Ricebean: Exploiting the Nutritional Potential of an Underutilized Legume [1st ed.] 9789811552922, 9789811552939

Citation preview

Rajan Katoch

Ricebean

Exploiting the Nutritional Potential of an Underutilized Legume

Ricebean

Rajan Katoch

Ricebean Exploiting the Nutritional Potential of an Underutilized Legume

Rajan Katoch Department of Genetics & Plant Breeding CSK Himachal Pradesh Krishivishvavidyala Palampur, Himachal Pradesh, India

ISBN 978-981-15-5292-2 ISBN 978-981-15-5293-9 https://doi.org/10.1007/978-981-15-5293-9

(eBook)

# Springer Nature Singapore Pte Ltd. 2020 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore

Foreword

v

Preface

Green revolution is a landmark in the history of global agriculture where the primary focus was to increase the production of staple food crops. Although success has been achieved in increasing crop productivity, the over-dependence on few crops and the limited availability of nutritionally rich food are slowly elevating the probability of malnutrition. Therefore, there is a need to look for all possible solutions in making the world nutritionally sustainable. There are many food crops designated as minor/ neglected/underutilized crops which have been domesticated parallel to the globally recognized staple food crops. These underutilized crops generally have superior traits over staple food crops and provide a valuable and sustainable complement to other means for the attainment of food and nutritional security. Their resilience in adverse growing conditions makes them suitable in the face of changing climatic scenario. Realizing the potential of underutilized crops, global scientific and economic interests are now emerging. Various international and national organizations are working independently or linking with each other on the popularization and utilization of the underutilized crops. Rice bean [Vigna umbellata (Thunb.) Ohwi and Ohashi], a potential underutilized crop is of current interest in view of its production potential and nutritive profile with high protein content, amino acid composition, and appreciable level of micronutrients. The crop also has favorable agronomic attributes with excellent climatic resilience which support it to thrive well in unpredictable and hostile growing conditions. Rice bean also has high nodulation efficiency which makes it a potential green manure crop for crop rotation and an intercrop to build up soil nutritional status. It is also utilized as a fodder crop producing a comparatively good amount of palatable and nutritious fodder. Rice bean has remarkable storage life because of high levels of defensive proteins particularly the enzyme inhibitors. This unique characteristic makes rice bean to be explored for broadening the plant defense gene pool through advanced molecular techniques. For the first time, we have investigated the potential of inhibitory proteins (RbTI and RbL) from rice bean as a source of resistance factor against insect pests. The book entitled “Ricebean: Exploiting the Nutritional Potential of an Underutilized Legume” has been presented keeping in view the importance of crop in the present scenario. The book has been divided into different sections and every vii

viii

Preface

section deals with unique aspects of the crop. The aim of bringing out this book is to bring forth the scientific facts on the potential of the crop. I truly believe that the book would facilitate the scientists and researchers for further exploring the potential of the crop for meeting global challenges in food and nutritional security. Palampur, India

Rajan Katoch

Acknowledgement

The author is highly thankful to the Indian Council of Agricultural Research (ICAR), Department of Science & Technology (DST), Department of Biotechnology (DBT), Council for Scientific & Industrial Research (CSIR) Government of India, for supporting research on Rice bean through financial assistance with Research Projects.

ix

Contents

1

Underutilized Crops: An Overview . . . . . . . . . . . . . . . . . . . . . . . 1.1 Diversified Potential of Underutilized Crops . . . . . . . . . . . . . 1.2 Global Distribution of Underutilized Crops . . . . . . . . . . . . . 1.2.1 Asian-Pacific Continent . . . . . . . . . . . . . . . . . . . . 1.2.2 African Continent . . . . . . . . . . . . . . . . . . . . . . . . 1.2.3 North and South American Continent . . . . . . . . . . 1.3 Potential Underutilized Crops of India . . . . . . . . . . . . . . . . . 1.3.1 Food Legumes . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.2 Food Crops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.3 Vegetables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.4 Oilseed Crops . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.5 Industrial Crops . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . .

1 2 4 4 5 5 7 7 14 17 19 20 25

2

Status of Research on Underutilized Crops for Food Security . . . 2.1 International Organizations and their Research Activities on Underutilized Crops . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2 Research Activities on Underutilized Crops in India . . . . . . . 2.2.1 Activities on Promotion and Utilization of Underutilized Crops in India . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.

29

. .

30 36

. .

37 40

Prospects of Underutilized Crops in Combating Poverty, Malnutrition, and Hunger . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1 Underutilized Crops and Food Security . . . . . . . . . . . . . . . . 3.2 Underutilized Crops and Nutritional Security . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . .

41 41 43 45

Constraints in Research, Promotion and Utilization of Underutilized Crops . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1 Strategies for Promoting Underutilized Crops . . . . . . . . . . . . 4.1.1 Information Generation . . . . . . . . . . . . . . . . . . . . 4.1.2 Information Transfer and Communication . . . . . . . 4.1.3 Maintaining Diversity . . . . . . . . . . . . . . . . . . . . .

. . . . .

47 50 50 51 51

3

4

xi

xii

Contents

4.1.4

Enhanced Research and Dissemination of Technology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.5 Uplifting Trade and Market Development . . . . . . . 4.1.6 Creation of Supportive Policy Environment . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . .

52 53 53 54

Rice Bean: A Potential Underutilized Legume . . . . . . . . . . . . . . . 5.1 Taxonomy and Diversification of Rice Bean . . . . . . . . . . . . 5.2 Evolutionary Relationship of Rice Bean with Other Members of Genus Vigna . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3 Origin and Distribution of Rice Bean . . . . . . . . . . . . . . . . . . 5.3.1 Common/Vernacular Names of Rice Bean . . . . . . . 5.4 Agro-Morphological Attributes of Rice Bean . . . . . . . . . . . . 5.5 Germplasm Status of Rice Bean . . . . . . . . . . . . . . . . . . . . . 5.6 Varietal Development in Rice Bean . . . . . . . . . . . . . . . . . . . 5.7 Studies on Different Characteristics of Rice Bean Germplasm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.8 Exploring Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. .

55 56

. . . . . .

58 61 61 64 69 71

. . .

71 73 78

6

Rice Bean Agronomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1 Soil and Climatic Requirements . . . . . . . . . . . . . . . . . . . . . 6.2 Cropping Patterns/Cropping Systems . . . . . . . . . . . . . . . . . . 6.3 Rice Bean Cultivation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.1 Land Preparation . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.2 Seed Rate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.3 Method of Seed Sowing . . . . . . . . . . . . . . . . . . . . 6.3.4 Intercultural Operations . . . . . . . . . . . . . . . . . . . . 6.3.5 Nutrient Management . . . . . . . . . . . . . . . . . . . . . 6.3.6 Crop Maturity and Harvesting . . . . . . . . . . . . . . . 6.3.7 Harvesting Method and Storage . . . . . . . . . . . . . . 6.3.8 Diseases and Pest Management . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . .

81 81 82 83 83 84 84 85 86 86 87 88 89

7

Morpho-Physiological and Productivity Attributes of Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.1 Variation in Morpho-Physiological Traits of Rice Bean Genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.1.1 Morpho-Physiological Attributes of Group-I Genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.1.2 Morpho-Physiological Attributes of Group-II Genotypes (LRB Series) . . . . . . . . . . . . . . . . . . . . 7.1.3 Morpho-Physiological Attributes of Group-III Genotypes (JCR Series) . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.

91

.

92

.

92

.

96

. .

98 102

5

Contents

8

9

10

Nutritional Potential of Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . 8.1 Nutritional Constituents in Different Rice Bean Genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1.1 Protein Content . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1.2 Dietary Fiber . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1.3 Total Carbohydrates . . . . . . . . . . . . . . . . . . . . . . . 8.1.4 Lipid and Fatty Acid Content . . . . . . . . . . . . . . . . 8.1.5 Vitamins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1.6 Amino Acid Composition . . . . . . . . . . . . . . . . . . . 8.1.7 Mineral Content . . . . . . . . . . . . . . . . . . . . . . . . . 8.2 Nutritional and Anti-nutritional Constituents in Different Seed Components of Rice Bean . . . . . . . . . . . . . . . . . . . . . 8.3 Comparison of Nutritional Composition of Rice Bean with Other Vigna Species . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.1 Variation in Nutritional Components of Vigna Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.2 Variation in Anti-nutrient Composition of Vigna Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.3 Protein Profiling of Vigna Species . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Incrimnating Factors in Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . 9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.1.1 Polyphenolic Compounds . . . . . . . . . . . . . . . . . . . 9.1.2 Saponins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.1.3 Phytic Acid Content . . . . . . . . . . . . . . . . . . . . . . . 9.1.4 Flatulence Factors in Ricebean . . . . . . . . . . . . . . . 9.1.5 Oxalates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.2 Incriminating Factors of Protein Origin . . . . . . . . . . . . . . . . 9.2.1 Digestive Enzyme Inhibitors . . . . . . . . . . . . . . . . . 9.2.2 Hemagglutinins . . . . . . . . . . . . . . . . . . . . . . . . . . 9.2.3 Lipoxygenases . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.2.4 Hydrocyanic Acid Content . . . . . . . . . . . . . . . . . . 9.3 Comparative Anti-Nutritional Profile of Different Vigna Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tackling Incriminating Factors . . . . . . . . . . . . . . . . . . . . . . . . . . 10.1 Germination (Sprouting) . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.2 Soaking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.3 Heat Processing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.4 Dehulling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.5 Puffing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.6 Milling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

xiii

.

103

. . . . . . . .

104 105 108 109 110 111 112 114

.

115

.

118

.

119

. . .

122 122 126

.

129

. . . . . . . . . . .

130 130 133 139 140 145 145 145 148 149 152

. .

153 156

. . . . . . .

159 160 161 162 164 164 165

xiv

Contents

10.7 10.8 10.9 10.10 10.11 10.12 10.13

Chemical Treatments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Extrusion Cooking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . High-Pressure Cooking . . . . . . . . . . . . . . . . . . . . . . . . . . . . Canning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Fermentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Combined Treatments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tackling Anti-Nutrients in Rice Bean with Different Processing Techniques . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.13.1 Effect of Soaking on Anti-Nutrients in Different Rice Bean Genotypes . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

12

13

. . . . . .

165 166 166 167 167 168

.

169

. .

171 175

. .

179 180

.

181

.

182

. . . . . . . . . .

183 184 185 194 195 196 197 198 198 202

Rice Bean: A Soil Enricher . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12.1 Biological Nitrogen Fixation in Legumes . . . . . . . . . . . . . . . 12.2 Soil Enrichment by Using Rice Bean as Green Manure and Cover Crop . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12.3 Nitrogen Fixation and Nodulation Efficiency in Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. .

205 207

.

208

. .

210 214

Effect of Fertilizers on Rice Bean Productivity and Quality . . . . . 13.1 Importance of Nutrients in Plant Growth and Development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13.2 Effect of Fertilizer on Productivity of Rice Bean Seeds . . . . . 13.2.1 Effect of Different NPK Levels on Pod Characteristics of Rice Bean . . . . . . . . . . . . . . . . . 13.2.2 Effect of Different NPK Levels on Seed Yield of Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.

215

. .

216 217

.

218

.

218

Rice Bean Foliage as Fodder . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.1 Fodder Production Potential of Rice Bean . . . . . . . . . . . . . . 11.1.1 Fodder Yield of Rice Bean Genotypes of Group-I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.1.2 Fodder Yield from Rice Bean Genotypes of Group-II . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.1.3 Fodder Yield from Rice Bean Genotypes of Group-III . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.2 Biochemical Composition of Rice Bean Forage . . . . . . . . . . 11.2.1 Nutritional Constituents in Rice Bean Forage . . . . . 11.3 Anti-Nutrients in Rice Bean Forage . . . . . . . . . . . . . . . . . . . 11.3.1 Group-1 Rice Bean Genotypes . . . . . . . . . . . . . . . 11.3.2 Group-II Rice Bean Genotypes . . . . . . . . . . . . . . . 11.3.3 Group-III Rice Bean Genotypes . . . . . . . . . . . . . . 11.4 Rice Bean-as Dual Purpose Crop . . . . . . . . . . . . . . . . . . . . . 11.5 Surplus Rice Bean Seeds in Animal Feeding . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Contents

Effect of NPK Application on Protein and Amino Acid Content of Rice Bean Seeds . . . . . . . . . . . . . . . . . . . . . . . . 13.3.1 Effect of Different NPK Levels on Crude Protein Content in Rice Bean Seeds . . . . . . . . . . . . . . . . . 13.3.2 Effect of Different NPK Levels on Tryptophan Content (g/16 g N) in Rice Bean Seeds . . . . . . . . . 13.3.3 Effect of Different NPK Levels on Methionine Content (g/16 g N) in Rice Bean Seeds . . . . . . . . . 13.4 Effect of Fertilizer on Rice Bean Fodder Yield . . . . . . . . . . . 13.4.1 Effect of Different NPK Levels on Plant Height (cm) . . . . . . . . . . . . . . . . . . . . . . 13.4.2 Effect of Different NPK Levels on Fodder Yield (q/ha) . . . . . . . . . . . . . . . . . . . . . 13.5 Effect of NPK Application on Rice Bean Fodder Quality . . . 13.5.1 Effect of Different NPK Levels on Crude Protein Content in Rice Bean Fodder . . . . . . . . . . . . . . . . 13.5.2 Effect of Different NPK Levels on Crude Fiber Content in Rice Bean Fodder . . . . . . . . . . . . . . . . 13.5.3 Effect of Different NPK Levels on Ash Content in Rice Bean Fodder . . . . . . . . . . . . . . . . . . . . . . 13.6 Effect of Fertilizer on Nodulation Efficiency of Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13.6.1 Effect of Different NPK Levels on Nodule Weight and Nodule Numbers in Rice Bean . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

xv

13.3

14

Insect Pest Resistance Factors in Rice Bean . . . . . . . . . . . . . . . . . 14.1 Protease Inhibitor from Rice Bean and Their Inhibitory Potential . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.1.1 Trypsin Inhibitor Content in Different Parts of Rice Bean Plant . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.1.2 Trypsin Inhibitor Content in Intact Pods, Developing and Mature Seeds of Different Rice Bean Genotypes . . . . . . . . . . . . . . . . . . . . . . 14.1.3 Isolation and Purification of Trypsin Inhibitor from Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . 14.1.4 Thermal and pH Stabilities of Rice Bean Trypsin Inhibitor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.1.5 Inhibitory Effect of Rice Bean Trypsin Inhibitor on Spodoptera Gut Proteases . . . . . . . . . . . . . . . . 14.2 Protease Inhibitor Gene (RbTI) from Rice Bean . . . . . . . . . . 14.2.1 Cloning and Characterization of Rice Bean Trypsin Inhibitor Gene . . . . . . . . . . . . . . . . . . . . . 14.2.2 Phylogenetic Analysis and 3D Structure Prediction of Rice Bean Trypsin Inhibitor . . . . . . . 14.2.3 RbTI Gene Expression . . . . . . . . . . . . . . . . . . . . .

.

221

.

221

.

221

. .

223 223

.

224

. .

224 226

.

226

.

226

.

228

.

228

. .

229 230

.

233

.

234

.

236

.

236

.

237

.

239

. .

241 243

.

243

. .

245 246

xvi

Contents

14.2.4

Spatiotemporal Expression Analysis of Rice Bean Trypsin Inhibitor Gene . . . . . . . . . . . . . . . . . . . . . . 14.2.5 Inhibitory Effect of Recombinant TI on Hessian Fly Gut Proteases . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.3 α-Amylase Inhibitor (α-AI) from Rice Bean . . . . . . . . . . . . . . 14.3.1 α-AI Content in Different Rice Bean Genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.3.2 Purification of α-AI from Rice Bean . . . . . . . . . . . . 14.3.3 N-Terminal Analysis of Purified α-AI . . . . . . . . . . . 14.3.4 Thermal and pH Stability of Rice Bean α-AI . . . . . . 14.3.5 Inhibitory Effect of α-AI from Rice Bean . . . . . . . . 14.4 Lectins in Insect–Pest Resistance . . . . . . . . . . . . . . . . . . . . . . 14.4.1 Insecticidal Activity of Plant Lectins Against the Agriculturally Important Insects . . . . . . . . . . . . . . . 14.4.2 Cloning and Characterization of Lectin Gene from Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.4.3 Molecular Modeling and Structure Prediction of Rice Bean Lectin . . . . . . . . . . . . . . . . . . . . . . . . 14.4.4 Prediction of Ligand Binding Sites in Rice Bean Lectin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.5 Polyphenolic Compounds . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

16

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.1 Strategies and Impact of Transferring Insect Resistance Genes in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.2 Approaches for Transferring Insect Resistance Genes in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.3 New Biotechnological Tools (NBTs) in Imparting Insect Resistance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.3.1 Gene Knockdown Technology (RNAi) . . . . . . . . . 15.3.2 Transplastomic Engineering . . . . . . . . . . . . . . . . . 15.3.3 CRISPR/Cas9 System . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nutraceutical Potential of Rice Bean . . . . . . . . . . . . . . . . . . . . . . 16.1 Nutraceuticals and Underutilized Legumes . . . . . . . . . . . . . . 16.1.1 Proteins and Peptides . . . . . . . . . . . . . . . . . . . . . . 16.1.2 Minerals and Vitamins . . . . . . . . . . . . . . . . . . . . . 16.1.3 Dietary Fiber . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.1.4 Oligosaccharides . . . . . . . . . . . . . . . . . . . . . . . . . 16.1.5 Saponins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.1.6 Phytic Acid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.1.7 Phenolic Compounds . . . . . . . . . . . . . . . . . . . . . .

247 248 249 251 252 253 253 254 255 256 258 259 261 261 264

.

271

.

273

.

276

. . . . .

279 280 284 284 286

. . . . . . . . .

293 294 294 294 295 295 295 296 296

Contents

17

xvii

16.1.8 Flavonoids and Isoflavones . . . . . . . . . . . . . . . . . . 16.1.9 α-Amylase Inhibitor . . . . . . . . . . . . . . . . . . . . . . . 16.1.10 Tannins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.1.11 Lectins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.2 Rice Bean: A Nutraceutical Legume . . . . . . . . . . . . . . . . . . 16.2.1 Polyphenols in Rice Bean . . . . . . . . . . . . . . . . . . . 16.2.2 Variation of Phenolic Content in Seed Coat, Whole Seed, Dehulled, and Cooked Rice Bean Dhal . . . . . 16.2.3 Dietary Fiber . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.2.4 α-Amylase Inhibitor and α-Glucosidase Inhibitor . . 16.2.5 Saponins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.2.6 Advanced Glycation End Products (AGEs) Inhibitors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16.3 Rice Bean in Traditional Chinese Medicinal System . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . .

297 297 297 298 298 298

. . . .

302 306 307 308

. . .

308 310 312

Value-Added Products from Rice Bean . . . . . . . . . . . . . . . . . . . . 17.1 Value Addition of Food Products . . . . . . . . . . . . . . . . . . . . 17.2 Necessity of Value Addition of Underutilized Crops . . . . . . . 17.3 Physicochemical Attributes of Rice Bean for Formulation of Different Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.3.1 Density, Porosity, and Angle of Repose . . . . . . . . 17.3.2 Hydration Parameters . . . . . . . . . . . . . . . . . . . . . . 17.3.3 Cooking Time . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.4 Physicochemical Properties of Rice Bean Starch . . . . . . . . . . 17.5 Food Fortification with Rice Bean Seed Flour . . . . . . . . . . . 17.6 Preparation of Value-Added Products and Common Culinary Uses of Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.1 Dhal (Boiled Pulse) . . . . . . . . . . . . . . . . . . . . . . . 17.6.2 Nuggets (Barian) . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.3 Stuffed Bread (Bhatura) . . . . . . . . . . . . . . . . . . . . 17.6.4 Halwa (Sweet Pudding) . . . . . . . . . . . . . . . . . . . . 17.6.5 Colocasia Leaf Rolls with Rice Bean Seed Flour (Patrodu) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.6 Pancake . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.7 Noodles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.8 Poha with Rice Bean Sprouts . . . . . . . . . . . . . . . . 17.6.9 Bhujia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.10 Nuggets (Sepuwadi) . . . . . . . . . . . . . . . . . . . . . . . 17.6.11 Wafer with Rice Bean Flour (Papad) . . . . . . . . . . . 17.6.12 Sweet Round Rolls with Rice Bean Flour (Ladoo) . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.13 Boondi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.14 Snack with Rice Bean Seed Flour (Pakauda) . . . . . 17.6.15 Bara . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.6.16 Khichdi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . .

315 315 316

. . . . . .

317 317 318 321 322 325

. . . . .

326 327 328 329 330

. . . . . . .

331 332 332 333 334 335 336

. . . . .

337 338 339 340 342

xviii

Contents

17.6.17

Some Other Value-Added Products from Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17.7 Value Addition and Nutritional Security . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

342 343 345

18

Common Diseases and Insect–Pests of Rice Bean . . . . . . . . . . . . . 18.1 Fungal Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18.1.1 Common Rust . . . . . . . . . . . . . . . . . . . . . . . . . . . 18.1.2 Powdery Mildew . . . . . . . . . . . . . . . . . . . . . . . . . 18.1.3 Rhizoctonia Blight . . . . . . . . . . . . . . . . . . . . . . . . 18.1.4 Anthracnose . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18.1.5 Cercospora Leaf Spot . . . . . . . . . . . . . . . . . . . . . 18.2 Bacterial Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18.2.1 Bacterial Blight . . . . . . . . . . . . . . . . . . . . . . . . . . 18.3 Viral Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18.4 Insect–Pests of Rice Bean . . . . . . . . . . . . . . . . . . . . . . . . . . 18.4.1 Pod Borers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18.4.2 Aphids (Aphis craccivora Koch) . . . . . . . . . . . . . . 18.4.3 Blister Beetles (Mylabris pustulata Thunberg) . . . . 18.4.4 Green Stink Bugs (Nezara spp.) . . . . . . . . . . . . . . 18.4.5 Pod Weevils (Apion spp.) . . . . . . . . . . . . . . . . . . . 18.4.6 Leaf Folders (Hedylepta indicata Fab) . . . . . . . . . 18.4.7 Pod-Sucking Bugs (Anoplocnemis spp.) . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . .

347 348 348 348 348 349 350 350 350 350 351 351 351 352 352 352 352 352 353

19

Strategies for the Projection of Rice Bean as a Potential Pulse . . . 19.1 Generation and Dissemination of Desired Information . . . . . 19.2 Enhancing Genome Base . . . . . . . . . . . . . . . . . . . . . . . . . . 19.3 Linkage with Stakeholders and Farmers . . . . . . . . . . . . . . . . 19.4 Value Addition and Marketing . . . . . . . . . . . . . . . . . . . . . . 19.5 Research and Education . . . . . . . . . . . . . . . . . . . . . . . . . . . 19.6 Creation of Supportive Policy Environment . . . . . . . . . . . . .

. . . . . . .

355 355 356 356 357 358 358

20

Conclusion and Future Prospects . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

361 365

About the Author

Rajan Katoch is currently working as Scientist at the Department of Genetics & Plant Breeding at CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur. He has more than twenty years research experience in the field of biochemistry and biotechnology. He is actively involved in research in the field of biochemistry and molecular biology and headed more than ten research projects as Principal Investigator funded by prestigious organizations. He has received several prestigious awards and honors, such as the Young Scientist Award 2001, award from CSIR, Govt. of India for excellence in biochemistry, Group Study Exchange (GSE) fellowship from South America (Brazil) in 2005, ICAR fellowship in 2011, and DBT Crest Award in 2012. He has also received “appreciation awards” from the United States Department of Agriculture (USDA) for his exemplary work on ricebean protease inhibitor as a transgene for resistance. He is a fellow and member of various professional societies and secretary of the Indian Society of Agricultural Biochemists (PC). He has published over 150 papers in high impact peer-reviewed international and national journals and has authored several successful books.

xix

List of Abbreviations

AI AIA ADF bp CE cm cP CV CT CP CF CD DAP DAS DPPH DM
C EC EE FAO GAE GM gm ha hrs HT IC IU kg LOX M μg μM

α-Amylase inhibitor α-Amylase inhibitor activity Acid detergent fiber Base pair Catechin equivalent Centimeter Centipoise Coefficient of variation Condensed tannins Crude protein Crude fiber Critical difference Days after planting Days after sowing 2,2-diphenyl-1-picrylhydrazyl Dry matter Degree Celsius Exotic collection Ether extract Food and Agriculture Organization Gallic acid equivalent Geometric mean Gram Hectare Hours Hydrolyzable tannins Indigenous collection International Unit Kilogram Lipoxygenase Meter Microgram Micromolar xxi

xxii

mg NDF NS NT Oligo. % PA q/ha RbL RbL RbTI Sec SP SE SD t t/ha TIU TI TP TT TE WHO

List of Abbreviations

Milligram Neutral detergent fiber Nonsignificant Net tannins Oligosaccharides Percent Phytic acid Quintal per hectare Rice bean lectin protein Rice bean lectin gene Rice bean trypsin inhibitor Seconds Simple phenols Standard error Standard deviation Tons Tons per hectare Trypsin inhibitory unit Trypsin inhibitor Total phenols Total tannins Trolox equivalents World Health Organization

List of Figures

Fig. 1.1 Fig. 1.2 Fig. 1.3 Fig. 1.4 Fig. 1.5 Fig. 1.6 Fig. 1.7 Fig. 1.8 Fig. 1.9 Fig. 1.10 Fig. 1.11 Fig. 1.12 Fig. 1.13 Fig. 1.14 Fig. 1.15 Fig. 1.16 Fig. 1.17 Fig. 1.18 Fig. 1.19 Fig. 1.20 Fig. 1.21 Fig. 1.22 Fig. 1.23 Fig. 1.24

Multifaceted potential of underutilized crops . . . . . . . . . . . . . . . . . . . . . . Rice bean plant and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Faba bean plant, pods, and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Winged bean pods and seeds .. . .. . .. .. . .. . .. .. . .. . .. . .. .. . .. . .. . .. .. Canavalia pods and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Adzuki bean pods and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Velvet bean pods and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bambara groundnut plant with seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Moth bean pods and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Horse gram pods and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Amaranth plant and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Buckwheat plant and seeds . .. . . . .. . . . .. . . . .. . . .. . . . .. . . . .. . . . .. . . . .. Chenopod plant and seeds .. . . . . . .. . . . . . .. . . . . . .. . . . . . .. . . . . . .. . . . . . . Job’s tears/adlay . .. . . . . . .. . . . . .. . . . . .. . . . . .. . . . . . .. . . . . .. . . . . .. . . . . .. . Kankoda fruit . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . Sechium edule . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Moringa pods .. . .. . .. . .. . . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . . .. . . Perilla plant . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jatropha curcas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Citrullus colocynthis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Parthenium argentatum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Simmondsia chinensis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cuphea plant . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . The portfolio of some important underutilized crops all with the potential to contribute to the sustainability of environment and humankind. In reading order: rice bean (Vigna umbellata), faba bean (Vicia faba), winged bean (Psophocarpus tetragonolobus), Canavalia sp., adzuki bean (Vigna angularis), velvet bean (Mucuna pruriens), Bambara groundnut (Vigna subterranea), moth bean (Vigna aconitifolia), horse gram (Macrotyloma uniflorum), amaranth (Amaranthus sp.); buckwheat (Fagopyrum sp.), chenopod (Chenopodium sp.), Jobs tears or adlay (Coix lacryma-jobi), kankoda (Momordica dioica), Sechium edule (chow-chow), drumstick

3 9 10 10 11 12 12 13 14 14 15 15 16 17 18 18 19 19 20 21 21 22 22

xxiii

xxiv

Fig. 4.1 Fig. 4.2 Fig. 5.1 Fig. 5.2

List of Figures

(Moringa oleifera), perilla (Perilla frutescens), simarouba (Simarouba glauca), purging nut (Jatropha curcas), tumba (Citrullus colocynthis), guayule (Parthenium argentatum), jojoba (Simmondsia chinensis), lana or khar (Haloxylon salicornicum), cuphea (Cuphea spp.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

23

Major hurdles in promotion and utilization of underutilized crops .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. .. . .. . .. . .. . .. . .. . .. Strategies for promotion and utilization of underutilized crops . .

48 50

Fig. 5.13 Fig. 5.14

Rice bean plant and seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Asiatic Vigna species, their probable wild progenitor and center of domestication (Source: Gautam et al. 2007) . . . . . . . . . . . . . . . . . . . . Differences in cultivated and wild forms of V. umbellata (Source: Bisht et al. 2005) .. . .. . .. . .. . . .. . .. . .. . .. . .. . .. . . .. . .. . .. . .. Global distribution of rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rice bean distribution in India . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Healthy flowering rice bean plant . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Scheme showing periodical stages of rice bean . . . . . . . . . . . . . . . . . . . (a) Pod development stages in rice bean (b) Pod bearing in rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yellowish-brown rice bean seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Diversity in color of rice bean seeds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Seed developmental stages in rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . Different growth stages of rice bean. (a) Vegetative phase (b) Flowering stage (c) Pod formation stage (d) Pod setting stage . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . Field trials with different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . The approach for evaluation and characterization of rice bean . .

Fig. 6.1 Fig. 6.2 Fig. 6.3 Fig. 6.4

Ridge planting of rice bean .. . .. . .. .. . .. . .. .. . .. . .. .. . .. . .. .. . .. . .. .. Rice bean intercropping with maize crop . . . . . . . . . . . . . . . . . . . . . . . . . . Initial stage of crop in field . .. . .. . . .. . . .. . .. . . .. . .. . . .. . . .. . .. . . .. . . . Stacking in rice bean crop . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

82 83 84 86

Fig. 8.1 Fig. 8.2 Fig. 8.3

Nutritional potential of rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Legume seed components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Crude protein and fiber content in different rice bean seed components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Total carbohydrate content in rice bean seed components . . . . . . . . Variation in anti-nutrient composition of Vigna species . . . . . . . . . . Comparison of protein profiles of different Vigna species. Lane 1 ¼ (V. umbellata), Lane 2 ¼ (V. mungo), Lane 3 ¼ (V. radiata), Lane 4 ¼ (V. angularis), Lane 5 ¼ (V. unguiculata), M ¼ Marker . . . . . . . . . . . . . . . . . . . . . . . . . .

104 117

Fig. 5.3 Fig. 5.4 Fig. 5.5 Fig. 5.6 Fig. 5.7 Fig. 5.8 Fig. 5.9 Fig. 5.10 Fig. 5.11 Fig. 5.12

Fig. 8.4 Fig. 8.5 Fig. 8.6

56 59 60 62 63 64 65 66 67 67 68

69 76 77

117 117 124

125

List of Figures

Fig. 9.1 Fig. 9.2 Fig. 9.3 Fig. 9.4 Fig. 9.5 Fig. 9.6 Fig. 9.7

Fig. 9.8 Fig. 10.1 Fig. 10.2

Fig. 10.3 Fig. 10.4

Fig. 10.5 Fig. 10.6

xxv

Structure of hydrolysable and condensed tannins . . . . . . . . . . . . . . . . . Structure of saponins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Phytic acid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Common oligosaccharides in legumes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . The overview of oligosaccharide metabolism in gastro-intestinal tract . . . . .. . . . .. . . . .. . . . .. . . . . .. . . . .. . . . .. . . . .. . . . . .. . . . .. . . . .. . . . . .. . . . . α-amylase inhibitor content in different rice bean genotypes . . . . (a) Erythrocyte network promoted by lectin binding to surface carbohydrate and (b) inhibition of hemagglutinating activity by free carbohydrate (Paiva et al. 2012) . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in anti-nutrient composition of Vigna species . . . . . . . . . . Variation in the hardness of seeds of rice bean genotypes after soaking . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . Variation in the cohesiveness, gumminess (N), springiness and chewiness (N mm) of seeds of rice bean genotypes after soaking . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . Variation in the hardness of seeds of rice bean genotypes after cooking . .. .. . .. . .. .. . .. . .. .. . .. . .. . .. .. . .. . .. .. . .. . .. . .. .. . .. . .. .. . .. . . Variation in cohesiveness, gumminess (N), springiness and chewiness (N mm) of seeds of rice bean genotypes after cooking . .. .. . .. . .. .. . .. . .. .. . .. . .. . .. .. . .. . .. .. . .. . .. . .. .. . .. . .. .. . .. . . Processing techniques for improving nutritional quality of rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Effect of various processing technologies on (a) Raffinose, (b) Stachyose, (c) Verbascose, (d) Lipooxygenases, and (e) Saponin content in the seeds of rice bean genotypes (Katoch 2014). [i: Control; ii: Soaking (24 h); iii: Soaking (48 h); iv: Soaking (72 h); v: Chemical treatments; vi: Roasting; vii: Germination (48 h); viii: Soaking and Cooking; ix: Germination and Cooking] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

131 139 140 141 142 147

148 154 161

162 163

163 170

174

Fig. 11.1

Rice bean at 25% flowering stage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195

Fig. 12.1

Rice bean grown as green manure crop in field . . . . . . . . . . . . . . . . . . . 209

Fig. 13.1

Rice bean crop after treatment with different NPK levels . . . . . . . . 220

Fig. 14.1 Fig. 14.2

Protease–protease inhibitor interaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235 (a) Trypsin inhibitory activity (%) and protein content (mg) in DEAE- Sepharose chromatographic fractions eluted with a 0.1–0.5 M step NaCl gradient, (b) trypsin inhibitory activity (%) and protein content (mg) in Superdex 75 chromatographic fractions, (c) trypsin inhibitory activity (%) and protein content (mg) in Sepharose-trypsin affinity chromatographic fractions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240

xxvi

Fig. 14.3 Fig. 14.4 Fig. 14.5 Fig. 14.6

Fig. 14.7 Fig. 14.8

Fig. 14.9

Fig. 14.10 Fig. 14.11 Fig. 14.12

Fig. 14.13 Fig. 14.14 Fig. 14.15 Fig. 14.16 Fig. 14.17 Fig. 14.18

Fig. 15.1 Fig. 15.2 Fig. 16.1 Fig. 16.2 Fig. 16.3 Fig. 16.4 Fig. 16.5

List of Figures

Effect of pH (a) and of temperature (b) on the activity of purified rice bean trypsin inhibitor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (a) Dissected insect larvae, (b) larval midguts . .. . .. .. . .. . .. .. . .. . . Inhibitory activity of rice bean trypsin inhibitor against gut proteases of Spodoptera litura . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Amplification of partial RbTI gene sequence. (a) Ladder, (b) amplified of RbTI from cDNA, and (c) amplified RbTI gene from genomic DNA . . . .. . . . . . .. . . . . .. . . . . . .. . . . . .. . . . . . .. . . . . .. . . . . .. Nucleotide and deduced corresponding amino acid sequence of RbTI. Source: Katoch et al. (2014) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Phylogenetic analysis of RbTI protein from rice bean and other Leguminosae family BBI proteins along with its homologs from cereals and other plant species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (a) The three-dimensional structure of rice bean trypsin inhibitor (RbTI); (b) alignment of RbTI with mung bean BBI (3myw) revealed conserved disulfide bonds . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . .. Relative expression of RbTI inhibitor in leaf and seed of rice bean. Source: Katoch et al. (2014) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Inhibition of larval gut proteases of Hessian fly with rice bean trypsin inhibitor (Source: Katoch et al. 2014) . . . . . . . . . . . . . . . . . . . . . (a) The rice bean α–AI activity and protein content in various DEAE-Sepharose chromatographic fractions. (b) Superdex 75 chromatographic fractions (1) α-AI activity; (2) protein; (3) NaCl gradient . . .. . .. . .. . . .. . .. . .. . . .. . .. . .. . . .. . .. . .. . . .. . .. . .. . . . Effect of pH (a) and temperature (b) on the rice bean α-AI activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lectin gene sequence from rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (a) 3D structure of RbL monomer and (b) dimer . . . . . . . . . . . . . . . . . Carbohydrate-binding loops in RbL structure . . . . . . . . . . . . . . . . . . . . . Predicted ligand binding sites in RbL protein structure . . . .. . . . . . . Agglutination and agglutination-inhibition assay with recombinant fusion protein (His6-RbL) (GAL galactose, NAG N-acetyl-D-glucosamine, LAC lactose) . . . . . . . . . . . . . . . . . . . . . . .

241 242 242

243 244

245

247 248 249

252 254 258 260 260 262

263

The process of RNA interference (Source: Katoch and Thakur 2012) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281 RNAi mechanism in insect control (Source: Katoch et al. 2013) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282 Therapeutic potential of rice bean imparted by different bioactive components and nutrients . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Major polyphenolic compounds in rice bean . . . . . . . . . . . . . . . . . . . . . . Variation in total phenolic acid content (mgGAE/g) in rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in total flavonoids (mgCE/g) in rice bean genotypes . . Variation in antioxidant potential of rice bean genotypes . . . . . . . .

299 300 301 301 302

List of Figures

Fig. 16.6

Fig. 16.7 Fig. 16.8 Fig. 16.9 Fig. 16.10 Fig. 17.1 Fig. 17.2 Fig. 17.3 Fig. 17.4 Fig. 17.5 Fig. 17.6 Fig. 17.7 Fig. 17.8 Fig. 17.9 Fig. 17.10 Fig. 17.11 Fig. 17.12 Fig. 17.13 Fig. 17.14 Fig. 17.15 Fig. 17.16 Fig. 17.17 Fig. 17.18 Fig. 17.19 Fig. 17.20 Fig. 17.21 Fig. 17.22 Fig. 19.1 Fig. 19.2

xxvii

Phytochemical constituents of seed coat, whole seed, and dehulled and cooked rice bean dhal (Source: Rani and Khabiruddin 2017) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Antioxidant activity of seed coat, whole seed, and dehulled and cooked rice bean dhal . . . .. . . . .. . . . .. . . . .. . . .. . . . .. . . . .. . . . .. . . .. . . . .. A-glucosidase inhibition activities in rice bean (Source: Yao et al. 2012) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Adzuki saponins isolated from rice bean . . . .. . . .. . . . .. . . .. . . . .. . . .. (a and b) AGEs inhibition activities of rice bean (Source: Yao et al. 2012) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (a) Swelling capacity. (b) Swelling index of seeds of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (a) Hydration capacity. (b) Hydration index of seeds of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cooking time of seeds of different rice bean genotypes . . . . . . . . . . Amylose content and pasting temperature of rice bean starch . . . Physical properties of rice bean starch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Physical properties of food multimix prepared from rice bean . . . Dhal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nuggets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stuffed bhatura . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Halwa (sweet pudding) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Colocasia leaf rolls with rice bean seed flour . . . . . . . . . . . . . . . . . . . . . . Rice bean pancake . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Noodles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Poha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bhujia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sepuwadi .. .. . .. .. . .. .. . .. .. . .. . .. .. . .. .. . .. .. . .. .. . .. .. . .. .. . .. .. . .. . . Papad . . . . . .. . . . . . .. . . . . .. . . . . . .. . . . . . .. . . . . .. . . . . . .. . . . . . .. . . . . .. . . . . . . Ladoo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Boondi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rice bean pakauda . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rice bean bara .. . . . . .. . . . . .. . . . . .. . . . . .. . . . . .. . . . . . .. . . . . .. . . . . .. . . . . . Khichdi . .. . .. . .. . .. . .. . .. . .. .. . .. . .. . .. . .. . .. . .. . .. . .. .. . .. . .. . .. . .. . ..

304 306 308 309 310 319 320 321 323 323 326 327 328 329 330 331 332 332 333 334 335 336 337 338 340 340 342

Rice bean seed distribution among the farmers .. . .. . .. . .. . .. . .. . . . 357 Strategies for the projection and utilization of rice bean (ovals indicate potential interventions, and rectangle represents outcomes of potential interventions) . . .. .. . .. . .. .. . .. .. . .. . .. .. . .. .. 360

List of Tables

Table 1.1 Table 1.2 Table 1.3 Table 1.4 Table 2.1 Table 2.2 Table 2.3 Table 5.1 Table 5.2 Table 5.3 Table 5.4 Table 5.5 Table 5.6 Table 7.1 Table 7.2 Table 7.3 Table 7.4 Table 7.5 Table 8.1 Table 8.2 Table 8.3

Potential underutilized crops of Asian-Pacific continent . . . . . . . Potential underutilized crops of African continent . . . . . . . . . . . . . . Potential underutilized crops of North and South American continent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Some minor underutilized crops in India and their potential uses . . . . . .. . . . . . .. . . . . .. . . . . . .. . . . . . .. . . . . .. . . . . . .. . . . . . .. . . . . .. . . . . . . Major agencies involved in the promotion and utilization of underutilized crops in different countries . . . . . . . . . . . . . . . . . . . . . . . . Status of germplasm of some underutilized crops at NBPGR, India . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . .. . Released varieties of some underutilized crops in India . . . . . . . . Rice bean distribution in different countries of world . . . . . . . . . . Rice bean growing states in India . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rice bean germplasm conserved at different centers . . . . . . . . . . . . Released rice bean varieties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rice bean germplasm and their growing location used in the study for characterization of different traits . . . . . . . . . . .. . . . . . . . . . . Rice bean genotypes submitted to NBPGR, India . . . . . . . . . . . . . .

6 8 9 24 30 38 39 62 63 70 72 74 76

Morpho-physiological and yield traits of different rice bean genotypes (group 1) . . . .. . . .. . . .. . . .. . . .. . . .. . . .. . . .. . . .. . . .. . .. . . .. 93 Yield contributing traits of rice bean genotypes (LRB series) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97 Yield contributing traits of rice bean genotypes (JCR series) . . 99 Grading of rice bean genotypes for morpho-physiological traits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101 Rice bean genotypes excelling in specific traits . . . . . . . . . . . . . . . . . 102 Characteristics of rice bean starch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105 Nutritional constituents in the seeds of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106 Protein fractions of the seed flour of different rice bean genotypes (g/100 g seed flour) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106 xxix

xxx

Table 8.4 Table 8.5 Table 8.6 Table 8.7 Table 8.8 Table 8.9 Table 8.10 Table 8.11 Table 8.12 Table 9.1 Table 9.2 Table 9.3 Table 9.4 Table 9.5 Table 9.6 Table 9.7 Table 9.8 Table 9.9 Table 9.10 Table 9.11 Table 9.12 Table 9.13 Table 9.14 Table 9.15 Table 9.16 Table 9.17

List of Tables

Fatty acid profile (%) in the seeds of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ascorbic acid and niacin content in the seeds of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Essential amino acid profile in the seeds of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Essential amino acid profile of seed flour of different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Comparison of micronutrient content of rice bean with other legumes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rice bean genotypes excelling in different nutritional constituents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nutritional profile of major Vigna species . . . . . . . . . . . . . . . . . . . . . . . Nutritional composition of other Vigna species . . . . . . . . . . . . . . . . . Protease inhibitor content in dry mature seeds of five Vigna species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in phenolic content in different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Genotypic grading of rice bean genotypes (Group-I) based on phenolic content . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in phenolic content in rice bean genotypes of LRB series . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Genotypic grading of rice bean genotypes (Group-II) based on phenolic content . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in phenolic content in rice bean genotypes of JCR series . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Genotypic grading of rice bean genotypes (Group-III) based on phenolic content . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in total saponin content in rice bean genotypes . . . . . . Variation in phytic acid content in rice bean genotypes . . . . . . . . Variation in raffinose, stachyose and verbascose content in rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Oxalate content in different rice bean genotypes . . . . . . . . . . . . . . . . Trypsin inhibitor content in different ricebean genotypes . . . . . . Agglutination and agglutination-inhibition activity of lectin from rice bean against human and rabbit erythrocytes . . . . . . . . . . Variation in total lipoxygenase activity in different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Variation in hydrocyanic acid content in different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Genotypic rating of rice bean genotypes for anti-nutrients . . . . . Protease inhibitor content in five different Vigna species . . . . . . Comparative anti-nutritional profile of lesser known Vigna species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

107 111 113 113 115 116 120 123 124 132 134 136 137 137 138 139 141 143 144 146 150 151 151 153 154 155

List of Tables

xxxi

Table 10.1

Effect of soaking and sprouting on mineral availability from rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171

Table 11.1 Table 11.2

Fodder yield from different rice bean genotypes . . . . . . . . . . . . . . . . Variation in fodder yield from different rice bean genotypes (Group-II) . . . . . . .. . . . . . . . .. . . . . . . .. . . . . . . .. . . . . . . . .. . . . . . . .. . . . . . . .. . Fodder yield from rice bean genotypes of Group-III . . . . . . . . . . . Promising genotypes for fodder yield . . . . . . . . . . . . . . . . . . . . . . . . . . . . Comparative nutritional profile of leguminous forages . . . . . . . . . Biochemical composition of foliage of rice bean genotypes (G-1) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Biochemical composition of foliage of rice bean genotypes (G-2) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Biochemical composition of foliage of rice bean genotypes (G-3) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell wall constituents in foliage from different rice bean genotypes (G-1) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell wall constituents in foliage from different rice bean genotypes (G-2) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell wall constituents in foliage from different rice bean genotypes (G-3) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anti-nutrients in forage from different rice bean genotypes . . . . Anti-nutrients in the forage from Group-II ricebean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anti-nutrients in the forage from Group-III rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dual purpose rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Grading of rice bean genotypes for fodder quality parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Table 11.3 Table 11.4 Table 11.5 Table 11.6 Table 11.7 Table 11.8 Table 11.9 Table 11.10 Table 11.11 Table 11.12 Table 11.13 Table 11.14 Table 11.15 Table 11.16

181 182 183 183 184 186 187 187 190 191 191 192 196 197 199 200

Table 12.1 Table 12.2

Nodulation efficiency in different rice bean genotypes . . . . . . . . . 212 Rice bean genotypes efficient in nodulation . . . . . . . . . . . . . . . . . . . . . 214

Table 13.1 Table 13.2

Effect of different fertilizer levels on yield of rice bean . . . . . . . . Effect of different fertilizer levels on protein and amino acid content of rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Effect of NPK treatment on plant height (cm) at 25% flowering, dry weight and green fodder yield (q/ha) . . . Effect of fertilizer on quality of rice bean fodder . . . . . . . . . . . . . . . Nodulation efficiency in rice bean genotypes at different fertilizer levels . . . . .. . . .. . . . .. . . .. . . .. . . . .. . . .. . . . .. . . .. . . . .. . . .. . . . .

Table 13.3 Table 13.4 Table 13.5 Table 14.1 Table 14.2 Table 14.3

219 222 225 227 230

Trypsin inhibitor (mg/g) in leaves, tendrils, and stem in different rice bean genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237 Variation in trypsin inhibitor (mg/g) content in intact pods, developing and mature rice bean seeds . . . . . . . . . . . . . . . . . . . . . . . . . . 238 Purification profile of trypsin inhibitor from rice bean . . . . . . . . . 239

xxxii

Table 14.4 Table 14.5 Table 14.6 Table 14.7 Table 15.1 Table 15.2

List of Tables

α–AI content in different rice bean genotypes . . . . . . . . . . . . . . . . . . . Purification profile of α-AI from rice bean . . . . . . . . . . . . . . . . . . . . . . Interaction of α-amylases from the larval midgut of S. litura and purified α-AI from rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Insecticidal activity of lectins against different insects . . . . . . . . .

251 253 255 257

Different inhibitory genes from plant sources targeted against insect–pests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 277 Examples of RNAi-mediated gene knockdown of different insect orders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283

Table 16.1 Table 16.2

Major nutraceutical compounds and their effects . . . . . . . . . . . . . . . 300 Variation in phenolic acids in rice bean . . . . . . . . . . . . . . . . . . . . . . . . . . 303

Table 17.1

Nutritional composition of food multimix . . . . . . . . . . . . . . . . . . . . . . . 321

Table 19.1

Limitation and possible solutions for rice bean projection and utilization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359

1

Underutilized Crops: An Overview

For thousands of the years, humankind has utilized plant-based food resources for satisfying hunger and other economic purposes. The domestication of useful plant species began with the dawn of civilization, which has helped in the evolution of valuable and diverse food crop species. Since then these species have been exploited globally. Among the estimated 300,000 plant species, approximately 5000 plants have been used for human food (Kew 2016). At present, around 20–30 food crop species have shown their dominance in the world agriculture for providing food to 90% of the total world population. Out of these crops, rice, wheat, and maize provide about 60% of total food requirements. This narrowed food base has possibility of imperiling the food requirements of humankind. The perspective research on these food crops has helped in meeting the requirements of rapidly growing population globally but dramatically narrowed the base of many other useful species having the potential for achieving the goal of sustainable global food security as well as nutritional security. The impact of the narrowing base of global food security is likely to be felt mostly by poor population living in developing and underdeveloped countries. Therefore, there is an urgent need to promote diverse food crops in present-day agriculture. Many lesser known species have comparative merits over conventional food crops in contributing the sustainable crop production with low inputs. To address the requirements of increasing human population, it is imperative to broaden the focus of research and development on lesser known food crops. The comprehensive surveys conducted in different parts of the world reveal the existence of many plant species which remain unexploited from year. These resources represent an enormous richness in agro-biodiversity. The lack of information and focused research has undetermined their potential value. The facilitation of extensive research activities to increase the value of these crops and to make them more available would certainly broaden the agriculture resource base and increase the food availability options for the sustenance of the livelihood of millions of people. The indigenous crop species which are of less importance than the staple food crops of the world in term of global production and market values are often # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_1

1

2

1 Underutilized Crops: An Overview

considered as neglected or underutilized species (NUS). Aboagye et al. (2007) described these species as crops whose contribution to the economy of any country has not been explored as a result of scientific ignorance on their production, consumption, and utilization. These underutilized crop species are also designated as minor crops, indigenous crops, neglected crops, orphan crops, or opportunity crops. All these terms encompass the aspects which restrict the wider exploitation of these crops for the betterment of humankind. The cultivation of these species restricted to the specialized geographical parts in different agroecological regions of the world. In these regions, they are usually grown and maintained by poor farming communities for deriving their sustenance and livelihood. Underutilized crops are also considered as poor people food. These species may be widely distributed beyond their center of origin but tend to occupy special niches in local production and consumption system. These crops also have sociocultural values for local farming communities, yet they remain untouched from being documented and scientifically investigated. The underutilization of these species has been attributed to a number of factors; mainly agronomic factors and non-agronomic factors. The cultivation of underutilized crops can potentially improve the food security (Chivenge et al. 2015). Besides being a potential food source for human population, they can also be used as animal feed source and in other agriculture operations. The following attributes often designate a crop either underutilized or orphan crop. • • • • • •

Poorly documented and scientifically investigated for their potential utilization Well adapted to specific geographical region and marginal growing conditions Source of income generation for resource poor farmers Have less cultivated area as compared to the other conventional crops Weak or lack of efficient seed supply system Collected from the wild or produced in traditional production systems with little or no external inputs. • Have excellent nutritive profile and/or have nutraceutical properties and/or have other multifarious uses. • Strongly linked to the cultural heritage of local farming communities.

1.1

Diversified Potential of Underutilized Crops

1. Underutilized crops hold potential for bringing sustainability, profitability, and diversification in agriculture. They also hold promise for restoring balance in export and import and for making our self more competitive in agricultural exports. 2. Underutilized crop species low-agricultural inputs requiring and can survive in extreme growing conditions which contribute sustainability to agriculture production, crop diversification, and biodiversity conservation. In this context, they are considered as Crops of Future.

1.1 Diversified Potential of Underutilized Crops

3

Fig. 1.1 Multifaceted potential of underutilized crops

3. Underutilized crops have potential to alleviate the risk of overdependency on few conventional crops. They can also contribute to make livelihood more sustainable as they can widen the food availability options. 4. Underutilized crops also provide a broad spectrum of crops for improving agriculture productivity and food security at national and international level. 5. Many underutilized crops contain high-quality proteins, essential minerals, vitamins, and other valuable nutrients. Hence, centering focus of attention on these crops is an effective way to maintain a diverse and healthy diet to combat nutrient deficiencies among the people. 6. Underutilized crops have a strong cultural identity and are associated with traditional customs and beliefs. Therefore, these crops can be a best way of preserving cultural diversity. 7. These crops could help in alleaviating malnutrition by value addition of the products of commonly used crop species (Fig. 1.1).

4

1.2

1 Underutilized Crops: An Overview

Global Distribution of Underutilized Crops

A number of plant species have been known to serve different purposes of humankind (Kermali et al. 1997). However, only three crops, namely, rice, wheat, and maize, supply more than 60% of human’s energy intake (FAO 2010). With everincreasing human population, the dependency on few crops has driven up the need for food. This pressure has begun the intensification of agriculture which further accelerated the rate of losing crop diversity in agriculture. With the increasing human population and rapid depletion of natural resource, it has become necessary to explore the potential of indigenous plant species. Underutilized crops have huge potential in improving food as well as nutritional security. The diversification of food supply chain with neglected species could be an effective way to improve overall human nutrition and health. Underutilized crops are characterized not only by their local importance; they have potential to improve diet diversity at national and international level. The global occurrence of underutilized crops including Asian-Pacific, African, and North- and South-American continents have been discussed below.

1.2.1

Asian-Pacific Continent

The Asian-Pacific continent has been a home for broad diversity of plant genetic resources. The Asia-Pacific region includes 39 countries representing West Asia, South Asia, Southeast Asia, East Asia and the Pacific. Its vast area represents diverse climates and physiography, supporting the population resides in semi-arid to humid tropical, littoral, subtropical to temperate high altitude. The region also possesses rich cultural diversity that reflects its agricultural heritage. Resource-poor farmers in the region are hugely dependent on the agro-biodiversity of minor crops, wild relatives of crops and wild species of plants and animals for food security and livelihood. In China, the existence of 400 plant families, 3100 genera, and about 30,000 plant species indicates great bio-diversity of plant species in this particular region (Chen and Zhang 2001; Larkcom and Douglass 2007). Besides unique and rich wild flora, it also abounds economic plant wealth of diverse useful species and most of them are underutilized. Arora (2014) compiled 778 underutilized crop species in AsianPacific region. These species can provide alternative sources of nutritionally rich foods that would ultimately contribute for improving people health. The Indian sub-continent is a treasure house of diverse plant species, having known uses for future benefits of humankind. India occupies special place among major biodiversity rich countries with approximately 49,000 species of higher plants (11.80% of the world). Of which, about 30% are endemic occurring in 16 major vegetation types. Comprehensive efforts have been made to compile the information on indigenous plant species including wild plant species. A rich biodiversity of agrihorticultural crops due to farmer’s unconscious selection is inherited and perpetuated over the generations. Among the vast array of plants requiring scientific attention,

1.2 Global Distribution of Underutilized Crops

5

only a few crops have been prioritized for scientific exploitation in India. Keeping in view the potential benefits of underutilized crops, in the year 1984, an All India Co-ordinated Project on Potential Crops was initiated by Indian Government under the aegis of Indian Council of Agricultural Research (ICAR) to provide necessary thrust for collection, conservation, evaluation and utilization of underutilized crops in the country. A range of underutilized species have been identified from different corners of the country and collections have been submitted at NBPGR (National Bureau of Plant Genetic Resources), New Delhi (Table 1.1).

1.2.2

African Continent

Agriculture in all countries, particularly in developing countries, is expected to contribute in diverse ways to the benefit of people. Sub-Saharan Africa accounts for 9% of the global population, struggling to get over food and nutritional crises (Bekunda et al. 2010). The indigenous crops make significant contribution in making the diet of the African people of more nutritious. These crops also play important role in providing economic source, resolve environmental issues, and form an integral part of traditional medicine. In Uganda, despite of negligence, poor communities are growing minor crop species. The use of some underutilized crops is also significant in Malawi, particularly with regard to Bambara groundnut (Vigna subterranea), sorghum, finger millets, and pearl millets. The exploitation of full potential of underutilized crops to improve nutrition and health of African people requires broad focus of research on these species. These plants are known by different names and serve different purposes in different communities. For example, Telfairia occidentalis leaves are used as vegetable. For medicine, it is used to prevent some diseases (e.g., diabetes and anemia) or to support women during pregnancy period (Esuoso et al. 1998; Oboh et al. 2006; Otitoju et al. 2014) (Table 1.2).

1.2.3

North and South American Continent

Tropical regions of American continent have rich plant diversity (Wilf et al. 2003). Underutilized crops still exist in both North and South American regions and still used for the variety of purposes. In Chile, the underutilized crops are important sources of food and medicines and also have significant values for industrial purposes. In Cuba, the underutilized crops serve different purposes such as animal feed, human food, condiments, and medicinal and ornamental purposes. In Guatemala, neglected crops are valued in human nutrition and for their medicinal properties. Over the last 10 years, in Peru a great emphasis has been made on using the significant diversity and variability of underutilized crops, particularly maca root (Lepidium meyenii) for having nutritional value and fertility-enhancing properties (Gonzales 2012). In Venezuela, only a few NUS species, such as celery, yam, and Chinese taro, are widely used (Table 1.3).

6

1 Underutilized Crops: An Overview

Table 1.1 Potential underutilized crops of Asian-Pacific continent Species Legumes Rice bean

Scientific name

Usage

Vigna umbellata

Common vetch Hyacinth bean Winged bean

Vicia sativa

Grains are consumed as pulse, and its fodder is potential source of animal feed Grains are consumed as pulse, and its fodder is potential source of animal feed Immature pods are boiled and eaten as a vegetable; leaves are used as potential source of fodder The immature pods, leaves, young sprouts, and flowers are consumed as a vegetable or in soups. It also has significant uses as fodder, green manure, and cover crop The green pods are used as a vegetable, and seeds are used dried, fresh, or canned Ripe, semi-ripened beans, and dried seeds are edible. They are normally boiled or processed before being eaten Ripe, semi-ripened beans, and dried seeds are edible. The boiled or processed before being eaten Whole or split seeds can be cooked or fried. The moth bean pods can be boiled and eaten. The flour of the bean is used for making value-added products

Lablab purpureus Psophocarpus tetragonolobus

Faba bean

Vicia faba

Jack bean

Canavalia spp.

Horse gram

Macrotyloma uniflorum Vigna aconitifolia

Moth bean

Pseudocereals and millets Job’s tears/ Coix lacryma-jobi adlay Digitaria cruciata

Jungle rice

Echinochloa colona

Ragi

Eleusine coracana

Root and tuber crops Achira Canna indica arrowroot Queensland arrowroot Earth chestnut

Lathyrus tuberosus Ipomoea mammosa

Grains are useful as a food source. The seeds are sometimes used as ornamental beads. The roots and seeds of the plant have medicinal usage Grains are eaten as a cereal, and its glutinous flour is used to make bread or porridge. It is sometimes mixed with rice or other cereals The seed can be cooked whole or ground into flour and used as a mush or porridge. Also a good source of animal fodder Seed can be cooked whole or ground and used as flour. It is used in cakes, puddings, porridge, etc. it is often used in making fermented foods. The grain may also be malted and can be used as a nourishing food for infants Introduced and sporadically grown as backyard cultigen in parts of Asia and the Pacific Islands. Tubers are boiled and eaten Tubers are eaten as a vegetable Tubers and leaves are eaten as vegetable (continued)

1.3 Potential Underutilized Crops of India

7

Table 1.1 (continued) Species Vegetables Ceylon spinach Ivy gourd Horseradish tree

Scientific name

Usage

Basella rubra

Sarawat lettuce Sunset muskmallow

Limnocharis flava

Its leaves and stem are cooked and used to treat constipation Fruits are cooked and eaten as vegetable Most parts of the tree are edible. The leaves and flowers are eaten as salad and cooked as vegetables. The tender pods are highly valued as a vegetable Leaves are cooked or pickled and eaten as vegetable

Tarragon

Coccinia grandis Moringa oleifera

Abelmoschus manihot Artemisia dracunculus

Fruits Jack fruit Sea buckthorn Karonda

Artocarpus heterophyllus Hippophae rhamnoides Carissa spp.

Lasora

Cordia spp.

Khirni

Mimusops hexandra

Mahua

Madhuca indica

Grown as a leafy vegetable; cultivated forms belong to var. manihot. Cultivated for its immature fruits; young shoots and leaves are eaten, cooked, and boiled as soup It is used for adding flavor in chicken, fish, and egg dishes

Boiled young fruit is used for making salads or as a vegetable in spicy curries In foods, sea buckthorn berries are used to make jellies, juices, purees, and sauces Immature fruits are used as vegetable, while mature fruits are eaten raw. Fruits are processed as pickle, jam, jelly, and marmalade Unripe fresh fruits are acrid and used as vegetable and for making pickle. Ripe fruits are eaten fresh. Fruit pulp is rich in carbohydrates, extractive matter, and ash Fruits are very sweet and eaten raw as well as after drying, and bark is used for several medicinal purposes. The seed oil is used for cooking purposes. It is commercially used as a rootstock for vegetative propagation of sapota Flowers are used as feed for livestock. Ripe fruits of mahua are nutritious and are eaten raw or cooked and pulp. Seeds are of high economic value as used for the oil extraction

1.3

Potential Underutilized Crops of India

1.3.1

Food Legumes

1.3.1.1 Rice Bean (Vigna umbellata) Rice bean, a potential underutilized crop of India, holds high-yielding potential, ability to grow in aberrant growing conditions, and good nutritional potential which make this underutilized legume a potential substitute for other well-established

8

1 Underutilized Crops: An Overview

Table 1.2 Potential underutilized crops of African continent Species Cereals Tef

Scientific name

Usage

Eragrostis tef

It is often eaten with meat or ground pulses. Sometimes it is also eaten as porridge. Moreover, it can also be used to prepare different alcoholic drinks

Legumes African yam bean

Sphenostylis stenocarpa

Bambara groundnut Hyacinth bean Marama bean

Vigna subterranea Lablab purpureus Tylosema esculentum

Seed grains and tubers are of immense economic importance as food for Africans. Seeds are roasted and eaten with kernel seed Mature, dry seeds are boiled and eaten as a pulse, also have values in animal feeding Leaves are used as potential source of fodder; immature pods are boiled and eaten as a vegetable After roasting, the seeds have delicious, nutty flavor similar to coffee beans. Seeds are also eaten as porridge. The sweettasting tuber can be baked, boiled, or roasted

Root and tuber crops Livingstone Plectranthus potato esculentus Vegetables African nightshade Water leaf Okazi/ Ukazi/ Afang Ugwu/Ugu/ pumpkin Utazi/Otazi Uzazi

Tubers are often used as a substitute for a potato or sweet potato. The stems have been used to sweeten gruel (porridge). The leaves can be cooked in sauces

Solanum scabrum Talinum fruticosum Gnetum africanum

Leaves and young shoots are used as leafy vegetable and in soups Leaves are used in the preparation of soups and used as vegetables Leaves are used in the preparations of soups and chewed with palm oil

Telfairia occidentalis Gongronema latifolium Piper guineense

Cooked in soups and stews and raw and blanched in smoothies used in traditional remedies Used as leafy vegetable and spice for sauces, soups, and salads as well as in traditional remedies Raw, boiled, or blanched leaves for salads and soups as a spice

legume crops. This underutilized crop also has multipurpose usage as a potential livestock fodder, green manure, and cover crop. This crop has enormous potential for meeting food and nutritional security, but lack of scientific research and consumer awareness has restricted the use of this potential underutilized crop to local communities of a few developing countries and thereby prevented global reorganization and commercialization of this crop (Fig. 1.2).

1.3.1.2 Faba Bean (Vicia faba) Faba bean is one of the main sources of protein for people in Middle East and North Africa, but its cultivation has not so far gained popularity as a pulse crop. In India, it

1.3 Potential Underutilized Crops of India

9

Table 1.3 Potential underutilized crops of North and South American continent Species Scientific name Root and tuber crops Arracacha Arracacia xanthorrhiza Maca Yacon Ulluco Fruits Nance Peach palm

Usage

Lepidium meyenii Smallanthus sonchifolius Ullucus tuberosus

Roots are consumed cooked and roasted, used for the preparation of soups and puree. Young stems are consumed fresh or cooked Roots are consumed cooked or roasted and can be used for flour production Tuberous root is used to prepare syrup and also have many industrial uses Tuber is the primary edible part, but the leaf also has similar uses as spinach

Byrsonima crassifolia Bactris gasipaes

Fruits are consumed fresh or cooked, used for making beverages Fermented fruits are used for making beverage

Fig. 1.2 Rice bean plant and seeds

is reported to be a minor crop in the Himalayan hills, Bihar, Eastern Uttar Pradesh, Punjab, Haryana, Jammu, and Kashmir. Currently, faba bean is gaining importance among consumers as a valuable source of protein (26.2%). Faba bean seeds have high lysine content (19.80 g/kg DM) and low methionine, cysteine, and tryptophan content (2.60, 3.70 and 2.70 g/kg DM) (Mosse 1990; Duc et al. 1999). The green pods are used as vegetable, and seeds are used dried, fresh, or canned. Beans can also be used in the form of soup. A number of value-added products can be prepared from seeds like soybeans to produce a range of high-protein products (Fig. 1.3).

1.3.1.3 Winged Bean (Psophocarpus tetragonolobus) Winged bean commonly known as goa bean, four-angled bean, is a rich source of protein (29.80–37.40% in seeds) and oil and has multifaceted uses. Winged bean is mostly cultivated as a backyard or garden crop and consumed locally. The nutritive profile of this legume is comparable to soybean. It has significant uses as fodder,

10

1 Underutilized Crops: An Overview

Fig. 1.3 Faba bean plant, pods, and seeds

Fig. 1.4 Winged bean pods and seeds

green manure, and cover crop. The immature pods, leaves, young sprouts, and flowers are consumed as a vegetable or in soups. The roots can also be used as a vegetable, similar to potato, and have a nutty flavor. For these reasons, this bean has been referred as “one species supermarket” because practically, the whole plant is edible. Seed oil is used for cooking and the oil cake as animal feed. Protein in winged bean seeds is comparable with that of soybeans in digestibility. Seeds are rich source of vitamin E. It is largely cultivated as a backyard or a garden crop in most of Southeast Asia and is consumed locally. In India, its cultivation is confined to humid, subtropical parts of the North-Eastern region, Bengal, Bihar, and Western Ghats (Fig. 1.4).

1.3 Potential Underutilized Crops of India

11

1.3.1.4 Canavalia Sp. The species belong to genus Canavalia are C. ensiformis, C. gladiata, C. maritima, and C. cathartica and display a wide distribution range. The species belong to this genus are fast-growing, tolerant to extreme environmental conditions, and can be used as manure, soil binder, and ornamental plant. The mature beans, pods of mature beans, and dried beans have 26.30%, 8.60%, and 7.80% protein, respectively. The lipid content in Canavalia seeds has been shown to vary among different subspecies from 1.40% to 12.10%. Ripe, semi-ripened beans, and dried seeds are edible. They are normally boiled or processed before being eaten. Purseglove (1974) detailed the usage of young pods of this legume as a green vegetable. The roasted and ground beans have been reported as a substitute for coffee (Bressani et al. 1987). Overall, in dried seeds of Canavalia species, the variation in protein content ranges between 13% and 35% (Arinathan et al. 2003) (Fig. 1.5).

1.3.1.5 Adzuki Bean (Vigna angularis) Adzuki bean has wide variety of uses. The dried seeds are used as human food, either cooked whole. In Japan, it is used largely as human food. Unlike other cultivated Vigna species, it is mainly grown in temperate and subtemperate regions. In India, it is confined to northeastern and northern hill zones. Sprouted beans are used as a vegetable. Adzuki bean is also reported to have usage as forage and green manure crop. The seeds contain 21.68% protein, 3.50% crude fiber, 0.90% ether extract, 50.18% carbohydrate, and 62.01 mg vitamin C per 100 mg of seed (Katoch 2013). The seeds and leaves have medicinal properties. Adzuki bean is a short-day plant and requires almost same climatic conditions as soybeans. It can be grown on all types of soil from light to heavy clay but does not grow well on extremely acidic soil. The crop is more tolerant to heavy rainfall than other grain legumes. It is also reported to be grown as a rainfed crop (Thomas et al. 1974) (Fig. 1.6).

Fig. 1.5 Canavalia pods and seeds

12

1 Underutilized Crops: An Overview

Fig. 1.6 Adzuki bean pods and seeds

Fig. 1.7 Velvet bean pods and seeds

1.3.1.6 Velvet Bean (Mucuna pruriens) This legume is popularly known as velvet bean, devil bean, and cow-hitch plant. It is grown as a minor food and feed crop by tribal groups of Asia and Africa, and the dried seeds are used for edible purpose after processing. The seeds of this legume have 20–31.44% protein content. Among the amino acids, lysine in velvet bean is reported to vary between 327 and 412 mg/g N and usually deficient in sulfur amino acids (116 and 132 mg/g N) (Rajaram and Janardhanan 1991). Globulins contribute major share in the total seed proteins (9–62%), followed by albumin (4–21%), glutelin (1.30–2.9%), and prolamin (0.80–2%). The in vitro digestibility of protein ranges from 72 to 77% and is much higher than for soybeans and other common legumes (Siddhuraju and Becker 2001; Gurumoorthi et al. 2003). The lipid content varies from 2.80 to 14.39%. In the seeds, the presence of high amounts of unsaturated fatty acids like oleic acid (6.90–28.7%) and linoleic acid (21.40–49.50%) has been reported (Mohan and Janardhanan 1995; Siddhuraju et al. 2000) (Fig. 1.7). 1.3.1.7 Bambara GroundNut (Vigna subterranea) It is an annual legume having tolerance to adverse climatic and soil conditions. Bambara groundnut is also considered as a complete diet as it contains sufficient

1.3 Potential Underutilized Crops of India

13

Fig. 1.8 Bambara groundnut plant with seeds

amounts of proteins, carbohydrates, fats, and minerals. It is composed of 56–63% carbohydrates, 17–25% protein, 6.50–8.50% oil, and 2.50–3.50% mineral salts (Bamshaiye et al. 2011; Hillocks et al. 2012). It contains 14–71% albumin, 6–43% globulin, 1.60–2.20% prolamins, and 3.30–5.20% glutelins (Hillocks et al. 2012). The protein content in Bambara groundnut is greater than cowpea, pigeon pea, and groundnut (Brough and Azam-Ali 1992). It also possesses the highest soluble fiber (4–12%) in comparison with other beans (Bamshaiye et al. 2011). In addition to this, it is a rich source of phosphorous, magnesium, potassium, and calcium (Bamshaiye et al. 2011; Yao et al. 2015) (Fig. 1.8).

1.3.1.8 Moth Bean (Vigna aconitifolia) Moth bean is a drought- and heat-tolerant minor legume. National Academy of Sciences has identified moth bean as a more significant food source for the future. The seeds of this legume have excellent nutritive profile mainly attributed to 24.30% protein, 68.00% carbohydrates, 3.90% lipids, 3.80% ash, 133 mg/100 g calcium, 356 mg/100 g phosphorus, 183 mg/100 g magnesium, 11 mg/100 g iron, 0.50 mg/ 100 g thiamine, 0.10 mg/100 g riboflavin, and 1.70 mg/100 g niacin. Whole or split seeds can be cooked or fried. In India, sprouted moth bean seeds are sprouted before cooking. The moth bean pods can be boiled and eaten. The flour of the bean is used for making idli and dosa in southern region of India (Fig. 1.9). 1.3.1.9 Horse Gram (Macrotyloma uniflorum) It is one of the neglected legumes in Asian and African countries where it serves as a cheap source of nutrition for unprivileged rural communities residing in inaccessible areas. This legume thrives well in extreme growing environment and embraces favorable agronomic features. Horse gram has excellent nutritive profile mainly attributed to 22–24% protein, 51.90–60.90% carbohydrate, 8.00–27.50% dietary fiber, 0.60–2.60% fat, 244–312 mg calcium, and 5.89–7.44 mg iron (Gopalan et al. 1999; Sudha et al. 1995). Despite holding excellent nutritive value, still it has remained an underutilized legume, consumed only by farming communities of inaccessible areas and low-income groups (Fig. 1.10).

14

1 Underutilized Crops: An Overview

Fig. 1.9 Moth bean pods and seeds

Fig. 1.10 Horse gram pods and seeds

1.3.2

Food Crops

1.3.2.1 Amaranth (Amaranthus Sp.) Amaranth is a fast-growing, cereal-like (pseudocereal) crop. Amaranth has multipurpose uses as grain, vegetable, and fodder. The genus Amaranthus consists of about 60 species. The main grain species are A. hypochondriacus (Prince’s feather), A. cruentus (purple amaranth), and A. caudatus (Inca wheat). The following species are well-known leafy vegetables, viz., A. blitum, A. dubius, and A. tricolor. The yield and nutritive value are similar to other well-established cereals. Its seeds have high protein with high lysine content and a good balance of other essential amino acids. The protein content in amaranth seeds ranges from 8.86 to 19.60% (Misra et al. 1985; You et al. 1987; Girenko et al. 1988). Being an excellent source of iron and β-carotene, it can help in reducing iron and vitamin A deficiency among people. High level of folic acid in amaranth seeds can also help in increasing the hemoglobin level in blood. The leaves are also endowed with high-protein content and are very useful from human nutrition point of view. Amaranth seeds can also be utilized in the preparation of some value-added products (Williams and Brenner 1995). Amaranth is also reported to have agro-industrial uses in the production of high-quality

1.3 Potential Underutilized Crops of India

15

Fig. 1.11 Amaranth plant and seeds

Fig. 1.12 Buckwheat plant and seeds

plastics, cosmetics, pharmaceuticals, and natural dyes. Black-seeded amaranth due to high forage yield, high-protein, and low-oxalate content offer a good scope for its utilization as a promising forage crop (Fig. 1.11).

1.3.2.2 Buckwheat (Fagopyrum Sp.) It is one of the important pseudocereals of mountainous regions both for grain and fodder (Singh and Thomas 1978). It is a short-duration crop (2–3 months) and fits well in the high hills of mid-Himalayas where growing season is short. The whole plant, young shoots, leaves, flower, and seeds are used for different purposes. The tender shoots are used as a leafy vegetable; the flowers and green leaves are used for the extraction of rutin (McGregor and McKillican 1952). The presence of rutin makes this crop medicinally valuable. The grains are used in several culinary preparations. The starchy flour is used to make value-added products. Buckwheat is also an excellent source of lysine amino acid. Husked kernels are cooked as rice. The biological value of protein is similar to eggs. Its grains also have potential to be used as livestock feed (Fig. 1.12).

16

1 Underutilized Crops: An Overview

1.3.2.3 Chenopod (Chenopodium Sp.) Chenopod is an important vegetable and grain crop generally consumed with other cereals. The grain is sometimes used as a staple food, consumed in the form of porridge and pudding, and also cooked with rice. Four species, viz., C. album, C. quinoa, C. nataliae, and C. pallidicaule, are known to be cultivated. Out of four species, C. album is the most widely distributed in Himalayan region. The Himalayan grain chenopod is comparable to Andean quinoa in nutrient composition and is much better than wheat, barley, maize, and rice (Tapia et al. 1979; Pratap 1982; Cusack 1984; Wood 1985). Chenopod leaves retain 26–64 mg kg 1protein, 78–190 mg kg 1 β-carotene, 0.5–2.40 mg kg 1 vitamin C, 2.60–5.0 mg kg 1 nitrate, and 9–39 mg kg 1 oxalate content. The protein quality of grains similar to that of milk contains high lysine (6 mg 100 mg 1 protein), methionine (2.30 mg 100 mg 1 protein), and cysteine (1.20 mg 100 mg 1 protein). Its green leaves are comparable to any leaf vegetable as it is rich in iron and β-carotene and low in oxalate content. The crop is also suited to the mixed farming system, particularly multiple-cropping systems (Pratap and Kapoor 1987). The grains are sometimes used as staple food and consumed in the form of porridge, pudding, and gruel and cooked with rice. The grains and whole plant can be used as potential livestock feed (Fig. 1.13).

1.3.2.4 Job’s Tears or Adlay (Coix lacryma-Jobi) It is an important minor cereal crop with high nutritional and medicinal value in Asian countries. The Job’s tears seeds are traditionally utilized as a diuretic, digestive tonic, analgesic, antispasmodic, and anti-inflammatory medicine. Prior to maize, this minor food crop was established crop in South India, but it has become a minor food crop with economic utilities and fodder crop in North India. This minor crop has potential to be a good substitute for rice. Rather, it is considered to be more wholesome by virtue of its higher fat and protein content. It can be used in preparation of value-added products by mixing with rice. This crop has prospects to be converted into good quality silage (Fig. 1.14).

Fig. 1.13 Chenopod plant and seeds

1.3 Potential Underutilized Crops of India

17

Fig. 1.14 Job’s tears/adlay

1.3.2.5 Millets The millets group includes finger millet (Eleusine coracana), pearl millet (Pennisetum glaucm), foxtail millet (Setaria italica), kodo millet (Paspalum scrobiculatum), bahiagrass (Paspalum notatum), little millet (Panicum sumatrense), proso millet (Panicum miliaceum), barnyard millet (Echinochloa crus-galli), guinea grass (Panicum maximum), and elephant grass (Pennisetum purpurium) belong to the family Poaceae of the monocotyledon group. Millets are important but underutilized crops in tropical and semiarid regions of the world. The flexibility in growing under aberrant growing conditions makes these crops for future human use. These also have excellent nutritional profile in comparison with other wellestablished cereal crops and have outstanding properties as a subsistence food crops. The tiny grains are gluten-free and endowed with vitamins and minerals. The presence of various phytochemicals makes them a powerhouse of several health-benefiting properties. There is vast potential to process millet grains into value-added products and beverages in developing countries.

1.3.3

Vegetables

1.3.3.1 Kankoda (Momordica dioica) Kankoda is a minor vegetable crop belongs to Cucurbitaceae family. Its fruits are used as vegetable. Its green fruits contain 12–14% protein, 275.10 mg/100 g ascorbic acid, and iodine (0.70 mg/100 g). Unlike M. charantia var. muricata (bitter gourd), it is not bitter in taste and has medicinal values for treating bowel infections and urinary complaints (Fig. 1.15). 1.3.3.2 Sechium edule (Chow-Chow) It is a vigorous, tuberous-rooted perennial plant, grown for its starchy, edible fruit, and seeds. Fruits, stems, tender leaves, and tuberous parts of adventitious roots are eaten. They are much appreciated as a vegetable and can be used in stews and

18

1 Underutilized Crops: An Overview

Fig. 1.15 Kankoda fruit

Fig. 1.16 Sechium edule

desserts. The flesh is crisp and white with a large white oval seed in the center. Chow-chow is a fruit but most often used as a vegetable (Fig. 1.16).

1.3.3.3 Drumstick (Moringa oleifera) Moringa is indigenous to South Asia, where it grows in the Himalayan foothills from Northeastern Pakistan to Northern-West India. Most parts of the tree are edible. The leaves and flowers are eaten as salad and as cooked vegetables, or added to soups and sauces, or used to make tea. The young, tender pods known as drumsticks are highly valued vegetable in Asia and also are pickled. Fried seeds taste like groundnuts. The root bark is used as a condiment. Moringa has high-nutrient density and is rich in many essential micronutrients and vitamins as well as antioxidants and bioavailable iron. Moringa seeds contain about 40% oil, known as ben oil. The oil is nondrying, resists rancidity, and is used for cooking, lubrication, and in cosmetic industry (Fig. 1.17).

1.3 Potential Underutilized Crops of India

19

Fig. 1.17 Moringa pods

Fig. 1.18 Perilla plant

1.3.4

Oilseed Crops

1.3.4.1 Perilla (Perilla frutescens) Perilla commonly known as Ban Tulsi, is one of the important oilseed crops in India. The oil is utilized for edible purposes. The seeds can also be used for giving a flavor to vegetables and are eaten as freshener. The seeds have 6.30% moisture, 23.12% protein, 45.07% fatty oil, 10.28% N-free extract, 10.28% crude fiber, and 4.64% ash content. The seed cake is rich in protein and may be used as a cattle feed. The cake on an average has 38.4% protein, 8.4% fat, 16.00% N-free extract, 20.90% crude fiber, 34.20% digestible protein, and 61.40% total digestible nutrients. The herb is reported to possess sedative, antispasmodic, and diaphoretic properties and is prescribed for cephalic and uterine troubles (Fig. 1.18).

20

1 Underutilized Crops: An Overview

1.3.4.2 Simarouba (Simarouba glauca) Simarouba known as paradise tree is an important underutilized oilseed crop. The seeds contain 60–75% edible oil which can be used in the manufacture of vegetable fat. The seed oil is useful for the manufacture of quality soaps, lubricants, paints, polishes, and pharmaceuticals. The oil cake being rich in nitrogen (7.70–8.10%), phosphorus (1.10%), and potash (1.24%) serves as valuable organic manure. The leaf and bark contain simarubin, a phytochemical useful to treat amoebiasis, diarrhea, and malaria.

1.3.5

Industrial Crops

1.3.5.1 Purging Nut (Jatropha curcas) This is an industrial oil-yielding species which is adapted to marginal lands. This wonder plant produces seeds with an oil content of 37%. The crude oil can be combusted as a fuel. However, the trans-esterified oil can be used as biodiesel. Its by-product, press cake, is a good source of organic fertilizer. The oil has insecticidal properties also. Jatropha is being used in traditional medicines for curing many diseases like cancer, piles, snakebite, paralysis, dropsy, etc. The cut branches sprout and grow readily making it most suitable for fencing (Fig. 1.19).

1.3.5.2 Tumba (Citrullus colocynthis) Tumba, also known as bitter apple, wild gourd, is a perennial creeper which grows on sandy undulated plains and sand dunes and is drought tolerant. The seeds contain 30–34% oil, used for manufacturing soap, candles, etc. Because of having glucosides such as colocynthin, the dried pulp of unripe fruit is used as purgative. The roots have purgative properties and are used in jaundice, rheumatism, and urinary diseases. The fruits are used as feed for cattle, goats, and camels (Fig. 1.20). Fig. 1.19 Jatropha curcas

1.3 Potential Underutilized Crops of India

21

Fig. 1.20 Citrullus colocynthis

Fig. 1.21 Parthenium argentatum

1.3.5.3 Guayule (Parthenium argentatum) This plant is an alternative source of rubber tree (Hevea brasiliensis), which can be grown easily in wastelands and marginal areas of semiarid regions. The chemical composition of guayule rubber is similar to Hevea rubber in chemical composition. Rubber in the guayule plant is present in stem, root, and branches in sclerenchyma cells of cortical tissues (Joshi et al. 1994). Plants having longer vascular ray fissures contain more rubber. Large number of leaf hairs has also shown positive correlation with the rubber content in guayule plant (Healey et al. 1986). Chemical analysis of available germplasm in India revealed that rubber content varied from 3.40 to 7.00%, while the resin content varied from 4.69 to 6.25% (Chhabra et al. 1990) (Fig. 1.21). 1.3.5.4 Jojoba (Simmondsia chinensis) Jojoba plant can withstand aberrant growing conditions such as drought, tolerate salinity and wide range of temperatures, rainfall, and desert habitat conditions. Because of slow growth in its wild habitat, it was unknown to cultivators. In the 1970s, the industrial and agronomic importance of this plant catch the attention of

22

1 Underutilized Crops: An Overview

Fig. 1.22 Simmondsia chinensis

Fig. 1.23 Cuphea plant

researchers when it became known that its beans contain about 45–55% liquid wax with similar chemical properties to those body fat obtained from sperm whales. Its oil has medicinal properties for curing sores and stomach problems (Bhatnagar et al. 1991). Seeds have been reported to have food value and also useful in making different beverages. The jojoba oil is completely free from resins, tars, or alkaloids and contains only steroids, tocopherols, and hydrocarbons. It has an added advantage of having fewer impurities, odorless nature, and good shelf life and thus has a great potential as a lubricant and chemical intermediate in industrial processes. Hydrogenation of the oil forms a hard, crystalline wax which has potential uses in manufacture of polish waxes and heat-resistant paper containers. The reaction of oil with sulfur chloride to form a rubbery compound known as factice is used in varnishes, rubber, adhesives, etc. It also has wide application in pharmaceutical as well as cosmetic industry (Fig. 1.22).

Fig. 1.24 The portfolio of some important underutilized crops all with the potential to contribute to the sustainability of environment and humankind. In reading order: rice bean (Vigna umbellata), faba bean (Vicia faba), winged bean (Psophocarpus tetragonolobus), Canavalia sp., adzuki bean (Vigna angularis), velvet bean (Mucuna pruriens), Bambara groundnut (Vigna subterranea), moth bean (Vigna aconitifolia), horse gram (Macrotyloma uniflorum), amaranth (Amaranthus sp.); buckwheat (Fagopyrum sp.), chenopod (Chenopodium sp.), Jobs tears or adlay (Coix lacryma-jobi), kankoda (Momordica dioica), Sechium edule (chow-chow), drumstick (Moringa oleifera), perilla (Perilla frutescens), simarouba (Simarouba glauca), purging nut (Jatropha curcas), tumba (Citrullus colocynthis), guayule (Parthenium argentatum), jojoba (Simmondsia chinensis), lana or khar (Haloxylon salicornicum), cuphea (Cuphea spp.)

1.3 Potential Underutilized Crops of India 23

24

1 Underutilized Crops: An Overview

1.3.5.5 Lana or Khar (Haloxylon salicornicum) Haloxylon is an important perennial plant of arid regions. Haloxylon possesses range of morphological, physiological, and ecological adaptation to thrive well under the adverse conditions of sandy and saline soils of Jaisalmer and Barmer districts of Western Rajasthan. Haloxylon has beneficial applications that include fruiting tops and seed as animal feed, seed as emergency food, wood as fuel, different plant parts for medicine, and restoration of degraded lands.

Table 1.4 Some minor underutilized crops in India and their potential uses Underutilized species Arachis glabrata Balanites aegyptiaca Brosimum alicastrum Canarium commune Caryocar nuciferum Cassia sturtii Colophospermum mopane Cucurbita foetidissima Euphorbia antisyphilitica Faidherbia albida (Acacia albida) Helianthus tuberosus Prosopis chilensis Prosopis glandulosa Prosopis tamurugo Vernonia galamensis Zizania caduciflora

Plant parts used Leaves, stems Seeds, fruits Leaves, branch tips, fruit Seeds Nuts

Potential usage Used as fodder, hay, foliage, and pasture Used as edible oilseed, fruit edible, decorticated fruit used as purgative and vermifuge Used as cattle fodder, fruit edible, milky latex-like cow’s milk Used as edible oilseed, seeds also edible, consumed with rice in pastries Used as edible oilseed, wood for ship building

Leaves, branch tips Leaves, shoots

Used as animal feed

Seed, nut

Seeds as food, ripe fruits substitute for soup

Stem, branches Leaves, shoots, pods, bark Tuber

Source of candelilla wax, used for polishes, creams, varnishes, and electric insulating material Pods, leaves eaten by livestock, bark for tannin, stem source of gum Arabic

Leaves, branches Pods, leaves, wood Leaves, pods, seeds Seeds

Foliage fed to livestock in fresh condition as well as hay

Leaves, swollen internodes

Used for fodder

Tubers are edible, eaten raw, and cooked

As fodder, firewood, and gum exudate from trunks/ branches As fodder For manufacture of plastic formulations and protective coatings Leaves as fodder, swollen part is stripped, sliced, boiled, and spiced to prepare a delicious recipe

References

25

1.3.5.6 Cuphea (Cuphea Spp.) These species adapted to a temperate climate are good sources of industrial oils with a high degree of drought resistance. These species hold promise for cultivation in northeastern hills. Cuphea oil contains medium-chain saturated fatty acids principally caprylic acid, capric acid, and lauric acid (Gesch et al. 2006; Phippen et al. 2006). These fatty acids are of commercial value in the manufacture of soaps and detergents, lubricants, and plasticizers. Cuphea oils rich in capric acid are valuable in the manufacture of biodiesel (Figs. 1.23 and 1.24) (Table 1.4). Underutilized or neglected crops have been given little attention or entirely ignored by agricultural researchers, plant breeders, and policymakers. These species endowed with untapped potential to become a member of list of major food crops. However, this potential is continuously diminishing in face of changing climate and overdependency of increasing human population on few staple crops. Considering this, the underutilized species require a broad focus of research which holds promise to attain sustainability, profitability, and diversification in agriculture through these crops. Many underutilized crops have been identified around the world and still more to be identified. Through this topic, effort has been made to shed light on the potential of some underutilized crops which have potential of being a crop of commercial importance. The benefits that would accrue as a result of agricultural diversification with these crops would be beneficial to both producers and consumers.

References Aboagye LM, Obirih-Opareh N, Amissah L, Adu-Dapaah H (2007) Underutilized species, policies and strategies. In: Analysis of existing national policies and legislation that enable or inhibit the wider use of underutilized plant species for food and agriculture in Ghana. Council for Scientific and Industrial Research, Ghana Arinathan V, Mohan VR, Britto AJ, Chelladurai V (2003) Studies on food and medicinal plants of Western Ghats. J Econ Tax Bot 27:750–753 Arora RK (2014) Diversity in underutilized plant species - an Asia-pacific perspective. In: B. International. Biodiversity International, New Delhi, p 203 Bamshaiye M, Adegbola J, Bamishaiye E (2011) Bambara groundnut: an underutilized nut in Africa. Adv Agric Biotechnol 1:61–72 Bekunda M, Sanginga N, Woomer PL (2010) Restoring soil fertility in sub-saharan Africa. Adv Agron 108:183–236 Bhatnagar N, Bhandari DC, Dwivedi NK, Rana RS (1991) Performance and potential of jojoba in the Indian arid regions. Indian J Plant Genet Resour 4:57–66 Bressani R, Brenes RS, Gracia A, Elias LG (1987) Chemical composition, amino acid content and protein quality of Canavalia spp. seeds. J Sci Food Agric 40:17–23 Brough SH, Azam-Ali SN (1992) The effect of soil moisture on the proximate composition of bambara groundnut (Vigna subterranea (L) Verdc). J Sci Food Agric 60:197–203 Chen H, Zhang Y (2001) Proceeding of atlas of the traditional vegetables in China. Zhejiang Science and Technology Publishing House, Zhejiang Chhabra AK, Sharma GD, Hooda JS (1990) Variability and association studies in guayule (Parthenium argentatum) a gray. Indian J. Plant Genet. Resour. 3:75–84

26

1 Underutilized Crops: An Overview

Chivenge P, Mabhaudhi T, Modi AT, Mafongoya P (2015) The potential role of neglected and underutilised crop species as future crops under water scarce conditions in sub-Saharan Africa. Int J Environ Res Public Health 12:5685–5711 Cusack DF (1984) Quinova: grain of the Incas. Ecologist 14:21–31 Duc G, Marget P, Esnault R, LeGuen J, Bastianelli D (1999) Genetic variability for feeding value of faba bean seeds (Vicia faba L.): comparative chemical composition of isogenics involving zerotannin and zero vicine genes. J Agric SciCamb 133:185–196 Esuoso K, Lutz H, Kutubuddin M, Bayer E (1998) Chemical composition and potential of some underutilized tropical biomass. I: fluted pumpkin (Telfairia occidentalis). Food Chem 61:487–492 FAO (2010) Report on the state of the world’s plant genetic resources for food and agriculture. FAO, Rome Gesch RW, Forcella F, Olness A, Archer D, Hebard A (2006) Agricultural management of cuphea and potential for commercial production in the northern Corn Belt. Ind Crop Prod 24:300–306 Girenko MM, Borodkin AS, Voskresenskaya VV (1988) Variation in the main economically useful characters in amaranth. Sbornik Nauchnykh Trudoy po Prikladnoi Botanike. Genetike i Selekisii 118:59–67 Gonzales GF (2012) Ethnobiology and ethnopharmacology of Lepidium meyenii (maca), a plant from the Peruvian highlands. Evidence-based complement. Alternat Med 2012:193496 Gopalan C, Ramasastry BV, Balasubramanium SC (1999) Proc. Nat. Inst. Nutri. Hyderabad. Nutritive value of Indian foods. p 156 Gurumoorthi P, Pugalenthi M, Janardhanan K (2003) Nutritional potential of five accessions of a south Indian tribal pulse Mucuna pruriens var. utilis; II. Investigation on total free phenolics, tannins, trypsin and chymotrypsin inhibitors, phytohaemagglutinins, and in vitro protein digestibility. Trop Subtrop Agroecosys 1:153–158 Healey PL, Mehta IJ, Westerling KE (1986) Leaf trichomes of some Parthenium sp. Am J Bot 73:1093–1099 Hillocks R, Bennett C, Mponda O (2012) Bambara nut: a review of utilization, market potential and crop improvement. African Crop Sci J 20:1–16 Joshi V, Mal B, Phogat BS (1994) Guayale (Parthenium argentatum gray) – an underexploited rubber yielding plant for exploitation in wastelands. Indian J. Plant Genet. Resour. 7:91–100 Katoch R (2013) Nutritional evaluation, protein digestibility and profiling of different Vigna spp. Indian J of Agric Biochem 26(1):32–35 Kermali S, Anishetty N, Cooper H (1997) Promoting development and commercialization of underutilized crops and species in the FAO global plan of action. ICUC, Southampton Larkcom J, Douglass E (2007) Vegetables from the Far East. Frances Lincoln Publishers, London McGregor WG, McKillican ME (1952) Rutin content of varieties of buckwheat. Sci Agric 32:48–51 Misra PS, Prakash D, Pandey RM, Pal M (1985) Protein and amino acid composition of grain amaranth seed. Fitoterapia 5:318–320 Mohan VR, Janardhanan K (1995) Chemical analysis and nutritional assessment of lesser known pulses of the genus Mucuna. Food Chem 52:275–280 Mosse J (1990) Acides amines de 16 ce’re’ales et prote’agineux: variations et cle’s ducalcul de la composition en function du taux d’azote des graines. Conse’quencesnutritionnelles. INRA Prod Anim 3:103–119 Oboh G, Nwanna EE, Elusiyan CA (2006) Antioxidant and antimicrobial properties of Telfairia occidentalis (fluted pumpkin) leaf extracts. J Pharmacol Toxicol 1:167–175 Otitoju GTO, Ene-Obong HN, Otitoju O (2014) Macro and micro nutrient composition of some indigenous green leafy vegetables in south-east zone Nigeria. J Food Process Technol 5:389 Phippen WB, Isbell TA, Phippen ME (2006) Total seed oil and fatty acid methyl ester contents of cuphea accessions. Ind Crop Prod 24:52–59 Pratap T (1982) Cultivated grain chenopods of Himachal Pradesh: distribution, variations and ethnobotany. Ph.D. thesis, Dept of Biosciences, Himachal Pradesh University, Shimla, India

References

27

Pratap T, Kapoor P (1987) The Himalayan grain chenopods III. An under-exploited food plant with promising potential. Agric Eco Environ 19:71–79 Purseglove JW (1974) Tropical crops: dicotyledons. Longman Publishers, London, p 242 RBG Kew (2016) State of the World’s Plants. Royal Botanic Gardens, Kew Rajaram N, Janardhanan K (1991) The biochemical composition and nutritional potential of the tribal pulse Mucuna gigantea wild DC. Plant Foods Hum Nutr 41:45–52 Siddhuraju P, Becker K (2001) Preliminary nutritional evaluation of Mucuna seed meal (Mucuna pruriens var. utilis) in common carp (Cyprinus carpio L.): an assessment by growth performance and feed utilisation. Aquaculture 196:105–123 Siddhuraju P, Becker K, Makkar HPS (2000) Studies on the nutritional composition and antinutritional factors of three different germplasm seed materials of an underutilized tropical legume. Mucuna pruriens var. utilis. J Agric Food Chem 48:6048–6060 Singh H, Thomas TA (1978) Grain amaranth, buckwheat and chenopods. Indian Council of Agricultural Research, New Delhi Sudha N, Begum JM, Shambulingappa KG, Babu CK (1995) Nutrients and some anti-nutrients in horsegram (Macrotyloma uniflorum (lam.) Verdc). Food Nutr Bull 16:100 Tapia M, Gandarillas H, Alandia S, Cardozo A, Mujica A, Ortiz R, Otazu V, Rea J, Salas B, Zanabria E (1979) La Quinova Y La Kaniwa: Cultivos Andinos. CIID and IICA, Bogota, Colombia Thomas TA, Patel DP, Bhagat NR (1974) Adzuki bean: a new promising pulse for the hills. Indian Farming 23:29–30 Wilf P, Cúneo NR, Johnson KR, Hicks JF, Wing SL, Obradovich JD (2003) High plant diversity in Eocene South America: evidence from Patagonia. Science 300:122–125 Williams JT, Brenner D (1995) Grain amaranths (Amaranthus species). In: Underutilized crops: cereals and Pseudocereals. Chapman and Hall (ICUC) Publishers, London, p 129 Wood RT (1985) Tale of the food survivor Quinova. East-West J 4:63–67 Yao DND, Kouassi KN, Erba D, Scazzina F, Pellegrini N, Casiraghi MC (2015) Nutritive evaluation of the bambara groundnut Ci12 landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] produced in Côte d ’ Ivoire. Int J Mol Sci 16:21428–21441 You SX, Sun HL, Chang BY, Chen ZP, Zuo JW (1987) The nutritional composition of grain amaranth and its potential for utilization. Acta Agron Sin 13:151–156

2

Status of Research on Underutilized Crops for Food Security

Presently humankind mainly depends on a few major crops to meet the requirements of diets. In the past, humankind has used different species to meet their needs. However, today about 30 major crop species dominate the global food production. These crops are widely and intensively cultivated and have been selected from more than 7000 food species (Myers 1983). The reasons behind such a narrow focus are physical appearance, taste, nutritional properties, cultivating techniques, processing qualities, environmental adaptability, range of possible uses, and storability. These factors have helped in the promotion of these crops and ensured their success across different countries and their acceptance by the different cultures. Today, more than six million accessions of genetic resources for food and agriculture are stored in more than 1300 germplasm collections centers globally (Anonymous 1996). Most of this ex situ conserved diversity (about 80%) belongs to major crops and their close relatives (Padulosi 1998). The research focus on the major crops resulted in a limited genetic resource in gene banks, and this will be a future challenge for successful improvement and promotion of underutilized crops. The continuously decreasing global agricultural productivity raises serious questions on how effectively major crops could contribute toward food and nutritional security, poverty alleviation, and ecosystem conservation. It is important fact that crop diversification at all levels and in all types of agro-systems is the most crucial element for sustainability (Collins and Hawtin 1998). The developing opportunities in last decade for utilization of minor crops reveal attention on their conservation and further their diversification and sustainable use (Table 2.1). Interest on underutilized crops developed due to their potential contribution to crop diversification, better use of marginal land and adverse growing environments, food and nutritional security, safeguarding agro-biodiversity and cultural heritage, additional source of income to farmers, and employment opportunities (Padulosi 1998). These points are fundamental to highlight the importance of underutilized species (Mal 1994). Indeed the true importance of underutilized species and their potentials is not related to their introduction to new areas but rather to the ways in which old and new use to address the today’s needs. Any effort in support to # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_2

29

30

2 Status of Research on Underutilized Crops for Food Security

Table 2.1 Major agencies involved in the promotion and utilization of underutilized crops in different countries Sr. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

11. 12. 13. 14. 15. 16.

Agency National prioritization committee ACIAR (Australian Centre for International Agricultural Research) BARC (Bangladesh Agricultural Research Council) ICAR (Indian Council of Agricultural Research) And NBPGR (National Bureau of plant genetic resources) Institute of crop genetic resources (ICGR) Taiwan agricultural research institute (TARI) and world vegetable Centre Vietnam academy of agricultural sciences (VAAS) Forest research institute Malaysia (FRIM) Pakistan agricultural research council (PARC) Philippine Council for Agriculture, aquatic, and natural resources Research and Development (PCAARRD) and National Plant Genetic Resource Laboratory, UPLB, Laguna Centre of biology, Indonesian institute of science research and development Sri Lanka Council for Agricultural Research Policy (SLCARP) United states department of agriculture (USDA) and ARS-GRIN Water research commission of South Africa and National Department of science and technology National Agriculture and Food Research Organization and Japan international research Center for Agricultural Sciences (JIRCAS) Nepal agricultural research council (NARC) and International Centre for Integrated Mountain Development (ICIMOD)

Country Sri Lanka, Kenya Australia Bangladesh India China Taiwan Vietnam Malaysia Pakistan Philippines

Indonesia Sri Lanka USA South Africa Japan Nepal

underutilized and neglected species must be consistent with this aspect to achieve their sustainable promotion and safeguarding their genetic base.

2.1

International Organizations and their Research Activities on Underutilized Crops

Comprehensive research efforts have been made in past few decades on underutilized species, aiming the conservation of their genetic base. The efforts for achieving this aim were initiated in the 1970s when development and spreading of high-yielding varieties were displacing many indigenous crops. The efforts for conserving biological diversity and plant genetic resources in agriculture keeping upcoming environmental and social changes under consideration were converted into a global commitment in the FAO global action plan for the conservation and sustainable utilization of plant genetic resources in agriculture.

2.1 International Organizations and their Research Activities on Underutilized Crops

31

In an international convention held at Chennai, the Consultative Group on International Agricultural Research (CGIAR) recognized value of underutilized plant species for ensuring food and nutritional security and combating poverty of resource-poor farmers. The international agencies are increasingly supportive of initiatives on neglected and underutilized species and working in collaboration with IPGRI (International Plant Genetic Resources Institute) such as BMZ’s support for a Global Facilitation Unit for Underutilized Species, the IFAD-supported global project on neglected and underutilized species, which focuses on nutrition and income generation, and the Dutch-supported project on leafy vegetables in sub-Saharan Africa. The efforts from different collaborations have established several international agencies which are involved in encouraging the research on underexplored species for broadening the range of plant species under cultivation. These agencies are helping in raising concern and awareness for conservation and sustainable use of underutilized plant genetic resources. 1. Consultative Group on International Agricultural Research (CGIAR): CGIAR is a global linkage engaging different organizations worldwide working with aim of providing food-secured future. The functioning of this research group is carried out by 15 CGIAR Research Centers in different countries in close collaboration with national and regional research institutes, civil society organizations, academic institutions and developmental organizations, as well as private sector. CGIAR research is dedicated to alleviating rural poverty, increasing food security, improving human health and nutrition, and ensuring sustainable management of natural resources. CGIAR originally supported four centers: CIMMYT (International Maize and Wheat Improvement Center); International Rice Research Institute (IRRI); the International Center for Tropical Agriculture (CIAT); and International Institute of Tropical Agriculture (IITA). CGIAR has also been involved in research on underutilized crops. The evolution in the CGIAR’s priorities and strategies has led to a situation where today a significant number of the centers are involved in one way or another, directly or indirectly, with underused species. In addition to the more traditional CGIAR work on genetic resources, plant breeding, and agronomy, activities now encompass such areas as crop diversification, domestication, income generation, processing, nutrition and health, marketing, and policy and institutional reform. 2. Food and Agriculture Organization (FAO): FAO, a United Nations agency headquarter located at Rome, Italy, is established in year 1945 with the objective of eradicating hunger and improving nutrition and socioeconomic status of people by increasing agricultural productivity and ensuring nutritional security. This includes long-standing work related to biodiversity for food and nutrition, including specific initiatives with underutilized plants and related indigenous knowledge. This work encompasses the policy initiatives, pilot action plans, and publications aimed at catalyzing the wider use of plant resources for food, nutrition, and livelihoods. The FAO Commission on Genetic Resources for Food and Agriculture is the intergovernmental forum for genetic resources,

32

2 Status of Research on Underutilized Crops for Food Security

with a notable focus on plant resources and underutilized species. Furthermore, FAO negotiated and hosts the International Treaty on Plant Genetic Resources. 3. IPGRI (the International Plant Genetic Resources Institute): IPGRI is an autonomous international scientific organization situated at Rome, Italy operating under Consultative Group on International Agricultural Research (CGIAR). IPGRI’s mandate is to advance conservation and use of plant genetic resources for benefit of present and future generations. The institute operates through three programs. These are (1) Plant Genetic Resources Programme, (2) CGIAR Genetic Resources Support Programme, and (3) International Network for Improvement of Banana and Plantain (INIBAP). IPGRI works in partnership with other organizations, undertaking research, training, and the provision of scientific and technical advice and information. IPGRI has been concerned to improve conservation and use of underutilized species since its establishment in the year 1974. IPGRI’s strategy for neglected and underutilized species is based on the deployment of plant genetic diversity in agriculture for achieving more equitable and sustainable development. The mandate of IPGRI includes work on both broadening the species portfolio within agriculture and the genetic diversity within crops and trees in production systems. This work also contributes toward implementation of FAO Global Plan of Action priority actions, e.g., “promoting underutilized crops,” the development of new markets for local varieties, the promotion of in situ and on-farm conservation, and public awareness of the value of plant genetic resources and their uses. IPGRI’s efforts to safeguard these resources for livelihood of rural communities across the globe are also consistent with the implementation of Convention on Biological Diversity. The ultimate goal of IPGRI’s strategy on neglected and underutilized crops is to enhance the biological assets of rural poor by enhancing and deploying a broader range of species adapted to diverse environments and providing new opportunities for better nutrition and income generation. To reach this goal, IPGRI has set out three main objectives: – Develop priority-setting approaches at local, national, and international levels and assist stakeholders to establish priorities for research, development, and conservation actions on neglected and underutilized species that increase their contribution to and impact on sustainable agriculture and livelihoods of rural poor and broaden the bases of food security. – Increase conservation and use of plant genetic resources of neglected and underutilized species through complementary approaches to genetic resources from production to consumption. – Strengthen the efforts of other organizations working on documentation, evaluation, improvement, processing, and marketing of neglected or underutilized species. 4. International Centre for Underutilized Crops (ICUC): The ICUC is an autonomous, nonprofit-making, scientific research and training center situated at Wye College, University of London, United Kingdom. The main function of ICUC is to provide expertise and acts as a knowledge hub and supported research programs on germplasm collections, agronomy, and postharvest management

2.1 International Organizations and their Research Activities on Underutilized Crops

5.

