Technologies for Rural Development: Proceedings of NERC 2022 981198512X, 9789811985126

Citation preview

Technologies for Rural Development

Sanjukta Patra · Sudip Mitra · Siddhartha Singha · Pankaj Kalita Editors

Technologies for Rural Development Proceedings of NERC 2022

Editors Sanjukta Patra Department of Biosciences and Bioengineering School of Agro and Rural Technology Indian Institute of Technology Guwahati Guwahati, Assam, India Siddhartha Singha School of Agro and Rural Technology Indian Institute of Technology Guwahati Guwahati, Assam, India

Sudip Mitra School of Agro and Rural Technology Indian Institute of Technology Guwahati Guwahati, Assam, India Pankaj Kalita School of Energy Science and Engineering Centre for Energy Indian Institute of Technology Guwahati Guwahati, Assam, India

ISBN 978-981-19-8512-6 ISBN 978-981-19-8513-3 (eBook) https://doi.org/10.1007/978-981-19-8513-3 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore

Foreword

It is a matter of great satisfaction for me that Indian Institute of Technology Guwahati successfully hosted North-East Research Conclave (NERC) 2022 during May 20–22, 2022. The NERC 2022 was conducted on the theme “Sustainable Science and Technology”. Concurrently, Assam Biotech Conclave (ABC) was also organized May 21–22, 2022. Both the events attracted huge participation from policymakers, researchers, industrialist, army, and students. Even the participation of school children was overwhelming. NERC and ABC had many events including panel discussions, exhibitions, keynote lectures, competitions, and paper presentations. Presentation of technical papers form the core of any research conference. NERC attracted 879 research papers on various themes covering science, technology, and humanities. Out of these, some select papers have been published by Springer Nature in the form of 15 volumes. These papers have been peer reviewed and thoroughly edited by IIT Guwahati faculty members. I am sure that these volumes will prove to be excellent resource material for research. Most of the papers presented in these volumes highlight the special needs and aspiration of eight states of Northeast India. I congratulate and thank authors, reviewers, editors, and publisher for bring out proceedings. Motivation for organizing NERC came from none other than Honorable Minister of Education, Government of India, Shri Dharmendra Pradhan Ji. It helped to bring policymakers, researchers, industrialists, academicians, students, and children in one forum. It is perhaps the rarest conclave covering almost all possible research themes. For better readability, the proceedings have been divided into 15 volumes, but each volume reflects diversity in terms of topics and researchers. Only common thread is sustainable development of Northeast India. Invariably, Sustainable North-East India is a prerequisite for sustainable India and the whole world. In that sense, these

v

vi

Foreword

15 volumes will serve guiding and stimulating light for all the stakeholders of the development. I am pleased to dedicate these volumes to nation as a part of Azadi ka Amrit Mahotsav.

T. G. Sitharam Director, Indian Institute of Technology Guwahati Guwahati, India

Preface

The concept of rural development encompasses an extensive spectrum in present times compared to what was considered a few years ago. A complete and real rural development is measured not only by economic advancements but also by other factors like health, education, agriculture, technological changes, etc. Technology aids in transforming the rural structure and enabling the developing countries to progress and prosper. There are many prominent examples where technology has made a significant impact toward rural development like ergonomically designed Bullock Driven Tractor (BDT), low-cost small tractor to work on small farms/lands, hybrid solar food dryer to dry agriculture produce, tricycle for the mobility disabled, ergonomically designed treadle pump, modified potter’s wheel, floating fish cages for inland aquaculture, multi-nutrient compressed feed block machine, biomass dryer, Mangal turbine for small hydropower generation, an improved chulha (stove), wind energy systems, etc. This book highlights the case studies and research ideas which provide an insight into the domain of science and technology for the development of various rural sectors. Rural health: In health care, communication has been a great challenge, especially for patients receiving ongoing or complex treatment for chronic issues, who may need to travel long distances for various healthcare services. Telemedicine assists with the delivery of healthcare services and reduces challenges such as transportation issues related to traveling for specialty care. Another significant technology is the mobile ambulance like AmbuPod Ambulance which is a portable ambulance providing healthcare facility to India’s rural population. Internet Kiosks in villages throughout India have allowed villagers to access health services. Role of information technology in rural development: Information technology has played a significant role in improving the quality of life in rural areas and helped an average Indian farmer to get relevant information regarding management of agro- and fish farms, better crop and seed production technologies, agro-processing as well as tracking plant-based diseases. Internet of Things and artificial intelligence are some of the prominent technologies discussed to uplift rural development.

vii

viii

Preface

Rural sanitation: Various technologies have been implemented for development of rural sanitation like safe handling of drinking water, wastewater treatment, solid waste management, domestic sanitation and hygiene, and village sanitation. Mechanization for rural development: Mechanization involves development of tools and technologies which can be used for agricultural land development, crop harvesting, farm production, food processing like solar fruit and vegetables dryer, battery-operated weeder, hand tractor-powered digger cum leaf topper, genderfriendly paddy weeder suitable for hill agriculture, and design and development of porous radiant burner for biogas for household applications. Mechanization is advantageous and significant for rural development because it reduces operational period and labor in farming and increases efficiency and overall rural upliftment. Discussion of these various facets or problems will be very helpful for the policymakers and planners to take necessary action. To conclude, technologies for rural development can bring the essential changes in the grassroot level which will be reflected in all the pyramids of society. Guwahati, India

Sanjukta Patra Sudip Mitra Siddhartha Singha Pankaj Kalita

North East Research Conclave 2022: Toward Sustainable Science and Technology

It is extremely important and imperative to have knowledge-driven growth based on innovation in the case of academic higher education institutes of high repute. The northeastern region endowed with rich biodiversity comprises eight states. However, the climatic conditions, limited connectivity, lack of research infrastructure/institutes, territorial conflicts, and the mountainous terrain of these regions are major impediments to the research ecosystem in the northeast. Quality higher education focusing on industry-academia collaboration and translational research is extremely beneficial for society. It has also been rightly pointed out by the Hon’ble Prime Minister Sh. Narendra Modi that, “India cannot develop till Eastern India develops”.

With this idea and as India marks 75 years of independence, Indian Institute of Technology Guwahati organized “The North-Eastern Research Conclave” from May ix

x

North East Research Conclave 2022: Toward Sustainable Science …

20–22, 2022. This grand event was jointly conducted with Science, Technology and Climate Change Department and the Department of Education, Govt. of Assam, at IIT Guwahati Campus. The mission behind the conclave was to showcase the best R&D activities from educational and research institutions across Northeast India and to create an environment, conducive to development of local indigenous technologies and innovations, creating the scope and laying the foundation for entrepreneurship. In order to attract people and spread awareness about the event, a roadshow was initiated from IIT Guwahati on May 7, 2022, in order to reach all the partnering academic institutes and make them an integral part of the mega event. The Director, IITG, waved the NERC 2022 flag and sent off the roadshow vehicle from the institute. More than 400 students, staff, and faculty participated actively in the roadshow.

A huge response was received by participants from throughout the country. The total no. of participating institutions in this conclave included 7 IITs, 10 NITs, 5 IIITs, and other CFTIs, 23 Research Laboratories, 17 Central Funded Universities,

North East Research Conclave 2022: Toward Sustainable Science …

xi

47 other Universities/Institutes along with about 100 schools. Eminent personalities from industries, start-ups, research councils, and PSUs also joined in. The presence of dignitaries from important Ministries was observed such as Shri Dharmendra Pradhan, Hon’ble Union Minister of Education and Minister of Skill Development and Entrepreneurship, GOI; Dr. Himanta Biswa Sarma, Hon’ble Chief Minister of Assam State; Dr. Ranoj Pegu, Hon’ble Minister of Education, Government of Assam; Dr. Rajkumar Ranjan Singh, Hon’ble Minister of State for Education, GOI; Dr. Subhas Sarkar, Hon’ble Minister of State for Education, GOI; Shri Keshab Mahanta, Hon’ble Minister of Science Technology and Climate Change, Government of Assam; and many more.

The inauguration ceremony of the conclave was followed by the signing of a MoU between IIT Guwahati and the Government of Assam to establish “The Assam Advanced Health Innovation Institute (AAHII)”. This MoU would prove to be a unique partnership between the Government of Assam and IIT Guwahati in order to set up a Research Institution to leverage advanced technologies to transform medical science. This joint venture company will be able to invite participation from intending parties including corporates/businesses/research institutions and philanthropic organizations.

xii

North East Research Conclave 2022: Toward Sustainable Science …

The third edition of Assam Biotech Conclave 2022 was also held as part of NERC 2022. It brought together the biotech entrepreneurs, industry leaders, researchers, academicians, government representatives, policymakers, innovators, and investors together on one platform to explore the possibilities of Biotechnology in Northeast India and to discuss the new opportunities in the transition. Officers from the Indian Army also actively participated in the conclave. A talk on “Atmanirbhar Bharat—Indian Army Initiatives towards Self Reliance” was delivered by Lt. Gen. D. S. Rana AVSM, YSM, SM General Officer Commanding, Gajraj Corps, on May 21, 2022. The talk was aligned with the vision of the apex leadership of the Government of India and initiatives undertaken by the Indian Armed Forces with a focus on the integration of civil-military establishment in the field of selfreliance. He also elucidated that institutions such as IIT Guwahati which has many running research projects and elaborate student exchange and joint collaboration setup with a large number of countries have the wherewithal to take up defenserelated R&D and also facilitate delivery with industry partners. He also invited IIT Guwahati to participate in EAST TECH Symposium planned at Kolkata in July 2022. This led to the signing of a MoU between Indian Army Eastern Command and IIT Guwahati on July 7, 2022, during East Tech 2022. This would further impetus to Indigenisation and Raksha Atmanirbharta.

North East Research Conclave 2022: Toward Sustainable Science …

xiii

Royal Society of Chemistry, global battery experiment was performed by more than 1300 students in three sessions starting from May 20 to May 22 at IIT Guwahati. Along with the global battery experiment, creating skilful educators (teacher training program) was also conducted in parallel sessions. Students had arrived from various schools across Assam and other northeastern states.

xiv

North East Research Conclave 2022: Toward Sustainable Science …

The Guwahati Declaration was launched at the valedictory ceremony of the conclave by Shri Lok Ranjan, Secretary, Ministry of Development of North Eastern Region (DoNER), in the presence of Shri Kailash Karthik, Deputy Commissioner, Kamrup. The Declaration is intended to create a set of guidelines, through which individual as well as a collective responsibility to promote and encourage innovation at the grassroot level and strive to stimulate and execute indigenization and entrepreneurship, can be taken up.

Science, education, research, and innovation are the four pillars on which the development, as well as the work culture of a nation, rests. This was well articulated by the promising number of exhibitors being seen participating from all across the NE states in the NERC 2022. All the NITs, CFTIs, and CFIs were allocated two stalls each, where the delegates showcased the working models of their inventions. Distinctive pavilions were arranged for IIT, NIT, CFIs, and CFTIs. Excellent response was obtained from the start-ups all across the NE states. Federation of Industry Commerce of North Eastern Region (FINER) had partnered with NERC 2022 as an industry partner, and they showcased 50 start-ups as a part of the exhibition under the

North East Research Conclave 2022: Toward Sustainable Science …

xv

FINER Pavilion. Other significant organizations that came forward to showcase their allied R&D start-ups were the Oil and Natural Gas (Oil and Natural Gas Pavilion), Indian Army (Defense Pavilion), and NE-Railway (NE-Railway Pavilion).

Multifarious research work on topics of societal relevance was presented by researchers from different organizations/institutes. The presentations were conducted in oral and poster presentation modes. The thematic areas for these presentations were part of some of the Sustainable Development Goals (SDGs) such as SDG-3: Good health and wellbeing; SDG-7: Affordable and Clean Energy; SDG-9: Industry, Innovation and Infrastructure; SDG-11: Sustainable cities and communities and SDG-12: Responsible consumption and production. Some of the papers highlighted environmental sustainability, efficiency, and management issues, which are important to be presented in the case of northeast regions. Two awards were given under each technical category for these presentations. Overall, the technical sessions were a grand success due to the active cooperation from editors, chairpersons of all the sessions, and student volunteers of IITG.

xvi

North East Research Conclave 2022: Toward Sustainable Science …

The Government of India has taken various steps to encourage women in the field of science and technology. In this line, the IIT Guwahati Woman Researcher Award was approved to recognize the contribution of women faculty members of IIT Guwahati fraternity. This prestigious award was conferred to Dr. Latha Rangan who is Senior Professor in the Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, India. Prof. Rangan has played a key role in Plant Biotechnology and Sustainable development and especially in the areas of energy security, food security, and medicinal crops. The conclave paved the way for creating mass awareness of research and innovation for developing a sustainable society. There was knowledge exchange and dissemination that led to the establishment of Centres of Excellence in Translational Collaborative Research and Innovation. This mega event led to the bridging of the gap between Industry-Academia and Creating Hand holding Pathways for setting up long-term collaboration for R&D innovations toward the goal of establishing sustainable NE India. The conclave brought together over 8000 participants including Hon’ble Ministers, Official Bureaucrats, Eminent Professors, Scientists, Renowned Industrialist, School Children/Teachers, and other delegates. This revolutionized the R&D road map of all the NE states through various dissemination of policies which will benefit the sustainable development of all NE states in the near future. It is an honor and a moment of extreme pride for getting the NERC proceedings published in the prestigious Springer volumes. We would like to thank and acknowledge the globally active publisher Springer for helping us being able to publish the

North East Research Conclave 2022: Toward Sustainable Science …

xvii

articles on 15 broad areas. We would also like to thank all the authors for their contribution to the grand success of NERC 2022 and wish them great success in all of their future endeavors.

Prof. Vimal Katiyar Dean, R&D Department of Chemical Engineering Centre for the Sustainable Polymer Indian Institute of Technology Guwahati Guwahati, India [email protected]

Prof. Subhendu Sekhar Bag Associate Dean, R&D Department of Chemistry Centre for the Environment Indian Institute of Technology Guwahati Guwahati, India [email protected]

From the Desk of Chairman of Technical Committee of NERC 2022

North-East Research Conclave 2022 was successfully organized during May 20– 22, 2022, with the participation of thousands of delegates. A total of 879 oral and poster papers were presented in the conference on 16 different tracks. The theme of the conclave was Sustainable Science and Technology, which is very pertinent in the modern era of globalization. Science and technology has to address economic, environmental, and social problems of the world. Technology and sustainability are not incompatible. In fact, technology can achieve the goal of sustainability, which also includes preserving our rich cultural heritage. Concurrently with North-East Research Conclave (NERC), Assam Biotech Conclave 2022 was also organized on May 21–22, 2022. These mega events were organized at Indian Institute of Technology Guwahati (IITG) in physical mode after two years of pandemic period. Along with IITG, Science, Technology and Climate Change Department and Department of Education, Govt. of Assam, were also organizers of these events under the patronage of Shri Dharmendra Pradhan Ji, Honorable Minister of Education and Minister of Skill Development and Entrepreneurship in the Government of India, and Shri Himanta Biswa Sarma Ji, Honorable Chief Minister of Assam. It is a matter of great pleasure that Springer Nature is publishing the select papers from the conclave in 15 volumes. These are Advanced Functional Materials, Low Cost Manufacturing Technologies, Agro and Food Processing Technologies, Artificial Intelligence and Data Science based R&D interventions, Conservation of Biodiversity in the North Eastern States of India, Disaster Management, Healthcare Research and Related Technologies, Innovative Design for Societal Needs, Policies for Research and Innovation, Research and Innovation for Sustainable Development Goals, Sustainable Environment, Sustainable Energy Generation and Storage, Sustainable Transportation and Urban Development, Teaching and Learning Technologies, Technologies for Rural Development. These volumes are useful archival and reference materials for policymakers, researchers, and students. As the Chairman of Technical Committee, I am thankful to all the editors of all volumes, reviewers, and student volunteers who have put tireless efforts to review, select, and edit the papers of respective divisions, overcoming the time-constraint. Support provided by Convener, Professor Vimal Katiyar, Dean R&D, IITG, and xix

xx

From the Desk of Chairman of Technical Committee of NERC 2022

Co-conveners Prof. Subhendu Sekhar Bag, Associate Dean R&D, IITG, and Shri Kailash Karthik N., IAS, is commendable. It is difficult to express words of gratitude to the Director, IITG, Prof. T. G. Sitharam who has been motivating and guiding all the teams of NERC 2022 and ABC 2022. Uday S. Dixit Professor, Department of Mechanical Engineering and Head, Center for Indian Knowledge Systems IIT Guwahati

About the Conference

It is a matter of great pleasure that a special issue on “Technologies for Rural Development” has been prepared based on the selected papers of the “North-East Research Conclave” held at Indian Institute of Technology Guwahati, India, during May 20– 22, 2022. This conference was a great success wherein the papers from research communities with versatile areas were presented. The papers discuss on applications of technologies in different sectors like rural health, agro-, and food which are helpful for improvement of rural areas. I am quite confident that these papers will stimulate the researchers in the universities as well as practicing engineers in the industry to apply scientific techniques for development of the rural sectors. India has a tremendous potential in science, which, if oriented toward developing and building technologies, can boost up the growth of the rural sector and thereby the economy of the nation. I convey my heartiest thanks to the editors/reviewers and authors of the track for their contribution in making this issue successful.

xxi

Contents

Doubling Farmers’ Income through Promotion of Organic Farming at All Kling Dorbar, Ri Bhoi District, Meghalaya . . . . . . . . . . . . Saikat Majumdar, Gayatri Saikia, Sanjib Kumar Dutta, Papiya Dutta, and Lilika Zhimomi Induction of RNA-Mediated Resistance Against Cucumber Mosaic Virus on Exogenous Application of dsRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . Anindita Saikia, Gowtham Kumar Routhu, and Munmi Borah Ecosystem Restoration Through Natural Farming . . . . . . . . . . . . . . . . . . . . Tapan Senchowa, Pankhi Priya Neog, and Bidisha Boruah Study the Effects of Storage Temperature, Relative Humidity, and Packaging Material on the Shelf Life of the Milled Black Rice Packed in the Flexible Packaging Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Shashikumar, Siddhartha Singha, and Sudip Mitra Development of Web Page and Android Application for IoT-Enabled Agricultural System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Alok Kumar, Sushant, and Surajit Kundu Development of IoT-Enabled Multi-sensor Unit for Agricultural Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Arun Kumar, Arjun Mandal, Anusha Dogra, Prajjval Govil, Dheeraj Pandey, and Surajit Kundu

1

13 33

39

55

63

An Improved Gender Friendly Paddy Weeder Suitable for Hill Agriculture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sapunii Sebastian and Karuna Kalita

73

Market Assessment and Process Engineering of a Traditional Fermented Dairy Product: A Product for Rural Entrepreneurship . . . . . Vinny Kohli, Siddhartha Singha, and Neha Jha

81

xxiii

xxiv

Contents

Protective Role of Leafy Vegetables in Rural Areas: Critical Review of Biology and Processing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101 Esha Bala and Siddhartha Singha

