Polycomb Group Proteins: Methods and Protocols [2 ed.] 107163142X, 9781071631423

Citation preview

Methods in Molecular Biology 2655

Chiara Lanzuolo · Federica Marasca  Editors

Polycomb Group Proteins Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by step fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Polycomb Group Proteins Methods and Protocols Second Edition

Edited by

Chiara Lanzuolo Institute of Biomedical Technologies, National Research Council, Milan, Italy; Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy

Federica Marasca Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy

Editors Chiara Lanzuolo Institute of Biomedical Technologies National Research Council Milan, Italy

Federica Marasca Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi” INGM, Milan, Italy

Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi” INGM, Milan, Italy

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-3142-3 ISBN 978-1-0716-3143-0 (eBook) https://doi.org/10.1007/978-1-0716-3143-0 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface The Polycomb group of proteins (PcG proteins) is one of the most studied families of epigenetic transcriptional repressors involved in several biological and cellular processes. Historically studied in the context of complex organism’s development where they play a fundamental role for the body formation, in the last years it has been demonstrated that they also govern lineage commitment, cell differentiation, and the capacity of cell to adapt to the environment. In the adult organism, PcG proteins are strictly required for the maintenance of the adult tissue self-renew and alterations of their functions can cause severe diseases. At the molecular level, PcG proteins act on chromatin at various levels of regulation, from modification of histone tails to modulation of DNA-DNA association (reviewed in [1]). In the nuclear space, PcG proteins are organized into aggregates called PcG bodies, which regulate both the 2D and 3D structures finally ensuring the transcriptional repression. The complexity of PcG world is exerted by a surprisingly complex diversity that, through a combinatorial association of subunits and other cofactors, determine the enzymatic function, the targets, and the cellular specificity. Considering the multiple PcG functions and properties, it is not surprising that the intracellular levels of each subunit is highly regulated and that any alterations of the complex composition can have drastic consequences for human health. Most of the studies described mechanisms through which PcG can be directly or indirectly involve in cancer [2]. However, increasing evidence suggest PcG involvement in other diseases [3, 4]. On the other hand, PcG proteins can represent an important target in several therapies and pharmaceutical companies are already investing in the production of potent Polycomb inhibitors with promising potential [5]. In the last decade, many advanced technologies have been applied in diverse cellular models in order to deeper investigate the context-dependent PcG multifaceted functions. The next generation of genomics and molecular biology hold the promise to facilitate the molecular understanding of PcG pathways. This chapter collection put together the most updated technologies used in the PcG field to help scientists working on Polycomb to investigate all multiple functions of PcG proteins in diverse cellular contexts. Milan, Italy Milan, Italy

Chiara Lanzuolo Federica Marasca

References 1. Doyle EJ, Morey L, Conway E (2022) Know when to fold ’em: Polycomb complexes in oncogenic 3D genome regulation. Front cell Dev Biol 10:986319. 2. German B, Ellis L. Polycomb directed cell fate decisions in development and cancer. Epigenomes. 2022;6:28 3. Varghese SS, Dhawan S (2022) Polycomb repressive complexes: shaping pancreatic beta-cell destiny in development and metabolic disease. Front cell Dev Biol 10:868592

v

vi

Preface

4. Bianchi A, Mozzetta C, Pegoli G, Lucini F, Valsoni S, Rosti V et al (2020) Dysfunctional polycomb transcriptional repression contributes to lamin A/C-dependent muscular dystrophy. J Clin Invest. 130:2408–2421 5. Kreso A, Van Galen P, Pedley NM, Lima-Fernandes E, Frelin C, Davis T et al (2014) Self-renewal as a therapeutic target in human colorectal cancer. Nat Med 20:29–36

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 Analyzing the Genome-Wide Distribution of Histone Marks by CUT&Tag in Drosophila Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Fides Zenk, Francesco Cardamone, Dafne Andrea Ibarra Morales, Nazerke Atinbayeva, Yinxiu Zhan, and Nicola Iovino 2 Chromatin Preparation and Chromatin Immunoprecipitation from Drosophila Heads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Davide Andrenacci and Filippo M. Cernilogar 3 Detecting Cell Compartment-Specific PRC2-RNA Interactions via UV-RIP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Francesco Della Valle, Peng Liu, Gabriele Morelli, and Valerio Orlando 4 Chromosome Conformation Capture Followed by Genome-Wide Sequencing (Hi-C) in Drosophila Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Francesco Cardamone, Yinxiu Zhan, Nicola Iovino, and Fides Zenk 5 Physics-Based Polymer Models to Probe Chromosome Structure in Single Molecules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mattia Conte, Andrea M. Chiariello, Simona Bianco, Andrea Esposito, Alex Abraham, and Mario Nicodemi 6 Co-Immunoprecipitation (Co-Ip) in Mammalian Cells . . . . . . . . . . . . . . . . . . . . . . Federica Lo Sardo 7 Site-Directed Mutagenesis Protocol to Determine the Role of Amino Acid Residues in Polycomb Group (PcG) Protein Function . . . . . . . . . . . Diaa Al-Raawi and Aditi Kanhere 8 Isolation of Chromatin Proteins by Genome Capture . . . . . . . . . . . . . . . . . . . . . . . Sergi Aranda and Luciano Di Croce 9 Dynamic Interactome of PRC2-EZH1 Complex Using Tandem-Affinity Purification and Quantitative Mass Spectrometry . . . . . . . . . . . . Peng Liu, Huoming Zhang, Francesco Della Valle, and Valerio Orlando 10 Replication Timing of Gene Loci in Different Cell Cycle Phases . . . . . . . . . . . . . . Irene Cantone 11 Polycomb Bodies Detection in Murine Fibromuscular Stroma from Skin, Skeletal Muscles, and Aortic Tissues. . . . . . . . . . . . . . . . . . . . . . . . . . . . . Valentina Rosti, Francesca Gorini, Philina Santarelli, Maria Lucia Sarnicola, Silvia Magnani, and Chiara Lanzuolo 12 Segmentation, 3D Reconstruction, and Analysis of PcG Proteins in Fluorescence Microscopy Images in Different Cell Culture Conditions. . . . . . Francesco Gregoretti, Federica Lucini, Elisa Cesarini, Gennaro Oliva, Chiara Lanzuolo, and Laura Antonelli

vii

v ix

1

19

31

41

57

67

79 91

101 117

125

147

viii

13

Contents

STORM Microscopy and Cluster Analysis for PcG Studies . . . . . . . . . . . . . . . . . . . Laura Martin, Alvaro Castells-Garcia, Maria Pia Cosma, and Maria Victoria Neguembor Quantitative Analysis of PcG-Associated Condensates by Stochastic Optical Reconstruction Microscopy (STORM) . . . . . . . . . . . . . . . . . . . Silvia Scalisi, Ali Ahmad, Sarah D’Annunzio, David Rousseau, and Alessio Zippo Immunoelectron Microscopy Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stefano Squarzoni Differentiation of hPSCs to Study PRC2 Role in Cell-Fate Specification and Neurodevelopment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Silvia Brocchetti and Paola Conforti Analysis of Polycomb Epigenetic Marks in HeLa Spheroids . . . . . . . . . . . . . . . . . . Carlo Di Cristo and Maria Vivo Establishment and Maintenance of Human CRC-Derived Organoids for PcG Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Giulia Della Chiara and Massimiliano Pagani

171

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

245

14

15 16

17 18

183

201

211 221

231

Contributors ` di Napoli Federico II, and INFN ALEX ABRAHAM • Dipartimento di Fisica, Universita Napoli, Complesso di Monte Sant’Angelo, Naples, Italy ALI AHMAD • Laboratoire Angevin de Recherche en Inge´nierie des Syste`mes, UMR INRAE IRHS, Universite´ d’Angers, Angers, France DIAA AL-RAAWI • Science Faculty, Sana’a University, Sana’a, Yemen DAVIDE ANDRENACCI • CNR Institute of Molecular Genetics “Luigi-Luca Cavalli-Sforza”, Unit of Bologna, Bologna, Italy; IRCCS Istituto Ortopedico Rizzoli, Bologna, Italy LAURA ANTONELLI • Institute for High Performance Computing and Networking, ICARCNR, Naples, Italy SERGI ARANDA • Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Barcelona, Spain NAZERKE ATINBAYEVA • Max Planck Institute of Immunobiology and Epigenetics, Freiburg im Breisgau, Germany; University of Freiburg, Faculty of Biology, Freiburg im Breisgau, Germany ` di Napoli Federico II, and INFN SIMONA BIANCO • Dipartimento di Fisica, Universita Napoli, Complesso di Monte Sant’Angelo, Naples, Italy SILVIA BROCCHETTI • AXXAM S.p.A.- Openzone, Bresso – Milan, Italy IRENE CANTONE • Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, Naples, Italy FRANCESCO CARDAMONE • Max Planck Institute of Immunobiology and Epigenetics, Freiburg im Breisgau, Germany; University of Freiburg, Faculty of Biology, Freiburg im Breisgau, Germany ALVARO CASTELLS-GARCIA • Medical Research Institute, Guangdong Provincial People’s Hospital (Guangdong Academy of Medical Sciences), Southern Medical University, Guangzhou, China FILIPPO M. CERNILOGAR • Division of Molecular Biology, Biomedical Center (BMC), Ludwig-Maximilians-University (LMU) Munich, Planegg, Germany ELISA CESARINI • Institute of Biochemistry and Cellular Biology, IBBC-CNR, Rome, Italy ` di Napoli Federico II, and ANDREA M. CHIARIELLO • Dipartimento di Fisica, Universita INFN Napoli, Complesso di Monte Sant’Angelo, Naples, Italy PAOLA CONFORTI • Laboratory of Stem Cell Biology and Pharmacology of Neurodegenerative Diseases, Department of Biosciences, University of Milan and INGM, Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, Milan, Italy ` di Napoli Federico II, and INFN MATTIA CONTE • Dipartimento di Fisica, Universita Napoli, Complesso di Monte Sant’Angelo, Naples, Italy MARIA PIA COSMA • Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Barcelona, Spain; Medical Research Institute, Guangdong Provincial People’s Hospital (Guangdong Academy of Medical Sciences), Southern Medical University, Guangzhou, China; Universitat Pompeu Fabra (UPF), Barcelona, Spain; Institucio Catalana de Recerca i Estudis Avanc¸ats (ICREA), Barcelona, Spain SARAH D’ANNUNZIO • Chromatin Biology & Epigenetics Lab, Department of Cellular, Computational, and Integrative Biology (CIBIO), University of Trento, Trento, Italy

ix

x

Contributors

GIULIA DELLA CHIARA • IFOM ETS – The AIRC Institute of Molecular Oncology, Milan, ` degli Italy; Department of Medical Biotechnology and Translational Medicine, Universita Studi di Milano, Milan, Italy FRANCESCO DELLA VALLE • King Abdullah University of Science and Technology, Biological and Environmental Sciences and Engineering Division, KAUST Environmental Epigenetics Research Program, Thuwal, Kingdom of Saudi Arabia ` del Sannio, CARLO DI CRISTO • Dipartimento di Scienze e Tecnologie (DST), Universita Benevento, Italy LUCIANO DI CROCE • Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Barcelona, Spain; Universitat Pompeu Fabra (UPF), Barcelona, Spain; ICREA, Barcelona, Spain ` di Napoli Federico II, and INFN ANDREA ESPOSITO • Dipartimento di Fisica, Universita Napoli, Complesso di Monte Sant’Angelo, Naples, Italy FRANCESCA GORINI • Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy FRANCESCO GREGORETTI • Institute for High Performance Computing and Networking, ICAR-CNR, Naples, Italy DAFNE ANDREA IBARRA MORALES • Max Planck Institute of Immunobiology and Epigenetics, Freiburg im Breisgau, Germany; University of Freiburg, Faculty of Biology, Freiburg im Breisgau, Germany NICOLA IOVINO • Max Planck Institute of Immunobiology and Epigenetics, Freiburg im Breisgau, Germany ADITI KANHERE • Institute of System, Molecular and Integrative Biology, University of Liverpool, Liverpool, UK CHIARA LANZUOLO • Institute of Biomedical Technologies, National Research Council, Milan, Italy; Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy PENG LIU • King Abdullah University of Science and Technology, Biological and Environmental Sciences and Engineering Division, KAUST Environmental Epigenetics Research Program, Thuwal, Kingdom of Saudi Arabia FEDERICA LO SARDO • IRCCS Regina Elena National Cancer Institute, UOC ricerca traslazionale oncologica, Rome, Italy FEDERICA LUCINI • Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, Milan, Italy; IFOM, Institute Foundation of Molecular Oncology, Milan, Italy SILVIA MAGNANI • Charles River Laboratories Italia S.r.l., Milan, Italy LAURA MARTIN • Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Barcelona, Spain GABRIELE MORELLI • King Abdullah University of Science and Technology, Biological and Environmental Sciences and Engineering Division, KAUST Environmental Epigenetics Research Program, Thuwal, Kingdom of Saudi Arabia MARIA VICTORIA NEGUEMBOR • Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Barcelona, Spain ` di Napoli Federico II, and INFN MARIO NICODEMI • Dipartimento di Fisica, Universita Napoli, Complesso di Monte Sant’Angelo, Naples, Italy; Berlin Institute for Medical Systems Biology, Max-Delbru¨ck Centre (MDC) for Molecular Medicine, Berlin, Germany; Berlin Institute of Health (BIH), MDC-Berlin, Berlin, Germany

Contributors

xi

GENNARO OLIVA • Institute for High Performance Computing and Networking, ICARCNR, Naples, Italy VALERIO ORLANDO • King Abdullah University of Science and Technology, Biological and Environmental Sciences and Engineering Division, KAUST Environmental Epigenetics Research Program, Thuwal, Kingdom of Saudi Arabia MASSIMILIANO PAGANI • IFOM ETS – The AIRC Institute of Molecular Oncology, Milan, ` degli Italy; Department of Medical Biotechnology and Translational Medicine, Universita Studi di Milano, Milan, Italy VALENTINA ROSTI • Institute of Biomedical Technologies, National Research Council, Milan, Italy; Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy DAVID ROUSSEAU • Laboratoire Angevin de Recherche en Inge´nierie des Syste`mes, UMR INRAE IRHS, Universite´ d’Angers, Angers, France PHILINA SANTARELLI • Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy MARIA LUCIA SARNICOLA • Istituto Nazionale di Genetica Molecolare “Romeo ed Enrica Invernizzi”, INGM, Milan, Italy SILVIA SCALISI • Chromatin Biology & Epigenetics Lab, Department of Cellular, Computational, and Integrative Biology (CIBIO), University of Trento, Trento, Italy STEFANO SQUARZONI • CNR Institute of Molecular Genetics “Luigi Luca Cavalli-Sforza”, Unit of Bologna, Bologna, Italy; IRCCS Istituto Ortopedico Rizzoli, Bologna, Italy MARIA VIVO • Department of Chemistry and Biology “Adolfo Zambelli”, University of Salerno, Fisciano, Italy FIDES ZENK • Department of Biosystems Science and Engineering ETH (D-BSSE ETH Zu¨rich), Basel, Switzerland YINXIU ZHAN • Department of Experimental Oncology, European Institute of Oncology IRCCS, Milan, Italy HUOMING ZHANG • King Abdullah University of Science and Technology, Core Labs, Thuwal, Kingdom of Saudi Arabia ALESSIO ZIPPO • Chromatin Biology & Epigenetics Lab, Department of Cellular, Computational, and Integrative Biology (CIBIO), University of Trento, Trento, Italy

Chapter 1 Analyzing the Genome-Wide Distribution of Histone Marks by CUT&Tag in Drosophila Embryos Fides Zenk, Francesco Cardamone, Dafne Andrea Ibarra Morales, Nazerke Atinbayeva, Yinxiu Zhan, and Nicola Iovino Abstract CUT&Tag is a method to map the genome-wide distribution of histone modifications and some chromatin-associated proteins. CUT&Tag relies on antibody-targeted chromatin tagmentation and can easily be scaled up or automatized. This protocol provides clear experimental guidelines and helpful considerations when planning and executing CUT&Tag experiments. Key words CUT&Tag (Cleavage Under Targets and Tagmentation), Drosophila embryos, Histone modifications

1

Introduction Since 2019 CUT&Tag has become a very popular method that is widely used to map histone modifications and some nuclear protein complexes (e.g., PolII and CTCF) in bulk, but has also been applied to single cells [1–3]. Briefly, CUT&Tag uses a Tn5 tethered to protein A that can bind to constant regions of antibodies. The Tn5 binds its targets in situ and cleavage is activated through the addition of MgCl2. Tn5 directly integrates sequencing adaptors into the DNA that can be used to amplify the fragments by PCR. At this step, the target regions will be enriched. The Tn5 has intrinsically a high affinity to bind to open chromatin (the reason it is popular for ATAC experiments), to prevent this unspecific binding, the Tn5 is added to chromatin in high salt conditions (300 mM NaCl), which in turn can destabilize some protein complexes, but does not affect the binding of histones. For that reason, testing the optimal experimental conditions for different protein complexes is highly recommended for CUT&Tag. We will introduce two protocol variants that use either native or crosslinked chromatin for the experiment.

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

1

2

Fides Zenk et al.

Fig. 1 Overview of the experimental procedure. Embryos are hand-sorted, collected, and stored until nuclei isolation. All incubation steps happen in situ inside the nucleus. The protein A-Tn5 is tethered through the primary and secondary antibody to any site in the genome. At the last step, cutting is induced by the addition of MgCl2. After purification of the DNA –fragments, libraries are amplified, indexed, and submitted for next-generation sequencing

Latest developments of the method directly couple the Tn5 chemically or through protein fusion to an antibody of choice and use customized adapters in order to profile several modalities at the same time in the same nuclei suspension [4–6]. In order to make quantitative comparisons, we will introduce a protocol that includes H3 CUT&Tag as well as lambda-DNA spike-ins that allow a systematic analysis of different treatments or experimental conditions. Figure 1 shows an overview of the experimental steps.

CUT & Tag in Drosophila Embryos

2

3

Material and Reagents

2.1 Embryo Collection

Standard equipment for fly husbandry and maintenance is required. 1. Embryo collection cages (compatible with 60 mm petri dishes are suitable for our approach). For large-scale collection, cages compatible with 100 mm petri dishes are recommended. 2. Petri dishes diameter fitting with fly cages. 3. Magnetic/heating stirrer. 4. Apple juice agar plates (see Note 1). 5. Yeast paste (see Note 2). 6. 50% “bleach” solution using sodium hypochlorite (6–14% active chlorine). 7. 70 μm pore size sieves or homemade mesh baskets for embryo collection. 8. Soft paintbrush. 9. Distilled water. 10. Paper towel. 11. Stereo microscope with transmitted light. 12. Cooling/heating chamber for microscopes. 13. External temperature circulator).

control

system

(heating–cooling

14. Glass chamber slide, single well. 15. Halocarbon oil 27 (Sigma 9002-83-9). 2.2 Protein–DNA Cross-Link

1. Buffer A: 15 mM HEPES [pH 7.9], 60 mM KCl, 15 mM NaCl, and 4 mM MgCl2. 2. Buffer A-TX: Buffer A supplemented with Triton X-100 to 0.1% (v/v) final. 3. Two-phase fixing solution (prepare freshly before use) (see Note 3). 4. 2.5 M of glycine solution. 5. Screw-cap glass tube 24 × 100, conical (Witeg, 4945302). 6. Glass Pasteur pipette. 7. Orbital shaker equipped with tension roller attachment.

2.3 General Chemicals and Solutions

1. 1 M HEPES [pH 7.5]. 2. 5 M NaCl. 3. 1 M KCl. 4. 1 M CaCl2. 5. 1 M MnCl2.

4

Fides Zenk et al.

6. 10% Tween. 7. 0.5 M EDTA. 8. 5% Digitonin; store at 4 °C and solubilize at 65 °C for 5–10 min before use. 9. 0.5 M Spermidine stock (see Note 4). 10. 1 M Sodium butyrate stock (see Note 5). 2.4 Nuclear Isolation, Binding to Concanavalin Beads and Primary Antibody Binding

1. Wash buffer: 20 mM HEPES [pH 7.5], 150 mM NaCl, 0.5 mM spermidine, 5 mM sodium butyrate, 1× Protease Inhibitor Cocktail. 2. Binding buffer: 20 mM HEPES [pH 7.5], 10 mM KCl, 1 mM CaCl2, 1 mM MnCl2. 3. BioMag®Plus Concanavalin A (Polysciences, 86057-3). 4. Disposable Pellet Mixers and Cordless Motor (VWR V9951901). 5. Protein low-binding tubes. 6. Refrigerated tabletop centrifuge. 7. Thermomixer. 8. DynaMag™-2 Magnet.

2.5 Secondary Antibody Binding and Tagmentation

1. High salt wash buffer: 20 mM HEPES [pH 7.5], 300 mM NaCl, 0.5 mM spermidine, 5 mM sodium butyrate, 1× Protease Inhibitor Cocktail. 2. Tn5 protein (homemade [7] from 3XFlag-pA-Tn5-Fl (Addgene Plasmid #124601), loaded with adaptor oligos at a concentration of 100 mM in TE: Tn5MErev, 5′-[phos] CTGTCTCTTATACACATCT-3′; Tn5ME-A (Illumina FC-121-1030), 5′-TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAG-3′; Tn5ME-B (Illumina FC-121-1031), 5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′). 3. 20% SDS. 4. Proteinase K. 5. Thermomixer. 6. DynaMag™-2 Magnet.

2.6

DNA Purification

1. ChIP DNA Clean&Concentrator Kit (Zymo Research D5205). 2. EB buffer (Qiagen 19086). 3. Lambda-DNA (NEB, N3011S), tagment with Tn5 and cleanup on columns or NucleoMag beads before use. Prepare 100 ng stock solution. 4. Tabletop centrifuge.

CUT & Tag in Drosophila Embryos

2.7 Library Preparation

5

1. Nebnext® High-Fidelity 2X PCR Master Mix (NEB, M0541S). 2. 25 mM Index Primer/i7 Primer (see table below, sequences from [8]). 3. 25 mM Index Primer/i5 Primer (see table below, sequences from [8]). 4. NucleoMag kit for clean-up and size selection of NGS library prep reactions (Macherey-Nagel 744970). 5. 0.2 mL PCR eight-tube stripes. 6. Thermocycler. 7. Dynamag PCR magnet. 8. EB buffer (Qiagen 19086). 9. Qubit and DNA HS kit to measure the final concentration of the library. 10. Agilent Fragment Analyzer or Tapestation.

2.8

Antibodies

H3K9me3, Abcam, #ab176916, dilute at 1:150. H3K9ac, Diagenode, #C15410195, A0824D, dilute at 1:150. H3K27me3, Diagenode, #C15410195, A0824D, dilute at 1:75. H3K27ac, Diagenode, #C15410196, A1723-0041D, dilute at 1: 150. H3K4me3, Diagenode, #C15410003, A1052D, dilute at 1:75. H3, Activemotif, #39763, 20418023, dilute at 1:150. HP1, dilute at 1:30. Guinea pig anti-rabbit guinea #ABIN101961, dilute at 1:50.

pig,

antibodies

online,

Rabbit anti-mouse, Abcam, #ab46540, dilute at 1:50. 2.9

3

Primers

Primers can be ordered from IDT or Sigma. Usually, desalted primers are fine but in case of low input material HPLC or PAGE purification is recommended. The primers are based on [8]. For convenience, primer mixes can be prepared in 96-well plates and pipetted in a combinatorial fashion from there. The i5 primers will repeat in columns; i7 primers will repeat in rows. Higher-plex options might require unique dual indices. Dilute primers to a 25 mM stock (refer to Tables 1 and 2).

