Plant Genome Engineering: Methods and Protocols 1071631306, 9781071631300

Citation preview

Methods in Molecular Biology 2653

Bing Yang · Wendy Harwood Qiudeng Que Editors

Plant Genome Engineering Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by step fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Plant Genome Engineering Methods and Protocols

Edited by

Bing Yang Division of Plant Sciences, University of Missouri, Columbia, MO, USA

Wendy Harwood Department of Crop Genetics, John Innes Centre, Norwich, UK

Qiudeng Que Syngenta Crop Protection, LLC., Research Triangle Park, NC, USA

Editors Bing Yang Division of Plant Sciences University of Missouri Columbia, MO, USA

Wendy Harwood Department of Crop Genetics John Innes Centre Norwich, UK

Qiudeng Que Syngenta Crop Protection, LLC. Research Triangle Park, NC, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-3130-0 ISBN 978-1-0716-3131-7 (eBook) https://doi.org/10.1007/978-1-0716-3131-7 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface The global human population is expected to reach 8.0 billion by the end of 2022 and 9.8 billion by 2050. It is critical to find solutions in providing sufficient food to feed these additional 1.8 billion people in the near future. Since the total arable land on earth is finite, it is thus important to increase land-use efficiency and crop productivity to reach this challenging goal. In the meantime, it is also critical to maintain soil health and reduce the impact of agriculture on the environment by reducing the use of agricultural inputs such as water, pesticides, and fertilizers. Plant science has a big role to play in the new era of sustainable agriculture. One of the imaginable solutions is to develop crop varieties that have higher yield, are more efficient in utilizing inputs, and are more tolerant of biotic and abiotic stresses. Fortunately, rapidly advancing science and technology is here to help. The advances in sequencing technology, genomics and genetics, genotyping, phenotyping, and breeding technology have already accelerated the pace of trait gene discovery and incorporation of useful trait gene variants into crop breeding pipelines. Now it takes a much shorter time to identify genes that are responsible for trait characteristics and the exact sequence elements underlying their expression control. In the meantime, advances in genetic engineering and recent genome editing technologies have made it possible to apply the knowledge gained from studying one plant species to the improvement of many crop species. The new development in systems biology and synthetic biology also makes it possible to engineer multigenic traits more predictably. All these advances, especially the development of highly flexible, programmable, and multiplexed CRISPR-Cas technologies, have enhanced our ability to precisely modify plant genomes including regulatory elements and coding sequences of genes to achieve the desirable level of expression for trait engineering in plants. This book is a collection of protocols for plant genome editing and trait engineering. The book is divided into five parts: genome engineering systems, machinery design and validation, delivery tools, generation and analysis of engineered materials, and crop genome engineering applications. Most of the chapters describe methods of applying the popular CRISPR-Cas9 or CRISPR-Cas12a systems for genome editing in different crop species. However, we have also included a chapter on the use of small synthetic plastome “minisynplastome” for potato genome engineering and another chapter on the use of CRISPRCas9 for algal cell genome engineering. We want to thank all the chapter contributors for their commitment to making this book possible during the challenging time of the COVID-19 pandemic which is still ongoing in many parts of the world. Research Triangle Park, NC, USA Norwich Research Park, Norwich, UK Columbia, MO, USA

Qiudeng Que Wendy Harwood Bing Yang

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

GENOME ENGINEERING SYSTEMS

1 PAM-Less CRISPR-SpRY Genome Editing in Plants . . . . . . . . . . . . . . . . . . . . . . . . Simon Sretenovic, Xu Tang, Qiurong Ren, Yong Zhang, and Yiping Qi 2 Type I-D CRISPR System-Mediated Genome Editing in Plants . . . . . . . . . . . . . . Naoki Wada, Keishi Osakabe, and Yuriko Osakabe 3 CRISPR/LbCas12a-Mediated Genome Editing in Soybean . . . . . . . . . . . . . . . . . . Dawei Liang, Yubo Liu, Chao Li, Qin Wen, Jianping Xu, Lizhao Geng, Chunxia Liu, Huaibing Jin, Yang Gao, Heng Zhong, John Dawson, Bin Tian, Brenden Barco, Xiujuan Su, Shujie Dong, Changbao Li, Sivamani Elumalai, Qiudeng Que, Ian Jepson, and Liang Shi 4 Base Editing in Poplar Through an Agrobacterium-Mediated Transformation Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gen Li, Simon Sretenovic, Gary Coleman, and Yiping Qi 5 Genetic Engineering of Potato (Solanum tuberosum) Chloroplasts Using the Small Synthetic Plastome “Mini-Synplastome” . . . . . . . . . . . . . . . . . . . . Alessandro Occhialini, Alexander C. Pfotenhauer, Henry Daniell, C. Neal Stewart Jr, and Scott C. Lenaghan

PART II

v xi

3

21 39

53

73

DESIGN AND VALIDATION TOOLS

6 Designing Guide-RNA for Generating Premature Stop Codons for Gene Knockout Using CRISPR-BETS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 Yuechao Wu and Tao Zhang 7 Construction of CRISPR/Cas9 Multiplex Genome Editing System in Rice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107 Jie Xiong, Chun Wang, and Kejian Wang 8 Use of Fluorescent Protein Reporters for Assessing and Detecting Genome Editing Reagents and Transgene Expression in Plants . . . . . . . . . . . . . . . 115 Guoliang Yuan, Gerald A. Tuskan, and Xiaohan Yang 9 Automated, High-Throughput Protoplast Transfection for Gene Editing and Transgene Expression Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129 Stephen B. Rigoulot, Brenden Barco, Yingxiao Zhang, Chengjin Zhang, Kerry A. Meier, Matthew Moore, Jonathan Fabish, Rachel Whinna, Jeongmoo Park, Erin M. Seaberry, Aditya Gopalan, Shujie Dong, Zhongying Chen, and Qiudeng Que

vii

viii

Contents

PART III

TRANSGENE-FREE DELIVERY OF MACHINERY

10

Delivery of CRISPR-Cas12a Ribonucleoprotein Complex for Genome Editing in an Embryogenic Citrus Cell Line . . . . . . . . . . . . . . . . . . . . . . . Hong Fang, James N. Culver, Randall P. Niedz, and Yiping Qi 11 Transgene-Free Genome Editing in Nicotiana benthamiana with CRISPR/Cas9 Delivered by a Rhabdovirus Vector . . . . . . . . . . . . . . . . . . . . . Xiaonan Ma, Xuemei Li, and Zhenghe Li 12 Ribonucleoprotein (RNP)-Mediated Targeted Mutagenesis in Barley (Hordeum vulgare L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Martin Becker and Goetz Hensel 13 Ribonucleoprotein (RNP)-Mediated Allele Replacement in Barley (Hordeum vulgare L.) Leaves . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Martin Becker and Goetz Hensel 14 Genome Editing in Chlamydomonas reinhardtii Using Cas9-gRNA Ribonucleoprotein Complex: A Step-by-Step Guide . . . . . . . . . . . . . . . . . . . . . . . . Dhananjay Dhokane, Nagesh Kancharla, Arockiasamy Savarimuthu, Bhaskar Bhadra, Anindya Bandyopadhyay, and Santanu Dasgupta

PART IV 15

16

17

18

19

20

153

173

187

199

207

GENERATION AND ANALYSIS OF ENGINEERED LINES

Highly Efficient Gene Knockout in Medicago truncatula Genotype R108 Using CRISPR-Cas9 System and an Optimized Agrobacterium Transformation Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tom Lawrenson, Nicola Atkinson, Macarena Forner, and Wendy Harwood Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tom Lawrenson, Mark Youles, Monika Chhetry, Martha Clarke, Wendy Harwood, and Penny Hundleby Introduction of Genome Editing Reagents and Genotyping of Derived Edited Alleles in Soybean (Glycine max (L.) Merr.) . . . . . . . . . . . . . . . Truyen Quach, Hanh Nguyen, Olivia Meyer, Shirley J. Sato, Tom Elmo Clemente, and Ming Guo A CRISPR/Cas9 Protocol for Target Gene Editing in Barley . . . . . . . . . . . . . . . . Qiantao Jiang, Qiang Yang, Wendy Harwood, Huaping Tang, Yuming Wei, and Youliang Zheng Targeted Insertion in Nicotiana benthamiana Genomes via Protoplast Regeneration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Fu-Hui Wu, Chen-Tran Hsu, and Choun-Sea Lin Stepwise Optimization of Real-Time RT-PCR Analysis . . . . . . . . . . . . . . . . . . . . . . Nathan A. Maren, James R. Duduit, Debao Huang, Fanghou Zhao, Thomas G. Ranney, and Wusheng Liu

221

253

273

287

297 317

Contents

21

CRISPR/Cas9 Technology for Potato Functional Genomics and Breeding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333 Matı´as Nicola´s Gonza´lez, Gabriela Alejandra Massa, Mariette Andersson, Leonardo Storani, Niklas Olsson, Cecilia Andrea De´cima Oneto, Per Hofvander, and Sergio Enrique Feingold

PART V 22

ix

GENOME ENGINEERING FOR CROP IMPROVEMENT

Recent Advances in Engineering of In Vivo Haploid Induction Systems . . . . . . . 365 Jian Lv and Timothy Kelliher

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

385

Contributors MARIETTE ANDERSSON • Department of Plant Breeding, Swedish University of Agricultural Sciences, Lomma, Sweden NICOLA ATKINSON • John Innes Centre, Norwich, Norfolk, UK ANINDYA BANDYOPADHYAY • Synthetic Biology Group, Reliance Corporate Park, Reliance Industries Ltd, Ghansoli, Navi Mumbai, India BRENDEN BARCO • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA MARTIN BECKER • Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Plant Reproductive Biology, Seeland OT Gatersleben, Germany; Stilla Technologies, Villejuif, France BHASKAR BHADRA • Synthetic Biology Group, Reliance Corporate Park, Reliance Industries Ltd, Ghansoli, Navi Mumbai, India ZHONGYING CHEN • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA MONIKA CHHETRY • John Innes Centre, Norwich, Norfolk, UK MARTHA CLARKE • John Innes Centre, Norwich, Norfolk, UK TOM ELMO CLEMENTE • Department of Agronomy & Horticulture, University of NebraskaLincoln, Lincoln, NE, USA GARY COLEMAN • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA; Institute for Bioscience and Biotechnology Research, University of Maryland, Rockville, MD, USA JAMES N. CULVER • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA; Institute for Bioscience and Biotechnology Research, Rockville, MD, USA HENRY DANIELL • Department of Basic and Translational Sciences, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA, USA SANTANU DASGUPTA • Synthetic Biology Group, Reliance Corporate Park, Reliance Industries Ltd, Ghansoli, Navi Mumbai, India JOHN DAWSON • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA CECILIA ANDREA DE´CIMA ONETO • Laboratorio de Agrobiotecnologı´a, IPADS (INTA – CONICET), Balcarce, Argentina; Facultad de Ciencias Agrarias, Universidad Nacional de Mar del Plata, Balcarce, Argentina DHANANJAY DHOKANE • Synthetic Biology Group, Reliance Corporate Park, Reliance Industries Ltd, Ghansoli, Navi Mumbai, India SHUJIE DONG • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA JAMES R. DUDUIT • Department of Horticultural Science, North Carolina State University, Raleigh, NC, USA SIVAMANI ELUMALAI • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA JONATHAN FABISH • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA HONG FANG • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA

xi

xii

Contributors

SERGIO ENRIQUE FEINGOLD • Laboratorio de Agrobiotecnologı´a, IPADS (INTA – CONICET), Balcarce, Argentina MACARENA FORNER • John Innes Centre, Norwich, Norfolk, UK YANG GAO • Syngenta Biotechnology China Co., Ltd., Beijing, China LIZHAO GENG • Syngenta Biotechnology China Co., Ltd., Beijing, China MATI´AS NICOLA´S GONZA´LEZ • Laboratorio de Agrobiotecnologı´a, IPADS (INTA – CONICET), Balcarce, Argentina; Consejo Nacional de Investigaciones Cientı´ficas y Te´ cnicas (CONICET), Buenos Aires, Argentina ADITYA GOPALAN • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA MING GUO • Department of Agronomy & Horticulture, University of Nebraska-Lincoln, Lincoln, NE, USA WENDY HARWOOD • John Innes Centre, Norwich, Norfolk, UK GOETZ HENSEL • Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Plant Reproductive Biology, Seeland OT Gatersleben, Germany; Division of Molecular Biology, Centre of the Region Hana for Biotechnological and Agriculture Research, Faculty of Science, Palacky´ University, Olomouc, Czech Republic; Centre for Plant Genome Engineering, Institute of Plant Biochemistry, Heinrich-Heine-University, Dusseldorf, Germany PER HOFVANDER • Department of Plant Breeding, Swedish University of Agricultural Sciences, Lomma, Sweden CHEN-TRAN HSU • Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan DEBAO HUANG • Department of Horticultural Science, North Carolina State University, Raleigh, NC, USA PENNY HUNDLEBY • John Innes Centre, Norwich, Norfolk, UK IAN JEPSON • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA QIANTAO JIANG • State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Chengdu, Sichuan, China; Triticeae Research Institute, Sichuan Agricultural University, Chengdu, Sichuan, China HUAIBING JIN • Syngenta Biotechnology China Co., Ltd., Beijing, China NAGESH KANCHARLA • Synthetic Biology Group, Reliance Corporate Park, Reliance Industries Ltd, Ghansoli, Navi Mumbai, India TIMOTHY KELLIHER • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA TOM LAWRENSON • John Innes Centre, Norwich, Norfolk, UK SCOTT C. LENAGHAN • Department of Food Science, University of Tennessee, Knoxville, TN, USA; Center for Agricultural Synthetic Biology, University of Tennessee Institute of Agriculture, Knoxville, TN, USA CHANGBAO LI • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA CHAO LI • Syngenta Biotechnology China Co., Ltd., Beijing, China GEN LI • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA XUEMEI LI • Technology Center, China Tobacco Yunnan Industrial Co. LTD, Kunming, Yunnan, China ZHENGHE LI • State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, China; Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insect Pests, Zhejiang University, Hangzhou, China; Key

Contributors

xiii

Laboratory of Biology of Crop Pathogens and Insects of Zhejiang Province, Zhejiang University, Hangzhou, China DAWEI LIANG • Syngenta Biotechnology China Co., Ltd., Beijing, China CHOUN-SEA LIN • Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan CHUNXIA LIU • Syngenta Biotechnology China Co., Ltd., Beijing, China WUSHENG LIU • Department of Horticultural Science, North Carolina State University, Raleigh, NC, USA YUBO LIU • Syngenta Biotechnology China Co., Ltd., Beijing, China JIAN LV • Syngenta Biotechnology China Co., Ltd, Changping, Beijing, China XIAONAN MA • State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, China; Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insect Pests, Zhejiang University, Hangzhou, China; Key Laboratory of Biology of Crop Pathogens and Insects of Zhejiang Province, Zhejiang University, Hangzhou, China NATHAN A. MAREN • Department of Horticultural Science, North Carolina State University, Raleigh, NC, USA; Mountain Crop Improvement Lab, Department of Horticultural Science, Mountain Horticultural Crops Research and Extension Center, North Carolina State University, Mills River, NC, USA GABRIELA ALEJANDRA MASSA • Laboratorio de Agrobiotecnologı´a, IPADS (INTA – CONICET), Balcarce, Argentina; Consejo Nacional de Investigaciones Cientı´ficas y Te´ cnicas (CONICET), Buenos Aires, Argentina; Facultad de Ciencias Agrarias, Universidad Nacional de Mar del Plata, Balcarce, Argentina KERRY A. MEIER • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA OLIVIA MEYER • Department of Agronomy & Horticulture, University of Nebraska-Lincoln, Lincoln, NE, USA MATTHEW MOORE • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA C. NEAL STEWART JR • Center for Agricultural Synthetic Biology, University of Tennessee Institute of Agriculture, Knoxville, TN, USA; Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA HANH NGUYEN • Center for Plant Science Innovation, University of Nebraska-Lincoln, Lincoln, NE, USA RANDALL P. NIEDZ • U.S. Horticultural Research Laboratory, USDA-Agricultural Research Service, Fort Pierce, FL, USA ALESSANDRO OCCHIALINI • Center for Agricultural Synthetic Biology, University of Tennessee Institute of Agriculture, Knoxville, TN, USA; Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA NIKLAS OLSSON • Department of Plant Breeding, Swedish University of Agricultural Sciences, Lomma, Sweden KEISHI OSAKABE • Graduate School of Technology, Industrial and Social Sciences, Tokushima University, Tokushima, Japan YURIKO OSAKABE • School of Life Science and Technology, Tokyo Institute of Technology, Kanagawa, Japan JEONGMOO PARK • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA ALEXANDER C. PFOTENHAUER • Center for Agricultural Synthetic Biology, University of Tennessee Institute of Agriculture, Knoxville, TN, USA

xiv

Contributors

YIPING QI • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA; Institute for Bioscience and Biotechnology Research, Rockville, MD, USA TRUYEN QUACH • Center for Plant Science Innovation, University of Nebraska-Lincoln, Lincoln, NE, USA QIUDENG QUE • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA THOMAS G. RANNEY • Mountain Crop Improvement Lab, Department of Horticultural Science, Mountain Horticultural Crops Research and Extension Center, North Carolina State University, Mills River, NC, USA QIURONG REN • Department of Biotechnology, School of Life Sciences and Technology, Center for Informational Biology, University of Electronic Science and Technology of China, Chengdu, China STEPHEN B. RIGOULOT • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA SHIRLEY J. SATO • Center for Plant Science Innovation, University of Nebraska-Lincoln, Lincoln, NE, USA AROCKIASAMY SAVARIMUTHU • Synthetic Biology Group, Reliance Corporate Park, Reliance Industries Ltd, Ghansoli, Navi Mumbai, India ERIN M. SEABERRY • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA LIANG SHI • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA SIMON SRETENOVIC • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA LEONARDO STORANI • Laboratorio de Agrobiotecnologı´a, IPADS (INTA – CONICET), Balcarce, Argentina; Agencia Nacional de Promocion Cientı´fica y Tecnologica, Buenos Aires, Argentina XIUJUAN SU • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA HUAPING TANG • State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Chengdu, Sichuan, China; Triticeae Research Institute, Sichuan Agricultural University, Chengdu, Sichuan, China XU TANG • Department of Biotechnology, School of Life Sciences and Technology, Center for Informational Biology, University of Electronic Science and Technology of China, Chengdu, China BIN TIAN • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA GERALD A. TUSKAN • Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA; The Center for Bioenergy Innovation, Oak Ridge National Laboratory, Oak Ridge, TN, USA NAOKI WADA • Graduate School of Technology, Industrial and Social Sciences, Tokushima University, Tokushima, Japan CHUN WANG • State key laboratory of rice biology and breeding, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China KEJIAN WANG • State key laboratory of rice biology and breeding, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China; National Nanfan Research Institute (Sanya), Chinese Academy of Agricultural Sciences, Sanya, China

Contributors

xv

YUMING WEI • State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Chengdu, Sichuan, China; Triticeae Research Institute, Sichuan Agricultural University, Chengdu, Sichuan, China QIN WEN • Syngenta Biotechnology China Co., Ltd., Beijing, China RACHEL WHINNA • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA FU-HUI WU • Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan YUECHAO WU • Jiangsu Key Laboratory of Crop Genomics and Molecular Breeding, Agricultural College of Yangzhou University, Yangzhou, China; Key Laboratory of Plant Functional Genomics of the Ministry of Education/Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education of China, Yangzhou University, Yangzhou, China JIE XIONG • State key laboratory of rice biology and breeding, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China; National Nanfan Research Institute (Sanya), Chinese Academy of Agricultural Sciences, Sanya, China; Hainan Yazhou Bay Seed Laboratory, Sanya, China JIANPING XU • Syngenta Biotechnology China Co., Ltd., Beijing, China QIANG YANG • State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Chengdu, Sichuan, China; Triticeae Research Institute, Sichuan Agricultural University, Chengdu, Sichuan, China XIAOHAN YANG • Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA; The Center for Bioenergy Innovation, Oak Ridge National Laboratory, Oak Ridge, TN, USA MARK YOULES • John Innes Centre, Norwich, Norfolk, UK GUOLIANG YUAN • Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA; The Center for Bioenergy Innovation, Oak Ridge National Laboratory, Oak Ridge, TN, USA CHENGJIN ZHANG • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA TAO ZHANG • Jiangsu Key Laboratory of Crop Genomics and Molecular Breeding, Agricultural College of Yangzhou University, Yangzhou, China; Key Laboratory of Plant Functional Genomics of the Ministry of Education/Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education of China, Yangzhou University, Yangzhou, China; Jiangsu Co-Innovation Center for Modern Production Technology of Grain Crops, Yangzhou University, Yangzhou, China YINGXIAO ZHANG • Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA YONG ZHANG • Department of Biotechnology, School of Life Sciences and Technology, Center for Informational Biology, University of Electronic Science and Technology of China, Chengdu, China FANGHOU ZHAO • Department of Horticultural Science, North Carolina State University, Raleigh, NC, USA; National Center for Soybean Improvement, State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, China YOULIANG ZHENG • State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Chengdu, Sichuan, China; Triticeae Research Institute, Sichuan Agricultural University, Chengdu, Sichuan, China HENG ZHONG • Seeds Research, Syngenta Crop Protection, LLC, Research Triangle Park, NC, USA

Part I Genome Engineering Systems

Chapter 1 PAM-Less CRISPR-SpRY Genome Editing in Plants Simon Sretenovic, Xu Tang, Qiurong Ren, Yong Zhang, and Yiping Qi Abstract Engineered SpCas9 variant, SpRY, has been demonstrated to facilitate protospacer adjacent motif (PAM) unrestricted targeting of genomic DNA in various biological systems. Here we describe fast, efficient, and robust preparation of SpRY-derived genome and base editors that can be easily adapted to target various DNA sequences in plants due to modular Gateway assembly. Presented are detailed protocols for preparing T-DNA vectors for genome and base editors and for assessing genome editing efficiency through transient expression of these reagents in rice protoplasts. Key words CRISPR-Cas9, SpRY, Genome editing, Base editing, Gateway assembly, Rice protoplast assay

1

Introduction Genome editing has been revolutionized by the demonstration of clustered regularly interspaced short palindromic repeats (CRISPR) technology [1, 2]. With CRISPR, DNA targeting is guided by RNA and is simpler compared to previously established technologies, like zinc finger nucleases (ZFN) [3] and transcription activator-like effector nucleases (TALENs) [4, 5]. In bacteria and archaea, the CRISPR-Cas9 system confers an adaptive defense mechanism against invading DNA molecules. It consists of RNA-guided CRISPR-associated (Cas) endonuclease 9 and synthetic single-guide RNA (sgRNA/gRNA) that is constructed of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) [1]. Within the ribonucleoprotein complex of Cas9-sgRNA, crRNA confers recognition of the target DNA sequence and tracrRNA with its secondary structure renders Cas9 catalytically active. However, before Cas9 introduces the double-stranded DNA (dsDNA) cut, it must recognize a three-nucleotide-long protospacer adjacent motif (PAM) 5′-NGG-3′ (N = A, T, C, G) sequence (in case of Streptococcus pyogenes Cas9 (SpCas9)) located immediately downstream of the 3′ end of the target DNA sequence

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

3

4

Simon Sretenovic et al.

[1]. After the double-stranded break (DSB) is introduced in the targeted region of the genome, in eukaryotic cells either nonhomologous end joining (NHEJ) [6], microhomology-mediated end joining (MMEJ) [7], or homology-directed repair (HDR) [8] process is initiated to covalently bridge the double-stranded gap in DNA. Error-prone NHEJ and MMEJ processes may disrupt targeted regions of genomic DNA through insertions, deletions, substitutions, or other DNA rearrangements at the DSB site [9, 10], while error-free HDR facilitates insertion of template DNA through homologous recombination [8]. Since the initial demonstration of programmable RNA-guided Cas9-mediated sequencespecific dsDNA cleavage [1], CRISPR technology has been used in several mammalian and nonmammalian organisms for various purposes, including genome editing, gene expression regulation, epigenome editing, and imaging genetic loci in biotechnological, biomedical, and agricultural applications [11]. One major disadvantage of CRISPR-SpCas9 endonuclease is its narrow targeting scope conferring recognition of targets associated with 5′-NGG-3′ canonical PAMs. To broaden the targeting scope, researchers have either tried to find heterologous Cas9 endonucleases recognizing different PAMs like SaCas9 [12], or engineer Cas9 variants like SpRY [13]. Compared to SpCas9, SpRY has 11 mutations found in different domains (Fig. 1a) enabling recognition of 5′-NRN-3′ (R = A, G) and with a lesser affinity to 5′-NYN-3′ (Y = T, C) PAMs. SpRY overcomes SpCas9’s PAM limitation in mammalian cells as well as in plants [13, 14]. However, PAM-less genome editing can produce secondary off-target effects by newly generated sgRNAs due to SpRY-mediated DNA selfediting, when the CRISPR-SpRY is introduced as a DNA reagent [14]. SpRY can also confer PAM-less base editing (Fig. 1b), which is a precise form of genome editing that enables irreversible conversion of one target nucleotide into another in a programmable manner, without requiring DSBs or a donor template [15, 16]. Currently, cytidine base editors (CBEs) [17], adenine base editors (ABEs) [15], and C-G base editors (CGBEs) [18–20] have been developed conferring C to T transition, A to G transition, and C to G transversion, respectively. Broadly adopted CBEs have a third generation architecture consisting of Cas9 nickase (nCas9 or Cas9D10A) with Asp10Ala mutation, fused with a cytosine deaminase that deaminates cytosine (C) to uracil (U), and a uracil glycosylase inhibitor (UGI) that prevents reversion of U back to C [17]. Frequently used cytidine deaminases in CBEs include activation-induced cytidine deaminase (AID) [21], Petromyzon marinus cytidine deaminase (PmCDA1) [16], and human APOBEC3A with Y130F mutation (hA3A-Y130F) [22]. ABEs consist of nCas9 and N-terminally fused Escherichia coli tRNA adenine deaminase that has been engineered to act on single-stranded

SpRY-Based Genome Editing in Plants

5

Fig. 1 Schematics of SpRY-derived genome and base editors. (a) Schematic representation of 11 mutations found in various domains of SpRY compared to SpCas9. (b) Schematic representation of SpRY genome and base editors used in this study

DNA (ssDNA) [23]. The mechanism of A to G transition involves conversion of adenine (A) to inosine (I) deamination by the adenine deaminase, and the process is further boosted by nicking of the target stand by Cas9D10A. During DNA repair or replication, “I” is read as a guanine (G), which results in A to G base change [15]. CBEs and ABEs have relative wide activity windows of deamination within the target site spanning approximately between 4 and 10 nucleotides [15, 17]. By contrast, CGBEs prefer a narrow editing window centered on the sixth position of the target sequences [18–20]. CGBEs consist of nCas9, a cytidine deaminase rAPOBEC1 [18, 19] or its engineered form rAPOBEC1 (R33A) [20] with reduced off-target effects at the genome and transcriptome levels [24, 25], and a base excision repair (BER) protein such as DNA glycosylase from E. coli (UNG) [18, 20] or rXRCC1 from rat [19]. It has been shown that nSpRY-derived CBEs and ABEs can expand base editing scope beyond targets associated with canonical 5′-NGG-3′ PAMs [13, 14, 26, 27] with higher base editing activity compared to CGBEs in mouse embryos [28] as well as in plants [29]. In this chapter, a modular Gateway assembly is utilized to prepare DNA reagents in an efficient and user-friendly manner. Relying on Gateway LR recombination, three modules are required for the final T-DNA plasmid assembly. The first module is a promoterless Cas9 or base editor entry plasmid with attL1 and attR5 recombination sites. The second module is a gRNA entry plasmid

6

Simon Sretenovic et al.

Fig. 2 Gateway assembly of SpRY editing T-DNA vector systems. Three entry plasmids are required for the final T-DNA plasmid assembly: a promoterless SpRY entry plasmid with attL1 and attR5 recombination sites; a gRNA entry plasmid with attL5 and attL2 sites; and a destination T-DNA plasmid with a pZmUbi promoter for SpRY transcription. Selection marker of final T-DNA plasmid in bacteria is kanamycin, and selection marker in transgenic plants is hygromycin

with attL5 and attL2 sites. The third module is a destination T-DNA plasmid with a promoter for Cas9 base editor transcription, a selection marker for bacteria, a selection marker for transgenic plants, and attR1 and attR2 sites (Fig. 2). Each module can be modified independently to fit specific experimental goals in diverse organisms. Transient expression of T-DNA plasmids in rice protoplasts is used as an example to demonstrate SpRY-mediated targeted mutagenesis and base editing in OsPDS and OsALS genes (Fig. 3a). The editing efficiency is assessed with high-throughput sequencing (Fig. 3b).

2

Materials 1. Annotated genomic sequence of target gene(s). The genomic sequence information for the OsPDS, OsALS genes used in this study can be found at the Rice Annotation Project (RAP-DB) and the National Center for Biotechnology Information GenBank database (NCBI-GenBank) (NCBI-GenBank) (Table 1).

SpRY-Based Genome Editing in Plants

7

Fig. 3 Target sites within OsPDS and OsALS genes and assessment of base editing activity in rice protoplasts. (a) Schematic diagram of genomic regions and target sites in OsPDS and OsALS genes. The PAM motif is shown in red. (b) Assessment of editing activity in rice protoplasts by high-throughput sequencing of PCR amplicons Table 1 Information of the target gene in this study

Full name

Gene locus

NCBI gene symbol

Purpose

Gene

Introducing NHEJ mutation with SpRY

OsPDS Oryza sativa phytoene dehydrogenase

Os03g0184000 LOC4336652

Introducing C to T mutation with SpRY CBE

OsALS Oryza sativa acetolactate synthase

Os02g0510200 LOC4329450

Introducing A to G mutation with SpRY ABE

OsPDS Oryza sativa phytoene dehydrogenase

Os03g0184000 LOC4336652

2. Genome editing gRNA design software or websites can be used to design gRNA for SpRY, including CRISPR RGEN Tools [30], CRISPRdirect [31], and Benchling (https://benchling. com). To introduce stop codons with SpRY-based CBEs, CRISPR-BETS gRNA design software [32] may be used. The availability of the whole genome sequence can help minimize the off-target effects. A few crRNA design principles should be considered when designing protospacers: (a) A protospacer target sequence within the plant genome is between 18 and 22 nucleotides long and is followed by SpRY PAM sequence 5′-NRN-3′ (associated with targets with higher SpRY activity) or 5′-NYN-3′ (associated with targets with lower SpRY activity). The protospacer can be at either strand of double stranded genomic DNA.

8

Simon Sretenovic et al.

Table 2 Protospacer sequences and DNA oligonucleotides Target gene crRNA target sequence with PAM

DNA oligonucleotides

OsPDS

AGAAACAGTGAACAACCCACTAA

5′-TGGC AGAAACAGTGAACAACCCAC-3′ 5′-AAAC GTGGGTTGTTCACTGTTTCT-3′

OsALS

GCGCGTCCATGGAGATCCACCAG 5′-GTGT GCGCGTCCATGGAGATCCAC -3′ 5′-AAAC GTGGATCTCCATGGACGCGC -3′

(b) If a restriction fragment length polymorphism (RFLP) method is used to detect base editing and measuring editing efficiency, a restriction endonuclease recognition site should overlap the SpRY cut site located 3 bp upstream of PAM or in case of cytosine and adenine base editors their respective activity windows. (c) Base editors can have different activity windows. PmCDA1-based SpRY CBE and hA3A-Y130F-based SpRY CBE have activity windows between C1-C5 and C5-C15, respectively, where N21-N23 represent PAM site. TadA8e based SpRY ABE has an activity window between A4 and A7 where N21-N23 represent PAM site. (d) The editing efficiency can be predicted by protospacer design software or website tools. Secondary structures with positive free Gibbs energy, extreme GC content (70%), and/or multiple repeats of the same nucleotides (especially multiple Ts) should be avoided. 3. DNA oligonucleotides for gRNA cloning (Table 2). Each protospacer consists of two reverse complementary primers or duplexed DNA oligonucleotides. If the first nucleotide of the protospacer is G or A, the OsU6 or OsU3 promoter is used for gRNA transcription, respectively. In case the protospacer starts with G, design the forward primer by adding 5′-GTGT-3′ to the 5′ end of forward primer (5′-GTGTGNNNNNNNNNNN NNNNNNNN-3′) and the reverse primer by adding 5′-AAAC-3′ to the 5′ end of reverse primer (5′-AAACNNN NNNNNNNNNNNNNNNNC -3′). In case the protospacer starts with A, design the forward primer by adding 5′-TGGC3′ to the 5′ end of forward primer (5′-TGGCANNNNNNN NNNNNNNNNNNN-3′) and the reverse primer by adding 5′-AAAC-3′ to the 5′ end of reverse primer (5′-AAACNNN NNNNNNNNNNNNNNNNT-3′). In case the protospacer s tarts with T or C, additional G or A is added to the 5′ end to facilitate the transcription with either OsU6 or OsU3 pro moter, respectively. If the crRNA starts with T or C (Y) and y ou decide to use OsU3 promoter for gRNA expression, design the forward primer by adding 5′-TGGCA-3′ to the 5′ end of

SpRY-Based Genome Editing in Plants

9

forward primer (5′-TGGCA YNNNNNNNNNNNNNNNN NNN-3′) and the reverse primer by adding 5′-AAAC-3′ to th e 5′ end and 5′-T-3′ to the 3′ end of the reverse primer (5′AAACNNNNNNNNNNNNNNNNNNNR T-3′). If the pro tospacer starts with T or C (Y) and you decide to use OsU6 promoter for its expression, design the forward primer by add ing 5′-GTGTG-3′ to the 5′ end of the forward primer (5′-G TGTG YNNNNNNNNNNNNNNNNNNN -3′) and the reverse primer by adding 5′-AAAC-3′ to the 5′ end and 5′-C3′ to the 3′ end of the reverse primer (5′-AAACNNNNNNN NNNNNNNNNNNNRC-3′) (Table 2). 4. Plasmids. All plasmids mentioned in this protocol are available from Addgene (https://www.addgene.org): pYPQ141C (#69292), pYPQ141D (#69293), pYPQ203 (#86207), pYPQ166-SpRY (#161520), pYPQ262B-ABE8e (#161524), pYPQ266E (#161521). 5. Molecular grade water is used for reaction mixtures preparation, otherwise sterile deionized water. 6. T4 polynucleotide kinase (PNK) and 10× PNK Buffer, 10 mM ATP. 7. Vacuum infiltration apparatus. 8. Autoclavable 330 mL culture vessels. 9. Petri dish with 90 mm diameter. 10. 12-well plates. 11. 0.22 μm syringe filters. 12. (Enhanced) Neubauer counting chamber. 13. Automatic pipettor with sterile pipette tips. When transferring protoplasts, cut the tip of pipette tips prior to sterilization. 14. 70% ethanol. 15. 50% commercial bleach (5.25% hypochlorite). 16. Silica column-based gel purification kit, for example, the QIAquick Gel Extraction Kit. 17. Plasmid Miniprep kit, for example, IBI scientific Hi-Speed Mini Plasmid Kit. 18. Plasmid Midiprep kit, for example, Qiagen® Midi Plasmid Kit. 19. LB medium: 1% tryptone, 0.5% yeast extract, 1% sodium chloride, add 1.5% agar for preparing solid LB plates. 20. S.O.C medium: 2% tryptone, 0.5% yeast extract, 10 mM sodium chloride, 2.5 mM potassium chloride, 10 mM magnesium chloride, 10 mM magnesium sulfate, and 20 mM glucose. 21. MS medium: 4.33 g/L MS salts and vitamins, 100 mg/L myoinositol, 30 g/L sucrose, 3 g/L Gelrite. Adjust pH to 5.8.

10

Simon Sretenovic et al.

22. Protoplast isolation buffer: 0.6 M D-mannitol, 10 mM MES (pH 5.7), 1.5% cellulase R10, 0.75% Macerozyme R10, 10 mM calcium chloride, 0.1% bovine serum albumin. 23. W5 buffer: 2 mM MES (pH 5.7), 5 mM potassium chloride, 154 mM sodium chloride, 125 mM calcium chloride, 5 mM D-glucose. 24. MGG buffer: 0.6 M D-mannitol, 4 mM MES (pH 5.7), 15 mM magnesium chloride. 25. PEG-calcium transfection buffer: 40% polyethylene glycol 4000, 0.2 M D-mannitol, 100 mM calcium chloride. 26. Antibiotic stock solutions (1000×): 50 mg/mL spectinomycin and 50 mg/mL kanamycin. Antibiotics are dissolved in water and filtered through 0.22 μm syringe filter. Stock solutions are aliquoted in 2 mL tubes and stored at -20 °C. 27. DNA quantification equipment, for example, NanoDrop™ One UV-visible spectrophotometer. 28. Agarose gel electrophoresis equipment and supplies, gel imaging system. 29. DNA molecular weight size markers. 30. Chemically competent cells of Escherichia coli DH5α. Other E. coli strains can be used for cloning if faster growth rate is preferred. 31. Gateway™ LR Clonase™ II Enzyme Mix.

3

Methods

3.1 T-DNA Vector Construction for CRISPR-SpRYMediated Genome Editing

1. Phosphorylate and anneal DNA oligonucleotides. Dissolve lyophilized DNA oligos with water (see Note 1) to a final concentration of 100 μM. Phosphorylate DNA oligonucleotides using T4 polynucleotide kinase (T4 PNK) (Table 3, see Note 2). Incubate reactions at 37 °C for 30 min (see Note 3). Denature and anneal phosphorylated oligonucleotides by exposing them to boiling water and cooling the water down to room temperature on its own. Dilute oligonucleotides 200X for protospacer cloning. 2. Digest gRNA entry plasmids. Use pYPQ141C (with OsU6 promoter) for protospacers beginning with G or pYPQ141D (with OsU3 promoter) for protospacers beginning with A. Digest both plasmids with Esp3I (BsmBI) and incubate samples at 37 °C for 1–16 h (Table 4). Purify digested plasmid with a gel purification kit. Heat inactivation of restriction enzymes is preferred if digested plasmids are not purified immediately after digestion. Performing agarose gel electrophoresis followed by excision of pYPQ141C and/or

SpRY-Based Genome Editing in Plants

11

Table 3 DNA oligonucleotides/primers phosphorylation Component

Volume

crRNA forward primer (100 μM)

1 μL

crRNA reverse primer (100 μM)

1 μL

T4 PNK reaction buffer (10×)

1 μL

ATP (10 mM)

1 μL

T4 PNK (10 U/μL)

0.5 μL (5 U)

dH2O

5.5 μL

Total

10 μL

Table 4 gRNA entry plasmid pYPQ141C and pYPQ141D restriction digestion Component

Volume

pYPQ141C or pYPQ141D

20 μL (2 μg)

Buffer 4 (10×)

5 μL

DTT (10 mM)

5 μL

Esp3I (BsmBI) (10 U/μL)

2 μL (20 U)

dH2O

18 μL

Total

50 μL

pYPQ141D from the gel is not necessary but can help reduce the background (undigested plasmids). Measure DNA concentration of the digested plasmids with a spectrophotometer. 3. Ligate phosphorylated and annealed DNA oligonucleotides into EspE3 (BsmBI) digested gRNA entry plasmids (Table 5, see Note 4). Incubate ligation mixtures at room temperature for 2 h (see Note 5). Transform half of the ligation mixture into Escherichia coli DH5α competent cells using either the heat shock or electroporation method. Plate cells on solid LB medium supplemented with 50 mg/L spectinomycin and incubate the Petri plates at 37 °C overnight. 4. Pick one or two colonies from each LB plate and culture them in 5–6 mL LB liquid medium supplemented with 50 mg/L spectinomycin at 37 °C overnight. Isolate the plasmid DNA from each cell culture using a Miniprep kit. 5. Confirm the successful ligation of protospacer sequence in gRNA entry plasmids by Sanger sequencing using M13-R2 primer (see Note 6).

12

Simon Sretenovic et al.

Table 5 gRNA entry plasmid ligation Component

Volume

Esp3I (BsmBI) digested pYPQ141C or pYPQ141D

2 μL (60 ng, 0.02 pmol)

200x diluted annealed DNA oligonucleotides

2 μL

T4 DNA ligase buffer (10×)

2 μL

T4 DNA ligase (400 U/μL)

1 μL (400 U)

dH2O

13 μL

Total

20 μL

Table 6 Three-way Gateway LR reaction Component

Volume

SpRY entry plasmid (pYPQ166-SpRY) or SpRY-based base editor (pYPQ262B-ABE8e or pYPQ266E) entry plasmid

1.5 μL (150 ng)

crRNA entry plasmid

1 μL (150 ng)

Destination plasmid pYPQ203

2 μL (200 ng)

LR Clonase II

1 μL

Total

5.5 μL

Table 7 List of prepared T-DNA vectors and their respective Gateway LR reactions T-DNA plasmid # crRNA entry plasmid Cas9 or base editor entry plasmid Destination plasmid 1

OsPDS-TAA-gR

pYPQ166-SpRY

pYPQ203

2

OsALS-CAG-gR

pYPQ266E

pYPQ203

3

OsPDS-TAA-gR

pYPQ262B-ABE8e

pYPQ203

6. Use Sanger sequencing confirmed gRNA entry plasmids, SpRY entry plasmid (pYPQ166-SpRY) and/or SpRY-based base editor (pYPQ262B-ABE8e, pYPQ266E) entry plasmids, as well as the destination plasmid pYPQ203 to set up the three-way Gateway LR reactions (Table 6). Vector pYPQ203 harbors the maize ubiquitin promoter (pZmUbi) to drive the transcription of SpRY or SpRY base editors. Other destination plasmids with the desired promoter and selective markers can be used. Using the three-way Gateway LR reactions, final T-DNA plasmids will be generated (Table 7).

SpRY-Based Genome Editing in Plants

13

7. Transform entire reaction mixtures into E. coli DH5α competent cells using either the heat shock or electroporation method. Plate cells on solid LB medium supplemented with 50 mg/L kanamycin and incubate the Petri plates at 37 °C overnight (see Note 7). 8. Pick one or two colonies from each LB plate and culture them in 5–6 mL LB liquid medium supplemented with 50 mg/L kanamycin at 37 °C overnight. Isolate the plasmid DNA from each cell culture using a Miniprep kit. Confirm successful assembly by restriction digestion of the T-DNA plasmid with EcoRI (see Note 8). 9. Prepare stock cultures with digestion-confirmed plasmids by supplementing cell cultures with 15–25% glycerol in final concentration and store stock cultures at -80 °C. 3.2 Rice Protoplast Transformation to Test the Editing Efficiency of SpRY Vectors

1. Dehusk the rice seeds. Prerinse 20–30 seeds in 30 mL of 70% (v/v) ethanol in 50 mL conical tube by vigorously shaking the tube for 1 min. Rinse once with 30 mL of sterile water. 2. Add 30 mL of 50% (v/v) commercial bleach (5.25% hypochlorite), and place the conical tube with seeds on an orbital shaker for 30 min at low setting. Decant the bleach solution and rinse the seeds five times with ~40 mL sterilized water each time. With a small amount of water in the final rinse, pour the seeds onto the autoclaved filter paper and allow the seeds to dry. 3. Transfer 20–30 seeds with sterile tweezers onto sterile half MS medium in 330 mL culture vessels and incubate the vessels in dark at 28 °C for 10–15 days. 4. In the meantime, prepare protoplast isolation buffer (see Note 9), W5 buffer (see Note 10), MMG buffer (see Note 11), and PEG-calcium transformation buffer (see Note 12). Isolate T-DNA plasmids from bacterial cultures (see Note 13). 5. Cut the leaves of etiolated rice seedlings perpendicular to direction of growth into approximately 0.5–1 mm strips with razor blade in a sterile laminar flow hood (with lights turned off) on the sterile filter paper. Transfer the cut strips promptly from the filter paper into ~15 mL of protoplast isolation buffer in Petri plate (see Note 14). Perform vacuum infiltration 3 times for 10 min at 15–25 mm Hg in dark. 6. Incubate the cut strips in protoplast isolation buffer for 8 h at 28 °C in dark with gentle shaking on an orbital shaker at 60–80 rpm. 7. Perform the following steps in a sterile laminar hood with light turned off. Place the 40 μm filter on top of the 50 mL conical tube and wet the filter with 1 mL of W5 buffer. Filter ~10 mL of protoplast isolation buffer with protoplasts from the Petri dish. While still having approximately 5 mL of buffer in the

14

Simon Sretenovic et al.

Petri dish, gently squeeze the cut strips to Petri dish walls two to three times to obtain more protoplasts. Filter the remaining solution (see Note 15). 8. Add 10 mL of W5 buffer into Petri dish with cut strips, and shake gently by hand or using orbital shaker at 120 rpm for 1 min. Afterwards, gently squeeze the cut strips against the Petri dish walls, and filter the entire solution. 9. To obtain higher protoplast isolation yield, you may repeat step 8 a couple of times. 10. After collecting the protoplasts into 50 mL conical tube, centrifuge the protoplasts at 100 g for 5 min (see Note 16). 11. Remove the supernatant carefully and add 4 mL of W5 buffer (see Note 17). Resuspend the protoplasts by gently inverting the tubes until homogeneous solution can be observed. Carefully pipette 12 mL of 0.55 M sucrose solution below the W5-protoplast suspension without shaking the tube (see Note 18). Carefully add to W5-protoplast suspension 4 mL of W5 buffer without disturbing the interphase between sucrose solution and W5-protoplast suspension. Centrifuge the tube at 100 g for 30 min. 12. After centrifugation, a band of protoplasts should be visible at the interface. Using a pipette, carefully extract the band of protoplasts and transfer it to a new round-bottom 15 mL culture tube (usually approximately 2 mL of protoplasts). Add 5–10 mL of W5 buffer and resuspend the protoplasts by gently inverting the tubes until homogeneous solution can be observed. Centrifuge the protoplasts at 100 g for 5 min. 13. Remove the supernatant carefully and add 1–5 mL of W5 buffer. Gently resuspend the protoplasts once again and using enhanced Neubauer counting chamber asses the protoplast concentration. 14. Centrifuge the protoplast suspension at 100 g for 2 min. 15. Remove the supernatant and add the MMG buffer to obtain the titer of 2 × 106 protoplasts per mL. 16. Transfer 200 μL of protoplast suspension into 2 mL roundbottom microcentrifuge tubes containing 30 μL of T-DNA plasmids with concentration of 1 μg/μL (see Note 19). 17. Add 230 μL of PEG-Calcium transformation buffer, gently invert the tubes to mix the solution and incubate for 30 min at room temperature (see Note 20). 18. Add 900 μL of W5 buffer, mix the solution gently by inverting the tubes and centrifuge at 250 g for 5 min. 19. Remove approximately half of the supernatant and mix the remaining solution gently by inverting the tubes.

SpRY-Based Genome Editing in Plants

15

20. Add 1 mL of W5 buffer into each well of 12-well plates, and transfer the protoplast suspensions to 12-well plates. Incubate the plates at 32 °C for 48 h in dark (see Note 21). 21. After the incubation, collect the protoplasts from 12 wellplates into 2 mL microcentrifuge tubes, and isolate genomic DNA using CTAB method. 22. PCR amplify the genomic regions flanking the target sites using barcoded primers. 23. Run 5 μL of PCR products on a 1% agarose gel to confirm successful amplification. There should be bright bands with expected sizes. 24. Send the PCR samples for amplicon sequencing to a provider of NGS services. Our Lab uses Novogene for NGS. 25. Use CRISPRMatch sequencing data.

4

or

CRISPResso2

to

analyze

the

Notes 1. Water used for T-DNA vector construction is sterile molecular grade water. 2. Instead of using T4 PNK reaction buffer (10×) and ATP (10 mM), T4 ligation buffer (10×) already containing ATP can be used. 3. If DNA oligonucleotides are annealed immediately after phosphorylation, there is no need for T4 PNK heat inactivation. Otherwise, T4 PNK can be heat inactivated at 65 °C for 20 min. 4. A control reaction can be included using the same protocol, except without the annealed DNA oligonucleotides, to assess the background level caused by incomplete digestion of gRNA entry plasmids and self-ligation. 5. T4 DNA ligase buffer needs to be thawed completely and resuspended at room temperature. Incubation time can be as short as 10 min at room temperature. Ligation mixtures can also be incubated at 16 °C overnight. Ligase can be heat inactivated at 65 °C for 10 min. If ligation mixtures are used in transformation immediately after ligation, heat activation is unnecessary. 6. Nucleotide sequence of M13-R2 DNA oligonucleotide is 5′-TCGAGGCATTTCTGTCCTGG-3′. 7. If a different destination plasmid is used, use the appropriate corresponding antibiotic at the right concentration for selection of bacterial cells.

16

Simon Sretenovic et al.

8. Due to the large size of the T-DNA plasmids, confirmation by restriction digestion is usually sufficient to verify the correct assembly. Since no PCR amplification step is involved, Sanger sequencing-based verification is optional. 9. Prepare the protoplast isolation buffer by adding the components in order as they are listed in Materials section. After the addition of the Macerozyme R10, incubate the mixture at 55 °C for 10 min. Cool down the mixture to a room temperature and add CaCl2·2H2O and BSA. Add sterile deionized water to a volume of 90 mL, adjust the pH to 5.8, and add water to a final volume of 100 mL. Filter the solution using 0.22 μm syringe filter, and aliquot the protoplast isolation buffer to 8–10 mL aliquots in 15 mL conical tubes. Unless the protoplast isolation buffer is used immediately, store it at -20 °C. 10. After the addition of all the listed components, add sterile deionized water to a volume of 950 mL, adjust the pH to 5.8, and add water to a final volume of 1000 mL. Filter the solution using 0.22 μm syringe filter. Unless the W5 buffer is used immediately, store it at 4 °C. 11. After the addition of all the components, add sterile deionized water to a volume of 150 mL, adjust the pH to 5.8, and add water to a final volume of 200 mL. Filter the solution using 0.22 μm syringe filter, and aliquot the MMG buffer to 8–10 mL aliquots in 15 mL conical tubes. Unless the MGG buffer is used immediately, store it at -20 °C. 12. After the addition of all the components, add sterile deionized water to a volume of 150 mL, adjust the pH to 5.8, and add water to a final volume of 200 mL. Filter the solution using 0.22 μm syringe filter. Unless the PEG-calcium transformation buffer is used immediately, store it at -20 °C. However, the use of fresh, same-day-prepared PEG-calcium transformation buffer is highly recommended to achieve the best genome editing efficiency. 13. Usually, 30 μg of T-DNA plasmid is used for protoplast transformation, which is obtained using Midiprep kit to isolate plasmids from 50 mL of E. coli overnight cultures. 14. Do not let cut strips to become desiccated, and make sure all the cut strips are submerged in the protoplast isolation buffer. For a high amount of cut strips, add more protoplast isolation buffer. 15. While transferring protoplasts using automatic pipette, you should cut pipette tips prior sterilization to form larger opening at the tip and thus reducing shear forces acting on protoplasts. While filtrating the protoplasts, position the 50 mL

SpRY-Based Genome Editing in Plants

17

conical flask under an approximately 30° angle from horizontal line to reduce the solution flow along the tube walls. 16. Use centrifuge without a brake to reduce shear forces acting on protoplasts. If the acceleration or deceleration gradient can be set on newer centrifuges with brake, set it to the lowest setting possible. 17. While adding solutions to protoplasts, you should position 50 mL conical flask under an angle to reduce the solution flow speed along tube walls. 18. Since 0.55 M sucrose solution is denser compared to W5-protoplast solution, the latter will be above the sucrose solution after completing pipetting. 19. Usually, three replicates of protoplast transformation are performed for each T-DNA plasmid to obtain statistically relevant results. Also prepare negative control: a sample with protoplasts with the same amount of water instead of DNA. If you want to assess protoplast transformation efficiency, use a plasmid expressing a fluorescent protein such as GFP (under constitutive promoter) and screen the protoplasts utilizing fluorescent microscopy. 20. The added volume of PEG-calcium transformation buffer should amount to half of the total volume. 21. For assessing the protoplast transformation efficiency, incubate protoplasts at 32 °C for 12 h in dark.

Acknowledgments This work was supported by the NSF Plant Genome Research Program (award no. IOS-2029889 and IOS-2132693) and the USDA-NIFA Biotechnology Risk Assessment Research Grants Program (award no. 2018-33522-28789) to Y.Q. It was also supported by the National Transgenic Major Project (award no. 2018ZX08020-003), the Technology Innovation and Application Development Program of Chongqing (award no. CSTC2021JSCX-CYLHX0001), and the Natural Science Foundation of Sichuan Province (award no. 2022NSFSC0143) to X.T. and Y.Z. References 1. Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821. https://doi.org/10. 1126/science.1225829

2. Zetsche B, Gootenberg JS, Abudayyeh OO et al (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163:759–771. https://doi.org/10.1016/j. cell.2015.09.038

18

Simon Sretenovic et al.

3. Kim YG, Cha J, Chandrasegaran S (1996) Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc Natl Acad Sci 93:1156–1160. https://doi.org/10.1073/ pnas.93.3.1156 4. Boch J, Bonas U (2010) Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol 48:419–436. https://doi.org/10.1146/annurev-phyto080508-081936 5. Miller JC, Tan S, Qiao G et al (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29:143–148. https://doi. org/10.1038/nbt.1755 6. Hefferin ML, Tomkinson AE (2005) Mechanism of DNA double-strand break repair by non-homologous end joining. DNA Repair 4: 639–648. https://doi.org/10.1016/j.dnarep. 2004.12.005 7. Sfeir A, Symington LS (2015) Microhomology-mediated end joining: a back-up survival mechanism or dedicated pathway? Trends Biochem Sci 40:701–714. https://doi.org/10.1016/j.tibs.2015.08.006 8. Liang F, Han M, Romanienko PJ et al (1998) Homology-directed repair is a major doublestrand break repair pathway in mammalian cells. Proc Natl Acad Sci 95:5172–5177. https://doi.org/10.1073/pnas.95.9.5172 9. Jeggo PA (1998) DNA breakage and repair. Adv Genet 38:185–218. https://doi.org/10. 1016/s0065-2660(08)60144-3 10. Kosicki M, Tomberg K, Bradley A (2018) Repair of double-strand breaks induced by CRISPR–Cas9 leads to large deletions and complex rearrangements. Nat Biotechnol 36: 765–771. https://doi.org/10.1038/nbt. 4192 11. Pickar-Oliver A, Gersbach CA (2019) The next generation of CRISPR–Cas technologies and applications. Nat Rev Mol Cell Biol 20:490– 507. https://doi.org/10.1038/s41580-0190131-5 12. Friedland AE, Baral R, Singhal P et al (2015) Characterization of Staphylococcus aureus Cas9: a smaller Cas9 for all-in-one adeno-associated virus delivery and paired nickase applications. Genome Biol 16:257. https://doi.org/10. 1186/s13059-015-0817-8 13. Walton RT, Christie KA, Whittaker MN et al (2020) Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science 368:290–296. https://doi.org/ 10.1126/science.aba8853 14. Ren Q, Sretenovic S, Liu S et al (2021) PAM-less plant genome editing using a CRISPR–SpRY toolbox. Nat Plants 7:25–33.

https://doi.org/10.1038/s41477-02000827-4 15. Gaudelli NM, Komor AC, Rees HA et al (2017) Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage. Nature 551:464–471. https://doi.org/10. 1038/nature24644 16. Nishida K, Arazoe T, Yachie N et al (2016) Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353(6305):aaf8729. https:// doi.org/10.1126/science.aaf8729 17. Komor AC, Kim YB, Packer MS et al (2016) Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533:420–424. https://doi. org/10.1038/nature17946 18. Zhao D, Li J, Li S et al (2021) Glycosylase base editors enable C-to-A and C-to-G base changes. Nat Biotechnol 39(1):35–40. https://doi.org/10.1038/s41587-0200592-2 19. Chen L, Park JE, Paa P et al (2020) Precise and programmable C:G to G:C base editing in genomic DNA. bioRxiv:2020.07.21.213827. https://doi.org/10.1101/2020.07.21. 213827 20. Kurt IC, Zhou R, Iyer S et al (2021) CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Nat Biotechnol 39:41–46. https://doi.org/10.1038/ s41587-020-0609-x 21. Kuscu C, Adli M (2016) CRISPR-Cas9-AID base editor is a powerful gain-of-function screening tool. Nat Methods 13:983–984. https://doi.org/10.1038/nmeth.4076 22. Wang X, Li J, Wang Y et al (2018) Efficient base editing in methylated regions with a human APOBEC3A-Cas9 fusion. Nat Biotechnol 36:946–949. https://doi.org/10.1038/ nbt.4198 23. Richter MF, Zhao KT, Eton E et al (2020) Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat Biotechnol 38(7): 883–891. https://doi.org/10.1038/s41587020-0453-z 24. Gru¨newald J, Zhou R, Garcia SP et al (2019) Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Nature 569:433. https://doi.org/10.1038/ s41586-019-1161-z 25. Doman JL, Raguram A, Newby GA et al (2020) Evaluation and minimization of Cas9independent off-target DNA editing by cytosine base editors. Nat Biotechnol 38:620–628.

SpRY-Based Genome Editing in Plants https://doi.org/10.1038/s41587-0200414-6 26. Xu Z, Kuang Y, Ren B et al (2021) SpRY greatly expands the genome editing scope in rice with highly flexible PAM recognition. Genome Biol 22:6. https://doi.org/10. 1186/s13059-020-02231-9 27. Zhang C, Wang Y, Wang F et al (2021) Expanding base editing scope to near-PAMless with engineered CRISPR/Cas9 variants in plants. Mol Plant 14:191–194. https://doi. org/10.1016/j.molp.2020.12.016 28. Chen S, Liu Z, Lai L et al (2022) Efficient Cto-G base editing with improved target compatibility using engineered deaminase–nCas9 fusions. CRISPR J 5(3):389–396. https:// doi.org/10.1089/crispr.2021.0124 29. Sretenovic S, Liu S, Li G et al (2021) Exploring C-To-G base editing in rice, tomato, and

19

poplar. Front Genome Ed 3:756766. https:// doi.org/10.3389/fgeed.2021.756766 30. Park J, Bae S, Kim J-S (2015) Cas-designer: a web-based tool for choice of CRISPR-Cas9 target sites. Bioinformatics 31(24): 4014–4016. https://doi.org/10.1093/bioin formatics/btv537 31. Naito Y, Hino K, Bono H et al (2015) CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 31:1120– 1123. https://doi.org/10.1093/bioinformat ics/btu743 32. Wu Y, He Y, Sretenovic S et al (2022) CRISPRBETS: a base-editing design tool for generating stop codons. Plant Biotechnol J 20:499– 510. https://doi.org/10.1111/pbi.13732

Chapter 2 Type I-D CRISPR System-Mediated Genome Editing in Plants Naoki Wada, Keishi Osakabe, and Yuriko Osakabe Abstract Genome editing has revolutionized plant research and plant breeding by enabling precise genome manipulation. In particular, the application of type II CRISPR-Cas9 systems to genome editing has proved an important milestone, accelerating genetic engineering and the analysis of gene function. On the other hand, the potential of other types of CRISPR-Cas systems, especially many of the most abundant type I CRISPRCas systems, remains unexplored. We recently developed a novel genome editing tool, TiD, based on the type I-D CRISPR-Cas system. In this chapter, we describe a protocol for genome editing of plant cells using TiD. This protocol allows the application of TiD to induce short insertion and deletions (indels) or longrange deletions at target sites with high specificity in tomato cells. Key words Genome editing, CRISPR-Cas, Type I-D, TiD, Tomato

1

Introduction The development of genome editing techniques has enabled sitedirected mutagenesis with high specificity [1]. Among the various genome editing tools that have been developed in recent years, including zinc finger nucleases [2], transcription activator-like effector nuclease (TALENs) [3, 4], and CRISPR-Cas systems, CRISPR-Cas9 is currently the most widely used, providing an easy, flexible, and efficient approach to targeted mutagenesis [1, 5–10]. CRISPR-Cas is a bacterial immune mechanism, comprising various types of interesting systems that have been classified into two classes and six types, depending on phylogenetic, comparative genomic, and protein structural analyses [11, 12]. The best known of these is CRISPR-Cas9, a Class 2 type II system with a single effector Cas9 protein that recognizes, binds to, and cleaves a target dsDNA (Fig. 1a) [5–7]. On the other hand, the most abundant CRISPR-Cas systems in nature are Class 1 type I systems, which require multi-subunit effector complexes to bind and cleave target dsDNAs [12–21]. Despite their abundance, application of type I

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

21

22

Naoki Wada et al.

Fig. 1 Schematic illustration of the DNA-crRNA-Cas protein complexes of Class 2 type II CRISPR-Cas9 (a) and Class 1 type I-D CRISPR Cas (TiD) (b). (a) CRISPR-Cas9 consists of Cas9 protein and a crRNA:tracrRNA that recognizes a 20 nt target sequence followed by NGG PAM. It induces small indels at the target site. (b) TiD consists of 5 types of Cas proteins (Cas3d, 5d, 6d, 7d, 10d) and a crRNA recognizing a 35–36 nt target sequence following GTH (T, C, A) PAM. TiD induces small indels or bidirectional long deletions at the target site. The main features of each CRISPR-Cas are summarized below

CRISPR-Cas systems to genome editing in eukaryotes has been limited until recently [22]. In 2019, three groups reported the use of type I-E CRISPR-Cas for genome editing in mammalian cells [23–25]. Tan et al. subsequently showed the importance of the small Cas11 protein for application of the type I CRISPR-Cas system to genome editing in mammalian cells [26]. However, type I CRISPR-Cas has not been used in plant genome editing until recently. We have recently applied type I-D CRISPR-Cas systems successfully to genome editing in both mammalian [27] and plant [28] cells. Our newly developed tool, TiD, derived from Microcystis aeruginosa type I-D CRISPR-Cas, consists of five Cas proteins (Cas3d, 5d, 6d, 7d, 10d) and a CRISPR RNA (crRNA) that recognizes 35–36 nt of target sequence (Fig. 1b). Unlike other type I systems in which Cas3 protein digests the target dsDNA, Cas10d functions as an effector protein and is responsible for recognizing and cleaving the target dsDNA with TiD. TiD has unique features that distinguish from other type I CRISPR-Cas and CRISPR-Cas9 systems reported thus far. TiD can induce both bidirectional long-range deletions and small indels at a target site, whereas other type I systems induce only unidirectional long deletions [23–25] and CRISPR-Cas9 induces mainly small indels [5–7]. TiD can also be applied to remove complex genome structures. TiD recognizes longer target sequences (35–36 nt) than

TiD-Mediated Genome Editing of Plants

23

Fig. 2 Experimental flow for the generation of genome-edited tomatoes using TiD

CRISPR-Cas9 (20 nt) and type I-E CRISPR-Cas (32 nt), suggesting a higher specificity of TiD compared with other tools. We have established a protocol for genome editing of plant cells using TiD. This protocol includes crRNA screening in human embryonic kidney (HEK) 293T cells, construction of plantoptimized vectors, and efficient transformation and regeneration of tomatoes (Fig. 2). Screening of crRNAs that target a specific sequence effectively is necessary, because dsDNA cleavage efficiency depends on the target sequence. For this purpose, we developed a NanoLuc single-strand annealing (SSA) assay that enables the simultaneous screening of around 20 kinds of crRNA in a 96-well plate using HEK293T cells (Fig. 3). The selected crRNA can then be inserted into TiD expression vectors with a crRNA and other cas gene expression cassettes that are optimized for genome editing. In this protocol presented here, tomato is chosen as an example plant for the application of TiD plant genome editing. TiD vectors are introduced into tomato leaf discs by an Agrobacterium-mediated transformation method. Our transformation and regeneration protocol for tomato plants has been shown to produce regenerated mutant plants efficiently [29, 30]. Here, we present detailed protocols for the application of TiD to genome editing, from crRNA design to the generation of genome-edited tomato plants. Our hope is that these protocols will help researchers open up new opportunities for plant genome engineering.

24

Naoki Wada et al.

Fig. 3 Summary of NanoLuc SSA assay. Nine types of vectors (two kinds of pCAG-nLUxxUC vector with target sequence and TiD cas and crRNA expression vectors, and fluc expression vector) were co-transfected into HEK293T cells. In transfected cells, expressed Cas proteins and crRNA form a complex and bind to the target sequence on pCAG-nLUxxUC vectors. Cleavage of dsDNA at the target site induces recombination between homologous sequences on each vector, resulting in the recovery of the full NanoLuc gene. Thus, dsDNA cleavage can be detected as emission of NanoLuc luminescence

2

Materials

2.1 Design of crRNA Targeting a Specific Sequence

1. Personal computer with internet access

2.2 Construction of a crRNA Vector for Expression in Mammalian Cells

1. pAEX_crRNA vector (100 ng/μL, Fig. 4, see Note 1). 2. Oligo DNA design (see Subheading 3.1). 3. TE buffer solution (pH 8.0) (Nacalai Tesque Inc.). 4. Thermal Cycler T100 (Bio-Rad Laboratories, Inc.). 5. Restriction enzyme BsaI and CutSmart Buffer (New England Biolabs Inc.). 6. T4 DNA ligase (New England Biolabs Inc.). 7. NEB Stable Competent Escherichia coli (High Efficiency) (New England Biolabs Inc.) (see Note 2). 8. Dry bath Sahara 320 (Rocker Scientific Co., Ltd.). 9. LB liquid medium: dissolve 25 g LB Broth, Miller (Nacalai Tesque Inc.), in 1 L ddH2O. Autoclave and store at 4 °C.

TiD-Mediated Genome Editing of Plants

25

Fig. 4 Summary of vector structures. Vectors for the expression of cas genes and crRNA in mammalian cells (a), for NanoLuc SSA assay in mammalian cells (b), and for expression in plant cells (c). Promoters, genes, and 2A sequence used in each vector are shown. SV40 NLS sequence, tag, and terminator are not indicated in this figure

10. Carbenicillin stock solution: dissolve 100 mg carbenicillin disodium salt (Biosynth Carbosynth) in 1 mL ddH2O, filtersterilize, and store at -30 °C. 11. LB agar plate containing carbenicillin: dissolve 25 g LB Broth, Miller (Nacalai Tesque Inc.), and 15 g Bacto Agar (Becton, Dickinson and Company) in 1 L ddH2O (final concentration: 1.5%).

26

Naoki Wada et al.

Autoclave, cool to about 55 °C, and then add 1 mL carbenicillin stock solution. Store at 4 °C. 12. General kits for plasmid extraction and sequencing, such as FastGene Plasmid Mini kit (Nippon Genetics Co, Ltd.), and SuperDye Cycle Sequence Kit (Edge Biosystems). 2.3 HEK293T Cell Culture

1. HEK293T cells. 2. Cell culture medium: add 55 mL fetal bovine serum (FBS) (see Note 3), 5.5 mL GlutaMAX Supplement (Thermo Fisher Scientific), and 5.5 mL penicillin-streptomycin solution (×100) (FUJIFILM Wako Pure Chemical Corporation) to 450 mL D-MEM (High Glucose) with L-glutamine, phenol red, and sodium pyruvate (FUJIFILM Wako Pure Chemical Corporation). 3. PBS (-): dilute 10× PBS (-) (FUJIFILM Wako Pure Chemical Corporation) with ddH2O. Filter-sterilize and store at 4 °C. 4. 0.05% (w/v) trypsin-0.53 mmol/L EDTA
4Na solution with phenol red (FUJIFILM Wako Pure Chemical Corporation). 5. 0.4% (w/v) Trypan Blue Solution (FUJIFILM Wako Pure Chemical Corporation). 6. LUNA™ Cell Counting Slides (Logos Biosystems). 7. LUNA™ Automated Cell counter (Logos Biosystems). 8. Corning® 60 mm TC-treated Culture Dish (Corning Inc.). 9. CO2 incubator MODEL310 (Thermo Fisher Scientific).

2.4 Transfection of HEK293T Cells for NanoLuc SSA Reporter Assay

1. TiD cas expression vectors (Fig. 4a). 2. TiD crRNA expression vector constructed as in Subheading 3.2 (Fig. 4a). 3. pGL4.53 [luc2/PGK] vector (Promega) (Fig. 4b, see Note 4). 4. pCAG-nLUxxUC_target_Block1 vector (with DNA fragment containing target sequence) (Fig. 4b, see Note 5). 5. pCAG-nLUxxUC_target_Block2 vector (with DNA fragment containing target sequence) (Fig. 4b, see Note 5). 6. OPTI-MEMI Reduced Serum Medium (FUJIFILM Wako Pure Chemical Corporation). 7. TurboFect Transfection Reagent (Thermo Fisher Scientifics). 8. Vortex mixer. 9. 96-well poly-L-lysine-coated culture plate (Iwaki).

2.5 Detection of Luciferase Activity

1. Nano-Glo Dual-Luciferase Reporter system (Promega). 2. OPTI-MEMI Reduced Serum Medium (FUJIFILM Wako Pure Chemical Corporation).

TiD-Mediated Genome Editing of Plants

27

3. 96-well black plate (Greiner Bio-One). 4. Plate reader (Cytation 3, BioTek Instruments). 2.6 Construction of a Plant-Optimized TiD Vector Containing a crRNA Targeting a Specific Sequence

1. pTiD1.2 and pMGTiD20(Fig. 4c, see Note 6).

2.7 Germination of Tomato Seeds

1. Micro-Tom (Solanum lycopersicum L. cv Micro-Tom) or Ailsa Craig (S. lycopersicum L. cv Ailsa Craig) seeds (see Note 7).

2. Oligo DNAs designed as in Subheading 3.1. 3. Kanamycin stock solution: dissolve 50 mg kanamycin (FUJIFILM Wako Pure Chemical Corporation) in 1 mL ddH2O, filter-sterilize, and store at -30 °C.

2. 70% ethanol. 3. Wash solution: add 3 mL sodium hypochlorite (FUJIFILM Wako Pure Chemical Corporation) and 15 μL Triton X-100 (FUJIFILM Wako Pure Chemical Corporation) to 30 mL ddH2O. 4. Sterile distilled water. 5. 1000× MS vitamin: add 10 mg myoinositol, 50 mg nicotinic acid, 50 mg pyridoxine hydrochloride, 10 mg thiamine hydrochloride, and 200 mg glycine, and make up the volume to 1 L with ddH2O. Store at -30 °C. 6. Tomato germination medium: add 4.6 g MS salt (FUJIFILM Wako Pure Chemical Corporation), 1 mL 1000× MS vitamin, 15 g sucrose (Nacalai Tesque Inc.), and 8 g agar (Nacalai Tesque Inc.), and make up to a volume of 1 L with ddH2O. Adjust the pH to 5.7. Autoclave and store at 4 °C. 7. Plant Growth Chamber CLE-305 (Tomy Digital Biology Co. Ltd.). 2.8 Transformation of Agrobacterium tumefaciens Using the TiD Vector

1. A. tumefaciens strain GV2260. 2. pTiD1.2 and pMGTiD20 with crRNA that targets the specific sequence (constructed in Subheading 3.6). 3. Gene Pulser Xcell electroporator (Bio-Rad Laboratories, Inc.) 4. YEP liquid medium: dissolve 10 g peptone (FUJIFILM Wako Pure Chemical Corporation), 5 g yeast extract (FUJIFILM Wako Pure Chemical Corporation), and 5 g sodium chloride (Nacalai Tesque Inc.) in ddH2O. Make up to 1 L. Adjust pH to 7.0 using sodium hydroxide and autoclave. Store at 4 °C. 5. YEP agar medium: dissolve 10 g peptone (FUJIFILM Wako Pure Chemical Corporation), 5 g yeast extract (FUJIFILM Wako Pure Chemical Corporation), 5 g sodium chloride (Nacalai Tesque Inc.), and 15 g Bacto Agar (Becton, Dickinson and Company) in ddH2O. Make up to 1 L. Adjust pH to 7.0

28

Naoki Wada et al.

using sodium hydroxide and autoclave. Cool to about 55 °C and add 1 mL kanamycin stock solution. Store at 4 °C. 6. Electro cuvettes (Bio-Rad Laboratories, Inc.). 7. BIO-SHEAKER BR-15 (TITEC). 8. Incubator IC402 (Yamato Scientific Co., Ltd.). 2.9 Preparation of Agrobacterium Solution

1. Agrobacterium strain established as in Subheading 3.8. 2. LB liquid medium containing kanamycin: dissolve 25 g LB Broth, Miller (Nacalai Tesque Inc.), in 1 L ddH2O. Autoclave and cool to about 55 °C. Add 1 mL kanamycin stock solution (see Subheading 2.6). Store at 4 °C. 3. Biowave C08000 Cell Density Meter (Biochrom Ltd., UK). 4. Acetosyringone stock solution (400 mM): dissolve 3.92 g acetosyringone (4′-hydroxy-3′,5′-dimethoxyacetophenone, Tokyo Chemical Industry Co., Ltd.) in 50 mL DMSO (dimethyl sulfoxide). Store at -30 °C. 5. AB salts solution: dissolve 20 g ammonium chloride, 6 g magnesium sulfate heptahydrate, 3 g potassium chloride, 300 mg calcium chloride dihydrate, and 50 mg iron (II) sulfate heptahydrate in ddH2O, and make up to 1 L. Store at 4 °C 6. Glucose solution, 5% (w/v): dissolve 5 g glucose (FUJIFILM Wako Pure Chemical Corporation) in ddH2O and make up to 100 mL. Store at 4 °C. 7. AB-MES medium containing 50 mg/L kanamycin and 200 μM acetosyringone: dissolve 3 g dipotassium hydrogen phosphate, 1.3 g sodium dihydrogen phosphate dihydrate, and 9.8 g MES in ddH2O, and make up to 850 mL. Adjust the pH to 5.7 and autoclave. After cooling, add 100 mL 5% (w/v) glucose solution and 50 mL AB salts solution. Store at 4 °C. 8. BIO-SHAKER BR-15 (TIETECH Co., Ltd.). 9. Thermo Scientific Sorvall ST 8FR (Thermo Fisher Scientific). 10. MS liquid medium: dissolve 4.6 g Murashige and Skoog Plant Salt Mixture (FUJIFILM Wako Pure Chemical Corporation) in ddH2O, and add 1 mL 1000× MS vitamin (described in Subheading 2.7), 30 g sucrose (Nacalai Tesque Inc.), and make up to 1 L using ddH2O. Adjust the pH to 5.7 and autoclave. Store at 4 °C. 11. Agrobacterium infection medium: mix 40 mL of MS liquid medium and 1.2 μL of 2-mercaptoethanol (Nacalai Tesque) and 40 μL of 100 mM acetosyringone prepared from acetosyringone stock solution (400 mM).

TiD-Mediated Genome Editing of Plants

2.10 AgrobacteriumMediated Transformation of the TiD Vector into Tomato Leaf Discs

29

1. Scissors. 2. Petri dish. 3. Agrobacterium suspension prepared in Subheading 3.9. 4. Sterilized filter paper. 5. Cocultivation medium: dissolve 4.6 g Murashige and Skoog Plant Salt Mixture (FUJIFILM Wako Pure Chemical Corporation), 1 mL 1000× MS vitamin solution (described in Subheading 2.7), 30 g sucrose (Nacalai Tesque Inc.), and 8 g agar (Nacalai Tesque Inc.) in ddH2O. Make up to 1 L using ddH2O and autoclave. After cooling to about 55 °C, add 100 μL 400 mM acetosyringone stock solution in a clean bench. 6. Plant Growth Chamber CLE-305 (Tomy Digital Biology Co. Ltd.).

2.11 Regeneration and Cultivation of Transgenic Tomatoes

1. Trans-Zeatin solution (1.0 mg/mL): dissolve 50 mg transZeatin in 50 mL ddH2O. Filter-sterilize and store at -30 °C. 2. Meropenem solution (12.5 mg/mL): dissolve 625 mg meropenem hydrate in 50 mL ddH2O. Filter-sterilize and store at 30 °C. 3. Callus induction medium containing kanamycin: add 8 g agar (Nacalai Tesque Inc.) to 1 L MS liquid medium (described in Subheading 2.9) and autoclave. After cooling down to about 55 °C, add 1.5 mL trans-Zeatin solution, 2 mL kanamycin solution, and 2 mL meropenem solution in a clean bench. Store at 4 °C (see Note 8). 4. Shoot induction medium: add 8 g agar (Nacalai Tesque Inc.) to 1 L MS liquid medium described in Subheading 2.9 and autoclave. After cooling down to about 55 °C, add 1 mL transZeatin solution, 2 mL kanamycin solution, and 2 mL meropenem solution in a clean bench. Store at 4 °C (see Note 8). 5. Rooting induction medium: dilute the 500 mL MS liquid medium described in Subheading 2.9 with ddH2O to make a 2-times dilution of the MS liquid medium. Add 8 g agar (Nacalai Tesque Inc.) to the 1 L of diluted MS liquid medium and autoclave. After cooling to about 55 °C, add 1 mL kanamycin solution and 2 mL meropenem solution in a clean bench. Store at 4 °C (see Note 8). 6. Soil (Takii & Co., Ltd). 7. Plant Growth Chamber CLE-305 (Tomy Digital Biology Co. Ltd.).

30

3

Naoki Wada et al.

Methods

3.1 Design crRNA Targeting a Specific Sequence

1. Identify the target sequences in your gene of interest. Target sequence should be designed at GTH (GTT, GTC, GTA) followed by 35 or 36 nt sequence (see Note 9). 2. Design two oligos per one target sequence for the construction of crRNA expression vector. The requirements for oligo DNA design are as follows (see Note 10): • Oligo A: AAAC-“35 or 36 nt target sequence”-G • Oligo B: GGAAC- “reverse complement of 35 or 36 nt target sequence in oligo A”

3.2 Construction of crRNA Expression Vector for Mammalian Cells

1. Mix 200 pmol each of oligo A and oligo B in 20 μL TE buffer. 2. Anneal oligo A and B in the following conditions: • 98 °C 5 min • 85–25 °C (lower the temperature at a constant rate of 0.1 °C/s), 25 °C 10 min 3. Add 80 μL TE buffer to give a final concentration of oligo DNAs of 2 pmol/μL. 4. Mix the DNAs, T4 DNA ligase and BsaI as follows: • pAEX_crRNA vector: 1.0 μL • Annealed oligo DNAs: 1.5 μL • T4 DNA ligase buffer: 2.0 μL • BsaI-HF: 1.0 μL • T4 DNA ligase: 1.0 μL • ddH2O: 13.5 μL 5. Digestion and ligation starts at the following condition • 10 cycles of 37 °C 5 min and 16 °C 10 min 6. Add 0.5 μL of BsaI-HF to the solution and incubate as follows • 50 °C 30 min, 80 °C 15 min 7. E. coli competent cells can be transformed with 5 μL of the reaction solution using a standard heat shock protocol. 8. Plasmid extraction and sequencing can be performed according to standard vector construction protocols. General kits necessary for the construction are described in Subheading 2.2.

3.3 HEK293T Cell Culture

The following experiments should be performed in a clean bench. 1. Culture HEK293T cells in cell culture medium. 2. When the cells are about 80% confluent in a 60 mm dish, aspirate the medium.