About IIT Guwahati

Indian Institute of Technology (IIT) Guwahati established in 1994 has completed 25 years of glorious existence in 2019. At present, the institute has eleven departments, seven interdisciplinary academic centres, and five academic schools covering all the major engineering, science, health care, management, and humanities disciplines, offering B.Tech., B.Des., M.A., M.Des., M.Tech., M.Sc., and Ph.D. programs. The institute presently offers a residential campus to 435 faculty members and more than 7500 students at present. Besides its laurels in teaching and research, IIT Guwahati has been able to fulfill the aspirations of people of the northeast region to a great extent since its inception in 1994. The picturesque campus is on a sprawling 285 hectares plot on the north bank of the Brahmaputra, around 20 kms from the heart of the Guwahati city. IIT Guwahati is the only academic institution in India that occupied a place among the top 100 world universities—under 50 years of age—ranked by the Londonbased Times Higher Education (THE) in the year 2014 and continues to maintain its superior position even today in various international rankings. IIT Guwahati gained rank 37 globally in the “Research Citations per Faculty” category and overall 384 rank in the QS World University Rankings 2023 released recently. IIT Guwahati has retained the 7th position among the best engineering institutions of the country in the “India Rankings 2021” declared by the National Institutional Ranking Framework (NIRF) of the Union Ministry of Education. IIT Guwahati has been also ranked 2nd in the “Swachhata Ranking” conducted by the Government of India. Recently, IIT Guwahati has been ranked as the top-ranked university in 2019 for IT developers by HackerRank in the Asia-Pacific region. Among other frontier areas of research and innovation, IIT Guwahati is working toward augmenting critical science research initiatives in Genomics, Developmental Biology, Health Care and Bioinformatics, Flexible Electronics, Advanced Functional Materials, Sustainable Polymers, Rural Technologies, Renewable Energy, Artificial Intelligence, Disaster Resilience and Risk Reduction, and Water Resources and Management. In its silver jubilee year, IIT Guwahati is poised to scale newer heights through all-round growth and development.

xxv

xxvi

About IIT Guwahati

Indian Institute of Technology Guwahati has dedicated itself to the cause of improving and empowering Northeast India through cutting-edge research, region relevant projects, innovations, individual and multilateral collaborations, and special initiatives. Being the only IIT in the entire northeastern region, IIT Guwahati has an immense amount of responsibility to develop the region and empower the people of the region. While the entire country is celebrating the “Azadi ka Amrit Mahotsav”—75 glorious years of independence, and the great pride with which our nation of more than a billion people has been steadily growing today, IIT Guwahati is strongly committed to support that pace of growth for the entire NE so that we can keep pace along with the rest of the country. The specific areas of focus where IIT Guwahati has been contributing immensely to the region are: (a) Infrastructure development across multiple sectors (b) Providing solutions for multiple natural disasters such as recurring floods, landslides, earthquakes, cyclones, hailstorms, and other natural calamities (c) Improving the education sector and creating opportunities for employment (d) Internet, telecommunication, and cultural integration (e) Technological intervention in interdisciplinary areas (f) Healthcare services and education (g) Renewable energy generation (solar, wind, biomass, hydro, geothermal) (h) Overall industrialization, refining fossil fuels, and setting up biorefineries. Besides bringing in the state-of-the-art technical knowhow for most of the above sectors, the institute has been partnering with the local governments and enhancing the technological and educational interactions such that the next-generation youth are empowered with knowledge, skills, and necessary entrepreneurial ability. These measures in Assam as well as all other northeast states will usher in a new era of growth and the opportunities it will provide for interaction with the ASEAN countries as part of the Act East Policy of the Government of India will bring prosperity to this region. Prof. Parameswar K. Iyer Dean, Public Relations, Branding and Ranking Indian Institute of Technology Guwahati

About the Editors

Dr. Sanjukta Patra is currently Professor in Department of Biosciences and Bioengineering, IIT Guwahati and Head, School of Agro and Rural Technology, IIT Guwahati. Before joining IIT Guwahati in 2007, she obtained her doctoral degree in Biotechnology from the prestigious Central Food Technological Research Institute, Mysore. Professor Patra leads the “Enzyme and Microbial Technology Research Group” at IIT Guwahati which studies application of microbes and enzymes in different spectrums. She works in the domains of applications of microbes and enzymes for Industrial, Environmental, Therapeutics and Diagnosis. Further her work extends to utilisation of agro wastes for value added products, usage of macro fungi for edible and medicinal purposes. Till date, she has to her credit 14 sponsored International/National Projects, supervised 7 doctoral thesis and 14 M.Tech. dissertations. Professor Patra has to her credit 3 granted Patents, 51 Research Papers, 18 Book Chapters, 02 Databases and 61 conference presentations. She is the editorial board member of the Nature Publishing Group’s Journal Scientific Report and also reviewer of leading journals as PLoS One, Enzyme and Microbial Technology, Food Chemistry, Medicinal Chemistry, Biosensor and Bioelectronics, Amino Acids etc. Dr. Sudip Mitra a faculty of the School of Agro and Rural Technology (SART) and the founding Head of the Centre for Disaster Management and Research (CDMR) at IIT Guwahati. In his 22 years of professional career, he has been actively involved in climate change, adaptation and disaster risk reduction (DRR) research, policy and outreach. His present research looks at the climate smart agriculture and application of indigenous resources and technologies for the enhancement of rural livelihood. He is a Fulbright fellow and visiting Faculty at the University of California, Davis, USA. He served as a Task Force Member of MNREGA convergence of schemes under the Ministry of Rural Development, Government of India (2008); and as a member of the Global Technology Watch Group, TIFAC, Department of Science and Technology (DST), Government of India. He is an elected member of the National Academy of Science, India (NASI).

xxvii

xxviii

About the Editors

Dr. Siddhartha Singha is a Food and Bioprocess Engineer by training and working in the area of food and bio processing for the last 13 years. Currently he is working as Assistant Professor at School of Agro and Rural Technology at IIT Guwahati. He has work experience in NIFTEM-Ministry of Food Processing Industries, GoI and in Industries like Pepsico Holdings, Bridge2Tech. Dr. Singha’s core area of research is process optimization and scale up of traditional food products. He is active to bring the culture of innovation in Policy making, Institution building, human resource development and research especially in the area of food and nutritional security. He is part of various Government programs like RuTAG, DoNER, DBTSEED, DRDO futuristic technology program, NetProFan-FSSAI etc. and various stakeholder groups. As an advisor to different NGOs and Industries he contributes to the ecology of food entrepreneurship for sustainable usage of the natural resources and circular economy. Dr. Pankaj Kalita is Associate Professor, in the School of Energy Science and Engineering, Indian Institute of Technology Guwahati. He has more than 8 years of teaching and 16 years of research experience in the field of renewable energy. He has published more than 60 peer reviewed research papers in various reputed journals, 15 book chapters and more than 25 conference papers. He is a recipient of India Distinguished Visiting Fellow awarded by the University of Nottingham, United Kingdom in the year 2010. He has been awarded early career research award by Science Engineering Research Board (SERB), DST, Government of India. He has successfully implemented seven research projects and twelve consultancy projects funded by different government and private agencies in various fields of renewable energy. At present two research projects funded by SERB Government of India and ASTEC, Government of Assam are in progress in the areas of renewable energy integration for remote electrification, and solar drying. His current areas of research include solar energy conversion, thermochemical and biochemical conversion, energy management, energy storage (li-ion and thermal energy) and integration of renewable energy for remote electrification. He has also offered one NPTEL moocs on solar energy engineering and technology which is available in YouTube.

Doubling Farmers’ Income through Promotion of Organic Farming at All Kling Dorbar, Ri Bhoi District, Meghalaya Saikat Majumdar, Gayatri Saikia, Sanjib Kumar Dutta, Papiya Dutta, and Lilika Zhimomi

Abbreviations PRA HQFTLC FGD ICT NABARD NGO

Participatory Rural Appraisal High Quality Farmers Training at Low Cost Focus Group Discussion Information and Communications Technology National Bank for Agriculture and Rural Development Non-governmental organization

1 Introduction Chemical fertilizers have aided farmers in increasing crop production since the 1930s. Despite the fact that the chemical fertilizers increased crop yield by manifolds, the harmful effects of chemical fertilizers cannot be ignored. It includes water pollution, chemical burn to crops, air pollution, depletion of the soil, etc. [1]. Organic farming is a method of farming system which primarily aimed at cultivating the land and raising crops in such a way, as to keep the soil alive and in good health by use of organic wastes (crop, animal and farm wastes, aquatic wastes) and other biological materials along with beneficial microbes to release nutrients to crops for increased sustainable production in an eco-friendly pollution-free environment [2]. Organic

S. Majumdar (B) · G. Saikia · S. K. Dutta · P. Dutta · L. Zhimomi Department of Rural Development, University of Science and Technology, Techno City, India e-mail: [email protected] © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 S. Patra et al. (eds.), Technologies for Rural Development, https://doi.org/10.1007/978-981-19-8513-3_1

1

2

S. Majumdar et al.

farming is a kind of farming where biological entities are used as inputs for sustainable agriculture. It is a holistic approach of farming [3]. Vermicompost is a key input in organic nutrient management [4]. The research work was conducted at the Jorbil villages, Ri Bhoi District, Meghalaya. Group interview, interviewing, focus group discussion, listening, use of secondary data, PRA method (problem tree for problem identification), observation (both participant and non-participant), and categorization and prioritization of needs have been used for collection of data. In this research paper, the following research questions have been pointed out. 1. What are the present infrastructures and whether these are sufficient for organic farming? 2. What infrastructures are needed to develop the agricultural sector through organic Farming? 3. Whether the organic farming creates any impact on productivity, cropping pattern, marketed surplus, and diversification of crops?

1.1 Statement of the Problem The farmers are not ready to take the risk to cultivate organically. The performance of the agricultural sector influences the standard of living of farm households. Though agriculture is the dominant sector of this district, it is necessary to improve the farmers’ income through organic farming [5].

1.2 Objectives 1. To promote the organic farming in the proposed research area 2. To enhance marketable surplus from the existing level up to 70% by providing High Quality Farmers Training at Low Cost (HQFTLC) and to reduce the cost of agricultural production 3. Doubling farmers’ income through organic farming.

Doubling Farmers’ Income through Promotion of Organic Farming …

3

2 Methodology 2.1 Study Area The study have been carried out in All Kling Dorbar, Ri Bhoi District, Meghalaya. According to 2011 Census, total area of Umling is 600 km2 including 553.63 km2 rural area and 46.00 km2 urban area. Umling has a population of 87,021 people. There are 15,776 houses in the sub-district. There are about 220 villages in Umling block, and All Kling Dorbar is one of the villages under it. The major populations inhabiting the All Kling Dorbar are the tribal groups of the Garo, the Khasi, and the Jaintia. The dorbar consists of 12 villages, namely Umlangpur, Hatimara, Bara Kling, Upper Jorbil, Chota Kling, Noksikgitham, Model Village, Umduba, Umnowe, Khasi Kling, and Abri Village. Out of these 12 villages, 10 villages have been selected for the research.

2.2 Selection of Sample The present study consisted of 100 sample households, of which 50 samples were taken from the developed area and the rest 50 were taken from the underdeveloped area. The sample households under the developed and underdeveloped areas were collected by using multistage random sampling procedure. In the first stage, Ri Bhoi District was selected purposively. Then, one developed village and one underdeveloped village were selected randomly from the district. In the third phase, 10 villages were selected randomly, and finally, from each village, 5 sample households were selected randomly. Developed area The area within 10 km radius from the main/connecting road is considered as a developed area in this study. The information on various parameters from the sample farmer of this area was collected to see the status of the farmer in developed area, i.e. area having good road network. Underdeveloped area The area that is 15–20 km away from the main/connecting road is considered as an underdeveloped area in the study. The information on various parameters from the sample farmer of this area is collected to see the status of the farmer in underdeveloped area, i.e. area which does not have good road network. The study location See Fig. 1.

4

S. Majumdar et al.

Fig. 1 Study location: all Kling Dorbar, Ri Bhoi District, Meghalaya

2.3 Stakeholders Primary Stakeholders: Small farmers (land holding less than 1.5 acre) and any interested small farmers of the project area. Secondary Stakeholders: Unemployed youths of the project area, crop sellers, and consumers of the project area. Key Stakeholders: Implementing agents and member farmers of the village area.

Doubling Farmers’ Income through Promotion of Organic Farming …

5

2.4 Data Collection and Analysis Tools of data collection: The data have been collected from focus group discussion, PRA method (problem tree for problem identification), observation (both participant and non-participant), and categorization and prioritization of needs. Situation analysis: Generated information was also recorded under the following heading: a. b. c. d. e. f. g.

Historical profile of the project area Social mapping Institutional arrangement Income of the farm families Economic status of the farmers Migration pattern Livelihood context comprising of basic information about assets (natural, physical, social, economic, human), standard of living.

After further brainstorming and applying various tools, the major findings regarding the situation in the area were: a. Fragmented landowners due to population pressure and cross-border migration. b. Degraded soil cannot support adequate yield to subsist the community. c. Farmers are still practising mono-cropping in the area due to the lack of irrigation in the area. d. Use of chemical fertilizers in high doses (more than the required amount) and use of chemical pesticides and herbicides increase the cost of production. e. The villagers are forced to engage in other contributory occupations which are less profitable and insufficient to support their family expenses. They are compelled to migrate to nearer cities or nearby towns for searching jobs (such as brickfield labour, stone crusher factory, masonry work, and casual labours in factories). This makes their family more vulnerable. f. Villagers were suffering from malnutrition due to a lack of access to nutritious food. These were the recognized problems of that community. The problems were grouped as: a. Use of high doses of chemical fertilizer, pesticides, herbicides, etc. b. Low agricultural production leads to food insecurity c. High rate of migration due to food insecurity.

6

S. Majumdar et al.

Problem identification After the survey, several group meetings have been conducted with local people in the presence of Panchayat members and NGO representatives, and all the social problems were identified. The problems include: Poor farming knowledge Unavailability of irrigation facilities Degrading soil fertility Migration Small land holding Poor economic status, political conflict, etc. Problem prioritization This was complemented and cross-checked by interaction with key informants. The PRA tools were used to generate relevant information regarding the problems and local resources and also for prioritization of the problems. Among the PRA tools, the ‘Head and Tail Method’ was adopted for prioritizing the problem. The villagers were requested to give scores against each of the problems with the help of drawing large to small circles in an art paper depending upon the problem. After prioritizing, the problems are as follows: Degrading soil fertility Poor economic status Unavailability of irrigation facility Migration No electricity Poor farming knowledge Political conflict. So, from the above prioritization, it has been identified that the degrading soil fertility is the biggest problem of the area. But as the issue is a far greater as well as policy-making issue, the research has been emphasized on the ‘Promotion of farm income through organic farming’ in the village. The following problem tree was prepared by the villagers (Tables 1, 2, 3 and 4).

Doubling Farmers’ Income through Promotion of Organic Farming … Problem tree

7

Retardation of Economic Growth

Low Capital formation

Lack of social security to the family members Low output from agriculture farms Migration

Low savings

People are avoiding agriculture profession

Unemployment

Poor Economic Status

Effect Low output in Agriculture sector

Cause

Degraded Soil Fertility

Small Land Holding

High production cost Unavailability of irrigation water High price of chemical fertilizer, pesticide etc

High usage of Chemical fertilizer, pesticide etc

No electricity and Cannel

Lack of marketing facility

Unavailable loan at low interest

Lack of training on organic farming, applications of ICT and Post harvest management

Fragmented family

Huge population pressure 8

Chemical fertilizer

3 Conclusion From the present research, following conclusions may be drawn as: Organic farming helps

8

S. Majumdar et al.

Table 1 Stakeholder analysis Interests

Likely impact of the project

Priority

Farmers

Knowledge and skill development

++++

I

Any interested unemployed persons

Skill development

++

III

Stakeholders Primary stakeholders

Secondary stakeholders

Key stakeholders

Crop sellers

Increase in production ++

III

Consumers

Low price and better quality of the commodity

+++++

II

Transporter

Increase frequency of transport

+

IV

Retailers

Increase in profit

+

III

Implementing agents

Improved service delivery

++

II

Development of the society

+++

II

Table 2 Importance and influence High I

1

7

M

8

1 2

Farmers Unemployed Youth

3 4 5 6 7

Crop sellers Consumers Transporter Retailers Implementing agents

P

6

O

6 5

R

2

T A N

9

C E

Low

High

Low

I

N

F

L

U

E

N

C

E

1. Increase income of farm family through organic farming, which is sustainable in nature. 2. Reduce production cost. 3. Decrease diseases and pest attack. 4. Increase soil fertility.

Doubling Farmers’ Income through Promotion of Organic Farming …

9

Table 3 Logical framework

(continued)

10 Table 3 (continued)

S. Majumdar et al.

Doubling Farmers’ Income through Promotion of Organic Farming …

11

Table 4 Activity calendar (Gantt chart) Duration(in months) Activities

Jan

Feb

Mar

Apr

May

Jun

Jul

Aug

Sept

Oct

Nov

Dec

A1 A2 A3 A4

Monitoring

Declaration This is to certify that all the materials pertaining to the topic ‘Doubling Farmers’ income through promotion of Organic Farming at All Kling Dorbar, Ri Bhoi District, Meghalaya’ is a genuine and bona fide research work, and no part of this research work has been published earlier in any journal and book. Thank you, Saikat Majumdar Assistant Professor Department of Rural Development University of Science and Technology, Meghalaya

References 1. Zhangab H, Wanga B, Xua M (2008) Effects of inorganic fertilizer inputs on grain yields and soil properties in a long-term wheat-corn cropping system in South China. Commun Soil Sci Plant Anal 39(11–12):1583–1599 2. Pradhan AM, Bista C, Manivannan DS (2015) An alternative source of livelihood: socioeconomic analysis of organic vegetable growing in Nepal: a case study. Int J Sci Res (IJSR) 4(4):924–928 3. Badgley C, Moghtader J, Quintero E et al (2007) Organic agriculture and the global food supply. Renew Agric Food Syst. 22(2):86–108 4. Ikerd J (1993) Two related but distinctly different concepts: organic farming and sustainable agriculture. Small Farm Today 10(1):30–31 5. Carlier L (2005) Organic farming: back to the past or the solution for a sustainable agriculture— Chance and challenge for the Bulgarian and Romanian agriculture. In: Paper presented at: Organic farming: CAP Conference. Sofia, Bulgaria

Induction of RNA-Mediated Resistance Against Cucumber Mosaic Virus on Exogenous Application of dsRNA Anindita Saikia , Gowtham Kumar Routhu , and Munmi Borah

Abbreviations °C % AGO bp cDNA cm CMV CP Dae Dat DNA Dpi ds E. coli Gm h IPTG kb Fig. LB

Degree centigrade Percent Argonaute Base pairs Complimentary DNA Centimeters Cucumber mosaic virus Coat Protein Days after emergence Days after treatment Deoxy nucleic acid Days post inoculation Double-stranded Escherichia coli Gram Hour Isopropyl-b-thiogalactoside Kilobase Figure Luria-Bertani

A. Saikia (B) · G. K. Routhu · M. Borah Department of Plant Pathology, Assam Agricultural University, Jorhat, Assam, India e-mail: [email protected] G. K. Routhu e-mail: [email protected] M. Borah e-mail: [email protected] © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 S. Patra et al. (eds.), Technologies for Rural Development, https://doi.org/10.1007/978-981-19-8513-3_2

13

14

M min ml mm mM μ mRNA ng nt PCR PTGS RT RT-PCR TE

A. Saikia et al.

Molar Minute Milliliter Millimeter Millimolar Micro (10–6 ) Messenger ribonucleic acid Nanogram Nucleotide Polymerase chain reaction Post-transcriptional gene silencing Reverse transcription Reverse transcription-polymerase chain reaction Tris EDTA

1 Introduction Ghost pepper (Capsicum chinense Jacq.), an interspecific hybrid of Capsicum chinense and Capsicum frutiscens, is one of the world’s hottest chilies and is widely produced in the northeastern states of India [8, 53]. Capsaicin, the main component of the aromatic Capsicum fruit, exhibits a wide range of bioactive effects in humans. The species has many culinary purposes and medicinal properties. Capsaicin, for example, is used to treat the pain of peripheral neuropathy [1] and has the ability to inhibit a wide range of cancer cells [2, 34]. It has also been demonstrated to have anti-inflammatory and antioxidant properties [2, 50]. Despite its commercial significance, the ghost pepper, like other species of Capsicum, is under threat by a number of plant diseases that limit production quality and quantity. CMV is a common viral disease that affects ghost peppers and other Capsicum species, causing a yield loss of around 55–60% [7, 6, 49]. Researchers in Assam identified CMV symptoms in ghost pepper fields and validated the diagnosis using Double Antibody Sandwich-ELISA (DAS-ELISA) techniques and reverse transcription PCR (RT-PCR) [3, 6]. The Cucumber mosaic virus belongs to the family Bromoviridae and genus Cucumovirus which is vectored by aphid species in a non-persistent manner [38]. It has the broadest host range of any RNA virus, making it one of the most commercially significant plant viruses in the pepper industry [55]. CMV induces systemic infection in the majority of host plants,however, some crops, such as alfalfa, may remain symptomless. CMV symptoms vary based on the crop affected and the maturity of the plant at the time of infection. CMV is transmitted in the field by aphids in a non-persistent way by over 86 aphid species [15], as well as by seed in some hosts [36, 62]. As a result, managing a CMV outbreak in the field is challenging [18].