6.

7.

8.

33

of underutilized species. In recent years, the focus has been shifted to include processing and marketing assessments regarding underutilized crop species. ICUC carry out research activities on underutilized crops through networks in different countries as UTFANET (Underutilized Tropical Fruits in Asia Network), UTVAPNET (Underutilized Tropical Vegetables for Asia and the Pacific Network), SEANUC (Southern and East Africa Network for Underutilized Crops, ACUC (Asian Centre for Underutilized Crops), etc. Global Facilitation Unit (GFU): The Global Facilitation Unit for Underutilized Species is an initiative established in June 2002 under the umbrella of Global Forum on Agricultural Research (GFAR) and currently hosted by International Plant Genetic Resources Institute (IPGRI). GFU is a multi-institutional initiative works globally for promotion and commercial exploitation of underutilized crop species. Convention on Biological Diversity (CBD): The Convention on Biological Diversity (CBD) is an international agreement adopted at the Earth Summit, in Rio de Janeiro, in the year 1992. It has three main objectives: (a) to conserve biological diversity, (b) to use its components in a sustainable way, and (c) to share fairly and equitably the benefits arising from the use of genetic resources. The CBD was signed by more than 150 government leaders at “United Nations Conference on Environment and Development” (Rio Earth Summit). The convention is now one of the most widely ratified international treaties on environmental issues signed by 194 countries. The conservation of biodiversity is a common concern of humankind. The Convention on Biological Diversity covers biodiversity at all levels: ecosystems, species, and genetic resources. It also covers biotechnology. In fact, it covers all possible areas that are directly or indirectly related to biodiversity and its role in development, ranging from science, politics, and education to agriculture, business, culture, and much more. The Secretariat of the Convention on Biological Diversity (SCBD) is based in Montreal, Canada, and its main function is to assist governments in the implementation of the strategies of CBD and its programs of work, to organize meetings, draft documents and coordinate with other international organizations, and collect and spread information. Crops For the Future (CFF): Since its inception, Crops For the Future (CFF) has established partnerships with organizations around the world. Crops For the Future Research Centre (CFFRC) was established in the year 2011 to provide research support for global crops for future organization. CFF has a mandate to promote and facilitate the use of neglected and underutilized crops to improve food and nutrition security, health, and incomes of the poor and the sustainable management of fragile ecosystems. It was constituted in the year 2008 by merging two agencies, i.e., International Centre for Underutilized Crops (ICUC) and the Global Facilitation Unit (GFU) for Underutilized Species. The International Center for Tropical Agriculture (CIAT): CIAT is an International Center for Tropical Agriculture, situated in Colombia, with the mission to reduce hunger and poverty and improve human nutrition in tropics. Recently, CIAT is associated with the research activities on mainstream crop species as

34

9.

10.

11.

12.

13.

2 Status of Research on Underutilized Crops for Food Security

well as those species considered as underutilized. CIAT has several projects to bring improvement in regional food crop species. ICARDA (International Center for Agricultural Research in the Dry Areas): ICARDA headquartered at Beirut, Lebanon is a member of CGIAR, supported by CGIAR Fund, and is a nonprofit agricultural research institute that aims to improve the livelihoods of resource-poor people across the dry areas of world. Since its establishment in the year 1977 as a non-for-profit organization, ICARDA has implemented research for development programs in more than 50 countries in the world’s dry areas. ICARDA combines scientific evidence and indigenous knowledge from dryland communities to address these challenges, which also have considerable impact on emerging global issues of food security, land degradation, and climate change. Over the years, ICARDA has been involved in conducting research on a wide variety of unexploited crops, especially through its megaprojects on (a) integrated gene management: conservation, improvement, and sustainable use of agro-biodiversity in dry areas and (b) improvement, intensification, and diversification of sustainable crop and livestock production systems in dry areas. IFPRI (International Food Policy Research Institute): IFPRI is s an international agricultural research center located at Washington, USA, carrying out a number of policy-related activities that are relevant to unexploited species. IITA (International Institute of Tropical Agriculture): The institute was established in the year 1967 and is headquartered in Ibadan, Nigeria, with several research stations across African continent. It works with partners to enhance crop quality and productivity, reduce producer and consumer risks, and generate wealth from agriculture, with the ultimate goals of reducing hunger, malnutrition, and poverty. IITA’s research and development (R&D) focuses on addressing the development needs of tropical countries. IITA in addition to its work on Bambara groundnut, yam, and cowpea referred to earlier is working on underused crops primarily through its projects on agro-biodiversity and highvalue products. World Agroforestry Centre (ICRAF, the International Council for Research in Agroforestry): The World Agroforestry Centre is an international institute headquartered in Nairobi, Kenya, and founded in 1978 as “International Council for Research in Agroforestry” (ICRAF) has been active in underused species since its establishment. ICRAF has developed and maintains an online searchable agroforestry tree database that contains details of more than 500 species, and it manages a germplasm collection of approximately 1800 accessions. Asian Vegetable Research and Development Center or World Vegetable Center: It is an international research and development institute situated at Taiwan and is committed to alleviating poverty and malnutrition in the developing world through the increased production and consumption of nutrition- and healthpromoting vegetables. Apart from being involved in the research activities on major vegetables, this center has also shifted its focus on the potential utilization of underused vegetables. Further the center has also a mandate for building partnership with governments, nongovernmental organizations, universities,

2.1 International Organizations and their Research Activities on Underutilized Crops

14.

15.

16.

17.

35

research institutes, and the private sector to promote prosperity for the poor and health for all. APAARI (Asia-Pacific Association of Agricultural Research Institutions): APAARI with its headquarters in Bangkok is a unique multi-stakeholder regional organization in the Asia-Pacific region. It promotes and strengthens agriculture and agri-food research and innovation systems through partnerships and collaboration, capacity development, and advocacy for sustainable agricultural development in the region. Since its establishment in the year 1990, APAARI has significantly contributed toward addressing agricultural research needs and enhancing food and nutritional security in the region. The close links, networks, partnerships, and collaboration with stakeholders that APAARI has developed over the years, as well as its goodwill, authority, and focus on results, make the association an important organization in the region. ICRISAT (International Crops Research Institute for the Semiarid Tropics): ICRISAT headquartered in Patancheru (Hyderabad, Telangana, India) conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. ICRISAT and its partners help empower these poor people to overcome poverty, hunger, and a degraded environment through better agriculture. ICRISAT belongs to the Consortium of Centers supported by the Consultative Group on International Agricultural Research (CGIAR). ICRISAT in addition to the work on minor millets mentioned earlier has number of other activities that involve underused food crop species. CIFOR (Center for International Forestry Research): CIFOR headquartered in Indonesia is involved indirectly with underused forest species in a number of its projects, although these are mostly designed to address more generic issues such as the sustainable use of forests and managing landscapes for sustainable livelihoods. A project on protecting and improving human well-being through forests, for example, is conducting a series of case studies in India, Nepal, Cameroon, and Guinea, looking at markets for non-timber forest products and identifying methods and opportunities for sustainably producing them. CIP (International Potato Center): It is a research facility based in Lima, Peru, that seeks to reduce poverty and achieve food security on a sustained basis in developing countries through scientific research and related activities on potato, sweet potato, and other root and tuber crops. CIP is one of the 15 specialized research centers of the Consultative Group on International Agricultural Research (CGIAR). CIP is continuing to work on Andean roots and tubers, primarily through its in situ and ex situ conservation activities and the selection of superior genotypes. It is also involved in activities on other Andean crops, for example, quinoa (Chenopodium quinoa). CIP also convenes a collaborative project entitled Urban Harvest that promotes urban and peri-urban agriculture and includes a number of research activities on underused species, especially vegetables.

36

2 Status of Research on Underutilized Crops for Food Security

2.2

Research Activities on Underutilized Crops in India

In India and other developing countries which are diversity rich and hold enormous indigenous knowledge, research and development in underutilized species is gaining momentum because of their adaptability to local agro-ecosystems, farming systems, and degraded and marginal lands. Besides, minor crops have high genetic diversity, low pest risk, multipurpose uses, and scope for value addition. Moreover, they are well-tuned to native/traditional farming practices with low inputs and provide food and nutritional security to rural communities. Realizing the importance of underutilized plants for diversification of agriculture and empowering the rural livelihoods which constitute a major portion of the total population in India was initiated in the 1960s at the Indian Agricultural Research Institute, New Delhi. This research was later extended by All India Coordinated Research Project on Underutilized and Underexploited Plants was established in 1982 during Sixth Five-Year Plan with its headquarters at the National Bureau of Plant Genetic Resources (NBPGR), New Delhi. During the tenth Five-Year Plan, this project was brought into a network mode and was renamed as All India Coordinated Research Network on Underutilized Crops (AICRNUC). Further, during the XII Plan it was renamed as All India Coordinated Research Network on Potential Crops (AICRNPC). There are several underutilized and introduced plant species which have potential to be exploited for various purposes. Ravi et al. (2010) discussed the mobilizing neglected and underutilized crops to strengthen food security and alleviate poverty in India. For strengthening of research on underutilized plants in India, All India Coordinated Research Project operates at various centers in different agroclimatic zones of India. During last three decades, a comprehensive research work has been carried out on underutilized crops in the country under this project with the following objectives: 1. To find new plant resources for food, fodder, and industrial uses. 2. To build up an extensive germplasm collection for their characterization and conservation. 3. To identify/develop high-yielding varieties of these crops for different farming situations. 4. To evolve an appropriate package of agronomic practices for their economic cultivation. 5. To disseminate knowledge about potential lesser known species. The main focus of AICRNPC is: 1. Introduction of new potential and useful plant species from different places and evaluating and testing them for acclimatization to local conditions. 2. To collect, evaluate, and conserve the germplasm of existing regional crops of importance through the cooperation of NBPGR Regional Stations.

2.2 Research Activities on Underutilized Crops in India

37

3. To breed new varieties through appropriate crop improvement research and standardize their production and protection technology through coordinated efforts. 4. Popularization of such underutilized crops in newer areas, besides taking up transfer of technology-related activities through frontline and on-farm demonstrations. Every available mode is made use of including television, radio, newspapers, etc. in popularizing these crops using their unique nutritional and special attributes as incentives. The underutilized crops identified in India have been prioritized according to their suitability to the existing cropping systems or potential to supplement new systems.

2.2.1

Activities on Promotion and Utilization of Underutilized Crops in India

1. Building up the germplasm of underutilized crops: Through well-organized efforts, large germplasm collections over the years have been built for the underutilized crops. The germplasm has been augmented through introduction from other countries through linking network of NBPGR. Thus, through exploration and introduction efforts, library of many accessions have been built up so far for underutilized crops. Extensive collections have been made of amaranth (Amaranthus sp.) from Uttar Pradesh, Himachal Pradesh, and North-Eastern Hill region, Gujarat and Maharashtra. A number of accessions of buckwheat (Fagopyrum sp.) have also been collected from same regions. A sizable germplasm of rice bean (Vigna umbellata) have been maintained by collecting different accession from the diverse locations of the country. The key role in this comprehensive effort has been played by NBPGR followed by a few individual centers for particular crops. There are certain areas in India where surveys are still needed to be conducted for germplasm collection of underutilized crops (Table 2.2). 2. Evaluation of germplasm and documentation: A systematic evaluation and characterization of different indigenous and introduced germplasm has been done for the underutilized crops such as pseudocereals and minor grain legumes, minor fruits, vegetables, oilseed crops, and industrial crops. This has resulted in the development of varieties of different underutilized crops for cultivation by the farmers under All India Coordinated Research Projects/network on small millets, underutilized crops, and arid legumes. Performance of some of these varieties was verified on farmers’ fields in the tribal, backward, and hilly areas. 3. Maintaining diversity of underutilized crops: The world is precariously dependent on a limited number of food crop species despite its wealth of traditional, locally adapted underutilized species. In many cases, the underutilized species have a much higher nutrient content than globally known species or varieties, even though they may not be fully suited to conventional production systems. Hence, there is a need of broadening the agriculture food base resource through

38

2 Status of Research on Underutilized Crops for Food Security

Table 2.2 Status of germplasm of some underutilized crops at NBPGR, India Crop group Food legumes

Millets

Pseudocereals

Industrial crops

Underutilized species Rice bean Faba bean Moth bean Horse gram Finger millet Foxtail millet Kodo millet Proso millet Barnyard millet Amaranth Buckwheat Chenopod Jatropha

Germplasm holdings 2067 824 1546 2500 7122 2821 1537 939 1657 5822 1000 197 2101

Source: Rana et al. (2016); Singh (2017)

conservation and sustainable utilization of neglected plant species. In the view of current large-scale overexploitation of lands, ecosystems are under threat because of the fragility of these ecosystems. In diversity-rich areas, conservation of underutilized species is obligatory for current and future use. Their conservation can be carried out through (1) in situ conservation by using local cultivars and (2) conservation through gene banks (ex situ conservation). Valuable germplasm of underutilized plant species is maintained at National GeneBank established by NBPGR, New Delhi, and its regional stations, located in different agroclimatic zones of the country. Also, a few selected centers of AICRPPC have the responsibility for maintaining the germplasm of particular species. 4. Varietal development: The evaluation of sizable germplasm of different few selected native and introduced underutilized plant species unveils the existence of variability in the germplasm and has been successfully utilized for the development of improved varieties through crop breeding approaches. Chemical analysis for quality traits and some anti-nutritional factors has been carried out for the germplasm and genotypes entered in coordinated trials of different crops. The genotypes superior in quality parameters has been use in breeding program. A number of multi-locational trials have been conducted to release promising varieties for grain amaranth, buckwheat, winged bean, rice bean, faba bean, guayule, and jojoba. A total of 42 varieties have been released for different underutilized crops. List of some varieties and recommended regions for cultivation is given in Table 2.3. 5. Breeding efforts: Concerted breeding efforts have also been initiated in a few selected potential crops at specified research centers for developing better varieties such as breeding grain amaranth at Ranichauri, Bangalore, Bhubaneshwar, and S.K. Nagar; in rice bean at Ludhiana, Pantnagar, Ranichauri, and Bangalore; and in faba bean at Hisar. Hybridization programs are underway

2.2 Research Activities on Underutilized Crops in India

39

Table 2.3 Released varieties of some underutilized crops in India Underutilized species Amaranth

Chenopodium Buckwheat

Winged bean Rice bean

Faba bean Guayule Jatropha Jojoba

Released variety Annapurna PRA-1 PRA-2 PRA-3 Durga GA-1 GA-2 GA-3 RMA-4 Suvarna Kapilasa Him Bathua Himpriya VL-UGAL-7 PRB-1 Himgiri Sangla AKWB-1 RBL-1 RBL-6 PRR-2 BRS-1 VH 82–1 Arizona-2 HG-8 Chhatrapati EC 33198

Recommended areas/regions Mid and high Himalayan region Northwest Himalayas except J&K Northwest Himalayas except J&K Northwest Himalayas Northwest Himalayas Gujarat, Maharashtra Gujarat Gujarat and Jharkhand Rajasthan Karnataka Orissa High hill and dry temperate zone of HP High-altitude region Mid hills of UP Mid and high hills Mid and high hills of HP Mid and high hills of HP All winged bean areas Punjab NW and NE regions Northwest hills Hilly region Northern plains Arid and semiarid regions Arid and semiarid regions Gujrat, Orissa, Haryana, and Maharashtra Arid and semiarid regions

for amaranth, rice bean, and tumba (C. colocynthis), while mutation breeding programs are being carried out in rice bean, winged bean, and tumba. 6. Development of the network: Networking for underutilized crops needs a great deal of clarification since a major goal is widely recognized as using such crops to broaden the base of agriculture and incorporating them into sustainable utilization to meet the ever-increasing demand for food and other agro-products as well as to sustain the ecological balance by maintaining diversity in agriculture. It also helps in conserving the cultural heritage and sustainable farming systems in remote areas and on marginal lands since most of the new crops are linked to subsistence farming systems in other regions in India. Extensive networking has been established with nongovernmental organizations, universities, research institutes, and the private sector to promote and utilize the underutilized crops for meeting out requirements of people. These linkages have been useful in the dissemination

40

2 Status of Research on Underutilized Crops for Food Security

of information on improved varieties and production technology of different underutilized crops. There are many plant species with significant food and/or industrial potential which remain underutilized through lack of a coherent strategy for their evaluation and development. The vast numbers of those unused and underutilized species represent an enormous untapped commodity resource which can help to meet the increasing demand for food and nutrition, energy, medicines, and industrial needs. Some of these untapped resources are either partly or fully domesticated, but most remain wild and unevaluated. Realizing the potential of underutilized crops in the diversification of agriculture and food habits of the people, many international and national agencies are working together to promote underutilized species for agricultural systems, as alternative crops or as sources of new products, and these programs have been undertaken in both developing and developed countries. In 1996, the FAO Global Plan of Action for the conservation and use of plant genetic resources for food and agriculture led to the greater commitment to promote and commercialize underutilized species. Later, IPGRI strengthened its activities on conservation and use of neglected and underutilized plant species. In India, NBPGR and All India Coordinated Research Network on Potential Crops (AICRNPC) are leading from the front for promoting underutilized crops and particularly by designing and implementing appropriate research—whether crop diversification, maintenance of agro-biodiversity, or meeting the needs of industries and/or communities.

References Anonymous (1996) Report on the state of the world’s plant genetic resources for food and agriculture, prepared for the international technical conference on plant genetic resources, Leipzig, Germany, 17 to 23 June 1996. Food and Agriculture Organization of the United Nations, Rome Collins W, Hawtin G (1998) In: Collins WW, Qualset C (eds) Conserving and using crop plant biodiversity in agroecosystems. In: biodiversity in agroecosystems. CRC Press, Washington Mal B (1994) Underutilized grain legumes and pseudocereals: their potentials in Asia. RAPA/FAO, Bangkok Myers N (1983) A wealth of wild species: storehouse for human welfare. Westview Press, Boulder Padulosi S (1998) Criteria for priority setting in initiatives dealing with underutilized crops in Europe. In: Proc. Eur. Sym. Plant Genet. Resour. Food Agric, Braunschweig Rana JC, Gautam NK, Gayacharan, Singh M, Yadav R, Tripathi K, Yadav SK, Panwar NS, Bhardwaj R (2016) Genetic resources of pulse crops in India: an overview. Indian J Genet 76:420–436 Ravi SB, Hrideek TK, Kumar ATK, Prabhakaran TR, Mal B, Padulosi S (2010) Mobilizing neglected and underutilized crops to strengthen food security and alleviate poverty in India. Indian J Plant Genet Resour 23(1):110–116 Singh K (2017) Country status reports on underutilized crops. Regional expert consultation on underutilized crops for food and nutritional security in Asia and Pacific. APAARI, Thailand. November 13-15, 2017. Pdf retrieved from http://www.slideshare.net/appari

3

Prospects of Underutilized Crops in Combating Poverty, Malnutrition, and Hunger

In the past few years, in particular the post green revolution era, we are struggling to provide, food, income, nutrition and environmental sustainability to the larger section of the world population. We have achieved the goal of food security in different parts of the world through green revolution by focusing on few staple crops, however over the years, the global food security in the world is constrained by many factors including overreliance on few key staple crops with many socioeconomic and ecological challenges. In order to make the world more sustainable in terms of food security, the alternative food crops which have potential to become one of the major food crops should be included in the diets of the people. To address the hunger and malnutrition in the world, especially in developing and underdeveloped countries, various international organizations have made emphasis on the potential utilization of the minor food crops in daily cuisine of people in combination with staple food crops. The prospects of underutilized crops in achieving the food and nutritional security in the world have been discussed in the following subheads.

3.1

Underutilized Crops and Food Security

Food security concept has evolved over the years following its introduction in the year 1970. Initially the term was concerned with the availability of food, both nationally and globally. However, in the year 1980, the focus was shifted on accessibility to food at family and individual level. Since then a number of several definitions and conceptual models have been given to understand the concept of food security. In year 2001, Food and Agriculture Organization (FAO) described food security as “reliable access to adequate and nutritious food that meets the dietary requirements and food preferences of all people, at all times for a healthy life”. In today’s globalized and interdependent world, a number of marginalized people in developing and underdeveloped countries don’t have reliable access to nutritious food, hence food and nutritional insecurity, mounting demands for energy and raising poverty are the key challenges (Stagnari et al. 2017). An efficient solution # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_3

41

42

3 Prospects of Underutilized Crops in Combating Poverty, Malnutrition, and Hunger

for these problems is not only ethnically imperative but is an essential requirement for world’s peace and security. At present, agriculture is under immense pressure for increasing food production with limited land resources to meet the requirement of expanding population. The situation will be more critical in comimg 20-25 years as the world population is expected to reach near 9 billion (Anonymous 2015). It has been predicted that food production has to be increased more than 60% to meet out the requirements of raising human population by the year 2050. This could be achieved by following agricultural intensification and yield improvements with additional land clearing. However, this would lead to increase in global land clearing natural ecosystems to a total of about one billion ha by the year 2050 and increase in global agricultural greenhouse gas emissions. Further, the production gains would come at the expense of dramatic global environmental impact eutrophication of terrestrial, freshwater and near-shore marine ecosystems and comparable increases in pesticide usages which would lead to massive loss of biodiversity and ecosystem services and consequently, the loss of quality of life for mankind. From past few years, significant efforts have been made to accomplish the objective of improved food production through green revolution. The cereal food production was more than double between 1960s and 1985s with the innovation in crop production technology, using high yielding varieties, improvement in irrigation facilities and advanced agricultural tools (Conway 1997). During this period, improved varieties of paddy, wheat, maize were responsible for increasing the food production by twofolds or threefolds in comparison to the varieties which were used conventionally for decades (Freed and Freed 2002). However, improvement in food production through green revolution reduced the variations within the well-established food crops. As a result of the green revolution, many of those local, traditional crop species and varieties have been replaced by high-yielding staple crop cultivars developed by modern breeding programs. Traditional crops typically do not meet modern standards for uniformity and other characteristics as were neglected by breeders. Thus they tend to be less competitive in the marketplace compared with commercial cultivars. In addition to this, replacement of traditional landraces with improved varieties also increased the risk of genetic erosion of plant diversity”. The erosion of agricultural diversity, especially of underutilized crops, causes loss of resilience in the face of climate change, social and economic shocks and low ecosystem functionality. In increasingly globalized and mechanized world, eradicating hunger is a prerequisite. To feed 9 billion people by the year 2050, at the same time protecting the environment, providing healthy and nutritious food for all, there is a dire need of diversification in our agriculture systems. A key strategy for the diversification in agriculture is the utilization of minor food crop species. The overreliance on a few crops leaves an abundance of plant genetic resources with potentially beneficial traits neglected. Exploiting the large reservoir of underutilized crop plants would provide multiple options to build temporal and spatial heterogeneity into uniform cropping systems and ultimately leading to a more sustainable supply of diverse and nutritious food. At the national level, underutilized crops can absorb economic and social shocks which might hit the population. They are often grown in poor areas where

3.2 Underutilized Crops and Nutritional Security

43

difficult agro-ecological conditions predominate, and where smallholder farmers do not have the means to adopt the high-input agricultural practices. Farmers maintain high levels of traditional varietal diversity. Diversity provides insurance as these are well adapted to marginal ecosystems and aberrant growing environments. Enhancing diversity by growing underutilized crops will not only diversify agroecosystems, but will also improve their adaptability to extreme climatic conditions and provide resilience to many stresses (Padulosi et al. 2002). Padulosi et al. (2009) reported that minor millets in India, due to short life cycle and an efficient root system had comparative advantage over other staple crops during drought. The diversity in local varieties of sorghum and pearl millet also appear to have an important component of survival for poor farmers during the long period of drought. Underutilized crops have been found resistant to many pests and diseases. These examples and combined with growing concerns over climate change and its impact on agriculture, contribute to a better appreciation of the role of underutilized crops in food security and resilient food systems, since crop diversification is one of the best ways to ensure sustainable agricultural production systems. This, in turn, require for more reliable seed supply systems that allow farmers to exploit the potential of underutilized crops.

3.2

Underutilized Crops and Nutritional Security

In the green revolution and in following decades, the focus of agricultural research was on increasing crop production to ensure adequate calories for people rather on nutritive quality. Emerging evidences suggested that over-dependency of rapidly growing population on cereal-based diets in addition to, high volatile prices of protein rich foods, paucity of fertile lands and humiliation of natural resources are major contributing factor for nutritional insecurity in human population. Around 795 million malnourished people (comprising around 12% of the total global population), exist in the world and apparently 98% of them are from developing countries (Anonymous 2015). The public health importance of these deficiencies lies upon their magnitude and their health consequences, especially in pregnant women and young children, as they affect fetal and child growth, cognitive development and resistance to infection. Although people in all population groups in all regions of the world may be affected, the most widespread and severe problems are usually found amongst resource poor, food insecure and vulnerable households in developing countries. Poverty, lack of access to a variety of foods, lack of knowledge of appropriate dietary practices and high incidence of infectious diseases are key factors. Micronutrient malnutrition is thus a major impediment to socio-economic development contributing to a vicious circle of underdevelopment and to the detriment of underprivileged crops. It has long-ranging effects on health, learning ability and productivity and has high social and public costs leading to reduced work capacity due to high rates of illness and disability. A major portion of the world population depends on few staple food crops for basic diet e.g., Wheat, Rice and Maize. These food crops dominate human

44

3 Prospects of Underutilized Crops in Combating Poverty, Malnutrition, and Hunger

consumption as they provide vital nutrients to people in developing countries; however they are nutritionally incomplete foods and their excessive consumption results in the deficiency of essential nutrients. For example, the over dependence of population on rice based diets is more prone to suffer from the deficiency of vitamin A, iron, zinc, and iodine. Hence, growing more staple food crops which are deficient in essential vitamins and minerals is not an effective strategy for tackling malnutrition associated problems caused by nutrient poor diets. In this regards, the focus of research should be shifted towards exploiting underutilized plant species for diversification of production and consumption habits. Underutilized crops provide essential micro-nutrients and thus act as a complement to staple foods. Additionally, underutilized crops also provide income opportunities. Many underutilized crops are high in nutrients and therefore could play a role in improving the diets of millions of people. Strategies based on diverse local food crops can provide a valuable and sustainable complement to other means of tackling malnutrition. It is widely accepted that increased consumption of locally available indigenous or traditional crops can improve human nutrition (Mayes et al. 2011; Kahane et al. 2012). For example, many underutilized fruits and vegetables contain more vitamin C and pro-vitamin A than well known crops. Neglected grains such as quinoa (Chenopodium quinoa) or fonio (Digitaria exilis), have better protein quality than most major cereals. The bambara groundnut (Vigna subterranea) from Africa, is rich in protein (24%), with high methionine content. Additionally, underutilized crops also provide flavoring in local cuisine, strengthen local gastronomic traditions and provide income opportunities for both the rural and urban poor. Many underutilized crops are high in carotenoids and minerals and therefore could play a role in improving micro-nutrient content in the diets of millions of people across the globe. In countries, where urbanization is changing the ways of living life, green vegetables and fresh fruits are considered as good source of nutrition. However, for many people in developing countries fruit and vegetables are difficult to afford (Ruel et al. 2005). Additionally fortified food products and increased consumption of fish and animal products are effective means of addressing some nutrient deficiencies, but these products are out of reach. Increased consumption of underutilized crops could help on addressing such deficiencies. In developed countries, the transition from traditional diets to a western style diet, high in fats, salt, sugar and processed foods, increases the incidence of non-communicable diseases. This trend is global, but is particularly worrying when combined with poor nutrition. Underutilized crops can be effective in ensuring both food insecurity and hidden hunger and are particularly useful in improving diets which are highly rich in refined carbohydrates, fats and other essential nutrients. Underutilized crops offer opportunities to make the diets more nutritious thus seem to be playing a much greater role in improving nutrition and health. With changing food habits and increased globalization and urbanization of the world, the attainment of global food and nutritional security is a key challenge for the food researchers around the world in near future. It seems highly likely that agriculture in large regions of world may need to undergo significant adjustment over the

References

45

next four decades to have any chance of meeting needs. It has envisaged that diversification of agriculture and food habits of people with underutilized crops alone or in combination with major staple food crops could make nutritional and food security achievable in coming future.

References Anonymous (2015) FAOSTAT. Food and Agriculture Organization of the United Nations, Rome, Italy Conway G (1997) The doubly green revolution. Penguin, London Freed SA, Freed RS (2002) Green revolution: agricultural and social change in a north Indian village. Anthropological papers of the AMNH; no. 85 Kahane R, Hodgkin T, Jaenicke H, Hoogendoorn C, Hermann M, Keatinge D, d’Arros Hughes J, Padulosi S, Looney N (2012) Forthcoming. Agrobiodiversity for food security, health and income. Agron Sustain Dev 33:671–693. https://doi.org/10.1007/s13593-013-0147-8 Mayes SD, Calhoun SL, Murray MJ, Zahid J (2011) Variables associated with anxiety and depression in children with autism. J Dev Phys Disabil 23(4):325–337 Padulosi S, Hodgkin T, Williams JT, Haq N (2002) Underutilized crops: trends, challenges and opportunities in the 21st century. In: Engels JMM, Rao VR, Brown AHD, Jackson MT (eds) Managing plant genetic diversity. CABI Publishers, Wallingford Padulosi S, Mal B, Ravi SB, Gowda J, Gowda KTK, Shanthakumar G, Yenagi N, Dutta M (2009) Food security and climate change: role of plant genetic resources of minor millets. Indian J Plant Genet Resour 22(1):1–16 Ruel MT, Minot N, Smith L (2005) Patterns and determinants of fruit and vegetable consumption in Sub-Saharan Africa. Background paper for the joint FAO/World Health Organization (WHO) workshop on fruits and vegetables for health, Kobe Stagnari F, Maggio A, Galieni A, Pisante M (2017) Multiple benefits of legumes for agriculture sustainability: an overview. Chem Biol Technol Agric 4:2

4

Constraints in Research, Promotion and Utilization of Underutilized Crops

Neglected or underutilized crops have untapped potential to support smallholder farmers and rural communities by improving their income, food and nutritional security. However, there are many obstacles in research and exploitation of potential of underutilized crops as presented in Fig. 4.1 and discussed below: 1. Climate change: With changing climate, the agro-ecology of many regions in the world is continuously changing and also has an impact on agro-biodiversity including underutilized crops. However, given their greater resilience as compared with major crops, underutilized crops are expected to offer great opportunities to farmers to cope with biotic and abiotic stresses (Padulosi et al. 2011). A comprehensive research work is required to validate resilience features of underutilized crops. 2. Loss of genetic diversity and traditional knowledge: Increased urbanization and rising demands of improved modern supply chains, lead farmers to concentrate on fewer crops. The result is a steady loss of biodiversity. This erosion will lead to irretrievable loss of the strategic resources necessary for wellbeing of millions of people. The rate of loss of underutilized crops through extinction and genetic erosion is accelerating in many areas of the world as a result of droughts, bushfires, pests and diseases, overexploitation, overgrazing, land clearing, deforestation, mining, overuse of pesticides, fertilizers and other agrochemicals and lack of incentives for farmers to maintain this diversity. Together with the loss of the species themselves, there is widespread erosion of local traditions and knowledge. The loss of indigenous knowledge has contributed in the loss of hundreds of valuable crops worldwide. 3. Undervaluation due to lack of knowledge and research: Due to lack of knowledge or limited participatory research, the nutritional or economic values of indigenous crops is not fully recognized. Many of agronomic practices which have been adopted for these crops have not been documented or even considered by researchers therefore, their potential contribution is lost. Traditional plants are deemed to be old-fashioned and unattractive in comparison to modern, exportable # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_4

47

48

4 Constraints in Research, Promotion and Utilization of Underutilized Crops

Fig. 4.1 Major hurdles in promotion and utilization of underutilized crops

crops produced in much simpler production systems, thereby such valuable genetic resources can be lost before they can be fully characterized and effectively used. The lack of recognition of the importance of participatory research at policy level is also responsible for their underutilization. 4. Poor competitiveness and lack of infrastructure: Today many underutilized crops have been neglected due to poor economic competitiveness. Major crops are benefitted from consistent investment in research and development or getting support for their production and markets. Poor market oriented research, consequent lack of attention by governments and policy makers and poor facilities for value addition and marketing has deprived the utilization of underutilized crops. An important constraint is the lack of stable sources of quality seed for many underutilized crops, although with sufficient training, particularly in marketing and managerial skills as well as in the technology of seed production, farmers can successfully provided with sustainable supplies of quality seed (Witcombe et al. 2010). 5. Lack of information: A number of indigenous plant species remain unexplored due to lack of information on their distribution and potential, inadequate policies, unavailability of physical infrastructure and lack of good extension materials (Information packaging).

4

Constraints in Research, Promotion and Utilization of Underutilized Crops

49

6. Lack of genetic material: Due to the lack of research efforts and challenges in the conservation of germplasm, the genetic material for bringing improvement in underutilized crops is less. This is also one of the hurdles in the promotion of underutilized crops. Therefore it is necessary to set up local germplasm supply systems among rural communities Initiate participatory and other improvement programmes to obtain clean planting materials. 7. Intense urbanization: The urbanization has brought considerable changes in food habit of people. This offers new opportunities for underutilized plant species to enter niche markets, creating income and job opportunities in rural areas. Nonetheless, urbanization also leads to prime agricultural land being used for housing, thereby increasing the stress on the remaining agricultural areas. 8. Policies and investment: The sustainable use of underutilized crops is also hampered by inappropriate rural development policies and programmes which focus on a limited number of commodities. The major issues in these areas include: a. Absence of legal frameworks, policies, projects, national programmes and strategies b. Poor investment in research, projects and programmes on underutilized crops c. Lack of characterization, breeding and evaluation of underutilized crops d. Lack of integration between conservation and use programmes e. Absence of efficient seed supply schemes f. Influence of international research priorities on national research and development priorities 9. Challenges in the in situ and ex situ conservation: Since the time that the Convention on Biological Diversity provided a general framework for ex situ and in situ conservation strategies, most agencies dealing with plant genetic resources conservation have been facing the dilemma of how to implement in in situ conservation of agricultural biodiversity in practical terms. The major challenges faced to achieve this end are centered on the following points: a. Lack of clear understanding of the scientific basis of in situ conservation of agricultural biodiversity b. Difficulty in changing the mindset of current institutional set up to work closer with farmers and communities c. Rationale of identifying least cost conservation areas d. Difficulties in identifying sustainable incentive mechanisms to support on farm conservation e. Obstacles in providing policy support to empower communities in diversity rich areas for community based management of agricultural biodiversity

50

4 Constraints in Research, Promotion and Utilization of Underutilized Crops

Fig. 4.2 Strategies for promotion and utilization of underutilized crops

4.1

Strategies for Promoting Underutilized Crops

For developing strategies to promote underutilized crops, barriers in mainstreaming of these crops have to be removed. These barriers are mainly attributed to (a) inefficiency in producing, storing and processing of underutilized crops (b) lack of sound knowledge of properties of underutilized crops (c) disorganized or non-existing food supply chains and (d) poor economic competitiveness of underutilized crops (Chweya and Eyzaguirre 1999; Fanzo et al. 2013). To better ensure food supply chain of underutilized crops, the most decisive action plans have to be developed and implemented (Fig. 4.2).

4.1.1

Information Generation

Generation of new knowledge through mapping and documentation of existing indigenous knowledge and further scientific research will help in carrying out (a) analysis of gaps in indigenous knowledge, (b) studies on specific cultural practices involving underutilized species, (c) studies on nutritional value and for

4.1 Strategies for Promoting Underutilized Crops

51

validation of traditional knowledge, (d) post-harvest handling/processing research (e) research for genetic enhancement of priority species. At national level, ethnobotanical surveys of underutilized crops linked to agricultural and economic development are important steps.

4.1.2

Information Transfer and Communication

An improved management of information and communication is a prerequisite to raise awareness and build capacity in primary stakeholders. Disseminating information on underutilized crops through local agencies, in fact sheets, newsletters and other media can promote household consumption of underutilized crops. Getting the message across to stakeholders and policy makers explaining that conserving and using underutilized crops can benefit communities, contribute to human nutrition and health and bring benefits both nationally and internationally. Scientists can generate, collect and disseminate information on the food and nutritional value and consumption of underutilized crops and establish formal databases and repositories of information on the economic and social aspects to provide evidence of economic and social contributions of underutilized crops. In addition to this, extension services should also be initiated. Information campaigns to promote greater use of underutilized crops and boost demand can target the general public with messages about the nutritional value of traditional and local foods and the role a varied diet plays in maintaining human health. National publicity campaigns promoting benefits of consuming underutilized crops can highlight products made with underutilized crops ingredients. Often the ecological and technological knowledge about underutilized crops is lost or only limited information is available for smallholder farmers who mainly grow these neglected crops. Thus, training courses for local farmers, extension workers and households for obtaining knowledge and skills necessary for production and household preparation of underutilized crops should be conducted. Moreover, in-depth high-level training on potential utilization of underutilized crops should be provided by universities, private companies and non-governmental organizations.

4.1.3

Maintaining Diversity

Little is known of the eco-geographic distribution of many neglected and underutilized crops and even less of the extent and distribution of their genetic diversity. Their poor conservation and high rate of genetic erosion warranted coordinated efforts to safeguard these resources. Surveys, taxonomic identification and analysis of the extent and distribution of genetic diversity, together with work on local and traditional knowledge, remain priorities for many underutilized crops. Tools to assess genetic erosion will have to be developed and applied to facilitate these processes. From this information, complementary conservation strategies will need to be developed that give priority to maintenance in production systems (in situ

52

4 Constraints in Research, Promotion and Utilization of Underutilized Crops

conservation), with ex situ conservation providing back-up systems and material for access by other users. Characterization and evaluation can, in many cases, be carried out in the production systems with the communities growing and using underutilized crops. There may also be a need for specific studies on topics such as reproductive biology, in vitro conservation and ways of eliminating viruses from vegetatively propagated species.

4.1.4

Enhanced Research and Dissemination of Technology

The lack of research on underutilized crops, particularly on their nutritional aspects, prevents them from realizing their full potential. There are huge gaps in knowledge, such as importance of underutilized crops in the diets of the poor, the bioavailability of nutrients, the impact of underutilized crops on vitamin A deficiencies and the role of underutilized crops carotenoids and minerals in healthy diets. Lack of research constrains the marketing of underutilized crops and seldom correlates well with morphological analysis. Combining scientific with indigenous knowledge of underutilized crops will be useful in identifying specific traits to focus on when selecting germplasm and assessing productivity of underutilized crops. Commonly, underutilized crops are mainly cultivated on small-scale local smallholder farms, they are produced, stored, and processed manually using simple traditional techniques which are time-consuming and labor-intensive processes (Eissing and Amend 2008). Underutilized crops have yield stability, high nutrient and low water demand and are also adapted to local pests. Collectively, these factors enable low-cost production of these crops (Thies 2000). However, for new crops to compete with already established crops, it is necessary to improve cultivation techniques. This has been also shown in the study conducted by Ravi et al. (2010), where traditional millet cultivation resulted in a loss to several farmers due to low yield; however, advanced techniques resulted in 60% increase in yield. Documentation and characterization of underutilized crops and dissemination of information on their properties, their cultivation requirements, and their processing applicability is essential to improve their utilization. Holistic approaches that link conservation to use via value or market chain approaches will help in the identification of priority species and add value to address limited competiveness. Scientists also need to study adaptive traits in underutilized crops landraces that could be important for breeding new varieties resilient to climate change. They could use tools and knowledge already developed for other crops and adapts these to strengthen research on underutilized crops. To address challenges, needs and opportunities related to underutilized crops there should be participatory approaches to consult local communities on proposed research or development. Researchers should consult farmer organizations during project planning. Scientists should acknowledge that farmers are practical plant breeders and that selecting planting material in response to changes in local environments happens at the farm level. Farmer organizations could make advances available to others in similar circumstances and exchange varieties, not only among farmer organizations within a country, but also with organizations in other countries. These exchanges will be

4.1 Strategies for Promoting Underutilized Crops

53

important in responding to climate change. Policymakers, government agents and agronomists can promote informal seed exchange including of gene bank materials among farmers, in particular between those in similar agro-ecological zones. Support could include developing knowledge systems, training encouraging farmer seed enterprises and linking regional gene banks. Organizing seed and biodiversity fairs will increase exposure and raise public awareness.

4.1.5

Uplifting Trade and Market Development

Underutilized crops can contribute to improvement of socioeconomic status of smallholder farmers in different communities (Meaza and Demssie 2015). However, prerequisite is their integration into production systems and development of sustainable markets at national and international level is essentially required (Wezel et al. 2016). Market development, which includes development of functioning value chains, provision of relevant training and support for business development, is more predictable, and success in this area is more likely. Research to find innovative solutions to mitigate harvest and postharvest limitations and to develop profitable local underutilized crops enterprises is also a priority. For commercial exploitation of underutilized crops, overcome different trade and regulatory barriers have to be removed. This will require collaboration of numerous and various stakeholders. One of the main trade barriers is country borders which are linked to different law systems, traditions and expectations of consumers. The provision of certification standards based on an internal control system will contribute to uplift such barriers (Preissel and Reckling 2010).

4.1.6

Creation of Supportive Policy Environment

Legal protection of underutilized crops is currently limited. Private sector interest in underutilized crops is mainly on species with either an economic or a health value. In most cases, local communities have been growing and caring for these species for generations. Policies conducive for conserving underutilized crops on-farm encourage the improvement and sharing of germplasm. Appropriate policies can also encourage the development of local markets and provide better access to international markets. Including underutilized crops in rural development policies can enhance adaptation to climate change and buffer agricultural production systems against climate shocks. Wider adoption and sustainable use of underutilized crops can multiply the many livelihood benefits they confer. Research policies to address bottlenecks can support full utilization of underutilized crops. National governments can create a supportive environment by developing policies that promote: • Including underutilized crops as part of, for example, school feeding programmes and sustainable diets • Enriching food aid with nutritious underutilized crops

54

4 Constraints in Research, Promotion and Utilization of Underutilized Crops

• Providing subsidies for growing and marketing underutilized crops • Providing official support for education campaigns to promote use of underutilized crops among young people • Running communication campaigns to change the all-too-common perception of underutilized crops as the “Food of the Poor” Underutilized crops are endowed with the potential for ensuring food and nutritional security to the growing population of the world. However, the possible reasons for their low utilization are lack of information on their nutritional and production potential, lack of governmental policies on utilization of these crops, over dependency on few crops and non-availability of planting material to farmers. In this context, it is germane to make action plans on genetic resource exploration, promotion, utilization and management of underutilized crops. At national and international levels, different agencies have recognized the potential of underutilized crops and working in collaboration to raise per capita consumption availability, to overcome nutritional deficiencies and to increase the income of the resource poor farmers. It should be well understood that without increased research and investment, the objective of supplying the world with a nutritious and dependable food supply with underutilized crop will be out of reach.

References Chweya JA, Eyzaguirre PB (1999) The biodiversity of traditional leafy vegetables. IPGRI, Rome Eissing S, Amend T (2008) Development needs diversity: people, natural resources and international cooperation – contributions from the countries of the south. Deutsche Gesellschaft fur Technische Zusammenarbeit (GTZ) GmbH, Bonn Fanzo J, Hunter D, Borelli T, Mattei F (2013) Diversifying food and diets: using agricultural biodiversity to improve nutrition and health. Routledge, Abingdon Meaza H, Demssie B (2015) Managing fragile homestead trees to improve livelihoods of land-poor farmers in the northern highlands of ethiopia. Singapore J Tropic Geograph 36:57–66 Padulosi S, Heywood V, Hunter D, Jarvis A (2011) Underutilized species and climate change: current status and outlook. In: Yadav SS, Redden RJ, Hatfield JL, LotzeCampen H, Hall AE (eds) Crop adaptation to climate change. Wiley, Hoboken Preissel S, Reckling M (2010) Smallholder group certification in uganda - analysis of internal control systems in two organic export companies. J Agric Rural Develop Tropic Subtropic 111:13–22 Ravi SB, Hrideek TK, Kumar ATK, Prabhakaran TR, Mal B, Padulosi S (2010) Mobilizing neglected and underutilized crops to strengthen food security and alleviate poverty in India. Indian J Plant Genet Resour 23(1):110–116 Thies E (2000) Promising and underutilized species, crops and breeds. GTZ, Eschborn Wezel A, Brives H, Casagrande M, Clement C, Dufour A, Vandenbroucke P (2016) Agroecology territories: places for sustainable agricultural and food systems and biodiversity conservation. Agroecol Sustain Food Syst 40:132–144 Witcombe JR, Devkota KP, Joshi KD (2010) Linking community-based seed producers to markets for a sustainable seed supply system. Exp Agric 46(4):425–437

5

Rice Bean: A Potential Underutilized Legume

The leguminosae (Fabaceae) is one of the important families of food crops after Poaceae, constituted by about 800 genera and nearly 20,000 plant species (Smykal et al. 2015). Food legumes, popularly known as pulses are in cultivation from thousands years and since then they have been utilized as a vital ingredient of the routine diet. Pulses are grown in virtually every corner of world and are an important component of existing cropping system of several developing countries. They are also recognized as most valuable contributor in global food production and nutrition and also contribute substantially in the improvement in the production of other crops when grown in mixture or rotation due to their ability to fix atmospheric nitrogen symbiotically. Legumes play important role in the diversification and sustainable intensification of agriculture, particularly for sustainability of the food and feed chain. The global agriculture is undergoing dynamic changes due to changing climatic conditions, degradation of natural resources, mounting human population and their increasing over dependency on few staple crops. To increase the availability of food for making population hunger free and free from nutritional deficiencies is one of the key challenges for researchers. Therefore, it is imperative to identify and exploit available alternative food resources to achieve the goal. One of the most viable options for food security is the exploitation of underutilized food crops having superior traits such as production and nutritional potential, tolerance to biotic and abiotic stresses. The diversification in agriculture production and consumption habits including underutilized legumes can contribute significantly to the attainment of nutritional and household food security (Jaenicke and Hoschle-Zeledon 2006). Exploitation of underutilized legumes for broadening genetic resource base in agriculture is an urgent need in view of current agricultural scenario. However, despite of having excellent characteristics, their potential has not been utilized due to focus on main food crops. The lack of sufficient knowledge of beneficial traits of underutilized crops and also lack of interest in their research and development are some of the key reasons for their lesser exploitation.

# Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_5

55

56

5

Rice Bean: A Potential Underutilized Legume

Fig. 5.1 Rice bean plant and seeds

In the year 2002, International Plant Genetic Resources Institute (IPGRI) the prime institute working for betterment of the food crops, made emphasis on harnessing nutritional richness and yield potential of underutilized food crops vis-a vis their impact on food security. Underutilized legumes with their dual purpose utility of enrichment of soil through their ability of nitrogen fixation and production of protein rich grain have emerged as a priority group of plants for detailed scientific investigation. Underutilized crops are a diverse set of minor crops that tend to be regionally important but not commercially exploited around the world and as such they have received little attention from research networks (Cullis and Kunert 2017). Rice bean (Vigna umbellata (Thunb.) Ohwi and Ohashi), is one of the underutilized legume which has recently gained attention due to multipurpose utility and holding potential to attain sustainability, profitability and diversification in agriculture. Mostly the crop is cultivated in the non-irrigated and uncultivated land which otherwise remain waste, therefore, the cultivation of rice bean in such areas is considered to utilize waste and marginal land. The productivity of rice bean is higher than the other pulses of the same group. The nutritive value of rice bean is exceptionally high and therefore hold potential not only for achieving food and nutritional security but also for environmental sustainability. Despite of all these merits the crop has not gained popularity due to lack of scientific attention toward research and development of the crop (Fig. 5.1).

5.1

Taxonomy and Diversification of Rice Bean

The genus Vigna includes legumes originating from Africa, America and Asia and has been subdivided into seven subgenera based on morphology and center of origin. The cultivated Asiatic Vigna species belong to sub-genus Ceratotropis, has chromosome number, 2n ¼ 22 (except V. glabrescens, 2n ¼ 44). There are important species within this sub-genus including mung bean or green gram (Vigna radiata),

5.1 Taxonomy and Diversification of Rice Bean

57

black gram or urd bean (Vigna mungo), cowpea (Vigna unguiculata), adzuki bean (V. angularis) and moth bean (Vigna aconitifolia) as well as wild species. Among them mung bean, cowpea and black gram are the most important species in terms of global production and nutrtion. Taxonomically, the wild forms of species are usually recognized as varieties below the rank of species of Asian Vigna. However, many differences in morphological and physiological traits associated with domestication have been observed between cultivated and wild forms that have resulted from continuous selection over thousands of years of adaptation in different growing environments, human nutritional requirements and preferences. The cultivated species are ideal to bring significant improvement in our genomics-based understanding of evolution regarding domestication within and among Vigna species. Among the Asiatic Vigna species, rice bean assumes great importance as an under-utilized but very promising legume of immense potential due to their higher nutritional quality, high grain yield and their multipurpose uses as food, fodder, cover crop, green manure and as soil enricher crop. Roxburgh (1874) who originally described rice bean as Phaseolus calcaratus Roxb. and put it in the genus Phaseolus. In recent taxonomic classification, rice bean has been transferred to the genus Vigna. The correct nomenclature of rice bean is Vigna umbellata (Thunb) Ohwi and Ohashi (Marechal et al. 1981). The other past synonyms for rice bean are Dolichos umbellata (Thunb); Azuki umbellata (Thunb) Ohwi and Ohashi; Phaseolus pubescens Blume; P. chrysanthus Savi; P. torosus Roxb; P. calcaratus Roxb.; P. ricciardianus Tenora; Vigna calcaratus (Roxb.) Kurz. The current taxonomic classification of rice bean is as under: Kingdom Subkingdom: Division: Class: Subclass: Order: Family: Subfamily: Genus: Species:

Plantae Tracheobionta Magnoliophyta-Flowering plants Magnoliopsida-Dicotyledons Rosidae Fabales Fabaceae-Pea family Faboideae Vigna umbellata

Rice bean is a diploid (2n ¼ 22) crop and has shown close resemblance to Vigna angularis (Adzuki bean) than to the other species in having similar evolutionary pattern. Rice bean also exhibits close similarity with adzuki bean particularly for pod and seed characteristics and also the pollen grains of both the species possess strong reticulation. Beside the presence of petiolate type of post cotyledonary leaves, the difference between rice bean and adzuki bean is in seedling pigmentation (purple in rice bean and non-pigmented in adzuki bean) and possessing lanceolate, post cotyledonary leaves with cordate base and acuminate apex. The following taxonomically distinct landraces of rice bean are known (Chandel 1981).

58

5

Rice Bean: A Potential Underutilized Legume

1. V. umbellata var. major: Foliage and tomentum as in the type but flowers are much larger. 2. V. umbellata var. glabra: Foliage and habit of var. major, leaves and stems almost glabrous; flowers as in var. major. 3. V. umbellata var. rumbaiya: stem short, erect or diffuse. 4. V. umbellata var. macrocarpa: Leaflets are narrowly ovate-lanceolate, 7.0–10.0 cm longer and 3.5–6.0 cm wider; stipules are 1.0 cm longer, fixed a little below middle; flowers are yellow, lower pedicels twice as long as calyx, bracteoles shorter than calyx. 5. V. umbellata var. gracilis: Stem is very slender, twining and quite glabrous as the leaves; leaflets are usually narrower.

5.2

Evolutionary Relationship of Rice Bean with Other Members of Genus Vigna

The genus Vigna is an important group of food legumes comprising about 82 species and has been divided into two subgroups (Asian and African) of which the Asiatic group of genus Vigna includes around 16 legumes and most of them are well established. To study the relationship between these species, comprehensive efforts have been made by several workers. Initially rice bean was kept under Phaseolus group and the scientific name was Phaseolus calcaratus Roxb., later the crop was classified as one of the member of genus Vigna. In recent classification, rice bean has been classified as Vigna umbellata (Thunb.) Ohwi and Ohashi. It shares common evolutionary pattern with adzuki bean, hence these two crops show much closer relationship than other legumes in Vigna genus. The difference between these two legumes also lies in having variation in the arrangement of cells in seed coat. A number of crosses have been attempted between different Vigna species and the results showed the existence of close association in Vigna umbellata, Vigna trilobata, Vigna radiata var. subloata, and Vigna dalzellina. Vigna dalzellina has been considered as a wild relative of rice bean because of high resemblance in morphology of plant and seed. The low number of chromosome number in Asiatic Vigna species (n ¼ 11) including rice bean suggest that the Asiatic Vigna species derived from the ancestral lower set during the course of evolution. The analysis of evolutionary relationship between the Vigna species including rice bean has also been carried out through various biochemical studies. Rice bean and adzuki bean were distinguished from other members of genus Vigna on the basis of their amino acid composition. The high level of pipecolic acid content in rice bean and adzuki bean also establish a close relationship each other (Chandel et al. 1988). The electrophoretic pattern analysis of rice bean and adzuki bean reveals a close relationship with each other and superficial similar banding pattern to Vigna silvestris (Chandel et al. 1988). Attempts have also been made to establish a phylogenetic relationship of rice bean with other members of Vigna genus using molecular markers. Vir et al. (2010) used 24 ISSR markers to elucidate evolutionary relationships in 46 accessions

5.2 Evolutionary Relationship of Rice Bean with Other Members of Genus Vigna

59

Fig. 5.2 Asiatic Vigna species, their probable wild progenitor and center of domestication (Source: Gautam et al. 2007)

representing 20 Vigna species in which Vigna umbellata showed close association with Vigna stipulacea, Vigna tenuicaulis and Vigna minima. Phylogenetic analysis based on DNA sequences from the ITS and atpB–rbcL regions showed a close relationship between Vigna umbellata, both cultivated and wild forms, with species of section Angulares such as Vigna hirtella, Vigna exilis, Vigna tenuicaulis, Vigna napalensis, Vigna minima, Vigna nakashimae and Vigna ruikiuensis (Doi et al. 2002). The sequence data from four intergenic spacer regions of chloroplast DNA of 18 species of the belong to subgenera Ceratopteris clustered rice bean under Vigna hirtella-Vigna exilis-Vigna umbellata subgroup which also include Vigna nakashimae–Vigna riukinensis–Vigna minima subgroup (Fig. 5.2). The wild forms of rice bean are typically perennial, fine-stemmed, freelybranching and small-leaved plants with either a twining or a trailing habit, showing photoperiod sensitivity and indeterminate growth habit with sporadic and asynchronous flowering, thick roots, strongly dehiscent pods and small hard seeds. In many areas, landraces which retain many of these characteristics persist, in particular to daylight sensitivity, growth habit and hard seeds. The cultivated forms are annual, erect, sub-erect, tending to be viny, usually clothed with fine hairs.

60

5

Rice Bean: A Potential Underutilized Legume

Fig. 5.3 Differences in cultivated and wild forms of V. umbellata (Source: Bisht et al. 2005)

There is a high degree of introgression between wild and cultivated forms. Within the wild types, Bisht et al. (2005) noted variation in rice bean landraces for pubescence, bud size, numbers of flowers per raceme and pods per peduncle, flowering and maturity, number of pod bearing clusters and pods per plant, and seed size and weight. The landraces from North-West Himalayas are less robust, having thinner leaflets and shorter pods and were considered to be more adapted to situations of abiotic stress, particularly drought (Fig. 5.3). The flowers of rice bean are cleistogamous hence self-fertile but some evidence of natural out-crossing has also been reported (Sastrapradja and Sutarno 1977). The crossability behavior shows differentiation between cultivated and wild form of rice bean and also between rice bean and adzuki bean with barriers to crossability occurring in degree of pollen fertility, pod formation, seed setting and seed germination. The cultivated forms of rice bean shows varying degree of intra-specific differentiation in relation to its closely related wild types and in having high cross incompatibility with adzuki bean. Monogenic inheritance is reported for seed color of rice bean and stem colour in seedling when earliness is controlled by dominant gene while pod colour is controlled by two pairs of non-allelic interacting genes. It has also been reported that the inheritance of anthocyanin pigmentation in flower buds is controlled by two interacting gene pairs. The genetic basis of anthocyanin pigmentation in rice bean plants is distinctly different from that in mung bean and urd bean. The crossability behavior of rice bean has been studied with urd bean (Vigna mungo). The crosses failed completely, when rice bean was used as the female, the pollen tube did not enter the stigma. In the reciprocal cross, the embryo gets aborted. The occurrence of embryo abortion was correlated with the early degeneration of the endosperm. It indicated that the barriers in the hybridization between these species operated at the level of stigma (gametic mortality) which inhibited the pollen tubes to enter into the stigma, when rice bean is used as the seed parent. In the reciprocal cross, it is at the level of endosperm and embryo development, where the embryo does not develop normally and finally aborts (zygotic mortality and hybrid inviability). Rice bean is crossable with mung bean as the male parent but fail to produce successful cross as female.

5.3 Origin and Distribution of Rice Bean

5.3

61

Origin and Distribution of Rice Bean

Rice bean is cultivated traditionally by farming communities for deriving their sustenance and livelihood, thereby its cultivation restrict to specialized geographical pockets in different agro-ecological regions. The crop is a native of South and SouthEast Asia and grown primarily in remote areas. Vavilov considered South East Asia as the center of origin which includes Assam and Burma. Marechal et al. (1981) suggested Indo-china and South East Asia as center of origin of rice bean. Zeven and Zhukovsky (1975) however, consider this crop of Indian origin. In Asian continent, rice bean has predominant occurrence in hilly regions of India, Nepal, Burma, China, Malaysia, Indonesia, Korea and Philippines. However, sporadic cultivation of rice bean has also been reported from South-Western regions of Japan. The rice bean cultivation by rural farming communities in Queensland and East Africa has also been reported. Furthermore, rice bean cultivation is also common in indigenous parts of Honduras, Brazil and Mexico too. Rice bean has been introduced in Fiji, Sri lanka, Mauritus, Ghana and Haiti as a garden and cover crop. It is believed that rice bean is a successor of Vigna umbellata var. gracilis (wild) which is typically a small leaved, fine-stemmed, freely branching, photosensitive plant with indeterminate growth habit, sporadic and asynchronous flowering with strongly dehiscent pods (Tomooka et al. 2011). Different genetic and eco-geographical relationships among the wild relatives of Vigna species have been established by Kumar et al. (2003).

5.3.1

Common/Vernacular Names of Rice Bean

Rice bean is commonly known as climbing bean, mountain bean, Mambi-Bean, Oriental Bean, Red bean and Jerusalem pea. English language name is literally the translation of the Chinese language name (Chinese: 米豆; Hanyu Pinyin: mǐdòu). The name rice bean usually denotes its cultivation in rice fields after the harvesting of paddy on residual soil moisture. In India, rice bean is also known by different vernacular names such as moth (not to be confused with Vigna aconitifolia), sitamash, khasia, sutari, rani, sem, pamia, rajmoong and satrangi mash, navrangi, haramah and paharimah (Himachal Pradesh) or bejiamah (Assam), nagamah (Arunachal Pradesh), bete (Mizoram), jami and agukzungken (Nagaland) and chak hawai (Manipur) (Gautam et al. 2007). It also designated as frijol arroz, frijol de arroz, judia arroz, kanime, poroto arroz in Spanish. In addition, it also has many regional names, like tapilan, paksai, taqlau, kalipan, munglasi in Philippines (Manguiat et al. 1985), tak adzuki in Japan and kacang uci, kacang sepalit in Indonesia and Malaysia, respectively. In Brazil, there is a generalized tendency to categorized rice bean as adzuki bean due to high degree of resemblance. In India, rice bean is mainly distributed in North-Eastern hills and hilly tracts of Western and Eastern Ghats and parts of Northern India. In Sub-temperate regions of Himalayas, it is generally preferred as intercrop with maize, particularly in the mid-hills of Himachal Pradesh and Uttaranchal. In the central and other lower parts of India, it is grown either as a sole crop or mixed with maize, sorghum or cowpea. In Western parts of India, particularly in Madhya Pradesh and Chhattisgarh,

62

5

Rice Bean: A Potential Underutilized Legume

Table 5.1 Rice bean distribution in different countries of world Continent Asia

Africa Europe North America South America Australia

Countries India, Burma, Bhutan, Sri Lanka, Taiwan, Pakistan, Mauritius, Bangladesh, Malaysia, Nepal, Indonesia, North and South Korea, Japan, Philippines southern China to the north Vietnam, Laos, Thailand and East Timor Ghana, Benin, Congo and East African countries Spain Southern USA, Mexico, Honduras, Haiti, Costarica, Guatemala, West- indies, Canada Brazil, Venezuela, Columbia, Paraguay Fiji, Papua New Guinea

it is usually grown on bunds of the rice fields. In the Eastern hills, this crop is predominantly cultivated under rainfed conditions, mixed farming systems, and in kitchen gardens. In the North Eastern region of India, rice bean is an important component of shifting cultivation (Jhum). Increasing productivity of Jhum is an important management option to improve the economies of farmers in this region. There is rich diversity in rice bean cultigens in the North Eastern region and Eastern Himalayas, in particular, in Assam plains and nearby hills and there is possibility of introgression and selection by tribal people in maintaining the genetic variability of rice bean (Arora 1986). Local rice bean landraces still exist in villages but the cultivating area under this crop is considerably declining. The probable reasons among others include non-synchronous maturity, non-availability of higher yielding varieties and replacement with major staple crops. The distribution pattern of rice bean indicates a great adaptive polymorphism with climatic variations ranging from humid subtropical to warm and cool temperate climate. The global distribution of rice bean has been presented in Table 5.1 and Fig. 5.4. The

Fig. 5.4 Global distribution of rice bean

5.3 Origin and Distribution of Rice Bean

63

Table 5.2 Rice bean growing states in India Crop spread High Medium Low

States Assam, Meghalaya, Manipur, Nagaland, Mizorum, parts of Arunachal Pradesh, hill regions of North Bengal, Sikkim and Orissa Himachal Pradesh, Uttarakhand, Chhattisgarh, Jharkhand, Madhya Pradesh Kerala, Tamil Nadu, Punjab, Gujrat, Maharashtra, Haryana, Jammu & Kashmir, Karnataka, Andaman and Nicobar Islands, Andhra Pradesh

Fig. 5.5 Rice bean distribution in India

rice bean growing states in India and the frequency of distribution has been presented in Table 5.2 and Fig. 5.5.

64

5.4

5

Rice Bean: A Potential Underutilized Legume

Agro-Morphological Attributes of Rice Bean

Rice bean is highly photosensitive annual legume with an erect to semi-erect growth habit that may grow more than three meters in height. The majority of rice bean plants are of vine type and only a few of dwarf type in nature (Arora et al. 1980). Plant height generally ranges between 2.5 m, although variations in the height have also been reported (Sastrapradja and Sutarno 1977; Singh et al. 2006; Katoch 2011; Pattanayak et al. 2018). In some cases the tendrillate forms are also reported. Generally, tall, robust genotypes (morphotype) with prolific pod bearing and longer/thicker pods also occur. The tribal folk domestication played an important role, predominantly under shifting/Jhoom farming system where mixed culture is a dominant factor. This might been the reason for evolution of erect/sub-erect types, being favored by natural and human selection (Fig. 5.6). Rice bean is a four to five months crop. From sowing to harvesting it takes about 130 to 150 days. Rice bean life cycle starts with sowing by first to second week of June. Germination takes place in 4 to 6 days of sowing and plants reach 50% flowering stage usually after 80 to 90 days of sowing. The pod formation takes place after 100 to 110 days from the date of sowing. Pod matures in 120 to 150 days after sowing. The rice bean cultivars vary from short stemmed to twining ones and require staking for proper support and spread of plant. The variation in life cycle has been observed under different growing conditions although the life cycle is also dependent on the cultivar. For example under equatorial conditions, reduced life cycle has also been reported (Fig. 5.7). Rice bean prefers long day length but intercropping with a tall companion crop reduces its overall performance. However, short day length is preliminary requirement for the seed production. Considering rice bean is a short-day plant, its life cycle under certain conditions can be very long. This situation is advantageous, since long vegetative phases are more convenient for getting higher forage yield when used as fodder for livestock. The leaves are alternate, trifoliate, stipules lanceolate 1.20 to Fig. 5.6 Healthy flowering rice bean plant

5.4 Agro-Morphological Attributes of Rice Bean

65

Fig. 5.7 Scheme showing periodical stages of rice bean Harvesting 130-150 days after sowing

Pod formation 100 to110 days after sowing

Flowering 80 to 90 days after sowing

Sowing

Germination 5 to 7 days after sowing

1.50 cm long, petiole 5 to 10 cm long, stipels linear to lanceolate about 0.5 cm long, leaflets broadly ovate to ovate-lanceolate, entire or bi or trilobed, the lateral leaflets unequal sided, membranous, almost glabrous (Sarma et al. 1995). The inflorescence is auxiliary raceme, 5 to 8 cm long with 5 to 20 flowers. Flowers are bright yellow in color and borne in pairs, peduncle up to 20 cm long. They are bisexual, papilionaceous, calyx campanulate and five toothed clusters producing five to sixteen seeded cylindrical and slightly curved pods, attach downward to the peduncle. The pods provides protective covering to the developing rice bean seeds and also provide transport connection and temporary reservoir for solutes mobilized from vegetative parts to developing seeds. At green stage, pods functions significantly to fix atmospheric carbon dioxide photosynthetically. The pod shell initially develop and at the same stage seed setting occurs which is followed by filling of seeds. In rice bean, the economic yield depends on the pod characteristics such as pod length, number of pods per plant and number of seeds per pod. The rates of the development of pod and seed inside the pod have significant impact on the overall performance of the rice bean. The rice bean pods at different developing stages and pod bearing in rice bean plant has been depicted in Fig. 5.8. The number of days for 50% flowering stage and maturity in rice bean shows positive relationship in local growing conditions, however in exotic conditions this relationship is reversed. In other words, rice bean outside the natural habitat shows delay in flowering and maturity. Seed coat color and seed morphology are one of the prime traits for demarcating the cultivars and lot of variations are reported by various workers for these traits. Rice bean has elongated, slightly curved and beaked seeds of variable size with predominant hilum. According to Bulisani and Leitao (1975) the seeds of rice bean

66

5

Rice Bean: A Potential Underutilized Legume

Fig. 5.8 (a) Pod development stages in rice bean (b) Pod bearing in rice bean

cultivars grown in Brazil have an average length of 6 mm with an average width of 4 mm. The seeds have also been described with varying shapes from round to cylindrical (Bulisani and Leitao 1975). Duke (1981) reported oblong to elongate and sub-trapezoidal shapes of rice bean seeds. The seed coat color is highly variable, including maroon, green, yellow-brown, light shades of yellowish green, speckled and mottled. In rice bean seeds, the distribution of sap soluble pigments in epidermal cell layer and sub-epidermal cell layer responsible for different seed coat color. The mottle color of seed coat is due to irregular distribution of sap soluble pigment in sub-epidermal polygonal cell layers. The yellow-brownish seeds are reported to have excellent nutritive value (Figs. 5.9 and 5.10).

5.4 Agro-Morphological Attributes of Rice Bean

Fig. 5.9 Yellowish-brown rice bean seeds

Fig. 5.10 Diversity in color of rice bean seeds

67

68

5

Rice Bean: A Potential Underutilized Legume

Fig. 5.11 Seed developmental stages in rice bean

A positive relationship has been observed between different pod characteristics and seed yield from rice bean (Fig. 5.11). On an average a single rice bean plant bears around 8 to 28 pod cluster and each cluster has 2 to 7 pods which contain 2 to 12 seeds (Pattanayak et al. 2019). On an average rice bean plant usually bears about 38 to 516 numbers of pods per plant (Pattanayak et al. 2019). Rice bean is a photosensitive crop and require specific climatic conditions to grow (Chaudhuri and Prasad 1972; Chandel et al. 1988; Lokesh Verma et al. 2003). The crop shows photosensitive response in controlling flowering and reproduction. In Indian conditions, depending on genotype, it is sown in June to July and starts flowering very late, in September and October, when the day length is shorter (Fig. 5.12). The plants face terminal drought at the time of pod formation and are harvested in November to December, when pods mature. But there are certain types in which flowering not initiated until beginning of December. The K1 variety (West Bengal), flowers only in December under the influence of short day conditions (Chaudhuri and Prasad 1972). The comparison between varieties for their response to change in photoperiod showed that degree of lateness is directly proportional to the short day period sensitivity whereas the degree of sensitivity to temperature is inversely related to photoperiod response. Rice bean has well developed tap root system with numerous finely branched secondary roots. This legume develops root nodules with nitrogen-fixing soil bacteria rhizobia in the surface part of its root system. Nodules are comparatively small and globose and generally borne singly.

5.5 Germplasm Status of Rice Bean

69

Fig. 5.12 Different growth stages of rice bean. (a) Vegetative phase (b) Flowering stage (c) Pod formation stage (d) Pod setting stage

5.5

Germplasm Status of Rice Bean

The grain legumes assume great importance as a source of protein rich food worldwide. Apart from traditional tropical pulses some underutilized crops including rice bean has shown excellent production and nutritional potential. A number of national and international centers maintain collections of rice bean accessions. The ex situ collection of rice bean at the World Vegetable Centre (AVRDC), Taiwan consists of 351 accessions from 24 different countries, with major contributions from India, Nepal, Philippines, Brazil and Congo. In Nepal, the Plant Genetic Resources Unit of Nepal Agricultural Research Council (NARC) Unit maintains a collection of some 400 accessions from 29 districts of the country. In India, initial efforts for investing the potential of rice bean have been made by NBPGR (National Bureau of Plant Genetic Resources, New Delhi, India) which initially held small collection of rice bean germplasm from indigenous sources as well as from foreign countries like Nepal, China, and USA. After 1970, the efforts have been made to increase the rice bean germplasm bank collections and evaluation

70

5

Rice Bean: A Potential Underutilized Legume

Table 5.3 Rice bean germplasm conserved at different centers Gene bank National Bureau of Plant genetic Resources (NBPGR), India Institute of Plant Breeding (IPB)UPLB, Philippines Institute of Crop Germplasm Resources, (ICGR) CAAS, China Plant Genetic Resources Centre (PGRC), Vietnam Others (18)

Number of accessions 2,067

150 1,615

117 364

Gene bank National Institute of Agrobiological Sciences (NIAS), Japan LBN, Indonesia

Number of accessions 476

100

World Vegetable Center (AVRDC), Taiwan

266

Nepal agricultural research council (NARC), Nepal Total ¼ 5567

467

Source: Tyagi et al. (2018)

of available germplasm. In India, germplasm has been collected from predominantly tribal inhabited areas of Assam, Meghalaya, Manipur, Mizoram, Tripura, Arunachal Pradesh, Sikkim and North Bengal, Santhal pargana in Bihar and North western parts of Odisha particularly Kalahandi, Koraput and Mayurbhunj districts and parts of Uttarakhand and bordering areas in Himachal Pradesh. India has also introduced substantial germplasm accessions from many countries over the years. The rice bean germplasm is separated into two groups’ viz., cultivated type and wild type. At present NBPGR manages 2067 accessions of rice bean, of which 1889 accessions are indigenous and 178 have been introduced from the other countries (Rana et al. 2016). Most of the indigenous collections were collected from NE India, followed by North western India, Eastern India, Southern India, and Central India. The Indian Institute for Pulses Research, and the NBPGR research station at Bhowali, Uttar Pradesh, also maintains a collection of over 300 genotypes. At present, more than 5567 accessions of rice bean are conserved at various germplasm collection centers globally (Table 5.3). Although, the comprehensive collection of germplasm at various national and international centers, but the insufficient data on the characterization of this potential underutilized legume is the roadblock in the mainstreaming of this crop. At various centers, rice bean germplasm comprising of both indigenous and exotic collections have been comprehensively characterized and evaluated. During the evaluation, genetic variability has been observed for leaf and seed characteristics viz. leaf shape, length, width, pubescence, seed length, breadth, colour, 100-grain weight as well as also for other characters such as maturity, pod length and pod number. The cultivated forms of rice bean differ considerably in their plant habit. Intermediate types have also been reported from Assam, Meghalaya and Manipur. The tendril forms are also reported in some areas. Generally, tall robust morphotypes with prolific pod bearing and long and thick pods have been identified. In rice bean germplasm ecotypic variations has also been observed. The taller genotypes has also

5.7 Studies on Different Characteristics of Rice Bean Germplasm

71

been observed from Odisha, profusely branched types from Mizoram and Manipur, types with more number of seeds per pod from Meghalaya and Mizoram, and collections with higher number of pods per peduncle, bold seeds and high grain yield from Manipur. A high degree of polymorphism has been noticed for seed colour. Several rice bean landraces have black, red, cream, violet, purple, maroon, brown, chocolate or mottled grain colour with greenish, brownish or ash grey background.

5.6

Varietal Development in Rice Bean

The importance of improved varieties in enhancing the production potential of agricultural crops has been very well documented. From the two decades, considerable efforts have been made for the promotion, utilization and cultivation of rice bean. In this context, plant breeders have been involved to exploit the existing variability in the rice bean germplasm for the development of improved varieties. Through intense research efforts at different coordinating centers of NBPGR (National Bureau of Plant Genetic Resources) and AICRPPC (All India Co-ordinated Project on Potential Crops), different varieties have been developed using appropriate genetic tools. It is important to know that India has made significant contribution in varietal developments in rice bean as almost all available reports of variety release are from India. These include both grain and fodder types. Apart from released varieties, several superior germplasm lines have been identified from the collections of north-east India. List of released from different research centers have been given in Table 5.4.

5.7

Studies on Different Characteristics of Rice Bean Germplasm

For the elaborate studies on different aspects of rice bean with the objective of prospecting rice bean as a potential pulse crop, we have collected and characterized rice bean germplasm from diverse geographical locations of the country including North-east India, Northern-hilly region, and other parts of the country where the cultivation of crop is being carried out by the farmers. The germplasm from the diverse locations have also been procured from National Bureau of Plant Genetic Resources, New Delhi. The under mentioned tables present the various collections of the rice bean germplasm and their growing locations which was utilized in our research programme for the assessment of different traits of the crop (Table 5.5). The germplasm evaluation study is of significance for identification of promising cultivars for large scale cultivation and genetic improvement programme. For the

72

5

Rice Bean: A Potential Underutilized Legume

Table 5.4 Released rice bean varieties Release Variety year Developed at Seed purpose varieties RBL 1 1987 PAU, Ludhiana

Recommended area

Salient features

Punjab state

Mature in normal duration, high seed yield (16q/ha), light green seeds with smooth seed coat Mature in normal duration, seed yield (16q/ha), dark green foliage and bluish black seed color, seed weight (7.0 g) Mature in normal duration, high seed yield (15q/ha), bold and attractive light yellow coloured seeds, tolerance to Ascochyta and resistant to yellow mosaic disease Mature in normal duration, high seed yield (18q/ha), photosensitive variety having vigorous spreading growth habit, resistant to yellow mosaic virus and most of the other foliar diseases, bold light green seeds Black seed color similar to black gram, high seed yield (17q/ha) Early maturing, seed yield (15q/ha), seeds are oblong, greenish brown with 6.2 g test weight Normal duration, high seed yield (15.50q/ha), green colored seed with 6.0 g test weight, dark brown pods at maturity. dark green foliage Normal maturing, average yield (17.08q/ha), seeds are bold and light green with 7.56 g seed weight

PRR 1 (8801)

1995

GBPUA&T, Ranichauri

Hill region of Uttarakhand

PRR 2 (8901)

1997

GBPUA&T, Ranichauri

Hill region of UP, HP and North Eastern states, North-west hilly region

RBL 6

2000

PAU, Ludhiana

Plains

BRS 1

2003

NBPGR, Bhowali

Hilly region

RBL 35

2003

PAU, Ludhiana

Plains

RBL 50

2003

PAU, Ludhiana

Plains

VRB-3 (Him Shakti)

2013

NBPGR, Shimla and VPKAS, Almora Fodder purpose varieties Konkan 1997 Dapoli, rice Maharastra bean-1 (KRB-1)

Northwest and North east hill region

Konkan region

High fodder yield (220q/ha)

(continued)

5.8 Exploring Rice Bean

73

Table 5.4 (continued) Release Variety year Seed purpose varieties Bidhan 2000 rice bean-1 Bidhan 2005 rice bean-2 Suravi 2013 Bidhan rice bean-3

Developed at

Recommended area

Salient features

BCKV, Kalyani

East and Northeast zone

High fodder yield (350q/ha), and insect resistant

BCKV, Kalyani

East and Northeast zone

High fodder yield (300q/ha), and insect resistant

KAU, Thrissur BCKV, Kalyani

Kerala

High fodder yield (220q/ha)

East and Northeast zone

High fodder yield (300q/ha), and insect resistant

evaluation of diversity for a range of morpho-physiological and productivity attributes different field trials were conducted. Beside this, the rice bean germplasm collections were enriched by explorations from different locations. The explored germplasm was used for the study as well as submitted in the gene bank of NBPGR for accessioning. The germplasm submitted at NBPGR, India for accessioning has been presented in Table 5.6 (Fig. 5.13).

5.8

Exploring Rice Bean

For advocating the cultivation and usage of any crop, the elaborate studies on different trials are imperative for large scale adaptation of crop. Rice bean has some fascinating features which attract for systematic research for exploring the underlying potential of the crop. Considering the importance of rice bean as a promising underutilized crop, we have conducted comprehensive studies on the rich genetic diversity, production potential, nutritional and anti-nutritional attributes and as a source of resistance factors owing to its ability to resist storage insect pest attack. Hence, with the main focus of exploring the potential of this underutilized legume, we further enriched the germplasm collections and conducted different studies for assessing the underlying potential of the crop. The brief outline of the research plan has been presented in Fig. 5.14.

Rice bean germplasm (group-I) IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194

IC-137195

IC-137199

IC-137200

IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801

Sr. No. 1. 2. 3. 4. 5. 6. 7.

8.

9.

10.

11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

Growing location Haryana Sikkim Sikkim Sikkim Sikkim Sikkim Uttar Pradesh Uttar Pradesh Uttar Pradesh Uttar Pradesh Punjab Punjab Punjab Punjab Punjab Punjab Punjab Punjab Manipur Manipur Manipur 11. 12. 13. 14. 15. 16.

LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176

LRB-140

LRB-135

LRB-134

Rice bean germplasm (group-II) LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128

Punjab Punjab Punjab Punjab Punjab Punjab

Punjab

Punjab

Punjab

Growing location Punjab Punjab Punjab Punjab Punjab Punjab Punjab

11. 12. 13. 14. 15. 16. 17.

10.

9.

8.

Sr. No. 1. 2. 3. 4. 5. 6. 7.

JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 BRS-2

JCR-107

JCR-93

JCR-81

Rice bean germplasm (group-III) JCR-12 JCR-20 JCR-32 JCR-52 JCR-54 JCR-76 JCR-79

Assam Assam Assam Assam Assam Assam Uttarakhand

Assam

Assam

Assam

Growing location Assam Assam Assam Assam Assam Assam Assam

5

10.

9.

8.

Sr. No. 1. 2. 3. 4. 5. 6. 7.

Table 5.5 Rice bean germplasm and their growing location used in the study for characterization of different traits

74 Rice Bean: A Potential Underutilized Legume

22. 23. 24. 25. 26.

IC-019352 EC-48223-B Check Check Check

Orissa China Baroi Dhagwar Panchrukhi

5.8 Exploring Rice Bean 75

76

5

Rice Bean: A Potential Underutilized Legume

Table 5.6 Rice bean genotypes submitted to NBPGR, India Sr. No. 1. 2.

Genotype IC-521350 IC-521351

Collection name RKH-1 RKH-2

Location Bilaspur (HP) Solan (HP)

3. 4.

IC-521352 IC-521353

RKH-3 RKH-4

Sirmour(HP) Shimla(HP)

5.

IC-521354

RKH-5

Bilaspur (HP)

6.

IC-521355

RKH-6

Bilaspur (HP)

7. 8. 9.

IC-521356 IC-521357 IC-521358

RKH-7 RKH-8 RKH-9

Bilaspur (HP) Bilaspur (HP) Bilaspur (HP)

10.

IC-521359

RKH-10

Bilaspur (HP)

11. 12. 13. 14. 15. 16. 17. 18.

IC-521360 IC-521361 IC-521362 IC-521363 IC-521364 IC-521365 IC-521366 IC-521366

RKH-11 RKH-12 RKH-13 RKH-14 RKH-15 RKH-16 RKH-17 RKH-17

Sirmour(HP) Sirmour(HP) Sirmour(HP) Sirmour(HP) Sirmour(HP) Sirmour(HP) Bilaspur (HP) Uttarakhand

Fig. 5.13 Field trials with different rice bean genotypes

Seed characteristics Maroon, medium sized, hilum raised Blackish green, bold seed, seeds variegated Maroon, small sized Greenish, nearly round, hilum not prominent Greenish, nearly round, hilum not prominent Greenish, medium sized, hilum raised Greenish, normal, hilum raised Greenish, normal, hilum raised Yellowish green, normal, hilum raised Yellowish green, normal, hilum raised Small sized Greenish, normal Normal size Normal size Reddish, small size Greenish yellow, small sized Light green normal Large size differentially colored (Bold seed)

Vegetative stage as fodder crop

Fig. 5.14 The approach for evaluation and characterization of rice bean

Assessment of effect of different interventions on rice bean seed and fodder productivity

Harvesting schedule and cutting regimes

Effect of fertilizer supplementation on yield and quality attributes

Assessment of production potential of rice bean genotypes

Seed productivity for use as pulse

Nutritional factors

1. 2. 3. 4. 5.

Germination Soaking Roasting Dehulling Chemical treatments

Traditional processing

Selection of nutritionally rich genotypes

Assessment of nutritional compounds in different genotypes

Study on different morpho-physiological attributes

Morpho-physiological characterization

Characterization of elite genotypes for different traits

Selection of elite genotypes

Evaluation of rice bean germplasm

Modern processing methods 1. Extrusion cooking 2. High pressure cooking 3. Canning

Tackling anti-nutrients

Anti-nutritional factors

Utilization of resistance factors in other crops through molecular techniques

Studies on inhibitory proteins against insect gut proteases

Factors responsible for insect pest resistance

Biochemical characterization

Exploration of rice bean germplasm for enrichment of existing collection

Procurement rice bean from diverse locations

5.8 Exploring Rice Bean 77

78

5

Rice Bean: A Potential Underutilized Legume

References Arora RK (1986) Diversity and collection of wild vigna species in India. FAO/BPGR Plant Genet Resour Newsletter 63:6–13 Arora RK, Chandel KPS, Joshi BS, Pant KC (1980) Rice bean: tribal pulse of Eastern India. Econ Bot 34:260–263 Bisht IS, Bhat KV, Lakhanpaul S, Latha M, Jayan PK, Biswas BK, Singh AK (2005) Diversity and genetic resources of wild Vigna species in India. Genet Resour Crop Evol 52:53–68 Bulisani EA, Leitao HF (1975) Contribuicao ao conhecimento botanico do feijao- adzuki e especies afins. Inst Agron Camp Circ 47:17 Chandel KPS (1981) Wild Vigna species in the Himalayas. Plant Genet Resour Newsl 45:17–19 Chandel KPS, Arora RK, Pant KC (1988) Rice bean - a potential grain legume, NBPGR Scientific Monograph No. 12. NBPGR, New Delhi Chaudhuri AP, Prasad B (1972) Flowering behaviour and yield of rice bean (Phaseolus calcaratus Roxb.) in relation to date of sowing. Indian J Agric Sci 42:627–630 Cullis C, Kunert KJ (2017) Unlocking the potential of orphan legumes. J Exp Bot 68:1895–1903 Doi K, Kaga A, Tomooka N, Vaughan DA (2002) Molecular phylogeny of genus Vigna subgenus Ceratotropis based on rDNA ITS and atpB-rbcL intergenic spacer for cpDNA sequences. Genetica 114:129–145 Duke JA (1981) Handbook of legumes of world economic importance. Plenum Press, New York, p 345 Gautam RN, Kumar JP, Yadavendra NSB, Thakur S, Khanal A, Bhandari B, Hollington PA (2007) Food Security through Rice bean research in India and Nepal (FOSRIN). Report1. Distribution of rice bean in India and Nepal, LI-BIRD, Pokhara, Nepal and CAZS Natural Resources, College of Natural Sciences, Bangor University, Wales, UK Jaenicke H, Hoschle-Zeledon I (2006) Strategic framework for underutilized plant species research and development: with reference to Asia and the Pacific and Sub-Saharan Africa. International Center for Underutilized Crops, Sri Lanka and Global Facilitation Unit for Underutilized Plants, Rome, p 33 Katoch R (2011) Morpho-physiological and nutritional characterization of ricebean (Vigna umbellata). Acta Agron Hun 59(2):109–120 Kumar PS, Tomooka N, Kaga A, Vaughan DA (2003) Conservation and use of crop wild relatives. In: Proceedings of the Department of Agriculture, Sri Lanka and National Institute of Agrobiological Science, Japan Lokesh Verma PK, Gupta SN, Behl RK (2003). Path coefficient analysis for various morphological and quality parameters in rice bean (Vigna umbellata (Thunb.) Ohwi and Ohashi). Nat J Plant Impr 5: 116–119. Manguiat LJ, Mendoza DM, Tilo SN (1985) Influence of the legume rhizobia symbiosis on the nitrogen economy of a legume based cropping system. Philippine Agric 68:44–55 Marechal R, Mascherpa JM, Stainier F (1981) Taxonomic study of the Phaseolus-Vigna complex and related genera. In: Polhill RM, Raven PH (eds) Advances in legume systematics. Proceedings International Legume Conference, Royal Botanica Gardens, Kew, Richmond, pp. 329–335 Pattanayak A, Ingrai B, Khongwir DEA, Gatpoh EM, Das A, Chrungoo NK (2018) Diversity analysis of rice bean (Vigna umbellate (Thunb.) Ohwi and Ohashi) collections from North Eastern India using morpho-agronomic traits. Sci Hort 242:170–180 Pattanayak A, Roy S, Sood S, Iangrai B, Banerjee A, Gupta S, Joshi DC (2019) Rice bean: a lesser known pulse with well-recognized potential. Planta 250(3):873–890. https://doi.org/10.1007/ s00425-019-03196-1 Rana JC, Gautam NK, Gayacharan Singh M, Yadav R, Tripathi K, Yadav SK, Panwar NS, Bhardwaj R (2016) Genetic resources of pulse crops in India: an overview. Indian J Genet 76:420–436 Roxburgh W (1874) Flora indica. Reprinted edition. Thacker, Spink and Co, Calcutta, pp 554–559

References

79

Sarma BK, Singh M, Gupta HS, Singh G, Srivastava KS (1995) Studies in Rice bean Germplasm. Res Bull 34:70 Sastrapradja S, Sutarno N (1977) Vigna umbellata (L.) DC in Indonesia. Annales Bogortensis VI (3):155 Singh KP, Kumar A, Saharan RP, Kumar R (2006) A new bold seeded genotype of mungbeanMRH-5. Nat J Plant Impr 8:92–93 Smykal P, Coyne CJ, Ambrose MK, Maxted N, Schaefer H, Blair MW et al (2015) Legume crops phylogeny and genetic diversity for science and breeding. Crit Rev Plant Sci 34:43–104 Tomooka N, Kaga A, Isemura T, Vaughan DA (2011) Vigna. In: Kole C (ed) Wild crop relatives: genomic and breeding resources legume crops and forages. Springer, New York, p 291 Tyagi RK, Agrawal A, Pandey A, Varaprasad KS, Paroda RS, Khetarpal RK (2018) Proceedings and recommendations of regional expert consultation on underutilized crops for food and nutritional security in Asia and the Pacific. Asia-Pacific Association for Agricultural Research Institutions (APAARI), Bangkok, Thailand, November 13–15, p 58 Vir R, Jehan T, Bhat KV, Lakhanpaul S (2010) Genetic characterization and species relationships among selected Asiatic Vigna Savi. Genet Resour Crop Evol 57:1091–1107 Zeven AC, Zhukovsk PM (1975) Dictionary of cultivated plants and their centers of diversity. Centre for Agriculture Publishing and Documentation, Wagenmgen

6

Rice Bean Agronomy

The knowledge of various agronomic principles is essential for getting healthy crop with higher yield and returns from any crop or cropping sequence. Although, there is a growing global concern regarding exploitation of underutilized legumes, but the knowledge about various agronomic attributes of these crops is not practiced like major staple legumes. Since these attributes have direct or indirect interrelatedness with different traits, therefore understanding of agronomic attributes is essential for fetching optimal productivity. Rice bean has potential of performing well on uncultivated or marginal lands, therefore, appropriate agronomic practices could contribute toward yield. The knowledge of the different agronomic attributes would also assist in optimizing the breeding and management strategies in the improvement of rice bean and ultimately for the benefit of growers and consumers.

6.1

Soil and Climatic Requirements

Rice bean is generally a warm season annual legume. The adaptive polymorphism allows rice bean to thrive well in different environmental conditions ranging from humid subtropical to temperate climate. In India, this crop is a Kharif season crop, generally sown from the month of April to September. However, due to changing climatic conditions, different sowing periods have been recommended for this crop. In USA, a range of sowing time has been recommended for this underutilized crop. In mid-Atlantic region, rice bean is directly seeded in the field from the month of April to June while in South-East gulf coastal region, rice bean is sown in the month of April. In the mid-west and south west regions of the world, sowing of rice bean in the months of April to July is recommended. The cultivation of this crop is commonly recommended in areas receiving 1000–1500 mm of rainfall. Heavy rain during flowering period affects the pod development and affects overall productivity (Poudel 2008). Rice bean being a highly photosensitive annual legume requires long day period for vegetative growth and short day period for seed production. Hence, rice bean # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_6

81

82

6

Rice Bean Agronomy

could be included in the category of short long day plants (SLDP). The crop thrives well in dry conditions and begins to proliferate in late monsoon in Indian conditions. However at seedling stage, the crop has high susceptibility to the waterlogged conditions. The maximum growth of rice bean is observed from 18  C to 30  C, although, it could tolerates temperature from 10  C to 40  C but is unable to withstand extreme changes in the temperature (Duke 1981; Rajerison 2006). This crop also improves the soil textural and structural properties, thereby reduces soil erosion. As compared to other legumes, rice bean can easily withstand to residual fertility and stress conditions in soil and contribute significantly to low-cost production systems. This is beneficial for resource-poor farmers holding marginal lands. Moderately fertile soils having pH 6.8–7.5 are suited best for the rice bean cultivation (Khanal and Paudel 2008; Khadka and Acharya 2009).

6.2

Cropping Patterns/Cropping Systems

The commonly cropping pattern for rice bean is mixed-cropping in which seeds are mixed with main crop and broadcasted in the field. The twining habit of rice bean also makes it highly suitable to be grown as a potential intercrop; however, this habit also makes mechanical harvesting a labor intensive process (Figs. 6.1 and 6.2). To make harvesting easier, staking is generally recommended to support the heavy load of vegetative growth. The varieties maturing in 130–150 days are generally preferred to be used for intercropping. In relay cropping system, rice bean is sown along the field margins. Generally mixed cropping is employed when rice bean is to be used as a grain crop. In mono-cropping, rice bean is mainly grown in kitchen gardens or in

Fig. 6.1 Ridge planting of rice bean

6.3 Rice Bean Cultivation

83

Fig. 6.2 Rice bean intercropping with maize crop

small pieces of land as a sole crop for routine consumption within the family. Planting determinate or semi-determinate rice bean cultivars on rice bunds is a very common practice. Seeds are sow on bunds and the growing plants are guided along the slopes of the terraces. Landraces bearing green long tender pods with bold grains are usually preferred to be consumed as vegetable.

6.3

Rice Bean Cultivation

6.3.1

Land Preparation

The land should be free from any water stagnation. During land preparation, the unwanted weeds should be removed. The land can be manually prepared using the conventional hand tools. This should be followed by plowing and harrowing, using a disc plough and harrow. The land may be ridged or left as flat seedbeds after harrowing. Ridging can be carried out after harrowing if ridge planting is required. At least 5–7 days should be allowed between each operation to allow the decay of bushes/grass and decomposition by micro-organisms, thus enhancing soil fertility for good seed germination and growth.

84

6.3.2

6

Rice Bean Agronomy

Seed Rate

Seed rate is an important agronomic component which ensures optimum plant stand necessary for raising and stabilization of production levels. Seed rate is a variable factor and depends on different factors such as sowing time, type of soil, seed size, and soil moisture availability. In broadcasting method of seed sowing, rice bean is generally sown at seed rate of 30–37 kg/ha whereas dibbling method of seed sowing require seed rate of 15–22 kg/ha (Poudel 2008). Generally the broadcasting method of seed sowing is followed when rice bean is grown as an intercrop. However, for planting on rice bunds and in kitchen gardens, sowing of individual seed is the preferred method.

6.3.3

Method of Seed Sowing

Precision in the selection of material for sowing purpose is the utmost requirement for getting higher production from any crop. For rice bean sowing, seeds free from pest and disease are selected. Pods for sowing material are usually collected from the middle portion of rice bean plant. Because of hard seed coat, overnight seed soaking for 10–12 h, is required for increasing the germination percentage. Seeds are sown in the field either by adopting broadcasting or dibbling method. Seed rate is an important agronomic principle which ensures optimum plant stand necessary for improving total production (Fig. 6.3).

Fig. 6.3 Initial stage of crop in field

6.3 Rice Bean Cultivation

85

Rice bean genotypes from diverse sources reveal high variability; therefore selection of variety should be according to the growing conditions. Proper spacing is required to ensure utilization of inputs like nutrients, moisture and light resulting in better production performance of the plant. The sowing strategy involves inter and intra row spacing. The spacing depends on optimum plant stand/population required for different regions having varied rainfall intensities. Inter-row spacing is also very important as rice bean shows exuberant growth habit. The viny type rice bean is usually planted at a distance of 60–90 cm apart in rows, whereas closer spacing between rows (30–45 cm) and between plants 15–20 cm is followed for erect and bushy type rice bean plants. Seeds can be spaced behind the plough above 5–8 cm deep in furrow or dibbled at a defined spacing. The germination of rice bean is hypogeal. Seedling emergence take place within 5–8 days of sowing and have usually two types of stem pigmentation; greenish yellow and light purple.

6.3.4

Intercultural Operations

Thinning and spacing between plants should be managed within the first fortnight to allow the proper establishment of plant population. Weeds are not a major threat to this crop. However, 2–3 manual weeding at about 6 weeks after sowing and before flowering are beneficial for good setting of flower. After sowing, spray of pendimethylene within 24 h is an effective control measure to remove weeds from the rice bean field. The young rice bean seedlings emerge after 5–7 days of sowing and attain 10–15 cm height within 25–30 days. At this time, one hoeing/raking induces several positive effects on plant growth. If there is a possibility of intermittent rains, raking with hoes or hand plough should be done at proper tilth. For irrigation purpose, normal rainwater is sufficient for supporting the good and uniform establishment of rice bean plants. Into the areas, where rainfall is inadequate, irrigation at a time of flowering and pot setting is good for getting high production. Because of the high susceptibility of young seedlings to water-logged conditions, proper drainage of water is required for the uniform establishment of crop in the field. After 2 months of sowing, rice bean plants attain about 50 cm height and start spreading. At this stage, stacking with 1–2 m long wooden sticks is useful as over-crowding of vines due to non-staking affects pod formation and yield adversely. As the rice bean plants have natural tendency to climb, thereby, stacking is an important operation in rice bean cultivation due to development of tendrils. The most appropriate time for staking is when rice bean plants attain about 50 cm height. The plants are trained on bamboo sticks, wire netting, trellis etc. Staking improves the plant spread and photosynthetic activity as a result contributing to higher yield due to higher number pods per plant. Quality of pods also improves as they don’t come with contact of soil. Stacking increases the yield, improves quality, reduces the incidence of various diseases, facilitates inter-cultural operations and promotes proper development of rice bean plants (Fig. 6.4).

86

6

Rice Bean Agronomy

Fig. 6.4 Stacking in rice bean crop

6.3.5

Nutrient Management

The quantity of nutrients applied to achieve high crop yield is possibly the most important and the most researched aspect of nutrient management programmes. Rice bean due to capacity of nodulation with rhizobium bacteria does not require nitrogen in higher amounts. However, a starter dose of 10–20 kg/ha stimulates growth of plants in early stages. Application of small dose of nitrogen improves the nodulation and nitrogen fixation in rice bean whereas application of excessive amounts of nitrogen results in slow nitrogen fixation process. The application of phosphorus is important for effective nodulation, bolder seed size and consequently improved yield. Application of phosphorus helps in better plant growth lead by better root system and increased number of seeds per pod and 100-seed weight. Rice bean responds positively to phosphorus application from 30–60 kg ha l. In addition to nitrogen and phosphorus, the application of potassium (10–20 kg ha l) has been found significant for improving the yield from rice bean.

6.3.6

Crop Maturity and Harvesting

The crop period from sowing to maturity is an important determinant of yield as it enables rice bean plants to match developmental processes with growing environment, as well as set yield potential. It also helps determining the crop fitness into different cropping system and the timing of various field operations including harvesting. Rice bean crop is normally ready to harvest in 4–5 months (Katoch 2011). However, crop duration varies as it mainly depends upon the prevailing climatic conditions in the growing region. The differences when crops sown in

6.3 Rice Bean Cultivation

87

different months; September sown crop may take longest duration as compared to August sown crop. In mixed cropping and intercropping, early varieties are ready to harvest along with main crop, whereas medium and late varieties require additional 3–4 weeks to be reached at maturity. The best time for harvesting of rice bean is when approximately one half to two thirds of the pods turns brown. In order to obtain higher yield, harvesting in 2–3 or more pickings is beneficial. Harvesting of rice bean pods at early stages, can result in the loss of immature pods while harvesting too late can result in losses from pod shattering during. Therefore, harvesting of rice bean should coincide with the onset of dry season when dry pods can remain about a week awaiting harvesting without spoilage. To save seed loss from weathering or shattering, the dry pods should not be left in the field longer than two weeks after full pod maturity. It is worth collecting the pods during morning and late afternoon. Also, a dry harvest period is highly desirable as most varieties are very susceptible to weather damage caused by wet and humid conditions that can result in severe reduction of seed quality. Rice bean seed yield is determined by the number of produced flowers, percentage of pod set, number of seeds per pod and seed size. However, pod shattering is a major problem in rice bean production and can cause significant yield losses if harvesting is delayed. The main reason for such yield losses is the non-synchronous maturity. Rice bean is a highly photosensitive crop requires short day period for flowering, and flowering may be significantly delayed or prevented if these requirements are not met. Therefore, fluctuations in the prevailing growing environmental conditions does play significant role in the maturity of pods. The asynchronous maturity is an important breeding problem as the harvesting/hand picking of pods becomes a labour intensive operation and ultimately increases the total production cost. If we can harvest all or more than 90% of total pods in a single harvest, we will be able to cut down the total harvesting cost. Thus, genotypes with synchronized maturity are desirable. Katoch et al. (2008) conducted a detailed investigation on synchrony in pod maturity in 30 diverse genotypes and reported that the total number of pods picked at maturity has direct relation with the yield as the genotypes having less number of pods picked at maturity were low yielder and vice versa. They also reported that pod picking is not an economically beneficial affair as pod picked from 120–160 days after sowing shows same maturity period and a good number of pods could be harvested at one time without much losses in the total yield.

6.3.7

Harvesting Method and Storage

Harvesting can be carried out manually (hand harvesting) or by using a combine harvester. In manual harvesting, rice bean pods picked from the plants by the hands or rice bean stalks are cut with a band saw, thereafter the harvested rice bean stalks containing the pods are sundried for 4–7 days. The seeds from the dried pods are threshed out by beating the dried pods with a bamboo stick or by trampling of draft animals and dried for 1–2 days before storage. When all the grains are removed from the vines, the residue is utilized as fodder for animals. The grain can be stored short

88

6

Rice Bean Agronomy

term at around 12% moisture or less and for long term storage at around 8–9%. The following care should be taken during the harvesting: 1. Harvesting should be done timely. Timely harvesting ensures optimum grain quality and consumer acceptance. 2. Harvesting before the crops mature, usually result lower yields, higher proportion of immature seeds, poor grain quality and more chances of disease incidence during storage. 3. Delay in harvesting, results in shattering of pods and other losses caused by birds, rats, insects etc. 4. Harvest the crop, when a large percentage of the pods are fully matured. 5. Separate out the admixtures of other crop prior to harvesting, 6. Avoid harvesting during adverse weather conditions i.e. rains and overcast weather. 7. Use proper harvest equipment. 8. All the harvested stems should be kept in one direction in order to ascertain efficient threshing. 9. The harvested bundles should be stacked in a dry place. The stacking should be cubical to facilitate circulation of the air around. Well dried grains are then stored in wooden boxes, mud pots or sacks. Seed quality is important, so care in harvest and post-harvest handling is important to avoid cracked or split seeds. Sorting is done to separate the broken seeds from the full seeds. Various agronomic attributes have direct and indirect influence on the crop production. Hence, the knowledge of crop agronomic characteristics is indispensible for designing the strategies for maximizing the crop production.

