The Human Organism: Explorations in Biological Anthropology [1st ed.] 978-1631894534, 1631894536

Citation preview

THE HUMAN ORGANISM Explorations in Biological Anthropology FIRST EDITION

By Elizabeth Weiss San Jose State University

Bassim Hamadeh, CEO and Publisher Michael Simpson, Vice President of Acquisitions Jamie Giganti, Managing Editor Jess Busch, Senior Graphic Designer Kristina Stolte, Acquisitions Editor Michelle Piehl, Project Editor Alexa Lucido, Licensing Assistant Claire Yee, Interior Designer Copyright © 2015 by Cognella, Inc. All rights reserved. No part of this publication may be reprinted, reproduced, transmitted, or utilized in any form or by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information retrieval system without the written permission of Cognella, Inc. First published in the United States of America in 2015 by Cognella, Inc. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Cover images: Copyright © 2012 Depositphotos Inc./lhfgraphics. Copyright © 2011 Depositphotos Inc./Morphart. Copyright © 2012 Depositphotos Inc./jumpingsack. Copyright © 2012 Depositphotos Inc./Morphart. Printed in the United States of America ISBN: 978-1-63189-453-4(pbk)/ 978-1-63189-454-1(br)

CONTENTS INTRODUCTION

VII

SECTION 1: UNDERSTANDING EVOLUTIONARY CONCEPTS Chapter 1: Evidence of Evolution Introduction Learning Objectives History of Evolutionary Theory Understanding Natural Selection Evidence of Evolution Types of Selection Summary Glossary Reading 1 1. Origin of Species, 1st Edition. Chapter XIII: Morpholog y, Embryolog y; Rudimentary Organs

1 1 1 2 6 7 10 12 13 14 15

Charles Darwin

Chapter 2: Mendelian Genetics and the Modern Synthesis

29

Introduction Learning Objectives Mendelian Genetics Non-Mendelian Patterns of Inheritance Modern Synthesis Summary Glossary Reading 2 2. Effects of Sexual Dimorphism on Facial Attractiveness

29 29 30 33 34 37 38 40 41

D. I. Perrett, K. J. Lee, I. Penton-Voak, D. Rowland, S. Yoshikawa, D. M. Burt, S. P. Henzi, D. L. Castles, and S. Akamatsu

Chapter 3: DNA and Molecular Anthropology Introduction Learning Objectives Cells and DNA Cell Division Protein Synthesis Molecular Anthropology Summary

49 49 49 50 51 53 55 58

Glossary Reading 3 3. Evolution in the Everyday World

58 60 61

David Mindell

SECTION 2: PRIMATES Chapter 4: Living Primates Introduction Learning Objectives General Primate Characteristics Prosimians Tarsiers Anthropoids Using Primates as Models for Human Evolution Summary Glossary Reading 4 4. Sexual Selection, Multiple Mating and Paternity in Grey Mouse Lemurs, Microcebus Murinus

73 73 73 74 76 78 79 88 90 90 92 93

Ute Radespiel, Valentina Dal Secco, Cord DröGemüller, Pia Braune, Elisabeth Labes & Elke Zimmermann

Reading 5 5. Chimpanzee Ai and Her Son Ayumu: An Episode of Education by Master-Apprenticeship

108 109

Tetsuro Matsuzawa

Reading 6 6. How Deep Is Your Love? Human Morality and the Question of Altruism Among Nonhuman Primates

118 119

Kenneth Krause

SECTION 3: HUMAN EVOLUTION Chapter 5: Our Earliest Humans Introduction Learning Objectives Fossils Types of Fossils in the Hominid Record Dating Fossils What Makes Hominids Different from Other Apes? Contenders for the Earliest Hominid Australopithecines Early Homo Species and the First Stone Tools Oldowan Tools Summary Glossary Reading 7 7. Early Hominids—Diversity or Distortion?

127 127 127 128 129 129 130 134 135 141 143 143 144 146 147

Tim White

Chapter 6: Humans Disperse: Homo erectus and Sibling Species Introduction

151 151

Learning Objectives Homo erectus Discoveries Homo erectus and Homo ergaster Earliest Fossils Outside of Africa Homo antecessor Summary Glossary

151 152 154 156 156 158 159

Chapter 7: Almost Ourselves: Archaics and the Arrival of Homo sapiens sapiens

161

Introduction Learning Objectives Homo heidelbergensis African Archaic Homo sapiens (400–125 KYA) Asian Archaic Homo sapiens (350–130 KYA) European Archaic Homo sapiens (400–150 KYA) Neanderthals (130–30 KYA) Origins of Anatomically Modern Humans Summary Glossary Reading 8 8. The Multiregional Evolution of Humans

161 161 162 163 163 164 164 168 170 171 172 173

Alan G. Thorne and Milford H. Wolpoff

Reading 9 9. Human Origins: Out of Africa

186 187

Ian Tattersall

SECTION 4: MODERN HUMAN VARIATION Chapter 8: Modern Human Variation

197

Introduction Learning Objectives Human Variation Human Adaptation Human Life Cycle Summary Glossary Reading 10 10. Understanding Race and Human Variation: Why Forensic Anthropologists Are Good at Identifying Race

197 197 198 200 204 208 209 210 211

Stephen Ousley, Richard Jantz, and Donna Freid

Reading 11 11. Change We Can Believe In: “Race” and Continuing Selection in the Human Genome

228 229

Kenneth W. Krause

Reading 12 12. The Evolution of Light Skin Color: Role of Vitamin D Disputed

234 235

Ashley H. Robins

IMAGE CREDITS

243

INTRODUCTION

T

he purpose of this volume is twofold. Many college students, and perhaps yourself, take human evolution introduction courses to fulfill a General Education requirement; thus, these students are not necessarily keen on the topic prior to enrollment, and you (and many others) may wonder what human evolution has to do with your major, or your day-today life, which brings me to the first purpose of this anthology. I hope to not only demonstrate that studying evolution is relevant to your life, but also that you might pass your knowledge on to others. Understanding evolutionary concepts can help one make informed health decisions, improve relationships, and to better understand fellow humans. Furthermore, evolutionary concepts are utilized in forensics (e.g., DNA analyses of crime scenes and victim identification through skeletal remains); medicine (e.g., gearing medicine to individuals based on their biology and learning of the ways that pathogens are transmitted from species to species); psychology (e.g., understanding why we judge people based on appearance and who we are attracted to); and many other applications. One does not have to become an anthropologist to utilize knowledge of evolution in his or her life; one must just be human. The second purpose of this book is to stimulate critical thinking skills; many students are not aware of the difference between primary and secondary sources. This volume has a mix of readings from popular literature, review articles, and primary journal articles. By introducing various types of references, I hope you will be able to see what makes a primary source so distinct. I believe that being able to find good information and then assess that information are among the most important things you can learn in college. Primary sources offer conclusions, but the authors provide information on their data and analyses that help you determine whether to accept their conclusions. Secondary sources do not reveal all the details of the scientific method, which can make it difficult to assess the strength of the author’s conclusions. This does not mean that all

VII

VIII | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

secondary sources should be tossed out, but rather that you should be able to recognize the difference between the types of sources, and find primary sources for topics that you wish to learn more about. Thus, I encourage you to ask yourself after each article what the author’s conclusions are, how did the author arrive at those conclusions, would you have drawn the same conclusions, and—perhaps most critically—what more information would you like to have about the topic. This allows you to critically analyze material you encounter in your everyday life (on the Internet, in the news, from magazines, etc.) and make informed decisions, such as after reading about a new health fad should you follow it or look at the original source to ensure the claims are based on scientific data? This skill to read critically will last a lifetime. This anthology is divided into four sections: 1) Understanding Evolutionary Concepts; 2) Primates; 3) Human Evolution; and 4) Modern Human Variation. Each section offers a diverse selection of readings that includes classic popular science chapters, review articles, and primary peer-reviewed research articles. Articles were chosen to emphasize some of the important connections evolution has with understanding humans and making connections to your life. I hope you will enjoy the diversity of the materials selected and can see how understanding evolution can enrich your college experience and your life for many years to come.

UNDERSTANDING EVOLUTIONARY CONCEPTS Section 1

CHAPTER 1

EVIDENCE OF EVOLUTION

I N TR T R O D U C TI TION Evolution occurs all the time and has been documented occurring quite rapidly in microbes. Flu viruses, for example, evolve each season, which is why doctors continuously work on new vaccines and why last year’s vaccine does not prevent us from getting this year’s flu. Bacteria also evolve quickly, and this has led to an arms race with medicine to prevent antibiotic resistant forms of staph, tuberculosis, and Chlamydia from killing countless individuals. It is possible to view evolution in action, but there is much evidence of evolution without having to watch bacteria and viruses. Evidence of evolution is all around us. Charles Darwin included many types of evidence in Origin of Species, such as comparative anatomy, comparative embryology, and fossils.

L E A R N I N G O BJEC LEAR B J E C TTII VES VES 1. 2. 3. 4. 5.

Understand the influences of past scientists on Darwin. Understand taxonomy and the species concept. Understand how natural and sexual selection work. Recognize different types of selection. Understand the evidence of evolution that Darwin utilized.

1

2 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

HISTORY OF EVOLUTIONARY THEORY

C

harles Darwin (1809–1882) is credited with explaining how species evolved because he was the first to put together a unifying and correct theory of evolution. Many people believe evolutionary theory began with Darwin, but scientists prior to Darwin pondered how to organize the world around them and explain the origins of species. Throughout the Middle Ages, the predominant European worldview was that all aspects of nature, including forms of life and their relationships to one another, were fixed and unchanging. This view of nature was shaped in large part by Christianity. Nevertheless, there were intellectuals who were trying to organize plants and animals into sensible categories. For example, Aristotle (384–322 BC) wrote the Great Chain of Being and tried to arrange the organisms by physical similarities, which made sense at the time, and still does to a large degree. Aristotle, however, was not evolutionary because his view was that no species had been created or went extinct since the first creation by God. Other scholars of that period argued from design; that is, all the anatomical adaptations of organisms were created by God for specific purposes and served those purposes perfectly. This Christian viewpoint did not change for many years, and as late as the 1500s there were still no true evolutionary scientists. But the scientific revolution (1543–1600) changed these beliefs, at least among some scholars. The discovery of the New World, which is defined as the Americas, and the circumnavigation of the globe in the fifteenth century overturned some of the prior fundamental beliefs. As Europeans began to explore the New World, they became keenly aware of the great biological diversity before them. Animals and plants they had never seen or even knew existed prompted them to begin questioning biblical explanations of animal and plant life. Other attacks on the traditional religious beliefs came from a Polish mathematician, Nicolaus Copernicus (1473–1543), who challenged Aristotle’s long-believed assertion that the earth was the center of the universe. Around this time scholars began shunning the idea of the fixity of species, which is the concept that species remain unchanged throughout time. By the seventeenth century, there was a flurry of scientific inquiry. Scientists such as Keppler, Descartes, and Newton were discovering the laws of physics, motion, and gravity. The discovery of blood circulation and the inventions of the barometer, telescope, and microscope allowed for further investigations of the natural world. European scholars were changing their views and the heavy religious influence on scientific inquiry was beginning to wane. For naturalists, organizing the world became even more important during the scientific revolution because new plants and animals were being discovered. Thus, physical appearance was not an adequate method of cataloging the new organisms. One early attempt at arranging organisms was performed by John Ray (1627–1705). Ray was an ordained minister with a keen interest in trying to arrange organisms, but he adhered to the fixity of species. His influence, however, is still felt in the scientific community. Ray recognized that groups of plants and animals were best distinguished from other groups by their inability to reproduce with those outside their groups, which is now known as the biological species concept. FIGURE 1.1: Carolus Linnaeus

EVIDENCE OF EVOLUTION | 3

Carolus Linnaeus (1707–1778) took the species concept a step further when he recognized that species shared similarities with other species and he grouped similar species into genera (genus, singular). Linnaeus published Systems of Nature in 1735. In it he explored binomial nomenclature, which is the standard convention used for naming any organism that employs the genus and species name. The binomial for modern humans is Homo sapiens. Binomial nomenclature is still used today and has become the foundation for taxonomy, which is the branch of science concerned with classifying organisms based on evolutionary relationships. As an aside, Linnaeus initially believed in the fixity of species as well, but changed his view when evidence of evolution began mounting. Comte de Buffon (1707–1788), the keeper of the King’s Gardens in Paris, provided Darwin with an important key for evolution: individual variation. Buffon did not accept the concept of perfection in nature nor the idea that nature had a purpose. He saw the dynamic relationship between organisms and the environment. Buffon published his series of books Natural History in 1749 (there were thirty-six volumes in all, and eight were published after his death). Buffon stressed the importance of changes in the universe and changes in species. Interestingly, his volume of work contained comparisons between apes and humans and a discussion of the possibility that the two groups were closely related and had a common ancestor. He also claimed the earth was at least seventy-five thousand years old, which he calculated based on the FIGURE 1.2: Comte de Bufon cooling rate of iron. Although his books were burned by the church in France, his work influenced many early naturalists, including Erasmus Darwin, Jean-Baptiste Lamarck, and Charles Darwin. In the eighteenth century, evolutionary theory could not be ignored. Scientists were pondering how species originated and they no longer accepted religious intrusions into science. For example, Erasmus Darwin (1731–1802), Charles Darwin’s grandfather and a leading European scholar, formulated one of the first formal theories on evolution (Zoonomia, or The Laws of Organic Life), which was published from 1794–1796. He expressed some of his evolutionary ideas as poems. He and other scientists were struggling with the question of how one species could evolve into another; organization of species was no longer enough. Erasmus Darwin wrote about competition and sexual selection and how these factors could cause species to change. Erasmus Darwin came to his conclusions through an integrative approach of looking at domesticated animals, behavior of wildlife, and knowledge of many different fields, such as paleontology, biogeography, systematics, embryology, and comparative anatomy. Another evolutionary scientist in the eighteenth century was Jean-Baptiste Lamarck (1744–1829). Lamarck expanded on the views of Buffon and tried to explain how species could change. He put forth a model, published in 1801, that allowed for a dynamic interaction between living organisms and the changing environment. He thought that species change was influenced by the environment and is best known for his use-disuse model (also known as the hypothesis of the inheritance of acquired characteristics). According to Lamarck, use causes structures to expand or gain importance while disuse causes structures to shrink or disappear. The most famous example is the proposed evolution of the long giraffe neck that Lamarck believed evolved from giraffes reaching high leaves on trees and then passing on this trait. Lamarck called this the “First Law” in his book Philosophie zoologique.

4 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Lamarck’s “Second Law” stated that all such changes were heritable. Lamarck’s hypothesis was incorrect, but his emphasis on environmental pressures impressed Charles Darwin even though Lamarck was ignored by many scientists in his lifetime. Geologists also were interested in evolution. For example, Georges Cuvier (1769–1832), the founding father of vertebrate paleontology (the study of fossils from animals with backbones), attempted to explain fossils of extinct animals through catastrophism, the concept that large disasters can wipe out all organisms and that God will then repopulate the earth. Cuvier was anti-evolutionary and a die-hard believer in the fixity of species. On the other hand, Charles Lyell (1797–1875), the founder of modern geology and Charles Darwin’s mentor, proposed a model called uniformitarianism. Lyell’s uniformitarianism proposes that the present is a good predictor of the past. FIGURE 1.3: Charles Darwin Forces such as wind, water erosion, local flooding, all contributed to the past as they do in the present and that is how geology formations occur. The most controversial aspect of uniformitarianism was that it required long periods of time for large formations or changes to occur, so Lyell argued that the earth must be many millions of years old, which may be Lyell’s biggest contribution to science. In the nineteenth century, evolutionary theory was formulated by Charles Darwin, one of six children from a wealthy family and the grandson of Erasmus Darwin, and on the other side of his family his grandfather was Josiah Wedgwood of the Wedgwood pottery fame. As a boy, Darwin had great interest in nature and spent his days fishing and collecting. After the death of his mother, when he was eight, Darwin was raised by his older sisters and his father. The father sent Darwin to Edinburgh University to learn medicine, but Darwin disliked medicine and was said to have fainted at several of the surgeries. Yet, this is when Darwin became engaged in discussions on evolution and began reading the works of the scientists cited earlier. During the 1820s, evolutionary notions were dreaded in England since many of the scholars who were evolutionists were post-revolutionary Frenchmen. There was growing political unrest in Britain and the class system was being challenged by the reform movement. Thus, evolution was considered a revolutionary idea that threatened to overturn many of the traditions that England prided itself on. Nevertheless, Darwin studied with professors who were supporters of Lamarck and other evolutionary scholars. In his second year at Edinburgh, Darwin went to the university museum to examine the collection and attended natural history lectures, and in that same year he dropped out of the medical training. After Edinburgh, Darwin was sent to Christ’s College in Cambridge to study theology. Although this may seem an odd topic for Darwin to study, for a person of his social class there were few acceptable options. All the biographical evidence suggests Darwin was indifferent to religion. During the time he was supposed to be studying theology, he honed his skills as a naturalist and became immersed in geology and biology. He also became a serious participant in local geological expeditions and began to be recognized in scientific circles. This enabled him to embark on a life-changing voyage. Upon his graduation in 1831, Darwin, at the age of twenty-two, was recommended to accompany a scientific expedition that would circle the globe. The voyage would last five years. Captain Robert

EVIDENCE OF EVOLUTION | 5

Fitzroy was eager to have Darwin aboard because he wanted a high-class gentleman to converse with, but Darwin and Fitzroy began to disagree about nature, science, evolution, and religion. Darwin went aboard the Beagle already doubting the fixity of species, and during the voyage his doubts grew. As early as 1832, he noted that snakes had rudimentary hind limbs and that this may mark the passage by which nature joins lizards and snakes. He also found and excavated fossils of ancient giant animals that looked like living forms from the same regions, except for size, and this caused him to ponder whether the fossils were the ancestors of the living forms. And, on the Galapagos Islands, he noted that plants and animals of South America showed striking similarities to those on the islands, as well as differences. Even more surprising to Darwin was that the inhabitants of the various islands differed slightly from one another. Finches, for example, on each island had a different beak shape and the shapes coincided with food resources on the islands. Darwin returned to England in October 1836 and was immediately accepted to the most prestigious scientific groups. Around this time he married his cousin, Emma Wedgwood, and moved outside of London to a village called Down. There he spent the rest of his life writing on topics ranging from fossils to flowers. His overriding concern was the question of species change, which he would address in his theory of natural selection. By the late 1830s Darwin had realized that no selection could occur in nature, or by breeders, without variation. And he recognized that sexual reproduction was essential in variation. Then he read an economics essay that greatly influenced him. Thomas Malthus (1766–1834) wrote An Essay on the Principle of Population. He was a political economist concerned about what he saw as the decline of living conditions in England. He remarked on the overproduction of young and the inability of resources to keep up with the rising human population. He thought this unbalance was largely the fault of the lower classes, and he proposed that family size of the lower classes be regulated so that these families do not have more children than they could afford. Malthus argued that population size and natural resources were always at odds and there had to be a natural check to prevent famine and poverty; thus, social aids that assisted the poor were preventing the natural order of things. From Malthus’s point of view, this was God’s way of preventing man from becoming idle. After reading Malthus, Darwin framed his evolutionary theory in terms of resources, competition, and selection, but left out morality and God. The process was purely natural both in outcome and in ultimate reason. He realized that producing more offspring than can survive establishes a competitive environment among siblings, and that the variation among siblings would produce some individuals with a slightly greater chance of survival. In 1842, Darwin wrote a short summary of his views and revised it in 1844, but believed he needed more evidence to publish a book. It was not until 1859 that Origin of Species was published, but throughout the years after his return from the voyage Darwin continued to conduct research and publish papers. He was a very active member of the scientific community. Some of the contents of Origin of Species included data from Galapagos, breeders, and fossils. Darwin only referred to man in one line of Origin of Species (which stated that “Much light will be thrown the on the origin of man and his history”). Nonetheless, the book proved controversial, causing much uproar, which is why some people suspect Darwin put off publishing it until he was practically forced to by the appearance of similar a work by Alfred Wallace. Alfred Wallace (1823–1913) was born into a family of modest means and began working at the age of fourteen. Wallace had a keen interest in plants and animals. In 1848, when he was twenty-five,

6 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

he joined an expedition to the Amazon and gained firsthand knowledge of many natural phenomena. And, in 1854, he sailed for Southeast Asia and the Malay Peninsula to continue his collecting of birds and insects. One year later, Wallace published a paper that suggested species were descended from other species and the appearance of new species was influenced by environmental factors, led by a competition for resources. The Wallace paper caused Lyell to urge Darwin to publish his book of species origins, but still Darwin hesitated. Then, in 1858, one year before the Origin of Species was published, Wallace sent Darwin another paper titled “On the Tendency of Varieties to Depart Indefinitely from the Original Type” in which Wallace outlined evolution as a process driven by competition and natural selection. Darwin read the paper, and realized he had to publish his own full-volume work or Wallace might get credit for the evolutionary model of natural selection. Darwin wrote a paper quickly presenting his ideas, and both papers, by Wallace and Darwin, were presented at the Linnaean Society of London in 1858. The papers, surprisingly, received little attention at the time. Darwin finished his book Origin of Species and it was published in 1859. There are some differences between Wallace’s and Darwin’s models of evolution. Wallace excluded plants whereas Darwin included all organisms. Darwin emphasized competition within a species whereas Wallace emphasized competition between species. And, Darwin included sexual selection whereas Wallace only wrote of natural selection. Descent of Man (1871), Darwin’s second book, addressed human evolution and added sexual selection as a force in evolution. Afterward, he published a book on the mentality of man (The Expression of the Emotions in Man and Animals) in which he examines behavior and intelligence of man and how they could have evolved. In this book, Darwin once again shows his genius for comparative biology and sees similarities that others might miss. In the following section, Darwin’s theory of evolution by natural and sexual selection is explained.

UNDERSTANDING NATURAL SELECTION Natural selection is the mechanism of evolutionary change proposed by Charles Darwin and Alfred Wallace. Natural selection refers to genetic alterations in the occurrence of certain traits in populations caused by individuals’ differential reproductive success, which translates to who has the most surviving offspring. Traits must be inherited—that is, they must be able to be passed on to the next generation—to be of any importance in evolution. Some basic tenets of evolution via natural selection include that there must be a struggle for existence and individuals with favorable variations of traits survive and reproduce. This is sometimes termed “survival of the fittest,” which is a phrase actually coined by Herbert Spencer, a British philosopher, after he read Darwin’s Origin of Species. Evolution by natural selection can be understood in eight steps. Darwin’s writing was clear and down to earth; his work was intended for a popular audience, which means you could read his original work and understand natural selection. And he included many examples in his work that show his comprehensive research, reading, and observation. The eight steps of evolution by natural selection are as follows: (1) All species are capable of producing offspring at a faster rate than food supplies increase. Darwin ascertained this information through observations of animal life, and he was also influenced by Malthus who emphasized the importance of controlling family size of the lower classes.

EVIDENCE OF EVOLUTION | 7

(2) There is variation within all species (with the exception of identical twins, no two individuals are alike). Darwin noted there was variation when he went to the Galapagos, but he had also read Buffon who remarked on variation in plants. Buffon really emphasized that individual variation must be of some importance. Darwin could see the link between individual variation and selection. (3) Because in each generation more individuals are born than can survive owing to the limited supply of resources, such as food, there is competition between individuals. Darwin saw competition wherever he looked; he saw this in animals and plants. Wallace thought the competition mainly occurred between species, such as in predator-prey scenarios. Darwin, on the other hand, would see competition within species, with the fastest prey (e.g., an antelope) getting away from the predator (e.g., a lion); thus, the competition would be described as between the various antelopes. Competition can be subtle, such as the bird with the strongest beak could crack open the most seeds. (4) Individuals with more favorable variations have an edge on others. Because of favorable traits, individuals are more likely to survive and produce offspring who will be like them. Having a favorable variation of a trait means you will survive and reproduce. (5) The environment is essential in determining which traits are favorable. If the environment changes, then a once favorable trait may no longer be favorable. Because environments change, evolution by natural selection is not goal-oriented. Darwin learned the importance of environment both through Lamarck and from his experiences on the Galapagos Islands. When he experienced an earthquake while in Chile, he saw that large changes in the environment could significantly change which traits would be favorable. (6) Traits are inherited and are passed on to the next generation. Without inheritance, traits cannot accumulate in future populations. (7) Over long periods of time, successful variations accumulate, so that later generations may be different from previous generations and this can produce a new species. Charles Lyell’s influence on Darwin is obvious here; although uniformitarianism was used to understand geological formations, Darwin saw that the same principle could work for biology. (8) Geographical isolation may also lead to formation of a new species. Owing to his island adventures, Darwin saw how the pressures on islands could be increased. Islands provide fewer resources for organisms, less new genetic material from the population, and greater competition. Before Darwin’s theory, most scientists did not understand the importance of individuals within the species; the individual seemed insignificant. Natural selection operates on individuals, but the population evolves. This made it difficult for scientists to imagine how evolution could occur. Darwin’s brilliance was that he focused on individual variation. The next section provides information on the evidence of evolution available to Darwin.

EVIDENCE OF EVOLUTION If species did not evolve from earlier forms, then we would expect there to be few similarities between different organisms. But we find quite the opposite. Early naturalists, including Darwin, found fossils that looked remarkably similar to modern animals. In Darwin’s case, he discussed fossil mammals from Australian caves that looked similar to extant marsupials. And, in South America, he saw firsthand the similarities between extinct animals that had “armour”-like bodies and extant armadillos.

8 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

He acknowledged the relationship between extinct and living species is not one of direct progeny (that the living are descendants from the past), but rather that they do share a common ancestor (i.e., the organism that gave rise to later organisms) along the line. Similarities are often due to sharing a common ancestor. The Origin of Species, Mutual Affinities of Organic Beings: Morphology: Embryology: Rudimentary Organs (1859) by Charles Darwin [Reading 1], excerpt included in this textbook, provides information on Darwin’s perception of evolutionary evidence seen in anatomy. For example, he noted that living species retained some vestigial body parts that may have come from previous common ancestors. Sometimes vestigial traits evolve for another function, but other times they remain without use. This is because evolution does not clear out everything from our past, but rather works with what is available and modifies it. In this way, evolution is a conservative process. Through genetic changes guided by natural selection, structures are remodeled during later stages of growth and development and may acquire new functions. Also covered in the excerpt is comparative embryology and an examination of adaptive radiation and convergence. Physical anthropologists are excellent at comparing anatomy. They often have to determine whether a bone is that of a human or another animal; this is sometimes difficult when just looking at a fragment. To reconstruct past lifestyles and family trees, anthropologists use comparative anatomy. The task is made easier due to different shapes species have due to evolving for specific environments. When closely related species are different on the surface (but have the same bone structure beneath), this is called adaptive radiation. Sometimes animals look the same on the surface, but a deeper look reveals differences. When a trait is similar due to environmental pressures, rather than due to a common ancestor, the trait is called homoplasic. Traits that are similar due to having a close common ancestor are called homologous. Homoplasic traits evolve from convergence, which is opposite of adaptive radiation. For example, water environments require body types fit for swimming. The best-adapted shape for water travel is a streamlined body, fins or flippers, and a tail; this body shape moves easily through water with reduced frontal resistance. Fins function as powerful guiding rudders or as paddles

FIGURE 1.4: Comparative embryology

EVIDENCE OF EVOLUTION | 9

FIGURE 1.5: Adaptive radiation

to propel the body through water. Looking at birds, mammals, and fish that spend a great deal of time in water, one can see they all look similar in external shape. The differences, however, are revealed in their internal structure. Another example of convergence is the appearance of marsupial and placental mammals. The two groups have different modes of reproduction and are separated from a common ancestor more than one hundred million years ago, yet they have adapted in similar ways to particular food supplies, locomotor skills, and climates. For instance, there are wolves in each group that act as large terrestrial predators, and rabbit-like animals that exist in arid climates and escape predators through jumping and have a keen sense of hearing with eyes on the sides of their skull that enable to see behind them. There are also small tree dwellers that take advantage of the safety and food resources above the ground, very much as squirrels, like the animal shown in figure 1.6. These adaptations are overlain on different types of reproduction, which means that reproduction is the feature that FIGURE 1.6: Marsupial sugar glider

10 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

accurately reflects their distant evolutionary relationships—Linnaeus, very early on, noted that reproduction mode was a good way to classify organisms. Marsupial and placental mammals of Australia and North America illustrate one example of evolutionary convergence whereby species not closely related resemble each other because they fill similar niches in each continent.

TYPES OF SELECTION Changes in species are called adaptations. Adaptations are functional responses of organisms to their environment. Selection can occur in three ways: directional, stabilizing, and disruptive. In all three modes of natural selection, there is survival of the fittest, where fitness equals reproductive success. In directional selection, one variation of the trait is selected for; thus, the variation of the trait enables those individuals with the favorable variation to survive and reproduce. The next generation will have more individuals with the favorable variation and less individuals with the other variation. Mindell’s (2009) article “Evolution in the Everyday World” [Reading 3], included in this textbook, described the microbial arms race, which is an excellent example of directional FIGURE 1.7: Types of selection: Directional and disruptive selection. Stabilizing selection occurs when extremes of the variation are selected against and the average or most common form of the variation is selected for, causing a decrease in variation over time for a particular trait. Human birth weight is a good example of stabilizing selection. Research by Karn and Penrose (1951) demonstrated that infants born between seven and nine pounds had the highest survival rates. Infants who are underweight may be less likely to survive because they are often born premature and have not developed enough (such as having underdeveloped lungs); very heavy infants may not survive due to difficult childbirth and perhaps the death of the mother. FIGURE 1.8: Darwin’s inches

EVIDENCE OF EVOLUTION | 11

Thus, over time, those infants who were genetically inclined to weigh between seven and nine pounds were most likely to survive and reproduce, which led to the next generation having fewer underweight and overweight infants. Modern medicine can be said to have loosened the selection pressure of human birth weight through incubators, intensive postnatal care, and other medical advances that have enabled some of the smallest infants to survive. What we are just now learning is how premature birth and low birth weight affects children, and the outlook is not good: learning and physical disabilities appear when these children grow up and may cause a different sort of selection pressure to arise. Finally, disruptive selection occurs when two extremes of the variation area selected for and the new populations form two different most common forms. This can eventually lead to a speciation event. Disruptive selection examples are harder to come by than directional or stabilizing examples (perhaps because they are less common or perhaps not as easy to spot). Darwin’s observations of the Galapagos finches can be considered an example of disruptive selection. A generalized finch from the mainland spread out to different islands of the Galapagos. On these islands, different food sources were available and, thus, the finches evolved from a general beaked finch to a finch with a very sturdy beak, such as the large ground-finch (Geospiza magnirostris) that inhabits dry environments and can crack the hard dry shells available in those environments, to the fine-beaked green warbler finch found in humid evergreen forests that uses its pointy beak to probe into moss, bark, and leaves for spiders and insects. As cited earlier, Charles Darwin also saw a second type of selection occurring in organisms; this was sexual selection, a type of evolution in which the selection agent is the opposite sex. Darwin proposed his theory of sexual selection in Descent of Man (1871), but he was not the first to bring up sexual selection. His grandfather, Erasmus Darwin, also cited the power of attraction as a key to evolution. Although sexual selection is very similar to natural selection, there are a few differences. In sexual selection the pressure is not to survive to reproductive age to become fit, but rather to survive to reproductive age and attract the attentions of the opposite sex. Thus, the opposite sex, not the environment, is the selecting agent. Sexual selection also operates only on one sex of a species, usually the male. The result of sexual selection is sexual dimorphism or differences between males and females. A good example of sexual selection is plumage color (or the colors of feathers) in birds. Often male birds are more brightly colored; for example, female ducks are often dull browns whereas the males are dramatic black, red, and yellow. These colors are also indicators of health and low parasite loads. Females will opt to mate with the males with the most colorful feathers and this will lead to drab males not passing on their genes. Bright colors in females may be harmful to raising offspring and attract unwanted attention to the female when she sits on eggs; thus, natural selection has acted on female color to ensure that reproduction is successful. Whereas the bright colors in males may actually work against natural selection and result in higher predation rate of the most colorful birds. The article “Effects of Sexual Dimorphism on Facial Attractiveness” (2002), by Perrett and colleagues [Reading 2], provides an interesting perspective on sexual selection in humans. A summary of mechanisms of evolutionary change can be divided into three main groups: (1) a trait must be inherited importance in natural selection (or any type of selection); (2) natural selection cannot occur without variation in inherited characteristics; and (3) fitness is a relative measure that will change as the environment changes.

12 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

SUM SU MMA M AR RY Even prior to the publication of the Origin of Species, some scientists took notice of the similarities in embryonic stages. Comparative embryology is a powerful line of evidence for evolution. It shows how evolution builds on what is already available and makes modifications. It also illustrates that the more closely related are species, the longer it takes in their development to distinguish them. Important to consider is that evolution is a conservative process. Adaptive radiation is a process in which external changes occur in closely related species due to differing environments. To determine relationships it is much more important to look at the deeper structures than the external structures. Reproductive mode is essential for looking at relationships. Sometimes very similar external structures can occur in very distantly related critters. These similarities are called convergences and can be misleading when reconstructing evolutionary relationships. Structures that are similar due to shared evolutionary origins are called homologies; homoplasies are opposite. Once again, we need to look beyond the surface.

EVIDENCE OF EVOLUTION | 13

G LLO O SSAR SSARY Adaptations: Functional responses of organisms to their environment. Adaptive radiation: When closely related species are different on the surface (but have the same bone structure beneath). Binomial nomenclature: The standard convention used for naming any organism that employs the genus and species name; for humans, it is Homo sapiens. Catastrophism: The concept that large disasters can wipe out all organisms and that God will then repopulate the earth. Cladograms: Evolutionary family trees. Convergence: When distantly related species are similar on the surface, but have different bone structure beneath. The opposite of adaptive radiation. Differential reproductive success: Who has the most surviving offspring. Directional selection: One variation of the trait is selected for; thus, the variation of the trait enables those individuals with the favorable variation to survive and reproduce. Disruptive selection: Occurs when two extremes of the variation area selected for and the new populations form two different most common forms. This can eventually lead to a speciation event. Fixity of species: The concept that species remained unchanged throughout time—all generations are the same as previous generations. Homoplasic: Traits that are similar due to similar environmental pressures rather than similar ancestry. Homologous: Traits that are similar due to sharing a common ancestor. Natural selection: Refers to genetic alterations in the occurrence of certain traits in populations caused by individuals’ differential reproductive success. Ontogeny: An individual’s life from conception to death. Phylogeny: Evolutionary relatedness of species from a common ancestor. Species: Groups of plants and animals were best distinguished from other groups by their inability to reproduce with those outside of their groups, and produce viable offspring with those within their group. Stabilizing selection: Occurs when extremes of the variation are selected against and the average or most common form of the variation is selected for, causing a decrease in variation over time for a particular trait. Taxonomy: The branch of science concerned with classifying organisms based on evolutionary relationships. Uniformitarianism: The concept that that the present is a good predictor of the past. Use-disuse theory: The concept that features that are used more often grow, and features that do not get used disappear and these changes are passed on.

SEC T I O N 1 R EAD I N G S

RE EAD ADING 1 Darwin C. 1859. Origin of Species, 1st Edition. Chapter XIII: Morphology, Embryology; Rudimentary Organs is an excerpt from Darwin’s seminal work. Darwin was writing for a large popular audience rather than the scientific elite and this chapter includes evidence of evolution that is still correct today. Charles Darwin has often been said not to have tackled the question of the Creator in his Origin of Species, but this section makes it clear that he did question how someone could interpret rudimentary organs, convergence, and homology and still accept that each species was created separately. Darwin’s evidence of evolution came from a large variety of sources including: • • • • •

Embryology Vestigial Organs Convergence Adaptive Radiation Selective Breeding

And, his work benefitted from the work of many before him included: • Charles Lyell and his theory of uniformitarianism; • Georges Buffon and his keen observations about plant variation; • Thomas Malthus who explained the importance of competition for resources on an economic level.

he Origin of Species by means of Natural Selection, 1st Edition-1859 CHAPTER XIII By Charles Darwin

MORPHOLOGY We have seen that the members of the same class, What can be more curious than independently of their habits of life, resemble each that the hand of a man, formed other in the general plan of their organisation. This for grasping, that of a mole for resemblance is often expressed by the term “ unity of type;” or by saying that the several pails and organs in digging, the leg of the horse, the the different species of the class are homologous. The paddle of the porpoise, and the whole subject is included under the general name of wing of the bat, should all be conMorphology. This is the most interesting department structed on the same pattern, and of natural history, and may be said to be its very soul. should include the same bones, in What can be more curious than that the hand of a the same relative positions? man, formed for grasping, that of a mole for digging, the leg of the horse, the paddle of the porpoise, and the wing of the bat, should all be constructed on the same pattern, and should include the same bones, in the same relative positions? Geoffroy St. Hilaire has insisted strongly on the high importance of relative connexion in homologous organs: the parts may change to almost any extent in form and size, and yet they always remain connected together in the same order. We never find, for instance, the bones of the arm and forearm, or of the thigh and leg, transposed. Hence the same names can be given to the homologous bones in widely different animals. We see the same great law in the construction of the mouths of insects: what can be more different than the immensely long spiral proboscis of a sphinx-moth, the curious folded one of a bee or bug, and the great

Copyright in the Public Domain.

15

16 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

jaws of a beetle ?—yet all these organs, serving for such different purposes, are formed by infinitely numerous modifications of an upper lip, mandibles, and two pairs of maxillæ. Analogous laws govern the construction of the mouths and limbs of crustaceans. So it is with the flowers of plants. Nothing can be more hopeless than to attempt to explain this similarity of pattern in members of the same class, by utility or by the doctrine of final causes. The hopelessness of the attempt has been expressly admitted by Owen in his most interesting work on the ‘ Nature of Limbs.’ On the ordinary view of the independent creation of each being, we can only say that so it is;—that it has so pleased the Creator to construct each animal and plant. The explanation is manifest on the theory of the natural selection of successive slight modifications,—each modification being profitable in some way to the modified form, but often affecting by correlation of growth other parts of the organisation. In changes of this nature, there will be little or no tendency to modify the original pattern, or to transpose parts. The bones of a limb might be shortened and widened to any extent, and become gradually enveloped in thick membrane, so as to serve as a fin; or a webbed foot might have all its bones, or certain bones, lengthened to any extent, and the membrane connecting them increased to any extent, so as to serve as a wing: yet in all this great amount of modification there will be no tendency to alter the framework of bones or the relative connexion of the several parts. If we suppose that the ancient progenitor, the archetype as it may be called, of all mammals, had its limbs constructed on the existing general pattern, for whatever purpose they served, we can at once perceive the plain signification of the homologous construction of the limbs throughout the whole class. So with the mouths of insects, we have only to suppose that their common progenitor had an upper lip, mandibles, and two pair of maxillæ, these parts being perhaps very simple in form; and then natural selection will account for the infinite diversity in structure and function of the mouths of insects. Nevertheless, it is conceivable that the general pattern of an organ might become so much obscured as to bo finally lost, by the atrophy and ultimately by the complete abortion of certain parts, by the soldering together of other parts, and by the doubling or multiplication of others,—variations which we know to be within the limits of possibility. In the paddles of the extinct gigantic sea-lizards, and in the mouths of certain suctorial crustaceans, the general pattern seems to have been thus to a certain extent obscured. There is another and equally curious branch of the present subject; namely, the comparison not of the same part in different members of a class, but of the different parts or organs in the same individual. Most physiologists believe that the bones of the skull are homologous with—that is correspond in number and in relative connexion with—the elemental parts of a certain number of vertebræ. The anterior and posterior limbs in each member of the vertebrate and articulate classes are plainly homologous. We see the same law in comparing the wonderfully complex jaws and legs in crustaceans. It is familiar to almost every one, that in a flower the relative position of the sepals, petals, stamens, and pistils, as well as their intimate structure, are intelligible on the view that they consist of metamorphosed leaves, orranged in a spire. In monstrous plants, we often get direct evidence of the possibility of one organ being transformed into another; and we can actually see in embryonic crustaceans and in many other animals, and in flowers, that organs, which when mature become extremely different, are at an early stage of growth exactly alike. How inexplicable are these facts on the ordinary view of creation! Why should the brain be enclosed in a box composed of such numerous and such extraordinarily shaped pieces of bone? As Owen has remarked, the benefit derived from the yielding of the separate pieces in the act of

READING: THE ORIGIN OF SPECIES BY MEANS OF NATURAL SELECTION, 1ST EDITION-1859 | 17

parturition of mammals, will by no means explain the same construction in the skulls of birds. Why should similar bones have been created in the formation of the wing and leg of a bat, used as they are for such totally different purposes? Why should one crustacean, which has an extremely complex mouth formed of many parts, consequently always have fewer legs; or conversely, those with many legs have simpler mouths? Why should the sepals, petals, stamens, and pistils in any individual flower, though fitted for such widely different purposes, bo all constructed on the same pattern ? On the theory of natural selection, we can satisfactorily answer these questions. In the vertebrata, we see a series of internal vertebra; bearing certain processes and appendages; in the articulata, we see the body divided into a series of segments, bearing external appendages; and in flowering plants, we see a series of successive spiral whorls of leaves. An indefinite repetition of the same part or organ is the common characteristic (as Owen has observed) of all low or little-modified forms; therefore we may readily believe that the unknown progenitor of the vertebrata possessed many vertebræ; the unknown progenitor of the articulata, many segments; and the unknown progenitor of flowering plants, many spiral whorls of leaves. We have formerly seen that parts many times repeated are eminently liable to vary in number and structure; consequently it is quite probable that natural selection, during a long-continned course of modification, should have seized on a certain number of the primordially similar elements, many times repeated, and have adapted them to the most diverse purposes. And as the whole amount of modification will have been effected by slight successive steps, we need not wonder at discovering in such parts or organs, a certain degree of fundamental resemblance, retained by the strong principle of inheritance. In the great class of molluses, though we can homologise the parts of one species with those of another and distinct species, we can indicate but few serial homologies; that is, we are seldom enabled to say that one part or organ is homologous with another in the same individual. And we can understand this fact; for in molluscs, even in the lowest members of the class, we do not find nearly so much indefinite repetition of any one part, as we find in the other great classes of the animal and vegetable kingdoms. Naturalists frequently speak of the skull as formed of metamorphosed vertebræ: the jaws of crabs as metamorphosed legs; the stamens and pistils of flowers as metamorphosed leaves; but it would in these cases probably be more correct, as Professor Huxley has remarked, to speak of both skull and vertebrae, both jaws and legs, &c.,—as haring been metamorphosed, not one from the other, but from some common element. Naturalists, however, use such language only in a metaphorical sense: they are far from meaning that during a long course of descent, primordial organs of any kind—vertebræ in the one case and legs in the other—have actually been modified into skulls or jaws. Yet so strong is the appearance of a modification of this nature having occurred, that naturalists can hardly avoid employing language having this plain signification. On my view these terms may be used literally; and the wonderful fact of the jaws, for instance, of a crab retaining numerous characters, which they would probably have retained through inheritance, if they had really been metamorphosed during a long course of descent from true legs, or from some simple appendage, is explained.