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

15

CMV is a single-stranded positive sense and has a tripartite genomic (RNAs 1, 2, and 3), as well as two sub-genomic RNA segments which are RNA4 and RNA 4A, respectively. RNA1 and 2a protein (an RNA-dependent RNA polymerase) encoded by RNA2 is an essential component of the replicase complex [20, 43]. RNA 2 encodes the 2b protein, which is involved in the long-distance movement from cell to cell in a host-specific manner [12], post-transcriptional gene silencing (PTGS) suppression [9], and symptom severity [13]. RNA3 encodes for two proteins that are 3a and 3b, with 3a serves as movement protein (MP) aids in cell-to-cell movement and 3b serving as a coat protein (CP). These proteins are involved in a variety of processes, which include virus assembly, aphid-mediated transmission [39], and cell-to-cell and vascular movement [10, 51]. The CMV isolates may be grouped into two main groups, I and II, based on the results of several investigations, including sequence similarity peptide mapping, serological data, and nucleic acid hybridization [39, 43]. Isolates from Group I are further subdivided into two groups, viz., IA and IB [33]. All of these factors are substantial obstacles to the successful control of viruses, including CMV, notably the lack of resistance genes in plants that present naturally, the emergence of new virus strains, and the escalating resistance of viral vectors to pesticides [32]. The resistance provided by RNA interference against viruses is based on transgenes, expressing RNA homologous to the target virus, on the other hand, can be an efficient and dependable strategy for viral disease management [27, 42]. Exogenous application of in vitro or in vivo-produced double-stranded RNA (dsRNA) molecules of a viral gene can offer resistivity against plant viruses such as TMV, PVY, ZYMV, and CMV, among many others [7, 25, 29, 54, 64, 52]. RNA interference (RNAi) is described as a sequence-specific process that occurs in the cytoplasmic space of eukaryotic cells that specifically targets the degradation of post-transcriptional mRNA [4]. RNAi is a well-known gene-regulated process that promotes growth, development, and host defense against viruses and transposons [14, 56]. RNA interference (RNAi) has been a reliable technology and effective strategy for engineering disease resistance in plants against fungi, viruses, viroids, nematodes, and insect pests [32, 44]. The identification of introduced double-stranded RNA (dsRNA) structures, which are then processed into 21–24 nucleotide RNA duplexes (also known as siRNA or short-interferring RNA) by a DICER-LIKE RNase III enzyme, initiates RNA silencing actions (Bernstein et al., 2001). The RNA duplex is loaded into the RNA-induced silencing complex (RISC) and acts together with the Argonaute (AGO) protein. One strand of siRNA is chosen which is the guide strand that serves to identify and target homologous mRNAs by complementary base pairing [19, 30]. Pairing the guide strand with the target mRNA and subsequent enzyme activity results in mRNA cleavage [37, 40]. A non-transgenic strategy was used in this study to inhibit aphid-mediated transmission of CMV and induction of resistance against CMV in ghost pepper since transgenic procedures are timeintensive, expensive, and have many concerns related to public and societal fronts.

16

A. Saikia et al.

2 Materials and Methods 2.1 Virus Isolate, Bacterial Strains, and Plant Material CMV S1, a viruliferous isolate of CMV, was obtained from the ghost pepper (Capsicum chinense Jacq.) plant exhibiting typical symptoms like filiform leaves and mottling of leaf, and chlorosis of leaf collected from the infected fields of Jorhat, Assam, was used in the study. The isolate is preserved and maintained through repeated sap inoculations on healthy ghost pepper plants. The bacterial strain used in the present study for in vivo production of dsRNA molecules was an E.coli strain HT115 (DE3), which contains RNase III gene disrupted by Tn10 transposon including a tetracycline marker and also inducible IPTG T7 RNA polymerase gene. For all other transformation works, E.coli strains, DH5α, were used. The bioassay tests were performed on healthy ghost pepper plants. Seeds were sown in portrays, and young plantlets of the two-leaf stage were transplanted in plastic disposable glasses. Plantlets were placed in greenhouse conditions at the Department of Plant Pathology, AAU, Jorhat.

2.2 Characterization of Coat Protein (CP) Gene Corresponding to CMV To obtain Coat Protein (CP) gene corresponding to CMV, total RNA was extracted from the ghost pepper plants artificially infected with CMV isolate (Accession no.OM654026.1), as a procedure followed by [63]. One-step RT-PCR was performed with gene-specific primers (CMV S1 forward—CGACCATTAATAGACCG, CMV S1 reverse—ATCTACTGGCGTGGGTTCTT) to obtain the cDNA fragment (610 bp) containing the Coat Protein gene [45]. From the isolated RNA, one-step reverse transcription PCR was conducted using a PrimeScript. One-step RT-PCR kit (Takara) is with a reaction mixture that included 0.5 μl of reverse transcriptase enzyme, 6.25 μl of PrimeScript RT buffer, 0.5 μl of 10 picomole forward and reverse primers, 1 μl of extracted RNA, and the final volume was adjusted to 10 μl by adding 1.25 μl of RNase-free water. The CP gene detection PCR protocol comprised 5 °C for 30 min, 94 °C for 3 min initial denaturation steps, 35 cycles of denaturation (94 °C for 30 s), annealing (54 °C for 45 s), and extension (72 °C for 45 s), and a final extension step at 72 °C for 8 min. After PCR, the amplified products were electrophoretically loaded onto a 1.2% (W/V) agarose gel stained with Ethidium Bromide dye in a 1X TBE buffer and visualized using a gel documentation system (BioRad, USA). Positive 610 bp amplicons were eluted with the sterile blade, purified with the NucleoSpin Gel and PCR clean-up kit, and cloned into the pJET 1.2 vector (Addgene) according to the manufacturer’s instructions. After ligation with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) into the pJET vector, the clones were transformed into competent cells of the DH5α strain of Escherichia coli (E.coli). Following cloning,

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

17

the recombinant clones were screened using restriction digestion analysis with the Bgl II restriction enzyme (New England Biolabs, Ipswich, MA, USA), preceded by gel electrophoresis on 1.3% agarose gel containing ethidium bromide. Sequencing was performed on the positive clones using gene-specific primers. The sequencing results were analyzed with NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and compared to other CMV strains in the GenBank database. The CMV-CP gene sequence was submitted to the NCBI database, and a unique accession number was assigned (Accession no. OM654026.1). For determining the genetic diversity between the isolated sequence and other isolates around the world, phylogenetic analysis was used. The phylogenetic inference was performed using the conserved CP region of CMV isolates using MEGAX software, and evolutionary distance was measured using the p distance method.

2.3 Production of dsRNA Corresponding to CMV-CP Gene The pre-digested PCR product was sub-cloned into a L4440 plasmid vector (plasmid Addgene 1654) manufactured by Andrew Fire for in vivo production of dsRNA (Carnegie Institution of Science, Washington, USA). The excised PCR product was ligated into a L4440 vector using T4 DNA ligase and T7 express competent. E.coli cells were transformed using CaCl2 standard transformation protocols. Using Bgl II and Sal I restriction enzymes, the plasmid product was validated through restriction digestion analysis (New England Biolabs, Ipswich, USA). dsRNA was produced by inducing T7 RNA polymerase in the plasmid vector with IPTG (-d-1thiogalactopyranoside) at a final concentration of 4μM in liquid Luria-Bertani (LB) medium, following confirmation of sub-cloning. The obtained cultures were pelleted and suspended in 1XTE buffer before being frozen at -20 degrees Celsius to form dsRNA molecules.

2.4 Induction of Resistance Against CMV by Seed-Applied dsRNAs The seeds were extracted from a healthy ghost pepper (Capsicum chinense Jacq.) fruit for the experiment. The seed was collected, rinsed, and kept in an airtight container. The seed was treated with dsRNA CMV-CP (RNA vaccine) by administering 2 ml of dsRNA at a concentration of 500 ng/μl to the seed and leaving it for 20–30 min. The seeds were then sown in the pots, three to four seeds per pot, and then covered with vermicompost and sterilized soil mix. It took around 15–20 days for the seeds to sprout. The plants were subjected to CMV challenge inoculation 40 days after emergence (dae) where CMV was mechanically inoculated in phosphate buffer in the ghost pepper plants. The sets of CMV source plants were kept, and the fresh

18

A. Saikia et al.

Fig. 1 Application of dsRNA as seed treatment followed by challenged inoculation of CMV

inoculum from those plants was used. DAS-ELISA was used to test the efficacy of the CMV-CP-specific RNA vaccination at 21 dpi. To check for efficacy, a set of mock plants was also maintained receiving only water and CMV as challenged inoculation. The experiments were conducted to determine the utility and efficacy of exogenously administered dsRNA for viral disease resistance. Each experiment had three replications with five units in each replication. Symptom expression studies were made in regular intervals of 7, 14, and 21 dpi (Fig. 1). DAS-ELISA was employed (detecting CMV-CP) at 21 dpi to validate the protective effect of dsRNA molecules on ghost pepper against CMV. The DAS-ELISA was carried out according to a previously disclosed modified methodology [21]. Anti-CMV IgG was coated in the wells of the plates (Bioreba AG Switzerland) at a concentration of 1.0 mg mL−1 and incubated for 4 h at 37 °C. Between each incubation phase, plates were washed with PBS containing 0.05% Tween 20 (PBS-T). ELISA plates (Bioreba AG Switzerland) were coated (200 μl per well) with sap extracts of seed-treated plants and control sets of plants at a 1:20 dilution (w/v) in 0.05 M carbonate buffer, pH 9.6 [11] along with positive and negative control and kept for incubation at 4 °C overnight. Conjugate diluted 1/500 in PBS-T was added and incubated at 37 °C for 5 h. The substrate was incubated at room temperature for 1 h 45 min. The results were recorded using the mean absorbance readings of the wells loaded with each sample. To test the effect of dsRNA between both the treatments, the symptom disease scores were calculated from all the replications and data were analyzed through students t test.

2.5 Identification and Rearing of CMV Vectors As almost around 86 species of aphids are responsible for the transmission of the Cucumber mosaic virus in crops, it is important to identify the most common and efficient species of aphids which are responsible to transmit the disease.

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

2.5.1

19

Insect Collection and Species Identification

Fields of ghost pepper (Capsicum chinense Jacq.) were surveyed, and vectors of CMV were collected in vials and proceeded for species identification. By microscopic observation, vectors of CMV were identified.

2.5.2

Rearing, Sub-culturing, Handling, and Maintenance of Aphids

Ghost pepper plants were grown in 6 cm wide pots in soil and vermicompost mix media under shade net house conditions at a mean temperature of 25 °C under natural light. Plants were watered on a constant schedule. An aphid cage was built for aphid rearing, and plants were maintained inside at 26 °C, 65% humidity, and a 16/8 h light/dark cycle. Myzus persicae and Aphis gossypii colonies were maintained on ghost pepper plants under the same growing circumstances. Because most viruliferous aphids do not transmit the virus to their offspring, non-viruliferous aphids can be raised from the young. Because young nymphs are thought to be effective viral transmitters, 3–4 day-old nymphs were chosen for the studies. They are sub-cultured to maintain a consistent supply of wingless (apterous) aphids of comparable age. The 10–15 apterous adults (8–9 days old) will be planted on healthy plant sets produced specifically for aphid rearing. The aphids are allowed to mature and begin their life cycle by laying eggs and producing nymphs. Following that, the following generation of nymphs was used in multiple experiments (Fig. 2). Aphids were starved before allowing to feed on as it aids in faster transmission of the virus. The aphids are moved from virus-free stock plants to vials for around 2 h to starve them. Aphids will be picked up with a moist brush and placed in a Petri plate before being transferred to the CMV source sets of plants. Aphids will be permitted to probe with an acquisition feeding period of 10 mins followed by an inoculation period of 5 mins. Aphids will then be transferred to the leaves and allowed to probe

Fig. 2 Rearing and sub-culturing of aphid species

20

A. Saikia et al.

as per the experiments. Following that, the symptoms will be evaluated, as well as the disease severity, infection rate, and efficacy of the CMV-specific RNA vaccine.

2.6 Aphid-Mediated CMV Transmission in Seedling Experiment Ghost pepper (Capsicum chinense Jacq.) seedlings were sprayed with dsRNA CMVCP (n = 9) in three replicates. Another set of ghost pepper seedlings was maintained receiving no treatment (n = 9) in three replicates (Fig. 3). The concentration of used dsRNA is 500 ng/μl. Aphids were allowed to feed on the CMV source plants, and 5 aphids were introduced to each plant 5 days after the spraying (vaccinated), including the mock (non-vaccinated) treatment, and were allowed to roam among the plants for 7 days. At 7, 14, and 21 days after aphid placement, the manifestation of symptoms, the percentage of infection, and the severity of the disease were all documented. Individual leaves were collected 21 days after aphid placement and subjected to semi-quantitative RT-PCR.

3 Results The anticipated amplicon size of leaves obtained from ghost pepper plants tested for CMV infection was around 610 bp (Fig. 4). The 610 bp PCR product was successfully purified, ligated into the pJET vector, and transformed into E. coli cells of the DH5α strain. The cloned product was sequenced, and the results were evaluated using BLASTn to locate CMV sequences that matched the subgroup IB type of CMV. The isolated CMV-CP had 99.67% similarity with the CMV isolate from Jorhat (MZ219645.1) when the sequence of the CMV-CP region of Teok sample (OM654026.1) was compared to the other NCBI database sequences in BLASTn. The amino acid sequences of 15 closely related cucumoviruses were used in a phylogenetic study (Fig. 5). MZ219645.1 and MZ219646.1, CMV isolates reported to infect Cucurbita moschata in Jorhat and Gosaigaon, respectively, established a closer cluster with CMV-CP of Teok, Assam, (OM654026.1). The CP gene was successfully sub-cloned into the L4440 vector and validated by restriction digestion by isolating the vector and gene of interest (Fig. 6). IPTG at a final concentration of 4 μM was used to induce the T7 RNA polymerase in L4440 vector-containing cells, resulting in the synthesis of dsRNA. The resulting product was validated by gel electrophoresis (Fig. 7), which was employed as an experiment to investigate the effect of dsRNA on ghost pepper plants for inhibiting the transmission of CMV. The dsRNA product was spectrophotometrical, and a concentration of 500 ng/μL was used. After that, a challenged inoculation was performed where CMV was mechanically inoculated in both the treatments. After inoculating the plants with

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

21

Fig. 3 a Vaccinated plants receiving CMV source aphids; b non-vaccinated plants receiving CMV source aphids in seedling experiment

CMV (T1) and dsRNA-CP+CMV (T2—seed treatment), the plants were visually evaluated for CMV symptoms to measure the infection percentage at 7, 14, and 21 dpi. In all of the treatments, symptom rating was used to assess the severity of viral symptoms. In the control groups, mild symptoms were reported; however, in the dsRNA-treated seedlings, no symptoms were recorded. T1 began to exhibit mottling symptoms and mosaic patterns after that, and the symptoms were completely exhibited at later days (14–21 dpi). Leaf curling, filiform leaf, crinkling of leaf, and stunted development were also observed (Fig. 8). Only a few infected plants showed

22

A. Saikia et al.

L

500 bp

1

2

3

610 bp

Fig. 4 Agarose gel electrophoresis showing amplification of CMV-CP gene. Lane L: 100 bp DNA ladder; Lanes 1 to 3: CMV-infected ghost pepper (Capsicum chinense Jacq.) sample

Fig. 5 Phylogenetic analysis of isolated CMV-CP gene from Assam (red triangle) with some selected NCBI database sequences of CMV around the world. The numbers at nodes represent the bootstrap percentage score out of 1000 replicates

moderate symptoms of mottling in T2 which was seed treatment (dsRNA-CP+CMV), and no additional infection was seen. At 21 dpi, the plants under T1 (CMV) and T2 (dsRNA-CP+CMV) exhibited typical CMV symptoms, indicating that the dsRNA-CP-treated plants were more resistant to CMV infection (Fig. 9). The plants were exposed to DAS-ELISA at

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

23

Fig. 6 Agarose gel electrophoresis showing restriction digestion analysis of CMV-CP gene. Lane L: 1 kb DNA ladder; Lanes 1 and 2: restriction digested product; Lane P: undigested plasmid product Fig. 7 In vivo production of double-stranded RNA (dsRNA) to be used for exogenous application on ghost pepper for inhibition of CMV transmission. Lane L: 1 kb DNA ladder; Lane 1: dsRNA from CP region of CMV derived from E.coli upon induction with IPTG; Lane 2: plasmid product without induction of IPTG

L

1000 bp

1

2

24

A. Saikia et al.

Fig. 8 Characteristics symptoms of CMV on ghost pepper (Capsicum chinense Jacq.). a Bumpy appearance on leaves; b shoe string or filiform leaves; c mosaic and mottling of leaves; d stunted and deformed growth

Fig. 9 Induction of resistance against CMV by seed treatment of dsRNA. a. Vaccinated plants (T1—seed treated); b non-vaccinated plant (T2—mock)

21 dpi, and it was discovered that the average percent disease index of CMV on ghost pepper was 82.66 in non-vaccinated plants (T1), but only 21.33 in seed treated with dsRNA plants (T2), confirming the effectiveness of CMV-specific RNA vaccination against CMV infecting ghost pepper crop in Assam. In this thorough investigation, DAS-ELISA found low viral antigen titer in dsRNA-treated ghost pepper plants with low CMV symptom severity. All plants under CMV treatment were found to be positive for ELISA at 21 dpi. The dsRNA-treated seedlings at 21 dpi showed an infection percentage of 20–25% based on ELISA results. The obtained ELISA results were correlated with visual symptoms of all the treatments. To test the effect of resistance obtained through dsRNA molecules on ghost pepper plants, the OD405 values of ELISA were statistically analyzed. From student t test analysis, OD405 values from both the treatments were found to be significantly different from each other. The P values (P value— 0.05) for all the experiments were 0.032, 0.025, and 0.007, respectively, stating that the treatments were significantly different from each other (Table 1). Statistical analysis for student t test was performed using RStudio software (http://www.rstudio. com/) with the level of significance at P as 0.005. The findings showed that dsRNA CMV-CP was successful in suppressing CMV infection in ghost pepper.