TiD-Mediated Genome Editing of Plants

31

3. Wash the cells with 1 mL PBS. 4. Add 500 μL trypsin solution to the cells and incubate them in a 37 °C incubator with 5% CO2 for 3 min. 5. Observe the cells under the microscope, and check if the cells are detached from the bottom of the dish completely. 6. Add 500 μL cell culture medium to the cell suspensions. 7. Mix the solution gently but thoroughly. 8. Measure the cell density and transfer 5 × 105 cells to a new dish (see Note 11). 9. Adjust the volume of cell culture medium to 5 mL. 10. Culture the cells in a 37 °C incubator with 5% CO2. 3.4 Transfection of HEK293T Cells for NanoLuc SSA Reporter Assay

Following experiments should be performed in a clean bench. 1. The day before transfection (i) HEK293T cells are collected and counted as in Subheading 3.3. (ii) Seed 2 × 104 cells/well (100 μL per well) on a 96-well plate. (iii) Incubate cells in the 96-well plate at 37 °C with 5% CO2. 2. On the day of transfection Analysis of X types of crRNA with a nontarget crRNA (see Note 12) can be performed with the following protocol. (i) Prepare 60× X μL of OPTI-MEM solution in a 1.5 mL tube. (ii) Add the following DNAs to the tube. • pGL4.53 ( fluc-expression vector): 30× X ng • pCAG-nLUxxUC_target_Block1: 30× X ng • pCAG-nLUxxUC_target-Block2: 30× X ng • TiD cas expression vectors: 90× X ng each 3. Divide the solution with DNAs above into 60 μL aliquots in 1.5 mL tubes. 4. Add 90 ng of each crRNA to each 60 μL aliquot. 5. Mix well by vortexing, and spin down briefly. 6. Add 1.2 μL TurboFect Reagent and vortex immediately. 7. Incubate at room temperature for 15 min. 8. Add 20 μL of the solution to every well of the 96-well plate on which cells were grown overnight. Cells in 3 wells should be transfected by the same DNA solution (technical replicate = 3). 9. Culture the cells in a 37 °C incubator with 5% CO2 for 2 days.

32

Naoki Wada et al.

3.5 Detection of Luciferase Activity (See Note 13)

1. Remove the medium by aspiration. 2. Add 20 μL of OPTI-MEM to cells in each well. 3. Add 20 μL ONE-Glo EX Luciferase Assay Reagent to each well. 4. Incubate the plate at room temperature for 10 min. 5. Transfer each solution to a 96-well black bottom plate. 6. Measure firefly luciferase luminescence by plate reader (Fluc value). 7. Add 20 μL Nano NanoDLR Stop & Glo Reagent to each well. 8. Incubate the plate at room temperature for 10 min. 9. Measure NanoLuc luciferase luminescence by plate reader (Nluc value). 10. Calculate the ratio of NanoLuc to firefly luminescence. 11. Normalize the ratio of the crRNAs to be examined to the ratio of the sample using nontarget crRNA. 12. crRNAs with high activity for genome editing can be selected using this assay.

3.6 Construction of a Plant-Optimized TiD Vector Containing a crRNA that Targets the Specific Sequence

A T-DNA region of the TiD vector constructed is shown in Fig. 4c. We constructed two types of TiD vectors, pTiDP1.2 and pMGTiD20 (Fig. 4, see Note 6). Both vectors can be used for the genome editing of tomatoes. Annealed oligo DNAs that target the desired sequences in plant genome, selected as in Subheading 3.5, can be inserted into the TiD vector by using a Golden Gate cloning protocol as described in Subheading 3.2.

3.7 Germination of Tomato Seeds

The following experiments should be performed in a clean bench. 1. Sterilize tomato seeds by shaking them in 70% ethanol for 2 min. 2. Remove the 70% ethanol. 3. Add Wash solution and shake seeds for 45 min. 4. Remove Wash solution and rinse seeds with sterile distilled water four to five times in a clean bench. 5. Place the tomato seeds in sterile distilled water and shake overnight. 6. Remove sterile distilled water and rinse with fresh sterile distilled water 4 to 5 times. 7. Place the seeds on a tomato germination medium plate. 8. Grow at 23 °C under 16 h light/8 h dark conditions.

TiD-Mediated Genome Editing of Plants

3.8 Transformation of A. tumefaciens Using TiD Vector

33

1. Thaw Agrobacterium competent cells (GV2260 strain) on ice. 2. Add 1 μL plasmid DNA (100–200 ng) to the electrocompetent cells and mix by tapping the test tube. 3. Transfer the solution containing DNA and Agrobacterium competent cells carefully into an electroporation cuvette chilled on ice in advance. 4. Place the electroporation cuvette in a GenePulser X cell electroporator. 5. Electroporate using the following conditions: 2400 V, 200 Ω, 25 μF. 6. Immediately add 1 mL YEP solution. After gentle mixing, transfer the solution into a culture tube and shake at 28 °C for 2–3 h. 7. Spread 50–100 μL cells onto the YEP plate containing kanamycin. 8. Incubate the plates at 28 °C for 2 or 3 days.

3.9 Preparation of Agrobacterium Solution

1. Inoculate a fresh colony of Agrobacterium into 3 mL LB liquid medium containing 50 mg/L kanamycin and culture at 28 °C with shaking (220 rpm) for 16–18 h. 2. Check the OD600 using a spectrophotometer. Centrifuge at 6000 × g for 5 min to collect the cells. 3. Remove the supernatant and resuspend the cell pellet to an OD600 of 0.2 in AB-MES medium containing 50 mg/L kanamycin and 200 μM acetosyringone. Culture 10 mL of the cell suspensions at 28 °C, 220 rpm for 16–18 h (until OD600 reaches to 0.5–1.0). 4. Centrifuge at 6000 × g for 5 min, and then resuspend the cell pellet in MS liquid medium. 5. Measure the OD600 and add Agrobacterium infection medium containing 2-mercaptoethanol and acetosyringone to OD600 of 0.01. Prepare 40 mL of Agrobacterium solution in a 50 mL tube for infection of tomato leaf discs.

3.10 AgrobacteriumMediated Transformation of Tomato Leaf Discs with TiD Vector

The following experiments should be performed in a clean bench. 1. Cut the cotyledons from young tomato seedlings using scissors on the Petri dish to prepare 5–7 mm leaf discs. 2. Soak the leaf discs in the Agrobacterium solution and shake gently for 10 min. 3. Transfer the leaf discs onto sterilized filter papers to remove the excess Agrobacterium solution, and then place them upside down on the cocultivation medium. 4. Incubate the leaf discs at 23 °C for 48–72 h in the dark.

34

Naoki Wada et al.

3.11 Regeneration and Cultivation of Transgenic Tomatoes (Fig. 5a)

The following experiments should be performed in a clean bench. 1. Transfer the leaf discs onto callus induction medium, and incubate at 23 °C under 16 h light/8 h dark conditions. Make sure that the abaxial sides of the leaf discs attach to the callus induction medium. 2. Transfer the leaf discs to fresh medium every 2 weeks. 3. Transfer the leaf discs to shoot induction medium when the callus sizes reach 3–5 mm (see Note 14). 4. When the regenerated shoots reach about 5 cm in height, transfer the shoots into rooting medium. 5. After rooting, transfer the regenerated plants to soil pots. 6. Genomic DNAs can be extracted from callus, shoots, and regenerated plants for analysis of mutations. Mutation patterns induced by TiD include (1) short indels and (2) long-range deletions. • Short indels can be detected by general methods such as the T7E1 nuclease-based assay, restriction fragment length polymorphism (RFLP) analysis, and amplicon deep sequencing. • For long-range deletions, long-range PCR can be used to detect mutations (see Note 15).

4

Notes 1. The pAEX_crRNA vector is designed for expression of TiD crRNA in mammalian cells. This vector has two BsaI sites, which can be used for the insertion of 35–36 nt of target sequence. 2. pAEX_crRNA vectors contain repeat sequences of crRNA. Therefore, to avoid unnecessary recombination between repeat sequences, we use NEB Stable Competent E. coli (High Efficiency) cells (New England Biolabs Inc.). 3. The quality of FBS should be checked before purchase; cell culture should be tried with free samples available from each provider. Based on the results of the trial, purchase FBS with same lot number used for the trial. 4. pGL4.53 [luc2/PGK] vector expresses the firefly luciferase gene (luc2) under the control of the PGK promoter in mammalian cells. The luminescence derived from firefly luciferase is used to normalize the variation of transfection efficiency among samples in this experiment.

TiD-Mediated Genome Editing of Plants

35

Fig. 5 Tomato genome editing using TiD. (a) Flow of tomato genome editing. Tomato leaf discs are transformed by an Agrobacterium-mediated method. Transformed cells are regenerated into tomatoes by tissue culture techniques. (b) General mutations introduced by TiD. Small indels or bidirectional long deletions can be induced by TiD

5. pCAG-nLUxxUC_target_Block1 vector contains the first half of the NanoLuc luciferase (Nluc) gene followed by ca. 500 bp of DNA sequence containing the PAM-35–36 bp of target sequence (Figs. 3 and 4b). pCAG-nLUxxUC_target_Block2 vector contains ca. 500 bp of DNA sequence containing the PAM-35–36 bp of target sequence followed by the second half of the NanoLuc luciferase (Nluc) gene (Figs. 3 and 4b). Both fragments from the NanoLuc luciferase gene share 300 bp of identical sequence, which works as a homology arm. DNA fragments containing target sequences should be inserted into pCAG-nLUxxUC_target vectors in advance. 6. pTiD1.2 and pMGTiD20 are TiD cas and crRNA expression vector optimized for expression in plants (Fig. 4). Both vectors express crRNA from the AtU6–26 promoter and have BsaI sites for the integration of target sequence. In pTiDP1.2, all cas genes are connected by 2A peptide sequence and expressed under one P35S promoter. In pMGTiD20, cas3d and cas6d genes are expressed from the P35S promoter, and cas10d, cas5d, and cas7d genes are expressed under the control of the Pubi4 promoter.

36

Naoki Wada et al.

7. Both varieties can be mutated using the protocol described in this chapter. 8. The medium described in this chapter is for the selection of transformed calli and shoots with pTiD vectors. For the regeneration of non-transformed plants, use medium without kanamycin. 9. In our experiment, GTT or GTC PAM was preferred over GTA PAM in eukaryotic cells. Usually, off-target sequences with a few mismatch sequences are very rare in the tomato genome. Please refer to [27, 28] for a detailed explanation of the number of off-target sites and effects of mismatches on each nucleotide position. 10. The PAM sequence is not included in the oligo sequence. Generally, we design at least 10 target sequences, and two or three crRNAs with the highest activity would be selected among them as active crRNA candidates. 11. In our hands, when we passage 5 × 105 HEK293T cells into a 60 mm dish, cells will be 80% confluent at 2 days after passage. Overgrowth should be avoided. 12. When carrying out this experiment, we always include a sample for a nontarget crRNA. Comparison of the Nluc/Fluc value of the samples to that of the nontarget crRNA is essential. We mix all the DNAs that are common to all samples in advance, dispense them into separate tubes, and then add samplespecific DNA such as crRNA expression vector to each tube. 13. The volume of each reagent is reduced as compared with the standard protocol provided by the manual of the Nano-Glo Dual-Luciferase Reporter Assay system (Promega) to reduce the cost of the experiment. Although luminescence can be obtained easily using this protocol, but when the luciferase activity is too strong or incubation is too long, the luminescence derived from nanoluciferase sometimes shows very low signals. This could be due to a shortage of substrate because a reduced amount of substrate is used in this protocol. 14. Shoots can be regenerated about 4 weeks after transfer to shoot induction medium. 15. For long-range PCR, we use 40 nt primers of HPLC grade for amplification. Takara EX Premier (Takara-Bio Inc.), KOD FX NEO and KOD ONE (TOYOBO Co., Ltd.) polymerases can be used for the amplification of long DNA fragments. Band patterns obtained by long-range PCR are generally influenced by the polymerase and primers used. Therefore, optimization of PCR conditions is required for the detection of reproducible results.

TiD-Mediated Genome Editing of Plants

37

Acknowledgments The work is supported by New Energy and Industrial Technology Development Organization (NEDO) and Japan Science and Technology Agency (JST) grant number JPMJPF2010 (to Y.O.), Adaptable and Seamless Technology transfer Program through Target-driven R&D (A-STEP) (to K.O.), Core Research for Evolutional Science and Technology (CREST) (to K.O.), and JSPS KAKENHI Grant number 22 K06192 (to N.W.). References 1. Osakabe Y, Osakabe K (2015) Genome editing with engineered nucleases in plants. Plant Cell Physiol 56:389–400 2. Cathomen T, Keith Joung J (2008) Zinc-finger nucleases: the next generation emerges. Mol Ther 16:1200–1207 3. Miller JC, Tan S, Qiao G et al (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29:143–148 4. Zhang F, Cong L, Lodato S et al (2011) Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol 29:149–153 5. Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821 6. Cong L, Ran FA, Cox D et al (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–823 7. Mali P, Yang L, Esvelt KM et al (2013) RNA-guided human genome engineering via Cas9. Science 339:823–826 8. Wang H, La Russa M, Qi LS (2016) CRISPR/ Cas9 in genome editing and beyond. Annu Rev Biochem 85:227–264 9. Jaganathan D, Ramasamy K, Sellamuthu G et al (2018) CRISPR for crop improvement: an update review. Front Plant Sci 9:985 10. Wada N, Ueta R, Osakabe Y et al (2020) Precision genome editing in plants: state-of-the-art in CRISPR/Cas9-based genome engineering. BMC Plant Biol 20:234 11. Pyzocha NK, Chen S (2018) Diverse class 2 CRISPR-Cas effector proteins for genome engineering applications. ACS Chem Biol 13: 347–356 12. Makarova KS, Wolf YI, Iranzo J et al (2020) Evolutionary classification of CRISPR–Cas systems: a burst of class 2 and derived variants. Nat Rev Microbiol 18:67–83

13. Brouns SJJ, Jore MM, Lundgren M et al (2008) Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960–964 14. Westra ER, van Erp PBG, Ku¨nne T et al (2012) CRISPR immunity relies on the consecutive binding and degradation of negatively supercoiled invader DNA by Cascade and Cas3. Mol Cell 46:595–605 15. Jackson RN, Golden SM, van Erp PBG et al (2014) Crystal structure of the CRISPR RNA– guided surveillance complex from Escherichia coli. Science 345:1473–1479 16. Mulepati S, He´roux A, Bailey S (2014) Crystal structure of a CRISPR RNA–guided surveillance complex bound to a ssDNA target. Science 345:1479–1484 17. Zhao H, Sheng G, Wang J et al (2014) Crystal structure of the RNA-guided immune surveillance Cascade complex in Escherichia coli. Nature 515:147–150 18. Hayes RP, Xiao Y, Ding F et al (2016) Structural basis for promiscuous PAM recognition in type I–E Cascade from E. coli. Nature 530: 499–503 19. Xiao Y, Luo M, Hayes RP et al (2017) Structure basis for directional R-loop formation and substrate handover mechanisms in type I CRISPR-Cas system. Cell 170:48–60.e11 20. Xiao Y, Luo M, Dolan AE et al (2018) Structure basis for RNA-guided DNA degradation by Cascade and Cas3. Science 361:eaat0839 21. Loeff L, Brouns SJJ, Joo C (2018) Repetitive DNA reeling by the Cascade-Cas3 complex in nucleotide unwinding steps. Mol Cell 70:385– 394.e3 22. Wada N, Osakabe K, Osakabe Y (2022) Expanding the plant genome editing toolbox with recently developed CRISPR–Cas systems. Plant Physiol 188:1825–1837 23. Cameron P, Coons MM, Klompe SE et al (2019) Harnessing type I CRISPR–Cas

38

Naoki Wada et al.

systems for genome engineering in human cells. Nat Biotechnol 37:1471–1477 24. Dolan AE, Hou Z, Xiao Y et al (2019) Introducing a Spectrum of long-range genomic deletions in human embryonic stem cells using type I CRISPR-Cas. Mol Cell 74:936– 950.e5 25. Morisaka H, Yoshimi K, Okuzaki Y et al (2019) CRISPR-Cas3 induces broad and unidirectional genome editing in human cells. Nat Commun 10:5302 26. Tan R, Krueger RK, Gramelspacher MJ et al (2022) Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Mol Cell 82:852–867.e5

27. Osakabe K, Wada N, Murakami E et al (2021) Genome editing in mammalian cells using the CRISPR type I-D nuclease. Nucleic Acids Res 49:6347–6363 28. Osakabe K, Wada N, Miyaji T et al (2020) Genome editing in plants using CRISPR type I-D nuclease. Commun Biol 3:648 29. Ueta R, Abe C, Watanabe T et al (2017) Rapid breeding of parthenocarpic tomato plants using CRISPR/Cas9. Sci Rep 7:507 30. Abe-Hara C, Yamada K, Wada N et al (2021) Effects of the sliaa9 mutation on shoot elongation growth of tomato cultivars. Front Plant Sci 12:627832

Chapter 3 CRISPR/LbCas12a-Mediated Genome Editing in Soybean Dawei Liang, Yubo Liu, Chao Li, Qin Wen, Jianping Xu, Lizhao Geng, Chunxia Liu, Huaibing Jin, Yang Gao, Heng Zhong, John Dawson, Bin Tian, Brenden Barco, Xiujuan Su, Shujie Dong, Changbao Li, Sivamani Elumalai, Qiudeng Que, Ian Jepson, and Liang Shi Abstract Currently methods for generating soybean edited lines are time-consuming, inefficient, and limited to certain genotypes. Here we describe a fast and highly efficient genome editing method based on CRISPRCas12a nuclease system in soybean. The method uses Agrobacterium-mediated transformation to deliver editing constructs and uses aadA or ALS genes as selectable marker. It only takes about 45 days to obtain greenhouse-ready edited plants at higher than 30% transformation efficiency and 50% editing rate. The method is applicable to other selectable markers including EPSPS and has low transgene chimera rate. The method is also genotype-flexible and has been applied to genome editing of several elite soybean varieties. Key words Soybean transformation, Soybean genome editing, CRISPR-LbCas12a, Genotype-independent transformation, Fast transformation, Plant selectable marker gene

1

Introduction Soybean (Glycine max) is an important food and feed crop. Soybean is also used in numerous industrial applications including biodiesel, ink, paint, adhesive, and many other products [1]. The worldwide production was estimated to be around 380 million metric tons in year 2021–2022 season; Brazil and the United States are the two top producing countries with 144 and 120 million metric tons, respectively [2]. In the United States, narrow germplasm availability has limited soybean breeding potential [3]. In order to expand the genetic diversity of soybean to meet the increasing demand, many academic labs and biotech companies have applied transgenic and genome editing technologies to complement conventional breeding methods for novel trait development [4–6]. Through transgenic technology, one or more trait genes can be introduced into a crop directly, giving rise to a transgenic plant with the

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

39

40

Dawei Liang et al.

desirable trait(s) [7]. These traits could increase insect resistance, herbicide tolerance, oil content, and abiotic or biotic tolerance, all of which lead to enhanced crop productivity [8]. The first soybean gene-edited product – high-oleic soybean oil – has also been successfully released to the market in the United States in 2019 [9]. Despite the development of efficient transient assays such as protoplast system for evaluation of constructs and editing machineries [10], generation of stable transgenic events and/or genomeedited lines is essential for the development of both genome-edited (GE) and conventional transgenic or genetic modification (GM) products. The technology for achieving this purpose is generally referred to as plant transformation. The two well-established approaches used for large-scale soybean transformation are the following: (i) Agrobacterium-mediated transformation [11–15] and (ii) particle bombardment [16–18]. In order to select for transgenic events during the tissue culture process, regardless of the delivery system utilized, a selectable marker gene is introduced along with a trait(s) of interest [19]. There are about fifty selectable marker genes available for transgenic event generation [19], and some of the widely used selectable marker genes in soybean include hygromycin B phosphotransferase (HPT), aminoglycoside adenylyltransferase (aadA/SpecR for spectinomycin resistance), phosphinothricin acetyltransferase (PAT), and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and acetolactate synthase (ALS) [19]. Currently, Agrobacterium-mediated transformation of explants derived from imbibed mature seeds remains the most efficient method for large-scale soybean transgenic event production operations [12–15, 20, 21]. These methods, despite with different methods of preparing and treating explant tissues, are targeting axillary meristems of the cotyledonary nodal region for efficient delivery of transgenes and regeneration of transgenic plants. There are many reports of incremental improvements of soybean transformation since their initial publications [11–14] by optimizing many factors, including soybean variety, explant source, explant preparation, wounding method, and delivery conditions, such as Agrobacterium strain selection, addition of antioxidants, infection time, coculture condition, selectable marker/selection agent, basal salts, hormonal combination for shoot elongation and rooting, and rooting method [13, 14, 22–29]. Recently, CRISPR-Cas9 has been used to generate targeted mutagenesis in soybean via Agrobacterium-mediated transformation [21, 30, 31 and other papers reviewed 6, 32]. Targeted insertion in soybean has also been achieved via biolistic delivery [33] and Ochrobactrum haywardense-mediated delivery [34]. LbCas12a (from Lachnospiraceae bacterium ND2006, formerly called LbCpf1) and AsCas12a (from Acidaminococcus sp. BV3L6, formerly called AsCpf1) RNPs have also been shown to mediate efficient targeted mutagenesis of soybean genes (GmFAD2) in protoplasts [35]. LbCas12a has been

CRISPR-LbCas12a-Mediated Soybean Genome Editing

41

successfully used to demonstrate efficient multiplexed targeted mutagenesis and large chromosomal segment deletions in hairy roots and protoplasts [36, 37]. However, so far, there is no report of heritable Cas12a-mediated genome editing with stable transgenic soybean plants. In this protocol article, we focus on Agrobacterium-mediated transformation and gene editing with CRISPR-LbCas12a utilizing either aadA (aka SpecR) marker gene cassette with spectinomycin selection or acetolactate synthetase gene (NtALS) from tobacco as marker gene cassette with bensulfuron-methyl (BSU) selection. The described soybean transformation method was modified from a previously described explant preparation method using imbibed mature seeds as an explant source [24]. Explants were infected, transgenic shoots regenerated and directly rooted in soil [26]. The method is fast and takes only about 45 days to produce greenhouse ready shoots; it has high transformation efficiency and a low chimera rate. The described CRISPR-LbCas12a expression vectors also result in a high editing efficiency.

2

Materials

2.1 Laboratory Supplies

1. Standard personal protection equipment (PPE) including safety glasses with side shield, gloves, and lab coats. 2. Spray bottle. 3. 50 mL presterilized disposable centrifuge tubes. 4. 15–20 cm long straight forceps. 5. Scalpels with #10 and #11 surgical blades. 6. Sterile disposable serological pipettes (5, 10, 25, and 50 mL). 7. Sharps box for disposal of scalpel blades. 8. Containers and autoclave bags – for disposal of biological waste and transgenic materials. 9. Petri dishes – 100
15 mm, 100
25 mm and 150
25 mm. 10. Phytatray II™ – 114
86
102 mm. 11. PhytoCon 16 oz. culture vessels or similar (Phytotechnology Laboratories product # C215, 115 mm diameter
70 mm height). 12. Sterile Whatman filter paper 85 mm diameter or equivalent. 13. Plastic transparent Flambeau® K801 box (32.39
21.59
5.40 cm) for holding cultures in Petri dishes. 14. Disposable sterile pipette tips (200 and 1000 μL). 15. Disposable sterile 10 μL inoculation loop. 16. 96-well blocks prefilled with steel bead for tissue sampling and grinding.

42

2.2

Dawei Liang et al.

Equipment

1. Fume hood. 2. Laminar flow hood. 3. Autoclave. 4. Dissecting microscope. 5. Timer with alarm. 6. Orbital shaker. 7. Vortex mixer. 8. Microcentrifuge. 9. Standard duty dry vacuum piston pump, Welch 2522C-02 preferred. 10. Desiccator or desiccator cabinet. 11. Sonicator/ultrasonic multi-cleaner, Honda W-113 preferred. 12. Spectrophotometer. 13. Incubator – set to 22  C for cocultivation in the dark. 14. Conviron® growth chamber or equivalent walk-in lightroom – set to 24  C with 16 h of light and 8 h of dark.

2.3 Chemicals, Media Recipes, and Reagents

1. Ethanol 95% and 70%.

2.3.1

4. MS basal salt mixture.

Chemicals

2. Gamborg’s B5 basal salt mixture. 3. Gamborg’s B5 vitamins (1000
). 5. Purified agar. 6. Pluronic™ F-68 (10%).

2.3.2

Media

1. YPC medium: 5 g/L yeast extract, 10 g/L peptone, 5 g/L NaCl, 1 g/L calcium chloride dehydrate (CaCl2*2H2O), 15 g/L Bacto Agar, pH to 6.8, and appropriate antibiotics. Add appropriate antibiotics after autoclaving and cooling to 50  C. Final concentration of antibiotics used in YPC: 25 mg/ L gentamicin, 50 mg/L kanamycin, 100 mg/L spectinomycin, and 10 mg/L tetracycline. 2. 1000
MS vitamins: 100 g/L myoinositol, 2 g/L glycine, 0.5 g/L nicotinic acid, 0.5 g/L pyridoxine hydrochloride, and 0.1 g/L thiamine-HCl. 3. 200
MS iron: 5.56 g/L FeSO4.7H2O, 7.46 g/L Na2EDTA. 4. SoyGerm: 3.1 g/L Gamborg’s B5 basal salt mixture, 1
Gamborg’s B5 vitamins 20 g/L sucrose, pH 5.6, 6.5 g/L purified agar. 5. SoyInf: 1.1 g/L MS basal salt mixture, 1
Gamborg’s B5 vitamins, 20 g/L sucrose, 10 g/L glucose, 4 g/L MES, pH 5.4, 2 mg/L zeatin riboside, trans isomers.

CRISPR-LbCas12a-Mediated Soybean Genome Editing

43

6. SoyCCM-2Zt: 2.15 g/L MS basal salt mixture, 1
Gamborg’s B5 vitamins, 20 g/L sucrose, 10 g/L glucose, 4 g/L MES, pH 5.4, 40 mg/L acetosyringone, 2 mg/L zeatin riboside, trans isomers. 7. SoyR1-1BSU: 3.1 g/L Gamborg’s B5 basal salt mixture, 1
Gamborg’s B5 vitamins, 30 g/L sucrose, 1 g/L MES, 1
MS iron, pH 5.6, 7.5 g/L purified agar, 1 mg/L BAP, 150 mg/L timentin, 75 mg/L cefotaxime, 50 mg/L vancomycin, 1 μM bensulfuron-methyl (BSU). 8. SoyR1-100Spec: 3.1 g/L Gamborg’s B5 basal salt mixture, 1
Gamborg’s B5 vitamins, 30 g/L sucrose, 1 g/L MES, 1
MS iron, pH 5.6, 7.5 g/L purified agar, 1 mg/L BAP, 150 mg/L timentin, 75 mg/L cefotaxime, 50 mg/L vancomycin, 100 mg/L spectinomycin. 9. SoyE1 0.3BSU: 4.3 g/L MS basal salt mixture, 30 g/L sucrose, 1
Gamborg’s B5 vitamins, 1
MS iron, 1 g/L MES, pH 5.6, 8 g/L purified agar, 50 mg/L glutamine, 50 mg/L asparagine, 0.5 mg/L zeatin riboside, trans isomers, 0.1 mg/L IAA, 1 mg/L GA3, 150 mg/L timentin, 75 mg/L cefotaxime, 50 mg/L vancomycin, 0.3 uM BSU. 10. SoyE1 75Spec: 4.3 g/L MS basal salt mixture, 1
Gamborg’s B5 vitamins, 30 g/L sucrose, 1
MS iron, 1 g/L MES, pH 5.6, 8 g/L purified agar, 50 mg/L glutamine, 50 mg/L asparagine, 0.5 mg/L zeatin riboside, trans isomers, 0.1 mg/L IAA, 1 mg/L GA3, 150 mg/L timentin, 75 mg/L cefotaxime, 50 mg/L vancomycin, 75 mg/L spectinomycin. 2.3.3

Other Supplies

1. Clorox® bleach. 2. Osmocote® dry fertilizer. 3. Soil: Fafard® germination mix and Fafard® 3B mix.

2.3.4 Disarmed Agrobacterium tumefaciens Strains

Binary vector in Agrobacterium tumefaciens strain EHA101 recA[38] or Chry5D3 recA- [39] is used for transformation. Agrobacterium culture is initiated weekly from –80  C freezer glycerol stock onto YPC plates containing appropriate antibiotics and grown in the 28  C incubator.

2.3.5 Transformation and Genome Editing Vectors

Binary vector contains expression cassettes for a codon-optimized LbCas12a, gRNA, and selectable marker gene (Fig. 1). The optimized LbCas12a is the same D156R mutant as described [40] with either Arabidopsis (vector 25333) or maize codons (vector 25335) but contains an optimized long linker 6
(GGGGS) between the SV40 NLS and LbCas12a at the N-terminus and another linker with 2 SV40 NLS sequences (GSPKK KRKVS GGSSG GSPKK KRKV) at the C-terminus for improved editing efficiency [41]. Vector 25333 has the gRNA sequence, 50 - GAACC CTTGA GAGAG

44

Dawei Liang et al.

Fig. 1 Diagram of T-DNA regions of binary transformation and editing vectors with aadA (SpecR) and ALS marker genes. (a) Soybean editing vector with aadA (SpecR) marker. (b) Soybean editing vector with ALS marker. RB, right border; LB, left border; pGmUbi1, soybean ubiquitin-1 promoter; prAtEF1a, Arabidopsis elongation factor 1a promoter; prGmEF1, soybean elongation factor 1 promoter; tNos, nopaline synthase terminator; tPsE9, pea RuBisco E9 terminator; tGmEPS, soybean EPSPS terminator; eFMV, FMV enhancer; aadA, spectinomycin resistance gene; NtALS, tobacco ALS gene with double mutations (W191A and W568L) conferring sulfonylurea resistance; LbCas12a, Arabidopsis (25333) or maize (25335) codon-optimized Cas12a nuclease gene from Lachnospiraceae bacterium ND2006 (LbCas12a); crRNA, CRISPR RNA comprised of the scaffold and spacer (gRNA) sequence; HH, hammerhead ribozyme; HDV, hepatitis delta virus ribozyme

GCTTC TTC-30 , for targeting GmFAD2 and vector 25335 has the gRNA sequence, 50 - GTAAG AAGCT CTTCA CCGTT CCA-30 , for targeting GmPDS (Fig. 1a). Please note that chloroplast transit peptide (CTP) is not essential for aadA as the selectable marker in soybean, but the lack of it may result in some reduction in the overall transformation and editing efficiency (Table 1). For editing vector with acetolactate synthase (ALS) marker (Fig. 1b), the overall configuration is similar, except that aadA gene is replaced with a soybean codon-optimized tobacco SurB gene (Uniprot ID P09114 with double mutant (P191A, W568L) [42]. crRNA sequence (scaffold and guide) is flanked by hammerhead (HH) and HDV ribozymes (Fig. 1) [43]. 2.3.6

Plant Materials

Syngenta elite soybean variety 06KG218440 is used for regular transformation and genome editing if not specified. Public lines like Jack and Williams 82 have also been tested with the protocol before with a similar high efficiency. Several other elite Syngenta varieties (NE1306802, NE0800097, LR1500228, BW1600439, CE1405112, and CS1702846) have also been tested for this protocol with high transformation efficiency.

CRISPR-LbCas12a-Mediated Soybean Genome Editing

45

Table 1 Representative transformation frequency and editing rate

Marker Vector gene

No. of No. of transgenic Editing target explants events

No. of Transformation edited frequency (TF %) events

Editing rate (%)

24959 aadA N/A (CTP)

1220

439

36.0

N/A

N/A

25333 aadA GmFAD2-1a, (+CTP) GmFAD21b

332

143

43.1

134, 135

93.5%, 94.6%

25335 aadA GmPDS-a, (+CTP) GmPDS-b

742

282

38.0

166, 160

58.9%, 56.7%

25098 NtALS

N/A

477

184

38.6

N/A

N/A

27059 NtALS

GmSH2

1697

582

34.3

448

77.0%

3 3.1

Methods Seed Sterilization

1. Well-dried soybean seeds are passed through test sieves, and seeds that are much smaller than average are discarded. For most genotypes, typically seeds that go through the 5.6 mm screen are discarded. The remaining seeds are placed in Petri dishes as a monolayer for sterilization, discarding seeds that are broken, misshapen, or green. Seeds with a light-colored seed coat without discoloration are preferred (see Note 1). 2. Petri dishes containing seeds are placed with lids open inside a desiccator, which is placed inside a chemical fume hood. If ambient humidity is low (70%, approaching 80% by hand calculated hemocytometer estimates. This automated protocol improves on previous techniques through implementation of a 96-well pipette pod for large-scale simultaneous transfection, built-in centrifugation steps to reduce runtime, and the use of a secondary Span-8 pod for randomization of samples following transfection. The protocol provides detailed description of the automated procedure to facilitate translation to different liquid handler models and software. Also included are methods for

132

Stephen B. Rigoulot et al.

analysis of gene editing and fluorescence-based experiments as well as important consideration for both. This automated procedure has streamlined the protoplast transfection process and has been demonstrated to reduce researchers’ time while improving efficiency and result quality.

2 2.1

Materials Equipment

1. Growth chamber (dark room). 2. Vacuum desiccator. 3. Vacuum source capable of -30 inch of water (i.e., 55.9936 mm Hg). 4. Centrifuge with swing bucket rotor or equivalent that has 96-well plate and 50 mL tube adapters. 5. Platform shaker incubator. 6. Beckman Coulter Biomek FXP Dual-Arm System automated liquid handler or equivalent with comparable functionality that has both 96-well multichannel pipettor and Span-8 pipettors. 7. Inverted fluorescent microscope with EGFP/FITC/Cy2/ Alexa Fluor 488 filter or equivalent for visualizing GFP transfection control. 8. Microcentrifuge. 9. Vortex mixer. 10. Thermal cycler. 11. Gel electrophoresis system with gel casting. 12. Gel documentation system. 13. ImageJ Software (https://imagej.nih.gov/ij/download.html).

2.2 Disposable Consumables

1. Potting tray insert – 36 cells – 6 × 6 nested and potting trays. 2. Redi-Earth Plug & Seedling Mix. 3. Disposable hemocytometer. 4. 40 μm cell strainers. 5. Petri dishes 100 × 25 mm. 6. Regular duty single edge blades. 7. Disposable centrifuge tube, sterile, polypropylene, 50 mL flat cap. 8. Microplate aluminum sealing tape. 9. 96-well, 2 mL, clear, V-shaped bottom, polypropylene assay block. 10. 96-well black/clear bottom microplate, TC surface.

Automated High-Throughput Protoplast Transfection

133

11. 96-well 1 mL, clear, round bottom, polypropylene assay block. 12. 96-round-well microplate storage mat, non-sterile. 13. Biomek™ FX/NX Robotic Tips. 14. Biomek™ Span-8 P1000 Tips. 15. PCR plate, 96-well, low profile, non-skirted. 16. PCR plate sealing mat. 17. Snap cap low-retention microcentrifuge tubes. 18. Vacuum filtration units (0.45 μm). 19. Autoclave bag for biological waste and transgenic materials. 20. Sharps box for disposal of blades. 21. Heating block. 2.3 Plant Materials, Enzymes, and Plasmids

1. Maize seeds of Syngenta inbred line NP2222. 2. Soybean seeds of Syngenta elite variety 06KG218440. 3. Cellulose RS. 4. Macerozyme R-10. 5. Bovine serum albumin (BSA). 6. Alt-R L.b. Cas12a (Cpf1) Ultra, 63 mM. 7. Alt-R L.b. Cas12a crRNA, freeze-dried. 8. Thermo Scientific Phire Plant Direct PCR Kit. 9. T7 endonuclease I (T7E1). 10. Plasmid pBSC11250 containing ZsGreen under the control of prCMP promoter was described previously [32].

2.4 Chemicals and Stock Solutions

1. Deionized (DI) water. 2. Germicidal bleach. 3. Tween-20. 4. β-mercaptoethanol or dithiothreitol (DTT). 5. 1 M mannitol. 6. 200 mM MES, pH 5.7. 7. 1 M CaCl2·2H2O. 8. 1 M MgCl2·6H2O. 9. 2.5 M NaCl. 10. PEG4000. 11. Low-EEO/multipurpose/molecular biology grade agarose. 12. Ethidium bromide solution (10 mg/mL). 13. Gel loading dye, purple (6×). 14. 100 bp DNA ladder.

134

Stephen B. Rigoulot et al.

2.5 Buffer and Enzyme Solutions

1. Enzyme solution (freshly prepared, 50 mL): 1.5% cellulase RS and 0.3% Macerozyme in 0.6 M mannitol, 10 mM MES (pH 5.7), 1 mM CaCl2, 0.1% (w/v) BSA, 0.5 mM β-mercaptoethanol, or DTT. 2. W5 buffer (40 mL): 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES (pH 5.7). Filter-sterilize and store @ 4 °C until ready to use. 3. MMg buffer (50 mL): 0.6 M mannitol, 15 mM MgCl2, 4 mM MES (pH 5.7). Filter-sterilize and store @ 4 °C until ready to use. 4. WI buffer (50 mL): 0.6 M mannitol, 4 mM MES (pH 5.7), 4 mM KCl. Filter-sterilize and store @ 4 °C until ready to use. 5. 40% (w/v) PEG solution (20 mL): 8 g PEG4000, 0.6 M mannitol, 100 mM CaCl2. Filter-sterilize immediately before use. Keep at 55 °C. 6. 10× TBE buffer (1 L): 1 M Tris, 0.9 M boric acid, and 0.01 M EDTA, and store at room temperature

3

Methods

3.1 Etiolated Maize Seedling Material Preparation

1. Maize seeds are surface-sterilized using 25% of commercial bleach (Clorox) solution with a few (5–6) drops of Tween-20 with gentle shaking (85 rpm) for 20–30 min. 2. Seeds are then rinsed with autoclaved DI water 3×. Seed sterilization is followed by an overnight soak in 16 h light conditions in deionized water at 25 °C. Autoclaved soil is dispensed into each well of a 36-cell (6 × 6 nested) tray insert. 3. Seeds are buried ~1 cm below the surface and then covered with soil. A layer of clay chips is added to absorb excess moisture. Seeds are germinated under continuous lighting for 3–4 days. When seedlings are Gels > Select first lane. If successful, the number “1” will appear in the selection area. 2. Drag the selection area over to the next lane to encompass all bands and mark using Analyze menu > Gels > Select next lane. If successful, the number “2” will appear in the selection area. Repeat for each lane in the row of the image. 3. Following the selection of the final lane, display the densitometry plots using Analyze > Gels > Plot lanes. 4. A window will appear displaying a histogram plot for each analyzed lane. For non-inverted DNA gel images, e.g., white on black background, histograms will display with downwardfacing peaks corresponding to each band. Select the Straight tool, and for each band of interest within each histogram, draw

140

Stephen B. Rigoulot et al.

a line across the base of the associated peak to convert the peak into a polygon. 5. When completed for each peak of interest, use the Wand tool and select in order each polygon within each lane, and repeat for every lane. A new Plots window will appear, which calculates the area of each selected polygon in the histogram. 6. Divide each band’s polygon area by the predicted size of the amplicon (in nucleotides) to obtain a normalized value. 7. To calculate T7E1 efficiency %, divide the normalized value of the larger cleavage product by that of the sum of the larger cleavage product and the substrate band (undigested band) and multiply by 100. 8. Under ideal T7E1 conditions, three bands will appear in each lane corresponding to the substrate amplicon and two smaller digest products of distinct sizes. Due to assay variability, co-migration of the smallest T7E1 product and PCR primer oligomers was occasionally observed. As a result, we calculated T7E1 efficiency for all lanes based solely on bands from the substrate and largest T7E1 product. 3.6 Fluorescence Analysis

Previous reports have looked at the application of fluorescence in rapid construct testing [1, 6, 21, 29], and while these experiments can be quick and fruitful, important considerations need to be made when employing them in protoplast assays. This method as well as others describes the visualization of protoplast transfected with fluorescent protein carrying constructs in clear bottom microplates. For presence/absence detection, no additional considerations need to be made; but for quantitative analyses, additional effort must be employed to ensure the interpretation and integrity of the results. Edge effect is a problem frequently experienced by users of multi-well plates in many scientific studies. This effect is based upon the observation that there is significant impact on performance based on the location of the well relative to the outside or edge of the plate. Whether these responses are due to temperature fluctuation or increased evaporation from wells bordering the outside of the plate is immaterial. Common solutions that include incubating plates on a temperature-regulated hotplate or filling the space between wells with water may not be amenable to high-throughput assays, as these may contribute toward the unintentional growth of fungus in protoplast samples or heatinduced cell death, detrimentally affecting the robustness of the result. Randomized complete block design (RCBD) of samples in an experiment can account for the contribution of the edge effect and distributes that effect across all samples without detriment to protoplast transfection (see Note 18). By equally distributing such confounding variables across treatment groups on average,

Automated High-Throughput Protoplast Transfection

141

randomization of treatments to experimental units is the distinguishing feature of the scientific experiment, as opposed to an observational study, enabling us to infer causality and not just correlation. Blocking is a form of restricted randomization we use when there is some reason, e.g., spatial or temporal correlation, to believe that experimental units within a block are more similar than experimental units from different blocks. A good blocking design reduces the estimate of the experimental error, thereby increasing the power for comparing different levels of the treatment of interest. This randomization can be accomplished on the Beckman Biomek FX or other comparable device with a Span-8 pipette pod. This pod features eight pipettes that can aspirate by column, and then each pipette can dispense independently in a new plate according to a predetermined plate layout. This type of protocol is called a Transfer from File (see Note 19). 1. Ahead of your transfection experiment, prepare a .csv file with two columns, “From” and “To.” According to the block design for the 96-well plate, assuming replicates of three for this example, assign one replicate for each of 32 constructs/ samples/controls to each block according to the complete block design depicted in Fig. 2a (see Note 20), e.g., A01 → D01, C10, E11, etc. 2. Load the deck layout with one tip box of 1 mL automated liquid handler pipette tips, the transfection plate from Subheading 3.3, step 13 (see Note 21) of the liquid handler automated transfection of protoplast protocol and the appropriate destination plate. The Transfer from File application will now move from the transfection layout (Fig. 2b) to the final randomized layout (Fig. 2c). If your liquid handler does not have a Span-8 pod, randomization can be done during the preparation of the transfection plate (see Note 22). This is easier to accomplish with constructs, but for time-sensitive sample preparation such as RNP/protein/RNA, this can be problematic. 3. Following transfer of protoplast using the randomization protocol to the clear bottom 96-well plate (see Note 23), cover and incubate in the dark at room temperature. 4. Quantification of intensity will be entirely dependent on the specific fluorescent proteins used (see Note 24). However, utilization of fluorescence microplate readers, such as the iD series from SpectraMax or the Cytation series from Biomek Agilent, can be used to rapidly analyze 96-well plates for fluorescence intensity (see Note 25). It is recommended to measure from the bottom of the microplate (see Note 26).

142

Stephen B. Rigoulot et al.

Fig. 2 Illustration of randomized complete block design (RCBD) for a 32-treatment, 3-replicate design in a 96-well plate. (a) RCBD blocking configuration. (b) Sample transfection layout. (c) An example of a randomization plate layout 3.7 Transfection of Soybean Immature Cotyledon Protoplasts

All protocols and procedures laid out within this chapter have been readily adapted and used with several protoplast systems. One such system follows the protocol established by Patil et al. [31] for protoplasts derived from immature soybean cotyledon but with some modifications. During the overnight digestion of immature cotyledon tissue, inclusion of 10 mM L-arginine as well as other standard digestion solution reagents (20 mM KCl, 10 mM CaCl2 and 0.1% BSA) improved protoplast transfection efficiency to ~70–80% with ZsGreen expression construct pBSC11250 [32] compared to the 44% maximum previously achieved (Fig. 3).

Automated High-Throughput Protoplast Transfection

143

Fig. 3 Improvement of soybean immature embryo fluorescence intensity and transfection efficiency with alterations to the digestion buffer. The bar chart on the left-hand side illustrates the fluorescence intensity of pBSC11250 transfected soybean protoplast for the different buffer solutions and increasing concentrations of plasmid. Buffer 1 represents the recommended digestion solution by Patil et al., 2022. For buffers 2 and 3, the added ingredients are included in the boxes on the right of the figure. Approximate transfection efficiency is included in the upper left of fluorescent images in white. Scale bar represents 50 μm

4

Notes 1. When preparing buffer solutions for protoplast transfection, W5, MMg, and WI buffers can be prepared in bulk in 50 mL centrifuge tubes or 100 mL containers and then kept at 4 °C until ready to use (remove 15–30 min before transfection). For best results, PEG solution should be prepared in a 55 °C water bath and filter-sterilized (0.45 um syringe filter or vacuum filter) immediately before use. You can sterilize earlier but return the PEG solution to 55 °C and remove 5–10 min prior to transfection. Transfection efficiencies are higher with fresh, warm PEG. 2. Figure 1 depicts the developmental continuum of etiolated maize leaf shown in days post sowing in soil. Both the first and second leaves of developing maize seedlings are amenable to transfection and display robust transfection efficiencies,

144

Stephen B. Rigoulot et al.

routinely achieving between 60% and 70% transfection as calculated by hand on hemocytometer. For best results, days 7–9 after sowing seeds produce the highest expression as indicated by the ZsGreen marker gene fluorescence intensity. 3. Typically, 1.5–2.0 g etiolated maize tissue routinely yields between 5 and 6 × 106 protoplasts per gram. For best results with the digestion, do not exceed 2 g fresh weight of leaf tissue per 25 mL of enzyme solution. For lesser fresh weight of leaf tissue, a 50 mL conical tube laid on its side works better. 4. A vacuum desiccator was used for this step, lid removed from the Petri dish. A vacuum was applied using a vacuum source capable of reaching -30 inch of water (-55.9936 mm Hg); this can be done using any vacuum source. 5. For RNP preparation [13]: (a) Reconstitute crRNAs to 50 mM concentration by adding appropriate amount of nuclease-free H2O to each crRNA and keep on ice. (b) Add 2.5 μL LbCas12a to the wells of the transfection plate. (c) Transfer crRNA to the appropriate wells. 3 μL is typically used for soybean experiments, which achieves a 1:1 Cas12a-crRNA molar ratio; 6 μL is typically used for corn experiments, which achieves a 1:2 Cas12a-crRNA molar ratio. (d) Spin the plate briefly up to 1200 × g prior to the protoplast addition step and keep on ice. (e) RNP can also be prepared ahead of time, but the best results are obtained with minimal freeze and thaw cycles. Keep samples frozen at -20 °C until ready to use. Thaw on ice and proceed directly to protoplast transfection within 30 min of thawing. 6. DNA constructs can be prepared in 96-well blocks ahead of time to minimize activities taking place on the day of transfection. The developers of this protocol prefer to add the aliquot of DNA to the wells of the 96-well, V-shaped, 2 mL, deep-well transfection plate, as this plate promotes a nice pellet formation following centrifugation during transfection and wash steps. This can be covered with microplate aluminum sealing tape and kept at -20 °C until ready to use. Plates should be defrosted by transferring to 4 °C on the day of experiment, but avoid longterm storage at 4 °C, as the water in the plasmid DNA solution may evaporate.

Automated High-Throughput Protoplast Transfection

145

7. Protoplast will settle to the bottom of any well or tube if left undisturbed. If using a trough and a multichannel pipette to add protoplast to wells already containing DNA or RNP (recommended), gently agitate the trough after adding to each column to make sure that protoplasts remain in suspension. 8. Transfection of protoplast using an automated liquid handler can be done using the 96-well head (recommended) or using the 8-span head. With the 96-well head, all reactions are treated simultaneously, which is important, as small deviations in PEG incubation time have been known to cause significant impact on the transfection reaction. Additionally, depending on the system, the hydraulic calibration of the 8-span is necessary for reliable and reproducible pipetting between each well handled by individual pipettes or between columns. 9. Wide bore pipette tips are required for the PEG addition step (Subheading 3.3, step 2), as this is a viscous fluid that can be difficult to pipette accurately with standard bore tips. Wide bore tips are recommended for remaining transfection steps but are not required. 10. While reservoirs can be purchased specifically for automated liquid handlers, these protocols were developed to use inverted tip box lids that are clean, disposable, and plentiful with the purchase of the required liquid handler tips. Make sure that these “reservoirs” are programmed on the device properly to allow for successful aspiration. Additionally, since the 96-well head pulls from the reservoir, there must be more than required of the buffer to do the transfection. If only providing the required amount, only a proportion of tips can draw the correct amount of liquid. For PEG aspiration 40 mL is required; for W5 and WI steps, it is 100 mL. 11. Depending on the type of experiment, the destination plate can be a microplate or some variation of the deep-well 96-well plate. Developers of this protocol would recommend for applications independent of visualization, that 1 mL round bottom plates be used. This plate has a silicone lid that can be purchased to cover the 96-well plate during incubation to prevent evaporation of buffer causing crystallization of the protoplast sample and cell death, which will detrimentally affect the outcome of the experiment. 12. This is the only step where any of the transfection solutions are added directly to the protoplast/DNA/RNP containing volume. Subsequent dilution steps are added at the top of the well, since the larger volumes require multiple transfer steps using the 200–250 μL pipette tips, and adding solutions in this way reduces the potential for contamination between wells.

146

Stephen B. Rigoulot et al.

This can obviously be avoided by using 1 mL tips for W5- and WI-related steps, which will also reduce the protocol run time. 13. User pauses in the protocol allow the operator to carefully remove the transfection plate and put it into a centrifuge. Centrifugation prior to supernatant aspiration greatly minimizes protoplast loss during those steps. To avoid substantial protoplast loss, we designed the protocol to have a series of buffer dilutions instead of complete removals, such that by the end of the protocol, the solution remaining is largely favorable to protoplast survivability. 14. A 24 h incubation is sufficient for RNP-mediated genome editing; a 48 h incubation is recommended for genome editing with machinery expressed from transfected plasmid DNA. 15. At this point, the samples can be stored at -20 °C. Thaw the plate on ice and centrifuge at 1000 × g before proceeding to PCR when resuming the protocol after freezing. 16. A master mix can be premade before adding T7E1 endonuclease cocktail to annealed PCR products. 17. For the original description of this measurement methodology, please consult: https://web.archive.org/web/202011250251 59/https://di.uq.edu.au/community-and-alumni/sparq-ed/ sparq-ed-services/using-imagej-quantify-blots 18. While illustrated for fluorescence measurement, these RCBD designs can be created for other experimental types and are recommended if edge effect is a pervasive factor for other plate types or assays. 19. For the “Transfer from File” command on the Biomek, a.csv file is required. This may be unique for this model/maker. Consult with the operators’ manual for the precise file requirement if utilizing other liquid handler systems. 20. A randomized incomplete block design in which the entire outer edge defines block 1 would also be a reasonable choice. Unlike the RCBD, the incomplete design would not allow for equal representation of all 32 treatment groups in each block (i.e., 1 replicate per block), but the blocks would be spatially uniform. 21. If proceeding from transfection to randomization, disable the aspirate/dispense mixing/transfer step (Subheading 3.3, steps 15 and 16) before initiating the transfection protocol. Transfection and randomization were developed as separate protocols on the liquid handler but could potentially be combined in future iterations of the protocol.

Automated High-Throughput Protoplast Transfection

147

22. These protocols were written with the randomization taking place following transfection, since it was more convenient to prepare construct DNA/RNP according to an ordered layout instead of the randomized order. For example: Construct one in wells A01, A02, and A03 instead of D01, C10, E11, etc. 23. Black microplates with clear bottom are recommended for fluorescence assays, while luminescence utilizes a white microplate. 24. Numerous fluorescent proteins have been successfully detected in plant transient assay individually or in higher-order combinations [3]. To determine the optimal excitation/emission for fluorescent marker genes of interest, databases such as FPBase. org can be a good resource. 25. These microplate readers are mentioned specifically as they have, through a feature called “multimode acquisition,” the capability to take multiple measurements per well. Because protoplasts are “settled” on the bottom, users will need to be careful about movements that would promote clumps or clusters of cells, which may skew the fluorescent measurement. Since these microplates can take multiple measurements per well, these replicate measurements can be averaged to better represent individual well intensity. 26. The advantage of clear bottom microplates is that they are designed such that readings from the bottom are less influenced by differences in liquid consistency, volume per well, etc. Readings from the top of the plate are also feasible; just be careful of any factors (such as those mentioned) that would negatively contribute to the interpretation of the results.

Acknowledgments The authors would like to thank our colleagues Zhongying Chen, Kasi Azhakanandam, Joshua Cohn, Julie Green, Heng Zhong, and Siva Elumalai for suggestions on protoplasts and transient assays and Ling Zhu, Melissa Murray, Xia Liu, Merle Terry, Eric Bumann, and Changbao Li for help with plasmid DNA, molecular analysis, and plant care. We also thank Tim Kelliher, Liang Shi, Ian Jepson, and Gusui Wu for their advice and support for this research.

Competing Interest Statements The authors are employed by Syngenta, a developer of transformation and editing technologies, seed products with conventional transgenic (GM), and genome-edited (GE) trait products.

148

Stephen B. Rigoulot et al.

References 1. Wroblewski T, Tomczak A, Michelmore R (2005) Optimization of Agrobacteriummediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnol J 3:259–273. https://doi.org/10. 1111/j.1467-7652.2005.00123.x 2. Matsuo K, Fukuzawa N, Matsumura T (2016) A simple Agroinfiltration method for transient gene expression in plant leaf discs. J Biosci Bioeng 122(3):251–256. https://doi.org/10. 1016/j.jbiosc.2016.02.001 3. Rigoulot SB, Schimel TM, Lee JH, Sears RG, Brabazon H, Layton JS, Li L, Meier KA, Poindexter MR, Schmid MJ, Seaberry EM, Brabazon JW, Madajian JA, Finander MJ, Dibenedetto J, Occhialini A, Lenaghan SC, Stewart CN Jr (2020) Imaging of multiple fluorescent proteins in canopies enables synthetic biology in plants. Plant Biotechnol J 19:830–843. https://doi.org/10.1111/pbi. 13510 4. Lacroix B, Citovsky V (2020) Biolistic approach for transient gene expression studies in plants. In: Rustgi S, Luo H (eds) Biolistic DNA delivery in plants. Methods in Molecular Biology, vol 2124. Humana, New York. https://doi.org/10.1007/978-1-07160356-7_6 5. Sheen J (1991) Molecular mechanisms underlying the differential expression of maize pyruvate, orthophosphate dikinase genes. Plant Cell 3:225–245. https://doi.org/10.1105/tpc.3. 3.225 6. Chatukuta P, Rey MEC (2020) A cassava protoplast system for screening genes associated with the response to South African cassava mosaic virus. Virol J 17:184. https://doi.org/ 10.1186/s12985-020-01453-4 7. Zhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2(2):100168. https://doi.org/10.1016/j.xplc.2021. 100168 8. Woo JW, Kim J, Kwon SI, Corvalan C, Cho SW et al (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162– 1164. https://doi.org/10.1038/nbt.3389 9. Malnoy M, Viola R, Jung M-H, Koo O-J, Kim S, Kim J-S et al (2016) DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Front Plant Sci 7:1904. https://doi.org/10. 3389/fpls.2016.01904

10. Lin CS, Hsu CT, Yang LH, Lee LY, Fu JY, Cheng QW et al (2018) Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnol J 16:1295–1310. https://doi.org/10.1111/ pbi.12870 11. Murovec J, Gucˇek K, Bohanec B, Avbelj M, Jerala R (2018) DNA-free genome editing of Brassica oleracea and B. rapa protoplasts using CRISPR-Cas9 ribonucleoprotein complexes. Front Plant Sci 9:1594. https://doi.org/10. 3389/fpls.2018.01594 12. Zhang Y, Cheng Y, Fang H, Roberts N, Zhang L, Vakulskas CA, Niedz RP, Culver JN, Qi Y (2022) Highly efficient genome editing in plant protoplasts by ribonucleoprotein delivery of CRISPR-Cas12a nucleases. Front Genome Ed 4:780238 13. Dong S, Qin YL, Vakulskas CA, Collingwood MA, Marand M (2021) Efficient targeted mutagenesis mediated by CRISPR-Cas12a ribonucleoprotein complexes in maize. Front Genome Ed 3:670529. https://doi.org/10. 3389/fgeed.2021.670529 14. Metje-Sprink J, Menz J, Modrzejewski D, Sprink T (2019) DNA-free genome editing: past, present and future. Front Plant Sci 9: 1957. https://doi.org/10.3389/fpls.2018. 01957 15. Sandhya D, Jogam P, Allini VR et al (2020) The present and potential future methods for delivering CRISPR/Cas9 components in plants. J Genet Eng Biotechnol 18:25. https://doi.org/10.1186/s43141-02000036-8 16. Cocking EC (1960) A method for the isolation of plant protoplasts and vacuoles. Nature 187: 9 6 2 – 9 6 3 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / 187962a0 17. Tanaka I, Kitazume C, Ito M (1987) The isolation and culture of lily pollen protoplasts. Plant Sci 50:205–211. https://doi.org/10. 1016/0168-9452(87)90075-6 18. Ortiz Ramirez C, Arevalo ED, Xu X, Jackson DP, Birnbaum KD (2018) An efficient cell sorting protocol for maize protoplasts. Curr Protoc Plant Biol 3(3):e20072. https://doi. org/10.1002/cppb.20072 19. Schweiger R, Schwenkert S (2014) Proteinprotein interactions visualized by bimolecular fluorescence complementation in tobacco protoplasts and leaves. J Vis Exp 9:51327. https:// doi.org/10.3791/51327

Automated High-Throughput Protoplast Transfection 20. Yue JJ, Yuan JL, W FH, Yuan YH, Cheng QW, Hsu CT, Lin CS. (2021) Protoplasts: from isolation to CRISPR/Cas genome editing application. Front Genome Ed 3:717017. https://doi.org/10.3389/fgeed.2021. 717017 21. Bargmann BOR, Birnbaum KD (2009) Positive fluorescent selection permits precise, rapid, and in-depth overexpression analysis in plant protoplasts. Plant Physiol 149:1231–1239. https://doi.org/10.1104/pp.108.133975 22. Gao L, Shen G, Zhang L, Qi J, Zhang C, Ma C, Li J, Wang L et al (2019) An efficient system composed of maize protoplast transfection and HPLC–MS for studying the biosynthesis and regulation of maize benzoxazinoids. Plant Methods 15:144. https://doi.org/10.1186/ s13007-019-0529-2 23. Gilliard G, Huby E, Cordelier S, Ongena M, Dhondt-Cordelier S, Deleu M (2021) Protoplast: a valuable toolbox to investigate plant stress perception and response. Front Plant Sci 12:749581. https://doi.org/10.3389/ fpls.2021.749581 24. Jorres T, Tonnies J, Wrightsman T, Buckler ES, Cuperus JT, Fields S, Queistch C (2021) Synthetic promoter designs enabled by a comprehensive analysis of plant core promoters. Nat Plants 7:842–855. https://doi.org/10.1038/ s41477-021-00932-y 25. Lenaghan SC, Stewart CN Jr (2018) An automated protoplast transformation system. In: Qi Y (ed) Plant genome editing with CRISPR systems, Methods in Molecular Biology, vol 1917. Humana Press, New York. https://doi. org/10.1007/978-1-4939-8991-1_26 26. Occhialini A, Nguyen MA, Dice L, Pfotenhauer AC, Sultana MS, Neal Stewart Jr C, Lenaghan SC (2022) High-throughput

149

transfection and analysis of soybean (Glycine max) protoplasts. Methods Mol Biol 2464: 245–259. https://doi.org/10.1007/978-10716-2164-6_17 27. Mann DGJ, Bevan SA, Harvey AJ, LeffertSorenson RA (2019) The use of an automated platform to assemble multigenic constructs for plant transformation. In: Kumar S, Barone P, Smith M (eds) Transgenic Plants, Methods in Molecular Biology, vol 1864. Humana Press, New York. https://doi.org/10.1007/978-14939-8778-8_2 € Thurow K (2010) Future and 28. Kolukisaoglu U, Frontiers of automated screening in plant sciences. Plant Sci 178(6):476–484. https:// doi.org/10.1016/j.plantsci.2010.03.006 29. Cao J, Yao D, Lin F, Jian M (2014) PEG-mediated transient gene expression and silencing system in maize mesophyll protoplasts: a valuable tool for signal transduction study in maize. Acta Physiol Plant 36:1271– 1281. https://doi.org/10.1007/s11738014-1508-x 30. Sant’Ana RRA, Caprestano CA, Nodari RO, Agapito-Tenfen SZ (2020) PEG-delivered CRISPR-Cas9 ribonucleoproteins system for gene-editing screening of maize protoplasts. Genes 11:1029. https://doi.org/10.3390/ genes11091029 31. Patil GB, Stupar RM, Zhang F (2022) Protoplast isolation, transfection, and gene editing for soybean (Glycine max). Methods Mol Biol 2464:173–186. https://doi.org/10.1007/ 978-1-0716-2164-6_13 32. Wenck A, Pugieux C, Turner M et al (2003) Reef-coral proteins as visual, non-destructive reporters for plant transformation. Plant Cell Rep 22:244–251. https://doi.org/10.1007/ s00299-003-0690-x

Part III Transgene-Free Delivery of Machinery

Chapter 10 Delivery of CRISPR-Cas12a Ribonucleoprotein Complex for Genome Editing in an Embryogenic Citrus Cell Line Hong Fang, James N. Culver, Randall P. Niedz, and Yiping Qi Abstract Clustered regularly interspaced short palindromic repeats (CRISPR) technology is a powerful genome editing tool. Recently developed CRISPR-Cas12a system confers several advantages over CRISPR-Cas9, making it ideal for use in plant genome editing and crop improvement. While traditional transformation methods based on plasmid delivery pose concerns associated with transgene integration and off-target effects, CRISPR-Cas12a delivered as ribonucleoproteins (RNPs) can effectively alleviate these potential issues. Here we present a detailed protocol for LbCas12a-mediated genome editing using RNP delivery in Citrus protoplasts. This protocol provides a comprehensive guideline for RNP component preparation, RNP complex assembly and delivery, and editing efficiency assessment. Key words CRISPR-Cas12a, Ribonucleoproteins, Transgene-free, Genome editing, Citrus, Embryogenic cell line, Protoplast transformation

1

Introduction Targeted genome editing is a technology to introduce site-specific changes within target genomic sequences. When editing, DNA nucleases are guided specifically to a target locus in a chromosome, produce double-strand breaks (DSBs) in the DNA, and use the existing cellular DNA repair machinery to introduce mutations [1]. In comparison with the earlier genome editing approaches based on protein recognition of specific DNA sequences including zinc finger nucleases (ZFN) [2] and transcription activator-like effector nucleases (TALEN) [3], the efficiency and ease of using RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR) [4–6] genome editing has made it a popular and widely used technology. A type of CRISPR endonucleases derived from Prevotella and Francisella 1 (CRISPR-Cpf1, also named Cas12a) is a class II type V endonucleases [7]; they have been used in plant genome editing

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_10, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

153

154

Hong Fang et al.

since 2016 [8]. The Cas12a system, like the most widely used Cas9 genome editing system [9], typically involves two components: a guide CRISPR RNA (crRNA) and a Cas12a endonuclease. The crRNA component contains a 19- to 20 nt direct repeat (DR) scaffold sequence and a 23 nt targeting or protospacer sequence. The Cas12a protein binds to crRNA and generate double-strand breaks (DSBs) at the target site of DNA [7]. Compared to the CRISPRCas9-based genome editing system, the CRISPR-Cas12a system has several advantages. First, with the Protospacer Adjacent Motif (PAM) requirement of “TTTV” or “TTV,” CRISPR-Cas12a system can target promoter regions and other T-rich gene coding regions [7]. Second, CRISPR-Cas12a system requires a shortened ~43 nt crRNA as the guide RNA that is much easier to synthesis and multiplex [10–12]. Additionally, Cas12a cuts 18–23 bp downstream of the PAM site, creating 4–5 bp staggered overhangs that can facilitate homology-directed repair (HDR) and nonhomologous end joining (NHEJ)-mediated gene insertion or replacement [7, 13]. Finally, Cas12a is smaller than Cas9, which might facilitate viral delivery [7]. With these advantages over CRSPR-Cas9, CRISPR-Cas12a technology is an area of intense study for plant genome editing. The CRISPR technology is a powerful tool for plant genome editing and shows promise for crop improvement. But the use of CRISPR for plant genome editing still has a lot of regulatory uncertainty in whether the edited plants will be regulated as genetically modified organisms (GMOs) [14]. Although small insertions and deletions (indels) or substitutions induced by CRISPR-Cas editing system are indistinguishable from naturally existing genetic variation, traditional DNA-based delivery methods like Agrobacterium tumefaciens-mediated transformation will inevitably introduce foreign DNA sequences into the host genome. Also, it is not feasible or very time-consuming to remove these foreign DNA sequences by conventional crossing and segregation in asexually propagated species such as potato and Citrus or plants that have long juvenile phase such as poplar [15]. Using non-integrating plasmids for plant cell transfection is another approach to delivery CRISPR systems. Unfortunately, after being degraded by endogenous nucleases in cells, the remaining small DNA fragments of transfected plasmids can still somehow be inserted into the genome of host cells [16]. Thus, both Agrobacterium tumefaciens-mediated transformation and plasmid-based transfection may introduce undesirable foreign DNA sequences into host genomes. In plants, delivery of preassembled Cas12a protein-gRNA ribonucleoproteins (RNPs) instead of DNAs encoding these components would eliminate the possibility of recombinant DNA being inserted into host cells [17]. RNP delivery has multiple advantages [18]. Firstly, RNP delivery can eliminate the need for transgenes in genome-edited crops, thereby minimizing the regulatory concerns

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

155

Fig. 1 Cas12a/crRNA-based genome editing in Citrus protoplast. (a) Preparation of Cas12a/crRNA RNP complex. The Cas12a/crRNA RNP used in this protocol consists of a crRNA that is transcribed from a synthesized duplexed dsDNA template and a recombinant Cas12a endonuclease expressed by E. coli. (b) Cas12a/crRNA RNP is delivered to Citrus protoplasts. (c) Cas12/crRNA-mediated genome editing. The PAM site is highlighted in red font color. The cleavage site indicated by red triangles is located in the recognition region of a selected restriction endonuclease, which is highlighted in yellow

associated with transgene. Secondly, the use of RNPs can bypass the transcription and translation processes of cells, thereby increasing the efficiency of site targeting and genome editing. Thirdly, RNP delivery is transient, and the delivered RNP will be degraded in a short time, which greatly reduces the possibility of off-target effects. In addition, RNP delivery could provide efficiency-tunable genome editing by adjusting dosages of RNPs. Moreover, multiple crRNAs that targeting different sites can be complexed with Cas12a to allow simultaneous multiplexed genome editing. Finally, RNP delivery may benefit from possible protein and/or RNA modifications in order to achieve genome editing outcomes that are not possible through DNA or virus delivery. For these reasons, RNP-based CRISPR delivery has now been successfully tested in various plant species, including wheat, soybean, tobacco, rice, lettuce, Citrus, and Arabidopsis [15, 18–20]. In this chapter, a detailed Cas12a/crRNA-based RNP preparation protocol (Fig. 1) that includes Cas12a endonuclease and crRNA preparation will be described. Here, we use Citrus protoplasts derived from an embryogenic cell line as a model system for target gene knockout using a Cas12a/crRNA-based RNP system. The preassembled Cas12a/crRNA RNP is transfected into Citrus protoplasts to facilitate the knockout of the CsPH5 gene [21]. The restriction fragment length polymorphism (RFLP) method, also known as the cleaved amplified polymorphism sequence (CAPS), is used to evaluate the editing efficiency.

156

Hong Fang et al.

Table 1 List of primers used in this experiment Primer

Sequence, from 5′ to 3′

Purpose

Cas12a-seq1

CGGTGATGTCGGCGATATAG

Sequence checking

Cas12a-seq2

TCAACGGATTCACAACAGCATTCA

Sequence checking

Cas12a-seq3

GAATGGAACGTGATCAGAGACAAA

Sequence checking

Cas12a-seq4

ACGATCCTGAGGTATGGTTC

Sequence checking

Cas12a-seq5

CTTGTAGTCCACCCTGCGAATAGT

Sequence checking

Cas12a-seq6

CGGCGGCGCACTCAAAGGTTAC

Sequence checking

CsPH5-target-F

AACCCTCTGAGTCACGAGTC

Target editing analysis

CsPH5-target-R

GCAAAAAAGAGCTAGCCCAC

Target editing analysis

2

Materials 1. Citrus embryogenic cell line (Citrus sinensis, cv. Hamlin), maintained in suspension culture. 2. Annotated genomic sequence of targeted gene(s). The genomic sequence information for the CsPH5 gene (NCBI Gene ID: LOC102616096) used in this study can be found at the National Center for Biotechnology Information (NCBI). 3. Genome editing gRNA/crRNA design software or websites for gRNA design for Cas12a mediated editing, including CRISPR-P v2.0 [22], CRISPRdirect [23], and Benchling (https://benchling.com). 4. Plasmids. All plasmids mentioned in this protocol are available from Addgene (https://www.addgene.org): pYPQ230 (#86210) and pET27b + R (# 188245). 5. DNA oligonucleotides primers (Table 1). 6. Synthesized duplexed DNA as crRNA transcription template. 7. Chemically competent cells of Escherichia coli DH5α and BL21 (DE3). 8. Molecular grade water for molecular reactions. 9. DEPC-treated water for RNA involved solution preparation. 10. 100% ethanol. 11. LB medium: 1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) sodium chloride, 1.5% (w/v) agar for preparing solid LB plates. 12. IPTG solution: 1 M.

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

157

13. 6 × His-tag binding buffer: 50 mM NaH2PO4-H2O, 500 mM NaCl, pH 8.0. 14. Washing buffer: 50 mM NaH2PO4-H2O, 500 mM NaCl, 20 mM imidazole, pH 8.0. 15. Elution buffer: 50 mM NaH2PO4-H2O, 500 mM NaCl, 250 mM imidazole, pH 8.0. 16. Tris dialysis buffer: 250 mM NaCl, 0.1 mM EDTA, 20 mM Tris-HCl, pH 7.4, 1 mM DTT, and 10% (v/v) glycerol. 17. Sodium acetate solution: 3 M, pH 5.2. 18. Cell wall digestion solution: 0.6 M mannitol, 10 mM CaCl2, 10 mM MES buffer, 0.75% (w/v) Cellulase Onozuka RS (Yakult Honsha, Tokyo, Japan), 0.75% (w/v) Macerozyme R-10 (Yakult Honsha, Tokyo, Japan), 0.1% BSA, pH 5.6. 19. W5 buffer: 2 mM MES, 5 mM KCl, 154 mM NaCl, 125 mM CaCl2, 5 mM glucose, pH 5.8. 20. MMG buffer: 0.4 M mannitol, 4 mM MES, 15 mM MgCl2, pH 5.8. 21. PEG transfection buffer: 0.1 M CaCl2, 0.2 M mannitol, 40% (w/v) PEG 4000, pH 5.8. 22. NEB buffer 3.1 (10×) for RNP assembly. 23. Ni-NTA resin for protein purification. 24. Restriction enzymes and their respective reaction buffers: NcoI, NotI, and EarI. 25. T4 DNA ligase and corresponding buffer. 26. T7 in vitro transcription kit. 27. Q5 polymerase PCR kit. 28. Plant direct PCR kit. 29. Silica column-based gel purification kit, for example, the QIAquick Gel Extraction Kit. 30. Plasmid miniprep kit, for example, IBI scientific Hi-Speed Mini Plasmid Kit. 31. 10 mL gravity flow column, 50 kDa MWCO 15 mL centrifugal filter units. 32. Neubauer improved hemocytometer. 33. Protein SDS-PAGE equipment and supplies. 34. Agarose gel electrophoresis equipment and supplies. 35. DNA quantification equipment, for example, NanoDrop™ One UV-visible spectrophotometer. 36. Sonication system.

158

3

Hong Fang et al.

Methods

3.1 Preparation of LbCas12a Nuclease

3.1.1 LbCas12a Expression Vector Construction

The LbCas12a nuclease preparation protocol includes the construction of expression plasmid and the expression and purification of LbCas12a nuclease. The gene of LbCas12a from Lachnospiraceae bacterium ND2006 is derived from the donor vector, pYPQ230, and expressed from a pET-based T7 promotercontaining plasmid (pET27b + R) in the Escherichia coli strain BL21 (DE3). The recombinant LbCas12a construct contains a N-terminal 6 × His-tag, followed by a tobacco etch virus (TEV) protease cleavage site, a 5 × GS linker, a SV40 nuclear localization signal (NLS), the LbCas12a sequence spanning residues 1–1368, and a C-terminal nucleoplasmin NLS (see Note 1). The expressed fusion protein can be purified with His6-tag affinity chromatography. With the TEV protease cleavage site, 6 × His-tag can be eliminated after protein purification. 1. Digest LbCas12a donor plasmid and empty expression vector plasmid. Digest pYPQ230 and pET27b + R with both NcoI and NotI restriction enzymes and incubate samples for 4 h at 37 °C (Table 2). Confirm the successful digestion with agarose gel electrophoresis. The bands of target fragments digested from the plasmids are expected at the size of 3864 bp for Cas12a gene, and 5367 bp for digested pET27b + R backbone. Purify the digested Cas12a gene fragment (3864 bp) and digested pET27b + R backbone (5367 bp) from excised agarose gel with a gel purification kit. 2. Ligate the digested recombinant Cas12a gene fragment into pET27b + R backbone. Incubate ligation mixture (Table 3) at room temperature for 2 h (see Note 2). Transform E. coli DH5α chemically competent cells with all the ligation mixture using heat shock method. Inoculate cells on solid LB medium containing 50 mg/L kanamycin and culture for overnight at 37 °C. Table 2 Cas12a donor plasmid and expression vector plasmid restriction digestion Component

Volume

pYPQ230 or pET27b+

15 μL (2 μg)

NEB CutSmart buffer (10×)

2 μL

NcoI

1 μL

NotI

1 μL

dH2O

1 μL

Total

20 μL

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

159

Table 3 Cas12a expression plasmid ligation Component

Volume

NcoI and NotI digested pET27b + vector

4 μL (80 ng)

NcoI and NotI digested Cas12a insert fragment

4 μL (80 ng)

T4 DNA ligase buffer (10×)

1 μL

T4 DNA ligase (400 U/μL)

1 μL

Total

10 μL

3. Pick one or two colonies from the solid LB medium and incubate them in about 5 mL liquid LB medium containing 50 mg/L kanamycin at 37 °C with 250 rpm shaking for overnight. Use a miniprep kit to isolate the plasmid DNA from each cell culture. 4. Confirm the successful ligation of Cas12a into expression vector by Sanger sequencing using sequence checking primers (Table 1), and make sure that the open reading frame is correct. 3.1.2 LbCas12a Protein Expression and Isolation

Day 1: Cell transformation. 1. Transform E. coli BL21 (DE3) chemically competent cells (see Note 3) with 1 μL (100 ng) of sequencing confirmed LbCas12a expression plasmid using heat shock method. Inoculate cells on solid LB medium containing 50 mg/L kanamycin, and incubate overnight at 37 °C with 250 rpm shaking. Day 2: Culture growth and induction 2. Inoculate a single colony from the solid LB medium in 5 mL of liquid LB medium containing 50 mg/L kanamycin. Incubate the liquid culture at 37 °C for 8 h or overnight with 250 rpm shaking. 3. In a 500 mL flask, inoculate 150 mL of fresh LB medium containing 50 mg/L kanamycin with 3 mL of the overnight culture. Incubate the culture at 37 °C with 250 rpm shaking for 2–3 h until the optical density (OD600) reaches 0.6–0.8. 4. Chill the 150 mL of E. coli cell culture to about room temperature, and induce the expression by adding 0.75 mL of 1 M IPTG to the cell culture to reach a final IPTG concentration of 0.5 mM. Incubate the E. coli cell culture at room temperature with 250 rpm shaking for overnight (see Note 4).

160

Hong Fang et al.

Day 3: Cell harvest and LbCas12a purification 5. Harvest cells by centrifugation at 3000 × g for 20 min at 4 °C and discard the supernatant. Resuspend the cells using 20 mL of ice-chilled 6 × His-tag binding buffer in a 50 mL conical tube (see Note 5). 6. Lyse the resuspended cells using a sonication system with 12 cycles of 5 s of sonication (amplitude of 50) followed by a 10 s pause. The cells should be lysed in ice water bath (see Note 6). 7. Centrifuge to clarify the lysate in 50 mL conical tubes at 10,000 × g for 20 min at 4 °C. Collect the supernatant. 8. Isolate expressed recombinant Cas12a from the crude extract using HisPur™ Ni-NTA Resin according to the manufacturers’ instructions. 9. All the following steps should be performed in a cold room or at 4 °C. Equilibrate 2 mL His-Select Ni-NTA Resin bedded in a 10 mL gravity flow column with 10 mL 6 × His-tag binding buffer. Load the cell lysate on the column slowly. 10. Wash the resin with 20 mL washing buffer. Elute with about 20 mL elution buffer and collect in 1.5 mL fractions. Pool peak fractions with high protein concentration according to Bradford assay [24]. 11. Change buffer and concentrate the isolated Cas12a protein in Tris dialysis buffer with a 15 mL centrifugal filter unit (50 kDa molecular weight cutoff). Adjust the concentration of Cas12a solution to 10 mg/mL (66.67 μM) with Tris dialysis buffer. Analyze the purified LbCas12a protein using SDS-PAGE (see Note 7). 12. Prepare 50 μL aliquots of the concentrated protein sample, and freeze in liquid nitrogen. Preserved LbCas12a protein at 80 °C can maintain activity for several months. 3.2 Preparation of crRNA

The crRNA used for LbCas12a-based RNP delivery is synthesized using an in vitro T7 transcription kit. The transcription template in this protocol is a duplexed DNA containing a T7 promoter sequence upstream of the crRNA sequence (Fig. 2d, see Note 8). The following protocol is used to prepare the crRNA for RNP-based delivery. 1. Dissolve lyophilized duplexed DNA with DEPC-treated water (DEPC–H2O) to a final concentration of 5 μM. The sequence of synthesized duplexed DNA is designed to be the transcription template of crRNA (Fig. 2, Table 4, see Note 9).

