Photosynthesis, Productivity, and Environmental Stress 9781119501770, 9781119501831, 9781119501824, 1119501776

Citation preview

Photosynthesis, Productivity, and Environmental Stress

Photosynthesis, Productivity, and Environmental Stress Edited by Parvaiz Ahmad

Department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia and Department of Botany, S. P. College, Srinagar, Jammu and Kashmir, India.

Mohammad Abass Ahanger

College of Life Science, NorthWest A & F University, Yangling Shaanxi, China.

Mohammed Nasser Alyemeni

Department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia.

Pravej Alam

Department of Biology, Prince Sattam bin Abdul Aziz University, Alkharaj, Riyadh, Saudi Arabia. 

This edition first published 2020 © 2020 John Wiley & Sons, Ltd All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by law. Advice on how to obtain permission to reuse material from this title is available at http://www.wiley.com/go/permissions. The right of Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam to be identified as the authors of this editorial material in this work has been asserted in accordance with law. Registered Offices John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, USA John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK Editorial Office The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK For details of our global editorial offices, customer services, and more information about Wiley products visit us at www.wiley.com. Wiley also publishes its books in a variety of electronic formats and by print‐on‐demand. Some content that appears in standard print versions of this book may not be available in other formats. Limit of Liability/Disclaimer of Warranty While the publisher and authors have used their best efforts in preparing this work, they make no representations or warranties with respect to the accuracy or completeness of the contents of this work and specifically disclaim all warranties, including without limitation any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives, written sales materials or promotional statements for this work. The fact that an organization, website, or product is referred to in this work as a citation and/or potential source of further information does not mean that the publisher and authors endorse the information or services the organization, website, or product may provide or recommendations it may make. This work is sold with the understanding that the publisher is not engaged in rendering professional services. The advice and strategies contained herein may not be suitable for your situation. You should consult with a specialist where appropriate. Further, readers should be aware that websites listed in this work may have changed or disappeared between when this work was written and when it is read. Neither the publisher nor authors shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages. Library of Congress Cataloging‐in‐Publication Data Names: Ahmad, Parvaiz, editor. | Ahanger, Mohammad Abass, editor. | Alyemeni, Mohammed Nasser, editor. | Alam, Pravej, editor. Title: Photosynthesis, productivity, and environmental stress / edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, Pravej Alam. Description: First edition. | Hoboken : Wiley, 2019. | Includes index. Identifiers: LCCN 2019024513 (print) | LCCN 2019024514 (ebook) | ISBN 9781119501770 (cloth) | ISBN 9781119501831 (adobe pdf ) | ISBN 9781119501824 (epub) Subjects: LCSH: Photosynthesis–Research. | Plants–Effect of stress on–Research. Classification: LCC QK882 .P385 2019 (print) | LCC QK882 (ebook) | DDC 572/.46072–dc23 LC record available at https://lccn.loc.gov/2019024513 LC ebook record available at https://lccn.loc.gov/2019024514 Cover Design: Wiley Cover Image: © Matteo Senesi/Getty Images Set in 10/12pt WarnockPro by SPi Global, Chennai, India 10 9 8 7 6 5 4 3 2 1

v



Contents

List of Contributors  xiii Preface  xvii About the Editors  xxi 1

Effects of Organic Pollutants on Photosynthesis  1 Rupal Singh Tomar, Bhupendra Singh, and Anjana Jajoo

1.1 Introduction to Organic Pollutants  1 1.2 Characteristics of the Organic Pollutants  3 1.3 Sources of Organic Pollutants  3 1.4 Uptake and Accumulation of Organic Pollutants in Plants  4 1.5 Effects of Organic Pollutants on Plant Growth  5 1.6 Effects of Organic Pollutants on Photosynthesis  7 1.6.1 Effects of Pesticides on the Light Reactions  7 1.6.2 Effects of Pesticides on the Dark Reactions  9 1.6.3 Effects of Antibiotics on the Light Reactions  11 1.6.4 Effects of Antibiotics on the Dark Reactions  13 1.6.5 Effects of Bisphenol A on the Light Reactions  13 1.6.6 Effects of Bisphenol A on the Dark Reactions  14 1.6.7 Effects of Polycyclic Aromatic Hydrocarbons on the Light Reactions  14 1.6.8 Effects of Polycyclic Aromatic Hydrocarbons on the Dark Reactions  16 1.7 Conclusion and Future Prospects  17 References  18 2

Cold Stress and Photosynthesis  27 Aditya Banerjee and Aryadeep Roychoudhury

2.1 Introduction  27 2.2 Primary Targets of Cold Stress in Plants  27 2.3 Cold Stress Distorts the Chloroplast Membrane Integrity  28 2.4 Cold Stress Damages the Photosynthetic Apparatus  28 2.5 Cold Stress Affects Carbon Dioxide (CO2) Fixation  31 2.6 Strategies to Ameliorate Cold Stress and Improve Photosynthesis  32 2.7 Conclusion and Future Perspectives  33 Acknowledgements  33 References  33

vi

Contents

3

High‐Temperature Stress and Photosynthesis Under Pathological Impact  39 Murat Dikilitas, Eray Simsek, Sema Karakas, and Parvaiz Ahmad

3.1 Introduction  39 3.2 High‐Temperature Stress on Crop Plants  41 3.3 High‐Temperature Stress on Photosynthesis Mechanisms  43 3.4 Impact of Pathogens on Photosynthesis Mechanisms Under Temperature Stress  45 3.5 Genomic, Biochemical, and Physiological Approaches for Crop Plants Under Temperature and Pathogenic Stresses  51 3.6 Conclusions and Future Prospects  55 References  55 4

Effect of Light Intensity on Photosynthesis  65 Rinukshi Wimalasekera

4.1 Introduction  65 4.2 Characteristics of Light  66 4.2.1 Photosynthetically Active Radiation (PAR)  66 4.3 Light Absorption and Pigments  67 4.3.1 Dissipation of Excess Light Energy  67 4.3.2 Photoinhibition  68 4.4 Light Absorption by Leaves  68 4.4.1 Light Absorption and the Anatomy, Morphology, and Biochemical Characteristics of Leaves  68 4.4.2 Light‐Mediated Leaf Movement  69 4.4.3 Light Absorption by Sun and Shade Adapted Leaves  69 4.5 Light and Photosynthetic Responses  70 4.6 Conclusion and Future Prospects  70 References  71 5

Regulation of Water Status, Chlorophyll Content, Sugar, and Photosynthesis in Maize Under Salinity by Mineral Mobilizing Bacteria  75 Yachana Jha

5.1 Introduction  75 5.2 Mineral Mobilizing Bacteria  76 5.3 Isolation and Identification of Mineral Mobilizing Bacteria  77 5.4 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Maize Under Salinity  78 5.5 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Chlorophyll Content  79 5.6 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Relative Water Content  80 5.7 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Stomatal Behavior  82 5.8 Mineral Mobilizing Bacteria Maintain Photosynthesis to Regulate Soluble Sugar by Altering Vascular Tissue  83 5.9 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Accumulating Various Osmoprotectants  84

Contents

5.10

Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Sugar Biosynthesis  87 5.11 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Reducing Ethylene Biosynthesis  88 5.12 Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Inducing Various Signaling Molecule  89 5.13 Conclusion  90 References  90 6

Regulation of Photosynthesis Under Metal Stress  95 Mumtaz Khan, Neeha Nawaz, Ifthekhar Ali, Muhammad Azam, Muhammad Rizwan, Parvaiz Ahmad, and Shafaqat Ali

6.1 Introduction  95 6.2 Effects of Metals on Photosynthesis  96 6.2.1 Reduction in CO2 Stomatal Conductance and Mesophyll Transport  96 6.2.2 Inhibition of Biosynthesis of Photosynthetic Pigments  97 6.2.3 Changes in Leaf Morphology and Chloroplast Ultrastructure  97 6.2.4 Induction of Reactive Oxygen Species  98 6.2.5 Metal‐Induced Hormonal Changes  98 6.2.6 Alterations in Photosynthetic Enzymes  99 6.3 Mechanisms of Photosynthesis Regulation under Metal Stress  99 6.3.1 Cell Signaling and Growth Hormones  99 6.3.2 Avoiding and Scavenging Reactive Oxygen Species  100 6.3.3 Interconversion of Chlorophylls  101 6.3.4 Role of Alleviatory Agents in Photosynthesis Regulation  101 6.3.5 Photosynthesis Regulation Through Overexpression of Genes  102 6.4 Conclusions  102 References  102 7

Heavy Metals and Photosynthesis: Recent Developments  107 Zahra Souri, Amanda A. Cardoso, Cristiane J. da‐Silva, Letúzia M. de Oliveira, Biswanath Dari, Debjani Sihi, and Naser Karimi

7.1 Introduction  107 7.2 Heavy Metals and Hyperaccumulation  109 7.2.1 Characteristics of Hyperaccumulator Plants  110 7.2.2 Hyperaccumulation and Photosynthesis  112 7.3 Heavy Metals and Chloroplast Structure  113 7.4 Heavy Metals and Gas‐Exchange  115 7.5 Heavy Metals and Photosynthetic Pigments  115 7.6 Heavy Metals and Photosystems (PSI and PSII)  117 7.7 Heavy Metals and Key Photosynthetic Enzymes  120 7.8 Heavy Metals and Antioxidant Defense Mechanism of the Photosynthetic System  121 7.9 Conclusion and Further Prospects  123 References  125

vii

viii

Contents

8

Toward Understanding the Regulation of Photosynthesis under Abiotic Stresses: Recent Developments  135 Syed Sarfraz Hussain

8.1 8.1.1 8.1.2 8.1.3 8.1.4 8.1.5 8.2

Introduction: Abiotic Stresses, Photosynthesis and Plant Productivity  135 Impact of Abiotic Stress on the Photosynthetic System of Plants  137 Drought Stress  137 Salinity Stress  139 Cold Stress  142 Heat Stress  144 Overexpression of Photosynthesis Related Genes and Transcription Factors  145 8.3 Conclusions and Future Perspectives  146 References  147 9

Current Understanding of the Regulatory Roles of miRNAs for Enhancing Photosynthesis in Plants Under Environmental Stresses  163 Syed Sarfraz Hussain, Meeshaw Hussain, Muhammad Irfan, and Bujun Shi

9.1

Introduction: Interaction Between miRNAs and Plant Growth/Functional Diversity of miRNAs and Their Impact in Plant Growth  163 9.2 miRNAs Involved in Photosynthesis and Other Downstream Biological Processes  165 9.3 Abiotic Stresses Drastically Affect Photosynthesis and Plant Productivity  166 9.4 Genome Wide miRNA Profiling Under Abiotic Stresses  168 9.5 Functional Characterization of miRNAs Associated with Photosynthesis  170 9.6 miRNAs and Shoot/Tiller Development  172 9.7 miRNAs in Root Development  173 9.8 miRNAs in Controlling Stomatal Density  175 9.9 miRNAs in Hormone Signaling  175 9.10 miRNAs in Controlling Nodule Development in Leguminous Crops  176 9.11 Conclusion and Future Perspective  177 References  178 10

Mineral Mobilizing Bacteria Mediated Regulation of Secondary Metabolites for Proper Photosynthesis in Maize Under Stress  197 Yachana Jha

10.1 Introduction  197 10.2 Isolation and Inoculation of Mineral Mobilizing Bacteria  198 10.2.1 Mineral Mobilizing Bacteria Mediated Regulation of Nutrients for Secondary Metabolites Production and Photosynthesis  200 10.2.2 Mineral Mobilizing Bacteria Mediated Regulation of Chlorophyll Content for Secondary Metabolites Production and Photosynthesis  201 10.2.3 Mineral Mobilizing Bacteria Mediated Regulation of Carbon/Sugar Metabolites for Secondary Metabolites Production and Photosynthesis  203

Contents

10.2.4 Mineral Mobilizing Bacteria Mediated Regulation of Nitrogen Metabolites for Secondary Metabolites Production and Photosynthesis  206 10.2.5 Mineral Mobilizing Bacteria Mediated Regulation of Secondary Metabolites Production and Photosynthesis Under Biotic Stress  207 10.2.6 Mineral Mobilizing Bacteria Mediated Regulation of Secondary Metabolites Production and Photosynthesis Under Abiotic Stress  207 10.2.7 Mineral Mobilizing Bacteria Mediated Regulation of Gene Expression for Secondary Metabolites Production and Photosynthesis  208 10.3 Conclusion  210 References  210 11

Role of Plant Hormones in Improving Photosynthesis  215 Belur Satyan Kumudini and Savita Veeranagouda Patil

11.1 Introduction  215 11.2 Phytohormones: Watchdogs of Plant Growth and Development  216 11.2.1 Auxins 216 11.2.2 Gibberellins or Gibberellic Acids  217 11.2.3 Cytokinins 217 11.2.4 Ethylene 218 11.2.5 Abscisic Acid  218 11.2.6 Jasmonic Acid  220 11.2.7 Salicylic Acid  220 11.2.8 Brassinosteroids 220 11.2.9 Strigolactones 221 11.3 Photosynthesis  221 11.3.1 Role of Plant Hormones in Photosynthesis  222 11.4 Phytohormones and Abiotic Stress Tolerance vis‐à‐vis Photosynthesis  223 11.4.1 Heavy Metals  223 11.4.2 Salinity 224 11.4.3 Drought 225 11.5 Deciphering the Role of Phytohormones in Perceiving Photosynthesis During Biotic Stress  225 11.6 Interplay Between the Phytohormones to Facilitate Photosynthesis Under Stress  227 11.7 Conclusion and Future Prospects  228 Acknowledgments  228 References  228 12

Promising Monitoring Techniques for Plant Science: Thermal and Chlorophyll Fluorescence Imaging  241 Aykut Saglam, Laury Chaerle, Dominique Van Der Straeten, and Roland Valcke

Abbreviations  241 12.1 Introduction  241 12.2 Thermal Imaging  242 12.2.1 Plant Water Status and Drought Stress  243

ix

x

Contents

12.2.2 Salt Stress  245 12.2.3 Herbicide Stress  245 12.2.4 Air Humidity and Air Pollutants  245 12.2.5 Ice Nucleation and Freezing  246 12.2.6 Plant–Pathogen Interactions  247 12.2.7 Herbivory Effects  249 12.3 Chlorophyll Fluorescence Imaging  249 12.3.1 Drought Stress  251 12.3.2 Light Stress  252 12.3.3 Herbicide Stress  252 12.3.4 Air Pollutants  254 12.3.5 Mineral Deficiency and Toxicity  255 12.3.6 Pathogen Effects  256 12.3.7 Herbivory Effects  258 12.4 Conclusions and Future Perspectives  259 References  260 13

Introgression of C4 Pathway Gene(s) in C3 Plants to Improve Photosynthetic Carbon Assimilation for Crop Improvement: A Biotechnological Approach  267 Sonam Yadav and Avinash Mishra

13.1 Introduction  267 13.2 Carbon Assimilation  268 13.2.1 CO2 Assimilation in C3 Plants: Photorespiration a Major Constraint  268 13.2.2 CO2 Assimilation in C4 Plants: Efficient Photosynthesis  269 13.2.3 C3 vs. C4 Plants  271 13.3 Evolution of C4 Metabolism in Higher Plants  271 13.3.1 Environmental Imperatives/Obligations  272 13.3.2 Evolution of C4 Photosynthesis Gene(s)  272 13.4 Effect of Elevated CO2 on C3 and C4 Plants  273 13.5 Ectopic Expression of C4 Photosynthesis Genes in C3 Plants  274 13.5.1 Single Gene Introgression  274 13.5.2 Double Gene Introgression  275 13.6 Conclusion  275 Acknowledgment  276 References  276 14

Interaction of Photosynthesis, Productivity, and Environment  283 Ulduza Ahmad Gurbanova, Tofig Idris Allahverdiyev, Hasan Garib Babayev, Shahnigar Mikayil Bayramov, and Irada Mammad Huseynova

14.1 Introduction  283 14.2 Plant Materials  286 14.3 Effect of Drought Stress on Some Physiological Traits, Yield, and Yield Components of Durum (Triticum durum Desf.) and Bread (Triticum aestivum L.) Wheat Genotypes  286

Contents

14.4

Subcellular Localization of the NADP‐Malic Enzyme and NAD‐Malic Enzyme Activity in the Leaves of the Wheat Genotypes Under Soil Drought Conditions  299 14.5 Physico‐Chemical Parameters of NADP‐Malic Enzyme and NAD‐Malic Enzyme in the Leaves of the Barakatli 95 and Garagylchyg 2 Genotypes Under Soil Drought Conditions  302 14.6 Conclusion  310 Acknowledgement  311 References  311 Index  315

xi

xiii

List of Contributors Parvaiz Ahmad

Hasan Garib Babayev

Department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia

Institute of Molecular Biology and Biotechnologies, Azerbaijan National Academy of Sciences, Matbuat Avenue, Baku AZ, Azerbaijan.

and Department of Botany, S.P. College, Srinagar, Jammu and Kashmir India Ifthekhar Ali

Department of Soil and Environmental Sciences, Gomal University, Dera Ismail Khan, Pakistan Shafaqat Ali

Department of Environmental Sciences and Engineering, Government College University Allama Iqbal Road Faisalabad, Pakistan Tofig Idris Allahverdiyev

Research Institute of Crop Husbandry, Ministry of Agriculture of the Republic of Azerbaijan, Pirshagi settlement, Sovkhoz, Baku AZ, Azerbaijan, Muhammad Azam

Department of Horticulture, University of Agriculture, Faisalabad, Pakistan

Aditya Banerjee

Post Graduate Department of Biotechnology, St. Xavier’s College (Autonomous), Mother Teresa Sarani, Kolkata, West Bengal, India Shahnigar Mikayil Bayramov

Institute of Molecular Biology and Biotechnologies, Azerbaijan National Academy of Sciences, Matbuat Avenue, Baku AZ, Azerbaijan. Amanda A. Cardoso

Department of Botany and Plant Pathology, Purdue Center for Plant Biology, Purdue University, West Lafayette, IN, USA Laury Chaerle

Department of Physiology, Laboratory of Functional Plant Biology, Ghent University, K. L. Ledeganckstraat, Ghent Belgium

xiv

  List of contributors

Biswanath Dari

Muhammad Irfan

Aberdeen Research and Extension Center, University of Idaho, Aberdeen, ID, USA

Department of Biological Sciences, Forman Christian College (A Chartered University), Lahore, Pakistan

Cristiane J. da-Silva

Anjana Jajoo

Departamento de Botânica, Instituto de Biologia, Universidade Federal de Pelotas, Pelotas, RS, Brasil

School of Life Science and School of Biotechnology, Devi Ahilya University, Indore, Madhya Pradesh, India

Letúzia M. de Oliveira

Yachana Jha

Soil and Water Science Department, University of Florida, Gainesville, FL, USA

Department of Biotechnology, Genetics and Bioinformatics, N. V. Patel College of Pure and Applied Sciences, S. P. University, V. V. Nagar, Anand (Gujarat), India

Murat Dikilitas

Department of Plant Protection, Harran University, Sanliurfa, Turkey Ulduza Ahmad Gurbanova

Institute of Molecular Biology and Biotechnologies, Azerbaijan National Academy of Sciences, Matbuat Avenue, Baku AZ, Azerbaijan. Irada Mammad Huseynova

Sema Karakas

Department of Soil Science and Plant Nutrition, Harran University, Sanliurfa, Turkey Naser Karimi

Laboratory of Plant Physiology, Department of Biology, Faculty of Science, Razi University, Kermanshah, Iran

Institute of Molecular Biology and Biotechnologies, Azerbaijan National Academy of Sciences, Matbuat Avenue, Baku AZ, Azerbaijan.

Mumtaz Khan

Meeshaw Hussain

Belur Satyan Kumudini

Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, Multan, Pakistan

Department of Biotechnology, School of Sciences, JAIN (Deemed-to-be University), Bengaluru, India

Syed Sarfraz Hussain

Avinash Mishra

Department of Biological Sciences, Forman Christian College (A Chartered University) Lahore, Pakistan

Division of Biotechnology and Phycology, CSIR‐Central Salt and Marine Chemicals Research Institute, G. B. Marg, Bhavnagar, Gujarat, India

Department of Soil and Environmental Sciences, Gomal University, Dera Ismail Khan, Pakistan

  List of contributors

Neeha Nawaz

Bhupendra Singh

Department of Environmental Sciences and Engineering, Government College University Allama Iqbal Road Faisalabad, Pakistan

School of Life science, Devi Ahilya University, Indore, Madhya Pradesh, India

Savita Veeranagouda Patil

Department of Biotechnology, School of Sciences, JAIN (Deemed-to-be University), Bengaluru, India Muhammad Rizwan

Department of Environmental Sciences and Engineering, Government College University, Faisalabad, Pakistan Aryadeep Roychoudhury

Post Graduate Department of Biotechnology, St. Xavier’s College (Autonomous), Mother Teresa Sarani, Kolkata West Bengal, India Aykut Saglam

Department of Molecular Biology and Genetics, Karadeniz Technical Univeristy, Trabzon, Turkey Bujun Shi

School of Agriculture, Food and Wine, Waite Campus, University of Adelaide, Adelaide, SA Australia Debjani Sihi

Environmental Sciences Division, Oak Ridge National Laboratory, Bethel Valley Rd, Oak Ridge, TN, USA Eray Simsek

Department of Plant Protection, Harran University, Sanliurfa, Turkey

Zahra Souri

Laboratory of Plant Physiology, Department of Biology, Faculty of Science, Razi University, Kermanshah, Iran Rupal Singh Tomar

School of Life science, Devi Ahilya University, Indore, Madhya Pradesh, India Roland Valcke

Laboratory of Molecular and Physical Plant Physiology, Faculty of Sciences, Hasselt University, Diepenbeek, Belgium Dominique Van Der Straeten

Laboratory of Functional Plant Biology, Department of Physiology, Ghent University, K. L. Ledeganckstraat, Ghent Belgium Rinukshi Wimalasekera

Department of Botany, Faculty of Applied Sciences, University of Sri Jayewardenepura, Gangodawila, Sri Lanka Sonam Yadav

Division of Biotechnology and Phycology, CSIR‐Central Salt and Marine Chemicals Research Institute, G. B. Marg, Bhavnagar, Gujarat, India

xv

xvii

Preface Plants due to their sessile nature are exposed to different environmental stresses. These environmental stresses (biotic and abiotic) have been reported to decrease plant growth and development and massive crop loss worldwide. Environmental stress imposes ionic, osmotic stress and in severe cases causes oxidative stress in plants. Oxidative stress is generated by the production of reactive oxygen species (ROSs). These ROSs are highly reactive and can attack biomolecules and change their structural and functional utility. However, plants are equipped with defense mechanisms like osmolytes, osmoprotectants and antioxidants that enable them to withstand the negative effects of osmotic and oxidative stress. Genes and proteins related to defence mechanisms are up and downregulated and leads to plant tolerance against the particular stress. Plant growth and development is regulated by different physio‐biochemical and molecular processes which are dependent on photosynthesis. All environmental stresses, irrespective of their targets and nature of perception in plants, algae, and cyanobacteria bring perturbation in the cellular energy homeostasis. The stress‐adaptive mechanisms developed by these photosynthetic organisms are primarily based on reestablishment of cellular energy balance. In this background photosynthesis, the energy‐producing process, plays a central role in modulating energy signaling and balance, which have significant implications for energy homeostasis of the whole organism. Therefore, this book is compiled to acquaint readers with the latest update and future goals of photosynthetic research and also some of the scientific challenges that still exist in photosynthesis and living organism’s interactions. The book is a compilation of 14 chapters. The volume entitled “Photosynthesis, Productivity, and Environmental Stress” has a wide variety of chapters with updated information related to the relevant topics. This book has been planned to fulfill the gap of knowledge in relation to photosynthesis, crop productivity, and environmental stress. Chapter  1 of this book describes the effects of organic pollutants (OPs) on photosynthesis. The authors have worked very hard and have provided information on the characteristics of the OPs, sources of OPs, uptake and accumulation of OPs by plants, and effects of OPs on plant growth. Chapter 2 demonstrates the photosynthetic processes under cold stress and the authors have discussed the aspects of primary targets of cold stress in plants, cold stress infiltration of the chloroplast membrane integrity, damage to photosynthetic apparatus, effects on carbon dioxide (CO2) fixation, and strategies to ameliorate cold stress and improve photosynthesis. Chapter 3 deals with high‐temperature stress and photosynthesis under the pathological impact with the main focus on high‐temperature stress

xviii

Preface

on crop plants, photosynthesis mechanisms, the impact of pathogens on photosynthesis mechanisms under temperature stress, and genomic, biochemical, and physiological approaches for crop plants under temperature and pathogenic stresses. Chapter 4 describes differential photosynthetic responses to light intensity with the thrust on characteristics of light, light absorption, and pigments, light absorption by leaves, light and photosynthetic responses. Chapter 5 deals with a case study of the effect of mineral mobilizing bacteria on photosynthesis and other physiological attributes under salinity stress. Chapter 6 narrates the regulation of photosynthesis under metal stress and the authors explain the ill effects of metals on photosynthesis and the mechanisms of photosynthesis regulation under metal stress. Heavy metals and photosynthesis: recent developments is the subject of Chapter 7. The authors take the opportunity to explain the heavy metals and hyperaccumulation, characteristics of hyperaccumulator plants, hyperaccumulation and photosynthesis, and the effect of heavy metals on chloroplast structure, gas‐exchange, photosynthetic pigments, photosystems (PSI and PSII), key photosynthetic enzymes, and antioxidant defence mechanism from the photosynthetic systems. Chapter 8 deals with the regulation of photosynthesis under abiotic stresses. Different abiotic stresses like, drought, salinity, cold, and heat stress have been considered with a focus on photosynthesis. Overexpression of photosynthesis related genes and transcription factors have also been explained very well. Chapter 9 describes the regulatory roles of miRNAs for enhancing photosynthesis in plants under environmental stresses. miRNAs involved in photosynthesis and other downstream biological processes, effect of abiotic stresses on photosynthesis and plant productivity, genome wide miRNA profiling under abiotic stresses, functional characterization of miRNAs associated with photosynthesis and the role of MiRNAs in shoot/tiller development, root development, controlling stomatal density, hormone signaling, and controlling nodule development in leguminous crops are the thrust area of this chapter. Chapter  10 explains mineral mobilizing bacteria (MMB) mediated regulation of secondary metabolites for proper photosynthesis in maize under stress. The main focus of the chapter is on MMB mediated regulation of nutrients, chlorophyll content, carbon/sugar metabolite, nitrogen metabolite, and gene expression for secondary metabolites production and photosynthesis. MMB mediated regulation of secondary metabolites production and photosynthesis under biotic and abiotic stresses is also explained. Chapter 11 discusses the improvement of photosynthesis with phytohormones. The authors explain phytohormones: watchdogs of plant growth and development, the role of phytohormones in photosynthesis and abiotic stress tolerance. Chapter 12 deals with thermal and chlorophyll fluorescence imaging with respect to drought, salt, light, herbicides, pathogens, herbivory, and air pollutant stresses. Chapter  13 is about the biotechnological approach of introgression of C4 pathway gene(s) in C3 plants to improve photosynthetic carbon assimilation for crop improvement. The authors explain CO2 assimilation in C3 and C4 plants, evolution of C4 metabolism in higher plants, the effect of elevated CO2 on C3 and C4 plants, and ectopic expression of C4 photosynthesis genes in C3 plants. Chapter 14 describes a case study regarding the interaction of photosynthesis, productivity, and the environment. Here the authors explain the effect of drought stress on some physiological traits, yield,  and yield components of durum (Triticum durum Desf.) and bread (Triticum aestivum L.) wheat genotypes, subcellular localization of the NADP‐ME and NAD‐ME activity in the leaves of the wheat genotypes under soil drought conditions

Preface

physico‐chemical parameters of NADP‐ME and NAD‐ME in the leaves of the Barakatli 95 and Garagylchyg 2 genotypes under soil drought conditions. Although we have tried our best to gather the information and recent updated discoveries related to photosynthesis, crop productivity, and environmental stress in this volume. We believe however, that there still must be some scope for expansion; therefore, valuable suggestions from the readers and researchers are welcome, which we would include in our future editions and volumes. Last but not the least, we are very much thankful to the contributors and the entire publication team of Wiley who helped in every possible way to make this project possible and valuable for publication. Dr. Parvaiz Ahmad Dr. Mohammad Abass Ahanger Dr. Mohammed Nasser Alyemeni Dr. Pravej Alam

xix

xxi

About the Editors

Dr. Parvaiz Ahmad is the Senior Assistant Professor in Department of Botany at Sri Pratap College, Srinagar, Jammu and Kashmir, India. Dr. Ahmad has completed his Master of Science in Botany in 2000 at Jamia Hamdard, New Delhi, India. After receiving a Doctorate degree from the Indian Institute of Technology (IIT), Delhi, India, he joined the International Centre for Genetic Engineering and Biotechnology, New Delhi, in 2007. His main research area is Stress Physiology and Molecular Biology. He has published more than 75 research papers in peer‐reviewed journals and 60 book chapters. Dr. Ahmad has published 21 books with different International publishers, like Elsevier, Springer, Wiley, Taylor and Francis, etc. He is a recipient of the Junior Research Fellowship and Senior Research Fellowship by CSIR, New Delhi, India. Dr. Parvaiz has been awarded the Young Scientist Award under the Fast Track scheme in 2007 by the Department of Science and Technology, of the Government of India. Dr. Parvaiz is actively engaged in studying the molecular and physio‐biochemical responses of different agricultural and horticultural plants under environmental stress. Dr. Mohammad Abass Ahanger is currently working as Guest Lecturer in the Education Department, Government of Jammu and Kashmir India. Dr. Ahanger completed his Postgraduate education in Botany from Jiwaji University, Gwalior, India in 2010 specializing in plant stress physiology. After receiving M Phil, Dr Ahanger completed his Ph D in 2016 from the same university. His main research interests are elucidation of tolerance mechanisms in plants for improved abiotic stress tolerance. He has published more than 15 research publications in reputed national and international journals, and has contributed several book chapters to internationally published volumes from publishers like Springer, Elsevier, and Wiley.

xxii

About the Editors

Dr. Pravej Alam has completed his PhD in Biotechnology from the Department of Biotechnology, Jamia Hamdard (Hamdard University) New Delhi, India in 2012. Dr. Alam did his doctoral research focused on biosynthesis of secondary metabolite production in plants and microbes through a genetic engineering approach. Dr. Alam has been awarded Dr. D.S. Kothari Postdoctoral Fellowship by UGC‐Govt. of India. He also served as an Assistant Professor (Guest) in Biotechnology Department, Jamia Millia Islamia, New Delhi, India from 2012 to 2015. In 2015, he has finally joined as Assistant Professor, Biology Department, College of science Prince Sattam bin Abdulaziz University, Saudi Arabia. Dr. Alam has published a good number of articles in high impact factor journals of plant science.

Prof. Dr. Mohammed Alyemeni is currently a Professor of Ecophysiology at Department of Botany and Microbiology – King Saud University. He received his Bachelor of Science from King Saud University, Saudi Arabia, his Master of Philosophy from Reading University in United Kingdom, and his PhD degree in Plant Ecology from Edinburgh University  –  United Kingdom. His research interest is focused in plant ecology, stress physiology, and plant hormones. He has taught university students at all levels for over 38 years and has guided many students to the award of MSc and PhD degrees. He has been the principal investigator of the various projects and has contributed extensively to the world plant ecology and physiology literature with over 90 publications appearing in ISI Web of Science Index Journals. He has also published several books in the area of plant ecology and physiology in Arabic and English.

1

1 Effects of Organic Pollutants on Photosynthesis Rupal Singh Tomar1, Bhupendra Singh1, and Anjana Jajoo1,2 1 2

School of Life Science, Devi Ahilya University, Indore, Madhya Pradesh, India School of Biotechnology, Devi Ahilya University, Indore, Madhya Pradesh, India

1.1 ­Introduction to Organic Pollutants Life on earth is powered by the process of photosynthesis. For more than billion years, life on earth has been transformed by the photosynthetic organisms. Photosynthetic organisms like cyanobacteria, algae, and plants harvest sunlight and produce oxygen and organic molecules, which are responsible for life on earth. Photosynthesis starts with the absorption of light of the visible region coming from the sun. It includes several partial processes such as splitting of water to molecular oxygen, electrons, and protons, which participate directly in the electrochemical reactions leading to phosphorylation and fixation of carbon dioxide into sugars. Plants are sessile organisms that cannot move and thus cannot avoid exposure to fluctuating environmental conditions. Plants face several abiotic stress factors, such as water deficit (drought), excess water (flooding/water logging), extremes of temperatures (cold, chilling, frost, heat), high salt, mineral deficiency, and toxicity. Because of climate changes, it is predicted that these abiotic stresses may become more intense and frequent. Climate change, occurring either naturally or anthropogenically, poses serious challenges for agriculture all over the world. During the last decades, environmental contamination has become one of the major problems on this planet. Anthropogenic activities have led to an abundance of soil, water, and air pollutants, factors that directly affect plants. Amongst these, environmental organic pollutants (OPs) have an immense effect on plant growth and development. OPs and their transformation products have been the most investigated environmental pollutants in last two decades. They accumulate in humans, animals, and plants as they are hydrophobic and lipid‐soluble, and they biomagnify as they move up the food chain. OPs can be found everywhere on earth as they can travel great distances in both air and water. OPs have been found to cause serious disorders in mammals such as cancer and endocrine disorders. It is therefore essential to understand how these contaminants enter and move in the ecosystem and environment. Plants are capable of taking up, transforming, and accumulating environmental Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

2

1  Effects of Organic Pollutants

pollutants such as OPs. Several physiological and biochemical reactions in plants are influenced by OPs in the same way as other toxic compounds such as metals. They can change the energetic metabolism of plants and are associated with growth and development. About 90% of the OPs accumulate in the soil due to their hydrophobic nature, because of which they rapidly associate with solid particles of soil and permeate to bottom sediments. Several studies have been carried out on the uptake of OPs by plants and their toxicity to plants cells. Here we present an updated account of these studies, focusing on (i) the uptake of OPs by the plants and (ii) their harmful effects on the photosynthetic reactions. The rapid growth in chemical and agrochemical industries has resulted in the release of a large number of new and toxic chemical compounds into the environment. These OPs are getting significant attention in environmental and engineering research. Several countries and international organizations have published lists of harmful pollutants, which are at alarming levels and should be controlled immediately. The group of organic chemicals discussed here include the pesticides, antibiotics, bisphenol A (BPA) and polycyclic aromatic hydrocarbons (PAHs) (Figure 1.1). Several internal and external factors regulate normal development and productivity of plants. External factors include natural and man‐made chemicals that have detrimental effects on plants. OPs are a major threat in terrestrial as well as aquatic ecosystems. They quite easily cross the cell membrane of plant and animal cells due to their lipophilic character resulting in substantial bioconcentration. Plant roots and leaves serve as a major sink for these pollutants. Plants and bacteria are both involved in the biogeochemical cycling of OPs. Uptake of OPs depends on cell size, temperature, and their hydrophobicity (Dachs et al. 2002; Gang and Xitao 2005). The toxic effect of OPs may be a result of direct interaction, or some OPs may accumulate into the plant tissue to a toxic level and can affect the plant development at any stage (Hanano et al. 2015). OPs contaminate water, soil, and sediments and thus become a major environmental problem that needs to be rectified. In more recent years, the studies with these OPs are more focused on the characterization of toxicity response in a variety of plant and animal species.

Organic Pollutants (OPs)

Pesticides

Antibiotics

• Aldicarb • Atrazine • Benomyl • Chlorotoluron • Fludioxonil • Paraquat • Uracil

• Chlortetracycline • Tetracycline • Oxytetracycline • Erythromycin

Bisphenol A (BPA)

PAHs

• Napthelene • Anthracene • Phenanthrene • Fluoranthene • Pyrene

Figure 1.1  Broad classification of organic pollutants (OPs), based on their effects on plants and photosynthetic machinery.

1.3  Sources of Organic Pollutants

Scientists are also trying to explore some plants species to degrade or at least to detoxify (phytoremediation) these OPs to protect other organisms from the adverse effects of these compounds.

1.2 ­Characteristics of the Organic Pollutants All OPs are synthetic chemicals, many are pesticides, while some others are products or by‐products of industrial processes or of incomplete combustion. They are quite persistence in the environment, and it may take a long time, up to several decades or even centuries, for their degradation. OPs have been found in tissues or environmental samples from almost all parts of the world. They are lipophilic in nature and have a tendency to remain in lipid‐rich tissues. This affinity for the fat tissues suggests that most likely, OPs will accumulate, persist, and bioconcentrate, and eventually could reach toxicologically significant amounts. In nature, OPs enter the food chain and prove to be toxic to plants, animals, and human beings. Because of their unique physicochemical characteristics, OPs are either adsorbed on atmospheric particles or exist in the vapor phase, which facilitates their transport over larger distances in the atmosphere. Very low water solubility and high affinity for lipids lead to their accumulation in the tissues (El‐Shahawi et al. 2010). From the atmosphere, they can be transferred to the ground surface either by dry (e.g. flying ashes) or by wet (through rainout/washout) deposition. They are, however, easily deposited on solid particles such as ash, dust, and soil. They have fair solubility in organic fluids such as fats, oils, and liquid fuels. This implies that there will be more OP content if more solid particles and organic liquids are present in the water (Katsoyiannis and Samara 2005). Interestingly, they have also been detected in snow and ice at the North Pole, along with the animals of the North Sea. This shows that they traveled long distances to reach that location, as nobody has used them in the polar regions (Kumar et al. 2005; Katsoyiannis and Samara 2005). It is reported that from the environment, 45% of PAHs are taken up by the plants (Wagrovski and Hites 1997).

1.3 ­Sources of Organic Pollutants Two possible natural sources of OPs are volcanic activity and forest fires. Several industrial sources also pave the way for their entry e.g. power stations, incinerating plants, agricultural sprays, and thermal stations. Sometimes, humans also contribute to OPs unintentionally through chemical factories, wastes from the use of obsolete oil, fly ash, cement plants, sewage sludge, products from incinerators, and burning of fossil fuels (Ying et al. 2005; Wenzel et al. 2006). Thus, important emission sources of OPs are: combustion processes, industrial production processes, energy production emissions, and open burning process emissions. These sources account for just over half of total PAH emissions and more than one third of the total dioxin and furan emissions. Apart from these, there are agriculture sources and waste incineration emissions too. Industrial processes and product use sources account for half of the polychlorinated biphenyl (PCB) emissions.

3

4

1  Effects of Organic Pollutants

1.4 ­Uptake and Accumulation of Organic Pollutants in Plants About 80% of the land surface on earth is covered with green vegetation having a cuticle rich in lipids. Plants have a significant role in global distribution and cycling of various OPs. Plants absorb OPs either from soil (through roots) or air (through leaves) (Figure  1.2). OPs, such as PAHs, BPA and antibiotics are mainly absorbed by plants through roots because of their low volatility. The plant root generally comes in contact with OPs first and so absorption through roots is the commonest way of uptake. Plants may sequester these pollutants through several routes. It includes (i) uptake from soil, transfer to plant roots and thereafter translocation within the xylem, (ii) deposition from the atmosphere on the leaf surface or uptake through stomata and further translocation through the phloem (Simonich and Hites 1994, 1995). The route of uptake depends on the physicochemical properties of the pollutant, property of the soil, and the plant species. For lipophilic OPs, however, the main pathway of accumulation is transfer from atmosphere to plant (Ockenden et al. 1998). Large amounts of OPs are continuously released into the environment. Plants form the basal step of the terrestrial food web and are therefore important for agricultural as well as natural ecosystems. Bioconcentration is defined as the uptake and concentration of compounds from the environment into a living organism (Bernes 1998). The concentration in plant tissues is related to the plant species in relation to physiology, leaf area, root depth, and growing time period, etc. (White 2002; Gonzales et al. 2003). The pathway by which OPs enter the plants varies with the hydrophobic nature, solubility in water, vapor pressure, and environmental conditions, such as organic content of the soil and temperature. Through their foliage, plants present a large area for uptake from the atmosphere. Many of the

Deposition of OPs on leaves

OPs transfer from root to shoot

Accumulation of OPs in leaves

OPs OPs

OPs OPs

Transport of OPs in plant tissue

OPs

Absorption of OPs form root

Figure 1.2  Schematic presentation of various pathways of uptake of OPs by plants. (See color plate section for the color representation of this figure.)

1.5  Effects of Organic Pollutants on Growth

highly toxic pollutants are hydrophobic in nature and the lipid cover on the surface of leaves provides an ideal sink for deposition and accumulation of these compounds. Through stomata, gaseous molecules diffuse inside and outside thereby interacting with a large hydrophobic area. After entering the food chain of ecosystems, OPs are biomagnified from one trophic level to the next. Plant species which offer a high surface‐to‐volume ratio accumulate more organic air pollutants compared to the species which have compact leaves. A well‐established link between photosynthesis and plant growth is reported (Huang et al. 1997; Marwood et al. 2001).