18 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

EMBRYOLOGY It has already been casually remarked that certain organs in the individual, which when mature become widely different and serve for different purposes, are in the embryo exactly alike. The embryos, also, of distinct animals within the same class are often strikingly similar: a better proof of this cannot be given, than a circumstance mentioned by Agassiz, namely, that having forgotten to ticket the embryo of some vertebrate animal, he cannot now tell whether it be that of a mammal, bird, or reptile. The vermiform larvæ of moths, flies, beetles, &c., resemble each other much more closely than do the mature insects; but in the case of larvæ, the embryos are active, and have been adapted for special lines of life. A trace of the law of embryonic resemblance, sometimes lasts till a rather late age: thus birds of the same genus, and of closely allied genera, often resemble each other in their first and second plumage; as we see in the spotted feathers in the thrush group. In the cat tribe, most of the species are striped or spotted in lines; and stripes can be plainly distinguished in the whelp of the lion. We occasionally though rarely see something of this kind in plants: thus the embryonic leaves of the ulex or furze, and the first leaves of the phyllodineous acaceas, are pinnate or divided like the ordinary leaves of the leguminosæ. The points of structure, in which the embryos of widely different animals of the same class resemble each other, often have no direct relation to their conditions of existence. We cannot, for instance, suppose that in the embryos of the vertebrata the peculiar loop-like course of the arteries near the branchial slits are related to similar conditions,—in the young mammal which is nourished in the womb of its mother, in the egg of the bird which is hatched in a nest, and in the spawn of a frog under water. We have no more reason to believe in such a relation, than we have to believe that the same bones in the hand of a man, wing of a bat, and fin of a porpoise, are related to similar conditions of life. No one will suppose that the stripes on the whelp of a lion, or the spots on the young blackbird, are of any use to these animals, or are related to the conditions to which they are exposed. The case, however, is different when an animal during any part of its embryonic career is active, and has to provide for itself. The period of activity may come on earlier or later in life; but whenever it comes on, the adaptation of the larva to its conditions of life is just as perfect and as beautiful as in the adult animal. From such special adaptations, the similarity of the larvæ or active embryos of allied animals is sometimes much obscured; and cases could be given of the larvæ of two species, or of two groups of species, differing quite as much, or even more, from each other than do their adult parents. In most cases, however, the larvæ, though active, still obey more or less closely the law of common embryonic resemblance. Cirripedes afford a good instance of this: even the illustrious Cuvier did not perceive that a barnacle was, as it certainly is, a crustacean; but a glance at the larva shows this to be the case in an unmistakeable manner. So again the two main divisions of cirripedes, the pedunculated and sessile, which differ widely in external appearance, have larvæ in all their several stages barely distinguishable. The embryo in the course of development generally rises in organisation: I use this expression, though I am aware that it is hardly possible to define clearly what is meant by the organisation being higher or lower. But no one probably will dispute that the butterfly is higher than the caterpillar. In some cases, however, the mature animal is generally considered as lower in the scale than the larva, as with certain parasitic crustaceans. To refer once again to cirripedes: the larvæ in the first

READING: THE ORIGIN OF SPECIES BY MEANS OF NATURAL SELECTION, 1ST EDITION-1859 | 19

stage have three pairs of legs, a very simple single eye, and a We are so much accustomed to see probosciformed mouth, with which they feed largely, for they diferences in structure between increase much in size. In the second stage, answering to the the embryo and the adult, and chrysalis stage of butterflies, they have six pairs of beautifully constructed natatory legs, a pair of magnificent compound likewise a close similarity in the eyes, and extremely complex antennlarvæ; but they have a embryos of widely diferent aniclosed and imperfect mouth, and cannot feed: their function at mals with in the same class, that this stage is, to search by their well-developed organs of sense, we might be led to look at these and to reach by their active powers of swimming, a proper facts as necessarily contingent in place on which to become attached and to undergo their final some manner on growth. metamorphosis. When this is completed they are fixed for life: their legs are now converted into prehensile organs; they again obtain a well-constructed mouth; but they have no antennas, and their two eyes are now reconverted into a minute, single, and very simple eye-spot. In this last and complete state, cirripedes may be considered as either more highly or more lowly organised than they were in the larval condition. But in some genera the larvæ become developed either into hermaphrodites having the ordinary structure, or into what I have called complemental males: and in the latter, the development has assuredly been retrograde; for the male is a mere sack, which lives for a short time, and is destitute of mouth, stomach, or other organ of importance, excepting for reproduction. We are so much accustomed to see differences in structure between the embryo and the adult, and likewise a close similarity in the embryos of widely different animals within the same class, that we might be led to look at these facts as necessarily contingent in some manner on growth. But there is no obvious reason why, for instance, the wing of a bat, or the fin of a porpoise, should not have been sketched out with all the parts in proper proportion, as soon as any structure became visible in the embryo. And in some whole groups of animals and in certain members of other groups, the embryo does not at any period differ widely from the adult: thus Owen has remarked in regard to cuttle-fish, “there is no metamorphosis; the cephalopodic character is manifested long before the parts of the embryo are completed;” and again in spiders, “there is nothing worthy to be called a metamorphosis.” The larvas of insects, whether adapted to the most diverse and active habits, or quite inactive, being fed by their parents or placed in the midst of proper nutriment, yet nearly all pass through a similar worm-like stage of development; but in some few eases, as in that of Aphis, if we look to the admirable drawings by Professor Huxley of the development of this insect, we see no trace of the vermiform stage. How, then, can we explain these several facts in embryology,—namely the very general, but not universal difference in structure between the embryo and the adult;—of parts in the same indivividual embryo, which ultimately become very unlike and serve for diverse purposes, being at this early period of growth alike;—of embryos of different species within the same class, generally, but not universally, resembling each other;—of the structure of the embryo not being closely related to its conditions of existence, except when the embryo becomes at any period of life active and has to provide for itself;—of the embryo apparently having sometimes a higher organisation than the mature animal, into which it is developed. I believe that all these facts can be explained, as follows, on the view of descent with modification.

20 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

It is commonly assumed, perhaps from monstrosities often affecting the embyro at a very early period, that slight variations necessarily appear at an equally early period. But we have little evidence on this head—indeed the evidence rather points the other way; for it is notorious that breeders of cattle, horses, and various fancy animals, cannot positively tell, until some time after the animal has been born, what its merits or form will ultimately turn out. We see this plainly in our own children; we cannot always tell whether the child will be tall or short, or what its precise features will be. The question is not, at what period of life any variation has been caused, but at what period it is fully displayed. The cause may have acted, and I believe generally has acted, even before the embryo is formed; and the variation may be due to the male and female sexual elements having been affected by the conditions to which either parent, or their ancestors, have been exposed. Nevertheless an effect thus caused at a very early period, even before the formation of the embryo, may appear late in life; as when an hereditary disease, which appears in old age alone, has been communicated to the offspring from the reproductive element of one parent. Or again, as when the horns of cross-bred cattle have been affected by the shape of the horns of either parent. For the welfare of a very young animal, as long as it remains in its mother’s womb, or in the egg, or as long as it is nourished and protected by its parent, it must be quite unimportant whether most of its characters are fully acquired a little earlier or later in life. It would not signify, for instance, to a bird which obtained its food best by having a long beak, whether or not it assumed a beak of this particular length, as long as it was fed by its parents. Hence, I conclude, that it is quite possible, that each of the many successive modifications, by which each species has acquired its present structure, may have supervened at a not very early period of life; and some direct evidence from our domestic animals supports this view. But in other cases it is quite possible that each successive modification, or most of them, may have appeared at an extremely early period. I have stated in the first chapter, that there is some evidence to render it probable, that at whatever age any variation first appears in the parent, it tends to reappear at a corresponding age in the offspring. Certain variations can only appear at corresponding ages, for instance, peculiarities in the caterpillar, cocoon, or imago states of the silk-moth; or, again, in the horns of almost full-grown cattle. But further than this, variations which, for all that we can see, might have appeared earlier or later in life, tend to appear at a corresponding age in the offspring and parent. I am far from meaning that this is invariably the case; and I could give a good many cases of variations (taking the word in the largest sense) which have supervened at an earlier age in the child than in the parent. These two principles, if their truth be admitted, will, I believe, explain all the above specified leading facts in embryology. But first let us look at a few analogous cases in domestic varieties. Some authors who have written on Dogs, maintain that the greyhound and bull-dog, though appearing so different, are really varieties most closely allied, and have probably descended from the same wild stock; hence I was curious to see how far their puppies differed from each other: I was told by breeders that they differed just as much as their parents, and this, judging by the eye, seemed almost to be the case; but on actually measuring the old dogs and their six-days old puppies, I found that the puppies had not nearly acquired their full amount of proportional difference. So, again, I was told that the foals of cart and race-horses differed as much as the full-grown animals; and this surprised me greatly, as I think it probable that the difference between these two breeds has been wholly caused by selection under domestication; but having had careful measurements made of the dam and of a

READING: THE ORIGIN OF SPECIES BY MEANS OF NATURAL SELECTION, 1ST EDITION-1859 | 21

three-days old colt of a race and heavy cart-horse, I find that the colts have by no means acquired their full amount of proportional difference. As the evidence appears to me conclusive, that the several domestic breeds of Pigeon have descended from one wild species, I compared young pigeons of various breeds, within twelve hours after being hatched; I carefully measured the proportions (but will not here give details) of the beak, width of mouth, length of nostril and of eyelid, size of feet and length of leg, in the wild stock, in pouters, fantails, runts, barbs, dragons, carriers, and tumblers. Now some of these birds, when mature, differ so extraordinarily in length and form of beak, that they would, I cannot doubt, be ranked in distinct genera, had they been natural productions. But when the nestling birds of these several breeds were placed in a row, though most of them could be distinguished from each other, yet their proportional differences in the above specified several points were incomparably less than in the full-grown birds. Some characteristic points of difference—for instance, that of the width of mouth—could hardly be detected in the young. But there was one remarkable exception to this rule, for the young of the short-faced tumbler differed from the young of the wild rock-pigeon and of the other breeds, in all its proportions, almost exactly as much as in the adult state. The two principles above given seem to me to explain these facts in regard to the later embryonic stages of our domestic varieties. Fanciers select their horses, dogs, and pigeons, for breeding, when they are nearly grown up: they are indifferent whether the desired qualities and structures have been acquired earlier or later in life, if the full-grown animal possesses them. And the cases just given, more especially that of pigeons, seem to show that the characteristic differences which give value to each breed, and which have been accumulated by man’s selection, have not generally first appeared at an early period of life, and have been inherited by the offspring at a corresponding not early period. But the case of the short-faced tumbler, which when twelve hours old had acquired its proper proportions, proves that this is not the universal rule; for here the characteristic differences must either have appeared at an earlier period than usual, or, if not so, the differences must have been inherited, not at the corresponding, but at an earlier age. Now let us apply these facts and the above two principles—which latter, though not proved true, can be shown to be in some degree probable—to species in a state of nature. Let us take a genus of birds, descended on my theory from some one parent-species, and of which the several new species have become modified through natural selection in accordance with their diverse habits. Then, from the many slight successive steps of variation having supervened at a rather late age, and having been inherited at a corresponding age, the young of the new species of our supposed genus will manifestly tend to resemble each other much more closely than do the adults, just as we have seen in the case of pigeons. We may extend this view to whole families or even classes. The fore-limbs, for instance, which served as legs in the parent-species, may become, by a long course of modification, adapted in one descendant to act as hands, in another as paddles, in another as wings; and on the above two principles—namely of each successive modification supervening at a rather late age, and being inherited at a corresponding late age—the fore-limbs in the embryos of the several descendants of the parent-species will still resemble each other closely, for they will not have been modified. But in each individual new species, the embryonic fore-limbs will differ greatly from the fore-limbs in the mature animal; the limbs in the latter having undergone much modification at a rather late period of life, and having thus been converted into hands, or paddles, or wings. Whatever influence longcontinued exercise or use on the one hand, and disuse on the other, may have in modifying an organ,

22 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

such influence will mainly affect the mature animal, which has come to its full powers of activity and has to gain its own living; and the effects thus produced will be inherited at a corresponding mature age. Whereas the young will remain unmodified, or be modified in a lesser degree, by the effects of use and disuse. In certain cases the successive steps of variation might supervene, from causes of which we are wholly ignorant, at a very early period of life, or each step might be inherited at an earlier period than that at which it first appeared. In either case (as with the short-faced tumbler) the young or embryo would closely resemble the mature parent-form. We have seen that this is the rule of development in certain whole groups of animals, as with cuttle-fish and spiders, and with a few members of the great class of insects, as with Aphis. With respect to the final cause of the young in these cases not undergoing any metamorphosis, or closely resembling their parents from their earliest age, we can see that this would result from the two following contingencies; firstly, from the young, during a course of modification carried on for many generations, having to provide for their own wants at a very early stage of development, and secondly, from their following exactly the same habits of life with their parents; for in this case, it would be indispensable for the existence of the species, that the child should be modified at a very early age in the same manner with its parents, in accordance with their similar habits. Some further explanation, however, of the embryo not undergoing any metamorphosis is perhaps requisite. If, on the other hand, it profited the young to follow habits of life in any degree different from those of their parent, and consequently to be constructed in a slightly different manner, then, on the principle of inheritance at corresponding ages, the active young or larvæ might easily be rendered by natural selection different to any conceivable extent from their parents. Such differences might, also, become correlated with successive stages of development; so that the larvæ, in the first stage, might differ greatly from the larvæ in the second stage, as we have seen to be the case with cirripedes. The adult might become fitted for sites or habits, in which organs of locomotion or of the senses, &c., would be useless; and in this case the final metamorphosis would be said to be retrograde. As all the organic beings, extinct and recent, which have ever lived on this earth have to be classed together, and as all have been connected by the finest gradations, the best, or indeed, if our collections were nearly perfect, the only possible arrangement, would be genealogical. Descent being on my view the hidden bond of connexion which naturalists have been seeking under the term of the natural system. On this view we can understand how it is that, in the eyes of most naturalists, the structure of the embryo is even more important for classification than that of the adult. For the embryo is the animal in its less modified state; and in so far it reveals the structure of its progenitor. In two groups of animal, however much they may at present differ from each other in structure and habits, if they pass through the same or similar embryonic stages, we may feel assured that they have both descended from the same or nearly similar parents, and are therefore in that degree closely related. Thus, community in embryonic structure reveals community of descent. It will reveal this community of descent, however much the structure of the adult may have been modified and obscured; we have seen, for instance, that cirripedes can at once be recognised by their larvæ as belonging to the great class of crustaceans. As the embryonic state of each species and group of species partially shows us the structure of their less modified ancient progenitors, we can clearly see why ancient and extinct forms of life should resemble the embryos of their descendants,—our existing species. Agassiz believes this to be a law of nature; but I am bound to

READING: THE ORIGIN OF SPECIES BY MEANS OF NATURAL SELECTION, 1ST EDITION-1859 | 23

confess that I only hope to see the law hereafter proved true. It can be proved true in those cases alone in which the ancient state, now supposed to be represented in many embryos, has not been obliterated, either by the successive variations in a long course of modification having supervened at a very early age, or by the variations having been inherited at an earlier period than that at which they first appeared. It should also be borne in mind, that the supposed law of resemblance of ancient forms of life to the embryonic stages of recent forms, may be true, but yet, owing to the geological record not extending far enough back in time, may remain for a long period, or for ever, incapable of demonstration. Thus, as it seems to me, the leading facts in embryology, which are second in importance to none in natural history, are explained on the principle of slight modifications not appearing, in the many descendants from some one ancient progenitor, at a very early period in the life of each, though perhaps caused at the earliest, and being inherited at a corresponding not early period. Embryology rises greatly in interest, when we thus look at the embryo as a picture, more or less obscured, of the common parent-form of each great class of animals.

RUDIMENTARY, ATROPHIED, OR ABORTED ORGANS Organs or parts in this strange condition, bearing the stamp of inutility, are extremely common throughout nature. For instance, rudimentary mamrnæ are very general in the males of mammals: I presume that the “bastard-wing” in birds may be safely considered as a digit in a rudimentary state: in very many snakes one lobe of the lungs is rudimentary; in other snakes there are rudiments of the pelvis and hind limbs. Some of the cases of rudimentary organs are extremely curious; for instance, the presence of teeth in foetal whales, which when grown up have not a tooth in their heads; and the presence of teeth, which never cut through the gums, in the upper jaws of our unborn calves. It has even been stated on good authority that rudiments of teeth can be detected in the beaks of certain embryonic birds. Nothing can be plainer than that wings are formed for flight, yet in how many insects do we see wings so reduced in size as to be utterly incapable of flight, and not rarely lying under wing-cases, firmly soldered together! The meaning of rudimentary organs is often quite unmistakeable: for instance there are beetles of the same genus (and even of the same species) resembling each other most closely in all respects, one of which will have full-sized wings, and another mere rudiments of membrane; and here it is impossible to doubt, that the rudiments represent wings, liudimentary organs sometimes retain their potentiality, and are merely not Some of the cases of rudimentary developed: this seems to be the case with the mammre of male organs are extremely curious; for mammals, for many instances are on record of these organs instance, the presence of teeth in having become well developed in full-grown males, and having foetal whales, which when grown secreted milk. So again there are normally four developed and two rudimentary teats in the udders of the genus Bos, but in up have not a tough in their heads; our domestic cows the two sometimes become developed and and the presence of teeth, which give milk. In individual plants of the same species the petnever cut through the gums, in the als sometimes occur as mere rudiments, and sometimes in a upper jaws of our unborn calves. well-developed state. In plants with separated sexes, the male

24 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

flowers often have a rudiment of a pistil; and Kölreuter found that by crossing such male plants with an hermaphrodite species, the rudiment of the pistil in the hybrid offspring was much increased in size; and this shows that the rudiment and the perfect pistil are essentially alike in nature. An organ serving for two purposes, may become rudimentary or utterly aborted for one, even the more important purpose; and remain perfectly efficient for the other. Thus in plants, the office of the pistil is to allow the pollen-tubes to reach the ovules protected in the ovarium at its base. The pistil consists of a stigma supported on the style; but in some Compositæ the male florets, which of course cannot be fecundated, have a pistil, which is in a rudimentary state, for it is not crowned with a stigma; but the style remains well developed, and is clothed with hairs as in other compositlarvæ, for the purpose of brushing the pollen out of the surrounding anthers. Again, an organ may become rudimentary for its proper purpose, and be used for a distinct object: in certain fish the swim-bladder seems to be rudimentary for its proper function of giving buoyancy, but has become converted into a nascent breathing organ or lung. Other similar instances could be given. Rudimentary organs in the individuals of the same species are very liable to vary in degree of development and in other respects. Moreover, in closely allied species, the degree to which the same organ has been rendered rudimentary occasionally differs much. This latter fact is well exemplified in the state of the wings of the female moths in certain groups. Rudimentary organs may be utterly aborted; and this implies, that we find in an animal or plant no trace of an organ, which analogy would lead us to expect to find, and which is occasionally found in monstrous individuals of the species. Thus in the snapdragon (antirrhinum) we generally do not find a rudiment of a fifth stamen; but this may sometimes be seen. In tracing the homologies of the same part in different members of a class, nothing is more common, or more necessary, than the use and discovery of rudiments. This is well shown in the drawings given by Owen of the bones of the leg of the horse, ox, and rhinoceros. It is an important fact that rudimentary organs, such as teeth in the upper jaws of whales and ruminants, can often be detected in the embryo, but afterwards wholly disappear. It is also, I believe, a universal rule, that a rudimentary part or organ is of greater size relatively to the adjoining parts in the embryo, than in the adult; so that the organ at this early age is less rudimentary, or even cannot be said to be in any degree rudimentary. Hence, also, a rudimentary organ in the adult, is often said to have retained its embryonic condition. I have now given the leading facts with respect to rudimentary organs. In reflecting on them, every one must be struck with astonishment: for the same reasoning power which tells us plainly that most parts and organs are exquisitely adapted for certain purposes, tells us with equal plainness that these rudimentary or atrophied organs, are imperfect and useless. In works on natural history rudimentary organs are generally said to have been created “for the sake of symmetry,” or in order “to complete the scheme of nature;” but this seems to me no explanation, merely a restatement of the fact. Would it be thought sufficient to say that because planets revolve in elliptic courses round the sun, satellites follow the same course round the planets, for the sake of symmetry, and to complete the scheme of nature? An eminent physiologist accounts for the presence of rudimentary organs, by supposing, that they serve to excrete matter in excess, or injurious to the system; but can we suppose that the minute papilla, which often represents the pistil in male flowers, and which is formed merely of cellular tissue, can thus act? Can we suppose that the formation of rudimentary teeth winch are subsequently absorbed, can be of any service to the rapidly growing embryonic calf by the excretion of precious phosphate of lime? When a man’s fingers have been amputated, imperfect nails sometimes appear

READING: THE ORIGIN OF SPECIES BY MEANS OF NATURAL SELECTION, 1ST EDITION-1859 | 25

on the stumps: I could as soon believe that these vestiges of nails have appeared, not from unknown laws of growth, but in order to excrete horny matter, as that the rudimentary nails on the fin of the manatee were formed for this purpose. On my view of descent with modification, the origin of rudimentary organs is simple. We have plenty of cases of rudimentary organs in our domestic productions,—as the stump of a tail in tailless breeds,—the vestige of an ear in earless breeds,—the reappearance of minute dangling horns in hornless breeds of cattle, more especially, according to Youatt, in young animals,—and the state of the whole flower in the cauliflower. We often see rudiments of various parts in monsters. But I doubt whether any of these cases throw light on the origin of rudimentary organs in a state of nature, further than by showing that rudiments can be produced; for I doubt whether species under nature ever undergo abrupt changes. I believe that disuse has been the main agency; that it has led in successive generations to the gradual reduction of various organs, until they have become rudimentary,—as in the case of the eyes of animals inhabiting dark caverns, and of the wings of birds inhabiting oceanic islands, which have seldom been forced to take flight, and have ultimately lost the power of flying. Again, an organ useful under certain conditions, might become injurious under others, as with the wings of beetles living on small and exposed islands; and in this case natural selection would continue slowly to reduce the organ, until it was rendered harmless and rudimentary. Any change in function, which can be effected by insensibly small steps, is within the power of natural selection; so that an organ rendered, during changed habits of life, useless or injurious for one purpose, might easily be modified and used for another purpose. Or an organ might be retained for one alone of its former functions. An organ, when rendered useless, may well be variable, for its variations cannot be checked by natural selection. At whatever period of life disuse or selection reduces an organ, and this will generally be when the being has come to maturity and to its full powers of action, the principle of inheritance at corresponding ages will reproduce the organ in its reduced state at the same age, and consequently will seldom affect or reduce it in the embryo. Thus we can understand the greater relative size of rudimentary organs in the embryo, and their lesser relative size in the adult. But if each step of the process of reduction were to be inherited, not at the corresponding age, but at an extremely early period of life (as we have good reason to believe to be possible) the rudimentary part would tend to be wholly lost, and we should have a case of complete abortion. The principle, also, of economy, explained in a former chapter, by which the materials forming any part or structure, if not useful to the possessor, will be saved as far as is possible, will probably often come into play; and this will tend to cause the entire obliteration of a rudimentary organ. As the presence of rudimentary organs is thus due to the tendency in every part of the organisation, which has long existed, to be inherited—we can understand, on the genealogical view of classification, how it is that systematists have found rudimentary parts as useful as, or even sometimes more useful than, parts of high physiological importance. Rudimentary organs may be compared with the letters in a word, still retained in the spelling, but become useless in the pronunciation, but which serve as a clue in seeking for its derivation. On the view of descent with modification, we may conclude that the existence of organs in a rudimentary, imperfect, and useless condition, or quite aborted, far from presenting a strange difficulty, as they assuredly do on the ordinary doctrine of creation, might even have been anticipated, and can be accounted for by the laws of inheritance.

26 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

SUMMARY In this chapter I have attempted to show that the arrangement of all organic beings throughout all time in groups under groups—that the nature of the relationships by which all living and extinct organisms are united by complex, radiating, and circuitous lines of affinities into a few grand classes—the rules followed and the difficulties encountered by naturalists in their classifications—the value set upon characters, if constant and prevalent, whether of high or of the most trifling importance, or, as with rudimentary organs of no importance—the wide opposition in value between analogical or adaptive characters, and characters of true affinity; and other such rules—all naturally follow if we admit the common parentage of allied forms, together with their modification through variation and natural selection, with the contingencies of extinction and divergence of character. In considering this view of classification, it should be borne in mind that the element of descent has been universally used in ranking together the sexes, ages, dimorphic forms, and acknowledged varieties of the same species, however much they may differ from each other in structure. If we extend the use of this element of descent—the one certainly known cause of similarity in organic beings—we shall understand what is meant by the Natural System: it is genealogical in its attempted arrangement, with the grades of acquired difference marked by the terms, varieties, species, genera, families, orders, and classes. On this same view of descent with modification, most of the great facts in Morphology become intelligible—whether we look to the same pattern displayed by the different species of the same class in their homologous organs, to whatever purpose applied, or to the serial and lateral homologies in each individual animal and plant. On the principle of successive slight variations, not necessarily or generally supervening at a very early period of life, and being inherited at a corresponding period, we can understand the leading facts in embryology; namely, the close resemblance in the individual embryo of the parts which are homologous, and which when matured become widely different in structure and function; and the resemblance of the homologous parts or organs in allied though distinct species, though fitted in the adult state for habits as different as is possible. Larvae are active embryos, which have become specially modified in a greater or less degree in relation to their habits of life, with their modifications inherited at a corresponding early age. On these same principles, and bearing in mind that when organs are reduced in size, either from disuse or through natural selection, it will generally be at that period of life when the being has to provide for its own wants, and bearing in mind how strong is the force of inheritance—the occurrence of rudimentary organs might even have been anticipated. The importance of embryological characters and of rudimentary organs in classification is intelligible, on the view that a natural arrangement must be genealogical. Finally, the several classes of facts which have been considered in this chapter, seem to me to proclaim so plainly, that the innumerable species, genera and families, with which this world is peopled, are all descended, each within its own class or group, from common parents, and have all been modified in the course of descent, that I should without hesitation adopt this view, even if it were unsupported by other facts or arguments.

READING: THE ORIGIN OF SPECIES BY MEANS OF NATURAL SELECTION, 1ST EDITION-1859 | 27

CHAPTER 2

MENDELIAN GENETICS AND THE MODERN SYNTHESIS

I N TR T R O D U C TI TION Charles Darwin and his colleagues did not have the knowledge of genetics to understand how traits were passed on from one generation to the next. The information, however, was already being laid out by an Austrian monk; his mathematical approach to understanding inheritance may have been one reason for the lack of interest in his work until it was rediscovered in 1900. At first, scientists believed this genetic knowledge could make Darwin’s theory of evolution obsolete, but a small group of scientists saw the connections and formed the school of modern synthesis. Genetics enables us to understand where variation comes from, how it is passed on, and how evolution changes populations—and this, in turn, will enable us to draw family trees without looking at morphology, which can be misleading due to homoplasies, and gives us new ways to understand primate behavior. Thus, genetics has revolutionized human evolutionary studies.

L E A R N I N G O BJEC LEAR B J E C TTII VES VES 1. 2. 3. 4.

Understand the principles of Mendelian genetics. Know the similarities and differences of Mendelian, polygenic, and pleiotropic traits. Understand the concepts of mutation, genetic drift, gene flow, and recombination. Understand how modern synthesis united evolution by natural selection to genetics.

29

30 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

MENDELIAN GENETICS

G

enetics is the study of biological mechanisms that guide cellular and physiological functions. This helps to explain the way that traits are passed from one generation to the next. For anthropologists, understanding genetics equals understanding of evolutionary mechanisms. For thousands of years, people tried to understand how traits are passed on. Most theories were inaccurate. Farmers, herders, and other selective breeders knew they could change frequency and expression of traits through selective breeding, but they did not understand the mechanisms involved. In the nineteenth century the question of genetics continued with Darwin. Most theories of genetics were based on the concept of blending of traits. During Darwin’s lifetime, Gregor Mendel (1822–1884), a monk living in what is now the Czech Republic and who studied botany, physics, and mathematics at the University of Vienna, was conducting and publishing his work on experiments completed in the monastery gardens. These experiments led him to explore the various ways in which traits could be expressed in hybrid plants. Mendel also hoped that by studying the crosses between two strains of purebred plants, he could determine and predict different forms of hybrids. By evaluating the differences, inheritance may be explained. Mendel chose to examine pea plants. He looked at seven traits, each of which could only be expressed in two ways, such as whether seed shape was smooth or wrinkled, seed color was yellow or green, seed coat was gray or white, the plant stem was tall or short. He noted and carefully recorded the number of plants in each generation with a given trait. What he found was that the ratio of plant varieties in a generation of offspring yielded clues about inheritance. And, as he continually tested his ideas by performing more experiments, he formulated laws of inheritance and discovered how traits are transmitted from one generation to the next. Mendel figured out some basic tenets of how genetics works, which are now called the principle of Mendelian genetics. He did this through a simple graph and many generations of pea plants. The graph is called a Punnett square, which helped Mendel figure out ratios of inheritance. The Punnett square is useful in predicting the next generation genotypes (i.e., the genetic makeup of an individual and refers to an organism’s entire genetic makeup or to specific alleles at a particular locus) and phenotypes (i.e., the observable or detectable physical characteristics of an organism). Let us consider pea plant seed color. If one took pure breed parents (Y, yellow; y, green) and then looked at the next generation offspring (also known as F-1), they were not intermediate in color; they were yellow. A second generation (F-2) showed that when Mendel allowed the offspring to self-fertilize, they produced another generation in which three were yellow FIGURE 2.1: Punnett square

MENDELIAN GENETICS AND THE MODERN SYNTHESIS | 31

and one was green. This relationship is expressed as a phenotypic ratio of 3:1 and typifies Mendelian traits. Mendelian traits are those that are influenced by alleles (variations of a gene) at only one genetic locus; examples include blood types, sickle-cell anemia, and Tay-Sachs disease. A gene is a segment of DNA that codes for a trait. Since the traits Mendel observed were all of this type of inheritance, he was able to conclude that genes were discrete, there was segregation of alleles, and that some alleles could cover the expression of other alleles. These are some of the main tenets of genetics. The results cited above on pea color suggested to Mendel that different expressions of a trait were controlled by discrete units and that these discrete units occurred in pairs. Thus, Mendel introduced the principle of segregation, which puts forth that genes come in pairs and that when gametes (or sex cells) get produced each gamete gets one gene at random from each gene pair but not both. The genes are inherited from the mother’s side and the father’s side. Each gamete contains only half of the genetic information. During fertilization, the full number of chromosomes is restored. Mendel recognized that the expression of green was absent in the first generation of offspring, but it had not disappeared because it came back in the next generation. This observation led him to name some traits recessive and some dominant. Recessive alleles need to be homozygous (i.e., have the same type of allele from both parents—e.g., yy) for the trait to be expressed. A trait that is expressed in both the heterozygous form (or having different alleles from each parent, e.g., Yy) or the homozygous form is dominant. In the case of the peas, a heterozygote pea has an allele for yellow and an allele for green. Dominant alleles prevent expression of recessive alleles in heterozygotes. Concepts of dominance and recessiveness are still important concepts in genetics today. In 1866, Mendel’s results were published, but the methodology and statistical nature of his work was beyond his time and their significance was overlooked until the end of the nineteenth century. His work was incredibly thorough—the methodology was described in detail, data were recorded in an organized manner, and the statistics were laid out clearly; anyone could replicate these studies and their results, one of the signatures of a good scientist. Mendelian traits are also known as discrete traits or traits of simple inheritance. They are characterized by alleles at only one genetic locus (i.e., the site of the gene on the chromosome) or in some cases more than one locus but very closely linked and, therefore, they act as one locus. The most complete list of Mendelian traits in humans is V. A. McKusick’s Mendelian Inheritance in Man, which can be found online at http://www.ncbi.nlm.nih.gov/omim. Currently it lists nearly ten thousand human characteristics shown to be inherited according to Mendelian principles. Although there are Mendelian traits visible to the eye, many are not. Most Mendelian traits are biochemical in nature, which often include the lack of an enzyme (a protein that causes reactions, such as digestive enzymes that break down foods for nutrients). Many genetic disorders are Mendelian traits and result from harmful alleles, which can be either dominant or recessive. Some examples of dominant Mendelian traits include dwarfism, Huntington disease (a progressive, degenerative disease that causes nerve cells in the brain to waste away), and familial hypercholesterolemia (genetically caused high cholesterol that can lead to clogged arteries and heart attacks). If the disorder lies on a dominant allele, then a person needs only to inherit one copy of a harmful allele for the condition to be present. Recessive conditions are commonly associated with a lack of an enzyme and some of these traits include cystic fibrosis (a life-threatening disorder that causes severe lung damage and nutritional deficiencies), Tay-Sachs disease (a buildup of fatty proteins in the brain, which hurts the baby’s sight,

32 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

hearing, movement, and mental development), and sickle-cell anemia (a condition in which there are not enough healthy red blood cells to carry oxygen throughout the body, which results in pain weakness and shorter life spans). For a person to actually be inflicted with any of these diseases, he or she needs two copies of the recessive allele. Often these diseases are termed ethnic diseases since inbreeding increases the chance of inheriting the two recessive alleles. These diseases can skip a generation and an individual who is heterzygous in these cases is known as a carrier. Carriers do not actually have the recessive trait, but they can pass the allele to their offspring. The mating of two carriers will have a 25 percent chance of having an affected child. Often students express confusion about dominance and recessiveness due to the connotations these words have in other contexts. Expression of dominance and recessiveness is not always an allor-nothing situation. There may be a slight influence from the recessive trait, but it is not as dramatic as the dominant trait. For example, carriers of Tay-Sachs do not have the disease, but they do have a lower amount of the enzyme that diseased individuals lack when compared with individuals who are not carriers and do not have Tay-Sachs. Knowing this, genetic counselors can test whether someone is a carrier for Tay-Sachs disease before the person starts a family. Many biochemical advances have led to tests for genetic predisposition of disorders such as Tay-Sachs. It is now fairly common for couples to seek genetic counseling before beginning their family. Also, dominance does not mean stronger or better alleles. Genetic disorders can be dominant or recessive. Dominant alleles are not necessarily more frequent in populations; the genetic term dominance only means it does not need to be homozygous to be expressed. Within Mendelian genetics there are different types of inheritance that can be examined using pedigree charts (which show family relationships and who is inflicted with the trait). These charts are important to be able to establish the pattern of inheritance in genetic traits, especially those related to disease. They help to determine an individual’s risk of inheriting diseases and passing them on, so being able to understand how that gene is passed on is essential. Six modes of Mendelian inheritance have been recognized in humans, three of which we will cover here. In autosomal dominant traits, the genes only require one allele to express the trait, and the heterozygote and homozygote for the mutation show the same phenotype. Harmful autosomal dominant traits are rare and often the homozygous forms are more severe and lead to death. Thus, we do not often have the opportunity to see the homozygous phenotype. For example, achondroplasia dwarfism in a double dose is lethal. The lethality of the homozygous condition was not appreciated until achondroplasic individuals married and it was noted that approximately 25 percent of the fetuses from such unions did not survive. Autosomal dominant traits are often FIGURE 2.2: Autosomal dominant

MENDELIAN GENETICS AND THE MODERN SYNTHESIS | 33

associated with malformations or other physical features, such as Treacher Collins syndrome (a jaw and face deformity that includes a very small jaw, absence of external ears, and cleft palate). They tend to be due to the presence of an abnormal protein. Some of them are age dependent, such as Alzheimer disease. Autosomal recessive traits require the affected person to have two mutant alleles. Parents of a person with autosomal recessive disorder are often heterozygotes and they are usually not affected. Their probability of having another affected child is 25 percent when married to another carrier. The normal sibs of an affected child have a two-thirds probability of being a carrier. Autosomal recessive trait phenotypes are less variable than autosomal dominant phenotypes. If someone has a rare autosomal recessive disorder, then he or she may be the result of a consanguineous mating or the parents may be from a small village where people are more apt to be related to one another. The rarer the recessive phenotype, the more likely the parents are to be related. FIGURE 2.3: Autosomal recessive Sex-linked traits are controlled by loci on sex chromosomes; the term sex-linked refers to the fact that these genes are located on the chromosome 23 pair (the X or Y chromosomes). Nearly all such loci have no role in primary sex determination. Of the more than two hundred forty traits suspected to result from this form of inheritance, nearly all are controlled by the X chromosome. The Y chromosome has hardly any genetic information. One example of a sexlinked trait is hemophilia, caused by a recessive allele at a locus on the X chromosome. Hemophilia results from the lack of a clotting factor in the blood, and affected individuals suffer from bleeding episodes and may hemorrhage to death from incidents that most people would consider trivial. The most striking feature shown by this pattern of inheritance is that usually only males are affected. Females possess two X chromosomes and therefore need to have the allele in both chromosomes; males possessing only one X chromosome need only to be affected on the X chromosome. They are referred to as hemizygous rather than homozygous. Males are more likely to have X recessive traits expressed than females. Males are much more likely to be affected by these X chromosome conditions whether they are recessive or dominant. Some of the basic characteristics of sex-linked traits are for rare traits: more males are affected than females; female carriers are not expected to be affected; the daughters of an affected man will all be carriers.

NON-MENDELIAN PATTERNS OF INHERITANCE Although many genes are Mendelian, other forms of inheritance exist and they include polygenic inheritance and pleiotropic inheritance. Polygenic inheritance refers to traits that are influenced by genes at two or more loci. Examples of polygenic traits include skin color and height. Many polygenic traits can also be influenced by the environment; for example, height can be negatively influenced by poor nutrition and the sun can darken skin color. Polygenic traits also happen to be continuous rather than discrete, and the huge number of these traits is probably why blending theory was so popular

34 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

prior to the knowledge of Mendelian genetics. These traits have a wide range of expressions that form a graded series. The most frequently cited instance of polygenic inheritance in humans is skin color. The single most important genetic factor that influences skin color is the amount of pigment melanin present; melanin is believed to be influenced by three to six genetic loci, with each locus having at least two alleles. This is why there is such a great variation in skin color. Those individuals with homozygous alleles at all loci for melanin production are the darkest; those having only alleles that code for reduced melanin production are the lightest. And, of course, there are many possibilities in between. Polygenic traits actually account for most of the readily observable phenotypic variation seen in humans. Because these traits can be measured (for example, height is measured in meters or feet and inches), scientists often use statistics to compare populations, and this in the past was used for racial classification as well. These types of statistics are not possible for Mendelian traits, which cannot have averages, but rather only frequencies in a population or between populations. Mendelian and polygenic inheritance produce different types of phenotypic variation, but it is important to understand that even for polygenic characteristics Mendelian principles still apply. The principles apply at each of the loci involved. If a trait is influenced by seven loci, then each locus may have two or more alleles, with some perhaps being dominant to others or with the alleles being codominant. It is the combined action of the alleles at the seven sites—perhaps also interacting with the environment—that results in the phenotype. As a final note, phenotype is not only the expression of the genotype, but rather it includes environmental effects as well. The genotype basically sets limits and potentials for development, but it also interacts with the environment. For many traits, scientists have developed statistical methods to determine how much is due to genes and how much is due to the environment. Much of this research involves the use of twins and pedigree analysis; however, it is difficult to determine the specific environmental components that influence the phenotype. As previously cited, many polygenic traits are obviously influenced by the environment. Mendelian traits are much less likely to be influenced by the environment. Another form of non-Mendelian inheritance is pleiotropy, which occurs when a single gene influences more than one phenotypic expression. Pleiotropic effects are very common and some examples include Marfan disease (a disorder of the connective tissues), diabetes, and PKU (a metabolic disorder that causes mental retardation if high protein foods are not avoided). Pleiotropy explains why we often see certain traits going hand in hand. Regulatory genes, such as those that control when we start and stop growing, are pleiotropic. Often traits that are matched with other traits, such as body proportions, are pleiotropic.