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

161

Fig. 2 Sequence information for crRNA transcription. (a) Sequence of crRNA target site withing Citrus genome. PAM site is highlighted in red, a recognition region of a selected restriction endonuclease that is highlighted in yellow for RFLP assay. (b) The 23 nt crRNA guiding sequence. (c) Sequence of the entire crRNA including the 20 nt direct repeat (DR) sequence and the 23 nt crRNA guiding sequence. (d) The sequence of crRNA transcription template. The 20 nt T7 promoter region is highlighted in green. Transcription coding region is indicated with an underline. (e) The entire synthesized duplexed dsDNA as the transcription template. (f) Sequence of crRNA transcript. Target region and its corresponding guiding sequences are aligned in the lightyellow box

2. Set up an in vitro transcription reaction by mixing the reagents according to Table 5. Incubate the mixture for 2 h at 37 °C. After incubation, add 1 μL of TURBO DNase to the reaction, mix well, and incubate at 37 °C for 15 min to remove DNA template (see Note 10). 3. Purify the crRNA transcript using the alcohol precipitation method (see Note 11). Add 115 μL DEPC-treated H2O and 15 μL sodium acetate solution (3 M, pH 5.2) into transcription mixture, and mix thoroughly in a clean 1.5 mL microcentrifuge tube. Precipitate the crRNA transcript by mixing with 300 μL of prechilled 100% ethanol (-20 °C) and chilling the mixture for 30 min at -20 °C.

crRNA guiding sequence

Entire crRNA sequence

crRNA transcription template sequence

crRNA transcript sequence

5′-TTTGGCCCCA 5′-GCCCCAAC 5′-TAATTTCTACTGT 5′-TAATACGACTCACTATAGGG 5′-GGGUAAUUUCUACUGUUG TAATTTCTACTGTTGTAGATGC ACAAGCTAGA AAGCTAGAA TGTAGATGCCCCA UAGAUGCCCCAACA AGAGAAA-3′ GAGAAA-3′ ACAAGCTAGAAG CCCAACAAGCTAGA AGCUAGAAGAGAAA-3′ AGAAA-3′ AGAGAAA-3′

crRNA target sequence with PAMa

PAM sequence is highlighted in red

a

CsPH5

Target gene

Table 4 Sequence information for crRNA in vitro transcription

162 Hong Fang et al.

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

163

Table 5 In vitro transcription mixture preparation Component

Volume (μL)

T7 reaction buffer (10×)

2

T7 ATP solution (75 mM)

2

T7 CTP solution (75 mM)

2

T7 GTP solution (75 mM)

2

T7 UTP solution (75 mM)

2

crRNA template DNA (5 μM)

1

T7 enzyme mix

2

DEPC-H2O

7

Total

20

4. Pellet precipitated crRNA transcript with centrifugation at 4 °C for 15 min at maximum speed (≥10,000 × g). Remove the supernatant and resuspend the crRNA in DEPC-H2O. Adjust the final concentration of crRNA to 66.67 μM (see Note 12). 5. Preserve the crRNA solution at -80 °C. 3.3 LbCas12a-RNPMediated Genome Editing in Transfected Citrus Protoplasts

3.3.1 Citrus Protoplast Isolation and RNP Transfection

With the purified Cas12a nuclease and crRNA transcript, RNP complex can be preassembled in vitro. The Cas12a/crRNA RNP will be transfected into Citrus protoplasts for genome editing. In this section, methods of Citrus protoplasts isolation, RNP-based protoplast transfection, and genome editing efficiency assay are described in detail. 1. From the suspension Citrus cell culture (see Note 13), harvest about 1 mL of packed cell volume (PCV) of Citrus embryogenic cells (Citrus sinensis, cv. Hamlin), and drain the cells by letting the cells settle down in a 50 mL conical tube and removing the supernatant (see Note 14). 2. Digest plant cell walls. Resuspend the cells in 5 mL of filtersterilized cell wall digestion solution and incubate at room temperature for 15–18 h in the dark with gentle shaking (60 rpm). 3. Assemble RNP complex according to Table 6 (see Note 15). First, mix 2 μL of Cas12a protein solution (66.67 pmol/μL) with 4 μL of crRNA solution (66.67 pmol/μL) in a clean PCR tube on ice. Then, add 2 μL of NEB buffer 3.1 (10×) and 12 μL

164

Hong Fang et al.

Table 6 RNP assembly mixture preparation Component

Volume (μL)

Cas12a solution (66.67 pmol/μL)

2

crRNA solution (66.67 pmol/μL)

4

NEB buffer 3.1 (10×)

2

DEPC–H2O

12

Total

20

of DEPC–H2O into the mixture to a final volume of 20 μL. Leave the mixture at room temperature for 10 min for assembly to occur (see Note 16). 4. Use a laminar hood to perform the following steps. Place a 40 μm Falcon Cell Strainer on top of a new 50 mL conical tube, and wet the strainer filter with 1 mL of W5 buffer. Filter all 5 mL of enzymatic hydrolysate (see Note 17). 5. Spin down the collected protoplasts with low-speed centrifugation (100 × g) for 5 min. 6. Carefully remove the supernatant and wash the protoplasts by resuspending in 5–10 mL of fresh W5 buffer (see Note 18). Precipitate protoplasts by centrifugation at 100 × g for 5 min. Repeat this washing step twice. After the final washing, resuspend protoplasts in MMG buffer to a final protoplast density of 1 × 106 protoplasts per milliliter as determined by hemocytometer. 7. Mix 200 μL protoplasts solution with 20 μL RNP solution in a 2 mL round-bottom microcentrifuge tube by gently tapping on the tube (see Note 19). 8. Add 220 μL PEG transfection buffer into the mixture and gently tap the tubes to mix. Incubate the mixture at room temperature in the dark for 30 min. 9. After incubation, add 900 μL of W5 buffer, gently tap on the tubes to mix, and centrifuge for 5 min at 200 × g. 10. Remove 1 mL of the supernatant, and resuspend the protoplasts in the remaining solution by gently tapping on the tubes. 11. Transfer the protoplast solutions into 12-well plates containing 1 mL per well of W5 buffer. Incubate the plate for 48 h at 28 °C in the dark.

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

165

Table 7 PCR reaction mixture preparation for genome editing analysis

3.3.2 Analysis of LbCas12a RNP-Mediated Genome Editing in Citrus Protoplasts

Component

Volume (μL)

Q5 reaction buffer (5×)

10

dNTPs (10 mM)

1

Forward primer: CsPH5-target-F (5 μM)

5

Forward primer: CsPH5-target-R (5 μM)

5

Template DNA (protoplast solution)

1

Q5 polymerase

0.5

ddH2O

27.5

Total

50

1. After the incubation, transfer the protoplast solution from 12-well plates into 1.5 mL microcentrifuge tubes. Pellet protoplasts by centrifugation for 5 min at 10,000 × g. 2. Remove supernatant and resuspend protoplast pellet in 30 μL of dilution buffer (from Thermo Scientific Phire Plant Direct PCR kit). Resuspended protoplasts can be stored at -80 °C. 3. Using the resuspended protoplast solution as template, PCR amplify the target region where the RNP-mediated editing occurs with primers CsPH5-target-F and CsPH5-target-R (Table 7, see Note 20). 4. Verify the PCR amplification with agarose gel electrophoresis, and purify the PCR products with commercial PCR cleanup kits. 5. Perform restriction digestion on 5 μL of purified PCR product with EarI (see Note 21). 6. Analyze EarI digestion mixtures using agarose gel electrophoresis. If the genome editing is successful, the EarI recognition site (Fig. 1c) would be destroyed, and restriction digestion will not happen. On the contrary, if the RNP-mediated genome editing failed, the EarI recognition (restriction) site is still present and the digestion will occur. Compare the digestion results with positive and negative controls (two WT genomic DNA samples digested with and without the addition of EarI). 7. Use image analysis software (e.g., ImageJ) to evaluate the intensities of the uncut DNA band (738 bp) and two cut DNA fragments (313 bp and 425 bp). Calculate the RNP-mediate editing efficiency as the ratio of uncut band against all three bands (see Note 22).

166

4

Hong Fang et al.

Notes 1. Include both NLS sequences in the LbCas12a gene. NLS is necessary for LbCas12a to enter the nucleus where genome editing happens and therefore contribute to higher genome editing efficiency. 2. Time duration of incubation for ligation can be as short as 10 min at room temperature or as long as overnight at 16 °C. After incubation, ligation reaction can be terminated by heating the reaction mixture for 10 min at 65 °C. Heat inactivation is unnecessary if ligation mixtures are not used in transformation immediately after ligation. 3. Other E. coli expression strains (Rosetta 2 DE3, BL21, BL21 CodonPlus, and BL21 Pyls S, for instance) can also be used for Cas12a expression. In this protocol, we use BL21 (DE3) strain, because it was found that the expression of LbCas12a in BL21 (DE3) strain produced a higher yield than in either BL21 CodonPlus or BL21 Pyls S strain under the same induction and incubation conditions. 4. To increase the protein yield and avoid the formation of insoluble inclusion bodies, a long-term incubation (8–14 h) at low incubation temperature (25 °C or room temperature) with low IPTG induction level (0.5 mM as the final concentration) is recommended. 5. The resuspended cells can be either used immediately for further protein purification or flash frozen in liquid nitrogen and preserved at -80 °C for several months without diminishing the activity of the Cas12a nuclease. 6. Sonication process will generate heat that may denature the expressed Cas12a. Applying short sonication cycle while keeping the lysate on ice with frequent and gentle shaking is recommended. 7. When using SDS-PAGE to analyze the purity of isolated Cas12a, the expected molecular weight of expressed fusion Cas12a is around 150 kDa. Western blot assay with anti-His antibodies can be used to identify the fusion Cas12a as well. To eliminate the potential influence of His6-tag on RNP assembly or genome editing, TEV protease treatment can be applied. However, there is no evidence indicating any negative effect of His6-tag on Cas12a enzymatic activity in our study. Therefore, TEV protease cleavage is an optional step for Cas12a preparation.

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

167

8. Short transcription template like crRNA can be prepared from synthetic duplexed DNA (Fig. 2e, Table 4). Using duplexed DNAs as transcription templates for crRNA preparation is relatively economic compared to direct purchase of synthetic RNA oligonucleotides as the crRNA, especially for multiple crRNA preparation. 9. The sequence of synthesized duplexed DNA contains three parts arranged in 5′ to 3′ order: a 20 nt T7 promoter sequence (5′-TAATACGACTCACTATAGGG-3′), a 20 nt CRISPR direct repeat (DR) sequence (5′-TAATTTCTACTGTTGTAG AT-3′) and a 23 nt designed targeting sequence (5′-G CCCCAACAAGCTAGAAGAGAAA-3′) (Fig. 2e). In general, any DNA led by a T7 promoter can be utilized as a template for in vitro transcription. A minimum 18 nt T7 promoter sequence (5′-TAATACGACTCACTATAG-3′) is required. The addition of two Gs at the 3′-end of T7 promoter sequence (Fig. 2d) in this protocol is recommended for highly efficient transcription. Terminator sequence is not necessary for in vitro transcription, since the transcription will be terminated by template runoff. The sequence of crRNA transcript is listed in Table 4. Following T7 promoter is the real crRNA template that consists of a 20 nt direct repeat (DR) sequence and a 23 nt designed targeting sequence (Fig. 2c). The 23 nt targeting sequence plays an important role in leading Cas12a to the target site and facilitating target DNA cleavage. The targeting sequence (Fig. 2b) used in this protocol is targeting the second exon of CsPH5 gene (NCBI Gene ID: LOC102616096, Fig. 2a). A few principles should be considered when designing the targeting sequence: (a) To knockout a protein-coding gene, the target site of crRNA is optimally located at the exon regions. In this study, the DNA double-strand break generated by Cas12a nuclease cleavage is most likely to induce NHEJ-mediated indels in the second exon region that would eventually cause the target gene disruption in having a frame-shift mutation. (b) For plant genome editing, the target protospacer sequence for Cas12a system is usually 23 bp, following a Cas12a PAM sequence 5′-TTTV-3′. Either leading or lagging strand can be targeted by designed crRNAs. (c) For genome editing detection using RFLP, the recognition site of selected restriction enzyme must overlap the Cas12a cleavage site, which is usually located 13–23 bp downstream of the PAM site (Fig. 1c).

168

Hong Fang et al.

(d) crRNA design software or websites can be utilized to predict the editing efficiency. Extreme GC content in crRNA sequence (less than 30% or more than 70%) and highly potential secondary structures of crRNA should be avoided. 10. An RNase-free environment is necessary for RNA-related experiments. Wearing gloves and using RNase-free plasticware and filter pipette tips are strongly recommended. Use nucleasefree or DEPC-treated water to prepare all reagents. If necessary, RNase inhibitors can be added into transcription reactions to avoid RNA degradation. 11. Other RNA purification methods including phenolchloroform method, centrifugal filter concentration, and gel purification can be alternative methods. Due to the small size (about 40 nt) of crRNA transcript (Fig. 2f, Table 4), glass filterbased column purification suitable for >100 nt RNA is not recommended. 12. For convenience, the final molar concentration of crRNA is adjusted to the same as purified Cas12a mentioned in Subheading 3.1.2. 13. Embryogenic Citrus suspension culture cells (Citrus sinensis, Hamlin) are maintained in liquid MT (Murashige & Tucker) media [25] supplemented with 50 μM 6-benzylaminopurine and subcultured every 3 weeks. Cells in good status, having clear culture medium with whitish colored callus cells that are well separated and not in large clumps, should be used for protoplast isolation. 14. To obtain 1 mL of drained cells, about 2–4 mL of cell suspension culture is required. Use wide-mouth or precut 1 mL pipette tips to transfer cell suspension culture into a 50 mL conical tube because the cell clusters are too large to pass through uncut 1 mL pipette tips. Leave the transferred cell suspension culture on bench top for about 3 min to settle down all the cells. Discard the supernatant, and drain the cells by inserting an uncut 1 mL pipette tip to the bottom of the 50 mL conical tube and withdrawing culture media slowly. 15. The molar ratio of Cas12a to crRNA in this method is 1:2. Different concentrations of RNP with the same ratio of Cas12a to crRNA can be prepared to perform adjustable genome editing efficiency. Theoretically, a 1:1 ration should facilitate configuration of the RNP complex with a minimum waste of either component. Nevertheless, more crRNA is recommended because of concerns of potential degradation.

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts

169

16. The RNP complex should be prepared prior to the transfection and used immediately. Although Cas12a and crRNA are relatively stable in the form of RNP, long-term storage is not recommended. 17. It is possible that fragile protoplasts can be damaged by shear forces. In order to reduce shear forces when transferring protoplasts using pipettes, pipette tips should be cut prior to sterilization to create a larger opening at the tip. When straining the protoplasts, angle the conical tube so that the solution flows along the walls of the tube rather than dropping directly onto the bottom. 18. After centrifugation at a low speed, Citrus protoplasts will form a loose fluffy white pellet in white to yellowish color. To avoid disturbing the fluffy pellet, retain about 0.5–1 mL solution when removing the supernatant. You may repeat the W5 buffer washing step to dilute and get rid of the enzyme solution. When adding solutions to protoplasts, angle the 50 mL conical tube so that the solution flows along the walls of the tube. 19. Usually, at least three replications of protoplast transfection are performed to obtain statistically reliable results. For a negative control, treat a sample of protoplast with the same amount of water instead of RNP solution. For a mock control, treat a sample of protoplast with the same amount of either crRNAonly solution or Cas12a-only solution. 20. In this study, primers CsPH5-target-F and CsPH5-target-R are designed to PCR amplify the editing-target-containing region with a size of 738 bp. To use the RFLP method to access editing efficiency, the amplified region should be no less than 500 bp. 21. Based on the concentration of purified PCR products, you can adjust the applied amount in the restriction enzyme digestion reaction. PCR products can be cut into two fragments of 313 and 425 bases by EarI restriction endonuclease. 22. When PCR amplification or restriction digestion cannot detect a low genome editing efficiency directly, enrichment PCR can be used. Before PCR amplification, restriction digestion with EarI is performed following successful DNA isolation. As a result, most unedited target DNA is cleaved. Only remaining uncut target DNA can be PCR amplified. Therefore, by detecting full size of PCR product, the successful editing at target site can determined. Even though enrichment PCR results may be difficult to quantify, they can indicate the occurrence of genome editing when compared to WT genomic DNA controls.

170

Hong Fang et al.

Acknowledgments This work was supported by the Emergency Citrus Disease Research and Extension Program (award no. 2020-7002933161) from the US Department of Agriculture and the Crop of the Future Collaborative Program (award no. 21010111) from the Foundation for Food and Agriculture Research. References 1. Zhan X, Lu Y, Zhu J, Botella JR (2021) Genome editing for plant research and crop improvement. J Integr Plant Biol 63:3–33 2. Kim Y-G, Cha J, Chandrasegaran S (1996) Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc Natl Acad Sci 93:1156–1160 3. Boch J, Bonas U (2010) Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol 48:419–436 4. Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821 5. Garneau JE, Dupuis M-E`, Villion M et al (2010) The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468:67–71 6. Jansen R, van JDA E, Gaastra W, Schouls LM (2002) Identification of genes that are associated with DNA repeats in prokaryotes. Mol Microbiol 43:1565–1575 7. Zetsche B, Gootenberg JS, Abudayyeh OO et al (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163:759–771 8. Endo A, Masafumi M, Kaya H, Toki S (2016) Efficient targeted mutagenesis of rice and tobacco genomes using Cpf1 from Francisella novicida. Sci Rep 6:1–9 9. Cong L, Ran FA, Cox D et al (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–823 10. Fonfara I, Richter H, Bratovicˇ M et al (2016) The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature 532:517–521 11. Zetsche B, Heidenreich M, Mohanraju P et al (2017) Multiplex gene editing by CRISPR– Cpf1 using a single crRNA array. Nat Biotechnol 35:31–34

12. Wang M, Mao Y, Lu Y et al (2017) Multiplex gene editing in rice using the CRISPR-Cpf1 system. Mol Plant 10:1011–1013 13. Tang X, Lowder LG, Zhang T et al (2017) A CRISPR–Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants 3:1–5 14. Jones HD (2015) Regulatory uncertainty over genome editing. Nat Plants 1:1–3 15. Woo JW, Kim J, Kwon SI et al (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162–1164 16. Kim S, Kim D, Cho SW et al (2014) Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res 24:1012–1019 17. Cho SW, Lee J, Carroll D et al (2013) Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9–sgRNA ribonucleoproteins. Genetics 195:1177–1180 18. Zhang Y, Cheng Y, Fang H et al (2022) Highly efficient genome editing in plant protoplasts by ribonucleoprotein delivery of CRISPR-Cas12a nucleases. Front Genome Ed 4:780238 19. Liang Z, Chen K, Yan Y et al (2018) Genotyping genome-edited mutations in plants using CRISPR ribonucleoprotein complexes. Plant Biotechnol J 16:2053–2062 20. Kim H, Kim ST, Ryu J et al (2017) CRISPR/ Cpf1-mediated DNA-free plant genome editing. Nat Commun 8:14406 21. Shi C-Y, Song R-Q, Hu X-M et al (2015) Citrus PH5-like H+-ATPase genes: identification and transcript analysis to investigate their possible relationship with citrate accumulation in fruits. Front Plant Sci 6:135 22. Liu H, Ding Y, Zhou Y et al (2017) CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol Plant 10:530– 532

Cas12a-Mediated Genome Editing Using RNP Delivery in Citrus Protoplasts 23. Naito Y, Hino K, Bono H, Ui-Tei K (2015) CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 31:1120–1123 24. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of

171

protein-dye binding. Anal Biochem 72:248– 254 25. Murashige T (1969) Growth factor requirements of citrus tissue culture. In: Proceedings of 1st international citrus symposium. ScienceOpen, Inc, pp 1155–1161

Chapter 11 Transgene-Free Genome Editing in Nicotiana benthamiana with CRISPR/Cas9 Delivered by a Rhabdovirus Vector Xiaonan Ma, Xuemei Li, and Zhenghe Li Abstract The clustered regularly interspersed short palindromic repeats (CRISPR)/Cas systems have become the most widely adopted genome editing platform owing to their unprecedented simplicity, efficiency, and versatility. Typically, the genome editing enzyme is expressed in plant cells from an integrated transgene delivered by either Agrobacterium-mediated or biolistic transformation. Recently, plant virus vectors have emerged as promising tools for the in planta delivery of CRISPR/Cas reagent. Here, we provide a protocol for CRISPR/Cas9-mediated genome editing in the model tobacco plant Nicotiana benthamiana using a recombinant negative-stranded RNA rhabdovirus vector. The method is based on infection of N. benthamiana with a Sonchus yellow net virus (SYNV)-based vector that carries the Cas9 and guide RNA expression cassettes to target specific genome loci for mutagenesis. With this method, mutant plants free of foreign DNA can be obtained within 4–5 months. Key words Genome editing, CRISPR/Cas9, Sonchus yellow net virus, Rhabdovirus, Delivery, Transgene-free, Nicotiana benthamiana

1

Introduction Genome editing technologies based on engineered programmable endonucleases, such as the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas nuclease, enable precise targeted modifications in plants and have revolutionized functional genomics research and crop improvement [1, 2]. Critical steps in applying genome editing to plants are introducing or delivering the CRISPR/Cas nuclease into plant cells and recovering mutant plants with heritable edits [3, 4]. CRISPR/Cas reagents are commonly delivered as transgenes into plant cells grown in culture via Agrobacterium-mediated transformation or particle bombardment. These transgenics-based approaches can only be applied to a limited number of transformable plant species and varieties [5, 6]. Furthermore, elimination of the transgene, a prerequisite for the commercialization of genome-edited plant progeny, involves lengthy sexual

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_11, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

173

174

Xiaonan Ma et al.

pSYNV-tgtRNA-Cas9 35S

L

AdhI G

M

sc4

P

Cas9

Bsu36I tgtRNA

sgRNA-sense TGCANNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNCAAA sgRNA-antisense

Bsu36I N

TGCATGAGACG......CGTCTCG GTTT tRNA ACGT Scaffold tRNA ACTCTGC......GCAGAGCCAAA BsmBI BsmBI

N

RZ

AdhI Cas9

pLB-GG-Scaffold

Fig. 1 Schematic representation of the pSYNV-tgtRNA-Cas9 vector and sgRNA cloning strategy. The pSYNVtgtRNA-Cas9 vector contains the full-length negative-sense genomic cDNA positioned between the 35S promoter and a hepatitis delta virus ribozyme (RZ). Two expression cassettes encoding the Streptococcus pyogenes Cas9 gene and sgRNA flanked by two pre-tRNAGly sequences (tgtRNA) were each placed downstream of a duplicated SYNV N/P gene junction sequence (red lines) and inserted between the N and P open reading frames. To facilitate Golden Gate-based cloning of sgRNA, we insert the Bsu36I-AhdI fragment containing the Cas9 and sgRNA coding regions into an intermediate cloning plasmid (pLB-GG-Scaffold) and engineer two BsmBI sites in place of the protospacer sequence. Two complementary oligos corresponding to a specific target site are annealed and inserted into pLB-GG-Scaffold via Golden Gate cloning, and then the assembled Bsu36I-AhdI fragment is subcloned into pSYNV-tgtRNA-Cas9 to produce a viral vector for targeting to a specific site

segregation. Therefore, the development of transgene-free delivery approaches has recently received considerable attention [7]. Plant viral vectors are valuable tools for transiently expressing foreign proteins and RNAs in a wide range of plant hosts [8], and some of these viral vectors have been repurposed for genome editing reagent delivery [9]. However, the large sizes of the commonly used Cas proteins exceed the packaging capacity of most of the developed viral vectors. Recently, we have engineered Sonchus yellow net virus (SYNV), a negative-stranded RNA virus, to deliver the entire CRISPR/Cas cassettes for transgene-free genome editing in N. benthamiana plants [10]. SYNV belongs to the genus Betanucleorhabdovirus, family Rhabdoviridae. The SYNV genome consists of a single-stranded, non-segmented, negative-sense RNA encoding six open reading frames in the order 3′-N-P-sc4-M-G-L5′ (Fig. 1) [11]. The linear, non-overlapping, modular organization of the rhabdovirus genome is particularly suited to vector development. Additional foreign gene expression cassettes can be readily engineered into the virus genome and be expressed under the control of duplicated viral gene junction sequences that contain necessary cis-elements for mRNA transcription [12, 13]. Furthermore, the virion structure and replication strategy of rhabdoviruses

Virus-Induced Genome Editing in N. benthamiana

175

also permit more stable maintenance of foreign inserts than most other types of viral vectors [14]. N. benthamiana is a wild tobacco species indigenous to northern Australia and has been extensively adopted as a model plant to study plant-pathogen interactions and defense signaling [15, 16]. Owing to its extreme amenability to Agrobacteriummediated transient protein expression, N. benthamiana is also embraced by plant biologists worldwide as an invaluable platform for investigating protein localization, protein interactions, and protein cellular and biochemical functions [15]. In addition, N. benthamiana has recently been gaining popularity as a chassis plant in metabolic engineering [17], synthetic biology [18], and molecular pharming [19]. Despite the broad utilities in plant science and biotechnology, genome editing in N. benthamiana is complicated by its complex allotetraploid genome with over 3.1 Gb in size [20]. In this chapter, we describe a step-by-step protocol for efficient transgene-free genome editing in N. benthamiana. The CRISPR/Cas reagent is delivered into intact plant through infection with an engineered SYNV vector to induce somatic mutations. Leaf tissues of the systemically infected plants are excised and cultured in vitro to regenerate plants with heritable genome modifications (Fig. 2). a

b

SYNV-tgtRNA -Cas9

p19

HcPro

c

d

SYNV-NPL

Jb PCR/RE

e

f

g

Sanger sequencing

Fig. 2 Overview of transgene-free genome editing in N. benthamiana with SYNV-delivered CRISPR/Cas9. (a) Binary constructs required for the recovery of recombinant SYNV vector are transformed into Agrobacterium cells. (b) Three young and fully expanded leaves (red arrows) of N. benthamiana plants are infiltrated with the Agrobacterium mixtures. (c) The agroinoculated plants exhibit typical SYNV symptoms about 2 weeks postinfiltration. The red rectangles denote leaf tissues used for mutation analysis. (d) Analysis of mutation pattern and frequency using the PCR/RE assay and Sanger sequencing. (e) Systemically infected leaf tissues are used as explants for tissue culture on shoot induction medium. (f) Examples of regenerated shoots are shown, with some shoots displaying an albino phenotype due to CRISPR/Cas-mediated mutagenesis of N. benthamiana PDS genes. (g) The regenerated green and albino shoots are transferred to rooting medium to establish roots

176

2

Xiaonan Ma et al.

Materials

2.1 Viral Vectors, Bacterial Strains, and Plant Materials

1. pSYNV-tgtRNA-Cas9 is a pCB301-based binary construct that contains the full-length negative-sense complementary DNA (cDNA) of the SYNV genome, in which two expression cassettes encoding the Streptococcus pyogenes Cas9 gene and the single guide RNA (sgRNA) were each placed downstream of a duplicated SYNV N/P gene junction sequence and inserted between the N and P genes [10] (see Note 1). The sgRNA sequence is flanked by two pre-tRNAGly sequences to recruit tRNA processing enzymes for precise sgRNA release from the primary viral transcript (Fig. 1) (see Note 2). 2. pGD-NPL is a pGD backbone plasmid designed for the tandem expression of SYNV N, P, and L core proteins driven by the 35S promoter [12] (see Note 3). 3. pGD-HcPro, pGD-p19, and pGD-γb are pGD-based binary vectors designed for expression of the three viral suppressors of RNA silencing, i.e., tobacco etch virus P1/HcPro, tomato bushy stunt virus p19, and barley stripe mosaic virus γb [21] (see Note 4). 4. pLB-GG-Scaffold is an intermediate cloning plasmid containing the Bsu36I-AdhI restriction fragment (~3.3 kb) derived from the pSYNV-tgtRNA-Cas9 plasmid, with the sgRNA protospacer sequence replaced by two BsmBI sites to facilitate Golden Gate-based cloning (Fig. 1) (see Note 5). 5. Escherichia coli (DH5α and Top10 strains)-competent cells. 6. Agrobacterium tumefaciens (GV3101 strain). 7. Seeds of N. benthamiana laboratory accession (LAB).

2.2 Molecular Cloning

1. High-fidelity DNA polymerase. 2. Restriction endonucleases: BsmBI, Bsu36I, and AhdI. 3. 10× NEB buffer 2 for oligo annealing. 4. Nuclease-free water. 5. Forward and reverse primers for Golden Gate-based sgRNA reconstruction. 6. Sanger sequencing primer for clone confirmation. • N/F 5′-CTACCAAACATACCGGACT-3′. 7. T4 DNA ligase and buffer. 8. Plasmid miniprep kit. 9. Gel extraction kit. 10. Antibiotic stock solutions: 100 mg/mL kanamycin; 100 mg/ mL ampicillin.

Virus-Induced Genome Editing in N. benthamiana

177

11. Luria-Bertani (LB) medium: 5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl. Add appropriate antibiotics when cooled to 55 °C. 12. 10× TBE buffer: 108 g/L Tris base, 55 g/L boric acid, 7.4 g/L EDTA. Dilute to 0.5× with Milli-Q H2O before use. 13. Agarose. 14. 1 kb ladder DNA marker. 2.3

Agroinoculation

1. Infiltration buffer: 10 mM 2-(N-morpholino)ethanesulfonic acid (MES, pH 5.6), 10 mM MgCl2, 200 μM acetosyringone. 2. Yeast Extract Peptone (YEP) medium: 10 g/L yeast extract, 10 g/L tryptone, 5 g/L NaCl. Add appropriate antibiotics when cooled to 55 °C. 3. Antibiotic stock solutions: 100 mg/mL kanamycin; 50 mg/ mL rifampicin; and 25 mg/mL gentamycin.

2.4 Mutation Identification and Genotyping

1. Cetyltrimethylammonium bromide (CTAB) buffer: 2% CTAB (w/v), 100 mM Tris-HCl (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl. Sterilize at 121 °C for 20 min. 2. T7 endonuclease I and buffer. 3. Reverse transcription kit. 4. Target-specific restriction enzymes and buffers. 5. Locus-specific primers for target site amplification. 6. PCR primers for SYNV detection. • M/F 5′-ATGGCAGGTATATACGCAGTTTCAA-3′. • M/R 5′-TCAGTCTCATCTTCAAAGTATGTAGGA-3′.

2.5 Tissue Culture and Plant Regeneration

1. 0.1% mercuric chloride (w/v). 2. 70% ethanol. 3. Shoot induction medium: 4.4 g/L Murashige and Skoog (MS) medium basal salt mixture, including vitamins (Duchefa, #M0222), 30 g/L sucrose, 1 mg/L 6-benzylaminopurine (BAP; Duchefa, #B0904), 4 g/L Phytagel (Sigma-Aldrich, #P8169), pH 5.8. Sterilize at 115 °C for 20 min. 4. Rooting medium: 4.4 g/L Murashige and Skoog (MS) medium basal salt mixture, including vitamins (Duchefa, #M0222), 3 g/L sucrose, 7 g/L glucose and 4 g/L Phytagel (Sigma-Aldrich, #P8169), pH 5.8. Sterilize at 115 °C for 20 min.

2.6

Equipment

1. Thermocycler. 2. Temperature stable water bath. 3. MicroPulser electroporator (Bio-Rad, cat. no. 165–2100).

178

Xiaonan Ma et al.

4. High-temperature autoclave. 5. Ultraclean workbench. 6. Rotary shaker. 7. Benchtop centrifuge. 8. pH meter. 9. Spectrophotometer. 10. Agarose gel electrophoresis gel tanks and devices. 11. Gel imaging system (e.g., Gel Documentation System from Bio-Rad). 12. 2 mL round-bottom microcentrifuge tubes. 13. 15 mL culture tubes. 14. Petri dishes (90 × 15 mm2). 15. Tissue culture plates (90 × 20 mm2). 16. Disposable latex-free gloves and plastic gloves. 17. 1 mL needleless syringe. 18. Nursery pots. 19. Whatman filter paper. 20. Single-edge razor blade. 21. Laminar flow hood. 22. Growth chamber.

3

Methods

3.1 Construction of SYNV-Based CRISPR/ Cas9 Vector

1. Download the genomic sequence and coding sequence of the target gene from the N. benthamiana genome databases, and use sgRNA design tools (e.g., CRISPR-P2.0, http://cbi.hzau. edu.cn/cgi-bin/CRISPR2/CRISPR) to select the most appropriate target sites (see Notes 6 and 7). 2. Design a target-specific sgRNA sense oligo, 5′-TGCAN20-3′ (where N20 corresponds to the 20 nt sequence upstream of the “NGG” protospacer-adjacent motif), and an sgRNA antisense oligo, 5′-AAACN20-3′ (where N20 is complementary to the 20 nt sequence upstream of the “NGG”) (see Notes 8 and 9). 3. Dilute the sgRNA sense and antisense oligos to 100 μM in ddH2O. Add 1 μL of each of the two oligos into a PCR tube containing 2 μL 10× NEB buffer 2 and 16 μL nuclease-free water. Anneal the oligos at 95 °C for 5 min, and then cool it down with a ramp of 5 °C/min to 25 °C to form DNA duplexes. 4. Prepare Golden Gate assembly reaction in a 20 μL reaction containing 1 μL pLB-GG-Scaffold plasmid (100 ng/μL), 1 μL

Virus-Induced Genome Editing in N. benthamiana

179

BsmBI restriction enzyme, 1 μL annealed oligo duplexes, 1 μL T4 DNA ligase, 2 μL T4 DNA ligase buffer, and 14 μL nuclease-free water. Incubate the reaction in a thermocycler for ten cycles of 37 °C for 5 min and 22 °C for 10 min and then at 37 °C for 30 min and hold at 75 °C for 15 min. 5. Transform E. coli DH5α-competent cells with 10 μL of the ligation product via heat shock. Plate the mixture onto an LB agar plate with 100 μg/mL ampicillin. 6. Pick single colonies to inoculate 15 mL culture tubes containing 5 mL LB medium with 100 μg/mL ampicillin. Propagate the bacterial culture on a shaker overnight at 37 °C, 220 rpm. 7. Extract the constructed pLB-CRISPR plasmid from bacterial cultures using a plasmid miniprep kit following the manufacturer’s instructions. 8. Digest approximately 2 μg of the pLB-CRISPR and pSYNVtgtRNA-Cas9 plasmids with Bsu36I and AhdI restriction enzymes. Separate the digestion products by 1% agarose gel electrophoresis in 0.5× TBE buffer, and isolate the Bsu36IAhdI fragment containing the target sequence and the pSYNV-tgtRNA-Cas9 backbone with a gel extraction kit. 9. Ligate the Bsu36I-AhdI fragment with the pSYNV-tgtRNACas9 backbone in a 10 μL reaction containing 1 μL of T4 DNA ligase buffer, 1 μL of T4 DNA ligase, 5 μL of the purified insert, and 3 μL of the purified vector. 10. Transform the ligation mixtures into 100 μL of E. coli TOP10competent cells and plate bacteria onto LB agar medium supplemented with 50 μg/mL kanamycin (see Note 10). 11. Propagate and extract the constructed plasmids from overnight bacterial cultures. Confirm the correctly constructed vectors by Sanger sequencing using the N/F oligo (see Note 11). 3.2 Agroinfiltration with SYNV Vectors (Agroinoculation)

1. Transform the plasmids pSYNV-tgtRNA-Cas9, pGD-NPL, pGD-HcPro, pGD-p19, and pGD-γb into A. tumefaciens GV3101 strain by electroporation. Plate the transformed cells onto Petri dishes with a solid LB medium containing 50 μg/ mL kanamycin, 50 μg/mL rifampicin, and 25 μg/mL gentamycin, and then incubate at 28 °C for 2 days. 2. Inoculate single colonies into 15 mL culture tubes containing 2 mL liquid YEP medium with 50 μg/mL kanamycin, 50 μg/ mL rifampicin, and 25 μg/mL gentamycin. Grow the culture at 28 °C overnight with shaking (220 rpm). 3. Dilute the culture 1:10 in fresh YEP medium with antibiotics, and culture the cells for an additional 5–6 h at 28 °C with constant shaking until the OD600 reaches approximately 1.0.

180

Xiaonan Ma et al.

4. Collect bacterial cells by centrifugation at 3000 g for 5 min at room temperature, and resuspend the pellet with the infiltration buffer. Measure the absorption of Agrobacterium suspension at 600 nm (OD600) using a spectrophotometer, and adjust concentration to OD600 of 0.6. 5. After a 3 h incubation at room temperature, mix the Agrobacterium cultures harboring the pSYNV-tgtRNA-Cas9, pGD-NPL, pGD-HcPro, pGD-p19, and pGD-γb at a 3:3:1: 1:1 ratio (see Note 12). 6. Infiltrate the Agrobacterium mixtures into the abaxial surfaces of three expanded leaves of 3–4 week-old N. benthamiana plants using a 1 mL needleless syringe (see Note 13). A plant at a suitable age for agroinoculation is shown in Fig. 2b. 7. Return the plants to the growth chamber set at 25 °C and a 16 h light/8 h dark photoperiod and 70% humidity, and monitor viral symptoms regularly (see Notes 14 and 15). 3.3 Analysis of Mutation Frequency

Mutations can be detected by polymerase chain reaction/restriction enzyme digestion assay (PCR/RE) if the Cas9 cleavage site overlaps with a suitable restriction site or otherwise with T7E1 assay or by Sanger sequencing or high-throughput sequencing of PCR amplicon. Detailed procedures for T7E1 assay and highthroughput sequencing can be found in previous protocols [22, 23] and will not be described here. 1. Extract the genomic DNA from young and symptomatic systemic leaves of infected plants about 1–2 weeks post-symptom appearance by the CTAB method [24]. Figure 2c shows an example of infected plants. 2. Amplify the genomic fragments containing the target sites using locus-specific primers, and isolate the products with a PCR purification kit (see Notes 16 and 17). 3. Digest the purified PCR products (200 ng) with an appropriate restriction enzyme with its recognition sequence that overlaps with the Cas9 cleavage sites. 4. Calculate the mutation rates by measuring the intensity of digested and undigested DNA fragments with ImageJ software (https://imagej.nih.gov/). Calculate the indel frequency using the following formula: a indel ð%Þ = 100 × ða þ b Þ where a is the intensity of the undigested PCR product and b is the sum of the intensity of the digested products. 5. Clone the PCR products and select multiple colonies for Sanger sequencing to further confirm the mutation frequencies (see Note 18).

Virus-Induced Genome Editing in N. benthamiana

3.4 Plant Regeneration and Genotyping

181

The steps 2–4 below are performed in an ultraclean laminar flow hood under aseptic conditions. 1. Select the leaves of systemically infected plants confirmed to have high somatic mutation rates as the source of explants. 2. Wash the leaves with sterile water for 10 min, surface-sterilize with 70% ethanol solution for 30 s followed by 0.1% mercuric chloride for 2 min, and then wash three to five times with sterile distilled water. 3. Cut the leaves with a single-edge razor blade into ~1 cm2 pieces on sterilized Whatman filter papers. Place the explants adaxial side up onto the Petri plates with shoot induction medium (Fig. 2e), and culture the explants in a growth chamber at 25 °C under an alternating regime of 12 h of light and 10 h of darkness. 4. After culture for 4–6 weeks, excise the regenerated shoots with four to five leaves (Fig. 2f), and transfer to rooting medium. Culture the shoots for 2–3 weeks until the plantlets develop a root system (1–3 cm). 5. Two days before transfer to soil, acclimate the plantlets by loosening the container caps to allow more airflow, and add 1–2 cm sterile water to the bottles. 6. Remove the seedlings from the rooting medium, and wash off the agar thoroughly using sterile water. Transplant the rooted plantlets into nursery pots containing standard greenhouse soil mix (e.g., vermiculite, peat, and perlite mixed at a ratio of 7: 2:1), and keep pots inside plastic trays. 7. Transfer the pots to a chamber with a 16 h light/8 h dark photoperiod and 70% humidity. Gradually remove the plastic cover to acclimate the plants fully (see Note 19). 8. Extract the genomic DNA from the regenerated seedlings using the CTAB method. Amplify the fragments spanning the target sites, and perform the PCR/RE assay and Sanger sequencing to determine the putative genotype of seedlings, according to Subheading 3.3 (see Note 20). 9. Optionally, detect the SYNV vector in the regenerated plants by reverse transcription PCR using the primer pair M/F and M/R (see Note 21). 10. Harvest the seeds from fully mature pods of the regenerated plants. Germinate the seeds and genotype the seedlings using the PCR/RE assay and Sanger sequencing described in Subheading 3.3 (see Note 22).

182

4

Xiaonan Ma et al.

Notes 1. Establishing an efficient reverse genetics system is fundamental for viral delivery of large payloads such as the CRISPR/Cas9 coding sequences. In the field of negative-strand RNA virology, it is commonly perceived that the positive-sense anti-genomic RNAs rather than the negative-sense genomic RNAs should be transcribed in the cells from cloned plasmids to serve as templates for the recovery of recombinant viruses. For SYNV recovery, however, we have recently shown that the negativesense approach is about 100-fold more efficient than the positive-sense approach [25]. 2. SYNV and related nucleorhabdoviruses are among the rare examples of RNA viruses that replicate in the nucleus. This character is exploited to design a strategy for sgRNA processing through recruiting endogenous tRNA maturation machinery in the nucleus. 3. For a negative-strand RNA virus, the genomic RNA alone is not infectious but requires the co-expressed nucleocapsid protein (N), RNA-dependent RNA polymerase (L), and co-factors (P for SYNV) for genome encapsidation and initiation of replication. We constructed a binary vector (pGD-NPL) for the tandem expression of the three viral proteins to minimize the plasmid numbers in agroinfiltration and increase the likelihood of their co-expression within infiltrated single cells [12]. 4. Co-expression of viral suppressors of RNA silencing is essential for the generation of recombinant SYNV [12]. Various suppressors with different modes of action can serve for this purpose, and they tend to have additive effects on promoting virus recovery. Among the suppressors we have tested, p19 is the most potent one [25]. 5. The sequence of pSYNV-tgtRNA-Cas9 already contains the most commonly used type IIS restriction sites. Direct insertion of sgRNA spacer into the vector by Golden Gate-based cloning is complicated to design. We therefore used an intermediate plasmid for cloning target site-specific sgRNA. Alternatively, other seamless assembly methods such as In-Fusion cloning can be employed to precisely introduce the designed protospacer sequence into the vector. 6. There are several online genomics and transcriptomics resources for N. benthamiana sequences and annotations that can be used to retrieve gene sequences, for example, the Queensland University of Technology (QUT) database (http://benthgenome.qut.edu.au/), the Sol Genomics Network (SGN) (https://solgenomics.net/organism/Nicotiana_ benthamiana/genome), the Boyce Thompson Institute (BTI)

Virus-Induced Genome Editing in N. benthamiana

183

N. benthamiana website (https://btiscience.org/ourresearch/research-facilities/research-resources/nicotianabenthamiana/), and NCBI’s GenBank (https://www.ncbi. nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4100). The CRISPR-P2.0 web tool supports Cas9 target site designing using the early Niben0.4.4 draft genome assembly as the N. benthamiana reference genome. The QUT website also has a bioinformatics tool for designing the Cas9 target site for the construction of tRNA-sgRNA cassettes. 7. Although the bioinformatics tools can make recommendations for target sites with a high score, it is important to select at least two different sites for each target gene as some sgRNA do not work as efficiently as predicted. Note that most N. benthamiana genes have two highly related homoeologs derived from two parental subgenomes. Pay attention to whether or not the selected target sites are conserved between the two homoeologs. 8. Target sequence with a restriction site overlapping with the Cas9 cleavage site can facilitate the detection of mutagenesis frequency by the PCR/RE assay. If a suitable restriction site is not available, the T7E1 assay can be used instead. 9. Make sure that the target sites lack Bsu36I and AhdI restriction sites. 10. It takes about 2 days for positive transformants harboring SYNV-tgtRNA-Cas9 to appear as medium-sized colonies. 11. The pCB301 backbone is a low copy number plasmid in E. coli. It is recommended to analyze the plasmid concentration by spectrophotometer and agarose gel electrophoresis. If the plasmid yield is poor, the minipreps may be concentrated by ethanol precipitation or by a speed vacuum concentrator. 12. The final OD600 for each of the Agrobacterium strains harboring the pSYNV-tgtRNA-Cas9, pGD-NPL, pGD-HcPro, pGD-p19, and pGD-γb plasmids is 0.2, 0.2, 0.067, 0.067, and 0.067, respectively. 13. Seedling age and condition have significant impacts on the efficiency of recombinant virus infection. It is critical to use young, healthy, and vigorous plants (about 3–4 weeks postsowing) and select the fully expanded leaves for agroinfiltration. 14. It generally takes about 10–20 days for infiltrated N. benthamiana plants to start showing systemic symptoms such as dwarfing, leaf curling, and vein yellowing, but the incubation time can be affected by the light intensity and wavelength. By 3 weeks post-agroinoculation, up to 100% of plants can be infected systemically.

184

Xiaonan Ma et al.

15. SYNV is naturally transmitted by aphids (Aphis coreopsidis) and also replicates in the insect vector. Although this aphid species is not reportedly widespread, it is important to comply with local biosafety regulations and take effective containment measures to prevent the accidental environmental release of the genetically modified virus when conducting the infection experiment in the laboratory. 16. For the PCR/RE assay, the amplicon sizes are preferably within the range of 300–600 bp, and the restriction site is located near the middle of the amplicon. However, deep sequencing has a different requirement for the amplicon size (usually about 150–300 bp), with the detection site located within the range of 10–100 bp to one of the ends. 17. The amplicons derived from two homoeologs may differ in size or sequence. In this case, homoeolog-specific primer sets should be used to amplify the target regions separately for the T7E1 assay, because hybrid amplicon DNAs annealed between the homoeolog sequences would cause false-positive digestion. 18. At least 10–15 individual colonies should be sequenced for approximate estimation of mutation efficiency and pattern. As a simple alternative, the PCR products can be directly Sanger sequenced, and the superimposed chromatograms are analyzed for mutation type and/or frequency by web-based tools such as ICE (https://ice.synthego.com/#/) and DSDecodeM (http://skl.scau.edu.cn/dsdecode/). 19. Special care should be taken to avoid drought stress in the initial few days after seedlings are transplanted to soil. 20. The genotypes at this stage are putative, and some mutation types may be of somatic nature and do not pass to offspring. 21. According to our experience, high percentages (>70%) of regenerated plants will be persistently infected by the SYNV vector, although most of these plants show very mild or no symptoms. 22. The progeny plants are free of virus because SYNV is seed non-transmissible.

Acknowledgments This work was supported by grants from the NSFC (No. 31870142), FCTC [No. 110202101034 (JY-11)], and FCYTIC (No. 2022JY03).

Virus-Induced Genome Editing in N. benthamiana

185

References 1. Gao CX (2021) Genome engineering for crop improvement and future agriculture. Cell 184: 1621–1635 2. Zhang YX, Malzahn AA, Sretenovic S et al (2019) The emerging and uncultivated potential of CRISPR technology in plant science. Nat Plants 5:778–794 3. PaP A, Voytas DF (2020) Overcoming bottlenecks in plant gene editing. Curr Opin Plant Biol 54:79–84 4. Yang B (2020) Grand challenges in genome editing in plants. Front Genome Ed 2:2. https://doi.org/10.3389/fgeed.2020.00002 5. Kausch AP, Nelson-Vasilchik K, Hague J et al (2019) Edit at will: genotype independent plant transformation in the era of advanced genomics and genome editing. Plant Sci 281: 186–205 6. Altpeter F, Springer NM, Bartley LE et al (2016) Advancing crop transformation in the era of genome editing. Plant Cell 28:1510– 1520 7. Gong Z, Cheng M, Botella JR (2021) Non-GM genome editing approaches in crops. Front Genome Ed 3:817279. https:// doi.org/10.3389/fgeed.2021.817279 8. Cody WB, Scholthof HB (2019) Plant virus vectors 3.0: transitioning into synthetic genomics. Annu Rev Phytopathol 57:211–230 9. Oh Y, Kim H, Kim SG (2021) Virus-induced plant genome editing. Curr Opin Plant Biol 60:101992 10. Ma X, Zhang X, Liu H et al (2020) Highly efficient DNA-free plant genome editing using virally delivered CRISPR-Cas9. Nat Plants 6:773–779 11. Jackson AO, Dietzgen RG, Goodin MM et al (2005) Biology of plant rhabdoviruses. Annu Rev Phytopathol 43:623–660 12. Wang Q, Ma XN, Qian SS et al (2015) Rescue of a plant negative-strand RNA virus from cloned cDNA: insights into enveloped plant virus movement and morphogenesis. PLoS Pathog 11:e1005223. https://doi.org/10. 1371/journal.ppat.1005223 13. Peng XX, Ma XN, Lu ST et al (2021) A versatile plant rhabdovirus-based vector for gene silencing, miRNA expression and depletion, and antibody production. Front Plant Sci 11: 627880. https://doi.org/10.3389/fpls.2020. 627880

14. Bukreyev A, Skiadopoulos MH, Murphy BR et al (2006) Nonsegmented negative-strand viruses as vaccine vectors. J Virol 80:10293– 10306 15. Goodin MM, Zaitlin D, Naidu RA et al (2008) Nicotiana benthamiana: its history and future as a model for plant-pathogen interactions. Mol Plant-Microbe Interact 21:1015–1026 16. Bally J, Jung H, Mortimer C et al (2018) The rise and rise of Nicotiana benthamiana: a plant for all reasons. Annu Rev Phytopathol 56:405– 426 17. Liu C (2022) Reconstitution of metabolic pathway in Nicotiana benthamiana. Methods Mol Biol 2396:29–33 18. Mitiouchkina T, Mishin AS, Somermeyer LG et al (2020) Plants with genetically encoded autoluminescence. Nat Biotechnol 38:944– 946 19. Stoger E, Fischer R, Moloney M et al (2014) Plant molecular pharming for the treatment of chronic and infectious diseases. Annu Rev Plant Biol 65:743–768 20. Schiavinato M, Marcet-Houben M, Dohm JC et al (2020) Parental origin of the allotetraploid tobacco Nicotiana benthamiana. Plant J 102: 541–554 21. Ganesan U, Bragg JN, Deng M et al (2013) Construction of a sonchus yellow net virus minireplicon: a step toward reverse genetic analysis of plant negative-strand RNA viruses. J Virol 87:10598–10611 22. Liu L, Chen R, Fugina CJ et al (2021) Highthroughput and low-cost genotyping method for plant genome editing. Curr Protoc 1:e100. https://doi.org/10.1002/cpz1.100 23. Shan QW, Wang YP, Li J et al (2014) Genome editing in rice and wheat using the CRISPR/ Cas system. Nat Protoc 9:2395–2410 24. Allen GC, Flores-Vergara MA, Krasnyanski S et al (2006) A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat Protoc 1: 2320–2325 25. Ma X, Li Z (2020) Significantly improved recovery of recombinant sonchus yellow net rhabdovirus by expressing the negative-strand genomic RNA. Viruses 12:1459. https://doi. org/10.3390/v12121459

Chapter 12 Ribonucleoprotein (RNP)-Mediated Targeted Mutagenesis in Barley (Hordeum vulgare L.) Martin Becker and Goetz Hensel Abstract The crop species barley is a genetic model for the small grain temperate cereals. Thanks to the availability of whole genome sequence and the development of customizable endonucleases, site-directed genome modification has recently revolutionized genetic engineering. Several platforms have been established in plants, with the most flexible one offered by the clustered regularly interspaced short palindromic repeats (CRISPR) technology. In this protocol, commercially available synthetic guide RNAs (gRNAs), Cas enzymes, or custom-generated reagents are used for targeted mutagenesis in barley. The protocol has been successfully used with immature embryo explants to generate site-specific mutations in regenerants. As the double-strand break-inducing reagents are customizable and can be efficiently delivered, pre-assembled ribonucleoprotein (RNP) complexes allow efficient generation of genome-modified plants. Key words Biolistic, Cereals, Targeted mutagenesis, Tissue culture, Triticeae

1

Introduction The targeted induction of double-strand breaks using customized endonucleases has revolutionized biotechnology. In a relatively simple way, a double-strand break (DSB) can be induced in any biological system at a predetermined genomic location. Two components, the target-specific guide RNA and the double-strand break-inducing reagent (Cas protein), are transferred as DNA, transcript RNA, or pre-assembled ribonucleoprotein complex into a living cell. Because of the cells’ endogenous repair mechanisms, this results in many erroneous repair products, leading to the inactivation of the corresponding gene (knockout) [1]. Furthermore, by excising defined DNA segments (e.g., deletion of 3, 6, 9, 12 base pairs, etc.), a protein with altered/attenuated function can also be genetically generated [2]. Shortly after the biochemical characterization of the CRISPR-Cas system was described [1], there were already the first applications of CRISPR-Cas

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_12, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

187

188

Martin Becker and Goetz Hensel

ribonucleoprotein complexes for genome editing in several animal and plant species [3–7]. Advantages of in vitro assembly include no need to worry about transcriptional constraints and uncertainties regarding promoters used for gRNA and Cas protein, the immediate activity of the RNA-protein complex, earlier edit generation and detection, and reduced off-target activity due to faster degradation later in cell development [4]. In addition to commercially available Cas enzymes and synthetic RNAs, the laboratory can also produce corresponding reagents. Depending on the application and frequency of use, one or the other may be advantageous. In plants, RNPs have been successfully applied with various Cas proteins [8]. On the one hand, they have been used to compare activity differences of different Cas proteins [9] and to study critical agronomic traits such as grain yield [10, 11], disease resistance [12], nutritional composition [13, 14], and herbicide resistance [15]. In barley, there have been no publications describing RNP-mediated induction of mutations. In contrast, rice [9], bread wheat [10], and corn [15] have already been successfully modified with this method, and traits such as grain size or male sterility have been investigated. With the protocol described in this chapter, inheritable mutations were efficiently obtained.

2

Materials

2.1 gRNAs and Cas Enzymes

1. HvLOX1-specific gRNA was selected by Jochen Kumlehn (IPK Gatersleben) (Fig. 1b, c). 2. Synthetic crRNA, tracrRNA, and Alt-R S.p. Cas9 nuclease V2 were ordered from Integrated DNA Technologies (IDT) Company.

2.2

Plant Material

2.3 Stock Solutions (See Note 1) 2.3.1

Mineral Salts

The method described here was established using the two-rowed spring-type barley (Hordeum vulgare L.) cv. “Golden Promise”, since this cultivar has long been recognized worldwide as more amenable to transformation than most others. 1. K4N macro minerals (20×) [16]: 6.4 g/L NH4NO3, 72.8 g/L KNO3, 6.8 g/L KH2PO4, 8.82 g/L CaCl2·2H2O, 4.92 g/L MgSO4·7H2O, filter-sterilized and stored at room temperature (RT). 2. K micro minerals (1000×) [16]: 11.2 g/L MnSO4·4H2O, 3.1 g/L H3BO3, 7.2 g/L ZnSO4·7H2O, 120 mg/L Na2MoO4·2H2O, 25 mg/L CuSO4·5H2O, 24 mg/L CoCl2·6H2O, 170 mg/L KI, filter-sterilized and stored at 4 °C.

Ribonucleoprotein-Mediated Targeted Mutagenesis in Barley

189

Fig. 1 Explants and sequence information for targeted mutagenesis using immature embryos in barley. (a) Bright-field and epifluorescence of immature embryos co-bombarded with RFP protein and an HvLOX1specific ribonucleoprotein complex 24 h post-bombardment. (b) Genomic organization of the HvLOX1 gene. The gene consists of seven exons. The target site for RNP-mediated knockouts is indicated in exon 1. (c) Sequencing results of amplicon sequencing of regenerants. The genomic DNA of eight plantlets was pooled and amplified with a unique barcode and sent to NGS sequencing

3. Copper sulfate (25 mM): 1.25 g/L CuSO4·5H2O, filtersterilized and stored at 4 °C. 4. Ethylenediaminetetraacetic acid, ferric-sodium salt (NaFeEDTA, 75 mM): 27.53 g/L NaFe-EDTA, filter-sterilized and stored at 4 °C. 5. CaCl2 (2.5 M) solution: 367.5 g/L CaCl2·2H2O, autoclaved and stored at RT. 2.3.2 Carbohydrate Source

1. Maltose (1 M): 360 g/L maltose·H2O, filter-sterilized and stored at RT.

2.3.3

1. Gamborg B5 vitamins (1000×): 112 g/L ready-to-use product (Duchefa, Cat. No. G0415.0100), filter-sterilized and stored at -20 °C.

Vitamins

2. Biotin (0.1 g/L): filter-sterilized and stored at 4 °C. 3. Thiamine HCl (1 g/L): filter-sterilized and stored at 4 °C. 2.3.4

Growth Regulators

1. 6-Benzylaminopurine (6-BAP, 1 mM): 0.225 g/L, dissolved in a few drops of 1 M NaOH, then made up to the final volume in water, filter-sterilized, and stored at 4 °C. 2. Dicamba (2.5 g/L): dissolved in a few drops of 96% heated ethanol, then made up to the final volume in warmed water, filter-sterilized, and stored at 4 °C.

2.3.5

Amino Acids

1. L-glutamine (0.25 M): 36.6 g/L, dissolved in a few drops of 0.1 M KOH, then made up to the final volume in warmed water, filter-sterilized, and stored at -20 °C.

190

Martin Becker and Goetz Hensel

2.3.6

Selective Agents

1. Spectinomycin (100 g/L): filter-sterilized and stored at -20 °C.

2.3.7

Gelling Agent

1. Phytagel (0.4% w/v): 4 g/L dissolved in cold water and autoclaved. The temperature of this stock and the remaining components of the medium are to be set to ca. 50 °C before mixing.

2.3.8 Other Additives and Solutions

1. Ethanol (70%): 729.2 mL/L of 96% ethanol, stored at RT. 2. Sodium hypochlorite (2.4% w/v): 200 mL/L of 12% (w/v) NaOCl, to which is added 0.1% (v/v) Tween 20. This solution should be freshly prepared. 3. Spermidine (0.1 M): dissolve 255 mg spermidine in water to a final volume of 10 mL. Store at -20 °C.

2.4 Plant Tissue Culture Media

1. Osmotic pre-treatment medium (OPM): The medium contains 4.3 g/L MS mineral salts (Sigma-Aldrich cat # M 5524) [17], 1 g/L casein hydrolysate, 0.69 g/L proline, 0.25 g/L myo-inositol, 30 g/L maltose·H2O, 1 mL/L Dicamba stock, 1 mL/L thiamine HCl stock, 63.75 g/L mannitol. The pH is adjusted to 5.8, the solution is filter-sterilized, and one volume is mixed with three volumes of Phytagel stock. 2. Liquid co-culture medium (BCCM): The medium contains 4.3 g/L MS mineral salts (Sigma-Aldrich No. M 5524) [17], 0.2 mL/L CuSO4·5H2O stock, 1 g/L casein hydrolysate, 0.69 g/L proline, 0.25 g/L myo-inositol, 30 g/L maltose·H2O, 1 mL/L Dicamba stock, 1 mL/L thiamine HCl stock. The pH is adjusted to 5.8 and the solution is filtersterilized. 3. Solid callus induction medium (BCIM): The medium contains 4.3 g/L MS mineral salts (Sigma-Aldrich No. M 5524) [17], 0.2 mL/L CuSO4·5H2O stock, 1 g/L casein hydrolysate, 0.69 g/L proline, 0.25 g/L myo-inositol, 30 g/L maltose·H2O, 1 mL/L Dicamba stock, 1 mL/L thiamine HCl stock. The pH is adjusted to 5.8, the solution is filter-sterilized, and one volume is mixed with three volumes of Phytagel stock. 4. Solid regeneration medium (BRM): The medium contains 50 mL/L K4N macro mineral stock; 1 mL/L each of the NaFe-EDTA, K micro, vitamin B5, and 6-BAP stocks; 4 mL/ L L-glutamine stock; 100 mL/L maltose stock; and 196 μL/L CuSO4·5H2O stock. The pH is adjusted to 5.8, the solution is filter-sterilized, and one volume is mixed with three volumes of Phytagel stock.

2.5 Laboratory Supplies

1. Forceps, scalpel, spatula, needles.

2.5.1 Immature Embryo Isolation

3. 6-well culture plates with 3-cm-diameter wells.

2. Preparative microscope.

Ribonucleoprotein-Mediated Targeted Mutagenesis in Barley

191

4. 5.5- and 9.0-cm-diameter Petri dishes. 5. Plastic boxes with a lid (107 × 94 × 96 cm). 6. Pipettes and disposable autoclaved filter tips (200–1000 μL and 1000–5000 μL). 7. Sterile Eppendorf Safe-lock tubes (1.5 mL) for RNP assembly. 8. Filter paper (several sizes, ash-free, autoclaved). 9. Magnetic stirrer. 2.5.2 Bombardment of Immature Barley Embryos

1. PDS-1000/He gene gun (Bio-Rad). 2. Microcarrier: 0.6 μm gold particles (Bio-Rad, cat. # 1652262). 3. 900 psi rupture discs (Bio-Rad, cat. # 1652328). 4. Macrocarrier (Bio-Rad, cat. # 1652335). 5. Isopropanol. 6. Molecular sieves 3A, 2–5 mm (Alfa Aesar, cat. # L05359). 7. 100% ethanol ultrapure. 8. Silica gel blue, 2–4 mm, with indicator and beads (Carl Roth, cat # 2440.2).

2.6 Plant Genomic DNA Isolation

1. Cut approximately 200–400 mg leaf tissue from a candidate plant, and place it in a sterile 2 mL Eppendorf tube containing an autoclaved metal bead (diam. 0.4 mm). Snap-freeze the sample using liquid nitrogen (see Note 2). Grind the leaf tissue to a fine powder using a Retsch mill (see Note 3). 2. After grinding, NucleoSpin II Mini Kit for DNA from plants (Macherey-Nagel, cat. # 740770.250) was used according to manufacturer instructions. 3. Elute genomic DNA by using 100 μL pre-heated DNAse-free water. Store at 4 °C or -20 °C for extended periods.

2.7 Adaptor Polymerase Chain Reaction

1. All putative mutant plants regenerated from biolistic bombarded immature embryos are investigated by amplifying a flanking 100–150 bp amplicon. 2. Primer sequences contained a unique 6 bp adaptor sequence flanking the mutation hot spot of the representative RNP. 3. Approximately 100 ng of isolated genomic DNA, appropriate primers, and Taq polymerase are mixed in a 25 μL reaction and processed in a thermocycler. 4. An aliquot of 5 μL of the PCR reaction is checked for the presence of amplication products by electrophoresis on a 2% agarose gel. Positive tested amplicons are purified using a “NucleoFast 96 PCR Plate, 96-well ultrafiltration plate for PCR clean up” (Macherey-Nagel, cat. # 743100.50) according to manufacturer instructions in combination with a QIAvac96 vacuum assembly (Qiagen, cat. # 19504). For elution, water was used.

192

Martin Becker and Goetz Hensel

2.8 Amplicon Sequencing

1. PCR amplicons are sent to Genewiz company for Illumina NovaSeq short-read sequencing. 2. Results are analyzed using a prototype-like bioinformatic pipeline based on FASTQ- sequencing data, barcode Cutadapt [18], BBMerge [19], and alignment of overlapping singlereads using MAFFT [20]. OR Results are sorted by adaptors using Excel and further investigated using SnapGene software.

3

Methods The mCherry reporter gene is used to evaluate the RNP delivery.

3.1 Growing the Donor Material for Stable RNP-Mediated Knockouts

1. Germination is conducted in trays filled with soil substrate (see Note 4) in a growth chamber set to provide a 12-h photoperiod (136 μmol/m2/s photon flux density) and a light/dark temperature regime of 14/12 °C. Ten to 20 grains are germinated at fortnightly intervals to ensure a continuous supply of explant material. 2. After 3 weeks, seedlings are potted into 2 L pots. At the tillering stage (BBCH code 29/30), each pot is given a dressing of 15 g Osmocote (Scotts, Netherlands) (see Note 5). 3. At the tiller elongation stage (BBCH code 39), the plants are transferred to a glasshouse maintained at 18/16 °C with a 16-h light/8-h dark photoperiod (l70 μmol/m2/s photon flux density).

3.2 Isolation of Immature Embryos (Day 1)

1. Harvest immature grains (see Note 6), remove the awns, and place them in a 500 mL bottle in an ice bath. 2. In a laminar airflow hood, immerse the immature grains for 3 min in 70% ethanol, then in NaOCl solution for 15 min on a shaker. Wash five times in sterile, distilled water. 3. Excise the embryo from each grain, and remove the embryo axis with a pair of forceps and a needle. This is achieved by slitting the lemma down the middle, just above the embryo; the embryo axis is removed while the embryo is still in situ. The embryo can be readily released from the immature grain with a needle. 4. Place 30–50 embryos on BCCM.

3.3

RNP Assembly

1. Hybridize the crRNA and tracrRNA to build the gRNA by pipetting per macrocarrier (per shot) 1.27 μL [=1.5 μg] crRNA [100 μM], 0.53 μL [=1.5 μg] tracrRNA [100 μM], and 3.2 μL IDT Duplex Buffer (IDT Integrated DNA

Ribonucleoprotein-Mediated Targeted Mutagenesis in Barley

193

Technologies). Mix carefully in a sterile standard Eppendorf tube. Heat 1 min to 95 °C and chill to RT within 20 min. 2. Dilute the Cas9 enzyme (see Note 7) per shot by adding 1.4 μL Cas9 enzyme [61 μM, stock = 10 μg/μL] with 3.6 μL PBS buffer (8 g/L NaCl, 0.2 g/L KCl, 1.42 g/L Na2HPO4, 0.24 g/L KH2PO4) with 50% glycerol to obtain 5 μL of a 20 μM Cas9 working solution. 3. Assemble the ribonucleoprotein complex by adding 8 μL sterile H2O, 2 μL NEBuffer™ r3.1 (New England Biolabs Inc.), 5 μL gRNA from step 1, and 5 μL Cas9-protein dilution from step 2 into a sterile standard Eppendorf tube in that order to a total volume of 20 μL. Incubate the RNP mix for 15 min at RT to build the RNP complex. Follow with the microcarrier coating process and place the RNP complex on ice until use. 3.4 Coating of Gold Particles with DNA and RNP Complexes

1. Wash the macrocarrier and stopping screen in 70% (v/v) ethanol, and let them air-dry on a sterile filter sheet in a laminar flow bench. Immediately before the biolistic transfer, wash the rupture disc in 100% isopropanol, and carefully place the wet rupture disc into the rupture disc holder (see Note 8). Mount the rapture disc holder using the short end of the torque wrench as tight as possible. 2. For the microcarrier preparation, weigh 50 mg gold particles (0.6 μm-diameter gold, Bio-Rad 1652262) into a 1.5 mL microcentrifuge tube. Add 1 mL 70% (v/v) ethanol, vortex briefly, and let stand for 15 min. Centrifuge at 620 × g for 5 min. Remove the supernatant and add 1 mL of sterile water. Centrifuge and discard the supernatant. Wash with water twice, then resuspend particles in 1 mL 50% (v/v) glycerol. 3. Mix 5 μL gold suspension per macrocarrier for coating with 5 μL 100% EtOH. Vortex vigorously and centrifuge in a benchtop centrifuge, removing the supernatant. Repeat the washing three times using sterile water instead of ethanol. Try to remove as much as possible of the supernatant without pipetting the pellet. 4. Add per macrocarrier 7.45 μL sterile H2O, 1 μL NEBuffer™ r3.1, 0.8 μL TransIT-2020 (Mirus Bio), 20 μL RNP complex from Subheading 3.3, step 3, and 0.75 μL mCherry plasmid [1 μg/μL; 202 fmol] and 10 μL DNA (1 μg/μL) in a total volume of 30 μL. Mix the microcarriers by pipetting up and down three times. Incubate for 10 min on ice, centrifuge at 4 °C with 8 × g for 30 s, and resuspend the coated microcarriers in 10 μL sterile H2O. 5. Spread the microcarriers evenly (see Note 9) on a macrocarrier using a 10 μL pipette in combination with 10 μL low-retention sterile tips. Place the macrocarriers on a sterile Petri dish filled

194

Martin Becker and Goetz Hensel

Fig. 2 Bombardment parameters for immature embryos in barley. Immature embryos were bombarded with a mCherry construct with varying rupture discs and distance to the stopping screen. Twenty-four hours after bombardment, red fluorescing foci were counted using a fluorescent microscope. Different letters indicate significant differences p ≤ 0.01

with silica gel beads topped with sterile filter paper, and allow them to air-dry on a sterile bench until they are dehydrated. Alternatively, store them overnight in the closed Petri dish with the silica gel beads at 4 °C. 6. For DNA, proceed as described above without using TransIT-2020. Resuspend the microcarriers in 10 μL 100% ethanol per macrocarrier, and spread them evenly on the macrocarrier. 3.5 Bombardment of Immature Embryos

1. Transfer the precultured embryos to an osmotic medium (OPM) 4–6 h before the biolistic transformation. 2. Adjust the helium pump so that the burst of a 1550 psi rupture disc will occur after 15 s (see Note 10). The vacuum chamber should be evacuated as fast as possible to -27 Hg (less than 30 s). The pressure release should take around 30 s. 3. Bombard each plate filled with immature embryos twice at a distance of 6 cm (level 2) to the stopping screen with 900 psi (rupture disc) (see Note 11 and Fig. 2). 4. Incubate the plates at 24 °C in the dark for 24 h and examine them for mCherry fluorescence (Fig. 1a).

3.6 Callus Formation, Regeneration, and Mutant Detection (from Day 2 up to 8– 12 Weeks)

1. Place the embryos with their scutellum side facing down on solid BCIM at a rate of ten embryos per 10 cm Petri dish (see Note 12). 2. After sealing the Petri dish, incubate at 24 °C in the dark for 2 weeks, then transfer the material to fresh solid BCIM for another 2 weeks.

Ribonucleoprotein-Mediated Targeted Mutagenesis in Barley

195

3. Transfer the callusing embryos onto BRM and incubate at 24 °C under 136 μmol/m2/s photon flux density with a 16hour light, 8-hour dark lighting schedule. 4. Transfer the material to fresh BRM on a fortnightly basis until shoots emerge. 5. Transfer shoots (once their leaf length has reached 2–3 cm) into a plastic box (107 × 94 × 96 cm) containing 80 mL BRM at a rate of up to 12 plantlets per box (see Note 13). 6. When the plantlets have developed roots, transfer them into the soil, maintaining them at high humidity for 7–10 days by covering them with a plastic dome. 7. Use leaf material of plantlets just established in soil for standard molecular analyses such as PCR and to prove the presence of target mutations. 8. Grow the resulting plants to maturity as described for the donor plants (see Note 14). 9. To identify homozygote mutants, germinate 20–40 progeny of each primary event, and analyze the seedlings by PCR and Sanger sequencing of amplicons. For single copy genes, a monogenic (three plants having a mutation to one wildtype plant) segregation would be expected. Grow plants with chromatograms containing single peaks to maturity.

4

Notes 1. All reagents must be dissolved/diluted in doubled distilled water unless specified otherwise. 2. The plant material may be stored at -80 °C until further processing. 3. To achieve optimal grinding of the snap-frozen leaf material, pre-cool the containers of the Retsch mill at -80 °C. 4. The substrate is a 3:1:2 mixture of garden mold/sand/white and black peat (Klasmann Substrate 2). 5. Osmocote is a commercially available fertilizer formulated to contain 19% N, 6% P, and 12% K. 6. The developmental stage of the immature embryo is more crucial than its size. The present protocol’s optimal stage is when the embryo is about to change from translucent to opaque. 7. Too high Cas9 enzyme concentration results in toxic effects and necrosis.

196

Martin Becker and Goetz Hensel

8. Placing the wet rupture disc into the rupture disc holder prevents shifting of the rupture disc during the mounting of the holder into the particle gun. By this procedure, the failing rate of the bombarding event can be reduced tremendously, and an equal bombarding pressure will be reached. 9. The macrocarrier is hydrophobic. The RNP solution is in water which makes an equal distribution of the microcarriers on the macrocarrier pretty tough. 10. The gauge needs to display the correct shooting pressure has been reached at this time. 11. The coating and bombardment procedure may be optimized and controlled using a fluorescent reporter construct, e.g., encoding a red fluorescent protein. The lengthy selection and regeneration process should be started if the transformed cells’ frequency is high enough. 12. The number of embryos can be increased to 25 per Petri dish at the cost of individual embryo development. 13. Alternatively, up to 16 plantlets can be grown per box on BRM. If desired, individual plantlets can also be raised in a glass tube. 14. The in vitro regeneration via callus formation entails a significantly reduced fitness of the plants compared to regular germination from mature grains. Nonetheless, primary mutants typically produce more than 50 grains.

Acknowledgments This work was supported by funding from the Federal Ministry of Education and Research (BMBF) under project ID 031B0547. We are grateful to the Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben for providing excellent working conditions for our research. References 1. Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821. https://doi.org/10. 1126/science.1225829 2. Li M, Hensel G, Melzer M et al (2021) Mutation of the ALBOSTRIANS Ohnologous gene HvCMF3 impairs chloroplast development and Thylakoid architecture in Barley. Front Plant Sci 12:732608. https://doi.org/10.3389/ fpls.2021.732608 3. Cho SW, Lee J, Carroll D et al (2013) Heritable gene knockout in Caenorhabditis elegans by

direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195:1177–1180. https://doi. org/10.1534/genetics.113.155853 4. Kim H, Kim S-T, Ryu J et al (2017) CRISPR/ Cpf1-mediated DNA-free plant genome editing. Nat Commun 8:14406. https://doi.org/ 10.1038/ncomms14406 5. Zuris JA, Thompson DB, Shu Y et al (2015) Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol 33:73–80. https://doi.org/10.1038/nbt.3081

Ribonucleoprotein-Mediated Targeted Mutagenesis in Barley 6. Woo JW, Kim J, Kwon SI et al (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162–1164. https://doi. org/10.1038/nbt.3389 7. Foster AJ, Martin-Urdiroz M, Yan X et al (2018) CRISPR-Cas9 ribonucleoproteinmediated co-editing and counterselection in the rice blast fungus. Sci Rep 8:14355. https://doi.org/10.1038/s41598-01832702-w 8. Zhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2:100168. https://doi.org/10.1016/j.xplc.2021. 100168 9. Banakar R, Schubert M, Collingwood M et al (2020) Comparison of CRISPR-Cas9/Cas12a Ribonucleoprotein complexes for genome editing efficiency in the Rice Phytoene Desaturase (OsPDS) gene. Rice (N Y) 13:4. https://doi.org/10.1186/s12284-0190365-z 10. Liang Z, Chen K, Li T et al (2017) Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat Commun 8:14261. https://doi. org/10.1038/ncomms14261 11. Toda E, Koiso N, Takebayashi A et al (2019) An efficient DNA- and selectable-marker-free genome-editing system using zygotes in rice. Nat Plants 5:363–368. https://doi.org/10. 1038/s41477-019-0386-z 12. Malnoy M, Viola R, Jung M-H et al (2016) DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 Ribonucleoproteins. Front Plant Sci 7:1904. https:// doi.org/10.3389/fpls.2016.01904

197

13. Kim S, Kim D, Cho SW et al (2014) Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res 24:1012–1019. https://doi.org/10.1101/gr.171322.113 14. Andersson M, Turesson H, Olsson N et al (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164:378–384. https://doi.org/ 10.1111/ppl.12731 15. Svitashev S, Schwartz C, Lenderts B et al (2016) Genome editing in maize directed by CRISPR-Cas9 ribonucleoprotein complexes. Nat Commun 7:13274. https://doi.org/10. 1038/ncomms13274 16. Kumlehn J, Serazetdinova L, Hensel G et al (2006) Genetic transformation of barley (Hordeum vulgare L.) via infection of androgenetic pollen cultures with Agrobacterium tumefaciens. Plant Biotechnol J 4:251–261. https:// doi.org/10.1111/j.1467-7652.2005. 00178.x 17. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473– 497. https://doi.org/10.1111/j.1399-3054. 1962.tb08052.x 18. Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17:10. https://doi.org/10. 14806/ej.17.1.200 19. Bushnell B, Rood J, Singer E (2017) BBMerge - accurate paired shotgun read merging via overlap. PLoS One 12:e0185056. https:// doi.org/10.1371/journal.pone.0185056 20. Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286–298. https://doi.org/10.1093/bib/bbn013

Chapter 13 Ribonucleoprotein (RNP)-Mediated Allele Replacement in Barley (Hordeum vulgare L.) Leaves Martin Becker and Goetz Hensel Abstract Varietal differences within a species with agronomic importance are often based on minor changes in the genomic sequence. For example, fungus-resistant and fungus-susceptible wheat varieties may vary in only one amino acid. The situation is similar with the reporter genes Gfp and Yfp where two base pairs cause a shift in the emission spectrum from green to yellow. Methods of targeted double-strand break induction now allow this exchange precisely with the simultaneous transfer of the desired repair template. However, these changes rarely lead to a selective advantage that can be used in generating such mutant plants. The protocol presented here allows a corresponding allele replacement at the cellular level using ribonucleoprotein complexes in combination with an appropriate repair template. The efficiencies achieved are comparable to other methods with direct DNA transfer or integration of the corresponding building blocks in the host genome. They are in the range of 35 percent, considering one allele in a diploid organism as barley and using Cas9 RNP complexes. Key words Biolistic, CRISPR/Cas, Cereals, Homology-directed repair, Tissue culture, Triticeae

1

Introduction Plant genomes have been entirely or partially duplicated or multiplied during plant evolution. Consequently, environmentally induced alterations led to the inactivation or neofunctionalization of duplicated genes [1]. These duplicates have contributed to the evolution of novel functions, such as the production of floral structures, induction of disease resistance, and adaptation to stress [2]. One example related to disease resistance is the wheat Lr34 gene [3] where a single amino acid decides whether an accession is susceptible or resistant to multiple fungal pathogens [4]. Other examples include changes in the biophysical properties of the encoded proteins, for example, the emission spectrum of fluorescent proteins. The green fluorescent protein’s (Gfp) green emission can be converted to yellow fluorescence by a simple T203Y amino acid switch (Fig. 1a; [5]).

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_13, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

199

200

Martin Becker and Goetz Hensel

Fig. 1 RNP-mediated allele replacement in barley leaves. (a) Excerpt of the DNA and amino acid sequences of Gfp and Yfp. The blue nucleotides and the altered Yfp-specific amino acid are highlighted, which induce the shift in the emission spectrum. (b) Epifluorescence of stomata cells co-bombarded with a mCherry, a Gfpspecific ribonucleoprotein complex, and a truncated, nonfunctional Yfp-gene 24 h post-bombardment. (c) Number of cells detected positive for the different fluorescent proteins 24 h post-bombardment

Gene replacement in plants became feasible with the development of CRISPR/Cas technology. For this purpose, the co-delivery of double-strand break-inducing reagents (gRNA and Cas enzyme) and a suitable (synthetic) repair template is necessary. One can do this by Agrobacterium-mediated co-delivery of two TDNAs harboring the aforementioned components, and one can use a single T-DNA carrying all three elements [6]. Alternatively, one can use preassembled gRNAs and Cas enzymes (ribonucleoprotein complexes, RNPs) to induce double-strand breaks. This RNP technology has been used successfully in plants to alter traits related to grain yield, disease resistance, nutritional composition, and herbicide resistance [7]. As the preferred repair pathway of such

RNP-Mediated Allele Replacement in Barley Leaves

201

double-strand breaks follows the nonhomologous end-joining pathway, editing outcomes conferring selective advantages would improve gene replacement efficiency. Therefore, the first examples in cereals were related to modifications which allowed the selection using herbicides [8]. In barley, there have been no publications describing RNP-mediated allele replacement yet. This protocol describes the use of RNP for demonstrating allele replacement activity in barley leaf tissues. To facilitate RNP-mediated allele exchange, we used the knowledge gained with a plasmid-based test system [9, 10]. Instead of delivering DNA sequences for expressing the Gfp-specific gRNA and Cas9 protein, a preassembled gRNA-Cas9 complex is used in this protocol.