Methods

3.1 Embryo Collection

Drosophila embryos at stage 5 (zygotic genome activation) contain between 4000 and 5000 nuclei. From 100.000 nuclei (around 25 stage 5 embryos), we can get around 25 ng of chromatin. For

CTCTCTAT TATCCTCT AGAGTAGA GTAAGGAG ACTGCATA AAGGAGTA CTAAGCCT GCGTAAGA

Ad1.3_TATCCTCT AATGATACGGCGACCACCGAGATCTACACTATCCTCTTCG TCGGCAGCGTCAGATGTG

Ad1.4_AGAGTAGA AATGATACGGCGACCACCGAGATCTACACAGAGTAGATCG TCGGCAGCGTCAGATGTG

Ad1.5_GTAAGGAG AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCG TCGGCAGCGTCAGATGTG

Ad1.6_ACTGCATA AATGATACGGCGACCACCGAGATCTACACACTGCATATCG TCGGCAGCGTCAGATGTG

Ad1.7_AAGGAGTA AATGATACGGCGACCACCGAGATCTACACAAGGAGTA TCGTCGGCAGCGTCAGATGTG

Ad1.8_CTAAGCCT AATGATACGGCGACCACCGAGATCTACACCTAAGCCTTCG TCGGCAGCGTCAGATGTG

Ad1.9_GCGTAAGA AATGATACGGCGACCACCGAGATCTACACGCGTAAGATCG TCGGCAGCGTCAGATGTG

Sequence

i5 bases for sample sheet MiSeq, HiSeq 2000/2500

Ad1.2_CTCTCTAT AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCG TCGGCAGCGTCAGATGTG

Primer

Table 1 Indices i5

TCTTACGC

AGGCTTAG

TACTCCTT

TATGCAGT

CTCCTTAC

TCTACTCT

AGAGGATA

ATAGAGAG

i5 bases for sample sheet MiniSeq, NextSeq, HiSeq 3000/4000

S517

S508

S507

S506

S505

S504

S503

S502

Illumina primer

6 Fides Zenk et al.

CAAGCAGAAGACGGCATACGAGATCTAG TACGGTCTCGTGGGCTCGGAGATGT

CAAGCAGAAGACGGCATACGAGATTTC TGCCTGTCTCGTGGGCTCGGAGATGT

CAAGCAGAAGACGGCATACGAGATGC TCAGGAGTCTCGTGGGCTCGGAGATGT

CAAGCAGAAGACGGCATACGAGATAGGAG GGACTCCT TCCGTCTCGTGGGCTCGGAGATGT

CAAGCAGAAGACGGCATACGAGATCA TGCCTAGTCTCGTGGGCTCGGAGATGT

CAAGCAGAAGACGGCATACGAGATG TAGAGAGGTCTCGTGGGCTCGGAGATG T

CAAGCAGAAGACGGCATACGAGATCCTC TCTGGTCTCGTGGGCTCGGAGATGT

CAAGCAGAAGACGGCATACGAGATAGCG TAGCGTCTCGTGGGCTCGGAGATGT

Ad2.2_CGTACTAG

Ad2.3_AGGCAGAA

Ad2.4_TCCTGAGC

Ad2.5_GGACTCCT

Ad2.6_TAGGCATG

Ad2.7_CTCTCTAC

Ad2.8_CAGAGAGG

Ad2.9_GCTACGCT

CGAGGCTG AAGAGGCA

Ad2.10_CGAGGCTG CAAGCAGAAGACGGCATACGAGATCAGCC CGAGGCTG TCGGTCTCGTGGGCTCGGAGATGT AAGAGGCA GTAGAGGA

Ad2.11_AAGAGGCA CAAGCAGAAGACGGCATACGAGATTGCC TCTTGTCTCGTGGGCTCGGAGATGT

Ad2.12_GTAGAGGA CAAGCAGAAGACGGCATACGAGATTCCTC TACGTCTCGTGGGCTCGGAGATGT

GTAGAGGA

GCTACGCT

CAGAGAGG

CTCTCTAC

TAGGCATG

GGACTCCT

TCCTGAGC

AGGCAGAA

CGTACTAG

TAAGGCGA

N712

N711

N710

N709

N708

N707

N706

N705

N704

N703

N702

N701

i7 bases for sample sheet MiniSeq, Illumina NextSeq, HiSeq 3000/4000 primer

GCTACGCT

CAGAGAGG

CTCTCTAC

TAGGCATG

TCCTGAGC

AGGCAGAA

CGTACTAG

CAAGCAGAAGACGGCATACGAGATTCGCC TAAGGCGA TTAGTCTCGTGGGCTCGGAGATGT

Ad2.1_TAAGGCGA

i7 bases for sample sheet MiSeq, HiSeq 2000/2500

Sequence

Primer

Table 2 Indices i7

CUT & Tag in Drosophila Embryos 7

8

Fides Zenk et al.

optimal performance, of the protocol, we recommend to start with around 50–100 embryos (of stage 5—earlier stages contain less chromatin and the number might need to be adjusted). Embryos are hand-sorted after fixation, and stage 5 embryos are identified by their characteristic morphology [9, 10]. 3.2 Embryo Collection for PFA Fixation (3 h)

1. To increase egg production, maintain flies for 2 days in egg-laying cages at 25 °C and 70% humidity before performing the collection. Change apple juice plates with a spot of fresh yeast paste placed in the middle two to three times a day (egg-laying is stimulated by continuous feeding) (see Note 6). 2. Before collection, change the apple juice plates with fresh yeast paste every hour for three times to achieve synchronized egg-laying. 3. To obtain stage 5 embryos, collect embryos for 1 h at 25 °C. Incubate the collected plate for additional 120 min at 25 °C. The collection and dechorionation procedure are performed in a single step (see Note 7). 4. Remove dead flies and the excess of yeast from the apple juice plate. Add 50% “bleach” directly onto the plate for maximum 2 min (see Note 8). 5. Collect the dechorionated embryos by pouring the suspension through a collection sieve while actively rinsing the plate with water. (Repeat until all embryos are collected and remaining yeast is removed.) 6. Wash the collected embryos extensively with a stream of water from a squirt bottle to remove all traces of bleach. 7. Carefully dry the sieve on a paper towel to remove any remaining liquid.

3.3

Fixation (0.5–1 h)

1. Before starting dechorionation of the embryos, prepare 5 mL of heptane in a screw-cap glass tube. 2. Immediately after washing, transfer the embryos from the sieve to the heptane with a soft paintbrush soaked in heptane. 3. Add 5 mL of fixative (1% of formaldehyde in Buffer A) to the heptane. 4. The embryos will gather at the interphase between the fixing solution and heptane. 5. Cap the tube tightly, shake briefly by hand, and then clip the tube horizontally on a platform orbital shaker to increase the heptane–fixative interface boundary. Agitate vigorously for 15 min at 250–300 rpm at room temperature. Cross-linking reagents act by stabilizing transient chromatin interactions in a time-dependent manner. It is crucial to not exceed 15 min to avoid unspecific DNA–DNA interactions.

CUT & Tag in Drosophila Embryos

9

6. Stop the cross-linking reaction by addition of 1 mL 2.5 M glycine (final concentration of 0.25 M) to quench the formaldehyde. Incubate for 5 min while rotating at room temperature. 7. Remove the two-phase cross-linking solution using a Pasteur pipette starting with the lower aqueous phase and then the organic phase. 8. Add 10 mL buffer A-Tx to the embryos. Incubate for 5 min while rotating at low speed to avoid foaming. Let the embryos settle to the bottom of the tube. (The embryos tend to stick to the inside of the cap—make sure to recover them.) Remove supernatant. Repeat wash with 10 mL Buffer A-Tx. Remove supernatant. The formation of a shampoo-like phase on top indicates remaining heptane. Make sure to wash the embryos for long enough, to get rid of any remaining solvent. 9. Keep the embryos in Buffer A-Tx on ice until starting the collection. 10. Transfer embryos in Buffer A-Tx to a precooled chamber slide fitting in a precooled chamber for microscopes connected to an external temperature control system. 11. Identify embryos of the correct stage and transfer them to a new chamber slide on ice. The developmental stages can be crosschecked with the literature [9]. 12. Before transferring the selected embryos to a tube, doublecheck them again under the microscope. Use a glass Pasteur pipette to prevent sticking and add the embryos to a 1.5 mL Protein low-binding tube. Remove the supernatant with a P1000. Small drops should be removed with a P10. It is important to remove all remaining liquid to ensure safe storage of the embryos. For stage 5, collect between 50 and 100 embryos per experiment. 13. Snap-freeze the embryos in liquid nitrogen and store at -80 until use. 3.4 Alternative: Native Collection of Embryos (0.5–1 h)

1. To increase egg production, maintain flies for 2 days in egg-laying cages at 25 °C and 70% humidity before performing the collection. Change apple juice plates with a spot of fresh yeast paste placed in the middle two to three times a day (egg-laying is stimulated by continuous feeding) (see Note 6). 2. Before collection, change the apple juice plates with fresh yeast paste every hour for three times to achieve synchronized egg-laying.

10

Fides Zenk et al.

3. To obtain stage 5 embryos, collect embryos for 1 h at 25 °C. Incubate the collected plate for additional 100 min at 25 °C. 4. Remove dead flies and the excess of yeast from the apple juice plate. Add halocarbon oil directly onto the plate. At the dissection microscope with transmitted light, check the development of the embryos and collect embryos at the desired stages. Use tweezers to collect embryos and transfer into ice-cold wash buffer supplemented with 0.1% Tween on ice. Collect between 25 and 100 embryos per experiment and do not let the embryos sit for too long on ice. At this step, it is crucial to wash the embryos and remove all remaining traces of halocarbon oil. Wash the embryos and transfer them into a new tube. At this step, the embryos can be snap-frozen in liquid nitrogen and stored at -80 °C until further use. 3.5 Nuclei Isolation (0.5 h)

1. Supplement 1 mL of wash buffer with 0.01% Digitonin (2 μL of 5% stock) 2. Add 50 μL of Digitonin-supplemented wash buffer to the embryos and grind them with the pestle for 20–30 s. Wash the pestle with 200 μL of wash buffer and check the nuclei under the microscope. The nuclei can be stained with Trypan blue and should become blue. This indicates successful lysis. 3. Spin the nuclei for 3 min at 600 × g at 4 °C and discard the supernatant. 4. Resuspend the pellet in 150 μL wash buffer and place the nuclei on ice.

3.6 Preparation of Concanavalin A Beads and Binding of the Nuclei (0.5 h)

1. Calculate 15 μL of beads per sample and transfer the slurry to a 1.5 mL Eppendorf tube. Mark the original volume of beads on the tube. 2. Place the beads on a magnetic stand and discard the supernatant. 3. Add 1000 μL of binding buffer and mix gently—give a short spin to collect drops and place back in the magnetic stand. 4. Discard the buffer and resuspend the beads in the original volume (15 μL per sample) of binding buffer. 5. Add the beads to the nuclei suspension (vortex gently). 6. Incubate the beads with the cell suspension for 15 min on the rotating wheel at RT.

3.7 Binding of the Primary Antibody (2.5 h – O/N)

1. Aliquot the samples (one tube per antibody, keep one IgG control). 2. Place the tubes on a magnet and remove the supernatant.

CUT & Tag in Drosophila Embryos

11

3. While gently vortexing, carefully add 150 μL of wash buffer supplemented with the primary antibody and 2 mM EDTA (0.6 μL of 0.5 M EDTA in 150 μL). 4. Incubate at 4 °C overnight or for 2 h at RT in the thermomixer at 350 rpm. We prefer to incubate the beads in a thermomixer, to prevent sticking to the walls of the tubes. 3.8 Binding of the Secondary Antibody (1.5 h)

1. Give a short spin to the tube to collect the liquid. 2. Place in the magnetic stand and remove the supernatant. 3. Wash the beads with 700 μL of wash buffer. Be careful at this step, since beads might stick to pipette tips. Nevertheless, stickiness of the beads does not seem to have a negative impact on the assay performance. 4. Place the tube in the magnetic stand and remove the supernatant. 5. While gently vortexing, carefully add 150 μL of wash buffer supplemented with the secondary antibody. 6. Incubate at 4 °C for 1 h or at RT for 30 min in the thermomixer at 350 rpm.

3.9 Binding of the Protein A-Tn5 (1.5 h)

1. Give a short spin to the tube to collect the liquid. 2. Place in the magnetic stand and remove the supernatant. 3. Wash the beads with 700 μL of wash buffer. 4. Place the tube back on the magnet, remove the supernatant, and repeat the washing step. 5. While gently vortexing, carefully add 150 μL Protein A-Tn5 diluted in high salt wash buffer (dilute homemade Protein A-Tn5 1:150 in high salt wash buffer to reach a final concentration of 0.04 μM or according to manufacturer’s recommendations). 6. Bind the Protein A-Tn5 to the epitopes for 1 h at 20 °C in the thermomixer.

3.10 Chromatin Digestion, Clean- Up, and Lambda-DNA Spike-In (1.5 h)

1. Give a short spin to the tube to collect the liquid. 2. Place in the magnetic stand and remove the supernatant. 3. Wash the beads with 1000 μL of high salt wash buffer. 4. Place the tube back on the magnet, remove the supernatant, and repeat the washing step. 5. Give a short spin to the tube to collect the liquid. 6. Place the tube in the magnet at discard the supernatant. 7. Add 100 μL high salt wash buffer supplemented with 10 mM MgCl2 final (1 μL of 1 M MgCl2 in 100 μL high salt wash buffer) and incubate for 1 h at 37 °C.

12

Fides Zenk et al.

8. To stop the reaction, add: 2.5 μL of 0.5 M EDTA, 2 μL 20% SDS, and 2 μL Proteinase K. 9. Incubate for 30 min at 55 °C and another 20 min at 70 °C to inactivate the Proteinase K. If cross-linked material is used for the protocol, the incubation at 55 °C should be extended O/N to revert the cross-linking. After the incubation, the reaction can be stopped and the samples can be safely stored at -20 °C. 10. Purify the supernatant using the ChIP DNA Clean&Concentrator Kit (Zymo Research) following Manufacturer’s Instructions (steps 11–16). 11. Add 5 volumes of ChIP DNA binding buffer to each volume of sample (5:1). Mix briefly (100 μL IP + 500 μL binding buffer). 12. Transfer mixture to a provided Zymo-Spin™ Column in a Collection Tube. 13. Centrifuge at ≥10,000 × g for 30 s. Discard the flow-through. 14. Add 200 μL wash buffer to the column. Centrifuge at ≥10,000 × g for 30 s. Repeat wash step. 15. Prepare the elution buffer by making a master mix and calculate 1 pg Tn5-digested lambda-DNA per sample and 25-(the volume of the lambda-DNA) μL of elution buffer. 16. Add 25 μL elution buffer supplemented with 1 pg of Tn5-digested lambda-DNA directly to the column matrix. Transfer the column to a new 1.5 mL tube (DNA low binding) and centrifuge at ≥10,000 g for 30 s to elute the DNA. See Note 9 for detailed instructions on how to prepare the lambdaDNA for spike-ins. 3.11 Library PCR and Indexing (1.5 h)

1. Give a short spin to the tube to collect the liquid. 2. Transfer 21 μL of the purified DNA into PCR-tube strips. 3. Add 25 μL Nebnext® High-Fidelity 2X PCR Master Mix. 4. Add 2 μL of each index primer i5 and i7 (25 mM stock concentration). 5. Mix by pipetting up and down 10 times and give a short spin in the centrifuge. 6. Put in the thermocycler and run the following program: 1× 5 min at 58 °C (gap filling); 1× 5 min at 72 °C (gap filling), 1× 30 s at 98 °C (denaturation), 4–14× 10 s at 98 °C (denaturation) plus 30 s at 63 °C (annealing/extension), 1× 1 min at 72 °C (extension), hold 4 °C.

3.12 Clean-up of the Libraries and Quality Control (1.5 h)

1. Add 0.9 volume of NucleoMag beads to the reaction mix (45 μL). Pipette up and down at least 10 times. 2. Incubate for 5 min at room temperature.

CUT & Tag in Drosophila Embryos

13

3. Place the tube in a magnetic stand and wait at least 1–2 min for the beads to separate from the solution. 4. Remove the supernatant and add 200 μL of 80% ethanol. Incubate for 30 s and remove the supernatant. 5. Repeat the washing step. 6. Give a short spin to the tubes and remove as much of the remaining Ethanol as possible. 7. Dry the pellet for 0.5–1 min. Over-drying may result in loss of material. 8. Remove the tubes from the magnetic stand and add 25 μL of 0.1× TE. 9. Pipette 10 times up and down and incubate for 5 min at room temperature. 10. Place the tubes back in the magnetic stand. 11. Transfer 23 μL to a new tube. 12. Measure the concentration by Qubit (DNA HS Assay) and check the fragment size distribution on the Tapestation or another highly sensitive assay. 13. For histone modifications, concentrations should range between 3 and 15 ng/μL for a successful experiment and the library should show a clear nucleosome banding pattern (see Fig. 2). 14. Cross-linking often results in lower recoveries and a less clear nucleosome banding pattern, but the signal distribution after sequencing is not affected. 15. Sequence with 2x50 bp PE or 2x75 bp PE, depending on the platform. 2–5 Mio reads per sample are enough to cover the Drosophila genome. The enrichment of the target regions can be assessed by qPCR on the library before sequencing. 3.13 Bioinformatic Analysis of CUT&Tag Data

1. Sequencing reads are mapped using mapping software (bowtie2, bwa-mem) to the corresponding reference genome (e.g., human hg38, mouse mm10, Drosophila dm6). Depending on the specific marks, multimapping reads can be discarded or retained. For H3K9me3 and HP1 that are enriched at repetitive sequences, we keep multimapping reads and randomly assign them to a single site. When CUT&Tag is performed with spike-ins for reliable quantification of global effects on chromatin proteins or histone modifications, the reads are mapped to a custom-made hybrid genome (here Drosophila and lambda-phage). 2. CUT&Tag peaks are called using MACS2 (v.2.1.3.3). 3. BamCoverage from deepTools generates CUT&Tag normalized signal tracks for visualization. In case of spike-ins, we used

14

Fides Zenk et al.

Fig. 2 Overview of different antibodies established for the profiling of histone modifications. Each mark is plotted on MACS2 called peaks of the respective mark and compared to the signal of the IgG and H3 controls. The FragmentAnalyzer profile shows the size distribution of the library. Mononucleosome fragments range between 300 and 400 bp. For cross-linked material, a peak of high-molecular weight DNA is often observed, which does not affect the sequencing results. For each mark, a representative genomic region with peak enrichment is shown next to IgG and H3 controls

CUT & Tag in Drosophila Embryos

spike-in normalized

sequencing depth normalized 10

HP1 ctrl HP1 KD

8

15

300

HP1 ctrl HP1 KD

250 200

6

150

4

100 50

2 0

0

peak +/- 5 kb

peak +/- 5 kb

HP1 KD

HP1 ctrl

0

10

0

HP1 KD

HP1 peaks +/- 5 kb n=7591

HP1 ctrl

240

Fig. 3 Comparison of library normalization methods for HP1 CUT&Tag in control and HP1 knockdown (KD) embryos. HP1 KD leads to a global reduction of HP1 binding, which only becomes obvious when using lambda-DNA spike-ins to normalize the coverage tracks. The left panel shows HP1 enrichment on HP1 peaks normalized by sequencing depth. The right panel shows the same libraries on the same peak set but normalized using lambda-DNA spike-ins

the relative of genome/spike-in total number of reads as normalization factor to rescale each sample through the bamCompare option –scaleFactor (see Fig. 3). 4. Another option is to use H3 CUT&Tag for normalization to account for differences in starting material. In this case, the ratio between the normalization factors (H3 vs mark-specific CUT&Tag) is used in the bamCompare option –scaleFactor. 5. The coverage heatmaps are computed using computeMatrix and plotHeatmap from deepTools.

16

4

Fides Zenk et al.

Notes 1. To prepare apple juice agar plates, dissolve 12.5 g sucrose in 125 mL apple juice. Dissolve 15 g agar in 375 mL dH2O by autoclaving (apply magnetic stirrer). Directly after autoclaving pour apple juice into the hot agar under constant stirring. Distribute into petri dishes. Let them dry with closed lid overnight on the bench. 2. To prepare yeast paste, mix dry baker’s yeast with a bit of water in a beaker and stir with a metal spatula into a smooth paste. The consistency of the paste should not be too watery otherwise flies will stick to it. Keep the yeast paste at 4 °C. 3. To prepare the two-phase fixing solution, dilute 16% formaldehyde methanol-free solution in Buffer A to 1.0% (v/v) final. Add the fixative to an equal volume of heptane after transferring the embryos into the heptane. Always use fresh formaldehyde at this step. Preferably, keep formaldehyde on ice during the fixation steps. This reagent is highly toxic and must be handled under a fume hood. 4. For a 0.5 M Spermidine stock, resuspend 1 g in 13.7 mL RNase/DNase free water. Aliquot and store at -20 °C until use. 5. For a 1 M sodium butyrate stock, resuspend 1 g in 9 mL RNase/DNase free water. Aliquot and store at -20 °C until use. 6. Set up cages using freshly hatched flies to avoid a low lay ratio. Flies tend to hold fertilized eggs for some time in their oviducts before laying them and this phenomenon increases in older flies. Providing fresh food encourages to release eggs held by the female overnight and stimulates egg-laying. Set up enough cages according to the number of embryos needed. 7. The Drosophila embryo is protected by a chorion (eggshell) and an impermeable vitelline membrane. The chorion needs to be removed to efficiently fix the embryos. Treatment with sodium hypochlorite dissolves the chorion (dechorionation), and the heptane in the 2-phase fixing solution is essential to generate holes in the vitelline membrane that allow the formaldehyde to enter the embryo. 8. Dechorionation can be monitored with a test batch of embryos before starting the fixation. The efficiency can vary with the batch of bleach, and for this reason, checking the status of the embryos under a stereomicroscope is highly recommended. A good indication that the embryos are dechlorinated is the disappearance of the two dorsal appendages.

CUT & Tag in Drosophila Embryos

17

9. Digestion of lambda-DNA by using Protein A-Tn5 generates a pool of fragments flanked at both 5′ and 3′ ends the respective adaptor oligos. The barcoded lambda-DNA will be directly added to the sample. Amplification of both genomic and lambda DNA will allow the user to systematically compare different libraries from different conditions, experiments, or sequencing runs. To generate spike-ins, digest 500 ng of lambda-DNA in 50 μL wash buffer supplemented with 10 mM MgCl2 and 1 μL of homemade Tn5 for 1 h at 37 °C. To stop the reaction, add 2.5 μL of 0.5 M EDTA, 2 μL 20% SDS, and 2 μL Proteinase K. Incubate for 30 min at 55 °C and another 20 min at 70 °C to inactivate the Proteinase K. Purify the supernatant using the ChIP DNA Clean&Concentrator Kit (Zymo Research) and follow the Manufacturer’s Instructions. Check the size distribution on the tapestation or bioanalyzer. The fragments should be in the range of 100 bp. If bigger fragments are still present, perform a double-sided clean-up on NulceoMag beads. Measure the concentration by Qubit and generate a concentrated of stock of 1 ng/μL that can be diluted before using the spike-ins. References 1. Kaya-Okur HS, Wu SJ, Codomo CA, Pledger ES, Bryson TD, Henikoff JG, Ahmad K, Henikoff S (2019) CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat Commun 10(1):1930. https://doi. org/10.1038/s41467-019-09982-5 2. Bartosovic M, Kabbe M, Castelo-Branco G (2021) Single-cell CUT&Tag profiles histone modifications and transcription factors in complex tissues. Nat Biotechnol 39(7):825–835. https://doi.org/10.1038/s41587-02100869-9 3. Wu SJ, Furlan SN, Mihalas AB, Kaya-Okur HS, Feroze AH, Emerson SN, Zheng Y, Carson K, Cimino PJ, Keene CD, Sarthy JF, Gottardo R, Ahmad K, Henikoff S, Patel AP (2021) Singlecell CUT&Tag analysis of chromatin modifications in differentiation and tumor progression. Nat Biotechnol 39(7):819–824. https://doi. org/10.1038/s41587-021-00865-z 4. Gopalan S, Wang Y, Harper NW, Garber M, Fazzio TG (2021) Simultaneous profiling of multiple chromatin proteins in the same cells. Mol Cell 81(22):4736–4746 e4735. https:// doi.org/10.1016/j.molcel.2021.09.019 5. Bartosovic M, Castelo-Branco G (2022) Multimodal chromatin profiling using nanobodybased single-cell CUT&Tag. bioRxiv:2022.2003.2008.483459. https://doi. org/10.1101/2022.03.08.483459

6. Stuart T, Hao S, Zhang B, Mekerishvili L, Landau DA, Maniatis S, Satija R, Raimondi I (2022) Nanobody-tethered transposition allows for multifactorial chromatin profiling at single-cell resolution. bioRxiv:2022.2003.2008.483436. https://doi. org/10.1101/2022.03.08.483436 7. Picelli S, Bjorklund AK, Reinius B, Sagasser S, Winberg G, Sandberg R (2014) Tn5 transposase and tagmentation procedures for massively scaled sequencing projects. Genome Res 24(12):2033–2040. https://doi.org/10. 1101/gr.177881.114 8. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ (2013) Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10(12):1213–1218. https://doi.org/10.1038/nmeth.2688 9. Campos-Ortega JA, Hartenstein V (1985) The embryonic development of drosophila melanogaster. Springer 10. Loser E, Latreille D, Iovino N (2016) Chromatin preparation and chromatin Immunoprecipitation from drosophila embryos. Methods Mol Biol 1480:23–36. https://doi.org/ 10.1007/978-1-4939-6380-5_3

Chapter 2 Chromatin Preparation and Chromatin Immunoprecipitation from Drosophila Heads Davide Andrenacci and Filippo M. Cernilogar Abstract Chromatin immunoprecipitation (ChIP) is a widely used method to map protein–DNA interactions in vivo. Formaldehyde cross-linked chromatin is fragmented, and the protein of interest is immunoprecipitated using a specific antibody. The co-immunoprecipitated DNA is then purified and analyzed by quantitative PCR (ChIP-qPCR) or next-generation sequencing (ChIP-seq). Therefore, from the amount of DNA recovered, it can be inferred the localization and abundance of the target protein at specific loci or throughout the entire genome. This protocol describes how to perform ChIP from Drosophila adult fly heads. Key words Chromatin immunoprecipitation, Drosophila heads, ChIP-seq

1

Introduction The aim of chromatin immunoprecipitation (ChIP) is to analyze interactions of proteins or protein complexes with chromosomal DNA in vivo. ChIP has been widely used to map the localization of post-translationally modified histones, transcription factors, or chromatin-modifying enzymes on specific loci or on the entire genome. Polycomb was the first protein that was mapped by ChIP to a genomic region, in Drosophila cells [1]. Subsequently, ChIP has been applied to multiple biological systems to map a variety of proteins, including several polycomb group members [2–7]. This protocol is intended to provide general guidelines for ChIP in adult fly heads [8, 9]. Briefly, protein–DNA interactions in adult fly heads homogenate are stabilized by formaldehyde crosslinking. Chromatin is isolated from purified nuclei and then sheared using sonication. Immunoprecipitation is performed with a specific antibody coupled to magnetic beads. Finally, the DNA fragments are purified from the immunoprecipitated complexes and analyzed

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

19

20

Davide Andrenacci and Filippo M. Cernilogar

by qPCR (quantitative PCR) or by deep sequencing. Specific optimization might be required if antibody and equipment differ from those described here.