MODERN SYNTHESIS Modern synthesis takes the information that was outlined by Mendel and merges it with natural selection. Modern synthesis emerged in the 1920s, only two decades after the rediscovery of Mendel’s work on pea plants. With modern synthesis, evolution is redefined and split into two stages. The first stage is the production and distribution of variation. This variation comes in the form of allelic variation that was proposed by Mendel in his genetic research. These alleles, which code for different variations of traits, are passed on from parent to offspring; thus, they are how traits are inherited. And,

MENDELIAN GENETICS AND THE MODERN SYNTHESIS | 35

the second stage of evolution in modern synthesis is that natural selection (or sexual selection) acts on this variation. Evolution is now redefined as a change in allele frequencies from one generation to the next. The expression of the trait is selected for or against, but it is the alleles that are passed on or not. This is why recessive alleles are not eliminated easily when they are deleterious, but dominant deleterious alleles are less common. Also, the Hardy-Weinberg equilibrium is a theory that helps explain why dominant alleles do not overtake recessive alleles. The Hardy-Weinberg equilibrium FIGURE 2.4: Albino peacock theory states mating is random. Random mating means we are not selecting based on genotype; we are selecting phenotypes. Those recessive alleles that are hidden from expression due to heterozygosity will not be selected against by mates or nature. Now that you are beginning to understand how alleles are selected for or against, let us examine the ways to get new variation and the ways the variation is distributed. The main concepts of modern synthesis include mutation, gene flow, genetic drift, and recombination. Mutation is basically a change in DNA. Mutations can be also viewed as a way to make new alleles. These changes take place when a mistake occurs during DNA replication. When these mistakes occur in non-sex cells, such as skin cells, you often end up with a disease, such as cancer. Radiation causes DNA replication errors and, thus, results in various forms of cancer or birth defects (if the female is pregnant when exposed to an x-ray). These mutations, however, do not get passed on to the next generation and, thus, do not affect evolution. Mutations in the sex cells occur more frequently than in non-sex cells (because sex-cell division is more complex than non-sex-cell division). Any mutation that affects sex cells will be passed on to offspring. Mutations, however, are not inherently good or bad. Whether the mutation is good or bad will be determined by the environment; thus, the mutation will be selected for or against. This is the natural selection aspect of genetics. But in our current environment, some mutations have been defined as deleterious (harmful), such as Down syndrome, caused by a faulty splitting and rejoining of DNA so that there is an extra chromosome 21. Mutations are most often neutral in the environment in which they occur, but sometimes a neutral mutation can turn out to be beneficial. When a mutation is positive in a specific environment, the mutation will be selected for and increase in frequency. If this occurs only in one part of the population, we may get the emergence of a new species. Another good example of a mutation that can vary in its usefulness is albinism in animals. Usually albino animals do not survive and reproduce because they cannot hide from predators, but humans have been very protective of albinos due to their uniqueness and have formed societies to help preserve their existence. Gene flow and genetic drift are theories that explain how allelic variation is distributed. Gene flow occurs when there is an exchange between genes of various groups. It occurs frequently in humans; for example, when American soldiers went to Korea and Vietnam during the wars of the 1950s and 1960s, they often fell for local women, married them, and started families. The genes

36 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

FIGURE 2.5: Founder efect

from the American soldiers, who were most likely to be African American or European American, flowed together with Asian genes. The two populations had different variations of alleles in some traits and different frequencies of alleles in other traits; thus, the joining of these populations brought about new combinations of alleles. When gene flow occurs for a long enough period in one direction, you may end up with a reduction in variation. The opposite of gene flow is genetic drift, which occurs when not all gene combinations are passed on. FIGURE 2.6 Some alleles never enter the mating pool. Two types of genetic drift are commonly discussed in evolutionary studies: founder effects and population bottlenecks. Founder effects occur when a small group of individuals leave the greater population and start a new population. Common examples in humans include religious groups that have isolated themselves from others outside their religion, such as the Amish populations in the

MENDELIAN GENETICS AND THE MODERN SYNTHESIS | 37

United States. Another example is when certain regions are uninhabited by large populations and inbreeding arises, such as in the mountainous regions of the Appalachians. In the founder effect populations, we see an increase in certain deformities, such as extra teeth and fingers. In extreme cases, founder effects may lead to the speciation and subsequent evolution of new species. A population bottleneck occurs by chance. It is an evolutionary occurrence when more than 50 percent of a population is prevented from reproducing. This is usually in terms of a natural disaster that kills off much of the mating population. A graph of this change resembles the neck of a bottle, from wide to narrow; hence, the name. Population bottlenecks increase genetic drift, as the rate of drift is inversely proportional to the population size, which is reduced. The lack of modern human genetic variation has been proposed to be the result of a volcanic eruption that occurred about seventy-five thousand years ago, when a volcano erupted on Sumatra and caused massive temperature changes, which wiped out many species and a large part of the human population. This would have had the result of limiting the overall level of genetic diversity in the human species, possibly by a large amount. Finally, recombination acts as a way to distribute alleles. In each chromosome in our sperm or egg cells there is a mixture of genes from our mother and father. You can think of recombination as way of gene shuffling. Our genes lie at specific locations on chromosomes and there are two of each chromosome type in every cell. Every chromosome is paired: we inherit one from our mother and the other from our father. When an organism produces gametes, the gametes end up with only one of each chromosome per cell. In meiosis, chromosomes line up and the DNA of the chromosome is broken on both chromosomes in several places and rejoined with the other strand. Later, the two chromosomes are split into two separate cells that divide and become gametes. Both of the chromosomes are a mix of alleles from the mother and father. Recombination creates new combinations of alleles. Recombination can occur not only between genes, but also within genes. Recombination within a gene can form a new allele. Recombination is a mechanism of evolution because it adds new alleles and combinations of alleles to the gene pool.

SU M MMA M AR RY Some final things to include about the modern synthesis: Natural selection still selects the individual; alleles do not interact with the environment. Successful individuals pass on their alleles and every individual will have some alleles that are beneficial in their environment and some that will not be, which is why we do not get rid of all harmful alleles. And you can have alleles that have lost their current function and are coded for vestigial traits. On the other hand, you can have exadaptations in which an allele may have more than one purpose. A good example of this is the allele that allowed some Europeans to naturally resist smallpox (a contagious, disfiguring, and deadly disease caused by the variola virus), which was eradicated by 1980 through vaccinations, and is now proving to aid in HIV resistance that occurs in northern Europeans. Although modern synthesis brought together genes and evolution, it was not until the 1950s that we understood how DNA functions. With the discovery of the double helix and the genomic revolution, anthropologists can begin to use DNA to draw family trees, use molecules as clocks, and even look at every aspect of the genome.

38 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

G LLO O SSAR S SA R Y Alleles: variation of a gene. Autosome: A trait on a non-sex chromosome. Dominant alleles: Those that are expressed in heterozygote and homozygote forms; they can prevent expression of recessive alleles in heterozygotes. Founder effects: Occur when a small group of individuals leave the greater population and start a new population. Gene: Segment of DNA that codes for a trait. Gene flow: Occurs when there is an exchange between genes of various groups. Genetic drift: Occurs when not all gene combinations are passed on. Basically, some alleles never enter the mating pool. Genotypes: The genetic makeup of an individual and refers to an organism’s entire genetic makeup or to specific alleles at a particular locus. Homozygous: Have the same type of allele from both parents. Heterozygous: Have different alleles from each parent. Mutation: A change in DNA. Mutations can also be thought of as a way to create new alleles. Phenotypes: The observable or detectable physical characteristics of an organism. Pleiotropy: When a single gene influences more than one phenotypic expression. Polygenic inheritance: Refers to traits that are influenced by genes at two or more loci. Population bottlenecks: An evolutionary occurrence when more than 50 percent of a population is prevented from reproducing. Recessive alleles: Those alleles that need to be homozygous to be expressed. Recombination: Processes that give rise to offspring who have combinations of genes different from those of either parent, such as crossing over and independent assortment of chromosomes during gamete formation. Sex-linked inheritance: The pattern of inheritance in which the trait is on the sex chromosome.

SEC T I O N 1 R EAD I N G S

RE EAD AD I N G 2 Effects of Sexual Dimorphism on Facial Attractiveness demonstrates that we too are affected by Sexual Selection; what is attractive is in part formulated by evolution. Attraction is complex and has a biological component. Beauty is not truly in the eye of the beholder, but rather structured by conflicting evolutionary desires that help to prevent runaway selection. Human Attraction studies by human evolutionary psychologists, biologists, and anthropologists have also examined: • Hip-to-Waist Ratios and found male cross-cultural preferences for larger hips in comparison to waists. • Waist-to-Shoulder Ratios and have found females prefer males with broader shoulders than waists. • Cross-cultural preferences for symmetry. • Cross-cultural preferences for youthful appearances.

Effects of Sexual Dimorphism on Facial Attractiveness By D. I. Perrett, K. J. Lee, I. Penton-Voak, D. Rowland, S. Yoshikawa, D. M. Burt, S. P. Henzi, D. L. Castles, and S. Akamatsu

T

estosterone-dependent secondary sexual Subjects preferred feminized to characteristics in males may signal im1 average shapes of a female face. munological competence and are sexually his preference applied across UK selected for in several species.2,3 In humans, oestrogen-dependent characteristics of the female body and Japanese populations but was correlate with health and reproductive fitness and stronger for within-population are found attractive.4–6 Enhancing the sexual dimorjudgements, which indicates that phism of human faces should raise attractiveness by attractiveness cues are learned. enhancing sex-hormone-related cues to youth and fertility in females,5,7–11 and to dominance and immunocompetence in males.5,12,13 Here we report the results of asking subjects to choose the most attractive faces from continua that enhanced or diminished differences between the average shape of female and male faces. As predicted, subjects preferred feminized to average shapes of a female face. This preference applied across UK and Japanese populations but was stronger for within-population judgements, which indicates that attractiveness cues are learned. Subjects preferred feminized to average or masculinized shapes of a male face. Enhancing masculine facial characteristics increased both perceived dominance and negative attributions (for example, coldness or dishonesty) relevant to relationships and paternal investment. These results indicate a selection pressure that limits sexual dimorphism and encourages neoteny in humans. Computer-graphic techniques can be used to construct ‘‘average’’ male and female faces by digitally blending photographs of individuals of the same sex14 ( Fig. 60.1). Sexual dimorphism in face shape can then be enhanced or diminished14,15 ( Fig. 60.2). We presented such manipulations of both Japanese and Caucasian face stimuli to Japanese subjects in Japan and Caucasian subjects in Scotland. Perrett, D. I.; Lee, K. J.; Penton-Voak, I., “Effects of Sexual Dimorphism on Facial Attractiveness,” Foundations in Social Neuroscience, pp. 937-942. Copyright © 2002 by MIT Press. Reprinted with permission.

41

42 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

The amount of transformation (that is, masculinization or feminization) that was applied by subjects to obtain the most attractive face shape was compared with a mean of 0% predicted by the null hypothesis (that altering sex-related characteristics would not affect attractiveness) and predicted by the hypothesis that attractiveness is averageness.16 The face shape selected by Caucasian subjects as most attractive (from the shape range available) was significantly feminized for both the Caucasian female face (mean level of feminization was 24.2%; t49 = 7.6, P < 0.001) and the Japanese female face continua (mean 10.2%; t49 = 2.3, P = 0.027). Japanese subjects also selected significantly feminized versions of the female stimuli for both the Japanese (mean 22.9%; t41 = 7.6, P = 0.001) and the Caucasian (mean 15.3%; t41 = 4.5, P = 0.001) female face continua. Three-way analysis of variance (ANOVA) of the level of transform applied by subjects to define attractive face shapes revealed no main effect of subject sex (F1,88 = 1.58, P = 0.21), population of subjects (F1,88 = 0.32, P = 0.57) or type of stimulus face ( Japanese/Caucasian; F1,88 = 1.42, P = 0.24). The only significant interaction between main effects was that between subject population and type of stimulus face (F1,88 = 17.06, P < 0.001), which was attributable to the greater degree of feminization preferred for stimulus faces of the subject’s own population ( Fig. 60.3a). Previous studies show cross-population consistency in judgements of attractiveness.9,11,14,17 Our study shows cross-cultural (between-population) agreement in the preference for feminized to average face shapes, which refutes the averageness hypothesis.14,16 The study also indicates effects of experience FIGURE 60.1: Composite ‘‘average’’ facial images. on judgements of female attractiveness as a greater (a) ‘‘Caucasian’’ female face; (b) ‘‘Caucasian’’ male face; degree of feminization was preferred for faces from (c) ‘‘Japanese’’ female face; (d) ‘‘Japanese’’ male face. the subject’s own population than for faces from a different population. Both generalization and cultural specificity of judgements of attractiveness may result from learning. We find cues to female attractiveness relate to the way that female faces differ from males. Sensitivity to the consistent sex differences in faces (and hence female attractiveness) could be learned through exposure to male and female exemplars. Most differences learned this way will generalize between populations as they reflect the common action of sex hormones during growth. Subjects, however, may become more sensitive to the sexual dimorphism of faces within the subject’s own population because of increased exposure to population-specific male–female variations. For the male face stimuli, the shape selected by Caucasian subjects as most attractive (from the shape Our study shows cross-cultural range available) was significantly feminized for both the (between-population) agreement Caucasian male face (mean level of feminization was in the preference for feminized to 15 %; t49 = 4.22, P < 0.001) and the Japanese male face average face shapes, which refutes continua (mean 9%; t49 = 2.2, P = 0.03). Japanese subjects the averageness hypothesis. also selected significantly feminized versions of the male

READING: EFFECTS OF SEXUAL DIMORPHISM ON FACIAL ATTRACTIVENESS | 43

FIGURE 60.2: Facial images of Caucasian and Japanese females and males that were ‘‘feminized’’ and ‘‘masculinized’’ 50% in shape. (a) Caucasian female, feminized; (b) Caucasian female, masculinized. (c) Caucasian male, feminized; (d) Caucasian male, masculinized. (e) Japanese female, feminized; (f ) Japanese female, masculinized. (g) Japanese male, feminized; (h) Japanese male, masculinized.

stimuli for both the Japanese (mean 20%; t41 = 6.5, P < 0.001) and the Caucasian (mean 17%; t41 = 4.8, P < 0.001) male face continua. For the male stimuli, three-way ANOVA revealed there was no main effect of subject sex (F1,88 = 0.18, P = 0.67), subject population (F1,88 = 2.94, P = 0.09) or type of stimulus face (F1,88 = 0.02, P < 0.89) and no significant interactions between effects. Asymmetries in the facial outline (from the hairline), which remain after cropping, could contribute to judgements. With a different set of Caucasian faces (19 male, 17 female, 30–35 years old), symmetrical composites were made by averaging component faces and their mirror reflections. Caucasian subjects (n = 67, age range 15–40, 23 female) made forced-choice judgements of attractiveness of symmetrical average stimuli that were 50% masculinized or feminized. Masculinization of face shape decreased attractiveness of male (87% of subjects; Binomial test P = 0.001) and female faces (78%; P < 0.001), whereas feminization increased attractiveness of male (64%; P < 0.05) and female faces (53%; P < 0.05). Males have larger faces than females. However, standardizing the distance between pupils removes this size difference. We prepared composite images from a new set of Caucasian faces (26 male, 17 female, 18–21 years old) without standardizing the inter-pupil separation. Manipulation of these composites maintained sexual dimorphism in face shape and size. Caucasian subjects (n = 135, age range 15–71, 65 female) ranked average images that were masculinized and feminized by 50% for attractiveness. Masculinization of the average shape decreased attractiveness of male (74% of subjects; P < 0.000005) and female (76%; P < 0.000005) faces, whereas feminization increased attractiveness rankings for male (58%; P = 0.029) and female (60%; P < 0.013) faces.

44 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Thus, preference for feminized face shapes over average male and female face shapes was found with interactive and forcedchoice methods using different face sets, even when the potential contributions by symmetry and size dimorphism were controlled. To interpret preferences, 50% masculinized, 50% feminized and cropped average images (Fig. 60.2) were rated for perceived characteristics by a new set of subjects. Twenty Caucasian subjects (age range 18–50, 10 female) were presented with four sets of three images that represented the end points of each continuum and the average. Subjects were asked to rank stimuli from one set on seven characteristics (masculinity, dominance, warmth, emotionality, honesty, intelligence and age). The order of testing of characteristics and image sets was randomized. An additional 20 subjects (age range 19–61, 10 female) ranked the stimuli on three further characteristics (cooperativeness, assertiveness and ‘‘good parent’’). For Caucasian and Japanese male faces, increasing the masculinity of face shape across the three set members increased ranking of perceived dominance, masculinity and age but decreased ranking of perceived warmth, emotionality, honesty, cooperativeness and quality as a parent ( Friedman’s χ2 ≥ 15.6, degrees of freedom FIGURE 60.3: he efect of feminiza(d.f.) = 2, P < 0.0005, for each rated dimension). Increasing mas- tion of face shape on judgements of culinity affected the Japanese and Caucasian female face sets in female and male attractiveness. the same way for all characteristics ( χ2 ≥ 8.1, d.f. = 2, P < 0.017, (a) Female stimuli; (b) male stimuli. Overall, subjects preferred a feminine each dimension), except for ‘‘good parent’’ with the Caucasian face shape to an average shape both female faces, where the rank order was average, feminized and within and between populations. he masculinized ( χ2 ≥ 6.7, d.f. = 2, P < 0.035). Increasing masculin- degree of feminization preferred was ity did not consistently decrease apparent intelligence (Caucasian greater within than between populations for female faces. male and female faces, P > 0.5; Japanese female face, P = 0.07; Japanese male face, P = 0.02) or increase attributions of assertiveness (Japanese and Caucasian female faces, P > 0.5; Japanese male face, P = 0.058; Caucasian male face, P = 0.157). The preference for male face shapes that are slightly feminized may reflect the effects of masculinity on perceived age. Whereas status and height are valued in males,9,18 youth benefits judgements of attractiveness for both female9,11,19 and male19 faces. For both males and females, enhancing sexual dimorphism in face shape develops cues to characteristics which, from a biological perspective, appear beneficial (that is, youth and fertility in females7–11 and dominance in males12,13,18). For males, however, enhancing masculinity in face shape also predisposes some negative personality attributions. Such attributions, although stereotypic, may predict behaviour; ratings of perceived dishonesty from facial appearance correlate with the face owner’s willingness to participate in deceptive behaviour.20 Indeed, increasing testosterone level in males is associated with more troubled relationships (including increased infidelity, violence and divorce).21 Feminization of male face shape may increase attractiveness because it ‘‘softens’’ particular features10,22 that are perceived to be associated with negative personality traits.

READING: EFFECTS OF SEXUAL DIMORPHISM ON FACIAL ATTRACTIVENESS | 45

Together, the results indicate that judgements of male More-feminine face shapes are attractiveness reflect multiple motives.22 Females may perceived as younger, the preferadopt different strategies, giving preference to characterences would encourage a youthful, istics that are associated with dominance and an effective 12,13 immune system, or to characteristics that are related to neotonous appearance in the species paternal investment. generally. Sexual dimorphism in any species reflects compromises among diverse selection pressures. In humans, the greater upper body musculature and more rugged skeletal anatomy of males relative to females may reflect advantages in male–male competition and hunting. Because male attractiveness is an important determinant of relationships and sexual partnerships,23 the reduction in attractiveness of male face shape with masculinization represents a further selection pressure. This would act against ‘‘run away’’ fisherian sexual selection for extreme male characteristics,1 and is consistent with the relative lack of sexual dimorphism in humans.24 The preferences found here indicate a selection pressure on the evolution of face shape that acts against pronounced differences between males and females and, as more-feminine face shapes are perceived as younger, the preferences would encourage a youthful, neotonous appearance in the species generally.

METHODS Preparation of Composite Facial Images Japanese faces (students at Otemon-Gakuin University; 28 male, age 20–23 years, mean 21.6 years; 28 female, age 20–22 years, mean 21.4 years) were photographed under standard lighting conditions with neutral facial expression. Similar photographs were prepared for Caucasian faces (students at St. Andrews University, 25 male, age 19–23 years, mean 21.0 years; 30 female, age 19–22 years, mean 20.6 years). Photographs were converted to digital format ( Kodak Photo-CD) and 174 feature points on salient facial landmarks (for example, nose-tip) were defined manually for each face.14,15 The average face shapes of the male and female Japanese and Caucasian face subsets were calculated from the feature points. The position of eye centres was standardized for corresponding average male and female face shapes. Each original face image was then warped to the shape of the corresponding average face and the resultant reshaped face images were blended together by averaging colour and intensity values of pixels at corresponding image locations14,15 ( Fig. 60.1). The vector difference between corresponding feature points on the male and female averages was increased or decreased by 50% to create feminized and masculinized shapes. The image of the composite face was then warped into these new face shapes to create image pairs with identical texture but enhanced or diminished sexually dimorphic differences in face shape. The size of all male and female face images was matched by standardization of inter-pupil distance. The resulting composite images were cropped around the face and faded into a black background ( Fig. 60.2). Cropping removed the hair, ears and neck, which were not consistent in shape or visibility in component images because of differing hairstyles and clothing.

46 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Procedure A Silicon Graphics Indigo2 Maximum Impact (4 MB TRAM) was used to create smooth continua between 50% masculinized and 50% feminized face pairs (Fig. 60.2) as the end points, and the cropped average as the midpoint. The point along a shape continuum was controlled interactively by the position of the computer mouse. The appropriate image was calculated in realtime using texture mapping hardware. Stimuli were presented in 24-bit colour at the centre of an 800 × 800 pixel window. Fifty Caucasian subjects (research staff and students from St. Andrews University; age 19–31 years, 25 female) and 42 Japanese subjects (research staff and students from ATR and Doshisha University; age 18–44 years, 19 female) were instructed to select the most attractive face from the continuum. Each continuum was presented twice to allow left/right counterbalancing of the end points, making a total of eight trials in randomized order.

ACKNOWLEDGEMENTS This work was supported by Unilever Research and the ESRC. We thank A. Whiten, R. Byrne, R. Barton, J. Lycett, S. Reicher, D. Carey, M. Ridley, J. Graves, and D. Symons for comments.

REFERENCES 1. Kirkpatrick, M. & Ryan, M. J. The evolution of mating preferences and the paradox of the lek. Nature 350, 33–88 (1991). 2. Andersson, M. Female choice for extreme tail length in a widowbird. Nature 299, 818–820 (1992). 3. Møller, A. P. Female swallow preference for symmetrical male sexual ornaments. Nature 357, 238–240 (1992). 4. Singh, D. Body shape and women’s attractiveness—the critical role of waist-to-hip ratio. Hum. Nature 4, 297–321 (1993). 5. Barber, N. The evolutionary psychology of physical attractiveness: sexual selection and human morphology. Ethol. Sociobiol. 16, 395–424 (1995 ). 6. Manning, J. T., Scutt, D., Whitehouse, G. H. & Leinster, S. J. Breast asymmetry and phenotypic quality in women. Evol. Hum. Behav. 18, 223–236 (1997 ). 7. Symons, D. The Evolution of Human Sexuality (Oxford Univ. Press, 1979). 8. Cunningham, M. R. Measuring the physical in physical attractiveness: quasi-experiments on the sociobiology of female facial beauty. J. Pers. Soc. Psychol. 50, 925–935 (1986). 9. Buss, D. M. Sex differences in human mate preferences: evolutionary hypotheses tested in 37 cultures. Behav. Brain Sci. 122, 1–49 (1989). 10. Johnston, V. S. & Franklin, M. Is beauty in the eye of the beholder? Ethol. Sociobiol. 14, 183–199 (1993). 11. Jones, D. Sexual selection, physical attractiveness, and facial neoteny. Curr. Anthropol. 36, 723–748 (1995). 12. Grammer, K. & Thornhill, R. Human (Homo sapiens) facial attractiveness and sexual selection: the role of symmetry and averageness. J. Comp. Psychol. 108, 233–242 (1994 ). 13. Thornhill, R. & Gangestad, S. The evolution of human sexuality. Trends Ecol. Evol. 11, 98–102 (1996 ). 14. Perrett, D. I., May, K. A. & Yoshikawa, S. Facial shape and judgements of female attractiveness. Nature 368, 239–242 (1994 ).

READING: EFFECTS OF SEXUAL DIMORPHISM ON FACIAL ATTRACTIVENESS | 47

15. Rowland, D. A. & Perrett, D. I. Manipulating facial appearance through shape and color. IEEE Comput. Graph. Appl. 15, 70–76 (1995 ). 16. Langlois, J. H. & Roggman, L. A. Attractive faces are only average. Psychol. Sci. 1, 115–121 (1990). 17. Cunningham, M. R., Roberts, A. R., Barbee, A. P. & Druen, P. B. ‘‘Their ideas of beauty are, on the whole, the same as ours’’: consistency and variability in the cross-cultural perception of female attractiveness. J. Pers. Soc. Psychol. 68, 261–279 (1995 ). 18. Jackson, L. A. Physical Appearance and Gender: Sociobiology and Sociocultural Perspectives (State Univ. New York Press, Albany, 1992). 19. Deutsch, F. M., Zalenski, C. M. & Clark, M. E. Is there a double standard of ageing? J. Appl. Soc. Psychol. 16, 771–785 (1986 ). 20. Berry, D. S. & Wero, J. L. F. Accuracy of face perception: a view from ecological psychology. J. Pers. 61, 497–519 (1993). 21. Booth, A. & Dabbs, J. Testosterone and men’s marriages. Social Forces 72, 463–477 (1993). 22. Cunningham, M. R., Barbee, A. P. & Pike, C. L. What do women want? Facialmetric assessment of multiple motives in the perception of male facial attractiveness. J. Pers. Soc. Psychol. 59, 61–72 (1990). 23. Gangestad, S. W. & Thornhill, R. The evolutionary psychology of extrapair sex: the role of fluctuating symmetry. Ethol. Hum. Behav. 18, 69–88 (1997 ). 24. Martin, R. D. & May, R. M. Outward signs of breeding. Nature 293, 7–9 (1990).

CHAPTER 3

DNA AND MOLECULAR ANTHROPOLOGY

I N TR T R O D U C TI TION Modern synthesis brought genetics to natural selection, but this was prior to the knowledge about DNA’s structure, functions, and mutation rates, which are now used to reconstruct family trees of all sorts.

L E A R N I N G O BJEC LEAR B J E C TTII VES VES 1. 2. 3. 4.

Understand the functions of DNA. Know the differences and similarities between mitosis and meiosis. Understand the use of hybrid DNA and molecular clocks to reconstruct family trees. Understand the use of DNA fingerprinting to determine paternity.

49

50 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

CELLS AND DNA

G

enetics tells us how traits are passed on from one generation to the next; however, it also helps us understand the biological mechanisms that guide cellular and physiological functions. Darwin did not have knowledge about genetics and Mendel discovered the rules of inheritance, but it was not until the 1950s that genetics really took off. In 1953, James Watson, Francis Crick, Maurice Wilkins, and Rosalind Franklin discovered the structure of DNA. The double helix structure helps us understand how genes, which are located on DNA, are passed on to offspring during meiosis and fertilization. There are two types of cells: prokaryotic cells, which are those without a nucleus and found only in bacteria and algae, and eukaryotic cells, which contain nuclei and occur in multicellular organisms. Evolution is conservative; thus, nearly all cells in multicellular organisms are the same. Cells are three-dimensional building blocks of life that are made of carbohydrates, fats, nucleic acids (DNA and RNA), and proteins. Within cells, there are organelles that have various FIGURE 3.1: Fertilization functions. Within eukaryotic cells there are somatic cells, which are all cells not involved in reproduction, and gametes, which are sex cells. Gametes transmit genetic information from parent to offspring. The male gametes (sperm) are made in the testes, whereas ovaries make ova, which are female gametes. These two types of sex cells unite to form a zygote (which is the first step in creation of a new being). In the nucleus of cells, DNA, or deoxyribonucleic acid (which is the nucleic acid that codes for our traits), exists bundled up as chromosomes. Humans have forty-six chromosomes; twentytwo are paired homologous chromosomes, which means that they look the same and code for the same genes. The chromosome 23 pair is the sex pair and can either be homologous, XX and code for a female, or Xy, not homologous and code for a male. Other species may have a different number of chromosomes; for example, FIGURE 3.2: DNA structure

DNA AND MOLECULAR ANTHROPOLOGY | 51

African apes possess forty-eight chromosomes. A difference in chromosome number does not mean there is a different amount of DNA, but that the DNA is packaged differently. Chromosomes are made of DNA and a protein, and DNA consists of nucleotides. Nucleotides consist of a sugar, phosphate, and a nitrogen base; these units stack upon one another and make a ladder with other stacks to form the double helix shape because of its coiling. The nitrogen bases help coding for traits. There are four nitrogen bases: adenine, guanine, thymine, and cytocine. Adenine and thymine always bind and guanine and cytocine always bind. We have about three billion base pairs in our DNA. DNA has three main functions: replication, protein synthesis, and correction. Correction is just the act of DNA checking the other two processes for errors and correcting errors when possible. The first function of replication enables healing, growing, and replacing of cells. The double helix of DNA gets unzipped by an enzyme (i.e., a special protein that breaks bonds), leaving two free strands of nucleotides looking for mates to reform the double helix. The free-floating nucleotides get attached in the cell to the free strand of DNA and the DNA becomes whole again. A new double helix is created that is made up of a daughter strand and a parent strand. This DNA replication occurs during cell division. Replication of DNA is very accurate, but errors occur. Errors are mutations. Rates of mutation vary from species to species; usually in organisms that reproduce often, mutation rates are high, such as in bacteria. Mutations are rare in humans due to our slow rate of reproduction. Mutation provides new alleles.

CELL DIVISION There are two types of cell division, mitosis and meiosis. Mitosis, which is simple cell division, occurs in nearly all cells except sex cells. Our bodies are made up millions of somatic cells, and with the possible exception of nerve and liver cells, they constantly replicate and divide to create new ones. In mitosis, one cell divides into two cells. This can occur because the DNA duplicates, and so the cells will have twice as much genetic information than it requires prior to splitting into two cells. Mitosis occurs during growth and healing; it also replaces old cells with new ones. Genetic material replicates and is passed on to each new cell during mitosis. Mutations in these cells can be passed onto other cells in the body, but will not affect evolution because it is not passed on to the next generation. Mitosis requires several steps: 1. The cell is involved in metabolic activities and DNA is replicating (this occurs eighteen out of twenty hours of the cell’s life). This is really called interphase and is not considered a stage of mitosis, but is required before mitosis can occur. 2. The cell now has forty-six double-stranded chromosomes in each cell. With twice as much genetic information as needed, the cell can begin to divide and nuclear membrane dissolves. This occurs during the prophase of mitosis. 3. The next step, called metaphase, occurs when chromosomes align at the center of the cell. 4. Then the chromosomes split at the centromeres, which are the center locations of chromosomes and the most condensed and constricted region of a chromosome. A spindle fiber is attached and the strands are moved to opposite ends of the cell, concluding the anaphase of mitosis.

52 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

FIGURE 3.3: Mitosis

5. As the cell division is nearly complete, the cell membrane begins to pinch together and form two new cells with forty-six single-stranded chromosomes in each, which is called telophase. 6. Finally, the nuclear membrane reforms and genetic material is replicated within the nucleus and divides into two daughter nuclei. Meiosis, or sex cell division, is a bit more complicated. Mitosis is called “simple cell division” because somatic cells divide one time to produce two daughter cells that are genetically identical to each other and are a clone of the original cell. Meiosis leads to the development of a new individual. It is more complicated than mitosis because it goes through a second series of phases. Sexual reproduction involves two organisms: one female and one male. Each contributes hereditary material to form a new organism; as such, the process is one that shuffles and exchanges genetic information. Sexual reproduction originated about one billion years ago and accounts for the incredible diversity in multicellular organisms. The process is more complex than mitosis because it is necessary to reduce the number of chromosomes by half (to twenty-three) because when sexual reproduction occurs the other half of the forty-six chromosomes come from the other parent. Fertilization is the union of a female ovum and a male sperm. Meiosis is similar to mitosis at the beginning stages and goes from prophase I through telophase I, which are similar to mitosis in all ways except that partner chromosomes will exchange genetic material in a process called crossover. After the first set of mitosis-like steps, each cell has forty-six chromosomes and this needs to be reduced to twenty-three chromosomes. Meiosis, then, goes into another set of stages. In the second set of steps, the chromosome pairs migrate to the center of the cell. Then the first division of reduction occurs; the paired chromosomes separate and each one of the pair moves to the opposite ends of the dividing cell. This results in half the original number of chromosomes in each new daughter cell, which are called haploids. All other cells in humans are diploids. After the first reduction, there are two daughter cells, each containing forty-six chromosomes. Then, because we have to further reduce the number of chromosomes, there is a second division. The chromosomes split at their centromeres and the strands move to opposite sides of the cell—very much like what we see in mitosis—but without another replication of DNA. In meiosis, the result is four daughter cells from one original parent cell. These daughter cells may mature to become functional gametes and contain only half of the DNA (twenty-three chromosomes) than in the original cell. In oogenesis (the production of ovarian cells), oogonia are formed, which are ovarian cells that may become ova. Two million ovarian cells are present in the human female at birth, but only about four hundred actually mature during a woman’s lifetime. The ovum receives most of the cytoplasm, which ensures that the zygote or fertilized egg will have a rich supply of nutrients.

DNA AND MOLECULAR ANTHROPOLOGY | 53

In spermatogenesis (production of sperm), male sex cells are produced in the male testicles. The second division of sperm cell meiosis results in four sperm cells of equal size and with only half the number of chromosomes. These cells grow long tails (called flagellum that are made up of proteins and act as a propeller to move the sperm) and develop a specialized head that contains the chromosomes and an enzyme that enables them to penetrate and fertilize the egg. A woman is born with all the ova she will ever produce. If she is not pregnant or lactating, she will usually release one egg every month of her reproductive life, from puberty until her forties. Men, however, produce millions of sperms continually from the onset of puberty. Over a quarter of a billion sperm are released at one time. The production of ova and sperm differ in several important ways. The primary egg cell produces only one ovum with a much larger portion of the cytoplasm, whereas the primary sperm cell gives rise to four viable sperms and very little cytoplasm. Mitochondrial DNA resides in cytoplasm and because of the high amount of cytoplasm in the female sex cells—but not in the male sex cells—mitochondrial DNA is passed on through the female line. The study of mitochondrial DNA helps determine relationships of closely related species and populations. Meiosis is evolutionary significant because it creates genetic variation at a faster rate than mutation alone. Individuals of sexually reproducing species are unique from their parents; this is the result of the contribution of genetic information from two parents and crossover. Crossover ensures that chromosomes are not transmitted intact from one generation to the next. Every generation gets a new shuffle hand in an infinite number of combinations. Natural selection acts on this genetic variation. If all individuals in a population are clones, then natural selection cannot occur. But there are also problems with meiosis. The process must be exact for a normal baby to be born and the two-stage division must produce twenty-three chromosomes with one member of each chromosome pair. If chromosomes fail to separate during either stage, serious problems may occur. This event is called nondisjunction and it can result in a zygote having either forty-five or forty-seven chromosomes. An abnormal number of chromosomes will affect every cell since the zygote reproduces itself initially through mitosis. Every cell in the developing body will also have an abnormal chromosome count. Most situations of this type are fatal and involve spontaneous abortion. There are exceptions, such as trisomy 21 in which there are three copies of chromosome 21. This is also known as Down syndrome and the effects are retardation, heart defects, hearing defects, and many others. Interestingly, nondisjunction occurs more often in older mothers and is possibly due, in part, to the fact that the mother’s eggs are aging along with the mother. Nondisjunction that occurs in the chromosome 23 pair rarely cause death, but it frequently cause sterility and may result in other problems as well.

PROTEIN SYNTHESIS The second major function of DNA is protein synthesis. Proteins are complex three-dimension molecules that function to bind to other molecules. There are more than one hundred thousand in the human body. Some examples include: hemoglobin, which are red blood cells and bind to oxygen; collagen, which are connective tissues that bind to bones and muscles; and insulin, which binds to sugar for energy.

54 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

FIGURE 3.4: Protein synthesis

DNA AND MOLECULAR ANTHROPOLOGY | 55

Proteins are made up of amino acids. There are twelve amino acids in the cell and eight from foods. The order and number of amino acids together equals a protein. DNA has the instructions to make proteins that are based on the sequence of the nucleotide bases. Thus, proteins are made from the number and sequence of amino acids; amino acids are coded by the number and sequence of nucleotide bases, and nucleotide bases are the foundations of DNA. The steps of protein synthesis include: 1. DNA is copied so that the message can leave the nucleus. DNA cannot get through the nuclear membrane, and so RNA helps the DNA message get out. RNA is a single-stranded nucleic acid that contains a different sugar and uracil instead of thymine. As such, the DNA nucleotide will match adenine with uracil during protein synthesis. 2. Next, transcription occurs. This is when DNA meets with RNA to form messenger RNA (mRNA). mRNA has two parts exons, which are coding sequences, and introns, which are noncoding sequences. 3. The DNA segments are copied and mRNA peels away and travels to ribosomes. During this time the free bases of DNA are matching up with free nucleotides to make a new double helix. 4. The fourth step is called translation. Here, mRNA is at the ribosome and the sequences of bases are being read with the introns being snipped out by enzymes. 5. Transfer RNA (tRNA) then binds to amino acids and reaches the ribosomes with the amino acids. Here, the message of the DNA is translated into proteins, which are basically genes. Genes are sequences of DNA bases responsible for a function. They can be made up of hundreds of thousands of DNA bases. Any change in bases during replication is called a mutation, but you can also have chromosomal mutations when the DNA does not separate correctly, as cited above. Many genes act as regulatory genes by switching off-andon functions, such as in growth, and thus very few genes are needed to make a big difference between species.

MOLECULAR ANTHROPOLOGY

FIGURE 3.5: Ape-human family tree after molecular data

Anthropologists use DNA to determine relationships, determine times of splits from the last common ancestors, and to determine paternity. DNA hybridization is a method used by anthropologists to draw family trees without the confounding

56 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

factors of homoplasy. Molecules are the direct expression of genes; whereas morphology can be changed quickly due to the environment. Molecular data is quantifiable and replicable. Finally, molecular data can be time-based. Since DNA is made up of two strands bound together by hydrogen bonds, we can take strands from two different species and make an artificial hybrid DNA. The base pairs will not match up exactly so the hybrid DNA will not be as tightly bound as either original double helix. The more genetically distant two species, the more mismatched bases will exist and the weaker the hybrid DNA will be. DNA is extracted from the cells of species to be tested; we will examine chimps, humans, and gorillas. When the DNA solutions are heated to about 86 degrees Celsius, the double helix breaks apart into two strands. Then, one would use an enzyme to cut a single homologous DNA strand from each species into fragments, which can be hundreds of nucleotides in length. The next step involves mixing the single strands from two species and letting the solution cool, the different strands will bind and we will have our hybrid DNA. When we then heat this hybrid, the double helix will break apart at a lower temperature than non-hybrid DNA strands. For the great apes and humans, this has been done numerous times. Results are that chimp-human hybrid DNA comes apart at around 84.4 degrees Celsius, which is 1.6 degrees different; so humans and chimps differ by 1.6% since each degree drop is about 1% of mismatch between the two strands of DNA. The human-gorilla difference is about 2.4% and the chimp-gorilla difference is about 2.1%. Humans and chimps are more closely related to each other than the gorilla is to either chimps or humans. Therefore, we can conclude that gorillas branched off somewhat earlier than the human-chimp common ancestor. DNA evidence has enabled us to draw a more accurate family tree. It used to be thought that gorillas and chimps were the most closely related since they had similar morphology, behavior, brain size, and so forth. So, why are humans so different? Basically, chimps and gorillas have been evolving in the same environment and, thus, have the same environmental pressures. When looking at DNA diversity, the great apes have more diversity than humans just because they have been evolving longer and have accumulated more variation. Yet, we are more phenotypically diverse than the African apes. Although looking at DNA differences helps us to redraw the family tree, we can also use DNA to determine the splitting times of different species. Molecular clocks help us determine the geological time of evolutionary relationships. In the early 1960s, Emile Zuckerlandl and Linus Pauling sequenced various amino acids of different species and counted the differences in these amino acids. They then compared their numbers with fossil finds and discovered that the differences in the amino acids were proportionate to the estimated geological time, since the species shared a common ancestor. For example, when looking at hemoglobin (which is the iron-containing oxygen transport in the red blood cells of all vertebrates), they found there were 18 amino acid differences between humans and horses, 35 differences between birds and humans, 62 differences between humans and frogs, and 79 differences between humans and sharks. On average, mammals had about 20 differences. The fossil record shows the first horse around 70 million years ago, the first bird around 270 million years ago, the first amphibian appears around 350 million years ago, and the first shark around 450 million years ago. Thus, hemoglobin was acting like a clock with a change occurring somewhere between 3 million and 7 million years. Finer-tuned methods enabled replication of these findings and additional molecules to be examined. It appeared that molecules could be used much as clocks, but only when calibrated to the fossil record.

DNA AND MOLECULAR ANTHROPOLOGY | 57

The molecular clock was used to put to rest one of the most controversial finds in anthropology. Ramapithecus (now known as Sivapithecus) is a fossil species from Pakistan and Africa and dated to around 14 million years old. Many believed these remains belonged to the earliest human. During the 1960s, most anthropologists thought the divergence between humans and apes occurred around 20 million years ago. But anthropologists also agreed 2-million-year-old australopithecines were early humans. And, oddly enough, there were some features that looked more human in Ramapithecus, such as the small browridge and cheek teeth. Australopithecine teeth were bigger in the back and smaller in the front and they had large browridges, but they had clear evidence of bipedality (or walking on two legs). To estimate the time of the ape-human split, Vincent Sarich and Allan Wilson looked at albumin (i.e., the main serum protein of all vertebrates and can be extracted from blood) immunology; the immune system works by creating antibodies (proteins that fight invaders, such as infections) and therefore injecting foreign albumin should create an antibody reaction. The more distant the species are related the more the immune system will work, since the molecule (in this case, albumin) will have mutated more over time. Thus, they were still using molecules as a clock. Sarich and Wilson injected albumin of humans, apes, and monkeys into rabbits and then obtained antisera (the antibodies). They then injected a new bunch of bunnies with the antisera for the various albumin reactions and injected them with a different species albumin. For example, a bunny gets the antisera for humans and then this same bunny is exposed to chimp albumin. A second bunny would also be injected with the human antisera, but then exposed to gorilla albumin in the same fashion. The bunny with the greater immune system response will show that the primate is more distantly related to humans than the bunny with the lesser reaction. Using this method, Wilson and Sarich discovered that humans, chimps, and gorillas differed by 1% and each of them differed from monkeys by 6%. To turn this information into a clock, they picked a well-known event from the fossil record (ape-monkey divergence of 30 MYA [million years ago]). Thus, the 1% difference is one-sixth of the 6% difference, and the ape-human split then must be 5 MYA, which meant Ramapithecus could not be a hominid. DNA has given us clues to understanding our family tree; it can also give us clues to understanding primate behavior. Before DNA fingerprinting, there was no sure way to determine who the father was among primates (even ourselves). Paternity was deduced by the primate’s rank or in humans by cultural traditions, such as marriage. The results of the DNA research on nonhuman primates paints a different picture. In Japanese macaques, for example, the dominant males did engage in intercourse most often, but paternity tests showed that these high-ranking males were only the father 73% of the time. So, more than one in four times the high-ranking males were not the father. This is important because in many primates, males will put in paternal care—and if the primate is not the father then this is a waste of energy. Also, primates will try to increase chances of reproduction through fighting to gain rank, sharing food, and taking care of offspring. Yet, there are some males who are not going through all this trouble and are still fathering little ones. Makes you wonder who is the smarter monkey. As for humans, our culture tries to aid in determining paternity through marriage practices. But we know that sometimes paternity is not assured, which may be why grandmothers have a preference to their daughters’ offspring compared to their sons’ offspring!