2

Materials

2.1 gRNA, Cas Enzyme, and Repair Template

1. Gfp-specific gRNA was selected according to [10]. 2. Synthetic crRNA, tracrRNA, and Alt-R S.p. Cas9 nuclease V2 were ordered from Integrated DNA Technologies (IDT) Company. 3. A nonfunctional truncated Yfp-fragment used as repair template was generated according to [9].

2.2

Plant Material

2.3 Stock Solutions (See Note 1) 2.3.1

Selective Agents

2.3.2

Gelling Agent

The method described here was established using leaves of two transgenic winter barley (Hordeum vulgare) cv. ‘Igri’ lines, denoted BPI 09 and BPI 11, each carrying a homozygous single copy Gfp insert [9]. 1. Ampicillin (100 g/L): filter-sterilized and stored at -20 °C. 2. Chloramphenicol (20 mg/mL): filter-sterilized and stored at 20 °C. 3. Benzimidazole (20 mg/mL): filter-sterilized and stored at 20 °C. 1. Plant agar (1.0% w/v): 10 g/L dissolved in cold water, autoclaved. The temperature of this stock and the remaining components of the medium are to be set to ca. 50 °C before mixing.

2.3.3 Other Additives and Solutions

1. Spermidine (0.1 M): dissolve 255 mg spermidine in water to a final volume of 10 mL. Store at -20 °C.

2.4 Media for Leaf Bombardment

1. Prepare 1% plant agar containing 20 mg/mL benzimidazole and 20 mg/mL chloramphenicol.

202

Martin Becker and Goetz Hensel

2.5 Laboratory Supplies

1. PDS-1000/He gene gun (Bio-Rad). 2. Microcarrier: 0.6 μm gold particles (Bio-Rad, cat. # 1652262). 3. 900 psi rupture discs (Bio-Rad, cat. # 1652328). 4. Macrocarrier (Bio-Rad, cat. # 1652335). 5. Isopropanol. 6. Molecular sieves 3A, 2–5 mm (Alfa Aesar, cat. # L05359). 7. 100% ethanol ultrapure. 8. Silica gel blue, 2–4 mm, with indicator and beads (Carl Roth, cat # 2440.2).

3

Methods The mCherry reporter gene is used to evaluate the RNP transfer.

3.1 Growing the Donor Material for Leaf Bombardment

1. Germination is conducted in pots filled with soil substrate (see Note 2) in a growth chamber set to provide a 16 h photoperiod and a light/dark temperature regime of 14/12 °C. 2. A total number of 30–50 grains are placed in a single 2 L pot. 3. After 7–10 days, leaves are cut and processed as described below.

3.2

RNP Assembly

1. Hybridize the crRNA and tracrRNA to build the gRNA by pipetting per macrocarrier (per shot) 1.27 μL [=1.5 μg] crRNA [100 μM], 0.53 μL [=1.5 μg] tracrRNA [100 μM], and 3.2 μL IDT Duplex Buffer (IDT Integrated DNA Technologies). Mix carefully in a sterile standard Eppendorf tube. Heat 1 min to 95 °C and chill to RT within 20 min. 2. Dilute the Cas9 enzyme (see Note 3) per shot by adding 1.4 μL Cas9 enzyme [61 μM, stock = 10 μg/μL] with 3.6 μL PBS buffer (8 g/L NaCl, 0.2 g/L KCl, 1.42 g/L Na2HPO4, 0.24 g/L KH2PO4) with 50% glycerol to obtain 5 μL of a 20 μM Cas9 working solution. 3. Assemble the ribonucleoprotein complex by adding 8 μL sterile H2O, 2 μL NEBuffer™ r3.1 (New England Biolabs Inc.), 5 μL gRNA from step 1, and 5 μL Cas9-protein dilution from step 2 into a sterile standard Eppendorf tube in that order to a total volume of 20 μL. Incubate the RNP mix for 15 min at RT to build the RNP complex. Follow with the microcarrier coating process and place the RNP complex on ice until use.

3.3 Coating of Gold Particles with DNA and RNP Complexes

1. For the microcarrier preparation, weigh 50 mg gold particles (0.6 μm diameter, Bio-Rad 1,652,262) into a 1.5 mL microcentrifuge tube. Add 1 mL 70% (v/v) ethanol, vortex briefly, and let stand for 15 min. Centrifuge at 620 × g for 5 min.

RNP-Mediated Allele Replacement in Barley Leaves

203

Remove the supernatant and add 1 mL of sterile water. Centrifuge and discard the supernatant. Wash with water twice, then resuspend particles in 1 mL 50% (v/v) glycerol. 2. Mix 5 μL gold suspension per macrocarrier for coating with 5 μL 100% EtOH. Vortex vigorously and centrifuge in a benchtop centrifuge, removing the supernatant. Repeat the washing three times using sterile water instead of ethanol. Try to remove as much as possible of the supernatant without pipetting the pellet. 3. Add per macrocarrier 7.45 μL sterile H2O, 1 μL NEBuffer™ r3.1, 0.8 μL TransIT-2020 (Mirus Bio), 20 μL RNP complex from Subheading 3.2, step 3, and 0.75 μL mCherry plasmid [1 μg/μL; 202 fmol] and 10 μL repair template (1 μg/μL) in a total volume of 30 μL. Mix the microcarriers by pipetting up and down three times. Incubate for 10 min on ice, centrifuge at 4 °C with 8 × g for 30 s, and resuspend the coated microcarriers in 10 μL sterile H2O. 4. Spread the microcarriers evenly (see Note 4) on a macrocarrier using a 10 μL pipette in combination with 10 μL low-retention sterile tips. Place the macrocarriers on a sterile Petri dish filled with silica gel beads topped with sterile filter paper, and allow them to air-dry on a sterile bench until they are dehydrated. Alternatively, store them overnight in the closed Petri dish with the silica gel beads at 4 °C. 5. For DNA, proceed as described above without using TransIT-2020. Dissolve the microcarriers in 10 μL per macrocarrier with 100% ethanol, and spread them evenly on the macrocarrier. 3.4 Bombardment of Barley Leaves

1. Cut the 7–10-day-old leaves and place them with the adaxial side up on the medium mentioned above (see Note 5). 2. Adjust the helium pump so that a 1550 psi rupture disc burst will occur after 15 s (see Note 6). The vacuum chamber should be evacuated as fast as possible to reach -27 Hg (less than 30 s). The pressure release should take around 30 s. 3. Wash the macrocarrier and stopping screen in 70% (v/v) EtOH, and let them air-dry on a sheet of sterile filter paper in a laminar flow bench. Immediately before the biolistic transfer, wash the rapture disc in 100% isopropanol, and carefully place the rapture disc wet into the rupture disc holder (see Note 7). Mount the rapture disc holder using the short end of the torque wrench as tight as possible. Adjust the pressure of the helium tank to the rupture disc used.

204

Martin Becker and Goetz Hensel

4. Resuspend RNP-coated gold microcarriers carefully by vortexing at 1000 rpm with a maximum of three times for 2 s. Carefully distribute the microcarriers onto the microcarrier by producing microdroplets using a 10 μL conical low-retention pipetting tip and a 10 μL pipette. 5. Allow the RNP-coated macrocarrier to air-dry, place on a 12 cm Petri dish filled with silica gel pearls, and cover with a sterile round sheet of filter paper. 6. Bombard each plate filled with leaves twice with a distance of 3 cm (level 1) to the stopping screen with 1100 psi (rupture disc) (see Note 8). 7. Incubate the plates at 24 °C in the dark for 12–48 h, and examine them for mCherry, Gfp, and Yfp fluorescence (see Note 9; Fig. 1b).

4

Notes 1. All reagents must be dissolved/diluted in doubled distilled water unless specified otherwise. 2. The substrate is a 3:1:2 mixture of garden mold/sand/white and black peat (Klasmann Substrate 2). 3. Too high Cas9 enzyme concentration results in toxic effects and necrosis. 4. The macrocarrier is hydrophobic. The RNP solution is in water which makes an equal distribution of the microcarriers on the macrocarrier pretty tough. 5. One can fix the leaves with two magnetic stirring fishes in a 9 cm diameter Petri dish. 6. The gauge needs to display the correct shooting pressure at this time. 7. Placing the wet rupture disc into the rupture disc holder prevents every movement of the rupture disc during the mounting of the holder into the particle gun. By this procedure, the failing rate of the bombarding event can be reduced tremendously, and an equal bombarding pressure will be reached. 8. The coating and bombardment procedure may be optimized and controlled using a fluorescent reporter construct, e.g., encoding a red fluorescent protein. 9. Calculate the ratio between Gfp/Yfp-positive and mCherry cells to estimate your allele exchange efficiency (Fig. 1c).

RNP-Mediated Allele Replacement in Barley Leaves

205

Acknowledgement This work was supported by funding from the Federal Ministry of Education and Research (BMBF) under project ID 031B0547. We are grateful to the Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben for providing excellent working conditions for our research. References 1. Rajaraman J, Douchkov D, Lu¨ck S et al (2018) Evolutionarily conserved partial gene duplication in the Triticeae tribe of grasses confers pathogen resistance. Genome Biol 19:116. https://doi.org/10.1186/s13059-0181472-7 2. Panchy N, Lehti-Shiu M, Shiu S-H (2016) Evolution of gene duplication in plants. Plant Physiol 171:2294–2316. https://doi.org/10. 1104/pp.16.00523 3. Krattinger SG, Keller B (2016) Molecular genetics and evolution of disease resistance in cereals. New Phytol 212:320–332. https:// doi.org/10.1111/nph.14097 4. Chauhan H, Boni R, Bucher R et al (2015) The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley. Plant J 84:202–215. https://doi.org/10.1111/tpj.13001 5. Wachter RM, Elsliger M-A, Kallio K et al (1998) Structural basis of spectral shifts in the yellow-emission variants of green fluorescent protein. Structure 6:1267–1277. https://doi. org/10.1016/S0969-2126(98)00127-0 6. Budhagatapalli N, Hensel G (2022) Multiplexed genome editing in plants using

CRISPR/Cas-based endonuclease systems. In: Wani SH, Hensel G (eds) Genome editing. Springer, Cham, pp 143–169 7. Zhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2:100168. https://doi.org/10.1016/j.xplc.2021. 100168 8. Svitashev S, Schwartz C, Lenderts B et al (2016) Genome editing in maize directed by CRISPR-Cas9 ribonucleoprotein complexes. Nat Commun 7:13274. https://doi.org/10. 1038/ncomms13274 9. Budhagatapalli N, Rutten T, Gurushidze M et al (2015) Targeted modification of gene function exploiting homology-directed repair of TALEN-mediated double-strand breaks in barley. G3 (Bethesda) 5:1857–1863. https:// doi.org/10.1534/g3.115.018762 10. Budhagatapalli N, Schedel S, Gurushidze M et al (2016) A simple test for the cleavage activity of customized endonucleases in plants. Plant Methods 12:18. https://doi.org/10. 1186/s13007-016-0118-6

Chapter 14 Genome Editing in Chlamydomonas reinhardtii Using Cas9-gRNA Ribonucleoprotein Complex: A Step-by-Step Guide Dhananjay Dhokane, Nagesh Kancharla, Arockiasamy Savarimuthu, Bhaskar Bhadra, Anindya Bandyopadhyay, and Santanu Dasgupta Abstract Genome editing technologies have provided opportunities to manipulate literally any genomic location, opening new avenues for reverse genetics-based improvements. Among them, CRISPR/Cas9 is the most versatile tool for genome editing applications in prokaryotes and eukaryotes. Here, we provide a guide to successfully carry out high-efficiency genome editing in Chlamydomonas reinhardtii using preassembled CRISPR/Cas9-gRNA ribonucleoprotein (RNP) complexes. Key words Chlamydomonas reinhardtii, CRISPR-Cas9, Genome editing, Ribonucleoprotein, Transformation

1

Introduction Apart from biofuel production, microalgae are gaining attention as green bio-factories due to their rapid growth in a short span of time by fixing atmospheric CO2 and comprising enhanced biomass enriched with various components for industrial applications [1]. Among microalgae, Chlamydomonas reinhardtii (C. reinhardtii) is a well-established model organism for basic and applied research. Various techniques have been applied to enhance algal biomass, biofuel production, and bio-products; among them, genome editing is the most favorable method to enhance capabilities of microalgae [2, 3]. Due to low genome editing efficiencies in microalgae, CRISPR/Cas9 is the first tool of choice due to its versatility and ease of application. In recent years, CRISPR/Cas9 methodology has accelerated successful genome editing in various prokaryotes and eukaryotes including green alga [2]. Its ability to perform high-precision genome editing at target loci with accuracy,

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_14, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

207

208

Dhananjay Dhokane et al.

simplicity, specificity, and efficiency enables fast gene knock-out and knock-in through homologous recombination. There are several approaches to introduce CRISPR components into the cells including plasmid vectors, RNAs, and ribonucleoproteins (RNPs) [2]. Cas9-gRNA RNP has become the method of choice for genome editing of C. reinhardtii with several advantages like DNA/transgene-free editing, reduced off-target modifications, no need for Cas9 codon optimization, no apprehension about choosing right promoters for the expression of Cas9 and gRNA, and reduced Cas9 toxicity as it is present transiently and is degraded by endogenous proteases in the cell [4]. With RNP- based approach, it is possible to titrate the dosage of Cas9 nuclease and gRNA for improved editing efficiencies [5]. This protocol provides a detailed step-by-step guide for carrying out Cas9-gRNA RNP-based genome editing in C. reinhardtii. It is likely that this protocol can be extended to other industrially important microalgae to carry out genomic modifications.

2

Materials 1. Axenic culture of C. reinhardtii. 2. Tris-acetate-phosphate (TAP). 3. Agar. 4. Agarose. 5. In vitro transcribed purified gRNAs. 6. TrueCut Cas9 protein v2 (Thermo Fisher Scientific). 7. Cas9 nuclease buffer (New England Biolabs). 8. TAP-40 mM sucrose solution. 9. DNase I. 10. Invitrogen™ precision gRNA synthesis kit (Thermo Fisher Scientific). 11. Q5 hot start high-fidelity 2× master mix (New England Biolabs). 12. Primers. 13. PureLink genomic DNA mini kit (Thermo Fisher Scientific). 14. Nuclease-free water. 15. DNA clean and concentrator kit (Zymo Research). 16. MAX Efficiency™ transformation reagent for algae (Thermo Fisher Scientific). 17. Sterilized conical flasks. 18. Petri plates.

Genome Editing in Chlamydomonas Using CRISPR-Cas9 RNP

209

19. Sterile 15 and 50 mL centrifugation tubes. 20. Incubator/Kuhner shaker. 21. Centrifuge. 22. Gyrotary shaker. 23. Agarose gel electrophoresis system (Bio-Rad Laboratories). 24. NanoDrop 2000 spectrophotometer (Thermo Scientific). 25. 0.2 cM cuvette. 26. Gene Pulser Xcell electroporation systems. 27. Thermal cycler PCR machine.

3

Methods

3.1 Bioinformatic Analysis 3.1.1 Gene Selection and Sequence Retrieval

Based on your research goals, select the target gene(s) to be targeted. Download the gene sequence from NCBI (https://www. ncbi.nlm.nih.gov/) if the gene is annotated. Alternatively, look for homolog of the gene in closely related species and perform BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) search against C. reinhardtii genome and retrieve the scaffold/contig that has sequence similarity. Run the contig through a gene prediction software like Augustus (http://bioinf.uni-greifswald.de/ augustus/) providing C. reinhardtii as the reference organism. Once you have identified the predicted gene sequences, perform BLAST search to get complete gene sequence for your gene of interest. Mark exons and introns so that it helps you to design your guide RNAs (gRNAs) targeting the initial exons (see Note 1).

3.1.2 Designing of gRNAs

Guide RNAs can be designed either manually or using available online resources. Online tools like CRISPOR, E-CRISP, CRISPRGE, and Benchling are used to design target-specific gRNAs. Make sure the selected target sequences for the intended guide RNA are followed by a protospacer adjacent motif (PAM) (Fig. 1a) (see Note 2). The protospacer sequence changes based on the Cas9 nuclease that you will be using. The PAM sequence for wild-type Streptococcus pyogenes Cas9 nuclease (SpCas9) is 5′-NGG-3′ (N is any nucleotide). Design at least three to four gRNAs targeting each gene since it will reduce the time downstream, just in case if a guide RNA fails to cleave the target in vitro (see Note 3).

3.1.3 Off-Target Predictions

Off-targets will lead to unintended changes in the genome, and hence, it is very important to assess if the gRNAs designed are very specific (see Note 4). You can manually BLAST search the designed gRNAs against the available C. reinhardtii genome sequence and determine if they perfectly hit the gene(s) of interest. Online tool like Cas-OFFinder (http://www.rgenome.net/cas-offinder/) is

210

Dhananjay Dhokane et al.

Fig. 1 Schematic representation of target gene selection, gRNA design, steps for in vitro gRNA synthesis, and demonstration of in vitro cleavage assay. (a) Target gene sequence and designing of gRNA (red colored sequence) followed by PAM sequence (marked yellow). (b) shows designing of overlapping primers to assemble gRNA-DNA template for in vitro gRNA synthesis. (c) Agarose gel showing gRNA-DNA template successfully assembled; a 120 bp band indicates the successful assembly of T7 promoter + target-specific gRNA sequence and tracrRNA sequence. (d) Agarose gel showing in vitro transcribed RNAs. A 100 bp discrete band indicates good-quality RNA. (e) Demonstration of in vitro cleavage assay. M-1 kb plus ladder: 1 and 2, target gene fragment incubated with two different gRNAs and Cas9 protein show successful cleavage at target loci, producing two bands; 3, target gene fragment incubated with only gRNA; 4, target gene fragment incubated with only Cas9 protein; 5, target gene fragment incubated without gRNA and Cas9 protein; hence, there is no cleavage seen in 3–5, as expected

often used to find potential off-target sites. Designing guides very specific to the gene of interest reduces downstream experiments that would be laborious and cost intensive (see Note 4). 3.2 Preparation of CRISPR Tools 3.2.1 gRNA Expression Cassette Construction and In Vitro Transcription

Invitrogen™ precision gRNA synthesis kit is used to assemble gRNA DNA template and for in vitro transcription of gRNAs (https://www.thermofisher.com/order/catalog/product/A293 77). The gRNA DNA template is assembled using two overlapping oligos having target-specific gRNA sequence and overlapping sequence of T7 promoter and tracrRNA sequence in a two-step PCR reaction (Fig. 1b). The PCR reaction is set up as follows: Component

Quantity (μL)

Phusion™ High-Fidelity PCR Master Mix (2×)

12.5

Tracr Fragment + T7 Primer Mix

1.0 (continued)

Genome Editing in Chlamydomonas Using CRISPR-Cas9 RNP

Component 0.3 μM Target F1/R1 oligonucleotide mix Nuclease-free water

211

Quantity (μL) 1.0 10.5

Upon completion of PCR reaction, 2 μL of PCR product is checked on 1% agarose gel to confirm successful template assembly. The PCR should yield a 120-base pair (bp) amplicon (Fig. 1c) (see Note 5). This gRNA DNA template is used as a template in an in vitro transcription (IVT) reaction. The IVT reaction is set up as follows by adding the reaction components in the order given below: Component

Quantity (μL)

NTP mix (100 mM each of ATP, GTP, CTP, UTP)

8.0

gRNA DNA template

6.0

5× TranscriptAid™ Reaction Buffer

4.0

TranscriptAid™ Enzyme Mix

2.0

Upon addition of all the components, give a short spin and incubate the tubes at 37 °C for 2–3 h. If higher concentrations of RNA are needed, extend the incubation period to overnight (see Note 6). Add 1 μL of DNase I into the reaction mix after the transcription reaction and incubate at 37 °C for 15 min. 3.2.2 Purification of gRNAs

Adjust the volume of the IVT reaction to 200 μL with nuclease-free water, and carry out the purification using gRNA cleanup kit provided in the Invitrogen™ precision gRNA synthesis kit by following the steps mentioned below: (a) Add 100 μL of binding buffer to the IVT reaction and mix thoroughly by pipetting. (b) Add 300 μL of ethanol (>96%) and mix by pipetting. (c) Transfer the mix to the RNA purification micro column and centrifuge for 30 s at 12,000 rpm and discard the flowthrough. (d) Add 700 μL wash buffer 1 and centrifuge for 30 s at 12,000 rpm and discard the flow-through. (e) Add 700 μL wash buffer 2, centrifuge for 30 s at 12,000 rpm, and discard the flow-through. (f) Centrifuge the empty purification column for 60 s at maximum speed to completely remove any residual wash buffer and transfer the purification column to a clean 1.5 mL collection tube.

212

Dhananjay Dhokane et al.

(g) Add 10 μL of nuclease-free water to the center of the purification column filter, and centrifuge for 60 s at 12,000 rpm to elute the gRNA (see Note 7). (h) The purified gRNA can be immediately used or stored at -80 °C for long-term use (see Note 7). 3.2.3 Quantification of gRNAs

Dilute the purified gRNAs 1:100 and quantify using NanoDrop 2000 spectrophotometer and check on 1.5% agarose gel for its integrity. You should see a 100 bp amplicon on agarose gel (Fig. 1d). A clear intact band on gel confirms its excellent quality and has not been sheared/degraded (see Note 8).

3.2.4 Cas-Associated Protein 9 (Cas9) Nuclease

Cas9 protein is available commercially, e.g., TrueCut Cas9 Protein v2 is available from Invitrogen (Thermo Fisher Scientific) (https:// www.thermofisher.com/order/catalog/product/A36496). TrueCut Cas9 nuclease is recombinant Streptococcus pyogenes Cas9 (wild-type) protein, purified from E. coli, for genome editing. Cas9 forms a very stable ribonucleoprotein (RNP) complex with the gRNA component of the CRISPR/Cas9 system. Nuclear localization signal (NLS) has been incorporated that aids delivery to the nucleus, increasing the rate of genomic DNA cleavage. You can also clone, express, and purify Cas9 protein in your lab and use it instead of TrueCut Cas9 protein for downstream editing experiments.

3.2.5 In Vitro Cleavage Demonstration

Performing in vitro cleavage assay is very important as it validates the designed gRNAs are specific to the target of interest and effective in cleaving the target sequence. This due diligence will save lot of your time and labor downstream (see Note 9). To perform the in vitro cleavage assay, extract the genomic DNA from the C. reinhardtii, then amplify the target gene fragment on which you have designed the gRNAs using gene-specific primers, and purify the fragment to further use it as a template in the assay. The in vitro cleavage reaction is set up in a total volume of 30 μL and consists of the following components: Component

Quantity (μLl)

Nuclease-free water

24.0

Cas9 nuclease (150 ng/μL)

1.0

Target-specific gRNA (100 ng/μL)

1.0

Cas9 nuclease buffer

3.0

Incubate @ 37 °C for 10 min Purified target gene fragment (100 ng/μL)

1.0

Incubate overnight @ 37 °C (see Note 10) Proteinase K Incubate at 65 °C for 10 min

1.0

Genome Editing in Chlamydomonas Using CRISPR-Cas9 RNP

213

Run the reaction mix on 1% agarose gel to check the expected sized amplicons. You should see two bands of the expected size on agarose gel when Cas9 cleaves the target template (Fig. 1e). Ensure you have proper controls by incubating the target template with only gRNA or Cas9 protein which should not produce any cleavage in the target template (see Note 9). 3.3

Cell Preparation

3.3.1 Culture Scale-Up

Retrieve a tube of cryo-preserved stock of C. reinhardtii strain from -80 °C, and use it to inoculate 10 mL of TAP medium in a sterilized conical flask (Fig. 2a). Incubate the flask in dark at 26 °C for 2 days and then under moderate light intensities of cool fluorescent white light (50 ± 10 μE m-2 s-1). Once the culture is revived, keep regularly subculturing and raise the culture for transformation experiments. Use 1 × 106 cells/mL for transformation experiments.

3.3.2 Competent Cell Preparation

Harvest 25 mL culture for each transformation event by centrifugating at 2500 rpm for 5 min (see Note 11). Carefully discard the supernatant and resuspend the pellet in 10 mL of GeneArt® MAX Efficiency transformation reagent (Thermo Fisher Scientific, Carlsbad, CA) and centrifuge the cells at 2500 rpm for 5 min. Discard the supernatant and once again resuspend the cells in 10 mL of GeneArt® MAX Efficiency transformation reagent and centrifuge at 2500 rpm for 5 min. Discard the supernatant and resuspend the cells in 250 μL of GeneArt® MAX Efficiency transformation reagent for transformation.

3.4 Transformation of CRISPR Tools

Take 7.5 μg of purified gRNA stored at -80 °C and 5 μg of TrueCut Cas9 protein for each transformation and mix well in 0.2 mL PCR tube and incubate at 37 °C for 15 min to form an active Cas9gRNA RNP complex for transformation in the cells [6] (Fig. 2b, c) (see Note 12).

3.4.1 Formation of Cas9gRNA RNP Complex 3.4.2 Transformation of CRISPR Tools

For each transformation event, take 250 μL of cells suspended in GeneArt® MAX Efficiency transformation reagent (https://www. thermofisher.com/order/catalog/product/A24229) and add the pre-assembled Cas9-gRNA RNP complex and incubate on ice for 5 min (Fig. 2d). Transfer the mix (cells + Cas9-gRNA RNP complex) to an ice-cold 0.2 cm cuvette (Fig. 2e). Place the cuvette in the cuvette chamber of Gene Pulser Xcell Total (Bio-Rad, USA). Electroporate the cells using the setting as follows: voltage, 500 V; capacity, 50 μF; and resistance, 800 Ω.

3.4.3 Incubation and Growth

After electroporation, place the cells at room temperature for 15–30 min for recovery. Transfer the cells to a sterile flask containing 10 mL of TAP-40 mM sucrose, and incubate at 35 °C for 14–16 h under continuous low illumination (6) (see Note 13). Transfer the cells to 15 mL sterile centrifuge tube and centrifuge at 2500 rpm for 5 min. Suspend the pellet in 200–250 μL of TAP

214

Dhananjay Dhokane et al.

Fig. 2 Diagrammatic representation of steps involved in carrying out genomic modifications in C. reinhardtii using Cas9-gRNA RNPs. (a) Culturing C. reinhardtii aseptically for transformation experiments, the cells are treated with MAX Efficiency reagent to make them competent to take foreign nucleic acids. (b) Cas9 nuclease and in vitro transcribed target-specific gRNA are mixed to form an active RNP complex. (c) Shows the formation of active RNP complex formation. (d) Active RNP complex is added to cells treated with MAX Efficiency reagent. (e) Cells + RNP mix is added to ice-cold 0.2 cm electroporation cuvette and electroporated using Gene Pulser Xcell Total. (f) After electroporation, cells are plated on TAP plate fortified with selection agent, and colonies will be visible 5 days post-plating. (g) Putative colonies are patched on the same selection plate to confirm the clones. (h) Culture is raised from loopful grown clones for genomic DNA extraction for amplification of target gene fragment. Wild-type genomic DNA is also extracted that serves as a control in the downstream experiments. (i) Target gene fragment where we designed gRNA sequence is amplified using target-specific primers. The fragment is purified using DNA clean and concentrator kit and sent for Sanger sequencing. (j) Shows multiple sequence alignment of the wild-type (WT) target gene fragment with mutants (M). PAM sequence is marked in red. See different kinds of mutations in the proximity of PAM sequence (insertion/deletion (indels), base substitutions, etc., demonstrating successful editing at the target loci

and plate the cells on TAP agar plates fortified with the right selection agent (antibiotics) for selection of mutants and incubate under continuous low illumination (Fig. 2f) (see Note 14). 3.5 Screening and Sequencing of Clones 3.5.1 Genomic DNA Extraction

The colonies that appear on selection plate are patched on the same media plate and incubated till proper growth is visible (Fig. 2g). Take a loopful of culture from the patched plate and inoculate in 5–10 mL of TAP media and incubate at 26 °C under moderate light intensities of cool fluorescent white light (50 ± 10 μE m-2 s-1) for 2 days (Fig. 2h). Harvest the cells by centrifuging at 2500 rpm for 10 min, and proceed with extraction of the genomic DNA using

Genome Editing in Chlamydomonas Using CRISPR-Cas9 RNP

215

PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific, Carlsbad, CA). Quantify the DNA extracted using NanoDrop 2000 Spectrophotometer (Thermo Scientific, USA), and check on 0.8% agarose gel. 3.5.2 Target Fragment Amplification and Cleanup

Use a pair of gene-specific primers that amplifies the target gene fragment within which you have designed the gRNA(s) (Fig. 2i) (see Note 15). Design primers such that you get 800 bp amplicon, so that it will be easier to get complete region sequenced using Sanger sequencing. Purify the PCR product using DNA clean and concentrator kit (Zymo Research, Germany).

3.5.3 Sanger Sequencing, Analysis of Sequenced Reads, and Identification of Mutations

Send 10 μL of 50–100 ng/μL of PCR purified product for Sanger sequencing, and sequence each purified PCR product with forward and reverse primer (see Note 16). Once you receive the sequenced reads, download the sequence, and paste it in word file. Perform multiple sequence alignment with the target reference sequence using ClustalW (https://www.genome.jp/tools-bin/clustalw) or MultAlin (http://multalin.toulouse.inra.fr/multalin/), and identify the type of mutations in close proximity of PAM sequence (Fig. 2j). As the cleavage site, in case of SpCas9 is always three base upstream of PAM site, you should see insertion/deletions or base substitution kind of mutations there.

4

Notes 1. Design your gRNAs targeting the first or second exon so that it results in early frameshift, which will ultimately lead to a premature stop codon, creating a gene knock-out with high frequencies. 2. Streptococcus pyogenes Cas9 always makes double-stranded breaks three base pairs upstream of the sequence motif (NGG). This motif is known as protospacer adjacent motif (PAM). Make sure there is -NGG sequence motif immediately downstream of the 3′ end of the target region. The PAM is present in the target DNA, but not the crRNA that targets it. 3. Design gRNAs of 18–20 nucleotides in length; the length of gRNA can significantly affect the degree of cleavage. As cleavage efficiency depends on several factors, therefore, it is recommended you at least design three to four gRNAs per target. 4. Ensure there are no off-targets to the designed gRNAs. Designing guides less than 20 bp (preferably 18 bp) results in lower off-target cleavage, and higher specificity is observed [7]. These nonspecific and unintended genetic modifications more likely would have deleterious effects on the cell and lead to potentially misleading and non-reproducible results.

216

Dhananjay Dhokane et al.

5. Always check your gRNA DNA cassette assembled on 1% agarose gel. The expected size amplicon of 120 bp on gel indicates the successful assembly of all three fragments (T7 promoter + target-specific gRNA + tracrRNA). 6. Longer incubation times up to 12 h of IVT reactions have been shown to improve the concentrations of RNA produced. You can double the amounts used in the IVT reaction, if higher gRNA yield is required. 7. Proper storage of RNA is very important to avoid RNA degradation. Make sure you purify your gRNAs in RNase-free water and store at -80 °C for long-term storage. Use RNaseZap when you are dealing with RNA preparation and purification part. 8. Run your gRNAs prior to its use in vitro or in vivo on 1.5–2% agarose gel to make sure there is no degradation. A discreet band of 100 bases indicates intact RNA. 9. In vitro cleavage assay is the proxy of how efficiently CRISPR tools might work in in vivo. Hence, it is always advisable to conduct in vitro cleavage assay, prior to use of RNP complex in vivo. Also make sure to have right controls where you incubate the target fragment either without target-specific gRNA or Cas9 nuclease, which should not yield any cleavage pattern. 10. Short duration incubation of target template with RNP complex for in vitro cleavage demonstration cleaves the target template partially. Hence, it is recommended to incubate the mix overnight to expect complete cleavage. 11. Carry out all the centrifugations at 25 °C. 12. Always make sure you incubate target-specific gRNA and Cas9 protein at 37 °C for 15 min to form an active RNP complex, prior to its use in vitro or in vivo. 13. As Cas9 nuclease activity is highest at 37 °C and C. reinhardtii can grow well till 35 °C, incubate the cells after RNP transformation at 35 °C. Incubation of cells at higher temperature above 32 °C improved Cas9 activity and the editing frequency [8]. 14. After plating the cells on selection plates, do not stack them, to allow continuous uniform illumination. 15. Make sure you design primers such that you amplify the target gene fragment on which you have designed the gRNAs. Proper designing of primers that carry the gRNA sequence(s) will help to identify the kind of mutations that occured at the cleavage site. 16. Sequence the purified PCR product with forward and reverse primer so that you get two reads for each product to assure the type mutations that occurred.

Genome Editing in Chlamydomonas Using CRISPR-Cas9 RNP

217

Acknowledgments Authors highly appreciate the infrastructural support that Reliance Industries Ltd. has provided to conduct algal research. References 1. Ghribi M, Nouemssi SB, Meddeb-Mouelhi F, Desgagne´-Penix I (2020) Genome editing by CRISPR-Cas: a game change in the genetic manipulation of Chlamydomonas. Life 10(11): 295 2. Naduthodi MIS, Mohanraju P, Su¨dfeld C, D’Adamo S, Barbosa MJ, van der Oost J (2019) CRISPR-Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1. Biotechnol Biofuels 12(66):1–11 3. Patel VK, Soni N, Prasad V, Sapre A, Dasgupta S, Bhadra B (2019) CRISPR-cas9 system for genome engineering of photosynthetic microalgae. Mol Biotechnol 61(8):541–561 4. Yu J, Baek K, Jin E, Bae S (2017) DNA-free genome editing of Chlamydomonas reinhardtii using CRISPR and subsequent mutant analysis. Bio-protocol 7(11):e2352

5. Zhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2(2):100168 6. Dhokane D, Bhadra B, Dasgupta S (2020) CRISPR based targeted genome editing of Chlamydomonas reinhardtii using programmed Cas9-gRNA ribonucleoprotein. Mol Biol Rep 47(11):8747–8755 7. Fu Y, Sander JD, Reyon D, Cascio V, Joung KS (2014) Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol 32(3):279–284 8. Milner MJ, Craze M, Hope MS, Wallington EJ (2020) Turning up the temperature on CRISPR: increased temperature can improve the editing efficiency of wheat using CRISPR/ Cas9. Front Plant Sci 11:583374. https://doi. org/10.3389/fpls.2020.583374

Part IV Generation and Analysis of Engineered Lines

Chapter 15 Highly Efficient Gene Knockout in Medicago truncatula Genotype R108 Using CRISPR-Cas9 System and an Optimized Agrobacterium Transformation Method Tom Lawrenson, Nicola Atkinson, Macarena Forner, and Wendy Harwood Abstract Medicago truncatula is the model plant species for studying symbioses with nitrogen-fixing rhizobia and arbuscular mycorrhizae, where edited mutants are invaluable for elucidating the contributions of known genes in these processes. Streptococcus pyogenes Cas9 (SpCas9)-based genome editing is a facile means of achieving loss of function, including where multiple gene knockouts are desired in a single generation. We describe how the user can customize our vector to target single or multiple genes, then how the vector is used to make M. truncatula transgenic plants containing target site mutations. Finally, obtaining transgenefree homozygous mutants is covered. Key words Medicago, Transformation

1

R108, Mutant,

CRISPR,

Cas9,

Gene

knockout,

Agrobacterium,

Introduction Medicago truncatula is a small annual legume native to the Mediterranean region that is used in genomic research. This species is studied as a model organism for legume biology because of its small diploid genome, self-fertility, rapid generation time, sequenced genome, and amenability to genetic transformation. It forms symbioses with nitrogen-fixing rhizobia and arbuscular mycorrhizae, whereas the model plant Arabidopsis thaliana does not, making M. truncatula an important tool for studying these processes. CRISPR/SpCas9 has become a go-to method for gene function studies in many plant species [1], including Medicago truncatula [2]. It is most commonly used to produce “edited” loss-of-function mutants resulting from imperfect DNA repair at the target site break created by Cas9. In order to allow genome editing, the Cas9 nuclease must complex with a guide RNA (gRNA), which, by nature of DNA/RNA base pairing, gives

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_15, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

221

222

Tom Lawrenson et al.

mutagenic specificity to homologous target sequence in the genome of interest [3]. The gRNA is composed of two elements, firstly a non-variable sequence with secondary structure that serves as a binding scaffold for the Cas9 nuclease and secondly a variable protospacer sequence [4]. This protospacer represents 20 nucleotides of the target sequence, and by manipulating this, the location of genomic mutations can be controlled. A wide array of CRISPR/ SpCas9 systems exist utilizing different coding sequences, promoters, terminators, and guide expression architectures [5]. It is now becoming clear that what works well in one plant species often does not work well in another and in order to achieve high editing efficiency, trialing different components and optimization are necessary. Selecting a highly efficient CRISPR system for any particular species is desirable as this determines the number of transgenic plants required and can allow simultaneous knockout of multiple genes in a single generation. We trialed a 35S-driven SpCas9-P2ACys4 transcriptional fusion in conjunction with a CmYLCV polymerase II promoter-driven single transcript containing multiple guides [2]. Our trialing over 12 Medicago truncatula target genes (unpublished) confirmed the SpCas9-P2A-Cys4 system as highly effective, giving complete knockout in a single generation. Our genes were addressed in multiplex using up to 9 guides per construct, allowing all attempted combinations of single, double, and triple knockouts to be attained in 1 generation from 12 primary transgenics per construct or less. We present here our protocol for highly efficient Cas9-P2ACys4 mutagenesis of Medicago truncatula genes, from construct assembly to transgene-free edited plants. We describe and make available a single plasmid vector containing all necessary editing components except for the gRNAs, which will be cloned in one or two steps by the user. gRNAs are cloned in using PCR products and type II restriction endonucleases making it cheap and available to most labs. We have inserted between one and nine guides into this vector, making this plasmid easily adaptable to single gene or multigene knockouts. The Cas9-P2A-Cys4 M. truncatula system has been described [6] although it is modified here to allow one or two separate gRNA cloning steps instead of a fixed one step. This is a beneficial feature allowing a greater number of gRNAs to be added than previously reported (at least nine here compared to six before). Additionally, here, we describe the tissue culture-based transformation of Medicago truncatula genotype R108 and screening procedure used to obtain transgene-free edited plants. The user will decide how many guide gRNAs they wish to include in their vector which in turn will depend on how many genes are being simultaneously targeted. We were successful in targeting from one to three genes simultaneously by using three or four guides per gene, meaning a total of nine guides for a triple knockout. More guides targeting each gene will likely increase the

Gene Knockout in Medicago truncatula Genotype R108

223

efficiency of mutagenesis although this must be balanced against the risk of unwanted off-target activity [7]. Once defined, one or more protospacer sequences can be fused to one or more non-variable gRNA and CYS4 recognition sequences to produce a single or multi-guide array [2]. From this, the CmYLCV promoter will produce a single transcript that is processed into individual guides by the CYS4 protein. Guide cloning is done by designing long primer pairs which will contain these sequences as well as BsaI and/or Esp3I recognition sites, followed by PCR against a plasmid template containing the non-variable region of the SpCas9 sgRNA sequence. Short amplicons are produced for cloning into the accepter vector in either one or two steps to arrive at the final construct. Splitting the guide cloning into two steps gives the potential to include more guides in the final construct as cloning efficiency is inversely proportional to the number of fragments (guides) ligated in any one step. We had no problem cloning up to five guides in one step and nine in two steps. It may be possible to insert even more than nine guides as we did not exceed the maximum possible in our experiments. The final construct containing the desired array of guides is transformed into Agrobacterium tumefaciens. Freezer stocks made of the Agrobacterium containing the final construct enable easy culture of inoculation medium at the appropriate time. Before the process of Medicago transformation can begin, aseptically grown plants aged 4 weeks are produced. These provide the explant leaf material used in the Agrobacterium infection process, which involves needle wounding of the leaf. The infected leaves are co-cultivated with the Agrobacterium for 24–30 h before moving to selective callus induction media to encourage the proliferation of transgenic callus. After at least 8–12 weeks, the callus is moved to embryo induction media for at least 2 more weeks before embryos/ shoot primordia become visible. Once shoots are big enough, they are moved to a root-inducing media and from here directly to a soil medium, where they establish before being sampled for genomic DNA. This DNA is used in a PCR/Sanger sequencing screen to identify target site mutations, from which useful T0 lines are identified for growing on to maturity and seed production. T1 plants which have inherited homozygous mutations and lost the T-DNA through segregation are then identified, leaving the user with homozygous mutants which can be used to bulk seed and phenotype. The high-efficiency Medicago truncatula transformation method described here is specifically tailored to the genotype R108, previously reported to yield transgenic plants from juvenile leaflets [8–10], and is improved by a combination of novel explant preparation, precise explant handling, correct explant orientation during co-cultivation, and the inclusion of post-co-cultivation washing [11]. The explant inoculation, co-cultivation, and

224

Tom Lawrenson et al.

post-co-cultivation techniques used here result in reliable, highefficiency M. truncatula R108 transformation through a combination of optimal tissue exposure to Agrobacterium and reduced explant necrosis often caused by Agrobacterium overgrowth or excess physical tissue damage during explant manipulations. In addition, the application of phosphinothricin (PPT) as the selective agent results in highly efficient selection of transformed callus which can be rapidly regenerated. This protocol is therefore ideal for application in high-throughput gene-editing projects.

2

Materials

2.1 Adding Guides to Vector and Transformation of Agrobacterium tumefaciens

1. Computer with internet access. 2. Guide accepter plasmid. EC64422 Addgene# 191768. 3. Plasmid containing non-variable gRNA sequence, e.g., Addgene# 191769. 4. Phusion DNA polymerase and buffer (New England Biolabs M053OS). 5. Set of four dNTPs. 6. Molecular biology-grade agarose for electrophoresis (Melford 9012-36-6). 7. 10× TBE gel running buffer. 8. Agarose gel casting apparatus and electrophoresis power supply. 9. 100 bp DNA ladder. 10. Gel extraction kit. 11. Bovine serum albumin (BSA) – molecular biology grade. 12. T4 DNA ligase and buffer. 13. BsaI restriction enzyme. 14. Esp3I restriction enzyme. 15. EcoRI restriction enzyme. 16. XhoI restriction enzyme. 17. Library efficiency competent E. coli cells. 18. AGL-1 Agrobacterium electrocompetent cells. 19. Electroporator. 20. X-Gal stock: Prepare a 20 mg/mL stock solution of X-Gal in dimethylsulfoxide (DMSO). Store frozen. 21. 1 M IPTG stock: Dissolve 2.38 g of IPTG in 10 mL distilled H2O. Filter-sterilize. Store frozen.

Gene Knockout in Medicago truncatula Genotype R108

225

22. 2× PCR master mix (Qiagen 201443). 23. Miniprep kit (Qiagen 27104). 24. LB medium (1 L): 10 g tryptone, 5 g sodium chloride, 5 g yeast extract, 1 L distilled H2O. Add 7.5 g agar for solid media or without for liquid. Autoclave. 25. Rifampicin (25 mg/mL): Dissolve in DMSO. 26. Kanamycin (50 mg/mL): Dissolve in distilled H2O. Filtersterilize. 27. Shaking and static incubators set for 28 °C and 37 °C. 28. Thermocycler for PCR. 29. Fresh scalpel blades. 2.2 Medicago truncatula Growth to Produce Explant Material for Agrobacterium Transformation

1. Medicago truncatula seeds of genotype R108. 2. Concentrated sulfuric acid (H2SO4) 98% (Sigma Merck 258105). 3. 10% sodium hypochlorite solution (containing 1% active chlorine). 4. Sterile water. 5. SH vitamin stock solution (1000×) (see Note 1): 0.5 g nicotinic acid, 0.5 g thiamine HCl (vitamin B1), 0.5 g pyridoxine HCl (vitamin B6), distilled water to 100 mL. Filter-sterilize. Store at 4 °C. 6. SbH10 germination medium (1 L): 3.183 g Schenk and Hildebrandt basal salts, 1 g myo-inositol (see Note 2), 10 g sucrose. Dissolve in 900 mL distilled water. Adjust to pH 5.8 and bring volume to 1 L with distilled water. Add 6 g agarose. Autoclave. When cooled to 60 °C, add 1 mL of SH vitamin stock solution. 7. Magenta vessels 76 × 76 × 102 mm (SPL Life Sciences MAG-GA7). 8. Magenta vessel lids (SPL Life Sciences MAG-GA7COVER). 9. Magenta vessel connector (SPL Life Sciences 310074). 10. Growth room with light at 100 μmol/m2/s (16 h/8 h day/ night) and temperature of 24 °C/20 °C. 11. Laminar flow hood. 12. Autoclave. 13. Long forceps, 30 cm (Duchefa F3003.0001). 14. 3M™ Micropore™ Medical Tape, 25 mm wide (3 M HealthCare: 1530-0).

226

Tom Lawrenson et al.

2.3 Medicago Transformation, T0 Plant Production, and T1 Seed Production

1. N6 Major salt stock solution (10×) [8]: 1.85 g of MgSO4·7H2O, 28.3 g KNO3, 4.63 g (NH4)2SO4, 1.66 g CaCl2 ∙2H2O, 4.00 g KH2PO4, distilled water to 1 L. Store at 4 °C.

2.3.1

2. SH Minor salt stock solution (1000×) [8]: 13.2 g MnSO4·4H2O, 5 g H3BO3, 1 g ZnSO4·7H2O, 1 g KI, 0.1 g Na2MoO4·2H2O, 0.2 g CuSO4·5H2O, 0.1 g CoCl2·6H2O, distilled water to 100 mL. Store at 4 °C.

Stock Solutions

3. SH vitamin stock solution (1000×), according to [8]: 0.5 g nicotinic acid, 0.5 g thiamine HCl (vitamin B1), 0.5 g pyridoxine HCl (vitamin B6), distilled water to 100 mL Store at 4 °C. 4. FeNaEDTA salt stock solution (100×): Dissolve 2 g in 1 L of distilled water. Store at 4 °C. 5. 2,4-D stock solution (1 mg/mL): Dissolve 20 mg 2,4-dichlorophenoxy acetic acid (2,4-D) in a few drops of ethanol and make up to 20 mL with distilled water. Filtersterilize and store as 1 mL aliquots at -20 C. 6. BAP stock solution (1 mg/mL): Dissolve 20 mg BAP in a few drops of NaOH and make up with distilled water to 20 mL. Filter-sterilize and store as 1 mL aliquots at -20 °C. 7. Kinetin stock solution (1 mg/mL): Dissolve 10 mg kinetin in small quantity of water and then make up with distilled water to 10 mL. Filter-sterilize and store as 1 mL aliquots at -20 °C. 8. Cefotaxime stock solution (200 mg/mL): Dissolve 5 g cefotaxime in 25 mL distilled water. Filter-sterilize, and store as 1 mL aliquots at -20 °C. 9. Timentin stock solution (200 mg/mL): Dissolve 5 g timentin in 25 mL distilled water. Filter-sterilize, and store as 1 mL aliquots at -20 °C. 10. Phosphinothricin (PPT) stock solution (10 mg/mL): Dissolve 100 mg PPT in 10 mL distilled water. Filter-sterilize, and store in 1 mL aliquots at -20 °C. 11. Rifampicin stock solution (25 mg/mL): Dissolve 0.5 g rifampicin powder in 20 mL DMSO, and store as 1 mL aliquots at 20 °C. 12. Silwet L-77 stock solution (1% v/v): Add 1 mL Silwet L-77 to 99 ml distilled water, filter-sterilize, and store at room temperature in 10 mL aliquots. 13. Acetosyringone stock solution (100 mM): Dissolve 0.196 g acetosyringone powder in 10 mL DMSO. Store in 1 mL aliquots at -20 °C. 14. KOH stock solution for pH adjustment: Add 5.6 g of KOH to 100 mL to make a 1 N stock solution. For a 0.1 N stock

Gene Knockout in Medicago truncatula Genotype R108

227

solution, take 10 mL of the 1 N stock solution and add 90 mL distilled water. 15. HCL stock solution for pH adjustment: Take 10 mL of concentrated HCl (37%, 12 N) and add 110 mL of distilled water. 2.3.2

Media

To prepare 1 L of each of the media below, add the solid components to the liquid media stock solutions (except for the solidifying agents Agar, Phytagel, or Phyto Agar which are added directly to the dry Duran bottle). Adjust the pH with KOH and HCl stock solutions, and then make up to 1 L with distilled water. Autoclave the media at 121 °C for 15 min. Allow the media to cool to 60 °C before adding hormones, antibiotics, PPT, and vitamin stock solutions within a prepared laminar flow cabinet. After adding the appropriate additional filter-sterilized ingredients, mix well by gentle swirling action for 30–60 s. For the LB and SH3a co-cultivation medium, pour approximately 25 mL into the small culture dishes (100 × 15 mm). For SH3a selection medium, SH9 selection medium, and MSBK selection medium, add approximately 30 mL to the large culture dishes (100 × 20 mm). For the SHb10 germination medium, pour approximately 40 mL of medium into each Magenta vessel. Allow all medium to set with the lids ajar within the laminar flow hood. 1. LB medium, pH 7, 1 L: 10 g tryptone, 5 g yeast extract, 10 g NaCl, 15 g agar. 2. SbH10 germination medium pH 5.8, 1 L: 3.183 g Schenk and Hildebrandt basal salts, 1 g myo-inositol, 10 g sucrose, 1 mL SH vitamin stock solution, 6 g agarose (Melford A20080-1000.0). 3. SH3a broth (pH 5.8), 1 L: 100 mL N6 Major salt stock solution, 1 mL SH Minor salt stock solution, 10 mL FeNaEDTA salt stock solution, 100 mg myo-inositol, 30 g sucrose, 1 mL SH vitamin stock solution, 4 mL 2,4-D stock solution, 0.5 mL BAP stock solution. 4. SH3a Agrobacterium inoculation medium (pH 5.8), 100 mL: 99 mL SH3a broth, 1 mL Silwet L-77 stock solution. Acetosyringone was added to a final concentration of 300 μM according to [11], i.e., 300 μL was added to 100 mL of medium. 5. SH3a co-cultivation medium (pH 5.8), 500 mL: 50 mL N6 Major salt stock solution, 0.5 mL SH Minor salt stock solution, 5 mL FeNaEDTA salt stock solution, 50 mg myo-inositol, 15 g sucrose, 3 g Phytagel (Sigma). Autoclave. When cooled to 60 °C add 0.5 mL SH vitamin stock solution, 2 mL 2,4-D stock solution, 0.25 mL BAP stock solution and 1.5 mL acetosyringone stock solution (to a final concentration of 300 μM).

228

Tom Lawrenson et al.

6. SH3a wash solution (pH 5.8), 1 L: 100 mL N6 Major salt stock solution, 1 mL SH Minor salt stock solution, 10 mL FeNaEDTA salt stock solution, 100 mg myo-inositol, 30 g sucrose, 1 mL SH vitamin stock solution, 4 mL 2,4-D stock solution, 0.5 mL BAP stock solution, 1 mL timentin stock solution, 1 mL cefotaxime stock solution prior to use. 7. SH3a selection medium (pH 5.8), 1 L: 100 mL N6 Major salt stock solution, 1 mL SH Minor salt stock solution, 10 mL FeNaEDTA stock solution, 100 mg myo-inositol, 30 g sucrose, 1 mL SH vitamin stock solution, 4 mL 2,4-D stock solution, 0.5 mL BAP stock solution, 1 mL timentin stock solution, 1 mL cefotaxime stock solution, 300 μL PPT stock solution, 3 g Phytagel (Sigma). 8. SH9 selection medium (pH 5.8), 1 L: 100 mL N6 Major salt stock solution, 1 mL SH Minor salt stock solution, 10 mL FeNaEDTA stock solution, 100 mg myo-inositol, 20 g sucrose, and 1 mL SH vitamin stock solution. Selective agents added to SH9 0.5 mL timentin stock solution, 0.5 mL cefotaxime stock solution, 200 μL PPT stock solution, 6 g Phyto Agar (Duchefa 9002-18-0). 9. MSBK selection medium (pH 5.8) 1 L: 4.43 g Murashige and Skoog medium, 30 g sucrose, 1 mL kinetin stock solution, 0.5 mL BAP stock solution, 0.5 mL timentin stock solution, 0.5 mL cefotaxime stock solution, 200 μL PPT stock solution, 6 g/L Phyto Agar (Duchefa 9002-18-0). 10. SH9 shoot elongation/rooting medium (pH 5.8): 100 mL N6 Major salt stock solution, 1 mL SH Minor salt stock solution, 10 mL FeNaEDTA stock solution, 100 mg myo-inositol, 20 g sucrose, 1 mL SH vitamin stock solution, 7 g Agar (Formedium AGA-03). 11. ½ SH9V shoot maturation medium (pH 5.5): 50 mL N6 Major salt stock solution, 0.5 mL SH Minor salt stock solution, 5 mL FeNaEDTA stock solution, 10 g sucrose, 0.5 mL SH vitamin stock solution, 9 g Agar (Formedium AGA-03). 12. Medicago mix potting media: 40% medium-grade peat, 40% sterilized soil (loam), 20% horticultural grit, 1.3 kg/m3 PG mix 14-16-18 + Te base fertilizer, 1 kg/m3 Osmocote mini 16-8-11 2 mg + Te 0.02%, 3 kg/m3 Maglime. 2.3.3

Equipment

1. 200 mL conical flasks, autoclaved. 2. Spectrophotometer for measuring bacterial cell culture optical density. 3. Sterile 15 mL and 50 mL conical tubes. 4. Shaking incubator set at 28 C, 200 rpm. 5. Centrifuge with swing rotor.

Gene Knockout in Medicago truncatula Genotype R108

229

6. Long forceps, 30 cm (Melford Laboratories, Duchefa F3003.0001). 7. Curved tipped Dumont tweezers Type 7 HP-1 (TAAB Laboratories: T050). 8. Scalpel handles No. 5, 130 mm (TAAB Laboratories: S297). 9. Scalpel blades No. 11 (TAAB Laboratories: S070/11). 10. Sterile hypodermic needles (Terumo Agani AN2138R1). 11. 3M™ Micropore™ Medical Tape, 25 mm wide (3 M HealthCare: 1530-0). 12. Filter paper, Whatman Grade 1. 13. Benchtop orbital shaker. 14. Small cell culture dishes, triple vent, 90 mm × 10 mm (R & L Slaughter Ltd: 101VR20). 15. Centrifuge with swing rotor. 16. Autoclavable glass bottles, Duran (DWK Life Sciences 218014459). 17. Large cell culture dishes, triple vent, 100 mm × 20 mm (Sarstedt Ltd: 2026-07-31). 18. Plant growth chamber suitable for aseptic growth of Medicago with dark growth conditions set to 23 °C. 19. 100 mm square cell culture dishes, Sterilin (Thermo Fisher Scientific: 109-17). 20. 3.5″ square plant pots. 21. Propagator with adjustable vents. 22. Clear polythene bags 61 cm × 76.2 cm (Polybags Ltd 2430120). 23. Cellophane bread bags, 380 mm × 900 mm, 25 micron, Lapseal (Amara packaging). 24. Paper-coated wire plant ties or string. 25. Plant growth chamber suitable for aseptic growth of Medicago with growth conditions of 100 μmol/m2/s (16 h/8 h day/ night) light and temperature of 24 °C/20 °C. 26. Plant growth chamber suitable for non-aseptic, soil growth of Medicago plants to maturity set at 24C, 500 μmol/m2/s light intensity (16 h/8 h day/night), 65% RH. 2.4 Genotyping Transgenic Plants

1. 1.7 mL Eppendorf tubes. 2. Microfuge. 3. Micro-pestles to fit 1.7 mL Eppendorf tubes (Sigma EP0030120973). 4. 0.2 mL PCR tubes.

230

Tom Lawrenson et al.

5. DNA buffer 1: 200 mM Tris-HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA, 0.5% SDS. Autoclaved. 6. 70% ethanol. 7. 100% ethanol. 8. Propan-2-ol. 9. 10× TE buffer (1 L): Dissolve 15.759 g Tris-HCl and 2.92 g EDTA in 800 mL distilled water. Bring pH to 8 and then increase volume to 1 L. Autoclave. 10. Thermocycler for PCR. 11. 2× PCR master mix (Qiagen 201443). 12. Molecular biology-grade agarose for electrophoresis. 13. 10× TBE gel running buffer. 14. Agarose gel casting apparatus and electrophoresis power supply. 15. 1 Kb DNA ladder marker.

3

Methods

3.1 Cloning of Guide Sequences into Vector and Transfer into Agrobacterium

Figure 1 shows the structure of the accepter vector EC64422 (Addgene# 191768) used and the final construct produced via PCR-based cloning of custom guide sequences. 1. Select protospacer sequences for the genes you wish to target (see Note 3). 2. Select guide templates based on the number of guides to be cloned. Templates for one and up to nine guides are as follows. For simplicity and saving space, “sgRNA scaffold” is used to represent the 76 non-variable scaffold nucleotide sequence in all the templates: 5′-GTTTTAGAGC TAGAAATAGC AAGTTAAAAT AAGGCTAGTC CGTTATCAAC TTGAAAAAGT GGCACCGAGT CGGTGC-3′. Template for one guide Position 1 (BsaI/Esp3I) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGgttctgagacg Template for two guides Position 1 (BsaI) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGCCGTATAGtgagacc Position 2 (BsaI/Esp3I) ggtctcaATAGGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGgttctgagacg

Gene Knockout in Medicago truncatula Genotype R108 BsaI P-Nos::BAR T-Nos

P-35S::Cys4-P2A-SpCas9 T-HSP

P-CmYLCV

Accepter vector (EC64422 )

231

BsaI LacZ

RFP

Esp3I

T-35S

Esp3I

KanR

Cloning of PCR derived guides

P-Nos::BAR T-Nos

P-35S::Cys4-P2A-SpCas9 T-HSP

P-CmYLCV

T-35S

Final construct

KanR

Fig. 1 A single accepter vector EC64422 (Addgene# 191768) contains all elements required for Medicago truncatula mutagenesis apart from the user-defined guide sequences which they will insert to arrive at the final construct. Plant selectable marker for PPT resistance in purple and Cys4-P2A-SpCas9 transcriptional fusion in yellow. LacZ and RFP give blue and red coloration, respectively, in E. coli for selection of colonies containing cloned inserts. Guide inserts are produced via PCR (black and red squares) and cloned into the accepter via BsaI and Esp3I restriction sites. A single transcript produced by the CmYLCV promoter is processed by the CYS4 protein into individual guides which can complex with the co-expressed SpCas9. P-Nos, nopaline synthase promoter; BAR, PPT resistance coding sequence; T-Nos, nopaline synthase terminator; P-35S, double 35S promoter; Cys4, CYS4 coding sequence; P2A, Porcine teschovirus skipping sequence; SpCas9, Arabidopsis codon optimized SpCas9 coding sequence; T-HSP, heat shock protein terminator; P-CmYLCV, Cestrum yellow leaf curling virus promoter; T-35S, 35S terminator; KanR, resistance cassette for selection in bacteria

Template for three guides Position 1 (BsaI) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGCCGTATAGtgagacc Position 2 (BsaI) ggtctcaATAGGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTtgagacc

232

Tom Lawrenson et al.

Position 3 (BsaI/Esp3I) ggtctcaCCGTATAGGCAGNNNNNNNNNNNNNNNNNN NN-sgRNA scaffold-GTTCgttctgagacg Template for four guides Position 1 (BsaI) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGCCGTATAGtgagacc Position 2 (BsaI) ggtctcaATAGGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTtgagacc Position 3 (BsaI) ggtctcaCCGTATAGGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGtgagacc Position 4 (BsaI/Esp3I) ggtctcaACTGCCGTATAGGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCgttctgagacg Template for five guides (one-step cloning) Position 1 (BsaI) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGCCGTATAGtgagacc Position 2 (BsaI) ggtctcaATAGGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTtgagacc Position 3 (BsaI) ggtctcaCCGTATAGGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCACTGtgagacc Position 4 (BsaI) ggtctcaACTGCCGTATAGGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCAtgagacc Position 5 (Esp3I/Esp3I) cgtctccTTCACTGCCGTATAGGCAGNNNNNNNNNNNNNNNNNNNN-sgRNA scaffold-GTTCgttctgagacg

Gene Knockout in Medicago truncatula Genotype R108

233

Template for six guides (two-step cloning) Cloning step 1 – guides 1–4 (BsaI): Position 1 (BsaI) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTATAGtgagacc Position 2 (BsaI) ggtctcaATAGGCAGNNNNNNNNNNNNNNNNN NNN-sgRNA scaffold-GTTCACTGCCGTtgagacc Position 3 (BsaI) ggtctcaCCGTATAGGCAGNNNNNNNNNNNNNN NNNNNN-sgRNA scaffold-GTTCACTGtgagacc Position 4 (BsaI) ggtctcaACTGCCGTATAGGCAGNNNNNNNNNNN NNNNNNNNN-sgRNA scaffold-GTTCtgagacc Clone and sequence. Select a perfect clone to continue with in cloning step 2. Cloning step 2 – guides 5 and 6 (Esp3I): Position 5 (Esp3I) cgtctccGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTATAGtgagacg Position 6 (Esp3I) cgtctccATAGGCAGNNNNNNNNNNNNNNNNN NNN-sgRNA scaffold-GTTCtgagacg Template for seven guides (two-step cloning) Cloning step 1 – guides 1–4 (BsaI): Use the same template for “positions 1 to 4” outlined for six guides above. Clone and sequence. Select a perfect clone to continue with in cloning step 2. Cloning step 2 – guides 5–7 (Esp3I): Position 5 (Esp3I) cgtctccGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTATAGtgagacg Position 6 (Esp3I) cgtctccATAGGCAGNNNNNNNNNNNNNNNNNN NN-sgRNA scaffold-GTTCACTGCCGTtgagacg Position 7 (Esp3I) cgtctccCCGTATAGGCAGNNNNNNNNNNNNNNN NNNNN-sgRNA scaffold-GTTCtgagacg

234

Tom Lawrenson et al.

Template for eight guides (two-step cloning) Cloning step 1 – guides 1–4 (BsaI): Use the same template for “positions 1–4” as outlined for six guides above. Clone and sequence. Select a perfect clone to continue with in cloning step 2. Cloning step 2 – guides 5–8 (Esp3I): Position 5 (Esp3I) cgtctccGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTATAGtgagacg Position 6 (Esp3I) cgtctccATAGGCAGNNNNNNNNNNNNNNNNNN NN-sgRNA scaffold-GTTCACTGCCGTtgagacg Position 7 (Esp3I) cgtctccCCGTATAGGCAGNNNNNNNNNNNNNN NNNNNN-sgRNA scaffold-GTTCACTGtgagacg Position 8 (Esp3I) cgtctccACTGCCGTATAGGCAGNNNNNNNNNNNN NNNNNNNN-sgRNA scaffold-GTTCtgagacg Template for nine guides (two-step cloning) Cloning step 1 – guides 1–5 (BsaI): Position 1 (BsaI) ggtctcaGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTtgagacc Position 2 (BsaI) ggtctcaCCGTATAGGCAGNNNNNNNNNNNNNNN NNNNN-sgRNA scaffold-GTTCACTGCCtgagacc Position 3 (BsaI) ggtctcaTGCCGTATAGGCAGNNNNNNNNNNNNN NNNNNNN-sgRNA scaffold-GTTCACTGtgagacc Position 4 (BsaI) ggtctcaACTGCCGTATAGGCAGNNNNNNNNNNN NNNNNNNNN-sgRNA scaffoldGTTCACTGCCG TATAGGCAtgagacc Position 5 (BsaI) ggtctcaGGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCtgagacc

Gene Knockout in Medicago truncatula Genotype R108

235

Clone and sequence. Select a perfect clone to continue with in cloning step 2. Cloning step 2 – guides 6–9 (Esp3I): Position 6 (Esp3I) cgtctccGCAGNNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGCCGTATAGtgagacg Position 7 (Esp3I) cgtctccATAGGCAGNNNNNNNNNNNNNNNNN NNN-sgRNA scaffold-GTTCACTGCCGTtgagacg Position 8 (Esp3I) cgtctccCCGTATAGGCAGNNNNNNNNNNNNNNN NNNNN-sgRNA scaffold-GTTCACTGtgagacg Position 9 (Esp3I) cgtctccACTGCCGTATAGGCAGNNNNNNNNNNN NNNNNNNNN-sgRNA scaffold-GTTCtgagacg 3. Insert protospacer sequences into the selected template according to how many guides are required in the final construct. The one-guide template is selected if only one guide is required, the two-guide template if two guides are required, and so on. Here is an example for cloning of a single guide targeting the genomic sequence 5′-GTTGAGAAGA ATCGGAATTC TGG-3′ where the PAM is underlined and the corresponding protospacer replaces the Ns in the one-guide template. The one-guide template to be used: ggtctcaGCAG-NNNNNNNNNNNNNNNNNNNNsgRNA scaffold-GTTCACTGgttctgagacg Protospacer replaces the Ns in the “one-guide template”: ggtctcaGCAGGTTGAGAAGAATCGGAATTCsgRNA scaffold- GTTCACTGgttctgagacg 4. Use templates where Ns are replaced by protospacers to design primer pairs. All forward primers should have the generic 3′ ending which is the 5′- part of the sgRNA scaffold sequence: 5′-GTTTTAGAGCTAGAAATAGCAAGT-3′ All reverse primers should have the generic 3′ ending which is the 3′-part of the sgRNA scaffold sequence: 5′-GCACCGACTCGGTGCCACTTTTTCAAGTTGA TAA-3′ The variable 5′ ends are then added to these generic sequences as shown below for the one-guide template example given above.

236

Tom Lawrenson et al.

Template 5′-ggtctcaGCAG-GTTGAGAAGAATCGGAATTC-sgRNA scaffold-GTTCACTGgttctgagacg-3′ Forward primer 5′-ggtctcaGCAGGTTGAGAAGAATCGGAATTC GTTTTAGAGCTAGAAATAGCAAGT-3′ Reverse primer 5′-cgtctcagaacCAGTGAAC GCACCGACTCGGTGCCACTTTTTCAAGTTGATAA-3′ 5. Add six T residues to the 5′ termini of these primers before commercial synthesis is requested in order to facilitate restriction enzyme cutting at a later stage. The primers in Subheading 3.1, step 4 above thus become: Forward primer 5′- TTTTTTggtctcaGCAGGTTGAGAAGAATCGGAATTC GTTTTAGAGCTAGAAATAGCAAGT-3′ Reverse primer 5′-TTTTTTcgtctcagaacCAGTGAAC GCACCGACTCGGTGCCACTTTTTCAAGTTGATAA-3′ Before ordering the primers designed to amplify the completed templates, ensure that there are no errors in the sequence by cloning the proposed amplicons into the accepter vector in silico using the assembly wizard tool in Benchling (https://www.benchling.com/). 6. Use primer pairs in PCR with a plasmid containing the non-variable sgRNA scaffold sequence as template. Prepare 50 μL reactions containing 10 μL high-fidelity Phusion buffer (NEB), 200 nM dNTPs, 500 nM forward and reverse primers, 10 ng of sgRNA containing plasmid, 0.5 μL (1 unit) Phusion polymerase (NEB), and water to a total volume of 50 μL. 7. Use a thermocycler to perform the following: 1 cycle of 98 °C for 1 min; 30 cycles of 98 °C for 10 s, 60 °C for 15 s, and 72 °C for 15 s; and, finally, 1 cycle of 72 °C for 2 min. 8. Run 20 μL of PCR products in a 2% agarose gel against a 100 bp ladder. Single-band products should be obtained which can be cut out using a clean sharp scalpel and purified using a Qiagen gel purification kit. The final elution in Qiagen EB buffer should be done in 10 μL. 9. Depending on how many guides are required in the final construct, there will be either one or two cloning steps to insert these guides into the accepter vector. Using the guide templates for between one and five guides will follow the single-

Gene Knockout in Medicago truncatula Genotype R108

237

step protocol. When using the templates for between six and nine guides, the two-step protocol will be followed. (a) Single-step protocol – For the cloning of one to five guides using BsaI and Esp3I (i) Add the following to a tube suitable for thermocycling: 100 ng EC64422, 1 μL of each gel purified PCR fragment(s) to be inserted, 1.5 uL 10× BSA, 1.5 uL T4 ligase buffer (NEB), 1 μL (20 u) BsaI (NEB), 1 μL (10 u) Esp3I (Thermo Fisher), 1 μL (400 u) T4 ligase (NEB), water to a total volume of 15 μL. (ii) Cycle as follows: 1 cycle of 37 °C for 1 min, followed by 26 cycles of 37 °C for 3 min and 16 °C for 3 min and, finally, 1 cycle of 50 °C for 10 min and 80 °C for 10 min. (iii) Use 7 μL of the cycled reaction for E. coli transformation using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this, samples will be in a 0.9 mL volume of SOC bacterial liquid media. (iv) Three LB agar plates should be prepared for each sample, containing 50 mg/L kanamycin, 200 mg/L X-GAL, and 1 mM IPTG. On one plate spread 10 μL of the SOC suspension and on the other 50 μL. Incubate up-side-down at 37 °C overnight before identifying white colonies containing the cloned fragments of interest. (v) Select 12 white colonies for PCR, using sterile tips to transfer each colony to 12 separate PCR tubes and simultaneously to the third LB agar plate. Move the plate to grow at 37 °C to act as the reference culture for the PCR result. To each PCR tube, add the following: 12.5 μL Qiagen PCR master mix, 10.5 μL water, 1 μL of 10 μM CmYLCV_Forward primer (5′-GAGAAAGAGA GCAAGTAGCC TAGAAGTAGT-3′), and 1 μL of 10 μM T-35s_Reverse primer (5′-ACAAATACAT ACTAAGGGTT TCTTATATGC TCA-3′). Then use a thermocycler to perform the following cycles: 1 cycle of 94 °C for 3 min, followed by 40 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min and, finally, 1 cycle of 72 °C for 5 min. (vi) Run 10 μL of the PCR reaction in a 2% agarose gel against a 100 bp ladder to identify clones that contain inserts of the correct size. After 24 h, use the reference plate to start 10 mL liquid LB cultures

238

Tom Lawrenson et al.

(kanamycin 50 mg/L) for the clones which contain inserts of the correct size. (vii) On the next day, extract plasmid DNA from the LB cultures using a Qiagen miniprep kit, following the manufacturer’s instructions. (viii) Send plasmid for commercial Sanger sequencing with two separate reactions per clone, one using the CmYLCV_Forward primer and the second using the T-35s_Reverse primer. Identify one clone which has the expected sequence over the cloned region (see Note 4). Transfer this plasmid into Agrobacterium tumefaciens strain AGL1 according to the manufacturer instructions. Transformed colonies should be selected on LB plates containing rifampicin (25 mg/L) and kanamycin (50 mg/L). (ix) Agrobacterium colonies should be checked by restriction digest for the correct banding pattern. In order to do this, the colony must be grown at 28 °C in liquid LB containing rifampicin (25 mg/L) and kanamycin (50 mg/L) before using 7 mL of this to extract plasmid using a Qiagen miniprep kit. Save 3 mL of the remaining LB cultures for glycerol stock preparation (see Note 5). Plasmid elution should be done in 20 μL EB at the final stage. Plasmid concentration will be low and insufficient for restriction digest and so it must be used to transform E. coli in order to replicate to a high copy number. All 20 μL of the eluted plasmid should be used to transform E. coli using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this, samples will be in a 0.9 mL of SOC bacterial liquid media. Pellet the cells and plate all of the E. coli onto a single LB plate containing kanamycin (50 mg/L). After overnight incubation at 37 °C, colonies can be used to set up liquid LB cultures with kanamycin (50 mg/L) and grown at 37 °C. Miniprep of this E. coli culture using the Qiagen kit will yield sufficient plasmid for restriction digest. The enzymes EcoRI and XhoI cut several times throughout the plasmid and produce a usefully diagnostic pattern. It is also recommended to sequence across the guide region at this stage using the same procedure as in viii above. (x) Make Agrobacterium glycerol stocks (standard inocula) by mixing 3 mL of the saved LB culture in ix with 3 mL of 50% sterile glycerol. Aliquot 0.5 mL

Gene Knockout in Medicago truncatula Genotype R108

239

volumes into 1.7 mL sterile Eppendorf tubes and store at -70 °C. (b) Two-step protocol – for the cloning of six to nine guides Step 1 – for the cloning of guides 1–4 using BsaI (i) Add the following to a tube suitable for thermocycling: 100 ng accepter vector, 1 μL of each gel purified PCR products to be inserted, 1.5 μL 10× BSA, 1.5 μL T4 ligase buffer (NEB), 1 μL (20u) BsaI (NEB), 1 μL (400u) T4 ligase (NEB), water to a total volume of 15 μL. (ii) Cycle as follows: 1 cycle of 37 °C for 1 min, followed by 26 cycles of 37 °C for 3 min and 16 °C for 3 min and, finally, 1 cycle of 50 °C for 10 min and 80 °C for 10 min. (iii) Use 7 μL of the cycled reaction for E. coli transformation using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this step, samples will be in a 0.9 mL of SOC bacterial liquid media. (iv) Three LB agar plates should be prepared for each sample, containing 50 mg/L kanamycin, 200 mg/L X-GAL, and 1 mM IPTG. On one plate spread 10 μL of the SOC suspension and on the other 50 μL. Incubate up-side-down at 37 °C overnight before identifying red colonies which should contain the cloned fragments of interest. (v) Select 12 red colonies for PCR, using sterile tips to transfer each colony to 12 separate PCR tubes and simultaneously to the third LB agar plate. Incubate the plate at 37 °C to act as the reference culture for the PCR result. To each PCR tube, add the following: 12.5 μL Qiagen PCR master mix, 10.5 μL water, 1 μL of 10 μM CmYLCV_Forward primer (5′-GAGAAAGAGA GCAAGTAGCC TAGAAG TAGT-3′), and 1 μL of 10 μM RFP_Reverse primer (5′-CGCTGATAGT GCTAGTGTAG ATCG CTAC-3′). Then use a thermocycler to perform the following cycles: 1 cycle of 94 °C for 3 min, followed by 40 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min and, finally, 1 cycle of 72 °C for 5 min. (vi) Run 10 μL of the PCR reaction in a 2% agarose gel against a 100 bp ladder to identify clones that

240

Tom Lawrenson et al.

contain inserts of the correct size. Use the reference plate after 24 h to start 10 mL LB cultures (kanamycin 50 mg/L) for the clones which contain inserts of the correct size. (vii) The following day, extract the plasmid from the LB cultures using a Qiagen miniprep kit following the manufacturer’s instructions. (viii) Send plasmid for two separate commercial Sanger sequencing reactions per clone, one using the CmYLCV_Forward primer and the second using the RFP_Reverse primer. Identify one clone which has the expected sequence over the cloned region. This clone will become the accepter vector in the second cloning step where the remaining guides will be inserted (see Note 4). Step 2 – for the cloning of guides 5–9 using Esp3I. (ix) Add the following to a tube suitable for thermocycling: 100 ng accepter vector (perfect clone from step 1), 1 μL of each gel purified PCR fragment(s) to be inserted, 1.5 μL 10× BSA, 1.5 μL T4 ligase buffer (NEB), 1 μL (u) Esp3I (Thermo Fisher), 1 μL (u) T4 ligase (NEB), water to a total volume of 15 μL. (x) Cycle as follows: 1 cycle of 37 °C for 1 min, followed by 26 cycles of 37 °C for 3 min and 16 °C for 3 min and, finally, 1 cycle of 50 °C for 10 min and 80 °C for 10 min. (xi) Use 7 μL of the cycled reaction for E. coli transformation using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this, samples will be in a 0.9 mL of SOC bacterial liquid media. (xii) Three LB agar plates should be prepared for each sample, containing 50 mg/L kanamycin, 200 mg/L X-GAL, and 1 mM IPTG. On one plate spread 10 μL of the SOC suspension and on the other 50 μL. Incubate up-side-down at 37 °C overnight before identifying white colonies containing the cloned fragments of interest. (xiii) Select 12 white colonies for PCR, using sterile tips to transfer each colony to 12 separate PCR tubes and simultaneously to the third LB agar

Gene Knockout in Medicago truncatula Genotype R108

241

plate. Move the plate to grow at 37 °C to act as the reference culture for the PCR result. To each PCR tube, add the following: 12.5 μL Qiagen PCR master mix, 10.5 uL water, 1 μL of 10 μM CmYLCV_Forward primer (5′-GAGAAAGAGA GCAAGTAGCC TAGAAGTAGT-3′), and 1 μL of 10 μM T-35s_Reverse primer (5′-ACAAATACAT ACTAAGGGTT TCTTATATGC TCA-3′). Then use a thermocycler to perform the following cycles: 1 cycle of 94 °C for 3 min, followed by 40 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min and, finally, 1 cycle of 72 °C for 5 min. (xiv) Run 10 μL of the PCR reaction in a 2% agarose gel against a 100 bp ladder to identify clones that contain inserts of the correct size. Use the reference plate after 24 h to start 10 mL LB cultures (kanamycin 50 mg/L) for the clones which contain inserts of the correct size. (xv) The following day, extract the plasmid from the LB cultures using a Qiagen miniprep kit following the manufacturer’s instructions. (xvi) Send plasmid for commercial Sanger sequencing with two separate reactions per clone, one using the CmYLCV_Forward primer and the second using the T-35s_Reverse primer. Identify one clone which has the expected sequence over the cloned region (see Note 4). Transfer this plasmid into Agrobacterium tumefaciens strain AGL1 according to the manufacturer instructions. Transformed colonies can be selected on LB plates containing rifampicin (25 mg/L) and kanamycin (50 mg/L). (xvii) Agrobacterium colonies should be checked by restriction digest for the correct banding pattern of the binary vector. In order to do this, the colony must be grown at 28 °C in liquid LB containing rifampicin (25 mg/L) and kanamycin (50 mg/L) before using 7 mL of this to extract plasmid using a Qiagen miniprep kit. Save 3 mL of the remaining LB cultures for glycerol stock preparation (see Note 5). Elution should be done in 20 μL EB at the final stage. Plasmid concentration at this stage will be low and insufficient for restriction digest and so it must be used to transform E. coli in order to

242

Tom Lawrenson et al.

replicate to a high copy number. All 20 μL of the eluted plasmid should be used to transform E. coli using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this, samples will be in a 0.9 mL of SOC bacterial liquid media. Pellet the cells and plate all of the E. coli onto a single LB plate containing kanamycin (50 mg/L). After overnight incubation at 37 °C, colonies must be used to set up liquid LB cultures with kanamycin (50 mg/L) and grown at 37 °C. Miniprep of this E. coli culture using the Qiagen kit will yield sufficient plasmid for restriction digest. The enzymes EcoRI and XhoI cut several times throughout the plasmid and produce a usefully diagnostic pattern. It is also recommended to sequence across the guide region at this stage using the same procedure as in xvi above. (xviii) Prepare Agrobacterium glycerol stocks (standard inoculum) by mixing 3 mL of the saved LB culture in xvii with 3 mL of 30% sterile glycerol. Aliquot 0.5 mL volumes into 1.7 mL sterile Eppendorf tubes and store at -70 °C. 3.2 Medicago truncatula Growth to Produce Explant Material for Agrobacterium Transformation

1. Scarify seeds of Medicago truncatula genotype R108 in a small volume of concentrated sulfuric acid for 8 min in a fume hood. 2. Remove as much acid as possible with a pipette and then add a large volume of cold (4 °C) sterile water. Rinse a further four times with sterile water (in fume hood). 3. The following steps are carried out in a prepared, sterilized flow hood. 4. Add one volume of 10% sodium hypochlorite solution (v/v) and leave for 5 min and then wash three times with sterile water. 5. Leave the seeds to imbibe for 4 h at room temperature and then rinse again in sterile water. 6. Place the surface-sterilized M. truncatula R108 seeds in sterile Magenta vessels containing 50 mL of SHb10 with four seeds per Magenta vessel using sterilized long forceps. Replace the lid and seal with Micropore tape. 7. Place the Magentas in a growth room with light at 100 μmol/ m2/s (16 h/8 h day/night) and temperature of 24 °C/20 °C for 3 weeks. 8. After 3 weeks, under aseptic conditions, remove the Magenta lids, and leave open for 5 min in the lamina flow hood before

Gene Knockout in Medicago truncatula Genotype R108

243

replacing the lid with a second sterile Magenta vessel, joining the two with sterile Magenta vessel connectors (see Note 6). 3.3 Medicago Transformation, T0 Plant Production, and T1 Seed Production

1. Take 300 μL of a standard inoculum and place in 10 mL of LB medium containing rifampicin (25 mg/L) and kanamycin (50 mg/L). 2. Incubate overnight (approximately 16 h) at 28 °C with shaking at 200 rpm. 3. The following day, inoculate a 100 mL of LB medium containing rifampicin (25 mg/L) and kanamycin (50 mg/L) with 0.5 mL of the overnight culture in a conical flask, and incubate overnight with shaking at 200 rpm. 4. The next day, check that the OD600nm of this overnight culture is less than 1.0 (see Note 7). 5. Centrifuge the Agrobacterium culture in 50 mL centrifuge tubes at 2400 × g at 24 °C for 12 min. 6. Resuspend the pellet in SH3a broth. Centrifuge the Agrobacterium again and resuspend in SH3a Agrobacterium inoculation medium to an OD600nm of 0.2–0.3. 7. Remove well-expanded leaf trifoliates from four aseptically grown 4-week-old M. truncatula plantlets (from one Magenta) by cutting at the base while holding the petiole with forceps (see Note 8). Place the trifoliates directly in approximately 5–10 mL prepared Agrobacterium suspension from Subheading 3.2 in a small culture dish. 8. Remove each leaflet of the trifoliates at their bases holding the main petiole with forceps. 9. Hold the leaflet under the Agrobacterium inoculation medium so that the very top and base of the leaflet are anchored securely to the base of the Petri dish using the curved parts of the curved tipped Dumont forceps (see Note 9). 10. Draw a new sterile needle held at a 45° angle across the abaxial surface using its flat slanted surface, being careful not to press too hard and penetrate the leaf. Make 3–5 scores across the leaflet depending on the size of leaflet (Fig. 2) (see Note 10). 11. Turn each leaflet so that the scored abaxial surface is directly in contact with the surface of the Agrobacterium suspension, and seal the plate with Micropore tape. 12. Place the plate on a benchtop orbital shaker set to approximately 1 rotation per second at room temperature for 30 min. 13. Lift out the leaflets from the Agrobacterium suspension using the curved part of the forceps to cradle the leaflet and lower on to a few layers of sterilized filter paper within a small culture dish (see Note 11).