1.5 ­Effects of Organic Pollutants on Plant Growth Plant growth is also influenced by nutritional, genetic, hormonal, and environmental conditions. It has been shown that exposure to certain environmental pollutants could promote or inhibit the growth, seed germination, elongation of pollen tubes, rate of photosynthesis, and content of hormones in the plants. Being a vital organ of plants, roots absorb not only water and nutrients from soil, but also absorb and transfer several pollutants. In comparison to aerial parts of the plant, roots in the soil are directly exposed to OPs present in the soil. Several studies are reported which give an assessment of global effects of OPs on plants (Yildiztekin et al. 2015; Du et al. 2006; Liu et al. 2009; Kreslavski et al. 2017; Tang et al. 2006; Jajoo et al. 2014; Jajoo 2017). Recent research on the effects of OPs on plant cells mainly targets the detrimental effects on the process of photosynthesis (Kreslavski et  al. 2017; Tomar and Jajoo 2013a; Sharma et al. 2017), protein synthesis, lipids, nucleic acids, (Pašková et  al. 2006), and hormones (Váňová et  al. 2011; Kummerova et  al. 2010). However different plant species sequester pollutants at different rates and extents (Kömp and McLachlan 1997). OPs affect plants by inhibiting several biological processes such as, mitosis, germination, the function of enzymes, production of hormones, root growth, leaf formation, synthesis of pigments, photosynthetic proteins or DNA, destruction of cell membranes, and promoting uncontrolled growth (Figure 1.3). OPs like pesticides can affect the germination process thereby altering physiological, biochemical, and e­ nzymatic reactions that ultimately inhibit the yield and also lead to accumulation of OPs in plants, vegetables, fruits, and different organisms. Moreover, UV exposure causes photooxidation of some OPs such as PAHs. The photoproducts have more toxic effects on plants (Grenvald et  al. 2013; Tomar and Jajoo 2015). As in the case of other abiotic stress (e.g. heavy metal, high temperature, and high salt), OP induced oxidative stress stimulates accumulation of reactive oxygen species (ROS), (Liao and Chen 2007; Ye et al. 2003; Zhang et al. 2007), which in turn induce DNA/RNA damage, membrane damage and lipid peroxidation (LPO). The effects of PAHs (pyrene) on ascorbate peroxidase (APX), superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), malondialdehyde (MDA) and proline were studied in various parts such as roots, stems, and leaves of Bruguiera gymnorrhiza (L.) Savigny. At different level of stress, the activities of antioxidant enzymes in PAH‐treated stems and roots varied and fluctuated. The levels of the antioxidant enzymes SOD and APX in leaves increased under PAH stress exhibiting a positive relationship. Kreslavski et al. (2017) studied the effects of PAHs on pea leaves. The study revealed

5

6

1  Effects of Organic Pollutants • Loss of photosynthetic pigments • Reduction in PSI and PSII activity • Block electron transport chain

Light reactions

OPs

• Destruction of cell membrane • Reduction in seed germination • Decrease in synthesis of proteins and hormones • Induce oxidative stress

Dark reactions

Decrease in plant growth

• Reduction in net photosynthetic rate • Decline in stomatal conductance • Reduction of Rubisco activity

Figure 1.3  General effects of OPs on growth and photosynthesis in plants. (See color plate section for the color representation of this figure.)

an increase of H2O2 formation in pea leaves by naphthalene. They concluded that it might be because of a disturbance in the lipid bilayer of the plasma membrane and membrane of cell organelles, particularly thylakoid membranes. According to Liu et  al. (2009) activity of the SOD increased while CAT activity was relatively unaffected. POD and APX exhibited peak enzyme activities at lower concentrations of phenanthrene and declined at higher concentrations. There was a dose‐dependent H2O2 accumulation seen in 3,3′‐diaminobenzidine (DAB) staining due to phenanthrene as evident from high activity of glutathione (GSH), and MDA. Microarray results suggested several perturbations in signaling and metabolic pathways which regulate ROS and responses related to pathogen defense. Wei et al. (2014) investigated effects of phenanthrene on LPO, chlorophyll content, antioxidant enzymes and accumulation of H2O2 in wheat. Phenanthrene elevated the levels of LPO and induced H2O2 accumulation in leaf tissues with increased dose. Li et al. (2008) suggested that the presence of PAHs caused enhanced content of soluble protein and induced SOD activities in rice. Zhang et  al. (2016) reported in soybean that a low dose of BPA caused some peroxidation of membrane lipids but did not activate antioxidant systems. However, a high dose of BPA increased levels of ROS and caused LPO in membranes at all stages of plant growth. Application of BPA induced oxidative stress in chickpea roots (Dogan et al. 2010). This study demonstrated more H2O2 formation, which was quantitatively correlated with POD activity, MDA activity, and non‐protein SH groups as a result of BPA treatment. Yildiztekin et al. (2015) studied effects of pesticides on the oxidative defence system in tomato (Solanum lycopersicum L.). Application of pesticides resulted in a significant increase in free proline content of leaves and electrolyte leakage. The foliar application of pesticides caused enhanced accumulation of MDA. Doses of pesticides promoted the activities of enzymes such as CAT, POD, and SOD in most of the cases. These results clearly suggest that the application of pesticides at higher doses provoked oxidative and antioxidative systems in tomato plants.

1.6  Effects of Organic Pollutants

1.6 ­Effects of Organic Pollutants on Photosynthesis Photosynthesis is an important metabolic process in plants, which is directly correlated with biomass. Unfortunately it is highly sensitive to stress conditions. Any stress which affects this process negatively will result in a decreased crop yield. Photosynthesis is inhibited by many environmental pollutants such as metals, herbicides, and organic contaminants (Jajoo 2017; Marwood et al. 2001, 2003). The process of photosynthesis occurs in two stages: light reactions are associated with the thylakoid membranes that capture light energy and convert it into chemical energy in the form of reducing power, nicotinamide adenine dinucleotide phosphate (NADPH), and energy, adenosine triphosphate (ATP), accompanied with oxygen evolution. In a sequence of reactions, dark reactions utilize NADPH and ATP to drive endergonic process leading to the formation of hexose sugar from CO2. In plants, the photosynthetic process occurs inside chloroplasts found in the mesophyll cells, which contain about 50 or more chloroplasts per cell. Each chloroplast is surrounded by an inner and an outer membrane with a diameter of approx. 5–10 μm, though many different sizes and shapes can be seen in different plants. Inside the chloroplast is the thylakoid membrane that contains proteins, required for the light reactions. The stacks of thylakoid membranes are called grana while the surrounding aqueous phase is called stroma. The proteins required for the fixation and reduction of CO2 are located in the stroma. Oxygenic photosynthetic organisms have several multi‐ subunit protein complexes associated with thylakoid membranes. These are: photosystem II (PSII), photosystem I (PSI), cytochrome b6f, (Cyt b6f ), and ATP‐synthase (Nelson and Ben‐Shem 2004; Dekker and Boekema 2005). In plants, CO2 enters the leaves through small holes called stomata, and reaches the mesophyll cells. Then CO2 diffuses into the stroma of the chloroplast where the organic molecule glucose is synthesized using ATP and NADPH. OPs cause serious damage to the photosynthetic apparatus. Many studies have demonstrated the effect of different stresses on photosynthetic organisms, particularly higher plants. Environmental stress conditions, such as scarcity of water, high temperature, and high salt have been extensively studied (Faraloni et al. 2011; Oukarroum et al. 2012). There are many research works available that have demonstrated the effects of organic compounds, such as PAHs, pesticides, etc., on plant photosynthesis (Figure 1.4) (Bi et  al. 2012; Jajoo et  al. 2014; Kreslavski et  al. 2014, 2017; Kumar and Han 2011; Magnusson et al. 2010; Naumann et al. 2010; Qiu et al. 2013; Tomar and Jajoo 2014). 1.6.1  Effects of Pesticides on the Light Reactions Use of pesticides is very common in agriculture fields to protect crops from pest induced damage. However, excessive use of pesticides may cause toxicity, which can have deleterious effect on plant growth and development. Literature reveals that the application of pesticides reduced the content of pigments like chlorophyll and carotenoids in Vitis vinifera L. and Nicotiana tabacum L., respectively (Garcia et  al. 2003; Saladin et  al. 2003a). Similarly, a reduction in photosynthetic pigments in maize was observed when pyriproxyfen was applied (Coskun et al. 2015). Application of the pesticides aldicarb, phorate fensulfothion, etc. in chickpea (Tiyagi et al. 2004) and tricyclazole in tomato

7

8

1  Effects of Organic Pollutants • Inhibit biosynthesis of pigments • Decrease Non-photochemical quenching • Reduction of Rubisco activity • Reduction in soluble carbohydrate and starch contents • Inhibit the transport of photo-assimilates

Pesticides

• Decrease in PSII activity BPA • Damage of PSII reaction center • Inhibit turnover of D1 protein • Decline in Rubisco carboxylation velocity

• Decrease in O2 evolution • Block electron transfer at QB level • Decease in active PSII reaction centers • Reduction in the production of both ATP and NADPH • Reduction in net photosynthetic rate • Reduction in internal CO2 concentration

Antibiotics

• Affect ultrastructure of thylakoid membrane • Affect PSII functional and structural heterogeneity • Decline in carboxylation capacity • Decrease in transpiration rate

PAHs

Figure 1.4  Effects of selective OPs on light and dark reactions in photosynthetic machinery of plants. (See color plate section for the color representation of this figure.)

also led to reduced pigment content (Shanmugapriya et al. 2013). Benomyl, a systemic fungicide, also inhibited pigment biosynthesis in Helianthus annuus L. (Ahmed et al. 1983). The inhibition of photosynthetic pigment content by pesticides can lead to a reduced photosynthetic efficiency in plants. Photosystem II (or water‐plastoquinone oxidoreductase) is the first protein complex in the photosynthetic machinery and is one of the most susceptible components to various stresses. Xia et al. (2006) observed significant changes in photosynthetic parameters measured by chlorophyll a (Chl a) fluorescence technique in cucumber (Cucumis sativus L.) when it was exposed to nine different pesticides. The maximal quantum efficiency of PSII (Fv/Fm) was significantly inhibited by paraquat, while other pesticides showed no significant effect on the value of Fv/Fm. The quantum efficiency of PSII (YII) was significantly reduced by most of the pesticides and this decrease was mostly due to an inhibited photochemical quenching coefficient (qP). Non‐photochemical quenching, (NPQ), was inhibited by paraquat and haloxyfop, whereas an up‐regulation was seen after exposure to other pesticides. The effect of dichloro‐diphenyl‐trichloroethane (DDT) and dichloro‐diphenyl‐dichloroethylene (DDE) (a metabolite of DDT) on electron transport in chloroplasts was investigated (Bowes 1972; Owen et al. 1977). The photosynthetic electron transport chain (ETC) in isolated spinach and barley chloroplasts (Owen et al. 1977) and from macroscopic green algae, Codium fragile (Suringar) Hariot and Chaetomorpha aerea (Dill.) Kuetz, (Bowes 1972) was inhibited by both compounds. Photoreduction and photophosphorylation showed 50% inhibition with DDT and DDE.  The addition of uncouplers such as ammonium ions and carbonyl cyanide m‐chlorophenyl hydrazone could not overcome the inhibition. Some herbicides such as  isoproturon and metolachlor caused lower quantum efficiency of PSII in aquatic photosynthetic organisms (Laviale et al. 2011; Thakkar et al. 2013). Chauhan et al. (2013) observed several photochemical changes in potato upon exposure to pesticides. Photosynthesis is greatly inhibited due to inefficient biosynthesis of

1.6  Effects of Organic Pollutants

chlorophyll content that results in leaf chlorosis (Mitra and Raghu 1998). A decrease in content of pigments Chl a, Chl b, and Chl a + b in tomato plants was observed when sprayed with a high dose of pesticides (Yildiztekin et al. 2015). Several amino phosphonate herbicides used on cucumber at a concentration of 0.25 mM caused a decrease of the chlorophyll content by 30–55% (Bielecki et  al. 2001). The chlorophyll content of wheat plants treated with 50 μM of the herbicide acifluorfen (diphenylether) was reduced by 44% five days after the treatment (Pascal et al. 2000). The herbicides norflurazon (pyridazinone) and amitrole (triazole) were used on barley leaves at 100 and 125 μM respectively (La Rocca et al. 2000). Both herbicides caused a photooxidation of chloroplasts which made them photosynthetically nonfunctional. Chl a, Chl b and carotenoid contents were strongly affected by amitrole and were completely degraded after the norflurazon treatment. Thylakoid membranes were dramatically altered by amitrole and totally degraded with norflurazon. The effect of herbicide treatments, atrazine, isoproturon, and metribuzin on chlorophyll content was studied by Khan et al. (2006). They proposed that a decrease in the amount of photosynthetic pigments could be one of the most important reasons for inhibition in photosynthesis. Moreover, a decrease in photosynthetic pigments may also cause a decline in the nutrition value of the pepper plant, since chloroplasts are the site for vitamin synthesis. Sharples et  al. (1997) demonstrated that the accumulation of pesticides in plants affected plant growth and caused metabolic disorders. For example, electron transfer from quinone to plastoquinone in PSII is blocked by metribuzin (Fedtke 1982). This prevents the reduction of NADP required in dark reactions, ultimately inhibiting photosynthesis. Further, the deficiency of pigment in green gram plants may be caused by photobleaching (Barry et al. 1990). Kaushik and Inderjit (2006) found that mung beans grown in soil treated with herbicides showed a decrease in chlorophyll content with a high dose of herbicide. Significant reduction in the content of carotenoids was reported in other plants under pesticide stress (Shakir et al. 2016; Garcia et al. 2003; Saladin et al. 2003a). It was concluded that the photochemical changes due to the pesticides were mainly due to chlorophyll degradation and activation of the oxidation process. Carotenoids also protect plants from photodynamic damage under stress condition. Oxygen evolution was inhibited in a concentration dependent manner by dimethoate (Mishra et al. 2008). In the same experiment, the activity of PSII and ETC decreased in chloroplasts in response to various concentrations of dimethoate. The herbicide chlorotoluron blocked the photosynthetic ETC (Fuerst and Norman 1991) and damaged the reaction center (RC) of PSII (Barry et al. 1990). 1.6.2  Effects of Pesticides on the Dark Reactions The effect of OPs on photosynthesis, particularly on PSII activity, has been well documented. However, there are still very few studies on changes in the carbon assimilation reaction in response to OPs. Gas exchange measurement is one of the common ways to study the dark reactions of photosynthesis. Diffusion of gases from the air to the leaves is the major uptake pathway for the entry of lipophilic OPs (Jensen et al. 1992; Wild and Jones 1992; Wild et al. 2005). Many works reported that herbicides can also affect the dark reactions of photosynthesis. Several parameters such as gas exchange, photosynthetic pigment content, or carbohydrate levels are used to evaluate the effects of OPs on the dark reactions of photosynthesis. Foliar application of pesticides partially block

9

10

1  Effects of Organic Pollutants

stomatal pores and inhibit photosynthesis by hindering the exchange of gases. The phytotoxicities of several pesticides on photosynthesis were investigated by Xia et al. (2006) in cucumber (Cucumis sativus L. cv. Jinyan No. 4) by gas exchange measurements. A reduction in net photosynthetic rate (Pn), stomatal conductance (Gs) and intercellular CO2 concentration (Ci) were affected to varying degrees with different pesticides (Xia et al. 2006). Three‐year‐old grapevines were treated weekly three times with the herbicide chlorsulfuron (sulfonylurea) used at 0.01% of the dose usually applied on adjacent wheat fields. A 33% reduction of the net leaf photosynthesis and a 60% increase in the stomatal resistance were registered (Bhatti et al. 1997). The pre‐emergence herbicide clomazone (isoxazolidinone) used on wheat seedlings reduced concomitantly the photosynthetic rate and carotenoid content by more than 50% and the chlorophyll content by 70% in primary leaves (Kaňa et  al. 2004). Six‐week‐old grapevines grown in vitro were exposed to the herbicide flumioxazin (N‐phenylphthalimide) at a lower concentration than in the field (Saladin et  al. 2003b). Three weeks after the treatment, gas exchange and photosynthetic pigment contents were still reduced by 90% and 80% respectively. Moreover, plastids were strongly affected, exhibiting a spherical shape, thylakoid disorganization and the accumulation of many plastoglobules. Similarly, grapevine fruiting cuttings treated with the herbicide flumioxazin exhibited a decrease of CO2 fixation (Saladin et al. 2003b). However, in the vineyard the plants responded oppositely to the herbicide treatment since the CO2 assimilation and the photosynthetic pigment content were stimulated by 13% and 25% respectively (Saladin et al. 2003b). The enzymes involved in the photosynthesis process are not well documented after pesticide exposure. Nevertheless, it was shown that the herbicide propachlor (chloroacetanilide) used at the field dose on bean plants caused a reduction of Rubisco activity by 25% (Scarponi et al. 2002). Hydrolysis of the carbohydrate reserves takes place after a decrease in photosynthesis by which the plants counteract the loss due to sugar synthesis. Bean plants treated with the chloroacetanilide herbicide propachlor exhibited a loss of soluble carbohydrate and starch content (50% and 10% respectively) after 16 days (Scarponi et  al. 2001). Imazamox, an imidazolinone herbicide used on maize at the recommended dose caused a starch hydrolysis of 20% and a parallel accumulation of soluble carbohydrates by 32% within 96 hours after the treatment (Scarponi et al. 2001). The herbicide flumioxazin caused a strong accumulation of soluble carbohydrate (sucrose and then monosaccharides) and starch content in grapevine grown in vitro (Saladin et al. 2003a). The decline of photosynthesis reported before suggests that the plants react to herbicide stress by stimulating the uptake of sucrose from the medium by the root system. In the vineyard, the same herbicide caused an accumulation of hexoses and a parallel decrease of sucrose and starch content in mature leaves, suggesting a stimulation of monosaccharide synthesis (from reserve sugars and photosynthesis) (Saladin et al. 2003b). In this case, the treatment may have a favorable effect if the carbohydrates are then exported to sink organs and particularly to berries. In other cases, the herbicide treatments may inhibit the transport of photoassimilates, causing a local accumulation of carbohydrates. For example, the imazethapyr herbicide (imidazolinone) sprayed on pea plants strongly increased the total soluble sugar content by 40% and 50% in shoots and roots respectively after four weeks (Royuela et al. 2000). In this experiment, sucrose content increased by 30% in both leaves and roots, and starch content increased by 200% in shoots after the exposure to the herbicide. These studies suggest an impairment of photoassimilate translocation. In the leaves of grapevine fruiting

1.6  Effects of Organic Pollutants

cuttings, hexose content transiently decreased one week after the flumioxazin treatment, whereas sucrose and starch accumulated, suggesting that the grapevine adapts to the stress by storing carbohydrates in mature leaves, which may thus enhance the production of secondary metabolites (involved for example in defence mechanisms), but limit the translocation of sugars to the sink organs and subsequent growth (Saladin et  al. 2003a). Several works have also reported an adverse effect of insecticides and fungicides on plant photosynthesis. The net photosynthesis rate of azalea treated with insecticidal soap (potassium salts of fatty acids) was reduced by 50% one day after each treatment and recovered after seven days (Klingeman et al. 2000). Dark respiration was reduced by 25% 1 day after the treatment and recovered after 14 days. Moreover, the carbon use efficiency (ratio of carbon fixed into dry mass to the carbon fixed during photosynthesis) decreased by 42% during the first week and was still 9% lower after 14 days. Apple trees were treated with both sulfur (lime sulfur and Kumulus®) and non‐ sulfur containing fungicides (Palmer et al. 2003). The sulfur containing fungicides significantly decreased the net CO2 assimilation. In vitro grown grapevines treated with the fungicides pyrimethanil (anilinopyrimidine) and fludioxonil (phenylpyrrole) at field concentration or at a lower rate, exhibited a reduction of net photosynthesis by 30% (Saladin et al. 2003a). Simultaneously, starch was progressively hydrolyzed and the soluble carbohydrates accumulated in the leaves suggesting a mobilization of sugar reserves to counteract the lack of photoassimilates. In contrast, the same fungicides used in the vineyard stimulated photosynthesis and concomitantly decreased the carbohydrate content in mature leaves indicating a translocation of sugars to sink organs (Saladin et al. 2003a). 1.6.3  Effects of Antibiotics on the Light Reactions Antibiotics are used in human and veterinary medicine as well as an additive for animal feed in agriculture (Boxall 2004). They have environmental effects on many organisms (Santos et al. 2010; Crane et al. 2006; Guo et al. 2015). It has been demonstrated that photosynthetic organisms, i.e. plants and algae are quite sensitive to contamination of antibiotics. A few studies show that some antibiotics are severely harmful and toxic to lower plants like algae (Holten‐Lützhøft et al. 1999; Halling‐Sorensen 2000; Wollenberger et  al. 2000). Halling‐Sorensen (2000) reported that chlortetracycline, penicillin G, spiramycin, and olaquindox were toxic to Microcystis aeruginosa (Kutzing) Lemmermann. González‐Naranjo et al. (2015) performed experiments with ibuprofen and perfluorooctanoic acid (PFOA) on Sorghum bicolor (L.) Moench, which was found to cause inhibition of PSII activity. A mixture of PFOA and ibuprofen caused synergistic effects on PSII activity, which was probably due to nonspecific interaction of PFOA with cell membranes, which disturbed their structure and enhanced the uptake of ibuprofen by the plants, finally leading to loss of photosynthetic efficiency of plants. Few studies have reported the toxicity of antibiotics on the process of O2 evolution in algae (Kviderova and Henley 2005). However, the mechanism of inhibitory action of antibiotics on photosynthesis is not known. Chlorophyll fluorescence is a potential indicator of photosynthetic efficiency in higher plants and algae. It has been proven to be a rapid, non‐invasive, and reliable method to assess photosynthetic performance under environmental pollution (Krause and Weis 1991; Schreiber et al. 1994). Amoxicillin is commonly used antibiotic for treating and preventing diseases in humans and animals.

11

12

1  Effects of Organic Pollutants

There are reports showing that lactam antibiotics like Amoxicillin affect photosynthesis in a number of ways depending on the species (Pan et al. 2008). Amoxicillin at a concentration range of mg l−1 had a clear inhibitory effect on the donor and the acceptor side of PSII of Synechocystis sp. However, other target sites such as PSI may also be involved. In this work in vivo chlorophyll fluorescence parameters were used to derive results, for example, for the measurement of inactive PSII centers, the kinetics of QA were useful in detecting toxic effects of antibiotics. Chen et al. (2016) reported inhibitory effects of oxytetracycline on growth and photosynthetic capacity of rape (Brassica campestris L.). It inhibited growth, chlorophyll content, photosynthesis capacity, and also altered the energy between the two photosystems. The fraction of quantum yield of non‐photochemical fluorescence quenching in PSII was found to be higher in oxytetracycline treated samples. Exposure to Naldx, a fluoroquinolone (FQ) antibiotic, inhibited ETC in thylakoids to a greater extent than the inhibition of DNA synthesis and replication in chloroplasts isolated from pea (Mills et al. 1989) and reduced the production of ATP and NADPH in carrot cell cultures (Ciarrochi et al. 1985). These findings proposed that Naldx may act as an inhibitor of photosynthesis by interfering with the generation of reduced electron carriers, which eventually affects the production of ATP and NADPH. In vitro exposure of chloroplasts to non‐fluorinated quinolone containing compounds (Reil et al. 2001) resulted in the inhibition of PSII and the cytochrome b6f complexes. By structure–activity analysis, it was revealed that their action as quinone site inhibitors in PSII could be attributed to the quinolone ring and secondary amino group present typically in FQ antibiotics. Nalidixic acid (Naldx) and ciprofloxacin (Cipro) were found to stereo chemically interfere with the catalytic activity of the RC of PSII. Naldx occupies the same binding site as QB in RC of PSII and interacts with the amino acid residues required for the enzymatic reduction of QB. Cipro binds in a somewhat different manner, suggesting a different mechanism of interference probably with the transfer of absorbed excitation energy from antenna molecules to RC of PSII thereby delaying the photoreduction of QA. Spinach plants exposed to Cipro exhibited severe inhibition in plant growth evident from both the synthesis of leaves and growth of the roots. These results thus demonstrate that Cipro and related FQ antibiotics interfere with photosynthetic pathways along with causing morphological deformities in higher plants (Aristilde et al. 2010). The macrolides are broad‐spectrum antibiotics against many gram‐positive bacteria. Macrolide antibiotics were most harmful to algal photosynthesis (Isidori et al. 2005). Macrolide antibiotics have been detected at concentrations of ng l–1 to μg l–1 in surface waters (Alder et al. 2004; Lin and Tsai 2009). Discharge of pharmaceutical waste water without proper treatment may lead to their accumulation at some sites (Isidori et al. 2005). Erythromycin is one of the most commonly used macrolide antibiotics in both human and veterinary medicine and has been commonly detected in surface waters and sediments (Zuccato et al. 2001). Erythromycin significantly affected the photosynthesis of alga Selenastrum capricornutum Printz (Liu et  al. 2011). Erythromycin is toxic to Anabaena CPB4337 and Psedokirchneriella subcapitata (Korshikov) F. Hindak, and the sensitivity of algae to it varies with the species (Isidori et  al. 2005; Liu et  al. 2011; González‐Pleiter et al. 2013). Deng et al. (2014) investigated the toxic effects of erythromycin on PSI and PSII in M. aeruginosa. The activity and electron transport of PSII and PSI were affected by erythromycin in a concentration dependent manner. Exposure of erythromycin enhanced the quantum yield of cyclic electron flow (CEF) around PSI.

1.6  Effects of Organic Pollutants

Fluoroquinolone inhibited enzymes and the activity of RCs in PSII (Aristilde et  al. 2010). Toxic effects of antibiotics on PSII are well established in cyanobacteria or algae (Pan et al. 2008; Aristilde et al. 2010; Liu et al. 2011). PSI was found to be less sensitive to various antibiotics as compared to PSII (Singh et al. 2012; Belatik et al. 2013). The effects of antibiotics on PSI and the interaction between PSII and PSI are still unclear, and more research is required. Yang et  al. (2013) reported that tetracycline has very significant inhibitory effects on PSII activity in S. capricornutum. Oh et  al. (2005) worked on the seaweed, Porphyra yezoensis (Ueda), with six commercial antibiotics. Most of them showed a decrease in Chl a fluorescence parameters such as maximum efficiency of PSII (Fv/Fm). Quenching analysis of chlorophyll fluorescence revealed three different patterns in the antibiotic‐treated Porphyra: (i) with erythromycin thiocyanate‐B and amoxicillin trihydrate, high NPQ and low photochemical quenching (qP) (ii) with pefloxacin, high NPQ and high qP and (iii) with oxytetracycline, low NPQ and low qP. These results demonstrated that antibiotics affected the photosynthetic apparatus in various ways reflecting different sites of antibiotics. 1.6.4  Effects of Antibiotics on the Dark Reactions As compared to the light reactions of photosynthesis, very few studies have been done on the dark reactions’ response with antibiotics. Zhao‐Jun et al. (2011) reported that photosynthesis of Triticum aestivum L. was suppressed by oxytetracycline. This study indicated a significant decrease in photosynthetic rate (Pn), transpiration rate (Tr), and stomatal conductance (Gs) and the significant increase in intercellular CO2 concentrations (Ci), at all oxytetracycline levels (Zhao‐Jun et  al. 2011). Ribulose bisphosphate carboxylase (Rubisco) is an essential enzyme which catalyzes the addition of CO2 to ribulose 1,5‐bisphosphate during the Calvin cycle in dark reactions (Cooper 2000). Macrolides could adversely influence the activity of Rubisco and further inhibit synthesis and activity of ribulose 1,5‐bisphosphate in algae (Liu et al. 2011). 1.6.5  Effects of Bisphenol A on the Light Reactions The widely distributed pollutant BPA suppresses photosynthesis in higher and lower plants. Previous studies have reported that in higher plants, the quantum efficiency of PSII diminished when BPA was applied to soybean seedlings (Qiu et al. 2013). Most of the studies used chlorophyll fluorescence techniques to investigate the effects of BPA on photosynthetic parameters in tomato, lettuce, soybean, maize, and rice seedlings. The extent of the effects of BPA exposure on photosynthesis in these five plants was in this order: lettuce > tomato > soybean > maize > rice. The response in plants depended on the dose of BPA and plant species. A low dose (1.5 or 3.0 mg l−1) of BPA improved PSII efficiency, increased the absorption and conversion efficiency of absorbed light energy, and accelerated photosynthetic electron transport reactions. However, these effects weakened or disappeared after the withdrawal of BPA. A high dose (100 mg l−1) of BPA damaged the RC of PSII, inhibited photochemical reactions, and caused conversion of excess energy to heat in all treated plants. Li et al. (2018) demonstrated the sensitivity of PSI and PSII to BPA under darkness and light. In the darkness PSII and PSI both were insensitive to BPA while under light, BPA inhibited PSII activity but not the PSI. This study proved that turnover of D1

13

14

1  Effects of Organic Pollutants

protein was responsible for BPA‐induced PSII photoinhibition. It was also shown that BPA could directly inhibit photosynthesis in plants and did not damage PSII directly, but it over reduces the ETC under light which leads to an increased production of ROS (H2O2). The over‐accumulated ROS inhibits the turnover of D1 protein thereby aggravating photoinhibition of PSII. Synergistic effects of BPA and Cd were studied by Hu et al. (2014). Combined treatment with BPA (1.5 mg l−1) and Cd (0.2 mg l−1) improved the initial fluorescence (Fo), photochemical efficiency (Fv/Fm), quantum yield of PSII, rate of photosynthetic electron transport (ETR), and chlorophyll content synergistically. However higher doses (17.2/50.0 mg l−1 BPA and 3.0/10.0 mg l−1 Cd) damaged the photosynthetic apparatus. 1.6.6  Effects of Bisphenol A on the Dark Reactions Jiao et al. (2015) revealed effects of BPA on photosynthesis in soybean seedlings (Glycine max L.) keeping in view the stomatal factors (stomatal conductance and behaviors) and non‐stomatal factors (Rubisco activity, carboxylation efficiency, capacity to regenerate ribulose 1,5‐bisphospate and rate of utilization of triose phosphate). The study reported that a low dose of BPA enhanced net photosynthetic rate (Pn) primarily by promoting stomatal factors. A high dose of BPA inhibited the Pn by decreasing stomatal as well as non‐stomatal factors, and this inhibition caused further reduction in the relative growth rates of soybean seedlings. However, all the above mentioned parameters were restored to varying degrees when BPA was withdrawn. A decrease in CO2 assimilation with BPA treatment was also reported by Li et al. (2018) in cucumber plants. 1.6.7  Effects of Polycyclic Aromatic Hydrocarbons on the Light Reactions PAHs form a major group of environmental OPs. It has been demonstrated that PAH toxicity can inhibit plant growth and development by influencing various physiological and biochemical processes in a qualitative as well as quantitative manner (Jajoo et al. 2014; Li et al. 2008; Marwood et al. 2003). The plant response to the presence of PAHs is evoked after reaching of threshold concentration. It may affect all stages of plant growth, right from germination until reproduction (Kummerova et al. 1996; Tomar and Jajoo 2014). PAHs can enter the plants through stomata and roots and may pose a problem to plant photosynthesis (Kuhn et  al. 2004; Ren et  al. 1996). PAHs affect several primary metabolic processes including photosynthesis, respiration, enzyme activities, and pigment content (Alkio et al. 2005; Huang et al. 1996, 1997; Tomar and Jajoo 2014, 2015), lipid oxidation causing damage to membranes (Branquinho et al. 1997; Chiang et al. 1996). It also affects plant growth and development and is involved in regulatory mechanisms. PAHs are hydrophobic/lipophilic in nature and therefore can change permeability of membranes and activity of many enzymes (Liu et al. 2009). Images from Transmission electron microscopy have shown that PAHs cause large deformation in chloroplasts and may lead to oxidation stress (Liu et al. 2009). PAHs inhibit the oxygen evolving complex and the ETC in chloroplasts (Kummerova et al. 2006, 2008; Aksmann and Tukaj 2008). PAHs accumulate in thylakoids preferentially (Duxbury et al. 1997) and affect the ultrastructure of thylakoid membranes and thus adversely regulate structure and function of the photosynthetic apparatus (Kreslavski et al. 2014). An increasing concentration of PAHs in the environment, is leading to a change in plant hormones

1.6  Effects of Organic Pollutants

and the inhibition of photosynthesis rate (Ahammed et al. 2012; Kummerova et al. 2010; Tomar and Jajoo 2014). The key mechanism by which PAH affect plants is by inhibiting photosynthesis (Huang et al. 1997; Marwood et al. 2001). Assays of PSII electron transport with PAHs have been studied by several researchers, and it has been found to be extremely sensitive to PAHs (Marwood et al. 2001, Jajoo et al. 2014). PSII is the first protein complex in photosynthesis, and its inhibition by OPs in the chloroplast leads to a blockage in the whole ETC. With exposure of PAHs to plants, inhibition of electron transport of PSII was the primary event (Huang et al. 1997; Babu et al. 2001). Kummerova et al. (2006) reported that inhibition of PSII is probably due to excitation pressure on PSII, once the downstream electron transport was blocked. Quinonic compounds, products of PAH transformation, could interact with plastoquinones and disturb or stop the ETC (Kummerova and Vanova. 2007; Tomar and Jajoo 2015). Several studies reported that PSII could be blocked on both its sides; on the donor side between the oxygen evolving center and the RC with P680 resulting in a lower fluorescence signal, and on the acceptor side between P680, QA, QB, and plastoquinones leading to some increase in fluorescence (Tomar and Jajoo 2014; Kreslavski et al. 2014, 2017). Tomar and Jajoo (2013a) demonstrated that a PAH (fluoranthene) inhibited the number of active RCs thereby affecting the overall primary photochemistry. However, otherwise the actual efficiency of the active RC was not affected. Another study by Tomar and Jajoo (2013b) reported that fluoranthene causes significant effects on the function and structure of PSII. PSII exhibits heterogeneity with regards to connectivity, antenna size, and electron transfer beyond QA. This report described changes in PSII heterogeneity due to fluoranthene (FLT). Fluoranthene caused a change in antenna heterogeneity by converting active α centers into inactive β and γ centers. At the same time in the presence of fluoranthene, the number of QB non‐reducing centers also increased. Tomar et  al. (2015) studied the deleterious effect of anthracene in soybean plants. Results revealed that anthracene treatment had a negative effect on certain parameters such as RC density, absorption and trapping, maximum quantum yield of PSII, area over the fluorescence curve, and performance index (PI). An alteration in PSII heterogeneity with exposure of anthracene was also reported. The numbers of active RCs decreased with increasing concentration of anthracene, as QB reducing centers were converted into QB non‐reducing centers, and PSIIα centers were converted into PSIIβ and PSIIγ centers. The effects of PAHs on PSII heterogeneity could be an important reason for inhibition of PSII performance. Energy conversions of PSI and PSII in fluoranthene treated wheat (T. aestivum) plants were measured by Tomar and Jajoo (2017). The quantum yield of PSII, Y(II), reduced at 5 μM fluoranthene while the quantum yield of PSI, Y(I), significantly decreased at 25 μM fluoranthene. The decline of Y(II) was accompanied by an increase of non‐regulated energy dissipation, Y(NO). The decrease of Y(I) induced by fluoranthene was caused by donor side, Y(ND), and acceptor side, Y(NA), limitation of PSI. High concentration of fluoranthene led to activation of CEF which is associated with the inhibition of linear electron flow (LEF). The inhibition of LEF and induction in CEF was essential for the tolerance of PSI to fluoranthene toxicity. The toxicity of three different PAHs was performed by Jajoo et al. (2014) on Arabidopsis by measuring Chl a fluorescence induction kinetics (Figure 1.5). The results showed that 3‐ring anthracene was more inhibitory as compared to 2‐ring naphthalene and 4‐ring pyrene. The three PAHs chosen differ from each other in aromaticity

15

1  Effects of Organic Pollutants

(number of rings comprising their structure). This indicates that the aromaticity of PAHs is unrelated to their response in photosynthetic processes. The properties of PAHs may be altered biotically (cytochrome P450 mediated mono‐ oxygenation) or abiotically (photomodification or photosensitization) (Huang et  al. 1993). Exposure of PAHs to sunlight leads to the formation of photomodified PAHs. Natural sunlight or simulated light can enhance the toxicity of PAHs (Kummerova and Vanova 2007; Marwood et al. 2003; Tomar and Jajoo 2015). Although intact PAHs are toxic themselves, the problems associated with them increase with photomodification, as the photoproducts are more polar, more water soluble, and have better bioavailability (Duxbury et  al. 1997; Kummerova and Vanova 2007; Tomar and Jajoo 2015). More prominent effects of photomodified PAHs on plant growth in terms of PSII activity have been reported. A study done by Tomar and Jajoo (2015) demonstrated the photochemical effects of intact fluoranthene and photomodified fluoranthene in wheat plants and they reported that the inhibition observed on all investigated parameters was more prominent in the case of photomodified PAHs. 1.6.8  Effects of Polycyclic Aromatic Hydrocarbons on the Dark Reactions Tomar and Jajoo (2015) studied the effects of fluoranthene (a PAH) on the dark reactions of wheat plants. A negative correlation was observed between Pn and the concentration of fluoranthene. The net photosynthesis rate (Pn) was lowered by 39% in 5 μM and by 52% in 25 μM fluoranthene as compared to non‐treated plants. Stomatal conductance (Gs) and transpiration rate (Tr) both exhibited lower values in fluoranthene treatment. The reduction of photosynthesis may be due to stomatal or non‐stomatal

1200

1000 Fluorescence Intensity

16

Control Naph Pyr Anth

800

600

400

200 1E-5

1E-4

1E-3 0.01 Time (S)

0.1

1

Figure 1.5  Chl a fluorescence transients in control and plants treated with three different PAHs. Naph: naphthalene, Pyr: pyrene, Anth: anthracene. (See color plate section for the color representation of this figure.)

1.7  Conclusion and Future Prospects

factors. The adverse effect of fluoranthene on Pn was associated with decreased Gs and Tr. They concluded that photochemical damage in fluoranthene treated plants also contributed to reduced Pn. However, there was no significant change in internal CO2 concentration (Ci) with fluoranthene. In this study Pn and Gs showed lower values with fluoranthene exposure but Ci was the same as the control, indicating a role of some non‐stomatal factors. They noted a significant decline in carboxylation capacity (Pn/Ci) of fluoranthene treated plants. Non‐stomatal factors particularly the amount and activity of enzymes in the chloroplast allow the determination of Pn/Ci (Condon et  al. 1987). The unchanged value of Ci indicates a decrease in carboxylation capacity of fluoranthene treated plants. Oguntimehin et al. (2008) performed experiments with phenanthrene and fluoranthene on the photosynthetic traits of two‐year‐old Japanese red pine seedlings. Foliage was fumigated with solutions of PAHs (10 mM each) for three months. Fluoranthene had negative effects on net photosynthesis, stomatal conductance, and Rubisco activity of current‐year needles. Phenanthrene had similar negative effects but to a lesser extent compared to fluoranthene. Kobayashi et al. (2002) and Yoon et al. (2006) also reported a reduction in net photosynthesis, Pn and Gs, in Japanese red pine needles by these two PAHs. The plants were fumigated with photo‐Fenton reagent (an OH radical‐generating solution). They suggested that like the OH radical and O3 which damage or inhibit photosynthesis (Farage et al. 1991; Nakatani 2004), PAHs affect the pine seedlings in a similar way. The inhibition of any step within the photosynthetic machinery will decrease the ability to utilize the light energy that it receives. In addition, the decreased effect of Gs might also cause decreased Pn values. Stomatal resistance is directly related to the diffusion of the pollutants across stomata. This stomatal limitation was observed in plants fumigated with PAHs. Fumigation of PAHs on pine leaves took around three months to produce any significant effect on the rate of photosynthetic and stomatal conductance. Tomato plants treated with fluoranthene exhibited severe changes in the rate of net photosynthesis (Oguntimehin et al. 2010). This study revealed that the ROS generated may be responsible for the damage. At saturating light, the photosynthetic rate was approximately 37% lower in fluoranthene‐treated plants compared to the control. Other parameters such as stomata conductance and total pigment content were also significantly reduced in the fluoranthene treated tomato leaves.

1.7 ­Conclusion and Future Prospects Organic pollutants such as pesticides, antibiotics, BPA, and PAHs are widespread environmental pollutants which deserve special attention. Although some research has been done to unravel the harmful effects of OPs on plant growth and photosynthesis, mechanisms underlying the physiological effects need to be elucidated. Toxic OPs can be taken up by plants through roots and foliage. In this chapter we have summarized effects of OPs on the light reactions and dark reactions of photosynthesis. OPs have the potential to influence the primary processes of photosynthesis, particularly PSII complex. Chl a fluorescence is used as an indicator to assess toxicity of OPs on plants and algae. This technique and its interpretations can be applied to monitor the effects of environmental pollutants on varied samples like higher plants, algae, etc. Based on the

17

18

1  Effects of Organic Pollutants

literature, we conclude that these pollutants have a potential risk to plant growth and crop yield through inhibition of the light reactions as well as the dark reactions of photosynthesis. Molecular mechanisms underlying the effects of OPs need to be investigated to unravel their mechanism of action and then to plan protective strategies. An improved understanding of these factors will allow strategies to be planned to reduce the harmful impacts of pollutants.

­References Ahammed, G.J., Yuan, H.L., Ogweno, J.O. et al. (2012). Brassinosteroid alleviates phenanthrene and pyrene phytotoxicity by increasing detoxification activity and photosynthesis in tomato. Chemosphere 86: 546–555. Ahmed, A.M., Heikal, M.D., and Hindawy, O.S. (1983). Side effects of benomyl (Fungicide) treatments on sunflower, cotton and cowpea plants. Phyton 23: 185–195. Aksmann, A. and Tukaj, Z. (2008). Intact anthracene inhibits photosynthesis in algal cells: a fluorescence induction study on Chlamydomonas reinhardtii cw92 strain. Chemosphere 74: 26–32. Alder, A.C., McArdell, C.S., and Golet, E.M. (2004). Environmental exposure of antibiotics in Switzerland. In: Pharmaceuticals in the Environment: Sources Fate, Effects and Risks (ed. K. Kümmerer), 63–64. Freiburg: Springer. Alkio, M., Tabuchi, T.M., Wang, X., and Colón‐Carmona, A. (2005). Stress responses to polycyclic aromatic hydrocarbons in Arabidopsis include growth inhibition and hypersensitive response‐like symptoms. J. Exp. Bot. 56: 2983–2994. Aristilde, L., Melis, A., and Sposit, G. (2010). Inhibition of photosynthesis by a fluoroquinolone antibiotic. Environ. Sci. Technol. 44: 1444–1450. Babu, T.S., Marder, J.B., Tripuranthakam, S. et al. (2001). Synergistic effects of a photooxidized polycyclic aromatic hydrocarbon and copper on photosynthesis and plant growth: evidence that in vivo formation of reactive oxygen species is a mechanism of copper toxicity. Environ. Toxicol. Chem. 20: 1351–1358. Barry, P., Young, A.J., and Briton, G. (1990). Photodestruction in higher plants by herbicide action. J. Exp. Bot. 41: 123–126. Belatik, A., Hotchandani, S., and Tajmir‐Riahi, H.A. (2013). Alteration of the structure and function of photosystem I by Pb2+. J. Photochem. Photobiol. B 123: 41–47. Bernes, C. (1998). Persistent Organic Pollutants. Stockholm: Swedish Environmental Protection Agency. Bhatti, M.A., Al‐Khatib, K., and Parker, R. (1997). Wine grape (Vitis vinifera) response to fall exposure of simulated drift from selected herbicides. Weed Technol. 11: 532–536. Bi, Y.F., Miao, S.S., Lu, Y.C. et al. (2012). Phytotoxicity, bioaccumulation and degradation of isoproturon in green algae. J. Hazard. Mater. 243: 242–249. Bielecki, K., Dziamska, A., and Sarapuk, J. (2001). Physiological activity of some aminophosphates. Z. Naturforsch. 56c: 995–998. Bowes, G.W. (1972). Uptake and metabolism of 2, 2‐bis‐(p‐Chlorophenyl)‐1, 1, 1‐ trichloroethane (DDT) by marine phytoplankton and its effects on growth and chloroplast electron transport. Plant Physiol. 49: 172–176.