58 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

SUM SU MMA M AR RY In this chapter, we learned that molecules are the direct expression of genetic messages. Reconstructing family trees without confounding factors, such as convergence, is best done through genetic testing. To understand molecular anthropology, however, one must understand DNA, and thus we began this with information on cell division and DNA functions. Currently, anthropologists use DNA to understand human evolution and primate behavior.

G LLO O SSAR S SA R Y Amino acids: Acids that code for proteins that are built with nitrogen base pairs from DNA. Cells: Three-dimensional building blocks of life that are made of carbohydrates, fats, and nucleic acids. Chromosomes: Bundled DNA plus an extra protein. DNA: Deoxyribonucleic acid and codes for proteins. Enzymes: Special proteins that break bonds. Eukaryotic cells: Cells that contain nuclei and occur in multicellular organisms. Exons: Coding sequences of DNA. Gametes: Sex cells. Genes: Sequences of DNA bases responsible for a function. Introns: Noncoding sequences of DNA Meiosis: Sex cell division. Mitosis: Simple cell division that occurs in all cells except sex cells. Nucleotides: The basic units of DNA, consisting of a sugar, phosphate, and a nitrogen base. Oogenesis: The production of ovarian cells. Prokaryotic cells: Cells without a nucleus found only in bacteria and algae. Proteins: Complex three-dimension molecules that function to bind to other molecules. RNA: A single-stranded nucleic acid that contains a different sugar and uracil instead of thymine compared with DNA, and helps DNA replicate. Somatic cells: Cells not involved in reproduction. Spermatogenesis: The production of sperm. Zygote: The cell resulting in the union of sperm and ovum, which is the first step in creation of a new being.

SEC T I O N 1 R EAD I N G S

R EA EAD DING 3 Mindell D. 2009. Evolution in the Everyday World introduces the diverse ways in which evolution has been applied. Today, evolution is defined as a change in allele frequency over time; Darwin did not know about the laws of heredity although Mendel’s work on the genetics of pea plants was already published. Now, genetics is used to time evolutionary splits, helps us understand evolutionary arms races, and even helps us understand the transmission of diseases from animals to humans. This article also proposes what understanding evolution may do for us in the future. Genetic Timeline 1866: Gregor Mendel (1822–1884), the Austrian monk, had his paper on the laws of inheritance published. 1900: Mendel’s work on pea plants and inheritance is rediscovered. 1920s: Scientists, such as R.A. Fisher, Theodosius Dobzhansky, J.B.S. Haldane, Ernst Mayer, and George Gaylord Simpson, from diverse fields combine genetics with evolution via Natural Selection and come up with the Modern Synthesis. 1953: Jim Watson, Francis Crick, Rosalind Franklin, and Maurice Wilkins discover the double-helix morphology of DNA. 1960s: Emile Zuckerlandl and Linus Pauling sequence amino acids and discover the concept of the molecular clock. 1967: Vincent Sarich and Allan Wilson publish a timescale for hominid evolution using genetics. 1977: DNA sequencing technology was developed by Fred Sanger. 1987: Rebecca Cann, Mark Stoneking, and Allan Wilson publish the genetic tree of modern human origins using mtDNA. 1990: Genome projects are started. 1996: The first mammalian clone (Dolly the sheep) is born. 2001: The sequence of the human genome is released.

Evolution in the Everyday World By David Mindell

KEY CONCEPTS • The theory of evolution provides humankind with more than just a scientific narrative of life’s origins and progression. It also yields invaluable technologies. • For instance, the concept of molecular clocks—based on the accumulation of mutations in DNA over the eons—underlies applications such as the DNA analyses used in criminal investigations. • DNA analysis of how pathogens evolve produces useful information for combating the outbreak and spread of disease. Accelerated evolution in laboratories has improved vaccines and other therapeutic proteins. • Computer scientists have adapted evolution’s mechanisms of mutation and selection to solve problems. — The Editors

EVOLUTION IN THE EVERYDAY WORLD

U

nderstanding of evolution is fostering powerful technologies for health care, law enforcement, ecology, and all manner of optimization and design problems. Charles Darwin surely had no clue of the technological advances that his studies of beetles and birds would unleash. Our progress in comprehending the history and mechanisms of evolution has led to powerful applications that shape a wide variety of fields today.

David P. Mindell, “Putting Evolution to Use in the Everyday World,” Scientific American, 300(1), pp. 82-89. Copyright © 2009 by Scientific American. Reprinted with permission.

61

62 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

For instance—as the CSI franchise of television shows has popularized—law-enforcement agencies now commonly use evolutionary analyses in their investigations. Knowledge of how different genes evolve determines the kind of information they can extract from DNA evidence. In health care, phylogenetic analysis (studies of DNA sequences to infer their evolutionary relatedness, or genealogy) of a pathogen such as bird flu or West Nile virus can lead to vaccines and to guidelines for minimizing the disease’s transmission to and among people. A laboratory process called directed evolution that rapidly evolves proteins can improve vaccines and other useful proteins. Among other examples, computer scientists have adapted the concepts and mechanisms of evolution to create a general system known as genetic programming that can solve complex optimization and design problems. And a recently developed approach known as metagenomics has revolutionized scientists’ ability to survey the kinds of microbes living in a region, bringing about the most dramatic change in our understanding of microbial diversity since the advent of microscopes. About 400 years ago English philosopher and statesman Francis Bacon commented that knowledge is power. The extremely useful techniques borne of our growing comprehension of evolution bear him out in spectacular fashion.

BEYOND REASONABLE DOUBT Evolutionary analyses and criminal investigations hold the same goal of revealing historical events. Their fruitful combination awaited only the maturing of DNA-sequencing technology to provide large data sets, robust quantitative methods, and enlightened integration of science and the legal system. As with many applications of evolution, the concept of molecular clocks plays a vital role. Changes in many DNA sequences occur at roughly predictable rates over time, forming the basis for molecular clocks. The clocks for two regions of DNA, however, can run at markedly different rates. In the early 1980s geneticists discovered regions of human DNA that evolve very rapidly, and scientists soon pressed these fast—evolving regions into service as genetic markers—unique identifiers of individuals, like fingerprints but with greater detail—in criminal cases and in paternity testing. Forensic investigators assess specific genetic markers as indicators of links between suspects and crime scene evidence such as a single human hair, lip cells left on a beer can, saliva on envelope flaps and cigarette butts, as well as semen, blood, urine and feces. The most straightforward use is to demonstrate a suspect’s innocence by the non-matching of his or her markers compared with those of crime scene Indeed, the Innocence Project, evidence. Indeed, the Innocence Project, a public policy a public policy organization organization pro-moting and tracking the use of genetic pro-moting and tracking the use markers to overturn wrongful convictions, reports that of genetic markers to overturn since 1989, nonmatching of genetic markers has exonerwrongful convictions, reports ated more than 220 people, many of them convicted for that since 1989, nonmatching of rape crimes and some of them on death row. genetic markers has exonerated The standing of evolutionary science within the U.S. more than 220 people, many of court system has completely reversed since its portrayal them convicted for rape crimes as an insidious scourge in the 1925 trial of Tennessee and some of them on death row. high school teacher John T Scopes. In the 1998 criminal

READING: EVOLUTION IN THE EVERYDAY WORLD | 63

case of the State of Louisiana v. Richard J. Schmidt, the judge set precedent in ruling that phylogenetic analyses met judicial standards because they were subject to empirical testing, published in peerreviewed sources and accepted within the scientific community—some of the criteria commonly known as the Daubert standard for scientific evidence, after the name of a plaintiff in an earlier precedent-setting case. I was fortunate to be invited to participate in Louisiana v. Schmidt as a scientist and expert witness by Michael L. Metzker of the Baylor College of Medicine and David M. Hillis of the University of Texas at Austin. The three of us worked together on the molecular analyses. The uncontested facts in the case are that a gastroenterologist broke into the home of his former office nurse and mistress and gave her an injection. He claimed it was a vitamin B shot. She claimed it was HIV. She had begun feeling ill several months after the injection and a blood test revealed that she had become infected with HIV, at which point she went to the district attorney’s office to file charges. The DA’s detectives quickly obtained a search warrant for the physician’s office, where they seized his record books and a vial of blood from a refrigerator. The physician said that the blood sample, drawn from one of his HIV-positive patients, was for his own research. The next logical step in the investigation was to perform phylogenetic analyses of the HIV lineages from the nurse and the alleged source. My collaborators and I selected two HIV genes to sequence, one relatively fast-evolving, encoding part of the viral envelope (env), the other slow, encoding a vital enzyme called reverse transcriptase (RT). We also had blood samples from about 30 other infected individuals to serve as a reference point. Our analyses of the env gene showed the HIV sequences from the victim and the doctor’s sample formed two sister clades relative to the epidemiological sample. The likelihood of two random people from the infected population having such similar viruses is extremely small. This result is consistent with the accusation that the physician used the blood sample from one of his patients to infect the nurse, but it could also be that the patient was infected with HIV from the nurse. The phylogeny inferred from the more slowly evolving RT sequences showed that viruses from the victim were younger, arising from within the clade of viruses from the alleged source. This result clearly indicated that viruses from the alleged source had infected the nurse. The jury found the doctor guilty of attempted murder, and he was sentenced to 50 years in prison. Of course, we cannot know how much weight the jurors placed on the evolutionary evidence and how much on other items such as the physician’s notebooks and behavior. But we do know that phylogenetic analyses will continue to be used in U.S. courts, thanks to the Supreme Court upholding the Louisiana v. Schmidt precedent in 2002.

MICROBIAL ARMS RACE Like crime, infectious disease will always be a fact of life for us. Parasitic viruses, bacteria, fungi and animals have been co-evolving with people throughout Homo sapiens’s entire history, driving evolution of our wonderfully adaptable immune systems. Human populations provide ever larger breeding grounds for microbial pathogens, and even if we do hold some at bay and drive a few to extinction, others will evolve to invade successfully and spread. We are in this arms race for the long haul. Understanding the evolutionary history of pathogens entails determining their genealogy, often based on phylogenetic analyses of DNA, which represent our best method for identifying unknown

64 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

pathogens and their genes. Learning a pathogen’s genealogy allows us to form valuable working hypotheses about its means of reproduction and transmission, as well as its preferred habitats, because close relatives are more likely to share heritable life history traits than distant relatives are. In turn, we can use this key information to make recommendations about how to minimize the pathogen’s transmission opportunities and, potentially, how to enhance immunity. Understanding evolutionary mechanisms requires identifying the causes of mutation and the roles of natural selection and chance events in the origin and persistence of particular heritable changes. We may track heritable changes across genotypes and morphology (physical form), as well as across life history traits such as virulence, transmissibility, host specificity and reproductive rate. For example, growing knowledge of distantly related bacteria exchanging drug-resistance genes, a process called horizontal transfer, has led biologists to seek new kinds of antibiotics that would block the ability of these mobile genetic elements to replicate and transfer themselves. The deadly history of human influenza epidemics and our increasing grasp of flu virus evolution illustrates some of these points in action. Phylogenetic analyses of flu virus genes sampled broadly from host species have shown us that wild birds are a primary source and that domestic pigs are often, though not always, the intermediary hosts between birds and humans. Thus, health officials now recommend that people in certain regions keep their poultry and pigs inseparate enclosed facilities to prevent contact with wild birds. They advise doing surveillance for a highly pathogenic variety known as influenza A strain H5N1 and other phylogenetically identified strains not just in poultry but also in select wild species, including waterfowl and shprebirds. Phylogenies also demonstrate that influenza A genomes have eight unique segments that can be mixed and matched among strains from different host species. This form of recombination, known as shift, combined with mutation in DNA sequences, provides the near kaleidoscopic variation that allows reconfigured viruses to elude previously developed immune system antibodies, requiring us continually to develop new vaccines. Coupling geographic sampling with the phylogenetic history of specific segments and particular mutations known to be pathogenic helps in predicting the spread of the disease and in identifying candidates for use in vaccine development. In 1997 scientists barely contained a potentially catastrophic outbreak in Hong Kong of H5N1, when they convinced authorities to slaughter all domestic fowl, the local virus source. Although future pandemics are a question of when, not if, our knowledge about evolutionary sources, hybridization among genomes and the host-shifting capability of flu viruses helps us to minimize risk.

EVOLUTIONARY MEDICINE Another way that evolution influences our health is through what might be called “unintelligent design features” of our bodies—legacies of our evolutionary past [see “This Old Body,” by Neil H. Shubin, on page 64]. For instance, humans have a higher incidence of birthing problems as compared with other Another way that evolution inluprimates because female pelvis size in humans has not ences our health is through what kept pace with selection for larger infant brain size. Some might be called “unintelligent traits that may seem unintelligently designed, however, design features” of our bodies— can actually be useful. Examples include fever, diarrhea legacies of our evolutionary past and vomiting, which aid in purging microbial infections.

READING: EVOLUTION IN THE EVERYDAY WORLD | 65

Applying an evolutionary perspective in understanding our susceptibilities and promoting health is known as evolutionary or Darwinian medicine. A vital step in this new endeavor is integration of basic evolutionary science into the curricula for medical and public health students. The matching of human genotypes with particular diseases has given rise to the possibility of personalized medicine, in which physicians can specify medications and dosages for individuals based on particular genetic traits. An example of this nascent approach involves the drug Herceptin (trastuzumab), which can reduce early-stage breast cancers in roughly 25 percent of cases but occasionally causes heart problems. Doctors can use information about an individual’s genotype to identify the likelihood of positive response to Herceptin and whether the low probability of heart problems is a worthwhile risk [see “Gaining Ground on Breast Cancer,” by Francisco J. Esteva and Gabriel N. Hortobagyi; SCIENTIFIC AMERICAN, June 2008]. Many people are reluctant to be genetically profiled, however, fearing unfair treatment by employers or insurance companies. In response, Congress passed the Genetic Information Nondiscrimination Act last May, outlawing such discrimination. Another concern is that race might be used as a proxy for genetic predisposition to particular diseases. Yet that kind of approach misunderstands the nature of human genetic variation, in which even closely related people may differ in their response to a drug. [For a cautionary tale on this topic, see “Race in a Bottle,” by Jonathan Kahn; SCIENTIFIC AMERICAN, August 2007.]

IN VITRO AND IN SILICO Evolution acting over billions of years has proved itself to be a versatile, if sometimes quirky, designer. Researchers are now borrowing from evolution’s drawing board, using directed evolution to enhance useful functions of proteins. These molecular biologists intentionally mutate genes, produce the proteins the genes encode, measure the proteins’ functional performance, and then select sets of top performers for subsequent bouts of mutation and testing. Repeating this cycle millions of times often yields impressive results. Understanding of evolutionary history and mechanisms improves directed evolution in several ways. First, discovering the phylogenetic relationships of genes is an important step in determining their functions and, therefore, in selecting genes as targets for directed evolution. The relatedness of genes is our best proxy for estimating a gene’s function prior to experiments. If we have experimentally determined the functions for a gene in mice, say, it is reasonable to hypothesize that the most closely related gene in humans will have similar functions. Second, knowledge of how particular genes evolve—understanding of the mechanisms of mutation and how natural selection operates on them—informs the choice of mutations to impose in directed evolution. A protein is a chain of amino acids whose sequence ultimately determines the protein’s function. Directed evolutionists may choose to alter single amino acids at random locations anywhere within the sequence or only in certain regions or even at specific sequence positions known to be functionally important. Protein-coding genes are structured in segments, which we can shuffle to try to create arrangements with novel capabilities. We can also mix the structural segments of related genes from within a gene family (phylogenetically identified) or from sister species to construct so-called chimeric proteins. Recombination and shuffling of gene segments has produced rapid evolution of proteins in nature, and mimicking this approach has proved to be powerful in the

66 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

lab. Researchers have further accelerated evolutionary change by shuffling whole genomes among populations of select microbes. Among directed evolution’s successes are a vaccine against human papillomavirus and better hepatitis C vaccines. Shuffling segments of 20 different human interferons (a family of immune system proteins) has led to chimeric proteins that are 250,000 times more effective at slowing viral replication. An improved human p53 protein, a tumor suppressor, has yielded better inhibition of tumor growth in lab experiments, and researchers are working on transferring this success to individuals who have compromised p53 proteins. Another way that scientists and engineers emulate evolution in the lab is with computer programs called evolutionary or genetic algorithms. People have used this technique extensively to search for optimal solutions to complex problems, including scheduling air traffic, forecasting weather, balancing stock portfolios and optimizing combinations of medicines, as well as for designing bridges, electronic circuits and robot-control systems [see “Evolving Inventions,” by John R. Koza, Martin A. Keane and Matthew J. Streeter; SCIENTIFIC AMERICAN, February 2003]. The general structure of an evolutionary algorithm includes five steps: 1. Generate a population of candidate solutions. 2. Evaluate the suitability, or fitness, of each “candidate solution. 3. If any candidate solution meets all the target criteria, stop the process. 4. Otherwise, select groups of relatively fit (individuals in the population to be parents). 5. Subject the parents to mutational changes and “sexual” recombination of their traits to produce a new population of candidate solutions. Then begin again with step 2. Genetic programming sometimes finds solutions very unlike typical human designs. For instance, an evolutionary computation to find orbits for constellations of communications satellites minimizing signal loss by ground-based receivers identified orbit configurations that were unusually asymmetric, with variable gaps between the individual satellite paths. These evolved optimal constellations outperformed the more symmetrical arrangements usually considered by designers.

CRITICAL SERVICES As humankind’s numbers continue to grow and cause environmental changes at a rapid pace, concerns mount about conserving biological diversity and sustaining human populations over time. We rely on healthy ecosystems, made up of organisms and their environments, to provide us with usable water, arable land and clean air. These critical ecosystem services are essential for human well-being, yet we have little understanding of their regulation and the consequences of changes in ecosystems. What are the roles of particular species and communities within an ecosystem? How sensitive are these natural systems to loss of species and habitats? How do ecosystem changes influence local climates, pollination and seed dispersal in plants, decomposition of waste, and the emergence and spread of disease? These are difficult questions that evolutionary methods and knowledge help to answer. Taking inventory is critical for understanding and managing resources. Yet a great many life-forms remain to be discovered and described, particularly the very small, including untold legions of viruses, bacteria and protists. The effort to determine the genealogical links among all life-forms includes

READING: EVOLUTION IN THE EVERYDAY WORLD | 67

extensive genetic sampling of biological diversity, within species as well as among them. With information from phylogenetic analyses of these samples, biologists can assess the relative distinctiveness of groups of organisms and delineate the evolutionary units (such as particular species or groups of species) of concern for conservation. Many phylogenetic analyses have revealed previously unrecognized species. DNA from African elephant populations supported recognition of two distinct species in Africa rather than one, as was long believed. Loxodonta africana is found primarily in forest habitats, whereas the newly named L. cyclotis lives in the savanna. DNA analyses have also found new species of Asian soft-shelled turtles, right whales and Old World vultures, among many others. The development of unique genetic markers for vertebrate species increasingly aids the enforcement of conservation laws by identifying protected animals or their parts being smuggled or sold illegally. This approach has helped prosecution of cases of illicit whaling, use of tiger products in Asian medicines and harvesting of caviar from protected sturgeon species.

METAGENOMICS The DNA from one organism makes up one genome. Collect the DNA from an entire community of microbes of various species in some location, and you have a metagenome. Biologists can now isolate DNA fragments from such a community, determine the fragments’ sequences and reassemble them into contiguous sequences—all without first requiring the difficult and labor-intensive steps involved in growing the microbes in the lab. Metagenomic analysis of microbes in the human intestinal tract has revealed more than 100 times as many different genes as are found in our own genomes (which contain about 25,000 protein-coding genes) and about 300 previously unknown and, so far, unculturable microbial lifeforms. The known microbes and their genes play important roles in development of our immune systems, in the production of fatty acids (which power healthy intestinal cell growth), and in detoxification of ingested substances that could otherwise lead to cancerous cell growth or alter our ability to metabolize medicines. Metagenomic analyses suggest that changes in the occurrence, abundance and interactions of both known and unknown microbes play a role in human diseases such as inflammatory bowel disease or in conditions such as obesity. Similar metagenomic analyses of the reproductive tract in females have shown that bacterial vaginosis, a disease associated with premature labor and delivery, pelvic inflammatory disease and the acquisition of sexually transmitted pathogens such as HIV, is accompanied by dramatic changes in the species composition of vaginal bacteria communities. Researchers have found many newly discovered bacterial groups in both healthy and unhealthy vaginal ecosystems. Improved treatment of bacterial vaginosis requires better understanding of how these changes in vaginal ecosystems occur and how they affect ecosystem function and disease progression. Turning to external ecosystems and sustainability, metagenomic analyses of water samples from the Pacific Ocean and from the Sargasso Sea in the North Atlantic have similarly indicated that a vast amount of oceanic biological diversity, including many viruses, remains to be discovered and understood. Scientists know relatively little about the metabolic abilities and ecological functions of these diverse microbial lineages and have numerous projects under way. We need to learn about them because microbial communities are largely responsible for supporting life on earth. They conduct

68 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

most of the world’s photosynthesis, and they make the Evolution is the unifying prinnecessary elements of carbon, nitrogen, oxygen and ciple for comprehending all life sulfur accessible to other life-forms, including people. on earth, and applying its lessons Using the evolution-based analyses of meta-genomics to learn the composition of communities in a variety of about the history and mechanisms circumstances is only the first step in learning what the of change can promote human community members do, how they interact, and how they well—being. are changed and sustained over time. Are diverse microbial communities more resilient to environmental change than less diverse ones? Are some particular groups of species of great importance in maintaining an ecosystem? What drives formation and turnover in the composition of microbial communities? The concepts and methods needed for this next level of understanding are largely within the realm of evolutionary ecology, which entails study of all interactions within and among species and populations and their environments. We have yet to see applications arising from microbial metagenomics and evolutionary ecology, but possibilities abound. Microbes both produce and consume carbon dioxide, methane and other greenhouse gases and may play a role in determining the success of efforts to curtail global warming. Metagenomics-based systems might monitor environmental health and watch for pathogens, whether naturally emergent or introduced by terrorists. Metagenomics could diagnose a broad selection of diseases in humans and livestock, which might be treated with probiotic therapies (the introduction of beneficial microbes). Newly discovered microbes could be exploited in the development of new antibiotics, in the discovery of enzymes to extract glucose from cellulose (which could then be fermented to ethanol as a fuel), and in the bioremediation of contaminated soil or water. Nearly all our scientific understanding stems from observing and interrogating nature at some level. Nature as teacher does not lecture or provide study guides. Instead natural systems appeal to our innate curiosity, with the awesome and strangely beautiful compelling us to learn as best we can. Evolution is the unifying principle for comprehending all life on earth, and applying its lessons about the history and mechanisms of change can promote human well—being. What was once a curiosity is now a powerful tool. Metagenomic analysis has revealed about 300 previously unknown microbes living in the human gut.

MORE TO EXPLORE The Future of Life. Edward O. Wilson. Alfred A. Knopf, 2002. A Citizen’s Guide to Ecology. Lawrence B. Slobodkin. Oxford University Press, 2003. The Evolving World: Evolution in Everyday Life. David P. Mindell. Harvard University Press, 2006. Is Evolutionary Biology Strategic Science? Thomas R. Meagher in Evolution, Vol. 61, No. 1, pages 239–244; January 31,2007. Evolution in Health and Disease. Edited by Stephen C. Stearns Jacob C. Koella. Oxford University Press 2007. Science and Technology for Sustainable Well-Being. John P. Holdren in Science, Vol. 319, pages 424–434; January 25, 2008 [erratum, Vol. 320, page 179; April 11, 2008].

READING: EVOLUTION IN THE EVERYDAY WORLD | 69

Evolution and Medicine Network. Available at http://evolutionandmedicine.org The Innocence Project. Available at http://innocenceproject.org

PRIMATES Section 2

CHAPTER 4

LIVING PRIMATES

I N TR T R O D U C TI TION Anthropologists study primates to help understand ourselves. Louis Leakey, one of the most prominent paleoanthropologists, was well aware that understanding ape behavior could be used to reconstruct early human behavior. He hired three females (because he thought females would be better observers of behavior) to look at great ape behavior in their natural environment. Dian Fossey was a graduate of San Jose State University in education who ended up studying gorillas; Jane Goodall, an Englishwoman with a love for nature, began studying chimpanzees in the 1960s; and Birute Galdikas, who was born in Wiesbaden, Germany, and grew up in Toronto, Canada, had the tremendous job of studying orangutans. These studies began to give us clues to early human behavior, but it is important to realize that all primates have been evolving, and therefore they all serve as models for human evolution. But that is not saying that we evolved from them or that they have not changed too.

L E A R N I N G O BJEC LEAR BJ EC TTII VES VE S 1. 2. 3. 4.

Be able to explain what makes a primate different from other mammals. Know the differences between the two suborders of primates. Be able to distinguish different types of primates based on key traits. Be able to match the primate with its natural geographical location.

73

74 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

GENERAL PRIMATE CHARACTERISTICS

T

here are two suborders of primates, prosimians and anthropoids. Within the prosimians there are lemurs, lorises, pottos, galagos, and tarsiers (which are in between the two suborders). Within anthropoids, there are monkeys (which can be split into New World monkeys and Old World monkeys), apes, and humans. Primates are a widespread and diverse order consisting of about two hundred species. Most primates live in the tropics or neotropics (the tropics of the New World). There is no single trait that can be used to identify primates apart from other mammals because primates are generalists (i.e., animals that are not restricted to a specific type of diet, locomotor, or environment). A suite of traits are useful, however, in identifying the difference between a primate and another mammal. These can be split into locomotor, diet, and behavioral traits. Primates have flexible joints that enable them to move their limbs in a variety of ways. We, too, can move our limbs in a variety of directions. Think of your shoulder joint and how you can lift your arm above your head. Apes lift their arms above their heads often to brachiate (a type of locomotion that involves swinging underneath branches by hands and arms). But most nonhuman primates have lower limb joints that are also very flexible. Having this flexibility is ideal for life in the trees, or what anthropologists call arboreality. In addition to flexible joints, primates have an upright posture, which means they can sit without supporting their bodies with their forearms, as do cats and dogs. This allows primates to reach out to grab fruit in the trees and bring it to their mouths. It also enables free hands for one of primates’ favorite activities, grooming. Grooming is not just to pick out bugs and dirt from friends’ fur, but also helps keep groups calm, soothes stressed primates, and tightens bonds. Grooming is much more similar to hugs than to a bath. In order to groom and pick fruit, prehensile (adapted for seizing, grasping, or holding) fingers and an opposable thumb (or being capable of being placed opposite something else) are advantageous. Nearly all primates have five digits and some degree of opposability. This means they can use their

Primate distribution

LIVING PRIMATES | 75

hands to grasp tree limbs, food, each other. Although most primates have opposable thumbs, many have feet and hands that look similar since they use both to move around. In addition to opposable digits, primates have nails instead of claws. Claws create a lack of bone area for nerve endings and, thus, animals with claws do not have a good sense of touch. By having nails, the last finger bone can stay flat and this leaves a bone surface area for nerve endings. A sense of touch is essential if you are going to grab things, groom others, and make tools. Another trait among primates is enhanced vision. Primates lost much of their sense of smell and have reduced snouts. To make up for the lack of smell, they have developed forward-facing eyes and color vision. This allows them to see in three dimensions. Prey animals often have FIGURE 4.1: Orangutan lexibility eyes on the side of their heads that help them see behind them, but this does not allow them to gauge depth. If an animal is moving in the trees, it will definitely want to know just how far away is that next branch it is reaching for. Color vision is also an effective way to recognize other primates, to attract mates, and to determine whether fruit is ripe. The male mandrill’s colorful face is evidence of sexual selection by color in primates. Primates also have enclosed eye sockets or post-orbital bars to protect their eyes; a good sign of the importance of vision. Primates are omnivores. They eat just about everything and their omnivore diet is reflected in their dentition. They have molars and premolars that are cusped for grinding, FIGURE 4.2: Grooming flat-bladed incisors for biting, and canines for tearing apart meat. Although some primates will eat more leaves (foliovores) than other primates—and, thus, will have smaller incisors than the fruit eaters (frugivores)—they all have a diverse diet. No primate limits itself to only one food, such as our grazing animals or carnivores that eat just meat. Mammals, in general, have a variety of different types of teeth (heterodonts), unlike reptiles that have homodonts (all teeth being the same), but many mammals have become specialized and no longer have the four types of teeth as do primates. Finally, primates are K-selected animals. All animals fall on a continuum of r-K selection. The r-selected animals have multiple births at one time (litters) and do not take care of their offspring for very long. Usually, r-selected animals grow up very fast, have smaller brains, and die earlier than K-selected animals. The likelihood of any one offspring surviving in r-selected organisms is low, but it does not matter much FIGURE 4.3: Maternal care

76 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

since others will survive. Fish are very r-selected. Primates are on the other side of the continuum; they are very K-selected. Primates, in general, give birth to one or two offspring at a time, take care of that offspring for many years, and live long lives. Primates take a long time to reach maturity; chimps do not have their first offspring until about ten years of age. Often primate mothers take care of their young for years; for example, baboons breast-feed for at least six (and sometimes as long as fourteen) months and then take care of their young for another several years. Orangutans stay with their mothers until they are five to seven years of age. Since K-selected animals take such a long time to develop, they also learn in social settings. Primates are very social and tend to be very smart, which often go hand in hand, and with brain sizes that are very large for their bodies. With these general traits in mind, let us examine the diversity of modern primates. FIGURE 4.4: Potto

PROSIMIANS Prosimians consist of two major lineages that separated around fifty-five million to sixty million years ago. The lineages are lorisiformes, which consists of lorises, pottos (figure 4.4), and galagos (figure 4.5), and lemuriformes, which contain all the Madagascar primates. As a group, prosimians are the older branch of primates (they seem to have evolved first) and they retain some of the primitive characteristics linked to the early nocturnal evolution of primates. For example, they have reflective eyes, called tapetum lucidum, which they have in common with other nocturnal (nighttime) animals, such as cats. They also have a continued reliance on their sense of smell as seen with their rhinarium (i.e., wet noses) and long snouts. Other animals with a keen sense of smell, such as dogs, also have these traits. It is difficult to see at night and distinguish mates and others; thus, a rhinarium combined with scent markings help prosimians socialize FIGURE 4.5: Galago and mark territory. In addition to these traits, prosimians are on average small (about rodent size), live in small social groups (e.g., mother and offspring), and have a grooming comb between their lower canines, which is necessary since they do not groom one another. They have some parental care, but their offspring are very large at birth and difficult to carry around, so the offspring are parked in nests while

LIVING PRIMATES | 77

FIGURE 4.6: Ring-tailed lemur

FIGURE 4.7: Sifaka lemur

FIGURE 4.8: Aye-aye lemur

FIGURE 4.9: Gentle lemur

mothers forage. Prosimians give birth to twins (and sometimes triplets) that weigh over a quarter of the mother’s weight at birth. These offspring initially cannot cling to their mothers and, thus, are carried in the mouth when moved around. Consequently, it makes sense that they park their offspring. Prosimians lack an enclosed eye orbit, but they do have a postorbital bar that protects their eye more than most mammals. Most prosimians are insectivores; their teeth are sharp and pointy to break open the exoskeletons of insects. Finally, they are either leapers or clingers and have claw-like nails that help with grooming and clinging to trees. The loris lineage (or lorisiformes) consists of lorises (in Southeast Asia), pottos (in Africa), and galagos (in Africa). All of the lorisiformes are nocturnal and small-bodied. Lorises, pottos, and galagos

78 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

diverged from one another around fifty-five million years ago; this probably related to sharing the same habitats. Pottos and lorises are slow-clinging primates with relatively short limbs and a strong, broad hand to cling to branches. They move slowly and deliberately. The foods they most commonly eat are slow-moving insects that smell bad to other primates, and to avoid predators they stay as still as possible while camouflaged with their fur. Galagos, on the other hand, are spectacular leapers. They have long legs and short forearms to assist in their leaping. Galagos (also known as bush babies) make high-pitched noises that Africans have likened to a baby crying. Galagos share their environment with pottos and, thus, their fast movements enable them to eat insects that pottos cannot catch. Also, instead of hiding from predators, galagos will flee. By having these different locomotor types, diets, and predator avoidances, they reduce competition in the west African rain forests. In Southeast Asia, lorises and tarsiers reduce competition for resources in the same way. Lemurs, or Lemuriformes, are a diverse nocturnal and diurnal superfamily. They range in size from about mouse size (in the change to dwarf lemur, figure 4.10 lemur) to cat size (sifakas, figure 4.7 indriis, and ring-tailed lemurs figure 4.6). They achieved this greater diversity through adaptive radiation. Lemurs are found only in Madagascar, a large island off the southeast coast of Africa. Few animals occupied the island when they arrived there around fifty-five million years ago, but there was a vast diversity of habitats and plants that created many varied niches. Currently, there are about thirty species of lemurs; half are diurnal and half are nocturnal. There are some strange variations, such as the ayeaye (figure 4.8) that has a long mobile finger, large ears, no premolars, and incisors that continuously grow. The aye-aye uses its finger and ears to tap on wood and then listen for insects below. If there are some insects underneath, it gnaws a hole into the tree and with its long finger scoops out the food. Dwarf lemurs and mouse lemurs are mouse-sized frugivores that hole up in trees. They can live off the fat they store in their tails and hibernate during the cold season. Gentle lemurs (figure 4.9) consume bamboo that is filled with arsenic and can kill any other primate, including humans. The group of ruffed lemurs acts as pollinators; they eat flowering plants with long tongues and the fur around their face captures the pollen and then distributes it when they leave. And, ring-tailed lemurs are incredibly social and use their tails to keep track of group members. They also use scent marking and are about cat-sized. They have female dominance in their groups. The article “Sexual Selection, Multiple Mating and Paternity in Grey Mouse Lemurs, Microcebus murinus” (2002), by Radespiel and colleagues [Reading 4], examines sexual selection in grey mouse lemurs and paints the complex picture of lemur mating.

TARSIERS Tarsiers (figure 4.11) consist of three species that live in Southeast Asia. They are wedged between anthropoids and prosimians and it appears that they diverged from the prosimians around fifty million years ago, but they took a different evolutionary path than anthropoids. Tarsiers have some traits

FIGURE 4.10: Dwarf lemur

LIVING PRIMATES | 79

that are prosimian-like, some that are anthropoid-like, and some that are unique. Similar to prosimians, they are small-bodied, nocturnal, and prey on insects and small invertebrates; however, they have independent control of each finger (which prosimians lack), they do not have a reflective eye, and they have a partially closed eye orbit. Their noses, similar to anthropoids, are dry and they have muscles on the top of their lip to enable them to communicate through expressions. Unique to it, a tarsier has eyes as large as its brain, which aids in night vision since it does not have a tapetum lucidum. Also, tarsiers can turn their heads one hundred eighty degrees, which FIGURE 4.11: Tarsier is useful to avoid predators and catch prey. Tarsiers are named after their elongated tarsal bones, which are bones of the foot, and they are excellent leapers. Their long feet and the fusion of their tibiae (shin bones) and fibulas enable them to make spectacular leaps. Remember that they are sharing their habitat with lorises and have evolved leaping abilities to reduce competition for resources with lorises.