244

Tom Lawrenson et al.

Fig. 2 Medicago truncatula R108 leaflets showing needle scores to abaxial surface

14. Place a filter paper gently and briefly over the surface of the leaflets to soak up the excess Agrobacterium suspension from the top. 15. Transfer the Agrobacterium inoculated leaflets, 10 per plate, on to the prepared SH3a co-cultivation medium taking care to place them with the adaxial surface facing down on to the medium and the wounded side facing upward. Seal the dishes with Micropore tape. 16. Place the dishes in the dark at 23 °C for 24–30 h to co-cultivate the leaflet explants with the Agrobacterium. 17. After 24–30 h of co-cultivation, explants are washed to remove Agrobacterium [11]. Carefully remove the leaflets from the co-cultivation plates, and place 20 leaflets at a time in sterile 100 mL Duran bottles containing 50 mL of SH3a wash solution (see Note 12). 18. Rinse explants with a gentle swirling action. Repeat the rinsing three times, draining through the loose lid of the bottle. 19. Finally, drain the leaflets and then tip them out onto sterile filter paper. Layer a dry piece of sterile filter paper over the top of the leaflets to blot them dry. 20. Place leaflets adaxial side down [10, 11] on to SH3a selection medium, seal with Micropore tape, and culture at 23 °C in a dark incubator. 21. Sub-culture the explants every 2 weeks on to fresh SH3a selection medium in large culture dishes for at least 8–12 weeks or until callus has formed (Fig. 3) (see Note 13). 22. Once callus has formed, sub-culture the explants on to SH9 selection medium in large culture dishes. At this stage, the

Gene Knockout in Medicago truncatula Genotype R108

245

Fig. 3 Medicago truncatula R108 leaflet after 10 weeks on SH3a selection medium (dark, 23 °C) showing friable callus production

larger pieces of brown necrotic explant should be cut away, being careful not to interfere with the callus (see Note 14). 23. Incubate the cultures in the dark for a further 2 weeks or until the callus has reached around 5 mm pile diameter (see Note 15). 24. If the callus has developed embryos and/or shoot primordia as in Fig. 4a, sub-culture again to fresh SH9 selection medium, and transfer to light conditions of 100 μmol/m2/s (16 h/ 8 h day/night) at 24 °C/20 °C for 10–14 days until shoot primordia become green as in Fig. 4b. 25. If the callus is not producing embryos/shoot primordia, or to stimulate an increase in callus and shoot primordia from the PPT-resistant callus, sub-culture on to MSBK selection medium, and incubate for 2 weeks in the dark followed by step 24 above (see Note 16). 26. Once shoot primordia have formed (Fig. 4b), usually after 2–4 weeks on SH9 selection medium, callus cultures can be transferred to SH9 shoot maturation medium which does not contain antibiotics or PPT, for 2–3 weeks to encourage rapid shoot development (see Note 17). 27. When shoots are at least 1.5 cm in length and have two to four leaves (Fig. 4c), transfer individual shoots to ½ SH9V rooting medium in square plates, laying them flat on the media with the basal end in good contact with the media. 28. Place the plates horizontally for 2 days to allow the shoots to adhere to the media, and then place the plates vertically. 29. Allow the plants to develop further until they have at least 4 cm of shoot and 4 cm of root (Fig. 5a). 30. Gently remove the plantlets from the agar, and transplant each into a 9 × 9 cm square pot containing Medicago mix potting

246

Tom Lawrenson et al.

Fig. 4 (a) Embryogenic callus proliferating 2 weeks after being transferred to SH9 medium in the dark and (b) after a further 2 weeks on SH9 medium in the light. (c, d) after 6–10 weeks in the light

Fig. 5 (a) Rooted shoots on ½SH9V shoot maturation media ready to transfer to soil. (b, c) fully grown transgenic Medicago yielding T0 seeds raised in controlled growth conditions

Gene Knockout in Medicago truncatula Genotype R108

247

media being careful to make a long vertical hole to accommodate long roots. 31. Place the potted plants in a propagator and then place the whole propagator in a large clear plastic bag. Seal the bag well with tape or zip tie (see Note 18). 32. Incubate the plants in a controlled growth room with light intensity 500 μmol/m2/s (16 h/8 h day/night), and temperature of 24 °C/20 °C, 65% RH (see Note 19), for 7 days before releasing the seal on the bag. 33. After a further 4 days, remove the propagator from the bag, and gradually acclimatize the plants by opening the vents on the propagator during the subsequent 14 days. 34. As the plants grow, carefully attach them to supportive wooden stakes using plant ties or string to prevent them from getting entangled (Fig. 5b, c). 35. Once the first seeds produced have started to mature and turn brown (on the lower branches of the plants), carefully place a porous cellophane bread bag over each plant, securing at the base with a plant tie. 36. When the seeds are matured and brown, invert the bagged plant to catch the seeds. Cut the plant at the base and shake the tied bag to allow the seeds to drop into the bag. 3.4 Genotyping T0 Primary Transgenic Plants

1. When the plants have adapted to their soil environment and are clearly healthy (see Subheading 3.3, step 33) and growing well, remove a leaf sample with an area of approximately 1 cm square. Samples are collected in 1.5 mL Eppendorf tubes. 2. Add 600 μL of DNA buffer 1 to each and grind the leaves using micro-pestles until all large particles are fragmented and the liquid becomes dark green. 3. Spin tubes in a benchtop microfuge at full speed for 10 min before 500 μL of the supernatant is moved to a fresh 1.5 mL Eppendorf tube, taking care to leave behind any solid matter. 4. Add an equal volume of propan-2-ol to each tube before vortexing and then spinning at full speed in a microfuge for 20 min. Carefully pour off the liquid and wash the pellet with 0.5 mL of 70% ethanol. 5. Spin tubes at full speed again for 10 min before carefully removing the liquid and allowing the pellet to air-dry until all liquid has evaporated. Pellets are resuspended in 100 μL of 1× TE. 6. 1 μL of this genomic DNA prep can be used as template in PCR using cycling conditions and primers previously shown to amplify target loci.

248

Tom Lawrenson et al.

Fig. 6 ABI sequence chromatogram showing multiple peaks starting at or near Cas9 cut site indicates presence of indels

7. Validate PCR amplification using agarose gel electrophoresis. Band shift relative to the wild-type band size may be seen and indicates target site mutations. Many bands are likely to appear wild type in size although sequencing is likely to reveal mutations. 8. Send remaining PCR products for commercial Sanger sequencing following company guidelines for sample submission. Each amplicon should be sequenced twice, once with a forward primer and again with a reverse primer. These sequencing primers should be internal to the primers used in the PCR and between 100 and 200 bases from the nearest target site. Depending on the location of target sites selected, it may be necessary to use further sequencing primers in additional reactions to cover all target sites. ABI files will be returned by the company of choice. 9. Upon viewing of the ABI files as chromatograms, indels at target loci will be visible as double or multiple peaks (Fig. 6), usually starting at or near to the Cas9 cut sites (3 bp from the PAM). The ICE Analysis web-based tool can be used to identify the alleles present and their relative proportion (ice. synthego.com). 10. Active T0 lines where mutagenesis has been detected should be grown to maturity and dry seed pods collected for T1 analysis.

Gene Knockout in Medicago truncatula Genotype R108

3.5 Identification of Transgene-Free Mutant Lines

249

1. Sow sufficient seeds from active T0 parents to give 24 T1 plants for each parental line of interest. Use Medicago mix potting media, and grow with light at 100 μmol/m2/s (16 h/8 h day/ night) and temperature of 24 °C/20 °C. 2. When plants are established after 2–3 weeks, sample leaf material and extract DNA as in Subheading 3.4. 3. Repeat the PCR and Sanger sequencing used in Subheading 3.4 to identify target site mutations. Some T1 siblings are likely to contain homozygous mutations at this stage. 4. Identify T1 plants which do not contain the T-DNA insert through segregation using PCR with primers and cycling conditions specific to the BAR gene. The forward primer sequence is 5′-GCAACGCCTACGACTGG-3′, and the reverse primer sequence is 5′-TTCAGCAGGTGGGTGTAGAG-3′, giving a PCR product of 97 bp. Each PCR reaction should contain 1 μL of genomic DNA template, 10 μL of Qiagen 2× PCR master mix, 200 nM final primer concentrations, and water to 20 μL. Cycle the reactions with 1× 94 °C 3 min and 35× 94 °C 30 s, 58 °C 45 s, and 72 °C 45 s. 5. Run the products in a 2% agarose gel against a 100 bp ladder. If positive and negative template controls are plus and minus a 97 bp band, respectively, then any T1 plant without a band will be free of the T-DNA. 6. By this stage, it is likely that homozygous T1 mutants which are T-DNA-free will have been identified, enabling phenotyping and growth to maturity for seed bulking. It may be necessary to screen more than 24 T1 siblings in order to achieve this, for example, where multiple genes are being targeted or where T-DNA has integrated at multiple unlinked loci. Another option is to grow into the T2 generation where the desired segregation may be detected.

4

Notes 1. It is not uncommon to find clones which have the correct size inserts as determined by the PCR colony screen, but having mutations in the cloned region. Starting with 12 colonies and sequencing all with the correct size colony PCR bands should enable at least one perfect clone to be identified. 2. Agrobacterium glycerol stocks are best prepared from freshly grown LB liquid cultures. Make sure that the plasmid is extracted from the same culture as part of the clone checking procedure. 3. The SH vitamin stock solution used here was made according to [8].

250

Tom Lawrenson et al.

4. SHb10 was prepared with 1 g/L myo-inositol according to [11]. 5. We currently use the CRISPOR tool for protospacer selection (CRISPOR (tefor.net)), pasting the target gene sequence into the box in step 1, selecting the R108 genome in step 2, and selecting the 20 bp-NGG option in step 3. This will enable you to choose protospacers based on off-target and on-target scores. Where possible, in order to make subsequent screening of targeted mutations straightforward, select protospacers in a target region that can be PCR amplified as a single amplicon, ensuring that primer binding sites are no closer to target sites than 100 bp. We recommend establishing the PCR and sequencing screen prior to finalization of protospacer choice to ensure that downstream screening of plants runs smoothly. Trial PCR/Sanger sequencing of wild-type material should ensure that all target sites are covered by clear, unambiguous Sanger chromatogram reads, preferably on both forward and reverse strands. 6. Converting the single Magenta vessel to a double Magenta vessel for the final week of plant growth visibly improved plant growth compared to continued growth in the single Magenta, possibly by providing more volume for improved gaseous exchange. Explant health is of paramount importance in developing an efficient transformation system. 7. If the Agrobacterium grows to an OD above 1, then take 0.5 mL of that culture and inoculate another 100 mL of LB with antibiotics and incubate for a further 22 h. 8. Minimizing random damage to the leaflets by maneuvering them via their petioles, rather than the leaflet lamina, improves explant health and reduces the incidence of Agrobacterium overgrowth during co-cultivation and selection. 9. Using curved tipped forceps to anchor and cradle explants helps prevent accidental puncturing and random damage to the leaflets. 10. It is important to angle the needle tip so that the sloped flat surface is used for explant wounding, drawing the needle gently across the leaflet, and to avoid fully penetrating the leaflet during needle scoring. Compared to other means of explant wounding, such as with a scalpel blade, needle scoring was found to minimize the onset of leaflet necrosis during the subsequent selection steps. This is possibly due to improved targeted Agrobacterium infection of undamaged cells beneath the leaflet abaxial membrane at the needle scored sites and reduced non-specific cell damage.

Gene Knockout in Medicago truncatula Genotype R108

251

11. The leaflets must be handled by cradling in the curved part of the forceps rather than holding with the sharp ends of the forceps. Each leaflet should be placed gently on to the surface of the sterile filter paper for blotting. 12. Medicago leaflets, being very thin and delicate, are severely affected by Agrobacterium overgrowth and/or persistence in later callus proliferation steps. A relatively short co-cultivation followed by washing enhances explant health and reduces the incidence of persistent Agrobacterium during selection, which is hard to eliminate once callus production commences. 13. Sub-culturing every 2 weeks helps to eliminate bacteria completely from the explant tissue to ensure bacteria-free callus production and enabling subsequent rapid and efficient plant regeneration using antibiotic-free medium. 14. Removal of dead tissue helps to minimize any bacterial growth from persistent Agrobacterium as antibiotic levels are reduced at this stage. 15. Dark incubation of explants on SH9 selection medium (which has a 50% reduction in antibiotic concentration compared to SH3 selection medium and a reduced PPT concentration) was found to greatly enhance friable callus production from the initial smaller and more compact PPT resistance callus formed on SH3a selection medium. The improved production of friable callus at this stage improves the resulting yield of transformed shoots during the subsequent light phase of callus culture. Cultures can be sub-cultured every 2 weeks and maintained at this dark intermediate stage for 4 or 6 weeks if necessary, in instances where friable callus and embryo production is slow. 16. MSBK selection medium can be used to stimulate shoot production at this stage; however, more than a 2-week interval on MSBK selection medium negatively impacts on the time it takes for shoots to elongate and root later on, probably due to the high levels of cytokinin in the MSBK selection medium persisting for longer than desired in regenerating shoots. 17. One advantage of using PPT selection is that selection stringency is high for transformed callus and very few “escape,” non-PPT-resistant callus remains by the end of the callus proliferation stage enabling complete removal of PPT during the shoot maturation and rooting stages, accelerating whole transgenic plant development. 18. Medicago plants generated in tissue culture are very susceptible to drying out prior to establishment in soil. Acclimatization is carried out very gradually to avoid plant losses due to dehydration.

252

Tom Lawrenson et al.

19. The use of a humidity-controlled growth room appeared to greatly improve the survival of Medicago generated in culture (compared to greenhouse acclimatization) and resulted in consistently abundant foliage and seed production for raising both T1 seed and for WT seed for use in explant production.

Acknowledgments We acknowledge support from the project Engineering Nitrogen Symbiosis for Africa (ENSA) currently supported through a grant to the University of Cambridge by the Bill and Melinda Gates Foundation and the Foreign, Commonwealth and Development Office (FCDO). We also thank John Innes Centre Horticultural Services for care of genome edited Medicago plants. References 1. Razzaq A et al (2019) Modern trends in plant genome editing: an inclusive review of the CRISPR/Cas9 toolbox. Int J Mol Sci 20(16): 4045 ˇ erma´k T et al (2017) A multipurpose toolkit 2. C to enable advanced genome engineering in plants. Plant Cell 29(6):1196–1217 3. Jinek M et al (2012) A programmable dualRNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096): 816–821 4. Raitskin O, Patron NJ (2016) Multi-gene engineering in plants with RNA-guided Cas9 nuclease. Curr Opin Biotechnol 37:69–75 5. Hassan MM et al (2021) Construct design for CRISPR/Cas-based genome editing in plants. Trends Plant Sci 26(11):1133–1152 6. Curtin SJ (2018) Editing the Medicago truncatula genome: targeted mutagenesis using the CRISPR-Cas9 reagent. Methods Mol Biol 1822:161–174 7. Sturme MHJ et al (2022) Occurrence and nature of off-target modifications by CRISPR-Cas genome editing in plants. ACS Agric Sci Technol 2(2):192–201

8. Cosson V, Eschstruth A, Ratet P (2015) Medicago truncatula transformation using leaf explants. Methods Mol Biol 1223:43–56 9. Jiang Q, Fu C, Wang ZY (2019) A unified Agrobacterium-mediated transformation protocol for alfalfa (Medicago sativa L.) and Medicago truncatula. Methods Mol Biol 1864: 153–163 10. Chabaud M, Ratet P, Arau´jo S, Duque S, Harrison H, Barker D (2007) Agrobacterium tumefaciens-mediated transformation and in vitro plant regeneration of M. truncatula. In: Mathesius U, Journet EP, Sumner LW (eds) The Medicago truncatula handbook. ISBN 0-9754303-1-9 11. Pfeilmeier S, George J, Morel A, Roy S, Smoker M, Stransfeld L, Downie JA, Peeters N, Malone JG, Zipfel C (2019) Expression of the Arabidopsis thaliana immune receptor EFR in Medicago truncatula reduces infection by a root pathogenic bacterium, but not nitrogen-fixing rhizobial symbiosis. Plant Biotechnol J 17(3):569–579

Chapter 16 Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems Tom Lawrenson, Mark Youles, Monika Chhetry, Martha Clarke, Wendy Harwood, and Penny Hundleby Abstract CRISPR/Cas has been established for targeted mutagenesis in many plant species since 2013, including Brassica napus and Brassica oleracea. Since that time, improvements have been made in terms of efficiency and choice of CRISPR systems. This protocol encompasses improved Cas9 efficiency and an alternative Cas12a system, allowing more challenging and diverse editing outcomes to be achieved. Key words CRISPR/Cas9, Cas12a, Brassica oleracea, Brassica napus, Genome editing, Targeted mutagenesis

1

Introduction Since the first reports of Streptococcus pyogenes Cas9 (SpCas9) usage in plants [1, 2], its application has become widespread in many crop species including Brassica napus [3] and Brassica oleracea [4]. Most often, it is used to bring about double-stranded DNA breaks (DSB) at target loci, which are frequently repaired by the host cell in an imperfect manner, leading to the insertion or deletion of nucleotides (indels) at the DSB. Indels in turn can bring about a loss or modification of gene function, which is a valuable tool in determining the roles of those genes and dissecting component parts of them. SpCas9 is an RNA-guided endonuclease that finds its genomic target through RNA/DNA base pairing between the RNA guide and the genomic target. If a match is found, the Cas9 endonuclease will cleave to leave a blunt ended DSB. In higher eukaryotic plants, the principal DNA repair mechanism is non-homologous end joining (NHEJ). NHEJ is error prone resulting in indels in some cases, although many DSBs will be perfectly repaired so they are never

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_16, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

253

254

Tom Lawrenson et al.

G

5’NNNNNNNNNNNNNNNNNNNN

UAAAAUU CGAU A GAA

GUUUUAGAGCUA G

A A

AGCCACGGUGAAAAAGUUC UCGGUGC

SpCas9

3’UUUU

AAGGCUAGUCCGUUAUCAA

3’--------------NNNNNNNNNNNNNNNNNNNNNCC-------------------------------5’ 5’--------------NNNNNNNNNNNNNNNNNNNNNGG-------------------------------3’ PAM

LbCas12a

5’UAAUUUCUACU A A 3’NNNNNNNNNNNNNNNNNNNNNNN UAGAUGU G

5’--------------------NNNNNNNNNNNNNNNNNNNNNNNVAAANNNNNN---------------3’ 3’--------------------NNNNNNNNNNNNNNNNNNNNNNNVTTTNNNNNN---------------5’ PAM

Fig. 1 (a) Representation of SpCas9 guide RNA and its interaction with target DNA. Ns in red = protospacer, giving target specificity. Sequence in blue is the tracr RNA, allowing complexing with Cas9 protein. Ns in black = target in genome. Red box indicates the PAM (protospacer adjacent motif). Black triangles indicate where each DNA strand is cut, giving a blunt end. (b) Representation of LbCas12a guide RNA and its interaction with target DNA. Ns in red = protospacer, giving target specificity. Sequence in blue is the DR, allowing complexing with Cas12a protein. Ns in black = target in genome. Red box indicates the PAM (protospacer adjacent motif). Black triangles indicate where each DNA strand is cut, giving a sticky end

detected. The SpCas9 single guide RNA (sgRNA) is composed of a 3′ invariable sequence known as the tracrRNA and a 5′ variable protospacer of 20 nucleotides in length (Fig. 1a). The 3′ tracrRNA allows the guide to complex with the Cas9, and the 5′ protospacer is used to interrogate the genome, providing the target specificity. By simply changing the protospacer sequence, the DSB can be targeted to the locus of interest. A requirement for sgRNA functionality is the presence of homologous genomic sequence that is directly followed by NGG which is referred to as the PAM (protospacer adjacent motif). If this entire 23-base sequence is found in the genome (20 from the protospacer plus PAM), then the Cas9 endonuclease will cut at a point 3 bp from the PAM.

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

255

Cas12a (formerly CPF1) is another RNA-guided endonuclease which was first utilized in plants [5] later than SpCas9. Cas12a from Lachnospiraceae bacterium (LbCas12a) is probably the second most widely used CRISPR system in plants after SpCas9 and has several potential advantages depending on the situation. Firstly, by nature of its TTTV PAM requirement as opposed to the SpCas9 requirement of NGG, it has utility in GC deserts which are often found in introns, UTRs, and promoter regions. Secondly, LbCas12a typically produces larger deletions than SpCas9 which may be desirable for deletion studies. Thirdly, while SpCas9 cuts at the PAM proximal end of the target giving blunt ends, LbCas12a cuts at the PAM distal region, giving sticky ends, two features which may explain the higher incidence of gene targeting achieved with LbCas12a [6]. The LbCas12a guide RNA has a short invariable region at the 5′ end which is sometimes known as the direct repeat (DR) sequence and allows complexing with the Cas12a protein. The variable protospacer allowing programmable targeting is found at the 3′ end of the guide RNA and is around 23 nucleotides in length (Fig. 1b). Upon interrogation of the host genome, if LbCas12a identifies a sequence homologous to the protospacer which is preceded by a TTTV PAM, then a sticky ended DSB will result. The length of the guide RNA responsible for targeting is relatively short (20 nucleotides Cas9/23nucleotides Cas12a plus PAM requirements) so it is sometimes difficult, especially in larger crop genomes, to ensure that this sequence is not present in other “off-target” locations. Even if the match between the guide RNA and the genomic target is not perfect, there is a chance of off-target mutations [7]. Today, many web-based tools which are linked to plant genomes of interest are available to aid in guide selection, giving predictive scores for on-target and off-target cutting [8]. The off-target score is particularly useful for avoiding unwanted mutagenesis. To date, most CRISPR genome editing approaches still rely on producing stable transgenic lines to introduce the guide RNAs and SpCas9/LbCas12a. Protocols for the routine transformation of Brassica using T-DNA delivery via Agrobacterium tumefaciens were previously reported [9]. In the current chapter, we detail how to prepare DNA constructs for SpCas9 and LbCas12a to use in Brassica napus and Brassica oleracea Agrobacterium-based transformation. For SpCas9, we use a primer extension cloning protocol to insert between one and four guides into a single level 1 guide accepter. This is then cloned into the final construct in level 2, along with a level 1 nptII selectable marker used in plant transformation and a level 1 SpCas9 expression cassette (Fig. 2). For LbCas12a, hybridized oligonucleotides representing individual protospacers are cloned into single guide accepters in level 1. Up to four level

256

Tom Lawrenson et al.

35S_nptII_T-Nos

LB

35S_nptII_T-Nos

AtUbi10_Cas9+int_T-E9

AtUbi10_Cas9+int_T-E9

AtU626

P.spacer

AtU626

tracrRNA

RFP

P.spacer

BsaI BpiI

P.spacer

BsaI

tracrRNA

BsaI

BpiI

BpiI

BpiI

BpiI

BpiI

P.spacer

BsaI

BsaI

BsaI

Primer extension

Level 1

tracrRNA

tracrRNA

RB

Level 2

Fig. 2 Two-step cloning protocol for level 2 SpCas9 constructs. Primer extension is used to assemble guides in the level 1 position 3 guide accepter via BsaI. The level 1 position 3 guide cassette is then cloned alongside the level 1 position 1 nptII selectable marker and level 1 position 2 SpCas9 cassette, into the level 2 accepter pAGM4723 via BpiI. tRNA = tRNA sequence for transcript cleavage and promoter activity. P.spacer = userdefined protospacer sequence. tracrRNA = tracr RNA sequence. 35S_nptII_T-Nos = 35S driven nptII with Nos terminator for kanamycin selection in plants. AtUBI10_Cas9+int_T-E9 = SpCas9 with 13 introns driven by the Arabidopsis ubiquitin 10 promoter and terminated by the Pea E9 terminator. AtU626 = Arabidopsis U626 promoter. RFP = Red fluorescent protein used for red/white colony selection during level 1 guide cloning. LB = Left T-DNA border sequence. RB = Right T-DNA border sequence. Curved arrows indicate transcription direction

1 guide cassettes are readily cloned into level 2 along with a level 1 nptII selectable marker and level 1 LbCas12a expression cassette, allowing the reader to choose between one and four guides in the final level 2 construct (Fig. 3). In order to maximize efficiency of mutagenesis, reducing the need for time-consuming tissue culture and downstream genotyping, we have recently tested various available component parts and derived novel variants, resulting in massive SpCas9 efficiency gains and an efficient LbCas12a system in Brassica. Central to this is the use of an SpCas9 allele containing 13 introns [10] in conjunction with a tRNA guide architecture [11]. tRNA sequences preceding each protospacer (Fig. 2) allow processing of a multi-guide transcript into individual guides. tRNA sequence also provides promoter activity, increasing guide RNA abundance. In the LbCas12a system, we have found that transcriptional cassettes with single guides work well when the DR and protospacer are flanked by a pair of self-cleaving hammerhead and Hepatitis delta virus ribozymes (Fig. 3) [6]. We also found that introducing eight introns

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

257

BsaI

BsaI

P.spacer

35S_NptII_T-Nos

LB

AtUbi10_Cas12a+int_T-E9

35S_NptII_T-Nos

AtUbi10_Cas12a+int_T-E9

AtU626

AtU626

H H

D R

H H

D R

P.spacer

BsaI

BpiI

Reverse oligo

BsaI

BpiI

BpiI

BpiI

BpiI

BpiI

Forward oligo

RFP

HDV

HDV

RB

Fig. 3 Two-step cloning protocol for level 2 LbCas12a constructs. Hybridizing oligos representing protospacers are inserted into level 1 guide accepters via BsaI. The level 1 guide cassette(s) is/are then cloned alongside the level 1 position 1 nptII selectable marker and level 1 position 2 SpCas9 cassette, into the level 2 accepter pAGM4723 via BpiI. 35S_nptII_T-Nos = 35S-driven nptII with Nos terminator for kanamycin selection in plants. AtUBI10_Cas12a+int_T-E9 = LbCas12a with 8 introns driven by the Arabidopsis ubiquitin 10 promoter and terminated by the Pea E9 terminator. AtU626 = Arabidopsis U626 promoter. P.spacer = user-defined protospacer sequence. HH = hammerhead ribozyme sequence. DR = Direct repeat sequence. RFP = Red fluorescent protein used for red/white colony selection during level 1 guide cloning. HDV = Hepatitis delta virus ribozyme sequence. LB = Left T-DNA border sequence. RB = Right T-DNA border sequence. Curved arrows indicate transcription direction

into an Arabidopsis codon-optimized LbCas12a coding sequence boosted its performance in Brassica (unpublished). These improvements are included in this protocol. The number of guides used and primary transgenics created must be decided by the individual, balancing the risks of off-targets, number of genes to be targeted, and inherent variation in untested guide function. The more guides that are used to target a particular gene, the greater the efficiency of mutagenesis is likely to be, although unless guides are carefully selected, the risk of off-targets will also increase. By producing more primary transgenic plants, the number of resulting plants containing targeted mutations will also increase, although at the cost of more plant work. If using 4 guides in one level 2 construct to target a single gene for

258

Tom Lawrenson et al.

both SpCas9 and LbCas12a systems, we recommend producing 20 independent lines. If targeting more than one gene which cannot be addressed using the same guides (i.e., non-related genes), then the guides should be split between target genes and the number of primary transgenics increased accordingly. We detail in this protocol how to make level 2 constructs for both SpCas9 and LbCas12a systems containing between one and four guides. If the user wishes to use more guides than this in the final construct, then it is possible to do so by using an additional level of cloning. In this case, multiple level 1 guide cassettes, a level 1 nptII selectable marker, and a level 1 Cas expression cassette can be assembled in two or more level M accepters and then combined in the final level P accepter. The additional level minimizes the number of fragments ligated in any one step, keeping the cloning efficiency high and allowing many guides to be used in a single T-DNA construct [12]. In order to do this, we provide Addgene numbers for the additional level 1 guide accepters, level M accepters, level M end linkers, level P accepter, and level P end linkers required. Once the T0 transgenics are available, they can be screened. We have found that direct Sanger sequencing of PCR amplicons which cover the target sites is relatively quick and simple, giving detailed information on the events occurring at the target locus if combined with web-based tools to decipher mixed peak chromatograms. SpCas9 cuts 3 bp from the PAM, while LbCas12a gives a staggered break starting around 17 nucleotides from the PAM. Therefore, where indels are present, sequencing chromatograms typically become double or triple peaked from precisely this cut point, whereas the preceding sequence consists of clean single wild-type peaks. This result indicates that there is a mixture of alleles, many of which will be potentially useful for functional studies. Homozygous mutations are also frequently identified at this stage. Once T0 mutant plants with mutations have been identified, they are grown to seed. Mutations should segregate from the T-DNA in the T1 generation allowing T-DNA-free mutants to be identified. T1 plants which contain no T-DNA can be identified by PCR for the selectable marker, and mutations can be screened for using the same PCR/sequencing procedure as used in the T0 parents. Usually, the aim is to identify lines containing no T-DNA and homozygous mutations. While the T-DNA should segregate in a Mendelian fashion in T1, often the targeted mutations do not. Where editing occurred early in the T0, for example, in the founder cell of regenerated plants, T1 mutagenesis may reach 100% (only mutant alleles in siblings). However, where editing has occurred later during T0 plant regeneration, the plants may be chimeric, and fewer T1 siblings are likely to be mutated meaning that a greater number of T1 plants will need to be screened.

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

2 2.1

259

Materials Cloning

1. Computer with internet access. 2. Level 1 position 3 SpCas9 guide accepter pICSL1P3_AtU626Ter26 (Addgene# 191771). 3. Level 1 position 3 (pICSL1P3_crU626), position 4 (pICSL1P4_crU626), position 5 (pICSL1P5_crU626), and position 6 (pICSL1P6_crU626) LbCas12a guide accepters (Addgene#s 191778, 191779, 191780, 191781) 4. Phusion DNA polymerase and buffer (New England Biolabs M053OS). 5. Set of four dNTPs (Promega U1330). 6. Molecular biology-grade agarose for electrophoresis (Melford 9012-36-6). 7. 10× TBE gel running buffer (Thermo Fisher). 8. Agarose gel casting and running facility. 9. 100 bp DNA ladder (New England Biolabs N3231S). 10. Clean scalpel blades. 11. Gel extraction kit (Qiagen 28704). 12. Hybridization buffer: 10 mM Tris-HCl pH 7.5, 50 mM NaCl, 1 mM EDTA. 13. Laboratory heat block with metal insert to fit Eppendorf tubes. 14. BSA (bovine serum albumin) molecular biology grade (NEB B9200). 15. T4 DNA ligase and buffer (NEB M0202L). 16. BsaI V2 restriction enzyme (NEB R3733S). 17. EcoRI restriction enzyme (NEB R3101S). 18. BpiI restriction enzyme (Thermo Fisher ER1011). 19. Library efficiency competent E. coli cells (Thermo Fisher 18263012). 20. Miniprep kit (Qiagen 27104). 21. LB medium (1 L): 10 g tryptone, 5 g sodium chloride, 5 g yeast extract, 1 L distilled H2O. Add 7.5 g agar for solid media or without for liquid. Autoclave. 22. Ampicillin (100 mg/mL): Dissolve in distilled H2O. Filtersterilize. 23. Shaking and static incubators set for 28 °C and 37 °C. 24. PCR machine. 25. Big dye version 3.1 sequencing reagent and buffer.

260

Tom Lawrenson et al.

2.2 Genotyping Transgenic Plants

1. 1.7 mL Eppendorf tubes. 2. Microfuge. 3. Micro-pestles to fit 1.7 mL Eppendorf tubes (Sigma EP0030120973). 4. 0.2 ml PCR tubes. 5. DNA buffer 1: 200 mM Tris-HCl pH 7.5, 250 Mm NaCl, 25 mM EDTA, 0.5% SDS. Autoclaved. 6. 70% ethanol. 7. 100% ethanol. 8. Propan-2-ol. 9. 10× TE buffer (1 L): Dissolve 15.759 g Tris-HCl and 2.92 g EDTA in 800 mL distilled water. Bring pH to 8 and then increase volume to 1 L.Autoclave. 10. PCR machine. 11. 2× PCR master mix (Qiagen 201443). 12. Molecular biology-grade agarose for electrophoresis (Melford 9012-36-6). 13. 10× TBE gel running buffer (Thermo Fisher). 14. Agarose gel casting and running facility. 15. 100 bp DNA ladder marker. 16. John Innes number 3 compost. 17. 2:1:1 NPK fertilizer.

3

Methods

3.1 Selection of Target Sequences

1. Use the CRISPOR web-based tool (www.crispor.tefor.net) to identify target sequences. Paste the sequence of the target region into the box in step 1. In step 2, select the target genome from the drop-down menu. Both B. napus and B. oleracea genomes are found here. In step 3, select the PAM motif requirement: 20 bp-NGG-SpCas9 for SpCas9 and TTT(A/C/G)-23 bp-Cas12a for LbCas12a. Submit the query to identify potential protospacer sequences in addition to predicted scores for on-target and off-target cutting. Choose protospacers which do not contain BsaI or BpiI restriction sites which will be needed later in cloning. 2. Design and test PCR amplicons which will cover all on-target sites and any off-target sites of concern. Primers internal to these should also be designed for the purpose of Sanger sequencing amplicons. Using wild-type DNA, sequencing primers should be tested on the amplicons to ensure that they give clean unambiguous reads over all chosen target sites. As a

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

261

general rule of thumb, each target site should have a forward and reverse sequencing primer between 100 nucleotides and 300 nucleotides away (see Note 1). 3.2 Cloning SpCas9 Guides

1. If using the SpCas9 system, select from the templates below according to how many guides you wish to use in your final level 2 construct. If one guide is required, use the one-guide template (one cloning position). If two guides are required, use the two-guide templates (two cloning positions). If three guides are required, use the three-guide templates (three cloning positions). If four guides are required, use the four-guide templates (four cloning positions). Replace the N’s in the templates with the protospacer sequences you wish to use. If you wish to have more than four guides in the final construct, see Note 2. An example of a target sequence with the PAM underlined is CGATGGCATGGACCAATGCA TGG. The PAM is not included in the protospacer giving the template completion shown below: Template ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgca NNNNNNNNNNN NNNNNNNNNgttttgagacctttttt Completed template ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaCGATGGCATGG ACCAATGCAgttttgagacctttttt From the completed templates of choice, design forward and reverse primer pairs to represent exactly the entire completed template sequence, and then request their commercial synthesis. Primers should have partial overlap as indicated in yellow to allow primer extension later, giving the full-length double-stranded product for cloning. The completed example template above will therefore give the primer pair shown below: Completed template showing overlapping region for primer pair (subscript) 5′ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccacggt acagacccgggttcgattcccggctggtgcaCGATGGCATGGACC AATGCAgttttgagacctttttt3′ Derived forward primer 5′ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccacggt3′ Derived reverse primer 5′aaaaaaggtctcaaaacTGCATTGGTCCATGCCATCGtgcaccag ccgggaatcgaacccgggtctgtaccgtggcagggtactattctaccact3′

262

Tom Lawrenson et al.

Template for one guide only Position 1 ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccacggt acagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNNN NNNNNNgttttgagacctttttt Templates for two guides Position 1 ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNNNNN NNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaac ttgaaaaagtggcaccgagtcggtgctgagacctttttt Position 2 ttttttggtctcagtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNN NNNNNNNgttttgagacctttttt Templates for three guides Position 1 ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNNN NNNNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaac ttgaaaaagtggcaccgagtcggtgctgagacctttttt Position 2 ttttttggtctcagtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNNNN NNNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaac ttgaaaaagtggcaccgagttgagacctttttt Position 3 ttttttggtctcagagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNN NNNNNNNNNgttttgagacctttttt Templates for four guides Position 1 ttttttggtctcaattgaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNNNNN NNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaac ttgaaaaagtggcaccgagtcggtgctgagacctttttt Position 2 ttttttggtctcagtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccac ggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNNNNNN NNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaac ttgaaaaagtggcaccgagttgagacctttttt

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

263

Position 3 ttttttggtctcagagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccc tgccacggtacagacccgggttcgattcccggctggtgcaNNNNNNNNNNNN NNNNNNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatc aacttgaaaaagtggcaccgagtcggtgcaacatgagacctttttt Position 4 ttttttggtctcaaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagaccc gggttcgattcccggctggtgcaNNNNNNNNNNNNNNNNN NNNgttttgagacctttttt 2. Prepare primer extension reactions in 0.2 mL tubes to obtain full-length double-stranded DNA: 33.5 μL water, 10 μL highfidelity 10× buffer (NEB), 1 μL of 10 mM stock dNTPs, 2.5 μL of (10 μM stock) forward primer, 2.5 μL of (10 μM stock) reverse primer, 0.5 μL Phusion DNA polymerase (NEB). 3. Cycle the reactions: 1 × 98 °C for 1 min, 30 × 98 °C 10 s/60 °C 15 s/72 °C 15 s, and, finally, 1 × 72 °C 2 min. 4. Run 20 μL of the primer extension products on a 2% agarose gel against a 100 bp ladder. Isolate the correct sized band (s) using a clean scalpel, and purify the DNA from the gel slice(s) using a Qiagen gel extraction kit. Elution into 20 μL of EB buffer at the final stage should give a DNA concentration of at least 10 ng/μL. 5. Prepare a digestion/ligation (diglig) reaction to insert the purified products into the level 1 position 3 SpCas9 guide accepter vector: 1 μL (100 ng) pICSL1P3_AtU626Ter26 (Addgene# 191771), 10 ng purified primer extension products, 1.5 μL 10× T4 ligase buffer, 1.5 μL bovine serum albumin (of 10 mg/mL stock), 1 μL (400 units) T4 DNA ligase (NEB), 1 μL (20 units) BsaI v2 (NEB), water to 15 μL. 6. Cycle the diglig reactions in a PCR machine: 1 × 37 °C for 20 s, 26 × 37 °C for 3 min/16 °C for 4 min, 1 × 50 °C for 5 min, and 1 × 80 °C for 5 min. Store frozen at -20 °C or use immediately for E. coli transformation. 3.3 Cloning of LbCas12a Guides

1. If using the LbCas12a system, design hybridizing oligonucleotides representing the protospacer(s) of choice, giving them additional sticky ends as shown below in red to allow their insertion into guide accepters. An example target site with the PAM underlined is 5′TTTGATTCGTTGATAGGGCTAAAGAGAT3′. The PAM is not included in the protospacer: 5′ATTCGTTGATAGGGCTAAAGAGAT3′.

264

Tom Lawrenson et al.

5′ overhangs are added to representative hybridizing oligo pair: 5’AGATATTCGTTGATAGGGCTAAAGAGAT 3’ 3’TAAGCAACTATCCCGATTTCTCTACCGG 5’

2. Complementary oligos are hybridized by preparing the pair at 2 μM in hybridization buffer within an Eppendorf tube and heating to 95 °C for 3 min using a metal heat block. The block is then switched off and allowed to slowly return to room temperature, which should take about 45 min. 3. Depending on how many protospacers the user would like to use in their final level 2 construct, the number of LbCas12a guide accepters used and diglig reactions undertaken will vary. If the final level 2 construct will contain one guide, use the position 3 guide accepter pICSL1P3_crU626 (Addgene# 191778). If the final level 2 construct will contain two guides, use the position 3 pICSL1P3_crU626 (Addgene# 191778) and position 4 pICSL1P4_crU626 (Addgene# 191779) guide accepters. If the final level 2 construct will contain three guides, use the position 3 pICSL1P3_crU626 (Addgene# 191778), position 4 pICSL1P4_crU626 (Addgene# 191779), and position 5 pICSL1P5_crU626 (Addgene# 191780) guide accepters. If the final level 2 construct will contain four guides, use the position 3 pICSL1P3_crU626 (Addgene# 191778), position 4 pICSL1P4_crU626 (Addgene# 191779), position 5 pICSL1P5_crU626 (Addgene# 191780), and position 6 pICSL1P6_crU626 (Addgene# 191781) guide accepters. If the user wishes to have more than four guides in the final T-DNA construct, see Note 3. 4. The following should be added to a 0.2 mL PCR tube: 100 ng of relevant position guide accepter, 1 μL of hybridized oligo pair, 1 μL of 10 × T4 ligase buffer, water to 8.5 μL, 0.5 μL (10 units) Bsa1, and 1 μL (400 units) T4 ligase (NEB). 5. Cycle the diglig reactions in a PCR machine: 1 × 37 °C for 20 s, 26 × 37 °C for 3 min/16 °C for 4 min, 1 × 50 °C for 5 min, and 1 × 80 °C for 5 min. Store frozen at -20 °C or use immediately for E. coli transformation. 3.4 Transformation of Guide Digligs into E. coli

Use 7 μL of the cycled diglig reaction for E. coli transformation using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this, samples will be in a 0.9 mL volume of SOC bacterial liquid media. Two LB agar plates should be prepared for each sample, containing 100 mg/L ampicillin. On one plate spread 10 μL of the SOC suspension and on the other 50 μL. Incubate up-side-down at

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

265

37 °C overnight before identifying white colonies containing the cloned fragments of interest. Colonies which do not contain the required inserts will be red. 3.5 Screening Cloned Guides

1. Pick white colonies from the plates in Subheading 3.4 into 10 mL of LB containing 100 mg/L ampicillin. For the SpCas9 guide accepter containing up to four guides, pick ten colonies. Many of these colonies are likely to have unwanted mutations over the cloned region, but by screening ten, at least one perfect clone should be identified. For the LbCas12a accepter, two colonies should suffice as mutations are quite rare when cloning single guides. Grow the cultures in a shaking incubator overnight at 37 °C until turbid. 2. Extract plasmid using a Qiagen miniprep kit. 3. The plasmid should be Sanger sequenced using the primer 5′ TTAGGCATCGAACCTTCAAGAATTT3′. Reactions should contain 200 ng plasmid, water to 6.5 μL, 1.5 μL BigDye 3.1 buffer, 1 μL of 10 μM primer, and 1 μL of BigDye version 3.1. Be sure to add the BigDye version 3.1 last. Cycle reactions as follows: 1 × 96 °C for 1 min and 25 × 96 °C for 10 s/50 °C for 5 s/60 °C for 4 min. Completed reactions should be sent to one of the specialist companies dealing with capillary electrophoresis of such material. Identify one clone for each diglig with the correct sequence over the cloned region.

3.6 Level 2 Cloning to Make SpCas9 Constructs Containing Between One and Four Guides

Between one and four guides will have been cloned into the level 1 position 3 guide accepter pICSL1P3_AtU626Ter26 in Subheading 3.2. This level 1 cassette will now be combined with two other level 1s: the level 1 position 1 nptII selectable marker pICSL11137 (Addgene# 191783) and the level 1 position 2 SpCas9 expression cassette pICSL11197 (Addgene# 191784) in level 2 cloning according to Fig. 2. The following should be added to a 0.2 mL PCR tube: 100 ng level 2 accepter pAGM4723 (Addgene# 48015), 300 ng pICSL11137 (Addgene# 191783), 400 ng pICSL11197 (Addgene# 191784), 250 ng confirmed level 1 position 3 guide cassette from Subheading 3.5, 200 ng position 3 end linker pICH41766 (Addgene# 48018), 1.5 μL of 10 × T4 ligase buffer, 1.5 μL bovine serum albumin (of 10 mg/mL stock), water to 13 μL, 1 μl (10 units) BpI1, and 1 μL (400 units) T4 ligase. The mixture should be immediately cycled as follows: 1 × 20 s at 37 °C, 26 × 37 °C for 3 min/16 °C for 4 min, 1 × 50 °C for 5 min, and 1 × 80 °C for 5 min. Store frozen at -20 °C or use immediately for E. coli transformation.

266

Tom Lawrenson et al.

3.7 Level 2 Cloning to Make LbCas12a Constructs Containing Between One and Four Guides

In Subheading 3.3, single protospacers will have been cloned into level 1 single guide accepters according to how many guides are required in the final level 2 construct. Now the level 1 guide cassettes are combined with two other level 1s in level 2 cloning: the position 1 nptII selectable marker pICSL11137 (Addgene# 191783) and the position 2 LbCas12a expression cassette EC59103 (Addgene# 191785) as shown in Fig. 3. Where one guide cassette is used (position 3), the position 3 end linker pICH41766 (Addgene# 48018) will be used. Where two guide cassettes are used (positions 3 and 4), the position 4 end linker pICH41780 (Addgene# 48019) will be used. Where three guide cassettes are used (positions 3, 4, and 5), the position 5 end linker pICH41800 is used (Addgene# 48020). Where four guides are used (positions 3, 4, 5, and 6), the position 6 end linker pICH41822 is used (Addgene# 48021). The following should be added to a 0.2 ml PCR tube: 100 ng level 2 accepter pAGM4723 (Addgene# 48015), 300 ng pICSL11137 (Addgene# 191783), 400 ng EC59103 (Addgene# 191785), 250 ng confirmed guide cassette(s) from 3.5, 200 ng appropriate end linker, 1.5 μL of 10 × T4 ligase buffer, 1.5 μL bovine serum albumin (of 10 mg/mL stock) water to 13 μL, 1 μL (10 units) BpI1, and 1 μL (400 units) T4 ligase. The mixture should be immediately cycled as follows: 1 × 20 s at 37 °C, 26 × 37 °C for 3 min/16 °C for 4 min, 1 × 50 °C for 5 min, and 1 × 80 °C for 5 min. Store frozen at -20 °C or use immediately for E. coli transformation.

3.8 Transformation of Level 2 Digligs into E. coli

Use 7 μL of the cycled diglig reaction (see Subheadings 3.6 and 3.7) for E. coli transformation using 100 μL of Invitrogen library efficiency competent cells and following the manufacturer’s instructions. At the end of this, samples will be in a 0.9 mL volume of SOC bacterial liquid media. Two LB agar plates should be prepared for each sample, containing 50 mg/L kanamycin. On one plate spread 10 μL of the SOC suspension and on the other 50 μL. Incubate upside-down at 37 °C overnight before identifying white colonies containing the cloned fragments of interest. Colonies which do not contain the cloned inserts will be orange.

3.9 Screening Level 2 Colonies

1. Pick white colonies from the plates in Subheading 3.8 into 10 mL of LB containing 50 mg/L kanamycin. Grow the cultures in a shaking incubator overnight at 37 °C until turbid. 2. Extract plasmid using a Qiagen miniprep kit. 3. Digest 300 ng of the plasmid using EcoRI which gives a usefully diagnostic pattern, and run in a 1% agarose gel against a 1 kb DNA ladder, to check that expected band sizes are present.

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

267

4. We recommend carrying out Sanger sequencing using the protocol in Subheading 3.5, step 3 and primers designed to give coverage over the level 2 junctions where level 1 cassettes were spliced together. In this way, verified level 2 clones will be ready for use in Agrobacterium-based transformation of Brassica. 3.10 Genotyping T0 Primary Transgenic Plants

1. When confirmed primary T0 transformed plants are available, remove a leaf sample with an area of approximately 1 cm square. Samples are collected in 1.5 mL Eppendorf tubes. 2. Add 600 μL of DNA buffer 1 to each, and grind the leaves using micro-pestles until all large particles are fragmented and the liquid becomes dark green. 3. Spin tubes in a benchtop microfuge at full speed for 10 min before 500 μL of the supernatant is moved to a fresh 1.5 mL Eppendorf tube, taking care to leave behind any solid matter. 4. Add an equal volume of propan-2-ol to each tube before vortexing and then spinning at full speed in a microfuge for 20 min. Carefully pour off the liquid and wash the pellet with 0.5 mL of 70% ethanol. 5. Spin tubes at full speed again for 10 min before carefully removing the liquid and allowing the pellet to air-dry until all liquid has evaporated. Pellets are resuspended in 100 μL of 1 × TE. 6. 1 μL of this genomic DNA prep can be used as template in PCR using cycling conditions and primers previously shown to amplify target loci. 7. Validate PCR amplification using agarose gel electrophoresis. Band shift relative to the wild-type band size may be seen and indicates target site mutations. Many bands are likely to appear wild type in size although sequencing is likely to reveal mutations. 8. Send remaining PCR products for commercial Sanger sequencing following company guidelines for sample submission. Each target site should be sequenced twice, once with a forward primer and again with a reverse primer. These sequencing primers should be internal to the primers used in the PCR and between 100 and 300 bases from the nearest target site. Depending on the location of target sites selected, it may be necessary to use multiple sequencing primers in additional reactions to cover all target sites. ABI files will be returned by the company of choice.

268

Tom Lawrenson et al.

9. Upon viewing of the ABI files as chromatograms, indels at target loci will be visible as double or multiple peaks, usually starting at or near to the Cas9/Cas12a cut sites. Homozygous mutations are also likely to be present, which will maintain single peaked chromatograms. The ICE Analysis web-based tool can be used to identify the alleles present and their relative proportion (ice.synthego.com). 10. Active T0 lines where mutagenesis has been detected should be grown to maturity and dry seeds collected for T1 analysis. 3.11 Identification of Transgene-Free Mutant Lines

1. Sow sufficient seed from active T0 parents into 9 cm pots using John Innes number 1 compost, to give 24 T1 plants for each parental line of interest. Grow plants in a glasshouse with day/night temperatures of 18 °C/12 °C, 16-h day length, with supplementary lighting (high-pressure sodium lamps with an average bench reading of 200 μmol/m2/s1). Fertilize plants weekly with a 2:1:1 NPK fertilizer. After around 3–4 weeks, the plants should be well established. 2. When plants are established after 3–4 weeks, sample leaf material and extract DNA as in Subheading 3.10. 3. Repeat the PCR and Sanger sequencing used in Subheading 3.10 to identify target site mutations. Some T1 siblings are likely to contain homozygous mutations at this stage. 4. Identify T1 plants which have lost the T-DNA through segregation using PCR with primers and cycling conditions specific to the NptII gene. The forward primer sequence is 5′ATGAA CAAGATGGATTGCAC3′ and the reverse primer sequence is 5′ TGAGATGACAGGAGATCCTG 3′, giving a product of 313 bp. Each PCR reaction should contain 1μl of genomic DNA template, 10 μL of Qiagen 2× PCR Master Mix, 200 nM final primer concentrations, and water to 20μL. Cycle the reactions with 1 × 94 °C 3 min and 35 × 94 °C 30 s/58 °C 45 s/72 °C 45 s. 5. Run the products in a 2% agarose gel against a 100 bp ladder. If positive and negative template controls are plus and minus a 313 bp band, respectively, then any T1 plant without a band will be free of the T-DNA. 6. By this stage, it is likely that homozygous T1 mutants which are T-DNA-free will have been identified, enabling phenotyping and growth to maturity for seed bulking. It may be necessary to screen more than 24 T1 siblings in order to achieve this, for example, where multiple genes are being targeted or where T-DNA has integrated at multiple unlinked loci. Another option is to grow into the T2 generation where the desired segregation may be detected.

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

4

269

Notes 1. It is important to test PCR amplification of target sites before assembling constructs to ensure mutation screening will run smoothly in subsequent steps. This is particularly important if working in a different genotype to that used in identification of target sites using the CRISPOR tool. It may be necessary to make alignments of related genes in order to achieve genespecific PCR amplicons, especially in the polyploid B. napus. For this reason, it is of great benefit to have access to the full genome sequence of the genotype you plan to transform. 2. If you wish to use more than four SpCas9 guides in the final construct, we recommend using additional level 1 guide accepter vectors, each of which should have between one and four guides inserted in the manor described in Subheading 3.2. Addgene numbers for level 1 SpCas9 guide accepters, positions 1–7 are as follows: Position 1: pICSL1P1_AtU626Ter26

Addgene# 191769

Position 2: pICSL1P2_AtU626Ter26

Addgene# 191770

Position 3: pICSL1P3_AtU626Ter26

Addgene# 191771

Position 4: pICSL1P4_AtU626Ter26

Addgene# 191772

Position 5: pICSL1P5_AtU626Ter26

Addgene# 191773

Position 6: pICSL1P6_AtU626Ter26

Addgene# 191774

Position 7: pICSL1P7_AtU626Ter26

Addgene# 191775

These guide accepters have red/white colony selection for cloning into and ampicillin resistance in bacteria. Level 1 guide cassettes plus the level 1 position 1 nptII selectable marker pICSL11137 (Addgene# 191783) and level 1 position 2 SpCas9 cassette pICSL11197 (Addgene# 191784) can then be assembled into relevant level M accepters [12], using the appropriate level M end linkers before their assembly into the level P accepter pICSL4723-P1 (Addgene# 191786). Cloning from level 1 into level M is via BpiI and from level M into level P uses BsaI. Addgene numbers for position 1–7 level M accepters are as follows: Position 1: pAGM8031

Addgene# 48037

Position 2: pAGM8043

Addgene# 48038

Position 3: pAGM8055

Addgene# 48039

Position 4: pAGM8067

Addgene# 48040 (continued)

270

Tom Lawrenson et al. Position 5: pAGM8079

Addgene# 48041

Position 6: pAGM8081

Addgene# 48042

Position 7: pAGM8093

Addgene# 48043

All level M accepters have spectinomycin selection in bacteria and blue/white selection on X-Gal/IPTG for fragment insertion during cloning. Addgene numbers for position 1–7 level M end linkers are as follows: Position 1

Addgene# 48044

Position 2

Addgene# 48045

Position 3

Addgene# 48046

Position 4

Addgene# 48047

Position 5

Addgene# 48048

Position 6

Addgene# 48049

Position 7

Addgene# 48050

In the final stage, level M cassettes are assembled into the level P accepter pICSL4723-P1 (Addgene# 191786) using the appropriate level P end linker [12]. The level P accepter has kanamycin resistance in bacteria and blue/white selection on X-Gal/IPTG for fragment insertion during cloning. Addgene numbers for position 1–7 level P end linkers are as follows: Position 1: pICH50872

Addgene# 48058

Position 2: pICH50881

Addgene# 48059

Position 3: pICH50892

Addgene# 48060

Position 4: pICH50900

Addgene# 48061

Position 5: pICH50914

Addgene# 48062

Position 6: pICH50927

Addgene# 48063

Position 7: pICH50932

Addgene# 48064

We recommend not exceeding four diglig inserts in any level 1, M, or P when cloning repetitive sequences such as guide RNAs. 3. If the user requires more than four LbCas12a guides in the final T-DNA construct, then this can be done by utilizing the full range of LbCas12a level 1 guide accepters from positions 1–7. These should have guides inserted in the manor described in Subheading 3.3. Addgene numbers for level 1 LbCas12a guide accepters are as follows:

Efficient Targeted Mutagenesis in Brassica Crops Using CRISPR/Cas Systems

271

Position 1: pICSL1P1_crU626

Addgene# 191776

Position 2: pICSL1P2_crU626

Addgene# 191777

Position 3: pICSL1P3_crU626

Addgene# 191778

Position 4: pICSL1P4_crU626

Addgene# 191779

Position 5: pICSL1P5_crU626

Addgene# 191780

Position 6: pICSL1P6_crU626

Addgene# 191781

Position 7: pICSL1P7_crU626

Addgene# 191782

Level 1 guide cassettes can then be assembled into appropriate level M accepters along with the level 1 position 1 nptII selectable marker pICSL11137 (Addgene# 191783) and level 1 position 2 LbCas12a cassette EC59103 (Addgene# 191785), using the correct level M end linkers before their assembly in level P. The Addgene numbers for level M accepters and end linkers are given above in Note 2. The Addgene numbers for the level P accepter and seven level P end linkers are given in Note 2. We recommend not exceeding four diglig inserts in any level M or P when cloning repetitive sequences such as guide RNAs. References 1. Feng Z et al (2013) Efficient genome editing in plants using a CRISPR/Cas system. Cell Res 23(10):1229–1232 2. Li J-F et al (2013) Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol 31(8): 688–691 3. Yang H et al (2017) CRISPR/Cas9-mediated genome editing efficiently creates specific mutations at multiple loci using one sgRNA in Brassica napus. Sci Rep 7(1):7489 4. Lawrenson T et al (2015) Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol 16(1):258 5. Tang X et al (2017) A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants 3:17018 6. Wolter F, Puchta H (2019) In planta gene targeting can be enhanced by the use of CRISPR/Cas12a. Plant J 100(5):1083–1094 7. Sturme MHJ et al (2022) Occurrence and nature of off-target modifications by

CRISPR-Cas genome editing in plants. ACS Agric Sci Technol 2(2):192–201 8. Li C et al (2022) Computational tools and resources for CRISPR/Cas genome editing. Genomics Proteomics & Bioinformatics. https://doi.org/10.1016/j.gpb.2022.02.006 9. Sparrow PACHn, Irwin JA (2015) Brassica oleracea and B. napus. In: Wang K (ed) Agrobacterium protocols, vol 1. Springer, New York, pp 287–297 10. Gru¨tzner R et al (2021) High-efficiency genome editing in plants mediated by a Cas9 gene containing multiple introns. Plant Commun 2(2):100135 11. Ma C et al (2019) CRISPR/Cas9-mediated multiple gene editing in Brassica oleracea var. capitata using the endogenous tRNAprocessing system. Hortic Res 6(1):20 12. Marillonnet S, Gru¨tzner R (2020) Synthetic DNA assembly using Golden Gate cloning and the hierarchical modular cloning pipeline. Curr Protoc Mol Biol 130(1):e115

Chapter 17 Introduction of Genome Editing Reagents and Genotyping of Derived Edited Alleles in Soybean (Glycine max (L.) Merr.) Truyen Quach, Hanh Nguyen, Olivia Meyer, Shirley J. Sato, Tom Elmo Clemente, and Ming Guo Abstract Cas9-based genome editing is a powerful genetic tool for loci specifically targeted for genome modification. This chapter describes up-to-date protocols using Cas9-based genome editing technology, including vector construction with GoldenBraid assembly, Agrobacterium-mediated soybean transformation, and identification of editing in the genome. Key words Soybean, Cas9, Genome editing, GoldenBraid assembly, Transformation

1

Introduction Genome editing technology has rapidly emerged as a powerful tool to add novel genetic variation in animals and plants [1]. Site-specific genome editing reagents are composed of genetic elements that encode for a DNA recognition complex coupled with an endonuclease that generates double-strand break (DSB) that leads to the creation of genetic deletions/insertions (INDELs) due to errorprone non-homologous end joining repair or targeted insertions (knock-ins) via homologous recombination [2]. Two of these reagents, zinc finger nucleases (ZFNs) and transcription activatorlike effector nucleases (TALEN), are protein-based recognition complexes that guide the endonuclease to the target site. Both have been successful in many plant species to create INDELs in genomes. However, designing of the protein-based DNA binding domain arrays can be complicated, with a high tendency for off-target INDEL creation. In contrast, CRISPR/Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins) system which uses RNA-based recognition reagents to shuttle the endonuclease to the target site in the genome, which

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_17, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

273

274

Truyen Quach et al.

provides a higher degree of precision, expanded target locations within genome, with a reduced off-target edits [3]. In this system, a chimeric guide RNA (sgRNA) is used to direct the Cas9 endonuclease to a defined DNA sequence through complementary base pairing between sgRNA and genomic locus [4]. For its simplicity in designing, assembly, and improved specificity, CRISPR/Cas system has become the genome editing platform of choice and has proven to be a powerful tool to add novel genetic variation to plant species [5]. Advances in cost-effective DNA sequencing technologies have enabled the creation of high-resolution plant reference genome sequence databases. These sequenced genomes greatly facilitate the design of editing reagents and genotyping of derived edited alleles. Examples of such databases include Phytozome database version 13 (https://phytozome-next.jgi.doe.gov/) which hosts 261 assembled and annotated genomes and provides excellent tools and information for genome mining. The Phytozome database includes genome sequences of major commodity crops along with their transcriptomic data across multiple tissue types. Extensive tools and genetic information are also available for 114 grass genomes on the Gramene database (https://www.gramene.org/). In addition, resequencing of various genomes in the past few years provides significant coverage of many more plant species. For example, the recent sequencing of the USDA core soybean collection composed of genome sequences from more than 1000 genotypes is available to the public [6]. Sequencing of core selection of rice that represent the diversity of rice genetic information was performed on 69 rice genomes, and it also provides great resources for genome editing and genetic mapping [7]. In this chapter, we describe a protocol to deliver CRISPR/Cas genome editing machinery to soybean and perform the downstream genotyping of the edited alleles. The described method will serve as tool to add novel genetic variation to the soybean crop to complement breeding programs and functional genomics studies. The protocol outlined below has been successfully utilized in soybean to create null germinal edited alleles in soybean, with the resultant lineages devoid of editing machineries.

2

Materials

2.1 Bacterial Strains and Plasmid Vectors

Agrobacterium tumefaciens and E. coli DH5α strains are grown in LB with appropriate antibiotics at 28 °C and 37 °C, respectively. A series of broad host range destination vectors designated pDGB3alpha1, pDGB3-alpha2, pDGB3-omega1, and pDGB3-omega2 are used in GoldenBraid (GB) assembly platform [8] to build the final binary vectors expressing the Cas9 editing machinery and the plant selectable marker bar gene [9] for soybean transformation.

CRISRP/Cas9-Based Gene Editing in Soybean

2.2 Reagents and Supplies

275

1. Taq polymerase. 2. T4-DNA ligase. 3. Type IIS restriction enzymes BsaI and BsmBI. 4. Cetyltrimethylammonium bromide (CTAB) buffer: 2% CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 5 mM EDTA, pH 8.0. 5. 100× chelated iron (Fe3+-EDTA) stock solution: Prepare 7.46 g/L of Na2EDTA and 5.56 g/L FeSO4·7H20 solutions separately, then mix equal volume of 7.46 g/L of Na2EDTA and 5.56 g/L FeSO4·7H2O, and stir with low heat until the solution turns a deep yellow to make the 100× chelated iron (Fe3+-EDTA) stock. 6. Plasmid DNA miniprep and gel extraction kits can be purchased from providers such as QIAGEN. 7. 2 mL microfuge tubes. 8. 200 μL PCR tubes. 9. Petri dishes (100 mm diameter × 10 mm height; 100 mm diameter × 25 mm height). 10. Magenta box. 11. Peat pots. 12. Metro-Mix soil.

2.3

Equipment

1. Laminar flow hood. 2. Autoclave. 3. Microcentrifuge. 4. Shaker for liquid bacterial culture. 5. Thermocycler. 6. Mini-Beadbeater-96 (BioSpec Products). 7. Microplate centrifuge.

2.4 Bacterial and Plant Culture Media

1. YEP agar: 5 g/L yeast extract, 10 g/L peptone, 5 g/L NaCl, 15 g/L Bacto agar. 2. YEB liquid medium: 5 g/L yeast extract, 10 g/L peptone, 5 g/L NaCl. 3. Multiple commercial sources of pre-formulated Gamborg’s B5 medium [10] and MS medium [11] are available. Shown in Tables 1 and 2 are the recipes for 10× and 100× stock solutions for the macronutrient and micronutrient for each formulation described in the original publications, along with the formulation of the Gamborg’s vitamin stock (100×) (Table 3).

276

Truyen Quach et al.

Table 1 Macronutrient stock (10×) solutions Nutrient

MS medium

B5 medium

NH4NO3

16.5 g

–

KNO3

19.0 g

25.0 g

CaCl2·2H2O

4.4 g

1.5 g

MgSO4·7H2O

3.7 g

2.5 g

KH2PO4

1.7 g

–

(NH4)2SO4

–

1.34 g

NaH2PO4

–

1.5 g

Macronutrient stock formulations for Gamborg’s B5 and MS recipes for a 1 L of 10× stock

Table 2 Micronutrient stock (100×) solutions Nutrient

MS medium (mg)

B5 medium (mg)

KI

83

75

H3BO3

620

300

MnSO4·H20

1690

1000

ZnSO4·7H20

860

200

Na2MoO4·2H2O

25

25

CuSO4·5H20

2.5

2.5

CoCl2·6H2O

2.5

2.5

Micronutrient stock formulations for Gamborg’s B5 and MS recipes for a 1 L of 100× stock

Table 3 Gamborg’s B5 stock (100×) solution Vitamin

Amount

Myo-inositol

10 g

Nicotinic acid

100 mg

Pyridoxine HCl

100 mg

Thiamine HCl

1g

Formulation for Gamborg’s B5 for a 1 L of 100× stock

4. Germination medium (GM): Gamborg’s B5 major and minor salts, supplemented with 2% sucrose and buffered 3 mM MES buffer. Adjust to pH 5.6, solidified with 0.8% agar. Autoclave and let the medium cool down to 65 °C in a water bath. Add 1×

CRISRP/Cas9-Based Gene Editing in Soybean

277

Gamborg’s B5 vitamins and pour 40 mL of the media on 100 × 25 mm Petri plates. 5. Co-cultivation medium (CCM): 0.1× Gamborg’s B5 major and minor salts, supplemented with 3% sucrose and buffered with 20 mM MES buffer. Adjust pH to 5.4. Autoclave and let cool down. Add filter-sterilized after-additions to final concentrations of 1.67 mg/L BAP, 0.25 mg/L GA3, 200 μM acetosyringone, and 0.1× Gamborg’s B5 vitamins. 6. Washing medium (WM): Gamborg’s B5 major and minor salts, supplemented 3% sucrose and buffered with 3 mM MES. Adjust to pH 5.6. Autoclave and let the medium cool down. Add filter-sterilized after-additions to final concentrations of 1× Gamborg’s B5 vitamins, 1.67 mg/L BAP, 50 mg/L ticarcillin, 50 mg/L cefotaxime, and 50 mg/L vancomycin. 7. Shoot initiation medium (SIM): Gamborg’s B5 major and minor salts, supplemented 3% sucrose and buffered with 3 mM MES. Adjust to pH 5.6 and add 0.8% washed agar. Autoclave and let the medium cool down to 65 °C in a water bath. Add filter-sterilized after-additions to final concentrations of 1× Gamborg’s B5 vitamins, 1.67 mg/L BAP, 50 mg/L ticarcillin, 50 mg/L cefotaxime, 50 mg/L vancomycin, and 5 mg/L glufosinate (if using the bar gene as a marker). Pour 40 mL of the media into each 100 × 25 mm Petri plates. 8. Shoot elongation medium (SEM): MS major and minor salts, supplemented with 3% sucrose and buffered with 3 mM MES; adjust to pH 5.6 and add 0.8% washed agar. Autoclave and let the medium cool down to 65 °C in a water bath. Add filtersterilized after-additions to final concentrations of 1× Gamborg’s B5 vitamins, 1 mg/L zeatin riboside, 0.1 mg/L IAA, 0.5 mg/L GA3, 100 mg/L pyroglutamic acid, 50 mg/L asparagine, 50 mg/L ticarcillin, 50 mg/L cefotaxime, 50 mg/L vancomycin, and 5 mg/L glufosinate (if using the bar gene as a marker). Pour 40 ml of the media into each 100 × 25 mm Petri plates. 9. Rooting medium (RM): MS major and minor salts, supplemented 2% sucrose and buffered with 3 mM MES; adjust to pH 5.6 and add 0.8% washed agar. Autoclave and let the medium cool down to 65 °C in a water bath. Add filtersterilized after-additions to final concentrations of 1× Gamborg’s B5 vitamins, 0.5 mg/L NAA, 50 mg/L asparagine, and 100 mg/L pyroglutamic acid. RM medium does not contain the antibiotics used to counter-select A. tumefaciens given the observation that the antibiotic cocktail impedes root development and bacterial overgrowth at the rooting stage is rarely observed. Pour 40 mL of the media into each rooting cups. This protocol uses commercial clear plastic “Sundae” cups (Solo Cup Company) for the rooting step.

278

3

Truyen Quach et al.

Methods

3.1 Vector Construction

Multiple approaches can be used for assembly of the final binary vectors expressing the editing machinery and plant selectable marker cassette. Conventional cloning with a binary vector can be used with appropriate restriction enzymes/ligations using standard molecular biology methods. The editing platform for soybean described here employs a combination of gene synthesis of the various reagents that are domesticated and stitched together via GoldenBraid (GB) assembly [8]. GB modular assembly platform has many advantages especially when multiple genetic elements need to be stacked within a single T-DNA. GB assembly system involves the use of Type IIS class restriction enzymes and T4-DNA ligase and two sets of destination vectors that alternate for assembly of multiple DNA elements [8]. 1. GB destination vectors: GB destination vectors described here refer to broad host range plasmids, carrying T-DNA borders, devoid of plant selection marker cassettes, to provide researchers the flexibility in plant selectable marker gene cassettes. The alpha (α) and omega (Ω) destination vectors carry kanamycin and spectinomycin bacterial selection markers, respectively. The alpha vectors include pDGB3-alpha1 and pDGB3alpha2, while omega (Ω) vectors are pDGB3-omega1 and pDGB3-omega2. The desired genetic elements to be assembled into a selected destination vector must first be domesticated for GB assembly. Domestication requires that the genetic element be devoid of BsaI or BsmBI sites, within the element and BsaI sites delineating the element to be assembled. It is more efficient to synthesize DNA with simultaneous codon optimization for the targeted crop plants and domestication to remove BsaI and BsmBI sites. Alternatively, PCR amplification can also be used to prepare DNA of target genetic elements such as RNA guides; however, it could be challenging and time-consuming for domestication especially when multiple BsaI and BsmBI sites are present. A schematic of GB assembly procedure to build a binary vector expressing editing machinery for soybean is shown in Fig. 1. 2. Common GB constructs: In practice, having the desired genetic elements in both pDGB3-alpha1 and pDGB3omega1 vectors facilitates GB assembly. In this protocol for genome editing in soybean, reagents include a GB domesticated cassette carrying the Streptococcus pyogenes Cas9 endonuclease, codon optimized for soybean [12], regulated by soybean ubiquitin promoter [13], and terminated by the A. tumefaciens nopaline synthase polyadenylation signal. The GB domesticated plant selectable marker cassette harbors the

CRISRP/Cas9-Based Gene Editing in Soybean

279

Fig. 1 Flowchart for assembly of editing machinery components into a binary vector via GoldenBraid protocol. Type IIS restriction enzymes are indicated in the boxes in each step of the GB assembling. pDGB-alpha and pDGB-omega vectors are shaded green and yellow colors, respectively. The pUC57::plasmids refer to the synthesized GB domesticated components

bar gene [9] regulated and terminated by the A. tumefaciens nopaline synthase promoter and polyadenylation signal, respectively. These cassettes reside in both pDGB3-alpha1 and pDGB3-omega1 (Fig. 1). 3. Guide reagent: Up to a four-plex guide reagent is for editing alleles in soybean. The expression of each guide is regulated independently by the small RNA U3, U6, and 7 L promoters from Arabidopsis and U3 promoter from tomato. There are numerous web-based portals that can facilitate guide design for soybean and other species. The Cas-Designer tool is used for the selection of guides, and it is available through Rgenome. net. The Cas-Designer tool is user friendly and can highlight guide targets across a 1 kb element for an array of endonucleases including S. pyogenes Cas9 for the protocol outlined here. Once the guide sections are made, the entire guide reagent (small RNA promoter-guide-tracrRNA) is synthesized with consideration for GB domestication rules. 3.2 GoldenBraid Assembly of Binary Vector

1. To assemble the binary vector (Fig. 1) destination vectors, pDGB3-alpha1 (or pDGB3-alpha2) are included in the reaction below, along with pDGB-omega derivatives carrying the bar and Cas9 cassettes, and the second the guide reagent element, in 200 μl PCR microfuge tubes:

pDGB3-alpha1 or pDGB-alpha2

1 μL

pDGB-omega1_genetic element 1

1 μL

pDGB-omega2_genetic element 2

1 μL

10× ligation buffer

2 μL (continued)

280

Truyen Quach et al. T4-DNA ligase

1 μL

Bsa1

1 μL

H2O

13 μL

Total

20 μL

2. The reaction mix is placed in a thermocycler using the parameters below: 37 °C, 2 min; 16 °C, 5 min for 30 cycles; and 65 °C, 10 min. Keep at 4 °C. 3. Transform E. coli DH5α with 5 μL of ligation mix. Follow a standard heat shock E. coli DH5α transformation protocol. 4. Plate the transformed cells on LB agar supplemented with 20 μL of 100 mM IPTG and 20 μL of 20 mg/mL X-gal for blue and white selection. 5. Select white colonies and extract plasmids. 6. Confirm the plasmid with restriction digestion or sequencing. 7. Introduce the confirmed plasmids into Agrobacterium tumefaciens strain to be used for transformation by electroporation or tri-parental mating. 8. Carry out a plasmid rescue from the Agrobacterium transconjugant to confirm integrity of the binary vector (see Note 1). 9. Prepare a glycerol stock of the Agrobacterium transconjugant and store at -80 °C for future use. 3.3 Plant Transformation and Tissue Culture

Soybean transformation is conducted using a direct organogenic regeneration system, coupled with glufosinate selection as previously described [14], to introduce the editing reagents into the crop (Fig. 2).

3.3.1 Soybean Seed Sterilization and Germination

1. Mature seeds are placed in an open Petri dish as a single layer in a desiccator within a fume hood (Fig. 2a). Place a beaker containing 100 mL commercial formulation of sodium hypochlorite in the middle of the desiccator. Slowly add 3.3 mL of 12 N HCl along the side of the beaker and cover the desiccator immediately. Seeds are sterilized by exposure to chlorine gas for 24 h. 2. Place sterilized seeds on germination (GM) plate (100 × 25 mm Petri plate) with the hilum facing down the agar. 3. Place plates in a stack of five in a clear plastic bag, and make four to five slices in the bag to allow gas exchange (Fig. 2b). 4. Keep the plates for 5 days at 24 °C in a growth chamber with 18 h of light and 6 h of dark. Observe seed germination, and when the seed’s cotyledons are about to open, place them in cold room at 4 °C overnight (Fig. 2c).

CRISRP/Cas9-Based Gene Editing in Soybean

281

Fig. 2 Soybean transformation steps used to introduce editing reagents into the crop. (a) Seed sterilization step. (b) Seed germination step. (c) Soybean seedlings for explant isolation. (d) Wounding step of axillary meristem. (e) Co-cultivation of cotyledonary explant. (f) Explants following 2 weeks of shoot initiation: left too little wounding, middle (arrow) ideal, and right too much wounding. (g–i) Explants following 4 weeks of shoot initiation displaying glufosinate-tolerant organogenesis (arrow). (h) Cup shoot elongation step. (j) Acclimated plantlet ready for transfer to greenhouse 3.3.2 Agrobacterium Inoculum Preparation

1. Streak Agrobacterium transconjugant carrying the binary vector harboring the editing reagents from glycerol stock on a YEP agar plate supplemented with appropriate antibiotics at 28 °C for 3 days. 2. From a single colony, start a 5 mL YEB culture, place on shaker (28 °C) with antibiotics in the morning, and transfer the 5 mL culture in the afternoon to a 2 L Erlenmeyer flask containing 250 mL YEB with antibiotics in the evening and grow the culture overnight, under the same conditions. 3. The next morning, pellet the overnight cultures in 50 mL tubes by centrifugation at 4000 rpm for 10 min. 4. Resuspend pellet in 35 mL of co-cultivation liquid (CCM) and adjust an OD600nm to 0.6–1.0. Place on ice until ready for use.