6.3.8

Diseases and Pest Management

Rice bean is seldom seriously affected by diseases which are quite common in other legumes of genus Vigna. However, sporadic incidence of some of the diseases such as rhizactonia blight, powdery mildew, bacterial blight has been observed during wet and humid climatic conditions which are highly conducive for the perpetuation of the pathogens and dissemination of the diseases. In comparison to other legumes, rice bean is generally less affected by the viral diseases, however in some places the incidence of mosaic virus has also been observed. A characteristic symptom of the mosaic virus disease is intermixing of light and dark-brown areas. Different cultural practices like crop rotation, proper drainage, soil solarization, field sanitation and the judicious use of chemicals could effectively manage these diseases in rice bean crop. Rice bean seeds are considered resistant to storage pests such as bruchids, an important storage pest of legumes due to presence of inhibitory proteins in seeds with growth-inhibiting effects on them. Though rice bean is fairly an insect resistant crop but some common insects which can harm the crop are pod borers, aphids,

References

89

blister beetle and soybean caterpillar. The attack of these insects could be managed by following different cultural practices and using insecticides.

References Duke JA (1981) Handbook of legumes of world economic importance. Plenum Press, New York, p 345 Katoch R (2011) Morpho-physiological and nutritional characterization of ricebean (Vigna umbellata). Acta Agron Hung 59(2):109–120 Katoch R, Chand U, Kumar N, Bhandari JC (2008) A study on asynchrony in pod maturity and production potential in rice bean. Forage Res 33:255–257 Khadka K, Acharya BD (2009) Cultivation practices of ricebean. In: Proceedings of the local initiatives for biodiversity, research and development (LI-BIRD), 1st ed., Pokhara, Nepal Khanal A, Paudel IH (2008) Farmer’s local knowledge associated with production, utilization and diversity of rice bean in rice bean growing areas of Nepal. LI-BIRD, Pokhara Poudel IH (2008) Conservation and commercialization prospect of rice bean landraces in Ramechhap district of Nepal. M.Sc. Thesis, Tribhuvan University, Institute of Agriculture and Animal Science, Rampur, Chitwan Rajerison R (2006) Vigna umbellata (Thunb.) Ohwi and Ohashi. In: Brink M, Belay G (eds) PROTA 1: cereals and pulses. PROTA, Wageningen

7

Morpho-Physiological and Productivity Attributes of Rice Bean

The economic yield from the plants has direct and positive correlation with the variation in morpho-physiological characteristics (Mathur 1995). Therefore, any morpho-physiological character associated with yield or makes significant contribution to productivity would be useful in further improvement of the crop. Morphophysiological attributes in any plant species are very dependable characteristics which generally change with prevailing environmental conditions. The plant height, days to flowering, pod characteristics, number of seeds per pod, and 100-seed weight are important yield attributing morpho-physiological traits. Plant height is an important agronomic trait which has direct influence on yield. The plants having indeterminate growth habit are more suited to produce large biomass; therefore, these features are more valuable when crop is grown for fodder purpose. Days to flowering also has direct relationship with the vegetative growth of the plant. Early flowering in a crop plants denotes the shorter vegetative phase, whereas late flowering represents longer vegetative phase. Early flowering is desirable for seed production, while late flowering is more suitable for higher fodder production. The number of days to flowering is significantly affected by the prevailing climatic conditions in growing area, and this is true in case of rice bean as variation has been observed in reaching 50% and 80% flowering in different growing areas (Joshi et al. 2008; Pattanayak et al. 2018; Singh et al. 2006; Tian et al. 2013). Pattanayak et al. (2018) reported that rice bean generally takes up to 134 days and 66 to 177 days to reach 50% and 80% flowering, respectively. It is important to analyze the number of pods and the number of seeds per pods to identify factors contributing to seed yield. The number of pods per plant is determined by the number of flowers per plant and proportion of flowers that develop into mature pods. It has been well-established that seed yield is directly related to pod length, pods per cluster, pod clusters per plant, 100-seed weight, and seeds per pod. To understand the basis of seed yield, it is important to know which factors are contributing for differences in pod characteristics. It is likely that some differences have a genetic basis and some are the result of physiological and environmental conditions. In the era of climate # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_7

91

92

7

Morpho-Physiological and Productivity Attributes of Rice Bean

change, unpredictable onset and delay in arrival of monsoon is becoming common. Thus, planting at the recommended sowing time may not be possible all the time, and sowing may have to be shifted. Under such circumstances growing medium and late maturity of cultivars delay the sowing of the next crop. Early maturing varieties offer flexibility in planting dates, which enables multiple plantings in a season to avoid the risk of crop failure due to stressed growing conditions. Rice bean has considerably high-yielding potential as compared to other members of Leguminosae family. The seed yield from rice bean up to 27q/ha has been reported by earlier workers in different environmental conditions. Average seed yield of 18.50 q/ha of rice bean has been reported from West Bengal (Chaudhuri and Prasad 1972). In North Indian plain, most of the accessions possessing high seed yield and other agronomic traits are not much successful being late maturing, viny, and vigorous in growth. To understand different characteristics of rice bean crop, the complete study involving different rice bean genotypes enlisted previously as group I, group II, and group III was carried out to investigate yield-governing morpho-physiological characters, seed yield, productivity, and nutritional attributes. The observations recorded have been presented in different topics.

7.1

Variation in Morpho-Physiological Traits of Rice Bean Genotypes

7.1.1

Morpho-Physiological Attributes of Group-I Genotypes

The group I of rice bean genotypes comprised of 30 genotypes including 1 exotic genotype from China. These genotypes were investigated to study variation in different morpho-physiological attributes. The results of the study on different morpho-physiological attributes have been presented under:

7.1.1.1 Plant Height The morpho-physiological analysis of 30 diverse genotypes revealed that the genotype JCR-32 had maximum height (45.33 cm) followed by IC-140795 (44.63 cm) and IC-137195 (44.50 cm), whereas the genotypes Baroi (27.53 cm), Panchrukhi (33.33 cm), Dhagwar (33.67 cm), and IC-016801 (34.30 cm) are with the least height. After 70 days of sowing, the genotype IC-140802 (79.40 cm) had vigorous growth followed by IC-140795 (78.40 cm), JCR-32 (74.20 cm), and IC-137195 (66.07 cm). After 115 days of sowing, the genotype IC-137194 (135.27 cm) followed by IC-137195 (127.60 cm), IC-140795 (124.73 cm), IC-140808 (121.50 cm), and IC-140805 (121.23 cm) had highest plant height. The genotypes with shorter plant height were Dhagwar (34.10 cm), Baroi (48.73 cm), IC-016801 (67.30 cm), and Panchrukhi (69.53 cm) (Table 7.1). The table reveals that there was prominent increase in the plant height 50 to 115 days after sowing.

Genotypes IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223B JCR-12

Plant height (70 DAS) (cm) 49.37 47.10 49.07 56.87 41.87 41.37 60.30 66.07 58.97 50.57 74.80 59.00 62.13 79.40 56.73 53.10 52.97 57.77 52.57 56.43 44.63 54.13 44.07

60.10

Plant height (50 DAS) (cm) 35.47 38.67 40.23 42.90 39.50 37.50 42.90 44.50 42.50 39.60 44.63 39.30 43.77 44.00 40.03 39.90 38.53 43.03 36.37 37.63 34.30 39.87 37.60

36.53

105.53

Plant height (115 DAS) (cm) 70.70 84.67 89.43 99.20 96.03 90.27 135.27 127.60 111.00 106.30 124.73 120.33 105.57 108.87 89.97 96.77 121.23 121.50 87.07 92.03 67.03 100.20 91.83 88

Days to 25% flowering 92 92 89 93 100 100 92 94 93 93 92 95 94 93 99 94 99 93 87 92 88 86 100 96

Days to 50% flowering 98 99 95 98 105 103 97 98 98 98 96 103 101 100 105 100 104 99 93 98 95 93 107 142

Days to 75% maturity 146 148 141 152 160 159 148 148 143 150 144 156 152 150 157 143 161 144 134 146 138 141 159

Table 7.1 Morpho-physiological and yield traits of different rice bean genotypes (group 1)

8.72

Pod length (cm) 9.02 8.1 9.7 9.04 8.42 7.72 8.2 9.68 8.92 8.26 10.0 8.96 8.90 8.28 8.34 7.56 7.66 9.26 8.44 8.70 7.12 9.08 7.62 55

No. of pods/ plant 45 44 37 48 57 58 52 52 50 44 23 49 35 31 30 41 25 31 35 54 39 51 45 25

No. of pod cluster / plant 20 21 17 21 23 20 25 24 27 22 12 19 16 13 13 21 10 12 19 25 22 24 21 2.00

Pods/ cluster 2.00 2.00 2.00 2.00 3.00 3.00 2.00 2.00 2.00 2.00 2.00 3.00 2.00 2.00 3.00 2.00 2.00 2.00 2.00 2.00 3.00 2.00 3.00 420

Total pods 472 443 511 457 241 319 457 657 381 478 620 603 467 474 310 404 415 432 363 352 278 633 137 7.00

No. of seeds/ pod 7.00 7.00 8.00 7.00 6.00 6.00 8.00 7.00 6.00 8.00 7.00 7.00 7.00 7.00 7.00 6.00 7.00 7.00 8.00 7.00 8.00 6.00 8.00 7.23

16.80

Seed yield (q/ha) 17.19 20.12 18.60 16.80 18.14 20.12 22.70 26.40 25.10 19.12 23.90 18.90 20.73 16.92 18.90 19.40 20.36 21.87 22.12 20.40 23.80 24.87 20.70

(continued)

100seed weight (g) 6.77 7.23 6.90 7.97 9.37 6.60 11.00 9.93 6.87 8.03 8.10 7.23 8.17 7.43 7.93 6.47 7.17 8.23 6.87 7.37 6.23 7.03 9.47

Genotypes JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Baroi (check) GM CV CD (5%) SE (m)

Plant height (70 DAS) (cm) 74.20 47.37 54.03 33.07 40.90 33.00

53.70 5.80 5.10 1.80

Plant height (50 DAS) (cm) 45.33 35.33 37.47 33.67 33.33 27.53

39.10 3.20 2.10 0.70

Table 7.1 (continued)

96.30 4.50 7.10 2.50

Plant height (115 DAS) (cm) 112.47 86.77 93.80 34.10 69.53 48.73 92 3.36 5.04 1.78

Days to 25% flowering 91 88 92 82 83 85 98.0 2.35 3.17 1.33

Days to 50% flowering 97 95 98 90 89 89 146 3.0 7.13 2.52

Days to 75% maturity 142 143 140 127 129 128 8.52 3.51 0.49 0.17

Pod length (cm) 8.72 8.46 7.70 6.94 7.74 6.24 42.0 42.77 NS –

No. of pods/ plant 58 35 58 26 31 27 20 39.56 NS –

No. of pod cluster / plant 29 19 23 17 18 18 2.0 16.70 0.6 0.213

Pods/ cluster 2.00 2.00 3.00 2.00 2.00 2.00 406 27.98 27.98 65.57

Total pods 464 429 430 156 274 189 7.00 3.5 3.50 0.14

No. of seeds/ pod 7.00 7.00 6.00 7.00 7.00 7.00 7.41 10.51 1.27 0.45

100seed weight (g) 8.20 6.93 6.63 6.17 5.03 3.77

20.20 22.93 2.13 1.37

Seed yield (q/ha) 17.40 19.38 17.90 18.40 19.31 19.70

7.1 Variation in Morpho-Physiological Traits of Rice Bean Genotypes

95

7.1.1.2 Days to Flowering In first group of rice bean genotypes (G-1), the genotypes Panchrukhi, Baroi, and Dhagwar required 89, 89, and 90 days to 50% flowering stage, respectively. The germplasm line IC-019352 required 93 days, whereas genotypes IC-137188, IC-016801, and JCR-52 required 95 days for 50% flowering. The exotic collection (EC-48223-B), IC-140803, IC-137190, and IC-140805 were of late-flowering type requiring 107, 105, 105, and 104 days for attaining 50% flowering stage, respectively. As presented in Table 7.1, it could be interpreted that days to 50% flowering have positive relationship with days to maturity. The local genotypes (Dhagwar, Baroi, and Panchrukhi) which were early flowering were also early maturing and required 127, 128, and 129 days for 75% maturity. The genotypes, viz., EC-48223B, IC-137191, IC-137190, and IC-140805 were late-maturing genotypes which require 159, 159, 160, and 161 days to reach 75% maturity stage. 7.1.1.3 Pod Length and Number of Pods per Plant The average pod length of rice bean genotypes belonging to first group was in the range of 6.24–10.0 cm (Table 7.1). The genotypes, namely, Panchrukhi, Baroi, and Dhagwar had shorter pods whose length was below the average pod length. The genotype IC-140795 had longer pods followed by IC-137188 and IC137195. A direct relationship was observed between pod characteristics and seed yield from different rice bean genotypes. 7.1.1.4 Number of Pod Cluster per Plant and Total Pods The mean value for total number of pods and pod clusters per plant varied from 23 (IC-140795) to 58 (IC-137191, JCR-32, and JCR-76) and 10 (IC-140805) to 29 (JCR-32), respectively. The total number of pods picked per plant at the maturity was in the range of 137–657 (Table 7.1). The highest number of pods (657 Nos.) were collected from the genotype (IC-137195) followed by IC-019352, IC-140795, and IC-140796 which was ultimately reflected in profuse pod bearing and large number of seeds per pod. The exotic genotype EC-48223-B and the local genotypes Dhagwar and Baroi revealed lowest number of pods picked per plant. 7.1.1.5 Number of Seeds per Pod and 100-Seed Weight The average number of seeds per pod for all genotypes understudy varied from 6.00 to 8.00. High variability in 100-seed weight was observed, ranging between 3.77 (Local Baroi) and 11.00 g (IC-137194). All the three local genotypes had low values for 100-seed weight. The genotype IC-137194 had significantly highest value for 100-seed weight than all the other genotypes. The local germplasm lines had low 100-seed weight and smaller seeds, whereas genotype IC-137194 revealed significantly high value for 100-seed weight and had bold seeds like cowpea. 7.1.1.6 Seed Yield (q/ha) Among different rice bean genotypes, the average seed yield (q/ha) ranged from 16.80 to 26.40 q/ha, of which the genotype IC-137195 was highest seed-yielding genotype followed by IC-137199 (25.10 q/ha) and IC-019352 (24.87 q/ha). The

96

7

Morpho-Physiological and Productivity Attributes of Rice Bean

genotypes, IC-137189 (16.80 q/ha) and JCR-12 (16.80 q/ha) were with low yield among others, although they had 48 and 55 pods per plant, whereas the local genotype had lesser number of pods. Thus, it is evident that seed yield not only affected by pod clusters and number of pods per plant; the pod length and number of seeds per pod also positively affect the seed yield from rice bean.

7.1.2

Morpho-Physiological Attributes of Group-II Genotypes (LRB Series)

The group II consisted of 16 genotypes (LRB series) from the state of Punjab, India was investigated for variation in their different morpho-physiological attributes. The variation in each morpho-physiological attributes has been presented below (Table 7.2):

7.1.2.1 Plant Height After 50 days of sowing, the genotype LRB-141 revealed maximum height (70.70 cm) followed by LRB-128 (64.40 cm), LRB-176 (63.80 cm), LRB-140 (62.60 cm), and LRB-168 (61.10 cm). The local genotype, namely, Baroi (47.50 cm) revealed least height (47.50 cm). After 70 days of sowing, the least plant height was also recorded for the genotype Baroi (94.60 cm) followed by LRB-134 (102.80), LRB-45 (105.40 cm), LRB-126 (106.50 cm), and LRB-156 (106.90 cm), whereas the genotype LRB-1 had maximum plant height (132.40 cm). The genotype LRB-158 (180.30 cm) followed by LRB-1 (174.60), LRB-126 (173.90 cm), LRB-164 (171.70 cm), and LRB-141 (170.30 cm) had maximum plant height, whereas the genotype Baroi had least plant height (96.00). From the table it was evident that the growth rate was high between 50 and 70 days after sowing. 7.1.2.2 Days to Flowering The number of days for 25% and 50% flowering stage revealed variation in second group (G2) of rice bean genotypes. The genotypes, viz., LRB-127 (79 days), Baroi (80 days), and LRB-40-2 (81 days) were early flowering, whereas LRB-135 (88 days), LRB-126 (87 days), and LRB-140 (87 days) were late-maturing genotypes. For 50% flowering, the genotypes Baroi and LRB-127 required 85 and 95 days, respectively. Days to 75% flowering for different genotypes followed similar trend. The genotypes, Baroi (125 days) and LRB-127 (142 days) were early and late-maturing genotypes in this group, respectively. Early maturing and early flowering in genotype Baroi might be attributed to its adaptability in growing conditions. 7.1.2.3 Pod Length and Pods per Plant The pod characteristics for group-II rice bean genotypes have been presented in Table 7.2. Genotype LRB-127 had longer pod length (11.4 cm) followed by LRB-40-1 (11.1 cm) and LRB-176 (11.1 cm), whereas the genotype Baroi had pods of smaller length (7.2 cm). The pod length for all LRB genotypes was significantly

Genotype LRB-1 LRB-401 LRB-402 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Local Baroi GM CV CD (5%) SE (m)

Plant height (70 DAS) (cm) 132.40 111.00

120.20

105.40 106.50 108.40 119.00 102.80 112.00 114.40 123.70 106.90 115.90 112.60 113.90 119.00 94.60

112.90 2.50 4.80 1.70

Plant height (50 DAS) (cm) 54.80 51.40

57.30

48.30 51.50 53.80 64.40 54.90 56.50 62.60 70.70 53.20 52.60 56.00 61.10 63.80 47.50

56.50 3.80 3.60 1.20

157.20 11.01 28.80 9.99

152.00 173.90 169.60 164.00 154.20 145.80 166.90 170.30 145.40 180.30 171.70 151.70 168.30 96.00

132.50

Plant height (115 DAS) (cm) 174.60 155.80

84 5.9 NS –

84 87 79 84 88 84 87 85 82 86 86 85 86 80

81

Days to 25% flowering 84 86

92 2.17 3.30 1.15

91 94 95 92 94 91 93 90 91 92 91 90 94 85

89

Days to 50% flowering 93 93

Table 7.2 Yield contributing traits of rice bean genotypes (LRB series)

81.84 8.93 3.67 1.27

134 138 142 133 139 137 141 141 133 138 141 138 141 125

134

Days to 75% maturity 136 138

10.62 4.95 0.87 0.30

10.90 10.90 11.40 10.70 10.70 10.60 10.80 10.80 10.40 10.70 11.00 10.90 11.10 7.20

10.60

Pod length (cm) 10.80 11.10

88 35.27 NS –

99 93 99 74 67 102 118 76 48 102 88 73 91 100

55

No. of pods/ plant 122 95

40 33.03 NS –

42 43 42 30 29 47 50 34 22 46 40 35 38 55

26

No. of pod cluster/ plant 48 45

2.00 20.78 NS –

3.00 2.00 3.00 3.00 2.00 2.00 2.00 2.00 3.00 2.00 2.00 2.00 2.00 2.00

2.00

Pods/ cluster 3.00 2.00

881 24.20 NS –

805 821 682 756 1131 862 672 955 844 919 928 1017 754 1100

957

Total pods 893 883

8.94 5.42 NS –

9.00 9.00 10.00 9.00 9.00 9.00 9.00 9.00 9.00 9.00 9.00 9.00 9.00 8.00

9.00

No. of seeds/ pod 9.00 9.00

6.93 10.46 1.21 0.42

7.40 7.00 6.80 6.80 7.10 7.30 6.50 7.30 7.00 7.30 6.50 7.20 8.10 4.4

7.40

100seed weight (g) 6.90 7.00

21.35 24.59 NS –

18.25 20.47 19.98 19.65 30.82 19.54 22.57 22.57 19.16 21.66 24.66 27.81 20.15 16.98

23.40

Seed yield (q/ha) 19.74 22.62

98

7

Morpho-Physiological and Productivity Attributes of Rice Bean

higher than the genotype Baroi. Local genotype was superior in having large number of pod cluster as compared to other genotypes. The number of pods per plant was highest for the genotype LRB-1 (122) and lowest for genotype LRB-156(48).

7.1.2.4 Number of Pod Cluster per Plant and Total Pods The number of pods per cluster and pod clusters per plant varied from 22 (LRB-156) to 55 (Baroi). The variability in total number of pods per plant at the maturity was in the range of 672 Nos. (LRB-140) to 1131 Nos. (LRB-131) (Table 7.2). The highest number of pods was harvested from the genotype LRB-134 followed by Baroi (1100), LRB-168 (1017), LRB-141 (955), and LRB-40-2 (957). The least number of pods were picked from the genotypes, viz., LRB-140 (672), LRB-127 (682), LRB-176 (754), and LRB-128 (756). 7.1.2.5 Number of Seeds per Pod and 100 Seed Weight The pod length has positive relationship with number of seeds per pod as genotypes LRB-127 (10) and Baroi (8) had highest and lowest number of seeds, respectively. The variation in 100-seed weight was between 4.4 (Baroi) and 8.10 g (LRB-176). The 100-seed weight in other genotypes were LRB-40-2 (7.4 g), LRB-45 (7.4 g), LRB-135 (7.3 g), and LRB-141 (7.3 g). The genotype LRB-164 with small cylindrical grains could have consumer preference. 7.1.2.6 Seed Yield (q/ha) In LRB series of genotypes, the mean value for seed yield (q/ha) ranged from 18.25 to 30.82 q/ha of which the genotype LRB-134 was highest seed-yielding genotype followed by LRB-168 (27.81 q/ha) and LRB-164 (24.66 q/ha).

7.1.3

Morpho-Physiological Attributes of Group-III Genotypes (JCR Series)

The group III included 17 rice bean genotypes (JCR series) from northeastern states of India. These genotypes were investigated for variation in their different morphophysiological attributes. The variation in each morpho-physiological attributes is presented below (Table 7.3):

7.1.3.1 Plant Height The variations in plant height of different rice bean genotypes at different time intervals have been presented in Table 7.3. After 50, 70, and 115 days of sowing, there was no significant difference in the plant height. The maximum height after 50 days of sowing was recorded for the genotype JCR-149 (59.10 cm) followed by JCR-54 (57.10 cm), JCR-20 (56.90 cm), and JCR-178 (55.70 cm), whereas after 70 days of sowing, the maximum height was recorded for the genotypes, viz., JCR-93 (122.70 cm), JCR-178 (122.10), JCR-54 (120.30), and JCR-152 (118.40 cm). After 115 days of sowing, the plant height was in order of JCR-152 (169.67 cm) followed by JCR-81 (161.00 cm), JCR-93 (160.80 cm), and JCR-20 (160.30 cm).

Genotype JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Local (Panchrukhi) GM CV CD (5%) SE (m)

Plant height (70 DAS) (cm) 113.00 120.30 103.50 109.50 122.70 114.40 101.10 118.40 104.90 105.60 110.80 122.10 106.70

111.80 8.00 NS –

Plant height (50 DAS) (cm) 56.90 57.10 41.80 47.10 43.90 46.70 59.10 53.20 46.00 47.80 45.10 55.70 50.30

50.10 13.80 NS 4.00

54.50 2.44 NS 1.09

Plant height (115 DAS) (cm) 160.30 152.67 154.07 161.00 160.80 163.13 142.00 169.67 153.27 159.00 151.73 153.47 127.60 86 3.43 5.00 1.71

Days to 25% flowering 88 85 90 86 86 87 85 89 94 87 85 83 79 93 2.33 3.67 1.26

Days to 50% flowering 94 92 96 93 91 94 92 95 102 94 92 91 86

Table 7.3 Yield contributing traits of rice bean genotypes (JCR series)

144 1.91 4.64 1.59

Days to 75% maturity 145 145 146 144 136 149 143 148 162 148 145 137 127 9.89 2.44 0.39 0.13

Pod length (cm) 10.17 9.93 10.25 10.18 10.10 9.65 9.81 9.92 9.24 10.63 10.05 10.57 8.14 96 44.98 NS –

No. of pods/ plant 112 77 115 121 60 86 86 110 83 126 102 83 84 42 46.96 NS

No. of pod cluster / plant 46 39 51 54 29 39 35 49 39 52 41 37 40 2.00 22.57 NS –

Pods/ cluster 2.00 2.00 2.00 3.00 2.00 2.00 2.00 2.00 2.00 3.00 2.00 2.00 2.00 944.72 28.86 NS –

Total pods 1350 953 777 955 851 885 878 900 502 970 982 1122 1156

9.0 2.68 0.41 0.14

No. of seeds/ pod 9.00 8.00 8.00 9.00 9.00 9.00 9.00 9.00 8.00 9.00 9.00 9.00 8.00

7.34 6.66 0.82 0.28

100seed weight (g) 7.80 7.20 8.60 7.73 7.20 7.40 7.40 7.73 6.93 7.80 7.70 7.50 5.73

26.20 27.60 NS –

Seed yield (q/ha) 34.36 23.56 23.49 23.51 19.73 25.62 26.70 27.79 22.54 28.70 26.97 32.72 24.91

100

7

Morpho-Physiological and Productivity Attributes of Rice Bean

7.1.3.2 Days to Flowering The number of days for gaining 25% and 50% flowering by JCR series of genotypes has been presented in Table 7.3. Maximum number of days to 25% flowering was observed for the genotype JCR-162. The least number of days to flower (79 and 86 days, respectively) were recorded for the genotype Panchrukhi. The genotypes JCR-162 and JCR-79 were late maturing as they required 102 and 96 days for attaining 50% flowering stage. 7.1.3.3 Pod Length and Pods per Plant Pod length varied from 8.14 to 10.57 cm with genotypes Panchrukhi and JCR-163 having minimum and maximum pod length. The highest number of pods were harvested from the genotype JCR-163 (126 Nos.) followed by the genotypes JCR-81 and JCR-59 with 121 Nos. and 115 Nos. of pods, respectively. The least number of pods was recorded for genotype JCR-93. 7.1.3.4 Number of Pod Cluster per Plant and Total Pods The average number of pod cluster per plant varied from 29 (JCR-93) to 54 (JCR-81). The number of pods picked at maturity was lowest for the genotype JCR-162 (502Nos.), whereas the highest pod harvest was recorded for JCR-20 (1350Nos.) followed by Panchrukhi (1156 Nos.) and JCR-178 (1122 Nos.). 7.1.3.5 Number of Seeds per Pod and 100-Seed Weight All genotypes of JCR series had on an average nine number of seeds per pod except JCR-54 (8.0), JCR-79 (8.0), JCR-162 (8.0), and Panchrukhi (8.0). The variability in 100-seed weight ranged from 6.93 to 8.60 g among the genotypes. The significantly higher value for 100-seed weight was observed for the genotype JCR-79 (8.6 g). It was followed by the genotypes JCR-20 and JCR-163 (7.8 g each). Lowest 100-seed weight was recorded for the JCR-162 (6.93 g). 7.1.3.6 Seed Yield (q/ha) The seed yield (q/ha) from different genotypes has been presented in Table 7.3. The genotype JCR-93 had lowest seed yield (19.73 q/ha). Highest seed yield was recorded for the genotype JCR-20 (34.36 q/ha) followed by JCR-178 (32.72 q/ha) and JCR-163 (28.70 q/ha). The seed yield from the genotype (Panchrukhi) (24.91q/ ha) was considerably higher than JCR-93, JCR-162, JCR-79, JCR-81, and JCR-54. From Table 7.3, it is evident that the seed yield in JCR-20 and JCR-178 was high mainly because of excellent yield attributing traits such as high pod harvest, higher seed weight, and longer pod with high number of seeds. The study conducted on different rice bean genotypes revealed variation in different morpho-physiological attributes and established a close association between morpho-physiological traits and seed yield from different genotypes. The higher seed yield reflected the profuse pod bearing, higher number of seeds per pod, and higher number of the picked pods from the genotype. It is evident that pod characteristics have positive correlation with the seed yield from rice bean. The grading of rice bean genotypes on the basis of the morpho-agronomic attributes and trait-specific promising genotypes has been presented in Tables 7.4 and 7.5.

LRB-168 (27.81) JCR-152 (27.79) JCR-171 (26.97) JCR-149 (26.70) IC137195 (26.40)

LRB-134 (30.82) JCR-163 (28.70)

Seed yielda (q/ha) JCR-20 (34.36) JCR-178 (32.72)

LRB-164 (171.70) LRB-141 (170.30) JCR-20 (170.13) JCR-152 (169.67) LRB-127 (169.60)

LRB-1 (174.60) LRB-126 (173.90)

Indeterminatea LRB-158 (180.30) LRB-168 (176.48)

Plant height (cm)

IC-140803 (89.97) IC-137191 (90.27) EC-48223-B (91.83) IC-016789 (92.03) JCR-76 (93.80)

IC-016771 (87.07) IC-137188 (89.43)

Determinateb IC-137187 (84.67) JCR-52 (86.77)

Genotypes graded in the descending order Genotypes graded in the ascending order

b

a

9.

8.

7.

6.

5.

4.

3.

2.

Sr. no. 1.

IC-016801 (67.30) Local Panchrukhi (69.53) IC-137186 (70.70)

Bushyb Local Dhagwar (34.10) Local Baroi (48.73)

Table 7.4 Grading of rice bean genotypes for morpho-physiological traits

LRB-168 (81.67) LRB-156 (82) Local Dhagwar (82) IC-019352 (83) LRB-134 (84)

(25% flowering) earlyb LRB-127 (79) Local Panchrukhi (79) Local Baroi (80) LRB-40-2 (81) IC-140803 (99) JCR-79 (96) IC-140796 (95) LRB-127 (95) JCR-152 (95)

EC-48223-B (100) IC-140805 (99)

(25% flowering) latea IC-137190 (100) IC-137191 (100)

LRB-156 (133) LRB-40-2 (134) LRB-45 (134) LRB-1 (136) JCR-93 (136)

Local Panchrukhi (127) LRB-128 (133)

(75% maturity) earlyb Local Baroi (125) Local Dhagwar (127)

EC-48223-B (159) IC-140798 (158) IC-140803 (157) IC-140796 (156) IC-137189 (152)

IC-137190 (160) IC-137191 (159)

(75% maturity) latea JCR-162 (162) IC-140805 (161)

7.1 Variation in Morpho-Physiological Traits of Rice Bean Genotypes 101

102

7

Morpho-Physiological and Productivity Attributes of Rice Bean

Table 7.5 Rice bean genotypes excelling in specific traits Trait Seeds per pod Pod length Number of pods per plant Pod cluster per plant Total number of pods picked 100-seed weight Seed yield

Genotype IC-137188, IC-137194, IC-137200, IC-016771, LRB-134, LRB-127, LRB-168, LRB-40-2, JCR-20, JCR-178, JCR-171, JCR-178 IC-140795, IC-137195, IC-140808, IC-019352, LRB-127, LRB-176, LRB-40-1, LRB-164, JCR-163, JCR-178, JCR-79, JCR-81 IC-137191, IC-137090, LRB-1, LRB-140, LRB-135, LRB-158, JCR-163, JCR-81, JCR-79, JCR-20, JCR-12, JCR-76 IC-016789, IC-137194, LRB-1, LRB-135, LRB-158, LRB-40-1, JCR-81, JCR-163, JCR-79, JCR-152, JCR-32, JCR-12 IC-137195, IC-019352, IC-140795, IC-140796, JCR-134, JCR-168, LRB-40-2, LRB-141, JCR-20, JCR-178, JCR-171, JCR-81 IC-137194, IC-137195, IC-137190, IC-140808, LRB-40-2, LRB-45, LRB-158, LRB-135, JCR-79, JCR-20, JCR-163, JCR-152 IC-137195, IC-137199, IC-019352, IC-140795, LRB-134, LRB-168, LRB-164, LRB-40-2, JCR-20, JCR-178, JCR-163, JCR-152

A substantial increase in seed production can also be ensured by maintaining the rice bean population at proper spacing. Plant spacing and seed rate are very useful criteria for obtaining higher return from rice bean. The seed rate of 25 kg ha 1 under 60 cm ridge sowing has been found best for obtaining high seed production from rice bean. Rice bean has higher production potential in comparison with other summer legumes such as soybean, black gram, cowpea, common bean, and horse gram. Following proper management and agronomic operations, the rice bean productivity could be enhanced substantially.

References Chaudhuri AP, Prasad B (1972) Flowering behaviour and yield of rice bean (Phaseolus calcaratus Roxb.) in relation to date of sowing. Ind J Agric Sci 42:627–630 Joshi KD, Bhandari B, Gautam R, Bajracharya J, Hollington PA (2008) Rice bean: a multipurpose underutilized legume. In 5th international symposium on new crops and uses: their role in a rapidly changing world, University of Southampton, Southampton, p. 234 Mathur R (1995) Genetic variability and correlation studies in segregating generations of cowpea. Madras Agric J 82:150–152 Pattanayak A, Ingrai B, Khongwir DEA, Gatpoh EM, Das A, Chrungoo NK (2018) Diversity analysis of rice bean (Vigna umbellate (Thunb.) Ohwi and Ohashi) collections from north eastern India using morpho-agronomic traits. Sci Hort 242:170–180 Singh KP, Kumar A, Saharan RP, Kumar R (2006) A new bold seeded genotype of mungbeanMRH-5. Nat J Plant Impr 8:92–93 Tian J, Isemura T, Kaga A, Vaighan DA, Tomooka N (2013) Genetic diversity of the rice bean (Vigna umbellata) as assessed by SSR markers. Genome 56:717–727

8

Nutritional Potential of Rice Bean

Food and nutritional security has become one of the major challenges faced by the developing countries in today’s globalized or mechanized world. Further, it is assumed that the population growth in world will continue and will reach 9 billion in coming 30 years. The highest percent increase will be in the developing countries. As a result the rate of converting farm lands into commercial landscapes will be more than double. Further, the dependency on few staple food crops will be too high. Under these circumstances, there is a need to exploit the other potential sources which can provide food, energy, and new avenues to improve livelihood of low-income groups in the developing countries. In search of alternative source of food, comprehensive ethnobotanical surveys have been conducted in different countries which confirm the existence of a number of food crops which remain unexploited and could provide a possible solution for mitigating food and nutritional crises perpetuating in larger section of world population residing especially in developing countries. The benefits of underutilized food legumes such as local importance in consumption and production system, adaptability to specialized agro-ecological niche and marginal areas, fragile environment, nutrient richness, and associated indigenous knowledge-based cultivation and utilization make them most potential and alternative food crop species for broadening world’s food basket. Prior to exploring the mass utilization of underexploited food legumes, it is essential to have proper knowledge of nutritional and anti-nutritional contents and potential health benefits. Legumes occupy an important place in human nutrition, especially for low-income population group in the developing countries as an alternative source of animal proteins. They provide an explicit source of protein for having 14–35% protein which is higher in comparison to 6–10% protein content in cereal food crops. The legume protein is known to be of good quality for containing two essential amino acids, i.e., lysine and tryptophan which are deficient in major cereal crops. Besides being a rich source of protein, pulses also have appreciable level of other essential nutrients such as fiber, starch, minerals, and vitamins (Kutos et al. 2002; Osorio-Diaz et al. 2003). Pulses are also important in crop rotation in farming # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_8

103

104

8

Nutritional Potential of Rice Bean

High Protein Low cholesterol

Lowfat

Excellent source of micronutrients

High dietary fiber

High in energy

Low glycemic index

Excellent source of essential fatty acids

Fig. 8.1 Nutritional potential of rice bean

systems with cereals, in providing feed source to livestock in many mixed farming systems and in fetching higher return and supplementing farmer’s income. The important and diverse role played by pulses in the farming systems and in diets of poor people help in improving human health and nutrition and enhancing ecosystem resilience (Akibode and Maredia 2011). Many legumes under the category of underutilized crop with sound nutritional profile and excellent production potential have been identified. Rice bean due to favorable nutritional characteristics especially protein content has the potential to meet the nutritional requirement of large number of populations. In comparison with the other legumes, the protein content is high with good digestibility and very favorable amino acid composition for human consumption. Level of vitamins particularly B complex (thiamine, riboflavin, niacin, pantothenic acid, and folate) is in nutritionally favorable proportion. It is also a good source of minerals, including calcium, phosphate, potassium, iron, and zinc. Compared to recommended daily requirements, the consumption of a realistic amount of rice bean can provide a number of health benefits (Fig. 8.1). .

8.1

Nutritional Constituents in Different Rice Bean Genotypes

Rice bean has drawn attention as potential source of proteins and other essential nutrients (Mal and Joshi, 1991). The variation in its nutritional composition may be due to differences between varieties, methods of nutritional analysis, and growing

8.1 Nutritional Constituents in Different Rice Bean Genotypes Table 8.1 Characteristics of rice bean starch

Compounds (%) Moisture Ash Nitrogen Lipids Amylose Starch damage

105 Mean 10.10 0.21 0.04 0.16 32.80 3.01

Source: Chavan et al. (2009)

conditions. The crude protein in rice bean varies from 14.00% to 26.00%, tryptophan (0.80–1.10%), methionine (0.39–0.94%), total soluble sugars (5.0%), non-reducing sugars (3.71–5.37%), and starch (52–57%) (Kaur et al. 2013; Kaur and Kapoor 1990; Saharan et al. 2004; Singh et al. 1980; Srivastava et al. 2001). Rice bean starch has characteristics similar to the other edible legumes (Table 8.1). These characteristics make rice bean starch valuable for making baked products and confectionaries (Chavan et al. 2009). Rice bean seeds are also a good source of micronutrients such as vitamins like thiamine, riboflavin, and niacin and minerals such as calcium, iron, and phosphorus (Sharma et al. 2003). Most of the protein and other nutritional components are present in the cotyledons. Based on our observations, the nutritional composition of different rice bean genotypes has been discussed for visualizing the prospects of this crop in meeting upcoming food and nutritional challenges.

8.1.1

Protein Content

Though, both plant and animal based food resources are absolute for human consumption, but the plant based food resources are vital for meeting increasing food requirements is vital for the survival of the mankind. The importance of plant-based food products can be understood from the fact that plant products directly contribute about 57% of global protein supply in comparison to meat (18%), dairy (10%), fish and shellfish (6%), and other animal products (9%) (Henchion et al. 2017). Among variety of foods, legumes are cheapest source of proteins (14–35%). The increased consumption of legumes could be useful in reducing the risks related to consumption of animal protein source. The high protein content of legumes may be the cause of their association with nitrogen-fixing bacteria in roots, which converts atmospheric nitrogen into ammonium ions which plant utilizes for the protein synthesis. Rice bean is one of the cheapest and quality protein sources with 14–26.00% protein which is quite comparable to other commonly consumed and marketed legumes like chick pea (Cicer arietinum) (18.77%), kidney bean (Phaseolus vulgaris) (19.91%), pigeon pea (Cajanus cajan) (20.27%) and dry peas (Pisum sativum) (20.43%), black gram (Vigna mungo) (21.97%), lentil (Lens culinaris) (22.49%), and green gram (Vigna radiata) (22.53%) (Pattanayak et al. 2019). However, due to varietal discrepancy, different methodology of analysis, and growing conditions, variations have been observed in protein profile of rice bean seeds (Bhagyawant et al. 2019; Katoch 2013a; Malhotra et al. 1988; Raiger et al. 2010; Rodriguez and Mendoza 1991;

106

8

Nutritional Potential of Rice Bean

Sadana et al. 2006; Singh et al. 1985). Among different seed components of rice bean, cotyledons have high protein content (Katoch 2011). The rice bean variety RBL-5 contains 19.50% protein in whole bean and 17.50% in dhal (Parvathi and Kumar 2006) (Tables 8.2 and 8.3). Table 8.2 Nutritional constituents in the seeds of different rice bean genotypes Genotypes JCR-152 JCR-178 JCR-163 JCR-20 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB-40–2

Protein content (%) 24.40
0.45 24.28
0.23 24.56
0.12 23.98
0.20 24.26
0.18 25.28
0.37 25.23
0.36 23.17
0.05 23.68
0.47 24.56
0.57 24.52
0.42 25.57
0.11 24.56
0.71 25.10
0.25 24.57
0.32 24.58
0.37

Dietary fiber (%) 4.22
0.02 5.23
0.06 4.98
0.05 4.25
0.07 5.07
0.04 5.12
0.05 4.78
0.06 5.12
0.05 4.78
0.06 4.52
0.05 4.23
0.04 5.56
0.03 5.01
0.04 4.27
0.05 4.33
0.03 4.44
0.07

Total carbohydrate (%) 52.23
0.12 55.36
0.06 54.63
0.11 55.22
0.09 53.11
0.07 54.36
0.06 55.23
0.12 54.36
0.06 55.23
0.12 53.56
0.13 55.02
0.04 54.36
0.06 53.26
0.13 52.69
0.06 54.54
0.15 54.23
0.06

Lipid (%) 2.02
0.02 2.28
0.11 3.42
0.04 3.27
0.05 2.94
0.02 2.50
0.01 2.89
0.09 2.50
0.01 2.89
0.09 2.47
0.09 2.56
0.04 3.01
0.04 3.11
0.07 1.92
0.03 1.98
0.06 2.69
0.08

Source: Katoch (2013a); Data presented as Mean of 3 values
SD

Table 8.3 Protein fractions of the seed flour of different rice bean genotypes (g/100 g seed flour) Genotypes JCR-152 JCR-178 JCR-163 JCR-20 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB-40–2

Albumins 7.27
0.02 7.02
0.09 6.25
0.05 6.87
0.04 6.90
0.08 6.12
0.06 6.69
0.03 7.11
0.03 6.88
0.01 6.97
0.08 6.87
0.05 7.47
0.05 6.45
0.05 6.22
0.05 6.15
0.03 6.13
0.09

Globulins 15.27
0.12 14.35
0.09 15.30
0.05 15.40
0.09 14.40
0.07 14.12
0.09 14.47
0.04 14.63
0.08 14.45
0.07 14.50
0.06 15.45
0.04 15.56
0.04 13.11
0.05 13.97
0.07 14.21
0.12 14.28
0.07

Prolamins 1.97
0.02 1.45
0.06 1.66
0.06 1.56
0.02 1.69
0.02 1.77
0.05 1.68
0.02 1.70
0.03 1.60
0.09 1.80
0.02 1.70
0.02 1.87
0.03 1.84
0.05 1.78
0.02 1.68
0.03 1.88
0.05

Source: Katoch (2013a); Data presented as Mean of 3 values
SD

Glutelins 2.20
0.03 1.98
0.06 2.02
0.08 1.88
0.03 1.97
0.06 2.29
0.11 2.21
0.13 2.09
0.09 2.22
0.06 2.10
0.03 1.77
0.11 1.98
0.08 1.87
0.08 1.83
0.07 1.98
0.15 1.72
0.03

8.1 Nutritional Constituents in Different Rice Bean Genotypes

107

The storage proteins in food crops have been classified into four groups depending on their solubility into albumins (water soluble), globulins (soluble in salt water), glutelins (soluble in ethanol or water solutions), and prolamins (soluble in alcohol) (Boye et al. 2010; Duranti 2006). Prolamins are most prominent storage proteins in cereal grains, while globulins (legumin, 11S, and vicilin, 7S) and albumins are present in higher amounts in leguminous seeds. Albumins and globulins represent the major proportion of total storage proteins in rice bean seeds. Fractions of globulin in rice bean seeds vary from 13.11 g/100 g to 15.56 g/ 100 g seed flour (Table 8.4). Albumins are the next major protein fraction, ranges from 6.13 g/100 g to 7.47 g/100 g seed flour. Albumins are categorized as enzymatic and metabolic proteins, such as lipoxygenase, protease inhibitors, and lectins. Prolamins and glutins are also present in appreciable amounts 1.60 g/100 g to 1.97 g/100 g seed flour and 1.77 g/100 g to 2.22 g/100 g seed flour, respectively (Table 8.4). The estimate of protein digestibility provides an assessment of nutritive value of food crops. Highly digestible protein provide amino acids to cells and allow muscles to build, organs to function, and overall make body of an individual to work, whereas the low protein digestibility has been suggested to be the cause of interplay

Table 8.4 Fatty acid profile (%) in the seeds of different rice bean genotypes Genotypes JCR-152 JCR-178 JCR-163 JCR-20 IC140802 IC140795 IC140796 IC137195 IC137194 IC019352 EC48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB40–2

Palmitic acid (C16:0) 15.23
0.15 16.88
0.23 16.56
0.15 15.68
0.25 15.98
0.36

Stearic acid (C18:0) 4.56
0.09 4.75
0.06 4.96
0.11 4.59
0.13 5.21
0.05

Oleic acid (C18:1) 15.62
0.13 16.23
0.19 15.89
0.15 16.87
0.11 16.90
0.16

Linoleic acid (C18:2) 18.23
0.15 18.01
0.13 17.56
0.14 17.89
0.21 18.98
0.23

Linolenic acid (C18:3) 44.36
0.45 42.13
0.44 41.03
030 41.89
0.25 40.27
0.89

14.56
0.19

5.58
0.16

17.91
0.17

18.74
0.15

39.89
0.45

15.63
0.13

5.48
0.10

16.88
0.21

18.36
0.09

41.65
0.56

15.27
0.21

4.98
0.08

16.58
0.25

18.54
0.25

42.62
0.47

16.23
0.1

4.36
0.13

16.98
0.19

18.56
0.22

40.12
0.56

14.36
0.13

4.56
0.07

17.54
0.16

17.56
0.24

42.57
0.48

14.23
0.21

5.11
0.09

17.23
0.14

18.24
0.45

42.58
0.69

14.89
0.14 15.69
0.05 15.84
0.09 15.63
0.12 15.55
0.13

4.87
0.12 4.74
0.15 4.88
0.19 5.59
0.16 5.87
0.11

17.58
0.25 16.51
0.23 17.23
0.22 17.11
0.11 17.25
0.12

18.29
0.36 17.56
0.12 17.24
0.16 17.92
0.11 17.36
0.18

44.38
0.55 42.92
0.23 42.71
0.19 41.97
0.29 42.27
0.47

Source: Katoch (2013a); Data presented as Mean of 3 values
SD

108

8

Nutritional Potential of Rice Bean

of anti-nutritional factors such as protease inhibitors, phytates, oxalates, lectins, goitrogens, and other anti-nutritional factors. In societies where legumes are consumed rather than much more expensive animal foods, there is concern over the level of anti-nutrients in the diets (Admassu and Kumar 2005; Gilani et al., 2005). Rodriguez and Mendoza (1991) reported 82–88.50% protein digestibility of rice bean (in vitro), which was higher than mung bean (80%) and cowpea (74%). Because of high protein content with good digestibility, consumption of rice bean with cereals could enhance the overall quality of diet.

8.1.2

Dietary Fiber

Dietary fiber resists the digestion in gastrointestinal tract by endogenous enzymes and is principally made up of cell wall components. Chemically, the fiber comprised of non-starch polysaccharides and many other components such as resistant starch, resistant dextrins, chitins, pectins, β-glucans, and oligosaccharides. The neutral detergent fiber (NDF), acid detergent fiber (ADF), hemicellulose, cellulose, lignin, and pectin contents are major constituents of dietary fiber in rice bean seeds and have been reported to the value of 13.00%, 8.50%, 4.50%, 7.40%, 3.00%, and 1.90%, respectively (Saharan et al. 2002). Dietary fibers are grouped based on their solubility into soluble and insoluble fiber where soluble fiber is the most digestible part due to ease in fermentation by the ruminal microflora of large intestine. Upon dissolution in water, some soluble fiber form viscous and constitutes the proportion indigestible dietary fiber. The viscous soluble fibers delay the gastric emptiness, slow intestinal movement, and bring structural changes in the gastrointestinal tract that affects the absorption of nutrients from digested food. The fiber viscosity is an important attribute for controlling appetite. The consumption of adequate amount of dietary fiber is essential for proper functioning of the gastrointestinal tract. The fiber content of legumes varies with legume type and processing methods; however, legumes typically contain more insoluble fiber. In most of the grain legumes, fiber content ranges from 8.0% to 27.50%, with soluble fiber in the range 3.30–13.80% that is fermentable into short-chain fatty acids (SCFA) in the colon (Mallillin et al. 2008). Rice bean is a good source of dietary fiber. The study on nutritional analysis of rice bean revealed that the dietary fiber content in rice bean ranged from 4.22% to 5.56% (Katoch 2013a) (Table 8.2). Among different genotypes, BRS-2 was observed as a good source of dietary fiber (5.56%) followed by JCR-178 (5.23%) and IC-140795 (5.12%). Since rice bean has fairly good amount of dietary fiber, therefore it has plenty of benefits to the human health like other traditional pulses. The dietary fiber from rice bean could also be valuable in regulating blood cholesterol level, blood glucose level and in ensuring the proper functioning of colon thereby lead to smooth transportation of waste material. It has been well established that increasing the consumption of dietary fiber could reduce the risk of obesity, diabetes, hypertension, coronary heart disease, stroke, and some gastrointestinal disorders such as gastroesophageal reflux disease, diverticulitis, duodenal ulcer, hemorrhoids, and constipation. Therefore, the increase consumption

8.1 Nutritional Constituents in Different Rice Bean Genotypes

109

of rice bean in routine cuisine could be beneficial in the prevention of chronic diseases.

8.1.3

Total Carbohydrates

In legumes, the carbohydrate content generally ranges from 50% to 60%, and starch is the most abundant carbohydrate. It is deposited as insoluble, semi-crystalline granules in storage tissues and to a lesser extent in most vegetative tissues. Amylose and amylopectin are components of starch. The starch from legumes contains about 60–70% amylopectin and 30–40% amylose content, whereas other starchy food contains 70–75% amylopectin and 25–30% amylose content. Legume starch is generally referred as nonstructural carbohydrate which is not efficiently utilized by monogastric animals, hence called resistant starch. The presence of resistant starch and amylose in higher amounts reduces the rate of digestion, thereby reducing the amount of glucose released into the system. In addition, because resistant starch is not completely digested by human digestive enzymes, they act as a substrate to the functional probiotics in large intestine/colon. Fermentation of resistant starches by colonic microbes produces short-chain fatty acids which provide favorable health benefits. Starch constitutes around 52–57% of total dry matter present in rice bean seeds with 35.20% and 64.80% of amylose and amylopectin, respectively (Kaur and Kapoor 1990). Kaur et al. (2013) also reported that the amylose content of starches separated from different rice bean genotypes ranged from 21.19% (RL-3) to 60.14% (LRB-417). Rice bean has average starch digestibility (32.86 mg maltose release/gm of meal) which is low in comparison to other commonly consumed pulses such as faba bean (42 mg maltose release/g of meal) (Kaur and Kapoor 1990; Saharan et al. 2002). Chavan et al. (2009) reported that the moisture, ash, nitrogen, lipids, and amylose in rice bean starch are comparable to the literature values for other legumes such as moth bean, horse gram, navy bean, beach pea, and pinto bean. Legume starch also has high retrogradation rate in gastrointestinal tract which increases the starch resistance to enzymatic hydrolysis, thereby reduces the glycemic index (GI) (Fredriksson et al. 2000). Furthermore, legumes are gluten free, making them suitable for consumption by celiac disease patients or individuals sensitive to the proteins gliadin and glutenin. Rice bean has low glycemic index in comparison to other staple legumes like mung bean, pea, pigeon pea, soybean, and cowpea (Marsosno et al. 2002). The low glycemic index makes rice bean suitable for consumption by diabetic patients and those with an elevated risk of developing diabetes. Rice bean also has total soluble sugars (5.0 g/100 g to 5.60 g/100 g) and non-reducing sugars (4.70 g/100 g to 5.30 g/100 g) and less starch (50 g/100 g to 55 g/100 g) than faba bean (Katoch 2013a; Saharan et al. 2002). Legume starches to a certain extent are refractory to enzymatic digestion and contribute flatulence. This can be overcome by intake of whole legume wherein the dietary fiber helps in reducing the intestinal transit time and thus supports bowel motility. Reduced

110

8

Nutritional Potential of Rice Bean

digestibility lowers glucose release into the blood stream which is advantageous to diabetic patients (Muhammad et al. 2000).

8.1.4

Lipid and Fatty Acid Content

Pulses generally have low fat content with the exception of peanut, and soybeans, which contain about 45% and 47% fat, respectively. The fat in legumes constituted by significant amount of mono and polyunsaturated fatty acids and virtually no saturated fatty acids. The polyunsaturated fatty acids present in some legumes include essential α-linoleic acid (C18:2, ω-6) and α-linolenic acid (C18:3, ω-3). These polyunsaturated fatty acids are essential for human health, and since human body cannot synthesize them, they must be included in diet. As compared to other traditional pulses, the total lipid content in rice bean seeds is on lower side which is nutritionally favorable (Katoch 2013a; Sritongtae et al. 2017). The study conducted by Katoch (2013a) revealed lipid content in rice bean ranges from 1.92% to 3.42% (Table 8.2). Among the investigated genotypes, the total lipids content was highest in JCR-163 (3.42%) followed by JCR-20 (3.27%), LRB-134 (3.11%), BRS-2 (3.01%), and IC-140802 (2.94%). Difference in fat content in rice bean is mainly due to variety, origin, location, climatic, and environmental conditions and type of soil on which they grown and extraction method. The low fat content in rice bean, according to nutritional guidelines, justifies the use of this underutilized legume in formulation of diet meant for weight restriction. Though the total lipids are in lesser amount in rice bean as compared to many other legumes, but the composition of fatty acids is excellent with low saturated fatty acids and high unsaturated fatty acids content. With respect to fatty acids, linolenic acid is the predominant one in rice bean (39.89–44.36%) followed by linoleic acid (17.24–18.98%), oleic acid (15.62–17.91%), palmitic acid (14.23–16.88%), and stearic acid (4.36 to 5.87%) (Table 8.4). The highest level of linolenic acid was observed in genotype BRS-2 (44.38%) followed by JCR-152 (44.36%), LRB-134 (42.92%), LRB-164 (42.71%), IC-137195 (42.62%), and EC-48223-B (42.58%). Genotype IC-140802 had highest level of linoleic acid (18.98%) followed by IC-140795 (18.74%), IC-137194 (18.56%), and IC-137195 (18.54%). The highest oleic acid content was observed for the genotype IC-140795 (17.91%), whereas the level of stearic acid and palmitic acid was highest for the genotypes LRB-40-2 (5.87%) and JCR-178 (15.23%), respectively (Table 8.5). Unsaturated fatty acids are highly desirable for different metabolic functions of the body. The balanced proportion of essential fatty acids, i.e., linoleic acid with α-linolenic acid in rice bean seeds, is a nutritionally desirable feature for driving various metabolic functions in the body. Some of the minor fatty acids such as myristic acid, behenic acid, arachidic acid, and lignoceric acid are also present in rice bean seeds (Duke 1981).

8.1 Nutritional Constituents in Different Rice Bean Genotypes

111

Table 8.5 Ascorbic acid and niacin content in the seeds of different rice bean genotypes Genotypes JCR-152 JCR-178 JCR-163 JCR-20 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB-40–2

Ascorbic acid (mg/100 g) 23.45
0.07 25.42
0.12 18.12
0.01 15.33
0.08 29.19
0.06 19.45
0.01 20.14
0.09 19.45
0.01 20.14
0.09 22.17
0.06 25.25
0.01 15.36
0.03 20.28
0.02 15.14
0.05 17.56
0.02 18.56
0.02

Niacin (mg/100 g) 4.25
0.03 3.89
0.02 3.77
0.02 4.01
0.01 4.26
0.04 3.87
0.07 3.56
0.04 3.87
0.07 3.56
0.04 3.48
0.05 4.01
0.02 3.85
0.08 4.02
0.06 3.48
0.01 3.67
0.04 3.66
0.11

Source: Katoch (2013a); Data presented as mean of 3 values
SD

8.1.5

Vitamins

Vitamins are compounds that are required in relatively small amounts but that cannot be synthesized in quantities large enough to meet the normal needs of the organism. Vitamins are considered as natural bio-regulatory compounds which relatively in low concentrations have many metabolic processes. Among the vitamins, vitamin C an important water-soluble antioxidant play significant role in maintaining the health of an individual. Vitamin C serves as cofactor for the enzymes involved in the synthesis of collagen, catecholamines, and carnitine and also in the metabolism of xenobiotics, cholesterol, and tyrosine (Combs 2008). This vitamin is also involved in the regeneration of vitamin E (α-tocopherol) (May et al. 1998). Moreover, vitamin C also increases the bioavailability of minerals particularly iron (Wollenberg and Rummel 1987). The deficiency of this particular vitamin leads to scurvy disease. Therefore, the diet must be enriched with the food having sufficient amounts of vitamin C. Niacin (vitamin B3) is one of the important B complex vitamins essential for proper growth and development as the co-enzymatic form (NAD+ and NADP+) is required by the regulatory enzymes of different metabolic pathways. The importance of vitamin B3 can be understood from the fact that the deficiency of this vitamin leads to pellagra disease which is characterized by dementia, diarrhea, and dermatitis; therefore, the diet should have the ingredients rich in vitamin B3 content. The inclusion of rice bean as a diet ingredient could increase the quality of diet as a good source of thiamine, riboflavin and niacin which play important roles in energy and fatty acid metabolism. The levels of niacin and ascorbic acid in rice bean ranges from 3.48 mg/100 g to 4.28 mg/100 g and 15.33 mg/100 g to 25.42 mg/100 g (Katoch

112

8

Nutritional Potential of Rice Bean

2013a) (Table 8.5). The ascorbic acid and niacin vitamins were in highest proportion in the genotypes LRB-134 (28.23 mg/100 g) and BRS-2 (4.28 mg/100 g), respectively. Andersen and Chandyo (Andersen and Chandyo 2009) reported 2.20 mg niacin per 100gm of rice bean seed flour. Kaur and Kapoor (1992) reported an average of 30 mg niacin and 1.40 mg ascorbic acid in five different rice bean varieties. Kalidas and Mohan (Kalidass and Mohan 2012) also described as rice bean as an excellent source of niacin and vitamin c. The ascorbic acid level in rice bean was higher than earlier reported for Cicer arietinum (Fernandez and Berry 1988), Vigna radiata, and Vigna mungo (Kataki et al., 2010). The niacin content in rice bean was also higher side in comparison to Cajanus cajan, Dolichos lablab, Dolichos biflorus, Phaseolus mungo, Vigna catjang and other Vigna species (Rajyalakshmi and Geervani 1994); and Vigna unguiculata (Arinathan et al. 2009).

8.1.6

Amino Acid Composition

Proteins are the source of constructive and energetic compounds like amino acids and play a bioactive role besides being the precursors of biologically active peptides with various physiological functions. The manner in which dietary protein exerts its physiological effects depends on the quantity and quality of proteins. The amino acid composition is the major determinant of protein quality. A complete protein provides all essential amino acids. Generally proteins from animal origin are considered as complete proteins. However, proteins from plant sources are deficient or low in particularly essential amino acids. Legumes contain relatively low quantities of the essential amino acid methionine (which is found in higher amounts in grains). Grains, on the other hand, contain relatively low quantities of the essential amino acid lysine, which legumes contain. Hence, legumes and cereals complement each other (Ampe et al. 1986; Rockland and Radke 1981). As such, protein quality is significantly improved when legumes are eaten in combination with cereals. For nutritional balance, legumes and cereals are advised to be in the ratio 35:65. Legumes are particularly important in vegetarian diets as they are the chief source protein and also provide vitamins and minerals. Rice bean has one of the suitable compositions of essential amino acids. Our study on amino acid composition in different rice bean genotypes revealed that rice bean has methionine and lysine which are limiting in other pulses with other essential amino acids and their amount is comparable to amino acid requirements recommended by FAO/WHO (Katoch 2013a). According to Mohan and Janardhan (Mohan and Janardhanan 1995), the methionine level in rice bean is higher than the other traditional legume crops like black gram (Vigna mungo) and green gram (Vigna radiata). Tables 8.6 and 8.7 presents amino acid composition (g/100g protein) in different rice bean genotypes. The level of methionine and lysine amino acids ranged from 2.09 g/100 g protein to 2.63 g/100 g protein and 7.23 g/100 g to 8.56 g/100 g protein, respectively. The genotypes JCR-163 (2.63 g/100 g protein) and JCR-178 (8.56 g/ 100 g protein) had highest level of sulfur-containing amino acids. The threonine content of different genotypes was above the minimal level recommended by

8.1 Nutritional Constituents in Different Rice Bean Genotypes

113

Table 8.6 Essential amino acid profile in the seeds of different rice bean genotypes Genotypes FAO-/WHO-recommended Pattern (g/100 g protein) JCR-152 JCR-178 JCR-163 JCR-20 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB-40–2

Phenylalanine 6.30

Valine 3.50

Leucine 6.60

Isoleucine 2.80

5.92
0.05 5.86
0.02 5.36
0.06 5.25
0.05 5.78
0.03 5.45
0.04 5.89
0.06 4.94
0.09 5.69
0.04 5.87
0.01 5.45
0.02 5.6
0.06 5.23
0.09 5.54
0.03 5.69
0.05 5.23
0.02

5.24
0.05 5.20
0.07 5.69
0.12 5.89
0.09 5.46
0.04 5.23
0.03 5.89
0.11 5.79
0.03 5.77
0.12 5.40
0.06 5.48
0.04 5.59
0.05 5.54
0.01 5.23
0.05 5.55
0.01 5.23
0.12

8.12
0.09 8.56
0.06 8.23
0.05 7.77
0.04 7.56
0.02 7.23
0.11 8.56
0.12 8.45
0.03 7.45
0.05 7.96
0.05 7.45
0.02 8.27
0.06 8.36
0.08 8.74
0.05 8.45
0.08 7.90
0.02

7.50
0.03 7.60
0.23 7.26
0.06 7.36
0.09 7.25
0.05 7.45
0.05 7.13
0.09 6.89
0.05 6.58
0.23 7.14
0.06 7.23
0.11 7.25
0.06 7.56
0.02 6.88
0.03 6.56
0.09 7.56
0.10

Source: Katoch (2013a); Data presented as mean of 3 values
SD Table 8.7 Essential amino acid profile of seed flour of different rice bean genotypes Genotypes FAO-/WHOrecommended Pattern (g/100 g protein ) JCR-152 JCR-178 JCR-163 JCR-20 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB-40–2

Threonine 3.40

Methionine 2.50

Lysine 5.80

Histidine 1.90

Tryptophan 1.1

4.80
0.17 4.53
0.06 4.23
0.11 4.25
0.06 4.89
0.10 4.78
0.10 5.12
0.09 4.88
0.12 4.56
0.08 4.23
0.07 4.78
0.05 5.08
0.06 4.87
0.11 4.78
0.12 4.95
0.08 4.77
0.03

2.25
0.02 2.56
0.02 2.63
0.07 2.36
0.05 2.50
0.09 2.12
0.06 2.25
0.09 2.14
0.02 2.20
0.05 2.16
0.04 2.56
0.06 2.11
0.09 2.09
0.03 2.25
0.01 2.29
0.05 2.27
0.03

8.40
0.10 8.56
0.06 7.98
0.08 7.23
0.06 7.89
0.06 7.98
0.05 7.58
0.06 8.12
0.01 8.56
0.08 8.47
0.01 7.25
0.05 8.12
0.06 8.75
0.04 7.98
0.06 7.88
0.03 7.68
0.05

2.55
0.02 2.45
0.01 2.36
0.02 2.45
0.06 2.33
0.03 2.22
0.06 2.12
0.01 2.57
0.03 2.45
0.05 2.64
0.06 2.45
0.08 2.98
0.09 2.45
0.05 2.35
0.03 2.31
0.0 2.11
0.02

1.53
0.01 1.56
0.02 1.84
0.01 1.23
0.03 1.25
0.03 1.65
0.01 1.45
0.02 1.36
0.05 1.47
0.02 1.28
0.01 1.36
0.05 2.00
0.04 1.87
0.03 1.36
0.01 1.98
0.03 1.45
0.02

Source: Katoch (2013a); Data presented as Mean of 3 values
SD

114

8

Nutritional Potential of Rice Bean

FAO/WHO for human intake. The threonine content among different genotypes varied from 4.23 g/100gm protein to 5.12 g/100 g protein. Among the genotypes, IC-140796 (5.12 g/100 g protein) had highest threonine content followed by BRS-2 (5.08 g/100 g protein), LRB-168 (4.95 g/100 g protein), IC-140802 (4.89 g/100 g protein), and IC-137195 (4.88 g/100 g). The level of histidine and threonine were also higher in rice bean than the minimal levels recommended by FAO/WHO (1.90 g/ 100 g protein and 1.10 g/100 g protein, respectively). The genotype BRS-2 was superior in having highest level of histidine and tryptophan amino acids (2.98 g/ 100gm and 2.00 g/100 g, respectively). The isoleucine amino acid content in rice bean genotypes was in the range of 6.58 g/100 g to 7.60 g/100 g which was higher than the minimal level recommended by FAO/WHO (2.80 g/100 g). The isoleucine content was highest in the genotype JCR-178 (7.60 g/100 g), followed by LRB-134 (7.56 g/100 g), LRB-40-02 (7.56 g/100 g protein), and JCR-152 (7.50 g/100 g protein). The valine and leucine amino acids content were observed in the range of 5.23 g/100gm to 5.89 g/100 g and 7.45 g/100 g to 8.45 g/100 g in different rice bean genotypes, respectively. The genotypes IC-140796 had highest valine and leucine amino acid content. The phenylalanine content in rice bean genotypes was slightly lower than value recommended by FAO/WHO (6.30 g/100 g). Highest phenylalanine content was observed for the genotype JCR-152 (5.92 g/100 g) followed by IC-019352 (5.87 g/100 g), IC-140802 (5.78 g/100 g), and JCR-178 (5.86 g/100 g protein). The above data revealed rice bean to be a good source of essential amino acids which advocate the inclusion of this pulse in diet to meet the daily nutritional requirements.

8.1.7

Mineral Content

Minerals and vitamins are important for human health and play a significant role in metabolism. As a carrier of oxygen or transporter of electrons, iron is essential for respiration and energy metabolism. Zinc is a component of numerous metalloenzymes that are dependent upon zinc for direct participation in catalytic activity or for their structural integrity. Zinc deficiency has been associated with cardiovascular and renal diseases. Enzymes, in which copper is a functional component, regulate important metabolic functions related to energy metabolism, neurotransmitter synthesis, metabolism, and antioxidant activity. Calcium is an important component of the structure of bones and teeth. It has a role in blood clotting, enzyme regulation, nerve transmission, and muscle contraction. Apart from a relevant source of essential macronutrients, rice bean constitutes an interesting source of micronutrients. Rice bean seeds contain appreciable quantities of sodium, potassium, calcium, magnesium, phosphorous, zinc, copper, and iron. Zinc (2.45 mg/100 g to 24.18 mg/100 g), potassium (610.44 mg/100 g to 1752.77 mg/100 g), calcium (111.51 mg/100 g to 168.00 mg/100 g), and iron (4.00 mg/100 g to 9.25 mg/100 g) are major mineral constituents in rice bean seeds (Saharan et al. 2002; Katoch 2013a). Kalidas and Mohan (2012) suggested that the low Na/K and high Ca/P ratios in legumes indicated their potential in controlling the deregulated activities such as high blood pressure. Diets having low potassium and high sodium

8.2 Nutritional and Anti-nutritional Constituents in Different Seed Components of. . .

115

Table 8.8 Comparison of micronutrient content of rice bean with other legumes Nutrients (per 100 g) Vitamin B1 (mg) Vitamin B2 (mg) Vitamin B3 (mg) Vitamin B6 (mg) Folate (μg) Calcium (mg) Phosphorus (mg) Iron (mg) Zinc (mg) Magnesium (mg) β-Carotene (μg) Vitamin E (mg) Vitamin K (μg)

Rice bean 0.46 0.14 1.70 0.25 180 290 340 12.50 3.00 230 22.0 0.70 28.0

Soya bean 0.83 0.30 2.20 0.53 230 240 580 9.40 3.20 220 6.0 3.60 18.0

Mung bean 0.70 0.22 2.10 0.52 460 100 320 5.90 4.00 150 150 0.90 16.0

Lima bean 0.48 0.18 1.90 0.41 130 75.0 200 6.10 5.50 170 0.00 0.50 6.00

Kidney bean 0.50 0.20 2.00 0.36 85.0 130 400 6.00 2.50 150 12.0 0.30 8.00

Lentil 0.55 0.17 2.50 0.54 59.0 58.0 440 9.40 5.10 100 28.0 1.40 14.0

Source: Dhillon and Tanwar (2018)

content may be partially or directly related to chronic illnesses, including hypertension, stroke, kidney stones, osteoporosis, etc. (Afolabi et al. 2015). Rice bean seeds have low Na/K ratio that has great concern in controlling the cardiac arrhythmia, whereas Ca/P ratio is high indicating rice bean as a good source of calcium (Kalidass and Mohan 2012) (Tables 8.8 and 8.9). The account of rice ben genotypes having better proportion differnt nutritional traits is presented in Table 8.9.

8.2

Nutritional and Anti-nutritional Constituents in Different Seed Components of Rice Bean

Legumes are the staple food for a large part of the world population, because their seeds provide valuable amounts of proteins, carbohydrates, fiber, vitamins, and minerals and have an important composition of essential amino acids, the sulfurcontaining amino acids being the limiting ones. Furthermore, legumes also have non-nutritional compounds that may decrease the absorption of nutrients or produce toxic effects. Leguminous seeds are similar in structure but differ significantly from each other in size, shape, color, and nutritional composition of different seed components. Legume seeds are chiefly composed of seed coat or testa, cotyledon, and embryonic axis which, in average, represent 10%, 89%, and 1%, respectively, of the seed content. Legumes as dicotyledons so named as they can easily separate into two halves. The cotyledons themselves are a pair of specialized leaves. The seed coat of legumes mainly consists of parenchyma cells with an outer layer of sclerenchyma and a vascular system embedded in it. The seed coat is firmly attached to cotyledons. It has been well established that different components of legume seeds contain varied amount of nutrients. Cotyledons are major component of the leguminous

116

8

Nutritional Potential of Rice Bean

Table 8.9 Rice bean genotypes excelling in different nutritional constituents Nutritional constituent Crude protein Dietary fiber Carbohydrates Vitamins 1. Ascorbic acid 2. Niacin Lipids Osborne fractions 1. Albumins 2. Globulins 3. Prolamins 4. Glutelins Fatty acids 1. Palmitic acid 2. Stearic acid 3. Oleic acid 4. Linoleic acid 5. Linolenic acid Amino acids 1. Alanine 2. Valine 3. Leucine 4. Isoleucine 5. Threonine 6. Methionine 7. Lysine 8. Histidine 9. Tryptophan

Genotypes BRS-2, IC-140795, IC-140796, LRB-164 BRS-2, JCR-178, IC-140795, IC-137195 JCR-178, JCR-20, IC-140796, IC-137194 IC-140802, EC-48223-B, JCR-178, JCR-152 IC-140802, JCR-152, LRB-134, JCR-20 JCR-163, JCR-20, LRB-134, BRS-2 BRS-2, JCR-152, IC-137195, JCR-178 BRS-2, EC-48223-B, JCR-20, JCR-163 JCR-152, LRB-40-2, BRS-2, LRB-134 IC-140795, IC-137194, IC-140796, JCR-152 JCR-178, JCR-163, IC-140802, JCR-20 LRB-40-2, LRB-168, IC-140795, IC-140796 IC-140795, BRS-2, IC-019352, LRB-40-2 IC-140802, IC-140795, IC-137194, IC-137195 BRS-2, JCR-152, LRB-154, LRB-164 JCR-152, IC-019352, JCR-178, IC-140802 JCR-20, IC-140796, IC-137195, IC-137194 LRB-164, JCR-178, IC-137195, LRB-168 JCR-178, LRB-134, LRB-40-2, JCR-152 IC-140796, BRS-2, LRB-168, IC-140802 JCR-163, JCR-178, EC-48223-B, IC-140802 LRB-134, IC-137194, JCR-178, IC-019352 BRS-2, IC-019352, IC-137195, JCR-152 BRS-2, LRB-134, JCR-163, LRB-168

seeds that contain the main reserve substances, basically proteins and carbohydrates and have importance for feeding the embryonic plant during germination of seed. Within the cotyledon cells, there are protein bodies and starch granules, which constitute the anatomical structure of energy reserve of these seeds. Seed coat is the source of dietary fiber, though it also contains some of the toxic anti-nutritional factors (Fig. 8.2). Rice bean seed coat contains 6.02% protein content which is comparable to other traditional legumes (7.62%). The rice bean cotyledon and whole seeds have 16.73% and 22.75% crude protein content, respectively. Fiber content is usually considered as valuable dietary constituents for improving gastrointestinal functions and satiety changes. The seed coat fraction in leguminous seeds contains comparatively higher amounts of fiber than other fractions. Particularly seed coat contains higher amounts of insoluble fiber, whereas cotyledons contain higher soluble fibers, slowly digestible and resistant starch, as well as oligosaccharides. Similar to other pulses, rice

8.2 Nutritional and Anti-nutritional Constituents in Different Seed Components of. . .

117

Fig. 8.2 Legume seed components 25.0

0.074

20.0

0.078

% 15.0 (Content)

Crude protein

0.59

10.0 0.29

0.029 5.0

Crude fiber

0.14

0.0 Seed coat

Whole seed

Cotyledon Seed components

Fig. 8.3 Crude protein and fiber content in different rice bean seed components

% Carbohydrate

80 70

0.06

0.03

60 50 40

Carbohydrate

0.05

30 20 10 0 Seed coat

Cotyledon

Whole seed

Seed components

Fig. 8.4 Total carbohydrate content in rice bean seed components

bean has highest fiber content in seed coat (12.60%), whereas cotyledons have low fiber content (3.0%) (Katoch 2011) (Fig. 8.3). Legumes are a source of complex, energy-giving carbohydrates with up to 60% carbohydrates (dry weight). The study indicated nearly 62.00% and 65.50% total carbohydrates in cotyledons and whole seed, respectively. The rice bean seed coat has lowest total carbohydrate (32.00%) content (Katoch 2011) (Fig. 8.4).

118

8

Nutritional Potential of Rice Bean

Legume proteins are important source of essential amino acids; however, they are deficient in sulfur-containing amino acids as well as tryptophan. As discussed, rice bean has comparatively higher proportions of methionine and tryptophan. Our study revealed that the methionine and tryptophan content in different seed components of rice bean ranges from 1.94 to 2.71 g/16 g N and 1.31 to 2.15 g/16 g N, respectively (Katoch 2011). It is also well recognized that the majority of food legumes possess certain biochemical compounds having anti-nutrient effects. These anti-nutritional factors generally affect efficient utilization, absorption, or digestion of nutrients and thus reduce their nutrient bioavailability and nutritional quality. The presence of antinutritional factors in crop plants is often the result of an evolutionary adaptation which enables the plant to survive and complete its life cycle under natural conditions, regardless of the negative consequences on quality and safety of food products. Phenolic compounds are one of the most important groups of secondary metabolites in plants associated with anti-nutrient properties. The higher level of polyphenolic content in rice bean seeds have been observed in seed coat (Katoch 2011). The total phenolic content ranges from 2.16 to 3.40%, simple phenolics from 0.18 to 0.35%, total tannins from 1.98 to 3.05%, condensed tannins from 0.28 to 0.58%, and hydrolysable tannins from 1.70 to 2.99% in different seed components of rice bean. The level of phytic acid content in different seed components of rice bean varies from 3.20 to 6.40% (Katoch 2011).

8.3

Comparison of Nutritional Composition of Rice Bean with Other Vigna Species

In some countries of the world, the inclusion of the legumes in the routine diet has decreased in favor of meat and highly processed products. An imbalance in these proportions in the diet has a negative impact on human health. Therefore, nutritionists recommend a return to the consumption of legume seeds. Due to their high nutritional values, legumes are widely used as the main source of protein, in particular when availability of animal protein is in irregular supply or in other words they are chief substitute of animal protein in vegetarian diet. Besides protein, legumes also provide many other important essential nutrients such as vitamins and minerals and various nutraceutical compounds that contribute many health benefits to humans. The importance of legumes can be understood from the fact that for a major fraction of the total human population legumes in combination with cereals is a staple diet. Though a number of leguminous crops belonging to different genera have been known for having great significance in the attainment of food and nutritional security globally, the leguminous crops of genus Vigna have special place for contributing significantly to the global productivity and nutrition. The genus Vigna is a large pan-tropical genus naturally distributed in the America, Africa, Asia, Australia, and the Pacific. This genus comprises about 82 species originating from regions of Africa, America, and Asia and has been subdivided into seven subgenera based on

8.3 Comparison of Nutritional Composition of Rice Bean with Other Vigna Species

119

morphology and their centers of origin. Two of these subgenera contain important grain legumes classified by centers of origin: African Vigna species (Vigna group) and Asian Vigna species (Ceratotropis group). A total of 36 species belong to African Vigna group of which the domesticated species include the important species of Vigna unguiculata (cowpea). The Ceratotropis group includes 16 species, of which the important species for human and animal consumption point of view are Vigna angularis (adzuki bean), Vigna umbellata (rice bean), Vigna radiata (mung bean), Vigna mungo (black gram), Vigna aconitifolia (moth bean), and Vigna subterranea (bambara groundnut). These species possesses some characteristics which make their domestication attractive such as desirable nutritive quality, their ability to resist in extreme environments including high temperatures, low rainfall, and poor soils with few economic inputs. All of the economic Vigna species have the potential as a supplemental, economic source of dietary protein, and owing to their high grain protein content, these legumes are also explicit alternative to animal proteins for consumption especially in the developing countries. The Vigna species are also highly valuable for enhancing the resilience of the farming system by means of green manuring and cover cropping. Although these species are rich and comparatively cheap sources of protein, yet the total nutritional composition varies among different species.

8.3.1

Variation in Nutritional Components of Vigna Species

The study on the comparative nutritional composition was carried out in five Vigna species, viz., V. umbellata, V. unguiculata, V. radiata, V. mungo, and V. angularis. The moisture content in these species varies from 8.85 to 12.17%. The ash content which provides an estimate of the total mineral content was highest in V. unguiculata (3.87%). The crude protein in V. umbellata was comparable to V. radiata (23.78%). The crude fiber in Vigna species varied from 3.50% to 4.60% among which rice bean had the highest level of crude fiber, whereas the lowest crude fiber was observed in V. mungo (Table 8.10). As a nonspecific source of energy, ether extract provides a measure of total essential fatty acids. The ether extract in Vigna species understudy revealed variations from 0.7% in V. radiata to 0.9% in V. umbellata and V. angularis. V. mungo was has highest total sugar content (8.06%), whereas minimum content for this parameter was observed in V. radiata (5.35%). The overall variation for starch content in different species of genus Vigna was observed from 42.86 to 48.63% where highest starch content was in V. mungo and least in Vigna radiata. All legume proteins are comparatively low in sulfur-containing amino acids methionine and tryptophan, whereas the proportion of other essential amino acid, lysine, is much higher than in cereal grains (Ampe et al. 1986; Rockland and Radke 1981). Therefore, considering lysine and sulfur amino acids, legume and cereal proteins are nutritionally complementary. The lysine and methionine content in Vigna species varied from 5.37 to 6.74 g/16gN and 0.63 to 1.18 g/16gN. Minerals are essential dietary components which are required for the metabolic processes catalyzed by the

Crude protein (%) 23.78
0.10 21.68
0.12 21.58
0.08 23.18
0.06 22.63
0.08

Crude fiber (%) 4.3
0.05 3.5
0.03 4.2
0.06 4.6
0.04 3.8 + 0.05 Ether extract (%) 0.70
0.03 0.90
0.07 0.80
0.05 0.90
0.01 0.80
0.04

Carbohydrate (%) 53.14
2.56 50.18
1.77 41.34
1.39 47.58
1.02 55.16
2.36

Ascorbic acid (g/100 g) 93.02
4.93 93.12
6.45 77.51
8.56 77.50
5.63 62.01
4.98

8

Source: Katoch (2013b); Data presented as Mean
SD

Species V. radiata V. angularis V. unguiculata V. umbellata V. mungo

Table 8.10 Nutritional profile of major Vigna species

120 Nutritional Potential of Rice Bean

8.3 Comparison of Nutritional Composition of Rice Bean with Other Vigna Species

121

enzymes. In totality, Vigna species are good source of macro- and micro-minerals. Zinc content in different Vigna species revealed variations from 2.41 to 3.93 mg/ 100 g where Vigna umbellata had highest content. Iron content revealed variations from 6.31 mg/100 g (Vigna angularis) to 8.77 mg/100 mg (Vigna umbellata). Manganese content also varied from 1.50 (Vigna radiata) to 2.87 mg/100 g (Vigna angularis). The calcium content varied from 218.00 to 402.33 mg/100 g. Vigna umbellata has higher calcium content, while the lowest value was observed in Vigna radiata. Potassium content in Vigna species observed in the range of 1953.33 to 2816.67 mg/100 g. Higher content of potassium was observed in Vigna umbellata, while lowest content was observed in Vigna mungo. The highest magnesium content was observed in Vigna mungo (236.33 mg/100 mg), whereas minimum content was estimated in Vigna umbellata (120.33 mg/100 g). Among these Vigna species, the highest sodium content 38.67 mg/100 g was observed in Vigna mungo. The phosphorus content varied from 213.46 mg/100 g to 333.03 mg/100 g. Higher value for phosphorous content was observed in Vigna angularis and the minimum value in Vigna unguiculata. Vigna umbellata and V. unguiculata had nearly at par value of ascorbic acid content. Variations were also observed for different protein fractions, where highest albumin content was observed for Vigna angularis (22.55 g/100 g protein). Among the different protein fractions, the bulk of the storage proteins is constituted by the globulins in rice bean. Vigna unguiculata (18.78 g/100 g protein) has highest glutelin content, whereas the lowest glutelin content was exhibited by Vigna mungo (14.84 g/100 g protein). Kalidas and Mohan (Kalidass and Mohan 2012) studied the nutritional composition of some minor pulses of Vigna genus, including Vigna trilobata, Vigna radiata var. sublobata, Vigna aconitifolia, Vigna vexillata, and Vigna bourneae and reported that the crude protein content in these species ranged from 21.40% to 25.84% among which Vigna radiata var. sublobata, V. aconitifolia, and V. vexillata were with high crude protein content. The lipid content ranged from 3.58 to 6.48%. The total dietary fiber content was reported highest in V. trilobata, V. radiata subsp. sublobata, and V. aconitifolia in comparison to other commonly cultivated pulses such as Cicer arietinum, Pisum sativum, and Cajanus cajan (Premakumari et al. 1984). The variation in carbohydrates content was reported from 59.44% to 72.06% which was higher as compared to Arachis hypogaea and Glycine max with 26.10% and 20.90% of total carbohydrates, respectively (Rao et al. 1989). The fatty acid profiles of Vigna species have high concentrations of palmitic, oleic, linoleic, and linolenic acids. They also have considerable level of niacin and ascorbic acid content as compared to Cajanus cajan, Dolichos lablab, Dolichos biflorus, (Rajyalakshmi and Geervani 1994), and Cicer arietinum (Alajaji and El-Adawy 2006). The Vigna species exhibit higher levels of potassium content than that of other legumes Phaseolus vulgaris, Phaseolus lunatus, Vigna unguiculata, Cicer arietinum, Pisum sativum, and Lens culinaris (Meiners et al., 1976); Cicer arietinum (Alajaji and El-Adawy 2006; Zia-Ul-Haq et al. 2007). The high content of potassium is beneficial in the diets of people who take diuretics to control hypertension and suffer from excessive excretion of potassium through the body fluid (Siddhuraju et al.

122

8

Nutritional Potential of Rice Bean

2000). The calcium content of Vigna trilobata and Vigna bourneae is higher than that of the recommended dietary allowances of calcium (>400 mg) for children. Vigna species contain higher levels of calcium, magnesium, and iron when compared with Cicer arietinum and Cajanus cajan (Nwokolo 1987) (Table 8.11).

8.3.2

Variation in Anti-nutrient Composition of Vigna Species

The presence of anti-nutritional factors reduces effective utilization of dietary benefits of legumes. The presence of anti-nutritional factors is one of the main drawbacks which limit the nutritional and food quality of Vigna species. The comparative anti-nutritional profiling of different Vigna species had reveal that the rice bean comparatively has modest level of anti-nutrients. Phenolic compounds are known for their inhibitory activity for digestive enzymes. They also decrease the digestibility of essential nutrients such as proteins and carbohydrates and availability of vitamins and minerals. The total phenolic content in Vigna species ranged between 1.31% (V. unguiculata) and 2.38% (V. radiata), while simple phenolics varied from 0.16% (V. unguiculata) to 0.78% (V. radiata). Tannins are complex polyphenolic substances that contribute astringency and bitterness to plants and have been classified into two classes: hydrolyzable and condensed tannins. The two types differ in their nutritional and toxic effects. The high level of condensed tannins decreases the absorption of two essential amino acids, namely, methionine and lysine amino acids. Tannins also have the property to precipitate proteins and making more complex bonds with starch, cellulose, and minerals and affecting their digestibility. The level of total, condensed, and hydrolyzable tannins in different Vigna species ranged between 1.15 per cent (V. unguiculata) to 1.96% (V. angularis), 0.68% (V. unguiculata) to 0.98% (V. umbellata), and 0.21% (V. umbellata) to 1.23% (Vigna angularis), respectively (Fig. 8.5). Protease inhibitors are present in considerable amounts in leguminous seeds, which are known to inhibit the activity digestive gut proteases and interfere with digestibility of dietary proteins and reduce their utilization. The trypsin inhibitor content of Vigna species has variations from 21.80 to 32.46 mg/g. α-Amylase inhibitor interferes with the activity of amylase enzyme, which is responsible for digestion of starchy food and also known as starch blockers due to their mode of inhibitory action. α-Amylase inhibitor content in Vigna species varied significantly from 614.33 unit/g (Vigna umbellata) to 1560.67 unit/g (Vigna angularis) (Table 8.12).

8.3.3

Protein Profiling of Vigna Species

The fingerprinting involving the biochemical markers is considered as a reliable way of characterization of germplasm. Electrophoretic pattern of seed proteins and of isozymes in many crops has been used for establishing distinctness among the species. Among the biochemical techniques, polyacrylamide gel electrophoresis is

V. trilobata 22.10
0.46 6.48
0.59 7.48
0.34 3.12
0.56 26.20
0.02 52.04
0.58

V. radiata var. sublobata 25.64
0.17 3.58
0.56 6.12
0.58 3.48
0.56 32.10
0.56 62.14
0.58

Source: Kalidass and Mohan (2012); Data presented in Mean
SE

Nutritional constituents Crude protein (%) Crude lipid (%) Total dietary fiber (%) Ash Niacin (mg 100 g1) Ascorbic acid (mg 100 g1)

Table 8.11 Nutritional composition of other Vigna species V. aconitifolia 24.40
0.10 5.26
0.53 6.78
0.71 4.12
0.58 38.48
0.58 79.40
0.56

V. vexillata 25.84
0.56 5.80
0.17 4.89
0.05 3.94
0.56 30.40
0.57 66.42
0.57

V. bourneae 21.40
0.01 4.20
0.02 5.25
0.05 3.38
0.05 28.34
0.59 48.36
0.63

8.3 Comparison of Nutritional Composition of Rice Bean with Other Vigna Species 123

124

8

Nutritional Potential of Rice Bean

Fig. 8.5 Variation in antinutrient composition of Vigna species

Table 8.12 Protease inhibitor content in dry mature seeds of five Vigna species Vigna species Vigna umbellata Vigna unguiculata Vigna radiata Vigna angularis Vigna mungo CD (5%) CD (1%)

Trypsin inhibitor (mg/g) 29.56 26.58 32.46 23.37 21.80 0.80 1.14

α-Amylase inhibitor (unit/g) 1560.67 1035.66 986.70 614.33 853.00 24.88 35.38

Source: Shweta et al. (2017)

the most widely used technique due to its validity and simplicity in the identification of variation among species. The technique is also useful for screening purity of ever-expanding number of cultivars, for verifying whether or not two or more morphologically identical accession, and for exploiting the important traits of landraces and wild relatives (Sammour 1991). Further, this electrophoretic technique is also a practical and reliable method for species identification because seed storage proteins are largely independent of environmental fluctuation. Seed protein patterns obtained by SDS-PAGE have also been successfully used to resolve the taxonomic and evolutionary problems of several plants (Pervaiz et al., 2011; Shah et al. 2011; Emre 2011). Further, proteins can be used as biomarkers, and if properly analyzed and studied, that could lead to identification of candidates with nutritional, industrial, or medicinal value/applications. The variation in protein profile of different Vigna species was also investigated by our group using SDS-PAGE (Fig. 8.6). Different bands with varying molecular weights ranging from 21 to 94 kDa were identified. The seed storage proteins from V. umbellata, V. mungo, and V. radiata resolved into seven detectable peptide bands. A polypeptide band corresponding to an apparent weight of 29 kDa was absent in the protein profile of V. unguiculata. In the protein profile of V. umbellata, V. mungo, and V. radiata, similar banding pattern between 29 and 66 kDa was

8.3 Comparison of Nutritional Composition of Rice Bean with Other Vigna Species Fig. 8.6 Comparison of protein profiles of different Vigna species. Lane 1 ¼ (V. umbellata), Lane 2 ¼ (V. mungo), Lane 3 ¼ (V. radiata), Lane 4 ¼ (V. angularis), Lane 5 ¼ (V. unguiculata), M ¼ Marker

KDa

M

1

2

3

4

125

5

94.4 66

43

29 20.1

observed which confirms the compositional similarity of seed proteins of these species. The banding pattern in V. unguiculata was different to other Vigna species. Food and nutrition security are going to face a tough challenge due to population outburst especially in the developing and third-world countries. Malnutrition is currently widespread in many areas of the world; and the most serious one is protein-calorie malnutrition (PCM). In coming decades, we have to face challenge of feeding more than 9 billion people. It is estimated that a large segment of the population in developing countries do not have enough food to meet their daily requirement and a further 2 billion people are deficient in one or more micronutrients. To mitigate the global food and nutritional insecurity, there is a need to explore the other potential food sources as this objective could not be achieved by relying on only a few food crops. The high cost and limited supply of animal proteins have necessitated research efforts toward the study of food properties and potential utilization of protein from locally available food crops, especially from underutilized legumes. Rice bean is one of the future crops which could be exploited for mitigating the nutritional insecurity particularly. The bioavailability of protein from rice bean and the amino acid composition is very favorable for human consumption. Therefore, it is well suited both as an alternative to and as a supplement to animal food sources among economically marginalized people. To nutritional benefits of rice bean could be utilized through its inclusion in diet for fulfilling the basic nutritional requirements of people. Furthermore, rice bean could provide a base for the development of many functional foods as well as a range of feed and raw material for industrial products.

126

8

Nutritional Potential of Rice Bean

References Admassu SE, Kumar RS (2005) Antinutritional factors and in-vitro protein digestibility of improved haricot beans (Phaseolus vulgaris L.) varieties grown in Ethiopia. Int J. Food Sci Nutr 56(6):377–387 Afolabi WAO, Oyawoye OO, Sanni SA, Onabanjo OO, Obanla OO (2015) Portion size, micronutrient content and nutritional quality of fast foods sold in Abeokuta, Nigeria. Int J Health Nutr 6:1–8 Akibode S, Maredia M (2011) Global and regional trends in production, trade and consumption of food legume crops. Report submitted to CGIAR Special Panel on Impact Assessment Alajaji SA, El-Adawy TA (2006) Nutritional composition of chickpea (Cicer arietinum L.) as affected by microwave cooking and other traditional cooking methods. J. Food Comp Anal 19:806–812 Ampe C, Van DJ, de Castro A, Sampaio MJ, Van MM, Van der J (1986) The amino acid sequence of the 2S sulphur-rich proteins from seeds of Brazil nut (Bertholletia excelsa.). Eur J Biochem 159:597–204 Andersen P, Chandyo RK (2009) Food security through ricebean research in India and Nepal (FOSRIN). Report 6. In: Hollington PA (ed) Health and nutrition impacts of ricebean. Department of Geography, University Bergen and Bangor/CAZS Natural Resources, College of Natural Sciences, Bangor University, Bergen Arinathan V, Mohan VR, Maruthupandian A, Athiperumalsami T (2009) Chemical evaluation of raw seeds of certain tribal pulses in Tamil Nadu, India. Trop Subtrop Agroecosyst 10:287–294 Bhagyawant SS, Narvekar DT, Gupta N, Bhadkaria A, Gautam AK, Srivastava N (2019) Chickpea (Cicer arietinum L.) lectin exhibits inhibition of ACE-I, α-amylase and α-glucosidase activity. Protein Pept Lett 26:494–501 Boye J, Zare F, Pletch A (2010) Pulse proteins: processing, characterization, functional properties and applications in food and feed. Food Res Int 43:414–431 Chavan UD, Momin A, Chavan JK, Amarowicz R (2009) Characteristics of Starch from Rice bean (Vigna umbellata L.) seeds—a short report. Pol J Food Nutri Sci 59:25–27 Combs GF (2008) The vitamins: fundamental aspects in nutrition and health, 3rd edn. Elsevier, Burlington Deepinder K, Kapoor AC (1992) Nutrient composition and antinutritional factors of rice bean (Vigna umbellata). Food Chem 43(2):119–124 Dhillon DK, Tanwar B (2018) Rice bean: a healthy and cost-effective alternative for crop and food diversity. J Food Secur 10(3):25–535. https://doi.org/10.1007/s12571-018-0803-6 Duke JA (1981) Handbook of legumes of world economic importance. Plenum Press, New York, p 345 Duranti M (2006) Grain legume proteins and nutraceutical properties. Fitoterapia 77:67–82 Emre I (2011) Determination of genetic diversity in the Vicia L. (section vicia) by using SDS-PAGE. Pak J Bot 43(3):1429–1432 Fernandez ML, Berry JW (1988) Nutritional evaluation of chickpea and germinated chickpea flours. Plant Foods Hum Nutr 38:127–134 Fredriksson H, Bjorck I, Andersson R, Liljiberg H, Silverio J, Eliasson AC, Aman P (2000) Studies on α-amylase degradation of retrograded starch gels from waxy maize and high- amylopectin potato. Carbohydr Polym 43:81–87 Gilani GS, Cockell KA, Sepehr E (2005) Effects of antinutritional factors on protein digestibility and amino acid availability in foods. J AOAC Int 88(3):967–987 Henchion M, Hayes M, Mullen AM, Fenelon M, Tiwari B (2017) Future protein supply and demand: strategies and factors influencing a sustainable equilibrium. Foods 6(7):53 Kalidass C, Mohan VR (2012) Nutritional composition and Antinutritional factors of little-known species of Vigna. Trop Subtrop Agroecosyst 15:525–538 Kataki P, Deka SC, Kotoki D, Saikia S (2010) Effect of traditional methods of processing on the nutrient contents and some antinutritional factors in newly developed cultivars of green gram

References

127

(Vigna radiata. (L.) Wilezeh) and black gram (Vigna mungo (L.) Hepper) of Assam, India. Int Food Res J 17:377–384 Katoch R (2011) Morpho-physiological and nutritional characterization of ricebean (Vigna umbellata). Acta Agron Hung 59(2):109–120 Katoch R (2013a) Nutritional potential of rice bean (Vigna umbellata): an underutilized legume. J Food Sci 78:8–16 Katoch R (2013b) Nutritional evaluation, protein digestibility and profiling of different Vigna species. Ind J Agric Biochem 26:32–35 Kaur D, Kapoor AC (1990) Starch and protein digestibility of rice bean (Vigna umbellata): effects of domestic processing and cooking methods. Food Chem 38:263–272 Kaur D, Kapoor AC, (1992) Nutrient composition and antinutritional factors of rice bean (Vigna umbellata). Food Chem 43(2):119–124 Kaur A, Kaur P, Singh N, Singh Virdib A, Singh P, Chand RJ (2013) Grains, starch and protein characteristics of rice bean (Vigna umbellata) grown in Indian Himalaya regions. Food Res Int 54(1):102–110 Kutos T, Golob T, Kac K, Plestenjak A (2002) Dietary fiber of dry processed beans. Food Chem 80:231–235 Mal B, Joshi V (1991) In: Paroda RS, Arora RK (eds) Plant genetic resources conservation and management concepts and approaches. International Board for Plant Genetic Resources, Pusa, New Delhi Malhotra S, Malik D, Dhindsa KS (1988) Proximate composition and anti-nutritional factors in rice bean (Vigna umbellata). Plant Foods Hum Nutr 38:75–81 Mallillin AC, Trinidad TP, Raterta R, Dagbay K, Loyola AS (2008) Dietary fibre and fermentability characteristics of root crops and legumes. Br J Nutr 100:485–488 Marsosno Y, Wiyon P, Noor DZ (2002) Glycemic index of selected legume. J Tuknol Dan Indus Pangan 13:211–216 May JM, Cobb CE, Mendiratta S, Hill KE, Burk RF (1998) Reduction of the ascorbyl free radical to ascorbate by thioredoxin reductase. J Biol Chem 273:23039–23045 Meiners CR, Derise NL, Lau HC, Ritchey SJ, Murphy EW (1976) Proximate composition and yield of raw and cooked mature dry legumes. J Agric Food Chem 24(6):1122–1126 Mohan VR, Janardhanan K (1995) Chemical analysis and nutritional assessment of lesser known pulses of the genus Mucuna. Food Chem 52:v275–v280 Muhammad JK, Major E, Patton DW (2000) Evaluating the neck for percutaneous dilatational tracheostomy. J Craniomaxillofac Surg 28(6):336–342 Nwokolo E (1987) Nutritional evaluation of pigeon pea meal. Plant Foods Hum Nutr 37 (4):283–290 Osorio-Diaz P, Bello-Perez LA, Sayago-Ayerdi SG, Tovar J, Paredes-Lopez O (2003) Effect of processing and storage time on in vitro digestibility and resistant starch content of two bean (Phaseolus vulgaris) varieties. J Sci Food Agric 83:1283–1288 Parvathi S, Kumar VJF (2006) Value added products from rice bean (Vigna umbellata). J Food Sci Technol 43:190–191 Pattanayak A, Roy S, Sood S, Iangrai B, Banerjee A, Gupta S, Joshi DC (2019) Rice bean: a lesser known pulse with well-recognized potential. Planta 250(3):873–890. https://doi.org/10.1007/ s00425-019-03196-1 Pervaiz ZH, Turi NA, Khaliq I, Rabbani MA, Malik SA (2011) Methodology a modified method for high-quality DNA extraction for molecular analysis in cereal plants. Genet Mol Res 10 (3):1669–1673 Premakumari MN, Fathima A, Saraswathi G (1984) Dietary fiber content of some food materials. J Food Sci Technol 21:95–96 Raiger HL, Bhandari BC, Phogat BS (2010) Proceedings of annual report of all india coordinated research network on under-utilized crops, NBPGR, New Delhi. p 408 Rajyalakshmi P, Geervani P (1994) Nutritive value of the foods cultivated and consumed by the tribals of South India. Plant Foods Hum Nutr 46:53–61

128

8

Nutritional Potential of Rice Bean

Rao NBS, Deosthale YG, Pant KC (1989) Nutritive value of Indian foods Hyderabad. National Institute of Nutrition, Indian Council Medical Research, Secunderabad, p 47 Rockland LB, Radke TM (1981) Legume protein quality. Food Technol 28:79–82 Rodriguez MS, Mendoza EMT (1991) Nutritional assessment of seed proteins in rice bean [Vigna umbellata (thumb.) Ohwi and Ohashi]. Plant Foods Hum Nutr 41:1–9 Sadana B, Hira CK, Singla N, Grewal H (2006) Nutritional evaluation of rice bean (Vigna umbellata) strains. J Food Sci Tech 43:516–518 Saharan K, Khetarpaul N, Bishnoi S (2002) Variability in physico-chemical properties and nutrient composition of newly release rice bean and faba bean cultivars. J Food Comp Anal 15:159–167 Saharan K, Khetarpaul N, Bishnoi S (2004) Content and digestibility of carbohydrates of rice bean and fababean as affected by simple inexpensive processing methods. Nutr Food Sci 34:13–16 Sammour RH (1991) Using electrophoretic techniques in varietal identification, biosystematic analysis, phylogenetic relations and genetic resources management. J Islamic Acad Sci 4:221–226 Shah AA, Zeb A, Masood T (2011) Effects of sprouting time on biochemical and nutritional qualities of Mungbean varieties. Afr J Agric Res 6:5091–5098 Sharma BK, Das A, Banjarbarnah KM (2003) Underutilized life support crop species: production and research in North-Eastern hill region of India. NATP Household Food and Nutrition Security-Programme-I Shweta, Katoch R, Kumari M (2017) Proximate and anti-nutritional composition of underutilized and common Vigna species of Himachal Pradesh. Bull Env Pharmacol Life Sci 6:24–31 Siddhuraju P, Becker K, Makkar HPS (2000) Studies on the nutritional composition and antinutritional factors of three different germplasm seed materials of an underutilized tropical legume, Mucuna pruriens var. utilis. J Agric Food Chem 48:6048–6060 Singh SP, Mishra BK, Chandel KPS, Pant KC (1980) Major food constituents of rice bean (Vigna umbellata). J Food Sci Technol 17:238–240 Singh SP, Mishra BK, Sikka KC (1985) Studies on some nutritional aspects of rice bean (Vigna umbellata). J Food Sci Technol 22:80–185 Sritongtae B, Sangsukiam T, Morgan MRA, Duangmal K (2017) Effect of acid pretreatment and the germination period on the composition and antioxidant activity of rice bean (Vigna umbellata). Food Chem 227:280–288 Srivastava RP, Srivastava GK, Gupta RK (2001) Nutritional quality of rice bean (Vigna umbellata). Ind J Agric Biochem 14:55–56 Wollenberg P, Rummel W (1987) Dependence of intestinal iron absorption on the valency state of iron. Naunyn Schmiedeberg's Arch Pharmacol 336(5):78–582 Zia-Ul-Haq M, Iqbal S, Ahmad S, Imran M, Niaz A, Bhanger MI (2007) Nutritional and compositional study of Desi chickpea (Cicer arientinum L.) cultivars grown in Punjab, Pakistan. Food Chem 105:1357–1363

9

Incrimnating Factors in Rice Bean

Pulses are essential component in making the diets of human and animals nutritionally rich owing to their richness in protein and other macro and micronutrients. In developing/underdeveloped countries, pulses are consumed in combination with low-protein and high calorie foods. Despite having excellent nutritive value, the raw pulses contain non-nutritive compounds/anti-nutrients/incriminating factors/ aversive factors obstructing the routine utilization of pulses. These anti-nutritional factors are also known as “Secondary Metabolites” in plants and have also been shown to be posses beneficial therapeutic potential in their optimum concentration (Habtamu and Negussie 2014). At higher concentration, anti-nutrients reduce the bioavailability of valuable nutrients resulting in reduced metabolic activities and produce toxic effects. It is well established that the presence of anti-nutrients is just the result of normal metabolism in plants and other different mechanisms. According to the Deshpande (2002) anti-nutrients may occur naturally in plants as protecting agents analogous to protective functions of the components of immune system of animals. Broadly the anti-nutritional factors from legumes have been categorized into two groups i.e., Non-proteinaceous and proteinaceous. The non-proteinaceous group of anti-nutrients includes polyphenolic compounds, alkaloids, phytic acid and saponins and the latter group includes protease inhibitors, α-amylase inhibitors and lectins. These anti-nutrients can be further classified into different groups based on their different biological responses on their consumption. Using this criterion, different anti-nutritional factors have been classified into four under given subgroups. 1. Factors having reductive effects on digestion and mobilization of proteins in body e.g., protease inhibitors, tannins and saponins 2. Factors depressing the mineral utilization in body e.g., phytates 3. Factors associated with immuno-stimulatory effects e.g., lectins, antigenic proteins. 4. Factors with negative effect on digestion and utilization of carbohydrates in body e.g., polyphenolic compounds, α-amylase inhibitors # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_9

129

130

9 Incrimnating Factors in Rice Bean

As discussed in the previous chapter’s rice bean legume has excellent nutritional profile with comparatively high protein content, appreciable level of essential amino acids such as tryptophan and methionine, vitamins and minerals. Despite above merits the presence of some anti-nutritional factors limit the utilization of different nutrients in the body. However, negative effects of these compounds are manifested only after consuming the raw seeds. Most of the anti-nutritional components in rice bean are located in seed coat (Katoch 2011). Among other Vigna species rice bean still has modest level of different anti-nutrients (Del Rosario et al. 1980). Our study on the different anti-nutrients in five important Vigna legumes viz., Vigna umbellata (rice bean), Vigna unguiculata (cowpea), Vigna radiata (green gram), Vigna mungo (black gram) and Vigna angularis (adzuki bean) comparatively has revealed balance among nutritional and anti-nutritional constituents in rice bean.