­  References

Boxall, A.B.A. (2004). The environmental side effects of medication: how are human and veterinary medicines in soils and water bodies affecting human and environmental health? EMBO Rep. 5: 1110–1116. Branquinho, C., Brown, D.H., and Catarino, F. (1997). The cellular location of Cu in lichens and its effects on membrane integrity and chlorophyll fluorescence. Environ. Exp. Bot. 38: 165–179. Chauhan, S.S., Agrawal, S., and Srivastava, A. (2013). Effect of imidacloprid insecticide residue on biochemical parameters in potatoes and its estimation by HPLC. Asian J. Pharm. Clin. Res. 6: 114–117. Chen, X.N., Qiu, D.Y., and Lin, H.M. (2016). Botanical characteristics and medicinal value of five Glycyrrhiza species cultivated in the Hexi region of Gansu. Acta Prataculturae Sin. 25: 246–253. Chiang, P., Li, K.P., and Hseu, T.M. (1996). Spectrochemical behavior of carcinogenic polycyclic aromatic hydrocarbons in biological systems. Part II: a theoretical rate model for BaP metabolism in living cells. Appl. Spectrosc. 50: 1352–1359. Ciarrochi, G., Nielsen, E., and Cella, R. (1985). Effect of nalidixic acid and novobiocin on the metabolism of suspension of cultured carrot cells. Physiol. Plant. 64: 513–518. Condon, A.G., Richards, R.A., and Farquhar, G.D. (1987). Carbon isotope discrimination is positively correlated with grain yield and dry matter production in field‐grown Wheat. Crop Sci. 27: 996–1001. Cooper, G.M. (2000). The cell: a molecular approach. In: Cell Metabolism, 6e (ed. R. Meyer), 89–91. Sunderland: Sinauer Associates. Coskun, Y., Kilic, S., and Duran, R.E. (2015). The effects of the insecticide pyriproxyfen on germination, development and growth responses of maize seedlings. Fresenius Environ. Bull. 24: 278–284. Crane, M., Watts, C., and Boucard, T. (2006). Chronic aquatic environmental risks from exposure to human pharmaceuticals. Sci. Total Environ. 367: 23–41. Dachs, J., Lohmann, R., Ockenden, W.A. et al. (2002). Oceanic biogeochemical controls on global dynamics of persistent organic pollutants. Environ. Sci. Technol. 36: 4229–4237. Dekker, J.P. and Boekema, E.J. (2005). Supramolecular organization of thylakoid membrane proteins in green plants. Biochim. Biophys. Acta 1706: 12–39. Deng, C.N., Zhang, D.Y., and Pan, X.L. (2014). Toxic effects of erythromycin on photosystem I and II in Microcystis aeruginosa. Photosynthetica 52: 574–580. Dogan, M., Yumrutas, O., Saygideger, S.D. et al. (2010). Effects of bisphenol A and tetrabromobisphenol A on chickpea roots in germination stage. Am. Eurasian J. Agric. Environ. Sci. 9: 186–192. Du, Q., Jia, X., and Yuan, B. (2006). Toxic effects of 1, 2, 4‐trichlorobenzene on rice seed germination and seedling growth. Chin. J. Appl. Ecol. 17: 2185–2188. Duxbury, C.L., Dixon, D.G., and Greenberg, B.M. (1997). Effects of simulated solar radiation on the bioaccumulation of polycyclic aromatic hydrocarbons by the duckweed Lemna gibba. Environ. Toxicol. Chem. 16: 1739–1748. El‐Shahawi, M.S., Hamza, A., Bashammakh, A.S., and Al‐Saggaf, W.T. (2010). An overview on the accumulation, distribution, transformations, toxicity and analytical methods for the monitoring of persistent organic pollutants. Talanta 80: 1587–1597. Farage, P.K., Long, S.P., Lechner, E.G., and Baker, N.R. (1991). The sequence of change within the photosynthetic apparatus of wheat following short time exposure to ozone. Plant Physiol. 95: 529–535.

19

20

1  Effects of Organic Pollutants

Faraloni, C., Cutino, I., Petruccelli, R. et al. (2011). Chlorophyll fluorescence technique as a rapid tool for in vitro screening of olive cultivars (Olea europaea L.) tolerant to drought stress. Environ. Exp. Bot. 73: 49–56. Fedtke, C. (1982). Biochemistry and Physiology of Herbicide Action. Berlin: Springer‐Verlag. Fuerst, E.P. and Norman, M.A. (1991). Interactions of herbicides with photosynthetic electron transport. Weed Sci. 39: 458–464. Gang, N.J.Y. and Xitao, L. (2005). Advances in photolysis of persistent organic pollutants in water. Prog. Chem. 17: 938–948. Garcia, P.C., Rivero, R.M., Ruiz, J.M., and Romero, L. (2003). The role of fungicides in the physiology of higher plants: implications for defence responses. Bot. Rev. 69: 162–172. Gonzales, M., Miglioranza, K.S.B., Aizpún De Moreno, J.E., and Moreno, V.J. (2003). Organochlorine pesticide residues in Leek (Allium porrum) crop grown on untreated soils from an agricultural environment. J. Agric. Food. Chem. 51: 5024–5029. González‐Naranjo, V., Boltes, K., de Bustamante, I., and Palacios‐Diaz, P. (2015). Environmental risk of combined emerging pollutants in terrestrial environments: chlorophyll a fluorescence analysis. Environ. Sci. Pollut. Res. 22: 6920–6931. González‐Pleiter, M., Gonzalo, S., and Rodea‐Palomares, I. (2013). Toxicity of five antibiotics and their mixtures towards photosynthetic aquatic organisms: implication for environmental risk assessment. Water Res. 47: 2050–2064. Grenvald, J.C., Nielsen, T.G., and Hjorth, M. (2013). Effects of pyrene exposure and temperature on early development of two co‐existing Arctic copepods. Ecotoxicology 22: 184–198. Guo, J., Boxall, A., and Selby, K. (2015). Do pharmaceuticals pose threat to primary producers? Crit. Rev. Env. Sci. Technol. 45: 2565–2610. Halling‐Sorensen, B. (2000). Algal toxicity of antibacterial agents used in intensive farming. Chemosphere 40: 731–739. Hanano, A., Almousally, I., Shaban, M. et al. (2015). Differential tissue accumulation of 2,3,7,8‐Tetrachlorinated dibenzo‐p‐dioxin in Arabidopsis thaliana affects plant chronology, lipid metabolism and seed yield. BMC Plant Biol. 15: 193. Holten‐Lützhøft, H.C., Halling‐Sørensen, B., and Jørgensen, S.E. (1999). Algal toxicity of antibacterial agents applied in Danish fish farming. Arch. Environ. Contam. Toxicol. 36: 1–6. Hu, H., Wang, L., Wang, Q. et al. (2014). Photosynthesis, chlorophyll fluorescence characteristics, and chlorophyll content of soybean seedlings under combined stress of bisphenol A and cadmium. Environ. Toxicol. Chem. 33: 2455–2462. Huang, X.D., Dixon, D.G., and Greenberg, B.M. (1993). Impacts of UV radiation and photomodification on the toxicity of PAHs to the higher plant Lemna gibba (duckweed). Environ. Toxicol. Chem. 12: 1067–1077. Huang, X.D., Zeiler, L.F., Dixon, D., and Greenberg, B.M. (1996). Photoinduced toxicity of PAHs to the foliar regions of Brassica napus (Canola) and Cucumbis sativus (Cucumber) in simulated solar radiation. Ecotoxicol. Environ. Saf. 35: 190–197. Huang, X.D., McConkey, B.J., Babu, T.S., and Greenberg, B.M. (1997). Mechanisms of photoinduced toxicity of photomodified anthracene to plants: inhibition of photosynthesis in the aquatic higher plant Lemna gibba (duckweed). Environ. Toxicol. Chem. 16: 1707–1715. Isidori, M., Lavorgna, M., and Nardelli, A. (2005). Toxic and genotoxic evaluation of six antibiotics on non‐target organisms. Sci. Total Environ. 346: 87–98.

­  References

Jajoo, A. (2017). Effects of environmental pollutants polycyclic aromatic hydrocarbons (PAH) on photosynthetic processes. In: Photosynthesis: Structures, Mechanisms, and Applications (ed. H. Hou, M. Najafpour, G. Moore and S. Allakhverdiev). Cham: Springer. Jajoo, A., Mekala, N.R., Tomar, R.S. et al. (2014). Inhibitory effects of polycyclic aromatic hydrocarbons (PAHs) on photosynthetic performance are not related to their aromaticity. J. Photochem. Photobiol. B 137: 151–155. Jensen, S., Eriksson, G., Kylin, H., and Strachan, W. (1992). Atmospheric pollution by persistent organic compounds: monitoring with pine needles. Chemosphere 24: 229–245. Jiao, L., Wang, L., Qiu, Z. et al. (2015). Effects of bisphenol A on chlorophyll synthesis in soybean seedlings. Environ. Sci. Pollut. Res. 22: 5877–5886. Kaňa, R., Špundová, M., Ilík, P. et al. (2004). Effect of herbicide clomazone on photosynthetic processes in primary barley (Hordeum vulgare L.) leaves. Pestic. Biochem. Physiol. 78: 161–170. Katsoyiannis, A. and Samara, C. (2005). Persistent organic pollutants (POPs) in the conventional activated sludge treatment process: fate and mass balance. Environ. Res. 97: 245–257. Kaushik, S. and Inderjit, S. (2006). Phytotoxicity of selected herbicides to mung bean (Phaseolus aureus Roxb.). Environ. Exp. Bot. 22: 41–48. Khan, M.S., Chaudhary, P., Wani, P.A., and Zaidi, A. (2006). Biotoxic effects of the herbicides on growth, seed yield and grain protein of green gram. J. Appl. Sci. Environ. Manage 10: 141–146. Klingeman, W.E., Bunti, G.D., van Irsel, M.W., and Braman, S.K. (2000). Whole plant gas exchange, not individual‐leaf measurements, accurately assesses azalea response to insecticides. Crop Prot. 19: 407–415. Kobayashi, T., Nakatani, N., Hirakawa, T. et al. (2002). Variation in CO2 assimilation rate induced by simulated dew waters with different sources of hydroxyl radical (OH*) on the needle surfaces of Japanese red pine (Pinus densiflora Sieb. et Zucc.). Environ. Pollut. 118: 383–391. Kömp, P. and McLachlan, M.S. (1997). Influence of temperature on the plant/air partitioning of semivolatile organic compounds. Environ. Sci. Technol. 31: 886–890. Krause, G.H. and Weis, E. (1991). Chlorophyll fluorescence and photosynthesis: the basics. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42: 313–349. Kreslavski, V.D., Lankin, A.V., Vasilyeva, G.K. et al. (2014). Effects of polyaromatic hydrocarbons on photosystem II activity in pea leaves. Plant Physiol. Biochem. 81: 135–142. Kreslavski, V.D., Brestic, M., Zharmukhamedov, S.K. et al. (2017). Mechanisms of inhibitory effects of polycyclic aromatic hydrocarbons in photosynthetic primary processes in pea leaves and thylakoid preparations. Plant Biol. https://doi.org/10.1111/ plb.12598. Kuhn, A., Ballach, H.J., and Wittig, R. (2004). Studies in the biodegradation of 5 PAHs (Phenanthrene, pyrene, fluoranthene, chrysene and benzo[a]pyrene) in the presence of rooted poplar cuttings. Environ. Sci. Pollut. Res. 11: 22–32. Kumar, K.S. and Han, T. (2011). Toxicity of single and combined herbicides on PSII maximum efficiency of an aquatic higher plant, Lemna sp. Toxicol. Environ. Health Sci. 3: 97–105. Kumar, K.S., Watanabe, K., Takemori, H. et al. (2005). Analysis of UNEP priority POPs using HRGC‐HRMS and their contamination profiles in livers and eggs of great

21

22

1  Effects of Organic Pollutants

cormorants (Phalacrocorax carbo) from Japan. Arch. Environ. Contam. Toxicol. 48: 538–551. Kummerova, M. and Vanova, L. (2007). Chlorophyll fluorescence as an indicator of fluoranthene phototoxicity. Plant Soil Environ. 53: 430–436. Kummerova, M., Gloser, J., Slovak, L., and Holoubek, I. (1996). Project Tocoen. The fate of selected organic compounds in the environment. The growth response of maize to increasing concentrations of fluoranthene. Toxicol. Environ. Chem. 54: 99–106. Kummerova, M., Krulova, J., Zezulka, S., and Triska, J. (2006). Evaluation of fluoranthene phytotoxicity in pea plants by Hill reaction and chlorophyll fluorescence. Chemosphere 65: 489–496. Kummerova, M., Vanova, L., Krulova, J., and Zezulka, S. (2008). The use of physiological characteristics for comparison of organic compounds phytotoxicity. Chemosphere 71: 2050–2059. Kummerova, M., Vanova, L., Fiserova, H. et al. (2010). Understanding the effect of organic pollutant fluoranthene on pea in vitro using cytokinins, ethylene, ethane and carbon dioxide as indicators. Plant Growth Regul. 61: 161–174. Kviderova, J. and Henley, W.J. (2005). The effect of ampicillin plus streptomycin on growth and photosynthesis of two halotolerant chlorophyte algae. J. Appl. Phycol. 17: 301–307. La Rocca, N., dalla Vecchia, F., Barbato, R. et al. (2000). Plastid photodamage and Cab gene expression in barley leaves. Physiol. Plant. 109: 51–57. Laviale, M., Morin, S., and Créach, A. (2011). Short term recovery of periphyton photosynthesis after pulse exposition to the photosystem II inhibitors atrazine and isoproturon. Chemosphere 84: 731–734. Li, J.H., Gao, Y., Wu, S.C. et al. (2008). Physiological and biochemical responses of rice (Oryza sativa L.) to phenanthrene and pyrene. Int. J. Phytorem. 10: 106–118. Li, Y.T., Liang, Y., Li, Y.N. et al. (2018). Mechanisms by which bisphenol A affect the photosynthetic apparatus in cucumber (Cucumis sativus L.) leaves. Sci. Rep. 8: 4253. Liao, Y. and Chen, G. (2007). Physiological adaptability of three mangrove species to salt stress. Acta Ecol. Sin. 27: 2208–2214. Lin, A.Y.C. and Tsai, Y.T. (2009). Occurrence of pharmaceuticals in Taiwan’s surface waters: Impact of waste streams from hospitals and pharmaceutical production facilities. Sci. Total Environ. 407: 3793–3802. Liu, H., Weisman, D., Ye, Y.B. et al. (2009). An oxidative stress response to polycyclic aromatic hydrocarbon exposure is rapid and complex in Arabidopsis thaliana. Plant Sci. 176: 375–382. Liu, B.Y., Nie, X.P., Liu, W.Q. et al. (2011). Toxic effects of erythromycin, ciprofloxacin and sulfamethoxazole on photosynthetic apparatus in Selenastrum capricornutum. Ecotoxicol. Environ. Saf. 74: 1027–1035. Magnusson, M., Heimann, K., Quayle, P., and Negri, A. (2010). Additive toxicity of herbicide mixtures and comparative sensitivity of tropical benthic microalgae. Mar. Pollut. Bull. 60: 1978–1987. Marwood, C.A., Solomon, K.R., and Greenberg, B.M. (2001). Chlorophyll fluorescence as a bioindicator of effects on growth in aquatic macrophytes from mixtures of polycyclic aromatic hydrocarbons. Environ. Toxicol. Chem. 20: 890–898. Marwood, C.A., Bestari, K.T.J., Gensemer, R.W. et al. (2003). Creosote toxicity to photosynthesis and plant growth in aquatic microcosms. Environ. Toxicol. Chem. 22: 1075–1085.

­  References

Mills, W.R., Reeves, M., Fowler, D.L., and Capo, S.F. (1989). DNA synthesis in chloroplasts: III. The DNA gyrase inhibitors nalidixic acid and novobiocin inhibit both thymidine incorporation into DNA and photosynthetic oxygen evolution by isolated chloroplasts. J. Exp. Bot. 40: 425–429. Mishra, V., Srivastava, G., Prasad, S.M., and Abraham, G. (2008). Growth, photosynthetic pigments and photosynthetic activity during seedling stage of cowpea (Vigna unguiculata) in response to UV‐B and dimethoate. Pestic. Biochem. Physiol. 92: 30–37. Mitra, J. and Raghu, K. (1998). Pesticides non target plants interactions: an overview. Arch. Agron. Soil Sci. 43: 445–500. Nakatani N (2004). Study of hydroxyl radical photo‐formation in environmental aqueous phase and its effects on plant. PhD thesis. Hiroshima University. Naumann, J.C., Anderson, J.E., and Young, D.R. (2010). Remote detection of plant physiological responses to TNT soil contamination. Plant Soil 329: 239–248. Nelson, N. and Ben‐Shem, A. (2004). The complex architecture of oxygenic photosynthesis. Nat. Rev. Mol. Cell Biol. 5: 971–982. Ockenden, W.A., Sweetman, A., Prest, H.F. et al. (1998). Toward an understanding of the global atmospheric distribution of persistent organic pollutants: the use of semi‐ permeable membrane devices as time integrated passive samplers. Environ. Sci. Technol. 32: 2795–2803. Oguntimehin, I., Nakatani, N., and Sakugawa, H. (2008). Phytotoxicities of fluoranthene and phenanthrene deposited on needle surfaces of the evergreen conifer, Japanese red pine (Pinus densiflora Sieb. et Zucc.). Environ. Pollut. 154: 264–271. Oguntimehin, I., Eissa, F., and Sakugawa, H. (2010). Negative effects of fluoranthene on the ecophysiology of tomato plants (Lycopersicon esculentum Mill): fluoranthene mists negatively affected tomato plants. Chemosphere 78: 877–884. Oh, M.H., Kang, Y.H., Lee, C.H., and Chung, I.K. (2005). Effects of six antibiotics on the activity of the photosynthetic apparatus and ammonium uptake of thallus of Porphyra yezoensis. Algae 20: 121–125. Oukarroum, A., Perreault, F., and Popovic, R. (2012). Interactive effects of temperature and copper on photosystem II photochemistry in Chlorella vulgaris. J. Photochem. Photobiol. B 110: 9–14. Owen, W.J., Delaney, M.E., and Rogers, L.J. (1977). Studies on the sites of inhibition of photosynthetic electron transport in Barley by DDT (1, 1, 1‐trichloro‐2, 2‐bis (p‐ chlorophenyl) ethane). J. Exp. Bot. 28: 986–998. Pašková, V., Hilscherová, K., Feldmannová, M., and Bláha, L. (2006). Toxic effects and oxidative stress in higher plants exposed to polycyclic aromatic hydrocarbons and their N‐heterocyclic derivatives. Environ. Toxicol. Chem. 25: 3238–3245. Palmer, J.W., Davies, S.B., Shaw, P.W., and Wünsche, J.N. (2003). Growth and fruit quality of “Braeburn” apple (Malus domestica) trees as influenced by fungicide programmes suitable for organic production. N. Z. J. Crop Hortic. Sci. 31: 169–177. Pan, X., Deng, C., Zhang, D. et al. (2008). Toxic effects of amoxicillin on the photosystem II of Synechocystis sp. characterized by a variety of in vivo chlorophyll fluorescence tests. Aquat. Toxicol. 89: 207–213. Pascal, S., Gullner, G., Kömives, T., and Scalla, R. (2000). Selective induction of glutathione‐S‐transferase subunits in wheat plants exposed to the herbicide acifluorfen. Z. Naturforsch. 55c: 37–39.

23

24

1  Effects of Organic Pollutants

Qiu, Z., Wang, L., and Zhou, Q. (2013). Effects of bisphenol A on growth, photosynthesis and chlorophyll fluorescence in above‐ground organs of soybean seedlings. Chemosphere 90: 1274–1280. Reil, E., Hofle, G., Draber, W., and Oettmeier, W. (2001). Quinolones and their N‐oxides as inhibitors of photosystem II and the cytochrome b6/f‐complex. Biochim. Biophys. Acta 1506: 127–132. Ren, L., Zeiler, L.F., Dixon, D.G., and Greenberg, B.M. (1996). Photoinduced effects of polycyclic aromatic hydrocarbons on Brassica napus (Canola) during germination and early seedling development. Ecotoxicol. Environ. Saf. 33: 73–80. Royuela, M., Gonzales, A., Gonzales, E.M. et al. (2000). Physiological consequences of continuous, sublethal imazethapyr supply to pea plants. J. Plant Physiol. 157: 345–354. Saladin, G., Magné, C., and Clément, C. (2003a). Effects of fludioxonil and pyrimethanil, two fungicides used against Botrytis cinerea, on carbohydrate physiology in Vitis vinifera L. Pest Manage. Sci. 59: 1083–1092. Saladin, G., Magné, C., and Clément, C. (2003b). Impact of flumioxazin herbicide on growth and carbohydrate physiology in Vitis vinifera L. Plant Cell Rep. 21: 821–827. Santos, L.H.M.L.M., Araujo, A.N., Fachini, A. et al. (2010). Ecotoxicological aspects related to the presence of pharmaceuticals in the aquatic environment. J. Hazard. Mater. 175: 45–95. Scarponi, L., Vischetti, C., and del Buono, D. (2001). Imazamox in maize: uptake, persistence and interference on protein and carbohydrate formation. Ital. J. Food Sci. 13: 213–220. Scarponi, L., Vischetti, C., and Hassan, N.M. (2002). Effects of propachlor on the formation of carbohydrates and proteins in Vicia faba and the response of its defence mechanisms. Agrochimica 46 (3–4): 165–175. Schreiber, U., Bilger, W., and Neubauer, C. (1994). Chlorophyll fluorescence as a noninvasive indicator for rapid assessment of in vivo photosynthesis. In: Ecophysiology of Photosynthesis (ed. E.D. Schulze and M.M. Calswell), 49–70. Berlin: Springer. Shakir, S.K., Kanwal, M., Murad, W. et al. (2016). Effect of some commonly used pesticides on seed germination, biomass production and photosynthetic pigments in tomato (Lycopersicon esculentum). Ecotoxicology 25: 329–341. Shanmugapriya, A.K., Sivakumar, T., and Panneerselvam, R. (2013). Difenoconazole and Tricyclazole induced changes in photosynthetic pigments of Lycopersicon esculentum L. Int. J. Agric. Food Sci. 3: 72–75. Sharma, C., Mathur, S., Tomar, R.S., and Jajoo, A. (2017). Investigating role of Triton X‐100 in ameliorating deleterious effects of anthracene in wheat plants. Photosynthetica 55: 1–8. Sharples, C.R., Null, M.R., and Cobb, A.H. (1997). Growth and photosynthetic characteristics of two biotypes of the weed black‐grass (Alopecurus myosuroides Huds) resistant and susceptible to the herbicide chlorotoluron. Ann. Bot. 79: 455–461. Simonich, S.L. and Hites, R.A. (1994). Vegetation‐atmosphere partitioning of polycyclic aromatic hydrocarbons. Environ. Sci. Technol. 28: 939–943. Simonich, S.L. and Hites, R.A. (1995). Organic pollutant accumulation in vegetation. Environ. Sci. Technol. 29: 2905–2914. Singh, R., Dubey, G., and Singh, V.P. (2012). High light intensity augments mercury toxicity in cyanobacterium Nostoc muscorum. Biol. Trace Elem. Res. 149: 262–272.

­  References

Tang, H.F., Sheng, X.M., Xiong, L. et al. (2006). The impact of organophosphates pesticide to soluble protein and several oxidant enzymes in vegetable. J. Cent. China Normal Univ. Nat. Sci. 1: 1000–1190. Thakkar, M., Randhawa, V., and Wei, L. (2013). Comparative responses of two species of marine phytoplankton to metolachlor exposure. Aquat. Toxicol. 126: 198–206. Tiyagi, S.A., Ajaz, S., and Azam, M.F. (2004). Effect of some pesticides on plant growth, root nodulation and chlorophyll content of chickpea. Arch. Agron. Soil Sci. 50: 529–533. Tomar, R.S. and Jajoo, A. (2013a). A quick investigation of the detrimental effects of environmental pollutant polycyclic aromatic hydrocarbon fluoranthene on the photosynthetic processes. Ecotoxicology 22: 1313–1318. Tomar, R.S. and Jajoo, A. (2013b). Alteration in PSII heterogeneity under the influence of polycyclic aromatic hydrocarbon (fluoranthene) in wheat leaves (Triticum aestivum). Plant Sci. 209: 58–63. Tomar, R.S. and Jajoo, A. (2014). Fluoranthene, a polycyclic aromatic hydrocarbon, inhibits light as well as dark reactions of photosynthesis in wheat (Triticum aestivum). Ecotoxicol. Environ. Saf. 109: 110–115. Tomar, R.S. and Jajoo, A. (2015). Photomodified fluoranthene exerts more harmful effects as compared to intact fluoranthene by inhibiting growth and photosynthetic processes. Ecotoxicol. Environ. Saf. 122: 31–36. Tomar, R.S. and Jajoo, A. (2017). Photosystem I (PSI) becomes more tolerant to fluoranthene due to initiation of cyclic electron flow (CEF). Funct. Plant Biol. 44: 978–984. Tomar, R.S., Sharma, A., and Jajoo, A. (2015). Assessment of phytotoxicity of anthracene in soybean (Glycine max) with a quick method of chlorophyll fluorescence. Plant Biol. 17: 870–876. Váňová, L., Kummerová, M., and Votrubová, O. (2011). Fluoranthene‐induced production of ethylene and formation of lysigenous intercellular spaces in pea plants cultivated in vitro. Acta Physiol. Plant. 33: 1037–1042. Wagrovski, D.M. and Hites, R.A. (1997). Polycyclic aromatic hydrocarbon accumulation in urban, suburban, and rural vegetation. Environ. Sci. Technol. 31: 279–282. Wei, H., Song, S., Tian, H., and Liu, T. (2014). Effects of phenanthrene on seed germination and some physiological activities of wheat seedling. C.R. Biol. 337: 95–100. Wenzel, T., Simon, R., Anklam, E., and Kleiner, J. (2006). Analytical methods for polycyclic aromatic hydrocarbons (PAHs) in food and the environment needed for new food legislation in the European Union. Trends Anal. Chem. 25: 716–725. White, J.C. (2002). Differential bioavailability of field‐weathered p, p’‐DDE to plants of the Cucurbita and Cucumis genera. Chemosphere 49: 143–152. Wild, S.R. and Jones, K.C. (1992). Polynuclear aromatic hydrocarbons uptake by carrots grown in sludge amended soil. J. Environ. Qual. 21: 217–225. Wild, E., Dent, J., Thomas, G.O., and Jones, K.C. (2005). Direct observation of organic contaminant uptake, storage, and metabolism with plant roots. Environ. Sci. Technol. 39: 3695–3702. Wollenberger, L., Halling‐Sorensen, B., and Kusk, K.O. (2000). Acute and chronic toxicity of veterinary antibiotics to Daphnia magna. Chemosphere 40: 723–730. Xia, X.J., Huang, Y.Y., Wang, L. et al. (2006). Pesticides‐induced depression of photosynthesis was alleviated by 24‐epibrassinolide pretreatment in Cucumis sativus L. Pestic. Biochem. Physiol. 86: 42–48.

25

26

1  Effects of Organic Pollutants

Yang, W., Tang, Z., Zhou, F. et al. (2013). Toxicity studies of tetracycline on Microcystis aeruginosa and Selenastrum capricornutum. Environ. Toxicol. Pharmacol. 35: 320–324. Ye, Y., Tam, N.F.Y., Wong, Y.S., and Lu, C.Y. (2003). Growth and physiological responses of two mangrove species (Bruguiera gymnorrhiza and Kandelia candel) to water logging. Environ. Exp. Bot. 49: 209–221. Yildiztekin, M., Kaya, C., Tuna, A.L., and Ashraf, M. (2015). Oxidative stress and antioxidative mechanisms in tomato (Solanum lycopersicum l.) plants sprayed with different pesticides. Pak. J. Bot. 47: 717–721. Ying, Y., Yong, Y., Dawson, R. et al. (2005). A spatial temporal assessment of pollution from PCBs in China. Chemosphere 60: 731–739. Yoon, J., Abe‐Suzuki, M., Eko, P. et al. (2006). Negative effects of hydroxyl radical‐ generating mists (simulated dew water) on the photosynthesis and growth of Japanese apricot seedlings (Prunus mume). Ecol. Res. 21: 117–125. Zhang, Z.L., Wei, N., Wu, Q.X., and Ping, M.L. (2007). Antioxidant response of Cucumis sativus L. to fungicide carbendazim. Pestic. Biochem. Physiol. 89: 54–59. Zhang, J., Li, X., Zhou, L. et al. (2016). Analysis of effects of a new environmental pollutant, bisphenol A, on antioxidant systems in soybean roots at different growth stages. Sci. Rep. 6: 23782. Zhao‐Jun, L., Xiao‐Yu, X., Shu‐Qing, Z., and Yong‐Chao, L. (2011). Wheat growth and photosynthesis as affected by oxytetracycline as a soil contaminant. Pedosphere 21: 244–250. Zuccato, E., Bagnati, R., Fioretti, F. et al. (2001). Environmental loads and detection of pharmaceuticals in Italy. In: Pharmaceuticals in the Environment (ed. K. Kummerer), 65. Berlin, Heidelberg, Germany: Springer‐Verlag.

27

2 Cold Stress and Photosynthesis Aditya Banerjee and Aryadeep Roychoudhury Post Graduate Department of Biotechnology, St. Xavier’s College (Autonomous), Kolkata, West Bengal, India

2.1 ­Introduction Photosynthesis is a crucial physiological process which actively determines the survival, growth, development, and yield of the plant system (Banerjee and Roychoudhury 2018a). As a result, environmental stresses like cold, heat, salinity, drought, and heavy metal toxicity primarily deteriorate the overall efficiency of the photosynthetic machinery. The stressed plants are subjected to molecular and anatomical alterations, which turn out to be harmful for the systemic maintenance (Apel and Hirt 2004). Hence, certain plant species have developed a number of novel mechanisms to robustly tackle the sub‐optimal conditions. Such evolutionary modifications aid in the gradual adaptation of plants to moderate or extreme conditions of abiotic stresses (Hirayama and Shinozaki 2010). Low temperature (LT) or cold is a major type of environmental stressor which limits plant survival, ecosystem abundance, and even productivity. Temperatures ranging between 0 and 15 °C are responsible for cold stress. Freezing stress is caused by still lower temperatures up to −15 °C (Xin and Browse 2001). The mechanisms of tolerance against cold and freezing stress are distinctly different. Cold stress is the major factor which inhibits agricultural production in high altitudes and hilly terrains (Banerjee et al. 2017). Crops of tropical and subtropical origin are incapable of adapting to cold stress. Such plant species might be able to cope up with temporary and transitory alterations induced by cold stress. However, they are incapable of surviving under prolonged cold stress. The stressed plants are manifested with physiological symptoms like chlorosis, wilting, and necrosis (Zhu et al. 2007). In this chapter, we have highlighted the various deteriorative effects of cold stress on photosynthesis of plants.

2.2 ­Primary Targets of Cold Stress in Plants Plant exposure to cold results in several physiological and morphological amendments correlated with a drop in photosynthetic efficiencies and photosynthate channelization. These result in a marked increase in necrosis leading to plant death (Banerjee and Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

28

2  Cold Stress and Photosynthesis

Roychoudhury 2018b,c,d,e). The overall lipid composition in the biomembranes is altered. Temperatures close to 0 °C induce the nucleation of ice crystals, which leads to membrane rupture and electrolyte leakage (Banerjee and Roychoudhury 2016a, 2017). Redistribution of the intracellular calcium ions and diversion of the electrons to alternate destinations have been observed during cold stress (Seo et al. 2010; Roychoudhury and Banerjee 2017). Accumulation of non‐enzymatic antioxidants like proline (Pro), glycine betaine (GB), sugars, polyphenols, glutathione, etc. and the activities of the enzymatic antioxidants like superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and guaiacol peroxidase (POD) are triggered. The entire antioxidant machinery is involved in scavenging the toxic reactive oxygen species (ROS) derived from the stress imposed by LT. Inefficient removal of ROS results in peroxidation of lipid membranes and damages the photosynthetic organelles like thylakoids (Banerjee and Roychoudhury 2018f ).

2.3 ­Cold Stress Distorts the Chloroplast Membrane Integrity Loss of membrane fluidity is the primary effect of cold stress in plants and cyanobacteria. The cold adapted plant species increase the content of unsaturated fatty acids leading to elevated membrane fluidity at LTs. The non‐acclimated plants on the contrary cannot modify the lipid content and hence are prone to membrane damage (Vogg et al. 1998). Rupture in the chloroplast membrane negatively affects thylakoid structure, chlorophyll content, photosynthetic enzyme activities, and electron transport (Banerjee and Roychoudhury 2018a). Paul et  al. (1992) highlighted these changes along with abnormal stomatal closure to be largely responsible for reduced photosynthetic efficiencies in plants growing at LTs. The osmoprotectants like soluble sugars, Pro, and polyamines (PAs) protect the chloroplast membrane from cold‐induced injuries by stabilizing the macromolecular structure (Shao et al. 2006; Banerjee and Roychoudhury 2016b). Li et al. (2018a,b) revealed that short‐term chilling stress in young tea plants resulted in a significant decrease in maximal photosynthetic efficiency (Fv/Fm), disintegration of membrane systems, and oxidative damages to the photosynthetic apparatus (Figure 2.1).

2.4 ­Cold Stress Damages the Photosynthetic Apparatus The initial photosynthetic reactions are catalyzed by photosystem I (PSI) and photosystem II (PSII), which trap light energy and convert it into redox potential energy (Ensminger et al. 2006). LTs induce the loss of photosynthetic capacity by triggering PSII activity, thus limiting photon density (Ball et  al. 1991). Cold stress rapidly affects the equilibrium in the chloroplasts. The chlorophyll biosynthesis is affected resulting in imbalances in PSII and the antenna complexes (Ensminger et al. 2006). As an urge to increase photon capture, plants exposed to cold usually accumulate higher concentration of accessory pigments like chlorophyll b (Chl b) and carotenoids compared to that of Chl a. The carotenoids and Chl remain associated with the light harvesting complex a

2.4  Cold Stress Damages

Cold stress CO2 Assimilation

Fv/Fm ROS

Photosynthate (Sucrose)

Chlorophyll Chloroplast Disintegration

Carotenoids

Membrane Damage

Xanthophyll

Chlorosis A

M

Proline

E

L

Glycine Betaine

I

O

R

Polyamines

A

T

Melatonin

I

O

N

Transgenics

Figure. 2.1  Cold stress deteriorates the overall photosynthetic efficiency and damages the photosynthetic apparatus in the chloroplast. Synthesis of the accessory pigments like carotenoids and xanthophylls (associated with antioxidant responses) often get stimulated in order to confer protection to the chloroplast. Exogenous priming with potentially beneficial chemical agents like proline, glycine betaine, polyamines, and melatonin has resulted in the successful amelioration of photosynthetic damage induced by cold stress. The development of transgenic lines overexpressing antioxidant genes or those encoding antifreeze proteins can also yield cold tolerant characters. (See color plate section for the color representation of this figure.)

(LHC a) and LHC b respectively. Carotenoids are efficient antioxidants which protect the families of light harvesting polypeptides from cold‐induced injuries (Krol et al. 1988; Banerjee and Roychoudhury 2016b). The xanthophyll pool constituted by violaxanthin, antheraxanthin, and zeaxanthin was found to increase in the stressed plants (Krol et al. 1988). This is probably due to the antioxidant capacity of xanthophylls, independent of non‐photochemical quenching (Banerjee and Roychoudhury 2015). In addition, xanthophylls act as the starting material for synthesis of the universal stress phytohormone, abscisic acid (ABA). The endogenous levels of ABA have been found to be stimulated in plants growing at LT (Gusta et al. 2005). The synergistic application of cold and high intensity of light enhanced the accumulation of total xanthophylls. The antheraxanthin and zeaxanthin fractions increased four folds at 5 °C compared to that at normal temperature (Savitch et al. 2002). The Arabidopsis seedlings exposed to high light intensity at LTs exhibited increased lipid peroxidation and chlorosis (Chl bleaching) leading to photoinhibition. On exposure to cold temperatures, the winter conifers organize their photosynthetic apparatus by decreasing the number of functional PSII reaction centers. A steep loss of the light harvesting Chl occurs. A large thylakoid protein complex is generated and further associated with the LHCII, PSII, and PSI (Ensminger et al. 2006). The PSI in Arabidopsis plants were more affected compared to PSII under low light treatments at chilling temperature (Zhang and Scheller 2004). Gombos et  al. (1994)

29

30

2  Cold Stress and Photosynthesis

reported that LT stress drastically slowed down the replenishing of D1 proteins leading to photoinhibition at PSII. It has been observed that the equilibrium maintained between degraded D1 and newly synthesized D1 protein determines the extent of PSII‐ dependent photoinhibition (Aro et al. 1993). Cold stress delays this recovery process, which requires newly synthesized D1 to be inserted into the thylakoids and finally incorporated in the PSI complex (Banerjee and Roychoudhury 2018a). Allen and Ort (2001) highlighted an altered expression of the plastidic gene, psbA (encoding D1) under cold stress. Thus, LTs induce systemic photodamage across plant species. PSI has been found to exhibit higher cold sensitivity compared to that of PSII (Harbinson and Foyer 1989). Navakoudis et al. (2007) reported the regulatory actions of PAs bound to LHCII in fine‐tuning the properties of PSII antenna complex. This is mainly achieved via PA‐ mediated expansion of the PSII antenna complex for optimum electron capture at LTs. Photosynthesis consists of vectorial transfer of electrons from water in the lumen to nicotinamide adenine dinucleotide phosphate (NADP+) in the stroma mediated by a set of redox carriers. Chlororespiration involves electron transfer reactions from stromal reductants to oxygen (O2) via the plastoquinone pool (Rumeau et al. 2007). The chlororespiratory components respond to abiotic stresses like drought, heat, and high light. The level of nucleus‐encoded, plastid‐localized terminal oxidase (PTOX) increased in the alpine plant species and Arabidopsis seedlings under high light intensity at LTs (Laureau et al. 2011; Ivanov et al. 2012). However, the content of the plastid encoded NADH dehydrogenase (NDH) complex remained unchanged during cold stress (Ivanov et al. 2012). Paredes and Quiles (2015) observed that the Hibiscus rosa‐sinensis L. plants were sensitive to cold stress due to the reduced photochemical efficiency of PSII and decrease in the electron transport capacity. Exposure to LT resulted in an increase in electron donation by NADPH and ferredoxin to plastoquinone. The synthesis of PGR5 polypeptide, required for electron cycling around PSI, was also elevated. These observations suggested that the cyclic electron flow confers photosynthetic protection. The cyclic flow did not increase in plants where only the stem and not the root were exposed to cold. As a result, due to insufficient dissipation of excess photons, the PSII exhibited significant damage. The chlororespiratory enzymes like PTOX and NDH complex increased in plants only where the stem was cooled, whereas their levels remained unchanged in the sets where the entire plant was exposed to stress. Thus, chlororespiration participates in the protection of PSII during cold stress in the absence of an increased cyclic electron flow around PSI (Paredes and Quiles 2015). Zhou et al. (2017) investigated the effects of LT in the cold‐acclimatized Rhododendron chrysanthemum L. using a proteomic approach. Among 153 identified photosynthesis‐ related proteins, seven including the Rubisco large subunit (RBCL) were found to increase under cold stress compared to the control seedlings. The stressed plants exhibited increased Fv/Fm, actual quantum yield of PSII, and photochemical quenching (qP). However, the non‐photochemical quenching significantly decreased in these sets. The electron transport rate was reduced along with elevated excitation pressure (1‐qP) (Zhou et al. 2017). Wang et al. (2018) identified a total of 366 unique cold‐responsive proteins in the cold tolerant hybrid wild rice DC907. It was found that these varieties on exposure to LT maintained higher levels of photosynthesis for metabolic channelization and to power the cells (Wang et al. 2018). Cvetkovska et al. (2018) characterized a novel photosynthetic ferredoxin from the Antarctic green alga Chlamydomonas sp., UWO241. The enzyme was found to be involved in the distribution of photosynthetic reducing

2.5  Cold Stress Affects CO2 Fixation

power. Ferredoxin from UWO241 exhibited elevated activity at LT. The cold tolerance of UWO241 was attributed to the presence of two distinct ferredoxin proteins involved in steadily maintaining photosynthesis at chilling temperature (Cvetkovska et al. 2018).

2.5 ­Cold Stress Affects Carbon Dioxide (CO2) Fixation Cold stress suppresses sucrose production in the cytosol resulting in the increase of phosphorus‐associated intermediates (Figure  2.1). Thus, phosphate‐cycling between the chloroplast and cytosol is inhibited due to utilization of the available inorganic phosphate sink (Hurry et al. 2000). As a result, the rate of adenosine triphosphate (ATP) biosynthesis is retarded and this impedes the generation of ribulose 1,5‐bisphosphate required for CO2 fixation. Gecin (2013) studied the relationship between carbon flux rate, photosynthesis, and LT in Hordeum vulgare L. seedlings. It was revealed that short term cold stress at 5 °C reduced the biochemical reaction and sink rates by consuming less energy along with decreased absorption and production of CO2. Ramalho et  al. (2003) reported elevated export of carbon in the leaves of cold stressed winter wheat seedlings compared to the control sets. The stressed plants exhibited increased activities of enzymes involved in the Calvin cycle and sugar metabolism. Proper channelization of metabolites toward the synthesis of non‐enzymatic osmoprotectants and enzymatic antioxidants ensures protection of crucial enzymes against cold‐induced injuries. The cold‐acclimatized winter wheat plants have evolved such important adaptations in order to tackle long‐term cold stress during prolonged winter seasons (Banerjee and Roychoudhury 2018f ). Chen et al. (2015) identified the relations between abiotic stresses and Rubisco activase (RCA) (a nuclear gene encoding a chloroplast protein involved in photosynthesis). Bioinformatic analysis of the cis acting elements in the RCA promoter revealed a possible induction by multiple abiotic stresses like cold, heat, salt, and drought. Thus, apart from acting as an activation enzyme of Rubisco, RCA is also a multiple responder to abiotic stresses (Chen et  al. 2015; Sehrawat et  al. 2013). Stitt and Hurry (2002) concluded that the photosynthetic decline in plants exposed to LTs is mainly due to degradation of Rubisco. Cold tolerant herbaceous plants have been found to increase the availabilities of adenylates and phosphorylated intermediates along with an increase in the chloroplastidic inorganic phosphorus content. This probably elevated the ribulose 1,5‐bisphosphate (RuBP) regeneration capacity of the plants during cold stress (Stitt and Hurry 2002). Oliveira and Penuelas (2004) examined the effects of natural Mediterranean winter conditions on the potted Cistus albidus L. and Quercus ilex L. plants. The stressed plants exhibited lower light, CO2‐saturated CO2 assimilation rates (Asat), and apparent quantum yield compared to those grown in normal greenhouse conditions. In spite of decreased leaf absorptance, leaf damage, and plant mortality, C. albidus was found to better adapt to cold stress than Q. ilex. However, Q. ilex maintained low rates of net assimilation along with higher leaf and plant survival compared to those in C. albidus (Oliveira and Penuelas 2004). Bilska‐Kos et al. (2018) found strong inhibition of net CO2 assimilation and Fv/Fm in Zea mays L. lines exposed to cold stress. The stressed plants developed thicker leaves and mesophyll layers. LT of 2 °C deteriorated plant growth, Chl content, Fv/Fm, net photosynthetic rate (Pn), stomatal conductance (Gs), intercellular

31

32

2  Cold Stress and Photosynthesis

CO2 and transpiration rate (Tr) in zoysia grass (Li et al. 2018a,b). In another study, it was found that three weeks of cold acclimation in Lolium multiflorum Lam. and Festuca arundinacea Schreb. resulted in stable maintenance of photochemical processes along with slightly reduced CO2 assimilation and significantly decreased Gs (Augustyniak et al. 2018).

