laptops, smartphones to our vehicles. Modern vehicles uses advanced technologies such as navigation system, smartphones connectivity, Bluetooth, WIFI, safety devices, and many more. Earlier, in crimes where vehicles are involved, the investigators focus on non-digital evidence such as fingerprints, DNA, trace elements to resolve any criminal cases. Due to these modern technologies embedded in the vehicles, these are becoming a chief reliable source of digital evidences in criminal investigation, as the data procured from devices can give us many crucial evidences regarding the incident. This chapter discusses vehicular forensics, internal network system of vehicular systems, classification as automotive and drone forensics, and important tools and techniques employed for evaluation purposes. Keywords:  Vehicular forensics, digital evidences, infotainment systems, automotive forensics, drone forensics

4.1 Introduction The crimes involving vehicles including vehicle theft, vehicle accident cases, and other crimes where vehicle is the center of any crime are increasing globally. This age of digitalization has improved the flexibility *Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (65–84) © 2023 Scrivener Publishing LLC

65

66  Modern Forensic Tools and Devices and efficiency in every facet of life. To enhance the functionality of vehicles, modern vehicles are introduced with embedded systems such as a Global positioning system (GPS), Bluetooth connectivity, Wi-Fi, Satellite radio, connectivity for user’s smartphone or laptops, sensors, and many more systems which enable safety and provides greater efficiency [1]. These integrated digital devices provide the investigator with a new opportunity to find digital evidences. After connecting the mobile devices, the user may not have the idea that their personal information from the mobile phones can be transferred and stored in the vehicle infotainment system. This stored information helps an investigator to solve a criminal case. These digital evidences procured from the vehicles can help the investigator to find the routes, location data, call history, chats, media, and more such information. Vehicular forensics is a comparatively novel field of study, which attracts academics as well as digital investigators [2]. Vehicular forensics till now has been a trying emergent, who’s doing and finding all the needful updates and modifications needed in the department or the technology used. These modifications are not just some certain update demands. They are being studied thoroughly and therefore with every incident or a committed crime in which a vehicle is the center of the crime or if there’s any involvement of the vehicle is, the vehicular department of forensics helps it in knowing the very legal owner or the registered owner of the vehicle (Figure 4.1).

Vehicular events Media

Routes Vehicular data

Connected devices

Location data Call logs

Figure 4.1  Digital evidences collected from vehicles.

Vehicle Forensics  67 The information procured from the modern vehicles can help to figure out the following things: • Establishes a sequence of events that occurred which leads to the incident. • To know the precise location of the vehicle. • Identification of previous locations, locations that are regularly visited, saved locations, which gives an idea where the vehicle was at a particular time. • The personal information gathered through the infotainment systems can lead us to find the culprit. • In case of an accident, with the help of other safety systems present in the vehicle, we can identify the cause of the event, whether it is a deliberate attempt or a genuine one [3].

4.1.1 Motives Behind Vehicular Theft Vehicles are becoming a necessity for people nowadays. Vehicle theft cases are epidemic globally. The professional thieves are attracted to the vehicles due to its high cost which leads to a great profit to them. There are numerous motives behind the vehicular thefts. A few important motives are mentioned here.

4.1.1.1 Insurance Fraud To gain the financial benefit from the insurance companies, owners disposed or sell their vehicles in another country and filed a report in police for theft and thereby claim the insurance company. In such a way they gain the financial benefit from the insurance company.

4.1.1.2 Resale and Export This motive usually instigate the professional thieves for vehicle theft. The resale and export the vehicle to another country. This can be done by changing the VIN (Vehicle Identification Number), which is a unique number for a single-vehicle. Another way is to resale the separate components of the vehicle, as the profit gained by separate components is more than that of the vehicle. Modern vehicles are the target of professional thieves because the digital devices and expensive systems embedded in the vehicles attract them [4].

68  Modern Forensic Tools and Devices

4.1.1.3 Temporary Transportation The thieves used a vehicle for traveling a small distance to arrive at a particular destination and left the vehicle when reached there. There is no other intention behind the stealing of the vehicle and this continues until the transportation is needed.

4.1.1.4 Commitment of Another Crime For the commission of other crimes such as burglary, kidnapping, smuggling, and many more, the culprit often steals a vehicle and uses it [4].

4.2 Intervehicle Communication and Vehicle Internal Networks Intervehicle communication is referred to as Vehicular Ad Hoc Networks (VANETs), which provides the features to vehicles to communicate with other vehicles making them more efficient and safe. VANETs includes the Vehicle to Vehicle Communication (V2V) which allows vehicles to be in direct contact with each other through peer to peer network. This also provides communication with infrastructure through Vehicle to Infrastructure and Infrastructure to Vehicle (V2I and I2V) [5]. VANET is the sub-branch of MANET (Mobile Ad Hoc Network) [6]. Here are few supreme applications of VANET: • • • • •

Road traffic safety. Traffic emergency. To ease and set standards for road travel. Predictable mobility patterns. Dynamic Topology [7].

VANET is classified into 3 domains. Mobile domain includes vehicle domain and mobile devices domain, the vehicle domain involves all sorts of vehicles that are constantly moving and mobile devices include portable devices such as smartphones, laptops, GPS. Infrastructure domain includes roadside domain and central infrastructure, roadside domain involves the roadside infrastructures such as traffic lights, poles and central infrastructure involves the managing centers.

Vehicle Forensics  69 Generic domain includes various types of information processing systems that are directly or indirectly comprises the VANET, which comes under the generic domain [6]. Electronic control unit (ECU) and Onboard units (OBU) are lodged in modern vehicles. OBU is responsible to send the information to all the vehicles. Speed of the vehicle, vehicle tracking, and other important information is shared within vehicles to ensure their safety. ECU is responsible for storing all the data, which can be further retrieved by the investigators and can help in finding the cause of the incident. ECU devices manage various operations in the vehicle, that includes, signaling system, braking system, telematics, and many more. Vehicle Internal Networks includes various computer buses for exchanging the data within the various systems. The four primary buses used in vehicles are the following: • CAN (Controller Area Network) – CAN is a core network that is responsible for data exchange between all the other devices or buses and allows the onboard diagnostic interface (Figure 4.2). FlexRay

MOST

Multimedia Display

Front Stability control Stability control Unit

Multimedia Head Unit

Rear Stability control

Heads-up Display

Tire Pressure Control

Telematics Control Unit Side Mirror Controller Body Control Unit Door Locks LIN

Figure 4.2  Vehicle internal network [2].

CAN

Engine Control

Junction Box

OBD Part

70  Modern Forensic Tools and Devices Table 4.1  Various systems embedded in modern vehicles [2]. Serial number

Type

System name

1

Braking Control

Autonomous Braking System Anti-lock Braking System Start/Stop technology Accidents avoidance Pedestrian Detection

2

Speed Control

Adaptive Cruise Control Speed warning technology Intelligent speed adaption

3

User’s Safety

Airbags Seat belt reminders Pre-crash systems

4

Driver’s condition

Airlogs Driver fatigue monitoring system

5

Others

Navigation Event data recorder Journey data recorder Tyre pressure monitoring system

• LIN (Local Interconnect Network) – This sub-network is employed for services that utilize low-speed data exchange. • FlexRay – Sub-network that is employed for high-speed data exchange, including key messages regarding safety. • MOST (Media Oriented System Transport) – This sub-­ network is employed for high-speed data transfer for applications linked with multimedia [8]. Table 4.1 shows important systems that are embedded in modern vehicles.

4.3 Classification of Vehicular Forensics As in vehicular forensics, most of the time the measures in forensics understanding are mistaken because of the difference in vehicles and their types and the security measures in the respective type o vehicle i.e Automotive

Vehicle Forensics  71 and Aerial. Considering the following aspects and for the understanding, the vehicular forensics could be bifurcated as: Automotive Vehicle Forensics and Unmanned Aerial Vehicle Forensics.

4.3.1 Automative Vehicle Forensics Automotive vehicles, mostly cars are involved in various types of criminal cases. Modern-day vehicles are becoming a vital source of digital evidences. The various digital devices having storing and data exchange capacity are connected with the vehicles. Varieties of modules are attached for storing different kinds of data. The complicated devices and networks, makes the forensic investigators to focus more on the working of the modems and understanding different types of systems. This helps the investigators to further extract the data from such devices without causing damage to the system and vitiating the data. The main goal of automotive forensics is to find the potential evidences that support in reconstruction of an incident. The data extracted from the systems can give us a clear idea about the cause of the incident [9]. The forensic examination in the automotive vehicle forensics is done in two ways as following.

4.3.1.1 Live Forensics Live forensics is applicable in the cases where the internal systems of the vehicles are yet in working condition or are not switched off. We can procure data from various ECU’s (Electronic Control Unit), main memory, and mass storage system. The data exchange that occurred between various channels including the CAN and MOST bus systems. Some forensic tools and techniques are available to extract the data from here. To get access to the main memory and mass storage, there is a requirement to send requests to specific ECU’s. As the procedure is complex, the investigator needs to be aware during the procedure to avoid any mishappening with the data [10].

4.3.1.2 Post-Mortem Forensics The post mortem forensics focuses on the mass storage data. The process for accessing the data is complex as mentioned in live forensics. There are few forensic tools present which helps in the data extraction. The data acquisition and interpretation steps are the most critical steps of

72  Modern Forensic Tools and Devices investigation. Although the procedure is tedious but if systematically done, it gives us some crucial evidences regarding the incident [10]. Steps involving in investigation a. Preparation – It is one of the most vital steps of investigation. The documentation, such as manuals for handling various embedded systems, electronic systems catalogs should be collected as they will assist us to run the data acquisition process smoothly. An unsystematic approach towards forensic investigation of vehicle systems can result in destroying the vital information [10]. b. Data acquisition – The data of mobile devices or other handheld devices that were linked with the vehicle can be extracted as the data is transferred from the mobile devices and get stored in the vehicle embedded systems. Data acquisition can be done mainly by 3 methods: • Logical extraction is a less time-consuming method. This method is supported by using a forensic tool that helps in the extraction of data by using API (Application Programming Interface). This method provides the live data of the device, such as SMS, MMS, image, video, audio, contact, app data. • File system extraction is the advancement of logical extraction procedure. The files of the internal storage of devices can be accessed in this method without using API. The data obtained includes SMS, MMS, location data, web browsing history. • Physical extraction is a widely used technique of data acquisition. This method provides full access to the device’s data. We can even get access to the deleted or hidden files. It works by copying the content of the device bit by bit. The extraction method is based on the features of the operating system used in the device. This includes data such as SMS, video, audio, e-mails, installed app data [11]. c. Data interpretation and analysis – The raw data is converted into a meaningful format and then analyzed. It depends on the type of crime. Following are the areas which are necessary for the investigation; ■■ Seat belt or Airbags reminder system ■■ Speed determination

Vehicle Forensics  73 ■■ ■■ ■■ ■■ ■■ ■■

Roadway geometry Collision calculation EDR interpretation Braking system interpretation GPS/Location data interpretation Personal data: call history, SMS, MMS, video, audio, images, location. ■■ Application data including Facebook, Twitter, WhatsApp, other apps. d. Reporting – A well-written report comprises of the examination process and conclusion both. The examination process should be separately written step by step, to make the documentation clear and impartial. The steps from the collection, data acquisition to analysis should be mentioned to maintain the chain of custody. The conclusion should be precise and clear [10].

4.3.1.3 Physical Tools for Forensic Investigation 1. iVE – The most widely used forensic tool for data acquisition and analysis of the crucial data found in the vehicular systems. The infotainment and telematics system stores an ample amount of data, which when analyzed properly can give critical information about the incident. Data such as recently visited locations, favorite locations, SMS, call history, chat history, application data, e-mails, pictures, videos, and many more. Various systems are embedded which record events speed determination, opening and closing of doors, driver’s fitness [3]. The iVE comprises a hardware and software kit, hardware for data acquisition, and software for data interpretation and analysis. This tool supports the models of Audi, Mercedes-Benz, SEAT, Skoda, FIAT, Ford, Chevrolet, Chrysler, BMW, Saturn, and many others. 2. GPS forensics – GPS networks are used globally. The navigator and GPS systems of the vehicles now have become a crucial part of everyday life. The data from these GPS devices can assist the investigators and forensic professionals a lot in tracking or to know the recently visited locations of a particular vehicle. The navigator provides a very precise location

74  Modern Forensic Tools and Devices with accurate time, which can act as a potential clue for the case [12].

4.3.2 Unmanned Aerial Vehicle Forensics (UAV)/Drone Forensics From the last few years calculated from the recent years, the growth rate in crimes has been increased a lot, and specifically when it comes to Drones, due to its easy availability and capabilities, it is used in terrorism or crimes happening in cities. Speaking of Drone, which is also known as Unmanned Aerial Vehicle (UAV) is a flying machine capable enough to capture images, to attack, to transport or smuggle, and is popular among localities of normal street or military or whether it’s the locality of some terrorists. Its usage is becoming usual among people in the livelihood and the crimes as well [13]. Therefore forensic investigations have been an initiative always, complying that whether it’s about finding the longitude, latitude, and altitude of the drone or whether it’s about finding the clues in the digital assets present in UAV or the camera or the hard drive of the drone which clearly may carry very severe information of the committed crimes or the upcoming crimes about to get commit. For every specific kind of task, there is a specific kind of UAV. Drones used for navigation, or cinematic experience, or in the security section, are different from having slight modifications. They are either fast or slow based on their applications [14, 15].

4.3.2.1 Methodology UAV crimes are highly being commenced and for a lot of circumstances, they are being recreated to get accurate information about the scenarios. There a lot of case studies and an ample amount of calculation-based analysis where the cases were recreated to get to know everything about it. Highly conventional data found by means of recreated situations can be used in solving a case and may also act as the reference towards the respective evidence found in the committed crime. From the recreated artifacts there are categories of vital information like interpretation of flight data via sensors and the other hardware present in UAV. Calculating Altitude, Taking readings of the GPS, Acceleration, Speed, Battery level. These are the key interests to know about the actions at the very initial stage of the flight. The weight of the flight under scenarios

Vehicle Forensics  75 that were real and the ones recreated may define some other aerial crime or smuggling [14]. The next category comes into the media i.e. the images and the videos extracted via camera incorporated in the UAV. At least one camera for capturing and navigation is present in all the drones, which is mostly connected with a smartphone. Whether it’s about letting a drone orbit to know the terrorist location from where they have been operating or whether it’s about sending a drone to cross-check the borders to check invasion inside nation or activities happening nearby the borders. As the most used device is a smartphone, therefore it complies with mobile forensics as well. The connectivity towards the server and the data stored is either needed to be gained back or needs to be studied enough to find crucial leads in the crime. The applications used in the phone and the applications used by the forensics are very different, so to maintain the severe security of the data. Stored images and videos or any other data can be extracted from the SD card storage or the hard drive [15, 16].

4.3.2.2 Steps Involved in Drone Forensics UAV forensic investigation involves the following steps: a. Preparation – Risks and threats bound with the crime scene should be assessed. This ensures the safety of the investigator. Technical preparation should also be completed for investigating the scene [17]. b. Identification and collection – The primary step is to recognize the UAV device, why it is used, and what type of crime is being committed. The data and evidence collection is done with the help of forensic tools and techniques available. c. Identify the make and model – The next step is to find out the category of the drone which has been used to commit the crime. The categorization is important to know as it will help for further analysis of drones such as knowing the weight, airspeed, and other characteristics. d. Weight measurement – The drones are classified depending on their weight. Thus the next step is to weigh the device. This will help us to find out the registration details of the user’s from the records available.

76  Modern Forensic Tools and Devices e. Identify any customization- the UAV is a highly customizable device. The use of drones for criminal activities will need some modifications in the original system. f. Implementation of convention forensic techniques – Fingerprints, DNA sources, or other trace materials may be found on the drone, which must be collected and preserve properly as this can be helpful to reach out to the culprit. g. Identification of other external devices – The drone may possess any external devices or memory cards to make the system work smoothly. These devices may contain some crucial information. The data from such devices is further extracted and analyzed. h. Geolocation – The navigation system or GPS incorporated in UAV can help us to find the probable locations of the travel of the drone before the commitment of crime. i. Documentation – Documentation involves the details of every step performed while investigation and examination. Detailed information about every procedure should be mentioned in the report to maintain the chain of custody [17, 18].

4.3.2.3 Challenges in UAV Forensics As in mobile forensics and UAV forensics do have similarities. For example, both have configuration which are enough to form an accurate GCS and is easy to be wiped remotely or modified. And UAV forensics also includes the conventional storage media forensics like memory cards are copied and also the live forensics wherein real-time if try to hop into the data of the media storage. But in any case, most of the time UAVs do not encompass the Graphical User Interface (GUI) or In-Built Interface. Therefore the possibility of adulteration in data may have happened. So it has to be a primary task for the examiner to least modify the data as the results couldn’t be any similar in the conducted second examination. Consistency among cases is the most enigmatic manner of being into the process of UAV forensics [14, 16].

4.4 Vehicle Identification Number For every investigation team, whether police or forensics, the basic identifier is a VIN (Vehicle Identification Number), it’s a globally unique number

Vehicle Forensics  77 which is been set separately for each manufactured vehicle across the globe, and the number serial is based on international standards. Most of the time in vehicle theft or defective vehicles that came in for re-registration without being known the police information check-ins or a national or an international vehicle register, the particular owner/offender has to hide the official identifier of the stolen vehicle. The manufacturers and the professional thieves, both the parties are aware of this particular fact. Through various processes, manufacturers make it as hard as much as possible to minimize the VIN change and replacement. State and professional institutions have to keep a continuous check on the VIN location, procedure of VIN insertion and the VIN inserted inside stays substantially safe and unique [4].

4.4.1 Placement in a Vehicle and Usage of a VIN A VIN shall be implemented in a vehicle as: 1. It is placed on a primary part of the vehicle which is inseparable from the fundamental unit. As the VIN is not just meant to be glued inside or sprayed or riveted, it’s embedded or fabricated using the technology which measures the volume and integrity of the metal. 2. The placement of VIN is the key point to know, as to ensure the security, safety, and easy accessibility of the VIN. So as when needed, it could be available. 3. They should be legible enough that it could be visible directly from human eyes without any optical support. Therefore the VIN is 6 inches big. 4. It should be unmistakable in every sense of placing and mentioning. It should be unique and the manufacturer attempts to produce it as hard as possible. 5. To make it easily visible, VIN should be placed either on the right side or in front of the vehicle. It is imprinted on the rectangular-shaped metal plates, of mostly black and silver color. VIN also helps in recognizing the real identity, in vehicular theft cases, or any illegal incident, or any crime where a vehicle is involved. As the identity is unique at a global level. The main concern is to prevent vehicle crime and theft at the global level [19].

78  Modern Forensic Tools and Devices

4.4.2 Vehicle Identification A vehicle identity is being questioned when a vehicle is a part of any criminal activity. The reason why do this identity question arises is because most of the time, the vehicle’s true identity is being obliterated through lynching, burning, modifications, or maybe intentional changes or dismantling the vehicle. The 17 digit VIN not only identifies a vehicle but it also possesses a lot of details about the particular vehicle itself. The starting three characters comprise the world manufacturer identifier (WMI) section. The next five characters comprise the vehicle descriptor section (VDS). The ninth digit is considered as the check digit. And the last eight characters comprise the vehicle identifier section or vehicle indicator section (VIS). The Society of Automotive Engineers (SAE) assigns the WMI section of VIN. This organization has been designated by the International Organization for Standardization (ISO). The letters I, O, and Q are excluded in a VIN, to avoid any confusion with numbers (Figure 4.3) [4]. The following characters are used in VINs. ABCDEFGHJKLMNPRSTUVWXYZ1234567890 The complete VIN can also be obtained in certain other areas of the vehicle. Areas from where complete VIN can be procured are mentioned below:

Country

Model Year

Manufacturer

Plant

Vehicle Type

World Manufacturer Identifier (WMI)

Vehicle Description Section (VDS)

Serial #

Check Digit

Figure 4.3  Vehicle identification number [20].

Vehicle Identification Section (VIS)

Vehicle Forensics  79

4.4.2.1 Federal Motor Vehicle Safety Certification Label Earlier this label certifies that the vehicle fulfills the safety requirements. Here the complete VIN is also mentioned. Now, this label possesses a lot more details about the vehicle such as assembly dates (month/year), passenger capacity, country of origin, GVWR, vehicle weight distribution, axle ratio, transmission code, paint color/trim codes, and original equipment manufacturer (OEM) tire specifications and inflation data along with the safety certification and VIN.

4.4.2.2 Anti-Theft Label The theft prevention label also includes the full VIN, which can be found on several vehicular components. These labels are stuck to the vital components of new vehicles including the doors, lids, front fenders, both rear quarters, and both bumpers.

4.4.2.3 Stamping on Vehicle Parts The VIN is simply stamped over the engine or other components of the vehicle. The stamping styles may vary from manufacturer to manufacturer. Here either the full VIN is stamped or partial VIN, i.e. eight characters of VIN is stamped.

4.4.2.4 Secondary and Confidential VIN The secondary VIN, or sometimes called a confidential VIN, is the most authentic source of a vehicle’s original identity. These VIN are not easily observable and minor disassembling of the vehicle may be required for viewing it. These numbers exist on the upper surface of frame rails, floor pan, flanges [4].

4.5 Serial Number Restoration The serial number (here VIN) is the number that is responsible for the recognition of the vehicle, the criminals tend to obliterate the original VIN of the vehicle. Thus the investigator must retrieve the original VIN. The following are the various techniques that are used for applying the serial number.

80  Modern Forensic Tools and Devices • Die stamping/cold working: An inverse positive of the character to be imprinted is taken and pressed over the metal surface by force of hand. • Hot stamping: It is used for inserting serial numbers on polymer surfaces. The die to be stamped is heated before stamping. • Pin stamping: Pins are used for making the individual character in dot form, through impact procedure, similar as in Dot matrix printers. • Engraving: The surface to which the number is to be imprinted is cut off so that it leaves the marks of the serial number onto the surface. • Laser etching: The serial number is imprinted by burning the surface using a laser. • Embossing: Similar method as cold working. It is applied on a thin metal surface which results in a raised serial number [21]. The criminals use the following techniques to obliterate the serial number. a. b. c. d. e.

Filling/Grinding Drilling Peening with hammer Overstamping Welding [22].

4.5.1 Restoration Methods To restore the obliterated serial number engraved on a metal plate, various kinds of destructive and non-destructive techniques are available. Destructive techniques include, chemical etching, electrolytic etching, heat treatment method, and non-destructive technique includes, magnetic particle method and electron channeling contrast method. A few techniques are mentioned below.

4.5.1.1 Chemical Etching This is a significant approach for retrieving a serial number. The distressed and normal surface can easily be distinguished by applying this method. The difference is visible due to the difference in both the surfaces. A cotton

Vehicle Forensics  81 or cloth is used for applying the chemical solution to the surface. The solution is spread several times over the surface. The visible number should be recorded instantly as it will disappear after some time.

4.5.1.2 Electrolytic Etching This method is a modified version of the chemical etching method. An electrolytic chamber is used, in which the metal plate from which serial number is to be retrieved acts as anode, and the wire containing cotton swab wet with the chemical solution acts as a cathode. The optimum voltage is then imposed and the restored serial number is visible after a few minutes.

4.5.1.3 Heat Treatment In this method, heat is directly applied on the metal surface, which allows the distressed/obliterated surface to protrude outwards. Abrasive paper is then used to rub the surface which clears any soot deposited on it [4].

4.5.1.4 Magnetic Particle Method The metal plate is first polished as a smooth surface is required for this method. It is then magnetized by putting it in magnetic crack testing devices, using AC or DC powered magnet. Fine magnetic particles are then sprayed over the surface, the particles adhered on the obliterated number or letter, making them clear and visible [22].

4.5.1.5 Electron Channeling Contrast This method is predicated on the principle of scanning electron microscope. Variation of the backscattered electron from the damaged and undamaged surface results in the visibility of the crystal defects and thus restoring the serial number [4].

4.6 Conclusion The advancement in computerized technology enhances the quality of every facet of our lifestyle. The complexity of the modern vehicles increases the challenges for a forensic investigator. As discussed in this chapter,

82  Modern Forensic Tools and Devices digital vehicular forensic has become the most growing and emerging area of research. The infotainment and telematics system embedded in modern vehicles provide the end-users many facilities such as GPS, mobile phone connectivity, Bluetooth, satellite radio, WI-FI connectivity, speed control, braking system, airbags, pre-crash system, and many more. This ensures greater efficiency and safety. These technologies along with the ease of the user also provide investigators important evidences, by data acquisition and analysis which helps them to find the cause of an incident. Even if it’s about a serial number or the VIN which is to know the fraud or the theft so as the legal aspects could be saved like insurance fraud, illegal import-­ export, theft, or vehicle crimes. The manufacturers of every vehicle knows the importance of VIN, therefore, whatever the structure they may give or take in the vehicle, the very first priority is to maintain the safety and security of the VIN as it’s been fabricated into the primarily inseparable part of the vehicle. As the technology has grown so much the popularity of UAV increasing spectacularly among people because of the unmanned features and the other technological features like camera. This advancement was not at all a problem until it started getting used in local crimes as well. Otherwise, the drones were and are used most of the time in the national security like along the borderlines of the nation, or being orbited around the enemy territory to know their actions and the locations. With time and advancement in and of technology will always be a challenge for investigators as the criminals are always beyond the given limit of the line. Investigators need more of the technological assets and more of the liberation is needed while recreating the scenarios of the accident or the committed crimes. The forensics investigators should be made aware already of the advancement of the technology and modifications in the technology. Thus there is a need for more forensic tools that can provide the investigators quick and better results.

References 1. Whelan, C.J., Sammons, J., Mcmanus, B., Retrieval of infotainment system artifacts from vehicles using iVe. JADE, 1, 30–45, 2018. 2. Cvitic, Perakovic, D., Peisa, M., Husnjak, S., Application possibilities of digital forensic procedures in vehicle telematic system. Zeszyty Naukowe Wyższej Szkoły Technicznej w Katowicach, 10, 133–144, 2018. 3. Bortles, W., McDonough, S., Smith, C., Stogsdill, M., An introduction to the forensic acquisition of passenger vehicle infotainment and

Vehicle Forensics  83 telematics systems data. SAE Tech. Pap., March 2017, 2017, https://doi. org/10.4271/2017-01-1437. 4. Stauffer, E. and Bonfanti, M.S., Forensic Investigation of Stolen Recovered and Other Crime Related Vehicles, Elsevier, Amsterdam, Netherlands, 2006. 5. Lacroix, J., El-Khatib, K., Akalu, R., Vehicular Digital Forensics, pp. 59–66, 2016, https://doi.org/10.1145/2989275.2989282. 6. Tomar, R., Prateek, M., Sastry, G.H., Vehicular adhoc network (VANET) - an introduction. Int. J. Control Theory Appl., 9, 18, 8883–8888, hal-01496806, 2017. 7. Le-Khac, N.A., Jacobs, D., Nijhoff, J., Bertens, K., Choo, K.K.R., Smart vehicle forensics: Challenges and case study. Futur. Gener. Comput. Syst., 109, 500–510, 2020. https://doi.org/10.1016/j.future.2018.05.081. 8. Lacroix, J., Vehicular Infotainment Forensics: Collecting Data and Putting It into Perspective, IEEE (Institute of Electrical and Electronics Engineers), USA, 2017. 9. Duboka, Č., Considerations in forensic examination of automotive systems. Int. J. Forensic Eng., 1, 111, 2012. https://doi.org/10.1504/ijfe.2012.050408. 10. Altschaffel, R., Lamshöft, K., Kiltz, S., Dittmann, J., A Survey on Open Automotive Forensics, pp. 65–70, 2017. 11. Elwell, C. and Poirier, J., Android forensics CCIC training Chapter 3: Data extraction with universal forensic extraction device (UFED), p. 9, California Cybersecurity Institute, USA, 2019. 12. Last, D., GPS forensics, crime, and jamming. GPS World, 20, 8–12, 2009. 13. Roder, A., Choo, K.-K.R., Le-Khac, N.-A., Unmanned aerial vehicle forensic investigation process: DJI phantom 3 drone as a case study. Annual ADFSL Conference on Digital Forensics, Security and Law 2018 Proceedings, pp. 1–14, 2018. 14. Bouafif, H., Kamoun, F., Iqbal, F., Marrington, A., Drone forensics: Challenges and new insights. 2018 9th IFIP Int. Conf. New Technol. Mobil. Secur. NTMS 2018-Proc, January 2018, pp. 1–6, 2018, https://doi.org/10.1109/ NTMS.2018.8328747. 15. Delfanti, R.L., Piccioni, D.E., Handwerker, J., Bahrami, N., Krishnan, A.P., Karunamuni, R., Hattangadi-Gluth, J.A., Seibert, T.M., Srikant, A., Jones, K.A., Snyder, V.S., Dale, A.M., White, N.S., McDonald, C.R., Farid, N., Louis, D.N., Perry, A., Reifenberger, G., von Deimling, A., Figarella-Branger, D., Cavenee, W.K., Ohgaki, H., Wiestler, O.D., Kleihues, P., Ellison, D.W., Lin, S., Eckel-Passow, J.E., Lachance, D.H., Molinaro, A.M., Walsh, K.M., Decker, P.A., Sicotte, H., Pekmezci, M., Rice, T., Kosel, M.L., Smirnov, I.V., Sarkar, G., Caron, A.A., Kollmeyer, T.M., Praska, C.E., Chada, A.R., Halder, C., Hansen, H.M., McCoy, L.S., Bracci, P.M., Marshall, R., Zheng, S., Reis, G.F., Pico, A.R., O’Neill, B.P., Buckner, J.C., Giannini, C., Huse, J.T., Perry, A., Tihan, T., Berger, M.S., Chang, S.M., Prados, M.D., Wiemels, J., Wiencke, J.K., Wrensch, M.R., Jenkins, R.B., Molinaro, A.M., Rice, T., Kosel, M.L., Smirnov, I.V., Sarkar, G., Caron, A.A., Kollmeyer, T.M., Giannini, C., Huse, J.T., Tihan,

84  Modern Forensic Tools and Devices T., Wiemels, J., Wiencke, J.K., Wrensch, M.R., Jenkins, R.B., Labreche, K., Kinnersley, B., Berzero, G., Di Stefano, A.L., Rahimian, A., Detrait, I., Marie, Y., Grenier-Boley, B., Hoang-Xuan, K., Delattre, J.Y., Idbaih, A., Houlston, R.S., Sanson, M., Wesseling, P., Capper, D., Glioma, E., Jiao, J., Ballester, L.Y., Huse, J.T., Tang, G., Fuller, G.N., Dis, N., Idh, I.D.H.I.D.H., Idh, I.D.H.I.D.H., Idh, I.D.H.I.D.H., Nad, D., Bryan, T.M., Englezou, A., Gupta, J., Bacchetti, S., Reddel, R.R., Pesenti, C., Paganini, L., Fontana, L., Veniani, E., Runza, L., Ferrero, S., Bosari, S., Menghi, M., Marfia, G., Caroli, M., Silipigni, R., Guerneri, S., Tabano, S., Miozzo, M., Moffitt-long, U., Hospitals, Z., Öîö, M., Chengjuan, Z., Bing, W., Jie, M., Mutations, P., Jun-, T.G.L.I.U., Jun-, L.I.U., Science, B.M., Hospital, Z., Aristóteles, Who, W.H.O., Clinicl, C., Cuniversity, T., San, C., Ucsfl, F., Shu, C., Wang, Q., Yan, X., Wang, J., Dis, N., Ii, W.H.O.I., Ii, W.H.O.I.-, Dna, A.T.P., Res, C., Treat, P., Med, T., Hai, W.E.I.M., Chun, H.U.Z., Hospital, S.A., Vol, M.B., Li, Z., Guo, Z., Li, Q., Le, L.I., Zheng, H.E., Remedies, C., Chang-, G.J.Z., Dehydrogenase, I., Papers, G., Drone forensic analysis using open source tools in the journal of digital forensics, security and law. N. Engl. J. Med., 372, 2499–2508, 2018. 16. Sharma, A. and Rao, P.K., Advanced forensic models, in: Technology in Forensic Science, pp. 303–326, Wiley, Weinheim, Germany, 2020, https://doi. org/10.1002/9783527827688.ch15. 17. De Daniela, U., Sociales, C., Virtual, C., Motivación, C., Sociales, C., Bello Garcés, S., De, F., Fern, J., De, F., Fern, J., de la Salud, O.M., Aparicio, J.J.J., Moneo, R., Sociales, C., La, I., Sociales, C., Virtual, C., Baquero, R., Orueta, B., Proximo, Z.D.E.D., Situación, S.Y., Problema, E.L., Rica, U.D.C., Rica, C., Baquero, R., Sociales, C., Virtual, C., Sociales, C., Los, C., Genética, P., Carretero, M., Desarrollo, C., Gardner, H., Kriger, M., Introducción, C., Castorina, J.A., Carretero, M., Piaget, J., Trilla, E.N.J., Rodríguez-Moneo, M., Curso, F.V., Superior, D., Impreso, C.S., Monjelat, N., Huertas, J.A., Rodríguez, E.M., Psicología, D., Motivaci, L., Unmanned aerial vehicle digital forensic investigation framework. Journal of Naval Sciences and Engineering (JNSE), Director 1, 32–53, 2018. 18. Jain, U., Rogers, M., Matson, E.T., Drone forensic framework: Sensor and data identification and verification. SAS 2017–2017 IEEE Sensors Appl. Symp. Proc, 2017, https://doi.org/10.1109/SAS.2017.7894059. 19. Rak, R. and Kolitschova, P., Forensic and manufacturer aspects of VIN production and location on motor vehicles. Arch. Mot., 82, 131–142, 2018. https://doi.org/10.14669/AM.VOL82.ART10. 20. VIN Decoding | Truth In Advertising [WWW Document], 2019. 21. Siegal, J., Knupfer, G., Saukko, P., Encylopedia of Forensic Science, Elsevier, Amsterdam, Netherlands, 2000, https://doi.org/10.1017/ cbo9781139924801.006. 22. Maiden, N.R., Serial number restoration: Firearm, 2009.

5 Facial Recognition and Reconstruction Payal V. Bhatt1, Piyush K. Rao2 and Deepak Rawtani1* School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India  2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University (Ministry of Home affairs, GOI), Gandhinagar, Gujarat, India 1

Abstract

Facial recognition and reconstruction is a rapidly developing field and has a great area of applications. It is a tool valuable and routinely used for crime investigation. Since last two decades great improvisation and automation have been discovered in the field of facial recognition and reconstruction. In this recent world of technological innovation and digitalization captured images and videos of criminal events have bought the facial recognition into the front field in judicial system. This chapter gives a brief introduction to facial recognition and reconstruction, together with different kinds of techniques used for the purpose of recognition and reconstruction face from different sources. A detailed discussion has been done on the challenges faced by experts for forensic facial recognition. At last the chapter shows some of the areas of application where facial recognition and facial reconstruction is successfully used. The aim of the chapter is to give a rough idea about the facial recognition and reconstruction along with its techniques and challenges. Keywords:  Facial reconstruction, facial recognition, biometrics, digital technique, sketch recognition

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (85–106) © 2023 Scrivener Publishing LLC

85

86  Modern Forensic Tools and Devices

5.1 Introduction With recent technological evaluations, and increased digitalization, the use of various biometrics system for personal identification and verification system has been taken into consideration [1]. Static physiological features such as fingerprint, palm print, and iris along with some behavioral characteristics such as signature, speech patterns, gait, and facial dynamics are used by biometric systems [2]. One of the main biometric trails of all time is face; it has various areas of execution including healthcare, security, marketing, and mainly forensics. Face recognition and reconstruction are two main scenarios having real time application in forensic science [3]. All the information about the gender, identity, age, race, and facial expressions that reflects mental state and emotions of a person is carried by a human face. An interdisciplinary research that analyze facial behavior and human face, involve areas like neuroscience, psychology and engineering [4]. Face recognition and facial reconstruction are considered a prized and important forensic instrument routinely used by crime experts [3]. There are several diverse methods utilized for facial recognition and reconstruction along with the challenges that are faced by forensic experts using these techniques and also the area of application of the techniques are known which are described in detail the chapter further.

5.2 Facial Recognition Facial recognition can be defined as a method of identifying a human face using different expertise and methods. Various different features and landmarks of face are used by a system to recognize a face [5]. On normal bases humans perform face recognition task effortlessly in their day-to-day life. Face recognition for different purposes using different methods can be considered difficult [6]. Due to increase in human factor in new generation technologies, facial recognition studies have been extensively increased in last few decades [5]. Facial recognition is a process that needs to be conducted for various different applications using different methods. In contrast to other biometric trails, face recognition plays an important role in forensic science [7]. Facial recognition does not require the cooperation of the person and can be accomplished in an unobtrusive way, hence can be considered much suitable for surveillance applications [4].

Facial Recognition and Reconstruction  87 Face recognition methodology are generally operated under two scenarios. One is verification and second is identification. In the process of verification, the two face images are compared and similarities between them are measured, after which a decision of match or non-match is taken [2, 8]. For the process of recognition, the given face image is matched with all the images present in the large record and similarities between them are measured [6]. The most similar, top ranked match is reimbursed as the hypothetical identification of the subject. These two described situations are system based and no human interactions are needed for the identity decisions [5, 9].

5.3 Facial Reconstruction The face is considered as the soul of a person. The amalgamation of the soft fatty tissues, muscles, and skin, along with the hard skeletal structure – the skull and the cartilage in the nose collectively makes the three-dimensional profile of the human face [10]. The elementary data that can be used to categorize the face is differences in soft fatty tissues, in conjunction with dissimilarities in texture and color of the skin, variances in facial features such as nose, eyes, and mouth and variation in hair [11]. Facial reconstruction is an artistic method that can be performed either by a forensic anthropologist or a forensic artist [12]. Facial reconstruction weather done with manual or computerized methods, gives a face to the faceless. To create an in vivo countenance of an unknown individual is the main aim of the facial reconstruction (2008 venezisphd). Facial reconstruction is defined as the restoration of lost, distorted, or unidentified facial structures of a person with an aim to intend recognition [13]. Forensic facial reconstruction is been used as an significant forensic tool that can help in facial recognition of the skull and eventually lead to affirmative identification of a person when the conventional procedures used for recognition like dental history examination, analysis of DNA, radiography, etc., are unsuccessful due to some glitches like absence of appropriate data, form of the remains of body, price, etc. [14]. In forensic facial reconstruction both artistic skill and scientific techniques are required for the precise identification of person [15]. This technique used to restructure the soft tissues onto the skull so as to achieve the spitting image of a distinct individual for that person’s identification.

88  Modern Forensic Tools and Devices

5.4 Techniques for Facial Recognition There are several techniques that can be used for the purpose of facial recognition. All the techniques mainly follow the same steps for the process which is mentioned below in Figure 5.1. In literature face recognition (FR) system can be separated into two main braches as image-based face recognition method and video-based face recognition method. The image based face recognition is mainly categorised into three main categories: i) appearance based method, ii) tecture besed method and iii) model based method. The video based face recognition method is brodly divided into two main assemblies: i) sequence based method and ii) set based method [4]. To give a clearcut classification of all the work on face recognition in the literature is very difficult. Therefore, the proposed classification is given in Figure 5.2 which is a course grouping of the method in literature [16].

Input: Image or Video

Face Anti-spoofing module

Face and/or Landmark Detection Preprocessing (Alignment, frame selection, etc.) Facial Feature Extraction Output: Identification/ verification result

Figure 5.1  Steps for facial recognition.

Facial Recognition and Reconstruction  89

Facial Recognition

Image Based Method

Appearance Based Method

Model Based Method

Video Based Method

Texture Based Method

Sequenced Based Method

Set Based Method

Figure 5.2  Classification of techniques used in facial recognition.

5.4.1 Image-Based Facial Recognition Image-based face recognition system uses physical appearance of the people to try and recognize a person. This approach involves recognition from a single frame using facial features [17].

5.4.1.1 Appearance-Based Method Murase and Nayar introduced the expression ‘appearance-based’. Appearance-based method tries to represent the face region as a whole in a lower dimensional subspace. Using linear or non-linear methods, lowerdimensional subspace can be learned [18]. Eigen face is solitary method used for appearance based face recognition. This method linearly projects images into the lower dimensional subspace using principle component analysis (PCA) method [19]. Firstly the test image to be identified is projected onto this subordinate dimensional subspace, then after the individuality of person is determined by comparing it to training sets by projecting of the gallery images [4]. The kernel-based approaches are used for the non-linear appearancebased method. This method works on the non-linear mapping of the data, after this mapping process the principle components of the features are calculated for successful face recognition [20].

90  Modern Forensic Tools and Devices

5.4.1.2 Model-Based Method Model-based face recognition technique can be encapsulated as 2D methods and 3D methods for face recognition. The well-known 2D approach or the two-dimensional model-based face recognition method is an Active Appearance Model [21]. In two-­ dimensional face recognition the primary step of all was to detect face, then second step of it was face alignment, then comes the third-step which was characteristic extraction and last step was facial feature matching from record of registered users to recognize face. There are various limitations of this 2D facial recognition model [21]. The performance and accuracy of this model depends on various features such as image quality, head orientation, lighting conditions, and facial expressions. Thus, after this the 3D model based face recognition came into use [4]. 3D human interpretation which is utilized for the face recognition is done using the landmarks measurement and by analyzing the geometric features including curvature and shape [22]. With the use of 3D facial shape indexes that are based facial curvature features and other characteristics three-dimensional face recognition can be performed [21]. To defeat the downsides of 2D face recognition techniques the use of three-dimensional technology came into consideration. Multiple images were attained from the sing image using a 3D morphable design for the 3D model based face recognition. Benefit of using 3D face recognition system is that it is not exaggerated by light concentration [21]. 3D model based face recognition method was tested on various databases and used with different augmentation techniques so that exactness and recognition rate can be higher [23].

5.4.1.3 Texture-Based Method Texture-based face recognition technique is also known as the local featurebased face recognition method, which uses various local face features for the purpose of facial recognition in forensics [24]. There are various texture based methods proposed by different researchers which use different local facial features to recognize the face and compare it to the gallery images. In computer vision for face recognition along with other recognition and revelation tasks the Histogram of Oriented Gradients (HOG) was utilized [25]. In this method, the HOG descriptor were calculated for all the facial landmark found using EBG in graph and

Facial Recognition and Reconstruction  91 the adjoining neighbor process was used as the classifier also, the HOG were calculated from unvarying grid for facial recognition [4]. Another method for face recognition categorized in texture based method is the scale-invariant Feature Transform (SIFT) and local binary patterns (LBP). SIFT technique is commonly resistant to rotation changes and scale, as number of feature points increases the computation time increases [26]. In computer vision, local binary patterns (LBP) were primarily expected for analysis of texture, and have been implemented for numerous functional applications.

5.4.2 Video-Based Facial Recognition Video-based face recognition system uses the physical appearance along with change in appearance with time or the subtleties of the face for facial recognition of the people. This method uses multiple frames and streams of video for recognition of face [27]. This video based face recognition system uses both facial expression as well as facial dynamics (rigid as well as non-rigid movement of face) for forensic face recognition.

5.4.2.1 Sequence-Based Method Sequence-based method as the name suggests uses the video frames in a specific sequence for the face recognition. The line of frames is necessary as it employ the temporal evidence that exists in a video [28]. Sequence-based method can be systematized as temporal methods and spatio-temporal methods [29]. Temporal technique uses the facial dynamics information discretely from the texture information, whereas spatio-temporal approaches model the texture and the motion data together. There are various methods used under the temporal method for face identification that uses the facial dynamics and face expressions for the detection and recognition of faces in video [30]. There are many changes seen in the facial features of a person but some of the emotional expression of the person do not changes even with age and are less profound to light alterations and thus are successfully used for the facial recognition in forensics [31]. Six primary emotions such as panic, anger, happiness, sorrow, disgust, and surprise can be successfully used for the sequence based facial recognition [4].

92  Modern Forensic Tools and Devices Spatio-temporal sequence-based methods utilize the motion and texture information of face together for face recognition from videos. This technique is successful and can be used for the low resolution videos [32]. The sequence based face recognition techniques focuses on the texture and facial dynamics more than the emotions of the face and hence can be very useful for the recognition from public surveillance cameras [4].

5.4.2.2 Set-Based Method Set-based method uses the frames of the video as set if images and the temporal order of the images are not considered for recognition of faces. The set based technique can be categorized as the method that uses the fusion before matching and fusion after matching for the purpose of recognition [33]. Joining all the features gained from each face image from the set before identifying procedure is considered as fusion before matching. Combining the recognition outcomes gained from each image of the set is considered fusion after matching [4]. This set based method divide and locate face into segments as nose, eye and mouth regions. Then after the feature extraction is carried out and the feature obtained from each frame is classified [34]. At last the feature classified score is obtained and the face recognition can be done with around 97% accuracy [4]. The video based method is much accurate and reliable method for the forensic face recognition as it uses various different techniques and 3D features of face for proper face recognition.

5.5 Techniques for Facial Reconstruction The skull and remaining parts of the postcranium are anthropologically examined and measured, before the reconstruction of face can start [35]. It is essential to gather all the possible information about the appearance of the dead from the available human remains and artifacts of which particular relevance are shape, color, length of the hair, beard/facial hair in men, eye color, skin color, height and weight, age, and ethnicity [36, 37]. Various different methods are used for the reconstruction of the face which is mentioned in Figure 5.3 and further discussed in detail.

Facial Recognition and Reconstruction  93 Manual Method

Graphical Method

Computerized Method

Facial Reconstruction

Figure 5.3  Techniques used in facial reconstruction.

5.5.1 Manual Method In manual facial reconstruction method also known as the three-dimensional method, the soft facial parts are reconstructed directly on to the skull in the form of wax, clay or synthetic substances [38]. The head or the face is considered as the central element of the body in all the belief systems and cultures [36]. If funereal is planned after the successful identification of the body, then this method is not considered suitable from ethical point of view. Therefore, the first step in this method is to cast the skull. Silicon is used to produce the templates and then synthetic material or plaster is used to cast the skull [39]. The skull model produced as a result of this procedure is then used as the base for the reconstruction of the soft facial tissues [36]. One of the methods used in manual facial reconstruction is Manchester method. In this process the face is reconstructed from the musculature with the help clay step by step [36]. The muscular tracks present on the bone specify whether musculature was more or less strongly developed. In the eye sockets the glass eye models are inserted. According to the anatomic position the glands, epidermis, and skin are applied, after the musculature has been completed [40]. For this step, the nutritional condition and the biological age of the person are important for deciding the thickness of the layer. To decide the thickness of the layer in this step, the biological age of the person and the nutritional condition of the person are necessary [36]. Using this procedure a successful sculpture-like face is created after subsequent sculpting and smoothing of the skin. The other method used in manual reconstruction is the “American method”. In this technique, the soft facial tissues are applied first in the

94  Modern Forensic Tools and Devices area of spacer device in the shape of ribbons. Subsequently, the spaces in between are filled [41]. As in the Manchester method, the influences of the facial muscles cannot be taken into consideration in this method [36]. In the manually reconstructed head, different variations of hairs and maybe beards are undertaken and documented. This method is both labor intensive and cost intensive for any kind of forensic facial reconstruction.

5.5.2 Graphical Method The detailed anatomic knowledge of head united with the artistic skills is used for the graphical facial reconstruction. This method totally depends on the mind of the investigator as, the three-dimensional reconstruction of the facial parts occur in investigators head which he puts on to the paper. The image of the person he/she is reconstructing is graphically drawn onto the paper by the artist [36]. This method is must faster than the manual method but is totally depend on the individual skill of the investigator and can hardly be checked [36].

5.5.3 Computerized Method The increased capabilities of the computers in this digital world and the drawbacks of the manual facial reconstruction have leaded us to develop the computerized facial reconstruction [42]. In the computerized method used for the facial reconstruction the first step is three-­dimensional digital capture of skull [43]. The CT scan or the surface scanner is used for this, which is a much faster process than creating a real copy of skull. Then after to apply the soft facial parts on to the virtual skull, methodological approaches used are based on the classical forensic facial reconstruction methods [44]. For the facial landmark positioning which is next step, programs has already been developed which automatically place the landmarks. But, computers can often lead to mistakes [45]. So, this program also has facility to place the landmarks manually or correct them manually after the automatic placing. The ends of the landmarks are joined together, after the virtual anchoring of the landmarks and their spacers. The resulting lattice patters have spaces which are filled in automatically and the edges are then smoothened. Depending upon the program skills and advancement of computer, the facial reconstruction of soft facial tissues can be achieved in seconds using computerized methods [46].

Facial Recognition and Reconstruction  95 There are other fully automatic programs used by investigation agencies for the computerized facial reconstruction. Also, step by step onscreen virtual facial reconstruction can also be done just as the manual reconstruction [47]. This method is more time consuming then the other automatic systems but the advantage of this method is many steps can be repeated as need also some of the intermediate steps can be skipped as desired and also many steps can be used in different variations for accuracy purpose [48]. One of the methods used is two-dimensional method in which, a forensic artist and a forensic anthropologist need to work jointly, for the facial reconstruction [37]. The two-dimensional technique is used in recognition of the lifeless from skeletal remains and is built on antemortem photographs and the skull that is to be reconstructed. It uses the soft tissues depth estimates to recreate the face from the skull. In this world of digitalization different computer software’s are used to speedily produce the 2D reconstruction that can be further manipulated and edited [46]. By capturing radiographs and images of skulls this software’s produces the electronically altered image of the skull. This method is effective as it speeds up the method of reconstruction and can produce more standard images [37]. Computerized methods are much easier and require very less time and thus, are widely used in the forensic face reconstruction. Various highly efficient and accurate programs are being made to make facial reconstruction easy and faster.

5.6 Challenges in Forensic Face Recognition Forensic face recognition is much demanding and very different from other automated and biometric face recognition. Forensic face recognition is a challenging task as it needs to handle facial images captured in nonideal condition and has to follow legal procedures [49]. Face recognition is a challenging problem in forensics due to various different constrains such as age, illumination, head poses, and facial expressions [5]. Also many changes can be made in the appearance of a person because of make-up, facial and hair accessories like glasses, scarves, and wigs [5]. Other than this similarities among individuals like twins and blood relatives can also be a problem in face recognition [50]. Of all these, the major challenges faced by forensic experts is mentioned in Figure 5.4 and is discussed in detail below.

96  Modern Forensic Tools and Devices

Facial Aging Facial Marks

Soft Biometrics

Forensic Face Recognition Challenges Forensic Sketch Recognition

NearInfrared Face Recognition Face Recognition in Video

Figure 5.4  Challenges in forensic face recognition.

5.6.1 Facial Aging Facial aging plays a significant role in forensic facial recognition. In many cases facial recognition scenario exhibit a noteworthy age difference between subject and gallery image acquired of a subject [5]. The correctness of a face recognition system generally reduces as the age difference between the subject and the gallery image of the identical subject upsurges. Human facial aging is a process in which both texture and shape of face is affected. In younger age group (≤18 years) the facial aging is characterized by the facial growth, whereas in older age group (>18 years) it is characterized by major texture changes and small shape deviations in face [51]. Depending upon the facial characteristics and human habits, mostly appearance of human’s changes more drastically at younger age [5]. In forensic investigation, there happens to be many cases where age differences are encountered and face recognition come into application. Identifying missing children and detection of the suspect from the database of the criminals are the type of cases where facial aging be a big challenge as a part of facial recognition [52].

Facial Recognition and Reconstruction  97

5.6.2 Face Marks Facial features like moles, scars, tattoos, and freckles are categorized as local facial marks, which plays a vital role in forensics for matching face images. The explicit use of these facial marks for the purpose of facial recognition is a challenging task, but they are valuable as the features provide a unique competency to interpret, examine, and exploit the face images in forensic applications [5]. Face marks help improve the accuracy and matching speed of the face recognition system, which can be useful to conclusively identify the suspect. In many law enforcement agencies and security organization, photo based identification involve a manual verification. In such law enforcement agencies, one of the main steps carried out for identification is to determine “class” and “individual” characteristics of person. The information of human face that falls under class is facial shape, presence of facial hair, hair color, presence of freckles and likewise [53]. The information included in individual characteristics is tattoos, scars, lip creases, chipped teeth, accidental scars, location, number of wrinkles, etc. A face recognition system based on face marks is not reliable for forensic applications and also they cannot recognize a subject exceptionally, as an alternative it can only screen a certain aspirant population from large database [5]. When an individual contains multiple face marks it is helpful for the investigators to retrieve list of subject with same face marks. The removed permanent marks and birthmarks using latest techniques such as plastic surgery make it very difficult for the system and forensic experts to recognize a particular face [54]. Thus, facial marks are valuable as well as challenging for the facial recognition in forensics.

5.6.3 Forensic Sketch Recognition A forensic sketch is produced by forensic artist when no video or photograph of suspect is available. Successfully imitated from an eye witness narrative, artist redemption of person’s facial appearance is considered as forensic sketch [55]. Forensic sketch were much in use in cases of prison escape and search of criminals. Traditionally, the law enforcement agencies used to circulate sketches to media outlets in the hope that somebody from somewhere will identify the individual in sketch [5]. Forensic sketch recognition is a challenging task in facial recognition because forensic sketch can be much misleading and inaccurate due to

98  Modern Forensic Tools and Devices reason such as error in witness memory recall, human error by the sketch artist, and lack of proper description by the eye witness. To generate a single forensic sketch an artist requires a significant amount of time, and thus culprits who have committed the most heinous crimes are only represented [55]. Also, it is of great importance to match a forensic sketch to the database images of such high profile culprits. Commercially used face recognition systems cannot match forensic sketch against a face photograph [5]. To overcome this, other face recognition system were developed which can match forensic sketch to face photograph various facial landmarks. The accuracy of such systems is very low. The major challenges in forensic sketch recognition for face recognition are the eye witness’s lack of ability to appropriately remember and properly describe the look of the criminal [5]. Out of all sketch recognition only few of the subjects can be correctly recognized. Most of the time, the photograph of the subject resembling the sketch turns out to be wrong and different from that of the original subject.

5.6.4 Face Recognition in Video Due to the widespread deployment of the surveillance cameras, the face recognition in video has added much reputation in the field of forensics. Developing systems which automatically recognize face from video streams can be of great use to law enforcement agencies [5]. However, to recognize a face from video obtained by the public surveillance camera can be a challenging task. The major difficulty in video face recognition is that face images in videos containing non-frontal poses of face. The other challenges that come in face recognition from a video are: 1) several lightening changes 2) images from dark places or night mode images 3) low camera resolution 4) covered faces between the frames. Apart from all these challenges, surveillance cameras and video streams can be much useful for face recognition in many cases. The video stream captures the multiple frames of the same subject which allows the system to select the image with high resolution and best quality [56]. Also, the dynamic facial expression changes recorded in the video can be used to recognize face with precision [5, 56]. There are much poses and lightening variation observed in video along with the illumination and resolution challenges; apart from all these face recognition using video is much useful for forensic investigation.

Facial Recognition and Reconstruction  99

5.6.5 Near Infrared (NIR) Face Recognition Near infrared (NIR) face images are less sensitive to illumination levels, and thus have gained great attention in facial recognition. One of the major challenges faced by forensic experts in face recognition was different illumination intensity in visible light images [5]. Application of face recognition in many branches is compromised due to environmental illumination changes. The near infrared (NIR) images provide an effective approach to solve the illumination problem in face recognition. In NIR imaging the images of face are obtained using active NIR lights with frontal lighting, mounted on the camera [5]. This active NIR images provide truly illumination steady facial images with great outcomes for both indoor and outdoor uses [57]. The challenging part in near infrared face recognition for forensics is matching the NIR images with the visible light (VIS) images in the database. As the VIS images are highly affected by various light illumination and natural illumination, perfectly matching NIR image to the VIS photographs is a difficult task [58]. In face recognition, some of the face features used by the systems to match images are not visible in NIR images and hence matching is inaccurate. In this age of development, there are various systems already in use for matching NIR face images with the visible gallery images. Having this, the surveillance system should ponder the use of Near Infrared cameras for eliminating the brightness problem.

5.7 Soft Biometrics Personal attributes like age, gender, scars, height, weight, eye color, tattoos, ethnicity, and voice accent are some of the soft biometric traits. Various soft biometrics are widely used for the forensic face recognition when the image obtained is of low quality [59]. The challenge in using soft biometric for forensic face recognition is duplication or removal of some traits such as moles and beards or changing eye color and removal of tattoos or newly carved tattoos to misguide the images and experts [5]. Apart from this soft biometric information has been used to improve the face recognition accuracies in different scenarios.

100  Modern Forensic Tools and Devices

5.8 Application Areas of Facial Recognition World-wide the facial recognition expertise is being embraced by law enforcement systems. Face recognition is always considered an interesting area and challenging task for the image retrieval. It has application in many discrete applications in specific areas which are briefly mentioned in Table 5.1 below. There are many biometric features that are being widely used like fingerprint, iris, palm prints, signatures, gaits, and speech. But, the issue in using all this biometrics is that they require active co-operation of an individual for any kind of authentication, whereas the facial recognition does not

Table 5.1  Application area of facial recognition. Area of application

Discrete applications

Law Enforcement

• • • •

Security and Healthcare

• • • • • •

Education, Entertainment and Marketing

• • • • • • • • •

For border monitoring Analysis of illegal event For tracking suspects For Passports, national ID cards, driver‘s licences • For purpose of immigration In information security For user authentication For logging in to electronic devices Human robot interaction For giving access to buildings To recognize faces from surveillance videos • Health related applications like smart homes and smart cars • For successful robotic assistants In virtual reality In gaming In photo management For video analytics In video retrieval process In online education of students For student follow-up For different advertising campaigns In social network moderation

Facial Recognition and Reconstruction  101 necessitate the active cooperation of people and hence, is widely used for the purpose of authentication in many departments [60]. Facial recognition is of great use in law enforcement especially in the border security and monitoring. The areas where facial reconstruction techniques are actively used are security, healthcare, education, entertainment, and marketing. Facial recognition is a challenging task but is also one of the most emerging and greatly developing fields nowadays.

5.9 Application of Facial Reconstruction Facial reconstruction is artistic area which has very limited number of applications. Facial recognition and forensics have an intimate connection, as forensic face recognition plays a key role in countless cases where other identification strategies fail to work [61]. There are many crucial cases where the dead body is found fully deformed and there is no sigh of recognition, also there are times when just the skeletal are found long after death. In such cases reconstruction of face plays an important role [62]. Also the medical, healthcare, anthropology and paleontology department uses the facial reconstruction techniques at some extend. Application of facial reconstruction is described in Table 5.2 below.

Table 5.2  Application area of facial reconstruction. Application area

Discrete application

Forensic Science

• In missing person cases • For identification of skeleton • For identification of deceased body

Medical and healthcare

• Facial Autologous Fat Grafting • Some cases of plastic surgery • For the correction of congenital and acquired deformities of the face

Anthropology and palaeontology

• To identify different skeletal • For the differentiation of various animal and human skeletal • For some historic information

102  Modern Forensic Tools and Devices

5.10 Conclusion Facial recognition and facial reconstruction are both very sensitive techniques which stands on the threshold between art and science, here an artist and a scientist need to work collectively to reconstruct an image which can ideally lead experts to identify a person [15]. Facial recognition is a technique which depends on the identification of the face and has various different techniques used for the recognition of a particular face. It falls under the category of biometrics and has wide range of application in several branches. There are various different challenges faced by the experts for the precise detection of the face and has various researches are carried out to improve the techniques used for the facial recognition. Facial reconstruction is a kind of art that helps in the identification of a person when all the other techniques fail. Facial reconstruction is best technique to produce image approximation that can say how a person may have looked in life. Facial reconstruction can traditionally be done using manual reconstruction method which is much time consuming and a lot expensive and hence, advanced computerized methods are being developed for the precise and advanced facial reconstruction. It has very limited application field, but is much important forensic cases where no other identification technique works.

References 1. Craw, I. and Cameron, P., Parameterising images for recognition and reconstruction, in: BMVC91, Springer, London, pp. 367–370, 1991. 2. Solanki, K. and Pittalia, P., Review of face recognition techniques. Int. J. Comput. Appl., 133, 12, 20–24, 2016. 3. Ali, T., Veldhuis, R., Spreeuwers, L., Forensic face recognition: A survey, Centre for Telematics and Information Technology, University of Twente, Tech. Rep. TR-CTIT-10-40, 1, 2010. 4. Taskiran, M., Kahraman, N., Erdem, C.E., Face recognition: Past, present and future (a review). Digit. Signal Process., 1, 102809, 2020. 5. Jain, A.K., Klare, B., Park, U., Face recognition: Some challenges in forensics, in: 2011 IEEE International Conference on Automatic Face & Gesture Recognition (FG), IEEE, pp. 726–733, March 2011. 6. Jain, A.K. and Li, S.Z., Handbook of Face. 1, Springer, New York, 2011. 7. Baron, R.J., Mechanisms of human facial recognition. Int. J. Man-Mach. Stud., 15, 2, 137–178, 1981.

Facial Recognition and Reconstruction  103 8. Gates, K.A., Our Biometric Future: Facial Recognition Technology and the Culture of Surveillance (Vol. 2), NYU Press, New York, 2011. 9. Wayman, J., Jain, A., Maltoni, D., Maio, D., An introduction to biometric authentication systems, in: Biometric Systems, pp. 1–20, Springer, London, 2005. 10. Stavrianos, C., Stavrianou, I., Zouloumis, L., Mastagas, D., An introduction to facial reconstruction. Balkan J. Stomatology, 11, 2, 76–83, 2007. 11. Verzé, L., History of facial reconstruction. Acta Biomed., 80, 1, 5–12, 2009. 12. Stephan, C.N., Anthropological facial reconstruction—Recognizing the fallacies, ‘unembracing’ the errors, and realizing method limits. Sci. Justice J. Forensic Sci. Soc., 43, 4, 193–200, 2003. 13. Cavanagh, D. and Steyn, M., Facial reconstruction: Soft tissue thickness values for South African black females. Forensic Sci. Int., 206, 1-3, 215–e1, 2011. 14. Clement, J.G. and Marks, M.K., Introduction to facial reconstruction, in: Computer-Graphic Facial Reconstruction, pp. 3–13, Netherlands, 2005. 15. Omstead, J., Facial reconstruction. Univ. Western Ontario J. Anthropology, 10, 1, 37–46, 2002. 16. Klare, B. and Jain, A.K., On a taxonomy of facial features, in: 2010 Fourth IEEE International Conference on Biometrics: Theory, Applications and Systems (BTAS), IEEE, pp. 1–8, September 2010. 17. Jain, A.K., Ross, A., Prabhakar, S., An introduction to biometric recognition. IEEE Trans. Circuits Syst. Video Technol., 14, 1, 4–20, 2004. 18. Levine, M.D. and Yu, Y.C., State-of-the-art of 3D facial reconstruction methods for face recognition based on a single 2D training image per person. Pattern Recognit. Lett., 30, 10, 908–913, 2009. 19. Fu, Y. and Zheng, N., M-face: An appearance-based photorealistic model for multiple facial attributes rendering. IEEE Trans. Circuits Syst. Video Technol., 16, 7, 830–842, 2006. 20. Quatrehomme, G., Cotin, S., Subsol, G., Delingette, H., Garidel, Y., Grévin, G., Ollier, A., A fully three-dimensional method for facial reconstruction based on deformable models. J. Forensic Sci., 42, 4, 649–652, 1997. 21. Singh, S. and Prasad, S.V.A.V., Techniques and challenges of face recognition: A critical review. Procedia Comput. Sci., 143, 536–543, 2018. 22. Tewari, A., Zollhofer, M., Kim, H., Garrido, P., Bernard, F., Perez, P., Theobalt, C., Mofa: Model-based deep convolutional face autoencoder for unsupervised monocular reconstruction, in: Proceedings of the IEEE International Conference on Computer Vision Workshops, pp. 1274–1283, 2017. 23. Park, U. and Jain, A.K., 3D model-based face recognition in video, in: International Conference on Biometrics, Springer, Berlin, Heidelberg, pp. 1085–1094, August 2007. 24. Weise, T., Bouaziz, S., Li, H., Pauly, M., Realtime performance-based facial animation. ACM Trans. Graph., 30, 4, 1–10, 2011.

104  Modern Forensic Tools and Devices 25. Qi, Y., Hu, B., Qiu, J., Lin, H., Fatigue expression recognition algorithm based on reconstructed LBP-HOG (LBP-RHOG) feature. IOP Conf. Ser. Earth Environ. Sci. IOP Publishing, 428, 1, 012065, 2020. 26. Hao, M. and Kang, C., Object location technique for binocular stereo vision based on scale invariant feature transform feature points. J. Harbin Eng. Univ., 30, 6, 649–652, 2009. 27. Jacquet, M. and Champod, C., Automated face recognition in forensic science: Review and perspectives. Forensic Sci. Int., 307, 110124, 2020. 28. Yamaguchi, O., Fukui, K., Maeda, K., II, Face recognition using temporal image sequence, in: Proceedings Third IEEE International Conference on Automatic Face and Gesture Recognition, IEEE, pp. 318–323, April 1998. 29. Spaun, N.A., Face recognition in forensic science, in: Handbook of Face Recognition, pp. 655–670, Springer, London, 2011. 30. Leong, S.M., Phan, R.C.W., Baskaran, V.M., Ooi, C.P., Privacy-preserving facial recognition based on temporal features. Appl. Soft Comput., 96, 106662, 2020. 31. Cohen, I., Sebe, N., Garg, A., Chen, L.S., Huang, T.S., Facial expression recognition from video sequences: Temporal and static modeling. Comput. Vis. Image Underst., 91, 1–2, 160–187, 2003. 32. Liu, M., Shan, S., Wang, R., Chen, X., Learning expressionlets on spatio-temporal manifold for dynamic facial expression recognition, in: Proceedings of the IEEE Conference on Computer Vision and Pattern Recognition, pp. 1749– 1756, 2014. 33. Zhao, J., Li, J., Tu, X., Zhao, F., Xin, Y., Xing, J., Feng, J., Multi-Prototype Networks for Unconstrained Set-Based Face Recognition, arXiv preprint arXiv:1902.04755, Cornell University, New York, USA, 2019. 34. Huang, Z., Shan, S., Wang, R., Zhang, H., Lao, S., Kuerban, A., Chen, X., A benchmark and comparative study of video-based face recognition on cox face database. IEEE Trans. Image Process., 24, 12, 5967–5981, 2015. 35. Aulsebrook, W.A., İşcan, M.Y., Slabbert, J.H., Becker, P., Superimposition and reconstruction in forensic facial identification: A survey. Forensic Sci. Int., 75, 2–3, 101–120, 1995. 36. Kreutz, K. and Verhoff, M.A., Forensic facial reconstruction-identification based on skeletal findings. Dtsch Arztebl., 104, 17, 985, 2007. 37. Gupta, S., Gupta, V., Vij, H., Vij, R., Tyagi, N., Forensic facial reconstruction: The final frontier. J. Clin. Diagn. Res., 9, 9, ZE26, 2015. 38. Suetens, P., Willems, G., Vandermeulen, D., De Greef, S., Claes, P., Statistically deformable face models for cranio-facial reconstruction. J. Comput. Inf. Technol., 14, 1, 21–30, 2006. 39. Wilkinson, C., Rynn, C., Peters, H., Taister, M., Kau, C.H., Richmond, S., A blind accuracy assessment of computer-modeled forensic facial reconstruction using computed tomography data from live subjects. Forensic Sci. Med. Pathol., 2, 3, 179–187, 2006.

Facial Recognition and Reconstruction  105 40. Wilkinson, C., Facial reconstruction–anatomical art or artistic anatomy? J. Anat., 216, 2, 235–250, 2010. 41. George, R.M., The lateral craniographic method of facial reconstruction. J. Forensic Sci., 32, 5, 1305–1330, 1987. 42. De Greef, S. and Willems, G., Three-dimensional cranio-facial reconstruction in forensic identification: Latest progress and new tendencies in the 21st century. J. Forensic Sci., 50, 1, 6pp., 2005. 43. Vanezis, M., Forensic Facial Reconstruction Using 3-D Computer Graphics: Evaluation and Improvement of Its Reliability in Identification, Doctoral Dissertation, University of Glasgow, 2008. 44. Shahrom, A.W., Vanezis, P., Chapman, R.C., Gonzales, A., Blenkinsop, C., Rossi, M.L., Techniques in facial identification: Computer-aided facial reconstruction using a laser scanner and video superimposition. Int. J. Legal Med., 108, 4, 194–200, 1996. 45. Thiemann, N., Keil, V., Roy, U., In vivo facial soft tissue depths of a modern adult population from Germany. Int. J. Legal Med., 131, 5, 1455–1488, 2017. 46. Wilkinson, C., Computerized forensic facial reconstruction. Forensic Sci. Med. Pathol., 1, 3, 173–177, 2005. 47. Clement, J.G. and Marks, M.K., Computer-Graphic Facial Reconstruction, Elsevier, Netherlands, 2005. 48. Stephan, C.N., Caple, J.M., Guyomarc’h, P., Claes, P., An overview of the latest developments in facial imaging. Forensic Sci. Res., 4, 1, 10–28, 2019. 49. Hassaballah, M. and Aly, S., Face recognition: Challenges, achievements and future directions. IET Comput. Vis., 9, 4, 614–626, 2015. 50. Wójcik, W., Gromaszek, K., Junisbekov, M., Face recognition: Issues, methods and alternative applications, in: Face Recognition-Semisupervised Classification, Subspace Projection and Evaluation Methods, pp. 7–28, 2016. 51. Sawant, M.M. and Bhurchandi, K.M., Age invariant face recognition: A survey on facial aging databases, techniques and effect of aging. Artif. Intell. Rev., 52, 2, 981–1008, 2019. 52. Atallah, R.R., Kamsin, A., Ismail, M.A., Abdelrahman, S.A., Zerdoumi, S., Face recognition and age estimation implications of changes in facial features: A critical review study. IEEE Access, 6, 28290–28304, 2018. 53. Jain, A.K. and Park, U., Facial marks: Soft biometric for face recognition, in: 2009 16th IEEE International Conference on Image Processing (ICIP), IEEE, pp. 37–40, November 2009. 54. Towler, A., White, D., Kemp, R., II, Evaluating the feature comparison strategy for forensic face identification. J. Exp. Psychol. Appl., 23, 1, 47, 2017. 55. Peng, C., Gao, X., Wang, N., Li, J., Face recognition from multiple stylistic sketches: Scenarios, datasets, and evaluation. Pattern Recognit., 84, 262–272, 2018. 56. Barr, J.R., Bowyer, K.W., Flynn, P.J., Biswas, S., Face recognition from video: A review. Int. J. Pattern Recognit. Artif. Intell., 26, 05, 1266002, 2012.

106  Modern Forensic Tools and Devices 57. Yi, D., Liu, R., Chu, R., Lei, Z., Li, S.Z., Face matching between near infrared and visible light images, in: International Conference on Biometrics, Springer, Berlin, Heidelberg, pp. 523–530, August 2007. 58. Guo, K., Wu, S., Xu, Y., Face recognition using both visible light image and near-infrared image and a deep network. CAAI Trans. Intell. Technol., 2, 1, 39–47, 2017. 59. Tome, P., Fierrez, J., Vera-Rodriguez, R., Nixon, M.S., Soft biometrics and their application in person recognition at a distance. IEEE Trans. Inf. Forensics Secur., 9, 3, 464–475, 2014. 60. Ahonen, T., Hadid, A., Pietikainen, M., Face description with local binary patterns: Application to face recognition. IEEE Trans. Pattern Anal. Mach. Intell., 28, 12, 2037–2041, 2006. 61. Evison, M.P., Iwamura, E.S.M., Guimarães, M.A., Schofield, D., Forensic facial reconstruction and its contribution to identification in missing person cases, in: Handbook of Missing Persons, pp. 427–441, Springer, Cham, 2016. 62. Wetterau, M., Szpalski, C., Hazen, A., Warren, S.M., Autologous fat grafting and facial reconstruction. J. Craniofac. Surg., 23, 1, 315–318, 2012.

6 Automated Fingerprint Identification System Piyush K. Rao1, Shreya Singh2, Aayush Dey1, Deepak Rawtani2* and Garvita Parikh2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University, Gandhinagar, Gujarat, India 2 School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India

1

Abstract

The primary reason behind the increase in criminal activities in the post-industrialization era is the increase in human population due to relocation in urban establishments for purposes such as employment, businesses, entertainment, and to avail different amenities. The population in rural settings diminished due to the aforementioned reasons and the need for identification was not yet urged. Fingerprint as an autonomous identification system was given in the late 1800s after the soar in criminal activities. After the establishment of the fingerprint classification system, the need for the automation of the fingerprint database was felt. In the mid-1900s the identification division was established by the federal bureau of investigation started developing platforms that would completely automatize the fingerprint acquisition process and the cross-referencing protocols. An automated fingerprint identification system proved to be more reasonable in terms of time and man-power as it cut short the tedious amount of work an analyst had to go through prior to match a fingerprint. This chapter not only emphasizes in the developmental phase of the automation process of fingerprints but also provides a critical insight upon the fingerprinting system laid down in modern day principles forensic science. Keywords:  Automation, fingerprints, quality enhancement, AFIS, fingerprint classification

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (107–124) © 2023 Scrivener Publishing LLC

107

108  Modern Forensic Tools and Devices

Abbreviations MDR Missed detection rate FDR False detection rate TV Total variation ConvNets Convolutional Neural Networks PPI Pixels per inch MSCC Minutia Spherical Coordinate Code CCN Convolutional Neural Network STFT Short-Time Fourier Transform ROI Region of interest FTR Failure to register FTE Failure to enroll AFIS Automated Fingerprint Identification System VID Value for Individualization VEO Value of Extraction NV No Value VMD Vacuum metal deposition DFO 1,8-diazafluoren9-one IAFIS Integrated automated fingerprint identification system FBI Federal Bureau of Investigation

6.1 Introduction The modern world is challenged by the necessity of identifying the individuals. Fingerprint recognition is one of the most researched and advanced technologies of biometrics. The first systematic attempt at personal identification was done by Alphonse Bertilone in 1883 the system relied on anthropometry (human measurement), it is the precise detailed body measurements i.e., wrist to fingertip, knee to ankle. The first person to use the fingerprints for the identification of person is Sir William Hershel. In 1856 he used the prints on the native contracts. The book titled Fingerprint describes the anatomy of fingerprint and method of recording it. Galton popularizes fingerprinting and the major US cities start using the fingerprint as a criminal identification in 1904. Fingerprint comprise of friction ridges which is found on the griping surfaces of hand and feet. The friction ridges form during the fetal development and so it is apparently unique. Millions of researches over a century shows that the fingerprints are extremely reliable [1].

Automated Fingerprint Identification System  109 In 1960s the domain of Automated Fingerprint Identification System originated and was utilized by various investigative agencies and converted into a worldwide phenomenon [2]. It is a computer-based identification system of where computers have been integrated into fingerprint identification, comparison, and analysis. In this computers are used to scan and encode fingerprints with a high speed of processing. Automated fingerprint identification system can make thousands of comparisons per seconds and it gives an output in the set of possible matches. Further the matches must be check by a trained fingerprint expert [3]. There are different types of AFIS system exist some are at local level, state level, country level and federal level, but not all are compatible with one another. There is no single integrated system exists. The largest AFIS system is in United State and it is FBI’s IAFIS (Integrated automated fingerprint identification system) with approximately 100 million fingerprints stored. Fingerprints is an oldest biometric identification techniques, it is the most popular and possible method for identification of fingermarks or impression. The study of fingerprint identification is known as “Dactyloscopy”. Fingerprint do not use only for identification of criminals Dusting powder Physical method Fingerprint development method

Magnetic powder Silver nitrate Ninhydrin Porous substrates

Iodine fuming Oil red O DFO

Chemical method

Cynoarcylate fuming Non-porous substrates

Multi Metal deposition Vacuum Metal deposition

Figure 6.1  Fingerprint classification.

110  Modern Forensic Tools and Devices but it is also used for authentication, public security, etc. [1]. Fingerprint is an individual characteristics; no two fingerprints have identical character or no two people have the exact same fingerprint pattern and it remains unchanged during individual’s lifetime [2]. Even if two identical twins which have same DNA they also don’t have same fingerprint pattern. A person’s fingerprint pattern does not change; however, the print itself may be change due to permanent scars, chemicals, or diseases [4]. The uniqueness of every person fingerprints is due to the different combination of ridge characteristics minutiae [5]. A pictorial representation of the fingerprint classification is depicted in Figure 6.1.

6.2 Ten-Digit Fingerprint Classification There are different fingerprint classification system which are used in different countries [6]. Galton, Henry, and Vucetich system of fingerprint arrangement are the most satisfactory classification that is used for finding out of the criminals. In 1896 Sir Edward Richard Henry proposed a tendigit fingerprint classification [7]. The ten-digit fingerprint classification system are studied under the subsequent seven titles: 1. 2. 3. 4. 5. 6. 7.

Primary classification system Major divisions system Secondary classification system Sub-secondary classification system Second sub-secondary classification system Final classification system Key classification system

6.3 Henry Faulds Classification System The first ever fingerprint classification system was proposed by Henry Faulds. This system comprised of a 10-finger system. In this particular system the fingers are grouped in five pairs in a distinct manner: Pair 1 – Right Thumb and Right Index (RT&RI) Pair 2 – Right Middle and Right Ring (RM&RR) Pair 3 – Right little and Left Thumb (RL<) Pair 4 – Left Index and Left Middle (LI&LM) Pair 5 – Left Ring and Left Little (LR&LL)

Automated Fingerprint Identification System  111 The fingers of the each hand has been given a particular number such as the right thumb is numbered as one, right index finger as 2, right middle finger as 3, right ring finger as 4, right little finger as 5, left thumb as 6, left index finger as 7, left middle finger as 8, left ring finger as 9 and left little finger as 10.

6.4 Manual Method for the Identification of Latent Fingerprint Before automated fingerprint identification system there is a manual latent fingerprint matching system: the ACE-V method. Latent fingerprint are examined manually by the experts. Manual examination of latent fingerprints follows the ACE-V (Analysis, Comparison, Evaluation, and Verification) method, which comprises of four sequential stages [3]. 1. Analysis (A): In this step, the latent print examiner examines the latent impressions to describe the satisfactoriness of a latent impression. Further, the examiner allocates one of the three tags: Value for Individualization (VID), Value of Extraction (VEO), and No Value (NV). Two types of results can be obtained in this step: (i) the fingerprint is labeled in a sense of its quality for performing following steps, (ii) the characteristics that match must be marked. 2. Comparison (C): The examiner physically compares the typical features of latent (unknown prints) to the fingerprints found at a crime scene also known as exemplar prints (known prints). This comparison is purely based on priorly marked matching features. This step basically brings out the records of resemblances and differences between the latent and available exemplar fingerprints. 3. Evaluation (E): In this phase, where the examiner derives a conclusion on the basis of the results of the comparison phase. The evaluator evaluates and make a conclusion in the form of: (i) Identification (or Individualization) – when there is sign to conclude that the latent and the exemplar record have come from the same source; (ii) Exclusion – when the latent print can’t be allocated to any known exemplar labels; or (iii) Inconclusive – when the examiner is incapable to make a conclusion about the unknown latent prints.

112  Modern Forensic Tools and Devices The decision is based on the earlier created list of similarities and differences. 4. Verification (V): The concluding phase in the process of manual latent fingerprint identification where a subsequent investigator or expert analyses all findings and data recorded by the primary expert.

6.5 Need for Automation The tedious work hours required for manual latent print identification gave rise to the automation of latent fingerprint identification system. As new types of fingerprints were discovered, the classification system proposed by Henry and Vucetich were dismissed. Before the automation of fingerprint databases, a physical file of offenders or convicts were collected via ink, slab, and roller and well-preserved on a 10-print card [8]. Manual maintenance of 10-print cards became difficult over time, mainly due to population boom and advent in criminal activity. This gave rise to the need of an automated system that could digitize and store all the prints priorly collected on a 10-print card. The primary need for an automated approach was need because of following three reasons. (1) digitize each print of two hands from a 10-print card. (2) image post processing to produce a reduced-sized template of feature information. (3) accurately determine the potential matches [9].

6.6 Automated Fingerprint Identification System With the advancement of technologies, an advance fingerprint identification system is developed and known as the Automated Fingerprint Identification System (AFIS). AFIS refers to a computer system developed to aid the process of maintaining, searching and matching fingerprints by digitizing the 10-print cards in online databanks [10]. Automated fingerprint identification system primarily comprises of two categories of searches (1) ten-print search and (2) a latent search. AFISs were originally intended to be used for assisting fingerprint experts in order to verify the identity of repetitive offenders. This was done by matching the fingerprints of prime suspects to the fingerprint impressions already stored in the AFIS database [9]. The applications of AFISs were broadened to the field of forensic intelligence by comparing fingerprints found on different crime scenes to the standard database. The working of AFISs can be simply stated

Automated Fingerprint Identification System  113 as, utilization of biometric algorithms to extract and equate features of fingerprints and fingermarks images and to compute scores representing the similarity and the typicality of two specimens [11]. Automated Fingerprint Identification Systems (AFIS) technology is making a revolutionary effect on law enforcement capability to arrest the lawbreakers and solve crime. Its exactness in searching and matching fingerprints is as high as 98 to 100 percent [9]. The complete course of an AFIS system is majorly classified into four chronological steps, namely “segmentation; enhancement; feature extraction and matching” [12].

6.7 History of Automatic Fingerprint Identification System In 1924, the experts of the United States of America established the FBI’s Identification Division. This division was setup to store a central database of criminal identification data for law enforcement agencies all over the United States. The primary number indicating the collection of fingerprint records was around 810,100. By the early 1960s the FBI’s criminal files had seen an exponential growth in criminal records accounting to about 15 million individuals. The FBI installed the AFIS prototype designed by the Cornell Aeronautical Laboratory [12]. The FBI began testing automatic searching in 1979, and automated searches became routine by 1983 [13].

6.8 Automated Method of Analysis The automated latent fingerprint identification system consists of four primary tasks that are attained in a preset sequence. These primary four tasks are systematized into two groups, as follows. Figure 6.2 describes the steps for automated method of analysis.

Before feature extraction

After feature extraction

• Latent fingerprint segmentation • Latent figerprint enhancement

• Latent fingerprint feature extraction • Latent figerprint matching

Figure 6.2  Steps for automated method of analysis.

114  Modern Forensic Tools and Devices

6.9 Segmentation The primary goal of the latent fingerprint segmentation is to separate the foreground latent fingerprint from the blurry or incomprehensive background. Latent fingerprint segmentation is hard in addition to the typical encounters of image segmentation. Practicing latent fingerprint segmentation is difficult because it must reproduce results in a manner that the borders of the latent fingerprints are clearly visible in addition to eliminating blurs and noises that are present inside the edges of the latent fingerprints [13]. Producing a specific region of interest (ROI) that marks each foreground sections with high precision, while eliminating the background blurs and noises as much as possible is the primary working of segmentation [14]. Separating the print region from the background is of absolute importance in fingerprinting. Collection methods of latent fingerprints patterns include basically lifting using cellophane tape or photography from different surfaces that varies in texture and shape [15]. Segmentation is a process where the fingerprint region is separated from the complete captured photograph. Segmentation of fingerprint directly affects the process of feature extraction. This is due to the fact that inappropriate segmentation leads to the abstraction of false fingerprint topographies. Segmentation is one of the challenging phases of the AFIS as the fore-ground fingerprint ridge information is entwined with the background details in most of the cases [3]. Arshad et al. proposed a clustering method for the segmentation of latent fingerprint. Clustering is used for the separation of foreground and background information from the classified image and sobel filter is used for background assessment [16]. Cao et al. proposed an automatic latent fingerprint segmentation and enhancement with the help of the fine ridges structure dictionary. Firstly the total variation decomposition is used for the removal of background noise from the latent fingerprint image, than the obtained image is separated into overlapping patches [17]. Yang et al. proposed a systematic approach for the detection, segmentation, and orientation of the latent fingerprints. The suggested technique achieved a better precision in the performance of a multi-latent fingerprint data and also improved the curve among MDR and FDR than the previous segmentation approaches [18]. Liu et al. proposed a latent fingerprint segmentation based on linear density. The proposed method is to isolate the fingerprint foreground region from the composite background. Firstly, a latent image is decomposed into cartoon and texture image with the help of TV model, the texture image is used for the further and the cartoon image is used for removing the noise.

Automated Fingerprint Identification System  115 Secondly, identify a set of line fragments from the texture image and compare the linear density for fingerprint [19]. Stojanovic et al. proposed a fingerprint ROI segmentation based on deep learning. This method is based on non-overlapping fingerprint image patches [20]. Sankaran et al. proposed a method which differentiate between ridge and non-ridges patterns, it is an automatic segmentation of latent fingerprint. For the determination of the foreground (ridges) and background (noise) we need to extract different features such as saliency, image, gradient, ridge, and quality features and these features are extracted from the local patches of the image [21]. Liu et al. proposed segmentation technique which is based on the ridge density and orientation consistency. First, decompose the latent fingerprint image with the help of total variation model. A texture image in obtained by the decomposition of the latent image. Second, ridge segments are detected from the texture image, and then the density of ridge segments and ridge orientation have been compared [22]. Nguyen et al. proposed an automatic latent fingerprint segmentation. The proposed technique is a fully automatic process of segmentation, known as SegFinNet. In this method a latent fingerprint image is used as an input and an output we get is a friction ridge pattern. It operates on a fully convolutional neutral network [23].