ANTHROPOIDS Anthropoids split from a common ancestor with prosimians around fifty million years ago, and became diurnal frugivores. Anthropoids have eye orbits that are more directed to the front compared with prosimians and are completely enclosed in bone. They have well-developed stereoscopic vision that lets them see in three dimensions, color vision, and an enlarged visual cortex in the brain. Anthropoids have lost the wet muzzle of prosimians and have a small nose and snout; some anthropoids look like they have a large snout, like baboons, but this is really a result of canine formation. Anthropoids tend to have large biting incisors while prosimians have small incisors. And, anthropoids have a fused lower jaw with square-shaped cheek teeth (the premolars and molars); these adaptations are useful in chewing foods that require more processing than insects. Anthropoids are more K-selected than prosimians, which is coupled with relatively larger brain sizes, longer life spans, longer gestation periods, fewer offspring at one time, more social interaction, and more parental care. PROSIMIANS

ANTHROPOIDS

Post-orbital bar, wet nose

Eye socket, dry nose

Leapers/clingers

Quadrupeds

More r-selected

More K-selected

Smaller bodied

Larger bodied

Insectivores

Frugivores

Anthropoids can be split into New World monkeys, Old World monkeys, and apes. Let us start with New World monkeys, also known as platyrrhines. They consist of two subfamilies (cebids and atelines) and five groups under these subfamilies. In the cebids, there are callitrichines (marmosets

80 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

FIGURE 4.12: Callitrichines

and tamarins) and cebines (capuchins and squirrel monkeys). In the atelines, there are owl monkeys, prehensile tail monkeys (spider monkeys, howler monkeys, and woolly spider monkeys), and the pithecines (uakaris, titis, and sakis). All New World monkeys shared a common ancestor around twenty million years ago. A popular hypothesis is that the New World monkeys rafted over from Africa. It appears that large areas of rain forest can be uprooted when rivers swell and the forests are moved along the rivers (in this case it would be the Nile). When the land is at the end of the river, it can be thrust out to sea along with the plant and animal life. These moving islands float along ocean currents and eventually arrive at other continents. At the same time monkeys arrived in the New World, some plants and other animals from Africa arrived there too. This island journey may have caused the beginning of body size decrease in New World monkeys since small animals are favored on islands due to limited resources. New World monkeys vary in size from the tiny marmosets and tamarins that weigh about twelve ounces to the fourteen-kilogram howler monkeys. Once the New World monkeys

LIVING PRIMATES | 81

arrived in the Americas there were no small arboreal animals occupying the niche, whereas in the Old World prosimians occupied that niche. In general, platyrrhines are nearly completely arboreal and some species never come to the ground. This makes them extremely difficult to study. All species of platyrrhines are diurnal, except for the owl monkey. Callitrichines (marmosets and tamarins) are the smallest anthropoids in the world. They consist of more than twenty-five species within five genera and all share a common ancestor around ten million years ago. They thrive on gum and sap by using their claw-like nails to hang on to tree trunks, and then with their specialized dentition gnaw through tree bark to get to the super sweet gum and sap. FIGURE 4.13: Squirrel monkeys Due to the high sugar content in their diet, they are always moving around and very active. They have small social groups and give birth to twins; interestingly, they are polyandrous (which means a single female has multiple male mates). Males provide a great deal of care to offspring. They also have low levels of sexual dimorphism and female dominance. Owl monkeys (aotines) are the only living anthropoids that are active at night; they weigh about one kilogram and lack sexual dimorphism. Their nocturnal habits seem to be a recent evolutionary adaptation since they lack reflective eyes and are most active during a full moon or just before it becomes really dark. Their nocturnal adaptation may have been a way for this little monkey to reduce competition with other monkeys that are active during the day. Owl monkeys spend their days in hollows of trees or in vines. They live in small family groups that are usually two to six individuals in size; males take part in raising offspring, which is usually just a single birth. Fathers and sometimes older siblings will carry FIGURE 4.14: Capuchin monkeys the infant on their backs. This helps mothers retain energy for foraging, improves mother caloric intake, and, as such, improves mother’s milk and delays weaning. Cebines, which consist of squirrel monkeys and capuchins, are widely distributed throughout the New World tropics. There are four species of squirrel monkeys and each weighs about one kilogram. Capuchins, which are found throughout South and Central America, weigh about three kilograms and also include four species. For both, capuchins and squirrel monkeys, their diets consist of fruit and animal prey; often these monkeys forage together. They are famous for their curiosity and seem to be able to manipulate objects very well, due to their long fingers and prominent thumbs. FIGURE 4.15: Titi monkey

82 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

They have very large brain sizes for their small bodies, which some anthropologists have argued is just a remnant of being larger bodied in the past rather than a true increase in brain size compared with other platyrrhines. Pithecines are seed-eating monkeys that consist of titis, sakis, and uakaris. Titi monkeys weigh about one kilogram and live in a small family group of about four; they consume seeds, unripe fruit, insects, and leaves. Adult pairs form strong bonds and often rest close together with their tails entwined; similar to other platyrrhines, paternal (or father) care is FIGURE 4.16: Uakari monkey common. Infants have a five-month gestation, which is incredibly long considering the size of these animals. DNA fingerprinting has revealed that less than 30% of the offspring are actually from a different male than from the bonded male. Saki and Uakari monkeys are the least-studied primates; there are about three genera and eight species and they weigh between 1.5 and 4 kg. Their habitats include flooded and non-flooded forests and they rarely come to the ground. Their diet is almost entirely seed-based and their jaws are incredibly strong to prevent breakage from opening seeds. They sometimes live in groups as large as twenty-five individuals and are sexually dimorphic in color. Atelines are (figure 4.17) the largest New World monkeys; they weigh about fourteen kilograms. They all have prehensile tails and include the howler monkey, the woolly monkey, the spider monkey, and the woolly spider monkey. Their tails are equipped with friction skin, sweat glands, and sensory nerves. Atelines rely on fruit and leaves, with spider monkeys, the smallest atelines, eating more fruit, seeds, and flowers than howler monkeys, who eat more leaves. When the dry season occurs, spider monkeys will eat young leaves and howler monkeys will eat drier older leaves, but during times of abundance spider monkeys eat ripe fruit and howler monkeys concentrate on unripe fruit. The spider monkey has no thumb; it uses its hand much as a hook to move around acrobatically through the trees, but this makes it difficult to catch prey. Howler monkeys have a reduced thumb, but a space between their other fingers and their index fingers aids them in grasping. Howler monkeys are very territorial and use their adapted hyoid, which is the bone that anchors the tongue, for loud calls to prevent unwelcome monkeys from intruding on their territory and perhaps snatching their mates. New World monkeys are called platyrrhines for their flat noses, while Old World monkeys are called catarrhines because their nostrils are below the nasal bridge. As a whole, New World monkeys have low degrees of sexual dimorphism, paternal care, and small group sizes. Old World monkeys, on the other hand, show large degrees of sexual dimorphism, no or little paternal care, and large group sizes. Old World monkeys also have larger overall body sizes (at the high end, 35 kg) and occupy a greater range of habitats (mountains, forests, and savanna grasslands). The body size differences between platyrrhines and catarrhines reflect niches that the two suborders fill; platyrrhines fill the small arboreal animal niche that is filled by prosimians in the Old World, whereas in the New World tapirs fill the medium to large animal niche. In the Old World, monkeys fill in the medium to large animal niche. Old World monkeys are less arboreal than New World monkeys, which enables catarrhines

LIVING PRIMATES | 83

FIGURE 4.17: Atelines

to be more social. Old World monkeys have ischial callosities (also known as bony calluses on their sitting bone) to make sitting for long times, especially during grooming, comfortable. PLATYRRHINE

CATARRHINE

Fill small animal niche

Fill medium animal niche

Extremely arboreal; prehensile tails

More terrestrial; ischial callosities

No sexual dimorphism

Great sexual dimorphism

Although Old World monkeys are more diverse than New World monkeys, Old World monkeys can be easily understood by examining their two subfamilies colobines and cercopithecines. These two subfamilies diverged around twelve million to fourteen million years ago; colobines are foliovores and cercopithecines are frugivores. Colobines are found in Africa and Asia; there are about ten species and most are in Asia. They range in size from 4 to 10 kg. All colobines have sharp-crested molars to slice up leaves, and spend most of their days eating and digesting food; their specialized anatomy includes an enlarged and chambered stomach that holds bacteria to break down the leaves, resulting in a large gut in appearance as well. Leaves are low sugar foods and, thus, colobines are not very active. Group sizes can vary from a few individuals to

FIGURE 4.18: Black and white colobus

84 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

FIGURE 4.19: Odd-nosed monkey

FIGURE 4.20: Langur baby

hundreds of monkeys. Sexual dimorphism is common, and sometimes comes in odd forms. Oddnose colobines have sexual dimorphism in their faces, with very pronounced noses that males can use to make sounds and even use for swimming underwater. Odd-nosed colobines are also unusual in their ability to survive cold weather; they can be found as far north as the mountainous regions of China. Langur monkeys are Asian colobines infamous for their high level of infanticide; the purpose

FIGURE 4.21 Guenon

FIGURE 4.22: Mandrill

LIVING PRIMATES | 85

FIGURE 4.23: Baboon

FIGURE 4.24: Gibbon

of the infanticide may be to put females back into estrus (i.e., ovulation) to get a second chance to mate and pass on genes. On the other hand, some anthropologists have suggested the infanticide is driven by overpopulation and stress induced by too many people (not monkeys); stresses include a lack of habitat, food competition, and other environmental factors. Cercopithecines are frugivores and have cheek pouches that they use to store food. These monkeys are active and extremely social. The high sugar content in their diet allows them to interact and spend energy in ways that the colobines cannot. The cercopithecines include guenons (twenty-five species in Africa) that occupy a variety of habitats in equatorial Africa, including rivers, forests, savannas, and swamps. Most guenons (figure 4.21) are small (4 to 7 kg) and have colorful faces; Old World monkeys have more color in their faces and other types of anatomical variation (such as odd noses) than New World monkeys. This difference between New World and Old World monkeys may be related to the fact that Old World monkeys are often in less-forested locales and can actually see these morphologies. The most terrestrial of the cercopithecines include the mandrills, (figure 4.22) mangabeys, baboons, (figure 4.23) and macaques. All of these monkeys are heavy; male baboons and mandrills can weigh 35 kg. They also display large sex differences in body size (females are about half the size of males) and canine size. Males use their canines in display to intimidate other males away from mates. Cercopithecine fingers are relatively short, most likely to aid in terrestrial locomotion, but they also spend much time grooming. Grooming is a way for them to gain rank, thereby assisting them in gaining access to resources and mates, calming their nerves, and building friendships. Their fingers are still developed enough to catch prey and they are known to eat small antelope and share their food. Cercopithecines, in general, have large group sizes and high degrees of sexual dimorphism that is coupled with multi-male, multi-female social groups. Interestingly, mandrills were often believed to be most closely related to baboons, but genetically they are closer to guenons and this may help explain their remarkable face coloration. Apes are our last group of living primates to cover. Apes are, in general, larger than monkeys; however, the lesser apes are smaller than some of the Old World monkeys. Apes do not have tails and have shorter backs than monkeys; apes are more erect in posture and monkeys are more quadrupedal. When monkeys move around in trees, much of it is above the tree branches; apes brachiate more. The brains of apes are larger and more complex than monkey brains, which is likely why we see tool

86 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

use and tool making in apes, but not often in monkeys. The behavior of apes is more complex as well; they have generations of families, they teach offspring behaviors, and they use a wide variety of communication methods. The article “Chimpanzee Ai and her son Ayumu” (2002), by Matsuzawa [Reading 5], presents an excellent example of chimpanzee intelligence and learning. Apes are more K-selected than are monkeys; they have few offspring, sometimes one every three to four years, and raise their offspring for years. This is one of the reasons they are endangered; when we lose an ape, it takes a long time for another to replace it. Apes are confined to the tropics of Africa and Southeast Asia; they are best understood as frugivores, but they have very diverse diets. MONKEYS

APES

Tailed More r-selected Medium Quadrupeds

Tailless More K-selected Large Brachiaters

Hylobatids (gibbons, figure 4.24, and siamangs) are called the lesser apes and inhabit Southeast Asia; molecular data suggest they diverged from the other apes around twelve million to fourteen million years ago. There are eleven species and they mainly differ by size and color. For example, siamangs, at around 12 kg, are larger than gibbons, which range from 4 to 5 kg, and siamangs, not surprisingly, consume more leaves than gibbons. The dietary differences between siamangs and gibbons become even more pronounced during dry seasons. Different species can also be distinguished by their duets, which they use to protect their territory. Sexual dimorphism is low in hylobatids; both males and females have large canines. The low degrees of sex differences and the territorial behavior are coupled with pair-bonding and a small social group of mother, father, and offspring. Hylobatids are also extremely arboreal and excellent swingers; they have extremely long arms that are not suited to weight bearing, short thumbs, and curved long fingers. Orangutans diverged from the other great apes at around ten million years ago; they live only in Borneo and Sumatra. They are exceptional in that they are large frugivores with high degrees of sexual dimorphism and also extremely arboreal. Their movement in trees is through clambering and bridging, which consists of moving from tree to tree and having three limbs on a branch at nearly all times. The males can weigh as much as 90 kg and females as little as 30 kg. The heavy size of males makes it impossible for them to be very social; there are not a lot of trees than can withstand more than one 90-kg primate. Females are more social and sometimes keep their offspring close for about six years, with the birth interval at eight years. Males develop in two distinct ways. Male orangutans can either develop into fully grown adults, which include physical changes such as increased flanged faces, deep voices, and increase in body odor and size, or they can remain juvenile in appearance. Female orangutans are not attracted to the males who have retained their juvenile traits; thus, these males use coercion to copulate. This has been FIGURE 4.25: Orangutan

LIVING PRIMATES | 87

compared to rape in humans. On the flipside, the males who have physically matured are found to be attractive by females and, therefore, tend to be able to reproduce without coercion. However, these physically mature males need more food and fight more frequently than the un-matured males. Orangutans have been seen using tools in Sumatra to get insects and fruits with hard shells. African apes share a common ancestor about seven million years ago. Among the African apes, gorillas are the most terrestrial and move around by knuckle-walking. FIGURE 4.26: Gorilla Knuckle-walking appears to have evolved independently (called parallel evolution when it occurs in closely related species) in gorillas and chimpanzees. Gorillas, the largest of all living primates, travel, feed, and even sometimes sleep on the ground. They reside in forested areas of western and eastern equatorial Africa. There are three subspecies: western lowland gorillas, eastern lowland gorillas, and mountain gorillas (who are the most extensively studied). Sex differences are extreme in gorillas; males usually weigh more than twice as much as females. Mountain gorillas live in groups that usually contain one or two silverback males—dominant adult males—and many females and their offspring; this type of social group is called a harem or polygyny. The silverback of males develops at around twelve to thirteen years of age. Both males and females leave their mother’s group; females join other groups while males live alone for a while, then join an all-male group, and finally start their own group. Gorillas eat mainly leaves, piths, and stalks; these foods require extensive chewing to break them down, which is why gorillas have large jaws with sagittal crests (a bony crest atop the head) for muscle attachment. Gorillas have also been seen using tools; they use tools to gauge the depth of water before passing through a flooded region. Chimpanzees and humans diverged from a common ancestor about five million years ago. There are two species of chimpanzees (Pan paniscus or bonobos, and Pan troglodytes or common chimpanzees). Bonobos are found in the central river basin of the Congo; the common chimp, which includes three subspecies, is found from the eastern shores of Lake Tanganyika into western Africa in Senegal and Gambia. Common chimpanzees and bonobos are similar in many ways, but differ in details of their anatomy and behavior. They are both moderately sexually dimorphic and both species weigh about the same (males 45 kg, females 35 to 40 kg). Canines are relatively small in both sexes of bonobos, but they are large in common male chimps. Bonobos have slightly smaller cranial capacities than common chimps, but the ranges overlap. Anatomically, FIGURE 4.27: Chimpanzee

88 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

bonobos have slightly longer legs, smaller faces, and darker faces. But it is really in their behaviors that the two species differ. Common chimps are known to be aggressive, territorial, and deal with conflicts through fighting and even tribal warfare. When common chimps hunt, they do so in all-male groups and often hunt colobus monkeys; females hunt too, but more often alone. Bonobos do not hunt often. In common chimps, the group dynamic is centered on males and male bonds are most significant. Interestingly, bipedal behavior in common chimps is usually performed to scare others and usually done by males. In bonobos, bipedality is performed by both males and females and is done to carry things. The most controversial finding is that bonobos are known for dealing with stress and competition through sexual activities. Bonobos are seen copulating FIGURE 4.28: Bonobo even when they are not ovulating; they often have sex face to face. Young bonobos engage in the activities as well. Also, females will massage each other’s genitals and engage in other sexual activities. These actions seem to reduce group stresses, form bonds between bonobos, and aid in group cohesion. But some anthropologists have argued that the behavioral differences between bonobos and common chimps are exaggerated because common chimps are in unprotected environments whereas bonobos are on conservation parks and, thus, protected from many stresses. These differences have implications when examining chimp species as models for early humans.

USING PRIMATES AS MODELS FOR HUMAN EVOLUTION Nonhuman primates are our relatives and chimpanzees are our closest living relatives. To understand early human behavior, anthropologists look at nonhuman primate behavior. Early hominids lived in environments similar to our apes and had similarities in cranial capacities; however, it is important to remember that monkey and ape behavior has changed since we diverged from them. Primates are social animals and we have good reason to assume that early hominids were social too. Primate groups are a result of natural selection in specific habitats and, as such, if early humans had similar habitats, then they too should have been social. Primates’ social groups are dynamic; membership changes as individuals are born, leave and join new groups, and die. Group numbers may remain

LIVING PRIMATES | 89

relatively stable over time. Also, with primates, sexes live together; in many mammals, adult females and males live apart for most of the year but come together to mate. Primate groups vary in size, in female-male ratio, and in degree of genetic relatedness among members, but many social bonds of higher primates derive from infant-mother attachment. Also, individuals learn to recognize others and behave appropriately, which aids group integrity. There are advantages to being social, such as having extra eyes and ears for detecting predators and opportunities for foraging together and defending feeding sites. Also, it is easier to protect infants in groups, and juveniles can play with other juveniles to learn appropriate behaviors. Living in groups, however, requires work to mediate relationships, reinforce bonds, and alleviate problems. This is done through dominance, communication, aggression, and affiliative behaviors. Dominance serves to impose a degree of order within groups by establishing parameters of individual behavior. Dominance, in primates, works to ensure reproductive success. For example, in ring-tailed lemurs females are dominant to males. Males give way to adult females and there is no sexual dimorphism, so males have no physical advantage over females. Ring-tailed lemurs live in southwestern Madagascar, which is relatively dry. They have two chances at reproduction, but the first time is optimal due to the abundance of food. In the second chance, there is greater scarcity of resources; as such, while the infant is being weaned, its chances for survival are reduced. By giving feeding priority to reproducing females, ring-tail lemurs improve the chances for the females to ovulate during the first reproductive chance while also enabling longer nursing periods. This also reduces competition for food and reduces male stress. Communication is universal among animals; some of it involves unintentional responses, such as pheromones that signal an animal is reproductively receptive. Intentional behaviors include gestures, facial expressions, and vocalizations. We recognize their meanings in nonhuman intentional communication because we have similar methods to communicate. In nonhuman primates, threats include staring, yawning (which exposes the canines), and branch shaking. On the flip side, submission includes a crouched position, patting, touching, and holding hands. Facial expressions are possible in nonhuman primates due to facial muscles, just as in humans. Apes, especially, are very expressive. Communication makes social living possible. Submissive gestures may cause a fight to be avoided. Affiliative behaviors relate to friendly associations between individuals and include grooming, hugging, kissing, and so forth. These behaviors serve to reinforce social bonds and promote group cohesion. Researchers have pondered whether these affiliative behaviors are always done in hopes of a reward, such as sexual access to a mate or shared food resources. Some researchers have suggested that this expectation of reward signifies that humans are different than nonhuman primates in that we often help others without expecting rewards; Krause’s review article on the topic of altruism addresses this conundrum [Reading 6]. When bonobos from different communities come into contact, they may greet each other, groom, play, or mate; the tension is relatively low. In bonobos, female-male bonds are strong; they are frequent grooming partners, and males often share food with females. Sexual behavior is frequent even when the female is not in estrus, and a mating pair maintains eye contact. In bonobos, females bond as well; when an adolescent female enters a new community, she bonds with an older female, which helps her integrate into the group. Grooming and sharing are frequent. Perhaps this was the same in our early hominid groups. On the other hand, common chimps appear to express more aggressive behaviors. Among common chimps, bonds established between males are the strongest within the community. Males band together

90 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

to patrol boundaries, hunt, and form complex coalitions in supporting or deposing the alpha male. Males more often than females are observed hunting. They share meat from a kill with one another and with females. They most frequently groom other males and grooming reduces tensions between competitors and promotes reconciliation and reassurance after aggressive acts. Which nonhuman primate do you believe is the best model for our early human ancestors? But remember that nonhuman primates have been evolving too.

SUM SU MMA M AR RY Primates, which currently consist of over 200 species, are our closest relatives; studying them may be the best way to understand early humans and ourselves. The order of primates is defined by a suite of traits that includes a general diet, an emphasis on sight, and arboreality coupled with long lives and complex social interactions. The extreme K-selection of primates have unfortunately led to their endangerment. The arboreal lifestyle of primates, which can be seen in their grasping hands and feet, also means that loss of rain forest in the Americas may lead to a vast extinction of our least well understood monkeys. About half of all primate species are endangered.

G LLO O SSAR S SA R Y Affiliative behaviors: Behaviors pertaining to friendly associations between individuals. Arboreal: Tree dwelling. Brachiate: A type of locomotion that involves swinging underneath branches by using hands and arms. Diurnal: Active during the day. Foliovores: Leaf eaters. Frugivores: Fruit eaters. Grooming: An affiliative behavior that helps keep groups calm, soothes stressed primates, and tightens bonds. Insectivores: Insect eaters. Ischial callosities: Bone and calluses on the sitting bone. Heterodonts: Teeth of a variety of shapes. Homodonts: Teeth that are all the same shape. Nocturnal: Active during the night. Opposable thumb: Capable of being placed opposite something else. Prehensile: Adapted for seizing, grasping, or holding. Rhinarium: Wet nose to enhance sense of smell. Tapetum lucidum: Reflective eyes for night vision. Terrestrial: Ground dwelling.

SEC T I O N 2 R EAD I N G S

R EA EAD DING 4 Radespiel U, Dal Secco V, Drögemüller C, Braune P, Labes E, et al. 2002. Sexual selection, multiple mating and paternity in grey mouse lemurs, microcebus murinus shows us that even in non-human primates, mating is complex. Concepts of dominance, submission and aggression are themes in primate behavior that we may recognize in ourselves. Charles Darwin’s grandfather Erasmus Darwin described evolution being driven by Sexual Selection and Charles Darwin expanded on the concept of Sexual Selection in Descent of Man (1871) in which he emphasized the importance of female choice.

Grey Mouse Lemur Facts Country: Madagascar Continent: Africa Diet: Omnivores Habitat: Arboreal Locomotion: Quadrupedal and leaping short distances. Size: 12.9 cm; 53.2–65.5 g Longevity: in captivity over 18 years

Sexual Selection, Multiple Mating and Paternity in Grey Mouse Lemurs Microcebus Murinus By Ute Radespiel, Valentina Dal Secco, Cord DröGemüller, Pia Braune, Elisabeth Labes & Elke Zimmermann

S

exual selection theory predicts that a male’s reproductive success is predominantly limited by his access to fertile females (Bateman 1948; Trivers 1972; Clutton-Brock 1991). As a consequence, males compete for access to females and male intrasexual selection is strong. Different male competitive strategies exist depending on the defensibility of females. This in turn depends on the number of females, their spatial distribution within a given area, as well as on the degree of oestrous synchrony and the female’s behaviour in the mating context (Ridley 1986; Dunbar 1988; Ims 1988; Altmann 1990; Mitani et al. 1996). Male competitive strategies can be of contest or scramble type (Clutton-Brock 1989; van Hooff & van Schaik 1992). If females are monopolizable, aggressive conflicts between males are common in multimale/ multifemale societies. Under these conditions social dominance has been predicted to play an important role in regulating access to fertile females (‘priority-of-access’ model, Altmann 1962; Berenstain & Wade 1983; de Ruiter & van Hooff 1993; Dixson 1998). Mating success, however, does not necessarily correlate with reproductive success, since females may have concealed ovulations and prolonged oestrous periods. Complete monopolization may be difficult or impossible under these circumstances, unless females are closely guarded or led into a consortship (Hrdy & Whitten 1987; Dixson 1998). Furthermore, female interests may override male interests and female choice may be an important factor altering the reproductive outcome. For example in Saimiri oerstedi (Boinski 1987) and Lemur catta (Pereira & Weiss 1991) females prefer newly immigrated males over resident males as mates, diminishing the importance of dominance for reproductive success. The comparison of the three variables dominance rank, mating success

Ute Radespiela, Valentina Dal Seccoa, Cord Drögemüllerb, Pia Braunea, Elisabeth Labesa, and Elke Zimmermann, “Sexual Selection, Multiple Mating and Paternity in Grey Mouse Lemurs, Microcebus Murinus,” Animal Behaviour, 63(2), pp. 259-268. Copyright © 2002 by Elsevier Science and Technology - Journals. Reprinted with permission.

93

94 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

and reproductive success may provide insight into competitive regimes, selective mating and the occurrence of female choice (de Ruiter & van Hooff 1993). The grey mouse lemur belongs to the Malagasy lemurs. It is a small, nocturnal and arboreal solitary forager with a dispersed multimale/multifemale system (Martin 1972; Radespiel 2000). Females build stable matrilinear female associations whose members sleep together during the day (Radespiel et al. 1998, 2001b; Radespiel 2000). As an adaptation to the highly seasonal environment, there is a marked breeding season of a few months before and within the rainy season (Schmelting 2000; Schmelting et al. 2000b). Early captive studies have shown that dominance hierarchies between males are established shortly before the mating season and suggested that dominant males completely monopolize access to oestrous females (Perret 1977, 1992). Urinary components of dominant males have inhibitory effects on subdominant males, subsequently leading to a reduction in testis size and body weight (Perret & Schilling 1987, 1995). Several authors have suggested that social dominance may also regulate reproductive decisions under natural conditions. Martin (1972) hypothesized that dominant males might exclude subdominant males from the centre of population nuclei containing the reproductive females. Fietz (1998) provided evidence that heavier males were more closely associated with females than lighter males, indicating that contest competition between males may influence spatial access to females. Radespiel (2000) and Peters et al. (2000) described males visiting female sleeping sites at dusk during the mating season, waiting for the females to emerge and then attempting to mate. Such a rendezvous may include a large number of visiting males (up to five), although usually one male stays close to the tree hole (C. Peters, Z. Sarikaya & U. Radespiel, unpublished data). Aggressive interactions between males have also been observed, indicating that dominance may influence the reproductive outcome under these circumstances. There are also indicators of scramble competition between males. Male home ranges increase significantly at the beginning of the mating season, indicating that competitive mate searching is one strategy used by males (Radespiel 2000; Schmelting 2000; Schmelting et al. 2000a). Furthermore, the testes of male grey mouse lemurs are larger than expected in a mammal of such body size (Kappeler 1996; Fietz 1999), suggesting the necessity for frequent and repeated matings and therefore the potential for sperm competition (Harcourt et al. 1995; Harcourt 1996). Finally, females can be expected to influence the reproductive outcome since they are dominant over males, at least under captive conditions (Radespiel & Zimmermann 2001a). They can therefore tolerate or refuse male mating attempts according to their own reproductive interests. The behavioural and potentially genetic attributes of males that influence or determine female mate choice in primates are so far only poorly understood, but factors such as dominance, relatedness, age and different potential male services provided to females have been considered (overviews in Robinson 1982; Small 1989; Keddy-Hector 1992; Manson 1994; Dixson 1998). We analysed the importance of social dominance for reproductive success in male grey mouse lemurs. If contest competition is an effective mechanism in regulating access to fertile females, we would expect dominant males to monopolize females and sire most or all offspring. A weak relationship between dominance and reproductive success would indicate the presence of other male or female strategies (e.g. sperm competition, female choice). We also investigated the influence of the males’ age and their relatedness to the oestrous female as potential factors influencing the reproductive outcome. We compared infant body mass and development between dominant and subdominant fathers to test whether the father’s dominance status is a predictor of the physical condition of his offspring. We used a captive setting, since mating behaviour and social interactions cannot be

READING: SEXUAL SELECTION, MULTIPLE MATING AND PATERNITY IN GREY MOUSE LEMURS | 95

systematically observed under natural conditions, owing to the dispersed and nocturnal lifestyle of these mouse-sized animals.

METHODS Study Animals and Housing Conditions We used 25 adult grey mouse lemurs (14 males, 11 females) housed in seven social groups during this study. They were all born in captivity, either descendants from our breeding colony or from the Parc Zoologique de Vincennes, France. Founders of our colony came from the Rotterdam Zoo, The Netherlands, in 1985 and 1993. All animals are registered in the European Studbook. Between 1993 and 1996 the colony was kept at the German Primate Center in Go¨ ttingen which has permission to keep and breed nonhuman primates for research purposes. The colony was subsequently moved to the Institute of Zoology, Hannover, whose breeding facility is approved by the municipal office of the city of Hannover. Since free-living mouse lemurs live in a dispersed social organization (see Introduction), the total number of individuals that can be kept together under captive conditions is generally limited (Perret 1982; Perret & Predine 1984). Therefore, we conducted observations on groups of four adult animals (two males, two females). This group composition approximates best the multimale/multifemale society known from their natural habitats and offers the possibility of promiscuous matings which are thought to occur in the wild (Fietz 1999; Radespiel 2000). Our long-term experience has shown that groups of several males and females cannot easily be kept together over a period of several months or years without bouts of serious aggression developing between the sexes and/or the males, usually leading to the eviction of one or several group members (U. Radespiel & E. Zimmermann, unpublished data). Levels of aggression in mouse lemur groups vary seasonally. Females show aggression against males most frequently during the mating season and males show higher levels of intrasexual aggression when competing for females (Zimmermann 1995; Radespiel 1998; Radespiel & Zimmermann 2001a). As a consequence, we generally put the animals into heterosexual groups shortly before or at the beginning of the mating season and keep them together for a limited period (usually several weeks; Perret 1997; U. Radespiel & E. Zimmermann, unpublished data). All study groups were formed within the first 8 weeks before the oestrus leading to conception. Four heterosexual groups were formed at the first day of oestrus of one of the group’s females, but in these cases the unisexual dyads had been housed together for several weeks to facilitate familiarity and the establishment of a social relationship. We observed dominance relationships and sexual interactions in five captive groups, each consisting of four (two males, two females) adults during seven conceptive oestrous periods between 1995 and 2000. In two groups (groups 1 and 4) both females reproduced and the same males therefore appear twice in the analysis. The beginning of the oestrus was detected by regular inspections of the outer vaginal morphology following Buesching et al. (1998). We determined the paternity (see below) for 10 litters born to eight females in these five and two further groups for which dominance data were not available. In one group (group 5), an additional male was present during the oestrus of the second female (F2). Two females and one male were successively members of two study groups (in different years). The age distribution of the potential fathers (N = 15) was as follows. Three potential

96 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

fathers were 1 year old, two were 2 years old, two were 3 years old, four were 4 years old, three were 5 years old and one was 6 years old. One male was assigned to two age classes because he was a group member in two different years. The groups were housed either in five adjacent and connected cages with a total size of 2.5 × 0.8 m and 1.3 m high, or in two connected cages, each 1.4 × 0.8 m and 1.65 m high. Cages were equipped with wooden branches, platforms and tubes and were provided with fresh leaves ad libitum. Each group had access to four sleeping boxes. We kept the animals under a reversed light regime with a dark period from 1000 to 2000 hours. Room temperature was kept at 22–24°C and the relative humidity was ca. 60%. Animals were fed once a day with a mixed diet of fruits and vegetables, a protein-rich pap and insects (locusts, mealworms). Housing conditions are described in detail in Wrogemann & Zimmermann (2001).

Observations and Analysis We conducted behavioural observations of agonistic conflicts between the males and mating behaviour during the night of conception which is the only night when female mouse lemurs are receptive and allow copulations (Glatston 1979; Buesching et al. 1998). This night was chosen because short-term dominance changes and reversals can occur (Lindemann 1996) and have been observed in one of the study groups (Radespiel 1998). The night of conception differed for all females and therefore the behavioural data during oestrus were all used only once. The 1-h observation session took place within the first 2 h of the dark period. We used the all-occurrences observational technique (Altmann 1974) to record all social interactions within the groups. We used all decided agonistic conflicts (definition sensu Pereira & Kappeler 1997: (1) animal 1: aggressive/animal 2: submissive or (2) animal 1: indifferent/animal 2: submissive) between the males to determine the dominance relationship on that particular day. Agonistic behaviours between males consisted of chasing/fleeing, spatial avoidance and occasional fights (two animals coiled around each other) but did not lead to visible injuries. Attacked animals could flee into adjacent cage compartments, into sleeping boxes or below a layer of paper that covered the floors. In these places they were hidden and the attack usually stopped. We defined male 1 as being dominant over male 2 when three conditions were fulfilled: (1) both animals had at least two decided conflicts, (2) male 1 won at least two more conflicts than male 2 and (3) male 2 did not win more than one conflict in all. We summed up the mating behaviour in a category that included mounting, attempted and successful copulations. Reproductive success was compared for dominant/subdominant as well as older/ younger males. We weighed the surviving offspring, during weekly handling routines at the age of 12–14 days, 6 months, 1 year and 2 years, in their sleeping boxes (by comparing the weight of the empty and occupied box).

Microsatellite Analysis We extracted DNA either from 20–40 hair roots or from a tissue biopsy (1–2 mm2) that was taken from one of the ears during a usual weekly handling routine. The procedure was performed with a forceps and fine sharp scissors and lasted a few seconds. We did not apply an anaesthetic in accordance with the German law for animal protection. If the wound bled, styptic cotton was applied. Adverse effects were never observed. These sampling procedures were approved by the Bezirksregierung Hannover. The hairs were placed in 250 μl of a 5% Chelex-100 (BioRad) suspension, 2.5 μl Proteinase K (20 mg/ml)

READING: SEXUAL SELECTION, MULTIPLE MATING AND PATERNITY IN GREY MOUSE LEMURS | 97

was added and the samples were incubated first at 55°C for 6–8 h and then for 10 min in a boiling water bath. The tissue samples were extracted with the QIAamp DNA Mini Kit (Qiagen, number 51306). We amplified the DNA of each individual (N = 44) for 13 nuclear microsatellite loci. Four newly developed microsatellite primers (Mm01, Mm04, Mm06, Mm11) and nine already published markers (C1P3, Mm02, Mm03, Mm07, Mm08, Mm09, Mm10, L1, Efr56) were used for genotyping. Table 1 gives the characteristics of these genetic markers. We performed PCR reactions in 10 μl (tissue) or 20 μl (hair) of reaction volume containing 1–1.5 mM MgCl2, 1 × PCR buffer (final concentration: 20 mM TrisHCl (pH 8.4), 50 mM KCl) or 1 × PARR buffer (Cambio), 225 μM of each dNTP, 0.1–0.3 μM of each primer and 0.25 U of Taq DNA Polymerase (Gibco Life Technologies, Paisley, U.K.) in a GeneAmp 9700 Thermocycler (Perkin Elmer). An initial denaturation of 4 min at 94°C was followed by 36 cycles (50 cycles for hair DNA) of 20–30 s at 94°C, 20–30 s at 48–55°C, 30 s at 72°C, and a final extension at 72°C for 7 min. IRD700-labelled PCR products were separated on 0.2-mm 6% denaturing polyacrylamide gels using a LI-COR Gene ReadIR 4200 automated Sequencer (MWG Biotech, Ebersberg, Germany). We analysed the bands with the Gene Profiler V3.55 Software (Scananalytics Inc., MWG Biotech, Ebersberg, Germany).

Statistical Analysis We established paternities by excluding one of the males present on the basis of his multilocus genotype, if it contained one or more pairs of alleles that were different from the offspring’s alleles (subtracting the mother’s alleles first). We used the individual multilocus genotypes of 14 males and eight females (the parent generation only) to calculate the relatedness values (r values) between each mother and both adult males of her group according to the formula of Queller & Goodnight (1989) with the Kinship 1.3.1 software. To verify that the allele distribution allows the calculation of r values, we simulated the r values (as calculated in Queller & Goodnight 1989) on the basis of the sample frequencies, using a Bayesian approach with 10 000 Monte Carlo simulations. Unrelated dyads (r = 0.0) were simulated as 0.066 ± 0.049 (SD), cousin relationships (r = 0.125) as 0.187 ± 0.048, half-siblings (r = 0.25) as 0.306 ± 0.043 and parent–offspring relationships (r = 0.5) as 0.529 ± 0.020. These results indicate a certain degree of variability in the r values, but also their general usefulness in describing genetic relationships.

RESULTS Dominance, Age and Mating Behaviour We determined the dominance relationship between the males in five groups and seven oestrous periods. In one group both males won conflicts and therefore neither was dominant during the first oestrous period, whereas male 1 was clearly dominant over male 2 during the second. In all other oestrous periods we could establish a dominance relationship that did not change during the study. The older male was dominant over the younger male in two out of three groups with differing male age. Both males with undecided dominance relationships, all dominant males (N = 6) and two subdominant males showed mating behaviour. Overall, dominant males showed mating behaviour significantly more frequently than subdominant males (two-tailed Wilcoxon signed-ranks test: T = 1.0, N =6, P < 0.05; Fig. 1). In one group, however, the subdominant male mated with the female more often (five times) than the dominant male (four times).

44

44

43

44

43

44

44

44

44

31

36

33

31

C1P3

Mm02

Mm03

Mm07

Mm08

Mm09

Mm10

L1

Efr 56

Mm01

Mm04

Mm06

Mm11

4

3

5

2

4

3

5

3

5

5

7

4

5

NO. OF ALLELES

216–236

161–189

139–177

235–239

234–258

190–196

117–139

187–191

154–186

242–272

93–149

156–172

209–231

SIZE RANGE(BP) H0

0.61

0.24

0.72

0.10

0.52

0.50

0.80

0.32

0.84

0.64

0.53

0.59

0.64

0.74

0.22

0.66

0.15

0.54

0.54

0.65

0.36

0.75

0.63

0.55

0.55

0.51

He

(GAAA)2GAAG (GAAA)16GAAG (GAAA)2(GGAA)23

(GA)4TT(GA)8GG (GA)30

(GA)26

(GA)8

(GTGC)2(GT)16

(TG)11

(CTTT)3CTT (CTTT)2CTGT (CTTT)13

(TC)24

(TC)18

(CT)4CC(CT)15

(GA)18

(GA)18

(TC)26

REPEAT TYPE

PRIMER SEQUENCES (5´ TO 3´)

F: GATCATGTTTAGTTCTTCCACAGG R: ACTGAACAGGGTGGGCATA

F: ACCTGCTGCAGATTGATG R: AGAGAATGCATTGGTGGAC

F: GAACATCCAGAAGCAGAGAG R: AGTTAGCAGGAACAAAGCAG

F: AGGCTGACACCACGACACTC R: TCTGGCATAGTTGAGTTTGTCTCC

F: CCACCTTAGCATATTTAGCAT R: GTTTGATGTTCGGAACTGAGAG

F: GCTAGGACATAGCAGGGGC R: ATGATAATGATTAATGCGTGA

F: GGGCTCCAATAGAGGCAATAA R: CTCCAGCCTAGCCAACAGAG

F: TCTGTCTCATGCCTCTTTGCT R: GGGTGTGAAAGACATTACTCACAG

F: CAGTTGGTGAATGGGCTAGG R: GAGACCATAATGCTGCAAGTAACC

F: AGTACCTAAGCCTGCCATTT R: GTAGTACAGTACCTAGAGCAACCAC

F: AGCCTCACTGTTTCAGTTGTGT R: GGCAGGAAATGTCATCTGG

F: TTAACAGGGCCTTCTCCTCAC R: AATTGCCCAGTCCACACCT

F: AGCCGAACACATTTCAGAGG R: GTAGTCACACCTGGGCTTGG

F: forward primer; R: reverse primer; H0: observed heterozygosity on the basis of all 44 animals; He: expected heterozygosity.

NO. OF SAMPLES

LOCUS

TABLE 1: Summary statistics of 13 polymorphic microsatellite loci in 44 captive grey mouse lemurs SOURCE

This study

This study

This study

This study

Jekielek & Strobeck 1999

Merenlender 1993

Radespiel et al. 2001

Radespiel et al. 2001

Radespiel et al. 2001

Radespiel et al. 2001

Radespiel et al. 2001

Radespiel et al. 2001

Radespiel et al. 2001

98 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

READING: SEXUAL SELECTION, MULTIPLE MATING AND PATERNITY IN GREY MOUSE LEMURS | 99

Determination of Paternity We analysed the paternity of 19 infants belonging to 10 litters (four singletons, three sets of twins, three sets of triplets; Fig. 2). Siblings always differed in their multilocus genotype, showing that they were dizygotic twins or trizygotic triplets, respectively. Paternities could be established in 17 (89.5%) ¯ ± SD = 2.7 ± 1.36) with a maximum of 13 typed cases by exclusion at one to six marker loci (X microsatellite markers. The remaining two paternities remained unresolved. Four out of six litters (1/F1, 5/F1, 6/F1, 1/F2) were sired by one male only and the second male could be excluded at one to five loci (Fig. 2). In one litter (2/F1) one infant was sired by male 2 and the other two infants by male 1, showing for the first time that multiple paternity occurs in a primate species. In one triplet (3/F1) multiple paternity could be neither excluded nor confirmed, since none of the males could be excluded as the father of one infant on the basis of their genotypes, leaving this paternity unresolved.

Dominance, Age, Relatedness and Reproductive Success Both dominant and subdominant males sired offspring in the study groups in comparable numbers (dominant: N = 6, 54.5%; subdominant: N = 5, 45.5%; Fig. 2). In two cases, we could confirm subdominant males as fathers even though we had not seen them mate with the female. The influence of age on paternity could be examined in 10 cases, where both males differed in age (Fig. 3). The younger males sired seven offspring and in five of these cases the father was only 1 year old. The older male sired the offspring in the three remaining cases. The difference between younger and older males’ reproductive success is not significant (χ21 = 1.6, NS). The degree of genetic relatedness between the males and the mother clearly differed in only three cases of paternity (4/F1, 5b/F2 and 6/F1; Table 2). In two of these cases the actual father was less closely related to the mother than his competitor. In the third case (5b/F2), the father had an intermediate position between the other two males.

FIGURE 1: Mating success of dominant and subdominant males in ive groups and six oestrous periods, where dominance could be determined. he inner box shows the median, the outer box the 75 and 25% quartiles and the vertical lines the minimum and maximum values. N = 6 dominant and 6 subdominant males. *P100 Ka Israeli site of that were drenched in symbol. Skhu- l (47). This adds a potential hint of complexity to the picture, although biogeographers have generally considered the Levant an extension of the African continent (48). Still, in the record as currently known, the first fully mature expressions of the human capacity do not appear until ca. 35 Ka (49–51) in Europe, when an extraordinary artistic flowering testifies to lives that were drenched in symbol. However, there is no reason to expect that all of the dimensions of the new human symbolic capacity should have been exploited at once, and it is at the very least plausible that what we are witnessing in the African Middle Stone Age are the first stirrings of a long process of cognitive discovery that is still continuing today. It is worth noting that shortly after Blombos times southern Africa experienced an episode of aridification that may have largely or entirely depopulated the area for an extended period (43), implying that early symbolic expression in this region may not have been linearly ancestral to later such expressions elsewhere. Nonetheless, whatever the details of the evidently complex acquisition of symbolic cognition in our species might have been, it seems clear that the Africa provided the stage on which this radically new mode of processing information initially evolved.

CONCLUSIONS Evidently, then, ‘‘becoming human’’ took place in two separate stages. First, the distinctive modern human morphology became established, ver y clearly in Africa, and probably shortly after 200 Ka. This event involved a radical departure from the primitive Homo body form. Only ca. 100 Ka later, again in Africa, and in a Middle Stone Age industrial context, did modern symbolic behaviors begin to be expressed, underwritten by a new capacity that had most plausibly been present but unexploited in the first anatomical H. sapiens. In evolutionary terms this disconnect was entirely routine, for every new behavior has to be permitted by a structure that already exists: Birds, for example, had feathers for millions of years before coopting them for flight, and tetrapods acquired their limbs in an aquatic context (52).

192 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Symbolic reasoning appears to be qualitatively different from all other forms of cognition, including its own immediate precursor. Its neural substrate continues to be strenuously debated (53, 54); but, whatever it was, that structural innovation was most plausibly acquired as part and parcel of the radical biological reorganization that gave birth to H. sapiens as an anatomically distinctive entity. In which case (like those feathers and limbs) it remained unexploited, at least in the cognitive context, for a very substantial length of time, until its new use was ‘‘discovered’’ by its possessor. How this discovery was made remains a matter for conjecture, but a leading candidate for the necessarily cultural stimulus to symbolic processing of information is the invention of language (55). Language is perhaps the ultimate symbolic activity; and, in contrast to theory of mind, the other leading candidate for the role of releaser (56), it has the advantage of being a communal rather than an internalized attribute. The ability to use language depended, of course, on the presence of the vocal structures required to produce speech; but clearly these had already been exaptively acquired by the earliest anatomical H. sapiens. Current evidence thus indicates that H. sapiens as we know it today had a dual origin: first as an anatomical entity, and only subsequently as a cognitive one. The clear signal of both the fossil and archaeological records is that both innovations occurred in Africa, from which the first fully modern humans expanded relatively recently to populate the rest of the world. ACKNOWLEDGMENTS. I thank R.G.K. for his initiative in organizing this significant PNAS Special Feature on a critical aspect of human evolution and for inviting me to contribute to it. Gibbons A (2006) The First Human: The Race to Discover Our Earliest Ancestors (Doubleday, New York). Tattersall I (2003) Out of Africa again . . . and again? Sci Am 13:38–45. Wood BA, Collard M (1999) The human genus. Science 284:65–71. Schwartz JH, Tattersall I (2005) The Human Fossil Record, Vol 4: Craniodental Morphology of Early Hominids (Genera Australopithecus, Paranthropus, Orrorin), and Overview (Wiley-Liss, New York). 5. de Lumley H, et al. (2002) Datation par la méthode 40Ar/39Ar de la couche de cendres volcaniques (couche VI) de Dmanissi (Géorgie) qui a livré des restes d’hominidés fossils de 1.81 Ma. C R Palevol 1:181–189. 6. Swisher CC, III, et al. (1994) Age of the earliest known hominids in Java, Indonesia. Science 263:1118–1121. 7. Clark JD, et al. (1984) Palaeoanthropological discoveries in the Middle Awash Valley, Ethiopia. Nature 307:423–428. 8. Holloway RL (2000) Brain. In Encyclopedia of Human Evolution and Prehistory, eds Delson E, Tattersall I, Van Couvering J, Brooks A (Garland, New York), 2nd Ed. 9. Schwartz JH, Tattersall I (2005) The Human Fossil Record, Vol. 1: Terminology and Craniodental Morphology of Genus Homo (Europe) (Wiley-Liss, New York). 10. Lieberman DE, McBratney BM, Krovitz G (2002) Sphenoid shortening and the evolution of modern human cranial shape. Proc Natl Acad Sci USA 99:1134–1139. 11. Stringer CB, Hublin JJ, Vandermeersch B (1984) In The Origin of Modern Humans: A World Survey of the Fossil Evidence, eds Spencer F, Smith F (Alan R. Liss, New York), pp 51–135. 12. Schwartz JH, Tattersall I (2000) The human chin revisited: What is it and who has it? J Hum Evol 38:367–409. 13. Sawyer GJ, Maley B (2005) Neanderthal reconstructed. Anat Rec 283B:23–31.

1. 2. 3. 4.