Induction of RNA-Mediated Resistance Against Cucumber Mosaic … Table 1 Student t-test analysis for testing the efficacy of dsRNA molecules in inhibiting transmission of CMV

25

Experiment

Mean

Standard deviation

P value

Experiment 1

0.96640

0.67074

0.032

Experiment 2

0.93100

0.59621

0.025

Experiment 3

1.25800

0.55750

0.007

Vectors of CMV were identified by microscopic observation. Over 80 species of aphids have been found as vectors in CMV transmission, and both of the identified species which are Aphis gossypii and Myzus persicae are acknowledged as good viral disease transmitters; hence, the two species of aphids were chosen and reared for further experiments (Fig. 10). Aphis gossypii is a serious cotton pest in the tropics. It is found practically everywhere and is especially widespread in the tropics. Aphis gossypii females are normally medium-sized and blackish-green or dark green speckled with a lighter green. They are smaller in hot weather or when crowded, and these dwarf forms are a very pale whitish-yellow in color. There are no dark sclerotized marks on the dorsum. Siphunculi are typically black, although, in dwarf form, they can be light with dark tips. The siphunculi are 1.3–2.5 times the length of the cauda. The cauda varies in color from pale to dusky to black, although it is generally paler than the siphunculi and has 4–8 hairs. The antennae are divided by five or six segments. The green peach aphid, Myzus persicae (Sulzer), is present all over the world and is considered a pest mostly because of its propensity to transfer plant viruses. Apterous Myzus persicae are light green to yellowish-green, with convergent frontal tubercles and cornicles that are fairly lengthy and light-colored. Winged (alate) aphids have a black head and thorax and a yellowish-green abdomen with a large dark patch dorsally with clear appendages. They measure 1.8–2.1 mm in length. The cauda is pale, digitated, and transparent in color. Myzus persicae alate has a light green abdomen with a black patch notched laterally and perforated, conspicuous and

Fig. 10 Microscopic observation of CMV vectors. a Aphis gossypii; b Myzus persicae

26

A. Saikia et al.

Fig. 11 Agarose gel electrophoresis showing amplification of CMV-CP gene. Lane L: 1 kb DNA ladder; Lane P: positive control; Lane N: negative control; Lanes 1–9: ghost pepper sample of seedling experiment (vaccinated); Lanes 10–18: ghost pepper sample of seedling experiment (nonvaccinated)

convergent frontal tubercles, long and pigmented antennae, cornicles long, dark, and swollen (on secondary hosts). Since exogenously administered CMV-CP dsRNA offered the most efficient protection, a seedling experiment using CMV-CP dsRNA was performed to test for the inhibition of aphid-mediated transmission. A seedling experiment was conducted to determine if whole ghost pepper (Capsicum chinense Jacq.) plants could be protected from aphid-mediated inoculation and resulting systemic infection with CMV, starved aphids were placed on non-vaccinated and vaccinated sets of plants after being fed on CMV source plants. At 21 days post-aphid placement, it was subjected to RT-PCR, and it was revealed that seven out of nine plants were infected with CMV, whereas only three were found to be positive from the vaccinated plants, showing that CMV-specific RNA vaccine can protect the plant from aphid-mediated CMV transmission. The plants were regularly monitored in between, and CMV symptom expression has been studied in the interval of 7, 14, and 21 dpi. It was found that 77.77% of the unvaccinated plants were infected, and only 33.33% of vaccinated plants were found to be infected (Fig. 11).

4 Discussion In terms of crop productivity and yield, plant viruses cause a significant loss every year, which raises concerns about their impact on global food security. Pathogenderived resistance has been utilized successfully to create virus-resistant plants by transforming plants with pathogen-derived genes [5, 26, 31]. Historically, the principle of pathogen-derived resistance (PDR) has been closely linked with the genetic manipulation of plants to produce transgenic resistance [47]. The first pathogenderived resistance described was in transgenic tobacco against the tobacco mosaic virus (TMV) as coat protein-mediated resistance [41]. Utilizing RNA interference (RNAi) technology has proven to be the most reliable and effective method for inducing virus resistance in plants [16, 42, 44]. Utilizing transgenic techniques,

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

27

RNAi was produced in plants to confer pathogen-derived resistance to invading plant viruses [48, 58]. Transgenic Nicotiana benthamiana plants expressing the CMV replicase gene and other RNA sequences were found to be CMV-resistant [49]. Due to growing concerns regarding the potential negative environmental effects of transgenic crops, the present study aimed to develop safe and effective techniques for non-transgenic antiviral resistance against CMV in Capsicum chinense Jacq. This investigation employs a non-transgenic RNA-based vaccine that has been shown to be effective against invading plant viruses such as TMV, ZYMV, and BCMV [25, 29, 54, 58–61]. Holeva et al. [23, 24] first described RNA vaccination against CMV in tobacco, followed by Borah et al. [7] in pepper. This study aimed to examine the impact of CMV-CP gene-derived dsRNA molecules on the transmission of a CMV isolate infecting ghost pepper (Capsicum chinense Jacq.). CMV causes severe disease problems with systemic mosaic and mottling symptoms in ghost pepper, resulting in substantial crop quality and production losses. On the basis of virus sap transmission and RT-PCR detection, a novel isolate of CMV was discovered in ghost pepper from Northeastern India (N.E. India). The sequence obtained from a multiple sequence alignment analysis is significantly conserved across CMV-CP genes based on an NCBI-provided comparison of CMV isolated sequences and also belongs to CMV subgroup IB. The current study suggests that the exogenous application of dsRNA molecules to ghost pepper plants can generate resistance against the CMV isolate OM654026.1. Specifically, when in vivogenerated dsRNA molecules derived from CMV-CP genes were applied externally to ghost pepper leaves, they conferred virus resistance. At 21 dpi, CMV-CP dsRNAtreated plants exhibited less severe symptoms (4–24%) than CMV-treated plants (80–100%). Moreover, based on DAS-ELISA results at dpi, the amount of virus titer found in CMV-treated (T1) sets of plants was greater than the amount of virus titer found in seed-treated (T2) sets of plants, and the percentage of infected plants in all replications ranged from 80 to 100% in CMV-treated plants and from 4 to 24% in dsRNA-treated plants. The in vivo-generated dsRNA molecules from the CMV 2b gene conferred resistance against CMV with an infection percentage ranging from 0 to 29% when administered exogenously to ghost pepper [7]. Tobacco seedlings treated with dsRNA molecules derived from the coat protein (ds-CP) and 2b (ds-2b) genes of CMV are highly effective in protecting seedlings from CMV infection, suggesting that the coat protein gene plays a significant role in reducing CMV infection in tobacco [22]. In addition, the produced dsRNA has demonstrated resistance to aphid-mediated transmission of the virus. The aphid-mediated transmission of Cucumber mosaic virus has been observed to be inhibited by 75–77%. BCMVCPdsRNA provided 94 and 87% protection in tobacco and cowpea, respectively, when BCMV was applied topically, as demonstrated by Worrall et al. [59]. Tenllado and Daz-Ruiz [54] published the first report of antiviral protection by topically administered homologous dsRNA when it was mechanically co-inoculated with pepper mild mottle virus (PMMoV) onto a local lesion host. Tenllado and Daz-Ruiz [54] reported that plants treated with dsRNA did not exhibit PMMoV-induced lesions, which were observed in plants only challenged with the virus.

28

A. Saikia et al.

According to the findings, an exogenous application of dsRNA derived from the CP gene of CMV could also be used to suppress CMV infection in ghost pepper. Although ghost pepper did not demonstrate 100% protection against CMV, but revealed a reasonable level of protection under greenhouse conditions. Recent research indicates that after topical treatment, dsRNA persists for at least 9 days in tobacco [29], ZYMV [25], and 21 days in tomato [25, 29, 35]. Consequently, repeated dsRNA sprays are recommended throughout the life of the crop to induce virus resistance. The use of layered double hydroxide sheets (LDH) nanosheets as dsRNA delivery carriers enhanced the stability and sustained release of dsRNA on the leaf surface, thereby extending the duration of protection [32, 59, 60]. When applied topically, naked dsRNA has also been shown to be effective against viruses, fungi, and insect pests [17, 28, 46, 57]. The use of dsRNA to manage plant viruses in a non-transgenic manner could be a promising alternative to the regulatory challenges that transgenic plants face. Other CMV strains isolated from infected ghost pepper fields in India could be used to assess the efficacy of the vaccination technique. According to the findings of this study, the application of exogenously applied dsRNA molecules appears to be an environmentally friendly method for protecting crops from cucumovirus in ghost pepper fields. This is a crucial proof of concept that dsRNA can provide better resistance against the most prevalent and important virus transmission mechanism observed in the field, a crucial step toward practical application. Acknowledgements The authors express their gratitude to the Head, Department of Pathology, Faculty of Agriculture, Assam Agricultural University, Jorhat, for their incessant guidance and support with the laboratory facilities.

References 1. Backonja M, Wallace MS, Blonsky ER, CutlerBJ, Malan Jr P, Rauck R, NGX-4010 C116 Study Group (2008) NGX-4010, a high-concentration capsaicin patch, for the treatment of postherpetic neuralgia: a randomised, double-blind study. Lancet Neurol 7(12):1106–1112 2. Baek YM, Hwang HJ, Kim SW, Hwang HS, Lee SH, Kim JA, Yun JW (2008) A comparative proteomic analysis for capsaicin-induced apoptosis between human hepatocarcinoma (HepG2) and human neuroblastoma (SK-N-SH) cells. Proteomics 8(22):4748–4767 3. Baruah BR, Kashyap A, Nath PD (2016) Incidence, detection and integrated management of viral disease complex in Bhut Jolokia, a Chilli cultivar in Assam. Ann Plant Prot Sci 24(1):136– 141 4. Baulcombe D (2004) RNA silencing in plants. Nature 431:356–363 5. Beachy RN (1997) Mechanisms and applications of pathogen-derived resistance in transgenic plants. Curr Opin Biotechnol 8:215–220 6. Borah M, Kumar RG, Siddappa S (2019) Molecular detection and phylogenetic analysis of Cucumber mosaic virus infecting Bhut jolokia (Capsicum chinense Jacq.) of Assam. Int J Econ Plants 6:126–129 7. Borah M, Berbati M, Reppa C, Holeva M, Nath PD, Voloudakis A (2018) RNA-based vaccination of Bhut jolokia pepper (Capsicum chinense Jacq.) against Cucumber mosaic virus. VirusDisease 29(2):207–211

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

29

8. Bosland WP, Baral BJ (2007) Bhut Jolokia: the world’s hottest known chile pepper is a putative naturally occurring interspecific hybrid. HortScience 42:222–222 9. Brigneti G, Voinnet O, Li WX, Ji LH, Ding SW, Baulcombe DC (1998) Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J 17:6739–6746 10. Canto T, Prior DAM, Hellwald KH, Oparka KJ, Palukaitis P (1997) Characterization of Cucumber mosaic virus. IV. Movement protein and coat protein are both essential for cell-to-cell movement of the Cucumber mosaic virus. Virology 237:237–248 11. Clark MF, Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34:475–483 12. Ding SW, Anderson BJ, Haase HR, Symons RH (1994) New overlapping gene encoded by the Cucumber mosaic virus genome. Virology 198:593–601 13. Ding S, Shi B, Li W, Symons RH (1996) An interspecies hybrid RNA virus is significantly more virulent than either parental virus. Proc Natl Acad SciUSA 93:7470–7474 14. Duan CG, Wang CH, Guo HS (2012) Application of RNA silencing to plant disease resistance. Silence 3(1):1 15. Edwardson JR, Christie RG (1991) Cucumoviruses. CRC handbook of viruses infecting legumes. CRC Press, Boca Raton, pp 293–319 16. Francisco T et al (2004) RNA interference as a new biotechnological tool for the control of virus diseases in plants. Virus Res 102(1):85–96 17. Ghosh SKB, Hunter WB, Park AL, Gundersen-Rindal DE (2017) Double strand RNA delivery system for plant-sap-feeding insects. PLoS ONE 12:e0171861. https://doi.org/10.1371/journal. pone.0171861 18. Grube RC, Zhang Y, Murphy JF, Loaiza-FigueroaF LVK, Provvidenti R, Jahn MK (2000) New source of resistance to Cucumber mosaic virus in Capsicum frutescens. Plant Dis 84:885–891 19. Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ (2001) Argonaute2 a link between genetic and biochemical analyses of RNAi. Science 293:1146–1150 20. Hayes RJ, Buck KW (1990) Complete replication of a eukaryotic virus RNA in vitro by a purified RNA-dependent RNA Polymerase. Cell 63(2):363–368 21. Hobbs HA, Reddy DVR, Rajeshwari R, Reddy AS (1987) Use of direct antigen coating and protein a coating Eur J Plant Pathol ELISA procedures for detection of three peanut viruses. Plant Dis 71:747–749 22. Holeva MC, Sklavounos A, Rajeswaran R, Pooggin MM, Voloudakis AE (2021) Topical application of double-stranded RNA targeting 2b and CP genes of cucumber mosaic virus protects plants against local and systemic viral infection. Plants 10:963 23. Holeva MC, Sclavounos AP, Kyriakopoulou PE, Voloudakis AE (2006) In vitro produced dsRNA induces resistance against a severe Hellenic CMV isolate in tobacco and tomato. In: Book of abstracts, proceedings of the 8th international congress of plant molecular biology, Adelaide, South Australia, POSTHU-580. Springer, Berlin/Heidelberg, Germany, p 221 24. Holeva MC, Sclavounos AP, Kyriakopoulou PE, Voloudakis AE (2007) External application of dsRNA of the capsid protein (CP) or 2b gene of CMV reduces the severity of CMV-infection in tobacco. In: Book of abstracts, proceedings of the XIII international congress of IS-MPMI, Sorrento, Italy, PS 12–574. Springer, Berlin/Heidelberg, Germany, p 286 25. Kaldis A, Berbati M, Melita O, Reppa C, Holeva M, Otten P, Voloudakis A (2018) Exogenously applied dsRNA molecules deriving from the Zucchini yellow mosaic virus (ZYMV) genome move systemically and protect cucurbits against ZYMV. Mol Plant Pathol 19(4):883–895 26. Karthikeyan A, Deivamani M, Shobhana VG, Sudha M, Anandhan T (2013) RNA interference: evolutions and applications in plant disease management. Arch Phytopathol Plant Prot 46(12):1430–1441 27. Khalid A, Zhang Q, Yasir M, Li F (2017) Small RNA-based genetic engineering for plant viral resistance: application in crop protection. Front Microbiol 2017:8 28. Koch A, Biedenkopf D, Furch A, Weber L, Rossbach O, Abdellatef E et al (2016) An RNAibased control of Fusarium graminearum infections through spraying of long dsRNAs involves a plant passage and is controlled by the fungal silencing machinery. PLoS Pathog 12:e1005901. https://doi.org/10.1371/journal.ppat.1005901

30

A. Saikia et al.

29. Konakalla NC, Kaldis A, Berbati M, Masarapu H, Voloudakis AE (2016) Exogenous application of double-stranded RNA molecules from TMV p126 and CP genes confers resistance against TMV in tobacco. Planta 244(4):961–969 30. Liu YX, Wang M, Wang XJ (2014) Endogenous small RNA clusters in plants. Genom Proteom Bioinform 12(2):64–71 31. Liu HM, Zhu CX, GuoXQ ZhuXP, SongYZ WFJ (2007) A link between PVYN CP genemediated virus resistance and transgene arrangement. J Phytopathol 155:676–682 32. Mitter N, Worrall EA, Robinson KE, Xu ZP, Carroll BJ (2017) Induction of virus resistance by exogenous application of double-stranded RNA. Curr Opin Virol 26(October):49–55 33. Mochizuki T, Ohki ST (2012) Cucumber mosaic virus: viral genes as virulence determinants. Mol Plant Pathol 13:217–225 34. Mori A, Lehmann S, O’Kelly J, Kumagai T, Desmond JC, Pervan M, McBride WH, Kizaki M, Koeffler HP (2016) Capsaicin, a component of red peppers, inhibits the growth of androgenindependent, p53 mutant prostate cancer cells. Cancer Res 66:3222–3229 35. Namgial T, Kaldis A, Chakraborty S, Voloudakis A (2019) Topical application of doublestranded RNA molecules containing sequences of Tomato leaf curl virus and Cucumber mosaic virus confers protection against the cognate viruses. Physiol Mol Plant Pathol 108(February):101432 36. Neegaard P (1977) Survey of seed-borne viruses. Seed pathology. Wiley, New York, pp 80–116 37. Omarov RT, Cioperlik JJ, Sholthof HB (2007) RNAi-associated ssRNAspecifc ribonucleases in tombusvirus P19 mutant-infected plants and evidence for a discrete siRNA-containing efector complex. Proc Natl Acad Sci USA 104:1714–1719 38. Palukaitis P, Gracia-Arenal F (2003) Cucumovirus. Adv Virus Res 62:242 39. Palukaitis P, Roossinck MJ, Dietzgen RG, Francki RIB (1992) Cucumber mosaic virus. Adv Virus Res 41:281–342 40. Pantaleo V, Szittya G, Burgyán J (2007) Molecular bases of viral RNA targeting by viral small interfering RNA-programmed RISC. J Virol 81:3797–3806 41. Powell Abel P, Nelson RS, De B, Hofmann N, Rogers SG, Fraley RT, Beachy RN (1986) Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232:738–743 42. Puyam A, Sharma S, Kashyap PL (2017) RNA interference-a novel approach for plant disease management. J Appl Nat Sci 9(3):1612–1618 43. Roossinck MJ, Zhang L, Hellwald KH (1999) Rearrangements in the 5’ nontranslated region and phylogenetic analyses of Cucumber mosaic virus RNA 3 indicate radial evolution of three subgroups. J Virol 73(8):6752–6758 44. Rosa C, Kuo YW, Wuriyanghan H, Falk BW (2018) RNA interference mechanisms and applications in plant pathology. Annu Rev Phytopathol 56(1):581–610 45. Routhu GK, Borah M, Siddappa S, Nath PD (2022) Exogenous application of coat proteinspecific dsRNA inhibits cognatecucumber mosaic virus (CMV) of ghost pepper. J Plant Dis Protect 1–8 46. San Miguel K, Scott JG (2015) The next generation of insecticides: dsRNA is stable as a foliar-applied insecticide. Pest Manag Sci 72:801–809. https://doi.org/10.1002/ps.4056 47. Sanford JC, Johnston SA (1985) The concept of parasite-derived resistance. Deriving resistance genes from the parasite’s own genome. J Theor Biol 113:395–405 48. Smith NA, Singh SP, Wang MB, Stoutjesdijk PA, Green AG, Waterhouse PM (2000) Total silencing by intron-spliced hairpin RNAs. Nature 407:319–320 49. Song EG, Ryu KH (2017) Engineering resistance to a resistance breaking strain of Cucumber mosaic virus in plants utilizing viral dsRNA. Plant Biotechnol Rep 11(6):429–438 50. Surh YJ (2002) Anti-tumor promoting potential of selected spice ingredients with antioxidative and anti-inflammatory activities: a short review. Food Chem Toxicol 40(8):1091–1097 51. Suzuki M, Kuwata S, Kataoka J, Masuta C, Nitta N, Takanami Y (1991) Functional analysis of deletion mutants of Cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 183:106–113

Induction of RNA-Mediated Resistance Against Cucumber Mosaic …

31

52. Tabein S, Jansen M, Noris E, Vaira AM, Marian D, Behjatnia SAA, Accotto GP, Miozzi L (2020) The induction of an effective dsrna-mediated resistance against tomato spotted wilt virus by exogenous application of double-stranded rna largely depends on the selection of the viral rna target region. Front Plant sci 11:533338. https://doi.org/10.3389/fpls.2020.533338 53. Talukdar J, Saikia AK, Borah P (2015) Survey and detection of the diseases of Bhut Jolokia (Capsicum chinense Jacq.) in Assam. J Crop Weed 11:186–192 54. Tenllado F, Diaz-Ruiz JR (2001) Double-stranded RNA-mediated interference with plant virus infection. J Virol 75(24):12288–12297 55. Tomlinson JA (1987) Epidemiology and control of virus diseases of vegetables. Ann Appl Biol 110:661–681 56. Voinnet O, Pinto YM, Baulcombe DC (1999) Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc Natl Acad Sci USA 96:14147–14152 57. Wang M, Weiberg A, Lin FM, Thomma BP, Huang HD, Jin H (2016) Bidirectional crosskingdom RNAi and fungal uptake of external RNAs confer plant protection. Nat Plants 2:16151. https://doi.org/10.1038/nplants.2016.151 58. Waterhouse PM, Graham MW, Wang MB (1998) Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proc Natl Acad Sci USA 95:13959–13964 59. Worrall EA, Bravo-Cazar A, Nilon AT, Fletcher SJ, Robinson KE, CarrJP MN (2019) Exogenous application of RNAi-inducing double-stranded RNA inhibits aphid-mediated transmission of a plant virus. Front Plant Sci 10:265 60. Worrall EA, Hayward AC, Fletcher SJ, Mitter N (2019) Molecular characterization and analysis of conserved potyviral motifs in bean common mosaic virus (BCMV) for RNAi-mediated protection. Arch Virol 164:181–194. https://doi.org/10.1007/s00705-018-4065-6 61. Worrall EA, WamonjeFO MG, Harvey JJW, Carr JP, Mitter N (2015) Bean common mosaic virus and Bean common mosaic necrosis virus: relationships, biology, and prospects for control. Adv Virus Res 93:1–46. https://doi.org/10.1016/bs.aivir.2015.04.002 62. Yang Y, Kim KS, Anderson EJ (1997) Seed transmission of Cucumber mosaic virus in spinach. Phytopathology 87:924–931 63. Yoo BC, Kragler F, Varkonyi-Gasic E, Haywood V, Archer-Evans S, Lee YM, Lough TJ, Lucas WJ (2004) A systemic small RNA signalling system in plants. Plant Cell 16:1979–2000 64. Zhu CX, Song YZ, Yin GH, Wen FJ (2009) Induction of RNA-mediated multiple virus resistance to Potato virus Y, Tobacco mosaic virus and Cucumber mosaic virus. J Phytopathol 157(2):101–107

Ecosystem Restoration Through Natural Farming Tapan Senchowa, Pankhi Priya Neog, and Bidisha Boruah

1 Introduction Through the use of enhanced cultivars, agrochemicals, and fertilizers, the green revolution has considerably increased agricultural productivity in the previous few decades to feed the rising population. However, the growing use of these agrochemicals has resulted in eutrophication, worsening of soil health, and disruption of many soils and associated ecosystems, all of which have contributed to water pollution. One of the key factors in plant growth is the soil, which controls processes like the breakdown of organic matter, the cycling of nutrients, and the breakdown of xenobiotics [1]. Several strategic techniques to minimize the disruption and improve soil quality have been developed keeping in view the primary objective of increasing yield. Some of these techniques like organic farming, crop rotation, intercropping have already been prevalent since ages but are gaining popularity due to their beneficial effects over conventional or fertilizer-based farming. The concept of natural farming has been proposed as long as 1935 by the Japanese spiritual leader Mokichi Okada as an alternative to organic farming. Natural farming is basically an ecological and sustainable approach to farming, aiming at conservation of soil and natural resources.