2.6 ­Strategies to Ameliorate Cold Stress and Improve Photosynthesis Cold stress usually deteriorates the overall photosynthetic apparatus. Exhaustive research has revealed some experimental strategies which can be utilized to ameliorate the cold‐induced damages of this important physiological process (Adam and Murthy 2014). Priming of the seeds or stressed seedlings with chemical agents can stimulate photosynthesis even under sub‐optimal conditions (Roychoudhury and Banerjee 2016). Exogenous application of melatonin at 100 μM concentration reduced the damage to photosynthetic apparatus in cold stressed Lycopersicon esculentum L. leaves (Yang et al. 2018). The treated seedlings exhibited increased electron transfer rates and quantum yields of PSI and PSII at LT (Yang et al. 2018). In another study, Li et al. (2016) deciphered the relations between melatonin and ABA in a process of cold tolerance induced by drought priming. It was found that exogenous melatonin application in the drought primed seeds of barley induced the endogenous antioxidant and ABA levels. The treated seedlings exhibited sustained photosynthetic electron transport during cold stress (Li et al. 2016). Cold priming of the winter wheat seeds at 5.2 °C stimulated the ROS scavenging systems (Li et al. 2014). The trapped energy flux, electron transport and photosynthetic rates increased in the primed plants grown at LT (Li et al. 2014). Cvetkovic et al. (2017) also reported the positive correlation between cold priming and stabilization of PSII activity in Arabidopsis. Priming with the compatible solute, GB essentially conferred photosynthetic protection in plants exposed to cold stress (Roychoudhury and Banerjee 2016; Giri 2011). Transgenic rice plants overexpressing choline oxidase A (codA) exhibited increased Fv/ Fm when subjected to cold stress (Kathuria et al. 2009). Hur et al. (2004) showed that knockout of the Pro synthesizing gene, Pyrroline‐5‐carboxylate synthetase 2 (P5CS2) severely retarded the photosynthetic process and growth in rice at 4 °C. Thus, P5CS2 proved to be the crucial gene for conferring cold tolerance in rice. Treatment of the medicinal herb, Stevia rebaudiana Bertoni, with polyamine supplement improved the photochemical efficiency of PSII along with an increase in the photosynthetic pigments during cold stress. The treated plants also accumulated higher quantities of Pro and GB during stress compared to the non‐treated sets (Peynevandi et al. 2018). Overexpression of glycerol‐3‐phosphate acyltransferase involved in cellular fatty acid saturation conferred protection to the photosynthetic apparatus in transgenic tobacco plants exposed to LT (Murata et al. 1992). The transgenic tobacco plants overexpressing SOD efficiently scavenged the cold‐induced generation of ROS and also exhibited 20% higher photosynthetic activity compared to the wild type plants (Sen Gupta et al. 1993). Pilon‐Smits et  al. (1995) overexpressed the dehydrin cold regulated 15a (cor15a) in Arabidopsis plants and observed enhanced freezing tolerance of the chloroplasts and protoplasts (Figure 2.1).

­  References

2.7 ­Conclusion and Future Perspectives Plants are autotrophic organisms which remain fixed to the substratum and acclimatize to a variety of abiotic stresses. Photosynthesis is the basic process which defines the presence of autotrophism in plants. Hence, subtle alterations in this crucial physiological metabolic pathway ultimately determine the survival capacity and viability of the entire plant system. Cold stress lowers the fluidity of lipid membranes of the chloroplast, thus damaging the entire organelle. This results in electrolyte leakage from the stroma and degradation of the thylakoids. LT also induces the generation of ROS which specifically target the photosystems and chlorophyll pigments (Figure 2.1). As a result, the overall photosynthetic efficiency is reduced. The accessory pigments like carotenoids and xanthophyll often increase during abiotic stresses due to their potential antioxidant activities. Cold stress also affects the CO2 assimilation in photosynthesis, thus promoting a decline in the rate of carbon fixation and food production in the system. As a result of the overall decrease in photosynthesis, the sensitive crop species become more susceptible to LT and produce poor yields. Strategies like seed or seedling priming with protective chemical agents and osmolytes like melatonin, GB, Pro, PAs, etc. can confer cold stress tolerance with improved photosynthesis across susceptible genotypes. Development of transgenic varieties overexpressing genes encoding osmolytes, antioxidant enzymes or antifreeze proteins like dehydrins can also lead to better photosynthetic protection during stress. Future perspectives should include experimental field trials, so that these can be utilized for the benefit of the global population. Furthermore, the chloroplastidic transcriptome should be carefully analyzed to identify the photosynthetic genes which are differentially expressed in response to cold stress. Such investigations will enable the generation of a chloroplast‐specific signaling blueprint which is operative during cold stress.

­Acknowledgements Financial assistance from the Council of Scientific and Industrial Research (CSIR), Government of India, through the research grant [38(1387)/14/EMR‐II] to Dr. Aryadeep Roychoudhury is gratefully acknowledged. The authors acknowledge the University Grants Commission, Government of India, for providing Junior Research Fellowship to Mr. Aditya Banerjee.

­References Adam, S. and Murthy, S.D.S. (2014). Effects of cold stress on photosynthesis of plants and possible protection mechanisms. In: Approaches to Plant Stress and Their Management (ed. R.K. Gaur and P. Sharma), 219–226. Springer India. Allen, D.J. and Ort, D.R. (2001). Impacts of chilling temperatures on photosynthesis in warm‐climate plants. Trends Plant Sci. 6: 36–42. Apel, K. and Hirt, H. (2004). Reactive oxygen species: metabolism, oxidative stress and signal transduction. Annu. Rev. Plant Biol. 55: 373–399.

33

34

2  Cold Stress and Photosynthesis

Aro, E.M., Virgin, I., and Andersson, B. (1993). Photoinhibition of photosystem II. Inactivation, protein damage and turnover. Biochim. Biophys. Acta 1143: 113–134. Augustyniak, A., Perlikowski, D., Rapacz, M. et al. (2018). Insight into cellular proteome of Lolium multiflorum/Festuca arundinacea introgression forms to decipher crucial mechanisms of cold acclimation in forage grasses. Plant Sci. 272: 22–31. Ball, M., Hodges, V., and Laughlin, G. (1991). Cold‐induced photoinhibition limits regeneration of snow gum at tree‐line. Funct. Ecol. 5: 663–668. Banerjee, A. and Roychoudhury, A. (2015). WRKY proteins: signaling and regulation of expression during abiotic stress responses. Sci. World J. 2015: 807560. Banerjee, A. and Roychoudhury, A. (2016a). Group II late embryogenesis abundant (LEA) proteins: structural and functional aspects in plant abiotic stress. Plant Growth Regul. 79: 1–17. Banerjee, A. and Roychoudhury, A. (2016b). Plant responses to light stress: oxidative damages, photoprotection and role of phytohormones. In: Plant Hormones Under Challenging Environmental Factors (ed. G.J. Ahammed and J.‐Q. Yu), 181–213. Dordrecht, Netherlands: Springer. Banerjee, A. and Roychoudhury, A. (2017). Abscisic‐acid‐dependent basic leucine zipper (bZIP) transcription factors in plant abiotic stress. Protoplasma 254: 3–16. Banerjee, A. and Roychoudhury, A. (2018a). Regulation of photosynthesis under salinity and drought stress. In: Environment and Photosynthesis: A Future Prospect (ed. V.P. Singh, S. Singh, R. Singh and S.M. Prasad), 134–144. Studium Press (India) Pvt. Ltd. Banerjee, A. and Roychoudhury, A. (2018b). Seed priming technology in the amelioration of salinity stress in plants. In: Advances in Seed Priming (ed. A. Rakshit and H.B. Singh), 81–93. Singapore: Springer Nature. Banerjee, A. and Roychoudhury, A. (2018c). Role of beneficial trace elements in salt stress tolerance of plants. In: Plant Nutrients and Abiotic Stress Tolerance (ed. M. Hasanuzzaman, M. Fujita, H. Oku, et al.), 377–390. Singapore: Springer Nature. Banerjee, A. and Roychoudhury, A. (2018d). Small heat shock proteins: structural assembly and functional responses against heat stress in plants. In: Plant Metabolites and Regulation Under Abiotic Stress (ed. P. Ahmad, M.A. Ahanger, V.P. Singh, et al.), 367– 374. United Kingdom/USA: Academic Press/Elsevier. Banerjee, A. and Roychoudhury, A. (2018e). Effect of salinity stress on growth and physiology of medicinal plants. In: Medicinal Plants and Environmental Challenges (ed. M. Ghorbanpour and A. Varma), 177–188. Cham, Switzerland: Springer International Publishing AG. Banerjee, A. and Roychoudhury, A. (2018f ). Abiotic stress, generation of reactive oxygen species, and their consequences: an overview. In: Revisiting the Role of Reactive Oxygen Species (ROS) in Plants: ROS Boon or Bane for Plants? (ed. V.P. Singh, S. Singh, D. Tripathi, et al.), 23–50. USA: Wiley. Banerjee, A., Wani, S.H., and Roychoudhury, A. (2017). Epigenetic control of plant cold responses. Front. Plant Sci. 8: 1643. Bilska‐Kos, A., Panek, P., Szulc‐Głaz, A. et al. (2018). Chilling‐induced physiological, anatomical and biochemical responses in the leaves of Miscanthus × giganteus and maize (Zea mays L.). J. Plant Physiol. 228: 178–188. Chen, Y., Wang, X.‐M., Zhou, L. et al. (2015). Rubisco activase is also a multiple responder to abiotic stresses in rice. PLoS One 10: e0140934.

­  References

Cvetkovic, J., Muller, K., and Baier, M. (2017). The effect of cold priming on the fitness of Arabidopsis thaliana accessions under natural and controlled conditions. Sci. Rep. 7: 44055. Cvetkovska, M., Szyszka‐Mroz, B., Possmayer, M. et al. (2018). Characterization of photosynthetic ferredoxin from the Antarctic alga Chlamydomonas sp. UWO241 reveals novel features of cold adaptation. New Phytol. 219: 588–604. Ensminger, I., Bosch, F., and Huner, N.P.A. (2006). Photostasis and cold acclimation: sensing low temperature through photosynthesis. Physiol. Plant 126: 28–44. Gecin, M.V. (2013). Effects of Cold Stress on Photosynthesis in Barley. Thesis: University of Western Ontario. Giri, J. (2011). Glycinebetaine and abiotic stress tolerance in plants. Plant Signal. Behav. 6: 1746–1751. Gombos, Z., Wada, H., Hideg, E., and Murata, N. (1994). The unsaturation of membrane lipids stabilizes photosynthesis against heat stress. Plant Physiol. 104: 563–567. Gusta, L.V., Trischuk, R., and Weiser, C.J. (2005). Plant cold acclimation: the role of abscisic acid. J. Plant Growth Regul. 24: 308–318. Harbinson, J. and Foyer, C.H. (1989). Relationship between the quantum efficiencies of photo systems I and II in pea leaves. Plant Physiol. 90: 1029–1034. Hirayama, T. and Shinozaki, K. (2010). Research on plant abiotic stress responses in the post‐genome era: past present. Plant J. 61: 1041–1062. Hur, J., Jung, K.‐H., Lee, C.‐H., and An, G. (2004). Stress‐inducible OsP5CS2 gene is essential for salt and cold tolerance in rice. Plant Sci. 167: 417–426. Hurry, V., Strand, A., Furbank, R., and Stitt, M. (2000). The role of inorganic phosphate in the development of freezing tolerance and the acclimatization of photosynthesis to low temperature is revealed by the pho mutants of Arabidopsis thaliana. Plant J. 24: 383–396. Ivanov, A.G., Rosso, D., Savitch, L.V. et al. (2012). Implications of alternative electron sinks in increased resistance of PSII and PSI photochemistry to high light stress in cold acclimated Arabidopsis thaliana. Photosynth. Res. 113: 191–206. Kathuria, H., Giri, J., Nataraja, K.N. et al. (2009). Glycinebetaine‐induced water‐stress tolerance in codA‐expressing transgenic indica rice is associated with up‐regulation of several stress responsive genes. Plant Biotechnol. J. 7: 512–526. Krol, M., Huner, N.P.A., and Mac Intosh, A. (1988). Chloroplast biogenesis at cold hardening temperatures. Development of photosystem I and photosystem II activities in relation to pigment accumulation. Photosynth. Res. 14: 97–112. Laureau, C., Bligny, R., and Streb, P. (2011). The significance of glutathione for photoprotection at contrasting temperatures in the alpine plant species Soldanella alpine and Ranunculus glacialis. Physiol. Plant 143: 246–260. Li, N.N., Yue, C., Cao, H.L. et al. (2018a). Transcriptome sequencing dissection of the mechanisms underlying differential cold sensitivity in young and mature leaves of the tea plant (Camellia sinensis). J. Plant Physiol. 225: 144–155. Li, S., Yang, Y., Zhang, Q. et al. (2018b). Differential physiological and metabolic response to low temperature in two zoysiagrass genotypes native to high and low latitude. PLoS One 13: e0198885. Li, X., Cai, J., Liu, F. et al. (2014). Cold priming drives the sub‐cellular antioxidant systems to protect photosynthetic electron transport against subsequent low temperature stress in winter wheat. Plant Physiol. Biochem. 82: 34–43.

35

36

2  Cold Stress and Photosynthesis

Li, X., Tan, D.‐X., Jiang, D., and Liu, F. (2016). Melatonin enhances cold tolerance in drought‐primed wild‐type and abscisic acid‐deficient mutant barley. J. Pineal Res. 61: 328–339. Murata, N., Ishizaki‐Nishizawa, O., Higashi, S. et al. (1992). Genetically engineered alteration in the chilling sensitivity of plants. Nature 356: 710–713. Navakoudis, E., Vrentzou, K., and Kotzabasis, K. (2007). A polyamine‐ and LHCII protease activity‐based mechanism regulates the plasticity and adaptation status of the photosynthetic apparatus. Biochim. Biophys. Acta Bioenerg. 1767: 261–271. Oliveira, G. and Penuelas, J. (2004). Effects of winter cold stress on photosynthesis and photochemical efficiency of PSII of the Mediterranean Cistus albidus L. and Quercus ilex L. Plant Ecol. 175: 179–191. Paredes, M. and Quiles, M.J. (2015). The effects of cold stress on photosynthesis in Hibiscus plants. PLoS One 10: e0137472. Paul, M.J., Driscoll, S.P., and Lawlor, D.W. (1992). Sink‐regulation of photosynthesis in relation to temperature in sunflower and rape. J. Exp. Bot. 43: 147–153. Peynevandi, K.M., Razavi, S.M., and Zahri, S. (2018). The ameliorating effects of polyamine supplement on physiological and biochemical parameters of Stevia rebaudiana Bertoni under cold stress. Plant Prod. Sci. 21: 123–131. Pilon‐Smits, E.A.H., Ebskamp, M.J.M., Paul, M.J. et al. (1995). Improved performance of transgenic fructan‐accumulating tobacco under drought stress. Plant Physiol. 107: 125–130. Ramalho, J.C., Quartin, V., Fahl, J.I. et al. (2003). Cold acclimation ability of photosynthesis among species of the tropical Coffea genus. Plant Biol. 5: 631–641. Roychoudhury, A. and Banerjee, A. (2016). Endogenous glycine betaine accumulation mediates abiotic stress tolerance in plants. Trop. Plant Res. 3: 105–111. Roychoudhury, A. and Banerjee, A. (2017). Abscisic acid signaling and involvement of mitogen activated protein kinases and calcium‐dependent protein kinases during plant abiotic stress. In: Mechanism of Plant Hormone Signaling Under Stress, vol. 1 (ed. G. Pandey), 197–241. USA: Wiley. Rumeau, D., Peltier, G., and Cournac, L. (2007). Chlororespiration and cyclic electron flow around PSI during photosynthesis and plant stress response. Plant Cell Environ. 30: 1041–1051. Savitch, L.V., Leonardos, E.D., Krol, M. et al. (2002). Two different strategies for light utilization in photosynthesis in relation to growth and cold acclimation. Plant Cell Environ. 25: 761–771. Sehrawat, A., Abat, J.K., and Deswal, R. (2013). RuBisCO depletion improved proteome coverage of cold responsive S‐nitrosylated targets in Brassica juncea. Front. Plant Sci. 4: 342. Sen Gupta, A., Heinen, J.L., Holady, A.S. et al. (1993). Increased resistance to oxidative stress in transgenic plants that over‐express chloroplastic Cu/Zn superoxide dismutase. Proc. Natl. Acad. Sci. U.S.A. 90: 1629–1633. Seo, P.J., Kim, M.J., Park, J.Y. et al. (2010). Cold activation of a plasma membrane‐tethered NAC transcription factor induces a pathogen resistance response in Arabidopsis. Plant J. 61: 661–671. Shao, H.B., Liang, Z.S., and Shao, M.A. (2006). Osmotic regulation of 10 wheat (Triticum aestivum L.) genotypes at soil water deficits. Biointerfaces 47: 132–139.

­  References

Stitt, M. and Hurry, V. (2002). A plant for all seasons: alterations in photosynthetic carbon metabolism during cold acclimation in Arabidopsis. Curr. Opin. Plant Biol. 5: 199–206. Vogg, G., Heim, R., Hansen, J. et al. (1998). Frost hardening and photosynthetic performance of Scots pine (Pinus sylvestris L.) needles. I. Seasonal changes in the photosynthetic apparatus and its function. Planta 204: 193–200. Wang, J., Wang, J., Wang, X. et al. (2018). Proteomic response of hybrid wild rice to cold stress at the seedling stage. PLoS One 13: e0198675. Xin, Z. and Browse, J. (2001). Cold comfort farm: the acclimation of plants to freezing temperatures. Plant Cell Environ. 23: 893–902. Yang, X.L., Xu, H., Li, D. et al. (2018). Effect of melatonin priming on photosynthetic capacity of tomato leaves under low‐temperature stress. Photosynthetica 56: 884–892. Zhang, S. and Scheller, H.V. (2004). Photoinhibition of photosystem I at chilling temperature and subsequent recovery in Arabidopsis thaliana. Plant Cell Physiol. 45: 1595–1602. Zhou, X., Chen, S., Wu, H., and Xu, H. (2017). Effects of cold stress on the photosynthesis and antioxidant system of Rhododendron chrysanthemum Pall. Preprints 2017030131. https://doi.org/10.20944/preprints201703.0131.v1. Zhu, X.G., de Sturler, E., and Long, S.P. (2007). Optimizing the distribution of resources between enzymes of carbon metabolism can dramatically increase photosynthetic rate: a numerical simulation using an evolutionary algorithm. Plant Physiol. 145: 513–526.

37

39

3 High‐Temperature Stress and Photosynthesis Under Pathological Impact Murat Dikilitas1, Eray Simsek1, Sema Karakas2, and Parvaiz Ahmad3,4 1

Department of Plant Protection, Harran University, Sanliurfa, Turkey Department of Soil Science and Plant Nutrition, Harran University, Sanliurfa, Turkey 3 Department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia 4 Department of Botany, S.P. College, Srinagar, Jammu and Kashmir, India 2

3.1 ­Introduction Increases in global temperature are at the point of no return. This means that harsh weather conditions would become prevalent, such as heat, heat waves, or high‐­ temperature stresses from now on in our environment, particularly in agricultural areas. The influence of heat stress would show itself as increased respiration, reduction in photosynthesis, and disrupted defence mechanisms in crop plants. In these conditions, even the resistant plants either genetically modified or biochemically induced would not keep up the heat or high‐temperature stress in terms of vegetative growth or crop yields. The initial effects of high‐temperature stress are mainly characterized by a reduction in growth, photosynthetic efficiency, water loss, and increased stress metabolites (Ding et al. 2016). Photosynthesis is one of the most crucial plant metabolic processes due to its involvement in plant biomass accumulation (Yamori and Shikanai 2016; Wang et  al. 2018). It converts light energy into functional chemical energy for plant growth and maintenance (Bailey‐Serres et  al. 2018). It is also one of the most sensitive biochemical processes, particularly under heat or high‐temperature stress. It has been reported that heat stress is able to induce an excess production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) but plants have the capacity to activate antioxidant enzymes like superoxide dismutase (SOD), peroxidase (POX), catalase (CAT), ascorbate peroxidase (APX), or glutathione peroxidase (GPX) to prevent or reduce the toxic oxygen and nitrogen species. Other metabolites including proline, a kind of stress‐related amino acid, proteins with small molecular weights, and soluble sugars might also play important roles (Zhang et al. 2012). However, defence mechanisms of crop plants under heat stress would be greatly affected depending upon the increase of stress period, severity, and additional stress factors. If the additional stress agent is abiotic, the additive effect would further deteriorate the conditions of crop plants. High‐temperature stress is mainly characterized with water or drought stress. The adaptation process of crop plants under these circumstances would be very Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

40

3  High-Temperature Stress and Photosynthesis

difficult, especially in arid conditions (Rezaei et al. 2015; Harsh et al. 2016). However, if the additional stress agent is biotic, then the case becomes more problematic to tackle. Temperatures above the optimum conditions could be defined as high temperature and the stress caused by high temperature could be defined as the heat stress. High‐ temperature or heat stress refers to a period of time that is able to cause a permanent physiological, biochemical, and even molecular damage to cells. In this chapter, we referred to heat stress as the short‐term increase in temperature and high‐temperature stress is referred to as a long‐term increase in temperature stress on crop plants. High‐ temperature or heat stress is one of the most complex and difficult stresses for plants to adapt to. Because, the accumulation of ROS and RNS, in the long run, could harm the structure of DNA in severe high‐temperature stress cases (Cvjetko et al. 2014; Kantidze et al. 2016; Krishnamoorthy et al. 2018). Gururani et al. (2015) stated that ROS are able to damage and disrupt the function of the photosynthetic apparatus, particularly photosystem II (PSII), causing photoinhibition due to an imbalance in the photosynthetic redox signaling pathways and the inhibition of PSII repair. These toxic species may decrease the resistance barrier of crop plants and predispose the crop plants to pathogenic attacks and they affect the stability of cell membranes, protein synthesis, and enzyme activations (Gururani et al. 2015; Zandalinas et al. 2018). Temperature stress can directly affect the quality and quantity of crops as well as affecting the behaviors of pathogen microorganisms. It may enhance or decrease disease incidence, however, in many cases, it increases the disease occurrences (Dhaliwal et  al. 2018; Kumari et  al. 2018). When compared to other abiotic stresses, temperature stress has a greater effect on plant development and growth and it has a significant impact on the global food supply (Acevedo et al. 2018; Martinez et al. 2018). Therefore, we have to evaluate how high temperatures affect the mechanisms of defence and other biochemical processes such as photosynthesis and respiration under pathological threat or vice versa. To overcome the negative effects of combined stress caused by high temperature and pathogens, development of stress tolerant plants to high temperature gains more importance than other issues aiming to cope with stress issues. In other combined stress issues such as between salinity and pathogens or between drought and pathogens or those between heavy metal stress and pathogens, one could prevent the occurring of abiotic stress through soil remediation, irrigation, soil fertilization, and so on. However, the case between high temperature and pathogens is more complex due to the impossibility of preventing of high‐temperature occurrences in nature. Therefore, only one option is left for us to improve the condition of plants, and that is to generate heat‐tolerant crop plants or induce heat tolerance through physiological and biochemical ways. Although the increase in population growth and global temperatures put plant breeders under great pressure, the pressure is now further increased with no predictable upper limit of temperature level in the atmosphere. On the other hand, pathogens would adapt to high‐temperature conditions as they adapted to saline and drought conditions (Dikilitas et al. 2017; Huot et al. 2017; Bai et al. 2018). As it has been stated, tolerant plants remain the cost‐effective and promising solution for high temperature and pathogen stresses. Tolerant plants have a high capacity to maintain homeostasis under stress conditions through activation of stress‐related enzymes, metabolites, and signaling pathways (Breusegem et al. 2018; Martinez et al. 2018). This enables tolerant plants to quickly set up defensive barriers. However, under combined stress conditions, tolerant plants may not cope with the negative effects of combined stresses. Even if tolerant plants are

3.2  High‐Temperature Stress on Crop Plants

generated for this purpose, the outcome may not be as satisfactory as desired because stress tolerant plants, in general, consist of early flowering, have limited growth, and low biomass through the reduced capacity of photosynthesis (Sakuraba et  al. 2017). High‐temperature‐tolerant plants may also lose the ability to cope with disease resistance. The detailed mechanisms and biochemical pathways of loss of tolerance or performance of crop plants under abiotic and biotic stress combinations have been demonstrated previously (Dikilitas and Karakas 2012, 2014). In this chapter, we evaluate how photosynthesis of crop plants through physiological, biochemical, and molecular changes have been affected under high‐temperature and disease threat. In the light of recent research findings, we evaluate why the impact of plant diseases increase under temperature stress.

3.2 ­High‐Temperature Stress on Crop Plants Limited availability of arable land and the increased demand for food has forced growers to cultivate their crops under unfavorable agricultural conditions. One of the abiotic stresses which stands out with its effect and consequences on crop plants is high‐­ temperature stress. It differs from other stresses even with its short‐term effect as it is likely to cause large negative impacts on crop productivity when compared to those of other abiotic stressors (Nazar et al. 2015). For example, Talanova et al. (2006) showed that heat shock over 50 °C resulted in an irreversible damage to cucumber plants within a couple of hours and negatively affected the photosynthesis as well as leading to premature aging, yield reduction and quality on crop plants. Similarly, Sgobba et al. (2015) and Wang et al. (2015) stated that even very short exposures of tropical crops to high temperatures or heat stress (40 °C) at sensitive life stages such as seedling, flowering, or fruiting stages could lead to irreparable damage and crop losses. Yuzbasioglu et al. (2017) stated that extreme temperature conditions (over 5 °C above the normal) for a few days had a negative impact on plant growth as well as development and crop production (Bita and Gerats 2013; Hatfield and Prueger 2015). Heat or high‐temperature stress not only negatively affects the C6 plants in terms of photosynthesis, crop production, crop quality, etc. but also deteriorates the conditions of C4 plants. For example, Coskun et  al. (2011) stated that net photosynthesis of maize plants exhibiting tolerance to high temperature was negatively affected when the temperature of maize leaves exceeded 38 °C. Although the responses of crop plants and trees could differ from each other in terms of biochemical and molecular responses under stress conditions, Song et al. (2014) stated that the transitory and constant effects of high temperature led to reductions in photosynthesis and productivity in poplar trees (Populus spp.) as well. They, however, stated that photosynthesis was able to recover after six hours of high‐temperature stress, which might be accepted as a turning point for heat stress in trees in terms of the photosynthetic response. They reported 29 896 differentially expressed genes (15 670 up‐regulated and 14 226 down‐regulated) after six hours of heat stress treatment via genome‐wide expression analysis. They showed that most of the genes were involved in regulation of photosynthesis‐related genes. This clearly showed that the photosynthesis was one of the most sensitive parameters of plant response. Heat stress of more than 12 hours led to permanent damage to photosystems and resulted in the accumulation of ROS (Song et  al. 2014). As a result of that, photosynthetic capacity was not able to repair itself

41

42

3  High-Temperature Stress and Photosynthesis

completely. Chlorophyll fluorescence analysis also showed that photosynthetic rate (Pn) was not able return to normal levels (Song et  al. 2014). Similarly, Chen et  al. (2012) reported that fingered citron (Citrus medica L. var. sarcodactylis Swingle) plants under 40 and 45 °C for six hours exhibited a significant decrease in Pn, carboxylation efficiency (CE), the maximal photochemical efficiency of PSII, and the light‐saturated photosynthetic rate. As clearly indicated, photosynthesis could be completely inhibited before other symptoms appear under high‐temperature stress (Camejo et  al. 2005; Cui et  al. 2006). The decrease in photosynthetic efficiency could result from a reduction in chlorophyll accumulation due to functional and structural disruptions of chloroplasts under high‐temperature stress (Dekov et al. 2000; Szymanska et al. 2017; Djanaguiraman et al. 2018). Decreases in Pn and stomatal conductance (Gs) under high temperature which resulted from the reductions in CO2 accumulation was attributed to the partial closure of stomata in leaves (Cui et al. 2006). Souza et al. (2004) stated that the reductions in CO2 accumulation might create an imbalance between photochemical activity at PSII and the electron requirement for it. This eventually results in an overexcitation and further photoinhibitory damage to PSII reaction centers (RCs) (Souza et al. 2004). In the last three decades, temperatures have been increasing constantly all over the world (Post et  al. 2018). The Intergovernmental Panel on Climatic Change (IPCC) (2012, 2013) stated that an increase of 0.5 °C was observed in the global mean surface air temperature in the beginning of this century, and a further 1.5–4.5 °C is expected by the end of this century (Kaushal et al. 2016). IPCC (2014) also reported that there have been increases in hot days and nights, while the number of cold days and nights have reduced globally. Climate change models firmly predict that global temperatures will carry on increasing in the near future, therefore, the frequency and intensity of drought and water stress along with heat stresses will be more common and have a major impact on crop plants and our life (Zhao et al. 2017). Crop plants cultivated in temperate climates will experience more heat stress from now on. Recent evidence has shown that the increase in temperature is directly connected to an increase in CO2 in the atmosphere. For example, Gustafson et al. (2017) stated that moderate temperature rise (3 °C) with the increase of CO2 concentration increased net photosynthesis of cohorts, however, biomass production decreased due to increased maintenance costs. After a certain level, the increase in temperature has negative effects. For example, an increase of 6 °C in air temperature resulted in a decrease in both photosynthesis and biomass production regardless of plant species. Recent studies have shown that CO2 in the atmosphere has been predicted to reach a level of 730–1000 ppm at the end of this century (Gray and Brady 2016). Carbon dioxide concentration in the atmosphere has an increasing trend, rising from 280 ppm in the 1950s, to more than 400 ppm today (Schrag 2018; Trierweiler et al. 2018). CO2 has two main functions on plant development, one has a direct effect on photosynthesis, which could be considered as positive, and the other one has an indirect effect as it contributes to increasing air temperatures, which reduces the benefits of elevated CO2, finally ending up with global warming (Gray and Brady 2016; Noctor and Mhamdi 2017). For example, Reich et al. (2014) stated that increases in CO2 concentration resulted in an approximately 33% increase in aboveground biomass in a grassland. Root biomass has also been observed to increase in response to elevated CO2 in many crop species (Madhu and Hatfield 2013; Gray and Brady 2016). The increase in the shoot and root biomass under ­ iameter elevated CO2 conditions was mainly attributed to the increased cortex and root d and increased total root system volume (Gray and Brady 2016). On the other hand, an

3.3  High‐Temperature Stress on Photosynthesis

increase in air temperature not only decreases the beneficial effects of CO2 but also creates a more complex environment for the crop plants. Because, crop plants do not experience high‐temperature stress alone. High‐temperature stress would come along with drought stress, where the water source is limited and with other abiotic stress factors such as light and increased transpiration. In normal conditions, an adequate supply of water will cause stomata to remain open even if the temperature becomes high. However, the cooling of the leaf surface through evapotranspiration would be insufficient where water is in deficit and this will eventually result in heat stress and the closing of stomata (Gray and Brady 2016; Haworth et  al. 2018). That would eventually reduce the photosynthetic capacity of crop plants. Jumrani and Bhatia (2018) stated that both temperature and water stress had a negative impact on the growth and yield of soybean, but the effect was prevalent when water stress occurred at much higher temperatures. They presumed that evaporation and transpiration in the presence of high temperatures accelerated the depletion of soil water even if the water was freely available. Prasad et  al. (2006) also reported that high‐temperature and water stress led to reductions in photosynthesis, senescence of leaves, early maturity, and reduced seed filing. These symptoms resulted in great crop loss (Prasad et  al. 2006). Under high‐­ temperature stress, reduced photosynthesis would have more pronounced effects ­during flowering or fruiting stages than vegetative growth stage. High‐temperature stress is also closely associated with light intensity. Intense light leads to photoinhibition, and the reaction centers in photosynthetic areas become closed, and this leads to subsequent build‐up of “unused” excitation energy in the photosynthetic membrane (Mathur et al. 2014). The decrease in photosynthesis could be more distinct in resistant and susceptible plants. For example, Zhang et al. (2018) stated that the combination of high‐temperature or heat stress along with drought in the soil significantly reduced photosynthetic rates in Picea crassifolia Komarov and Picea wilsonii Mast. (spruce species). They concluded that P. wilsonii was more susceptible to high temperatures and drought stress indicating a clear difference between resistant and susceptible species in terms of photosynthetic responses. Similarly, Feng et al. (2014) showed that photosynthetic rates in flag leaves during the grain‐filling stage of cultivar XM26 decreased quickly when compared to that of cultivar JM22 under heat stress. Heat stress caused an alteration of mesophyll cell ultrastructure. Heat injury in organelles was more severe in XM26 than JM22. Moreover, the JM22 cultivar exhibited more self‐repair capacity following heat stress injury. Heat or high‐temperature stress has unique properties as compared to those of other abiotic stresses. The increase in temperature whether occurring rapidly or gradually would not lead to any differences in terms of plant responses. Only the symptoms would delay in the latter case. In general, if crop plants are not able to tolerate heat stress at early stages, they would not tolerate it at later stages as well.

3.3 ­High‐Temperature Stress on Photosynthesis Mechanisms Photosynthesis mainly occurs in mesophyll cells in plant leaves. It is one of the major metabolic processes which is sensitive to environmental stresses. It consists of two major processes: the light‐dependent electron transport chain and the light‐­independent carbon fixation cycle. The light reactions occur in the thylakoid membranes of the

43

44

3  High-Temperature Stress and Photosynthesis

chloroplast. The thylakoid membrane is composed of four main macromolecular protein complexes including PSII, PSI, cytochrome b6/f (Cyt b6/f) and ATP synthase, which are involved in electron transport and energy‐transducing membrane systems (Rast et al. 2015; Yamori and Shikanai 2016; Wang et al. 2018). Light energy is captured by a series of pigments localized in light harvesting complexes (LHC) and reaction centers (RC) in two complexes: PSI and PSII (Baker 2008). Plants absorb light mainly by chlorophylls, carotenes, and xanthophyll pigments. Most of the PSII centers are localized in the grana stack of the thylakoid membranes and the PSI centers are localized in the margin of the grana stacks or in stroma lamellae (Koochak et al. 2019). LHCs accumulate energy and transfer it to photosystem reaction centers through the energy transfer system and the absorbed energy causes a transition in specialized chlorophyll a molecules, P680 (in PSII) and P700 (in PSI), from a ground state to an excited state (Yamori and Shikanai 2016). PSII is a multi‐subunit pigment‐protein complex with two elements: the core, which contains the major cofactors of electron transport and the light‐ harvesting antenna complex, which consists of most of the light absorbing pigments (Croce and van Amerongen 2011; Umena et al. 2011). In plants, LHC proteins can also be categorized as LHCI (in PSI) and LHCII (in PSII) which are encoded by Lhca or Lhcb genes, respectively. The detailed mechanism of photosynthesis is demonstrated by Shi et al. (2012) and Crepin and Caffari (2018). The photosynthetic apparatus such as chlorophyll biosynthesis, net Pn, Rubisco activity, and the PSII center are the primary targets of heat stress damage (Sinsawat et al. 2004; Jajoo and Allakhverdiev 2017). Heat or high‐temperature stress results in photoinhibition, which leads to the accumulation of reduced electron acceptors and increased formation of ROS including hydrogen peroxide (H2O2), superoxide (O2−), and hydroxyl ions (OH−). Accumulation of ROS over the tolerance level could cause lipid peroxidation and lead to damage including pigments, nucleic acid, and protein oxidation (Wang et al. 2014). Chen et al. (2012) also reported that heat stress‐induced disorganization of thylakoid structures caused a significant loss in PSII activity and a slight loss in PSI activity. High‐temperature stress can also lead to a decrease in grana stacking around core complexes (Lan et al. 2014) and destroy the photosynthetic elements such as thylakoid membranes and PSII structures (Lan et  al. 2012; Chen et  al. 2017). Therefore, under high‐temperature stress, maintaining stable LHC function and normal plant photosynthesis is important. Chen et al. (2012) did not observe any disintegration of chloroplasts in C. medica var. sarcodactylis Swingle plants at 30 °C, however, they noticed that vacuolation and separation of lamella pairs were evident at 40 °C heat treatment. At 45 °C heat treatment, in addition to those stresses, a sharp elevation in the ROS level and a drastic decrease in the Pn level were evident. A number of studies have shown that synthesis of chlorophyll in crop plants under high‐temperature or heat stress were greatly impaired (Mathur et al. 2014). One of the main mechanisms behind this was attributed to the impairment of the activity of 5‐aminolevulinate dehydratase (ALAD) (Mathur et al. 2014; Saitoh et al. 2018). Two main factors play important roles in making PSII electron transport system susceptible to heat stress. These could be counted as the increase in fluidity of thylakoid membranes, which leads to separation of PSII from thylakoid membranes and the disruption of PSII integrity (Mathur et al. 2014; Iqbal et al. 2017). Many studies have shown that PSI is more heat tolerant than PSII (Tiwari et al. 2008; Tikkanen and Grebe 2018). There is a close relationship between photosynthesis and stomatal conductance. Heat stress tolerance is directly related to leaf gas exchange and CO2 assimilation rates under

3.4  Impact of Pathogens on Photosynthesis

heat stress (Mathur et al. 2014). The difference between respiration and photosynthetic CO2 assimilation determines the level of crop productivity. The activity of Rubisco (ribulose1,5‐bisphosphate carboxylase/oxygenase), the enzyme responsible for CO2 fixation, determines the level of photosynthesis and this could be insufficient at high temperatures (Nazar et al. 2015). Under high‐temperature stress, plants respond to stress by increasing their photooxidation and reducing their CO2 assimilation capacity (Chen et al. 2012). Reduction in the rate of electron transport via converting the absorbed light into thermal energy is also another way for the mechanism to protect the photosynthetic cells from the excess heat (Gururani et  al. 2015). The dissipation of excess energy as heat is known as non‐­ photochemical quenching (NPQ) of chlorophyll fluorescence (Spetea et al. 2014). NPQ reduces the excess energy in PSII by activating a heat dissipation channel (Cazzaniga et al. 2013). Under high temperatures, cyclic electron transport also plays an important role for the reduction of ROS, thus protecting PSII and lipid membranes (Sharkey and Schrader 2006; Silva et al. 2018). Another important mechanism involves the enhancement of antioxidant enzymatic systems under heat stress (Silva et  al. 2018; Ahanger et al. 2018). For example, Silva et al. (2013) stated that oxidative damage in Jatropha curcas L. plants under heat stress was alleviated via up‐regulation of CAT, APX, and SOD activities. Many workers have also stated that secondary metabolites including phenolic compounds, anthocyanins, and steroids also played vital roles under heat stress (Sharma et al. 2012; Verma and Shukla 2015; Ashraf et al. 2018). Increased phenylalanine ammonia lyase (PAL) activity (Spadoni et al. 2014; Abeele et al. 2017) and some phytohormones such as abscisic acid (ABA), salicylic acid (SA), and ethylene (ET) were evident under heat stress (Abdelrahman et al. 2017; Torres et al. 2017). In some studies, heat shock proteins (HSPs) have been used as criteria to determine the heat stress tolerance. For example, Neta‐Sharir et al. (2005) showed that the small heat‐shock protein, HSP21, formed after heat treatment in chloroplasts of tomato leaves, protected PSII from further oxidative stress. They stated that chloroplast HSPs did not participate in the repair of temperature‐dependent stress damage, instead, HSPs were involved in preventing the stress‐related damage. Pollen viability under heat stress has also been used as a good criterium for selection of tolerant species in breeding programs (Jagadish et al. 2010). Morphologically, avoidance and tolerance mechanism strategies as in the cases of other abiotic stresses are also valid for plant heat stress adaption. Short‐term avoidance from heat stress or acclimation to heat stress via changing leaf orientation and leaf size with changing membrane lipid compositions, stomata orientation, etc. play important roles in maintaining heat stress tolerance (Chitara et  al. 2017; Jajoo and Allakhverdiev 2017). However, an adaptation of pathogen microorganisms or insects to high temperature would deteriorate the quality and quantity of crop plants under high‐ temperature stress or normal growth conditions. In Section 3.4, this concept is illustrated with conceptual figures and tables.

3.4 ­Impact of Pathogens on Photosynthesis Mechanisms Under Temperature Stress Environmental conditions such as pollution, drought, salinity, heavy metals, pesticides, high temperature, light, etc. affect the defence responses of crop plants as well as affecting their photosynthetic activities. A resistant plant could cope with the above stresses

45

46

3  High-Temperature Stress and Photosynthesis

depending on the duration, severity, and genetic background of plants. Exposure of plants to one particular stress can induce resistance to other stress factors (cross‐­ adaptation). However, if the other stress factors are biotic, then the expected resistance to multiple stresses may not take place. Because it is possible that biotic stress agents are stimulated by the presence of an abiotic stress factor or act consecutively or simultaneously with the abiotic stress factors on crop plants that would result in susceptibility even on resistant crop plants. For example, pathogens could adapt to high temperatures and result in pathogenicity. Also, there might be new pathogens or pathogen races which appear and cause significant crop losses at high temperatures. For example, Pythiogeton ramosum Minden, a newly isolated pathogen of soft rot disease of ginger (Zingiber officinale Roscoe) was quite effective at high temperatures (Kumar et al. 2016). Since concurrent or simultaneous occurrence of abiotic and biotic stress agents are quite realistic in nature due to the high impacts of environmental stresses in the last two or three decades, development of stress‐resistant or tolerant crop plants is quite challenging. Recent studies showed that responses of plants to the combined stresses are different from individual stress responses. Concurrent or simultaneous or even consecutive occurrences of an abiotic stress with a biotic stress agent either aggravate the stress on crop plants or inhibit the pathological effect of biotic agents leading to either enhanced or reduced susceptibility to plant pathogens (Pandey et al. 2015; Ramegowda and Senthil‐Kumar 2015; Dikilitas et al. 2017). A Plant’s adaptation strategy to a combined stress involves both shared and unique responses (Pandey et al. 2015). The shared response involves a general physiological adaptation mechanism. The unique response involves an unforeseen response, which is not easily predicted. Pandey et  al. (2015) stated that plant responses to stress combination are mainly characterized by the more dominant stress, which could be stated as the more severe one. A general conceptual pathway is illustrated in Figure 3.1. In general, stress sensing follows up a series of biochemical pathways. The case has no other exception in a combined stress. However, the main issue here is which type of stress, abiotic or biotic, would be sensed earlier. This actually determines the level of resistance barrier in host plants. If the pathogen is able to survive under temperature stress, it would cause more pathogenic effects through secretion of enzymes and toxins, because organic materials sub‐divided into sugars and amino acids followed by heat stress would be a rich substrate for pathogens to grow on. Most commonly, cell death may occur in the case of combined stress due to insufficient antioxidant metabolism in the host plants. Heat stress, like other abiotic stresses, leads to either resistance or susceptibility of plants to pathogens depending on the stress severity, duration, and host resistance (Nicol et  al. 2011). For example, Sharma et  al. (2007) stated that high temperatures in the warmer plains of South Asia over a six‐year experimental period in wheat production areas correlated with increased susceptibility to the fungus Cochliobolus sativus (Ito and Kuribayashi) Dastur (causal agent of root rot in wheat). Similarly, hypersensitive responses to Pseudomonas syringae van Hall pathovars were compromised at high temperatures (Wang et al. 2009). For example, MacDonald (1991) stated that the roots of ornamental plants exposed to 45 °C soil temperatures showed increased susceptibility to Phytophthora infestans (Montagne) de Bary. Similarly, Prasch and Sonnewald (2013) reported that Arabidopsis thaliana Schur plants exposed to a combination of heat and Turnip Mosaic Virus (TuMV) infection showed great susceptibility to the viral infection.

3.4  Impact of Pathogens on Photosynthesis

Temperature and Pathogen

Temperature

Signal sensing

Signal transduction

Gene expression

Activation of defence mechanism

Antioxidant Non-enzymatic Carbohydrates enzymes antioxidants and sugars

Crop plants get stressed

Proteins and amino acids

Crop plants mostly dead

Figure 3.1  Stress‐sensing pathways under temperature/temperature and pathogen stresses. (See color plate section for the color representation of this figure.)