6.10 Enhancement and Quality Assessment After the segmentation of latent fingerprint it is important to enhance the fingerprint image. It is an essential step. Enhancement is usually done to remove the noise, improve the image quality and for the clarity of the ridge structure. The main motive behind the enhancement is to produce a good quality of image that can be used for the feature extraction from the segmented image [13]. If the segmented fingerprint image doesn’t contain the minimum information that is required for a good match the impression should be discarded and the discarded image is known as FTR (failure to register) or FTE (failure to enroll) [15]. The enhancement process usually goes along with a quality evaluation phase. Quality assessment is also an important step because it ensure that the quality of the fingerprint is appropriate for extraction and we can extract the minimum amount of information necessary for the suitable match [14]. The image matching algorithm, quality of input fingerprint image and fingerprint features extraction are co-related with each other. If we have a poor quality fingerprint image the ridge structures are not very well defined and can’t be correctly matched [3].

116  Modern Forensic Tools and Devices Yoon et al. present a work on latent fingerprint enhancement. In the proposed enhancement algorithm it only needs physically marked region of interest and singular points but the orientation field estimation play the major role. Skeletonized image generated is used for the calculation of the orientation field and Gobor filter is used for the enhancement of the print [24]. Feng et al. proposed a latent fingerprint enhancement via robust orientation field estimation; it requires the minimum manual marking of ROI and singular points. Firstly, the calculation of all orientation elements in every segment is done by using the Short-Time Fourier Transform (STFT). Secondly the approx. calculation of the orientation field has been done by using the R-RANSAC and by suing the Gobor filtering the ridge structures are enhanced [25]. Zhou et al. proposed an orientation field estimation for latent fingerprint enhancement by utilizing the previous information of a fingerprint (ridge structure). The field orientation is obtained by using a dictionary of references [26]. Yang et al. proposed a localized dictionaries based orientation field estimation method in which the noisy patch is removed by the real orientation patch at the same location by using the local orientation based dictionaries [27]. Kumar et al. proposed orientation field correction using region wise dictionary algorithm in which the latent print is divided into six regions of overlapped orientation patches and create a region wise dictionary of the patches. There is automatic correction for the orientation field, the region having the maximum resemblance index replaces the corresponding region [28]. Cao et al. proposed an orientation field estimation via ConvNet (convolutional neural network) algorithm in which orientation field is classified into different latent patches. Orientation field are obtained from the 128 representative orientation patches and a large number of orientation fields are used to find the orientation patches [29]. Xu et al. proposed fingerprint enhancement using gobor and minutia dictionaries. The proposed algorithm construct two dictionaries Gobor dictionary is used for the enhancement of ridges while the minutia is enhance by the both dictionaries. It is the two step multi-scale patch based sparse representation for the ridge and minutiae enhancement. It also requires the prior information about the ridge and minutiae [30]. Li et al. proposed a deep convolutional neural network (CNN) for latent fingerprint enhancement method. The CNN based method is also known as FingerNet. The proposed method is much faster than the previously proposed methods. It involves three major steps, feature extraction of fingerprint, removing the noise and the guide for the multi task learning approach [31].

Automated Fingerprint Identification System  117

6.11 Feature Extraction The feature extraction from a latent fingerprint is a very important procedure. It is mainly due to the fact that it is vital to seize all observable characteristics form the fingerprint for its effective matching [15]. Feature extraction is a very stimulating task primarily due to factors such as low quality image, less data contents and less ridge information. The extraction step encrypts the content of segmented and enhanced fingerprint [3]. Fingerprint features widely classified into some categories [32]: i.

Ridge orientation field – Overall ridge flow pattern or global structure of fingerprint. ii. Minutiae points – Ridge ending and bifurcation points. iii. The singularities – Core and delta. The primary classification for fingerprint features are [14]. • Level-1 feature: This features includes ridge orientation field and singular points which are primarily generalized features. • Level-2 feature: This feature comprises of local features of fingermark ridges which shows some discontinuity in the flow is known as minutiae points. These are of two types of ridge flow discontinuity namely ridge endings and ridge bifurcations. Form a standard 500 ppi image the minutiae, bifurcation and ridge endings can be extracted. • Level-3 feature: this level includes details about the intraridge. It can be detected at every minute level. Intra-ridge includes pores, width, dots, curvature, recipient ridges, shape and edge contours of ridges. For the extraction of these features we need at least 1000 ppi image and these features are highly distinctive. Teixeira et al. proposed an algorithm to utilize spatial analysis to improve the pore extraction in high resolution fingerprint image. They introduce a relation between the spatial and photometric dependence which is used for the extraction of the pores [33]. Sankaran et al. proposed a minutiae extraction using stacked denoising sparse auto encoders. The author said that the extraction of minutiae is limited because of the noisy ridge pattern which is present in the background. So they proposed a twofold: (1)  to learn the minutiae descriptor use the stacked sparse auto encoder and

118  Modern Forensic Tools and Devices (2) classification of patches as minutiae and non-minutiae and minutiae extraction is a binary classification problem [34]. Segundo et al. proposed pore-based ridge reconstruction for fingerprint recognition method. It is a fully automatic technique for the pore-based ridge reconstruction. The pore-based ridge reconstruction is done by using the Kruskal’s minimum spanning tree algorithm and it also helps to connect the consecutive pores [35]. Genovese et al. developed a technique for the touch-less pore fingerprint biometrics. The method in particular extract the sweat pores form the fingerprint by using the different touch-less image acquisition. Further, a computational intelligence is used to find the actual sweat pores [36]. Donida et al. proposed an extraction method of level 3 feature with heterogeneous fingerprint images (touch-based, touch-less and latent prints) using Convolutional Neural Network and the results were tested on different databases [37]. Su et al. propose a deep learning approach towards pore extraction. For the detection of pores it utilize the classification capability of CNNs. The pore detection rate is 88.6% [38]. Tang et al proposed FingerNet for minutiae extraction from the rolled and latent fingerprint. The author proposed to combine the domain knowledge and representation abilities of deep learning to design the deep convolutional network. However the results of segmentation and enhancement steps highly effect the performance of it [39]. Tang et al. proposed a latent fingerprint minutia extraction using fully convolutional network. It doesn’t require the segmentation and enhancement of the print. It directly generate the minutiae from the latent fingerprint [40]. Nguyen et al. proposed a fully automatic minutiae extractor. They combine two network CoarseNet and FineNet. CoarseNet provides the location of the minutiae and orientation by using the domain knowledge. Further the FineNet use to refine the minutiae location [41].

6.12 Latent Fingerprint Matching A protocol for fingerprint matching equates two different images of fingerprints and exhibits a certainty of similarity between them or a binary result i.e., match or no match [3]. The process of matching and comparing fingerprints is a thought-provoking problem. This is mainly due to huge intra-class variations [15]. This primary step involved in latent fingerprint matching includes finding the exact match of an unknown latent fingermark found at a crime scene to the fingerprint already stored in a database [32].

Automated Fingerprint Identification System  119 Table 6.1  Latent fingerprint databases. S no.

Year

Name of database

1.

2000

2.

Description

Ref.

NIST SD-27A

It contains 258 grayscale fingerprint images, the resolution of the images are 500 PPI and 1000 PPI and level 1 and level 2 features are extracted.

[50]

2001

IIIT latent fingerprint

It contains 1046 grayscale fingerprint images, from 15 subjects. The resolution of each image is 4752 x 3168 pixels and level 2 features is extracted.

[43]

3.

2012

IIIT-D Simultaneous Latent Fingerprint

It contains 1080 images from 30 subjects, the resolution of the image is 500 PPI and level 1 and 2 features is extracted.

[44]

4.

2012

ELFT (Evaluation of Latent Fingerprint Technologies) - EFS (Extended Feature Set)

It contains 1100 latent fingerprint images, the resolution of each image is 1000 PPI and 500 PPI and level 1,2 and 3 features is extracted.

[45]

5.

2013

WVU latent fingerprint

It contains 449 latent images, the resolution of the image is 1000 PPI, and level 2 and 3 features are extracted.

[45]

6.

2015

IIITD Multisurface Latent Fingerprint Database (IIITD MSLFD)

It contains 551 latent fingerprint images from 51 subjects, the resolution of image is 3840 x 2748 pixels and level 2 feature is extracted.

[51]

120  Modern Forensic Tools and Devices A latent fingerprint matching protocol was proposed by Jain et al. The proposed module consist of minutiae matching, orientation field matching, and skeleton matching. The minutiae matcher was improved to 74 percent [42]. Sankaran et al. proposed a technique matching latent to latent fingerprints. The proposed method consist three steps (i) a comparative analysis of existing algorithms is presented for this application, (ii) fusion and context switching frameworks are presented to improve the identification performance, and (iii) a multi-latent fingerprint database is prepared [43]. Sankaran et al. present a work on hierarchical fusion for matching the latent fingerprint. They proposed two step procedure firstly an automated hierarchical fusion method in which the evidence are fused from various latent prints and secondly the IIITD simultaneous latent fingerprint record is prepared [44]. The algorithm consider minutiae and orientation both [45]. Zanganeh et al. proposed a partial matching through region-based similarity. The proposed algorithm is a simple but effective method for matching in which the pixel and the correlation coefficient are compared [46]. Zheng et al. proposed a matching technique using minutia spherical coordinate code. In this Minutia Spherical Coordinate Code (MSCC) algorithm is used. MSCC helps us to find the minutiae pairs [47]. Cao et al. proposed an automated latent fingerprint recognition system. This algorithm operates on the ConvNets. ConvNets helps in the assessment of ridge flow, minutiae extraction, and extraction of corresponding templates (2 minutiae and 1 texture template) [48]. Nguyen et al. proposed an end-to-end pore extraction and matching. The proposed framework deals with the level-3 features (pores). The result show that the matching performance of the pores is improved [49].

6.13 Latent Fingerprint Database Latent fingerprint database is one of the challenging task to tackle. It is very difficult to simulate all the fingerprints because of the crime scene variation and background difference [14]. Some of the databases are mentioned in Table 6.1.

6.14 Conclusion After the advent of fingerprinting systems, the technology has evolved, yet there is a plethora of challenges that needs to be countered prior to build a fully functional and error proof and automated platforms for

Automated Fingerprint Identification System  121 the acquisition of fingerprints. Although the AFIS based systems have upgraded throughout the years, the primary drawback of AFIS based system is that, they lack the critical decision-making aspect of an expert trained in the domain of fingerprinting. Nonetheless, AFIS based platforms are undeniably rapid, feasible, reliant and provide solutions in various conventional and emerging applications in the field of forensic science. Most of the researches that have been carried out regarding the upgrade of automated fingerprint acquisition systems have mostly tried to induce the aspect of human like performance. Now this aspect of human intellect has been tried to incorporate into automated machines without the availability of information-rich sources. Due to the unavailability of complex models and image acquisition techniques automated platforms for fingerprint identification lack the necessary gist to replace the need of fingerprint experts. In a concluding remark it must be stated that there is a need for reconnoitering completely unlike characteristics that possess a plethora of discriminatory data, and vigorous protocols for the comparison of fingerprints which could be incorporated to automated fingerprint identification systems.

References 1. Houck, M.M., Forensic Fingerprints-Advanced Forensic Science Series, Mm, pp. 1–282, 2015. 2. Uchida, K., Fingerprint identification. NEC J. Adv. Technol., 2, 1, 19–27, 2005. 3. Singla, N., Kaur, M., Sofat, S., Automated latent fingerprint identification system: A review. Forensic Sci. Int., 309, 110187, 2020. 4. Win, K.N., Li, K., Chen, J., Viger, P.F., Li, K., Fingerprint classification and identification algorithms for criminal investigation: A survey. Future Gener. Comput. Syst., 110, 758–771, 2020. 5. Abraham, J., Champod, C., Lennard, C., Roux, C., Modern statistical models for forensic fingerprint examinations: A critical review. Forensic Sci. Int., 232, 1–3, 131–150, 2013. 6. Henry, E. R., Classification and uses of finger prints. HM Stationery Office [printed by Harrison and sons, Limited], 1922. 7. Hutchins, L. A., Systems of friction ridge classification. The Fingerprint Sourcebook, 1, 2011. 8. Wang, Q., Wang, W., Zhang, W., Zhao, T., Jin, G., Research and realization of ten-print data quality control techniques for imperial scale automated ­fingerprint identification system. J. Forensic Sci. Med., 3, 2, 90–96, 2017. 9. Loll, A., Automated Fingerprint Identification Systems (AFIS), 2nd ed., Elsevier Ltd., 2013.

122  Modern Forensic Tools and Devices 10. Kaushal, N. and Kaushal, P., Human identification and fingerprints: A review. J. Biom. Biostat., 02, 04, 2011. 11. Marcel, S., Nixon, M.S., Li, S.Z. (Eds.), Advances in Computer Vision and Pattern Recognition Handbook of Biometric Anti-Spoofing, Springer, Switzerland, 2019. 12. Shen, X., Cheng, M., Shi, Q., Qiu, G., A new automated fingerprint identification system. J. Comput. Sci. Technol. (JCST), 4, 4, 289–294, 1989. 13. Maltoni, D., Cappelli, R., Meuwly, D., Automated fingerprint identification systems: From fingerprints to fingermarks, in: Advances in Computer Vision and Pattern Recognition, pp. 37–61, 2017. 14. L.-M.-U. M. Technische Universtität München, 済無No Title No Title, 2018. 15. Ezhilmaran, D. and Adhiyaman, M., A review study on latent fingerprint recognition techniques. J. Inf. Optim. Sci., 38, 3–4, 501–516, 2017. 16. Arshad, I., Raja, G., Khan, A.K., Latent fingerprints segmentation: Feasibility of using clustering-based automated approach. Arab. J. Sci. Eng., 39, 11, 7933–7944, 2014. 17. Cao, K., Liu, E., Jain, A.K., Segmentation and enhancement of latent fingerprints: A coarse to fine ridge structure dictionary. IEEE Trans. Pattern Anal. Mach. Intell., 36, 9, 1847–1859, 2014. 18. Yang, X., Feng, J., Zhou, J., Xia, S., Detection and segmentation of latent fingerprints. 2015 IEEE Int. Work. Inf. Forensics Secur. WIFS 2015-Proc., 2015. 19. Liu, S., Liu, M., Yang, Z., Latent fingerprint segmentation based on linear density. 2016 Int. Conf. Biometrics, ICB 2016, 2016. 20. Stojanovic, B., Marques, O., Neskovic, A., Puzovic, S., Fingerprint ROI segmentation based on deep learning. 24th Telecommun. Forum, TELFOR 2016, pp. 5–8, 2017. 21. Sankaran, A., Jain, A., Vashisth, T., Vatsa, M., Singh, R., Adaptive latent fingerprint segmentation using feature selection and random decision forest classification. Inf. Fusion, 34, 1–15, 2017. 22. Liu, M., Liu, S., Yan, W., Latent fingerprint segmentation based on ridge density and orientation consistency. Secur. Commun. Netw., 2018, 2018. 23. Nguyen, D.L., Cao, K., Jain, A.K., Automatic latent fingerprint segmentation. 2018 IEEE 9th Int. Conf. Biometrics Theory, Appl. Syst. BTAS 2018, pp. 1–9, 2018. 24. Yoon, S., Feng, J., Jain, A.K., On latent fingerprint enhancement. Biometric Technol. Hum. Identif. VII, vol. 7667, p. 766707, 2010. 25. Yoon, S., Feng, J., Jain, A.K., Latent fingerprint enhancement via robust orientation field estimation. 2011 Int. Jt. Conf. Biometrics, IJCB 2011, vol. no. c, 2011. 26. Feng, J., Zhou, J., Jain, A.K., Orientation field estimation for latent fingerprint enhancement. IEEE Trans. Pattern Anal. Mach. Intell., 35, 4, 925–940, 2013. 27. Yang, X., Feng, J., Zhou, J., Localized dictionaries based orientation field estimation for latent fingerprints. IEEE Trans. Pattern Anal. Mach. Intell., 36, 5, 955–969, 2014.

Automated Fingerprint Identification System  123 28. Kumar, S. and Velusamy, R.L., Latent fingerprint preprocessing: Orientation field correction using region wise dictionary. 2015 Int. Conf. Adv. Comput. Commun. Informatics, ICACCI 2015, pp. 1238–1243, 2015. 29. Cao, K. and Jain, A.K., Latent orientation field estimation via convolutional neural network. Proc. 2015 Int. Conf. Biometrics, ICB 2015, pp. 349–356, 2015. 30. Xu, M., Feng, J., Lu, J., Zhou, J., Latent Fingerprint Enhancement Using Gabor and Minutia Dictionaries, pp. 3540–3544, 2017. 31. Li, J., Feng, J., Kuo, C.C.J., Deep convolutional neural network for latent fingerprint enhancement. Signal Process. Image Commun., 60, 52–63, 2018. 32. Jain, A.K., Feng, J., Nandakumar, K., Fingerprint matching. Computer, 43, 2, 36–44, 2010. 33. Teixeira, R.F.S. and Leite, N.J., Improving pore extraction in high resolution fingerprint images using spatial analysis. 2014 IEEE Int. Conf. Image Process. ICIP 2014, pp. 4962–4966, 2014. 34. Sankaran, A., Pandey, P., Vatsa, M., Singh, R., On latent fingerprint minutiae extraction using stacked denoising sparse autoencoders. IJCB 2014-2014 IEEE/IAPR Int. Jt. Conf. Biometrics, vol. no, 2014. 35. Segundo, M.P. and Lemes, R.D.P., Pore-based ridge reconstruction for fingerprint recognition. IEEE Comput. Soc. Conf. Comput. Vis. Pattern Recognit. Work, October 2015, pp. 128–133, 2015. 36. Genovese, A., Munoz, E., Piuri, V., Scotti, F., Sforza, G., Towards touchless pore fingerprint biometrics: A neural approach. 2016 IEEE Congr. Evol. Comput. CEC 2016, pp. 4265–4272, 2016. 37. Donida Labati, R., Genovese, A., Muñoz, E., Piuri, V., Scotti, F., A novel pore extraction method for heterogeneous fingerprint images using convolutional neural networks. Pattern Recognit. Lett., 113, 58–66, 2018. 38. Su, H.-R., Chen, K.-Y., Wong, W.J., Lai, S.-H., High-resolution fingerprint recognition. IEEE Int. Conf. Acoust. Speech, Signal Process. 2017, pp. 2057–2061, 2017, [Online]. Available: https://ieeexplore.ieee.org/document/7952518/ authors#authors. 39. Tang, Y., Gao, F., Feng, J., Liu, Y., FingerNet: An unified deep network for fingerprint minutiae extraction. IEEE Int. Jt. Conf. Biometrics, IJCB 2017, January 2018, pp. 108–116, 2018. 40. Tang, Y., Gao, F., Feng, J., Latent fingerprint minutia extraction using fully convolutional network. IEEE Int. Jt. Conf. Biometrics, IJCB 2017, pp. 117– 123, January 2018. 41. Nguyen, D.L., Cao, K., Jain, A.K., Robust minutiae extractor: Integrating deep networks and fingerprint domain knowledge. Proc.-2018 Int. Conf. Biometrics, ICB 2018, pp. 9–16, 2018. 42. Jain, A.K. and Feng, J., Latent fingerprint matching. IEEE Trans. Pattern Anal. Mach. Intell., 33, 1, 88–100, 2011. 43. Sankaran, A., Dhamecha, T., II, Vatsa, M., Singh, R., On Matching Latent to Latent Fingerprints, 2011.

124  Modern Forensic Tools and Devices 44. Sankaran, A., Vatsa, M., Singh, R., Hierarchical fusion for matching simultaneous latent fingerprint. 2012 IEEE 5th Int. Conf. Biometrics Theory, Appl. Syst. BTAS 2012, pp. 377–382, 2012. 45. Paulino, A.A., Feng, J., Jain, A.K., Latent fingerprint matching using ­descriptor-based. IEEE Trans. Inf. Forensics Secur., 8, 1, 31–45, 2013. 46. Zanganeh, O., Srinivasan, B., Bhattacharjee, N., Partial fingerprint matching through region-based similarity. 2014 Int. Conf. Digit. Image Comput. Tech. Appl. DICTA 2014, 2015. 47. Zheng, F. and Yang, C., Latent fingerprint match using minutia spherical coordinate code. Proc. 2015 Int. Conf. Biometrics, ICB 2015, pp. 357–362, 2015. 48. Cao, K. and Jain, A.K., Automated latent fingerprint recognition. IEEE Trans. Pattern Anal. Mach. Intell., 41, 4, 788–800, 2019. 49. Nguyen, D.-L. and Jain, A.K., End-to-End Pore Extraction and Matching in Latent Fingerprints: Going Beyond Minutiae, pp. 1–10, 2019, [Online]. Available: http://arxiv.org/abs/1905.11472. 50. Garris, M.D. and McCabe, R.M., Fingerprint Minutiae from Latent and Matching Tenprint Images, National Institute of Standards and Technology, Gaithersburg, MD, United States, 2000. 51. Sankaran, A. et al., Latent fingerprint from multiple surfaces: Database and quality analysis. 2015 IEEE 7th Int. Conf. Biometrics Theory, Appl. Syst. BTAS 2015, pp. 1–6, 2015.

7 Forensic Sampling and Sample Preparation Disha Bhatnagar1, Piyush K. Rao2* and Deepak Rawtani3 School of Forensic Sciences, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 3 School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India 1

Abstract

The chapter puts forward a basic idea related to the science of forensics, which focuses moreover on sampling and the varieties of sample preparation methods including conventional and novel techniques that are used to analyze forensics. The analytical instruments are considered as a vital part of forensic analysis. The sample preparation scrutinizes as the most critical step in forensic analysis. Any error in the extraction of analyte can cause a difference in results. Varieties of extraction methods are available for different samples as samples in forensics usually contain complicated matrices. The intent behind the methods used for extraction is to separate our analyte of interest from the interferents present in the matrix. With the concept of developing more accurate, sensitive, and robust techniques, different techniques such as SPME, LLME, SFC, SBSE, Microwave digestion, Headspace extraction etc. are rapidly gaining acceptance in the wide field of forensic science. Keywords:  Forensic science, sample preparation, extraction, analytical instruments, matrices

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (125–148) © 2023 Scrivener Publishing LLC

125

126  Modern Forensic Tools and Devices

7.1 Introduction Forensic science is the study of expansive use of sciences, to carry out an effective investigation of an unlawful act, to apprehend the accused. This branch uses the concepts of basic sciences to put forth a conclusion and clears any ambiguity. The systematic investigation starts right from the protection and preservation of the crime scene to documentation, collection, and preservation of the evidence found so that proper analysis can be done, which helps us to solve the case [1]. Depending upon the types of crime committed, different types of evidences can be procured from the location of the crime. The types of crime include Homicide, Rape, Burglary, Assault, Forgery, etc. a proper investigation can help an investigator to establish a relation between the victim, crime scene, and culprit. The application of forensic science facilitates us to identify; • • • • •

Who the culprit was (among the suspects). Where the crime occurred (location of the scene). What type of crime it was (homicidal, suicidal, or accidental). When the crime is committed (time of crime). How the crime occurred (by reconstruction of the event occurred). • Lastly, Why the crime occurred (motive behind the crime) [2, 3].

7.2 Advancement in Technologies Used in Forensic Science There have been many new and exciting developments that arise in the area of forensic science. The technologies of DNA fingerprinting and analytical techniques have overpowered other areas of forensics. Modern technologies will enhance the reliability and efficiency of forensic investigations [4]. New technologies focus on improving the sensitivity, thereby strengthening their applications towards forensic investigations. The technologies act as a catalyst in the scientific findings, which makes the availability of forensic information rapidly, which assists in solving crimes and making the judicial system more efficient [5]. Criteria for a suitable technology for identification any forensic technology must fulfill the following criteria:

Forensic Sampling and Sample Preparation  127 • • • •

Pertinent towards the topic of forensic investigation. Modernity in the technologies. It must be reliable. Greater sensitivity.

This chapter is structured to provide the information and description regarding the evidences, sampling, and the various kinds of extraction procedures involved in forensic analysis. Varieties of extraction procedures are used for different analytical instruments. Here we will focus upon the extraction techniques used for modern technologies evolved in forensic science and are widely used, such as Gas ChromatographyMass Spectrometry, Liquid Chromatography-Mass Spectrometry-Mass Spectrometry, Inductively Coupled Plasma–Mass Spectrometry, Atomic Absorption Spectroscopy, and many more.

7.3 Evidences Evidences can be defined as anything which can be submitted in court for confirming and refuting any question of fact. Evidences are said to play a vital role in solving a criminal case. It links victim, suspect, and area and place of crime and helps in establishing a relationship between them [1]. It can either make or break a case. The proper analysis of evidences can help police, prosecutor, and judge to solve a case and can prevent the wastage of valuable time of the court.

7.3.1 Classification of Evidences 7.3.1.1 Direct Evidence Direct evidences are those which directly prove the alleged fact, which includes the unmediated observations including Eye witness. The direct evidence includes the testimony of bystanders in the court, which may help in proving the guilt of the accused.

7.3.1.2 Circumstantial Evidence These are also referred to as indirect evidences. Evidences that do not directly prove any fact but is used to implicit a fact. These are the evidences that are being left either accidentally or sometimes on purpose at the crime

128  Modern Forensic Tools and Devices .

scene. These include the physical, chemical, biological, or trace evidences which were transferred from the victim and suspect [3]. The first-ever person to notice this scenario of exchange of materials was Sir Edmond Locard. He gave the “Principle of Exchange” which is the foundation of forensic investigation. This principle claims that an exchange of trace material occurs when there is contact between two objects or persons [2]. Thus every piece of evidence found on the location of crime has great significance and can help us to solve a case. The circumstantial evidences are further classified as follows: • Physical Evidences – These are evidences which are of non-living origin and can be acquired from the victim’s body or scene of crime or from the suspect’s, which helps us to link between them. The physical evidences are sub-­classified into trace evidence, impression evidence, digital evidence, ballistics, and document evidences. The examples are mentioned in the Figure 7.1 [6]. • Chemical Evidences – Chemical evidences are evidences which are of chemical origin. These are further classified as Pharmacological/Toxicological evidences, Narcotics, Arson and Explosives, and Petroleum products [7]. • Biological Evidences – Biological Evidences can be defined as the evidences which are of biological origin. The biological evidences include body fluids and non-body fluids as evidence. The utmost reason behind assembling the evidences of biological origin is that the DNA is a primary substance in almost every biological material, which confirms the identity of an individual, and his/her presence at the location of the crime scene [6]. The examples of biological evidences are mentioned in the Figure 7.1. The complete forensic analysis consists of: 1. 2. 3. 4. 5.

Searching for physical evidences. Photography of physical evidences. Collection, preservation, packaging of physical evidences. Documentation. Dispatching the evidences for analysis.

Forensic Sampling and Sample Preparation  129 EVIDENCES

CHEMICAL

PHYSICAL

BODY FLUIDS Blood, Saliva, Semen, Urine, Sweat, Vaginal secretions, Human milk etc.

PHARMA/ TOXICOLOGICAL

NDPS

Drugs/ Medicine Cosmetics Pesticides Poisin bottle

Narcotic Drugs Psychoactive substances

TRACE Fibre Soil Paint Glass

IMPRESSION Fingerprint Footprint Lip print Tyre marks Tool marks

BALLISTIC Firearm Cartridge case Bullets GSR

BIOLOGICAL

NON-BODY FLUIDS Teeth Nails Tissue Hairs Bones

ARSON AND EXPLOSIVES Fire Debris Explosive substances Detonating cord

DIGITAL Computers Mobile phone Flash drive CPU DVDs

BOTANICAL

MICROBIAL

Dry Leaves Seeds Pollens

PETROLEUM PRODUCTS Petrol Diesel Kerosine Bio fuel

DOCUMENT Charred Documents Counterfeit Currency Passports Forged Documents

Figure 7.1  Classification of evidences.

6. Analysis of evidences which includes sample extraction, analysis, interpretation of results. 7. Recreating the events. 8. Presenting the conclusion in the court [8].

7.4 Collection of Evidences The evidence collection must be done under the supervision and in a proper systematic manner. The following points should be kept in mind while collecting evidences: • • • • •

Collect the evidences as early as possible. Avoid any contamination. Gloves should be worn while collecting evidences. Photography of every piece of evidence must be done. Proper handling of evidences must be done.

130  Modern Forensic Tools and Devices • Evidences must be labeled accurately with case no., evidence no., location, collector’s name, and type of evidence. • Maintaining the chain of custody.

7.4.1 Sampling Methods There are different collection and preservation methods used for the collection of different types of evidence found at the scene. Table 7.1 has mentioned few important evidences and their sampling methods.

Table 7.1  Different sampling methods for different evidences [7, 9]. Serial no.

Type of evidence

Sampling method

1.

Blood and bloodstains; a. Liquid blood b. Blood clot c. Wet bloodstain d. Dried bloodstain

a. Collected by sterile disposable syringe and transfer it to a clean test tube. b. With sterile spatula. c. Transfer it to a cotton cloth, air dry it, and then packed. d. Scrape off and then collected in a cotton cloth or a paper bag.

2.

Semen and seminal stains a. Liquid semen

a. Collected by sterile syringe and transfer it to test tube or transfer the sample to a cotton cloth, air dry it, and then packed. b. Should be collected as such, if present on a large object, then cut a piece containing stains and then packed in a paper bag. c. Scrape off and collected in a paper bag.

b. Stain on movable object c. Stain on an immovable object 3.

Urine, Saliva, and other bodily fluids

Same as the blood and seminal stains.

4.

Hairs

Using tweezers or forceps, and collected in a plastic or paper bag. (Continued)

Forensic Sampling and Sample Preparation  131 Table 7.1  Different sampling methods for different evidences [7, 9]. (Continued) Serial no.

Type of evidence

Sampling method

5.

Fibers

Using tweezers or tape lifting in a plastic bag.

6.

Glass Evidence

Using tweezers or tape for the collection of broken glass fragments.

7.

Paint

Scrape off or using tweezers to collect chips.

8.

Soil samples

Collected using spatula on a filter paper. If soil is stuck on the shoe, then the complete shoe is sent.

9.

Footprints, shoe prints

Collection is done by Photography, Tracing, Lifting and Casting.

10.

Tool marks

Photography and Casting is done for the collection

11.

Firearms

Collect after removing the magazine, or covering the muzzle end with a piece of cloth or cotton. Collect it by covering it in a cellophane sheath or a clean cotton cloth and put it in a wooden box.

12.

GSR

Swabbing, Adhesive tape, and sometimes by casting.

13.

Documents; Torn documents

Photography, collect all pieces with help of forceps and placed them in a cardboard or plastic bag. Collected using tweezers or spatula in a glass sheet and put it into a separate cardboard box.

Charred Documents

14.

Fire Debris

Collected in metal cans or glass bottles or jars for the identification of accelerants.

15.

Fingerprint

Tape lifting and photography

132  Modern Forensic Tools and Devices Table 7.2  Types of evidences and instrumental methods [8]. Instruments used for analysis

Serial number

Types of evidence

1.

Blood, Bodily fluids, Tissues

Spectrophotometry, Electrophoresis, Enzyme assays.

2.

Drugs, Toxic substances

UV, IR, HPLC, GC-MS, LC-MS etc.

3.

Paint, Pigments

IR, AAS, SEM, Microscopy

4.

Explosives residue

IR, HPLC etc.

5.

Gunshot residue

NAA, AAS, SEM-XRD

6.

Accelerants, Solvents

GC

7.

Hairs

Microscopy, Electrophoresis etc.

8.

Fibers

Microscopy, UV, IR, Microspectrophotometry.

UV: Ultraviolet, IR: Infrared, HPLC: HighPerformance Liquid Chromatography, LC-MS: Liquid chromatographyMass spectrometry, AAS: Atomic Absorption Spectroscopy, SEM-XRD: Scanning electron microscope–X-ray Diffractometry, NAA: Neutron Activation Analysis, GC: Gas Chromatography

Forensic Sampling and Sample Preparation  133 In this chapter, we will be focusing on extraction procedures practiced for analysis from analytical instruments. Table 7.2 shows different types of evidences and the analytical instruments that are used for their analysis. Analytical instrumentation laboratory plays an important role in the area of forensic science. The analytical instruments are used to a wide extent for toxicological and chemical purposes. Apart from this, elemental identification in samples such as GSR can be done. The main aim of every analysis is the identification and individualization of the sample. Any analytical procedure which is applied in forensic analysis must be accurate, sensitive, quick, reliable, simple, and readily available [8]. The samples procured in forensic are of very low quantity, so the modern technologies use a minute quantity of sample for identification of analyte. The sample usually contains complex matrices, which if not removed can cause deviations in results. So for removing the interferents from the sample and obtaining the analyte of interest, there are few sample preparation or extraction techniques are available, which are used and is the most important and inevitable step of sample analysis. Here we are going to discuss the different types of sample preparation techniques [10–12].

7.5 Sample Preparation Techniques for Analytical Instruments Forensic samples usually contain a large number of interfering components along with the analyte of interest. The analyte often present in very minute quantity, in nanogram or picogram level. The analysis cannot be done in presence of complex matrices, so the extraction is the most crucial step of analysis. For any sample preparation technique, there are two goals, to remove the maximum interferants and high recovery of our analyte [8]. Extraction or sample preparation, as the very first measure of analysis using analytical instruments, and any error in this method can affect our results. An ideal extraction procedure consists the least number of steps and is applicable for varieties of samples [13]. Table 7.3 shows varieties of extraction techniques depends upon the sample matrices, whether the analyte of interest is present in a solid, liquid, or gaseous sample.

134  Modern Forensic Tools and Devices Table 7.3  Sample matrices and different extraction methods used. Serial number

Sample matrices

Extraction method

1.

Analyte in Solid sample

Solvent extraction, ASE, Microwave extraction, SFE

2.

Analyte in insoluble solid matrices

Pyrolysis

3.

Analyte in solution

SPE, SPME, Stir bar sorptive extraction

4.

Analyte in the liquid phase

Membrane extraction, Purge and trap

ASE: Accelerated solvent extraction, SFE: Supercritical fluid extraction, SPE: Solid Phase extraction, SPME: Solid-phase microextraction.

7.5.1 Conventional Methods of Sample Preparation Before directly moving forward to the modern extraction techniques, we will first discuss a few important conventional methods of extraction. The following are some extraction methods [10, 12, 14].

7.5.2 Solvent Extraction Liquid-liquid extraction is another name of solvent extraction. This is the very first method of analyte separation from the matrix. In this method, an arrangement of two immiscible solvents is placed for the material separation. The active component should be unevenly distributed in the solvents. The solvents usually contain an organic phase and an aqueous phase [15]. The efficiency can be measured through the distribution coefficient (D).

Forensic Sampling and Sample Preparation  135



D Total wt. (gm) in aqueous phase Total wt. (gm) in organic phase

The value of D is directly proportional to the efficiency of the extraction. The system is first shaken well and then allowed to settle. This allows the solute to pass on from one phase to another and thus efficiently separating it from interferents [16]. Advantages – Simple, No complex instruments are required, High selectivity and Flexible. Disadvantages – Emulsion formation, less recovery, Not efficient, Time consuming.

7.5.2.1 Distillation The basic idea of the distillation procedure is to first heat the sample and converting it into vaporous form and giving allowance to flow in a condenser where it gets cooled and converts back to a liquid state. This procedure is further modified into various types, such as fractional distillation, sweep co-distillation, steam distillation, and distillation under pressure. The distillation methods are enforced for the extraction of petroleum products, alcohol etc. [17]. Advantages – Simple setup, consumes less energy, cheap. Disadvantages – Time-consuming, poor separation, undesirable chemical reactions can occur.

7.5.2.2 Acid Digestion This procedure of acid digestion depends on the fact that some toxicants present in biological matrices can be extracted with acid/alkali. The sample is allowed to digest in a muffle furnace or water bath for about 1 h in the presence of acid/alkali. This method was earlier used to extract inorganic metals [18]. This method is further upgraded as microwave digestion which is extensively used now. Advantages – Simple, cheap, no complicated systems. Disadvantages – Loss of volatile elements, risk of contamination, more acid consumption.

136  Modern Forensic Tools and Devices

7.5.2.3 Solid Phase Extraction SPE is an extensively used sample preparation technique that replaces solvent extraction. It has proved as a very efficient technique with considerable good recovery of analyte. The method is based on the use of a small SPE cartridge, packed with a small amount of sorbent. SPE cartridges are typically, 10–20 mm length x 1–4.6 mm ID. C18- or C8-bonded silica or a styrene-divinylbenzene (SDB) copolymer are the commonly used adsorbent packed in the cartridge [19]. A solvent containing liquid or solid sample is poured in an SPE cartridge under vacuum or pressure. The analyte of interest is then retained from the adsorbent material using another solvent. This solvent is collected for further analysis. An SPE cartridge is composed of three basic components (Figure 7.2): • Cartridge – It is the tube body, usually a syringe-like. It is small and is made of medical-grade polypropylene. • Frits – These are used to hold the sorbent in the barrel or tube body. • Sorbent – The sorbent used can be both silica-based and non-silica-based. SPE can be categorized on the basis of their phases Normal Phase – All phases used here are polar and are used to extract the polar analyte. For normal phase sorbents, solvent strength gets an increment simultaneously when it becomes more polar. Reverse Phase – All the phases used are non-polar are used to extract the non-polar analyte. For reverse-phase sorbent, the solvent strength gets an increment simultaneously when it becomes more non-polar.

Sample Reservoir

Sorbent bed

Fritted discs

Luer tip

Figure 7.2  SPE cartridge [20].

Forensic Sampling and Sample Preparation  137 Ion Exchange – The analyte and the sorbent have ionic interactions. The cationic phase retains the positively charged compounds and the anionic phase retains the negatively charged compounds [21]. Steps Involved in SPE • • • •

Conditioning of the adsorbents by solvent Sample application (Adsorption) Washing (optional) Elution with the help of solvent [22].

Advantages – Cleaner extraction, easy to use, higher recoveries. Disadvantages – Incomplete removal of interferents, high variability in results.

7.5.2.4 Soxhlet Extraction The usage of this method is when the analyte has little dissolving ability in the solvent and impurities are insoluble in the solvent (Figure 7.3). In this

Condenser

Extraction chamber Thimble Siphon arm Vapor

Extraction solvent Boiling flask

Figure 7.3  Soxhlet apparatus [23].

138  Modern Forensic Tools and Devices method, a thimble which is made of thick filter paper is used to hold the sample which is dried and finely divided. The thimble is then put into an extractor chamber which is positioned in such a way that a flask containing solvent lies below it and the condenser lies above it. The solvent evaporates by continuous heating of the flask and then it moves towards the condenser, where it liquifies. The extractor chamber is made in such a way, that the solvent when overflows, it falls back into the flask. In this way, the extraction is carried out [24]. Advantages – Simplicity and efficiency. Disadvantages – Time-consuming, risk of contamination, polar lipids are not extracted well.

7.5.3 Modern Methods of Sample Preparation 7.5.3.1 Accelerated Solvent Extraction ASE is the upgraded method of solvent extraction. It is the least quality solvent usage extraction method which is mechanized to perform the most automatically. The extraction is procured at the highest temperature and pressure, which helps in efficient and fast extraction [25]. The solvents with the least boiling level can also be used at increased temperatures with increasing pressure. This fastens the operation of extraction. The entire process is automated and gives efficient results in very little time with less quantity of solvent [26]. Advantages – Quick, Easy to use, reduce usage of solvent. Disadvantages – Low selectivity, High cost, complicated washing process.

7.5.3.2 Microwave Digestion In this method, the microwaves are used to heat the sample in line with the organic solvents in a microwave-assisted system. The use of microwaves increases the rate of extraction. This method works at high pressure, thereby giving allowance to separate the analyte. Considering the nature of the analyte and the sample, different ranges of temperature and pressure can be used. The extract is further used for elemental analysis through ICP-MS or AAS [27]. Advantages – Simple, Efficient, less time consuming, less solvent required. Disadvantages – Risk of cracking of vessel due to high pressure.

Forensic Sampling and Sample Preparation  139

7.5.3.3 Ultrasonication-Assisted Extraction This extraction technique consists of the usage of ultrasonic energy, having a frequency higher than 20 kHz. This method is used mainly for the extraction of compounds from plants, and in food industries. When the waves of this frequency travels, it causes the phenomenon of caviation, which leads to the disruption of the cell wall and release of cell content [19]. Advantages – Low cost, small amount of energy is used, Disadvantages – Repetition of procedure may require, need for filtration.

7.5.3.4 Microextraction Microextraction is the operation of disjunction that is extensively used when a minute amount of analyte is available in a huge volume of matrix. Microextraction techniques are of basically two types 1. SPME (Solid Phase Microextraction). 2. LPME (Liquid Phase Microextraction)

7.5.3.4.1 Solid Phase Microextraction

SPME is based on the principle of liquid-solid adsorption equilibrium [21]. In this method, the extract is obtained with the help of a syringe-like device, commonly called SPME fiber, which is coated by a stationary phase (Figure 7.4). SPME fibers may contain different types of stationary phases such as polydimethylsiloxane (PDMS), polyacrylate (PA), c­arboxen/ polydimethyl­ siloxane (CAR/PDMS), carbowax/ template resin (CW/ TPR), and many more [28]. There are two types of SPME methods



Direct SPME – In this method, the fiber is immersed into the solution containing the analyte, and the analyte is adsorbed on the surface of the stationary phase. There is even an additional coating that is visible at the top of fiber to put a stop to the absorption of fats or other lipids. Headspace SPME – In headspace, the placing of fiber is in the headspace on the matrix. The analyte in the vapor state dissolves at the end of the syringe [29].

The fiber is then introduced into the GC, for further analysis [30].

140  Modern Forensic Tools and Devices Plunger Barrel

Hub- viewing window Needle guide Coated fused silica fiber

Z-Slot O-Ring Adjustable depth guage Septum piercing needle

Figure 7.4  SPME syringe [31].

Advantages – Simple, time-saving, high throughput, eliminate environmental hazards. Disadvantages – Lack of robustness, low reproducibility.

7.5.3.4.2 Liquid Phase Microextraction

LPME are the techniques which consists the usage of less amount of samples as well as extraction solvents in microliter to extract an analyte the LPME are further classified into 3 important techniques which includes • Single Drop Microextraction (SDME) • Hollow Fiber Liquid-phase microextraction (HF-LPME) • Dispersive Liquid-Liquid Microextraction (DLLME) Single Drop Microextraction SDME is an extensively used technique of LLME. SDME technique is used in two ways; Direct immersion SDME and Headspace SDME ■■ Direct Immersion SDME – The usual usage of this method is for the analyte extraction from the liquid sample. Based on the nature of the analyte the method is further categorized into two-phase and three-phase DI-SDME [32]. In two-phase SDME, an aqueous solution is a donor phase and an organic phase known as the acceptor phase is used.

Forensic Sampling and Sample Preparation  141 It is very similar to LLE but the sample and solvent volume used in SDME is very less. Three-phase SDME is known as LLME. Three phases used in this method are an analyte solution (donor phase), an organic phase, and an aqueous phase (Acceptor phase). The equilibrium first occurs between the donor phase and the organic phase which is called extraction. The second equilibrium sets between the organic phase and the aqueous phase which is called back extraction. These steps of extraction and back extraction results in analyte enrichment [33]. ■■ Headspace SDME – It is a widely used technique as it has relatively more advantages of getting an extract free from interferents, as no direct contact between the sample and the matrix occurs. In HS-SDME, the solvent drop hangs at the end of the syringe in the headspace above the matrix. This is a suitable method for the volatile and semi-volatile compounds [33]. Hollow Fiber Liquid Phase Microextraction To increase the steadiness in the drop technique used in SDME, hollow fiber composed of highly porous polymer came into existence. HF-LPME can be used in both ways i.e. Direct immersion HF-LPME and Headspace HF-LPME. Both two phase and three phase microextraction techniques can also be used in HF-LPME. The sample undergoes the lumen of the hollow fiber. The mass transfer procedure in this technique becomes easier due to the presence of a porous surface in the fiber, which helps in summoning up the extraction process and avoid the extraction of interferents with the analyte of interest [28]. Dispersive Liquid-Liquid Microextraction In DLLME, separation is sufficed using an extraction solvent which is brought up as fine droplets along with the dispersive solvent into the sample solution. The analyte was quickly transferred into the fine droplets due to the larger contact area between the sample solution and solvent. The mixture is then separated using a centrifugation process. The extract is then further used for analysis [28].

7.5.3.4.3 Stir-Bar Sorptive Extraction (SBSE)

This method is derived from SPME. SBSE provides a much larger extraction phase than SDME, which results in a high recovery of analyte [13]. Stir Bars are composed of three essential parts;

142  Modern Forensic Tools and Devices a. A magnetic stir rod which is 10-30 mm in length. b. A glass jacket that is used for covering the stirring rod, when not in use. c. Extraction phase, made of polydimethylsiloxane (PDMS) of 24-47 µl, which provides a larger surface area for extraction [19]. The procedure of SBSE includes the following steps: 1. The stir bar is dipped in the liquid sample and is rotated at 1000-1500 rpm speed for almost 1 hr. 2. After equilibrium is created, the stir bar is separated and washed with distilled water to remove the proteins or sugars. Rinsing does not cause the removal of analyte because of the coating of PDMS. 3. The extraction is followed by placing the stir bar in the thermal desorption system for further chromatographic analysis [34]. Advantages – Simple, Inexpensive, less time-consuming. Disadvantages – Low selectivity.

7.5.3.4.4 Microextraction by Packed Sorbent (MEPS)

MEPS is a compact version of SPE. The advantage of MEPS over SPE is that we can use a little volume of samples up to 10µl. The extraction occurs with the help of the cartridge which contains packed sorbent. The analyte adsorbs on this sorbent. The procedure for MEPS is similar to that of SPE that includes the steps of conditioning, application, washing, and elution. It can be combined with GC or LC and the extraction and injection performs in a single syringe [28].

7.5.3.5 Supercritical Fluid Extraction The supercritical state is the state between a gaseous phase and a liquid phase. This method results in efficient extraction because of the good extraction properties of supercritical fluid. Carbon- dioxide is frequently used supercritical fluid, having critical pressure 31°C and pressure 73.8 bar, and is utilized in almost all SFE. The SFE system comprises a source of highly pure CO2, a pump, an oven, a pressure outlet, and a collection vessel [19].

Forensic Sampling and Sample Preparation  143 A cartridge composed of stainless steel is used for placing the sample. The sample is placed in the concentrate form. It is then put into the oven, and then the supercritical CO2 gas is supplied. The extract is then moved to the condenser, where the CO2 returns to its gaseous state. To vaporize the components, the trap is heated and the collection vessel is used to collect the extract [26]. Advantages – Greater Efficiency, high selectivity. Disadvantages – Expensive, Complicated instrumentation.

7.5.3.6 QuEChERS Also referred to as Dispersive SPE. QuEChERS is the abbreviation of quick, easy, cheap, effective, rugged, and safe. This method is becoming very popular in the area of bioanalysis and pharmaceutical analysis. In this method, the analyte is extracted with an organic solvent. Acetonitrile is routinely used for this purpose; salts such as magnesium sulfate and sodium chloride are also added. It is a very quick and efficient extraction technique [35]. Advantages – High recovery rate, fast, easy to use, no complicated system involves, no chlorinated solvents used. Disadvantages – Acetonitrile is comparatively expensive.

7.5.3.7 Membrane Extraction The process of separation through the pores existing in the membrane. Various types of membranes can be utilized in this method which includes Emulsion liquid membrane (ELM), Bulk liquid membrane (BLM), and Supported liquid membrane (SLM) [19]. SLM membrane is usually used in membrane extraction. It is formed when a very fine layer of the organic phase, fixed on a microporous support and is lodged amidst the aqueous layers. The components of this method include: Support – The solid support used is polymers like PTFE, polypropylene, polysulphones etc. Extractor – Organic solvent is utilized as an extraction solvent that has been selected according to the compound. Diluents – Change in concentration of organic solvents is done using the diluents, which are cheap and are readily available like xylene, hexane, and many more [36].

144  Modern Forensic Tools and Devices The operation of SLM starts with the placement shifting of metal ions within the matrix to the inner sheath of the membrane, simultaneously hydrogen ions move from the inner sheath of the membrane to the matrix. Here metal ion assumes to be divalent. Then diffusion of complex from the inner sheath to the outer sheath of the membrane occurs. Here the metal ion is liberated. The metal ion then moves from the outer sheath to the strip phase. Thus the extraction of metal ions is done [36]. Advantages – low solvent loss, no flooding or loading limitation, high efficiency. Disadvantages – instability of SLM, low research.

7.6 Conclusion The analytical techniques have considerable significance in scientific investigation. In this section, we concentrated on the basics of forensics and various kinds of sampling and sample preparation methods engaged with scientific investigation. An extraction procedure is viewed as an inevitable segment and the most crucial stage of analysis. Even working with the most sophisticated instruments like mass spectrometer, sample preparation is the most basic and necessary part of examination. The novel ways of extraction uses a low quantity of sample, are highly efficient, sensitive, and extremely quick in comparison to the conventional methods. Forensic scientists now have the choice to pick the technique that supports the sample matrix and analyte. Because of the growing need for forensic analysis, further advancement in the extraction procedures is necessary. There is a need of fully automated extraction procedure, which results in reduction of manual errors and will help us to get an analyte enriched sample. However, improvement in technologies is quite evident from the previous decade. The researchers are constantly discovering new techniques that may provide us relatively efficient and precise results by overcoming the present problems.

7.7 Future Perspective The scientists of forensic science laboratories must count on the modern technologies that are recently developed, to create a better system that works more efficiently and faster. Although, gradual advancement in analytical procedures is fairly evident. The analytical instruments are the key

Forensic Sampling and Sample Preparation  145 component of any forensic examination. The advanced technologies, that are employed for forensic investigations are of the greatest significance. To meet the growing demands in this field, further development and optimization of new methods is necessary. Focusing more on the extraction techniques, a universal extraction method is required which is still not developed. The development of these technologies will further strengthen this area and ultimately strengthening our judicial system.

References 1. Saferstein, R., Forensic Science, London, UK, 2010. 2. Bertino, A. J., Forensic Science: Fundamentals and Investigations, Mason, OH, USA, 2009. 3. Fischer, B.A.J. and Tilstone, W.J., Criminalistics the Foundation of Forensic Science, Cambridge, MA, USA, 2009. 4. Dror, I.E. and Morgan, R.M., A futuristic vision of forensic science. J. Forensic Sci., 65, 8–10, 2020. https://doi.org/10.1111/1556-4029.14240. 5. Chariot, P. and Durigon, M., The impact of forensic science journals. Forensic Sci. Int., 66, 213–215, 1994. https://doi.org/10.1016/0379-0738(94)90346-8. 6. Rao, P.K., Pandey, G., Tharmavaram, M., Biological evidence and their handling, in: Technology in Forensic Science, pp. 55–78, 2020a. https://doi. org/10.1002/9783527827688.ch4. 7. Rao, P.K., Pandey, G., Tharmavaram, M., Chemical evidences and their handling, in: Technology in Forensic Science, pp. 79–99, 2020b. https://doi. org/10.1002/9783527827688.ch5. 8. Samal, N. and Padhee, S., Role of analytical instruments in forensic science: A pedagogical approach. IETE J. Educ., 60, 74–81, 2019. https://doi.org/10. 1080/09747338.2019.1670101. 9. Cătălin, M., Andrei, A., Mitraşca, O., Modern methods of collection and preservation of biological evidence for human identification by DNA analysis. Biochemisty, 2004. 10. Rawtani, D., Tharmavaram, M., Pandey, G., Hussain, C.M., Functionalized nanomaterial for forensic sample analysis. TrAC-Trends Anal. Chem., 120, 115661, 2019. https://doi.org/10.1016/j.trac.2019.115661. 11. Rao, P.K., Tharmavaram, M., Pandey, G., Conventional technologies in forensic science, in: Technology in Forensic Science, pp. 17–34, 2020c. https:// doi.org/10.1002/9783527827688.ch2. 12. Hussain, C.M., Rawtani, D., Pandey, G., Tharmavaram, M., Handbook of Analytical Techniques for Forensic Samples, Amsterdam, Netherlands, 2021. https://doi.org/10.1016/c2019-0-04330-0.

146  Modern Forensic Tools and Devices 13. Samanidou, V., Kovatsi, L., Fragou, D., Rentifis, K., Novel strategies for sample preparation in forensic toxicology. Bioanalysis, 3, 17, 2019–2046, 2011. https://doi.org/10.4155/bio.11.168. 14. Rao, P.K., Tharmavaram, M., Pandey, G., Conventional technologies in forensic science, in: Technology in Forensic Science, pp. 17–34, Wiley, Weinheim, Germany, 2020d. https://doi.org/10.1002/9783527827688.ch2. 15. Seppälä, P., Dahal, R., Moriam, K., Downstream Process: Liquid-Liquid Extraction, vol. 1, p. 11, Degree Programme in Chemical Technology, Espoo, Finland, 2016. 16. Settle, F. A., Handbook of Instrumental Techniques for Analytical Chemistry. National Science Foundation, Arlington, 1997. 17. Kulkarni, S.J., Distillation-researh, studies and reviews on modeling, simulation and combined mode separations. Int. J. Res. Rev., 4, 44–47, 2017. 18. Hu, Z. and Qi, L., Sample digestion methods, in: Treatise on Geochemistry, Second Ed., 15, 87–109, 2013. https://doi.org/10.1016/ B978-0-08-095975-7.01406-6. 19. De Koning, S., Janssen, H.G., Brinkman, U.A.T., Modern methods of sample preparation for GC analysis. Chromatographia, 69, Suppl. 1, 33, 2009. https:// doi.org/10.1365/s10337-008-0937-3. 20. Mavumengwana-Khanyile, B., Katima, Z., Songa, E.A., Okonkwo, J.O., Recent advances in sorbents applications and techniques used for s­ olid-phase extraction of atrazine and its metabolites deisopropylatrazine and deethylatrazine: A review. Int. J. Environ. Anal. Chem., 99, 1017–1068, 2019. https:// doi.org/10.1080/03067319.2019.1597866. 21. Peng, J., Tang, F., Zhou, R., Xie, X., Li, S., Xie, F., Yu, P., Mu, L., New techniques of on-line biological sample processing and their application in the field of biopharmaceutical analysis. Acta Pharm. Sin. B, 6, 540–551, 2016. https://doi.org/10.1016/j.apsb.2016.05.016. 22. More, V.N. and Mundhe, D.G., Microextraction techniques in analysis of drugs. Int. J. Res. Pharm. Chem., 3, 329–344, 2013. 23. Shamsuddin, N.M., Yusup, S., Ibrahim, W.A., Bokhari, A., Chuah, L.F., Oil extraction from calophyllum inophyllum L. via soxhlet extraction: Optimization using response surface methodology (RSM). 2015 10th Asian Control Conf. Emerg. Control Tech. a Sustain. World, ASCC 2015, 2015. https://doi.org/10.1109/ASCC.2015.7244791. 24. Verran, J., Redfern, J., Burdass, D., Kinninmonth, M., Using soxhlet ethanol extraction to produce and test plant material (essential oils) for their antimicrobial properties. J. Microbiol. Biol. Educ., 15, 45–46, 2014. https://doi. org/10.1128/jmbe.v15i1.656. 25. Giergielewicz-Mozajska, H., Dabrowski, L., Namieśnik, J., Accelerated solvent extraction (ASE) in the analysis of environmental solid samples - Some aspects of theory and practice. Crit. Rev. Anal. Chem., 31, 149–165, 2001. https://doi.org/10.1080/20014091076712.

Forensic Sampling and Sample Preparation  147 26. Keglevich, G., Natural Product Extraction: Principles and Applications, Current Green Chemistry, London, UK, 2013. https://doi.org/10.2174/2213 34610101131218100515. 27. Madej, K., Microwave-assisted and cloud-point extraction in determination of drugs and other bioactive compounds. TrAC-Trends Anal. Chem., 28, 436–446, 2009. https://doi.org/10.1016/j.trac.2009.02.002. 28. He, Y. and Concheiro-Guisan, M., Microextraction sample preparation techniques in forensic analytical toxicology. Biomed. Chromatogr., 33, 1–12, 2019. https://doi.org/10.1002/bmc.4444. 29. Moein, M.M., Said, R., Bassyouni, F., Abdel-Rehim, M., Solid phase microextraction and related techniques for drugs in biological samples. J. Anal. Methods Chem., 2014, Article ID 921350, 24pp, 2014. https://doi. org/10.1155/2014/921350. 30. Moller, M., Aleksa, K., Walasek, P., Karaskov, T., Koren, G., Solid-phase microextraction for the detection of codeine, morphine and 6-monoacetylmorphine in human hair by gas chromatography-mass spectrometry. Forensic Sci. Int., 196, 64–69, 2010. https://doi.org/10.1016/j.forsciint.2009.12.046. 31. Schmidt, K. and Podmore, I., Current challenges in volatile organic compounds analysis as potential biomarkers of cancer. J. Biomark., 2015, 1–16, 2015. https://doi.org/10.1155/2015/981458. 32. Rutkowska, M., Dubalska, K., Konieczka, P., Namieśnik, J., Microextraction techniques used in the procedures for determining organomercury and organotin compounds in environmental samples. Molecules, 19, 7581–7609, 2014. https://doi.org/10.3390/molecules19067581. 33. He, Y., Liquid-based microextraction techniques for environmental analysis, in: Comprehensive Sampling and Sample Preparation, vol. 3, pp. 835–862, 2012. https://doi.org/10.1016/B978-0-12-381373-2.00116-2. 34. Telgheder, U., Bader, N., Alshelmani, N., Stir bar sorptive extraction as a sample preparation technique for chromatographic analysis: An overview. Asian J. Nanosci. Mater., 1, 56–62, 2018. 35. Vojislava, B., Vuković, G., Zeremski, T., Dušan, M., Gvozdenac, S., Popović, A., Petrović, A., Advantages and disadvantages of active carbon in QuEChERS sample preparation method. Sci. Bull. Ser. Biotechnol., XX, 6–9, 2016. 36. Parhi, P.K., Supported liquid membrane principle and its practices: A short review. J. Chem., 2013, Article ID 618236, 11pp, 2013. https://doi. org/10.1155/2013/618236.

8 Spectroscopic Analysis Techniques in Forensic Science Payal V. Bhatt and Deepak Rawtani* School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India

Abstract

In countless fields of research and characterization of compounds, spectroscopes have been proven extremely beneficial. Spectroscopes have proven to be a promising approach in criminological examination and crime evidence analysis. Each spectroscopy has its own characteristic working and applications. Spectroscopic methods and forensics are thus, claimed to be having an unbroken bond. There are various traditional approaches applied by experts in analysis that are destructive and outdated and can be replaced with the modern and non-destructive spectroscopic investigation. This chapter summarizes the classification, instrumentation, and working of the spectroscopes with diagram together with spectroscopy and its importance in criminology. Additionally, the application of each and every spectroscopy in evidence analysis is highlighted. The importance of using the non-­ destructive and precise spectroscopic techniques in crime investigation and its future development and implications are also considered and discussed. New evolutions in the sector of spectroscopic approaches can open on to fully automated and in situ investigation of crime. Keywords:  Spectroscopy, criminal examination, non destructive methods, analysis techniques, absorption, emission, photoluminisense, chemiluminisense, forensic science

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (149–198) © 2023 Scrivener Publishing LLC

149

150  Modern Forensic Tools and Devices

8.1 Introduction “The requisition of science and technology for the investigation of crime, identification of evidence, civil laws, and criminal procedure is defined as Forensic Science” [1, 2]. It’s also identified as criminalistics, as during investigation its use is mostly on the criminal side. It is a multifaceted area of sciences that covers different subdivisions from chemistry, physics to medicines and from engineering to psychology [3]. The judicial system and forensic science are interrelated intimately with one another. As such, holding the whole area of forensic science to a standard can be much hard, as it is an extremely diversified and immeasurable field. In the interest to ward off the bias analysis and investigator, analyst, or expert witness there must be particular features and rules that procedure must possess and ones that should be avoided. Forensic science is the key to extricate crime from frauds, and further substitute it to assault, rape, murder, and terrorism. Therefore, evolution and advancement in forensic science and its approaches are the answer to decrease the crime rate. Speaking of evolution and automation in forensic science and its methods, investigation in forensic science can be accomplished using several analytical approaches. Figure 8.1 describes the five different types of analytical techniques used in forensic science.

8.2 Spectroscopy The definition says “Spectroscopy is the study of the absorption and emission of light and other radiation by matter”. Also, these approaches are dependent on the wavelength of radiation [4]. Recently, the definition is broadened. Spectroscopy incorporates the learning of the interactions between particles like protons, electrons, and ions additionally as a

Analytical Techniques used In Forensics

Spectroscopic Analysis

Chromatographic Analysis

Thermogravimetric Analysis

Figure 8.1  Analytical techniques used in forensics.

X-Ray based Techniques

Microscopy Analysis

Spectroscopic Analysis Techniques  151 function of their collision energy and their interaction with other particles [5]. Spectroscopy is a pivotal tool in evolving scientific understanding when applied to high energy collision. A spectrometer is defined as “An instrument that measures the property of light over a specific portion of the electromagnetic spectrum” [6]. In 1859 the German chemist Robert wiheim Bunsen and German physicist Gustav Robert Kirchhoff invented first-ever spectroscope. The discovery made in 1859 revel basis for investigating spectroscopy that says: every pure substance has its own characteristic spectrum [7]. Spectrum can be split into separate region according to the wavelength of radiation, as shown in Figure 8.2. Normally production and examination of the spectrum requires the following: 1. A light source. 2. A disperser, for the distinction of light into its compound wavelength. 3. A detector, for sensing the presence of light after dispersion. Altogether apparatus makes spectrometer. In consonance to the region of the spectrum, phenomena explored by different types of spectroscopes

Wavelength in meters (m) 10-16 10-14

10-12

Gamma rays

10-10 X rays

10-8

10-6

UV

10-4

10-2

IR

1 102 104 106 Radio waves

Visible Light 400 (violet)

100

600

Wavelength in nanometers (nm)

Figure 8.2  Electromagnetic spectrum.

700 (Red)

108

152  Modern Forensic Tools and Devices

Spectroscopic Techniques Based on Energy Transfer

Absorption

X-Ray Absorption

UV/Vis Spectroscopy

Emission

Atomic Emission

Photoluminescence

X-Ray Fluorescence

Chemiluminescence

Chemiluminescence Spectroscopy

Fluoroscence Spectroscopy

Atomic Absorption

Phosphorescence Spectroscopy

Infrared

Atomic Fluorescence

Raman

Electron Spin Resonance

Nuclear Magnetic Resonance

Figure 8.3  Classification of spectroscopic techniques based on energy transfer.

are totally different. Figure 8.3 shows the spectroscopic techniques classification based on energy transfer and their sub-divisions [8]. Table 8.1 shows the spectroscopic techniques according to the spectral region [9, 10].

Spectroscopic Analysis Techniques  153 Table 8.1  Spectroscopic technique according to the spectral region. Type of energy transfer

Region of electromagnetic spectrum

Spectroscopic technique

Absorption

X-ray

X-ray absorption spectroscopy

Ultraviolet/Visible

UV/Vis spectroscopy Atomic absorption spectroscopy

Infrared

Infrared spectroscopy Raman spectroscopy

Radio wave

Electron spin resonance spectroscopy Nuclear magnetic resonance spectroscopy

Emission

Ultraviolet/Visible

Atomic emission spectroscopy

Photoluminescence

X-ray

X-ray fluorescence

Ultraviolet/Visible

Fluorescence spectroscopy Phosphorescence spectroscopy Atomic fluorescence spectroscopy

Chemiluminescence

Ultraviolet/Visible

Chemiluminescence spectroscopy

8.2.1 Spectroscopy and its Applications Spectroscopy is a technique adapted for the detection, analysis, and discovery of molecule, or structural composition of a specimen and/or quantification of the molecule [11]. Speaking of uses, these spectroscopies have been universally applied for different purposes in different areas of science and technology, because of its versatility, that is graphically mentioned in Figure 8.4.

154  Modern Forensic Tools and Devices

Astronomy Environmental Studies

Forensics

Medicine

Application of Spectroscopy

Biology

Pharmaceuticals

Chemistry Physics

Figure 8.4  Application of spectroscopy.

In astronomy, “the research of the spectral emission lines of distant galaxies and observation of Doppler shift of spectral lines constructed the finding that the universe is being distended rapidly and isotropically” [12]. Distinct spectroscopies are adapted for distinct astronomical application, especially for optical astronomy [13]. Talking about its usage in medicine, by making advancement in healthcare, spectroscopic methods are acknowledged for different photodynamic therapies, diagnostic applications, studying properties of matter, and to regulate molecular identity and structure [14]. In chemistry, for studying the structure of atoms and molecules, spectroscopy is an extensively used technique [15]. It provides many different analytical procedures for the detection of constituents in a material having an unknown chemical composition and, also promotes to explore the structural characteristic of atoms [16]. Abundant spectroscopic instruments are utilized in physics and physical chemistry for surface structure elucidation and numerous plasmonic effects in substance. Catalytic structure, microorganism study, distinguishing protein structure and appreciably more biological studies are executed using spectroscopes [17]. Acknowledging the presence of impurities in raw materials, quality checks, material identification that are manufactured in industries, and various material identifications is incorporated in the industrial application [18, 19]. An environmental examination needs accurate results and

Spectroscopic Analysis Techniques  155 hence, spectroscopic techniques have helped in ultra-modern research of several environmental issues essentially data on atmospheric composition, gases flux between earth surface and atmosphere, air quality, pollution control, and significantly more issues [20]. Purity is the predominant factor need to be demonstrated in pharmaceuticals. Spectroscopy is employed to uphold and recognize new molecules and compounds in the pharmaceuticals and to inspect the righteousness of molecule precisely [21, 22].

8.3 Spectroscopy and Forensics “Forensic sciences as defined earlier necessitate the study and analysis of the evidence for criminal investigation.” Assembling the elements of a crime and providing court crucial testimonies is what forensic experts do [23]. During the proceedings of investigation important evidence and particles are assembled from the place where the crime was committed. As to grasp information it is essential to inspect and pick out these collected materials and evidence [3]. The challenge that a forensic inspector face is, forensic evaluation and inspection must be done in a non-destructive way so that, it won’t harm the evidence [24, 25]. The requirements of evidence analysis in forensics are not satisfied by the old conventional techniques used. The present approaches are not absolute for completing the piece of work as they have many downsides such as: 1. Destructive techniques that damage evidence. 2. Very specialized skills required. 3. Materials and chemicals used can be dangerous or even explosive. 4. Bring out bias analysis and investigation as handled by humans. To overcome all the above-described disadvantages, investigation of evidence to be made automated and efficient can be an optimal solution. The spectroscopic techniques come into consideration here [26]. For successful evaluation of different types of compounds, spectroscopy has been demonstrated as a useful and non-destructive method. Discrete bodily fluids with other forensic particulate materials like fingerprint drugs or can be successfully analyzed utilizing different spectroscopes [27]. It

156  Modern Forensic Tools and Devices will permit the evaluation of evidence while still preserving it. There are in numerous spectroscopic methods, where instrument let the evaluation done then and there at the place of crime making it simple and without eliminating evidence from scene [28]. Also, the analyte does not need any pre-­ preparation neither it needs any harmful chemicals. Samples like bodily fluids have been identified easily by comparing them with the spectrometers spectral library [29]. There are many other benefits of utilizing spectroscopic methods in forensics that are listed below: 1. To confirm the presence innumerable types of foreign matter present at the scene of crime. 2. Differentiate between animal fluid and human fluid. 3. To estimate the presence of poisonous chemicals in toxicology cases. 4. To recognize and possibly find the origin of some of the rare compound found at the location of crime. Thus, many different spectroscopes help the scientists to put together segments of information, answer some critical questions and draw some conclusion about crime [30].

8.4 Spectroscopic Techniques and their Forensic Applications 8.4.1 X-Ray Absorption Spectroscopy As the title suggest x-ray absorption spectroscopy denoted as XAS is an experiment carried out at the synchrotron radiation facility, which comes up with intense and tuneable x-ray beams [31]. The instrumentation of x-ray absorption spectroscopy is explained in Figure 8.5. In XAS the significant parts of the instrument are; an x-ray source, a sample holder, an x-ray monochromator, and a detector. An ordinary x-ray source generates x-rays by bombarding high energy electrons onto a heavy metal target [32]. Modern source being synchrotron radiation is much efficient as it produces tuneable and intense x-rays. The motive of this source of the x-ray is to supply x-ray beam to the specimen so that, x-ray absorption experiments can be conducted. Monochromator used with the

Spectroscopic Analysis Techniques  157 Detectors X-ray source Slits

Monochromator

Sample Positioning Stage

Figure 8.5  Instrumentation of x-ray absorption spectroscopy.

system is helpful in selecting the x-ray energy incident on the substance [33]. In-between monochromator and sample stage there is a slit present, that can be used to define the x-ray beam profile and to stop the undesirable x-rays. Sample stage is the place where a sample is placed. Detector is ruling part of spectroscopy and is helping hand for the examination of electrons being excited from valance band to conduction band as the analyte absorbs x-ray photons [34]. XAS is an instrumental technique predominantly used for the resolution of local geometric structure and/or electronic structure of any matter [35]. Also, they help to examine the radial distribution of atoms and hence, are abundantly useful in several fields for many applications like chemistry, nanotechnology, environment, life science, and forensics [36].

8.4.1.1 Application of X-Ray Absorption Spectroscopy in Forensics Figure 8.6 describes the pictorial representation, where x-ray absorption spectroscopy is applied in forensics. Forensic science is a branch of science which exercises identification, comparison, and quantification. Thus, several problems may arise in the forensic analysis because of insufficient sample purity, sample size, and specimen changes mainly with biological samples. These difficulties linked with forensic analytes can lay out consequential analytical problems, moreover in investigation and identification of trace evidence and multi-­ component samples [37]. In countless such situations, XAS can be the utmost suitable investigation technique. It is an elementary technique and analyte composition also omits any complicated procedure. The outcomes provided are also straightforward and easy to interpret. It is very fast and non-destructive approach which permits re-analysis of the specimen [38].

158  Modern Forensic Tools and Devices

Trace evidence analysis

Illicit drug analysis

Application of X-Ray Absorption Spectroscopy in forensics

Soil analysis

Document analysis

Figure 8.6  Application of x-ray absorption spectroscopy in forensics.

The strange thing about this spectroscopy is that with all these advantages, it is not considerably popular in evidence analysis. Having all these positive factors, it is viable to utilize x-ray absorption spectroscopy in several trace analysis. In 1960, in a kidnapping case, this technique was used for soil exploration. In this kidnapping and murder case the victim’s shoes, clothes, and blanket in which body was wrapped were found from location of murder. They revealed innumerous particles which were identified with the help of microscopic techniques, but here, more genuine and precise results were needed by the investigation agents and thus, x-ray absorption spectroscopy (XAS) had been used to recognize granules and mineral composition to match it with the soil specimens from culprit’s place [39]. For the investigation and recognition of illicit drugs XAS is successfully used. XAS is beneficial as it can identify even little quantity of drug and adulterations. The most useful aspect of this instrument in illegal drugs is that it can recognize the excipients that are put-on to dilute medicines and provide it in bulk. Using XAS, quick reorganization and brilliant data can be gathered regarding doses and excipients of drugs. Many drug scandals and rackets have been stopped and youngsters have been saved from these fatal drugs [40].

Spectroscopic Analysis Techniques  159 In legal document examination, the old orthodox techniques were just to inspect and differentiate handwritings and typewriting. In ­present-day forensics, it has expended to incorporate the physical and chemical investigation of legal documents including paper, inks, watermarks, adhesives, and many different things associated with writing and printing of documents [41]. It is important that during testing the document should not be influenced and thus, XAS is considered. Examination of small specimens is done that is enough to find out details, vital about the pigment and chemical used in paper manufacturing and printing [11]. The x-ray absorption spectroscopic method provides an extremely handy and neat tool for investigation and identification of the material that are of forensic interest. It is a spectroscopic method that requires very small sample, is non-destructive in nature and flexible enough that it can be used for both organic and inorganic compounds. Its use in laboratories for evidence analysis is highly recommended.

8.4.2 UV/Visible Spectroscopy “The type of absorption spectroscopy in which light of UV region is absorbed by the molecules, which in return excites the electrons from the ground state to higher energy state is defined as UV/Visible spectroscopy” [42]. It is shortly written as UV/Vis spectroscopy. UV/Vis has simple working and instrumentation which is shown in Figure 8.7. As shown in the figure the light source which emits the UV radiation is used in the system. Hydrogen-deuterium lamp or tungsten filaments are the two most widely used light sources which can cover the entire UV region. The monochromator is consisting of the slits and prism. The prism is used to disperse the radiations that are emitted by the source. The slit then select various wavelengths of the light source that are separated by the prism [43]. Slits select the monochromatic beam. The selected beam goes through the sample. A cell made of silica or quartz is used to contain the sample solution, as glass can absorb the beam of light in the UV region. The photocell serves the motive of detecting cell in UV/Vis spectroscopic technique. The beam travels through the specimen and received by a detector (photocell). The beams received generate altering current in the photocell, and then it’s transferred to the amplifier. The photocell then rises the low intensity current thus; main purpose of an amplifier is to amplify the signals to higher intensity, so that, they are clearly recorded. At last, there is a recording device [44]. The amplifier is attached to a pen recorder that

160  Modern Forensic Tools and Devices tor ma hro c o n Mo

Sample

Dispersion Device

Detector

Exit Slit

Source

Entrance Slit

Figure 8.7  Instrumentation of UV/Vis spectroscopy.

is further coupled to a computer. The spectrum of desired substances is constructed and stored by the computer system [45]. Mainly UV/Vis spectroscopy is used for the quantitative investigation of different analysts including solid, liquid, and gases. It is easy and enormously used process in many areas like chemistry, biology, physics, organic substance analysis, and forensic evidence analysis.

8.4.2.1 Application of UV/Vis Spectroscopy in Forensics Figure 8.8 describes the pictorial representation, where UV/Vis spectroscopy is applied in forensics. The UV/Vis spectroscopy is highly nominated technique in forensic analysis. In forensic physical evidence, examination is the key purpose to compare the questionable material from place of crime with specific reference form suspect [46]. The inspection of physical evidence without leaving the location is a significant challenge for crime branch experts [47]. Based on the certainty that the UV/Vis spectroscopic method is a non-destructive and useful quantitative analytical process it is considerably recommended for the forensic investigation of fibers and inks. Due to ease of shifting and subsequent resistance, trace evidence like textile fiber has particular significance in forensic science [48]. Knowing about the truth that such trace evidence is located there in little amount; the investigation

Spectroscopic Analysis Techniques  161

Fiber Analysis

Application of UV/Vis Spectroscopy in Forensics

Document Analysis

Toxicology Analysis

Figure 8.8  Application of UV/Vis spectroscopy in forensics.

should be done on one single fiber. The long-established microscopic analytical approaches can only determine whether the fiber is natural or manmade. Modern spectroscopic methods like UV/Vis spectroscopic analysis should be used for the chemical findings of fiber [49]. The examination of color from one fiber is crucial and extracting and recognizing dyes from one tiny fiber is crucial and complex. The UV/Vis spectra acquired from one tiny fiber analysis using UV/Vis spectroscopic technique make it viable for investigating experts to carry-out such analysis. It has the ability to match and differentiate between various fibers acquired from offence spot. In forensic analysis mainly to decide whether the writing on the contract had been altered, the writing in one section of the paper is varying from the other, also sometimes to recognize the chemicals or certain impurities present in the ink that can solve some case details is specifically done by ink examination [50]. In old methods a small section of writing is cut and the solvent is extracted using distinct chemicals that can remove fluorescence and other compounds from the paper. These orthodox approaches used are destructive and can’t be put together when paper or document found from location of crime is torn or is just a little section of that paper or document. The UV/Vis spectroscopic method in comparison to conventional one can disclose minute and consistent difference between dyes associated with inks with a non-destructive approach. Also, the ink spotted on place of crime and ink associated with a suspect can be compared with the help of this method. Only a little quantity of sample is needed and

162  Modern Forensic Tools and Devices various chemicals and ink identification are possible with the help of this spectroscopy that makes analysis very easier for experts [51]. UV/Vis spectroscopic approach also plays a fundamental part in toxicological examination in a legal investigation. The existence of any harmful chemical, poison, or drug in some bodily fluid or tissue can be recognized using UV/Vis spectroscopy. The regular methods need much time and larger amount of sample for many toxicological experiments [52]. Whereas, UV/Vis spectrometer in toxicology can do experimental identification and analysis with even small amount of sample. Moreover, this method is not acknowledged much as it does not give clear answers but all the spectroscopes can make it possible in future work.

8.4.3 Atomic Absorption Spectroscopy “Atomic absorption spectroscopy (AAS) is a quantitative analytical technique in which optical radiations are absorbed by free atoms in the gaseous state for the discovery and resolution of chemical elements” [53]. Figure 8.9 represents the schematic representation of working of AAS. An AAS includes five elementary functional parts; a light source, it is a hollow cathode lamp constructed of a cup shaped cathode and an anode that is built from tungsten. These cathode and anode are situated in a void (hollow) tube filled with inert gas. A nebulizer that sucks liquid specimen at a controlled rate, creating a fine aerosol that mixes with fuel and oxidant for introducing next within the flame [54]. To atomize and launch the analyte in the light path, the nebulizer utilizes the combustion flames. Also, to accumulate the concentrated acidic garbage in a glass container, the nebulizer is used. In AAS, burner head used is prepared from solid titanium

Source (Hollow−cathode lamp)

Cu Wavelength Selector (Monochromator)

Nebulizer Waste

Sample

Figure 8.9  Instrumentation of atomic absorption spectroscopy.

Detector (Photomultiplier Tube)

Spectroscopic Analysis Techniques  163 that is corrosion free to concentrated acid and gases. The key motive of a monochromator is to segregate a wavelength from lines emitted by the source and then transfer it to the detector. Aside from selecting a particular wavelength it does excludes every other interfering wavelength in that region. A detector amplifies the wavelengths that reach it from monochromator into an electrical signal that can be recorded. The emission of electrons upon being revealed to radiation is the concept on which detector of AAS works which is generally a PMT (photomultiplier tube). The recorder is something joined to the detecting unit. It is a computer system which transfers the analogue signal into readable responses using suitable software [54, 55]. AAS is an easy and cost-effective spectroscopy used primarily to inspect the substances that are in a solution [55]. This advanced mechanism is thus applied in different branches of science essentially pharmaceuticals, medical, healthcare, metallurgical, chemical analysis, and forensics.

8.4.3.1 Application of Atomic Absorption Spectroscopy in Forensics Figure 8.10 describes the pictorial representation, where atomic absorption spectroscopy is put in applications in forensics. The biggest challenge faced by investigators during the investigation, analysis of evidence located on crime place without destroying it is. Several spectroscopes are taken into consideration for the detection of such trace evidence as they are non-destructive by nature. Atomic absorption spectroscopy is one among these techniques applied in the investigation and discovery of evidence. GSR is gunshot residues that are disclosed into the environment and can be settled on skin, objects surfaces, tissues, and cloths when the gun is shot. The presence of these GSRs on suspect’s body or at location of crime or clothing represents decisive evidence and hence, GSR detection is an important area of investigation. The characteristic particles present in the GSR sample derived by instrumental determination allow a detailed and neat investigation [56]. The specimen of GSR is obtained from hair, epithelial tissue, cloths, nasal macasa, between index finger and thumb. The GSR particles gathered is minimal in amount as hardly in µg and thus detection should be specific and standard. Atomic absorption spectroscopy is extremely compassionate and non-destructive techniques. For finding concentrations of the elements of interest that are in GSR are

164  Modern Forensic Tools and Devices

Toxicology analysis

GSR analysis

Application of Atomic Absorption Spectroscopy in forensics

Soil analysis

Metal trace analysis

Figure 8.10  Application of atomic absorption spectroscopy in forensics.

in the order of µg, and hence AAS is the most recommended technique here. Thus, AAS makes work trouble-free for the investigating officers to discover GSR and its elements [57]. In DSF laboratories AAS is mostly applied in evidence of poison and toxicology evidence detection. In inorganic chemistry, the components differ in degree of toxicity. For the majority of periodic table elements detection, the flame AAS and graphite furnace AAS is used. Drug trafficking and poisoning are constantly attempted crimes in today’s world. Arsenic and cocaine are the most prominent drugs detected using flame AAS [58]. This will help police to deduct such crimes from the state. In the cases of fatal electrocution, the investigation of metal trace in suspected electric marks can be used to confirm the contact with a metallic electrode. Also, it is practiced to reveal the source of deadly electrocution. Traditionally, the analysis of metal traces mostly focuses on qualitative characteristics, while quantitative characteristics were scarcely studied. In the recent method, AAS was applied for studying external metal deposited through the current impact and establishment of metal particles in electric marks. AAS is an authentic methodology considered by many investigators and researchers [59].

Spectroscopic Analysis Techniques  165 Apart from skin the AAS also detects metal particles from the soil samples. AAS has been auspiciously applied for exploration of concentration of many different metals in soil [60]. It’s a prominent approach used in the DSF laboratories.

8.4.4 Infrared Spectroscopy “The spectroscopy that deals with the infrared region of the electromagnetic spectrum is infrared spectroscopy (IR Spectroscopy).” It is one among absorption spectroscopy but it also analyses the sample based on emission and reflection. It normally refers as the investigation of the interaction of a molecule with an infrared region [61]. FTIR (Fourier Transform Infrared) spectroscopy is the instrument used in laboratories that work on the principle of infrared spectrum. The instrumentation of infrared spectroscopy is shown in Figure 8.11. The source of radiation used in infrared spectroscopy needs to be steady, intensity should be enough that it can be detected and should be extended over the desired wavelength. FTIR mainly functions on Michelson Interferometer experimental setup [62]. The interferometer is made of a fixed mirror, an adjustable mirror, and a beam splitter which will transmit the half radiation and reflects the other half strike on it. Solid, liquid and gaseous all the types of sample can be analyzed in the sample compartment which has a sample cell and reference cell [63]. Monochromator in infrared spectroscopy is used to disperse the broad IR spectrum into individual IR

Reference Detector Monochromatic system IR Source

Splitter

Sample

Figure 8.11  Instrumentation of infrared spectroscopy.

Read out

166  Modern Forensic Tools and Devices spectrum. Then comes a detector that is being used to measure the intensity of IR radiations that are unabsorbed [64]. Then after there is a recorder which is a computer system, it is used to record the results of the IR spectrum in a graphical manner [65]. IR spectroscopic method is being of great significance in hand full scientific researches in various departments like biology, medicines, pharmaceuticals, chemistry, space exploration, and crime investigation department.

8.4.4.1 Application of Infrared Spectroscopy in Forensics “Infrared spectroscopy and spectroscopic imaging are label free, robust, and inherently non-destructive method used for measurement of the sample.” Analyzing chemical content inside the analyte using this technique, it is feasible to utilize the similar sample for an additional technique that reveal further complimentary details and hence, it is much more attractive to the researcher in evidence analysis. Particles of paint are the only trace present on some of the place of crime, and paint can be recovered as evidence in various cases. The evidence recuperated in the form of paint can be distinguished from single layer to multilayer from fragment, smear, or even a small droplet [66]. The foremost aspiration of investigating experts is to inspect the layer structure, color, and chemical composition of the paint when paint stain is recovered. The standard approaches used microscopic method and that cannot give comprehensive information. Also as the strain is minute, the absolute idea cannot be conveyed using this conventional method. Modern laboratory uses infrared spectroscopy to readily disclose the kind of binder and extender present in the paint. Detected chemical’s analysis can be done, and further, the comparison between originating materials found from the suspect the data obtained can be done [67]. Using FTIR imaging latent fingerprint examination has been done. The conventional approaches of fingerprint development ensure to be complicated because of some obstacles like, age of the paint and surface upon which the paint is found and ambient atmosphere. To overcome such difficulties it’s prominent to study the chemical composition and chemical changes that occur under particular conditions in the fingerprint. In such condition, the macro FTIR spectroscopic imaging method provides the possibility of directly imaging fingerprint in site [68]. Also, innumerable progress and customization are done in latent fingerprint development and characterization. Characterization and verification of gunshot residue (GSR) and the volatile compound is utmost importance in crime investigation. For the

Spectroscopic Analysis Techniques  167 detection of GSR different analytical methods have been auspiciously used including HPLC and AAS. Nevertheless, the hypothetical techniques of few of these methods can destroy the specimen or are unable to give adequate amount of information. Thus, forensic officers should employ non-destructive and precise approach essentially IR spectroscopy for complementary information [69]. FTIR can be outlined to successfully utilize and reveal model explosive compounds. Also, this spectroscopy can reveal the traces of explosive compounds available in the fingerprint. Diverse inflammable substances have been differentiated and compared using their FTIR spectrum. Thus, in defense laboratories, FTIR is broadly used for explosive and gunshot residue investigation [70]. In crime investigation, the area of questioned documents involves the investigation of various legal paper documents and inks. The papers are almost same and difficult to individualize between, but can be discriminated based on physical properties being color, fiber content, tearing strength, thickness, and fluorescence. The exploration of paper and inks is a relevant part of the analysis in several cases. Counterfeit documents and signature are highly prevailing cases nowadays. FTIR spectroscopy is a powerful and non-destructive technique used in inks and paper analysis [71]. Even a little quantity of ink droplets has been inspected using FTIR spectroscopic method. Besides this, a little piece of paper can also be examined without destroying it. Various legal documents have been investigated and discriminated from copied or forged samples. Different chemicals and hazardous drugs that are there in ink can be differentiated [72]. Additionally, the emergence of any things can be investigated. An idiosyncratic method utilizing different investigation and detection in laboratories is FTIR for infrared spectroscopy.