9.1

Incriminating Factors of Non-Protein Origin in Rice Bean Seeds

9.1.1

Polyphenolic Compounds

Polyphenolic compounds inhibit the action of different digestive enzymes such as α-amylase, trypsin, chymotrypsin and lipase (Rao and Deosthale 1982). Among the polyphenolic compounds, tannins constitute an important group of polyphenolic compounds and considered as anti-nutrients as they precipitate proteins and make complex bonds with starch, cellulose and minerals. In legumes, tannins have been classified into two groups: 1. Tannic acid type (Hydrolyzable tannins) 2. Catechin type (Condensed tannins and proanthocyanidins) The hydroxyl groups of tannins are partially or totally esterified with gallic acid or its derivatives. Hydrolyzable tannins are easily broken down by weak acids, bases or enzymes and the degradation products of hydrolyzable tannins are toxic in nature and can cause poisoning in organisms. In contrast, non-hydrolyzable tannins are derivatives of flavonoids which is an important group of secondary metabolites with characteristic carbon skeleton (C6-C3-C6) without sugar units (Fig. 9.1). The high level of condensed tannins decreases the absorption of methionine and lysine amino acids. The decreased availability of methionine amino acid could increase the toxicity of other plant compounds such as cyanogenic glycosides, as methionine is essential for the cyanide metabolism in liver. Tannins also make complexes with enzymes and non-enzymatic proteins and these complexes are reported to be responsible for low digestibility of proteins, decreased amino acid availability and increased excretion of nitrogen. In vitro and in vivo digestibility assays have revealed the protein indigestibility either by inactivating digestive enzymes or by reducing the susceptibility of proteins to be digested after the formation of complexes with tannins.

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds

131

Fig. 9.1 Structure of hydrolysable and condensed tannins

Besides proteins, tannins also form complexes with carbohydrates as well as with mineral ions like iron. The greater tendency of tannins to form complexes with proteins rather than carbohydrates is attributed to the involvement of carboxyl oxygen of the peptide group in hydrogen bonding with hydroxyl group in the structure of tannins. One tannin molecules binds two or more carboxyl oxygen of the peptide group forming cross-linking between the protein chains (Reddy et al. 1985). The presence of tannins in foods also affects the availability of some of the essential vitamins such as vitamin A and vitamin B12 (Wang et al. 2000). In leguminous seeds, the higher concentration of the tannins has been estimated mainly in the seed coat or testa of dark colored seeds. Kaur and Kapoor (1992) reported that rice bean varieties (RB-32, RB-40 and RB-53) having dark seed coat has higher concentration of polyphenols than light coloured varieties (RB-4 and RB-27).

9.1.1.1 Variation in Phenolic Content of Group-1 Rice Bean Genotypes The anti nutrients levels were studied in all the three groups (G-1, G-2 and G-3) of rice bean. The total phenolic content in 30 diverse rice bean genotypes (mentioned as Group-I) revealed variation from 0.57% (JCR-76) to 0.80% (IC-137189) (Table 9.1). Genotypes JCR-76 (0.57%), IC-137200 (0.60%), and IC-016771 (0.61%) have low level of total phenolic content as compared to check (0.73%). The simple phenolic content varied from 0.34% (EC-48223-B) to 0.59% (IC-137191). Genotypes IC-137191 (0.59%), IC-137195 (0.56%) and Panchrukhi (0.54%) had highest simple phenolic content, whereas the genotypes EC-48223-B (0.34%), JCR-12 (0.38%) and IC-016789 (0.40%) had lower values. The total tannin content in the rice bean seeds varied from 0.30% to 0.49%, with minimum and maximum values in genotype IC-137191 and Panchrukhi, respectively. The check (Baroi) had a total tannin content of 0.36%. Genotypes IC-140802 and Panchrukhi revealed significantly higher values of total tannin content. The condensed tannin content which generally varies with the seed coat color ranged

132

9 Incrimnating Factors in Rice Bean

Table 9.1 Variation in phenolic content in different rice bean genotypes

Genotype IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223-B JCR-12 JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Check (Baroi) SE CD (5%)

Total phenols (%) 0.76 0.73 0.75 0.80 0.68 0.75 0.61 0.63 0.66 0.60 0.65 0.69 0.68 0.68 0.73 0.72 0.68 0.69 0.61 0.65 0.71 0.70 0.73 0.66 0.72 0.63 0.57 0.61 0.70 0.73 0.05 NS

Simple phenols (%) 0.47 0.45 0.41 0.43 0.43 0.59 0.49 0.56 0.47 0.53 0.50 0.43 0.50 0.53 0.42 0.48 0.42 0.47 0.44 0.40 0.41 0.41 0.34 0.38 0.43 0.46 0.46 0.51 0.54 0.46 0.05 NS

Total tannins (%) 0.35 0.30 0.32 0.35 0.31 0.27 0.27 0.38 0.36 0.38 0.31 0.38 0.42 0.47 0.39 0.37 0.40 0.42 0.33 0.32 0.41 0.42 0.37 0.31 0.35 0.34 0.29 0.38 0.49 0.36 0.04 0.107

Condensed tannins (%) 0.20 0.03 0.03 0.03 0.04 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.10 0.03 0.05 0.03 0.10 0.05 0.03 0.03 0.04 0.01

Hydrolysable tannins (%) 0.30 0.30 0.30 0.32 0.27 0.30 0.24 0.35 0.33 0.35 0.30 0.35 0.39 0.44 0.36 0.34 0.37 0.39 0.30 0.29 0.38 0.38 0.26 0.28 0.30 0.31 0.27 0.33 0.46 0.34 0.04 0.10

from 0.03% (IC-140804) to 0.20% (IC-137186). The mean values of hydrolysable tannins varied from 0.24% (IC-137194) to 0.46% (Panchrukhi). Genotypes IC-140802 (0.44%) and Panchrukhi (0.46%) has significantly higher values of hydrolysable tannins, while genotypes IC-137194 (0.24%), EC-48223-B (0.26%) and JCR-76 (0.27%) has comparatively low level of hydrolysable tannins. The cumulative grading of different rice bean genotypes revealed that genotype IC-137194, JCR-12 and JCR-76 has lesser amount of polyphenolic content.

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds

133

Rice bean genotypes of LRB series (G-2) has phenolic content ranging from 1.72% (LRB-140) to 2.90% (LRB-126) (Table 9.2). Genotype LRB-1 (2.82%), LRB-40-1 (2.79%), LRB-45 (2.54%) and LRB-40-2 (2.52%) had comparatively high levels of total phenolic content. The simple phenolic content in these rice bean genotypes ranged from 0.41% to 1.13%. Genotypes LRB-45 (1.13%) followed by LRB-1 (1.09%) and LRB-40-1 (1.06%) had comparatively higher simple phenolic content, whereas LRB-127 (0.41%), LRB-128 (0.47%) and LRB-126 (0.69%) had lower levels of phenolics. Total tannin content in these rice bean genotypes varied from 1.08% to 2.21%. The highest and lowest tannin content was observed in genotypes LRB-126 and LRB-140, respectively. The level of condensed tannin content varied from 0.60% (LRB-168) to 0.82% (LRB-45). Genotypes LRB-140 (0.61%), LRB-128 (0.64%) and LRB-140 (0.69%) had lowest level of condensed tannins (Table 9.3). Hydrolysable tannins varied from 0.01% (LRB-164) to LRB-128 (1.36%). The genotypes LRB-168 (0.07%) followed by Baroi (0.28%) and LRB-45 were low in hydrolysable tannins. In totality genotypes, LRB-140, LRB-135 and LRB-141 had lower levels of polyphenols (Table 9.4). Rice bean genotypes of JCR series (G-3) had phenolic content ranging from 2.69% to 3.59% where highest and lowest total phenolic content was observed for the genotypes JCR-152 and JCR-20, respectively (Table 9.5). Genotypes JCR-162 (3.33%), JCR-179 (3.29%), and JCR-171 (3.28%) had higher levels of total phenols, whereas the genotypes JCR-20 (2.69%) and Baroi (2.72%) were lower in total phenolics. The simple phenolics in rice bean seeds ranged from 0.74% (Baroi) to 1.34% (JCR-93). Genotypes JCR-81 (1.29%) followed by JCR-54 (1.12%) and JCR-152 (1.10%) has higher level of simple phenolics. Genotypes JCR-162 (0.75%) and JCR-163 (0.76%) were observed with low levels of simple phenols. Total tannins were in higher proportion in genotype JCR-81 (2.98%) followed by JCR-107 (2.45%), JCR-152 (2.36%), Panchrukhi (2.29%) and JCR-162 (2.19%). Genotypes JCR-20 (1.67%) followed by JCR-54 (1.67%), JCR-149 (1.86%) and JCR-79 (1.88%) were low in total tannins. The condensed tannin content varied from 0.51% (Panchruki) to 0.81% (JCR-79). The genotypes JCR-79 (0.81%), JCR-107 (0.80%), and JCR-171 (0.78%) had highest level of condensed tannins. The mean values of hydrolysable tannins in these genotypes varied from 1.11% to 1.95%. Genotypes JCR-152 (1.95%) followed by JCR-178 (1.83%) JCR-149 (1.82%), JCR-162 (1.82%) and JCR-107 (1.66%) has low levels of hydrolysable tannin. The least polyphenolic content was in genotypes JCR-20, Panchrukhi and JCR-54 (Table 9.6).

9.1.2

Saponins

Saponins are heterogeneous group of foam producing steroidal glycosides with a polycyclic non-polar aglycone (sapogenin) attached through an ether bond to a sugar side chain. This combination of polar and non-polar components in their structure is

Genotype IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223-B JCR-12 JCR-32

Total phenolics (%) 14 12 13 15 7 13 3 4 6 2 5 8 7 7 12 11 7 8 3 5 10 9 12 6 11

Simple phenolics (%) 9 7 3 5 5 17 11 16 9 14 12 5 12 14 4 10 4 9 6 2 3 3 1 2 5

Total tannins (%) 8 3 5 8 4 1 1 11 9 11 4 11 15 16 12 10 13 15 6 5 14 15 10 4 8

Condensed tannins (%) 4 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 4 1 2

Table 9.2 Genotypic grading of rice bean genotypes (Group-I) based on phenolic content Hydrolysable tannins (%) 6 6 6 8 3 6 1 10 9 10 6 10 14 15 11 8 12 1 6 6 13 13 2 4 6 Total 41 29 28 37 19 38 17 42 34 38 28 35 49 53 40 40 37 34 22 19 41 41 29 17 32

Rank 11 5 4 8 2 9 1 12 7 9 4 7 13 14 10 10 8 7 2 2 11 11 5 1 6

134 9 Incrimnating Factors in Rice Bean

JCR-52 JCR-76 Dhagwar Panchrukhi Check

4 1 3 9 12

8 8 13 15 8

7 2 11 17 9

1 4 2 1 1

7 3 9 16 8

27 17 38 58 38

3 1 9 15 9

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds 135

136

9 Incrimnating Factors in Rice Bean

Table 9.3 Variation in phenolic content in rice bean genotypes of LRB series Genotype

LRB-1 LRB-401 LRB-402 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Baroi (Check) CD (5%) SE (m)

Total phenols (%) 2.82 2.79

Simple phenols (%)

Total tannins (%)

Condensed tannins (%)

Hydrolysable tannins (%)

1.09 1.06

1.72 1.73

0.74 0.69

0.98 1.03

2.52

0.88

1.62

0.65

0.97

2.54 2.90 2.38 2.48 2.08 1.87 1.72 2.04 2.19 2.35 2.57 2.50 2.14 2.07

1.13 0.69 0.41 0.47 0.73 0.54 0.64 0.81 0.72 0.84 0.79 0.82 0.76 0.99

1.40 2.21 1.84 2.00 1.34 1.33 1.08 1.21 1.47 1.23 1.77 1.68 1.45 1.08

0.82 0.81 0.73 0.64 0.72 0.63 0.61 0.71 0.71 0.66 0.81 0.60 0.77 0.79

0.57 1.39 1.10 1.36 0.62 0.79 0.45 0.37 0.81 1.09 0.01 0.07 0.62 0.28

5.87 0.08

18.79 0.08

9.48 0.08

4.85 0.02

19.3 0.09

responsible for their soap-like behavior in aqueous solutions. The anti-nutritional nature of saponins is mainly due to their intra-lumenal physico-chemical interactions. Saponins form insoluble complexes with 3-β-hydroxysteroids and are known to form large, mixed micelles with bile acids and cholesterol which reduce their proper absorption in body (Messina 1999). These are bitter in taste and causes erythrolysis, reducing of blood and liver cholesterol level, growth rate depression, and inhibiting the activity of smooth muscles (Messina 1999) (Fig. 9.2). The saponin content in different rice bean genotypes ranged from 1.20 mg/100 g (IC-137194) to 3.10 mg/100 g (IC-019352) (Table 9.7). The low saponin content was recorded in genotypes IC-137195 (1.30 mg/100 g), LRB-40-2 (1.30 mg/100 g) and LRB-134 (1.40 mg/100 g). Genotypes with higher value of saponin content were EC-48223-B (2.70 mg/100 g), IC-140795 (2.70 mg/100 g), JCR-163 (2.50 mg/ 100 g) and JCR-178 (2.40 mg/100 g) (Table 9.7). Genotypes IC-140795, EC-48223-B and JCR-163 were having higher saponin content as compared to the other genotypes. Saponin reduces the nutrient bioavailability and enzyme activity which ultimately result in growth-retarding effect in animals.

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds

137

Table 9.4 Genotypic grading of rice bean genotypes (Group-II) based on phenolic content

Genotype LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Check Baroi

Total phenols (%) 16 15 12 13 17 9 10 5 2 1 3 7 8 14 11 6 4

Simple phenols (%) 16 15 13 17 5 1 2 7 3 4 10 6 12 9 11 8 14

Total tannins (%) 11 12 9 6 16 14 15 5 4 1 2 8 3 13 10 7 1

Condensed tannins (%) 11 7 5 15 14 10 4 9 3 2 8 8 6 14 1 12 13

Hydrolysable tannins (%) 11 12 10 6 16 14 15 7 8 5 4 9 13 1 2 7 3

Total 65 61 49 57 68 48 46 33 20 13 27 38 42 51 35 40 35

Rank 15 14 11 13 16 10 9 4 2 1 3 7 8 12 5 6 5

Table 9.5 Variation in phenolic content in rice bean genotypes of JCR series

Genotype JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Check (Panchrukhi) CD (5%) SE (m)

Total phenols (%) 2.69 3.17 3.18 3.10 3.12 3.45 3.23 3.59 3.33 3.09 3.28 3.29 2.72

Simple phenols (%) 0.80 1.12 1.01 1.29 1.34 0.97 0.86 1.10 0.75 0.76 0.81 0.79 0.74

Total tannins (%) 1.67 1.67 1.89 2.98 2.13 2.45 1.86 2.36 2.19 1.92 2.01 1.90 2.29

Condensed tannins (%) 0.76 0.78 0.81 0.72 0.66 0.80 0.53 0.54 0.75 0.73 0.78 0.65 0.51

Hydrolysable tannins (%) 1.12 1.13 1.35 1.11 1.11 1.66 1.82 1.95 1.82 1.59 1.71 1.83 1.45

4.22 0.07

12.8 1.73

3.92 0.04

3.18 0.01

10.19 0.08

Genotype JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Panchrukhi (check)

Total phenols (%) 1 6 7 4 5 12 8 13 11 3 9 10 2

Simple phenols (%) 5 1 9 11 12 8 7 10 2 3 6 4 1

Total tannins (%) 1 1 3 12 7 11 2 10 8 5 6 4 9

Condensed tannins (%) 9 10 12 6 5 11 2 3 8 7 10 4 1

Table 9.6 Genotypic grading of rice bean genotypes (Group-III) based on phenolic content Hydrolysable tannins (%) 2 3 4 1 1 7 9 11 9 6 8 10 5

Total 18 21 35 34 30 49 28 47 38 24 39 32 18

Rank 1 2 7 7 5 11 4 10 8 3 9 6 1

138 9 Incrimnating Factors in Rice Bean

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds

139

Fig. 9.2 Structure of saponins

Table 9.7 Variation in total saponin content in rice bean genotypes

9.1.3

Genotype JCR-20 JCR-152 JCR-178 JCR-163 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B LRB-134 LRB-164 LRB-168 LRB-40-2 BRS-2 GM CV CD at 5% SE (m) 

Saponin content (mg/100 g) 1.70 1.90 2.40 2.50 2.00 2.70 2.30 1.30 1.20 3.10 2.70 1.40 1.30 2.20 1.30 1.30 1.95 14.48 0.47 0.16

Phytic Acid Content

Phytic acid (PA) is a characteristic and abundant constituent of legume seeds. Phytic acid [PA, myo-inositol-(1, 2, 3, 4, 5, 6) hexakis-phosphate, IP6] serve as principal storage form of phosphorus and is accumulated as part of globoid crystals in membrane-bound protein bodies of certain cell types within the developing seed, such as within protein bodies occurring in aleurone layer of cereal grains. It accumulates during seed development until the seed reaches maturity and accounts for about 60–70% of total phosphorus content, although it is not bioavailable for humans due to the absence of phytase enzyme in gastrointestinal tract. In human gut, phytic acid lowers the bioavailability of minerals and limits the digestibility of proteins and starch by inhibiting proteases and amylases. Specifically, it is known

140

9 Incrimnating Factors in Rice Bean

Fig. 9.3 Phytic acid

to form complexes with the dietary essential minerals calcium, zinc, iron and magnesium, making them unavailable for absorption. Phytic acid has six reactive phosphates which meet the criterion of chelating agent. Cations linked with PA are not available and disturb the various metabolic processes which require the presence of specific microelements. It can also chelate niacin, potentially contributing to the pellagra diseases. Furthermore, phytic acid associated with hard to cook defects in beans (Fig. 9.3). The reduced bioavailability of minerals depends on several factors, including the level of minerals and phytic acid in foodstuffs, the ability of endogenous carriers in intestinal mucosa to absorb essential minerals bound to phytate and other dietary substance. Phytic acid is known to be involved in undesirable processes including those leading to hard cook phenomena of leguminous seeds. The phytic acid content in different rice bean genotypes ranged from 6.40 mg/gm in JCR-20 to 8.40 mg/gm in IC-140795 (Table 9.8). Low phytate content was observed in genotypes IC-137195 (6.50 mg/gm), IC-140802 (6.80 mg/gm) and LRB-134 (6.90 mg/gm). Other rice bean genotypes with higher phytic acid content were LRB-40-2 (7.50 mg/gm), IC-140796 (7.50 mg/gm), JCR-152 (7.40 mg/gm) and BRS-2 (7.30 mg/gm). Among the evaluated rice bean genotypes, three genotypes viz., IC-140795, LRB-40-2 and IC-140796) were having higher phytic acid content, whereas genotyoes JCR-20 and IC-137195 were with significantly low phytic acid content as compared to other genotypes. In rice bean, the phytic acid content was lower as compared with Vigna mungo, Dolichos lablab var. vulgaris, Mucuna pruriens var. utilis, and Mucuna atropurpurea (Kataria et al. 1988; Vijayakumari et al. 1995; Janardhanan et al. 2003; Kamatchi et al. 2010).

9.1.4

Flatulence Factors in Ricebean

Flatulence factors are the oligosaccharides with low molecular weight, non-reducing and water soluble sugars which constitute approximately 53% of the total soluble sugars. The oligosaccharides e.g., raffinose, stachyose verbascose) are

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds Table 9.8 Variation in phytic acid content in rice bean genotypes

Genotypes JCR-20 JCR-152 JCR-178 JCR-163 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B LRB-134 LRB-164 LRB-168 LRB-40-2 BRS-2 GM CV CD at 5% SE (m) 

141

Phytic acid (mg/gm) 6.40 7.40 7.00 7.20 6.80 8.40 7.50 6.50 7.20 7.00 7.00 6.90 7.30 7.00 7.50 7.30 7.06 2.60 0.31 0.11

Fig. 9.4 Common oligosaccharides in legumes

non-digestible carbohydrates causing flatulence due to fermentation of undigested carbohydrates by ruminal microbes (Salunkhe and Kadam 1989). Raffinose Family Oligosaccharides (RFOs) are α-(1-6)-linked galactosides and raffinose is the representative of this group. The other structural homologues of raffinose are stachyose (Tetrasaccharide), verbascose (Pentasaccharide). Raffinose is a trisaccharide containing galactose linked by α-(1–6) bond to glucose unit of sucrose. Stachyose is a tetrasaccharide containing a galactose linked by α-(1–6) to the terminal glucose of raffinose. Most of the legumes generally contain up to 50 mg/g of total oligosaccharides (Fig. 9.4).

142

9 Incrimnating Factors in Rice Bean

Oligosaccharides

Gastro-intestinal microflora

Bacteroides spp. Clostridium spp. Coprococcus spp. Escherichia spp. Fusobacterium spp. Megaspaera spp. Mitsuokella spp. Ruminococcus spp. Veillonella spp.

Final products: Gases, Traces of organic acids

Bifidobacterium spp. Lactobacillus acidophilus Bacillus spp.

Final products: Organic acids

Fig. 9.5 The overview of oligosaccharide metabolism in gastro-intestinal tract

Due to the absence of α-galactosidase and invertase enzymes in gastrointestinal tract, oligosaccharides undergo anaerobic fermentation by ruminal microflora forming large amounts of carbon dioxide, hydrogen and methane. These gases cause bloating and gastric discomfort and are removed from the body as flatulence. The presence of highly odoriferous compounds, like skatole and indole, hydrogen sulphide, volatile amines and short chain fatty acids is responsible for the characteristic odor. Conversely, these flatulence causing oligosaccharides are the sources of non-digestible carbohydrates, which promote several beneficial physiological effects and stimulate the growth of Bifidobacteria spp. and Lactobacilli (Prebiotics) in GI tract. The stimulating effect of these compounds on Bifidobacteria growth and/or activity is accompanied with changes in quantitative and qualitative microbial composition leading to a number of beneficial metabolic changes in colon (Gupta and Abu-Ghannam 2012). The oligosaccharides are a source of carbon and energy, which activate genes involved in sucrose utilization by Bifidobacteria, inducing multiplication and processes of sugar fermentation (Trafalska and Grzybowski 2006). In addition to this scientific evidence supports a relationship between the prebiotic activity of RFO’s and other beneficial physiological effects (Wang et al. 2008) (Fig. 9.5). Special concern for flatulence-producing substances is important since the presence of substances restricts the use of pulses (Smily 1997). The biosynthesis of flatulence factors in legumes starts with the seed development and their highest concentrations are present in mature seeds. Seeds of rice bean contain diverse saccharides however low in flatulence producing oligosaccharides as compared to

9.1 Incriminating Factors of Non-Protein Origin in Rice Bean Seeds

143

other pulses (Rejaul and Wadikar 2019). The oligosaccharides content in different ricebean genotypes has been discussed below

9.1.4.1 Raffinose Content in Rice Bean The mean value of total raffinose content in different rice bean genotypes varied from 2.06 g/100 g (JCR-152) to 2.91 g/100 g (EC-48223-B). The genotypes with higher value of raffinose content were JCR-163 (2.84 g/100 g) and IC-140802 (2.78 g/100 g). The lower levels of raffinose were observed in genotypes JCR-178 (2.24 g/100 g), IC-140796 (2.25 g/100 g) and LRB-134 (2.34 g/100 g). Three rice bean genotypes (EC-48223-B, JCR-163 and IC-140802) were with higher raffinose content, whereas, genotypes JCR-152 and IC-137194 were lower in raffinose content as compared to rest of the genotypes (Table 9.9). 9.1.4.2 Stachyose Content in Rice Bean The stachyose content in different rice bean genotypes was in the range of 0.73 g/ 100 g in IC-019352 to 1.64 g/100 g in JCR-152. Genotypes IC-140802 (1.61 g/ 100 g), JCR-163 (1.49 g/100 g) and BRS-2 (1.46 g/100 g) have higher value of stachyose content, whereas lower value of stachyose content was observed in genotypes LRB-40-2 (0.79 g/100 g), IC-137194 (0.86 g/100 g) and IC-140795 Table 9.9 Variation in raffinose, stachyose and verbascose content in rice bean Genotype JCR-20 JCR-152 JCR-178 JCR-163 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B LRB-134 LRB-164 LRB-168 LRB-40-2 BRS-2 GM CV CD at 5% SE (m) 

Raffinose (g/100 g) 2.62 2.06 2.24 2.84 2.78 2.72 2.25 2.41 2.06 2.56 2.91 2.34 2.66 2.41 2.78 2.37 2.50 6.62 0.27 0.09

Source: Katoch (2013)

Stachyose (g/100 g) 1.42 1.64 1.23 1.49 1.61 0.98 1.11 1.36 0.86 0.73 1.42 1.30 1.08 1.31 0.79 1.46 1.24 1.30 0.03 0.01

Verbascose (g/100 g) 3.23 3.07 2.78 3.30 3.14 2.74 3.30 3.17 3.33 3.04 3.46 2.78 3.49 2.65 3.36 2.81 3.10 0.47 0.02 0.01

144

9 Incrimnating Factors in Rice Bean

(0.98 g/100 g) (Table 9.9). Genotypes JCR-152, IC-140802 and JCR-163 were having higher stachyose content as compared to other rice bean genotypes.

9.1.4.3 Verbascose Content in Rice Bean The verbascose content in rice bean genotypes varied from 2.65 g/100 g in LRB-168 to 3.49 g/100 g in LRB-164. Genotypes EC-48223-B (3.46 g/100 g), LRB-402 (3.36 g/100 g) and IC-137194 (3.33 g/100 g) were having higher verbascose content. Genotypes with low verbascose content were IC-140795 (2.74 g/100 g), LRB-134 (2.78 g/100 g) and JCR-178 (2.78 g/100 g) (Table 9.10). Among sixteen rice bean genotypes evaluated, the three genotypes (LRB-164, LRB-40-2 and EC-48223-B) were with significantly higher value of verbascose content, whereas genotypes LRB-168 and IC-140795 have low verbascose content. Different studies have been conducted for assessing the level of oligosaccharides in rice bean seeds. Singh et al. (1980) observed variation in raffinose, stachyose, and verbascose content from 0.30% to 2.58%, 0.37% to 1.98% and 0.45% to 2.58%, respectively in rice bean seeds. Shweta Katoch and Kumari (2017) observed 0.84%, 1.14% and 2.05% raffinose, stachyose, and verbascose content, respectively in rice bean seeds. Kaur and Kawatra (2000) estimated raffinose and stachyose content in rice bean (RBL-6) and observed 1.48% raffinose and 3.29% stachyose in raw seeds. Malhotra et al. (1988) estimated raffinose, stachyose, verbascose content in 14 ricebean varieties in the range of 320 mg/100 g to 910 mg/100 g, 950 mg/ 100 g to 1980 mg/100 g, 1400 mg/100 g to 1880 mg/100 g, respectively. Girigowda et al. (2006) studied ajugose content in 12 cultivars of black gram and reported 830 mg/100 g to 1650 mg/100 g. Bhagyawant et al. (2019) reported raffinose, stachyose and verbascose content in different rice bean genotypes ranging from 11.35 mg/g to 23.53 mg/g (mean value of 19.04 mg/g) 4.74 mg/g to 30.51 mg/g (mean value of 13.05 mg/g) and 2.76 mg/g to 23.39 mg/g (mean value of 9.48 mg/g), respectively.

Table 9.10 Oxalate content in different rice bean genotypes

Genotypes JRC-08-7 JRC-08-8 JRC-08-10 JRC-08-12 JRC-08-15 JRC-08-16 JRC-08-32 JRC-13-11 JRC-13-13 JRC-50 Nagadal Source: Bepary et al. (2017)

Oxalate content (mg/100 g) 34.12 29.80 34.24 30.79 32.97 33.36 27.28 30.33 26.14 33.18 23.17

9.2 Incriminating Factors of Protein Origin

145

Despite of anti nutritive value, different reports have indicated the anticardiovascular, anti-carcinogenic and anti-diabetic activity of oligosaccharides from legumes (Masao 2002; Tajoddin et al. 2012).

9.1.5

Oxalates

Oxalic acid binds strongly to divalent cations like calcium, magnesium and form water soluble salts. The higher intakes of oxalates rich food lead to lowering of absorption of calcium (Noonan and Savage 1999). The deposition of insoluble oxalate salts particularly calcium oxalate results in crystal nephropathies. In the patients suffering from kidney ailment should not exceed the intake of oxalate 50–60 mg/day (Massey et al. 2001). Oxalate binds with nutrients and rendering them inaccessible to body (Noonan and Savage 1999). The formation of calcium oxalate crystal leads to disturbed Ca: P ratio in body and results in increased mobilization of minerals from bones to recover from hypocalcemic conditions. The excessive mobilization of calcium and phosphorus from bone causes secondary hyperparathyroidism or osteodystrophy fibrosa (Noonan and Savage 1999). Bepary et al. (2017) evaluated oxalate content in 10 rice bean genotypes ranging from 23.17 mg/100 g to 34.12 mg/100 g, among which genotypes JRC-08-32, JRC-13-13 and Nagadal were with low oxalate (23.17 mg/100 g to 27.28 mg/100 g) (Table 9.10). The oxalate content of rice bean was comparable to other bean like adzuki bean, black gram. The oxalate content of adzuki bean (Vigna angularis) was reported 25 mg/100 g and that of black gram as 30 mg/100 g (Campos-Vega et al. 2010; Chai and Liebman 2005). The oxalic acid content in bean seeds could be managed by different processing methods before consumption.

9.2

Incriminating Factors of Protein Origin

9.2.1

Digestive Enzyme Inhibitors

9.2.1.1 Protease Inhibitors The inhibitors of digestive enzymes have been reported from various pulses. These inhibitors are low molecular weight compounds which form stable complexes with digestive enzymes and irreversibly inhibit their activity. The serine protease inhibitors (Trypsin and chymotrypsin inhibitor) are extensively studied inhibitors because of their importance in human and animal nutrition. Serine protease inhibitors belong to two different families, referred to as Kunitz and Bowman-birk type inhibitors. The presence of protease inhibitors in food decreases the apparent nutritional quality of proteins by affecting the ability of digestive enzymes to degrade proteins and therefore limit the availability of essential amino acids. Protease inhibitor could also lead to pancreatitis and a reduction in the apparent availability of sulphur amino acids.

146

9 Incrimnating Factors in Rice Bean

Table 9.11 Trypsin inhibitor content in different ricebean genotypes Genotypes JCR-152 JCR-178 JCR-163 JCR-20 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B BRS-2 LRB-134 LRB-164 LRB-168 LRB-40-2

% inhibition 40.80 44.63 46.76 40.30 45.54 48.33 47.16 44.39 52.73 38.57 51.58 56.10 51.06 45.22 42.76 43.90

TI content (mg/g) 28.47 30.25 31.09 24.07 30.43 32.67 30.12 30.61 34.90 24.55 34.16 37.23 33.94 28.98 26.13 27.93

Total protein content (%) 10.37 11.53 10.64 9.96 10.90 11.08 10.52 10.20 10.99 10.66 10.58 10.18 10.96 10.38 10.81 10.33

Source: Katoch (2013)

Malhotra et al. (1988) observed trypsin inhibitor activity (TIA) to be between 113 and 164 units per gram in 13 rice bean genotypes. Kaur and Kapoor (1992) measured trypsin inhibitor activity between 35 and 49 units per gram in five rice bean varieties. Saikia et al. (1999) noted higher TIA in raw seeds and observed that they are largely destroyed by cooking and does not pose a problem in human consumption if beans are properly processed. Katoch (2013) reported that trypsin inhibitor content in rice bean ranges from 24.07 to 37.23 mg/g with lowest value in JCR-20 (24.07 mg/g). The levels of trypsin inhibitor were estimated in the different genotypes so as to screen out those having lower levels of this inhibitor. The isolation and purification of the inhibitor was also carried out from the genotypes having the highest level of the inhibitor. The highest trypsin inhibitor content was observed in genotypes BRS-2(37.23 mg/g) followed by IC-137194 (34.90 mg/g), EC-48223B (34.16 mg/g), LRB-134 (33.94 mg/g) and IC-140795 (32.67 mg/g) (Table 9.11). Generally, legume seeds contain considerable levels of trypsin inhibitors, but variations in their content have been observed during different growth stages in different plant parts. For the first time, Katoch et al. (2015) studied the spatio-temporal variations in trypsin inhibitor content in rice bean. The study showed highest level of trypsin inhibitor content in mature seeds (30.90 mg/g). Different studies have shown variation in TIA (trypsin inhibitory activity) of different rice bean genotypes from 47.37 TIU/g to 163.98 TIU/g (Rejaul et al. 2016; Rejaul et al. 2017).

9.2 Incriminating Factors of Protein Origin

147

9.2.1.2 a-Amylases Inhibitors α-amylases are most abundant hydrolytic enzymes found in microorganisms, animals and plants which catalyze the hydrolysis of glycosidic linkage in sugar polymers which is an important step towards converting complex sugar polymers into simpler units which can be easily assimilated in the body. The end products of the action of α-amylases are D-glucose and D-maltose together with a series of α-limit dextrins. The dextrins are oligosaccharides of four or more residues that contain α (1–>6) glucosidic linkages constituting the branch points sugars. The α-amylase inhibitors, also known as starch blockers, the compounds which suppress carbohydrate absorption through inhibiting the activity of α-amylases thereby reducing the apparent digestibility and utilization of dietary starch. Although, α-amylase inhibitors have been identified in different sources but the higher amount have been reported from legumes. Pusztai et al. studied the effect of Kidney bean α-amylase inhibitor on rats fed with different dietary concentrations and reported that the inhibition of starch digestion resulted reduction in body weight of rats. The α-amylase inhibitor content in different rice bean genotypes varied from JCR-163(1473 units/g) to LRB-168(3177 units/g). The genotypes JCR-178 (3051 units/g), JCR-20 (2556 units/g) and BRS-2 (2430 units/g) were with high α-amylase inhibitor content. Low value of α-amylase inhibitor content was observed in genotypes IC-140796 (1742 units/g), LRB-40-2 (1566 units/g) and IC-137195 (1566 units/g). Genotypes LRB-168, JCR-178 and JCR-20 were having higher α-amylase inhibitor content over rest of the genotypes (Fig. 9.6).

Alpha-amylase inhibitory units/g 3500.0 3000.0

(Units/g)

2500.0 2000.0 1500.0 1000.0

Genotypes

Fig. 9.6 α-amylase inhibitor content in different rice bean genotypes

BRS-2

LRB-40-2

LRB-168

LRB-164

LRB-134

EC-48223-B

IC-019352

IC-137194

IC-137195

IC-140796

IC-140795

IC-140802

JCR-163

JCR-178

JCR-152

0.0

JCR-20

500.0

148

9.2.2

9 Incrimnating Factors in Rice Bean

Hemagglutinins

Hemagglutinins are glycoproteins which also referred as phytoagglutinins or lectins. Lectins exhibits reversible binding to specific carbohydrate moieties on the surface of erythrocytes and agglutinate them, without altering the structure of surface carbohydrates. This binding of lectin is one of the easiest ways of detecting lectins in biological sources. Further, the inhibition of agglutination with sugars is useful for specifying the carbohydrate properties of lectin (Fig. 9.7) (Paiva et al. 2012). Although lectin have been identified from varied source but the higher amount of lectins have been found in leguminous crops particularly in their seeds where they constitute a major fraction of storage protein. Sometimes they become dominant in the seeds and constitute 50% of the total proteins in seeds. Legume lectins are relatively stable proteins that may remain intact after heat denaturation and proteolytic digestion. As legume lectins are not degraded during their passage through the digestive tract they are able to bind the sugar branches on the epithelial cells. This binding of legume lectins to cell surface proteins is central to its toxic effects of disrupting barrier function as shown by a loss of epithelial resistance, reducing brush border enzyme activity and distorting villous architecture. These effects are responsible for acute gastrointestinal symptoms similar to those triggered by an infectious gastroenteritis and other food poisoning and may lead to indigestion, malabsorption, loss of appetite and weight loss in humans and animals. In morphologic studies using electron microscopy, Banwell et al. (2007) reported small intestinal bacterial overgrowth in rats exposed to a diet rich in legume lectins. By binding to sugars expressed both on microbes and the intestinal surface, lectins are thought to enhance bacterial adherence to the intestinal epithelium leading to bacterial overgrowth. Such combined effects of legume lectins in disrupting barrier function and inducing bacterial overgrowth may lead to bacterial translocation as a further toxic complication. Lectins from rice bean have specificity towards human erythrocytes of blood group A and B (Datta et al. 1988). The study conducted in our laboratory also

Fig. 9.7 (a) Erythrocyte network promoted by lectin binding to surface carbohydrate and (b) inhibition of hemagglutinating activity by free carbohydrate (Paiva et al. 2012)

9.2 Incriminating Factors of Protein Origin

149

revealed specificity of rice bean lectin towards rabbit erythrocytes (Table 9.12). The results of the study also showed that the agglutination activity of rice bean lectin is readily inhibited by D-galactose at 6.25 mM. Bhagyawant et al. (2019) also reported the specificity of lectin from different rice bean genotypes with trypsinized rabbit erythrocytes. They suggested that the agglutination activity of lectin with rabbit erythrocytes may be due to molecular properties of the lectin, cell surface interactions, metabolic state of the cells and assay conditions as well. Further they also reported that lectin content in rice bean accessions ranged between 0.14 to 0.41 hemaglutination Unit mg 1 proteins.

9.2.3

Lipoxygenases

Lipoxygenases (LOX) are non-heme iron containing dioxygenase enzymes, which catalyze the dioxygenation of polyunsaturated fatty acids containing cis-1, 4-pentadiene moieties and produce hydroperoxides (Savage and Deo 1989). LOX also induces the synthesis of oxylipins, including acyclic and cyclic compounds. Linoleic (LA, 18:2)and linolenic acids (LeA, 18:3) are the major polyunsaturated fatty acids in plant tissues and are two important substrates for lipoxygenases and can be classified into two types, 9-LOX and 13-LOX, as they incorporate oxygen at C-9 and C-13 positions in the fatty acyl chains and gene rate corresponding hydroperoxides (Feussner et al. 2001). These hydroperoxides are involved in further enzymatic reactions resulting in spontaneous cleavage of fatty acid chains. The Lox have been associated with the several negative implications in plant based foods which include off-flavour and odor production, loss of pigments such as carotenes and chlorophylls, and destruction of essential fatty acids. They are present in a wide range of biological organs and tissues, but they are particularly abundant in grain legume seeds (beans and peas). The protein content in soybean is about 40%, and in mature seeds, lipoxygenase accounts for 1.2% of total protein content. The legumes contain several lipoxygenase isoenzymes with considerable activity, capable of oxidizing unsaturated fatty acids in free and ester-bound form and producing off-flavor thereby reduces their culinary value (Katoch 2013). In 1932, Andre et al. observed that the bean flavor in soybeans was mainly caused by lipoxygenase. In 1947, Theorell et al first extracted lipoxygenase from soybeans. In soybean, the soybean seed lipoxygenase catalyses the hydroperoxidation of Linoleate and linolenate esters, resulting in, from linoleic acid, 9(Z),11(E)-13hydroperoxy-9,11-octadecadienoic acid (13-HPOD) or 10(S)-12(Z)-9-hydroperoxy-10,12-octadecadienoic acid (9-HPOD) and from linolenic acid 10(E),12 (Z),15(Z)-9-hydroperoxy-10,12-15-octadecatrienoic acid (9-HPOT) and 9(Z),11(E) 15(Z)-13-hydroperoxy-9,11,15-octadecatrienoic acid (13-HPOT). These hydroperoxides are involved in further enzymatic reactions resulting in spontaneous or enzymatically caused cleavage of the fatty acid chain. When this occurs, aldehydes (hexanal, nonenal) and ketones are released causing grassy beany taste in processed foods.

Crop Rice bean

AB+ve

O+ve

B+ve

Blood group A+ve

with pure seed extract)

pure seed extract)

pure seed extract)

pure seed extract)

(No agglutination

(No agglutination with

(No agglutination with

(No agglutination with

Agglutination with human erythrocytes

Inhibition of agglutination activity of rice bean lectin with serial dilution of test sugar (galactose 200 mM)

Agglutination and agglutination inhibition with rabbit erythrocytes

Table 9.12 Agglutination and agglutination-inhibition activity of lectin from rice bean against human and rabbit erythrocytes

150 9 Incrimnating Factors in Rice Bean

9.2 Incriminating Factors of Protein Origin Table 9.13 Variation in total lipoxygenase activity in different rice bean genotypes

Genotype JCR-20 JCR-152 JCR-178 JCR-163 IC-140802 IC-140795 IC-140796 IC-137195 IC-137194 IC-019352 EC-48223-B LRB-134 LRB-164 LRB-168 LRB-40-2 BRS-2 GM CV CD at 5% SE (m) 

151

Lipoxygenase activity (units/mg) 820 782 800 739 808 850 840 789 736 703 950 888 783 900 765 732 805.31 0.32 4.28 1.48

Source: Katoch (2013) Table 9.14 Variation in hydrocyanic acid content in different rice bean genotypes

Genotypes JRC-08-7 JRC-08-8 JRC-08-10 JRC-08-12 JRC-08-15 JRC-08-16 JRC-08-32 JRC-13-11 JRC-13-13 JRC-50 Nagadal

HCN content (μg/100 g) 71.17 104.53 49.90 69.60 98.19 130.44 158.17 97.79 138.44 113.16 120.33

Source: Rejaul et al. (2017)

Different rice bean genotypes were investigated for the lipoxygenase activity and the variations from 703 LOX units/mg protein in IC-019352 to 950 units/mg in EC-48223-B were observed. Genotypes with higher value of lipoxygenase activity were LRB-168 (900 units/mg), LRB-134 (888 units/mg), IC-140795 (850 units/mg) and IC-140796 (840 units/mg) (Table 9.13). Genotypes BRS-2 (732 units/mg), IC-137194 (736 units/mg) and JCR-163 (739 units/mg) had low value for lipoxygenase activity (Table 9.14). Genotypes EC-48223-B, LRB-168 and

152

9 Incrimnating Factors in Rice Bean

LRB-134 were with significantly higher lipoxygenase activity as compared to other rice bean genotypes.

9.2.4

Hydrocyanic Acid Content

Cyanogenic glycosides are chemical compounds present in some foods which release hydrogen cyanide when digested. The release of hydrogen cyanide from foods involves the action of β-glucosidase enzyme which produces sugars and a cyanohydrin from cyanogenic glycosides that spontaneously produces hydrocyanic acid and a ketone or aldehyde. The potential toxicity of cyanogenic glycosides is due to enzymatic degradation that results in the release of hydrocyanic acid. Exposure to cyanide from unintentional or intentional consumption of cyanogenic glycosides may lead to acute intoxications, characterized by growth retardation and neurological symptoms resulting from tissue damage in the central nervous system (CNS). The cyanogenic glycosides are natural plant toxins and have been reported from varied plant sources and the most of the plants belong to leguminosae family. 300 species of plants were examined and the highest number was obtained from leguminosae family of which the 52 plants were from the pea family. The presence of cyanogenic glycosides and the production of hydrocyanic acid on hydrolysis have undesirable effect on the nutritional quality of leguminous crops, if consumed in large quantities. Since, the consumption of cyanogenic glycosides in excess amount leads to the problems of acute cyanide poisoning; therefore there is a need to have knowledge regarding the cyanogenic potential of foods. Okolie and Ugochukwu (1989) reported cyanide in the seeds of varieties of Phaseolus aureus, Vigna unguculata, Cajanus cajan and Canavalia gladiatus from 381 to 1093 mg kg 1 dry matter. They also noted the presence of higher HCN content in testa than cotyledons. Usually, the outer layer of many cyanogenic tissues contains more HCN than the edible inner layer (Bourdoux et al. 1980). However, a reversal of this trend has been observed in Canavalia gladiatus, where the cotyledons have three times as much HCN as in testa. Bepary et al. (2017) analyzed different rice bean genotypes and reported variation in the level of HCN from 49.90 μg/100 g to 138.44 μg/100 g) (Table 9.14). The genotypes viz., JRC-08-7, JRC-08-10, JRC-08-12 exhibited low (49.90 μg/100 g to 71.17 μg/100 g) HCN content whereas variety JRC-08-32 displayed the highest (158.17 μg/100 g) HCN content (Table 9.14). The study conducted by Tresina et al. (2012) reported low HCN content (0.09 mg/100 g) in rice bean comparable with other legumes such as Vigna sinensis and Pisum sativum (Montgomery 1980); Dolichos lablab var. vulgaris, Bauhinia purpurea (Vijayakumari et al. 1995); Entada phaseoloides (Siddhuraju et al. 2001). Owolabi et al. (2012) reported HCN content as 0.7 μg/100 g to 37 μg/100 g for five accessions of cowpea. Manay and Sharaswamy (2008) also reported that pulse consumption is considered to be safe if cyanide content ranges from 10.00 mg/100 g to 20.00 mg/100 g. The HCN content in rice bean has been observed far below the lethal level i.e. 36.00 mg/100 g (Oke

9.3 Comparative Anti-Nutritional Profile of Different Vigna Species

153

Table 9.15 Genotypic rating of rice bean genotypes for anti-nutrients Genotypes JCR-20 JCR-152 JCR-178 JCR-163 IC140802 IC140795 IC140796 IC137195 IC137194 IC019352 EC48223-B LRB-134 LRB-164 LRB-168 LRB-40-2 BRS-2

Saponins 4 5 9 10 6

Oligo. (%) 12 8 1 14 13

TI (mg/g) 1 5 8 11 9

AIA (units/g) 12 7 13 1 8

PA (%) 1 8 5 6 3

Lox (units/g) 12 6 9 4 10

Total 42 39 45 46 49

Rank 6 5 9 10 11

11

5

12

6

10

12

56

12

8

7

7

3

9

11

45

9

2

10

10

2

2

8

34

3

1

1

15

9

6

3

35

4

12

2

2

4

5

1

26

1

11

15

14

5

5

15

65

13

3 2 7 2 2

4 11 3 9 6

13 6 3 4 16

8 10 14 2 11

4 7 5 9 7

13 7 14 5 2

45 43 46 31 44

9 7 10 2 8

1969), that indicate that the rice bean is safe from adverse effect of HCN on human health. The overall rating of investigated rice bean genotypes based on the level of different anti-nutrients revealed that the genotypes IC-019352, LRB-40-2, IC-137195, IC-137194 and JCR-152 were better for having least anti-nutrient content. These superior genotypes could have the significant values in rice bean improvement programme (Table 9.15).

9.3

Comparative Anti-Nutritional Profile of Different Vigna Species

The genus Vigna is one of the important groups of nutritionally sound legumes which also include some of the lesser known legumes such as rice bean. The presence of anti-nutritional factors is one of the limiting factors for effective utilization of different legumes. The anti-nutritional profile of different Vigna species viz., Vigna umbellate (Rice bean), Vigna unguiculata (Cow pea), Vigna radiata (Mung bean), Vigna angularis

154

9 Incrimnating Factors in Rice Bean

Fig. 9.8 Variation in antinutrient composition of Vigna species

Table 9.16 Protease inhibitor content in five different Vigna species Vigna species Vigna umbellata Vigna unguiculata Vigna radiata Vigna angularis Vigna mungo CD (5%) CD (1%)

Trypsin inhibitor (mg/gm) 29.56 26.58 32.46 23.37 21.80 0.80 1.14

α-amylase inhibitor (Unit/g) 1560.67 1035.66 986.70 614.33 853.00 24.88 35.38

Source: Shweta Katoch and Kumari (2017)

(Adzuki bean) and Vigna mungo (Black gram) revealed that rice bean has modest level of anti-nutrients. The level of total and hydrolysable tannins was higher in adzuki bean (Fig. 9.8). As discussed protease inhibitors are present in considerable amounts in leguminous seeds, which inhibit the activity digestive gut proteases and interfere with digestibility of dietary proteins ultimately affecting their utilization. The trypsin inhibitor content of different Vigna species revealed variations from 21.80 to 32.46 mg/g (Table 9.16). Vigna radiata had higher amount of trypsin inhibitor content among five Vigna species, whereas their low value was observed in Vigna mungo. α-amylase inhibitor interferes with the activity of amylase enzyme responsible for digestion of starchy food and thereby also known as starch blockers. α-amylase inhibitor content in revealed variations in Vigna species varied from 614.33 Unit/g (Vigna umbellata) to 1560.67 Unit/g (Vigna angularis). Kalidass and Mohan (2012) also conducted comparative study on anti-nutritional composition of different lesser known Vigna species and the observed under mentioned variation in their content (Table 9.17). Legumes are comparatively inexpensive source of protein and other essential nutrients, but the presence of antinutritional factor affects their wide acceptability. The studies have revealed that rice bean has modest level of different anti-nutrients in comparison to other traditional legumes, therefore with further improvement in

Source: Kalidass and Mohan (2012)

Anti-nutritional constituents Total free phenolics (g 100 g 1) Tannins (g 100 g 1) Hydrogen cyanide (mg 100 g 1) Raffinose (g 100 g 1) Stachyose (g 100 g 1) Verbascose (g 100 g 1) Trypsin inhibitor activity (TIU mg protein)

1

Vigna umbellata 0.58  0.01 0.24  0.01 0.09  0.01 0.78  0.01 2.01  0.01 1.76  0.01 34.30

Vigna trilobata 0.78  0.01 0.23  0.01 0.18  0.01 0.41  0.01 1.78  0.01 1.17  0.01 23.19

Vigna radiata var. sublobata 1.07  0.01 0.31  0.01 0.24   0.17 0.38  0.01 1.58  0.02 0.98  0.01 24.48

Table 9.17 Comparative anti-nutritional profile of lesser known Vigna species Vigna aconitifolia 1.02  8.82 0.48  0.01 0.26  0.01 0.58  0.01 1.98  0.01 1.36  0.01 31.36

Vigna vexillata 0.98  0.01 0.19  0.01 0.12  0.01 0.66  0.01 2.06   0.01 1.74  0.01 33.20

Vigna bourneae 1.21  0.01 0.36  0.01 0.14  0.02 1.01  0.01 2.12  0.01 1.84  0.02 24.60

9.3 Comparative Anti-Nutritional Profile of Different Vigna Species 155

156

9 Incrimnating Factors in Rice Bean

different characters involving conventional and modern techniques the crop could gain wider acceptability.

References Banwell B, Ghezzi A, Bar-Or A, Mikaeloff Y, Tardieu M (2007) Multiple sclerosis in children: clinical diagnosis, therapeutic strategies, and future directions. Lancet Neurol 6(10):887–902 Bepary RH, Wadikar DD (2019) HPLC profiling of flatulence and non-flatulence saccharides in eleven ricebean (Vigna umbellata) varieties from north-East India. J Food Sci Technol 56 (3):1655–1662 Bepary RH, Wadiker DD, Neog SB, Patki PE (2017) Studies on physiochemical and cooking characteristics of rice bean varieties grown in N-E region of India. J Food Sci Technol 54:973– 986 Bhagyawant SS, Bhadkaria A, Narvekar DT, Srivastava N (2019) Multivariate biochemical characterization of rice bean (Vigna umbellata) seeds for nutritional enhancement. Biocatal Agric Biotechnol 20:101193 Bourdoux P, Mafuta M, Hanson A, Ermans AM (1980) In: Errnans AM, Mbulamoko NM, Delange F, Ahluwalia R (eds) Role of cassava in the etiology of endemic goitre and cretinism. IDRC, Ottawa, p 15 Campos-Vega R, Loarca-Pina G, Oomah BD (2010) Minor components of pulses and their potential impact on human health. Food Res Int 43:461–482 Chai W, Liebman M (2005) Oxalate content of legumes, nuts, and grain-based flours. J Food Compos Anal 18(7):723–729 Datta PK, Basu PS, Datta TK (1988) Purification of human erythrocytes specific lectins from rice bean, Phaseolus calcaratus syn. Vigna umbellata by high-performance liquid chromatography. J Chromatogr 431:37–44 Del Rosario RR, Lozano Y, Pamorasamit S, Noel ME (1980) The trypsin inhibitors activity of legume seeds. Phil Agr 63:339–344 Deshpande SS (2002) Handbook of food toxicology. Marcel Dekker, New York, pp 370–378 Feussner I, Kuhn H, Wasternack C (2001) Lipoxygenase-dependent degradation of Storage Lipids. Plant Sci 6(6):268–273 Girigowda K, Prashanth SJ, Mulimani VM (2006) Oligosaccharins of Black Gram (Vigna mungo L.) as affected by processing methods. Plant Foods Hum Nutr 60:173–180 Gupta S, Abu-Ghannam N (2012) Probiotic fermentation of plant based products: possibilities and opportunities. Cri Rev Food Sci Nutr 52:183–199 Habtamu FG, Negussie R (2014) Antinutritional factors in plant foods: potential health benefits and adverse effects. Int J Nutr Food Sci 3(4):284–289 Janardhanan K, Vadivel V, Pugalenthi M (2003) Biodiversity in Indian underexploited/tribal pulses. In: Jaiwal PK, Singh RP (eds) Improvement strategies for Leguminasae biotechnology. Kluwer, Great Britain, pp 353–405 Kalidass C, Mohan VR (2012) Biochemical composition and nutritional assessment of selected underutilized food legume of the genus Rhynchosia. Int Food Res J 19:977–984 Kamatchi KB, Tresina SP, Mohan VR, Vadivel V (2010) Nutrient and chemical evaluation of raw seeds of five varieties of Lablab purpureus (L.) sweet. Adv Biores 1:44–53 Kataria A, Chauhan BM, Gandhi S (1988) Effect of domestic processing and cooking on the antinutrients of black gram. Food Chem 30(2):149–156 Katoch R (2011) Nutritional and anti-nutritional constituents in different seed components of rice bean (Vigna umbellata). Indian J Agric Biochem 24(1):65–67 Katoch R (2013) Nutritional potential of rice bean (Vigna umbellata): an underutilized legume. J Food Sci 78:8–16

References

157

Katoch R, Sharma K, Singh SK, Thakur N (2015) Evaluation and characterization of trypsin inhibitor from rice bean with inhibitory activity against gut proteases of Spodoptera litura. Zeitschrift für Naturforschung C 70(11–12):287–295 Kaur D, Kapoor AC (1992) Nutrient composition and antinutritional factors of rice bean (Vigna umbellata). Food Chem 43:119–124 Kaur M, Kawatra BL (2000) Effect of domestic processing on flatus producing factors in ricebean (Vigna umbellata). Nahrung/Food 44(6):447–450 Malhotra S, Malik D, Dhindsa KS (1988) Proximate composition and anti-nutritional factors in rice bean (Vigna umbellata). Plant Foods Hum Nutr 38:75–81 Manay NS, Sharaswamy MS (2008) Food facts and principles. New Age International Ltd., New Delhi Masao H (2002) Noval physiological functions of oligosaccharides. Pure Appl Chem 74:1271–1279 Massey LK, Palmer RG, Horner HT (2001) Oxalate content of soybean seeds (glycine max: leguminosae), soyfoods, and other edible legumes. J Agric Food Chem 49(9):4262–4266 Messina MJ (1999) Legumes and soybeans: overview of their nutritional profiles and health effects. Am J Clinic Nutr 70:439S–450S Montgomery RD (1980) Cyanogens. In: Liener IE (ed) Toxic constitutes of plant food stuffs, 2nd edn. Academic, New York, p 158 Noonan SC, Savage GP (1999) Oxalate content of foods and its effect on humans. Asia Pacific J Clin Nutr 8:64–74 Oke OL (1969) The role of hydrocyanic acid in nutrition. World Rev Nutr Diet 11:118–147 Okolie NP, Ugochukwu EN (1989) Cyanide content of some Nigerian legumes and the effect of simple processing. Food Chem 32:209–216 Owolabi OA, Ndidi US, James BD, Amune FA (2012) Proximate, antinutrient and mineral composition of five varieties (improved and local) of Cowpea, Vigna unguiculata, commonly consumed in Samaru community, Zaria-Nigeria. Asian J Food Sci Tech 4(2):70–72 Paiva PMG, Napoleao TH, Sa RA, Coelho LCBB (2012) Insecticide activity of lectins and secondary metabolites, insecticides - advances in integrated pest management. IntechOpen, London Rao PU, Deosthale YG (1982) Tannin contents of pulses: varietal differences and effect of cooking and germination. J Sci Food Agric 33:1013–1016 Reddy NR, Pierson MD, Sathe SK, Salunkhe DK (1985) Dry bean tannins: a review of nutritional implications. J Am Oil Chem Soc 62(3):541–549 Rejaul HB, Wadikar DD, Patki PE (2016) Rice bean: nutritional vibrant bean of Himalayan belt (North East India). Nutri Food Sci 46:412–431 Rejaul HB, Wadikar DD, Patki PE (2017) Studies on physico-chemical and cooking characteristics of rice bean varieties grown in NE region of India. J Food Sci Technol 54(4):973–986 Rejaul HB, Wadikar DD (2019) HPLC profiling of flatulence and non-flatulence saccharides in eleven ricebean (Vigna umbellata) varieties from north-East India. J Food Sci Technol 56 (3):1655–1662 Saikia P, Sarkar CR, Borua I (1999) Chemical composition, anti-nutritional factors and effect of cooking on nutritional quality of rice bean Vigna umbellata (Thunb; Ohwi and Ohashi). Food Chem 67:347–352 Salunkhe DK, Kadam SS (1989) Hand book of world legumes. CRC Press, Boca Raton Savage GP, Deo S (1989) Nutr Abstr Rev 59:66–88 Shweta Katoch R, Kumari M (2017) Proximate and anti-nutritional composition of underutilized and common Vigna species of Himachal Pradesh. Bull Env Pharmacol Life Sci 6:24–31 Siddhuraju P, Becker K, Makkar HS (2001) Chemical composition, protein fractionation, essential amino acid potential and antimetabolic constituents of an unconventional legume, Gila bean (Entada phaseoloides Merrill.) seed kernel. J Sci Food Agric 82:192–202 Singh SP, Misra BK, Chandel KPS, Pant KC (1980) Major food constituents of rice-bean (Vignaumbellata). J Food Sci Technol 17:238–240

158

9 Incrimnating Factors in Rice Bean

Smily V (1997) Some unorthodox perspectives on agricultural biodiversity. The case of legume cultivation. Agric Eco Env 62:135–144 Tajoddin M, Manohar S, Lalitha J (2012) Laboratory experiments illustrating evaluation of Raffinose family oligosaccharides of mung bean (Phaseolus aureus L.) cultivars. Indian J Innov Dev 5(1):390–394 Trafalska E, Grzybowski A (2006) Probiotics and prebiotics in prevention of chronic civilization diseases. New Med 1:3–6 Tresina SP, Daffodil ED, Lincy P, Mohan VR (2012) Assessment of biochemical composition and nutritional potential of three varieties of Vigna radiata (L) Wilezek. Biolife 2:655–667 Vijayakumari K, Siddhuraju P, Janardhanan K (1995) Effects of various water or hydrothermal treatments on certain antinutritional compounds in the seeds of the tribal pulse, Dolichos lablab var. vulgaris L. Plant Foods Hum Nutr 48:17–29 Wang CC, Chen LG, Yang LL (2000) Cuphiin D1, the macrocyclic hydrolyzable tannin induced apoptosis in HL-60 cell line. Cancer Lett 149:77–83 Wang C-H, Lai P, Chen M-E, Chen H-L (2008) Antioxidative capacity produced by Bifidobacterium- and Lactobacillus acidophilus-mediated fermentations of konjac glucomannan and glucomannan oligosaccharides. J Sci Food Agric 88(7):1294–1300

Tackling Incriminating Factors

10

It is a well known fact that legumes are excellent source of protein and other nutrients and contribute significantly to the global productivity and nutrition. The nutritional composition of legumes depends on variety, species and the growing region. The legume protein though adequate in lysine, is deficient in methionine and cysteine. They act as a good supplement for cereals which are deficient in lysine, an essential amino acid from nutritional point of view. Grain legumes are also a good source of minerals and vitamins in particular vitamin B complex. Despite such advantageous characteristic, legume seeds generally contain anti-nutrients mostly in their raw state and thereby their direct consumption is associated with decreased bioavailability of nutrients (Saharan et al. 2001; Tharanathan and Mahadevamma 2003). Considering the nutritional merits of legumes, it is imperative to adopt the methodologies for lowering/minimizing the level of anti-nutrients from legumes. Rice bean, one of the underutilized legumes posses’ excellent nutritional characteristics which are comparable to other commonly consumed legumes, along with the presence of beneficial bioactive compounds. Moreover, rice bean is also endowed with the potential for enhancement and conservation of agro-diversity. Though rice bean has been considered as nutritious legume with modest antinutritional profile which include total phenolics (1.63–1.82%), total tannins (1.37–1.55%), condensed tannins (0.75–0.80%), hydrolysable tannins (0.56–0.79%), trypsin inhibitor (24.55–37.23 mg/g), phytic acid (7.32–8.17 mg/g), lipoxygenase activity (703–950 units/mg), and saponin content (1.20–3.10 mg/100 g). The oligosaccharides associated with the production of flatulence viz., raffinose, stachyose, and verbascose were in the limits of 1.66% to 2.58%, 0.94% to 1.88%, and 0.85% to 1.23%, respectively. The presence of these anti-nutritional factors cannot holdback this legume to be utilized in routine cuisine, as a multitude of the processing techniques have been investigated for reducing the level of different antinutrients in leguminous crops. Various modern and traditional food processing methodologies have been developed for improving the nutritive quality of legumes. These processing techniques enhance consumer appeal and acceptability by deactivate enzymes, reducing the # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_10

159

160

10

Tackling Incriminating Factors

level of different nutrients and inhibit the growth of microorganisms causing spoilage thus increasing the nutritive value and storage life. The effectiveness of different processing method depends not only on the type of legume, but also on the properties of the anti-nutritive compounds and selected processing techniques. The common methods for processing of legumes include heat treatment, milling, dehulling, fermentation, soaking, germination, puffing and chemical treatment. These techniques save time, energy and fuel and produce edible products with higher nutritional value. Different traditional methods for improving nutritive quality of legumes have been discussed under the following subheads

10.1

Germination (Sprouting)

Worldwide, increasing popularity of bean sprouts has been observed together with the consumer perception that these are rich source of nutrients with excellent flavor and taste. In many countries, mung bean sprouts are one of the most popular vegetables. Germination (Sprouting) is one of the most common and effective legume processing methods. It includes the transformation of seeds from their dormant state to a metabolically active state, which involves mobilization of stored reserves of these seeds. During germination, there is a rapid increase in respiration, proteins and nucleic acids biosynthesis and cell division (Kadlec et al. 2008). In general, germination is preceded by soaking. During germination the sugar content of soaked seeds is increased due to mobilization and hydrolysis of stored polysaccharides in seeds. Germination increases protein content of mung bean seeds, due to utilization of carbohydrates as an energy source (Liener and Kakade 1980). Evidence of protein synthesis during germination has been reported by Kylen and Mccready (1975). They observed the protein content of all sprouts was higher than that of the non-germinated seeds. Prudente and Mabesa (1984) revealed that the protein quality of mung beans improved after 60 h of sprouting. Germination also results in the decrease of anti-nutrients such as decrease in trypsin inhibitor which could be attributed to their leaching in soaking medium or utilization as source of energy during early stages of germination. For example the loss of tannins during germination is mainly due to leaching into soaking medium and enzymatic hydrolysis. This results in significant changes in the physicochemical characteristics of seeds. Germination of mung bean for 48 h has been resulted in significant reductions in phytic acid content and tannin contents with a consequent increase in ionizable iron content (Narasinga Rao and Prabhavathi 1982). Reddy et al. (1978) also pointed out that during germination enzymatic breakdown of phytic acid yields phosphorus, cations and inositol to the germinating seeds. Germination is also one of the most efficient treatments to remove α-galactosides. The lowering of oligosaccharides is mainly due to their utilization as a source of available energy in the germination process thereby reduction of the flatus potential of the beans caused by the action of intestinal anaerobic

10.2

Soaking

161

microorganisms (Udayasekhara Rao and Belavady 1978; Jaya and Venkataraman 1981). Jaya and Venkataraman (1981) reported significant increase in the level of sugars such as glucose, galactose and sucrose after germination.

10.2

Soaking

Soaking is one of the key steps in consumption of pulses where soaking temperature, time period, composition of soaking solution (water, acidic or basic) and pulse type affect the level of different anti-nutrients. Leguminous seeds are primarily soaked in water and/or salt solutions (0.25–1%) to soften the cotyledon, which ultimately reduces the cooking time (Silva et al. 1981). Sodium chloride, acetic acid and sodium bicarbonate solutions have been used for soaking of legume seeds (Huma et al. 2008). Soaking also improves the structural and textural profile of leguminous seeds (Figs. 10.1 and 10.2). Beside shortening the cooking time and improving the textural profile of legume seeds, soaking has also been reported to significantly reduce the phytic acid and tannin contents in legume seeds (Toledo and Canniatti-Brazaca 2008). The flatulence factors in legumes are also reduced considerably by soaking due to leaching out of stachyose and raffinose. Luo and Xie (2013) observed 26% reduction in phytic acid in white faba bean seeds after soaking. Soaking of lentil in water is also helpful in 25–30% reduction in total phenolic content (Vidal-Valverde et al. 1994). A time dependent reduction in total phenolic content (10–50%) after soaking has been reported for peas (Alonso et al. 1998; Bishnoi et al. 1994; Han and Baik 2008). Soaking of chickpea seeds cause 12% reduction in trypsin inhibitor (TI) activity which is mainly due to increased solubility of trypsin inhibitor in soaking medium (Fernandez et al. 1993). Soaking of faba bean seeds for 12 h at 37  C resulted 20–23% reduction in saponin content (Sharma and Sehgal 1992). Further increasing the soaking time reduces the saponin and tannin content in leguminous seeds which is may be attributed to their leaching in the soaking medium. During soaking of seeds, the addition of acid in particular citric acid improves the retention of water

Fig. 10.1 Variation in the hardness of seeds of rice bean genotypes after soaking

162

10

Tackling Incriminating Factors

Fig. 10.2 Variation in the cohesiveness, gumminess (N), springiness and chewiness (N mm) of seeds of rice bean genotypes after soaking

soluble vitamins. The addition of acid also produces best retentions of other nutrients, such as starch, glucose, fructose, sucrose and a greater destruction of anti-nutrients.

10.3

Heat Processing

Thermal treatments significantly improve the nutritional quality and digestibility of pulses (Tiwari and Singh 2012). Cooking of pulses and pressure cooking are the commonly used heat processing methods and their effects on the level of different anti-nutrients have been evaluated by many researchers. Prior to cooking, it includes soaking of seeds to make them tender. During cooking of legumes, seeds undergo important physico-chemical changes involving gelatinization and swelling of the starch and softening of cell wall constituents, which result in a palatable texture (Stanley and Aguilera 1985). The constituents like fiber, lignin, cellulose and hemicelluloses are the factors responsible for hardness of grain. Sefa-Dedeh and Stanley (1979) reported that seed coat with good hydration properties facilitate rapid cooking. The cooking process of pulses involves water absorption to an equilibrium condition, followed by softening of texture by heat. Kaur et al. (2013) reported that cooked seeds’ hardness ranged from 13.46 N for LRB10 to 40.71 N for SKMRB1 and was higher than the soaked seeds’ hardness (Fig. 10.3). This indicated that the hardness of the seeds increased with cooking. This may be due to the gelatinization of starch during heating followed by retrogradation on cooling. Springiness, also represents as elasticity is a measure of the recovery after the first compression. It is a measure of how much of the original structure of food was broken during first

10.3

Heat Processing

163

Fig. 10.3 Variation in the hardness of seeds of rice bean genotypes after cooking

Fig. 10.4 Variation in cohesiveness, gumminess (N), springiness and chewiness (N mm) of seeds of rice bean genotypes after cooking

compression. Cohesiveness is an index which indicates how well the food material withstands a second deformation, relative to its behavior under first deformation. The cooked seed’s cohesiveness ranged between 0.18 (LRB23) and 0.25 (LRB160). Gumminess is the product of hardness and cohesiveness and the unit is Newton (N) and also represents as the force required to disintegrate the particles ready for swallowing. Chewiness is a measure of the energy required to masticate the semisolid food into a fluidized state before swallowing. It is generally calculated as a product of gumminess and springiness. Chewiness and gumminess of cooked seeds varied from 1.05 to 2.87 N mm and 2.88 to 8.46 N, respectively (Fig. 10.4).

164

10.4

10

Tackling Incriminating Factors

Dehulling

Dehulling (decortication) is also one of the important traditional processing methods which generally involves loosening or removal of hull and cleaning. Loosening of hull can be achieved by • Prolonged sun drying until the hull is loosened • Application of small quantities of edible oil, followed by sun drying and tempering • Soaking in water for several hours, followed by coating them with red-earth slurry and sun drying • Combinations of above methods. Dehulling produces refine cotyledons with low fiber content. Most importantly it affects the appearance, texture, cooking quality, digestibility and palatability of seeds. Dehulling shows a maximum reduction in the level of phenolic compounds as they are primarily located in the seed coat of pulses. Han and Baik (2008) recorded 80% reduction in total phenolic content upon dehulling of lentil seeds. Wang et al. (2009) also reported a similar trend with the tannin content upon dehulling eight varieties of Canadian lentils. Dehulling also results in 34% decrease in total phenols in yellow peas (Han and Baik 2008). In chickpeas, dehulling reduces the total phenolic content in cream colored Kabuli and Desi varieties by 11–16% but in black and red colored Desi cultivars, dehulling resulted in 75% reduction in total phenolic content in seeds (Sotelo et al. 1987). Dehulling reduces cooking time and it shows a negligible effect on the total protein content and amino acid composition. Sinha and Kawatra (2005) studied the effect of soaking and dehulling on cow pea (Vigna unguiculata) and reported 16.30% and 30.10% phytic acid content in soaked and dehulled cowpea seeds. The activity of anti-nutritional factors like trypsin inhibitor, hemamagglutinin activity, tannins, and phytic acid reduce by 7.60%, 32.60%, 33.30%, and 20.70%, respectively, after dehulling of mung bean seeds (Mubarak 2005). Plahar et al. (1997) analyzed in vitro protein digestibility of four cultivars of dehulled cowpea and observed significant reduction in tannin content of dehulled grains. Both protein and its digestibility increased significantly following dehulling of green gram, cowpea, lentil, and chickpea in range of 2.20% to 5.10% and 13.20% to 16.70%, respectively (Ghavidel and Prakash 2007).

10.5

Puffing

Puffing is a complicated physiochemical process. One requirement for successful puffing is the internal moisture content and the permeability of the seed. Internal moisture is important during heating, which, because of high temperature, will be vaporized to create steam pressure and lead to rapid expansion in the puffing step.

10.7

Chemical Treatments

165

The permeability of the seed is likely to be influenced by the thickness of the seed coat, its morphology, the chemical composition of its surface, its toughness and integrity. Puffing had been one of the traditional ways of processing legume seeds. This technique is often used for the processing of chickpeas and peas, resulting in a light and crispy product. Puffed legumes are commonly eaten as snack foods, though they can also be milled into flour and used for other purposes. The grains are first soaked in water for short duration (1–3 min), mixed with sand heated to 250  C and toasted for 15–25 s with agitation. After sieving off the sand, the grains are dehusked between a hot plate and a fast rotating rough roller. The yield of puffed product is about 65–70% by weight. This normally results in the expansion of the grains, leading to the splitting of the husk of the legumes. Puffed legumes are known to retain all nutrients and also result in improved protein and carbohydrate digestibility (Baskaran et al. 1999). Though this processing technique is widely used for the chick pea and peas for making different value added products, the exploitation of this processing technique could be useful for utilization of the rice bean in the making of different products such as a traditional food item known as Sattu.

10.6

Milling

The removal of the outer husk and splitting the grain into two equal halves is known as milling of pulses. To facilitate dehusking and splitting of pulses alternate wetting and drying method is used. After dehulling, the seeds may be wet-milled or dry-milled. In milling, the seeds are processed into smaller particles. Wet milling of seeds will produce a paste while dry milling of seeds produces flour. Wet milled legume seeds may be mixed with other ingredients and steamed in leaves to produce pudding or fried in hot oil to obtain cake. Milling is the most commonly used method to remove phytic acid from grains. This technique removes the phytic acid but also has major disadvantages as it also removes other essential nutrients such as minerals and dietary fiber (Gupta et al. 2015).

10.7

Chemical Treatments

The effectiveness of various chemical treatments has been investigated for improving the nutritional quality of legumes. Treatment of legume seeds with different solvents yields fractions of toxicants on the basis of their solubility in the extraction medium (Ologhobo et al. 1993). The chemical treatment of leguminous seeds with alkali has been found most effective in removing the anti-nutritional factors in comparison to acid, ether and alcohol solvents (Eicher and Satterlee 1988; D’Mello and Walker 1991). Treating leguminous seeds with urea is another approach for improving their nutritive value as functional group in urea competes for making intra-chain hydrogen bonds in peptide backbone, thereby breaks down secondary structure of proteinaceous anti-nutritional factors and inhibits their biological

166

10

Tackling Incriminating Factors

activity (Rawn-David 1983). Other additives chemicals such as potassium and sodium bicarbonate, citric acid, sodium carbonate, sodium chloride and sodium polyphosphate have also been used to improve nutritive value of legumes. Soaking of leguminous seeds in 0.50% sodium bicarbonate solution causes softening of the testa and cotyledons, thereby make the sugars extraction a lot easier. De León et al. (1992) reported that the application of 0.50% sodium bicarbonate and 2.50% potassium carbonate was effective in making bean seeds softer. The soaking of soyabean seeds in 2% sodium bicarbonate for 12 h causes a greater reduction in phytic acid content (Ku et al. 1976). The loss of phytic acid during soaking in legumes may be attributed to the activity of phytase and diffusion. A study by Plahar et al. (2002) showed a significant improvement in the cookability of Bambara groundnut, a underutilized legume with alkaline salts causes up to 25% reduction in an average cooking time. Katoch (2014) studied the effect soaking of rice bean seeds in 0.03% sodium bicarbonate solution and reported significant reduction in the level of different anti-nutrients.

10.8

Extrusion Cooking

Extrusion cooking has been used to reduce cooking time and improve the textural, nutritional and sensorial characteristics of pulses. Extrusion cooking has advantages including versatility, high productivity, low operating costs, energy efficiency and shorter cooking times. This processing method has developed quickly during the last decade, and can now be considered as a technology of its own right. The extrusion cooking of leguminous seeds improve the nutritional quality at a lower cost in comparison to other processing methods due to more efficient use of energy and better control with greater production capacities. In this processing method, cooking of seeds is carried out at high temperature and pressure inside a screw-barrel assembly (Bhattacharya and Prakash 1994). Extrusion cooking is used to produce ready-to-eat products. This processing method has been found effective in removing aflatoxin from peanuts and canavanine form jack bean seeds (Tepal et al. 1994; Saalia and Phillips 2011). This processing method is also useful in the complete removal of trypsin inhibitor activity and lectin from pulses. Improvement in the protein and starch digestibility of extruded faba bean and kidney bean by this processing method has been reported by Alonso et al. (2000).

10.9

High-Pressure Cooking

There is increasing worldwide interest in the use of high-pressure cooking because of the advantages of this technology over other methods of processing and preservation. This processing method offers homogeneity of treatment at every point in the product due to the fact the applied pressure is instantaneously and uniformly distributed within the processing chamber (Mertens and Deplace 1993).

10.11

Fermentation

167

The important advantages of this processing method are: • Significant or total inactivation of microorganisms • Better functional and nutritional retention of ingredients in the processed products, with improved food quality parameters • Significant energy savings in comparison to thermal stabilization techniques. This process involves the application of high hydrostatic pressure. Recent studies have demonstrated that under optimal conditions, this processing method may inactivate the anti-nutrients while preserving food quality and constituents (Estrada-Giron et al. 2005). Enormous information regarding the processing of pulses by traditional methods is available; but research concerning the application of high pressure cooking in legume processing is scanty. High hydrostatic pressure has been applied to produce tofu which has been to have longer shelf life due to the significant reduction in microbial population (Prestamo et al. 2000). The activity of lipoxygenase, an enzyme which is responsible for the off-flavor in soybean, is found to be sensitive to high pressures, thereby minimized through this processing technique (Ludikhuyze et al. 1998).

10.10 Canning Canning is a heat sterilization process. It is used to improve the shelf life of the food products. Canning of legume seeds is mainly result of two processes: soaking or blanching and thermal processing or heat sterilization. Soaking is done before canning for removing foreign material and ensuring seed tenderness and improving color and taste. During canning, the soaking of leguminous seeds reduces the level of anti-nutritive factors due to leaching. Blanching inactivates the lipoxygenases which are responsible for producing off flavor and also softens the product and removes gases from the can during retorting. Afoakwa et al. (2007) studied the combined effects of blanching, soaking, and sodium hexametaphosphate salt on cooking parameters of bambara groundnut and reported that blanching and soaking of the seeds prior to canning led to increases in water absorption and leaching. In addition, there was a significant decline in the level of phytic acid, tannins, and hardness.

10.11 Fermentation Fermentation is one of the oldest methods of food preservation and contributes to the improving flavor and taste and amount and availability of nutrients (Svanberg and Lorri 1997; Granito et al. 2002). This is achieved by degradation of non-desirable anti-nutrients by enzymatic hydrolysis (Frías et al. 1996). Changes occurring during the fermentation process are mainly due to the activation of endogenous enzymes

168

10

Tackling Incriminating Factors

present in seeds and activity of microbiota present in legumes e.g., phytate hydrolysis into lower inositol phosphates via the action of microbial phytase enzyme. Fermentation process can also be combined with other processing methods to remove these adverse compounds and improve the nutritional value of pulses (Torres et al. 2006). Fermented legumes have increasingly gained interest among the consumers because of their excellent nutritive value and potential health benefits. The popular example of fermented food products are mung sauce (shoyu), Japanese miso, Indonesian tempeh, Indonesian tape ke ten, Japanese sake (Steinkraus 1983) and Egyptian kishk and bouza (Morcos et al. 1973). Some general observations made by different workers on the effects of fermentation on nutritive value include increases in B12 as well as in other vitamins of the B group. Likewise, there are increases in protein quality, increased availability of various nutrients, and removal of anti-physiological factors. Of particular significance is the supplementary effect induced by microbial growth on a substrate (Dworschak 1982). Fermentation completely removes trypsin inhibitor, oligosaccharides and phytic acid. Rhizopus oligosporus is a food-grade fungus that has been widely used in solidsubstrate bioconversion systems to produce value added food products. Fermentation with R. oligosporus reduces phytic acid by 30.7% in soybean, 32.6% in cowpea and 29.1% in groundbean (Egounlety and Aworh 2003). Kiers et al. (2000) reported tremendous increase in solubility and in vitro digestibility in fermented mung bean, and cowpea with rhizopus spp. Kozlowska et al. (1996) found that spontaneous fermentation of lentil flour for 96 h resulted in significant degradation of inositol hexaphosphate (IP6) to its IP5-IP3 forms at the highest incubation temperature (42  C). Natural fermentation eliminates more than 95% of the lectin activity in lentils (Cuadrado et al. 2002). A significant decrease in the tannin content of red kidney bean flour and pea flour has been reported by Khattab and Arntfield (2009) when flour was fermented with Saccharomyces cerevisiae for more than 24 h.

10.12 Combined Treatments This approach includes combination of different processing techniques and considered as best strategy to improve the nutritive quality of pulses. For example, preliminary soaking prior to cooking is required for complete elimination of lectin. Similarly, overnight soaking in water and subsequent germination for 48 h removes more than 50% tannin from pulses. The decrease in phytic acid content by soaking followed by cooking of presoaked seeds is because of leaching in water. Sat and Keles (2004) reported that soaking of Phaseolus vulgaris seeds in sodium bicarbonate solution for 18 h followed by autoclaving procedures was the most effective strategy for removing oligosaccharides (65–72%), phytic acid (51%) and tannins (100%). Soaking in sodium bicarbonate solution followed by autoclaving lowers the levels of total free phenolics (82–83%), tannins (74–84%), L-DOPA (l-3,4-dihydroxyphenylalanine) (83–85%), phytic acid (75–78%), oligosaccharides

10.13

Tackling Anti-Nutrients in Rice Bean with Different Processing Techniques

169

such as raffinose (76–82%), stachyose (77%) and verbascose (75–76%), hemagglutinating activity (71–75%), trypsin inhibitor activity (81–82%) and α-amylase inhibitor activity (82–84%) of velvet bean (Mucuna pruriens) seeds (Egounlety and Aworh 2003). It also resulted in significant improvement on the in vitro protein digestibility (18.70–20.10%) of bean seeds. The germination and dehulling of green gram (Phaseolus aureus Roxb.), cowpea (Vigna catjang), lentil (Lens esculanta), and chickpea (Cicer arietinum) improved starch digestibility significantly (36.30–39.20%). The combined effect of soaking, dehulling and cooking may reduce the level of oligosaccharides to about 50% of raffinose and more than 55–60% of stachyose (Ghavidel and Prakash 2007). The combined treatment of germination and lactic fermentation utilizing Lactobacillus species is recommended process for enhancing the quality of legume proteins (Khalil 2006). Chitra et al. (1996) found that germination and fermentation greatly increased the in-vitro protein digestibility and remarkably decreased the total dietary fiber with little effect on calcium, magnesium and iron contents. In another study by Shimelis and Rakshit (2007), dry beans (Phaseolus vulgaris) were subjected to natural fermentation and assessed for flatus-producing compounds, anti-nutrients and in vitro protein digestibility. Results revealed decrease in raffinose oligosaccharides, other antinutrients and appreciable improvement in the protein digestibility. For all varieties of dry beans, raffinose and stachyose concentration reduced prominently to undetectable level (92–95%) after 96 h of natural fermentation. The combination of different treatments has also been found to resolve the problem of prolonged cooking, hard seed coat phenomena and poor digestibility. Soaking of seeds is the most widely domestic processing method for improving nutritive value of grain legumes.

10.13 Tackling Anti-Nutrients in Rice Bean with Different Processing Techniques Though rice bean has excellent nutritional quality in comparison to other well established legumes but the presence of anti-nutrients decreases its potential utilization in routine cuisine. However, the level of different anti-nutrients is low in comparison to other staple legume crops. Different anti-nutrients in rice bean could be managed by proper processing. The effect of different processing methods has been investigated to estimate their effectiveness in reducing the level of different anti-nutrients in rice bean (Fig. 10.5). Boiling of rice bean seeds for 50 min or pressure cooking for 15 min has been resulted in the substantial reduction in different anti-nutrients, whereas the content of total soluble sugars has been recorded increased through degradation of starch into simple soluble sugars (Saikia et al. 1999). Pressure cooking is not effective in improving the nutritive quality of rice bean due to less leaching of the anti-nutrients. Dry roasting and germination of rice bean seeds cause complete removal of flatulence factors. Tannins reduce the digestibility of protein and the uptake of some minerals. Tannins content has been found to be

170

10

Tackling Incriminating Factors

Fig. 10.5 Processing techniques for improving nutritional quality of rice bean

reduced by 30–37% by pressure cooking and 34–45% by boiling. Trypsin inhibitors affect the enzymatic activities in the intestines, and thereby not only affect protein digestibility but also produce unpleasant symptoms after consumption. The level of trypsin inhibitor activity in uncooked rice bean has been found to be reduced by 64% by pressure cooking and by 52–55% by boiling. The presence of oligosaccharides or flatulence factors reduces the acceptability of rice bean for its utilization in daily cuisine. Therefore, need to be reduced for quality improvement of rice bean. It has been determined that soaking, sprouting, roasting, open pan cooking and pressure cooking are effective in reducing the oligosaccharide content in rice bean seeds. The combination of sprouting and pressure cooking reduces the raffinose content from 1.48 to 0.29 g/100 g dry matter (DM) and the stachyose content from 3.29 to 0.68 g/100 g DM. The inexpensive and simple processing treatments have significant impact on in vitro availability of the minerals and vitamins, which is most likely due to the reduction in anti-nutrients such as phytic acid. Saharan et al. (2001) observed that dehulling, soaking and sprouting process reduces the phytic acid content in rice bean seeds by 13%, 16% and 57% respectively. However, these processes increased the extractability of calcium by 5%, 7% and 18 %, iron by 9%, 5% and 10% and phosphorus by 12%, 10% and 13% from rice bean seeds (Table 10.1). Bajaj (2014) investigated the effect of soaking for 12 h and pressure cooking (for 15 min) on four rice bean varieties (RBL-1, RBL-2,

10.13

Tackling Anti-Nutrients in Rice Bean with Different Processing Techniques

171

Table 10.1 Effect of soaking and sprouting on mineral availability from rice bean Mean values Raw bean Soaked 12 h Sprouted 24 h

Ca g/100 g Total % available 311.70 59.80 303.00 62.10 299.20 67.50

Fe g/100 g Total % available 6.60 57.90 6.40 39.30 6.40 41.50

P g/100 g Total 257.10 255.00 255.80

% available 33.40 37.70 38.80

Source: Saharan et al. (2001)

RBL-35 and RBL-50) and inferred that both methods significantly improved the nutritional composition of rice bean varieties by reducing phytic acid, trypsin inhibitor, polyphenol and saponin contents. In another study, Kaur and Kapoor (1990) assessed various domestic processing methods such as soaking, sprouting, ordinary cooking and autoclaving for improving the nutritional quality of both soaked and unsoaked seeds of five high yielding varieties (RB-4, RB-32, RB-37, RB-40 and RB-53). It was observed that soaking and sprouting not only decreases the anti-nutritional factors but also led to a progressive and significant increase in both in vitro starch metabolism (from 29.30 mg to 36.50 mg maltose released/gm of meal) and protein digestibility (from 57.20% to 62.80%). Manpreet and Kawatra (2002) observed that bioavailability of zinc in kidney, spleen and liver of rats was higher from sprouted and pressure cooked rice bean seeds.

10.13.1 Effect of Soaking on Anti-Nutrients in Different Rice Bean Genotypes A comprehensive investigation was carried out to assess the potential of different processing techniques and their combinations for improving the nutritional quality of rice bean. In this study, eight nutritionally superior rice bean genotypes viz., JCR-163, JCR-178, JCR-152, IC-140802, JCR-20, BRS-2, IC-137194 and IC-137195 were investigated for anti-nutritional factors after the course of processing. The inferences of the study have been discussed in the following subheads:

10.13.1.1 Effect of Treatments on Flatulence Causing Sugars The raffinose, stachyose and verbascose content in different rice bean genotypes revealed significant variation where stachyose and raffinose contents were lower than verbascose. The raffinose, stachyose and verbascose contents varied from 2.06 g/100 g (IC-137194) to 2.84 g/100 g (JCR-163), 0.86 (IC-137194) to 1.64 g/ 100 g (JCR- 152) and 2.78 g/100 g (JCR-178) to 3.33 g/100 g (IC-137194), respectively. After processing the reduction in the level of these sugars have been discussed in the following subheads:

172

10

Tackling Incriminating Factors

(a) Raffinose content Appreciable decrease in the level of raffinose content was observed after different treatments on rice bean seeds. Soaking of seeds for 24 h showed maximum reduction of raffinose in genotype JCR-163 (2.84–1.77 g/100 g) followed by JCR-20 (2.62–1.95 g/100 g), whereas least effect of treatment was noticed in genotype JCR-152 (2.06 to 1.98 g/100 g) and JCR-178 (2.24 to 1.96 g/100 g). Genotypes IC-137194 and IC-137195 showed maximum (1.30 g/100 g) and minimum (1.76 g/100 g) reduction in the raffinose content after soaking for 48 h, respectively. Roasting was least effective among all the treatments and showed maximum reduction in raffinose content in genotype JCR-163 (2.84 g/100 g to 1.81 g/100 g). All eight genotypes showed complete reduction in raffinose content after germination for 48 h, soaking for 24 h followed by cooking (30 min) and germination for 48 h followed by cooking. Among the different genotypes maximum reduction in raffinose content was observed in JCR-163 followed by IC-137195. The reduction in the raffinose level after these treatments is primarily attributed to leaching out of sugars from the seed to the surrounding medium. Soaking of seeds activates the dormant enzyme like α-galactosidases, hydrolysing α-1, 6-galactosidic linkages, which leads to the breakdown of the oligosaccharides. These two factors, leaching and enzyme action may be responsible for the reduction in levels of the oligosaccharides. (b) Stachyose content Significant reduction in stachyose content was observed after different processing techniques. Soaking for 24 h resulted in highest reduction in genotype JCR-20 (0.74 g/100 g) as compared to control (1.42 g/100 g) followed by IC-140802 (1.61 to 0.87 g/100 g). After soaking for 48 h, genotypes JCR-20 (1.42 to 0.63 g/100 g) followed by IC-140802 (1.61 to 0.76 g/100 g) showed maximum reduction in stachyose content, whereas, JCR-178 (1.01 g/100 g) exhibited minimum reduction. On the basis of per cent reduction, genotype JCR-20 revealed 55.60% reduction as compared to JCR-178 with 17.90% reduction. The chemical treatment revealed maximum effect in genotype JCR-20 (1.42 to 0.68 g/100 g) whereas minimum effect was observed in JCR-178 (1.23 to 1.05 g/100 g). Among different treatments, germination (48 h) followed by cooking (15 min), soaking (24 h) followed by cooking (15 min), and germination for 48 h and soaking for 72 h were the most efficient treatments for the reduction of anti-nutrients. Roasting at 100  C for 10 min was least effective treatment for reducing stachyose content. It is clear from the above results that the combination of different treatments was more effective in decreasing the stachyose content than compared to application of individual treatment. (c) Verbascose content Among different processing methods, Soaking, germination for 48 h followed by cooking (30 min) and soaking (48 h) followed by cooking (30 min) were observed as most efficient treatments. Genotype JCR-163 showed maximum reduction in verbascose content, whereas, the minimum effect of all the

10.13

Tackling Anti-Nutrients in Rice Bean with Different Processing Techniques

173

treatments was recorded in genotype BRS-2. Maximum reduction in verbascose content 24 h (3.33 to 2.90 g/100 g) and 48 h (3.33 to 2.51 g/100 g) after soaking was observed in genotype IC-137194, whereas least effect of the treatment was observed in genotype BRS-2. The maximum reduction with chemical treatment was observed in IC-137194 where verbascose content reduced from 3.33 g/ 100 g to 2.70 g/100 g whereas, minimum reduction was observed in genotype BRS-2 (2.81 to 2.18 g/100 g). Different genotypes revealed complete reduction in verbascose content upon germination and soaking followed by cooking whereas roasting was least effective treatment.

10.13.1.2 Effect of Treatments on Lipoxygenase Activity The effect of different processing techniques on lipoxygenase (LOX) activity is presented in Fig. 10.6. The maximum effect soaking for 24 h was observed in genotype IC-140802 followed by IC-137195, where lipoxygenase activity reduced significantly to 44.30% and 43.80%, respectively, whereas minimum effect was seen in genotype JCR- 163. All eight genotypes revealed complete reduction in LOX activity after soaking for 72 h and germination for 48 h followed by cooking. Among different treatments, germination (48 h) and soaking for 72 h were most effective treatments resulting hundred per cent reduction in lipoxygenase activity whereas, soaking for 24 h was least effective. Reduction in lipoxygenase isozyme activities during germination may be due to their utilization in lipid mobilization during germination. 10.13.1.3 Effect of Treatments on Saponin Content Genotypes JCR-152 and IC-140802 revealed maximum (1.20 g/100 g) and minimum (1.99 g/100 g) reduction in saponin content after soaking for 24 h. The maximum reduction in saponin content was observed after germination (48 h) followed by cooking (30 min) where the saponin content reduced to 1 mg/100 g as compared to control. Genotype BRS-2 (0.60 g/100 g) followed by JCR-20 (0.80 g/100 g) showed highest reduction in saponin content after germination for 48 h. The losses in the saponin content may be attributed to leaching out of theses organic compounds during soaking and reduction in their content during germination may be due to enzymatic degradation. The possible mechanism for the reduction in saponin content in rice bean seed could be due to delinking of the carbohydrate moiety from the aglycone of steroids/triterpenoids bound through glycosidic linkages. The chemical treatment was also effective in genotype JCR-152, which reduced the saponin content to 1.10 g/100 g as compared to control (1.90 g/100 g). The minimum effect was observed in genotype IC-140802 with negligible reduction in saponins. Among different treatments, cooking after germination and soaking caused appreciable reduction in saponin content in almost all genotypes. The study revealed that the soaking of rice bean seeds for 24 h followed by cooking for 30 min, germination for 48 h and germination for 48 h followed by cooking for 30 min were the best processing techniques for the complete removal of raffinose content. Germination (48 h) followed by cooking (15 min), soaking (24 h) followed by cooking (15 min), germination for 48 h and soaking for 72 h were effective

174

10

Tackling Incriminating Factors

Fig. 10.6 Effect of various processing technologies on (a) Raffinose, (b) Stachyose, (c) Verbascose, (d) Lipooxygenases, and (e) Saponin content in the seeds of rice bean genotypes (Katoch 2014). [i: Control; ii: Soaking (24 h); iii: Soaking (48 h); iv: Soaking (72 h); v: Chemical treatments; vi: Roasting; vii: Germination (48 h); viii: Soaking and Cooking; ix: Germination and Cooking]

processing techniques for reducing stachyose content in rice bean seeds whereas, roasting at 100  C for 10 min was least effective treatment. Among different treatments, cooking after germination and soaking caused appreciable reduction in the saponin content. Germination followed by cooking was the most effective treatment, whereas, roasting for 10 min at 100  C was least effective processing technique for reducing the levels of different anti-nutrients in rice bean seeds. The study revealed that germination followed by cooking was the most effective treatment whereas, roasting for 10 min at 100  C was least effective processing technique for reducing the levels of different anti-nutrients in rice bean seeds before routine consumption. With complete knowledge regarding the nutritive profile of rice bean and along with the effectiveness of various processing strategies in reducing the

References

175

anti-nutritional compounds, a concerted effort could be made to encourage people for using rice bean in their diet for meeting the nutrient requirements in general and the availability of proteins in particular. Several factors contribute to the limited use of legumes which include the presence of anti-nutrients, their association with bloating and flatulence as well as their hard-to-cook phenomenon. On the basis of ongoing worldwide research, it has now become clear that underutilized legumes including rice bean possess beneficial nutritional attributes. The presence of certain anti-nutrients should not be considered as hindrance in the use of these legumes as various processing techniques have shown significant reduction in level of different anti-nutrients. The application of modern processing methods with traditional knowledge could be more valuable in making strategies for the commercial exploitation of underutilized legumes. Rice bean has been found to posses beneficial nutritional attributes but presence of antinutrients such as off flavor producing compounds reduces its utilization. Different processing methods are effective in reducing the level of anti-nutrients, the germination followed by cooking has been observed as most effective treatment in reducing the anti-nutritional components from rice bean. It is a simple treatment which enhances the palatability and also increase the digestibility and nutritive value of rice bean. The use of pressure cooking without prior soaking or sprouting of rice bean seeds should be discouraged. The prior soaking of seeds reduces the cooking time and make seeds more digestible for health benefits.