T. Senchowa (B) Department of Crop Physiology, Assam Agricultural University, Jorhat, Assam, India e-mail: [email protected] P. P. Neog Department of Agronomy, Assam Agricultural University, Jorhat, Assam, India e-mail: [email protected] B. Boruah Department of Seed Science and Technology, Plant Breeding and Genetics, Assam Agricultural University, Jorhat, Assam, India e-mail: [email protected] © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 S. Patra et al. (eds.), Technologies for Rural Development, https://doi.org/10.1007/978-981-19-8513-3_3

33

34

T. Senchowa et al.

Natural farming can be an alternative to conventional farming for long-term sustained use of agricultural soils. Natural farming principles are focused on maintaining soil and general ecological health in harmony with nature and at the same time maintaining agricultural production. Natural farming encourages the complexity of living species, including plants and animals that shape each specific ecosystem to grow along with food plants in harmony with the natural ecology of each farming system. Since it excludes external inputs, it contributes to minimal disruption to the prevailing ecosystems. Reports of several studies have demonstrated that, natural farming can enhance the soil’s characteristics, biodiversity, and enzyme activity in various agroecosystems [2]. In India, the concept of natural farming is pioneered by Shri. Subhash Palekar especially in the state of Karnataka under the term “Zero Budget Natural Farming” (ZBNF) [3]. By eliminating the cost of production materials and associated expenses, the concept of “Zero Budget Natural Farming” guarantees to terminate farmers’ reliance on loans and break the cycle of debt.

2 Impact of Conventional Agriculture on Ecosystems The Indian economy has been based on agriculture for generations. In 2020–21, agriculture’s GDP contribution rose to 19.9% (Economic Survey 2020–2021). The increase in production over years can be mainly attributed to increase in use of chemical fertilizers. India saw a rise in its fertilizer use from 12.4 kg/ha in 1969 to 175 kg/ha in 2018, expanding at an average yearly rate of 5.96% (FAO 2019). Fertilizers and pesticides contaminate the soil biosphere and the water bodies. The fertilizers accumulate over time (eutrophication), which can disrupt the ecosystem. Heavy metals can accumulate over time and can cause great risk to humans, animals, and microorganisms. Conventional agricultural systems are often mono-cropping systems which further deteriorate the soil health over time. Moreover, use of genetically modified seeds and hybrid seeds can lead to loss of biodiversity which reduces the sustainability of the ecosystem. In a nutshell, conventional agriculture has a negative impact on biodiversity and the environment as a whole, despite being more productive than organic or natural agricultural systems.

3 Zero Budget Natural Farming: Impacts on Ecosystem 3.1 Promotes a Rich and Healthy Ecosystem Chemical fertilizers can be toxic to humans, and some can be carcinogenic. Extended use can lead to a wide variety of illness, disorders, and mental health problems [4]. The effects of the chemicals also cause a drop in the numbers of insects and microbes [5]. The phosphorous cycle is just one of many metabolic cycles that are disturbed.

Ecosystem Restoration Through Natural Farming

35

Over long-term use of chemicals can cause a great deal of damage to the elements of the whole ecosystems. By excluding these inputs, Zero Budget Natural Farming promotes a healthy overall well-being of each element of the ecosystem. Rich species diversity of both flora and fauna is an indicator of a healthy ecosystem. Soils of natural farming have considerable higher microbial count than soils over which conventional agriculture is practiced [6]. Weed diversity is higher in naturally and organically grown fields than those of conventional fields [7]. By enhancing pest management, nutrient cycling, soil chemical and physical characteristics, and reducing soil erosion, maintaining a diversified weed community contributes to the sustainability of an agro-ecosystem. Natural farming can restore the soil structure for the deep soil earthworms which helps to further improve fertility of soil. A comparison of the effects of different production systems (conventional, integrated, and natural farming) on population of earthworms revealed that the number of earthworm species and their population increases in natural farming system than conventional farming system [8]. An analysis of 30 triticale fields (15 natural and 15 conventional) and a comparison of five conventional fields treated with insecticides and ten untreated conventional fields revealed that the richness of plant species was five times higher in organic fields than in conventional fields, and the richness of pollinator species was about 20 times higher [9]. A study reported that in general, natural farming methods often have 30% more species diversity and 50% more organism abundance than conventional farms [10]. Conventional agriculture systems are generally associated with growing of a single crop over a large area, but natural farming systems are generally associated with small land holdings and different crops and hence higher species diversity. The absence of pesticide and chemicals in natural farming promotes more species diversity and a healthier ecosystem.

3.2 Protects, Restores, and Promotes Sustainable Use of Terrestrial Ecosystems and Halt Biodiversity Loss Natural farming can help to restore degraded agricultural land help in reclamation of problematic soils better than conventional farming [11]. The soils grown by natural farming generally go deeper and confer the soil with better resistance against erosion. By minimizing the disturbance to the soil by minimizing tillage practices, the soil is less susceptible to erosion. Integrating biodiversity conservation with natural can create new opportunities to address the threats to life on land due to agriculture. Natural farming can restore the soil structure for the deep soil earthworms which helps to further improve fertility of soil. In a study of winter wheat and spelt production in Slovenia, a life cycle analysis method was carried out that measured the ecological footprint of several production systems, and it was found that organic or natural farming practices performed 8.5 and 5.9 times better environmentally than conventional methods [12, 13]. The pesticides used in conventional agriculture

36

T. Senchowa et al.

lead to poisoning of insects, microflora, and fauna. Natural farming preserves the population of flora and fauna and promotes their richness.

3.3 Conserves the Water Resources Natural farming eliminates fertilizers and pesticides which helps to prevent water acidification and contamination. Phosphorus is limited in freshwater systems. It is the nutrient that causes the most concern for runoff and erosion losses together. A small amount of phosphorus together with nitrogen added to lakes, rivers, or streams can result in nutritional imbalances that encourage the growth of toxic algal blooms causing a threat to fishes and fauna. In natural farming systems, nitrogen and phosphorous are not supplied in inorganic fertilizer form, rather the requirement of the crops is obtained mostly from decomposing plant residues or from animal dung. Microorganisms that break down these wastes stabilize the nutrients in their own bodies and in the soil humus, reducing runoff and leaching losses. The use of cover crops and crop rotation also helps to stabilize the nutrients within the soil.

3.4 Improves the Resilience of Crops to Climate Change Being resilient means having the ability to adapt to change and recover back. Natural farming can help to grow climate-resilient crops. Strong evidence suggests that natural farming systems, which typically consist of a variety of diverse plant communities and are very different from the plains of monocultures that make up the bulk of conventional agriculture, are both more resilient and resistant to environmental change than other planting systems. Records show that during cyclonic winds in Vishakhapatnam, India 2017, paddy grown by natural farming withstood the wind better than the adjacent non-natural farming paddy. A study of natural farming initiatives in East Africa revealed that natural farming methods improved flood management, lengthened the growing season, and boosted resiliency to temperature swings by decreasing soil erosion and boosting soil moisture retention. Natural farming helps the plants to grow in a more natural environment, hence more adapted to the particular environment [14]. The practices of natural farming like cropping rotations, decreased tillage, the development of legume cover crops, the use of manure and compost, and fallow techniques strengthen the stability and resilience to droughts and/or floods and also assist in reducing climate change by sequestering carbon in the soil [15]. Natural and ecological farming techniques appear to be more damage-resistant and capable of considerably quicker recovery than conventional agricultural methods under severe perturbations, such as heavy rains and storms.

Ecosystem Restoration Through Natural Farming

37

3.5 Combats Climate Change Natural farming is likely to prevent CO2 emissions at numerous points throughout the agricultural value chain by ceasing to use and produce fertilizers and other chemical inputs. Natural farming has the most potential for reducing greenhouse gas emissions through soil carbon retention and decreased destruction of primary ecosystems. Practices of natural farming like cover crops, nutrient management practices, use of intercrop, conservation tillage, etc. greatly enhance the carbon sequestration process. The production of synthetic nitrogen (N) fertilizers used in agricultural production operations is a substantial source of greenhouse gas (GHG) emissions. And it is acknowledged that the use of synthetic N fertilizers is the primary cause for direct N2 O emissions from agricultural soils. Estimated emissions from the supply chain for synthetic N fertilizer in 2018 were 1.13 GtCO2 e or 2.1% of world GHG emissions and 10.6% of agricultural emissions [15]. Conversion of conventional agriculture to natural farming system will greatly reduce this CO2 emission. Proper management of nutrients and carbon sequestration in soils greatly contributes to adaptation and mitigation to climate change and variability in a variety of temperature zones and under a wide range of specific local conditions.

3.6 Improves the Livelihood of Local People Natural farming, which does not use chemical inputs, typically has a higher labor demand than conventional farming, which helps to create jobs in rural areas which should assist to maintain small farms that would otherwise be unable to compete with intensification and globalization. Zero Budget Natural Farming involves zero costs of inputs as all the inputs required are obtained from the farm itself. So, it will help the farmers to get away from the grasp of debt, which is a common problem of conventional farming in India in case of farmers with small holdings.

4 Conclusion Natural farming is one of the promising alternatives to combat ecological damage done through conventional farming systems. It involves changing farming practices to more closely resemble natural ecosystems. The damage done to the ecosystem by conventional farming practices can be restored by shifting to natural farming system or organic farming systems. A shift to natural farming from conventional farming increases the species diversity and population. The greenhouse gases from agriculture can be reduced to a large extent through natural farming practices. There is significant potential for natural farming to support rural economies by promoting ecotourism to natural farms and other forms of sustainable development. It is a tool to

38

T. Senchowa et al.

aid in the transition from conventional to organic farming by assisting small farmers to make more money. In a nutshell, natural farming can serve as a promising way to restore the biodiversity of an area and to elevate the overall economic situation of the rural people.

References 1. Doran JW, Zeiss MR (2000) Soil health and sustainability: managing the biotic component of soil quality. Appl Soil Ecol 15(1):3–11 2. Liao J, Xu Q, Xu H, Huang D (2019) Natural farming improves soil quality and alters microbial diversity in a cabbage field in Japan. Sustainability 11(11):3131 3. Sarada O, Kumar GS (2018) Perception of the farmers on zero budget natural farming in Prakasam district of Andhra Pradesh. J Res PJTSAU XLVI(1):1–67. 4. Deziel NC, Warren JL, Huang H, Zhou H, Sjodin A, Zhang Y (2021) Exposure to polychlorinated biphenyls and organochlorine pesticides and thyroid cancer in Connecticut women. Environ Res 192:110333 5. Ayansina ADV, Oso BA (2006) Effect of two commonly used herbicides on soil microflora at two different concentrations. Afr J Biotech 5(2):129–132 6. Chowdhury A, Pradhan S, Saha M, Sanyal N (2008) Impact of pesticides on soil microbiological parameters and possible bioremediation strategies. Indian J Microbiol 48(1):114–127 7. Kleijn D, Baquero RA, Clough Y, Díaz M, De Esteban J, Fernández F et al (2006) Mixed biodiversity benefits of agri-environment schemes in five European countries. Ecol Lett 9(3):243–254 8. Verbruggen E, Röling WF, Gamper HA, Kowalchuk GA, Verhoef HA, van der Heijden MG (2010) Positive effects of organic farming on below-ground mutualists: large-scale comparison of mycorrhizal fungal communities in agricultural soils. New Phytol 186(4):968–979 9. Gosme M, De Villemandy M, Bazot M, Jeuffroy MH (2012) Local and neighbourhood effects of organic and conventional wheat management on aphids, weeds, and foliar diseases. Agr Ecosyst Environ 161:121–129 10. Bavec M, Bavec F (2015) Impact of organic farming on biodiversity. In: Lo Y-H, Blanco JA, Roy S (eds) Biodiversity in ecosystems—Linking structure and function, vol 8, pp 185–202 11. Mosier S, Córdova S, Robertson GP (2021) Restoring soil fertility on degraded lands to meet food, fuel, and climate security needs via perennialization. Front Sustain Food Syst 5 12. Hyvönen T, Ketoja E, Salonen J, Jalli H, Tiainen J (2003) Weed species diversity and community composition in organic and conventional cropping of spring cereals. Agr Ecosyst Environ 97(1–3):131–149 13. Pacini C, Wossink A, Giesen G, Vazzana C, Huirne R (2003) Evaluation of sustainability of organic, integrated and conventional farming systems: a farm and field-scale analysis. Agric Ecosyst Environ 95(1):273–288; Menegat S, Ledo A, Tirado R (2022) Greenhouse gas emissions from global production and use of nitrogen synthetic fertilisers in agriculture. Sci Rep 12(1):1–13 14. Rosenzweig C, Tubiello FN (2007) Adaptation and mitigation strategies in agriculture: an analysis of potential synergies. Mitig Adapt Strat Glob Change 12(5):855–873 15. Menegat S, Ledo A, Tirado R (2022) Greenhouse gas emissions from global production and use of nitrogen synthetic fertilisers in agriculture. Sci Rep 12(1):1–13

Study the Effects of Storage Temperature, Relative Humidity, and Packaging Material on the Shelf Life of the Milled Black Rice Packed in the Flexible Packaging Systems C. Shashikumar, Siddhartha Singha, and Sudip Mitra

Abbreviations MLF EVOH PP RH MC WVTR WVP J D c x pb1 pb2 P A X m aw b

Multilayered film Ethylene-vinyl alcohol copolymer Polypropylene Relative humidity Moisture content Water vapor transmission rate Water permeability value Diffusion flux Diffusion coefficient Permeant concentration Distance in the flow direction Partial pressure of gas outside the packaging film Partial pressure of gas inside the packaging film Package film permeability Area of packaging film Thickness of the packaging film Moisture content in dry basis Water activity Slope of the isotherm

C. Shashikumar · S. Singha (B) · S. Mitra School of Agro and Rural Technology, Indian Institute of Technology Guwahati, Guwahati, Assam 781039, India e-mail: [email protected] C. Shashikumar e-mail: [email protected] S. Mitra e-mail: [email protected] © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 S. Patra et al. (eds.), Technologies for Rural Development, https://doi.org/10.1007/978-981-19-8513-3_4

39

40

c me mi m p0 t ρb ρt ε

C. Shashikumar et al.

Constant Equilibrium moisture content of the food Initial moisture content of the food Moisture content of the food at time t Vapor pressure of pure water at the storage temperature Shelf life Bulk density True density Porosity

1 Introduction Rice is the primarily grown food crop globally and is the staple food for over 50% of the world population [1]. India stands in the second position in rice production globally, followed by China [2]. Estimated annual post-harvest lose for is about 10% of the global production due to unscientific processing and handling [3]. Milled rice is easily susceptible to insects and mold attacks during long-term storage due to the change in the moisture content in the storage/packaging system [4]. This is even worst for traditionally cultivated and harvested indigenous rice varieties (e.g., black rice, soft rice, sticky rice, etc.). The traditional rice varieties are important to bring dietary diversity and sometime highly sought-after due to some exotic property [5]. In spite of high demand, their use is confined in small geographical area due to lack of knowledge about their processing and storage or packaging system. Once such traditional rice, black rice, or Chak-hao in Manipur has recently emerged as a superfood because of its unique nutritional properties [6, 7]. It is black or deep purple in appearance and has a unique aroma and taste. It is rich in dietary fiber and antioxidants and gluten free [2, 8–10]. Black rice is primarily grown organically in Manipur, Assam, and other parts of Northeast India. It is susceptible to insect and mold infestation and therefore has a shorter shelf life than other rice hybrid rice varieties [11]. The quality deterioration during storage can be controlled by monitoring and regulating the temperature and relative humidity of the air inside the storage system and selecting the right packaging system. The selection of grain packaging systems and management practices depends on the physical and chemical properties of the grain, environmental condition, packaging material, and cost. Bulk quantity of grains in a storage structure is a connected system in which deterioration occurs from interactions among physical (i.e., humidity and temperature), chemical (i.e., moisture and oxygen), and biological (i.e., microorganisms, insects, and pests) parameters [12–14] (Fig. 1). The most important and controllable parameters among these are the temperature and relative humidity of the packaging environment and the moisture content of the grains. A small change in the relative humidity of atmospheric air especially above 70% RH results in a significant increase in the grain moisture content and subsequent quality deterioration [4, 15].

Study the Effects of Storage Temperature, Relative Humidity …

41

Packaing material: Barrier properties & mechnical properties

Shelf-life of milled black rice Rice properties: Physical, Chemical and biological properties

Storage condition: Temperrature & Relative humidity

Fig. 1 Factors influencing shelf life of milled black rice

Shelf-life (SL) determination is an essential parameter for food industries to ensure that consumers get good quality food products after purchase. For low moisture food products like rice, SL testing is a costly and time-consuming process, and it has a few weeks to several months of shelf life [16, 17]. Hence, the investigation aimed to study the effects of storage temperature, relative humidity, and packaging material on the shelf life of the milled black rice packed in two different flexible packaging systems. And a simulation of grain moisture content in a flexible pack was done in the present study.