8.4.5 Raman Spectroscopy Raman spectroscopy is a light scattering non-destructive technique used for chemical analysis. In this spectroscopy, a higher intensity laser source is scattered to incident light by molecules. In compared to other spectroscopy, there is a larger depth of detection in Raman spectroscopic technique. The instrumentation of Raman spectroscopy is explained in Figure 8.12. The source used in Raman spectroscopy is a laser. Laser has an intense beam and is monochromatic in nature and hence, is used as a source. After that there are two different filters used, laser transmitting filter and laser blocking filter. As the name narrates the functioning of filters, the laser transmitting filter helps to transmit just the laser rays and obstruct rest of

168  Modern Forensic Tools and Devices Sample

Laser Transmitting Filter

Laser

Laser Blocking Filter

Spectrometer

Figure 8.12  Instrumentation of Raman spectroscopy.

all radiations, whereas laser blocking filter will stop laser light and transmit rest of all short and long wavelengths [73]. A spectrometer used by Raman spectroscopy is a tool which helps detector to measure strokes and snitstrokes Raman scattering. Normally a CCD (charged coupled device) is used as a detector. Finally, the measured data is saved and evaluated using appropriate software in a computer system [74]. Discussing about applications Raman spectroscopy is a non-destructive and straightforward instrumentation method which has been historically used for studying chemical bondings, intermolecular bond, and to recognize molecules. Adaptability of this spectroscopy facilitates its use in different areas such as chemistry, industries, labs forensics and others.

8.4.5.1 Application of Raman Spectroscopy in Forensics Figure 8.13 describes the pictorial representation, where Infrared spectroscopy is applied in forensics. Raman spectroscopy, on the whole is a developed and simplified ­spectroscopy of all the spectroscopes. It’s highly usual and highly applied spectroscopic method in criminology. Resolution of substances found from location of crime is done comfortably and precisely using Raman spectroscopy. Raman spectroscopy is a highly versatile method of all and thus, can resolve almost all of the potholes of other spectroscopic techniques. Wide-range of samples, qualitative and quantitative examination has been done with the help of this method. Investigating drug of abuse and illicit substance indulged in crime is challenging. The old techniques used for the examination of drug of abuse are noxious and outdated. Also, identification of drug from little trace obtained is complicated. Raman spectroscopy is a legitimate and

Spectroscopic Analysis Techniques  169

Application of Raman Spectroscopy in forensics

Fingerprint analysis

GSR analysis

Document analysis

Paint analysis

Illicit drug detection

Figure 8.13  Application of Raman spectroscopy in forensics.

non-destructive method established by researches for the qualitative and quantitative analysis of different types of illicit drugs. Raman spectroscopy is proficient enough for analyzing both solid and liquid analyte without withdrawing it from packet and murder spot thereby, conserving the wholeness of the analyte. The simplified spectra acquired by Raman spectroscopy authorize an easy finding of specimen contained in a complex mixture [73]. A portable Raman instrument has made in situ detection possible for officers at work. Identification of eruptive and hazardous compounds with the help of Raman spectroscopy is time-honored and perfect nowadays. The recent approach of confocal Raman spectroscopy had been used for the investigation and identification of explosives and their precursors from synthetic fibers and colored specimens. It is highly rapid in situ technique used, which produces spectra in the span of just 90 seconds. The trace explosive fragments trapped in the middle of highly fluorescent cloth and fibers can also be easily detected with the help of this technique. Currently, the progress of remote Raman stations provided with remote sampling probe is done. Employing these mobile instrument hazardous and explosive compounds are examined and objectified at location of crime avoiding personal contact with the sample. Also, using UV Raman spectroscopy automated discloser of the explosive present in the fingerprint is to be done. Several modifications can be done in Raman spectroscopic instrument to create distinctive and detection much speedy and easier. Advanced Raman instrument with,

170  Modern Forensic Tools and Devices required modification can be used to disclose various explosive substances such as HMTD (hexamethylene triperoxide diamine) from the standoff distance of 30 meters [75]. Thus, Raman spectroscopy is the greatest ever spectroscopy that can save much efforts and time of lab experts. The questioned documents in criminology need analysis of numerous parts of a document. The paper, inks, signatures, watermarks, and adhesives are needed to be investigated and revealed with great precision to answer many question documents. The classic technique used in the reorganization of legal papers is thin layer chromatography which does not broadcast the formulation of inks and compounds present in paper, chemicals and fibers examination and various other compounds are unknown [76]. Raman spectroscopy is applied for the investigation and perusal of questioned documents as it is non-destructive, simple to execute and involves negligible or zero manipulation of the analyte. The subsequent physical and chemical identification of things are done using Raman spectroscopy: • To inspect similarities between two inks, whether they exhibit the same components. • To test if any of the document exhibit any additional or altered entities written or printed. • To possibly determine the origin of ink. • Backdating of inks. • To decide the chronological order of two or more than two inks, when they intersect in documents. This makes it effortless for investigative experts to investigate and examine questioned documents and inks [77]. Paint is collected as proof in many cases such as, vehicle hit and run case, building accident case and tools at location of incident. Several techniques are used for the analysis of paint evidence. Of all, Raman spectroscopy is used primarily to identify the key pigments of paint. At times traces are found, which holds only single layer of paint, or utterly a smear, at that time finding the pigments of paint and investigating it is a difficult task. Raman spectroscopy is the finest methodology to identify, analyze, and set side by side to compare the paint evidence with the culprit’s sample [78]. In criminology for the investigation of specimens, different spectroscopic techniques are used. Among all, Raman spectroscopy is an extremely versatile, flexible, and subtle technique. Various qualitative and quantitative analysis of the sample can be done using this method. Its mobile

Spectroscopic Analysis Techniques  171 instruments and ease of applying it at crime spot make it more versatile and handier for experts [78].

8.4.6 Electron Spin Resonance Spectroscopy The electron spins resonance (ESR) spectroscopy which is also known as electron magnetic resonance (EMR) spectroscopy or electron paramagnetic resonance (EPR) spectroscopy. It is a type of absorption spectroscopy. ESR is a class of spectroscopy where compounds having more than one unpaired electron can only be utilized that suck up the radiation that has frequencies in the microwave region. The instrumentation diagram of ESR is explained in Figure 8.14. ESR uses klystron tube as radiation source. The frequency of monochromatic radiation is determined by the voltage applied to this tube. A sample cavity is situated in the middle of two electromagnets, and it helps in magnifying (amplify) feeble signals from the compound sample. Detectors fastened with the system are an aid for the examination of microwaves radiations [79]. Various other devices like attenuators and isolators cooperatively with wave meter are successfully used for enhancing the performance of ESR spectroscopy. ESR works by keeping the photon frequency constant and changing the magnetic field incident on the sample that generates spectra. By shooting up the external magnetic field the interval in between energy states of electron increases and they spin in the middle of

Detector

Klystron

Phase Sensitive detector

Sample Cavity

Electromagnet

Modulation input

Figure 8.14  Instrumentation of electron spin resonance spectroscopy.

172  Modern Forensic Tools and Devices two energy states [80]. Consequently, the net absorption of energy is monitored and converted into a spectrum. It is a spectroscopic method which functions on magnetic field and hence, has multiple uses in many fields of science which include chemistry, physics, geology, archaeology, and forensics.

8.4.6.1 Application of Electron Spin Resonance Spectroscopy in Forensics Figure 8.15 describes the pictorial representation, where electron spin resonance spectroscopy is applied in forensics. Electron Spin Resonance (ESR) is a type of spectroscopy which toils on the magnetic field and thus has too little requisition in criminal research. Beside this reality, there are few forensic analyses are feasible with the use of ESR spectroscopy. Bloodstains are important evidence in the criminological analysis because they give important information regarding species, race, sex, and blood type. The ESR spectrum switches the spectrum value as the blood dry and thus, it is taken into consideration by criminology investigation agents to analyze blood samples. There are number of tests carried out for the blood examination in forensics, yet it’s hard to investigate blood and finalize time, how old are these samples. ESR is kind of spectroscopy

is lys

d loo

in

sta

a an

e nc

a on es R in ics Sp rens n o o ctr in f Ele opy f n o osc tio ctr a e c i pl Sp sis Ap aly n ha ot To B

Figure 8.15  Application of electron spin resonance spectroscopy in forensics.

Spectroscopic Analysis Techniques  173 which utilizes the metallic components available in vital fluid to produce a spectrum, which on examination can tell about the time after bleeding [81]. Out of all the methods used for bloodstain analysis, ESR is much accurate technique for the evaluation of blood traces and estimating time after bleeding. The additional use of electron spin resonance spectroscopy is tooth examination for assessment of the time of death. The accustomed technique used by experts for the assessment of the time of death is tooth analysis. This can be done using many conventional processes, but conventional ones have many drawbacks. The enamel, dentine, and cementum are dental tissues utilized by ESR for teeth investigation. The comprehensive and data table information of tooth examination can be done using ESR spectroscopic technique [82]. ESR is barely used for crime investigation but gives the most concrete and precise outcome in whichever analysis used. It makes it simple for the crime department to evaluate the time of death using numerous small teeth samples.

8.4.7 Nuclear Magnetic Resonance Spectroscopy “Nuclear magnetic resonance (NMR) spectroscopy is a type of absorption analytical technique most extensively used for the determination of molecular structure, content, and purity of the sample.” Of all the spectroscopy, nuclear magnetic resonance is the sole spectroscopy where complete investigation and detection of the complete spectrum is expected. The nuclear magnetic resonance instrumentation is described in Figure 8.16. The NMR spectroscopy is based entirely on a different concept where NMR signal is fabricated by the nuclei specimen is assembled in the magnetic field. Here, the sample container is a tube like structure where sample material is filled. It is kept in between two permanent magnets which supply homogenous magnetic field. When current flows through magnetic coils, which are wrapped around a magnet controller which in return will induce magnetic field. A magnet controller is attached to it as mentioned, so the equal quantity of magnetic field stream through the sample to be analyzed. A RF (Radio Frequency) transmitter is attached that creates a short powerful pulse of radio waves. Also, for the detection of the radio frequencies emitted by the nuclei as they settle down to lower energy state from higher energy state a detector is fixed after the RF transmitter [83]. After that, there is a readout tool which is a computer that records every information and inspects it. Furthermore, it can be printed and secured graphically.

174  Modern Forensic Tools and Devices RF Transmitter

Absorption

Magnet

Detector

Magnetic field

Magnet Controller

Figure 8.16  Instrumentation of nuclear magnetic resonance spectroscopy.

Most adaptable spectroscopy use to study the interaction of electromagnetic radiation with matters is NMR spectroscopy. Thus, it can be used in different branches such as chemical analysis, protein determination, space research, and forensics.

8.4.7.1 Application of Nuclear Magnetic Resonance Spectroscopy in Forensics Figure 8.17 describes the pictorial representation, where nuclear magnetic resonance spectroscopy is applied in forensics. Nuclear magnetic resonance (NMR) spectroscopy is extremely resourceful techniques utilized in the field of crime detection. NMR means an idiosyncratic methodology to carry out a quantitative investigation which includes structure illumination of molecules. The implementation of NMR in crime investigation is for revealing the purity of drugs and discovery of illicit drugs. Various spectroscopic techniques and orthodox method used to evaluate the purity of drugs and analysis of illegitimate drugs. The drawback of all those techniques is that they are slow, need much tricky sample construction, and are destructive to some extent. The root cause behind using nuclear magnetic resonance

Spectroscopic Analysis Techniques  175

Blood stain analysis

Application of Nuclear Magnetic Resonance Spectroscopy in forensics

Drug analysis

Figure 8.17  Application of nuclear magnetic resonance spectroscopy in forensics.

spectroscopy is accuracy of the instrument. Performance gives absolute (not relative) purity drugs and natural compounds. The additional reason is that adulterations detected in the drug should be further quantitated using NMR whereas others just examine the impurities [84]. The outdated techniques applied for the illicit drug detection is unable to analyze some of the non-­volatile material of drugs. The NMR spectroscopy is cost-effective, much faster and can detect non-volatile compounds. Also, NMR technique omits the requirement of reference compound or a solvent for the investigation and hence, it abstains waste time on preparing various reference samples. The NMR is a hi-tech instrumentation technique with great accuracy, correctness, and linearity. The NMR is astronomically applied for cocaine analysis and its adulteration quantification. Moreover, NMR detects the traces of cocaine and the quantities of its present [85]. Much adulteration done in the regular drug is detected and examined. Thus, NMR is much conventional method applied for investigation of purity of drugs in forensic. Blood species and blood traces are the common evidence obtained from the crime location. Also, it is an influential and challenging task for experts to determine and analyze blood samples. In criminological occurrence, the foremost question that needs to be answered is that, a found trace is blood or not. The succeeding question arises is regarding blood origin, whether it’s human or non-human. Traditionally, vital fluid

176  Modern Forensic Tools and Devices is screened utilizing different destructive techniques like oxidation-reduction tests or luminol reaction. Besides, these methods had pitfalls, as like they can destroy the DNA, or can give wrong obstructive leading which may reduce the confidence of investigating officers. The technique that has potential for bloodstains analysis and is applied by investigating officers is Raman spectroscopy and infrared spectroscopy. However, at times crime investigating officers need additional information like the presence of alcohol in blood, human or non-human blood, and disease present in the blood. Dominant technique that crime investigation system can use to examine and investigate all the intricate data is NMR spectroscopy [86]. One can say that NMR has flaws but has an essential approach in crime investigation.

8.4.8 Atomic Emission Spectroscopy Atomic emission spectroscopy is defined as “A type of emission spectroscopy in which matter is excited by an excitation source and study of electromagnetic radiations emitted from matter is performed.” One can say that emission spectroscopy is kind of spectroscopic technique where the study of radiations is done when radiations emitted by matter settle back to its lower energy state from higher energy state. The instrumentation of atomic emission spectroscopy is mentioned in Figure 8.18. The atomic emission spectroscopy (AES) is one of the most primarily used techniques for the investigation of the analytical concentration of substances. At a primary stage in this technique, sample introduction is present, where compound to be analyzed is introduced into the instrument ION Coupled Plasma

Pump

Argon

Wavelength Selector

PMT Detector

Nebulizer

Sample Fluid

Figure 8.18  Instrumentation of atomic emission spectroscopy.

Read out

Spectroscopic Analysis Techniques  177 after which it reaches argon plasma after passing through a pump. Sample inserted in whatever state should be transformed into fine liquid aerosols before entering plasma. In plasma the atoms get excited. It is fissile for the atoms to emit light after they get excited. The light emitted by atoms then goes through a wavelength selector which conveniently selects proper wavelengths that reach the detecting device called detector. Different detectors are being used in AES on the bases of the requirement of the evidence material used. Variety of detectors adapted by AES are photomultiplier tube (PMT), image dissector, photodiode array (PDA), and charge coupled detector (CCD) [87]. Computer system connected to the detector collects whole of the signals and conducts all data handling needed to construct spectrum. It is sole emission spectroscopy and thus, universally indulged in many different areas of analysis such as food industries, chemical factories, biological analysis, medicine, and forensics.

8.4.8.1 Application of Atomic Emission Spectroscopy in Forensics Figure 8.19 describes the pictorial representation, where atomic emission spectroscopy is applied in forensics. The highly developed atomic emission spectroscopy with plasma can take over many instruments in defense laboratories that are concern with characterization of glass traces. Glass obtained from the location of crime

Glass analysis Tissue analysis

Application of Atomic Emission Spectroscopy in forensics Steel trace analysis

Figure 8.19  Application of atomic emission spectroscopy in forensics.

178  Modern Forensic Tools and Devices is considered prime evidence in various cases like hit and run, vehicle accidents, and murders with glass weapons. The glass pieces found are compared with the one found on accused belonging or victim’s body. The glass pieces are delicate and fragile; and so it is important that the method set for analysis must be proficient of handling small samples. Physical characteristics commonly as color, thickness, density, and refractive index (RI) of glass are considered for the identification and correlation of glass traces [88]. The improved and automated glass production has done cut-down in spread among RI values reducing information power of traditional investigation techniques and show up the requirement of well-grounded and advance identification. Atomic emission spectroscopy thus became universal alternative for the characterization and inspection of glass sample. Apart from AES, there are other spectroscopies utilized for glass analysis but, they have some drawbacks such as restricted by specimen shape and size, higher cost, longer detecting time, and destruction of the found trace. The AES has overcome all these pitfalls and it can be greatly simplified for analysis of glass samples; 100% correct detection can be done with the help of AES. Atomic emission spectroscopy can also be used in steel and tissue analysis at some extend. The reorganization and representation of steel trace can be done using AES. Steel tracers are rarely established on crime spot and can be investigated using different method. AES with plasma source open rooms for comprehensive characterization and comparison of steel evidence [89]. Also using AES various chemical compounds present in the human tissue can be strongly detected. In acute poisoning cases, availability of toxic compounds in the tissue of human organs requires to be identified and analyzed with great precision. AES is successfully applied for the examination of human tissues and to confirm the presence of toxic compounds [88, 89]. It is a kind of technique which is hardly used for such analysis now but has wide room in the upcoming world of forensic analysis.

8.4.9 X-Ray Fluorescence Spectroscopy X-ray fluorescence spectroscopy (XRF) is fluorescence spectroscopy non-destructive in nature. XRF spectroscopic method can be used for the measurement of single compound wavelengths. When the sample to be investigated is exposed to x-rays, the fluorescence emission is obtained which can be measured using XRF. Figure 8.20 shows the working and instrumentation of XRF.

Spectroscopic Analysis Techniques  179 Sample

X-ray tube Detector

Read out Amplifier and multi-channel analyzer

Figure 8.20  Instrumentation of x-ray fluorescence spectroscopy.

In XRF, source of light is an x-ray tube which emits the x-ray radiation on a specimen. When the sample is illuminated by the beam of x-ray, the sample can be declared excited. In return, x-ray along the spectrum of wavelengths is emitted by excited sample. The detecting unit determines the power of the emitted x-ray photon. The detector then accumulates whole data results inside a multi-channel analyzer. It is a technique that gathers details about all the elements synchronically. The outcome must be significantly boosted by getting that in a graphical manner with specific spectral identification in a computer system [90]. XRF has innumerably applied in different areas including research analysis, industries, biological analysis, pharmaceuticals, and is also suited for crime investigation.

8.4.9.1 Application of X-Ray Fluorescence Spectroscopy in Forensics Figure 8.21 describes the pictorial representation, where x-ray fluorescence spectroscopy is applied in forensics. X-ray fluorescence (XRF) spectroscopy with developed tools was explored as an investigating method in numerous evidence analyses. One of the major applications of XRF spectroscopy is ink and stamp examination. There are numerous important documents printed by the government which include; currency notes, and government stamp papers that contains the tagged substance, not present in the commercial inks. These tagged substances are rare Earth metals that can be recognized at times when required in evidence analysis using XRF spectroscopic technique.

180  Modern Forensic Tools and Devices

Application of X-Ray Fluorescence Spectroscopy in forensics

Paint analysis

Ink analysis

Figure 8.21  X-ray fluorescence spectroscopy application in forensics.

It is one amidst of some main uses of XRF to disclose the tagged ink with a specific compound in an eccentric way. XRF is utilized in discriminating original and forged stamps. Revenue, fiscal, and tax stamps are diverse categories of important government printed document stamps. Numerous crimes are carried out by the culprits who utilize the duplicate and forgery of stamps. Authentic and counterfeit stamp should be discriminated successfully to stop such crime. Various specimens of stamps are tested and differentiation is carried out on the account of characterization of essential compounds contained by paper and ink. There are three distinct region of a stamp which can be analyzed: 1. the ink-printed area, 2. the non-printed area, and 3. the holographic area [91, 92]. The analysis of original sample is compared with the counterfeit sample using XRF spectroscopy. The X-ray fluorescence is much suggested method for the investigation of ink and forged samples. Samples containing paint traces found from violation spot are analyzed using XRF. X-ray fluorescence spectroscopy is a robust technique which successfully analyzed paint traces. The supremacy of applying XRF spectroscopy over other technique is: 1. Non-destructive and hence, the analytical procedure does not alter the specimen used. 2. Possible to analyze the sample without removing it from place of crime and avoiding any kind of physical contact.

Spectroscopic Analysis Techniques  181 3. Facilitates the process of examination of an unknown sample. 4. Physical and chemical properties can be investigated which allows the reorganization of origin and type of paint. 5. It allows the comparison between various samples. 6. Paint examination can be done utilizing paint database and is useful in recognizing and comparing it with automobile models [93]. X-ray fluorescence spectroscopy is a highly preferable technique for examination and depiction of paint, ink, and stamp samples.

8.4.10 Fluorescence Spectroscopy Fluorescence spectroscopy is a kind of spectroscopy which applies the fluorescence properties of a specimen for examination and ascertainment of concentration of the analyte. It uses a light beam to excite the electrons and causes them to emit light. Figure 8.22 shows the instrumentation of fluorescence spectroscopy.

Sample Light Source

Monochromter

Emission Manochromter

Detector

Read out

Figure 8.22  Fluorescence spectroscopy instrumentation.

182  Modern Forensic Tools and Devices Fluorescence spectroscopy has fundamental instrumentation which is easy to understand. It accommodates a light source, two monochromators, a sample holder, and a detector. Also, a spectral output system is present which mostly a computer. A xenon arc is the light source used here, as it produces continuous spectrum. The two different monochromators used in this are 1) excitation monochromator and 2) emission monochromator. The source of light passes through the excitation monochromator and here it allows only the radiation requires for the excitation of the molecule to pass through. After the sample specimen emission monochromator is placed at the angle of 90º from incident light source. Thus, this monochromator accumulates the radiations emitted from the specimen and pass it to the detector. A holder that holds the sample is cuvette mostly produced using glass or quartz. PMT (Photomultiplier Tube) which can convert light energy into electrical signals is one of the most common detectors used in fluorescence spectroscopy. These electric signals are passed to the spectral output which displays specific results [94]. This is elementary and significant spectroscopy and hence, its uses include biochemical, chemistry, forensic science, pharmaceuticals, and medical.

8.4.10.1 Application of Fluorescence Spectroscopy in Forensics Figure 8.23 describes the pictorial representation of application of fluorescence spectroscopy in forensics.

Application of Fluorescence Spectroscopy in forensic

Petroleum product analysis

Saliva analysis

Figure 8.23  Fluorescence spectroscopy application in forensics.

Spectroscopic Analysis Techniques  183 Forensic evidences complicated to analyze are the one that are invisible to human eye. One such invisible evidence is saliva stains. It is an important evidence and examination of saliva traces made it much simple to differentiate them from the victim’s saliva and the suspect’s one. Analyzing spit traces has made it effortless to carry out the DNA analysis. Analysis of saliva traces from drinking glass surface is much simple in comparison to that constructed on inanimate objects like paper, cigars, envelopes, and clothes. Since drive saliva spots are invisible to human eyes, to detect saliva from inanimate articles is a challenging task for experts. The accumulation and existence of dried saliva stains have been predicted using fluorescence spectroscopic technique. In saliva the enzyme amylase is present in high concentration, which is used by fluorescence spectroscopy for analysis of saliva. Dried saliva stains have been investigated and obtained spectra have been compared with the fresh liquid saliva stains. Various evaluations were regulated successfully and it concluded that fluorescence peak, fluorescence intensity, and area under the curve can be used and studied to examine the dried saliva evidence [95, 96]. Thus, using this easy instrument of fluorescence spectroscopy, feasible samples for detailed DNA investigation can be screened and selected. The spectroscopic technique can thus make a significant endowment to forensic identification. Spectroscopy has been broadly utilized for different physical and biological sample analyses. Sometimes there are cases where petroleum products such as crude oils have to be investigated. Fortunately, to investigate and compare crude oil traces the fluorescence spectroscopy can be used. To analyze these crude oil traces, the spectra obtained in the visible region of fluorescence spectroscopy can be used. The analyzed specimen is compared with the other samples found from the victim or from the suspects’ articles. Also, the emergence and composition have been determined with the help of fluorescence spectroscopy [97]. Fluorescence spectroscopic method has thus; found much importance in forensic researcher for the analysis of some complex compound. It has rare but much important uses in the field of crime investigation.

8.4.11 Phosphorescence Spectroscopy Phosphorescence Spectroscopy functions on the principle where radiation transition takes place. In this, intersystem crossing state is obtained by absorbed energy, with a different spin multiplicity known as the meta-­stable state. The phosphorescence persists as afterglow, even after

184  Modern Forensic Tools and Devices

Source

Excitation monochromter

Sample Cell

Emission Monochromter

Recorder

Amplifier

Detector

Figure 8.24  Instrumentation of phosphorescence spectroscopy.

exciting radiations has been removed. Thus, phosphorescence is a rarer phenomenon then fluorescence. The instrumentation diagram is shown in Figure 8.24. The first component in phosphorescence spectroscopy is a light source. The source used to irradiate the specimen is a xenon lamp. After source, there is a filter, which attenuates the stray light and permits only light of specific wavelength to pass through. After that, there is a sample holder where compound to be analyzed are placed. The sample is placed in a special sample holder with a fixed slit system and a rotating shutter. The subsequent component is phosphorescence filter, which is kept at 90º from an incident source which permits only the phosphorescence radiation to go through it and reach the detector. A photomultiplier tube (PMT) is used as a detector in which wavelength is detected and investigated [98]. This spectroscopy works on the phenomenon of phosphorescence and hence, has special interest in crime investigation. The other uses include chemistry, biology, and biochemistry.

8.4.11.1 Application of Phosphorescence Spectroscopy in Forensics Figure 8.25 shows the pictorial representation, where phosphorescence spectroscopy is used in forensics.

Spectroscopic Analysis Techniques  185

Fingerprint analysis Application of Phosphorescence Spectroscopy in forensics Glass analysis

Figure 8.25  Phosphorescence spectroscopy application in forensics.

Phosphorescence spectroscopy is not famous and its significant applications cannot be seen in crime investigation. The recent advancement and development in instrumentation and data processing of phosphorescence spectroscopic method have made it a noteworthy instrument for fingerprint and glass sample investigation in evidence analysis. Fingerprint has always been a powerful technique and in future also it will be one of the most powerful and common analysis techniques in crime investigation. There are many different techniques used in fingerprint examination of which, all have their own drawbacks. Various harmful chemicals being used in these methods may destroy the sample; furthermore, it has been toxic for investigation officers. Using advanced phosphorescence spectroscopic method for fingerprint visualization can be a good alternative. It is a kind of technique, mostly used for the visualization and development of latent fingerprints. It is a type of technique which utilized on both porous and non-porous surfaces. Using different phosphorescence compounds, it’s easy to see the invisible latent fingerprint from both kinds of surfaces even after a long time [99]. Apart from this, the successful use of phosphorescence spectroscopy is for the examination of glass pieces found on spot of crime. Forensic science analysis of glass samples primarily indulges the comparison of the glass specimen with other fragments recovered from suspect’s fabrics or some other articles. There are numerous techniques used for the investigation of glass sample which uses refractive index and density of the glass to analyze various such samples. It is much complicated to analyze glass samples using these properties due to the advanced glass manufacturing techniques. Glass sample analysis has been made much easier using phosphorescence technique. Utilizing phosphorescence spectra various glass

186  Modern Forensic Tools and Devices samples can be analyzed and compared. Even very small particles have been investigated and detected, weather the found trace is a specimen containing glass or other identical material. Phosphorescence in spectroscopy methods have been thus, said to be the automated tomorrow of forensic investigation [100].

8.4.12 Atomic Fluorescence Spectroscopy The Atomic Fluorescence Spectroscopy (AFS) is a bit same as Atomic Absorption Spectroscopy (AAS) and Atomic Emission Spectroscopy (AES). It works on the measurement of the emission fluorescence that a sample analyte emits. The main supremacy of AFS over AAS and AES is its high sensitivity and decreased background signals. Figure 8.26 shows instrumentation of AFS. The same basic instrumentation as that of atomic absorption spectroscopy is used in the atomic fluorescence spectroscopy. Talking of AFS, as a source of radiation the hollow cathode lamp or xenon arc lamp is used. The atoms of analyte are excited by this source. The atomic fluorescence dispersion takes place using monochromator. Here, the photomultiplier tube (PMT) is used as a detector. Also, a flame atomizer contained with a nebulizer is available in the system is used to convert the sample into an aerosol, which is then fed into burner [101]. Thus, one can say the instrumentation of AFS is the same as that of AAS and AES, just one difference that AFS detects the excited atomic fluorescence wavelength. AFS is generally applied in the detection of quantified metals. Other applications of Monochromter

Excitation

Emission

Monochromter

Light Source

Detector

Figure 8.26  Instrumentation of atomic fluorescence spectroscopy.

Spectroscopic Analysis Techniques  187 AFS include pharmaceuticals, forensic evidence analysis, chemical analysis, and metallurgy.

8.4.12.1 Application of Atomic Fluorescence Spectroscopy in Forensics Figure 8.27 describes the pictorial representation, where atomic fluorescence spectroscopy is applied in forensics. “Atomic Fluorescence spectroscopy (AFS) involves radiative excitation of a sample by the light source for the determination of elements present in the sample.” Due to its compound determination and fast sample analysis, it has versatile application in forensic for drug detection and chemical analysis. At times, there are in numerous sample traces found oat place of crime which cannot be recognized just by observing. Various granules and particles are collected and need to be examined [102]. The determination of such unknown chemical compounds and drugs is done using atomic fluorescence spectroscopy. AFS offers excellent sensitivity as compared to other spectroscopic techniques. Additionally, it also has cost-effective instrumentation, simple and easy sample preparation and injection, and super-fast sample analysis. This makes this method more suitable and useful for the examination of different drugs and chemical samples. Talking of drug investigation this method is used for the

Application of Atomic Fluorescence Spectroscopy in forensics

Chemical analysis

Drug analysis

Figure 8.27  Atomic fluorescence spectroscopy application in forensics.

188  Modern Forensic Tools and Devices discovery of the compounds present in drugs. In the drug preparation, it simplifies the presence of toxic substances. Also found powder from the place of crime, in which drug or chemical compound can be distinguished using AFS [102, 103]. Thus, AFS is an important tool for forensic analysis as it is used for elemental specification, the determination of chemical forms of elements and toxic compounds. It does not have much versatile application but can be very useful for fewer applications in forensics.

8.4.13 Chemiluminescence Spectroscopy Chemiluminescence spectroscopy is a very versatile spectroscopic technique as chemiluminescence is a type of chemical reaction that produces light, unlike other spectroscopic techniques. The chemiluminescence spectroscopy produces the spectrum due to some energized molecules and not because of the excited atoms. Figure 8.28 shows the instrumentation and working of chemiluminescence spectroscopy. As described in Figure 8.28 as compared to other spectroscopic techniques the instrumentation of chemiluminescence spectroscopy is totally contrasting. A light source is not used here. The light in this technique is emitted by the chemical reaction taking place and that can be detected using various detectors. To carry out the reaction a luminescence reagent is used. Other chemicals involved in this chemical reaction are transferred using column. The luminescence reagent will pass through the delivery

Mixer Photomultiplier tube

Column

Chemiluminescence detector Delivery pump

Luminescence reagent

Figure 8.28  Instrumentation of chemiluminescence spectroscopy.

Spectroscopic Analysis Techniques  189 pump reaches mixture column and there it meets other chemicals needed for a reaction to complete. All the regents get mixed in mixture column and the chemical reaction in return emits light. The detector used in the system detects this light. The detectors that can be used in this spectroscopic technique are PMT (Photomultiplier Tube), photographic films, photocells, and multiple channel detectors [104]. The chemiluminescence is an experimental tool used for the clarity of detection. The attractiveness in this spectroscopy is that, light source here is its own. It implies that the experimental methods and the instruments utilized to execute them necessarily need detector that detects rays of light and computer system to record results. Because of its simple instrumentation and ambiguous specifications, this spectroscopy has applications in numerous branches including food analysis, medicine, forensics, and chemistry.

8.4.13.1 Application of Chemiluminescence Spectroscopy in Forensics Chemiluminescence spectroscopy is defined as, “A unique method which uses emission of light from a chemical reaction.” It is hardly popular in forensic investigation but is feasible for bloodstain analysis. Forensic experts often come across scenarios where the blood marks are much older and thus dried. Above all, there are some cases where the blood is cleaned off the floor or cloths to destroy the evidence. In cases like this, it is difficult to analyze the presence of blood at place of crime [105]. Much useful technique used in such cases by forensic investigators for blood analysis is chemiluminescence spectroscopy. The light emitted from chemiluminescent reactions has a discrete intensity, lifetime, and wavelength. It encloses the spectrum from nearultraviolet, through the visible and into the near-infrared region and can analyze various parameters. The chemicals like luminol and hydrogen peroxide are used to prepare a solution for the reaction. When this chemical solution is sprinkled over the dried or swapped blood stains the emission of light is observed [104]. The light emitted in this process is then analyzed for future information. For the successful analysis of bloodstain in forensics, it is the most favorable technique [104]. Chemiluminescence is a different concept of instrumentation and has successfully analyzed dried and invisible blood samples; also it is a nondestructive, rapid, and sensitive technique to rely on.

190  Modern Forensic Tools and Devices

8.5 Conclusion To conclude, for forensic evidence analysis one requires advanced, highly sensitive, precise, and non-destructive techniques. Spectroscopic techniques come much into consideration, with the growth in research to develop more efficient and advanced tools for forensic investigation. Along with the classification of different spectroscopic techniques this chapter also describes instrumentation and working of the same. Moreover, the application of all these spectroscopic techniques in forensic science is provided in detail. Analysis of various complicated evidence has been made an easy task by employing automated and developed spectroscopy in forensic science. It is content that important and relevant information for forensic science research will be continuously produced by spectroscopic imaging approaches. However, the real-time scenario of using some of these modern technologies is still at bleak. This is because of the insufficient expertise in modern techniques or the resistance to accept and use a new technology. Nevertheless, in few years, this scenario will change, and fully advanced technologies will be used for the crime scene investigation.

References 1. Bhatt, P.V., Pandey, G., Tharmavaram, M., Rawtani, D., Mustansar Hussain, C., Nanotechnology and taggant technology in forensic science, in: Technology in Forensic Science: Sampling, Analysis, Data and Regulations, pp. 279–301, 2020. 2. Rawtani, D., Tharmavaram, M., Pandey, G., & Hussain, C. M., Functionalized nanomaterial for forensic sample analysis. TrAC, Trends Anal. Chem., 120, 115661, 2019. 3. Muro, C.K., Doty, K.C., Bueno, J., Halámkova, L., Lednev, I.K., Vibrational spectroscopy: Recent developments to revolutionize forensic science. Anal. Chem., 87, 1, 306–327, 2015. 4. Niemantsverdriet, J.W., Spectroscopy in Catalysis: An Introduction, John Wiley & Sons, NJ, USA, 2007. 5. Pavia, D.L., Lampman, G.M., Kriz, G.S., Vyvyan, J.A., Introduction to Spectroscopy, Nelson Education, Canada, 2014. 6. Milton, E.J., Review article principles of field spectroscopy. Remote Sens., 8, 12, 1807–1827, 1987. 7. Siegel, D.M., Balfour Stewart and Gustav Robert Kirchhoff: Two independent approaches to “Kirchhoff ’s radiation law”. Isis, 67, 4, 565–600, 1976.

Spectroscopic Analysis Techniques  191 8. Smyrnios, N.A., Irwin, R.S., Curley, F.J., Chronic cough with a history of excessive sputum production: The spectrum and frequency of causes, key components of the diagnostic evaluation, and outcome of specific therapy. Chest, 108, 4, 991–997, 1995. 9. Harvey, D., Modern Analytical Chemistry, Vol. 1, McGraw-Hill, New York, 2000. 10. Da Silva, J.C., Queiroz, A., Oliveira, A., Kartnaller, V., Advances in the application of spectroscopic techniques in the biofuel area over the last few decades, in: Frontiers in Bioenergy and Biofuels, pp. 25–58, 2017. 11. Manso, M. and Carvalho, M.L., Application of spectroscopic techniques for the study of paper documents: A survey. Spectrochim. Acta Part B At. Spectrosc., 64, 6, 482–490, 2009. 12. Oka, T., Spectroscopy and astronomy: H 3+ from the laboratory to the Galactic center. Faraday Discuss., 150, 9–22, 2011. 13. Kulesa, C., Terahertz spectroscopy for astronomy: From comets to cosmology. IEEE Trans. Terahertz Sci. Technol., 1, 1, 232–240, 2011. 14. Mantsch, H.H. and Shaw, R.A., Vibrational spectroscopy and medicine: An alliance in the making. Vib. Spectrosc., 30, 1, 31–41, 2002. 15. Ng, C.Y., Vacuum ultraviolet spectroscopy and chemistry by photoionization and photoelectron methods. Ann. Rev. Phys. Chem., 53, 1, 101–140, 2002. 16. Pessanha, S., Manso, M., Carvalho, M.L., Application of spectroscopic techniques to the study of illuminated manuscripts: A survey. Spectrochim. Acta Part B At. Spectrosc., 71, 54–61, 2012. 17. Baranska, M. (Ed.), Optical Spectroscopy and Computational Methods in Biology and Medicine, Vol. 14, Springer Science & Business Media, Netherlands, 2013. 18. Simonescu, C.M., Application of FTIR spectroscopy in environmental studies, in: Advanced Aspects of Spectroscopy, pp. 49–84, 2012. 19. Kuhar, N., Sil, S., Verma, T., Umapathy, S., Challenges in application of Raman spectroscopy to biology and materials. RSC Adv., 8, 46, 25888–25908, 2018. 20. Cardoza, L.A., Korir, A.K., Otto, W.H., Wurrey, C.J., Larive, C.K., Applications of NMR spectroscopy in environmental science. Prog. Nucl. Magn. Reson. Spectrosc., 45, 3–4, 209–238, 2004. 21. Blanco, M., Coello, J., Iturriaga, H., Maspoch, S., De La Pezuela, C., Nearinfrared spectroscopy in the pharmaceutical industry. Analyst, 123, 135R–150R, 1998. 22. Lewen, N., The use of atomic spectroscopy in the pharmaceutical industry for the determination of trace elements in pharmaceuticals. J. Pharm. Biomed. Anal., 55, 4, 653–661, 2011. 23. Chalmers, J.M., Edwards, H.G., Hargreaves, M.D. (Eds.), Infrared and Raman Spectroscopy in Forensic Science, John Wiley & Sons, NJ, USA, 2012.

192  Modern Forensic Tools and Devices 24. Rinke-Kneapler, C.N. and Sigman, M.E., Applications of laser spectroscopy in forensic science, in: Laser Spectroscopy for Sensing, pp. 461–49, Woodhead Publishing, Netherlands, 2014. 25. Hussain, C. M., Rawtani, D., Pandey, G., & Tharmavaram, M.,

Handbook of Analytical Techniques for Forensic Samples: Current and Emerging Developments. Elsevier, Amsterdam, 2020.

26. Espinoza, E.O., Kirms, M.A., Filipek, M.S., Identification and quantitation of source from hemoglobin of blood and blood mixtures by high performance liquid chromatography. J. Forensic Sci., 41, 5, 804–811, 1996. 27. Tangen, J.M., Thompson, M.B., McCarthy, D.J., Identifying fingerprint expertise. Psychol. Sci., 22, 8, 995–997, 2011. 28. Biedermann, A., Bozza, S., Taroni, F., Normative decision analysis in forensic science. Artif. Intell. Law, 28, 1, 7–25, 2020. 29. Ribaux, O., Walsh, S.J., Margot, P., The contribution of forensic science to crime analysis and investigation: Forensic intelligence. Forensic Sci. Int., 156, 2–3, 171–181, 2006. 30. Vandenabeele, P., Edwards, H.G.M., Jehlička, J., The role of mobile instrumentation in novel applications of Raman spectroscopy: Archaeometry, geosciences, and forensics. Chem. Soc. Rev., 43, 8, 2628–2649, 2014. 31. Koningsberger, D.C. and Prins, R., X-ray Absorption: Principles, Applications, Techniques of EXAFS, SEXAFS, and XANES, OSTI.GOV, USA, 1988. 32. Pizzini, S., Roberts, K.J., Greaves, G.N., Harris, N., Moore, P., Pantos, E., Oldman, R.J., Instrumentation for glancing angle x-ray absorption spectroscopy on the synchrotron radiation source. Rev. Sci. Instrum., 60, 7, 2525– 2528, 1989. 33. Gaur, A., Shrivastava, B.D., Nigam, H.L., X-ray absorption fine structure (XAFS) spectroscopy–a review. Proc. Indian Natl. Sci. Acad., 79, Part B, 921– 966, 2013. 34. Sauer, K., Yano, J., Yachandra, V.K., X-ray spectroscopy of the photosynthetic oxygen-evolving complex. Coord. Chem. Rev., 252, 3-4, 318–335, 2008. 35. Menzies, A.C., A study of atomic absorption spectroscopy. Anal. Chem., 32, 8, 898–904, 1960. 36. Slavin, W. and Carnrick, G.R., The possibility of standardless furnace atomic absorption spectroscopy. Spectrochim. Acta Part B At. Spectrosc., 39, 2-3, 271–282, 1984. 37. Kempson, I.M., Kirkbride, K.P., Skinner, W.M., Coumbaros, J., Applications of synchrotron radiation in forensic trace evidence analysis. Talanta, 67, 2, 286–303, 2005. 38. Thatcher, P.J. and Briner, G.P., The application of x-ray powder diffraction to forensic science. Powder Diffr., 1, 4, 320–324, 1986. 39. Švarcová, S., Kočí, E., Bezdička, P., Hradil, D., Hradilová, J., Evaluation of laboratory powder x-ray micro-diffraction for applications in the fields of cultural heritage and forensic science. Anal. Bioanal. Chem., 398, 2, 1061– 1076, 2010.

Spectroscopic Analysis Techniques  193 40. Akhgari, M., Moradi, F., Ziarati, P., The texture of psychoactive illicit drugs in Iran: Adulteration with lead and other active pharmaceutical ingredients. J. Psychoactive Drugs, 50, 5, 451–459, 2018. 41. Williams, C.H., David, D.J., Iismaa, O., The determination of chromic oxide in faeces samples by atomic absorption spectrophotometry. J. Agric. Sci., 59, 3, 381–385, 1962. 42. Jentoft, F.C., Ultraviolet–visible–near infrared spectroscopy in catalysis: Theory, experiment, analysis, and application under reaction conditions, in: Advances in Catalysis, vol. 52, pp. 129–211, 2009. 43. Clark, B.J., Frost, T., Russell, M.A. (Eds.), UV Spectroscopy: Techniques, Instrumentation and Data Handling, Vol. 4, Springer Science & Business Media, Netherlands, 1993. 44. Limniou, M., Papadopoulos, N., Roberts, D., An integrated lecture, virtual instrumentation lab approach to teaching UV-Vis spectroscopy. Educ. Inf. Technol., 12, 4, 229–244, 2007. 45. Baeten, V. and Dardenne, P., Spectroscopy: Developments in instrumentation and analysis. Grasas Aceites, 53, 1, 45–63, 2002. 46. Gill, R., Bal, T.S., Moffat, A.C., The application of derivative UV-visible spectroscopy in forensic toxicology. J. Forensic Sci. Soc., 22, 2, 165–171, 1982. 47. Sharma, V., Kumar, R., Kaur, P., Forensic examination of textile fibers using UV-Vis spectroscopy combined with multivariate analysis. J. Appl. Spectrosc., 86, 1, 96–100, 2019. 48. Kumar, R. and Sharma, V., A novel combined approach of diffuse reflectance UV–Vis-NIR spectroscopy and multivariate analysis for non-destructive examination of blue ballpoint pen inks in forensic application. Spectrochim. Acta A Mol. Biomol. Spectrosc., 175, 67–75, 2017. 49. Thanasoulias, N.C., Piliouris, E.T., Kotti, M.S.E., Evmiridis, N.P., Application of multivariate chemometrics in forensic soil discrimination based on the UV-Vis spectrum of the acid fraction of humus. Forensic Sci. Int., 130, 2-3, 73–82, 2002. 50. Kumar, R., Kumar, V., Sharma, V., Discrimination of various paper types using diffuse reflectance ultraviolet–visible near-infrared (UV-vis-NIR) spectroscopy: Forensic application to questioned documents. Appl. Spectrosc., 69, 6, 714–720, 2015. 51. Adam, C.D., Sherratt, S.L., Zholobenko, V.L., Classification and individualisation of black ballpoint pen inks using principal component analysis of UV–vis absorption spectra. Forensic Sci. Int., 174, 1, 16–25, 2008. 52. Tomaszewska, E., Soliwoda, K., Kadziola, K., Tkacz-Szczesna, B., Celichowski, G., Cichomski, M., Grobelny, J., Detection limits of DLS and UV-Vis spectroscopy in characterization of polydisperse nanoparticles colloids. J. Nanomater., 2013, 60, 2013. 53. Beaty, R.D. and Kerber, J.D., Concepts, Instrumentation and Techniques in Atomic Absorption Spectrophotometry, p. 27, Perkin-Elmer, USA, 1978.

194  Modern Forensic Tools and Devices 54. Robinson, J.W., Atomic absorption spectroscopy. Analyt. Chem., 32, 8, 17A– 29A, 1960. 55. Broekaert, J.A.C., Atomic absorption spectroscopy instrumentation. Spectrochim. Acta B: At. Spectrosc., 45, 8, 845–856, 1990. 56. Dahl, D.B. and Lott, P.F., Gunshot residue determination by means of gunpowder stabilizers using high-performance liquid chromatography with electrochemical detection and analysis of metallic residues by graphite furnace atomic absorption spectrophotometry. Microchem. J., 35, 3, 347–359, 1987. 57. Krishnan, S.S., Detection of gunshot residue on the hands by neutron activation and atomic absorption analysis. J. Forensic Sci., 19, 4, 789–797, 1974. 58. Singhal, S.P., Atomic absorption spectroscopy in forensic chemistry. Can. Soc. Forensic Sci. J., 7, 1, 7–17, 1974. 59. Jakubeniene, M., Zakaras, A., Minkuviene, Z.N., Benoshys, A., Application of atomic absorption spectroscopy for detection of multimetal traces in low-voltage electrical marks. Forensic Sci. Int., 161, 1, 36–40, 2006. 60. Maurya, A., Kesharwani, L., Mishra, M.K., Analysis of heavy metal in soil through atomic absorption spectroscopy for forensic consideration. Int. J. Res. Appl. Sci. Eng. Technol., 6, 231–242, 2018. 61. Chabal, Y.J., Surface infrared spectroscopy. Surf. Sci. Rep., 8, 5–7, 211–357, 1988. 62. Perkins, W.D., Fourier transform-infrared spectroscopy: Part l. Instrumentation. J. Chem. Educ., 63, 1, A5, 1986. 63. Ohyama, Y., Onaka, T., Matsuhara, H., Wada, T., Kim, W., Fujishiro, N., Ishihara, D., Near-infrared and mid-infrared spectroscopy with the infrared camera (IRC) for AKARI. Publ. Astron. Soc. Jpn., 59, sp2, S411–S422, 2007. 64. Faix, O., Fourier transform infrared spectroscopy, in: Methods in Lignin Chemistry, pp. 83–109, Springer, Berlin, Heidelberg, 1992. 65. Siesler, H.W., Ozaki, Y., Kawata, S., Heise, H.M. (Eds.), Near-Infrared Spectroscopy: Principles, Instruments, Applications, John Wiley & Sons, NJ, USA, 2008. 66. Zięba-Palus, J. and Trzcińska, B.M., Application of infrared and Raman spectroscopy in paint trace examination. J. Forensic Sci., 58, 5, 1359–1363, 2013. 67. Beveridge, A., Fung, T., MacDougall, D., Use of infrared spectroscopy for the characterisation of paint fragments, vol. 223, Taylor and Francis, Inc., New York, 2001. 68. Ewing, A.V. and Kazarian, S.G., Infrared spectroscopy and spectroscopic imaging in forensic science. Analyst, 142, 2, 257–272, 2017. 69. Bueno, J., Sikirzhytski, V., Lednev, I.K., Attenuated total reflectance-FT-IR spectroscopy for gunshot residue analysis: Potential for ammunition determination. Anal. Chem., 85, 15, 7287–7294, 2013. 70. Brożek-Mucha, Z., A study of gunshot residue distribution for close-range shots with a silenced gun using optical and scanning electron microscopy,

Spectroscopic Analysis Techniques  195 x-ray microanalysis and infrared spectroscopy. Sci. Justice, 57, 2, 87–94, 2017. 71. Kumar, R., Kumar, V., Sharma, V., Fourier transform infrared spectroscopy and chemometrics for the characterization and discrimination of writing/ photocopier paper types: Application in forensic document examinations. Spectrochim. Acta A Mol. Biomol. Spectrosc., 170, 19–28, 2017. 72. Kher, A., Mulholland, M., Reedy, B., Maynard, P., Classification of document papers by infrared spectroscopy and multivariate statistical techniques. Appl. Spectrosc., 55, 9, 1192–1198, 2001. 73. Bumbrah, G.S. and Sharma, R.M., Raman spectroscopy–basic principle, instrumentation and selected applications for the characterization of drugs of abuse. Egypt. J. Forensic Sci., 6, 3, 209–215, 2016. 74. Coates, J., Vibrational spectroscopy: Instrumentation for infrared and Raman spectroscopy. Appl. Spectrosc. Rev., 33, 4, 267–425, 1998. 75. Bueno, J., Sikirzhytski, V., Lednev, I.K., Raman spectroscopic analysis of gunshot residue offering great potential for caliber differentiation. Anal. Chem., 84, 10, 4334–4339, 2012. 76. Raza, A. and Saha, B., Application of Raman spectroscopy in forensic investigation of questioned documents involving stamp inks. Sci. Justice, 53, 3, 332–338, 2013. 77. Braz, A., López-López, M., García-Ruiz, C., Raman spectroscopy for forensic analysis of inks in questioned documents. Forensic Sci. Int., 232, 1–3, 206– 212, 2013. 78. Izake, E.L., Forensic and homeland security applications of modern portable Raman spectroscopy. Forensic Sci. Int., 202, 1–3, 1–8, 2010. 79. Weckhuysen, B.M., Heidler, R., Schoonheydt, R.A., Electron spin resonance spectroscopy, in: Characterization I, pp. 295–335, Springer, Berlin, Heidelberg, 2004. 80. Wertz, J.E. and Bolton, J.R., Basic instrumentation of electron spin resonance, in: Electron Spin Resonance, pp. 21–37, Springer, Dordrecht, 1986. 81. Miki, T., Kai, A., Ikeya, M., Electron spin resonance of bloodstains and its application to the estimation of time after bleeding. Forensic Sci. Int., 35, 2-3, 149–158, 1987. 82. Rink, W.J., Electron spin resonance (ESR) dating and ESR applications in Quaternary science and archaeometry. Radiat. Meas., 27, 5–6, 975–1025, 1997. 83. Bollard, M.E., Stanley, E.G., Lindon, J.C., Nicholson, J.K., & Holmes, E., NMR‐based metabonomic approaches for evaluating physiological influences on biofluid composition. NMR in Biomed.: An International Journal Devoted to the Development and Application of Magnetic Resonance In vivo, 18, 3, 143–162, 2005. 84. Hays, P.A., Proton nuclear magnetic resonance spectroscopy (NMR) methods for determining the purity of reference drug standards and illicit forensic drug seizures. J. Forensic Sci., 50, 6, 1342–1360, 2005.

196  Modern Forensic Tools and Devices 85. Rocha, W.W., Leite, J.D.A., Correia, R.M., Tosato, F., Madeira, N.C., Filgueiras, P.R., Neto, Á.C., Quantification of cocaine and its adulterants by nuclear magnetic resonance spectroscopy without deuterated solvents (No-D qNMR). Anal. Methods, 10, 15, 1685–1694, 2018. 86. Zailer, E., Diehl, B.W., Monakhova, Y.B., Blood species discrimination using proton nuclear magnetic resonance spectroscopy. Int. J. Legal Med., 131, 3, 723–729, 2017. 87. Broakaert, J.A.C. and Raeymaekers, B., Atomic emission spectroscopy instrumentation. Spectrochim. Acta B: At. Spectrosc., 45, 8, 845–856, 1982. 88. Rodriguez-Celis, E.M., Gornushkin, I.B., Heitmann, U.M., Almirall, J.R., Smith, B.W., Winefordner, J.D., Omenetto, N., Laser induced breakdown spectroscopy as a tool for discrimination of glass for forensic applications. Anal. Bioanal. Chem., 391, 5, 1961, 2008. 89. Locke, J., The application of plasma source atomic emission spectrometry in forensic science. Anal. Chim. Acta, 113, 1, 3–12, 1980. 90. Thomas, B.W., X-ray fluorescence spectroscopy instrumentation. Ind. Eng. Chem., 46, 3, 93A–96A, 1954. 91. Dhara, S., Misra, N.L., Maind, S.D., Kumar, S.A., Chattopadhyay, N., Aggarwal, S.K., Forensic application of total reflection x-ray fluorescence spectrometry for elemental characterization of ink samples. Spectrochim. Acta B At. Spectrosc., 65, 2, 167–170, 2010. 92. Melendez-Perez, J.J., Correa, D.N., Hernandes, V.V., de Morais, D.R., de Oliveira, R.B., de Souza, W., Eberlin, M.N., Forensic application of x-ray fluorescence spectroscopy for the discrimination of authentic and counterfeit revenue stamps. Appl. Spectrosc., 70, 11, 1910–1915, 2016. 93. Rani, A. and Kumar, R., Forensic application of energy dispersive x-ray fluorescence to analyse a vehicle paint sample. J. Forensic Sci. Crim. Investig., 11, 4, 555820, 2019. 94. Lakowicz, J.R., Instrumentation for fluorescence spectroscopy, in: Principles of Fluorescence Spectroscopy, pp. 25–61, Springer, Boston, MA, 1999. 95. Denny, S.E., Nazeer, S.S., Sivakumar, T.T., Nair, B.J., Jayasree, R.S., Forensic application of fluorescence spectroscopy: An efficient technique to predict the presence of human saliva. J. Lumin., 203, 696–701, 2018. 96. Ladokhin, A.S., Fluorescence spectroscopy in peptide and protein analysis, in: Encyclopedia of Analytical Chemistry: Applications, Theory and Instrumentation, 2006. 97. Ryder, A.G., Analysis of crude petroleum oils using fluorescence spectroscopy, in: Reviews in Fluorescence 2005, pp. 169–198, Springer, Boston, MA, 2005. 98. Dıaz-Garcıa, J., Costa-Fernández, J.M., Bordel-Garcıa, N., Sanz-Medel, A., Room-temperature phosphorescence fiber-optic instrumentation for simultaneous multiposition analysis of dissolved oxygen. Anal. Chim. Acta, 429, 1, 55–64, 2001.

Spectroscopic Analysis Techniques  197 99. Eaton-Magaña, S., Post, J.E., Heaney, P.J., Freitas, J., Klein, P., Walters, R., Butler, J.E., Using phosphorescence as a fingerprint for the hope and other blue diamonds. Geology, 36, 1, 83–86, 2008. 100. Calloway, A.R. and Jones, P.F., Enhanced discrimination of glass samples by phosphorescence analysis. J. Forensic Sci., 23, 2, 263–273, 1978. 101. Alkemade, C.T.J., A theoretical discussion on some aspects of atomic fluorescence spectroscopy in flames, in: Atomic Absorption Spectroscopy, pp. 73–98, Butterworth-Heinemann, Berlin, 1970. 102. Winefordner, J.D. and Vickers, T.J., Atomic fluorescence spectroscopy as a means of chemical analysis. Anal. Chem., 36, 1, 161–165, 1964. 103. Heidari, A., Cavity ring–down spectroscopy (CRDS), circular dichroism spectroscopy, cold vapour atomic fluorescence spectroscopy and correlation spectroscopy comparative study on malignant and benign human cancer cells and tissues with the passage of time under synchrotron radiation. Enliven Chall. Cancer Detect. Ther., 4, 2, e001, 2017. 104. Bowie, A.R., Achterberg, E.P., Sedwick, P.N., Ussher, S., Worsfold, P.J., Realtime monitoring of picomolar concentrations of iron (II) in marine waters using automated flow injection-chemiluminescence instrumentation. Environ. Sci. Technol., 36, 21, 4600–4607, 2002. 105. Barni, F., Lewis, S.W., Berti, A., Miskelly, G.M., Lago, G., Forensic application of the luminol reaction as a presumptive test for latent blood detection. Talanta, 72, 3, 896–913, 2007.

9 Emerging Analytical Techniques in Forensic Samples Disha Bhatnagar1 and Piyush K. Rao2* School of Forensic Sciences, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 1

Abstract

The global advancement in the field of analytical chemistry has also spread over diverse fields such as environmental chemistry, forensics, pharmaceutical industry, medical sciences, and many more. In forensic analysis, the concern is to determine the physical and biological evidences recovered from the crime scene or victims or suspects. The analytical instruments play a crucial role in the forensic analysis of the sample. The sophisticated analytical instruments provide the qualitative as well as quantitative analysis of matter. Qualitative analysis indicates the identification and quantitation indicates the measurement of the concentration of analyte. This chapter will be with a center of attention on the emerging and analytical techniques broadly in use including gas chromatography, liquid chromatography, capillary electrophoresis mass spectrometry, inductively coupled plasma-mass spectrometry, laser ablation inductively coupled plasma mass spectrometry. Keywords:  Analytical techniques, chromatographic techniques, electrophoresis, spectrophotometry, sample analysis, quantitative analysis

9.1 Introduction Forensic science is the relevance of basic sciences to legal systems. Forensic analysis uses the postulate of basic sciences for analysis during a criminal *Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (199–224) © 2023 Scrivener Publishing LLC

199

200  Modern Forensic Tools and Devices proceeding or investigation. It applies the science of Chemistry, biology, physics, geology, and many more subjects and helps in the analysis of evidences procured from the site of crime [1]. Analytical chemistry is the sub-division of pure sciences that deals with the developing and growing applications of new methods in analysis and instrumentation to provide information about the structural composition of the matter. Analytical chemistry has become an integral fragment of the analysis field of forensics. The main impetus of forensic analysis is the detection and quantification of the sample found on the crime scene that can help in criminal proceedings [2]. The evolution of analytical techniques happened quite rapidly in the past few years and they have a very extensive range of applications in forensic science. The sophisticated analytical instruments have made the detection possible at very low concentrations with high sensitivity. Forensic toxicology and forensic chemistry are the subcategories of forensic science where the analytical instruments are used an ample number of times and they have great importance [3]. In this chapter, we will be focusing on important analytical techniques that have emerged recently and have broad applications in forensic science. The techniques include Gas chromatography, Liquid Chromatography, Mass spectrometry, and many more. The chapter focuses on the basics, principles, instrumentation, and applications of each technique.

9.2 Separation Techniques 9.2.1 Chromatography The development of chromatography was done by Michael Tswett. Chromatographic techniques are separation processes which are used to disjunction a complex mixture into its components. The involvement of two phases, i.e., stationary phase and mobile phase are relatively helpful in the distribution of components of mixtures. The mobile phase takes the sample containing the mixture of components, across the stationary phase. The communication between the stationary phase and the sample mixture occurs due to the differential affinity of each component towards the stationary phase. Depending on the affinity of the components the different components are eluted and the detector generates a chromatogram. The mobile phase can be liquid or gas and the stationary phase can be solid or liquid [4, 5].

Analytical Techniques in Forensic Samples  201 There are a few important terms to understand before explaining the different types of chromatographic techniques. Retention time – The total time consumed by a component to pass over the system. The shorter the retention time the faster is the elution. Resolution – Resolution can be defined as the ability to separate two peaks or separation of two different components. Sensitivity – Sensitivity can be defined as the minimal detectable concentration of the compound [4]. Figure 9.1 shows the classification of chromatographic techniques, based on three different criteria. The chromatography is categorized on the basic interaction of solute and stationary phase as Adsorption, Partition, Size exclusion, and Ion exchange chromatography, based on chromatographic bed as twodimensional and three-dimensional chromatography and based on mobile phase as gas chromatography, liquid chromatography, and supercritical fluid chromatography. The most vital and emerging analytical techniques of chromatography broadly used in forensic analysis are explained here.

Injector

Carrier Gas

Detector Flow Controller Data System

Column

Figure 9.1  Basic instrumentation of gas chromatography [6].

202  Modern Forensic Tools and Devices

9.2.1.1 Gas Chromatography This chromatographic technique employs an inert gas as a mobile phase and the stationary phase is packed within the column. Based on the type of stationary phase used, gas chromatography is categorized as Gas solid Chromatography and Gas-Liquid Chromatography. Gas-Liquid Chromatography – In GLC, the stationary phase is a liquid overlaid on a solid support. The liquid used as stationary phase either is chemically bonded with the solid surface or is just simply immobilized on it. GLC is the most extensively used technique as it is applicable to a broad range of compounds. This technique is contingent on the fundamentals of partition chromatography i.e. the separation occurs based on the solubility of the sample molecules. Gas-Solid Chromatography – In GSC, the stationary phase used is a solid such as silica, alumina, or polymer. These stationary phases i.e. adsorbent powder is filled in the column which provides an adsorbent surface for the volatile components. The separation in GSC roots upon the principle of adsorption chromatography. The process of separation depends upon the affinity of the sample components and the adsorbent powder [6]. Principle – The sample either in liquid or gaseous state is injected into the heated injection port where it get volatized. The mobile phase i.e. gas, carries the sample through the column, where it interacts with the stationary phase based on their affinities. Due to their differential affinity, the components get out of the column at different times and reach the detector where it gets detected. The data system then generates a chromatogram [4]. The compounds used for analysis in GC must fulfill two criteria: • Must be volatile. • Compounds must be thermally stable [7]. Instrumentation – The typical GC instrument includes a flow controller, injection port, a column, oven, detector, and a data processor connected to the instrument. Inert gases such as He, H2, N2 are used as carrier gases and are supplied at a constant flow rate. From the injection port, the sample is introduced, where its vaporization occurs and the carrier gas carries the sample towards the column, where separation happens based on affinities. The column is then in the connection with the detector. The compounds other

Analytical Techniques in Forensic Samples  203 than the carrier gas elute out from the column and reach the detector. Here the detection occurs and the electrical signals are amplified and sent to a data processor, where the chromatogram is generated. Thus both qualitative and quantitative examination can be done with GC [7]. Now we’ll discuss some of the important parts of GC instruments 1. Sample Injection – Varieties of sample injection methods are used in GC. The techniques are discussed here in brief (Figure 9.2). 1.1. Split Injection – It is the most versatile injection method. In this method, when the sample is introduced through the injection port, it vaporizes along the liner, moving downstream, a major portion of the sample is split out through the split valve, and a smaller portion is allowed to enter in the column. This will help to protect the column by sample overloading. The ratio between the column flow rate and split flow rate is the split ratio. The higher the ratio, the lesser the volume of sample enters the column. Septum

P Vent Septum Purge Flow Regulator

Mass flow controller Seal

Back pressure Regulator Liner

Split/Purge flow Vent Inlet Weidment

Column

Figure 9.2  Design of split/splitless injection [8].

204  Modern Forensic Tools and Devices 1.2. Splitless Injection – Splitless injection method is suitable for the samples, in which the analyte concentration is very low. It is similar to the split injection, just the split valve is closed in this method. When the sample is introduced in the injection port, due to oven temperature it gets vaporized and move towards the column. The valve is then opened after a few minutes, to remove the remaining sample. This method is best suited for compounds having a high boiling point with a relatively low concentration of analyte [9]. 1.3. Programmable Temperature Vaporizer Injection System (PTV) – When the sample is injected, the injection port is set at a low temperature. Thereafter PTV is heated rapidly and the sample along with the solvent is completely vaporized. Both split and splitless can be applied to a PTV [4]. 2. Columns – The columns used in GC are categorized into two types, Packed column and Capillary column. The capillary column/open tubular column is widely used due to its remarkable ability of fine separation. It has two basic forms. 2.1. Wall Coated Open Tubular – In WCOT, a fine layer of stationary phase is coated along the walls of the column. It is made of glass, aluminum, plastic copper etc. 2.2. Support Coated Open Tubular – In SCOT, the adsorbent is overlaid on the walls with a single layer, and then, the liquid stationary phase is coated over the adsorbent. The packed column is a glass built or metal tubing and is densely packed with the adsorbent material such as diatomaceous earth (Figure 9.3). It has a larger diameter than the capillary column. They can achieve only half of the efficiency when compared to WCOT [9]. 3. Detectors –The position of the detectors are at the end of the column, which identifies and quantifies the components present in the mixture as they elute out from the column. The detectors are studied under two major categories. Bulk Property Detectors – It measures/detects based on the general properties possessed by both the sample and carrier gas.

Analytical Techniques in Forensic Samples  205

Figure 9.3  Packed column [10].

Specific Property Detector – It detects by the specific properties of components of mixture. It has limited applications but has great sensitivity. The important detectors used in GC, are explained here. 3.1. Flame Ionization Detectors (FID) – FID is the most widely and common detectors used in GC. The sample is subjected to air hydrogen flame after eluting out from the column. This results in pyrolysis of the sample. The pyrolyzed hydrocarbon releases electrons or ions which carry current and this current is measured by picoammeter. This detector has high sensitivity (Figure 9.4) [11]. 3.2. Thermal Conductivity Detector (TCD) – TCD works by assessing the thermal conductivity. Two detectors are employed in this, one measures the thermal conductivity of carrier gas, a He, H2 has very high thermal conductivity, and the other measures the thermal conductivity of sample with carrier gas. So the change in the thermal conductivity in carrier gas, along with the sample is detected. The detector consists of an electrically heated source usually a gold or platinum wire which is maintained at constant temperature. It is a universal detector but has low sensitivity [11].

206  Modern Forensic Tools and Devices

Collector (Cathode)

Tower body

− Power Supply Flame

+

Flam tip (anode)

Ignitor

H2

Air

Column

Figure 9.4  Flame ionization detector [12].

3.3. Electron Capture Detector (ECD) – ECD is a highly selective detector, which is used for the detection of substances having halogen, peroxides, quinines, and nitro groups. The ECD consists of a radioactive emitter of Nickel 63 or Tritium, which is placed in an electric field. The compound when elutes out from the column, passes through the emitter which ionizes the nitrogen-containing carrier gas and it then releases a ray of electrons (Figure 9.5). A constant current is maintained between the electrodes in the absence of an organic compound. The presence of organic compound results in a significant decrease in the current as they captures the electrons [11]. 3.4. Photo Ionization Detector (PID) – This is a selective detector used for aromatic hydrocarbon, organo heteroatom, inorganic species, and other organic compounds. A UV lamp is present that emits photons, which compound absorbs are eluted out from the column. Another detector ionizes and analysis the small portion of the compound.

Analytical Techniques in Forensic Samples  207 63Ni

Foil

Insulation Cell pulser probe

Electron Cloud

Cell assembly Collector electrode

Signal probe Ceramic insulators

Column

Figure 9.5  Electron capture detector [13].

3.5. Mass Spectrometer – MS is the most potential of all the detectors. The sample when elutes out from the column of GC it passed to the inlet of MS. Herewith the help of an ion source, the sample is ionized and fragmented. These fragmented ions travel through a mass analyzer, where they got separated by their m/z value. Thus, the mass spectrometry detects the compounds according to their mass to charge ratio [4]. Table 9.1 shows the detectors and their detection ranges:

Applications of GC • Food Industry – GC is used for the analysis of esters, fatty acids, alcohol, and many more. The analysis of adulterants and contaminants can be detected.

208  Modern Forensic Tools and Devices Table 9.1  Different types of detectors and detection limits [6]. Serial no.

Detectors

Detection limit

1.

FID (Flame Ionization Detector)

100 pg

2.

TCD (Thermal Conductivity Detector)

1 ng

3.

NPD (Nitrogen Phosphorus Detector)

10 pg

4.

PID (Photo-ionization Detector)

2 pg

5.

ECD (Electron Capture Detector)

50 fg

• Forensics – Specimen found from the crime scene such as biological samples or toxicological analysis can be done. Analysis of fire debris, poison detection, pesticides, the presence of drug in blood, urine, semen. The applications of GC are spread up to anti-doping laboratories for ensuring any intake of prohibited products by athlete. • Medicine – The detection of some metabolic disorders can be done through GC. It is used to detect the minute quantities from the urine or blood samples which can help in analyzing any medical emergency. • Pharmaceutical – GC is widely used in the pharmaceutical industry for drug development and detection of any impurities and many more areas. Most importantly the GC is used in quality control and research and development department of the pharmaceutical industry [4, 14].

9.2.2 Liquid Chromatography Liquid chromatography is a separation technique with the involvement of liquid as a mobile phase which transports our sample along the column which is packed with a stationary phase. HPLC is the abbreviated form of High-Performance Liquid Chromatography. HPLC is extensively used nowadays. It is a type of column chromatography. In HPLC, the solvent along with the sample has the allowance to flow with high pressure overall the column resulting in the separation of components. HPLC have few advantages over GC as in GC, only volatile compound and thermally stable can be analyzed. There are no such criteria in LC so, is used for the analysis of a broad range of compounds.

Analytical Techniques in Forensic Samples  209 Based on the mode of separation, HPLC is divided into 2 phases: Normal Phase HPLC – When the polar stationary phase and non-polar mobile phase is used, the system is known as normal phase HPLC. Reverse Phase HPLC – The unalike of the normal phase is reverse phase HPLC. The mobile phase used is polar and non-polar is the stationary phase [15].

Instrumentation The HPLC system involves a solvent reservoir, pump, injector, column, detector, and display system (Figure 9.6). 1. Solvent Reservoir – The mobile phase is placed in the solvent reservoir. It contains bottles containing different ­solvents/mobile phases which are then used according to the composition of the sample. 2. Pump – The pump provides the required pressure and forces the mobile phase to pass from the solvent reservoir to the column and then detector. 3. Column – Stainless steel columns are used. They vary in size from 50-3000 mm, internal diameter of 2-5 mm. Generally is packed with stationary phase of molecular size of 3-10 µm. Solvent reservoir A and B

Sample injection system

chromatographic column

Detector Waste Solvent delivery system

Figure 9.6  Flow diagram of HPLC system [16].

Integrated/Computer

210  Modern Forensic Tools and Devices 4. Sample Injector – Either manual or autosampler can be used for sample injection. Injection volume lies from 0.1 ml to 100 ml [15, 17]. 5. Detectors – The detector detects the analyte as it elutes out from the column. The most commonly used detectors of HPLC are described here. • UV VIS Detector – This is the most broadly used detector of HPLC. This is based on fact about organic compounds light absorption in UV or visible region. It follows the principle of Beer Lambert’s law. The detector consists of a deuterium source, monochromator, and photodiodes for measuring intensities of the sample. This is a highly sensitive and robust technique. • Refractive Index Detector – RI detector is considered a universal detector. It is categorized under bulk property detector. This detector works on the difference measured between the RI of the compound along with the solvent and RI of the pure solvent. It can be used for almost all kinds of sample but have less sensitivity as compared to UV Vis detector. • Photo Diode Array (PDA) – This is one of the most common detectors in HPLC. It allows us to view the UV spectra of the components eluted out and also monitors the absorbance of the solvent. It can also help us to identify the impurities for new method development. • Fluorescence Detector – This is a highly sensitive and selective detector and has limited applications. It detects the components by the fluorescent light emitted by them. The detector constitutes of a xenon source, an excitation monochromator, an emission monochromator, a flow cell, and a photomultiplier, which amplifies the emitted photons and thus detects the compound. • Electrical Conductivity Detector – ECD is a highly sensitive and universal detector. It works by calculating the conductivity of the compounds along with the eluents. It is categorized under bulk property detector. For measuring the conductivity electrodes of stainless steel or platinum can be used [18].

Analytical Techniques in Forensic Samples  211

Applications of HPLC • Pharmaceutical – In the pharmaceutical industry, HPLC has a wide range of applications in drug discovery, method development, detection of impurities, ensuring the quality of the product, structure elucidation, and many more. • Environment – Detection of environmental impurities. Phenol compound in drinking water, monitoring of pollutants in the environment can be done with HPLC. • Forensic – The analysis of drugs, such as cocaine, barbiturates, benzodiazepines, poisons, anabolic steroids can be done through HPLC. Bilirubin and Biliverdin quantification in blood plasma, the antibiotics in urine can be quantitated through HPLC [19].

9.2.3 Capillary Electrophoresis Electrophoresis is the process of separation of solute ions with the help of an electric field with the help of a running buffer. The separation in this process depends upon the following factors: • • • •

Velocity of molecule Electric field Charge of molecule Friction coefficient [20]

Capillary electrophoresis principle – in capillary electrophoresis, the migration of analyte molecules is done in capillary through a run buffer by applying a high voltage. The separation occurs due to the electrophoretic mobility and electro-osmosis flow of the solution. Electro-osmosis flow is the mechanism of movement of buffer in the capillary from the inlet to the detector. Electrophoretic mobility can be defined as the movement of charged solute in an electric field [21].

Instrumentation The basic instrumentation of capillary electrophoresis comprises a high voltage power supply, two buffer reservoirs, two electrodes, and two detectors (Figure 9.7).

212  Modern Forensic Tools and Devices

Fused silica capillary Detector

Anode Analyte sample plug

Cathode

Data System

Laser

Buffer Reservoir

Figure 9.7  Capillary electrophoresis [22].

The sample is introduced by substituting one buffer reservoir by sample vial. The sample is surrounded by a buffer solution. The sample migrates according to their electrophoretic mobility, on applying the high voltage electric field. Neutral molecules cannot be separated by this process. The time taken by the sample to pass the capillary is the migration time and reaches the detector. 1. Capillary – A capillary formed of fused silica having an internal diameter of 25-75 µm is used. The capillary is first conditioned before usage. The conditioning is done to ensure the systematic charge of the capillary. Conditioning is done by washing it with 0.1 M NaOH and then by distilled water for about 5 minutes. 2. Sample Injection – The ability of this system to inject the sample in picoliter or nanoliter is extremely advantageous. The sample is injected by simply applying a voltage for some time. 3. Detectors – The detector used in HPLC such as UV Vis, ECD, RI, PDA can be used in capillary electrophoresis [23].

Analytical Techniques in Forensic Samples  213

Applications of Capillary Electrophoresis • The separation can be done from simple molecules to complex structures, such as peptides, proteins, oligonucleotides, and many such molecules. • The use in pharmaceutical industries has rapidly increased from the past recent years. This can be considered as the replacement of HPLC. Complex molecules separation, method development, detection of impurities, ensuring the quality of product is done by capillary electrophoresis. • Trace elemental detection for forensic samples can also be done by CE [4].

9.3 Mass Spectrometry MS has gained an important position in analytical chemistry. This method has rapidly progressed and become very popular due to its enhanced sensitivity, limit of detection, speed, and accuracy. Principle – The MS works by first ionization of the molecules. When the ions are generated, they are differentiated according to their mass in the existence of an electric or magnetic field by charge ratio. A mass spectrometer comprises an ion source, which causes ionization of molecule, a mass analyzer, for ions separation according to their m/z ratio, and a detector, for qualitative and quantitative measurement of the analyte. The system works under high vacuum conditions [24]. Instrumentation – The instrumentation includes the sample introduction system, ion source, mass analyzer, and detector (Figure 9.8). We will discuss them one by one each. Sample Inlet – Sample introduction methods depend on the type of sample. As the next step is ionization and the ionization method mostly used is for molecules that exist in a gaseous state. so the sample is introduced in a gaseous state. A few sample introduction methods are explained here. • Direct Vapor Inlet – The sample is directly introduced using a needle. The analysis of the gaseous phase is introduced into the ion source, where it gets ionized.

214  Modern Forensic Tools and Devices IONIZATION

ACCELERATION Electromagnet To vacuum pump

Vapourized sample DEFLECTION

DETECTION

Amplifier Computer

Figure 9.8  Block diagram of mass spectrometer [25].

• Gas Chromatography – GC is a widely used sample introduction technique in MS. The sample is first allowed to separate into its component and then these individual components are identified and quantified in MS. • Liquid Chromatography – The compounds which are not easily identified by GC are separated by LC and the individual components separated by LC are introduced in MS for detection. • Direct Ionization Probe – This method is used for compounds having low vapor pressure. A small capillary tube is used, which consists of a probe that can be heated. The sample is introduced into this and the probe is inserted into the MS. The temperature can be raised afterward to vaporize the sample. • Direct Ionization of Sample – The direct ionization is in the usage for the compound which is not thermally stable. The sample is introduced by direct ionization [26, 27]. Ionization Methods – There are varieties of ionization methods used in MS. The methods are discussed here in brief. a. Electron Ionization – EI is the most broadly used technique. The ionization is done using electrons which are

Analytical Techniques in Forensic Samples  215 produced by a stream of current that flows through a wire filament. The amount of current directly proportionate to the electrons emitted through the filament. This electron beam strikes on the analyte and causes it to produce an ion.   The ionization capacity of an organic molecule is considered to be 8-16 eV and this technique involves high energy up to 70 eV and thus it produces a large number of molecular ions or fragment ions. b. Chemical Ionization – It is a soft ionization technique. As energy used in this process is less, the production of the number of fragment ions is less than EI.   In this method, firstly a reagent gas such as CH4, NH3 is ionized by electron impact. The gas ions and molecules of gas reacts and the product of their reaction interact with our analyte and causes ionization of our analyte. c. Fast Atom Bombardment – In this method, high energy atoms of rare gas are focused upon liquid or solid sample and convert it into gaseous phase and ionize it in one step. The sample must be dissolved in a non-volatile solvent. d. Electrospray Ionization – ESI is an abbreviated form of electrospray ionization. A remarkable growth and popularity is gained by this technique from the last decade. In this method, the eluents are sprayed at atmospheric pressure into a chamber of high electrostatic field, which is maintained between an inlet needle and the capillary. The sample gets nebulized and due to the net charge, they accumulate on the surface of the capillary and then finally burst out due to the high columbic repulsion causing the production of multiply charged ions. e. MALDI – Matrix-assisted laser desorption/ionization. The extremely large molecules such as peptide, protein, polymer etc. are analyzed using this technique. The direct ionization is done from the condensed phase. Molecules weighing up to 200000 Dalton can be analyzed (Figure 9.9).   The sample is mixed with the appropriate matrix and is placed onto a metal rod/probe, and is allowed to dry. The laser beam (pulsed) is focused on the dried sample. The  matrix absorbed the laser beam and the energy ejects  the analyte ions from the surface of the metal probe [28].

216  Modern Forensic Tools and Devices Laser Beam

+

+ +

MALDI Plate

+

+

+

+ +

+ +

+

+

+

+

+

+

+

+

To mass analyzer

+ Analyte ions +

Matrix ions

Cation

Focussing ions Extraction grid

Figure 9.9  MALDI [29].

Mass Analyzers After ionization, the ions produced are allowed to separate according to their mass by charge value. The continuous and pulsed analyzer are used in MS. Continuous analyzer includes the Quadrapole and Magnetic sector. This works by transmitting a single m/z to the detector. A single m/z is selected and the other ions m/z are lost and thus reducing the S/N ratio. It is a sensitive technique. Pulsed analyzer includes TOF, ion trap, and many more. a. Quadrapole – The quadrapole mass analyzer is highly efficient and is most commonly used. It consists of four rods arranged as shown in the (Figure 9.10) A DC/RF voltage is applied across the electrodes. This causes the ions to separate according to their m/z value. The four electrodes are connected in pairs and RF voltage is applied in such a way that firstly the rods placed above and below are at a positive potential and the other two at negative potential. The polarity changes after few minutes causing the analyte ion

Analytical Techniques in Forensic Samples  217 Quadrapole rod –

+

+

–

Detector

Ion Source

Exit slit

Entrance slit Ion with an unstable trajectory

Ion with stable trajectory

Figure 9.10  Quadrapole [30].

to travel in 3D motion and gets separated according to the m/z ratio [24]. b. Magnetic Sector – Magnetic sector mass analyzer have higher resolution than quadrapole. A magnetic field is applied in this method, which accelerates the charged ions and causes the ion beam to bend in an arc. The radius of this arc increases as the charge of ion and magnetic field strength decreases.

r



B C

µ can be written as mass (m) * velocity (v) and charge of ion is charge number (z) * charge of electron (e).

m v z r B e m r B e z v



For a single m/z value, they follow the fixed radius.

218  Modern Forensic Tools and Devices c. Time of Flight – The separation of ions in the absence of a magnetic field. The ions generated through the ionization process, travels by different velocities, depending on their masses, in a flight tube which is a free field. Mostly the TOF is applied with MALDI. The time taken by an ion to reach a detector is measured [4]. Detectors – The usage of detectors in MS detects the current signal produced through the ions. Different types of detectors are used in MS. Following are the most important detectors which are widely used. a. Faraday Cup – It is a metal cup that is positioned in the path of the ion beam. It collects all the ions and measures the current, through an electrometer attached to the metal cup. Though the faraday cup cannot be used in pulse counting mode, it is comparatively less sensitive than the other detectors (Figure 9.11). Ion Suppressor

Ion Source

Collector electrode

Faraday Cage Slit

Figure 9.11  Faraday cup [31].

Load resistor

To Amplifier

Analytical Techniques in Forensic Samples  219 b. Electron Multiplier detector – EM consists of a series of dynodes. When the ion strikes the surface of the dynode, a secondary electron is emitted. Thus it amplifies the signal and detects the current. This technique is considered to be robust fast and sensitive [28].

Applications of MS • Proteomics – The MS is used to determine the protein structure, folding, enzymatic reactions, and quantification of proteins in a given sample. • Pharmaceutical – In the detection of impurities, new method development, drug discovery, structure elucidation, and in quality control. • Forensic – For detection and quantification of drug of abuse, poison detection, trace evidence analysis. • Environment – For the water quality verification and the detection and adulterants of the contaminant in food commodities. • Geology – For determination of differently composed petroleum products [32].

9.4 Tandem Mass (MS/MS) When two mass analyzers are joined as one instrument for the sensitivity increment and specificity, it is then known as Tandem mass. These analyzers are in connection with a collision cell. The first MS is used for selecting a precursor ion. The precursor ion passes through the collision cell and gets fragmented in the second MS producing product ions [24]. The MS is usually combined with GC or LC and as recent development tandem mass technique is widespread because of its resolution and sensitivity. Hyphenated techniques that are commonly used are: • • • •

GC-MS GC-MS-MS LC-MS LSC-MS-MS

220  Modern Forensic Tools and Devices

9.5 Inductively Coupled Plasma-Mass Spectrometry ICP-MS is one of the most crucial emerging analytical techniques. We can detect several metals and non-metals at concentration levels up to ppb in almost any material. The multi-elemental analysis can be done in a single step. Principle – The liquid sample is mixed with argon gas and converts it into aerosol in the nebulizer. These aerosol particles then enter in the ion source chamber, where the plasma ionizes the sample. Focusing lens are used to remove the neutrals and the photons (Figure 9.12). The ions from here travels to the quadrapole mass analyzer where it gets separated according to their m/z ratio. This further reaches the detector, where the electron multiplier is used to detect the ions [33].

Applications • The detection of almost all elements can be done in all types of samples. • In semiconductor and electronic industries. • Determination of trace elements in drinking water • Quantification of elements from sewage water, industrial effluents, and many more. interface mass spectrometer

inductively coupled plasma

lens detector

quadrupole

solution introduction system

cones Ar

load coil vacuum pumps

signal conversion

Figure 9.12  Block diagram of ICP-MS [34].

Ar torch

spray chamber and nebulizer

drain

sample solution

Analytical Techniques in Forensic Samples  221 • In food and agricultural industries in identification of impurities or adulterants in food commodities, quantification of certain elements in food commodities. • Trace element detection from blood, urine, serum for either medical or forensic purposes. • Characterization of rocks and minerals based on their trace elements [4].