References Afoakwa EO, Budu AS, Merson AB (2007) Response surface methodology for studying the effect of processing conditions on some nutritional and textural properties of bambara groundnuts (Voandzei subterranea) during canning. Int J Food Sci Nutr 58:270–281 Alonso R, Orue E, Marzo F (1998) Effects of extrusion and conventional processing methods on protein and antinutritional factor contents in pea seeds. Food Chem 63:505–512 Alonso R, Aguirre A, Marzo F (2000) Effects of extrusion and traditional processing methods on antinutrients and in vitro digestibility of protein and starch in faba and kidney beans. Food Chem 68:159–165 Bajaj M (2014) Nutrients and antinutrients in rice bean (Vigna umbellata) varieties as effected by soaking and pressure cooking. Asian J Dairy Food Res 33:71–74 Baskaran V, Malleshi N, Shankara R, Lokesh B (1999) Acceptability of supplementary foods based on popped cereals and legumes suitable for rural mothers and children. Plant Foods Hum Nutr 53(3):237–247 Bhattacharya S, Prakash M (1994) Extrusion of blends of rice and chickpea flours: a response surface analysis. J Food Eng 21(3):315–330 Bishnoi S, Khetarpaul N, Yadav RK (1994) Effect of domestic processing and cooking methods on phytic acid and polyphenol contents of pea cultivars (Pisum sativum). Plant Foods Hum Nutr 45:381–388 Chitra U, Singh U, Rao PV (1996) Phytic acid, in vitro protein digestibility, dietary fiber and minerals of pulses as influenced by processing methods. Plant Foods Hum Nutr 49:307–316 Cuadrado C, Hajos G, Burbano C, Pedrosa MM (2002) Effect of Natural Fermentation on the Lectin of Lentils Measured by Immunological Methods. Food Agric Immunol 14:41–49 D’Mello JPF, Walker AG (1991) Detoxification of jackbeans (Canavalia ensiformis): Studies with young chicks. Anim Feed Sci Technol 33:117–127

176

10

Tackling Incriminating Factors

De León L, Elias L, Bressani R (1992) Effect of salt solutions on the cooking time, nutritional and sensory characteristics of common beans (Phaseolus vulgaris). Food Res Int 25:131–136 Dworschak E (1982) Effect of processing on nutritive value of food: fermentation. Int Sys Agric Sci Technol 74:63–76 Egounlety M, Aworh O (2003) Effect of soaking, dehulling, cooking and fermentation with Rhizopus oligosporus on the oligosaccharides, trypsin inhibitor, phytic acid and tannins of soybean (Glycine max Merr.), cowpea (Vigna unguiculata L. Walp) and groundbean (Macrotyloma geocarpa Harms). J Food Eng 56:249–254 Eicher NJ, Satterlee LD (1988) Nutritional quality of Great Northern bean proteins processed at varying pH. J Food Sci 53:1139–1143 Estrada-Giron Y, Swanson BG, Barbosa-Canovas GV (2005) Advances in the use of high hydrostatic pressure for processing cereal grains and legumes. Trends Food Sci Technol 16 (5):194–203 Fernandez MM, Aranda P, Lopez-Jurado M, Urbano G, Estrella E, Sotomayor C, Diaz C, Prodanov M, Frias J, Vidal-Valverde C (1993) Effect of processing on some antinutritive factors of faba beans: Influence on protein digestibility and food intake in rats. In: Recent advances of research in antinutritional factors in legume seeds. Wageningen Pers, Wageningen, p 467 Frías J, Vidal-Valverde C, Kozlowska H, Tabera J, Honke J, Hedley CL (1996) Natural fermentation of lentils: Influence of time, flour concentration and temperature on the kinetics of monosaccharides, disaccharides and alpha-galactosidases. J Agric Food Chem 44:579–584 Ghavidel RA, Prakash J (2007) The impact of germination and dehulling on nutrients, antinutrients, in vitro iron and calcium bioavailability and in vitro starch and protein digestibility of some legume seeds. LWT Food Sci Technol 40(7):1292–1299 Granito M, Frias J, Doblado R, Guerra M (2002) Nutritional improvement of beans (Phaseolus vulgaris) by natural fermentation. Eur Food Res Technol 214:226–231 Gupta RK, Gangoliya SS, Singh NK (2015) Reduction of phytic acid and enhancement of bioavailable micronutrients in food grains. J Food Sci Technol 52:676–684 Han H, Baik B-K (2008) Antioxidant activity and phenolic content of lentils (Lens culinaris), chickpeas (Cicer arietinum L.), peas (Pisum sativum L.) and soybeans (Glycine max), and their quantitative changes during processing. Int J Food Sci Technol 43:1971–1978 Huma N, Anjum M, Sehar S, Issa Khan M, Hussain S (2008) Effect of soaking and cooking on nutritional quality and safety of legumes. Nutr Food Sci 38:570–577 Jaya TV, Venkataraman LV (1981) Changes in carbohydrate constituents of chickpea and greengram during germination. Food Chem 7(2):95 Kadlec P, Dostalova J, Bernaskova J, Skulinova M (2008) Degradation of α-galactosides during the germination of grain legume seeds. Czeck J Food Sci 26(2):99–108 Katoch R (2014) Incriminating factors in rice bean (Vigna Umbellata) and processing techniques for their minimization. Indian J Agric Biochem 27:138–144 Kaur D, Kapoor A (1990) Some antinutritional factors in rice bean (Vigna umbellata): effects of domestic processing and cooking methods. Food Chem 37(3):171–179 Kaur A, Kaur P, Singh N, Virdi AS, Singh P, Rana JC (2013) Grains, starch and protein characteristics of rice bean (Vigna umbellata) grown in Indian Himalaya regions. Food Res Int 54:102–110 Khalil AA (2006) Nutritional improvement of an Egyptian breed of mungbean by probiotic lactobacilli. Afr J Biotechnol 5:206–212 Khattab RY, Arntfield SD (2009) Nutritional quality of legume seeds as affected by some physical treatments 2. Antinutritional factors. LWT Food Sci Technol 42:1113–1118 Kiers JL, Nout RMJ, Rombouts FM (2000) In vitro digestibility of processed and fermented soya bean, cowpea and maize. J Sci Food Agric 80:1325–1331 Kozlowska H, Honke J, Sadowska J, Frias J (1996) Natural fermentation of lentils: influence of time, concentration and temperature on the kinetics of hydrolysis of inositol phosphates. J Sci Food Agric 71:367–375

References

177

Ku S, Wei LS, Steinberg MP, Nelson AI, Hymovitz T (1976) Extraction of oligosaccharides during cooking of whole soybeans. J Food Sci 41:361 Kylen AM, McCready RM (1975) Nutrients in seeds and sprouts of alfalfa, lentils, mung beans and soybeans. J Food Sci 40:1008–1009 Liener IE, Kakade ML (1980) Protease inhibitors. In: Liener IE (ed) Toxic constituents of plant foodstuffs. Academic Press, New York, p 7 Ludikhuyze L, Indrawati, Van den Broeck I, Weemaes C, Hendrickx M (1998) Effect of combined pressure and temperature on Soybean lipoxygenase. 2. Modeling inactivation kinetics under static and dynamic conditions. J Agric Food Chem 46:4081–4086 Luo Y-W, Xie W-H (2013) Effect of different processing methods on certain antinutritional factors and protein digestibility in green and white faba bean (Vicia faba L.). CYTA-Food 11:43–49 Manpreet K, Kawatra BL (2002) Effect of domestic processing on zinc bioavailability from ricebean (Vigna umbellata) diets. Plant Foods Hum Nutr 57(3/4):307–318 Mertens B, Deplace G (1993) Engineering aspects of high-pressure technology in the food industry. Food Technol 43:164–169 Morcos SR, Hegazi SM, El-Damhoughy ST (1973) Fermented foods in common use in Egypt. II: The Chemical composition of bouza and its ingredients. J Sci Food Agric 24:1157–1161 Mubarak AE (2005) Nutritional composition and antinutritional factors of mung bean seeds (Phaseolus aureus) as affected by some home traditional processes. Food Chem 89:489–495 Narasinga Rao BS, Prabhavathi T (1982) Tannin content of foods commonly consumed in India and its influence on ionisable iron. J Sci Food Agric 33:89–96 Ologhobo AD, Apata DF, Oyejide A, Akinpelu RO (1993) A comparison of protein fractions prepared from Lima beans (Phaseolus lunatus) in starter diets for broiler chicks. J Appl Anim Res 4:13–30 Plahar WA, Annan NT, Nti CA (1997) Cultivar and processing effects on the pasting characteristics, tannin content and protein quality and digestibility of cowpea (Vigna unguiculata). Plant Food Hum Nutr 51:343–356 Plahar WA, Annan NT, Larweh PM, Golob P, Swetman T, Greenhaulgh P, Coote C, Hodges R (2002) Marketing and processing of bambara groundnuts (W. Africa). Crop Post Harvest Programme. Food Res. Inst. (FRI): Accra, Ghana Prestamo G, Lesmes M, Otero L, Arroyo G (2000) Soybean vegetable protein (tofu) preserved with high pressure. J Agric Food Chem 48(7):2943–2947 Prudente VR, Mabesa LB (1984) Vitamin content of mungbean [Vigna radiata (L.) Wilzeck] sprouts. Philipp Agr 64:365–370 Rawn-David J (1983) Biochemistry, vol 9. Harper and Row Publishers, New York, p 114 Reddy NR, Balakrishna CN, Salunkhe DK (1978) Phytate, phosphorus and mineral changes during germination and cooking of black gram (Phaseolus mungo) seeds. J Food Sci 43:540 Saalia FK, Phillips RD (2011) Degradation of aflatoxins by extrusion cooking: Effects on nutritional quality of extrudates. LWT-Food Sci Technol 44(6):1496–1501 Saharan K, Khetarpaul N, Bishnoi S (2001) Processing of newly released rice bean and fababean cultivars: changes in total and available calcium, iron and phosphorus. Int J Food Sci Nutr 52:413–418 Saikia P, Sarkar CR, Borua I (1999) Chemical composition, anti-nutritional factors and effect of cooking on nutritional quality of rice bean Vigna umbellata (Thunb; Ohwi and Ohashi). Food Chem 67:347–352 Sat IG, Keles F (2004) Effect of processing on certain antinutrients in seeds of seker variety (P. vulgaris L.) grown in Turkey. Int J Food Prop 7:121–128 Sefa-Dedeh S, Stanley DW (1979) The relationship of microstructure of cowpeas to water absorption and dehulling properties. Cereal Chem 56:379–386 Sharma A, Sehgal S (1992) Effect of domestic processing, cooking and germination on the trypsin inhibitor activity and tannin content of faba bean (Vicia faba). Plant Foods Hum Nutr 42:127–133

178

10

Tackling Incriminating Factors

Shimelis EA, Rakshit SK (2007) Effect of processing on antinutrients and in vitro digestibility of kidney bean (Phaseolus vulgaris L) varieties grown in East Africa. Food Chem 103:161–172 Silva CAB, Bates RP, Deng C (1981) Influence of pre-soaking on black bean cooking kinetics. J Food Sci 46:1721 Sinha R, Kawatra A (2005) Effect of processing on phytic acid and polyphenol contents of cowpeas (Vigna unguiculata (L) Walp). Plant Foods Hum Nutr 58(3):1–8 Sotelo A, Flores F, HernaÂndez M (1987) Chemical composition and nutritional value of Mexican varieties of chickpea (Cicer arietinum L.). Plant Foods Hum Nutr 37:299–306 Stanley DW, Aguilera JM (1985) A review of textural defects in cooked reconstituted legumes The influence of structure and composition. J Food Biochem 9:277–323 Steinkraus KH (1983) Lactic acid fermentation in the production of foods from vegetables, cereals and legumes. Antonie van leeuwenhoek 49:337–348 Svanberg U, Lorri W (1997) Fermentation and nutrient availability. Food Control 8:319–327 Tepal JA, Castellanos R, Larios A, Tejada I (1994) Detoxification of jack beans (Canavalia ensiformis): I.—Extrusion and canavanine elimination. J Sci Food Afric 66:373–379 Tharanathan RN, Mahadevamma S (2003) Grain legumes-a boon to human nutrition. Trends Food Sci Tech 14:501–518 Tiwari BK, Singh N (2012) Pulse chemistry and technology. Royal Society of Chemistry, Cambridge Toledo TCF, Canniatti-Brazaca SG (2008) Chemical and nutritional evaluation of Carioca beans (Phaseolus vulgaris L.) cooked by different methods. Cieˆncia e Tecnologia de Alimentos 28:355–360 Torres A, Frias J, Granito M, Vidal-Valverde C (2006) Fermented pigeon pea (Cajanus cajan) ingrdients in paste products. J Agric Food Chem 54(18):6685–6691 Udayasekhara Rao P, Belavady B (1978) Oligosaccharides in pulses: varietal differences and effects of cooking and germination. J Agric Food Chem 26:316–319 Vidal-Valverde C, Frias J, Estrella I, Gorospe MJ, Ruiz R, Bacon J (1994) Effect of processing on some antinutritional factors of lentils. J Agric Food Chem 42:2291–2295 Wang N, Hatcher DW, Toews R, Gawalko EJ (2009) Influence of cooking and dehulling on nutrional compostion of several varieties of lentils (Lens culinaris). LWT-Food Sci Technol 42:842–848

Rice Bean Foliage as Fodder

11

Livestock rearing is an integral part of crop farming which contributes substantially to the rural livelihood. Livestock on other hand convert dry and green roughages into milk, meat and other valuable byproducts. The availability of by product is not the sole advantage associated with livestock production, but they also provide a source of income to the farmers. Types and number of livestock raised by smallholder farmers and their associated production systems are greatly influenced by the regularity in the availability of feed resources. Due to intense urbanization and expanding human, as well as livestock population, the demands for animal products is increasing, whereas the main feed resources for livestock feeding are continuously depleting. The shortage of fodder is one of the major obstacles in the success of any livestock production programme. Non-availability of quality fodder makes farmers to become heavily dependent on crop residues and other crop by products for meeting the requirements of the livestock. However, these feeding resources possess poor nutritive profile, hence often considered as low-quality forage sources. This overreliance is associated with increased probability of malnutrition, poor growth and incidence of various diseases in animals which ultimately reduces the livestock productivity. In view of the priority for food grains, oilseeds and pulses, there is a little scope for increasing the area under fodder cultivation. For improving animal productivity, leguminous forages having dual purpose i.e., seed and fodder usage therefore these crops must be cultivated and integrated in the farming system on a large scale. The fodder obtained from leguminous forages has excellent nutritive profile which is mainly attributed to high protein content with good proportion of minerals and vitamins. Comparative analysis of grasses and forage legumes reveals the superiority of forage legumes over forage grasses. Forage legumes can be easily grazed, harvested and even stored as hay or silage. A sustainable strategy of improving nutritive quality of forage grasses and their byproducts is through supplementation with leguminous fodder. Besides being highly nutritious, leguminous fodder also offer

# Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_11

179

180

11

Rice Bean Foliage as Fodder

several advantages in maintaining the sustainability and reproducibility of environment. Rice bean, having dual-purpose character makes it a very attractive crop for mixed cropping system where land is becoming scarce for the cultivation of pulse as well as forage crops. The vegetative parts can be fed fresh or made into hay and seeds can also be used for feeding purpose. The luxurious growth habit of rice bean makes it possible to produce large amount of biomass. This type of potential is not possible in other grain legumes such as lentil and black gram due to their short growing and erect habit. Rice bean is therefore, the must grown potential legume for fodder production and crucial for crop-livestock integration farming. Despite of being a potential fodder crop, its use in livestock production system is still marginal. In this context, it is imperative to have the advantage of the nutritive value and productivity of this forage resource.

11.1

Fodder Production Potential of Rice Bean

Rice bean, owing to its high fodder production potential is receiving attention in livestock feeding. The climatic requirements of rice bean are similar to cowpea which is a well recognized source of quality fodder. The remarkable drought tolerance, feasibility for cultivation in marginal soils and aberrant growing conditions enhance the scope of the cultivation of this crop for fodder availability during scarcity periods. Rice bean plant retains greenness for a longer period and supply green fodder usually when other leguminous fodders are scare. The areas where shortage of fodder is prominent, it suits well with forage production programmes due to its short life cycle and high fodder yield without hampering seed production. The vegetative parts of rice bean can be fed fresh or made into hay and the moreover, seeds can also be used as a livestock feed component. The fodder from the plant includes the stems, leafy portions, empty pods, and some seeds (Göhl 1982). Rice bean can be intercropped with cereal forages particularly with sorghum and maize to improve the quality of mixed forage. Furthermore, the productivity of the cropping system gets improved due to nitrogen fixing ability of rice bean. In the North Eastern Indian hills, farmers consider rice bean as a grain and fodder legume (Khanal et al. 2009). Rice bean is generally sown in July–August and harvested either when the crop attains maximum vegetative growth or at 25% flowering for obtaining high fodder yield. In India, the late maturing and photosensitive landraces of rice bean are cultivated for fodder because it can take advantage of a longer growing season to produce more biomass. They are sown during long-day periods in order to prevent the plant from blooming. In Bengal (India), yield of rice bean forage have reported from 5 to 7 t DM/ha from the crop harvested from May to June and 8 to 9 t DM/ha in November-December under favorable

11.1

Fodder Production Potential of Rice Bean

181

conditions (Chatterjee and Dana 1977). However, variations have been observed in different growing conditions. In a study conducted on 15 rice bean genotypes, fresh fodder yield of more than 15 t/ha has been recorded by Mandal and Mukherjee (1999). Although, high forage yield (37.50 t/ha) has also been recorded by Bhattacharya and Mukherjee (1998) from rice bean cultivar K-1 after 100 days of sowing. The study on the fodder production potential and quality of different rice bean genotypes of Group-I, Group-II and Group-III was conducted and the outcome on different aspects has been discussed below.

11.1.1 Fodder Yield of Rice Bean Genotypes of Group-I Green fodder yield, being a complex trait, is the interactive effect of various yield attributing traits. The green fodder yield from first group (G-1) of rice bean genotypes after 115 days of sowing has been presented in Table 11.1. Among 30 genotypes, the highest fodder yield was recorded in genotype IC-137200 (356.66 q/ha) while least fodder yield was recorded in genotypes Panchrukhi (151.10 q/ha) Baroi (160.98 q/ha) and Dhagwar (163.60 q/ha). The lower forage yield from local germplasm may be attributed to their low height and early flowering. It was observed that the genotype flowering early produces less fodder. The plant height after 50 days after sowing also has positive co-relation with fodder yield (0.54) along with 25% and 50% flowering. The co-relational analysis also Table 11.1 Fodder yield from different rice bean genotypes Genotype IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804

Fodder yield (q/ha) 248.49 228.76 251.74 226.25 311.33 284.74 253.93 312.92 244.63 356.66 258.76 291.39 301.59 266.90 290.83 284.20

Genotype IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223-B JCR-12 JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Baroi CD (5%) SE (m) CV

Fodder yield (q/ha) 319.54 282.88 236.16 300.43 200.45 282.38 259.30 242.33 241.70 190.56 214.20 163.60 151.10 160.98 3.042 1.51 0.728

182

11

Rice Bean Foliage as Fodder

revealed significant positive co-relation between plant height after 115 days of sowing and fodder yield (0.63).

11.1.2 Fodder Yield from Rice Bean Genotypes of Group-II The green fodder yield from the different rice bean genotypes of LRB-series (G-2) has been presented in Table 11.2. The genotypes LRB-176 (402.67 q/ha) followed by LRB-127 (393.06 q/ha), and LRB-156 (349.33 q/ha) were high fodder yielding genotypes. The low fodder yield was observed for LRB-40-1 (240.67 q/ha) followed by LRB-128 (240.67 q/ha), LRB-134 (244.00 q/ha), LRB-135 (256.00 q/ha) and LRB-158 (268.67 q/ha). Although, genotype Baroi was of low height but it produced considerably higher fresh fodder yield due to exuberant lateral growth, therefore it could be interpreted that the plant height is not always a positive criteria for higher green fodder yield in ricebean but also attributed to branching and lateral growth pattern. Table 11.2 Variation in fodder yield from different rice bean genotypes (Group-II)

Genotype(s) LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Local Baroi GM CV CD (%) SE(m)

Green fodder yield (q/ha) 291.33 240.67 253.73 293.87 252.40 393.06 240.67 244.00 256.00 333.33 310.00 349.33 268.67 270.67 292.67 402.67 290.00 293.12 32.94 NS –

11.1

Fodder Production Potential of Rice Bean

183

11.1.3 Fodder Yield from Rice Bean Genotypes of Group-III The variation in fodder yield of rice bean genotypes of group III (JCR-series) has been presented in Table 11.3. The higher fodder yield was recorded in genotype JCR-93 (384.67 q/ha), JCR-152 (333.33 q/ha), JCR-162 (303.33 q/ha) and JCR-20 (296.67 q/ha). The genotype with lower fodder yield were JCR-81 (191.33 q/ha) followed by JCR-171 (198.00 q/ha), JCR-54 (240.67 q/ha) and JCR-149 (204.67 q/ ha). Green fodder yield is directly related with plant height but certain other factors such as number of branches and leaf area also have significant effect on fodder yield. The rating of rice bean genotypes based on biomass productivity revealed that the genotypes IC-137200, IC-137190, IC-137195, IC-140796, IC-140798, IC-140805, IC-016789 and IC-140804 were promising in producing large quantity of fodder from group-I while LRB-176, LRB-127, LRB-156, LRB-140, LRB-141 were from the second group. In group-III, the genotypes JCR-93, JCR-152, JCR-107, JCR-162 and JCR-20 were highest fodder yielding genotypes (Table 11.4). Table 11.3 Fodder yield from rice bean genotypes of Group-III

Genotype(s) JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Local GM CV CD (%) SE(m)

Green fodder yield (q/ha) 296.67 240.67 266.00 191.33 384.67 302.00 204.67 333.33 303.33 228.67 198.00 278.67 266.67 284.51 40.91 NS –

Table 11.4 Promising genotypes for fodder yield Group I II III

Genotype IC-137200, IC-137190, IC-137195, IC-140796, IC-140798, IC-140805, IC-016789, IC-140804 LRB-176, LRB-127, LRB-156, LRB-140, LRB-141 JCR-93, JCR-152, JCR-107, JCR-162, JCR-20

184

11.2

11

Rice Bean Foliage as Fodder

Biochemical Composition of Rice Bean Forage

Good nutritive quality forages are the main requisites of any livestock operation and they are also laid the foundation of most rations in animal diets. The quality of forages defines as the optimum level of essential macro and micronutrients that can be derived from it by animals and the presence and the level of any toxic compounds which could reduce the animal performance or threaten the animal health. The nutritional quality of forages also defines a function of nutrient concentration in the herbage, intake potential, nutrient availability and partitioning of metabolized products in the animals. In most situations, intake of energy and protein determine the animal performance and the forage quality. Intake of available energy is primarily a function of plant cell wall constituents. Available energy and protein in forages are often low relative to animal requirements. The forage maturity is the most important factor determining the amount of available energy and protein in forages. Additionally environment also has significant impact on the quality of forages. Livestock productivity is the ultimate test of forage quality. If the animal has the genetic potential, animal production of forage-based diets depends on the nutritive value of forage. Importantly, the performance of livestock depends on the intake of the forage. Rice bean fodder is nutritive fodder for the livestock with appreciable nutritional content. The foliage from ricebean is more palatable with protein content comparable with other fodder legumes like cowpea (Vigna unguiculata) and moth bean (Vigna aconitifolia) (Heuzé et al. 2016). Dry matter (DM) is important component for the determination of chemical composition and nutritive value. It varies greatly with different type of feed and fodders. Therefore, DM content can be the biggest reason for variation in the composition of feedstuff. The accumulation of dry matter in rice bean increases as the maturity advances that improves the nutritive value. There is positive relationship between the dry matter accumulation and plant maturity. The maximum yield of digestible dry matter is at first flowering stage in legumes (Wattiaux 1994). The dry matter content in rice bean fodder varies from 14.74% to 20.81% (Katoch 2010) (Table 11.5).

Table 11.5 Comparative nutritional profile of leguminous forages Nutritional constituents Dry matter (%) Crude protein (%) Crude fiber (%) NDF (%) ADF (%) Ether extract (%) Ash (%)

Rice bean 21.40 19.00 30.80 59.70 38.90 1.80 10.40

Source: Heuzé et al. (2016)

Cowpea 20.90 18.10 24.10 38.60 27.10 2.80 11.30

Mung bean 26.90 17.10 22.50 28.40 – 3.00 11.40

Alfalfa 19.90 20.60 26.70 39.30 30.90 2.90 11.50

Berseem 12.50 19.90 22.30 44.80 27.60 3.20 15.40

White clover 16.80 24.90 19.60 27.50 22.10 2.70 11.30

11.2

Biochemical Composition of Rice Bean Forage

185

11.2.1 Nutritional Constituents in Rice Bean Forage 11.2.1.1 Crude Protein Livestock particularly need substantial quantities of protein in their feed for their growth and productivity. In animals, protein functions in the growth and repair of body tissue, synthesis of enzymes and hormones and also in the supply of energy. The level of CP content is commonly used to measure forage quality. Higher the CP content in forages, more will be the nutritional quality. Rice bean forage is an excellent source of protein to livestock. The protein content in rice bean fodder is comparable or higher than other traditional leguminous forages. The biochemical evaluation of rice bean genotypes of Group-I revealed crude protein content from 13.59% (IC-137188) to 18.92% (IC-137190) (Table 11.6) (Katoch et al. 2007). The genotypes IC-137188, IC-137195, IC-137200, IC-140802 and IC-140803 have low crude protein content. The genotype IC-137190 has highest protein content in the group. In LRB series (Group-II) of rice bean genotypes, the crude protein content varied from 13.12% (LRB-164) to 16.92% (LRB-156) (Table 11.7). Among these genotypes, LRB-164, LRB-40-1, LRB-45, LRB-127 and LRB-168 were with lower percentage of crude protein. In rice bean genotypes of JCR series, the protein content was within the range of 13.12% (JCR-54) to 17.20% (JCR-79) (Table 11.8). Genotypes JCR-54, JCR-93, JCR-20, JCR-107, and JCR-152 were with lower protein content. The rice bean fodder enhances the intake of other roughages when these are fed in combination. 11.2.1.2 Crude Fiber Crude fiber also called as roughage, consists of complex structural carbohydrates. The main constituents of crude fiber are NDF, ADF, cellulose, hemi-cellulose, lignin, pectin and cutin substances. The high fiber content in forages is postulated to have positive physiological effects in animals like reducing the transit time of food material in gastrointestinal tract. This help in relieving the problem constipation and diverticular disease. The fodder crude fiber content in the rice bean genotypes of Group-I was in the range of 18.70% (Dhagwar and Panchrukhi) to 25.87% (IC-140805) (Table 11.6). The mean crude fiber content in rice bean genotypes of LRB series (Group-II) was from 21.10% to 35.70% (Table 11.7). The genotypes with higher crude fiber content were LRB-40-1 (35.70%) followed by LRB-134 (34.70%), LRB-164 (34.20%) and LRB-135 (33.70%). The crude fiber in fodder of group-III genotypes (JCR series) was in range from 27.13% to 32.30% (Table 11.8). The highest crude fiber containing genotypes were JCR-54 (32.30%), JCR-163 (31.67%), JCR-93 (31.13%) and JCR-20 (31.06%). 11.2.1.3 Total Soluble Carbohydrates Carbohydrates form one of the important nutritional attributes as these are considered as readily available source of energy. The level of total available carbohydrates

186

11

Rice Bean Foliage as Fodder

Table 11.6 Biochemical composition of foliage of rice bean genotypes (G-1) Genotype (s) IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223B JCR-12 JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Local (C) CD (5%) SE(m)

Crude protein (%) 16.07 17.34 13.59 15.99 18.92 17.15 15.20 14.07 15.39 14.17 15.09 15.11 15.86 14.35 14.25 17.81 16.62 16.60 16.93 15.33 17.10 15.29 18.77

Crude fiber (%) 19.93 19.97 22.53 20.43 19.73 22.87 23.37 24.37 22.47 24.70 23.73 23.33 24.93 25.60 22.83 20.37 25.87 22.63 22.97 23.80 21.30 20.83 19.40

Total soluble carbohydrate (%) 10.44 9.82 12.69 11.72 9.99 8.29 10.60 10.06 10.00 7.78 9.90 10.05 10.61 10.06 9.48 8.83 8.95 9.20 10.99 11.28 7.79 8.70 7.33

Total ash (%) 1.80 1.33 1.27 1.53 1.27 1.67 1.33 1.33 1.60 1.13 1.00 1.53 1.60 1.20 1.60 1.33 2.33 2.13 1.83 1.93 1.33 2.33 1.06

15.44 16.13 16.8 17.20 15.95 15.11 16.79 2.28 0.81

19.03 19.80 19.93 20.37 18.70 18.70 17.80 3.77 1.33

9.02 8.81 9.12 9.29 12.21 11.90 12.20 N.S. 1.21

1.60 1.27 1.40 1.27 2.50 0.80 1.47 0.66 0.28

in plants is helpful in indicating the period of storage and also helpful in evaluating the potential for re-growth and persistence in adverse climatic conditions. In plants, there are two major types of carbohydrates, referred as structural and storage carbohydrates. The structural carbohydrates make up the fiber portion of the plants, whereas storage carbohydrates make up the cell content. The performance and productivity of livestock is highly associated with the level of non-structural carbohydrates in forages. High level of non-structural carbohydrates allows more efficient utilization of nitrogen in the rumen (Miller et al. 2001; Lovett et al. 2004).

11.2

Biochemical Composition of Rice Bean Forage

187

Table 11.7 Biochemical composition of foliage of rice bean genotypes (G-2) Genotype(s) LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Local Baroi GM CV CD (5%) SE(m)

Crude protein (%) 14.87 13.41 15.16 13.41 16.33 14.29 16.04 15.16 14.58 16.33 16.04 16.92 16.92 13.12 14.87 16.62 16.33 15.30 12.80 NS 1.06

Crude fiber (%) 30.30 35.70 27.30 21.10 26.00 28.07 32.67 34.70 33.77 27.53 30.07 29.53 29.20 34.20 33.17 29.70 30.73 30.57 13.21 NS 2.33

Total Carbohydrates (%) 11.44 12.19 15.96 16.85 17.46 14.65 13.92 14.00 12.11 12.38 12.48 12.02 13.25 15.79 13.43 12.34 13.56 13.92 2.06 8.93 0.72

Total ash (%) 0.73 1.07 0.40 1.00 1.60 0.27 0.60 0.60 0.27 0.33 0.33 0.73 0.73 0.27 0.60 1.07 0.40 0.65 18.80 0.20 0.068

Table 11.8 Biochemical composition of foliage of rice bean genotypes (G-3) Genotype(s) JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Local GM CV CD (5%) SE(m)

Crude protein (%) 14.29 13.12 17.20 15.45 13.70 14.29 16.91 14.87 15.16 16.62 16.33 16.04 14.58 15.27 8.00 2.05 0.70

Crude fiber (%) 31.06 32.30 28.26 30.66 31.13 30.97 28.40 27.13 30.43 31.67 28.83 30.37 30.90 30.16 12.95 NS 2.25

Total Carbohydrates (%) 11.74 11.41 8.86 7.44 10.35 10.21 8.82 10.34 7.14 8.31 9.01 9.71 8.62 9.38 0.89 5.69 0.14

Total ash (%) 1.53 0.60 0.47 1.13 1.06 0.93 0.67 0.93 0.93 0.87 1.00 1.27 0.93 0.95 47.45 NS 0.258

188

11

Rice Bean Foliage as Fodder

The amount of total carbohydrates in a fodder also determines the nutritive value of forage. Total carbohydrates in forage of rice bean genotypes of group–I were in range from 7.33% (EC-48223-B) to 12.69% (IC-137188) (Table 11.6). The level of total carbohydrate in forage from the rice bean genotypes of group-II was from 11.44% to 17.46%. The genotypes LRB-126 (17.46%), LRB-145 (16.85%) and LRB-164 (15.79%) had highest level of total carbohydrates (Table 11.7). In JCR series of rice bean, the level of total carbohydrates was from 7.14% to 11.74%. Total carbohydrates were high in genotype JCR-20 (11.74%) followed by JCR-54 (11.41%), JCR-93 (10.35%) and JCR-152 (10.34%) (Table 11.8).

11.2.1.4 Total Ash Ash is the inorganic residue remaining after the water and organic matter is removed by heating in the presence of oxidizing agents and represents the total of mineral elements as well as nutritionally undesirable silica content. Minerals are important factors in nutrition of animals both as a whole and as individual ingredients. Farm animals, especially those in active stage of growth, in advanced state of pregnancy and producing liberal quantities of milk are prone to suffer from lack of calcium and phosphorus. The feeding stuffs vary markedly in their calcium and phosphorus contents and their absorbability in the animal system depends on the combination with other constituents of feeds. Apart from sodium and chlorine (common salt), calcium and phosphorus, such microelements as iron, copper, manganese, iodine, and cobalt in small quantities by farm animals, when insufficient or absent, in feeding stuffs cause considerable setback in animal productivity. • In 30 rice bean genotypes (group-I), the ash content was in range of 1.06% to 2.50%. The highest ash content was observed in genotype Dhagwar (2.50%) followed by IC-140805 (2.33%), IC-019352 (2.33%) and IC-140808 (2.13%). Genotypes IC-140795 (1.00%), followed by EC-48223-B (1.06%), IC-137200 (1.13%), IC-140802 (1.20%) and IC-137188 (1.27%) had low ash content (Table 11.6). • In group-II (LRB series), the high ash content was recorded in genotype LRB-126 (1.60%) followed by LRB-40-1 (1.07%), LRB-176 (1.07%) and LRB-45 (1.00%), while the ash content was low in LRB-127(0.27%), LRB-164 (0.27%), LRB-140 (0.33%), LRB-141 (0.33%) and LRB- 127(0.27%) (Table 11.7). • The ash content in JCR series of rice bean genotypes (Group-III) ranged from 0.47% to 1.53%. The genotypes JCR-20 (1.53%), JCR-178 (1.27%), JCR-81 (1.13%) and JCR-93 (1.06%) were highest ash containing genotypes (Table 11.8).

11.2.1.5 Cell Wall Constituents Hemicellulose and cellulose are two important constituents of plant cell wall. Cellulose is the single most abundant component in cell walls and composed exclusively of linear glucose chains linked by β-1, 4 glycosidic linkages.

11.2

Biochemical Composition of Rice Bean Forage

189

Hemicellulose consists of polymers of pentoses, hexoses and sugar acids (Xylans, glucoronic acids). Hemicelluose serves as a cementing material between lignin and cellulose fibrils and make cell wall more rigid (Laureano-Perez et al. 2005). Cellulose and hemicellulose can be broken down by enzymatic action of bacteria and other microbes in the animal’s digestive tract, though their digestion is markedly slower than the digestion of sugars, starches, and other freely available non-structural carbohydrates. In contrast, lignin is not carbohydrate-based but is a phenolic compound. As such, lignin is not digestible and the presence of lignin acts as a physical barrier to the microbial enzymes which break down cellulose and hemicellulose. The high Neutral detergent fiber (NDF) content indicates high fiber content in forage, therefore low NDF content in fodder is desirable. The ADF fraction of forages is moderately indigestible. Feeding trial and laboratory testing have shown that high ADF values are associated with decreased digestibility; therefore, a low ADF is better for good digestibility of forage. NDF content has traditionally been used as a predictor of forage intake, while ADF has been used as a predictor of forage digestibility. These relationships are used to calculate relative feed value (RFV). The neutral detergent fiber (NDF) content represents the total fiber fraction (cellulose, hemicellulose and lignin) which make up the cell wall. The NDF content in forages varies from 10% to 80%. High level of NDF content in the cell wall reduces the digestibility of any forage crop, hence, considered as an important indicator of forage digestibility. The ADF content has also been used as a predictor of forage digestibility. The concentration of ADF increases with the advancement in maturity of the forage crops (Dabo et al. 1988). Lignin is considered as an anti-quality component in forages because of its negative impact on the availability of nutrients. Lignin is an integral component of plant cell wall which form structural framework of plant architecture (Varner and Lin 1989; Moore and Jung 2001). The most important function of lignin is to provide strength and rigidity to plants. It is also important in limiting the water loss by rendering the permeability of the cell wall. All of these attributes are desirable from the perspective of plant function and survival, but it limits the nutritive value of forage crop for livestock. The main anti-quality role of lignin in forages is in limiting digestion of the structural polysaccharides (Hatfield et al. 1999; Moore and Hatfield 1994). Lignification controls the amount of fiber that can be digested and therefore has a direct and often important impact on the digestible energy and dry matter intake (Mertens et al. 1994; Jung and Allen 1995). The undigested portion of the forage passes slowly through the gastro-intestinal tract and contributes to the fill effect of the diet. Greater the concentration of undigested fiber in the diet, lesser it will be consumed by livestock. Therefore, lignification reduces nutritive value of forages by decreasing digestible energy and limiting dry matter intake (Moore et al. 1993). Neutral Detergent Fiber (NDF) The NDF content in foliage of rice bean genotypes (Group-I) varied from 45.73% to 52.67%. The highest NDF content was observed in the genotypes IC-019352

190

11

Rice Bean Foliage as Fodder

Table 11.9 Cell wall constituents in foliage from different rice bean genotypes (G-1) Genotype(s) IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223-B JCR-12 JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Local (C) CD (5%) SE(m)

NDF (%) 45.73 51.13 46.00 47.00 46.47 49.20 45.53 46.13 46.40 50.47 50.00 48.93 48.33 51.60 50.53 48.33 50.33 50.20 45.27 47.00 48.33 52.67 51.50 48.60 48.27 52.20 47.13 51.40 49.00 45.93 4.36 1.54

ADF (%) 40.07 39.33 40.00 40.06 39.67 42.33 40.33 39.73 38.60 41.33 43.27 40.67 39.33 41.20 40.60 39.80 42.20 39.20 41.00 41.50 40.40 42.93 40.47 40.67 40.07 43.73 41.40 40.93 40.67 40.07 1.51 0.53

Hemi-cellulose (%) 5.53 11.80 6.00 6.90 6.80 6.90 5.20 7.00 7.10 8.30 7.50 8.50 8.40 10.80 9.40 7.40 9.10 10.80 4.30 5.60 7.10 10.50 10.50 7.50 5.50 9.50 5.40 11.10 8.10 5.90 NS –

Lignin (%) 12.00 11.73 10.73 12.93 14.27 13.60 15.00 12.20 13.87 15.40 12.50 12.20 10.70 13.87 15.73 15.80 15.20 18.08 14.33 12.27 14.73 15.27 13.07 14.27 12.33 15.53 16.67 17.40 15.27 17.47 1.59 0.56

(52.67%) followed by JCR-52 (52.20%), IC-140802 (51.60%), and Dhagwar (51.40%), whereas the lowest values were for the genotypes IC-016771 (45.27%), IC-137194 (45.53%), IC-137186 (45.73%), IC-137188 (46.00%) and IC-137195 (46.13%) (Table 11.9). The NDF content in rice bean forage (Group-II) varied from 45.80% to 52.27%. The highest value for NDF content was observed in LRB-164 (52.27%) and the lowest value was observed for LRB-128 (45.80%) (Table 11.10). In JCR series, the NDF % content varied from 48.00% (JCR-79) to JCR-81 to Panchrukhi (52.93%) (Table 11.11). The other genotypes JCR-20 (52.53%), JCR-152 (52.40%) and JCR-162 (51.33%) had higher NDF content, whereas JCR-149 (48.06%) and JCR-171 (48.47%) had lower NDF content (Table 11.12).

11.2

Biochemical Composition of Rice Bean Forage

191

Table 11.10 Cell wall constituents in foliage from different rice bean genotypes (G-2) Genotype(s) LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Local Baroi GM CV CD (5%) SE(m)

NDF (%) 49.80 51.67 50.06 49.67 48.87 48.60 45.80 47.93 49.80 49.60 50.27 49.13 51.27 52.27 46.53 51.40 48.00 49.45 NS 5.16 1.47

ADF (%) 41.67 40.60 42.07 39.00 40.20 41.67 40.60 40.67 42.87 41.80 43.33 42.00 38.93 47.00 39.93 43.73 37.67 41.40 4.12 6.00 2.05

Hemi-cellulose (%) 8.13 11.07 8.00 10.67 8.67 6.93 5.20 7.26 6.93 7.80 6.93 7.13 12.33 5.27 6.60 7.67 10.33 8.05 27.04 3.62 1.25

Lignin (%) 15.60 15.87 16.80 14.20 14.87 12.40 12.67 13.70 10.80 12.20 11.87 13.73 10.53 10.00 12.93 13.60 8.87 12.97 19.94 4.30 1.49

Table 11.11 Cell wall constituents in foliage from different rice bean genotypes (G-3) Genotype(s) JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Local GM CV CD (5%) SE(m)

NDF (%) 52.53 50.33 48.00 48.00 50.07 49.33 48.06 52.40 51.33 49.40 48.47 49.93 52.93 50.06 6.65 NS 2.18

ADF (%) 43.13 42.33 39.86 41.60 43.60 44.86 42.20 42.00 45.46 43.00 41.80 45.40 43.87 43.01 6.58 NS 1.63

Hemi-cellulose (%) 9.40 8.00 8.14 6.40 6.47 4.47 5.87 10.40 5.87 6.40 6.67 4.53 9.06 7.05 47.40 NS 19.29

Lignin (%) 9.93 9.73 9.40 11.47 10.73 11.87 10.27 11.47 11.00 14.07 13.00 10.53 13.20 11.28 NS 20.76 1.35

192

11

Rice Bean Foliage as Fodder

Table 11.12 Anti-nutrients in forage from different rice bean genotypes Genotype (s) IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801 IC-019352 EC-48223B JCR-12 JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Local (C) GM CV CD (5%) SE(m)

Total phenols (%) 0.93 1.14 1.03 0.96 1.15 1.11 0.83 1.21 1.05 1.03 0.99 1.13 1.06 0.95 1.06 0.97 0.83 1.08 1.04 0.98 1.06 1.18 1.08

Simple phenols (%) 0.35 0.35 0.33 0.29 0.39 0.33 0.35 0.35 0.38 0.35 0.34 0.35 0.33 0.31 0.35 0.31 0.32 0.32 0.29 0.29 0.32 0.33 0.33

Total tannins (%) 0.58 0.79 0.70 0.66 0.75 0.78 0.48 0.86 0.68 0.67 0.65 0.78 0.73 0.61 0.71 0.66 0.50 0.76 0.74 0.68 0.75 0.85 0.75

Condensed tannins (%) 0.044 0.047 0.037 0.050 0.056 0.041 0.036 0.036 0.041 0.040 0.042 0.042 0.043 0.044 0.039 0.042 0.043 0.041 0.045 0.050 0.043 0.054 0.053

Hydrolysable tannins (%) 0.53 0.74 0.66 0.60 0.69 0.74 0.44 0.82 0.64 0.63 0.60 0.74 0.68 0.57 0.67 0.62 0.46 0.72 0.69 0.63 0.70 0.80 0.69

0.95 0.98 0.94 0.93 0.86 0.87 1.08 1.01 13.23 0.21 –

0.32 0.41 0.35 0.38 0.31 0.35 0.36 0.34 11.27 NS –

0.62 0.57 0.59 0.56 0.54 0.52 0.73 0.66 21.44 NS –

0.043 0.042 0.042 0.043 0.041 0.043 0.041 0.044 18.63 NS –

0.58 0.53 0.55 0.51 0.50 0.48 0.68 0.63 22.70 NS –

Acid Detergent Fiber (ADF) The ADF content in foliage from rice bean genotypes of group-I ranged from 39.20% to 43.27%. The genotypes IC-140808 (39.20%), IC-137199 (38.60%), IC-140798 (39.33%), IC-137187 (39.33%) and IC-137190 (39.67%) had the lowest value of ADF content. These genotypes with low ADF are suitable for fodder

11.2

Biochemical Composition of Rice Bean Forage

193

purpose. The highest values of ADF content observed for genotypes IC-140795 (43.27%), IC-019352 (42.93%), IC-137191 (42.33%) and IC-140805 (42.20%) (Table 11.9). In LRB series (Group-2), the ADF content varied from 38.93% to 42.87%. The lowest ADF content recorded in the genotype Baroi (37.67%), LRB-158 (38.93%), LRB-45 (39.00%) and LRB-168 (39.93%) (Table 11.10). The ADF content in JCR series (group-3) of rice bean genotypes (group-III) varied from 39.86% to 45.46%. The lowest values of ADF content was observed in the genotype JCR-79 (39.86%), JCR-81 (41.60%), JCR-171 (41.80%) and JCR-152 (42.00%) (Table 11.11).

Hemicellulose Content The hemicellulose content in foliage of rice bean genotypes (Group-I) varied from 4.30% to 11.80%. The genotypes IC-137187, Dhagwar, IC-140802, IC-140808, IC-019352, and EC-48223B have high level of hemicellulose. The lowest hemicellulose was observed for the genotypes IC-016771 (4.30%), IC-137194 (5.20%), JCR-76 (5.40%), IC-137186(5.53%) and IC-016789 (5.60%) (Table 11.9).The hemicellulose content in forage from rice bean genotypes (Group-II) varied from 5.20% (LRB-128) to 12.33% (LRB-158). All genotypes except LRB-45 (10.67%), LRB-40-1 (11.07%) and LRB-158 (12.33%) had lower hemicellulose content (Table 11.10). In JCR series, the genotypes JCR-152 (10.40%), JCR-20 (9.40%), Panchrukhi (9.06), JCR-79 (8.14%) and JCR-54 (8.00%) had high hemicellulose, whereas, genotype JCR-178 (4.53%), JCR-162 (5.87%) and JCR-149 (5.87%) were with low hemicellulose content (Table 11.11).

Lignin Content The lignin content in foliage of rice bean genotypes of group-I ranged from 10.70% to 17.47% (Katoch et al. 2007). The genotypes Baroi (17.47%), Dhagwar (17.40%), IC-140804 (15.80%), IC-140803 (15.73%), JCR-52 (15.53%) and IC-137200 (15.40%) had highest lignin content in their foliage. The low level of lignin content was in genotype IC-140798 (10.70%) followed by IC-137188 (10.73%), IC-137187 (11.73%) and IC-137186 (12.00%) (Table 11.9). The lignin content in foliage of rice bean genotypes of group-II varied from 8.87% in Baroi to LRB-40-2 (16.80%). The genotypes with high lignin content were LRB-40-1 (15.87%), LRB-1 (15.60%), LRB-126 (14.87%) and LRB-45 (14.20%) (Table 11.10). In foliage of rice bean genotypes of JCR series, the lignin content varied from 9.40% to 14.07%. The genotypes with higher lignin content were JCR-163 (14.07%), Panchrukhi (13.20%), JCR-171 (13.00%) and JCR-107 (11.87%). The low lignin content were observed in genotypes JCR-79 (9.40%) followed by JCR-54 (9.73%) and JCR-20 (9.93%) (Table 11.11).

194

11

Rice Bean Foliage as Fodder

Superior Genotypes of Group-1 Forage nutritional factors Crude protein Crude fiber Total soluble carbohydrates Ash content NDF ADF Hemicellulose content Lignin content

Genotype IC-137190, IC-140804, IC-137187, EC-48223B IC-140798, IC-140802, IC-140808, IC-137195 IC-137188, Dhagwar, Baroi, Panchrukhi, IC-137189 Dhagwar, IC-019352, IC-140808, IC-140805, IC-016771, IC-137194, IC-137186, Baroi IC-137199, IC-140808, IC-137187, IC-140808, IC-137190 IC-016771, IC-137194, JCR-76, IC-137186 IC-140798, IC-137188, IC-137187, IC-137186

Superior Genotypes of Group-2 Forage nutritional factors Crude protein Crude fiber Ash content Lignin content NDF ADF Hemicellulose content Lignin content

Genotype LRB-140, LRB-128, LRB-135, LRB-40-1 LRB-40-1, LRB-134, LRB-164, LRB-168 LRB-40-1, LRB-176, LRB-45, LRB-1 LRB-40-1, LRB-40-2, LRB-1, LRB-126 LRB-168, LRB-128, LRB-134, LRB-127 LRB-158, LRB-45, LRB-168, LRB-126 LRB-164, LRB-168, LRB-156, LRB-176 LRB-164, LRB-158, LRB-135, LRB-141

Superior genotypes of Group-3 Forage nutritional factors Crude protein Crude fiber Ash content Lignin content NDF ADF Hemicellulose content Lignin content

11.3

Genotype JCR-149, JCR-163, JCR-171, JCR-178 JCR-54, JCR-163, JCR-93, JCR-20 JCR-20, JCR-178, JCR-81, JCR-93 JCR-20, JCR-54, JCR-79, JCR-149 JCR-79, JCR-81, JCR-149, JCR-171 JCR-79, JCR-81, JCR-171, JCR-152 JCR-107, JCR-149, JCR-162, JCR-81 JCR-79, JCR-54, JCR-20, JCR-149

Anti-Nutrients in Rice Bean Forage

The rice bean foliage has the prospects for green feeding, hay making, grazing and also for ensiling in mixtures with low quality feeds. Though rice bean forage is a potential feed for the livestock, but the variations in the level of different anti-has been recorded after harvesting the forage at inappropriate time. Normally harvesting

11.3

Anti-Nutrients in Rice Bean Forage

195

Fig. 11.1 Rice bean at 25% flowering stage

of rice bean at 25% flowering is beneficial for obtaining good quality fodder with minimal level of anti-nutrients (Fig. 11.1). Tannin (Polyphenols) is known to form complexes with proteins under certain pH conditions. Tannins-protein complexes are reported to be responsible for low protein digestibility, decreased amino acid availability and increased fecal nitrogen. Tannins have been categorized into two subgroups, condensed tannins and hydrolysable tannins. Tannins have negative effects on animal production include inhibition of microbial and animal enzymes, prevention of nutrient absorption, and reduced intake resulting from reduced palatability of feed (Kumar and Singh 1984; Mangan 1988; Mueller-Harvey and McMallan 1992).

11.3.1 Group-1 Rice Bean Genotypes The forage from different rice bean genotypes of group-I revealed variation in total phenolic content from 0.83% (IC-137194) to 1.21% (IC-137195), of which genotypes viz., IC-137195 (1.21%) and IC-019352 (1.18%) had higher total phenolic content (Table 11.12). Genotypes IC-137194 (0.83%), IC-140805 (0.83%), Dhagwar (0.86%), Panchrukhi (0.87%), JCR-76 (0.93%), IC-137186 (0.93%) and JCR-52 (0.94%) had comparatively low level of total phenols. In case of simple phenols, all the genotypes has the content ranging from 0.29% to 0.41% (Table 11.12). The total tannins content ranged from 0.48% (IC-137194) to 0.86% (IC-137195). The lowest tannin content was observed in IC-137194 followed by IC-140805 (0.50%), Panchrukhi (0.52%), Dhagwar (0.54%) and JCR-76 (0.56%). The condensed tannins in foliage from group-I rice bean genotypes varied from 0.036% to 0.056% (Table 11.12). The genotypes viz., IC-137194 and IC-137195

196

11

Rice Bean Foliage as Fodder

Table 11.13 Anti-nutrients in the forage from Group-II ricebean genotypes Genotype (s) LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Baroi GM CV CD (5%) SE(m)

Total phenols (%) 3.14 3.65 3.70 2.57 3.18 3.82 3.93 4.13 3.69 2.76 3.71 3.85 3.88 4.10 4.05 4.08 4.12 3.67 0.60 4.85 0.20

Simple phenols (%) 0.96 0.94 1.56 1.64 1.37 1.63 2.20 2.43 1.07 0.75 1.14 0.82 0.93 1.09 1.32 0.72 1.21 1.29 0.30 14.31 0.10

Total tannins (%) 2.99 2.14 2.80 0.98 1.83 2.56 1.51 1.68 2.19 2.01 2.56 2.85 2.43 3.00 2.70 3.20 2.91 2.40 0.47 11.99 0.16

Condensed tannins (%) 0.052 0.057 0.048 0.040 0.047 0.051 0.054 0.049 0.037 0.040 0.063 0.051 0.052 0.040 0.049 0.052 0.029 0.04 NS 26.0 0.07

Hydrolysable tannins (%) 2.29 2.08 2.09 0.94 1.79 2.14 1.59 1.64 2.15 1.97 2.50 2.80 2.88 2.96 2.65 3.15 2.88 2.26 0.66 17.60 0.23

had lowest condensed tannins (0.036%) followed by IC-137188 (0.037%), IC-140803 (0.039%) and IC-137200 (0.040%). The hydrolysable tannins in rice bean fodder (group-I) exhibited a range of variation from 0.44% to 0.82% (Table 11.12). Among the genotypes, IC-137194 had lowest hydrolysable tannins followed by IC-140805 (0.46%), Panchrukhi (0.48%) and Dhagwar (0.50%)

11.3.2 Group-II Rice Bean Genotypes The rice bean genotypes of group-II revealed the total phenolic content ranging from 2.57% (LRB-45) to 4.13% (LRB-135) (Table 11.13). The genotypes viz., Local Baroi (4.12%), LRB-164 (4.10%) and LRB-176 (4.08%) were with higher levels of total phenolic content whereas genotype LRB-140 (2.76%), and LRB-1 (3.14%) were with low level of total phenols. The simple phenols among the LRB genotypes varied from 0.72% (LRB-176) to 2.43% (LRB-135). Highest level of simple phenols was observed in LRB-135 (2.43%) followed by LRB-128 (2.20%) and LRB-45 (1.69%), whereas the genotypes LRB-140 (0.75%), and LRB-176 (0.72%) had low simple phenolic content. The condensed tannins varied from 0.029% (Local Baroi) to 0.063%

11.3

Anti-Nutrients in Rice Bean Forage

197

Table 11.14 Anti-nutrients in the forage from Group-III rice bean genotypes Genotype (s) JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Local GM CV CD (5%) SE(m)

Total phenols (%) 2.82 2.72 3.00 3.44 3.39 3.34 2.63 2.90 2.95 2.54 2.72 2.74 3.00 2.94 0.12 2.38 0.04

Simple phenols (%) 1.14 1.05 1.10 0.45 1.25 0.88 0.76 0.53 0.75 0.61 0.71 0.84 0.73 0.83 0.07 5.37 0.025

Total tannins(%) 1.67 1.67 1.89 2.98 2.13 2.45 1.86 2.36 2.19 1.92 2.01 1.90 2.29 2.10 0.13 3.92 0.04

Condensed tannins (%) 0.065 0.041 0.059 0.060 0.048 0.051 0.037 0.055 0.057 0.037 0.034 0.049 0.042 0.048 0.008 9.79 0.002

Hydrolysable tannins (%) 1.61 1.62 1.83 2.92 2.08 2.39 1.82 2.31 2.14 1.88 1.98 1.85 2.24 2.05 0.13 4.01 0.047

(LRB-141) (Table 11.13). Genotypes, LRB-134, LRB-45 and LRB-140 had least level of condensed tannins. The total tannin content in 13 rice bean genotypes of group II ranged from 1.51% (LRB-128) to LRB-176 (3.20%) while the level of hydrolysable tannins ranged from LRB-45 (0.94%) to LRB-176 (3.15%) (Table 11.13).

11.3.3 Group-III Rice Bean Genotypes The forage from the rice bean genotypes of JCR series revealed total phenolic content from 2.54% (JCR-163) to 3.44% (JCR-81) whereas, the simple phenolic content ranged from 0.61 to (JCR-163) to 1.25% (JCR-93) (Table 11.14). Genotypes JCR-152 (0.51%) and JCR-81 (0.45%) are with low level of simple phenols. The level of condensed tannins vary from 0.034 (JCR-171) to 0.065% (JCR-20) (Table 11.14). Genotypes, JCR-79, JCR-162 and JCR-152 have highest level of condensed tannins. The total tannins among 13 JCR genotypes ranged from 1.67% (JCR-20, JCR-54) to 2.98% (JCR-81). The genotypes viz., JCR-20 (1.67%), JCR-79 (1.89%) and JCR-149 (1.86%) had low level of total tannins. Variation from 1.61% (JCR-20) to 2.92 % (JCR-81) were observed for hydrolysable tannins. JCR-107 have highest level of hydrolysable tannins, whereas the JCR-93 (2.08%), JCR-171 (1.98%), JCR-163 (1.88%), and JCR-178 (1.85%) were observed with low level of hydrolysable tannins (Table 11.14).

198

11.4

11

Rice Bean Foliage as Fodder

Rice Bean-as Dual Purpose Crop

Currently global food and feed demands have been projected to double in the twentyfirst century, which will increase the pressure on the pattern of using existing farmlands and other resources. Hence, there is a need of investigating possible avenues for mitigating food and nutritional insecurity of people and livestock in the world. The investigation on dual purpose characteristics of rice bean resulted in the identification of the genotypes having potential usage as food feed crop. The list of potential dual purpose genotypes has been given in Table 11.15.

11.5

Surplus Rice Bean Seeds in Animal Feeding

The utilization of surplus rice bean seeds in animal feeding could replace 50% each of cereals and de-oiled cake in concentrate mixture (Ahuja et al. 2001). Feeding of sheeps with rice bean seeds could replace 50% of metabolizable energy from oat hay without any deleterious effect on nitrogen balance in animal (Krishna et al. 1989). Processed rice bean seeds could be included in the poultry diets (Gupta et al. 1992). An experiment conducted by Singh et al. (2000) revealed that ad libitum feeding of ricebean forage and sorghum sudan grass mixture could support a growth of 456 g/day in crossbred calves (age 22–23 months). Rice bean hay is generally used as a protein source to supplement poor quality roughage-based diets. In an experiment conducted by Gupta et al. (1981) with rice bean hay, bullocks consumed it hesitantly at first, but within a few days were accustomed to it, and dry matter consumption increased. Wanapat (2012) reported Holstein  Friesian crossbred dairy cows receiving rice bean hay mixed with Ruzi grass tended to have higher digestibility of dry matter, organic matter and crude protein, higher milk yield and fat corrected milk. Thang et al. (2008) observed higher daily weight gain (609 g/day), better feed efficiency and reduced feeding cost in growing crossbred heifers fed on a mixture of cassava hay and rice bean hay (3:1 ratio) replaced with 60% of concentrate in a forage-based diet (Pennisetum purpureum + urea-treated rice straw). Supplementation of rice bean hay at 600 g dry matter/head/day is beneficial for swamp buffaloes fed with rice straw as a basal roughage, as it results in increased dry matter intake, reduced protozoal and methane gas production in rumen, increased N retention as well as better efficiency of ruminal microflora (Chanthakhoun et al. 2011). Chanthakhoun and Wanapat (2010) also reported that supplementation of rice bean hay in the diet of buffalo increases cellulolytic rumen bacteria, thus improving the utilization of feeds having high fiber content. Das (2002) reported that local goats fed with grass and rice bean hay (15% of total diet DM) did not increase grass intake, while total dry matter intake and nutrient digestibility were increased. Increasing the level of rice bean hay above 15% had no further effect on digestibility (Table 11.16). The shift from conventional livestock production to livestock industrialization during the last few decades was the consequence of increasing demand for various

Genotype JCR-178 JCR-20 JCR-152 LRB-168 LRB-141 IC140808 IC019352 IC140798 IC016789 IC140796 IC140802 IC137195 LRB-176 IC137200 BRS-2 GM CD (5%) CV SE (m)

Green fodder yield (q/ha) 227.00 267.00 233.00 220.00 267.00 237.00

253.00

260.00

247.00

243.00

187.00

243.00

175.00 173.00

227.00 230.60 – – –

Seed yield (g) 286.50 387.43 308.67 369.00 301.20 217.60

276.73

256.70

310.37

392.37

256.17

323.63

312.03 273.27

266.27 302.53 NS 24.14 –

5.30 5.11 NS 6.81 0.20

5.30 5.00

5.00

5.13

5.10

5.10

5.30

5.13

CF (%) 4.67 5.10 5.17 5.30 4.93 5.07

1.06 1.07 0.36 20.4 0.13

1.10 1.03

1.10

1.03

1.20

0.90

1.40

1.50

EE (%) 0.70 1.06 0.76 0.90 1.03 1.30

87.82 81.63 12.39 9.07 4.27

67.16 77.51

67.16

87.82

87.82

77.51

82.67

67.16

Ascorbic acid (mg/100gm) 82.67 103.32 82.67 92.99 82.67 77.51

48.04 49.25 NS 14.59 4.41

49.66 47.98

48.35

49.69

52.00

50.30

49.88

52.53

CHO (%) 49.88 51.44 49.94 50.49 52.76 51.56

1.25 1.14 NS 18.17 0.119

1.16 1.26

1.15

1.17

1.25

1.06

1.08

1.06

Tryptophan (g/16gm N) 1.15 1.36 0.78 1.27 1.06 1.02

2.40 2.49 0.56 13.61 0.19

2.18 2.71

2.16

2.06

2.42

2.45

2.32

2.26

Methionine (g/16gm N) 3.05 2.95 2.36 3.14 2.41 2.50

21.29 21.75 NS 13.77 1.72

18.95 19.24

23.62

20.12

21.58

18.66

20.99

23.91

CP (%) 24.50 22.16 23.91 22.75 19.24 25.29

27.36 28.70 NS 15.02 2.48

28.56 29.53

29.53

29.76

31.20

33.90

21.30

27.10

CF (%) 27.76 29.76 28.06 24.30 26.93 25.36

46.46 43.89 NS 16.57 4.19

45.59 44.98

41.40

44.33

45.60

47.66

49.40

42.33

NDF (%) 43.33 48.13 44.00 41.33 31.36 42.80

35.13 33.98 NS 15.55 3.05

34.46 33.73

32.46

35.46

36.40

35.46

29.40

30.27

ADF (%) 33.07 34.07 35.00 30.26 34.06 30.60

14.54 14.16 1.20 5.07 0.414

13.33 14.37

12.66

11.83

15.68

14.48

12.24

14.95

CHO (%) 16.15 15.17 11.49 13.30 17.32 14.90

Nutritional characteristics (Forage)

1.00 0.77 0.20 15.64 0.22

1.06 0.46

1.06

0.66

0.46

0.66

0.80

0.93

Ash (%) 0.46 0.73 0.86 0.80 1.06 0.60

7.40 8.54 NS 36.87 1.81

9.06 9.20

8.47

12.26

10.47

7.40

8.40

8.33

Lignin (%) 6.67 7.93 7.20 7.19 11.13 7.00

Surplus Rice Bean Seeds in Animal Feeding

22.16 22.05 NS 7.64 0.97

22.45 23.04

21.87

21.87

21.29

22.45

23.03

23.62

CP (%) 22.45 19.24 22.45 21.58 21.29 21.87

Nutritional characteristics (Seeds)

Table 11.15 Dual purpose rice bean genotypes

11.5 199

LRB-156 (21.29)

JCR-152 (20.99)

IC-137195 (20.99)

IC-137200 (20.70)

LRB-127 (20.41)

JCR-93 (20.41)

JCR-162 (20.12)

IC-016789 (20.12)

3

4

5

6

7

8

9

CP (%)a IC-137190 (22.74)

2

Sr. No. 1

JCR-20 (31.06)

ADF (%)b JCR162 (26.93) LRB127 (28.06) JCR152 (28.33) IC016789 (28.80) LRB176 (29.0) IC140798 (29.40) IC137195 (29.60) IC140805 (29.80) JCR-93 (30.13) IC-137186 (5.53)

JCR-32 (5.50)

JCR-76 (5.40)

LRB-164 (5.27)

IC-137194 (5.20)

LRB-128 (5.20)

JCR-178 (4.53)

JCR-107 (4.47)

Hemicelluloseb (%) IC-016771 (4.30)

JCR-79 (9.40)

Lignin (%)b LRB127 (6.33) LRB176 (6.80) IC137190 (7.06) LRB156 (7.53) JCR162 (7.60) IC140805 (8.40) IC137200 (8.80) JCR-93 (8.93) IC140805 (2.33) IC019352 (2.33) IC140808 (2.13) IC016789 (1.93) IC016771 (1.83) IC137186 (1.80) IC137191 (1.67) IC137199 (1.60)

Ash (%) Dhagwar (2.50)

LRB-128 (13.93)

LRB137 (14.00)

JCR-93 (14.17)

JCR-93 (14.65)

LRB-127 (14.65)

LRB-164 (15.79)

LRB-40-2 (15.96)

LRB-45 (16.85)

Carbohyd-ratea (%) LRB-126 (17.46)

IC-140802 (0.95)

JCR-12 (0.95)

JCR-52 (0.94)

IC-137186 (0.93)

Local Panchrukhi (0.87) JCR-76 (0.93)

Dhagwar (0.86)

IC-137194 (0.83)

Total phenolicsb (%) IC-140805 (0.83)

IC-137191 (0.39)

IC-137194 (0.38)

JCR-52 (0.34)

Dhagwar (0.34)

Local Panchrukhi (0.31) IC-137186 (0.33)

JCR-76 (0.30)

IC-140805 (0.28)

Total Tanninsb (%) JCR-32 (0.27)

11

JCR-93 (31.13)

CF (%)a LRB40-1 (35.70) LRB135 (34.70) LRB164 (34.70) LRB134 (33.77) LRB168 (33.17) LRB128 (32.67) JCR-54 (32.30)

NDF (%)b IC140798 (43.66) IC016789 (43.66) JCR152 (43.80) LRB127 (44.06) IC137200 (44.26) JCR162 (44.59) IC137190 (45.26) IC016771 (45.27) IC137194 (45.53)

Table 11.16 Grading of rice bean genotypes for fodder quality parameters

200 Rice Bean Foliage as Fodder

LRB-140 (19.24) IC-140798 (19.24)

LRB176 (30.73)

LRB128 (45.80) IC137190 (30.27)

IC-016789 (5.60)

JCR-52 (9.73)

Genotypes graded in the descending order for nutritionally desirable characters Genotypes graded in the ascending order for nutritionally undesirable constituents

b

a

10 IC140798 (1.60) Local Baroi (13.56) LRB-168 (13.43)

IC-137189 (0.96)

IC-137199 (0.39)

11.5 Surplus Rice Bean Seeds in Animal Feeding 201

202

11

Rice Bean Foliage as Fodder

livestock products. The current trend is likely to result in a doubling of livestock products in developing countries over the next two or three decades. Consequently the, availability of nutritious feeding resource is vital to improve the productivity and performance of livestock, that invite attention on utilization of alternative food resources for livestock. Rice bean is one of the legumes having the potential to be utilized as food-feed crop. The fodder from this crop has the potential for meeting the food and nutritional requirement of livestock.

References Ahuja AK, Kakkar VK, Gupta BK (2001) Nutritional evaluation of rice bean in buffalo calves. Indian J Anim Nutr 18(2):172–175 Bhattacharya N, Mukherjee AK (1998) Herbage growth of ricebean under different dates of sowing and levels of phosphorus. Forage Res 24(2):121–123 Chanthakhoun V, Wanapat M (2010) Effect of legume (Phaseolus calcaratus) hay supplementation on rumen cellulolytic bacterial populations in swamp buffaloes investigated by the real-time PCR technique. J Anim Vet Adv 9(11):1654–1659 Chanthakhoun V, Wanapat M, Wachirapakorn C, Wanapat S (2011) Effect of legume (Phaseolus calcaratus) hay supplementation on rumen microorganisms, fermentation and nutrient digestibility in swamp buffalo. Livest Sci 140(3):17–23 Chatterjee BN, Dana S (1977) Rice bean (Vigna umbellata (Thunb) Ohwi and Ohashi). Trop Grain Legume Bull 10:22–25 Dabo SM, Taliaferro CM, Coleman SW, Horn FP, Claypool DL (1988) Chemical composition of old world bluestem grasses as affected by cultivar and maturity. J Range Manag 41:40–48 Das P, Biswas S, Ghosh TK, Haldar S (2002) Micronutrient status of dairy cattle maintained by farmers in the new alluvial zone of West Bengal. Anim Nutr Feed Technol 2(1):19–26 Göhl B (1982) Les aliments du bétail sous les tropiques. FAO, Division de Production et Santé Animale, Roma Gupta BN, Singh RB, Chatterjee D (1981) Chemical-composition and nutritive-value of Rice bean (Phaseolus calcaratus Roxb.) hay. Indian Vet J 58(9):727–730 Gupta JJ, Yadav BPS, Gupta HK (1992) Rice bean (Vigna umbellata) as poultry feed. Indian J Anim Nutr 9(1):59–62 Hatfield RD, Ralph J, Grabber JH (1999) Cell Wall structural foundations: molecular basis for improving forage digestibilities. Crop Sci 39(1):27–37 Heuzé V, Tran G, Boval M (2016) Rice bean (Vigna umbellata). Feedipedia, a programme by INRA, CIRAD, AFZ and FAO Jung HG, Allen MS (1995) Characteristics of plant cell walls affecting intake and digestibility of forages by ruminants. J Anim Sci 73:2774–2790 Katoch R (2010) Effect of different fertilizer levels on root nodulation and fodder quality in rice bean (Vigna umbellate) genotypes. Range Manag Agrofor 31:41–47 Katoch R, Sood S, Kumar N, Bandhari JC (2007) Fodder production potential and nodulation efficiency of different rice bean genotypes. Forage Res 33:73–77 Khanal AR, Khadka K, Poudel I, Joshi KD, Hollington P (2009) Report on farmers’ local knowledge associated with the production, utilization and diversity of ricebean (Vigna umbellata) in Nepal. In: The Ricebean Network: Farmers indigenous knowledge of ricebean in Nepal (report N 4), EC. 6th FP, Project no. 032055, FOSRIN (Food Security through Ricebean Research in India and Nepal) Krishna G, Mandal AB, Paliwal VK, Yadab KR (1989) Rice bean Vigna-umbellata as a feed for adult sheep. Indian J Anim Nutr 6(4):365–368

References

203

Kumar R, Singh M (1984) Tannins: their adverse role in ruminant nutrition. J Agr Food Chem 32:447–453 Laureano-Perez L, Teymouri F, Alizadeh H, Dale BE (2005) Understanding factors that limit enzymatic hydrolysis of biomass: characterization of pretreated corn stover. Appl Biochem Biotech 124:1081–1099 Lovett DK, Bortolozzo AP, Conaghan P, O’Kiely P, O’Mara FP (2004) In vitro total and methane gas production as influenced by rate of nitrogen application, season of harvest and perennial ryegrass cultivar. Grass Forage Sci 59:227–232 Mandal SR, Mukherjee AK (1999) Forage yield and qualities of some ricebean (Vigna umbellata) germplasms. Environ Ecol 17(3):749–751 Mangan JL (1988) Nutritional effects of tannins in animal feeds. Nutr Res Rev 1:209–231 Mertens DR, Wilkerson VA, Casper DP (1994) Nitrogen excretion for Holstein cattle. J Dairy Sci 72:353 Miller LA, Moorby JM, Davies DR, Humphreys MO, Scollan ND, MacRae JC, Theodorou MK (2001) Increased concentration of water-soluble carbohydrate in perennial ryegrass (Lolium perenne): Milk production from late-lactation dairy cows. Grass Forage Sci 56:383–394 Moore KJ, Hatfield RD (1994) Carbohydrates and forage quality. In: Fahey GC, Collins MC, Mertens DR, Moser LE (eds) Forage quality, evaluation, and utilization. American Society of Agronomy, Madison, p 229 Moore KJ, Jung HJG (2001) Lignin and fiber digestion. J Range Manag 54:420–430 Moore KJ, Vogel KP, Hopkins AA, Pedersen JF, Moser LE (1993) Improving the digestibility of warm-season perennial grasses. Proceedings of the XVI International Grassland Congress, p 447 Mueller-Harvey I, McMallan AB (1992) Tannins. Their biochemistry and nutritional properties. In: Morrison IM (ed) Advances in plant cell biochemistry and biotechnology, vol Vol. 1. JAI Press Ltd., London, p 151 Singh RB, Saha RC, Singh S (2000) Effect of feeding ricebean and sorghum sudan mixed fodder on growth and nutrient utilization in crossbred calves. Indian J Anim Nutr 17(2):160–161 Thang CM, Sanh MV, Wiktorsson H (2008) Effects of supplementation of mixed cassava (Manihot esculenta) and legume (Phaseolus calcaratus) fodder on the rumen degradability and performance of growing cattle. Asian-Aust J Anim Sci 21:66–74 Varner JE, Lin LS (1989) Plant cell wall architecture. Cell 56:231–239 Wanapat M (2012) Contribution towards ruminant nutrition, animal scientists’ development and International Animal Agriculture: Past, current and future prospects. In: Proceeding of the 1st International Conference on Animal Nutrition and Environment (ANI-NUE), Pullman Raja Orchid Hotel, Khon Kaen, Thailand, p 7 Wattiaux M (1994) Nutrients in the Feed. The Babcock Institute for International Dairy Research and Development. University of Wisconsin, Madison

Rice Bean: A Soil Enricher

12

The capacity to supply the nutrients required by a crop during its active growth period depends on fertility status of the soil. Besides this, favorable environment is also required for optimum plant growth created by the presence of organic matter in soil. One of the potential ways to improve the soil health is the use the practice of green manuring and cover cropping. Green manuring helps in nutrient distribution in the soil profile resulting in the full exploitation of the root zone with crops of differing rooting depths. Use of legumes in rotations potentially reduces dependence on nitrogen fertilizer and is economically prudent. Rice bean besides being a pulse and fodder crop, also has significant value to be utilized as a green manure crop and cover crop. The high nodulation efficiency and large biomass production during the growth are major attributes which signifies the role of rice bean as a promising green manure and cover crop. Nitrogen management is a primary concern for farmers since N is the nutrient required in substantial quantities by most crops and is also lost from the system easily. The integration of rice bean into annual crop rotations has the potential to offer substantial benefits to farmer by returning most of the green manure nitrogen and other nutrients to the cropping system. Nitrogen constitutes a major proportion of total atmospheric gases (about 78%). Although available in plenty, plant cannot utilize this nitrogen directly. This nitrogen could be available to the plants by establishing association with few microorganisms having the capability of converting the unavailable atmospheric nitrogen into available form through a process called biological nitrogen fixation. These microorganisms are (a) symbiotic bacteria (b) free-living heterotrophic soil bacteria (c) photosynthetic blue-green algae. In the process of nitrogen fixation, the strong two-atom nitrogen molecules break apart so they can combine with other atoms and convert into inorganic or organic usable forms to plant through the agency of microorganisms. The organisms able to fix the atmospheric nitrogen into usable form are called bioazotrophs. As far as is currently known, no eukaryotic organisms fix nitrogen except Rhodotorula (Yeast). Some microorganisms live in a symbiotic relationship with leguminous plants (e.g., # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_12

205

206

12

Rice Bean: A Soil Enricher

soybeans, alfalfa) where as some establish symbiotic relationship with non-leguminous plants (e.g., Alder, Myrica). Some nitrogen-fixing bacteria live free in the soil (Azotobactor). Nitrogen-fixing bacteria are essential to maintaining the fertility of semi-aquatic environments like rice fields. The biological nitrogen fixation requires a complex set of enzymes and a huge expenditure of ATP. Although the first stable product of the process is ammonium ions, this is quickly incorporated into protein and other organic nitrogen compounds. The three modes of fixing atmospheric nitrogen into most available form are: 1. Non-symbiotic nitrogen fixation: Nitrogen is fixed both in photosynthetic and non-photosynthetic organisms. Photosynthetic blue-green algae such as Anabaena and Nostoc fix nitrogen by using light energy and deriving electrons from water. All nitrogen fixing blue-green algae have long, thick walled colorless cells called heterocysts. These are the site of nitrogen fixation. Green and purple non-sulphur bacteria as Rhodospirullum, Rhodopseudomonas, Cholorobium, Chromatium get electrons from other reduced electron donors in presence of light energy. A proper amount of minerals like molybdenum, iron and calcium in the soil is essential for nitrogen fixation. 2. Associative symbiotic nitrogen fixation: Certain bacteria, living in close association with the roots of cereals and grasses can also fix nitrogen. Thus association is a loose mutualism, called associative symbiosis. For example (a) inoculation of Beijerinckia spp. promotes significant increase in nitrogen content in some maize hybrids (Govedarica 1990) (b) Inoculation of ammonium excreting Azospirillum exhibited enhanced nitrogen supply to wheat plants (Van Dommelen et al. 2009). 3. Biological nitrogen fixation: Biological nitrogen fixation is the distinguishing feature of leguminous crops occurring in all known ecosystems. In fact, biological nitrogen by diazotrophic bacteria, which reduce dinitrogen to ammonium using nitrogenase enzyme system, is a major contributor to the nitrogen economy of the biosphere, accounting for 30% to 50% of the total nitrogen in crop fields (Ormeño-Orrillo et al. 2013). The symbiotic nitrogen fixation is dependent on the host plant genotype and the interaction of these symbionts with soil factors and environmental conditions. Most legume species are able to form symbiotic association with Rhizobium, Mesorhizobium, Sinorhizobium, and Bradyrhizobium), use solar energy captured by the plant to break the bond in inert atmospheric dinitrogen and form reactive nitrogen species, initially ammonium (NH4+). As a result of this symbiosis, the legume crop requires little or no input of nitrogenous fertilizer and makes little demand on soil N reserves. The best known nitrogen fixing symbiotic bacterium is Rhizobium leguminosarum. This bacterium lives in soil to form nodules on the roots of the leguminous plants. These root nodules vary in shape and size. Nitrogen fixing bacteria rhizobium resides in these root nodules and causes fixation of atmospheric nitrogen. Although the nitrogen is fixed by rhizobia bacteria in the root nodules, it is not stored there. Most of the nitrogen is found in the top growth of the plant with a smaller amount in crown, roots and nodules. Estimate for perennial legumes shows that about 75% to 80% of the plant nitrogen content is present in top growth.

12.1

12.1

Biological Nitrogen Fixation in Legumes

207

Biological Nitrogen Fixation in Legumes

In the process of biological nitrogen fixation, when a root hair of a leguminous plant comes in contact with rhizobium, it becomes curved due to some specific chemical substances secreted by bacteria. Partial destruction of cell wall takes place at the point of contact. At this site, rhizobium embedded in a thread of mucilaginous substance that invades the root tissues and multiplies within the root hair. Some of the bacteria enlarge to form membrane bound structures called bacteriods. These bacteriods cannot divide; thereby some bacteria remain untransformed and carry out the infection. An infection thread made up of plasma membrane is formed, which grows inward from the infected cell of the plant that separates the infected tissue from rest of the plant. Cell division is stimulated in the infected tissue and more bacteria invade the newly formed tissue. The nodule establishes direct vascular connections with the host for exchange of nutrients. When nodules are young and not yet fixing nitrogen, they are usually white or grey inside. As nodules grow in size, they gradually turn pink or reddish in colour, indicating nitrogen fixation has started. The pink or red colour is caused by leghaemoglobin (similar to haemoglobin in blood) that controls oxygen flow to bacteria. Its presence results in a red colouration of the interior of nodules, indicating that the microorganism is alive and active, whereas dead, inactive and senescent nodules are usually greyish green or brown inside. The formation of nodules appears 4 to 6 weeks after sowing and reaches maximum activity around flowering. In autumn and at plant maturity (after flowering), the roots and nodules are senescent and some have started to decay. Nodules on many perennial legumes, such as alfalfa and clover, are finger like in shape. Mature nodules may actually resemble a hand with a centre mass (palm) and protruding portions (fingers), although the entire nodule is generally less than half inch in diameter. Nodules on perennials are long-lived and fix nitrogen through the entire growing season as long as conditions are favourable. Most of the nodules are located on the tap root. Nodules on annual legumes like rice bean are round and can reach the size of a large pea. Nodules on annuals are short-lived and replaced constantly during the growing season. At the time of pod fill, nodules on annual legumes generally lose their ability to fix nitrogen because the plant feeds the developing seed rather than the nodule. Legume nodules that are no longer fixing nitrogen usually turn green and may actually be discarded by the plant. Pink or red nodules should predominate on a legume in the middle of the growing season. If white, grey, or green nodules predominate, little nitrogen fixation is occurring as a result of an inefficient rhizobia strain, poor plant nutrition, pod filling, or other plant stress. The location of the nodules along the roots is primarily linked to genus/ species of the plants and the presence of rhizobia in soil. At low frequency of rhizobia, the low number of nodules per plant is compensated by increased nodule size. In addition, the content of nutrients in the soil and soil structural and textural properties influence the distribution and size of the nodules. Any stress that reduces plant activity will reduce nitrogen fixation. Factors like temperature and water availability may not be under the farmer’s control, but nutrition stress (especially phosphorus, potassium, zinc, iron, molybdenum, and cobalt) can be corrected with

208

12

Rice Bean: A Soil Enricher

fertilizers. When a nutritional stress is corrected, the legume responds directly to the nutrient and indirectly to the increased nitrogen nutrition resulting from enhanced nitrogen fixation. Poor nitrogen fixation in the field can be easily corrected by inoculation, fertilization, irrigation, or other management practices.

12.2

Soil Enrichment by Using Rice Bean as Green Manure and Cover Crop

Since last few decades, the agricultural productivity gains are of result of development of farming systems, are heavily dependent on external inputs of energy and chemicals (Oberle 1994). The use of agrochemicals to enhance the agriculture production and to manage the agricultural pests is a common practice throughout the world. Now-a-days many farmers are using these agrochemicals and other technologies in non-judicious manner and leading to soil organic matter losses and structure degradation, affecting water, air and nutrients flows, and consequently plant growth. It is a well known fact that the future sustainability of crop production greatly depends upon improvement in soil resource base through its effective management (Singh et al. 2004), therefore, the adoption of alternative management practices to restore the inherent capacity of the soil for providing optimum nutrition to the plant is warranted. The use of green manure and cover crops in farming systems is one of such management practices for soil quality restoration, maintaining soil organic matter, reclaiming degraded soils and supplying the plant nutrients (Sinha et al. 2009; Kumar 2010). For soil improvement, a green manure crop is any crop grown for the purpose of being turned under while green or soon after maturity for soil improvement. Green manuring is the process of turning of green plants into the soil either by raising them in same field or plants grown elsewhere at the green stage before flowering and incorporated into the soil whereas cover cropping is the practice of planting crops between the main crop to suppress weeds, manage soil erosion, help build and improve soil fertility and quality, control diseases and promote biodiversity. The use of legume cover and green manure crops in improving agricultural sustainability is well recognized. Legume benefits to subsequent crops by symbiotic association of microorganism and leguminous plant which is responsible for the fixation of atmospheric nitrogen in soil from there plant can easily absorb nitrogen. Legumes may also be used to reduce carbon and nitrogen losses from agricultural systems and increase soil carbon (Drinkwater et al. 1998). The major functions of cover crops in a cropping system are supply of nitrogen, building soil physical and textural properties builder, erosion controller, weed controller and pest fighter. The selection of appropriate cover crop should be based on providing satisfactory biomass production to cover enough soil surface area and bring other benefits to improve yield of succeeding cash crops or plantation crops. Rice bean is a promising nitrogen fixer and has great potential to contribute nearly all their nitrogen to subsequent crops when plowed in the soil (Chatterjee and Dana 1977).

12.2

Soil Enrichment by Using Rice Bean as Green Manure and Cover Crop

209

The use of rice bean as a cover crop has been studied in a series of field experiments (Fig. 12.1). The spreading nature of rice bean provides ground cover, thus suppressing the growth of weeds and reduces soil erosion. The ground cover also reduces soil temperature due to high biomass production over a short period of time. Growing rice bean as a cover crop offer several other beneficial effects to soil such as it add organic matter and their roots provide space to symbiotic microorganism that increases the nitrogen available to plants, improves water absorption and reduces soil compaction. The utilization of rice bean as cover crop is mainly the result of economic and environmental concerns, not just among chemical-conscious consumers, but among farmers too. There are both climbing and bush types of rice bean. Trifoliate leaves grow thick on the stems providing a dense ground cover. The cultivation of rice bean replenishes soils which get depleted as a result of monoculturing or sole cropping of the cereals. Like other leguminous crops, rice bean is also efficient for improving nitrogen content in soil through symbiotic relationship with nitrogen-fixing micro-organism which not only enables it to fulfill own nitrogen requirements but also benefited the succeeding crops (Katoch 2010). The recognition and attachment of the symbiotic bacteria to the host through nod factors [Lipo-chitooligosaccharides (LCO’s)], curling of the root hairs, infection thread formation and its growth and development are important processes during nodulation in leguminous crops (Nutman 1959). The genetic variability within the host species has pivotal role in differential symbiotic behaviour (Rathnaswamy et al. 1986). A sand culture study on the effect of different rhizobial strains on the growth of rice bean was conducted under glass house conditions by Susono and Karsono (1977) and computed the correlation coefficient between the weights of various plant parts. The effect of nodulation on plant growth is dependent on the weight as well as the number of nodules. The effect of nodulation on the growth of rice bean above

Fig. 12.1 Rice bean grown as green manure crop in field

210

12

Rice Bean: A Soil Enricher

ground part is greater than underground part. The determinate type of rice bean cultivars produces more profuse growth and nodulation (Singh and Verma 1988). Beside genetic constitution of the host, the nodulation efficiency is also dependent on genetic constitution of rhizobium (Katoch 2010). Rice bean cultivation after or before rice or maize crop, is highly suitable for maintaining the fertility of soil. This system is profitably followed in Thailand, where rice bean is sown between maize plants and once maize reaches to the maturity, it covers enough soil at harvest. In Thai highlands, rice bean as a green manure out-competes other potential legumes like Jack bean (Canavalia ensiformis), Lablab purpureus and Mimosa diplotricha (Chaiwong et al. 2012). In China, rice bean used as green manure in tangerine orchards results in higher fruit production in comparison to soyabean (Glycine max), mung bean (Vigna radiata) and cowpea (Vigna unguiculata) (Ming-xia et al. 2011).

12.3

Nitrogen Fixation and Nodulation Efficiency in Rice Bean

Symbiotic N2 fixation is one of the biological processes important for development of sustainable agriculture by which the atmospheric nitrogen is converted in to most available form to plant with the aid of a key enzyme called nitrogenase. It is achieved by bacteria inside the cells of de novo formed organs, the nodules, which usually develop on roots of various leguminous plants. This process is resulted from the complex interaction between the host plant and rhizobia. This mutualistic relationship is beneficial for both symbiotic partners; the host plant provides the rhizobia with carbon and source of energy for growth and functions while the rhizobia fix atmospheric nitrogen and provide the plant with a source of reduced nitrogen in the form of ammonium. Thus, the process offers an economically attractive and ecologically sound mean of reducing external inputs and improving internal resources. Different rice bean genotypes showed varied number of nodules which denotes the variation in their nitogen fixing ability. Rice bean plays a vital role in nitrogen enrichment of soil and fixes about 80 N/ha (ECHO Asia seed fact). Rerkasem et al. (1988) observed that rice bean as a monocrop and as an intercrop with maize fixed equal amount of nitrogen upto first 90 days after sowing. The high nodulation capacity of rice bean in a cultivar RBL-1 has been reported by Singh and Verma (1988). The number of nodules and nodule weight are two major factors defining the nodulation efficiency of the plant. A leguminous plant having high number of nodules plant denotes its potential in fixing the higher amount of nitrogen in soil. The nodule number in a leguminous plant have has direct relationship with the soil fertility status which ultimately affect the crop productivity. The formation of nodules in a leguminous plant denotes a symbiotic relationship between symbiotic bacteria and the plant as nodule provide space and energy to the bacteria for its growth and multiplication. The rate of multiplication of bacteria in nodules reflects in its nodule weight.

12.3

Nitrogen Fixation and Nodulation Efficiency in Rice Bean

211

The number of nodules and nodule weight are interdependent to each other, in which the low number of nodules in plant is compensated by high nodule weight. Both number of nodules and nodule weight have direct relationship with the soil health. Higher the number of nodules and nodule weight, higher will be the soil fertility status. The nodule number and weight of nodules in different rice bean genotypes for assesing their ability to fix atmosphearic nitrogten through symbiotic association with bacteria have been presented in Table 12.1. The nodules number was recorded for each group of rice bean genotypes (GroupI, Group-II and Group-III). In the first group, the number of nodules per plant varied significantly from 21.00 to 117.00. The maximum number of nodules were recorded for the genotype IC-137194 (117 nodules) followed by IC-140798 (94.00 nodules), IC-137190 (78.00 nodules) and IC-140808 (78.00 nodules). The mean value for nodule weight among the rice bean genotypes was varied significantly from 0.32 g (Dhagwar ) to 2.81 g (IC-137194). The least number of nodules recorded in the genotypes Dhagwar, Panchrukhi, and Baroi. In the second group (G-II), the number of nodule per plant was varied significantly from 60.00 to 115.00 and the highest number of nodules recorded for genotype LRB-156 (115 nodules) followed by LRB-135 (99 nodules), LRB-1 (95 nodules) and LRB-40-1 (93 nodules). The least number of nodules per plant was recorded in the genotype LRB-128 (60), LRB-168 (69) and Baroi (69). In comparison to first group, the weight of nodules per plant was low in the group-II varying from 0.19 g to 0.50 g. The genotype LRB-40-1 had highest nodule weight (0.5 g) followed by LRB-158 (0.49 g) and LRB-127 (0.47 g). The lowest nodule weight was observed in the genotype LRB-128 (0.19 g) followed by LRB-1 (0.22 g), LRB-45 (0.26 g) and LRB-141 (0.27 g). In group III of rice bean genotypes (G-3), the number of nodule per plant varied significantly from 26 to 69. The highest number of nodules were recorded for the genotype JCR-93 (69 nodules) followed by JCR-152 (66 nodules) JCR-163 (63 nodules) and JCR-79 (56 nodules). The least number of nodules was observed for the genotypes Local germplasm (27 nodules) and LRB-171 (29 nodules). The mean nodule weight was varied significantly from 0.16 to 0.60 g, whereas the highest nodule weight was recorded for genotype JCR-93 (0.60 g) followed by genotype JCR-163 (0.39 g), JCR-79 (0.31 g) and JCR-149 (0.30 g). The least nodule weight was recorded in genotype JCR-81 (0.16 g), Baroi (0.19 g) and JCR-107 (0.24 g). The rice bean genotypes efficient in nodulation have been presented in Table 12.2. Besides being potential food–feed crop, rice bean also hold significant values for making agro-ecological systems more sustainable. This crop is potential green manure crop which fixes significant amount of nitrogen in soil thereby fulfilling the nitrogen requirements of next crop. Further, rice bean as a cover crop, reduces soil erosion and improves soil textural and structural profile thereby improves soil fertility. Thus, this crop has the prospects for not only achieving the food and nutritional security but also the environmental sustainability.

Group I IC-137186 IC-137187 IC-137188 IC-137189 IC-137190 IC-137191 IC-137194 IC-137195 IC-137199 IC-137200 IC-140795 IC-140796 IC-140798 IC-140802 IC-140803 IC-140804 IC-140805 IC-140808 IC-016771 IC-016789 IC-016801

Nodule number/plant 54.00 52.00 56.00 41.00 78.00 64.00 117.00 55.00 52.00 65.00 63.00 78.00 94.00 60.00 65.00 42.00 51.00 78.00 41.00 65.00 44.00

Nodule weight (g)/plant 1.55 2.18 1.05 0.94 2.21 1.62 2.81 1.28 1.12 1.56 1.08 1.83 2.06 1.77 1.73 0.84 1.48 1.23 0.98 1.72 0.46 Group II LRB-1 LRB-40-1 LRB-40-2 LRB-45 LRB-126 LRB-127 LRB-128 LRB-134 LRB-135 LRB-140 LRB-141 LRB-156 LRB-158 LRB-164 LRB-168 LRB-176 Local Baroi GM CV CD (5%) SE(m)

Table 12.1 Nodulation efficiency in different rice bean genotypes Nodule number/plant 95 93 88 78 85 92 60 76 99 69 76 115 85 79 69 75 87 813.34 8.93 12.08 4.19

Nodule weight (g)/plant 0.22 0.50 0.42 0.26 0.36 0.47 0.19 0.33 0.45 0.34 0.27 0.47 0.49 0.36 0.26 0.37 0.27 0.36 15.14 0.09 0.031 Group III JCR-20 JCR-54 JCR-79 JCR-81 JCR-93 JCR-107 JCR-149 JCR-152 JCR-162 JCR-163 JCR-171 JCR-178 Local GM CV CD (5%) SE(m)

Nodule number/plant 47 46 56 26 69 50 49 66 45 63 29 42 27 47 11.81 9.39 3.22

Nodule weight (g)/plant 0.24 0.27 0.31 0.16 0.60 0.24 0.30 0.34 0.25 0.39 0.27 0.27 0.19 0.30 18.18 0.091 0.031

212 12 Rice Bean: A Soil Enricher

IC-019352 EC-48223B JCR-12 JCR-32 JCR-52 JCR-76 Dhagwar Panchrukhi Local (C) GM CV CD (5%) SE(m)

0.79 0.70 0.74 0.86 0.58 0.78 0.32 0.47 0.46 1.24 12.83 0.26 0.092

53.00 62.00

50.00 62.00 39.00 64.00 21.00 30.00 31.00 58.00 9.56 8.99 3.17

12.3 Nitrogen Fixation and Nodulation Efficiency in Rice Bean 213

214 Table 12.2 Rice bean genotypes efficient in nodulation

12

Trait Nodule number Group-I Group-II Group-III Nodule weight Group-I Group-II Group-III

Rice Bean: A Soil Enricher

Genotype IC-137194, IC-140798, IC-137190, IC-140796 LRB-156, LRB-135, LRB-1, LRB-40-1 JCR-93, JCR-107, JCR-79, JCR-163 IC-137190, IC-137187, IC-140798, IC-140796 LRB-40-1, LRB-158, LRB-127, LRB-156 JCR-93, JCR-163, JCR-152, JCR-79

References Chaiwong U, Yimyam N, Rerkasem K, Rerkasem B (2012) Green manures for highland paddy in a mountainous area. J Nat Sci 11:103–168 Chatterjee BN, Dana S (1977) Rice bean (Vigna umbellata (Thumb) Ohwi and Ohashi). Trop Grain Legume Bull 10:22–25 Dommelen AV, Croonenborghs A, Spaepen S, Vanderleyden J (2009) Wheat growth promotion through inoculation with an ammonium-excreting mutant of Azospirillum brasilense. Biol Fert Soils 45:549–553 Drinkwater LE, Wagoner P, Sarrantonio M (1998) Legume-based cropping systems have reduced carbon and nitrogen losses. Nature 396:262–265 Govedarica M (1990) Specific relationship between Beijerinckia Derx strains and some maize hybrids. Zemljište Biljka 39:125–132 Katoch R (2010) Effect of different fertilizer levels on root nodulation and fodder quality in rice bean (Vigna umbellate) genotypes. Range Manag Agrofor 31:41–47 Kumar R (2010) Studies on decomposing fungi of Sesbania aculeata L. in soil and its effects on soil borne plant pathogens. Ph.D. Thesis, Banaras Hindu University, Varanasi Ming-Xia W, Xiao-Jun S, Zhen-Peng N, Wen-Feng L, Xin-Bin Z (2011) Effect of summer green manure in Pankan Tangerine orchard. J Fruit Sci 28:1077–1081 Nutman PS (1959) The physiology of nodule formation. In: Hallsworth EG (ed) Nutrition of the legumes. Butterworths Scientific Publication, London, p 87 Oberle S (1994) Farming systems options for U.S. agriculture: an agroecological perspective. J Prod Agric Abstr Res 7:119–123 Ormeño-Orrillo E, Hungria M, Martínez-Romero E (2013) Dinitrogen-fixing prokaryotes. In: Rosenberg E, De Long EF, Lory S, Stackebrandt E, Thompson F (eds) The prokaryotes: prokaryotic physiology and biochemistry. Springer, Berlin, p 427 Rathnaswamy R, Shanmungam AS, Rangaswamy SR (1986) Variability for nodulating ability in green gram genotypes under field conditions. Madras Agric J 73:481–494 Rerkasem B, Rerkasem K, Peoples MB, Herridge DF, Bergersen FJ (1988) Measurement of N2 fixation in maize (Zea mays L.)-ricebean (Vigna umbellata [Thunb.] Ohwi and Ohashi) intercrops. Plant Soil 108:125–135 Singh B, Verma MM (1988) RBL-1 a pulse variety of rice bean (Vigna umbellata (Thumb.) Ohwi and Ohashi). J Res PAU 25:507 Singh H, Mishra D, Nahar NM (2004) Energy use pattern in production agriculture of a typical village in arid zone - Part III. Energy Convers Manag 45(15/16):2453–2472 Sinha A, Kumar R, Kamil D, Kapur P (2009) Release of nitrogen, phosphorus and potassium from decomposing Crotalaria juncea L. in relation to different climatic factors. Environ Ecol 27 (4B):2077–2081 Susono S, Karsono H (1977) Studies on the effect of different rhizobial strains Phaseolus calcaratus Roxb. (In) Sand Culture. Ann Bugor 11:143–154

Effect of Fertilizers on Rice Bean Productivity and Quality

13

For feeding the world population, gross crop productivity has to be increased and the primary hway to achieve this goal is through increasing the yield. In last few decades, significant efforts have been made to increase the yield of the crops. However, due to increased cropping intensity, the quality and productivity of many farming lands is continuously deteriorating. The poor soil management, improper use of fertilizers and soil contamination are major contributing for declining capacity of the soil to function optimally. The productivity of degraded and eroded soils can be restored by the effective management of soil (Mikha et al. 2010). Fertilizers are generally referred as mineral components often added to the soil to supply one or more elements required for optimal plant growth and productivity. They provide essential macro and microelements which are required by the plants for proper growth and development in soil lacking these nutrients. Bowyer (2010) described fertilizer as “chemicals, which are used to produce an overall effective response in crop yield, or they can be single nutrient which means they are used to replenish a single type of mineral that is lacking in the soil”. Fertilizers have played a key role in assisting the farmers to achieve high production by providing essential plant nutrients which are indispensable for producing sufficient and healthy food (Khaskheli 2011). However, one of the factors responsible for stagnating yield and decreasing fertilizer use efficiency is the injudicious and indiscriminate use of fertilizers in the agriculture fields. The crop plants need to be healthier for exhibiting their potential and yield; the application of fertilizer helps plants in keeping their healthiness. Optimum crop yields can only be achieved if all the essential nutrients are present in adequate amounts and in the correct proportion with each other. The three macronutrients that are essential for plant growth are nitrogen, phosphorus, and potassium. Micronutrients are required in much smaller quantities than the primary and secondary nutrients, they are also essential to crops and to maintain health. Rice bean has immense yield potential to be grown as food or fodder crop. Although being leguminous crop, the application of nitrogen fertilizer may not be required, however due to poor soil conditions the application of fertilizer may have # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_13

215

216

13

Effect of Fertilizers on Rice Bean Productivity and Quality

desirable effect on its productivity. Nitrogen and phosphorus are prime nutrients as their deficiency appears to be the principal cause of lower yield in legumes (Bhati et al. 1988). Nitrogen application is known to increase vegetative growth, while phosphorus promotes reproductive growth, and also plays a crucial role in the development of the symbiotic relationship between legumes and bacteria as a certain amount of phosphorus is required to carry out biological nitrogen fixation (Rotaru and Sinclair 2009). There is considerable evidence that nodulated legumes require more phosphorus than non-symbiotic plants grown solely on a mineral nitrogen source (Rotaru and Sinclair 2009; Sulieman and Schulze 2010). Phosphorus is also required in larger quantities in the meristamatic tissues. Nitrogen application in combination with adequate amounts of phosphorus improves the overall performance of the plant (Tomar et al. 1984). Available potassium in proper quantity has much to do with vigorous growth. Like phosphorus, it also increases natural resistance in plants against diseases by balancing the effect of nitrogen and phosphorus. Potassium is also needed for the formation of chlorophyll. The application of potassium at high concentration may cause heavy damage to the crop. It has been observed that fertilizer application in proper ratio increases the seed yield and protein content from 1.40 to 2.00 times in pulses (Niklyaev 1975).

13.1

Importance of Nutrients in Plant Growth and Development

With the adequate scientific attention and better agronomic manipulations, yield and quality of the crop could be increased considerably (Mohapatra et al. 1996a). The application of macro as well as microelements in proper combination is essential to bring significant improvement in the crop production. Nitrogen is so vital because it is a major component of chlorophyll, the compound by which plants use sunlight energy to produce sugars from water and carbon dioxide (i.e., photosynthesis). It is also a major component of amino acids, the building blocks of proteins. Without proteins, plants wither and die. Some proteins act as structural units in plant cells while others act as enzymes, making possible many of the biochemical reactions on which life is totally dependent. Nitrogen is also a component of energy-transfer compounds, such as ATP (adenosine triphosphate). ATP allows cells to conserve and use the energy released in metabolism. Finally, nitrogen is a significant component of nucleic acids such as DNA, the genetic material that allows cells (and eventually whole plants) to grow and reproduce. The availability of nitrogen is essential for better utilization of other essential nutrients in plants. Like nitrogen, phosphorus is also a primary nutrient essential for plant growth and development and important for regulation of various enzymatic activities and constituent for energy transformation (Schulze et al. 2006). Some molecules which contain P include nucleic acids, proteins, lipids, sugars, and adenylate and are required for the functioning of plant cells (Zhang et al. 2014). Phosphorus also plays a significant role in many metabolic processes including energy generation, respiration, membrane synthesis and its integrity, nucleic acid synthesis, photosynthesis, activation or inactivation of enzymes, signaling, and carbohydrate

13.2

Effect of Fertilizer on Productivity of Rice Bean Seeds

217

metabolism (Vance et al. 2003; Zhang et al. 2014). Therefore, phosphorus deficient soil and low availability poses major restrictions on the vegetative and reproductive growth development of crop (Vance et al. 2003; Zhang et al. 2014). The phosphorus constraint directly decreases photosynthesis through its negative effects on vegetative crop growth of leaf area development and photosynthetic ability per unit leaf area (Vance et al. 2003; Sulieman et al. 2013). Likewise, inadequate supply of phosphorus can also affect carbon absorption and distribution between plant shoots and its underground parts (Zhang et al. 2014). Potassium (K) is needed by virtually all crops and often in higher rates than nitrogen. Potassium is essential in nearly all processes needed to sustain plant growth and reproduction. Plants deficient in potassium are less resistant to drought, excess water, and high and low temperatures. They are also less resistant to pests, diseases and nematode attacks. Because potassium improves the overall health of growing plants and helps them fight against disease, it is known as the “quality” nutrient. It affects quality factors such as, color and vigor of the seed or grain, and improves quality. Potassium increases crop yields because it (1) increases root growth and improves drought tolerance, (2) builds cellulose and reduces lodging (3) activates at least 60 enzymes involved in growth, (4) aid in photosynthesis and food formation (5) helps in translocating metabolites, (6) produces grains rich in starch (7) increases protein content of plants (8) maintains turgor, reduces water loss and wilting (9) helps retard the spread of crop diseases and nematodes. Of the three secondary nutrients needed at lower levels than nitrogen, phosphorus and potassium (NPK), calcium (Ca) is perhaps the most important one. Calcium strengthens cell walls, help to reduce bruising and disease in fruit, salad and vegetable crops. This means that a good supply of calcium produces food crops that are less prone to damage and have a longer shelf life. Magnesium (Mg) is also important for improving nutritional quality, but is also a key component of leaf chlorophyll and the enzymes that support plant growth and development. Low magnesium leads to reduced photosynthesis, which severely limits crop productivity. Sulfur (S) is an essential part of many amino acids and proteins. Without both S and Mg, leaves turn pale or yellow which significantly affect the crop growth.

13.2

Effect of Fertilizer on Productivity of Rice Bean Seeds

Although, rice bean has high yield potential but sometimes to poor soil health, higher yield is generally not achieved. A detailed investigation on the effect of NPF treatments on rice bean seed production was conducted by Katoch (2011). In the study, fertilizer treatments were categorized into three groups consisting three NPK levels: 0:0:0 kg/ha, 10:30:10 kg/ha and 20:60:20 kg/ha and the data for different traits contributing to yield were recorded in different genotypes.

218

13

Effect of Fertilizers on Rice Bean Productivity and Quality

13.2.1 Effect of Different NPK Levels on Pod Characteristics of Rice Bean Pod characteristics of rice bean such as number of pods per plant, number of seeds per pod which are related to the yield were recorded in different genotypes.

13.2.1.1 Number of Pods The number of pods per plant varied from 102.20 to 139.20 in rice bean genotypes without fertilizer application. Application of NPK level at10:30:10 kg/ha revealed variation in number of pods per plant from 124.46 to 141.60. The genotypes JCR-152 (141.60), followed JCR-20(D) (140.20) and JCR-20(S) (138.53) had highest number of pods per plant. Genotypes JCR-152, JCR-20(D), JCR-20(S) and IC-137195 were responsive to the fertilizer treatment. Application of NPK fertilizer at 20:60:20 kg/ha varied the number of pods per plant in rice bean genotypes from 128.46 to 154.93. Genotype IC-140796 (154.93) had highest number of pods per plant followed by JCR-20(D) (146.53) and JCR-20 (S) (145.60). The mean number of pods per plant for individual genotype was varied from 120.40 to 140.91 with the highest in genotypes IC-140796 (140.91), JCR-20 (140.73) and JCR-152 (138.17) (Table 13.1). The genotypes, BRS-2, IC-019352, LRB-164 and JCR-20(D) were highly responsive to the NPK level at 20:60:20 kg ha 1 for number of pods per plants. The highest percentage increase in the number of pods per plant (9.71%) was with NPK level at 20:60:20 kg ha 1. 13.2.1.2 Seeds Per Pod In rice bean, without fertilizer treatment (control) the number of seeds per pod varied from 7.29 (IC-140796) to LRB-164 (8.88). Rice bean fertilized with NPK level at 10:30:10 kg/ha revealed variation in number of seeds per pod from 7.92 to 9.90. The highest response to this treatment was observed for the genotypes LRB-168 (9.90), followed by IC-019352 (8.86), LRB-164 (8.66) and JCR-20(D) (8.63). NPK fertilizer at 20:60:20 kg/ha (T2) revealed variation in number of seeds per pod in rice bean genotypes from 7.50 to 8.79. Among the genotypes, the genotype IC-019352 (8.79) had highest number of seeds per pod followed by LRB-164 (8.76), and LRB-402 (8.74). The mean number of seeds per pod for individual genotype varied from 7.88 in IC-016789 to 8.79 (IC-019352). It was observed that number of seeds per pod with NPK treatment increased (6.38%) as compared to control. Among the genotypes, the highest response to fertilizer treatment was observed for the genotypes LRB-168, IC-140796, BRS-2 and JCR-152.

13.2.2 Effect of Different NPK Levels on Seed Yield of Rice Bean The seed yield in the ricebean genotypes without fertilizer treatment was 15.60 q/ha to 23.67 q/ha. The seed yield in the rice bean genotypes fertilized with NPK levels (10:30:10 kg/ha) varied from 17.33 q/ha to 24.73 q/ha. Among the genotypes

Source: Katoch (2011)

Genotypes JCR-20(S) IC-019352 LRB-168 LRB-40-2 LRB-164 IC-140796 JCR-152 IC-137195 IC-016789 JCR-20(D) BRS-2 Mean CD(Fertilizers) CV(Fertilizers) CD(genotypes)

Number of pods/plant NPK ratio 0:0:0 10:30:10 138.06 138.53 119.60 133.26 134.80 128.46 125.46 133.46 120.53 127.13 139.20 128.60 130.60 141.60 126.93 133.53 121.80 125.33 130.06 140.20 102.20 124.46 126.29 132.33 NS 15.48 NS 20:60:20 145.60 140.26 129.60 131.20 141.80 154.93 142.33 128.46 128.93 146.53 134.33 138.56

Table 13.1 Effect of different fertilizer levels on yield of rice bean Number of seeds/pod NPK ratio 0:0:0 10:30:10 8.33 8.58 7.80 8.86 7.36 9.90 8.42 8.13 8.88 8.66 7.29 8.22 7.80 7.92 8.10 8.30 8.09 8.04 8.18 8.63 7.65 8.22 7.99 8.50 0.40 9.78 NS 20:60:20 8.32 8.79 8.60 8.74 8.76 8.16 8.37 8.56 7.50 8.53 8.72 8.46

Seed yield (q/ha) NPK ratio 0:0:0 10:30:10 20.21 22.90 20.20 24.73 23.67 19.70 15.60 20.66 18.78 17.33 21.43 23.04 19.90 20.13 20.50 21.86 19.77 18.85 22.83 17.81 18.13 22.46 20.09 20.86 2.34 21.80 NS

20:60:20 31.41 24.47 21.83 22.62 19.94 25.88 29.18 24.74 27.44 19.98 19.91 24.27

13.2 Effect of Fertilizer on Productivity of Rice Bean Seeds 219

220

13

Effect of Fertilizers on Rice Bean Productivity and Quality

Fig. 13.1 Rice bean crop after treatment with different NPK levels

IC-019352 (24.73 q/ha), followed by IC-140796 (23.04 q/ha), JCR-20 (S) (22.90 q/ ha) and IC-137195 (21.86 q/ha) had higher seed yield. The application of NPK levels at 20:60:20 kg/ha revealed variation in the seed yield from rice bean genotypes from 19.91 q/ha to 31.41 q/ha. The genotypes JCR-20(S) (31.41 q/ha), JCR-152 (29.18 q/ ha), IC-016789 (27.44 q/ha) and IC-140796 (25.88 q/ha) had higher seed yield. The mean seed yield among different rice bean genotypes was from 18.53 q/ha (LRB– 164) to 24.84q/ha (JCR-20(S). The NPK fertilizer applied at 20:60:20 kg ha 1 ratio resulted 20.80% increase in seed production followed by 3.83% with 10:30:10 kg ha 1 (Table 13.1). Various aspects of the investigation revealed that seed yield from rice bean could be influenced NPK levels (Fig. 13.1). Different studies have also been conducted for appropriate production technology for improving the overall performance of rice bean particularly with fertilizer management. The seed yield of rice bean responded positively to N and P fertilization up to 30 and 60 kg ha 1, respectively (Mohapatra et al. 1996b). Mishra et al. (1995) observed that application of N at 40 kg ha 1 was sufficient to obtain maximum seed yield from rice bean. Khanda and Mishra (1998) observed higher seed production from rice bean when N applied at 40 kg ha 1, followed by 60 kg ha 1. Zaman and Malik (1999) reported that application of 20 kg N and 60 kg P2O5/ha has significant improvement in morpho-physiological attributes of rice bean that ultimately reflected in increased seed yield. Mukherjee et al. (2005) observed that application of SSP (Single Super Phosphate) as a phosphorus source applied at 80 kg ha 1 resulted significant increase in seed production over DAP (Di ammonium phosphate). Maiti et al. (2006) noticed maximum seed production when the crop received 80 kg of P2O5 per hectare. Kumar et al. (2016) also reported significant increase in the seed yield from rice bean with phosphorus, applied at

13.3

Effect of NPK Application on Protein and Amino Acid Content of Rice Bean Seeds 221

90 kg ha 1. Behera et al. (2015) reported that application of N upto 40 kg ha 1 revealed 49.65% increase in the seed yield with high net return, increased harvest index and benefit: cost ratio (1.81). The increased harvest index in rice bean indicates better partitioning of photosynthates which ultimately results in higher grain yield. The study also revealed that further increase in nitrogen level reduces the seed production in rice bean (Oomen and Sumabai 2002). The significant response of the measured yield traits of rice bean to phosphorus application could be attributed to increased rate of seed formation and grain filling.