READING: HUMAN ORIGINS: OUT OF AFRICA | 193

14. Rak Y (1990) On the differences between two pelvises of Mousterian context from Qafzeh and Kebara Caves, Israel. Am J Phys Anthropol 81:323–332. 15. Schmid P (1983) Eine Rekonstruktion des Skelettes von A.L. 288–1 (Hadar) und deren Konsequenzen. Folia Primatol 40:283–306. 16. Kibii JM, Clark RJ (2003) A reconstruction of the StW 431 Australopithecus pelvis based on newly discovered fragments. South African J Sci 99:225–226. 17. Walker A, Leakey REF (eds) (1993) The Nariokotome Homo erectus Skeleton. (Harvard University Press, Cambridge MA). 18. Arsuaga JL, et al. (1999) A complete human pelvis from the Middle Pleistocene of Spain. Nature 399:255–258. 19. Simpson SW, et al. (2008) A female Homo erectus pelvis from Gona, Ethiopia. Science 322:1089–1092. 20. Rose MD (1984) A hominine hip bone, KNM-ER 3228, from East Lake Turkana. Am J Phys Anthropol 63:371–378. 21. Rosenberg KR, Zune L, Ruff CB (2006) Body size, body proportions, and encephalization in a Middle Pleistocene archaic human from northern China. Proc Natl Acad Sci USA 103:3552–3556. 22. Hauser MD, Chomsky M, Fitch WT (2002) The faculty of language: What is it, who has it, and how did it evolve? Science 298:1569–1579. 23. McDougall I, Brown FH, Fleagle JG (2005) Stratigraphic placement and age of modern humans from Kibish, Ethiopia. Nature 433:733–736. 24. White TD, et al. (2003) Pleistocene Homo sapiens from Middle Awash, Ethiopia. Nature 423:742–747. 25. Bräuer G (1984) In The Origins of Modern Humans: A World Survey of the Fossil Evidence, eds Smith F, Spencer F (Alan R. Liss, New York), pp 327–410. 26. Stringer CB, Andrews P (1988) Genetic and fossil evidence for the origin of modern humans. Science 239:1263–1268. 27. Wolpoff MH, Wu X, Thorne AG (1984) In The Origins of Modern Humans: A World Survey of the Fossil Evidence, eds Smith F, Spencer F (Alan R. Liss, New York), pp 411–483. 28. Cann RL, Stoneking M, Wilson AC (1987) Mitochondrial DNA and human evolution. Nature 325:31–36. 29. Stoneking M, Sherry ST, Redd AJ, Vigilant L (1993) New approaches to dating suggest a recent age for the human mtDNA ancestor. Phil Trans R Soc Lond Ser B 337:167–175. 30. Nei M, Roychoudhury AK (1974) Genic variation within and between the three major races of man, Caucasoids, Negroids and Mongoloids. Am J Hum Genet 26:421–443. 31. Tattersall I, Schwartz JH (2008) The morphological distinctiveness of Homo sapiens and its recognition in the fossil record: Clarifying the problem. Evol Anthropol 17:49–54. 32. Schwartz JH, Tattersall I (2005) The Human Fossil Record, Vol. 1: Craniodental Morphology of Genus Homo (Africa and Asia) (Wiley-Liss, New York). 33. Valladas H, et al. (1988) Thermoluminescence dating of Mousterian ‘‘Proto-Cro-Magnon’’ remains from Israel and the origin of modern man. Nature 331:614–616. 34. Fagundes JRF, et al. (2007) Statistical evaluation of alternative models of human evolution. Proc Natl Acad Sci USA 104:17614–17619. 35. Vandermeersch B (1981) Les Hommes Fossiles de Qafzeh (Israe¨ l) (CNRS, Paris). 36. Tattersall I (2004) What happened in the origin of human consciousness? Anat Rec (New Anat) 267B:19–26. 37. McBrearty S, Brooks AS (2000) The revolution that wasn’t: A new interpretation of the origin of modern human behavior. J Hum Evol 39:453–563.

194 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

38. Ambrose SH (2001) Paleolithic technology and human evolution. Science 291:1748–1753. 39. Klein RG (1999) The Human Career (University of Chicago Press, Chicago), 2nd Ed. 40. Clark JD, et al. (2003) Stratigraphic, chronological and behavioural contexts of Pleistocene Homo sapiens from Middle Awash, Ethiopia. Nature 423:747–752. 41. Marean CW, et al. (2008) Early human use of marine resources and pigment in South Africa in the Middle Pleistocene. Nature 449:905–909. 42. Stringer CB, et al. (2008) Neanderthal exploitation of marine mammals in Gibraltar. Proc Natl Acad Sci USA 105:14319–14324. 43. Deacon H, Deacon J (1999) Human Beginnings in South Africa: Uncovering the Secrets of the Stone Age (David Philip, Cape Town). 44. Henshilwood C, et al. (2003) Emergence of modern human behavior: Middle Stone Age engravings from South Africa. Science 295:1278–1280. 45. Henshilwood C, d’Errico F, Vanhaeren M, van Niekerk K, Jacobs Z (2004) Middle Stone Age shell beads from South Africa. Science 304:404. 46. Bouzouggar A, et al. (2007) 82,000-year-old shell beads from North Africa and implications for the origins of modern human behavior. Proc Natl Acad Sci USA 104:1964–1969. 47. Vanhaeren M, et al. (2006) Middle Paleolithic shell beads in Israel and Algeria. Science 312:1785–1788. 48. Tchernov E (1998) In Neandertals and Modern Humans in Western Asia, eds Akazawa T, Aoki K, Bar-Yosef Y (Plenum, New York), pp 77–90. 49. Clottes J (2008) Cave Art (Phaidon, New York). 50. Conard NJ (2009) A female figurine from the basal Aurignacian of Hohle Fels Cave in southwestern Germany. Nature 459:248–252. 51. Conard NJ, Malina M, Münzel SWC (2009) New flutes document the earliest musical tradition in southwestern Germany. Nature 460:737–740. 52. Shubin N (2008) Your Inner Fish (Pantheon, New York). 53. Lieberman P (2007) The evolution of human speech: Its anatomical and neural bases. Curr Anthropol 48:39–66. 54. Coolidge FL, Wynn T (2005) Working memory, its executive functions, and the emergence of modern thinking. Cambr Archaeol J 15:5–26. 55. Tattersall I (2008) An evolutionary framework for the acquisition of symbolic cognition by Homo sapiens. Comp Cogn Behav Revs 3:99–114. 56. Dunbar R (1996) Grooming, Gossip and the Origin of Language (Faber and Faber, London).

MODERN HUMAN VARIATION Section 4

CHAPTER 8

MODERN HUMAN VARIATION

I N TR T R O D U C TI TION This last chapter will address how humans are classified, how modern human variation is a result of natural selection, and how our lifestyle interacts with our evolutionary adaptations.

L E A R N I N G O BJEC LEAR BJ EC TTII VES VE S 1. 2. 3. 4.

Understand how anthropologists study human variation. Be able to link modern human variation to evolutionary adaptations. Understand how our present lifestyle affects our health as a result of past adaptations. Understand the human life phases and how they are defined biologically and culturally.

197

198 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

HUMAN VARIATION

I

n earlier chapters, we learned that because humans evolved relatively recently, humans do not have much genetic diversity. Yet, when measuring the exact combination of alleles, humans are all genetically different from one another. The only exception to this rule is monozygotic twins, who are essentially naturally occurring clones. Nonetheless, with all the variation we still see that closely related individuals look alike because they share genes. And, groups of people who share ancestry also share physical traits; many traits that make up our appearance are determined mainly by genes. One of the jobs of anthropologists has been to categorize the genetic diversity in humans. This human taxonomy has multiple purposes, such as identifying victims of crime in forensic cases, understanding medical differences between groups, and being able to trace our migration patterns. Although understanding human diversity is of great importance, most anthropologists do not agree on the best way to classify peoples; in other words, the concept of race or ethnicity is highly debated in the anthropological community. For example, we cannot even agree upon the names of groups, or the traits to use, for grouping peoples. In North America, categories may include black, white, Asian, Hispanic or Latino, and Native American, but anthropologists sometimes use the terms of Negroid, Caucasoid, Caucasian, and Mongoloid. What these exact groupings are can be hard to define, but they are usually based on physical types and often these groups reflect socially recognized groupings rather than purely scientific groupings. Human variation is intricate and it does not always follow the basic races. Yet, the surprising thing is that most people can accurately classify people and agree on the classifications; this is even more surprising when you take into consideration that forensic anthropologists usually reach the same conclusions from just a skeleton as the geneticists who use DNA, and the lay people who use only their vision to make an assessment. This most likely occurs because we do not just take one trait into account to determine racial categories. For example, skin color may be a significant trait that is cited to group people, and dark skin is often believed an important trait to classify Africans from Europeans and Asians. But dark skin is also found in other parts of the world, such as Australia

SKIN color distribution

MODERN HUMAN VARIATION | 199

and West Asia, and yet most people have no problem distinguishing Africans from other dark-skinned populations. The article “Understanding Race and Human Variations: Why Forensic Anthropologists are Good at Identifying Race” (2009), by Ousley and colleagues [Reading 10], discusses why forensic anthropologists are good at determining race from only a skull. To sort people in a way that fits biological reality, anthropologists have tried several models of classification. Three basic ways will be discussed here, but there are a number of other classification models. In the nineteenth century and the early twentieth century, anthropologists used typological models, which included the classic race categories mentioned above. The traits that were utilized to place people into groups were phenotypic; however, many individuals could fit into a variety of categories and some people did not fit into any categories. Overall, the groups had much overlap and the specific traits utilized varied from anthropologist to anthropologist. In general, anthropologists tried to utilize traits that were reflections of natural selection and ethnicity, but convergence of traits made this difficult. The second classification method, the population model, was used in the 1940s. This model is based on mating patterns, since reproduction is the key to evolution. First, anthropologists tried to group individuals by who mated with whom (or breeding isolates), and then considered the other traits that may distinguish them. Theoretically, this model may be logically sound, but the model fails to work because humans often mate outside their population. Very few isolated mating populations exist and, thus, this model did not help in understanding human diversity. After World War II and the end of colonialism and the Holocaust, anthropologists began to look at populations as continuums rather than separate groups. Thus, in the 1950s, the clinal model of understanding human variation became popular. The clinal model viewed each trait as being on a continuous gradation moving from one geographic area to the next. Most inherited traits have clinal distributions since the variation is based on selective pressures. All of the models both fail and succeed. The typological is successfully used by forensic anthropologists, medical doctors, and in human population studies. As seen in the article by Ousley and colleagues, included in this textbook, the population model is probably the most scientifically sound model, but it fails because we do not limit our breeding to isolated populations. The clinal model best describes the real nature of human variation. Regardless of how one classifies humans, evolutionary studies have shown that we all share a close common ancestor around 200 KYA and that means there is very little genetic diversity between us. All humans around the world are about 99.9% genetically similar by counts of overall DNA similarity. Compared with other animals, we have lower rates of genetic diversity. There are two to three times more variation among chimpanzees and eight to ten times more genetic variation among orangutans. To put this in perspective, however, let us not forget that mice and humans share about 90% of DNA and there is only 1.6% difference between chimpanzee and human DNA. Only a tiny amount of DNA variation creates lots of differences; this is because there are 3,000,000,000 base pairs and, thus, a 0.1% difference means that 3,000,000 base pairs vary! Additionally, some genes code for many traits; these are pleiotropic genes (remember back to the genetics chapter).

200 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

HUMAN ADAPTATION The reason for our variation is that we have been adapting and are continuing to adapt just as other organisms. The article “Change We Can Believe In: ‘Race’ and Continuing Selection in the Human Genome” (2009), by Krause [Reading 11], examines how we are still changing, and some of these changes are very controversial. Anthropologists view human adaptation as a result of evolution as they would view any other animal or plant adaptations. Some of the driving factors of evolution we have examined include genetic drift, gene flow, adaptation to environmental conditions, and cultural factors. Adaptations can be a combination of all these factors. As a rule, all organisms have to maintain normal functions of organs to survive in an ever-changing environment. Therefore, all organisms are made to adapt to changes and to accommodate daily and yearly changes. Physiological responses to environmental changes are influenced by genes. Different populations vary in gene frequencies that allow them better survival in different environments. Longterm genetic changes that occur from one generation to the next to aid in surviving FIGURE 8.1: Sickle cells in an environment are called adaptations; however, short-term changes within an individual’s life is called acclimatization and it varies depending on exposure to environmental stress, individual differences, and underlying genetic factors. Let us look at some examples of how humans adapt and acclimatize. Culture is a human strategy of adaptation. For humans, culture is an important aspect to understanding evolutionary processes. Two good examples of human adaptation and culture include sickle cell allele selection and lactose tolerance selection. Sickle cell is a Mendelian trait; one gene codes for whether red blood cells are sickled or normal. It is also a recessive trait, so it takes two recessive alleles for an individual to have all their red blood cells sickle-shaped; if an individual has both recessive alleles for sickling, then the individual has sickle cell anemia. Anemia, which is iron deficiency, will result in numerous health problems, and frequently lead to an early death. But if an individual is

MODERN HUMAN VARIATION | 201

heterozygous for the sickle cell allele, then only some of their red blood cells are sickled. Sickle cell anemia is pervasive throughout tropical Africa, and in the 1950s geneticist Anthony Allison suspected that the sickle cell mutation provided protection against malaria. Malaria, which is transmitted from the blood of one individual to another via mosquito bites, is the greatest killer in the tropical world. Parasites that cause malaria cannot survive in blood that is sickled; thus, sickle cells protect against an even deadlier agent. The fittest individual in an environment in which malaria exists would have only some sickled cells, which means that person would have one gene that codes for normal cells and one that codes for sickling. In such an environment, the fittest individuals would most likely reproduce because they would not get malaria and not die due to full sickle cell anemia and, thus, the trait is passed on. To further understand the malaria and sickle cell trait interaction, we must also add the importance of agriculture as a factor in driving malaria. Prior to the invention of agriculture, mosquitoes that carried the malaria parasite did not coexist with humans; mosquitoes tend to like open fields and stand- FIGURE 8.2: Massai woman ing water, humans were either in drier climates or forested environments. Mosquitoes were attacking grazing animals, lake animals, and other animals in their preferred environments. With the advent of agriculture, however, Africans changed their environment. This enabled mosquitoes to live side by side with them. Slash-and-burn agriculture created more open land, and irrigation created the standing water required for mosquitoes to thrive. With these changes, humans became targets of mosquitoes—and, eventually, the favored targets (perhaps due to their thinner skins), and this fueled the malaria problem in Africa and throughout the world. Not all cultural biological interactions are negative. Most adults are lactose-intolerant. We lose the ability to break down lactose because the lactase enzyme that breaks down lactose (the sugar in dairy) decreases as we get older. Nearly all babies are lactose-tolerant, but by the time people turn around twelve years of age they lose their ability to consume lots of lactose-rich foods and drinks. When you map out groups that can digest milk, you find they are also the populations that retain lactase. FIGURE 8.3: Inuit woman

202 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

LACTOSE intolerance distribution. Red is for intolerance; green is for tolerance.

Thus, lactose tolerance occurs when the gene for producing the lactase enzyme is present. Populations such as African herders, Northern Europeans, and some mountainous Asian populations kept dairy cattle for thousands of years and, as such, they retained the milk-drinking habit and have suffered no indigestion from it because their intestinal lactase enzyme remains high throughout life. Natural selection favored mutations that resulted in the retention of the lactase enzyme because these people existed in places where there are not a lot of other dietary resources, and so to be able to consume milk gave individuals an advantage. Females were probably able to put on enough fat to ovulate. When those who consumed dairy got sick from other sources, they were more likely to survive due to their extra weight. And drinking milk even protected against dehydration. The lactose-tolerant people survived, reproduced, and passed on their tolerance. The lactase gene in these people and this trait are passed on as a hereditary dominant from parents to offspring. If either parent is lactose-tolerant, the child will be as well. Interestingly, there have been about a half-dozen mutations that allow for lactose consumption and they were selected for independently; it appears the ability to digest lactose has been advantageous in many groups and, thus, whenever the mutation arises, it has been selected for. Other populations, however, have dealt with dairy consumption by fermenting the dairy into yogurt and cheese, which breaks down the lactose prior to consumption. There are many other examples of human adaptations, but perhaps the most often discussed adaptation is skin color. For many years, light skin color has been portrayed as an evolutionary adaptation to cloudy climates, but in the article “The evolution of light skin color: Role of vitamin D disputed” (2009) [Reading 12], Robins challenges this perspective; her article is a cautionary tale for all anthropologists. Heat and cold adaptations reveal that all people are more adapted to heat than cold. Cold adaptations are stuck on top of heat adaptations; since evolution is conservative, it does not get rid of things that are still working fine. Cultural patterns and technology have helped us adjust to climate, but there are biological ways we to prevent hypothermia (freezing) and hyperthermia (overheating). Long-term population adaptations include body-size variation, with larger people being in colder climates since

MODERN HUMAN VARIATION | 203

this conserves heat (also known as Bergman’s rule), and body proportion differences that include shorter distal elements in cold climes to conserve heat and prevent frostbite (also known as Allen’s rule). Acclimatization to temperature shows our heat-adapted origins. We are much better at acclimatizing to heat; we do it quicker and more efficiently than acclimatizing to cold. Actually, populations that dwell in extreme cold places have far more cultural adaptations related to their environmental stressors than populations living in hot climates.

Acclimatize

COLD CLIMATE RESPONSES

HOT CLIMATE RESPONSES

Shivering

Sweating

Increased metabolic rate (rate at which calories are burned to create energy and, consequently, heat) Decreased metabolic rate Vasoconstriction (constricts blood flow to extremities; conserves heat Vasodilation (blood vessels open and allow but increases frostbite risk) blood flow to extremities and radiate heat) Adaptation

Fat insulation of vital organs

Ability to sweat

Change in blood-flow patterns Culture

Food type Housing Clothing

Shivering is one way we stay warm when it is cold, but this wastes energy and is very ineffective. We also experience vasoconstriction in the cold, but as this keeps our core body temperature higher it also prevents blood from flowing to our fingers and toes, resulting in an increased risk of frostbites. For heat, we sweat to cool down, which is very effective in hot and dry climates where the sweat evaporates and cools us down. Within a few days of being in a hot environment, we sweat less and our sweat is less salty (which conserves our electrolytes and prevents dehydration). Vasodilation, which has no negative side effects, also helps us radiate heat and cool down. Finally, our metabolism increases in cold, which can be detrimental if food sources are scarce, whereas in the heat we need to eat less. Although we may not do very well with cold, high altitude is even more stressful. The stresses are due to the great range in temperature throughout the day and to the low air pressure that results in less oxygen with each breath. High-altitude populations have blood cells and capillaries that produce more oxygen. And they have greater lung capacities and a barrel-shaped chest. Nevertheless, their miscarriage rates are FIGURE 8.4: Andean man

204 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

high and they have many cultural traditions to cope with, such as moving down the mountain during pregnancy and gestation. Climate is not the only factor in human variation. HIV/AIDS is another example in which culture and disease interact in modern populations. Research begun in the 1990s has found that Europeans have a greater immunity to HIV than people in other regions of the world. Europeans and people of European ancestry more often live longer with HIV than other infected people; they are also less likely to develop AIDS. For example, some HIV-positive Europeans were found to live for ten to fifteen years without symptoms. Biologists have found a genetic mutation that confers resistance to HIV; the mutation is one at a protein receptor site that fails to recognize the virus. Homozygotes for the mutation are immune to HIV whereas heterozygotes have fewer symptoms and live longer. Research has found that about 10 percent of Europeans and European descendants have this resistance. They have linked the resistance to smallpox, a deadly viral disease that broke out during the eighteenth century. Smallpox killed about 10 to 15 percent of Europeans. The first vaccine was found in 1796, by Edward Jenner, and smallpox was eradicated by 1977 through vaccination; however, prior to medical intervention it appears a mutation occurred and individuals with the mutation survived smallpox and reproduced, passing on their mutation. This mutation is the same one that makes these offspring/ descendants resistant to HIV. Thus, sometimes a mutation may no longer be advantageous because the resistance it conferred is no longer a threat. But if it remains in the population it may confer resistance to a similar disease in the future.

HUMAN LIFE CYCLE We have many examples of our modern lifestyle altering our life cycle. We can consider the changes through time due to culture. Remember that while many of our traits are, in part, controlled by genetics, there is still much room for influence from culture. The nongenetic influences either hinder development or improve development through culture; however, most likely the optimum is set by genetics and culture may prevent environmental factors from reaching our genetic optimum. For example, how tall we become is probably due to genes, but often people do not reach their full potential due to childhood illnesses (such as parasite loads that decrease nutrition). Cultural adaptations, such as making sure water is clean of parasites, or increasing the length of breastfeeding to avoid children having to drink parasite-loaded water, can help individuals reach their genetic height potential. Growth and development are slightly different. Growth is an increase in the number of cells or in size, whereas development is a differentiation of cells into various types of cells. Cell growth is called hyperplasia and cell development is called hypertrophy, and most cells are continuously replaced. Growth and development in humans begins at conception and continues until the late teens or early twenties, and then we start to age. A well-nourished human grows quickly during the first six months in the womb; growth slows during the third trimester. After birth, the rate of growth increases and remains fast for the first four years. There is a short growth spurt in adolescence (at around twelve to fourteen years of age). Girls grow faster and have their spurt about two years earlier than boys, but girls end their growth earlier than boys. Good examples of the human growth pattern are the head and brain. At birth, the human brain is about 25 percent of its adult size; by six months the brain has doubled in size. By age ten, humans have 95 percent of their adult brain size. There is a very small

MODERN HUMAN VARIATION | 205

spurt in brain growth in adolescents. This pattern of brain growth is unusual for primates and other mammals, in which most of the brain is finished growing prior to birth. For humans, the narrow pelvis required in bipedal gait makes this difficult. Also, this way the brain can grow in a culturally stimulating environment. Nutrition influences human growth at every stage of life. During pregnancy, a woman’s diet can have a profound influence on the development of her infant and the eventual health of the child. The mother’s diet can even influence multiple generations; that is, it can be transgenerational because a woman’s own supply of eggs is developed while she herself is in utero. Nutrients needed for growth, development, and body maintenance include proteins, carbohydrates, fats, vitamins, and minerals. The specific amount has coevolved with the type of foods available to humans throughout our evolutionary history. Modern humans often do not get the right amount of nutrients for growth and development. For example, vegetarians often have deficiencies reflective of not getting essential amino acids, and most people consume too much domesticated meats with too much fat, which results in weight gain, diabetes, and other health issues. Our preagricultural diet was probably high in animal protein and complex carbohydrates and low in fats, salt, and sugar. Modern diet is nearly the complete opposite. This is, in part, due to the fact that throughout our evolutionary history, sugar, salt, and fat were greatly valued but very scarce. So, we have evolved a love for fat, sugar, and salt. Biological and behavioral characteristics evolved because in the past they were advantageous. Our ability to store fat was adaptive in the past when we would go through periods of scarcity. In the preagricultural past, humans, who are evolved to eat fruits, would face times of food shortages due to seasonal fluctuations. The stored fat would enable us to survive in times of scarcity and store fat in times of food abundance. In modern industrial periods, we usually have food available at all times and, thus, put on fat but never lose it. This shift has led to the global obesity problem and the health problems associated with obesity. Interestingly, orangutans face similar issues in captive environments, since they are also large frugivores with the ability to store fat for the lean times. Humans have very clearly demarcated phases in their lives FIGURE 8.5 Forceps that are partly a factor of growth and development and partly culturally constructed. Most animals do not have clearly demarcated phases in their lives, and often have far fewer phases in their lives than us. Primates usually have more life phases than non-primates. For example, monkeys and apes go through a prenatal phase, which ends at birth; an infancy phase, which ends at weaning (i.e., the cessation of breastfeeding); a juvenile phase, which ends at no longer being dependent; a subadult phase, which ends at first birth; and an adult phase. Humans also have these phases, but they are, for the most part, lengthened—and there is an extra phase at the end, the post-reproductive years that begin with menopause in women. Recently, it has been recognized that men also go into a post-reproductive age in which their fertility is greatly reduced, in part because their male hormones are greatly diminished.

206 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Biology and culture interact to determine who gets pregnant and when. Once pregnancy has occurred, there is a lot of variation in how a woman should behave, what she should eat, and where she can go. We put dietary restrictions on pregnant women, such as the avoidance of alcohol. Many cultural practices have a biological basis that aids in the birth of a healthy infant, and biological aversions to coffee and alcohol in pregnant women also work to prevent toxins getting into the baby’s system. Birth, which starts infancy, is an event celebrated with ritual in nearly every culture; this may be because the risk of death is high (or used to be high) in childbirth. One of the risk factors of birth is the large infant head compared to the narrow pelvis. The newborn must have a malleable head to squeeze through the birth canal. Fontanels, which are soft membranes and skin connecting the bones of the skull, allow the skull to be malleable. Later, fontanels give way to the growth of bone and the fusion at the sutures. An underdeveloped brain seems necessary for birth to occur through a narrow pelvis, but it may be advantageous for learning. Interestingly, in many cultures childbirth is relatively easy, but in Western societies the laying on the back position with legs up hinders an easy birth. This difficulty has led to the invention of forceps to assist the baby’s birth and epidurals to make pregnancy less painful. The squatting position is actually a better and less painful way to give birth and is utilized in many cultures. Infancy is the period during which breastfeeding (or nursing) takes place. Typically, in nonindustrialized cultures, this is 2.5 to three years. Primate milk, including our own, is low in fats and proteins; such a low nutrient content is typical for species in which mothers are seldom or never separated from their infants and nurse frequently. Frequent nursing suppresses ovulation and allows for birth intervals that are beneficiary for the infant. In modern populations, however, the excess nutrition and calories that mothers consume, along with possible fat storage, make ovulation suppression difficult. Breastfeeding seems to have other benefits, such as an increased connection with the mother and an increased emotional well-being in the child. And, the infant picks up all the same immunities that the mother has for the first six months of the infant’s life. Childhood (or the juvenile phase) is the time between weaning and puberty. During childhood the brain growth is completing and children are gaining both technical and social skills. For most other mammals, once weaning has occurred getting food is left to the individual, but humans take care of basics for children. There is a great deal of parental care in humans and this ensures greater offspring survival. Family roles increase in importance during childhood; however, it is still the mother who puts the most into childrearing. Even in the United States, women do about 80 percent of childrearing and this includes women who are working full time. Puberty is marked by biological events, such as changes in body shape and the development of sexual organs that signal the transition to adolescence for males and females. Hormonal changes are the driving forces of these changes, especially testosterone in boys and estrogen in girls. Menarche, the first menstruation, is a clear sign of puberty in girls and is ritually celebrated. Genes, nutrition, disease, and activity levels affect the age of the onset of puberty in humans. Females reach sexual maturity before males. The age at menarche has been decreasing recently; females are gaining significant weight early on and this triggers estrogen development that causes menarche to start early. On the other hand, extremely athletic females who have low body fat usually suppress estrogen accumulation and, thus, have late menarche.

MODERN HUMAN VARIATION | 207

Adolescence is the time between puberty and completion of physical growth. This recognition of adulthood is usually culturally based and can be in the form of marriage, bearing a child, or completing high school. Pregnancy and child care occupy much of a woman’s adult life in most cultures. For women, the years from menarche to menopause are marked by monthly menstruation, except when they are pregnant or nursing. A normal menstrual cycle has two phases and occurs about monthly. A woman who never becomes pregnant may have as many as four hundred cycles. During the course of human evolution, females may have had as few as sixty cycles because their many pregnancies and prolonged breastfeeding prevented menstruation. At the social level, adulthood for women in the majority of world cultures means caring for children and participating in economic activities. Adulthood for men typically includes activities related to subsistence, religion, politics, and family. Roles of women vary much more from culture to culture than the roles of men. During adulthood, the status of an individual may change as new skills are acquired or new achievements are reached. The post-reproductive years for women begin at menopause (which marks the end of fertility and menstruation). Estrogen and progesterone production begin to decline until ovulation ends. Menopause occurs between forty and fifty-five years of age, with women who have never had a child experiencing earlier menopause, but it is also mediated by genetic factors. Throughout much of human evolution, people did not live this long and so menopause was not a factor. Males do not have the same type of change, but during the same years testosterone is decreasing and fertility is greatly reduced by age fifty in males. One hypothesis for human longevity is that humans live long because it takes about fifteen years for a child to no longer need his or her mother and, thus, menopause ensures the mother will live until the offspring can survive on his or her own. This hypothesis would assume that the age of death for preindustrial or preagricultural populations was about sixty to sixty-five, which is quite reasonable. And studies in Africa have shown that grandmothers increase the survival of offspring. After menopause or the end of fertility, old age arrives. We often define people as old depending on their capabilities; if they are still active and mentally competent, then they may seem young. Yet, old age is marked by several indicators, such as decreased learning capabilities, decreased memory, decreased ability to heal, and the loss of some normal functions, such as bladder control. By and large, people today are outliving people of the past, which is due more to medical advances that have increased our life span than due to healthier living. We have dealt fairly effectively with some of the biggest killers in prehistory, such as infectious diseases with antibiotics and dental diseases with dental care. Things that kill us now usually affect individuals who are in their post-reproductive years; for example, cancers that affect children are far rarer than cancers that affect the elderly. This is because there are no selection pressures to remove the cancers affecting older people, whereas anything that decreases a child’s likelihood of surviving will not be passed on to the next generation. Maximum life span potential is estimated to be about one hundred twenty years. Yet, lifestyle and geography may affect us greatly. For example, smoking, sedentary behavior, and poor diet can take years off our life span. One universal belief seems to be that women live longer than men, which is strange since the group that matures quicker is generally the one that dies earlier. Perhaps this is because females are less likely to engage in risky behavior or females are more likely to eat better and lead healthier lives than males.

208 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

SUM SU MMA M AR RY This chapter provided information on modern human variation in relation to human evolution. Natural selection clearly has played a part in many of our traits. And our modern lifestyle ways reflect the cravings we have due to scarcity in the past and, yet, we have changed our lifestyle so quickly that evolution has not had time to catch up. This has led to modern health problems, such as diabetes. Yet, medical advances have stopped some of the major killers of the past. Our life span has lengthened, allowing us to live past reproductive years and extend parental care into the next generation as grandparents.

MODERN HUMAN VARIATION | 209

G LLO O SSAR SSARY Acclimatization: Short-term biological responses to environmental stresses. Adaptations: Long-term genetic changes that help populations survive in a particular environment. Adolescence: The time between puberty and completion of physical growth. Adult phase: Usually lasts from first birth to end of fertile period; defined in numerous ways culturally. Allen’s rule: The rule that animals adapted to the cold have shorter distal elements than warm adapted animals. Bergman’s rule: A geographic rule that correlates latitude with body mass in animals. Clinal model: The model to understand variation of humans based on traits being distributed on continuums. Development: Differentiation of cells into different types of cells. Fontanels: Soft membranes and skin connecting the bones of the skull in infants. Growth: The increase in the number of cells or in size. Hyperthermia: Overheating, heat stress. Hypothermia: Freezing, cold stress. Hyperplasia: Cell growth. Hypertrophy: Cell development. Infancy phase: Starts at birth and ends at weaning. Juvenile phase: Starts at the end of weaning and ends at no longer being dependent, also known as childhood. Lactase: The enzyme that enables the digestion of lactose, which is the sugar found in dairy products. Menarche: The first menstruation. Menopause: The end of fertility and menstruation. Metabolic rate: Rate at which calories are burned to create energy and consequently heat. Population model: The model to classify people based on their mating patterns. Post-reproductive: Begins at menopause in women; period when one can no longer have offspring. Prenatal phase: Starts at conception and ends at birth. Transgenerational: Something that influences beyond one generation. Typological models: Models to classify people on the basis of appearance or phenotype that can be grouped. Vasoconstriction: Narrowing of blood vessels, conserves heat at body core. Vasodilation: Blood vessels open and allow blood flow to extremities and radiate heat. Weaning: The cessation of breastfeeding. Subadult phase: Usually ends at first birth; defined in numerous ways culturally.

SEC T I O N 4 R EAD I N G S

R EAD I N G 1 0 Ousley S, Jantz R, Freid D. 2009. Understanding Race and Human Variation: Why Forensic Anthropologists are Good at Identifying Race explains why anthropologists can use a skull to identify race, which is both a social construct and concords with biological reality according to the authors. This article is heavy in statistics and anatomy and, thus, may take you a while to read. However, the findings will surprise you and should help you understand how science tests hypotheses that are then translated into useful practices, such as forensic identification of crime victims. Utilize the glossary and information box to help you understand this article. Statistics: Most students hate statistics, but they are used in nearly all scientific fields and in many other fields of research. Here are some basic concepts utilized in this article: • DFA (Discriminant function analysis)-determines which variables allow one to separate two or more naturally occurring groups. • KNN (K-nearest neighbor)-allows researchers to classify a new individual case among known examples. • Cluster analyses–methods that allow researchers to group cases of similar kind into categories (that often produce tree or branching diagrams). • PCA (Principal Component Analysis)-allows for the reduction of variables into groups (components) that then can be used to determine relationships and classify variables. • Interobserver Error-mistakes in data collection between two or more researchers who are collecting the same data. • Intraobserver Error-mistakes in data collection within a single researcher; for example, if I collected a measurement multiple times and each time the measurement was a different number. • Multivariate methods-statistical analyses that use more than one variable to determine groupings, such as looking at 10 traits in one test rather than testing each trait separately (which would be univariate).

Understanding Race and Human Variation WHY FORENSIC ANTHROPOLOGISTS ARE GOOD AT IDENTIFYING RACE By Stephen Ousley, Richard Jantz, and Donna Freid

F

orensic anthropology is most often employed in the personal identification of human remains from crime scenes or mass disasters. Part of the identification process in identifying unknown remains is the construction of the biological profile, with parameters such as age, race, sex, and stature to compare to possible individual identifications. The continued use of race in forensic anthropology has been criticized because of the recent emphasis in biological anthropology to disprove the biological race concept of classic physical anthropology when discussing human variation. Indeed, many contemporary textbooks in forensic anthropology structure human variation in terms of three main races, stocks, or ancestral groups (Bass, 2005; Byers, 2005; Klepinger, 2006). Although a shift in terminology has been underway in forensic anthropology, with ‘‘ancestry’’ used more often in place of ‘‘race,’’ in many case reports the classic physical anthropology terms such as ‘‘Caucasoid,’’ ‘‘Mongoloid,’’ or ‘‘Negroid’’ are still seen. Unfortunately, the frequently ambiguous use of ‘‘race’’ in publications has led to many misunderstandings. This ambiguity is also reflected in the pages of the American Journal of Physical Anthropology in an article titled ‘‘Race’’ Specificity and the Femur/Stature Ratio (Feldesman and Fountain, 1996), in which race is referred to repeatedly in quotation marks, but never defined or explained. In this article, ‘‘race’’ will be used in its normal American sense, to refer to social race, and ‘‘biological race’’ will be used for the biological sense of the word. A reasonable but subjective definition of a biological race comes from Brues’ definition (1977, p 1), ‘‘a division of a species which differs from other divisions by the frequency with which certain hereditary traits appear among its members.’’, which parallels definitions from Boyd (1950) and Hooton (1926). Thus, biological races in humans as well as animals are supposed to share heritable traits that make them similar to each other and also make them distinct from other biological races. In zoology, one

Stephen Ousley, Richard Jantz & Donna Freid, “Understanding Race and Human Variation: Why Forensic Anthropologists are Good at Identifying Race,” American Journal of Physical Anthropology, 139(1), pp. 68-76. Copyright © 2009 by John Wiley & Sons, Inc.. Reprinted with permission.

211

212 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

statistical approach to discerning subspecies was the ‘‘75% rule’’ (Amadon, 1949) of separation as a criterion for taxonomists using morphological traits. Sauer (1992) recognized the theoretical tension between forensic and biological anthropology in his article with the subtitle ‘‘If races don’t exist, why are forensic anthropologists so good at identifying them?’’ While no accuracy figures were given, Sauer (1992) concluded that forensic anthropologists were good at identifying races because there is a concordance between American social races and skeletal biology, specifically, cranial morphology in black and white Americans. These two groups are the most likely to have historically required forensic identification in most areas of the US. Sauer (1992) maintained that in the US, people of African an- FIG. 1: Illustration of how views of human variation have changed, begincestry were likely to have a differ- ning with the classic typological view of physical anthropology. Lewontin’s view has dominated for more than 30 years, but the emerging view of ent morphology from those with human variation takes into account the covariation of variables. Note that European ancestry. However, the emerging view recognizes large amounts of within-group variation Sauer (1992) also concluded that compared to among-group variation, yet also allows separation among the ability of forensic anthropolo- groups. gists to classify individuals does not validate the classic biological races from physical anthropology in the broader sense, i.e., that humans form a small number of discrete entities that are inherently different from each other. Explicit tests of Sauer’s (1992) hypotheses have not been published until now, though Goodman (1997) challenged the view that forensic anthropologists can accurately identify race at all, citing four cases in which forensic anthropologists were incorrect in their assessment of race. Goodman (1997, p 22) concluded that ‘‘At best, in other words, racial identifications are depressingly inaccurate. At worst, they are completely haphazard’’. Four misjudgments, compared to what must be many thousands of cases in which forensic anthropologists have been correct, do not make a compelling argument. Additionally, Armelagos and Goodman (1998, p 370) maintained ‘‘The use of race in forensic research has probably led to countless misidentifications.’’ Many historical and theoretical reasons have been provided for why there should be no association between social and biological race in the US (Goodman and Armelagos, 1996; Williams et al., 2005). There is genetic evidence of up to ~20% European admixture in some African-Americans communities, which would make the two groups more similar (Parra et al., 1998). Some racial definitions in the US have depended on the One-Drop Rule, whereby ‘‘one drop’’ of African ancestry would qualify a person as black. In fact, there does not appear to be a consistent legal definition of what ‘‘race’’ means (Wright, 1995). Race definitions have changed over time, and in fact at one time the Irish were not considered part of the white race for immigration purposes. Finally, human variation is supposed to show a clinal pattern with no distinct boundaries, and Livingstone’s (1962, p 279) quote is often cited: ‘‘There are no

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 213

races, there are only clines.’’ Many have also repeated the claim that the traits that supposedly define biological races are inherited independently and do not form distinctive trait clusters by which one could objectively define biological races. These findings have changed how physical anthropology is taught and has resulted in the frequently heard mantra ‘‘Race doesn’t exist’’ (Lieberman and Kirk, 2004). On the other hand, social race has greatly influenced mating in the US, reflecting positive assortative mating and limiting gene flow among groups. Up to 1970, the black-white interracial marriage rate for whites was ~0.1% and for blacks was 1%, based on US Census data (Fryer, 2007). The interracial marriage rate has increased since then but rates were still relatively low based on census data from 2000, with a rate of ~0.3% for whites and 4% for blacks. A historically low rate of interracial marriage in the US should come as no surprise when racism, especially institutional racism, has been prevalent. The first colonies to enact antimiscegenation laws were Maryland and Virginia, with official penalties for interracial marriage that included banishment and jail. In fact, laws against interracial marriage In a recent study of whites who in 16 states including Virginia were not repealed until after placed online dating ads, ~50% the 1967 Supreme Court decision in Loving v. Virginia (Fryer, said that race was not important, 2007). Unofficial social penalties for interracial relationships but 90% of those individuals and marriage included violence and murder. Marriage is a very public social declaration, so marriage rates from census data replied only to white respondents. will not reflect all interracial relationships, and personal ads may better represent human behavior in such relationships. In a recent study of whites who placed online dating ads, ~50% said that race was not important, but 90% of those individuals replied only to white respondents (Hitsch et al., 2004). In examining human genetic variation on a worldwide scale, Lewontin’s (1972) study of human variation using classic genetic markers has been cited as evidence that differences among human groups are too small to allow accurate classification. Lewontin estimated that ~85% of human genetic variation is found within populations, ~8% is found within populations of the same race or regional grouping, and only 6% is found among races or regions. Lewontin analyzed each of the genetic markers independently and overlooked the fact that some markers are significantly correlated with others and therefore not independently distributed among groups. Edwards (2003) confirmed that Lewontin’s findings are correct at the single-locus level, meaning that single loci will show great overlap among groups, but analyzing multiple loci will produce less overlap among groups and reveal a more realistic picture of among-group variation. Additionally, Lewontin’s conclusions seem more likely to be anomalous after the publication of numerous molecular analyses utilizing combinations of SNPs, STRPs, VNTRs, Alu insertions, and other molecular features that indicate strong geographic patterning in worldwide samples and accurate classification of groups (Pritchard et al., 2000; Rosenberg et al., 2002; Bamshad et al., 2003; Allocco et al., 2007) despite large amounts of within-region variation (Jorde and Wooding, 2004). The evolution of how scientists have viewed human variation is shown in Figure 1. The emerging view shown in Figure 1 also illustrates how accurate classification is possible despite large amounts of withingroup variation. In examining human craniometric variation on a worldwide scale, studies of the Howells craniometric data have produced consistent results. Relethford (1994, 2002) found worldwide levels of craniometric variation in the Howells data on a par with Lewontin’s estimates. In contrast to Lewontin,

214 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Howells (1973, 1989) and Roseman and Weaver (2004) found strong geographic patterning in the same data, and this patterning is present at an early age (Vidarsdottir et al., 2002). Other studies have used discriminant function analysis (DFA) to classify one individual at a time from known samples into Howells’ groups, and their results seem to seem in agreement with those of Lewontin (1972). Ubelaker et al. (2002) classified 50 individuals from a likely 16th or 17th Spanish cemetery, and while most classified into the geographically closest groups, from Austria, Egypt, Hungary, and Norway, a good number classified into the Howells groups from Asia. Ubelaker et al. (2002), echoing Ousley and Jantz (1996), concluded that DFA should be used with caution when classifying populations that are not represented in the reference populations. Williams et al. (2005) classified 42 Nubians into the Howells groups with the expectation that all Nubians would classify into Howells’ Egyptian group because the Egyptians are the closest group TABLE 1: Howells male groups used in worldwide comparisons temporally and geographically. and their geographic region However, some of their Nubians GROUP NAME N ABBREVIATION CONTINENT/REGION were classified into groups as far Ainu 48 AINM East Asia away as Japan, Australia, and the Andaman Islanders 35 ANDM East Asia New World. The main conclusion Anyang 42 ANYM East Asia of Williams et al. (2005) was that Arikara 42 ARIM America classification methods cannot Atayal 29 ATAM East Asia work because human variation Australian 52 AUSM SW Pacific is very limited and craniometric Berg 56 BERM Europe affinities of groups do not reflect Buriat 55 BURM East Asia geography: ‘‘The possibility that Bushman 41 BUSM Africa skeletal material could be sorted Dogon 47 DOGM Africa by geographic origin, at any other Easter Islanders 49 EASM Polynesia level than geographic extremes, is Egypt 58 EGYM Africa quite small’’ (Williams et al., 2005, Eskimo 53 ESKM America p 345). Guam 30 GUAM SW Pacific Several problems are apparent Hainan 45 HAIM East Asia in the approach, results, and conMokapu 51 MOKM Polynesia clusions of Williams et al. (2005). Moriori 57 MORM Polynesia Ten Nubians in their sample Norse 55 NJAM Europe showed typicality probabilities North Japan 55 NORM East Asia that were too low (P < 0.05) to Peru 55 PERM America be assigned with confidence. In Philippines 50 PHIM East Asia fact, eight of the ten, or 19% of Santa Cruz 51 SANM America the total sample, showed a typicalSouth Japan 50 SJAM East Asia ity probability for the group they Tasmanians 45 TASM SW Pacific classified into of 0.005 or less, Teita 33 TEIM Africa as seen in their Table 1. When Tolai 56 TOLM SW Pacific individuals show such low typicalZalavar 53 ZALM Europe ity probabilities, they are outliers, Zulu 55 ZULM Africa and measurement or data entry N, number in each sample. error should be checked for first

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 215

(Maindonald and Braun, 2003; Hair et al., 2006; Tabachnick and Fidell, 2007). As has been pointed out, DFA will classify any and all measurements and individuals, whether or not the measurements are correct, even if the measurements come from another species or a soccer ball (Freid et al., 2005; Ousley et al., 2007). Also, there must be something wrong with their measurements because the 12 measurements they specified include two measurements that Howells never collected: palate length and minimum frontal breadth. If they mistakenly entered palate length as palate breadth, or minimum frontal breadth as frontomalar breadth, that would explain the low typicality probabilities. Otherwise, Williams et al. (2005) performed their analyses using only 10 variables. However, there is no way of identifying which measurements they used or how they used them, because the authors have refused repeated requests for their Nubian data or Fordisc results from several researchers. Despite some disagreements in interpretation, assessing human variation using craniometrics and multivariate methods is the best way to test Sauer’s (1992) conclusions for several reasons. First, craniometrics reflect aspects of cranial morphology suggested by Sauer (1992) and can be easily analyzed using several multivariate statistical methods that allow more powerful tests of variation. Using multiple measurements provides a better overall morphological assessment of variation, and avoids problems with using only a few measurements. Second, multivariate classifications of craniometrics within traditional races have found significant variability, such as in American whites (Ousley and Jantz, 2002), African groups (Spradley, 2006; Spradley et al., 2008b), Hispanic groups (Ross et al., 2004; Slice and Ross, 2004; Ross et al., 2005; Spradley et al., 2008a), Native Americans (Ousley and Billeck, 2001; Ousley et al., 2005), and East Asian groups (Ousley et al., 2003). Third, while craniometrics show an association with environmental factors such as mean temperature (Beals et al., 1984), they and other measurements have been shown to reflect genetic relationships in animals with known pedigrees, including humans (Cheverud, 1988; Konigsberg and Ousley, 1995), and thus qualify as heritable traits in identifying biological races following Brues’ (1977) definition. Finally, craniometric data sets with numerous measurements and large sample sizes are available from modern Americans as well as populations from around the world. This article will scientifically evaluate the conclusions of Sauer (1992) using modern, historic, and prehistoric craniometric data. It will also explore the apparently contradictory results from examining group affinities and individual classifications.