2 Materials and Methods 2.1 Mathematical Modeling for Shelf-life Prediction 2.1.1

Conceptual Model Development

A schematic diagram of the conceptualized food package system to be modeled is shown in Fig. 2. The system consists of a milled rice enclosed package. Moisture transfer occurs through the packaging material into or out of the food package. The package can be of various sizes and shapes, and the packaging material or film consists of multiple layers with different properties. It should be noted that all packaging layers are in direct contact; thus, the system contains only a single individual packaging layer.

42

C. Shashikumar et al.

H2O & O2 H2O & O2

Fig. 2 One-dimensional view of rice packaging

2.1.2

Assumptions

To simplify the mathematical modeling is necessary to make some assumptions. Therefore, the assumption was made for the standard grain packaging transfer model [16, 18], i.e., 1. The grain bed is assumed to be a continuum where the grain phase and intergranular air phase are evenly distributed through the porous media. 2. Grain and intergranular air are in local thermodynamic equilibrium in a control volume. 3. The mass of the moisture in the headspace is negligible. 4. Permeation is one direction only, and temperature changes throughout the system. 2.1.3

Mass Transfer in the Packaging Materials

The permeability of packaging material gives an idea about the penetrability of moisture or gas through a packaging material. Permeability is the mass of vapor or gas transferred per unit of area, time, and a driving force. In the case of diffusional mass transfer, the driving force is a difference in concentration or partial pressures [16, 18]. According to Fick’s law, the diffusion rate may be expressed as follows: ( Diffusionrate = J = −DA

dc dx

) (1)

where J—diffusion flux (mol/cm2 /s); D—diffusion coefficient (cm2 /s); c—permeant concentration (mol/cm3 ); x—distance in the flow direction (cm).

Study the Effects of Storage Temperature, Relative Humidity …

43

The expression for the steady-state permeation of a vapor or gas through a packaging material can be written as follows: P δw = A( p1 − p2 ) δt X

(2)

where ( pb1 − pb2 ): partial pressure of gas outside and inside the packaging film (kPa); P: package film permeability (mol/cm3 ); A: area of packaging film (m2 ) for gas exchange; x is the thickness of the packaging film (mm).

2.1.4

Determination of Water Vapor Transfer and Shelf-life Simulation

The prediction of moisture transfer through packaged food requires an investigation of the preceding equation with a specific boundary condition. The primary analysis requires certain assumptions, i.e., (i) P/X is constant. (ii) The external environment is at constant temperature and relative humidity. (iii) p2 is the vapor pressure of the water in the food. (iv) The external environment will not remain constant inside the packaged food, during transportation, and retailing. Hence, P/X will not be constant. But, using WVTRs determined at 38 °C and 90% relative humidity gives a worst-case (extreme environment) analysis [19]. The critical point about the above Eq. (2) is that the internal vapor pressure is not constant but varies with the moisture content of the food at any time. In low and intermediate moisture foods, the internal vapor pressure is determined by the moisture sorption isotherm of the food. In the simplest case, when the isotherm is treated as a linear function [16, 18, 19], i.e., m = baw + c

(3)

where m—moisture content in dry basis; aw —water activity; b—slope of the isotherm; c—constant. By substitution, Ws P | p0 m e p0 m | δw = δm = A − δt δt X b b

(4)

which on rearranging gives P A p0 δm = δt me − m X Ws b

(5)

And on integrating, ln

me − mi = me − m

|

| P A po t X Ws b

(6)

44

C. Shashikumar et al.

where me —equilibrium moisture content of the food; mi —initial moisture content of the food; m—moisture content of the food at time t; p0 —vapor pressure of pure water at the storage temperature; t—shelf life (no. of days).

2.2 Selection of Sample and Packaging Material Black rice paddy was purchased from Udalguri (26.7460°N, 92.0959°E), Assam, India. It ensures a safe moisture level ( Chenopodium album > Urtica dioica > Diplazium esculentum > Murraya koenigii > Moringa oleifera contain high carbohydrate contents compared to that of other components present in the leaves. Moreover, the low moisture content of the leaves reduces microbial growth and increases the shelf life of the products. Similarly, the crude protein content of the leaves in Amaranthus viridis (19.8%) > Centella asiatica (19.4%) > Hibiscus sabdariffa (17.3%) > Murraya koenigii (11.8%) > Table 2 Proximate composition of leafy vegetables Sl. no

Leafy vegetable name

Proximate composition (g/100 g d.b.) Protein

Fat

Ash

1

Centella asiatica

8.0

4.8

19.4

2.9

12

2

Moringa oleifera

7.6

38.2

24.4

7.1

11.2

3

Murraya koenigii

6.8

39.44

11.8

5.1

12.5

6.3

4

Hibiscus sabdariffa

7.8

8.7

17.3

3.1

6.5

24.5

5

Amaranthus viridis

13.3

64.6

19.8

3.4

12.2

8.2

6

Chenopodium album

15.2

53.3

23

4.2

19.5

24.45

7

Enhydra fluctuans

13.66

9.64

8.00

1.10

15.15

15.37

8

Eryngium foetidum

13.43

5.34

5.25

1.95

10.21

9.72

9

Marsilea minuta

16.6

57.50

24.9

5.53

10.43

7.33

10

Diplazium esculentum

7.6

44.3

31.2

8.3

16.2

4.6

11

Nasturtium officinale

9.4

31.7

33.8

9.6

24.9

21.31

Moisture

Carbohydrate

CF 2.77 27.1

(continued)

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

115

Table 2 (continued) Sl. no 12

Leafy vegetable name

Proximate composition (g/100 g d.b.)

Urtica dioica

Moisture

Carbohydrate

Protein

Fat

Ash

CF

15.5

47.4

28.5

5.2

18.9

26.85

Sl. no

Leafy vegetable name

Fe

K

P

Ca

Mg

Zn

Cu

Mn

1

Centella asiatica

6

3182

290

1283

345

7

1

1.7

2

Moringa oleifera

7.3

1583

354

2560

600

3.1

1.9

2.1

3

Murraya koenigii

5

2150

364

2089

314

2

1

1

4

Hibiscus sabdariffa

5

1227

216

1365

205

3

1

4.4

5

Amaranthus viridis

10.8

382

52

24.7

0.48

9.73

1.11

8

6

Chenopodium album

5.4

848.32

1.55

155.75

0.31

8.44

1.22

118

7

Enhydra fluctuans

123

487

48.3

622

3.8

4.38

0.3

11.5

8

Eryngium foetidum

111.21

58.4

43

312.3

98.5

4.5

441.4

10.5

9

Marsilea minuta

0.46

6.13

10.13

80.35

38.33

0.13

0.42

0.17

10

Diplazium esculentum

11.2

914.4

49

192.7

0.36

2.73

0.32

0.51

11

Nasturtium officinale

7

465.2

52.5

65.6

0.41

2.04

0.58

0.62

12

Urtica dioica

8.1

917.2

ND

113.2

0.22

2.32

0.67

ND

Micro nutrients (mg/100 g d.b.)

Sl. no

Leafy vegetable name

Vitamins (mg/100 g d.b.)

DF (mg/100 g d.b.)

References

A

B1

B2

B3

B6

C

E

SDF

ISDF

1

Centella asiatica

0.39

ND

ND

ND

0.78

0.76

ND

0.8

26.3

[44]

2

Moringa oleifera

18.9

2.64

20.5

8.2

ND

17.3

ND

4.5

27.5

[45]

3

Murraya koenigii

6.04

0.89

0.09

2.73

ND

0.04

0.03

2.5

38.8

[18]

4

Hibiscus sabdariffa

1.23

0.2

0.4

1.4

ND

2.3

35.11

8.5

34.7

[46]

5

Amaranthus viridis

65.70

ND

0.52

0.05

0.07

179

ND

12.5

36.5

[47–49]

6

Chenopodium album

1.74

0.01

0.14

ND

ND

35

ND

4.29

20.15

[50, 51]

7

Enhydra fluctuans

0.98

0.40

1.04

0.60

1.85

4

ND

ND

ND

[52]

8

Eryngium foetidum

7.33

0.05

0.02

1.02

0.1

3.60

0.36

0.22

10.3

[53]

9

Marsilea minuta

0.491

ND

ND

ND

ND

69.06

ND

ND

ND

[54–56]

10

Diplazium esculentum

0.83

0.02

0.210

0.1

4.76

32.03

ND

ND

ND

[57–59]

11

Nasturtium officinale

0.42

1.63

ND

ND

0.23

62.5

1.46

2.09

19.22

[60]

12

Urtica dioica

32.25

0.06

1.48

4

0.44

1535

92.9

3.25

23.6

[61, 62]

Note d.b. = dry basis; ND = Not detected; CF = Crude fibre; DF = Dietary fibre; SDF = Soluble dietary fibre; ISDF = Insoluble dietary fibre

116

E. Bala and S. Singha

Plant Cell wall

Leaf matrix

Processing Releases Plant metabolites

Hydrolysis Primary metabolites

Secondary metabolites

Fig. 1 Nutrients and phytochemical classification in plant cell

Enhydra fluctuans (8%) > Eryngium foetidum (5.25%) were significantly lower when it was compared with Nasturtium officinale (33.8%) > Diplazium esculentum (31.2%) > Urtica dioica (28.5%) > Marsilea minuta (24.9%) > Moringa oleifera (24.4%) > Chenopodium album (23%). The values of ash content in leafy vegetables ranges from 10 to 24% which reflects high mineral content. The results, therefore, suggests that leafy vegetables has high deposition of minerals in leaves. The values of the crude fat for the leaves range from 0.81% (Nasturtium officinale) to 8.3% (Diplazium esculentum). The crude fibre content is highest in Moringa oleifera (27.1%) and lowest in Nasturtium officinale (1.05%) compared to other leaves which is an important area to be explored in leafy vegetables. Vegetable with high dietary fibre contains low starch and is important in diet to control obesity, diabetes, and cancer [63]. Therefore, these aspects highlighted another group of nutrients required for our body:

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

117

phytochemicals, which work as a plant defence system and combat many diseases in the human system. It has been reported that these leafy vegetables have a wide range of bioactive compounds as phytochemicals (flavonoids, terpenoids, stilbenes, steroids, sesquiterpene, and essential oils). Still, the absorption or bioavailability of these compounds in the human gut needs to be understood.

3.3 Effect of Gut Processing on Phytochemicals of Leafy Vegetables The most bioactive compounds in ingested meals vary significantly depending on the bioaccessibility, bioavailability, and concentration of these active metabolites in the tissues. Food fragmentation occurs predominantly in the mouth and stomach, while enzymatic digestion and absorption of vitamins and water appear primarily in the small and large intestines. The quantification of bioavailable bioactive compounds is essential to understand the extent of these compounds’ existence in the foods. The digestion of the food material and release of bioactive compounds depends on the located tissues. Secondary metabolites such as polyphenols conjugated with monosaccharide and polysaccharides and proteins and located in vacuoles and the apoplast of plant cells. However, carotenoids are located both in the chloroplast and chromoplast membrane. For example, in plant chromoplast of tomato (crystal), papaya (lipid dissolved) and mango (liquid crystalline) having unique varieties of carotenoids that effectively influence the liberation from the food matrix and are typically involved in defence system. There are different classed of flavonoids and are ubiquitously present in foods. Flavonols present at low concentrations within the range of ~15–30 mg/kg fresh wt [64]. The absorption of flavanols depends on the glycosylation which exists in almost all food types (Fig. 2). However, different sugars may additionally be involved as galactose, glucuronic acid, arabinose, and xylose but its sugar moiety present usually as glucose or rhamnose. These materials should be hydrolyzed through intestinal enzymes or colonic microflora earlier than they are absorbed. Polyphenols are conjugated in the small intestine and consequently in the liver during absorption. This method commonly consists of methylation, sulfation, and glucuronidation. Whereas compounds like carotenoids or triterpenes are lipophilic in nature requires micellization, as can also positive aglycones polyphenol. The release of carotenoids absorption from the food matrix relies upon subsequent solubilization by using bile acids and digestive enzymes, which leads to their addition to micelles (Fig. 3). In plant tissues, carotenoids are disassociated from their native surroundings at some point of food processing and digestion in the stomach [65]. The carotenoids passively absorbed with lipids irrespective of actively absorbing through the intestine. The effectivity of absorption of carotenoids is based on dissolving lipophilic molecules into dietary lipids [66].

118

E. Bala and S. Singha

Fig. 2 Absorption pattern of water soluble phytoconstituents

Fig. 3 Absorption pattern of water insoluble phytoconstituents

However, dietary fibre bound polyphenols hydrolyzed via enzymes in the upper intestine; otherwise, these compounds will now not be bioaccessible and will be inclined to degradation through the colonic microflora in the large intestine [67]. Dietary fibre acts as an entrapping matrix and restricts the diffusion of the enzymes with its substrates. Additionally, specific dietary fibre bound polyphenols end up in the large intestine. Therefore, processing and consumption patterns are the essential factors to be viewed for the bioavailability of the bioactive compounds. Several food consumption databases provide the specific nutrients in fruits and vegetables. It is used in monitoring nutrition and recommending food policies. Throughout this study, very few leafy vegetables are documented to assess the nutrient content for deriving nutritional guidelines. Moreover, there is limited quantitative data on bioactive compounds that have a physiological role in human health. Table

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

119

3 highlights some reliable data on leafy vegetable consumption patterns and intake to estimate the exposure of a group of available phytochemical constituents and will estimate the requirement and the frequency. Documented leafy vegetables highlighted that more than 46 LVs required nutritional quantification for the recommended amount of dietary effect.

3.4 Effects of Cooking Practices and Processing on Bioavailability of Phytonutrients Leafy vegetables are usually processed through heat treatment such as boiling, steaming, frying, and microwave drying. Processing changes the chemical composition and thereby bioavailability of the bioactive compounds. Household process of cooking disrupts the membrane, turgor, and cell adhesion strength is lost. This leads to loss of firmness or softening. This processing techniques effect the food matrix differently. It depends on the types of vegetables, duration of heat treatment and processing which have both positive and negative effect. The activity of antioxidants and phenolic bioavailability depends on four possible reasons as described by Morales and Babel: (1) Heat treatment disrupts the cell wall and subcellular compartment to release the bioactive compounds having high antioxidant properties (2) Thermal chemical reaction produces strong radical-scavenging antioxidants (3) Thermal inactivation of oxidative enzymes suppresses the oxidation potential of antioxidants (4) Non-nutrient antioxidants production or compounds formation such as Maillard reaction with antioxidant activity. 3.4.1

Boiling

Green leafy vegetables are cooked mostly by boiling process to make them tender and palatable. This process predominantly modifies the physical and chemical composition of food matrix. The boiling time and its processing condition depend on type of vegetables and preferably on consumption pattern. During boiling, leaching changes the quantity and quality of vegetables which affects the antioxidative potential [68]. For example, in spinach, boiling increases the phenolics and influences the β-carotene and lutein content [69, 70]. More studies reported that boiling increases the water-soluble polyphenol compounds by 81% higher than raw spinach [71]. Similarly, reports are found in Brassica family, water spinach, and Moringa [72–74] but increase in β-carotene were observed in basil, pak choi, sweet potato leaves, and coriander leaves. Gehse et al. [75] observed that in vegetables, bioavailability of carotenoids increases in short boiling time which should not be more than 10 min. The bioavailability increases due to release of absorbable phenolics and aglycones from

2.14

0.043

1.20

Centella asiatica

Moringa oleifera

Murraya koenigii

Hibiscus sabdariffa

1

2

3

4

105.04

Total phenols

5.28

0.07

31.28

23.03

Total Flavonoids

Available phytochemical constituents (mg/g d.b.)

Leafy vegetable name

Sl. No

Table 3 Consumption pattern and absorption of phytochemicals

3.27

0.02

70

17.75

Total Alkaloids

0.04

0.01

93.6

11.6

Total Tannins

2.19

0.03

64

2.6

Total saponins [11–13]

References

[18, 19]

(continued)

Tender leaves and [20, 21] stalks are eaten as salad and as a pot herb and are used for seasoning curries

5–10% dried leaf powder at 5 or 10% to increase the intake of greens as a source of micronutrients, for flavouring foodstuffs

Leaves are fried, [14–17] mixed with tuna chips, eaten with rice and curry. Leaves in preparation of soup and eaten for breakfast

Raw leaves and stems are edible, cooked as curry, paste, dried leave powder in smoothies, nut milks, cakes, crackers, etc.

Consumption pattern

120 E. Bala and S. Singha

2.94

1.11

50.23

Chenopodium album

Enhydra fluctuans

Eryngium foetidum

Marsilea minuta

6

7

8

9

72.6

14

Total phenols

Amaranthus viridis

Leafy vegetable name

54.9

77.24

2.25

17.64

27.8

Total Flavonoids

Available phytochemical constituents (mg/g d.b.)

5

Sl. No

Table 3 (continued)

ND

7.8

0.2

2.80

131.4

Total Alkaloids

ND

14.5

6.6

22.34

60.7

Total Tannins

ND

2.3

4.1

3.22

530

Total saponins

References

[25]

Eaten as a potherb or fried as vegetables

The leaves can be eaten as a soup or raw or cooked as vegetables

(continued)

[31–33]

[27–30]

Fried or boiled with [26–28] rice and eaten with boiled rice with boiled potato, salt and mastered oil

Eaten raw in salad or with curd and cooked as vegetables

Amaranth leaves, [22–24] stems and entire plants may be eaten raw or cooked as spinach or greens

Consumption pattern

Protective Role of Leafy Vegetables in Rural Areas: Critical Review … 121

Nasturtium officinale

Urtica dioica

11

12

4.52

9.35

0.24

Total phenols

Note ND = Not Detected; d.b. = dry basis

Diplazium esculentum

Leafy vegetable name

20.29

42.65

0.09

Total Flavonoids

Available phytochemical constituents (mg/g d.b.)

10

Sl. No

Table 3 (continued)

14

ND

0.05

Total Alkaloids

10.54

43.05

ND

Total Tannins

81.4

ND

0.32

Total saponins

References

Fresh vegetables added to soups, cooked as a pot herb, or used as a vegetable

Fresh leaves are cooked as vegetables

[38–42]

[36, 37]

Cooked as vegetable [34, 35] or with fruit of Dillenia indica and fish, boiled and fried and cooked as vegetable and in soups

Consumption pattern

122 E. Bala and S. Singha

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

123

Table 4 Effect of processing in nutrients and bioactive with different in vitro assays Sl. Centella No asiatica

Proximate composition (g)

1

Boiling

16.77

7.31

3.47

0.41 11.78

44.65

2

Steaming

12.84

5.6

2.66

0.32 14.04

35.34

3

Frying

33.94

14.79

7.03

0.85 15.37

41.42

11.4

4

Microwaving 14.34

6.25

2.96

0.36 13.94

35.91

25.27

BDM carbohydrate protein Fat (%FW)

TPC TFC RP (mg GAE/g) (mg QE/g) (mg AA/g) 4.18 7.41

Note BDM = Bone dry mass; FW = Fresh weight; TPC = Total Phenolic Content; TFC = Total Flavonoid Content; RP = Reducing Power

flavonoid conjugates, inactivated oxidizing enzymes of carotenoids and disruption of the carotenoid-protein complexes [72, 76–78].

3.4.2

Steaming

In terms of bioavailability of essential bioactive, steaming is regarded a reliable method for processing leafy vegetables. This method is safer method for water soluble polyphenolic compounds because during steaming the food materials are not in direct contact with boiling water. It softens the food matrix to extract bioavailable compounds and enhancing digestibility of fundamental nutrients. In our study, one of the leafy vegetables such as Cenetlla asiatica losses its nutritional components but 16% more retention of phenolic content and 47% more reducing power compared to boiling (Table 4). Similar study on some edible leaves and Centella asiatica highlighted that concentration of polyphenols and flavonoid increased but decrease in carotenoids during 5 min of steaming [79]. The phenolic contents of spinach additionally get increased during steaming [69, 80]. The study on spinach by Mazzeo et al. [69] and Eriksen et al. [81] discussed that β-carotene decreases; however, polyphenolic and flavonoid increased by 34 and 25% during steaming.