2

Materials Prepare all solutions using ultrapure water, with no detectable DNase, RNase, or protease activities, and analytical grade reagents. Standard equipment for fly husbandry and maintenance is required. Low-binding filter tips are recommended.

2.1 Material for Heads Isolation (Fig. 2a–c)

1. 15 mL tubes. 2. 1.5 mL tubes. 3. Liquid nitrogen bowl. 4. Liquid nitrogen container. 5. Benchtop cooler. 6. Vortexer. 7. White cardboard. 8. Paintbrush. 9. 710 μm and 425 μm stainless-steel sieves. 10. Liquid nitrogen.

2.2 Material for Chromatin Preparation and Immunoprecipitation

1. Dry ice. 2. Mortar pestle. 3. Mechanical homogenizer. 4. 50 mL conical tubes. 5. Tabletop refrigerated centrifuge for 50 mL tubes. 6. Formaldehyde 16% methanol-free. 7. 2 M Glycine solution. 8. Horizontal shaker. 9. 70 μm nylon cell strainer. 10. 1.5 mL low-binding tubes. 11. E220 Focused-ultrasonicator (Covaris). 12. 1 mL tube AFA Fiber & Cap 12 × 12 mm (Covaris). 13. Magnetic beads (Dynabeads Protein A or Protein G). 14. Antibodies validated for immunoprecipitation of cross-linked material. This protocol is optimized for the rabbit antiH3K27me3 antibody from Diagenode C15410069. 15. Isotype-matched control immunoglobulin. 16. Rotating wheel.

Chromatin Immunoprecipitation from Drosophila Heads

21

17. Magnetic rack for 1.5 mL tubes. 18. RNaseA (10 mg/mL). 19. Proteinase K (20 mg/mL). 20. Thermomixer. 21. Qiagen MinElute PCR purification Kit. 22. Qubit Fluorometer. 23. Qubit dsDNA HS Assay Kit. 24. 2100 Agilent Bioanalyzer. 25. High Sensitivity DNA Kit, Agilent. 26. BCA protein assay kit. 27. Primer sets: Rp49_F TCTGCATGAGCAGGACCTC; Rp49_R ATCGGTTACGGATCGAACAA; Bxd-PRE_F GCACTCAAAATCCGAAAATG; Bxd-PRE_R CACGTCAG ACTTGGAATAGC 2.3

Buffers

1. Homogenization buffer: 350 mM sucrose, 15 mM HEPES pH 7.6, 10 mM KCl, 5 mM MgCl2, 0.5 mM EGTA, 0.1 mM EDTA, 0.1% Tween-20, with 1 mM DTT and Protease Inhibitor Cocktail (Roche). Filter and store at 4 °C up to 6 months. Add proteinase inhibitors and DTT before use. 2. RIPA buffer: 150 mM NaCl, 25 mM HEPES pH 7.6, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and Protease Inhibitor Cocktail (Roche). Filter and store at 4 °C up to 6 months. Add proteinase inhibitors before use. 3. PBST buffer: Phosphate-buffered saline (PBS), Tween-20. Filter and store at 4 °C up to 6 months.

0.1%

4. Shearing buffer: 150 mM NaCl, 25 mM HEPES pH 7.6, 1 mM EDTA, 0.3% SDS, 0.1% sodium deoxycholate, Protease Inhibitor Cocktail (Roche). Filter and store at 4 °C up to 6 months. Add proteinase inhibitors before use. Make sure that there are no crystals. In case gently heat and mix until crystals disappear. 5. LiCl wash buffer: 250 mM LiCl, 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.5% NP-40, 0.5% sodium deoxycholate. Filter and store at 4 °C up to 6 months. 6. TE buffer: 10 mM Tris–HCl pH 8, 1 mM EDTA. Filter and store at room temperature up to 6 months. 7. Elution buffer: 0.5% SDS, 300 mM NaCl, 5 mM EDTA, 10 mM Tris–HCl pH 8.0. Filter and store at room temperature up to 6 months.

22

3

Davide Andrenacci and Filippo M. Cernilogar

Methods In this section, we will describe the ChIP method with formaldehyde cross-linking (X-ChIP). The outline of the main steps is illustrated in Fig. 1. ChIP can also be performed without crosslinking (native ChIP) [10]. This kind of assay has been used successfully for the analysis of histone modifications.

3.1 Head Isolation from Adult Flies 3.1.1

Fly Collection

3.1.2

Head Removal

1. Collect flies (800–1000) in 15 mL plastic tubes (Fig. 2d), freeze in liquid nitrogen (Fig. 2e), and store in a -80 °C freezer. 1. Vortex the tubes containing the flies for few sec to knock off the heads (Fig. 2f). Alternate vortexing with liquid nitrogen to keep it frozen. Repeat three-five times. 2. Put the sieves on top of the bowl (stack the 710 μm sieve on top of 425 μm sieve) (Fig. 2c, g). Put the 1.5 mL tube in a benchtop cooler. 3. Pre-chill sieves with liquid nitrogen and spill the vortexed flies (Fig. 2h). Shake the sieves. Bodies will remain in 710 μm sieve, while heads will be collected in the 425 μm sieve (see Note 1).

Head isolation

Chromatin preparation

1. Fly collection 2. Head removal

3. Homogenization 4. Formaldehyde cross-linking 5. Nuclei isolation 6. Chromatin shearing

Chromatin immunoprecipitation 7. Binding antibodies to magnetic beads 8. Immunoprecipitation and washes 9. Elution and cross-link reversal 10. DNA purification 11. Quality controls Analyis qPCR Library preparation and NGS

Fig. 1 Flowchart of the assay. The scheme highlights the major steps of the protocol. NGS next-generation sequencing

Chromatin Immunoprecipitation from Drosophila Heads

23

Fig. 2 Equipment and procedure for isolating Drosophila heads. (a) Equipment required (from left to right): vial containing adult Drosophila, cardboard, paintbrush, 15 mL vial, liquid nitrogen container, liquid nitrogen bowl, benchtop with 1.5 mL tube, 710 μm and 425 μm sieves, vortexer. (b) 710 μm (left) and 425 μm sieve (right). (c) Stacked sieves (710 μm sieve at the top and 425 μm sieve at the bottom). (d) 15 mL tube with anesthetized adult flies. (e) 15 mL tube with adult flies in liquid nitrogen. (f) Vortexing procedure. (g) Stacked sieves on the top of the bowl. (h) Drosophila bodies retained by the 710 μm sieve. (i) Only heads are retained in the 425 μm sieve. (j) Transfer of the heads into a chilled 1.5 mL tube

24

Davide Andrenacci and Filippo M. Cernilogar

4. Quickly, spill the frozen heads from the 425 μm sieve on the folded cardboard (see Note 2, Fig. 2i) and from this into the frozen 1.5 mL tube (see Note 3, Fig. 2j). Use a pre-chilled paintbrush to quickly transfer the frozen heads. 5. Store the collected heads in a -80 °C. 3.2 Chromatin Preparation

1. Grind 800–1000 frozen fly heads with a mortar pestle (chilled on dry ice) to a fine powder.

3.2.1

2. Resuspend the powder in 25 mL ice-cold homogenization buffer and let it stand on ice for 5 min.

Homogenization

3. Dounce in a mechanical homogenizer (rotation 2000 rpm, 20 movements up and 20 movements down, slowly). 3.2.2 Formaldehyde Cross-Linking

1. Transfer the homogenate to a 50 mL conical tube and centrifuge 5 min, 2000 × g, 4 °C. 2. Discard supernatant and gently resuspend the pellet in 25 mL room temperature homogenization buffer supplemented with 1% formaldehyde (see Note 4). 3. Incubate at room temperature for precisely 10 min with gentle shaking on a horizontal shaker (see Note 5). 4. Add 0.125 M final concentration of glycine to stop fixation and incubate for 5 min at room temperature with gentle shaking on horizontal shaker. 5. Remove the tissue debris by filtration with 70 μm nylon cell strainer.

3.2.3

Nuclei Isolation

1. Collect nuclei by centrifugation (5 min, 2000 × g, 4 °C) and discard supernatant. 2. Resuspend nuclei in 1 mL ice-cold RIPA buffer and transfer to a 1.5 mL low-binding tube. 3. Collect nuclei by centrifugation (1 min, 3500 × g, 4 °C) and discard supernatant. 4. Resuspend nuclei in 1 mL ice-cold RIPA buffer, collect by centrifugation (1 min, 3500 × g, 4 °C), and discard supernatant. 5. Repeat step 4.

3.2.4 Chromatin Shearing

1. Resuspend nuclei in 1 mL shearing buffer. 2. Incubate 5 min on ice. 3. Transfer the lysate to 1 mL Covaris AFA tube. 4. Fragment the chromatin to an average size of 100–500 bp using a Covaris E220 device (time 30 min; temperature 4 °C; peak incident power 120; duty factor 20; cycles per burst 200; see Note 6).

Chromatin Immunoprecipitation from Drosophila Heads

25

5. Transfer chromatin to a low-binding tube. 6. Collect the debris by centrifugation (10 min, 16,000 × g, 4 °C). 7. Save 50 μL chromatin to check the average size of the DNA fragments (go to Subheading 3.2.5). 8. From the remaining sample, prepare aliquots, flash-freeze and store at -80 °C, or use the chromatin directly for immunoprecipitation (see Note 7). 3.2.5 DNA Fragment Size Check

1. Add 50 μL elution buffer containing 2 μL RNaseA (10 mg/ mL) and incubate for 30 min at 37 °C in a Thermomixer at 900 rpm. 2. Add 2 μL of Proteinase K (20 mg/mL) and incubate for 1 h at 55 °C and overnight at 65 °C in a Thermomixer at 900 rpm to revert formaldehyde cross-linking. 3. Purify the size-check DNA with a Qiagen MinElute PCR purification Kit. Elute DNA with 20 μL EB buffer (provided in the kit). 4. Measure the DNA concentration with a Qubit Fluorometer according to manufacturer’s protocol. 5. Determine the DNA size range on an Agilent Bioanalyzer using high sensitivity DNA chip according to manufacturer’s protocol. The optimal size range of DNA should be between 100 and 500 base pairs (Fig. 3).

3.3 Chromatin Immunoprecipitation 3.3.1 Binding Antibodies to Magnetic Beads

1. Transfer 30 μL of Dynabeads suspension (protein G or protein A depending on the antibody type and origin) to a low-binding 1.5 mL tube (see Note 8). 2. Wash the beads with 500 μL of ice-cold PBST buffer. Each wash is done as follows: add buffer, close the tube caps, vortex the tube at low speed to resuspend the beads, place in the magnetic rack, wait 1 min, and discard the buffer. Keep the captured beads.

Fig. 3 Typical size distribution of DNA fragments after chromatin sonication with a Covaris E220 sonifier (time 30 min; temperature 4 °C; peak incident power 120; duty factor 20; cycles per burst 200). DNA fragments are analyzed by a Bioanalyzer 2100. Two molecular weight markers are included and indicated by an asterisk. Most of the DNA fragments are between 100 bp and 500 bp

26

Davide Andrenacci and Filippo M. Cernilogar

3. Keep the bead pellet. Repeat the wash one time. 4. Resuspend the beads in 500 μL ice-cold PBST buffer. 5. Add the specific or negative control antibody to each tube (see Notes 9 and 10). For H3K27m3-IP, we use 6 μg antibody per 150 μL chromatin (based on our starting material of 800–1000 fly heads). A negative control (no antibody or isotype matched control immunoglobulin) is necessary to determine the background level. 6. Incubate the IP tubes on a rotating wheel for 1–2 h at 4 °C (speed 10 rpm). 7. Wash once the beads–antibody complexes with PBST buffer and resuspend in 850 μL ice-cold RIPA buffer. 3.3.2 Immunoprecipitation and Washes

1. Add 150 μL of chromatin per each IP but set aside 5% of the volume as input sample and keep at 4 °C. Do the cross-link reversal and DNA purification of the input together with IP samples (Subheading 3.3.3). 2. Incubate on a rotator overnight at 4 °C (speed 10 rpm). 3. Place the 1.5 mL tubes on the magnetic rack, wait 1 min, and transfer the supernatants to a clean tube. Supernatants can be used to monitor IP efficiency (see Note 10). 4. Wash the beads four times with ice-cold RIPA buffer, one time with ice-cold LiCl wash buffer, and one time with ice-cold TE buffer. Each wash is done as follows. Add 1 mL buffer, close the tube caps, invert the tubes to resuspend the beads, incubate for 10 min at 4 °C on a rotating wheel (speed 20 rpm), place the tubes in the magnetic rack, wait 1 min, and discard the buffer. Keep the captured beads. 5. After the last wash, briefly spin tubes containing beads in TE buffer to remove beads from the lids, place the tubes on ice (not in the magnetic rack), transfer the content of each tube into separate clean 1.5 mL low-binding tube on ice, capture the complexes in the magnetic rack, and remove the TE buffer. The change of the tube at this point is important to reduce the background.

3.3.3 Elution and CrossLink Reversal

1. Incubate the beads and input with 100 μL elution buffer containing 2 μL RNaseA (10 mg/mL) for 30 min at 37 °C in a Thermomixer at 900 rpm. 2. Add 2 μL of Proteinase K (20 mg/mL) and incubate for 1 h at 55 °C and overnight at 65 °C in a Thermomixer at 900 rpm to revert formaldehyde cross-linking. 3. Transfer the supernatant to a new 1.5 mL low-binding tube.

Chromatin Immunoprecipitation from Drosophila Heads 3.3.4 DNA Purification and Recovery

27

1. Purify the IP-DNA and input with Qiagen MinElute PCR purification Kit according to manufacturer’s instruction. Elute DNA with 20 μL EB buffer (provided in the kit). 2. Measure the DNA concentration with a Qubit Fluorometer according to manufacturer’s protocol.

Quality Controls

1. Measure the DNA concentration of IP and input DNA with Qubit (high sensitivity dsDNA kit). 2. Check the chromatin shearing before performing the immunoprecipitation in case of a first-time ChIP. Once the chromatin shearing step is standardized, this control can be done at the end of the experiment by using the input DNA. 3. The specificity and efficiency of the ChIP can be evaluated using real-time quantitative PCR by analyzing the DNA samples from input, Mock-IP, and IP material (see Note 11). The enrichment of a known target region (e.g., bxd Polycomb Response Element for H3K27m3) in the specific IP fraction versus the input will determine the percentage of input recovered. The comparison of the expected enriched region over a negative control region (e.g., RP49) will provide information about the signal-to-noise ratio (Fig. 4).

H3K27me3 enrichment 0.18 0.16 0.14 0.12

% input

3.3.5

0.1 0.08 0.06 0.04 0.02 0

rp49

bxd-PRE

Fig. 4 Example of ChIP-qPCR quality control for H3K27me3 enrichment on selected positive (bxd-PRE) and negative regions (rp49). Results are presented as the percentage of input material recovered after immunoprecipitation (rp49: ribosomal protein L32; bxd-PRE: bxd polycomb responsive element)

28

Davide Andrenacci and Filippo M. Cernilogar

3.4 Library Preparation and NextGeneration Sequencing 3.4.1 Library Preparation for Illumina Sequencing

3.4.2

4

Sequencing

For ChIP-seq, the input DNA will be the background reference. The input and the IP material will be required for library preparation. The amount of DNA required ranges normally between 1 and 10 ng. The library preparation consists of three main steps: (1) end repair, 5‘ phosphorylation, and dA tailing, (2) Illumina adaptor ligation, and (3) PCR amplification. Several commercial kits are available with detailed protocols making its description superfluous here. We favor the ThruPLEX DNA-Seq Kit (Takara) for its high sensitivity (minimum starting DNA material 50 pg) and limited hands-on time. Fifty cycles are enough to provide meaningful data in most cases. The number of reads required depends on the enrichment profile of the factor and genome size. As a rule of thumb, the broader is the enrichment profile, the higher is the number of reads required. The H3K27me3 modification and most of the PcG proteins are enriched in broad domains. For these types of profiles, in Drosophila, about ten million reads are required. The input sample needs more reads (for Drosophila about 20 million reads) to reach an even coverage and serve as good background reference in peak calling (see Note 12).

Notes 1. To keep the heads frozen, pour more liquid nitrogen on the sieves after shaking. 2. Weighing Boats could be also used in the place of the folded cardboard to transfer chilled heads in the chilled 1.5 mL tube. 3. This step is crucial and must be done as quickly as possible to prevent the heads from thawing. 4. Always use fresh methanol-free formaldehyde sold in single-use ampoules. The effective concentration of formaldehyde can drop significantly over time once bottles are exposed to air. Some formaldehydes contain up to 15% methanol as stabilizer, but its concentration is variable. Since methanol increases the permeability of cells, it can influence the efficiency of fixation. This can have a significant effect on reproducibility of chromatin cross-linking and subsequent steps 5. Carefully control the cross-linking temperature. Fixation it is influenced by temperature. The higher is the temperature, the faster is the fixation process. Fixing for 10 min at 20 °C is not the same as fixing for 10 min at 30 °C. Our “room temperature” is set at 22 °C and to avoid seasonal fluctuation we pre-incubate the fixation solution at 22 °C in a thermoblock. Usually, a fixation time of 10 min at 22 °C works well for most

Chromatin Immunoprecipitation from Drosophila Heads

29

of the proteins but some require longer times and the presence of additional cross-linkers such as disuccinimidyl glutarate (DSG) or ethylene glycol bis (succinimidyl succinate) (EGS) [11]. 6. First time perform a sonication time course between 20 and 40 min with intervals of 5 min. To determine the optimal sonication time after cross-link reversal, analyze the DNA fragments on an Agilent chip. 7. Chromatin can be flash-frozen and stored at -80 °C for few weeks. This works well for histone modifications, but ChIP of other chromatin proteins might benefit from the use of fresh chromatin. 8. Volume of magnetic beads should be adjusted to the amount of antibody used: 10 μL of Dynabeads can bind approximately 3 μg of human IgG antibody. 9. Use ChIP-validated antibodies. The amount of antibody required depends on its affinity for the target protein and the abundance of the latter. Ideally, it should be used the minimal amount of antibody capable to immunoprecipitate most of the target protein. 10. Reverse the cross-link of supernatants overnight at 65 °C. Quantify protein concentration with a BCA protein assay and analyze about 20 μg by Western blot. The target protein should be visible only in the mock supernatant. If the target protein is still visible in the supernatant of the IP sample, the amount of antibody can be increased. We recommend performing this type of assay the first time to determine the optimal antibody amount. 11. Dilute the input at the same concentration of the IP material. Use 1–2 μL for the qPCR. Relative quantifications as a percentage of starting material (percentage of input) can be determined using the following equation: % (ChIP/total input) = 2^[(Ct(x% input) - log(x%)/log2) - Ct (ChIP)] × 100%. Ct(ChIP) and Ct(x%input) are threshold values obtained from the exponential phase of qPCR for the IP-DNA sample and input sample, respectively; (logx%/log2) accounts for the dilution 1:x of the input to balance the difference in amounts of ChIP and input DNA from qPCR. The signal fold change positive over negative regions should be >10. 12. Obtain at least two biological replicates for each experiment.