MATERIALS AND METHODS Craniometric data from 353 individuals in the FDB were used to compare variation in white and black Americans. All were born in the 20th century and are of self-identified race and sex. Craniometric data collected by W.W. Howells were used in comparing groups from around the world, and measurement abbreviations follow Howells (1973). The Howells database consists of 2,504 individuals from 28 groups of males and 26 groups of females from around the world and from various time periods (Howells, 1996). The names of the groups, abbreviations, and region are listed in Table 1. Because multiple variables provide a better assessment of overall morphological variation, several multivariate statistical methods were used, each with different advantages and assumptions. Discriminant function analysis (DFA) maximizes the differences among groups, so it provides a best case classification method if withingroup variation is similar, but exaggerates underlying

216 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

differences among groups. K-nearest neighbor (KNN) analysis relies on interindividual similarities rather than group similarities, but still relies on within-group variation in the original groups. Both of these classification methods record classification error rates for each group. The error rate is important because a classification procedure is best judged by how well it classifies known reference groups. Correct classification rates that are little better than random mean that there is no appreciable intergroup variation in the variables used. Accordingly, classification rates at a far greater rate than expected based on random allocation will be considered as support for the hypothesis that differences exist among groups. Cluster analysis is a more conservative test for group differences because individuals are naively classified into a specified number of natural groupings, and only natural group parameters are used. Additionally, principal components analysis (PCA) was employed in various analyses. The first principal component contains the greatest amount of variation present in all original measurements, and subsequent principal components represent progressively smaller amounts of variation. Often, the bulk of variation in a large number of measurements is expressed in far fewer principal components (Tabachnick and Fidell, 2007). DFA uses multivariate methods developed over 70 years ago (Fisher, 1936; Mahalanobis, 1936) to classify individuals into the group they are most similar to using group means and the pooled within-group variance-covariance matrix (Huberty, 1994; Huberty and Olejnik, 2006; Tabachnick and Fidell, 2007). Additionally, an individual’s posterior and typicality probabilities are calculated. Stepwise variable selection is a technique to identify the measurements that separate groups best. Fordisc 3.0 (Jantz and Ousley, 2005) and Systat (Systat Software Inc., 2004) were used to perform DFA and stepwise variable selection. We report classification percentages using the most often recommended way of estimating classification error rates, leave-one-out cross-validation. In this method, each individual is sequentially removed from the DFA, a function based on the rest of the sample is calculated, and the classification of the individual is recorded. The estimated error rate using leave-one-out cross-validation is not biased upwards and will better reflect error rates when applied to new cases (Huberty, 1994). KNN analysis using a custom computer program and SAS (SAS Institute, 2001) was also used for classification. Unlike DFA, group membership and group means are not incorporated into the procedure. Instead, individuals are classified based on their similarity to other individuals. Multivariate distances are calculated to individuals, rather than to groups, and the most similar K individuals form the basis for classification (SAS Institute, 2001). KNN analysis using craniometrics is the basis for CRANID (Wright, 1992) and has been used to classify individuals, including an Egyptian mummy (Hughes et al., 2005). In these analyses, group assignment was based on K = 1, the single nearest neighbor. K-means cluster analysis was also used to classify individuals using Systat. In contrast to the other procedures, it finds a specified number (K) of natural groups of individuals in a sample. At the beginning of the process, all members are placed in one group and the means for each variable are calculated. The member of the group that is most different from the grand mean is chosen as the seed for a second group. New means are calculated for each group, and each individual is then assessed as to which cluster it is most similar to, and the individual closest to a different cluster is then transferred to that cluster. Cluster means are recalculated whenever membership changes, and the process is repeated numerous times. In the process, cluster members may later be rejoined to their former cluster. At the end of the process, there are K clusters with minimized within-cluster

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 217

variation and maximized among-cluster variation (Systat Software Inc., 2004; Tabachnick and Fidell, 2007).

RESULTS American Whites and Blacks DFA using just two variables, basion-nasion length (BNL) and basion-prosthion length (BPL), separates American blacks and whites about 80% correctly, and using more variables improves classification accuracy (Jantz and Ousley, 2005). A discriminant function using 19 measurements magnifies the differences and can classify the same samples into social race 97% correctly. Using stepwise variable selection, only seven variables (BNL, BPL, biauricular breadth (AUB), nasal breadth (NLB), palate breadth (MAB), orbital height (OBH), in order of selection) are necessary to classify blacks and whites 95% correctly, and these variables are ones that can be visually appreciated by forensic anthropologists. BNL and BPL express relative prognathism, BBH is an expression of vault height, AUB is a measure of vault breadth, NLB of nasal breadth, MAB of palate breadth, and OBH, orbital height, representing orbital shape. Nearly all of these measurements represent morphological configurations mentioned in forensic anthropology texts as valuable in determining race visually: prognathism, the cranial index, nasal breadth, and orbit shape. Because DFA magnifies differences among groups, quantifying group differences using PCA will produce a better baseline measure of differences. When PCA was run on 19 basic measurements from the total sample of 375 black and white males, the first principal component, which comprises the greatest interindividual variation, separated TABLE 2: Results of K-means cluster analysis performed black and white males 81% correctly. Further, on 375 American black and white males from the FDB in a K-means cluster analysis using the same using a two-cluster solution 19 basic variables, 92% of cluster one memCLUSTER 1 CLUSTER 2 bers were white males, and 80% of cluster BM 17 132 89% in 2 two members were black males; 89% of black WM 194 32 86% in 1 males were placed into cluster two and 86% 211 (92% WM) 164 (80% BM) of white males were placed into cluster one Between Cluster SS 21,824 (Table 2). Between-cluster variation was 11% = = 11%. Total SS 191,079 of the total variation. These results indicate that there are significant differences between the two groups before being magnified by DFA, and support Sauer’s (1992) assertion that there are morphological differences between American blacks and whites that can be visually appreciated. In other words, for these groups, there is a strong concordance between social race and biological differences.

Worldwide craniometric variation and classification The other conclusions of Sauer (1992) and Williams et al. (2005) were tested by investigating patterns of worldwide craniometric classification. First, the effect of the number of variables on classification accuracy in the Howells groups was investigated (see Fig. 2), with higher classification accuracy resulting from a greater number of variables used. When using at least two variables, the mean classification accuracy in groups was greater than random (3.6%) at P < 0.01, and using more

218 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

variables narrowed the variation in mean classification percentage by improving the lowest correct percentages. When the Howells groups were classified with the same 10 variables used by Williams et al. (2005) in a 28 group function, the 10 variables classified individuals 50% correctly on average, and 70% were assigned into a group from the same continent or region (Table 3). Using 10 stepwise-selected variables produced somewhat higher accuracies, with the lowest group accuracy at 13%, FIG. 2: Number of variables in DFA and classification accuracy for but the greatest performance was seen in 27 Howells male groups. he mean percentage correct for two or using 24 stepwiseselected variables, with more variables is significantly greater than chance at P < 0.01. almost 75% of the individuals correctly classified into their own group and almost TABLE 3: Correct classification percentages of 27 Howells 90% classified into a group from the same male groups using different combinations of variables region. Further, using 14 basic measureN VARS % GROUP CORRECT % REGION CORRECT ments in a KNN analysis classified indi70 10 50 viduals into their own group 31% correctly 75 10 SW 56 on average, far higher rate than expected by 83 15 SW 64 chance, and into the correct continent or 89 24 SW 74 region 56% correctly. Thus, individuals in The first entry for 10 variables includes the 10 variables used by the Howells data are more similar to other Williams et al. (2005). SW, stepwise-selected measurements. individuals from the same group than they are to individuals from other groups. The similarities and differences among groups are apparent whether looking at interindividual similarities (KNN analysis), or intergroup differences magnified by DFA, and there is clear regional patterning to their similarities. Occasionally some individuals were classified into groups from different continents in these analyses, but the number of those individuals so classified decreased as more variables were used. Using the 24 variable set, the only groups that were classified outside of their own continent involved the Egyptian and European samples. Five of 58 Egyptians (9%) classified into the Norse sample and 3 (7%) were classified into the Zalavar sample; 5 of 55 (9%) of the Norse sample were classified into Egypt and of 4 of 53 (8%) of the Zalavar sample were classified into Egypt. Egypt lies in the northeast corner of Africa, and these Egyptian-European results are in agreement with the consensus view that the Sahara Desert has been a more significant barrier to human groups than the Mediterranean Sea. As a follow-up to the clear craniometric separation of American blacks and whites, a six-way DFA was performed on six of Howells’ European and sub-Saharan African samples (Berg, Norse, Zalavar, Dogon, Teita, and Zulu). The function classified 82% of them correctly into their own group and 98% of them into a group from the same continent. When the groups were pooled into Europeans and Africans in a two-way function, similar to what Howells (1970) performed, 99% were correctly classified, and K-means cluster analysis revealed continental differences, with one cluster having 81%

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 219

of the Africans and the other cluster having 91% of the Europeans. The groups from Europe and Africa would thus appear to meet Brues’ (1977) definitions of a biological race in that they can be separated from each other very effectively using craniometrics. However, within-continent analyses complicate the craniometric differences between continents. In Europe, DFA applied to Howells’ Berg and Norse groups classified them about as well (83% correct) as DFA applied to American blacks and whites, and using the best variables improved the correct classification rate to 93%. Moreover, K-means cluster analysis separated 81% of the Berg and Norse samples into two different clusters. Also, a European three-way function for Berg, Norse, and Zalavar classified the groups 73% correctly, and the best variables classified them 85% correctly. Therefore, the three European samples would appear to meet Brues’ (1977) definition of different biological races as well. In Japan, DFA using 18 variables classified Howells’ Northern and Southern Japan samples 89% correctly, and K-means cluster analysis allocated 81% of each Japanese group into separate clusters. Therefore, the Northern and Southern Japan samples would also represent different biological races. It would seem that the number of biological races may be limited only by the number of samples, contradicting the classic view that there are only a few discrete biological races.

DISCUSSION Our analyses of craniometric variation in black and white Americans using several multivariate statistical methods support Sauer’s (1992) conclusion that objective morphological differences exist between American whites and blacks. We have demonstrated a concordance between social race and cranial morphology, at least in 20th century American blacks and whites. Other skeletal studies have reached similar conclusions (Edgar, 2002; Konigsberg and Jantz, 2002; Ousley and McKeown, 2003). Craniometric differences Craniometric diferences between between American blacks and whites have not diminished since American blacks and whites have the 19th century, though both groups have changed since then (Wescott and Jantz, 2005). The probable reasons for biological not diminished since the 19th differences should be familiar to many. American blacks and century, though both groups have whites originated from different continents, and American changed since then. blacks are largely composed of West African groups transported to the US for the slave trade. Europeans and Africans had been separated and experiencing different evolutionary forces for tens of thousands of years before migrating to the US. The high accuracy of the two-way DFA between the pooled Howells European and subSaharan African groups indicates they likely had differentiated. As mentioned, institutional racism and assortative mating within social race has prevented significant gene flow between them, which would make them more similar. Part of the reason for the disagreement between forensic and biological anthropologists has been in their different approaches and goals. Forensic anthropologists answer practical questions of age, sex, and race to construct the biological profile and narrow down possible identifications. In examining American blacks and whites, forensic anthropologists would naturally think in terms of two biological races because of the concordance between social and morphological race. Identifying social race, available in missing persons reports, would be the stopping point. Biological anthropologists would explore within-group variation further. These findings illustrate the essential difference

220 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

between a forensic analysis and a biological analysis: forensic analysis produces practical information useful for forensic identification, while a biological analysis provides insight about relationships among arbitrarily defined populations, which may be defined by social races, breeding populations, language, nationality, time periods, and other criteria. Sauer’s (1992) additional suggestion that differences in American blacks and whites did not validate the traditional biological race concept is likewise supported by our results. On a worldwide scale, humans show geographically patterned variation when classified as groups and individuals, and although there is a good deal of overlap between groups and much variation within groups, individuals and groups can nonetheless be classified at a rate far greater than chance on the group and regional level. The classifications of the Howells data echo Howells’ (1973, 1989) results that show rather strong geographic patterning, and there is clearly enough craniometric variation among groups to classify at rates far higher than random allocation. These findings directly contradict the conclusions of Williams et al. (2005) because individual crania are far more often than not classified into the group they are part of, or into a group from the same region. The classification rates are not 100% because of overlap among groups, consistent with other studies (Howells, 1970, 1989, 1995; Relethford, 1994, 2002; Roseman, 2004; Roseman and Weaver, 2004), and contradicting the biological race concept of classic physical anthropology. In the Ubelaker et al. (2002) study, most individuals classified into the geographically closest Howells groups, from Egypt or Europe. As Ousley and Jantz (1996) point out, when classifying individuals that are not represented in the reference populations, caution is warranted. DFA will indicate the group that an individual is closest to morphologically, and should not be interpreted as a literal and binding classification. Also, individuals from countries like Spain that represented a world empire may well be morphologically heterogeneous, as Ubelaker et al. (2002) had noticed before their metric analysis. The Iberian Union (1580–1640) of the kingdoms of Castile, Aragon, and Portugal included parts of the Mediterranean, the Americas, coastal areas of Africa, India, Indonesia, the Philippines, Japan, and Guam, and Iberia had been part of Arab and Moor empires that stretched across the Mediterranean for hundreds of years. The morphological diversity of the Ubelaker et al. (2002) Spanish individuals may well reflect their heterogeneous origins, as is reflected in molecular studies (Casas et al., 2006; Alvarez et al., 2007). However, the Spanish centroid—the mean Spanish morphology—likely shows greatest similarity to the Howells European and Egyptian centroids. In our classifications of the Howells data, some individuals were classified into groups from different continents, but those classifications largely disappeared when more variables were used. If Williams et al. (2005) used the correct measurements, they analyzed the Nubians in a 28-way function using 10 variables and maintained that a classification rate of less than 100% into Howells’ Egyptians was evidence of failure. Thus, their null hypothesis was that of an extreme typologist: that all groups are expected to be unique with no overlap among groups. By the middle of the 20th century, many physical anthropologists had already acknowledged overlap among groups, though some still argued that a relatively small number of human races existed (e.g. Coon, 1965). More recent statistical comparisons among Howells’ groups as well as modern forensic groups show considerable overlap and less than perfect classification, even when using more variables (Howells, 1995; Ousley and Jantz, 1997). In this case, a correct classification rate of 3.6% (1/28) would be expected by chance. As a matter of fact, even with strong indications of measurement error, the most common classification, eight of 32, or 25% of their Nubian sample, was into Howells’ Egyptian group. It is also important to

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 221

note that Williams et al. (2005) formed their conclusions about group similarities based on compiling individual classifications. Comparing group centroids is the best way to compare group relationships. Based on the individual results of Williams et al., their Nubian sample centroid is most likely closest to Egypt. Other results indicate that the conclusions of Williams et al. (2005) are erroneous. Freid and Jantz (2005) analyzed Nubian craniometric data (93 females, 144 males) from the fortress at Mirgissa that had been collected during the UNESCO sponsored excavations (Vercoutter, 1976). When each individual was classified into the Howells groups using 17 variables in a 28-way function, 142 out of 237 (60%) were closest to Howells’ Egyptian sample, and 183 out of 237 (77%) were closest to one of Howells’ African groups. These results are consistent with what Williams et al. (2005) maintained was to be expected, because the Egyptian group is the closest geographically. Geography is often a proxy for population history, because groups that are closer to each other have more likely exchanged more genes directly or through other nearby groups simply because of proximity. Therefore, migration, gene drift, and gene flow likely influence modern human craniometric variation more than selection alone because through them, morphological changes can occur at a far greater rate. Why was biological race considered an explanation for human differences, and why does it remain so for some? The socially inherited concept of race no doubt shapes interpretations, but so do interpretations of any inherent differences among human groups. Examining variation in different combinations of groups reveals a confirmation bias for the variable that is used to define groups, most often biological race. Craniometric comparisons of various groups from Ousley and Jantz (2002) are shown in Table 4 and the first few examples may seem to support traditional racial divisions of mankind. In the first comparison, biological race seems to be the reason that white and black males are different, because we assume that race is the controlling variable, the primary difference between them. When Chinese and Native American groups are added, results are still consistent with the traditional race concept. But in the third example, if Japanese are substituted for Chinese, the accuracy decreases because black and Japanese males tend to misclassify as each other. Further classifications in Table 4 among groups traditionally considered part of the same biological race were also highly accurate. A three-way DFA using Japanese, Chinese, and Vietnamese males classifies them quite well, but the differences among them are in language and nationality. Females

TABLE 4: Classifications using DFA with various groups GROUPS IN DF

VARIABLES

% CORRECT

WHY?

BM vs. WM

19

97

Biological race

BM vs. WM vs. CHM vs. NAM

25

96

Biological race

BM vs. WM vs. JM vs. NAM

25

84

Biological race

JM vs. CHM vs. VM

25

80

Geography

7

87

Tribe

Nagasaki vs. Tohoku Males

Arikara vs. Sioux Females

25

94

Geography

N Japan vs. S Japan Males

18

89

Geography

WM born 1840–1890 vs. WM born 1930–1980

10

96

Time

BM, American black males; CHM, Chinese males; JM, Japanese males; NAM, Native American males; VM, Vietnamese males; WM, American white males.

222 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

from two Native American tribes, Arikara and Sioux, can be classified quite accurately, and tribe or language defines each sample. Within Japan, DFA can differentiate between modern Japanese from the north (Tohoku) and south (Nagasaki) even better, and in this case the groups are defined by geography. These differences parallel those between the Howells North and South Japanese males. Finally, white males born between 1840 and 1890 can be separated from white males born 1930 to 1980 very well, and they are distinguished by time, and would appear to qualify as different races. In all of these analyses, the groups were categorized by a variable and differences were found. While race has been traditionally used to explain why the groups are different, time as an explanation may be more difficult to grasp. But time per se is not the reason the two groups are different. Time in this example is correlated with vast improvements in nutrition, medical care, and hygiene in the US, which have produced secular changes in the later population. Relaxed selection and gene flow from new immigrants may have also contributed to the changes. The northern-southern dichotomy seen in modern Japanese represents considerable variation within Japan in other biological systems as well. These examples demonstrate that though the group qualifiers change, the qualification is not directly related to why the groups are different. In the first two examples, race does not directly explain differences, just as language per se does not, nor does region, nor geography, nor distance, nor tribe, nor time. Instead, all of these comparisons involve differently defined populations with different origins or histories. Each of the defining variables is arbitrary but is related to differences in origins, histories, environments, and reproductive barriers. Groups separated through social mechanisms, language, geography, or time can differentiate due to genetic drift and other evolutionary forces, and those qualifiers were likely factors restricting gene flow among the groups.

CONCLUSIONS The Howells craniometric data provide a rich data set for testing hypotheses about human variation. Another significant advantage to the Howells data is the large number of variables collected. As we demonstrated, the number of variables analyzed affects classification accuracy. There is an obvious parallel in examining one genetic system such as ABO blood group and drawing conclusions based on that single system. Lewontin’s (1972) conclusions were likewise based on univariate frequencies from a few genetic systems. However, as we and others have shown, many measures of human variation are correlated, requiring multivariate methods. The Howells data also has no interobserver errors, which likely explain the anomalous results of Williams et al. (2005). In investigating the connection between social race and biology, it is clear that race in the US is a social phenomenon with biological consequences due to positive assortative mating and institutional racism: whatever differences there were between ancestral groups from Europe and Africa were not obliterated because of very low historic gene flow between them in the US, despite theoretical and historical reasons why social races may not reflect biology. In this regard, race (i.e., the history of American race relations) helps explain modern craniometric variation in American blacks and whites. Worldwide craniometric variation shows strong geographic patterning. However, if biological distinctiveness is an accepted criterion for biological races, a very large number of biological races can be discerned using craniometric data alone. Given this fact and the many populations with unique histories, it makes sense to collect data from as many populations as possible to aid in accurate classification, as Howells (1995) and Ubelaker et al. (2002) concluded. With other biological systems

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 223

and traits, the distribution and number of biological races will change. There are so many possible distinctive biological races that the concept is virtually meaningless. We can only concur with Howells’ (1995, p 103) modification of Livingstone’s 1962 quote: ‘‘There are no races, only populations.’’

ACKNOWLEDGMENTS The authors thank Alain Fremont for access to Vercoutter’s Nubian craniometric data from Mirgissa. Hajime Ishida provided craniometric data from modern Japanese. At Mercyhurst College, E. Susanne Daly helped with historical research and Alexandra Klales assisted designing several figures. The authors express their thanks to symposium organizers, Heather Edgar and Keith Hunley, who provided much encouragement. They also thank the anonymous reviewers and the AJPA editors for their feedback.

LITERATURE CITED Allocco DJ, Song Q, Gibbons GH, Ramoni MF, Kohane IS. 2007. Geography and genography: prediction of continental origin using randomly selected single nucleotide polymorphisms. BMC Genomics 8:68. Alvarez JC, Johnson DL, Lorente JA, Martinez-Espin E, Martinez-Gonzalez LJ, Allard M, Wilson MR, Budowle B. 2007. Characterization of human control region sequences for Spanish individuals in a forensic mtDNA data set. Leg Med 9:293–304. Amadon D. 1949. The seventy-five per cent rule for subspecies. Condor 51:250–258. Armelagos G, Goodman AH. 1998. Race racism, and anthropology. In: Goodman AF, Leatherman TL, editors. Building a new biocultural synthesis: political-economic perspectives on human biology. Ann Arbor: University of Michigan Press. p 359–378. Bamshad MJ, Wooding S, Watkins WS, Ostler CT, Batzer MA, Jorde LB. 2003. Human population genetic structure and inference of group membership. Am J Hum Genet 72:578–589. Bass WM. 2005. Human osteology, 5th ed. Columbia, MO: Missouri Archaeological Society. Beals KL, Smith CL, Dodd SM. 1984. Brain size, cranial morphology, climate and time machines. Curr Anthropol 25:301–330. Boyd WC. 1950. Genetics and the races of man. Boston: Little, Brown and Company. Brues A. 1977. People and races. New York: Macmillan. Byers SN. 2005. Introduction to forensic anthropology, 2nd ed. New York: Pearson. Casas MJ, Hagelberg E, Fregel R, Larruga JM, Gonzalez AM. 2006. Human mitochondrial DNA diversity in an archaeological site in al-Andalus: genetic impact of migrations from North Africa in medieval Spain. Am J Phys Anthropol 131: 539–551. Cheverud JM. 1988. A comparison of genetic and phenotypic correlations. Evolution 42:958–968. Coon CS. The living races of man. New York: Alfred A. Knopf. Edgar HJH. 2002. Biological distance and the African American dentition. Ph.D. dissertation. Ohio: Ohio State University. Edwards AWF. 2003. Human genetic diversity: Lewontin’s fallacy. Bioassays 25:798–801.

224 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Feldesman MR, Fountain RL. 1996. ‘‘Race’’ specificity and the femur/stature ratio. Am J Phys Anthropol 100:207–224. Fisher RA. 1936. The use of multiple measurements in taxonomic problems. Ann Eugenics 7:179–184. Freid D, Jantz RL. 2005. Classification and evaluation of unusual individuals using Fordisc. Proc Am Acad Forensic Sci 11:293–294. Freid D, Spradley MK, Jantz RL, Ousley SD. 2005. The truth is out there: how not to use Fordisc. Am J Phys Anthropol Suppl 40:103. Fryer RG Jr. 2007. Guess who’s been coming to dinner? Trends in interracial marriage over the 20th century. J Econ Perspect 21:71–90. Goodman AH. 1997. Bred in the bone? Sciences 37:20–25. Goodman AH, Armelagos GJ. 1996. The resurrection of race: the concept of race in physical anthropology in the 1990s. In: Reynolds LT, Lieberman L, editors. Race and other misadventures: essays in honor of Ashley Montagu in his ninetieth year. Dix Hills, New York: General Hall. p 174–186. Hair JF, Black WC, Babin BJ, Anderson RE, Tatham RL. 2006. Multivariate data analysis, 6th ed. Upper Saddle River, NJ: Pearson. Hitsch G, Hortacsu A, Ariely D. 2004. What makes you click? An empirical analysis of online dating. UCSC Economics Department Seminars Paper 3. Available at: http://repositories. cdlib.org/ucsc econ seminar/ winter2005/3. Hooton EA. 1926. Methods of racial analysis. Science 63:75–81. Howells WW. 1970. Multivariate analysis for the identification of race from crania. In: Stewart TD, editor. Personal identification in mass disasters. Washington, DC: National Museum of Natural History, Smithsonian Institution. p 111–121. Howells WW. 1973. Cranial variation in man. Papers of the Peabody Museum of Archaeology and Ethnology, Vol. 67. Cambridge, MA: Harvard University. p 1–259. Howells WW. 1989. Skull shapes and the map. Craniometric analyses in the dispersion of modern Homo. Papers of the Peabody Museum of Archaeology and Ethnology, Vol. 79. Cambridge, MA: Harvard University. p 1–189. Howells WW. 1995. Who’s who in skulls. Ethnic identification of crania from measurements. Papers of the Peabody Museum of Archaeology and Ethnology, Vol. 82. Cambridge, MA: Harvard University. p 1–108. Howells WW. 1996. Howells’ craniometric data on the Internet. Am J Phys Anthropol 101:441–442. Huberty CJ. 1994. Applied discriminant analysis. New York: Wiley. Huberty CJ, Olejnik S. 2006. Applied MANOVA and discriminant analysis. New York: Wiley. Hughes S, Wright R, Barry M. 2005. Virtual reconstruction and morphological analysis of the cranium of an ancient Egyptian mummy. Australas Phys Eng Sci Med 28:122–127. Jantz RL, Ousley SD. 2005. Fordisc 3: computerized forensic discriminant functions. Version 3.0. Knoxville: The University of Tennessee. Jorde LB, Wooding SP. 2004. Genetic variation, classification, and ‘race’. Nat Genet Suppl 36:S28–S33. Klepinger LL. 2006. Fundamentals of forensic anthropology. New York: Wiley. Konigsberg LW, Jantz RL. 2002. Mixture analysis as an alternative to ‘‘determination of ancestry’’. Am J Phys Anthropol Suppl 34:96. Konigsberg LW, Ousley SD. 1995. Multivariate quantitative genetics of anthropometric traits from the Boas data. Hum Biol 67:481–498. Lewontin RC. 1972. The apportionment of human diversity. Evol Biol 6:381–398.

READING: UNDERSTANDING RACE AND HUMAN VARIATION | 225

Lieberman L, Kirk RC. 2004. What should we teach about the concept of race? Anthropol Educ Q 35:137–145. Livingstone F. 1962. On the non-existence of human races. Curr Anthropol 3:279–281. Mahalanobis PC. 1936. On the generalized distance in statistics. Proc Natl Inst Sci India 2:49–55. Maindonald J, Braun WJ. 2003. Data analysis and graphics using R—an example-based approach. New York: Cambridge University Press. Ousley SD, Billeck WT. 2001. Assessing tribal identity in the Plains using nontraditional craniometrics (interlandmark distances). Am J Phys Anthropol Suppl 32:115–116. Ousley SD, Billeck WT, Hollinger RE. 2005. Federal repatriation legislation and the role of physical anthropology in repatriation. Yrbk Phys Anthropol 48:2–32. Ousley SD, Jantz RL. 1996. Fordisc 2.0: personal computer forensic discriminant functions. Knoxville: The University of Tennessee. Ousley SD, Jantz RL. 1997. The Forensic Data Bank: documenting skeletal trends in the United States. In: Reichs K, editor. Forensic osteology, 2nd ed. Springfield, IL: C.C. Thomas. p 297–315. Ousley SD, Jantz RL. 2002. Social races and human populations: why forensic anthropologists are good at identifying races. Am J Phys Anthropol Suppl 34:83–84. Ousley SD, Jantz RL, Freid D. 2007. Exploring human craniometric variation: statistical, mensural, biological, and historical considerations. Am J Phys Anthropol Suppl 44:182. Ousley SD, McKeown A. 2003. A comparison of morphometric data and methods in classification. Am J Phys Anthropol Suppl 36:162. Ousley SD, Seebauer JL, Jones EB. 2003. Forensic anthropology, repatriation, and the ‘‘Mongoloid’’ problem. Proc Am Acad Forensic Sci 9:245–246. Parra E, Marcini A, Akey J, Martinson J, Batzer MA, Cooper R, Forrester T, Allison DB, Deka R, Ferrell RE, Shriver MD. 1998. Estimating African-American admixture proportions by use of population-specific alleles. Am J Hum Genet 63:1839–1851. Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155:945–959. Relethford JH. 1994. Craniometric variation among modern human populations. Am J Phys Anthropol 95:53–62. Relethford JH. 2002. Apportionment of global human genetic diversity based on craniometrics and skin color. Am J Phys Anthropol 118:393–398. Roseman CC. 2004. Detecting interregionally diversifying natural selection on modern human cranial form by using matched molecular and morphometrics data. Proc Natl Acad Sci USA 101:12824–12829. Roseman CC, Weaver TD. 2004. Multivariate apportionment of global human craniometric diversity. Am J Phys Anthropol 125:257–263. Rosenberg NA, Pritchard JK, Weber JL, Cann HM, Kidd KK, Zhivotovsky LA, Feldman MW. 2002. The genetic structure of human populations. Science 298:2381–2385. Ross AH, Slice DE, Pachar DV. 2005. Forensic identifications and the complexity of determining biological affinities of ‘‘Hispanic’’ crania. Proc Am Acad Forensic Sci 11:292. Ross A, Slice DE, Ubelaker DH, Falsetti A. 2004. Population affinities of 19th century Cuban crania: implications for identification criteria in Cuban Americans in South Florida. J Forensic Sci 49:11–16. SAS Institute Inc. 2001. SAS/SHARE 9 user’s guide. Cary, NC: SAS Institute Inc.

226 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Sauer NJ. 1992. Forensic anthropology and the concept of race: if races don’t exist, why are forensic anthropologists so good at identifying them? Soc Sci Med 34:107–111. Slice DE, Ross AH. 2004. Population affinities of ‘‘Hispanic’’ crania: implications for forensic identification. Proc Am Acad Forensic Sci 10:280–281. Spradley MK. 2006. Biological anthropological aspects of the African diaspora; geographic origins, secular trends, and plastic versus genetic influences utilizing craniometric data. Ph.D. dissertation. Knoxville: The University of Tennessee. Spradley MK, Jantz RL, Robinson A, Peccerelli F. 2008a. Demographic change and forensic identification: problems in metric identification of Hispanic skeletons. J Forensic Sci 53: 21–28. Spradley MK, Ousley SD, Jantz RL. 2008b. Evaluating cranial morphometric relationships using discriminant function analysis. Am J Phys Anthropol Suppl 46:199. Systat Software Inc. 2004. Systat Version 11. Point Richmond, CA: Systat Software Inc. Tabachnick BG, Fidell LS. 2007. Using multivariate statistics, 5th ed. Boston: Allyn and Bacon. Ubelaker DH, Ross AH, Graver SM. 2002. Application of forensic discriminant functions to a Spanish cranial sample. Forensic Sci Commun 4:1–6. Available at:http://www.fbi.gov/hq/lab/fsc/backissu/july2002/ubelaker1.htm. Vercoutter J. 1976. Mirgissa III, Les necropoles. Paris: Guenther. Vidarsdottir US, O’Higgins P, Stringer CB. 2002. A geometric morphometric study of regional differences in the ontogeny of the modern human facial skeleton. J Anat 201:211–229. Wescott DJ, Jantz RL. 2005. Assessing craniofacial secular change in American Whites and Blacks using geometric morphometry. In: Slice D, editor. Modern morphometrics in physical anthropology. New York: Kluwer Academic. p 231–246. Williams FL, Belcher RL, Armelagos GJ. 2005. Forensic misclassification of ancient Nubian crania: implications for assumptions about human variation. Curr Anthropol 46:340–346. Wright L Jr. 1995. Who’s black, who’s white, and who cares: reconceptualizing the United States’s definition of race and racial classifications. Vanderbilt Law Rev 48:513–570. Wright R. 1992. Correlation between cranial form and geography in Homo sapiens: CRANID—a computer program for forensic and other applications. Archaeol Oceania 27:128–134.

SEC T I O N 4 R EAD I N G S

RE EAD AD I N G 1 1 CHANGE WE CAN BELIEVE IN: “RACE” AND CONTINUING SELECTION IN THE HUMAN GENOME emphasizes that we are still evolving and perhaps not in the same direction as different selection pressures are faced by different populations. Culture speeds up evolution; it does not slow it down.

This article mentions the International HapMap Project several times; here are some facts about the project that may help us understand its significance. • “A public resource intended to help researchers find genes associated with human disease and response to pharmaceuticals.” • The DNA comes 270 people from • Nigeria, • Japan, • China, • the U.S.A. • Haplotypes: • are produced by sexual reproduction and the history of a species. • are regions of chromosomes that have not been broken up by recombination, and they are separated by places where recombination has occurred. • enable geneticists to search for genes involved in diseases and other medically important traits. You can find more information from: http://hapmap.ncbi.nlm.nih. gov/

Change We Can Believe In “RACE” AND CONTINUING SELECTION IN THE HUMAN GENOME By Kenneth W. Krause

S

teven pinker might be right about what most people would prefer to believe. But equivalency, I would argue, is a concept better left to mathematicians—should they choose to keep using it. In any other, less antiseptic context, however, the notion is utterly bankrupt. That we have had to work so hard in recent centuries to construct and maintain political equality among individuals and classifications of individuals should tell us how persistent and pervasive inequality really is. We should never confuse the social construct with the scientific reality. Denial is the least mature and, certainly, the least progressive response to fear. Like all other species, human beings continue to change. But until very recently, both the popular and scientific Denial is the least mature assumptions had been that if humans were still evolving and, certainly, the least at all, it was through the very slow and completely ranprogressive response to fear. dom process of genetic drift. The alternatives, natural and sexual selection, of course turn on differential reproductive success based on fitness, attractiveness, or both. So the prevailing argument has long been that, because we civilized humans have for the most part managed to insulate ourselves from the natural environment, to nurse our sick back to health, and to provide mates for nearly all persons among us, the march of Darwinian selection had finally reached an impasse. Similarly, many have claimed that because selection had long ago relaxed its discriminating grip on the human genome, our collective abilities to think and to resist disease, for example, have steadily degenerated. But there have been exceptions—like University of California at San Diego biologist Christopher Wills, who in his 1998 book, Children of Prometheus, defiantly pronounced that “[t]he powerful effects of our culture have, if anything, accelerated our biological evolution.” Wills’ powerful and prescient hypothesis was that genes and an increasingly rich—or at least Kenneth W Krause, “Change We Can Believe In: “Race” and Continuing Selection in the Human Genome,” The Humanist, vol. 69, no. 1, pp. 20-22. Copyright © 2009 by American Humanist Association. Reprinted with permission. Provided by ProQuest LLC. All rights reserved.

229

230 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

complex—culture have combined to create a positive feedback loop in which human minds in particular benefit from frequent adaptive boosts. Sure enough, recent genome projects and surveys along with new and controversial genetic studies seem to bear Wills out. In 2005, for example, University of Chicago geneticist Bruce Lahn published a pair of studies concluding that two genes thought to regulate brain growth have continued to evolve under selective pressures until very recendy, if not to the present day (Science 309, 1717–1720 and Science 309, 1720–1722). An intellectual controversy erupted because Lahn, a Chinese-born lifetime member of the NAACP, also discovered that the mutated alleles were less common among sub-Saharan Africans than in other populations. Different mutations of the Microcephalin and ASPM genes were known to cause primary microcephaly, a condition marked by severely reduced brain size (typically 400 cubic centimeters in affected adults compared to 1200 to 1600 cubic centimeters in normal adults). It was also commonly understood that phylogenic analyses of both genes had revealed strong positive selection in the primate lineage leading to Homo sapiens. The question for Lahn, then, was whether certain variants of Microcephalin and ASPM had continued to evolve by natural selection during the last 200,000 years, since humans became anatomically modern. After sifting through a vast cache of DNA broadly representative of global diversity, Lahn’s team located an allele for each gene that occurred so frequently that it simply had to have been adaptive rather than merely the stray product of genetic drift or group migration. Then, using past mutation rates as a reliable molecular clock, they estimated the dates when these alleles originated. Lahn determined that the Microcephalin variant arose only about 37,000 years ago (with a 95 percent confidence interval of 14,000 to 60,000 years) and, much to everyone’s amazement, that the ASPM allele clocked in at about 5,800 years ago (with a 95 percent confidence interval of 500 to 14,100 years). Many, including Lahn’s team, noted that these dates generally corresponded to the explosion of symbolically driven behavior in Europe (the “Upper Paleolithic revolution”) on the one hand, and the development of cities and written language on the other. But these studies ignited a firestorm of debate over race and intelligence because they concluded as well that these apparently beneficial variants were common in Eurasia (75 percent of some populations), but quite rare in Africa (less than 10 percent among some groups). Several researchers formally challenged Lahn’s findings of selection generally or of selection for various brain-related abilities in particular (See, e.g., Currat, M„ et. al., Science 313, 172a [2006]; Timpson, N., et. al., Science 317, 1036a [2007]; and Rushton, J.P., et. al., Biol. Lett. 3, 157–160 [2007]). But Lahn defended his work and reemphasized that he had never claimed to have demonstrated a cognitive purpose for the alleles (Science 313, 172b [2006] and Science 317, 1036b [2007]). He even conceded the remote possibility that their roles might implicate functions completely unrelated to the brain. In any case, the new genes’ youth and worldwide prevalence clearly evidenced a “selective sweep”— the rapid spread of an advantageous new allele—very much reminiscent of the genetic adaptations that had allowed early Holocene European adults to digest milk lactose. LCT, the lactase gene, arose after people domesticated animals and began drinking their milk and has subsequently spread to more than 80 percent of Europeans. However in many Asian and African populations lacking a long history of dairy farming, lactose intolerance is common. But for any kind of selective sweep to occur, the advantage or selective force of the new allele must be dramatic. Could it be, as Wills suggested back

READING: CHANGE WE CAN BELIEVE IN | 231

in 1998, that our genes and cultural circumstances were and, in fact, are collaborating to accelerate human evolution? University of Utah anthropologists Henry Harpending and Gregory Cochran certainly count themselves among the growing number of scientists who think so. Many will recall their famous—in some circles infamous—2006 study on the natural history of Ashkenazi intelligence ( J. Biosoc. Sci. 38,659-693). There, they and collaborator Jason Hardy determined that the unusually high IQ scores of European Jews resulted from their forced and intense occupation of a particular professional niche between the ninth and seventeenth centuries that strongly selected for economic acumen. Unfortunately for the Ashkenazim, heritable diseases like Tay-Sachs and Gaucher’s accompanied these mutations. By the end of 2007, Cochran, Harpending, and University of Wisconsin-Madison biological anthropologist John Hawks had published their analysis of DNA in the International HapMap Project, a mammoth survey of genetic distinctions among populations around the globe. After scrutinizing 3.9 million single nucleotide polymorphisms (SNPs) from 270 people the team concluded that “[t] he rate of adaptive evolution in human populations has indeed accelerated” during recent millennia, especially since the Ice Age ending roughly 10,000 years ago (Proc. Natl. Acad. Sci., USA 104, 20753–20758). The agricultural revolution initiating the Holocene epoch allowed certain Eurasian populations to explode, says Hawks, and for increasingly complex human cultures to flourish. Lahn rejoined that scientists have become “almost like creationists” in their unwillingness to acknowledge that the brain is not exempt from selection pressures. As population densities increase, Hawks adds, so do the opportunities for genetic mutation— favorable or otherwise. Indeed, the team found that a minimum of 7 percent of the human genome appears to be evolving right now at the highest rate in our species’ history. But how can we know that some of these changes were adaptive? Geneticists look to haplotypes—large blocks of linked DNA passed on from one generation to the next—for helpful clues. An allele resulting from an important adaptive trait will expand to great frequency in a population so rapidly that it will often drag an extended haplotype with it before recombination and mutation can break it down. In other words, to population geneticists like Hawks, rare SNPs flanked by long stretches of identical DNA in many individuals among a given population suggests recent and robust selection for an especially advantageous trait. And such were precisely the attributes that Hawks’ researchers discovered in about 1,800 human genes. Although scientists don’t know the identity or function of most of these genes, many appear to be responses to recent changes in diet and to new waves of virulent diseases, including AIDS, malaria, and yellow fever. Again, the agricultural revolution was the likely catalyst and, again, some populations were more affected than others. As Hawks notes, “sub-Saharan Africa has no archeological evidence for agriculture before 4,000 years ago,” and “[a]s a consequence, some 2,500 years ago the population of sub-Saharan Africa was likely < 7 million people, compared Contrary to popular belief, Hawks to European, West Asian, East Asian, and South Asian populations approaching or in excess of 30 million each.” Contrary concludes, humans on diferent to popular belief, Hawks concludes, humans on different concontinents appear to be evolving tinents appear to be evolving away from each other and at quite away from each other and at quite an impressive clip. an impressive clip.