13.3

Effect of NPK Application on Protein and Amino Acid Content of Rice Bean Seeds

Macro as well as micronutrients play pivotal role in wide range of metabolic functions in plants such as activation of various enzymes, accumulation and distribution of proteins, carbohydrates and fat and tolerance to various biotic and abiotic stresses which ultimately lead to increased nutritive quality of food crops. It has been reported that in the absence of any other production constraints, plant growth and nutritional characteristics have been largely dependent on the soil nutrient status. Therefore, supply of nutrients in proper combination is needed in order to obtain improved production with excellent nutritive quality. Fertilizers along with macronutrients can be supplemented with essential micronutrients to help eradicate deficiencies in people, particularly children, as well as plants and livestock. Different studies have been conducted with the prime objective of improving the nutritive quality of food crops with the application fertilizers (Oloyede et al. 2012; Dania et al. 2014; Khalid and Shedeed 2015; Fouda et al. 2017). The effect of three NPK levels: 0:0:0 kg/ha, 10:30:10 kg/ha and 20:60:20 kg/ha was evaluated on the quality traits of rice bean seeds.

13.3.1 Effect of Different NPK Levels on Crude Protein Content in Rice Bean Seeds NPK level at 10:30:10 revealed variation in crude protein content from 21.58% to 25.95% in the genotypes under study. In rice bean genotypes, fertilizer treatment with NPK level at 20:60:20, the crude protein content was in range from 22.49% to 25.95% (Table 13.2).

13.3.2 Effect of Different NPK Levels on Tryptophan Content (g/16 g N) in Rice Bean Seeds In rice bean genotypes receiving NPK at 10:30:10 kg/ha, the tryptophan content was in the range of 1.08 g/16g N to 1.42 g/16g N. Among them, the highest tryptophan containing genotypes were LRB-40-2 (1.42 g/16 g N) followed by IC-019352

20:60:20 25.08 24.79 24.79 24.20 23.91 25.08 25.95 24.49 24.20 22.74 22.49 24.49

Tryptophan (g/16 g N) NPK ratio 0:0:0 10:30:10 1.22 1.16 1.30 1.27 1.25 1.18 1.52 1.42 1.23 1.27 1.15 1.19 1.10 1.08 1.12 1.13 1.13 1.15 1.11 1.16 1.20 1.25 1.21 1.21 NS 12.16 0.14 20:60:20 1.28 1.32 1.17 1.43 1.29 1.18 1.05 1.10 1.21 1.19 1.18 1.22

Methionine (g/16 g N) NPK ratio 0:0:0 10:30:10 4.48 4.29 5.09 5.01 5.39 4.78 5.26 4.79 5.49 5.05 5.46 4.68 4.25 4.38 4.37 4.78 5.67 5.13 4.36 6.20 4.16 5.97 4.91 5.00 NS 17.00 NS

20:60:20 4.19 5.00 4.83 5.03 4.91 4.72 4.72 4.78 5.07 5.96 5.52 4.97

13

Source: Katoch (2011)

Genotypes JCR-20(S) IC-019352 LRB-168 LRB-40-2 LRB-164 IC-140796 JCR-152 IC-137195 IC-016789 JCR-20(D) BRS-2 Mean CD(Fertilizers) CV(Fertilizers) CD(genotypes)

Crude protein content (%) NPK ratio 0:0:0 10:30:10 25.37 24.49 24.79 24.79 24.20 25.08 23.91 24.20 24.49 23.91 24.79 24.79 25.08 25.95 24.20 24.79 24.20 23.91 23.91 21.58 24.20 23.33 24.47 24.25 NS 7.01 NS

Table 13.2 Effect of different fertilizer levels on protein and amino acid content of rice bean

222 Effect of Fertilizers on Rice Bean Productivity and Quality

13.4

Effect of Fertilizer on Rice Bean Fodder Yield

223

(1.27 g/16 g N), LRB-164 (1.27%) and LRB-168 (1.18 g/16 g N). Application of NPK at 20:60:20 in rice bean genotypes revealed tryptophan content in the range of 1.05% to 1.43% (Table 13.2).

13.3.3 Effect of Different NPK Levels on Methionine Content (g/16 g N) in Rice Bean Seeds Application of NPK level at 10:30:10 kg/ha increased the methionine content in different genotypes from 4.29 g/16 g N to 6.20 g/16 g N. The highest methionine content was observed in genotype JCR-20(D) (6.20 g/16 g N), followed by BRS-2 (5.97 g/16 g N) and IC-019789 (5.13 g/16 g N). The rice bean genotypes with NPK level at 20:60:20 revealed variation in methionine content from 4.19 to 5.96 g/16 g N (Table 13.2). The significant effect of fertilizer application on seed production from rice bean and the non significant variation in the level of crude protein and two nutritionally essential amino acids i.e., Methionine and Tryptophan reveals that the fertilizer application has significant role in enhancing rice bean productivity without affecting amino acid composition and protein content.

13.4

Effect of Fertilizer on Rice Bean Fodder Yield

Livestock is an important component in our agricultural production system, playing a vital role in the national economy of the country, however, due to ever increasing population pressure of human, arable land is mainly used for food and cash crops, thus, there is little chance of having good quality arable land available for fodder production. In India, generally there is no practice of fodder production in rural areas and animals generally consume naturally grown grasses and shrubs which are of low quality in terms of protein and available energy. Therefore, fodder crops in agriculture needs lot of emphasis for sustainable livestock production, regular availability of quality fodder is a basic requirement to produce milk, butter and other byproducts for human consumption. Among the forages, legumes are important in supplying quality nutrients like protein, minerals and vitamins to the animals. Leguminous forage can be used as supplement with straw-based diets for ruminants in order to improve digestibility of feed and overall performance of ruminants. From legumes, the nutritious fodder is generally obtained before the induction of flowering (Wattiaux 1994). Any delay in flowering has added the advantage of the supply of green fodder for longer periods and this can be achieved by applying essential mineral nutrients with proper combination of fertilizers. Nitrogen is an essential component of protein which might have resulted in more crude protein in plants receiving more NPK fertilization. The addition of phosphorus increases the nitrogen percentage in legumes. This is attributed to better root

224

13

Effect of Fertilizers on Rice Bean Productivity and Quality

development and plant metabolism. Comparatively higher crude protein content could also be attributed to phosphorus, which improves the protein synthesis because it is an essential component of nucleoprotein. Rice bean has great potential to be used as a feed source to animals. The effect of different NPK levels (0:0:0 kg/ ha, 10:30:10 kg/ha and 20:60:20 kg/ha) on plant height (cm), dry weight and fodder yield from rice bean has been discussed below.

13.4.1 Effect of Different NPK Levels on Plant Height (cm) The rice bean genotypes fertilized with NPK at 10:30:10 revealed variation in plant height from 188.93 cm to 234.14 cm (Table 13.3). The highest plant height was observed for the genotype IC-137200 (234.14 cm) followed by JCR-152 (228.26 cm), IC-137195 (224.40 cm). The highest response to this treatment was observed in the genotypes JCR-20, JCR-162, IC-137190 and JCR-152 as they showed highest percent increase in the plant height in comparison to control. In rice bean genotypes receiving NPK level at 20:60:20, the plant height varied from 189.80 to 233.06 cm. The genotypes IC-137200 (233.06 cm), IC-140796 (227.20 cm), JCR-152 (224.53 cm) and IC-137195 (208.93 cm) had maximum plant height. The highest response to the treatment was observed in genotypes JCR-162, BRS-2 and JCR-152 (Table 13.3). The plant height of different rice bean genotypes varied from 186.95 cm to 233.46 cm with different NPK levels. The study revealed that NPK treatment at 10:30:10 kg ha 1 has significant effect on plant height (Table 13.3).

13.4.2 Effect of Different NPK Levels on Fodder Yield (q/ha) The green fodder yield from rice bean genotypes with NPK at 10:30:10 kg ha– 1 varied from 282.82 q/ha to 375.55 q/ha (Table 13.3). The highest fodder yield was observed in genotype IC-137200 (375.55 q/ha), JCR-107 (375.55 q/ha) followed by IC-137195 (373.33 q/ha). Among the genotypes, the significant response to the treatment for fodder yield was observed in genotype JCR-107, JCR-152 and JCR-162 (Table 13.3). Treatment with NPK fertilizer at 20:60:20 kg ha 1, the fodder yield from the rice bean genotypes varied from 261.10 q/ha to 353.53 q/ha (Table 13.3). The highest fodder yield was recorded from the genotype IC-137200 (353.53 q/ha) followed by IC-137195 (344.44 q/ha), BRS-2 (327.77 q/ha) and IC-016789 (322.21 q/ha). The maximum response to the treatment was observed in genotype IC-016789, IC-1370190, and BRS-2 (Table 13.3). NPK treatment at 10:30:10 kg ha 1 resulted increase in green fodder yield (8.95%) with over the control (Table 13.3). Different studies have revealed effect of varying NPK level on fodder yield from rice bean. The application of phosphorus up to 40 kg ha 1 is optimum for obtaining maximum dry matter from rice bean fodder (Arya and Singh 1996). Behera and Mishra (1997) reported that application

Source: Katoch (2010)

Genotypes IC-140796 JCR-152 IC-137194 IC-016789 JCR-20 IC-137195 IC-137200 JCR-107 JCR-162 IC-137190 BRS-2 Mean CD(Fertilizers) CV(Fertilizers) CD(genotypes)

Plant height at 25% flowering NPK ratio 0:0:0 10:30:10 225.73 212.26 208.86 228.26 213.06 220.26 189.60 208.60 195.33 219.93 234.46 224.40 233.20 234.14 218.33 219.33 163.73 188.93 195.73 223.13 184.60 203.80 205.59 216.64 NS 9.44 18.76 20:60:20 227.20 224.53 208.93 190.13 198.40 208.33 233.06 217.00 208.20 208.73 189.80 210.39

Dry weight (g/100 g fresh wt.) NPK ratio 0:0:0 10:30:10 20:60:20 19.83 20.83 20.93 16.50 17.26 15.66 16.76 20.30 16.93 16.03 16.16 17.76 14.53 16.26 16.20 19.20 20.43 19.63 21.10 19.50 21.83 18.20 19.30 18.76 14.56 14.40 15.26 16.76 18.40 18.53 15.26 15.93 15.30 17.16 18.07 17.89 NS 12.30 2.05

Fodder yield (q/ha) NPK ratio 0:0:0 10:30:10 353.33 322.21 266.66 348.88 306.66 286.66 247.77 283.33 278.88 285.55 354.44 373.33 375.53 375.55 268.88 375.55 226.66 282.82 288.88 315.55 294.44 305.55 296.53 323.12 NS 16.14 47.22

Table 13.3 Effect of NPK treatment on plant height (cm) at 25% flowering, dry weight and green fodder yield (q/ha)

20:60:20 315.55 286.66 311.10 322.21 285.55 344.44 353.53 295.55 261.10 322.21 327.77 311.41

13.4 Effect of Fertilizer on Rice Bean Fodder Yield 225

226

13

Effect of Fertilizers on Rice Bean Productivity and Quality

of 30:60 kg of N: P2O5 per hectare increased the fodder production from rice bean. In other study, Iqbal et al. (1998) also observed maximum green fodder yield from rice bean when nitrogen and phosphorus applied at 50–75 kg ha 1. Pradhan et al. (2000) observed highest quantity of green fodder from rice bean (18.70 t/ha) with phosphorus, applied at 60 kg ha 1. Rudragouda et al. (2008) reported that application of 35:70:35 kg ha 1 of N: P2O5: K2O was beneficial to obtain higher green and dry forage yield from rice bean.

13.5

Effect of NPK Application on Rice Bean Fodder Quality

The nutritive value of herbage crops is principally dependent on species, variety, developmental phase, climatic conditions, nutrient application and harvesting time individually or by their combination. Scary information is available on the effect of primary nutrients (NPK) on quality of fodder from rice bean. The study with NPK fertilizer treatments 0:0:0 kg/ha, 10:30:10 kg/ha and 20:60:20 kg/ha was carried out to see their effect on forage productivity.

13.5.1 Effect of Different NPK Levels on Crude Protein Content in Rice Bean Fodder The crude protein content in forage from rice bean genotypes with NPK level at 10:30:10 kg/ha ranged from 20.99% to 27.41%. The maximum response to the NPK treatment was observed in genotypes IC-137195, IC-016789, and JCR-20. After treatment with NPK levels at 20:60:20 kg/ha, the crude protein content in forage from different rice bean genotypes varied from 23.62% to 25.37%. The genotypes IC-137195, IC-137190, and IC-137200 responded to the fertilizer treatment as compared to control (0:0:0 kg ha 1) (Table 13.4). The crude protein recorded in plants fertilized with NPK ratio at 10:30: 10 kg ha 1 was statistically similar to NPK ratio at 20:60:20 kg ha 1. N is an essential component of protein which might had resulted in more crude protein in plants receiving more NPK (Jamriska 1987). The addition of phosphorus increases the nitrogen percentage in legumes. This is attributed to better root development and plant metabolism. More crude protein content could also be attributed to phosphorus, which improves the protein synthesis because it is an essential component of nucleo-proteins.

13.5.2 Effect of Different NPK Levels on Crude Fiber Content in Rice Bean Fodder The crude fiber content in forage from different rice bean genotypes treated with NPK level at 10:30:10 kg/ha varied from 24.80% to 29.96%. The increase in crude fiber content was observed in genotype JCR-20 followed by IC-137195, IC-140796, and IC-137190. The application of NPK fertilizer at 20:60:20 kg/ha

Source: Katoch (2010)

Genotypes IC-140796 JCR-152 IC-137194 IC-016789 JCR-20 IC-137195 IC-137200 JCR-107 JCR-162 IC-137190 BRS-2 Mean CD(Fertilizers) CV(Fertilizers) CD(genotypes)

Crude protein content (%) NPK ratio 0:0:0 10:30:10 26.83 23.91 23.62 24.79 23.33 25.08 23.62 27.41 24.78 25.66 22.45 25.37 23.04 20.99 24.79 24.50 24.78 23.62 23.03 25.08 24.20 22.45 24.04 24.44 NS 7.00 NS 20:60:20 23.91 23.62 25.08 25.37 23.62 23.91 24.49 25.08 24.20 24.78 23.62 24.33

Table 13.4 Effect of fertilizer on quality of rice bean fodder

1.85

Crude fiber (%) NPK ratio 0:0:0 10:30:10 22.53 25.50 26.20 27.63 25.76 27.53 24.16 26.86 24.56 29.96 25.26 28.03 25.33 25.83 28.96 27.66 28.10 24.80 25.46 28.60 31.13 26.93 26.13 27.21 0.97 20:60:20 27.96 28.16 28.10 25.10 27.20 27.40 28.53 28.33 28.43 28.13 28.50 27.80

Total ash (%) NPK ratio 0:0:0 10:30:10 2.53 2.80 2.33 2.80 2.66 2.80 3.00 3.13 2.93 2.93 2.73 2.73 2.80 3.20 2.73 3.06 2.73 2.93 3.53 3.53 2.06 2.06 2.73 2.90 0.35 23.80 0.67

20:60:20 3.06 2.80 3.53 3.46 3.20 3.66 3.60 4.00 4.33 3.93 2.20 3.43

13.5 Effect of NPK Application on Rice Bean Fodder Quality 227

228

13

Effect of Fertilizers on Rice Bean Productivity and Quality

indicated variation in crude fiber content in rice bean genotypes from 25.10% to 28.53%. The genotypes IC-137200 (28.53%), BRS-2 (28.50%), JCR-162 (28.43%) and JCR-107 (28.33%) had significantly high level of crude fiber content in comparison to the other genotypes. NPK at 20:60:20 kg ha 1 resulted significant increase (6.39%) in the crude fiber content in rice bean fodder as compared to control (0:0:0 kg ha 1) (Table 13.4). Crude fiber content was maximum in plants fertilized with NPK ratio at 20:60:20 kg ha 1 followed by NPK ratio at 10:30: 10 kg ha 1. More crude fiber content with NPK ratio at 20:60:20 kg ha 1 might been due to better absorption of NPK and its utilization for plant growth.

13.5.3 Effect of Different NPK Levels on Ash Content in Rice Bean Fodder The ash content in fodder from different rice bean genotypes treated with NPK level at 10:30:10 kg/ha ranged from 2.06% to 3.53%. The genotypes JCR-152, IC-137200, IC-140796, and JCR-107 were responsive to the treatment. Treatment with NPK at 20:60:20 kg/ha, the ash content in rice bean fodder ranged from 2.20% to 4.33%. The high values for ash content was observed in genotype JCR-162 (4.33%), followed by JCR-107 (4.00%), IC-137190 (3.93%) (Table 13.4). The NPK treatments have crucial role in the crop productivity and NPK ratio of 20:60:20 kg/ha is responsive for increasing seed production without significant effect on nutritional profile of rice bean, where as the NPK ratio of 10:30:10 kg/ha was responsive for fodder quality.

13.6

Effect of Fertilizer on Nodulation Efficiency of Rice Bean

Nitrogen fixation is an important attribute of leguminous crop where the symbiotic association with nitrogen fixing bacteria in root nodules play significant role in the fixation of atmospheric nitrogen into most available form to the plant. The root nodule provides space and energy to the nitrogen fixing bacteria which in turn fix the atmospheric nitrogen for the plant. This is a symbiotic association between bacteria and the plant. The symbiotic association is helpful in replenishing the total available nitrogen in soil. Besides increasing the total available nitrogen in soil, legumes also maintain the soil physical and chemical property which is useful in making the soil fertility status better. The efficiency of a leguminous crop in improving the soil fertility status depends upon the nodulation efficiency which has two main component i.e., number of nodules and nodule weight. A leguminous plant having high number of nodules plant reflects its potential in fixing the higher amount of nitrogen in soil. In other words, the nodule number have proportional relationship with the soil fertility, thereby, crop production. As discussed earlier, the nodule provides living space and energy to the nitrogen fixing bacteria for its growth and multiplication, the

13.6

Effect of Fertilizer on Nodulation Efficiency of Rice Bean

229

higher nodule weight reflects the fast growth and multiplication of the bacteria inside the nodule. The number of nodules and nodule weight are interdependent to each other, in which the low number of nodules in plant is compensated by high nodule weight. Both number of nodules and nodule weight have direct relationship with the soil health. Higher the number of nodules and nodule weight, higher will be the soil fertility status. The nodulation efficiency in the leguminous plant varies with the genotype, environment conditions, availability of mineral nutrients, proper combination ratio and time of fertilizer application. N, P, K and some other micronutrients are required for nodule formation, of which phosphorus is of greater importance (Thakuria and Ioi-Khan 1991; Balchander et al. 2003). Though legumes don’t require nitrogen to be supplemented to the soil, but some time due to the poor soil health conditions, a booster dose of nitrogen is required.

13.6.1 Effect of Different NPK Levels on Nodule Weight and Nodule Numbers in Rice Bean The fertilization of rice bean genotypes with NPK level at 10:30:10 kg/ha resulted nodule weight from 0.74 g to 1.87 g. The highest response to the treatment was exhibited by the genotypes IC-137190, IC-140796, JCR-162 and IC-137195. The application of NPK fertilizer at 20:60:20 kg/ha revealed nodule weight in different rice bean genotypes from 0.90 g to 2.49 g. The increase in the nodule weight was observed in genotype IC-140796, JCR-20, JCR-162 and IC-137195. Fertilizer treatments affect the nodulation efficiency in rice bean and NPK treatment at 20:60:20 kg/ha was responsive for nodulation efficiency in rice bean. The nodule number varied from 87.69 to 112.19 in different genotypes (Table 13.5). The number was highest in genotype IC-140796 (131.33) followed by JCR-152 (111.88) and JCR-162 (110.62), whereas, lowest in genotypes IC-137200(72.25) and JCR-107(78.48). This differential response of rice bean genotypes to nodulation may be attributed to differences in their genetic makeup. The variations in nodule number were observed with varying doses of fertilizer treatments. Increase in nodule number was observed with NPK treatment at 20:60:20 kg ha 1. The study also revealed a positive relationship between nodulation efficiency, plant biomass and days to flowering. Application of nitrogen at early growth stages reduces nodulation efficiency in legumes as plants fulfill their own nitrogen requirements from the fertilizers (Hossain 1977; Sharma and Ramesh 2002). However, at later growth stages NPK treatment increases root nodulation (Hossain 1977). Katoch (2010) reported that mean nodule weight varied significantly from 0.74 to 1.93 g in individual rice bean genotypes. Higher nodule weight (g) was recorded in IC-140796 (1.93 g), JCR-152 (1.85 g), JCR-162 (1.62 g) and IC-137190 (1.60 g) in comparison to the check BRS-2 (1.05 g). Arya and Singh (1996) also reported that application of single super phosphate at the rate of 60 kg ha 1 has higher average fresh weight of rhizobium in rice bean. Other studies have also reported the significant effect of fertilization on

230

13

Effect of Fertilizers on Rice Bean Productivity and Quality

Table 13.5 Nodulation efficiency in rice bean genotypes at different fertilizer levels

Genotypes IC-140796 JCR-152 IC-137195 IC-016789 JCR-20 IC-137195 IC-137200 JCR-107 JCR-162 IC-137190 BRS-2 Mean CD(Fertilizers) CV(Fertilizers) CD(genotypes)

Nodule weight NPK ratio 0:0:0 10:30:10 1.44 1.87 1.84 1.84 1.04 1.37 0.77 0.93 0.90 0.91 0.78 0.90 0.60 0.74 1.32 1.08 1.33 1.72 1.30 1.75 0.80 1.23 1.10 1.30 0.23 36.31 0.44

20:60:20 2.49 1.89 1.50 0.96 1.56 1.15 0.90 1.09 1.80 1.75 1.11 1.47

Nodule number NPK ratio 0:0:0 10:30:10 121.11 134.44 97.88 109.44 80.00 110.22 88.33 114.33 91.88 98.55 70.44 88.33 66.66 75.55 81.11 74.33 101.22 125.33 88.88 100.00 77.10 120.66 87.69 104.65 10.72 21.46 20.54

20:60:20 138.44 128.33 114.99 120.44 129.11 103.33 74.55 80.00 105.33 111.44 128.10 112.19

Source: Katoch (2010)

nodulation efficiency in legumes (Agboola and Obigbesan 2001; Mokwunye and Bationo 2002; Olaleye et al. 2011; Nkaa et al. 2014). Rice bean respond to different agronomic appraisals. A positive relationship between nodulation efficiency, plant biomass and days to flowering in rice bean has been observed. The application of NPK fertilizer at 10:30:10 kg ha 1 and 20:60:20 kg ha 1 influences the seed yield, fodder yield and their quality attributes and thereby considered as optimal doses for improving seed as well as fodder yield from rice bean along with nutritional attributes.

References Agboola AA, Obigbesan GO (2001) Effect of different sources and levels of P on the performance and P uptake of IfeBrown variety of cowpea. Ghana J Agric Sci 10(1):71–75 Arya MPS, Singh RV (1996) Effect of sources and levels of phosphorus on the growth and nodulation behavior of rice bean (Vigna umbellata). Legume Res 19:227–229 Balchander D, Nagarajan P, Gunasekaran S (2003) Effect of organic amendments and micronutrients on nodulation and yield of black gram in acid soils. Legume Res 26:92–195 Behera B, Mishra M (1997) Effect of nitrogen fertilization and weed management on weed growth, nitrogen uptake and productivity of rice bean. Ann Agric Sci 18:214–217 Behera J, Mohanty PK, Lokose RYP, Mishra A (2015) Response of promising rice bean [Vigna umbellata (Thunb.) Ohwi & Ohashi] genotypes in different levels of nitrogen. Int J Sci Res 6:272–275 Bhati DS, Mathur JR, Sharma RC (1988) Response of Moth bean [Vigna aconitifolia (Jacq.) Marechal] to graded levels of N and P. Ann. Arid Zone 27:63–64 Bowyer A (2010) The use of fertilizers in farming. eHow.com

References

231

Dania SO, Akpansubi P, Eghagara OO (2014) Comparative effects of different fertilizer sources on the growth and nutrient content of moringa (Moringa oleifera) seedling in a greenhouse trial. Adv Agric 2014:726313 Fouda KF, El-Ghamry AM, El-Sirafy ZM, Klwet IHA (2017) Integrated effect of fertilizers on beans cultivated in alluvial soil. Egypt J Soil Sci 57:303–312 Hossain MM (1977) Nodulation formation in V. mungo in response to different combinations of nitrogen, phosphorus and potassium fertilizers. Bangladesh J Bot 6:1–7 Iqbal K, Tanveer A, Ali A, Ayub M, Tahir M (1998) Growth and yield response of rice bean fodder to different levels of N and P. Pak J Biol Sci 1:212–214 Jamriska P (1987) Effect of nitrogen fertilization, sowing rate and harvesting time of oats under sown with alfalfa on forage yield and quality. Agrochemia 27:71–75 Katoch R (2010) Effect of different fertilizer levels on root nodulation and fodder quality in rice bean (Vigna umbellata) genotypes. Range Manag Agrofor 31:41–47 Katoch R (2011) Effect of NPK enrichment on growth, yield and quality traits in rice bean (Vigna umbellata). Acta Agron Hung 59(4):317–324 Khalid KA, Shedeed MR (2015) Effect of NPK and foliar nutrition on growth, yield and chemical constituents in Nigella sativa L. J Mater Environ Sci 6:1709–1714 Khanda CM, Mishra PK (1998) Effect of plant density and nitrogen fertilization on growth and yield of rice bean. Indian J Agron 43:700–703 Khaskheli MA (2011) Sustainable agriculture and fertilizer practices in Pakistan. http://www. pakissan.com/english/allabout/farminputs/fertilizers/sustainable.agriculture.and.fertilizer.shtml Kumar B, Surin SS, Tuti A (2016) Response of rice bean genotypes to varied levels of phosphorus under rainfed condition of Jharkhand. Int J Sci Environ Technol 5:4607–4611 Maiti S, Mukherjee AK, Nanda MK, Bhattacharya S (2006) Effect of levels of phosphorus and dates of sowing on the productivity of rice bean when grown as a grain legume. J Crop Weed 2:37–39 Mikha MM, Stahlman PW, Benjamin JG, Geier PW, Poss DJ (2010) Remediation/restoration of degraded soil to improve productivity in the central great plains region. Proceedings of the Great Plains Soil Fertility Conference, Denver, CO, pp 229–235 Mishra A, Muduli KC, Mishra BK, Patra AK (1995) Inter-relationship between yield and its components in rice bean. Environ Ecol 13:430–432 Mohapatra AK, Paikray RK, Mishra RC, Haldar J (1996a) Response of rice bean (Vigna umbellata) to nitrogen and phosphorus fertilization in acid red soil. Ann Agric Sci 17:445–446 Mohapatra AK, Paikray RK, Mishra RC, Haldar J (1996b) Response of rice bean (Vigna umbellata) to nitrogen and phosphorus fertilization in acid red soil. Ann Agric Sci 17:445–446 Mokwunye AU, Bationo A (2002) Meeting the phosphorus needs of soils and crops of west Africa: The role of indeginous phosphate rocks. In: Vanlauwe B, Diels J, Sanginga N, Merckx R (eds) Integrated plant nutrition management in sub Saharan Africa; from concept to practise. CABI/ IITA, Cormwell Press, Trowbridge, p 209 Mukherjee AK, Maiti S, Nanda MK, Bhattacharya S, Nandi M (2005) Effect of phosphorus sources on seed production of rice bean (Vigna umbellata) cultivars in red lateritic zones of West Bengal. J. Crop Weed 1:5–7 Niklyaev VS (1975) The effect of seed rate and fertilizers on the growth, development and yield of pulses. Vestmik Soliskohozaistvenmo 11:29–35 Nkaa FA, Nwokeocha OW, Ihuoma O (2014) Effect of Phosphorus fertilizer on growth and yield of cowpea (Vigna unguiculata). IOSR J Phar Biol Sci (IOSR-JPBS) 6:74–82 Olaleye O, Fagbola O, Abaidoo RC, Ikeorah N (2011) Phosphorus response efficiency in cowpea genotypes. IITA, Ibadan. Canadian Centre of Sciences and Education. pp 1–10 Oloyede FM, Obisesan IO, Agbaje GO, Obuotor EM (2012) Effect of NPK fertilizer on chemical composition of pumpkin (Cucurbita pepo Linn.) seeds. Sci World J 2012:808196 Oomen SK, Sumabai DL (2002) Rice bean-potential fodder crop. The Hindu. Science and Technology, Online edition, India’s Nat Newspaper

232

13

Effect of Fertilizers on Rice Bean Productivity and Quality

Pradhan AC, Samanta G, Agasti MK (2000) Effect of phosphate nutrition and harvesting schedule on the production of forage and mineral matter in rice bean [Vigna umbellata (Thunb.) Ohwi and Ohashi] in terai region of West Bengal. Indian Agric 44:321–334 Rotaru V, Sinclair TR (2009) Interactive influence of phosphorus and iron on nitrogen fixation by soybean. Environ Exp Bot 66(1):94–99 Rudragouda R, Angadi SS, Hongal MM (2008) Influence of genotypes, spacing’s and fertility levels on growth and yield of rice bean [Vigna umbellata (Thunb.) Ohwi and Ohashi] for fodder production. Crop Res 35:153–154 Schulze J, Temple G, Temple SJ, Beschow H, Vance CP (2006) Nitrogen fixation by white lupin under phosphorus deficiency. Ann Bot 98:731–740 Sharma KL, Ramesh V (2002) Nutrient management practices in dry land agriculture and cropping systems. Proceedings of the System approach to plant nutrition for sustainable crop production, Rajendranagar, Hyderabad, pp 335–339 Sulieman S, Schulze J (2010) Efficiency of nitrogen fixation of the model legume Medicago truncatulata (Jemalong A17) is low compared to Medicago sativa. J Plant Physiol 167:683–692 Sulieman S, Van Ha C, Schulze J (2013) Growth and nodulation of symbiotic Medicago truncatula at different levels of phosphorus availability. J Exp Bot 64:2701–2712 Thakuria K, Ioi-Khan E (1991) Effect of phosphorus and molybednum on growth nodulation and yield of cowpea and soil fertility. Indian J Agron 36:602–660 Tomar SS, Sharma RK, Namdeo KN (1984) Performance of urd bean varieties under various row spacing and fertility levels. Legume Res 17:51–53 Vance CP, Uhde-Stone C, Allan DL (2003) Phosphorus acquisition and use: critical adaptations by plants for securing a nonrenewable resource. New Phytol 157:423–447 Wattiaux M (1994) Nutrients in the feed. The Babcock Institute for International Dairy research and development. University of Wisconsin, Madison Zaman QUZ, Malik MA (1999) Growth, seed yield and protein content of rice bean (Vigna umbellata) in relation to nitrogen and phosphorus nutrition. Int J Agric Biol 4:290–292 Zhang Z, Liao H, Lucas WJ (2014) Molecular mechanisms underlying phosphate sensing, signaling, and adaptation in plants. J Integr Plant Biol 56:192–220

Insect Pest Resistance Factors in Rice Bean

14

Presently insect pest menace has significantly affecgeted the crop productivity worldwide. At present more than 10,000 insect species posing imminent threat to different food crops have been identified (Rauf et al. 2019). For many decades, the most widely adopted approach has been the use of agrochemicals for pest management. Pesticides were used initially to benefit human life through increasing crop production, but their adverse effects overweighed the benefits associated with their use (Gill and Garg 2014). The situation is getting worse in developing countries due to rapid increase in human population together with changing climatic conditions. Therefore, in order to feed expanding human population in face of changing climatic scenario, crop protection without affecting the environmental health must be an integral component of modern-day agriculture practices. Currently farmers are utilizing pesticides indiscriminately and injudiciously which has led to wide concerns among agriculturist and environmentalist regarding the long-term damage to environmental health, reduction in population of natural enemies (Predators, parasites and parasitoids), beneficial insects, development of resistance and resurgence in targeted insect-pests, and their biomagnification in food chain (Kranthi et al. 2002a, b). Since the concerns regarding the use of ecologically unsafe pesticides have increased, therefore, investigation on developing more economical and eco-friendly pest management strategies has become imperative. The alternative approach for preventing agricultural losses or to control pest population is exploiting the potential toxicity of plant inhibitory proteins. Genes encoding these proteins provide a great means of transferring resistance to susceptible crops using recombinant DNA technology. The global pulse production suffers severe yield losses every year due infestation of storage pests particularly Callosobruchus maculatus a serious storage pest of legumes. This insect is widely distributed among the bruchid species, occurring in Africa, Asia, and Australia (Daglish et al. 1993). The estimated losses due to bruchid attack on various pulses are from 30% to 40% within a period of 6 months, and the postharvest seed losses due to bruchids could reach to up to 100% during severe infestation (Mahendran and Mohan 2002). # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_14

233

234

14

Insect Pest Resistance Factors in Rice Bean

Researchers have identified the some of the wild species of Vigna genus including Vigna vexillata, Vigna luteola, and Vigna reticulata resistant to Callosobruchus maculatus. Rice bean, one of the members of Vigna genus, is also least affected by this insect; thereby its seeds own a longer storage life (Tomooka et al. 2000). Kashiwaba et al. (2003) based on visual inspection of seed coats and X-ray observation of seed internal parts of the seed reported that the rice bean not only has the resistance to Callosobruchus maculatus but also has resistance against two other bruchid species adzuki bean weevil (Callosobruchus chinensis) and Graham bean weevil (Callosobruchus analis). The resistance to bruchid in legumes could be because of (1) hard seed coat, (2) seed shape and size, (3) less stored food in seed, and (4) the presence of inhibitory factors in seed (Southgate 1979). The study by Kashiwaba et al. (2003) ruled out the possibility of seed coat as one of the resistance factors imparting bruchid resistance in rice bean. The study by Ignacimuthu et al. (2000) established that seeds of wild legumes contain higher amounts of trypsin and chymotrypsin inhibitors. A similar phenomenon was observed in 19 accessions of wild plants including rice bean belonging to the genus Vigna by Srinivasan and Durairaj (2007). They reported that the chymotrypsin inhibitor (units/g) was in the range of 314.56–883.35 in different accessions of rice bean. The genotype LRB 292 has maximum quantity of chymotrypsin inhibitor which was 2.8 times higher than susceptible variety, CO-6 (314.56 CIU/g). It has been well established that the presence of protease inhibitors in rice bean seeds prevent the larval growth and development in the seed (Srinivasan and Durairaj 2007; Pavithravani et al. 2013; Katoch et al. 2013). Several defense proteins in rice bean might have role in imparting resistance against storage insects. The inhibitors of serine proteases especially trypsin and chymotrypsin and lectins are of particular interest as many insects obtain essential amino acids by secreting trypsin and chymotrypsin enzymes into midgut lumen (Bhattacharyya et al. 2007).

14.1

Protease Inhibitor from Rice Bean and Their Inhibitory Potential

Biochemically, protease inhibitors (PIs) are small inhibitory proteins which competitively bind with the active site of proteolytic enzymes and inhibit their functional activity. The feeding of insects on plant parts having high level of protease inhibitors reduces the digestive capability of insects by binding to digestive proteases and leads to deficiency of essential amino acids, thereby affecting the growth and development, fecundity, and ultimately survival of the insects (Azzouz et al. 2005; Katoch et al. 2014; Lawrence and Koundal 2002; Oppert et al. 2003; Ryan 1990). The plant PIs profoundly bind to insect gut proteases, and insect produces large amount of proteases which increase the loss of essential amino acids for protein synthesis, due to which the insect become weak and ultimately die (Broadway and Duffey 1986; De Leo and Gallerani 2002). The PIs in plant system are generally competitive inhibitors acting as pseudo-substrate and form stable stoichiometric complexes with gut proteases in insect midgut, thus preventing their catalytic function. This

14.1

Protease Inhibitor from Rice Bean and Their Inhibitory Potential

235

Inactive protease

Active site

Inhibitor

Active protease

Substrate

Enzyme substrate complex

No product

Final products

Enzyme-inhibitor complex

Fig. 14.1 Protease–protease inhibitor interaction

irreversible binding causes severe damage to insect cuticle, basement membranes, and peritrophic matrix and activates/deactivates different metabolic pathways responsible for the production of cytotoxic compounds. Initially PIs have been classified into nonspecific and class-specific super families, and subgroups have been further classified into four mechanistic classes depending upon amino acid sequence, position and nature of reactive site, and number of disulfide bridges in their structure. The most common classes of protease inhibitors are serine, cysteine, aspartic, and metalloprotease inhibitor. Among them, serine protease inhibitors are universal and thoroughly investigated. Serine proteinase inhibitor directly blocks the active site of the proteinase in a substrate-like manner. The inhibitor provides a reactive site loop forming several inter-main chain hydrogen bonds with binding sites of the proteinase, with its scissile peptide bond partially added to the active site, and with the P1 side chain (here that of a Lys residue) as the principal cleavage site determinant projecting into the S1 specificity pocket, making numerous substrate-like interactions. Among serine PIs, trypsin inhibitor is the most studied because trypsin activates and regulates the functioning of several digestive proteases which are secreted as proenzymes in gastrointestinal tract (Fig. 14.1). The protease inhibitors have been reported from different plant families, but their higher amount has been reported from Leguminosae family. Occurring commonly in leguminous seeds, the protease inhibitors have been classified into two distinct families of Kunitz and Bowman–Birk type of inhibitors based upon the molecular mass and disulfide bond pattern. The Kunitz-type inhibitors have a single chain polypeptide with an apparent molecular mass of ~20 kDa with two intra-chain disulfide bridges and lower cysteine content, while the Bowman–Birk inhibitors

236

14

Insect Pest Resistance Factors in Rice Bean

are single chain polypeptides with molecular mass ranges from 7.0 to 10 kDa molecular weight. The Bowman–Birk inhibitors possess seven disulfide bridges with two active domains for trypsin and/or chymotrypsin enzymes. Rice bean seeds have remarkable storage characteristics and remain unaffected from storage pests for a longer time compared to other legumes of the genus Vigna. This attribute makes this crop more important for designing strategies for transferring resistance into the susceptible crops. The studies conducted on rice bean have confirmed that the protease inhibitor content varies in different plant parts, and particularly higher amounts are there in mature seeds. The trypsin inhibitor was isolated and purified from rice bean, and its inhibitory potential was investigated against the agriculturally important insects.

14.1.1 Trypsin Inhibitor Content in Different Parts of Rice Bean Plant In the study, 12 different rice bean genotypes were investigated for trypsin inhibitor content in the leaves, tendrils, and stem after 105 days of planting (DAP). The results revealed significant variation in TI content in different plant parts. In leaves, the trypsin inhibitor content varied from 13.98 to 15.32 mg/g, and the highest trypsin inhibitor content was observed in genotype IC-140795 followed by genotype JCR-163. The least values of trypsin inhibitor content were observed in genotype Baroi. The trypsin inhibitor content in tendrils varied from 17.04 to 18.16 mg/g (Table 14.1). The highest trypsin inhibitor content in tendrils was recorded in genotype LRB-141, whereas genotype EC-48223B had lowest trypsin inhibitor content in tendrils. In comparison to the trypsin inhibitor content in tendrils and leaves, the stems comparatively had higher trypsin inhibitor content, and the value ranged from 18.40 to 19.70 mg/g. The higher values of trypsin inhibitor content in stems were in genotype IC-137194 followed by IC-137200 while minimum for genotype IC-140808 (Table 14.1).

14.1.2 Trypsin Inhibitor Content in Intact Pods, Developing and Mature Seeds of Different Rice Bean Genotypes Different rice bean genotypes were investigated for trypsin inhibitor in intact pods as well as in seeds at different growth stages. The stem, tendrils, and intact pods revealed decreasing content as compared to seeds with lowest level in leaves. In seeds, the trypsin inhibitor content was comparatively high even at early stage of seed development. The changes in trypsin inhibitor content were consistent with the overall metabolic changes during seed development that favor net accumulation of seed reserves including storage proteins from early stages till seed maturation. Increasing inhibitor content was observed from 105 to 160 days after planting, particularly in seeds. In the intact pods, the trypsin inhibitor content 145 days after

14.1

Protease Inhibitor from Rice Bean and Their Inhibitory Potential

Table 14.1 Trypsin inhibitor (mg/g) in leaves, tendrils, and stem in different rice bean genotypes

Genotype JCR-54 JCR-163 IC-137194 IC-140795 IC-140808 IC-140798 IC-137200 LRB-141 LRB-176 EC-48223B Baroi BRS-2 GM CD at 5% CV SE (m)


Trypsin inhibitor content (mg/g) Plant part Leaves Tendrils 14.77 17.93 15.24 17.77 14.85 18.01 15.32 17.61 15.00 17.93 14.77 17.45 15.08 17.85 14.77 18.16 14.45 17.77 14.69 17.14 13.98 17.77 14.37 17.69 14.77 17.75 0.42 NS 1.31 1.41 0.13 0.17

237

Stem 18.95 19.43 19.74 19.43 18.40 19.35 19.67 19.43 19.66 19.51 19.67 19.43 19.39 NS 2.72 0.21

Source: Katoch et al. (2015) Results have been presented as trypsin inhibitor content after 105 days of planting

planting, ranged from 15.88 to 16.98 mg/g while it was minimum after 105 days of planting (6.16 to 7.89 mg/g) (Table 14.2). In intact pods, the trypsin inhibitor content was in genotype IC-140808 (16.98 mg/g) followed by EC-48223B (16.90 mg/g), whereas the lowest trypsin inhibitor content was in IC-140798 at 145 days after planting. The trypsin inhibitor content in seeds was 160 days after planting ranged from 27.42 to 30.60 mg/g followed by 145 days after planting (16.58 to 18.56 mg/g), 135 days after planting (9.95 to 10.58 mg/g), and 105 days after planting (8.76 to 10.02 mg/g). The trypsin inhibitor in seeds nearing maturity at 160 days after planting was in genotype BRS-2 (30.60 mg/g). The trypsin inhibitor content is contributing factor for resistance against insect pests in rice bean seeds. The relatively low amount of trypsin inhibitor in leaves and tendrils of rice bean indicated a trivial role for trypsin inhibitor in regulation of proteases during growth. However, the trypsin inhibitor content in seeds of most rice bean genotypes confirms the regulatory and defensive role for trypsin inhibitor. The quantitative differences in the inhibitor proteins among genotypes are likely due to inherent genotypic differences.

14.1.3 Isolation and Purification of Trypsin Inhibitor from Rice Bean Before isolation and purification of trypsin inhibitor, different rice bean genotypes were screened for the trypsin inhibitor content. Genotype BRS-2 was identified with

105 DAP Intact pods 7.10 6.24 7.11 7.34 7.89 7.18 6.71 7.58 7.42 6.16 6.87 6.53 7.01 0.88 5.71 0.28

Developing seeds 9.40 9.00 9.08 10.02 9.39 9.00 9.87 9.47 9.71 10.02 9.16 8.76 9.40 0.76 3.67 0.24

135 DAP Intact pods 15.40 15.72 15.08 15.16 14.45 15.16 15.00 15.64 15.71 15.55 15.24 15.08 15.26 NS 2.20 0.23 Developing seeds 10.42 10.06 9.95 10.50 10.10 10.58 10.50 10.58 10.42 10.34 10.10 11.21 10.41 NS 2.90 0.21

145 DAP Intact pods 16.27 16.50 16.19 16.43 16.98 15.88 16.11 16.11 16.35 16.90 16.58 16.58 16.40 0.48 1.35 0.15 Developing seeds 18.08 17.93 17.85 17.93 17.53 17.61 17.53 17.77 18.56 17.53 16.58 17.37 17.90 0.80 2.08 0.25

160 DAP Mature seeds 27.42 28.74 29.27 28.61 29.79 28.74 28.74 29.79 28.61 29.27 28.74 30.60 28.70 NS 14.25 2.95

14

Source: Katoch et al. (2015)

Genotypes JCR-54 JCR-163 IC-137194 IC-140795 IC-140808 IC-140798 IC-137200 LRB-141 LRB-176 EC-48223B Baroi BRS-2 GM CD at 5% CV SE (m)


Table 14.2 Variation in trypsin inhibitor (mg/g) content in intact pods, developing and mature rice bean seeds

238 Insect Pest Resistance Factors in Rice Bean

14.1

Protease Inhibitor from Rice Bean and Their Inhibitory Potential

239

Table 14.3 Purification profile of trypsin inhibitor from rice bean

Step Crude extract Ammonium sulfate precipitation Ion exchange chromatography Gel filtration Affinity chromatography

Total activity (TIU) 42,806 30,211

Protein (mg) 4811 1080

40

22,198

49

35 14

16,123 10,491

25.50 6.50

Volume (ml) 100 50

Specific activity 8.9 27.9

Fold purification 1.00 3.14

Yield (%) 100 70.60

483.0

50.95

51.80

632.30 1614.00

71.12 181.55

37.60 24.50

appreciable trypsin inhibitor activity. Isolation and purification of inhibitor were carried out from the genotype BRS-2. Entailing different chromatographic methods, the trypsin inhibitor was purified to homogeneity with 181.50-fold purification and 29% yield (Table 14.3). The ion exchange chromatography on DEAE-sepharose column and elution with a NaCl gradient (0.1 M to 0.5 M) resulted in chromatographic profile featuring two peaks corresponding to 0.2 M and 0.4 M NaCl, respectively. The details of chromatographic separation of trypsin inhibitor have been given in Fig. 14.2. The specific activity of trypsin inhibitor in the crude extract was 8.90 which after affinity purification increased to 1614 units per mg of total protein. The fractions pooled from the second peak revealed highest trypsin inhibitory activity (Fig. 14.2a). The active fractions of those possessing high trypsin inhibitor activities were loaded on Superdex 75 column for gel filtration chromatography (Fig. 14.2b). Finally, pooled fractions from the Sephadex G-75 column were allowed to flow through CNBractivated Sepharose-trypsin column, and the active fractions with trypsin inhibitor activity were collected (Fig. 14.2c). The electrophoretic analysis of the purified trypsin inhibitor on SDS-PAGE revealed a single sharp protein band with a molecular mass of approximately 13.0 kDa. From other leguminous species, protease inhibitors with molecular mass of 13-24 kDa have been purified. Trypsin inhibitor having 14 kDa molecular weight with 13.5-fold purification with 30% yield has also been purified from mung bean. It is well documented that legume seeds normally contain trypsin and chymotrypsin inhibitors of either the Bowman–Birk (10–12 kDa) or the Kunitz family (21–26 kDa). Since the trypsin inhibitor from rice bean was of approx. 13.0 kDa, thereby it is an Bowman-Birk type of inhibitor.

14.1.4 Thermal and pH Stabilities of Rice Bean Trypsin Inhibitor The stability of purified trypsin inhibitor at a range of the temperatures and pH was also investigated. The incubation of purified trypsin inhibitor in buffers of pH ranged from 2.2 to 9.0 revealed maximal inhibitory activity at pH 4.0, followed by a decline

240

14

Insect Pest Resistance Factors in Rice Bean

Fig. 14.2 (a) Trypsin inhibitory activity (%) and protein content (mg) in DEAE- Sepharose chromatographic fractions eluted with a 0.1–0.5 M step NaCl gradient, (b) trypsin inhibitory activity (%) and protein content (mg) in Superdex 75 chromatographic fractions, (c) trypsin inhibitory activity (%) and protein content (mg) in Sepharose-trypsin affinity chromatographic fractions

at higher pH values. This characteristic of purified inhibitor corroborates the characteristic of trypsin inhibitor from mung bean whose stability observed between the pH 4.0 and 7.5. Thermostability analysis of purified rice bean trypsin inhibitor in 0.1 M phosphate buffer (pH 7.5) at temperatures ranging from ambient to 100  C for

14.1

Protease Inhibitor from Rice Bean and Their Inhibitory Potential

241

Fig. 14.3 Effect of pH (a) and of temperature (b) on the activity of purified rice bean trypsin inhibitor

45 min revealed that the inhibitor was stable up to 70  C, but incubation above 70  C resulted in decreased trypsin inhibitor activity (Fig. 14.3a, b). Sierra et al. (1999) suggested that the stability of the inhibitor at high temperatures may be attributed to its rigid and compact structure, which is stabilized by a number of disulfide linkages and extensive hydrogen bond networks. The presence of intramolecular disulfide bridges is presumably responsible for the functional stability of Kunitz-type inhibitors in the presence of physical and chemical denaturants such as temperature, pH, and reducing agents.

14.1.5 Inhibitory Effect of Rice Bean Trypsin Inhibitor on Spodoptera Gut Proteases Herbivorous insects, majority of which belong to the order Lepidoptera, are serious pest of many economic crops and are responsible for causing significant yield losses from these crops every year. The larval stage of these insects causes significant damage to the crop plants. Among the herbivorous lepidopteran pest, Spodoptera litura, commonly known as cluster caterpillar, tobacco cutworm, and tropical armyworm, is a polyphagous pest for having wide host range. This pest has been known

242

14

Insect Pest Resistance Factors in Rice Bean

Fig. 14.4 (a) Dissected insect larvae, (b) larval midguts

Fig. 14.5 Inhibitory activity of rice bean trypsin inhibitor against gut proteases of Spodoptera litura

to cause serious pest outbreaks on major crops which results in 25.80% to complete crop loss depending upon the stage of infestation (Dhir et al. 1992). Spodoptera litura is resistant to many insecticides including new insecticides such as lufenuron (Armes et al. 1997; Kranthi et al. 2002a, b). The rice bean trypsin inhibitor strongly inhibited the activity of trypsin. Since the trypsin inhibitors are also potent chymotrypsin inhibitors, the potential of rice bean trypsin inhibitor was also checked against chymotrypsin enzyme. The inhibition profile of trypsin and chymotrypsin enzyme from Spodoptera litura has been presented in Figs. 14.4 and 14.5. The highest percent inhibition of trypsin and chymotrypsin inhibition was observed at the third larval stage (97% and 81%, respectively) followed by the fourth larval stage (89% and 79%, respectively). The rice bean trypsin inhibitor is effective in inhibiting the activities of both trypsin and chymotrypsin enzymes; therefore, it has prospects of application in designing insect–pest control strategies.

14.2

14.2

Protease Inhibitor Gene (RbTI) from Rice Bean

243

Protease Inhibitor Gene (RbTI) from Rice Bean

Transferring resistance factors into the susceptible crops also requires information on its molecular background. A large number of protease inhibitor genes have been cloned and characterized from leguminous as well as from non-leguminous plants, and their molecular aspects have been thoroughly studied along with the structural and functional properties of encoded proteins (Ge et al. 2012; Kuhar et al. 2012; Saini et al. 2015; Chinnapun et al. 2016).

14.2.1 Cloning and Characterization of Rice Bean Trypsin Inhibitor Gene For the first time, we successfully cloned and characterized the Bowman–Birk protease inhibitor from rice bean (Fig. 14.6). The partial cDNA sequence was further used for the designing of primers for the amplification of the 50 and 30 cDNA ends. Employing RACE technique, the fulllength sequence of 593 bp was obtained in which the 327 bp was coding sequence (Fig. 14.7). The gene sequence encoding Bowman–Birk protease inhibitor from rice bean (RbTI) has been successfully submitted in NCBI gene bank with under the accession number KJ159908. The analysis of deduced amino acid sequence obtained by using expasy translate tool (http://www.expasy.org) revealed that the coding region of rice bean trypsin inhibitor gene containing 54.13% AT-rich region and CG 45.87% encoded a single polypeptide made up of about 108 amino acids. In this polypeptide chain, the most of the amino acids are polar which are 35 in number [asparagine (N), cysteine (C), glutamine (Q), serine (S), threonine (T), and tyrosine (Y)], while 26 amino acids are hydrophobic amino acids [alanine (A), isoleucine (I), leucine (L), phenylalanine (F), tryptophan (W), and valine (V)], 13 are strongly acidic [glutamic acid (D) and aspartic acid (E)], and 11 are strongly basic [lysine (K) and arginine (R)] amino acids. It is well known that the most of the eukaryotic genes are interrupted by one or more non-coding sequences known as introns. Though the intronless genes are a Fig. 14.6 Amplification of partial RbTI gene sequence. (a) Ladder, (b) amplified of RbTI from cDNA, and (c) amplified RbTI gene from genomic DNA

244

14

Insect Pest Resistance Factors in Rice Bean

Fig. 14.7 Nucleotide and deduced corresponding amino acid sequence of RbTI. Source: Katoch et al. (2014)

characteristic feature of prokaryotic cell, there are still a number of intronless genes in eukaryotes. The gene fragment of 327 bp was also amplified using genomic DNA as a template, which inferred that the RbTI gene was intronless. Similar to our observation, the small gene size and intronless nature of BBI-type inhibitors have also been predicted by Wang et al. (2008). Gruden et al. (1998) also observed the intronless nature of genes encoding potato cysteine proteinase inhibitors (PCPIs) from a multigene family, and their genes do not possess any introns. Similarly, Ishikawa et al. (1994) also reported intronless nature of potato genes encoding Kunitz-type proteinase inhibitors. Intronless nature of genes encoding aspartic proteinase inhibitor from potato has also been confirmed. D’Onofrio et al. (1991) suggested that the presence of intronless gene may be a structural feature that is maintained because it provides a selective advantage, by rapidly encoding turning over transcripts in order to be able to respond without significant delay to various exogenous signals. Since RbTI gene is intronless, the transcription and translation of this gene occur simultaneously inside the cell (Katoch et al. 2014); furthermore, both genomic and cDNA clones can be mobilized for developing transgenic plants. The sequence alignment of deduced BBI sequence with the known BBI protein sequence from legumes in gene database revealed 99% similarity in the amino acid sequence along with the presence of conserved BBI domain. In the amino acid sequence, the amino acid numbered from 48 to 63 (DLCLCIKSIPPQCQCA) constituted the reactive loop of BBI domain of rice bean trypsin inhibitor.

14.2

Protease Inhibitor Gene (RbTI) from Rice Bean

245

14.2.2 Phylogenetic Analysis and 3D Structure Prediction of Rice Bean Trypsin Inhibitor Phylogenetic analysis is a powerful and visually intuitive approach of investigating evolutionary relatedness among groups of organisms. With the large amount of publicly available sequence data, phylogenetic inference has become increasingly important in all fields of biology. A number of tools are available today to have a deep understanding of the evolutionary relationships among the gene sequences. The relationships between the BBI protein sequence from rice bean and that of other species of legumes and non-leguminous species were deduced from phylogenetic tree (Fig. 14.8). In the analysis cereals were also taken into account to analyze the evolutionary origin based on conserved sequence and structural characteristics such as amino acid homology and conserved motifs with protease inhibitors from Leguminosae species. The BBI from Vigna umbellata and Vigna vexillata grouped together revealing highest degree of similarity between them. The phylogenetic tree analysis also revealed that the BBI domains from Leguminosae family grouped together as the cereals and pseudocereals, while BBI of Bromeliaceae family was out grouped with Setaria italica. This reveals that during the course of evolution, plant species conserved their BBI domain and the separation of species was compensated by incorporation of different sets of amino acids for adapting to particular physiological and environmental conditions during their evolution.

Fig. 14.8 Phylogenetic analysis of RbTI protein from rice bean and other Leguminosae family BBI proteins along with its homologs from cereals and other plant species

246

14

Insect Pest Resistance Factors in Rice Bean

The numeric value at the branches depicts the bootstrapping for the grouping of species, shows robustness of grouping. Accession numbers: Vigna angularis, P01058.1; Phaseolus parvulus, CAM84155.1; Phaseolus filiformis, CAL69282.1; Vigna radiata var. sublobata, ABD91575.1; Vigna trilobata, ABD91574.1; Phaseolus grayanus, CAQ52359.1; Vigna vexillata, ABD97866.1; Cicer arietinum, AEW50186.1; Vigna mungo, ABD97865.1; Phaseolus microcarpus, CAM84156.1; Glycine max, XP_003544720.1; Oryza sativa, ADM86865.1; Hordeum vulgare, BAJ94350.1; Triticum aestivum, ABX84380.1; Zea mays, ACG40110.1; Setaria italica, XP_004968056.1; Phaseolus maculatus, CAM88857.1; Ananas comosus, P01068.2. From the amino acid sequence, it was inferred that the rice bean trypsin inhibitor had 80% similarity with mung bean BBI. The mung bean BBI was used as a template for the 3D structure prediction of rice bean trypsin inhibitor. The deduced tertiary structure of rice bean BBI peptide from online structure prediction tool (SWISSMODEL) revealed the presence of reactive loop of conserved BBI domain constituted by the amino acids (DLCLCIKSIPPQCQCA) and further also unraveled the presence of conserved disulfide bonds in RbTI which are an important component in maintaining the structural integrity and functional activity of proteinase inhibitor. The structure also revealed conservedness in the reactive loop of BBI domain (Fig. 14.9).

14.2.3 RbTI Gene Expression The production of recombinant proteins is one of the most powerful techniques used today. The ability to produce and purify an abundance of a desired recombinant protein can permit a wide range of applications. The strategy for expression and purification recombinant proteins involves the cloning of the gene downstream of a promoter in an expression vector. This vector is then introduced into a host cell such as E. coli and expressed in the presence of an inducer, and the cell’s protein synthesis machinery produces desired protein which is purified through affinity chromatography. In the study, the RbTI gene was cloned into pET200 directional-Topo expression vector, and the inframe cloning was confirmed through sequencing. The pET– RbTI construct was transformed into BL21 Star™ (DE3) E. coli cells and induced in the presence of IPTG. The fusion protein was purified from soluble fraction of bacterial lysate by single-step chromatography on Ni-NTA resin with 89-fold purification with specific activity of 62.30. The SDS–PAGE further confirmed that with the MW of approx 13.0 kDa RBTI was themajor species. The molecular weight of trypsin inhibitors and BBI of Vigna species has been reported to be from 10.0 to 16.0 kDa (Kuhar et al. 2012). A large variation in the molecular weight for Bowman–Birk inhibitor from several legumes is due to its ability to self-associate to form dimer. The self-association to form dimer and anomalous behavior on SDS– PAGE resulting in a large overestimation of molecular weight has been reported for Bowman–Birk inhibitor from several legumes (Katoch et al. 2014).

14.2

Protease Inhibitor Gene (RbTI) from Rice Bean

247

Fig. 14.9 (a) The three-dimensional structure of rice bean trypsin inhibitor (RbTI); (b) alignment of RbTI with mung bean BBI (3myw) revealed conserved disulfide bonds

14.2.4 Spatiotemporal Expression Analysis of Rice Bean Trypsin Inhibitor Gene The protease inhibitor along with other anti-metabolites starts to accumulate in various plant parts at different stages of growth. However, protease inhibitors are synthesized in high concentration after insect pest attack probably via induction of octadecanoid pathway. The expression levels of BBI gene from rice bean at different developmental stages of seed and foliage have been observed with real-time qRT-PCR using total RNA from foliage and immature seeds and 18 s RNA gene as the reference gene (Katoch et al. 2014). The highly variable expression of rice bean BBI gene was observed in leaves and seeds. In leaves the expression level of RbTI gene was very low (Fig. 14.10). Rakwal et al. (2001) observed similar pattern of proteinase inhibitor induction in plant leaves and reported active induction of protease inhibitor to high levels when plants are attacked by insects, suffer mechanical damage, or are exposed to exogenous phytohormones. Hilder et al. (1987) also reported artificial wounding by heat or even crushing with a file could mimic the action of an insect bite and stimulate the production of the inhibitor. The induction of PI upon wounding has also been reported from other plants. A rapid increase in proteinase inhibitor concentration in sweet potato leaves within 4 h of wounding and

Relative expression value

248

14 16.0 14.0

Insect Pest Resistance Factors in Rice Bean

Relative expression of BBI in leaf and seeds at differnt growth stages

12.0 10.0 8.0 6.0 4.0 2.0 0.0 Leaf 1

Leaf 2

Leaf 3

Leaf 4

Seed1

Seed2

Seed3

Seed4

Plant tissue

Fig. 14.10 Relative expression of RbTI inhibitor in leaf and seed of rice bean. Source: Katoch et al. (2014)

a constant level up to 16 h. after wounding has been reported by Sasikiran et al. (2002). In comparison to the leaves, the expression of RbTI gene was highest in mature seeds, where the expression of gene increased gradually with the maturity. These results corroborates with results where we investigated the trypsin inhibitor content in different parts of rice bean plant, and the highest trypsin inhibitor content was recorded in mature seeds. Further the highest gene expression in seeds unraveling its role in imparting resistance in rice bean against storage insect pests. The accumulation of the protease inhibitor in the seeds and tubers of plants in the form of storage proteins has been reported to serve important functions such as the provision of the essential amino acids during the development of seeds and sprouts (Candido Ede et al. 2011). Further the accumulation of protease inhibitors in storage organs and their ability to inhibit the activity of the proteases are of important component of the defense mechanisms of the plant against predators and pathogens. The information provided on the expression analysis of RbTI gene will facilitate their manipulation as eminent source of resistance in the generation of transgenic plants.

14.2.5 Inhibitory Effect of Recombinant TI on Hessian Fly Gut Proteases Wheat is one of the important cereal crops in the world and has great value in making significant contribution in the economy of the major wheat-producing countries of the world including the United States, North African countries, and European countries. However, these countries are experiencing major shortfall in wheat production. One of the major factors responsible for this is the damage caused by Hessian fly (Mayetiola destructor; Diptera) which is considered as the most destructive pest of cereal crops. Many grass species serve as hosts of this fly (Zeiss et al. 1993), including at least 16 wild grass species (Harris et al. 2001), mostly belonging to the tribe Triticeae. Triticeae includes major cereal crops such as wheat, barley, and

a-Amylase Inhibitor (a-AI) from Rice Bean

Fig. 14.11 Inhibition of larval gut proteases of Hessian fly with rice bean trypsin inhibitor (Source: Katoch et al. 2014)

249 Trypsin

Percent Inhibition

14.3

Chymotrypsin

100 90 80 70 60 50 40 30 20 10 0 0.12

0.26 0.28 0.29 0.33 Protein concentration (mg/ml)

0.34

rye, but wheat is the most preferred host (Chen et al. 2009; Harris et al. 2001). Therefore, there is a need to develop effective strategies for controlling population densities of this insect. Studies have reported the increase in the transcript level of defense proteins like lectin and lectin-like proteins in the innate defense response of resistant wheat to larval Hessian fly attack (Giovanini et al. 2007; Subramanyam et al. 2008). Shukle et al. (2012) suggested the potential application of transgenes encoding anti-nutrient proteins (e.g., lectins, proteinase inhibitors) and other entomotoxic proteins in engineering resistance in plants against the Hessian fly. The purified trypsin inhibitor from rice bean (RbTI) was tested for the inhibitory activity against the gut proteases of Hessian fly larvae. The rice bean trypsin inhibitor showed inhibition of trypsin and chymotrypsin of Hessian fly to the extent of 87% and 56%, respectively. The highest inhibitory activities were observed with protein concentration of 0.342 mg/ml (Fig. 14.11). The purified recombinant RbTI showed inhibitory activity against both trypsin and chymotrypsin, a characteristic feature of BBI type PIs. This inhibitory activity of RbTI was more pronounced against trypsin, when compared with chymotrypsin. Most of the BBIs were known to inhibit both trypsin and chymotrypsin due to the presence of two different reactive sites (Singh and Appu Rao 2002).

14.3

a-Amylase Inhibitor (a-AI) from Rice Bean

α-Amylases constitute a family of endo-amylases that catalyze the hydrolysis of α-D(1–4)-glucan linkages in starch components, glycogen, and other carbohydrates. The enzyme plays a key role in carbohydrate metabolism of microorganisms, plants, and animals. Furthermore, several insects, especially those similar to the seed weevils that feed on starchy seed during larval and adult stages, depend upon α-amylases for their survival. Chrzaszez and Janicki (1934) were the first to report the presence of α-AIs in buckwheat. Thereafter, α-AI has been isolated from many plants, mainly cereals and legumes. The studies conducted by Ishimoto et al. (Ishimoto and Kitamura 1989) and Shade et al. (1994) laid the foundation of targeting starch

250

14

Insect Pest Resistance Factors in Rice Bean

digestion as a potential target for the insect control. They highlighted the importance of α-amylase inhibitors as digestibility reducers from Phaseolus vulgaris in inhibiting the growth and development of cowpea weevil Callosobruchus maculatus and adzuki bean weevil Callosobruchus chinensis. Since then α-amylase inhibitors (α-AIs) have been extensively studied as they play an important role in building resistance against herbivores and pathogens (Mehrabadi et al. 2012; Pelegrini et al. 2008). The α-AIs bind tightly to the active site of α-amylases and inhibit their activity. When the ability to utilize the ingested starch and to recycle the digestive enzymes is decreased by plant inhibitors, nutrition of the insect is impaired affecting its growth, survival, and fecundity (Piasecka-Kwiatkowska et al. 2007). The α-AI inhibitors provides an excellent example of the co-evolution of insect digestive enzymes and plant defense proteins. α-AIs are primarily the products of single gene and are small, low molecular weight monomeric proteins, α-AIs from bean contain two or more subunits (Ho and Whitaker 1993), and α-AIs from wheat, barley and rye are tetrameric in nature (Garcia-Casado et al. 1996; Sánchez-Monge et al. 1996). Several α-AI proteins that have been isolated from wheat kernels strongly inhibit α-amylases from insects with null or weak effect on mammalian amylases (Feng et al. 1996). These properties make them attractive candidates for plant genetic manipulations for imparting resistance to insect pests. α-AIs provide an excellent example of the co-evolution of insect digestive enzymes and plant defense proteins. Different species of bruchids are found all over the world; two main bruchid species of common bean, Zabrotes subfasciatus and Acanthoscelides obtectus, have evolved in America and are able to feed on all cultivated varieties of the common bean. The pea and cowpea weevil have evolved in the Old World and not able to consume the common bean. They thrive on cowpeas, mung beans, and other Eastern Hemisphere legumes. The α-AIs found in common bean do not inhibit the amylase of the Mexican bean weevil but completely inhibit the amylases of the pea and cowpea weevils, which suggest a co-evolution between insect and their food source (Chrispeels et al. 1998a; Grossi De Sa and Chrispeels 1997). The α-AIs have been classified into six different classes, i.e., lectin-like, knottinlike, cereal-type, Kunitz-like, y-purothionin-like, and thaumatin-like. These classes of inhibitors show remarkable structural variety leading to different modes of inhibition and different specificity profiles against diverse α-amylases. Specificity of inhibition is an important aspect as the introduced inhibitor must not adversely affect the plant’s own α-amylases nor the nutritional value of the crop. α-AIs are particularly abundant in cereals (Abe et al. 1993; Feng et al. 1996; Yamagata et al. 1997; Franco et al. 2000; Iulek et al. 2000) and legumes (Marshall and Lauda 1975; Ishimoto et al. 1996; Grossi De Sa and Chrispeels 1997). They are of great interest as potentially important tools of natural and engineered resistance against pests in transgenic plants (Chrispeels et al. 1998b; Gatehouse and Gatehouse 1998; Valencia et al. 2000). Among the various classes of α-AIs, particular attention has been focused on the lectin-like inhibitors present in the common bean P. vulgaris seeds, which have shown toxic effects to several insect pests (Ishimoto and Kitamura 1989; Huesing et al. 1991; Ishimoto and Chrispeels 1996; Grossi De Sa and Chrispeels 1997). The effect of the bean amylase inhibitors on the amylases of different

14.3

a-Amylase Inhibitor (a-AI) from Rice Bean

251

organisms was well determined not only by enzymatic activity but also in feeding assay experiments (Ishimoto and Kitamura 1989; Ishimoto et al. 1996; Grossi De Sa and Chrispeels 1997). Rice bean seeds have longer life span during storage owing to the capability to resist the attack of bruchids which generally damages the other pulses during storage. This attribute make us to dig deep for having more information on the characteristic of this crop. There are numerous reports on interaction of α-AIs from different crops with the amylases from the insect gut, but the information on the α-AI from rice bean is scanty. Therefore, the study was conducted to purify α-AI from rice bean and to investigate its interaction with the midgut α-amylases of insects.

14.3.1 a-AI Content in Different Rice Bean Genotypes Thirteen different rice bean genotypes were analyzed for the α-AI content varying from 7529 (LRB–134) to 10,766 IU/g (BRS–2) Table 14.4. The highest inhibitor activity was observed in genotype BRS–2 followed by genotypes JCR–152 (10,504 IU/g), LRB–176 (10,361 IU/g), LRB–141 (10,004 IU/g), and BRS–1 (9433 IU/g). Low value of the α-AI content was in genotypes JCR–178 (9290 IU/ g), LRB–164 (9100 IU/g), LRB–40–2 (8648 IU/g), JCR–54 (8576 IU/g), LRB–168 (7957 IU/g), and JCR–163 (7576 IU/g). Genotypes BRS–2, JCR–152, and LRB– 176 were having higher α-AI content exhibiting 55.25%, 52.75%, and 51.55% inhibition, respectively. Table 14.4 α–AI content in different rice bean genotypes Genotypes LRB-164 LRB-168 LRB-40-2 LRB-134 LRB-176 LRB-141 JCR-20 JCR-152 JCR-163 JCR-54 JCR-178 BRS-1 BRS-2

Inhibition (IU/g) 9100 7957 8648 7529 10,361 10,004 8100 10,504 7576 8576 9290 9433 10,766

Source: Katoch and Jamwal (2013)

Inhibition (%) 41.43 39.76 43.44 36.44 51.55 48.84 38.57 52.75 35.71 40.70 49.55 49.56 55.25

Protein (%) 10.38 10.81 10.96 9.96 10.9 10.33 10.37 10.64 9.96 10.66 11.53 10.18 10.18

252

14

Insect Pest Resistance Factors in Rice Bean

14.3.2 Purification of a-AI from Rice Bean Isolation and purification of α-AI inhibitor was carried out from genotype BRS-2. The protein extract was precipitated with ammonium sulfate at different concentrations. The high inhibitory activity (46.05%) was in the fraction precipitated at 80% ammonium sulfate saturation. It was resuspended in 20 mM phosphate buffer (pH 6.9) and after dialysis applied onto a DEAE-Sepharose ion exchange column. Bound protein was recovered from the column by elution with a gradient 0.2 to 0.4 M of sodium chloride in the same buffer. The inhibitory activity showed a single peak that had maximum activity at 0.3 M NaCl (Fig. 14.12a). DEAE fraction was loaded on to Superdex 75 column for gel filtration chromatography. The elution

Fig. 14.12 (a) The rice bean α–AI activity and protein content in various DEAE-Sepharose chromatographic fractions. (b) Superdex 75 chromatographic fractions (1) α-AI activity; (2) protein; (3) NaCl gradient

14.3

a-Amylase Inhibitor (a-AI) from Rice Bean

253

Table 14.5 Purification profile of α-AI from rice bean

Step Crude extract Ammonium sulphate precipitation Ion exchange chromatography Gel filtration

Total activity (TIU) 48,033 27,211

Protein (mg) 5486 1036

Specific activity 8.7 26.3

Fold purification 1 3.0

Yield (%) 100 56.7

25

15,803

43

368.0

42.3

32.9

15

13,468

20.4

660.1

75.9

28.0

Volume (ml) 150 35

Source: Katoch and Jamwal (2013)

profile obtained on Superdex 75 is shown in Fig. 14.12b. The purification data of the rice bean α-AI is presented in the Table 14.5. An overall purification of 75.90-fold with a total yield of 28.0 was achieved. The specific activity increased from 8.7 in crude extract to 660.2 IU after gel filtration. The electrophoretic analysis of the purified α-AI on SDS-PAGE revealed a single sharp protein band with a molecular mass of approximately 25 kDa. The α-AIs of 27 kDa and 21 kDa molecular weights have also been purified from mung bean (Wisessing et al. 2010) and sorghum (Kutty and Pattabiraman 1986). An α-AI of 14 kDa molecular weight with 55.17-fold purification, and 924.31 specific activity has been also purified from V. sublobata.

14.3.3 N-Terminal Analysis of Purified a-AI On isoelectric focusing, the purified inhibitor showed a single band at pH 4.7. The low pI value further indicates the acidic nature of the purified inhibitor which was also confirmed to the affinity of the purified α-AI inhibitor to anion exchanger. The amylase inhibitor of low pI value of 4.3–4.9 has also been reported from Phaseolus vulgaris. The N-terminal analysis of purified inhibitor reveals the presence of six amino acid sequence Ala-Ser-Ser-Arg-Phe-Cys (ASSRFC), similar to the Phaseolus vulgaris (Blanco-Labra et al. 1996).

14.3.4 Thermal and pH Stability of Rice Bean a-AI The incubation of the inhibitor in the pH range of 2.2–9.0 revealed maximal inhibitory activity at pH 6.9 with 69.30% inhibition (Fig. 14.13a). In alkaline solution at pH 9.0, nearly 50% of the inhibitor activity was lost. Rice bean α-amylase inhibitor is more stable under acidic and neutral conditions than at alkaline solutions. Temperature is one of the most important parameters that affect the rate of enzyme hydrolysis. The thermostability analysis of purified α-AI at different range of temperature revealed maximum inhibition at 37  C (68.8%) and

254

14

Insect Pest Resistance Factors in Rice Bean

Fig. 14.13 Effect of pH (a) and temperature (b) on the rice bean α-AI activity

minimum at 100  C (37.0%). The inhibitory activity was stable at 50  C and decrease with increase in temperature (Fig. 14.13b).

14.3.5 Inhibitory Effect of a-AI from Rice Bean Among other inhibitory proteins, the α-AIs have gained attention for providing protection against the attack of storage insects that are highly dependent on the α-amylases for feeding. Studies have revealed the potentiality of α-AI as alternative biocontrol agent from varied sources in view of providing adequate protection against economically important insects (Ishimoto et al. 1996; Kluh et al. 2005; Ignacimuthu and Prakash 2006; Pelegrini et al. 2008; Solleti et al. 2008; Barbosa et al. 2010). The genus Callosobruchus (Coleoptera: Bruchidae) includes the most serious pest on Vigna species (Talekar and Lin 1981). α-AIs have been studied in common beans (Marshall and Lauda 1975), maize (Blanco-labra and Iturbe-chinas 1981), sorghum (Kutty and Pattabiraman 1986), wheat (Warchalewski 1977), and barley (Mundy and Rogers 1986). Seed alpha-amylase inhibitor (α-AI) in several cultivars of the common bean plays a protective role against bruchid pests (Ishimoto and Kitamura 1989). The α-AI strongly inhibited the larval midgut α-amylase activities of adzuki bean weevil (C. chinensis L.) and cowpea weevil (C. maculatus), non-pest species of the common bean. Since rice bean seeds have the properties of resisting the attack of storage insects, therefore the inhibitory potential of α-AI from rice bean was investigated against the α-amylases of larval midgut of Spodoptera litura. The inhibition up to 86.6% was observed on the 3 day old larvae (Table 14.6). The inhibitor was quite effective in blocking insect α-amylases even during the advance stages of larvae (up to 24 days). Kokiladevi et al. (2005) reported that protein extract from rice bean had 110% inhibitory activity against α-amylases from Callosobruchus analis. The results revealed potential toxicity of the α-amylase inhibitors against the gut proteases of Lepidopteran insects. The potential of the α-amylase inhibitor as a biotechnological tool for transferring resistance has been confirmed by

14.4

Lectins in Insect–Pest Resistance

255

Table 14.6 Interaction of α-amylases from the larval midgut of S. litura and purified α-AI from rice bean Larval stage (days after hatching) 3 6 9 12 15 18 21 24

Protein concentration (mg/5 ml) 8.11
0.03 9.23
0.13 10.37
0.08 11.71
0.04 13.23
0.12 15.19
0.05 15.28
0.07 15.30
0.09

α-Amylase inhibition (%) 86.61
0.13 77.95
0.15 75.25
0.11 73.10
0.21 71.67
0.17 71.89
0.04 72.15
0.09 72.39
0.10

Data presented in as Mean
SD; Source: Katoch et al. (2013)

overexpressing the content in the plants (Altabelia and Chrispeels 1990; Shade et al. 1994; Schroeder et al. 1995; Dias et al. 2005, 2010). The transgenic plant technology provides an alternative to the use of agrochemicals and could be useful in the production of crop varieties having resistant to insect pests. The α-amylase inhibitor gene from rice bean would enhance the defense gene pool and may be used for designing specific bioinsecticides against the economically important insects.

14.4

Lectins in Insect–Pest Resistance

In the last few decades, lectins have gained attention of the agriculturist for their entomotoxic properties. The results of feeding insects with purified lectins have shown detrimental effects ranging from delay in larval development to mortality of insect (Vandenborre et al. 2011). Studies have revealed that the insecticidal lectins have peculiar carbohydrate binding property and their stability in the wide range of pH and ability to resist proteolytic degradation help them in exerting insecticidal action. On chewing, lectins release from disrupted plant structures and bind with carbohydrate moieties in insect mid gut. Since epithelial cell lining of the insect gut is directly exposed to the lectins in diet, therefore it is one of the potent target sites of insecticidal lectins. These epithelial cells form peritrophic membrane covered with a grid-like network of glycoprotein receptors. These receptors contain glycan structures (chitin-binding glycoproteins such as peritrophins), fill the interstitial spaces, and form a molecular sieve (Hegedus et al. 2009). This makes peritrophic membrane as a potent target for insecticidal lectins. The interaction of lectins with glycoprotein receptors on epithelial cells in insect mid gut leads to their disruption, elongation of striated border microvilli, swelling of epithelial cells, and increased permeability of membrane for harmful substances in hemolymph due to which insect may be repelled, retarded in its growth, or even killed (Vandenborre et al. 2011). It has also been observed that some of the lectins can pass through the midgut epithelium and accumulate in hemolymph and malpighian tubules. Some of the lectins have also been found in fat tissue and

256

14

Insect Pest Resistance Factors in Rice Bean

ovarioles. This clearly illustrates the presence of alternative binding sites of lectins inside the insect body (Vandenborre et al. 2009). Plant lectins also have affinity to the insect glycoproteins secreted in the insect midgut such as ferritin which is essential for the iron transport in insect body (Sadeghi et al. 2008a). Several enzymes such as membrane-bound amino-peptidases (Cristofoletti et al. 2006). α-amylases (Macedo et al. 2007) and sucrases (Macedo et al. 2015) are other potential target sites of lectins in insect. Binding of lectin with secreted glycoproteins from large complexes therefore cannot diffuse back through peritrophic membrane for being recycled for digestion. This leads to leakage of digestive enzymes in insect gut which implies that interaction of lectins with digestive enzymes or transport proteins in the mid gut lumen may also contribute to their insecticidal action (Vandenborre et al. 2011). Several receptors have also been identified as an alternative target site of lectins inside the insect body which affect metabolic functions in insects (LagardaDias et al. 2017).

14.4.1 Insecticidal Activity of Plant Lectins Against the Agriculturally Important Insects The entomotoxic nature of lectins involving Phaseolus vulgaris lectin (PHA) was attributed to the inability of bruchid beetle (Callosobruchus maculatus) to feed on cowpea seeds (Janzen et al. 1976). The artificial diet assay with purified lectin showed inability of insects to survive at 5% and even at 0.1% concentrations. Similarly, Gatehouse and colleagues (1984) also reported insecticidal property Phaseolus vulgaris lectin (PHA). Mannose-binding legume lectin from jack bean, Concanavalin A (ConA), has also been reported toxic to pea aphid (Acyrthosiphon pisum) (Sauvion et al. 2004a, b). When the effect of ConA was investigated on plant hopper (Tarophagous proserpina), high mortality was observed after ingestion of ConA (Powell 2001). Feeding trials with purified lectin from snowdrop (Galanthus nivalis) and garlic (Allium sativum) indicated that they are moderately active against chewing insects (Pusztai et al. 1992). Rahbe and Febvay (1993) demonstrated that the Canavalia ensiformis lectin (Con A) was toxic to pea aphid (Acyrthosiphon pisum). GNA lectin also caused mortality of pea aphids (Acyrthosiphon pisum) and sugarcane white grubs (Antitrogus sanguineus) (Allsopp and McGhie 1996). Feeding trials with snowdrop lectin revealed insecticidal effects of lectin in terms of delay in development and retarded fecundity of peach-potato aphid (Myzus persicae) (Sauvion et al. 1996). GNA lectin also showed anti-nutritive effects on tomato moth (Lacanobia oleracea) (Fitches et al. 2001). Feeding trials conducted with Vigna radiate lectin revealed 50 to 100% mortality of mustard aphid (Lipaphis erysimi) (Singh et al. 2016). The insecticidal activity of plant lectins that belong to different lectin families has been presented in Table 14.7. A few plant lectins have entomotoxic potential against a particular insect, while others possess broad insecticidal action against insect belonging to phylogenetically distant orders (Vandenborre et al. 2011). Different insect species have strongly acidic to very alkaline environment in mid gut; therefore, lectins need some degree

14.4

Lectins in Insect–Pest Resistance

257

Table 14.7 Insecticidal activity of lectins against different insects Sr. no. 1.

2.

Lectin family Legume lectins

GNA-related lectins

Examples Con A, PSA, Gleheda

APA, ASAL, ACA GNA, LOA

3.

Hevein-related lectins

OSA, WGA, UDA

4.

Nictaba-related lectins

NICTABA, PP2

Insects Meligethes aeneus Leptinotarsa decemlineata Callosobruchus maculatus Acyrthosiphon pisum Tarophagous proserpina Rhopalosiphum maidis Nephotettix virescens Lipaphis erysimi Nilaparvata lugens Sogatella furcifera Spodoptera littoralis Callosobruchus maculatus Diabrotica undecimpunctata Spodoptera littoralis Manduca sexta Acyrthosiphon pisum Myzus persicae

5.

6. 7.

Ricin-related lectins

Amaranthins Jacalins

SNA-I, SNA-I0 , maize RIP

ACA Heltuba, HFR-1

Spodoptera exigua Helicoverpa zea Lasioderma serricorne Aphis gossypii Myzus persicae

References Melander et al. (2003) Wang et al. (2003) Zhu et al. (1996) Sauvion et al. (2004a) Sauvion et al. (2004b) Wang et al. (2005) Saha et al. (2006) Hossain et al. (2006) Yarasi et al. (2008) Yarasi et al. (2008) Sadeghi et al. (2008b) Murdock et al. (1990) Czapla and Lang (1990) Vandenborre et al. (2010) Vandenborre et al. (2010) Beneteau et al. (2010) Beneteau et al. (2010) Shahidi-Noghabi et al. (2009) Dowd et al. (2003) Dowd et al. (2003) Wu et al. (2006) Chang et al. (2003)

of resistance to cope with the hostile environment in insect midgut. Most of the plant lectins are stable within the pH range of 2–12, while NICTABA (Nicotiana tabaccum agglutinin) lectins have shown stability only under alkaline conditions (Chen et al. 2002). It is evident that NICTABA lectins are highly active against insects having alkaline midgut conditions (Lepidopteran insects) (Vandenborre et al.

258

14

Insect Pest Resistance Factors in Rice Bean

2010). Another factor related to variability in insecticidal action of lectins is their resistance to proteolytic degradation in insect midgut (Zhu-salzman et al. 1998). Insects have their own proteolytic machinery, and for exerting insecticidal action, lectins must have resistance to proteolytic degradation in insect mid gut (Felton 2005).

14.4.2 Cloning and Characterization of Lectin Gene from Rice Bean The gene encoding lectin proteins from a large number of sources including leguminous as well as from non-leguminous plants have been successfully cloned, and their molecular aspects have been thoroughly studied along with the structural and functional properties of encoded proteins (Ge et al. 2012; Kuhar et al. 2012; Saini et al. 2015; Chinnapun et al. 2016). For the first time, we have also cloned and characterized a novel gene encoding lectin protein from rice bean. To amplify lectin gene from rice bean, RNA was isolated from seeds for cDNA synthesis. The cDNA synthesis was confirmed by amplification of RbTI gene of 327 bp size. The amplification of cDNA resulted in an amplicon of approximately 850 bp size. The sequencing of recombinant plasmid with vector specific primers resulted lectin gene (RbL) of 843 bp size with 55.41% GC and 44.59% AT content (Fig. 14.14). The grouping of RbL gene with other Vigna lectins gave an indication of structural and functional similarity with their common evolutionary origin. The sequence alignment of lectin gene and its genomic counterpart revealed intronless nature of RbL gene. For expression studies, the amplified RbL gene with 50 and 30 overhangs (Sticky ends) were ligated to pET-28a-c(+) vector, transformed into heterologous expression (Forward primer)

ATGGCTTCCTCCAACTTCTCTATTATCCTCTCTCTCTCCGTAGCCCTCTTCCTGGTGCT TCTCACCCATGCAAACTCAACCAACGTCTTCTCCTTCAACTTCCAGTCCTTCGACTCAT CCAACCTTATCCTCCAAGGTGACGCCACCGTCTCATCCGCCGGCCAATTACGATTAAC CAAAGTTAAAGGCAACGGCAAACCCACGCCGGCATCTCTGGGCCGCGCCTTCTACTC CGCCCCCATCCAAATCTGGGACAGCACCACTGGCAGCGTCGCCAGCTTCGCCACCT CCTTCACTTTCAAAATCTTCGCTCCCAACAAGTCAAGCACCGCCGATGGGCTTGCATT TGCTCTCGTACCCGTCGGGTCTGAGCCCAAATCCAACGCCGGTTATCTGGGTCTTTT CGACAACGCCACCTACGACAGCTCCGCCCAGACTGTGGCTGTGGAGTTCGACACCT ACTCGAACCCTAAGTGGGACCCGGGACCCCGTCACATTGGCATCGACGTGAACTCCA TCGAGTCTATCAGATGGGCGTCGTGGGGTTTGGCGAACGGGCAAAACGCGGAGATT CTGATCACGTACGACGCCTCGACGCAGCTCTTGGTGGCCTCTCTAGTTCACCCTTCT CGGAGAGCGAGCTACATCGTGTCTGAGAGAGTGGACCTGAAGAGCGTTCTTCCGCA GTGGGTGAGCATTGGGTTCTCTGCCACCACAGGGTTGCTTGACGGGTCAACCGAAA CCCACGACGTGCTCTCTTGGTCTTTTGCTTCCAAGCTTTCAGATGGCATCACTACTGG AGGTATAGATCTCGCCAAATTCG TCCTCAACAAAATCCTCTAG (Reverse primer)

Fig. 14.14 Lectin gene sequence from rice bean

14.4

Lectins in Insect–Pest Resistance

259

system, and induced with IPTG at 0.5 and 1.0 mM concentrations for 3–4 h. Maximum expression (~35 kDa) was observed with 0.5 mM IPTG concentration after 4 h of incubation at 37  C. Further, expression of fusion protein (His6-RbL) was confirmed by Western blot analysis and purified (~35 kDa) using immobilized metal affinity chromatography (IMAC) to the extent of 0.26 mg/ml concentration.

14.4.3 Molecular Modeling and Structure Prediction of Rice Bean Lectin The amino acid sequence of Rbl was deduced by using expasy translate nucleotide software (http://web.expasy.org/translate/), and the deduced amino acid sequence was analyzed on Galaxy web server (http://galaxy.seoklab.org) and Swiss Modeler (http://swissmodel.expasy.org/) with structural coordinates of DBL (PDBID: 1G7Y_A) having 74.40(%) similarity and 85(%) query coverage. Homologymodeled structure of RbL protein visualized using UCSF chimera visualization tool. The 3D structures including monomeric and dimeric form of RbL protein have been presented in Fig. 14.15a, b. The dimer of RbL was featured by sandwiched c-terminal α-helix between two identical monomers which have been previously reported to stabilize dimeric interface between lectin monomers. The presence of two identical carbohydrate-binding domain categorized RbL protein in the group of hololectins. Like other legume lectins, the dome-like structure also known as lectin fold (Loris et al. 1998; Bouckaert et al. 1999), jelly roll motif, and β-sandwich was also identified in RbL protein. The structure also showed six-stranded flat antiparallel β-sheets forming back face and seven-stranded curved antiparallel β-sheets forming front face of structure. RbL consisted of 16-β strands connected with turn and loops (50% of the total amino acid residues). Since 3D structure model of RbL protein showed concurrency with conserved structure (β sandwich model) of legume lectins, the protein must have two hydrophobic cores, (1) between the front and back sheets and (2) between the front sheet and three loops, forming metal binding sites and carbohydrate recognition domain. The hydrophobic cavity formed by hydrophobic amino acid residues may be responsible for binding with hydrophobic ligands such adenine. The analysis of 3D structure also revealed the presence of four loops, namely, A, B, C, and D connected by turns and loops which are responsible for carbohydrate binding specificity of legume lectins (Fig. 14.16). The conserved triad of amino acids [(Asp(D)-Asn(N)-Gly(G)/Arg(R)] responsible for monosaccharide binding through hydrogen bonding was also identified in putative RbL protein. Further, aromatic amino acid (tyrosine), which is required for stacking with the non-polar face of sugar, was also identified in Loop C (Loris et al. 1998). The overall predicted folding of RbL protein, constituted typically from the β-sheets interlinked by the turn and loops, appears to create a very rigid and strong structural scaffold. In many legume lectins, the changes of orientation of β-sheets confer rigidity to structure and provide protection from proteolytic degradation (Van Damme 1998). The presence

260

14

Insect Pest Resistance Factors in Rice Bean

Fig. 14.15 (a) 3D structure of RbL monomer and (b) dimer

Loop A: (104-116) APNKSSTADGLAF Loop B: (122-133) GSEPKSNAGYLG

Loop C: (149-161) VEFDTYSNPKWDP Loop D: (234-254) GFSATTGLLDGSTETHDVLSW

Fig. 14.16 Carbohydrate-binding loops in RbL structure

14.5

Polyphenolic Compounds

261

of the rigid structure suggests that rice bean lectin may have insecticidal effects by resisting proteolytic degradation in insect midgut.

14.4.4 Prediction of Ligand Binding Sites in Rice Bean Lectin Proteins perform their biological functions by interacting with the other molecules known as ligands. These ligands can be of any nature; they can be either proteins, metals, nucleic acids, carbohydrates, or lipids. The detection of the ligand binding sites is of paramount importance in order to characterize the protein on the basis of their biological function (Heo et al. 2014). Since the in vivo and in vitro elucidation of ligand binding sites in a protein 3D structure is a laborious and time-consuming, the in silico prediction using different web servers is the most suitable way of predicting ligand binding sites (Roche et al. 2010). Lectins are known for their carbohydrate binding and ion binding properties and their biological functions are because of their binding specificity; therefore, the PDB file of structured RbL model form was subjected to GalaxySite web server (http://galaxy.seoklab.org/site) for the prediction of putative ligand binding sites in 3D structure. The analysis revealed that the RbL has putative binding sites for β-D-galactose, N-acetyl-D-glucosamine and lactose sugars (Fig. 14.17). Agglutination with human blood groups revealed the non-specificity of RbL toward human erythrocytes indicated by the formation of discrete button at the bottom of microtiter plate. The agglutination with rabbit erythrocytes confirmed the specificity of lectin toward these erythrocytes, revealed by formation of uniform layer of erythrocytes over lectin solution in microtiter plate (Fig. 14.18). It has been well established that legume lectins exert insecticidal action by making interactions with carbohydrate moieties present on epithelial cells or components of chitinous peritrophic membrane. Agglutination studies have revealed carbohydrate binding specificity of RbL protein to N-acetyl-D-glucosamine sugar. Since N-acetyl-D-glucosamine is a monomer of chitin and RbL has specificity to bind with, it is logical to conclude that RbL protein have the property to induce insecticidal effects. Konami et al. (1994) confirmed that galactose-specific lectins has ability to interact with sialic acid associated with terminal galactose sugar in Nglycan structure present in insect gut, thereby exerting insecticidal action. Further, the presence of rigid jelly roll motif confer ability to rice bean lectin to resist proteolytic degradation which is an important characteristics of insecticidal lectins.

14.5

Polyphenolic Compounds

Several secondary metabolites also have defensive role against herbivores, pests, and pathogens. Their defensive role includes deterrence/antifeedant activity, toxicity, or precursors to physical defense systems. Phenylpropanoids are a group of phenolics, ranging from simple phenolic acid to complex polymers such as tannins, lignins, and flavonoids (War et al. 2011a, b; Sharma et al. 2011). Qualitative and quantitative

262

14

Insect Pest Resistance Factors in Rice Bean

(A) Galactose binding with RbL protein 3D structure with bonded ligand

LigPlot analysis

(B) N-Acetyl-D-glucosamine binding with RbL protein

c) Lactose binding with RbL protein

Fig. 14.17 Predicted ligand binding sites in RbL protein structure

changes in phenolic compounds and elevated activities of oxidative enzymes are the most common phenomena associated with insect infestation. Tannins have significant impact on insect growth by forming strong tannin– protein complexes, reducing the nutrient absorption efficiency and causing lesions precipitate. Tannins make complexes with the digestive enzymes of insect midgut by hydrogen bonding or covalent bonding. In addition to this, tannins also chelate metal ions, thereby reducing their availability to herbivores. Tannins are astringent and bitter in taste, and this property helps them to act as feeding deterrent for many insect pests. Flavonoids are another group of phenolic compounds which play a pivotal role in various facet of life span of plants. These compounds provide protection against biotic and abiotic stresses (Treutter 2006). These compounds are cytotoxic and make complexes with various enzymes through complexion. Both flavonoids and isoflavonoids impart resistance to the plant against insect pests by influencing the behavior and growth and development of insects (Simmonds 2003).

14.5

Polyphenolic Compounds

263

Control Agglutination with trypsinized rabbit erythrocytes

Agglutination-inhibition with sugars A

B

O GAL

NAG

LAC

Control Agglutination with trypsinized human erythrocytes Agglutination-inhibition with sugars

GAL

NAG LAC GAL

NAG LAC GAL

NAG LAC

Fig. 14.18 Agglutination and agglutination-inhibition assay with recombinant fusion protein (His6-RbL) (GAL galactose, NAG N-acetyl-D-glucosamine, LAC lactose)

Ensuring food security to the increasing human population has always been a key challenge for agriculturist across the globe. Notably insect pest menace is one of the major factors responsible for destabilizing global crop production. Though pest management using agrochemicals has brought considerable improvement in crop production, their inappropriate usages have resulted in adverse effects on environment and human health. These undesirable effects justify the necessity of developing environmentally friendly and cost-effective pest management strategies. Currently, an alternative approach for preventing agricultural losses or to control the pest population is by exploiting the potential toxicity of plant inhibitory proteins. Genes encoding these proteins provide a great means of transferring resistance to susceptible crops using recombinant DNA technology. Rice bean seeds have greater degree of resistance to storage pests. Considering the potent role of inhibitory protein in providing resistance against insect pests, the novel genes encoding trypsin inhibitor and lectin have been isolated from rice bean. Numerous reports are available on lectins and their encoding genes from various legumes but previously the genes encoding these proteins have not been isolated and characterized from rice bean. These inhibitory genes along with lectin genes could have future role in multigene transfer for developing resistant plants. Expected to provide sustained economic benefit. Numerous reports have been published suggesting lectin gene as potential candidate for transferring insect resistance in susceptible crops. To overcome the compatibility barriers in conventional breeding, researchers have advocated the potential utilization of recombinant DNA technology for

264

14

Insect Pest Resistance Factors in Rice Bean

incorporating genes encoding insecticidal proteins into plants. Genetically modified crops carrying these genes exhibit considerable protection against target insect– pests. Using recombinant DNA technology, the genes encoding endotoxin proteins from Bacillus thuringiensis were used in the first place to generate insect resistant crops without any adverse effects on environment (Krattiger 1997). In another instances, different genes encoding inhibitory proteins from plants have been used for generating resistance against insects in susceptible crops.