9.6 Laser Ablation–Inductively Coupled Plasma-Mass Spectrometry LA-ICP-MS is the modified version of ICP-MS, for elemental detection directly from the solid samples we can detect up to ppt to ppm-level (Figure 9.13). Neodymium Yttrium Aluminum Garnet laser is used to focus a UV radiation of 213 nm on the sample surface in an ablation chamber purged with Argon gas. This induces the formation of aerosol due to the absorption efficiency. The aerosols particles are then transferred to the ICP unit and get detected. Helium is used as ablation gas [35].

Monitor

Prism CCD Camera

Monitorized Zoom

Filter Beam Expander

Nd: YAG Laser

Objective lens

Energy Probe

Light Source

Solenoid valve To ICP

Air in Purge Tranlational Stage Polarized light source

Figure 9.13  Flow diagram of laser ablation [36].

222  Modern Forensic Tools and Devices The trace elemental detection by LA-ICP-MS provides rapid and lucid means for forensic sample analysis. The glass fragments can easily be identified from LA-ICP-MS as there is a minor difference in their elemental composition by different manufacturers which can be identified by this method. It enables accurate information [37].

9.7 Conclusion Analytical tools get moreover sophisticated with the increased use and the instruments are undoubtedly the major part of the forensic analysis as they provide the definitive results for individualization of evidences. As a lot of variations have been there in evolution in the techniques but the most modern analytical techniques like Gas chromatography–Mass spectrometry (GC/MS) or the Liquid chromatography–Mass spectrometry (LC-MS), Laser ablation inductively coupled plasma mass spectrometry (LA/ICP/ MS), Capillary electrophoresis (CE) are the mains and are extensively used. The primary tactics of the instruments are to expose the vital information of the analyte including its qualitative and quantitative analysis depending on the case. In some of the cases, the qualitative analysis i.e. individualization of the substance is sufficient such as in cases of controlled substances, but in most of the cases, quantitative analysis must be done to know the actual quantity of the analyte in the sample to prove the guilt of the individual. Analytical instrumentation advancement has helped in resolving the crimes. Modern instruments have the potential to work with the small amount of sample as the forensic samples often found in small quantity. As the evidence is to be made sure before bringing them in court and the analytical techniques justify the composition of the unknown sample upon the quality and the quantity. To get a very factual determination of the information regarding drug or alcohol or even the poison consumption whether in accidental or homicidal form as the analytical instruments are mostly used in toxicological analysis, these are considered to be the most relevant techniques. The total evolution and advancement in analytical techniques and skills has become the key to problem-solving which led to the use of it in other than forensic science laboratories such as gas, oil, pharmaceutical, and industries of food as well. The further development and advancement in the analytical techniques will strengthen different areas of chemistry including forensics by providing more efficient and precise results.

Analytical Techniques in Forensic Samples  223

References 1. Fisher, B.F., Forensic science, in: Edgar Allan Poe Context, pp. 363–371, 2009, https://doi.org/10.1017/CBO9780511844027.042. 2. Manimala, M. and Vijay, K.D., A review on forensic analytical chemistry. Pharmatutor, 5, 12, 2017. https://doi.org/10.29161/pt.v5.i12.2017.12. 3. Samal, N. and Padhee, S., Role of analytical instruments in forensic science: A pedagogical approach. IETE J. Educ., 60, 74–81, 2019. https://doi.org/10. 1080/09747338.2019.1670101. 4. Settle, F., Handbook_Instrumental_Techniques_Analytical_Chemistry.Pdf, 1998. 5. Coskun, O., Separation techniques: Chromatography. North. Clin. Istanb., 3, 6, 156–160, 2016. https://doi.org/10.14744/nci.2016.32757. 6. Al-Bukhaiti, W.Q., Noman, A., Qasim, A.S., Al-Farga, A., Gas chromatography: Principles, advantages and applications in food analysis. Int. J. Agric. Innov. Res., 6, 2319–1473, 2017. 7. Kupiec, T., Quality-control analytical methods: Gas chromatography. Int. J. Pharm. Compd., 8, 305–309, 2004. 8. Separations Science Gas Chromatography Solutions. Hot split injections-part 1 [WWW document], Sep. Sci., 2020. 9. Taha, S.M., An introduction to gas chromatography, in: Sample Introduction Systems in ICPMS and ICPOES I, pp. 1–12, 2018. 10. Hanafi, D.R., Lecture 9 Gas Chromatography ppt [WWW Document], Slide Play, New Cairo, Egypt, 2012. 11. Shimadzu, Basics & Fundamentals: Gas Chromatography, p. 21, Shimadzu, Kyoto, Japan, 2020. 12. Dr. Deepak, Selecting a suitable detector for gas chromatographic analysis. Lab-Training.com [WWW Document]. 2018. 13. Chromedia, n.d. ECD: Electron capture detector - chromedia. Chromedia Anal. Sci. http://www.chromedia.org/chromedia?waxtrapp=wbqucDsHqnOx mOlIEcCdCqBhBmB&subNav=qpbgcDsHqnOxmOlIEcCdCqBhBmBbC 14. Zuo, H.L., Yang, F.Q., Huang, W.H., Xia, Z.N., Preparative gas chromatography and its applications. J. Chromatogr. Sci., 51, 704–715, 2013. https://doi. org/10.1093/chromsci/bmt040. 15. Kitagawa, S., Liquid chromatography. Anal. Sci., 35, 949–950, 2019. https:// doi.org/10.2116/analsci.highlights1909. 16. Scherf-Clavel, O., Impurity Profiling of Challenging Active Pharmaceutical Ingredients without Chromophore, p. 194, zur Erlangung des der JuliusMaximilians-Universität Würzburg Oliver Wahl, Würzburg, Germany, 2016. 17. Rathore S., Mangal, S., Agdi, P., Rathore, K, Nema, R.K., Mahatama, O.P., An overview on dyslexia and its treatment. J. Glob. Pharma Technol., 2, 4, 18–25, 2014. 18. Arti, T., Ramni, K., Navneet, K., Ashutosh, U., Suri, O.P., High performance liquid chromatography detectors–a review. Int. Res. J. Pharm., 2, 1–7, 2011. 19. Babu, A.V.S., HPLC and LCMS–a review and a recent update performance. Int. J. Pharm. Anal. Res., 6, 555–567, 2017.

224  Modern Forensic Tools and Devices 20. Chasteen, T.G., Capillary electrophoresis. Food Toxic. Anal. Tech. Strateg. Dev., 1997, 561–597, 2005. 21. Group, P.D. and Pharmacopoeia, T.I., 1.17 Capillary electrophoresis 2018-07, pp. 1–8, Geneva, Switzerland, 2019. 22. Labgene Scientific SA, Qsep100 Capillary Electrophoresis System [WWW Document], Labgene Scientific SA, Châtel-Saint-Denis, Switzerland, 2020. 23. Xu, Y., Tutorial: Capillary electrophoresis. Chem. Educ., 1, 1–14, 1996. https://doi.org/10.1007/s00897960023a. 24. Gross, J.H., Mass Spectrometry, Springer, Berlin, Germany, 2004. 25. Honour, J.W., Benchtop mass spectrometry in clinical biochemistry. Ann. Clin. Biochem., 40, 628–638, 2003. https://doi.org/10.1258/000456303770367216. 26. Nageswaran, G., Choudhary, Y.S., Jagannathan, S., Inductively coupled plasma mass spectrometry, in: Spectroscopic Methods for Nanomaterials Characterization, vol. 2, pp. 163–194, 2017, https://doi.org/10.1016/ B978-0-323-46140-5.00008-X. 27. Pramanik, B.N., Lee, M.S., Chen, G., Characterization of Impurities and Degradants Using Mass Spectrometry, Hoboken, NJ, United States, 2011, https://doi.org/10.1002/9780470921371. 28. de Hoffmann, E. and Stroobant, V., Mass spectrometry, in: Methods in Molecular Biology, 2018, https://doi.org/10.1007/978-1-4939-7877-9_17. 29. Gates, P., Mass Spectrometry Facility, MALDI [WWW Document], University of Bristol, Bristol, UK, 2014. 30. Santoiemma, G., Recent methodologies for studying the soil organic matter. Appl. Soil Ecol., 123, 546–550, 2018. https://doi.org/10.1016/j.apsoil.2017.09.011. 31. Atomic Mass Spectrometry-ppt video [WWW document], slide Play, 2015. 32. Perkel, J.M., Mass spectrometry applications for proteomics. Scientist, 15, 31–32, 2001. 33. Skoog, D.A., Holler, F.J., Crouch, S.R., The Easy Guide To: Inductively Coupled Plasma Mass Spectrometery (ICP-MS), pp. 1–11, Boston, MA, United States, 2007. 34. Gilstrap, R., A Colloidal Nanoparticle Form of Indium Tin Oxide: System Development and Characterization System Development and Characterization, Presented to The Academic Faculty by Richard Allen Gilstrap Jr. In Partial Fulfillment of the Requirements for the Degree, Georgia Institute of Technology, Atlanta, USA, 2018. 35. Neufeld, L.M., Introduction to laser ablation ICP-MS for the analysis of forensic samples, pp. 1–6, Agilent Technologies Publication, 2004. 36. Sela, H., Karpas, Z., Zoriy, M., Pickhardt, C., Becker, J.S., Biomonitoring of hair samples by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). Int. J. Mass Spectrom., 261, 199–207, 2007. https://doi. org/10.1016/j.ijms.2006.09.018. 37. Dodds, A.J., Pollock, E.M.C., Land, D.P., Forensic Glass Analysis by LA-ICP-MS: Assessing the Feasibility of Correlating Windshield Composition and Supplier, Director. U.S. Department of Justice Office of Justice Programs, USA, 2010.

10 DNA Sequencing and Rapid DNA Tests Archana Singh1 and Deepak Rawtani2* School of Engineering and Technology, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 2 School of Pharmacy, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India

1

Abstract

The perspective of double-helix Deoxyribonucleic acid (DNA) was explained by Watson and crick in 1953. The attribute of DNA is the arrangement of four nucleotides. The organization of adenine (A), thymine (T), guanine (G), or cytosine (C) bases is called DNA sequencing. Numerous methodologies utilized for sequencing DNA samples are Maxam and Gilbert method, pyrosequencing, the whole genome shotgun sequencing method, chain termination method, automated method, clone by clone sequencing method, semiautomated method, next-generation sequencing method. The analysis used for DNA profiling is restriction fragment length polymorphism (RFLP) analysis, polymerase chain reaction (PCR) analysis, short tandem repeats (STR) analysis. Other analyses like amplified fragment length polymorphism (AFLP), mitochondrial DNA (MT-DNA) analysis, Y-chromosome analysis, and DNA extraction are used for DNA profiling. The above approaches are utilized for resolving criminal cases by analyzing forensic DNA evidence found at the crime scene. However, this course of action is time-consuming and costly. The Federal Bureau of Investigation (FBI) established the Rapid DNA test in 2010 for sequencing DNA in less amount of time. Thus, it is an alternative to DNA sequencing methods because of its immense characteristics like cost-effectiveness, robustness, and rapidness. Keywords:  Deoxyribonucleic acid (DNA), DNA sequencing, Rapid DNA test, ANDE, RapidHit

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (225–264) © 2023 Scrivener Publishing LLC

225

226  Modern Forensic Tools and Devices

10.1 Introduction Deoxyribonucleic acid (DNA), a hereditary [1], and self-replicating [2] material exist in nearly all mortal beings. DNA is a nucleic acid and it serves as a blueprint for life [3]. DNA is an assembly of chemical building blocks known as nucleotides [4]. There are four nucleotides, each nucleotide consists of a nucleobase either adenine (A), thymine (T), guanine (G), or cytosine (C) [5]. DNA is a double helix [6] with two complementary strands [7] that sprint in the opposite direction [8]. Sequencing of DNA is done to determine the precise order of four bases in a single piece of DNA [9].

10.1.1 DNA Sequencing The Maxam-Gilbert and Sanger method are the two approaches that were developed in the mid-1970s after the discovery of the DNA structure [10]. Prior to the formation of the Maxam-Gilbert sequencing technique, no sequencing technique was reported by which one could directly sequence DNA. The concept of DNA sequencing is used for detecting mutation [11], identifying human haplotypes [12], designating polymorphisms [13] for deciphering the code of life [14]. Donating the features of scientific techniques in a criminal investigation is what we call forensic science [15]. Here, DNA is a crucial material and DNA sequencing plays a significant role [16]. The traditional methods and theories (classical theory, positivist theory, social disorganization theory, and rational choice theory) are not applicable today as we progress into the more sophisticated era the criminals are adapting to newer and smarter technologies while the government is still following the traditional method of analysis. This has created a massive rift between the progression and resolution of the crime. This problem can be resolved by adapting the new emerging technologies such as DNA profiling, sequencing, and Rapid DNA test. DNA is an important biological material that can be extracted from liquid blood [17], liquid semen [18], hair (with root) [19], urine [20], bone [21], tissue [22], saliva [23]. Assemblage, arrangement, shape elucidation, and dispensation of blood splatter are the steps involved in the Bloodstain pattern analysis (BPA) method [24]. Semen is a greyish body fluid used for the identification of the culprits. It can be found at the crime scene in cases like sexual assault or rape. Semen is stored in a liquid state at 10-15°C [25].

DNA Sequencing and Rapid DNA Tests  227 Saliva is prominent as well as a strenuous element/evidence in numerous crimes like drug abuse, sexual assault, and animal biting. Any cloth or apparel present at the crime could have sweat or dry stain of sweat on the backside of cloth, alongside the armpit, and neck region. The sweat identification becomes quite hard and heating the cloth or apparel produces a distinctive odor that confirms the presence of sweat [26]. It is difficult to identify as it is a colorless stain but can be easily visualized by ultraviolet rays and other light sources [23]. Urine is a fluid upshot of metabolism consists of salt, water, electrolytes, and chemicals. It is one of the challenging pieces of evidence present at the crime scene as its cell can be destructed and DNA can be degraded due to no addition of preservatives, keeping it for many days without analyzing it, stepping on it during the collection process. Hence, the collection of urine requires more attention. It can be collected by pipet, cotton, or swab [27]. The other evidence that can be found on the crime scene are tears which fall under the three categories such as basal, emotional, and reflex tears. These are classified on the basis of their compositions [28]. Vaginal secretions like skin cells or pubic hairs require more effort and attention to avoid loss of evidence during the collection process [29]. Hair is a simple and thin structure classified into two types – i) ­surface hair ii) hair that emerges from the skin and their identification at the crime scene is quite hard as the hair is lighter in weight and not easily visible with naked eyes [30]. The biological evidence found at the crime scene are first documented, collected, preserved, and then transferred to laboratory for the sequencing process. To maintain the integrity of evidence, chain of custody, validity, and reliability of the evidence, the proper care and handling is required [31]. The sequence of DNA are obtained by analyzing a series of short tandem repeats (STR) markers by implementing capillary electrophoresis [32] but STR can’t provide an outcome and may link biological evidence to multiple individual because of the degradation of sample, low quantity of sample, no STR match availability in database of DNA, and low resolution STR examination. To overcome such limitations DNA sequencing is done to identify the criminals [33]. Several DNA sequencing methods like Maxam and Gilbert method, pyrosequencing, the whole genome shotgun sequencing method, chain termination method, automated method, clone by the clone sequence method, semiautomated method, next-generation sequencing method were explained [34]. However, the above

228  Modern Forensic Tools and Devices approaches involve various primers, reagents, and it is a ­multiple-step process which involves different instruments.

10.1.2 DNA Profiling Analysis Methods Numerous analysis methodologies like restriction fragment length polymorphism (RFLP) analysis [35], polymerase chain reaction (PCR) analysis [36], short tandem repeats (STR) analysis [37], amplified fragment length polymorphism (AFLP) [38], mitochondrial DNA (mt-DNA) analysis [39], Y-chromosome analysis [40], and DNA extraction [41] have been evolved for DNA profiling.

10.1.3 The Rapid DNA Test The discovery of the “Rapid DNA test” is an impactful innovation in the field of forensic science [42]. A Rapid DNA test is a process in which DNA profiling is done without human interceding and it is the fastest DNA profiling process [43]. The Rapid DNA strategy was established by the Federal Bureau of Investigation (FBI) in the year 2010 [44]. It involves steps like self-regulating extraction, amplification, separation, detection, and allele calling within an instrument designed for Rapid DNA analysis [45]. The intention behind the evolution of the Rapid DNA test is to sequence DNA with great efficiency. It is an expeditious process and can sequence a large amount of DNA [46]. The act of 1994 was amended and on 18 August 2017, the Rapid DNA act was passed by the Senate and US house. The concept behind approving the act is to reduce crime and permit the police to do DNA testing outside the laboratory. This process does not involve any laboratory processing which in turn makes this process faster and reliable [47]. This chapter will provide information about DNA. DNA is a hereditary material as it carries all the genetic information stated by Avery, Macleod, and McCarty in 1944. It is a highly programmable material consisting of four nucleotides and its structure was explained by Watson and crick in 1953. The forensic evidence like bone, blood, tissue, saliva, sweat, hair, tears present near the crime scene consist of DNA. For the identification of the culprits, the forensic DNA evidence is sequenced and compared with the sequenced DNA sample of the culprits. Numerous DNA sequencing methods like Maxam and

DNA Sequencing and Rapid DNA Tests  229 Gilbert method, pyrosequencing, the whole genome shotgun sequencing method, chain termination method, automated method, clone by the clone sequence method, semiautomated method, next-generation sequencing were developed. The first DNA sequencing method was developed in the year 1970. For the DNA profiling of the forensic evidence, various methodologies were evolved such as restriction fragment length polymorphism (RFLP) analysis, polymerase chain reaction (PCR) analysis, short tandem repeats (STR) analysis, amplified fragment length polymorphism (AFLP), mitochondrial DNA (mt-DNA) analysis, DNA extraction, and Y-chromosome analysis. However, the above approaches consume more time and resources, and to overcome such obstacles the Rapid DNA analysis was evolved (Figure 10.1). This chapter also aims to provide a short overview of the Rapid DNA test. It was fundamentally established in the year 2010 by the Federal Bureau of Investigation (FBI). This technique is rapid, robust, and cost-effective. This technique is used for solving paternal disputes and forensic cases such as sexual assaults, rapes, murders, drug-facilitated sexual approaches. Various amendments were made in the laws to allow the Rapid DNA test outside the laboratory. Numerous Rapid DNA test instruments or kits have evolved for example – RapidHit® ID, ANDE, ANDE 4C, ANDE 6C consist of three elements – buccal swab, A-chip, instrument. Owing to the automation and no laboratory processing of the Rapid DNA test the criminal investigation became faster and adequate.

DNA sequencing Unearthing forensic DNA evidence

Analysis of sequenced forensic DNA

Documentation of forensic DNA evidence Collection of forensic DNA Evidence

Rapid DNA test

Figure 10.1  The procedure involved throughout the criminal investigation.

Analysis of sequenced forensic DNA

230  Modern Forensic Tools and Devices

10.2 DNA – The Hereditary Material For countless years DNA remained a vague molecule within the nucleus with various properties and structural information [48]. The young Swiss physician Friedrich Miescher obtained the 1st crude purification of DNA which led to the examination of the configuration and properties of the genetic material [1]. He named this substance “nuclein” and today it is recognized as Deoxyribonucleic acid (DNA) [1]. DNA is the hereditary material was stated by Avery, Macleod, and McCarty in the year 1944, and the structure was explained by Watson and crick [49]. The similarity in the human genome is approximately 99.5% when compared within a large sample of the human population [50]. DNA is a highly programmable and organized structure consist of four nucleotides ATGC. These ATGC forms contrasting combinations lead to the formation of genetic codes [51]. Genetic codes contain genetic information [52].

10.2.1 DNA – Structure and Genetic Information Watson and Crick explained the double helix arrangement of DNA in the year 1953 [53] before that scientists used to say that the structure of DNA was extremely uniform however, the DNA structure is hardly monotonous and uniform [54]. Bases play an important role and undergo chemical modification. The DNA structure physically contains all the important atoms present on the bases. On the outer side of DNA, it has a phosphate backbone and on the inner side, it has a hydrogen bond [55]. Watson and Crick stated that DNA is a double-helical structure where each helical turn consists of 10.5 base pairs [56]. Each helical turn is 360° and due to this, the twist rotation for per residue is 37.5Å between adjoining base pairs. The interspace between the two base pairs is 3.4Å and the incline in the base pair is around -6°. the diameter of the DNA helix is about 23Å [57]. It is relevant to know every single component of DNA to perceive the structure of the DNA. A phosphate group [58], ribose sugar [59], and aromatic bases is a component of DNA together with the phosphodiester bond [60]. Any changes in the component of DNA lead to changes in the structure of DNA. The dynamic molecule – DNA comprises of four nucleotides i.e., adenine (A), thymine (T), guanine (G), or cytosine (C). The revelation of genetic codes is one of the greatest discoveries in molecular biology. The

DNA Sequencing and Rapid DNA Tests  231 different arrangement/combination of four nucleotides results in the formation of genetic codes [61]. Genetic codes consist of 3 nucleotide bases counted as triplet encodes amino acids [62]. There are 20 amino acids and 64 attainable codons out of which three do not code for an amino acid. Each triplet or codon encodes a single amino acid [63]. Any alteration in the genetic codes will provide information about any inappropriate activity or issue occurring inside the body. Alteration in the genetic codes may cause diseases like cancer [64], low production of insulin [65], mutation [66].

10.3 DNA Sequencing DNA sequencing is the process in which the sequence of nucleotide is determined present within the DNA molecule. The alteration such as addition, deletion, substitution in the nucleotide sequence is the main reason behind human pathological conditions (cancer, AIDS, genetic disorders). The alterations in the nucleotide sequence are identified by DNA sequencing hence, it becomes important to decipher DNA sequencing. Forensic DNA evidence is sequenced to obtain genetic information and DNA sequencing which helps in resolving criminal cases such as murders, sexual assault, rape [67]. After the discovery of the three-dimensional structure of DNA [68], many other frameworks and discoveries took place. However, no sequencing information was available for some time. A great deal of time and resources were invested by the researchers to develop the method or technology for sequencing DNA fragments [69]. Tactics such as “plus and minus” were developed to sequence DNA but failed due to the similar and repetitive units which become quite difficult to differentiate. In the year 1965, the nucleic acid of saccharomyces cerevisiae was sequenced by Robert Holley and co-workers. Among different methods and techniques, the revelation of the dideoxy technique or sanger’s chain-termination in 1977 was an important breakthrough [10]. As time is increasing, the development is in every single field which also took place in the field of DNA sequencing. The different methods developed to sequence DNA are Maxam and Gilbert method [70], pyrosequencing [71], the whole-genome shotgun sequencing method [72], chain termination method [73], automated method [74], clone by

232  Modern Forensic Tools and Devices 1977

Chain termination method

1977

1982

Pyrosequencing

Whole-genome shotgun sequencing method

1985

1986

Automated method

Maxam and Gilbert method

Semiautomated method

1987

2005

New generation DNA sequencing method

Figure 10.2  The classification of DNA sequencing.

the clone sequence method [72], semiautomated method (Figure 10.2) [75], next-generation sequencing [76] method briefly explained below.

10.3.1 Maxam and Gilbert Method In 1977 the Allan Maxam and Walter Gilbert discovered a DNA sequencing procedure also recognized as a chemical degradation method comprised of piperidine and two chemicals involving pyrimidine and purine [77]. This is a method in which the DNA fragment is sequenced by the action of chemicals and enzymes. It is a multistep process which is briefly explained below (Figure 10.3)• End labeling – it is a rapid and sensitive method utilized to label DNA fragments in order to visualize small and large fragments of DNA [78]. In this step, the DNA is labeled with a radioactive isotope at both the edges [79]. The isolation of the DNA segment is done on which radioactive isotope phosphate (p32) replaces the phosphate group situated at 5’ by alkaline phosphatase action which ultimately gives dephosphorylated DNA molecule [80]. • Restriction enzyme digestion – the role of the restriction enzyme is to cleave the DNA at various points. The adenosine triphosphate (ATP) consists of radioactive p32 led to the

DNA Sequencing and Rapid DNA Tests  233 5' 3'

3' 5' dsDNA DEPHOSPHORYLATION ALKALINE PHOSPHATASE

ATP ADP

POLYNUCLEOTIDE KINASE 3' -OH P RESTRICTION ENZYME 3' -OH P DENATURATION

P 3' P 3'

P 5' - GAATTCGAATTC -3'-OH

3' -OH 5' -OH

P END LABELED ssDNA P 5' - GAATTCGAATTC -3'-OH

G

A+G

C+T

C

ADDITION OF CHEMICALS LARGE12 SIZE 11 10 9 8 7 6 5 4 3 SMALL 2 SIZE 1

C T T A A G C T T A A G

SEQUENCE

OH- 5' OH- 3'

Figure 10.3  The process of Maxam and Gilbert approach.

addition of radioactive isotope phosphate on 5’ by polynucleotide kinase. Restriction enzyme cuts and denatures the DNA [81]. • Chemical degradation – copies of DNA are taken in four reaction tubes in which chemicals like dimethyl sulfate with heat, dimethyl sulfate in formic acid, hydrazine, and hydrazine with 2M sodium chloride (NaCl) are added. The modification of sequence done by these chemicals which are recognized by piperidine which further removes the bases [82]. • Gel electrophoresis – the DNA bands are separated on the basis of dimension and magnitude. The separation is visualized by a technique that locates a radioactive substance known as autoradiography. • Sequence determination – the complete DNA sequence of the sample is obtained or determined. The limitation of this method is it can sequence up to 500 base pairs and utilizes toxic chemicals and radioactivity [83].

10.3.2 Chain Termination Method or Sanger’s Sequencing A great method was developed by Frederick Sanger. Instead of using chemical cleavage reactions, Sanger developed a method that consists of the

234  Modern Forensic Tools and Devices third form of ribose sugar [84]. This procedure is also known as dideoxy sequencing or Sanger DNA sequencing. It involves various steps which are elucidated below (Figure 10.4)• Heat denaturation – owing to an increase in temperature the double-stranded DNA (dsDNA) is converted into ­single-stranded DNA (ssDNA) [85]. • Primer annealing – for the polymerization to take place the radiolabeled primer is attached to a DNA template [86]. • Chain termination reaction – ssDNA with radiolabeled primer is added into four divergent responsive tubes [73] along with DNA polymerase and four different dNTPs (dATP, dCTP, dGTP, dTTP) to stop polymerization. • Denaturation and visualization – the next step is the denaturation of newly synthesized fragments followed by gel electrophoresis. The band is visualized through the assistance of autoradiography [87]. • Sequence determination – the complete sequence of the sample is obtained. The limitation of this method is it can only sequence up to 900 base pairs, high cost [88], and time-consuming process [89].

5' 3'

dsDNA

3' 5'

Heat denaturation

Radiolabelled primer annealing

Templated DNA ATGCATGC

ddATP

ddGTP

ddCTP

ddTTP

5'-TA 5'-TACG 5'-TAC 3'-ATGCATGC 3'-ATGCATGC 3'-ATGCATGC 5'-TACGTA 5'-TACGTACG 5'-TACGTAC 3'-ATGCATGC 3'-ATGCATGC 3'-ATGCATGC

ssDNA

3'

~DNA polymerase ~dNTPs

5'

8 7 6 5 4 3 2 1

ddATP

ddGTP

ddCTP

Figure 10.4  Sanger’s or chain termination sequencing methodology.

5'-T 3'-ATGCATGC 5'-TACGT 3'-ATGCATGC

ddTTP 3'

G C A T G C A T 5'

DNA Sequencing and Rapid DNA Tests  235

10.3.3 Automated Method The automated DNA sequencing is similar to the Sanger sequencing method however, the observation or identification is different. The automated method was discovered to overcome the limitations of the chain termination mechanism. It can sequence up to 500 base pairs in 5 hours. [90]. It involves the following steps: • Heat denaturation – the double-stranded DNA is converted into single-stranded DNA by the mechanism of melting or heating. Then the primer is attached to the DNA template. After this, DNA polymerase and deoxyribonucleotide (dNTPs) are added [91]. • Fluorescent tagging – the very next step is the addition of Dideoxy ribonucleotide (ddNTP). The ddNTP are tagged with different fluorescent colors such as ddATP-green, ddGTP-yellow, ddCTP-blue, and ddTTP-red. The next step is chain termination. • Gel electrophoresis – here, capillary gel electrophoresis of the sample is done to separate DNA on the basis of their sizes. There is a production of rays that falls on the detector resulting in auto-generated sequences of the sample. • Sequence determination – the DNA sequences are obtained by analyzing chromograph [92]. The limitation of this approach is it can only sequence up to 5 to 10 kb long fragments, it is difficult to automate, and it is a slow process. The advantages of this process are it has the ability to sequence highly repetitive regions and also reduces the workload.

10.3.4 Semiautomated Method The semiautomated method was developed in 1986. The semiautomated DNA sequencing procedure is used in clinical microbiology laboratories [93]. This procedure is similar to automated DNA sequencing because of the procedure which is briefly elucidated below• Heat denaturation – the double-stranded DNA is converted into single-stranded DNA by applying high temperature to the sample. After this, DNA polymerase, dNTPs, and ddNTPs (tagged with fluorescent) are added.

236  Modern Forensic Tools and Devices • Gel electrophoresis – gel electrophoresis is done to separate DNA bands on the basis of size. • Data interpretation – the concluding step includes the data interpretation which is acquired directly on a computer that provides rapid and correct information and then sequencing of DNA takes place [94]. In this particular process, radioactivity is displaced by fluorescent which provides supplemental knowledge and greater size resolution. The semi-automated system consists of one thermocycler, two automated laser fluorescence sequencer, and one robot workstation can sequence 20000-30000 nucleotides per day. It is utilized to sequence large DNA segments [75]. The semi-automated fluorescent-based technique carries characteristics like accuracy, cost-effectiveness, and efficiency. This method is used in various fields such as genomic-analysis, forensic, cancer genetics, linkage studies, cytogenetics, and pattern of chromosome [95].

10.3.5 Pyrosequencing Method The pyrosequencing method resembles Sanger DNA sequencing [88]. It includes a combination of four different enzymes. It is based on the sequencing-by-synthesis method that incorporates the luminometric detection of pyrophosphate (PPi) upon nucleotide [96]. This method was discovered in 1985 which includes liquid phase and solid phase pyrosequencing. Four enzymes Klenow fragment of DNA polymerase I, luciferase, apyrase, and ATP sulfurylase participate in this reaction [97]. In the reaction mixture substrate like D-luciferin primer annealing and adenosine phosphosulfate (APS) are added for polymerization. Four nucleotides are added in the reaction chamber (at a time only one nucleotide) in a cyclic manner. Afterward, there is a production of light detected by the CCD detector camera. A further step in the sequence determination [98]. It can sequence up to 20 bases. For the detection of polymorphic positions, tag sequencing, and microbial typing pyrosequencing method has been utilized. It is a sequencing technology monitored by bioluminescence [99]. It is a valuable approach for oncogene detection in tumors, human genetic testing, methylation analysis, confirming mutations, and for identifying ambiguous Sanger sequencing mutations. It can differentiate between one dinucleotide substitution

DNA Sequencing and Rapid DNA Tests  237 and 2 adjacent single-base substitutions and between the cis- and transthe configuration of closely juxtaposed mutations [100].

10.3.6 Clone by Clone Sequencing Method It is a process in which the chromosomes were mapped and afterward get divided into sections. These sections are further split into smaller bits and overlapping bits by themselves. The smaller bits are sequenced, whereas the role of the overlapping bit is to put the genome back again. The DNA sequence is derived from a known region so it is quite reliable to arrange them and determine where the gap is present in the sequence. However, the assembly of a short region of DNA is quite firm. This method is costly and time-consuming.

10.3.7 The Whole-Genome Shotgun Sequencing Method Fred Sanger in the year 1982 evolved the whole-genome shotgun sequencing procedure as an alternative to the clone by clone method. This approach includes random primers to deal with overlapping regions [101]. This mechanism is a strategy for sequencing DNA molecule or whole-genome which involves steps like DNA fragmentation, agarose gel electrophoresis, DNA

DNA FRAGMENT

SEQUENCED DNA FRAGMENT

TACTGTTACGTACATGCAGT ATCGGTACCGTAGGTATGCCC OVERLAPPING DNA TGCCCTGAACTAGGATACTG FRAGMENTS ATCGGTACCGTAGGTATGCCCTGAACTAGGATACTGTTACGTACATGCAGT ASSEMBLED GENOME SEQUENCE

Figure 10.5  Whole-genome sequencing process.

238  Modern Forensic Tools and Devices purification and modification, cloning, and sequencing [102]. This approach provides numerous advantages over clone by clone sequencing mechanism for instance-rapidness, cost-­effectiveness, and polymorphism detection in large quantities (Figure 10.5) [72].

10.3.8 Next-Generation DNA Sequencing Next-generation DNA sequencing is also called massively parallel sequencing [103]. It can sequence a large amount of DNA as it involves two methods, whole-genome sequencing, and whole-exome sequencing based on new technologies [104]. It is less time-consuming and cost-effective. This technique has relevance in the field of forensics as it requires less amount of DNA as compared to other approaches [105]. The four new sequencing procedures are Micro electrophoretic methods, sequencing by hybridization, real-time detection of single molecules, and cyclic-array sequencing. It has an application in biomedicine and drug discovery. Next-generation involves three steps which involve fabrication of library, sequencing, and data exploration [106]. This approach provides precise and authentic results along with high-­quality exome sequencing [107].

10.4 Laboratory Processing and DNA Evidence Analysis After the collection of DNA evidence, they are brought to forensic laboratories for DNA profiling [108]. There are several sections in a forensic science laboratory that especially deal with DNA analyses, examples include the biological section [109], chemistry section [110], DNA section [111], and toxicology section [112]. For no degradation and contamination of the samples, it is important to handle the sample with proper care [113]. Gloves, covered hair, avoiding chemical exposures, protective coats, and protective eyewear should be used during the analysis of the sample in order to avoid contamination and degradation [114]. The analysis of DNA evidence is done by some approaches which provide DNA profiling and helps in solving criminal cases. The different analysis or DNA profiling methods are restriction fragment length polymorphism (RFLP) analysis, polymerase chain reaction (PCR) analysis, short tandem repeats (STR) analysis, amplified fragment length polymorphism  (AFLP),

DNA Sequencing and Rapid DNA Tests  239 mitochondrial DNA (MT-DNA) analysis, Y-chromosome analysis, and DNA extraction.

10.4.1 Restriction Fragment Length Polymorphism For the detection of mutations or sequencing DNA, restriction fragment length polymorphism is used, and this approach has been derived from DNA profiling or DNA fingerprinting. The first step of this method is the extraction and purification of DNA. The next step is the formation of a DNA fragment by the action of the restriction enzyme. Agarose gel electrophoresis is done to separate the DNA fragments based on their size or length. The gel is relocated to a membrane and combined with a hybridization probe. Hybridization of corresponding DNA occurs which results in a restriction map [115]. This process is time-consuming as well as subjected to more workers [116]. High specificity and great reproducibility are the characteristics of RFLP (Figure 10.6) [117].

10.4.2 Polymerase Chain Reaction (PCR) In this methodology, amplification or cloning of a short DNA strand is done. This method is utilized for the detection of diseases. For analyzing the small amount of genetic material PCR is used so that it can amplify the small amount of sample collected from the crime scene which can be used in numerous testing. There are three steps involved in PCR [118],

1

2 3

4

DNA Extraction

PCR with labeled primers

2 4 1 3 6 8 5 9 7 10

6

5 7

Electrophoresis seperation

8

Digestion with restriction enzyme 3

5

Lazer detection 1 7

Figure 10.6  RFLP methodology.

240  Modern Forensic Tools and Devices first is denaturing where the DNA sample is heated for the 90s at 94°C for separating complementary strand, annealing involves cooling for 2 min at 55–65°C for primer binding, and in the last step, the primer is extended on the DNA strand for 3 min at 72°C by Taq polymerization and this process is called polymerization [119]. In 1985 PCR was evolved and came out as a sturdy approach. Genetic engineering, cell biology, food microbiology, biotechnology, microbiology are the fields in which PCR acts as an essential tool (Figure 10.7) [120]. The very famous PCR includes three different categories - quantitative PCR (qPCR) [121], digital PCR (dPCR) [122], and End-type PCR (Figure 10.8) [123].

PRIMER

DOUBLE_STRANDED DNA

DENATURING STAGE 94ºC

EXTENDING STAGE 72ºC

ANNEALING STAGE 55-65ºC

Figure 10.7  Procedure of PCR. Mastercycler PCR Gradient PCR

Real time PCR

Polymerase chain reaction (PCR)

Next-generation PCR

Reverse-transcriptase PCR

Nested PCR

Laser PCR Multiplex PCR

Figure 10.8  Types of PCR.

DNA Sequencing and Rapid DNA Tests  241

10.4.3 Short Tandem Repeats (STR) STR plays the important role in cases like paternity, rapes, sexual assault owing to markers of STR used for the identification of humans. Markerassisted selection, identification of species, DNA fingerprinting, disease transmission are studied by STR and it also plays an important character in gene expression, transcription, and many other biological procedures [124]. The number of repeats varies from individual to individual which allows the identification of criminals in numerous forensic cases. Owing to the presence of STR within the locus, variation in the nucleotide can be detected which varies from individual to individual. Hence, this mechanism is utilized for recognizing individuals. This detection is done with PCR and capillary electrophoresis [125]. STR consists of 3–7 base pairs which are repeated multiple times, for instance, AATGAATGAATGAATG. Herein, extraction of DNA is done and STR alleles are formed. After this, the gel electrophoresis is done for separating DNA, and finally, the data is obtained which is compared to the suspect’s DNA sequences. Hence, STR analysis resolves criminal investigation [126]. STR profiling is an effective and efficient process [127].

10.4.4 Mitochondrial DNA (mt-DNA) Mitochondria is present in all cells and contains its DNA [128]. It’s the most prevalent and effective approach. Mitochondrial DNA is a great innovation in progressive biology and is used for evaluating genetic variation, recognizing different population individuals, and conservation of the population [129]. Over 25 years mt-DNA is providing information to scientists and researchers about mitochondrial DNA [130]. The discovery of mt-DNA was developed in 1980 and the entire sequence was explained in 1981. Anderson et al. in 1981 for the first time reported the sequence of the mitochondrial DNA genome of humans. Its size is around 16,569 bp. It is more robust and has a higher number of copies per cell which makes it easy to recover and sequence as compared to nuclear DNA. It consists of heavy and light strands also known as purinerich strands and a pyrimidine-rich strand [131]. Mitochondrial DNA is present in all body tissues also in the tissues which do not have cells and can survive in ambient conditions as they are protected inside the cell. Mitochondrial DNA is an important element in forensic studies used in the study of tooth tissues, bones, follicles [132]. It is a circular DNA

242  Modern Forensic Tools and Devices exhibits maternal inheritance [133], no recombination [134], and weak replication repair [135]. The mt-DNA procedure is used for a degraded or low-quality sample because of the availability of 1000 copies of mt-DNA in each cell. It involves four major steps in this mechanism namely DNA extraction, annealing of DNA by PCR, sequencing of DNA, comparison of known and unknown data. Many new mt-DNA laboratories are established for DNA profiling which will help in the identification of criminals. The mt-DNA produces a similar sequence which is compared to the suspect’s sequences [115].

10.4.5 Amplified Fragment Length Polymorphism (AFLP) AFLP was first described by Vos and Zabeau in 1993. It plays an important role in the genetic and molecular field, genetic classification, linkage maps, traits mapping, and identifying parentage [136]. AFLP offers several advantages such as the polymorphism band rate is high, the reproducibility rate is high. It is based on PCR and RFLP. This process is performed to know whether the two organisms are from the same species or not [137]. A high multiplex ratio categorizes AFLP. However, this process is not widely used [116]. AFLP is a vigorous, dependable, and efficient approach that detects 50-100 DNA fragments. It involves three major steps namely (i) DNA restriction and ligation, (ii) amplification of DNA fragments, (iii) gel electrophoresis of DNA fragments. The first step involves the restriction of endonucleases like four-base cutter MseI and six-base cutter EcoRI for digestion of DNA. Two different adaptors (short double-stranded DNA with sticky ends) are ligated to the digested fragments. Further, one adapter will complement with MseI and others will complement with EcoRI. The selected fragments are amplified and separated by polyacrylamide gel electrophoresis. Different subsets of the genome are amplified by repeating amplification for the second time with other primers. The next step is gel electrophoresis in which polyacrylamide gel is used for separating DNA bands [138]. Many loci are simultaneously analyzed high reproducibility are the advantages of AFLP and the limitation of AFLP is it is a complex process.

10.4.6 Y-Chromosome The sex-determining chromosome is Y [139]. Y chromosome comprises of two classes namely Y chromosome single nucleotide polymorphism (Y-SNPs) and short tandem repeats (Y-STRs) [140]. The

DNA Sequencing and Rapid DNA Tests  243 DNA Commission of the International Society of Forensic Genetics (ISFG) published about Y-chromosome polymorphism with emphasis on short tandem repeats (STRs) in the year 2001. After this Y-STRs has gained popularity and various new loci have been introduced [141]. A microsatellite is another name of Y-STRs that had an impact-full role in forensics, genealogical, evolutionary studies [142]. This approach is used to identify the male component in the sample when there is the availability of a large no of female components and it also helps in the identification of parent’s relationships [143]. Y-STRs are formed by the combination of the Y chromosome and short tandem repeats. STR is situated in a non-coding area whereas autosomal STRs are located outside of the bogus-autosomal part. Y-STR procedure is beneficial in the criminal investigation as it can identify the male DNA in the mixture of male and female DNA and conduct “conventional DNA analysis”. Hence, a complicated case like rape can be solved [144]. Sometimes differential extraction does not work in situations like old evidence, aspermatic males, sperm cells on treated slides, and degradation of sperm cells. This approach is useful in cases like male or female bloodstain mixtures, fingernail scrapings, vaginal swabs containing saliva, and male/male mixture. Disadvantages of Y-chromosome include a similar Y-chromosome pattern in the case of paternal relatives and it is more susceptible to duplications and deletion. The European, American, and Asian databases “Y-STR Haplotype Reference Database” consist of nine minimal haplotype markers and recently described markers- DYS437, DYS447, DYS448, DYS449, DYS456, DYS481, DYS504, DYS510, DYS518, DYS532, DYS536, DYS542, DYS552, DYS562, DYS576, DYS587, DYS612, DYS626, DYS644, DYS710, and Y-GATA-H4. They are utilized in the forensic field for providing higher discrimination at a lower cost [145, 146].

10.5 Rapid DNA Test Earlier numerous approaches developed for sequencing DNA namely Maxam and Gilbert method, pyrosequencing, the whole genome shotgun sequencing method, chain termination method, automated method, clone by the clone sequence method, semiautomated method, next-­ generation sequencing method. However, the above process is time-­ consuming, costly, involves multiple steps, and requires many workers. To overcome the above limitations the Rapid DNA test was evolved. The Rapid DNA test approach is fully automated and requires around two

244  Modern Forensic Tools and Devices hours for DNA profiling. The Rapid DNA test is performed on various samples namely tissue, muscle, bone, liver, tooth, brain [42]. Multiple types of research and modification have been done to develop a cost-­ effective and less time-consuming method that can sequence a large amount of DNA. The rapid DNA test was evolved successfully for DNA sequencing [46]. Rapid DNA analysis/test comprises of two elements(i) Rapid DNA profile prospect, (ii) threshold level of Rapid DNA test. According to a survey, the success rate of a laboratory for the sample is 90% and the Rapid DNA success rate is 85% due to the sensitivity of the Rapid DNA test. Hence, the Rapid DNA test is less sensitive as compared to laboratory processing [147]. For the identification of the criminal, the reference DNA sample is compared with the suspect’s sequenced DNA sample. Mobile Rapid DNA is utilized by the police to sequence DNA in the police station. However, the result is verified by forensic DNA laboratories [148]. The Rapid DNA test involves characteristics like high-throughputs and cost-effectiveness [149], great efficiency. It is a speedy approach that permits the sequencing of a fragment of DNA in a couple of hours. The utilization of Rapid DNA tests in the forensic sector is advantageous because its rapidness and efficacy are greater as compare to other DNA sequencing methods. After the act of 2017, the Rapid DNA test can be performed outside the laboratory in situations like paternity testing or criminal cases. In cases like murder, sexual assault, and rapes this method allows the police to examine the DNA sequence without taking it to the laboratory which makes the investigation faster and adequate [47]. The blood, tears, semen, saliva, nasal secretions, and other biological samples can’t be processed in Rapid DNA instrument because the variables such as quality, quantity, sample nature, subjection, and duration of the sample in samples are different under different conditions. The most important reason among all of them is the sample can contain a mixture of two or more than two individuals’ DNA. Hence, it requires experienced scientists so that no problem or issue arises in the future regarding criminal cases (“Rapid DNA – FBI,”).

10.5.1 The Evolution of the Rapid DNA Test Short tandem repeats (STR) are utilized in different fields like in the military [150], for identification of the victim [151], law enforcement, paternity testing [152]. STR plays an important role in the sequencing of DNA [153]. However, the respective procedure is time-taking [154], quite a costly process, and can only sequence few base pairs at a time.

DNA Sequencing and Rapid DNA Tests  245 To overcome the above issues an alternative was developed named the Rapid DNA test. The collaboration occurred between the Federal Bureau of Investigation (FBI), the Development of Homeland Security, and the Department of Defense to establish the identification system of rapid DNA in 2010 The Rapid DNA index system (RDIS) was established by the FBI to execute rapid DNA test outside the laboratories [155, 156]. The act of 1994 was amended and on 18 August 2017 where the Rapid DNA act was passed by the Senate and US house [157, 158]. The concept behind this act was to reduce crime and allow the police to do DNA testing outside the laboratory. The police can use a Rapid DNA approach/­ instrument for sequencing the DNA of suspects at the police station in cases such as rape, murder, and many more, and this makes the process faster and does not require laboratory processing [47]. The Rapid DNA maturity assessment is passed in 2018 to implement the use of the Rapid DNA approach outside the laboratory such as in police stations, traders, agencies [159].

10.5.2 Rapid DNA Instrument DNA is a source to identify the criminal in cases like rape, sexual assault, murder, drug-facilitated sexual approach. The advantage of using the Rapid DNA test that it is a reliable, fast, less time-­consuming, and automated process. ANDE is an instrument of Rapid DNA test configured with System Software version 2.0.6 and Expert System Software 2.0.5. This instrument is capable of purifying the samples; however, they are not utilized for this purpose. It is a bench-top instrument that consists of three elements: A-C hip, instrument, and swab. A-C hip is used once, it is disposable, and materials/reagents such as FlexPlex STR PCR reagents, DNA purification reagents, buffers, and the polymer are loaded on-chip [160]. The pneumatic pressure is provided to the sample in the chip whereas the sample and the instrument are not in direct contact. Swabs are placed in the A-C hip and consist of a buccal sample [45]. The Rapid DNA instrument is a closed chamber. It consists of software that performs functions like instrument control, an assemblage of data, STR profiling interpretation [47]. This is a fully-automated process. FlexPlex27 is a multiplexed 27 locus assay that provides data required for an international database, of STR loci and combined DNA index system (CODIS) loci. ANDE 4C and ANDE 6C are the instruments developed for Rapid DNA testing. The mode of detection of the

246  Modern Forensic Tools and Devices first ANDE 4C instrument is laser-based which detects four types of fluorescent dyes then a modified version was evolved named ANDE 6C which can detect six types of fluorescent dyes [155] and consist of four elements that are ANDE swab, chip, automated system, and ANDE 6C instrument [161]. One of the instruments of the Rapid DNA approach is the DNAscan/ ANDE™ Rapid DNA Analysis™ manufactured by Network Biosystems in 201. It consists of a system that does STR allele calling [162]. The instrument consists of biochip cassettes that have five reference swabs which can be used only once. It consists of a microfluidic channel designed for waste collection that occurred during the analysis. Owing to the presence of the microfluidic channel, the sample added into the cassette are capable of electrophoretic separation [163]. The swab is loaded into cassettes after scanning, locked with caps, and placed into the instrument which is fully packed to avoid contamination and mixing of samples [164]. Another fully automated set-up is RapidHit® ID requires barely one minute for handling and effortlessly used. RapidHit® ID comprises of RapidHit™ software. Above 1000 STR are uploaded in the national database system by using a tremendous instrument RapidHit® 200 system. This procedure is rapid, cost-effective, and provides great efficiency (Figure 10.9) [165].

En 2 ter ing s a ID m ple

f

Scanning the swab

RAPID DNA TEST

In

th ng rti b se swa

6

Data tation interpre

eo 1 ag bl ple m se am As s

ple

Ru n

sam

Figure 10.9  The Rapid DNA test procedure.

e

nin g

5

4

3

DNA Sequencing and Rapid DNA Tests  247

Table 10.1  The procedure required before DNA analysis in the ANDE instrument. Forensic DNA sample

Collection Collected by

Collected in

Mode of collection

Pre-treatment

Storage and preservative

Sample size

Concluding process

Dried blood

Scrapping by sterile scalpel

Paper cover

Air-dried

Homogenized and desiccated overnight

EDTA and kept in a cool place

2–4 ml

The sample id collected in buccal swab inserted into an instrument

Wet blood

Sterile cotton gauge

Paper cover

Dried in cool air or ambient temperature

1x3 mm punch taken and macerated in TE-4 buffer at 50˚C for around 15 minutes

EDTA and kept in a cool place

2–4 ml

The sample id collected in buccal swab inserted into an instrument

(Continued)

248  Modern Forensic Tools and Devices

Table 10.1  The procedure required before DNA analysis in the ANDE instrument. (Continued) Forensic DNA sample

Collection Collected by

Collected in

Mode of collection

Pre-treatment

Storage and preservative

Sample size

Concluding process

Muscle and brain fragment

Sterile scalpel or scissor

Sterile glass container

Air-dried

Lacerate in fragments of size 20–30 mg

No inclusion of formalin/ preservatives

5–10mg

The sample id collected in buccal swab inserted into an instrument

Liver fragment

Sterile scalpel or scissor

Polypropylene tube

Air-dried

Lacerate in fragments of size 20–30 mg

No inclusion of formalin/ preservatives

0.10–0.25 mg

The sample id collected in buccal swab inserted into an instrument (Continued)

DNA Sequencing and Rapid DNA Tests  249

Table 10.1  The procedure required before DNA analysis in the ANDE instrument. (Continued) Forensic DNA sample

Collection Collected by

Collected in

Mode of collection

Pre-treatment

Storage and preservative

Sample size

Concluding process

Bone

Sterile scissor

Sterile glass container or polypropylene tube

Air-dried

Immersed into 10% bleach solution and inverted 15–20 times twice

No inclusion of formalin/ preservatives

5–10 mg

The sample id collected in buccal swab inserted into an instrument

Tooth

Sterile scalpel or scissor

Sterile glass container or polypropylene tube

Dried in cool air or ambient temperature

Immersed into 10% bleach solution and inverted 15–20 times twice

No inclusion of formalin/ preservatives

5–10 mg

The sample id collected in buccal swab inserted into an instrument

250  Modern Forensic Tools and Devices

10.5.3 Methodology of Rapid DNA ANDE system consists of thermal cycling subsystem, high voltage subsystem, mechanical porthole between instrument and chip. It consists of a chip in which five buccal swabs are loaded, placed into the instrument followed by onscreen guidelines. It is an automated approach hence, purification of DNA, amplification of purified DNA, the formation of labeled STR fragment, and all these steps are performed within 90 minutes (Table 10.1) [166]. For simplification and no mixing of samples, the 2-D barcode chip and RFID chip are incorporated in the instrument. Dispensable and single-use A-chip encompasses an entire variety of reagent, waste, and microfluidic constituents which is required during STR analysis [155]. The instrument consists of detectors and a closed chamber to circumvent mixing and adulteration in samples. The 4C and 6C ANDE involves a detector, dichroic mirror, blue, green, red, yellow dyes [167, 168]. This instrument also faces numerous limitations such as (i) tough samples including bone and teeth unable to process, (ii) pre-processing is required before analysis, (iii) doesn’t provide a 100% success or triumph rate [169].

10.6 Conclusion and Future Aspects The discovery of DNA has become the symbol of modern bioscience. DNA sequence varies between and within species, hence, utilized in forensic work when there is an association between biological material and crime or other legal cases. The identification of victims, culprits, and accidents is greatly facilitated by sensitive DNA sequencing methods. However, the sequencing process is time-consuming as well as costly so an alternative was developed that is a Rapid DNA test. This approach is rapid, less time-consuming, adequate, automated, and can be used outside the laboratory. This process is reliable and robust hence, can be used by non-scientists in non-laboratory with guidelines and proper handling. The future of forensic DNA will have an impact on other areas of forensic science. DNA has become a successful biological material used in the past few decades to solve crimes and paternity resources. The cost will be a considerable area in the future in the field of forensic science. In the future, automated, cost-effective, and economic procedures are needed for sequencing large DNA samples in less amount of time. Hence, further research is required in the DNA sequencing field for the strengthening of these techniques.

DNA Sequencing and Rapid DNA Tests  251 The new technology can reduce the workload of the laboratory and exploit in solving criminal cases by sequencing forensic DNA samples.

References 1. Veigl, S.J., Harman, O., Lamm, E., Friedrich Miescher’s discovery in the historiography of genetics: From contamination to confusion, from nuclein to DNA. J. Hist. Biol., 53, 451–484, 2020. https://doi.org/10.1007/ s10739-020-09608-3. 2. Liew, P.S., Tan, T.H., Wong, Y.C., Sim, E.U.H., Lee, C.W., Narayanan, K., A self-replicating linear DNA. ACS Synth. Biol., 9, 804–813, 2020. https://doi. org/10.1021/acssynbio.9b00478. 3. Borah, B., E-zine of biological sciences DNA sequencing and its applications, BIONE by Babrone, 13, 13, 2020. 4. Peng, C.K., Buldyrev, S.V., Havlin, S., Simons, M., Stanley, H.E., Goldberger, A.L., Mosaic organization of DNA nucleotides. Phys. Rev. E, 49, 1685–1689, 1994. https://doi.org/10.1103/PhysRevE.49.1685. 5. Akkasaligar, P.T. and Biradar, S., Selective medical image encryption using DNA cryptography. Inf. Secur. J., 29, 91–101, 2020. https://doi.org/10.1080/1 9393555.2020.1718248. 6. Chen, X., Cui, Y., Best, R.B., Wang, H., Zhou, Z.H., Yang, W., Gellert, M., Cutting antiparallel DNA strands in a single active site. Nat. Struct. Mol. Biol., 27, 119–126, 2020. https://doi.org/10.1038/s41594-019-0363-2. 7. Bokelmann, L., Glocke, I., Meyer, M., Reconstructing double-stranded DNA fragments on a single-molecule level reveals patterns of degradation in ancient samples. Genome Res., 30, 1449–1457, 2020. https://doi.org/10.1101/ gr.263863.120. 8. Setiaputra, D. and Durocher, D., Shieldin-the protector of DNA ends. EMBO Rep., 20, e47560, 2019. https://doi.org/10.15252/embr.201847560. 9. Rawtani, D., Kuntmal, B., Agrawal, Y., Charge transfer in DNA and its diverse modelling approaches. Front. Life Sci., 9, 214–225, 2016. https://doi.org/10. 1080/21553769.2016.1207570. 10. Heather, J.M. and Chain, B., The sequence of sequencers: The history of sequencing DNA. Genomics, 107, 1–8, 2016. https://doi.org/10.1016/j. ygeno. 2015.11.003. 11. Iwasa, Y., Nishio, S., Sugaya, A., Kataoka, Y., Kanda, Y., Taniguchi, M., Nagai, K., Naito, Y., Ikezono, T., Horie, R., Sakurai, Y., Matsuoka, R., Takeda, H., Abe, S., Kihara, C., Ishino, T., Morita, S., Iwasaki, S., Takahashi, M., Ito, T., Arai, Y., Usami, S., OTOF mutation analysis with massively parallel DNA sequencing in 2,265 Japanese sensorineural hearing loss patients. PloS One, 14, e0215932, 2019. https://doi.org/10.1371/journal.pone.0215932.

252  Modern Forensic Tools and Devices 12. Abante, J., Fang, Y., Feinberg, A.P., Goutsias, J., Detection of haplotype-­ dependent allele-specific DNA methylation in WGBS data. Nat. Commun., 11, 1–13, 2020. https://doi.org/10.1038/s41467-020-19077-1. 13. Alderborn, A., Kristofferson, A., Hammerling, U., Determination of single-nucleotide polymorphisms by real-time pyrophosphate DNA sequencing. Genome Res., 10, 1249–1258, 2000. https://doi.org/10.1101/gr.10.8.1249. 14. Fimmel, E. and Strüngmann, L., Linear codes and the mitochondrial genetic code. Biosystems, 184, 103990, 2019. https://doi.org/10.1016/j. biosystems.2019.103990. 15. Hemanth, K., Tharmavaram, M., Pandey, G., History of forensic science, in: Technology in Forensic Science, pp. 1–16, Wiley, Weinheim, Germany, 2020, https://doi.org/10.1002/9783527827688.ch1. 16. Liu, P., Yeung, S.H.I., Crenshaw, K.A., Crouse, C.A., Scherer, J.R., Mathies, R.A., Real-time forensic DNA analysis at a crime scene using a portable microchip analyzer. Forensic Sci. Int. Genet., 2, 301–309, 2008. https://doi. org/10.1016/j.fsigen.2008.03.009. 17. Singh, R., Blood stain identification and its DNA stability on different fabrics. Int. J. Forensic Med., 2, 21–24, 2020. https://doi.org/10.33545/27074447.2020. v2.i1a.21. 18. Casey, T., Mistek, E., Halámková, L., Lednev, I.K., Raman spectroscopy for forensic semen identification: Method validation vs. environmental interferences. Vib. Spectrosc., 109, 103065, 2020. https://doi.org/10.1016/j. vibspec.2020.103065. 19. Chettri, J. and Bahadur, J., Microscopic Comparison of Hair in the Human Body, Masters by Coursework thesis, Murdoch University, 2020, https// researchrepository.murdoch.edu.au/view/author/Jung Chettri, Jaipratavi Bahadur.html. 20. Vyas, B., Halámková, L., Lednev, I.K., A universal test for the forensic identification of all main body fluids including urine. Forensic Chem., 20, 100247, 2020. https://doi.org/10.1016/j.forc.2020.100247. 21. Mahmood, H.M. and Alganimi, Y.K., Use markers of short tandem repeats (Str) for samples of bone in the forensic diagnosis of the human being in the in Kerbala governorate. Indian J. Forensic Med. Toxicol., 14, 2373–2378, 2020. 22. Satcher, L., DNA methylation analysis for tissue and age determination for forensic human identification forensic human identification, Master’s Theses, 733, 2020, https://aquila.usm.edu/masters_theses/733. 23. Nilendu, D., Kundu, A., Chand, A., Johnson, A., Forensic implications of saliva: An overview. Indian J. Forensic Med. Toxicol., 14, 189, 2020. https:// doi.org/10.37506/v14/i1/2020/ijfmt/192893. 24. Peschel, O., Kunz, S.N., Rothschild, M.A., Mützel, E., Blood stain pattern analysis. Forensic Sci. Med. Pathol., 125, 259–265, 2011. https://doi. org/10.1007/s12024-010-9198-1. 25. Salamon, S. and Maxwell, W.M.C., Storage of ram semen. Anim. Reprod. Sci., 62, 77–111, 2000. https://doi.org/10.1016/S0378-4320(00)00155-X.

DNA Sequencing and Rapid DNA Tests  253 26. Rao, P.K., Pandey, G., Tharmavaram, M., Biological evidence and their handling, in: Technology in Forensic Science, pp. 35–53, Wiley, Weinheim, Germany, 2020a, https://doi.org/10.1002/9783527827688.ch3. 27. Dufva, C., Karlsson, E., Forsberg, C., Ansell, R., DNA profiles obtained from urine in snow. Forensic Sci. Int. Genet. Suppl. Ser., 7, 544–545, 2019. https:// doi.org/10.1016/j.fsigss.2019.10.084. 28. Aparna, R. and Shanti Iyer, R., Tears and eyewear in forensic investigation—A review. Forensic Sci. Int., 306, 110055, 2020. https://doi.org/10.1016/j. forsciint.2019.110055. 29. Giampaoli, S., DeVittori, E., Valeriani, F., Berti, A., Romano Spica, V., Informativeness of NGS analysis for vaginal fluid identification. J. Forensic Sci., 62, 192–196, 2017. https://doi.org/10.1111/1556-4029.13222. 30. Seta, S., Sato, H., Miyake, B., Forensic hair investigation, pp. 47–166, Springer, Berlin, Heidelberg, 1988, https://doi.org/10.1007/978-3-642-69403-5_3. 31. Thakar, M.K., Sahajpal, V., Bhambara, A.K., Bhandari, D., Sharma, A., DNA profiling of saliva traces habitually deposited on various documents: A pilot study. Egypt. J. Forensic Sci., 10, 14, 2020. https://doi.org/10.1186/ s41935-020-00188-1. 32. Clayton, T.M., Guest, J.L., Urquhart, A.J., Gill, P.D., A genetic basis for anomalous band patterns encountered during DNA STR profiling. J. Forensic Sci., 49, 1–8, 2004. https://doi.org/10.1520/jfs2003145. 33. McErlich, J., Rapid nanopore DNA sequencing: Potential for field applications and forensic sample analysis, 2020. 34. Mitsui, J., Ishiura, H., Tsuji, S., DNA sequencing and other methods of exonic and genomic analyses, in: Rosenberg’s Molecular and Genetic Basis of Neurological and Psychiatric Disease, pp. 109–120, Elsevier, Amsterdam, Netherlands, 2020a, https://doi.org/10.1016/B978-0-12-813955-4.00008-8. 35. Ghatak, S., Muthukumaran, R.B., Nachimuthu, S.K., A simple method of genomic DNA extraction from human samples for PCR-RFLP analysis. J. Biomol. Tech., 24, 224–231, 2013. https://doi.org/10.7171/jbt.13-2404-001. 36. Budowle, B., Moretti, T.R., Niezgoda, S.J., Brown, B.L., CODIS and PCRbased short tandem repeat loci: Law enforcement tools, Second European Symposium on Human Identification, 7388, 73–88, 1998. 37. Udogadi, N.S., Abdullahi, M.K., Bukola, A.T., Imose, O.P., Esewi, A.D., Forensic dna profiling: Autosomal short tandem repeat as a prominent marker in crime investigation. Malays. J. Med. Sci., 27, 22–35, 2020. https:// doi.org/10.21315/mjms2020.27.4.3. 38. Rao, P.K., Tharmavaram, M., Pandey, G., Conventional technologies in forensic science, in: Technology in Forensic Science, pp. 17–34, Wiley, Weinheim, Germany, 2020b, https://doi.org/10.1002/9783527827688.ch2. 39. Zapico, S.C., Crucet, K., Antevska, A., Fernandez-Paradas, R., Burns, C., DeGaglia, C., Ubelaker, D.H., From your eyes only: Efficiency of nuclear and mitochondrial DNA isolation from contact lenses at crime scenes. Electrophoresis, 42, 1–2, 2020. https://doi.org/10.1002/elps.202000140.

254  Modern Forensic Tools and Devices 40. Xia, M., Yang, X., Fu, J., Teng, Z., Lv, Y., Yu, L., Application of chromosome microarray analysis in prenatal diagnosis. BMC Pregnancy Childbirth, 20, 696, 2020. https://doi.org/10.1186/s12884-020-03368-y. 41. Fullar, A., Kutnyanszky, V., Leiner, N., Identification of burglars using foil impressioning based on tool marks and DNA evidence. Forensic Sci. Int., 316, 110524, 2020. https://doi.org/10.1016/j.forsciint.2020.110524. 42. Turingan, R.S., Brown, J., Kaplun, L., Smith, J., Watson, J., Boyd, D.A., Steadman, D.W., Selden, R.F., Identification of human remains using Rapid DNA analysis. Int. J. Legal Med., 134, 863–872, 2020a. https://doi. org/10.1007/s00414-019-02186-y. 43. Kappel, K., Eschbach, E., Fischer, M., Fritsche, J., Design of a user-friendly and rapid DNA microarray assay for the authentication of ten important food fish species. Food Chem., 311, 125884, 2020. https://doi.org/10.1016/j. foodchem.2019.125884. 44. Chong, K.W.Y., Thong, Z., Syn, C.K., Recent trends and developments in forensic DNA extraction. WIREs Forensic Sci., 3, e1395, 2020. https://doi. org/10.1002/wfs2.1395. 45. Romsos, E.L., French, J.L., Smith, M., Figarelli, V., Harran, F., Vandegrift, G., Moreno, L.I., Callaghan, T.F., Brocato, J., Vaidyanathan, J., Pedroso, J.C., Amy, A., Stoiloff, S., Morillo, V.H., Czetyrko, K., Johnson, E.D., Tagyos, J., Murray, A., Vallone, P.M., Results of the 2018 rapid DNA maturity assessment. J. Forensic Sci., 65, 953–959, 2020. https://doi.org/10.1111/1556-4029.14267. 46. S.A. Soper, B. Rouge, J.D. Davies, M. Vernon, Y. Vladimirsky, United States Patent (19), 1998. 47. Carney, C., Whitney, S., Vaidyanathan, J., Persick, R., Noel, F., Vallone, P.M., Romsos, E.L., Tan, E., Grover, R., Witkowski, R.S., French, J.L., Selden, R.F., Developmental validation of the ANDETM rapid DNA system with FlexPlexTM assay for arrestee and reference buccal swab processing and database searching. Forensic Sci. Int. Genet., 40, 120–130, 2019. https://doi.org/10.1016/j. fsigen.2019.02.016. 48. Shen, F., Mao, S., Mathivanan, J., Wu, Y., Chandrasekaran, A.R., Liu, H., Gan, J., Sheng, J., Short DNA oligonucleotide as a Ag+ binding detector. ACS Omega, 44, 28565–28570, 2020. acsomega.0c03372. https://doi.org/10.1021/ acsomega.0c03372. 49. Dahm, R., Friedrich Miescher and the discovery of DNA. Dev. Biol., 278, 274–288, 2005. https://doi.org/10.1016/j.ydbio.2004.11.028. 50. Dey, A., Tharmavaram, M., Pandey, G., Rawtani, D., Mustansar Hussain, C., Conventional and emerging biometrics techniques in forensic investigations, in: Technology in Forensic Science, pp. 175–197, Wiley, Weinheim, Germany, 2020, https://doi.org/10.1002/9783527827688.ch9. 51. Wang, Z., Tang, L., Tan, L.H., Li, J., Lu, Y., Discovery of the DNA “Genetic Code” for abiological gold nanoparticle morphologies**. Angew. Chem. Int. Ed., 51, 1–6, 2012. https://doi.org/10.1002/anie.201203716.

DNA Sequencing and Rapid DNA Tests  255 52. Crick, F.H.C., The origin of the genetic code. J. Mol. Biol., 38, 367–379, 1968. https://doi.org/10.1016/0022-2836(68)90392-6. 53. Lamm, E., Harman, O., Veigl, S.J., Before watson and crick in 1953 came friedrich miescher in 1869. Genetics, 3, e1395, 2020. https://doi.org/10.1534/ genetics.120.303195. 54. Liebl, K. and Zacharias, M., How global DNA unwinding causes non-­ uniform stress distribution and melting of DNA. PloS One, 15, e0232976, 2020. https://doi.org/10.1371/journal.pone.0232976. 55. Yu, B., Pletka, C.C., Iwahara, J., NMR observation of intermolecular hydrogen bonds between protein tyrosine side-chain OH and DNA phosphate groups. J. Phys. Chem. B, 124, 1065–1070, 2020. https://doi.org/10.1021/acs. jpcb.9b10987. 56. Skoruppa, E., Voorspoels, A., Vreede, J., Carlon, E., Length scale dependent elasticity in DNA from coarse-grained and all-atom models, American Physical Society, USA, 2020. 57. Heinemann, U. and Roske, Y., Symmetry in nucleic-acid double helices. Symmetry (Basel), 12, 753, 2020. https://doi.org/10.3390/SYM12050737. 58. Schneider, B., Patel, K., Berman, H.M., Hydration of the phosphate group in double-helical DNA. Biophys. J., 75, 2422–2434, 1998. https://doi. org/10.1016/S0006-3495(98)77686-6. 59. Singhal, P. and Kuhr, W.G., Ultrasensitive voltammetric detection of underivatized oligonucleotides and DNA. Anal. Chem., 69, 4828–4832, 1997. https://doi.org/10.1021/ac970731q. 60. Salvio, R., Volpi, S., Folcarelli, T., Casnati, A., Cacciapaglia, R., A calix[4] arene with acylguanidine units as an efficient catalyst for phosphodiester bond cleavage in RNA and DNA model compounds. Org. Biomol. Chem., 17, 7482–7492, 2019. https://doi.org/10.1039/c9ob01141b. 61. Erdmann, V.A. and Barciszewski, J., 2011: 50th anniversary of the discovery of the genetic code. Angew. Chemie Int. Ed., 50, 9546–9552, 2011. https://doi. org/10.1002/anie.201103895. 62. Santos, M.A.S., Moura, G., Massey, S.E., Tuite, M.F., Driving change: The evolution of alternative genetic codes. Trends Genet., 20, 2, 95–102, 2004. https://doi.org/10.1016/j.tig.2003.12.009. 63. Swart, E.C., Serra, V., Petroni, G., Nowacki, M., Genetic codes with no dedicated stop codon: Context-dependent translation termination. Cell, 166, 691–702, 2016. https://doi.org/10.1016/j.cell.2016.06.020. 64. Dietlein, F., Weghorn, D., Taylor-Weiner, A., Richters, A., Reardon, B., Liu, D., Lander, E.S., Van Allen, E.M., Sunyaev, S.R., Identification of cancer driver genes based on nucleotide context. Nat. Genet., 52, 208–218, 2020. https://doi.org/10.1038/s41588-019-0572-y. 65. Berdous, D., Berney, X., Sanchez-Archidona, A.R., Jan, M., Roujeau, C., Lopez-Mejia, I.C., Mynatt, R., Thorens, B., A genetic screen identifies Crat as a regulator of pancreatic beta-cell insulin secretion. Mol. Metab., 37, 100993, 2020. https://doi.org/10.1016/j.molmet.2020.100993.

256  Modern Forensic Tools and Devices 66. Qonita, U.S., Elvira, K., Irawati, Ilma, F.M., Akhmaloka, An automorphism in the LK_ITB5a H110F gene mutation. Afr. J. Math. Comput. Sci. Res., 13, 61–65, 2020. https://doi.org/10.5897/ajmcsr2020.0824. 67. de Freitas Martins, E., Amorim, R.G., Feliciano, G.T., Scheicher, R.H., Rocha, A.R., The role of water on the electronic transport in graphene nanogap devices designed for DNA sequencing. Carbon, 158, 314–319, 2020. https:// doi.org/10.1016/j.carbon.2019.10.067. 68. Ye, T., Zhang, Z., Yuan, M., Cao, H., Yin, F., Wu, X., Xu, F., An all-in-one aptasensor integrating enzyme powered three-dimensional DNA machine for antibiotic detection. J. Agric. Food Chem., 68, 2826–2831, 2020. https:// doi.org/10.1021/acs.jafc.9b08143. 69. Dube, S., Tharmavaram, M., Pandey, G., Rawtani, D., Mustansar Hussain, C., Sensors for the detection of biological fluids, in: Technology in Forensic Science, pp. 239–258, Wiley, Weinheim, Germany, 2020, https://doi.org/10. 1002/9783527827688.ch12. 70. Maxam, A.M. and Gilbert, W., A new method for sequencing DNA. Proc. Natl. Acad. Sci. U. S. A., 74, 560–564, 1977a. https://doi.org/10.1073/ pnas.74.2.560. 71. Ronaghi, M., Pyrosequencing sheds light on DNA sequencing. Genome Res., 11, 3–11, 2001a. https://doi.org/10.1101/gr.150601. 72. Weber, J.L. and Myers, E.W., Human whole-genome shotgun sequencing. Genome Res., 7, 401–409, 1997. https://doi.org/10.1101/gr.7.5.401. 73. Bankier, A.T., Weston, K.M., Barrell, B.G., Random cloning and sequencing by the M13/dideoxynucleotide chain termination method. Meth. Enzymol., 155, 51–93, 1987. https://doi.org/10.1016/0076-6879(87)55009-1. 74. Dini, G. and Santochi, M., Automated sequencing and subassembly detection in assembly planning. CIRP Ann. Manuf. Technol., 41, 1–4, 1992. https:// doi.org/10.1016/S0007-8506(07)61140-8. 75. Uhlén, M., Hultman, T., Wahlberg, J., Lundeberg, J., Bergh, S., Petterson, B., Holmberg, A., Ståhl, S., Moks, T., Semi-automated solid-phase DNA sequencing. Trends Biotechnol., 10, 52–55, 1992. https://doi.org/10.1016/ 0167-7799(92)90169-V. 76. Mardis, E.R., Next-Generation DNA Sequencing Methods. Annu. Rev. Genomics Hum. Genet., 9, 387–402, 2008. https://doi.org/10.1146/annurev. genom.9.081307.164359. 77. Pichersky, E., Terminal labeling of DNA for Maxam and Gilbert sequencing. Methods Mol. Biol., 58, 441–446, 1996. https://doi.org/ 10.1385/0-89603-402-x:441. 78. Harwood, A.J., End-labeling of DNA probes. Methods Mol. Biol., 187, 17–22, 2002. https://doi.org/10.1385/1-59259-273-2:017. 79. Tyagi, P. and Bhide, M., History of DNA sequencing. Folia Vet., 64, 66–73, 2020. https://doi.org/10.2478/fv-2020-0019.

DNA Sequencing and Rapid DNA Tests  257 80. Maxam, A.M. and Gilbert, W., A new method for sequencing DNA. Proc. Natl. Acad. Sci. U. S. A., 74, 560–564, 1977b. https://doi.org/10.1073/ pnas.74.2.560. 81. Werner, O., Prudencio, Á.S., de la Cruz-Martínez, E., Nieto-Lugilde, M., Martínez-Gómez, P., Ros, R.M., A cost reduced variant of epi-genotyping by sequencing for studying DNA methylation in non-model organisms. Front. Plant Sci., 11, 694, 2020. https://doi.org/10.3389/fpls.2020.00694. 82. Jagadeeswaran, P. and Kaul, R.K., Use of reverse-phase chromatography in the Maxam-Gilbert method of DNA sequencing A step toward automation. Gene Anal. Tech., 3, 79–85, 1986. https://doi.org/10.1016/0735-0651(86)90007-5. 83. Mitsui, J., Ishiura, H., Tsuji, S., DNA sequencing and other methods of exonic and genomic analyses, in: Rosenberg’s Molecular and Genetic Basis of Neurological and Psychiatric Disease, pp. 109–120, Elsevier, Amsterdam, Netherlands, 2020b, https://doi.org/10.1016/B978-0-12-813955-4.00008-8. 84. Sanger, F., Nicklen, S., Coulson, A.R., DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A., 74, 5463–5467, 1977. 85. Purushothaman, S., Toumazou, C., Georgiou, J., Towards fast solid state DNA sequencing, in: Proceedings-IEEE International Symposium on Circuits and Systems, 2002, https://doi.org/10.1109/iscas.2002.1010416. 86. Metzker, M.L., Emerging technologies in DNA sequencing, IEEE International Symposium on Circuits and Systems (ISCAS), 2002, 4–4, 2002. https://doi.org/10.1101/gr.3770505. 87. Crossley, B.M., Bai, J., Glaser, A., Maes, R., Porter, E., Killian, M.L., Clement, T., Toohey-Kurth, K., Guidelines for Sanger sequencing and molecular assay monitoring. J. Vet. Diagn. Invest., 32, 767–775, 2020. https://doi. org/10.1177/1040638720905833. 88. Md, F. and Chowdhury, A., Pyrosequencing-an alternative to traditional Sanger sequencing. Characterization of stress tolerant high potential ethanol producing yeast from agro-industrial waste. Isolation of native cellulase producing fungus, American Journal of Biochemistry and Biotechnology, 8, 1, 14–20, 2012. https://doi.org/10.3844/ajbbsp.2012.14.20. 89. Beck, T.F., Mullikin, J.C., Biesecker, L.G., Systematic evaluation of sanger validation of next-generation sequencing variants. Clin. Chem., 62, 647–654, 2016. https://doi.org/10.1373/clinchem.2015.249623. 90. Ansorge, W., Sproat, B., Stegemann, J., Schwager, C., Zenke, M., Automated DNA sequencing: Ultrasensitive detection of fluorescent bands during electrophoresis. Nucleic Acids Res., 15, 4593–4602, 1987. https://doi.org/10.1093/ nar/15.11.4593. 91. Smith, L.M., Sanders, J.Z., Kaiser, R.J., Hughes, P., Dodd, C., Connell, C.R., Heiner, C., Kent, S.B.H., Hood, L.E., Fluoresence detection. Nature, 321, 674–679, 1986. 92. Smith, L.M., Madison, W., Leroy, E., Hood, M.W., Hunkapiller, S., Carlos, T.J., Hunkapiller, C., Applications and Data Services Management Division, Cold Spring Harbor Laboratory Press., New York, USA, 1987.

258  Modern Forensic Tools and Devices 93. Schuurman, T., de Boer, R., Patty, R., Kooistra-Smid, M., van Zwet, A., Comparative evaluation of in-house manual, and commercial semi-automated and automated DNA extraction platforms in the sample preparation of human stool specimens for a Salmonella enterica 5’-nuclease assay. J. Microbiol. Methods, 71, 238–245, 2007. https://doi.org/10.1016/j. mimet.2007.09.003. 94. Carrano, A.V., Lamerdin, J., Ashworth, L.K., Watkins, B., Branscomb, E., Slezak, T., Raff, M., de Jong, P.J., Keith, D., McBride, L., Meister, S., Kronick, M., A high-resolution, fluorescence-based, semiautomated method for DNA fingerprinting. Genomics, 4, 129–136, 1989. https://doi. org/10.1016/0888-7543(89)90291-7. 95. Schwengel, D.A., Jedlicka, A.E., Nanthakumar, E.J., Weber, J.L., Levitt, R.C., Comparison of fluorescence-based semi-automated genotyping of multiple microsatellite loci with autoradiographic techniques. Genomics, 22, 46–54, 1994. https://doi.org/10.1006/geno.1994.1344. 96. Agah, A., Aghajan, M., Mashayekhi, F., Amini, S., Davis, R.W., Plummer, J.D., Ronaghi, M., Griffin, P.B., A multi-enzyme model for pyrosequencing. Nucleic Acids Res., 32, e166–e166, 2004. https://doi.org/10.1093/nar/gnh159. 97. Elahi, E. and Ronaghi, M., Pyrosequencing: A tool for DNA sequencing analysis, in: Methods in Molecular Biology, vol. 255, pp. 211–219, 2004, https:// doi.org/10.1385/1-59259-752-1:211. 98. Ronaghi, M., Pyrosequencing sheds light on DNA sequencing. Genome Res., 11, 3–11, 2001b. https://doi.org/10.1101/gr.150601. 99. Ahmadian, A., Ehn, M., Hober, S., Pyrosequencing: History, biochemistry and future. Clin. Chim. Acta, 363, 83–94, 2006. https://doi.org/10.1016/j. cccn.2005.04.038. 100. Harrington, C.T., Lin, E.I., Olson, M.T., Eshleman, J.R., Fundamentals of pyrosequencing. Arch. Pathol. Lab. Med., 137, 303–1296, 2013. https://doi. org/10.5858/arpa.2012-0463-RA. 101. Ranjan, R., Rani, A., Metwally, A., McGee, H.S., Perkins, D.L., Analysis of the microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing. Biochem. Biophys. Res. Commun., 469, 967–977, 2016. https:// doi.org/10.1016/j.bbrc.2015.12.083. 102. Venter, J.C., Adams, M.D., Sutton, G.G., Kerlavage, A.R., Smith, H.O., Hunkapiller, M., Shotgun sequencing of the human genome. Science, 280, 1540–1542, 1998. 103. Reis-Filho, J.S., Next-generation sequencing. Breast Cancer Res., 11, 1–7, 2009. https://doi.org/10.1186/bcr2431. 104. Ansorge, W.J., Next-generation DNA sequencing techniques. N. Biotechnol., 25, 195-203, 2009. https://doi.org/10.1016/j.nbt.2008.12.009. 105. Schuster, S.C., Next-generation sequencing transforms today’s biology. Nat. Methods, 5, 16–18, 2008. https://doi.org/10.1038/nmeth1156. 106. Ziebolz, B., Next-generation sequencing technologies. Bio Tech Int., 2, 255– 260, 2006. https://doi.org/10.1016/j.ddtec.2005.08.003.

DNA Sequencing and Rapid DNA Tests  259 107. Adams, D.R. and Eng, C.M., Next-generation sequencing to diagnose suspected genetic disorders. N. Engl. J. Med., 14, 1353–1362, 2018. https://doi. org/10.1056/NEJMra1711801. 108. Vintiner, S.K., Veth, J.S., Bright, J.A., A review of DNA profiling success for laser microdissected forensic casework samples. Aust. J. Forensic Sci., 52, 282–292, 2020. https://doi.org/10.1080/00450618.2018.1510030. 109. Taylor, D., Abarno, D., Rowe, E., Rask-Nielsen, L., Observations of DNA transfer within an operational forensic biology laboratory. Forensic Sci. Int. Genet., 23, 33–49, 2016. https://doi.org/10.1016/j.fsigen.2016.02.011. 110. Hasan, S., Bromfield-Lee, D., Oliver-Hoyo, M.T., Cintron-Moldonado, J.A., Using laboratory chemicals to imitate illicit drugs in a forensic chemistry activity. J. Chem. Educ., 85, 813–816, 2008. https://doi.org/10.1021/ ed085p813. 111. Touron, P., Siatka, C., Pussiau, A., Follot, S., Fritz, T., Petit, M., Latifa, N., Herrmann, J.L., Rottman, M., Lemoine, A., Hubac, S., A mobile DNA laboratory for forensic science adapted to coronavirus SARS-CoV-2 diagnosis. Eur. J. Clin. Microbiol. Infect. Dis., 125, 1–4, 2020. https://doi.org/10.1007/ s10096-020-03989-3. 112. Bakdash, A., Al-Qudsi, J., M. Hassan, H., Alzahrani, F., Assi, S., Forensic toxicology laboratory guidelines: Analytical method validation (version 2.0). Arab J. Forensic Sci. Forensic Med., 2, 2163–7281, 2020. https://doi. org/10.26735/lqfp2592. 113. Biswas, U.K., Khan, N.T., Hossain, M.A., Kader, A., Kumar, U., Assistant, B., Review article, Collection, preservation and forwarding of biological samples for toxicological analysis in medico legal autopsy cases. J. ZHSWMC, 30, 96–100, 2019. 114. Sobczak, Ł. and Goryński, K., Evaluation of swabs from 15 commercially available oral fluid sample collection devices for the analysis of commonly abused substances: Doping agents and drugs of abuse. Analyst, 145, 7279– 7288, 2020. https://doi.org/10.1039/d0an01379j. 115. Castresana, J.S. and Lázcoz, P., Techniques for DNA analysis, in: Reproductive Endocrinology: A Molecular Approach, pp. 83–96, Springer US, Boston, MA, 2009, https://doi.org/10.1007/978-0-387-88186-7_8. 116. Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S., Rafalski, A., The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed., 125, 259–265, 1996. https://doi. org/10.1007/BF00564200. 117. Lakemeyer, J., Siebert, U., Abdulmawjood, A., Ryeng, K.A., IJsseldijk, L.L., Lehnert, K., Anisakid nematode species identification in harbour porpoises (Phocoena phocoena) from the North Sea, Baltic Sea and North Atlantic using RFLP analysis. Int. J. Parasitol. Parasites Wildl., 12, 93–98, 2020. https:// doi.org/10.1016/j.ijppaw.2020.05.004.