3.3.3 Explant Preparation and Inoculation

1. Excise the germinating seeds using a scalpel blade to cut through the hypocotyl region. Split the two cotyledons by a vertical cut through the hypocotyl, and remove the embryonic axis. 2. The cotyledon explant is wounded by making 7–12 vertical light slices 3–4 mm long, parallel to the axis about the junction between the cotyledon and the hypocotyl (axillary meristem) (Fig. 2d). The slices should not be too deep to impede the direct organogenic response (Fig. 2f). 3. Inoculate explants (30–40/Petri plate) with 25 mL of Agrobacterium inoculum, and incubate for about 30 min with occasional agitation. 4. Transfer five explants onto each co-cultivation plate. A co-cultivation plate is prepared by placing four layers of

282

Truyen Quach et al.

sterilized filter paper saturated with approximately 4 mL of CCM. Place the explants adaxial side down. Wrap the plates with parafilm, and place them in growth chamber with 24 °C and 18/6 h light regime for 3 days (Fig. 2e). 3.3.4

Shoot Initiation

1. Following the 3-day co-cultivation period, briefly wash the explants in liquid WM medium. Transfer the washed explants, adaxial side up (5 per plate) with the junction of the hypocotyl/ cotyledon just below the surface of the shoot initiation media (SIM). 2. Wrap the plates (100 × 25 mm) with Micropore tape and culture at 24 °C, 18 h light/6 h dark regime. After 2 weeks, trim the base of the tissues, and transfer to a new fresh plate and culture for an additional 2 weeks (Fig. 2g).

3.3.5 Step

Shoot Elongation

1. Following the 4-week shoot initiation step, discard all non-differentiated explants. Remove the cotyledon from the differentiated explants, make a fresh cut at the base of the developing node (horizontally), and transfer the tissue to shoot elongation medium (SEM). Wrap the plates with Micropore tape and place them at 24 °C, 18 h light/6 h dark for 2 weeks (Fig. 2h). 2. Transfer the tissue to fresh shoot elongation medium every 2 weeks. At each transfer, make a fresh horizontal slice at the base of the tissue. Once a shoot has elongated to approximately 2–3 cm in size, transfer the isolated elongated shoot to a cup with elongation medium for an additional 2 weeks (Fig. 2i).

3.3.6

Rooting Step

3.4 Greenhouse Soybean Growth and Preliminary Phenotyping Assessment

Transfer the elongated shoots (> 3 cm) on rooting medium (RM) in cups without further selection to initiate roots. 1. Soybean seeds are sown in 7.6 cm peat pots in a soil mix consisting of 40% peat, 40% vermiculite 15% sand, and 5% soil. Once the plants reach V3 stage of development [15], they are upshifted to 15.2 cm clay pots, until V5 stage, then 20.3 cm clay pots until maturity. Soybean plants are maintained under supplemental 14-h day length, 24–27 °C day and 18–21 °C night temperature. 2. Putative primary events, carrying the editing reagents, are acclimated for a post-tissue culture environment (Fig. 2j) by transferring rooted shoots to peat pots filed with Metro-Mix, saturated with half-strength Hoagland’s solution, and placing in a covered Magenta box. The Magenta box is placed in a growth chamber, 24 °C 18 h light, for 1 week, after which the lid is loosen to allow air exchange, and the plantlet allowed to grow for another week. The acclimated primary event is then transferred to a greenhouse environment.

CRISRP/Cas9-Based Gene Editing in Soybean

283

3. The primary events are first assessed for the presence/absence of the bar gene cassette using an herbicide tolerance assay. A glufosinate solution (0.1 mg/mL) is prepared and applied to the unifoliate or first trifoliate leaf with a Q-tip. Keep soybean plants in greenhouse for 2–3 days and record the herbicidesensitive and herbicide-resistant plants. 3.5 Genotyping of Primary Events

1. Sample upper young leaf tissue (up to 100 mg) to each vial.

3.5.1 Genomic DNA Extraction

3. Add four small beads to each tube and seal the tubes carefully.

2. Add 400 μL of 2× CTAB buffer to each sample. 4. Grind the samples using the Mini-Beadbeater-96 (BioSpec Products) for 5 min. 5. Centrifuge briefly and keep the tube rack at 65 °C for 30 min. 6. Cool the tube rack at room temperature for 10 min. 7. Add 300 μL chloroform/isoamyl alcohol (24:1, v/v) and mix by pipetting with tips. 8. Centrifuge at 4000 rpm for 20 min. 9. Transfer 200 μL from aqueous layer carefully to fresh tubes with 250 μL isopropanol, and mix by pipetting with tips. 10. Centrifuge the tube racks at 4000 rpm at 4 °C for 20 min. 11. Decant the tube carefully, so not to disturb pellet. 12. Wash pellet with 500 μL of 70% ethanol by centrifugation at 4000 rpm at 4 °C for 20 min. 13. Decant the tubes carefully, so not to disturb pellet. 14. Air-dry the tubes. 15. Add 100 μL 5 mM TE (pH 8.0) or H2O to resuspend pellet. 16. Proceed genotyping by PCR using genomic DNA extracts as templates.

3.5.2 Genotype Primary Event for Edits

1. Extract DNA from primary events and the WT. 2. Genotype via PCR for the presence/absence of Cas9 cassette. 3. PCR with a primer set that flanks the guide’s target site (s) (Fig. 3). 4. Run PCR products out on a 0.8% agarose gel (see Note 2). 5. Isolate the DNA product, putative edit lanes, from gel. 6. Sequence PCR products to assess presence of edit (see Note 3). 7. Prioritize primary events for genotyping for germinal edits in T1 plants based on observation of edits observed in primary event. The goal is to identify progeny carrying edited allele (homozygous), devoid of editing reagents (Fig. 3).

284

Truyen Quach et al.

Fig. 3 Editing reagents designed to create INDELs in soybean gene Glyma.20G85100. (a) Schematic genome structure about the 5′ UTR downstream to exon 2 of Glyma.20G85100 gene model showing the four guide targets (g1–g4) within the locus. Primers (P1–P6) for genotyping via PCR. (b) Binary vector pPTN1576 assembled using GoldenBraid protocol. Element 1, plant selectable marker cassette, always proximal to left bored (LB). Element 2, Cas9 endonuclease cassette. Element 3, multiplex guide reagent. Element 4, broad host range binary plasmid backbone. (c) PCR genotyping of T1 individuals for a dual edit which a smaller PCR product would suggest (red arrow). (d) PCR genotyping for the presence/absence of dual edit and Cas9 of T2 individuals derived from T1 to 30 (panel c). Note: T2–3 a failed PCR reaction. T3 seed collected from T2 plant number 6 (panel D) to obtain homozygous line carrying dual edit

4

Notes 1. Confirmation of integrity of a GoldenBraid assembled binary vector in A. tumefaciens is critical. We have observed stability in E. coli, but rearrangement in A. tumefaciens, in some larger assembled binary vectors. This may be resolved by selecting plasmids with different arrangement of the DNA elements within the T-DNA. 2. Larger deletions (>15 bp) can be obtained if multiple guides are designed for the targeted allele. This permits the identification of smaller PCR products, when two simultaneous edits occur (Fig. 3). However, smaller, single guide edits will require sequencing, unless a convenient gain/loss of a restriction site can be designed. 3. In this protocol, a constitutive promoter regulates the expression of the Cas9 endonuclease. Hence, an edit can occur randomly at any cells across development. Therefore, edits in primary event can be somatic or a germinal cell lineage.

CRISRP/Cas9-Based Gene Editing in Soybean

285

References 1. Songstad D et al (2017) Genome editing of plants. Crit Rev Plant Sci 36(1):1–23 2. Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol 31(7):397–405 3. Voytas DF (2013) Plant genome engineering with sequence-specific nucleases. Annu Rev Plant Biol 64:327–350 4. Jinek M et al (2012) A programmable dualRNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096): 816–821 5. Feng Z et al (2013) Efficient genome editing in plants using a CRISPR/Cas system. Cell Res 23(10):1229–1232 6. Bayer PE et al (2022) Sequencing the USDA core soybean collection reveals gene loss during domestication and breeding. Plant Genome 15(1):e20109 7. Tanaka N et al (2020) Whole-genome sequencing of the NARO World Rice Core Collection (WRC) as the basis for diversity and association studies. Plant Cell Physiol 61(5):922–932 8. Sarrion-Perdigones A et al (2013) GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol 162(3):1618–1631

9. Thompson CJ et al (1987) Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus. EMBO J 6(9): 2519–2523 10. Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50:152–158 11. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473– 497 12. Michno J-M et al (2015) CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food 6(4):243–252 13. De La Torre CM, Finer JJ (2015) The intron and 5′ distal region of the soybean Gmubi promoter contribute to very high levels of gene expression in transiently and stably transformed tissues. Plant Cell Rep 34(1):111–120 14. Zhang Z et al (1999) The use of glufosinate as a selective agent in Agrobacterium-mediated transformation of soybean. Plant Cell Tissue Organ Cult 56(1):37–46 15. Fehr WR, Caviness CE (1979) Stages of soybean development, vol 80. Cooperation Extension Service: Iowa State University, pp 1–12

Chapter 18 A CRISPR/Cas9 Protocol for Target Gene Editing in Barley Qiantao Jiang, Qiang Yang, Wendy Harwood, Huaping Tang, Yuming Wei, and Youliang Zheng Abstract Previous studies of gene function rely on the existing natural genetic variation or on induction of mutations by physical or chemical mutagenesis. The availability of alleles in nature, and random mutagenesis induced by physical or chemical means, limits the depth of research. The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system provides the means to rapidly modify genomes in a precise and predictable way, making it possible to modulate gene expression and modify the epigenome. Barley is the most appropriate model species for functional genomic analysis of common wheat. Therefore, the genome editing system of barley is very important for the study of wheat gene function. Here we detail a protocol for barley gene editing. The effectiveness of this method has been confirmed in our previous published studies. Key words Genome editing, CRISPR/Cas9, Hordeum vulgare, T-DNA-free

1

Introduction Genome editing is a type of genetic engineering, in which DNA indels can be targeted to site-specific locations of the host genome [1]. The genome editing technology was first reported in the 1990s [2], and the engineered meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) are four families of engineered nucleases used to induce targeted mutations in a living organism [3]. As a precise, efficient genome editing technology, the CRISPR/Cas9 system is a valuable tool for generating site-specific mutations in genes of interest. It is highly important for the functional genomic analysis of plants and the production of genetically engineered crops [4]. Barley is one of the closest relatives of common wheat, a more appropriate model species than Arabidopsis or Brachypodium

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_18, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

287

288

Qiantao Jiang et al.

distachyon for the functional genomic analysis of common wheat [5–7]. The published protocol for high-throughput Agrobacterium-mediated barley transformation provides an effective barley genetic transformation system [8] for the delivery of genome editing components, which makes it possible to realize targeted genome editing in barley. Barley mutants induced by the CRISPR/Cas9 system have been reported before, and here we provide an updated method for achieving barley gene editing using CRISPR/Cas9. In the barley genome editing method described below, the procedures such as sgRNA design, vector construction, barley transgenic production, and mutation analyses are described in detail. The method has been successfully used to knock out the D-Hordein gene (Hor3) and starch synthase IIa gene (SSIIa) with mutation frequencies ranging from 5.6% to 25.0%.

2

Materials

2.1

Plant Material

2.2

Reagents

Barley cv. ‘Golden Promise’ was grown in a greenhouse at 20 °C under a 16 h light/8 h darkness regime. The compost for barley contained a 3:1 mix of LvZiYuan compost (Chengdu, Sichuan, China): Grit, and compound fertilizer, YunHe (Shifang, Sichuan, China), at the manufacturer’s recommended concentration. The immature embryos with a size of 1.5–2.0 mm in diameter were collected for Agrobacterium tumefaciens-mediated transformation. 1. E. coli-competent cells (DH5α). 2. Agrobacterium tumefaciens-competent cells (AGL1). 3. BIOFIT Plant Genomic DNA Extraction Kit (Baifeite, Chengdu, China). 4. E.Z.N.A.™ Gel Georgia, USA).

Extraction

kit

(OMEGA,

Norcross,

5. Plant Cas9/gRNA plasmid construction kit Catalog. No. VK005-05 (Viewsolid Biotech, Beijing, China). 6. pEASY-T1 Simple Cloning Kit Vector No. CT111-01 (TransGen Biotech, Beijing, China). 7. High-fidelity polymerase DNA Polymerase P505-d1 (Vazyme, Nanjing, China). 8. T7 Endonuclease I kit EN303-01 (Vazyme, Nanjing, China). 9. Q5® High-Fidelity DNA Polymerase kit (Code No. M0491, NEB, America). 10. 1 × Taq MasterMix MT261-01 (Biomed, Beijing, China).

A Protocol for Gene Editing in Barley

3

289

Procedure

3.1 Donor Plant Growth and Target Gene Cloning (Step 1)

1. Barley cv. ‘Golden Promise’ was planted as transgenic donor plants in the greenhouse at 20 °C under a 16 h light/8 h darkness regime [9]. 2. The genomic DNA of Golden Promise was extracted from leaf tissue using BIOFIT Plant Genomic DNA Extraction Kit (Baifeite, Chengdu, China). 3. Primers were designed for polymerase chain reaction (PCR) for the amplification of the target gene, and PCR amplification reaction was set up with high-fidelity polymerase DNA Polymerase P505-d1 (Vazyme, Nanjing, China). 4. The PCR products were extracted and purified using the E.Z. N.A.™ Gel Extraction kit (OMEGA, Norcross, Georgia, USA) and ligated with pEASY-T1 Simple Cloning Kit Vector No. CT111-01 (TransGen Biotech, Beijing, China). 5. The ligation products were transformed into E. coli (DH5α), and the cloned PCR set up with 1XTaq MasterMix MT261-01 (Biomed, Beijing, China) was used to select positive clones. 6. Positive colonies (at least three) were randomly selected for sequencing, and the sequence of the target gene was aligned using the DNAMAN software package (V8.0; Lynnon Biosoft) (Fig. 1a).

3.2 The SgRNA Design and the Genome Editing Vector Construction (Step 2)

1. The sequence of the target gene was used to select the target sites for genome editing using the web-based software (http:// crispr.dbcls.jp), and target sites located in the exon region of the target gene were chosen for the vector construct. 2. Plant Cas9/gRNA plasmid construction kit Catalog. No. VK005-05 (Viewsolid Biotech, Beijing, China) was chosen to generate the genome editing vector. Two reverse complementary single-strand nucleic acids for each selected target site were synthesized and annealed according to the manufacturer’s instructions. The annealing reaction contained 50 μmol of sense and antisense DNA strands, and sterile water was added to make up the total volume to 15 μL. The annealing parameters were 95 °C for 3 min, followed by placing the Eppendorf tube in 95 °C water and cooling to room temperature. 3. The Cas9/gRNA vector and oligo from the annealing reaction were ligated and transformed into E. coli (DH5α). 4. Positive clones were selected and analyzed by plasmid sequencing with the special sequence primer (5′- GATGAAGTGGACG GAAGGAAGGAG- 3′) (sqprimer).

Fig. 1 The process of barley genome editing system: (a) Cloning of target gene; (b) construction of genome editing vector; (c) genetic transformation of barley; (d) identification of mutant plants; (e) genotype analysis of potential off-targets; (f) identification of homozygous mutants; (g) the selection of the non-genetically modified organism

A Protocol for Gene Editing in Barley

291

5. The positive plasmid was extracted from E. coli and then transformed into Agrobacterium tumefaciens (AGL1), and Agrobacterium cells harboring the Cas9/gRNA vector were used for barley transformation (Fig. 1b). 3.3 AgrobacteriumMediated Genetic Transformation of Barley [10] (Step 3)

1. Agrobacterium tumefaciens-mediated transformation of barley was undertaken when the donor immature embryo diameter reached 1.5–2.0 mm in length. 2. The selected, positive Agrobacterium clone was cultured in MG/L liquid medium under the selection pressure of 25 mg/L of rifampicin and 50 mg/L of kanamycin on a shaker at 200 rpm at 28 °C for approximately 18–20 h. 3. The immature grains of Golden Promise were removed from barley plants and the awns removed. They were sterilized in 70% ethanol for 30 s, washed in sterile distilled water three times, and then sterilized in a 20% solution of sodium hypochlorite (concentration) for 4 min, followed by washing in distilled water four times. 4. The immature embryos with a diameter of 1.5–2.0 mm were chosen and isolated and then plated on callus induction medium with the scutellum side up. 5. The full-strength Agrobacterium culture solution was dropped onto the embryo to cover the surface of embryos in a thin layer of the Agrobacterium cells and then co-cultured with the immature embryos at 23 °C in the dark for 3 days. 6. After co-cultivation, immature embryos were transferred to the selection medium with 50 mg/L hygromycin and 160 mg/L timentin and cultured at 23 °C in the dark. They were then sub-cultured onto the same medium every 2 weeks. 7. Non-transformed tissues failed to proliferate and were removed after three rounds of selection culture. 8. The vigorous calli were transferred to transition medium and cultured at 23 °C under low intensity of light for 2 weeks and then transferred and cultured on the regeneration medium. 9. The surviving hygromycin-resistant plants after selection with 2–3 cm shoots were transferred to the rooting medium, and then well-rooted plants then transferred to soil (Fig. 1c).

3.4 Screening of Transgenic Plants (Step 4)

1. The genomic DNAs of all of the surviving hygromycinresistant barley plants were extracted from leaf tissue at the three- to four-leaf stage. 2. Primer pair F1 (5′-AGAGAACCTTGCGGACTGTG-3′) and R1 (5′- TTGTGAAGGTCATGGGACGG -3′) designed based on the Cas9 gene sequence were used to detect the presence of the T-DNA insertion from the genome editing vector, and the hygromycin-resistant plants with a 1022 bp specific band were identified as the Cas9-positive transgenic plants (Fig. 1d).

292

Qiantao Jiang et al.

3.5 Screening of Mutant Plants and Genotypic Analyses (Step 5)

1. The genomic DNA of each Cas9-positive transgenic barley plants was extracted from leaf tissue at the tiller completion period using BIOFIT Plant Genomic DNA Extraction Kit. For each Cas9-positive transgenic barley plant, almost an equal amount of leaf tissue from each tiller was sampled and mixed as the leaf tissue pool for DNA extraction. 2. Primer pairs F-gX and R-gX (x representing the name of the corresponding target site) were designed to amplify each target site region. 3. The genomic DNAs of each Cas9-positive transgenic barley plant and the donor plant Golden Promise were used as PCR templates, and the high-fidelity polymerase DNA Polymerase P505-d1 was used for the PCR reaction. 4. The PCR products were run in a 1% agarose gel, and the target amplified bands were extracted and purified from the gel using the E.Z.N.A.TM Gel Extraction kit (OMEGA, Norcross, Georgia, USA), then the quality of the purified PCR product was determined by analysis on a 1% agarose gel again. 5. The commercial T7 Endonuclease I kit EN303-01 (Vazyme, Nanjing, China) was used to recognize the mismatch between single-strand nucleic acids amplified from the target site. The purified PCR product with 2 μL 10× endonuclease I reaction buffer and sterile water to make up a total volume to 20 μL were mixed in an annealing reaction. The annealing reaction was carried out in a PCR machine as follows: first at 95 °C for 5 min, then a 2 °C decrease per second from 95 °C to 85 °C, and a 0.1 °C decrease per second from 85 °C to 25 °C, and finally the temperature was decreased to and held at a cooling step at 4 °C through a cooling process. 6. Two 9 μL aliquots of annealed products for each Cas9-positive transgenic plant were sampled, one for the enzyme digest and the other one as a negative control. 1 μL endonuclease I and 1 μL sterile water were added and mixed with the enzyme digest sample and negative control, respectively, which were both incubated at 37 °C for 15 min with the PCR machine. 7. Both the enzyme products and negative controls were tested on a 2% agarose gel, and the plants with the sizes of two expected digested bands were identified as positive mutant plants. The genomic DNA of the donor plant Golden Promise was used as a negative control. 8. The genomic DNAs of positive mutant plants and primer pairs for target site region amplification were sent to Personalbio (Personalbio, Shanghai, China) for the next-generation sequencing.

A Protocol for Gene Editing in Barley

293

(a) The PCR amplification reaction in Personalbio was set up with Q5® High-Fidelity DNA Polymerase kit (Code No. M0491, NEB, America). (b) The Illumina MiSeq platform was used for PCR product sequencing (Fig. 1d). (c) Sliding window technique, with parameters: average quality Q20 and a read length threshold of 150 bp were used to pick out the high-quality reads and spliced by FLASH (version 1.2.7, http://ccb.jhu.edu/software/ FLASH/) [11]. (d) The data were visualized to show the mutation genotypes using software according to the study of Jia et al. [12]. 3.6 Off-Target Mutation Analysis (Step 6)

1. Potential off-target sites for each gRNA were analyzed using the web-based software (http://crispr.dbcls.jp), and the same “seed sequence” (8 nucleotides immediately adjacent to the PAM) between the putative off-targets and the corresponding target site was used as an essential additional condition to confirm potential off-target sites [13, 14]. 2. The genomic DNA of mutant plants was extracted, and primer pairs F-tbx and R-tbx (x representing the name of the corresponding off-target site) were designed to amplify the corresponding off-target site regions, and the PCR amplification reaction was set up with the high-fidelity polymerase DNA Polymerase P505-d1. 3. The PCR products were purified using the E.Z.N.A.TM Gel Extraction kit and ligated with pEASY-T1 Simple Cloning Kit Vector No. CT111-01. 4. Ten positive colonies for each potential off-target site were randomly selected for sequencing, and the sequences were aligned using DNAMAN (Fig. 1e).

3.7 Genotypic Analyses of Mutant Progeny Plants (Step 7)

This is a flexible step, and the ultimate goal is to identify the homozygous mutants from a large number of T1 progenies, e.g.: 1. SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) combined with Coomassie bright blue staining and silver staining can be used to identify the T1 homozygous mutants in offspring populations for experiments in which the target gene can be detected directly in a protein-based detection approach. Then, the identified T1 mutant progenies can be germinated and planted, and the genotype analyzed by direct sequencing of the target PCR products.

294

Qiantao Jiang et al.

2. For the experiment with a target gene that cannot be detected in a protein-based approach, all of the T1 progenies from each T0 mutant plant were grown in soil in a small hole tray. The genomic DNA of each living T1 plant was extracted at the two-leaf stage, then the genotype of each plant can be analyzed by direct sequencing of PCR products, and three types of sequencing results were obtained (Fig. 1f): (a) The sequence chromatograms were the same as that in the donor plant, Golden Promise with a normal peak chromatogram (wild type). (b) The sequence chromatograms contained the indel sequence compared to wild-type genotype, but had a normal peak chromatogram (homozygous mutation). (c) The sequence chromatograms had hybrid peaks that appeared from the target mutant site (heterozygous mutation). 3.8 The Selection of the Transgene-Free Mutant Lines (Step 8)

1. All of the T1 homozygous mutants were planted in pots. 2. The genomic DNA of all of the surviving T1 homozygous mutant plants, Golden Promise, and non-edited plant were extracted from leaf tissue using BIOFIT Plant Genomic DNA Extraction Kit. 3. Primer pairs F1 and R1, F2 (5′- ACTGCCCTCTAGCTCT CACT-3′) and R2 (5′-CTCCCCCGTAGGTTTGGTTT -3′), and F3 (5′-AAAGCCTGAACTCACCGC-3′) and R3 (5′-GGCGTCGGTTTCCACTAT-3′) were designed to detect Cas9, gRNA region, and hptII to verify the presence/absence of T-DNA in the surviving T1 homozygous mutant plants, and the PCR amplification reaction was set up with 1XTaq MasterMix MT261-01 (Biomed, Beijing, China), and the PCR products were analyzed in a 1.5% gel. The genomic DNA of Golden Promise, non-edited plant, and the corresponding plasmid were used as controls. 4. Healthy green leaves, at the same growth stage, were chosen from each surviving T1 homozygous mutant plant and the non-transgenic Golden Promise. 5. Leaf tips about 5 cm long were excised from each selected leaf and soaked in hygromycin B solution (40 mg/L of hygromycin B and 1 mg/L of 6-benzylaminopurine (6-BA) with the pH adjusted to 7.0) [15, 16] and cultivated about 5 days in the dark at 23 °C (Fig. 1g).

3.9 The Phenotypic Analysis (Step 9)

Another flexible step to test the phenotype [eg. the albumin, globulin, prolamine (hordein) and glutenin in Hor3 null barley grains were extracted and analyzed using an automatic kjeldahl apparatus equipment Foss Kjeltex 8400 series (Foss, Denmark); The total

A Protocol for Gene Editing in Barley

295

starch, amylose, and RS contents of SSIIa mutant grains were measured using the Megazyme Total Starch Assay Kit (No. KTSTA), Amylose Assay Kit (No. K-AMYL), and RS Assay Kit (No. K-RSTAR)] to demonstrate the function of the target geneTarget genes in barleyBarley and infer the potential application value of the mutant plants in production.

4

Notes 1. An efficient transgenic system is of key importance to realize the targeted mutation in the barley genome [8]. A sufficient number of transgenic plants is the prerequisite to obtaining mutants. Therefore, the factors that affect the transgenic efficiency may affect the mutation frequencies of gene editing indirectly. 2. The sequence of sgRNA is an important factor affecting the mutation frequencies of genome editing. For the barley genome editing system using Cas9 protein, the sgRNA PAM sequence is required to be set as NGG, and the host plant should choose Hordeum vulgare [17]. 3. The genome editing system is useful for the study of the gene function. However, the non-destination mutation at potential off-target sites is one of the drawbacks of genome editing technologies, which may make conclusions less convincing. Bioinformatic programs combined with Sanger sequencing can effectively identify whether the non-destination mutations have occurred at the off-target sites. However, no bioinformatic program can retrieve all of the putative off-target sites in the genome of the host; thus, it is still possible off-target mutations might happen in the barley genome. The whole genome sequence can overcome this problem, but is limited by its high cost [18]. 4. A sufficient number of homozygous mutants were required for the study of the target gene function. Homozygous mutants identified from independent genome-edited lines belong to independent genetic backgrounds [18]. Where all of them show similar changes in phenotype, this can improve reliability of conclusions drawn from the target gene null mutants.

References 1. Bak RO, Gomez-Ospina N, Porteus MH (2018) Gene editing on center stage. Trends Genet 34(8):600–611 2. Woolf TM (1998) Therapeutic repair of mutated nucleic acid sequences. Nat Biotechnol 16(4):341–344

3. Voytas DF, Gao C (2014) Precision genome engineering and agriculture: opportunities and regulatory challenges. PLoS Biol 12(6): e1001877 4. Xing HL, Dong L, Wang ZP et al (2014) A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol 14(1):327

296

Qiantao Jiang et al.

5. Santamaria ME, Diaz-Mendoza M, PerezHerguedas D et al (2018) Overexpression of HvIcy6 in barley enhances resistance against Tetranychus urticae and entails partial transcriptomic reprogramming. Int J Mol Sci 19(3):697 6. Ferdous J, Whitford R, Nguyen M et al (2017) Drought-inducible expression of Hv-miR827 enhances drought tolerance in transgenic barley. Funct Integr Genomics 17(2–3):279–292 7. Chen J, Liu C, Shi B et al (2017) Overexpression of HvHGGT enhances tocotrienol levels and antioxidant activity in Barley. J Agric Food Chem 65(25):5181–5187 8. Harwood WA (2014) A protocol for highthroughput Agrobacterium-mediated barley transformation. Methods Mol Biol 1099:251– 260 9. Yang Q, Li S, Li X et al (2019) Expression of the high molecular weight glutenin 1Ay gene from Triticum urartu in barley. Transgenic Res 28(2):225–235 10. Hinchliffe A, Harwood WA (2019) Agrobacterium-mediated transformation of barley immature embryos. Methods Mol Biol 1900: 115–126 11. Magocˇ T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27(21): 2957–2963 12. Jia H, Zhang Y, Orbovic´ V et al (2017) Genome editing of the disease susceptibility

gene Cs LOB 1 in citrus confers resistance to citrus canker. Plant Biotechnol J 15(7): 817–823 13. Semenova E, Jore MM, Datsenko KA et al (2011) Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence. Proc Natl Acad Sci 108(25): 10098–10103 14. Wiedenheft B, van Duijn E, Bultema JB et al (2011) RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions. Proc Natl Acad Sci 108(25):10092–10097 15. Gritz L, Davies J (1983) Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene 25(2–3):179–188 16. Wang MB, Waterhouse PM (1997) A rapid and simple method of assaying plants transformed with hygromycin or PPT resistance genes. Plant Mol Biol Rep 15(3):209–215 17. Naito Y, Hino K, Bono H et al (2015) CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced offtarget sites. Bioinformatics 31:1120–1123 18. Yang Q, Ding JJ, Feng XQ et al (2022) Editing of the starch synthase IIa gene led to transcriptomic andmetabolomic changes and high amylose starch in barley. Carbohydr Polym 285:119238

Chapter 19 Targeted Insertion in Nicotiana benthamiana Genomes via Protoplast Regeneration Fu-Hui Wu, Chen-Tran Hsu, and Choun-Sea Lin Abstract Insertion of a specific sequence in a targeted region for precise editing is still a major challenge in plants. Current protocols rely on inefficient homology-directed repair or non-homologous end-joining with modified double-stranded oligodeoxyribonucleotides (dsODNs) as donors. We developed a simple protocol that eliminates the need for expensive equipment, chemicals, modifications of donor DNA, and complicated vector construction. The protocol uses polyethylene glycol (PEG)-calcium to deliver low-cost, unmodified single-stranded oligodeoxyribonucleotides (ssODNs) and CRISPR/Cas9 ribonucleoprotein (RNP) complexes into Nicotiana benthamiana protoplasts. Regenerated plants were obtained from edited protoplasts with an editing frequency of up to 50% at the target locus. The inserted sequence was inherited to the next generation; this method thus opens the possibility for the future exploration of genomes by targeted insertion in plants. Key words Targeted insertion, CRISPR, Ribonucleoprotein, Protoplast transfection, Nucleofection, Protoplast regeneration

1

Introduction Nicotiana benthamiana is an allotetraploid species with a very large genome of 3.1 Gb. Genome editing and the isolation of mutants for plant biological and gene functional studies are therefore difficult in this species [1]. To address these limitations, we employed powerful genome editing tools based on clustered regularly interspaced short palindromic repeats (CRISPR)/ribonucleoprotein (RNP) and built targeted insertion platforms. The past decade has witnessed the rapid development of several accurate and efficient gene editing techniques, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR/CRISPR-associated nucleases (Cas). Introducing random mutations in genes of interest is a wellestablished tool employed in multiple plant species for research

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_19, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

297

298

Fu-Hui Wu et al.

[2–17]. However, placing a desired sequence precisely at a preselected site within the target gene still remains challenging in plants. Although CRISPR-based editing can introduce nucleotide substitutions at specific positions, targeting of sequences is often limited by the requirement for a nearby protospacer adjacent motif (PAM) and the width of the editing window. Most of the reported successful cases are restricted to the Gramineae, with only a few examples of effective editing in dicotyledonous species [18– 20]. The ultimate goal of gene editing is to insert a desired sequence in a given target region [21]. Targeted DNA insertion is usually performed using either Agrobacterium tumefaciensmediated transformation or bombardment with DNA-coated particles. However, these methods often result in the insertion of one to a few copies of the DNA at random locations in the host genome, which may produce an unexpected phenotype independent of the nature of the sequence being inserted. In addition, the required components need to be carried out by a single DNA molecule, with the intended target of gene editing being only modified in 10% of cases or less, even when combined with highly efficient Cas proteins. For both Agrobacterium-mediated transformation and bombardment, it can be labor-intensive and timeconsuming to remove the transgenes for expressing Cas protein, single guide RNA (sgRNA), and selection marker by crossing, especially for plant species with long generation times [22–26]. Protoplasts are single plant cells devoid of cell wall that can be obtained from the enzymatic digestion of the cell wall with cellulase and macerozyme. Protoplasts can be transiently transfected via polyethylene glycol (PEG)-calcium (Ca2+)-mediated delivery of or via electroporation with DNA constructs of interest [27–29]. In the context of gene editing, a single plasmid can be designed that harbors the sequences encoding the Cas protein and the sgRNAs [30–35]. Alternatively, the Cas enzyme and the sgRNA can be directly assembled into ribonucleoprotein (RNP) complexes [36– 38] in vitro before being introduced into protoplasts via transfection. Both CRISPR reagents can be used to edit the DNA sequence of interest at high efficiency [21, 26, 35]. Since each protoplast is a single cell, any plant regenerated from a protoplast carrying an insertion of the donor DNA at its intended target site will not exhibit chimerism. In addition, the edited sites detected in the T0 generation by genotype analysis will be transmitted to the offspring. Another appeal of transient transfection is that the CRISPR/Cas vector or the CRISPR/RNP complex and the donor DNA will not be inserted into chromosomes, thus alleviating the need to select transgene-free edited plants [21, 26, 30–35]. Here we present a detailed method for the preparation of axenic explants, protoplast isolation, PEG-Ca2+ transfection, regeneration, sgRNA synthesis, and assembly of the Cas9/RNP

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

299

complex. The transfection of protoplasts with a Cas9/RNP complex or plasmid DNA via the PEG-Ca2+ method can achieve a 70% transfection efficiency [29, 32–35]. With a careful selection of suitable target sites [39–41] and high editing efficiency, protoplasts with the targeted insertion can be regenerated into whole plants via tissue culture with plant growth regulators, even without the use of antibiotics or a specialized phenotype as a screening marker.

2

Materials

2.1 Supplies and Equipment

1. 0.1 mm-deep hemacytometer. 2. 0.22 μm syringe sterilization filter, with a polyethersulfone (PES) membrane or a mixed cellulose ester (MCE) membrane. 3. 15 mL centrifuge tube. 4. 50 mL centrifuge tube. 5. 40 μm nylon mesh. 6. Autoclave. 7. Cell culture dishes (35 mm [diameter] × 10 mm [height]; 55 mm [diameter] × 15 mm [height]; 90 mm [diameter] × 15 mm [height]). 8. Glass Petri dish (60 mm [diameter] × 15 mm [height]). 9. Glass screw cap culture tubes (round bottom, 13 mm [diameter] × 100 mm [length]; see Note 1). 10. Laminar flow hood. 11. Microcentrifuge and swing-out rotor centrifuge. 12. Optical microscope. 13. Orbital shaker. 14. Surgical blades. 15. Test tubes (20 mm [diameter] × 150 mm [length]). 16. Thermal cycler for polymerase chain reaction (PCR) analyses. 17. Ultrasonicator. 18. NanoDrop or spectrophotometer. 19. Wide-mouth glass bottle with cap (50 mm [diameter] × 80 mm [height]). 20. Cell spreader. 21. Open ultraviolet (UV) light box.

2.2 Plant Material and Selection of the Target Site

1. Plant material: Nicotiana benthamiana seeds. Seeds were a gift from Professor Jen Sheen (Harvard Medical School); for growth conditions, please refer to Subheading 3.1.

300

Fu-Hui Wu et al.

2. Select and screen target sites on the CRISPR-P v.2.0 website [40] and RNAfold WebServer [41]; choose higher on-score candidate target sites, and avoid those showing pairing to the sgRNA by more than a consecutive 6-bp stretch [8]. Design oligonucleotides that contain the T7 promoter sequence, the target site sequence, and the sgRNA scaffold sequence as RNA synthesis template [36, 37]. Synthesize the sgRNAs with an in vitro transcription (IVT) kit using T7 RNA polymerase. For the detailed protocol, please refer to Subheading 3.2. 2.3 Chemicals and Stock Solutions

Prepare all solutions using ultrapure water (18 MΩ × cm at 25 °C) or diethyl pyrocarbonate (DEPC)-treated ultrapure water. Autoclave or filter all prepared solutions and operate in a sterile environment. Special instructions: autoclave, 121 °C for 20 min; sterile filtration, 0.22 μm syringe sterilization filter; room temperature, 22–26 °C. 1. DEPC-treated water: Add 1 mL of DEPC to 1000 mL ultrapure water, mix well, and let the solution incubate for 12 h at 37 °C. Autoclave to inactivate DEPC. The solution can be stored at room temperature for up to 1 year. 2. 1 M potassium hydroxide (KOH): Dissolve 0.56 g of KOH in water and adjust to a final volume of 10 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months. 3. 0.1 M 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.7: Dissolve 1.95 g of MES in ultrapure water and adjust pH to 5.7 with 1 M KOH and the final volume to 100 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 1 month. 4. 0.6 M potassium chloride (KCl): Dissolve 4.473 g of KCl in ultrapure water and adjust to a final volume of 100 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months. 5. 0.2 M potassium chloride (KCl): Dissolve 1.49 g of KCl in ultrapure water and adjust to a final volume of 100 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months. 6. 10 mM magnesium chloride (MgCl2): Dissolve 0.203 g of MgCl2 in ultrapure water and adjust to a final volume of 100 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months.

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

301

7. 10 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP): Dissolve 0.287 g of TCEP in ultrapure water and adjust to a final volume of 100 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months. 8. 0.5 M glucose: Dissolve 4.50 g of glucose in ultrapure water and adjust to a final volume of 50 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at 4 °C for up to 6 months. 9. 0.8 M D-mannitol: Dissolve 7.29 g of D-mannitol in ultrapure water and adjust to a final volume of 50 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 2 months. 10. Half-strength Murashige and Skoog (MS) basal medium with vitamins: Dissolve 1.1 g of commercial MS stock powder and 15 g of sucrose in water; adjust pH to 5.7 with 1 M KOH and adjust the final volume to 500 mL. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter or by autoclaving. The solution can be stored at room temperature for up to 2 months. 11. 1 mg/mL kinetin: Dissolve 20 mg of kinetin in 2 mL of 1 M KOH and adjust to a final volume of 20 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at 4 °C for up to 1 year. 12. 1 mg/mL naphthaleneacetic acid (NAA): Dissolve 20 mg of NAA in 2 mL of 1 M KOH and adjust to a final volume of 20 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at 4 °C for up to 1 year. 13. 1 mg/mL 6-benzylaminopurine (BA): Dissolve 50 mg of BA in 2 mL of 1 M KOH and adjust to a final volume of 50 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at 4 °C for 1 year. 14. 2 M calcium chloride (CaCl2): Dissolve 29.40 g of CaCl2·2H2O in ultrapure water and adjust to a final volume of 100 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months. 15. 20% sucrose: Dissolve 10 g of sucrose in ultrapure water and adjust to a final volume of 50 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at 4 °C for up to 1 month.

302

Fu-Hui Wu et al.

16. 3 M sodium chloride (NaCl): Dissolve 17.53 g of NaCl in ultrapure water and adjust to a final volume of 100 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. The solution can be stored at room temperature for up to 6 months. 17. Bleach solution: 1 mL of commercial bleach (6% [w/v] sodium hypochlorite) diluted with 5 mL of ultrapure water; add 20 μL of Tween-20 and mix well. This should be freshly prepared before seed sowing. 18. 20 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal): Dissolve 100 mg of X-gal in dimethylformamide (DMF) and adjust to a final volume of 5 mL with DMF. The solution can be stored in the dark at -20 °C for 1 year. 19. 50 mg/mL isopropyl β-D-1-thiogalactopyranoside (IPTG): Dissolve 250 mg of IPTG in ultrapure water and adjust to a final volume of 5 mL with ultrapure water. The solution can be stored at -20 °C for 1 year. 20. 100 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES): Add 1 mL of commercial 1 M HEPES (pH 7.2–7.5) solution to 9 mL of ultrapure water. 21. Hyponex No. 1. 22. Tryptone. 23. Yeast extract. 24. Activated charcoal (cell culture tested). 25. Bacto Agar. 26. Cellulose R10 (see Note 2). 27. Macerozyme R10 (see Note 2). 28. In vitro transcription (IVT) kit using T7 RNA polymerase. 29. Genomic DNA plant purification kit. 30. Gel purification kit. 31. Small RNA purification kit. 32. DNase I. 33. 1 M hydrochloric acid (HCl; see Note 2). 34. 5× polymerase chain reaction (PCR) mixture reagent. 35. Cas9 Nuclease, Streptococcus pyogenes (see Note 3). 36. Proofreading and high-fidelity DNA polymerase. 37. Ethanol (absolute for analysis). 38. 75% (v/v) ethanol. 39. Tween-20. 40. Agarose. 41. DNA Library Prep for Illumina Kit.

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

2.4 Working Solution and Growth Medium

303

1. Cas9 assembly buffer: Add 10 mL of 100 mM HEPES pH 5.7, 12.5 mL of 600 mM KCL, 5 mL of 10 mM MgCl2, 5 mL of 10 mM TCEP, and 5 mL of glycerol, and adjust to a final volume of 50 mL with ultrapure water. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter and store at -80 °C. 2. Digestion solution: Dissolve 0.1 g of Cellulase R10 and 0.05 g of Macerozyme R10 in 10 mL half-strength MS medium with 1 mg/L NAA, 0.3 mg/L kinetin, 0.4 M mannitol, and 3% (w/v) sucrose, pH 5.7. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. Digestion solution needs to be freshly prepared before protoplast isolation (see Note 4). 3. W5 solution: Add 10.3 mL of 3 M NaCl, 12.5 mL of 2 M CaCl2, 5 mL of 0.2 M of KCl, 4 mL of 0.1 M MES, pH 5.7, and 2 mL of 0.5 M glucose to autoclaved sterile water, and adjust to a final volume of 200 mL. The solution can be stored at room temperature for up to 2 months (see Note 5). 4. Transfection solution and callus initiation medium: Halfstrength MS solution supplemented with 3% (w/v) sucrose, 0.4 M mannitol, 1 mg/L NAA, and 0.3 mg/L kinetin, pH 5.7. Sterilize the solution by passing through a 0.22 μm syringe sterilization filter. 5. PEG-Ca2+ solution: Dissolve 4 g of PEG 4000, 5 mL of 0.8 M mannitol, 0.5 mL of 2 M CaCl2, and 1 mL ultrapure water to a final volume of 10 mL. The solution can be vortexed to accelerate the dissolution and sterilized by passing through a 0.22 μm syringe sterilization filter with a PES membrane or MCE membrane. The PEG-Ca2+ solution must be freshly prepared before each protoplast transfection (see Note 6). 6. Seed germination and explant root-inducing medium: Halfstrength MS solution supplemented with 3% (w/v) sucrose; adjust pH to 5.7 with 1 M KOH and bring final volume to 500 mL. Add 5 g Bacto Agar (final concentration of 1% [w/v]; see Note 7) and sterilize by autoclaving. After sterilization, let the seed germination and root medium cool down to 50 °C, and divide into test tubes or wide-mouth glass bottles with caps. 7. Shoot-inducing medium: Prepare liquid and solid media. For liquid medium, to half-strength MS supplemented with 3% (w/v) sucrose, add 1 mL of 1 mg/mL BA, adjust the pH to 5.7 with 1 M KOH, and bring final volume to 500 mL. For solid medium, add 5 g Bacto Agar (final concentration: 1% [w/v]; see Note 7). Sterilize both the liquid and solid media

304

Fu-Hui Wu et al.

by autoclaving. After sterilization, let the solid shoot-inducing medium cool down to 50 °C, and divide into cell culture dishes (90 mm [diameter] × 15 mm [height]); each dish should contain 25 mL of medium. 8. Root-inducing medium: Dissolve 3 g of Hyponex No. 1, 2 g of tryptone, and 20 g of sucrose, adjust pH to 5.2 with 1 N HCl, and bring final volume to 1 L. Add 10 g Bacto Agar (final conc. 1% [w/v]; see Note 7) and 1 g/L activated charcoal, and sterilize by autoclaving. After sterilization, let the root medium cool down to 50 °C, and divide into test tubes or wide-mouth glass bottles with caps. 9. 2xYT solid medium: Dissolve 16 g of tryptone, 10 g of yeast extract, and 5 g of NaCl in water, and adjust to a final volume of 1 L with ultrapure water. Add 20 g Bacto Agar (final conc. 2% [w/v]; see Note 8) and sterilize by autoclaving. After sterilization, let the medium cool down to 50 °C, add appropriate antibiotics, and divide into cell culture dishes (90 mm [diameter] × 15 mm [height]).

3

Methods All processes must be carried out in a sterile laminar flow hood.

3.1 Explant Preparation

1. Surface-sterilize Nicotiana benthamiana seeds with 75% (v/v) ethanol for 1 min in a 15 mL centrifuge tube (see Note 9). Remove the ethanol and replace with bleach solution. Incubate in an ultrasonicator for 20 min. Remove the bleach solution, and wash with autoclaved water at least five times until there are no bubbles left in the water. Soaking in water for 30 min can raise the germination rate. 2. Place surface-sterilized seeds directly into a wide-mouth glass bottle containing germination medium. 3. Place seeds in bottles in a 26 °C growth chamber under a light density of 75 μmol m-2 s-1 and a 12-h-light/12-h-dark photoperiod. 4. Perform protoplast isolation and transfection 4–6 weeks after seed germination. 5. Six weeks after seed germination, cut off the top branches and transfer to germination medium. Plant material requires subculture every month. 6. After 4–6 weeks of subculture, the explants can be used as material for protoplast isolation and transfection.

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

3.2 sgRNA Template Assembly, Amplification, In Vitro Transcription, and sgRNA Purification

305

1. The DNA template containing the T7 promoter region, protospacer sequence, and sgRNA scaffold sequence is assembled from commercially synthesized oligonucleotides and overlapping PCR. Add the desired protospacer sequence to the T7 top oligonucleotide sequence; order the resulting oligonucleotide from your favorite oligonucleotide supplier. For overlapping PCR, the T7 top template sequence is 5′-TAATACGACT CACTATAG-20-nt protospacer sequence 5′-GTTTT AGAGCTATGCTGGAAACAGCATAGCAAGTTAA-3′. T7 RNA polymerase requires a 5′ G for proper transcription initiation. The bottom sequence is 5′-GCACCGACTCGGT GCCACTTTTTCAAGTTGATAACGGACTAGCCTT ATTTTAACTTGCTATGCTGTTTCCAGCAT-3′. 2. The sequences containing the T7 promoter region (5′-TAATA CGACTCACTATAG-3′) and the scaffold region (5′-GCACC GACTCGGTGCCACTTTTTCAAG-3′) are used as PCR primers. 3. PCR is performed using a proofreading and high-fidelity DNA polymerase according to the manufacturer’s protocol. The volume of PCR mixture should be at least 50 μL to obtain an accurate and highly concentrated RNA template. 4. Run all assembled DNA products on 0.8–1% agarose gels to ensure that the PCR worked and visualize on an open UV box (see Note 10). Slice the desired DNA fragment from the gel with a sterile razor blade (see Note 11). 5. Place the gel in a labeled microfuge tube, and purify PCR products with a commercial gel purification kit. 6. Use 1 μg of purified PCR product as template for sgRNA synthesis with an IVT kit using T7 RNA polymerase (see Note 12). Follow the instructions of the kit and incubate the synthesis reaction at 37 °C overnight. 7. Run 0.5 μL of the sgRNA mixture on an agarose gel, and measure the RNA concentration with a spectrophotometer. The total amount of sgRNA is recommended to be over 400 μg. 8. Remove DNA template by adding 1 μL of RNase-free DNase I (1 U/μL) into the reaction mixture, and incubate at 37 °C for 15 min to 1 h. 9. Add 300 μL of absolute ethanol to the DNase I-treated sgRNA mixture, and adjust volume to 500 μL with DEPC-treated water. 10. Purify sgRNA with a small RNA purification kit. The sgRNA is dissolved in DEPC-treated water. 11. Measure concentration RNA spectrophotometer.

with

a

NanoDrop

306

Fu-Hui Wu et al.

3.3 Cas9/sgRNA Ribonucleoprotein Assembly

1. Cas9/sgRNA RNP complexes are assembled immediately before nucleofection by mixing equal volumes (1.35 μL each) of 40 μM Cas9 protein and 88.3 μM sgRNA at a molar ratio of 1:2.2 and incubating at 37 °C for 10 min.

3.4 Donor DNA Preparation

1. We used unmodified synthetic single-stranded oligodeoxynucleotide (ssODN) as donor DNAs, assembled from commercially synthesized oligonucleotides. Each ssODN donor was 40 nucleotides (nt) or 60 nt in length and consisted of the targeted insertion sequence (e.g., restriction enzyme site to be edited) flanked by 17- or 27-nt homologous arms, respectively, on both sides.

3.5 Protoplast Isolation

1. Collect five to seven pieces of 4- to 6-week-old, fully expanded N. benthamiana leaves, grown aseptically in germination medium (see Notes 13 and 14). 2. Place the leaves into a 6-cm sterile glass Petri dish containing 10 mL of digestion solution. Cut the leaves into 0.5-cm strips with a surgical blade without crushing the tissue (see Note 15), and incubate at room temperature (24–26 °C) and in the dark for 3 days. 3. By day 4, the enzyme solution should have turned green, which indicates the release of protoplasts. 4. Check for the release of protoplasts in the enzyme solution under the microscope, and ensure that most protoplasts appear healthy and intact (see Note 16). 5. Carefully filter the enzyme/protoplast solution on a 40 μm nylon mesh in a new sterile 6-cm glass dish, and discard undigested leaf debris from the protoplast suspension (see Note 16). 6. Slowly add one equal volume (approximately 10 mL) of W5 solution to the protoplast suspension to stop the digestion of the cell wall. 7. Transfer the solution to four glass screw cap culture tubes (4–5 mL each; see Note 1). 8. Centrifuge the solution at the low speed of 200 × g with a swing-out rotor at 24 °C for 3 min to collect protoplasts. 9. Remove as much of the supernatant as possible. Slowly and gently resuspend the protoplasts in 5 mL of W5 solution per tube (see Note 17). 10. Centrifuge at 200 × g for 3 min as described in step 8. 11. Remove the supernatant.

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

307

12. Add 3 mL of 20% (w/v) sucrose solution and resuspend the protoplast pellet. Carefully mix the contents by gentle swirling and flicking the tube. 13. Centrifuge at 200 × g for 3 min. 14. Carefully transfer the dark green, intact, and healthy protoplasts collected at the surface of the sucrose solution into a new glass screw cap culture tube (see Note 18). 15. Add two cell volumes of W5 solution to resuspend the protoplasts. 16. Centrifuge at 200 × g for 3 min. 17. Repeat steps 15 and 16 twice. 18. Remove the supernatant and resuspend protoplasts with W5 solution. 19. Take 10 μL of well-mixed protoplast suspension and load onto a hemacytometer to determine the protoplast density. Intact and healthy protoplasts should be at a cell density of 2 × 105/ mL in W5 solution after counting cells under the microscope (×100). 3.6 Protoplast Transfection (Nucleofection)

1. Once the protoplast density is determined, centrifuge the tube at 200 × g for 3 min. 2. Remove as much of the W5 solution as possible without touching the protoplast pellet (see Note 19). 3. Resuspend the cells with transfection solution, and adjust the cell density to 3 × 105/mL using a hemacytometer (see Note 20). 4. Add the assembled RNP and 50 μg ssODN donor into a glass screw cap culture tube, and adjust to a final volume of 20 μL with Cas9 assembly buffer. 5. Slowly transfer 200 μL (cell density approximately 1.2 × 105) of protoplasts into the tube, and mix carefully. 6. Add an equal volume (220 μL) of PEG-Ca2+ solution. 7. Carefully tap the wall of the tube to completely mix the protoplasts with the PEG-Ca2+ solution. 8. Incubate the nucleofection mixture at room temperature (24–26 °C) for up to 30 min. 9. Add 3 mL of W5 solution. Mix well by gently rocking or inverting the tube to terminate the nucleofection reaction. 10. Centrifuge at 200 × g for 3 min. 11. Remove the supernatant and resuspend and wash protoplasts gently with 3 mL of W5 solution. 12. Centrifuge at 200 × g for 3 min.

308

Fu-Hui Wu et al.

3.7 Protoplast Regeneration

1. After centrifugation, remove the supernatant from nucleofected protoplasts. Add 2 mL of callus initiation medium to resuspend nucleofected protoplasts and transfer into a cell culture dish (35 mm [diameter] × 10 mm [height]). 2. Incubate in the dark for 3 weeks at 24–26 °C (see Note 21). 3. Three weeks after incubation in callus initiation medium, the protoplasts are regenerated into 2 mm calli. Tilt the culture dish 5–10° and remove the supernatant (see Note 22). 4. Add 3 mL of liquid shoot-inducing medium into the culture dish and resuspend the calli by pipetting. 5. Transfer the calli and medium to a 9-cm culture dish. Add liquid shoot-inducing medium. Adjust to a final volume of 10 mL. 6. Incubate the calli at 26 °C under a light density of 75 μmol m2 -1 s with a 16-h-light/8-h-dark photoperiod. 7. After 4 weeks, green calli can be observed in liquid shootinducing medium and regenerated into 5 mm calli. 8. Pick up green calli using tweezers and transfer them to solid shoot-inducing medium. Subculture green calli every 4 weeks on fresh solid shoot-inducing medium. After subculturing one to two times, 100–500 shoot clusters of 1-cm regenerative buds and leaves can be obtained. 9. Transplant the regenerated explants with leaves to rootinducing medium. Adventitious roots will grow after 1 month. 10. Transfer the rooted regenerated plants to a pot containing peat moss, vermiculite, and perlite in a ratio of 1:1:1 (v/v/v). Grow the plants in the greenhouse or a growth chamber at 26 °C under a light density 70 μmol m-2 s-1 and a 16-h-light/8-hdark photoperiod.

3.8 Evaluation of CRISPR/RNP ComplexTargeted Insertion Efficiency in Protoplasts and Regenerants 3.8.1 Testing the Initial Protoplast Transfection Efficiency

1. Nucleofected protoplasts can be used for transient analysis of CRISPR/RNP complex-mediated targeted mutagenesis and insertion. Four days after nucleofection, use 500 μL of pooled protoplasts in callus initiation medium for genomic DNA extraction using a DNA extraction kit. 2. Use a NanoDrop to quantify genomic DNA concentration, which should be about 25–100 ng/μL (see Note 23). 3. Amplify the genomic region targeted by the sgRNA with the corresponding pairs of designed primers by PCR. Use 1–2 μL of protoplast genomic DNA as template, and mix with 0.8 μL (10 μM; see Note 24) forward primer, 0.8 μL (10 μM) reverse primer, 4 μL 5× PCR Taq mixture, and 13.4 μL H2O to a final volume of 20 μL. PCR conditions: 94 °C for 5 min, 35 cycles consisting of denaturation at 94 °C for 30 s, primer annealing

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

309

at 55–63 °C for 30 s, extension at 72 °C for 30 s, followed by one last extension at 72 °C for 3 min. N. benthamiana is allotetraploid; therefore, there are two subgenomes. When designing PCR primers, specific primers for the different subgenomes are important (see Notes 25 and 26). 4. Separate PCR products by agarose gel electrophoresis to confirm that the amplicon size is as expected. 5. PCR products that cannot be digested after incubation with the appropriate restriction enzyme whose site is targeted by the sgRNA are defined as edited. 6. Conversely, when the donor ssDNA is designed to knock in a restriction site at the target sequence, PCR products that are digested with the restriction enzyme are defined as edited. 7. In both cases, the PCR products should be sequenced by Sanger sequencing to confirm editing. The presence of multiple peaks in the electropherograms about 3 bp upstream of the PAM compared relative to the non-transfected control indicates that the CRISPR/RNP complex can edit the protoplast genome. These edited protoplasts can be used for regeneration. 3.8.2 Genotyping of Regenerated Plants

Although successful gene editing can be assessed from transfected or nucleofected protoplast DNA and by Sanger sequencing, these results are not. Single protoplast-regenerated plants should be used to determine editing efficiency. 1. Use 0.2 g regenerated plant leaves for genomic DNA extraction. 2. Amplify the target site by PCR as in Subheading 3.8.1, steps 3– 6. 3. Determine the target sequences of the regenerated plants with non-edited and homozygous edited alleles (with identical edited events in all alleles) by Sanger sequencing of the PCR products. Analyze multiple sequencing results of bi-allelic and heterozygous regenerated plants using the Poly Peak Parser website [42]. 4. If multiple signals cannot be identified in silico, the PCR products should be cloned into TA cloning vectors and individual clones sequenced, as detailed below. 5. Use T4 DNA ligase and ligation buffer to ligate PCR products and linearized destination TA vector with the LacZ fragment and adjust the reaction volume to 10 μL. A typical molar ratio of insert PCR product to destination vector is 3:1. 6. Incubate the PCR product + TA vector mixture with T4 DNA ligase mixture at 4 °C overnight.

310

Fu-Hui Wu et al.

7. Introduce ligation mixture into E. coli-competent cells such as strain DH5α, and spread onto a 2xYT plate with 30 μL of X-gal solution, 30 μL of IPTG solution, and an appropriate antibiotic, e.g., ampicillin (see Note 27). 8. Incubate the plate at 37 °C overnight. 9. Blue and white colonies will appear on the surface of the 2xYT plate. Select the white colonies (see Notes 28 and 29). 10. Amplify the insert from all white colonies by PCR as in Subheading 3.8.1, steps 3 and 4. 11. Sequence the PCR products using Sanger sequencing. 12. Harvest the seeds of regenerated plants for progeny analysis. Grow the plants in the greenhouse or a growth chamber at 26 °C under a light density 70 μmol m-2 s-1 and a 16-h-light/ 8-h-dark photoperiod. 13. Determine the genotype of progeny as in Subheading 3.8.2, steps 1–11. 3.9 Whole-Genome Sequencing for OffTarget Donor DNA Insertions

1. Collect leaves of N. benthamiana explants regenerated from protoplasts for genomic DNA extraction with a plant DNA purification kit. 2. Construct paired-end libraries from the extracted genomic DNA using the DNA Library Prep for Illumina Kit with 2 × 150 bp and an average insert size of 900 bp; sequence the libraries on a NovaSeq 6000 platform (Illumina; 20028312). 3. Three technical replicates should be performed for each sample. A target sequencing depth of 30× should be achieved, corresponding to 120 Gb of raw reads per regenerated plant. Remove the first 10 nt of Illumina reads and retain the last 141 bases for further analysis. 4. Align Illumina reads to the N. benthamiana reference genome (genome assembly v.1.0.1) with BWA (v.0.7.17) using default settings [43]. 5. Identify single nucleotide polymorphisms (SNPs) and insertion and deletion (InDel) polymorphisms with DeepVariant (v.1.1.0-GPU, WGS model), followed by processing with bGLnexus (v.1.2.7, DeepVariant WGS model) and bcftools (v.1.10.2, FMT/GQ< = 20 and GT = “RA”, http:// samtools.github.io/bcftools/bcftools.html) for a joint variant calling. 6. Predict off-target sites by Cas-OFFinder (v.2.4.1) with default settings. Sample specific SNPs and InDels that were compared to predicted off-target sites from Cas-OFFinder to identify coincident sites [44].

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

311

7. Use the potential off-target insertion sites identified above and the target sequence as the query in a high-sensitivity BLASTN search strategy (-dust no -soft_masking false -word_size 4 -gapopen 1 -gapextend 2 -penalty -1 -reward 1 -evalue 5000 -perc_identity 80 -num_alignments 50000) against the Illumina reads. Based on the known edited sequence lengths in different samples, filter high-scoring segment pairs of Illumina reads. 8. Retrieve candidate Illumina reads, and examine their exact location in the N. benthamiana genome further by BLASTN (-dust no -soft masking false -task blastn-short -evalue 0.1 -perc_identity 90 -num_descriptions 1 -num_alignments 1). If the Illumina read is identical to the published genome sequence, their sequences were not affected by a targeted insertion. If a difference is detected compared to the published wild-type genome sequence, and the difference is the same as the donor DNA, the sequence should be regarded as an off-target insertion.

4

Notes 1. Use round-bottom centrifuge tubes during all experimental procedures for protoplast isolation and transfection. 2. Hydrochloric acid is monoprotic; thus, 1 M HCl is the same as 1 N HCl. 3. Cas9 recombinant protein was produced in E. coli BL21 (DE3) from plasmid pMJ915 (Addgene # 69090). Preparation of Cas9 protein was performed according to Huang et al. [36, 37]. 4. Cellulase R10 and Macerozyme R10: Yakult Pharmaceutical Industry, Japan. Stored at 4 °C. We found that the quality of the cellulase and macerozyme source is critical to achieving high protoplast isolation efficiency. We therefore recommend enzymes from this manufacturer. 5. We dispense 500 mL of W5 solution at a time and divide the solution into five bottles. For large volumes, 0.22 μm Stericup vacuum filters can be used for sterilization. 6. PEG 4000: Catalog no. 95904, BioUltra, Sigma-Aldrich, USA. We found that the quality and purity of PEG are critical to achieving high transfection efficiency, with transfection efficiency increasing with higher purity. The PEG-Ca2+ solution should be freshly prepared at least 1 h before transfection. Freshly prepared PEG-Ca2+ solution can improve the efficiency of protoplast transfection compared to an older solution [28]. The PEG-Ca2+ solution cannot be sterilized by

312

Fu-Hui Wu et al.

autoclaving and should thus be filtered using a 0.22 μm syringe sterilization filter, PES membrane, or MCE membrane. 7. Bacto Agar for plant culture medium: The weight required per liter of agar varies from company to company, but the amount added is usually 7–10 g/L. 8. Bacto Agar bacterium culture plate: The weight required per liter of agar varies from company to company, but the amount added is usually 15–20 g/L. 9. Incubating seeds in 75% (v/v) ethanol for too long will lower the germination rate. 10. Be sure to wear proper UV protection, especially for your eyes. 11. Try to get as little excess gel around the band as possible. This is especially important during the DNA purification step to increase yield. 12. Do not vortex T7 RNA polymerase solutions. 13. Do not use yellowed leaves; selecting healthy leaves is a very important factor in protoplast experiments. 14. A good preparation yields approximately 106 protoplasts per 0.2–0.25 g fresh weight (approximately 5–7 leaves digested in 10 mL of enzyme solution). 15. Handle the protoplasts gently at all steps. 16. It is not necessary to digest all the leaves in the enzyme solution. Early-released protoplasts may break and be damaged. 17. Handle protoplasts with regular pipettes and pipette tips but without touching the protoplast pellet. 18. Total volume of the protoplast suspension can range from 0.5 to 1 mL depending on the operator’s experience. 19. The W5 supernatant can reduce transfection efficiency. The transfection efficiency will increase with lower remaining W5 solution. 20. Before the PEG-Ca2+-mediated transfection, replace the W5 supernatant with transfection buffer. 21. If protoplasts are derived from healthy leaf materials, most protoplasts should remain intact throughout the isolation, transfection, culture, and harvesting procedures. 22. Subculture on time. 23. DNA purity is determined by measuring the absorbance ratio at 260 and 280 nm (a good purity falls between 1.80 and 2.00). 24. Most common primers are ordered from a company that synthesizes and ships them as a lyophilized powder. The researcher then needs to reconstitute their primers in liquid, normally sterile ultrapure water.

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration

313

25. The annealing temperature varies depending on the GC content of the primer pairs. 26. Extension step: The Taq polymerase has an optimal temperature around 70–75 °C, so this step allows the DNA polymerase to synthesize and elongate the new target DNA strand accurately and rapidly. Set the extension step to between 30 s and 2 min per kilobase of product depending on whether you are using a polymerase with proofreading capabilities, as a good proofreading enzyme will be slower during amplification. 27. Leave the plates to dry in a laminar flow chamber with lids slightly open before spreading transformed E. coli cells onto the 2xYT agar plates. 28. X-gal is used as a visual indicator and offers a convenient method of distinguishing a successful cloning product from other unsuccessful ones. 29. If the color difference between the blue and white colonies after overnight incubation is not obvious, plates can be kept at 4 °C for 2–4 h to increase the staining pattern. References 1. Bombarely A, Rosli HG, Vrebalov J, Moffett P, Mueller LA, Martin GB (2012) A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Mol Plant-Microbe Interact 25(12): 1523–1530 2. Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol 31: 397–405 3. Li JF, Aach J, Norville JE, McCormack M, Zhang D, Bush J, Church GM, Sheen J (2013) Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol 31:688– 691 4. Bortesi L, Fischer R (2015) The CRISPR/ Cas9 system for plant genome editing and beyond. Biotechnol Adv 33:41–52 5. Cermak T, Baltes NJ, Cegan R, Zhang Y, Voytas DF (2015) High-frequency, precise modification of the tomato genome. Genome Biol 16:232 6. Li JF, Zhang D, Sheen J (2015) Targeted plant genome editing via the CRISPR/Cas9 technology. Methods Mol Biol 1284:239–255 7. Osakabe Y, Osakabe K (2015) Genome editing with engineered nucleases in plants. Plant Cell Physiol 56:389–400

8. Ma X, Zhu Q, Chen Y, Liu Y (2016) CRISPR/ Cas9 platforms for genome editing in plants: developments and applications. Mol Plant 9: 961–974 9. Cermak T, Curtin SJ, Gil-Humanes J, Cegan R, Kono TJY, Konecna E, Belanto JJ, Starker CG, Mathre JW, Greenstein RL, Voytas DF (2017) A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell 29:1196–1217 10. Malzahn A, Lowder L, Qi Y (2017) Plant genome editing with TALEN and CRISPR. Cell Biosci 7:21 11. Murovec J, Pirc Z, Yang B (2017) New variants of CRISPR RNA-guided genome editing enzymes. Plant Biotechnol J 15:917–926 12. Shah T, Andleeb T, Lateef S, Noor MA (2018) Genome editing in plants: advancing crop transformation and overview of tools. Plant Physiol Biochem 131:12–21 13. Bao A, Burritt DJ, Chen H, Zhou X, Cao D, Tran LP (2019) The CRISPR/Cas9 system and its applications in crop genome editing. Crit Rev Biotechnol 39:1–16 14. Wang T, Zhang H, Zhu H (2019) CRISPR technology is revolutionizing the improvement of tomato and other fruit crops. Hortic Res 6: 77 15. El-Mounadi K, Morales-Floriano ML, GarciaRuiz H (2020) Principles, applications, and

314

Fu-Hui Wu et al.

biosafety of plant genome editing using CRISPR-Cas9. Front Plant Sci 11:56 16. Tong CG, Wu FH, Yuan YH, Chen YR, Lin CS (2020) High-efficiency CRISPR/Cas-based editing of Phalaenopsis orchid MADS genes. Plant Biotechnol J 18:889–891 17. Yue JJ, Hong CY, Wei PC, Tsai YC, Lin CS (2020) How to start your monocot CRISPR/ Cas project: plasmid design, efficiency detection, and offspring analysis. Rice 13:9 18. Shimatani Z, Kashojiya S, Takayama M, Terada R, Arazoe T, Ishii H, Teramura H, Yamamoto T, Komatsu H, Miura K, Ezura H, Nishida K, Ariizumi T, Kondo A (2017) Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Nat Biotechnol 35:441–443 19. Wada N, Ueta R, Osakabe Y, Osakabe K (2020) Precision genome editing in plants: state-of-the-art in CRISPR/Cas9-based genome engineering. BMC Plant Biol 20:234 20. Li G, Sretenovic S, Eisenstein E, Coleman G, Qi Y (2021) Highly efficient C-to-T and A-toG base editing in a Populus hybrid. Plant Biotechnol J 19:1086–1088 21. Hsu CT, Yuan YH, Lin YC, Lin S, Cheng QW, Wu FH, Sheen J, Shih MC, Lin CS (2021) Efficient and economical targeted insertion in plant genomes via protoplast regeneration. CRISPR J 4:752–760 22. Barone P, Wu E, Lenderts B, Anand A, Gordon-Kamm W, Svitashev S, Kumar S (2020) Efficient gene targeting in maize using inducible CRISPR-Cas9 and marker-free donor template. Mol Plant 13:1219–1227 23. Dong OX, Yu S, Jain R, Zhang N, Duong PQ, Butler C, Li Y, Lipzen A, Martin JA, Barry KW, Schmutz J, Tian L, Ronald PC (2020) Markerfree carotenoid-enriched rice generated through targeted gene insertion using CRISPR-Cas9. Nat Commun 11:1178 24. Lu Y, Tian Y, Shen R, Yao Q, Wang M, Chen M, Dong J, Zhang T, Li F, Lei M, Zhu JK (2020) Targeted, efficient sequence insertion and replacement in rice. Nat Biotechnol 38:1402–1407 25. Peng F, Zhang W, Zeng W, Zhu JK, Miki D (2020) Gene targeting in Arabidopsis via an allin-one strategy that uses a translational enhancer to aid Cas9 expression. Plant Biotechnol J 18:892–894 26. Dong OX, Ronald PC (2021) Targeted DNA insertion in plants. Proc Natl Acad Sci U S A 118:e2004834117 27. Sheen J (2001) Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiol 127:1466–1475

28. Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc 2:1565–1572 29. Wu FH, Shen SC, Lee LY, Le SH, Chan MT, Lin CS (2009) Tape-Arabidopsis Sandwich-a simpler Arabidopsis protoplast isolation method. Plant Methods 5:16 30. Woo JW, Kim J, Kwon SI, Corvala´n C, Cho SW, Kim H, Kim SG, Kim ST, Choe S, Kim JS (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162–1164 31. Andersson M, Turesson H, Nicolia A, F€alt AS, Samuelsson M, Hofvander P (2017) Efficient targeted multiallelic mutagenesis in tetraploid potato (Solanum tuberosum) by transient CRISPR-Cas9 expression in protoplasts. Plant Cell Rep 36:117–128 32. Lin CS, Hsu CT, Yang LH, Lee LY, Fu JY, Cheng QW, Wu FH, Hsiao HCW, Zhang Y, Zhang R, Chang WJ, Yu CT, Wang W, Liao LJ, Gelvin SB, Shih MC (2018) Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnol J 16:1295–1310 33. Hsu CT, Cheng YJ, Yuan YH, Hung WF, Cheng QW, Wu FH, Lee LY, Gelvin SB, Lin CS (2019) Application of Cas12a and nCas9activation-induced cytidine deaminase for genome editing and as a non-sexual strategy to generate homozygous/multiplex edited plants in the allotetraploid genome of tobacco. Plant Mol Biol 101:355–371 34. Yu J, Tu L, Subburaj S, Bae S, Lee GJ (2020) Simultaneous targeting of duplicated genes in Petunia protoplasts for flower color modification via CRISPR-Cas9 ribonucleoproteins. Plant Cell Rep 40:1037–1045 35. Lin CS, Hsu CT, Yuan YH, Zheng PX, Wu FH, Cheng QW, Wu YL, Wu TL, Lin S, Yue JJ, Cheng YH, Lin SI, Shih MC, Sheen J, Lin YC (2022) DNA-free CRISPR-Cas9 gene editing of wild tetraploid tomato Solanum peruvianum using protoplast regeneration. Plant Physiol 188(4):1917–1930 36. Lin S, Staahl BT, Alla RK, Doudna JA (2014) Enhanced homology-directed human genome engineering by controlled timing of CRISPR/ Cas9 delivery. elife 3:e04766 37. Huang RS, Shih HA, Lai MC, Chang YJ, Lin S (2020) Enhanced NK-92 cytotoxicity by CRISPR genome engineering using Cas9 ribonucleoproteins. Front Immunol 11:1008 38. Andersson M, Turesson H, Olsson N, F€alt AS, Ohlsson P, Gonzalez MN, Samuelsson M,

A Simple Protocol for Protoplast-targeted Insertion and Plant Regeneration Hofvander P (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164:378–384 39. Lei Y, Lu L, Liu HY, Li S, Xing F, Chen LL (2014) CRISPR-P: a web tool for synthetic single-guide RNA design of CRISPR-system in plants. Mol Plant 7:1494–1496 40. Liu H, Ding Y, Zhou Y, Jin W, Xie K, Chen LL (2017) CRISPR-P 2.0: an improved CRISPRCas9 tool for genome editing in plants. Mol Plant 10:530–532 41. Gruber AR, Lorenz R, Bernhart SH, Neubo¨ck R, Hofacker IL (2008) The Vienna RNA websuite. Nucleic Acids Res 36(Web Server issue):W70–W74

315

42. Hill JT, Demarest BL, Bisgrove BW, Su YC, Smith M, Yost HJ (2014) Poly peak parser: method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products. Dev Dyn 243:1632–1636 43. Li H, Durbin R (2009) Fast and accurate short read alignment with Bur-rows-Wheeler transform. Bioinformatics 25:1754–1760 44. Bae S, Park J, Kim JS (2014) Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30(10): 1473–1475

Chapter 20 Stepwise Optimization of Real-Time RT-PCR Analysis Nathan A. Maren, James R. Duduit, Debao Huang, Fanghou Zhao, Thomas G. Ranney, and Wusheng Liu Abstract Quantitative real-time reverse transcription PCR (qRT-PCR) analysis has been used routinely to quantify gene expression levels. Primer design and the optimization of qRT-PCR parameters are critical for the accuracy and reproducibility of qRT-PCR analysis. Computational tool-assisted primer design often overlooks the presence of homologous sequences of the gene of interest and the sequence similarities between homologous genes in a plant genome. This sometimes results in skipping the optimization of qRT-PCR parameters due to the false confidence in the quality of the designed primers. Here we present a stepwise optimization protocol for single nucleotide polymorphisms (SNPs)-based sequence-specific primer design and sequential optimization of primer sequences, annealing temperatures, primer concentrations, and cDNA concentration range for each reference and target gene. The goal of this optimization protocol is to achieve a standard cDNA concentration curve with an R2 ≥ 0.9999 and efficiency (E) = 100 ± 5% for the best primer pair of each gene, which serves as the prerequisite for using the 2-ΔΔCT method for data analysis. Key words Real-time RT-PCR, SNPs-based sequence-specific primer design, Stepwise parameter optimization, Reference gene

1

Introduction Quantifying (trans)gene expression levels is an important part of many different gene function studies. Quantitative real-time reverse transcription PCR (i.e., qRT-PCR) is one of the best tools for such purpose [1]. As a relative measure of (trans)gene expression, qRTPCR obviates the need for absolute quantification of reference or internal control genes for successful experimental execution [2]. The accuracy of qRT-PCR experiments depends on multiple factors, which include primer specificity, the optimization of qRTPCR amplification conditions, and the accuracy of transcript normalization using stably expressed reference genes. Frequently, primer specificity, GC content, self-dimerization, and secondary structure formation are the principal considerations of primer

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_20, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

317

318

Nathan A. Maren et al.

design [3, 4]. Many bioinformatics tools have been developed for qRT-PCR primer design. The Primer3 core algorithm has served as the primary primer design tool used in the development of Primer3Plus [5], Primique [6], BatchPrimer3 [7], QuantPrime [8], PrimerBank [9], primer-BLAST [10], MRPrimerW [11], Oli2go [12], qPrimerDB [13], and MRPrimerW2 [14]. Primer3Plus, Primique, BatchPrimer3, and QuantPrime provide a convenient interface and rich filtering constraints and produce a ranked list of potential primer pairs for subsequent use. PrimerBank, primerBLAST, and MRPrimerW are the only tools within this list capable of testing off-target binding by including whole-genome sequence data in the analysis pipelines. The most comprehensive predesigned primer databases qPrimerDB and MRPrimerW2 contain genome sequences for 9 and 516 organisms, respectively [13, 14]. The sequence similarity of homologs in a genome of interest is rarely a significant consideration in online primer design tools and is a principal drawback in their application in gene expression analysis. Homologous genes often exist in a genome of interest due to genome or gene duplications, resulting in the presence of nearly identical or highly similar homologous sequences. Single nucleotide polymorphisms (SNPs) between these homologs serve as ideal targets for robust homolog-specific primer design to distinguish them from each other. Fortuitously, SNPs designed at the last one or two nucleotides at the 3′-end of each primer offer enough differences under optimized qRT-PCR conditions for the SYBR Taq DNA polymerase to differentiate two homologous sequences. We posit that it is essential to obtain all homologous sequence information of each gene of interest, conduct robust searches for distinguishing gene features from sequence alignment, and design sequence-specific primers considering those SNP variations as principal design elements. Assurances and high confidence in a well-designed qRT-PCR experiment are achieved by careful design, validation, and necessary optimization. In qRT-PCR experiments, three methods have been used predominantly for relative quantification of gene expression levels, i.e., the 2-ΔΔCT method [15], the efficiency calibrated method [16, 17], and the standard curve method [16, 18, 19]. The threshold cycle (Ct) represents the entry of the exponential phase of the PCR amplification, where the PCR product (or amplicon) abundance crosses the basal phase of amplification [1]. Requiring an equal PCR amplification efficiency for both the reference and target genes, the 2-ΔΔCT method is efficient and widely adopted for data analysis. The efficiency calibrated method requires as input into the equation the primer efficiencies of each gene for an accurate quantification of gene expression. A serial dilution of the input cDNA for the relative quantification of each reference and target gene distinguishes the standard curve method from the other two methods.

Stepwise Optimization of Real-Time RT-PCR Analysis

319

For the application of the aforementioned methods for data analysis, qRT-PCR conditions for each reference and target gene should be optimized [20–23]. Expression of reference genes should be consistent and stable in all tissues and test conditions of each experiment. Commonly used reference genes in plant qRTPCR experiments include elongation factor 1 alpha (EF1α), actin (Act), ubiquitin (UBI), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein L18 (RPL), tubulin (TUB), ribosomal protein S (RPS), 18S ribosomal RNA (18S), cyclophilin (CYC), and TIP41-like family protein (TIP41) [24, 25]. These genes are often constitutively expressed house-keeping genes and required for essential cellular functions. Based on data from the Internal Control Genes (ICG) database (http://icg.big.ac.cn/index.php/ Main_Page), the most frequently used reference genes in different plant tissues, at various developmental stages, under salinity stress, and water-deficit stress, are EF1α, Act, UBI, and 18S, respectively [25]. However, their expression levels always vary under some experimental conditions and in different plant species and thus should be validated prior to commitment in a new experiment [1, 26, 27]. To achieve the goal of R2 ≥ 0.99 and efficiency = 100 ± 5% in qRT-PCR analysis, we optimized the approach for primer design and qRT-PCR conditions for relative gene expression analysis. These conditions prequalify the reliable and accurate use of the 2-ΔΔCT method for data analysis.

2

Materials

2.1 Reagents and Supplies

1. RNA Zap (Thermo Fisher; Waltham, MA, USA) or equivalent for RNase decontamination. 2. TRIzol® reagent (Molecular Research Center, Cincinnati, OH, USA) or equivalent. 3. GeneJET RNA Cleanup and Concentration Micro Kit (Thermo Fisher; Waltham, MA, USA) or equivalent. 4. QIAquick Gel Extraction Kit (Qiagen; Hilden, North RhineWestphalia, Germany) or equivalent. 5. DNase I. 6. DNase I reaction buffer. 7. Liquid nitrogen. 8. RNase-free microcentrifuge tubes (1.7 mL). 9. Clear plastic 96-well plates. 10. Micropipette for various volumes (e.g., 10, 20, 100, and 1000 μL). 11. Sterile aerosol barrier pipette tips in all sizes.

320

Nathan A. Maren et al.