3.4.3

Frying

Frying is one of the oldest processing techniques employed in the food industry and house kitchens [82]. The organoleptic properties change during frying. Numerous techniques of frying usually consist of mainly pan, shallow, and deep-fat frying. Food is exposed to boiling oil during frying at 160–180 °C [83]. Frying is a kind of drying process where it vaporizes the moisture content, which is carried out by increasing the surface temperature of the vessel. During frying of leafy vegetables, the lipid-soluble phenolic compounds inhibits the formation of thermal-oxidative compounds like acrylamide and heterocyclic amines in frying oil [84]. It has a two-way relationship; this process increases the stability of the frying oil as well

124

E. Bala and S. Singha

as enhances the antioxidant potential of the leafy vegetables. For example Zeb and Habib [85] confirmed and discussed that there was an increase in phenolic acids such as chlorogenic acid, coumaric acid derivatives, caffeic acids, and caffeoyl hexose in Nasturtium officinale. However, compounds such as quinic acids (caffeoyl feruloyl quinic acid, 5-caffeoylquinic acid, 4-feruloyl quinic acid, 3,4-di-caffeoylquinic acid, 4-caffeoylquinic acid) and hydroxycinnamic acid (sinapic acid derivative) decreased during the frying process. In foods, phenolic compounds play a substantial antioxidant role [86]. Consequently, phenolic compounds are commonly much less affected by frying on the primary processing conditions like time of cooking and type and amount of oil used. There are reports on frying that compared to fresh samples frying till its crispiness reduces the antioxidant and polyphenolic content [79].

3.4.4

Microwave Drying

Microwave drying is now a modern cooking method due to its potential to attain high rate of heat transfer, high moisture diffusivity, low cooking time and maintenance [87, 88]. Furthermore, microwave drying would possibly have much less impact on food flavour and nutritional qualities in contrast to different traditional techniques of cooking [89]. The composition of food matrix and its bioactive compound has low or no effect during microwave drying [80]. Other reports also confirmed that its nutritional content remains unchanged in microwave drying of Brassica (glucosinolate rich leafy vegetables) [90]. Moreover, Otles and Cagindi [91] reported that there was an reduction of carotenoids due to long duration of microwaving to achieve the suitable texture and palatability. However, it increases the bioavailability of the carotenoid and phenolic content of the food matrices. In Centella asiatica, we observed that there is net increase in antioxidant activity in microwave drying compared to other processing. Table 4 shows that Centella asiatica reduces its antioxidant power by ~65%, 47% in boiling and steaming, and ~26% during frying, whereas during microwave drying, there is an increase in reducing power by ~26%. Therefore, this study emphasizes that based on food matrix and types of processing, there is a change in phytochemicals which can either reduce their concentration or biological activity or break their complex matrices and increase the porosity to extract phytochemicals.

3.5 Ethnomedicine Practices of Leafy Vegetables Traditionally leafy greens serve as sources for curing certain diseases and contribute to improve and develop biomedical drugs. However, the studies and data available to characterize the ethnobotanical plants along with its medicinal importance and physiological effect are limited. Verpoorte [92] estimated that among all plant species only 15% have been characterized photochemically and 6% have medicinal importance with respect to its biological value. However, there is no considerable evidence

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

125

whether those species have been used in ethnomedicine. Therefore, to assess the medicinal significance of these leafy greens, we first assume how it affects in in vivo or clinically. Unfortunately, all 100 LVs have very limited in vivo study and solely a few scientific trials, as some of them are given in Table 5. Therefore, it is challenging to evaluate and recognize its health benefits’ efficacy and long-term impact. However, several trials and scientific validation rely on the ethnopharmacological method primarily based on their bioactive compounds and the usage of several concepts and techniques.

4 Conclusion This study reemphasizes the importance of leafy vegetables in the human diet for improving human health. Phytotaxonomy is a starting point for studying the possible properties of a leafy vegetable. The secondary metabolite composition is very different between different families of plant species, and plants of the same family members show similarities in metabolism. Different processing conditions such as boiling, steaming, frying, and microwave drying can also affect the nutritional and bioactivity of a leafy vegetable. Apart from these two aspects, the final bioactivity of such plants depends on the way the plants get digested. However, there is a lack of quantitative data about dietary phytochemicals, particularly in leafy vegetables. Nutritional guidelines for per day consumption of leafy vegetables are essential. Therefore, it is important to document and analyse the nutritional quality of leafy vegetables. Moreover, it is necessary to quantify the antinutritional components under different processing conditions along with nutritional components. This strategy will assist in increasing the consumption of leafy vegetables and maintaining a healthy diet among rural people. It will also increase the cultivation and research on increasing the secondary metabolites and lowering antinutrients by utilizing agronomy practices. Furthermore, the studies on appropriate postharvest processing can reduce the loss of phytonutrients from fresh samples on retailers’ shelves throughout marketing. To apprehend the maximum production of phytonutrients, a growth study of the leafy vegetables is necessary for each medicinally important leafy vegetable to understand its harvesting time. Overall, leafy vegetables have immense potential to improve food security and maintain human health especially w.r.t the management of LDs.

Clinical study/in vivo

Centella asiatica

Moringa oleifera

Murraya koenigii

Hibiscus sabdariffa

Amaranthus viridis

Chenopodium album

Enhydra fluctuans

Eryngium foetidum

Marsilea minuta

Diplazium esculentum

Nasturtium officinale

Urtica dioica

1

2

3

4

5

6

7

8

9

10

11

12

Note LS = Limited study

In vivo

In vivo

In vivo

In vivo

In vivo

LS

In vivo

In vivo

In vivo

In vivo

In vivo

Cardiovascular diseases

LV Name

Sl. No

In vivo

In vivo

In vivo

In vivo

In vivo

In vivo

LS

In vivo

LS

In vivo

In vivo

Clinical study/in vivo

Diabetes

Table 5 Scientific validation in chronic diseases

In vivo

LS

In vivo

LS

LS

LS

In vivo

LS

LS

In vivo

clinical

Clinical study/in vivo

Respiratory diseases

In vivo

Clinical study/in vivo

LS

LS

In vivo

In vivo

In vivo

In vivo

In vivo

In vivo

In vivo

Clinical study/in vivo

Cancer

In vivo

LS

In vivo

In vivo

In vivo

LS

In vivo

In vivo

LS

In vivo

In vivo

Clinical study/in vivo

Neural diseases

In vivo

In vivo

LS

LS

In vivo

In vivo

In vivo

LS

LS

In vivo

In vivo

Clinical study/in vivo

Skin disease

In vivo

In vivo

In vivo

LS

In vivo

In vivo

In vivo

In vivo

In vivo

In vivo

In vivo

Clinical study/in vivo

Rheumatoid Arthritis

[41, 141–146]

[136–140]

[132–135]

[128–131]

[125–127]

[123, 124]

[117–122]

[113–116]

[111, 112]

[104–110]

[98–103]

[93–97]

References

126 E. Bala and S. Singha

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

127

Acknowledgements The first author acknowledges the financial support from Indian Institute of Technology, Guwahati through doctoral fellowship.

References 1. Bulletin of the World Health Organization (2018) 96(11):792 2. Jana A, Chattopadhyay A (2022) Prevalence and potential determinants of chronic disease among elderly in India: rural-urban perspectives. PLoS ONE 17(3):e0264937. https://doi.org/ 10.1371/journal.pone.0264937 3. Diet and physical activity for the prevention of noncommunicable diseases in low- and middleincome countries: a systematic policy review. https://www.who.int/news-room/fact-sheets/det ail/noncommunicable-diseases 4. Minocha S, Thomas T, Kurpad AV (2018) Are ‘fruits and vegetables’ intake really what they seem in India? Eur J Clin Nutr 72(4):603–608 5. Boeing H et al (2012) Critical review: vegetables and fruit in the prevention of chronic diseases. Eur J Nutr 51(6):637–663 6. Singleton VL, Rossi JA (1965) Colorimetry of total phenolics with phosphomolybdicphosphotungstic acid reagents. Am J Enol Vitic 16(3):144–158 7. Oyaizu M (1986) Studies on products of browning reaction: Antioxidative activity of product of browning reaction prepared from glucosamine. Jpn J Nurtion 44:307–315 8. Patel A et al (2010). Estimation of flavonoid, polyphenolic content and in-vitro antioxidant capacity of leaves of Tephrosia purpurea Linn. (Leguminosae). Int J Pharma Sci Res 1(1):66– 77 9. Ankanna S, Suhrulatha D, Savithramma N (2012) Chemotaxonomical studies of some important monocotyledons. Botany Res Int 5(4):90–96 10. Anukul S (2011) Chemotaxonomy of medicinal plants. File:///User/Documents/Chemotaxonomy-of-medicinal-plant2.html 11. Kunjumon R, Johnson AJ, Baby S (2022) Centella asiatica: secondary metabolites, biological activities and biomass sources. Phytomed Plus 2(1):100176 12. Long HS, Stander MA, Van Wyk BE (2012) Notes on the occurrence and significance of triterpenoids (asiaticoside and related compounds) and caffeoylquinic acids in Centella species. S Afr J Bot 82:53–59 13. Quyen NTC, Quyen NTN, Quy NN, Quan PM (2020) Evaluation of total polyphenol content, total flavonoid content, and antioxidant activity of Centella asiatica. In: IOP conference series: materials science and engineering, vol 991, no 1, p 012020. IOP Publishing 14. Hassan MA, Xu T, Tian Y, Zhong Y, Ali FAZ, Yang X, Lu B (2021) Health benefits and phenolic compounds of Moringa oleifera leaves: a comprehensive review. Phytomedicine 93:153771 15. Kashyap P, Kumar S, Riar CS, Jindal N, Baniwal P, Guiné RP et al Recent advances in Drumstick (Moringa oleifera) leaves bioactive compounds: composition, health benefits, bioaccessibility, and dietary applications. Antioxidants 11(2):402 16. Madukwe EU, Ezeugwu JO, Eme PE (2013) Nutrient composition and sensory evaluation of dry Moringa oleifera aqueous extract 17. Leone A, Spada A, Battezzati A, Schiraldi A, Aristil J, Bertoli S (2015) Cultivation, genetic, ethnopharmacology, phytochemistry and pharmacology of Moringa oleifera leaves: an overview. Int J Mol Sci 16(6):12791–12835 18. Igara CE, Omoboyowa DA, Ahuchaogu AA, Orji NU, Ndukwe MK (2016) Phytochemical and nutritional profile of Murraya koenigii (Linn) Spreng leaf. J Pharmacogn Phytochem 5(5):7

128

E. Bala and S. Singha

19. Jain M, Gilhotra R, Singh RP, Mittal J (2017) Curry leaf (Murraya koenigii): a spice with medicinal property. MOJ Biol Med 2(3):00050 20. Da-Costa-Rocha I, Bonnlaender B, Sievers H, Pischel I, Heinrich M (2014) Hibiscus sabdariffa L.-A phytochemical and pharmacological review. Food Chem 165:424–443 21. Famurewa AC, Kanu SC, Uzoegwu PN, Ogugua VN (2015) Ameliorative effects of Hibiscus sabdariffa extract against carbon tetrachloride-induced lipid peroxidation, oxidative stress and hepatic damage in rats. J Pharm Biomed Sci 5(9):725–732 22. Ahmed SA, Hanif S, Iftkhar T (2013) Phytochemical profiling with antioxidant and antimicrobial screening of Amaranthus viridis L. leaf and seed extracts. Open J Med Microbiol 23. Khanam UKS, Oba S (2013) Bioactive substances in leaves of two amaranth species, Amaranthus tricolor and A. hypochondriacus. Can J Plant Sci 93(1):47–58 24. Sarker U, Oba S (2018) Drought stress enhances nutritional and bioactive compounds, phenolic acids and antioxidant capacity of Amaranthus leafy vegetable. BMC Plant Biol 18(1):1–15 25. Choudhary N, Chatterjee M, Kumar S, Singh G, Suttee A (2021) Effect of conventional method and microwave assisted extraction on phytoconstituents of Chenopodium album. Mater Today: Proc 45:5362–5367 26. Ramproshad S, Mondal B, Mondal M, Uddin SJ, Hossain MG (2018) Comparative phytochemical & pharmacological study on Enhydra fluctuans, Alternanthera philoxeroides and Chenopodium album. Pharmacologyonline 3:337–353 27. Choudhury BH, Baruah AM, Sarmah TC, Baishya S (2017) Nutritional and antinutritional composition of twenty five indigenous leafy vegetables of Jorhat District of Assam State India. Asian J Chem 29(1):65 28. Barua A, Alam MS, Junaid M, Akter Y, Afrose SS, Sharmin T et al (2021) Phytochemistry, traditional uses and pharmacological properties of Enhydra fluctuans Lour: a Comprehensive Review. Curr Pharm Biotechnol 22(8):1061–1068 29. Wang P, Su Z, Yuan W, Deng G, Li S (2012) Phytochemical constituents and pharmacological activities of Eryngium L.(Apiaceae) 30. Malik T, Pandey DK, Roy P, Okram A (2016) Evaluation of phytochemicals, antioxidant, antibacterial and antidiabetic potential of Alpinia galanga and Eryngium foetidum Plants of Manipur (India). Pharmacogn J 8(5) 31. Arokiyaraj S, Bharanidharan R, Agastian P, Shin H (2018) Chemical composition, antioxidant activity and antibacterial mechanism of action from Marsilea minuta leaf hexane: methanol extract. Chem Cent J 12(1):1–11 32. Iqbal A, Ashique S, Pal S, Ali MS, Pramanik S, Sarkar P (2021) phytochemical and pharmacological establishment of traditional ethnomedicinal plant ‘Marsilea Minuta’-a review. NVEO-Nat Volatiles Essent Oils J| NVEO, 305–316 33. Chakraborthy R, De B, Devanna N, Sen S (2012) Total phenolic, flavonoid content and antioxidant capacity of Marsilea minuta L., an Indian vegetable. Int J Pharm Sci Rev Res 16:79–84 34. Khatoniar S, Barooah MS, Baruah IC (2018) Qualitative and quantitative phytochemical assessment and antioxidant activity of selected green leafy vegetables of Assam. J Pharmacogn Phytochem 7(3):1762–1765 35. Semwal P, Painuli S, Painuli KM, Antika G, Tumer TB, Thapliyal A et al (2021) Diplazium esculentum (Retz.) Sw.: ethnomedicinal, phytochemical, and pharmacological overview of the Himalayan Ferns. Oxid Med Cell Longev 36. Amiri H (2012) Volatile constituents and antioxidant activity of flowers, stems and leaves of Nasturtium officinale R. Br. Nat Prod Res 26(2):109–115 37. Rawal P, Negi N, Sah AN, Guglani A (2021) A comparative study of antioxidant potential and phytochemical contents of different extracts of wild Nasturtium Officinale WT Aiton collected from Kumaun Region of Uttarakhand 38. Repaji´c M, Cegledi E, Zori´c Z, Pedisi´c S, Elez Garofuli´c I, Radman S et al (2021) Bioactive compounds in wild nettle (Urtica dioica L.) leaves and stalks: polyphenols and pigments upon seasonal and habitat variations. Foods 10(1):190

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

129

39. Kukri´c ZZ, Topali´c-Trivunovi´c LN, Kukavica BM, Matoš SB, Paviˇci´c SS, Boroja MM, Savi´c AV (2012) Characterization of antioxidant and antimicrobial activities of nettle leaves (Urtica dioica L.). Acta Period Technol 43:257–272 40. Stankovi´c M, Terzi´c J, Stefanovi´c O (2019) Synergistic antibacterial activity of Curcuma longa L. and Urtica dioica L. extracts and preservatives. Kragujev J Sci 41. Dhouibi R, Affes H, Salem MB, Hammami S, Sahnoun Z, Zeghal KM, Ksouda K (2020) Screening of pharmacological uses of Urtica dioica and others benefits. Prog Biophys Mol Biol 150:67–77 42. Rutto LK, Xu Y, Ramirez E, Brandt M (2013) Mineral properties and dietary value of raw and processed stinging nettle (Urtica dioica L.). Int J Food Sci 43. Neugart S et al (2017) Indigenous leafy vegetables of Eastern Africa—A source of extraordinary secondary plant metabolites. Food Res Int 100:411–422 44. Ajayi OA, Olumide MD, Tayo GO, Akintunde AO (2020) Evaluation of chemical and elemental constituents of Centella asiatica leaf meal. Afr J Agric Res 16(5):661–666 45. Dhakar RC, Maurya SD, Pooniya BK, Bairwa N, Gupta M (2011) Moringa: the herbal gold to combat malnutrition 46. Singh P, Khan M, Hailemariam H (2017) Nutritional and health importance of Hibiscus sabdariffa: a review and indication for research needs. J. Nutr. Health Food Eng 6(5):00212 47. Md Nazmul H, Akhtaruzzaman M, Md Zakir S (2013) Estimation of Vitamins B-complex (B 2, B 3, B 5 and B 6) of some leafy vegetables indigenous to Bangladesh by HPLC method. J Anal Sci Methods Instrum 48. Ray A, Ray R (2022) The leafy greens of India-their diversity, pattern of consumption, and overriding implication on food and nutrition security. Agroecol Sustain Food Syst 46(3):432– 451 49. Jayasinghe MA, Senadheera SPAS, Wijesekara I, Ranaweera KKDS (2019) Determination of macronutrient compositions in selected, frequently consumed leafy vegetables, prepared according to common culinary methods in Sri Lanka. Vidyodaya J Sci 22(2) 50. Poonia A, Upadhayay A (2015) Chenopodium album Linn: review of nutritive value and biological properties. J Food Sci Technol 52(7):3977–3985 51. Koca I, Hasbay I, Bostanci S, Yilmaz VA, Koca AF (2015) Some wild edible plants and their dietary fiber contents. Pak J Nutr 14(4):188 52. Datta S, Sinha BK, Bhattacharjee S, Seal T (2019) Nutritional composition, mineral content, antioxidant activity and quantitative estimation of water soluble vitamins and phenolics by RP-HPLC in some lesser used wild edible plants. Heliyon 5(3):e01431 53. Chyne DAL, Ananthan R, Longvah T (2019) Food compositional analysis of Indigenous foods consumed by the Khasi of Meghalaya, North-East India. J Food Compos Anal 77:91–100 54. Bhati D, Bhatnagar V, Acharya V (2016) Effect of pre-milling processing techniques on pearl millet grains with special reference to in-vitro iron availability. Asian J Dairy Food Res 35(1):76–80 55. Sinha R (2018) Nutritional analysis of few selected wild edible leafy vegetables of tribal of Jharkhand, India. IJCMAS 7:1323–1329 56. Gupta S, Srivastava A, Lal EP (2017) Food and nutritional security through wild edible vegetables or weeds in two district of Jharkhand India. J Pharmacogn Phytochem 6(6):1402– 1409 57. Pradeepkumar T, Indira V, Sankar M (2015) Nutritional evaluation of wild leafy vegetables consumed by tribals in the Wayanad District of Kerala. Proc Natl Acad Sci India Sect B: Biolo Sci 85(1):93–99 58. Sarwar S, Tuz-Zohora F, Khatun O, Begum P, Khatun M, Ahsan M, Nazrul SI (2020) Estimation of B-vitamins (B1, B2, B3 and B6) by HPLC in vegetables including ethnic selected varieties of Bangladesh. Pharm Pharmacol Int J 8(1):16–23 59. Komarayanti S, Suharso W, Herrianto E (2020) Local fruits and vegetables of Jember District that can increase immunity during the Covid-19 pandemic. Budapest Int Res Exact Sci (BirEx) J 2(4):492–508