260  Modern Forensic Tools and Devices 118. Ashrafmansouri, S.S., Kamaladini, H., Haddadi, F., Seidi, M., Simple innovative adaptor to improve genome walking with convenient PCR. J. Genet. Eng. Biotechnol., 18, 1–8, 2020. https://doi.org/10.1186/s43141-020-00082-2. 119. Kiely, T.F., Forensic Evidence: Science and the Criminal Law, Second Edition, Google Books [WWW Document], Routledge, Taylor and Francis Group, Milton Park, Abingdon-on-Thames, Oxfordshire, England, UK, 2005. URL https://books.google.co.in/books?hl=en&lr=&id=0u_ LBQAAQBAJ&oi=fnd&pg=PP1&dq=PCR+(TF+Kiely,+2005)&ots=oKCa7_ b1QUD1zS&sig=28pEfGoFLU6G6-h34qnlsKE&redir_esc=y#v=onepage&q&f=false(accessed 11.28.20). 120. Sreejith, K.R., Gorgannezhad, L., Jin, J., Ooi, C.H., Stratton, H., Dao, D.V., Nguyen, N.-T., Liquid marbles as biochemical reactors for the polymerase chain reaction. Lab. Chip, 19, 3220–3227, 2019. https://doi.org/10.1039/c9lc00676a. 121. Jian, C., Luukkonen, P., Yki-Järvinen, H., Salonen, A., Korpela, K., Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling. PloS One, 15, 1–10, 2020. https://doi.org/10.1371/journal.pone.0227285. 122. Tellinghuisen, J., dPCR vs. qPCR: The role of poisson statistics at low concentrations. Anal. Biochem., 611, 113946, 2020. https://doi.org/10.1016/j. ab.2020.113946. 123. Paul, S., Peddayelachagiri, B.V., Gogoi, M., Nagaraj, S., Ramlal, S., Konduru, B., Batra, H.V., Genome-wide unique insertion sequences among five Brucella species and demonstration of differential identification of Brucella by multiplex PCR assay. Sci. Rep., 10, 1–11, 2020. https://doi.org/10.1038/ s41598-020-62472-3. 124. Mohanty, P.S., Saikia, D., Kalra, S., Naaz, F., Bansal, A.K., Pawar, H.S., Mohanty, K.K., Sharma, S., Singh, M., Patil, S.A., LEPStr: A database for Mycobacterium leprae short tandem repeats. Inform. Med. Unlocked, 19, 100322, 2020. https://doi.org/10.1016/j.imu.2020.100322. 125. Asogawa, M., Ohno, A., Nakagawa, S., Ochiai, E., Katahira, Y., Sudo, M., Osawa, M., Sugisawa, M., Imanishi, T., Human short tandem repeat identification using a nanopore-based DNA sequencer: A pilot study. J. Hum. Genet., 65, 21–24, 2020. https://doi.org/10.1038/s10038-019-0688-z. 126. Butler, J.M., Buel, E., Crivellente, F., McCord, B.R., Forensic DNA typing by capillary electrophoresis using the ABI Prism 310 and 3100 genetic analyzers for STR analysis. Electrophoresis, 25, 1397–1412, 2004. https://doi. org/10.1002/elps.200305822. 127. Masters, J.R., Thomson, J.A., Daly-Burns, B., Reid, Y.A., Dirks, W.G., Packer, P., Toji, L.H., Ohno, T., Tanabe, H., Arlett, C.F., Kelland, L.R., Harrison, M., Virmani, A., Ward, T.H., Ayres, K.L., Debenham, P.G., Short tandem repeat profiling provides an international reference standard for human cell lines. Proc. Natl. Acad. Sci. U. S. A., 98, 8012–8017, 2001. https://doi.org/10.1073/ pnas.121616198.

DNA Sequencing and Rapid DNA Tests  261 128. Spikes, T.E., Montgomery, M.G., Walker, J.E., Structure of the dimeric ATP synthase from bovine mitochondria. Proc. Natl. Acad. Sci. U. S. A., 117, 23519–23526, 2020. https://doi.org/10.1073/pnas.2013998117. 129. Moritz, C., Applications of mitochondrial DNA analysis in conservation: A critical review. Mol. Ecol., 3, 401–411, 1994. https://doi.org/10.1111/j.1365294X.1994.tb00080.x. 130. Lott, M.T., Leipzig, J.N., Derbeneva, O., Michael Xie, H., Chalkia, D., Sarmady, M., Procaccio, V., Wallace, D.C., MtDNA variation and analysis using mitomap and mitomaster. Curr. Protoc. Bioinf., 1, 1.23.1, 2013. https:// doi.org/10.1002/0471250953.bi0123s44. 131. Butler, J.M. and Levin, B.C., Forensic applications of mitochondrial DNA, in: Trends in Biotechnology, 98, pp. 158–162. Elsevier Ltd, 1998. https://doi. org/10.1016/S0167-7799(98)01173-1. 132. Wilson, M.R., DiZinno, J.A., Polanskey, D., Replogle, J., Budowle, B., Validation of mitochondrial DNA sequencing for forensic casework analysis. Int. J. Legal Med., 108, 68–74, 1995. https://doi.org/10.1007/BF01369907. 133. Giles, R.E., Blanc, H., Cann, H.M., Wallace aD., C., Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad. Sci. U. S. A., 77, 6715–6719, 1980. https://doi.org/10.1073/pnas.77.11.6715. 134. Hagström, E., Freyer, C., Battersby, B.J., Stewart, J.B., Larsson, N.G., No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline. Nucleic Acids Res., 42, 1111–1116, 2014. https:// doi.org/10.1093/nar/gkt969. 135. Graziewicz, M.A., Longley, M.J., Copeland, W.C., DNA polymerase γ in mitochondrial DNA replication and repair. Chem. Rev., 106, 383–405, 2006. https://doi.org/10.1021/cr040463d. 136. Yazdizadeh, M., Fahmideh, L., Mohammadi-Nejad, G., Solouki, M., Nakhoda, B., Association anal ysis between agronomic traits and AFLP markers in a wide germplasm of proso millet (panicum miliaceum L.) under normal and salinity stress conditions. BMC Plant Biol., 20, 427, 2020. https:// doi.org/10.1186/s12870-020-02639-2. 137. Nurmansyah, Alghamdi, S.S., Migdadi, H.M., Khan, M.A., Afzal, M., AFLPbased analysis of variation and population structure in mutagenesis induced faba bean. Diversity, 12, 303, 2020. https://doi.org/10.3390/D12080303. 138. Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, T., Hornes, M., Friters, A., Pot, J., Paleman, J., Kuiper, M., Zabeau, M., AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res., 23, 4407–4414, 1995. https://doi. org/10.1093/nar/23.21.4407. 139. Meisel, R.P., Evolution of sex determination and sex chromosomes: A novel alternative paradigm. BioEssays, 42, 1900212, 2020. https://doi.org/10.1002/ bies.201900212. 140. Song, M., Wang, Z., Zhang, Y., Zhao, C., Lang, M., Xie, M., Qian, X., Wang, M., Hou, Y., Forensic characteristics and phylogenetic analysis of both Y-STR and Y-SNP in the Li and Han ethnic groups from Hainan Island of

262  Modern Forensic Tools and Devices China. Forensic Sci. Int. Genet., 39, e14–e20, 2019. https://doi.org/10.1016/j. fsigen.2018.11.016. 141. Gusmão, L., Butler, J.M., Carracedo, A., Gill, P., Kayser, M., Mayr, W.R., Morling, N., Prinz, M., Roewer, L., Tyler-Smith, C., Schneider, P.M., DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Int. J. Legal Med., 120, 191–200, 2006. https://doi.org/10.1007/s00414-005-0026-1. 142. Baeta, M., Núñez, C., Villaescusa, P., Ortueta, U., Ibarbia, N., Herrera, R.J., Blazquez-Caeiro, J.L., Builes, J.J., Jiménez-Moreno, S., Martínez-Jarreta, B., de Pancorbo, M.M., Assessment of a subset of slowly mutating Y-STRs for forensic and evolutionary studies. Forensic Sci. Int. Genet., 34, e7–e12, 2018. https://doi.org/10.1016/j.fsigen.2018.03.008. 143. Ballantyne, K.N., Keerl, V., Wollstein, A., Choi, Y., Zuniga, S.B., Ralf, A., Vermeulen, M., De Knijff, P., Kayser, M., A new future of forensic Y-chromosome analysis: Rapidly mutating Y-STRs for differentiating male relatives and paternal lineages, Forensic Science International: Genetics, 6, 2, 208–218, 2011. https://doi.org/10.1016/j.fsigen.2011.04.017. 144. Stephens, K.M., Holt, C., Davis, C., Jager, A., Walichiewicz, P., Han, Y., Silva, D., Shen, M.R., Amini, S., Steemers, F.J., WO2015126766 - Methods and compositions for DNA profiling. Publication Number WO/2015/126766, Publication Date 27.08.2015. 145. Alves, C., Gusmão, L., Barbosa, J., Amorim, A., Evaluating the informative power of Y-STRs: A comparative study using European and new African haplotype data. Forensic Sci. Int., 134, 126–133, 2003. https://doi.org/10.1016/ S0379-0738(03)00127-0. 146. D’Amato, M.E., Benjeddou, M., Davison, S., Evaluation of 21 Y-STRs for population and forensic studies. Forensic Sci. Int. Genet. Suppl. Ser., 2, 446–447, 2009. https://doi.org/10.1016/j.fsigss.2009.08.091. 147. Mapes, A.A., Stoel, R.D., de Poot, C.J., Vergeer, P., Huyck, M., Decision support for using mobile rapid DNA analysis at the crime scene. Sci. Justice, 59, 29–45, 2019. https://doi.org/10.1016/j.scijus.2018.05.003. 148. Mapes, A.A., Kloosterman, A.D., de Poot, C.J., van Marion, V., Objective data on DNA success rates can aid the selection process of crime samples for analysis by rapid mobile DNA technologies. Forensic Sci. Int., 264, 28–33, 2016. https://doi.org/10.1016/j.forsciint.2016.03.020. 149. Wang, Z., MacMillan, K., Powell, M., Wein, L.M., A cost-effectiveness analysis of the number of samples to collect and test from a sexual assault. Proc. Natl. Acad. Sci. U. S. A., 117, 13421–13427, 2020. 150. Hauck, Y., Soler, C., Jault, P., Mérens, A., Gérome, P., Nab, C., Trueba, F., Bargues, L., Thien, H.V., Vergnaud, G., Pourcel, C., Diversity of acinetobacter baumannii in four french military hospitals, as assessed by multiple locus variable number of tandem repeats analysis. PloS One, 7, e44597, 2012. https://doi.org/10.1371/journal.pone.0044597.

DNA Sequencing and Rapid DNA Tests  263 151. Cerri, N., Ricci, U., Sani, I., Verzeletti, A., De Ferrari, F., Mixed stains from sexual assault cases: Autosomal or y-chromosome short tandem repeats?, Croatian Medical Journal, 44, 289–292, 2003. 152. Thomson, J.A., Pilotti, V., Stevens, P., Ayres, K.L., Debenham, P.G., Validation of short tandem repeat analysis for the investigation of cases of disputed paternity. Forensic Sci. Int., 1999. 153. C.T. Caskey, A.O. Edwards et al., DNA typing with short tandem repeat polymorphisms and identification of polymorphic short tandem repeats. United States Patent (19), 1991. 154. Hannis, J.C. and Muddiman, D.C., Genotyping short tandem repeats using flow injection and electrospray ionization fourier transform ion cyclotron resonance mass spectrometry. Rapid Commun. Mass Spectrom., 15, 348–350, 2001. https://doi.org/10.1002/rcm.234. 155. Grover, R., Jiang, H., Turingan, R.S., French, J.L., Tan, E., Selden, R.F., FlexPlex27-highly multiplexed rapid DNA identification for law enforcement, kinship, and military applications, Probability Theory and Related Fields, 125, 259–265, 2017. https://doi.org/10.1007/s00414-017-1567-9. 156. Morgan, R., Illidge, S., Wilson-Wilde, L., Assessment of the potential investigative value of a decentralised rapid DNA workflow for reference DNA samples. Forensic Sci. Int., 294, 140–149, 2019. https://doi.org/10.1016/j. forsciint.2018.11.015. 157. Romsos, E.L. and Vallone, P.M., Results of the 2018 rapid DNA maturity assessment and earlier studies, Journal of Forensic Sciences, 65, 953–959, 2018. 158. Steward, E.R., Discussion and evaluation: The legality and use of rapid DNA technologies. UMKC Law Rev., 84, 1–12, 2015. 159. Romsos, E.L., Moreno, L.I., Vallone, P., Copper view project rapid DNA view project. Rapid DNA maturity assessment. J. Forensic Sci., 65, 953–959, 2018. https://doi.org/10.1111/1556-4029.14267. 160. Romsos, E.L., Lembirick, S., Vallone, P.M., Rapid DNA maturity assessment. Forensic Sci. Int. Genet. Suppl. Ser., 5, e1–e2, 2015. https://doi.org/10.1016/j. fsigss.2015.09.001. 161. Turingan, R.S., Tan, E., Jiang, H., Brown, J., Estari, Y., Krautz-Peterson, G., Selden, R.F., Developmental validation of the ANDE 6C system for rapid DNA analysis of forensic casework and DVI samples. J. Forensic Sci., 65, 1056–1071, 2020c. https://doi.org/10.1111/1556-4029.14286. 162. Wiley, R., Sage, K., LaRue, B., Budowle, B., Internal validation of the rapidHIT® ID system. Forensic Sci. Int. Genet., 31, 180–188, 2017. https://doi. org/10.1016/j.fsigen.2017.09.011. 163. Moreno, L.I., Brown, A.L., Callaghan, T.F., Internal validation of the DNAscan/ANDETM rapid DNA analysisTM platform and its associated PowerPlex® 16 high content DNA biochip cassette for use as an expert system with reference buccal swabs. Forensic Sci. Int. Genet., 29, 100–108, 2017. https://doi.org/10.1016/j.fsigen.2017.03.022.

264  Modern Forensic Tools and Devices 164. French, J.L., Turingan, R.S., Hogan, C., Selden, R.F., Developmental validation of the DNAscanTM rapid DNA analysisTM instrument and expert system for reference sample processing. Forensic Sci. Int. Genet., 25, 145–156, 2016. https://doi.org/10.1016/j.fsigen.2016.08.008. 165. Salceda, S., Barican, A., Buscaino, J., Goldman, B., Klevenberg, J., Kuhn, M., Lehto, D., Lin, F., Nguyen, P., Park, C., Pearson, F., Pittaro, R., Salodkar, S., Schueren, R., Smith, C., Troup, C., Tsou, D., Vangbo, M., Wunderle, J., King, D., Validation of a rapid DNA process with the rapidHIT® ID system using globalfiler® express chemistry, a platform optimized for decentralized testing environments. Forensic Sci. Int. Genet., 28, 21–34, 2017. https://doi. org/10.1016/j.fsigen.2017.01.005. 166. Turingan, R.S., Brown, J., Kaplun, L., Smith, J., Watson, J., Boyd, D.A., Steadman, D.W., Selden, R.F., Identification of human remains using rapid DNA analysis. Int. J. Legal Med., 134, 863–872, 2020b. https://doi. org/10.1007/s00414-019-02186-y. 167. Kitayama, T., Fukagawa, T., Watahiki, H., Mita, Y., Fujii, K., Unuma, K., Sakurada, K., Uemura, K., Sekiguchi, K., Mizuno, N., Evaluation of rapid DNA system for buccal swab and disaster victim identification samples. Leg. Med., 46, 101713, 2020. https://doi.org/10.1016/j.legalmed.2020.101713. 168. Turingan, R.S., Tan, E., Jiang, H., Brown, J., Estari, Y., Krautz-Peterson, G., Selden, R.F., Developmental validation of the ANDE 6C system for rapid DNA analysis of forensic casework and DVI samples. J. Forensic Sci., 65, 1056–1071, 2020d. https://doi.org/10.1111/1556-4029.14286. 169. Dash, H.R., Shrivastava, P., Das, S., RAPID DNA technology: A boon to forensic DNA typing, pp. 313–316, Humana, New York, NY, 2020, https://doi. org/10.1007/978-1-0716-0274-4_33.

11 Sensor-Based Devices for Trace Evidence Aayush Dey1, Piyush K. Rao1 and Deepak Rawtani2* School of Doctoral Studies and Research, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 2 School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India

1

Abstract

In order to properly reconstruct and analyze a crime scene it is important for a forensic professional to have a keen eye for trace evidences. Trace evidences are intricate amounts of physical, chemical or biological evidences found at a crime scene that require proper handling and analysis to produce a near accurate representation of the events that could have occurred at a crime scene. At a crime scene, sensor-based devices come in handy in analyzing trace evidences. There are several advantages to the use of sensors in the field of forensics. Sensor based analyses of evidences are generally rapid, cost-efficient, precise and possess higher limits of detection, hence their applications become diverse in the field of forensic science and crime scene investigations. This chapter deals with the different type of trace evidences found at a crime scene and the diverse applications of sensors in their detection and quantification. Additionally, a critical emphasis has also been given on the different mechanisms through which the sensor-based devices interact with the samples that needs to be assessed. Keywords:  Immunosensors, genosensors, cell-based biosensors, aptasensors, enzymatic biosensors, trace evidences, forensic science

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (265–298) © 2023 Scrivener Publishing LLC

265

266  Modern Forensic Tools and Devices

11.1 Introduction It is well established that trace evidences are the most intricate amount of evidences that can be found at a crime scene or suspects or victims related to the scene. Trace evidences have a crucial role to play in crime scene reconstruction process and its importance been clearly validated in Locard’s exchange principle. According to this principle exchange in particles of two objects takes place whenever they come in contact with each other [1]. This principle comes into application in a crime scene reconstruction process, where a probable suspect, a victim and the scene where the crime has occurred can be linked to each other, all based upon the type and amount of trace evidence found and their transference. When evidences are recovered from a crime scene or from the near vicinity of a victim, generally these evidences in question are compared to substances that are collected from a verified source. This institutes the fact that recent practices in the field of forensics not solely but to a great extent depend upon a comparative analysis of suspected evidence to a reference standard. Chemical constituent obtained from different forms of evidences obtained at a crime scene is a very common practice in the field of forensic toxicology [2]. Immunoassays such as enzyme linked immunosorbent assay (ELISA) or radio immunoassay (RIA) are frequently used to analyze biological samples. Although the primary concept behind such methodologies use antigen-antibody interactions, the applications of such strategies are limited to samples such as urine or blood serum [3]. Strategies such as ELISA and RIA have shortcomings such as high rates of false positives and negatives, lack in quantitative applications and specificity. On the contrary, there is a need of specific strategies that could overcome these shortcomings. Sensor-based technologies have reportedly been developed and are used to overcome the shortcomings exhibited by immunoassays. Although the shortcomings of immunoassays could be overcome by the utility of immunosensors, there is a room for improvement for the analysis of samples such as biological fluids and other complex samples. Microbe/pathogen sensing in the field of forensic toxicology is done by the use of DNA-based biosensors or more commonly known as genosensors [4]. Aptamers are short sequences of oligonucleotide or peptide molecules that bind to a specific target. Aptamer based biosensors or aptasensors have been utilized for forensic applications biological evidence detection, illicit drug detection, poison analysis and explosive detection [5]. Other types of biosensors i.e. enzymatic biosensors imply upon the immobilization of an enzyme with

Sensor-Based Devices for Trace Evidence  267

Surface Plasmon Resonance

Direct

Enzymatic biosensors

Piezoelectrical Immunosensors Optical Immunosensors

Indirect

Aptameric biosensors

Immunosensors Genosensors and cell-based biosensors

Electrochemical Impedance Spectroscopy

FRET Fluorescence Chemiluminescence

Electrochemical Immunosensors

Amperometric Voltammetric Potentiometric Immunosensors Immunosensors biosensors

Figure 11.1  An account of different sensor-based devices for trace evidence analysis in forensic science.

an explicit analyte upon the electrode surface. Further any physical or chemical changes that would occur would be quantified [6]. The primary objective of this chapter is to culminate all of the sensing technologies developed till date corresponding to forensic analysis. The primary focus in this chapter has been given to immunosensors, genosensors, cellbased biosensors, aptasensors and enzymatic sensors (Figure 11.1) for trace evidence analysis. The categorization of the types of sensors in this chapter has been done upon the basis of strategies involved in the detection of different analytes holding a relevance to forensic science.

11.2 Immunosensors in Forensic Science The basic principle behind the working of an immunosensor is the contact between an antigen and an antibody. The interaction between an antibody and an antigen causes a specific immunochemical reaction that are further quantified by direct or indirect means. The direct means of immunochemical reaction sensing involves the utility of label-free sensing strategies. In the direct approach, the binding of the antibody to the sample analyte (the antigen) is screened through mapping the fluctuations in the physiochemical properties of the analyte. Unlike direct approaches, indirect means of immunosensing emphasizes upon the labelling of the antibody or the

268  Modern Forensic Tools and Devices

EIS

Illicit drug detection Degraded fingerprint analysis

SPR

Detection of toxins Warfare agent

Piezoelectric sensors

Illicit drug detection Explosives

Illicit drug detection

Figure 11.2  Direct immunosensors and their application in forensic science.

antigen with a signaling molecule. The examples of direct approaches of immunosensing include piezoelectric immunosensing, electrochemical impedance spectroscopy (EIS) and surface plasmon resonance (SPR). An overview of the applications of direct immunosensing strategies is depicted in Figure 11.2. Optical sensing strategies such as fluorescence, chemiluminescence and Fourier resonance energy transfer (FRET) etc., and electrochemical sensing, account for the indirect strategies for immunosensing [7]. The classification of immunosensors on the basis of sensing strategy involved have been classified into direct and indirect immunosensing approaches.

11.2.1 Direct Immunosensing Strategies The direct immunosensing strategies corresponding to forensic application consists of approaches such as Surface Plasmon Resonance, Electrochemical impedance Spectroscopy and Piezoelectric Immunosensing. A detailed emphasis upon these two techniques have been emphasized the sections 11.2.1.1 and 11.2.1.2 respectively.

11.2.1.1 Surface Plasmon Resonance SPR is an optical strategy that utilizes the production of plasmons. SPR based immunosensors corresponding to applications in forensic science

Sensor-Based Devices for Trace Evidence  269

Table 11.1  SPR-based immunosensor for forensic applications. Analyte immobilization methodology

Limit of detection (LOD)

References

31 µg/kg

[8]

Analyte type

Example

Sample used

Toxins

Okadaic acid, dinophysistoxins

Shellfish matrix

Oxalic acid immobilized to oxalic acid antibodies

Domoic acid

Shellfish matrix

Domoic acid conjugated with BSA

Palytoxin

Seafood matrix (grouper and clam)

Covalent coupling

2.8 ng/ml and 1.4 ng/ml

[10]

Saxitoxin, neosaxitoxin, gonyautoxins

Shellfish matrix

Flow injection

10,000 ng/ml

[11]

[9]

(Continued)

270  Modern Forensic Tools and Devices

Table 11.1  SPR-based immunosensor for forensic applications. (Continued)

Analyte type

Example

Sample used

Analyte immobilization methodology

Limit of detection (LOD)

References

Saxitoxin

Seafood samples

Covalent coupling

2.93–10.6 ng/ml

[12]

Saxitoxin

Shellfish matrix

Covalent coupling

2.02–6.40 ng/ml

[13]

Tetrodotoxin

European sea food matrix

Chip functionalization via covalent bond with ethylenediamide

200 µg/kg

[14]

Microcystin

Drinking water

Covalent immobilization

73 ± 8 ng/ml

[15]

Botulinum neurotoxins

Serum and stool samples

Selective immobilization

6.76 pg/ml

[16]

(Continued)

Sensor-Based Devices for Trace Evidence  271

Table 11.1  SPR-based immunosensor for forensic applications. (Continued) Sample used

Analyte immobilization methodology

Limit of detection (LOD)

References

Analyte type

Example

Illicit drugs

Cocaine

Saliva sample

Physical adsorption of protein– analyte complex upon gold surface

8–10 ng/ml

[17]

MDMA

Saliva sample

Physical adsorption of protein– analyte complex upon gold surface

20–25 ng/ml

[17]

Ractopamine

Urine samples, liver samples

RCT derivative immobilised onto sensor chip using Biacore Q instrument

500 µg/ml

[18]

Morphine-3glucoronide

Human urine samples

Flow injection

3 ng/ml

[19]

(Continued)

272  Modern Forensic Tools and Devices

Table 11.1  SPR-based immunosensor for forensic applications. (Continued) Sample used

Analyte immobilization methodology

Limit of detection (LOD)

References

Analyte type

Example

Chemical and biological warfare agents

Cyanazine

Drinking water

Molecular imprinting

0.095 nM

[20]

Simazine

Drinking water

Molecular imprinting

0.031 nM

[20]

Atrazine

Drinking water

Molecular imprinting

0.091 nM

[20]

Atrazine

Wastewater

Molecular imprinting of plastic antibodies

0.7134 ng/ml

[21]

(Continued)

Sensor-Based Devices for Trace Evidence  273

Table 11.1  SPR-based immunosensor for forensic applications. (Continued) Analyte immobilization methodology

Limit of detection (LOD)

References

Analyte type

Example

Sample used

Explosives

TNT

-

π-stacking methodology used to functionalize TNT recognition peptide onto SWCNT

772 ppb

[22]

TNT

-

Direct immobilization onto sensor chip

3.4 ppm

[23]

MDMA, 3,4-methylenedioxymethamphetamine; BSA, Bovine Serum Albumin; TNT, 2,4,6-Trinitrotoluene; SWCNT, Single-Walled Carbon Nanotubes.

274  Modern Forensic Tools and Devices has been used for detection of illicit drugs such as methamphetamine and cocaine metabolites. The primary role of SPR based immunosensors is to establish an affinity and kinetics relationship among different biomolecules. Quantification of receptor-ligand interaction and nucleic acid hybridization also constitute the roles of a SPR immunosensor [24]. The chief constituent of an SPR based immunosensor include a light source, a prism, a surface for transduction purposes, an antibody or an antigen, a flow system and a detector [25]. A coherent charge density wave prevailing with two different surfaces simultaneously, in which the dielectric constants these surfaces remain contradictory is known as a surface plasmon. Basically, in this approach of immunosensing, biomolecules such as antibodies are fixed onto a metal surface, upon which polarized light from a source is irradiated via prism and further introduced onto the target analyte. The polarized light from the source is reflected by the metal surface and then the grit of the reflected light is analyzed and measured. Further, when the biomolecules are fixed onto the target analyte, an alteration in the SPR angle is detected which solely depends upon the concentration of the target [26, 27]. The use of chromatographic methods for illicit drug detection is very evident. Such strategies although providing accurate results, exhibit some shortcomings. Such shortcomings include non-feasibility. Prerequisites such as complex treatment protocols and tedious procedures are other shortcomings that account for the urgent requirement for novel strategies for illicit drug sensing. SPR-based immunosensors on the contrary tend to overcome such disadvantages of chromatographic techniques. Illicit drugs such as cocaine, methamphetamine, morphine, ecstasy etc. can be deduced with the help of SPR-based biosensors. SPR-based immunosensors have also been used for the detection of toxins, warfare agents and explosives, all of which holds a great significance in forensic analysis. An account of the applications of SPR-based immunosensor is exhibited in Table 11.1.

11.2.1.2 Electrochemical Impedance Spectroscopy Electrochemical impedance spectroscopy based immunosensing is a strategy that provides a wide spectrum for mapping the interfacial reaction mechanism between an analyte and the electrode upon which the analyte has been immobilized [28]. EIS also provides a platform for rapid detection of biomolecular interactions [29]. Chemical transformations and processed related to alterations in the conductivity in an electrochemical circuit are measured via an EIS-based immunosensor.

Sensor-Based Devices for Trace Evidence  275 As discussed prior in the chapter, EIS based immunosensing is a labelfree strategy that is used to probe the interaction between an antigen and an antibody [28]. EIS-based strategy enables an expert to monitor label-free affinity interactions in real-time [30, 31]. The range of applications of EIS-based immunosensors is evident in molecular biology and chemistry, but its applications is not limited to the aforementioned fields. However, the utilization of EIS-based immunosensor is limited in the field of forensic science. EIS-based immunosensors have found their application in the analysis of ageing fingerprints [32]. In this particular study, the physiochemical alterations that could have occurred to the fingerprints obtained from a non-porous surface is measured through EISbased immunosensor. EIS-based strategy has also been used for the label free detection of the genetic material deoxyribose nucleic acid (DNA) with a detection limit of 25 fmol [33].

11.2.1.3 Piezoelectric Immunosensors Piezoelectric quartz crystals have been integrated in instruments to utilize them as immunosensors [34]. The basic working principle in a piezoelectric immunosensor is that the mass sensitivity of the piezoelectric quartz crystals is utilized in response to the biomolecule and analyte (antigen-antibody) interaction. Some of the advantages of piezoelectric immunosensors include high sensitivity, specificity, rapid sensing capability and high stability etc. [35]. Piezoelectric immunosensors find their applications mainly in the determination of illicit drugs as trace evidences in forensic science. Illicit drugs such as cocaine and ecstasy have been quantified by the use of piezoelectric immunosensors. In a study reported by [36], cocaine metabolite benzoylecgonine-1,8-diamino-3,4-dioxaoctane (BZE-DADOO) as an analyte was detected using sheep antibody (IgG). The limit of detection reported in this study was about 100pmol/l. Different other works related to piezoelectric immunosensors being used for the detection of illicit drugs such as cocaine and ecstasy have been reported. The detection limits corresponds to 100 ng and 200 ng respectively [37]. Piezoelectric sensors for cocaine detection have been extensively used, [38] reported a limit of detection of cocaine in the range of 10-300 µg/l using benzoylecgonine as the metabolite for cocaine. Methamphetamine is another stimulant drug that has been detected from human urine using piezoelectric immunosensors. The detection limit was established as 0.02-100 ppm [39].

276  Modern Forensic Tools and Devices

11.2.2 Indirect Immunosensing Strategies The indirect method of immunochemical sensing used for the analysis of trace evidences in forensic science corresponds to strategies such as optical and electrochemical sensing. A detailed emphasis on the type of indirect immunosensing strategies has been given in the section 11.2.2.1 and 11.2.2.2.

11.2.2.1 Optical Immunosensors Immunosensing strategies that require a label to analyze the antigen-­ antibody reaction include optical and electrochemical immunosensing strategies. Emphasizing upon optical immunosensing strategies, these approaches have gained immense interest in terms of trace evidence analysis in the field of forensic science. Surface plasmon resonance is a type of optical immunosensing strategy that requires no labels for analyzing the antigen–antibody interactions; hence, it has been placed under 11.2.1 section of this chapter. Apart from SPR, optical immunosensing strategies involve other methods of detection such as FRET-based, chemiluminescence-based and fluorescence-based [40]. Optical-based immunosensors tend to measure the changes in the phase, velocity of light polarization and the frequency of the light source which would be analogous to the formation of antigen-antibody complex [41]. Fluorescence resonance energy transfer (FRET) based immunosensors are another type of optical sensors that have been used for the detection of microbes [42]. In this study, FRET-based optical immunosensor was developed for the rapid detection of Salmonella typhimurium (S. typhimurium). This sensing platform constituted labelled antibodyprotein G complexes. The antibody component of the sensor was labelled with Alexa Flour 546 fluorophores and the analyte (protein G) were labelled with Alexa Flour 594 fluorophores. The aforementioned complex was further immobilized onto tapered silica fibers to form a rapid sensing platform. The limit of detection for S. typhimurium in this work ranged from 103-105 CFU/ml. Microbial detection in forensic science is an important aspect as it keeps issues such as bioterrorism and pathogenic outbreaks in check [2]. Some of the most common infectious agents that are responsible for pathogenic outbreak include Listeria monocytogenes (L. monocytogenes), Escherichia coli (E. coli), Salmonella enterica (S. enterica). A multiplex biosensing platform for the detection of the aforementioned pathogens was

Sensor-Based Devices for Trace Evidence  277

Table 11.2  Optical biosensors for detection of biological warfare agents (Reproduced with permission from [43]). Specific material in biosensor

Limit of detection

Other specifications

The modified dots interacted with 2,6-dipicolonic acid; it resulted in change of fluorescence color

Manganese-doped carbon dots with ethylene diamine and ethylenediamine tetraacetic acid with bound EuIII

0.1 nmol/L

Results within 1 min

[44]

Photonic sensor immobilized single stranded DNA; interaction with DNA from sample causes resonant wavelength shift

Photonic crystal sensor with total-internalreflection modified with DNA

0.1 nmol/L

Results within 1h

[45]

Analyte

Principle

2,6-dipicolonic acid – a marker of Bacillus anthracis

DNA from Bacillus anthracis

References

(Continued)

278  Modern Forensic Tools and Devices

Table 11.2  Optical biosensors for detection of biological warfare agents (Reproduced with permission from [43]). (Continued) Analyte

Principle

Specific material in biosensor

Limit of detection

Other specifications

DNA from Francisella tularensis

Optical inteferometry using DNA probes

Long-period fiber gratings

1 ng

Results within 20 min

[46]

Bio-layer interferometry based on fiber optic biosensors and standard 96-well microplates

104 CFU/ mL for Francisella tularensis and 10 pg/ mL for ricin

Results within 17 min

[47]

Francisella Optical inteferometry tularensis and using immobilized ricin antibodies and antibodies labelled with alkaline phosphatase—the enzyme finally caused a deposition of insoluble crystals, which was measured by the interferometry

References

(Continued)

Sensor-Based Devices for Trace Evidence  279

Table 11.2  Optical biosensors for detection of biological warfare agents (Reproduced with permission from [43]). (Continued) Specific material in biosensor

Limit of detection

Other specifications

Botulinum toxin Botulium toxin A converting fluorogenic peptide containing SNAP25 precursor located on graphene oxide, fluorescence resonance energy transfer is measured

Graphene oxide modified with a peptide

1 fg/mL

Selective for light chain of Botulinum toxin A

[48]

Botulinum toxin A

Fluorogenic peptide

1.25 nmol/L

Assay of 16 samples contemporary

[49]

Analyte

Principle

Botulium toxin convert fluorogenic peptide containing SNAP25 precursor, fluorescence is measured by CCD photodetector

References

280  Modern Forensic Tools and Devices reported in the work of [50]. The antibody-analyte complex constituted of monoclonal antibodies labelled with Alexa Fluor 647. The analyte component of the biosensor was a fiber optic sensor Analyte 2000, made especially for detection of foodborne pathogens. The samples used in this study constituted of ready to eat beef, turkey and chicken meats. The detection limits obtained for each sample was found to be approximately 103 CFU/ ml. Illicit drug detection in forensic science is another aspect where the utilization of optical immunosensors is vital. A recent example for this regard has been reported in the work of [51]. In this research, an anti-­ cocaine aptamer named as MNS 4.1 was functionalized onto Thioflavin T (ThT). This complex when analyzed with biological fluids such as human saliva and human urine gave a confirmatory presence of cocaine. This complete research was based on a “mix-an-detect” strategy. The limit of detection of cocaine in this study was reported to be 250 nM. Chemiluminescence based optical immunosensors have also been developed for the rapid and highly sensitive detection of cocaine. A chemiluminescence complex i.e., luminol/H2O2 intercalated with mesoporous silica nanoparticles labelled with a cocaine aptamer has been used to detect cocaine in serum samples. The reported detection limit was 1.43 µM of cocaine [52]. Bioterrorism uses biological warfare agents, which is another rising concern. In terms of forensic science, analysis of biological warfare agents is a must, as it would assist the concerned population against an imminent threat posed by such warfare agents. Optical biosensors have been extensively utilized for the biosensing of biological warfare agents [53, 54]. A tabular depiction of optical biosensors for the detection of biological warfare agents is given in Table 11.2.

11.2.2.2 Electrochemical Immunosensors The electrochemical immunosensors work upon the principle that during the formation of antigen-antibody complex, the alterations in the electrical signal, i.e., either an increase or decrease is quantified [41]. The application of electrochemical immunosensor is evident as such analytical approaches are cost-feasible, easy to handle and run, transportable etc. With the advent of technological advances, electrochemical immunosensors have become more sensitive, specific and rapid. These characteristics of electrochemical immunosensors have made them a suitable approach for wider range of applications in forensic science [55] and as well as in clinical diagnosis [56]. The electrochemical biosensors are

Sensor-Based Devices for Trace Evidence  281 further classified into amperometric, potentiometric and voltammetric electrochemical immunosensors. Amperometric electrochemical immunosensors – These biosensors began attracting attention when it was established that potentiostatic protocols are proficient in perceiving alterations in the dielectric characteristics of an electrode surface [57]. The amperometric electrochemical immunosensor has been extensively utilized for the determination of illicit drugs such as methamphetamine. In a study reported by [58]. an amperometric sensing platform was created using Prussian blue deposited/l-cystine-modified electrode engraved into nano-Au/ (3-mercaptorpropyl) trime-thoxysilane film. The gold nanoparticles were exploited for the amperometric immunosensing platform in order to detect methamphetamine from human blood samples. The amperometric immunosensor has a recovery rate of approximately 96%. Ecstasy and its metabolites, another common illicit drug was detected using the amperometric biosensing platform from biological samples such as saliva and urine. The limit of detection for ecstasy was reported to be approximately 0.36 ng/ml from human saliva samples and 0.042 ng/ml from human urine samples [59]. Methamphetamine in human urine samples have also been detected via amperometric immunosensing. The detection strategy utilized electrodes made out of carbon paste and Ag/AgCl. The biorecognition element utilized in this strategy was monoclonal anti-methamphetamine antibodies. This biosensing platform provided a rapid analysis of methamphetamine with a limit of detection 1500 ng/ml [60]. Amperometric electrochemical immunosensors have also been utilized for the detection and analysis of explosives such as 2,4,6-trinitrotoluene [61]. In forensic science the study of arsenic and cyanide-based poisons are the most common. Amperometric biosensors have been repeatedly utilized for the sensing of arsenic-based poisons [62–64]. Potentiometric electrochemical immunosensors – These biosensing platforms monitors the activity of ions in an electrochemical reaction. These alterations in the activity of ions occur when the antigen-antibody complex is formed. Such sensors tend to determine the mass charge potential at a working electrode, antagonistic to the reference electrode. The current at the reference electrode stays nil [24]. Potentiometric electrochemical immunosensors have been utilized for the trace evidence analysis corresponding to forensic science. The major applications of this biosensing platform lies in poison analysis, toxin analysis and biological warfare agent detection etc.

282  Modern Forensic Tools and Devices Voltammetric electrochemical immunosensor – Another widely used biosensing platform that incorporates the measurement of current and potential. Voltammetric biosensing enables an expert for a multiplexed determination of analytes in a sample [65]. Due to its intrinsic characteristics such as absence of background noise, voltammetric biosensing is highly sensitive [66]. The applications of voltammetric immunosensors lies in arsenic poison detection, detection of toxins, illicit drug detection such as cocaine, codeine and morphine and explosive detection etc. A general description of the aforementioned electrochemical biosensors has been mentioned. These biosensors have been extensively utilized for the detection of trace evidences such as poisons, toxins illicit drugs, explosives and chemical and biological warfare agents.

11.3 Genosensors and Cell-Based Biosensors in Forensic Science Genosensors or DNA-based biosensors play a very vital role in the detection of pathogens. Pathogens or infectious microorganisms are responsible for transmitting diseases, causing toxicity to food substances, contamination of water and pathogenic outbreaks. In order to mitigate and detect such issues, biosensors with high specificity and sensitivity are required. Genosensors or DNA-based biosensors are utilized to detect such pathogenic agents. DNA-based biosensors apart from being highly specific and sensitive, are also robust and rapid. DNA-based biosensors incorporate nanomaterials that give an edge to the developed biosensors [67]. Enhanced detection of pathogenic agents are exhibited by the utilization of DNA-based biosensors, and such biosensors can also detect infectious agents in biological fluids such as blood [68]. DNA-based biosensors have also been incorporated with self-assembled monolayers (SAMs) that have greatly improved the detection limits for pathogens. In a study by [69] a biosensing platform was synthesized where a ternary surface monolayer was coupled with co-assembled capture probes and horseradish peroxidase/tetramethylbenzidine (TMB). The capture probes used here was, mercaptohexanol, and dithiothereitol. The detection limit of this biosensing platform was in the zeptomole range, approximately 40 zmol in 4-µl sample volume. As mentioned in section 11.2.2.1 bioterrorism and food-security are some of the primary issues that needs urgent attention. Advent of novel

Sensor-Based Devices for Trace Evidence  283 pathogens or modified strains of infectious agents serve as the chief reasons behind the emergence of such issues. In order to detect, analyze and mitigate the transmission of such pathogens, cell-based biosensors (CBB) have been developed. This biosensing platform analyses the functionality or the biological activity of the sample via screening the alterations in the physiological activities of the mammalian cells upon exposure. A popular example to the CBB platform is the utilization of B lymphocyte Ped-2E9 cell line as the sensing element. This sensing element is further encapsulated with a collagen matrix that appears as a three-dimensional scaffold. This biosensor could clearly distinguish between the pathogenic and non-pathogenic cell by screening the interaction between the analyte and the mammalian cell. The screening is carried out by measuring the optical characteristics of cellular metabolites and intracellular enzymes. This platform could further distinguish between active and inactive toxins. Apart from such broad sensing application, the CBB platform could also detect different bacterial pathogens with a high sensitivity ranging from 103-104 cfu ml-1 [70].

11.4 Aptasensors in Forensic Science Aptamers are short sequences of oligonucleotides and peptide molecules. Aptasensors corresponding to its utility in forensic science are rapid, highly specific and sensitive. The aptasensors despite being effective, the commercial utility of such biosensing strategy is less. In order to create an aptamer-based biosensing platform, it is first necessary to select an appropriate aptamer, followed by aptamer sequence monitoring and quantification of aptamer affinity [5]. The biosensing-platforms that can be formed by aptamers can be classified into three distinctive categories that include, optical aptasensors, electrochemical aptasensors and masssensitive aptasensors (Figure 11.3). Optical aptamer biosensing platform was first introduced in the year 1998. The first biosensor to employ the aptamers as molecules for analyte determination constituted the incorporation of L-adenosine and FITClabelled molecules to an RNA ligand. This complex was further engraved on the surface of an optical fiber [71]. Optical platforms for aptasensors have gained popularity in two most commonly used approaches. The former one is the aptamer-beacon assay and the latter one corresponds to hybridized DNA displacement assay [72]. There is a traditional format

284  Modern Forensic Tools and Devices Aptamer-based biosensing platforms

Optical Aptamerbased biosensing

Electrochmical Aptamer-based biosensing

Mass-sensitive Aptamer-based biosensing

Aptamer-beacon

Target-induced structure switching (TISS)

Surface Acoustic Wave (SAW)

Hybridized DNA assay

Sandwich electrochemical aptasensors

Quartz Crystal Microbalance (QCM)

Target-induced displacement (TID)

Microcantilever Assay

Competitive replacement

Figure 11.3  A pictorial representation of aptamer based biosensing platforms.

for the synthesis of molecular beacons that are used for the recognition of specific DNA molecules, similarly aptamer-beacons are created, where a short and complementary nucleotide sequence is attached to the ends of the aptamer sequence. These short and complementary nucleotide sequences attached at the ends of the aptamers are known as the fluorophore and the quencher [73]. Further, these nucleotide sequences i.e., the fluorophore and the quencher allow the aptamer to don a closed loop (hairpin) structure. The formation of this structure brings the quencher and the fluorophore in close proximity that limits the fluorescence output. On the contrary, in the presence of an analyte, the loop structure unwinds, which finally results into a fluorescence emission [72]. The working of the hybridized DNA displacement assays is similar to that

Sensor-Based Devices for Trace Evidence  285

Table 11.3  Applications of aptasensors in trace evidence analysis. Nanomaterial/ electrode Forensic system application mediated Analyte Biological evidence detection

Illicit Drug detection

Au NPs

Aptamer sequence/name LOD

Sensing platform

Aptamer concentration References

Thrombin

Thrombin binding aptamer

8.9 pM Fluorometric sensing

-

[80]

Salivary Cortisol

DNA cortisol-aptamer

0.5Lateral flow 0.15 biosensing ng/ ml

3.3 µM

[81]

Au-MOS2 NPs Cocaine

5 -CCATAGGGAGACAAG 7.49 Colorimetric GATAAATCCTTCAAT nM sensing GAAGTGGGTCTCCC-3

50 nM

[82]

AuNPs

Anti-cocaine aptamer

2 µM

Colorimetric sensing

20 µM

[83]

DNA Hairpin aptamer

5 µM

Colorimetric sensing

4 µM

[84] (Continued)

286  Modern Forensic Tools and Devices

Table 11.3  Applications of aptasensors in trace evidence analysis. (Continued) Nanomaterial/ electrode Forensic system application mediated Analyte

Aptamer sequence/name LOD Monolithic, Double Fragment Aptamer and Triple Fragment Aptamer

Explosive detection

Sensing platform

100 Colorimetric µM sensing

Aptamer concentration References -

PT-Pala electrode

Benzoylecognine (Cocaine metabolite)

Au@Ag core shell NPs

Methamphetamine DNA aptamer

0.5 nM Colorimetric sensing

-

[87]

Cocaine

3.3. Colorimetric nM sensing

-

[88]

2.43 Piezoelectric ppb cantilever sensing

-

[89]

rGO

Cocaine aptamer 1.5 nM Differential 3.5 mM 5′- C6−NH2−AGACAAGG pulse AAAATCCTTCAATGA voltammetry AGTGGGTCG−SH2-3

[85]

DNA aptamer

2,4-dinitrotoluene Peptide aptamers

Au nanoprobes TNT

TNT-sensitive DNA aptamers

1 ppb

Electrochemical 0.1mM sensing

[86]

[90]

Au, Gold; MOS2, Molybdenum sulphide; TNT, 2,4,6-Trinitrotoluene; Ag, Silver; rGO, reduced graphene oxide; NPs, Nanoparticles; µM, micromolar; nM, nanomolar; ppb, parts per billion.

Sensor-Based Devices for Trace Evidence  287 of aptamer-beacon assay, but instead of the quencher and fluorophore sequence attached at the ends of the aptamer sequence, an antisense quencher sequence is bound to the fluorescent aptamers. In the presence of an analyte the quencher sequence dissociates with the aptamer sequence [74]. The electrochemical aptamer biosensing platform is acquiescent in the field of forensic science because of their outstanding capabilities in the analysis of analytes with turbid media [75]. According to a study the electrochemical platform for aptasensors are categorized into four classes i.e., target-induced structure switching (TISS), sandwich electrochemical aptasensors, target-induced displacement (TID) and competitive replacement [76]. Amongst these biosensing platforms, the TISS electronic aptasensor is more frequently used for forensic analysis. The last biosensing platform for aptamer-based biosensor is the mass-sensitive platform. According to [77] the mass-­sensitive platform of aptasensors can be classified into the following categories i.e., Surface Acoustic Wave (SAW), Quartz Crystal Microbalance (QCM) and microcantilever assay. The SAW and QCM-based aptameric biosensors incorporate the production and recognition of acoustic waves by the electrodes immobilized on the surface of aptamer-incorporated with piezoelectric crystals [78]. The microcantilever assay is more of a physical method in which the changes in mechanical stress is measured with the help of thin silicon or polymer-based micromechanical beams (cantilevers) [79]. A depiction of the applications of aptasensors in various fields of forensic science is given in a tabular form (Table 11.3).

11.4.1 Forensic Applications of Aptasensors The applications of aptamer-based biosensors range from the analysis of biological fluids or body fluids when spoken about biological evidences. A FRET-based aptasensor assay has been reported in the work of [80] which utilizes protein-induced fluorescence enhancement (PIFE) based detection of DNA aptamer that binds to thrombin in human serum samples. The thrombin detection using this methodology exhibited a detection limit of 8.9 pM. Another example of biological fluid assay via aptasensors is the analysis of salivary cortisol presented in the work of [81]. In this work of Dalirirad et al., 2020, an ­aptamer-based lateral flow biosensor was created which constituted of a duplex aptameric complex, immobilized to the surface of gold nanoparticles. Saliva sample constituting cortisol is then added to the aptameric complex, further inducing changes to the cortisol-aptamer

288  Modern Forensic Tools and Devices confirmation. The limit of detection of cortisol was reported to be 0.5-0.15 ng/ml. Aptameric biosensors have been extensively utilized for the detection of illicit drugs such as cocaine and methamphetamine. In a research study reported by [82], molybdenum disulphide conjugated to gold nanoparticles were functionalized onto an cocaine aptamer sequence, (5-CCATAGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC-3). This complete method was based upon colorimetric sensing and reported a limit of detection of approximately 7.49 nM. Other aptasensor-based detection methods of cocaine included the utilization of different aptamers such as the anti-cocaine aptamer [83] with a detection limit of 2 µM. [84] reported the usage of a DNA hairpin aptamer for the detection of cocaine with a limit of detection of 5 µM. A novel duplexed detection method for illicit drugs namely methamphetamine and cocaine was reported by [88]. The limit of detection for methamphetamine was approximated around 0.5 nM and 3.3 nM for cocaine. Explosives detection as a part of trace evidence analysis holds a significant place in forensic sciences. In order to achieve real-time detection of explosives, biosensors with high specificity, reliability and rapid processing times are required. This objective could be achieved by the utilization of aptamer-based biosensors. A research published by [89] reports the usage of highly selective reduced graphene oxide (rGO) sensor incorporated with a peptide aptamer to detect the by-product of trinitrotoluene (TNT) i.e., dinitrotoluene (DNT). The limit of detection for the same was approximately around 2.43 parts per billion (ppb). Another study exhibiting the detection of TNT with the help of DNA aptamers was reported by [90].

11.5 Enzymatic Biosensors in Forensic Science Biomolecule detection in the field of forensic science requires the development of tools that could analyze samples effectively and at a rapid rate. These tools act as a portable means for on-site analysis of samples that holds forensic significance. Also, these tools act as a complementary strategy for analytical techniques, for example, high performance liquid chromatography (HPLC), gas chromatography or mass spectroscopy etc. These tools are given the term enzymatic biosensors. Generally, an enzymatic biosensor is composed of two distinctive components i.e., a bioreceptor and the transducer. A bioreceptor, apart from an enzyme can be a DNA probe or an antibody, which is used to recognize the targeted sample. Antibodies and aptamer sequences are commonly employed for the development of a

Sensor-Based Devices for Trace Evidence  289 biosensor, but enzymatic biosensors exhibit a broader range of applications in forensic science. Apart from trace evidence analysis in forensic science, enzymatic biosensors are also used for environmental screening as well as clinical diagnostics [91]. The second component of an enzymatic biosensor is the transducer that changes biochemical signals into electrical signals. Biochemical signals are generated when the bioreceptor interacts with a target analyte (sample). Enzymatic biosensors are developed when an enzyme is functionalized onto a transducer. Strategies for enzyme immobilization may vary according to the required application. The enzyme immobilization strategies can be classified into five distinctive categories i.e. Adsorption, Covalent immobilization, entrapment immobilization, cross-linking and affinity immobilization. As this chapter discusses about the usage of sensor-based devices for trace evidence analysis, the applications of enzymatic biosensors are described as follows.

11.5.1 Applications of Enzymatic Biosensors for Trace Evidence Analysis Enzymatic biosensors have been developed for the detection of explosives such as tetryl and trinitrotoluene. An innovative ion-selective field effect transistor (ISFET)-based enzymatic biosensor has been developed for the purpose of explosive detection. Nitroreductase enzyme obtained from E. coli has been utilized as the biorecognition element in this sensor design. The principle motive behind the selection of nitroreductase enzyme as it offers high sensitivity toward nitrogen containing aromatic compounds. The enzyme was immobilized onto the ISFET surface by the means of self-assembly. The detection limit exhibited by the application of this sensor design was measured as 70 µM for tetryl and 91 µM for trinitrotoluene [92]. The use 2,4-Dinitroanisole (DNAN) as a more convenient replacement of 2,4,6-Trinitrotoluene (TNT) has been a growing concern for the national security. A novel enzyme-based biosensor has been designed for the optimum demineralization of DNAN. The biorecognition element is an enzyme known as DNAN demethylase, which is obtained from Nocardioides strain [93].

11.6 Conclusion Different analytical techniques such as UV-visible spectroscopy, high performance liquid chromatography, mass spectrometry, nuclear magnetic

290  Modern Forensic Tools and Devices resonance and X-ray diffraction have been utilized for evaluation of samples that hold a forensic significance. Although these approaches are reliable and highly specific, they do not offer portability and real-time, on-site analysis of samples. Biosensing platforms act as a complementary tool to these analytical techniques that allow a forensic expert to perform rapid tests on-site with accuracy. Biosensor development strategies may be easy or complex as per the type of analyte and application that it might be used for. The routine use of biosensors is still confined to a fewer samples due to analyte or sensor design complexity. Henceforth, major research efforts are required to overcome such hurdles. Also, to prepare biosensing platforms that are readily armed to analyze samples that are complex in nature and increase the reliability and sturdiness of biosensors, much research is required in the field of forensic biosensing. Issues such as storage conditions and stability of biosensors must also be addressed. It would be justifiable to state that sensor-based devices in the near future will play an important role for forensic applications. Addressing the real-world issues such as usage of terrorism, bioterrorism, pathogenic outbreaks, poison and toxin administration, counter-mechanisms are required to overcome such issues before-hand, biosensors provide an excellent platform that can be utilized for good.

References 1. Saferstein, R., Criminalistics: An Introduction to Forensic Science, Sixth Edition, Prentice Hall, Upper Saddle River, NJ, 2018. 2. Yáñez-Sedeño, P., Agüí, L., Villalonga, R., Pingarrón, J.M., Biosensors in forensic analysis. A review. Anal. Chim. Acta, 823, 1–19, 2014. https://doi. org/10.1016/j.aca.2014.03.011. 3. Chen, H., Liang, Y., Wang, M., Lv, P., Xuan, Y., Reverse ATRP of ethyl acrylate with ionic liquids as reaction medium. Chem. Eng. J., 147, 297–301, 2009. https://doi.org/10.1016/j.cej.2008.11.007. 4. Brettell, T.A., Butler, J.M., Almirall, J.R., Forensic science. Anal. Chem., 83, 4539–4556, 2011. https://doi.org/10.1021/ac201075e. 5. Gooch, J., Daniel, B., Parkin, M., Frascione, N., Developing aptasensors for forensic analysis. TrAC Trends Anal. Chem., 94, 150–160, 2017. https://doi. org/10.1016/j.trac.2017.07.019. 6. Hooda, V., Kumar, V., Gahlaut, A., Hooda, V., Alcohol quantification: Recent insights into amperometric enzyme biosensors. Artif. Cells, Nanomed., Biotechnol., 46, 398–410, 2018. https://doi.org/10.1080/21691401.2017.1315 426.

Sensor-Based Devices for Trace Evidence  291 7. Harshavardhan, S., Rajadas, S.E., Vijayakumar, K.K., Durai, W.A., Ramu, A., Mariappan, R., Electrochemical immunosensors, in: Bioelectrochemical Interface Engineering, Wiley Online Books, Hoboken, New Jersey, 2019, https://doi.org/10.1002/9781119611103.ch18. 8. Stewart, L.D., Hess, P., Connolly, L., Elliott, C.T., Development and ­single-laboratory validation of a pseudofunctional biosensor ­immunoassay for the detection of the okadaic acid group of toxins. Anal. Chem., 81, 10208–10214, 2009. https://doi.org/10.1021/ac902084a. 9. Stevens, R.C., Soelberg, S.D., Eberhart, B.-T.L., Spencer, S., Wekell, J.C., Chinowsky, T.M., Trainer, V.L., Furlong, C.E., Detection of the toxin domoic acid from clam extracts using a portable surface plasmon resonance biosensor. Harmful Algae, 6, 166–174, 2007. https://doi.org/10.1016/j.hal.2006.08.001. 10. Yakes, B.J., DeGrasse, S.L., Poli, M., Deeds, J.R., Antibody characterization and immunoassays for palytoxin using an SPR biosensor. Anal. Bioanal. Chem., 400, 2865, 2011a. https://doi.org/10.1007/s00216-011-5019-y. 11. Campbell, K., Huet, A.-C., Charlier, C., Higgins, C., Delahaut, P., Elliott, C.T., Comparison of ELISA and SPR biosensor technology for the detection of paralytic shellfish poisoning toxins. J. Chromatogr. B, 877, 4079–4089, 2009. https://doi.org/10.1016/j.jchromb.2009.10.023. 12. Yakes, B.J., Prezioso, S., Haughey, S.A., Campbell, K., Elliott, C.T., DeGrasse, S.L., An improved immunoassay for detection of saxitoxin by surface plasmon resonance biosensors. Sensors Actuators B Chem., 156, 805–811, 2011b. https://doi.org/10.1016/j.snb.2011.02.043. 13. Haughey, S.A., Campbell, K., Yakes, B.J., Prezioso, S.M., DeGrasse, S.L., Kawatsu, K., Elliott, C.T., Comparison of biosensor platforms for surface plasmon resonance based detection of paralytic shellfish toxins. Talanta, 85, 519–526, 2011. https://doi.org/10.1016/j.talanta.2011.04.033. 14. Campbell, K., Barnes, P., Haughey, S.A., Higgins, C., Kawatsu, K., Vasconcelos, V., Elliott, C.T., Development and single laboratory validation of an optical biosensor assay for tetrodotoxin detection as a tool to combat emerging risks in European seafood. Anal. Bioanal. Chem., 405, 7753–7763, 2013. https:// doi.org/10.1007/s00216-013-7106-8. 15. Herranz, S., Bocková, M., Marazuela, M.D., Homola, J., Moreno-Bondi, M.C., An SPR biosensor for the detection of microcystins in drinking water. Anal. Bioanal. Chem., 398, 2625–2634, 2010. https://doi.org/10.1007/ s00216-010-3856-8. 16. Patel, K., Halevi, S., Melman, P., Schwartz, J., Cai, S., Singh, B.R., A novel surface plasmon resonance biosensor for the rapid detection of botulinum neurotoxins. Biosensors, 7, 32–46, 2017. https://doi.org/10.3390/bios7030032. 17. Sonny, S., Sesay, A.M., Virtanen, V., Development of diagnostic SPR based biosensor for the detection of pharmaceutical compounds in saliva, in: Proc. SPIE, 2010, https://doi.org/10.1117/12.871116.

292  Modern Forensic Tools and Devices 18. Thompson, C.S., Haughey, S.A., Traynor, I.M., Fodey, T.L., Elliott, C.T., Antignac, J.-P., Le Bizec, B., Crooks, S.R.H., Effective monitoring for ractopamine residues in samples of animal origin by SPR biosensor and mass spectrometry. Anal. Chim. Acta, 608, 217–225, 2008. https://doi.org/10.1016/j. aca.2007.12.019. 19. Dillon, P.P., Manning, B.M., Daly, S.J., Killard, A.J., O’Kennedy, R., Production of a recombinant anti-morphine-3-glucuronide single-chain variable fragment (scFv) antibody for the development of a “real-time” biosensor-based immunoassay. J. Immunol. Methods, 276, 151–161, 2003. https://doi.org/10.1016/S0022-1759(03)00099-1. 20. Saylan, Y., Akgönüllü, S., Çimen, D., Derazshamshir, A., Bereli, N., Yılmaz, F., Denizli, A., Development of surface plasmon resonance sensors based on molecularly imprinted nanofilms for sensitive and selective detection of pesticides. Sensors Actuators B Chem., 241, 446–454, 2017. https://doi. org/10.1016/j.snb.2016.10.017. 21. Yılmaz, E., Özgür, E., Bereli, N., Türkmen, D., Denizli, A., Plastic antibody based surface plasmon resonance nanosensors for selective atrazine detection. Mater. Sci. Eng. C Mater. Biol. Appl., 73, 603–610, 2017. https://doi. org/10.1016/j.msec.2016.12.090. 22. Wang, J., Du, S., Onodera, T., Yatabe, R., Tanaka, M., Okochi, M., Toko, K., An SPR sensor chip based on peptide-modified single-walled carbon nanotubes with enhanced sensitivity and selectivity in the detection of 2,4,6-trinitrotoluene explosives. Sensors, 18, 4461–4468, 2018a. https://doi.org/10.3390/ s18124461. 23. Wang, J., Muto, M., Yatabe, R., Tahara, Y., Onodera, T., Tanaka, M., Okochi, M., Toko, K., Highly selective rational design of peptide-based surface plasmon resonance sensor for direct determination of 2,4,6-trinitrotoluene (TNT) explosive. Sensors Actuators B Chem., 264, 279–284, 2018b. https:// doi.org/10.1016/j.snb.2018.02.075. 24. Lim, S.A. and Ahmed, M.U., Chapter 1 Introduction to immunosensors, in: Immunosensors, pp. 1–20, The Royal Society of Chemistry, London, 2019, https://doi.org/10.1039/9781788016162-00001. 25. He, F., Qin, X., Bu, L., Fu, Y., Tan, Y., Chen, C., Li, Y., Xie, Q., Yao, S., Study on the bioelectrochemistry of a horseradish peroxidase-gold nanoclusters bionanocomposite. J. Electroanal. Chem., 792, 39–45, 2017. https://doi. org/10.1016/j.jelechem.2017.03.033. 26. Homola, J., Present and future of surface plasmon resonance biosensors. Anal. Bioanal. Chem., 377, 528–539, 2003. https://doi.org/10.1007/ s00216-003-2101-0. 27. Ritzefeld, M. and Sewald, N., Real-time analysis of specific protein-DNA interactions with surface plasmon resonance. J. Amino Acids, 2012, 816032, 2012. https://doi.org/10.1155/2012/816032. 28. Ramanavicius, A., Finkelsteinas, A., Cesiulis, H., Ramanaviciene, A., Electrochemical impedance spectroscopy of polypyrrole based

Sensor-Based Devices for Trace Evidence  293 electrochemical immunosensor. Bioelectrochemistry, 79, 11–16, 2010. https:// doi.org/10.1016/j.bioelechem.2009.09.013. 29. Katz, E. and Willner, I., Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors. Electroanalysis, 15, 913–947, 2003. https://doi.org/10.1002/elan.200390114. 30. Xiao, Y., Li, C.M., Liu, Y., Electrochemical impedance characterization of antibody–antigen interaction with signal amplification based on polypyrrole–streptavidin. Biosens. Bioelectron., 22, 3161–3166, 2007. https://doi. org/10.1016/j.bios.2007.02.008. 31. Lee, S.-J., Anandan, V., Zhang, G., Electrochemical fabrication and evaluation of highly sensitive nanorod-modified electrodes for a biotin/avidin system. Biosens. Bioelectron., 23, 1117–1124, 2008. https://doi.org/10.1016/j. bios.2007.10.025. 32. Rosa, R., Giovanardi, R., Bozza, A., Veronesi, P., Leonelli, C., Electrochemical impedance spectroscopy: A deeper and quantitative insight into the fingermarks physical modifications over time. Forensic Sci. Int., 273, 144–152, 2017. https://doi.org/10.1016/j.forsciint.2017.02.016. 33. Keighley, S.D., Estrela, P., Li, P., Migliorato, P., Optimization of label-free DNA detection with electrochemical impedance spectroscopy using PNA probes. Biosens. Bioelectron., 24, 906–911, 2008. https://doi.org/10.1016/j. bios.2008.07.041. 34. Ricci, F., Volpe, G., Micheli, L., Palleschi, G., A review on novel developments and applications of immunosensors in food analysis. Anal. Chim. Acta, 605, 111–129, 2007. 35. Chen, Y., Huang, X., Shi, H., Wang, Y., Research progress of piezoelectric immunosensors, in: 2011 Symposium on Piezoelectricity, Acoustic Waves and Device Applications (SPAWDA), pp. 286–289, 2011, https://doi.org/10.1109/ SPAWDA.2011.6167245. 36. Halámek, J., Makower, A., Skládal, P., Scheller, F.W., Highly sensitive detection of cocaine using a piezoelectric immunosensor. Biosens. Bioelectron., 17, 1045–1050, 2002. https://doi.org/10.1016/S0956-5663(02)00098-2. 37. Frisk, T., Sandström, N., Eng, L., van der Wijngaart, W., Månsson, P., Stemme, G., An integrated QCM-based narcotics sensing microsystem. Lab. Chip, 8, 1648–1657, 2008. https://doi.org/10.1039/B800487K. 38. Attili, B.S. and Suleiman, A.A., A piezoelectric immunosensor for the detection of cocaine. Microchem. J., 54, 174–179, 1996. https://doi.org/10.1006/ mchj.1996.0091. 39. Miura, N., Higobashi, H., Sakai, G., Takeyasu, A., Uda, T., Yamazoe, N., Piezoelectric crystal immunosensor for sensitive detection of methamphetamine (stimulant drug) in human urine. Sensors Actuators B Chem., 13, 188– 191, 1993. https://doi.org/10.1016/0925-4005(93)85358-H. 40. Monroe, D., Amperometric immunoassay. Crit. Rev. Clin. Lab. Sci., 28, 1–18, 1990. https://doi.org/10.3109/10408369009105895.

294  Modern Forensic Tools and Devices 41. Moina, C. and Ybarra, G., Fundamentals and applications of immunosensors, in: Advances in Immunoassay Technology, pp. 65–80, 2012. 42. Ko, S. and Grant, S.A., A novel FRET-based optical fiber biosensor for rapid detection of Salmonella typhimurium. Biosens. Bioelectron., 21, 1283–1290, 2006. https://doi.org/10.1016/j.bios.2005.05.017. 43. Pohanka, M., Current trends in the biosensors for biological warfare agents assay. Materials, 12, 2303–2318, 2019. https://doi.org/10.3390/ma12142303. 44. Rong, M., Liang, Y., Zhao, D., Chen, B., Pan, C., Deng, X., Chen, Y., He, J., A ratiometric fluorescence visual test paper for an anthrax biomarker based on functionalized manganese-doped carbon dots. Sensors Actuators B Chem., 265, 498–505, 2018. https://doi.org/10.1016/j.snb.2018.03.094. 45. Zhang, B., Petersen, R., Hussain, S., Ye, J.Y., Dallo, S., Weitao, T., Detection of anthrax lef with DNA-based photonic crystal sensors. J. Biomed. Opt., 16, 1–7, 2011. https://doi.org/10.1117/1.3662460. 46. Cooper, K.L., Bandara, A.B., Wang, Y., Wang, A., Inzana, T.J., Photonic biosensor assays to detect and distinguish subspecies of francisella tularensis. Sensors, 11, 3004–3019, 2011. https://doi.org/10.3390/s110303004. 47. Mechaly, A., Cohen, H., Cohen, O., Mazor, O., A biolayer interferometry-based assay for rapid and highly sensitive detection of biowarfare agents. Anal. Biochem., 506, 22–27, 2016. https://doi.org/10.1016/j.ab.2016.04.018. 48. Shi, J., Guo, J., Bai, G., Chan, C., Liu, X., Ye, W., Hao, J., Chen, S., Yang, M., A graphene oxide based fluorescence resonance energy transfer (FRET) biosensor for ultrasensitive detection of botulinum neurotoxin A (BoNT/A) enzymatic activity. Biosens. Bioelectron., 65, 238–244, 2015. https://doi. org/10.1016/j.bios.2014.10.050. 49. Balsam, J., Ossandon, M., Kostov, Y., Bruck, H.A., Rasooly, A., Lensless CCD-based fluorometer using a micromachined optical Söller collimator. Lab. Chip, 11, 941–949, 2011. https://doi.org/10.1039/C0LC00431F. 50. Ohk, S.-H. and Bhunia, A.K., Multiplex fiber optic biosensor for detection of Listeria monocytogenes, Escherichia coli O157:H7 and salmonella enterica from ready-to-eat meat samples. Food Microbiol., 33, 166–171, 2013. https:// doi.org/10.1016/j.fm.2012.09.013. 51. Wu, Z., Zhou, H., Han, Q., Lin, X., Han, D., Li, X., A cost-effective fluorescence biosensor for cocaine based on a “mix-and-detect” strategy. Analyst, 145, 4664–4670, 2020. https://doi.org/10.1039/D0AN00675K. 52. Chen, Z., Tan, Y., Xu, K., Zhang, L., Qiu, B., Guo, L., Lin, Z., Chen, G., Stimulus-response mesoporous silica nanoparticle-based chemiluminescence biosensor for cocaine determination. Biosens. Bioelectron., 75, 8–14, 2016. https://doi.org/10.1016/j.bios.2015.08.006. 53. Zhou, H., Liu, J., Xu, J.-J., Zhang, S.-S., Chen, H.-Y., Optical nano-biosensing interface via nucleic acid amplification strategy: Construction and application. Chem. Soc. Rev., 47, 1996–2019, 2018. https://doi.org/10.1039/ C7CS00573C.

Sensor-Based Devices for Trace Evidence  295 54. Li, Z., Zhang, W., Xing, F., Graphene optical biosensors. Int. J. Mol. Sci., 20, 2461–2484, 2019. https://doi.org/10.3390/ijms20102461. 55. Yáñez-Sedeño, P., Agüí, L., Campuzano, S., Pingarrón, J.M., What electrochemical biosensors can do for forensic science? Unique features and applications. Biosensors, 9, 127–156, 2019. https://doi.org/10.3390/bios9040127. 56. Hayat, A., Catanante, G., Marty, J.L., Current trends in nanomaterial-based amperometric biosensors. Sensors, 14, 23439–23461, 2014. https://doi. org/10.3390/s141223439. 57. Villagrasa, J.P., State of the Art in Biosensors, J. Colomer-Farrarons (Ed.), IntechOpen, Rijeka, 2013, https://doi.org/10.5772/52248. 58. Zhang, L.-Y. and Liu, Y.-J., Label-free amperometric immunosensor based on prussian blue as artificial peroxidase for the detection of methamphetamine. Anal. Chim. Acta, 806, 204–209, 2014. https://doi.org/10.1016/j. aca.2013.11.019. 59. Butler, D., Pravda, M., Guilbault, G.G., Development of a disposable amperometric immunosensor for the detection of ecstasy and its analogues using screen-printed electrodes. Anal. Chim. Acta, 556, 333–339, 2006. https://doi. org/10.1016/j.aca.2005.09.056. 60. Luangaram, K., Boonsua, D., Soontornchai, S., Promptmas, C., Development of an amperometric immunosensor for the determination of methamphetamine in urine. Biocatal. Biotransformation, 20, 397–403, 2002. https://doi. org/10.1080/1024242021000058685. 61. Giannetto, M., Maiolini, E., Ferri, E.N., Girotti, S., Mori, G., Careri, M., Competitive amperometric immunosensor based on covalent linking of a protein conjugate to dendrimer-functionalised nanogold substrate for the determination of 2,4,6-trinitrotoluene. Anal. Bioanal. Chem., 405, 737–743, 2013. https://doi.org/10.1007/s00216-012-6137-x. 62. Cosnier, S., Mousty, C., Cui, X., Yang, X., Dong, S., Specific determination of As(V) by an acid phosphatase–polyphenol oxidase biosensor. Anal. Chem., 78, 4985–4989, 2006. https://doi.org/10.1021/ac060064d. 63. Sanllorente-Méndez, S., Domínguez-Renedo, O., Arcos-Martínez, M.J., Immobilization of acetylcholinesterase on screen-printed electrodes. Application to the determination of arsenic(III). Sensors, 10, 2119–2128, 2010. https://doi.org/10.3390/s100302119. 64. Sanllorente-Méndez, S., Domínguez-Renedo, O., Arcos-Martínez, M.J., Development of acid phosphatase based amperometric biosensors for the inhibitive determination of As(V). Talanta, 93, 301–306, 2012. https://doi. org/10.1016/j.talanta.2012.02.037. 65. Su, L., Jia, W., Hou, C., Lei, Y., Microbial biosensors: A review. Biosens. Bioelectron., 26, 1788–1799, 2011. https://doi.org/10.1016/j.bios.2010.09.005. 66. Velusamy, V., Arshak, K., Korostynska, O., Oliwa, K., Adley, C., An overview of foodborne pathogen detection: In the perspective of biosensors. Biotechnol. Adv., 28, 232–254, 2010. https://doi.org/10.1016/j.biotechadv.2009.12.004.

296  Modern Forensic Tools and Devices 67. Rawtani, D., Tharmavaram, M., Pandey, G., Hussain, C.M., Functionalized nanomaterial for forensic sample analysis. TRAC-Trends Anal. Chem., 120, 115661, 2019. https://doi.org/10.1016/j.trac.2019.115661. 68. Kaittanis, C., Santra, S., Perez, J.M., Emerging nanotechnology-based strategies for the identification of microbial pathogenesis. Adv. Drug Deliv. Rev., 62, 408–423, 2010. https://doi.org/10.1016/j.addr.2009.11.013. 69. Wu, J., Campuzano, S., Halford, C., Haake, D.A., Wang, J., Ternary surface monolayers for ultrasensitive (zeptomole) amperometric detection of nucleic acid hybridization without signal amplification. Anal. Chem., 82, 8830–8837, 2010. https://doi.org/10.1021/ac101474k. 70. Banerjee, P. and Bhunia, A.K., Cell-based biosensor for rapid screening of pathogens and toxins. Biosens. Bioelectron., 26, 99–106, 2010. https://doi. org/10.1016/j.bios.2010.05.020. 71. Kleinjung, F., Klussmann, S., Erdmann, V.A., Scheller, F.W., Fürste, J.P., Bier, F.F., High-affinity RNA as a recognition element in a biosensor. Anal. Chem., 70, 328–331, 1998. https://doi.org/10.1021/ac9706483. 72. Kim, Y.S. and Gu, M.B., Advances in aptamer screening and small molecule aptasensors, in: Biosensors Based on Aptamers and Enzymes, M.B. Gu and H.-S. Kim (Eds.), pp. 29–67, Springer Berlin Heidelberg, Berlin, Heidelberg, 2014, https://doi.org/10.1007/10_2013_225. 73. Hamaguchi, N., Ellington, A., Stanton, M., Aptamer beacons for the direct detection of proteins. Anal. Biochem., 294, 126–131, 2001. https://doi. org/10.1006/abio.2001.5169. 74. Tang, Z., Mallikaratchy, P., Yang, R., Kim, Y., Zhu, Z., Wang, H., Tan, W., Aptamer switch probe based on intramolecular displacement. J. Am. Chem. Soc., 130, 11268–11269, 2008. https://doi.org/10.1021/ja804119s. 75. Grieshaber, D., MacKenzie, R., Vörös, J., Reimhult, E., Electrochemical biosensors-sensor principles and architectures. Sensors, 8, 1400–1458, 2008. https://doi.org/10.3390/s80314000. 76. Han, K., Liang, Z., Zhou, N., Design strategies for aptamer-based biosensors. Sensors, 10, 4541–4557, 2010. https://doi.org/10.3390/s100504541. 77. Song, S., Wang, L., Li, J., Fan, C., Zhao, J., Aptamer-based biosensors. TRAC Trends Anal. Chem., 27, 108–117, 2008. https://doi.org/10.1016/j. trac.2007.12.004. 78. Voinova, M.V., On mass loading and dissipation measured with acoustic wave sensors: A review. J. Sensors, 2009, 943125, 2009. https://doi. org/10.1155/2009/943125. 79. Datar, R., Kim, S., Jeon, S., Hesketh, P., Manalis, S., Boisen, A., Thundat, T., Cantilever sensors: Nanomechanical tools for diagnostics. MRS Bull., 34, 449–454, 2009. https://doi.org/10.1557/mrs2009.121. 80. Umrao, S., Jain, V., Anusha, Chakraborty, B., Roy, R., Protein-induced fluorescence enhancement as aptamer sensing mechanism for thrombin detection. Sensors Actuators B Chem., 267, 294–301, 2018. https://doi.org/10.1016/j. snb.2018.04.039.

Sensor-Based Devices for Trace Evidence  297 81. Dalirirad, S., Han, D., Steckl, A.J., Aptamer-based lateral flow biosensor for rapid detection of salivary cortisol. ACS Omega, 5, 32890–32898, 2020. https://doi.org/10.1021/acsomega.0c03223. 82. Gao, L., Xiang, W., Deng, Z., Shi, K., Wang, H., Shi, H., Cocaine detection using aptamer and molybdenum disulfide-gold nanoparticle-based sensors. Nanomedicine, 15, 325–335, 2020. https://doi.org/10.2217/nnm-2019-0046. 83. Zhang, J., Wang, L., Pan, D., Song, S., Boey, F.Y.C., Zhang, H., Fan, C., Visual cocaine detection with gold nanoparticles and rationally engineered aptamer structures. Small, 4, 1196–1200, 2008. https://doi.org/10.1002/ smll.200800057. 84. Nie, J., Zhang, D.-W., Tie, C., Zhou, Y.-L., Zhang, X.-X., A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners. Biosens. Bioelectron., 49, 236–242, 2013. https://doi. org/10.1016/j.bios.2013.05.020. 85. Zou, R., Lou, X., Ou, H., Zhang, Y., Wang, W., Yuan, M., Guan, M., Luo, Z., Liu, Y., Highly specific triple-fragment aptamer for optical detection of cocaine. RSC Adv., 2, 4636–4638, 2012. https://doi.org/10.1039/C2RA20307C. 86. Bozokalfa, G., Akbulut, H., Demir, B., Guler, E., Gumus, Z.P., Odaci Demirkol, D., Aldemir, E., Yamada, S., Endo, T., Coskunol, H., Timur, S., Yagci, Y., Polypeptide functional surface for the aptamer immobilization: Electrochemical cocaine biosensing. Anal. Chem., 88, 4161–4167, 2016. https://doi.org/10.1021/acs.analchem.6b00760. 87. Mao, K., Yang, Z., Li, J., Zhou, X., Li, X., Hu, J., A novel colorimetric biosensor based on non-aggregated Au@Ag core–shell nanoparticles for methamphetamine and cocaine detection. Talanta, 175, 338–346, 2017. https://doi. org/10.1016/j.talanta.2017.07.011. 88. Mao, K., Ma, J., Li, X., Yang, Z., Rapid duplexed detection of illicit drugs in wastewater using gold nanoparticle conjugated aptamer sensors. Sci. Total Environ., 688, 771–779, 2019. https://doi.org/10.1016/j.scitotenv.2019.06.325. 89. Lee, K., Yoo, Y.K., Chae, M.-S., Hwang, K.S., Lee, J., Kim, H., Hur, D., Lee, J.H., Highly selective reduced graphene oxide (rGO) sensor based on a peptide aptamer receptor for detecting explosives. Sci. Rep., 9, 10297, 2019. https://doi.org/10.1038/s41598-019-45936-z. 90. Priyanka, Shorie, M., Bhalla, V., Pathania, P., Suri, C.R., Nanobioprobe mediated DNA aptamers for explosive detection. Chem. Commun., 50, 1080–1082, 2014. https://doi.org/10.1039/C3CC47562J. 91. Sassolas, A., Blum, L.J., Leca-Bouvier, B.D., Immobilization strategies to develop enzymatic biosensors. Biotechnol. Adv., 30, 489–511, 2012. https:// doi.org/10.1016/j.biotechadv.2011.09.003. 92. Komarova, N.V., Andrianova, M.S., Gubanova, O.V., Kuznetsov, E.V., Kuznetsov, A.E., Development of a novel enzymatic biosensor based on an ion-selective field effect transistor for the detection of explosives. Sensors Actuators B Chem., 221, 1017–1026, 2015. https://doi.org/10.1016/j.snb. 2015.07.015.

298  Modern Forensic Tools and Devices 93. Karthikeyan, S., Kurt, Z., Pandey, G., Spain, J.C., Immobilized biocatalyst for detection and destruction of the insensitive explosive, 2,4-dinitroanisole (DNAN). Environ. Sci. Technol., 50, 11193–11199, 2016. https://doi. org/10.1021/acs.est.6b03044.

12 Biomimetic Devices for Trace Evidence Detection Manika1* and Astha Pandey2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 2 School of Forensic Science, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India

1

Abstract

Biomimetics is an emerging field of science where biological phenomenon are transmuted into technical procedures so as to serve a purpose of great importance as it can be used to develop sensors to detect various trace evidences namely, TNT and nicotine, for drug delivery at nano or micro levels, electro-­ active lens and smart tattoos formation. Artificial platforms, including certain material scaffolds, promote biomimetic, cell-laden devices’ mechanical stability of structure and increase the efficiency of living components without toxicity in the organic or device setting. However, it is still a big challenge to come up with a new class of fully functioning, autonomous biological machines. Moreover, very less literature is present to be referred to work in this field. So, there is a need to work in this direction so as to strengthen this field of study and provide market with innovative products that can be used efficiently to solve problems of day-to-day life like non-invasive glucose sensing, easy and quick on-site trace evidence detection etc. Keywords:  Biomimetic, trace evidences, cell-laden, biological phenomenon, and detection

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (299–314) © 2023 Scrivener Publishing LLC

299

300  Modern Forensic Tools and Devices

12.1 Introduction Biomimetics is indeed an evolving research field, as the transition of interventions from biological phenomenon to technical applications, which has led to important concepts over the past decades. Biomimetics applies concepts and methods from biological structures to technical procedures and architecture in general. The capacity of biomimetics is considered infinite in approach, and the life will get benefited immensely from its major science, economic and social impacts. Over the past years, the pace of publications in biomimetics has risen and has reached almost 3,000 articles a year, to show that biomimetics are becoming a leading paradigm for different technical disciplines, such as robotics and materials sciences. The number of commercially produced biomimetic products, however, is quite limited, out of 303 biomimetic cases, 28% are commercially usable, 60% are under production, 8% are concepts, and 2% are withdrawn [1, 2]. For various uses, research is going on into formulating particular chemical structures that would distinguish target molecules from a closely associated entities in the environment that culminated in new groups of smart polymers. These interactions with the atmosphere can be general e.g. temperature, ionic strength, pH, solvent thermodynamic compatibility, co-analyte type or unique in nature. Research objective is to create new polymeric or biohybrid material compositions and chemical structures that ‘communicate’ with their surrounding ecosystems. The capacity of a substance to act as a smart actuator through ‘contact,’ combining biological stimuli and transducing a mechanical output is referred here. An ‘actuator’ is identified as a component of control mechanism that transforms a stimulus into an output. Biomedical actuators transform beneficial outputs into biological stimuli. Biomedical applications that involve smart polymeric actuators are biosensors, smart and/or activatable drug delivery systems, closed-loop machines that respond to physiological stimulus with therapeutic interference, and biological machinery scaffolds. It is possible to adapt these devices by emitting a signal or interfering therapeutically to react to environmental conditions. To develop new biohybrid devices that address enigmatic medical and biological issues, researchers are now combining various components at cellular and molecular levels with smart material scaffolds. These uses include constant tracking of analytes in vivo tumor detection, for diagnostic purposes, reconstruction of diseased or weakened tissue e.g. skeletal muscle, and recapitulation of strongly organized biological phenomenon within advanced devices.

Biomimetic Devices  301 By the inclusion of tissue that is natural (or non-native), biomedical substance actuators gives hope to repair disease-triggered, anomalous control mechanisms in the body. As a class of ‘biomimetic devices’ that conduct special mechanical functions well beyond the potential of solely mechanical parts, for medical and non-medical applications, there are innovative constructs of smart biomaterial [3, 4]. Smart materials need to be synthesized, chosen, assembled and stored to achieve a dynamic structure, or assembly capable of converting a biological signal into a therapeutic reaction. These sensitive biomaterials can be of natural or synthetic nature, have pH, or in other cases, reactive moieties of chemicals have labile or crosslinked functional groups and are correlated with biomacromolecules with differential affinity. Co-polymerization, mixing, and interconnectivity may create blend of material-environment and various interactions possible between them. Dynamic, bioactive materials are generated by the precise macroscopic assembly of these smart materials [3–5].

12.2 Tools or Machines for Biomimetics Artificial frameworks with natural components, possessing the capacity to progressively deform and feel physiological conditions, biological devices or actuators have created considerable interest in numerous in vitro applications, consisting of drug screening, the formation of artificial muscles, and biosensing. To achieve their functional target, the efficiency of its constituents is important for biological sensors to detect and react with dynamic control [2]. Non-human platforms, including certain material scaffolds, promote biomimetic, cell-laden devices’ mechanical stability of structure and increase the efficiency of living parts without toxicity in the organic or device setting. Dynamic communications systems are included into artificial platforms that allows the modification of actuation output externally and also the biomimetic device’s path and rate. Given recent development, biomimetic systems still have major limits on autonomously controlled movement, life-like motion, and rate with which force is developed. It’s a big challenge to construct a class of fully functioning, autonomous biological machines. Nevertheless, it can solve urgent medical needs and allow new scientific applications to resolve current restrictions and engineer next-generation biological devices. Driven by living organisms, bioengineers have developed revolutionary techniques for incorporating various cells and materials into new bioactuators [2].

302  Modern Forensic Tools and Devices

12.3 Methods of Biomimetics To explain several biological systems or association between biological and technical systems, three phases build a scientifically based design, which are behavior, activities and operations. Where, this design satisfies the three requirements for identifying a biomimetic product: (a) analysis of the biological function, (b) model abstraction from the system, and (c) conversion and implementation without the use of the biological system, it is not just seen as biologically influenced, but also as biomimetic [2, 6].

12.4 Applications Biomimetics has many applications in diverse fields like for the detection of trace evidences like TNT, nicotine etc., converting hybrid material to medical device so as to assist in drug delivery, and development of biosensors for biological constituents like glucose.

12.4.1 Detection of Trace Evidences Trace evidences are nothing but physical evidences varying from drugs, explosives to glass pieces, fibers, etc. These are left behind when an object comes in contact with any surface, serving as an important clue for crime scene reconstruction [7].