12. Clean and sterile mortars and pestles. 13. RNase-free spatulas for transferring pulverized tissue. 14. Aliquots of chloroform (2 mL/sample ± ~10%). 15. Aliquots of isopropanol (0.5 mL/sample ± ~10%). 16. Molecular-grade pure ethanol. 17. Molecular-grade RNase-free water. 18. Isopropanol. 19. High-capacity cDNA reverse transcription kit (Thermo Fisher; Waltham, MA, USA) or equivalent. 20. SYBR Select Master Mix kit (Thermo Fisher; Waltham, MA, USA) or equivalent. 21. dNTP Mix (100 mM). 22. Disposable gloves. 2.2

Equipment

1. Vortex mixer. 2. Tabletop centrifuge with a pre-chill function. 3. Real-time PCR thermocycler, e.g., Bio-Rad CFX96 with CFX Manager 3.1 (Bio-Rad; Hercules, CA, USA). 4. Spectrophotometer, e.g., Thermo Scientific™ NanoDrop™ 2000/2000c (Thermo Fisher; Waltham, MA, USA). 5. Precision balance (± 0.001 g readout) for weighing out standardized preparations of sample tissue. 6. Storage containers for ice. 7. Liquid nitrogen dewar.

3

Methods

3.1 RNA Isolation and cDNA Synthesis

1. Extract total RNA from all samples relevant to the experiment, using the TRIzol® reagent according to manufacturer’s instructions (see Note 1). About 100 mg of each sample tissue with three biological replicates are used for total RNA extraction (see Note 2). Pre-chilled mortars can reduce the cost of liquid nitrogen additions during sample preparation. Pre-chilled spatulas in liquid nitrogen can prevent plant tissue sticking (see Note 1). 2. Treat RNA samples with DNase I to remove genomic DNA contamination. Set up 100 μL reactions in microfuge tubes placed in an ice bath. Each reaction should include 10 μL 10× DNase I reaction buffer, 10 μg of RNA, 2 units of DNase I (1 unit for every 5 μg of RNA), and molecular-grade RNasefree water. Incubate the reaction mixture at 37 °C for 10 min. Add 1 μL of 0.5 M EDTA to the final concentration of 5 mM.

Stepwise Optimization of Real-Time RT-PCR Analysis

321

Mix well prior to heat inactivation at 75 °C for 10 min. Place the reaction mixture in an ice bath while setting up for the next reaction. 3. Clean up with the GeneJET RNA Cleanup and Concentration Micro Kit according to manufacturer’s instructions (see Note 3). 4. Assess total RNA concentration and quality of each sample by spectrophotometry and gel electrophoresis. RNA with spectrophotometry 260/280 ratios between 1.9 and 2.1 and 260/230 ratios greater than 2.0 are indicators for adequate quality. After being evaluated by gel electrophoresis with a 1% agarose gel, samples with clear bands for 28S and 18S rRNA can be used for cDNA synthesis. 5. Perform cDNA synthesis for qRT-PCR from 1 μg of total RNA using high-capacity cDNA reverse transcription kit (Thermo Fisher; Waltham, MA, USA) or your cDNA reverse transcription kit of choice. One μg of total RNA is mixed with 2 μL of 10× RT buffer, 2.0 μL 10× RT random primers, 0.8 μL of 25× dNTP Mix (100 mM), and 1 μL MultiScribe® Reverse Transcriptase (50 units/μL) in a total volume of 20 μL. Incubate the mixture for 10 min at 25 °C, 120 min at 37 °C, and 5 s at 85 °C. 6. The resulting cDNA should be stored at -20 °C until further use. 3.2 Selection of Candidate Reference Genes Based on Their Digital Expression Profiles

1. Select candidate reference genes from a tissue-specific Illumina RNA-Seq data set. Selection should be based on their relatively stable normalized read counts as in the intended tissues and with conditions to be used in the planned studies. 2. The RNA-Seq data set can be obtained from the expression data set of transcripts, followed by filtering the transcripts with a minimum expression value of 200 transcripts per million (TPM), a mean value of less than 2,000 TPM, and a coefficient of variation (CV; %) less than 0.35 [28]. 3. Each candidate reference gene is used as the query sequence to search against a tissue-specific full-length transcript set using a BLAST tool.

3.3 Identification of the Homologous Sequences of Each Candidate Reference Gene in the Genome

1. For newly sequenced plant genomes, map the full-length transcript sequence of each candidate reference gene to an appropriate reference genome assembly (see Note 4). 2. For the plant genome sequences present in the Phytozome database (v12.1; https://phytozome.igi.doe.gov/pz/portal. html), the protein sequence of each candidate reference gene may be obtained from the plant genome of interest in the Phytozome database and used as the query sequence to search

322

Nathan A. Maren et al.

against the whole genome sequence of the plant genome of interest in Phytozome using TBLASTN. 3. The cDNA and deduced protein sequences of all the potential homologous sequences of each candidate reference gene are downloaded from the whole genome sequence database of the plant genome of interest. 4. The deduced protein sequences of all the returned homologous sequences of each gene are used for protein sequence alignment using ClustalX 2.0 (http://www.clustal.org/). 5. After the homologous sequences that lack sequence homology are removed, the remaining homologous sequences of each gene are used for both protein and then cDNA sequence (including 5′- and 3′-UTRs) alignment (see Note 5), followed by manual adjustment based on the protein sequence alignment. 6. SNPs present in each gene’s cDNA alignment with its homologs should be used for gene-specific primer design for each gene (Fig. 1). 3.4 Validation of the Accuracy of the FullLength Transcript Sequences by PCR and Sanger Sequencing Without Cloning

1. Two forward and two reverse primers, forming four primer pairs with their PCR amplicons of 85–125 bp in length, are designed for each candidate reference gene. PCR is used to amplify both the full-length transcript sequence and its most similar homolog simultaneously with SNPs present in the PCR amplicons. 2. Gradient PCR with different annealing temperatures (54.6, 56.0, 58.0, 60.6, and 62.7 °C) is conducted on clear plastic 96-well plates with optical film and Bio-Rad CFX96 real-time PCR thermocycler for each primer pair for each full-length transcript sequence using the diluted leaf cDNA (1:10 dilution) as the templates and the SYBR Select Master Mix kit (Fig. 2). 3. A primer concentration of 350 nM per primer per reaction should be sufficient. 4. Under these conditions, the Ct values are expected to be 15 < Ct < 32 (see Note 6). 5. All the qRT-PCR reactions are conducted in triplicate (technical replicates) for each biological replicate (see Note 7). 6. Confirmation of a single PCR product per primer pair can be checked by gel electrophoresis, followed by PCR product purification using the QIAquick Gel Extraction Kit. 7. Sanger sequencing with melt curve analysis without cloning serves to validate and confirm the correct amplicon (see Note 8).

Stepwise Optimization of Real-Time RT-PCR Analysis

323

Fig. 1 An example of qRT-PCR primer design. Four primers were designed for the Tripidium ravennae Ubi4 gene based on the alignment of its cDNA sequence and its closest homologous sequences

8. The accuracy of each full-length transcript sequence is analyzed by aligning the sequencing results with their respective fulllength transcript sequence using a graphical user interfacebased alignment software (Fig. 3) (see Note 9). 3.5 Primer Design for qPCR

1. The SNPs identified between each of the candidate reference genes and its most similar homolog in the genome are used for qPCR primer design. 2. With the SNPs being located on the last position (or more positions including the last one) at the 3′-end of all the primers, two forward primers of 20–23 bp in length are designed next to each other for each candidate reference gene (Fig. 1) (see Note 10).

324

Nathan A. Maren et al.

Fig. 2 The plot of the averaged Ct values from three technical replicates against the Log (cDNA in ng/reaction) for optimizing qRT-PCR conditions for the best primer pair of each of the eight candidate reference genes in T. ravennae. The PCR efficiency (E; %) for each primer pair is calculated as E = (10–1/A - 1) × 100. The cDNA concentration in 1:10, 1:20, 1:40, 1:80, and 1:160 dilutions is 5, 2.5, 1.25, 0.625, and 0.3125 ng/μL, respectively, while the Log (cDNA in ng/reaction) for the 1:10, 1:20, 1:40, 1:80, and 1:160 dilutions are 0.69897, 0.39794, 0.09691, -0.20412, and -0.50515, respectively. The data from the lowest (or highest) one (or two) cDNA concentration might have been omitted in order to obtain R2 ≥ 0.99 and E = 95–105% for the data from the remaining four (or three) consecutive cDNA concentrations for the best primer pair for each candidate gene. This serves as the prerequisite for using the 2-ΔΔCT method for data analysis

3. Similarly, two reverse primers are designed next to each other for the same candidate gene with the PCR amplicons being 85–125 bp in length (including the length of the primer pair).

Stepwise Optimization of Real-Time RT-PCR Analysis

325

Fig. 3 Melting curves of all the eight candidate reference genes in T. ravennae. Gradient PCR with different annealing temperatures (56.0, 58.0, 60.6, and 62.7 °C) is conducted using each of the four primer pairs for each PacBio sequence. The single peak indicates the specificity of the primers used in qPCR amplification at 60.6 °C, while the different peaks (the blue font circles) arose from PCR amplification at 56.0 °C

4. The PCR products could be longer than 125 bp in length if sequence homology prevents the design of sequence-specific primers for PCR amplicons of 85–125 bp in length. 5. Thus, four sequence-specific primer pairs are designed for each candidate reference gene (Fig. 1).

326

Nathan A. Maren et al.

3.6 Optimization of qPCR Conditions

1. After the validation of primer specificity by PCR, gel electrophoresis, and Sanger sequencing, qPCR conditions need to be optimized for each of the four primer pairs for each candidate reference gene. 2. To test the optimal annealing temperature for each primer pair, a gradient PCR experiment (56.0, 58.0, 60.6, and 62.7 °C) is performed using the diluted cDNA (1:10 dilution) as the templates and primer concentration of 350 nM per primer per reaction. 3. The optimal annealing temperature for each primer pair is determined from the resultant lowest Ct value (Table 1). 4. Different primer concentrations (250, 300, 350, and 400 nM per primer per reaction for each primer) are assessed to determine the optimal primer concentration for each primer pair using the diluted cDNA (1:10 dilution) as templates and the optimized annealing temperature. 5. The optimal primer concentration for each primer pair is identified by the conditions yielding the lowest Ct value. 6. The optimal annealing temperature, primer concentration for each primer pair, and serial dilution of the cDNA (1:10, 1:20, 1:40, 1:80, and 1:160 dilutions) are used to obtain the standard cDNA concentration curve with a logarithmic scale (see Note 11). 7. The standard curve equation y = Ax + B and R2 are obtained in a spreadsheet for each primer pair. 8. The PCR efficiency (E; %) for each primer pair is calculated as E = (10–1/A - 1) × 100, where A is the slope of the standard curve (Fig. 2; Table 1). 9. The outliers from the lowest (or highest) one (or two) cDNA concentration might require removal to obtain R2 ≥ 0.99 and E = 95–105% for the data from the remaining four (or three) consecutive cDNA concentrations for each primer pair for each candidate gene. 10. This serves as the prerequisite for using the 2-ΔΔCT method for data analysis.

3.7

qPCR

1. The primer pair with the best R2 and E for each candidate gene is used for qPCR analysis to quantify the transcript abundance of each gene in different tissues or under different treatment conditions. 2. For each qPCR reaction, 10 μL PCR reaction volume is used, which contains 5 μL of SYBR Select Master Mix, 0.3 μL of each primer, 1 μL of diluted cDNA, and 3.4 μL of ddH2O (see Note 11).

a

ACCTGATCTACAAGCTTGGC/ GCACCCACGCATACTTGAAT

TCTTCGTTAAGACCCTCACT/ CTGGATCTTAGCCTTGACATT

GGCTTGTCAGGGAAATTGCA/ TGTCCTCAAACAGGCCAACA

TCCGACTCCTTCCAGTACAA/ ACATCGACAGGTCCTTGGAC

TGAACAAGCTCAGCACCAAG/ GCCTTCTCAATGTTCTCCAC

TGTCCTTGTCCTAACTAGCT/ AGCCTGAGAAGACCAAAGCT

TGATTGTTGAGAAGGCTGAG/ CTGAGCTTGATTCTCTTCCTA

TGAGATACAAATCTGAGGGC/ TCACAGCTTTAACTCCCAGG

EF1α

Ubi4

H3.3

TCTPH

Aldolase

BI1

8C

AH 86

121

142

112

86

114

86

102

Amplicon length (bp)

60.6

60.6

60.6

60.6

60.6

60.6

60.6

60.6

Optimal Tm (°C)b

The best primer pair for each gene is in bold. bTm, annealing temperature. cE(%), efficiency

Primer paira

Gene

400

400

400

400

350

250

350

350

Optimal primer concentration (mM)

Table 1 The optimized qPCR parameters for the eight candidate reference genes in Tripidium ravennae

1/20–1/160

1/10–1/80

1/10–1/160

1/10–1/160

1/40–1/160

1/40–1/160

1/20–1/160

1/10–1/40

cDNA dilution

0.9924

0.9962

0.9924

0.9987

0.9981

0.9876

0.9946

0.9999

R2

100.98

103.49

100.32

101.31

100.70

102.85

100.79

104.84

E (%)c

Stepwise Optimization of Real-Time RT-PCR Analysis 327

328

Nathan A. Maren et al.

3. PCR cycling is performed as follows: 2 min at 95 °C followed by 39 rounds of 5 s at 95 °C, 30 s at the optimal annealing temperature, and finally 1 cycle of 5 s at 65 °C. A melting curve (65–95 °C; at increments of 0.5 °C) is generated to verify the specificity of primer amplification. 4. Three technical replicates are used for each of three biological replicates for each tissue sample to monitor possible sampling error and experimental error (see Notes 12 and 13). 3.8 Data Analysis for Transcript Abundance of the Candidate Reference Genes

1. Raw fluorescence Ct values are acquired from qPCR experiments and analyzed by Bio-Rad CFX Manager 3.1 and in a spreadsheet. 2. The average Ct value from the three technical replicates is calculated for each biological replicate of each tissue sample for each candidate gene. 3. The coefficient of variation (CV; %) of the Ct values of each candidate gene is calculated for different samples individually and in combination.

3.9 Analysis of the Stability of Expression of the Candidate Reference Genes

1. To analyze the stability of expression of the candidate reference genes, RefFinder [29], a web-based tool that integrates Delta Ct [30], NormFinder [31], BestKeeper [32], and geNorm [33], is used to obtain a comprehensive stability ranking of all the candidate reference genes. 2. Data analysis is conducted using the web-based software package of qbase+ and the mean Ct values as input. 3. RefFinder runs each algorithm, assigns a weight to each gene based on its rankings by each method, and calculates the geometric mean of its weights as the overall final ranking score.

3.10 Identification of the Optimal Number of Reference Genes

1. The pair-wise variation (Vn/n + 1) of the candidate reference genes under various conditions are calculated by geNorm [33], and the optimal number of reference genes is determined by the lowest number of genes with Vn/Vn + 1 smaller than the threshold of 0.15. 2. This indicates that the use of the n most stable candidate genes as the reference genes is adequate to ensure the accurate normalization of qPCR data and the addition of one more candidate gene will not make a significant difference.

4

Notes 1. To prevent RNase contamination of the samples, storage containers (for ice) or liquid nitrogen dewars, spatulas, and tools used for sample preparation should be thoroughly cleaned and sterilized prior to use. Heat-sensitive tools and equipment can

Stepwise Optimization of Real-Time RT-PCR Analysis

329

be prepared and cleaned by treatment with 70–90% ethanol and a paper towel scrub followed by RNA Zap or other strong denaturants such as guanidine salts, sodium dodecyl sulfate (SDS), or a phenol-based compound. Clean spatulas should be chilled in a dewar of liquid nitrogen prior to use and between samples. 2. High-quality RNA is essential for a sound experimental procedure. If more samples are required at a later time point or if part of the procedure fails requiring follow-up, you’ll want to extract RNA as soon as possible and prepare your cDNA for the experiment prior to long-term storage of the sample material. Ensure that you have sufficient material available to test your procedure and prepare additional samples against unforeseen lab mishap. Ensure that tubes are well labeled (sample name, date, nucleic acid concentration) prior to moving samples from one tube to another and before cold storage in 80 °C. 3. Removal of protein contaminants and salts (EDTA in particular) associated with some protocols for DNase neutralization is important for subsequent steps. Ensure wash buffers have been handled appropriately and contain essential additional components (e.g., pure ethanol additions to wash buffers I and II). 4. Using GMAP [34] or other relevant mapping tools that will quickly aid in the identification of alternative priming sites or other pertinent homologs for analysis. 5. The cDNA sequence alignment may require manual adjustment according to the protein sequence alignment. This step is critical to make sure the cDNA sequence alignment is correct. 6. In case the Ct values would be smaller than 15 cycles or larger than 32 cycles, the dilution factors of the cDNA would be adjusted accordingly (primer concentration could also be adjusted thereafter). 7. All of the components, except SYBR Select Master Mix, should be mixed and spun down 3 times in a master tube for each technical replicate and aliquoted into 3 wells in a clear plastic 96-well plate (Bio-Rad; Hercules, CA, USA), followed by the addition of SYBR Select Master Mix and mixing by gently pipetting at least 30 times. Each dilution step should be mixed very well by gently pipetting about 30 times. After the addition of SYBR Select Master Mix, tapping and spinning down should be avoided since tapping and spinning down will result in lots of bubbles affecting the qPCR accuracy. The initial cDNA concentration is calculated by dividing 1000 ng RNA by 20 μL cDNA (i.e., 50 ng/μL). Serially diluted cDNA concentrations were calculated by dividing the initial cDNA concentration by the dilution factors (i.e., 5, 2.5, 1.25, 0.625,

330

Nathan A. Maren et al.

0.3125 ng/μL). The average Ct values from three technical replicates were plotted against the Log (cDNA in ng/reaction), which were 0.69897, 0.39794, 0.09691, -0.20412, and 0.50515, respectively. 8. Sanger sequencing of the PCR products without cloning indicates whether the full-length transcript sequence, its most similar homolog, or both copies (by showing double peaks on the SNPs) were PCR amplified. 9. We use Sequencher (Gene Codes; Ann Arbor, MI, USA), but other software may be more readily available. 10. Intron spanning primer designs can aid in the disambiguation between amplicons derived from gDNA. 11. Serial dilution means a stepwise dilution of cDNA using the same dilution factor (specifically, the original cDNA is diluted by a ratio of 1–10 to make the 1:10 dilution, which is diluted by a ratio of 1–2 to make the 1:20 dilution; the 1:20 dilution is used to make the 1:40 dilution, which is used to make the 1:80 dilution, and the 1:80 dilution is used to make the 1:160 dilution). 12. Experimental work leading to the development of this protocol can be found in [35]. 13. A guideline for performing qRT-PCR analysis in the present protocol can be found in [35] and presented in Fig. 4.

Fig. 4 Guideline for performing qRT-PCR analysis in the present protocol. Tm annealing temperature

Stepwise Optimization of Real-Time RT-PCR Analysis

331

Acknowledgments The authors thank the USDA National Institute of Food and Agriculture Hatch project 02685 and North Carolina State University for the startup funds to the Liu laboratory. References 1. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3:1101–1108 2. Bolha L, Dusˇanic´ D, Narat M, Oven I (2012) Comparison of methods for relative quantification of gene expression using real-time PCR. Acta Agric Slov 100:97 3. Gue´nin S, Mauriat M, Pelloux J, Van Wuytswinkel O, Bellini C, Gutierrez L (2009) Normalization of qRT-PCR data: the necessity of adopting a systematic, experimental conditions specific, validation of references. J Exp Bot 60:487–493 4. Thornton B, Basu C (2015) Rapid and simple method of qPCR primer design. In: Basu C (ed) PCR primer design. Methods in molecular biology, vol 1275. Humana Press, New York, pp 173–179. https://doi.org/10.1007/9781-4939-2365-6_13 5. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JAM (2007) Primer3Plus, an enhanced web interface to Primer3. Nucleic Acid Res 35:W71–W74 6. Fredslund J, Lange M (2007) Primique: automatic design of specific PCR primers for each sequence in a family. BMC Bioinf 8:369–375 7. You FM, Huo N, Gu YQ, Luo MC, Ma Y, Hane D, Lazo GR, Dvorak J, Anderson OD (2008) BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinf 9:253 ˜ o-Pacho´n 8. Arvidsson S, Kwasniewski M, Rian DM, Mueller-Roeber B (2008) QuantPrime-a flexible tool for reliable high-throughput primer design for quantitative PCR. BMC Bioinf 9:465 9. Spandidos A, Wang X, Wang H, Seed B (2010) PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res 38: D792–D799 10. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinf 13:134 11. Kim H, Kang N, An K, Koo J, Kim MS (2016) MRPrimerW: a tool for rapid design of valid

high-quality primers for multiple target qPCR experiments. Nucleic Acids Res 44:W259– W266 12. Hendling M, Pabinger S, Peters K, Wolff N, Conzemius R, Barisˇic I (2018) Oli2go: an automated multiplex oligonucleotide design tool. Nucleic Acids Res 46:W252–W256 13. Lu K, Li T, He K, Chang W, Zhang R, Liu R et al (2018) qPrimerDB: a thermodynamicsbased gene-specific qPCR primer database for 147 organisms. Nucleic Acids Res 46:D1229– D1236 14. Jeon H, Bae J, Hwang SH, Whang KY, Lee HS, Kim H, Kim MS (2019) MRPrimerW2: an enhanced tool for rapid design of valid highquality primers with multiple search modes for qPCR experiments. Nucleic Acids Res 47: W614–W622 15. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402–408 16. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45 17. Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30:e36 18. Pfaffl MW, Georgieva TM, Georgiev IP, Ontsouka E, Hageleit M, Blum JW (2002) Real-time RT-PCR quantification of insulinlike growth factor (IGF)-1, IGF-1 receptor, IGF-2, IGF-2 receptor, insulin receptor, growth hormone receptor, IGF-binding proteins 1, 2 and 3 in the bovine species. Domest Anim Endocrinol 22:91–102 19. Tellmann G (2006) The E-Method: a highly accurate technique for gene-expression analysis. Nat Methods 3:1–2 20. Alonso-Rebollo A, Ramos-Gomez S, Busto MD, Ortega N (2017) Development and optimization of an efficient qPCR system for olive authentication in edible oils. Food Chem 232: 827–835

332

Nathan A. Maren et al.

21. Chen X, Mao Y, Huang S, Ni J, Lu W, Huo J et al (2017) Selection of suitable reference genes for quantitative real-time PCR in Sapium sebiferum. Front Plant Sci 8:637 22. Expo´sito-Rodrı´guez M, Borges AA, BorgesPe´rez A, Pe´rez JA (2008) Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. BMC Plant Biol 8:131 23. Jain M, Nijhawan A, Tyagi AK, Khurana JP (2006) Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Commun 345:646–651 24. Jin Y, Liu F, Huang W, Sun Q, Huang X (2019) Identification of reliable reference genes for qRT-PCR in the ephemeral plant Arabidopsis pumila based on full-length transcriptome data. Sci Rep 9:8408 25. Sang J, Wang Z, Li M, Cao J, Niu G, Xia L et al (2018) ICG: a wiki-driven knowledgebase of internal control genes for RT-qPCR normalization. Nucleic Acids Res 46:D121–D126 26. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611–622 ´ vila C, Ca´novas FM, Can ˜ as RA 27. Granados JM, A (2016) Selection and testing of reference genes for accurate RT-qPCR in adult needles and seedlings of maritime pine. Tree Genet Genomes 12:1–15 28. Cheng Y, Bian W, Pang X, Yu J, Ahammed GJ, Zhou G et al (2016) Genome-wide identification and evaluation of reference genes for

quantitative RT-PCR analysis during tomato fruit development. Front Plant Sci 8:1440 29. Xie F, Xiao P, Chen D, Xu L, Zhang B (2012) miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol Biol 80:75–84 30. Silver N, Best S, Jiang J, Thein SL (2006) Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol Biol 7:33 31. Andersen CL, Jensen JL, Ørntoft TF (2004) Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64: 5245–5250 32. Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – Excel-based tool using pair-wise correlations. Biotechnol Lett 26:509–515 33. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:research0034.1–0034.11 34. Wu TD, Watanabe CK (2005) GMAP: a genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics 21:1859–1875 35. Zhao F, Maren NA, Kosentka PZ, Liao YY, Lu H, Duduit JR et al (2021) An optimized protocol for stepwise optimization of real-time RT-PCR analysis. Hort Res 8:179

Chapter 21 CRISPR/Cas9 Technology for Potato Functional Genomics and Breeding Matı´as Nicola´s Gonza´lez, Gabriela Alejandra Massa, Mariette Andersson, Leonardo Storani, Niklas Olsson, Cecilia Andrea De´cima Oneto, Per Hofvander, and Sergio Enrique Feingold Abstract Cultivated potato (Solanum tuberosum L.) is one of the most important staple food crops worldwide. Its tetraploid and highly heterozygous nature poses a great challenge to its basic research and trait improvement through traditional mutagenesis and/or crossbreeding. The establishment of the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) as a gene editing tool has allowed the alteration of specific gene sequences and their concomitant gene function, providing powerful technology for potato gene functional analysis and improvement of elite cultivars. This technology relies on a short RNA molecule called single guide RNA (sgRNA) that directs the Cas9 nuclease to induce a site-specific double-stranded break (DSB). Further, repair of the DSB by the error-prone non-homologous end joining (NHEJ) mechanism leads to the introduction of targeted mutations, which can be used to produce the loss of function of specific gene(s). In this chapter, we describe experimental procedures to apply the CRISPR/Cas9 technology for potato genome editing. First, we provide strategies for target selection and sgRNA design and describe a Golden Gate-based cloning system to obtain a sgRNA/Cas9-encoding binary vector. We also describe an optimized protocol for ribonucleoprotein (RNP) complex assembly. The binary vector can be used for both Agrobacterium-mediated transformation and transient expression in potato protoplasts, while the RNP complexes are intended to obtain edited potato lines through protoplast transfection and plant regeneration. Finally, we describe procedures to identify the gene-edited potato lines. The methods described here are suitable for potato gene functional analysis and breeding. Key words Potato, CRISPR/Cas9, Genome editing, Functional genomics, Crop breeding, Agrobacterium tumefaciens, Protoplasts, Ribonucleoprotein complexes

Per Hofvander and Sergio Enrique Feingold are joint senior authors. Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_21, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

333

334

1

Matı´as Nicola´s Gonza´lez et al.

Introduction Genetic variability is essential in plant breeding and gene functional studies. Until recently, generating variability among individuals of a species was only possible by traditional crossing and/or the use of chemical or physical mutagens [1]. However, the randomness of these methods makes them time-consuming and difficult to apply, especially for vegetative-propagated, highly heterozygous, and polyploid crops such as potato (Solanum tuberosum L.) [2, 3]. Thus, the ability to introduce precise and predictable modifications into the genome through genome editing technologies is revolutionizing plant science and breeding. Although alternative technologies such as zinc-finger nucleases (ZFN) or transcription activator-like effector nucleases (TALEN) provided a landmark advancement in plant genome editing, the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPRassociated protein 9 (CRISPR/Cas9) have been the most widely adopted. This is fundamentally due to its great versatility, its simplicity of reprogramming and applying, and the high editing efficiency that can be achieved (for a recent review in potato, see [4]). This technology relies on the induction of a double-stranded break (DSB) by the Cas9 nuclease on a specific site of the genome, defined by the sequence of a short single guide RNA (sgRNA) [5]. The specificity for the DSB induction is determined by a 20-nucleotide-length sequence within the sgRNA, usually called “guide”, which recognizes and hybridizes with the sequence of the target site by base complementarity. The guide sequence can be easily reprogrammed by the user for the recognition and cleavage of new target sites. For the most widely used Cas9 nuclease, derived from the Streptococcus pyogenes bacterium, the presence of a 5′-NGG-3′ motif adjacent to the target site (PAM, protospacer adjacent motif) is essential for the nuclease activity [6]. The DSB is further repaired by endogenous mechanisms of the cell, which predominantly use the error-prone non-homologous end joining (NHEJ) pathway resulting in targeted mutations that may interrupt gene function [7]. Here, we describe in detail a pipeline for the application of CRISPR/Cas9 technology for potato genome editing, aiming at the loss of function of a target gene. We provide detailed insights for target site selection and sgRNA design and describe two different systems to obtain the CRISPR/Cas9 components to be delivered into the potato cell. First, a Golden Gate cloning system is described that results in the assembly of a binary vector suitable for both Agrobacterium-mediated transformation and transient expression in potato protoplasts. In addition, an in vitro transcription protocol is provided to generate the sgRNA and further combination with a commercial Cas9, which results in ribonucleoprotein (RNP) complexes that can be directly

CRISPR/Cas9 Technology in Potato

335

transfected to potato protoplasts. Finally, we depict techniques for Agrobacterium-mediated transformation and molecular characterization of the regenerated plants through the cleaved amplified polymorphic sequences (CAPS) and the high-resolution fragment analysis (HRFA) methods. The complete pipeline is suitable for potato functional genomics studies and the incorporation of new traits in elite cultivars, to obtain new improved varieties.

2

Materials

2.1 General Molecular Biology Supplies

1. High-fidelity DNA polymerase. 2. Taq DNA polymerase. 3. DNA gel extraction kit. 4. PCR purification kit. 5. Plasmid miniprep kit. 6. Plant genomic DNA purification kit. 7. PCR cloning kit. 8. 10 mM dNTP mix. 9. Nuclease-free water. 10. 5× DNA loading dye solution.

2.2

Bacteria Strains

1. Chemically competent E. coli TOP10. 2. Electro-competent Agrobacterium tumefaciens GV3101 (C58 chromosomal background with the disarmed helper Ti plasmid pMP90).

2.3 Golden Gate Binary Vector Assembly

1. Vectors available from Addgene: pICH86966::AtU6p:: sgRNA_PDS (Plasmid #46966), pICSL01009::AtU6p (Plasmid #46968), pICH47751 (Plasmid #48002), pICH47761 (Plasmid #48003), pICH47732::NOSp-NPTII-OCST (Plasmid #51144), pICH47742::2×35S-5′UTR-hCas9-NOST (Plasmid #49771), pICH41780 (Plasmid #48019), and pAGM4723 (Plasmid #48015). The vector pICH86966:: AtU6p::sgRNA_PDS is used as template for the sgRNA amplification by PCR (described in Subheading 3.4). Therefore, it may not be necessary in the case of an alternative sgRNAencoding vector available in-house. 2. Primers: (a) Fw_sgRNA1/Fw_sgRNA2: 5′-TGGTCTCAATTG(N)20GTTTTAGAGCTAGAAATAGCAAG-3′; replace (N)20 by the 20 nucleotides of each target site/guide sequence (designed as specified in Subheading 3.2). Do not include the PAM sequence. If

336

Matı´as Nicola´s Gonza´lez et al.

the guide sequence contains a G in the 5′end, remove the extra G from the forward primer (indicated as a bold G in primer sequence). (b) Rv_sgRNA: 5′-TGTGGTCTCAAGCGTAATGCCAACT TTGTAC-3′. (c) Fw_SeqLevel1: 5′-TACTGGGGTGGATGCAGTGG-3′. (d) Rv_SeqLevel1: 5′-CCACTTCGTGCAGAAGACAA-3′. (e) RBf1: 5′-GGATAAACCTTTTCACGCCC-3′. (f) Cas9-6f: 5′-ATCTCCCGAAGATAATGAGCAGAAG-3′. 3. Restriction enzymes: BsaI, BbsI, and HindIII. 4. T4 DNA ligase. 5. 20 mg/mL X-Gal stock solution: Dissolve 0.5 g of 5-bromo-4chloro-3-indolyl-β-D-galactoside (X-Gal) in 25 mL of dimethylformamide in a polypropylene tube. Dispense into 1 mL aliquots and wrap the tubes with aluminum foil to avoid light exposure. Store at -20 °C. 6. 100 mM IPTG stock solution: Dissolve 0.238 g of isopropyl-β-D-thiogalactopyranoside (IPTG) in 8 mL of distilled water, and adjust the volume to 10 mL with distilled water. Sterilize by filtration through 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 2.4 Ribonucleoprotein (RNP) Complex Assembly

1. GeneArt Precision gRNA Synthesis Kit (Thermo Fisher Scientific). 2. Primers: (a) Target F1/Target F2: 5′-TAATACGACTCACTATAG (N)20-3′; replace (N)20 by the 20 nucleotides of each target site/guide sequence (designed as specified in Subheading 3.2). Do not include the PAM sequence. If the guide sequence contains a G in the 5′end, remove the extra G from the Target F primer (indicated as a bold G in primer sequence). (b) Target R1/Target R2: 5′-TTCTAGCTCTAAAAC (RC-N)20-3′; replace (RC-N)20 by the reverse complement sequence of the 20-nucleotide target site/guide sequence. 3. RNase decontaminant. Use to decontaminate equipment, plastic, and bench surfaces before handling RNA samples. 4. Sterile RNase-free tubes and pipette tips. 5. E-Gel EX agarose gels, 2%. 6. TrueCut Cas9 Protein v2 (Thermo Fisher Scientific).

CRISPR/Cas9 Technology in Potato

2.5 Antibiotics and Phytohormone Stock Solutions

337

1. 100 mg/mL ampicillin: Dissolve 1 g of ampicillin in 8 mL of distilled water and adjust the volume to 10 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 2. 50 mg/mL kanamycin: Dissolve 0.5 g of kanamycin in 8 mL of distilled water and adjust the volume to 10 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 3. 25 mg/mL rifampicin: Dissolve 0.25 g of rifampicin in 8 mL of dimethyl sulfoxide (DMSO) and adjust the volume to 10 mL with DMSO. Dispense into aliquots of 1 mL and store at -20 °C. 4. 50 mg/mL gentamicin: Dissolve 0.5 g of gentamicin in 8 mL of distilled water and adjust the volume to 10 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 5. 100 mg/mL cefotaxime: Dissolve 1 g of cefotaxime in 8 mL of distilled water and adjust the volume to 10 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 6. 1 mg/mL zeatin riboside (ZR): Dissolve 0.1 g zeatin riboside (trans-isomer) in 2 mL of 1 M NaOH. Add some extra drops of NaOH solution if needed, until the powder is completely dissolved. Adjust the volume to 100 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 7. 1 mg/mL naphthalene acetic acid (NAA): Dissolve 0.1 g naphthalene acetic acid in 2 mL of 1 M NaOH. Add some extra drops of NaOH solution if needed, until the powder is completely dissolved. Adjust the volume to 100 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C. 8. 1 mg/mL gibberellin A3 (GA3): Dissolve 0.1 g gibberellin A3 in 2–5 mL of ethanol. Adjust the volume to 100 mL with distilled water. Sterilize by filtration through a 0.22 μm syringe filter. Dispense into 1 mL aliquots and store at -20 °C.

2.6

Culture Media

1. Luria-Bertani (LB) medium: Dissolve 10 g tryptone, 10 g NaCl, and 5 g yeast extract in 900 mL distilled water. Adjust the volume to 1 L. Sterilize by autoclaving. 2. LB agar medium: Prepare 1 L LB medium and add 15 g bacteriological agar, before autoclaving. For Petri dishes preparation, allow the medium to cool down until 50–60 °C prior to adding the proper antibiotics, and pour 20 mL of medium per Petri dish.

338

Matı´as Nicola´s Gonza´lez et al.

3. MS30 medium: Dissolve 4.43 g of Murashige and Skoog medium including vitamins and 30 g sucrose in 850 mL of distilled water. Adjust the volume to 1 L with distilled water and bring the pH to 5.8 with 1 M KOH. Sterilize by autoclaving. 4. MS30 agar medium: Prepare 1 L MS30 medium. Before autoclaving, add 8 g of Phytoagar and dissolve by heating the solution in a microwave. Sterilize by autoclaving. 5. LSR1 medium: Prepare and autoclave 1 L MS30 agar medium. Cool down at room temperature until 50–60 °C; add 2 mL of 1 mg/mL ZR stock solution, 0.2 mL of 1 mg/mL NAA stock solution, 0.02 mL of 1 mg/mL GA3 stock solution, 4 mL of 100 mg/mL cefotaxime stock solution, 1 mL of 100 mg/mL ampicillin stock solution, and 1 mL of 50 mg/mL kanamycin stock solution. 6. LSR2 medium: Prepare and autoclave 1 L MS30 agar medium. Cool down at room temperature until 50–60 °C; add 2 mL of 1 mg/mL ZR stock solution, 0.02 mL of 1 mg/mL NAA stock solution, 0.02 mL of 1 mg/mL GA3 stock solution, 4 mL of 100 mg/mL cefotaxime stock solution, 1 mL of 100 mg/mL ampicillin stock solution, and 1 mL of 50 mg/mL kanamycin stock solution. 2.7 Molecular Characterization 2.7.1 Target Gene Sequencing 2.7.2 Primers for T-DNA Detection

Primers for target gene sequencing by Sanger (designed as specified in Subheading 3.1). These primers will be used for target gene sequencing before target site selection (see Subheading 3.1) and for gene editing confirmation and characterization (see Subheading 3.7). 1. F_Cas9: 5′-TCGTGCCCCAGTCTTTTCTC-3′. 2. R_Cas9: 5′-ACCACTGCATTCAGGTAGGC-3′. 3. F_nptII: 5′-CAAGATGGATTGCACGCAGG-3′. 4. R_nptII: 5′-TCGCCATGAGTCACGACGAG-3′.

2.7.3

CAPS

1. Primers for target site(s) amplification (designed as specified in Subheading 3.2). 2. Restriction enzymes Subheading 3.2).

2.7.4 High-Resolution Fragment Analysis (HRFA)

for

gene

editing

screening

(see

1. Primers for target site(s) amplification (designed as specified in Subheading 3.2). Forward primers must be synthetized with a fluorophore at the 5′end, such as 5′-FAM, 5′-HEX, or 5′-TET. Avoid using fluorophore(s) that interfere with that of the labelled size standard. For multiplexing during fragment analysis, get each forward primer synthesized with a different

CRISPR/Cas9 Technology in Potato

339

fluorophore. Since fluorophores are light-sensitive, avoid light exposure of the primers (and the resulting amplicons) as much as possible. 2. Highly deionized (Hi-Di) formamide. 3. Dye-labelled size standard. 4. Applied Biosystems 3500 Genetic Analyzer and data collection software (Thermo Fisher Scientific). 2.8 Other Equipment and Supplies

1. Agarose gel electrophoresis materials and equipment and image capture software. 2. Scalpel, forceps, scissors. 3. Paper towels. 4. Thermocycler. 5. Micro-volume and 96-well plate spectrophotometer. 6. Electroporation cuvettes, 0.1 cm gap. 7. Electroporator. 8. Orbital shaker incubator (28 and 37 °C). 9. Static incubator (28 and 37 °C). 10. Water bath (42 °C). 11. Magenta GA7 boxes. 12. Glass tubes for plant in vitro culture. 13. Plant growth chamber with controlled temperature and photoperiod. 14. Laminar flow cabinet.

3

Methods

3.1 Target Gene Sequencing

Since tetraploid potato is highly heterozygous, the allelic variation of the target gene must be analyzed in your cultivar of interest before target site selection, to ensure the selected guides will recognize all the target gene alleles. To do this, we recommend the following steps: 1. Design specific primers to amplify a 500–800 bp region of the target gene in your cultivar of interest, based on the data from the potato reference genome (Solanum tuberosum DM1–3516 R44 v6.1), available at Spud DB (http://spuddb.uga.edu/) (see Note 1). To disrupt a gene function, the selected region should belong to the coding sequence and preferably be located near the translation start codon. Otherwise, select a region within the target gene encoding for key residues of the resulting protein, to enhance the chances of disrupting its function.

340

Matı´as Nicola´s Gonza´lez et al.

2. Use a high-fidelity DNA polymerase to amplify the target gene and check the PCR products in a 2% agarose gel. A discrete band of the expected molecular weight should be observed, suggesting the amplification is specific. 3. Ligate the PCR product into a cloning vector suitable for sequencing. 4. Add up to 5 μL of the ligation mixture into 50 μL chemically competent E. coli TOP10 on ice, mix, heat shock at 42 °C, and plate the recovered cells on LB agar supplemented with the appropriate selection antibiotic. Incubate plates overnight at 37 °C. 5. Select 15–20 individual colonies and inoculate tubes containing 3 mL of LB supplemented with the appropriate selection antibiotic and grow the culture overnight with shaking at 37 °C. Isolate the plasmid from each culture with a miniprep kit and perform Sanger sequencing using appropriate primers. Optional: Prior to Sanger sequencing, confirm the presence of the expected DNA inserted by PCR. 6. Align the obtained sequences using a multiple alignment program, such as MAFFT version 7 (https://mafft.cbrc.jp/ alignment/software/) or similar, and analyze the allelic variation within the amplified regions. 3.2 Target Site Selection

The most critical requirement for selecting a target site is the presence of a 5′-NGG-3′ PAM located downstream. Furthermore, a key criterion to consider during this step is the screening method that will be used for detecting the edited variants. Below, we describe a protocol for target site selection with the Cas-Designer tool of the CRISPR RGEN Tools software, considering two different screening approaches, the cleaved amplified polymorphic sequences (CAPS) assay and the high-resolution fragment analysis (HRFA) method. 1. Open Cas-Designer tool at http://www.rgenome.net/casdesigner/. 2. Select the PAM type. By default, the 5′-NGG-3′ PAM of the Streptococcus pyogenes Cas9 nuclease is selected. 3. Select the potato genome as the target genome. To this, search for the term “Plants” in the “Organism type” field, and select the “Solanum tuberosum (v6.1 from Spud DB) – potato” in the “Genomes” field. 4. Insert up to 1000 nucleotides (in FASTA format) of your sequence of interest in the “Target sequence” box. You can use either the sequence of the target gene obtained from the reference genome database or a sequence obtained from the sequencing analysis of the gene in your cultivar of interest.

CRISPR/Cas9 Technology in Potato

341

Since during this step the software will also identify potential off-target sites for the resulting guides by searching within the genome set as reference, we recommend inserting the sequence obtained from the reference genome and checking your sequencing results later if the possible target sites are also present in your cultivar. 5. Select the length of the target site in the “crRNA length” field. For experiments with the Streptococcus pyogenes Cas9 nuclease, we recommend maintaining the default length of 20 nucleotides for the target sites (see Note 2). 6. Click “Submit” to obtain the target site candidates. 7. Optional: Filter the obtained results by selecting a G/C content ranging from 30% to 70%, an out-of-frame score equal or above 66, and a mismatch pattern of 1-0-0 (see Note 3). 8. Identify the candidate target sites in the column “RGEN Target (5′ to 3′)” of the results. Check each candidate target site in your sequencing result alignments to corroborate they are present in your cultivar of interest and that no allelic variation is present throughout the target sequence. Additionally, if your aim is to obtain the sgRNA sequence cloned into the binary vector, check that no restriction sites are present in the candidate target sites for enzymes BsaI (5′-GGTCTC-3′) and BbsI (5′-GAAGAC-3′) (see Note 4). If CAPS assay will be performed for edited lines detection, proceed to step 9, whereas if you decide to perform a HRFA, go to step 10. 9. From the candidate target sites, select two that meet the following criteria (see Note 5): (a) Contain a restriction enzyme recognition site overlapping the expected Cas9 cut site, located 3 bp upstream of the PAM. The recognition sites can be identified by using the online tools available from your preferred enzymes provider, such as the NEBcutter V2.0 (http://nc2.neb.com/ NEBcutter2/). (b) Allow the design of a specific primer pair, to amplify the targeted region prior to digestion with the restriction enzyme. The primers should recognize regions without allelic variation, spanning the target sites individually or simultaneously, and 200–500 bp of the flanking sequence, with the cleavage site(s) preferably offset of the center of the amplicon. The optimal melting temperature should be around 60 °C, and the primer sequences should be carefully analyzed to avoid primer dimers, secondary structure formation, and nonspecific amplification. In addition, the amplicon should not have additional recognition sites for the restriction enzyme to be used for detecting edits, as this would complicate further analysis of the results.

342

Matı´as Nicola´s Gonza´lez et al.

10. From the obtained candidate target sites, select two that allow the design of a specific primer pair for HRFA (see Note 5). The primers should recognize regions without allelic variation and result in the amplification of a 200–500 bp fragment spanning both target sites individually or simultaneously (see Note 6). The optimal melting temperature should be around 60 °C, and the primer sequences should be carefully analyzed to avoid primer dimers, secondary structure formation, and unspecific amplification. Ensure that no length polymorphisms are present among the different alleles, throughout the expected amplicon, as this would complicate further analysis of the results. 3.3 Off-Target Site Prediction

The Cas-Designer tool used for target site selection analyzes potential off-target sites of the resulting guide within the reference genome, considering up to two mismatches. Although the CRISPR/Cas9 technology has proven to be rather specific in plants, off-target editing has been reported for loci sharing a significant similarity with the target sites [8–11]. A further analysis extending the number of mismatches might be useful to improve off-target prediction. This analysis would contribute to predicting potential off-target effects of CRISPR/Cas9 application, as well as identifying genomic sites that should be analyzed afterward to discard the materials with unwanted mutations. In order to extend the off-target site analysis, the following steps are performed: 1. Open Cas-OFFinder tool at http://www.rgenome.net/casoffinder/. 2. Select the PAM type. By default, the 5′-NGG-3′ PAM of the Streptococcus pyogenes Cas9 nuclease is selected. 3. Select the potato genome as the target genome. To this, search for the term “Plants” in the “Organism type” field, and select the “Solanum tuberosum (v6.1 from Spud DB) – potato” in the “Genomes” field. 4. Insert the 20-nucleotide guide sequences previously obtained with Cas-Designer, in the “Query sequences.” Notice that the guide sequence is the exact 20 nucleotides of the corresponding target site, without including the PAM sequence. You can analyze one guide sequence at the time or perform a bulk analysis. 5. Select the total number of mismatches. Based on our experience with potato and on results published in other plant species [8, 9, 11–13], we recommend searching for off-target sites with up to three mismatches and zero bulges of both DNA and RNA. Click “Submit” to obtain the potential off-target sites.

CRISPR/Cas9 Technology in Potato

343

6. In the results page, find the putative off-target sites in the table “Details.” Analyze the number of mismatches and their position within the guide sequence. Use the chromosome number and the nucleotide position to locate each potential off-target site using the potato reference genome browser available at Spud DB (http://spuddb.uga.edu/). A good guide candidate should meet the following criteria: (a) Displays three (or more) mismatches with the sequences of its potential off-target sites or more than one mismatch at the PAM proximal seed region, defined as the first eight nucleotides upstream the PAM sequence. (b) The potential off-target sites are located at the non-coding regions of the potato genome. If a particular selected guide does not fulfill one or both criteria, you could consider experimentally analyzing the putative off-target site(s) after applying the CRISPR/Cas9 directed to your target gene, to confirm the absence of unwanted mutations. 3.4 CRISPR/Cas9 Binary Vector Assembly

3.4.1 sgRNA Amplification

In this section we describe a Golden Gate cloning-based protocol, which in two cloning steps results in a binary vector carrying the coding sequences of two sgRNA together with a human codonoptimized Streptococcus pyogenes Cas9 gene (see Note 7) and the neomycin phosphotransferase II (nptII) gene for selection with kanamycin. The final plasmid is suitable for both Agrobacteriummediated transformation and protoplast transfection. This protocol utilizes a set of plasmids that are available from the Addgene repository (https://www.addgene.org/), thanks to the deposits of Sylvestre Marillonnet, Sophien Kamoun, and Jonathan D. Jones [14–16]. 1. Amplify each sgRNA sequence by setting up the following PCR reaction: 1 μL of 100 ng/μL pICH86966::AtU6p:: sgRNA_PDS, 10 μL of 5× high-fidelity DNA polymerase buffer, 1 μL of 10 mM dNTPs mix, 2.5 μL of 500 μM Fw_sgRNA1 or Fw_sgRNA2, 2.5 μL of 500 μM Rv_sgRNA, 0.5 μL of high-fidelity DNA polymerase, and 32.5 μL of nuclease-free water. 2. Run the PCR in a thermocycler with the following conditions: 3 min, 98 °C; 35 cycles of 10 s, 98 °C, 30 s, 60 °C, and 15 s, 72 °C; and 3 min, 72 °C. 3. Check the PCR products in a 2% agarose gel. A discrete band of around 160 bp should be observed. Purify each sgRNA PCR product using a PCR purification kit. No DNA quantification is needed in this step.

344 3.4.2

Matı´as Nicola´s Gonza´lez et al. Cloning Step 1

In the first step of simultaneous cut and ligation, each sgRNA is cloned downstream of an Arabidopsis thaliana U6 promoter (Fig. 1a). 1. Set up the following cloning reaction: 2 μL of 10× T4 DNA ligase buffer, 1 μL of BsaI, 3 μL of 100 ng/μL pICH47751 (for sgRNA1) or pICH47761 (for sgRNA2), 1 μL of 100 ng/μL pICSL01009::AtU6p, 5 μL of the purified sgRNA PCR product, 2 μL of T4 DNA ligase, and 6 μL of nuclease-free water. 2. Incubate the reaction in a thermocycler with the following program: 50 cycles of 5 min, 37 °C and 5 min, 16 °C; 10 min, 50 °C; and 10 min, 80 °C. 3. Transform 50 μL chemically competent E. coli TOP10 by heat shock using 3 μL of the cut-ligation mixture, and plate the recovered cells on LB agar supplemented with 100 μg/mL ampicillin, 20 μg/mL X-Gal, and 0.5 mM IPTG. Incubate plates overnight at 37 °C. 4. After incubation, blue and white colonies should be observed on the plate, with the latter expected to carry the AtU6p:: sgRNA insert. Analyze six to eight white colonies per transformation for the presence of the DNA inserts. For this, run a colony PCR with a Taq DNA polymerase using the Fw_SeqLevel1 and Rv_SeqLevel1 primers. Check the PCR products in a 2% agarose gel. For positive clones, a fragment of 260 bp should be observed, while for negative clones, a fragment of 680 bp is expected (see Note 8). 5. Select a positive clone from each transformation to inoculate 3 mL LB supplemented with 100 μg/mL ampicillin, and culture overnight with shaking at 37 °C. Isolate the plasmids using a plasmid miniprep kit, and quantify them using a microvolume spectrophotometer. 6. Optional: Perform Sanger sequencing to the final plasmids using the Fw_SeqLevel1 and/or Rv_SeqLevel1, to corroborate no mutations are present within the sgRNA sequences. The sequence of the pICH86966::AtU6p::sgRNA_PDS vector, available in the Addgene repository webpage, can be used as a reference in the alignment.

3.4.3

Cloning Step 2

In the second step of simultaneous cut and ligation, the complete T-DNA construct is inserted into the final binary vector (Fig. 1b). 1. Set up the following cloning reaction:: 2 μL of 10× T4 DNA ligase buffer, 1.5 μL of BbsI, 1.5 μL of 200 ng/μL pICH47751::sgRNA1, 1.5 μL of 200 ng/μL pICH47761:: sgRNA2, 3 μL of 100 ng/μL pICH47732::NOSp-NPTIIOCST, 3 μL of 100 ng/μL pICH47742:: 35S-hCas9- NOST, 1 μL of 100 ng/μL pICH41780, 3 μL of 100 ng/μL pAGM4723, 2 μL of T4 DNA ligase, and 1.5 μL of nucleasefree water.

CRISPR/Cas9 Technology in Potato

345

Fig. 1 Golden Gate cloning system for CRISPR/Cas9 binary vector assembly. (a) Cloning step 1, with simultaneous cut and ligation with BsaI and T4 ligase. (b) Cloning step 2, with simultaneous cut and ligation with BbsI and T4 ligase. Vectors carrying the hCas9 and the nptII genes are used in combination with the constructs obtained from cloning step 1, to obtain the final T-DNA inserted into the vector pAGM4723. AtU6p small nuclear RNA U6 promoter of Arabidopsis thaliana, BsaI recognition sequence of BsaI restriction enzyme, BbsI recognition sequence of BbsI restriction enzyme, LacZ LacZα fragment of the β-galactosidase enzyme,

346

Matı´as Nicola´s Gonza´lez et al.

2. Incubate the reaction in a thermocycler with the same program used for cloning step 1. 3. Transform 50 μL chemically competent E. coli TOP10 by heat shock using 3 μL of the cut-ligation mixture, and plate the recovered cells on LB agar supplemented with 50 μg/mL kanamycin. Incubate plates overnight at 37 °C. 4. After incubation, red/light-red and white colonies should be observed on the plate, with the latter expected to carry the full T-DNA insert. Analyze two to four white clones by colony PCR, using the Cas9-6f and RBf1 primers. Check the PCR products in a 1.5% agarose gel. A fragment of 1380 bp is expected for positive clones. 5. Select one to two positive clones to inoculate 3 mL LB supplemented with 50 μg/mL kanamycin, and incubate overnight with shaking at 37 °C. Isolate the plasmids using a plasmid miniprep kit, and check the constructs by HindIII restriction enzyme digestion. Run the digestion products in a 1% agarose gel. Bands of around 4, 1.8, 1.3, 0.5, and 0.4 kbp are expected (see Note 9). 6. Perform Sanger sequencing to the final plasmid using the Cas9-6f and RBf1 primers (see Note 10). 3.5 RNP Complex Assembly

In this section, we describe a protocol to obtain RNP complexes, suitable for protoplast transfection. For the production of sgRNA, we use an in vitro transcription method based on the GeneArt Precision gRNA Synthesis Kit pipeline. We have introduced modifications to the protocol provided by the manufacturer and included an additional DNA purification and quantification step in order to reduce the probabilities of foreign DNA contaminations in the final RNP that could result in unintended DNA insertions into the plant genome (see Note 11). Next, we provide details of the modified protocol: 1. Set up the following reaction for each sgRNA DNA template: 12.5 μL of 2× Phusion High-Fidelity PCR Master Mix, 1 μL of Tracr Fragment + T7 Primer Mix, 1 μL of 0.3 μM Target F1-R1 (for sgRNA1) or 0.3 μM Target F2-R2 (for sgRNA2) primer mix, and 10.5 μL of nuclease-free water.

ä Fig. 1 (continued) Spec indicates spectinomycin resistance for selection in bacteria, Amp indicates ampicillin resistance for selection in bacteria, nptII neomycin phosphotransferase II gene for selection with kanamycin in plants, hCas9 human codon-optimized gen of the Streptococcus pyogenes Cas9 nuclease, L4E linker sequence, RED artificial bacterial operon responsible for canthaxanthin biosynthesis, Kan indicates kanamycin resistance for selection in bacteria

CRISPR/Cas9 Technology in Potato

347

2. Run the assembly in a thermocycler with the following conditions: 10 s, 98 °C; 32 cycles of 5 s, 98 °C and 15 s, 55 °C; and 1 min, 72 °C. 3. Check that each sgRNA DNA template is correctly assembled, by running a 3 μL aliquot of each product in a 2% agarose gel. A discrete band of 120 bp should be observed. 4. Purify the remaining volume of the sgRNA DNA template with a PCR purification kit, and measure the DNA concentration afterward by using a micro-volume spectrophotometer. 5. Set up the following reaction for each sgRNA in vitro transcription: 8 μL of NTP mix, 40 ng of sgRNA1 or sgRNA2 DNA template, 4 μL of 5× TranscriptAid reaction buffer, 2 μL of TranscriptAid enzyme mix, and RNase-free water to a final volume of 20 μL. 6. Incubate the reactions at 37 °C for 3 h. 7. Add 1 U of DNAse I into the in vitro transcription reaction mix, and incubate at 37 °C for 30 min. 8. Purify the sgRNA using the gRNA Cleanup Kit provided with the GeneArt Precision gRNA Synthesis Kit, following the manufacturer’s instructions. 9. Check the quality of the sgRNA by gel electrophoresis. For this, prepare a 1/50 sgRNA dilution by pipetting 0.5 μL of each sgRNA into 10 μL of RNase-free water. Add the proper volume of loading dye solution, and heat the sample at 70 °C for 10 min, to prevent the formation of secondary structures in the RNA. Place the samples in ice before gel loading, and run 2 μL of the sample in a 2% E-Gel EX agarose gel. A discrete band of around 100 bp should be observed, indicating a good RNA quality. 10. Measure the sgRNA concentration with a micro-volume spectrophotometer. 11. Keep the final sgRNA at -80 °C until protoplast transfection. 12. Before protoplast transfection, thaw the sgRNA on ice. Add 5 μg of each sgRNA to 5 μg of the TrueCut Cas9 Protein v2 in a final volume of 5 μL, mix gently by pipetting, and incubate at room temperature for 15 min to allow RNP complex formation. 3.6 CRISPR/Cas9 System Delivery in Potato

The delivery of the CRISPR/Cas9 components to the plant cell is a critical step to obtain the desired genomic modification. Being one of the first species ever transformed with Agrobacterium tumefaciens [17], it is the most widely used approach in potato. Numerous potato genotypes are amenable to Agrobacterium-mediated transformation, and the high efficiency of transformation and relative

348

Matı´as Nicola´s Gonza´lez et al.

simplicity of the developed protocols make it the method of choice for many laboratories, to obtain a high number of potato lines with genomic stable integration of the CRISPR/Cas9 encoding sequences [18–25]. While the Agrobacterium-mediated transformation is a straightforward methodology in basic research studies such as reverse genetics or gene functional validation, the integration of foreign DNA sequences into potato genome may be preferentially avoided for potato breeding [3]. In those cases, the most attractive methodology is to employ the CRISPR/Cas9 RNP complexes to directly transfect potato protoplasts and further obtain regenerated plants carrying the desired mutation without stable integration of foreign DNA [23, 24, 26–31]. The RNP complexes and the binary vector described in previous sections are suitable for protoplast transfection. For this approach, we recommend the reader to consult the detailed protocol published by Nicolia et al. which has been shown to be successful in the application of CRISPR/Cas9 as DNA vectors and RNP complexes in potato [32]. Otherwise, in this section, we describe a detailed protocol for Agrobacterium-mediated transformation with the binary vector obtained in Subheading 3.4. This protocol was established through modifications introduced in the original protocol reported by Beaujean et al. [33]. 3.6.1 Introduction of the Binary Vector into Agrobacterium tumefaciens

1. Thaw electro-competent cells of Agrobacterium tumefaciens strain GV3101 on ice. 2. Mix 40 μL of electro-competent cells and up to 5 μL (between 0.5 and 1 μg) of the binary vector in a pre-cooled 0.1 cm-gap electroporation cuvette. Mix gently by tapping the bottom of the cuvette and keep it in ice. 3. Place the cuvette into an electroporator chamber and pulse it for 5 ms at 2.2 kV. Immediately after the pulse, add 1 mL of LB to the cuvette. 4. Collect the suspended cells from the cuvette and transfer them to a sterile 2 mL tube. Incubate the cells at 28–30 °C for 2 h, shaking at 200 rpm. 5. Plate an aliquot (usually 200 μL) of the recovered cells in plates with LB agar supplemented with 25 μg/mL rifampicin, 50 μg/ mL gentamicin, and 50 μg/mL kanamycin. Incubate the plate at 28 °C for 48 h. 6. Confirm the transformation by colony PCR of four to six individual colonies, with the RBf1 and Cas9-6f primers. 7. Select a positive clone to prepare a 3 mL LB overnight culture supplemented with the same antibiotics as step 5. Prepare a glycerol stock and store it at -80 °C.

CRISPR/Cas9 Technology in Potato 3.6.2 Preparation of Plant Material

349

1. Transfer apical cuttings from potato plantlets grown in vitro to Magenta GA7 boxes containing 50 mL of MS30 medium. Prepare a total of five boxes and place four cuttings per box close to each corner. 2. Incubate the cuttings for 4 weeks at a constant temperature of 24 °C, under a photoperiod of 16 h 80 μE m-2 s-1 light and 8 h dark (Fig. 2a).

3.6.3 Agrobacterium Culture

1. Prepare a fresh streak of the Agrobacterium tumefaciens clone, from the glycerol stock obtained in Subheading 3.6.1. 2. Use the streak to inoculate 5 mL of LB medium supplemented with 25 μg/mL rifampicin, 50 μg/mL gentamicin, and 50 μg/ mL kanamycin, and incubate at 28 °C overnight, shaking at 200 rpm. 3. Transfer the culture to a 250 mL Erlenmeyer flask containing 50 mL of LB supplemented with antibiotics as above, and incubate at 28 °C and shaking at 200 rpm, until the optical density at 600 nm (OD600) is 0.5–0.7. This is usually reached after 16 h of culture.

3.6.4 Explant Infection and Plant Regeneration

1. Dispense 20 mL of MS30 medium into each of 12 Petri dishes. 2. Excise segments of 0.5–0.8 cm from the internodes of the potato plants using a scalpel, taking great care of avoiding the buds. Transfer the explants to the Petri dishes prepared in the above step, at a ratio of 20 explants per Petri dish. 3. Add 500 μL of the Agrobacterium culture (OD600 = 0.5–0.7) to ten Petri dishes and 500 μL of LB medium to the remaining two Petri dishes (controls). Seal the Petri dishes with Parafilm, and shake slowly by hand, until the liquid medium looks homogeneous. Incubate the Petri dishes for 30 min in the dark at room temperature. During incubation, repeat the shaking every 10 min to ensure all the explants are making contact with the bacteria. 4. Pick the explants and place them on a sterile paper towel to remove the excess liquid. Transfer the explants to a new Petri dish containing 20 mL of MS30 agar medium (20 explants per Petri dish). Seal the Petri dishes with Parafilm and incubate for 72 h in dark at 21 °C (Fig. 2b). 5. Wash the explants to remove the excess bacteria. For this, prepare six 50 mL centrifuge tubes containing 30 mL of MS30 medium supplemented with 1 mg/mL cefotaxime and 100 μg/mL ampicillin. Transfer the explants to the centrifuge tubes at a ratio of 40 explants (the content of two Petri dishes) per tube. It should be noted that the 40 explants used as control must be placed in the same centrifuge tube, avoiding contaminations with the bacteria. Close the centrifuge tubes tightly and place them horizontally on an orbital shaker and shake for 30 min at 50 rpm.

350

Matı´as Nicola´s Gonza´lez et al.

Fig. 2 Agrobacterium-mediated transformation. (a) Four-week-old potato plantlets in a Magenta box. (b) Internode explants in MS30 agar medium. (c) Callus transferred to LSR2 medium, 25 days after explant infection. (d) Shoots emerging from calli, 75 days after explant infection. (e) Individual shoot transferred to MS30 agar supplemented with 50 μg/mL kanamycin. (f) Plantlet with growing roots after 10 days of culture in MS30 agar supplemented with 50 μg/mL. (Images b, c, and d have been reproduced from [31], by permission of Springer Nature Customer Service Center GmbH)

CRISPR/Cas9 Technology in Potato

351

6. Remove explants from the centrifuge tubes and place them on a sterile paper towel to remove the excess liquid. Transfer the explants to a new Petri dish containing 20 mL of LSR1 medium (20 explants per Petri dish). With the control explants, transfer 20 explants to LSR1 medium as negative control and another 20 explants to LSR1 medium lacking the antibiotics as positive control. Seal the Petri dishes with Parafilm, and incubate at a constant temperature of 24 °C under a photoperiod of 16 h 80 μE m-2 s-1 light and 8 h dark for 4 weeks. Refresh the culture media every 7 days. 7. Once calli are formed at the edges of the explants, transfer them to new Petri dishes containing 20 mL LSR2 (Fig. 2c). For the positive control, use LSR2 medium without antibiotics. Seal the Petri dishes with Parafilm and incubate under the same conditions as for step 6. Subculture tissues onto freshly prepared LSR2 medium every 7 days. Shoots emerge from calli normally after 4–6 weeks of culture on LSR2 (Fig. 2d). 8. Once shoots are at least 2 cm long, excise them from the calli, and transfer them individually to glass tubes containing 3 mL of MS30 agar medium, supplemented with 50 μg/mL kanamycin (Fig. 2e) (see Note 12). Incubate in the same conditions as for step 6. For further analysis, select only those plants that produce roots in this step (Fig. 2f). 3.7 Molecular Analysis of Regenerated Lines

3.7.1 Confirmation of TDNA Integration into the Potato Genome

Regenerated lines that produce roots in selective medium can be directly screened for target gene editing. As an additional step and prior to the screening, the genomic integration of the T-DNA can be confirmed by PCR amplification of one or more of the genetic elements present in the binary vector. To confirm the insertion of the T-DNA in the regenerated lines, go to Subheading 3.7.1. Otherwise, proceed to the screening of edited lines as described in Subheadings 3.7.2 and 3.7.3. 1. Purify genomic DNA of the regenerated lines using a plant genomic DNA kit. Determine the DNA concentration using a micro-volume spectrophotometer. 2. Set up a PCR reaction with Taq DNA polymerase and approximately 10 ng of the genomic DNA, to amplify one or both of the following genes present in the T-DNA: (a) hCas9 gene: Perform the PCR with the F_Cas9 and R_Cas9 primers. The expected amplicon size is 457 bp. (b) NptII gene: Perform the PCR with the F_nptII and R_nptII primers. The expected amplicon size is 558 bp. As a positive control in the PCR, use the binary vector as a template. For negative control, use the genomic DNA of a wildtype plant as a template. This control would corroborate the specificity of the primers for the amplification of the T-DNA.

352 3.7.2

Matı´as Nicola´s Gonza´lez et al. CAPS Assay

1. Purify genomic DNA of the regenerated lines and a wild-type plant, with a plant genomic DNA purification kit. Quantify the DNA using a micro-volume spectrophotometer. 2. Use a high-fidelity DNA polymerase and around 10 ng of genomic DNA as template, to amplify the target sites individually or simultaneously, using the primers designed in Subheading 3.2. The total reaction volume should be 10–20 μL. If handling multiple samples at once, a 96-well PCR plate is recommended for the amplifications. 3. Use an aliquot of 2 μL to check the PCR products in a 2% agarose gel. If both target sites are amplified simultaneously, deletions of the fragment in between may be observed during gel electrophoresis (Fig. 3a). 4. Prepare a master mix of the digestion mixture with the restriction enzyme identified during target site selection (see Subheading 3.2), according to the protocol provided by the enzyme manufacturer. In a clear, non-skirted 96-well plate, add 17 μL of the master mix and 3 μL of each PCR products per well. The following controls must be included in the 96-well plate: (a) Digestion control: Use 3 μL of the PCR product obtained from the wild-type plant. (b) Non-digestion control: Use 3 μL of the PCR product obtained from the wild-type plant in a reaction with all the digestion components, except for the restriction enzyme. 5. Seal the plate with a film or flat cap strips, and centrifuge briefly to collect all the drops. Incubate the plate in a static incubator set at the proper temperature for 1 h. 6. Add 5 μL of a 5× loading dye solution per well and mix by pipetting. Run 10–15 μL of each product in a 2% agarose gel electrophoresis (Fig. 3b). The presence of a resistant band in the digested products indicates the restriction enzyme site has been lost as a consequence of gene editing. 7. Confirm the gene editing in selected lines by performing Sanger sequencing. For sequencing analysis, we recommend amplifying the targeted region by using either the primers designed for CAPS analysis or the primers used for target gene sequencing (see Subheading 3.1) and to ligate the PCR products in a sequencing vector. Perform Sanger sequencing to 12–15 clones per edited line (see Note 13).

CRISPR/Cas9 Technology in Potato

353

Fig. 3 Molecular analysis of regenerated lines. (a) Simultaneous amplification of the two target sites in a dualsgRNA strategy. Lanes 1, 2, 3, and 4 correspond to edited lines carrying deletions of the fragment between the two target sites. The edited line in lane 3 displays in addition a DNA insert in at least one allele of the target gene. M: DNA ladder. WT: wild-type line. (b) CAPS results of regenerated lines. Digestion resistant bands in lanes 4, 7, and 15 indicate editing of the target gene. M: DNA ladder. WT: Digested wild-type fragment (digestion control). WT n/d: non-digested wild-type fragment (non-digestion control). (c) HRFA results obtained with the GeneMarker software. From the top to the bottom: a wild-type line; an edited line displaying at least one allele with a 4 bp deletion; a tetra-allelic edited line displaying all four alleles with a deletion of 2 bp; and a tetra-allelic edited line showing deletions of 2, 3, and 4 bp

354 3.7.3

Matı´as Nicola´s Gonza´lez et al. HRFA

1. Purify genomic DNA of the regenerated lines and a wild-type plant with a plant genomic DNA purification kit. Quantify the DNA in a micro-volume spectrophotometer. 2. Amplify the target site(s) with the HRFA primers (see Subheading 3.2), in a 96-well PCR plate. Use a high-fidelity DNA polymerase and around 10 ng of genomic DNA as template, in a total reaction volume of 10 μL. Include a control reaction consisting of DNA from the wild-type plant and a negative control lacking DNA template. Avoid light exposure of the plate as much as possible, by covering it with aluminum foil. 3. Check the PCR products by running 2 μL of each sample in a 2% agarose gel. If both target sites are amplified simultaneously, deletions of the fragment in between may be observed during gel electrophoresis (Fig. 3a). 4. Prepare a HRFA master mix, by adding 8.9 μL of highly deionized (Hi-Di) formamide and 0.1 μL of a dye-labeled size standard, per sample. For the analysis of fragments ranging from 200 to 500 bp, a dye-labeled size standard for sizing DNA fragments up to 600 bp is recommended. 5. In a 96-well plate, add 1 μL of the diluted PCR product (see Note 14) and 9 μL of the HRFA master mix. As a reference, a PCR product amplified from the wild-type plant should be included in one well of the plate. Also, set up a negative control by pipetting 1 μL of the negative control included in the PCR. 6. Mix the wells carefully and centrifuge the plate briefly to collect all drops. Seal the plate with an adhesive film. 7. Denature the samples by incubating the plate for 3 min at 95 °C. Cover the plate and transfer to ice for 5 min to cool down. 8. Run the samples in a 3500 Genetic Analyzer for fragment analysis, according to the supplier’s instructions (see Note 15). 9. Analyze the results with the GeneMapper Software provided with the 3500 Genetic Analyzer or with an alternative software, such as the GeneMarker software (SoftGenetics, https:// softgenetics.com/products/genemarker/). Gene editing is indicated by the presence of peaks whose molecular size differs from the wild-type fragment, due to deletions or insertions. The absence of the wild-type peak for a given sample indicates a tetra-allelic edited line (Fig. 3c). 10. Confirm the gene editing in selected lines by performing Sanger sequencing. For sequencing analysis, we recommend to amplify the targeted region by using either the primers designed for HRFA (without the fluorescent label) or the primers used for target gene sequencing (see Subheading 3.1) and to ligate the PCR products in a sequencing vector. Perform Sanger sequencing to 12–15 clones per edited line (see Note 13).

CRISPR/Cas9 Technology in Potato

4

355

Notes 1. Due to the high heterozygosity of cultivated potato and possible sequence discrepancies between the potato reference genome and your cultivar of interest, it is highly recommended to design two or three primer pairs covering different regions of the target gene. This would improve the chances of amplifying all the alleles for an appropriate sequencing analysis, prior to the selection of a target site. 2. In Streptococcus pyogenes adaptive immunity, the Cas9 nuclease recognizes 20-nucleotide target sequences within an invader genome, preceding the PAM sequence [6]. Based on this, most applications of Cas9 for genome editing utilize 20-nucleotide guides. However, guides of 17–18 nucleotides have been successfully used in human cells resulting in a reduced incidence of off-target editing without penalties in the on-target efficiency. This result may be attributed to a stronger effect of the mismatches on shorter guides, increasing the specificity [34]. However, off-target effects have barely been reported for the Cas9 nuclease in plants when 20-nucleotide guides are employed and, moreover, the use of truncated guides may result in a lower on-target efficiency [35]. 3. Most of the filters mentioned in this step are based on guide sequence features not experimentally validated in plant genome editing. Nevertheless, the number of putative target sites found within a coding sequence of around 1000 bp is generally very high, and these filters may contribute to reduce the number of target candidates and to focus on the theoretically best ones. Regarding G/C content, it is still unclear which is the optimal percentage range to ensure a high efficiency of the sgRNA, and such an optimal percentage most likely varies among different organisms [36–39]. Our experience working in potato indicates that sgRNAs with good efficiency can be obtained for a guide-G/C content ranging between 40% and 70%, which is in agreement with reports in other plant species [39]. The out-offrame score is calculated based on the microhomology that surrounds the cleavage site and that could lead to unwanted in-frame mutations as a result of microhomology-mediated end joining [40]. A value of 66 or higher is recommended by the software developers, based on results obtained in human cells [40]. Finally, a mismatch pattern of 1-0-0 enables to avoid selecting guides with potential off-target sites displaying one or two mismatches, which – even though with a low frequency – could lead to inducing unwanted mutations [11].

356

Matı´as Nicola´s Gonza´lez et al.

4. Avoid target sites with repetitions of thymines in cases where the sgRNA will be under the control of U3 or U6 promoters. This is because four or more thymines in tandem may stop the transcription of the RNA molecule by RNA polymerase III (RNA Pol III). Prioritize target sites that contain a guanine at the 5′end for sgRNA expression under the control of either a U6 promoter – like in the binary vector described in this chapter – or a T7 promoter, like in the in vitro transcription for RNP complex assembly described in this chapter, for a proper transcription by RNA Pol III or T7 RNA polymerase, respectively. However, this is not mandatory, since both expression systems allow the user to add a guanine immediately downstream of the respective promoter, to ensure a proper transcription (see Subheading 2.3 and 2.4). Such an extra guanine will remain in the 5′end of the guide sequence and, theoretically, without negative effects on the sgRNA efficiency. Finally, the candidate target sites can be further analyzed to determine the secondary structures adopted between the guide and the scaffold sequences within the resulting sgRNA, which has been proposed to influence sgRNA efficiency [41–43]. This analysis can be carried out by using online available software, such as CRISPR-GE (http://skl.scau.edu.cn/) [42] or the RNAstructure program (http://rna.urmc.rochester.edu/ RNAstructureWeb/) [44]. However, in our experience, there is not a clear consensus between the theoretical functionality and the experimental outcome of a sgRNA based on its secondary structure prediction [31]. 5. Employing two sgRNAs simultaneously on a target gene may result in large deletions, which facilitates screening by simply preforming a PCR followed by gel electrophoresis. Moreover, since the editing efficiency is possibly affected by the guide sequence and the sgRNA structural features [45], using two sgRNAs may increase the chances of a higher proportion of edited lines, decreasing the screening efforts. 6. Amplifying both target sites simultaneously, as one amplicon, is recommended for a rapid detection of tetra-allelic edited lines through HRFA. Thereby, such lines would be identified by the loss of the wild-type fragment peak in the resulting electropherograms, and a further sequencing analysis of selected lines would determine the precise site of the modification. The limitation of this approach is that both target sites must be located close enough to allow a simultaneous amplification. Conversely, the individual amplification of each target site makes HRFA suitable for detecting the exact site of the modification. However, such an approach hinders the rapid detection of tetra-allelic edited lines in those lines having one/some alleles edited at one target site and the remaining alleles edited at the other site. In those cases, only sequencing analysis would help to identify the tetra-allelic edited lines.

CRISPR/Cas9 Technology in Potato

357

7. We employ a human codon-optimized Cas9 nuclease gene since it was proved to work very effectively in a wide range of plant species, including both monocots and dicots, and particularly in species closely related to potato, such as tomato, Nicotiana benthamiana, and Nicotiana tabacum [15, 46– 50]. Our experience with this construct suggests that it is highly active in potato cells, although we have not tested any plant codon-optimized Cas9 nuclease gene to make comparative studies. 8. Occasionally, we have experienced a low efficiency of cloning step 1 noticed by an absence of white colonies after ligation. In these cases, we found it helpful to add an extra cloning step for the sgRNA PCR product before cloning step 1, as outlined next: (a) Ligate the sgRNA PCR product into a transitory plasmid, such as the pGEM-t-easy (Promega). (b) Digest the pGEM-t-easy::sgRNA vector with BsaI in a 50 μL volume reaction, following the restriction enzyme supplier’s instructions. (c) Run the digested product in a 2% agarose gel. Since the pGEM-t-easy vector contains a BsaI recognition site, three bands are expected if the digestion was complete. Purify the band corresponding to the sgRNA fragment (around 160 bp) using a DNA gel extraction kit. During this step, minimize the UV-light exposure of the gel to prevent unwanted mutations in the sgRNA sequence. (d) Use the purified digested sgRNA fragment for the cloning step 1, instead of the sgRNA PCR fragment (see Subheading 3.4.2), and continue with the Golden Gate cloning as described in Subheading 3.4.2. 9. The digestion of the final vector with the HindIII restriction enzyme produces fragments of 4202, 3936, 1833, 1270, 509, 387, 366, and 73 bp. However, due to the low resolution of the electrophoresis in a 1% agarose gel, the products of the digestion are commonly observed as five major bands of around 4, 1.8, 1.3, 0.5, and 0.4 kbp. 10. The Golden Gate is a modular cloning system that allows multi-gene construct assembly in a directional manner, and, theoretically, a module cannot be ligated to the final construct without the presence of its compatible overhang fusion site [16]. However, we have occasionally obtained final binary vectors carrying only one sgRNA correctly assembled under the control of the corresponding AtU6 promoter. The reason for this is unknown, but such a result highlights the importance of a proper analysis of the final construct by Sanger sequencing to corroborate the adequate assembly of each component. You

358

Matı´as Nicola´s Gonza´lez et al.

can corroborate the presence of both sgRNA correctly cloned under an AtU6 promoter, by sequencing the final construct with RBf1 primer. Moreover, sequencing with the Cas9-6f would be useful to confirm the presence of the hCas9 gene in the final construct. 11. The optimized protocol for RNP assembly described in this section results in a considerably lower proportion of unwanted DNA insertions in the final edited lines, in comparison with the original protocol [27, 31]. Nevertheless, this approach may not completely eliminate the contaminating traces of DNA in the final RNP complexes, still resulting in integration of foreign DNA into the potato genome, which may raise regulatory burdens when applied to potato breeding [31]. In our experience with application of this protocol to obtain improved potato varieties in Argentina, we needed to provide empirical evidence on the absence of foreign DNA sequences to the regulatory agencies, although different requirements may apply for this technology in different countries [51]. Instead, chemically synthesized sgRNAs are produced without the use of DNA molecules, which result in RNP-mediated edited lines that can be considered as foreign DNA-free [27, 52]. 12. In our experience, one callus resistant to the selective agent may give rise to plants with different editing status – that is, edited and wild-type lines – and with different edited genotypes [31]. This was also reported by other authors when using Agrobacterium tumefaciens to deliver the CRISPR/Cas9 components to the plant cell [8, 23]. Therefore, we recommend picking several (at least five) shoots per each regenerated callus, in order to broaden the molecular screening. 13. Confirming and characterizing the edited lines through sequencing is indispensable for a proper selection of lines to be advanced to phenotypic analysis. CAPS assay relies on the loss of a restriction enzyme recognition site, which could result from insertion, deletions, and/or base replacements at the DSB site, depending on the restriction enzyme employed. Therefore, only the sequencing analysis would determine if the mutation is predicted to result in a loss of gene function. In the case of HRFA, on the other hand, the length of the insertions or deletions determined would be enough to predict a loss of function of the target gene. However, we recommend confirming the HRFA results by sequencing at least in a subset of edited lines. In addition, we found that the HRFA may occasionally be inaccurate in determining the length of large deletions or insertions [31], in accordance with other authors [53]. For this reason, we suggest prioritizing the sequencing analysis of lines displaying such types of mutations.