130

E. Bala and S. Singha

60. Al-Snafi AE (2020) Phenolics and flavonoids contents of medicinal plants, as natural ingredients for many therapeutic purposes-A review. IOSR J Pharm 10(7):42–81 61. Said AAH, Otmani ISE, Derfoufi S, Benmoussa A (2015) Highlights on nutritional and therapeutic value of stinging nettle (Urtica dioica). Int J Pharm Pharm Sci 7(10):8–14 62. Pradhan S, Manivannan S, Tamang JP (2015) Proximate, mineral composition and antioxidant properties of some wild leafy vegetables 63. Meckling AK (2006) Nutrient-drug interactions. Taylor & Francis. ISBN-13:978-1-42001913-1 64. Agostoni C, Riva E, Giovannini M (1995) Dietary fiber in weaning foods of young children. Pediatrics 96(5):1002–1005 65. Khachik F, Carvalho L, Bernstein PS, Muir GJ, Zhao DY, Katz NB Chemistry, distribution, and metabolism of tomato carotenoids and their impact on human health. Exp Biol Med (Maywood) 227(10):845–851 66. van Het Hof KH, West CE, Weststrate JA, Hautvast JG (2000) Dietary factors that affect the bioavailability of carotenoids. J Nutr 130(3):503–506 67. Pérez-Jiménez J, Serrano J, Tabernero M, Arranz S, Díaz-Rubio ME, García-Diz L, Goñi I, Saura-Calixto F (2009) Bioavailability of phenolic antioxidants associated with dietary fiber: plasma antioxidant capacity after acute and long-term intake in humans. Plant Foods Hum Nutr 64(2):102–107 68. Pods˛edek A, Sosnowska D, Redzynia M, Koziołkiewicz M (2008) Effect of domestic cooking on the red cabbage hydrophilic antioxidants. Int J Food Sci Technol 43(10):1770–1777 69. Mazzeo T, N’Dri D, Chiavaro E, Visconti A, Fogliano V, Pellegrini N (2011) Effect of two cooking procedures on phytochemical compounds total antioxidant capacity and colour of selected frozen vegetables. Food Chem 128:627–633 70. Rani EP, Fernando RRS (2016) Effect of cooking on total antioxidant activity in selected vegetables. Int J Home Sci 2:218–222 71. Ng ZX, Chai JW, Kuppusamy UR (2011) Customized cooking method improves total antioxidant activity in selected vegetables. Int J Food Sci Nutr 62(2):158–163 72. Do TN, Hwang E (2015) Effects of different cooking methods on bioactive compound content and antioxidant activity of water Spinach (Ipomoea aquatica). Food Sci Biotechnol 24(3):799– 806. https://doi.org/10.1007/s10068-015-0104-1 73. Subramaniam S, Rosdi MHB, Kuppusamy UR (2017) Customized cooking methods enhance antioxidant, antiglycemic, and insulin-like properties of Momordica charantia and Moringa oleifera. J Food Qual 2017:1–9 74. Subudhi BB, Bhoi A (2014) Antioxidative effects of Brassica juncea and Moringa oleifera prepared by different processing methods. J Food Sci Technol 51(4):790–794. https://doi.org/ 10.1007/s13197-011-0542-6 75. Gehse S, Knorr F, Patzelt A, Zastrow L, Meinke MC, Lademann J, Darvin ME (2018) Determination of the effect of boiling on the bioavailability of carotenoids in vegetables using resonance Raman spectroscopy. Laser Phys 28:10 76. Kao FJ, Chiu YS, Tsou MJ, Chiang WD (2012) Effects of Chinese domestic cooking methods on the carotenoid composition of vegetables in Taiwan. Food Sci Technol 46(2):485–492 77. Moyo SM, Serem JC, Bester MJ, Mavumengwana V, Kayitesi E (2020) Influence of boiling and subsequent phases of digestion on the phenolic content, bioaccessibility, and Bioactivity of Bidens pilosa (Blackjack) leafy vegetable. Food Chem 311 78. Sultana B, Anwar F, Iqbal S (2008) Effect of different cooking methods on the antioxidant activity of some vegetables from Pakistan. Int J Food Sci Technol 43(3):560–567 79. Gunathilake K, Ranaweera K, Rupasinghe H (2018) Effect of different cooking methods on polyphenols, carotenoids and antioxidant activities of selected edible leaves. Antioxid (Basel, Switzerland) 7(9):117. https://doi.org/10.3390/antiox7090117 80. Turkmen N, Sari F, Velioglu YS (2005) The effect of cooking methods on total phenolics and antioxidant activity of selected green vegetables. Food Chem 93(4):713–718 81. Eriksen JN, Luu AY, Dragsted LO, Arrigoni E (2016) In vitro liberation of carotenoids from spinach and Asia salads after different domestic kitchen procedures. Food Chem 203:23–27

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

131

82. Zeb A (2019) Food frying: chemistry, biochemistry, and safety. Wiley 83. Banerjee S, Sahu CK (2017) A short review on vacuum frying-a promising technology for healthier and better fried foods. Int J Nutr Health Sci 2:68–71 84. Cheng KW, Shi JJ, Ou SY, Wang M, Jiang Y (2010) Effects of fruit extracts on the formation of acrylamide in model reactions and fried potato crisps. J Agric Food Chem 58(1):309–312 85. Zeb A, Habib A (2018) Lipid oxidation and changes in the phenolic profile of watercress (Nasturtium officinale L.) leaves during frying. J Food Meas Charact 12(4):2677–2684 86. Zeb A (2020) Concept, mechanism, and applications of phenolic antioxidants in foods. J Food Biochem 44(9):e13394 87. Salazar-González C, Martín-González S, Fernanda M, López-Malo A, Sosa-Morales ME (2012) Recent studies related to microwave processing of fluid foods. Food Bioprocess Technol 5(1):31–46 88. Zhang M, Tang J, Mujumdar AS, Wang S (2006) Trends in microwave-related drying of fruits and vegetables. Trends Food Sci Technol 17(10):524–534 89. Vadivambal R, Jayas DS (2010) Non-uniform temperature distribution during microwave heating of food materials—A review. Food Bioprocess Technol 3(2):161–171 90. Song L, Thornalley PJ (2007) Effect of storage, processing and cooking on glucosinolate content of Brassica vegetables. Food Chem Toxicol 45(2):216–224 91. Ötles S, Çagindi Ö (2007) 2.2 Carotenoids as natural colorants. Food Color: Chem Funct Prop 51 92. Verpoorte R (1998) Exploration of nature’s chemodiversity: the role of secondary metabolites as leads in drug development. Drug Discov Today 3(5):232–238 93. Fong LY, Ng CT, Yong YK, Hakim MN, Ahmad Z (2019) Asiatic acid stabilizes cytoskeletal proteins and prevents TNF-α-induced disorganization of cell-cell junctions in human aortic endothelial cells. Vascul Pharmacol 117:15–26 94. Ding B, Niu W, Wang S, Zhang F, Wang H, Chen X et al (2022) Centella asiatica (L.) Urb. attenuates cardiac hypertrophy and improves heart function through multi-level mechanisms revealed by systems pharmacology. J Ethnopharmacol 291:115106 95. Legiawati L, Bramono K, Indriatmi W, Yunir E, Setiati S, Jusman SWA et al (2020) Oral and topical Centella asiatica in type 2 diabetes mellitus patients with dry skin: a three-arm prospective randomized double-blind controlled trial. Evid-Based Complement Altern Med 96. Giribabu N, Srinivasarao N, Swapna Rekha S, Muniandy S, Salleh N (2014) Centella asiatica attenuates diabetes induced hippocampal changes in experimental diabetic rats. Evid-Based Complement Altern Med 97. Sun B, Wu L, Wu Y, Zhang C, Qin L, Hayashi M et al (2020) Therapeutic potential of Centella asiatica and its triterpenes: a review. Front Pharmacol 1373 98. Mabrouki L, Rjeibi I, Taleb J, Zourgui L (2020) Cardiac ameliorative effect of Moringa oleifera leaf extract in high-fat diet-induced obesity in rat model. BioMed Res Int 99. Khor KZ, Lim V, Moses EJ, Abdul Samad N (2018) The in vitro and in vivo anticancer properties of Moringa oleifera. Evid-Based Complement Altern Med 100. Paikra BK (2017) Phytochemistry and pharmacology of Moringa oleifera Lam. J Pharmacop 20(3):194 101. Ali A, Akhtar N, Mumtaz AM, Khan MS, Iqbal FM, Zaidi SS (2013) In vivo skin irritation potential of a cream containing Moringa oleifera leaf extract. Afr J Pharm Pharmacol 7(6):289–293 102. Mahdi HJ, Khan NAK, Asmawi MZB, Mahmud R, Vikneswaran A, Murugaiyah L (2018) In vivo anti-arthritic and anti-nociceptive effects of ethanol extract of Moringa oleifera leaves on complete Freund’s adjuvant (CFA)-induced arthritis in rats. Integr Med Res 7(1):85–94 103. Mehta A, Agrawal B (2008) Investigation into the mechanism of action of Moringa oleifera for its anti-asthmatic activity. Adv Trad Med 8(1):24–31 104. Singh RJ, Kumar GDU, Research in pharmacy and health sciences 105. Sandamali JA, Hewawasam RP, Jayatilaka KA, Mudduwa LK (2020) Cardioprotective potential of Murraya koenigii (L.) Spreng. leaf extract against doxorubicin-induced cardiotoxicity in rats. Evid-Based Complement Altern Med

132

E. Bala and S. Singha

106. Noolu B, Gogulothu R, Bhat M, SYH Qadri S, Sudhakar Reddy V, Bhanuprakash Reddy G, Ismail A (2016) In vivo inhibition of proteasome activity and tumour growth by Murraya koenigii leaf extract in breast cancer xenografts and by its active flavonoids in breast cancer cells. Anti-Cancer Agents Med Chem (Formerly Curr Med Chem-Anti-Cancer Agents) 16(12):1605–1614 107. James SA, Omwirhiren RE, Joshua IA, Dutse I (2016) Anti-diabetic properties and phytochemical studies of ethanolic leaf extracts of Murraya koenigii and Telfairia occidentalis on alloxan-induced diabetic albino rats. Ornament 49 108. Vasudevan M, Parle M, Sengottuvelu S, Shanmugapriya T (2008) Nootropic Potential of Murraya koenigii leaves in Rats. Adv Tradit Med 8(4):365–373 109. Gupta VANDANA, Sharma MUKTA (2010) Protective effect of Murraya koenigii on lipid peroxide formation in isolated rat liver homogenate. Int J Pharma Bio Sci 1(3):1–6 110. Nagappan T, Segaran TC, Wahid MEA, Ramasamy P, Vairappan CS (2012) Efficacy of carbazole alkaloids, essential oil and extract of Murraya koenigii in enhancing subcutaneous wound healing in rats. Molecules 17(12):14449–14463 111. Kuriyan R, Kumar DR, Kurpad AV (2010) An evaluation of the hypolipidemic effect of an extract of Hibiscus Sabdariffa leaves in hyperlipidemic Indians: a double blind, placebocontrolled trial. BMC Complement Altern Med 10(1):1–8 112. Meraiyebu AB, Olaniyan OT, Eneze C, Anjorin YD, Dare JB (2013) Anti-inflammatory activity of methanolic extract of Hibiscus sabdariffa on carrageenan induced inflammation in wistar rat. Int J Pharm Sci Inven 2(3):22–24 113. Ragupathi G (2017) Neuropharmacological effects of Methanolic extract of leaves of Amaranthus viridis. L In Rats & Mice. Doctoral dissertation, The Erode College of Pharmacy and Research Institute, Erode 114. Sahoo HB, Sahoo SK, Mishra K, Sagar R (2015) Evaluation of the wound-healing potential of Amaranthus viridis (Linn.) in experimentally induced diabetic rats. Int J Nutr Pharmacol Neurol Dis 5(2):50 115. Jin YS, Li CM, Xuan YH, Jin YZ, Chen ML, Row KH (2013) Anticancer activities of extract from Amaranthus viridis L. Asian J Chem 25(14):7857 116. Bihani GV, Kadam PP, Bodhankar SL (2015) Antiarthritic activity of hydroalcoholic extract of leaves of Amaranthus tricolor in Freund’s complete adjuvant-induced arthritis in Wistar rats. World J Pharm Res 4(4):1337–1354 117. Rana S, Rahman S, Sana S, Biswas TK, Hashem AKM, Parvin S, Mazumder K (2020) Anticancer potential of Chenopodium album leaf extract against Ehrlich ascites carcinoma cells in Swiss albino mice. Future J Pharm Sci 6(1):1–9 118. Singh P, Shivhare Y, Singhai AK, Sharma A (2010) Pharmacological and phytochemical profile of Chenopodium album linn. Res J Pharm Technol 3(4):960–963 119. Sharma A, Kaur S, Shri R, Evaluation of antidepressant activity of Chenopodium album extracts and fractions in mice 120. Dai Y, Ye WC, Wang ZT, Matsuda H, Kubo M, But PPH (2002) Antipruritic and antinociceptive effects of Chenopodium album L. in mice. J Ethnopharmacol 81(2):245–250 121. Mousavi T, Salek Moghadam A, Falak R (2008) Immunotherapy of Chenopodium album induced asthma by intranasal administration of CpG oligodeoxynucleotides in BALB/c mice. Iran J Immunol 5(1):57–63 122. Arora SK, Itankar PR, Verma PR, Bharne AP, Kokare DM (2014) Involvement of NFκB in the antirheumatic potential of Chenopodium album L., aerial parts extracts. J Ethnopharmacol 155(1):222–229 123. Hasan MN, Sabrin F, Rokeya B, Khan MSH, Ahmed MU, Matondo A et al (2019) Glucose and lipid lowering effects of Enhydra fluctuans extract in cadmium treated normal and type-2 diabetic model rats. BMC Complement Altern Med 19(1):1–10 124. Sannigrahi S, Mazumder UK, Pal D, Mishra SL, Maity S (2011) Flavonoids of Enhydra fluctuans exhibits analgesic and anti-inflammatory activity in different animal models. Pak J Pharm Sci 24(3)

Protective Role of Leafy Vegetables in Rural Areas: Critical Review …

133

125. Zhang X, Chen J, Zhou S, Zhao H (2022) Ethanol extract of Eryngium foetidum leaves induces mitochondrial associated apoptosis via ROS generation in human gastric cancer cells. Nutr Cancer 1–11 126. Garcia MD, Saenz MT, Gomez MA, Fernandez MA (1999) Topical antiinflammatory activity of phytosterols isolated from Eryngium foetidum on chronic and acute inflammation models. Phytother Res: Int J Devot Pharmacol Toxicol Eval Nat Product Deriv 13(1):78–80 127. Dawilai S, Muangnoi C, Praengamthanachoti P, Tuntipopipat S (2013) Anti-inflammatory activity of bioaccessible fraction from Eryngium foetidum leaves. BioMed Res Int 128. Janwitthayanuchit K, Kupradinun P, Rungsipipat A, Kettawan A, Butryee C (2016) A 24weeks toxicity study of Eryngium foetidum Linn. Leaves in mice. Toxicol Res 32(3):231–237 129. Bhattamisra SK, Singh PN, Singh SK, Kumar V (2007) Anxiolytic activity of Marsilea minuta Linn in rodents. J Herb Med Toxicol 1(1):15–20 130. Gupta RS, Kumar P, Sharma A, Bharadwaj TN, Dixit VP (2000) Hypocholesterolemic activity of Marsilea minuta in gerbils. Fitoterapia 71(2):113–117 131. Sajini RJ, Prema S, Chitra K (2019) Phytoconstituents, pharmacological activities of Marsilea Minuta L. (Marsileaceae)-an overview. Int J Pharm Sci Res 10(4):1582–1587 132. Junejo JA, Gogoi G, Islam J, Rudrapal M, Mondal P, Hazarika H, Zaman K (2018) Exploration of antioxidant, antidiabetic and hepatoprotective activity of Diplazium esculentum-A wild edible plant from North Eastern India. Fut J Pharm Sci 4(1):93–101 133. Roy S, Tamang S, Dey P, Chaudhuri TK (2013) Assessment of the immunosuppressive and hemolytic activities of an edible fern. Diplazium esculentum. Immunopharmacol Immunotoxicol 35(3):365–372 134. Das B, Paul T, Apte KG, Parab PB, Chauhan R, Saxena RC (2012) Antianaphylactic and mast cell stabilizing activity of Diplazium esculentum Retz. On sensitized Wistar rats. Inventi Impact Ethnopharmacol 3:136–141 135. Kaushik A, Jijta C, Kaushik JJ, Zeray R, Ambesajir A, Beyene L (2012) FRAP (Ferric reducing ability of plasma) assay and effect of Diplazium esculentum (Retz) Sw. (a green vegetable of North India) on central nervous system 136. Clemente M, Miguel M, Gribner C, Moura PF, Rigoni AAR, Fernandes LC, Miguel OG (2019) Watercress, as a functional food, with protective effects on human health against oxidative stress: a review study. Int J Med Plants Nat Prod 5(3):12–16 137. Panahi Kokhdan E, Khodabandehloo H, Ghahremani H, Doustimotlagh AH (2021) A narrative review on therapeutic potentials of watercress in human disorders. Evid-Based Complement Altern Med 138. Sedaghattalab M, Razazan M, Shahpari M, Azarmehr N, Larki RA, Sadeghi H et al (2021) The effect of the hydroalcoholic extract of watercress on the levels of protein carbonyl, inflammatory markers, and Vitamin E in chronic hemodialysis patients. Biochem Res Int 139. Fenton-Navarro B, Martínez MU, Castro BF, Castillo OM, López-Rodríguez M, Arellanes SP, Hernández AV (2018) Antioxidant and hypoglycemic effects of watercress (Nasturtium officinale) extracts in diabetic rats. Afr J Tradit Complement Altern Med 15(2):68–79 140. Klimek-Szczykutowicz M, Szopa A, Ekiert H (2018) Chemical composition, traditional and professional use in medicine, application in environmental protection, position in food and cosmetics industries, and biotechnological studies of Nasturtium officinale (watercress)—A review. Fitoterapia 129:283–292 141. Ranjbari A, Azarbayjani MA, Yusof A, Halim Mokhtar A, Akbarzadeh S, Ibrahim MY, Dehghan F (2016) In vivo and in vitro evaluation of the effects of Urtica dioica and swimming activity on diabetic factors and pancreatic beta cells. BMC Complement Altern Med 16(1):1– 11 142. Testai L, Chericoni S, Calderone V, Nencioni G, Nieri P, Morelli I, Martinotti E (2002) Cardiovascular effects of Urtica dioica L.(Urticaceae) roots extracts: in vitro and in vivo pharmacological studies. J Ethnopharmacol 81(1):105–109 143. Zemmouri H, Sekiou O, Ammar S, El Feki A, Bouaziz M, Messarah M, Boumendjel A (2017) Urtica dioica attenuates ovalbumin-induced inflammation and lipid peroxidation of lung tissues in rat asthma model. Pharm Biol 55(1):1561–1568

134

E. Bala and S. Singha

144. Esposito S, Bianco A, Russo R, Di Maro A, Isernia C, Pedone PV (2019) Therapeutic perspectives of molecules from Urtica dioica extracts for cancer treatment. Molecules 24(15):2753 145. Bazazzadegan N, Shasaltaneh MD, Saliminejad K, Kamali K, Banan M, Khorshid HRK (2017) Effects of herbal compound (IMOD) on behavior and expression of Alzheimer’s disease related genes in Streptozotocin-rat model of sporadic Alzheimer’s disease. Advanced Pharmaceutical Bulletin 7(3):491 146. Zouari Bouassida K, Bardaa S, Khimiri M, Rebaii T, Tounsi S, Jlaiel L, Trigui M (2017) Exploring the Urtica dioica leaves hemostatic and wound-healing potential. BioMed Res Int