12.4.1.1 Biomimetic Sniffing Although it is quite significant to develop next-generation sensors, the sampling portion of an instrument is considerably less established and often a forgotten link. Traditional explosive sampling approach on the basis of vapor involves either a passive way with stationary detectors looking for the arrival of the analyte or a suction-based method where air is inhaled continuously [8]. The passive approach to vapor sampling is based on vapor movement from the atmosphere (e.g. flow powered by momentum), a restriction where the sample is submitted to the detector. Methods based on suction suffer from a restricted aerodynamic “reach,” marked by an inability to intake the fluid beyond the immediate region of the inlet detector. A dog, naturally works as one of the most efficient chemical detectors in existence,

Biomimetic Devices  303 does not suffer from so many possible shortcomings in search and rescue, identification of bombs, detection of cadavers, detection of drugs of abuse, and, most recently, detection of several diseases for e.g., cancer. To collect an odor sample, dogs deliberately sniff, in general, a canine sniff is a twostep process consisting of an inspiration accompanied by an expiration that repeats at a fixed frequency of 5Hz as depicted in Figure 12.1. Air is inhaled into each nostril during inspiration with a laminar hemispherical profile. The nostril and vestibule function as a diverter of flow of air during expiration, which ejects an expired jet of air flow that is ventral-laterally guided. The warm jets of air that is expired, mechanically disrupt and volatilize the latent odorant while a surface is being sniffed, thus releasing vapor that is further inhaled. In addition, while sniffing, the path of the air jet that is expired from each nostril performs two main roles: 1) it avoids the odorant sample’s blow-off that occurs just outside the nostril, causing its inspiration afterwards, and 2) it attracts or pulls air right outside the nose, sending inside nostril, essentially expanding the aerodynamic control of the nose over simple inspiration. The essence of bioinspiration driving this research was this fluid dynamic mechanism that leads to the expansion of the aerodynamic distance of the nose. Previous studies using arthropods focused mainly on actions of plume sampling after locating the plume during chemotaxis. During smell monitoring, mammals have concentrated on the behavior of dogs, rats, and humans. Of the same animals, dogs, rats, and humans, the external aerodynamics involved in the acquisition of scent have also been studied. The use of odorant sampling assisted by jet, for chemical detection artificially, for example, a system of the aerodynamics, first patented by Aaberg, that is based on the flow visualization studies of canine sniffing [2, 8].

Expiration

Inspiration

Odorant source

Figure 12.1  Flow representation of canine sniffing using the nose of a dog.

304  Modern Forensic Tools and Devices The goals associated with this work are fourfold: 1) to get better understanding of olfaction aerodynamics of external canine with an identical 3D model of the nose of the dog; 2) to estimate the quantity of chemical detected by active sniffing versus continuous inspiration compared to the sampling on the basis of suction used by current technology; 3) to customize a bio-inspired inlet, to be used for handheld explosive vapor detector that are available commercially, to promote active sniffing assisted by jets having the dog here, as a source of bio-inspiration; and 4) to compare the efficiency of the system involved in active sniffing [8]. Using a mixture of high-speed videography and Schlieren imaging, the pattern of flow occurring outside the nose of the dog is first visualized, which depicts successful sniffing pattern. The tests show that from each nostril, a turbulent air jet leaves as the nose expires and goes inward (ventrally) and outward (laterally), jet-assisted fluid training helps the nose to improve its aerodynamics reach, attracting air which are vapor-laden to the nostrils that is inaccessible from prolonged distances after expiration of vapor-laden air. During vigorous sniffing, these external patterns of flow comply with prior studies conducted with live dogs, where the nose model of the new 3D printed dog is used. To study the efficiency of sampling carried out aerodynamically, the 3D printed dog’s nose steady inspiration versus vigorous sniffing, two separate experiments can be used [8]. First approach involves chemical extraction using polyurethane foam (PUF) absorbent substance mounted in the vestibule of the dog’s nose 3D printed model and further, quantification of 2,4-dinitrotoluene (DNT) using ultraviolet liquid chromatography. The model of the nose is situated at a distance of 3 cm away from the vapor source and 13 mm above from the ground and around 60 L/min of peak flow rate is used to ventilate so as to imitate either aggressive sniffing or steady inspiration. The DNT vapor and the primary signature odorant aerodynamic sample detected by canines can be quantified in terms of total mass of DNT obtained per unit of inspired air volume. The findings of the DNT sampling tests shows that in case of vigorous sniffing, the performance of the nose model is around 8 times better as compared to steady inspiration at a distance of 3 cm from the source of DNT vapor [8]. The second category of tests involves describing the effect of successful sniffing, conducted by direct fixation of the nose to an ambient ionization mass spectrometer that allows detection of odorant signatures in real time. The control system for sniffing and the inlet for mass spectrometer share the same flow direction, which stop the physiological sniffing flow rate waveform from matching exactly. As the vapor source, a

Biomimetic Devices  305 diffusion cell for dimethylformamide (DMF) is used. For the nose model, the vapor source is fixed on the axes at two standoff distances and there is mechanical ventilation to simulate vigorous sniffing or non-stop inspiration, all while tracking the mass spectrometer’s DMF signal. The findings of sampling tests predicts that the performance of nose model for the sampling of the DMF vapor by sniffing is approximately 4 times better as compared to steady inspiration where vapor source is located 10cm away and approximately 18 times more when the standoff distance is 20 cm [8]. Trace Vapor Detector for Bioinspired Sniffing: For the enhancement of the efficiency of sample collection, a minor bio-inspired adjustment in the inlet to place trace vapor detectors can be made. For the validation of this architecture idea, a trace vapor detector (VaporTracer, Morpho Detection) is used on the basis of Ion Mobility Spectrometric (IMS) detection. It is equipped with an inlet which is customized by 3D printing for vigorous sniffing to imitate the exterior flow patterns of the dog’s nose. A different mechanical sniffing method is involved with the bioinspired inlet; hence, the overall concentration of analyzed air for both successful sniffing and inspiration-only tests is the same. The tests are conducted with a constant release of TNT vapor source where the distance from the inlet to the detector is 1cm. The aerodynamic scope of the detector inlet is clearly increased by aggressive sniffing using the bioinspired inlet, allowing odorant collection from a greater distance relative to continuous air drawing [8]. Multiple Constraints in the Current Analysis: Second, rigid nostrils were used in the 3D printed model of dog’s nose, although a dog’s nares are not static during sniffing. And also, due to the constraints of the experimental setup, there is inability to precisely fit the physiological sniffing flow rate waveform in experiments that directly connected the nose model to an ionization mass spectrometer [8].

12.4.1.1.1 Methods

Schlieren Imaging: A light beam travels through the test region in the ­single-mirror Schlieren imaging method, where the light bends away from its coincident direction due to refractive index gradients. Then a spherical mirror is filled with light and after reaching its focal point, it returns to a beam splitter that steers the beam. At the beam’s focal point, a razor blade is placed where a portion of the distorted light is cut-off, producing an image indicative of the density gradients in the test segment of light and dark

306  Modern Forensic Tools and Devices comparisons. Here a coincident beam system of single-mirror Schlieren is used with a 40.6 cm diameter circular mirror with a 243.8 cm focal length. Video imagery of the experimental tests is taken by a high-definition video camera [8]. 3D Printing: A 3D printed nose model of dog is reconstructed using a female mixed-breed Labrador as a model with the help of magnetic resonance imaging scanners. No efforts are made to replicate the intricate internal systems lying inside the nose involved during inspiration and expiration, this analysis is mainly interested in the external fluid dynamics. Just the nose’s key exterior characteristics are replicated on the model [8]. Kit for Personalized Sniffing: To calculate the flow rate of the piston unit, and eventually the nose of dog, a hot-wire anemometer is used as a function of time. The nose of the dog is followed by a probe which is placed inside a tube, offering measurements from polyurethane foam. In order to integrate a polyurethane foam (PUF) adsorbent into the nasal vestibule, the 3D printed dog’s nose is changed. A clean PUF implant is inserted into the nose to trigger the mechanical sniffing device, gathering the DNT vapor on the adsorbent PUF quantitatively. On the incident surface of the PUF, 25μL of an extremely soluble 2-methylbutane solvent is dissolved and the internal standard (IS) is added for the quantification. The 2-methylbutane was separated by nitrogen flow via PUF. Then elution of DNT and internal standard takes place with two hot acetonitrile (50 °C) volumes (25 and 10 mL) that are mixed and condensed under nitrogen before study. Liquid chromatography-ultraviolet detection (LCUV) can be used to evaluate the 2,4-DNT [8]. Ambient Ionization Mass Spectrometry Measurements: Here, a diffusion cell is formed by a small glass vial, a nylon cap and an O-ring. A hole is formed in the nylon cap and a micrometer ID capillary tube is glued into it using torr-seal so as to create a controlled leak. During continuous inhalation tests, the mass spectrometer inlet with flow rate of 5 L/min is combined with a vacuum pump running at 20 L/m so as to provide an inspiratory flow rate of 25 L/min. After this experiment, the instrumental parts are washed with isopropyl alcohol to clear residual vapors, and an additional 15 minutes are then passed before the next experiment [8]. Spectrometer with Vapor Tracer Ion Mobility: Here, the system of mechanical ventilation work independently of the inlet flow provided to the IMS without adjusting the total quantity of air sampled for either successful sniffing or continuous inspiration in the 10-s sampling cycle. The undesired loss of TNT and vapor accumulation on nearby surfaces is prevented by capping the vapor source between each trial. After individual tests, the region is washed with ethyl alcohol [8].

Biomimetic Devices  307

12.4.1.2 L-Nicotine Detection An innovative approach has been made for the detection of analytes of interest on the basis of heat transfer resistance change which is imposed by the target molecules binding to the nanocavities of the MIP. The calculation of impedance is done at the same time when the procedure is going on to verify the readings. Aluminum electrodes-MIP particles functionalized conjugates conduct L-nicotine detection tests. Serotonin and histamine samples dissolved in buffer solutions are also tested in order to see if this procedure can be used with other templates. Furthermore, detection can be done at nanomolar level, which is beyond the physiologically appropriate concentration regime [9]. L-nicotine quantification by spiking saliva sample, in the PBS buffer (pH=7.4) is done in a proof-of-principle experiment. For the ionic strength of biological samples, use of PBS buffer is recommended. The same amounts are prepared with cotinine in PBS to test selectivity. For serotonin and histamine, this process is repeated. Histidine work as an analogue of histamine, while its rival dopamine is chosen for serotonin. Saliva samples are analyzed as the next step. A non-smoker research subject deposits saliva in a sterilized falcon tube to extract the saliva which is centrifuged for 10 minutes at a speed of 10,000 rpm and the supernatant is then purified using a 1-μm syringe filter. The saliva samples collected are broken up into multiple aliquots. One aliquot is kept unaltered and thus act as a fluid for power. The other aliquots are spiked with varying L-nicotine concentrations. The “pore-blocking model” is used to explain the theory of this technique where heat transport is strongly minimized in that direction by forming conjugates of the nanocavities present in the MIP and the target which results in improvement of heat transfer resistance. In the physiologically applicable regime, the built dose-response curve demonstrates sensitivity, indicating the sensor platform’s applicability in biological media. In short, the applicability of MIPs with HTM as an innovative sensing technique allows easy and inexpensive quantification of buffer solutions with the option to use them as an application of biological samples [9].

12.4.1.3 TNT Detection To build highly sensitive, on-site sensors to detect several chemical and biological agents, the extraordinary mechanical and electronic properties of carbon nanotubes (CNTs) are exploited. Single-walled carbon nanotubes (SWNTs) alone, however, display low selectivity against given targets,

308  Modern Forensic Tools and Devices so it is important to create the surface functionalization coatings i.e. recognition elements so as to develop selective SWNT sensors. The target of interest selectively binds to the surface of SWNTs through the immobilized recognition element which results in a selective adjustment of the SWNTFET device’s electronic properties [10]. There is an effective approach for designing molecular recognition elements by using biomolecular coatings that are immobilized on the surface of SWNT which specifically identifies the target molecule. Small molecules i.e. peptides or aptamers dependent on nucleic acid are excellent candidates for such applications and demonstrate increased stability in comparison to large biomolecules i.e. antibodies. Using combinatorial methods, it is possible to identify molecular models including peptides or aptamers that selectively bind to a given target. A peptide library is searched to find peptide sequences that bind specifically to the carbon nanotubes, metal surfaces, explosives, and bacterial spores have previously been described. To bind and spread SWNTs, found a SWNT binding peptide P1 with amino acids sequence as follows: His-Ser-Ser-Tyr-Trp-Tyr-Ala-Phe-AsnAsn-Lys-Thr. A bifunctional peptide i.e. P1-R5 is formed which is used for SWNTs surface functionalization with metal oxides. A non-covalent bond is formed on the surfaces of the SWNT via P1 peptide domain and the growth of metal oxides is tempered on the nanotube surface via the R5 domain (Ser-Ser-Lys-Lys-Ser-Gly-Ser-Tyr-Ser-Gly-Ser-Lys-Gly-SerLys-Arg-Arg-Ile-Leu-). An electropolymerization procedure occurs for the accumulation of peptides on the SWNTs surface for the detection of Ni2 and Cu2 where selective identification of metal ions in the pico- to micromolar range can be achieved [10]. Just the way odor detection is carried out by insects using their antenna, small proteins namely, odorant binding proteins (OBPs) and ferry hydrophobic odorant molecules from the external environment, form bond with the receptors on the antennal olfactory [10]. The extraordinary ability of insects to identify chemical signatures has prompted Los Alamos National Laboratory researchers to give training to bees for several analytes of interest in a handheld device. An antennal-­ specific protein-1 (ASP1) is the OBP of Apis mellifera which has a C-terminal tail fragment that binds with target analytes. The C-terminus end with four residues of amino acids namely, Trp-Phe-Val-Ile plays an essential function in TNT detection. The ASP1 protein tetrapeptide sequence is homologous to the C- terminal end of the peptide binding TNT i.e. Trp-His-Arg-ThrPro-Ser-Thr-Leu-Trp-Gly-Val-Ile which is identified from a library of phage peptide. Those amino acids are then linked to the C-terminal end of the P1 peptide through a tetraglycine linker so as to construct a diblock

Biomimetic Devices  309 P1ASP1C peptide library i.e. -His1-Ser2-Ser3-Tyr4-Trp5-Tyr6-Ala7Phe8-Asn9-Asn10-Lys11-Thr12-Gly13-Gly14-Gly15-Gly16-Trp17 Phe18Val19-Ile20. The SWNTs is then functionalized with the P1ASP1C diblock peptide. In this research, statistical models and experimental techniques are used where not only structural but functional properties of P1ASP1C are also demonstrated upon adsorption on SWNTs which provide evidence for the applicability of designer peptides in the formation of chemosensor functioning as selective recognition elements [10].

12.4.2 Hybrid Materials to Medical Devices Hybrid materials are smart biomedical materials that scientists and engineers utilize when developing modern tissue-material interfaces. These materials may respond to a physiological stimulus reversibly or irreversibly, transduce biological signals into electrical or mechanical outputs, and from complex solutions pick target biomarkers. Let’s consider a system that mimics heart muscle bioactivity. Basic spatial adhesion of cardiomyocytes, assist in synchronous cellular contractions via electrical stimuli, and degradation in a cell-responsive way with reproducible kinetics must be the ideal material for this situation [5].

12.4.2.1 Smart Drug Delivery Micro and Nanodevices A primary clinical aim is to integrate the identification of specific biomarkers with the delivery of a therapeutic payload. Biomarkers are particularly sensitive to a specific disorder or illness (i.e. an overexpressed cell receptor or secreted protein), spatially variable (i.e. marker concentration gradients from extracellular to intracellular conditions), or temporally variable (i.e. cyclical temperature or pH changes). The therapeutic window of existing medications can be expanded by micro and nano-scale materials which react to physiological stimuli that with cellular parts, is making drug administration to be patient friendly [5]. • Systems for Oral Delivery of Therapeutic Macromolecules Delivery of therapeutic proteins into the bloodstream passing particularly, through the gastrointestinal tract faces so many challenges. Next, in acidic gut conditions, fragile protein therapeutics can denature. Second, unregulated protein can be removed by proteolytic enzymes present in the oral cavity, gut, and intestine. After that, to enter circulation,

310  Modern Forensic Tools and Devices processes must allow therapeutic protein transfer through the intestinal epithelium. Oral protein distribution polymeric carriers allow physicians and engineers to conquer these barriers [5]. • Transdermal Drug Delivery Systems Delivering a drug transdermally is a patient-friendly path that is especially useful for skin-permeating molecules. However, crossing the skin epithelium and entering the bloodstream is difficult for macromolecules and hydrophilic small molecules, and needs the assistance of chemical and/ or material structures. Advanced methods for designing and production of material allow several bioactive molecules to be transported, which may have important therapeutic implications in the future [5].

12.4.2.2 Nanodevices for Combination of Therapy and Theranostics Theranostic nanodevices are the structures incorporating therapeutic payloads and agents for the simultaneous diagnosis and treatment of the disease. For biomedical uses, there have been important developments in diagnostic implants and wearable technology. This is particularly true for drug monitoring carried out in vivo and measuring instruments for physiological responses via in situ contact with organs and tissue. Implantable and portable medical devices of the next decade are made possible by the integration of responsive fabrics and innovative processing techniques [5]. • General Requirements and Characteristics: Bioinert materials, distinguished by low toxicity and reactivity and well accepted for implantation in the body, are capable of decaying, solubilizing or absorbing biodegradable or bioabsorbable materials after a defined period of time. Implantable devices involve chemical bonds formed by bioactive materials that enable free expansion of cells on the material surface and receptive materials that respond to their external environment and experience predictable changes [5].

12.4.2.3 Continuous Biosensors for Glucose For several patients worldwide, glucose biosensing systems are critical for the treatment of diabetes. Subcutaneous, amperometric, needle-like

Biomimetic Devices  311 electrodes are utilized by advanced continuous tracking systems to record the blood glucose level in the interstitial fluid of skin. As glucose exchanges electrons with the sensor, the amperometric electrodes detect minor changes in the fluid by measuring electric current. The glucose biosensor consists of three key phenomenon. First, in a competitive setting, the receptive substance differentiates and identifies a target molecule. The substance is engineered to have an oxidative-reductive moiety, or enzymes specific for glucose to achieve this. Then, a transducer transforms the sensing act into an observable and distinct signal. Usually, the transducers used are electrochemical, piezoelectric, optical, thermometric, or magnetic. The signal is then converted by a signal processing device into a user-friendly output [4, 5].

12.4.2.4 Electro-Active Lenses Most recent interest has been paid to smart contact lenses and electro-­ active lenses as they can monitor as well as capture real-time information on analytes present in eye, in a non-invasive manner. Previous models are confined to opaque and brittle products with such a high risk of injury to the eyes. In addition, the need for time-consuming production methods, cumbersome power supplies, and massive transducers prevented many designs from being accepted. New materials and unconventional methods have been explored recently by researchers to form optical glucose sensors utilizing signals in the anterior chamber of the eye [5].

12.4.2.5 Smart Tattoos Smart tattoos have received a lot of popularity for their application both as diagnostic instruments as well as therapeutic platforms. Basically, because they are recommended to be elastic, stretchable, adhesive, and secure for daily wear, the material specifications for smart tattoos can be challenging [5].

12.5 Challenges for Biomimetics in Practice The absence of a consistent method, the complexities associated with interdisciplinary work and difficult biological concepts are some of the factors that are the major reasons of the availability of very few biomimetic products on the market. Core problem with the development of biomimetic

312  Modern Forensic Tools and Devices device is the identification of any biological systems such that communication can be established across various discipline boundaries so as to solve the problem by the analysis of the situation. The biomimetic method clearly shows gaps and difficulties in operation. Operation, which basically means the use of biomimetics for product creation and concept generation on the basis of the manufacturing context. Important research has been conducted to promote the transition to technology of biological expertise systematically and to apply methods involved in the creation of instruments that eventually help the biomimetic phase. The absence of limited entry because of the sheer absence of information about current resources, suggests a contact void between research and production [1, 2].

12.6 Conclusion Biomimetics is the transition of interventions from biology to technology. However, only a few number of biomimetic products are commercially available. Therefore, a major research objective is to create new biohybridchemical structures so as to ‘communicate’ with their surrounding ecosystems. Here, the capacity of a substance to function as a smart actuator on receiving a biological stimuli and transducing a response is referred as the mechanical output. The incorporation of tissue based biomedical substance actuators give hope to restore the disease-induced, defective control mechanisms in the body. These uses include constant tracking of analytes for diagnostic purposes, in vitro tumor detection and reconstruction of diseased and weakened tissue. Biomaterials can be of natural or synthetic nature, having reactive chemical moieties. Dynamic and bioactive materials are created by the precise supramolecular and macroscopic assembly of these smart materials. Key benefit of creating cell-laden devices is to accomplish complicated, environmentally sensitive behavior. Biomimetic systems still have major limits on autonomously controlled movement, life-like motion, and rate of force development. It’s a big challenge to come up with a new class of fully functioning, autonomous biological machines. Nevertheless, it can solve urgent medical needs and allow new scientific applications to resolve current restrictions and engineer next-generation biological devices. Biomimetics is used to develop drug screening, the synthesis of artificial muscles, and biosensing. Sensors or pharmaceutical application based work can also be carried out using biomimetics. It also allows simulate the functioning

Biomimetic Devices  313 performance of organisms by exploiting the actuating performance of cells embedded in biomimetic platforms. Dogs are one of the best naturally available chemical detectors in existence. Researchers have created a 3D printed model of a dog’s nose to study canine olfaction aerodynamics which is used to train the nose to allow for active sniffing assisted by jet, with the motive to design a bio-inspired inlet for a handheld explosive vapor detector. Studies to measure the mass of 2,4-dinitrotoluene (DNT) obtained from a source of DNT vapor with uniform release have been carried out. Different system is used for mechanical sniffing, since the total volume of tested air is equal for both effective sniffing and inspiration-only research. The 2,4-DNT vapor is measured using a mass spectrometer using biomimetic approach. Furthermore, there is an effective approach for designing molecular recognition elements by using biomolecular coatings that are immobilized on the surface of SWNT which specifically identifies the target molecule. Small molecules i.e. peptides or aptamers dependent on nucleic acid are excellent candidates for such applications and demonstrate increased stability in comparison to large biomolecules i.e. antibodies. Using combinatorial methods, it is possible to identify molecular models including peptides or aptamers that selectively bind to a given target. A peptide library have previously been described that is searched to find peptide sequences that bind specifically to the carbon nanotubes, metal surfaces, explosives, and bacterial spores. In case of drug delivery systems using micro and nanodevices, transdermal drug delivery pathway is recommended for skin-permeating molecules. Implantable and portable medical devices are made possible by the integration of responsive fabrics and innovative processing techniques. For several patients worldwide, glucose biosensing systems are critical for diabetes treatment. Most recent interest has been paid to smart contact lenses and electro-active lenses as they are able to capture as well as monitor real-time information on fluid analytes present in the eye. The absence of a consistent method, the complexities associated with interdisciplinary work and difficult biological concepts are some of the factors that are the major reasons of the availability of very few biomimetic products on the market. Core problem with the development of biomimetic device is the identification of any biological systems such that communication can be established across various discipline boundaries so as to solve the problem by the analysis of the situation. The biomimetic method clearly shows gaps and difficulties in operation and hence, further research work needs to be carried out in this direction.

314  Modern Forensic Tools and Devices

References 1. Wanieck, K. et al., Biomimetics and its tools. Bioinspired Biomim. Nanobiomaterials, 6, 2, 53–66, 2016. 2. Xia, Z., Biomimetic Principles and Design of Advanced Engineering Materials, Wiley, USA, 2016. 3. Bar-Cohen, Y., Biomimetics: Biologically Inspired Technology, Taylor & Francis Group, USA, June 2015. 4. Rudnitskaya, A., Sensors|biomimetic sensor arrays, in: Encyclopedia of Analytical Science, vol. 9, pp. 154–160, 2019. 5. Clegg, J.R. et al., Modular fabrication of intelligent material-tissue interfaces for bioinspired and biomimetic devices. Prog. Mater. Sci. Elsevier Ltd, 106, 100589, 2019. 6. Otero, T.F., Biomimetic conducting polymers: Synthesis, materials, properties, functions, and devices. Polym. Rev., 53, 3, 311–351, 2013. 7. Bevel, T. and Gardner, T., Trace evidence, in: Techniques of Crime Scene Investigation, pp. 183–224, 2020. 8. Staymates, M.E. et al., Biomimetic sniffing improves the detection performance of a 3D printed nose of a dog and a commercial trace vapor detector. Sci. Rep. Nat. Publishing Group, 6, 1–10, 2016. 9. Peeters, M. et al., Heat-transfer-based detection of l-nicotine, histamine, and serotonin using molecularly imprinted polymers as biomimetic receptors. Anal. Bioanal. Chem., 405, 20, 6453–6460, 2013. 10. Kuang, Z. et al., Biomimetic chemosensor: Designing peptide recognition elements for surface functionalization of carbon nanotube field effect transistors. Nat. Rev., 2009.

13 Forensic Photography Aayush Dey1, Piyush K. Rao1 and Deepak Rawtani2* School of Doctoral Studies & Research (SDSR), National Forensic Sciences University, Gandhinagar, Gujarat, India 2 School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India

1

Abstract

A photograph taken by an expert practitioner at the crime scene is a crucial piece of evidence and such evidences are bound to follow a proper chain of custody. Photographs taken at a crime scene by a forensic photographer contribute a significant part in court trials. Forensic photography can also be termed as crime scene photography. Forensic photography is an aspect of forensic science that documents the former presence of the scene and the types of evidences found at the scene. Forensic photography, if done properly can reveal the tiniest details that can act as a bridge between the victim, the actual chain of events at the scene and a potential suspect. There are numerous types of photography techniques, but forensic photography stands apart from a wide array of photography variations and this is so because, a forensic photographer takes photographs for an explicit purpose, which are further discussed in this chapter. This chapter also discusses in details about various aspects of forensic photography such as the modern principles and the fundamental rules of forensic photography. In addition to the aforementioned aspects, different dynamics of a digital camera and the crime scenarios where forensic photography is used are also discussed. Keywords:  Crime scene photography, digital camera, homicide photography, sensor architecture

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (315–334) © 2023 Scrivener Publishing LLC

315

316  Modern Forensic Tools and Devices

13.1 Introduction Forensic photography in the modern age serves as an obligatory aspect that portrays a vital role for investigation in felonious cases, medico-legal issues in addition many more heinous cases. The technique of forensic photography is also often articulated as “crime scene photography” [1]. In any crime scene investigation (CSI) the primary objective of photography is to make the investigative part feasible with respect to time and to procure evidences faster rate. The term “photography” is derived from two Greek words “PHOTOS” and “GRAPHOS” which means ‘light’ and ‘to write’ respectively [2]. The origin of forensic photography predates to 19th century. In 1851, a forged document’s photograph was presented and admitted as a courtroom evidence in Belgium, and by the 1870s numerous advancements took place and hence it became cutting edge [3]. During the initial foundation days of forensic photography it was Alphonse Bertillon who comprehended that photography techniques of that time were ineffectual. It was so because of the lack of standardization of extra equipment usage such as alternate light sources, different angles for scene capture and usage of scale for measurements [4]. A perpetual graphic record is delivered to an investigator via a photograph, which can later be examined for references or utilized for further usage in an investigation. Photographs as evidence are used by investigative as well as expert witness personnel and also at a courtroom trial session, provide the judge or jury with an actual graphic representation of the crime scene and the evidences collected from the crime scene. Photos taken at a crime scene are labelled as a physical evidence, due to which the photographer at a crime scene must have ample amount of knowledge regarding the mechanics of a camera and the technical skills required to handle photographic equipment and skills regarding their proper documentation [5]. This chapter deals with the purposes and principles of forensic photography, fundamental rules of processing image at a crime scene, different dynamics related to the process of capturing the image and the different camera apparatus setups needed in regards to capturing photographs at different conditions, photographing different types of crime scenes and their documentation.

13.2 Forensic Photography and Its Purpose Digital photography is utilized by current crime scene investigators, because of which it is necessary for students and investigators to fully comprehend

Forensic Photography  317 the complete functioning of a digital camera and its proper utilization in the photography at an ongoing CSI process. In solving a crime, reconstruction of a crime scene has always played a major significant role [6], one such aspect is the forensic photography. Images captured at a crime scene are examined thoroughly to serve the purpose of crime scene reconstruction. Photographs are generally captured in color and in black and white combinations so that images can be viewed in different contrasts. The path to justice is paved by forensic photography along with the technological advancements in this field, where recorded crime scene visuals are utilized as evidence. It is natural that in any CSI process, forensic photography has an integral role to play [7]. In the field of forensic photography, it is generally stated that the primary purpose of forensic photography is to document a particular crime scene. But the true purposes of forensic photography lie beyond just documenting the crime scene. A first responding officer is expected to fortify a crime scene [8], but to preserve the crime scene the way it was discovered, here, forensic photography comes into play. Forensic photography, apart from documenting the whole crime scene, also plays an important part in exhibiting the position of a piece of evidence found at a crime scene with respect to a firm reference standpoint for example, a dead body or a pillar. A reference standpoint can be placed in outdoor crime scenarios. In addition to exhibiting the position of the evidence, dimensions of the particular evidence are also captured using forensic photography with the help of measurement scales. Forensic photography also helps in resolving any contradictions in between an ongoing investigation and also as corroborative evidence that might be a decisive factor for re-opening a trial. Furthermore forensic photography always serve as a chief reference for future use [9]. It also acts as a means of briefing to investigative officials who were not able to attend to the preliminary investigation. In a crime scene if a corpse is photographed, it is done to maintain a track of events that can be documented such as, the way the corpse was discovered, the positioning of the body along with the nature of deadly injuries that caused the death [10]. Photographic evidences are significant at court criminal proceeding, as photographs taken at a crime scene are brought to the court, some of the photographs among the lot are chosen to prove or disproves an argument. It also acts as a means of briefing to investigative officials who were not able to attend to the preliminary investigation. While documenting a crime scene it is necessary to capture the most sophisticated details which may be used for reference in the forthcoming times. Finally, when the crime scene has been recognized and all

318  Modern Forensic Tools and Devices of the evidences have been bagged and tagged, final chain of custody of the evidences are followed and ensured by the investigating officer.

13.3 Modern Principles of Forensic Photography With the ongoing CSI no definitive time limits are set to document a scene photographically. Complexity and size of the crime scene determines the time taken to photographically document a crime scene. The condition of the surrounding ambience including weather conditions and lighting conditions also impact the time taken to document a scene of crime. Due to the introduction of forensic photography and its cutting applications and advancements, in the criminal investigation process, huge possibilities have opened up. Laborious work hours have been cut down, due to the introduction of forensic photography. Instant reviewing of pictures taken on a crime scene and necessary changes in the camera settings in order to seize the best possible picture is possible due to the use of a digital camera. While the ongoing process of crime scene documentation relentless critical thinking skills and analysis are applied by the forensic photographer [3]. Certain principles have been laid out to acquire the best possible images of the crime scene and are elaborated below. Scene of crime documentation – The process of production of imageries of a particular object of interest on a sensitized surface is defined as photography. It is primarily due to the chemical action of light or other forms of energy in the electromagnetic spectrum that images are produced on a sensitized surface. Advancements in photography have led to the possibility of storing images in a digital format. Silver plates, films and daguerreotypes are other surfaces upon which images where produced initially in the 1820s. Properly captured photographs at a crime scene fully serve their purpose of directing or aiding scientists, investigators and the judge and jury of court in establishment of the truth and justice. It is due to this fact that crime scene photography is an essential skill that must be mastered by the practitioner. It is an obligatory protocol of the first responding officer to document the crime scene with the variety of camera apparatuses that have been allocated to them. In this era of advancement, digital cameras with numerous combinations of settings are available that are helpful in executing a well-planned documentation process, provided a rudimentary

Forensic Photography  319 drill is provided to the responding officer or the photography practitioner [11]. Incident light regulation – Aperture, shutter speed, depth of field and white balance are some the dynamics that are exploited by the photographer, that conveys the camera on how to capture the shot. Aperture of the camera is defined as the diameter of the opening that allows the passage of incident light into the camera, and the duration of that opening is termed as the adjusted shutter speed. The ratio of the expanse of space in the foreground and the background of the object of interest is termed as the depth of field. On the other hand, the white balance allows to regulate the temperature of light, leading to on-point illustration of the color tendencies of the object of interest [11]. Illuminating dull or low light in pictures – Also termed as “Painting with light”, this is an important technique utilized in the field of forensic photography. In order to uncover image details in dull or low light circumstances this technique is utilized. To be precise, in this technique, the shutter of the camera is allowed to be open for a longer time period and an external light source is used to capture images of evidences or points of interest at a crime scene [11].

13.4 Fundamental Rules of Forensic Photography The rules of forensic photography stated below are to be followed for optimum quality of crime scene photos and are narrowed down to basically three fundamental rules. A forensic photographer is expected to strictly adhere to these rules as crime scene photographs hold a key importance in any CSI procedure.

13.4.1 Rule Number 1. Filling the Frame Space A forensic photographer must be wary of the environment that they are working in, and they are expected to have a good judgmental basis of what piece of the scene is important enough to photograph. If a forensic photographer finds evidence important enough to photograph, the frame space must be filled with that particular object. This goes hand in hand with an individual object as well as a particular area of the crime scene. Such interesting elements serve as the “chief evidence” in forensic photographs. Care must be taken that there are minimal to no extra details in a photograph

320  Modern Forensic Tools and Devices along with the “chief evidence” otherwise it may be a confusing mix of elements [12]. The first fundamental rule can be constituted into two parts, the former one being “getting close to the “chief evidence” that can take account of a single object or a specific part of the crime scene and the latter one is, removal of unnecessary or insignificant details in the background, the foreground and the sides of the photograph and controlling shadows and lens flare. When a forensic photographer is closing in on a piece of evidence that is of relevance it is advised to put the camera sensor’s digital pixels over the “chief evidence” and also unwanted or unnecessary details around the “chief evidence” must be removed. A forensic photographer while capturing the scene must keep a check on the background, the foreground as well as the side areas (left and right) of the evidence. A forensic photographer is always accounted for what appears in the background, the foreground and the sides. Also, the viewer of the photographs taken at a crime scene always presumes that if any detail is present at the any of the areas around the evidence, it is because the forensic photographer intended to put it in the photograph. To eliminate unnecessary details in the background the camera needs to be tilted down and vice-versa for removing unnecessary details in the foreground. The angles of photography can always be changed according to the photographer’s convenience. Same considerations are taken into account to remove unnecessary details from the sides of the photographs of the “chief evidence” [12]. It is always advisable to avoid self-shadows or shadows of any inanimate objects or any colleague in the field of view of the camera while clicking pictures at the crime scene. There must be scenarios where the crime scene might be small in area, in such cases it is advisable to position self-shadow completely over the area to be photographed. Most of the times it is recommended to take photographs completely shadow free or with minimalistic amount of shadow [13]. Avoiding lens flares is the last task that a forensic photographer must fulfil, because it tends to ruin excellently clicked pictures. Lens flares, in a photograph tend make evidence of interest backlit and the exposure levels are dull. It is generally advisable to avoid clicking photographs with a source of light in front of the camera [12].

13.4.2 Rule Number 2. Expansion of Depth of Field In general terms depth of field (DOF) is defined as the array of scene depth that remains in the field of focus from the foreground to the background in an image [14]. It is necessary for a forensic photographer to

Forensic Photography  321 ascertain that every inch of detail spread across the field of view i.e., from foreground to the background is in focus. If a forensic photographer fails to do so, it may not be a perfect illustration of the crime scene. This leads to two possible conclusions, i.e., either the forensic photographer intentionally did not bring the complete scene into focus or the forensic photographer is inept enough to make such blunders. This would result in the inadmissibility of photographs in the court of law. In order to avoid such mishaps and delay and deny justice to the worthy, some focusing techniques are employed to keep the entire array starting from the foreground to the background in focus. These focusing techniques include the use of “reciprocal exposure” in which utilization of smallest apertures result in a larger depth of field range. “Hyperfocal focus” is another focusing technique used in open and larger areas of crime scene. “Zone focus” is the third in line technique used in confined spaces. The last technique is the “prefocus” used for taking photographs of small evidences, for example, fingerprints [12].

13.4.3 Rule Number 3. Positioning the Film Plane Different forensic photographers have different styles of photography. But when it comes to the position of the film pane, it is emphasized that the film pane is positioned parallel with the subject or the piece of evidence that is to be photographed. If a scenario is considered where the film pane is positioned differently apart from being parallel to the evidence, for example, in a diagonal position, part of the subject tends to be larger and other significant part of the evidence tends to be smaller in size. Another disadvantage of placing the film pane in a diagonal position is that it creates distance goofs between the foreground and the background range. The third drawback in this list is that, the complete depth of field is not covered in the photograph. If a night shot is taken in a similar diagonal manner using flash, a part of the evidence is illuminated whereas the other part remains partially illuminated [12].

13.5 Camera Setup and Apparatus for Forensic Photography A forensic photographer can personally handpick the setup they require for photography of the scene. But a standard set of equipment [9] is provided to a forensic photography practitioner. Primarily a practitioner must

322  Modern Forensic Tools and Devices

DSLR (Digital single lens ref`lex) camera

Basic camera setup and apparatus

Release cable

Macro lens

External flash

Zoom lens

Compass

Polarizing lens

Forensic scale

Tripod stand

Ring flash

Figure 13.1  Different parts of a digital camera.

be well acquainted to the primary camera functions. The list of a standard equipment list is as follows (Figure 13.1). • A DSLR (Digital single lens reflex) camera, its capabilities must include burst photo mode, White balance (WB) and its alteration capabilities, a preferable international standards organization (ISO) range i.e., 100-6400, manual override styles i.e., aperture, shutter speed and manual operation capabilities etc. • Macro Lenses – f/1.4 or f/2.8. 60 mm. • Zoom Lenses - f/2.8, 18–70 and 70–200 mm, or f/3.5, 18–200 mm. • Polarizing lenses • Tripod stands • External flash or flash guns • Cable release • Forensic ruler • Ring flash • Compass

13.6 The Dynamics of a Digital Camera Emulsion film photography is the conventional photographic technique that has evolved into something more cutting edge. The digital camera

Forensic Photography  323 comes into significance when advancements in the field of photography are accounted for. Many experiments regarding the recording of light images constitute an important component i.e., the digital camera, hence it is necessary to comprehend the complete functionality of the camera and the process by which digital images are shot. There are some dynamics that define the performance of a digital camera, some of them are explained in detail as follows.

13.6.1 Types of Digital Cameras The high-end digital camera is basically categorized into CCD and CMOS cameras– • Charged-Coupled Device (CCD) camera – At the corner of each array, only one amplifier is present in a CCD type camera. Charge flows subsequently from parallel to serial readout registers. After the subsequent flow of charge, output charge is obtained from a node that is placed end-to-end to a read-out amplifier. The origins of the CCD camera design date back to the early 60s. Unlike modern CCD design based digital cameras, the conventional CCD camera setup was quiet primitive. Recent advancements in CCD designs have relatively crossed performance barriers by achieving significant noise reduction from an amplifier readout [15]. The CCD cameras are further categorized into electron multiplying charged couple device and image intensified charged couple device cameras as follows. Electron Multiplying Charge Coupled Device (EMCCD) – The architecture of the EMCCD and the CCD cameras are somewhat alike with a slightly different adjustment. The EMCCD sensor in addition to a readout register comes with a multiplication register. It is the multiplication register where the charge is amplified. The charge hence shifts to a supplementary multiplication register earlier to be detected at the output node. It is due to the additional register that the EMCCD camera has higher frame rates and sensitivity than a CCD camera [15]. Image Intensified CCD (ICCD) Camera – Ultra short exposure times are achievable by the utilization of ICCD cameras. In ICCD cameras, photons are apprehended on a

324  Modern Forensic Tools and Devices photosensitive surface and charges are generated that are further sensed and amplified. • Complementary-Metal-Oxide-Semiconductor (CMOS) – In a CMOS camera each array or column of a photo sensor is accompanied with a particular amplifier. A CMOS camera is typically a parallel readout device, hence results in higher frame rates. This characteristic of CMOS camera makes it more essential in forensic photographic applications. Although many substantial improvements are required in its architecture in order to compete against CCD cameras. Multiple amplifiers with different gain, linearity and noise configurations are used to acquire parallel readouts. CMOS devices struggle with accuracy issues at different illumination conditions required for different scientific uses [15].

13.6.2 Sensor Architecture CCD camera being the most common scientific camera, is classified into three basic formats i.e., Full frame, Frame transfer and the Interline architecture, they are described as follows.

13.6.2.1 Full Frame In CCD cameras this particular architecture is the simplest. A light sensitive array is an integral part of this sensor upon which the inbound photons fall. Upon the interaction of the array and photons, electric charge is generated and accumulated. This electric charge then shifts row by row into the serial output register. Further, the readout register is shifted in a horizontal direction. This results in the individual readout of each pixel, and this procedure of pixel readout is termed as progressive scan. This process causes the formation of smear upon the sensor, when the photons interact with the sensor, this serves to be major disadvantage of this particular architecture. In order to overcome the problem of smear formation, the usage of a mechanical shutter that covers the sensor during pixel readout is a solution. Another major issue in the usage of mechanical shutter is its relatively low speed and the lifetime issues, the smear formation could not be avoided for longer time-periods. This sensor architecture is probably the most delicate and is efficient in different lighting conditions [16].

Forensic Photography  325

13.6.2.2 Frame Transfer This sensor architecture is basically divided into two parts. The former portion is an uncovered sensor parallel array and the latter half portion being masked with a light-tight chamber. The incoming photons are allowed to fall upon the uncovered portion of the parallel array, further these accrued photons are shifted towards the chambered portion, which is also used for charge storage. From this chambered portion the photons are transferred onto the serial output register. The last phase is the pixel readout phase which occurs when electrical signals are combined to the light-sensitive or the uncovered portion of the sensor. When compared to a CCD camera with a full-frame sensor architecture, frame transfer architectures are better at delivering higher frame rates. In spite of this architecture’s advantage over the full frame architecture, both of these sensors share the same disadvantage i.e., charge smear formation in the masked portions of the sensor. The frame transfer has another advantage of greater sensitivity over the full frame sensor architecture, hence more expensive [16].

13.6.2.3 Interline Architecture This particular sensor has a unique build when compared to other sensors. This particular architecture consists of parallel channels also known as charge transfer channels. These charge transfer channels are termed as interline masks. These channels are placed in close proximity to photodiodes which help in rapid photon acquisition. This technology completely eliminates the possibility of smear formation. This sensor technology has lesser light sensitivity when compared to full frame and frame transfer sensors, although this sensitivity issue can be partially remunerated with the use of microlens arrays [16].

13.6.3 Spectral Response When the light falling on to a camera is expressed as a function of its wavelength, it is termed as the spectral response of the light. The spectral response is often articulated in terms of quantum efficiency (QE). The photons or the light particles get absorbed in the depletion region of the camera detector. The photons are converted into a charge in this region and these charges are held in an electric field which further constitutes a pixel.

326  Modern Forensic Tools and Devices

13.6.4 Light Sensitivity and Noise Cancellation The sensitivity of a camera is defined by the ability to detect the lowest possible intensity of light. It is generally measured in the terms of “lux”. Lux of a camera can also be defined as the levels of photon that falls upon the camera sensor. As a result, a signal is produced that is equivalent the noise of the camera. The sensitivity of a camera can be limited by the camera noise due to the aforementioned fact.

13.6.5 Dynamic Range When the full-well capacity of a camera is divided by the noise of the camera, dynamic range of a camera is obtained. The dynamic range of a camera also refers to the capability of a camera to record low and bright light signals consecutively.

13.6.6 Blooming and Anti-Blooming When a charge situated in a pixel gets inundated that particular charge begins to fill the nearby pixels. This process is known as blooming. Vertical shifting of charge is preferred over horizontal shifting in typical CCD sensors. This enables the easy flow of charge onto the adjacent vertical pixels, therefore exhibiting a distinctive upright strip. In images with high dynamic range (HDR), blooming is unnecessary. Unlike HDR images, spectroscopy applications are reliable on blooming characteristics. Here the CCD sensor is in parallel alignment with the spectrographic silt. Structures embedded into sensors that bound blooming characteristics are known as anti-blooming structures. These structures basically stop the overflow of charge onto adjacent pixels, hence limiting blooming. Nonlinearity is induced onto a sensor by the anti-blooming structures. On the other hand, the quantum efficiency of an image can be limited by the anti-blooming structures.

13.6.7 Signal to Noise Ratio The ratio between the incident light signal and the resulting intrinsic noise levels is often defined as the signal to noise ratio. The signal to noise ratio of the digital camera is generally abbreviated as S/N ratio or the SNR.

Forensic Photography  327

13.6.8 Spatial Resolution The number of pixels in a digital camera is finite. These pixels are responsible for setting up the limit upon the spatial resolution of the camera. Eminence of the camera lens as well as the camera are other factors that define the spatial resolution of the digital camera [17]. The least possible separation between two high contrast subjects or different objects governs the limiting spatial resolution. Contrast is an important factor in the field of forensic photography. It is well known that two contrasting subjects are more easily resolved than objects of low contrast. The Module transfer function (MTF) is utilized to impart contrasting [18] and resolution enhancing capacities into a digital camera.

13.6.9 Frame Rate This factor is generally defined as the speed at which a digital camera can record and save continuous pictures. Faster frame rates can be achieved by a digital camera by culminating sub sections of an image or bin pixels of the image. The pixel readout rate or the number of pixels predominantly administers the frame rate of a digital camera. Other dynamics that affect the frame rate include the utilization of a sub array and binning of the image. Full frame readout is utilized to measure the frame rate of a digital camera in image mode, unlike the spectral mode that utilizes a fully vertically binned pattern [19].

13.7 Common Crime Scenarios and How They Must be Photographed In any CSI procedure a particular standard protocol has already been pre-determined. One of the most integral part of the CSI is the forensic photography [20]. Forensic photography is not independent of the CSI and it intrinsically settles down into the logic of the investigative process. This field of study is an important medium for the documentation of the scene and does not hinder with the investigative process. In crime scene photography the source of the scene is determined prior to documenting other points of interest in a crime scene. This origin will serve as the initiation point for the investigative as well as the photography process. Although the forensic photography is an integral part of the investigative process, it is a

328  Modern Forensic Tools and Devices tight schedule to follow between the investigative team and the photography team, as both of the teams would spend a chunk of time at the origin point of the crime scene. Both processes act as a cascading process where both the investigative and the photography process take well within phase. If the process is mistimed for example the photography, the investigative process gets incompetent and critical evidences may escape the sight of the team. Crime types such as road traffic accidents (RTA), murders or homicidal crimes, brutal sexual offences, larceny or burglaries, hit and run, suicide, intended or non-intended arson cases and bombings have some sort of similar repeating patterns and details that must be paid attention to. Each type of crime scene is unique and pre-determined strictures to document such scenes must be followed for proper documentation.

13.7.1 Photography of Road Traffic Accidents Road traffic accidents (RTA) are complicated, typically in the open and frequently occur in areas with heavy rush traffic. A forensic photographer must endeavor for determining the objectivity and diligence required to approach RTA scenes. Elements of the accident site such as the vehicle and their impact co-ordinates, blood, debris and skid and tire impressions must be shot on camera by the forensic photographer. The role of the practitioner is not only just clicking different dynamics of the scene but also to portray the relationship between the aforementioned elements to the tangible scene of RTA. Recent practices regarding photography of RTAs has employed unmanned aerial vehicles for a greater perspective regarding the scene [21]. A photographer must also determine the sight of the vehicle driver as well as the passengers and also the obstruction to those sights. Other points of significant importance that might be traffic signals and signs that may or may not have been noticed by the driver. All of these photographs must be taken at level of the driver’s eye if probable. Some of the dynamics that must be considered while taking pictures in a road traffic accident include determining the how the vehicle could have been lowered due to the bulk of the driver and the bulk’s impact upon the line of vision of the vehicle driver. Other dynamics include slants in the road and its affect upon the driver and presence of any hindrances blocking the vision of the driver [9]. A brief account on the guidelines of how the photography of a road traffic accident is done is depicted in Table 13.1.

Forensic Photography  329 Table 13.1  Road traffic accidents photography guidelines [9]. Aspects to be photographed

Purpose of the photograph

Sightline of driver

Determine the vision of field of the driver

Impact point

To establish the exact coordinates where the vehicle collided

Skid Marks

To determine the acceleration and deceleration of the vehicle

Condition of the road

Dynamics of the road that impacted the accident of the vehicle

Biological evidences

Evidences such as blood, flesh and hair on the ground and the vehicle, windshield and tires

Tire track-marks

To determine location and drag direction and duration of the tire drags

Vehicle paint impression

To establish any kind of paint transfer or fabric impressions

Trace evidences

To find any sorts of fabrics or glass embedded in the vehicles

Faults in vehicles

To determine faults in wheel alignment, headlight or indicator light malfunction and sagging suspensions

Wreckage or debris

Determination of the distance between the wreckage to the site of actual collision

Vehicle interior

Obtaining readings from the speedometer, seat and blood stain positions, lever and handbrake shifts etc.

Vehicle details

Complete overview of the vehicle along with the VIN numbers and the licence plates

13.7.2 Photography of Homicides When working at a scene of homicide, a variety of issues must be kept in mind regarding health and safety regulations. Since, a forensic photographer works in a close vicinity to dead bodies, PPE kits must be worn in order to prevent bacterial and viral spread. Apart from self-care points a

330  Modern Forensic Tools and Devices forensic photographer must keep some key points in mind for the best photography results at a scene. The first one being, a forensic photographer must treat the scene with utmost care, i.e., care should be taken while moving around the scene in order to prevent any relocation of evidences that may be crucial to the CSI procedure [22]. In simpler terms a forensic photographer must also tend to the homicide scene same as any other crime scenario i.e., with utmost care. In a homicide crime scene, a dead body tends to become the center of focus but not necessarily contain sensitive evidences. Therefore, prior to photographing the dead body, a forensic photographer must document all other environmental aspects of the homicide scene. When it comes to the documentation of the dead body, it should be photographed in full length and then followed by close-up shots. In some homicide cases, bodies are tied up in a ceiling, in such scenarios the ties in the rope prior to the removal of body. There are homicide cases that include the use of exogenous drugs. In such cases any reminiscent of drugs must be photographed including their packaging. Injuries or changes in skin conditions of the dead bodies must also be photographed. Any equipment, object or weapon found at a crime scene must also be photographed [9].

13.7.3 Arson Crime Scenes In arson cases generally, the photography begins from the entry point and ends at a noted exit point of the scene. Close-up photography is preferred in scenarios if a definite seat of fire is observed. Burning patterns, damage made with smoke and its spread should be assessed prior to taking photographs of the scene [23]. Forensic photographers are often required to take photographs of the scene when the area has been cleaned up from the rubbles. In such cases previously taken photographs are referred to imitate the angles of the photograph. Photography of an arson crime scene is often challenging, it is mainly due to high contrast levels and flares. Open flash approach is the most commonly used technique for photography at arson crime scenes in which most small to medium sized external flash units are used to create exposure [24].

13.7.4 Photography of Print Impressions at a Crime Scene Fingerprints, palm or foot prints are some of the print impressions that can be found at a crime scene. Generally, a 35 mm lens camera is used to click photographs of the discovered impressions. Different macro lenses are generally preferred for fingerprint photography along with gray cards

Forensic Photography  331 to improve exposure [5]. To enhance the quality of fingerprint or palm and footprint [25] photographs black and white films are preferred to give more contrast to the pictures. This technique is also great for photographs of latent prints. Fingerprints can be found in a variety of surfaces [26], which can vary from soft to porous and hard surfaces. If fingerprints are found in soft surfaces such as clay smear or wax, an oblique angle would be perfect for taking the pictures for fingerprints. A perpendicular angle is preferred for fingerprint photography in porous surfaces such as sand. Forensic photographers are expected to turn to low oblique angles while placing a white background and scales for measurement purposes, when fingerprints are discovered in harder surfaces such as glass or mirrors [27].

13.7.5 Tire Marks and Their Photography The primary step in cases of tire marks photography is to practice orientation photography. This is done in order to determine the exact position of the tire impression in the crime scene [28]. To unveil the finest details of the tire impression, close up shots are taken, while exploiting different lighting techniques and a measurement scale placed along the tire impression, to determine the dimensions of the tire [5].

13.7.6 Photography of Skin Wounds The application of ultra violet (UV) light imaging in forensic science is not new. Ultra violet imaging as an alternating light source has been used to document injuries on human skin [29]. Different wound marks on skin such as lacerations, contusions, abrasions and bite marks can be documented with UV lighting as an alternative source. Heinous crimes such as homicides, domestic violence, sexual assaults or child abuse give arise to such wounds. Numerous other lighting techniques such as the usage of black and white filters are the conventional techniques that have been prevailing in order to present evidences at a courtroom trial. It is an established fact that the ultraviolet lights possess a spectrum wavelength lesser than the wavelength of visible light. Due to the aforementioned fact, UV radiation can be absorbed, reflected and diffused by different surfaces that it strikes and as a result images produced due to this alternating light source technique, this makes UV light appropriate for skin wound photography and forensic photography applications [30].

332  Modern Forensic Tools and Devices

13.8 Conclusion With the population boom, crime rates have elevated, now considering this present era, adequate advancements have taken place in the field of forensic science. Forensic photography is an imperative aspect of forensic science and crime scene investigation procedure, and although new tactics and technologies have been implemented in the field of forensic photography, yet much more promising advancements are yet to be seen. This chapter deals in details each and every aspect of forensic photography including its purposes and the types of crime scenarios where forensic photography is required. Forensic photography can be compared to a tool that can be used by its practitioners to obtain high quality images of a crime scene. The technicalities of forensic photography can be used to precisely reconstruct the possible events that could have occurred at a crime scene. It is the primary responsibility of a forensic photographer to capture the complete ambience in such a way that the photographs signify absolute relevance in the court of law. To conclude, a forensic photographer’s ultimate companion is the camera and their skillset, hence it is important for a forensic photographer to keep up with the advancements in the field and produce the best representation of the crime scenario, whilst adhering to the fundamentals of forensic photography.

References 1. Balaji, N., Senapati, S., Mk, S., Forensic digital photography: A review. Int. J. Dent. Med. Sci. Res., 1, 132–135, 2014. 2. Raut, S., www.santoshraut.com: Forensic photography [WWW Document], 2008, http://www.santoshraut.com/forensic/forensicphotography.htm (accessed 10.22.20). 3. Rohatgi, R. and Kapoor, A.K., Importance of still photography at scene of importance of still photography at scene of crime: A forensic vs. judicial perspective. J. Harmonized Res. Appl. Sci., 2, 4, 271–274, 2015. 4. Ramesh, D.G., Forensic photography - An emphasis on bite mark photograph. J. Dent. Res. Updates, 1, 39–41, 2014. 5. Gouse, S., Karnam, S., Girish, H.C., Murgod, S., Forensic photography: Prospect through the lens. J. Forensic Dent. Sci., 10, 2–4, 2018, https://doi. org/10.4103/jfo.jfds_2_16. 6. Sargaiyan, V., Bharddwaj, D., Singh, P., Sharma, R., Siddiqui, S.N., Bhatele, S., Forensic photography: A review. Int. J. Forensic Sci. Pathol., 3, 9, 169–171, 2015, https://doi.org/10.19070/2332-287x-1500041.

Forensic Photography  333 7. Shaler, R.C., The principles of forensic photography, in: Crime Scene Forensics, pp. 137–190, 2020, https://doi.org/10.1201/b11595-11. 8. Donofrio, A.W., First responder duties: Responsibilities of the first officer at a crime scene. Law Order, 48, 117–122, 2000. 9. Shaler, R.C., Crime scene forensics, CRC Press, Boca Raton, 2011, https://doi. org/10.1201/b11595. 10. Bell, A., Crime scene photography in England, 1895–1960. J. Br. Stud., 57, 53–78, 2018, https://doi.org/10.1017/jbr.2017.182. 11. CS Phtography, Crime scene photography: Principles, USA, 2020. 12. Robinson, E.M., Chapter 2 - Composition and cardinal rules, in: E.M.B.T.-C.S.P. Robinson (Ed.), Crime Scene Photography (third edition), pp. 27–60, Academic Press, San Diego, 2016, https://doi.org/10.1016/ B978-0-12-802764-6.00002-7. 13. Robinson, E.M., An overview of crime scene photography and composition, in: Introduction to Crime Scene Photography, pp. 1–77, Elsevier, Oxford, UK, 2013, https://doi.org/10.1016/b978-0-12-386543-4.00001-8. 14. Kuthirummal, S., Nagahara, H., Zhou, C., Nayar, S.K., Flexible depth of field photography. IEEE Trans. Pattern Anal. Mach. Intell., 33, 58–71, 2011, https://doi.org/10.1109/TPAMI.2010.66. 15. Digital Camera Fundamentals, Introduction, vol. 1579, pp. 4–29, 2006. 16. Keim, R., CCD image sensor types: Full-frame, interline-transfer, and frame-transfer CCDs - Technical articles [WWW Document], 2020, https:// www.allaboutcircuits.com/technical-articles/types-of-ccd-image-sensorsinterline-transfer-frame-transfer-full-frame-ccd/ (accessed 12.11.20). 17. Oxford, Essential overview of CCD spatial resolution, Andor Learning Centre-Oxford Instruments [WWW Document], 2020, https://andor.oxinst. com/learning/view/article/ccd-spatial-resolution (accessed 3.8.21). 18. Ahmed, S.N., 7- Position-sensitive detection and imaging, in: Physics and Engineering of Radiation Detection (second edition), Ahmed, S.N.B.T.-P. and E. of R.D. (Ed.), pp. 435–475, Elsevier, Amsterdam, Netherlands, 2015, https://doi.org/10.1016/B978-0-12-801363-2.00007-3. 19. Holmes, T., What is frame rate?, Wistia [WWW Document], 2019, https:// wistia.com/learn/production/what-is-frame-rate (accessed 3.8.21). 20. Wittmann, A., Overview of the forensic photography. J. Forensic Sci. Criminal Inves., 2, 2017, https://doi.org/10.19080/JFSCI.2017.02.555581. 21. Feng-Hui, W., Ling-Yi, L., Yong-Tao, L., Shun, T., Lang, W., Road traffic accident scene detection and mapping system based on aerial photography. Int. J. Crashworthiness, 26, 5, 1–12, 2020, https://doi.org/10.1080/13588265.2020. 1764719. 22. Henham, A.P. and Lee, K.A.P., Photography in forensic medicine. J. Audiov. Media Med., 17, 15–20, 1994, https://doi.org/10.3109/17453059409018372. 23. Kennedy, J., Photography in arson investigations. J. Crim. Law Criminol., 46, 5, 726–736, 1956.

334  Modern Forensic Tools and Devices 24. Marsh, N., Crime scene photography, in: Forensic Photography, pp. 113– 162, Wiley Online Books, West Sussex, UK, 2014, https://doi.org/10.1002/ 9781118852750.ch4. 25. Srihari, S.N., Analysis of Footwear Impression Evidence, U.S. Department of Justice, Washington DC, USA, 2011. 26. Finn, J., Photographing fingerprints: Data collection and state surveillance. Surveill. Soc., 3, 21–44, 2005. 27. Staggs, S., Lighting methods for copy and evidence close-up photography, Staggs Publishing, Wildomar, CA, USA, 2014, [WWW Document]. https:// www.crime-scene-investigator.net/closeup.html (accessed 12.13.20). 28. Sharma, B.K., Chand, D., Bashir, R., Shafiq, E., Analysis of overlapped tire marks characteristics with the aid of enlarged photography. Int. J. Recent Technol. Eng. (IJRTE), 7, 6, 932–936, 2019. 29. Langemo, D., Hanson, D., Anderson, J., Thompson, P., Hunter, S., Digital wound photography: Points to practice. Adv. Skin Wound Care, 19, 386–387, 2006. 30. Barsley, R.E., West, M.H., Fair, J.A., Forensic photography. Ultraviolet imaging of wounds on skin. Am. J. Forensic Med. Pathol., 11, 300–308, 1990.

14 Scanners and Microscopes Aayush Dey1, Piyush K. Rao1 and Deepak Rawtani2* School of Doctoral Studies & Research (SDSR), National Forensic Sciences University, Gandhinagar, Gujarat, India 2 School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India

1

Abstract

Crime scene reconstruction and the morphological analysis of evidences are some of the core requirements in solving a crime. A forensic scientist encounters countless variations in the dimensions of a crime scene. It ranges from indoors to outdoors, shooting scenarios to arson cases. Physical documentation of such scenes is tedious and labor demanding, also man-made errors are inevitable. Such problems necessitated the incorporation of technologies either conventional or contemporary that assisted forensic scientists to document a complete crime scene in a jiffy. The use of different scanners such as the three-dimensional laser scanner, the structured light scanners, the intraoral optical scanners and the computerized tomography scanners have significantly reduced the physical efforts invested by a forensic professional by a significant margin. Scanners in forensic science are reliable pieces of technology because of their speed and accuracy. The most intricate details about the crime scene can be revealed via utilization of scanners. Microscopes, on the other hand are analytical tools that are used to visualize different evidences or samples of forensic significance. Sometimes it is important to characterize evidences at the nanoscale levels and microscopy techniques cover that aspect too. Light, electron and probe-based microscopes that are most frequently used for forensic investigations have been discussed in absolute details in this chapter. Keywords:  Scanners, microscopes, forensic science, crime scene investigation

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (335–360) © 2023 Scrivener Publishing LLC

335

336  Modern Forensic Tools and Devices

14.1 Introduction In any crime scene reconstruction or investigation procedure, the primary responsibility of a forensic professional is to thoroughly document a crime scene. After a thorough reconstruction of the crime scene has been completed, the gathered physical evidences are bagged and tagged, a proper chain of custody is maintained and further analyses are carried out at the respective forensic laboratory. Crime scene reconstruction is a tedious process and requires man power [1]. To ease the reconstruction process crime scene investigators and forensic professionals use different techniques of scanning. Microscopy techniques are exploited for further analyses. As mentioned earlier, crime scene reconstruction is not only a tedious process, but it is also important as crime scenes are short-lived as well as unsteady [2]. The above statement implies that forensic professionals have a limited time to extract as much possible information prior to any onset of degradation in evidences [3, 4]. As a core part of the investigative process investigative professionals utilize photo and videography and hand drawn diagrams for crime scene documentation. A crime scene documentation procedure is incomplete without physical measurements of the complete scene which includes measuring the boundaries of the scene, intricate details of the scene as well as evidences found at the scene [3]. Capturing measurements in a crime scene reconstruction process is a necessary step as it provides an investigator with an insight upon the actual locations of all marked evidences, as well as it exhibits the three-dimensional distribution of the evidences and the association of the evidence to the crime scene [5, 6]. It is evident that three-­dimensional representation of evidences is not possible with manual measurements or hand-made drawings. Apart from the fact that manual handling of measurements take a lot of effort and long work hours, another major drawback of manual measurements is that there are potential chances of errors [6]. Such reasons provide continual rooms for improvement in efficacy and speed, and hence contemporary technologies such as three-dimensional laser scanning, magnetic and intraoral scanners have found their way as an integral part of the scene documentation process. Microscopes on the other hand is described as culmination of different kinds of lenses in order to resolve and differentiate fine details of a sample object. In forensic science different types of microscopes are utilized to analyze different kinds of samples that ranges from gunshots, bullet marks, cells and

Scanners and Microscopes  337 tissues, fingerprint impressions and much more [7]. Microscopes that have the most frequent usage in forensics include the compound microscope, the comparison microscope, polarizing and stereoscopic microscope, electron and more advanced probe microscopes i.e., atomic force microscopy. That being stated, microscopy techniques have brought to such an advancement that they are used to characterize samples at the nanoscale levels. The advent in the improvements of microscopy technique exhibits promising novel proportions in field of forensic science which seemed to be unachievable inside the boundaries of the common light microscope [8].

14.2 Scanners in Forensic Science Crime scene reconstruction requires focus, time and skilled manpower at disposal. Despite the skills and experience of a forensic investigator, there is a room for error, however small it might be. Different types of scanners are required and used now in different scenarios in the broad field of forensics and hence discussed in detail as follows. Figure 14.1 depicts the different types of scanners used.

Arson crime Post-mortem analysis scene

Analysis of anthropological evidences

Structured light scanner

Three-dimensional laser scanner

Shooting Blood-stain crime scene analysis

Shoe-print analysis

Types of Scanners

Forensic pathology Computerized Tomography scanner

Intraoral optical scanner

Forensic profiling

Figure 14.1  Different types of scanners and their applications.

Forensic odontology

338  Modern Forensic Tools and Devices

14.2.1 Three-Dimensional Laser Scanners Laser scanners have primarily been employed for architectural buildings and engineering purposes. Its application in the field of forensic sciences have been developed in the recent years. Shooting scenes, homicides and arson cases are some of the primary areas of forensic science where three-dimensional laser techniques are employed for crime scene reconstruction [9]. The working principle of the three-dimensional laser scanner is based upon light detection and ranging (LIDAR). In this technique a sensor fires up a pulse upon a targeted object, consequently the pulse is sent back to the sensor after it hits the target [10, 11]. The distance traversed by the pulse is determined by comparing the difference between the collected pulse and the prior emitted pulse. The time taken by the pulse to return to its origin also accounts for the distance traversed between the pulse origin and the target points. A three-dimensional laser scanner is capable of aiming approximately up to a million targets per second. Simultaneously a three-dimensional laser scanner is also capable of capturing photographs of the targets. “Point cloud” is the term given to such targets. The information hence collected from point clouds are analyzed and as a result fully colored three-dimensional render of the crime scene is obtained at absolute accuracy [12].

14.2.1.1 Benefits of Three-Dimensional Laser Scanners The foremost and the most direct advantage of using three-dimensional laser scanners is the less reliability on man-power and reduction in time consumption. If a scenario is considered where physical labor can complete a crime scene reconstruction process within an hour, laser scanners can take up just a couple of minutes to finish the job. This exhibits the rapid analysis nature of three-dimensional laser scanners [9]. Although this technique is easier to maneuver, accuracy can be expected with prior training. The visual appeal of the final crime reconstruction procedure post-­processing is excellent, which in turn is helpful and admissible in the court of law. The three-dimensional stature of the actual crime scene is so lively that it helps the judge the jury and the expert witness for better understanding of the aspects of the crime scene [13].

14.2.1.2 Drawbacks of Three-Dimensional Laser Scanners There are some aspects that three-dimensional laser scanners are unable to excel in. One such drawback lies in the inability to capture distant targets

Scanners and Microscopes  339 and objects with a shiny surface [11]. It is highly likely that three-dimensional laser scanners would fail to acquire data or produce noise signals that would ultimately result in a failed three-­dimensional rendering of a crime scene, if objects such as windows or shiny glasses intervene the path of pulses transmitted by a laser scanner [14]. Generally, in order to eliminate any reflective or shiny surface from the path of a scanner pulse, shampoo can be applied on the surface to impart a matte effect, but this is unacceptable because it would be accounted for tampering with the crime scene. Three-dimensional laser scanners also face a drawback regarding acquisition of a spatial representation of complex bony surfaces. Although techniques such as portable laser scanners can be used for the detailed analysis but in order to reveal the most intricate details expensive three-dimensional microscopes and laser scanners can be used [15]. The three-dimensional laser scanners can never be questioned regarding its accuracy and speed, although an extensive prior training is required to completely comprehend the functioning of the scanner. That being said, a laser scanner cannot be expected to produce the accuracy levels on its own. There are some factors regarding the accuracy of the scanner that must be noted. The first such aspect is the software of the scanner, the second factor is the human factor and lastly, the accuracy depends upon the ambience in which it is being operated [16]. Software glitches or the incompatibility with the hardware specifications can cause inaccuracy in results. Human factor is another cause of error in the functioning of the laser scanner. It may be because of distractions while working at the scene or the incompetency of the operator. Lastly, ambient conditions such as in highways or areas with thick plantation are highly repetitive and this could lead to struggle in registering the scan into the software [2].

14.2.1.3 Applications in Forensic Science The three-dimensional laser scanner has been used for the forensic analysis in following cases.

14.2.1.3.1 Reconstruction of a Firearm Shooting Crime Scene

In a study by [9], a scene of firearm shooting between a suspect and a police officer was recorded on video by different witnesses with different positioning perspectives. Referring to the videos captured a three-dimensional model of the shooting scene was recreated. This revealed intricate details about the scene such as distance between the suspect and the police official

340  Modern Forensic Tools and Devices and the passers-by. The technology permitted the creation of the complete scene from a bird’s eye view and was also able to recreate the scene from the officer’s point of view.

14.2.1.3.2 Reconstruction of Arson Crime Scene

If a scenario is considered when electrical or chemical fires burn down a structure, the most rapid and effective method to capture the complete scenario without risking the lives of investigators is the utilization of three-dimensional laser scanning technique. The structural strength can be compromised because of fires and those particular spots where the structure is weak can be avoided due to the implementation of this technique, and also debris can be located and removed. Also if the original blueprint of the structure and the scans were synced, it could help in the reconstruction of the structure, speculate how individuals got trapped in the fires and lastly, evaluate the evidences how the fire spread in the first place [9].

14.2.1.3.3 Blood Stain Pattern Analysis

The application of three-dimensional laser scanning is not limited. The capabilities that they possess is also expanded to be used in homicidal cases in which large pools of blood and blood spatter is very evident. In a research by [16]. A blood stain pattern originating from a large pool of blood was documented using this technique. Pulses from the scanner device are emitted and spreads evenly in the area of investigation. The field of view in a two-axis plane was pre-specified, in which the horizontal and the vertical field of view was set to 360° and 310° respectively. The scanner further measures the angles and distances from the received pulses and calculates the three-dimensional position of the targeted objects hence revealing the complete blood stain and the whole crime scene filled with intricate details.

14.2.1.3.4 Post-Mortem Analysis

A three-dimensional laser scanner is helpful in the post-mortem analysis of a cadaver. Bite-marks, ligature impressions or tool marks [17] are some important evidences which can be analyzed by a three-dimensional laser scanner. Analysis of blunt and sharp force injuries and facial reconstruction also use three-dimensional laser scanning technique [18]. If a deadbody suffers mild putrefaction and decomposition, three-dimensional

Scanners and Microscopes  341 laser scanners can be used for substituting for viewing the actual morbid state of the body to ease the anxiety of relatives [4].

14.2.2 Structured Light Scanners A portable alternative to three-dimensional laser scanner is the structured light scanner. The structured light scanner works on the principle of triangulation. The structured light scanners measure any kind of deformation in a target by projecting uni- or bi-dimensional, non-coherent light [10]. The greatest advantage of using structured light scanners is its rapid analysis. The structured light scanners represent evidences such as anthropological remains, archaic reminiscent and latent prints in a three-dimensional pattern. This particular scanner examines the complete field of view at once, which ultimately eliminates any possibility of distortion due to movement. Hence the structured light scanners can also be used for scanning moving objects in real time [19].

14.2.2.1 Applications in Forensic Science The applications of structured light scanners in the field of forensic sciences are vividly broad, a detailed discussion on its applications is stated as follows.

14.2.2.1.1 Spatial Representation of Footwear Impressions

A study by [20] used three components to produce a three dimensional render of a footwear impression. A camera, a projector and a scanner were used for the purpose. The scanner was calibrated geometrically by altering the intrinsic and the extrinsic characteristics of the scanner. After the calibration process, the camera and the projector were placed in the field of view of the footwear impression and it was ensured that the camera and the projector position was not altered, as it could result in incomprehensible rendering. A recognized configuration of light due to the previous calibrated settings is projected upon the footwear impression and the depressions around the footwear impression bends the light which is further recorded and stored by the camera. In order to ensure that the footwear impression is captured from all angles the scanner is moved around the impression. After the collection of scans,  the software processes the different scans and in the post-processing all of the noise (unwanted data) is removed. All of the individual scans of the impression are compiled

342  Modern Forensic Tools and Devices to create a three-dimensional or a spatial representation of the footwear impression.

14.2.2.1.2 Miscellaneous Applications in Forensic Science

The structured light scanning finds its other major applications in anthropological investigations. [21] emphasized upon the use of structured light scanners for the recovery of faunal remains. Similarly, the research data hence accumulated can be used to determine and recover human remains.

14.2.3 Intraoral Optical Scanners Odontology is another important field in forensic sciences. Conventional methods of documenting a bite-mark impression included the use of plaster molds. The recent technologies involve the usage of intraoral optical scanners. This device is used to capture an optical three-­ dimensional impression of bite marks [22]. The working principle of an intraoral scanner is almost similar to that of a three-dimensional laser scanner. The pulse source projects a structured light that scans the dental arches. Teeth casts and extrinsic implants can also be scanned to prepare a three-dimensional rendering [23]. The scanning software captures images of the dentogingival tissues as well. These primary targets act as a point cloud for the scanner. Further all of the point clouds are compiled and a spatial illustration of the complete oral cavity is produced [24]. This render act as an alternative for conventional plaster molds [25].

14.2.3.1 Applications in Forensic Science Bite-mark documentation and identification in forensic science is of grave importance. In general terms, bite-mark is defined as the impression or design made on a surface, be it skin, food items etc., by human or animal dentition. The shape of a bite-mark ranges from oval to circular usually and is composed of two proportioned U-shaped arcs that might be discrete or merged towards the basal point. Prior to the usage of intraoral scanners dental photography technique was followed which for obvious reasons has its own drawback. Although, less time consuming and accurate, if protocols of dental photography are not strictly adhered to, distortions can intervene and analysis results would not be correct [26]. Now, intraoral scanners can be classified into categories. The former one being

Scanners and Microscopes  343 three-dimensional contact intraoral scanners and the latter one being intraoral three-dimensional optical scanners. Accuracy have never been an issue for both the categories of intraoral scanners. The former category i.e., the three-dimensional contact intraoral scanners acquires the topography of the dental arch by using a probe. Although accurate, the main drawback of such scanners is that it takes longer time-periods to conduct point-to-point acquisition. The alternative for this drawback was to device intraoral three-dimensional optical scanners, which emits pulses or signals to completely scan the most intricate details of the dental arch. Further, point clouds generated in the analysis are compiled to obtain a complete three-dimensional render [27].

14.2.4 Computerized Tomography Scanner Trauma and cancer studies have seen the applications of computerized tomography scanners for a long time now, but its application in forensic science is impeccable too [28]. Computerized tomography has been specifically used in forensic pathology branch of forensic sciences in lieu of forensic autopsies [29]. Computerized tomography is completely different from a conventional x-ray imaging technique. Instead, in computerized tomography, a motorized x-ray source is rotated around the subject. The pulses from the x-ray source is interpreted by the detector of the machine and cross-sectional images of the subject is procured. These cross-sectional images are also referred to tomographic images and consists of more intricate details that can be missed by normal forensic autopsy procedure. The tomographic images are further compiled in an orderly fashion to produce a three dimensional render of the scanned subject [30].

14.2.4.1 Applications in Forensic Science The computerized tomography has the following applications in the field of forensic sciences.

14.2.4.1.1 Forensic Pathology

The computerized tomography has a whole range of applications in forensic science. This scanner is outstanding for the three-dimensional representation of fractures in cases of physical assaults or road traffic accidents. In cases of wounds due to a sharp object, in cases of stabbings computerized tomography can reveal air pockets in the blood vessels, damages in

344  Modern Forensic Tools and Devices the soft tissue and bone marrow, whereas internal wounds due to a blunt force can also be scanned by the computerized tomography techniques. Such intricate details are very useful to professionals with non-medical background such as investigators, and individuals of the court of law. Skull fractures due to the gunshot wounds and other intricate details such as displacement of the bone fragments at the entry and exit wounds of the bullet are better visualized by computerized tomography than a conventional autopsy. Metal shrapnel from an explosive can also be better visualized in computerized tomography [31].

14.2.4.1.2 Forensic Profiling – Sex and Age Estimation

The two most significant rudiments that signifies a biological profile for the purpose of forensic identification are sex and age of that individual. The skull base and the pelvic bones are very significant in speculating the sex and age of an individual, but at times the conditions of the due to extensive putrefaction or fractures in cases of mass disasters it is nearly impossible to determine the profile. To establish the sex of an individual, the imagery of the proximal part of the femur bone was obtained using computerized tomography. The scanned data obtained revealed that males had approximately 57 cubic centimeters of more substance in the proximal femur than females and approximately 50 cubic centimeters of more trabecular volume than females, hence establishing the difference between male and female victims with an accuracy of 93.5%. Age estimation unlike sex determination is not easy. Estimation of age, of a fully-grown adult is more difficult than estimating age in individuals pertaining to the adolescent phase. The accuracy of age estimation mainly depends upon different skeletal and dental features. The tomographic scans of the femur established an accuracy of 86-92% in the estimation of the age of an individual [32].

14.3 Microscopes in Forensic Science One piece of equipment that is mandatorily required for analysis of different evidences ranging from biological, physical, chemical, geological, anthropogenic evidences is the microscope. This piece of equipment is basically a combination of lenses that magnifies the subject of interest to reveal the smallest detail not visible to the visible eye [8]. The primary purpose of using microscopes in forensic science is to analyze and compare evidences that hold a significance to forensic investigations. Prior

Scanners and Microscopes  345 Compound Microscope Comparison Microscope Polarizing Microscope Stereoscopic Microscope

Light Microscope

Electron Microscope

Scanning Electron Microscope Transmission Electron Microscope

Types of Microscope

Probe Based Microscope

Atomic Force Microscopy

Figure 14.2  Microscopes in forensic science.

training in handling, maintenance and operation of different types of microscope is mandatory for forensic investigators. A detailed account on different types of microscopes classified on the basis of their primary illumination source is discussed as follows. Figure 14.2 depicts different types of microscopes.

14.3.1 Light Microscopes Light microscopes are most commonly utilized microscopes in a forensic case. A compound microscope can be used for viewing smaller evidences like the polarizing microscope. When it comes to a comparison microscope, two like objects of interest are compared. Stereomicroscope unlike the compound and the polarizing microscope is used for the visualization of big sized evidences. The aforementioned types of light microscopes and their significance in forensic science is discussed as follows.

14.3.1.1 Compound Microscope One of the most commonly used microscopes in forensic science is the compound microscope. A compound microscope is composed of two parts, the former one being the mechanical system and the latter one being the optical system. The functions of these systems are to support

346  Modern Forensic Tools and Devices the working components and lighting up the evidence placed for investigation respectively. The final image of the object i.e., the evidence is formed behind the objective lens of the microscope (Figure 14.3). The mechanical part of the compound microscope is composed of the base, the C-shaped arm, the stage, the body tube, adjustment systems i.e., the coarse and fine adjustment systems. The optical system of the microscope unlike the mechanical system is composed of the following components, the eyepiece also termed as the ocular lens, the objective lens, a light source and a condenser [8]. The base of the microscope is the part upon which the complete instrument stands, whereas the C-shaped arm is an extension of the base and provides support to the instrument and also acts as a handle for portability. The microscope area upon which the specimen slide rests for assessment is termed as the microscope stage. The microscope stage can be adjusted manually i.e., provisions have been provided to move it upwards or downwards in order to bring the specimen slide under focus. The movement of the slide is controlled by the coarse adjustment knob whereas the fine adjustment is used to bring the specimen into sharp focus under low magnifying power. The lens closest to the eye is the eyepiece or the ocular lens and the lens positioned closest to the specimen is the objective lens. In a compound microscope the power of the objective lens differs. Different objective lenses in a compound microscope are placed in an orderly fashion in a revolving turret shaped tube. An illuminator is fitted at the base of the compound microscope which provides artificial light for specimen observation. The last component of the optical system is the condenser, whose function is to collect light rays from the illuminator and directs them on to the specimen. The condenser consists of an iris diaphragm that is used to control the amount of light passing through the illuminator [33].

Eye piece Objective lens Observer

Sample

Inverted and enlarged image of sample

Figure 14.3  Ray diagram of a compound microscope.

Scanners and Microscopes  347 The utilization of a compound microscope in forensic investigations have been restricted to the analysis of metals, bullets and tool marks [7]. Sample preparation in case of transparent samples is mandatory, because the sample has to be adequately shrill to permit the passage of light. Different configurations of compound microscopes are used in forensic sciences for example, brightfield, comparison, phase contrast and hot stage microscopes and fluorescence microscopes [34].

14.3.1.2 Comparison Microscope Assessment of evidences in forensic science frequently require a detailed side-by-side comparison. One such microscope used for the side-by-side comparison of evidences is the comparison microscope. The comparison microscope works in the same principle as of the normal compound microscopes and is a combination of two compound microscopes in a single unit. The fact that a conduit incorporates a range of mirrors and lenses to combine the two independent objective lenses make this design of a comparison microscope stand-out. This conduit joining the two compound microscopes into a single unit make it a binocular microscope. The circular field of view of a compound microscope is divided into two equal parts via a precise margin. The specimen placed under the left and right objective lenses are viewed in the left and right halves of the circular field of view. It is important to ensure minimal lens distortions in both of the objective lenses. Forensic evidences such as bullets, cartridge heads, and tool marks can be viewed and analyzed under a compound microscope (Figure 14.4). Biological evidences such as hair strands and physical

Textile fabrics

Bullets Comparison microscope

Bullet marks

Tools and tool impressions

Figure 14.4  Comparison microscope in analysis of forensic evidences.

Hair strands

348  Modern Forensic Tools and Devices evidences such as textile fabrics can also be viewed and analyzed under a compound microscope [8].

14.3.1.3 Polarizing Microscope The polarizing microscope is a powerful tool in forensic science that be utilized for assessing the structure of an object, working similarly as a compound microscope. This microscope can unveil the smallest of details about the surface structure of a sample by accessing the optical characteristics of the sample. There are two types of samples that can be analyzed by a polarizing microscope. The former type is the isotropic type and the latter one is the anisotropic type. Those samples that illustrate the exact optical property throughout falls into the isotropic category, whereas those samples whose optical characteristics vary with the direction of incident light fall into the latter i.e., the anisotropic category. Forensic samples such as gases, liquids, certain crystals and glasses are isotropic samples whereas objects with rough surfaces such as sand grains and wood are anisotropic samples. The refractive indices of an isotropic sample remain constant throughout whereas in anisotropic substances refractive indices may vary. A polarizing microscope uses two types of filters, namely a “polarizer” and an “analyzer”. The polarizer is situated at the base of microscope whereas the analyzer is set above the objective lens. The direction of vibrating photons falling into both the filters are aligned opposite to each other. The analyzer filter can be manually moved into or out of the path of light, but it must be ensured that the analyzer must not be placed in a non-parallel fashion to the polarizer. It is because of the orientation of the analyzer to the polarizer that objects can be visualized under the polarizing microscope. Samples in a polarizing microscope can be viewed in two scenarios. The first is when only the polarizing filter is in place, which exhibits the evident of plane polarized light and the second scenario when both the polarizer and analyzer filters are in place. The latter scenario is the presence of cross-polarized light [33].

14.3.1.4 Stereoscopic Microscope Stereoscopic microscopes generally have almost similar resolving power when compared to a compound microscope but the fact regarding the complexities encountered while operating a stereoscopic microscope, gives compound microscopes a slight better edge. Generally, stereoscopic microscopes are used for analysis of forensic samples that do not require

Scanners and Microscopes  349 to be viewed under higher magnification powers. A stereoscopic microscope provides magnifying powers raging up to 125X. The fascinating aspect about a stereoscopic microscope is that it grants its user to observe a three-dimensional image of the sample. The image formed by a compound microscope is inverted whereas a stereomicroscope forms a right-side-up image. The stereoscopic microscope offers a wide field of view with a good depth of focus and this makes it a suitable instrument for the analysis of trace evidences, garments, tools and weapons. The spectrum of the type of samples that could be analyzed with a stereoscopic microscope can be broadened to dye smears, mud, GSR and marijuana with the help of an extrinsic light source [8].

14.3.2 Electron Microscopes The most widely utilized electron microscopes in the field of forensic science are the scanning electron microscope (SEM) and transmission electron microscope (TEM). These microscopes produce high resolution images and are discussed in detail as follows.

14.3.2.1 Scanning Electron Microscope The working principle of SEM is based upon a beam of electron falling upon a specimen that is to be investigated. The electrons hence scattered by the sample surface is monitored in a closed-circuit screen. A hot tungsten filament acts as the source of electrons and electromagnetic coils direct these beams of electrons on to the specimen surface. A secondary beam of electrons is formed from the primary beams of electrons. This happens when due to the bombardment of electrons from the source causes the upper surface of the specimen to release electrons. In SEM almost, 20% to 30% of electrons rebound back from the specimen surface and these electrons are known as backscattered electrons. The secondary and the backscattered electrons causes the signal to be amplified and this amplification readout is produced in the screen. The image of the specimen is created by scanning the primary electron beam across the specimen’s surface in sync with the cathode ray tube (CRT). The image thus obtained has high resolution, high depth of focus and is highly magnified [8]. SEM finds in primary applications in analysis of GSR. SEM can easily characterize gunpowder on the basis of their size, their shape and the composition. SEM can also be used to analyze paint chips, glass and metallic shrapnel.

350  Modern Forensic Tools and Devices Chemical evidences of explosives and fire residues can also be analyzed by SEM along with biological samples such as hairs [35].