30

Davide Andrenacci and Filippo M. Cernilogar

References 1. Orlando V, Paro R (1993) Mapping Polycomb-repressed domains in the bithorax complex using in vivo formaldehyde crosslinked chromatin. Cell 75(6):1187–1198. https://doi.org/10.1016/0092-8674(93) 90328-n 2. Orlando V (2000) Mapping chromosomal proteins in vivo by formaldehyde-crosslinkedchromatin immunoprecipitation. Trends Biochem Sci 25(3):99–104. https://doi.org/10. 1016/s0968-0004(99)01535-2 3. Breiling A, Turner BM, Bianchi ME, Orlando V (2001) General transcription factors bind promoters repressed by Polycomb group proteins. Nature 412(6847):651–655. https:// doi.org/10.1038/35088090 4. Sessa L, Breiling A, Lavorgna G, Silvestri L, Casari G, Orlando V (2007) Noncoding RNA synthesis and loss of Polycomb group repression accompanies the colinear activation of the human HOXA cluster. RNA 13(2):223–239. https://doi.org/10.1261/rna.266707 5. Cernilogar FM, Onorati MC, Kothe GO, Burroughs AM, Parsi KM, Breiling A, Lo Sardo F, Saxena A, Miyoshi K, Siomi H, Siomi MC, Carninci P, Gilmour DS, Corona DF, Orlando V (2011) Chromatin-associated RNA interference components contribute to transcriptional regulation in Drosophila. Nature 480(7377): 3 9 1 – 3 9 5 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / nature10492 6. Cernilogar FM, Burroughs AM, Lanzuolo C, Breiling A, Imhof A, Orlando V (2013) RNA-interference components are dispensable for transcriptional silencing of the drosophila bithorax-complex. PLoS One 8(6):e65740.

https://doi.org/10.1371/journal.pone. 0065740 7. Cernilogar FM, Hasenoder S, Wang Z, Scheibner K, Burtscher I, Sterr M, Smialowski P, Groh S, Evenroed IM, Gilfillan GD, Lickert H, Schotta G (2019) Pre-marked chromatin and transcription factor co-binding shape the pioneering activity of Foxa2. Nucleic Acids Res 47(17):9069–9086. https://doi. org/10.1093/nar/gkz627 8. Guida V, Cernilogar FM, Filograna A, De Gregorio R, Ishizu H, Siomi MC, Schotta G, Bellenchi GC, Andrenacci D (2016) Production of small noncoding RNAs from the flamenco locus is regulated by the gypsy retrotransposon of Drosophila melanogaster. Genetics 204(2):631–644. https://doi.org/ 10.1534/genetics.116.187922 9. Schauer T, Schwalie PC, Handley A, Margulies CE, Flicek P, Ladurner AG (2013) CASTChIP maps cell-type-specific chromatin states in the Drosophila central nervous system. Cell Rep 5(1):271–282. https://doi.org/10. 1016/j.celrep.2013.09.001 10. O’Neill LP, Turner BM (2003) Immunoprecipitation of native chromatin: NChIP. Methods 31(1):76–82. https://doi.org/10.1016/ s1046-2023(03)00090-2 11. Rasmussen KD, Berest I, Kebetaler S, Nishimura K, Simon-Carrasco L, Vassiliou GS, Pedersen MT, Christensen J, Zaugg JB, Helin K (2019) TET2 binding to enhancers facilitates transcription factor recruitment in hematopoietic cells. Genome Res 29(4): 564–575. https://doi.org/10.1101/gr. 239277.118

Chapter 3 Detecting Cell Compartment-Specific PRC2-RNA Interactions via UV-RIP Francesco Della Valle, Peng Liu, Gabriele Morelli, and Valerio Orlando Abstract Upon cellular reprogramming, the activity of polycomb repressive complex 2 (PRC2), together with histone demethylases, is essential for the suppression of cell lineage-specific gene expression programs, for resetting of epigenetic memory and for the reacquisition of pluripotency. PRC2 requires interaction with RNAs for the correct protein complex assembly and recruitment on chromatin. Moreover, PRC2 components can be found in different cell compartments and their intracellular dynamics is part of their functional activity. Several loss-of-function studies revealed that many lncRNAs expressed upon reprogramming are essential for the silencing of lineage-specific genes and the function of chromatin modifiers. Compartment-specific UV-RIP technique is a method that will help understanding which is the nature of those interactions, with no interference from indirect interactions typical of methods involving the use of chemical cross-linkers or performed in native conditions with non-stringent buffers. This technique will shed lights on the specificity of lncRNA interaction and PRC2 stability/activity on chromatin and whether PRC2-lncRNA interaction occurs in specific cell compartments. Key words UV-RIP, lncRNAs, PRC2, Cell compartments, Reprogramming

1

Introduction The gene expression profile of a differentiated cell is preserved by a distinct array of DNA and chromatin modifications. Specifically, during lineage commitment, pluripotency and stem cell-associated genes are repressed via methylation of both DNA and lysine 9 and 27 of the histone H3 (H3K9 and H3K27, respectively). Upon cell reprogramming, the genome-wide remodeling of both DNA and histone modifications is an essential step for the complete reacquisition of pluripotency and for the loss of somatic cells’ identity [1– 3]. Somatic cell reprogramming can be induced by a combination of transcription factors that, in combination with many chromatinmodifying enzymes, initiates the switch of a “uni-potent” somatic cell into a pluripotent stem cell [4]. Transcription factors associated with the pluripotent state (e.g., Yamanaka Factors) partly mediate

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

31

32

Francesco Della Valle et al.

the repression of lineage-specific genes by targeting the polycomb repressive complex 2 (PRC2) to the promoters of those genes, thus reinstating the methylation of the H3K27 residue [5, 6]. The wave of epigenetic reprogramming is also associated with a change in the pool of both short and long noncoding RNAs (lncRNAs) in somatic cells undergoing reprogramming [7, 8]. Single-cell RNA-seq data have demonstrated that upon reprogramming more than 400 different lncRNAs are differentially expressed during different stages of cell reprogramming [7]. For decades, it has been questioned whether long noncoding RNA molecules play an important role in regulating the activity of chromatin modifiers and very recently it has been demonstrated that lncRNAs can regulate both the assembly and the recruitment/activity of PRC2 on chromatin [9, 10]. It is therefore proven that lncRNAs are essential epigenetic regulators, physically interacting with chromatin modifier and remodeling enzymes, marking distinctive epigenetic profiles and specific cell states. Accordingly, it is essential to rely on techniques able to capture and preserve the dynamic nature of the interaction between lncRNAs and chromatin modifiers. Here, we present a method, consisting of an adaptation of the RNA immunoprecipitation (RIP) technique [11], that combines the RNA cross-linking features of UV rays [12] and the possibility to investigate lncRNA association to chromatin modifiers in specific cell compartments: Cytosol, Nucleosol, and Chromatin [13]. Many techniques have been applied in the past for the purification of RNAs associated to chromatin modifiers. However, most of them are performed in native conditions, with non-sufficiently stringent immunoprecipitation reactions, or on cross-linked materials. Most of the chemical reagents used to fix biological samples (e.g., formaldehyde and DSG) cross-link nucleic acids to proteins even if not in direct contact, introducing a bias in the functional interpretation of RNA–protein interaction. CLIP-seq was the first high-throughput method in which short wavelength UV lights have been used to generate a covalent bond precisely between proteins and RNA residues that are in direct contact allowing the mapping of the interaction at the resolution of a single nucleotide [14, 15]. Interestingly, UV cross-linking can be coupled with cell fractionation methods relying on salt-based chromatin-associated protein isolation. The irradiation with UV lights is not altering the solubility of membranes and makes possible the isolation of nuclei using buffers supplemented with non-ionic detergents at very low concentration, preserving protein complexes localization inside the cell. In strongly hypotonic solutions (1 Mb) where it is roughly one order of magnitude lower than Hi-C and SPRITE (1% vs 10%). Consistent with the central limit theorem, we also find that the noise-to-signal ratio decreases with N as an inverse square root (by fixing

64

Mattia Conte et al.

genomic distance and efficiency) and it increases as an inverse power law when efficiency is reduced (by fixing genomic distance and N) [46]. Overall, those studies can guide experimentalists on the best approach to use to interrogate genome structure in different contexts and can provide a blueprint in designing novel experiments.

4

Notes 1. MD simulations are performed up to when fully stationarity is reached (i.e., 108 MD time iteration steps). 2. The distance-corrected Pearson correlation, r′, is the correlation after the effect of genomic distance is subtracted from a contact or distance map [14]. 3. A standard z-score is applied on the experimental and model coordinates to have a fair comparison and missing values are linearly interpolated. 4. Similar results are also found by applying our in silico approach to 3D conformations of a toy block-copolymer, unrelated to real chromatin loci, hence confirming the general validity of our analyses [46].

References 1. Lieberman-Aiden E, Van Berkum NL, Williams L et al (2009) Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science (80-). https://doi.org/10.1126/science.1181369 2. Rao SSP, Huntley MH, Durand NC et al (2014) A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 159:1665–1680. https:// doi.org/10.1016/j.cell.2014.11.021 3. Quinodoz SA, Ollikainen N, Tabak B et al (2018) Higher-order inter-chromosomal hubs shape 3D genome organization in the nucleus. Cell 174:744–757.e24. https://doi.org/10. 1016/j.cell.2018.05.024 4. Beagrie RA, Scialdone A, Schueler M et al (2017) Complex multi-enhancer contacts captured by genome architecture mapping. Nature 543:519–524. https://doi.org/10.1038/ nature21411 5. Nora EP, Lajoie BR, Schulz EG et al (2012) Spatial partitioning of the regulatory landscape of the X-inactivation centre. Nature 485:381– 385. https://doi.org/10.1038/nature11049

6. Dixon JR, Selvaraj S, Yue F et al (2012) Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 485:376–380. https://doi.org/10. 1038/nature11082 7. Fraser J, Ferrai C, Chiariello AM et al (2015) Hierarchical folding and reorganization of chromosomes are linked to transcriptional changes in cellular differentiation. Mol Syst Biol 11:852–852. https://doi.org/10. 15252/msb.20156492 8. Dekker J, Mirny L (2016) The 3D genome as moderator of chromosomal communication. Cell 164:1110–1121 9. Dixon JR, Gorkin DU, Ren B (2016) Chromatin domains: the unit of chromosome organization. Mol Cell 62:668–680. https://doi. org/10.1016/j.molcel.2016.05.018 10. Esposito A, Chiariello AM, Conte M et al (2020) Higher-order chromosome structures investigated by polymer physics in cellular morphogenesis and differentiation. J Mol Biol 432: 701–711

Polymer Models of Chromosome 3D Structure in Single Molecules 11. Finn EH, Misteli T (2019) Molecular basis and biological function of variability in spatial genome organization. Science (80-) 365: eaaw9498. https://doi.org/10.1126/science. aaw9498 ˜ ez DG, Kraft K, Heinrich V et al (2015) 12. Lupia´n Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 161:1012–1025. https:// doi.org/10.1016/j.cell.2015.04.004 13. Hnisz D, Weintrau AS, Day DS et al (2016) Activation of proto-oncogenes by disruption of chromosome neighborhoods. Science (80-) 351:1454–1458. https://doi.org/10.1126/ science.aad9024 ˜ ez DG, Chiariello AM et al 14. Bianco S, Lupia´n (2018) Polymer physics predicts the effects of structural variants on chromatin architecture. Nat Genet 50:662–667. https://doi.org/10. 1038/s41588-018-0098-8 ˜ ez DG, Mundlos S 15. Spielmann M, Lupia´n (2018) Structural variation in the 3D genome. Nat Rev Genet 19:453–467 16. Valton AL, Dekker J (2016) TAD disruption as oncogenic driver. Curr Opin Genet Dev 36: 34–40 17. Weischenfeldt J, Dubash T, Drainas AP et al (2017) Pan-cancer analysis of somatic copynumber alterations implicates IRS4 and IGF2 in enhancer hijacking. Nat Genet 49:65–74. https://doi.org/10.1038/ng.3722 18. Boettiger AN, Bintu B, Moffitt JR et al (2016) Super-resolution imaging reveals distinct chromatin folding for different epigenetic states. Nature 529:418–422. https://doi.org/10. 1038/nature16496 19. Cattoni DI, Gizzi AMC, Georgieva M et al (2017) Single-cell absolute contact probability detection reveals chromosomes are organized by multiple low-frequency yet specific interactions. Nat Commun 8:1753. https://doi.org/ 10.1038/s41467-017-01962-x 20. Bintu B, Mateo LJ, Su J-H et al (2018) Superresolution chromatin tracing reveals domains and cooperative interactions in single cells. Science (80-) 362. https://doi.org/10.1126/ science.aau1783 21. Cardozo Gizzi AM, Cattoni DI, Fiche JB et al (2019) Microscopy-based chromosome conformation capture enables simultaneous visualization of genome organization and transcription in intact organisms. Mol Cell 74: 212–222.e5. https://doi.org/10.1016/j. molcel.2019.01.011 22. Finn EH, Pegoraro G, Branda˜o HB et al (2019) Extensive heterogeneity and intrinsic variation in spatial genome organization. Cell

65

176:P1502–1515.E10. https://doi.org/10. 1016/j.cell.2019.01.020 23. Esposito A, Bianco S, Fiorillo L et al (2021) Polymer models are a versatile tool to study chromatin 3d organization. Biochem Soc Trans 49:1675–1684 24. Fudenberg G, Imakaev M, Lu C et al (2016) Formation of chromosomal domains by loop extrusion. Cell Rep 15:2038–2049. https:// doi.org/10.1016/j.celrep.2016.04.085 25. Jost D, Carrivain P, Cavalli G, Vaillant CCC (2014) Modeling epigenome folding: formation and dynamics of topologically associated chromatin domains. Nucleic Acids Res 42: 9553–9561. https://doi.org/10.1093/nar/ gku698 26. Di Stefano M, Paulsen J, Lien TG et al (2016) Hi-C-constrained physical models of human chromosomes recover functionally-related properties of genome organization. Sci Rep 6. https://doi.org/10.1038/srep35985 27. Brackley CA, Brown JM, Waithe D et al (2016) Predicting the three-dimensional folding of cis-regulatory regions in mammalian genomes using bioinformatic data and polymer models. Genome Biol 17. https://doi.org/10.1186/ s13059-016-0909-0 28. Barbieri M, Chotalia M, Fraser J et al (2012) Complexity of chromatin folding is captured by the strings and binders switch model. Proc Natl Acad Sci U S A 109:16173–16178. https:// doi.org/10.1073/pnas.1204799109 29. Nuebler J, Fudenberg G, Imakaev M et al (2018) Chromatin organization by an interplay of loop extrusion and compartmental segregation. Proc Natl Acad Sci U S A 115. https:// doi.org/10.1073/pnas.1717730115 30. Buckle A, Brackley CA, Boyle S et al (2018) Polymer simulations of heteromorphic chromatin predict the 3D folding of complex genomic loci. Mol Cell 72:786–797.e11. https:// doi.org/10.1016/j.molcel.2018.09.016 31. Bianco S, Annunziatella C, Andrey G et al (2019) Modeling single-molecule conformations of the HoxD region in mouse embryonic stem and cortical neuronal cells. Cell Rep 28: 1574–1583.e4. https://doi.org/10.1016/j. celrep.2019.07.013 32. Chiariello AM, Bianco S, Oudelaar AM et al (2020) A dynamic folded hairpin conformation is associated with α-globin activation in erythroid cells. Cell Rep 30:2125–2135.e5. https://doi.org/10.1016/j.celrep.2020. 01.044 33. Racko D, Benedetti F, Dorier J, Stasiak A (2018) Transcription-induced supercoiling as the driving force of chromatin loop extrusion

66

Mattia Conte et al.

during formation of TADs in interphase chromosomes. Nucleic Acids Res 46:1648–1660. https://doi.org/10.1093/nar/gkx1123 34. Lesne A, Riposo J, Roger P et al (2014) 3D genome reconstruction from chromosomal contacts. Nat Methods 11:1141–1143. https://doi.org/10.1038/nmeth.3104 35. Serra F, Bau` D, Goodstadt M et al (2017) Automatic analysis and 3D-modelling of Hi-C data using TADbit reveals structural features of the fly chromatin colors. PLoS Comput Biol 13. https://doi.org/10.1371/journal.pcbi. 1005665 36. Bianco S, Chiariello AM, Conte M et al (2020) Computational approaches from polymer physics to investigate chromatin folding. Curr Opin Cell Biol 64:10–17 37. Fiorillo L, Bianco S, Chiariello AM et al (2019) Inference of chromosome 3D structures from GAM data by a physics computational approach. Methods 181–182:70–79. https:// doi.org/10.1016/j.ymeth.2019.09.018 38. Fiorillo L, Bianco S, Esposito A et al (2020) A modern challenge of polymer physics: novel ways to study, interpret, and reconstruct chromatin structure. Wiley Interdiscip Rev Comput Mol Sci 10:e1454. https://doi.org/10.1002/ wcms 39. Bohn M, Heermann DW (2010) Diffusiondriven looping provides a consistent provides a consistent framework for chromatin organization. PLoS One 5. https://doi.org/10. 1371/journal.pone.0012218 40. Conte M, Fiorillo L, Annunziatella C et al (2021) Dynamic and equilibrium properties of finite-size polymer models of chromosome folding. Phys Rev E 104:054402 41. Tjong H, Li W, Kalhor R et al (2016) Population-based 3D genome structure analysis reveals driving forces in spatial genome organization. Proc Natl Acad Sci U S A 113. https://doi.org/10.1073/pnas.1512577113 42. Chiariello AM, Bianco S, Esposito A et al (2021) Physical mechanisms of chromatin spatial organization. FEBS J 289:1180–1190 43. Nicodemi M, Prisco A (2009) Thermodynamic pathways to genome spatial organization in the

cell nucleus. Biophys J 96:2168–2177. https://doi.org/10.1016/j.bpj.2008.12. 3919 44. Chiariello AM, Annunziatella C, Bianco S et al (2016) Polymer physics of chromosome largescale 3D organisation. Sci Rep 6. https://doi. org/10.1038/srep29775 45. Conte M, Fiorillo L, Bianco S et al (2020) Polymer physics indicates chromatin folding variability across single-cells results from state degeneracy in phase separation. Nat Commun 11. https://doi.org/10.1038/s41467-02017141-4 46. Fiorillo L, Musella F, Conte M et al (2021) Comparison of the Hi-C, GAM and SPRITE methods using polymer models of chromatin. Nat Methods 18:482–490. https://doi.org/ 10.1038/s41592-021-01135-1 47. Plimpton S (1995) Fast parallel algorithms for short-range molecular dynamics. J Comput Phys 117:1–19. https://doi.org/10.1006/ jcph.1995.1039 48. De Gennes PG (1979) Scaling concepts in polymer physics. Cornell University Press, Ithaca. https://doi.org/10.1163/_q3_SIM_ 00374 49. Kremer K, Grest GS (1990) Dynamics of entangled linear polymer melts: a moleculardynamics simulation. J Chem Phys 92:5057– 5086. https://doi.org/10.1063/1.458541 50. Conte M, Esposito A, Fiorillo L et al (2019) Efficient computational implementation of polymer physics models to explore chromatin structure. Int J Parallel, Emergent Distrib Syst 37:91–102. https://doi.org/10.1080/ 17445760.2019.1643020 51. Stevens TJ, Lando D, Basu S et al (2017) 3D structures of individual mammalian genomes studied by single-cell Hi-C. Nature 544:59– 64. https://doi.org/10.1038/nature21429 52. Theobald DL (2005) Rapid calculation of RMSDs using a quaternion-based characteristic polynomial. Acta Crystallogr Sect A Found Crystallogr 61:478–480. https://doi.org/10. 1107/S0108767305015266

Chapter 6 Co-Immunoprecipitation (Co-Ip) in Mammalian Cells Federica Lo Sardo Abstract The cell is a fantastic place where molecules dynamically move through the various cellular structures and compartments and meet each other, either transiently or in more stable complexes. These complexes have always a specific biological function; thus, it is important to identify and characterize the interaction between molecules, either DNA/RNA, DNA/DNA, protein/DNA, protein/protein, and so on. polycomb group proteins (PcG proteins) are epigenetic repressors involved in important physiologic processes as development and differentiation. They act on the chromatin through the formation of a repressive environment involving histone modification, recruitment of co-repressors, and chromatin– chromatin interactions. PcG form multiprotein complexes, whose characterization required several approaches. In this chapter, I will describe the co-immunoprecipitation (Co-IP) protocol, an easy method used to identify and analyze multiprotein complexes. In Co-IP, an antibody is used to isolate its target antigen, along with its binding partners, from a mixed sample. The binding partners purified with the immunoprecipitated protein can be identified by Western blot or by mass spectrometry. Key words Protein–protein interactions, Immunoprecipitation, Co-IP, Protein complexes, PcG

1

Introduction Protein–protein interactions occur inside the cell, at its surface and in the extracellular microenvironment, and are involved in several processes, including signal transduction, protein shuttling through cellular and extracellular compartments, metabolism, immune response, gene expression regulation. Some complexes may form constitutively, some other transiently or under certain circumstances (i.e., upon specific developmental states, in response to specific signaling pathways, in the presence of a specific chemical environment). As an example, polycomb group proteins (PcG) form stable complexes with important roles in epigenetic regulation of gene expression [1] and are involved in many processes including differentiation ad development [2]. In addition to the “core” subunits of the PcG complexes, there are many other subunits interacting with low stoichiometry with the core complex, allowing the

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_6, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

67

68

Federica Lo Sardo

formation of alternative forms of the complex during physiologic development and differentiation [3, 4]. Through the years, the co-immunoprecipitation was largely used to dissect and characterize those interactions in order to understand the biological processes they are involved in. Moreover, several diseases are characterized by aberrant and pathogenic protein–protein interactions (PPIs) [5–10]. The targeting of those pathogenic PPIs with small molecule- based pharmacological compounds might be a precious therapeutic strategy [11]. The detection, the validation and the characterization of those interactions is the first step to design the appropriated therapeutic strategy [12, 13]. Recently, a functional interaction between the oncogenic Enhancer of zeste homolog 2 (EZH2), belonging to the PRC2 complex, and the transcriptional coactivator Yes-associated protein (YAP), the final effector of the Hippo pathway, was observed. Studies are ongoing in order to characterize other potential proteins involved in the transcriptional co-repressor complex made up of YAP and EZH2, which was found to repress onco-suppressor genes and hence to promote tumorigenesis in different experimental models by two independent research groups [14, 15]. The characterization of multiprotein complexes requires different experimental approaches including the Co-immunoprecipitation protocol, aimed to enrich for a specific protein of interest and its interactors for subsequent analyses. The co-immunoprecipitation protocol consists of the following steps (Fig. 1):

Fig. 1 Schematic representation of the main steps of the immunoprecipitation protocol

The Co-IP in Mammalian Cells

69

• Preparation of a cell lysate or a protein mixture. • Incubation of the lysate with a resin coupled with the antibody of interest, which directly captures a “bait” protein and indirectly captures the bait interactors (“preys”). • Wash of the protein complexes immunoprecipitated with the antibody-coupled resin, to remove unspecific interactions • Elution of the immunoprecipitated protein complexes The eluted complexes can then be analyzed by mass spectrometry or by Western blot to see which proteins are interacting with the bait. The main difference between the two analytic approaches is that Western blot is performed when the researcher wants to detect any interaction between the bait and other hypothetic proteins of interest, while mass spec is aimed to characterize all the interactors that are immunoprecipitated with the bait without any a priori candidate.

2 2.1

Materials Reagents

1. 1 M Tris–HCl pH 7.5. 2. 1 M Tris–HCl pH 8.0. 3. 1 M Tris–HCl PH 6.8. 4. 1 M Hepes pH 7.5. 5. Triton X-100. 6. 1 M Dithiothreitol. 7. Protease inhibitors cocktail. 8. 100 mM PMSF (phenylmethylsulfonyl fluoride). 9. 100 mM Na3VO4 (sodium orthovanadate). 10. 500 mM NaF (sodium fluoride). 11. 3 M NaCl. 12. 1 M KCl. 13. 0.5 M EDTA. 14. 0.5 M EGTA. 15. 1 M MgCl2. 16. 10% NP-40. 17. 1 M Tris–HCl pH 6.8. 18. SDS (powder and 10% solution in H2O). 19. 100% Glycerol. 20. Bromophenol blue. 21. Magnetic beads.

70

Federica Lo Sardo

22. 17.4 M β-Mercaptoethanol. 23. Glycerol. 24. Antibodies for the Ip and IGG controls. 25. Antibodies for immune-detection. 2.2

Buffers

1. Lysis buffer 1: 50 mM Tris–Cl pH 7.5, 150–300 mM NaCl, 5 mM EDTA, 10 mM MgCl2, 1 mM KCl, 0.5% NP-40. Make fresh and store at room temperature. Add protease inhibitors just prior to use. 2. Lysis buffer 2: 150 Mm Hepes pH 7.5, 300 mM NaCl, 1% Triton X-100, 10 mM MgCl2, 5 mM KCl, 2 mM EDTA, 5 mM EGTA. 3. 4X Sample buffer: 200 mM Tris-HCl pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol, 50 mM EDTA, 6% bromophenol blue. Aliquots can be stored at- 20 °C without β-mercaptoethanol. After addition of β-mercaptoethanol, store at room temperature.

2.3

Equipments

1. Termomixer. 2. Centrifuge. 3. Microcentrifuge. 4. Wheel. 5. Magnetic rack. 6. Cool room. 7. Bioruptor.

3

Methods A good protein immunoprecipitation mainly depends on the affinity between the antibody and the bait of interest, as well as the presence of conditions that preserve native protein folding and native protein-protein interactions (see Note 1). Immunoprecipitation can be performed in native conditions, in which the endogenous proteins maintain their native post-translational modifications and three-dimensional structure, or in overexpression conditions (see Note 2). In any case, the co-IP is an explorative experiment that can give artifacts, false-positive and false-negative results (see Note 3). Moreover, Co-IP experiment cannot discriminate between direct and indirect interactions. To verify the confidence of the experimental design a positive and a negative control (see Note 4).

3.1 Lysis and Denaturation of Cellular Extracts

1. For cellular lysates, 5–10 × 106 cells are recommended to start. Once set up the best experimental conditions, starting material can be scaled down.

The Co-IP in Mammalian Cells

71

2. Trypsinize cultured cells. 3. Transfer cells into conical tubes. 4. Centrifuge at 500 × g for 5 min at 4 °C and remove the supernatant. 5. Wash the pellet twice with ice-cold PBS and centrifuge at 500 × g for 5 min at 4 °C. 6. Resuspend the cell pellet in 5 volumes of the appropriated lysis buffer supplemented with proteinase inhibitors (see Note 1) 7. Incubate 20’ On ice 8. Sonicate the lysate to fragment DNA (see Note 5) 9. Centrifuge the sonicated lysate for 10′ 13,000 rpm 4 °C to pellet and remove cellular debris. 10. Transfer the supernatant in a fresh tube and quantify the protein lysate for subsequent immunoprecipitation. 11. Calculate at least 800 μg of protein for each IP and for each isotype control (see Note 6). 3.2 Preclearing of the Antibody with the Beads

1. At this step, you can decide to use agarose beads or magnetic beads for you IP (see Notes 7 and 8). 2. Calculate 40 μL of beads for each sample and pull together the beads for subsequent washes. 3. Wash beads twice with 500 μL of lysis buffer supplemented with 0.05% BSA or in 1XPBS supplemented with 0.05% BSA. 4. To pellet beads, use the centrifuge if handling agarose beads and use magnetic rack for magnetic beads. 5. Resuspend washed beads in a volume of lysis buffer equal to the starting volume of the washed beads. 6. Supplement the lysis buffer with 0.05% BSA and split 40 μL of bead suspension for each sample. 7. Add lysis buffer up 500 μL for each sample. 8. Incubate on the wheel at 4 °C overnight.

3.3 Incubation of the Lysate with the Resin/ Coupled Antibody

1. Use at least 800 μg of sample in up to 500 μL lysis buffer supplemented with protease inhibitors and 0.05% BSA for incubation with either: • IgG as negative control. • The antibody/antibodies of interest. 2. Incubate the lysate with the beads-coupled antibody on the wheel at 4 °C overnight. 3. Store the remaining lysate at -80 °C for use as input control the next day.