CRISPR/Cas9 Technology in Potato

359

14. In most cases, PCR products should be diluted prior to capillary electrophoresis analysis. Optimal dilution normally range between 1/20 and 1/100 and should be determined in advance. For that, we recommend running HRFA on a subset of the samples (usually 8–16 samples out of the total 96 contained in the plate) to test different dilutions to determine a proper range of fluorescence. 15. If a Genetic Analyzer instrument is not available in-house, the HRFA could be requested as a service from most of the Sanger sequencing service providers. References 1. Holme IB, Gregersen PL, Brinch-Pedersen H (2019) Induced genetic variation in crop plants by random or targeted mutagenesis: convergence and differences. Front Plant Sci 10:1468 2. Schaart JG, van de Wiel CCM, Smulders MJM (2021) Genome editing of polyploid crops: prospects, achievements and bottlenecks. Transgenic Res 30(4):337–351 3. Nadakuduti SS, Buell CR, Voytas DF et al (2018) Genome editing for crop improvement – applications in clonally propagated polyploids with a focus on potato (Solanum tuberosum L.). Front Plant Sci 9:1–11 ˜ ak V, Almasia NI, Gonza´lez MN et al 4. Nahirn (2022) State of the art of genetic engineering in potato: from the first report to its future potential. Front Plant Sci 12:3181 5. Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual-RNA – guided. Science (80- ) 337:816–822 6. Jiang F, Doudna JA (2017) CRISPR–Cas9 structures and mechanisms. Annu Rev Biophys 46:505–529 7. Puchta H (2005) The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution. J Exp Bot 56:1–14 8. Lee K, Zhang Y, Kleinstiver BP et al (2019) Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize. Plant Biotechnol J 17:362–372 9. Wang X, Tu M, Wang Y et al (2021) Wholegenome sequencing reveals rare off-target mutations in CRISPR/Cas9-edited grapevine. Hortic Res 8:114 10. Zhang Q, Xing HL, Wang ZP et al (2018) Potential high-frequency off-target mutagenesis induced by CRISPR/Cas9 in Arabidopsis and its prevention. Plant Mol Biol 96:445–456 11. Modrzejewski D, Hartung F, Lehnert H et al (2020) Which factors affect the occurrence of off-target effects caused by the use of

CRISPR/Cas: a systematic review in plants. Front Plant Sci 11:1838 12. Es¸ I, Gavahian M, Marti-Quijal FJ et al (2019) The application of the CRISPR-Cas9 genome editing machinery in food and agricultural science: current status, future perspectives, and associated challenges. Biotechnol Adv 37: 410–421 13. Feng C, Su H, Bai H et al (2018) Highefficiency genome editing using a dmc1 promoter-controlled CRISPR/Cas9 system in maize. Plant Biotechnol J 16:1848–1857 14. Nekrasov V, Staskawicz B, Weigel D et al (2013) Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol 31:691–693 15. Belhaj K, Chaparro-Garcia A, Kamoun S et al (2013) Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods 9:39 16. Weber E, Engler C, Gruetzner R et al (2011) A modular cloning system for standardized assembly of multigene constructs. PLoS One 6:e16765 17. De Block M (1988) Genotype-independent leaf disc transformation of potato (Solanum tuberosum) using agrobacterium tumefaciens. Theor Appl Genet 76:767–774 18. Ba´nfalvi Z, Csa´kva´ri E, Villa´nyi V et al (2020) Generation of transgene-free PDS mutants in potato by Agrobacterium-mediated transformation. BMC Biotechnol 20:25 19. Butler NM, Atkins PA, Voytas DF et al (2015) Generation and inheritance of targeted mutations in potato (Solanum tuberosum L.) using the CRISPR/Cas system. PLoS One 10:1–12 20. Butler NM, Baltes NJ, Voytas DF et al (2016) Geminivirus-mediated genome editing in potato (Solanum tuberosum L.) using

360

Matı´as Nicola´s Gonza´lez et al.

sequence-specific nucleases. Front Plant Sci 7: 1–13 21. Enciso-Rodriguez F, Manrique-Carpintero NC, Nadakuduti SS et al (2019) Overcoming self-incompatibility in diploid potato using CRISPR-Cas9. Front Plant Sci 10:376 22. Kieu NP, Lenman M, Wang ES et al (2021) Mutations introduced in susceptibility genes through CRISPR/Cas9 genome editing confer increased late blight resistance in potatoes. Sci Rep 11:4487 23. Tuncel A, Corbin KR, Ahn-Jarvis J et al (2019) Cas9-mediated mutagenesis of potato starchbranching enzymes generates a range of tuber starch phenotypes. Plant Biotechnol J 17: 2259–2271 24. Veillet F, Chauvin L, Kermarrec M-P et al (2019) The Solanum tuberosum GBSSI gene: a target for assessing gene and base editing in tetraploid potato. Plant Cell Rep 38:1065– 1080 25. Zhou X, Zha M, Huang J et al (2017) StMYB44 negatively regulates phosphate transport by suppressing expression of PHOSPHATE1 in potato. J Exp Bot 68:1265–1281 26. Andersson M, Turesson H, Nicolia A et al (2017) Efficient targeted multiallelic mutagenesis in tetraploid potato (Solanum tuberosum) by transient CRISPR-Cas9 expression in protoplasts. Plant Cell Rep 36:117–128 27. Andersson M, Turesson H, Olsson N et al (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164:378–384 28. Johansen IE, Liu Y, Jørgensen B et al (2019) High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato. Sci Rep 9:17715 29. Zhao X, Jayarathna S, Turesson H et al (2021) Amylose starch with no detectable branching developed through DNA-free CRISPR-Cas9 mediated mutagenesis of two starch branching enzymes in potato. Sci Rep 11:4311 30. Gonza´lez MN, Massa GA, Andersson M et al (2020) Reduced enzymatic browning in potato tubers by specific editing of a polyphenol oxidase gene via ribonucleoprotein complexes delivery of the CRISPR/Cas9 system. Front Plant Sci 10:1–12 31. Gonza´lez MN, Massa GA, Andersson M et al (2021) Comparative potato genome editing: agrobacterium tumefaciens-mediated transformation and protoplasts transfection delivery of CRISPR/Cas9 components directed to StPPO2 gene. Plant Cell Tissue Organ Cult 145(2):291–305 32. Nicolia A, F€alt A-S, Hofvander P et al (2021) Protoplast-based method for genome editing

in tetraploid potato. In: Tripodi P (ed) Crop breeding. Methods in molecular biology, vol 2264. Humana, New York 33. Beaujean A, Sangwan RS, Lecardonnel A et al (1998) Agrobacterium-mediated transformation of three economically important potato cultivars using sliced internodal explants: an efficient protocol of transformation. J Exp Bot 49:1589–1595 34. Fu Y, Sander JD, Reyon D et al (2014) Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol 32:279–284 35. Sugano SS, Nishihama R, Shirakawa M et al (2018) Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha. PLoS One 13:e0205117 36. Doench JG, Hartenian E, Graham DB et al (2014) Rational design of highly active sgRNAs for CRISPR-Cas9–mediated gene inactivation. Nat Biotechnol 32:1262–1267 37. Housden BE, Valvezan AJ, Kelley C et al (2015) Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts with RNAi. Sci Signal 8:rs9 38. Haeussler M, Scho¨nig K, Eckert H et al (2016) Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol 17:148 39. Liang G, Zhang H, Lou D et al (2016) Selection of highly efficient sgRNAs for CRISPR/ Cas9-based plant genome editing. Sci Rep 6: 21451 40. Bae S, Kweon J, Kim HS et al (2014) Microhomology-based choice of Cas9 nuclease target sites. Nat Methods 11:705–706 41. Ma X, Zhu Q, Chen Y et al (2016) CRISPR/ Cas9 platforms for genome editing in plants: developments and applications. Mol Plant 9: 961–974 42. Xie X, Ma X, Zhu Q et al (2017) CRISPR-GE: a convenient software toolkit for CRISPRbased genome editing. Mol Plant 10:1246– 1249 43. Kumlehn J, Pietralla J, Hensel G et al (2018) The CRISPR/Cas revolution continues: from efficient gene editing for crop breeding to plant synthetic biology. J Integr Plant Biol 60:1127– 1153 44. Bellaousov S, Reuter JS, Seetin MG et al (2013) RNAstructure: web servers for RNA secondary structure prediction and analysis. Nucleic Acids Res 41:W471–W474 45. Schindele P, Wolter F, Puchta H (2020) CRISPR guide RNA design guidelines for

CRISPR/Cas9 Technology in Potato efficient genome editing. In: Heinlein M (ed) RNA tagging. Methods in molecular biology, vol 2166. Humana, New York 46. Naim F, Shand K, Hayashi S et al (2020) Are the current gRNA ranking prediction algorithms useful for genome editing in plants? PLoS One 15:e0227994 47. Brooks C, Nekrasov V, Lippman ZB et al (2014) Efficient gene editing in tomato in the first generation using the clustered regularly interspaced short palindromic repeats/ CRISPR-Associated9 system. Plant Physiol 166:1292–1297 48. Nekrasov V, Wang C, Win J et al (2017) Rapid generation of a transgene-free powdery mildew resistant tomato by genome deletion. Sci Rep 7:482 49. Rodrı´guez-Leal D, Lemmon ZH, Man J et al (2017) Engineering quantitative trait variation

361

for crop improvement by genome editing. Cell 171:470–480.e8 50. Jacobs TB, LaFayette PR, Schmitz RJ et al (2015) Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnol 15:1–10 51. Zhang D, Hussain A, Manghwar H et al (2020) Genome editing with the CRISPRCas system: an art, ethics and global regulatory perspective. Plant Biotechnol J 18:1651–1669 52. Zhang Y, Iaffaldano B, Qi Y (2021) CRISPR ribonucleoprotein-mediated genetic engineering in plants. Plant Commun 2(2):100168 53. Ramlee MK, Yan T, Cheung AMS et al (2015) High-throughput genotyping of CRISPR/ Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis. Sci Rep 5: 15587

Part V Genome Engineering for Crop Improvement

Chapter 22 Recent Advances in Engineering of In Vivo Haploid Induction Systems Jian Lv and Timothy Kelliher Abstract Doubled haploid (DH) technology is an important approach to accelerate genetic gain via a shortened breeding cycle, which relies on the ability to generate haploid cells that develop into haploids or doubled haploid embryos and plants. Both in vitro and in vivo (in seed) methods can be used for haploid production. In vitro culture of gametophytes (microspores and megaspores) or their surrounding floral tissues or organs (anthers, ovaries, or ovules) has generated haploid plants in wheat, rice, cucumber, tomato, and many other crops. In vivo methods utilize pollen irradiation or wide crossing or in certain species leverage genetic mutant haploid inducer lines. Haploid inducers were widespread in corn and barley, and recent cloning of the inducer genes and identification of the causal mutations in corn have led to the establishment of in vivo haploid inducer systems via genome editing of orthologous genes in more diverse species. Further combination of DH and genome editing technology led to the development of novel breeding technologies such as HI-EDIT™. In this chapter, we will review in vivo haploid induction and new breeding technologies that combine haploid induction and genome editing. Key words In vivo haploid induction, Haploid inducer, MATL/PLA1/NLD, CenH3, DMP, HIEDIT™

1

Introduction In vitro haploid induction involves a switch in the developmental fate of the gametophytes from gametogenesis to embryogenesis. This is induced by pre-isolation stress treatments followed by postisolation cell or tissue culture treatments. Amenability to the process is highly genotype dependent. In contrast, in vivo haploid induction occurs through natural biological events in seeds, and it is germplasm independent [1]. In vivo methods are wildly used in corn breeding since the discovery and development of the Stock6 haploid inducer line, originally identified by Ed Coe at the University of Missouri and subsequently shared with industrial and academic breeders around the world [2]. In vivo methods are challenging to apply in crops that do not have such native inducer

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7_22, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

365

366

Jian Lv and Timothy Kelliher

mutants. However, in some crops, interspecific wide crosses can effectively induce haploid embryo formation. For example, wheat has an efficient system in which corn pollen is used to stimulate haploid embryogenesis [3]. Haploid embryo formation can also be induced in barley and tobacco by pollen from H. bulbosum and N. africana, respectively [4, 5]. With the recent advent of genome editing technology and the identification of haploid induction genes, more crops may soon have in vivo inducer systems that can be deployed in routine breeding operation. However, having a haploid inducer line is only one step toward an efficient DH system. The efficiency of haploid induction rate and the ability to efficiently induce doubling are additional factors to consider for an efficient DH system. In principle, lab manipulation is not required, but in practice, additional intervention may contribute toward an efficient in vivo DH operational pipeline. Such interventions may include embryo rescue and induced chromosome doubling of the resulting offspring or injection of doubling agents or hormones into inflorescences to promote haploid seed maturation and genome doubling. In vivo haploid induction includes both maternal haploid induction and paternal haploid induction pathways. In this chapter, we will review the respective histories of these two different approaches and discuss how to optimize current methods for future haploid inducer development.

2

Maternal Haploid Inducers in Corn If a haploid inducer is used as the pollen donor to induce female haploids, the process is referred to as maternal haploid induction (because maternal haploids are induced). In 1948, Chase investigated 38,684 seedlings collected from different treatments with various monoploid stimulators and obtained 43 monoploids (haploids) [6]. Haploid induction rate (HIR) varied among different stimulators, from 0.013% to 0.688%. Chase also applied a dominant gene for purple plumule, Pu, which indicated haploids induced were maternal with genomes from female parents. This study opened the journey to maternal haploid induction system development. In 1959, Professor Ed Coe identified the Stock 6 line and observed a 2.29% maternal HIR [2], with the HIR of selfpollinated plants reaching 1.27%. Lasherme tested nine F1 hybrids using Stock 6 as pollen donor; and the HIR was similar to that of the self-pollinated Stock 6 [7], which further established that haploid induction was induced by the pollen of Stock 6. WS14 was developed from the cross W23 × Stock 6 and found to have a 1.2–5.5× higher HIR than Stock 6, indicating that it was possible to breed for higher HIR. This was further demonstrated by additional inducer breeding efforts (Table 1). Based on studies of their genetic diversity, haploid inducers can be grouped into six groups:

Engineering of In Vivo Haploid Induction Systems

367

Table 1 Temperate corn haploid inducers Haploid inducer line

Year Cross

HIR

Reference

WS14

1988 W23 × Stock 6

3–5%

[7]

ZMS (Zarodyshevy Marker Saratovsky)

1994 ZM × Stock 6

0.55–3.43% [65]

KMS (Korichnevy Marker Saratovsky)

1994 Brown-marker × Stock 6

0.16–6.30% [8]

KEMS (Korichnevy Embryo Marker Synthetic)

1994 KMS × ZMS

1.9–13.1%

[66]

CAUHO1

2000 Stock 6 × BHO

5–6%

[8]

MHI (Moldovian Haploid Inducer)

2002 ZMS × KMS

2.7–8.0%

[67]

RWS (Russian inducer KEMS + WS14)

2005 KEMS × WS14

1.2–8.3%

[68]

PK6

2008 Synthetic of Stock 6, WS14, FIGH1, and MS1334

3–6%

[69]

UH400

2009 KEMS derived

4–10%

[69]

CAU5

2013 CAUHOI × UH400

10.9%

[70]

Stock 6 direct progenies, high-oil inducers, RWS/MHI direct progenies, UH400 and related inducers, CAUHOI and direct progenies, and tropical inducers [8]. CIMMYT developed several tropical haploid induction lines including TAIL5, TAIL7, and TAIL9, with 5–11% HIR [9]. The temperate haploid inducers UH400 and RWS were successfully employed for haploid induction and DH line development in tropical and subtropical germplasms. In Syngenta, a temperate haploid inducer is used to induce haploids in tropical germplasms, with 8–9% HIR (Fig. 1). Via continuous improvement, the haploid induction capability may be increased to above 20% HIR before further gains are offset by loss of seed set.

3

The Journey to Develop Maternal Haploid Induction System Corn maternal haploid inducers provide the possibility to explore maternal haploid genes via traditional forward genetic strategy. The journey starts when scientists proved haploid induction was controlled by nuclear genome. With multiple rounds of mapping, maternal haploid genes are explored and verified via genome editing; within the process, the experience of genome editing also paves a way to extend corn knowledge to other crops.

368

Jian Lv and Timothy Kelliher

Fig. 1 Tropical haploids induced by temperate haploid inducer 3.1 Maternal Haploid Genes

In 1988, Lasherme and Beckert tested the haploid induction capability of nine F1s derived from Stock 6 and indicated that haploidyinducing ability was not reliant on the cytoplasm source of Stock 6 [7]. The correlation coefficient between F2 and F3 generations of MS 1334 × Stock 6 and W23 × Stock 6 indicated that haploid induction was a heritable trait controlled by nuclear gene(s). In 1997, Deimling et al. studied progenies from W23 × Stock 6 and identified one major haploid induction quantitative trait locus (QTL) in chromosome 1 and one minor QTL in chromosome 2, which together explained 17.9% of the phenotypic variation in HIR [10]. Later in 2012, from the CAUHOI × UH400 population, five maternal haploid induction QTLs were detected on chromosomes 1, 3, 4, 5, and 9, which together explain 71% genetic variance; qhir8 on chromosome 9 and qhir1 on chromosome 1 were the two major QTLs [11]. Dong et al. checked a F2 population of 14,375 plants derived from a cross between UH400 and 1680 and narrowed down the qhir1 locus to a 243 Kb region; qhir1 explained 66% of the genotypic variance in this population [12]. Since 2006, Syngenta used RWK as a haploid-inducing donor to map the haploid inducer QTL [13]. After several rounds of fine mapping,

Engineering of In Vivo Haploid Induction Systems

369

a ~0.57 Mb region overlapping qhir1 was narrowed to an interval containing seven genes. Compared to the near-isogenic non-inducer RWK-NIL, both RWK and Stock 6 lacked one of the genes, a PHOSPHOGLYCERATE MUTASE (PGM, GRMZM2G062320), and had a 4 bp insertion in a patatin-like phospholipase (GRMZM2G471240). Using transcription activator-like effector nuclease (TALEN) technology, biallelic and homozygous frameshift mutations in the phospholipase gene led to 3.98–12.50% out-cross HIR using the tester female NP2222. In B73, the same gene (ZmPLA1) was knocked out in the first exon [14], resulting in an HIR of 1.85–3.51%. Laurine et al. also mapped the same gene named as NOT LIKE DAD (NLD) from a population derived from haploid inducer line PK6 and non-inducer line DH99 [15]. After qhir1(ZmMATL/ZmPLA1/ZmNLD), qhir8 is the second largest QTL for maternal haploid induction in corn, which explains 20% of the genotypic variance. Via screening 3989 F2 plants from the cross of inducers CAUHOI and UH400, the qhir8 locus was fine mapped to a region of 789 Kb [16]. In 2019, a putative causal gene in qhir8 locus was identified and named ZmDMP (GRMZM2G465053, a DUF679 domain membrane protein) [17]. One SNP between CAU5 (10.9% HIR) and CAUHOI (5–6% HIR) in ZmDMP, resulting in an amino acid substitution from methionine to threonine, has been hypothesized to be responsible for the increased HIR when qhir8 is combined with qhir1. Knockout mutant of ZmDMP generated by CRISPR-Cas9 induced haploids with a rate of 0.1–0.3%, while in the presence of Zmmatl/Zmpla1/Zmnld, maternal HIR is increased by two to six times. Progress in cloning the inducer genes has led to explorative studies on the haploid induction mechanism. ZmMATL/ ZmPLA1/ZmNLD encodes a patatin-like phospholipase A protein which is expressed specifically in the vegetative cell of pollen grains, on the endomembrane surrounding the sperm cells. This endomembrane is part of the “male germ unit,” and defects in membrane structure or its function, or in sperm-female gamete (egg/central cell) signaling, could lead to haploid induction. Beyond phospholipase A, phospholipases C (PLC) and D (PLD) are also involved in membrane dynamics and lipid metabolism, and here reverse genetic strategies have proven fruitful. ZmPLD3 knockout triggered 0.85–0.96% HIR [18]; stacking with Zmmatl/Zmpla1/Zmnld increased it to 4%. There was no synergistic effect between zmpld3 and dmp based on HIR check of the double mutant. Triple mutant of pld3/matl/dmp achieves highest haploid induction rate, up to 7.2% in average, but the seed set is low. Single nucleus sequencing revealed high-frequency sperm DNA fragmentation in Zmmatl/Zmpla1/Zmnld haploid inducers [19], which indicates another hypothesis for maternal haploid

370

Jian Lv and Timothy Kelliher

induction. ROS (reactive oxygen species) usually can lead to DNA fragmentation and trigger DNA repair pathways. To mimic ROS burst, methimazole (MMI, a peroxidase inhibitor) and phosphatidylcholine (PC, inducer of ROS) were used to treat pollen, and haploid seedlings were observed after pollination with treated pollen [20]. Three peroxidases, ZmPOD65, ZmPOD60-1, and ZmPOD60-2, were expressed highly at triple nucleus stage. In-frame shift of ZmPOD65 in heterozygous led to ~1% haploid induction rate, and M73L point mutation in a heterozygous state led to a 7.7% HIR [20]. Knockout of ZmPOD60-1 and ZmPOD602 didn’t induce haploids. 3.2 Genome Editing of Haploid Inducer Orthologs in Other Crops

The discovery of haploid inducer genes in corn has triggered a plethora of genome editing efforts in related crops. The pollenspecific ZmMATL/ZmPLA1/ZmNLD phospholipase is conserved in Poaceae. For example, in rice, there are 16 patatin-like phospholipase genes, but only OspPLAIIφ/OsMATL (Os03g27610) was selected to develop maternal haploid inducers, based on high similarity to ZmMATL/ZmPLA1/ZmNLD in amino acid sequence and expression pattern [21]. Knockout of OsMATL led to a self-haploid induction rate of 6% and outcrossing HIR of 1.8% and 4.6% in two female testers. Knockout of the wheat A and D genome orthologs of ZmMATL/ZmPLA1/ZmNLD (TraesCS4A02G018100 and TraesCS4D02G284700) triggered 5.9–15.7% HIR, and outcrossing HIR was about 10% [22]. Combining these with a knockout of the B genome gene (TraesCS4B02G286000) further boosted the HIR to 31.6% [23]. The foxtail millet (Setaria italica) ortholog SiMATL (Seita.9G376800) knockout produced an HIR of 2.8% [24]. Outside of grasses, there are multiple patatin-like phospholipase homologs; but it is not clear which can trigger haploid induction as there are no specific ZmMATL/ZmPLA1/ ZmNLD orthologs. Unlike ZmMATL/ZmPLA1/ZmNLD, DMP is conserved in monocot and dicot species. There are ten DMP-like genes in Arabidopsis; AtDMP8 (AT1G09157) and AtDMP9 (AT5G39650) are the most promising orthologs based on protein identity comparison to ZmDMP [25], and they are specifically expressed in pollen and sperm. Single-gene knockouts did not induce haploids among hundreds of selfed progenies, but the double mutant dmp8dmp9 led to 3.6% HIR by selfing and 0.9–4.4% by outcrossing. In M. truncatula, MtDMP8 (Medtr7g010890) and MtDMP9 (Medtr5g044580) double mutants had a 0.29–0.82% HIR [26]. Knockout of the tomato SlDMP (Solyc05g007920) gene (expressed highly in pollen and flower buds) produced 1 haploid out of 55 selfed progenies [27]. During outcross, HIR of homozygous mutants ranged from 0.2% to 2.6%. Interestingly, when Sldmp is in heterozygous, haploids can be obtained at a rate from 0.1% to 0.4%. Zmmatl/Zmpla1/Zmnld maize male inducers have been

Engineering of In Vivo Haploid Induction Systems

371

known to trigger different haploid induction rates when crossing to different females. Likewise, in Sldmp, the HIR ranged from 0.5% to 3.7% in testcrosses to 36 different female genotypes. In allotetraploid Nicotiana tabacum, NtDMP1, NtDMP2, and NtDMP3 were identified using AtDMP8 and AtDMP9 as query and share 57.38%, 56.56%, and 54.10% identity with AtDMP8 protein, respectively [28]. All NtDMPs were highly expressed in 0.5 cm anther (binucleate pollen grain stage), but their expression in other tissues was at much lower level. In ovaries, NtDMPs expression increased after pollination, reaching a maximum at 72 h after artificial pollination. Simultaneous knockout of NtDMP1, NtDMP2, and NtDMP3 triggers haploid induction with 1.5–1.8% maternal HIR. Based on TTC (2,3,5-triphenyltetrazolium chloride) staining, dmp1 dmp2 dmp3 triple mutant pollen had weak viability. In Brassica napus, there are four BnDMP genes: BnDMP1A(BnaA03g55920D), BnDMP1C(BnaC03g03890D), BnDMP2A(BnaA04g09480D), and BnDMP2C(BnaC04g31700D). In the Westar genome, BnDMP1C was lost in its genome; and the remaining three BnDMP genes were knocked out via genome editing. Seed setting rate was significantly reduced in Bndmp triple mutants but not in Bndmp2a mutants, which indicates functional redundancies among the 3 BnDMP genes [29]. In Bn-T0-7, Bndmp1a and Bndmp2a had homozygous loss-of-function mutations, and one allele of Bndmp2c was knocked out, and another allele had in-frame deletion; the self HIR was 1.03%. When all three BnDMP genes were completely knocked out, the self HIR was increased to 4.44% in Bn-T1-1 genotype. When it was crossed with two female testers, the HIR ranged from 1.10% to 3.86%. So far, there are four types of maternal haploid-inducing genes explored, most of which rely on loss of function to induce haploids (Table 2). The application of genome editing technology has greatly simplified the extension of haploid induction into other crops, especially for the case of DMP. Since the elucidation of the role of ZmDMP in haploid induction in 2019, maternal haploid inducers were developed in five dicot crops already. ZmPLD3 was identified in 2021; extension of this gene via genome editing hasn’t been verified. Based on phylogenetic analysis, OsPLDα2, AtPLDα1, and AtPLDα2 are the most promising candidates for genome editing [18]. Differently, M73L change in ZmPOD65 triggers 7.7% maternal HIR in corn. Based on ortholog analysis, there are three orthologs in rice (OsPOD65-1/2/3) and three homeologs in wheat (TaPOD65-A/B/D). Prime editing or base editing can be considered to extend ZmPOD65 knowledge to rice and wheat.

372

Jian Lv and Timothy Kelliher

Table 2 Genome editing applications for maternal haploid inducer line development Species

Maternal haploid induction gene Function

Monocot Corn

Rice

Wheat

Dicot

ZmMATL/ ZmPLA1/ ZmNLD

DMP

ZmPOD65

Phospholipase A Domain of unknown function membrane protein

Phospholipase Peroxidase D

ZmMATL/ ZmPLA1/ ZmNLD- KO OsMATL KO

ZmPLD3 KO

ZmDMP-KO

ZmPOD65 BE

OsPLDα2 KOa OsPOD65-1/ 2/3 BE or PEa TaPOD65A/B/D BE or PEa

TaPLA-A/B/D KO

Arabidopsis

AtDMP8/9 KO

Tomato Tobacco Alfalfa Brassica

SlDMP KO NtDMP1/2/3 KO MtDMP8/9 KO BnDMP1A/ BnDMP2A/ BnDMP2C KO GhDMP1/2 KOa GmDMP1/2 KOa CsDMP KOa CaDMP KOa

Cotton Soybean Cucumber Chili pepper

ZmPLD3

AtPLDα1/ 2 KOa

KO knockout, BE base editing, PE prime editing a Potential genome editing opportunities without data so far

4

The Journey to Develop Paternal Haploid Induction System Unlike the journey to develop maternal haploid induction system, the one for paternal haploid induction system is doomed to flexural. The real breakthrough came from CENH3 study in Arabidopsis via reverse genetic strategy in 2010 [30]. Then in the following decade, similar strategy was tested in many crops but never be well repeated in similar HIR as AtCENH3 modification. The journey is accelerated now by the progresses in genome editing, which enriches reverse genetic tools.

4.1 Paternal Haploid Genes

When haploid inducers are used as females to induce paternal haploids (with male genome but female cytoplasm), it is called paternal haploid induction. The first known gene responsible for paternal haploid induction is from maize: indeterminate gametophyte1 (ZmIG1). A spontaneous mutation in inbred line Wisconsin-

Engineering of In Vivo Haploid Induction Systems

373

23 (W23) was reported in 1969, which had abnormal female gametophyte development [31]: ~50% of seeds from ig1 homozygous plants and 25% from heterozygous plants were aborted or defective. 6% of seeds from ig1 homozygous plants contain supernumerary embryos. When heterozygous IG/ig line was used as a female, 63 paternal haploids were obtained from 9580 progenies; that was an HIR of 0.66%; the HIR was 2.35% for homozygous ig female inducers. In studies to introgress ig1 into 17 different germplasms, it was observed that the line C0220 had a strong HIR during outcrosses [32]. More efforts were employed to increase the paternal haploid induction rate; in 1993, the frequency of haploid induction was shown to be as high as 8% in the Lancaster heterotic group [33]. In 1980, the ig1 locus was mapped to the long arm of chromosome 3 [34], and the causal gene was identified as a LATERAL ORGAN BOUNDARIES (LOB) domain gene with high similarity to the well-studied Arabidopsis gene ASYMMETRIC LEAVES2 (AS2) [35]. Maize ig1 mutants contain extra egg cells, central cells, and polar nuclei within embryo sacs. When three polar nuclei fuse with one sperm nucleus, the endosperm is shrunken. When four polar nuclei or more fuse with one sperm nucleus, it triggers endosperm abortion. The ig1 homozygous mutation usually induced male sterility, but not in the B73 and W22 backgrounds. Homozygous ig1 mutants exhibited ectopic outgrowths of the leaf lamina on the adaxial side of the midrib in maize, via modifying ectopic expression of Kn1, Rs1, Lg3, Lg4a/b, Gn1, and Knox3. In ig1 mutant embryos, knox8 was also greatly reduced in expression. A similar regulatory network was observed in Arabidopsis as2 mutant, though no haploid induction was reported. The mechanism of IG1-based haploid induction remains unclear, but it is likely triggered by improper embryo sac fate acquisition and spontaneous development of supernumerary eggs into embryos. In mitosis and meiosis, centromeres recruit proteins that make up the kinetochore to control faithful segregation of chromosomes into daughter cells. In most eukaryotes, centromere formation and kinetochore stabilization depend on the presence of specialized nucleosomes which are comprised of a centromere-specific histone H3 variant, referred to as centromere protein A (CENP-A, aka CENH3). In Arabidopsis, cenh3-1 loss of function is embryo lethal, but use of a transgene comprising the native CENH3 fused with green fluorescent protein at the N terminus can complement the loss-of-function mutant. Replacing the amino terminal domain of CENH3 with a conventional H3.3 amino terminal tail tagged with GFP (“tailswap”) led to efficient (25–45%) haploid induction via outcrossing as a female to a wildtype Arabidopsis pollen donor. GFP-tailswap can also induce maternal haploids at a lower 4–5% rate, whereas selfing GFP-tailswap doesn’t generate haploids. When Atcenh3-1 is complemented with L. oleraceum CENH3, the

374

Jian Lv and Timothy Kelliher

paternal HIR ranged from 2% to 11%. For B. rapa CENH3 complementing Atcenh3-1, the paternal HIR was 1–2% [36]. The CATD domain (centromere-targeting domain) of AtCENH3, defined by loop 1 and the α2 helix of the histone fold domain, is required for centromere loading of CENH3 protein. Point mutations (e.g., L130F) in CATD impaired CENH3 loading [37] and triggered 4.8% HIR after pollination with WT pollen. Other ethyl methanesulfonate (EMS)-derived point mutations in the conserved histone fold domain (HFD) were introduced in Atcenh3-1 and tested for paternal HIR; 19 out of 27 point mutations induced haploids at frequencies ranging from 1% to 44% [38]. Double amino acid substitutions, such as a combination of P82L and A132T, showed a 6x increase in HIR. In-frame deletion of multiple amino acids before and in the alpha helix also produced paternal haploids ranging from 8.0% to 25.7%. Several CENH3-associated proteins have been modified to generate infrequent haploids. A knockout mutation in AtKNL2 (KINETOCHORE NULL 2, AT5G02520) can induce 10% paternal haploid induction when used as female [39]. KNL2 recruits MIS18 to the centromere, which restricts the deposition of CENH3. The CENPC conserved motif (CENPC-k) in KNL2 is required for centromeric localization [40]. Atknl2 also exhibits varying defects in organ development and has reduced fertility. Centromere protein C (CENPC) encodes a DNA binding protein that has a key role in centromere recognition and maintenance. Beyond interacting with CENH3 nucleosomes, CENPC also interacts with KNL2 [40]. Via mutating tomato CENPC, a mutant 553insH-D554K-N555Y was obtained, which has an additional amino acid histidine inserted before SlCENPC position 544 [41]. When using 553insH-D554K-N555Y as a female, paternal haploids were induced at a frequency of 0.5% (3 out of 564 progenies) and 1.06% (2 out of 188 progenies). The 553insH-D554KN555Y mutation in SlCENH3 also can trigger 0.65% and 1.54% maternal HIR; M556V mutation can also induce maternal haploids at a 0.32–2.13% HIR; no paternal HIR was reported. To summarize, paternal haploid genes come from different sources, such as IG1 from maize, CENH3 from Arabidopsis, and CENPC from tomato, and have been explored using reverse genetics. These genes can also induce maternal haploids in a similar ratio or smaller rate. 4.2 Paternal Haploid Inducer Development via Genome Editing

Orthologs of ZmIG1 are LATERAL ORGAN BOUNDARIES DOMAIN (LBD) proteins belonging to a plant-specific transcription factor family. There are 43 LOB genes in maize, 35 in rice, 43 in Arabidopsis, 57 in Medicago truncatula [42], and 90 in soybean [43]. There are two ZmIG1 orthologs in rice, OsIG1 (Os01g66590) and OsIAL1 (Os05g34450) [35]. OsIG1 is expressed in the primordia of stamens and ovules and at the

Engineering of In Vivo Haploid Induction Systems

375

micropylar end of mature ovaries. Silencing of OsIG1 leads to abnormal floral organs, lower seed setting rate, and extra egg cells in 6–9% embryo sacs. However, haploid induction was not reported in OsIG1 RNAi lines [44]. As RNAi achieves only a partial knockdown, it is possible that knockout of OsIG1 via genome editing may enable haploid induction in rice. Wheat contains three TaIG1 homeologs in the A, B, and D genomes (TraesCS3A01G402300, TraesCS3B01G435700, and TraesCS3D01G397200). Triple knockout loss of function of TaIG1A/B/D failed to induce any paternal haploids out of 228 outcrossed progenies [45]. AtAS2 loss of function hasn’t been reported to trigger haploidy. It is very promising that the high HIR were achieved with CENH3 tailswap and point mutations in Arabidopsis; the journey to extend CENH3-based paternal haploid induction to crops has been anything but straightforward. In corn, the tailswap transgenic design was tested in combination with ZmCenH3 knockdown via RNAi and Mu-insertion lines, but the average maternal and paternal haploid induction rate was only 0.24% and 0.07%, respectively [46]. In-frame deletion also was introduced into tomato SlCENH3 in the alpha-N helix region, but its haploid induction capability was not reported [38]. From a tomato mutant population, a K9E mutation in SlCENH3 was isolated, and 1 paternal haploid was identified out of 564 progenies when crossing with pollen from the MicroTom line. The K9E mutant triggered higher maternal haploid induction at frequencies of 1.16% and 4.38% [41]. OsCENH3 V9M, P16S, and P26L mutants were isolated from EMS mutation pool in Oryza sativa L. ssp. japonica cv. Volano, but less than 1% HIR was found for each allele. Different from point mutations in the C terminus of AtCENH3, amino acid modifications in SlCENH3 and OsCENH3 are in N terminus. The difference may explain higher maternal haploid induction rate compared to that in paternal haploid induction. In cucumber CENH3, a premature stop codon mutation at position 102 was able to induce 1% paternal haploids [47]. A similar loss-of-function mutation in ZmCENH3 in heterozygous status was shown to induce 0.5% maternal haploids and 5% paternal haploids [48]. In wheat, there are two CENH3 genes, TaCENH3α and TaCENH3β; each gene has three homeologs distributed into A, B, and D genomes [49]. Based on gene expression check, TaCENH3α has higher expression in pollen and ovule. Restored frameshift (RFS) mutation in the N terminal region of TaCENH3α-A was introduced via CRISPR-Cas-mediated genome editing by using cuts directed by two gRNAs. When RFS mutation was in heterozygous status, the paternal haploid induction rate reached 8% in the wheat line [45]. Based on the phylogenetic analysis, a candidate KNL2 gene exists in both maize (NP001145421.1) and soybean (XP003534700.1). There are two OsKNL2 candidates in rice, OsKNL2a (IGEEC70806.1) and OsKNL2b (IGEEC77053.1)

376

Jian Lv and Timothy Kelliher

Table 3 Genome editing applications for paternal haploid inducer line development Species

Maternal haploid IG1 induction gene Function LOB domain protein

Monocot Corn

Dicot

CENH3

KNL2

Centromere-specific histone

CENPC-k motif CENPC motif protein protein

ZmIG1 KO ZmCENH3 KO

Rice

OsCENH3 KO, RFS, IFD, BE or PEa

Wheat

TaCENH3α RFS

Arabidopsis Tomato

Soybean Cucumber

AtAS2 KOa AtCENH3 IFD, BE (or PE) SlCENH3-IFD, BE (or PE)a

ZmKNL2 KOa

CENPC

ZmCENPC BE or PEa

OsKNL2a and OsKNL2b KOa TaKNL2A/B/D KOa AtKNL2-KO SlCENPCGE, BE (or PE)

GmCENH3-GE KO, GmKNL2-KOa a RFS, IFD, BE (or PE) CsCENH3 KO

KO knockout, BE base editing, PE prime editing, RFS restored frameshift, IFD in-frame deletion a Potential genome editing opportunities without data so far

[50]. TaKNL2A, B, and D in chromosomes 2A, 2B, and 2 all have the canonical CENPC-k motif. Amino acid mutations in SlCENPC empowering haploid induction are conserved in Solanum. Unlike maternal haploid inducers which can be developed by simple knockout via genome editing, paternal haploid induction often requires more diverse and complex modifications, as shown in Table 3.

5

The Needs for Genome Editing Tools CRISPR (clustered regularly interspaced short palindromic repeats)/Cas-mediated genome editing has been widely used in mammalian cells [51] and plants (tobacco [52], Arabidopsis, and rice [53]) to successfully generate knockout alleles, which was enough to enable maternal haploid induction in many crops. But paternal haploid induction may require efficient base editing or prime editing capabilities. In 2016, cytosine base editor (CBE) was developed to convert a C•G base pair into a T•A base pair [42]. In 2017, the first adenine base editor (ABE) tool was shown to convert an A•T base pair into a G•C base pair [54]. Complex edits involving changes in multiple amino acid residues such as the 553insH-D554K-N555Y mutation series in SlCENH3 would

Engineering of In Vivo Haploid Induction Systems

377

require the use of efficient prime editing technology [55] and/or template-dependent homology-directed repair [53]. In 2020, prime editing, the replacement of a small sequence with one encoded in the guide RNA, was proven in wheat and rice [56]. Saturated targeted endogenous mutagenesis editor (STEME) fusing cytidine deaminase with adenosine deaminase was developed [57], and in 2021, a prime-editing-library-mediated saturation mutagenesis (PLSM) method was developed to introduce all 64 types of codons at 6 conserved residues of OsACC1 and led to a total of 16 types of amino acid substitutions [58]. With these progresses in genome editing tools, more haploid inducers can be developed in more diverse crops.

6

Perspectives Haploid inducer systems have been newly developed through genome editing in diverse crops. However, there is still not that much known about the basic biological and reproductive mechanisms of haploid induction. There are several pain points that require more investment to uncover these mechanisms and to enable efficient deployment of the novel haploid induction systems in plant breeding pipeline. One of them is low haploid induction rate. Knocking out ZmMATL/ZmPLA1/ZmNLD in maize led to maternal HIR ranging from 3.5% to 12.5%, but there was a side effect of lowered seed set and kernel abortion [13]. Likewise, Osmatl knockout triggers a 4.6% HIR [21], but there was only 20% of normal seed set. There are several studies extending DMP haploid induction capability to dicots. Atdmp8/9 double mutant can introduce 0.9–4.4% maternal haploid induction [25]; in Medicago, Mtdmp8/9 double mutant triggered 0.82% HIR maximally [26]. One reason for the low haploid induction rate is that the trait is controlled by multiple genes: combinations of Zmdmp mutation with Zmmatl/Zmpla1/ Zmnld mutation can increase haploid induction by 2–3× [17]. This is consistent with the genetic analysis of maize haploid induction since ZmMATL/ZmPLA1/ZmNLD and ZmDMP are two major QTLs in corn controlling maternal haploid induction. However, ZmMATL/ZmPLA1/ZmNLD is only functionally conserved in Poaceae. A recent reverse genetic study on a PHOSPHOLIPASE D gene (ZmPLD3) may pave a possible way of resolving the challenge of extending maternal haploid induction to dicots. ZmPLD3 was identified due to annotation as a phospholipase and high expression in pollen [18]. Zmpld3 triple haploid induction from 1.19% to 4.13% in the presence of the Zmmatl/Zmpla1/Zmnld phospholipase 2A mutant and combination of Zmdmp can further increase the HIR, despite a negative impact on seed set. Zmpld3/ Zmdmp has a similar HIR as the Zmpld3 single mutant. The success

378

Jian Lv and Timothy Kelliher

of this reverse genetic approach suggests that a similar path of modifying pollen-expressed lipases in dicots, and potentially combining that with dmp mutations, could enable high maternal induction rates. In contrast to maternal haploid induction, the combination of different paternal haploid induction genes is not as clear. Based on typical trilaminar structure of the kinetochore, the CENH3 protein binds centromeric DNA and forms part of the inner centromere. CENPC is part of the inner kinetochore, and KNL2 forms part of the outer kinetochore which attaches to the mitotic spindle [59]. As such, combination of modifications of KNL2, CENPC, and CENH3 should be a reasonable strategy to increase paternal HIR. Recently, the combination of tail-altered CENH3 (paternal haploid induction) and ZmMATL/ZmPLA1/ZmNLD (maternal haploid induction) mutated Stock 6-derived lines resulted in maternal HIR of 16.3% (6.1% more than the Stock 6-derived lines) [60]. This approach paves a new way to boost HIR further. When the Sldmp mutant was crossed with tens of female parents, the HIR ranged from 0.49% to 3.68% [27]. Difference between highest and lowest HIR was 7.5×, suggesting that the female germplasm genetic background greatly influences the haploid induction rate. Similar donor genetic background effect was also observed for Zmmatl/Zmpla1/Zmnld mutant: when crossing with pollen from CAU5 inducer, Zheng58 had a high HIR of 11.55%, and Chang7-2 was 5.60% [61]. One 186 F2:3 lines derived from a cross between Zheng58 and Chang7-2 were tested with the inducer line CAU5 and two QTLs were identified, qmhir1 (chromosome 1) and qmhir2 (chromosome 3). qmhir1 explained 14.70% of the phenotypic variation; qmhir2 explained 8.42%. Causal genes from the two QTLs may be incorporated into maternal haploid inducers to potentially alleviate female impact on low HIR. For paternal haploid genes, HIR has not exceeded 10% except in Arabidopsis studies. Another aspect for improvement is the seed set which is a major limitation to the number of haploids that can be produced in a given cross. The seed setting rate of Osmatl mutants is around 20%, while controls are 70–80% [21]. During outcrossing, a strong correlation (r = 0.8) between haploid induction and seed death was observed [38]. In paternal haploid inducers, the mutations that disrupt maternal DNA stability may also negatively impact female gametophyte development: indeed, the alleles of CENH3 that give rise to haploids in maize and wheat also result in segregation distortion and lowered seed set. TaCENH3α-A RFS in heterozygous state also reduced seed setting by 50% during selfing [45]. However, some mutants in AtCENH3, such as G83E mutant, can ensure 64% seed setting rate and 12.2% HIR. Saturation mutations via genome editing could be a tool to identify the best balance between haploid induction and seed set on a single

Engineering of In Vivo Haploid Induction Systems

379

gene level. When combining different haploid induction genes, a high-throughput method of checking seed set and haploid induction rate is really needed. Genome editing technology has opened the door to a new era of accelerated plant breeding by the identification of in vivo haploid induction genes and deployment of novel haploid inducers across different plant species. Even though there are still major challenges ahead, there have been a lot of success stories already in the last few years. In 2014, cytoplasmic swapping was achieved in Arabidopsis based on the tailswap design of AtCENH3 [62]. Cytoplasmic swapping is the basis of a novel breeding technology used for new cytoplasmic male sterility (CMS) female line conversions. Recently, based on CENH3 modifications via genome editing, cytoplasmic swapping was also achieved in wheat [45] and corn [48]. In vivo haploid induction also can be used to deliver genome edits into diverse commercial germplasm, utilizing Haploid InductionEditing (HI-EDIT™)/haploid Inducer-Mediated Genome Editing (IMGE) technology [63, 64]. Genome editing components are introduced into transformable haploid inducer lines, which can generate edited haploids (then edited DH plants after doubling). In this process, no transgenic components are inherited into the edited DH materials, and edits are made homozygous in the process. This method is a novel way to bypass elite line transformation and eliminate the lengthy trait introgression timeline for genome edited traits. With that, in vivo haploid induction and genome editing work together to contribute toward food security worldwide. References 1. Jacquier NMA, Gilles LM, Martinant JP, Rogowsky PM, Widiez T (2021) Maize in planta haploid inducer lines: a cornerstone for doubled haploid technology. Methods Mol Biol 2288:25–48. https://doi.org/10.1007/ 978-1-0716-1335-1_2 2. Coe EH (1959) A line of maize with high haploid frequency. Am Nat 93(873):381–382 3. Sun G, Geng S, Zhang H, Jia M, Wang Z, Deng Z, Tao S, Liao R, Wang F, Kong X, Fu M, Liu S, Li A, Mao L (2022) Matrilineal empowers wheat pollen with haploid induction potency by triggering postmitosis reactive oxygen species activity. New Phytol 233(6): 2405–2414. https://doi.org/10.1111/nph. 17963 4. Subrahmanyam N, Bothmer RV (1987) Interspecific hybridization with Hordeum bulbosum and development of hybrids and haploids. Hereditas 106(1):119–127

5. Burk L, Gerstel D, Wernsman E (1979) Maternal haploids of Nicotiana tabacum L. from seed. Science 206(4418):585–585 6. Chase SS (1949) Monoploid frequencies in a commercial double cross hybrid maize, and in its component single cross hybrids and inbred lines. Genetics 34(3):328–332. https://doi. org/10.1093/genetics/34.3.328 7. Lashermes P, Beckert M (1988) Genetic control of maternal haploidy in maize (Zea mays L.) and selection of haploid inducing lines. Theor Appl Genet 76(3):405–410. https:// doi.org/10.1007/BF00265341 8. Hu H, Schrag TA, Peis R, Unterseer S, Schipprack W, Chen S, Lai J, Yan J, Prasanna BM, Nair SK, Chaikam V, Rotarenco V, Shatskaya OA, Zavalishina A, Scholten S, Schon CC, Melchinger AE (2016) The genetic basis of haploid induction in maize identified with a novel genome-wide association method.

380

Jian Lv and Timothy Kelliher

Genetics 202(4):1267–1276. https://doi. org/10.1534/genetics.115.184234 9. Prigge V, Schipprack W, Mahuku G, Atlin GN, Melchinger AE (2012) Development of in vivo haploid inducers for tropical maize breeding programs. Euphytica 185(3):481–490. https://doi.org/10.1007/s10681-0120657-5 10. Deimling S, Ro¨ber FK, Geiger HH (1997) Methodology and genetics of in vivo haploid induction in maize. Pflanzenzu¨chtg 38:203– 224 11. Prigge V, Xu X, Li L, Babu R, Chen S, Atlin GN, Melchinger AE (2012) New insights into the genetics of in vivo induction of maternal haploids, the backbone of doubled haploid technology in maize. Genetics 190(2): 781–793. https://doi.org/10.1534/genetics. 111.133066 12. Dong X, Xu X, Miao J, Li L, Zhang D, Mi X, Liu C, Tian X, Melchinger AE, Chen S (2013) Fine mapping of qhir1 influencing in vivo haploid induction in maize. Theor Appl Genet 126(7):1713–1720. https://doi.org/10. 1007/s00122-013-2086-9 13. Kelliher T, Starr D, Richbourg L, Chintamanani S, Delzer B, Nuccio ML, Green J, Chen Z, McCuiston J, Wang W, Liebler T, Bullock P, Martin B (2017) MATRILINEAL, a sperm-specific phospholipase, triggers maize haploid induction. Nature 542(7639):105–109. https://doi.org/10. 1038/nature20827 14. Liu C, Li X, Meng D, Zhong Y, Chen C, Dong X, Xu X, Chen B, Li W, Li L, Tian X, Zhao H, Song W, Luo H, Zhang Q, Lai J, Jin W, Yan J, Chen S (2017) A 4-bp insertion at ZmPLA1 encoding a putative phospholipase a generates haploid induction in maize. Mol Plant 10(3):520–522. https://doi.org/10. 1016/j.molp.2017.01.011 15. Gilles LM, Khaled A, Laffaire JB, Chaignon S, Gendrot G, Laplaige J, Berges H, Beydon G, Bayle V, Barret P, Comadran J, Martinant JP, Rogowsky PM, Widiez T (2017) Loss of pollen-specific phospholipase NOT LIKE DAD triggers gynogenesis in maize. EMBO J 36(6):707–717. https://doi.org/10.15252/ embj.201796603 16. Liu C, Li W, Zhong Y, Dong X, Hu H, Tian X, Wang L, Chen B, Chen C, Melchinger AE, Chen S (2015) Fine mapping of qhir8 affecting in vivo haploid induction in maize. Theor Appl Genet 128(12):2507–2515. https://doi.org/ 10.1007/s00122-015-2605-y 17. Zhong Y, Liu C, Qi X, Jiao Y, Wang D, Wang Y, Liu Z, Chen C, Chen B, Tian X, Li J, Chen M, Dong X, Xu X, Li L, Li W,

Liu W, Jin W, Lai J, Chen S (2019) Mutation of ZmDMP enhances haploid induction in maize. Nat Plants 5(6):575–580. https://doi. org/10.1038/s41477-019-0443-7 18. Li Y, Lin Z, Yue Y, Zhao H, Fei X, Lizhu E, Liu C, Chen S, Lai J, Song W (2021) Loss-offunction alleles of ZmPLD3 cause haploid induction in maize. Nat Plants 7(12): 1579–1588. https://doi.org/10.1038/ s41477-021-01037-2 19. Li X, Meng D, Chen S, Luo H, Zhang Q, Jin W, Yan J (2017) Single nucleus sequencing reveals spermatid chromosome fragmentation as a possible cause of maize haploid induction. Nat Commun 8(1):991. https://doi.org/10. 1038/s41467-017-00969-8 20. Jiang C, Sun J, Li R, Yan S, Chen W, Guo L, Qin G, Wang P, Luo C, Huang W, Zhang Q, Fernie AR, Jackson D, Li X, Yan J (2022) A reactive oxygen species burst causes haploid induction in maize. Mol Plant 15:943. https://doi.org/10.1016/j.molp.2022. 04.001 21. Yao L, Zhang Y, Liu C, Liu Y, Wang Y, Liang D, Liu J, Sahoo G, Kelliher T (2018) OsMATL mutation induces haploid seed formation in indica rice. Nat Plants 4(8): 530–533. https://doi.org/10.1038/s41477018-0193-y 22. Liu C, Zhong Y, Qi X, Chen M, Liu Z, Chen C, Tian X, Li J, Jiao Y, Wang D, Wang Y, Li M, Xin M, Liu W, Jin W, Chen S (2020) Extension of the in vivo haploid induction system from diploid maize to hexaploid wheat. Plant Biotechnol J 18(2):316–318. https://doi.org/10.1111/pbi.13218 23. Liu H, Wang K, Jia Z, Gong Q, Lin Z, Du L, Pei X, Ye X (2020) Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system. J Exp Bot 71(4):1337–1349. https://doi.org/10.1093/jxb/erz529 24. Cheng Z, Sun Y, Yang S, Zhi H, Yin T, Ma X, Zhang H, Diao X, Guo Y, Li X, Wu C, Sui Y (2021) Establishing in planta haploid inducer line by edited SiMTL in foxtail millet (Setaria italica). Plant Biotechnol J 19(6):1089–1091. https://doi.org/10.1111/pbi.13584 25. Zhong Y, Chen B, Li M, Wang D, Jiao Y, Qi X, Wang M, Liu Z, Chen C, Wang Y, Chen M, Li J, Xiao Z, Cheng D, Liu W, Boutilier K, Liu C, Chen S (2020) A DMP-triggered in vivo maternal haploid induction system in the dicotyledonous Arabidopsis. Nat Plants 6(5):466–472. https://doi.org/10.1038/ s41477-020-0658-7 26. Wang N, Xia X, Jiang T, Li L, Zhang P, Niu L, Cheng H, Wang K, Lin H (2022) In planta

Engineering of In Vivo Haploid Induction Systems haploid induction by genome editing of DMP in the model legume Medicago truncatula. Plant Biotechnol J 20(1):22–24. https://doi. org/10.1111/pbi.13740 27. Zhong Y, Chen B, Wang D, Zhu X, Li M, Zhang J, Chen M, Wang M, Riksen T, Liu J, Qi X, Wang Y, Cheng D, Liu Z, Li J, Chen C, Jiao Y, Liu W, Huang S, Liu C, Boutilier K, Chen S (2022) In vivo maternal haploid induction in tomato. Plant Biotechnol J 20(2): 250–252. https://doi.org/10.1111/pbi. 13755 28. Zhang X, Zhang L, Zhang J, Jia M, Cao L, Yu J, Zhao D (2022) Haploid induction in allotetraploid tobacco using DMPs mutation. Planta 255(5):98. https://doi.org/10.1007/ s00425-022-03877-4 29. Zhong Y, Wang Y, Chen B, Liu J, Wang D, Li M, Qi X, Liu C, Boutilier K, Chen S (2022) Establishment of a dmp based maternal haploid induction system for polyploid Brassica napus and Nicotiana tabacum. J Integr Plant Biol 64: 1281. https://doi.org/10.1111/jipb.13244 30. Ravi M, Chan SW (2010) Haploid plants produced by centromere-mediated genome elimination. Nature 464(7288):615–618. https:// doi.org/10.1038/nature08842 31. Kermicle JL (1969) Androgenesis conditioned by a mutation in maize. Science 166(3911): 1422–1424 32. Pollacsek M (1992) Management of the ig gene for haploid induction in maize. Agronomie 12(3):247–251 33. Kindiger B, Hamann S (1993) Generation of haploids in maize: a modification of the indeterminate gametophyte (ig) system. Crop Sci 33(2):342–344 34. Kermicle JL, Demopoulos-Rodriguez JD (1980) Location of indeterminate gametophyte (ig) on chromosome 3. Maize Genet Coop Newslett 54:84–85 35. Evans MM (2007) The indeterminate gametophyte1 gene of maize encodes a LOB domain protein required for embryo Sac and leaf development. Plant Cell 19(1):46–62. https://doi. org/10.1105/tpc.106.047506 36. Maheshwari S, Tan EH, West A, Franklin FC, Comai L, Chan SW (2015) Naturally occurring differences in CENH3 affect chromosome segregation in zygotic mitosis of hybrids. PLoS Genet 11(1):e1004970. https://doi.org/10. 1371/journal.pgen.1004970 37. Karimi-Ashtiyani R, Ishii T, Niessen M, Stein N, Heckmann S, Gurushidze M, BanaeiMoghaddam AM, Fuchs J, Schubert V, Koch K, Weiss O, Demidov D, Schmidt K, Kumlehn J, Houben A (2015) Point mutation

381

impairs centromeric CENH3 loading and induces haploid plants. Proc Natl Acad Sci U S A 112(36):11211–11216. https://doi.org/ 10.1073/pnas.1504333112 38. Kuppu S, Ron M, Marimuthu MPA, Li G, Huddleson A, Siddeek MH, Terry J, Buchner R, Shabek N, Comai L, Britt AB (2020) A variety of changes, including CRISPR/Cas9-mediated deletions, in CENH3 lead to haploid induction on outcrossing. Plant Biotechnol J 18:2068. https:// doi.org/10.1111/pbi.13365 39. Lermontova I (2019) Generation of haploid plants based on knl2 40. Sandmann M, Talbert P, Demidov D, Kuhlmann M, Rutten T, Conrad U, Lermontova I (2017) Targeting of Arabidopsis KNL2 to centromeres depends on the conserved CENPC-k motif in its C terminus. Plant Cell 29(1):144–155. https://doi.org/10.1105/ tpc.16.00720 41. Den Camp RHMO, Van Dijk PJ, Gallard A (2017) Method for the production of haploid and subsequent doubled haploid plants 42. Yang T, Fang GY, He H, Chen J (2016) Genome-wide identification, evolutionary analysis and expression profiles of LATERAL ORGAN BOUNDARIES DOMAIN gene family in Lotus japonicus and Medicago truncatula. PLoS One 11(8):e0161901. https:// doi.org/10.1371/journal.pone.0161901 43. Yang H, Shi G, Du H, Wang H, Zhang Z, Hu D, Wang J, Huang F, Yu D (2017) Genome-wide analysis of soybean LATERAL ORGAN BOUNDARIES domain-containing genes: a functional investigation of GmLBD12. Plant Genome 10(1). https:// doi.org/10.3835/plantgenome2016.07. 0058 44. Zhang J, Tang W, Huang Y, Niu X, Zhao Y, Han Y, Liu Y (2015) Down-regulation of a LBD-like gene, OsIG1, leads to occurrence of unusual double ovules and developmental abnormalities of various floral organs and megagametophyte in rice. J Exp Bot 66(1): 99–112. https://doi.org/10.1093/jxb/ eru396 45. Lv J, Yu K, Wei J, Gui H, Liu C, Liang D, Wang Y, Zhou H, Carlin R, Rich R, Lu T, Que Q, Wang WC, Zhang X, Kelliher T (2020) Generation of paternal haploids in wheat by genome editing of the centromeric histone CENH3. Nat Biotechnol 38(12): 1397–1401. https://doi.org/10.1038/ s41587-020-0728-4 46. Kelliher T, Starr D, Wang W, McCuiston J, Zhong H, Nuccio ML, Martin B (2016) Maternal haploids are preferentially induced

382

Jian Lv and Timothy Kelliher

by CENH3-tailswap transgenic complementation in maize. Front Plant Sci 7:414. https:// doi.org/10.3389/fpls.2016.00414 47. Van Dun CMP, Lelivelt CLC, Movahedi S (2018) Non-transgenic haploid inducer lines in cucurbits 48. Wang N, Gent JI, Dawe RK (2021) Haploid induction by a maize cenh3 null mutant. Sci Adv 7(4). https://doi.org/10.1126/sciadv. abe2299 49. Yuan J, Guo X, Hu J, Lv Z, Han F (2015) Characterization of two CENH3 genes and their roles in wheat evolution. New Phytol 206(2):839–851. https://doi.org/10.1111/ nph.13235 50. Lermontova I, Kuhlmann M, Friedel S, Rutten T, Heckmann S, Sandmann M, Demidov D, Schubert V, Schubert I (2013) Arabidopsis kinetochore null2 is an upstream component for centromeric histone H3 variant cenH3 deposition at centromeres. Plant Cell 25(9):3389–3404. https://doi.org/10.1105/ tpc.113.114736 51. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819–823. https://doi.org/10. 1126/science.1231143 52. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S (2013) Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol 31(8):691–693. https://doi.org/10. 1038/nbt.2655 53. Mao Y, Zhang H, Xu N, Zhang B, Gou F, Zhu JK (2013) Application of the CRISPR-Cas system for efficient genome engineering in plants. Mol Plant 6(6):2008–2011. https://doi.org/ 10.1093/mp/sst121 54. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR (2017) Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551(7681):464–471. https://doi.org/10. 1038/nature24644 55. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR (2019) Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576(7785):149–157. https://doi.org/10. 1038/s41586-019-1711-4 56. Lin Q, Zong Y, Xue C, Wang S, Jin S, Zhu Z, Wang Y, Anzalone AV, Raguram A, Doman JL, Liu DR, Gao C (2020) Prime genome editing in rice and wheat. Nat Biotechnol 38(5):

582–585. https://doi.org/10.1038/s41587020-0455-x 57. Li C, Zhang R, Meng X, Chen S, Zong Y, Lu C, Qiu JL, Chen YH, Li J, Gao C (2020) Targeted, random mutagenesis of plant genes with dual cytosine and adenine base editors. Nat Biotechnol 38(7):875–882. https://doi. org/10.1038/s41587-019-0393-7 58. Xu R, Liu X, Li J, Qin R, Wei P (2021) Identification of herbicide resistance OsACC1 mutations via in planta prime-editing-library screening in rice. Nat Plants 7(7):888–892. https://doi.org/10.1038/s41477-02100942-w 59. Perpelescu M, Fukagawa T (2011) The ABCs of CENPs. Chromosoma 120(5):425–446. https://doi.org/10.1007/s00412-0110330-0 60. Meng D, Luo H, Dong Z, Huang W, Liu F, Li F, Chen S, Yu H, Jin W (2022) Overexpression of modified CENH3 in maize Stock6derived inducer lines can effectively improve maternal haploid induction rates. Front Plant Sci 13:892055. https://doi.org/10.3389/ fpls.2022.892055 61. Wu P, Li H, Ren J, Chen S (2014) Mapping of maternal QTLs for in vivo haploid induction rate in maize (Zea mays L.). Euphytica 196(3): 413–421 62. Ravi M, Marimuthu MP, Tan EH, Maheshwari S, Henry IM, Marin-Rodriguez B, Urtecho G, Tan J, Thornhill K, Zhu F, Panoli A, Sundaresan V, Britt AB, Comai L, Chan SW (2014) A haploid genetics toolbox for Arabidopsis thaliana. Nat Commun 5: 5 3 3 4 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / ncomms6334 63. Kelliher T, Starr D, Su X, Tang G, Chen Z, Carter J, Wittich PE, Dong S, Green J, Burch E, McCuiston J, Gu W, Sun Y, Strebe T, Roberts J, Bate NJ, Que Q (2019) One-step genome editing of elite crop germplasm during haploid induction. Nat Biotechnol 37(3):287–292. https://doi.org/10. 1038/s41587-019-0038-x 64. Wang B, Zhu L, Zhao B, Zhao Y, Xie Y, Zheng Z, Li Y, Sun J, Wang H (2019) Development of a haploid-inducer mediated genome editing system for accelerating maize breeding. Mol Plant 12(4):597–602. https://doi.org/ 10.1016/j.molp.2019.03.006 65. Chalyk ST (1994) Properties of maternal haploid maize plants and potential application to maize breeding. Euphytica 79(1):13–18. https://doi.org/10.1007/BF00023571 66. Battistelli GM, Von Pinho RG, Justus A, Couto EG, Balestre M (2013) Production and

Engineering of In Vivo Haploid Induction Systems identification of doubled haploids in tropical maize. Genet Mol Res 12(4):4230–4242. https://doi.org/10.4238/2013.October.7.9 67. Eder J, Chalyk S (2002) In vivo haploid induction in maize. Theor Appl Genet 104(4): 703–708. https://doi.org/10.1007/s00122001-0773-4 68. Ro¨ber FK, Gordillo GA, Geiger HH (2005) In vivo haploid induction in maize – performance of new inducers and significance of doubled haploid lines in hybrid breeding. Maydica 50: 275–283

383

69. Chang M-T, Coe EH (2009) Doubled haploids. In: Kriz AL, Larkins BA (eds) Molecular genetic approaches to maize improvement. Springer Berlin Heidelberg, Berlin, Heidelberg, pp 127–142. https://doi.org/10.1007/ 978-3-540-68922-5_10 70. Xu X, Li L, Dong X, Jin W, Melchinger AE, Chen S (2013) Gametophytic and zygotic selection leads to segregation distortion through in vivo induction of a maternal haploid in maize. J Exp Bot 64(4):1083–1096. https://doi.org/10.1093/jxb/ers393

INDEX A Acetolactate synthase (ALS) marker .............................. 44 Adenine base editors (ABEs).............................. 4, 5, 7, 8, 54, 58, 60, 63, 64, 95, 375 Agrobacterium-mediated transformation .............. 23, 29, 33, 40, 41, 53–68, 112, 116, 173, 298, 334, 335, 343, 347, 348, 350 Agrobacterium tumefaciens...............................27, 28, 33, 43, 118, 176, 179, 223, 224, 238, 241, 255, 274, 277–280, 284, 291, 335, 347, 349, 358 Allele replacement ................................................ 199–204 Ampicillin ......................... 108, 176, 179, 201, 259, 264, 265, 269, 310, 337, 338, 340, 344, 346, 349 Arabidopsis thaliana .........................................63, 81, 96, 117, 221, 344, 345 Automation ................................................................... 131

B Barley .......................................................... 176, 187–196, 199–204, 287–295, 366 Base editing ...............................................4–8, 53–55, 57, 62, 65, 67, 96, 116, 122, 371, 372, 375, 376 6-Benzylaminopurine (6-BAP) .......................... 119, 177, 189, 190, 293, 301 Binary vector ................................. 43, 60, 111–113, 176, 182, 241, 274, 278–281, 284, 334–336, 341, 343–348, 350, 356, 357 Biolistic transformation ............................ 81–85, 90, 194 BLAST-search................................................................ 209 Bombardment ......................................40, 173, 191, 194, 196, 201–204, 298 Brassica napus.............................253, 255, 260, 269, 371 Brassica oleracea .......................................... 253, 255, 260 5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) ................................ 56, 61, 224, 237, 239, 240, 270, 280, 302, 310, 313, 336, 344

C Callus ............................................. 29, 34, 60, 78, 84, 85, 90, 112, 118, 124, 131, 168, 190, 194–196, 223, 224, 244–246, 251, 291, 303, 308, 350, 358 Cas9 endonuclease .....................253, 254, 274, 278, 284 Cas12a endonuclease ........................................... 154, 155

Chlamydomonas reinhardtii....... 207–210, 212–214, 216 Chloroplast engineering .................................... 74, 80, 81 Chloroplasts........................................................ 44, 73–91 Citrus .................................................................... 153–170 Cleaved amplified polymorphic sequences (CAPS) ..................................................... 155, 335, 338, 340, 341, 352, 353, 358 Clustered regularly interspaced short palindromic repeat (CRISPR) ............................ 3, 4, 7, 21–36, 49, 53, 95, 103, 107–113, 116, 153–155, 167, 173–175, 178, 182, 184, 200, 207, 208, 210–214, 216, 221, 222, 253–271, 273, 274, 287–295, 297, 298, 308–310, 334, 340, 341, 343–350, 358, 375 CRISPR associated (Cas)..........................................3, 116 CRISPR-BETS .............................................7, 57, 95–104 CRISPR-Cas systems CRISPR-Cas9..........................................3, 21, 22, 40, 53, 95, 221–252, 369 CRISPR-Cas12a............................................. 153–169 CRISPR-SpRY....................................................... 3–17 CRISPR-Type I-D (TiD) ............... 22–25, 35, 21–36 CRISPR RNA (crRNA) ....................................3, 7, 8, 11, 12, 22–27, 30–32, 34–36, 44, 54, 57, 133, 144, 154–156, 160–164, 167–169, 188, 192, 201, 202, 215, 341 Cytosine base editors (CBEs)................................. 4, 5, 7, 53, 54, 57, 95, 96

D DNA preparation .......................................................... 306 Donor DNA ........................................298, 306, 310, 311 Doubled haploids (DH) ............................. 366, 367, 379

E Electroporation ....................................11, 13, 33, 60, 61, 63, 179, 209, 213, 214, 280, 298, 339, 347 Embryo .......................................... 5, 131, 143, 189–192, 194–196, 223, 245, 251, 288, 291, 366, 367, 373, 375 Embryogenic cell line .......................................... 155, 156 Episomal replication..................................................74, 90 eYGFPuv..............................................115, 116, 123, 124

Bing Yang, Wendy Harwood and Qiudeng Que (eds.), Plant Genome Engineering: Methods and Protocols, Methods in Molecular Biology, vol. 2653, https://doi.org/10.1007/978-1-0716-3131-7, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

385

PLANT GENOME ENGINEERING: METHODS AND PROTOCOLS

386 Index F

K

Fast transformation ......................................................... 46 Fluorescent protein reporters .............................. 115–126

Kanamycin .............................................. 6, 10, 13, 27–29, 33, 36, 42, 56, 60, 64, 91, 108, 118–120, 122–125, 158, 159, 176, 177, 179, 225, 237–243, 266, 270, 278, 291, 337, 338, 343, 346, 347, 349–351 Kinetin .................................................226, 228, 301, 303 Knock-in ............................................................... 208, 309 Knockout .............................................. 95–104, 116, 155, 167, 187, 189, 192, 208, 215, 221–251, 288, 369–372, 374–377

G Gateway assembly.............................................5, 6, 55, 62 Genome editing ............................................ 3–17, 21–36, 39–50, 53, 57, 95, 107, 115–126, 130, 137, 146, 153–169, 173–175, 184, 188, 207, 208, 212, 221, 255, 273, 274, 278, 279, 281, 284, 287–291, 295, 297, 334, 355, 366, 367, 369–379 Genome engineering ............................................. 23, 116 Genotyping........................................ 78, 85, 87, 88, 177, 181, 229, 230, 244, 256, 260, 267, 268, 273, 274, 279, 281, 283, 284, 309 Gibberellin A3 (GA3) ...............43, 76, 78, 277, 337, 338 Golden Gate assembly .....................................61, 62, 178 Green fluorescent protein (GFP) .............. 17, 81, 86, 87, 89, 115, 116, 121–123, 132, 135, 137, 199, 373 Guide RNA (gRNA) ...................................3, 5–8, 10–12, 14, 43, 44, 57, 58, 60, 61, 63, 68, 69, 96, 100–104, 107, 108, 111–113, 116, 135, 154, 156, 187, 188, 192, 193, 200–202, 208–216, 221–224, 255, 256, 270, 271, 274, 288, 289, 291, 293, 336, 346, 347, 375, 377

H Haploid induction................................................ 365–379 Haploid induction mediated genome editing (HI-Edit) ........................................................... 379 HEK293T cell .................................................... 25, 30, 31 High resolution fragment analysis (HRFA) ...............335, 338, 340–342, 353, 354, 356, 358, 359 High throughput (HTP) ........................... 6, 7, 129–147, 180, 224, 288, 379 Homologous recombination (HR)...........................4, 73, 74, 208, 273 Homology-directed repair (HDR) .................4, 154, 377 Hordeum vulgare........................ 187–196, 199–204, 295 Hygromycin............................................6, 40, 56, 57, 65, 66, 118, 119, 291, 293

I ImageJ quantification ................................................... 138 Indole-3-acetic acid (IAA)..................43, 49, 76, 78, 277 Insertion and/or deletion (InDel)...................22, 34, 35, 53, 95, 154, 167, 180, 214, 248, 253, 258, 268, 273, 284, 287, 294, 310 Isocaudomer ................................................ 108, 111, 112 Isopropyl β-D-1-thiogalactopyranoside (IPTG) .......... 56, 61, 156, 159, 166, 224, 237, 239, 240, 270, 280, 302, 310, 336, 344

L LbCas12a nuclease............................................... 158–160 Leaf infiltration........................... 116–118, 120, 122–124 Liquid handler.......... 131, 132, 135, 138, 141, 145, 146 Luria-Bertani (LB) medium ............................... 9, 11, 13, 57, 60, 63, 118, 119, 122, 156, 158, 159, 177, 179, 225, 227, 243, 259, 337, 349

M Maize ............................................... 12, 43, 96, 103, 130, 131, 133–135, 143, 144, 369, 372–375, 377, 378 mCherry fluorescent protein ........................................ 194 Medicago truncatula ...........................221–251, 369, 373 Meganuclease ................................................................ 287 Microcystis aeruginosa ..................................................... 22 Mini-synplastome ......................................................73–91 Multiplex genome editing (MGE)...................... 107–113 Mutagenesis..........................................21, 175, 183, 222, 223, 231, 248, 255–258, 268, 377

N NanoLuc single-strand annealing (SSA) assay.........23–25 Naphthaleneacetic acid (NAA)............................... 56, 76, 78, 118, 277, 301, 303, 337, 338

P Plasmid .......................................... 5, 6, 9–14, 16, 17, 26, 30, 33, 55–58, 60–64, 68, 69, 74, 76, 78, 80–82, 86, 87, 89, 91, 113, 117, 121, 123, 133, 135, 137, 143, 144, 146, 147, 154, 156–159, 174, 176, 178, 179, 182, 183, 193, 203, 208, 222–224, 236, 238, 240–242, 249, 265, 266, 274, 275, 278–280, 284, 288, 289, 291, 293, 298, 299, 311, 335, 340, 343, 344, 346, 357 Plastome ....................................................................73–91 Polyethylene glycol (PEG) ................................... 10, 117, 120, 121, 123, 131, 134, 135, 137, 143, 145, 157, 164, 298, 303, 311 Polymerase chain reaction (PCR) ...................... 7, 15, 16, 34, 36, 55, 56, 61, 65–67, 69, 78, 85–87, 91, 108,

PLANT GENOME ENGINEERING: METHODS 110–113, 129, 133, 138–140, 146, 157, 161, 165, 169, 175, 177, 178, 180, 181, 183, 184, 191, 192, 195, 209–211, 213, 215, 216, 222, 223, 225, 229–231, 236, 237, 239–241, 244, 248–250, 258–260, 263–267, 269, 275, 278, 279, 283, 284, 289, 292–294, 299, 302, 305, 308–310, 318, 320, 322, 324–326, 328, 330, 335, 340, 343, 344, 346, 347, 350, 352, 354, 356, 357, 359 Poplar.................... 53–69, 117, 118, 120, 123, 124, 154 Potato .....................................73–91, 130, 154, 334–359 Primer ..........................................8, 9, 11, 15, 36, 49, 58, 59, 61, 63, 65, 67, 69, 78, 87, 108–113, 138, 140, 156, 159, 165, 169, 176, 177, 180, 181, 184, 191, 208, 210, 212, 214–216, 223, 235–241, 244, 248–250, 255, 260, 261, 263, 265, 267, 283, 284, 289, 291–293, 305, 308, 309, 312, 313, 317–319, 321–330, 335, 336, 338–342, 344, 346, 347, 350, 352, 354, 355, 358 Protoplast ............................................. 6, 7, 9–11, 14–17, 40, 41, 120, 121, 123, 130, 131, 134–137, 140–147, 155, 161–165, 168, 169, 298, 299, 303, 304, 306–312, 334, 335, 348 regeneration.................................................... 297–313 transfection ...................................129–147, 161, 169, 303, 307, 308, 311, 343, 346–348 transformation ........... 11, 14–17, 116, 117, 119–121 Protospacer adjacent motif (PAM) .............................3, 4, 7, 8, 22, 36, 57, 58, 100–103, 108, 154, 155, 161, 162, 167, 209, 210, 214, 215, 235, 248, 254, 255, 258, 260, 261, 263, 293, 295, 298, 309, 334–336, 340, 341, 343, 355

Q Quantitative real-time reverse transcription PCR (qRT-PCR) ..................... 317–319, 321–324, 330

R Real-time reverse transcription polymerase chain reaction (RT-PCR) ................................... 317–330 Regeneration ........................................23, 29, 34, 36, 40, 47, 49, 69, 77–79, 83–85, 87, 131, 177, 181, 190, 194–196, 251, 258, 280, 291, 298, 309, 349 Rhabdovirus vector .............................................. 173, 175 Ribonucleoprotein (RNP) complex................... 155, 161, 168, 169, 193, 194, 202, 203, 212–214, 216, 298, 299, 306, 309, 336, 346–348, 356, 358 Rice ..............................................6, 7, 11, 14, 15, 96, 98, 103, 107–113, 116, 130, 155, 188, 274, 369, 371–373, 375–377

S Selection marker gene..................................................... 48

AND

PROTOCOLS Index 387

Single guide RNA (sgRNA) ................................. 3, 4, 53, 54, 57–59, 61–63, 69, 96, 102, 103, 174, 176, 178, 182, 183, 223, 230, 235, 236, 254, 274, 288, 289, 295, 298, 300, 305, 306, 308, 309, 334–336, 341, 343, 344, 346, 347, 355–358 Single nucleotide polymorphism (SNP) .....................113, 310, 318, 322, 323, 330, 369 Solanum tuberosum .........................73–91, 334, 339–341 Sonchus yellow net virus (SYNV) ...................... 174–177, 179–182, 184 Soybean.......................................... 39–50, 130, 131, 133, 142–144, 155, 273, 274, 278–284, 372, 373, 375, 376 Spectinomycin ...................................... 10, 11, 40–43, 47, 56, 63, 69, 76–79, 87, 91, 190, 270, 278, 346 Stable transformation..........................116–119, 122, 124 Stop codons.................................................. 7, 54, 57, 58, 95–104, 116, 215, 375

T Targeted insertion ............... 40, 273, 297, 299, 306, 311 Targeted mutagenesis .................................. 6, 21, 40, 41, 187–196, 253–271, 308 Target gene........................................... 6–8, 58, 102, 108, 155, 162, 167, 178, 183, 209, 210, 212, 214–216, 222, 250, 258, 287–295, 298, 318, 319, 334, 338–340, 343, 350, 352–356, 358 Target sequence ......................................... 5, 7, 8, 22–25, 30, 34–36, 48, 57, 58, 108, 109, 112, 113, 137, 162, 179, 183, 209, 212, 213, 222, 260, 261, 309, 311, 340, 341, 355 T7E1 endonuclease cleavage assay..................... 137–140, 180, 183, 184 TiD (Type I-D) CRISPR-Cas system ......................21–36 Tomato ..................................23, 27, 29, 32–36, 96, 176, 279, 357, 369, 372, 374–376 Transfection....................................... 10, 25, 31, 34, 121, 131, 132, 135, 137, 141–147, 154, 157, 161, 164, 169, 298, 299, 303, 304, 307, 311, 312 Transfer DNA (T-DNA).................................5, 6, 10–14, 16, 17, 32, 57, 58, 60, 62–64, 69, 200, 223, 249, 255, 258, 264, 267, 270, 278, 284, 291, 293, 338, 344–346, 350 Transformation.....................................11, 14, 16, 17, 23, 27, 28, 33, 40, 41, 43, 44, 47–50, 54, 55, 57, 60, 65, 66, 69, 73, 74, 77, 83–85, 90, 110, 116, 147, 154, 159, 166, 188, 208, 213–214, 216, 221–251, 255, 263–267, 274, 280–282, 288, 290, 291, 298, 344, 347, 379 Transgene expression ................... 74, 115–126, 129–147 Transgene-free................................... 174, 175, 208, 222, 249–252, 267, 293, 298 Transient expression..................................................6, 334

PLANT GENOME ENGINEERING: METHODS AND PROTOCOLS

388 Index V

Z

Vector assembly .......................... 130, 335, 336, 343–346

Zeatin riboside ................................. 42, 43, 49, 277, 337

W Woody plants ................................................................. 117