References Allsopp PG, McGhie TK (1996) Snowdrop and wheatgerm lectins and avidin as antimetabolites for the control of sugarcane whitegrubs. Entomol Exp Appl 80(2):409–414 Altabelia T, Chrispeels MJ (1990) Tobacco plants transformed with the bean αAI gene express an inhibitor of insect α-amylase in their seeds. Plant Physiol 93:805–810 Armes NJ, Wightman JA, Jadhav DR, Ranga Rao GV (1997) Status of insecticide resistance in Spodoptera litura in Andhra Pradesh India. Pestic Sci 50:240–248 Azzouz H, Campan EDM, Cherqui A, Saguez J, Couty A, Jouanin L, Giordanengo P, Kaiser L (2005) Potential effects of plant protease inhibitors, oryzacystatin I and soybean Bowman-Birk inhibitor, on the aphid parasitoid Aphidius ervi Haliday (hymenoptera, Braconidae). J Insect Physiol 51:941–951 Barbosa AEAD, Albuquerque EVS et al (2010) α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest. BMC Biotech 10:44 Beneteau J, Renard D, Marché L, Douville E, Lavenant L, Rahbé Y, Dupont D, Vilaine F, Dinant S (2010) Binding properties of the N-acetylglucosamine and high-mannose N-glycan PP2-A1 phloem lectin in Arabidopsis. Plant Physiol 153(3):1345–1361 Bhattacharyya A, Leighton SM, Babu CR (2007) Bioinsecticidal activity of Archidendron ellipticum trypsin inhibitor on growth and serine digestive enzymes during larval development of Spodoptera litura. Toxicol Pharmacol 145:669–667 Blanco-labra A, Iturbe-chinas FA (1981) Purification and characterization of an α-amylase inhibitor from maise (Zea maize). J.Food Biochem 5:1–17 Blanco-Labra A, Sandoval-Cardosa L, Mendiola-Olaya E, Valdes-Rodriguez S, Lopez MG (1996) Purification and characterization of a glycoprotein α-amylase inhibitor from tepary bean seeds (Phaseolus acutifolius a. gray). J. Plant Physiol 149:650–656 Bouckaert J, Hamelryck T, Wyns L, Loris R (1999) Novel structures of plant lectins and their complexes with carbohydrates. Curr Opin Struct Biol 9(5):572–577 Broadway RM, Duffey SS (1986) Plant proteinase inhibitors: mechanism of action and effect on the growth and digestive physiology of larval Heliothis zea and Spodoptera exigua. J Insect Physiol 32:827–833 Candido Ede S, Pinto MF, Pelegrini PB, Lima TB, Silva ON, Pogue R, Grossi-de-Sa MF, Franco OL (2011) Plant storage proteins with antimicrobial activity: novel insights into plant defense mechanisms. FASEB J 25:3290–3305 Chang T, Chen L, Chen S, Cai H, Liu X, Xiao G, Zhu Z (2003) Transformation of tobacco with genes encoding Helianthus tuberosus agglutinin (HTA) confers resistance to peach-potato aphid (Myzus persicae). Transgenic Res 12(5):607–614 Chen Y, Peumans WJ, Hause B, Bras J, Kumar M, Proost P, Barre A, Rougé P, Van Damme EJM (2002) Jasmonate methyl ester induces the synthesis of a cytoplasmic/nuclear chitooligosaccharide-binding lectin in tobacco leaves. FASEB J 16(8):905–907 Chen M-S, Echegaray E, Whitworth RJ et al (2009) Virulence analysis of hessian fly populations from Texas, Oklahoma, and Kansas. J Econ Entomol 102:774–780

References

265

Chinnapun D, Sarawoot P, Hatairat H (2016) Cloning and characterization of a putative gene encoding serine protease inhibitor (251Hbpi) with antifungal activity against ‘Trichophyton rubrum’ from 'Hevea brasiliensis’ leaves. Plant Omics 9:142–148 Chrispeels MJ, Grossi De Sa MF, Higgins TJV (1998a) Genetic engineering with α-amylase inhibitors makes seeds resistant to bruchids. Seed Sci Res 8:257–264 Chrispeels MJ, Grossi-de-Sa MF, Higgins TJV (1998b) Genetic engineering with alpha-amylase inhibitors seeds resistant to bruchids. Seed Sci Res 8:257–263 Chrzaszez T, Janicki J (1934) The inactivation of animal amylase by plant paralysers and the presence of inactivating substances in solutions of animal amylase. Biochem J 28:296–304 Cristofoletti PT, de Sousa FA, Rahbé Y, Terra WR (2006) Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells. A major binding site for toxic mannose lectins. FEBS J 273:5574–5588 Czapla TH, Lang BA (1990) Effect of plant lectins on the larval development of European corn borer (Lepidoptera: Pyralidae) and southern corn rootworm (Coleoptera: Chrysomelidae). J Econ Entomol 83(6):2480–2485 D’Onofrio M, Lee MD, Starr CM, Miller M, Hanover JA (1991) The gene encoding rat nuclear pore glycoprotein p62 is intronless. J Biol Chem 266:11980–11985 Daglish GJ, Hall EA, Zorzetto MJ, Lambkin TM, Erbacher JM (1993) Evaluation of protectants for control of Acanthoscelides obtectus (say) (Coleoptera: Bruchidae) in navybeans (Phaseolus vulgaris (L.)). J Stored Prod Res 29:215–219 De Leo F, Gallerani R (2002) The mustard trypsin inhibitor 2 affects the fertility of Spodoptera littoralis larvae fed on transgenic plants. Insect Biochem Mol Biol 32:489–496 Dhir BC, Mohapatra HK, Senapati B (1992) Assessment of crop loss in groundnut due to tobacco caterpillar, Spodoptera litura (F.). Ind J Plant Prot 20:215–217 Dias SC, Franco OL, Magalhaes CP et al (2005) Molecular cloning and expression of an α-amylase inhibitor from Rye with potential for controlling insect pests. Protein J 24:113–123 Dias SC, Da Silva MCM, Tereira FR, Figueira ELZ, de Oliveira-Neto OB, de Lima LA (2010) Investigation of insecticidal activity of rye α-amylase inhibitor gene expressed in transgenic tobacco (Nicotiana tabacum) toward cotton boll weevil (Anthonomus grandis). Pestic Biochem Physiol 98(1):39–44 Dowd PF, Zuo W-N, Gillikin JW, Johnson ET, Boston RS (2003) Enhanced resistance to in tobacco expressing an activated form of maize ribosome-inactivating protein. J Agric Food Chem 51 (12):3568–3574 Felton GW (2005) Indigestion is a plant’s best defense. Proc Natl Acad Sci 102(52):18771–18772 Feng GU, Richardson M, Chen MS, Kramer KJ, Morgan TD, Reeck GR (1996) α-Amylase inhibitors from wheat: amino acid sequences and patterns of inhibition of insect and human α-amylases. Insect Biochem Mol Biol 26:419–426 Fitches E, Woodhouse SD, Edwards JP, Gatehouse JA (2001) In vitro and in vivo binding of snowdrop (Galanthus nivalis agglutinin; GNA) and jack bean (Canavalia ensiformis; ConA) lectins within tomato moth (Lacanobia oleracea) larvae: mechanisms of insecticidal action. J Insect Physiol 47:777–787 Franco OL, Rigden DJ, Melo FR, Bloch C, Silva CP, Grossi de Sá MF (2000) Activity of wheat α-amylase inhibitors towards Bruchid α-amylases and structural explanation of observed specificities. Eur J Biochem 267(8):2166–2173 Garcia-Casado G, Sanchez-Monge R, Puente XS, Salcedo G (1996) Divergence in properties of two closely related alpha-amylase inhibitors of barley. Physiol Plant I98:523–528 Gatehouse AMR, Gatehouse JA (1998) Identifying proteins with insecticidal activity: use of encoding genes to produce insect-resistant transgenic crops. Pestic Sci 52:165–175 Ge Z, Wan P, Han Z (2012) Cloning and characterization of trypsin-and chymotrypsin-like genes in the striped rice stem borer, Chilo suppressalis. Genome 55:281–288 Gill HK, Garg H (2014) Pesticide: environmental impacts and management strategies. In: Solenski S, Larramenday ML (eds) Pesticides- toxic effects. Intech, Rijeka, p 187

266

14

Insect Pest Resistance Factors in Rice Bean

Giovanini MP, Saltzmann KD, Puthoff DP, Gonzalo M, Ohm HW, Williams CE (2007) A novel wheat gene encoding a putative chitin-binding lectin is associated with resistance against hessian fly. Mol Plant Pathol 8:69–82 Grossi De Sa FM, Chrispeels MJ (1997) Molecular cloning of bruchid (Zabrotes subfasciatus) α-amylase cDNA and interactions of the expressed enzyme with bean amylase inhibitors. Insect Biochem Mol Biol 27:271–281 Gruden K, Stukelj B, Popovic T, Lenarcic B et al (1998) The cysteine protease activity of Colorado potato beetle (Leptinotarsa decemlineata say) guts, which is insensitive to potato protease inhibitors, is inhibited by thyroglobulin type-1 domain inhibitors. Mol Biol 28:549–560 Harris MO, Sandanayaka M, Griffin W (2001) Oviposition preferences of the hessian fly and their consequences for the survival and reproductive potential of offspring. Ecol Entomol 26:473–486 Hegedus DD, Erlandson M, Gillott C, Toprak U (2009) Peritrophic matrix synthesis, architecture and function: new insights. Annu Rev Entomol 54:285–302 Heo L, Shin WH, Lee MS, Seok C (2014) Galaxy site: ligand-binding-site prediction by using molecular docking. Nucleic Acids Res 42:W210–W214 Hilder VA, Gatehouse AMR, Sheerman SE, Barker RF, Boulter D (1987) A novel mechanism of insect resistance engineered into tobacco. Nature 300:160–163 Ho MF, Whitaker JR (1993) Purification and partial characterization of white kidney beans (Phaseolus vulgaris) α-amylase inhibitors from two experimental cultivars. J Food Biochem 17:15–33 Hossain MA, Maiti MK, Basu A, Sen S, Ghosh AK, Sen SK (2006) Transgenic expression of onion leaf lectin gene in Indian mustard offers protection against aphid colonization. Crop Sci 46 (5):2022–2032 Huesing JE, Shade RE, Chrispeels MJ, Murdock LL (1991) α-Amylase inhibitor, not phytohemagglutinin explains the resistance of common bean seeds to cowpea weevil. Plant Physiol 96:993– 996 Ignacimuthu S, Prakash S (2006) Agrobacterium-mediated transformation of chickpea with α-amylase inhibitor gene for insect resistance. J Biosci 31:339–345 Ignacimuthu S, Janarthanan S, Balachandran (2000) Chemical basis of resistance in pulses to Callosobruchus maculatus (F.) (Coleoptera: Bruchidae). J Stored Prod Res 36:89–99 Ishikawa A, Ohta S, Matsuoka K, Hattori T, Nakamura K (1994) A family of potato genes that encode Kunitz-type proteinase inhibitors: structural comparisons and differential expression. Plant Cell Physiol 35:303–312 Ishimoto M, Chrispeels MJ (1996) Protective mechanism of the Mexican bean weevil against high levels of alpha-amylase inhibitor in the common bean. Plant Physiol 111:393–401 Ishimoto M, Kitamura K (1989) Growth inhibitory effects of an α-amylase inhibitor from kidney bean, Phaseolus vulgaris (L.) on three species of Bruchids (Coleoptera: Bruchidae). Appl Ent Zool 24:281–286 Ishimoto M, Sato T, Chrispeels MJ, Kitamura K (1996) Bruchid resistance of transgenic azuki bean expressing seed amylase inhibitor of common bean. Entomol Exp Appl 79:309–315 Iulek J, Franco OL, Silva M, Slivinski CT, Bloch C Jr, Rigden DJ et al (2000) Purification, biochemical characterisation and partial primary structure of a new α-amylase inhibitor from Secale cereale (rye). Int J Biochem Cell Biol 32:1195–1204 Janzen DH, Juster HB, Liener IE (1976) Insecticidal action of the phytohaemagglutinin in black beans on a bruchid beetle. Science 192:795–796 Kashiwaba K, Tomooka N, Kaga A, Han OK, Vaughan DA (2003) Characterization of resistance to three Bruchid species (Callosobruchus spp., Coleoptera, Bruchidae) in cultivated Rice bean (Vigna umbellata). J Econ Entomol 96:207–213 Katoch R, Jamwal A (2013) Characterization of α -amylase Inhibitor from Rice bean with inhibitory activity against Midgut α-amylases from Spodoptera litura. Appl Biochem Microbiol 49:419–425

References

267

Katoch R, Sethi A, Thakur N, Murdock LL (2013) RNAi for insect control: current perspective and future challenges. Appl Biochem Biotechnol 171(4):847–873. https://doi.org/10.1007/s12010013-0399-4 Katoch R, Singh SK, Thakur N, Dutt S, Yadav SK, Shukle R (2014) Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman–Birk type protease Inhibitor from Rice bean. Gene 546:342–351 Katoch R, Sharma K, Singh SK, Thakur N (2015) Evaluation and characterization of trypsin Inhibitor from Rice bean with inhibitory activity against gut proteases of Spodoptera litura. Z Naturforsch 70(11–12):287–295 Kluh I, Horn M, Hyblova J et al (2005) Inhibitory specificity and insecticidal selectivity of α-amylase inhibitor from Phaseolus vulgaris. Phytochemistry 66:31–39 Kokiladevi E, Manickam A, Thayumanavan B (2005) Characterization of α-amylase inhibitor in Vigna sublobata. Bot Bull Acad Sinica 46:189–196 Konami Y, Yamamoto K, Osawa T, Irimura T (1994) Strong affinity of hemagglutinin (MAH) for sialic acid-containing Ser/Thr-linked carbohydrate chains of N-terminal octapeptides from human glycophorin A. FEBS Lett 342(3):334–338 Kranthi K, Jadhav DR, Kranthi S, Wanjari RR (2002a) Insecticide resistance in five major pests of cotton in India. Crop Prot 21:449–460 Kranthi KR, Jadhav DR, Kranthi S, Wanjari RR, Ali SS, Russell DA (2002b) Insecticide resistance in five major insect pests of cotton in India. Crop Prot 21:449–460 Krattiger AF (1997) Insect resistance in crops: a case study of bacillus thuringiensis and its transfer to developing countries. ISAAA Briefs 2:1–42 Kuhar K, Kansal R, Mishra A, Koundal KR, Gupta VK (2012) Cloning, characterization and expression analysis of a novel gene encoding Kunitz-type protease inhibitor from Dolichos biflorus. Biotech 2:199–209 Kutty AVM, Pattabiraman TM (1986) Isolation and characterization of an amylase inhibitor from sorghum seeds, specific for human enzymes. J Agric Food Chem 34:552–557 Lagarda-Dias I, Guzman-Partida AM, Vazquez-Moreno L (2017) Legume lectins: proteins with diverse applications. Int J Biol Macromol 18:1–18 Lawrence PK, Koundal KR (2002) Plant protease inhibitors in control of phytophagous insects. Electron J Biotechnol 5:1–17 Loris R, Hamelryck T, Bouckaert J, Wyns L (1998) Legume lectin structure. Biochim Biophys Acta Protein Struct Mol Enzymol 1383(1):9–36 Macedo MLR, das Graças Machado Freire M, da Silva MBR, Coelho LCBB (2007) Insecticidal action of Bauhinia monandra leaf lectin (BmoLL) against Anagasta kuehniella (Lepidoptera: Pyralidae), Zabrotes subfasciatus and Callosobruchus maculatus (Coleoptera: Bruchidae). Comp Biochem Physiol A Mol Integr Physiol 146(4):486–498 Macedo M, Oliveira C, Oliveira C (2015) Insecticidal activity of plant lectins and potential application in crop protection. Molecules 20(2):2014–2033 Mahendran K, Mohan S (2002) Technology adoption, estimation of loss and farmers behavior in pulses storage. A study in Western Tamil Nadu. Pestol 24:21–29 Marshall JJ, Lauda CM (1975) Purification and properties of phaseolamin, an inhibitor of alphaamylase, from the kidney bean. Phaseolus vulgaris 250:8030–8037 Mehrabadi M, Bandani AR, Mehrabadi R, Alizadeh H (2012) Inhibitory activity of proteinaceous α-amylase inhibitors from triticale seeds against Eurygaster integriceps salivary α-amylases: interaction of the inhibitors and the insect digestive enzymes. Pestic Biochem Pyhsiol 102:220–228 Melander M, Åhman I, Kamnert I, Strömdahl A-C (2003) Transgenic Res 12(5):555–567 Mundy J, Rogers JC (1986) Selective expression of a probable amylase/protease inhibitor in barley aleurone cells: comparison to the barley amylase/subtilisin inhibitor. Planta 169:51–63 Murdock LL, Huesing JE, Suzanne Nielsen S, Pratt RC, Shade RE (1990) Biological effects of plant lectins on the cowpea weevil. Phytochemistry 29(1):85–89

268

14

Insect Pest Resistance Factors in Rice Bean

Oppert B, Morgan TD, Hartzer K, Lenarcic B, Galesa K, Brzin J, Turk V, Yoza K, Ohtsubo K, Kramer KJ (2003) Effects of proteinase inhibitors on digestive proteinases and growth of the red flour beetle, Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae). Toxicol Pharmacol 134:481–490 Pavithravani BV, Gowda R, Bhanuprakash K, Ramesh S, Rao MA, Subramanya S, Gireesh C (2013) Biochemical components: an index of bruchid resistance in rice bean (Vigna umbellata) Ohwi and Ohashi. Legume Res 36:582–588 Pelegrini PB, Lay FT, Murad AM, Anderson MA, Franco OI (2008) Novel insights on the mechanism of action of a-amylase inhibitors from the plant defensin family. Proteins 73:719–729 Piasecka-Kwiatkowska D, Madal D, Warchalewski JR (2007) The biological activity of wheat, Rye and triticale varieties harvested in four consecutive years. Acta Sci Pol Technol Aliment 6:55–65 Powell KS (2001) Antimetabolic effects of plant lectins towards nymphal stages of the plant hoppers Tarophagous proserpina and Nilaparvata lugens. Entomol Exp Appl 99:71–77 Pusztai A, Ewen SWB, Grant G, Brown DS, Peumans WJ, Van Damme EJM, Bardocz S (1992) Stimulation of growth and polyamine accretion in the small intestine and pancreas by lectins and trypsin inhibitors. In: Dowling RH et al (eds) Polyamines in the gastrointestinal tract. Kluwer Academic Publishers, Lancaster, pp 473–483 Rahbe Y, Febvay G (1993) Protein toxicity to aphids: an in vitro test on Acyrthosiphon pisum (Homoptera: Aphididae). Entomol Exp Appl 67:149–160 Rakwal R, Agarwal KG, Jha NS (2001) Characterization of a rice (Oryza sativa L.) Bowman-Birk proteinase inhibitor: tightly light regulated induction in response to cut, jasmonic acid, ethylene and protein phosphatase 2A inhibitors. Gene 263:189–198 Rauf I, Javaid S et al (2019) In-planta expression of insecticidal proteins provides protection against lepidopteran insects. Sci Rep 9:6745 Roche DB, Tetchner SJ, McGuffin LJ (2010) The binding site distance test score: a robust method for the assessment of predicted protein binding sites. Bioinformatics 26(22):2920–2921 Ryan CA (1990) Proteinase inhibitors in plants: genes for improving defenses against insects and pathogens. Annu Rev Phytopathol 28:425–449 Sadeghi A, Smagghe G, Broeders S, Hernalsteens J-P, De Greve H, Peumans WJ, Van Damme EJM (2008a) Ectopically expressed leaf and bulb lectins from garlic (Allium sativum L.) protect transgenic tobacco plants against cotton leafworm (Spodoptera littoralis). Transgenic Res 17 (1):9–18 Sadeghi A, Smagghe G, Proost P, Van Damme EJM (2008b) Ferritin acts as a target site for the snowdrop lectin (GNA) in the midgut of the cotton leafworm. Insect Science 15(6):513–519 Saha P, Majumder P, Dutta I, Tui R, Roy SC, Das S (2006) Transgenic rice expressing Allium sativum leaf lectin with enhanced resistance against sap-sucking insect pests. Planta 223 (6):1329–1343 Saini M, Nandeesha P, Kaashyap M, Gupta P, Mohan M, Datta S (2015) Cloning and characterization of protease inhibitor genes from some legumes. Legum Res 38:178–181 Shahidi-Noghabi S, Van Damme EJM, Smagghe G (2009) Expression of Sambucus nigra agglutinin (SNA-I’) from elderberry bark in transgenic tobacco plants results in enhanced resistance to different insect species. Transgenic Res 18(2):249–259 Sánchez-Monge R, García-Casado G, Barbe D, Salcedo G (1996) Interaction of allergens from house-dust mite and from cereal flours: Dermatophagoides pteronyssinus α-amylase (Der p 4) and wheat and rye α-amylase inhibitors. Allergy 51(3):176–180 Sasikiran K, Rekha MR, Padmaja G (2002) Proteinase and alpha-amylase inhibitors of sweet potato: changes during growth phase, sprouting, and wound induced alterations. Bot Bull Acad Sin 43:291–298 Sauvion N, Rahbe Y, Peumans WJ, Van Damme EJM, Gatehouse JA, Gatehouse AMR (1996) Effects of GNA and other mannose binding lectins on development and fecundity of the peachpotato aphid Myzus persicue. Entomologia Expetimentalis et Applicata 79:285–293

References

269

Sauvion N, Nardon C, Febvay G, Gatehouse AMR, Rahbe Y (2004a) Binding of the insecticidal lectin Concanavalin a in pea aphid, Acyrthosiphon pisum (Harris) and induced effects on the structure of Midgut epithelial cells. J Insect Physiol 50:1137–1150 Sauvion N, Nardon C, Febvay G, Gatehouse MR, Abd Rahbe Y (2004b) Binding of the insecticidal lectin Concanavalin a in pea aphid, Acyrthosiphon pisum (Harris) and induced effects on the structure of midgut epithelial cells. J Insect Physiol 50:1137–1150 Schroeder HE, Gollasch S, Moore A, Tabe LM, Craig S, Hardie D, Chrispeels MJ, Spencer D, Higgins TJV (1995) Bean α-amylase inhibitor confers resistance to the pea weevil, Bruchus pisorum, in genetically engineered peas (Pisum sativum L.). Plant Physiol 107:1233–1239 Shade RE, Schroeder RE, Poueyo JJ, Tabe LM, Murdock LI, Higgins TJV, Chrispeels MJ (1994) Transgenic pea seeds expressing the α-amylase inhibitor of the common bean are resistant to bruchid beetles. Biotechnol 12:793–796 Sharma GN, Dubey SK, Sati N, Sanadya J (2011) Phytochemical screening and estimation of total phenolic content in Aegle marmelos seeds. Int J Pharma Clinic Res 3:27–29 Shukle RH, Subramanyam S, Williams CE (2012) Effects of Antinutrient proteins on hessian fly (Diptera: Cecidomyiidae) larvae. J Insect Physiol 58(1):41–48 Sierra IL, Quillien L, Flecker P, Gueguen J, Brunie S (1999) Dimeric crystal structure of a Bowman-Birk protease inhibitor from pea seeds. J Mol Biol 285:1195–1207 Simmonds MSJ (2003) Flavonoids-insect interactions: recent advances in our knowledge. Phytobiochem 64:21–30 Singh RR, Appu Rao AG (2002) Reductive unfolding and oxidative refolding of a Bowman–Birk inhibitor from horsegram seeds (Dolichos biflorus): evidence for ‘hyperreactive’ disulfide bonds and rate-limiting nature of disulfide isomerization in folding. Biochim Biophys Acta 1597:280–291 Singh P, Tiwari P, Sabat BC, Prajapat RK, Kansal R (2016) Use of Vigna radiata lectin gene in development of transgenic Brassica Juncea resistant to aphids. Int J Agric Sci Res 6:199–210 Solleti SK, Bakshi S, Purkayastha J, Panda SK, Lingaraj S (2008) Transgenic cowpea (Vigna unguiculata) seeds expressing a bean α-amylase inhibitor 1 confer resistance to storage pests, bruchid beetles. Plant Cell Rep 27:1841 Southgate BJ (1979) Biology of the Bruchidae. Annu Rev Entomol 24:449–473 Srinivasan T, Durairaj C (2007) Biochemical basis of resistance in Rice bean (Vigna umbellata (Thunb). Ohwi and Ohaswi) against Callosobruchus maculatus. J Entomol 4:371–378 Subramanyam S, Smith DF, Clemens JC, Webb MA, Sardesai N, Williams CE (2008) Functional characterization of HFR1, a high-mannose N-glycan-specific wheat lectin induced by hessian fly larvae. Plant Physiol 147:1412–1426 Talekar NS, Lin YH (1981) Two sources with differing modes of resistance to Callosobruchus chinensis in mungbean. J Econ Entomol 74(5):639–642 Tomooka N, Kashiwaba K, Vaughan DA, Ishimoto M, Egawa Y (2000) The effectiveness of evaluating wild species: searching for sources of resistance to bruchid beetles in the genus Vigna subgenus Ceratotropis. Euphytica 115:27–41 Treutter D (2006) Significance of flavonoids in plant resistance: a review. Environ Chem Lett 4:147–157 Valencia A, Bustillo AE, Ossa GE, Chrispeels MJ (2000) α-Amylase of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant α-amylase inhibitors. Insect Biochem Mol Biol 30:207–213 Vandenborre G, Van Damme EJM, Smagghe G (2009) Natural products: plant Lectins as important tools in controlling Pest insects. Biorational Control of Arthropod Insects 1:163–187 Vandenborre G, Groten K, Smagghe G, Lannoo N, Baldwin IT, Van Damme EJM (2010) Nicotiana tabacum agglutinin is active against Lepidopteran pest insects. J Exp Bot 61(4):1003–1014 Vandenborre G, Smagghe G, Van Damme EJM (2011) Plant lectins as defense proteins against phytophagous insects. Phytochemistry 72(13):1538–1550 Van Damme E (1998) Plant lectins: a composite of several distinct families of structurally and evolutionary related proteins with diverse biological roles. Crit Rev Plant Sci 17(6):575–692

270

14

Insect Pest Resistance Factors in Rice Bean

Wang W, Hause B, Peumans WJ, Smagghe G, Mackie A, Fraser R, Van Damme EJM (2003) The Tn antigen-specific lectin from ground ivy is an insecticidal protein with an unusual physiology. Plant Physiol 132(3):1322–1334 Wang Z, Zhang K, Sun X, Tang K, Zhang J (2005) Enhancement of resistance to aphids by introducing the snowdrop lectin genegna into maize plants. J Biosci 30(5):627–638 Wang YP, Chen XT, Qiu LJ (2008) Novel alleles among soybean Bowman–Birk proteinase inhibitor gene families. Sci China C Life Sci 51:687–692 War AR, Paulraj MG, War MY, Ignacimuthu S (2011a) Jasmonic acid- mediated induced resistance in groundnut (Arachis hypogaea L.) against Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae). J. Plant Growth Regul 30:512–523 War AR, Paulraj MG, War MY, Ignacimuthu S (2011b) Herbivore- and elicitor-induced resistance in groundnut to Asian armyworm, Spodoptera litura (fab.) (Lepidoptera: Noctuidae). Plant Signal Behav 6:1769–1777 Warchalewski J (1977) Isolation and purification of native alpha-amylase inhibitors from malted winter wheat. Int Inf Syst Agric Sci Technol 25:731–735 Wisessing A, Engkagul A, Wongpiyasatid A, Choowongkomon K (2010) Biochemical characterization of the α-amylase inhibitor in Mungbeans and its application in inhibiting the growth of Callosobruchus maculatus. J Agric Food Chem 58:2131–2137 Wu J, Luo X, Guo H, Xiao J, Tian Y (2006) Transgenic cotton, expressing Amaranthus caudatus agglutinin, confers enhanced resistance to aphids. Plant Breed 125(4):390–394 Yamagata H, Kunimatsu K, Kamasaka H, Kuramoto T, Iwasaki T (1997) Rice Bifunctional α-amylase/Subtilisin inhibitor: characterization, localization, and changes in developing and germinating seeds. Biosci Biotechnol Biochem 62:978–985 Yarasi B, Sadumpati V, Immanni CP, Vudem DR, Khareedu VR (2008) Transgenic rice expressing Allium sativum leaf agglutinin (ASAL) exhibits high-level resistance against major sap-sucking pests. BMC Plant Biol 8(1):102 Zeiss MR, Brandenburg RL, van Duyn JW (1993) Suitability of seven grass weeds as hessian fly (Diptera: Cecidomyiidae) hosts. J Agric Entomol 10:107–119 Zhu K, Huesing JE, Shade RE, Bressan RA, Hasegawa PM, Murdock LL (1996) An insecticidal Nacetylglucosamine-specific lectin gene from Griffonia simplicifolia (Leguminosae). Plant Physiol 110(1):195–202 Zhu-Salzman K, Shade RE, Koiwa H, Salzman RA, Narasimhan M, Bressan RA, Hasegawa PM, Murdock LL (1998) Carbohydrate binding and resistance to proteolysis control insecticidal activity of Griffonia simplicifolia lectin II. Proc Natl Acad Sci 95(25):15123–15128

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

15

Today global agriculture is facing downfall in total production and one of the critical factors for less productivity is food crop damages caused by insects and pests. Food availability is one of the major objectives to make food security attainable to people of the world and thereby huge money is spent every year to control the population of crop-damaging insects. Despite all the insect–pest control measures, there are considerable losses in agricultural crops every year. A chunk of money is spent worldwide on the use of agrochemicals which not only pollute the environment but also pose severe threats to human and animal health. Additionally, their injudicious and indiscriminate uses have also become responsible for resurgence and resistance in insects in many corners of the world. Therefore, it becomes necessary to control the population densities of crop-damaging insects by employing more programmed, eco-friendly, and effective crop protection strategies. Over the last few decades, conventional plant breeding has played a significant role in the development of varieties having resistance to biotic and abiotic stresses; however, the pace of varietal development using this approach is very much slow to combat the emerging threats. The advent of genetic engineering technologies has revolutionized crop improvement programs by breaking hybridization barriers among species and genera. Genetic engineering of crops offers many advantages: not just widening the potential pool of useful genes but also permitting the introduction of any desirable gene and reducing the time needed to introduce characters into an elite genetic background. The development of insect-resistant crops has been one of the major successes of applying plant genetic engineering technology to agriculture. The crops having resistance to both lepidopteran and coleopteran larvae (rootworms) are being widely used in global agriculture and have reduced pesticide usage and cost of production (Brookes and Barfoot 2005). The generation of insect-resistant crops harboring genes from soil bacterium Bacillus thuringiensis (Bt) encoding insecticidal toxins has been a major milestone in recombinant DNA technology. Bt strains have differing specificities of insecticidal activity and constitute a large reservoir of genes encoding insecticidal proteins, which are accumulated in crystalline inclusion bodies produced by bacterium on # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_15

271

272

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

sporulation or expressed during bacterial growth. The interaction of these proteins with receptors on the surface of cells of the insect gut epithelium leads to oligomerization of endotoxin proteins and becomes responsible for the formation of channels through cell membrane (Bravo et al. 2007). The resulting ionic leakage destroys the cell, leading to breakdown of the gut, bacterial proliferation, and ultimately death of insects. However, it is important to know that not all pests are in the target range of Bt toxins at present. Moreover, emerging evidences of increasing resistance in insects against Bacillus thuringiensis (Bt) have warranted the necessity of alternative strategies for transferring resistance in plants against insects. Plants have elaborate natural mechanisms to protect themselves from various insects and phytopathogens by synthesizing endogenous protective substances. Most of these protective compounds are of proteinaceous nature such as protease inhibitor, amylase inhibitors, lectins, etc. which generally accumulate in seeds in high amount. These compounds are also reported from vegetative parts of plants in lower concentration. In seeds, these compounds accumulate constitutively or in response to insects’ attack in order to confer resistance against them. Several artificial diet studies have revealed the entomotoxic effects of these proteinaceous compounds on insects such as retardation of insect development and fecundity. Plant protease inhibitors are important group of plant inhibitory proteins exhibiting a variety of functions ranging from endogenous regulatory functions to defense against insect–pests. The choice of appropriate protease inhibitors or set of PIs represents a primary determinant in the success or failure on any pest control strategy relying on protease inhibition. For successful results the choice of PIs should be based on a detailed understanding of insect biology. The targeted expression of PIs in response to pest attack could be controlled by the use of inducible promoters. The availability of diverse genes from different plant sources is in itself an advantage as two or more genes can be transferred in combination for more deleterious effects. These advantages advocates insect–pest inhibitory genes an ideal choice for developing transgenic crops resistant to insect–pests. Inhibitor genes of plant origin are particularly promising as they are not likely to have problems in expression, when inserted into other plant genomes. Moreover, plants’ PIs also have practical advantages over the other genes in terms of optimal expression from their own wound-inducible or constitutive promoters. This minimizes the possibility of development of resistance in insect populations against PIs. A number of studies have described the inhibitory potential of defense-related proteins. The first experiment with protease inhibitor encoding transgenes was carried out using Bowman–Birk proteinase inhibitor from cowpea (Vigna unguiculata; CpTI). This inhibitor had been identified as one of the factors providing resistance against bruchid beetles (Callosobruchus maculatus) (Gatehouse et al. 1979) and was transferred to tobacco plants. Insect performance was significantly compromised on these plants, with decreases of up to 50% in growth and survival of larvae of tobacco budworm (Heliothis virescens) and similar effects on other lepidopteran larvae. Since then a large number of plant protease inhibitor genes have been isolated, cloned, and sequenced (Katoch et al. 2014; Kuhar et al. 2012). The gene size and coding regions of protease inhibitors are small, usually devoid of

15.1

Strategies and Impact of Transferring Insect Resistance Genes in Plants

273

introns (Katoch et al. 2014). They are also of particular interest for being the product of single gene and inhibit proteolytic enzymes of animal and fungal origin but rarely of plant origin and therefore are thought to act as protective agents. α-Amylase inhibitors (α-AIs) are also important category of inhibitors present in different parts of plants as defense compounds. They provide an excellent example of the coevolution of insect digestive enzymes and plant defense proteins. There is a great interest in using α-AIs encoding gene for the production of transgenic plants that are resistant against storage pest. These inhibitors act on α-amylases, which are the most important enzymes of the insect’s digestive system that feeds exclusively on seed products during larval and/or adult life. When these amylases are inhibited, nutrition of the organism is impaired causing loss of energy. Their effective expression has been observed in transgenic plants. The expression of the cDNA encoding α-AI-1 in pea (Pisum sativum L.) and adzuki bean (Vigna angularis L.) has shown resistance against bruchids. The transgenic plants expressing α-amylase inhibitors from common beans (α-AI) were completely resistant to the Bruchus pisorum and Callosobruchus chinensis weevils (Morton et al. 2000). Similarly, adzuki bean seeds expressing α-AI-1 were completely resistant to the adzuki bean weevil (Ishimoto et al. 1996a, b) and showed minimal effects on mammalian digestion system (Pusztai et al. 1993), suggesting that these proteins can be safely introduced in crops of economic importance. Plant lectins have shown entomotoxic effects when fed to insects from Coleoptera, Homoptera, and Lepidoptera orders. Many plant lectins show carbohydrate specificity for glycoconjugates present in organisms outside the plant kingdom. It has been demonstrated that some lectins bind to the brush border membrane of the insect’s intestinal epithelial cells or, in the case of chitin-binding lectins to the peritrophic membrane. During the last two decades, a lot of progress has been made on the study of the activity of plant lectins against pathogens, nematodes and especially insects. The gene encoding lectin protein such as GNA, WGA, and ConA has also been successfully expressed in plants to confer resistance to pest insects. Different studies have shown that lectins from different sources have the potential to be utilized as a possible candidate for transferring resistance in susceptible crops. A common feature of these inhibitory proteins is that they have a chronic rather than an acute toxicity on insects as in case of synthetic insecticides.

15.1

Strategies and Impact of Transferring Insect Resistance Genes in Plants

Plants synthesize a range of secondary metabolites in response to pathogen invasion and insect attack which play a significant role in plant defense. One of the important groups of these compounds is inhibitory proteins which provide substantial protection to plants against different crop-damaging insects. These inhibitory proteins have therefore provided opportunity to generate insect–pest resistance in plants through advanced molecular techniques. The first step in plant transformation with inhibitory proteins requires investigation on entomocidal effects of these proteins which could

274

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

be carried out through artificial insect feeding assays containing inhibitory proteins. The callus-based insect bioassays can also be used for aforesaid purpose. The second step in plant transformation with inhibitory proteins involves identification and isolation of their encoding gene(s). The techniques such as map-based cloning like chromosome walking and molecular probing provide invaluable approaches in the identification and isolation of their encoding genes and their deployment in generating insect resistance in susceptible crops. Once the genes encoding inhibitory proteins are identified and isolated, the priority is to introduce them successfully into plants having desirable traits (e.g., high yield) but susceptible to infestation of insectpest. This requires designing of gene construct, suitable vectors, efficient techniques for introduction of genes into plants, development of tissue culture and regeneration systems, recovery and multiplication of transgenic plants, molecular and genetic characterization of transgenic plants for stable and efficient transgene expression and evaluation of transformed resistant plants. The use of protease inhibitor genes in the production of resistance crops was first demonstrated in the year 1987 by Hilder and colleagues. They fused cDNA coding for cowpea trypsin inhibitor (CpTI) with constitutive CaMV promoter and a popaline synthase terminator. The gene construct was transformed into tobacco plants using Agrobacterium-mediated gene transfer method. The study revealed that the inhibitor protein accumulated nearly 1% of total soluble proteins of leaf and provided substantial protection against tobacco bud worm (Heliothis virescens). Since then protease inhibitor genes from different sources have been introduced into plants including legumes, cereals, and other plants which showed protection against damaging insects. For example, transgenic chickpea plants expressing cowpea trypsin inhibitor revealed resistance to bruchid species (Thu et al. 2003). Transgenic tobacco plants expressing soybean Kunitz-type trypsin inhibitor (SBTI) increased insect mortality and reduced larval growth and damage caused by Helicoverpa virescens, Helicoverpa zea (Hoffmann et al. 1992), Spodoptera littoralis and Manduca sexta (McManus et al. 1999; Yeh et al. 1997) and Helicoverpa armigera (Charity et al. 1999; Zhao et al. 1998). The serine proteinase inhibitors (KTi3, C-II, and PI-IV) from soybean when expressed in transgenic tobacco plants resulted in up to 100% mortality of first-instar cotton leaf worms (Schuler et al. 1998). Smigocki et al. (2013) fused serine proteinase inhibitor gene from Beta vulgaris (BvSTI) to constitutive CaMV35S promoter for overexpression in Nicotiana benthamiana plants. The leaves of transgenic plants fed to Spodoptera frugiperda, Spodoptera exigua, and Manduca sexta larvae had significant reduction in larval weights than untransformed leaves. Tiwari et al. (2016) also transformed Brassica juncea plants with Vigna mungo protease inhibitor cloned in binary vector (pOREO4) under phloem-specific (rolC) promoter by Agrobacterium-mediated transformation and reported resistance against Lipaphis erysimi. The ability of some insect species to compensate for protease inhibition in their body by switching onto an alternative proteolytic activity or by increasing the synthesis of proteases and the level of protease inhibitor expression in transgenic plants may limit the use of protease inhibitor genes in plant protection. Most problems arise from single protease inhibitor gene targeting only one protease or

15.1

Strategies and Impact of Transferring Insect Resistance Genes in Plants

275

one class of proteases in the insect midgut. However, to overcome these problems, two strategies have been proposed which include first the selection of secondgeneration protease inhibitors from novel sources and use of multiple inhibitors. The accumulation of PI-resistant proteases in insects could be attributed to selection pressure that is imposed on insects when they face high endogenous PI levels in host plants. Such selection pressure for PI-resistant proteases does not occur for protease inhibitors from unrelated plants. Therefore, the strategy involves the utilization of protease inhibitor genes from unrelated source. The second approach includes the utilization of at least two inhibitors that have different targets (multigene transfer) that can be achieved by producing chimeric proteins, gene stacking (pyramiding), or the use of single inhibitors having dual targets. Stevens et al. (2012) used two structurally different PIs that target different enzymes and substantially improved the protection of transgenic cotton plants. This approach has also been successful in increasing the level of protection in transgenic tobacco plants expressing both Bt toxin and a cowpea trypsin inhibitor (CpTI) against H. armigera (Fan et al. 1999). α-Amylase enzymes play important role in carbohydrate metabolism of microorganisms, plants, and animals. Several insects feed on starchy seeds during larval and/or adult stages and depend on α-amylases for digestion. The report that α-amylase inhibitors from Phaseolus vulgaris seeds have inhibitory effects on Mexican bean weevil (Callosobruchus maculatus) first time confirmed the application of α-amylase inhibitor in developing transgenic plants with insect resistance. Since then α-amylase inhibitors from different sources have been investigated comprehensively. The transgenic tobacco plants expressing amylase inhibitors from wheat (WAAI) have been reported to increase the mortality of the lepidopteran larvae by 30–40% (Carbonero et al. 1993) and similarly for amylase inhibitors from bean (BAAI) against Callosobruchus spp. (Schroeder et al. 1995; Shade et al. 1994). Enhanced levels of resistance to the bruchids have also been observed in seeds of transgenic adzuki beans with α-amylase inhibitor gene from common bean (Ishimoto et al. 1996a, b). Transgenic chickpea plants expressing bean α-amylase inhibitor gene revealed resistance to bruchid species (Sarmah et al. 2004; Schroeder et al. 1995; Shade et al. 1994). Transgenic pea plants expressing bean α-amylase inhibitor with resistance to pea weevil (Bruchus pisorum) have also been developed (Morton et al. 2000). Luthia et al. (2013) also transformed chickpea (Cicer arietinum) and cowpea (Vigna unguiculata) plants with α-AI-1 gene from common bean and reported 100% larval mortality of Callosobruchus chinensis and Callosobruchus maculates. The feeding assay comprising both α-amylase and protease inhibitors revealed increased insect mortality which justified the use of α-amylase inhibitor in multiple gene transfer in plants. These transgenic grains showed minimal effects on mammalian digestive system. Genes coding for entomotoxic lectins have been introduced into different crop species and transgenic plant revealed lesser susceptibility to the insect attack. The insecticidal activity of snowdrop lectin against different insects was first demonstrated by Powell et al. (1993). Since then, this lectin has been used to transform different plant species (Hilder et al. 1995; Down et al. 1996; Fitches et al. 2001; Foissac et al. 2000; Maqbool et al. 2001; Ramesh et al. 2004; Setamou

276

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

et al. 2002; Nagadhara et al. 2003, 2004). Other entomotoxic lectins, such as WGA, chitin-binding lectins, Vigna radiate lectin, Allium sativum leaf agglutinin (ASAL), pea seed agglutinin (PSA,) and Concanavalin A (ConA) have also been introduced in different plants including legumes, cereals, potato, tobacco, and rape seeds which showed protection against damaging insects (Chakraborti et al. 2009, b; Gatehouse et al. 1999a; Kanrar et al. 2002; Rauf et al. 2019; Saha et al. 2006; Stoger et al. 1999; Yarasi et al. 2008). Numerous plant lectins are present in vegetables and fruits which are routinely consumed by humans. Since many of these plants are eaten raw, plant lectins are considered to be nontoxic for humans and mammals in general. A few legume lectins, for example, GNA, ConA, and PHA, have been known for exerting toxic effects in mammals (Vasconcelos and Oliveira 2004). This signifies the need of conducting toxicity studies concerning safety issues associated with the development of genetically engineered crops with lectin genes. Plant inhibitory proteins provide a promising alternative for designing strategy for protecting crops from the damaging insects. The availability of large repertoire of such defense genes makes possible to use one or more genes in combination, whose products are targeted at different biochemical and physiological processes in insect. However, use of the genes encoding inhibitory protein requires thorough knowledge of plant–insect interactions that will be valuable in designing strategies and their implementation for agricultural insect–pest management. The inhibitory genes from different sources which have been transferred into the plants for providing resistance against targeted insect–pests have been presented in Table 15.1.

15.2

Approaches for Transferring Insect Resistance Genes in Plants

The gene delivery systems have provided invaluable tools to generate desirable novelties in the targeted plants. In order to transfer insect resistance genes, they must be loaded to vector having additional genetic material which include “promoter region” that decides spatial and temporal expression of foreign gene in the host plant and a “marker gene” that allows recombinant selection. For transferring genes, different approaches have been developed for successful integrative transformation (Potrykus 1991). Among these only four approaches have been widely practiced and have enabled scientists to introduce genes into targeted plants. These include Agrobacterium-mediated gene transfer, particle bombardment or biolistics, microinjection, and direct DNA transfer into isolated protoplasts. Among these approaches, the first two have been widely used. Agrobacterium-mediated gene transfer has been used successfully for transforming crop plants with genes governing desirable traits from other sources. Agrobacterium is a soilborne bacterium responsible for causing crown gall disease in many dicotyledonous plants. The gall formation capability is due to the presence of Ti (tumor-inducing) plasmid in virulent strains of Agrobacterium. Similarly, Ri (root-inducing) megaplasmids are found in virulent strains of A. rhizogenes, causing

15.2

Approaches for Transferring Insect Resistance Genes in Plants

277

Table 15.1 Different inhibitory genes from plant sources targeted against insect–pests Gene source Proteinase inhibitors CpTI Vigna unguiculata Vigna unguiculata and Vigna sesquipedalis

Transformed plant Strawberry Cauliflower Potato

Potato TI

Potato

Soybean Soybean Bowman– Birk TI Soybean Soybean Kunitz inhibitor Tomato Tomato inhibitor I (Tom I) Nicotiana Winged tobacco alta PI (NaPI) Rice cysteine Rice inhibitor α-Amylase inhibitors α BIII Secale cereale (A1)-1 and (A2)-2 Lectins G. nivalis agglutinin N. tabacum agglutinin

Target pest

Reference

Otiorhynchus sulcatus Pieris rapae

Graham and Ryan (1997) Lingling et al. (2005) Gatehouse et al. (1995) Xu et al. (1996) Shirani et al. (2007) Falco and Silva-Filho (2003) Lee et al. (1999)

Tobacco

Lacanobia oleracea Lepidoptera

Tomato

Heliothis obsolete

Sugarcane

Diatraea saccharalis

Rice

Nilaparvata lugens

Tobacco

Manduca sexta

Johnson et al. (1989)

Royal Gala apple

Epiphyas postvittana

Maheswaran et al. (2007)

Poplar

Chrysomela tremulae

Leplé et al. (1995)

Tobacco

Zabrotes subfasciatus Bruchus pisorum

Morton et al. (2000) Svensson et al. (1986) Van Damme et al. (1987) Vandenborre et al. (2010)

Phaseolus vulgaris

Transgenic peas

Galanthus nivalis

Rice

Homoptera

Nicotiana tabacum

Nicotiana attenuata

Manduca sexta, Spodoptera littoralis

hairy root disease. Agrobacterium-mediated transformation is brought about by incorporation of genes of interest from an independently replicating Ti plasmid within the A. tumefaciens cell, which then infects the plant cell and transfers the T-DNA containing the gene of interest into the genome of actively dividing cells of host plant. For genetic engineering purposes, Agrobacterium must first be disarmed by removing regions of T-DNA that produces toxic compounds leaving the left and

278

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

right border sequences, which integrate foreign gene into the genome of plant cells. The examples of Agrobacterium-mediated gene transfer of inhibitory proteins include generation of transgenic chickpea plant having resistance to Callosobruchus maculatus with α-amylase inhibitor gene from Phaseolus vulgaris (Ignacimuthu and Prakash 2006) and transformation of oil palm plants with cowpea trypsin inhibitor (Ismail et al. 2010). For successful plant transformation with Agrobacterium, co-cultivation of plant cells and bacteria is a crucial step that is carried out by mixing the plant cells with bacteria in vitro for few days, after which bacteria are removed and cells or organs are regenerated to plants. Alternatively, whole plants are dipped in Agrobacterium and subsequently allowed to grow under natural conditions, as in floral dip transformation (Clough and Bent 1998). Since legumes have been observed recalcitrant to Agrobacterium-mediated gene transfer, thereby, numerous studies have been carried out for the optimization of co-cultivation conditions for successful Agrobacteriummediated gene transfer (light regime, temperature, co-cultivation period, application of physical treatments like sonication, electroporation, mechanical pre-wounding, or treatment by enzymes). The technique of direct gene transfer through physical or chemical methods provides an alternative to Agrobacterium-mediated transformation method. Examples of direct gene transfer methods are particle bombardment or gene gun, microinjection of DNA, and protoplast fusion. The particle bombardment (biolistics) is genotype independent and a more efficient method of gene transfer. In this technique tungsten or gold particle microprojectiles are coated with the foreign gene to be inserted and bombarded into cells capable of plant regeneration. Acceleration of heavy microprojectiles (0.5–5.0 μm diameter tungsten or gold particles) coated with foreign gene carries genes into virtually every type of cell and tissue (Klein et al. 1987; Sanford 1990). Further the transformed cells are selected for plant regeneration. This transformation method has been used to generate transgenic wheat plants expressing trypsin inhibitor gene from barley (Altpeter et al. 1999). In microinjection, the genetically engineered DNA is directly injected into nuclei of embryogenic single cells, which can be induced to regenerate plants in cell culture (Neuhaus et al. 1987). This requires micromanipulation of single cells or small colonies of cells and precise injection with a thin glass micropipette. Injected cells are subsequently raised in in vitro culture systems and regenerated into plants. In protoplast transformation, the cell wall of the target cells is removed by enzymatic treatment and the cells remain bound by a plasma membrane (Zhang and Wu 1988). The genetically engineered DNA can be added into cell suspension which can be introduced by affecting the plasma membrane by polyethylene glycol or by passing an electric current through protoplast suspension. The genetically engineered DNA gets incorporated into the genome of a few cells. A suitable marker may be inserted to select the transformed protoplasts that develop from them (Shimamoto et al. 1989).

15.3

New Biotechnological Tools (NBTs) in Imparting Insect Resistance

279

In gene transformation endeavors, a major constraint has been the lack of promoters offering high expression with higher specificity in crops of interest. The success of genetic transformation depends on the generation of the specific gene product with desired expression level in appropriate tissues at appropriate time. This could be achieved by designing gene constructs which include promoters and transcription regulatory elements. Traditionally transgene expression has been driven by strong constitutive promoters such as CaMV35 (Benfey and Chua 1989) and Actin 1 (McElroy et al. 1990). Though CaMV35S is widely used in many dicotyledonous plant transformation systems, it produces low expression in monocotyledonous species (Wilmink et al. 1995). Moreover, it is also difficult to predict the level of expression in different plant parts (Benfey and Chua 1990). Monocot promoters produce high level of expression in monocot tissues than in dicot tissues (Wilmink et al. 1995). The targeted expression of insecticidal genes can be achieved by tissue- and organ-specific promoters which constitute an important component for developing transgenic plants having resistance to insects (McBride et al. 1995a, b; Svab and Maliga 1993; Wong et al. 1992).

15.3

New Biotechnological Tools (NBTs) in Imparting Insect Resistance

The generation of insect-resistant crops with traditional plant breeding approaches is limited by numerous factors including lower level of resistance in the available germplasm for many insects and also introgression of undesirable traits from wild sources. The traditional breeding approach is a long-term process because of its long generation time. Contrary to traditional breeding approaches, genetic engineering allows plant breeders to introduce insect resistance genes in one plant from a wide range of sources. This approach has the added advantage of being precise, faster, cheaper, and an effective method of transferring desirable traits in plants. Genetic engineering in plants has been in practice from the last many decades. Different direct and indirect methods of gene transfer have proved very useful in heterologous DNA introduction into plant species (Altpeter et al. 2005). However, there are certain limitations in using these techniques like frequent integration of multiple transgene copies in particle bombardment and unsuitability of Agrobacterium-mediated transformation for monocotyledonous species. The success of Agrobacterium-mediated transformation is also limited due to activation of plant defense mechanism on the approach of bacterium. This is the reason why the co-cultivation and physical conditions are needed to be optimized to increase the virulence of bacterium and increase transformation efficiency. In the last few decades, significant progress has been made in the field of the molecular biology to overcome the limitations in existing plant transformation techniques. As a result a number of novel and valuable tools for plant improvement are now available. These tools make it possible to create desirable novelties in crops such as insect–pest resistance in fast and more efficient way with the objective of meeting demand for improved crop species for supporting sustainable agricultural

280

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

productivity. Some of the recent research innovations which have gained leads in crop improvement programs have been discussed in subsequent heads.

15.3.1 Gene Knockdown Technology (RNAi) Since the discovery of RNAi more than 25 years ago, research on the potential applications of this technique have been extensively investigated in different fields. According to the central dogma of life, RNA is a medium for transferring genetic information stored in DNA to protein. However, after the discovery of antisensemediated silencing of homologous genes, the regulatory role of RNA came into existence (Nellen and Lichtenstein 1993). In the year 1998, Fire et al. reported that double-stranded RNA (dsRNA) triggered the silencing of genes. This discovery led to the phenomenon which we currently know as RNA interference (RNAi). This process is a posttranscriptional control mechanism involving degradation of target mRNA mediated by small interfering RNAs (siRNAs). In simple words, RNAi is a sequence-specific silencing of target gene (Mamta and Rajam 2017). This technique has implications in plant and animal genomics ranging from functional genomics to gene knockdown in insects of economic Importance. The implication of RNAi as an insect control strategy which requires selection of target genes vital for insect survival that must be highly expressed without any functional redundancy (Li et al. 2013; Lomazzo et al. 2011) and the synthesis of double-stranded RNA (dsRNA) are two crucial components. Moreover, the introduction of vector which contains target gene in sense and antisense orientation separated by an intron and mode of dsRNA delivery are other crucial components of this approach. The major dsRNA delivery methods explored till now in different organisms are soaking, microinjection, and oral feeding. The functional RNAi machinery has two major components, the core component inside the cells, which comprised Dicer enzymes, RNA-binding factors, and Argonaute protein, and systemic component that amplifies dsRNA signal (Siomi and Siomi 2009). Small interfering RNAs (siRNAs) generated from dsRNA by specific endonucleases referred to as DICERS are responsible for RNAi effect. These siRNAs are incorporated into a RNA-induced silencing complex (RISC) which consists of Argonaute protein, Dicer, and dsRNA-binding protein. Argonaute proteins use siRNAs as a template to recognize and degrade complementary mRNA. The flowchart illustrating the process of RNAi-mediated gene silencing is presented in Fig. 15.1. The delivery of dsRNA mediated through oral feeding is comparatively a simple and effective method than that of other methods. Timmons and Fire et al. (1998) demonstrated for the first time the delivery of dsRNA molecules through oral route in insects. In the year 2007, two studies demonstrated the concept of plants expressing dsRNAs derived from hairpin vectors that directed dsRNAs to target gene regions of economically important agricultural pests: the cotton bollworm (Helicoverpa armigera; Lepidoptera; Mao et al. 2007) and the Western corn rootworm (Diabrotica virgifera virgifera; Coleoptera; Baum et al. 2007). Since

15.3

New Biotechnological Tools (NBTs) in Imparting Insect Resistance

281

Fig. 15.1 The process of RNA interference (Source: Katoch and Thakur 2012)

then, RNAi by transgenic plants became a potential new approach to control important agricultural pests The application of RNAi technology in insect control through oral feeding requires take-up of dsRNA either added to the food or produced by transgenic plants as hairpin RNAs (hpRNAs). In both the cases, dsRNA will first enter inside the insect gut. The insect midgut, an important part of insect gut for the digestion and absorption of nutrients consists of a single layer of columnar cells with microvilli, endocrine cells, and stem cells at the base. It absorbs nutrients from the lumen with its large absorption area provided by microvilli. This unique characteristic of midgut makes this tissue very potential dsRNA uptake location. On the delivery of dsRNA in insect gut, the two prominent transmembrane proteins, SID-1 and SID-2, are known to be involved in the transport of dsRNA into cells via a passive uptake mechanism which leads to functioning of RNAi machinery in insect gut (Fig. 15.2). Other than this, the endocytic dsRNA uptake mechanism has also become known for

282

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance Feeding insect with dsRNA

Putative action of nucleases inside the gut, which could disintegrate dsRNA dsRNA inside the gut

pH extremes inside the midgut posing hostile environment for dsRNA

Import inside the cell (I) SID-1 and and or SID-2 (in C.elegans) (ii) Endocytosis Transport of dsRNA inside the cells lining the midgut Processing by DICER (ribonucleases) siRNA Association of Argonaute protein

Formation of RISC complex

Binding of guide strand to target mRNA

Target mRNA degradation, (Gene Knockdown effects) RNAi

Fig. 15.2 RNAi mechanism in insect control (Source: Katoch et al. 2013)

the dsRNA uptake. Plants have system for amplification and transport of RNAi signal, whereas these systems are absent in insects; therefore, plants amplify the siRNA molecules and transport them through phloem and plasmodesmata to other parts. Since insects lack systems for the amplification and transport of the RNAi signal, the continuous supply of dsRNA is required in sufficient amounts at the specific site for effective silencing of target genes. Different group of workers have achieved RNAi-mediated control of lepidopteran, dipteran, and hemipteran insects in different crops. A brief resume of success of RNAi technology in different crops has been presented in Table 15.2.

Nicotiana tabacum

Nicotiana tabacum

Arabidopsis thaliana

Arabidopsis thaliana and Nicotiana benthamiana Arabidopsis thaliana

Lepidoptera

Lepidoptera

Lepidoptera

Hemiptera

Hemiptera

Hemiptera

Hemiptera

Myzus persicae

Myzus persicae

Bemisia tabaci

Rodrigues and Figueira (2016)

Solanum tuberosum

Coleoptera

Nicotiana rustica

Nicotiana tabacum

Crop Zea mays

Order Coleoptera

Insects Diabrotica virgifera Leptinotarsa decemlineata Helicoverpa armigera Spodoptera exigua Helicoverpa armigera Helicoverpa armigera Myzus persicae

vATPase

Hunchback (hb)

Serine protease

MpC001, Rack1

Molt-regulating transcription factor gene (HR3) HaAK

Mortality

Inhibited reproduction

Progeny reduced

Developmental deformities and larval lethality Developmental deformities and larval lethality Progeny reduced

Molting defect and larval lethality

Mortality

β-Actin, shrub Nuclear receptor complex of 20-hydroxyecdysone (HaEcR)

Remarks Mortality

Target gene vATPase

Table 15.2 Examples of RNAi-mediated gene knockdown of different insect orders

Xiong et al. (2013) Liu et al. (2015) Pitino et al. (2011) Bhatia et al. (2012) Mao and Zeng (2014) Thakur et al. (2014)

Reference Li et al. (2015) Zhang et al. (2015) Zhu et al. (2012)

15.3 New Biotechnological Tools (NBTs) in Imparting Insect Resistance 283

284

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

From the above examples, it is obvious that RNAi could be one of the strategies for insect management in different crops. However, the use of RNAi at field level is still in its infancy and many barriers are needed to be overcome for the success of this technology. The major disadvantage of this approach is that it requires continuous supply of dsRNA in sufficient amounts for silencing of target genes in insects as they lack the silencing signal amplification and transport system. This problem could be overcome by identifying the vital genes essential for insect survival and by engineering plants for producing dsRNA molecules against target genes. The efficacy of in planta RNAi against the insects can be increased by expressing long hairpin RNA (hpRNA) in the chloroplast to minimize processing by plant RNAi machinery (Bally et al. 2016) and stacking hpRNAs against target gene in insects (Spit et al. 2017). Also the integrity of the dsRNA in the hostile environment in insect midgut having nucleases is also at stake (Katoch and Thakur 2012). However with the advancement in the sequencing facilities, the whole genome sequence of most of the agriculturally important insects is now available; thereby, many challenges in the success of RNAi technology have been overcome.

15.3.2 Transplastomic Engineering Transplastomic engineering also known as engineering of chloroplast genome is one of the currently used approaches for bringing significant improvement in crops. One of the important features of this approach relies on cytoplasmic inheritance in plastids; thereby, transfer of foreign genes prevents the possibility of outcrossing (Maliga 2004). This approach also offers the expression of polycistronic operon, thus increasing the possibility of stacking of multiple-expressed genes in a single transformed event (Staub and Maliga 1995). The polyploidy nature of plastid genome also facilitates high expression of transgene (Maliga and Bock 2011). Plastid transformation also offers convenience in multigene engineering without transgene silencing and pleiotropic effects. This approach is advantageous over nuclear transformation of Bt gene as the transplastomic plants are able to synthesize much higher amounts of endotoxin proteins, which further limits the damage to nontarget insects. The expression of the Bt (pro) toxins in tobacco chloroplasts resulted in significant accumulation (3–5%) of the soluble proteins in the leaves that conferred the high toxicity of transplastomic plants against different Bt-susceptible insects (McBride et al. 1995a, b). The success through this technique in obtaining transplastomic soybean plants expressing high level of Bt cry1Ab protein with enhanced resistance against Anticarsia gemmatalis was achieved by Dufourmantel and colleagues in year 2005 (Dufourmantel et al. 2005).

15.3.3 CRISPR/Cas9 System CRISPR (clustered regularly interspersed short palindromic repeats) technique of gene editing has revolutionized the prospects of plant improvement. This method

15.3

New Biotechnological Tools (NBTs) in Imparting Insect Resistance

285

provides invaluable and precise technique of genome editing over other available technologies. A number of variant of this technique are available including those having the capacity to generate site-specific indels (often yielding frameshift mutations), to replace or insert specific sequences, and (by using a deactivated Cas9) to suppress gene expression. One of the important features of this technique is inherently stable changes in genome. Functionally this gene editing system is able to induce desired changes in the genome through guide RNA (sgRNA) technology. The construction of guide RNA is one of the crucial components of this technique. sgRNA is formed by the fusion of crRNA and trans-encoded CRISPR RNA (tracrRNA) (Qi et al. 2013). Cas9 protein is a DNA-specific nuclease that makes a double-stranded break in DNA at a site guided by binding of synthetic guide RNA (Jinek et al. 2013). The repair of double-stranded break in DNA either by homologous end joining (HEJ) or non-homologous end joining leads to the addition and deletion of nucleotides, results in mutations, and ultimately disturbs the translational machinery. The site-specific cleavage action of sgRNA–Cas9 complex is defined by predesigned sequences in guide RNA which has ~20 base pairs that are complementary to target sequence and helps in the binding of guide RNA to strands of target gene sequence (Wang et al. 2016). The CRISPR/Cas9-mediated genome editing technology has expanded the opportunities for introducing resistance traits into crops. The use of CRISR/Cas9 technology in crops conferring resistance to insect-vectored viruses, especially the geminiviruses, having DNA genomes has gained practical implications (Ali et al. 2016; Fondong 2017). Recently this technique has been used to knock out the vital genes of insects causing severe damage to the agricultural crops such as Tribolium castaneum (Gilles et al. 2015), Helicoverpa armigera (Wang et al. 2016), Spodoptera litura (Bi et al. 2016; Zhu et al. 2016), and Spodoptera littoralis (Koutroumpa et al. 2016). This system of gene editing has prospects in developing genetically edited plants having resistance to agriculturally important insects. Further CRISPR/Cas9-mediated silencing of vital genes in insects is expected to provide new solution to the existing and emerging problems in insect management. For the protection of economically important crop plants from insect–pest damage, the transgenic plant technology has expanded rapidly. In the coming times, the transgenic insect-resistant plants would make a promising contribution toward maximizing crop yields and minimizing crop losses. A number of transgenic plants and crops have been developed however, raising concerns regarding the pest resistance and biosafety, there is a need to exploit plants own defense mechanism by increasing the expression of endogenous defense proteins or by introducing insect resistant genes from other sources. Plant inhibitory proteins, a rich pool of natural arsenal in the plants, could be utilized for the development of insect–pest resistance using different technologies.

286

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

References Ali Z, Ali S, Tashkandi M, Zaidi SS-e-A, Mahfouz MM (2016) CRISPR/Cas9-mediated immunity to geminiviruses: differential interference and evasion. Sci Rep 6(1):1–13 Altpeter F, Díaz I, McAuslane H, Gaddour K, Carbonero P, Vasil IK (1999) Increased insect resistance in transgenic wheat stably expressing trypsin inhibitor CMe. Mol Breed 5:53–63 Altpeter F, Baisakh N, Beachy R, Bock R, Capell T, Christou P, Daniell H, Datta K, Datta S, Dix PJ, Fauquet C, Huang N, Kohli A, Mooibroek H, Nicholson L, Nguyen TT, Nugent G, Raemakers K, Romano A, Somers DA, Stoger E, Taylor N, Visser R (2005) Particle bombardment and the genetic enhancement of crops: myths and realities. Mol Breed 15(3):305–327 Bally J, McIntyre GJ, Doran RL, Lee K, Perez A, Jung H, Naim F, Larrinua IM, Narva KE, Waterhouse PM (2016) In-plant protection against Helicoverpa armigera by production of long hpRNA in chloroplasts. Front Plant Sci 7:1453 Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaighn T, Roberts J (2007) Control of coleopteran insect pests through RNA interference. Nature Biotechnol 25:1322–1326 Benfey PN, Chua N-H (1989) Regulated genes in transgenic plants. Science 244(4901):174–181 Benfey PN, Chua NH (1990) The cauliflower mosaic virus 35S promotor combinatorial regulation of transcription in plants. Science 250:959–966 Bhatia V, Bhattacharya R, Uniyal PL, Singh R, Niranjan RS (2012) Host generated siRNAs attenuate expression of serine protease gene in Myzus persicae. PLoS One 7:e46343 Bi HL, Xu J, Tan AJ, Huang YP (2016) CRISPR/Cas9-mediated targeted gene mutagenesis in Spodoptera litura. Insect Sci 23(3):469–477 Bravo A, Gill SS, Soberón M (2007) Mode of action of Bacillus thuringiensis cry and Cyt toxins and their potential for insect control. Toxicon 49:423–435 Brookes G, Barfoot P (2005) GM crops: The global economic and environmental impact: the first nine years 1996–2004. AgBioFor 8:187–196 Carbonero P, Royo J, Diaz I, Garcia-Maroto F, Gonzalez-Hidalgo E, Gutierez C, Casanera P (1993) Cereal inhibitors of insect hydrolases (α-amylases and trypsin): genetic control, transgenic expression and insect pests. In: Bruening GJ, Garcia-Olmedo F, Ponz FJ (eds) Workshop on engineering plants against pests and pathogens. Instituto Juan March de Estudios Investigacions, Madrid Chakraborti D, Sarkar A, Mondal HA, Das S (2009) Tissue specific expression of potent insecticidal, Allium sativum leaf agglutinin (ASAL) in important pulse crop, chickpea (Cicer arietinum L.) to resist the phloem feeding Aphis craccivora. Transgenic Res 18:529–544 Charity JA, Anderson MA, Bittisnich DJ, Whitecross M, Higgins TJV (1999) Transgenic tobacco and peas expressing a proteinase inhibitor from Nicotiana alata have increased resistance. Mol Breed 5:357–365 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743 Down RE, Gatehouse AMR, Hamilton WDO, Gatehouse JA (1996) Snowdrop lectin inhibits development and decreases fecundity of the glasshouse potato aphid (Aulacorthum solani) when administered in vitro and via transgenic plants both in laboratory and glasshouse trials. J Insect Physiol 42:1035–1045 Dufourmantel N, Tissot G, Goutorbe F, Garçon F, Muhr C, Jansens S, Pelissier B, Peltier G, Dubald M (2005) Generation and analysis of soybean plastid transformants expressing Bacillus thuringiensis Cry1Ab protoxin. Plant Mol Biol 58:659–668 Falco MC, Silva-Filho MC (2003) Expression of soybean proteinase inhibitors in transgenic sugarcane plants: effects on natural defense against Diatraea saccharalis. Plant Physiol Biochem 41:761–766 Fan X, Shi X, Zhao J, Zhao R, Fan Y (1999) Insecticidal activity of transgenic tobacco plants expressing both Bt and CpTI genes on cotton bollworm (Helicoverpa armigera). Chin J Biotechnol 15:1

References

287

Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806–811 Fitches E, Woodhouse SD, Edwards JP, Gatehouse JA (2001) In vitro and in vivo binding of snowdrop (Galanthus nivalis agglutinin; GNA) and jackbean (Canavalia ensiformis; Con A) lectins within tomato moth (Lacanobia oleracea) larvae; mechanisms of insecticidal action. J Insect Physiol 47:777–787 Foissac X, Nguyen TL, Christou P, Gatehouse AMR, Gatehouse JA (2000) Resistance to green leafhopper (Nephotettix virescens) and brown planthopper (Nilaparvata lugens) in transgenic rice expressing snowdrop lectin (Galanthus nivalis agglutinin; GNA). J Insect Physiol 46:573–583 Fondong VN (2017) The search for resistance to cassava mosaic geminiviruses: how much we have accomplished, and what lies ahead. Front Plant Sci 8:1–19 Gatehouse AMR, Gatehouse JA, Dobie P, Kilminster AM, Boulter D (1979) Biochemical basis of insect resistance in Vigna unguiculata. J Sci Food Agric 30:948–958 Gatehouse AMR, Powell KS, Peumans WJ, Van Damme EJM, Gatehouse JA (1995) Insecticidal properties of plant lectins; their potential in plant protection. In: Pusztai A, Bardocz S (eds) Biomedical perspectives. Taylor & Francis, London, p 35 Gatehouse AM, Davison GM, Stewart JN, Galehouse LN, Kumar A, Geoghegan IE, Birch ANE, Gatehouse JA (1999a) Concanavalin a inhibits development of tomato moth (Lacanobia oleracea) and peach-potato aphid (Myzus persicae) when expressed in transgenic potato plants. Mol Breed 5:153–165 Gatehouse AMR, Davison GM, Stewart JN, Gatehouse LN, Kumar A, Geoghegan IE, Birch ANE, Gatehouse JA (1999b) Concanavalin a inhibits development of tomato moth (Lacanobia oleracea) and peach-potato aphid (Myzus persicae) when expressed in transgenic potato plants. Mol Breed 5:153–165 Gilles AF, Schinko JB, Averof M (2015) Efficient CRISPR-mediated gene targeting and transgene replacement in the beetle Tribolium castaneum. Development 142(16):2832–2839 Graham JS, Ryan CA (1997) Accumulation of metallocarboxy-peptidase inhibitor in leaves of wounded potato plants. Biochem and Biophys Res Commu 101:1164–1170 Hilder VA, Gatehouse AMR, Sheerman SE, Baker RF, Boulter D (1987) A novel mechanism of insect resistance engineered into tobacco. Nature 330:160–163 Hilder VA, Powell KS, Gatehouse AMR, Gatehouse JA, Gatehouse LN, Shi Y, Hamilton WDO, Merryweather A, Newell CA, Timans JC, Peumans WJ, Van Damme EJM, Boulter D (1995) Expression of snowdrop lectin in transgenic tobacco plants results in added protection against aphids. Transgenic Res 4:18–25 Hoffmann MP, Zalom FG, Wilson LT, Smilanick JM, Malyj LD, Kisen J, Hilder VA, Barnes WM (1992) Field evaluation of transgenic tobacco containing genes encoding Bacillus thuringiensis -endotoxin or cowpea trypsin inhibitor: efficacy against Helicoverpa zea (Lepidoptera: Noctuidae). J Econ Entomol 85:2516–2522 Ignacimuthu S, Prakash S (2006) Agrobacterium-mediated transformation of chickpea with α-amylase inhibitor gene for insect resistance. J Biosci 31:339–345 Ishimoto M, Sato T, Chrispeels MJ, Kitamura K (1996a) Bruchid resistance of transgenic azuki bean expressing seed amylase inhibitor of common bean. Entomol Exp Appl 79:309–315 Ishimoto M, Sato T, Chrispeels MJ, Kitamura K (1996b) Bruchid resistance of transgenic azuki bean expressing seed α-amylase inhibitor of common bean. Entomol Exp Appl 79:309–315 Ismail I, Lee FS, Ruslan A, Chan F, Zamri Z, Nik S (2010) Molecular and expression analysis of cowpea trypsin inhibitor (CpTI) gene in transgenic Elaeis guineensis Jacq leaves. Aust J Crop Sci 4:37–48 Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2013) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821 Johnson R, Narvaez J, An G, Ryan C (1989) Expression of proteinase inhibitors I and II in transgenic tobacco plants: effects on natural defense against Manduca sexta larvae. Proc Nat Acad Sci United States Am 86:9871–9875

288

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

Kanrar S, Venkateswari J, Kirti P, Chopra V (2002) Transgenic Indian mustard (Brassica juncea) with resistance to the mustard aphid (Lipaphis erysimi Kalt.). Plant Cell Rep 20:976–981 Katoch R, Thakur N (2012) Insect gut nucleases: a challenge for RNA interference mediated insect control strategies. Int J Biochem Biotechnol 1:198–203 Katoch R, Sethi A, Thakur N, Murdock LL (2013) RNAi for insect control: current perspective and future challenges. Appl Biochem Biotechnol 169:1579–1605 Katoch R, Singh SK, Thakur N, Dutt S, Yadav SK, Shukle R (2014) Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman–Birk type protease inhibitor from rice bean. Gene 546:342–351 Klein TM, Wolf ED, Wu R, Sanford JC (1987) High-velocity microprojectiles for delivering nucleic acids into living cells. Nature 327:70–73 Koutroumpa FA, Monsempes C, Francois M-C, de Cian A, Royer C, Concordet J-P, Jacquin-Joly E (2016) Heritable genome editing with CRISPR/Cas9 induces anosmia in a crop pest moth. Sci Rep 6:29620 Kuhar K, Kansal R, Mishra A, Koundal KR, Gupta VK (2012) Cloning, characterization and expression analysis of a novel gene encoding Kunitz-type protease inhibitor from Dolichos biflorus. Biotech 2:199–209 Lee SI, Lee S-H, Koo JC, Chun HJ, Lim CO, Mun JH, Song YH, Cho MJ (1999) Soybean Kunitz trypsin inhibitor (SKTI) confers resistance to the brown planthopper (Nilaparvata lugens Stål) in transgenic rice. Mol Breed 5(1):1–9 Leplé JC, Bonadé-Bottino M, Augustin S, Pilate G, Tân VDL, Delplanque A, Cornu D, Jouanin L (1995) Toxicity to Chrysomela tremulae (Coleoptera: Chrysomelidae) of transgenic poplars expressing a cysteine proteinase inhibitor. Mol Breed 1(4):319–328 Li H, Jiang W, Zhang Z, Xing Y, Li F (2013) Transcriptome analysis and screening for potential target genes for RNAi-mediated pest control of the beet armyworm. Spodoptera exigua PLoS One 8:e65931 Li H, Khajuria C, Rangasamy M, Gandra P, Fitter M, Geng C et al (2015) Long dsRNA but not siRNA initiates RNAi in western corn rootworm larvae and adults. J Appl Ento mol 139:432–445 Lingling L, Lei J, Song M, Li L, Cao B (2005) Study on transformation of cowpea trypsin inhibitor gene into cauliflower (Brassica oleracea L. var. botrytis). Afr J Biotechnol 4:45–49 Liu F, Wang X, Zhao Y, Li Y, Liu Y, Sun J (2015) Silencing the HaAK gene by transgenic plantmediated RNAi impairs larval growth of Helicoverpa armigera. Int. J. Biologic. Sci 11:67–74 Lomazzo E, Hussmann GP, Wolfe BB, Yasuda RP, Perry DC, Kellar KJ (2011) Effects of chronic nicotine on heteromeric neuronal nicotinic receptors in rat primary cultured neurons. J Neurochem 119:153–164 Lüthia C, Álvarez-Alfagemea F, Ehlersa JD, Higgins TJ, Romeis J (2013) Resistance of αAI-1 transgenic chickpea (Cicer arietinum) and cowpea (Vigna unguiculata) dry grains to bruchid beetles (Coleoptera: Chrysomelidae). Bull Entomol Res 103(04):373–381 Maheswaran G, Pridmore L, Franz P, Anderson MA (2007) A proteinase inhibitor from Nicotiana alata inhibits the normal development of light-brown apple moth, Epiphyas postvittana in transgenic apple plants. Plant Cell Rep 26:773–782 Maliga P (2004) Plastid transformation in higher plants. Annu Rev Plant Biol 55:289–313 Maliga P, Bock R (2011) Plastid biotechnology: food, fuel, and medicine for the 21st century. Plant Physiol 155:1501–1510 Mamta B, Rajam MV (2017) RNAi technology: a new platform for crop pest control. Physiol Mol Biol Plants 23:487–501 Mao J, Zeng F (2014) Plant-mediated RNAi of a gap gene-enhanced tobacco tolerance against the Myzus persicae. Transgenic Res 23:145–152 Maqbool SB, Riazuddin S, Loc NT, Gatehouse AMR, Gatehouse JA, Christou P (2001) Expression of multiple insecticidal genes confers broad resistance against a range of different rice pests. Mol Breed 7:85–93

References

289

McBride KE, Svab Z, Schaaf DJ, Hogan PS, Stalker DM, Maliga P (1995a) Application of a chimeric Bacillus gene in chloroplasts leads to extraordinary level of an insecticidal protein in tobacco. BioTechnol 13:362–365 McBride KE, Svab Z, Schaaf DJ, Hogan PS, Stalker DM, Maliga P (1995b) Amplification of a chimeric Bacillus thuringiensis gene in chloroplasts leads to an extraordinary level of an insecticidal protein in tobacco. BioTechnol 13:362–365 McElroy D, Rothenberg M, Wu R (1990) Structural characterization of a rice actin gene. Plant Mol Biol 14:163–171 McManus MT, Burgess EPJ, Philip B, Watson LM, Laing WA, Voisey CR, White DWR (1999) Expression of the soybean (Kunitz) trypsin inhibitor in transgenic tobacco: effects on larval development of Spodoptera litura. Transgenic Res 8:383–395 Morton RL, Schroeder HE, Bateman KS, Chrispeels MJ, Armstrong E, Higgins TJV (2000) Bean alpha-amylase inhibitor 1 in transgenic peas (Pisum sativum) provides complete protection from pea weevil (Bruchus pisorum) under field conditions. Proc Natl Acad Sci 97(8):3820–3825 Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Krishnaiah NV, Sarma NP, Bown DP, Gatehouse JA, Reddy VD, Rao KV (2003) Transgenic indica rice resistant to sap sucking insects. Plant Biotech J 1:231–240 Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Sarma NP, Reddy VD, Rao KV (2004) Transgenic rice plants expressing the snowdrop lectin gene (GNA) exhibit high-level resistance to the white backed plant hopper (Sogatella furcifera). Theor Appl Genet 109:1399–1405 Nellen W, Lichtenstein C (1993) What makes an mRNA antisense-itive? Trends Biol Sci 18:419–423 Neuhaus G, Spangenberg G, Scheid OM, Schweiger HG (1987) Transgenic rapeseed plants obtained by the injection of DNA into microscope derived embryoids. Theor Appl Genet 75:30–36 Pitino M, Coleman AD, Maffei ME, Ridout CJ, Hogenhout SA (2011) Silencing of aphid genes by dsRNA feeding from plants. PLoS One 6:e25709 Potrykus I (1991) Gene transfer to plants: assessment of published approaches and results. Annu Rev Pl Physiol Mol Biol 42:205–225 Powell KS, Gatehouse AMR, Hilder VA, Gatehouse JA (1993) Antimetabolic effects of plants lectins and fungal enzymes on the nymphal stages of two important rice pests, Nilaparvata lugens and Nephotettix cinciteps. Ent Exp App 66:119–126 Pusztai A, Ewen SW, Grant G, Brown DS, Stewart JC, Peumans WJ, Van Damme EJ, Bardocz S (1993) Antinutritive effects of wheat-germ agglutinin and other Nacetylglucosamine-specific lectins. Br J Nutr 70:313–321 Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA (2013) Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152:1173–1183 Ramesh S, Nagadhara D, Reddy VD, Rao KV (2004) Production of transgenic indica rice resistant to yellow stem borer and sap-sucking insects using super binary vectors of Agrobacterium tumefaciens. Plant Sci 166:1077–1085 Rauf I, Javaid S, Naqvi RZ, Mustafa T, Amin I, Mukhtar Z, Jander G, Shahid Mansoor S (2019) In-planta expression of insecticidal proteins provides protection against lepidopteran insects. Sci Rep 9:6745 Rodrigues TB, Figueira A (2016) Management of insect pest by RNAi – a new tool for crop protection. In: Abdurakhmonov IY (ed) RNA interference. In Tech, Dubrovnik Saha P, Majumder P, Dutta I, Ray T, Roy SC, Das S (2006) Transgenic rice expressing Allium sativum leaf lectin with enhanced resistance against sap-sucking insect pests. Planta 223:1329–1343 Sanford JC (1990) Biolistic plant transformation. Physiol Plant 79:206–209 Sarmah BK, Moore A, Tate W, Molvig L, Morton RL, Rees DP, Chiaiese P, Chrispeels MJ, Tabe LM, Higgins TJV (2004) Transgenic chickpea seeds expressing high levels of amylase inhibitor. Mol Breeding 14:73–82

290

15

Prospects of Inhibitory Proteins in Imparting Insect–Pest Resistance

Schroeder HE, Gollasch S, Moore A, Tabe LM, Craig S, Hardie DC, Chrispeels MJ, Spencer D, Higgins TJV (1995) Bean alpha-amylase inhibitor confers resistance to the pea weevil (Bruchus pisorum) in transgenic peas (Pisum sativum L.). Plant Physiol 107:1233–1239 Schuler TH, Poppy GM, Kerry BR, Denholm I (1998) Insect resistant transgenic plants. Trends Biotechnol 16:168–175 Setamou M, Bernal JS, Legaspi JC, Mirkov TE, Legaspi BC Jr (2002) Evaluation of lectinexpressing transgenic sugarcane against stalk borers (Lepidoptera: Pyralidae): effects on life history parameters. J Econ Entomol 95:469–477 Shade RE, Schroeder HE, Pueyo JJ, Tabe LM, Murdock LL, Higgins TJV, Chrispeels MJ (1994) Transgenic pea seeds expressing the α-amylase inhibitor of the common bean are resistant to bruchid beetles. Biotechnology 12:793–796 Shimamoto K, Terada R, Izawa T, Fujimoto H (1989) Fertile transgenic rice plants regenerated from transformed protoplasts. Nature 338(6212):274–276 Shirani DA, Bhat S, Bhat RS, Kuruvinashetti MS (2007) Cloning of trypsin inhibitor gene from cowpea and yard long bean and transformation of tobacco. Trop Agric Res 19:1–9 Siomi H, Siomi MC (2009) On the road to reading the RNA-interference code. Nature 457:396–404 Smigocki AC, Ivic-Haymes S, Li H, Savić J, Doucet D (2013) Pest protection conferred by a Beta vulgaris serine proteinase inhibitor gene. PLoS One 8(2):e57303 Spit J, Philips A, Wynant N, Santos D, Plaetinck G, Vanden BJ (2017) Knockdown of nuclease activity in the gut enhances RNAi efficiency in the Colorado potato beetle, Leptinotarsa decemlineata, but not in the desert locust, Schistocerca gregaria. Insect Biochem Mol Biol 81:103–116 Staub JM, Maliga P (1995) Expression of a chimeric uidA gene indicates that polycistronic mRNAs are efficiently translated in tobacco plastids. Plant J 7:845–848 Stevens J, Dunse K, Fox J, Evans S, Anderson M (2012) Biotechnological approaches for the control of insect pests in crop plants. Pestic Adv Chem Bot Pestic 2012:269–308 Stoger E, Williams S, Christou P, Down RE, Gatehouse JA (1999) Expression of the insecticidal lectin from snowdrop (Galanthus nivalis agglutinin; GNA) in transgenic wheat plants: effects on predation by the grain aphid Sitobion avenae. Mol Breed 5:65–73 Svab Z, Maliga P (1993) High frequency plastid transformation in tobacco by selection for a acd A gene. Proc Natl Acad Sci USA 90:913–917 Svensson B, Asano K, Jonassen I, Poulsen FM, Mundy J, Svendsen I (1986) A 10 kD barley seed protein homologous with an α-amylase inhibitor from Indian finger millet. Carlsb Res Commun 51(7):493–500 Thakur N, Upadhyay SK, Verma PC, Chandrashekar K, Tuli R, Singh PK (2014) Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene. PLoS One 9:e87235 Thu TT, Mai TTX, Dewaele E, Farsi S, Tadesse Y, Angenon G, Jacobs M (2003) In vitro regeneration and transformation of pigeonpea [Cajanus cajan (L.) Millsp.]. Mol Breeding 11:159–168 Tiwari P, Singh P, Sabat BC, Kansal R (2016) In vitro expression of Vigna mungo protease inhibitor gene that confers resistance against Lipaphis erysimi transgenic mustard. Int J Agric Sci Res 6:135–146 Van Damme EJM, Allen AK, Peumans WJ (1987) Isolation and characterization of a lectin with exclusive specificity towards mannose from snowdrop (Galanthus nivalis) bulbs. FEBS Lett 215(1):140–144 Vandenborre G, Van Damme EJM, Ghesquière B, Menschaert G, Hamshou M, Rao RN, Gevaert K, Smagghe G (2010) Glycosylation signatures in: fishing with Lectins. J Proteome Res 9 (6):3235–3242 Vasconcelos IM, Oliveira JTA (2004) Antinutritional properties of plant lectins. Toxicon 44:385–403 Wang K, Peng Y, Jian P, Wenxi F, Wang J, Han Z (2016) Variation in RNAi efficacy among insect species is attributable to dsRNA degradation in vivo. Insect Biochem Mol Biol 77:1–9

References

291

Wilmink A, van de Ven BCE, Dons JJM (1995) Activity of constitutive promoters in various species from the Liliaceae. Plant Mol Biol 28:949–955 Wong EY, Hironaka CM, Fischhoff DA (1992) Arabidopsis thaliana small subunit leader and transit peptide enhance expression of Bacillus thuringiensis proteins in transgenic plants. Plant Mol Biol 20:81–93 Xiong Y, Zeng H, Zhang Y, Xu D, Qiu D (2013) Silencing the HaHR3 gene by transgenic plantmediated RNAi to disrupt Helicoverpa armigera development. Int. J Biologic Sci 9:370–381 Xu D, Xue Q, McElroy D, Mawal Y, Hilder VA, Wu R (1996) Constitutive expression of a cowpea trypsin inhibitor gene, CpTi, in transgenic rice plants confers resistance to two major rice insect pests. Mol Breed 2:167–173 Yarasi B, Sadumpati V, Immanni CP, Vudem DR, Khareedu VR (2008) Transgenic rice expressing Allium sativum leaf lectin (ASAL) exhibits high level resistance against major sap-sucking pests. BMC Plant Biol 8:102 Yeh KW, Lin ML, Tuan SJ, Chen YM, Lin CY, Kao SS (1997) Sweet potato (Ipomoea batatas) trypsin inhibitors expressed in transgenic tobacco plants confer resistance against Spodoptera litura. Plant Cell Rep 16:696–699 Zhang W, Wu R (1988) Efficient regeneration of transgenic plants from rice protoplasts and correctly regulated expression of the foreign gene in the plants. Theor Appl Genet 76(6):835– 840 Zhang J, Khan SA, Hasse C, Ruf S, Heckel DG, Bock R (2015) Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science 347:991–994 Zhao JZ, Shi XP, Fan XL, Zhang CY, Zhao RM, Fan YL (1998) Insecticidal activity of transgenic tobacco co-expressing Bt and CpTI genes on Helicoverpa armigera and its role in delaying the development of pest resistance. Rice Biotech Quart 34:9–10 Zhu JQ, Liu S, Ma Y, Zhang JQ, Qi HS, Wei ZJ, Yao Q, Zhang WQ, Li S (2012) Improvement of pest resistance in transgenic tobacco plants expressing dsRNA of an insect-associated gene EcR. Plos One 7:e38572 Zhu GH, Xu J, Cui Z, Dong XT, Ye ZF, Niu DJ, Huang YP, Dong SL (2016) Functional characterization of SlitPBP3 in Spodoptera litura by CRISPR/Cas9 mediated genome editing. Insect Biochem Mol Biol 75:1–9

Nutraceutical Potential of Rice Bean

16

Pulses possess excellent nutritional profile with low glycemic index, low cholesterol and fats, considerable amounts of carbohydrates, and appreciable levels of vitamins and minerals. In addition to being an explicit source of nutrients, grain legumes also provide many bioactive compounds having beneficial metabolic and/or physiological effects on the body. These bioactive compounds are also known as nutraceutical compounds (Siddhuraju and Becker 2007). The term “nutraceutical” was coined by Stephen DeFelice in the year 1989 and can be defined as “a food (or part of a food) that provides medical or health benefits, including the prevention and/or treatment of diseases”. Simply the nutraceuticals are bioactive compounds in foods that provide health benefits including prevention, protection, and treatment of diseases (Belem 1999). In view of their synergistic medicinal value, economical status, and no side effects, the nutraceuticals compounds have catch the eye of food nutritionist around the world during the last few decades as a potential substitute of present-day medicines (Raskin et al. 2002). The potential health benefits of nutraceuticals compounds are likely due to complex biochemical and cellular interactions which together promote overall health of an individual (Dillard and German 2000). The beneficial health promotion effects and increasing health consciousness of the people have been resulted in the rapid growth of nutraceutical industry. The evidences from epidemiological studies have indicated that diets rich in pulses are associated with lowering the risk of several chronic diseases, attributed to the fact that these foods supply bioactive ingredients/health-promoting nutraceuticals. Legumes have attracted food nutritionist for being a functional food ingredient. Some of the underutilized legumes such as horse gram and winged bean have also been found to possess excellent nutritive and nutraceutical value and their importance has been well recognized by traditional medicine as a potential therapeutic agent in treating various health complications such as kidney stones, urinary diseases, piles, common cold, throat infection, fever, etc. However, their potential as nutraceutical food still remain unrecognized. Due to increasing health consciousness among the people, the demand of food endowed with nutraceutical properties is

# Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_16

293

294

16

Nutraceutical Potential of Rice Bean

continuously increasing; therefore, exploitation of underutilized crops for harnessing their nutraceutical potential is imperative.

16.1

Nutraceuticals and Underutilized Legumes

The nutritional factors in pulse grains are considered critical for human nutrition. Studies have indicated that in routine diets, legumes should be the main ingredient along with the cereals owing to their richness in protein and other bioactive compounds. The predominant bioactive components in underutilized legume and their associated affects have been discussed subsequently.

16.1.1 Proteins and Peptides Legumes have been known to possess high amount of proteins. Beside this these legumes also retain proteins having some biological activity, valuable in view of human health such as Vigna angularis having angularin protein; Vigna unguiculata having α-antifungal protein, β-antifungal protein, and unguilin; Vigna umbellata having delandin and antifungal peptide (5 kDa); and Vigna sesquipedalis (ground bean) having lectin (60 kDa) (Katoch and Tripathi 2017). Among therapeutic proteins, α-antifungal protein and β-antifungal protein act on α- and β-glucosidases enzyme and inhibit the digestion of carbohydrates and act as antidiabetic agent. These proteins also have the potential for the treatment of AIDS patients with no adverse effects as compared to synthetic drugs.

16.1.2 Minerals and Vitamins Legumes are good source of minerals and vitamins which play vital role in the continuation of various metabolic processes inside the body. Minerals like selenium along with other act as a cofactor for many enzymatic reactions. Vitamins such as thiamin, riboflavin, pyridoxine, and folic acid are also present in appreciable quantities in legumes which act as coenzyme in many enzymatic reactions. In absence of minerals and vitamins, many regulatory enzymes become inactive and affect the various metabolic processes. Some vitamins like vitamin E, C, and K are present in trace amount in legumes. Vitamin E and C are known to play a role as an antioxidant and inhibit the oxidation of vitamin A in the gastrointestinal tract. These are also believed to maintain the stability of cell membranes. Vitamin K functions primarily in the liver where it is necessary for the formation of blood clotting factors.

16.1

Nutraceuticals and Underutilized Legumes

295

16.1.3 Dietary Fiber Legumes are good source of dietary fiber. It involves the portion of plants which is not easily digested. Lower gut bacteria metabolize the dietary fiber and produce short-chain fatty acids (SCFA) such as acetic, propionic, and butyric acids having many important physiological functions. Propionic acid and acetic acids are metabolized in the liver to provide energy, whereas propionate acts as a natural HMG-CoA reductase inhibitor and is responsible for lowering the cholesterol level in human gut. Butyric acid provides an important energy source for the cell lining of the colon and has been shown to possess impressive anticancer activity which is useful in the treatment of ulcerative colitis and colon cancer. Fiber-rich foods improve serum lipoprotein values, reduce blood pressure, and improve the blood glucose level for diabetic individuals. Fiber itself has no calories yet provides a “full” feeling because of its water-absorbing ability.

16.1.4 Oligosaccharides Indigestible substances especially flatulence-causing oligosaccharides (α-galactosides, e.g., raffinose, stachyose, verbascose, and ajugose) are usually present in legume seeds. These are low-molecular weight, nonreducing, and watersoluble sugars which constitute 53% of total soluble sugars. Sucrase and α-galactosidase are two enzymes required for the digestion of oligosaccharides as these are not digested in the intestine of monogastric animals due to the absence of endogenous enzymes (α-galactosidase). This enzyme is necessary to break α-(1-6) glycosidic linkages. Intestinal microflora has α-galactosidase enzyme which can digest oligosaccharides. They favor the intensive anaerobically bacterial fermentation (can promote the growth of Bifidobacteria) which produces considerable quantities of short-chain fatty acids that are the source of energy for cell lining of intestinal mucosa and also produce CO2 and methane (CH4) which cause flatulence. They can also reduce the transit time and promote the growth of Bifidobacteria and used as prebiotic agent. Oligosaccharides have also been shown beneficial physiological properties like anticarcinogenic, antidiabetic, and anti-cardiovascular with higher rate of mineral absorption which is beneficial in view of human health.

16.1.5 Saponins Saponins are secondary plant metabolites, from stable, soap-like foams in aqueous solutions, containing a carbohydrate moiety (mono/oligosaccharide) linked to a hydrophobic aglycone (sapogenin), which may be steroidal or triterpenoid in nature. Though saponins are anti-nutrient and reduce nutritive value of pulses, but these appear to be beneficial by showing different pharmacological properties including expectorant, anti-inflammatory, vasoprotective, hypocholesterolemic, immunomodulatory, hypoglycemic, molluscicidal, antifungal, and antiparasitic activities.

296

16

Nutraceutical Potential of Rice Bean

Saponins have also shown effective in treating colon cancer. Intestinal microorganisms metabolized bile acid to form secondary bile acids and cause colon cancer. Saponins can reduce the formation of carcinogenic substances in the colon by binding with bile acid and reducing its availability to microbial population. As they may bind with cholesterol or bile acids, thereby this binding increases the fecal cholesterol excretion. Therefore, saponins are responsible for lowering the cholesterol level in the body and are important in human nutrition by reducing the risk of heart diseases.

16.1.6 Phytic Acid Phytic acid salts are known as phytates which regulate the various cellular functions including DNA repair, chromatin remodeling, endocytosis, nuclear messenger RNA export, and potentially hormone signaling which is crucial for plant and seed development. Phytic acid also plays important roles in plant metabolism, stress, and pathogen resistance. They have also shown beneficial in human diets by acting as anticarcinogen. Phytic acid may play important role via reducing level of cholesterol and lipids in serum and thus reduce the risk of heart disease, while both exogenous and endogenous phytic acid may have hypoglycemic effects and thus be of consequence in diabetes.

16.1.7 Phenolic Compounds In legume seeds, phenolic compounds act as antioxidants because of their ability to chelate metal ions, inhibit lipid peroxidation, and scavenge free radicals. Phenolic compounds found in legume seed are mainly tannins, phenolic acids, anthocyanins, and flavonoids. Polyphenolic compounds are also responsible for the color of legume seeds, and dark colored and highly pigmented seeds have reported to have high phenolic content. The phenolic content of legume seeds is associated with its antioxidant activity. Phenolic compounds in legume seeds show antibacterial, antiviral, anti-inflammatory, and anti-allergenic activities. The nutraceutical activity of phenolic compounds is mainly due to their antioxidant potential. Antioxidants scavenge free radicals and reactive oxygen species and play a vital role in inhibiting the oxidative mechanisms leading to chronic diseases. One significant example of failure of antioxidant machinery is diabetes where cells of patients are under oxidative stress with a striking imbalance between free radical-generating and radical scavenging capacities. The increased free radical production and reduced antioxidant defense may mediate the initiation and progression of diabetic complications in the body.

16.1

Nutraceuticals and Underutilized Legumes

297

16.1.8 Flavonoids and Isoflavones These are also secondary metabolites of plants with polyphenolic structure. Common flavonoid groups include aurones, xanthones, and condensed tannins. Flavonoids act as an antioxidant and prevent many diseases such as cancer, inflammation, autoimmune diseases, cataract, arteriosclerosis, and aging. Legumes produce large amounts of several isoflavones isoforms with antimicrobial action which play an important role in plant protection. Isoflavones consist of daidzin, daidzein, and genistein. In gastrointestinal tract, daidzin and genistin are metabolized into daidzein and genistein by β-glucosidase enzyme. Isoflavones also have antioxidant activity and act as agonist of estrogen in mammals. There are many biological activities associated with the isoflavones such as reduction in osteoporosis, prevention of cardiovascular disease and cancer, and for the treatment of menopause symptoms. Genistein is potent inhibitor of protein tyrosine kinase enzyme, which can arrest the cell cycle and cause apoptosis of leukemic cells to prevent cancer.

16.1.9 a-Amylase Inhibitor Obesity is a complex disease with serious consequences. Legumes are rich in protein as compared to carbohydrates and fats. So protein-rich food is beneficial for maintaining body weight. Legumes also contain α-amylase protein inhibitors valuable for the prevention and therapy of obesity and diabetes. α-amylase inhibitor binds with porcine pancreas α-amylase enzyme (which act on starch and hydrolyze it into mixture of small oligosaccharides like maltose, maltotriose, and oligoglucans), delays carbohydrate absorption, and results in reduction of peak postprandial plasma glucose concentrations in the blood.

16.1.10 Tannins Because of the ability of tannins to bind with proteins, tannins can be used for removing some toxins from the intestine. However, these complexes (tannin–toxin) are unstable and therefore should be removed very fast because of danger of degradation and absorption. Tannin could also inhibit the growth of bacteria that cause tooth decay, thereby tannins can also be useful in keeping hygiene of the mouth. The tannin-protein complexes (e.g., tanalbine) have been utilized in human and animal medicine as a prophylactic substance, styptic agent, and antidiarrheal drug. Tannins also have positive role in limiting the parasitic invasions and reduction of the pathogens activity.

298

16

Nutraceutical Potential of Rice Bean

16.1.11 Lectins Lectins may be beneficial by stimulating gut function, limiting tumor growth, and ameliorating obesity. In certain diseases lectins can identify altered structural profiles of glycans which involves enhanced sialylation, increased branching pattern of complex sugars, and fucosylation. Due to this property, lectins act as valuable disease biomarkers. Lectins also manifest with antitumor, immunomodulatory, antimicrobial, and HIV-1 reverse transcriptase inhibitor activities, which may find applications in many therapeutic areas.

16.2

Rice Bean: A Nutraceutical Legume

The current recent research has revealed that legumes possess antioxidant properties which are mainly attributed to the presence of bioactive compounds. Rice bean is a potential underutilized legume holding potential to be served as a nutraceutical food owing to the presence of different bioactive components. In spite of the scanty literary evidences on the role of rice bean for disease prevention, its prospects of imparting health benefit are fairly extensive. This legume is a treasure house of recuperative properties due to the richness of proteins, dietary fiber, macro-, and micronutrients, and beneficial phytochemicals are essential for maintaining human health (Fig. 16.1). In the recent years, there has been increased awareness about functional foods and nutraceuticals possessing various bioactive substances.

16.2.1 Polyphenols in Rice Bean Several phytochemicals act as dietary antioxidants to protect diseases caused by oxidative damage of cellular molecules. In recent years, with the advent of nutraceutical concept and increased health consciousness among the masses, prevention of diseases in natural ways through healthy foods has gained huge attention. Richness in bioactive compounds like polyphenols suggests the use of rice bean as an alternate functional food. Phenolic acids and flavonoids including p-coumaric acid, ferulic acid, sinapic acid, catechin, epicatechin, vitexin, isovitexin, and quercetin are the major antioxidant present in rice bean seeds (Fig. 16.2). Yao et al. (2012) studied different rice bean genotypes for level of different phenolic acids and reported the dominance of vitexin followed by catechin and isovitexin in rice bean seeds. In the study, the highest vitexin and isovitexin contents were both found in the D-90 variety (401.84 μg/g and 190.29 μg/g, respectively) (Table 16.1). The dominance of these phenolic acids has also been observed in adzuki bean. For catechin levels, the highest was found for the genotype D-958, which was 7.40 times higher than the lowest level found for the genotype D-809. The level of epicatechin, p-coumaric acid, ferulic acid, sinapic acid, and quercetin concentrations in rice bean seeds has been found similar to each other. The level of total of phenolic compounds in rice bean seeds ranges from 123.09 μg/gm to 843.75 μg/gm, whereas total phenolic

16.2

Rice Bean: A Nutraceutical Legume

299

Nutrients and bioactive components of rice bean

Functional properties

Therapeutic properties

Proteins and peptides (Albumins, globulins, Protamines and delandin)

High proportional of essential amino acids

Reduce protein energy malnutrition and increase lean muscle mass and natural

Carbohydrates (Resistant starch, free sugars and oligosaccharides)

Slow and gradual digestibility

Antidiabetic and prevent colorectal cancer

Lipids (Essential fatty acids)

Phytosterol esters

Antiulcer activity and prevent acute ulceration

Dietary fiber

Reduction in serum cholesterol and glucose level

Decrease the risk of cardiovascular disease and gastrointestinal disorder and constipation

Secondary metabolites (Polyphenols, saponins, and tannins)

Antioxidant and free radical scavenging activities

Positive cardiovascular effects, protection from UV radiation, ageing, immunodeficiency diseases

Enzyme inhibitors (Bowman Birk inhibitor, αAmylase inhibitor, αglucosidase inhibitor)

Anti-inflammatory and antidiabetic activities

Treatment of ulcerative colitis and regulation of glucose concentration in blood

relaxant, antimicrobial activity

Fig. 16.1 Therapeutic potential of rice bean imparted by different bioactive components and nutrients

content and total flavonoids range from 3.27 mg gallic acid equivalents to 6.43 mg gallic acid equivalents (GAE)/g) and 55.95 mg catechin (CE)/g to 320.39 mg catechin (CE)/g, respectively (Figs. 16.3 and 16.4). Rice bean contains more total phenolic content than soybeans (1.57–5.57 mg GAE/g), chickpeas (0.98 mg GAE/gm), yellow peas (0.85–1.14 mg GAE/g), green peas (0.65–0.99 mg GAE/g), lentils (21.9 mg GAE/g), and red kidney bean (18.8 mg GAE/g) which confirms the superiority of rice bean in nutraceutical value from other commonly consumed pulses (Bhagyawant et al. 2019; Djordjevic et al. 2011). The pigmented seeds of legumes contain higher total phenolic content than the light-colored seeds. The seed coat of legumes is rich in phenolic compounds, although it represents approximately 10% of the total seed weight. The total phenolic content varies in different legumes which might be due to difference in geographical conditions and locations of the cultivars. The total phenolic content of lentils ranges from 3.04 to 4.54 mg CE/g; common beans from 0.92 to 4.24 mg CE/g; yellow pea from 0.09 to 0.17 mg CE/g; green pea from 0.05 to 0.15 mg CE/g; and soybean from 1.06 to 4.04 mg CE/g which is lower than the total flavonoid content in rice bean. Among the hydroxycinnamic acids, ferulic acid is present in higher amounts in rice bean seeds, ranging from 11.57 to 78.32 μg/g followed by p-coumaric acid and sinapic acid (Table 16.1).

300

16

Nutraceutical Potential of Rice Bean

Fig. 16.2 Major polyphenolic compounds in rice bean Table 16.1 Major nutraceutical compounds and their effects Nutraceutical compounds Protein and peptides (angularin, delandin, and unguilin) Minerals and vitamins Fiber Oligosaccharides Saponins Lectins Phytic acid Polyphenolic compounds Flavonoids, isoflavones (phytoestrogens) Amylase inhibitors Source: Singh and Basu (2012)

Health beneficial effects Anti-HIV activity Antioxidant activity Lower cholesterol level and reduce colon cancer Reduce colon cancer and act as prebiotics Hypocholesterolemic effect and anticarcinogenic May help in obesity treatment and tumor growth Hypocholesterolemic effect and anticarcinogenic activity Risk factors for menopause, coronary heart disease, and anti-carcinogenic Act as antioxidant and anticarcinogenic Reduces utilization of dietary starch, potentially therapeutic in obesity and diabetes

16.2

Rice Bean: A Nutraceutical Legume

301

8

Total phenolic acid (mgGAE/g)

7 6 5 4 3 2 1 0 D-318 D-708 D-294 D-874 D-955 D-958 D-699 D-909 D-1152 D-310 D-329 D-809 D-651

Genotypes

Fig. 16.3 Variation in total phenolic acid content (mgGAE/g) in rice bean genotypes

Total flavonoids (mgCE/g)

400 350 300 250 200 150 100 50 0 D-318 D-708 D-294 D-874 D-955 D-958 D-699 D-909 D-1152 D-310 D-329 D-809 D-651

Genotypes

Fig. 16.4 Variation in total flavonoids (mgCE/g) in rice bean genotypes

The level of ferulic acid in rice bean seeds is higher than the level of ferulic acid in green lentil (10.10 μg/g), pinto bean (11.80 μg/g), and black cowpea seeds (26.25 μg/g). The level of p-coumaric acid is also higher than the raw lentil (7.51 μg/g) and green lentil (37.30 μg/g). Rice bean stands parallel to adzuki bean in having similar amount of p-coumaric acid (31.30 μg/g). These hydroxycinnamic acid-derived compounds are acknowledged for free radical scavenging capacity, metal-chelating activity, and an ability to inhibit lipid peroxidation and pro-oxidative enzymes (Koleckar et al. 2008). Bhagyawant et al. (2019) investigated antioxidant potential of different rice bean genotypes and reported that the DPPH-free radical scavenging activity was observed in a range of 9.36–18.57% with 13.14% of mean free radical scavenging activity in entire accessions understudy. The difference in the antioxidant potentials of different rice bean accessions was attributed to the presence of condensed tannins and phytic acid. Tannins show high antioxidant activity as they possess high molecular weight with high degree of hydroxylation to aromatic rings. It provides free radical scavenging activity against superoxide radicals, hydroxyl radicals, and nitric oxide. It has the ability to donate electron to a free radical and make it stable (Barrett et al. 2018; Koleckar et al. 2008). In addition, environmental factors including soil, time of

302

16

Nutraceutical Potential of Rice Bean

50 40 30 20 10 65 1 D-

80 9 D-

32 9 D-

31 0 D-

90 9

11 52 D-

D-

69 9 D-

95 8 D-

95 5 D-

87 4 D-

29 4 D-

D-

D-

70 8

0 31 8

DPPH activity (μM TE/g)

60

(Genotypes)

Fig. 16.5 Variation in antioxidant potential of rice bean genotypes

harvest, temperature, and postharvest management affect the antioxidant capacity of phenolic compounds. Yao et al. (2012) evaluated the antioxidant potential of rice bean extracts by measuring their DPPH radical scavenging activities (μM Trolox Equivalent/g) and the antioxidant values ranged between 39.87 μM TE/g and 46.40 μM TE/g which is comparable to the other well-stablished legumes (Fig. 16.5). The highest antioxidant activity was observed for the genotype D-874 (46.40 μM TE/g) followed by D-310 (46.29 μM TE/g), D-909 (46.20 μM TE/g), and D-708 (45.76 μM TE/g). They also established a positive correlation between antioxidant activity and the total phenolic and total flavonoid contents in rice bean seeds. A similar trend has also been observed by Yao et al. (2010) who investigated seven colored grains of rice bean and found a positive correlation between antioxidant activity and total phenolic content. Rice bean and adzuki bean have a similar color of seed coats. Lin and Lai (2006) have reported that adzuki bean seed coats mainly contained proanthocyanidins, which are a group of polyphenolic flavonoids that contribute to the high antioxidant abilities. It has been reported that the phenolic content in rice bean is affected by differences between various cultivars which are likely due to genotypic and environmental differences including location, UV-B irradiation, and diseases and pest exposure. A detail of phenolic acids in different rice bean genotypes has been given in Table 16.2.

16.2.2 Variation of Phenolic Content in Seed Coat, Whole Seed, Dehulled, and Cooked Rice Bean Dhal There is growing interest in the dietary intake of natural antioxidants as a way of preventing different health problems related to oxidative stress, such as inflammation, neurodegenerative diseases, cancer, cardiovascular diseases, etc. (Halliwell and Gutteridge 1990). The variation in phenolic content is known to be due to genetic factors, the degree of maturity and environmental conditions. Secondly, extractability of different phenolic compounds is governed by the type of solvent (polarity)

p-Coumaric acid (μg/g) 5.67
0.49 17.84
1.28 16.58
1.48 31.25
2.41 21.74
1.92 25.32
1.47 20.09
2.21 39.72
2.69 28.15
2.45 21.36
1.40 19.73
2.10 15.40
1.07 11.29
1.14

Ferulic acid 11.57
0.96 13.20
1.32 28.15
1.45 49.71
2.48 25.30
1.93 31.48
2.10 54.63
1.48 78.32
3.50 19.65
1.29 21.08
1.46 41.15
2.21 48.07
2.08 35.86
2.74

Sinapic acid nd 17.21
1.24 19.68
1.53 21.35
1.64 17.33
1.38 18.29
2.53 25.32
1.29 27.35
1.97 8.42
0.86 31.08
1.98 11.27
1.27 8.16
0.75 8.41
0.86

Catechin 53.48
3.29 142.19
8.96 78.51
5.47 132.68
11.20 69.33
5.42 182.64
12.03 89.72
4.12 68.53
3.95 43.59
6.87 175.39
14.2 54.28
8.60 24.76
1.29 101.17
8.39

Source: Yao et al. (2012); data presented in mean
SD; nd not determined

Genotype D-318 D-708 D-294 D-874 D-955 D-958 D-699 D-909 D-1152 D-310 D-329 D-809 D-651

Table 16.2 Variation in phenolic acids in rice bean Epicatechin nd 4.37
0.48 6.89
0.96 11.24
1.04 1.35
0.24 5.49
0.79 7.13
0.65 2.29
0.11 nd 9.77
0.72 4.68
0.38 7.10
0.56 nd

Vitexin 26.46
1.92 30.68
1.84 nd 33.13
1.64 30.64
1.88 40.16
1.29 192.53
16.68 401.84
21.57 250.71
17.62 186.39
18.19 nd 73.81
2.81 232.92
17.16

Isovitexin 7.45
0.68 nd 0.43
0.03 27.08
1.59 118.04
15.75 nd 105.34
8.74 190.29
3.69 271.97
9.98 33.27
1.08 23.99
1.31 18.85
0.46 143.11
5.51

Quercetin 18.46
1.25 27.15
2.13 10.77
0.98 26.53
1.63 35.46
2.35 29.31
2.47 12.35
1.08 35.41
2.84 24.63
2.36 17.1
1.28 nd 30.54
2.69 nd

16.2 Rice Bean: A Nutraceutical Legume 303

304

16

Nutraceutical Potential of Rice Bean

used degree of polymerization of phenolics, the interaction of phenolics with other food constituents, as well as the extraction time and temperature (Marathe et al. 2011; Oomah et al. 2011). Environmental factors such as growing season, soil type, temperature, seed variety, and agronomic practices have also been found to significantly affect the phytochemical compositions. In recent years the phenolic contents and antioxidant activities in different components of legume seeds have been extensively studied. However, the report from the level of phenolic content and antioxidative properties is scanty. Rani and Khabiruddin (2017) determined the chemical composition and antioxidant activity of whole seeds, seed coats, and de-coated raw and cooked dhal of rice bean and observed a significant correlation with antioxidant properties and the phenolic contents. The detailed description of phenolic content and antioxidant properties in seed coat, whole seed, and dehulled and cooked rice bean (dhal) is given under the following subheads.