72

Federica Lo Sardo

3.4 Washes and Elution of ImmunePrecipitated Sample

1. Wash the beads 4 times with lysis buffer freshly supplemented with protease inhibitors. 2. Resuspend the washed beads in 50–60 μL of 1X sample buffer (from 4X stock). 3. Denaturate the sample for 10′ at 95 °C. 4. Separate beads from the eluted sample (use centrifuge at room temperature for agarose beads, or magnetic rack for magnetic beads). 5. Load 20 μL of each Ip and the desired amount of input for Western blot analysis (see Note 9). 6. Analyze the Western blot (see Note 10).

4

Notes 1. Choice of the optimal lysis conditions: a good lysis buffer should preserve native protein folding and native protein–protein interactions as well as favor the antibody/bait interaction, to immunoprecipitate the bait and indirectly its interactors. In our hands, lysis buffer 1 and lysis buffer 2 work well for our purposes. Lysis buffer 2 contains a higher concentration of salts and the detergent Triton X-100, more indicated for the extraction of nuclear proteins. Prior to lysis, the buffer should be kept cold and supplemented freshly with Protease inhibitors cocktail, PMSF, Na3VO4, NaF. 2. The choice between experimental native conditions or overexpression conditions depends on different variables. The co-IP can be performed in endogenous conditions if a good antibody that recognizes with high affinity the bait of interest in native conditions is available, and if the bait is expressed at high levels in the cell model system or in the tissue analyzed. However, it can be possible that commercial antibodies that successfully immunoprecipitate a native protein are not available, or that low physiological expression of the endogenous proteins of interest make them difficult to be detected by an antibody. In those cases, the protein of interest (either the bait, the hypothesized prey, or both) can be overexpressed in a tagged version. MYC, FLAG, and HA are some examples of TAGS, consisting of small epitopes that can be expressed in frame with the protein of interest in order to be incorporated either at its N terminus or at C terminus (Fig. 2). In this case, the overexpressed proteins can be immunoprecipitated by TAG-specific antibodies and detected in the western blot analysis either by TAG-specific antibodies and by protein-specific antibodies (Fig. 3a, upper and middle blot, respectively).

The Co-IP in Mammalian Cells

73

Fig. 2 Cartoon representing a plasmid for the overexpression of a tagged protein (specifically, the YAP protein tagged with the FLAG epitope in frame with its N terminus). The main plasmid elements are schematically represented: the bacterial and eukaryotic replication origins, the ampicillin resistance gene, the FLAG tag in frame with the YAP open reading frame (ORF), the promoter and poly-A signal upstream and downstream the YAP ORF

3. False-positive results: In the lysis buffer, “sticky” proteins can immunoprecipitate molecules that in vivo are not interacting. False-negative results: transient or weak interactions between proteins may not be captured by co-Ip performed in native conditions. In that case, one could fix protein–protein interactions through crosslinking with 1–2% formaldehyde before cell lysis. Moreover, to confirm the results, the co-IP experiment can be accompanied by immunofluorescence and/or PLA (proximity ligation assay), two techniques which assess the proximity and the interaction between proteins directly in the cells, respectively, without prior lysis. These two techniques enable to see the position of the co-localization/interaction within the cell. 4. Positive and negative controls: a positive control is any protein already shown to interact with the bait, while a negative control is a non-interacting protein. As an example, for YAP protein, we know that it interacts in several cell types with the TEAD transcription factor (positive control, Fig. 3a, b) while it does not interact with the GAPDH protein (negative control, Fig. 3b). 5. Working condition for YAP co-IP: 2 pulses of 5′ (30 s on, 30 s off) with Bioruptor sonicator at a medium intensity.

74

Federica Lo Sardo

Fig. 3 (a) Western blot analysis of a co-Ip performed in cells overexpressing YAP. Prior to lysis, cells were transfected for 72 h with a plasmid encoding a FLAG-tagged version of the YAP protein (FLAG-YAP) or with an empty vector (EV) as a negative control. The lysates from EV or from FLAG-YAP transfected cells were immunoprecipitated either with an anti-FLAG antibody or with a rabbit IgG as negative isotype control. Samples were loaded in the gel with the following order: lane 1: EV input, (10% of the amount of the EV lysate used for each Ip). Lane 2: FLAG-YAP input (10% of the amount of the FLAG-YAP lysate used for each Ip). Lane 3 and 4: EV and FLAG-YAP extracts immunoprecipitated with rabbit IgG. Lane 5 and 6: EV and FLAG-YAP extracts immunoprecipitated with rabbit anti-FLAG antibody. The gel was blotted with antibodies recognizing YAP, FLAG, and TEAD, this latter used as a positive control of YAP interactor. (b) Western blot analysis of a co-Ip performed in native conditions in the non-small-cell-lung cancer cell line H1299 expressing appreciable levels of endogenous YAP. Cell lysates were immunoprecipitated either with a rabbit anti-YAP antibody or with rabbit IgG as isotype control. The loaded samples are indicated. The gel was blotted with antibodies recognizing YAP, TEAD (positive control), and GAPDH (negative control). (c) Western blot showing the signal of the heavy chain of increasing amount of rabbit IgG (lane 2–4). The signal is very close to that of the protein of interest, detected with an antibody made in rabbit (lane 1). In such cases, an antibody produced in a different host species should be preferable for blotting. In alternative, the gel should run for a longer time in order to better separate protein bands with similar molecular weights

6. Isotype controls are used as negative controls to discriminate non-specific background signal from specific antibody signal. If we immunoprecipitate a protein with an antibody produced in Rabbit, we will need to use IgG made in the same host species (Rabbit) as negative isotype control.

The Co-IP in Mammalian Cells

75

Table 1 Advantages and disadvantages of agarose vs magnetic beads

Advantages

Disadvantages

Agarose beads

Magnetic beads

High binding capacity

Low non-specific binding

Do not need magnetic rack (centrifugation or filtration are used to separate beads from supernatant) Lower cost

Easy to handle with magnetic rack Reproducible results

Beads are not visible in tubes

Higher cost

Handling is more difficult

Magnetic rack required

Possibility of losing beads through centrifugation steps

Lower binding capacity

Beads are visible in tubes

7. The antibody used for immunoprecipitation should be complexed with a resin prior to be incubated with the protein lysate. It is possible to use protein A/G-complexed agarose beads or magnetic beads, both of which have pros and cons, listed in Table 1. 8. Both agarose and magnetic beads are complexed with the antibody-binding domains of Protein A, Protein G, or both, which enable the purification of the IgG antibodies used for immunoprecipitation. In nature, Protein A is exposed on the surface of bacteria, specifically some strains of Staphylococcus Aureus, and is able to recognize and bind the Fc fragment of IgG molecules. Protein G is present on the cell wall of Streptococcal bacteria and binds the Fc fragment and the Fab fragment of IgG molecules, with some affinity difference compared to protein A. The protein A-complexed beads preferentially bind rabbit polyclonal antibodies, while protein G-complexed beads bind a wider range of antibodies including most mouse monoclonal IgG molecules. Beads complexed to both protein A and G are more expensive but offer the higher flexibility for each purpose. 9. The amount of total input loaded in the western blot gel can vary from 2% to 20% of the amount of total protein used in each pull-down. It should be adjusted depending on the enrichment of the protein of interest in the pull-down. If in the western blot the signal of the protein of interest is strong, the amount of the input sample should be higher. If the protein of interest is not much enriched in the Ip sample, the amount of the input loaded on the gel can be scaled down to amplify the signal of the immune-precipitated protein in the blot (Fig. 3).

76

Federica Lo Sardo

10. When we want to detect by western blot the presence or not of any protein of interest in the IP sample (putative interactors), we should pay attention to the antibody used for protein detection. If we use for detection an antibody made in the same host species of the antibody used for the Ip, the signal of the heavy chains and the light chains of the immunoprecipitated IgG molecules can interfere with the signal of the protein that we want to detect, if the protein of interest runs near 50 kda (heavy chain molecular weight), or 25 kda (light chain molecular weight, Fig. 3c). In such case, prefer, if available, an antibody made in a different host to detect the protein of interest. References 1. Blackledge NP, Klose RJ (2021) The molecular principles of gene regulation by Polycomb repressive complexes. Nat Rev Mol Cell Biol 22(12):815–833. https://doi.org/10.1038/ s41580-021-00398-y 2. Schuettengruber B, Bourbon HM, Di Croce L, Cavalli G (2017) Genome regulation by polycomb and trithorax: 70 years and counting. Cell 171(1):34–57. https://doi.org/10. 1016/j.cell.2017.08.002 3. Wang L, Jahren N, Vargas ML, Andersen EF, Benes J, Zhang J, Miller EL, Jones RS, Simon JA (2006) Alternative ESC and ESC-like subunits of a polycomb group histone methyltransferase complex are differentially deployed during Drosophila development. Mol Cell Biol 26(7):2637–2647. https://doi.org/10.1128/ mcb.26.7.2637-2647.2006 4. van Mierlo G, Veenstra GJC, Vermeulen M, Marks H (2019) The complexity of PRC2 subcomplexes. Trends Cell Biol 29(8):660–671. https://doi.org/10.1016/j.tcb.2019.05.004 5. Spires-Jones TL, Attems J, Thal DR (2017) Interactions of pathological proteins in neurodegenerative diseases. Acta Neuropathol 134(2):187–205. https://doi.org/10.1007/ s00401-017-1709-7 6. Lage K (2014) Protein-protein interactions and genetic diseases: the interactome. Biochim Biophys Acta 1842(10):1971–1980. https:// doi.org/10.1016/j.bbadis.2014.05.028 7. Cheng F, Zhao J, Wang Y, Lu W, Liu Z, Zhou Y, Martin WR, Wang R, Huang J, Hao T, Yue H, Ma J, Hou Y, Castrillon JA, Fang J, Lathia JD, Keri RA, Lightstone FC, Antman EM, Rabadan R, Hill DE, Eng C, Vidal M, Loscalzo J (2021) Comprehensive characterization of protein-protein interactions

perturbed by disease mutations. Nat Genet 53(3):342–353. https://doi.org/10.1038/ s41588-020-00774-y 8. Bellazzo A, Sicari D, Valentino E, Del Sal G, Collavin L (2018) Complexes formed by mutant p53 and their roles in breast cancer. Breast Cancer (Dove Med Press) 10:101–112. https://doi.org/10.2147/bctt.S145826 9. Parreno V, Martinez AM, Cavalli G (2022) Mechanisms of Polycomb group protein function in cancer. Cell Res 32:231–253. https:// doi.org/10.1038/s41422-021-00606-6 10. Kuehner JN, Yao B (2019) The dynamic partnership of polycomb and trithorax in brain development and diseases. Epigenomes 3(3): 1 7 – 2 4 . h t t p s : // d o i . o r g / 1 0 . 3 3 9 0 / epigenomes3030017 11. Wang X, Ni D, Liu Y, Lu S (2021) Rational design of peptide-based inhibitors disrupting protein-protein interactions. Front Chem 9: 682675. https://doi.org/10.3389/fchem. 2021.682675 12. Qiu J, Chen K, Zhong C, Zhu S, Ma X (2021) Network-based protein-protein interaction prediction method maps perturbations of cancer interactome. PLoS Genet 17(11): e1009869. https://doi.org/10.1371/journal. pgen.1009869 13. Lu H, Zhou Q, He J, Jiang Z, Peng C, Tong R, Shi J (2020) Recent advances in the development of protein-protein interactions modulators: mechanisms and clinical trials. Signal Transduct Target Ther 5(1):213. https://doi. org/10.1038/s41392-020-00315-3 14. Lo Sardo F, Pulito C, Sacconi A, Korita E, Sudol M, Strano S, Blandino G (2021) YAP/TAZ and EZH2 synergize to impair tumor

The Co-IP in Mammalian Cells suppressor activity of TGFBR2 in non-small cell lung cancer. Cancer Lett 500:51–63. https://doi.org/10.1016/j.canlet.2020. 11.037 15. Hoxha S, Shepard A, Troutman S, Diao H, Doherty JR, Janiszewska M, Witwicki RM,

77

Pipkin ME, Ja WW, Kareta MS, Kissil JL (2020) YAP-mediated recruitment of YY1 and EZH2 represses transcription of key cell-cycle regulators. Cancer Res 80(12):2512–2522. https://doi.org/10.1158/0008-5472.Can19-2415

Chapter 7 Site-Directed Mutagenesis Protocol to Determine the Role of Amino Acid Residues in Polycomb Group (PcG) Protein Function Diaa Al-Raawi and Aditi Kanhere Abstract Site-directed mutagenesis (SDM) is a technique in molecular biology and protein engineering that is widely used to determine the significance of specific residues involved in post-translational modifications (PTMs), protein structure, function, and stability. Here, we describe a simple and cost-effective polymerase chain reaction (PCR)-based SDM method. This method can be used to introduce point mutation, short addition, or deletions in protein sequences. Using polycomb repressive complex-2 (PRC2)-associated protein JARID2 as an example, we demonstrate how SDM can be used to study structural and consequently functional changes in a protein. Key words Site-directed mutagenesis, Point mutations, PRC2, Protein sequence manipulation, Sequence function relationship

1

Introduction SDM is an important technique that can be used to manipulate protein sequences at specific position. Such directed changes can be really useful in studying the relationship between protein sequence, structure, and its function. This technique can also provide valuable information about the role of specific amino acid residues in a protein in its interactions with other molecules, enzymatic activity, or changes in structure. Most commonly, in SDM, PCR primers are used to introduce mutations in protein-coding DNA sequences such as plasmids which are then translated in desired protein sequence. There are several PCR-based methods that have been applied to the generation of gene mutants [1–3]. One of the most prevalent and widely used method in many laboratories such as Quick-Change SDM is based on PCR with complementary primers and double-stranded DNA, digestion by the restriction enzyme Dpn I and transformation [4].

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_7, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

79

80

Diaa Al-Raawi and Aditi Kanhere

Fig. 1 Overview of Experimental Design of Point Mutation Method. The dsDNA template (Blue) with gene interest (dark red) is amplified by PCR and mutagenic complementary primers (cross depicts mutated base). Non-mutated plasmid (dash circle) is digested by the restriction enzyme Dpn I. Mutated DNA (black) is then transformed into competent cells, purified and confirmed by sequencing

Here, we describe SDM method (Fig. 1) that was used to introduce mutations into JARID2 protein which is an interacting partner of PRC2 complex. Recent proteomics studies have revealed that PRC2 proteins in particular EZH2, SUZ12, and JARID2 undergo different post-translational modifications (PTMs), such as methylation, acetylation, phosphorylation, ubiquitination, and sumoylation [5, 6]. Little is known about the functional mechanistic of how these PTMs modulate the PRC2 function. Base substitutions were introduced into JARID2 plasmid to identify proteolytic cleavage site in JARID2 and whether this proteolytic cleavage is affected by post-translational modifications. Previously, we have shown that full-length JARID2 is cleaved by serine protease enzyme resulting in a low molecular weight form, spanning the C-terminal conserved jumonji domains [7]. JARID2 is highly

Mutagenesis Protocol to Study PRC2 Function

81

phosphorylated at its N-terminus [8]. This protocol illustrates, using JARID2 as an example, how SDM can be used to introduce point mutation to replace Serine (phosphorylated site) at 78th position and to replace tyrosine (serine protease cleavage site) at 573th position with alanine.

2

Materials Maintain nuclease-free condition. All solutions should be made in DEPC-treated RNase- and DNase-free H2O (see Note 1).

2.1 General Reagents

1. DEPC-treated RNase-and DNase-free H2O.

2.2

1. DNA template: circular and double-strand DNA stock in RNase-and DNase-free H2O (see Note 2).

PCR Reagents

2. 70% Ethanol.

2. PCR primers: prepare 10 μM working stock and store at -20 °C avoiding repeated freezing and thawing (see Note 3). 3. High-fidelity DNA polymerase: PfuTurbo DNA polymerase (2.5 U/μL) or another suitable high-fidelity DNA polymerase (see Note 4). 4. DNA polymerase buffer: 10X Pfu reaction buffer with MgSO4 (supplied with DNA polymerase). 5. dNTPs mix at 10 mM. 6. SYBR Safe DNA gel stain. 7. TBE buffer 10X: 108 g Tris base, 55 g boric acid, 80 mL 0.5 M EDTA pH 8, 700 mL of dH2O. Adjust pH to 8.3 and bring to 1 L volume with dH2O. 8. Agarose gel 0.7%: 0.7 g of agarose, 100 mL 1× TBE buffer. 9. DNA ladder (1 kb). 10. DNA loading buffer. 2.3 DpnI Treatment Reagents

1. Dpn I restriction enzyme (10 U/μL).

2.4 Transformation Reagents

1. TOP10 cells or other suitable E. coli XL1 Blue competent cells. 2. pUC19 control plasmid. 3. S.O.C. medium. 4. Ampicillin 100 mg/mL, sterilize using 0.45 μm membrane filter. Aliquot and store at -20 °C. 5. LB—agar plate containing 100 μg/mL ampicillin: 15 g of agar, 20 g of Luria broth (LB), 1 L dH2O. Autoclave, after cooling add 1 mL of 100 mg/mL ampicillin. Mix well and pour to petri dishes (see Note 5).

82

Diaa Al-Raawi and Aditi Kanhere

2.5 Colony PCR Reagents (Optional)

1. 10 μM stock of PCR primers (see Note 6).

2.6 Mutant Purification Reagents

1. Luria broth (LB) containing 100 μg/mL ampicillin: 20 g of LB powder, 1 L dH2O. Autoclave, after cooling add 1 mL of 100 mg/mL ampicillin.

2. MyTaq Red mix or a suitable alternative ready-to-use PCR mix.

2. Plasmid DNA extraction kit: QIAprep Spin Miniprep kit (QIAgen) or a suitable alternative (see Note 7). 2.7

Equipment

1. RNase free: Eppendorfs, pipette tips, PCR tubes, falcon tubes. 2. Thermocycler. 3. DNA gel electrophoresis. 4. UV transilluminator. 5. NanoDrop spectrophotometer. 6. Centrifuge. 7. Water bath. 8. Inoculating loop, culture tubes, culture dishes, and flasks. 9. Shaking incubator at 37 °C. 10. Non-shaking incubator at 37 °C.

3

Methods We used this method to introduce point mutation in PRC2 interacting protein, JARID2 (3.7 kb sequence) inserted into pEF6 plasmid, with a total size is ~9.5 kb. All the methods should be done in Nuclease-free conditions (see Note 1).

3.1 Design of Primers

1. For point mutations, primers should be complementary to each other, anneal to the same site on opposite strands of the plasmid. 2. Using online tool or using SnapGene Viewer, 25–45 bases long primers spanning the site of mutation were designed. Primers should have a melting temperature (Tm) close to or greater than 78 °C and with a minimum GC content of 40%. 3. Primers should terminate with one or more C or G bases. 4. Point mutation should be in the middle of the primers with at least 10–15 bases on both sides. 5. As a guide, primers used for introducing point mutations in JARID2 sequence are provided below: For mutation of phosphorylation, target Serine 78 to Alanine: Forward Primer: 5′ -CCAGCATCAGAACAGGCAGAGAATGAAAAGGACG-3′ Reverse Primer: 5′-CGTCCTTTT CATTCTCTGCCTGTTCTGATGCTGG-3′.

Mutagenesis Protocol to Study PRC2 Function

83

For mutation of predicted serine protease cleavage site Tyrosine 573 to Alanine: Forward: 5′-ACGATCCGCTCATCGCCATCGAGTCGGTC C-3′. Reverse: 5′-GGACCGACTCGATGGCGATGAGCGGATC GT -3′. For calculating melting temperature for these primers, see Note 8. 3.2 PCR Amplification

1. PCR. Set up a 50 μL PCR as follows: 50 ng plasmid (JARID2 pEF6), 1 μL forward primer (10 μM stock), 1 μL reverse primer (10 μM stock), 1 μL dNTPs (10 mM stock), 5 μL 10× Pfu reaction buffer with MgSO4, 1 μL PfuTurbo DNA polymerase (2.5 U/μL), and make up the final volume to 50 μL using RNase-free H2O (see Note 9). 2. PCR program. Amplify DNA through PCR as follows (or according to vendor’s instruction in case of using another HF DNA polymerase) (see Note 10): denaturation: 95 °C for 3 min; amplification: 18 cycles of 50 s at 95 °C, 1 min at 55 °C and 10 min (1 min / 1 kb) at 68 °C; final Extension: 68 °C for 10 min; hold at 4 °C (see Note 11). 3. Gel electrophoresis: check the amplification by loading 10 μL of the PCR product on a 0.7% agarose gel containing 0.3 μg/ mL SYBR safe DNA gel stain. If there is a clear band of desired plasmid size, proceed with Dpn I digestion (see Note 12 & Fig. 2a).

3.3

Dpn I Digestion

1. Treat PCR product by adding 1 μL of the Dpn I restriction enzyme (10 U/μL) to the reaction, gently pipette the solution up and down several times and centrifuge for 1 min. Incubate the reaction in incubator at 37 °C for 1 h (see Note 13). 2. Load 10 μL of the treated DNA with Dpn I on a 0.7% agarose containing 0.3 μg/mL SYBR safe DNA gel stain to test digestion. Use a standard UV illuminator to visualize the gel. If there is a band corresponding to desired size of the plasmid, then proceed to DNA transformation (see Note 14 & Fig. 2b).

3.4 DNA Transformation

1. For each transformation, thaw 50 μL of TOP10 competent cells on ice (see Note 15). Add 3 μL of Dpn I-treated DNA into competent cells and stir gently using a pipette tip (do not mix by pipetting). Incubate the cells for 30 min on ice and store the remaining Dpn I reaction at -20 °C (see Note 16). As controls, carry out a negative control (competent cells only) and a positive control with 1 μL (0.1 ng/μL) of pUC19 control plasmid.

84

Diaa Al-Raawi and Aditi Kanhere

Fig. 2 PCR Amplification and Dpn I Digestion for JARID2 Mutants. (a) Agarose gel electrophoresis shows PCR products of JARID2 mutants detected at 9.5 kb and another faint band migrate faster corresponded to supercoiled parental DNA. (b) Analysis of Dpn I digestion from agarose gel shows a clear band of JARID2 mutants (9.5 kb), and parental DNA (non-mutated) is completely removed from the reactions

2. Heat-shock the cells at 42 °C for 45 s without shaking and then incubate for 2 min on ice. Incubate cells with 250 μL of room temperature S.O.C. medium at 225 rpm in a shaking water bath at 37 °C for 1 h. 3. Spread 100 μL of transformed cells on LB ampicillin agar plates (see Note 17). Incubate plates at 37 °C incubator overnight. If successful, colonies should appear in sample and positive control, but not in negative control. 3.5 Colony PCR (Optional)

1. Prepare 50 μL PCRs as follows: pick colonies into 21 μL RNase-free H2O in PCR tubes, 2 μL forward primer (10 μM), 2 μL reverse primer (10 μM), and 25 μL red mix reagent or other alternative PCR mix. 2. Amplify DNA through PCR as follows (or according to vendor’s instruction in case of using other PCR mix): denaturation: 94 °C for 1 min; amplification: 35 cycles of 94 °C; for 15 s, 58 °C for 30 s, and 72 °C for 10 s; final single extension at 72 °C for 1 min. 3. Check the size of PCR products on a 0.7% agarose containing 0.3 μg/mL SYBR safe DNA gel stain using a standard UV illuminator. Process to Subheading 3.6 if there is a band of desired size observed (see Note 18).

Mutagenesis Protocol to Study PRC2 Function

3.6 Mutant Purification and Confirmation

85

1. Pick two to three transformant colonies. Inoculate a single colony into 5 mL LB supplemented with ampicillin in a 15 mL culture tube overnight at 37 °C with constant shaking (see Note 19). 2. Extract DNA using a commercial plasmid purification kit (QIAprep Spin Miniprep Kit (QIAGEN)) or another alternative. To harvest the bacterial cells, centrifuge the 5 mL of LB culture at 6800 × g for 3 min at room temperature. Invert the tube to discard all the medium. 3. Re-suspend pelleted bacterial cells in 250 μL of P1 buffer containing RNase A, ensuring there are no cell clumps in suspension and then transfer to a microcentrifuge tube. Lyse cells in 250 μL of P2 buffer for no more than 5 min by inverting the tube 4–6 times until the solution becomes viscous and slightly clear. 4. Add 350 μL of N3 buffer to lysed cells and invert the tube 4–6 times to mix gently and thoroughly. Centrifuge at ~17,900 × g for 10 min to remove cell debris. Apply the supernatant to QIAprep spin column and centrifuge for 1 min. Discard the flow-through that is collected in the bottom tube. 5. Wash the column in 0.5 mL PB buffer and centrifuge for 1 min. Discard the flow-through that is collected in the bottom tube. Wash the column in 0.75 mL PE buffer containing 70% ethanol and centrifuge for 1 min. Discard the flow-through and centrifuge for 1 min at full speed to remove residual ethanol from PE buffer. 6. Elute DNA by placing QIAprep spin column in 1.5 mL microcentrifuge tube and adding 40 μL RNase-free H2O to the center of the column. Incubate for 1 min and centrifuge for 1 min (see Note 20). Measure the concentration of DNA using a NanoDrop spectrophotometer. 7. Prepare miniprepped DNA for sequencing by mixing the desired quantity with specifically designed forward and reverse primers at the two ends of the cloned sequence (see Note 21). The reaction can be given for DNA sequencing to the local facility (Fig. 3).