14.3.2.2 Transmission Electron Microscope A TEM consists of a columnar structure with the source of electron on top of it. The components of a TEM microscope includes an electron gun whose material is similar to that of a SEM microscope i.e., the electron source is made of tungsten. The electromagnets also known as the “Wehnelt cylinder” reforms the electrons in the form of a beam. The electricity heats up the tungsten source and electrons are emitted. An alternative source of electrons also known as emission guns can also be used in lieu of the tungsten filament. The sample preparation in case of TEM is tricky. The samples need to be immobilized and made very thin. The immobilization of the sample takes place in a specimen chamber which constitutes the second component of the TEM. The lens system of the TEM is magnetic because electrons cannot be manipulated by glass lenses. The vacuum chamber is another component of the TEM where surface particles of the specimen interact with the electrons. These interactions are then analyzed and recorded and displayed in the viewing chamber which is situated at the base of the screen. The TEM finds its applications in examination of paint and fiber materials, counterfeit currency examination, GSR analysis, firearm identification [33].

14.3.3 Probing Microscopes 14.3.3.1 Atomic Force Microscope The atomic force microscope (AFM) is a probe-based microscope that finds itself in the midst of vast array of forensic applications. Based upon the nanoscale technology a sharp and flexible cantilever or more commonly termed as probe or an AFM tip, interacts with an object of interest whose surface morphology has to be mapped. The rebounds in the cantilever when it interacts with the surface are recorded by a detector which further determines the topography of the surface of interest. The greatest benefit of AFM imaging in forensic science is that it has a speedy imaging frequency in addition to its being non-destructive method of imaging and no prior sample preparation is required. AFM grants the user to perform analysis in both air and liquid environment [36]. Application of AFM is diverse in the field of forensic science and is depicted in Figure 14.5.

Scanners and Microscopes  351

Blood Analysis Diatom Test

Data recovery from damaged sim cards

Fire Investigation

Line Crossing Shooting Distance Determination Examination

Firearm Incident Examination

Laser Photodiode

Tip

Cantilever

Surface

Corrosion and Pressure sensitive Degradation adhesives Analysis Analysis Hair Analysis Explosives Detection

Fiber Analysis Soil Analysis

Figure 14.5  Applications of AFM. Reproduced with permission from [37].

14.3.3.1.1 AFM in Analysis of Chemical Evidence 14.3.3.1.1.1 AFM for Firearm and Gun Shot Residue (GSR) Analysis

AFM can be employed to assess diverse morphological characteristics of firearms and explosive devices [37]. In a shooting scene cartridge that were fired and an imitation of their heads were made via molding. The molds of the cartridge head exhibited some irregularity but the breechfree marks could not be detected in order to characterize the firearm that was used in the shooting. To study the surface topography of the cartridge mold AFM as well as state of the art imaging tools was utilized. The analysis results gathered from AFM analysis along with PSFD analysis successfully characterize the surface topography of the cartridge head imitation mold [38]. The micromechanical and morphological features of gun-shot residue (GSR) was investigated by [39]. Samples of GSR were collected from the suspect individual and the bullet via a double-sided tape. AFM revealed the most intricate of details including fine edges around the GSR grain.

14.3.3.1.1.2 AFM for Explosives and Shooting Scenario Analysis

AFM has been employed for the topographic analysis of explosives such as triamino-trinitro-benzene, PBXs and ammonium perchlorate

352  Modern Forensic Tools and Devices [40]. To gain newer perceptions in the already present explosives, it is important to assess the surface topography of the aforementioned explosives. The capabilities of AFM are broad. AFM has been utilized to speculate the firing range, the distance between the firearm muzzle and the target, the morphological characteristics of the gun powder and its makers [41]. Also while conducting a GSR analysis on AFM, it is possible that GSR grains can stick upon the AFM cantilever, hence altering the shape of GSR grain and subsequently altering the results [42].

14.3.3.1.2 AFM in Analysis of Biological Evidence 14.3.3.1.2.1 AFM for Blood Analysis

In almost every major crime scene, the most common biological evidence that are encountered by forensic professionals include blood. In forensic science, blood sampling and analysis often holds the key to give a proper closure to a criminal investigation procedure. Various analysis of blood such as DNA-profiling to confirm the identity of a victim or a culprit or blood pattern assessment for the reconstruction process of a crime scene. Conventional methods have been employed for estimating the age of a blood stain at a crime scene, for instance solubility, allocation of chlorides [43], degradation of RNA [44] and electron spin resonance spectroscopy [45]. Some other strategies depended upon assessing the enzymatic changes [46] and examining the changes is color of blood spots. The structural composition of a red blood cell in a human being is complex [47]. The oxidative alterations in blood, effects of exogenous medicines and chemicals constitute the primary cause of RBC rupture. On a nanoscale level AFM can be used to obtain images of the structural morphology of the RNA. Along with nanoscale level visualization of the surface, the alterations caused at the surface of the RBC can also be assessed by AFM [48]. The alterations in the elastic characteristics of the RBC have also been examined with the help of AFM [49].

14.3.3.1.2.2 AFM for “Touch/Trace DNA” Analysis

There are multiple sources from where the human genetic material i.e., deoxyribonucleic acid (DNA) can be extracted, for example, tissue, organs, teeth, hair, fingernails, blood, semen and saliva etc. DNA as a tool for personal identification in forensic science has been evident for a long time now. The collection and sequencing strategies for DNA have also received upgrades with the passage of time. Information relevant to

Scanners and Microscopes  353 forensics that can be extracted when DNA is assessed via AFM is limited. Unlikely, AFM can be used to describe ‘touch/trace DNA” [50]. It is a commonly known fact that DNA can be extracted from epithelial cells or cells from the buccal cavity. There have been reports where AFM imaging of rare cell samples found at a crime scene has been used to analyze “touch/trace DNA” which provides a greater insight in differentiating the epithelial cells of the skin and cells shed from the buccal cavity of the human body. These samples could be transferred onto surfaces via contact with skin and saliva. The main objective of this research was to differentiate between keratinized and non-keratinized cells and the quantification of “touch/trace DNA” from different cell types. Mapping of cells to reveal such information poses as a potent tool with its core significance in forensic science [51].

14.3.3.1.2.3 AFM for Human Hair Analysis

As mentioned in the previous section, hair samples found at a crime scene can serve as a source for DNA extraction and most of the times, hair samples are used in this context only. But this is also a fact that exogenous drugs, chemicals and other biological substance may get aggregated in hair due to erstwhile exposure. Hair as a forensic evidence is resistant to extreme degradation or alterations due to ambient factors, thus it provides a broad window for assessment that can vary from weeks to years. Nano-mechanical properties of human hair might get affected due to environmental factors, hence AFM is an excellent imaging tool in this scenario to map its surface morphology [52]. The cuticle state of human hair holds a great importance in forensic analysis and can reveal medical conditions if any [37]. The density of cuticle, the lean angle of hair and step height are some of the markers that can be characterized via AFM imaging. AFM imaging can also be used to reveal the effects of bleaching and the distance between the distal ends of the hair strand. In a study by [53] AFM has been used to investigate different mechanical properties of human hair in African, Asian and Caucasian individuals. The effects of fatigue, water absorption and ethnicity on the tensile strength of human hair have also been examined via AFM.

14.3.3.1.3 AFM in Analysis of Physical Evidences 14.3.3.1.3.1 AFM for Fingerprint Analysis

Fingerprints are most commonly used forensic evidences for identification purposes. A fingerprint is constituted of skin ridges designed in a particular

354  Modern Forensic Tools and Devices fashion and the ridge patterns differs in every individual. There have been many technological advances that have improved the acquisition of fingerprints from different surfaces. AFM, for the analysis of fingerprints is a boon for forensic science. For instance, in a case study presented by [54] explains how AFM has been utilized to obtain fingerprints from refined brass surfaces thus attaining an unparalleled feat.

14.3.3.1.3.2 AFM for Soil Profiling

A forensic investigator can come across scenarios where they could encounter soil samples. Soil samples can illustrate forensically significant insights upon their origin [55, 56] and its constituents. AFM examination of soil samples is preferred over SEM assessments because it provides quantitative results and also a three-dimensional render of the soil texture.

14.3.3.1.3.3 AFM for Textile Fabric Analysis

A textile fabric as an evidence at crime scenes gives an insight upon the presence or the connection of an individual at a crime scene. A piece of textile fabric can be used to speculate potential suspects, the victim or possibly an eye-witness, who are related to the crime scene. Probe based microscopic techniques i.e., AFM is a potential tool that can be used for the analysis of fabric pieces [50]. A research study by [57] used AFM and SEM for the morphological analysis of a very ordinarily utilized (poly ethylene terephthalate) PET as a textile fiber. PET has also been used for the manufacture of plastics. The spectral analysis of PET fibers was conducted via (infrared spectroscopy) IR and (nuclear magnetic resonance) NMR techniques, thermal analysis via (differential scale calorimetry) DSC and lastly molecular weight analysis was carried out with (mass spectrometry) MS and GPC. AFM already has been utilized for the acquisition of surface topography of different materials. To study the morphological alterations at a nanoscale level in fabrics made up of cellulose, wool and cotton, AFM has been utilized.

14.3.3.1.4 AFM in the Analysis of Computerized Data

Various researches have established the utilization of AFM for the enhancement of a technique holding forensic significance regarding extraction of information from a damaged SIM card found at a crime scene. AFM can be used to characterize the topography of an integrated EEPROM/flash memory circuit that is usually present in a smart card microcontroller [58–60].

Scanners and Microscopes  355

14.3.3.1.5 AFM in Analysis of Question Documents

Any document, if its source and authenticity is in question is termed as a questioned document. Handwriting and signature comparisons, refurbishment of any charred or altered document, the non-destructive analysis of ink composition and paper material are some of the strategies involved in analysis of questioned documents. Another important aspect of analyzing questioned documents includes the study of line crossing [61]. Electron and optical microscopes have previously been utilized for the examination of line crossing. Analysis through an optical microscope posed drawbacks such as low differentiating or resolving power and low depth of focus, although these drawbacks have been overcome by the use of SEM. But then, analysis through SEM was a destructive strategy, which led to alterations in original evidences and hence compromising the results of questioned documents examination. Such drawbacks necessitated the use of an alternative method for questioned document analysis, hence the AFM comes into play [62]. The use of AFM for the examination of line crossings have been demonstrated by [63]. In this study, to create line crossing new and used black fabric ribbons and different ball-point pens of black ink were utilized. The line crossing hence created were used as a reference and was compared to another questioned document with line crossing using AFM. The topographical scans, thus acquired were of the same quality as observed under SEM. In the results obtained from AFM, ink deposits could be seen clearly under medium levels of magnification and could easily determine the comparative sequence. Another advantage of using AFM over SEM is because it was a non-intrusive method of analysis. AFM was also used to analyze nano-indentations to measure the crossings of a toner and stamping inks. AFM could also differentiate between, if a seal was imprinted over a toner or whether the toner was applied post seal stamping [64].

14.4 Conclusion It is clear that the importance of scanners and microscopes in forensic science is very well-established. Forensic professionals while working at a crime scene and analyzing the evidences collected from the scene, are expected to be well-equipped with the knowledge of the technology they are going to work with. Not only knowledge, but also a smart judgment of the tools to be used at a crime scene must also be made by a forensic professional. It is absolutely fine to rely on technology but the shortcomings of certain

356  Modern Forensic Tools and Devices technologies must not be overlooked by a forensic professional. The usage of scanners at a crime scene has provided investigators, and the members of the court of law a proper insight of the possible events that could have occurred at a crime scene. Scanning technologies have been used to solve criminal cases for almost past two decades and further research in such technologies is needed to counter any kind of chances of error. The microscopic analytical techniques are always reliable as they have the ability to reveal details that cannot be seen through naked eyes. In the end it is the forensic scientist who has keep a keen eye so that little details are not missed.

References 1. Tredinnick, R., Smith, S., Ponto, K., A cost-benefit analysis of 3D scanning technology for crime scene investigation. Forensic Sci. Int. Rep., 1, 100025, 2019, https://doi.org/10.1016/j.fsir.2019.100025. 2. Berezowski, V., Mallett, X., Moffat, I., Geomatic techniques in forensic science: A review. Sci. Justice, 60, 99–107, 2020, https://doi.org/10.1016/j.scijus. 2019.10.006. 3. Gardner, R.M., Practical Crime Scene Processing and Investigation, CRC Press, Boca Raton, 2012. 4. Komar, D.A., Davy-Jow, S., Decker, S.J., The use of a 3-D laser scanner to document ephemeral evidence at crime scenes and postmortem examinations. J. Forensic Sci., 57, 188–191, 2012, https://doi.org/10.1111/ j.1556-4029. 2011.01915.x. 5. Schultz, J.J. and Dupras, T.L., The contribution of forensic archaeology to homicide investigations. Homicide Stud., 12, 399–413, 2008, https://doi. org/10.1177/1088767908324430. 6. Berezowski, V., Keller, J.J., Peng, E.L., Article 3D documentation of a clandestine grave: A comparison between manual and 3D digital methods article. J. Assoc. Crime Scene Reconstr., 22, 23–37, 2018. 7. Saadat, S., Pandey, G., Tharmavaram, M., Microscopy for forensic investigations, in: Technol. Forensic Sci., Wiley Online Books, Weinheim, Germany, 2020, https://doi.org/10.1002/9783527827688.ch6. 8. Saferstein, R., The microscope, in: Criminalistics: An Introduction to Forensic Science, Sixth edition, pp. 169–185, Prentice Hall, Upper Saddle River, New Jersey, 2018. 9. Raneri, D., Enhancing forensic investigation through the use of modern three-dimensional (3D) imaging technologies for crime scene reconstruction. Aust. J. Forensic Sci., 50, 697–707, 2018, https://doi.org/10.1080/004506 18.2018.1424245. 10. Sansoni, G., Trebeschi, M., Docchio, F., State-of-the-art and applications of 3D imaging sensors in industry, cultural heritage, medicine, and criminal investigation. Sensors, 9, 568–601, 2009, https://doi.org/10.3390/s90100568.

Scanners and Microscopes  357 11. Dustin, D. and Liscio, E., Accuracy and repeatability of the laser scanner and total station for crime and accident scene documentation. J. Assoc. Crime Scene Reconstr., 20, 57–68, 2016. 12. Liscio, E., Guryn, H., Stoewner, D., Accuracy and repeatability of trajectory rod measurement using laser scanners. J. Forensic Sci., 63, 1506–1515, 2018, https://doi.org/10.1111/1556-4029.13719. 13. Schofield, D. and Fowle, K., Technology corner visualising forensic data: Evidence (Part 1). J. Digit. Forensics, Secur. Law, 8, 2013, https://doi. org/10.15394/jdfsl.2013.1141. 14. Boehler, W., Bordas Vicent, M., Marbs, A., Investigating laser scanner accuracy. Inst. Spat. Inf. Surv. Technol., 35, 696–701, 2003. 15. Bello, S.M., Verveniotou, E., Cornish, L., Parfitt, S.A., 3-dimensional microscope analysis of bone and tooth surface modifications: Comparisons of fossil specimens and replicas. Scanning, 33, 316–324, 2011, https://doi. org/10.1002/sca.20248. 16. Buck, U., Kneubuehl, B., Näther, S., Albertini, N., Schmidt, L., Thali, M., 3D bloodstain pattern analysis: Ballistic reconstruction of the trajectories of blood drops and determination of the centres of origin of the bloodstains. Forensic Sci. Int., 206, 22–28, 2011, https://doi.org/10.1016/j.forsciint.2010.06.010. 17. Lasser, A.J., Warnick, A.J., Berman, G.M., Three-dimensional comparative analysis of bitemarks. J. Forensic Sci., 54, 658–661, 2009, https://doi. org/10.1111/j.1556-4029.2009.01009.x. 18. Thali, M.J., Braun, M., Dirnhofer, R., Optical 3D surface digitizing in forensic medicine: 3D documentation of skin and bone injuries. Forensic Sci. Int., 137, 203–208, 2003, https://doi.org/10.1016/j.forsciint.2003.07.009. 19. Georgopoulos, A., Ioannidis, C., Valanis, A., Assessing the performance of a structured light scanner. Remote Sens. Spat. Inf. Sci., XXXVIII, 250–255, 2010. 20. Thompson, T.J.U. and Norris, P., A new method for the recovery and evidential comparison of footwear impressions using 3D structured light scanning. Sci. Justice, 58, 237–243, 2018, https://doi.org/10.1016/j.scijus.2018.02.001. 21. Niven, L., Steele, T.E., Finke, H., Gernat, T., Hublin, J.J., Virtual skeletons: Using a structured light scanner to create a 3D faunal comparative collection. J. Archaeol. Sci., 36, 2018–2023, 2009, https://doi.org/10.1016/j. jas.2009.05.021. 22. Ting-Shu, S. and Jian, S., Intraoral digital impression technique: A review. J. Prosthodont. Off. J. Am. Coll. Prosthodont., 24, 313–321, 2015, https://doi. org/10.1111/jopr.12218. 23. Zimmermann, M., Mehl, A., Mörmann, W.H., Reich, S., Intraoral scanning systems - a current overview. Int. J. Comput. Dent., 18, 101–129, 2015. 24. Imburgia, M., Logozzo, S., Hauschild, U., Veronesi, G., Mangano, C., Mangano, F.G., Accuracy of four intraoral scanners in oral implantology: A comparative in vitro study. BMC Oral. Health, 17, 92, 2017, https://doi. org/10.1186/s12903-017-0383-4.

358  Modern Forensic Tools and Devices 25. Aragón, M.L.C., Pontes, L.F., Bichara, L.M., Flores-Mir, C., Normando, D., Validity and reliability of intraoral scanners compared to conventional gypsum models measurements: A systematic review. Eur. J. Orthod., 38, 429– 434, 2016, https://doi.org/10.1093/ejo/cjw033. 26. Fournier, G., Savall, F., Galibourg, A., Gély, L., Telmon, N., Maret, D., Threedimensional analysis of bitemarks: A validation study using an intraoral scanner. Forensic Sci. Int., 309, 110198, 2020, https://doi.org/10.1016/j. forsciint.2020.110198. 27. Nagi, R., Aravinda, K., Rakesh, N., Jain, S., Kaur, N., Mann, A.K., Digitization in forensic odontology: A paradigm shift in forensic investigations. J. Forensic Dent. Sci., 11, 5–10, 2019, https://doi.org/10.4103/jfo.jfds_55_19. 28. Poulsen, K. and Simonsen, J., Computed tomography as routine in connection with medico-legal autopsies. Forensic Sci. Int., 171, 190–197, 2007, https://doi.org/10.1016/j.forsciint.2006.05.041. 29. Leth, P.M., The use of CT scanning in forensic autopsy. Forensic Sci. Med. Pathol., 3, 65–69, 2007, https://doi.org/10.1385/FSMP:3:1:65. 30. Caldemeyer, K.S. and Buckwalter, K.A., The basic principles of computed tomography and magnetic resonance imaging. J. Am. Acad. Dermatol., 41, 768–771, 1999, https://doi.org/10.1016/S0190-9622(99)70015-0. 31. Thomsen, A.H., Jurik, A.G., Uhrenholt, L., Vesterby, A., An alternative approach to computerized tomography (CT) in forensic pathology. Forensic Sci. Int., 183, 87–90, 2009, https://doi.org/10.1016/j.forsciint.2008.10.019. 32. Ford, J.M., Kumm, T.R., Decker, S.J., An analysis of hounsfield unit values and volumetrics from computerized tomography of the proximal femur for sex and age estimation. J. Forensic Sci., 65, 591–596, 2020, https://doi. org/10.1111/1556-4029.14216. 33. Houck, M.M. and Siegel, J.A., Microscopy, in: Fundamentals of Forensic Science, pp. 69–91, Elsevier, Oxford, 2015, https://doi.org/10.1016/ B978-0-12-800037-3.00004-2. 34. Bernhard, W.R., Paint and tape: Collection and storage of microtraces of paint in adhesive tape. J. Forensic Sci., 45, 1312–1315, 2000, https://doi. org/10.1520/JFS14886J. 35. Basu, S., Scanning electron microscopy in forensic science, in: Encycl. Anal. Chem., Major Reference Works, 2006, https://doi.org/10.1002/9780470027318. a1122. 36. Chen, Y., Forensic applications of nanotechnology. J. Chin. Chem. Soc., 58, 828–835, 2011, https://doi.org/10.1002/jccs.201190129. 37. Pandey, G., Tharmavaram, M., Rawtani, D., Kumar, S., Agrawal, Y., Multifarious applications of atomic force microscopy in forensic science investigations. Forensic Sci. Int., 273, 53–63, 2017, https://doi.org/10.1016/j. forsciint.2017.01.030. 38. Valle, F., Bianchi, M., Tortorella, S., Pierini, G., Biscarini, F., D’Elia, M., Nanotechnology for forensic sciences: Analysis of PDMS replica of the case head of spent cartridges by optical microscopy, SEM and AFM for the ballistic

Scanners and Microscopes  359 identification of individual characteristic features of firearms. Forensic Sci. Int., 222, 288–297, 2012, https://doi.org/10.1016/j.forsciint.2012.07.005. 39. D’Uffizi, M., Falso, G., Ingo, G.M., Padeletti, G., Microchemical and micromorphological features of gunshot residue observed by combined use of AFM, SA-XPS and SEM + EDS. Surf. Interface Anal., 34, 502–506, 2002, https://doi.org/10.1002/sia.1348. 40. Yang, G., Nie, F., Huang, H., Zhao, L., Pang, W., Preparation and characterization of nano-TATB explosive. Propellants Explos. Pyrotech., 31, 390–394, 2006, https://doi.org/10.1002/prep.200600053. 41. Mou, Y., Lakadwar, J., Rabalais, J.W., Evaluation of shooting distance by AFM and FTIR/ATR analysis of GSR. J. Forensic Sci., 53, 1381–1386, 2008, https:// doi.org/10.1111/j.1556-4029.2008.00854.x. 42. Jones, B.J., Commentary on: Mou Y., Lakadwar J., Rabalais J.W. Evaluation of shooting distance by AFM and FTIR/ATR analysis of GSR. J. Forensic Sci., 2008, 53, 1381–6, 2009, https://doi.org/10.1111/j.1556-4029.2009.00989.x. 43. Fiori, A., Detection and identification of bloodstains, in: Methods Forensic Sci., vol. 1, pp. 243–290, 1962. 44. Bauer, M., Polzin, S., Patzelt, D., Quantification of RNA degradation by semi-quantitative duplex and competitive RT-PCR: A possible indicator of the age of bloodstains? Forensic Sci. Int., 138, 94–103, 2003, https://doi. org/10.1016/j.forsciint.2003.09.008. 45. Fujita, Y., Tsuchiya, K., Abe, S., Takiguchi, Y., Kubo, S., Sakurai, H., Estimation of the age of human bloodstains by electron paramagnetic resonance spectroscopy: Long-term controlled experiment on the effects of environmental factors. Forensic Sci. Int., 152, 39–43, 2005, https://doi.org/10.1016/j. forsciint.2005.02.029. 46. Tsutsumi, A., Yamamoto, Y., Ishizu, H., Determination of the age of bloodstains by enzyme activities in blood cells. Nihon Hoigaku Zasshi, 37, 770–776, 1983. 47. Mohandas, N. and Gallagher, P.G., Red cell membrane: Past, present, and future. Blood, 112, 3939–3948, 2008, https://doi.org/10.1182/ blood-2008-07-161166. 48. Kozlova, E.K., Chernysh, A.M., Moroz, V.V., Kuzovlev, A.N., Analysis of nanostructure of red blood cells membranes by space Fourier transform of AFM images. Micron, 44, 218–227, 2013, https://doi.org/10.1016/j. micron.2012.06.012. 49. Strasser, S., Zink, A., Kada, G., Hinterdorfer, P., Peschel, O., Heckl, W.M., Nerlich, A.G., Thalhammer, S., Age determination of blood spots in forensic medicine by force spectroscopy. Forensic Sci. Int., 170, 8–14, 2007, https:// doi.org/10.1016/j.forsciint.2006.08.023. 50. Yadavalli, V.K. and Ehrhardt, C.J., Atomic force microscopy as a biophysical tool for nanoscale forensic investigations. Sci. Justice, 61, 1–12, 2020, https:// doi.org/10.1016/j.scijus.2020.10.004. 51. Wang, C., Stanciu, C.E., Ehrhardt, C.J., Yadavalli, V.K., Nanoscale characterization of forensically relevant epithelial cells and surface

360  Modern Forensic Tools and Devices associated extracellular DNA. Forensic Sci. Int., 277, 252–258, 2017, https:// doi.org/10.1016/j.forsciint.2017.06.019. 52. Dupres, V., Camesano, T., Langevin, D., Checco, A., Guenoun, P., Atomic force microscopy imaging of hair: Correlations between surface potential and wetting at the nanometer scale. J. Colloid Interface Sci., 269, 329–335, 2004, https://doi.org/10.1016/j.jcis.2003.08.018. 53. Seshadri, I.P. and Bhushan, B., Effect of ethnicity and treatments on in situ tensile response and morphological changes of human hair characterized by atomic force microscopy. Acta Mater., 56, 3585–3597, 2008, https://doi. org/10.1016/j.actamat.2008.03.039. 54. Goddard, A.J., Hillman, A.R., Bond, J.W., High resolution imaging of latent fingerprints by localized corrosion on brass surfaces. J. Forensic Sci., 55, 58–65, 2010, https://doi.org/10.1111/j.1556-4029.2009.01217.x. 55. Ruffell, A. and McKinley, J., Geoforensics, Wiley, Chichester, 2008, https:// doi.org/10.1016/j.quascirev.2009.01.014. 56. Ritz, K., Dawson, L., Miller, D., Criminal and environmental soil forensics, in: Criminal and Environmental Soil Forensics, Springer Netherlands, Dordrecht, 2009, https://doi.org/10.1007/978-1-4020-9204-6. 57. Farah, S., Tsach, T., Bentolila, A., Domb, A.J., Morphological, spectral and chromatography analysis and forensic comparison of PET fibers. Talanta, 123, 54–62, 2014, https://doi.org/10.1016/j.talanta.2014.01.041. 58. Christophe, D.N., Desplats, R., Perdu, P., Beaudoin, F., Gauffier, J., EEPROM Failure analysis methodology: Can programmed charges be measured directly by electrical techniques of scanning probe microscopy?, 2005. 59. De Nardi, C., Desplats, R., Perdu, P., Beaudoin, F., Gauffier, J.L., Oxide charge measurements in EEPROM devices, in: Microelectronics Reliability, pp. 1514–1519, Pergamon, United Kingdom, 2005, https://doi.org/10.1016/j. microrel.2005.07.055. 60. DeNardi, C., Desplats, R., Perdu, P., Gauffier, J.L., Guérin, C., Descrambling and data reading techniques for flash-EEPROM memories. Application to smart cards. Microelectron. Reliab., 46, 1569–1574, 2006, https://doi. org/10.1016/j.microrel.2006.07.022. 61. Shiver, F.C., Intersecting lines: Documents, Wiley Encycl. Forensic Sci., Major Reference Works, 2009, https://doi.org/10.1002/9780470061589.fsa328. 62. Friedbacher, G. and Harald, F., Classification of scanning probe microscopies. Pure Appl. Chem., 71, 1337–1357, 1999. 63. Kasas, S., Khanmy-Vital, A., Dietler, G., Examination of line crossings by atomic force microscopy. Forensic Sci. Int., 119, 290–298, 2001, https://doi. org/10.1016/S0379-0738(00)00458-8. 64. Kang, T.-Y., Lee, J., Park, B.-W., Use of atomic force microscopy in the forensic application of chronological order of toners and stamping inks in questioned documents. Forensic Sci. Int., 261, 26–32, 2016, https://doi.org/10.1016/j. forsciint.2016.01.033.

15 Recent Advances in Forensic Tools Tatenda Justice Gunda1, Charles Muchabaiwa1, Piyush K. Rao2, Aayush Dey2, and Deepak Rawtani2* School of Doctoral Studies & Research (SDSR), National Forensic Sciences University, Gandhinagar, Gujarat, India 2 School of Pharmacy, National Forensic Sciences University, Gandhinagar, Gujarat, India 1

Abstract

Recent interests in forensic tools have led to the rapid development and updates of convectional tools to bridge the gap between analysis of the evidence found at the crime scene and the suspected victims. The advancement of forensic tools has given crime investigators a contemporary extra-terrestrial feel of fiction novelty with the rapid expansion of technology. Fields such as fingerprinting, document examination, DNA fingerprinting, and autopsy have been upgraded consistently in such a way that they have consistency in reproducibility of results in image form and storage of information. Despite this other branches such as eDNA, sensors, virtospy, facial reconstruction, narco analysis, and psychology have been developed which try to recreate events that would have happened, to module the individual and get information from questioning. Forensic tools are used throughout the forensic science process to handle exhibits to save crimes. The forensic tools assist in measurements including evidence analysis, DNA fingerprinting, drug analysis, and bodily fluids. Notably, the confluence of forensic tools enables them to do most of their work in a timely manner. This has led to the presentation of good quality results which are acceptable in the courts of law by providing sufficient vital evidence and, furthermore, ensuring that proper justice is given by the legal system. This chapter serves to show in-depth information on the advancements of forensic tools in forensic science namely forensic chemistry, forensic biology, forensic physics, and question document examination and fingerprint. Keywords:  Forensic tools, exhibits, analysis, reconstruction, data, report, admissible report *Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (361–392) © 2023 Scrivener Publishing LLC

361

362  Modern Forensic Tools and Devices

15.1 Introduction Forensic science is an ever-emerging field, which uses the application of sciences, in the investigation, collection, analysis, data presentation, and issuing a detailed report for justice delivery in the courts of law. Forensic science utilizes scientific methods and develops new technologies to better modus operandi and yield high-quality results [1]. In recent years rate and nature of crimes being committed and the criminals committing them have been evolving in the way they operate, to carry out their modus operandi. This has also led to the development of various forensic tools and devices, which facilitate how crime scene evidence is collected and analyzed. To catch up with this advancement trend, investigators need tools that can keep up to date with the technological changes and to assist in carrying the specific mandate in question [2, 3]. This has given rise to scientists and engineers to be at the forefront of technology in devising forensic tools and devices that will assist in the recovery of crucial samples and information to give a better understanding of the provided data [4]. The use of Docubox, 3D scanner, sensors, and chromatographic technologies have aided in assisting forensic investigation. The above-mentioned technologies are used in a manner which abides by the legal standards of the criminal procedure. These modern forensic technologies reduce crime, enhance the quality of data and minimize racial differences. As a result, advances in forensic science can only aid in the apprehension of offenders and the exoneration of wrongly convicted individuals. Furthermore, a more effective justice system is developed and more equitable. The amount of time it takes in the forensic investigation is shortened due to the high specificity, selectivity, and sensitivity of the technologies. Eventually delivering the justice system in a manner, which is per the criminal procedure and legal standards [5–7]. Forensic science embraces most branches of science such as physics, chemistry, biology, and other non-traditional science discipline subjects such as toxicology, odontology, anthropology, and archaeology. However, there has been a nascent plethora of scientific branches that have been invented specifically for the intended aiding in the vast applications of forensics. These include ballistics, question document examination, forensic psychology, DNA profiling, which have obtained a lot of attention from different law enforcement agencies [8].

Recent Advances in Forensic Tools  363 This has led to the evolution in the ways that analyses are being implemented and carried out promptly with results having a high percentage degree of accuracy [9]. For instance, the first case of ballistics was solved in 1835 when Henry Goddard applied ballistic fingerprinting by physical examination of the defects on the bullet which were caused by the manufacturer during manufacturing. Nowadays technologies have made some upgrades whereby instruments are coupled with techniques and software which can now give a better understanding in the field of ballistics. Also, there have been various developments in the way scientists can understand different fields of forensic science the tools which are being implemented [10]. A case in point where National Forensic Science University assembled an expert panel highlight the importance of developing forensic DNA infrastructure in India [11]. Improvement of each tool leads to the adoption of new Standard Operating Procedures, which are governed by the International Standard Organization (ISO), and the training of personnel to be more equipped and accustomed to the needs of the intended subjects in the scientific field. Since the inception of DNA fingerprinting in which a suspect Richard Buckland was exonerated and Collin Pitchfork DNA matched the double rape-murder which occurred in 1983 and 1986 [12]. During the first case alleles were used for the determination of the culprit and over the years there have been changes to using loci, short tandem repeat units (STR) and now a polymerase chain reaction machine has been developed which is used in the amplification of DNA. The DNA manhunt case took two years between the years 1986 and 1988 [13]. This chapter focuses more on the technological advancement of forensic science tools, which are now upgrading, and improving the conventional instruments used in the advent and course of development of science. A lot of funding is being directed to research and development of the equipment of forensic science and as such leading to the establishment of high throughput machinery and tools that yield better accurate results. Furthermore, forensic science techniques are grouped into four main groups namely are forensic physics, forensic biology, forensic chemistry, and question documentation. These will be well articulated in the following text.

15.1.1 Recent Forensic Tool: Trends in Crime Investigations Operating systems are software used to assist an investigator in the process of analyzing and reviewing various data when carrying out an investigation.

364  Modern Forensic Tools and Devices The operating system or software will then process the data and try to do a precisely detailed reconstruction that resembles the actual default parameters [14]. Integrated Ballistic Systems, DRONES, and Link Analysis Software for forensic accountants have influenced the rise of cloud storage or cloud database [15]. Forensic tools are part of the methodology; the method is also under forensic tools, which leads to the union between the two. Johnson [14], stated that forensic tools are used for various analytical processes such as • Restoration of erased files and pinpointing various file directories e.g. (used space, free space, hidden files) • Contrasting various data characteristics by analyzing the input data and to the standard • Carrying out different algorithm searches • Continuous updating of the database • Report generation • Keeping passwords and encryption • Search engines

15.1.2 Recent Forensic Device Forensic devices are mechanical or electrical equipment designed specifically to carry out analytical forensic analysis. These can either be portable or on the bench and they include software which is called a forensic tool to carry out their intended function or mandate [16]. Portable devices examples include an electrochemical sensor, lab on a chip, Breathalyzer, and drones. On the bench devices, the examples include chromatography, high-end powered microscopes, and spectroscopy [17].

15.2 Classification of Forensic Tools and Devices Forensic tools and devices classification based on their function and mode of operation. Forensic tools are software installed in a device and they aid in the processing, analyzing, and giving out a report of the input data. The forensic device is the machine aspect part that carries the programmed input data from the forensic tools [18] (Figure 15.1).

Recent Advances in Forensic Tools  365 Devices

• Sensors • GC/MS • HPLC • LC-MS/MS • FTIR • ESDA • Docubox • Drones/UAVs • SEM • Virtopsy

Tools

Forensics

• Video spectra comparator • Biometry • Facial recognition • 3D reconstruction • ABIS • Audio video aided analysis • eDNA • Massive parallel sequencing

Figure 15.1  Illustration showing the classification of forensic tools and devices.

15.2.1 Forensic Chemistry Using a plethora of analytical techniques that give the constituents in a given compound for analysis, it encompasses other groups such as forensic toxicology, pathology and narcotics will gain more appreciation in the application with forensic science tools.

15.2.1.1 Sensors A sensor is a device, module, gadget, or subsystem that detects and transmits information about events or changes in its surroundings. A sensor to be reliable follows certain rules: • Sensitivity to the component being measured • It does not affect the measured component chemically • Specific to the component being measured Sensors are now extensively employed in forensics science for a variety of procedures. The procedures include detection of explosives and gunshot residue, detection of illicit drugs (Table 15.1), detection of biological fluids, and dope tests in sports [19]. Biosensors are devices that use sensing techniques based on biorecognition components to offer precise, quick findings for bioaffinity based reactions [20]. New technology was invented for outdoor and on-site to quickly test unknown chemical substances found at the crime scene. The sensors came into existence for their cost effectiveness, real-time high elevated responsiveness [21], selectiveness, portable size, and are coupled with battery. These small devices can intercommunicate with database storage hence the increase in responsive time of results produced [22]. A lot of technology such as nanotechnology has been included to replenish the miniaturized

366  Modern Forensic Tools and Devices Table 15.1  Sensors for illicit drugs. S. no.

Drug

Detection

Reference

1

Cocaine

Aptamer nanomedicine

[33]

2

CQD combined with aptasensor

[34]

3

Aptasensor combined with silica nanoparticles

[35]

4

CQD and nanoparticles combined with aptamer

[36]

5

Fluorophore quenched by the aptamer

[37]

6

Morphine

Fluorescence

[38]

7

GHB

Iridium (18) chemosensor

[39]

8

Heroin

Surface acoustic waves sensors

[40]

9

Marijuana

Tetrahydrocarbonyl confirmation in urine

[41]

GHB 4-hydroxybutanoic acid; CQD carbon quantum dots.

tools that have electrodes printed on either ceramic or silicon that can analyze a single drop size of 50 μm e.g. lab on a chip for the capillary system that has the potential for STR genotyping for obtaining segments for comparison purposes. However, they face challenges in constant calibration and are prone to challenges in electrodes handling which might affect the results. No-wash biosensors have gained subsequent use in presumptive tests of collected evidence at the crime scene. Their main principle of the application is based on the bottom-up approach to nanotechnology [30]. They give rapid results of tested samples. Operation of these tools can be used by untrained police offers who would be attending the crime scene, thereby providing the possibility of cutting costs. They consist of a recognition element and a transducer. The recognition element can either be a laboratory agent, peptide, or single-stranded DNA which is connected to a signal element that can either be gold or magnetic nanoparticles. The suspected

Recent Advances in Forensic Tools  367 biomarker is reacted with a signal element by just simple mixing and measuring the signal that will be produced. Signal elements are usually nanomaterials. The SERATEC® PSA Semiquant is an example of a biosensor that is used for examination to detect the presence of Prostate-Specific Antigen (PSA) in seminal fluid. The prostate generates a glycoprotein called PSA and is released into the seminal fluid. PSA concentration in the seminal fluid ranges from 0.2-3.0 mg/ml because of this high concentration PSA is an intriguing marker in the forensic examination for detecting very minute amounts of seminal fluids [23]. This biosensor at a PSA concentration of 4ng/ml, the amount of antibody at the internal standard is adjusted to a line color intensity that is comparable to the test line color intensity. comprises of monoclonal murine anti-PSA antibodies [31]. One of the antibodies is fixed at the membrane test area. The polyclonal goat antibodies that are present in the upstream control area and the internal standard region are rendered immobile. It takes advantage of being specific, stable, and in rare subjects in which the metazoa is not found (vasectomized men and azoospermic semen) [31, 32] (Table 15.2). The Rapid Stain Identification Series (RSID) is a biosensor that is used both in the field as well as in the laboratory [31]. This biosensor is used for the examination of distinct human seminal fluids from a variety of samples the forensic laboratory would have come across. Its sensitivity is from as little as 1microlitre of seminal fluid. Test strips are used for sample analysis and test results will be out in 10 min. The biosensor uses dual monoclonal antibodies which are only specific for human semenogeline antigen. The biosensor is made up of conjugate pad, membrane, and wick, overlapping components. They are constructed in such a way that the tested fluid is transferred from the conjugate pad to the membrane and then maintained on the wick. Both the conjugate pad and membrane are prepared before fabrication which allows the addition of extract to the running buffer to start the examination. After the sample has been placed on the sample window, circulating buffer and simple diffuse via the conjugating pad which is precharged with colloidal gold conjugated antihuman semenogeline monoclonal antibodies [25]. Colloidal gold-labeled antisemenogeline are dissolved by the sample. The semenogeline colloidal gold anticomplex is carried by the flow to the test strip membrane phase. A red line will appear in the presence of the human sperm when the complex moves over the membrane and binds at the test line [26].

368  Modern Forensic Tools and Devices Table 15.2  Different body fluids biosensors. S. no.

Body fluid

Target molecule

1

Semen

Test name

Reference

PSA

Seratec PSA SEraquant test

[23]

2

PSA

Biosign PSA test

[24]

3

Semenogelin

RSID PSA test

[24]

4

PSA

ABA card p30 test

[23]

Salivary amylase

The Phadebas Test

[25]

Salivary amylase

RSID Saliva test

[25]

5

Saliva

6 7

Urine

Tamm Horsfall glycoprotein

RSID urine test

[26]

8

Blood

Haemoglobin

Hemastix test; Abacard Hematrace test; Seratec Hemdirect test

[27, 28]

Glycophorin A

RSID Blood test

[27, 29]

9

PSA, Prostate Specific Antigen.

15.2.1.2 Chromatographic Techniques Chromatography is an analytical method that is used for identifying, distinguishing chemical constituents that would make up a compound by separation. Various chromatographic techniques are affected by different properties such as charge, size, and concentration. The mobile phase is the carrier component which carries the sample from the injection point into

Recent Advances in Forensic Tools  369 the device. The mobile phase can either be liquid or gas. The stationary phase is a component where the reactions take place. The component can either be liquid or gas. Mikhail Tsvet started this technique in 1900. Since the inception of this technique, a lot of useful technology has been advanced to increase the separation processes and the detection system has been developed for easier detection systems.

15.2.1.3 Gas Chromatography–Mass Spectrometer (GC-MS) A hyphenated technique GC-MS is being used in forensic science. It has applications e.g. fire debris, gunshot residue, and drug/illicit drug testing. GC-MS has a high definitive identification to determine chemical compounds in question. It comprises two parts i.e. the Gas chromatography which does separation analysis of the compound being analyzed and coupled with a Mass Spectrometer [42]. The MS is a detector that further breaks down the separated components which are blasted by high moving electrons at a speed of 70 eV causing ionization and the acceleration in the detector tube to get the actual molecular mass of the constituents in the component. The detector amplifies and counts the number of ions associated with that specific mass hence the amount of substance is quantified. The information is then sent to a computer and a mass spectrum is created which shows ions of different masses that traveled through the filter and using a computer algorithm the generated spectra are compared and matched in the library database containing a well-known mass spectrum [43]. The unknown chemical is identified if there is a match in the database. This is an upgraded tool that is regarded as the first choice for a plethora of investigations such as the identification of unknown samples, drug composition, and determination, explosives chemical constituent determination, etc. The mobile phase in GC is a gas, which flows in a coiled column either stainless steel which flows in a coiled stationary phase which can either be stainless steel or gas column. The stationary phase is where the separation occurs due to the interaction with different bonded phases in the column of the introduced analytes carried by gas. The study of enantiomers can shed more light on how illicit drugs are produced. For illustration, GC is used for the identification of illicit drugs, compounds that have an enantiomers structure. Two techniques are applied direct method and indirect method. Indirect method enantiomers are reacted with chiral derivatized reagents (CDR) and direct method in which the stationary phase is chiral  [44].

370  Modern Forensic Tools and Devices MS is a detector that is coupled with GC which ionizes the chemical compound by generating vast ions that will be processed by a forensic tool to produce the actual chemical molecular formula. GCMS has a high affinity, specificity for testing of illicit drugs from biological fluids. In application, Py-GCMS is used in industries for tires failures. This is done by reverse engineering of material analysis to their single constituents. Py-GCMS is an uncomplicated and credible technique that breaks down the whole sample into single analytes.

15.2.1.4 High-Performance Liquid Chromatography (HPLC) HPLC is a column chromatography, which uses a mechanical pump to deliver a mobile phase at high pressure and in the column a solvent reservoir for which filters out undesired impurities such as dust. It requires pure substances for sample analysis. The column is where the separation takes place and the detection is recorded on a digital screen which records the time taken by the analyte to be eluted which is also called retention time. The time taken depends on the modes of HPLC and the stationary phase. HPLC has been used in the application of forensic investigation of explosives, color analysis, toxicological analysis, food analysis, and the environment (Table 15.3) [45]. The existence of HPLC paved the way for the research and development of Ultra High Performance (UHPLC) Liquid Chromatography that uses high pressure of up to 15000 psi. However, HPLC is strong, authenticated, and reliable with performance that is anchored in its stability from the column size that has reduced diameter and perfect pipe fittings. Scientific vanquish core HPLC systems have been upgraded to alter their gradient delay volume to be in synchronization with their analyte retention time and tool outline of other separation profiles. Modern HPLC is now connected to informatics software during instrument design which allows data monitoring either remotely or proximate from chromatographic data systems (CDS).

15.2.1.5 Liquid Chromatography (LC/MS/MS) Rapid Toxicology Screening System This technology increases the efficiency of LC/MS/MS by allowing the user for analysis without first performing the time-consuming processes such

Recent Advances in Forensic Tools  371 Table 15.3  Illustration of the various applications in forensic science of HPLC. S. no.

Application

i.

Drug analysis

ii.

Sampling technique UNODC statistical guidelines

Analyte

Analytic technique

Reference

Casodex; Plavix; Zyprexa; Crystal meth; Cocaine; Opium

Presumptive tests; GCMS; LCMS

[46–48]

Toxicological analysis

Drugs; Pesticides; Urine; Blood; Vitreous humor

EMIT; ELISA; Colour techniques; GCMS; HPLC-UV

[49, 50]

iii.

Color analysis

Fibers; Paint;

FTIR; Microscopes; Fluorescence microscope; MSP; HPLC

[51]

iv.

Explosive analysis

Debris; Clothing; Swabs; Detonating device; Peroxide based explosives

GCMS; LCMS; Raman Spectroscopy; NMR

v.

Food and Environ­ ment analysis

Sudan red dyes; Melamine in baby milk; polyaromatic hydrocarbons; pesticides

HPLC

[46, 51]

UNODC United Nations Office Drug and Crime; EMIT Enzyme Multiplied Immunoassay Technique, ELISA Enzyme Linked Immunosorbent Assay; MSP Microspectrophotometry; NMR Nuclear Magnetic Resonance.

as separation assessment of existing and MS parameter adjustment. It consists of a library of 231 compounds common in toxicology which includes drugs of abuse, psychoneurotic medications, and sedatives. Furthermore, with rapid simultaneous analytical techniques with process times below 15 minutes [52]. In addition, the technology optimizes the circumstance for synchronizing survey scans utilized in screening measures. For data

372  Modern Forensic Tools and Devices analysis it uses a forensic software named Lab solutions Insight Library Screening to check the following: i. ii. iii. iv. v.

MS Chromatogram MS/MS spectra Structural formula Library search Quantitative results

15.2.1.6 Fourier Transform Infrared (FTIR) Spectroscopy FTIR measures the bond vibration frequencies when an infrared region which is between the visible and microwave region is passed through a molecule, the functional groups will have an interaction or absorb a wavelength according to the specific frequency which causes specific vibration transition [53]. This phenomenon gives FTIR the propensity for identification of functional groups in a compound depiction of thin-film multilayer and analysis of molecules. Advancement in sample preparation, attenuated total reflectance (ATR) allows the easy measurement of a sample by dropping on it which leads to normal sample preparation or grinding the sample to make pellets. Diffuse measurement accessories are used for quantitative analysis of powder and solid [16]. In FTIR instruments the sample is in between the interferometer and the detector. The detector produces a fast Fourier transform of intensity vs wavelength and the detectors have very high responsiveness. The range of FTIR is 12500 – 50cm-1. It can also be coupled with a fluorescence that detects an interferogram. The FTIR can be used in combination with chemometrics on post-mortem. The post-mortem interval will be based on pericardial fluids. FTIR is being used to collect biochemical data at various stages at post mortem intervals. Data collected can also be used for metabolic fingerprinting in disease diagnosis.

15.2.1.7 Drug Testing Toxicology of Hair Drug testing is an analytical quantifying method of illicit drugs, toxins, and poison dosage. When analytes are present in a biological specimen, they can be used to document the amount of intoxication in the body, victim to determine and evaluate the period. In hair analysis, there is the growth of bacteria microbiota which would be unique to an

Recent Advances in Forensic Tools  373 individual [54]. When two individuals interact there is the exchange of these bacteria and when carrying out suspected rape cases or murder cases the bacteria can be isolated to see if it would match with the bacteria on the suspect. By using hair we can obtain information about how often an individual takes drugs [55, 56]. It can give information about drug addiction. The drugs are deposited on the hair roots by various deposition methods. The drug will be anchored and this makes it easy for detection after long periods. This can be done by performing a test on the hair shafts. Immunoassaying techniques (ELISA) or GC-MS are used after the hair has been prepared, incubated and extraction of the toxin. Sensitive tools with high responsiveness such as LC-MS, GC-MS have high corroboration in the separation and detection of drug analytes [56].

15.2.2 Question Document and Fingerprinting This field of forensic science deals with the authentication of documents to distinguish if there is any forgery or counterfeit or authentication. Also, Handwriting analysis can be carried out for determining an individual’s character or persona from any piece of paper. In the earlier days, magnifying glasses were used to compare the alleged forged document with an original one to check if there was any similarity between the two by the use of a magnifying glass [5]. Foster and Freeman designed a device known as ECCO 2 LIBS Elemental Analysis elementary comparator, built with a larger sample chamber for examination. This tool can establish the elemental makeup of a sample by identifying each element in the periodic table. By examination and identification as it is both convenient and efficient by the use of laserinduced breakdown spectroscopy (LIBS). The sensitivity of this instrument for analysis for material is as low as 300microns [57]. The device principle is based on a high-intensity pulse laser which is focused on a sample to generate a plasmon of evaporated materials that emits an atomic spectrum of the component elements. LIBS is a powerful and effective method for forensically analyzing materials such as identification documents and money. ECCO 2 can identify trace elements in the paper, pencil, and printer inks and document security features and as such differentiate between genuine and counterfeit. A library of emission lines allows the automated identification and labeling of components [57, 58]. Nowadays paper currency bills are being manufactured with special or distinct features embedded

374  Modern Forensic Tools and Devices in the documents which when exposed to a UV range of 100-400nm produce or give a color change or reflection of color that shows the authenticity of the bill in hand. Another special important feature, which is provided by UV, is the examination of forged documents [22]. Under UV contrast there would be clear differences if suspected handwriting or signature is being written for the ink will provide a different color illumination. The UV tools are also used for checking whether an envelope has been opened and resealed. The analytical techniques of GC coupled with MS further analyze the inks so that they can be traced from their origins [59]. FORAM 3 6852 Raman Spectrometer for QDE applications, uses the Raman spectroscopy principle which is specifically designed for forensic evidence examination. This device utilizes two wavelengths of 685nm and 785nm, as well as data storage and casework software and an optional spectra database to facilitate the detection of different compounds. The laser wavelength of 685nm gives higher sensitivity levels and the 785nm infrared laser is for restriction organic compounds which easily give fluo­rescence automatically [60]. The device is utilized for various molecular structure compounds and characteristic functional groups thereby differentiating them. In QDE it is used in examining pigments, based ink of gel pens, and capable of distinguishing blue gel pens inks with a level of sensitivity above 70%. Moreover, in toners printer, Raman examination of tiny samples can distinguish toner at a 4% rate [58].

15.2.2.1 Electrostatic Detection Analysis (ESDA) Electrostatic Detection analysis (ESDA) is a device that is used to uplift indentation on documents. It works on documents that would have been exposed to the humidity of about 70%. The paper to be analyzed is placed in a chamber filled with water for about five minutes [59]. The paper is then placed in an ESDA machine where a Mylar film is stretched over the document and then a wand is used which contains a charge that produces positive electrostatic which are attracted to the indentation of the document. A negative toner is then sprinkled. The impression is then lifted from the top of the Mylar with sticky tape and placed on a piece of plain paper and the impressions will then be visible.

Recent Advances in Forensic Tools  375 DOCUBOX HD Projectina is a device that enables complete and detailed document inspection in the field of QDE. It consists of comprehensive inspection techniques, along with methodical handling and operator convenience. The DOCUBOX has gained rapid and effective study of travel documents, banknotes, and security printed matter. The apparatus consists of fourteen (14) integrated light sources, powered with a 20X zoom lens and IR-sensitive HD camera autofocus with precision [61]. However, as per request monitors are available. The DOCUBOX is coupled with: i.

Image capture on SD card Image capturing component which saves on a SD card ii. Sequential mode automatic light source selection and varying the inspection times iii. Intuitive operation for easy operation with touch screen and jogger knobs with presetting of different light sources iv. Highest efficiency storage of 200 default control settings by just using a memory stick DOCUBOX uses a forensic tool for analysis, attestation, and storage for later use. The tool is PIA-7 software which is menu-driven and the major software language is operated in the manager column. PIA-7 features remote control capabilities that allow the control of the DOCUBOX HD from a notebook. The control can be programmed directly in the workplace or over a local network with image data and instrument settings maybe save and accessed in the same location [61].

15.2.2.2 Video Spectral Comparator A video spectral comparator is a special tool used for examining question documents by imaging which allows the examination of inks, envisaging special embedded security features, and divulging documents that would have been modified. This device has two components i.e. a computer desk that runs on operating system software and a connected tool that is installed with a device that captures black and white pictures. It also includes barrier filters with an energy source. This machine has also taken advantage of the magnification of fingerprints on documents such as passports, driver’s licenses, banknotes, and Visa, etc. It uses its various illuminating lights e.g. Tungsten [22].

376  Modern Forensic Tools and Devices

15.2.2.3 Fingerprinting The system of identification and classification of fingerprints was developed by Francis Garlton. Fingerprints are unique to each individual and they are a permanent feature that cannot be erased. Fingerprints are used because they live distinctive ridges after a person comes into contact with a surface by their fingertips [62]. A high-resolution live finger scan system with a high-end laptop (finger enrolment device) is a forensic tool for aid in the identification or linking unknown fingerprints to an individual via a database. The database function is for searching, retrieving, and storage of input information. The database is known as AFIS. AFIS requires the fingerprint to be enrolled into the computer to be of high quality [12]. A foreign scope is a forensic tool for searching, recognizing, creating, and reproducing a fingerprint impression on fingerprints that are left on surfaces that are difficult to lift fingerprints physically; the tool is a portable tablet with a built-in camera equipped with high operating software for processing 4k images. The operating system photographs images and distinguishes the fingerprints by verifying with the ones stored in the database. Fingerprint biometry is a set of tools that can be classified into two physical categories and use of computer software. The use of computer software which is coded and contains algorithms information the fingerprints are stored when a perpetrator is being processed. The uniqueness of fingerprints allows the system to save just one set of fingerprints per individual. An integrated automated fingerprint identification system is used by the Federal Bureau of Investigation (FBI) for the identification and storage of information of criminals [63]. This system tool is robust and fast. It can store up to 70 million subjects [62]. Investigators now have another forensic tool in the form of palm capture, although palm prints left at a crime scene are usually 30% [64, 65]. his will be an essential supplement for investigators as an investigating tool. This software was launched by the FBI in May 2003. Next-generation identification (NGI) mandates that in palm capture, the whole hand not just the palm be captured. It is critical to run the whole hand so that it can be measured to fingerprints in the database [66, 67].

Recent Advances in Forensic Tools  377

15.2.3 Forensic Physics Forensic physics is an area that deals with evaluation of exhibits or analytes such as glass, paint, metals, and press evidence using contemporary anal­ ysis tools (Figure 15.2). There is a provision for evaluating the strength and quality of building materials such as cement, concrete and iron beams according to the protocol.

15.2.3.1 Facial Recognition Is a useful investigative forensic tool that further improves the identification of perpetrators. Furthermore, as technology advances, it is being improved in facial recognition. The technology compares the photo obtained at the booking station or crime scene to mug photos in the NGI database which will then sort and search for a matching subject’s photo [68]. Another forensic tool for facial recognition is by UK based firm that is used in the detection of terrorists and criminals has excelled in the scanning of faces. This technology uses artificial intelligence

Bring Your Face in to View

Audio-video aided

BEO

3D Facial recognition

Phenom Desktop Scanning Electron Microscope

Facial recognition

A

Forensic Physics

B

xray edx

ABIS

Drone/UAVs

Figure 15.2  Schematic illustration of different analytical tools used in exhibition investigation.

378  Modern Forensic Tools and Devices technology and decreases investigation time to cases involving facial video evidence [69]. Neo face technology also reveals that it can analyze photographic evidence quickly and produce a list of persons of interest as soon as the crime has been committed at the crime scene. This enables investigators to pinpoint the exact individual to have committed the crime.

15.2.3.2 3D Facial Reconstruction This is a fusion of scientific procedures and creative ability. It may also be used to build soft tissues onto the skull to create a picture of a person for recognition and identification [70]. This forensic tool encompasses the artistic possibilities of a human with software [71]. A picture of an unidentified person is taken and occasionally digitally modified. 2D and 3D techniques are used for the reconstruction of the face and then computerized by the software which is robust and efficient. The forensic tools used to model the face onto the skull virtually are phantom desktop haptic devices and sensible technologies. Haptic feedback deals by examination of the top surface of the skull with the outlined details of the skeletal muscle attachment strength, eye position, etc. [70, 71]. The computer software is programmed with mathematical modeling that will help in the processing of input data to valuable information.

15.2.3.3 Arsenal Automated Ballistic Identification System (ABIS) This is a forensic tool that processes the data after scanning bullets and cartridges cases. Papillion ballistic scanner and BS-16 are the components that are used for scanning. Arsenal ABIS works by converting the BS-16 bullet and cartridge scans to digital format. The forensic tool automatically color codes distinctive striations such as extraction needles and feed marks. The procedure will sort the marks by kind which simplifies the rigorous convectional comparison technique. Moreover, the scanned data is uploaded in a data set for investigation which amplifies and emphasizes the bullet details of the firearm in question. Arsenal ABIS has a high accuracy rate which has high scanning proficiency, automated computer comparison, utilizes 3D dimensions, and can multitask up to ten (10) analyses in one go. Arsenal ABIS is mainly applied to match bullets collected at crime scenes then the bullet will pinpoint the exact match of the perpetrator and guide

Recent Advances in Forensic Tools  379 the investigators. It can also be used for database creation and issuing of licenses [72].

15.2.3.4 Audio Video Aided Forensic Analysis A forensic tool for recording and capturing the audio, video articulated testimony of the suspect’s to conduct the forensic interviews. Audio and video recordings unlike other forensic evidence can give real-time, eyewitness accounts of a crime and allow investigators to observe and understand how events would have occurred. For instance, a forensic psychologists expert operates the tool or software by asking questions that are recorded and observing the body movements [7, 73]. This tool is used for various investigations like terrorism, murder, rape, and sexual abuse. The operating system will aid in the translation of information from the person being interviewed by compiling input data and producing a detailed statistical data which shows a score on how the individual would have performed. The paramount importance of the tool is to direct and narrow the investigators in the right direction to obtain facts about events that would have occurred [5]. Furthermore, surveillance footage shows a detailed timeline and acts as a “Big Brother Watch”, whilst a concealed camera provides both video and audio for undercover sting operations [74].

15.2.3.5 Brain Electrical Oscillations Signature (BEOS) A profiling system is an electroencephalogram (EEG) method used to determine suspects involved in a crime by evoking electrophysiological impulses, by analyzing the experimental knowledge (EK) of the person. BEOS technique is based on memory testing with a scientific base that relies upon two memory systems, responsible for knowing and the second which is remembrance. The memory is then saved as signatures detailing the whole crime as signatures in the brain of the accused.

15.2.3.6 Phenom Desktop Scanning Electron Microscope (SEM) The device is engineered for maximum simplicity of use which allows for the quickest imaging of sample surface topology. It consists of a venting system that allows for maximum efficiency and a duration of fewer than thirty seconds to produce an image. An optical navigating camera provides a view of the complete sample and allows the operator to navigate any spot

380  Modern Forensic Tools and Devices on the sample with a single click. Clear images are produced from coupled four-segment backscatters detectors along with CeB 6 electron sources. However, on other phenom devices, secondary electron detectors are provided. This is a specialized instrument for analyzing gunshot residues. The operating software used by this tool includes one-of-a-kind automation that allows the acceleration of the analytical process, making it asynchronously, simpler, and more reliable. The Phenom Desktop is compact and used in forensics applications like ballistic, paint analysis, and fiber analytics. Phenom Desktop SEM has made topography analysis simple with its simple interface and workflow analysis of software merged, allowing users to examine photographic data and do the evaluation on a single screen.

15.2.3.7 X-Ray Spectroscopy EDX Is also coupled with Phenol desktop SEM in ballistics to identify the chemical composition or make-up of gunshot residue which is in the size range of 0.5 – 10micrometres. The Phenom tool starts with an examination and the EDX is then used for the chemical identification of the components [75]. It can also be used in traffic road accidents, animal hair identification, forensic hair analysis, and mechanical evidence.

15.2.3.8 Drones/UAVs Unmanned aerial vehicles (UAVs), known as drones, are a subfield of digital forensics. This branch of forensic tool deals with recovering digital evidence or supporting data from a drone under forensically sound settings. Drone applications in forensics are outfitted with cutting-edge equipment (Figure 15.3). For control, the pilot is done by remote ground control systems (GSC), often known as a ground cockpit. Communication connection from Wi-Fi, 3G or 4G, imaging systems (HD cameras, thermal cameras, infrared (IR) camera sensors OEM camera cores and camera modules) and coupled with internal memory [76]. Drones (UAVs) have distinct capabilities that enable area monitoring, observation, mapping, unarmed freight, armed assault machines, and aerial photography [77]. These drones can be used to access crime scenes which would have undergone Chemical Biological Radiological and Nuclear attacks to check whether these scenes are still exposed to the attacks. The drones will have sensors attached to them which are able to detect the amount of chemicals or biological agents which would be available in that area. This will help in ascertaining whether humans can enter the scene to do evidence collection.

Recent Advances in Forensic Tools  381

3D crime scene reconstruction

Searcing for evidence

Birds eye view of scene

Drones

Photography and videotaping

Crime control Analysis

Figure 15.3  Application of drones in forensic science.

The drone and the control systems are the two components of an unmanned aerial vehicle system. The nose on the unmanned aerial vehicle contains all the sensors, guidance equipment, and the rest of the body is filled with drone advanced technological systems. The notion of deploying unmanned aerial vehicles in forensic investigations is utilized in exercises as illustrated in Figure 15.4. Drone Forensic Methodology Block Diagram, this enables the employment of unmanned aerial vehicles (UAVs) in forensic investigations exceedingly efficiently [78]. UAVs use a technique that images objects using UV-Vis light and near-infrared light. The infrared has the capabilities of imaging a broad variety of materials, including metallic and nonmetallic objects, aerosol,

DRONE

Hardware Forensics

Digital Forensics

Payload Check

Memory Card

Hardware Check

System Logs

Biology Evidence

2D & 3D visualization, Audio

Overall Forensic Analysis

Figure 15.4  Utilization of UAV’s in forensic investigation

Prediction

382  Modern Forensic Tools and Devices Table 15.4  Showing where to retrieve information from a drone. Tool

Location/Path

1

Drone

• • • •

2

Ground Control System (GCS)

• Cloud account information • Cached drone files (photos/videos/audio files) • Plain-text black-box flight log files

3

Software Applications

• Photos • Account flying statistics • Plain-text black-box flight log files

Storage on board Photos Videos Flight log files in plain-text or encrypted

clouds, and isolated molecules. Amongst other desirable features, UAVs provide clearer documentation of a crime scene with detailed mapping, ‘birds-eye view, and ease of accessibility of crime scene in real-time [79, 80]. Hence revolutionized forensic science, especially a fingerprint recovered at a crime scene can be photographed and sent straight to the fingerprint bureau for searching and analysis (Table 15.4). Moreover, the increase in UAVs population has also led to them being abused as rogue drones in aiding criminal activities thereby making it difficult for them to be accepted in the legal fraternity. Now they are various forensic softwares such as Parrot and DJI that are used to determine the drones activity such as flight path, coordinates, audio and video footages.

15.2.4 Forensic Biology DNA fingerprinting is the examination of DNA in a person’s nucleated cell, with the comparison of biological traces collected at a crime scene or from a subject to identify criminal offenders and which will exclude innocent victims. DNA analysis in forensic science is now dependent on lineage markers (mitochondrial DNA, Y chromosome, and short tandem repeat (STR) units). A real-time PCR also called qPCR is used for quantitative DNA. This tool produces products that are obtained in real-time. The samples can be compared to a standard curve of known amounts to establish the starting quantities of an interest sequence. Specificity is increased by

Recent Advances in Forensic Tools  383 using particular probes which accomplish the analysis after the PCR process [81]. This device provides quality assays after DNA has been extracted and then provides information from the DNA present in an unknown sample [82]. A forensic tool for DNA phenotyping then processes the quantified DNA. In the decoding of DNA, computers aid in the establishment of estimated genotype probabilities. With an accuracy of 90% or higher, this current technical breakthrough can detect sex, hair color, height estimation, and color of the eyes. Also, age, skin color, pattern baldness are accreditedly detected by this forensic tool [81, 83]. eDNA is a forensic tool system used in the comparison and evaluation of forensic DNA files for investigations. It automatically provides accurate forensic DNA casework reports with also a detailed evaluation. It uses DNA evidence information that would have been obtained from the crime scene or individual and analyzes it thereby shortening the procedures that are supposed to be done by a DNA expert with a throughput report [84]. This forensic tool is a web-based program that has a single installation on a server that is secure and centralized within the user organization [6]. This server handles all computational heavy activities. Access to this program is by client computers using a graphical web interface browser, moreover, standalone systems where a client and the server can also run on the same physical computer. The software eDNA is developed by JAVA EE7 along with JAVA server FACES 2.2 and PRIME FACES 5.2. this forensic tool also supports output display systems which also facilitate the provision of several screens [85]. Touch DNA is a new forensic technique that relies on the amplification of DNA from as little as eight cells from the epidermal layer of the skin. It contradicts the statement that was in use “If you can see it, you can analyze it” [86]. Usually, DNA analysis required blood or semen but with Touch DNA you only need skin cells for analysis. From the Locard principle, every contact leaves a trace, from this theory lies the principle which is used for Touch DNA [87]. Steps in Touch DNA: i. ii. iii. iv. v.

Identifying particular surfaces and gathering trace DNA samples Touch DNA isolation Ascertainment of DNA quality and quantity DNA amplification DNA detection

384  Modern Forensic Tools and Devices Cells are collected from the site and using a technique known as polymerase chain reaction (PCR) to replicate the genes in large numbers [88]. Thirteen short tandem repeat (STR) loci are discovered and fluorescence chemicals are then added to the DNA and they bind to the DNA, these provide a unique genetic picture of a particular individual. Touch DNA obtained is then compared to the DNA profile of a suspect, in case there will not be any matching DNA databases are utilized [87, 89]. 15.2.4.1  Massive parallel sequencing (MPS) is a cutting-edge technique in the discipline of forensic biology. It can sequence a part of the whole individual genome. This method makes use of DNA sequencing that is the ability to carry numerous DNA sequences simultaneously, with screening for mutation in hundreds of loci in genetically diverse diseases [90, 91]. MPS sequencing method is a benefit because they allow for quick and low-cost mutation spans for whole human genomes which is a key for forensic research. MPS provides a piece of additional information regarding DNA evidence which will be important in assisting in the resolution of missing people instances such as catastrophic disasters. It is less expensive and time-consuming than Sanger sequencing. The Illumina Genome analyzer, the Applied Biosystems SOLid Sequencer, and the GS-FLX 454 Sequencer Workflow all employ MPS and are now commercially available [92].

15.2.4.2 Virtopsy Virtopsy is a virtual autopsy, which is a non-invasive examination. Virtopsy is consistent and precise in depicting bone fractures, soft tissues injuries, wound extent, and organ damage while also providing natural and convincing evidence analysis [93]. In forensic science virtopsy is used in the application for examining the time and cause of death, death from traffic accidents, fall from a great height, toxicological tests identification of gun wounds drowning, heat injury, and pulmonary embolization. Virtopsy consist of the following techniques which are: • Photogrammetry for capturing images • Surface scanning is for scanning of the subject • Contrast-enhanced (CT-angiography or MRI) for post mortem • Robotic post-mortem biopsy • Post mortem MRI

Recent Advances in Forensic Tools  385 The system setup consists of the following steps: i. Attach reflective markers on the subject to be tested. ii. Perform computed tomography (CT) scan and send data to the navigation system. iii. The system uses a combination of a locator and a press footswitch. The locator is used for defining the relic plane and the footswitch to freeze view which will be displayed on the monitor.

15.2.4.3 Three-Dimensional Imaging System Forensic scientists are increasingly implementing 3D technology in crime scene reconstruction. Considering 3D techniques such as 3D imaging and printing are being used at all levels of forensic science approach. The 3D usage is regarded as a separate subject in forensic science thus described as the study that brings together a variety of 3D techniques and methodologies. This enables the establishment of several fields for generating crime scene reconstruction as well as interpreting and displaying data [94].

15.3 Conclusion and Future Perspectives The field of forensic science is experiencing a rapid shift with the way technology is evolving. Current researches have directed the use of tools that are robust, safe with rapid reproducibility of results. These methods rely on bridging the gap of criminals and crime investigation to integrate the knowledge to provide a flawless examination, which leads to a justice delivery system that is fair. The forensic tools and devices must have a standard operating procedure in the mode of operation, handling, reports and troubleshooting, and ease of explanation in providing evidence in court. Crime scene investigators must be ameliorated such that the teams from the various branches of forensic science have a general appreciation of how the tools and devices function and the information that their work uncovers. Database setup in different fields must possess the ability to exchange and share information. There must be a mechanism with a vibrant expression of laying out output data in a detailed report which is respected by ethical and legal provisions. The advent of nanotechnology allows a very small quantity of data on samples to be analyzed. This new brand of science will help in the reduction

386  Modern Forensic Tools and Devices of types of devices to be used either portable or bench machines. More technology advancement will be brought about which will try to solve and prevent various crimes. However, with the decrease in size there pose a challenge in the throughput development of operating software. Forensic science has great potential as new techniques, technology, and scientific breakthroughs are opening up unprecedented possibilities. For illustration, the revelation and use of DNA in biosensors have altered modern forensic science. It will continue to do so as testing systems advance our understanding of trace DNA transmission, persistence, prevalence, and restoration expand. Researchers cannot forecast the advances and new technologies that will emerge but the scientific community is positive that they will be okay and will open up new avenues of forensic research.

References 1. Lupu, C. and Valeriu, L., The beginnings of using fingerprints as biometric characteristics for personal identification purposes. Annals of the “Constantin Brancusi” University of Targu Jiu, Engineering Series, No. 3/2014, pp. 53–56, April, 2015. 2. Evidence, T.M. and Evidence, I., Source: Pittsburgh sun-telegraph, Monday, October 22, 1934, page 3. 2287–2431, 1997. 3. Tully, G. et al., Quality standards for digital forensics: Learning from experience in. Forensic Sci. Int.: Digit. Investig., 32, 200905, 2020. 4. Hemanth, K., Tharmavaram, M., Pandey, G., Background of forensic science, in: Technology in Forensic Science: Sampling, Analysis, Data and Regulations, pp. 1–16, 2020. 5. Keisler, P.D., Daley, C.K., Hagy, D.W., Investigative uses of technology: Devices, tools, and techniques. NIJ Special Report, p. 174, 2007. 6. Kloosterman, A., Sjerps, M., Quak, A., Error rates in forensic DNA analysis: Definition, numbers, impact and communication. Forensic Sci. Int.: Genet., 12, 77–85, 2014. 7. Forensic Science Regulator Act 2021. FSR, Forensic science regulator guidance, Forensic Science Regulator Newsletter. October 26, 2015. 8. Rao, P.K., Tharmavaram, M., Pandey, G., Conventional technologies in forensic science, in: Technology in Forensic Science, pp. 17–34, 2020. 9. Hall, S. and Dack, J.R., Using forensic ballistics in the courtroom, Seton Hall University, New Jersey, United States, 2014. 10. Franckenberg, S. et al., Fatal gunshot to a fox: The Virtopsy approach in a forensic veterinary case. J. Forensic Radiol. Imaging, 3, 1, 72–75, 2015. 11. The Economic Times: Need of the hour, 2020.

Recent Advances in Forensic Tools  387 12. Page, H. et al., A review of quality procedures in the UK forensic sciences: What can the field of digital forensics learn? Sci. Justice, 59, 1, 83–92, 2019. 13. Guinness World Records, ISBN 1913484017, 9781913484019, 2021. 14. Johnson, L.R., Forensics tools, in: Computer Incident Response and Forensics Team Management, pp. 145–165, 2014. 15. Marshall, A.M., Digital forensic tool verification: An evaluation of options for establishing trustworthiness. Forensic Sci. Int.: Digital Invest., 38, 301181, 2021. 16. Pereira De Oliveira, L. et al., Forensics in hand: New trends in forensic devices (2013-2017). Anal. Methods, 10, 43, 5135–5163, 2018. 17. Khanna, N. et al., A survey of forensic characterization methods for physical devices. Digital Invest., 3, Suppl., 17–28, 2006. 18. Sharma, A. and Rao, P.K., Advanced forensic models, in: Technology in Forensic Science, pp. 303–326, 2020. 19. Dube, S. et al., Sensors for the detection of biological fluids, in: Technology in Forensic Science, pp. 239–258, 2020. 20. Anil, D. et al., Sensors for dope tests in sports, in: Technology in Forensic Science, pp. 259–278, 2020. 21. Wang, J., Portable electrochemical systems. 21, 4, 226–232, 2002. 22. De Araujo, W.R., Cardoso, T.M.G., da Rocha, R.G., Santana, M.H.P., Muñoz, R.A.A., Richter, E.M., Coltro, W.K.T., Portable analytical platforms for forensic chemistry: A review. Anal. Chim. Acta., 1031, 1–196, 2018. 23. PSA Semiquant | SERATEC 2019, https://seratec.com/psa-semiquant, 2019. 24. Boward, E. S., & Wilson, S. L., A comparison of ABAcard® p30 and

RSID™-Semen test kits for forensic semen identification. J. Forensic Leg. Med., 20, 8, 1126–1130, 2014.

25. Boward, E.S. et al., Original communication A comparison of ABAcard Ò p30 and RSID Ô -Semen test kits for forensic semen identification. J. Forensic Leg. Med., 20, 1126–1130, 2013. 26. Old, J. et al., Developmental validation of RSID TM-semen: A lateral flow immunochromatographic strip test for the forensic detection of human semen. 57, 2, 489–499, 2012. 27. Gujarathi, D., Need for an independent mandatory system of forensic

laboratories. Issue 3 Int'l. JL Mgmt. & Human., 3, 2124, 2020.

28. Dogăroiu, C., Dermengiu, D., & Viorel, V., Forensic comparison

between bear hind paw and human feet. Rom. J. Leg. Med., 20, 131– 134, 2012. 29. Lopez, G. H., Hyland, C. A., & Flower, R. L., Glycophorins and the MNS blood group system: A narrative review. Ann Blood, 6, 39, 2021. 30. Huang, X. et al., Nanotechnology-enhanced no-wash biosensors for in vitro diagnostics of cancer. ACS Nano, 11, 6, 5238–5292, 2017. 31. Deepak, R., DNA Technology in Forensic Science, Wiley-VCH, Weinheim, Germany, 2020.

388  Modern Forensic Tools and Devices 32. Singh, V., Kamthania, M.C., Mishra, N., Biosensor developments: Application in crime detection. Article Int. J. Eng. Tech. Res., 2, 6, 163–166, June, 2014. 33. Garrido, E., Pla, L., Lozano‐Torres, B., El Sayed, S., Martínez‐Máñez,

R., & Sancenón, F., Chromogenic and fluorogenic probes for the detection of illicit drugs. ChemistryOpen, 7, 5, 401–428, 2018. 34. Dhawan, G., Floden, A. M., & Combs, C. K., Amyloid-β oligomers stimulate microglia through a tyrosine kinase dependent mechanism. Neurobiol. Aging, 33, 10, 2247–2261, 2012. 35. Emrani, A. S., Danesh, N. M., Ramezani, M., Taghdisi, S. M., & Abnous, K., A novel fluorescent aptasensor based on hairpin structure of complementary strand of aptamer and nanoparticles as a signal amplification approach for ultrasensitive detection of cocaine. Biosens. Bioelectron, 79, 288–293, 2016. 36. Emine, G., Bozokalfa, G., Demir, B., Gumus, P. Z., Guler, B., Aldemir, E., Timur, S., & Coskunol, H.,. An aptamer folding‐based sensory platform decorated with nanoparticles for simple cocaine testing. Drug testing and analysis, 9, 4, 578–587, 2017. 37. Roncancio, D., Yu, H., Xu, X., Wu, S., Liu, R., Debord, J., ... & Xiao, Y., A label-free aptamer-fluorophore assembly for rapid and specific detection of cocaine in biofluids. Analytical chemistry, 86, 22, 11100– 11106, 2014. 38. Shcherbakova, Elena G., Ben Zhang, Samer Gozem, Tsuyoshi Minami, Peter Y. Zavalij, Mariia Pushina, Lyle D. Isaacs, and Pavel Anzenbacher Jr. Supramolecular sensors for opiates and their metabolites, J. Am. Chem. Soc., 139, 42, 14954–14960, 2017. 39. Wang, W., Dong, Z. Z., Yang, G., Leung, C. H., Lin, S., & Ma, D. L., A long-lived iridium (iii) chemosensor for the real-time detection of GHB. J. Mater. Chem. B, 5, 15, 2739–2742, 2017. 40. Anderson, M. D., Hansen, B., & Rees, D. I.. Medical marijuana laws, traffic fatalities, and alcohol consumption. J. Law Econ., 56, 2, 333– 369, 2013. 41. Starks, T. J., Jones, J. S, Kyre, K., Robles, G., Cain, D., Jimenez, R., Stephenson, R., & Sullivan, P. S., Testing the drug use and condomless anal sex link among sexual minority men: The predictive utility of marijuana and interactions with relationship status. Drug and Alcohol Dependence, 216, 108318, 2020. 42. Sisco, E. and Forbes, T.P., Forensic applications of DART-MS: A review of recent literature. Forensic Chem., 22, November 2020, 100294, 2021. 43. Rotello, V.M., Steed, J.W., Turner, D.R., Wallace, K.J., Core concepts in supramolecular chemistry and nanochemistry. J. Am. Chem. Soc., 129, 46, 14524, 2007.

Recent Advances in Forensic Tools  389 44. Ribeiro, G., Christina, S., Hanna, R., Chiral drug analysis in forensic chemistry: An overview. Molecules, 23, 262–309, MDPI (Multidisciplinary Digital Publishing Institute), 2018. 45. Barne, S. and Carlin, M., Forensic Applications of High Performance Liquid Chromatography, 1st Edition, 2010. 46. Bayne, S., & Michelle C., Forensic applications of high performance liq-

uid chromatography. CRC Press, 2017.

47. Nahar, L. K., Murphy, K. G., & Paterson, S., Misuse and mortal-

ity related to gabapentin and pregabalin are being under-estimated: A two-year post-mortem population study. Journal of Analytical Toxicology (JAT), 43, 7, 564–570, 2019. 48. Schwelm, H. M., Grumann, C., Auwärter, V., & Neukamm, M. A., Application of a chiral high‐performance liquid chromatography‐tandem mass spectrometry method for the determination of 13 related amphetamine‐type stimulants to forensic samples: Interpretative hypotheses. Drug Testing and Analysis, 12, 9, 1354–1365, 2020. 49. Dinis-Oliveira, R. J., Carvalho, F., Duarte, J. A., Remiao, F., Marques, A., Santos, A., & Magalhaes, T., Collection of biological samples in forensic toxicology. Toxicol. Mech. Methods, 20, 7, 363–414, 2010. 50. Singh, Z., Forensic toxicology: biological sampling and use of different analytical techniques. Forensic Research & Criminology International Journal (FRCIJ), 4, 4, 117–120, 2017. 51. Hall, A. B., & Saferstein, R. (2020). Forensic Science Handbook, Volume I. CRC Press, 2020.

52. LC/MS/MS Rapid Toxicology Screening System Ver.3: SHIMADZU (Shimadzu Corporation), https://www.shimadzu.com/an/products/liquidchromatograph-mass-spectrometry/lc-ms-system/lcmsms-rapid-toxicologyscreening-system-ver3/index.html, 2020. 53. Zhang, J. et al., Application of fourier transform infrared spectroscopy with chemometrics on postmortem interval estimation based on pericardial fluids. Sci. Rep., 7, 1–8, June, 2017. 54. Kintz, P., Hair analysis in forensic toxicology: An updated review with a special focus on pitfalls. Curr. Pharm. Des., 23, 36, 5480–5486, 2017. 55. Harper, L., Powell, J., Pijl, E.M., An overview of forensic drug testing methods and their suitability for harm reduction point-of-care services. Harm Reduct. J., 14, 1, 1–12, Article 52, 2017. 56. Usman, M. et al., Forensic toxicological analysis of hair: A review. Egypt. J. Forensic Sci., 9, Article number 17, 1–12, 2019. 57. ECCO||[col=180]Laser Induced Breakdown Spectrometer 2017, https:// www.bcluae.com/products/product_details/ecco-2-advanced-­documentanalysis, 2017.

390  Modern Forensic Tools and Devices 58. Si, A., For the elemental analysis of evidence by laser induced breakdown spectroscopy, 2017. 59. Ismail, D. et al., Ultra-violet and visible (UV-VIS) spectroscopy and chemometrics techniques for forensic analysis of ballpoint pen inks: A preliminary study. Malays. J. Forensic Sci., 5, 1, 47–52, January, 2014. 60. Foster + Freeman 2018, https://fosterfreeman.com/, 2018. 61. Projectina Crime Scene Equipment—Ultra Electronics Forensic Technology, https://www.projectina.ch/, 2018. 62. Evans, D. and Parish, S., Predicting the first recorded set of identical fingerprints. J. Interdiscip. Sci. Topics, 4, 4–6, March 2015. 63. Saini, M. and Kapoor, A.K., Biometrics in forensic identification: Applications and challenges. J. Forensic Med., 1, 2, 1–6, 2016. 64. Uchida, K., Fingerprint identification. NEC J. Adv. Technol., 2, 1, 19–27, 2005. 65. 5 ways biometrics help solve crimes - M2SYS blog on biometric technology. International Conference on Biometrics, 2014. 66. Zhang, D. et al., Online palmprint identification. IEEE Trans. Pattern Anal. Mach. Intell., 25, 9, 1041–1050, 2003. 67. Jain, A.K., Flynn, P., Ross, A.A., Handbook of biometrics, Springer, London, UK, 2007. 68. Banday, M. and Mir, A.H., A study on the applications of biometrics in forensic science. Int. J. Adv. Res. Sci. Eng. (IJARSE), 7, 2389–2395, 2018. 69. Masaki, S., Aki, A., Yusuke, I., Face recognition cloud service. NeoFace Cloud, 13, 2, 37–41, 2017. 70. Gupta, S. et al., Forensic facial reconstruction: The final frontier. J. Clin. Diagn. Res., 9, 9, 26–28, 2015. 71. Rinchon, S. et al., 3D Forensic facial reconstruction: A review of the traditional sculpting methods and recent computerised developments. Int. J. Forensic Sci., 3, 1, 1–6, 2018. 72. ARSENAL ABIS - Papilon Savunma - Automatic Ballistic Analysis System, https://papillonsystems.com/products/programs/arsenal/, 2020. 73. National Forensic Service, A simplified guide to forensic audio and video analysis. National Forensic Science Technology Center . Vol 1, 19, 2012. 74. Forensic Audio and Video Analysis: How It’s Done, https://www.forensicsciencesimplified.org/av/how.html, 2013. 75. Of, E. et al., GAP interdisciplinarities effect of repeated probes on creating. 875, Iii, 17–29, 2020. 76. Digitpol, Drone forensics, DIGITPOL, HongKong, 2021. 77. College, S., Iqbal, F., Yankson, B., AlYammahi, M.A., AlMansoori, N., Qayed, S.M., Baker, B.S.T., Drone forensics: Examination and analysis. Int. J. Electron. Secur. Digit. Forensics (IJESDF), 11, 3, 245–264, 2019. 78. Mendis, N.A., Use of unmanned aerial vehicles in crime scene investigations novel concept of crime scene investigations. Forensic Res. Criminol. Int. J., 4, 1, 2005–2006, 2017.

Recent Advances in Forensic Tools  391 79. Kao, D.Y. et al., Drone forensic investigation: DJI spark drone as a case study. Proc. Comput. Sci., 159, 1890–1899, 2019. 80. Renduchintala, A. et al., A comprehensive micro unmanned aerial vehicle (UAV/Drone) forensic framework. Digital Invest., 30, 52–72, 2019. 81. Martins, C. et al., DNA quantification by real-time PCR in different forensic samples. Forensic Sci. Int.: Genet. Suppl. Ser., 5, e545–e546, 2015. 82. Alonso, A. et al., Real-time PCR designs to estimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies. Forensic Sci. Int., 139, 2–3, 141–149, 2004. 83. Oliveira, N.C.L. et al., DNA genotyping analysis overview: Profile of rape cases in the state of Pernambuco, Brazil. Forensic Sci. Int.: Genet. Suppl. Ser., 5, e551–e552, 2015. 84. Haldemann, B. et al., eDNA—An expert software system for comparison and evaluation of DNA profiles in forensic casework. Forensic Sci. Int.: Genet. Suppl. Ser., 5, e400–e402, 2015. 85. Benschop, C.C.G. et al., Low template STR typing: Effect of replicate number and consensus method on genotyping reliability and DNA database search results. Forensic Sci. Int.: Genet., 5, 4, 316–328, 2011. 86. What is touch DNA? Sci. Am. J., 5, 108, 2008. 87. Sessa, F. et al., Touch DNA: Impact of handling time on touch deposit and evaluation of different recovery techniques: An experimental study. Sci. Rep., 9, 1, 1–9, 2019. 88. Leary, M.G., Touch DNA and chemical analysis of skin trace evidence: Protecting privacy while advancing investigations. William Mary Bill Rights J., 26, 2, 251–285, 2017. 89. Thotakura, S., Touch DNA: An investigative tool in forensic science article in. Int. J. Curr. Res., 8, 02, 26093–26097, 2016. 90. Devesse, L. et al., Classification of STR allelic variation using massively parallel sequencing and assessment of flanking region power. Forensic Sci. Int.: Genet., 48, July, 102356, 2020. 91. Petrovick, M.S. et al., Analysis of complex DNA mixtures using massively parallel sequencing of SNPs with low minor allele frequencies. Forensic Sci. Int.: Genet., 46, December 2019, 102234, 2020. 92. Mienkerd, S., Nettakul, A., Waiyawuth, W., The using of massively parallel sequencing of mitochondrial DNA to assist the missing person identification: Human remains in the wild. Forensic Sci. Int.: Genet. Suppl. Ser., 7, 1, 716–717, 2019. 93. Wan, L. et al., The approach of virtual autopsy (VIRTOPSY) by postmortem multi-slice computed tomography (PMCT) in China for forensic pathology. Forensic Imaging, 20, December 2019, 200361, 2020. 94. Carew, R.M., French, J., Morgan, R.M., 3D forensic science: A new field integrating 3D imaging and 3D printing in crime reconstruction. Forensic Sci. Int.: Synergy, 3, October, 100205, 2021.