16.2.2.1 Seed Coat Seed coat constitutes approximately 8–10% of the seed mass and is considered to be important by-products of the pulse crop processing. Rice bean seed coat contains 103.62 mg GAE/gm total phenolics which are considerably higher than the total phenolic content in the seed coat of faba bean (45.60–107.60 mg GAE/g). Similar to the total phenolic content the level of ortho-dihydric phenolic and hydrophilic phenolic content is also higher in seed coat (42.35 mg COEg1, 53.09 mg GAE/g, respectively) (Fig. 16.6). In rice bean seed coat the total phenolic content is 49% (w/ w) and 51% (w/w) of hydrophobic and hydrophilic phenols (ratio of approx. 1:1, w/ 110 100 90 80 70 60 50 40 30 20 10 0 Yield (%) of methanolic extracts

Total phenolics (mg Total o-dihydric Hydrophilic phenols GAE/g) phenols (mg COE/g) (mg GAE/g) Seed Coat

Dehusked Dal

Cooked Dhal

Flavonoids (mg CAE/g)

Whole Seed

Fig. 16.6 Phytochemical constituents of seed coat, whole seed, and dehulled and cooked rice bean dhal (Source: Rani and Khabiruddin 2017)

16.2

Rice Bean: A Nutraceutical Legume

305

w), respectively. A positive correlation has been observed between total phenols, hydrophobic phenols, and antioxidant activity (82%) (Fig. 16.5). Rice bean seed coat contains 25.32 mg CAE/g which is higher than the flavonoid content in the seed coat of faba bean seeds (5.30–17.50 mg RE/g). Due to these attributes rice bean legume parallels with other legumes in nutraceutical value.

16.2.2.2 Whole Seed The phenolic content in whole rice bean seed is 52.15 mg GAE/mg which is composed of 60% and 40% (w/w) for hydrophilic (31.26 mg GAEg1) and hydrophobic (20.88 mg GAEg1) phenols, respectively. The whole seed contains about 32.32 mg COE/g and 30.19 mg CAE/g ortho-dihydric phenolic content and flavonoid content (Fig. 16.6). In methanolic extract of whole seed, the antioxidant activity has been 77.60%. 16.2.2.3 Dehusked Dhal Dehusking refers to the removal of the seed coat by physical and chemical means. It is an essential step in legume processing. Due to dehusking the relative amount of total phenols is generally low (45.10%) in comparison with whole seed. On dehusking the level of ortho-dihydric phenolic, hydrophilic, and hydrophobic phenolic contents is found 30.57 mg COE/g, 32.23 mg GAE/g, and 12.87 mg GAE/g (Fig. 16.6). Dehusking also increases the total flavonoid content (33.66 mg CAE/gm) in rice bean in comparison with the whole seed. Because of removal of seed coat, the antioxidant activity in dehusked dhal is observed to the value of 73.34%. In case of raw dhal extract the total phenolic content is consist of 29% (w/w) and 71% (w/w) of hydrophobic and hydrophilic phenols, respectively (Fig. 16.6). 16.2.2.4 Cooked Seeds (Dhal) Cooking is referred as the heat processing of seeds. It has been observed that the phenolic content in seeds reduces after heat processing. Segev et al. (2010) reported 85% decrease in total phenolics by cooking in Kabuli chickpea. Similarly, Hwang et al. (2012) found that heat processing significantly decreased the ascorbic acid content, total phenolics, and antioxidant levels compared with the other cooking methods. In cooked rice bean seeds (dhal), the level of total phenolic content, flavonoids. and ortho-dihydric phenolic content were 21.95 mg GAE/g, 15.80 mg CAE/g, and 9.92 mg COE/g, which is significantly lower than the phenolic content in seed coat and dehusked and whole seed (Fig. 16.6). The cooked dhal extract possesses 12.12 mg GAEg1 hydrophobic (55%, w/w) and 9.82 mg GAEg-1 hydrophilic phenols (45%, w/w) (Fig. 16.6). The methanolic extracts of cooked dhal showed 67.60% antioxidant activity corresponding to 0.43 mg/ml radical scavenging efficiency against DPPH (Fig. 16.7).

306

16

Nutraceutical Potential of Rice Bean

0.5

DPPH radical scavenging assay EC 50(mg/g extract)

0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 Seed Coat

Dehusked Dal

Cooked Dhal

Whole Seed

Fig. 16.7 Antioxidant activity of seed coat, whole seed, and dehulled and cooked rice bean dhal

16.2.3 Dietary Fiber Rice bean seeds are rich source of dietary fiber. Dietary fiber refers to all polysaccharide which is resistant to digestion and absorption in small intestine but complete and partial fermentation in large intestine (Prosky and DeVries 1991). It includes oligosaccharides, such as inulin, and resistant starches (Jones et al. 2006). Major dietary fiber includes cellulose, hemicelluloses, pectin, arabinoxylans, beta-glucan, glucomannans, plant gums, and mucilages and hydrocolloids, which are principally found in the plant cell wall (Cummings and Stephen 2007). In rice bean seeds, the fiber content has been found higher in seed coat fractions (12.60%) in comparison with other seed components (Katoch 2011). Furthermore, seed coat fractions of legumes with high fiber and low protein may be valuable in the formulation food products to improve gastrointestinal health and satiety changes (Sreerama et al. 2010). In human being, fibers primarily act on gastrointestinal tract, affecting different physiological effects like alteration of the gastrointestinal transit time, satiety changes, influence on the levels of body cholesterol, after-meal serum glucose and insulin levels, flatulence, and alteration in nutrient bioavailability (Lajolo et al. 2001). The main bioactive functions that have been attributed to dietary fibers are reduce constipation, modulation of blood glucose level (Redgwell and Fischer 2005; Spiller 2001), cholesterol reduction, prebiotic effects, prevention of certain cancers (Redgwell and Fischer 2005; Spiller 2001), cardiovascular diseases (CVD), diverticulosis, obesity (Spiller 2001) and lower blood pressure (Brand et al. 1990). Similarly, Sharma and Kawatra (1995) also reported that soluble fiber also decreases serum cholesterol, reducing the risk of heart attack and colon cancer. Insoluble

16.2

Rice Bean: A Nutraceutical Legume

307

dietary fiber is required for normal, lower intestinal function in humans (Anderson et al. 1994).

16.2.4 a-Amylase Inhibitor and a-Glucosidase Inhibitor Diabetes mellitus (DM) is a chronic disease caused by inherited or acquired deficiency in insulin secretion and by decreased responsiveness of the organs to the secreted insulin. Such a deficiency results in increased blood glucose level, which in turn can damage to vital organs. One of the therapeutic approaches is to suppress the postprandial hyperglycemia, by inhibiting of α-amylase and α-glucosidase enzymes. αα -amylases are hydrolytic enzymes which catalyze the hydrolysis of α-1, 4-glycosidic linkage in sugar polymers which is important for converting complex sugar polymers into simpler units. α-amylase inhibitor prevents digestion and absorption of dietary starch in the body. This could be useful for reducing chronic hyperglycemia resulting from defects in secretion of insulin from pancreas. α-glucosidase hydrolyzes terminal nonreducing (1 ! 4)-linked α-glucose residues to release a single α-glucose molecule. α-glucosidase is a carbohydrate–hydrolase that releases α-glucose. β-glucose residues can be released by glucoamylase, a functionally similar enzyme. α-glucosidase inhibitors are glucose-lowering agents that specifically inhibit α-glucosidases in the brush border of the small intestine and thereby play important role in digestion and absorption of carbohydrates and consequently suppress the postprandial hyperglycemia. The interest in glucosidase inhibitors is increasing because of its implications for the management of diabetes mellitus. Diabetes mellitus is a serious metabolic disorder that affects approximately 4% of the population worldwide. The presence of α-amylase inhibitor and α-glucosidase inhibitor in rice bean seeds make this crop valuable for treating diabetes. Katoch and Jamwal (2013) reported that α-amylase inhibitor (α-AI) activity in rice bean seeds varied from 7529 (IU/g) to 10,766 (IU/g) in different rice bean genotypes. In another study, Yao et al. (2012) reported that α-glucosidase inhibitory activity in rice bean ranged from 44.32% to 68.71% (Fig. 16.8). In the study, the genotype D-310 was most active (68.71%) followed by the D-294 variety (66.06%). Rice bean and adzuki bean share close association with each other in different attributes. Itoh et al. (2004) investigated the antidiabetic effects of adzuki bean on streptozotocin (STZ)-induced diabetic rats and suggested that the active fraction of adzuki bean suppresses the postprandial blood glucose by inhibiting α-glucosidase. The rice bean could reveal similar effects as in case of adzuki bean in treating diabetes. The α-glucosidase inhibition activity and phenolic content in rice bean are not correlated with each other and the inhibitory effect on the α-glucosidase may be attributed to other non-phenolic compounds. The selection of appropriate processing method of food legumes before consumption is a very important aspect for harvesting the beneficial effects of different phytoconstituents. Different processing

308

16

Nutraceutical Potential of Rice Bean

80

α-glucoside inhibition (%)

70 60 50 40 30 20 10 0 D-318 D-708 D-294 D-874 D-955 D-958 D-699 D-909 D-1152 D-310 D-329 D-809 D-651

Genotypes

Fig. 16.8 A-glucosidase inhibition activities in rice bean (Source: Yao et al. 2012)

method may alter the phenolics and flavonoids present in pulses which ultimately affects their antioxidant properties.

16.2.5 Saponins Triterpenoid and steroidal glycosides, referred to collectively as saponins, are bioactive compounds present naturally in many plants. They have considerable potential as pharmaceutical and nutraceutical agents. The total saponins in rice bean are in the range of 0.30–0.70% (Kitagawa et al. 1983); however, variations to these values have also been observed in different genotypes. Some compounds belonging to triterpenoid saponin such as azukisaponins I, II, III, IV, V, and VI, sophoradiol, soyasapogenol b, gypsogenic acid, etc. have also been isolated from rice bean (Yan 2012) (Fig. 16.9). These compounds have anti-inflammation, antiviral, hepatoprotective activity. Cardiovascular disorders has emerged worldwide as an ubiquitous cause of morbidity. Metabolic risk factors like hypertension, cholesterol abnormalities, central obesity, and an increased risk for blood clotting further intensify the risk of cardiovascular diseases. As saponin have hypocholesterolemic, anticoagulant, anticarcinogenic, hepatoprotective, hypoglycemic and antioxidant activity thereby these saponins from different sources including rice bean could provide a remedy for the treatment of cardiovascular diseases.

16.2.6 Advanced Glycation End Products (AGEs) Inhibitors The nonenzymatic binding of sugars to proteins alters the structure and function of proteins and leads to formation and accumulation of advanced glycation end products (AGEs). The accumulation of AGEs in the body contributes to the onset and progression of diabetic complications, osteoporosis, and lifestyle-related

16.2

Rice Bean: A Nutraceutical Legume

309

Fig. 16.9 Adzuki saponins isolated from rice bean

diseases such as arteriosclerosis. In vivo glycation represents a risk factor for accelerated aging and is known as glycation stress, a topic of recent interest. Mitigation of glycation stress to inhibit accumulation of AGEs is probably playing important role in prevention of diseases. Natural products have been evaluated as AGE inhibitors showing strong inhibitory activities against the formation of AGEs. The inhibitory effects of most of plant extracts on the formation of AGEs is mainly contributed by phenolic antioxidants present in them. As free radicals are involved in the formation of AGEs, it is reasonable to expect that phenolic antioxidants could inhibit the formation of AGEs and subsequent inhibition of modification of proteins, which is a major mechanisms for mediating their anti-glycation activities. BSA-glucose and BSA-MGO models provide a useful tool for assessing the effects of various compounds on the nonenzymatic glycation process. Yao et al. (2012) evaluated the antidiabetic potential of rice bean by estimating the inhibition of formation of glycation end products and reported glycation end products formation inhibition activity in rice bean ranging from 34.11% to 75.75% (Fig. 16.10). The inhibition ability of the D-1152 variety was above 65% in both of the BSA-glucose and BSA-MGO assays (Fig. 16.10a, b). The close relation between inhibition of glycation product inhibition and polyphenolic content in rice bean was established. The inhibition of glycation products is mainly due to the inhibition of free radical generation in the glycation process and subsequent inhibition of protein modification. The above data supports that rice bean could be a valuable food

310

16

Nutraceutical Potential of Rice Bean

80 70

BSA-Glucose (%)

60 50 40 30

20 10 0 D-318 D-708 D-294 D-874 D-955 D-958 D-699 D-909 D-1152 D-310 D-329 D-809 D-651

Genotypes

(a) 80 70 BSA-MGO (%)

60

50 40 30 20 10 0 D-318 D-708 D-294 D-874 D-955 D-958 D-699 D-909 D-1152 D-310 D-329 D-809 D-651

Genotypes

(b)

Fig. 16.10 (a and b) AGEs inhibition activities of rice bean (Source: Yao et al. 2012)

ingredient in making diet healthier and coping with the risk of various diabetic complications and other diseases.

16.3

Rice Bean in Traditional Chinese Medicinal System

The nutraceutical potential of rice bean has been exploited in traditional Chinese medicinal system. In Chinese traditional medicine system rice bean was first recorded in the Classic of the Materia Medica (Shennong Bencao Jing), which is the earliest Chinese pharmacy monograph published 2000 years ago. As a diuretic, this legume is good for mitigating the edema caused by the heart, liver or kidney problems. Due to its richness in flavonoids and polyphenols, rice bean also serves as an important source of dietary antioxidants and healthy weight loss products such as scavenging oxygen-free radicals, reducing the elevated blood pressure, suppressing the postprandial blood glucose level, suppressing the serum cholesterol levels, lowering serum triglyceride concentrations, etc. (Itoh et al. 2004; Mukai and Sato 2009; Nishi et al. 2008). Furthermore, rice bean extract possesses hepato-protection, anti-inflammation, anticancer, enhancing immunity, contraception, inhibition of

16.3

Rice Bean in Traditional Chinese Medicinal System

311

trypsin activity, and estrogenic effects (Han et al. 2004). The consumption of rice bean induces dieresis and counteracts toxicity. As a traditional Chinese herbal medicine, rice bean has therapeutic potential by internal or external taking. Internal taking most act as compatibility with other herbs based on theory of traditional Chinese medicine or as dietetic therapy in purpose of adjuvant function. One of the commonly proved recipes is Mahuang Lianqiao Chixiaodou decoction. It shows significant effects on hepatobiliary diseases, i.e., chronic hepatitis, acute icteric hepatitis, and cirrhosis ascites, and on nephropathy, such as acute or chronic nephritis, proteinuria, and nephrotic syndrome with pleural effusion. In addition, this decoction is also used in all kinds of edema, allergic dermatosis, lower limbs dermal vasculitis, anal-intestinal diseases, and so on. A clinical study conducted on 121 patients with allergic dermatosis revealed the therapeutic effect of Mahuang Lianqiao Chixiaodou decoction was better than that of terfenadine (Han 2010). A clinical observation about 91 patients with chronic nephritis also revealed that supplementing Mahuang Lianqiao Chixiaodou decoction was able to improve significantly patient’s clinical symptoms and reduce urine protein (Qiang et al. 2008). It was reported that this decoction could assist related Western medicine and improve treatment effect (Lu et al. 2007). A decoction of rice bean and rice bean leaves is taken orally to treat frequent urination. A decoction of rice bean leaves can also be used to treat enuresis (more commonly known as bed-wetting. Nocturnal enuresis, or bed-wetting at night, is the most common type of elimination disorder). A decoction of rice bean is taken orally to treat caked breasts (or galactostasis). The crucian cooked with fresh Phytolacca acinosa root and Vigna umbellata seeds are taken on an empty stomach to treat edema (swelling caused by fluid retention). Powdered Illicium anisatum leaves, Vigna umbellata seeds, and bitter wine are mixed and applied externally to treat acute mastitis. Brushing teeth with rice bean powder helps to relieve toothache. Rice bean (soaked in vinegar) is dried and pounded for oral taking to treat bleeding caused by hemorrhoids. For external use, appropriate quantity of rice bean is ground into powder and mixed with water to reduce exudation and remove swelling. It is clinically used in the treatment of acute parotitis, boil sores, varicella, acute lymphadenitis, and herpes zoster. Besides this in clinical prescription there are some Chinese medicine preparations containing rice bean such as Toubiao Huichun Pill containing Fangfeng (root of Saposhnikovia divaricata), Shandougen (root of Sophora tonkinensis), Chuanxiong (rhizome of Ligusticum chuanxiong) and Liushenqu which contains Laliao (herb of Polygonum pubescens), Qinghao (herb of Artemisia annua), Cang’erzi (fruit of Xanthium sibiricum), and Chixiaodou (seed of Vigna umbellata). Food legumes are nutritious food for the people around the world as it is known to produce richer quality of proteins. Among legumes, rice bean a nutritionally rich but unexploited legume has potential as a functional food for benefitting the human health. Rice bean could be useful in diabetes and other chronic diseases. By underlining the health benefits of rice bean, it is necessary to include this underutilized legume in the diet and encourage its consumption among different

312

16

Nutraceutical Potential of Rice Bean

communities. Nevertheless, the available information on nutraceutical value of rice bean is very scanty, further studies are required to exploit the nutraceutical potential of this legume. The inclusion of rice bean in routine cuisine would be helpful in meeting the demand for protein, nutrients and bioactive compounds from accessible source.

References Anderson JW, Jones AE, Riddell-Mason S (1994) Ten different dietary fibers have significantly different effects on serum and liver lipids of cholesterol-fed rats. J Nutr 124(1):78–83 Barrett AH, Farhadi NF, Smith TJ (2018) Slowing starch digestion and inhibiting digestive enzyme activity using plant flavanols/tannins—a review of efficacy and mechanisms. LWT-Food Sci Technol 87:394–399 Belem MAF (1999) Application of biotechnology in the product development of nutraceuticals in Canada. Trends Food Sci Tech 10(3):101–106 Bhagyawant SS, Narvekar DT, Gupta N, Bhadkaria A, Gautam AK, Srivastava N (2019) Chickpea (Cicer arietinum L.) lectin exhibits inhibition of ACE-I, α-amylase and α-glucosidase activity. Protein Pept Lett 26:494–501 Brand JC, Snow BJ, Nabhan GP, Truswell AS (1990) Plasma glucose and insulin responses to traditional Pima Indian meals. Am J Clin Nutr 51(3):416–420 Cummings JH, Stephen AM (2007) Carbohydrate terminology and classification. Eur J Clin Nutr 61(Suppl. 1):5–18 Dillard CJ, German JB (2000) Phytochemicals: nutraceuticals and human health. J Food Agric Sci 80(12):1744–1756 Djordjevic TM, Šiler-Marinkovic SS, Dimitrijevic-Brankovic SI (2011) Antioxidant activity and total phenolic content in some cereals and legumes. Int J Food Prop 14:175–184 Halliwell B, Gutteridge JM (1990) Role of free radicals and catalytic metal ions in human disease: an overview. Methods Enzymol 186:1–85 Han Z (2010) Treatment of 121 cases of allergic dermatosis with decoction of Mahuang Lianqiao Chixiaodou. Hebei J Tradit Chin Med 32(3):377 Han KH, Fukushima M, Ohba K, Shimada K, Sekikawa M, Chiji H, Lee CH, Nakano M (2004) Hepatoprotective effec ts of the water extract from adzuki bean hulls on acetaminophen-induced damage in rat liver. J Nutr Sci Vitaminol 50(5):380–383 Hwang IG, Shin YJ, Lee S, Lee J, Yoo SM (2012) Effects of different cooking methods on the antioxidant properties of red pepper (Capsicum annuum L.). Preventive Nutr Food Sci 17:286–292 Itoh T, Kita N, Kurokawa Y, Kobayashi M, Horio F, Furuichi Y (2004) Suppressive effect of a hot water extract of rice beans (Vigna angularis) on hyperglycemia after sucrose loading in mice and diabetic rats. Biosci Biotech Biochem 68:2421–2416 Jones JR, Lineback DM, Levine MJ (2006) Dietary reference intakes: implications for fiber labeling and consumption: a summary of the international life sciences institute North American Fiber Workshop, Washington, DC. Nutr Rev 64(1):31–38 Katoch R (2011) Nutritional and anti-nutritional constituents in different seed components of rice bean (Vigna umbellata). Ind J Agric Biochem 24(1):65–67 Katoch R, Jamwal A (2013) Characterization of α -amylase inhibitor from rice bean with inhibitory activity against midgut α-amylases from Spodoptera litura. Appl Biochem Microbiol 49:419–425

References

313

Katoch R, Tripathi A (2017) Nutraceutical and pharmacological properties of Vigna species. Ind J Agric Biochem 30:10–20 Kitagawa I, Wang HK, Saito M, Yoshokawa M (1983) Saponin and sapogenol. XXXII. Chemical constituents of the seeds of Vigna angularis (Willd.) Ohwi et Ohashi. (2). Azukisaponins I, II, III and IV. Chem Pharm Bull 31(2):674–682 Koleckar V, Kubilova K, Rehakova Z, Kuca K, Daniel J et al (2008) Condensed and hydrolysable tannins as antioxidants influencing the health. Med Chem 8:436–447 Lajolo FM, Saura-Calixto F, Penna EW Menezes EW (2001) Fibra dietética en Iberoamérica: tecnología y salud: obtención, caracterización, efecto fisiológico y aplicación en alimentos. Livraria Varela, São Paulo Lin PY, Lai HM (2006) Bioactive compounds in legumes and their germinated products. J Agric Food Chem 54:3807–3814 Lu B, Yang X, Wang X (2007) The sum-up of chronic hepatitis B companied autoimmune hepatitis treated with Jiawei Mahuang Lianqiao Chixiaodou decoction. Chin Arch Tradit Chin Med 25 (10):2018–2019 Marathe SA, Rajalakshmi V, Jamdar SN, Sharma A (2011) Comparative study on antioxidant activity of different varieties of commonly consumed legumes in India. Food Chem Toxicol 49 (9):2005–2012 Mukai Y, Sato S (2009) Polyphenol-containing adzuki bean (V. angularis) extract attenuates blood pressure elevation and modulates nitric oxide synthase and caveolin-1 expressions in rats with hypertension. Nutr Metab Cardiovasc Dis 19(7):491–497 Nishi S, Saito Y, Souma C, Kato J (2008) Suppression of serum cholesterol levels in mice by adzuki bean polyphenols. Food Sci Technol Res 14(2):217–220 Oomah BD, Caspar F, Malcolmson LJ, Bellido AS (2011) Phenolics and antioxidant activity of lentil and pea hulls. Food Res Int 44(1):436–441 Prosky L, DeVries JW (1991) Controlling dietary fiber in food products. In: Gottschalk W, Muller HP (eds) Proteins. Van Nostrand Reinhold, New York, p 499 Qiang et al (2008) Clinical observation of “Mahuang Lianqiao Chixiaodou decoction” in treating chronic nephritis. Shanghai J Tradit Chin Med 42(12):31–32 Rani S, Khabiruddin M (2017) Antioxidant potential of processed Vigna umbellate (L.) seeds: an Indian underutilized legume. Int J Chem Stud 5(4):1407–1412 Raskin I, Ribnicky DM, Komarnytsky S, Ilic N, Poulev A, Borisjuk N, Brinker A, Moreno DA, Ripoll C, Yakoby N, O’Neal JM, Cornwell T, Pastor I, Fridlender B (2002) Plants and human health in the twenty first century. Trends Biotechnol 20:522–531 Redgwell RJ, Fischer M (2005) Dietary fiber as a versatile food component: an industrial perspective. Mol Nutr Food Res 49(6):521–535 Segev A, Badani H, Kapulnik Y, Shomer I, Oren-Shamir M, Galili S (2010) Determination of polyphenols, flavonoids, and antioxidant capacity in colored chickpea (Cicer arietinum L.). J Food Sci 75(2):115–119 Sharma M, Kawatra A (1995) Effect of dietary fibre from cereal brans and legume seed coats on serum lipids in rats. Plant Foods Hum Nutr 47:287–292 Siddhuraju P, Becker K (2007) The antioxidant and free radical scavenging activities of processed cowpea (Vigna unguiculata (L.) Walp.) seed extracts. Food Chem 101:10–19 Singh J, Basu PS (2012) Non-nutritive bioactive compounds in pulses and their impact on human health: an overview. Food Nutr Sci 3:1664–1672 Spiller GA (2001) Dietary fiber in prevention and treatment of disease. In: Spiller GA (ed) CRC handbook of dietary fiber in human nutrition. CRC Press, Washington, p 363 Sreerama YN, Vadakkoot BS, Vishwas MP (2010) Variability in the distribution of phenolic compounds in milled fractions of chickpea and horse gram: evaluation of their antioxidant properties. J Agric Food Chem 58:8322–8330 Yan W (2012) Determination of total triterpenes of different origin and quality evaluation in adzuki bean. Lishizhen Med Mat Med Res 23(2):305–306

314

16

Nutraceutical Potential of Rice Bean

Yao Y, Sang W, Zhou MJ, Ren GX (2010) Antioxidant and α-glucosidase inhibitory activity of colored grains in China. J Agric Food Chem 58:770–774 Yao Y, Cheng X-Z, Wang L-X, Wang S, Ren G (2012) Major phenolic compounds, antioxidant capacity and antidiabetic potential of Rice bean (Vigna umbellata L.) in China. Int J Mol Sci 13:2707–2716

Value-Added Products from Rice Bean

17

In today’s globalized and mechanized world, the consciousness of the people about health, food quality and healthy nutrition options is continuously increasing. Maintaining health with tyhe provision of good quality food to the people is among top priorties of the nation. Pulses are a rich source of dietary protein and essential micronutrients which have the potential to relive the dependency on animal food products in the diet. Apart from this, their bioactive and functional properties have also been well documented (Philanto and Korhonen 2003). In developing world, people have become more oriented toward the nutritive food products and one of the potential ways for addressing their demands is increase the availability of pulse-based value-added products. Generally, the value addition of food is purely for commercial purpose but sometimes it could be practised for the augmentation of nutrient content in food products. Besides providing a nutritionally rich food, value addition to agriproducts also stabilizes and makes agriculture more lucrative and creates employment opportunities both at the production and marketing stages. The focus on value addition to agricultural products is vital for comprehensive development or improving the socioeconomic status of rural community. Since the food processing industry creates job opportunities, the demand for value-added products can lead to diversification and commercialization of agriculture and bring improvement in total income of the farmers.

17.1

Value Addition of Food Products

The World Health Organization (WHO) and Food and Agricultural Organization of the United Nations (FAO) define fortification as “the practice of deliberately increasing the level of an essential micronutrient in food” irrespective of whether the nutrients were originally in the food before processing or not, so as to improve the nutritional quality of the food supply and to provide a health benefit with minimal risk to health, whereas enrichment is the addition of micronutrients # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_17

315

316

17

Value-Added Products from Rice Bean

to a food which are lost during processing. Finding new cost-effective and sustainable ways to fight hidden hunger and nutrient deficiencies is core part of the programs associated with the food and nutritional security. Fortifying a variety of foods with essential nutrients is one of the potential ways for the attainment of nutritional security. Food fortification is generally the addition of micronutrients to the food. It may be a purely commercial in order to provide extra nutrients in food, while other times it is a public health policy program aiming to improve healthiness of the people. Since the health benefits are huge, food fortification can be a way cost-effective intervention for bringing significant improvement in health of people. However, an obvious requirement is that the fortified food products should be easily available to the people and should be consumed in adequate amounts by target people in population.

17.2

Necessity of Value Addition of Underutilized Crops

The underutilized crops are valuable source of providing food as well as cash income for indigenous people. They also play significant role in maintaining the productivity and stability of traditional agroecosystems. These little-known crops contribute to food security and play vital roles in the nutrition that enrich the diet of the rural population. Most of the underutilized crops are often available only in the local markets and are practically unknown in other parts of the world. A large number of these crops have the potential to resist the adverse growing conditions with excellent nutritive and therapeutic value and can satisfy the demands of health-conscious consumers. The value addition of underutilized crops is an effective approach for their utilization. Most of consumers these days are demanding new, delicious, nutritious, and attractive food products to meet their food and nutritional requirements. The value addition and utilization of underutilized crops which have excellent nutritive value and therapeutic properties is a possible way for meeting the current requirement of the consumers. Furthermore, the generation of different food products by means of value addition would be useful in promoting and commercializing the underutilized crops in global market. Among the underutilized legumes, rice bean has high production potential, balanced nutritional profile with high protein content, essential amino acids, vitamins, and minerals in comparison to other wellestablished legumes. Low fat content and a relatively high proportion of healthy, unsaturated fatty acids make rice bean a wholesome food over other traditionally consumed pulses. Therefore, it is worthwhile for promoting rice bean as potential pulse crop for development of different value-added products and their popularization among the masses.

17.3

17.3

Physicochemical Attributes of Rice Bean for Formulation of Different Products

317

Physicochemical Attributes of Rice Bean for Formulation of Different Products

Physicochemical properties of food can be defined as the characteristics of agricultural products that can be quantified, or the state of the food material. The assessment of physicochemical properties is required for designing the strategies for better utilization of the food material. Designing of strategies without taking the physical properties of the food into considerations may yield poor results. For the reason, thorough knowledge of the physiochemical properties is important for scientists. The important physicochemical properties of rice bean seeds have been discussed in the subsequent subheads.

17.3.1 Density, Porosity, and Angle of Repose To explore the potential of legume seeds in the formulation of various end products, relevant machinery and equipment for processing operation is essential. Furthermore, for efficient, adequate, effective, and economical equipment design for product development, knowledge of physical properties of legume under consideration is of paramount importance (Bhise et al. 2014). The density, porosity, and angle of repose are essential for the designing of the process and manufacturing of food products. These properties encompass the practical application of food science to develop efficient industrial production, storage, packaging, and physical distribution of nutritious and convenient foods that are safe and uniform in quality. In simpler term these properties establish a reference data for their processing (Chukwu and Orhevba 2011). For obtaining better quality of the final food product and the maximum efficiency of the processing and handling machines, it is essential to understand physical properties of the legume seeds. Density (bulk density and true density) and porosity are important physical properties of the legume seeds for designing systems for providing proper storage conditions. The high porosity of seeds ensures better heat exchange, aeration during heating, drying, and cooling operations in product development (Theertha et al. 2014). The angle of repose is the characteristics of the bulk material which indicates the cohesion among the individual grains. Additionally, it is beneficial for designing equipment for proper storage facility for the food product. The angle of repose is important for designing the equipment for mass flow and structures for seed storage (Kaleemullah and Kailappan 2003). The bulk density and true density are two important parameters to assess the quality of food. Bulk density of grain is the ratio of mass of grain to its bulk volume. True density (including pore spaces between grains) of grain is greater than actual volume (without pore spaces between grains). Hence, bulk density of grain is smaller than that of true density. Seed density is one of the important parameters to assess the quality of seeds. Higher bulk density of flour is desirable for greater ease of dispersibility of flours. In contrast, lower bulk density would be an advantage in the formulation of

318

17

Value-Added Products from Rice Bean

complementary foods. The bean flour could also be favorable in infant feeding where less bulk density is desirable. High bulk density of flour suggests its suitability to be used as thickener in food products and for use in food preparation since it helps to reduce paste thickness which is an important factor in convalescent and child feeding (Chandra et al. 2015). Rice bean seeds have 0.98 g/mL density in comparison to 0.85 g/ml of faba bean seeds (Saharan et al. 2002). The bulk density, true density, porosity, and angle of repose of rice bean seeds range from 820 to 877 kg m 3, 1138.40 to 1388.79 kg m 3, 26.47% to 40.57%, and 9.75 to 21.40 , respectively (Rejaul et al. 2017).

17.3.2 Hydration Parameters 17.3.2.1 Swelling Capacity and Swelling Index Starch is one of the most important but flexible food ingredients possessing valueadded attributes for innumerable industrial applications. Starch contributes significantly to the texture and sensory properties of processed foods. It exhibits a wide range of functional properties and it is probably the most commonly used hydrocolloid in the formulation of various food products. The swelling capacity and swelling index denote the swelling power of the starch in the food products. Swelling index represents the volume occupied by the starch in seeds after soaking in excess of water, which maintains the integrity of starch in aqueous dispersion (Kaushal et al. 2012). Swelling index is related to gelatinization of starch which is probably the result of breaking of intramolecular hydrogen bonds in crystalline regions and water absorption by non-starch polysaccharides and proteins (Wani et al. 2013). The swelling power of starch depends on the formation of protein–amylose complex as it reduces swelling power of starch. The processing of food item at higher temperature make starch granules increasingly susceptible to shear disintegration as they swell and starches with lower amylose content (higher amylopectin content) swell more than those rich in amylose content. High swelling capacity and swelling index of item denote delayed gastric emptying and concurrently increase the stomach distension, which triggers the feeling of fullness in the stomach. The swelling capacity and swelling index of different rice bean genotypes ranged from 0.46 to 0.79 ml/seed and 5.50 to 9.93, respectively (Kaur et al. 2013). Genotype LRB-13 (0.79 ml/ seed) had highest swelling capacity followed by the genotype SKMRB1 (0.78 ml/ seed), IC-563980 (0.66 ml/seed), and IC-360564 (0.60 ml/seed) (Fig. 17.1a). The highest swelling index was observed for the genotype IC-360394 (9.93) followed by SKMRB1 (9.75), LRB-10 (9.33), and LRB-160 (9.33) (Fig. 17.1b). Saharan et al. (2002) reported 0.32 ml/seed swelling capacity and 0.73 swelling index for rice bean seeds which was higher than faba bean seeds.

17.3

Physicochemical Attributes of Rice Bean for Formulation of Different Products

319

Fig. 17.1 (a) Swelling capacity. (b) Swelling index of seeds of different rice bean genotypes

17.3.2.2 Hydration Capacity and Hydration Index Soaking is the initial stage of most technological processes in pulses. Proper selection of soaking conditions is important, as it affects the behavior of seeds during further processing, as well as the nutritive and sensory quality of the final product. Soaking makes uniform expansion of the seed coat and cotyledons easier. The amount of water absorbed by seeds during soaking decides about protein denaturation and the degree of starch granule gelatinization during heat processing. Soaking of pulses is directly related to the cooking quality and cooking time. It could be well understood by knowing the hydration capacity and hydration index. Hydration capacity is defined as the amount of water that whole seeds absorb after soaking in excess water for 16 h at room temperature (22  2  C) and is expressed as the amount of water absorbed per 100 g of seeds. In other words, hydration capacity is the ability of a seed to absorb water and swell for desired consistency in food which creates a quality end product. The hydration capacity increased with increase in temperature. Hydration index is calculated as hydration capacity per seed/weight of one seed (g). Higher hydration capacity is associated with the shorter cooking time. In

320

17

Value-Added Products from Rice Bean

Fig. 17.2 (a) Hydration capacity. (b) Hydration index of seeds of different rice bean genotypes

general, higher seed weight has higher hydration and swelling capacity, but they took longer cooking time. The hydration capacity and hydration index are two important factors while formulating baked product where different bakery products require different water absorption or hydration levels. Rice bean seeds have been reported with 0.19 g/seed hydration capacity and 0.86 hydration index (Saharan et al. 2002). Kaur et al. (2013) observed that the hydration capacity and hydration index of different rice bean genotypes ranged from 0.02 to 0.19 g/seed and 0.25 to 2.33, respectively. The genotype LRB13 showed the highest hydration capacity (0.19 g/ seed) and hydration index (2.33), whereas genotype LRB005 showed lowest hydration capacity (0.02 g/seed) and hydration index (0.25) (Fig. 17.2a, b). They also reported that seed weight has proportional relationship with hydration capacity and swelling capacity and negative relationship with cooking time. The seeds having higher seed weight has less compact and loose intercellular structure with large-sized starch granules, while those with lower seed weight shows more compact structure and presence of small-sized granules. The differences in the hydration properties may be attributed to the difference in seed characteristics like weight, seed coat thickness, and water absorption (Sefa-Dedeh and Stanley 1979).

17.3

Physicochemical Attributes of Rice Bean for Formulation of Different Products

321

17.3.3 Cooking Time Cooking is known to be fundamental processing method for legume consumption, as it increases digestibility, inactivates anti-nutritional factors, increases nutrient biological value, and confers the sensorial quality (Tharanathan and Mahadevamma 2003). Cooking results in gelatinization of intracellular starch and denaturation of proteins, accompanied by softening of seeds as a result of partial solubilization of the middle lamella, which leads to separation of individual cotyledon cells. Generally, pulses are soaked before they are cooked, in order to render good sensory quality. The seeds undergo important physicochemical changes during soaking and cooking resulting in much softer texture (Stanley and Aguilera 1985). The cooking quality of pulses is a function of the cooking time. Cooking in other words means the time taken between the beginning of the boil and when the seeds are ready to eat. This means that at least 90% of them are soft enough to masticate. Long cooking times are associated with the hard-to-cook defect, a condition that aggravates during storage. Proneness of beans to the hard-to-cook defect has been determined to be a function of both variety and storage conditions (Giselle et al. 2004; Shiga et al. 2004). Besides, the cooking quality is also a function of an increase in volume after cooking, higher dispersibility of solids into cooking media, and improved texture after cooking from consumer point of view. Rice bean seeds generally take 30–44 min for cooking; however varietal differences in cooking time have also been reported (Kaur et al. 2013). Their study revealed that genotypes BC2 and LRB-417 had highest and lowest cooking time, respectively. The genotypes PRR-2007-2, LRB005, EC97882, and IC563980 have higher cooking time (40–41 min) (Fig. 17.3). Although there is a variation in the Table 17.1 Nutritional composition of food multimix

FMM I FMM II

Moisture g/100 g 4.23 6.13

Carbohydrate

Protein

Fat

Crude fiber

63.28 64.04

16.31 17.86

4.75 3.91

12.47 12.00

Source: Baruah et al. (2018)

Fig. 17.3 Cooking time of seeds of different rice bean genotypes

Energy Kcal/100g 365 362

322

17

Value-Added Products from Rice Bean

cooking time of rice bean, still it requires less time to be cooked in comparison to the other legumes. Generally kidney bean, lima bean, pinto bean, white bean and cowpea require 70–90 min, 50–70 min, 60–90 min, 45–60 min, and 45–60 min which is quite higher than cooking time of rice bean. The difference in cooking times has been related to the rate at which cell separation occurred and attributed to loosening of the intercellular matrix of the middle lamella upon cooking (Rockland and Jones 1974). The cooking time is also affected by the permeability of the seed coat and internal structure of the endosperm, which is determined by the rate of soaking of water. The cotyledons with higher density show slower water uptake capacity and longer cooking time (Seena and Sridhar 2005). Grain soaking followed by cooking is fundamental for the utilization of pulses in routine cuisine by guaranteeing the inactivation of anti-nutrients and providing sensorial and color characteristics, flavor, and texture. Soaking generally reduces the cooking time of leguminous seeds; however, it is a time requiring process (between 12 and 24 h at room temperature). The dehulling process has been resulted in considerable reduction in the soaking time of pulses. Increasing the temperature of the soaking solution has also been identified as another method for reducing the soaking time (Abu-Ghannam and McKenna 1997). Soaking of the pulses in either high pH or monovalent salt solutions can also reduce the cooking time. Cooking of beans under high pressure (13–15 psi) also reduces the cooking time, significantly.

17.4

Physicochemical Properties of Rice Bean Starch

A starch paste is defined as a viscous mass consisting of a continuous phase of solubilized amylose and/or amylopectin and a discontinuous phase of granule ghosts and fragments. Pasting refers specifically to the changes in the starch upon further heating after gelatinization has occurred. Rapid Visco Analyser (RVA) is commonly used to determine pasting properties of starch. During RVA test, the starch granules imbibe water rapidly. However, as the mixture is heated, granule begins to swell significantly, and the imbibed water aids the melting of the crystalline regions of starch granules which allows for rapid movement of water into and within the granules (Hung and Morita 2005). Starch granules absorb and bind more water while swelling which reduces the available water resulting in physical interactions between them. These interactions referred to as the pasting that results in sudden increase in the viscosity of starch and water mixture. Disruption of granules by shearing action of paddle releases starch molecules in the solution where they can have random interactions among them. The maximum viscosity, i.e., peak viscosity, is achieved when the rate of granules swelling equals the breakdown of granules. Peak viscosity indicates the water-holding capacity of the starch or mixture. It is often correlated with final product quality. Disruption of starch granules results in a decrease in paste viscosity which is termed as trough viscosity, and the difference between peak viscosity and trough viscosity is termed as breakdown viscosity. Therefore, breakdown is regarded as the measure of the degree of disintegration of

17.4

Physicochemical Properties of Rice Bean Starch

323

Fig. 17.4 Amylose content and pasting temperature of rice bean starch

Fig. 17.5 Physical properties of rice bean starch

the granules. Setback viscosity represents reassociation between starch molecules during cooling. It involves retrogradation, or re-ordering, of the starch molecules and has been correlated with texture of various products. Pasting temperature is the temperature at which the viscosity begins to increase during heating. The high pasting temperature of starches indicates a higher resistance to swelling and rupture. During cooling, glucan chains of starch molecules entangle each other and form gel and thus increase in paste viscosity. The setback viscosity (difference between peak and final viscosity) is exhibited due to recrystallization of amylose molecules in the gel, which is the measure of the gelling ability or retrogradation ability of starches (Hung and Morita 2005). Kaur et al. (2013) studied the pasting properties of starch from different rice bean genotypes and reported that pasting temperature ( C), peak viscosity, trough viscosity, final viscosity, breakdown viscosity, and setback viscosity (cP; centipoise) ranged between 74.97 to 76.43  C, 5053 to 8059 cP, 3079 to 3924 cP, 1829 to 4763 cP, and 2471 to 3625 cP, respectively (Figs. 17.4 and 17.5). The pasting behavior during cooking from 50 to 90  C reflects the capacity of starch to absorb water and swell. Pasting temperature provides an indication of the minimum temperature to cook as well as temperature at which the viscosity begins to increase during the heating process. The higher pasting temperature for rice bean starches indicates their high resistance toward the swelling. Rice bean starch shows pasting temperature around 75  C, which is lower than kidney bean starch (82  C)

324

17

Value-Added Products from Rice Bean

reported earlier (Kaur et al. 2013) but higher than faba beans (66  C) and mung beans (71  C). The differences in pasting properties may be attributed to the difference in amylose content. Peak viscosity in rice bean seeds ranges from 5053 to 8059 cP. Peak viscosity was the highest for PRR-2007-2 (8059 cP) and the lowest for LRB417 (5053 cP) (Kaur et al. 2013). The increase in viscosity with increase in temperature may be attributed to the removal of water from the exuded amylose by granules as they swell. The increase in viscosity with increase in temperature may be attributed to the removal of water from the exuded amylose by granules as they swell. Breakdown viscosity of rice bean ranged from 1829 cP to 4763 cP (Kaur et al. 2013). The breakdown viscosity was the highest for PRR-2007-2 (4763 cP) and the lowest for LRB-417 (1829 cP) (Fig. 17.5). Breakdown viscosity and peak viscosity of rice bean starch have shown negative relation with amylose content. This demonstrate that the starch granules swell to the restrictive levels as well as disrupt to lesser extent in the presence of higher amylose during heating, which thus resulted to reduced peak viscosity and breakdown viscosity. The higher breakdown viscosity indicates lower stability of the swollen granules against disintegration during cooking. During cooling increase in viscosity may be due to aggregation of amylose molecules. Setback viscosity observed to be highest for IC-360616 (3625 cP) and the lowest for IC-341977 (3017 cP). The higher degree of the setback value shows a strong tendency of aggregation of starch chains. A significant positive correlation of final viscosity and setback viscosity has also been observed. The difference in pasting properties may be in extent up to which the granule structure is broken down and dispersion of amylose. The rice bean starch has been reported to absorb 83.20% of water and 77.60% of fat (Chavan et al. 2009). Starch obtained from rice bean exhibits a gelatinization temperature of 66  2  C. Rice bean genotypes with higher seed weight are suitable for the products where higher thermal stability is required (Kaur et al. 2013). Starch gelatinization is the process where starch and water are subjected to heat, causing the starch granules to swell. As a result, the water is gradually absorbed in an irreversible manner. This gives the system a viscous and transparent texture. The result of the reaction is a gel which is used in sauces, puddings, creams, and other food products providing a pleasing texture. The most common examples of starch gelatinization are found in sauce and pasta preparations and baked goods. The degree of starch gelatinization in rice bean seeds ranges from 48.65% to 55.33%. The degree of gelatinization is mainly attributed to starch content and their starch properties, including amylose/ amylopectin content and gelatinization enthalpy. Soaking of rice bean seeds facilitates the gelatinization of starch which may be due to leaching of tannin and facilitation of water into seed through seed coat which increases the swelling ratio. The swelled seed having more water content which bound with starch may have led to higher degree of gelatinization during cooking.

17.5

17.5

Food Fortification with Rice Bean Seed Flour

325

Food Fortification with Rice Bean Seed Flour

Food fortification can be described as a method of adding essential vitamins and minerals to foods to increase their nutritional value. According to Codex Alimentarius, fortification or enrichment is the addition of one or more essential nutrients to a food, whether or not it is normally present in food. The food to which the nutrients are added is called vehicle for fortification and the added nutrients are called “food fortificants.” One of the approaches to address the problem of deficiencies of micronutrients is by development of value-added products from local ingredients for better affordability, accessibility, and availability. Different global organizations like the FAO and WHO focus on the potential utilization of orphan legumes in the preparation of the value-added products with commonly consumed food ingredients making use of their nutrient strengths. The fortification of food can be a potential way of preventing hunger, starvation, and micronutrient deficiencies among vulnerable section of community (Table 17.1). The most successful and well-known example of global fortification has been fortification of common salt with iodine. A significant proportion of the populations in more than 120 countries have access to iodized salt. Nearly 76% of salt consumed in the world is being iodized, protecting nearly 80 million newborn babies each year from the threat of mental impairment caused by iodine deficiency. Successful salt iodization has reduced the incidence of goiter and cretinism and prevented mental retardation and subclinical iodine deficiency disorders. Baruah et al. (2018) developed food multimix (FMM) using raw and malted rice bean, millet (Konidhan), flax seed, rice (luit variety), and tomato powder. Two food multimixes were developed; the first one (FMM-I) was formulated based on energy density value between 1512.00 and 1890.00 kJ (360–450 kcal) per 100 g of sample and further by mixing all the ingredients at appropriate amount (Table 17.1). Subsequently FMM II was formulated by inoculating probiotic bacteria, viz., Lactobacillus plantarum and Lactobacillus rhamnosus in FMM-I both individually and in combination in different test samples. The study revealed that FMM developed from malted rice bean had appreciable level of nutrients. The FMM also had good physical properties in terms of bulk density, viscosity, and water-holding and fat-holding capacity, and these properties make these food mixes suitable to be used for the preparation of different value-added products like cakes, cookies, and savory items. The knowledge of physicochemical characteristics of food multimix is important for developing different value-added food products. Since the choices of consumers are getting diverse, the food manufacturers are increasingly demands best base product which imparts good functional properties to the food, apart from nutritional quality. Physical properties of foods are very crucial in product development, process design, shelf life, and quality. Knowledge of physical properties is important in handling, preparing, processing, preserving, packaging, storing, and distribution of foods. The physicochemical characteristics like bulk density, viscosity, and waterholding and fat-holding capacity of both FMM I and FMM II are presented in Fig. 17.6.

326

17

Value-Added Products from Rice Bean

Fig. 17.6 Physical properties of food multimix prepared from rice bean

From Fig. 17.6, it was evident that the bulk density of FMM II (0.46 g/ml) decreased after the process of probiotification of FMM I (0.48 g/ml). This reduction in starch content after its breakdown leads to decrease in the bulk density. Reports have shown that decrease in bulk density of fermented flours would be an advantage in the preparation of infant foods. The low value of bulk density in food multimix I and II makes the samples suitable for packaging and transportation. Viscosity is an important constraining factor and also a rheological property related to the quality of the liquid multimix which invariably depends on various factors like composition, total solid content, and temperature. The results showed increase in viscosity of fermented food multimix (FMM II). Many researchers revealed that the decrease in pH during fermentation is the main cause of increase in viscosity. Many researchers also revealed that a combination of malting and fermentation is known to be better than malting alone because this combination not only reduces viscosity, but the fermentation components also impart color and flavor along with increase in shelf life of end products. Water-holding capacity (WHC) is an important protein–water interaction that occurs in various food systems. WHC is the ability of a protein matrix to absorb and retain bound, hydrodynamic, capillary, and physically entrapped water against gravity. Fat-holding capacity is an important property in food formulations because fats improve the flavor and mouthfeel of foods. The fat-holding capacities of FMM I and FMM II were 2.32 g and 2.32 g, respectively (Fig. 17.6). It has been observed from the data that both mixes had comparatively similar fat-holding capacities. No or less change in fat-holding capacity after processing indicates their suitability for low-fat snacks food formulations.

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

Rice bean has multiple culinary uses as several food items are being prepared locally from this crop according to social and culture setting and food habits of the local people. The preparation of some important culinary and value-added products from rice bean has been described under the following subheads.

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

327

Fig. 17.7 Dhal

17.6.1 Dhal (Boiled Pulse) Rice bean seeds are usually taken as a soup or as a pulse (dhal) with rice. Dhal (soup, curry) is the common use of pulses and is prepared by different kinds of pulses. In the rice-based food system, dhal is being preferred by the most of the people in the morning meal with pickle and vegetables. People use both dehulled and non-dehulled seeds, directly to make dhal. However, the ways of preparing dhal from dehulled and non-dehulled seeds are different. The non-dehulled bean is normally soaked and cooked, but the dehulled bean is not soaked before cooking. Mostly, it is mixed with other pulses such as black gram. The rice bean dhal is also known as Dhal Mori and Dhal Khatti which is prepared by mixing non-splitted rice bean seeds with others pulses and by adding mango powder in the recipe, respectively (Fig. 17.7). Recipe Cook rice bean seeds in a pressure cooker with chopped garlic, turmeric powder, red chillies, salt, and 2½ cups of water for 20 min

Separately fry finely chopped onion in oil/ghee until the onion turns golden brown

Add cumin seeds and sauté for a few seconds

Add chopped/pureed tomatoes

Cook until tomatoes are done and mixture leaves the sides of the pan. Add boiled rice bean to above mixture

328

17

Value-Added Products from Rice Bean

Add garam masala to dhal and garnish it with finely chopped coriander leaves

17.6.2 Nuggets (Barian) Rice bean is also served using a number of other recipes, including mixed bean sprout soup, rice bean-stuffed items, and grinding soaked rice bean into a paste to make various products. Nuggets (barian) are also prepared from the paste of soaked and grinded rice bean seeds with black gram. These nuggets are sundried and stored in air tight containers for future use (Fig. 17.8). Recipe Soak rice bean seeds overnight

Drain it and grind it with ginger and green chilies to a fine paste without adding water

Now add spices and mix well

Grease a polythene sheet or a steel thali (plate)

Pour 1 spoonful of the paste all over the sheet and let it dry in the sun for a day or two

When dried store them in airtight jars Fig. 17.8 Nuggets

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

329

Fig. 17.9 Stuffed bhatura

17.6.3 Stuffed Bread (Bhatura) The fermented products of rice bean are also used for preparing nutritious recipes. Stuffed bhatura is a fermented product made up of soaked and grinded rice bean with yeast (Fig. 17.9). Recipe Take half cup of warm water and add yeast to it along with sugar. Place it in a warm and humid place for 7 to 8 min. Once the yeast gets nice frothy and bubbly, it is ready to use

Sieve rice bean flour, salt, and ajwain seeds and keep aside. Add the activated yeast to the sifted flour. Knead with fingers

Now add curd and knead into soft and smooth dough. Knead for 10 to 15 min and lastly add 1 tbsp oil. Shape into an oval shape

Place into a greased vessel with a damp cloth or cling film over it. Keep in a warm or humid place for an hour. Now again knead for 2 min and shape into small balls about 2 in. size

Now roll the risen balls with a roller and deep fry The mixing of rice bean flour and cereal flour is another method for making a large number of value-added products. Babroo, Halwa, Puri, Chapati, Mathari,

330

17

Value-Added Products from Rice Bean

Chilla (pancake), Patrodu (rice bean paste in taro leaf rolls, steam cooked and fried), Poha (pan fried with spices), Kandal veg. (taro stem rolled in rice bean paste, dried and deep fried), Gulgulae, and Ankaliyan are important recopies which could be prepared from rice bean flour.

17.6.4 Halwa (Sweet Pudding) Halwa is the most common sweet dish made across India. It is has evolved in various forms in different parts of the country. Basically halwa is made by continuously frying the ingredients in ghee till it all mixes up together and becomes semisolid paste. Halwa is made on all good occasions or to celebrate happiness in a homely way (Fig. 17.10). Recipe Heat ghee or refined oil

Add rice bean flour and roast slowly until it turns golden brown

Add sugar and water slowly while stirring continuously

Cook on the slow flame for 5–10 min

Cool at room temperature Garnish with dry fruits

Fig. 17.10 Halwa (sweet pudding)

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

331

Serve hot in bowl

17.6.5 Colocasia Leaf Rolls with Rice Bean Seed Flour (Patrodu) Patrodu is local delicious snack prepared in hilly areas during rainy season with healthy leaves of arbi (Colocasia) (Fig. 17.11). Recipe Wash colocasia leaves

Mix rice bean flour in water and add spices

Spread rice bean flour paste over taro leaves and roll

Cook over steam for 15 min

Cut the leaves and deep fry for serving

Fig. 17.11 Colocasia leaf rolls with rice bean seed flour

332

17

Value-Added Products from Rice Bean

Fig. 17.12 Rice bean pancake

17.6.6 Pancake (Fig. 17.12) Recipe Add rice bean flour in water, and adjust the thickness of the batter by adding water, if required, to make it of dropping consistency

Add lemon juice and mix well

Heat oil in a non-stick pan and wipe dry with a tissue paper. Pour batter on it and gently spread in form of a disc

Add some chopped onion on top, press, and cook evenly from both sides Serve hot

17.6.7 Noodles (Fig. 17.13) Fig. 17.13 Noodles

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean Rice bean seed flour + Wheat grain flour

Sieving (twice a time)

Steaming for 5mins

Sieving (to remove clots)

Kneading

Water and salt

Water, salt, and Tomato juice

Extrusion

Steaming for 5 mins

Tempering

Drying

Noodles

Packing, sealing labeling and storage

17.6.8 Poha with Rice Bean Sprouts (Fig. 17.14) Fig. 17.14 Poha

333

334

17

Value-Added Products from Rice Bean

Recipe Put rice flakes in a sieve and wash under tap water

Boil potatoes and cut into small pieces

Chop cabbage, onions, and coriander leaves. Fry onion in oil/ghee until golden brown

Add potatoes, cabbage, steamed rice bean sprouts, chopped coriander leaves, turmeric powder, mustard seeds, red chillies, peanuts, and salt. Cook for 2–3 min

Add tamarind chutney and mix well Dhokla and bhujia are also some value-added products, prepared by mixing of rice bean and Bengal gram flour. Batuk, Bara, Biraunla, Masyaura, Kwanti, Rot, Furaula, and Khichdi are other major local recipes prepared from rice bean in Nepal. The Nepalese people consumed soon after harvest, so the crop will only indirectly impact on food security during the lean season in the pre- and early monsoon period.

17.6.9 Bhujia (Fig. 17.15) Fig. 17.15 Bhujia

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

335

Recipe Boil the potatoes

Sieve the flour and keep it in any utensil

Grate the potatoes, salt, turmeric powder, and garam masala; mix well in the rice bean flour

Knead to make smooth dough

Cover the dough with wet muslin cloth for 15–20 min

Make dough in to desirable size and pass through sev making machine

Heat oil in a frying pan

Push the machine’s piston and put sev in hot oil

Allow sev to fry for some time, till it turns light brown

17.6.10 Nuggets (Sepuwadi) (Fig. 17.16) Fig. 17.16 Sepuwadi

336

17

Value-Added Products from Rice Bean

Recipe Soak split dhal overnight

Prepare paste of dhal (Add Garam masala and salt)

Roll dhal into ball

Steam the ball

Cut into desirable size (perfectly rectangular) and deep fry in oil

Cool at room temperature and pack in selective packing material

17.6.11 Wafer with Rice Bean Flour (Papad) (Fig. 17.17) Fig. 17.17 Papad

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

337

Recipe Sieve mixture of rice bean and gram flour

Add ajwain, cumin seed, sodium bicarbonate, chilli powder, and salt

Add water to form very hard dough

Cover the dough and keep aside for 2 h

Make equal and small-sized balls Roll out each ball on a rolling board in a circular movement



Dry in hot air drier at 60 C and cool

Pack in selected packing material till consumption

17.6.12 Sweet Round Rolls with Rice Bean Flour (Ladoo) (Fig. 17.18) Fig. 17.18 Ladoo

338

17

Value-Added Products from Rice Bean

Recipe Heat ghee

Add rice bean and gram flour

Roast on a low flame stirring constantly till brown

Keep for some time to allow cool and add powdered sugar

Shape into desired size (perfectly round)

Pack in selected packing material flour

17.6.13 Boondi (Fig. 17.19)

Fig. 17.19 Boondi

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

339

Recipe Take rice bean flour in bowl

Add water and whisk it thoroughly to avoid lumps

Heat oil in a pan

Take 1 tsp of boondi batter and pour it over slotted spoon

Allow the batter to fall gently into oil in the form of small pearl-like balls

Fry for some time, till it turns light brown

Take it out and place on a plate and cover with paper napkin

Cool at room temperature and pack in selected packing material

17.6.14 Snack with Rice Bean Seed Flour (Pakauda) Pakauda is made from legume flour, mixed with water and spices, and deep fried and served as a snack. Sometimes pakauda is also prepared by soaking beans and grinding them into a paste, which is seasoned and shaped into patties. Rice bean pakauda is popular in the Tharu people (Nepalese community) and is locally called khariya. They offer it during social gathering. The availability of the rice bean increases the variety in serving guest in social gathering. According to them more food varieties show their social status and respect to the guest. Therefore most Tharu people grow at least a small amount of rice bean in their field. They have a preference for rice bean as a vegetable at social gatherings. In all communities there is tradition for making soup from rice bean if one gets cold in the winter, due to its perceived medicinal value. Rice bean also has cultural and religious values in Nepalese society. Batuk and Bara are used during marital ceremony and other social functions in Magar and Newar communities, respectively (Fig. 17.20).

340

17

Value-Added Products from Rice Bean

Fig. 17.20 Rice bean pakauda

Recipe Soak rice bean seeds overnight (6–8 h) in water

Grind the soaked dhal in electric blender or with pestle and mortar into a fine paste

Clean and chop spinach leaves

Add spinach, salt, red chillies, and garam masala to the dhal paste

Make balls using above mixture and deep fry in oil/ghee. Serve hot with tamarind and mint chutneys

17.6.15 Bara Bara is made by the flour of the legume deep fried in oil, which in other parts of the country is known by khariya (Fig. 17.21). Fig. 17.21 Rice bean bara

17.6

Preparation of Value-Added Products and Common Culinary Uses of Rice Bean

341

Recipe Preheat air fryer to 180º C

Coarsely grind together drained soaked rice bean seeds in a food processor

Roughly chop green chillies and add to carrot mixture. Roughly chop almonds and add to the bowl along with raisins, salt and ground mixture. Mix well

Grease palms with some coconut oil, divide the mixture into equal portions, shape them into balls, and flatten slightly

Place the baras into the air fryer basket, fit it to the fryer, and air fry for 15–20 min or till golden and crisp, brushing some coconut oil once in between

To prepare chutney, grind together almonds, coriander leaves, and broken green chilies to fine mixture

Add coconut and grind. Add 1–2 tablespoons water and grind again to a smooth mixture. Transfer into another bowl, add salt, and mix

Heat coconut oil in a non-stick tempering pan. Add mustard seeds and let them splutter

Discard the stem from dried chilies, roughly chop, and remove seeds

Add curry leaves and chopped chilies to hot oil

Garnish the baras with coriander sprigs and serve hot with few green chilies and chutney

342

17

Value-Added Products from Rice Bean

Fig. 17.22 Khichdi

17.6.16 Khichdi Khichadi is a traditional dish prepared from a mixture of rice, and black gram bean is one of the five grains used in preparing Biruda, an offering that is made to the festival deity or rice bean on the occasion of Maghe Sankranti, a festival celebrated by Nepalese during mid-January (Fig. 17.22). Recipe Cook onion in oil/ghee until golden brown in a pressure cooker

Add cumin seeds and finely chopped tomatoes and green chillies

Cook until tomatoes are done and the mixture leaves the sides of the cooker

Wash rice and rice bean dhal

Wash and chop cauliflower/radish leaves

Add rice, rice bean dhal, chopped cauliflower/radish leaves, and water (4 cups) to the above mixture in a pressure cooker and cook for 15 min

17.6.17 Some Other Value-Added Products from Rice Bean During Gaura Parba, a festival celebrated widely in far-western region of Nepal, rice bean is one of the five grains used in preparing Biruda, an offering that is made to the festival deity. The Newar community has a tradition of preparing soup known as

17.7

Value Addition and Nutritional Security

343

Quantee (kwanti/kwati) from a mixture of sprouted seeds of nine grain legumes during the festival of Janai Purnima, and rice bean constitutes one of these grain legumes. Many of these recipes are existing local ones, and field demonstrations show that rice bean is a versatile raw material which can substitute other pulses in common recipes that are locally popular. Thereby, rice bean has potentials when it comes to value-added products which can be produced at a local market place and tea shop level. In India, food scientists have been investigating the possibilities of rice bean utilization in routine cuisine and for various industrial uses. The research involves the nutritional analysis of different value added products prepared from whole bean or in combination with cereals and other crops such as sundal, puli kulambu, ball curry, fried ball, snacks, sweets, and other supplementary products and their acceptability among the consumers.

17.7

Value Addition and Nutritional Security

Nutrition security is a global challenge and a prerequisite for a healthy and peaceful society. At present about 795 million malnourished people (comprising around 12% of the total global population) exist in the world, and apparently 98% of them lives in developing and underdeveloped countries. The malnutrition can affect all age groups, but young children and women at reproductive age tend to have high risk of malnutrition. The malnutrition has many serious detrimental effects on human health. Besides having direct effect on human physiology, malnutrition also has profound effect on economic development of any country. Major factor responsible for this situation is overdependency of rapidly growing population on cereal-based diets in addition to high volatile prices of protein-rich foods, paucity of fertile lands and degradation of natural resources which are major contributing factors for nutritional insecurity in human population. To address the cause of malnutrition which rest intrinsic to in poverty and unsustainable livelihoods, strategies that promote increase in the supply of quality food to all population groups should be supported. The value addition of agriculture products is one of the key strategies for the attainment of nutritional security. In the process of value addition, the raw commodity changes its form to produce a high quality end product with desirable nutritional characteristics. In current context of malnutrition in world, the value addition or formulation of value-added products are highly desirable, as these can remove the overdependency on few staple crop which are able to provide food but unable to provide enough nutrients, thereby leading to malnutrition among people. With the increasing globalization and industrialization, the food habits of the people are continuously changing, and people prefer the consumption of ready to eat nutritionally rich products. Food fortification is one of the approaches of value addition in which the deficiency of micronutrient overcome with the addition of micronutrients. A large number of fortified food products are available to combat with hidden hunger and malnutrition-associated problems such as fluid milk,

344

17

Value-Added Products from Rice Bean

including fat-free and low-fat milk, which is typically fortified with vitamin D. Enriched bread, flour, pasta, rice, and other grain products are fortified with folic acid. Many ready-to-eat cereals are also fortified with folic acid. Efforts have also been made for bio-fortification of food crops employing biotechnological tools. One of the significant examples of fortified food crops is “Golden Rice-1 and Golden Rice-2” which have been produced to combat vitamin A deficiency in the people. Endemic brain damage, goiter, and cretinism can be prevented by correcting for iodine deficiency and provided the rationale for the iodine fortification of salt with associated major impacts on the prevalence of these conditions. The introduction of commercially produced iodized salt during the middle of the last century substantially reduced iodine deficiency. Reduction and recovery of food losses throughout the food chain from production to consumption and improvements in preservation, transportation, nutritional content, safety, and shelf life of foods will be key strategies to combat food and nutrition demands of the future. Value addition of agriculture food products through food processing has been used to preserve food, improve food safety, and maintain their quality. Over the years, traditional food preparation and preservation processes have been industrialized, and due to which the availability of foods in both in local and export markets has been increased. Processing of the food product can occur at various points along the supply chain. It can be applied proximate to food harvest (e.g., initial processing of agricultural commodities) or further downstream when it is applied in the manufacture of formulated food products (e.g., bread, biscuit, noodles, yoghurt). The transfer of technology to farmers or making them aware of different value addition techniques is absolute for the commercial exploitation of agriproduct. For example, knowing the way of increasing shelf life of food products through value addition is helpful in raising the income of the farmers by increasing the availability of their products in local and distant markets. Furthermore, the value addition technology also creates job opportunities which can lead to the diversification and commercialization of agriculture and improvement in the socioeconomic status of rural households. Family farming is one of the most predominant forms of agriculture worldwide, both in developing and in developed countries. Despite vast crop diversity, only few food crops have gained acceptability of the people. Many of the indigenous crops have still remained untouched from commercial exploitation due to the lack of awareness of their potential, lack of market access, weak market demand, poor market structure, market incentives, and improper market chains which have been identified as some of the many concerns that small-scale farmers face. Presently, the raising concern of the people regarding their health has increased the demand for food having excellent nutritive value and therapeutic values. The world agriculture is dominated by few food crops, and this exclusive dependency on these creates major roadblock in the success of any food and nutritional security program. Various international organizations working for the betterment of the humankind have made serious emphasis on the use of alternative food resources particularly underutilized legumes.

References

345

Underutilized legumes are endowed with excellent nutritional and therapeutic properties. However, there is a need of formulation of different strategies for their commercial exploitation. Preparation of different value-added products is one of the potential ways for their commercial exploitation and utilization. Rice bean, an underutilized crop, has enormous nutritional, medicinal, and economic values and could contribute to poverty reduction mainly in rural areas and to the improvement of both nutritional and health status of the local populations. The development of different value-added products with rice bean will offer uncommon opportunities for income generation to the farmers, in particular the farm women. The quantitative and qualitative aspects of dietary intake are important factors influencing the nutritional status in young children in a developing country. In a developing country like India, ensuring optimal food safety, healthy environment, and availability of health services is a target still to be achieved. The excellent nutritive profile make rice bean to be potentially utilize in the formulation of feeding babies and those convalescing. Further, it can also be used in different preparations for meeting the nutritional requirements in growing children’s and lactating mother. The overall impact of such interventions for rice bean utilization will be reflected on socio-economics of the communities, enhancing their food and nutritional security and strengthening of their traditional food culture.

References Abu-Ghannam, McKenna (1997) Hydration kinetics of red kidney beans (Phaseolus vulgaris L). J Food Sci 62:3 Baruah DK, Das M, Sharma RK (2018) Nutritional and microbiological evaluation of rice bean (Vigna umbellata) based probiotic food multi mix using Lactobacillus plantarum and Lactobacillus rhamnosus. J Prob Health 6:1–7 Bhise S, Kaur A, Manikantan MR (2014) Evaluation of engineering properties of soybean cultivar SL 744. J Res 51(3–4):291–294 Chandra S, Singh S, Kumari D (2015) Evaluation of functional properties of composite flours and sensorial attributes of composite flour biscuits. J Food Sci Technol 52(6):3681–3688 Chavan UD, Momin A, Chavan JK, Amarowicz R (2009) Characteristics of Starch from rice bean (Vigna umbellata L.) seeds—a short report. Pol J Food Nutri Sci 59:25–27 Chukwu O, Orhevba BA (2011) Determination of selected engineering properties of soya beans (Glycine max) related to design of processing machine. J Agric Food Technol 1(6):68–72 Giselle AM, Banu FO, Lisa JM, Nielsen SS (2004) Analysis of hard-to-cook red and black common beans using Fourier transform infrared spectroscopy. J Agr Food Chem 52:1470–1477 Kaleemullah S, Kailappan R (2003) Geometric and morphometric properties of Chillies. Int J Food Prop 6:481–498 Kaur A, Kaur P, Singh N, Singh Virdib A, Singh P, Chand RJ (2013) Grains, starch and protein characteristics of rice bean (Vigna umbellata) grown in Indian Himalaya regions. Food Res Int 54(1):102–110 Kaushal P, Kumar V, Sharma HK (2012) Comparative study of physico-chemical, functional, antinutritional and pasting properties of taro (Colocasia esculenta), rice (Oryza sativa), pigeon pea (Cajanus cajan) flour and their blends. LWT-Food Sci Technol 48:59–68 Philanto A, Korhonen H (2003) Bioactive peptides and proteins. Adv Food Nutr Res 47:175–181

346

17

Value-Added Products from Rice Bean

Rockland LB, Jones FT (1974) Scanning electron microscope studies of dry beans. Effect of cooki ng on the cellular structure of cotyledons in rehydrated large Lima beans. J Food Sci 39:342–346 Saharan K, Khetarpaul N, Bishnoi S (2002) Variability in physico-chemical properties and nutrient composition of newly release rice bean and faba bean cultivars. J Food Comp Anal 15:159–167 Seena S, Sridhar KR (2005) Physicochemical, functional and cooking properties of under explored legumes, Canavalia of the southwest coast of India. Food Res Int 38:803–814 Sefa-Dedeh S, Stanley DW (1979) The relationship of microstructure of cowpeas to water absorption and dehulling properties. Cereal Chem 56:379–386 Shiga TM, Lajolo FM, Filisetti CC (2004) Changes in the cell wall polysaccharides during storage and hardening of beans. Food Chem 84:53–64 Stanley DM, Aguilera JM (1985) A review of textural defects in cooked reconstituted legumes. The influence of structure and composition. J. Food Biochem 9:277 Tharanathan RN, Mahadevamma S (2003) A review grain legumes a boon to human nutrition. Trends Food Sci Technol 14:507–518 Theertha DP, Sujeetha JARP, Abirami K, Alagusundaram K (2014) Effect of moisture content on physical and gravimetric properties of black gram (Vigna Mungo L.). Int. J. Adv. Res Technol 3 (3):97–104 Wani IA, Sogi DS, Wani AA, Gill BS (2013) Physico-chemical and functional properties of flours from Indian kidney bean (Phaseolus vulgaris L.) cultivars. LWT - Food Science Technol 53:278–284

Common Diseases and Insect–Pests of Rice Bean

18

The Vigna genus is an important genus of Leguminosae family comprising wellestablished pulses such as black gram, mung bean and cowpea. These pulses are grown in virtually every corner of the world. They are also recognized valuable for global food production and nutrition. In recent years, considerable emphasis has been laid on the improvement of the yield of these crops. The low production of these pulses is attributed to abiotic and biotic stresses. The biotic stresses often pose a serious threat to their production by increasing cost of cultivation and impairing quality of produce. A number of insect–pests and diseases are known to infest these crops and cause significant damage to foliage and pods thereby reducing the yield from these crops. For example, the floral infestation of blister beetle (Mylabris pustulata) one of the important pests of pulse crops, causes 47.93%, 37.00%, 26.67%, and 17.53% reduction in the yield of pigeon pea, cowpea, urd bean, and mung bean, respectively (Durairaj 2001). Duraimurugan and Tyagi (2014) also reported that the losses due to insect–pest on different varieties of mung bean and urd bean ranged from 27.03% to 38.06% and 15.62% to 30.96% with an average loss of 32.97% and 24.03%, respectively. Rice bean is generally resistant to various diseases which are easily observable in other legumes. However, during unfavorable growing conditions, incidence of few diseases and insects has been observed to cause yield losses in rice bean. The incidence of diseases in rice bean mainly depends on prevailing climatic conditions and geographical positioning of growing area. Areas with heavy rainfall make environment highly conducive for the perpetuation of the different pathogens to infect rice bean. During rainy season, water stagnation in field allows Rhizoctonia solani and Colletotrichum truncatum fungus to perpetuate and cause stem rot and anthracnose diseases, respectively. Therefore, proper field drainage is one of the best control measures for reducing the incidence of these diseases. The symptoms of anthracnose disease start with the yellowing of the leaves and finally leaf drop which directly affects growth and yield. This disease causes severe yield losses if humid conditions prevail for longer period in growing region. In comparison to other members of # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_18

347

348

18

Common Diseases and Insect–Pests of Rice Bean

Vigna genus, rice bean also has low incidence of viral diseases. The descriptions of some diseases which have sporadic occurrence in rice bean (Dhillon and Tanwar 2018) have been detailed below.

18.1

Fungal Diseases

18.1.1 Common Rust 18.1.1.1 Causal Organism: Uromyces appendiculatus (Pers.) Unger Symptoms Initially, rust pustules are whitish, minute, and slightly raised, and at later stage, they turn reddish-brown. During the vegetative phase, rust causes premature leaf fall. After harvesting, complete crop destruction is required to reduce dissemination of disease. Crop rotation also checks the perpetuation of inoculum. The spray of Maneb (Indofil M-45) @ 3 g/L before or immediately after the appearance of rust pustules is effective in controlling the disease.

18.1.2 Powdery Mildew 18.1.2.1 Causal Organism: Oidiopsis taurica (Lev.) Salmon Symptoms A powdery coat appears on leaves, stems, and pods. Severely affected plant parts get shriveled and completely distorted. The affected leaves gradually turn yellow, die, and fall off. The incidence of disease inhibits the pod formation which causes significant reduction in yield. This disease is prominently observed in high humid areas with 20–35  C temperature. Delayed sowing of rice bean seeds can help in reducing the incidence of the disease. Application of Triadimefun-Bayletan 25% EC and carbendazim @ 0.5 g/l can also be useful for the management of the disease.

18.1.3 Rhizoctonia Blight 18.1.3.1 Causal Organism: Rhizoctonia solani Symptoms The disease is characterized by small, irregular, water-soaked, pale greenish spots with damp appearance on the lower leaves. In humid conditions, disease spread rapidly and covers a large portion on leaf stem and pods. The leaflets and pods shrivel, turn brown, and dry up causing significant reduction in the yield. For effective prevention of this disease, the combination of cultural management with chemical application is quite beneficial. Late sowing and maintaining crop rotation and proper drainage are beneficial in controlling the disease. The disease can also be effectively controlled by spraying Bavistin @ 1 g/kg of seed.

18.1

Fungal Diseases

349

18.1.4 Anthracnose 18.1.4.1 Causal Organism: Colletotrichum truncatum Although rice bean is resistant to various diseases, the occurrence of this disease has been observed during unfavorable growing conditions causing significant reduction in the production. The warm and moist weather is suitable for the perpetuation of the pathogen. Infection typically occurs when plant leaf wetness and rain or dew periods exceed 12 h per day. In this disease, sunken, dark brown lesions develop on the cotyledons of seedlings. Seedling lesions may expand to the stem and kill young seedlings. Plants may become infected at any stage of development. The most common symptoms are brown, irregularly shaped spots on the stem and pods. The girding of petioles by large lesions results in premature defoliation. When pods are infected, mycelium may completely fill the cavity, and no seeds are produced or fewer and/or smaller seeds form. Leaf infections result in leaf rolling, necrosis of veins, and premature defoliation.

350

18

Common Diseases and Insect–Pests of Rice Bean

For management of this disease, crop rotation and dumping off infected crop residue incorporation will reduce inoculum. The fungicide treatment of seeds before sowing could be useful in reducing the damage caused by the pathogen.

18.1.5 Cercospora Leaf Spot 18.1.5.1 Causal Organism: Cercospora spp. Symptoms The disease causes spots on leaves and defoliation in most of the legumes including rice bean. Small dry spots initially appear on leaves and get larger and ultimately defoliate the plants. For Cercospora disease management, a most important control strategy is the selection of healthy seeds and solarization of field.

18.2

Bacterial Diseases

18.2.1 Bacterial Blight 18.2.1.1 Causal Organism: Pseudomonas spp. Symptoms Initially small, round or irregular, flat, water-soaked spots surrounded by a greenish-yellow zone appear on leaf. The infection spreads along the veinlets, and veins turn brown and necrotic and cause distortion of leaflets. To control bacterial leaf blight, use of disease-free seed or the treatment of seeds with streptomycin is the beneficial method. Crop rotation and alteration of sowing date are effective management strategy as they provide least favorable conditions for pathogen.

18.3

Viral Diseases

Bean Yellow Mosaic Virus The incidence of this virus causes losses to a number of important pulse crops including Vigna species. In comparison to other species, rice bean is rarely affected by this virus; however, under conditions which are unfavorable to the crop and favorable to the virus, the incidence of this virus has been observed and causes significant reduction in yield. In this disease, initially symptoms appear as small yellow specks along the veins and then spread over the leaf. In severe infections the entire leaf may become chlorotic. In severe case, the chlorotic areas sometimes turn necrotic and induce a downward leaf curling.

18.4

Insect–Pests of Rice Bean

351

Uprooting of the infected plant is the best possible way out to manage this disease.

18.4

Insect–Pests of Rice Bean

Rice bean is generally considered as a pest-free crop, comparatively immune to most storage insects including bruchids, which generally damage other pulses during storage. However, incidence of some of the insects has been observed under unfavorable growing conditions (Khadka and Acharya 2009).

18.4.1 Pod Borers (Helicoverpa armigera Hubner and Lampides boeticus L.) Pod borers are highly polyphagous, feeding on about 200 plant species, mainly annuals, developing on a wide range of crops. Enormous amount of loss has been reported in different crops worldwide. Apart from being highly polyphagous, pod borers are widely adapted to feeding on various plant parts. However, damage to their productive parts particularly to flowers and developing seeds results in direct loss. These insects lay eggs in small clusters on leaves and young pods. The larvae initially feed on the young leaves, and the larger larvae bore into the pods and consume the developing seeds. The larva also damages the fruiting bodies and leaves in several other crops buds and flowers. The larval stage is more destructive than adults. The spray of Margosom Nemarin @ 1.5 ml/ltr has been recommended for Helicoverpa and neem (Azadirachta indica)-based pesticides or Malathion (0.05%) for Lampides.

18.4.2 Aphids (Aphis craccivora Koch) The aphids are dark purple to black-colored insects which are usually wingless, although some may have clear membranous wings. The colonies of aphids contain different sizes of nymphs and adults. Aphids cause direct damage to plants by stunting and distorting the growth feed. Aphids insert their sucking type mouthparts in plant tissue and remove plant sap in large amounts. The heavy infestation of plants with aphids causes yellowing of foliage and distortion of pods which ultimately reduces the yield. The use of parasites and predators is effective for controlling this insect. The aphid population could be managed by spraying dimethoate (0.03%).

352

18

Common Diseases and Insect–Pests of Rice Bean

18.4.3 Blister Beetles (Mylabris pustulata Thunberg) These insects vary by species in shape, size, and color. The mouthparts are specialized for chewing. Blister beetle species feed on flowers and foliage of a wide variety of crops including rice bean, thus affecting the yield considerably. Adult stage of this insect is more detrimental. Adult blister beetles are fast moving and move from one field to another in a short period of time. The insect population can be controlled manually by hand picking. Spraying insecticides of artificial pyrethroid groups can be beneficial for managing this insect.

18.4.4 Green Stink Bugs (Nezara spp.) Both nymphs and adults suck sap from leaves, stem, and pods. The degree of damage depends to some extent on the developmental stage of the plant. Thus, whole plant becomes weak, as well as withered. Immature fruit and pods become deformed, and seeds flattened and shriveled. Bugs can be manually managed by collecting and destroying the nymphs as well as adults.

18.4.5 Pod Weevils (Apion spp.) Young ones feed on immature pods, while adults feed on leaves and flowers. Thus, the seed yield, seed quality, seed germination, and market values are all adversely affected. There are no recommended preventive measures or management practices for this pest. However, the application of dimethoate, monocrotophos, and artificial pyrethroids could be beneficial.

18.4.6 Leaf Folders (Hedylepta indicata Fab) The insects feeding on the leaf are of major importance as they defoliate or remove the chlorophyll content of leaves and lead to considerable reduction in yield. These insects attack rice bean leaves from the early vegetative stage. They fold leaves and form a web of many leaves. Manual and biological control is effective for controlling these insects. However, spray of monocrotophos and dichlorvos is also beneficial.

18.4.7 Pod-Sucking Bugs (Anoplocnemis spp.) With their sucking type mouthparts, they remove sap from immature seeds within the pod, and consequently seeds become wrinkled and black spotted; as a result, seeds lose germination ability and become unfit for human consumption. Systemic pesticides such as dimethoate and monocrotophos are effective against these pests.

References

353

References Dhillon DK, Tanwar B (2018) Rice bean: a healthy and cost-effective alternative for crop and food diversity. Food Secur 10(3):525–535. https://doi.org/10.1007/s12571-018-0803-6 Duraimurugan P, Tyagi K (2014) Pest spectra, succession and its yield losses in mungbean and urdbean underchanging climatic scenario. Legume Res 37:212–222 Durairaj C (2001) A note on the host preference by two species of blister beetle in pulses crops. Madras Agric J 87:355–356 Khadka K, Acharya BD (2009) Cultivation practices of rice bean. Research and Development (LI-BIRD), Local Initiatives for Biodiversity, Pokhara

Strategies for the Projection of Rice Bean as a Potential Pulse

19

Rice bean legume despite of having potential for the utilization of uncultivated marginal lands for cultivation, conserving biodiversity as well as contributing to the food and nutritional security of rural households remained neglected due to the lack of major research programmes focused on this legume. There is a need to strategize and execute scientific efforts for meeting the challenges in the projection and utilization of rice bean. The efforts based on the aspect of deployment of plant genetic diversity through rice bean in agriculture will lead to more balanced and sustainable patterns of development. The different aspects for projection and utilization of rice bean as a potential pulse crop have been presented below.

19.1

Generation and Dissemination of Desired Information

The availability of information is one of the most important constraints in promotion and utilization of rice bean for routine consumption and commercial exploitation. The mainstreaming of rice bean as a pulse crop includes accurate characterization of germplasm resources, identification of wild type, and mapping of existing indigenous knowledge consequently widening the global information on rice bean. Till date a fairly good number of genotypes possessing desirable characteristics such as earliness, extensive branching with higher number of pods, high seed yield, and high degree of resistance to biotic stresses has been identified and their utilization not only lead to the release of new varieties but will also result in the development of lines for mapping of various traits. Rice bean is of great significance for the local people residing in non-accessible areas; hence comprehensive efforts are required to generate information regarding cultivation and potential use of rice bean in their cuisine. The detailed documentation of information which is maintained within the indigenous farming communities would be useful for designing strategies for promoting rice bean as a potential legume. A good communication of information for raising awareness and building capacity among stakeholders regarding the potential uses of rice bean is essentially # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_19

355

356

19

Strategies for the Projection of Rice Bean as a Potential Pulse

required which ultimately increases the demand of rice bean and their products through demonstration sites, success stories, targeted campaigns, and training. Ultimately, all these interventions could influence the policymakers at all levels to overcome barriers for production and marketing of rice bean. If these strategies formulated in well-planned manner, they would result in appropriate policy, which could followed for sustainable production, increased demand, better supply and finally consumption or use of rice bean.

19.2

Enhancing Genome Base

This is also a key aspect which will be important for promotion of rice bean. The maintenance of genetic diversity through both ex situ and in situ conservation can ensure the availability of genetic material to plant breeders for further improvement. In recent past NBPGR, India has made significant contribution in conserving rice bean germplasm from diverse locations in country as well as from other countries. Though efforts have been made, but still there is a great possibility to widen the genome resource base of rice bean from other unexploited resources. Since rice bean is resistant to many of the economic pest in particular to storage insect pest, the availability of resource base would be useful in transferring resistance into susceptible crops. Rice bean occupies important niches, adapted to the risky and fragile conditions, and thereby contributes to sustainable production with minimal inputs. These characteristics endow this legume crop valuable in the improvement of other crops employing breeding techniques. Apart from this, rice bean also contributes to the diversity and the stability of agro-ecosystems. To address the need of rice bean, there is a need to broaden the genomic resource base and focus of research and development with the ultimate objective of sustainable crop productivity.

19.3

Linkage with Stakeholders and Farmers

Unlike globally important crops, rice bean has made significant contribution to local farming communities living in non-accessible areas. The poor and marginalized farmers have utilized and safeguarded the rice bean for many years. Mainstreaming the gender-sensitive approaches allows vulnerable groups like women farmers to enhance their capacity to manage, conserve, and use rice bean in new ways. The efficient research orientation on rice bean need support of farmers and local farming communities in making diversified and resilient agricultural systems through rice bean cultivation. Farmers need access to seed, as well as training in maintaining and exchanging quality seed and planting material. The prerequisites for continuing targeted research and development activities that will use and further increase the global knowledge base on rice bean include increased capacity among the primary stakeholder and a better educated younger generation. This will produce an iterative process that will enable sustainable growth in the production of and demand for rice bean. Developing frameworks for community collaboration can help effectively engage stakeholders and harmonize views objectives and agendas associated with the potential utilization of rice bean as pulse crop. The access of planting material as

19.4

Value Addition and Marketing

357

Fig. 19.1 Rice bean seed distribution among the farmers

seed to farmers can be improved through establishing linkages with local extension workers through organizing Kisan Mela and short-duration training courses at block level. Furthermore, making farmers aware about local seed production and nutritional quality is also essential. In addition to this, timely dissemination of knowledge on adaptation, production technology, and utilization of rice bean is also essentially required for the popularization of rice bean. Comprehensive efforts have been made by our group for establishing linkages with the farmers in order to provide information regarding the potential of rice bean over other pulses. Various extension activities such as training courses have been carried out and farmers were provided with planting material of rice bean. Such activities on a large scale would be useful in mainstreaming of rice bean for its potential utilization and commercial exploitation for the benefit of the farmers (Fig. 19.1).

19.4

Value Addition and Marketing

The technologies developed for commercial crops are not always suited to traditional crops including rice bean. The value addition of the crop or the production of different products could pave way for commercial exploitation of this promising underutilized crop. A change in attitude is noticed over the last two decades among policymakers and the public with regard to the quality of life as related to the quality of food as well as diverse sources of food. Vitamins and other micronutrients are being searched in crops and plant species with greater emphasis than in the past in recognition of their role in combating diet imbalances. Although “hidden hunger” affects mainly developing countries, particularly children and older people, it is increasingly being recorded also among the more vulnerable social groups in developed nations. As rice bean has excellent nutritive value and holds potential nutraceutical value, it could be used for the preparation of the various commercial products of great nutritional value which are quite common in the market such as baby food and food for the lactating mother which holds potential for improving the health of the individuals. Developing and strengthening markets for rice bean at the local, national, and international levels will improve farmers’ access to markets, encourage value adding, and stimulate demand for a wider range of crops.

358

19.5

19

Strategies for the Projection of Rice Bean as a Potential Pulse

Research and Education

It is essential that the existing information on rice bean germplasm should be catalogued, updated accurately, and disseminated among the farmers and consumers efficiently. In recent years, attempts have been made for improvement of rice bean through collection and characterization of germplasm from diverse locations. Though, varieties have been released, but this legume need further improvement by advanced breeding and molecular techniques with desirable characteristics for generating food and sustainable income for farmers. Since little is known about its genome, hence there is a great possibility for retrieving more valuable information by employing next-generation genomic and proteomic technologies. This would also help in maintaining the biochemical and molecular database of rice bean. By maintaining the database of genetic information, several characteristics which are beneficial for bringing significant improvement in the other crop can be transferred from rice bean by employing different crop improvement approaches. For brining continued improvement and deployment of the rice bean in existing cropping system, multilocational trials would also be useful in assessing its performance in different growing conditions in the country. Rice bean is also need to be tested in other parts of the tropical world where climate change mitigation is posing a serious challenge to agriculture and animal husbandry.

19.6

Creation of Supportive Policy Environment

Favorable policies and legal frameworks are much needed to support the research, cultivation, and promotional strategies of rice bean. Sincere efforts of the different nongovernment organizations along with government organizations are also required to create a supportive environment by developing policies that promote rice bean as part of, for example, 1. 2. 3. 4. 5.

School feeding programs and sustainable diets. Enriching food aid with rice bean. Providing subsidies for growing and marketing rice bean. Providing official support for education, campaigns to promote use of rice bean. Financial assistance for running communication campaigns on utilization of rice bean.

With continuous upgradation in existing policies with development of new technologies, one is required to facilitate different research projects on rice bean, and farmers participation in these projects should be encouraged. The demonstration of the production of value-added products with rice bean and better packaging can also be used for catching the eye of consumers. Further these products should also available at popular food outlets. The chemical, nutritional, and sensory evaluations along with extensive market surveys should be conducted at different intervals to make an assessment of the progress in promotion of rice bean. The varieties excelling in nutritional quality, productivity, and processing quality need wide extension (Table 19.1 and Fig. 19.2).

19.6

Creation of Supportive Policy Environment

359

Table 19.1 Limitation and possible solutions for rice bean projection and utilization Limitation Lack of awareness

Lack of information

Probable cause • No policy and investment support • Poor knowledge and communication • Lack of social marketing • Scarcity of genetic material • Infrastructure lacking • Information not linked to action learning • Lack of research on genetic diversity assessment and use

Inadequate marketing opportunities

• Transport, cold chain, packaging, quality, hygiene, appearance • Lack of promotions • Lack of private sector partnerships • Limited supply and demand

Lack of coordination

• Poor communication • Lack of common goals and priorities • Lack of mechanisms for coordination • Unsupportive nature of policymakers for new risky initiatives • Prioritization of conventional food crops • Policymakers not aware of potential of rice bean • Lack of budgetary and financial support • Lack of awareness • Low priority by partners • Inadequate financial support • Limited scientific capacity • Insufficient information exchange

Inadequate policies

Lack of (access to) technologies (production, postharvest, processing, packaging)

Possible solution • Shifting focus of attention from few staple legumes • Increasing awareness on the sociocultural use

• Prioritization • Gather information on traditional knowledge • Documenting traditional knowledge • Public awareness on role of traditional knowledge • User definition promotion campaign, market niche studies • Development of resources, skills, and infrastructure • Improvement in the scientific information related to health and nutrition • Enhanced production of value added products • Enhance information • Policy support • Strengthening partnerships and capacities • Increasing flow of money for research and development on rice bean • Improving profitability of rice bean cultivation

• Providing sufficient training opportunities for the rice bean cultivation and other agronomic appraisals • Enhanced knowledge on rice bean processing for improving nutritive value

360

19

Strategies for the Projection of Rice Bean as a Potential Pulse

Generation, collection and documentation of all scientific information on rice bean

Increased global knowledge on rice bean

Dissemination of available information

New policies

Market development Education and research Increased stakeholders capacity

Increased awareness Sustainable production Appropriate policies

Better supply

Consumption of rice bean and niche based production

Increase in demand

Best utilization of crop

Multiple benefits to masses

Fig. 19.2 Strategies for the projection and utilization of rice bean (ovals indicate potential interventions, and rectangle represents outcomes of potential interventions)

Conclusion and Future Prospects

20

1. During the period between 1960s and 1980s, almost all the efforts of the green revolution were focused on bringing significant improvement in few staple crops. However, overdependence on a few crop species exacerbated many difficulties in food security, nutrition and health. The food security with dependency on narrow food base has made the food supply chain extremely vulnerable. Moreover, lack of genetic diversity within the gene pool of few crops has made agricultural systems vulnerable to biotic and abiotic stresses. Due to overdependency on few staple crops, different local and traditional crops were lost. In the recent times few of these crops again remain neglected due to the lack of awareness regarding their potential benefits for the betterment of the communities. In many areas of the world, these crops have been lost along with the traditional knowledge of their cultivation and uses. 2. Due to building population pressure and increasing urbanization the productive agricultural land is being used for the urban development resulting in intense pressure on the remaining available agricultural land. The aggravating situation of malnutrition, poverty, degradation of agroecosystems, and the impacts of climate change on crop production necessitates firm and more consistent actions for broadening the food basket of the world by supporting and promoting the development of different traditional crops. With the growing awareness, the underutilized crops are moving out from the dark. In the recent times, there is growing interest in new food resources which can contribute in novel ways for the improvement of human health and nutrition. A number of national and international frameworks have been associated with the promotion and utilization of underutilized crops in different cropping systems of the world. These include United Nation agencies such as FAO and different conventions including CBD, IPGRI, CGIAR, ICARDA, and others with global mandates for agriculture, biodiversity, and sustainable development. The regional organizations concerned with the distinctive, economically, and culturally important species of a region are also playing a crucial role on the promotion of these crops. The underutilized crops could be exploited to develop # Springer Nature Singapore Pte Ltd. 2020 R. Katoch, Ricebean, https://doi.org/10.1007/978-981-15-5293-9_20

361

362

20

Conclusion and Future Prospects

markets for non-staple crops from which poor communities can improve the socio-economic status. At present there is a much need for improving agriculture production instead of green revolution technologies which were based on genetic improvement of the staple crops but at high external cost. Although, the green revolution managed the problem of hunger in different countries, but it also resulted in inappropriate and excessive use of agrochemicals, loss of beneficial biodiversity and reduction in crop and varietal diversity. 3. In the present scenario, there is a lot of concern for hidden hunger and malnutrition in the developing and underdeveloped countries. This worrisome situation is probably due to inadequacy of nutritionally rich food for the people residing in the developing and underdeveloped countries and further overdependency on few staple crops. This situation has gained the attention of the food researchers to identify alternative food resources which are least exploited and have excellent nutritive value. A number of crops have been identified from different corners of the world representing a potential substitute to the few staple crops on which a large segment of the world population is heavily dependent. Among these crops, rice bean is a valuable multipurpose legume with a number of favorable agronomic and nutritional characteristics in comparison with other traditional pulses. Rice bean has excellent nutritive value which is mainly attributed to high bioavailability of proteins, favorable amino acid composition and appreciable level of different micronutrients. Therefore, it is well recognized as an alternative and as a supplement to scarce food sources for economically marginalized people. Compared to recommended daily requirements, the consumption of rice bean can provide considerable amounts of dietary protein, essential amino acids, and minerals. Rice bean also has a very low level of fats which make this crop as a nutritious health package. Due to the excellent nutritional profile of the crop with appreciable level of essential nutrients in particular to the methionine and lysine amino acids the legume has importance in the nutritional security programmes. Therefore, the inclusion of the rice bean in daily diet routine could possibly a rational approach to combat malnutrition and hidden hunger in the people. The great adaptive polymorphism with rich genetic diversity, high yield, and nutritional potential suggests that rice bean has potential to alleviate hunger directly by ensuring production in challenging environmental conditions. Therefore, rice bean need to be explored keeping in view the situation of global food production and nutritional security. The presence of certain anti-nutrients/incriminating factors must not be considered impediment in the safe use of this legume, as proper processing methods improves the nutritional quality of the legume. Germination followed by cooking has been observed as a best processing technique for improving the nutritional quality of rice bean. The application of modern processing methods along with traditional knowledge will definitely provide a substantial bases for the commercial exploitation of rice bean for developing new food products, bio-fortification as well as for use in the pharmaceutical industry. 4. Rice bean seeds are rich in dietary fiber, proteins and nutraceuticals which promote health and longevity by curing chronic diseases. Owing to different

20

5.

6.

7.

8.

9.

Conclusion and Future Prospects

363

nutritional attributes this potential legume could be an essential component of the routine diet of an individual. Besides being a potential pulse crop, rice bean also produces nutritious fodder comparable to other traditional leguminous fodder. By virtue of its high fodder production potential, it is now attracting attention as a leguminous fodder crop which could be an alternate feed shortages during lean periods. As a shortduration and close-growing crop with tender stems and green foliage even at maturity, rice bean is ideal for catch-cropping, intercropping, and multiplecropping systems and also serves as an excellent cover crop and green manure crop. Breeding of varieties with desirable traits has been the method of choice and tremendously successful for improving the nutritional status of food crops, but because of time consumption, limited genetic resources, and exploitation of traditional landraces of most of the crops, little space is left for the improvement of crop plants by these methods. Modern recombinant technologies are highly efficient which enable researchers to move genes across species without any taxonomical limitations. The advancements in plant transformation technologies have helped to incorporate genes of interest in crop plants of economic importance. Gene editing systems have emerged as a new horizon to for further improvement in this minor legume. The potential of RNAi has also been recognized in reducing the levels of undesirable components (anti-nutrients) in edible plant parts by downregulation of genes encoding these components. Therefore, it will be a versatile approach for the improvement of a large number of underutilized crops including rice bean. Application of modern biotechnological methods might provide sufficient support for developing transgenic plants with less anti-nutrients or toxicological factors in underutilized crops. Recently CRISPR-Cas 9 genome editing system has received the focus of attention of the food researchers globally for gene manipulation in wellestablished food crops for improving yield, nutritional value, disease resistance and other important traits. In last 5 years, this technique is being applied vigorously in many plant systems for functional studies and combating biotic and abiotic stresses as well as to improve other important agronomic traits. This system of genome editing has enormous potential for improving quality and production from underutilized crops to achieve the goal of zero hunger and regular food supply for growing population. Crop losses due to biotic and abiotic stresses have seriously paralyzed the global agriculture productivity. Though success was achieved through implication of chemical control strategies, but the evidences of their hazardous effect on the human health and environment made researchers to look for other alternative strategies to reduce crop losses with an overall objective of increasing global agricultural productivity. The generation of transgenic plants expressing entomotoxic proteins of Bacillus thuringiensis (Bt) bacteria through recombinant DNA technology is one of the milestone in crop protection. However, the emerging evidences of pest resurgence and development of resistance in insects

364

10.

11.

12. 13.

14.

20

Conclusion and Future Prospects

against Bt have necessitate the use of gene encoding plant inhibitory proteins. Rice bean has high level of resistance to the major storage pest bruchid beetles (Callosobruchus spp.), and studies attributed this ability of rice bean to the high level of plant inhibitory proteins in seeds (Kashiwaba et al. 2003; Somta et al. 2006; Tomooka et al. 2000). For the first time, the gene encoding protease inhibitor (RbTI) and lectin (RbL) has been successfully cloned and characterized by our group from rice bean. Protease inhibitor and other resistance factors from rice bean may allow researchers to use protein engineering as a tool to design novel chimeric proteins for insect pest control. The long-term goal of protein engineering would be construction of modular proteins that will target specific pests without harmful effects on the beneficial organisms. As much more efforts are geared toward food and nutritional security and improvement in the economic conditions of people in countries where unreliable supply of food exists, more research should be conducted on the relevant attributes of rice bean. Rice bean holds great potential to be utilized as nutraceutical food owing to the appreciable amount of bioactive compounds. The excellent proportions of phenolic compounds make this crop as an excellent supplier of antioxidative compounds. Apart from this, rice bean has prospects to be served as a potential cure for treating obesity and diabetes. Furthermore, there are still great possibilities for its chemoprofile, pharmacology, biological evaluation, toxicological consequences, innate health-promoting aspects, and many undiscovered phytochemicals and multipurpose usage. In addition to resistance against insect pest, rice bean also shows high degree of resistance to the diseases which are common in other legumes of same group. Rice bean could be utilized as a donor parent in transferring resistance in susceptible crops through breeding approaches. The value addition is a term frequently mentioned when discussing the future profitability of agriculture. In general, adding value is the process of changing or transforming a product from its original state to a more valuable state. With the continuous shifting to a global economy, the international market for valueadded products is growing. Market forces have led to greater opportunities for product differentiation and added value to raw commodities because of (a) Increased consumer demands regarding health, nutrition, and convenience. (b) Efforts by food processors to improve their productivity. (c) Technological advances that enable producers to produce what consumers and processors desire. Production of value-added product from rice bean is one of the key strategies to promote the utilization and commercial exploitation of this underutilized crop. Today the food habits of the people are continuously changing; hence their requirements are changing and become more oriented to take food of excellent nutritive value. Rice bean has excellent proportions of essential nutrients; hence the production of value-added products from this underutilized crop could be useful in its commercial exploitation and valuable in combating malnutrition in people. Today various commercial products are prepared of different

References

365

ingredients, where legume and cereals are two major ingredients. The replacement of legumes in such foods with rice bean could enhance their nutritive value. The farming community needs to diversify and take up allied activities as well as to supplement household income. It has been well established that technology should not be confide to the group of people or the area and must be disseminated. The transfer of technology on the preparation of different value-added products would be useful in making the farmers more smart and self-reliant by raising household income. 15. It could be concluded that rice bean as well as other orphan crops do have the substantial potential to add the variety and nutritional value of local diets and improve food security that could bring improvement in the global nutritional security. Rice bean and other orphan crops also offer substantial, indirect ecological benefits in terms of nitrogen fixation, animal fodder, soil erosion control and pest and drought resistance. With the advancement of new research technologies in the last few decades and the possibilities of even greater developments in the future, agricultural scientists need to focus on the potential of rice bean and other potential crops and considered them as a “window of opportunity” to mitigate environmental unsustainability and attainment of global food and nutritional security.

References Kashiwaba K, Tomooka N, Kaga A, Han O-K, Vaughan DA (2003) Characterization of resistance to three Bruchid species (Callosobruchus spp., Coleoptera, Bruchidae) in cultivated Rice bean (Vigna umbellata). J Econ Entomol 96:207–213 Somta P, Kaga A, Tomooka N, Kashiwaba K, Isemura T, Chaitieng B, Srinivas P, Vaughan DA (2006) Development of an interspecific Vigna linkage map between Vigna umbellata (Thunb.) Ohwi & Ohashi and V. nakashimae (Ohwi) Ohwi & Ohashi and its use in analysis of bruchid resistance and comparative genomics. Plant Breed 125:77–84 Tomooka N, Kashiwaba K, Vaughan DA, Ishimoto M, Egawa Y (2000) The effectiveness of evaluating wild species: searching for sources of resistance to bruchid beetles in the genus Vigna subgenus Ceratotropis. Euphytica 115:27–41