4

Notes 1. Clean workplace with RNase Zap and ethanol if possible and use disposable, sterile Eppendorfs and pipette to maintain Nucleases free conditions. Ensure that disposable gloves and a lab coat are worn at all the times. 2. It is important that the template is a double-strand DNA, isolated from a dam+ E. coli strain which methylates adenine

86

Diaa Al-Raawi and Aditi Kanhere

Fig. 3 DNA sequencing results of JARID2 S78A and Y573A mutants. (a) DNA sequencing map of JARID2 S78A shows the mutated base T replaced by G, framed by the red rectangle. (b) Map of DNA sequences of mutated JARID2 Y573A where tyrosine (TAC) is replaced by alanine (GCC), outlined by red rectangle

residue in the GATC sequence by its dam methylase. The restriction enzyme Dpn I digests non-mutated dsDNA through targeting this methylated sequence. Thus, plasmid purified from dam- strains such as JM110 and SCS110 should not be used. 3. Primers may be required to be purified by HPLC or PAGE for high mutation efficiency. However, desalted primers worked well for us without any issues. 4. It is necessary to use a high-fidelity DNA polymerase that exhibits 3′ → 5′ exonuclease proofreading activity and a high extension rate to minimize the chances of unwanted mutation. We advise to use Pfu Ultra High-Fidelity DNA polymerase exhibiting 18-fold higher fidelity than Taq DNA polymerase. 5. Optional: prepare LB- agar plates without antibiotic for transformed bacteria without plasmid to be used as control. This will be useful to check the competent cells are in a good condition. 6. Use forward primer on the plasmid (such as: T7 promoter 5′-TAATACGACTCACTATAGGG-3′) and reverse primer on the insert gene.

Mutagenesis Protocol to Study PRC2 Function

87

7. At this stage, small-scale DNA purification using miniprep kit is enough. If required, use Midiprep or Maxiprep kits for largescale purifications. 8. Calculate melting temperature values for primers using online tools such as (http://depts.washington.edu/bakerpg/ primertemp/). The melting temperature (Tm) is calculated based on this equation Tm = 81.5 + 0.41(%GC) - 675/N % mismatch, where N = total number of bases. 9. PCR conditions should be optimized according to the plasmid size and HF DNA polymerase used. To optimize the concentration of the plasmid, use different concentration of desired plasmid template (5 ng, 10 ng, 20 ng, and 50 ng) without changing concentration of the primers. Adjust the concentration of primers according to vendor’s recommendations for HF DNA polymerase used. High concentration of primers causes primer dimers by favoring primer–primer annealing. 10. For PCR amplification, setting up “Hot start” of the enzyme is required for its activity to reduce non-specific binding, primer dimers, and background. Initial denaturation may increase up to 5 min with higher complexity (GC-rich) templates. The annealing temperature at 55 °C should work fine, if this does not work, try annealing temperature between 50 and 60 °C. Number of cycles depends on the type of mutations; 12–18 cycles are sufficient for point mutation to avoid the chances of introducing unwanted mutations. Change extension time based on template size and polymerase used. 11. Final extension step is not required for Quick-Change sitedirected mutagenesis protocol. 12. Using gel electrophoresis, there should be a visible band corresponding to mutated DNA plasmid with correct size. Another faint band corresponding to parental supercoiled dsDNA (non-mutated) might be seen running lower than mutated DNA. If the PCR fails, adjust annealing temperature, check primer design, primer concentration, denaturation time, extension time, and Mg2+ concentration. 13. The restriction enzyme Dpn I digests DNA purified from a dam+ strain through cleaving methylated sites, removing non-mutated DNA (parental) from amplified PCR product. Dpn I is highly active in most of polymerase reaction buffers; thus, it can be directly added to amplification reaction. 14. A clear band of the mutated plasmid should be seen on a 0.7% agarose gel. If there is a faint band corresponding to non-mutated DNA (see Note 12), this means the digestion is not complete, try to increase incubation time to 2 h or more.

88

Diaa Al-Raawi and Aditi Kanhere

15. Transformation is crucial for SDM protocol. We advise to use super-competent cells with high transformation efficiency. To be noted that E. coli XL1-Blue cells are not suitable to use with plasmid containing tetracycline resistance markers because they are resistance to tetracycline. We found no colonies when used in house prepared DH5-alpha E. coli. Then, TOP 10 cells were used, allowing for transformation efficiency of 1 × 109 cfu/μ g DNA. 16. PCR buffers inhibit the transformation. Therefore, 3 μL of Dpn I-treated DNA is enough to transform into competent cells with the good PCR yield. In case of low colony number and there is a need to use a large volume of Dpn I-treated DNA, we advise to clean-up the reaction first using DNA purification kit and elute in water before transformation. 17. Plate two dishes for each transformation by spreading two different volumes for well-spaced colonies. To plate smaller volume, pellet the cells by centrifuging at 6800 × g for 3 min, and re-suspend in 100 μL of S.O.C. medium. An optional step is to spread transformed cells on LB ampicillin agar plates with 80 μg/mL X-gal to confirm the transformation. 18. This step is optional. Before proceeding with mutant purification, verify the transformation using specific primers that span boundaries of the inserted gene and plasmid and check the product size using gel. 19. Growth of bacteria in LB medium with antibiotic should be for no more than 16 h as cells begin to lyse, leading to reduce plasmid DNA yields. 20. A short incubation after addition of the elution buffer will increase DNA yield. 21. For sequencing, use 500 ng of DNA and primers in both directions covering the whole gene sequence and plasmid backbone.

Acknowledgments This work was supported by University of Liverpool and Islamic Development Bank. References 1. Edelheit O, Hanukoglu A, Hanukoglu I (2009) Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies. BMC Biotechnol 9:61. https://doi. org/10.1186/1472-6750-9-61

2. Silva D, Santos G, Barroca M, Collins T (2017) Inverse PCR for point mutation introduction. Methods Mol Biol 1620:87–100. https://doi. org/10.1007/978-1-4939-7060-5_5 3. Zhang K, Yin X, Shi K, Zhang S, Wang J, Zhao S, Deng H, Zhang C, Wu Z, Li Y,

Mutagenesis Protocol to Study PRC2 Function Zhou X, Deng W (2021) A high-efficiency method for site-directed mutagenesis of large plasmids based on large DNA fragment amplification and recombinational ligation. Sci Rep 11(1):10454. https://doi.org/10.1038/ s41598-021-89884-z 4. Braman J, Papworth C, Greener A (1996) Sitedirected mutagenesis using double-stranded plasmid DNA templates. Methods Mol Biol 57: 31–44. https://doi.org/10.1385/0-89603332-5:31 5. Lu H, Li G, Zhou C, Jin W, Qian X, Wang Z, Pan H, Jin H, Wang X (2016) Regulation and role of post-translational modifications of enhancer of zeste homologue 2 in cancer development. Am J Cancer Res 6(12):2737–2754

89

6. Yang Y, Li G (2020) Post-translational modifications of PRC2: signals directing its activity. Epigenetics Chromatin 13(1):47. https://doi.org/ 10.1186/s13072-020-00369-1 7. Al-Raawi D, Jones R, Wijesinghe S, Halsall J, Petric M, Roberts S, Hotchin NA, Kanhere A (2019) A novel form of JARID2 is required for differentiation in lineage-committed cells. EMBO J 38(3). https://doi.org/10.15252/ embj.201798449 8. Kasinath V, Faini M, Poepsel S, Reif D, Feng XA, Stjepanovic G, Aebersold R, Nogales E (2018) Structures of human PRC2 with its cofactors AEBP2 and JARID2. Science 359:940–944. https://doi.org/10.1126/science.aar5700

Chapter 8 Isolation of Chromatin Proteins by Genome Capture Sergi Aranda and Luciano Di Croce Abstract Control of gene expression and the faithful transmission of genetic and epigenetic information rely on chromatin-bound proteins. These include the polycomb group of proteins, which can display a remarkable variability in their composition. Alterations in the chromatin-bound protein compositions are relevant for physiology and human disease. Thus, chromatin-bound proteomic profiling can be instrumental for understanding fundamental cellular processes and for identifying therapeutic targets. Inspired by biochemical strategies for the isolation of proteins on nascent DNA (iPOND) and the very similar DNA-mediated chromatin pull-down (Dm-ChP), we described a method for the identification of Protein on Total DNA (iPOTD) for bulk chromatome profiling. Here, we update our iPOTD method and, in particular, detail the experimental procedure for the isolation of chromatin proteins for mass spectrometry-based proteomic analysis. Key words Chromatin, Polycomb, Proteomics, iPOTD

1

Introduction In eukaryotic cells, chromatin is a highly organized and packed macromolecular nuclear structure formed by DNA, RNA, histones, and non-histone proteins [1, 2]. Chromatin-bound proteins organize the three-dimensional structure of chromatin, regulate gene expression, replicate DNA, and transmit epigenetic information to cellular progeny [1–5]. Several human diseases are highly influenced by alterations in the chromatin-bound protein [6, 7]. These include mutations and misregulation in the components of the polycomb group of proteins that are associated to the evolution and prognosis of different cancer types [8, 9]. Considering that chromatin is estimated to contain thousands of different proteins [10], the development of new approaches for the systematic de novo identification of chromatin-binding proteins could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders.

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_8, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

91

92

Sergi Aranda and Luciano Di Croce

We have recently developed an experimental strategy for a simple, robust, and straightforward chromatome profiling that combines a biochemical method to capture DNA with highresolution mass spectrometry analysis and a subsequent statistical assessment, for the identification of bona fide chromatin-bound proteins [11, 12]. This method, the identification of Proteins on Total DNA (iPOTD), relies on first efficiently incorporating the thymidine analog 5-ethynyl-20 -deoxyuridine (EdU) throughout cellular genomes in a non-cytotoxic manner, then adding a biotin moiety to the incorporated EdU using mild conditions, capturing sheared EdU-labelled chromatin using streptavidin–biotin affinity, and finally identifying relevant chromatin interactors by mass spectrometry and SAINT analysis (Fig. 1). Here, we provide an updated version of the biochemical procedure of iPOTD, which enables to survey the chromatin-bound proteome in a global and unbiased manner.

2

Materials

2.1 Media Components and Reagents

1. Biotin-azide (PEG4 carboxamide-6-azidohexanyl biotin). 2. Copper (II) sulfate pentahydrate, suitable for cell culture, 98% (CuSO45H2O). 3. Dynabeads M-280 streptavidin. 4. EdU, 5-ethynyl-20 -deoxyuridine. 5. Glycine, for molecular biology, 99.0%. 6. L-Ascorbic acid, reagent grade, crystalline. 7. Paraformaldehyde, reagent grade, crystalline. 8. PIC, complete, EDTA-free protease inhibitor cocktail. 9. RapiGest SF Surfactant. 10. Salmon sperm DNA (ssDNA), deoxyribonucleic acid, low molecular weight from salmon sperm. 11. Gelatin 0.1% (EmbryoMax, Millipore). 12. PD0325901 (Selleck). 13. CHIR-99021 (Selleck). 14. DMEM/F12 medium (Gibco). 15. Neurobasal medium (Gibco). 16. N2 supplement (Gibco). 17. B-27 serum-free supplement (Gibco). 18. Glutamax (Gibco). 19. Nonessential amino acids-MEM (NEAA) (Gibco). 20. β-Mercaptoethanol (Gibco).

20

iPOTD Total

Sin3a Kdm2a Kdm3a

Mll5

Epop

Wdr82

Atrx

Ruvbl2

Chd4

Rnf2 Nsd1 Smarca4

Jarid2

Ezh2

Nacc1

Ruvbl1

7.5

Component Function

iPOTD Total

Naa50 Kdm5b

Hcfc1 Smyd5

Hdac1

Smarca5 Kdm1a

Sap18

Mtf2 Mll2

Eed

Suz12

Mga

Wdr5

Smarcb1

Hells

Hdac2

0.5

Enrichment score 30

Log2(FC;EdU+/EdU-)

nu cl ea rn N uc A pa le ck nu os nu a cl om cl gin eo e pr ea g so ot r e co m ei u m e n- ch p DN ro le A ma x eu com tin ch p s r le ce om x po ma st ll r M ll s at i sy ib CM u n rf na os p om co ace po tic al mp st sp su lex e po syn cia bu ly ap liz nit cy so ti at to m c d ion so la al en lic rge rib s la ri os ity rg bo r o e s rib om ibo me os al so nu om su me cl eo al bu so su ni m bu t nu al ni st ch cl DN t ru eo A r o ct m so b ur at m in al ne in e di c ga D N b i ng s t on tiv A ndi ru st e ct itu rRN bin ng re ur e n A d gu in al t la m of bi n g tio ne ol ri di n ec bo ng ga of ul so tiv ch e e ac me re reg ro tiv gu u m ity la lat atin tio io nu n n o sile do cl of f c nc ub eo ge el in le g -s n s n l tr pr c pr n uc om e s killi an ot h o u le e il n r t c d ein om ei le os po en g c n br o o ea DN ati -DN so m siti ing k A n a A m e a on pr rep co ss co e o ss i ng PC e m e A PC e-re air p m mp rga mb in A p vi lex bly le ni x za ly vo in lic a s o b a lv vo at re ub r d s ti o ed l iv a u i se n v in ed e c k-in nit sas mb nu in om du or se ly cl ce pl ce ga mb ea ll ex d ni ly r c cy a re za el cl sse pl tio lc e m ic n y DN b ati cy cle A ly ( on to DN rep PC pl A li A as r ca ) m ep tio ic lic n tr at an io sl n at io n D

Purification of Chromatin Proteins for iPOTD 93

a 100

90 40

Process iPOTD Total

10

0

b

Aebp2 Sirt1

Cbx3

Ash2l

not present in our data-set

FDR ≤ 5%

Ehmt1

FDR ≥ 5%

Pcgf2

Rbbp4

Rbbp7

Fig. 1 Enrichment for proteins associated with chromatin-based processes. (a) Enrichment scores for the selected Go terms found common in both iPOTD and total proteome from [12]. Using iPOTD, we found remarkable enrichment in proteins associated with nucleosome associated complexes (Go component), with DNA binding/packaging (Go function) and, with gene regulation and nucleosome organization processes

94

Sergi Aranda and Luciano Di Croce

21. Bovine serum albumin (BSA) fraction V 30% (Gibco). 22. Penicillin–streptomycin (Gibco). 23. LIF (ESGRO mouse LIF medium, Millipore). 2.1.1

Solutions

1. 0.5 M Ascorbic acid solution: 8.8 g L-ascorbic acid, 100 mL dH2O. Store aliquots at 20  C for up to 1 year. 2. 10 mM Biotin-azide solution: 1 mg biotin-azide, 162.5 uL DMSO. Store aliquots at 20  C for up to 1 year. 3. 1 M CuSO4 solution: 24.9 g copper (II) sulfate pentahydrate, 100 mL dH2O. The solution can be stored at 4  C for up to 6 months. 4. 25 mM EdU solution: 50 mg EdU, 7.9 mL PBS pH 7.4 at 37  C. Store aliquots at 20  C for up to 1 year. Avoid freeze and thaw cycles. 5. 16% Formaldehyde (wt/vol) solution: 0.17 g of Na2CO3, 80 mL, 16 g of paraformaldehyde. Store aliquots at 80  C for up to 1 year. Avoid repeated freeze/thaw cycles. 6. 1.25 M Glycine solution: 9.4 g of glycine in 100 mL 1 PBS pH 7.4. 7. 25 Protease cocktail inhibitors (PIC) solution: one tablet of PIC in 2 mL dH2O. Store aliquots at 20  C for up to 3 months. Avoid freeze/thaw cycles. 8. 5% RapiGest SF solution: 50 mg RapiGest SF Surfactant, 1 mL 10 mM Tris–HCl. Store aliquots at 20  C. 9. Salmon sperm DNA (ssDNA) solution: 75 mg salmon sperm DNA, 1 mL dH2O. Sonicate for 10 ns with Bioruptor at 4  C (30 s ON/30 s OFF, at a high intensity). Prepare freshly every time. 10. 2iLIF mouse ESCs culture media: 250 mL DMEM/F12, 250 mL Neurobasal, 2.5 mL N2, 5 mL B27, 2.2 mL BSA, 0.5 mL β-mercaptoethanol, 5 mL penicillin–streptomycin, 5 mL NEAA, 5 mL Glutamax, 50 uL PD0325901 10 mM, 150 uL CHIR99021 10 mM, 50 uL LIF.

ä Fig. 1 (continued) (Go processes), as compared with total proteome. In contrast, iPOTD samples are reduced in ribosomal components, which are highly abundant in the total proteome. (b) Interacting networks from selected proteins found by iPOTD in [12]. Protein interaction data were retrieved from the STRING database (v 11.5, [16]). Only experimentally validated protein–protein interactions, curated databases, and text-mining information was considered. Functionally related protein networks were visualized using Cytoscape (v3.8.2, [17]). For visualization, only a protein–protein interacting network centered on the polycomb repressive complex 2 (PRC2) was selected. The legend indicates the color code for log2 of the fold changes in +EdU/ EdU conditions and the presence and significance of each protein. The edge style indicates the confident score for the protein–protein interaction (dashed lines < 0.4; solid lines > 0.4)

Purification of Chromatin Proteins for iPOTD 2.1.2

Buffers

95

1. Click reaction mix with biotin-azide: 100 mM Tris–HCl pH 7.4, 2 mM CuSO4, 0.2 mM biotin-azide, and (added immediately before use) 100 mM L-ascorbic acid. 2. Dilution buffer: 1% Triton X-100, 2 mM EDTA pH 8, 150 mM NaCl, 20 mM Tris–HCl (pH 8), 20 mM β-glycerol phosphate, 2 mM sodium orthovanadate, 1 PIC, and 5 mg/ mL salmon sperm DNA. 3. Elution buffer: 0.25% RapiGest SF, 0.06 M Tris–HCl pH 6.5, and 0.1 M dithiothreitol (DTT). 4. Fragmentation buffer: 20 mM Tris–HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.1% sodium deoxycholate (SDS), 0.5% sodium deoxycholate, 1% Triton X-100, 10 mM -β-glycerol phosphate, 1 mM sodium orthovanadate, and 1 PIC. 5. High-salt washing buffer: 1% Triton X-100, 2 mM EDTA, 500 mM NaCl, 20 mM Tris–HCl pH 8. 6. PBS-PIC: Dissolve one PIC tablet in 50 mL PBS. 7. Permeabilization buffer: 10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% [v/v] glycerol, 1 mM DTT, 10 mM β-glycerol phosphate, 1 mM sodium orthovanadate, 1 PIC and 0.1% (vol/vol) Triton X-100. 8. 1 TE: 10 mM Tris–HCl (pH 7.5), 1 mM EDTA (pH 8.0). 9. Washing buffer: 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, and 20 mM Tris–HCl pH 8.

3

Methods The following protocol is indicated when applying iPOTD with mouse embryonic stem cells (ESCs). However, the protocol can be successfully applied to multiple proliferating cells.

3.1 EdU Labeling, Cell Fixation, and Permeabilization

1. Incubate exponentially growing ESC cultures with 0.1 μM EdU for 20 h. Use non-EdU incubated growing ESCs cultures as a negative control. From then onwards, process EdU and non-EdU incubated cells in parallel (see Note 1). 2. Fix the growing cells by adding formaldehyde solution (final concentration 1%) directly to the media under a fume hood. Incubate for 10 min at room temperature with gentle agitation (see Notes 2 and 3). 3. Quench the formaldehyde by adding glycine solution (final concentration 0.125 M) directly to the fixed cells. Incubate for 5 min at room temperature with gentle agitation. 4. Discard the media from the dishes in an appropriate recipient for its environmentally friendly disposition.

96

Sergi Aranda and Luciano Di Croce

5. Wash the attached cells three times with PBS 1 (pH 7.4). 6. Harvest the cells with ice-cold PBS-PIC solution and collect them into a 15 mL polystyrene centrifuge tube. 7. Use a swing-bucket rotor at 1300 g for 4 min at 4  C to pellet the cells by centrifugation (see Note 4). 8. Suspend the cells with 2 mL ice-cold PBS-PIC and count them. 9. Collect 2–4  107 cells by centrifugation, using a swing-bucket rotor at 1300 g for 4 min at 4  C, and suspend with 5 mL permeabilization buffer. Incubate cells for 30 min at 4  C with gentle rotation (see Note 5). 10. Use a swing-bucket rotor at 1300 g for 4 min at 4  C to pellet the permeabilized cells by centrifugation. 11. Wash the permeabilized cells with 2 mL ice-cold PBS-PIC and then collect them by centrifugation in a swing-bucket rotor at 1300 g for 4 min at 4  C. 12. Transfer the permeabilized cells into a 1.5 mL Eppendorf tube with 1 mL ice-cold PBS-PIC and collect them by centrifugation using a swing-bucket rotor at 1300 g for 4 min at 4  C (see Note 6). 3.2 Biotinylation and Chromatin Fragmentation

1. Perform the biotinylation by suspending the cells in 1 mL of freshly prepared Click reaction mix for 30 min at room temperature with gentle rotation (see Note 7). 2. Collect the cells by centrifugation in a swing-bucket rotor at 1300 g for 4 min at 4  C. 3. Wash the cell pellet two times with 1.4 mL ice-cold PBS-PIC and then collect them by centrifugation in a swing-bucket rotor at 1300 g for 4 min at 4  C. 4. Homogenize the pellet with 4 mL fragmentation buffer into a 15 mL polystyrene centrifuge tube and then incubate them for 10–30 min on ice. 5. Fragment the cells with a Bioruptor sonicator for 40 min at 4  C with cycles of 30 s ON and 30 s OFF at high intensity. 6. Clarify the samples by centrifugation at 15000 g for 10 min at 4  C in a tabletop centrifuge (see Note 8). 7. Collect the cleared samples for Biotin capture with streptavidin magnetic beads M280 (see Note 9).

3.3 Pre-block of Beads

1. For each genome capture, collect 0.5 mL streptavidin magnetic beads M280 using the DynaMag™-2 Magnet (see Note 10). 2. Wash two times with 1 mL PBS 1 (pH 7.4).

Purification of Chromatin Proteins for iPOTD

97

3. Incubate the beads with 1 mL PBS containing 10 mg/mL ssDNA, for 1 h at room temperature with gentle agitation in a rotator. The beads can be prepared 1 day in advance and stored at 4  C. Once the beads are blocked, continue with the genome capture procedure. 3.4 Genome Capture and Protein Elution

1. Collect the pre-blocked beads using the DynaMag™-2 Magnet and dilute them in 0.5 mL dilution buffer. 2. Add the fragmented samples diluted four times the volume with dilution buffer. 3. Incubate fragmented samples and blocked beads, for 2 h at 4  C with gentle agitation in a rotator. 4. Collect the beads with the DynaMag-2 Magnet (see Note 11). 5. Wash the beads twice by adding 1 mL washing buffer, mixing the tube upside-down, and collecting the beads with the DynaMag™-2 Magnet. 6. Repeat step 5 using 1 mL high-salt washing buffer. 7. Repeat step 5 using 1 mL 1 TE buffer. 8. Resuspend the beads using 200 μL 1 TE buffer and collect them with the DynaMag-2 Magnet. 9. Suspend the beads in 75 μL RapiGest SF buffer (see Note 12). 10. Boil the bead suspension for 20 min at 95  C. After boiling for 10 min, mix the bead suspension with a quick vortex. 11. Collect the supernatant after precipitating the beads with the DynaMag-2 Magnet. Samples can be stored at 20  C for posterior mass spectrometry or Western blot analysis (see Note 13).