16 Future Aspects of Modern Forensic Tools and Devices Swathi Satish1, Gargi Phadke1 and Deepak Rawtani2* School of Pharmacy, National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India 2 School of Doctoral Studies & Research (SDSR), National Forensic Sciences University (Ministry of Home Affairs, GOI), Gandhinagar, Gujarat, India

1

Abstract

Forensic science is the backbone of the criminal justice system globally. The essence of the scientific methodologies used in it aims to help the investigators in comprehensively and definitively determining the evidences provided to them. The paces at which the research and development progresses in such a mainstay domain are crucial as the rate of crimes are increasing alarmingly in the modern world. The development of novel tools and devices has a significant impact on the trend in the processes of forensic domain as whole. The foremost need for the new tools and devices is reliability, which is a critical aspect for the investigating process in determining the outcome of a case. This chapter explores and assures the readers of the developments in tools and devices used in forensic science with a futuristic vision. The current trends give the readers the idea of numerous advancements in process to help the forensic scientists efficiently. Keywords:  Forensic tools, forensic devices, analytical tools, analytical devices, digital tools, digital devices

*Corresponding author: [email protected] Deepak Rawtani and Chaudhery Mustansar Hussain (eds.) Modern Forensic Tools and Devices: Trends in Criminal Investigation, (393–414) © 2023 Scrivener Publishing LLC

393

394  Modern Forensic Tools and Devices

16.1 Introduction The sphere of forensics is vast with many subfields and regions orbiting and branching out of it. All the primary and secondary branches of forensic science are aided by tools and devices for various applications according to the domain. Hence, the forensic tools and devices play the crucial role of holding together the web of such a vast and versatile domain. The field of forensics needs more holistic, collaborative and multidisciplinary approaches for evidentiary and intelligence purposes. The objective method developments should be supported by subjective methods, validation, statistical analysis and error progress studies [1]. Now, the historical developments in forensic science are going through a fragmentation with more attention being focused on the means, tools, and devices [2]. The basis of forensic investigations is to lay down a link between objects, places and people involved in a certain crime. This is done through analyzing and interpreting physical evidences visually and chemically. The chemical data is analyzed through spectra, chromatograms and other analytical results which is where the forensic tools come into play. The results obtained through any analytical tool should be reliable and acceptable in court of law – which are crucial aspects to be kept in mind while developing any new technique [3]. Forensic tools can be classified along various lines; a broader line of classification being analytical and digital tools. Analytical tools include different spectroscopies, chromatographies, other analytical techniques etc., while the digital tools include numerous software applications like PALADIN, CAINE, Autopsy, Wireshark, NetworkMiner, etc. which are used for varying targets as depicted in Figure 16.1. Different spectroscopies and scientific techniques come together to form a device for forensic analysis and investigations. Various spectroscopy such as Raman spectroscopy, Fourier Transform Infrared (FTIR) spectroscopy, fluorescence spectroscopy, Mass spectrometry, Atomic Force Spectroscopy [4], Vis-NIR spectroscopy [5], MALDI FT-ICR MS [6], TD-DART-MS [7], as well as chromatography including paper chromatography, gas chromatography, high-performance liquid chromatography (HPLC), etc. are the forensic tools utilized to develop a forensic device as shown in Figure 16.1. Currently, biochemical techniques like Reverse Transcription–Polymerase Chain Reaction (RT-PCR) [8], immunoassay screening test [9] and proteomics [10] are also being used for forensic research and development. Nanomaterials such as Nanophosphors [11], gold and silver nanoparticles [12] and

Analytical

Future Aspects of Modern Forensic Tools  395 Forensic Spectrometric analysis Chromatography for forensic analysis

Spectroscopy based devices

Nuclear Analytical techniques

Forensic wearable devices

Microbiome

Forensic tools

System forensic analysis

Forensic Science

Forensic devices

Digital forensic devices

Digital

Linux based forensic tools

Nanomaterial based forensic devices

Network forensic analysis Memory forensics Malware forensics

Microfluidic-Integrated Cell Phone Imaging System

Mobile forensics

Figure 16.1  Forensic tools and devices.

carbon electrodes are also being prominently utilized to fabricate forensic devices with wide range of applications. These techniques are used for detection or analysis of various samples including bodily fluids, documents, textile fiber samples, explosives, fingerprint analysis, counterfeit money, and so on. In this chapter an assortment of forensic tools and devices utilized for forensic investigation along with their future aspects are discussed. The different tools and techniques designed to form a device helps to make the investigation faster and can be applied for on-site detection and quicker analysis of crime scene. These techniques serve as forensic devices for real-time situations during forensic investigations but there is still need of more research to increase the applicability for actual samples. The loopholes of accuracy, precision and applicability in real life situations need to be worked upon in order to carry out forensic investigation properly.

16.2 Forensic Tools Forensic tools are any application used for investigation and analysis of evidence to be further used in by law to solve a crime. The use of such forensic tools and techniques has become an integral part of investigating process through the years and forensic scientists use an array of tools in their craft necessary to gather evidences and extract information. Other tools utilized in forensic science process for analysis of samples and evidences,

396  Modern Forensic Tools and Devices DNA identification, fingerprint analysis, chemical analysis of drugs, digital investigation, etc. The basic sciences like chemistry, biology and mathematics are integrated with technologies to develop forensic tools. Specialist forensic tools focus on specific pieces of evidences for investigation such as DNA phenotyping, biosensors for fingerprint analysis and body fluids, etc.

16.2.1 Emerging Trends in Forensic Tools The most canonical tools used by forensic scientists involve spectrometers, microscopes, chromatograms, photography techniques, etc. Spectrometers, especially mass spectrometry is used for trace evidence analysis and imaging. An emerging development called the mass spectrometric imaging (MSI) helps to produce molecular information and images directly on to the surface of the sample under atmospheric conditions without the hassle of staining and labelling [13]. Another area of interest is the fieldable mass spectrometry which will help in significantly improving the efficiencies of testing drugs and related crimes. The inlet systems and hybrid gas chromatography systems based fieldable mass spectrometers like NFiDENT program have already been introduced in market for application in forensics and security. Similarly, an ambient ionization mass spectrometry called MT Explorer 50 (MassTech) was recently developed for analysis of drugs on-site as well [14]. Immunochromatography is used to detect substances in body fluids, and it was integrated with smart phone to develop a sensor to evaluate saliva sample without a laboratory set up [15]. Palynology is the study of pollens, grains, spores and seeds in geological and archaeological scope. It has become an established analytical tool for scientific developments over the years. Forensic palynology has been in use for criminal investigations but the pollen DNA profiling has not yet been applied in the field [16]. Numerous studies are being conducted to develop unique and relevant forensic tools to increase the efficiency and accuracy of investigative processes. Isotopes can have a unique signature, a property which has been explored for forensic analyses led to geolocating a suspect or victim using stable isotopes of water [17]. Another interesting forensic tool is based on the block chain technology and is called cloud forensics. Though digital forensics has been in use since some time, it is still one of the most rapidly developing branches of forensic science. Cloud forensics is in a relatively nascent stage, but has immense potential to revolutionize the investigative models for cyber crime [18]. Similarly, digital vehicle forensics is a field where investigators collect physical

Future Aspects of Modern Forensic Tools  397 evidence from vehicles. As vehicles are becoming more sophisticated technologically, the vehicle forensic tools also need to advance to keep pace. Various hardware and software solutions are being developed to acquire advanced forensic data from vehicles, especially since the advent of smart cars [19]. The modern world poses tough challenges to investigators with the accelerative use of social media giving rise to more cyber crimes. Social network forensics has become a necessity in the forensic investigations of cyber crimes. Scientists are developing and modifying models to evaluate the large amount of data extracted from the social networks. Forensic techniques are being constantly updated for source identification and the verification of data uploaded on social networks along with multimedia algorithms for assessing credibility of the data [20]. Another modern approach is the drone forensics for which models are being developed by the scientists on war-front. The increase in usage of drones has become a challenge for the law enforcement due to its connection to digital crimes. The forensic scientists are required to be adept in the capabilities of the tools to efficiently tackle the growing ­menace [21].

16.2.2 Future Facets of Forensic Tools Tools for the futuristic vision of forensic science should be able to take into account analysis of evidences but in a scientifically relevant manner as well. The present and future of forensic science depends on the developing of capabilities of simulations, prediction tools, analytical and digital tools. The major factor influencing the development of new forensic tools is the change in society and advancement in technology which will give rise to more sophisticated types of crime. Even though it is not possible to predict the minute details of the scientific and technological advances that will take place in future of forensic science, it is possible to have confidence in the current discoveries that will pave way to the futuristic vision [22]. Many potential capabilities are in research and implementation stage all around the globe to enhance the current capacity of forensic tools used in investigations.

16.2.2.1 Analytical Forensic Tools As the crime rates continue to climb, the need for rapid analytical tools in forensic laboratories has become more imperative. The analysis of chemical samples is the major application for forensic analytical tools and many developments are being reported for achieving complete sample profile.

398  Modern Forensic Tools and Devices a)  Forensic Spectrometric Analysis One such powerful tool in forensic chemistry is the real time mass spectrometry (DART-MS) used for direct analysis. This mass spectrometry has been in used for study of drugs, explosives, gunshot residues, psychotropic substances, pyrotechnic residues, adulterants in food, and so on [23]. The DART-MS has the capability of direct and rapid analysis of samples without the hassle of extensive sample preparation; hence it finds application in examination of unique samples. This feature has made the technique useful in wildlife forensics, for screening species of timber using metabolome profiling [24]. These developments have extended the range of usage of spectrometric tools for forensic applications. The liquid chromatography tandem mass spectrometry (LC-MS/MS) was used for sensing polyphenols like catechins and theaflavins present in tea. This polyphenols detection was further used for forensic discrimination of different types of teas [25]. LC-MS/MS is used in forensic toxicology as well such as a recent study for qualitative screening of amphetamine and ketamine in urine samples. The authors reported the method fit to be employed for forensic analysis of drugs alleviating sexual assaults and other criminal acts [26]. b)  Chromatography for Forensic Analysis Forensic volatolomics deals with detection, analyses, and characterization of volatiles released by any human being or object. Chemically, an odor is an amalgamation of volatile organic compounds which can be sensing by analytical instruments. For this, two dimensional has chromatography (GCxGC) is being explored due to its increased sensitivity. The technique is being used and further explored for application in various regions of forensics like forensic profiling, arson investigation, drugs, explosives, chemical threat agents, etc. The amalgamation of GCxGC with MALDI-TOF, TOF-MS, etc. has been studied and many more areas for its applications are being explored as well [27]. The samples size available for forensic analysis is often very limited hence some promising new miniaturized liquid chromatography systems like micro, capillary and nano are being developed. This can be optimize in terms of detection limits, operating costs with in-laboratory and on-site applications for forensic chemical analysis [28]. c)  Nuclear Analytical Techniques as Forensic Tools Glass forensics, a subfield in forensic science has been an important part of crime investigations. Numerous techniques are employed for glass analysis ranging from traditional to sophisticated methods. One such set of

Future Aspects of Modern Forensic Tools  399 sophisticated tools are the nuclear analytical techniques which includes Instrumental Neutron Analysis (INAA), Particle Induced Gamma Ray Emission (PIGE), etc. These have been reported to be capable of chemically characterizing wide variety of glass samples with accurate results [29]. Several nuclear analytical techniques are being modified to be integrated into food forensics as well to determine food authenticity and for quality control [30]. d)  Microbiome as a Forensic Tool Another very interesting development is the use of human microbiome as a tool for forensic investigations especially for identification of different personal information. The forensic microbiome database (FMD) is an accumulation of 16S rRNA data and related metadata compiled form a publicly accessible data. The FMD has been further extended into a website form where the users can predict geolocation based on taxonomic deviations between microbiomes extracted from various locations. This development can act as a model for future database on similar line using advanced DNA sequencing techniques [31]. The other applications of human microbiome as forensic tool includes forensic medicine, tissue/body fluid identification, individual identification, post-mortem interval estimation, time passed since stain deposition estimation, etc. The forensic microbiome analysis holds great potential which is yet to be fully explored as a forensic tool. The microbiome analysis has the capability of integration with current techniques to enhance the performance. But the current lack of analytical and experimental data needs to addresses to access the full potential of the tool [32]. The choice of analysis technique in forensic analysis and many a times this crucial selection step is ignored resulting in failure of the analysis investigation. Hence, it is important to streamline the process of identifying the right tool for the investigators to arrive at the accurate results [33]. With the extensive amount of research that is taking place for the development of specific and broad range analytical tools, the future of analysis investigation seems to have lesser chances of failures.

16.2.2.2 Digital Forensic Tools Digital forensic have a very focus and practical application in forensic investigations, hence digital forensic tools are ever evolving with changing nature of crimes. A digital tool or software is self-contained and can provide a definite degree of automation, with minimal user interaction. Digital forensics has subfields namely computer forensics,

400  Modern Forensic Tools and Devices software forensics, multimedia forensics, Internet-of-Things (IoT) forensics, malware forensics, network forensics, and memory forensics [34]. a)  System Forensic Analysis System Forensic analysis is used to attain the goal of identifying, preserving, recovering, analyzing the digital information forensically. It is broadly called as computer forensics as it combines rudiments of law and computer science to analyze cyber systems and networks used in any act of crime. i)  Autopsy and Sleuth Kit Autopsy is a software toolkit to scope smart phones and computer hardwires to identify activities of crime or suspicion. The concept of the software was inspired from the medical autopsy procedure itself. The key characteristics of the software include recovery of deleted or corrupted media, extraction of calls and browsing activity, location determination form pictures, etc. [35]. The latest version offers advanced tools compared to other commercial software. The Sleuth kit (TSK) is similar software which enables the examiner to analyze system data through a library of command line tools. This is applied in investigation of images and videos. The TSK works behind the scenes for the Autopsy which is a GUI-based system. b)  Linux-based Forensic tools Linux based forensic tools like PALADIN and CAINE are widely used and have application in various cyber fields. The Linux distribution is considered good for cyber forensics as it helps to spot security weaknesses in IT infrastructure and reduces threats from bad actors. It helps in strengthening network security settings as well. i) PALADIN It is one of most used and versatile tools available for forensic analysis. It is Ubuntu based tool with more than 100 tools for quick and effective investigative process. The latest version called PALADIN PRO includes CARBON VFS for examiners. PALADIN has major application is in defense and security as many security agencies around the world make use of it. ii)  CAINE (Computer Aided Investigative Environment) CAINE is a Linux live distribution tool with an interactive GUI for broad range of forensic analysis. It has the capability of assessment of database, memory and networks which makes it different from other tools. The live

Future Aspects of Modern Forensic Tools  401 distribution software enables its usage without installation through flash drives directly and can integrate various existing software tools as well. It is fashioned to render the forensic tools needed for preservation, collection, examination, and analysis which are crucial investigative processes. c)  Network Forensic Analysis It is an arm of digital forensics related to the analysis and monitoring of network traffic for gathering information and legal evidence and for intrusion detection as well. The network forensics deals with highly dynamic and volatile information. Specialized network analyzers like Wireshark and NetworkMiner are widely used tools for network forensics investigations. i) Wireshark It is well used network protocol analyzer because it investigates the network activities at microscopic level. It has numerous features like live capture and offline analysis, compatibility with different file formats, live data reading, decryption support, and so on. The latest development supersedes the previous versions especially in stability. The working of this software is easy to understand and helps the network administrators and security analysts to detect attacks in the network as well as in traffic monitoring [36]. ii) NetworkMiner NetworkMiner is an open source tool used by network administrators and investigators to analyze traffic in a network [37]. It has the capability to extract information from print traffic, file and parameters from HTTP and SMB2 traffic as well. The user interface has also been made better to identify extension of extracted files. It is used as a passive network packet tool to analyze hostnames, operating systems, sessions, open ports and so on. d)  Memory Forensics Memory forensics particularly deals with the volatile data in the computer’s memory which is easily lost. This is very crucial for security and investigative purposes. This field deals with attacks and malicious behavior that usually do not leave any detectable tracks on hard drive data. i)  Volatility Framework Forensic information can be stored in RAM which is a volatile memory as it can be destroyed quickly. The Volatility framework software helps in the analysis of such volatile memory which is a crucial for cyber forensics. This software is useful for law enforcement, intelligence agencies along

402  Modern Forensic Tools and Devices with military and civilian investigators. The software has been recently been utilized for ransomware detection which is an emerging category of malware globally [38]. e)  Mobile Forensics Mobile forensics is a sub-division of digital forensics which deals with data recovery from mobile phones involved in any kind of crime investigation or security breach. Personal devices based crimes are on the rise owing to affordable technology, but the need for powerful forensic tools has also become pertinent. Software like oxygen forensic suite and Cellebrite UFED are such advanced tools specially used in mobile forensic analysis. i)  Oxygen Forensic Suite It is one of the most effective tools for collecting forensic information from mobile phones and applications. As the mobile applications and smart phones are advancing, the intensity of their involvement in cyber crimes is also increasing which has led to extensive usage of the Oxygen forensic suite tool. Newer developments support more than twenty-five thousand mobile devices and all operating systems. ii)  Cellebrite UFED Cellebrite is another well adopted tool for mobile forensics with the number of cyber attacks on mobile phones is increasing day by day. It supports a broad range of devices from mobile phones, drone, SIM cards, SD card to GPS devices and more. It includes multiple data collection and extraction methods with enhanced user interface. It is a high performance forensic workstation to handle rigorous data sets for intelligence and security needs [39]. f)  Malware Forensics Malware attacks have become a tool of attack in digital world with even countries using it to attack each other. Malware forensics involves investigating the reason and culprits behind an attack through analyzing the malicious codes. Many of the already mentioned software have usage in malware detection as well. FireEye is a company focusing on cyber security. It has capability of monitoring global cyber attacks in real time. It develops cyber security solutions to help organizations to protect themselves from malware attacks and other cyber security breaches.

Future Aspects of Modern Forensic Tools  403

16.3 Forensic Devices The techniques and methods applied to prepare a device which can help the forensic scientists and investigators to carry out the analysis and investigation with ease are regarded as forensic devices. The forensic devices can make the investigation rapid with precision and accuracy as well as it can be used for on-site analysis. Forensic devices that can be used for detection of various evidences on-site or in lab are discussed further. The digital forensic devices developed that work with the help of software and GPS are also included.

16.3.1 Emerging Trends in Forensic Devices The forensic devices have a very crucial and ubiquitous role in investigations and chain of evidences. Earlier most of the analyses were conducted through long and tedious processes which may in the end provide inconclusive results. But the 20th century turned a new page in terms of faster and sophisticated forensic devices for evidence processing as well and investigation itself. There have been numerous developments in terms of devices like Video Spectral Comparator (VSC) was utilized for differentiation and evaluation of ammunition markers. The luminescent markers used in the study were MOFs-based, consisted of correlating polymers from coordination of organic ligands ions. Studies for two markers consisting of europium (Eu3+) and two organic ligands (trismesic acid (H3BTC) and terephthalic acid disodium salt (Na2BDC)) were performed. Both markers were added in the gunpowder and shooting session was conducted. VSC with UV light as an irradiation source was used for obtaining the emission luminescence spectra. The method is effective as it can distinguish between the luminescent markers prior to and after the integration to the gunshot ammunition as obtained by the results of the study [40]. Tomar et al. performed a study for forensic examination of thermal paper using VSC. This experiment indicated that VSC has potential to characterize, identify, discriminate and decipher thermal paper samples for forensic investigations [41]. In addition, Hay et al. proposed a low cost electrochemical device for simultaneous sampling and trace solid explosive (Trinitrotoluene) detection from non-porous surface. For the study, four substrates including glass microfiber filter paper, bare thin-film electrode, gel-polymer electrolyte (GPE) and GPE-filter

404  Modern Forensic Tools and Devices paper composite were investigated for explosive residue sampling. With swabbing technique, the sampling was carried out from the substrates and the square wave voltammetry was performed for determination of effects of oxygen and moisture on current response. The thin-film electrode covered with a thin coating of GPE was found to be user-friendly for detection on field and was tested using a hand-held portable potentiostat in real-life environment. The device can detect TNT within 30 minutes of the development time in various real life situations. Hence, the GPE/TFE system is portable forensic device for on-scene detection of TNT in real environment [42].

16.3.2 Future Aspects of Forensic Devices Numerous forensic tools are used for fabrication of forensic devices, and the advances in research and development of tools and techniques advances the forensic devices that are available for application. Arrays of devices are being used in the field of forensic sciences and the latest developments have been detailed here. a)  Spectroscopy-Based Device (i)  Portable Raman Spectrometer for Forensic Drug Detection Raman spectroscopy is non-destructive spectroscopic technique used to analyze vibrational modes of molecules which provides details about the chemical structure, polymorphic structure, and phase, crystalline and molecular level interactions. The basic principle of Raman is inelastic scattering or Raman scattering of molecules occurring after interaction with light. Many variants of Raman have been developed with respect to the application required. Raman spectroscopy has wide range of forensic applications such as chemometrics, biological samples, counterfeit pharmaceuticals, toxicology, explosives, gunshot residues, questioned documents, trace analysis of paint, fibers and hair [43]. The Raman spectroscopy system was implemented for screening of toxicological samples. Validation of portable Raman spectrometer was performed according to United Nations Office on Drugs and Crime (UNODC) guidelines for 15 frequently encountered drugs of abuse and 15 diluents compounds. The accuracy for diluents examined through glass packaging was 91% with 90% precision whereas through plastics it was 89% accurate with 88% precision. This system

Future Aspects of Modern Forensic Tools  405 can serve as a forensic device for detection of drug and diluents analytes for real-time monitoring [44]. Navin et al. determined percent drug release and potency of ciprofloxacin HCl tablets by developing chemometric models from portable Raman spectrometer. The Raman model as well as the ciprofloxacin tablets successfully passed the dissolution experiments and potency specifications respectively. The experiments show that a portable Raman spectrometer can be utilized to quantitatively analyze critical product parameters of manufactured drug products. Moreover, this forensic device has applications in analytical and pharmaceutical areas [45]. b)  Wearable Internet of Things (IoT) Forensic Devices Wearable devices have generally been regarded as challenging for forensic investigators in terms of acquiring evidence. But the tide has turned with development of wearable forensic devices for monitoring and detecting various drugs and for alcohol analysis as well. Such devices can be used by the investigators for the sole purpose of forensic investigations, like Tai, Li-Chia et al. developed a wearable band for detection of caffeine as a methylxanthine drug from sweat. The band consists of flexible poly(ethylene terephthalate) (PET) substrate with triple-electrode array interfaced with PCB. The working mechanism of the band includes oxidation of caffeine by implementing DPV from PCB. The band eliminates the prevailing drug monitoring techniques including venipuncture, sweat or urine sample collection. Moreover, the band also informs users about the drug intake and metabolism. This forensic device serves as a link for further applications in clinical pharmacology, drug abuse intervention and other drug related crimes in healthcare system [46]. A skin-worn microneedle sensing device was developed by Vinu Mohan, A.M. et al. for subcutaneous alcohol monitoring. This device uses a pyramidal microneedle design integrated with Pt and Ag wires with micro cavity openings for minimally invasive electrochemical monitoring. The o-phenylene diamine was electropolymerized on Pt wire microtransducer then alcohol oxidase (AOx) is immobilized in an intermediate chitosan layer covered with Nafion layer for fabrication of the microneedle aperture. The selectivity of the biosensor was tested by measuring the chronoamperometric alcohol response in the presence and absence of known interferents at physiologically relevant concentrations. The viability of the biosensor framework was assessed ex vivo by utilizing mice skin model demonstrating stable enzymatic layer unaffected by the skin

406  Modern Forensic Tools and Devices infiltration process. The minimally-invasive alcohol biosensor system can serve as a forensic device for constant monitoring of alcohol in real life situations [47]. Wearable devices are proving to be useful in investigations of sexual crimes as well, such as a safety device named ‘SafeBand’ as an Information and Communication Technology based solution for women to combat physical harassment and for investigators to obtain details of the crime scene. The user can wear the band on wrist or as locket and press the button in danger. The nearby police station will receive the location of the user sent from the band requesting for immediate action. Moreover, pressing the button will also send the message and location to family members. Two applications were developed, one for the police officers to monitor the victim’s request and another one for victims to add as well as update the contact numbers of family. After the request is received by the police station, the police can send an assurance message to victim resulting in turning on the LED of the band. Another security highlight is on the off chance that somebody fails to remember the band some place, it will produce an alarm message in client’s cell phone with the utilization of ‘SafeBand’ application. On the off chance that the client doesn’t squeeze YES button inside explicit time-frame the assist with informing will be shipped off police. The review performed to assess the framework demonstrated the gadget to be successful, productive and appropriate to all clients [48]. Such devices can be helpful quite helpful for forensic investigators especially in sexual offenses investigations. c)  Digital Forensic Devices Gentry and Soltys developed a digital forensic device SEAKER (Storage Evaluator and Knowledge Extraction) that enables forensic investigators to perform triage on many digital devices rapidly. The arrangement script changes over a Raspberry Pi into a SEAKER gadget followed by gadget mounting and web coding. Promptly when the drives are associated with Raspberry Pi, the filenames and registries are gathered and put away in a media explicit text document. In the mean time, specialists should interface with the Raspberry Pi through WIFI on a different remote empowered gadget. Further, the specialist should open the SEAKER website page. The principal drive will be consequently added to the rundown of drives accessible on the website page to be looked. At the point when the page will be invigorated physically by the specialist, the rundown of extra drives will be shown. All chose drives will then, at that point, go through the pursuit interaction and each drive will be handled each in turn. At the point when the PHP motor will get done with handling and HTML page is concluded

Future Aspects of Modern Forensic Tools  407 then it will be sent back to specialists’ cell phone. From the review results, the SEAKER gadget is valuable for on-scene examinations during the warrant execution and help diminishing overabundances at computerized criminological research facilities [49]. d)  Nanomaterial-Based Forensic Devices Biosensors have crucial role to play in forensics and their applications are spread through all the sub-branches of forensic sciences from toxicology to detection of chemical and biological weapons. Incorporation of nanomaterials in fabrication of biosensors help in enhancing the sensitivity and output efficiency of the sensor like Polydopamine-modified carbon nanofibers (CNFs) biosensor was developed by Liao et al. for detection of hypoxanthine (Hx) in vitreous humor samples in corpses. The results of FTIR spectroscopy and electrochemical studies showed good conductivity and catalytic ability. Additionally, the assay has acceptable stability and reproducibility under optimal environment. The linear range of the electrochemical biosensor for Hx concentration was 5–60 µM and the limit of detection was obtained to be 2 µM. Further studies confirmed that the detection specificity of the assay is outstanding for actual sample analysis. Hence, this forensic device can be applicable in actual forensic investigations and post mortem interval (PMI) estimation [50]. A poisonous nerve agent VX ((O-ethyl-S-2-(N,N-diisopropylamino)ethyl ­methyl-phosphonothioate) was detected in a study. The gold nanoparticles are utilized for identification of VX by straightforward colorimetric technique bringing about shading change of AuNPs from brilliant red to dark blue on development of nerve agent VX under acidic conditions. Be that as it may, AuNP conglomeration happened under antacid circumstances because of presence of 2-(diisopropylamino)ethanethiol (DAET). On the basis of this principle, a hand-powered extraction device was developed for on-site detection application. The reverse extraction protocol was applied to remove the background matrix interference. Phase separation method was used for further application of the extraction protocol. For separation of organic and water phases, centrifugal force was applied to the device. The results of the study were performed to check the applicability of the device indicated no color change as any DAET was present in the sample. Therefore, this portable analytical device can be used for on-site VX detection [51]. e)  Microfluidic Devices for Forensic Samples Analysis Microfluidic devices are based on the manner in which fluids behave in microenvironment level. These devices have multitudinous applications

408  Modern Forensic Tools and Devices in various fields of science including forensic science. Microfluidic devices have been largely used for forensic DNA analysis as offer many advantages such as reduced contamination risk, shorter analysis time, on-site application on crime scene, etc. [52]. Lab-on-a-chip devices have been produced for criminological forensic applications since a few times and as of late a scaled down lab-on-a-chip Forensic Short tandem probe (STR) profiling test was created. QueSTR is a hybridization based genotyping assay that depends with respect to the recognition and cleavage of RNA: DNA duplex by RNase H2 compound. This miniature Forensic STR profiling device is dependable replacement for capillary electrophoresis generally used for genotyping [53]. Another fascinating use of microfluidic devices is the development of a portable smart phone based microfluidic colorimetric system for environmental forensics. This device is proficient on location identification of foreign substances like phosphate, nitrite and silicate in coastal front waters. The device is a blend of Microfluidic paper-based sensors and android advanced mobile phone application for synchronous on location measurement of foreign substances. This data obtained is GPS tagged and can be shared via social networks as well. Such device has immense potential to be utilized in environmental forensic applications [54]. Deshmukh et al. developed an original criminological sample screening instrument which is a central processor incorporated with a convenient mobile phone imaging stage that records and cycles pictures of sperm tests for additional examination and capacity. The sample handling workflow takes less than 15 minutes which includes sample preparation on-chip, sample loading through cell phone image acquisition to analysis. The image processing work process includes three stages. Introductory morphology-based sperm determination with a Laplacian of Gaussian mass identification technique, Excluding the epithelial cells in the sperm’s encompassing by a pixel aggregate limit, Hough gradient change on binarized picture with a base distance boundary to decrease over counting of sperm cells. The reconciliation of mobile phone imaging stage and cell acknowledgment calculations with dispensable central processor was effective and this can be an attainable answer for wrongdoing research facilities. Further review on approving the central processor incorporated with mobile phone imaging framework to speed up the evaluating system for forensic examinations is required [55].

Future Aspects of Modern Forensic Tools  409

16.4 Conclusion Forensic is witnessing a continuous development of new tools and technologies by infinite scientific disciplines, but such a fast paced development of technology and methods are also pushing back the discoveries of newer scientific principles. A balance needs to be attained between improvement of process and inventions of scientific principles in future. Even with numerous new developments, many of the subfields are lacking behind than others in terms of novel tools and devices. There is underdevelopment of tools when it comes to IoT forensics despite being a fast growing field. The gaps in research still persist as the development is not keeping up with rate of crimes. Similarly, there is need of more efficient development of network forensic tools as well, in order to extract information effectively from communication channels. Also, the use of chromatography as analytical tool, even with its vast potential is limited in forensic science as compared to other scientific fields. Likewise, the full potential of human microbiome hasn’t been realized yet for forensic applications. The advancement in forensic tools discussed in this chapter show that the research is taking the right direction and pace hence making future facets reliable. The forensic devices are made by using the various tools and techniques for forensic applications. Numerous devices have been discussed in this chapter under the broad classification of biosensors, wearable devices and portable spectroscopy. The digital forensic devices are one of the emerging areas of forensic science. Digital forensic has been applied for safety of women in public transportation and for performing triage on digital devices. Apart from digital forensics, analytical forensic devices such as portable Raman spectroscopy have been used for screening of seized drugs as well as for determination of drug release and potency of ciprofloxacin HCl tablets. Moreover, for subcutaneous alcohol monitoring a skin-worn microneedle sensing device has been developed resulting in minimally invasive alcohol biosensor system that can be used in real life situations. Biosensor was prepared from carbon nanofibers modified with Polydopamine for sensing of hypoxanthine (Hx) in vitreous humor samples in corpses. In addition to that, gold nanoparticles have been used in an extraction device for detection of nerve agent VX ((O-ethyl-S-2-(N,Ndiisopropylamino)ethyl methyl-phosphonothioate). For investigation of sperm samples microchip combined portable cell phone imaging platform

410  Modern Forensic Tools and Devices was developed. These forensic devices have been studied at lab scale and the results indicate that it can be applied for real-life situations. The devices can be improved to avoid interferences of substances for precise and accurate detection or analysis. But there is confidence in the pace at which the sphere is advancing, and provides certainty that more efficient and specific tools and devices will be added into the commercial platforms soon.

References 1. Airlie, M. et al., Contemporary issues in forensic science—Worldwide survey results. Forensic Sci. Int., 320, 110704, 2021. 2. Roux, C., Willis, S., Weyermann, C., Shifting forensic science focus from means to purpose: A path forward for the discipline? Sci. Justice, 61, 6, 678– 686, 2021. 3. Sauzier, G., van Bronswijk, W., Lewis, S.W., Chemometrics in forensic science: Approaches and applications. Analyst, 146, 8, 2415–2448, 2021. 4. Cadd, S. et al., Fingerprint composition and aging: A literature review. Sci. Justice: J. Forensic Sci. Soc., 55, 4, 219–238, 2015. 5. Zeng, R. et al., Forensic soil source identification: Comparing matching by color, vis-NIR spectroscopy and easily-measured physio-chemical properties. Forensic Sci. Int., 317, 110544, 2020. 6. Yeh, K. et al., Preliminary analysis of latent fingerprints recovered from underneath bloodstains using Matrix-Assisted Laser Desorption/Ionization Fourier-Transform Ion Cyclotron Resonance Mass Spectrometry Imaging (MALDI FT-ICR MSI). Forensic Chem., 20, 100274, 2020. 7. Jones, S., Sisco, E., Marginean, I., Analysis of benzodiazepines by thermal desorption direct analysis in real time mass spectrometry (TD-DART-MS). Anal. Methods, 12, 45, 5433–5441, 2020. 8. Akutsu, T. et al., Development of a multiplex RT-PCR assay and statistical evaluation of its use in forensic identification of vaginal fluid. Legal Med. (Tokyo, Japan), 45, 101715, 2020. 9. Moslah, B. et al., Fast screening tests for the simultaneous detection of 11 drugs of abuse in urine specimens. A forensic epidemiology study of 28,298 cases in Tunisia. Forensic Sci. Int., 283, 35–40, 2018. 10. Díaz Martín, R.D. et al., Proteomics as a new tool in forensic sciences. Span. J. Leg. Med., 45, 3, 114–122, 2019. 11. Shilpa, C.J. et al., New insights into the rapid deposition and visualization of latent fingerprints: Cyan light emitting GdAlO3:Ce3+ nano fluorescent probe. J. Photochem. Photobiol. A: Chem., 376, 288–304, 2019. 12. Shrivastava, P. et al., Handheld device for rapid detection of lead (Pb2+) in gunshot residue for forensic application. Microchem. J., 165, 106186, 2021.

Future Aspects of Modern Forensic Tools  411 13. Xue, J., Bai, Y., Liu, H., Recent advances in ambient mass spectrometry imaging. TrAC Trends Anal. Chem., 120, 115659, 2019. 14. Evans-Nguyen, K. et al., Fieldable mass spectrometry for forensic science, homeland security, and defense applications. Mass Spectrom. Rev., 40, 5, 628– 646, 2021. 15. Li, X. et al., A smartphone-based bacteria sensor for rapid and portable identification of forensic saliva sample. Sens. Actuators B: Chem., 320, 128303, 2020. 16. Alotaibi, S.S. et al., Pollen molecular biology: Applications in the forensic palynology and future prospects: A review. Saudi J. Biol. Sci., 27, 5, 1185– 1190, 2020. 17. Bartelink, E. et al., Applications of stable isotope forensics for geolocating unidentified human remains from past conflict situations and largescale humanitarian efforts, in: New Perspectives in Forensic Human Skeletal Identification, pp. 175–184, 2018. 18. Vaidya, N., Cloud forensics: Trends and challenges. Int. J. Eng. Res. Technol., 9, 9, 2020, Available at: https://www.ijert.org/research/cloud-­ forensicstrends-and-challenges-IJERTV9IS090415.pdf, https://www.ijert.org/cloudforensics-trends-and-challenges (Accessed: 9 March 2022). 19. Le-Khac, N.-A. et al., Smart vehicle forensics: Challenges and case study. Future Gener. Comput. Syst., 109, 2018. 20. Pasquini, C., Amerini, I., Boato, G., Media forensics on social media platforms: A survey. EURASIP J. Inf. Secur., 2021, 1, 4, 2021. 21. Yousef, M., Iqbal, F., Hussain, M., Drone forensics: A detailed analysis of emerging DJI models, in: 2020 11th International Conference on Information and Communication Systems (ICICS). 2020 11th International Conference on Information and Communication Systems (ICICS), pp. 066–071, 2020. 22. Dror, I.E. and Morgan, R.M., A futuristic vision of forensic science. J. Forensic Sci., 65, 1, 8–10, 2020. 23. Sisco, E. and Forbes, T.P., Forensic applications of DART-MS: A review of recent literature. Forensic Chem., 22, 100294, 2021. 24. Deklerck, V. et al., A protocol for automated timber species identification using metabolome profiling. Wood Sci. Technol., 53, 4, 953–965, 2019. 25. Kikkawa, H.S. et al., Simultaneous determination of eight catechins and four theaflavins in bottled tea by liquid chromatography-tandem mass spectrometry for forensic analysis. J. Forensic Sci., 67, 1, 309–320, 2022. 26. Wong, G.F., Lee, W.-M., Li, C.-K., Qualitative screening of amphetamineand ketamine-type abuse drugs in urine employing dual mode extraction column by Liquid Chromatography–Tandem Mass Spectrometry (LC– MS-MS). J. Anal. Toxicol., bkac004, 2022. 27. Dubois, L. et al., Use of GC×GC for the characterization of odours in forensic applications, in: Comprehensive Analytical Chemistry, 2022. 28. Langford, J.B. and Lurie, I.S., Use of micro, capillary, and nano liquid chromatography for forensic analysis. J. Sep. Sci., 45, 1, 38–50, 2022.

412  Modern Forensic Tools and Devices 29. Sharma, V. et al., Utilization of accelerator and reactor based nuclear analytical techniques for chemical characterization of automobile windshield glass samples and potential of statistical analyses using trace elements towards glass forensics. Forensic Sci. Int., 334, 111262, 2022. 30. Saadat, S. et al., Food forensics: Techniques for authenticity determination of food products. Forensic Sci. Int., 333, 111243, 2022. 31. Singh, H. et al., Forensic microbiome database: A tool for forensic geolocation meta-analysis using publicly available 16S rRNA microbiome sequencing. Front. Microbiol., 12, 2021, Available at: https://www.frontiersin.org/ article/10.3389/fmicb.2021.644861 (Accessed: 10 March 2022). 32. Díez López, C., Vidaki, A., Kayser, M., Integrating the human microbiome in the forensic toolkit: Current bottlenecks and future solutions. Forensic Sci. Int.: Genet., 56, 102627, 2022. 33. Booker, N.K. et al., Objective selection of forensic analysis methodologies. J. Fail. Anal. Prev., 22, 1, 241–258, 2022. 34. Wu, T., Breitinger, F., O’Shaughnessy, S., Digital forensic tools: Recent advances and enhancing the status quo. Forensic Sci. Int.: Digital Invest., 34, 300999, 2020. 35. Patil, A. et al., Roadmap of digital forensics investigation process with discovery of tools, in: Cyber Security and Digital Forensics, pp. 241–269, John Wiley & Sons, Ltd, USA, 2022. 36. Jain, V., Getting familiar with wireshark, in: Wireshark Fundamentals: A Network Engineer’s Handbook to Analyzing Network Traffic, V. Jain, (Ed.), pp. 35–78, Apress, Berkeley, CA, 2022. 37. Javed, A.R. et al., A comprehensive survey on computer forensics: State-ofthe-art, tools, techniques, challenges, and future directions. IEEE Access, 10, 11065–11089, 2022. 38. Arfeen, A. et al., Process based volatile memory forensics for ransomware detection. Concurr. Comput.: Pract. Exp., 34, 4, e6672, 2022. 39. Gilbert, A. and Seigfried-Spellar, K., Forensic discoverability of iOS vault applications. J. Digit. Forensics Secur. Law, 17, 1, 2022. 40. Carneiro, C.R. et al., Application of luminescent markers to ammunition encoding in forensic routine using a Video Spectral Comparator (VSC). Microchem. J., 159, August, 105362, 2020. 41. Tomar, A. et al., Forensic examination of thermal papers using Video Spectral Comparator (VSC) and ATR-FTIR spectroscopy coupled with chemometrics: Non-destructive approach. Spectrochim. Acta Part A, Mol. Biomol. Spectrosc., 260, 119982, 2021. 42. Hay, C.E., Lee, J., Silvester, D.S., An electroanalytical methodology to detect explosive residues using a gelled ionic liquid based field-deployable device. 15, 2020. 43. Fikiet, M.A. et al., Forensics: Evidence examination via raman spectroscopy. Phys. Sci. Rev., 4, 2, 2019.

Future Aspects of Modern Forensic Tools  413 44. Cooman, T. et al., Screening of seized drugs utilizing portable raman spectroscopy and direct analysis in real time-mass spectrometry (DART-MS). Forensic Chem., 25, 100352, 2021. 45. Navin, C.V. et al., Quantitative determinations using portable Raman spectroscopy. J. Pharm. Biomed. Anal., 136, 156–161, 2017. 46. Tai, L.-C. et al., Methylxanthine drug monitoring with wearable sweat sensors. Adv. Mater., 30, 23, 1–8, 2018, Wiley Online Library, Available at: https:// onlinelibrary.wiley.com/doi/abs/10.1002/adma.201707442 (Accessed: 11 March 2022). 47. Vinu Mohan, A.M. et al., [PDF] Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays. | Semantic Scholar, 2017, Available at: https://www.semanticscholar.org/paper/Continuousminimally-invasive-alcohol-monitoring-Mohan-Windmiller/6cd2574a15c5 5e9a854a8a21f93859f40390d20b (Accessed: 11 March 2022). 48. Islam, M.N. et al., SafeBand: A wearable device for the safety of women in Bangladesh, in: Proceedings of the 16th International Conference on Advances in Mobile Computing and Multimedia, pp. 76–83, Association for Computing Machinery (MoMM2018), New York, NY, USA, 2018. 49. Gentry, E. and Soltys, M., SEAKER: A mobile digital forensics triage device. Proc. Comput. Sci., 159, 1652–1661, 2019. 50. Liao, L. et al., An electrochemical biosensor for hypoxanthine detection in vitreous humor: A potential tool for estimating the post-mortem interval in forensic cases. Microchem. J., 155, October 2019, 104760, 2020. 51. Takahashi, F. et al., Simple colorimetric screening of the nerve agent VX using gold nanoparticles and a hand-powered extraction device. Sens. Actuators B: Chem., 327, 128902, 2021. 52. Bruijns, B. et al., Microfluidic devices for forensic DNA analysis: A review. Biosensors, 6, 3, 41, 2016. 53. Tytgat, O. et al., QueSTR probes: Quencher-labeled RNase H2-dependent probes for short tandem repeat genotyping. Sens. Actuators B: Chem., 361, 131714, 2022. 54. Manbohi, A. and Ahmadi, S.H., Portable smartphone-based colorimetric system for simultaneous on-site microfluidic paper-based determination and mapping of phosphate, nitrite and silicate in coastal waters. Environ. Monit. Assess., 194, 3, 190, 2022. 55. Deshmukh, S. et al., A confirmatory test for sperm in sexual assault samples using a microfluidic-integrated cell phone imaging system. Forensic Sci. Int.: Genet., 4973, 20, 102313, 2020.

Index

2,4-dinitroanisole (DNAN), 289 2,6-dipicolonic acid, 277 3D facial reconstruction, 378 3D human interpretation, 90 ABIS (automated ballistic identification system), 378–379 Accelerated solvent extraction, 138 ACE-V (analysis, comparison, evaluation, and verification) method, 111–112 Acid digestion, 135 Active appearance model, 90 Adjusted shutter speed, 319 Aerodynamics, 303–304, 313 AFIS, 376 AFM. see Atomic force microscope (AFM) Age estimation, 344 Ageing fingerprints, analysis of, 275 Alexa Flour 546 fluorophores, 276 American method, 93–94 Ammonium perchlorate, 351–352 Amperometric electrochemical immunosensors, 281 Amplified fragment length polymorphism (AFLP), 228, 238, 242 Analyte 2000, 280 Analytes, antibody-analyte complex, 280 BZE-DADOO as, 275 cocaine, 285 detection of, 267

electrode and, 274 immobilization methodology, 269–273 physiochemical properties of, 267 salivary cortisol, 285 thrombin, 285 type, 269–273 Analytical instruments, 127, 133–144 Analyzer filter, 348 ANDE 4C, 229, 246 ANDE 6C, 229, 246 ANDE, 229, 245, 250 Android, 41, 45, 48–53, 59, 61 Anisotropic type, polarizing microscope, 348 Anthropometry, 108 Anti-blooming structures, 326 Antigen-antibody interactions, 266–268, 275, 276 Anti-theft label, 79 Aperture, of camera, 319 Apparatus, for forensic photography, 321–322 Appearance-based method, 89 Applied biosystems SOLid sequencer, 384 Aptamer-beacon assay, 283, 284, 287 Aptamers, 266, 280, 283 Aptasensors in forensic science, 266, 283–288 electrochemical aptamer biosensing, 287 forensic applications, 287–288

415

416  Index mass-sensitive platform, 287 optical aptamer biosensing, 283–284, 287 Arsenal automated ballistic identification system (ABIS), 378–379 Arsenic, 164 Arsenic-based poison, study of, 281, 282 Arson crime scene, reconstruction of, 340 Arson crime scenes, photography of, 330 Atomic absorption spectroscopy (AAS), 162–165 Atomic emission spectroscopy (AES), 176–178 Atomic fluorescence spectroscopy (AFS), 186–188 Atomic force microscope (AFM), 350–355 biological evidence, analysis of, 352–353 for blood analysis, 352 for human hair analysis, 353 for “touch/trace DNA” analysis, 352–353 chemical evidence, analysis of, 351–352 explosives and shooting scenario analysis, 351–352 firearm and GSR analysis, 351 computerized data, analysis of, 354 physical evidences, analysis of fingerprint analysis, 353–354 soil profiling, 354 textile fabric analysis, 354 question documents, analysis of, 355 Atrazine, 272 Attenuated total reflectance (ATR), 372 Audio video aided forensic analysis, 379 Automated fingerprint identification system (AFIS), automated method of analysis, 113 enhancement and quality assessment, 115–116

feature extraction, 117–118 Henry Faulds classification system, 110–111 history of, 113 introduction, 108–110 latent fingerprint database, 120 latent fingerprint matching, 118, 120 manual method for the identification of latent fingerprint, 111–112 need for automation, 112 overview, 112–113 segmentation, 114–115 ten-digit fingerprint classification, 110 Automated method, 231, 235 Automotive vehicle forensics, live forensics, 71 physical tools for forensic investigation, 73–74 post-mortem forensics, 71–73 B lymphocyte Ped-2E9 cell line, 283 Bacillus anthracis, 277 Backscattered electrons, defined, 349 Bacteria microbiota, growth of, 373 Ballistics, fingerprinting, 362, 363 Benzoylecgonine-1,8-diamino-3,4dioxaoctane (BZE-DADOO), 275 Biochemical signals, 289 Bioengineers, 301 Biohybrid, 300 Bioinspired inlet, 304–305, 313 Biological, 299–302, 307, 309, 311–314 Biological evidence(s), 347–348 AFM in analysis of, 352–353 for blood analysis, 352 for human hair analysis, 353 for “touch/trace DNA” analysis, 352–353 Biological fluids, detection of, 365 Biological warfare agents, 272, 274, 280, 282, 285 Biomacromolecules, 301

Index  417 Biomedical, 300–301, 309–310, 312 Biometric algorithms, 113 Biomimetics, 299–302, 311–312, 314 Bioreceptor, 288 Biosensing, 301, 310, 312–313 Biosensors, 365, 366 different body fluids, 367, 368 no-wash biosensors, 366 RSID, 367 SERATEC® PSA Semiquant, 367 Biosensors, types, 266–267 Bioterrorism, 280, 282 Bite-marks, 340 defined, 342 documentation, 342 Blood analysis, AFM for, 352 Blood samples, 266, 281, 282 Blood stain pattern analysis, 340 Blood, body fluids biosensors, 368 Bloodstain pattern analysis, 226 Blooming, 326 Botulinum neurotoxins, 270 Botulinum toxin A, 279 Brain electrical oscillations signature (BEOS), 379 Brute force, 7 BS-16 bullet, 378 Bulk property detectors, 204 Cabir, 5 CAINE, 400 Camera, digital camera, dynamics of, 322–327 blooming and anti-blooming, 326 CCD camera, 323 CMOS camera, 324 dynamic range, 326 EMCCD camera, 323 frame rate, 327 frame transfer, 325 full frame, 324 ICCD camera, 323–324 interline architecture, 325

light sensitivity and noise cancellation, 326 sensor architecture, 324–325 signal to noise ratio, 326 spatial resolution, 327 spectral response, 325 setup, 321–322 CAN (controller area network), 69 Cancer studies, 343 Capillary electrophoresis, 211–213 CCD (charged-coupled device) camera, 323–326 Cell-based biosensors (CBBs), in forensic science, 282–283 Cell-laden device, 299, 301, 312 Cells, 301, 309–310, 313 Chain termination method, 231, 233–234 Chain termination reaction, 234 Charge transfer channels, 325 Charged-coupled device (CCD) camera, 323–326 Chemical and biological warfare agents, 272, 274, 280, 282 Chemical biological radiological and nuclear attacks, 380 Chemical degradation, 233 Chemical etching, 80–81 Chemical evidence, AFM in analysis of, 351–352 explosives and shooting scenario analysis, 351–352 firearm and GSR analysis, 351 Chemical ionization, 215 Chemiluminescence spectroscopy, 188–189 Chemiluminescence-based immunosensors, 268, 276, 280 Chemotaxis, 303 Chief evidence, 319–320 Child pornography, 13 Chiral derivatized reagents (CDR), 369 Chromatographic data systems (CDS), 370

418  Index Chromatographic methods for illicit drug detection, 274 Chromatographic techniques, 368–369 Chronological records, 17 Circumstantial evidence, 127–129 Clone by clone sequencing method, 231–232, 237 Cloud computing, IaaS, 45–46 PaaS, 45–46 SaaS, 45 Clustering, 114 CMOS (complementary-metal-oxidesemiconductor) camera, 324 CoarseNet, 117 Cocaine, 164, 175 sensors for, 366 Cocaine, detection of, 271, 274, 275, 280, 282, 285, 286, 288 Code red, 4 Codeine, 282 Colloidal gold-labeled antisemenogeline, 367 Colorimetric sensing, 285, 286, 288 Combined DNA index system (CODIS) loci, 245 Comparison microscope, 347–348 Competitive replacement, 287 Complementary-metal-oxidesemiconductor (CMOS) camera, 324 Compound microscope, 345–347 Computerized data, AFM in analysis of, 354 Computerized facial reconstruction method, 94–95 Computerized tomography scanner, applications, forensic pathology, 343–344 forensic profiling – sex and age estimation, 344 Contrast, 327 ConvNet (convolutional neural network) algorithm, 116

Convolutional neural network (CNN), 116, 117 Cortisol, detection of, 287–288 Crime, 302 Crime investigations, trends in, 363–364 Crime scene, reconstruction, 336–338 arson crime scene, 340 firearm shooting, 339–340 Crime scene investigation (CSI) process, 316, 317, 327, 336–337 three-dimensional laser scanners, 338 Crime scene photography, defined, 315, 316 different types of, 327–331 arson crime scenes, 330 homicide photography, 329–330 print impressions at crime scene, 330–331 RTA, photography of, 328–329 skin wound photography, 331 tire marks photography, 331 documentation, 317–319, 327–328 expansion of depth of field, 320–321 filling frame space, 319–320 illuminating dull or low light in pictures, 319 incident light regulation, 319 positioning film plane, 321 rules, 319 Crime scene reconstruction, 299–300, 302, 309–310, 313 Crime scenes, complexity and size of, 318 images of, 318–319 reconstruction, 317 Crime, types, 328 Curse of silence, 6 Cyanazine, 272 Cyanide-based poison, study of, 281 Cyber terrorism, 1 Cynoarcylate fuming, 109

Index  419 Dactyloscopy, 109 DART-MS, 398 Data, analysis, 371–372 collection, 372 Data acquisition, 72 Data analysis process, acquisition, 26 examination, 26 review, 26 utilization, 26 Data interpretation, 236 Data interpretation and analysis, 72–73 Denaturation and visualization, 234 Dental photography, 342 Depth of field (DOF), defined, 319, 320 expansion of, 320–321 Device information, 41, 49, 60–61 DFO, 109 Die stamping/cold working, 80 Differential pulse voltammetry, 286 Differential scale calorimetry (DSC), 354 Digital camera, complete functioning of, 317 different parts of, 322 dynamics of, 322–327 blooming and anti-blooming, 326 dynamic range, 326 frame rate, 327 frame transfer, 325 full frame, 324 interline architecture, 325 light sensitivity and noise cancellation, 326 sensor architecture, 324–325 signal to noise ratio, 326 spatial resolution, 327 spectral response, 325 types, 323–324 CCD camera, 323 CMOS camera, 324

EMCCD camera, 323 ICCD camera, 323–324 use, 318 Digital evidences, 2, 66, 71 Digital forensic, 1–12, 20 Digital forensic investigation process, data analysis, 29 data capture, 29 data identification, 28 data processing, 29 project planning, 28 report generation, 29 Digital photography, 316–317 Digital probe, 2 Dinitrotoluene (DNT), 288 Dinophysistoxins, 269 Direct evidences, 127 Direct immunosensing strategies, 267–275 EIS, 274–275 piezoelectric immunosensors, 268, 275 SPR, 268–274 Direct ionization probe, 214 Disk forensics, 3 Dispersive liquid-liquid microextraction (DLLME), 141 Distillation, 135 Dithiothereitol, 282 DJI, 382 DNA, 1 DNA fingerprinting, 363, 382 DNA phenotyping, 383 DNA sequencing, 384 DNA sequencing and rapid DNA tests, DNA, 230–231 DNA profiling analysis methods, 228 DNA sequencing, 226–228, 231–238 automated method, 231, 235 chain termination method or Sanger’s sequencing, 231, 233–234 clone by clone sequencing method, 231–232, 237

420  Index Maxam and Gilbert method, 227–228, 231–233, 243 next-generation DNA sequencing, 232, 238 pyrosequencing method, 236–237 semiautomated method, 232, 235–236 whole-genome shotgun sequencing method, 231, 237–238 laboratory processing and DNA evidence analysis, 238–243 amplified fragment length polymorphism (AFLP), 228, 242 mitochondrial DNA (mt-DNA), 241–242 polymerase chain reaction (PCR), 239–240 restriction fragment length polymorphism, 239 short tandem repeats (STR), 241 Y chromosome, 242–243 rapid DNA test, 228–229 evolution of, 244–245 instrument, 245–246 methodology of, 250 DNA-based biosensors, 266, 282–283 DOCUBOX HD Projectina, 375 Documentation, bite-mark, 342 crime scenes, 317–319 homicide scene, 330 Domoic acid, 269 Dope tests in sports, 365 Drone forensics, 74–76 Drones, 364, 380–382 Drug addiction, 373 Drug testing toxicology of hair, 372–373 DSLR (digital single lens reflex) camera, 322 Duh, 6

Dusting powder, 109 Dynamic range of camera, 326 ECCO 2 LIBS elemental analysis elementary comparator, 373 Ecstasy, detection for, 274, 275, 281 EDNA, 383 Eigen face, 89 Electrical conductivity detector (ECD), 210 Electrochemical aptamer biosensing, 287 Electrochemical immunosensors, 268, 276, 280–282 amperometric, 281 application of, 280 characteristics of, 280 potentiometric, 281 voltammetric, 282 Electrochemical impedance spectroscopy (EIS), 268, 274–275 Electrochemical sensing, 286 Electroencephalogram (EEG) method, 379 Electrolytic etching, 81 Electron capture detector (ECD), 206 Electron channeling contrast, 81 Electron ionization, 214–215 Electron microscopes, 349–350 SEM, 349–350 TEM, 350 Electron multiplying charge coupled device (EMCCD) camera, 323 Electron spins resonance (ESR) spectroscopy, 171–173 Electronic control unit (ECU), 69 Electronic serial number (ESN), 6 Electro-osmosis flow, 211 Electrophoretic mobility, 211 Electrospray ionization, 215 Electrostatic detection analysis (ESDA), 374–375 Embossing, 80

Index  421 Emerging analytical techniques in forensic samples, inductively coupled plasma-mass spectrometry, 220–221 introduction, 199–200 laser ablation–inductively coupled plasma-mass spectrometry, 221–222 mass spectrometry, 213–219 separation techniques, 200–213 capillary electrophoresis, 211–213 gas chromatography, 202–208 liquid chromatography, 208–211 tandem mass (MS/MS), 219 Emission guns, 350 Emulsion film photography, 322 End labeling, 232 Engraving, 80 Enhancement algorithm, 116 Enzymatic biosensors, 266–267 in forensic science, 288–289 Enzyme linked immunosorbent assay (ELISA), 266 Escherichia coli, 276, 289 Ethylene diamine, 277 Evidence(s), chief, 319–320 photographic, 317 biological, 347–348 Evolution of network data analysis tools over the years, 37 Exemplar prints, 111 Exhibits, 377 Expiration, 303–304, 306 Explosive(s), analysis, AFM for, 351–352 chemical evidences of, 350 Explosives, detection of, 273, 274, 281, 282, 286, 288, 289, 365 Face marks, 97 Face recognition in video, 98 Facial aging, 96

Facial recognition, 377–378 application areas, 100–101 challenges in, 95 forensic sketch recognition, 97–98 near infrared (NIR) face recognition, 99 definition and concept, 86–87 introduction, 86 soft biometrics, 99 techniques for, 88 image-based facial recognition, 88–91 video-based facial recognition, 89, 91–92 Facial reconstruction, application of, 101 definition and concept, 86–87 introduction, 86 techniques for, 92 computerized method, 94–95 graphical method, 94 manual method, 93–94 Facial reconstruction, 3D, 378 Fast atom bombardment, 215 Federal Bureau of Investigation (FBI), 376 Federal motor vehicle safety certification label, 79 Fiber optic sensor, 280 Filling frame space, 319–320 Film plane, positioning, 321 FineNet, 117 Fingerprint, drugs, 155–156 examination, 166–167, 169, 185 Fingerprint analysis, AFM for, 353–354 Fingerprint classification, 109 Fingerprint photography, 330–331 Fingerprinting, ballistic, 363 DNA, 363, 382

422  Index question document and, 373–376 ESDA, 374–375 video spectral comparator, 375 Fingerprints, ageing, 275 Fire residues, 350 Firearm shooting crime scene, reconstruction of, 339–340 Firearm, analysis, 351 Flame ionization detectors (FID), 205 FlexPlex27, 245 FlexRay, 70 Fluorescence detector, 210 Fluorescence spectroscopy, 181–183 Fluorescence-based immunosensors, 268, 276 Fluorescent tagging, 235 Fluorometric sensing, 285 Fluorophore, 284, 287 Footwear impressions, spatial representation of, 341–342 FORAM 3 6852 Raman spectrometer for QDE applications, 374 Forensic biology, 382–385 three-dimensional imaging system, 385 virtopsy, 384–385 Forensic chemistry, 365–373 chromatographic techniques, 368–369 drug testing toxicology of hair, 372–373 FTIR spectroscopy, 372 GC-MS, 369–370 HPLC, 370, 371 LC/MS/MS rapid toxicology screening system, 370–372 sensors, 365–368 Forensic device, classification of, 364–385 ESDA, 374–375 fingerprinting, 376 forensic biology, 382–385 forensic chemistry, 365–373 forensic physics, 377–382

question document and fingerprinting, 373–376 video spectral comparator, 375 recent, 364 Forensic microbiome database, 399 Forensic pathology, 343–344 Forensic photography, camera setup and apparatus for, 321–322 crime scene photography, 327–331 (see also Crime scene photography) arson crime scenes, 330 homicide photography, 329–330 print impressions at crime scene, 330–331 RTA, photography of, 328–329 skin wound photography, 331 tire marks photography, 331 CSI process, 316, 317, 327 digital camera, dynamics of, 322–327 blooming and anti-blooming, 326 CCD camera, 323 CMOS camera, 324 dynamic range, 326 EMCCD camera, 323 frame rate, 327 frame transfer, 325 full frame, 324 ICCD camera, 323–324 interline architecture, 325 light sensitivity and noise cancellation, 326 sensor architecture, 324–325 signal to noise ratio, 326 spatial resolution, 327 spectral response, 325 objective, 316 origin of, 316 overview, 316 principles, 318–319 purposes, 316–318 rules, 319–321

Index  423 expansion of depth of field, 320–321 filling frame space, 319–320 positioning film plane, 321 technique, 316 Forensic physics, 377–382 3D facial reconstruction, 378 arsenal ABIS, 378–379 audio video aided forensic analysis, 379 BEOS, 379 drones/UAVs, 380–382 facial recognition, 377–378 phenom desktop SEM, 379–380 x-ray spectroscopy EDX, 380 Forensic profiling, sex and age estimation, 344 Forensic sampling and sample preparation, advancement in technologies, 126–127 collection of evidences, 129–133 evidences, 127–129 introduction, 126 sample preparation techniques for analytical instruments, 133–144 Forensic science, 1–6 advances in, 362–363 aptasensors in, 266, 283–288 electrochemical aptamer biosensing, 287 forensic applications, 287–288 mass-sensitive platform, 287 optical aptamer biosensing, 283–284, 287 enzymatic biosensors in, 288–289 genosensors and cell-based biosensors in, 282–283 immunosensors in, 267–282 direct immunosensing strategies, 267–275 indirect immunosensing strategies, 267, 268, 276–282

microbe/pathogen sensing in, 266 microscopes in, AFM, 350–355 comparison microscope, 347–348 compound microscope, 345–347 electron microscopes, 349–350 light microscopes, 345–349 overview, 336–337 polarizing microscope, 348 probing microscopes, 350–355 purpose of using, 344–345 SEM, 349–350 stereoscopic microscopes, 348–349 TEM, 350 overview, 266–267 scanners in, computerized tomography scanner, 343–344 intraoral optical scanners, 342–343 structured light scanners, 341–342 three-dimensional laser scanners, 338–341 types, 337 techniques, 363 Forensic tools, recent advances in, classification of, 364–385 ESDA, 374–375 fingerprinting, 376 forensic biology, 382–385 forensic chemistry, 365–373 forensic physics, 377–382 question document and fingerprinting, 373–376 video spectral comparator, 375 future perspectives, 385–386 overview, 362–364 recent forensic device, 364 trends in crime investigations, 363–364 Forensic volatolomics, 398

424  Index Forwarding link, 47, 51–55, 58 Fourier resonance energy transfer (FRET), -based aptasensor assay, 287 -based immunosensors, 268, 276 Frame rate, of digital camera, 327 Frame space, filling, 319–320 Frame transfer architectures, 325 Francisella tularensis, 278 FTE (failure to enroll), 115 FTIR (Fourier transform infrared) spectroscopy, 165–167, 372 FTR (failure to register), 115 Full-frame sensor architecture, 324 Gas chromatography, 202–208, 214 Gas chromatography (GC), in forensic science, 369–370 Gel electrophoresis, 233, 235, 236 Generic domain, 69 Genosensors, defined, 266 in forensic science, 282–283 Geolocation, 41, 53, 61 Gobor filter, 116 Gonyautoxins, 269 GPS (global positioning system), 9 GPS forensics, 73–74 Graphical facial reconstruction method, 94 Ground control systems (GSC), 380 GS-FLX 454 sequencer workflow, 384 Gun shot residue (GSR) analysis, 351 Gunshot residue, detection of, 365 Gunshot residues (GSR), 163–164, 166–167 Hair analysis, 372–373 Hair strands, 347–348 Handwriting analysis, 373–374 Heat denaturation, 234, 235 Heat treatment, 81 Heroin, sensors for, 366

High dynamic range (HDR) images, 326 High performance liquid chromatography (HPLC), 208–213, 288, 370, 371 Histogram of oriented gradients (HOG), 90–91 HMTD (hexamethylene triperoxide diamine), 170 Hollow fiber liquid phase microextraction (HF-LPME), 141 Homicide photography, 329–330 Hot stamping, 80 Human hair analysis, AFM for, 353 Hybridized DNA displacement assay, 283, 284, 287 Hydrogen-deuterium lamp, 159 Hyperfocal focus, 321 IAFIS (integrated automated fingerprint identification system), 109 ICCD (image intensified CCD) camera, 323–324 ICT – information and communication technology, 2 Ikee, 6 Illicit drugs, analytical quantifying method of, 372–373 detection of, 365, 366, 369, 370 sensors for, 365, 366 Illicit drugs, detection, 271, 274, 275, 280, 282, 285, 288 Illumina genome analyzer, 384 Illuminating dull or low light in pictures, 319 Image intensified CCD (ICCD) camera, 323–324 Image-based facial recognition, 88–91 Images of crime scene, 318–319 Immunoassaying techniques, 373 Immunoassays, 266

Index  425 Immunosensors in forensic science, 267–282 direct immunosensing strategies, 267–275 EIS, 274–275 piezoelectric immunosensors, 268, 275 SPR, 268–274 indirect immunosensing strategies, 267, 268, 276–282 electrochemical immunosensors, 280–282 optical immunosensors, 268, 276–280 Incident light regulation, 319 Indirect immunosensing strategies, 267, 268, 276–282 electrochemical immunosensors, 280–282 amperometric, 281 application of, 280 characteristics of, 280 potentiometric, 281 voltammetric, 282 optical immunosensors, 268, 276–280 Indirect method enantiomers, 369 Inductively coupled plasma-mass spectrometry, 220–221 Information security, 1, 10 Infotainment system, 66, 67, 73, 82 Infrared spectroscopy (IR), 165–167, 354 Infrastructure domain, 68 Innovative ion-selective field effect transistor (ISFET)-based enzymatic biosensor, 289 Inspiration, 303–306, 313 Insurance fraud, 67 Integrated ballistic systems, 364 Interline architecture, 325 International mobile equipment identifier (IMEI), 9

International Standard Organization (ISO), 363 Internet of Things, 400 Intraoral optical scanners, 342–343 applications, 342–343 Iodine fuming, 109 Ion mobility spectrometric, 305 Ionization mass spectrometer, 305 IP address, 41, 44–45, 49, 52–53, 58–61 iPhone, 41, 49, 53, 59–60 iplogger, 49, 51–53, 59 Isotropic type, polarizing microscope, 348 iVE, 73 JAVA EE7, 383 JAVA server FACES 2.2, 383 Kernel-based approaches, 89 Klystron tube, 171 Lab solutions insight library screening, 372 L-adenosine, 283 Laser ablation–inductively coupled plasma-mass spectrometry, 221–222 Laser etching, 80 Laser scanners, three-dimensional, 338–341 applications, 339–341 blood stain pattern analysis, 340 post-mortem analysis, 340–341 reconstruction of arson crime scene, 340 reconstruction of firearm shooting crime scene, 339–340 benefits, 338 drawbacks, 338–339 Laser-induced breakdown spectroscopy (LIBS), 373 Latent fingerprinting databases, 119 Lateral flow biosensing, 285

426  Index Lens flares, avoiding, 320 Ligature impressions, 340 Light detection and ranging (LIDAR), 338 Light microscopes, 345–349 comparison microscope, 347–348 compound microscope, 345–347 polarizing microscope, 348 stereoscopic microscopes, 348–349 Light sensitivity, 326 LIN (local interconnect network), 70 Link analysis software, 364 Liquid chromatography, 214, 208–211 Liquid chromatography (LC/MS/ MS) rapid toxicology screening system, 370–372 Liquid phase microextraction (LPME), 140–141 Liquid-liquid extraction, 134–135 Listeria monocytogenes, 276 Live forensics, 71 L-nicotine, 307, 314 Local binary patterns (LBP), 91 Locard’s exchange principle, 266 Lux, of camera, 326 MAC (modified, accessed, created), 4 Magnetic particle method, 81 Magnetic powder, 109 Magnetic resonance imaging, 306 MALDI (matrix-assisted laser desorption/ionization), 216 Malware attacks, 402 Manchester method, 93–94 MANET (mobile ad hoc network), 68 Manual facial reconstruction method, 93–94 Marijuana, sensors for, 366 Mass analyzers, 216–219 Mass spectrometer, 207 Mass spectrometer (MS), in forensic science, 369–372 Mass spectrometry, 213–219

Massive parallel sequencing (MPS), 384 Mass-sensitive platform of aptasensors, 287 Materials sciences, 300 Matrices, 133, 135 Maxam and Gilbert method, 226–228, 231–233, 243 MDMA (3,4-methylenedioxymethamphetamine), 271 Mechanical, 299–301, 303, 305–307, 309, 312–313 Membrane extraction, 143–144 Memory forensics, 4 Mercaptohexanol, 282 Metadata, 4 Methamphetamine, 274, 275, 281, 286, 288 Michelson Interferometer, 165–166 Microbe/pathogen sensing, 266 Microbial detection in forensic science, 276 Microcantilever assay, 287 Microcystin, 270 Microextraction by packed sorbent (MEPS), 142 Microextraction, 139–144 Microscope stage, 346 Microscopes, electron microscopes, 349–350 SEM, 349–350 TEM, 350 light microscopes, 345–349 comparison microscope, 347–348 compound microscope, 345–347 polarizing microscope, 348 stereoscopic microscopes, 348–349 overview, 336–337 probing microscopes, AFM, 350–355 purpose of using, 344–345 Microwave digestion, 138

Index  427 Mitochondrial DNA (MT-DNA) analysis, 239, 241–242 MNS 4.1, 280 Mobile domain, 68 Mobile forensics, 402 Mobile identification number (MIN), 6 Model-based face recognition technique, 90 Module transfer function (MTF), 327 Molybdenum disulphide, 288 Monochromators, 156–157, 163, 165–166 Morphine, 274, 282 sensors for, 366 Morphine-3-glucoronide, 271 MOST (media oriented system transport), 70 Motorola droid, 11 MS (mass spectrometer), in forensic science, 369–372 Multi metal deposition, 109 Multimedia messaging service (MMS), 6 Mylar film, 374 Nanodevices, 309–310, 313 Nanophosphors, 394 National Forensic Science University, 363 Near infrared (NIR) face recognition, 99 Necessity for data analysis, data acquisition, 25 data recovery, 25 log monitoring, 25 operational troubleshooting, 25 Neodymium yttrium aluminum garnet laser, 221 Neosaxitoxin, 269 Netfox, 7 Network security and forensics, 26, 27 Next-generation DNA sequencing, 232, 238 Ninhydrin, 109

Nitroreductase enzyme, 289 Nocardioides strain, 289 Noise, of camera, 326 Non-destructive method, 155, 166, 169 Non-invasive, 299, 311 Non-linear appearance-based method, 89 Non-porous substrates, 109 No-wash biosensors, 366 Nuclear magnetic resonance (NMR), 354 Nuclear magnetic resonance (NMR) spectroscopy, 173–176 Odontology, 342 Oil red O, 109 Okadaic acid, 269 Onboard units (OBU), 69 Open flash approach, 330 Opening the forwarded link, 51–53, 56–59 Operating systems, 363–364 Optical aptamer biosensing, 283–284, 287 Optical sensing strategies, 268, 276–280 Painting with light, 319 Palm or foot prints, photography, 330–331 Palytoxin, 269 Parrot, 382 Personal identification number (PIN), 9 Personal unlock key (PUK), 9 PET (poly ethylene terephthalate), 354 Phenom desktop SEM, 379–380 Phosphorescence spectroscopy, 184–186 Photo diode array (PDA), 210 Photo ionization detector (PID), 206 Photography, forensic. see Forensic photography

428  Index Photomultiplier tubes (PMT), 163, 182, 184, 185, 189 Physical evidences, 302 Physical evidences, AFM in analysis of, fingerprint analysis, 353–354 soil profiling, 354 textile fabric analysis, 354 Physical tools for forensic investigation, 73–74 Physiological, 301, 304–305, 307, 309–310 PIA-7 software, 375 Piezoelectric cantilever sensing, 286 Piezoelectric immunosensors, 268, 275 Pin stamping, 80 Point cloud, for scanner, 338, 342 Poison dosage, analytical quantifying method of, 372–373 Polarizer filter, 348 Polarizing microscope, 348 Poly ethylene terephthalate (PET), 354 Polymerase chain reaction (PCR), 382–384 Polymerase chain reaction (PCR) analysis, 238–240 Polyurethane foam, 304, 306 Pore-based ridge reconstruction, 117 Porous substrates, 109 Positioning film plane, 321 Post-mortem analysis, 340–341 Post-mortem forensics, 71–73 Potentiometric electrochemical immunosensors, 281 Prefocus, 321 PRIME FACES 5.2, 383 Primer annealing, 234 Principle component analysis (PCA) method, 89 Print impressions at crime scene, photography of, 330–331 Privacy concerns, 44 Private information, 41–42, 44, 48–49, 53, 58, 60

Probing microscopes, AFM, 350–355 biological evidence, analysis of, 352–353 chemical evidence, analysis of, 351–352 computerized data, analysis of, 354 physical evidences, analysis of, 353–354 question documents, analysis of, 355 Programmable temperature vaporizer injection system (PTV), 204 Progressive scan, defined, 324 Prostate-specific antigen (PSA), 367, 368 Protein-induced fluorescence enhancement (PIFE), 287 Pyrosequencing method, 236–237 Quantum efficiency (QE), 325 Quartz crystal microbalance (QCM), 287 QuEChERS, 143 Quencher, 284, 287 Question document and fingerprinting, 373–376 ESDA, 374–375 video spectral comparator, 375 Question documents, AFM in analysis of, 355 QueSTR, 408 Ractopamine, 271 Radio immunoassay (RIA), 266 Raman spectroscopy, 167–171 Raman spectroscopy principle, 374 Rapid DNA test, 228–229 evolution of, 244–245 instrument, 245–246 methodology of, 250 Rapid stain identification series (RSID), 367 Rapid toxicology screening system, LC/MS/MS, 370–372

Index  429 RapidHit® ID, 229, 246 Reciprocal exposure, use of, 321 Reconstruction, 3D facial, 378 Reconstruction, crime scene, 317, 336–338 arson crime scene, 340 firearm shooting, 339–340 Reduced graphene oxide (rGO) sensor, 288 Refractive index detector, 210 Reporting, 73–74 Resale and export, 67 Restriction enzyme digestion, 232–233 Restriction fragment length polymorphism (RFLP), 238, 239 Road traffic accidents (RTA), photography of, 328–329 ROI segmentation, 114–115 R-RANSAC, 116 Saliva sample, 271, 280, 281, 287 Saliva, body fluids biosensors, 368 Salivary cortisol, 285, 287 Salmonella enterica, 276 Salmonella typhimurium, 276 Sample injection, 203 Sample matrices and different extraction methods, 134 Sampling methods, 130–133 Sandwich electrochemical aptasensors, 287 Sanger sequencing, 384 Sanger’s sequencing, 231, 233–234 Saxitoxin, 269, 270 Scale-invariant feature transform (SIFT), 91 Scanners, computerized tomography scanner, applications, 343–344 forensic pathology, 343–344 forensic profiling – sex and age estimation, 344 intraoral optical scanners, 342–343 applications, 342–343

overview, 336–337 point cloud for, 338, 342 software of, 339, 342 structured light scanners, 341–342 advantage, 341 miscellaneous applications, 342 spatial representation of footwear impressions, 341–342 three-dimensional laser scanners, 338–341 applications, 339–341 benefits, 338 blood stain pattern analysis, 340 drawbacks, 338–339 post-mortem analysis, 340–341 reconstruction of arson crime scene, 340 reconstruction of firearm shooting crime scene, 339–340 types, 337 Scanning electron microscope (SEM), 349–350 phenom desktop, 379–380 Schlieren imaging, 304, 305 SegFinNet, 115 Self-assembled monolayers (SAMs), 282 Self-care, 329 Semen, body fluids biosensors, 368 Semenogeline colloidal gold anticomplex, 367 Semiautomated method, 232, 235–236 Sensitivity of camera, 326 Sensor architecture, 324–325 frame transfer, 325 full frame, 324 interline architecture, 325 Sensor-based devices for trace evidence, aptasensors, 283–288 electrochemical aptamer biosensing, 287 forensic applications, 287–288 mass-sensitive platform, 287 optical aptamer biosensing, 283–284, 287

430  Index enzymatic biosensors, 288–289 genosensors and cell-based biosensors, 282–283 immunosensors, 267–282 direct immunosensing strategies, 267–275 indirect immunosensing strategies, 267, 268, 276–282 overview, 266–267 Sensors, 299–302, 307–308, 310–312, 314 Sensors, in forensics science, 365–368 biosensors, 365, 366 different body fluids, 367, 368 no-wash biosensors, 366 RSID, 367 SERATEC® PSA Semiquant, 367 for illicit drugs, 365, 366 Sequence determination, 233–235 Sequence-based method, 91–92 Serial number restoration, 79–81 Set-based method, 92 Sex, estimation of, 344 Sexual assault, 1 Shooting scenario analysis, AFM for, 351–352 Short message service (SMS), 6 Short tandem repeats (STR), 241 Short tandem repeat (STR) units, 363, 382, 384 Short-time fourier transform (STFT), 116 Shutter speed, defined, 319 Signal to noise ratio (SNR), of digital camera, 326 Silicon, 93 Silver nitrate, 109 Simazine, 272 Single drop microextraction (SDME), 140–141 Sketch recognition, 96–98 Skin wound photography, 331

Skulls, 5 Slueth kit, 400 Smart actuator, 300, 312 Smear formation, 324 Snapshot, 4 Sniffing, 302–306, 313–314 Social network chat (SNC) applications, Facebook messenger, 47, 50–52, 54–59 hangouts, 48, 50–59 hike, 50–52, 54–59 linkedIn, 42, 43, 47, 50–52, 54–59 snapchat, 50–52, 54–59 telegram, 50–52, 54–59 twitter, 42–43, 45, 47, 50–52, 54–59 whatsapp, 43, 47, 50–59 Social networking, 41–44, 49 Software, 363–364 Software of scanners, 339, 342 Soil profiling, AFM for, 354 Solid phase extraction (SPE), 136–137 Solid phase microextraction (SPME), 139–140 Solvent extraction, 134–138 Soxhlet extraction, 137–138 Spatial resolution of camera, 327 Spatio-temporal sequence-based methods, 92 Specific property detector, 205 Spectral response of light, 325 Spectrometer, 151, 304–306, 313 Spectroscopic analysis techniques, introduction, 150 spectroscopic techniques and their forensic applications, 156–189 atomic absorption spectroscopy, 162–165 atomic emission spectroscopy, 176–178 atomic fluorescence spectroscopy (AFS), 186–188

Index  431 chemiluminescence spectroscopy, 188–189 electron spins resonance (ESR) spectroscopy, 171–173 fluorescence spectroscopy, 181–183 infrared spectroscopy, 165–167 nuclear magnetic resonance (NMR) spectroscopy, 173–176 phosphorescence spectroscopy, 183–186 Raman spectroscopy, 167–171 UV/visible spectroscopy, 159–162 x-ray absorption spectroscopy, 156–159 x-ray fluorescence spectroscopy (XRF), 178–181 spectroscopy, 150–152 and forensics, 155–156 and its applications, 153–155 Split injection, 203 Splitless injection, 204 SQL slammer, 4 Stereoscopic microscopes, 348–349 Stimuli, 300, 309, 312 Stir-bar sorptive extraction (SBSE), 141–142 Structured light scanners, 341–342 advantage, 341 applications of, miscellaneous applications, 342 spatial representation of footwear impressions, 341–342 Supercritical fluid extraction, 142–143 Support-coated open tubular (SCOT), 204 Surface acoustic wave (SAW), 287 Surface plasmon resonance (SPR), 268–274, 276 Surveillance applications, 86 Symbian, 5 Synchrotron radiation, 156–157

Tandem mass (MS/MS), 219 Target-induced displacement (TID), 287 Target-induced structure switching (TISS), 287 Teeth casts, 342 Temporal technique, 91 Tetramethylbenzidine (TMB), 282 Tetrodotoxin, 270t Textile fabric analysis, AFM for, 354 Textile fabrics, 347–348 Texture-based face recognition technique, 90–91 Theranostics, 310 Therapeutic, 300–301, 309–311 Thermal conductivity detector (TCD), 205 Thioflavin T (ThT), 280 Three-dimensional imaging system, 385 Three-dimensional laser scanners, 338–341 applications, 339–341 blood stain pattern analysis, 340 post-mortem analysis, 340–341 reconstruction of arson crime scene, 340 reconstruction of firearm shooting crime scene, 339–340 benefits, 338 drawbacks, 338–339 Thrombin, 285, 287 Tire marks photography, 331 TNT, 299, 302, 305–308 TNT (2,4,6-trinitrotoluene), 273, 281, 286, 288, 289 Tool marks, 340 Tools for network and data analysis, CAINE, 35 cellebrite UFED, 31 computer online forensic evidence extractor (COFEE), 34

432  Index digital forensic framework (DFF), 32 e-Fensee, 36 EnCase forensic imager tool, 30 forensic imager txt, 32 FTK imager tool, 31 magnet RAM capture, 35 oxygen forensics detective, 33 paladin forensic suite, 32 ProDiscover forensics, 34 SANS investigative forensic toolkit (SIFT), 33 Sleuth kit, 35 tableau TD2U forensic duplicator, 32 Win Hex, 33 WindowsSCOPE toolkit, 34 WireShark tool, 36 xplico, 36 x-ways forensics, 36 Touch DNA, 383, 384 Touch/trace DNA analysis, AFM for, 352–353 Toxicology of hair, drug testing, 372–373 Toxins, analytical quantifying method of, 372–373 Toxins, detection of, 269–270, 274, 282 Trace evidence, applications of enzymatic biosensors for, 289 in forensic science (see Forensic science) role, 266 Trace evidences, 299, 302 Transducing, 300, 312 Transmission electron microscope (TEM), 350 Trauma, studies, 343 Triamino-trinitro-benzene, 351–352 Tumor, 300, 312 Tungsten, 159, 162

Two-dimensional model-based face recognition method, 90 Ultra-high performance liquid chromatography (UHPLC), 370 Ultraviolet (UV) light imaging in forensic science, 331 Ultrasonication-assisted extraction, 139 Ultraviolet (UV) tools, 374 Unmanned aerial vehicle forensics (UAV), 74–76 Unmanned aerial vehicles (UAVs), 380–382 Urine samples, 266, 271, 275, 280, 281 Urine, body fluids biosensors, 368 User agent, 46–49, 52–53, 58–60 User information, 41–42, 60 UV VIS detector, 210 UV/visible spectroscopy, 159–162 Vacuum metal deposition, 109 Vehicle forensics, classification of, 70–77 intervehicle communication and vehicle internal networks, 68–70 introduction, 65–67 motives behind vehicular theft, 67–68 serial number restoration, 79–82 VIN (vehicle identification number), 77–79 Vehicle internal networks, 69–70 Vehicular ad hoc networks (VANETs), 68–70 Video spectral comparator, 375 Video-based facial recognition, 89, 91–92 VIN (vehicle identification number), 67, 76–77 placement in a vehicle and usage of, 77 vehicle identification, 78–79 Virtopsy, forensic science, 384–385

Index  433 Visible light (VIS) images, 99 Voltammetric electrochemical immunosensor, 282 VT-x technology, 4

White balance, 319, 322 Whole-genome shotgun sequencing method, 231, 237–238 Witty, 4

Wall coated open tubular (WCOT), 204 Warfare agents, chemical and biological, 272, 274, 280, 282 Wearable devices, 405 Web defacement, 1 WebView, 48, 51–52, 59–60 Wehnelt cylinder reforms, 350

Xenon arc, 182 X-ray fluorescence spectroscopy (XRF), 156–159, 178–181 X-ray spectroscopy EDX, 380 Y-chromosome analysis, 239, 242–243 Zone focus, 321

WILEY END USER LICENSE AGREEMENT Go to www.wiley.com/go/eula to access Wiley’s ebook EULA.