The authors concluded that the concurrent occurrence of heat and viral infection resulted in the enhanced transcription of the P3 gene, a marker gene for viral infection. Neto et al. (2015) stated that simultaneous application of heat stress (42 °C) on shoots and roots of J. curcas plants for 12 hours, reduced leaf CO2 assimilation rate, and stomatal and mesophyll conductance in both tissues. They concluded that the yield of PSII, electron transport rate, photochemical and NPQ, and maximum electron transport rate driving Rubisco generation showed that high shoot temperature was more deleterious for photosynthesis than high root temperature. Again, Lu et al. (2017) showed that the combination of heat and Phytophthora capsici Leonian infection led to worse symptoms than either of the individual stress agents. The symptoms were more deleterious in the susceptible pepper cultivar “Early Calwonder” than in the resistant landrace line “Criollo de Morelos 334.” The gene expression levels for Capsicum annuum L. heat shock proteins (CaHSPs) were enhanced in both cultivars under heat stress treatment, however, under the combined stress, their expression levels increased in the resistant cultivar while decreasing in the susceptible one. Heat stress or high‐temperature stress not only reduces photosynthetic activity through the destruction of PSII and thylakoid membranes but also results in increased

47

48

3  High-Temperature Stress and Photosynthesis

DNA damage and indirectly affects the photosynthetic activity. For example, Cvjetko et al. (2014) stated that young tobacco plants (one‐month‐old), exposed to 42 °C heat stress for 2 and 4 hours and left for recovery at 26 °C for 24 and 72 hours, exhibited high soluble protein and malondialdehyde (MDA) contents as well as high DNA damage. Therefore, an additional stress especially a biotic stress agent which is able to cause pathogenic attack would further reduce the photosynthetic activity and defence level. Similarly, Huot et al. (2017) reported that elevated temperature promoted translation of pathogen‐related effector proteins into plant cells and disrupted the defence mechanism of Arabidopsis plants. As mentioned previously in this chapter, atmospheric greenhouse gas conditions have been accumulating in the earth’s atmosphere at an alarming rate, thus causing climate change (Jones 2016). The global average accumulation of CO2 in the atmosphere has increased by 41% since the middle of the eighteenth century (Gilardi et al. 2016). Atmospheric CO2 levels are predicted to reach up to 560 μmol mol−1 by 2050 and could further reach up to 650 μmol mol−1 by the year 2100 (IPCC 2014). High temperatures due to the accumulated concentration of CO2 is inevitable. For example, Gilardi et al. (2016) stated that basil (Ocimum basilicum L.) plants inoculated with downy mildew (Peronospora belbahrii Thines) showed lower photosynthetic activity under elevated atmospheric CO2 and temperature conditions. Similarly, Kumar et  al. (2016) studied three temperature levels (ambient, 1.5 °C higher than ambient, and 3 °C higher than ambient) throughout crop growth periods of two maize genotypes, PEHM5 (moderately resistant) and CM119 (highly susceptible) under ambient (400 μmol mol−1) and elevated (550 μmol mol−1) CO2 levels to evaluate the progress of maydis leaf blight (MLB) disease. The disease severity in the highly susceptible cultivar was higher than that of the moderately resistant cultivar in all treatments. The severity of the disease increased with the increase of temperature, however, elevated CO2 concentration reduced the negative effect of temperature stress. However, it is very rare to find a place at ambient temperature with high CO2 level. Therefore, the authors predicted that the severity of MLB disease would likely increase in the future. Similarly, Pugliese et  al. (2010) reported that an increase in CO2 did not affect powdery mildew occurrence caused by Erysiphe necatrix on the grapevine. This was possibly due to the increased photosynthetic activity of elevated CO2 conditions. The authors suggested that the gradual rise in CO2 concentrations could allow more time for pathogen evolution and this could possibly increase pathogen growth and dissemination as well as its survival rate and therefore, increased CO2 concentrations could indirectly affect the increase in powdery mildew of grapevine. Pugliese et al. (2012) stated that under increased CO2 conditions (800 μmol mol−1), both healthy and powdery mildew (Podosphaera xanthii [Castagne] Braun and Shishkoff ) infected zucchini (Cucurbita pepo L.) plants grew better when the temperature was lower than the standard temperature (18 °C night, 24 °C day). Elevated CO2 levels caused no significant differences neither in pathogen development nor in disease severity, whereas elevated temperature (22 °C night, 28 °C day) stimulated the growth of the powdery mildew agent. The authors concluded that the combination of elevated CO2 level and the high temperature always had a stimulative effect on the development of the pathogen when compared to standard conditions. It was shown that heat stress and pathogenic agents result in destructive consequences on photosynthesis in crop plants, however, recent evidence showed that heat‐tolerant

3.4  Impact of Pathogens on Photosynthesis

fungi would result in epidemiological consequences on crop plants. Miyake et al. (2014) reported that high‐temperature tolerant Pythium species such as Pythium aphanidermatum (Edson) Fitzpatrick, Pythium helicoides (Drechsler) Abad, De Cock, Bala, Robideau, Lodhi and Lévesqueand, and Pythium myriotylum Drechsler, led to disease incidences at 35 °C in Poinsettia plants. Zoospore concentrations of these fungal species were at the highest level at 35 °C. Romero‐Olivares et al. (2015) stated that fungi having relatively short generation time (Neurospora spp.) could adapt to heat stress. An in vitro work with Neurospora crassa Shear and Dodge showed that this fungus was able to adapt itself to temperature changes via synthesizing enhanced metabolites with increased high spore production (Romero‐Olivares et al. 2015). Similarly, Choudhury et al. (2014) showed that Erysiphe necator Schwein was more adaptable to environmental stress than previously recognized. Ding et al. (2016) revealed that heat shock treatment significantly decreased the net photosynthetic rate, photochemical efficiency, photochemical quenching coefficient, and starch content. Heat shock, on the other hand, resulted in an increase in the stomatal conductance, transpiration rate, antioxidant enzyme activities, total soluble sugar, sucrose, soluble protein, and proline contents in both healthy and downy mildew‐ infected leaves. They demonstrated that heat shock treatment activated the defence mechanism as well as the transpiration pathway to reduce the excess energy in cucumber leaves, which protected the photosystem from further damage. They indicated that heat shock might suppress the development of the downy mildew. They also stated that heat shock treatment should not exceed 48 °C and longer application periods, and plants need to be well‐watered to avoid heat damage. Trebicki et al. (2015) demonstrated that elevated atmospheric CO2 increased barley yellow dwarf virus‐PAV strain (BYDV‐PAV) titer by 36.8% in wheat leaves. The simulation of the same atmospheric conditions gave similar results. Interactions between temperature stress and pathogens and their effects on plants, and the responses of crop plants in terms of biochemical, morphological, molecular, and physiological responses are illustrated in Figure  3.2. Some of the major studies including temperature stress, or temperature and pathogen stress are listed in Table 3.1. In some studies, HSP induction was used to improve the conditions of crop plants. For example, Prokopova et al. (2010) stated that powdery mildew Oidium neolycopersici Kiss infection caused minimal impairment of photosynthesis in both moderately resistant (Lycopersicon chmielewskii C.M. Rick, Kesicki, J.F. Forbes and M. Holle) and susceptible (Lycopersicon esculentum cv. Amateour L.) tomato genotypes. When the plants were pre‐ treated by heat shock (40.5 °C, 2 hours) before inoculation, the resistance response of the resistant tomato genotype was not affected, whereas the susceptible one developed chloroses and necroses, and the rate of CO2 assimilation and maximum quantum yield PSII photochemistry (F V/FM) decreased in infected leaves. They hypothesized that the increased activity of cell wall invertase enzyme increased the demand for carbohydrates in heat shock‐induced defence reactions. Although the accumulation of sugars or carbohydrates are good sources for successful plant tolerance to abiotic stress, they are also good substrates for pathogen growth. Nožková et  al. (2019) stated heat shock pre‐­ treatment (40.5 °C, 2 hours) exhibited different mechanisms on the susceptible and moderately resistant tomato genotypes. Heat shock pre‐treatment accelerated the development of symptoms caused by Pseudoidium neolycopersici L. Kiss and biochemical responses in the susceptible genotype of Solanum lycopersicum L. while showing a slight suppression

49

Cell metabolism under temperature and pathogen stress conditions.

Cell metabolism under high-temperature conditions.

Cell metabolism under temperature conditions.

3.5  Genomic, Biochemical, and Physiological

Figure 3.2  A diagrammatic illustration of physiological, biochemical, and molecular changes in crop plants under heat stress or combined heat stress and pathogen conditions. Source: Mathur et al. 2014; Kaushal et al. 2016. Reproduced with permission of Elsevier and Taylor and Francis. Oxidative stress, induced by the accumulation of reactive oxygen species (ROS) such as O2−, H2O2, and OH˙, results in a series of biochemical and molecular responses ending up with either apoptosis, DNA repair, or cell death. Severe oxidative stresses can induce permanent DNA damage, which can ultimately lead to cell death. ROS in severe stress conditions have toxic potentials as they could induce protein oxidation, membrane and DNA damage, hormonal and enzymatic dysfunctions, and lipid peroxidation along with the destruction of pigments. There is a direct link between ROS scavenging and plant stress tolerance under temperature stress, which could enhance the activities of defence‐related enzymes. However, even though defence mechanisms are active in stress conditions, most of the defence related genes are either down‐regulated or not expressed in combined stress conditions. Multiple single strand breaks and double strand breaks mostly occur at temperature and pathogen stress conditions. As a response to heat stress, accumulation of antioxidant metabolites (glutathiones, vitamins, etc.) and enzymes show a declining trend in temperature stress conditions, however, the case is more severe under temperature and pathogen stress conditions. Color from yellow to red implies an increase in the severity of stress and dysfunctionality of defence mechanisms. ROS, reactive oxygen species; GA, gibberellic acid; ABA, abscisic acid; IAA, indole acetic acid; SA, salicylic acid; JA, jasmonic acid; IMP, increased membrane permeability; DRG, down‐regulation of genes; URG, up‐regulation of genes; sSB, single‐strand breaks; dSB, double‐strand breaks; HSP, heat shock proteins; FD, fruit discoloration; LR, leaf rolling; ISRG, inhibition in shoot and growth; EM, early maturation; CLO, changes in leaf orientation; IRA, inactivation of Rubisco activities; HR, hormonal response; PO, protein oxidation; P, photosynthesis; RP, reduced photosynthesis; MRP, much‐reduced photosynthesis; IR, increased respiration; DSC, decrease in stomatal conductance; R, respiration; RWP, reduced water potential; SWP, sustained water potential; SC, stomatal conductance; RLA, reduced leaf area; AGE, alterations in gene expressions; RICC, reduced internal CO2 concentration; TC, transcriptional change; CR, chromatin remodeling; DDR, DNA damage response. Due to limited space, we were not able to show antioxidant metabolism in this figure.

Cell metabolism under temperature conditions.

high‐temperature conditions.

Cell metabolism under

Cell metabolism under temperature and pathogen stress

conditions. (See color plate section for the color representation of this figure.)

of the pathogen in the resistant tomato genotype (Solanum chmielewskii C.M. Rick, Kesicki, J.F. Forbes and M. Holle) with the increase of jasmonic acid, salicylic acid, and antioxidant enzyme activities. Therefore, priming before main stress may not work in plants under temperature influence due to pathogen involvement as it worked in the case of additional abiotic stress cases. It is also important to note that CO2 influx could be inhibited in heat‐shock treatments due to stomatal closure and powdery mildew can also affect nutrient remobilization toward infection sites and source–sink relations, which can result in the inhibition of the Calvin cycle and in the inhibition of photosynthetic light reactions in thylakoid membranes (Magyarosy et al. 1976).

3.5 ­Genomic, Biochemical, and Physiological Approaches for Crop Plants Under Temperature and Pathogenic Stresses Increase in temperature is affecting the mechanism of photosynthesis as well as modifying defence responses of crop plants. Although short‐term heat or long‐term high temperature results in heat‐shock proteins that play crucial roles in preventing the cell

51

52

3  High-Temperature Stress and Photosynthesis

Table 3.1  Plant responses under temperature, or temperature and pathogen stresses. Crop species

Stress type or combination

Effects

References

Tomato (Lycopersicon esculentum L.)

Heat; 31/25 °C

Reduced pollen viability and pollen germination

Firon et al. (2006)

Chickpea (Cicer arietinum L.)

Heat; 35/20 °C

Reduced pollen germination

Devasirvatham et al. (2010)

Soybean (Glycine max [L.] Merr.)

Heat; 38/28 °C

Reduced pollen germination

Djanaguiraman et al. (2013)

Chickpea (Cicer arietinum)

Heat; 45/35 °C

Reduced pollen germination and stigma activity

Kumar et al. (2013)

Wheat (Triticum aestivum L.)

Heat; (45/55 °C)

Reduction in photosynthesis

Reda and Mandoura (2011)

Chickpea (Cicer arietinum)

Heat; 45/35 °C

Reduced photosynthesis

Kumar et al. (2013)

Rice

Heat; 28/35 °C

Reduced photosynthesis

Fahad et al. (2016)

Wheat (Triticum aestivum)

Heat (18/25 °C) and pathogen The increased infection rate of the pathogen by stress combination; temperature effect (Puccinia striiformis f. sp. tritici)

Bryant et al. (2014)

Nicotiana benthamiana Domin

Heat (25/30 °C) and Pathogen Reduced photosynthesis and stress combination; increased disease symptoms Potato virus Y─O Potato virus A

Chung et al. (2016)

Wheat (Triticum aestivum)

Barley yellow dwarf virus‐PAV

Elevated temperatures have been associated with increased disease symptoms

Nancarrow et al. (2014)

Vitis vinifera L.

Heat (37 °C) and Pathogen stress combination; Erysiphe necator

E. necator has a capacity in high temperature

Choudhury et al. (2014)

Hordeum vulgare L.

Heat (48–49 °C) and pathogen Heat pre‐treatment caused a stress combination; Blumeria late decrease of SOD and a slight increase in CAT graminis f. sp. hordei enzyme activities

Barna et al. (2014)

Brassica napus L.

Heat (22/32 °C) and pathogen Increase in disease development stress combination; Leptosphaeria maculans

Hubbard and Peng (2018)

Arabidopsis thaliana

Heat (23/30 °C) and pathogen stress combinations; Pseudomonas syringae pv. tomato DC3000 (Okabe) Young, Dye and Wilkie

Plant defence is weakened and bacterial virulence is strengthened at elevated temperature.

Huot et al. (2017)

Source: Kaushal et al. 2016. https://www.cogentoa.com/article/10.1080/23311932.2015.1134380. Licensed under CC BY 4.0.

3.5  Genomic, Biochemical, and Physiological

from further stress attack (Driedonks et  al. 2015), however, an additional stress may deteriorate the case. High‐temperature stress represents one of the most limiting stress factors in crop production as compared to those of other abiotic stresses. One of the efficient solutions is to develop crop plants that are tolerant or resistant to high‐ temperature stress. In developing resistant cultivars, grafting is regarded as a rapid alternative tool to a slow breeding approach (Nazar et al. 2015). However, whichever method is needed or developed for high‐temperature stress, it requires a further step ahead to make more resistant crops due to the involvement of pathogenic agents in high‐temperature conditions. In this section, suitable and cost‐effecting approaches were briefly outlined and listed for developing heat‐stress tolerant crop plants under pathogen influence, Figure  3.3; Table 3.2. Rather than suggesting methods to be developed in the long‐term with a futuristic approach, we suggest the main methods which work under stress conditions. For example, biochemical approaches took a great part in modulating heat‐stress‐tolerant plants. For example, Zhao et al. (2017) stated that the effects of 2,4‐epibrassinolide (EBR) application enhanced the photosynthetic capacity of wheat leaf subjected to combined heat and drought stress by increasing Rubisco activity. Similarly, Wang et  al. (2018)

Exogenous application of osmolytes and hormones

Gene induction (transgenic approach)

OMICS studies

Grafting

Priming

Crop plants

Temperature

Temperature and Pathogen

Figure 3.3  Crop improvement strategies under temperature or temperature and pathogen stress conditions. It should be remembered that most of the resistance genes regarding abiotic and biotic stress issues are functional within 20–30 °C. Even though crop plants become resistant, pathogens are able to infect the host plants. Below or above these ambient temperatures, no resistance genes are functional (for further reading, Alcazar and Parker 2011; Bryant et al. 2014; Aoun et al. 2017). However, pathogens which are not able to infect the host plants within unfavorable temperatures, they have now been infecting the host tissues due to adaptation to harsh environments. Under combined temperature and pathogen interactions, the response could be different from those of each stress factor alone. Heat stress might increase the incidence of the pathogenic effects thus preventing DNA repair of the host plant. Therefore, the future of crop production is now more complex and handicapped. Scientists have to increase the resistance of host plants within extreme temperatures as well. Otherwise, a severe famine danger is right round the corner, which would be more realistic upon firm adaptation of pathogens to high‐temperature conditions. (See color plate section for the color representation of this figure.)

53

54

3  High-Temperature Stress and Photosynthesis

Table 3.2  Improvement of plants under pathogen and/or heat stress. Plant species

Stress type

Treatment method

References

Arabidopsis thaliana

Heat stress

Heat‐shock proteins

Yoshida et al. (2011)

Arabidopsis thaliana

Heat stress

Heat stress has been linked to increased thermotolerance of the photosynthetic apparatus

Hemantaranjan et al. (2014)

Rice

Heat stress

Over expression of heat shock proteins resulted in a significant improvement in rice plants during heat stress

Liu et al. (2011)

Arabidopsis thaliana

Heat stress

Genes are involved in thermotolerance

Li et al. (2014)

Arabidopsis thaliana

Heat stress

Light‐induced chloroplast signaling played a key role in the tolerance mechanism

Dickinson et al. (2018)

Rice

Heat stress

The biochar+P application recorded 7% higher grain yield of rice

Fahad et al. (2016)

Arabidopsis thaliana

Heat stress

Tolerance of the plant to heat stress is characterized by minimal damage to photosynthetic apparatus via increased biosynthesis of protective compounds

Bita and Gerats (2013)

Sorghum bicolor (L.) Moench

Heat stress

Recovery was observed after heat shock

Setimela et al. (2005)

reported that exogenous spermidine (Spd) alleviated the photosynthetic damage caused by heat shock. They showed that exogenous Spd modulated the expression of photosynthetic and somatic membrane proteins, inhibited the degradation of thylakoid membrane proteins, and maintained the stability of the thylakoid membrane in cucumber leaves. This increased the heat tolerance of the seedlings (Tian et al. 2012). It has been reported that exogenous Spd improved carbon and nitrogen metabolism by modulating the gene expression (Shan et al. 2016). Exogenous Spd could also regulate the endogenous polyamine levels as confirmed in tomato plants under high‐temperature stress (Sang et al. 2016). Nazar et al. (2015) stated that the exogenous application of salicylic acid improved the growth and photosynthesis of crop plants under drought stress conditions. Similarly, Lunde et al. (2008) have shown the beneficial effects of sulfur. Siddiqui et  al. (2016) suggested that adequate magnesium supply also improved plant heat tolerance by minimizing cellular damage induced by ROS through enzymatic and non‐enzymatic antioxidant mechanisms. Muneer et al. (2017) reported that silicon application under temperature stress maintained photosynthesis by improving the photosynthetic proteins (PsaA and PsbA). Moreover, the silicon source (K2SiO3) alleviated the oxidative damage (ROS). Similarly, Siddiqui et al. (2017) stated that the co‐application of sodium nitroprusside (SNP) and indole acetic acid (IAA) alleviated the adverse effects of heat stress by promoting antioxidant enzymes and enhanced accumulation of photosynthetic pigments (chlorophyll a and b) with a concomitant

­  References

decrease in H2O2 and O2− content. This resulted in a concomitant decrease in DNA  damage. The addition of NO scavenger cPTIO, 2‐(4‐carboxyphenyl)‐4,4,5,5‐­ tetramethylimidazoline‐1‐oxyl‐3‐oxide, along with SNP and IAA further reduced the SNP signal in tomato plants. Harizanova et  al. (2014) stated that exogenous silicon application increased young cucumber antioxidant capacity and photosynthesis. Photosynthesis is also associated with reduced nitrogen and sulfur metabolisms. Xu and Zhou (2006) reported that insufficient amounts of those elements under drought stress negatively affected Rubisco and chlorophyll content, and PSII efficiency. Therefore, the application of those elements has the potential to increase photosynthesis under temperature stress conditions. Kaushal et al. (2016) reported that HSPs and biomolecules played important roles for mitigating thermal stress. They stated that various transgenic plants were developed with improved heat tolerance. Increased heat tolerance has been achieved in many plant species (Kurek et al. 2007; Martinez et al. 2014; Fan et al. 2018). Mathur et al. (2018) demonstrated that maize plants colonized with arbuscular mycorrhizal fungi (AMF) at high‐temperature stress (44 °C) improved photochemistry of maize plant and protected PSII from further damage during stress conditions. Similarly, Zhu et al. (2011) reported that arbuscular mycorrhizal symbiosis with the fungus Glomus etunicatum W.N. Becker and Gerd. markedly enhanced the net photosynthetic rate, stomatal conductance, and transpiration rate in the maize leaves.

3.6 ­Conclusions and Future Prospects Damage caused by high‐temperature stress could lead to metabolic disorders, membrane disorganization, reduction in photosynthesis, etc. Currently, global warming is one of the biggest problems threatening crop production and food quality. Crop improvement strategies have been failing due to the increasing trend in temperature and carbon dioxide levels. Therefore, heat stress poses a significant threat for sustainable agriculture. On the other hand, pathogen dissemination and increased virulence characterized via increased toxin production due to adaption of stress‐tolerant pathogens and the decreased level of defence mechanisms of crop plants under heat stress is another issue which should be tackled seriously. Hence, prolonged drought conditions or water stress under irrigation regimes under heat stress would be another problem for food security. We tried to highlight at least what we can do under the heat and pathogen stress conditions in the near future. Approaches to solve stress cases under heat and pathogen combinations via molecular and biochemical methods and evaluating the behaviors of the plant pathogens under heat stress conditions would help us to develop more resistant crops.

­References Abdelrahman, M., El‐Sayed, M., Jogaiah, S. et al. (2017). The “STAY‐GREEN” trait and phytohormone signaling networks in plants under heat stress. Plant Cell Rep. 36 (7): 1009–1025. Abeele CV, Raes K, Sampers I (2017) The effect of heat shock on browning‐related enzyme activity in lettuce. Presented at the 22nd National symposium for Applied Biological Sciences, Leuven, Belgium (7 February 2017).

55

56

3  High-Temperature Stress and Photosynthesis

Acevedo, M., Zurn, J.D., Molero, G. et al. (2018). The role of wheat in global food security. In: Agricultural Development and Sustainable Intensification (ed. U.S. Nagothu), 81–110. London: Routledge. Ahanger, M.A., Alyemeni, M.N., Wijaya, L. et al. (2018). Potential of exogenously sourced kinetin in protecting Solanum lycopersicum from NaCl‐induced oxidative stress through up‐regulation of the antioxidant system, ascorbate‐glutathione cycle and glyoxalase system. PLoS One 13 (9): e0202175. Alcazar, R. and Parker, J.E. (2011). The impact of temperature on balancing immune responsiveness and growth in Arabidopsis. Trends Plant Sci. 16 (12): 666–675. Aoun, N., Tauleigne, L., Lonjon, F. et al. (2017). Quantitative disease resistance under elevated temperature: genetic basis of new resistance mechanisms to Ralstonia solanacearum. Front. Plant Sci. 8: 1387. Ashraf, M.A., Iqbal, M., Rasheed, R. et al. (2018). Environmental stress and secondary metabolites in plants: an overview. In: Plant Metabolites and Regulation Under Environmental Stress (ed. P. Ahmad, M.A. Ahanger, V.P. Singh, et al.), 153–167. London: Academic Press. Bai, Y., Kissoudis, C., Yan, Z. et al. (2018). Plant behaviour under combined stress: tomato responses to combined salinity and pathogen stress. Plant J. 93 (4): 781–793. Bailey‐Serres, J., Pierik, R., Ruban, A., and Wingler, A. (2018). The dynamic plant: capture, transformation, and management of energy. Plant Physiol. 176: 961–966. Baker, N.R. (2008). Chlorophyll fluorescence: a probe of photosynthesis in vivo. Annu. Rev. Plant Biol. 59: 89–113. Barna, B., Harrach, B., Viczián, O., and Fodor, J. (2014). Heat induced susceptibility of barley lines with various types of resistance genes to powdery mildew. Acta Phytopathol. Hun. 49 (2): 177–188. Bita, C.E. and Gerats, T. (2013). Plant tolerance to high temperature in a changing environment: scientific fundamental sand production of heatstress‐tolerant crops. Front. Plant Sci. 4: 273. Breusegem, F.V., Foyer, C., and Mann, G. (2018). Reactive oxygen species are crucial "pro‐life" survival signals in plants. Free Radical Biol. Med. 122: 1–3. Bryant, R.R., McGrann, G.R., Mitchell, A.R. et al. (2014). A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36. BMC Plant Biol. 14 (1): 1, 10. Camejo, D., Rodríguez, P., Morales, M.A. et al. (2005). High temperature effects on photosynthetic activity of two tomato cultivars with different heat susceptibility. J. Plant Physiol. 162 (3): 281–289. Cazzaniga, S., Dall’Osto, L., Kong, S.G. et al. (2013). Interaction between avoidance of photon absorption, excess energy dissipation and zeaxanthin synthesis against photooxidative stress in Arabidopsis. Plant J. 76 (4): 568–579. Chen, W.R., Zheng, J.S., Li, Y.Q., and Guo, W.D. (2012). Effects of high temperature on photosynthesis, chlorophyll fluorescence, chloroplast ultrastructure, and antioxidant activities in fingered citron. Russ. J. Plant Physiol. 59 (6): 732–740. Chen, Y.E., Zhang, C.M., Su, Y.Q. et al. (2017). Responses of photosystem II and antioxidative systems to high light and high temperature co‐stress in wheat. Environ. Exp. Bot. 135: 45–55. Chitara, M.K., Keswani, C., Bisen, K. et al. (2017). Improving crop performance under heat stress using thermotolerant agriculturally important microorganisms. In: Advances in

­  References

PGPR Research (ed. H.B. Singh, B.K. Sarma and C. Keswani), 296–305. United Kingdom: CAB International. Choudhury, R.A., McRoberts, N., and Gubler, W.D. (2014). Effects of punctuated heat stress on the grapevine powdery mildew pathogen, Erysiphe necator. Phytopathol. Mediterr. 53 (1): 148–158. Chung, B.N., Canto, T., Tenllado, F. et al. (2016). The effects of high temperature on infection by Potato virus Y, Potato virus A, and Potato leafroll virus. Plant Pathol. J. 32 (4): 321–328. Coskun, Y., Coşkun, A., Demirel, U., and Özden, M. (2011). Physiological response of maize (Zea mays L.) to high temperature stress. Aust. J. Crop Sci. 5 (8): 966–972. Crepin, A. and Caffarri, S. (2018). Functions and evolution of Lhcb isoforms composing LHCII, the major light harvesting complex of photosystem II of Green eukaryotic organisms. Curr. Protein Pept. Sci. 19 (7): 699–713. Croce, R. and van Amerongen, H. (2011). Light‐harvesting and structural organization of photosystem II: from individual complexes to thylakoid membrane. J. Photochem. Photobiol. B 104 (1–2): 142–153. Cui, L., Li, J., Fan, Y. et al. (2006). High temperature effects on photosynthesis, PSII functionality and antioxidant activity of two Festuca arundinacea cultivars with different heat susceptibility. Bot. Stud. 47 (1): 61–69. Cvjetko, P., Balen, B., Štefanić, P.P. et al. (2014). Dynamics of heat‐shock induced DNA damage and repair in senescent tobacco plants. Biol. Plant. 58 (1): 71–79. Dekov, I., Tsonev, T., and Yordanov, I. (2000). Effects of water stress and high‐temperature stress on the structure and activity of photosynthetic apparatus of Zea mays and Helianthus annuus. Photosynthetica 38 (3): 361–366. Devasirvatham, V., Tan, D.K.Y., Trethowan, R.M. et al. (2010). Impact of high temperature on the reproductive stage of chickpea. In: Food Security from Sustainable Agriculture. Proceedings of the 15th Australian Society of Agronomy Conference (ed. H. Dove and R.A. Culvenor), 15–18. New Zealand: Lincoln. Dhaliwal, L.K., Sandhu, S.K., Kaur, S., and Singh, S. (2018). Effect of meteorological parameters on incidence of brown leaf spot in rice crop under different planting methods. J. Agrometeorol. 20 (1): 53–56. Dickinson, P.J., Kumar, M., Martinho, C. et al. (2018). Chloroplast signaling gates thermotolerance in Arabidopsis. Cell Rep. 22 (7): 1657–1665. Dikilitas, M. and Karakas, S. (2012). Behaviour of plant pathogens for crops under stress during the determination of physiological, biochemical, and molecular approaches for salt stress tolerance. In: Crop Production for Agricultural Improvement (ed. M. Ashraf, M. Ozturk, M.S.A. Ahmad and A. Aksoy), 417–441. Dordrecht: Springer. Dikilitas, M. and Karakas, S. (2014). Crop plants under saline‐adapted fungal pathogens: an overview. In: Emerging Technologies and Management of Crop Stress Tolerance, vol. 2 (ed. P. Ahmad and S. Rasool), 173–192. Elsevier. Dikilitas, M., Yucel, N., and Dervis, S. (2017). Production of antioxidant and oxidant metabolites in tomato plants infected with Verticillium dahliae under saline conditions. In: Reactive Oxygen Species and Antioxidant Systems in Plants: Role and Regulation Under Abiotic Stress (ed. M.I.R. Khan and N.A. Khan), 315–329. Singapore: Springer. Ding, X., Jiang, Y., Hao, T. et al. (2016). Effects of heat shock on photosynthetic properties, antioxidant enzyme activity, and downy mildew of cucumber (Cucumis sativus L.). PLoS One 11 (4): e0152429.

57

58

3  High-Temperature Stress and Photosynthesis

Djanaguiraman, M., Prasad, P.V., Boyle, D.L., and Schapaugh, W.T. (2013). Soybean pollen anatomy, viability and pod set under high temperature stress. J. Agron. Crop Sci. 199 (3): 171–177. Djanaguiraman, M., Boyle, D.L., Welti, R. et al. (2018). Decreased photosynthetic rate under high temperature in wheat is due to lipid desaturation, oxidation, acylation, and damage of organelles. BMC Plant Biol. 18 (55): 1–17. Driedonks, N., Xu, J., Peters, J.L. et al. (2015). Multi‐level interactions between heat shock factors, heat shock proteins, and the redox system regulate acclimation to heat. Front. Plant Sci. 6: 999. Fahad, S., Hussain, S., Saud, S. et al. (2016). Exogenously applied plant growth regulators affect heat‐stressed rice pollens. J. Agron. Crop Sci. 202 (2): 139–150. Fan, Y., Ma, C., Huang, Z. et al. (2018). Heat priming during early reproductive stages enhances thermo‐tolerance to post‐anthesis heat stress via improving photosynthesis and plant productivity in winter wheat (Triticum aestivum L.). Front. Plant Sci. 9: 805. Feng, B., Liu, P., Li, G. et al. (2014). Effect of heat stress on the photosynthetic characteristics in flag leaves at the grain‐filling stage of different heat‐resistant winter wheat varieties. J. Agron. Crop Sci. 200 (2): 143–155. Firon, N., Shaked, R., Peet, M.M. et al. (2006). Pollen grains of heat tolerant tomato cultivars retain higher carbohydrate concentration under heat stress conditions. Sci. Hortic. 109 (3): 212–217. Gilardi, G., Pugliese, M., Chitarra, W. et al. (2016). Effect of elevated atmospheric CO2 and temperature increases on the severity of basil downy mildew caused by Peronospora belbahrii under phytotron conditions. J. Phytopathol. 164 (2): 114–121. Gray, S.B. and Brady, S.M. (2016). Plant developmental responses to climate change. Dev. Biol. 419 (1): 64–77. Gururani, M.A., Venkatesh, J., and Tran, L.S.P. (2015). Regulation of photosynthesis during abiotic stress‐induced photoinhibition. Mol. Plant 8 (9): 1304–1320. Gustafson, E.J., Miranda, B.R., De Bruijn, A.M. et al. (2017). Do rising temperatures always increase forest productivity? Interacting effects of temperature, precipitation, cloudiness and soil texture on tree species growth and competition. Environ. Modell. Softw. 97 (2017): 171–183. Harizanova, A., Zlatev, Z., and Koleva, L. (2014). Effect of silicon on activity of antioxidant enzymes and photosynthesis in leaves of cucumber plants (Cucumis sativus L.). Turk. J. Agric. Nat. Sci. 1 (special issue 2): 1812–1817. Harsh, A., Sharma, Y.K., Joshi, U. et al. (2016). Effect of short‐term heat stress on total sugars, proline and some antioxidant enzymes in moth bean (Vigna aconitifolia). Anna. Agric. Sci. 61 (1): 57–64. Hatfield, J.L. and Prueger, J.H. (2015). Temperature extremes: effect on plant growth and development. Weather Clim Extrem 10: 4–10. Haworth, M., Marino, G., Brunetti, C. et al. (2018). The impact of heat stress and water deficit on the photosynthetic and stomatal physiology of olive (Olea europaea L.)—a case study of the 2017 heat wave. Plants 7 (4): 76. Hemantaranjan, A., Bhanu, A.N., Singh, M.N. et al. (2014). Heat stress responses and thermotolerance. Adv. Plants Agric. Res. 1 (3): 00012. Hubbard, M. and Peng, G. (2018). Quantitative resistance against an isolate of Leptosphaeria maculans (blackleg) in selected Canadian canola cultivars remains effective under increased temperatures. Plant Pathol. 67 (6): 1329–1338.

­  References

Huot, B., Castroverde, C.D.M., Velásquez, A.C. et al. (2017). Dual impact of elevated temperature on plant defence and bacterial virulence in Arabidopsis. Nat. Commun. 8 (1808): 1–12. IPCC (2012). Managing the risks of extreme events and disasters to advance climate change adaptation. In: A Special Report of Working Groups I and II of the Intergovernmental Panel on Climate Change (ed. C.B. Field, V. Barros, T.F. Stocker, et al.), 582. Cambridge: Cambridge University Press. IPCC (2013). Climate change 2013: the physical science basis. In: Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (ed. T.F. Stocker, D. Qin, G.K. Plattner, et al.), 1535. Cambridge, United Kingdom and New York, NY, USA: Cambridge University Press. IPCC (2014). Climate Change 2014: Synthesis Report. Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (ed. R.K. Pachauri and L.A. Meyer), 151. Geneva, Switzerland: IPCC. Iqbal, M., Raja, N.I., Yasmeen, F. et al. (2017). Impacts of heat stress on wheat: a critical review. Adv. Crop Sci. Technol. 5 (1): 1–9. Jagadish, S.V.K., Cairns, J., Lafitte, R. et al. (2010). Genetic analysis of heat tolerance at anthesis in rice. Crop Sci. 50 (5): 1633–1641. Jajoo, A. and Allakhverdiev, S.I. (2017). High‐temperature stress in plants: consequences and strategies for protecting photosynthetic machinery. In: Plant Stress Physiology, 2e (ed. S. Shabala), 138–154. Oxfordshire: CAB International. Jones, R.A.C. (2016). Future scenarios for plant virus pathogens as climate change progresses. Adv. Virus Res. 95: 87–147. Jumrani, K. and Bhatia, V.S. (2018). Impact of combined stress of high temperature and water deficit on growth and seed yield of soybean. Physiol. Mol. Biol. Plants 24 (1): 37–50. Kantidze, O.L., Velichko, A.K., Luzhin, A.V., and Razin, S.V. (2016). Heat stress‐induced DNA damage. Acta Naturae 8 (2): 75–78. Kaushal, N., Bhandari, K., Siddique, K.H., and Nayyar, H. (2016). Food crops face rising temperatures: an overview of responses, adaptive mechanisms, and approaches to improve heat tolerance. Cogent Food Agric. 2 (1134380): 1–42. Koochak, H., Puthiyaveetil, S., Mullendore, D.L. et al. (2019). The structural and functional domains of plant thylakoid membranes. Plant J. 97 (3): 412–429. Krishnamoorthy, M., Venugopal, V., Venkatesan, V. et al. (2018). Occupational heat stress, DNA damage and heat shock protein‐a review. Med. Res. Arch. 6 (1): 1–19. Kumar, S., Thakur, P., Kaushal, N. et al. (2013). Effect of varying high temperatures during reproductive growth on reproductive function, oxidative stress and seed yield in chickpea genotypes differing in heat sensitivity. Arch. Agron. Soil Sci. 59 (6): 823–843. Kumar, R., Mina, U., Gogoi, R. et al. (2016). Effect of elevated temperature and carbon dioxide levels on maydis leaf blight disease tolerance attributes in maize. Agric. Ecosys. Environ. 231: 98–104. Kumari, M., Verma, S.C., and Bharat, N.K. (2018). Effect of elevated CO2 and temperature on incidence of diseases in bell pepper (Capsicum annuum L.) crop. J. Entomol. Zool. Stud. 6 (1): 1049–1052. Kurek, I., Chang, T.K., Bertain, S.M. et al. (2007). Enhanced thermostability of Arabidopsis Rubisco activase improves photosynthesis and growth rates under moderate heat stress. Plant Cell 19 (10): 3230–3241.

59

60

3  High-Temperature Stress and Photosynthesis

Lan, S., Wu, L., Zhang, D., and Hu, C. (2012). Composition of photosynthetic organisms and diurnal changes of photosynthetic efficiency in algae and moss crusts. Plant Soil 351 (1–2): 325–336. Lan, S., Wu, L., Zhang, D., and Hu, C. (2014). Desiccation provides photosynthetic protection for crust cyanobacteria Microcoleus vaginatus from high temperature. Physiol. Plant. 152 (2): 345–354. Li, S., Liu, J., Liu, Z. et al. (2014). Heat‐induced tas1 target1 mediates thermotolerance via heat stress transcription factor A1a–directed pathways in Arabidopsis. Plant Cell 26: 1764–1780. Liu, H.C., Liao, H.T., and Charng, Y.Y. (2011). The role of class A1 heat shock factors (HSFA1s) in response to heat and other stresses in Arabidopsis. Plant Cell Environ. 34 (5): 738–751. Lu, J., Guo, M., Zhai, Y. et al. (2017). Differential responses to the combined stress of heat and Phytophthora capsici infection between resistant and susceptible Germplasms of pepper (Capsicum annuum L.). J. Plant Growth Regul. 36 (1): 161–173. Lunde, C., Zygadlo, A., Simonsen, H.T. et al. (2008). Sulfur starvation in rice: the effect on photosynthesis, carbohydrate metabolism, and oxidative stress protective pathways. Physiol. Plant. 134 (3): 508–521. MacDonald, J.D. (1991). Heat stress enhances Phytophthora root rot severity in container‐ grown chrysanthemums. J. Am. Soc. Hortic. Sci. 116 (1): 36–41. Madhu, M. and Hatfield, J.L. (2013). Dynamics of plant root growth under increased atmospheric carbon dioxide. Agron. J. 105 (3): 657–669. Magyarosy, A.C., Schürmann, P., and Buchanan, B.B. (1976). Effect of powdery mildew infection on photosynthesis by leaves and chloroplasts of sugar beets. Plant Physiol. 57 (4): 486–489. Martinez, C.A., Bianconi, M., Silva, L. et al. (2014). Moderate warming increases PSII performance, antioxidant scavenging systems and biomass production in Stylosanthes capitata Vogel. Environ. Exp. Bot. 102: 58–67. Martinez, V., Nieves‐Cordones, M., Lopez‐Delacalle, M. et al. (2018). Tolerance to stress combination in tomato plants: new insights in the protective role of melatonin. Molecules 23: 535. Mathur, S., Agrawal, D., and Jajoo, A. (2014). Photosynthesis: response to high temperature stress. J. Photochem. Photobiol. B 137: 116–126. Mathur, S., Sharma, M.P., and Jajoo, A. (2018). Improved photosynthetic efficacy of maize (Zea mays) plants with arbuscular mycorrhizal fungi (AMF) under high temperature stress. J. Photochem. Photobiol. B 180: 149–154. Miyake, N., Nagai, H., and Kageyama, K. (2014). Wilt and root rot of poinsettia caused by three high‐temperature‐tolerant Pythium species in ebb‐and‐flow irrigation systems. J.Gen. Plant Pathol. 80 (6): 479–489. Muneer, S., Park, Y.G., Kim, S., and Jeong, B.R. (2017). Foliar or subirrigation silicon supply mitigates high temperature stress in strawberry by maintaining photosynthetic and stress‐responsive proteins. J. Plant Growth Regul. 36 (4): 836–845. Nancarrow, N., Constable, F.E., Finlay, K.J. et al. (2014). The effect of elevated temperature on barley yellow dwarf virus‐PAV in wheat. Virus Res. 186: 97–103. Nazar, R., Umar, S., Khan, N.A., and Sareer, O. (2015). Salicylic acid supplementation improves photosynthesis and growth in mustard through changes in proline accumulation and ethylene formation under drought stress. S. Afr. J. Bot. 98: 84–94.

­  References

Neta‐Sharir, I., Isaacson, T., Lurie, S., and Weiss, D. (2005). Dual role for tomato heat shock protein 21: protecting photosystem II from oxidative stress and promoting color changes during fruit maturation. Plant Cell 17 (6): 1829–1838. Neto, M.C.L., Martins, M.D.O., Ferreira‐Silva, S.L., and Silveira, J.A.G. (2015). Jatropha curcas and Ricinus communisdisplay contrasting photosynthetic mechanisms in response to environmental conditions. Sci. Agric. 72 (3): 260–269. Nicol, J.M., Turner, S.J., Coyne, D.L. et al. (2011). Current nematode threats to world agriculture. In: Genomics and Molecular Genetics of Plant–Nematode Interactions (ed. J. Jones, G. Gheysen and C. Fenoll), 21–44. London: Springer. Noctor, G. and Mhamdi, A. (2017). Climate change, CO2, and defense: the metabolic, redox, and signaling perspectives. Trends Plant Sci. 22 (10): 857–870. Nožková, V., Mieslerová, B., Luhová, L. et al. (2019). Effect of heat‐shock pre‐treatment on tomato plants infected by powdery mildew fungus. Plant Protect. Sci. 55: 31–42. Pandey, P., Ramegowda, V., and Senthil‐Kumar, M. (2015). Shared and unique responses of plants to multiple individual stresses and stress combinations: physiological and molecular mechanisms. Front. Plant Sci. 6: 723. Post, E., Steinman, B.A., and Mann, M.E. (2018). Acceleration of phenological advance and warming with latitude over the past century. Sci. Rep. 8 (3927): 1–8. Prasad, P.V., Boote, K.J., and Allen, L.H. Jr. (2006). Adverse high temperature effects on pollen viability, seed‐set, seed yield and harvest index of grain‐sorghum [Sorghum bicolor (L.) Moench] are more severe at elevated carbon dioxide due to higher tissue temperatures. Agric. Forest Meteorol. 139 (3–4): 237–251. Prasch, C.M. and Sonnewald, U. (2013). Simultaneous application of heat, drought and virus to Arabidopsis thaliana plants reveals significant shifts in signaling networks. Plant Physiol. 162: 1849–1866. Prokopova, J., Mieslerová, B., Hlaváčková, V. et al. (2010). Changes in photosynthesis of Lycopersicon spp. plants induced by tomato powdery mildew infection in combination with heat shock pre‐treatment. Physiol. Mol. Plant Pathol. 74 (3–4): 205–213. Pugliese, M., Gullino, M.L., and Garibaldil, A. (2010). Effects of elevated CO2 and temperature on interactions of grapevine and powdery mildew: first results under phytotron conditions. J. Plant Dis. Protect. 117 (3): 9–14. Pugliese, M., Liu, J., Titone, P. et al. (2012). Effects of elevated CO₂ and temperature on interactions of zucchini and powdery mildew. Phytopathol. Mediterr. 51 (3): 480–487. Ramegowda, V. and Senthil‐Kumar, M. (2015). The interactive effects of simultaneous biotic and abiotic stresses on plants: mechanistic understanding from drought and pathogen combination. J. Plant Physiol. 176: 47–54. Rast, A., Heinz, S., and Nickelsen, J. (2015). Biogenesis of thylakoid membranes. Biochim. Biophys. Acta 1847 (9): 821–830. Reda, F. and Mandoura, H.M.H. (2011). Response of enzymes activities, photosynthetic pigments, proline to low or high temperature stressed wheat plant (Triticum aestivum L.) in the presence or absence of exogenous proline or cysteine. Int. J. Acad. Res. 3: 108–115. Reich, P.B., Hobbie, S.E., and Lee, T.D. (2014). Plant growth enhancement by elevated CO2 eliminated by joint water and nitrogen limitation. Nat. Geosci. 7 (12): 920–924. Rezaei, E.E., Webber, H., Gaiser, T. et al. (2015). Heat stress in cereals: mechanisms and modelling. Eur. J. Agron. 64: 98–113.