4

Notes 1. Before starting to use the strategy, we recommend to set up the appropriate times and concentrations of EdU incubations. Long incubations of more than 48 h with 10 μM of EdU are cytotoxic in several human cancer cell lines [13–15]. We recommend evaluating the possible cytotoxicity of EdU incubation at three different levels [12]: (i) at the transcriptional level; (ii) at the proliferation level; and (iii) at the DNA damage response activation. The time and concentration indicated below refer to those used previously with mouse ESCs [12]. 2. The current protocol includes a fixation step using a homemade 16% formaldehyde (wt/vol) solution. However, commercially available methanol-free formaldehyde solutions can also be used.

98

Sergi Aranda and Luciano Di Croce

3. The current protocol performs the fixation step with adherent cells attached to the petri dish. However, fixation can be also performed in cells in suspension (e.g., growing conditions, trypsinized, or fluorescent-activated sorted cells). Then, additional washing steps with 1 PBS and centrifugation steps can be performed after formaldehyde quenching with glycine solution. 4. Fixed cell pellets can be stored at 80  C at this step after centrifugation, and before permeabilization. 5. For the optimal analysis, we recommend starting with >1  107 cells. However, we have successfully performed the proteomic analysis with 2–4  106 cells. 6. The use of a swing-bucket rotor enables the collection of the cells at the bottom of the tube. 7. Longer incubation up to 1 h can be performed without increasing the background signal. 8. If required, split the sample into several Eppendorf tubes for centrifugation and then pool the clarified samples. 9. Chromatin fragmentation is critical for optimal streptavidin capturing. DNA fragmentation and EdU labeling must be monitored before moving on to the next step. Optimal fragmentation is around 200–500 bp. If fragmentation is not optimal, include additional sonication cycles. Fragmented samples can be stored at 80  C. 10. Pool the amount of beads required for the analysis in one tube for the pre-block. 11. Perform serial collection of the beads with the material captured in one single Eppendorf tube. 12. The use of RapiGest SF simplifies and improves the subsequent in-solution protein digestion during sample preparation for mass spectrometry analysis. 13. The efficiency of the genome capture can be monitored by a dot blot and using specific antibodies against chromatin protein (e.g., histone H3) and cytosolic protein markers (e.g., vinculin).

Acknowledgments This work was supported by the Spanish of Economy, Industry and Competitiveness (MEIC) (PID2019-108322GB-100), “CaixaResearch Health” (HR20-00411), “Fundacio´n Vencer El Cancer” (VEC), the European Regional Development Fund (FEDER), and from AGAUR to L.D.C. The Ramon y Cajal program of the Ministerio de Ciencia, Innovacio´n y Universidades and the

Purification of Chromatin Proteins for iPOTD

99

European Social Fund under the reference number RYC-2018025002-I, and the Instituto de Salud Carlos III-FEDER (PI19/ 01814 and PI22/01837), to S.A. We acknowledge the funding support of the Spanish Ministry of Science and Innovation to the EMBL partnership, the Centro de Excelencia Severo Ochoa, and the CERCA Programme/Generalitat de Catalunya. References 1. Cramer P (2014) A tale of chromatin and transcription in 100 structures. Cell 159(5): 985–994. https://doi.org/10.1016/j.cell. 2014.10.047 2. Aranda S, Mas G, Di Croce L (2015) Regulation of gene transcription by Polycomb proteins. Sci Adv 1(11):e1500737. https://doi. org/10.1126/sciadv.1500737 3. Bonev B, Cavalli G (2016) Organization and function of the 3D genome. Nat Rev Genet 17(11):661–678. https://doi.org/10.1038/ nrg.2016.112 4. Almouzni G, Cedar H (2016) Maintenance of epigenetic information. Cold Spring Harb Perspect Biol 8(5). https://doi.org/10.1101/ cshperspect.a019372 5. Gilbert DM, Takebayashi SI, Ryba T, Lu J, Pope BD, Wilson KA, Hiratani I (2010) Space and time in the nucleus: developmental control of replication timing and chromosome architecture. Cold Spring Harb Symp Quant Biol 75:143–153. https://doi.org/10.1101/ sqb.2010.75.011 6. Mirabella AC, Foster BM, Bartke T (2016) Chromatin deregulation in disease. Chromosoma 125(1):75–93. https://doi.org/10. 1007/s00412-015-0530-0 7. Espejo I, Di Croce L, Aranda S (2020) The changing chromatome as a driver of disease: a panoramic view from different methodologies. BioEssays 42(12):e2000203. https://doi.org/ 10.1002/bies.202000203 8. Di Carlo V, Mocavini I, Di Croce L (2019) Polycomb complexes in normal and malignant hematopoiesis. J Cell Biol 218(1):55–69. https://doi.org/10.1083/jcb.201808028 9. Chammas P, Mocavini I, Di Croce L (2020) Engaging chromatin: PRC2 structure meets function. Br J Cancer 122(3):315–328. https://doi.org/10.1038/s41416-0190615-2 10. UniProt Consortium T (2018) UniProt: the universal protein knowledgebase. Nucleic Acids Res 46(5):2699. https://doi.org/10. 1093/nar/gky092

11. Aranda S, Borras E, Sabido E, Di Croce L (2020) Chromatin-bound proteome profiling by genome capture. STAR Protoc 1(1): 100014. https://doi.org/10.1016/j.xpro. 2020.100014 12. Aranda S, Alcaine-Colet A, Blanco E, Borras E, Caillot C, Sabido E, Di Croce L (2019) Chromatin capture links the metabolic enzyme AHCY to stem cell proliferation. Sci Adv 5(3):eaav2448. https://doi.org/10.1126/ sciadv.aav2448 13. Diermeier-Daucher S, Clarke ST, Hill D, Vollmann-Zwerenz A, Bradford JA, Brockhoff G (2009) Cell type specific applicability of 5-ethynyl-20 -deoxyuridine (EdU) for dynamic proliferation assessment in flow cytometry. Cytometry A 75(6):535–546. https://doi. org/10.1002/cyto.a.20712 14. Qu D, Wang G, Wang Z, Zhou L, Chi W, Cong S, Ren X, Liang P, Zhang B (2011) 5-Ethynyl-20 -deoxycytidine as a new agent for DNA labeling: detection of proliferating cells. Anal Biochem 417(1):112–121. https://doi. org/10.1016/j.ab.2011.05.037 15. Neef AB, Luedtke NW (2011) Dynamic metabolic labeling of DNA in vivo with arabinosyl nucleosides. Proc Natl Acad Sci U S A 108(51): 20404–20409. https://doi.org/10.1073/ pnas.1101126108 16. Szklarczyk D, Gable AL, Nastou KC, Lyon D, Kirsch R, Pyysalo S, Doncheva NT, Legeay M, Fang T, Bork P, Jensen LJ, von Mering C (2021) The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/ measurement sets. Nucleic Acids Res 49(D1): D605–D612. https://doi.org/10.1093/nar/ gkaa1074 17. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T (2003) Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 13(11):2498–2504. https://doi.org/10. 1101/gr.1239303

Chapter 9 Dynamic Interactome of PRC2-EZH1 Complex Using Tandem-Affinity Purification and Quantitative Mass Spectrometry Peng Liu, Huoming Zhang, Francesco Della Valle, and Valerio Orlando Abstract The Polycomb repressive complex 2 (PRC2) is a well-characterized chromatin regulator of transcription programs acting through H3K27me3 deposition. In mammals, there are two main versions of PRC2 complexes: PRC2-EZH2, which is prevalent in cycling cells, and PRC2-EZH1 where EZH1 replaces EZH2 in post-mitotic tissues. Stoichiometry of PRC2 complex is dynamically modulated during cellular differentiation and various stress conditions. Therefore, unraveling unique architecture of PRC2 complexes under specific biological context through comprehensive and quantitative characterization could provide insight into the underlying mechanistic molecular mechanism in regulation of transcription process. In this chapter, we describe an efficient method which combines tandem-affinity purification (TAP) with label-free quantitative proteomics strategy for studying PRC2-EZH1 complex architecture alterations and identifying novel protein regulators in post-mitotic C2C12 skeletal muscle cells. Key words PRC2-EZH1, Tandem-affinity purification, Quantitative proteomics, C2C12

1

Introduction In mammals, Polycomb group proteins (PcG) are conserved, mainly repressive regulators of transcription implicated in various physiological processes linked to cell identity homeostasis [1]. PcG proteins form two main complexes with distinct enzymatic activities: Polycomb repressive complex 1 (PRC1) is an E3 ubiquitin ligase mediating ubiquitination on H2A lysine 119 (H2AK119ub); Polycomb repressive complex 2 (PRC2) is a methyltransferase that deposits mono-, di-, and tri-methylation on H3 lysine 27 (H3K27me/me2/me3) [2]. Two variants of PRC2 are present in mammalian cells: PRC2-EZH2 is predominantly present in mitotic cells, whereas PRC2-EZH1 is found in adult post-mitotic tissues and stem cells. While PRC2-EZH2 controls canonical

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_9, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

101

102

Peng Liu et al.

H3K27me3-dependent mitotic epigenetic cell memory, the function of PRC2-EZH1 is involved in adaptive cell response, allowing silencing upon environmental signals [3]. Initial biochemical analyses have identified EZH1/2, SUZ12, and EED as catalytic core of PRC2 [4]. Along with the core subunits, additional accessory PRC2 subunits have been recently characterized, which are required for the recruitment to chromatin and activity on chromatin, and this led to the identification of biochemically distinct PRC2 complex variants [2]. EZH1 function appears to be distinct from EZH2. Several studies unveiled EZH1 alone and EZH1-SUZ12 sub-complex without the core component EED as a positive regulator of transcription through RNA Pol II [5–8]. Instead, canonical silencing function appears to be dynamically regulated. We previously described a molecular mechanism in which a cytoplasmic short isoform of EZH1 (EZH1β) modulates shuttling of EED into the nucleus, facilitating adaptive and reversible PRC2-EZH1 complex assembly and H3K27me3 deposition in response to oxidative stress [9]. Further studies reported that E3 ligase NEDD4 and HUWE1 mediated ubiquitination and degradation of EZH1 plays an essential role in regulating stoichiometry of nuclear localized PRC2-EZH1α complex upon oxidative stress challenging [10]. To better understand the complexity of PcG-mediated epigenetic regulation in mammals [3] and dynamic assembly behavior of different PcG variants quantitatively would provide novel insights on how PcG rewires transcriptional regulation under different biological contexts. Mass spectrometry (MS)-based proteomics provides a powerful tool to investigate protein–protein interactions globally. Several studies have combined immunoprecipitation with mass spectrometry strategy to decipher composition and mutual interaction landscape of PcG complexes [11–13]. Commonly used quantitative proteomics techniques include label-free quantification (LFQ), stable isotope labeling by amino acids in cell culture (SILAC), and isobaric mass tag-based approach like tandem mass tagging (TMT) [14]. These discovery-based proteomics are highthroughput but have drawbacks such as relatively poor reproducibility and being costly in either reagents or instrumental time. Alternatively, recently developed targeted-based LFQ approaches have proved to be superior for quantitative proteomics due to their robustness in high reproducibility and sensitivity [14, 15]. Among these, of particular interest is the Sequential Window Acquisition of all THeoretical fragment ions (SWATH) type Data-Independent Acquisition (DIA), not only a targeted approach but also highthroughput. In this approach, MS2 spectra are acquired for all precursor ions within each isolation windows to obtain complete MS/MS data for full mass ranges. As a result, DIA is a high-impact novel technology which combines deep proteome coverage with

Quantitative Characterization of PRC2-EZH1 Interactome

103

quantitative consistency and accuracy [16]. In the earlier days of DIA analysis, a high-quality and comprehensive spectral library was required, typically generated from multiple data-dependent acquisition (DDA) runs. This not only significantly impact instrumental run time and costs, but also may not be applicable for small amount of materials such as in the case of affinity purification. Recently, a new workflow called direct-DIA has been developed where a collection of pseudo-MS2 spectra was generated from the DIA data and directly used for database search and library construction [17]. The resulting DIA data specific library is then used for targeted analyses of the same DIA data. This enables precise quantification of protein abundancy with high sensitivity and reproducibility for analyzing a small amount of sample without the need for DDA-based spectral libraries [17, 18]. Thus, immunoprecipitation in combination with DIA-based label-free quantitative proteomics could be used to map dynamic protein–protein interactome under different biological conditions [19–21]. Here, we detailed a method devised in our lab for characterizing dynamic changes of PRC2-EZH1 stoichiometry in C2C12 skeletal myotube cells (Fig. 1).

Fig. 1 Schematic overview of the tandem-affinity purification combined with mass spectrometry (TAP-MS) workflow

104

2 2.1

Peng Liu et al.

Materials Cells and Media

1. Stable C2C12 mouse myoblasts cells (ATCC, CRL-1772™), constitutively expressing EZH1α-Flag-HA[10]. 2. Wild-type C2C12 CRL-1772™).

mouse

myoblasts

cells

(ATCC,

3. C2C12 growth medium (GM): Dulbecco’s modified Eagle medium (4.5 g/L D-glucose and Glutamax), 10% Fetal bovine serum (FBS), 100 U/mL Pen/Strep Antibiotics 4. C2C12 differentiation medium (DM): Dulbecco’s modified Eagle medium (4.5 g/L D-glucose and Glutamax), 2% Horse serum, 100 U/mL Pen/Strep Antibiotics. 5. 0.25% Trypsin-EDTA. 2.2 Buffer Components and Reagents

1. 1 M Tris-Cl pH 8.

2.2.1 Cell Lysis, Sonication and Immunoprecipitation (IP)

4. Imidazole.

2. 5 M NaCl. 3. 0.5 M EDTA pH 8. 5. Triton X-100. 6. Glycerol. 7. Complete EDTA-free protease inhibitor cocktail (PIC) tablet.

2.2.2 IPs and Peptide Elution

1. M2 anti-FLAG antibody conjugated agarose beads (Sigma, #A2220). 2. Anti-HA antibody conjugated agarose beads (Thermo Scientific, #26182). 3. FLAG peptide (Sigma, #F3290). 4. HA peptide (Thermo Scientific, #26184). 5. 1 M Tris-Cl pH 7.65. 6. 1 M Tris-Cl pH 7.8. 7. 5 M NaCl. 8. 1 M MgCl2. 9. 0.5 M EDTA pH 8. 10. Glycerol. 11. NP-40. 12. Complete EDTA-free protease inhibitor cocktail (PIC) tablet.

2.2.3 Silver Staining and Immunoblot Assay

1. NuPAGE 4–12% Bis-Tris Gel (Thermo Scientific). 2. NuPAGE LDS sample buffer (Thermo Scientific). 3. Primary antibodies (Table 1).

Quantitative Characterization of PRC2-EZH1 Interactome

105

Table 1 Detailed information for the primary antibody used in this chapter Antibody

WB Dilution

Supplier

HA

1:1000

Rat monoclonal antibody (clone 3F10) Roche

SUZ12

1:1000

(D39F6) XP rabbit mAb#3737, cell signaling technology

4. HRP conjugated secondary antibodies for Western Blot (WB). 5. 1XTBST buffer. 6. Prestained Protein Ladder. 7. Mark 12 Unstained Protein Ladder. 8. SilverQuest silver staining kit (Thermo Scientific, #LC6070). 2.2.4 Filter Aided Sample Preparation (FASP) and Desalting Using Zip-Tip

1. Urea. 2. 1 M Tris-Cl pH 8.5. 3. 1 M Tris-Cl pH 8.0. 4. 1 M DTT. 5. 1 M IAA. 6. Trpsin/Lys-C Mix, Mass Spec Grade. 7. 0.5 M NaCl. 8. 0.5 M NH4HCO3. 9. 0.1% TFA in diH2O. 10. 100% Acetonitrile (ACN). 11. 0.1% trifluoroacetic acid (TFA) in diH2O. 12. 75% acetonitrile (ACN) in diH2O with 0.1% trifluoroacetic acid (TFA).

2.2.5

Mass Spectrometry

1. Formic Acid. 2. Acetonitrile (ACN).

2.2.6

Antibodies

2.3

Equipment

See Table 1 1. Cell culture hood. 2. Inverted microscope with 4×, 10× and 20× objectives. 3. Incubator at 37 °C, 5% CO2. 4. Water bath at 37 °C. 5. Refrigerated Bench-top centrifuge. 6. Rotator. 7. Pierce Centrifuge columns, 0.8 mL. 8. Refrigerated centrifuge with swing bucket.

106

Peng Liu et al.

9. Micropipettes (1–10, 2–20, 20–200, 200–1000 μL). 10. Vivaspin protein concentrator MWCO 10000. 11. 0.8 mL Centrifuge filter unit. 12. Microwave. 13. XCell SureLock Mini-Cell Electrophoresis system. 14. ChemiDoc (Bio-Rad). 15. Thermo-mixer. 16. Millipore Zip-Tip Pipette Tips 10 μL. 17. Agilent Technologies OMIX pipette tips, 10–100 μL. 18. Precolumn (Acclaim PepMap, 300 mm × 5 mm, 5 μm particle sizes, Thermo Scientific). 19. EasySpray C18 Column (50 cm × 75 mm ID, PepMap C18, 2 mm particles, 100 Å pore size, Thermo Scientific). 20. Orbitrap Fusion Scientific).

Lumos

mass

spectrometer

(Thermo

21. UltiMate 3000 UHPLC (Thermo Scientific). 2.4

Disposables

1. Sterile serological plastic pipettes (5, 10, 25, and 50 mL). 2. 15 and 50 mL Falcon conical tubes. 3. T75 flask and 150 mm tissue culture dish plates (Falcon). 4. Filter pipette tips (0.5–10, 2–20, 20–200, 200–1000 μL), 5. Sterilized glass Pasteur pipettes. 6. 1.5 mL Eppendorf tubes. 7. 0.8 mL centrifuge filter units (Pierce), 8. Vivaspin protein concentrator 10,000 MWCO (Sartorius), 9. Microcon YM-10 (Millipore, #42407),

2.5

Solutions

2.5.1 C2C12 Growth Medium (GM)

2.5.2 C2C12 Differentiation Medium (DM)

500 mL 10% FBS

50 mL

DMEM

445 mL

Antibiotics (100 U/mL Pen/Strep)

5 mL

500 mL 2% Horse Serum

10 mL

DMEM

485 mL

Antibiotics (100 U/mL Pen/Strep)

5 mL

Quantitative Characterization of PRC2-EZH1 Interactome 2.5.3

Solutions

107

1. Cytosolic Extraction Buffer (CEB): 50 mM Tris-Cl pH 8, 150 mM NaCl, 0.5 mM EDTA, 10 mM Imidazole pH 8, 0.5% Triton X-100, 10% Glycerol, 1× PIC (see Note 1). 2. Nuclear Extraction Buffer (NEB): 50 mM Tris-Cl pH 8, 50 mM NaCl, 0.5 mM EDTA, 10 mM Imidazole pH 8, 0.5% Triton X-100, 10% Glycerol, 1× PIC (see Note 1). 3. TGEN-150 Buffer: 20 mM Tris-Cl pH 7.65, 150 mM NaCl, 3 mM MgCl2, 0.1 mM EDTA, 10% Glycerol, 0.01% NP-40, 1× PIC (see Note 1). 4. FASP buffer-UA: 100 mM Tris-Cl pH 8.5, 8 M Urea. 5. FASP buffer-UB: 100 mM Tris-Cl pH 8.0, 8 M Urea.

3

Methods

3.1 Culture of C2C12 Cells

1. Thaw a frozen cryo-vial containing approximately 0.5–1 × 106 C2C12 cells rapidly (within 1–2 min) in a water bath at 37 °C. 2. Transfer cells to 15 mL warm growth medium in a 50 mL conical tube, plate the cells in a T75 Nunc flask and place the flask inside the 37 °C incubator. 3. Next day, remove the old medium and add fresh growth medium. 4. When cells reaching 50–60% confluency, split cells with ratio 1: 4 or 1:5 and culture cells for further expansion using 15 cm2 dish plates, to reach required number of cells (see Note 2) for protein extraction and immunoprecipitation.

3.2 Differentiation of C2C12 Myoblast to Myotube

1. When cells are 80–90% confluent replace growth medium with differentiation medium. 2. After 96 h, cells reach myotube day 4 with high-fusion index (4 days of differentiation). 3. To prepare enough nuclear extracts for immunoprecipitation, we prepare 20 × 15 cm2 dishes of cells per immunoprecipitation (see Note 2).

3.3 Nuclear Extracts Preparation

1. C2C12 myotube cells were collected by trypsinization. 2. Centrifuge cells at 200 × g for 3 min at 4 °C 3. Wash cells with cold PBS, supplemented with 1× PIC, and centrifuge at 200 × g, for 3 min at 4 °C. 4. Resuspend cell pellets with Cytosolic Extraction Buffer (CEB). For each 15 cm dish plate, add 1 mL CEB buffer supplemented with protease inhibitors. 5. Incubate on ice for 30 min and invert the tubes every 3–5 min.

108

Peng Liu et al.

6. Centrifuge cells at 1500 × g for 10 min at 4 °C; supernatant was collected and kept as cytosolic fraction protein extracts. 7. Wash the nuclear pellet three times with CEB buffer. 8. Resuspend the nuclear pellets with Nuclear Extraction Buffer (NEB). For each 150 cm dish plate, add 0.3 mL NEB buffer. 9. Incubate on ice for 30 min and invert the tube every 3–5 min. 10. Sonicate cells: High power, 30 s ON/30 s OFF, 5 cycles using Bioruptor (Diagenode). 11. Centrifuge nuclear extracts for 10 min at 16,380 × g for 10 min at 4 °C. Supernatant was used for immunoprecipitation step. Final concentration of NaCl was adjusted to 150 mM before IP. Keep 10% Input for silver staining and WB assay. 3.4 Tandem Affinity Purification

1. De-freeze the M2 anti-Flag antibody-conjugated agarose beads and mix them gently. 2. Wash the beads three times with TGEN-150 buffer. Each wash was performed by centrifuging at 300 × g (Beckman Coulter Allegra X-30R, SX241.5 swing bucket) for 2 min at 4 °C. Amount of M2 beads varied depending on nuclear protein amount (see Note 3). 3. Incubate the nuclear extracts with M2 beads overnight at 4 °C, seal the tube with Parafilm and keep them on the rotator, with gentle rotation at 4 °C. 4. Next day, quick spin all samples at 300 × g (Beckman Coulter Allegra X-30R, SX4400 swing bucket) for 2 min at 4 °C, collect the supernatant, and keep them as flow-through (FT). 5. Wash the immunoprecipitated complex 3–5 times with TGEN150 buffer. Each wash by centrifuge at 300 × g (Beckman Coulter Allegra X-30R, SX241.5 swing bucket) for 2 min. 6. Transfer samples into Protein Low-Bind 1.5 mL tubes. Elute the samples with Flag peptide (final concentration 200 μg/mL) in TGEN-150 buffer (see Note 4). 7. Incubate overnight at 4 °C, cover the tube with parafilm and keep them on the rotator at 4 °C. 8. Next day quick spin of all samples. 9. Transfer Beads-Flag peptide mixture solution into 0.8 mL Pierce centrifuge unit columns placed on 1.5 mL tube. 10. Centrifuge at 8000 g for 5 min. 11. Collect the first IP (FLAG IP) in the new 1.5 mL tube. Keep 20 μL first elution for silver staining and WB assay. 12. Mix the HA antibody conjugated agarose beads gently 13. Beads equilibration was performed by washing them three times with TGEN-150 buffer, centrifuge at 300 g (Beckman

Quantitative Characterization of PRC2-EZH1 Interactome

109

Coulter Allegra X-30R, SX241.5 swing bucket) for 2 min. Amount of HA agarose beads would be adjusted based on initial nuclear protein amount and M2 beads used (see Note 3). 14. Incubate HA-beads with first Flag IP elute overnight at 4 °C. 15. Give the short spin to all samples and keep supernatant as flow through. 16. Wash the immunoprecipitated HA beads 3–5 times with TGEN-150 buffer. Centrifuge at 300 g (Beckman Coulter Allegra X-30R, SX241.5 swing bucket) at 4 °C for 2 min. 17. Elute the sample with HA peptide (final concentration 200 μg/mL) in TGEN-150 buffer. Mix well and incubate overnight at 4 °C, cover the tube with parafilm and keep them on the rotator at 4 °C (see Note 4). 18. Give the short spin to all samples. 19. Transfer them into 0.8 mL Pierce centrifuge columns placed on 1.5 mL tube. 20. Centrifuge at 8000 g for 5 min at 4 °C. 21. Collect the second IP (HA IP) in the new 1.5 mL tube. Keep 20 μL second IP elution for silver staining and WB assay. 3.5 Silver Staining and WB

1. Silver staining was performed following SilverQuest silver staining kit manufacture’s manual without any modification. 2. WB assay was done to check enrichment efficiency and specificity: detected with both anti-HA and anti-SUZ12 antibody (Fig. 2) (see Note 5).