232 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Now, a group of French and Spanish geneticists, led by Lluis Quintana-Murci at the Pasteur Institute in Paris, France, has reinforced the Americans’ results by identifying 582 genes that have evolved differentially in various world populations during the past 60,000 years (Nature Genetics 40(3), 340–345 [2008]). Attempting to isolate disease-causing variations, Quintana-Murci examined the DNA of 210 persons from Phase II of the HapMap database, including 2.8 million SNPs from Europeans, Asians, and Africans. Like Hawks, he found compelling indicators of recent positive selection that varied strikingly between geographic populations. An ENPP1 mutation, for example, which is known to protect against obesity and type II diabetes, is present in about 90 percent of non-Africans but nearly absent in Africans. A CR1 gene, by contrast, which is known to thwart malarial attacks, is virtually absent in everyone except Africans, who carry it at a rate of about 85 percent. But Quintana-Murci isn’t interested in any potential political implications. Rather, he expects his results to “open multiple avenues of research” and to “facilitate genetic explorations of medical conditions by identifying strong candidate genes for diseases in which prevalence depends on ethnic background.” Even so, many scientists are still concerned about what some non-scientists will do with this information—and understandably so, given our history. On November 7, 2008, Constance Holden reported a meeting of about forty scientists and ethicists at the National Human Genome Research Institute in an article titled, “The Touchy Subject of ‘Race’ ” (Science 322, 839). Although much debate has already ensued over the medical use of racial distinctions in disease-related alleles, “it won’t be long,” Holden predicts, “before [scientists] have solid leads on much more controversial genes: genes that influence behavior—possibly including intelligence.” University of Georgia at Athens professor of speech communication, Celeste Condit, apparently criticized Lahn’s work at the meeting, charging that his studies could be seen as embedding a political message. I would insist that precision alone Lahn denied the accusation and, according to Holden, should drive our vocabulary, not rejoined that scientists have become ‘ “almost like crefear of historical baggage or the ationists’ in their unwillingness to acknowledge that the specters of inappropriate popular brain is not exempt from selection pressures.” One could argue, in fact, that because the brain is affected by so inferences and political agendas. many genes, it is uniquely situated to sustain adaptation. The panel wisely agreed that we need to police our language to some extent, by opting for terms like “geographic ancestry” in lieu of “race,” for example. I would insist that precision alone should drive our vocabulary, not fear of historical baggage or the specters of inappropriate popular inferences and political agendas. And although we surely must remain vigilant on behalf of universal political equality, neither social conservatives nor liberals can afford to keep ignoring the differences between populations at the molecular level. If indeed culture is accelerating human evolution by means of natural selection, perhaps technology and the economic forces of globalism will one day in the very distant future meld many populations into one. But, until then—for our own benefit—we should let the scientific chips fall where they may. In his timely and thoughtful new book, Strange Fruit: Why Both Sides Are Wrong in the Race Debate (Oneworld, 2008), British author Kenan Malik acknowledged that the very concept of “race” is both unscientific and irrational. But so is the current practice of antiracism, he adds, which, on the one hand, tends to impose otherwise alien cultures upon minority individuals and, on the other, seeks to deny them important

READING: CHANGE WE CAN BELIEVE IN | 233

biological facts that might one day benefit them and their descendants in very profound ways. “We need to challenge both [concepts],” Malik urges, “in the name of humanism and reason.” H Kenneth W. Krause is a contributing editor for the Humanist and books editor for Secular Nation. He has recently contributed to Skeptical Inquirer, Free Inquiry, Skeptic, Truth Seeker, Freethought Today, Wisconsin Lawyer, and Wisconsin Political Scientist. He may be contacted at krausekc@msn. com.

SEC T I O N 4 R EAD I N G S

R EAD I N G 1 2 Robins AH. 2009. The evolution of light skin color: Role of vitamin D disputed asks whether the selective pressures were strong enough to lead to skin color differences in humans. Although it is not debated that vitamin D is required for healthy bones and that sunlight provides the stimulant for vitamin D activation, this article clearly demonstrates that sometimes the most beautiful examples of evolution need to be reassessed.

he Evolution of Light Skin Color ROLE OF VITAMIN D DISPUTED By Ashley H. Robins

V

itamin D is essential for calcium and phosphorus homeostasis and for the growth, development, and structural integrity of the skeleton. Over 90% of the body’s requirements for vitamin D derive from cutaneous photosynthesis, with dietary sources accounting for the remainder. Ultraviolet-B radiation (UVB) penetrates the epidermis where it photolyses 7-dehydrocholesterol to previtamin D3, which is then converted to vitamin D3. The latter is translocated to the circulation via the dermal vasculature; it is hydroxylated (enzymatically) in the liver to 25-hydroxyvitamin D (25-OHD) and then in the kidneys to 1,25-dihydroxyvitamin D (1,25-(OH)2D) (Holick, 2007). Although the serum 25-OHD concentration gives the best index of an individual’s vitamin D status, 1,25-(OH)2D is the most active form biologically in mediating the effects on intestine (calcium absorption) and bone. The serum concentration of 1,25-(OH)2D is tightly regulated and is not ordinarily dependent on sun exposure or diet. Severe vitamin D deficiency causes nutritional rickets in children and adolescents, and osteomalacia and osteoporosis in adults. Rickets is caused by defective mineralization of the collagen matrix in newly formed osteoid tissue, with resultant bone softening. It is characterized by crippling deformities Rickets is a sunlight deprivation (notably bowing of the lower limb bones and narrowing disease, which emerged on an epiof the pelvic outlet), muscle weakness, and, in neonates demic scale during the industrial born to vitamin D-deficient mothers, by potentially fatal hypocalcaemia (manifesting as convulsions, heart revolution, when cities in Europe failure) (Wharton and Bishop, 2003; Holick, 2006b). and North America were envelRickets is a sunlight deprivation disease, which oped in a perpetual twilightlike emerged on an epidemic scale during the industrial haze of coal smoke. revolution, when cities in Europe and North America Ashley H. Robins, “The Evolution of Light Skin Color : Role of Vitamin D Disputed,” American Journal of Physical Anthropology, 139(4), pp. 447-450. Copyright © 2009 by John Wiley & Sons, Inc.. Reprinted with permission.

235

236 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

were enveloped in a perpetual twilightlike haze of coal smoke. By the end of the 19th century, up to 90% of children in these centers suffered from rickets.

SKIN DEPIGMENTATION: THE VITAMIN D HYPOTHESIS Originated by Murray (1934), the vitamin D hypothesis was revived and popularized by Loomis (1967), and, more recently, refined by Jablonski and Chaplin (2000) with the application of quantitative UVB data. It is based on the observation that the skin color of the world’s indigenous peoples follows a clinical distribution: the darkest populations inhabit the equatorial and tropical belt; the most pale-skinned the regions above 50°N; and those of intermediate pigmentation the middle latitudes. Skin reflectances exhibit a high-positive and high-negative correlation with latitude and UVB measurements, respectively (Jablonski and Chaplin, 2000; Parra, 2007), i.e., higher reflectances (lighter skin color) are strongly associated with higher latitudes and lower UVB. At high latitudes, UVB intensity is reduced throughout the year but profoundly so in the winter months. At this latitude, solar elevation is low and UVB has to travel a more oblique and longer course to the earth, thereby being subjected to increased scattering and ozone absorption in the upper atmosphere. Anatomically modern, and presumably deeply pigmented, humans (Homo sapiens) arose in subSaharan Africa 100,000–150,000 years ago. Some of them left the continent and advanced northward, arriving in Europe 35,000–40,000 years ago. The hypothesis proposes that as these northbound migrants proceeded to higher latitudes they underwent progressive depigmentation until they ultimately attained the light-colored appearance typical of contemporary northern Europeans. This pigmentary transformation was a physiological adaptation to the less intense UVB at these latitudes. The melanin of dark-skinned individuals would have impeded the epidermal transmission of an already attenuated UVB and inhibited the synthesis of previtamin D3 and vitamin D3. (Melanin is an excellent sunscreen.) The resultant vitamin D deficiency would have produced rickets, which, with its deformities and muscle weakness, would have seriously handicapped mobility and the ability to forage for food. In the female, a contacted pelvis would have led to obstructed labor and death of mother and baby (in the absence of Caesarean section); and even if the infant was successfully delivered, there was the danger of brain damage or life-threatening hypocalcaemia. There is little doubt that in the hostile environment of late-Pleistocene Europe rickets would have imperiled reproductive fitness and survival. Natural selection would have favored the genes for light skin color and promoted depigmentation. Conversely, in the topics (with their intense and perennial UVB), selection pressures would have driven the evolution of dark pigmentation owing to the remarkable photoprotective properties of melanin (Robins, 1991; Jablonski and Chaplin, 2000).

WHY THE VITAMIN D HYPOTHESIS IS FLAWED The hypothesis was initially predicated on data from the 1920s and 1930s, which showed that blacks in the United States had a twofold to threefold increase over whites in the prevalence of clinical rickets (Robins, 1991). Recent surveys also record substantially lower serum 25-OHD levels, and a markedly higher occurrence of vitamin D deficiency, in African Americans compared with white Americans (Looker et al., 2002; Nesby-O’Dell et al., 2002; Gordon et al., 2004). Exposure in vitro of isolated skin specimens and in vivo of human volunteers to UVB showed that hypopigmented (Caucasian) skin was five to 10 times more efficient at forming vitamin D3 than melanized (African

READING: THE EVOLUTION OF LIGHT SKIN COLOR | 237

American) skin (Chen et al., 2007). Moreover, the UVB doses that dramatically raised serum vitamin D levels in whites by up to 60-fold had no significant effect on heavily pigmented African Americans (Clemens et al., 1982). At these doses, therefore, deep melanin pigment reduced cutaneous synthesis of vitamin D3 by as much as 99%, the equivalent of a sunscreen with a sun protection factor of 15 (Holick, 2006a). The hypothesis is weakened, however, because this epidermal melanin barrier is not absolute; it is surmountable provided that the UVB doses or the irradiation exposure times are increased according to the degree of pigmentation. For example, a sixfold increase in either of these variables brought vitamin D production in highly melanized skin in line with that of lightly pigmented skin (Holick et al., 1981; Clemens et al., 1982). Furthermore, single or repeated whole-body UVB (artificially administered) evoked similar increases in 25-OHD concentrations in Asian, black, and white subjects (Stamp, 1975; Lo et al., 1986; Brazerol et al., 1988). These experiments with simulated sunlight were confirmed in the natural setting by Ellis et al. (1977), who noted that groups of Asian, West Indian, and European adolescents with vitamin D deficiency and living in England showed marked and comparable increases respectively in serum 25-OHD concentrations during the spring and summer months (March to October). The conclusion from all of these studies is that there is an intrinsic capacity for vitamin D3 synthesis regardless of skin color, provided that UVB exposure is adequate. Skin pigmentation is not a primary factor in causing rickets, as exemplified in Britain where Asian immigrants and their families were far more susceptible to vitamin D deficiency and rickets than the more deeply pigmented West Indians (African Caribbeans) (Ellis et al., 1976; Ford et al., 1976). A survey in the high-latitude city of Glasgow, Scotland (56°N), found no cases of florid rickets in 100 African children, 100 Chinese children, or 100 Scottish children, but there were 10 cases in 200 Asian children (Goel et al., 1976). (The problem of Asian rickets and osteomalacia in Britain is probably due to multiple factors, e.g., diet, genetic predisposition, socio-cultural attitudes to clothing, and sun exposure.) Webb et al. (1988) demonstrated that irrespective of skin pigmentation there was no photolysis of 7-DHC to previtamin D3 in Boston (42°N) and Edmonton (52°N) from November to February (inclusive) and from October to March, respectively. This dormancy of vitamin D production for up to 6 months at these latitudes is offset by the synthesis, storage, and accrual of vitamin D3 during sun exposure in summer. Mawer et al. (1972) established that vitamin D and 25-OHD are stored for extended periods in body tissues, predominantly fat. In their vitamin D-deficient patients, a large intravenous dose of radioactive vitamin D3 was rapidly cleared from the circulation and, together with its 25-OHD metabolite, was distributed to the depleted storage sites. (These findings of Mawer et al. were misinterpreted by Jablonski and Chaplin (2000: 78) to imply that deficient subjects had a reduced potential for vitamin D storage.) This cumulative storage property of vitamin D was neatly illustrated by a study of gardeners in Dundee, Scotland (56°N), who worked outdoors throughout the year. They not only had considerably higher serum 25-OHD levels than indoor workers, but these levels increased from July (the month of maximum UVB exposure) until they peaked in November and December (when UVB was in sharp decline) (Devgun et al., 1981). At high latitudes, therefore, where vitamin D3 photosynthesis ceases during the winter months, the body maintains an acceptable vitamin D status on a year-round basis by mobilizing reservoirs in fat and other tissues that have been built up during the summer (Webb and Holick, 1988).

238 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

The question arises as to what extent early Homo sapiens at latitudes above 40°N would have been vulnerable to rickets. Historically, rickets is a product of urbanization, industrialization, and civilization; it was rampant in the smog-ridden cities of Europe and North America during the industrial revolution but conspicuously absent in the surrounding rural areas with their clean air and outdoor lifestyles. Sporadic cases of rickets were described in European skeletal material dating from the Neolithic period until medieval times, but its prevalence was very low; it occurred in about one percent of skeletons from Swedish and Danish cemeteries (AD 1100–1550), and there was no evidence of it in Anglo-Saxon remains from East Anglia. In pre-Columbian North and South America, it hardly existed (Wells, 1975). Where instances of rickets occurred in preindustrial times, these were most likely due to sunlight deprivation. Ortner and Mays (1998) identified eight cases of active rickets (out of a sample of 687 excavated skeletons) from a churchyard in North Yorkshire, England, dating to the Middle Ages. All were infants aged from 3 to 18 months, and it was conjectured that these children had been sickly and thus kept indoors in dark, smoky houses. An examination of graveyard material from medieval cities in Hungary showed an increase in the frequency of rickets from 0.7% to 2.5% from the 10th to the 13th centuries AD, respectively (Wells, 1975), probably because of the proliferation of windowless houses during that period. The strongest case against the hypothesis is that the smoky and rickets-producing urban environments of the industrial revolution (and even earlier) were diametrically opposed to the sparsely inhabited, open-air, and unpolluted landscapes in which Upper Paleolithic Europeans lived and roamed. These individuals would have spent their daylight hours during late spring and summer under open skies and, partly clad in animal skins, they would have exposed a relatively large body area to an intensity of UVB that was optimal for cutaneous vitamin D3 photosynthesis. This quality and quantity of UVB (possibly enhanced during glacial periods by reflectivity from snow and ice), maintained daily for 4 or 5 months, would have amply fulfilled their physiological vitamin D requirements for the rest of the year. The decisive question though is whether early, deeply pigmented Homo sapiens in northern Europe would have benefited from the ambient summer UVB or whether they would have been deprived of vitamin D by virtue of melanin blockade. As discussed earlier, dark-skinned persons are endowed with the same capability to manufacture vitamin D3 as their lighter counterparts. Estimates are that fair-skinned people living in North America or Europe require only 5–10 min sun exposure of the arms and legs between 10:00 and 15:00 three times a week (except winter) to prevent vitamin D insufficiency (Webb and Holick, 1988; Holick, 2006a; Holick, 2007). If we assume that very dark individuals at latitudes above 50° need 10–20 times that duration of exposure to override the melanin barrier, then this would equate to about 1–3 h thrice weekly, a quota that would have been achievable within 1 or 2 days of the hunter-gatherer life of Upper In recent times, there has been Paleolithic Europeans. It is highly improbable that rickets ever a resurgence of vitamin D emerged in that setting. Thus, vitamin D status could not have insufficiency and deficiency, not constituted the fitness differential between lightly pigmented only in high-latitude countries and darkly pigmented individuals at high latitudes that favored but in some of the sunniest regions the evolutionary selection of the former. There was no risk of vitamin D toxicity from prolonged UVB exposure, as in the world. mistakenly contemplated by Loomis (1967), because excessive

READING: THE EVOLUTION OF LIGHT SKIN COLOR | 239

sunlight degrades previtamin D3 and vitamin D3 into inert photoproducts (Holick et al., 1981; Webb and Holick, 1988). In recent times, there has been a resurgence of vitamin D insufficiency and deficiency, not only in high-latitude countries but in some of the sunniest regions in the world (Holick, 2006b). The explanation is that presentday populations receive inadequate solar insolation for various reasons: indoor working and living conditions, deliberate sun avoidance, and the wearing of concealing clothing. A survey conducted across three regions of Australia of differing latitudes (27°S, 38°S, and 43°S) noted the high prevalence of vitamin D insufficiency but found, unexpectedly, that season and latitude together accounted for less than 20% of the variation in serum 25-OHD levels (van der Mei et al., 2007). This indicated that interindividual differences in sun-related behavior (duration of exposure, amount of clothing) vastly outweighed the more obvious seasonal and latitudinal differences in determining vitamin D status. Similarly, the marked black–white disparity in the United States in the occurrence of vitamin D inadequacy is not predominantly a consequence of skin color but rather a reflection of behavior or circumstances that restrict sun exposure. An example is a study in Cincinnati (39°N) where black breast-fed infants had strikingly lower 25-OHD levels compared with their white counterparts: the former were confined indoors and had negligible solar exposure, whereas the latter had regular outings in the sunshine (Specker et al., 1985). Socioeconomic circumstances largely account for the chronic sunlight deprivation experienced by many black babies. Compared with their white compatriots, AfricanAmerican mothers tend to be financially and educationally disadvantaged and to live in crowded neighborhoods. Consequently, they lack the leisure time, the amenities (ready access to gardens and parks), and the resources (baby carriages and cars) to take their infants on regular outdoor excursions in spring and summer, thereby maximizing vitamin D production. It is not surprising that, where cases of rickets have been reported in the United States in recent times, these have affected predominantly black children. The above arguments do not negate the effect of melanin pigmentation on vitamin D3 production, but they shift its influence from a primary to a secondary role, i.e., where UVB exposure is already marginal, a darkskin color will accentuate the problem and contribute significantly to vitamin D deficiency. It is crucial to recognize that the overwhelming majority of In an evolutionary context, vitapeople worldwide with vitamin D insufficiency and deficiency min D deficit per se would not have the subclinical form; they are apparently healthy and free have exerted a negative selective of skeletal deformities (Gordon et al., 2004; Rockell et al., 2005; action against dark pigmentaHolick, 2006b). A survey of 232 black (East African) immigrant tion unless it translated into children living in Melbourne, Australia (37°S), found that alflorid rickets, with the attendant though vitamin D insufficiency and the more severe vitamin D deformities and disabilities that deficiency occurred in 81% and 44%, respectively, none showed curtailed reproductive fitness and clinical signs of rickets (McGillivray et al., 2007). In the event survival. that early, dark-skinned humans at high latitudes did develop vitamin D deficiency, it is highly probable that they would have remained asymptomatic. In an evolutionary context, vitamin D deficit per se would not have exerted a negative selective action against dark pigmentation unless it translated into florid rickets, with the attendant deformities and disabilities that curtailed reproductive fitness and survival. There is another perspective that undermines the hypothesis. Matsuoka et al.

240 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

(1991) demonstrated that after single-dose, whole-body UVB exposure black subjects had distinctly lower serum vitamin D3 levels than whites; but differences between the two groups narrowed after liver hydroxylation to 25-OHD and disappeared after kidney hydroxylation to 1,25-(OH)2D. These findings suggest that there is a compensatory mechanism whereby, in the presence of vitamin D3 suppression by melanin, the liver and kidney hydroxylating enzymes are activated in tandem to ensure that the concentration of the biologically active 1,25-(OH)2D metabolite is normalized and kept constant regardless of ethnic pigmentation (Matsuoka et al., 1991, 1995). Homeostatic control of bone metabolism and function is mediated by a complex series of feedback interactions between vitamin D, calcium, phosphorus, and parathyroid hormone (one action of which is to enhance the enzymatic conversion of 25-OHD to 1,25-(OH)2D) (Holick, 2007). Blacks have optimally modulated this vitamin D endocrine system to protect the skeleton from the adverse consequences of reduced vitamin D3 synthesis (Looker et al., 2002; Harris, 2006). These adaptive processes fail in extreme vitamin D deficiency (and possibly also in the elderly), but they are decidedly effective in the moderate vitamin D deficit state that affects nearly half of African Americans. The latter, for example, have a lower prevalence of osteoporosis, a lower incidence of fractures and a higher bone mineral density than white Americans, who generally exhibit a much more favorable vitamin D status (Henry and Eastell, 2000; Hannan et al., 2008). In the past decade, there has been an increasing focus on the nonskeletal functions of vitamin D. The biologically active metabolite 1,25-(OH)2D is produced locally in organs such as breast, colon, and prostate, where it is believed to regulate cellular growth and potentially to inhibit cancer development and progression. It is active in the immune system (macrocytes and lymphocytes) and it may promote immunity against infectious diseases such as tuberculosis. It is also claimed to prevent conditions such as cardiovascular disease, hypertension, diabetes, and rheumatoid arthritis (Holick 2006a, 2007). Much of this work is still speculative and experimental, and the evidence linking vitamin D to the various disease states is inconsistent and dogged by confounding variables (Wolpowitz and Gilchrest, 2006). Proponents of the vitamin D hypothesis have not yet been able to structure these ideas into a specific evolutionary formulation; indeed many of the diseases mentioned above manifest later in life (after the reproductive period) and so have negligible fitness consequences. Infectious diseases tend to occur within high-density populations and not within small and scattered nomadic groups such as those that characterized Upper Paleolithic humans. But, since the thrust of this work has been to exclude vitamin D deficiency in these early Europeans, neither the skeletal nor the nonskeletal effects of such deficiency would pertain to the skin color debate.

CONCLUSION The vitamin D hypothesis has gained widespread acceptance as the standard explanation for light skin color in northern Europe. It has received strong endorsement in two recent and reputable review publications (Jablonski, 2004; Parra, 2007), and it threatens to become enshrined in evolutionary lore. Although I have previously advanced detailed counter-arguments (Robins, 1991), in this work I have reformulated and updated the opposing position in the hope that it will evoke discussion and reassessment. I believe that this hypothesis, which superficially appears elegant and convincing, is invalidated

READING: THE EVOLUTION OF LIGHT SKIN COLOR | 241

by current research. Alternative hypotheses deserve to be revisited but, more important, new ideas need to be sought to unravel the enigma of human depigmentation.

LITERATURE CITED Brazerol WF, McPhee AJ, Mimouni F, Specker BL, Tsang RC. 1988. Serial ultraviolet B exposure and serum 25 hydroxyvitamin D response in young adult American blacks and whites: no racial differences. J Am Coll Nutr 7:111–118. Chen TC, Chimeh F, Lu Z, Mathieu J, Person KS, Zhang A, Kohn N, Martinello S, Berkowitz R, Holick MF. 2007. Factors that influence the cutaneous synthesis and dietary sources of vitamin D. Arch Biochem Biophys 460:213–217. Clemens TL, Adams JS, Henderson SL, Holick MF. 1982. Increased skin pigment reduces the capacity of skin to synthesise vitamin D3. Lancet 1:74–76. Devgun MS, Paterson CR, Johnson BE, Cohen C. 1981. Vitamin D nutrition in relation to season and occupation. Am J Clin Nutr 34:1501–1504. Ellis G, Woodhead JS, Cooke WT. 1977. Serum-25-hydroxyvitamin-D concentrations in adolescent boys. Lancet 1:825–828. Ford JA, McIntosh WB, Butterfield R, Preece MA, Pietrek J, Arrowsmith WA, Arthurton MW, Turner W, O’Riordan JL, Dunnigan MG. 1976. Clinical and subclinical vitamin D deficiency in Bradford children. Arch Dis Child 51:939–943. Goel KM, Sweet EM, Logan RW, Warren JM, Arneil GC, Shanks RA. 1976. Florid and subclinical rickets among immigrant children in Glasgow. Lancet 1:1141–1145. Gordon CM, DePeter KC, Feldman HA, Grace E, Emans J. 2004. Prevalence of vitamin D deficiency among healthy adolescents. Arch Pediatr Adolesc Med 158:531–537. Hannan MT, Litman HJ, Araujo AB, McLennan CE, McLean RR, McKinlay JB, Chen TC, Holick MF. 2008. Serum 25-hydroxyvitamin D and bone mineral density in a racially and ethnically diverse group of men. J Clin Endocrinol Metab 93:40–46. Harris SS. 2006. Vitamin D and African Americans. J Nutr 136:1126–1129. Henry YM, Eastell R. 2000. Ethnic and gender differences in bone mineral density and bone turnover in young adults: effect of bone size. Osteoporos Int 11:512–517. Holick MF, 2006a. High prevalence of vitamin D inadequacy and implications for health. Mayo Clin Proc 81:353–373. Holick MF. 2006b. Resurrection of vitamin D deficiency and rickets. J Clin Invest 116:2062–2072. Holick MF. 2007. Vitamin D deficiency. N Eng J Med 357:266–281. Holick MF, MacLaughlin JA, Doppelt SH. 1981. Regulation of cutaneous previtamin D3: skin pigment is not an essential regulator. Science 211:590–593. Jablonski NG. 2004. The evolution of human skin and skin color. Annu Rev Anthropol 33:585–623. Jablonski NG, Chaplin G. 2000. The evolution of human skin coloration. J Hum Evol 39:57–106. Lo CW, Paris PW, Holick MF. 1986. Indian and Pakistani immigrants have the same capacity as Caucasians to produce vitamin D in response to ultraviolet radiation. Am J Clin Nutr 44:683–685. Looker AC, Dawson-Hughes B, Calvo MS, Gunter EW, Sahyoun NR. 2002. Serum 25-hydroxyvitamin D status of adolescents and adults in two seasonal subpopulations from NHANES III. Bone 30:771–777.

242 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Loomis WF. 1967. Skin-pigment regulation of vitamin-D biosynthesis in man. Science 157:501–506. Matsuoka LY, Wortsman J, Chen TC, Holick MF. 1995. Compensation for the interracial variance in the cutaneous synthesis of vitamin D. J Lab Clin Med 126:452–457. Matsuoka LY, Wortsman J, Haddad JG, Kolm P, Hollis BW. 1991. Racial pigmentation and the cutaneous synthesis of vitamin D. Arch Dermatol 127:536–538. Mawer EB, Backhouse J, Holman CA, Lumb GA, Stanbury SW. 1972. The distribution and storage of vitamin D and its metabolites in human tissues. Clin Sci 43:413–431. McGillivray G, Skull SA, Davie G, Kofoed S, Frydenberg L, Rice J, Cooke R, Carapetis JR. 2007. High prevalence of asymptomatic vitamin-D and iron deficiency in East African immigrant children and adolescents living in a temperate climate. Arch Dis Child 92:1088–1093. Murray FG. 1934. Pigmentation, sunlight and nutritional disease. Am Anthrop 36:438–445. Nesby-O’Dell S, Scanlon KS, Cogswell ME, Gillespie C, Hollis BW, Looker AC, Allen C, Doughertly C, Gunter EW, Bowman BA. 2002. Hypovitaminosis D prevalence and determinants among African American and white women of reproductive age: third National Health and Nutrition Examination Survey, 1988-1994. Am J Clin Nutr 76:187–192. Ortner DJ, Mays S. 1998. Dry-bone manifestations of rickets in infancy and early childhood. Int J Osteoarchaeol 8:45–55. Parra EJ. 2007. Human pigmentation variation: evolution, genetic basis, and implications for public health. Yrbk Phys Anthropol 50:85–105. Robins AH. 1991. Biological perspectives on human pigmentation. Cambridge: Cambridge University Press. Rockell JE, Green TJ, Skeaff CM, Whiting S, Taylor RW, Williams SM, Parnell WR, Scragg R, Wilson N, Schaaf D, Fitzgerald ED, Wohlers MW. 2005. Season and ethnicity are determinants of serum 25-hydroxyvitamin D concentrations in New Zealand children aged 5-14y. J Nutr 135:2602–2608. Specker BL, Valanis B, Hertzberg V, Edwards N, Tsang RC. 1985. Sunshine exposure and serum 25-hydroxyvitamin D concentrations in exclusively breast-fed infants. J Pediatr 107:372–376. Stamp TCB. 1975. Factors in human vitamin D nutrition and in the production and cure of classical rickets. Proc Nutr Soc 34:119–130. van der Mei IA, Ponsonby A-L, Engelson O, Pasco JA, McGrath JJ, Eyles DW, Blizzard L, Dwyer T, Lucas R, Jones G. 2007. The high prevalence of vitamin D insufficiency across Australian populations is only partly explained by season and latitude. Environ Health Perspect 115:1132–1139. Webb AR, Holick MF. 1988. The role of sunlight in the cutaneous production of vitamin D3. Annu Rev Nutr 8:375–399. Webb AR, Kline L, Holick MF. 1988. Influence of season and latitude on the cutaneous synthesis of vitamin D3: exposure to winter sunlight in Boston and Edmonton will not promote vitamin D3 synthesis in human skin. J Clin Endocrinol Metab 67:373–378. Wells C. 1975. Prehistoric and historical changes in nutritional diseases and associated conditions. Prog Food Nutr Sci 1:729–779. Wharton B, Bishop N. 2003. Rickets. Lancet 362:1389–1400. Wolpowitz D, Gilchrest BA. 2006. The vitamin D questions: how much do you need and how should you get it? J Am Acad Dermatol 54:301–317.

IMAGE CREDITS CHAPTER 1 Johan Henrik Scheffel, “Carl Linneaus,” http://commons.wikimedia.org/wiki/File:Carl_Linnaeus.jpg. Copyright in the Public Domain. “Georges-Louis Leclerc, Comte de Buffon,” http://commons.wikimedia.org/wiki/File:Georges-Louis_Leclerc,_ Comte_de_Buffon.jpg. Copyright in the Public Domain. Richard Leakey and Roger Lewin, “Charles Darwin by R. Richmond,” http://commons.wikimedia.org/wiki/ File%3ACharles_Darwin_by_G._Richmond.png. Copyright in the Public Domain. G. J. Romanes, “Haeckel drawings,” http://commons.wikimedia.org/wiki/File:Haeckel_drawings.jpg. Copyright in the Public Domain. Copyright © Jerry Crimson Mann (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Evolution_pl.png Copyright © Jonathan Hornung (CC BY-SA 2.5) at http://commons.wikimedia.org/wiki/File:Sugies03_hp.jpg Copyright © Marek Mazurkiewicz (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Directional_selection_after.svg Copyright © Azcolvin429 (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Disruptive_selection_after. svg John Gould, “Darwin’s finches,” http://commons.wikimedia.org/wiki/File:Darwin%27s_finches.jpeg. Copyright in the Public Domain.

CHAPTER 2 Copyright © Pbroks13 (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Punnett_Square.svg Copyright © Domaina (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Autosomal_dominant_-_en.svg Copyright © Aymleung (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Autosomal_recessive_EN.svg Copyright © Eric Kilby (CC BY-SA 2.0) at https://www.flickr.com/photos/ekilby/3558372042/

CHAPTER 3 Tronicum, “Sperm-egg,” http://commons.wikimedia.org/wiki/File:Sperm-egg.jpg. Copyright in the Public Domain.

243

244 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

Forluvoft, “DNA simple2,” http://commons.wikimedia.org/wiki/File:DNA_simple2.svg. Copyright in the Public Domain. LadyofHats, “Mitosis cells sequence,” http://commons.wikimedia.org/wiki/File:Mitosis_cells_sequence.svg. Copyright in the Public Domain. Copyright © Kelvinsong (CC by 3.0) at http://commons.wikimedia.org/wiki/File:Protein_synthesis.svg.

CHAPTER 4 Jackhynes, “Non-human primate range,” http://commons.wikimedia.org/wiki/File:Non-human_primate_ range.png. Copyright in the Public Domain. Copyright © Cephoto, Uwe Aranas (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Sandakan_ Sabah_Sepilok-Orangutan-Rehabilitation-Centre-14.jpg PookieFugglestein, “Gibraltar, monkey grooming another,” http://commons.wikimedia.org/wiki/ File:Gibraltar,_monkey_grooming_another.JPG. Copyright in the Public Domain. Copyright © Tony Hisgett (CC by 2.0) at http://commons.wikimedia.org/wiki/File:Snow_Monkeys.jpg. Copyright © Chucku3 (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:False_ Potto_2014-01-03_18-28.jpg Copyright © OpenCage (CC BY-SA 2.5) at http://commons.wikimedia.org/wiki/File:Galago_senegalensis. jpg Copyright © Twowells (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Lemur_walking.jpg Copyright © Pmarzio (CC by 2.5) at http://commons.wikimedia.org/wiki/File:Indri_Indri.jpg. Gustav Mützel, “Aye-Aye (Chiromys madagascariensis),” http://commons.wikimedia.org/wiki/File:AyeAye_(Chiromys_madagascariensis).png. Copyright in the Public Domain. Copyright © Serge Gomes da Silva (CC BY-SA 2.5) at http://commons.wikimedia.org/wiki/File:Avahi_laniger_Madagascar_30-09-2004.jpg Friedrich Specht, “Dwarf Lemur,” http://commons.wikimedia.org/wiki/File:Dwarf_Lemur.jpg. Copyright in the Public Domain. Copyright © mtoz (CC BY-SA 2.0) at http://commons.wikimedia.org/wiki/File:Bohol_Tarsier.jpg Copyright © Miguelrangeljr (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Callitrichinae_genus. jpg Copyright © Jens Buurgaard Nielsen (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Blackcapped_Squirrel_Monkeys_in_tree.JPG Copyright © Frans de Waal (CC by 2.5) at http://commons.wikimedia.org/wiki/File:Capuchin_monkeys_sharing.jpg. Copyright © Cliff (CC by 2.0) at http://commons.wikimedia.org/wiki/File:Brown_Titi_Monkey_(Callicebus_ brunneus).jpg. Ipaat, “Uakari male,” http://commons.wikimedia.org/wiki/File:Uakari_male.jpg. Copyright in the Public Domain Copyright © Miguelrangeljr (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Atelidae_Family. jpg Copyright © Yoky (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Colobus_guereza_Mantelaffen. JPG

IMAGE CREDITS | 245

Josh, “Neusaap,” http://commons.wikimedia.org/wiki/File:Neusaap.jpg. Copyright in the Public Domain. Copyright © Rob (CC by 2.0) at http://commons.wikimedia.org/wiki/File:Baby_ginger_monkey.jpg. Copyright © Aaron Logan (CC by 1.0) at http://commons.wikimedia.org/wiki/File:Lightmatter_guenon. jpg. Copyright © Marlene Thyssen (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/Monkey#mediaviewer/ File:Mandril.jpg Gary M. Stolz, “Olive baboon,” http://commons.wikimedia.org/wiki/File:Olive_baboon.jpg. Copyright in the Public Domain. Copyright © Programme HURO (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Gibbon_ Hoolock_de_l%27ouest.JPG tbachner, “Orangutan bukit lawang 2006,” http://commons.wikimedia.org/wiki/File:Orang-utan_bukit_lawang_2006.jpg. Copyright in the Public Domain. Copyright © Kabir Bakie (CC BY-SA 2.5) at http://commons.wikimedia.org/wiki/File:Gorilla_019.jpg Copyright © 2010 Ikiwaner, GNU Free Documentation License at: http://commons.wikimedia.org/wiki/ File:Gombe_Stream_NP_Mutter_und_Kind.jpg. A copy of the license can be found here: http://commons.wikimedia.org/wiki/Commons:GNU_Free_Documentation_License,_version_1.2 Copyright © Ltshears (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Bonobo_0698.jpg

CHAPTER 5 Copyright © Sting (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Map_of_the_fossil_sites_of_ the_earliest_hominids_(35.8-3.3M_BP).svg Copyright © Didier Descouens (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Sahelanthropus_ tchadensis_-_TM_266-01-060-1_Global_fond.jpg Copyright © Lucius (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Orrorin_tugenensis.jpg Copyright © Guérin Nicolas (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Australopithecus_ anamensis_bone_(University_of_Zurich).JPG Copyright © 120 (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Lucy_blackbg.jpg Copyright © Sting (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Map_of_the_fossil_sites_of_ the_early_hominids_(4.4-1M_BP).svg Copyright © Didier Descouens (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Australopithecus_ africanus_-_Cast_of_taung_child.jpg Copyright © Bjørn Christian Tørrissen (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/ File:Paranthropus-boisei-Nairobi.JPG José-Manuel Benito Álvarez, “Homo habilis-KNM ER 1813,” http://commons.wikimedia.org/wiki/ File:Homo_habilis-KNM_ER_1813.jpg. Copyright in the Public Domain. José-Manuel Benito Álvarez, “Homo rudolfensis-KNM ER 1470,” http://commons.wikimedia.org/wiki/ File:Homo_rudolfensis-KNM_ER_1470.jpg. Copyright in the Public Domain. Copyright © Chichi (CC by 3.0) at http://commons.wikimedia.org/wiki/File:Sm12.jpg.

246 | THE HUMAN ORGANISM: EXPLORATIONS IN BIOLOGICAL ANTHROPOLOGY

CHAPTER 6 “Pithesanthropus-erectus,” http://commons.wikimedia.org/wiki/File:Pithecanthropus-erectus.jpg. Copyright in the Public Domain. Frédéric MICHEL, “Biface silex,” http://commons.wikimedia.org/wiki/File:Biface_silex.png. Copyright in the Public Domain. Copyright © Jose Luis Martinez Alvarez (CC by 2.0) at http://commons.wikimedia.org/wiki/File:Homo_antecessor_female.jpg. Copyright © ROCEEH (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:ROCEEH_Motm2011_01_Early_Pleistocene_presence_of_Homo_in_Eurasia.pdf

CHAPTER 7 Copyright © Ryan Somma (CC BY-SA 2.0) at http://commons.wikimedia.org/wiki/File:Homo_heidelbergensis.jpg Copyright © DrMikeBaxter (CC BY-SA 2.0) at http://commons.wikimedia.org/wiki/File:Sapiens_neanderthal_comparison_en_blackbackground.png Copyright © Nilenbert (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Range_of_Neanderthals. png Copyright © Thilo Parg (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/ File:Heidenschmiede_Faustkeil_Tafel_V1.jpg

CHAPTER 8 Copyright © Dark Tichondrias (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Unlabeled_ Renatto_Luschan_Skin_color_map.png The National Heart, Lung, and Blood Institute, “Sickle cell 01,” http://commons.wikimedia.org/wiki/ File:Sickle_cell_01.jpg. Copyright in the Public Domain. Copyright © Guillaume Tranquard (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/ File:Massa%C3%AF_women.jpg Lomen Bros, “Inuir Woman 1907 Crisco edit 2,” http://commons.wikimedia.org/wiki/File:Inuit_Woman_1907_ Crisco_edit_2.jpg. Copyright in the Public Domain. Stevenfruitsmaak, “World map of lactose intolerance,” http://commons.wikimedia.org/wiki/File:World_map_ of_lactose_intolerance.png. Copyright in the Public Domain. Copyright © Cacophony (CC BY-SA 3.0) at http://commons.wikimedia.org/wiki/File:Andean_Man.jpg McLeod, “Smellie forceps,” http://commons.wikimedia.org/wiki/File:Smellie_forceps.jpg. Copyright in the Public Domain.