61

62

3  High-Temperature Stress and Photosynthesis

Romero‐Olivares, A.L., Taylor, J.W., and Treseder, K.K. (2015). Neurospora discreta as a model to assess adaptation of soil fungi to warming. BMC Evol. Biol. 15: 198. Saitoh, S., Okano, S., Nohara, H. et al. (2018). 5‐aminolevulinic acid (ALA) deficiency causes impaired glucose tolerance and insulin resistance coincident with an attenuation of mitochondrial function in aged mice. PLoS One 13 (1): e0189593. Sakuraba, Y., Bülbül, S., Piao, W. et al. (2017). Arabidopsis EARLY FLOWERING 3 increases salt tolerance by suppressing salt stress response pathways. Plant J. 92 (6): 1106–1120. Sang, Q.Q., Shu, S., Shan, X. et al. (2016). Effects of exogenous spermidine on antioxidant system of tomato seedlings exposed to high temperature stress. Russ. J. Plant Physiol. 63 (5): 645–655. Schrag, D.P. (2018). The timescales of climate change. ReVis. 18 (3): 1–84. Setimela, P.S., Andrews, D.J., Partridge, J., and Eskridge, K.M. (2005). Screening sorghum seedlings for heat tolerance using a laboratory method. Eur. J. Agron. 23 (2): 103–107. Sgobba, A., Paradiso, A., Dipierro, S. et al. (2015). Changes in antioxidants are critical in determining cell responses to short‐and long‐term heat stress. Physiol. Plant. 153 (1): 68–78. Shan, X., Zhou, H., Sang, T. et al. (2016). Effects of exogenous spermidine on carbon and nitrogen metabolism in tomato seedlings under high temperature. J. Am. Soc. Hortic. Sci. 141 (4): 381–388. Sharkey, T.D. and Schrader, S.M. (2006). High temperature stress. In: Physiology and Molecular Biology of Stress Tolerance in Plants (ed. K.V.M. Rao, A.S. Raghavendra and K.J. Reddy), 101–130. Dordrecht: Springer. Sharma, R.C., Duveiller, E., and Ortiz‐Ferrara, G. (2007). Progress and challenge towards reducing wheat spot blotch threat in the eastern Gangetic plains of South Asia: is climate change already taking its toll? Field Crop. Res. 103 (2): 109–118. Sharma, A.K., Gangwar, M., Tilak, R. et al. (2012). Comparative in vitro antimicrobial and phytochemical evaluation of methanolic extract of root, stem and leaf of Jatropha curcas Linn. Pharmacogn. J. 4 (30): 34–40. Shi, D., Kranz, S.A., Kim, J.M., and Morel, F.M. (2012). Ocean acidification slows nitrogen fixation and growth in the dominant diazotroph Trichodesmium under low‐iron conditions. Proc. Nat. Acad. Sci. U.S.A. 109 (45): E3094–E3100. Siddiqui, M.H., Alamri, S.A., Al‐Khaishany, M.Y. et al. (2016). Mitigation of adverse effects of heat stress on Vicia faba by exogenous application of magnesium. Saudi J. Biol. Sci. 25 (7): 1393–1401. Siddiqui, M.H., Alamri, S.A., Al‐Khaishany, M.Y. et al. (2017). Sodium nitroprusside and indole acetic acid improve the tolerance of tomato plants to heat stress by protecting against DNA damage. J. Plant Interact. 12 (1): 177–186. Silva, E.N., Vieira, S.A., Ribeiro, R.V. et al. (2013). Contrasting physiological responses of Jatropha curcas plants to single and combined stresses of salinity and heat. J. Plant Growth Regul. 32 (1): 159–169. Silva, E.N., Silveira, J.A.G., Ribeiro, R.V. et al. (2018). Photosynthetic and antioxidant responses of Jatropha curcas plants to heat stress: on the relative sensitivity of shoots and roots. J. Plant Growth Regul. 37 (1): 255–265. Sinsawat, V., Leipner, J., Stamp, P., and Fracheboud, Y. (2004). Effect of heat stress on the photosynthetic apparatus in maize (Zea mays L.) grown at control or high temperature. Environ. Exp. Bot. 52 (2): 123–129.

­  References

Song, Y., Chen, Q., Ci, D. et al. (2014). Effects of high temperature on photosynthesis and related gene expression in poplar. BMC Plant Biol. 14 (111): 1–20. Souza, R.P., Machado, E.C., Silva, J.A.B. et al. (2004). Photosynthetic gas exchange, chlorophyll fluorescence and some associated metabolic changes in cowpea (Vigna unguiculata) during water stress and recovery. Environ. Exp. Bot. 51 (1): 45–56. Spadoni, A., Guidarelli, M., Sanzani, S.M. et al. (2014). Influence of hot water treatment on brown rot of peach and rapid fruit response to heat stress. Postharvest Biol. Technol. 94: 66–73. Spetea, C., Rintamäki, E., and Schoefs, B. (2014). Changing the light environment: chloroplast signalling and response mechanisms. Philos. Trans. R. Soc. B Biol. Sci. 369: 20130220. Szymanska, R., Ślesak, I., Orzechowska, A., and Kruk, J. (2017). Physiological and biochemical responses to high light and temperature stress in plants. Environ. Exp. Bot. 139: 165–177. Talanova, V.V., Topchieva, L.V., and Titov, A.F. (2006). Efect of abscisic acid on the resistance of cucumber seedlings to combined exposure to high temperature and chloride. Biol. Bull. 33 (6): 619–622. Tian, J., Wang, L.P., Yang, Y.J. et al. (2012). Exogenous spermidine alleviates the oxidative damage in cucumber seedlings subjected to high temperatures. J. Am. Soc. Hortic. Sci. 137 (1): 11–19. Tikkanen, M. and Grebe, S. (2018). Switching off photoprotection of photosystem I–a novel tool for gradual PSI photoinhibition. Physiol. Plant. 162 (2): 156–161. Tiwari, A., Jajoo, A., and Bharti, S. (2008). Heat‐induced changes in photosystem I activity as measured with different electron donors in isolated spinach thylakoid membranes. Photochem. Photobiol. Sci. 7 (4): 485–491. Torres, C.A., Sepúlveda, G., and Kahlaoui, B. (2017). Phytohormone interaction modulating fruit responses to Photooxidative and heat stress on apple (Malus domestica Borkh.). Front. Plant Sci. 8: 2129. Trebicki, P., Nancarrow, N., Cole, E. et al. (2015). Virus disease in wheat predicted to increase with a changing climate. Global Change Biol. 21 (9): 3511–3519. Trierweiler, A.M., Winter, K., and Hedin, L.O. (2018). Rising CO2 accelerates phosphorus and molybdenum limitation of N 2‐fixation in young tropical trees. Plant Soil 429 (1–2): 363–373. Umena, Y., Kawakami, K., Shen, J.R., and Kamiya, N. (2011). Crystal structure of oxygen‐ evolving photosystem II at a resolution of 1.9 Å. Nature 473: 55–63. Verma, N. and Shukla, S. (2015). Impact of various factors responsible for fluctuation in plant secondary metabolites. J. Appl. Res. Med. Aromat. Plants 2 (4): 105–113. Wang, Y., Bao, Z., Zhu, Y., and Hua, J. (2009). Analysis of temperature modulation of plant defense against biotrophic microbes. Mol. Plant Microbe Interact. 22 (5): 498–506. Wang, Y., Noguchi, K., Ono, N. et al. (2014). Overexpression of plasma membrane H+‐ ATPase in guard cells promotes light‐induced stomatal opening and enhances plant growth. Proc. Nat. Acad. Sci. U.S.A. 111 (1): 533–538. Wang, X., Vignjevic, M., Liu, F. et al. (2015). Drought priming at vegetative growth stages improves tolerance to drought and heat stresses occurring during grain filling in spring wheat. Plant Growth Regul. 75 (3): 677–687. Wang, L., Zhou, H., Guo, S. et al. (2018). Exogenous spermidine maintains the chloroplast structure of cucumber seedlings and inhibits the degradation of photosynthetic protein complexes under high‐temperature stress. Acta Physiol. Plant. 40 (47): 1–15.

63

64

3  High-Temperature Stress and Photosynthesis

Xu, Z.Z. and Zhou, G.S. (2006). Combined effects of water stress and high temperature on photosynthesis, nitrogen metabolism and lipid peroxidation of a perennial grass Leymus chinensis. Planta 224 (5): 1080–1090. Yamori, W. and Shikanai, T. (2016). Physiological functions of cyclic electron transport around photosystem I in sustaining photosynthesis and plant growth. Annu. Rev. Plant Biol. 67: 81–106. Yoshida, T., Ohama, N., Nakajima, J. et al. (2011). Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock‐responsive gene expression. Mol. Gene. Genomics 286 (5–6): 321–332. Yuzbasioglu, E., Dalyan, E., and Akpinar, I. (2017). Changes in photosynthetic pigments, anthocyanin content and antioxidant enzyme activities of maize (Zea Mays L.) seedlings under high temperature stress conditions. Trak. Univ. J. Nat. Sci. 18 (2): 97–104. Zandalinas, S.I., Mittler, R., Balfagón, D. et al. (2018). Plant adaptations to the combination of drought and high temperatures. Physiol. Plant. 162 (1): 2–12. Zhang, J., Li, D.M., Gao, Y. et al. (2012). Pretreatment with 5‐aminolevulinic acid mitigates heat stress of cucumber leaves. Biol. Plant. 56 (4): 780–784. Zhang, X., Chen, L., Wang, J. et al. (2018). Photosynthetic acclimation to long‐term high temperature and soil drought stress in two spruce species (Picea crassifolia and P. wilsonii) used for afforestation. J. Forestry Res. 29 (2): 363–372. Zhao, G., Xu, H., Zhang, P. et al. (2017). Effects of 2, 4‐epibrassinolide on photosynthesis and Rubisco activase gene expression in Triticum aestivum L. seedlings under a combination of drought and heat stress. Plant Growth Regul. 81 (3): 377–384. Zhu, X.C., Song, F.B., Liu, S.Q., and Liu, T.D. (2011). Effects of arbuscular mycorrhizal fungus on photosynthesis and water status of maize under high temperature stress. Plant Soil 346 (1–2): 189–199.

65

4 Effect of Light Intensity on Photosynthesis Rinukshi Wimalasekera Department of Botany, Faculty of Applied Sciences, University of Sri Jayewardenepura, Gangodawila, Sri Lanka

4.1 ­Introduction In plants, the conversion of light energy into chemical energy happens in the process of photosynthesis. In photosynthesis, higher plants use solar energy to reduce carbon dioxide, producing carbohydrates, and to oxidize water, releasing oxygen. Light is essential for three important phases of photosynthesis, namely, light harvested from sunlight, reduces nicotinamide adenine dinucleotide phosphate (NADP) and produces adenosine triphosphate (ATP), and converts CO2 into carbohydrates (Mirkovic et  al. 2017). The protein complexes photosystem I (PSI) and photosystem II (PSII) in higher plants are composed of the pigments necessary to harvest photons from specific wavelengths of light to catalyze photosynthetic reactions. Light reactions where energy transduction happens and dark reactions where carbon fixation happens are the two main types of reactions. Photosynthesis of higher plants and green algae are regulated by light‐harvesting functions in response to different light qualities (Ueno et al. 2018). Photosynthetically active radiation (PAR) ranging from 400 to 700 nm represents the critical energy for photosynthesis in plants. Although PSI and PSII use the same pigments, their absorption spectra differ. PS1 preferentially absorbs wavelengths longer than 680 nm in the far‐red light region and PSII strongly absorbs 475–680 nm with an affinity for red light of 680 nm (Taiz and Zeiger 2002; Blankenship 2014). Light intensity or light quantity is the total amount of light that plants receive and it is an important factor determining the rate of photosynthesis (Chapman and Carter 1976; Taiz and Zeiger 2002). At low light intensities, above the light compensation point (LCP), photosynthetic rate increases proportionally to the light intensity and reaches a maximum. However, as light intensity is increased further, chlorophyll can get damaged and as a result the rate of photosynthesis decreases. Plant productivity is strongly dependent on the photosynthetic rate. At a given time, photosynthetic rate is determined by the limiting factors of light or CO2 concentration. Rubisco and ribulose 1,5‐bisphosphate (RuBp) activities are major metabolic steps that are important for optimal photosynthetic performance. At high light conditions rubisco Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

66

4  Effect of Light Intensity on Photosynthesis

activity is limited and at low light conditions RuBp regeneration is limited. Maintaining photosynthetic efficiency under changing light conditions requires modification of light‐harvesting and energy‐transfer processes. Leaves are capable of adapting to high or low light conditions depending on the growth environment of plants. Anatomical features of leaves and the arrangement of chloroplasts regulate the quantity of light absorption thereby preventing damage to the photosynthetic system by absorption of excessive light. In a similar way, leaf anatomical and biochemical features help in optimizing light capture when exposed to shade conditions. Plasticity in morphology and biochemical responses are important in maximizing photosynthetic efficiency (Taiz and Zeiger 2002; Valladares et al. 2005). Several signaling pathways and underlying regulatory genes responsible for photosynthetic light reactions have been identified in many plant species.

4.2 ­Characteristics of Light Light has both particle and wave characteristics. A light particle is known as a photon and the energy it contains is called a quantum. Light intensity or light quantity is the rate at which light spreads over a given surface area. Light intensity is also referred to as the energy transferred per unit area (Taiz and Zeiger 2002; Blankenship 2014). Essential parameters in measuring light are spectral quality, quantity, and direction (Taiz and Zeiger 2002; Both et al. 2015). The quantity of energy that falls on a sensory plane such as a flat leaf of a known area per unit time is quantified as irradiance in Wm−2. Photon irradiance in mol m−2 s−1 is the light that is measured as incident quanta. The direction of light is also an important factor in photosynthesis. Light strikes directly on a flat surface from above or obliquely (Schirillo 2013). The omnidirectional measurement is called the fluence rate (Rupert and Latarjet 1978). Light interception to shoots, whole plants, and chloroplasts is mostly not direct. Light can also come from many directions simultaneously (Schirillo 2013). 4.2.1  Photosynthetically Active Radiation (PAR) The total radiant energy from the sun is called the total solar irradiance. Only about 5% of energy reaching the earth can be converted into carbohydrates by photosynthesis because the wavelengths of the major fractions of the incident light cannot be absorbed by the photosynthetic pigments. The radiant energy of the sun is comprised of a range of wavelengths. PAR represents the fraction of sunlight from 400 to 700 nm and is the crucial source of energy for plants (Taiz and Zeiger 2002; Blankenship 2014). Depending on the time of the day and latitude PAR fluctuates and also seasonal variations of PAR can be observed. The availability of PAR for photosynthesis is affected by cloud cover, shading by trees, buildings, and air pollution (Rahman et  al. 2017). PAR values span from 0 to 3000 μmol m−2 s−1 and usually PAR irradiance and PAR fluence rates are about 2000 μmol m−2 s−1. Net primary productivity or biomass production shows a linear relationship with intercepted PAR. Radiation use efficiency (RUE) is dependent on the low availability of water, nutrient deficiency, or any adverse stress conditions that negatively affect metabolic activities (Hammer and Wright 1994; Ruimy et  al. 1995). PAR intensity

4.3  Light Absorption and Pigments

requirements for different species at given growth condition differ. Ubiernai et  al. (2013) reported that Zea mays, Miscanthus x giganteus and Flaveria bidentis show varied C4 photosynthesis under a series of different PARs. Too high or too low PAR intensity causes photoinhibition and disrupts the photosynthetic machinery in Thalassia testudinum seedlings in response to changes in light (Howarth and Durako 2013). PAR changes constantly within a day. Plants have developed mechanisms to maintain a balance between converting radiation energy thereby protecting the photosynthetic apparatus from photoinhibition and repairing possible damage (Bertamini and Nedunchezhian 2003).

4.3 ­Light Absorption and Pigments Chlorophylls are the main light absorbing pigments present in the chloroplasts of photosynthesizing plants. The thylakoid reactions of photosynthesis begin with the absorption of light, electron transport reactions then occur that lead to the reduction of NADP+ to NADPH and production of ATP takes place in the internal membranes of thylakoids in chloroplasts and carbon fixation takes place in the stroma (Lodish et al. 2000; Taiz and Zeiger 2002). Chlorophylls a and b are the most abundant photosynthetic pigments that absorb light and drive the power for photosynthesis. Carotenoids which are integral constituents of the thylakoid membranes act as accessory pigments to absorb light and transfer to chlorophylls for photosynthesis. Pigments act as complexes of antenna that absorb light and transfer energy to the reaction center complex. Light harvesting complexes (LHCs) contain a high concentration of chlorophyll a and depending on the species, chlorophyll b and other pigments (Nicholls and Ferguson 2013). In higher plants PSI and PSII consist of pigments necessary to harvest photons from specific wavelengths of light. A decrease in PSII results in a substantial decrease in photosynthesis (Demmig‐Adams and Adams 1992). If excess light is not dissipated, over reduction of reaction centers takes place by damaging the PSII. Studies with mutants disrupted in regulatory functions of thylakoid reactions of photosynthesis provide important information on the regulatory genes and signaling pathways. 4.3.1  Dissipation of Excess Light Energy Plants have developed some photoprotective mechanisms to dissipate excess light and thereby to avoid photodamage to PSII (Demmig‐Adams and Adams 1992; Qiu et  al. 2003). Quenching of chlorophyll fluorescence, which transfers excessively absorbed light energy away from electron transport toward heat production, is one such mechanism of dissipating surplus energy. When exposed to excess light, leaves dissipate the surplus absorbed light energy in order to protect the photosynthetic apparatus from damage. Dissipated light energy is based on irradiance, species, growth conditions, nutrition conditions, and temperature (Qiu et al. 2003; Zhou et al. 2007). It has been shown that in rice, high light stress limits the metabolic processes of photosynthesis (Zhou et al. 2007). Photoinactivation of PSII complexes and photoprotection was observed in Capsicum annuum L. leaves when exposed to 500 μmol photons m−2 s−1 (high light) (Lee et al. 2001). The xanthophyll cycle plays an important role in protecting plants from excess light energy (Lodish et  al. 2000; Taiz and Zeiger 2002). High light

67

68

4  Effect of Light Intensity on Photosynthesis

intensity receiving leaves contain higher levels of xanthophyll than shade leaves. The xanthophyll cycle is also active in low light receiving plants in the forest understory which usually experience sun flecks. Xanthophylls are useful in photoprotection of PSII (Jahns and Holzwarth 2012). Regulation of the xanthophyll cycle is also helpful in protecting against damage caused by high leaf temperatures that often results from high light levels. 4.3.2 Photoinhibition Photoinhibition is the light‐induced decrease of photosynthetic activity that occurs when leaves receive more light than they can utilize. When exposed to high light levels, the reaction center of PSII is inactivated and damaged (Keren and Krieger‐Liszkay 2011). Dynamic photoinhibition can be observed under moderately excess light especially during midday when leaves are exposed to maximum light. Photoinhibition is triggered by the diversion of absorbed energy toward heat dissipation. Photoinhibition is reversed when photon flux levels reduce below the saturation levels. Prolonged photoinhibition results from exposure to excess light that damages the photosynthetic system and lowers both quantum efficiency and photosynthetic rate (Aro et al. 1993). The reaction center of PSII gets severely damaged and the damage persists for longer periods of time, severely affecting photosynthesis. Photoinhibition could be observed in peas acclimated to a series of high 11 irradiance levels (Aro et al. 1993). A short‐term decrease in quantum efficiency can be considered as a protective measure for the photosynthetic apparatus. Several studies show protective mechanisms in response to high light intensities. It has been found that excessive light energy absorbed by lichen soil crusts is dissipated by increasing non‐photochemical quenching, providing some protection for lichen soil crusts (Wu et al. 2017).

4.4 ­Light Absorption by Leaves Leaves are specialized organs for light utilization and carbon fixation. Photosynthesis greatly depends upon the absorption of light by pigments, especially chlorophyll a in the plant leaves. Chlorophyll absorbs blue and red regions of the spectrum and about 85–90% of PAR is absorbed by the leaf surface and the remainder is reflected or transmitted (Taiz and Zeiger 2002; Blankenship 2014). Because of high light absorption by chlorophyll in the upper region of the leaf, a light gradient is created from the leaf surface into the tissue inducing different light regimes. Under strong light intensities, the chloroplasts at the surface of the leaf are saturated and most of the light cannot be used for photosynthesis, but the chloroplasts in the lower surface of the leaf might be light deprived. Quantification of light absorption by isolated chloroplasts and leaves show considerable differences due to light scattering and “packing” effects (Merzlyak et al. 2009). 4.4.1  Light Absorption and the Anatomy, Morphology, and Biochemical Characteristics of Leaves Leaves show highly specialized anatomical features for light absorption. The importance of leaf anatomy for photosynthesis is reflected by the differential anatomical ­features exhibited by leaves that develop under different light conditions (Vogelmann et al. 1996; Xiao et al. 2016).

4.4  Light Absorption by Leaves

The epidermal cells are transparent to light and can focus the light to chloroplasts because of the convex nature of epidermal cells. The amount of light that is finally received by the chloroplasts can be several times higher than the amount of ambient light (Vogelmann et al. 1996). The distribution pattern of chlorophylls creating gaps in the chloroplasts leads to differential absorption of light and this phenomenon is known as the sieve effect. Light penetrates the palisade cells because of the sieve effect and light channeling. A fraction of incident light is propagated through the central vacuole of the palisade and air spaces between the cells. Transmission of light into the leaf interior occurs by facilitating light channeling (Atrashevskii et  al. 1999). The multiple reflections of light that occur between cell–air interfaces greatly enhance the length of the path of photon travel. This phenomenon of light scattering is important in increasing the probability of light absorption and thereby enhancing photosynthesis. Light scattering occurs to a greater extent when light penetrates through the air space surrounding spongy mesophyll cells (Vogelmann et al. 1996; Pierantoni et al. 2017). In a study with 24 plant species, chloroplast movement is reported to be influenced by anatomy and optical properties of leaves (Davis et al. 2011). There are some anatomical differences in shade exposed and sun exposed plants. Sun grown leaves show characteristic features like specialization of upper surface of leaves e.g. longer palisade cells (Davis et al. 2011). 4.4.2  Light‐Mediated Leaf Movement Leaves are capable of regulating the incident light they absorb by chloroplast and leaf movement. Under low light conditions, photosynthetic rate is increased by gathering chloroplasts at the cell surface parallel to the plane of the leaf to maximize the absorption of light. Under high light, excess absorption of light is avoided by moving chloroplasts to the cell surface parallel to incident light (Taiz and Zeiger 2002; Davis et al. 2011). Leaves are able to move diurnally and absorb light, orienting leaf blades (lamina) perpendicular or parallel to the sun rays (Ehleringer and Forseth 1980; Koller 1990, 2000; Vandenbrink et al. 2014). This phenomenon of solar tracking occurs widely in the photosynthetic pathway of C3 and C4 plants in many families. Sun‐induced leaf movement is often described as heliotropism and sun‐avoidant leaf movement as paraheliotropism. Leaves that maximize light interception by solar tracking are called diaheliotropic leaves. Leaves orientate perpendicular to direct sun rays for tracking, absorbing maximum light throughout the day thereby increasing photosynthetic rates. Some solar‐ tracking plants avoid direct exposure to sunlight. Leaves that are oriented parallel to the direct sun rays show reduced leaf temperatures and decreased water loss through transpiration (Ehleringer and Forseth 1980; Koller 1990, 2000). Solar tracking of leaves significantly contributes to improving photosynthesis, which especially beneficial for plants that grow in arid regions. Recent studies provide evidence for the function of the circadian clock in modulating heliotropic movement during the day and reorientation of movement during the night (Harmer 2009; Kutschera and Briggs 2016). 4.4.3  Light Absorption by Sun and Shade Adapted Leaves Some of the plants have a great ability to adapt to light regimes of their habitats. Leaves that are adapted to low light intensity environments are unable to grow in high light. In shade species, light absorption is greatly dependent on chloroplast movement and more

69

70

4  Effect of Light Intensity on Photosynthesis

than 10% of absorptance changes are observed between high‐ and low‐light treatments (Davis et al. 2011). Besides the differences of anatomical characteristics of shade and sun adapted leaves, shade leaves have more total chlorophyll and the ratio of chlorophyll b to chlorophyll a is high. Sun adapted leaves have more rubisco and xanthophyll cycle components. Light harvesting mechanisms are different in shade and sun plants. Some of the shade plants exhibit a 3 : 1 ratio of PSII to PSI reaction centers while the ratio is 2 : 1 in sun plants (Anderson 1986). Some shade plants add more chlorophyll to PSII. All these adaptations are for the enhancement of light absorption.

4.5 ­Light and Photosynthetic Responses The relationship between photosynthetic CO2 assimilation and photon fluxes provide useful information on photosynthetic properties. CO2 uptake exactly balances the CO2 released at a certain point and it is called the LCP. The LCP varies with species, growth, and developmental conditions of plants. Plants grown in full sunlight and those grown in the shade show a significant difference in LCP, determining a plant’s tolerance to low light levels (Walters and Reich 1999). Shade plants, with lower LCPs, survive in light‐ limited environments (Taiz and Zeiger 2002; Craine and Reich 2005). Above the LCP, photosynthetic rate increases proportionally to photon flux and reaches the maximum quantum yield. In intact leaves, measured quantum yields for CO2 fixation is estimated to be in the range of 0.04 and 0.06 (Taiz and Zeiger 2002). Quantum yield also varies with parameters such as temperature and CO2 concentration. Below 30 °C, quantum yields are generally higher in C3 plants than those of C4 plants and above 30 °C the quantum yield of C4 plants are higher. The level of light saturation is lower in shade plants than those of sun plants. At higher photon fluxes the photosynthetic rate saturates, indicating that other factors such as electron transport and rubisco activity can limit photosynthesis. Leaves are unable to utilize full sunlight. At a given time, only a small fraction of leaves are exposed to full sunlight. Crop yield is highly dependent on the amount of light received during the growth season when other factors are not limiting.

4.6 ­Conclusion and Future Prospects In higher plants photosynthetic reactions are regulated by the photons harvested from specific wavelengths of light by the photosystems that are composed of chlorophylls. The PAR intensity requirement for different species at a given growth condition differs and leaves are capable of regulating the incident light they absorb. Too high or too low PAR intensity causes photoinhibition and disrupts the photosynthetic machinery. Photoprotective reactions dominate the regulation of highly dynamic photosynthetic processes in response to a fluctuating light environment. Recent genetics, molecular, physiological, biochemical, and functional genomics studies have revealed a variety of genes and signaling molecules that are implicated in light‐mediated regulation of photosynthesis. The majority of plants including important crop species growing in a wide geographic range deal successfully with the excessive light they receive by avoiding photodamage, often with a trade‐off between photosynthetic

­  References

efficiency and photoprotection. It is not well understood how agricultural crops maximize crop productivity under high light intensities sensitizing the environment. Understanding the genetic variations present in certain crop varieties to maintain high photosynthetic efficiency at high light intensities can be manipulated to improve photosynthetic productivity. Some plant varieties grown under shade conditions are well adapted to maximize their photosynthetic efficiency under low light interception. The molecular mechanisms that operate in these plants can be further studied and applied to improve the photosynthetic efficiency of plants growing especially under canopy cover and at high latitudes, ultimately increasing biomass production.

­References Anderson, J.M. (1986). Photoregulation of the composition, function and structure of thylakoid membranes. Annu. Rev. Plant Physiol. 37: 93–136. Aro, E.‐M., McCaffery, S., and Anderson, J.M. (1993). Photoinhibition and D1 protein degradation in Peas acclimated to different growth irradiances. Plant Physiol. 103: 835–843. Atrashevskii, Y.I., Sikorskii, A.V., Sikorskii, V.V., and Stel’makh, G.F. (1999). The reflection and scattering of light by a plant leaf. J. Appl. Spectrosc. 66: 105–114. Bertamini, M.M. and Nedunchezhian, N. (2003). Photosynthetic functioning of individual grapevine leaves (Vitisvinifera L. cv. Pinot noir) during ontogeny in the field. Vitis 42: 13–17. Blankenship, R.E. (2014). Molecular Mechanisms of Photosynthesis. Wiley Blackwell. Both, A.J., Benjamin, L., Franklin, J. et al. (2015). Guidelines for measuring and reporting environmental parameters for experiments in greenhouses. Plant Methods 11: 43. Chapman, S.R. and Carter, L.P. (1976). Crop Production: Principles and Practices, 146–163. San Francisco: W.H. Freeman and Company. Craine, J.M. and Reich, P.B. (2005). Leaf‐level light compensation points in shade‐tolerant woody seedlings. New Phytol. 166: 710–713. Davis, P.A., Caylor, S., Whippo, C.W., and Hangarter, R.P. (2011). Changes in leaf optical properties associated with light‐dependent chloroplast movements. Plant Cell Environ. 34: 2047–2059. Demmig‐Adams, B. and Adams, W.W. (1992). Photoprotection and other responses of plants to high light stress. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43: 599–626. Ehleringer, J. and Forseth, I. (1980). Solar tracking by plants. Science 210: 1094–1098. Hammer, G.L. and Wright, G.C. (1994). A theoretical analysis of nitrogen and radiation effects on radiation use efficiency in peanut. Aust. J. Agric. Res. 45: 575–589. Harmer, S.L. (2009). The circadian system in higher plants. Annu. Rev. Plant Biol. 60: 357–377. Howarth, J.F. and Durako, M.J. (2013). Variation in pigment content of Thalssiatestudinum seedlings in response to changes in salinity and light. Bot. Mar. 56: 261–273. Jahns, P. and Holzwarth, A.R. (2012). The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II. Biochim. Biophys. Acta 1817: 182–193. Keren, N. and Krieger‐Liszkay, A. (2011). Photoinhibition: molecular mechanisms and physiological significance. Physiol. Plant. 142: 1–5. Koller, D. (1990). Light‐driven leaf movements. Plant Cell Environ. 13: 615–632. Koller, D. (2000). Plants in Search of Sunlight. Elsevier.

71

72

4  Effect of Light Intensity on Photosynthesis

Kutschera, U. and Briggs, W.R. (2016). Phototropic solar tracking in sunflower plants: an integrative perspective. Ann. Bot. 117: 1–8. Lee, H.‐Y., Hong, Y.N., and Chow, W.S. (2001). Photoinactivation of photosystem II complexes and photoprotection by non‐functional neighbours in Capsicum annuum L. leaves. Planta 212: 332–342. Lodish, H., Berk, A., Zipursky, L.S. et al. (2000). Molecular Cell Biology, 4e. New York: W. H. Freeman. Merzlyak, M.N., Chivkunova, O.B., Zhigalova, T.V., and Naqvi, K.R. (2009). Light absorption by isolated chloroplasts and leaves: effects of scattering and ‘packing’. Photsynth. Res. 102: 31–41. Mirkovic, T., Ostroumov, E.E., Anna, J.M. et al. (2017). Light absorption and energy transfer in the antenna complexes of photosynthetic organisms. Chem. Rev. 117: 249–293. Nicholls, D.G. and Ferguson, S.J. (2013). Photosynthetic Generators of Protonmotive Force in Bioenergetics, 4e. Academic Press. Pierantoni, R., Tenne, R., Brumfeld, V. et al. (2017). Plants and light manipulation: the integrated mineral system in okra leaves. Adv. Sci. (Weinh) 4: 1600416. Qiu, N., Lu, Q., and Lu, C. (2003). Photosynthesis, photosystem II efficiency and the xanthophyll cycle in the salt‐adapted halophyte atriplexcentralasiatica. New Phytol. https://doi.org/10.1046/j.1469‐8137.2003.00825.x. Rahman, M.A., Moser, A., Rotzer, T., and Pauleit, S. (2017). Within canopy temperature differences and cooling ability of Tiliacordata trees grown in urban conditions. Build. Environ. 114: 118–128. Ruimy, A., Jarvis, P.G., Baldocchi, D.D., and Saugier, B. (1995). CO2 fluxes over plant canopies and solar radiation: a review. Adv. Ecol. Res. 26: 1–68. Rupert, C.S. and Latarjet, R. (1978). Toward a nomenclature and dosimetric scheme applicable to all radiations. Photochem. Photobiol. 28: 3–5. Schirillo, J.A. (2013). We infer light in space. Psychon. Bull. Rev. 20: 905–915. Taiz, L. and Zeiger, E. (2002). Plant Physiology, 3e. Sunderland: Sinauer Associates, Inc., Publishers. Ubiernai, N., Sun, W., Kramer, D.M., and Cousins, A.B. (2013). The efficiency of C4 photosynthesis under low light conditions in Zea mays, Miscanthus x giganteus and Flaveriabidentis. Plant Cell Environ. 36: 365–381. Ueno, Y., Aikawa, S., Kondo, A., and Akimoto, S. (2018). Adaptation of light‐harvesting functions of unicellular green algae to different light qualities. Photsynth. Res. https:// doi.org/10.1007/s11120‐018‐0523‐y. Valladares, F., Arrieta, S., Aranda, I. et al. (2005). Shade tolerance, photoinhibition sensitivity and phenotypic plasticity of Ilex aquifolium in continental Mediterranean sites. Tree Physiol. 25: 1041–1052. Vandenbrink, J.P., Brown, E.A., Harmer, S.L., and Blackman, B.K. (2014). Turning heads: the biology of solar tracking in sunflower. Plant Sci. 224: 20–26. Vogelmann, T.C., Bornman, J.F., and Yates, D.J. (1996). Focusing of light by leaf epidermal cells. Physiol. Plant. 98: 43–45. Walters, M.B. and Reich, P.B. (1999). Low‐light carbon balance and shade tolerance in the seedlings of woody plants: do winter deciduous and broad‐leaved evergreen species differ? New Phytol. 143: 143–154.

­  References

Wu, L., Lei, Y., Lan, S., and Hu, C. (2017). Photosynthetic recovery and acclimation to excess light intensity in the rehydrated lichen soil crusts. (ed. R. Balestrini). PLoS One 12 (3): e0172537. Xiao, Y., Tholen, D., and Zhu, X.‐G. (2016). The influence of leaf anatomy on the internal light environment and photosynthetic electron transport rate: exploration with a new leaf ray tracing model. J. Exp. Bot. 67: 6021–6035. Zhou, Y., Lam, H.M., and Zhang, J. (2007). Inhibition of photosynthesis and energy dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58: 1207–1217.

73

75

5 Regulation of Water Status, Chlorophyll Content, Sugar, and Photosynthesis in Maize Under Salinity by Mineral Mobilizing Bacteria Yachana Jha Department of Biotechnology, Genetics and Bioinformatics, N. V. Patel College of Pure and Applied Sciences, S. P. University, V. V. Nagar, Anand, Gujarat, India

5.1 ­Introduction Crop productivity and reduced biomass under the influence of an environmental factor is known as stress. Crop production gets severely limited under saline soil/water conditions, especially in arid and semi‐arid regions. It is one of the most common factors affecting crop productivity. Nowadays, the entire world focus is on the adverse effects of salt stress on the various physiological systems of plants (Negrão et al. 2017). The osmotic potential of soil is significantly decreased under saline conditions and this results in reduced accessibility of water, also affecting the translocation of water and nutrients in the plant. The accumulated salt ions cause both osmotic and water stress in plants and have a lethal effect on plants. Water stress results in reduced leaf turgor and also causes stomata closure, and ultimately reduced stomatal conductance, so all these factors finally hamper the process of photosynthesis (Chaves et al. 2009). For a green plant, photosynthesis is one the most important metabolic processes, which is affected during all its phases by water stress. There are various components in the metabolic pathway of photosynthesis, like photosystems, the photosynthetic pigments, the electron transport system, and CO2 reduction pathway, as stated by Ashraf and Harris (2013). Therefore, any alteration at any stage of photosynthesis may result in reduced photosynthetic competence in green plants. The threat of global climate change is causing concern in agriculture and the climatic factors essential for crop development will be severely affected, reducing the production and quality of crops, such as maize. Maize is an important cereal for human food and animal feed, and reduced production would affect mainly small farmers and the agroindustries that use maize. In crop like maize under stress, induction of photosynthesis is the only way to enhance production and to date farmers are dependent mostly on agrochemicals to increase crop production. But studies have reported that such chemicals present a potential risk to all life forms and unwanted side effects to the environment. So, to reduce such risk, people are focusing on environmentally safe options and microorganisms like Bacillus, Burkholderia, Rhizobium, Pseudomonas, Pantoea, etc. as they are a group of bacteria having beneficial Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

76

5  Regulation of Photosynthesis Under Salinity

effects in increasing a crop’s ability against stress like heat stress, salinity, chilling injury, and drought in wheat, sunflower, groundnut, maize, and chickpea under lab conditions. Mineral mobilizing bacteria (MMB) are none symbiotic soil bacteria that help plants to survive under stress directly or indirectly by enhancing photosynthesis (Stefan et  al. 2013). Maize plants inoculated with MMB have an enhanced rate of photosynthesis under salinity stress and it is correlated with changes in plant physiology such as an increase in chlorophyll content, relative water content (RWC), and stomatal conductance, to help the plant to survive under adverse conditions of salinity. In this sense, MMB may be a suitable option to improve plant health, development, photosynthesis, and yield without polluting the ecosystem.

5.2 ­Mineral Mobilizing Bacteria Traditional agriculture practices with heavy use of chemical fertilizers and pesticides is significantly able to fulfill the food requirement of the increasing population (Aktar et al. 2009). Plants totally remain dependent on the soil nutrients derived by the root or air by photosynthesis and supplemented with chemical fertilizers to fulfill the requirement. Plants require various essential elements for their growth and development. Each element has its own function, character, and requirement in plant development. With growth of the plant, the nutritional requirements of the plant also increase, at the same time an excess of nutrients has a damaging effect on plants by inhibiting growth and yield. New innovative agricultural technologies used nowadays are accompanied by the increasing use of chemical fertilizers to enhance crop production. But such random use of chemical fertilizers is polluting our environment, eroding soil quality, and contaminating the food product and ground water recourses, and consequently causing health hazards. So recently for sustainable development and to ensure biosafety, researches are more focused toward the production of “nutrient rich high quality food.” The novel view to ensure biosafety is to use bio‐based organic fertilizers, which are in demand as an exclusive substitute to such harmful agrochemicals (Raja 2013). Organic farming not only ensures food safety, but also enriches the biodiversity of the soil and is mainly dependent on the natural microorganism of the soil to enhance food production in a natural way. Such groups of natural microflora constitute all kinds of beneficial bacteria called MMB. Mineral mobilizing microorganisms are the soil microbial population that has a significant role in maintaining the nutrient cycle in the soil to facilitate the availability of minerals like phosphorus, iron, and potassium to the plants. MMB have massive potential in solubilizing the fixed minerals or very slowly releasing soil minerals for the development of plants. The mechanism of mineral solubilization by microorganisms depends on the type of mineral, size of ores, amount of mineral in ores, and environmental factors, which finally decide the nutritional status of soil. However, the stability of such nutrient mobilizing microorganisms after application in soil decides the solubilization of minerals to assist crop growth. Soil nutrient status has been maintained with all kinds of micro and macronutrients by MMB complemented with plant growth regulators and biodegradation of organic matter in the soil (Sinha et al. 2014). The plant only takes 10% to 40% of the applied total fertilizer and the rest, 60% to 90% of the applied fertilizer, is lost. So the application of MMB like beneficial bacteria has a

5.3  Isolation and Identification

significant role in integrated nutrient management to improve crop productivity as well as to maintain a healthy environment.

5.3 ­Isolation and Identification of Mineral Mobilizing Bacteria During evolution, plants have developed symbiotic relationships with microbes as an adaptive mechanism against adverse environments (Zilber‐Rosenberg and Rosenberg 2008). This has resulted in a complex host system, comprising diverse microhabitats with a vast diversity of endophytic and rhizospheric microorganisms in the plant root. Such colonized bacteria play a significant role in the absorption of nutrients from the soil and also provide protection against biotic and abiotic stress for the survival of the plant. The soil around the plant’s roots are in close contact with each other is a highly dynamic environment having multiple interactions with beneficial and pathogenic microorganisms, or root systems of other plants. Among these, some bacteria have the ability to solubilize minerals to acquire soil nutrients, produce plant growth regulators, or produce antibiotics. Accordingly, plant growth is favored by such interactions directly or indirectly by the action of such microorganisms, which make them an imperative biological tool for agronomic interest and environmental safety (Jha and Subramanian 2014). MMB from genera such as Pseudomonas and Bacillus are non‐symbiotic bacteria that remain in non‐leguminous plants and are famous for their ability to promote growth under stress. The bacteria have been isolated from the rhizosphere and root of Suaeda nudiflora, wild mosque plant, in a previously published method. These bacteria are identified by molecular analysis using total genomic DNA of the isolates. The isolated DNA has been amplified with 16S rDNA specific primers F: 5′AGAGTTTGATCCTGGCTCAG3′ and R: 5′AGGTTACCTTGTTACGACTT3′ and then sequenced as per our published method (Jha and Subramanian, 2013). Polymerase chain reaction (PCR) amplicons of about 1500 bp are obtained on agarose gel as discrete bands and used for the construction of phylogenetic trees using BLAST software. The phylogenetic analysis and nucleotides homology showed that the isolated bacteria from the root are Pseudomonas aeruginosa (GenBank Accession Number: JQ790515) and from the soil are Bacillus megaterium (GeneBank Accession Number: JQ790514) they are non‐symbiotic bacteria. Maize cultivar Pioneer 30 V92 seeds were used to analyze the effect of isolates as per our published method. The thoroughly washed seeds were soaked by placing them in sterilized distilled water for five to six hours and transferred on tryptone glucose yeast extract agar medium to check the possible contamination after incubating it in the dark at 30 °C. The effect on the selected biochemical parameters of the isolated bacteria was analyzed by transferring the seedlings into culture tubes with 400 ml Hoagland’s nutrient medium, 400 ml micronutrients and 1% agar. The culture tubes were co‐inoculated with selected bacteria by adding bacteria at a concentration of 6 x 108 cfu ml−1 per tube and then placed in a growth chamber at 27 ° C in a 12 hour light–dark cycle. The confirmation of MMB association with the root was carried out by TTC staining (2,3,5‐triphenyl tetrazolium chloride).