3.6 Solution Digestion (FASP)

1. Concentrate second IP HA peptide elutes using Vivaspin protein concentrator (10,000 MWCO) to final volume around 30 μL 2. Mix up 30 μL second elutes with 200 μL UA in the filter unit and centrifuge at 14,000 g for 40 min at 23 °C. 3. Add 200 μL of UA to the filter unit and centrifuge at 14,000 g for 40 min at 23 °C. 4. Discard the flow through from the collection tube. 5. Add 100 μL DTT solution and mix at 600 rpm in a thermomixer for 1 min at 37 °C and incubate without mixing for 5 min. 6. Centrifuge the filter units at 14,000 × g for 30 min. 7. Add 100 μL IAA solution and mix at 600 rpm in a thermomixer for 1 min at 37 °C and incubate without mixing for 5 min. 8. Centrifuge the filter units at 14,000 × g for 30 min at 23 °C. 9. Discard the flow-through from the collection tube.

EZH1α-FH 1st Elute

b

Rep2 Rep3

100 kDa

100 kDa

*

Rep2 Rep3

Rep2 Rep3

C2C12

El

ut e PU T 1s tE lu te 2n d El ut e IN PU T 1s tE lu te 2n d El ut e

EZH1α-FH #2

Rep1

IN

tE

d 2n

1s

PU

T

lu

te

EZH1α-FH #1

Rep1

C2C12 2nd Elute

Anti-HA

Rep1

EZH1α-FH 2nd Elute

Anti-SUZ12

a

Mark 12

Peng Liu et al.

IN

110

Fig. 2 Immunoprecipitation of Ezh1a-associated protein partners. (a) EZH1α-FH-associated protein complexes were tandemly affinity purified from nuclear extracts of C2C12 stable cell line which expresses C-terminally FLAG-HA tagged EZH1α. First and second elute represents Flag and HA elutes, respectively. Three replicates samples were separated by SDS-PAGE and silver stained. Wild-type C2C12 cell line was used as mock samples. (b) Interaction among Ezh1α and SUZ12 was validated through co-immunoprecipitation (Co-IP) assay. Wild-type C2C12 cell line was used as mock control. Immunoblot analysis was performed with anti-SUZ12 and anti-HA

10. Add 100 μL of UB to the filter unit and centrifuge at 14,000 × g for 40 min at 23 °C. Repeat step 10. 11. Add 120 μL ABC with trypsin-Lyc mix (enzyme to protein ratio 1:50) and mix at 600 rpm in a thermo-mixer for 1 min at 37 °C.

Quantitative Characterization of PRC2-EZH1 Interactome

111

Table 2 General guide for Sep-Pak cartridges and Zip-tip pipette

Sorbent type

Amount of peptide to be desalted

Use

C18 (for peptide)

0.6 mg/mL. We usually apply 300–500 μL M2 beads and 150–200 μL HA beads to 20–40 mg initial protein extracts. 4. To prepare 5 mg/mL Flag and HA peptide stock solution, lyophilized peptide was reconstituted using 1× TBS buffer (50 mM Tris-Cl pH 7.5, 150 mM NaCl) and stored at -20 °C.

114

Peng Liu et al.

5. Both silver staining and WB assay are important quality control steps before proceeding peptide digestion and mass spec analysis step. Usually, input sample, first and second IP elutes from both target cell line and wild-type cell line, will be used to check efficiency and specificity with both anti-HA and anti-SUZ12 antibody. 6. For zip-tipping, sample must be completely dried. 7. In addition to Spectronaut, there are other alternative options for DIA data analyses such as Skyline and MaxQuant. Choose the convenient software for your own analyses. 8. These settings will define many important aspects of the analysis, such as digestion rules, FDR thresholds, quantification preferences, how to filter your data, etc. The default parameters include: (a) The p-value was calculated by the kernel-density estimator. (b) Interference correction was activated and a minimum of three fragment ions and two precursor ions were kept for the quantitation. (c) Peptide (stripped sequence) quantity was measured by the mean of 1–3 best precursors, and protein quantity was calculated accordingly by the mean of 1–3 best peptides. (d) Local normalization strategy and q-value sparse selection were used for cross run normalization. 9. The GO database can be downloaded from http:// geneontology.org and imported into Spectronaut software. 10. To determine the differential abundance between samples, the major group (quantification settings) was used for the differential abundance grouping, and the precursor ion (quantification settings) was chosen in the smallest quantitative unit. In addition, an unpaired t-test with assuming equal variance, group-wise testing correction and clustering was carried out. Proteins with a fold-change of higher than 1.5 and a q-value of less than 0.001 were considered as differentially expressed proteins. 11. Although Spectronaut could generate many different datasets, we normally re-analyze all these datasets with homemade script using exported source data “candidates.tsv” and “Report_Protein Quant.xls”. These datasets produce normalized protein intensity value for each condition and comparison group. Other plots, like PCA, Volcano and Heatmap plot can be easily generated using these processed datasets from Spectronaut.

Quantitative Characterization of PRC2-EZH1 Interactome

115

References 1. Yu JR, Lee CH, Oksuz O, Stafford JM, Reinberg D (2019) PRC2 is high maintenance. Genes Dev 33(15–16):903–935. https://doi. org/10.1101/gad.325050.119 2. Piunti A, Shilatifard A (2021) The roles of Polycomb repressive complexes in mammalian development and cancer. Nat Rev Mol Cell Bio 22(5):326–345. https://doi.org/10.1038/ s41580-021-00341-1 3. Marasca F, Bodega B, Orlando V (2018) How polycomb-mediated cell memory deals with a changing environment: variations in PcG complexes and proteins assortment convey plasticity to epigenetic regulation as a response to environment. BioEssays 40(4):e1700137. https://doi.org/10.1002/bies.201700137 4. Cao R, Wang LJ, Wang HB, Xia L, ErdjumentBromage H, Tempst P et al (2002) Role of histone H3 lysine 27 methylation in polycomb-group silencing. Science 298(5595):1039–1043. https://doi.org/10. 1126/science.1076997 5. Xu J, Shao Z, Li D, Xie H, Kim W, Huang J et al (2015) Developmental control of polycomb subunit composition by GATA factors mediates a switch to non-canonical functions. Mol Cell 57(2):304–316. https://doi.org/10. 1016/j.molcel.2014.12.009 6. Su SK, Li CY, Lei PJ, Wang X, Zhao QY, Cai Y et al (2016) The EZH1-SUZ12 complex positively regulates the transcription of NF-kappaB target genes through interaction with UXT. J Cell Sci 129(12):2343–2353. https://doi. org/10.1242/jcs.185546 7. Stojic L, Jasencakova Z, Prezioso C, Stutzer A, Bodega B, Pasini D et al (2011) Chromatin regulated interchange between polycomb repressive complex 2 (PRC2)-Ezh2 and PRC2-Ezh1 complexes controls myogenin activation in skeletal muscle cells. Epigenet Chromatin 4. https://doi.org/10.1186/ 1756-8935-4-16 8. Mousavi K, Zare H, Wang AHJ, Sartorelli V (2012) Polycomb protein Ezh1 promotes RNA polymerase II elongation. Mol Cell 45(2):255–262. https://doi.org/10.1016/j. molcel.2011.11.019 9. Bodega B, Marasca F, Ranzani V, Cherubini A, Della Valle F, Neguembor MV et al (2017) A cytosolic Ezh1 isoform modulates a PRC2Ezh1 epigenetic adaptive response in postmitotic cells. Nat Struct Mol Biol 24(5): 444–452. https://doi.org/10.1038/nsmb. 3392

10. Liu P, Shuaib M, Zhang HM, Nadeef S, Orlando V (2019) Ubiquitin ligases HUWE1 and NEDD4 cooperatively control signaldependent PRC2-Ezh1 alpha/beta-mediated adaptive stress response pathway in skeletal muscle cells. Epigenet Chromatin 12(1):78. https://doi.org/10.1186/s13072-0190322-5 11. Hauri S, Comoglio F, Seimiya M, Gerstung M, Glatter T, Hansen K et al (2016) A highdensity map for navigating the human Polycomb complexome. Cell Rep 17(2):583–595. https://doi.org/10.1016/j.celrep.2016. 08.096 12. Kloet SL, Makowski MM, Baymaz HI, van Voorthuijsen L, Karemaker ID, Santanach A et al (2016) The dynamic interactome and genomic targets of Polycomb complexes during stem-cell differentiation. Nat Struct Mol Biol 23(7):682–690. https://doi.org/10. 1038/nsmb.3248 13. Oliviero G, Brien GL, Waston A, Streubel G, Jerman E, Andrews D et al (2016) Dynamic protein interactions of the Polycomb repressive complex 2 during differentiation of pluripotent cells. Mol Cell Proteomics 15(11):3450–3460. h t t p s : // d o i . o r g / 1 0 . 1 0 7 4 / m c p . M 1 1 6 . 062240 14. Schubert OT, Rost HL, Collins BC, Rosenberger G, Aebersold R (2017) Quantitative proteomics: challenges and opportunities in basic and applied research. Nat Protoc 12(7):1289–1294. https://doi.org/10.1038/ nprot.2017.040 15. Ong SE, Blagoev B, Kratchmarova I, Kristensen DB, Steen H, Pandey A et al (2002) Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol Cell Proteomics 1(5):376–386. https://doi.org/10.1074/ mcp.m200025-mcp200 16. Ludwig C, Gillet L, Rosenberger G, Amon S, Collins B, Aebersold R (2018) Dataindependent acquisition-based SWATH-MS for quantitative proteomics: a tutorial. Mol Syst Biol 14(8):e8126. https://doi.org/10. 15252/msb.20178126 DB, Bernhardt OM, 17. Bekker-Jensen Hogrebe A, Martinez-Val A, Verbeke L, Gandhi T et al (2020) Rapid and site-specific deep phosphoproteome profiling by dataindependent acquisition without the need for spectral libraries. Nat Commun 11(1):787. https://doi.org/10.1038/s41467-02014609-1

116

Peng Liu et al.

18. Zhang HM, Bensaddek D (2021) Narrow precursor mass range for DIA-MS enhances protein identification and quantification in arabidopsis. Life-Basel 11(9):982. https:// doi.org/10.3390/life11090982 19. Bludau I, Aebersold R (2020) Proteomic and interactomic insights into the molecular basis of cell functional diversity. Nat Rev Mol Cell Bio 21(6):327–340. https://doi.org/10. 1038/s41580-020-0231-2 20. Collins BC, Gillet LC, Rosenberger G, Rost HL, Vichalkovski A, Gstaiger M et al (2013)

Quantifying protein interaction dynamics by SWATH mass spectrometry: application to the 14-3-3 system. Nat Methods 10(12): 1246–1253. https://doi.org/10.1038/ nmeth.2703 21. Lambert JP, Ivosev G, Couzens AL, Larsen B, Taipale M, Lin ZY et al (2013) Mapping differential interactomes by affinity purification coupled with data-independent mass spectrometry acquisition. Nat Methods 10(12):1239–1245. https://doi.org/10.1038/nmeth.2702

Chapter 10 Replication Timing of Gene Loci in Different Cell Cycle Phases Irene Cantone Abstract Replication of distinct genomic loci occurs at different times during cell cycle. The replication timing correlates with chromatin status, three-dimensional folding, and transcriptional potential of the genes. In particular, active genes tend to replicate early in S phase, whereas inactive replicate late. In embryonic stem cells, some early replicating genes are not yet transcribed reflecting their potential to be transcribed upon differentiation. Here, I describe a method for evaluating the proportion of gene loci that is replicated in different phases of cell cycle thus reflecting the replication timing. Key words Replication timing, Polycomb group of protein, Embryonic stem cells

1

Introduction Genes are replicated at different times during the S phase of cell cycle. The replication timing correlate with the epigenetic and transcriptional state of the genes [1]. Active genes replicate early, whereas inactive genes replicate late. In embryonic stem cells (ESCs), genes replicating in early S phase include both actively transcribed genes and genes that are poised for transcription and will be expressed upon differentiation [2]. These poised genes carry a bivalent chromatin signature with markers of open chromatin, such as histone H3 lysine 4 trimethylation (H3K4me3), alongside the repressive mark histone H3 lysine 27 trimethylation (H3K27me3) that is deposited by Polycomb Repressive Complex 2 (PRC2). These genes are lineage specific and replicate later in S phase in cells that have lost the capacity to differentiate towards the appropriate lineage in which the genes are expressed. In the absence of Ezh2, the enzymatic component of PRC2, H3K27me3, is lost and lineage specific genes are derepressed. Nonetheless, replication timing of many genes is unchanged in many mutant ESCs including Jarid2 mutants that lose the ability to properly differentiate [3, 4].

Chiara Lanzuolo and Federica Marasca (eds.), Polycomb Group Proteins: Methods and Protocols, Methods in Molecular Biology, vol. 2655, https://doi.org/10.1007/978-1-0716-3143-0_10, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

117

118

Irene Cantone

Here, I describe a method for evaluating the relative abundance of nascent DNA synthesized into different cell cycle fractions in mouse ESCs. This method is based on the incorporation of a nucleoside analog (i.e., bromo-deoxy-uridine, BrdU) in asynchronous cells followed by sorting of six different cell cycle fractions (i.e., G1, S1, S2, S3, S4, and G2/M) based on propidium iodide staining. BrdU-labelled DNA is then sonicated and immunoprecipitated from an equal number of cells in each sorted fraction. Finally, quantitative real-time PCR is used to evaluate the relative abundance of nascent BrU-labelled DNA in each fraction.

2 2.1

Materials Reagents

1. Cell culture media depending on your cells. 2. PBS w/o Ca2+ and Mg2+. 3. Trypsine-EDTA 1× (Gibco). 4. 5′-bromo-1′-deoxyuridine BrdU (Sigma). 5. 0.5 M EDTA. 6. 5% NP-40. 7. 1 mg/mL Propidium iodide. 8. 10 mg/mL RNAse A. 9. 5 M NaCl. 10. 1 M Tris-HCl. 11. 20% SDS. 12. 10 mg/mL sheared salmon sperm. 13. 400 mM monobasic sodium phosphate 14. 400 mM di-basic sodium phosphate. 15. 100% Triton X 100. 16. 10 mg/mL proteinase K. 17. 25 μg/mL mouse Anti BrdU antibody (Becton Dickinson). 18. Rabbit anti-mouse IgG (Sigma). 19. Phenol chloroform. 20. Ethanol 100%. 21. Ammonium acetate. 22. Gel extraction kit (Quiagen). 23. Taqman Quantitect Probe PCR kit (Quiagen). 24. Primers for genes to test. 25. Primers for control genes (Table 1).

Replication Timing

119

Table 1 Primers for amplifying control genes

2.2 Buffer and Solutions

Name

Sequence

a-globin F

CCACAAGCTGCGTGTGGAT

a-globin R

ATGCCGCCTGCCAGGT

amilase2-1 F

CAAAGCAAAATGAAGTTCGTTCTGCTGC

amilase2-1 R

GAAGTTATCTTACCTGCACCCCTCCAAATC

X141 F

GGGTCATAAAACGCTTTTCCAGGAA

X141 R

TAGCACTGGAGATCAGATTGACGCCT

GBE F

GGTGCAGATCATCCCCTTGA

GBE R

TTACCCGACGGCGAAAG

1. BrdU (5′-bromo-1′-deoxyuridine) stock solution: 1.5 mg/mL (5 nM) in PBS, filter sterilized, store aliquots at -20 °C protected from light. 2. Staining buffer: 3 mM EDTA, 0.05% NP40, 50 μg/mL propidium iodide, 1 mg/mL RNAseA in PBS. 3. Lysis buffer: 1 M NaCl, 10 mM EDTA pH 8, 50 mM Tris-HCl pH 8, 0.5% SDS, 0.4 mg/mL proteinase K, 0.5 mg/mL denatured sheared salmon sperm. 4. BrdU-labelled Drosophila DNA (S2). Store aliquots in dark at -20 °C. 5. TE buffer: 10 mM Tris-HCl pH 8, 1 mM EDTA. 6. Adjuster buffer: 10 mM sodium phosphate pH 7, 0.14 M NaCl, 0.05% Triton X-100. 7. 400 mM sodium phosphate pH 7: 400 mM monobasic sodium phosphate 100 mL, 400 mM di-basic sodium phosphate 100 mL. On the pH meter constantly stirring put the monobasic onto the dibasic sodium phosphate until pH is 7. Autoclave, filter, and store at room temperature. 8. Washing buffer: 10 mM sodium phosphate buffer pH 7, 0.14 M NaCl, 0.05% Triton X 100, keep on ice. 9. 5 M NaCl: Autoclave filter and store at room temperature. 10. 5% Triton X-100: Dissolve in milli-Q water. 11. Anti-BrdU at 25 μg/mL. Keep at 4 °C. 12. Rabbit anti-mouse IgG. Use 35 μg. Aliquot and store at -20 °C. 13. Washing buffer: 10 mM sodium phosphate buffer pH 7, 0.14 M NaCl, 0.05% Triton X-100. Keep on ice.

120

Irene Cantone

14. Lysis buffer: 50 mM Tris-HCl pH 8, 10 mM EDTA, 0.5% SDS, 0.25 mg/mL proteinase K. 15. Ammonium acetate 7 M pH 7.5. 2.3

Equipment

1. Cell culture hood. 2. Cell incubator. 3. Fluorescence activated cell sorter. 4. Syringes with G25 needle. 5. Sonicator (Bioruptor). 6. Centrifuge for Eppendorf tubes. 7. Real Time PCR machine.

3 3.1

Methods BrdU Labelling

1. To label cells with BrdU, incubate exponentially growing mouse ESC cultures (see Note 1) with 150 μL of 5 nM BrdU stock (final concentration 50 μM) in 15 mL of medium for approximately 30 min in cell culture incubator. 2. Wash cells two times in PBS w/o Ca2+ and Mg2+. Trypisinize with 3 mL of trypsine and neutralize with medium supplemented with fetal calf serum (FCS). Recover cells with one wash in cell culture medium and centrifuge for 5 min at 200 × g, twice. 3. Resuspend cells in cold PBS and spin down at 200 × g, twice. 4. Count cells and pellet 107 cells per 50 mL. 5. Fix cells with 10 mL ice-cold EtOH 70% (see Note 2). You can store cell in EtOH 70% at 4 °C for few days.

3.2 Cell Cycle Fractionation by Flow Cytometry

1. Wash cells twice with 50 mL cold PBS w/o Ca2+ and Mg2+ and centrifuge 600 × g for 7 min (see Note 3). 2. Resuspend the cells in staining buffer—1 mL for 5 × 106 cells. 3. Stain in the dark for 30 min (10 min at room temperature plus 20 min on ice) just prior to sorting (see Note 4). 4. Prepare 4 mL of lysis buffer. 5. Put 200 μL of lysis buffer in each Eppendorf where you will collect cells after sorting (see Note 5). 6. Sort equal number of cells (typically 20,000–50,000 cells) in different phases of cell cycle based on their DNA content (cells will be divided in the following cell cycle phases G1, S1, S2, S3, S4, and G2/M) directly into the tubes containing lysis buffer. 7. Pass cells through a syringe by using G25 needles and 1 mL syringe for five times. Put slowly through 40 μm cell strainer. 8. Incubate 2 h at 50 °C and store at -20 °C until required (see Note 6).

Replication Timing

3.3 Isolating BrdU Labelled DNA 3.3.1 Phenol Chloroform Extraction

121

1. Spin the samples briefly. 2. Add 35 ng of control BrdU labelled Drosophila Schneider cell DNA (S2) in each sample. 3. Add one volume of phenol in each sample. 4. Mix by inverting samples for 1 min. 5. Spin the samples 16,000 × g for 5 min. 6. Remove phenol from the bottom of the tube leaving at least 50 μL (see Note 7). 7. Spin the samples 16,000 × g for 5 min. 8. Remove remaining phenol by leaving as little as possible. 9. Spin samples for 1 min. 10. Add one volume of chloroform to each sample. 11. Repeat steps 4–9. 12. Remove the top aqueous phase and place in a new tube.

3.3.2 Ethanol Precipitation

1. Add 2 volumes of cold EtOH 100% per volume of extract. 2. Precipitate 2 h or overnight at -20 °C. 3. Centrifuge the samples for 30 min at 4 °C at full speed. 4. Place tubes on ice. 5. Remove EtOH. Keep tubes on ice. 6. Add 1 mL EtOH 70%. 7. Shake tubes. The pellet should be floating in the EtOH 70%. 8. Centrifuge pellets for 15–20 min at full speed at 4 °C. 9. Remove EtOH. 10. Dry samples 5–10 min at room temperature. 11. When no ethanol is left, add 480 μL of TE buffer in each tube. 12. Incubate 1 h at 37 °C mixing. 13. Add 20 μL of 10 mg/mL of salmon sperm at half time of the incubation (30 min). 14. Spin the tubes and keep on ice or at 4 °C in dark (see Note 8).

3.3.3

Sonication

1. Prepare adjuster (room temperature), washing buffer (at 4 °C) and lysis buffer after IP (room temperature). Turn on the heating block at 100 °C. Put anti-BrdU antibody on ice. 2. Sonicate samples to obtain a smear of 2 kb–200 bp (average 700 bp) (see Note 9). 3. Spin samples and place back on ice. 4. Heat samples for 3 min at 95 °C. Put protective cap on tubes. 5. Place directly samples on ice for 2 min.

122

Irene Cantone

3.3.4 Immunoprecipitation

1. Spin the tubes briefly (5–6 min) and place back on ice. 2. Samples need to be adjusted to 10 mM sodium phosphate pH 7, 0.14 M NaCl, 0.05% Triton X-100. To this, open all tubes and add 50 μL of adjuster buffer (kept at room temperature) on the side at the top of the tubes without touching the samples. 3. For each sample individually: vortex gently allowing the adjuster to drop down, add 80 μL anti BrdU (25 μg/mL) into each sample on ice, vortex slowly, leave for 20 min of constant rocking at room temperature. 4. Spin samples very briefly. 5. For each sample individually, add the secondary antibody (35 μg rabbit anti-mouse IgG), mix by pipetting, leave rotating for 20 min. 6. Place tubes on ice. 7. Centrifuge for 20 min full speed at 4 °C. 8. Remove supernatant. 9. Add 1 mL washing buffer and vortex extensively. 10. Centrifuge samples 20 min at full speed at 4 °C. 11. Remove supernatant (see Note 10).

3.3.5 Proteinase K and Purification

1. Resuspend the DNA-protein complex in 200 μL of lysis buffer after IP and incubate overnight at 37 °C (see Note 11). After 1 h, vortex and spin down and put back at 37 °C. 2. In the next morning, add 100 μL of lysis buffer after IP and incubate 1 h at 50 °C (see Note 12). 3. Purify by Gel extraction kit (Quiagen) using 3 volumes of QG buffer without isopropanol. Elute in 250 μL (1 μL every 200 cell equivalent).

3.3.6

Quantitative PCR

1. Use 4 μL for qPCR with 300 nM primers, 1× SYBER green. 2. Perform PCR on controls that replicate in early (α-globin) mid (amilase) and late S phase (X141 repeat on the X chromosome) and on one Drosophila gene (Gbe) that should be distributed evenly in all the sorted fraction if they were immunoprecipitated and processed correctly (Fig. 1). Primer sequences are reported in Table 1. 3. In order to calculate the relative fraction of replicated loci in each sample, use the following formula 2-Ct/(sum of 2-Ct for all fractions), where Ct is the cycle threshold (Fig. 1).

Replication Timing

Fraction of loci w BrdU

α globin

Amilase

0,6 0,5 0,4 0,3 0,2 0,1 0

G1

S1

S2

S3

S4

G2/M

0,45 0,4 0,35 0,3 0,25 0,2 0,15 0,1 0,05 0

G1

S1

S2

S3

123

X141

S4

G2/M

0,5 0,45 0,4 0,35 0,3 0,25 0,2 0,15 0,1 0,05 0

G1

S1

S2

S3

S4 G2/M

Fig. 1 Replication timing in mouse ESC. Graphs show the fraction of genes that contains BrdU and is, indeed, replicated in each separate phase of cell cycle (G1, S1, S2, S3, S4, G2/M). Alpha globin is the prototype for genes replicating in early S phase, Amilase in middle, and X141 is a repeat on the X chromosome that replicates in late S phase—G2/M

4

Notes 1. Label and collect at least 15 million cells per each replicate. 2. Add ethanol dropwise while vortexing (continuous 5< speed