77

5  Regulation of Photosynthesis Under Salinity

5.4 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Maize Under Salinity A multitude of biochemical, physiological, and molecular processes will regulate plant growth, but the key phenomenon which has a significant role in plant growth and development is photosynthesis. The sunlight with carbon dioxide and water are converted into glucose and chemical energy by photosynthesis. The chemical energy produced by photosynthesis is expended by various metabolic processes. In all green plants occurring in oceans or on land, photosynthesis is the main process (Pan et  al. 2012). Environmental stresses, like drought, salinity, and harsh temperatures, significantly impeded the process of photosynthesis by altering the concentration of photosynthetic pigments, metabolites including enzymes, and the ultrastructure of the organelles, as well as stomatal conductance. During light reactions, the light energy is converted into adenosine triphosphate (ATP) and nicotinamide adenine dinucleotide phosphate (NADPH) and oxygen is released, and during dark reactions, the CO2 is assimilated into carbohydrates using the products of the light reactions, ATP and NADPH, in the process of photosynthesis (Figure 5.1), (Dulai et al. 2011). The photosynthetic response to environmental stress is extremely multifaceted where there is coordinated interplay taking place at different sites of the cell at different times in a plant in relation to plant development. The chloroplast is the main site for both light and dark reactions of photosynthesis for the sugar and chemical energy. The interplay of intracellular organelles sugar exchange is responsible for diverse growth and development related processes of green plants. The stress‐induced stomatal or non‐­stomatal limitations reduce the photosynthetic rate under stress conditions (Rahnama et al. 2010).

(6O2)

H n io

op

Water (6H2O)

en

lor

W

at

er

=

H

yd

ro g

Ph Ch

ly oto

Energy

+

hy

ll

Ph

ot

yd

ro

on

xy

pa

li

rti

on

cl es

Sun

sis

78

Glucose (C6H12O6) Light reaction

Water

Carbon dioxide (6CO2)

Figure 5.1  Light and dark reactions of photosynthesis.

Reaction without light

5.5  Regulating Chlorophyll Content

Table 5.1  Effect of MMB on root length, shoot length, total dry weight, and photosynthesis rate of maize under salinity (n = 5).

Treatment

Root length (cm)

Shoot length (cm)

Dry weight (g plant−1)

Photosynthesis μmol m−2 s−1

2.33 2.58 2.67 2.79

23 26 25 28

1.53 1.76 1.81 2.02

19 21 22 24

Normal Control Control + B. megaterium Control + P. aeruginosa Control + B. megaterium +  P. aeruginosa

0.182 0.201 0.234 0.243

46.3 48.1 49.9 50.2 Stressed

Control Control + B. megaterium Control + P. aeruginosa Control + B. megaterium +  P. aeruginosa

0.164 0.181 0.199 0.203

42.2 43.3 44.1 44.9

The effect of salinity and MMB on root length shoot length, total dry weight, and photosynthetic rate of the inoculated and non‐inoculated plant under salinity is determined by an open‐system portable photosynthesis meter (Li‐Cor 6400). The results show that the growth of maize is adversely affected by salinity, irrespective of biological treatment with MMB. The reduction in growth response is due to the modification of several physiological activities including photosynthesis under stress (Table 5.1). However, the extent of growth reduction is less in the plants inoculated with MMB, as the MMB help the inoculated plants to have a higher photosynthesis rate as shown in (Table 5.1). In the present study growth response and photosynthetic rate were also significantly higher in plants inoculated with B. megaterium and P. aeruginosa in non‐saline conditions and also under salinity compared to non‐inoculated control plants. Such isolates help the plants in water retention and absorption; the findings are accordance with Han and Lee (2005). However, a mixture of both isolates is more effective only up to moderate salinity levels, at higher salinity none of the above treatments are helpful to the plants to overcome the damaging effects of salinity.

5.5 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Chlorophyll Content Chlorophyll pigments of green plants absorb light energy for the plant and is dynamic for photosynthesis. The photosystems are embedded in the thylakoid membranes of chloroplasts and remain surrounded by chlorophyll pigments. Fresh leaves (0.5 g) are used for chlorophyll extraction by placing them in 80% acetone on a shaker until they become completely bleached. The supernatant of the extract is used to measure chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoid at 663, 645, and 470 nm absorbance,

79

80

5  Regulation of Photosynthesis Under Salinity

Table 5.2  Effect of MMB on the total chlorophyll content, chlorophyll a, chlorophyll b, and carotenoid content of maize under salinity (n = 5).

Treatment

Total chlorophyll content (g kg−1)

Chl a (g kg−1)

Chl b (g kg−1)

Carotenoid (mg kg−1)

0.63 0.94 0.79 0.82

0.71 0.84 0.92 1.12

1.91 2.04 2.38 2.42

0.24 0.26 0.22 0.27

0.47 0.63 0.78 0.83

1.02 1.13 1.36 1.45

Normal Control Control + B. megaterium Control + P. aeruginosa Control + B. megaterium +  P. aeruginosa

1.92 2.11 2.54 2.63 Stressed

Control Control + B. megaterium Control + P. aeruginosa Control + B. megaterium +  P. aeruginosa

1.03 1.27 1.49 1.57

respectively, using a spectrophotometer. In the present study, chlorophyll content under the non‐saline state increased, but under salinity it decreased both in inoculated as well as non‐inoculated plants. Under salinity it was less in plants inoculated with both P. aeruginosa and B. megaterium compared to the control plants (non‐saline and non‐ inoculated), while in non‐inoculated plants under salinity it decreased more. These isolates may influence better root development, which enhances water absorption and retention, findings are in accordance with Han and Lee (2005). The salinity remarkably reduced chlorophyll a, chlorophyll b, and carotenoids of the plant irrespective of the bacterial treatments (Table 5.2). The concentration of photosynthetic pigments is higher in MMB inoculated plants compared to control plants. A decrease of chlorophyll content in non‐inoculated plants under salinity has been considered to be a typical symptom of oxidative stress and may be the result of pigment photooxidation, chlorophyll degradation, or lack of chlorophyll synthesis. Wu et al. (2016), reported a direct relationship between leaf tissue chlorophyll content and overall plant salinity tolerance ability. The positive response of MMB on chlorophyll content in canola, wheat, mung bean, pea, and soybean against stress has been reported by researchers. The enhanced production of chlorophyll content in plants indicates a higher photosynthetic rate and carbon assimilation for better growth and survival of the plant under stress conditions.

5.6 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Relative Water Content The response of plants against salinity stress are multifaceted and depends on factors like the plant genotype, development stage of plant, environmental effect, severity, and duration of the stress (Lata et  al. 2015). The salinity induces biochemical and

5.6  Regulating Relative Water Content

morpho‐physiological changes, which induces decreases in the chlorophyll content, foliar area, and the RWC and finally causes leaf senescence, as well as decreased photosynthesis of the plant. The leaf RWC is one of most reliable and simple methods to measure leaf water status. The plant’s response to diverse environmental states is shown strongly by leaf RWC as a resilient parameter (Jha 2017a). The second or third youngest fully expanded leaf from the top of the plant is used for the measurement of leaf RWC using the following equation:

RWC (%) = (FW – DW) × 100/(TW – DW)

Where, leaf fresh weight is instant weight and represented by FW, leaf dry weight is the constant weight reached after 24 hours drying at 70 °C and represented by DW, turgid weight of leaf is weight after submergence in distilled H2O for 4 hours and represented by TW. The photosynthetic rate of plants decreases as their RWC decreases. The results of this study show that, the RWC in inoculated plants, increased in the non‐saline state and under salinity it minutely increased in plants inoculated with both P. aeruginosa and B.megaterium compared to the non‐inoculated control (Table 5.3). The most exciting observation is that, the MMB inoculated plants under both normal and saline conditions had better RWC, which is in accordance with Sandhya et al. (2010). An increased level of leaf RWC in maize under salinity suggests the role of osmoprotectants in preventing cell injury from salt stress induced dehydration. Table 5.3  Effect of MMB on the RWC, stomatal conductance, xylem cortex thickness, and sugar concentration in phloem sap of maize under salinity (n = 5).

Treatment

RWC %

Stomatal conductance (mol m−2 s−1)

Stomata density (pores mm−2)

Xylem thickness (μm)

Cortex thickness (μm)

Sugar in phloem sap (%wt/wt)

2201 2188 2184 2165

1898 1818 1782 1711

19.1 20.4 23.8 24.2

6124 6091 6047 5993

873 814 767 723

10.2 11.3 13.6 14.5

Normal Control Control +  B. megaterium Control +  P. aeruginosa Control +  B. megaterium +  P. aeruginosa

90.2 93.0 94.7 96.3

0.71 0.84 0.92 1.12

60 64 67 68

Stressed Control Control +  B. megaterium Control +  P. aeruginosa Control +  B. megaterium +  P. aeruginosa

21.2 22.1 23.6 24.2

0.07 0.13 0.18 0.23

52 54 56 58

81

82

5  Regulation of Photosynthesis Under Salinity

5.7 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Stomatal Behavior Plant life is adversely affected by drought and salinity stress. The growth of plants is badly hampered by a cascade of numerous physiological responses including leaf water status, stomatal behavior, modifications of ion balance, photosynthetic efficiency, mineral nutrition status, and carbon allocation and utilization. The water conductance from root to leaf stomatal site is required to maintain leaf water balance, to maintain stomatal opening to capture carbon in the plant. Stomatal behavior is a multifaceted phenomenon with feedback regulation influenced by an extensive range of environmental stimuli (Zweifel et al. 2007) such as relative humidity, light intensity, temperature. To enhance the efficacy of photosynthesis, an integrated system is required for regulation of stomatal conductance to harvest as much carbon as possible. The reduced stomatal conductance is responsible for reduced assimilation of photosynthetic CO2 and results in reduced availability of CO2 for carboxylation. Loss of water from turgid leaf tissue in response to transpiration results in not only a significant decline in water potential, but also a decline in osmotic potential. The response of photosynthesis to salinity stress has been assessed using different physiological measurement techniques, such as water potential, leaf osmotic potential, and stomatal conductance. There is a direct link between stomatal conductance and photosynthesis arising from the fact that under photosynthetic conditions, stomata operate to enhance photosynthesis on the one hand, while to avoid dehydration induced damage on the other. Such damage includes excessive dehydration and disturbance to cellular water relations and other physiological events. Evidence shows that stomatal conductance of leaves and photosynthetic rate are correlated with each other under diverse environment conditions. This correlation between photosynthetic rate and stomatal conductance has been regulated from the mesophyll that directs stomatal behavior (Jha and Subramanian 2015), because photosynthetic rate is a function of intercellular CO2 concentration, which is a function of stomatal conductance. Stomatal conductance of the fresh leaves of plants is measured using the Li‐Cor 6400. Stomatal conductance of the inoculated plant increased in the non‐saline state, while a marginal decrease was recorded in plants inoculated with both P. aeruginosa and B. megaterium under salinity. Salinity rapidly decreases stomatal conductance, resulting in a decreased rate of transpiration. Stomata closure is an effective mechanism for efficient utilization of water and to reduce uptake of harmful salt ions under salt stress. However, inoculation with MMB increased stomatal conductance under saline and non‐saline states to improve leaf water potential to support photosynthesis in adverse conditions; this observation is supported by Mia et  al. (2010). MMB inoculation enhances the rate of photosynthesis by prompting a change in leaf anatomical structure and photochemistry. MMB inoculated plants show higher stomatal frequency as a plant strategy to satisfy the increasing demand of CO2 needed for better growth response (Table 5.3). The potential to regulate excess water loss and CO2 uptake can be greatly amplified by higher stomata density. However, MMB inoculated plants show the occurrence of smaller stomata, which permit better control of stomata opening or closure, as small stomata have faster dynamic features (Drake et al. 2013). Indeed, inoculation with MMB encouraged the alteration of leaf structure

5.8  Regulate Soluble Sugar

for better regulation of stomata opening or closure for efficient photosynthesis under adverse conditions to support the plant.

5.8 ­Mineral Mobilizing Bacteria Maintain Photosynthesis to Regulate Soluble Sugar by Altering Vascular Tissue Plants have evolved different mechanisms to respond and adjust to hostile environmental conditions during their growth and development as they have a sessile life cycle. The environmental stress severely affects plant growth due to impaired stomatal opening, which restricts the CO2 uptake and finally diminishes the photosynthetic activity. Salinity stress also causes greater lignification of vascular tissues and/or development of xylem. In the present study, saline stress also accelerated the lignification of the developing xylem (Figure 5.2), but inoculation with MMB caused little effect on permanent tissues like xylem, whereas it will regulate the lignification of it for the survival of plant under stress to maintain source and sink coordination (Table 5.3). The reduced production of sugar due to reduced photosynthesis reduced the growth of plant, which recovered due to the association of MMB with the plant under stress. So altered photosynthesis resulted in an altered vascular system at various stages and (i) resulted low availability of sugar to be exported through the vascular tissue (ii) increased the sugar requirement for the sustainable growth of the plant, and MMB for its survival under stress (iii) the interconnection of sugar path between plant and MMB leading to impaired sugar delivery, as the plant is a host for the MMB, so MMB helps plants to survive under stress. The metabolic fate of sugar changes intensely depending on the developmental stage of the plant. The mature green leaves have high photosynthetic activities to export photosynthates to sink organs, while young sink leaves must import the photosynthates required for the construction of their photosynthetic systems. Therefore the complexity of sugar exchanges has a direct relationship with concentration of sugar in

A

B

C

Figure 5.2  Effect of MMB on vascular tissue of maize root cells under salinity, where A = inoculated with Pseudomonas aeruginosa, B = inoculated with Bacillus megaterium and C = control. (See color plate section for the color representation of this figure.)

83

84

5  Regulation of Photosynthesis Under Salinity

the mesophyll cells of plant leaves and the export of sugar, and on source limitation in plants under stress. Abiotic stress like salinity causes alteration in the distribution of sugar among various parts of the plant as sugar allocation to roots is favored under mineral deficiency conditions. Phloem transport is affected prior to photosynthesis due to altered phloem integrity under stress. Phloem transport decreases due to photosynthesis inhibition resulting in enhanced sugar concentration (Liu et al. 2012). In green plants, energy produced in the leaves is transported to sites of active growth by vascular tissue. The concentration of sugar flow through the phloem vascular tissue is dependent on the sugar concentration and on the rate of sap flow. The sugars are ­transported through the phloem vascular system produced by photosynthesis. In the present study, the plants inoculated with MMB had an enhanced sugar concentration in phloem sap in both normal as well as stressed plants (Table 5.23). The sugars are either actively or passively loaded into the phloem for transportation and is initiated in the leaves. In active loading, sugar polymerization and membrane transportation take place against the concentration gradient of sugar. While in passive loading, sugar traveling down a concentration gradient from the mesophyll to phloem without the use of metabolic energy (Rennie and Turgeon 2009). A microfluidic network bridging the entire length of the plant through the phloem having a series of narrow, elongated cylindrical cells called sieve tube elements remain filled with an aqueous solution of ions, sugars, proteins, amino acids, and signaling molecules. There is a large variation in the concentration of sugar in the different plant tissues, which may act as a broad range of signals.

5.9 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Accumulating Various Osmoprotectants Osmosis is the process of uptake of the water through the roots in the plant. Salinity adversely pulls out water from the plant cell, causing dehydration. High osmotic stress has detrimental effects on cellular components of the plant. The best characterized osmotic stress response is the accumulation of high concentrations of low molecular weight organic ions or solutes known as compatible solutes as a biochemical response. Such compatible solutes are non‐toxic to cells/enzymes, highly water soluble, and electrically neutral at physiological pH, so do not interfere with important metabolic reactions like photosynthesis even at high concentrations. Osmotic compounds in the form of low molecular weight soluble sugars are produced by the plants by altering the photosynthetic products that build up in response to an imposed dehydration and have a function in sustaining tissue metabolic activity. Induction of osmotin like low molecular weight soluble sugar induct an enhanced chlorophyll content, expanded leaf, and RWC, suggesting that osmotin is able to protect the photosynthetic machinery by protecting the cell under water limited conditions. Adaption against such adverse conditions include modifications in ion transport as uptake, sequestration, and extrusion of ions as well as synthesis of compatible solutes, to restore the cellular homeostasis and detoxify cells and therefore help the plants to survive under stress. Compounds like low molecular weight soluble sugars, glycine betaine‐like quaternary ammonium compounds

5.9  Accumulating Various Osmoprotectants

20 18 16 14 12 10 8 6 4 2 0

Proline

Control Stressed

... m +P

a no s

te riu

ug i C +B

.m

eg a

.a er C +P

C +B

.m

C

on tro

l

eg at er iu m

.

mMol min–1 g–1 FW

(QACs), and proline are known osmoprotectants whose concentration can be influenced by the MMB in plants under osmotic stress. These compounds are measured as glycine betaine (GB) equivalents. Proline and low molecular weight soluble sugar have been analyzed in the leaf extract by gas chromatography–mass spectrometry (GC–MS) analysis. In our study, the accumulation of low molecular weight soluble sugars, proline, and glycine betaine are remarkably high in the P. aeruginosa and B. megaterium inoculated plants (Figure 5.3). Accumulation of QACs is enhanced in the maize leaves inoculated with both P. aeruginosa and B. megaterium compared to plants treated with either of the P. aeruginosa and B. megaterium under salinity (Figure 5.4). In the present study, osmotic adjustment of cells is due to accumulation of soluble sugar, as there is a direct relationship of total soluble sugar and salinity in both inoculated and non‐inoculated plants (Figure 5.5). The natural mechanism of plants to cope osmotic stress is accumulation of sugar, proline, and QACs, as chief organic osmolytes under diverse abiotic stresses. An adaptive role is played by these compounds in stressed plants for protecting intracellular organelles like chloroplasts and arbitrating osmotic adjustment (Asharf and Foolad 2007). However, the concentration of sugar, proline, and QACs serve as an internal water index in stressed plant tissue. An enhanced level of such compounds modifies the membrane behavior of the plant, resulting in improved sodium flux from cytoplasm to vacuole (Jha 2017b). It alleviates the oxygen evolving activity of photosystem II protein complex, stabilizes manganese clusters, and protects regulatory extrinsic proteins against dissociation, resulting in overall protection of the entire photosynthetic machinery with osmoregulation. Thus, different approaches have been used to increase the concentration of such compounds under stress conditions in the plants grown to enhance their stress tolerance ability, and the use of MMB is an ecofriendly approach to it. Such osmoprotectant induction due to MMB inoculation induces the formation of strong H‐bonded water around the protein/enzymes of photosynthesis and preserves the native state of the cell biopolymers for the survival of plant under stress. To develop tolerance toward environmental stress, metabolic engineering of compatible solutes provides a positive response by enhancing the plant’s tolerance ability

Figure 5.3  Effect of MMB on proline content of maize cells under salinity.

85

5  Regulation of Photosynthesis Under Salinity

Glycine Betain 

m Molmin–1 g–1 FW

3.5 3 2.5 2 1.5

Control

1

Stressed

0.5

... m eg .m

C

+B

C

C

+B

+P

.m

.a

at

er

er

iu

ug

at eg

C

+P

os a in

er

on

iu

tro

l

m

.

0

Figure 5.4  Effect of MMB on glycine betaine content of maize cell under salinity.

350 m Molmin–1 g–1 FW

Sugar

300 250 200 150 Control Stressed

100 50

m .m

+B C

C

+P

eg

.a

at

er

er

ug

iu

in

er at eg .m +B C

+P

a

iu

os

m

l tro on

...

.

0

C

86

Figure 5.5  Effect of MMB on sugar content of maize cell under salinity.

against abiotic stresses by enhanced production of soluble sugars and other osmolytes. While decreased sugar concentration signifies osmotic stress‐induced reduction in photosynthesis, which causes a shortage of photoassimilates in shoots, as well as the divergence of the photosynthetic product for osmotin. So to maintain homeostasis there is down‐regulation of photosynthesis due to high accumulation of sugars in source tissues. The adaptation in carbon metabolism against the changing environmental conditions depends on the differential source sink effects to maintain the availability of essential nutrients. The MMB inoculated plants enabled a higher photosynthetic capacity to improve the accumulation of biomass under saline stress. The symbiotic effect of MMB alleviate the metabolic inhibition of photosynthesis and increase water uptake and translocation, on one hand, while on other, the carbon sink is simulated by the MMB sugar/carbon requirements (Porcel et al. 2015).

5.10  Regulating Sugar Biosynthesis

5.10 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Regulating Sugar Biosynthesis Sugar is both produced and consumed by photosynthetic organisms such as autotrophic plants, which acts as a carbon precursor in some of the non‐green organs of the plant and is utilized in some parts of their life cycle that are not involved in photosynthesis. The proficiency of photosynthesis in plant tissues substantially decreases under changed environmental factors such as temperature, light, and water and thus, diminishes the supply of soluble sugars to sink tissues. To sustain respiration and other metabolic processes under sugar deprivation conditions, substantial changes in physiological and biochemical pathways are needed. Both sugar and light play vital roles in plant growth and development, and sugar has a central role in plant metabolism. Structurally and metabolically important compounds such as fatty acids, cellulose, and amino acids, which are substrates for energetic processes, are produced during photosynthesis and are also the key storage material in plants. Sugar affects the metabolic changes, has a regulatory role in photosynthesis, and also has a signaling effect in plants (Jha and Subramanian 2018a). Gene expression can be modulated and influences numerous signaling pathways by the sugar sensors, such as hexokinase in plant cells (Granot 2008). The accumulation of sugar in the leaves was estimated by GC–MS analysis of leaf extracts in MMB inoculated and non‐inoculated plants under salinity and showed a significant difference in the types, number, and concentration of soluble sugars. The non‐inoculated plants under salinity showed a lower number of common sugars, while the plants inoculated with MMB showed a greater variety of sugars under salinity in this study (Table 5.4). So, MMB inoculated plants under salinity showed more types and a higher concentration of soluble sugars in GC–MS analysis. Similarly, the change in Table 5.4  Different soluble carbohydrates in non‐inoculated plant extracts identified in GC–MS analysis under salinity. Hit

Rev

For

Compound name

Normal 1.

846

686

6‐Deoxy‐d‐galactose

2.

793

576

Lactose

3.

756

616

d‐Mannose

4.

748

565

4‐o‐α‐d‐Glucopyranosyl‐d‐glucose

1.

796

637

2,3,4,5‐Tetrahydroxypbtanal

2.

786

616

d‐Mannose

3.

767

598

Methyl beta‐d‐ribopyranoside

4.

731

543

d‐Lyxose

5.

705

512

2,3,4,5‐Tetrahydroxypentanal

Stressed

Where Hit = attempt number, Rev = reverse match of peak, and For = forward match of peak.

87

88

5  Regulation of Photosynthesis Under Salinity

sugar concentration has been reported by Rejsiková et al. (2007), to overcome salt stress in plants. The transformation of starch to sugars or low utilization of carbohydrates by the tissues may cause accumulation of soluble sugar in plant cells under salinity. It is difficult to interpret the relationship between sugar accumulation and saline stress, and the parallel responses are clearly pleiotropic for protection mechanisms, which is of great interest. The lack of or availability of sugars activates several metabolic and growth responses and the status of sugar is of great importance for the plant cells during all stages of the plant’s life cycle. Therefore, the sugars profoundly affect the expression of a large number of genes in plants under stress. Sugar sensing occurs at the level of individual cells and the responses of such cells must be integrated at the tissue, organ, and plant level. Therefore, sugar‐induced signals will interact with other sensing and signaling pathways. Whether starch and sugars like glucose, fructose, sucrose, and fructans are accumulated in plant cells depends on the magnitude of stress, as salt stress is related to the level of soluble carbohydrates and salinity tolerance. Therefore, MMB like beneficial bacteria can encourage carbohydrate transport and metabolism by directly establishing the source–sink relationship, photosynthesis, biomass allocation and growth of plant. Upadhyay and Singh (2015) reported that there was enhanced accumulation of total soluble sugars and reducing sugars in B. aquimaris inoculated wheat under saline (EC  =  5.2 dS m−1) field conditions, and also showed higher shoot biomass and NPK accumulation.

5.11 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Reducing Ethylene Biosynthesis Photosynthesis is the site for the production of carbohydrates required to maintain the fundamental activity in plant life. The photosynthate production, utilization, storage, and transportation is an active process, which is strongly dependent on the developmental stage of the plant, cell physiology, plant organ, and environmental conditions. The ability of the plant to respond and regulate the level of sugars is a governing mechanism to coordinate the stimulus of environmental conditions as nutrients, light, biotic or abiotic stress, as well as endogenous growth response is directly controlled by hormones (Agulló‐Antón et al. 2011). The plant normally produces growth hormones under normal as well as under different stresses, which regulate miscellaneous physiological changes in plants. Ethylene is a plant growth regulator and is also known as a stress hormone. The endogenous level of ethylene is remarkably increased under stresses like, drought, salinity, water logging, pathogenicity, and heavy metal toxicity, which harmfully affects the overall plant growth response (Jha and Subramanian 2018b). The over production of ethylene under stress may affect several cellular processes and induces defoliation, which results in reduced crop performance and photosynthesis (Bhattacharyya and Jha 2012). MMB have the enzyme, 1‐aminocyclopropane‐1‐carboxylate (ACC) deaminase to decrease the ethylene concentration, which enhances the plant by inducing salt tolerance in plants (Zahir et al. 2008). In the present study, both the isolates have ACC deaminase activity, which increases with time after inoculation in a suitable medium (Figure  5.6). Several bacteria belonging to various genera exhibit ACC

5.12  Inducing Various Signaling Molecule 12

ACC Deaminase

UmolFKA(mg.h)–1

10 8 6

B. megaterium P. aeruginosa

4 2 0 24h

48h

72h

Figure 5.6  ACC deaminase activity of the two isolates at various time duration.

deaminase activity such as Achromobacter, Acinetobacter, Agrobacterium, Azospirillum, Alcaligenes, Burkholderia, Bacillus, Enterobacter, Ralstonia, Pseudomonas, Rhizobium, etc. (Kang et al. 2010). It has been reported that ethylene production increases under stress conditions and results in inhibitory effects on plants, but ACC deaminase‐containing MMB can hydrolyze ACC, the precursor of ethylene, thereby reducing the excess ethylene and rescuing plants from stress generated inhibitory effects (Glick et al. 1998).

5.12 ­Mineral Mobilizing Bacteria Maintain the Photosynthetic Efficiency of Plants by Inducing Various Signaling Molecule As sessile organisms, plants have developed the ability to rapidly sense the surrounding environment for an effective response toward environmental signals. When a plant is exposed to abiotic and biotic stress, it will generate systemic signals and act in a coordinated way metabolically to maintain its development. Such responses are activated by principal osmotic stress signals (Chaves et al. 2003) or by ancillary metabolic signals via temporary induction, which finally include endogenous second messengers (phospholipids, sugars, etc.), reactive oxygen species (ROS), and hormones (e.g. ethylene, abscisic acid (ABA), cytokinins). Biomolecules have an important role for plant growth and development under stress. They play a critical role in assimilating numerous stress signals and cause downstream regulation stress responses in plants by modifying biochemical reactions, regulating numerous transporters/pumps and modulating gene expression machinery. These chemicals comprise cyclic nucleotides, sugars, calcium (Ca2+), nitric oxide (NO), polyphosphoinositides, ABA, salicylic acid (SA), polyamines, and jasmonates (JA). The gene expression involved in glycolysis; photosynthesis; sucrose, nitrogen, and starch metabolism; cell cycle regulation; and defense mechanisms is mainly affected by sugar. There chemical signaling pathways are interlinked with each other and have common responses to abiotic and biotic factors in plants (Jha et al. 2014). Sugar, the main product of photosynthesis playing a critical role in initiating

89

90

5  Regulation of Photosynthesis Under Salinity

signals primarily under abiotic stress, does interact with hormones as part of the signaling network and sugar sensing in plants (Rolland et al. 2006). Soluble sugars like glucose, fructose, and sucrose act as signaling molecules and their concentration is altered due to water deficiency or salinity in plants. The gene expression and proteomic patterns involved in governing photosynthetic metabolism are modify by sugars. The genes involved in source activities like photoassimilate export, nutrient mobilization, and photosynthesis are down‐regulated by high sugar (product) concentration. However, the genes involved in sink activities like the synthesis of lipids, proteins, and storage polysaccharides are up‐regulated by MMB (Stitt and Zeeman 2012) under stress. Chaves et al. (2003) reported that, environmental signals like light, water, and CO2, can also be assimilated and are apparent as sugar signals, this signifies that diverse signal types may be recognized by the same receptor or downstream converge signal pathways – starting from a single point in the sugar signal pathways. So the effects of sugars and MMB are diverse in plant growth and development, as thousands of gene transcriptions respond to shifting sugar levels (Usadel et al. 2008). The availability of carbohydrates decides the molecular network dynamic for cell division and expansion to provide energy and biomass.

5.13 ­Conclusion Abiotic stresses limit the yield and overall agriculture production and the continuous change in the climate will intensify the degree, frequency, and net damage. Various environmental factors, including salinity, cause abiotic stresses and plants have developed multifaceted mechanisms. MMB residing in soil alleviate the negative effects of such stress by enhancing photosynthesis as well as plant biomass in a very cost‐effective and time‐sensitive manner. The development of tolerant cultivars has been rather impressive. The use of MMB in salt‐affected fields helps plants to develop tolerance, which inspires the commercialization of such MMB for salinity tolerance. The plant– microbe association approach in response to adverse environmental stimuli unlocks a new way to understand the governing networks for stress tolerance in plants, which are modulated by such bacteria. The salt tolerance induced may be added by the induction of various mechanism as a chemical signal in the plant. Salt tolerance ability of plants encouraged by accompanying MMB, needs cutting‐edge research for its successful development to improve crop yield in saline prone regions. The possible benefits of MMB to deal with stress in agricultural fields appears to be highly helpful for sustainable development.

­References Agulló‐Antón, M.Á., Sánchez‐Bravo, J., Acosta, M., and Druege, U. (2011). Auxins or sugars: what makes the difference in the adventitious rooting of stored carnation cuttings? J. Plant Growth Regul. 30: 100–113. Aktar, M.W., Sengupta, D., and Chowdhury, A. (2009). Impact of pesticides use in agriculture: their benefits and hazards. Interdiscip. Toxicol. 2: 1–12.

­  References

Ashraf, M. and Foolad, M.R. (2007). Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 59: 206–216. Ashraf, M. and Harris, P.J.C. (2013). Photosynthesis under stressful environments: an overview. Photosynthetica 51: 163–190. Bhattacharyya, P.N. and Jha, D.K. (2012). Plant growth‐promoting rhizobacteria (PGPR): emergence in agriculture. World J. Microbiol. Biotechnol. 28: 1327–1350. Chaves, M.M., Maroco, J.P., and Pereira, J.S. (2003). Understanding plant responses to drought – from genes to the whole plant. Funct. Plant Biol. 30: 239–226. Chaves, M.M., Flexas, J., and Pinheiro, C. (2009). Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Ann. Bot. 103: 551–560. Drake, P.L., Froend, R.H., and Franks, P.J. (2013). Smaller, faster stomata: scaling of stomatal size, rate of response, and stomatal conductance. J. Exp. Bot. 64: 495–505. Dulai, S., Molnár, I., and Molnár‐Láng, M. (2011). Changes of photosynthetic parameters in wheat/barley introgression lines during salt stress. Acta Biol. Szeged 55: 73–75. Glick, B.R., Penrose, D.M., and Li, J. (1998). A model for the lowering of plant ethylene concentrations by plant growth promoting bacteria. J. Theor. Biol. 190: 63–68. Granot, D. (2008). Putting plant hexokinases in their proper place. Phytochemistry 69: 2649–265410. Han, H.S. and Lee, K.D. (2005). Plant growth promoting rhizobacteria effect on antioxidant status, photosynthesis, mineral uptake and growth of lettuce under soil salinity. Res. J. Agric. Biol. Sci. 1: 210–215. Jha, Y. (2017a). Potassium mobilizing bacteria: enhance potassium intake in paddy to regulate membrane permeability and accumulate carbohydrates under salinity stress. Braz. J. Biol. Sci. 4: 333–344. Jha, Y. (2017b). Cell water content and lignification in maize regulated by rhizobacteria under salinity. Braz. J. Biol. Sci. 4: 9–18. Jha, Y. and Subramanian, R.B. (2013). Root associated bacteria from the rice antagonizes the growth of Magnaporthegrisea. J. Plant Pathol. Microb. 4: 164. Jha, Y. and Subramanian, R.B. (2014). Characterization of root‐associated bacteria from paddy and its growth‐promotion efficacy. 3 Biotech. 4: 325–330. Jha, Y. and Subramanian, R.B. (2015). Reduced cell death and improved cell membrane integrity in rice under salinity by root associated bacteria. Theor. Exp. Plant Physiol. 27: 227–235. Jha, Y. and Subramanian, R.B. (2018a). Effect of root‐associated bacteria on soluble sugar metabolism in plant. In: Under Environmental Stress Plant Metabolites and Regulation Under Environmental Stress (ed. P. Ahmad, M.A. Ahanger and M.N. Alyemeni), 231–240. Academic Press, Elsevier. Jha, Y. and Subramanian, R.B. (2018b). From interaction to gene induction: an eco‐friendly mechanism of PGPR‐mediated stress Management in the Plant. In: Plant Microbiome: Stress Response (ed. D. Egamberdieva and P. Ahmad), 217–232. Springer. Jha, Y., Sablok, G., Subbarao, N. et al. (2014). Bacterial‐induced expression of RAB18 protein in Orzya sativa salinity stress and insights into molecular interaction with GTP ligand. J. Mol. Recognit. 27: 521–527. Kang, S.M., Hamayun, M., Joo, G.J. et al. (2010). Effect of Burkholderia sp. KCTC journal of plant interactions 681 11096BP on some physiochemical attributes of cucumber. Eur. J. Soil Biol. 46: 264–268.

91

92

5  Regulation of Photosynthesis Under Salinity

Lata, C., Muthamilarasan, M., and Prasad, M. (2015). Drought stress responses and signal transduction in plants. In: Elucidation of Abiotic Stress Signaling in Plants (ed. G.K. Pandey), 195–225. New York, NY, USA: Springer. Liu, D.D., Chao, W.M., and Turgeon, R. (2012). Transport of sucrose, not hexose, in the phloem. J. Exp. Bot. 63: 4315–4320. Mia, M.A.B., Shamsuddin, Z.H., and Mahmood, M. (2010). Use of plant growth promoting bacteria in banana, a new insight for sustainable banana production. Int. J. Agr. Biol. 12: 459–467. Negrão, S., Schmöckel, S.M., and Tester, M. (2017). Evaluating physiological responses of plants to salinity stress. Ann. Bot. 119: 1–11. Pan, J., Li, S., and Woodbury, N.W. (2012). Bacterio chlorophyll excited state quenching pathways in bacterial reaction centers with the primary donor oxidized. J. Phys. Chem. B. 116: 2014–2022. Porcel, R., Redondo‐Gómez, S., Mateos‐Naranjo, E. et al. (2015). Arbuscular mycorrhizal symbiosis ameliorates the optimum quantum yield of photosystem II and reduces non‐photochemical quenching in rice plants subjected to salt stress. J. Plant Physiol. 18575–18583. Rahnama, A., Poustini, K., Tavakkol‐Afshari, R., and Tavakoli, A. (2010). Growth and stomatal responses of bread wheat genotypes in tolerance to salt stress. Int. J. Biol. Life Sci. 6: 216–221. Raja, N. (2013). Biopesticides and biofertilizers: ecofriendly sources for sustainable agriculture. J. Biofertil. Biopestici. 4: e112. Rejsiková, A., Patková, L., Eva Stodulková, E., and Lipavská, H. (2007). The effect of abiotic stresses on carbohydrate status of olive shoots (Oleaeuropaea L.)under in vitro conditions. J. Plant Physiol. 164: 174–184. Rennie, E.A. and Turgeon, R. (2009). A comprehensive picture of phloem loading strategies. Proc. Natl. Acad. Sci. U.S.A. 106: 14162–14167. Rolland, F., Baena‐Gonzalez, E., and Sheen, J. (2006). Sugar sensing and signaling in plants: conserved and novel mechanisms. Annu. Rev. Plant Biol. 57: 675–709. Rosenberg, Z. and Rosenberg, E. (2008). Role of microorganisms in the evolution of animals and plants: the hologenome theory of evolution. FEMS Microbiol .Rev. 32: 723–735. Sandhya, V., Ali, S.K.Z., Minakshi, G. et al. (2010). Effect of plant growth promoting Pseudomonas spp. on compatible solutes, antioxidant status and plant growth of maize under drought stress. Plant Growth Regul. 62: 21–30. Sinha, R.K., Valani, D., Chauhan, K., and Agarwal, S. (2014). Embarking on a second green revolution for sustainable agriculture by vermiculture biotechnology using earthworms: reviving the dreams of Sir Charles Darwin. Int. J. Agric. Health Saf. 1: 50–64. Stefan, M., Munteanu, N., Stoleru, V., and Mihasan, M. (2013). Effects of inoculation with plant growth promoting rhizobacteria on photosynthesis, antioxidant status and yield of runner bean. Rom. Biotechnol. Lett. 18: 8132–8143. Stitt, M. and Zeeman, S.C. (2012). Starch turnover: pathways, regulation and role in growth. Curr. Opin. Plant Biol. 15: 282–229. Upadhyay, S.P. and Singh, D. (2015). Effect of salt‐tolerant plant growth‐promoting rhizobacteria on wheat plants and soil health in a saline environment. Plant Biol. https://doi.org/10.1111/plb.12173.

­  References

Usadel, B., Bläsing, O.E., Gibon, Y. et al. (2008). Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. Plant Physiol. 146: 1834–1861. Wu, S., Li, Z., Yang, L. et al. (2016). NON‐YELLOWING2 (NYE2), a close paralog of NYE1, plays a positive role in chlorophyll degradation in Arabidopsis. Mol. Plant 9: 624–627. Zahir, Z.A., Munir, A., Asghar, H.N. et al. (2008). Effectiveness of rhizobacteria containing ACC‐deaminase for growth promotion of pea (Pisumsativum) under drought conditions. J. Microbiol. Biotechnol. 18: 958–963. Zweifel, R., Steppe, K., and Sterck, F.J. (2007). Stomatal regulation by microclimate and tree water relations: interpreting eco‐physiological field data with a hydraulic plant model. J. Exp. Bot. 58: 2113–2131.

93

95

6 Regulation of Photosynthesis Under Metal Stress Mumtaz Khan1, Neeha Nawaz 2, Ifthekhar Ali1, Muhammad Azam3, Muhammad Rizwan2, Parvaiz Ahmad4,5, and Shafaqat Ali2 1

Department of Soil and Environmental Sciences, Gomal University, Dera Ismail Khan, Pakistan Department of Environmental Sciences and Engineering, Government College University Allama Iqbal Road, Faisalabad, Pakistan 3 Department of Horticulture, University of Agriculture, Faisalabad, Pakistan 4 Department Botany, S.P. College, Srinagar, Jammu and Kashmir, India 5 Department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia 2

6.1 ­Introduction Photosynthesis is the key carbon fixation process in plants, green algae, and cyanobacteria, in which light energy is converted to chemical energy. It is a complex phenomenon and the intermediate steps in carbohydrate metabolism exceed 50. Several hundred pigments are involved in collecting and transferring light to the reaction center complexes which operate four times to produce one oxygen molecule. Antenna complexes harvest light energy and oxidation reduction reactions happen in reaction centers. Chloroplasts are the indispensable components of photosynthesis which consist of thylakoid membranes, stacked one over the other, forming grana lamellae and stroma. Extra‐thylakoid spaces in chloroplasts possess enzymes involved in carbon fixation and other metabolic reactions. Chlorophylls are ring‐shaped green pigments found in photosynthesizing organisms. They absorb blue and red light, while green is reflected, rendering them the later color. Chlorophyll a (Chl a) and chlorophyll b (Chl b) are well‐known photosynthetic pigments, however, there also exists chlorophyll c and chlorophyll d. In addition to chlorophylls, chloroplasts contain carotenoids – the orange‐colored pigments commonly referred to as “accessory pigments.” Carotenoids perform several functions in plants, but from a photosynthesis point of view, their major role is to transfer absorbed light to the chlorophylls. Earlier research has shown that chloroplast membranes, chlorophylls, and enzymes in photosynthetic pathways are prone to abiotic stress induced by metals. This needs better understanding of the toxicity effects caused by metals and the mechanisms involved in regulation of photosynthesis. Metals are either essential or non‐essential for photosynthesis in plants. Essential metals are required in trace amounts while non‐essential are mainly toxic to the plants. Essential metals have several important roles e.g. they serve as cofactors for metalloproteins, transfer electrons in photosynthetic reaction centers, maintain protein stability, and provide protection against oxidative stresses (Khan et al. 2018; Yruela 2013). For Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

96

6  Regulation of Photosynthesis Under Metal Stress

instance, copper (Cu), as Cu/Zn superoxide dismutase, detoxifies harmful reactive ­oxygen species (ROS) produced during stress conditions and constitutes an electron carrier, plastocyanin. Copper, however, adversely affects photosynthesis when its concentrations surpass the plant’s threshold levels. Similarly, iron (Fe), as ferritin, balances its own concentration in the chloroplasts where almost 80% of the total cell Fe is present. Further, zinc (Zn) is a part of β‐carbonic anhydrase which is responsible for catalyzing carbon dioxide (CO2) and water to HCO3−. Manganese (Mn) is a constituent of photosystem II (PSII) redox enzymes, Mn‐SOD (superoxide dismutase), Mn‐CAT (catalase), pyruvate carboxylase (PC) and phosphoenolpyruvate carboxylase (PEPC). It is found as a Mn‐cluster in PSII and oxidizes H2O. Metal concentration and mobility, both in growth medium and within the plant, defines the stress response and cell damage. It is evident from the earlier studies that photosynthesis apparatus and related metabolic pathways are adversely affected by the excess of essential metals such as Zn, Fe, Mn, and Cu, and non‐essential metals, for example, Pb (Khan et al. 2016), Cd (Ali et al. 2014; Asgher et al. 2014), Cr, As, and Hg. In trace amounts, these may have stimulatory effects, but in oversupplied situations, metals become active ROS producers and cause damage to chloroplasts and related biological functions. Importantly, heavy metals may reduce uptake of other trace metals required for photosynthesis functioning. So, keeping essential metals under physiological limits and reducing the uptake of non‐ essential metals is vital for the regulation of photosynthesis. In the next sections of this chapter, heavy metal‐induced effects on plants’ photosynthesis and key regulatory mechanisms are discussed.

6.2 ­Effects of Metals on Photosynthesis Plants grown on metal‐polluted soils can assimilate heavy metals that can bring adverse physiological, biochemical, and ultrastructural changes in leaves (Khan et al. 2016). In this chapter, metal‐induced changes in photosynthesis at several levels including stomatal conductance, chloroplasts, photosynthetic pigments, and enzymes involved in the plant’s defenses and metabolic pathways are considered. Previously, a major focus of interest was metal‐induced changes in net photosynthesis rate, CO2 exchange, chlorophyll quantity, leaf morphology, and ultrastructure. 6.2.1  Reduction in CO2 Stomatal Conductance and Mesophyll Transport Stomatal conductance of CO2, under normal conditions, is controlled by turgidity of guard cells and intercellular concentrations of CO2. Heavy metals hinder stomatal conductance by altering the turgidity of guard cells due to water imbalance and morphological changes in stomata. Earlier studies have reported a decline in stomatal conductance of CO2 in various plants due to heavy metals (Sagardoy et  al. 2010; Subrahmanyam 2008; Vernay et al. 2008). For example, Cr inhibited chlorophyll biosynthesis and CO2 assimilation in Lolium perenne L., mainly due to closing of stomata (Vernay et al. 2008). Chromium affects net photosynthesis rate, stomatal conductance and transpiration in plants (Subrahmanyam 2008; Vernay et al. 2008). It is suggested that Cr‐triggered inhibition of CO2 assimilation may be due to less ATP (adenosine triphosphate) and NADPH (nicotinamide adenine dinucleotide phosphate)

6.2  Effects of Metals on Photosynthesis

utilization, non‐photochemical quenching, and a reduced rate of electron transport in photosystem II, which consequently decreases the quantum yield of linear electron transport and net photosynthesis in plants. Under Zn toxicity, a 76% decline occurred in stomatal conductance of Beta vulgaris, associated with altered morphology of guard cells and mesophyll tissues (Sagardoy et al. 2010). Another study reported that elevated CO2 supply reduced net photosynthesis due to inhibition of activase activity controlled by ATP/ADP (adenosine diphosphate) ratio (Crafts‐Brandner and Salvucci 2000). Similarly, Zn toxicity depleted CO2 concentration at the site of Rubisco carboxylase which led to a 40–50% decline in net photosynthesis in B. vulgaris plants (Sagardoy et al. 2010). As most of the experiments, on stomatal conductance and CO2 assimilation under elevated CO2, have been conducted in controlled environments, the situation may differ in open field experiments (Ainsworth and Rogers 2007). Mesophyll transport of CO2 is also affected by heavy metal stress. A previous study reported that Zn stress caused 44% decline in mesophyll conductance of CO2 (Sagardoy et al. 2010). Several factors may be responsible for less mesophyll transport of CO2 such as altered chloroplast morphology and less interaction between chloroplasts and cell membranes. 6.2.2  Inhibition of Biosynthesis of Photosynthetic Pigments Chlorophylls are key photosynthetic pigments that indicate vegetation cover over an ecological zone. They are prone to degradation under adverse environmental conditions including heavy metal stress. Many studies have reported metal‐induced inhibition of chlorophyll biosynthesis and decline in concentrations of Chl a and Chl b, their ratio, and carotenoids contents (Ali et al. 2014; Daud et al. 2013; Khan et al. 2016; Mei et  al. 2015). It is suggested that heavy metals affect biosynthesis of chlorophylls by inhibiting activities of enzymes linked to their biosynthesis, or by replacing required elements such as Mg in the chlorophyll. Further, pigment‐protein complexes may also be affected by heavy metals. In a comparative study conducted on spinach chloroplasts, results revealed that Cu and Hg had stronger inhibitory effects on photosynthetic proteins and pigments than Ni, Co, and Mn (Ventrella et al. 2009). Similarly, in soil experiments, Cd, Pb, and Mn inhibited biosynthesis of Chl a and Chl b in Suaeda glauca (Bunge) Bunge and Arabidopsis thaliana (L.) Heynh (Zhang et  al. 2018). Cadmium, applied to Phragmites australis Adans at 50 μM, reduced chlorophyll concentration by 30% (Pietrini et al. 2003). In polluted soils, mixed heavy metals are present that may create more adverse photosynthetic responses in plants. A combined application of Cd, Cu, Cr, and Zn, tested over a range of 5–500 ppm, demonstrated a significant decline in chlorophyll quantity in four hybrids of poplar (Chandra and Kang 2016). 6.2.3  Changes in Leaf Morphology and Chloroplast Ultrastructure Translocation of heavy metals via symplastic and apoplastic pathways causes accumulation of heavy metals in photosynthetic apparatus. A study conducted on P. australis reported that 8.5 nM Cd was accumulated in leaves while 0.8 nM in chloroplasts (Pietrini et al. 2003). Heavy metals alter leaf morphology and chloroplast ultrastructure, especially thylakoid membranes. Plants grown in metal‐polluted environments have reduced leaf dimensions including length, width, and area. Leaf size influences

97

98

6  Regulation of Photosynthesis Under Metal Stress

photosynthesis by reducing the total surface area exposed to sunlight, lesser biosynthesis of ­chlorophylls, and reduced CO2 intake and C assimilation. Chloroplasts have lipid bilayer thylakoid membranes that convert light energy into plant‐useable metabolites i.e. ATP and NADPH. However, heavy metals disintegrate lipid bilayers by releasing proteins, lipids, and other constituents of photosynthetic membranes. Several supramolecular protein complexes are incorporated into thylakoid membranes and play roles in photosynthesis regulation. Previous research has shown that Pb and Cd disintegrated grana stacks and stroma of chloroplasts in upland cotton (Gossypium hirsutum L.), as revealed through transmission electron microscopy (Daud et al. 2013, 2015, 2016; Khan et al. 2016). Beside abnormalities in chloroplasts, changes also occur in size and number of m ­ itochondria, plastoglobuli, starch grains, and vacuoles that indirectly affect photosynthesis. 6.2.4  Induction of Reactive Oxygen Species Being an aerobic process, photosynthesis is coupled with ROS production. Chloroplasts are cell organelles which produces significant amounts of ROS. Similarly, the electron transport chain is the main process for ROS generation. Under heavy metal stress, excess ROS are produced due to over‐reduction of the electron transport chain. Several types of ROS are produced during photosynthesis including singlet oxygen (1O2), superoxide anion (•O−), hydrogen peroxide (H2O2) and hydroxyl radical (•OH). Singlet oxygen is produced in PSII and is vulnerable to light‐induced damage. Superoxide anion and hydrogen peroxide are generated in photosystem I (PSI). ROS are toxic to photosynthetic tissues and metabolic processes. For example, H2O2, if not effectively controlled, triggers oxidation of Calvin cycle enzymes and causes a significant decline in the rate of photosynthesis (Hajiboland 2014). Elevated ROS generation in leaves of various plants have been reported with Cd (Ali et al. 2014; Daud et al. 2013, 2016), Pb (Khan et al. 2016; Mei et al. 2015), Cr (Subrahmanyam 2008; Vernay et al. 2008), and Hg (Sahu et al. 2012). Although, excess ROS are destructive to biological structures and functions, their optimum levels are mandatory for cells as they perform important functions such as cell signaling. 6.2.5  Metal‐Induced Hormonal Changes Previous studies have revealed that heavy metals bring changes in several growth hormones (Gangwar et al. 2014; Han et al. 2013). Phytohormones that play roles in signal transduction or stimulation of protective reactions include auxins, abscisic acid (ABA), gibberellins, ethylene, jasmonate, etc. Different heavy metals had either increasing or decreasing effects on the hormonal concentration in different plant species. Three commonly known auxins are IIA (indole acetic acid), IBA (indole butyric acid) and NAA (naphthalene acetic acid). There levels were altered by As‐stress in Brassica juncea L. (Srivastava et al. 2012). Ethylene is a natural phytohormone having important roles in growth and development. An earlier study revealed that 100 μM ZnSO4 application reduced ABA concentration of xylem by 70% in B. vulgaris leaves (Sagardoy et al. 2010). On the other side, Cd toxicity decreased ABA, glutathione (GSH), and α‐tocopherol concentrations in Kosteletzkya virginica K. Presl (Han et al. 2013). Metal concentration may cause a differential response in the same plant. For example, over‐supplied Zn (10 mM) decreased indigenous levels of gibberellic acid and zeatin, while a lower dose

6.3  Mechanisms of Photosynthesis Regulation

(0.1 mM) had the opposite effect (Atici et al. 2005). In the same study, Pb increased ABA and zeatin concentration but decreased gibberellic acid. Not only does an excess of metals alter hormonal balance, deficiency may also trigger changes in plant tissues. For example, Fe deficiency in enhanced auxins concentration in A. thaliana (Chen et al. 2010). 6.2.6  Alterations in Photosynthetic Enzymes Rubisco (ribulose 1,5‐bisphosphate carboxylase/oxygenase) is the key enzyme in the photosynthetic pathway. Activation of Rubisco directly affects photosynthesis efficiency of plants which in turn depends on the enzyme, activase. Moreover, activase functioning is greatly influenced by ratio of ATP/ADP. Previous research has shown that a decline occurs in the activity of Rubisco under Cd contamination (Lee and Roh 2003). In another study, 50 μM Cd decreased Rubisco content by 10% and Rubisco activity by 60% in P. australis (Pietrini et al. 2003). These studies suggested that induction or inhibition of Rubisco activity was associated with metal type and its concentration, Rubisco protein content, and the activity of Rubisco activase. Antioxidants and antioxidant enzymes, that also help in regulating photosynthesis under metal stress, respond differentially to oxidative stress induced by various metals. Both up‐ and down‐regulation of antioxidants and antioxidant enzymes have been reported in different studies. At low heavy metal concentrations, GSH pools were increased in P. australis, G. hirsutum, and Brassica napus L. leaves, which protected key enzymes of metabolic pathways from metal binding (Pietrini et al. 2003). Cadmium stress increased SOD and CAT activity in the leaves of sunflower but glutathione reductase (GR) was unaffected (Laspina et al. 2005). It was noted that the enzymes that take part in photosynthesis were more affected as compared to the rate of photosynthesis or activity of photosystems in the presence of Cd in pea seedlings (Chugh and Sawhney 1999).

6.3 ­Mechanisms of Photosynthesis Regulation under Metal Stress Many factors may influence acclimation and regulation of photosynthesis under metal stress, including metal concentrations, stress duration, plant growth stage, variation in plant species (plant tolerance to metal stress), etc. Some plant species or cultivars are more tolerant to metal stress than others. Such plant species have greater ability to exclude metals, restrict root to shoot metal translocation and sequester metals, thus protecting photosynthesis. Photosynthetic response to metal stress is multifaceted. Regulation of photosynthesis under metal stress may be achieved through effective ROS scavenging, signal transduction, induction of antioxidants, modifying transport pathways, metal sequestration and detoxification. These mechanisms from a metal stress perspective are discussed in detail in the later sections. 6.3.1  Cell Signaling and Growth Hormones Sensing stress‐induced signals and devising a coordinated response against heavy metal stress may be the first strategy in the regulation of photosynthesis in plants. Same receptors may perceive different signals or different signals may submerge in

99

100

6  Regulation of Photosynthesis Under Metal Stress

downstream signal pathways. Some important signaling molecules, involved in photosynthesis regulation under metal stress, are H2O2, plastoquinone, ferredoxin, and growth hormones such as ABA, ethylene (C2H4), and nitric oxide (NO). It is well known that ROS production and ROS scavenging are balanced in the chloroplasts under normal conditions. Upon heavy metal encounter, an existing ROS pool activates the antioxidant defense system and stimulates gene expression in plants. Chloroplasts produce significant amounts of H2O2 that performs signaling activity under abiotic stress. It interacts with thiol‐possessing proteins, cell signaling pathways and some transcription factors to regulate expression of genes. An increase in H2O2 concentration under different heavy metal stresses has been reported in many previous studies (Ali et al. 2014; Khan et al. 2016; Mei et al. 2015). Its rate of production depends on metal type and stress duration. The specific role of H2O2, in regulating stress responses, is dependent on its interaction with other growth hormones like indole acetic acid (IAA), ABA, NO, ­ethylene, etc (Ireneusz Ślesak 2007). Phytohormones play roles in regulation of photosynthesis under abiotic stress, inducted by internal or external stimuli. To subside Cd stress in ethylene sensitive and insensitive cultivars of B. juncea, external S application increased its levels in plant tissues and improved photosynthesis (Asgher et al. 2014). In a study of a similar nature, gibberellic acid combined application with S improved photosynthesis in B. juncea (Masood et al. 2016). Abscisic acid biosynthesis is induced under different abiotic stresses (Tuteja 2007; Vishwakarma et al. 2017). ABA synthesis can occur in the leaves and triggers sugar transport to the guard cells. Evidence exists for increased soluble sugars levels in response to metal stresses. A study conducted on Cd‐stressed rice seedlings revealed that ABA levels were increased in Oryza sativa L. leaves (Hsu and Kao 2003). In another comparative study, Cr toxicity triggered more endogenous contents of ABA than Cu in radish seedlings (Choudhary 2010). Ethylene is a volatile phytohormone involved in the regulation of photosynthesis under stress conditions. Nitric oxide (NO), in the form of peroxynitrite, is a non‐toxic signaling molecule in chloroplasts. It is stored as nitrosoglutatione, a product formed as a result of NO interaction with other thiols. Although NO has improved metabolic enzymes in plants, its external application may reduce ascorbate content under Cd stress (Laspina et al. 2005). GSH and α‐tocopherol play important roles in plan protection against abiotic stresses. Previous research has demonstrated that 5 μM Cd decreased GSH and α‐tocopherol contents in K. ­virginica, a wetland halophyte (Han et al. 2013). 6.3.2  Avoiding and Scavenging Reactive Oxygen Species Excess photons, due to non‐utilization, cause ROS production in chloroplasts, putting plant cells at greater risk of oxidative damage. Decreased inflow of CO2 to chloroplasts due to metal stress, as reported previously, causes a decline in NADP levels. NADP has the important role of receiving electrons from PSI. The unaccepted electrons produce ROS. It is estimated that 80 mM S−1 hydrogen peroxide and 160 mM S−1 superoxide is produced in plant cells under normal conditions, but as low as 10 mM S−1 hydrogen peroxide can restrict C fixation by 50%, emphasizing effective ROS scavenging. Avoiding and scavenging are two important mechanisms to cope with ROS. In the first instance, excess excitation energy is dissipated by non‐photochemical quenching to avoid ROS formation. In the second instance, ROS are scavenged by antioxidant enzymes, low molecular weight antioxidants, carotenoids, and tocopherols (Hajiboland 2014).

6.3  Mechanisms of Photosynthesis Regulation

Reduced GSH and ascorbic acid (AsA) are the most abundant antioxidants in the chloroplasts that scavenge H2O2. Reduced glutathione and AsA both work independently to scavenge ROS; however, the GSH‐AsA cycle and the water‐water cycle are the best examples of their joint scavenging of ROS. Metal stress in plants causes lipid peroxidation in cellular membranes including chloroplasts. Some fat‐soluble antioxidants like carotenoids and tocopherols minimize lipid peroxidation. Reduced ascorbic acid, formed in the AsA‐GSH cycle, scavenges O2− and peroxy radicals. 6.3.3  Interconversion of Chlorophylls Biosynthesis of adequate amounts of chlorophylls ensures regulated photosynthesis in plants under different environmental conditions. Previous research has shown that interconversion of chlorophylls i.e. Chl a and Chl b in the chlorophyll cycle has a significant effect on chlorophylls quantification in A. thaliana (Meguro et al. 2011). Further, the chemical structure of chlorophylls has revealed that Chl a has a methyl group and Chl b has formyl group on the B ring. Chlorophyll a leads to biosynthesis of Chl b when the methyl group is oxidized to formyl. Similarly, Chl b, through an intermediate product: 7‐hydroxymethyl chlorophyllide, is reconverted to Chl a. This interconversion of Chl a into Chl b maintains optimum levels of the later which is helpful in stabilizing light harvesting complexes. However, interconversion of chlorophylls under different metal stresses is still unstudied. 6.3.4  Role of Alleviatory Agents in Photosynthesis Regulation To subside metal‐induced damage in photosynthetic machinery, several alleviatory agents have been tested to date. In an earlier study, 50 μM GSH recovered photosynthesis in Pb‐stressed G. hirsutum (Khan et al. 2016). Nitric oxide, provided as nitroprusside, successfully alleviated Cu‐toxicity in tomato and recovered chlorophyll pigments, stomatal conductance, and net photosynthesis (Wang et al. 2015). Sulfur (S), provided as SO42− (1 mM), augmented net photosynthesis rate and Rubisco activity in ethylene sensitive B. juncea under 50 μM Cd stress (Asgher et al. 2014). Moreover, reduced glutathione and cysteine were increased while a differential response for antioxidant enzymes was observed. Exogenous application of ABA increased its indigenous levels in rice leaves and enhanced plant tolerance to Cd stress (Hsu and Kao 2003). Exogenously‐applied ethylene increased Rubisco activity and improved net photosynthesis rate in B. juncea treated with elevated levels of Ni and Zn (Khan and Khan 2014). IAA is an important growth hormone in plants and has been involved in regulation of abiotic stresses. A study conducted on Solanum melongena L. revealed that 3 mg kg−1 and 9 mg kg−1 Cd had adverse effects on photosynthesis rate and chlorophyll fluorescence, which were effectively alleviated by external application of IAA (Singh and Prasad 2015). Similarly, exogenous application of NO modulated SOD and CAT activities in Cd‐affected sunflower leaves and decreased ascorbate contents but there was no significant effect on GR and POD (Laspina et al. 2005). In B. juncea, the external supply of jasmonate and IAA regulated 300 μM As stress (Srivastava et al. 2012). Salts such as sodium chloride (NaCl) are generally detrimental to tropical plants, however, its application in Cd stress, reduced oxidative stress in K. virginica, a wetland halophyte, by

101

102

6  Regulation of Photosynthesis Under Metal Stress

improving the electron transport chain, maximum quantum yield, and contents of GSH, α‐tocopherol, and AsA (Han et al. 2013). 6.3.5  Photosynthesis Regulation Through Overexpression of Genes Gene expression profiling, coupled with traditional physiological investigations, has enabled better understanding of stress‐related effects on plants and the devising of alleviating strategies in metal‐stressed plants. Although, photosynthesis related genes are least affected by metal stresses, improving plant tolerance through overexpressing such genes may be a good strategy to enhance the plant’s photosynthetic capacity. This has been achieved through overexpression of genes encoding ascorbate peroxidase (APX), SOD, GR, and dehydroascorbate in chloroplasts. Overexpression of APX, bound to thylakoid membranes, enhanced Nicotiana tabacum L. and A. thaliana tolerance to oxidative stress. In chloroplasts, ascorbate peroxidases may be inactivated by ROS, however, they may facilitate the signaling role of ROS under stress conditions. Overexpression of Cu/Zn SOD in transgenic A. thaliana reduced H2O2 and O2 generation and improved the plant’s ability to tolerate oversupplied Cd (Li et al. 2017). Similarly, in N. tabacum, CAT improved plant tolerance to photooxidative stress. The ATPase family of metal transporting genes has roles in the detoxification of metals which have resulted in the regulation of photosynthesis. Restricted Zn translocation to plastids, under AtHMA1, a metal transporter gene, has regulated photosynthesis in A. thaliana (Kim et  al. 2009). Similarly, OsHMA2, a mutated transporter gene, restricted Zn and Cd translocation to shoots in rice (Satoh‐ Nagasawa et  al. 2012). Further, HvHMA1 is involved in adjusting Cu and Zn levels in chloroplasts in barley (Mikkelsen et al. 2012). The introduction of desaturase genes into the plant’s genome has helped in protecting PSII complex under low temperature stress (Gopalakrishnan Nair et al. 2009; Kanervo et al. 1997). However, the role of desaturase genes in genetically engineered plants is yet to be elucidated in heavy metal stress.

6.4 ­Conclusions Metals in excess, whether essential or non‐essential, are detrimental to photosynthesis in many plant species. Non‐essential metals such as Cd, Pb, Cr, Hg, etc. induce excess ROS generation, stimulate cell signals, delay or inhibit activation of photosynthetic enzymes, affect transport of CO2 and essential metals, bring hormonal changes, and alter leaves morphologically and structurally. Photosynthesis regulation is very complex and needs investigation and with regards to metal‐specific effects on various regulatory mechanisms, further research is needed in various plant species.

­References Ainsworth, E.A. and Rogers, A. (2007). The response of photosynthesis and stomatal conductance to rising [CO2]: mechanisms and environmental interactions. Plant Cell Environ. 30: 258–270. https://doi.org/10.1111/j.1365‐3040.2007.01641.x. Ali, B., Qian, P., Jin, R. et al. (2014). Physiological and ultra‐structural changes in Brassica napus seedlings induced by cadmium stress. Biol. Plant. 58: 131–138.

­  References

Asgher, M., Khan, N.A., Khan, M.I.R. et al. (2014). Ethylene production is associated with alleviation of cadmium‐induced oxidative stress by sulfur in mustard types differing in ethylene sensitivity. Ecotoxicol. Environ. Saf. 106: 54–61. https://doi.org/10.1016/j. ecoenv.2014.04.017. Atici, Ö., Ağar, G., and Battal, P. (2005). Changes in phytohormone contents in chickpea seeds germinating under lead or zinc stress. Biol. Plant. 49: 215–222. https://doi. org/10.1007/s10535‐005‐5222‐9. Chandra, R. and Kang, H. (2016). Mixed heavy metal stress on photosynthesis, transpiration rate, and chlorophyll content in poplar hybrids. Forest Sci. Technol. 12: 55–61. https://doi.org/10.1080/21580103.2015.1044024. Chen, W.W., Yang, J.L., Qin, C. et al. (2010). Nitric oxide acts downstream of Auxin to trigger root ferric‐chelate Reductase activity in response to iron deficiency in Arabidopsis. Plant Physiol. 154: 810–819. https://doi.org/10.1104/pp.110.161109. Choudhary, S.P., Bhardwaj, R., Gupta, B. et al. (2010). Changes induced by Cu2+ and Cr6+ metal stress in polyamines, auxins, abscisic acid titers and antioxidative enzymes activities of radish seedlings. Braz. J. Plant Physiol. 22: 263–270. Chugh, L.K. and Sawhney, S.K. (1999). Photosynthetic activities of Pisum sativum seedlings grown in presence of cadmium. Plant Physiol. Biochem. 37: 297–303. https:// doi.org/10.1016/S0981‐9428(99)80028‐X. Crafts‐Brandner, S.J. and Salvucci, M.E. (2000). Rubisco activase constrains the photosynthetic potential of leaves at high temperature and CO(2). Proc. Natl. Acad. Sci. U.S.A. 97: 13430–13435. Daud, M.K., Ali, S., Variath, M.T., and Zhu, S.J. (2013). Differential physiological, ultramorphological and metabolic responses of cotton cultivars under cadmium stress. Chemosphere 93: 2593–2602. https://doi.org/10.1016/j. chemosphere.2013.09.082. Daud, M.K., Quiling, H., Lei, M. et al. (2015). Ultrastructural, metabolic and proteomic changes in leaves of upland cotton in response to cadmium stress. Chemosphere 120: 309–320. https://doi.org/10.1016/j.chemosphere.2014.07.060. Daud, M.K. et al. (2016). Leaf‐based physiological, metabolic, and ultrastructural changes in cultivated cotton cultivars under cadmium stress mediated by glutathione. Environ. Sci. Poll. Res. 23: 15551–15564. https://doi.org/10.1007/s11356‐016‐6739‐5. Gangwar, S., Singh, V.P., Tripathi, D.K. et al. (2014). Chapter 10 – Plant responses to metal stress: the emerging role of plant growth hormones in toxicity alleviation. In: Emerging Technologies and Management of Crop Stress Tolerance (ed. P. Ahmad and S. Rasool), 215–248. San Diego: Academic Press https://doi.org/10.1016/ B978‐0‐12‐800875‐1.00010‐7. Gopalakrishnan Nair, P.M., Kang, I.‐S., Moon, B.‐Y., and Lee, C.‐H. (2009). Effects of low temperature stress on rice (Oryza sativa L.) plastid ω‐3 desaturase gene, OsFAD8 and its functional analysis using T‐DNA mutants plant cell. Plant Cell Tissue Org Cult. 98: 87–96. https://doi.org/10.1007/s11240‐009‐9541‐y. Hajiboland, R. (2014). Chapter 1 – Reactive oxygen species and photosynthesis. In: Oxidative Damage to Plants (ed. P. Ahmad), 1–63. San Diego: Academic Press https:// doi.org/10.1016/B978‐0‐12‐799963‐0.00001‐0. Han, R.‐M. et al. (2013). Antioxidant enzyme activities and hormonal status in response to cd stress in the wetland halophyte Kosteletzkya virginica under saline conditions. Physiol. Plant. 147: 352–368. https://doi.org/10.1111/j.1399‐3054.2012.01667.x.

103

104

6  Regulation of Photosynthesis Under Metal Stress

Hsu, Y.T. and Kao, C.H. (2003). Role of abscisic acid in cadmium tolerance of rice (Oryza sativa L.) seedlings. Plant Cell Environ. 26: 867–874. https://doi.org/10.1046/j.1365‐3040. 2003.01018.x. Ireneusz Ślesak, M.L., Karpinska, B., Karpinski, S., and Miszalski, Z. (2007). The role of hydrogen peroxide in regulation of plant metabolism and cellular signalling in response to environmental stresses. Acta Biochem. Pol. 54: 39–50. Kanervo, E., Tasaka, Y., Murata, N., and Aro, E.M. (1997). Membrane lipid unsaturation modulates processing of the photosystem II reaction‐Center protein D1 at low temperatures. Plant Physiol. 114: 841–849. https://doi.org/10.1104/pp.114.3.841. Khan, M. et al. (2016). Alleviation of lead‐induced physiological, metabolic, and ultramorphological changes in leaves of upland cotton through glutathione. Environ. Sci. Poll. Res. 23: 8431–8440. https://doi.org/10.1007/s11356‐015‐5959‐4. Khan, M. et al. (2018). Trace elements in abiotic stress tolerance. In: Plant Nutrients and Abiotic Stress Tolerance (ed. M. Hasanuzzaman, M. Fujita, H. Oku, et al.), 137–151. Singapore: Springer Singapore https://doi.org/10.1007/978‐981‐10‐9044‐8_5. Khan, M.I.R. and Khan, N.A. (2014). Ethylene reverses photosynthetic inhibition by nickel and zinc in mustard through changes in PS II activity, photosynthetic nitrogen use efficiency, and antioxidant metabolism. Protoplasma 251: 1007–1019. https://doi. org/10.1007/s00709‐014‐0610‐7. Kim, Y.‐Y., Choi, H., Segami, S. et al. (2009). AtHMA1 contributes to the detoxification of excess Zn(II) in Arabidopsis. Plant J. 58: 737–753. https://doi. org/10.1111/j.1365‐313X.2009.03818.x. Laspina, N.V., Groppa, M.D., Tomaro, M.L., and Benavides, M.P. (2005). Nitric oxide protects sunflower leaves against Cd‐induced oxidative stress. Plant Sci. 169: 323–330. https://doi.org/10.1016/j.plantsci.2005.02.007. Lee, K.R. and Roh, K.S. (2003). Influence of cadmium on rubisco activation inCanavalia ensiformis L. leaves. Biotechnol. Bioprocess Eng. 8: 94. https://doi.org/10.1007/ bf02940263. Li, Z. et al. (2017). Overexpressing the sedum alfredii cu/Zn superoxide dismutase increased resistance to oxidative stress in transgenic Arabidopsis. Front. Plant Sci. 8: 1010. https://doi.org/10.3389/fpls.2017.01010. Masood, A., Khan, M.I.R., Fatma, M. et al. (2016). Involvement of ethylene in gibberellic acid‐induced sulfur assimilation, photosynthetic responses, and alleviation of cadmium stress in mustard. Plant Physiol. Biochem. 104: 1–10. https://doi.org/10.1016/j. plaphy.2016.03.017. Meguro, M., Ito, H., Takabayashi, A. et al. (2011). Identification of the 7‐Hydroxymethyl chlorophyll a reductase of the chlorophyll cycle in Arabidopsis. Plant Cell 23: 3442– 3453. https://doi.org/10.1105/tpc.111.089714. Mei, L., Daud, M.K., Ullah, N. et al. (2015). Pretreatment with salicylic acid and ascorbic acid significantly mitigate oxidative stress induced by copper in cotton genotypes. Environ. Sci. Pollut. Res. 22: 9922–9931. https://doi.org/10.1007/s11356‐015‐4075‐9. Mikkelsen, M.D. et al. (2012). Barley HvHMA1 is a heavy metal pump involved in mobilizing organellar Zn and Cu and plays a role in metal loading into grains. PLoS One 7: e49027. https://doi.org/10.1371/journal.pone.0049027. Pietrini, F., Iannelli, M.A., Pasqualini, S., and Massacci, A. (2003). Interaction of cadmium with glutathione and photosynthesis in developing leaves and chloroplasts of Phragmites

­  References

australis (Cav.) Trin. ex Steudel. Plant Physiol. 133: 829–837. https://doi.org/10.1104/ pp.103.026518. Sagardoy, R. et al. (2010). Stomatal and mesophyll conductances to CO2 are the main limitations to photosynthesis in sugar beet (Beta vulgaris) plants grown with excess zinc. New Phytol. 187: 145–158. https://doi.org/10.1111/j.1469‐8137.2010.03241.x. Sahu, G.K., Upadhyay, S., and Sahoo, B.B. (2012). Mercury induced phytotoxicity and oxidative stress in wheat (Triticum aestivum L.) plants. Physiol. Mol. Biol Plants 18: 21–31. https://doi.org/10.1007/s12298‐011‐0090‐6. Satoh‐Nagasawa, N. et al. (2012). Mutations in rice (Oryza sativa) heavy metal ATPase 2 (OsHMA2) restrict the translocation of zinc and cadmium. Plant Cell Physiol. 53: 213–224. https://doi.org/10.1093/pcp/pcr166. Singh, S. and Prasad, S.M. (2015). IAA alleviates Cd toxicity on growth, photosynthesis and oxidative damages in eggplant seedlings. Plant Growth Regul. 77: 87–98. https://doi. org/10.1007/s10725‐015‐0039‐9. Srivastava, S., Srivastava, A., Penna, S., and D’Souza, S. (2012). Identification and profiling of arsenic stress‐induced microRNAs in Brassica juncea. J. Exp. Bot. 64: https://doi. org/10.1093/jxb/ers333. Subrahmanyam, D. (2008). Effects of chromium toxicity on leaf photosynthetic characteristics and oxidative changes in wheat (Triticum aestivum L.). Photosynthetica 46: 339. https://doi.org/10.1007/s11099‐008‐0062‐4. Tuteja, N. (2007). Abscisic acid and abiotic stress Signaling. Plant Signal. Behav. 2: 135–138. Ventrella, A., Catucci, L., Piletska, E., and Piletsky, S. (2009). Agostiano A, Interactions between heavy metals and photosynthetic materials studied by optical techniques. Bioelectrochemistry 77: 19–25. https://doi.org/10.1016/j.bioelechem.2009.05.002. Vernay, P., Gauthier‐Moussard, C., Jean, L. et al. (2008). Effect of chromium species on phytochemical and physiological parameters in Datura innoxia. Chemosphere 72: 763–771. https://doi.org/10.1016/j.chemosphere.2008.03.018. Vishwakarma, K. et al. (2017). Abscisic acid Signaling and abiotic stress tolerance in plants: a review on current knowledge and future prospects. Front. Plant Sci. 8. https://doi. org/10.3389/fpls.2017.00161. Wang, L., Yang, X., Ren, Z. et al. (2015). Alleviation of photosynthetic inhibition in copper‐stressed tomatoes through rebalance ion content by exogenous nitric oxide. Turk. J. Bot. 39: 10–22. Yruela, I. (2013). Transition metals in plant photosynthesis. Metallomics 5: 1090–1109. https://doi.org/10.1039/C3MT00086A. Zhang, X., Li, M., Yang, H. et al. (2018). Physiological responses of Suaeda glauca and Arabidopsis thaliana in phytoremediation of heavy metals. J. Environ. Manage. 223: 132–139. https://doi.org/10.1016/j.jenvman.2018.06.025.

105

107

7 Heavy Metals and Photosynthesis: Recent Developments Zahra Souri1, Amanda A. Cardoso2, Cristiane J. da‐Silva3, Letúzia M. de Oliveira4, Biswanath Dari5, Debjani Sihi6, and Naser Karimi1 1

Laboratory of Plant Physiology, Department of Biology, Faculty of Science, Razi University, Kermanshah, Iran Department of Botany and Plant Pathology, Purdue Center for Plant Biology, Purdue University, West Lafayette, IN, USA 3 Departamento de Botânica, Instituto de Biologia, Universidade Federal de Pelotas, Pelotas, RS, Brazil 4 Soil and Water Science Department, University of Florida, Gainesville, FL, USA 5 Aberdeen Research and Extension Center, University of Idaho, Aberdeen, ID, USA 6 Environmental Sciences Division, Oak Ridge National Laboratory, Bethel Valley Rd, Oak Ridge, TN, USA 2

7.1 ­Introduction With the increasing urbanization, industrialization, and technology development, the contamination of the environment with toxic heavy metals has been extensively observed worldwide (Jia et  al. 2018), declining the quality of soils, atmosphere, and waterways, as well as threatening the health of animals and human (Tume et al. 2018; Jia et al. 2018). Heavy metals and metalloids such as arsenic (As) and antimony (Sb) are common environmental pollutants that are naturally found in soils and aquatic environments. Anthropogenic sources (traffic emissions, industrial discharges, and municipal wastes), however, can considerably increase their concentration in the environment. As, Sb, aluminum (Al), cadmium (Cd), chromium (Cr), copper (Cu), lead (Pb), manganese (Mn), mercury (Hg), nickel (Ni), and zinc (Zn) are commonly found at contaminated sites (Kabata‐Pendias 2010). These metals can decrease crop productivity and increase the risk of bioaccumulation and biomagnification in the food chain. There is a also risk of superficial and groundwater contamination. Human activities such as atmospheric deposition, mining, manufacturing, and the use of synthetic products (pesticides, paints, batteries, industrial waste, and land application of industrial or domestic sludge) can result in heavy metal contamination of urban and agricultural soils (Wuana and Okieimen 2011). Contaminated soils with heavy metals may also occur from traffic emissions, industrial discharges, municipal wastes, and from old orchards that used insecticides containing As as the active ingredient (USEPA 2000). Unlike organic contaminants which are oxidized to carbon (IV) oxide by microbial action, most metals do not undergo microbial or chemical degradation (Kirpichtchikova et  al. 2006; Wuana and Okieimen 2011), and they can only be transformed into less toxic species (Ojuederie and Babalola 2017). Given their inability Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

108

7  Heavy Metals and Photosynthesis

to degrade naturally (with the exception of Hg and selenium (Se), which can be transformed and volatilized by microorganisms), metals can persist in soils for a long time after their introduction (USEPA 2000; Adriano 2001). The levels of heavy metals in the environment have increased beyond the recommended limit, being detrimental to all life forms. The maximum permissible limit of As, Cd, Cr, Pb, Sb, and Hg in water, as stated by the Environmental Protection Agency (EPA), is 10, 5, 100, 15, 6, 2, and 0.05 μg l−1 respectively (USEPA 2009). Decontamination of heavy metals from contaminated environments can occur in situ or ex situ. In situ decontamination occurs when the contaminated soil or water are treated in their original place of occurrence, while ex situ decontamination occurs when the contaminated soil or water are removed from their original place. Containment remedies involve the construction of vertical engineered barriers, caps, and liners used to prevent the migration of contaminants (USEPA 2007; Wuana and Okieimen 2011). However, both technologies require a huge capital cost. Phytoremediation is a green, low cost, environmentally friendly, and effective method for decontamination of heavy metals from polluted areas without creating any destructive effect in the soil structure, compared to remediation strategies involving excavation/removal or chemical in situ conversion. This green technology has been broadly subdivided into different categories such as phytostabilization, phytodegradation/phytovolatilization, and phytoextraction/phytoaccumulation (Fayiga and Saha 2016; Souri et al. 2017) (Figure 7.1). Amongst these technologies, phytoextraction has been extensively studied as a mechanism to clean up metal pollutants from contaminated soils through their absorption by roots and subsequent translocation to the above‐ground

Phytoextraction M

M

Phytovolatilization M

M

M

M Metals before treatment

Phytodegradation

M Metals after treatment M

M

M

M

M M

M

Metals

M

M

M M

Phytostabilization

Water Figure 7.1  Techniques of phytoremediation and alternative destinations of the heavy metals. (See color plate section for the color representation of this figure.)

7.2  Heavy Metals and Hyperaccumulation

parts of plants (Souri et al. 2017). Exploring and selecting stabilizers and accumulators, or even hyperaccumulators, for heavy metals is a key step for successful phytoremediation. Metal (hyper)accumulating plants have long been observed to accumulate and tolerate unusually high concentrations of heavy metals in their tissue (Figure 7.1) (Jia et al. 2018). Accumulators of Ni, for example, may contain as much as 5% Ni on a dry‐ weight basis. Extracting metals from soil and accumulating them in the above‐ground plant tissues enables plants to be used as part of a soil cleanup technology. For example, plants accumulating metals at the above‐mentioned 5% dry‐weight concentration (50 000 mg kg−1) from a soil with a total metal concentration of 5000 mg kg−1 results in a 10‐fold bioaccumulation factor (Terry and Banuelos 1999). The metal‐rich plant material can be swathed, collected, and removed from the site using established agricultural practices, without the extensive excavation and loss of topsoil associated with traditional remediation processes. Heavy metal toxicity has the potential to affect the photosynthetic process, growth, and development of plants in a species‐specific manner. The adaptive responses of hyperaccumulator or hypertolerant plants to heavy metal‐contaminated environments comprise an efficient process that includes many physiological, molecular, genetic, and ecological traits. These traits give certain species the ability to tolerate or even hyperaccumulate toxic metals. Regarding sensitive plant species, heavy metals adversely affect them both directly and indirectly. Some of the direct toxic effects caused by high metal concentration include inhibition of cytoplasmic enzymes and damage to cell structures due to oxidative stress (Assche and Clijsters 1990; Djingova and Kuleff 2000). The indirect toxic effect is the replacement of essential nutrients at cation exchange sites of plants (Taiz and Zeiger 2002). Photosynthetic functions have been invariably affected either directly or indirectly by heavy metals. Heavy metals react with the photosynthetic apparatus at various levels of organization and architecture: (i) accumulation of metals in the leaf (main photosynthetic organ), (ii) partitioning in leaf tissues and cells like stomata, mesophyll, and bundle sheath, (iii) metal interaction with cytosolic enzymes and organics, (iv) alteration of chloroplast membranes, and (v) photosystems (PS) I and II (Prasad and Strzałka 1999).

7.2 ­Heavy Metals and Hyperaccumulation Remediation of hazardous heavy metals in soils is often harder than its identification because of its colorless and odorless nature. From a wide range survey on heavy metal contamination, Wood (1974) reported that the complete remediation of heavy metals from a contaminated soil may take up to100–200 years. Thus, it incurs a relatively higher cost and longer duration of remediation cycles. One such method of remediating soils contaminated with heavy metals is phytoremediation, other than engineering and/or chemical remediation. Among various bioremediation processes, phytoremediation is the most effective, safe, and efficient solution for remediating soils contaminated by various heavy metals worldwide, (Chaney et  al. 2007; Akhtar et  al. 2013; Aruna et al. 2015; van der Ent et al. 2015) which involves remediation with the help of green plants. The plants commonly named as hyperaccumulator are characterized with 100–1000 of times greater accumulation of a particular or multiple heavy metal(s)

109

110

7  Heavy Metals and Photosynthesis

or metalloid(s) in their plant cells than normal plants (Reeves 2003; Mahar et al. 2016; Reeves et al. 2018). Phytoextraction, the most common procedure for phytoremediation of any plant or crop species, which absorbs the heavy metals from the soils by the root of plants (i.e. hyperaccumulator) and accumulate (by precipitation technique) in the above ground plant parts. This is not common for many plants, in fact, only a few hyperaccumulator plants have this ability to phytoextract. However, the hyperaccumulation brings into other limitations for the respective plant growing into the soil such as bioavailability of metals within the root zone, greater uptake of metals by roots, higher fixation of metals in soils, increased xylem loading to plant shoot, etc. In general, the limitation of using a hyperaccumulator for phytoremediation may include (i) often, the hyperaccumulator plants are limited by their growth and biomass, (ii) the hyperaccumulator plants are not good to grow in heavily contaminated soils due to lower growth rate. 7.2.1  Characteristics of Hyperaccumulator Plants The contribution of a particular metal is important when a hyperaccumulator plant grows in highly contaminated soil and the concentration of that metal crosses a particular limit (i.e. threshold limit; Table 7.1). Thus, this criterion of threshold limit in the concentration of heavy metal accumulation provides useful guidance in identifying the characteristics and physiological behavior of hyperaccumulator plants (van der Ent et al. 2015). However, the critical issue with the above situation is a hyperaccumulator plant can grow in a wide range of soil, weather, and climatic regions and thus, treat a variety of heavy metal contamination (Table 7.2). There are hyperaccumulators listed as Table 7.1  Threshold concentration of heavy metals in hyperaccumulator plants and availability of respective hyperaccumulator plant species in the world as per current data. Heavy metals

Symbol of metals a

Concentration (mg kg−1)

Number of species that exist a

Gold Silver

Au Ag

41

4 NA

Cadmium Selenium Tantalum

Cd Se Ta

4100

1 20 NA

Copper Cobalt Chromium Nickel Lead Uranium Arsenic

Cu Co Cr Ni Pb U As

41 000

34 30 NA >320 14 NA NA

Manganese Zinc

Mn Zn

410 000

10 11

a) The symbols of metals and number of species are indicated in the order as mentioned in the order of the list of heavy metals in the first column of this table. NA: not available.

112

7  Heavy Metals and Photosynthesis

“obligate,” which is characterized by growing only in metalliferous soils and reported to show contamination with only certain heavy metals (Pollard et al. 2002). Among obligate hyperaccumulators, the most widespread plants are considered as “obligatory,” which are grown in metalliferous soils, whereas the “facultative” ones originate from non‐metalliferous soils which are often reported to show enormous accumulation of certain metals (Pollard et al. 2014). 7.2.2  Hyperaccumulation and Photosynthesis The most important physiological processes affected in the hyperaccumulator plants is photosynthesis, which has significance implications on the behavior of the plants. The disturbances in the photosynthesis processes induce various types of toxicity in plants and such disturbances may incur changes in some physiological processes such as photodisrupting nutrients and water uptake, and transport, altering nitrogen metabolism, disrupting the activity of ATPase, interfering with plant growth, causing plant photosynthetic machinery in chloroplasts to dysfunction, and causing stomatal closure (Khalid et al. 2017). However, the role of these plants in determining the efficiency of these physiological processes is under consideration due to lack of rigid background information available from any published reports e.g. mechanism of Ni hyperaccumulation from the Berkheya coddii species (Asteraceae) and Thlaspi and Alyssum genera (Brassicaceae) (Keeling et al. 2003). Photosynthesis is an important plant physiological processes within the plant and defines lots of properties in hyperaccumulator plants. For example, for the heavy metal Ni, a hyperaccumulator not only absorbs it largely but that element actively enters the xylem system of the plant and improves photosynthesis and effective transpiration. Thus, heavy metals are highly concentrated in the above‐ground parts of the plant compared to other parts, e.g. Ni. Certain plants can be very efficient in accumulation and tolerance of heavy metals e.g. Pteris vittata species and Isatis cappadocica species (belonging to the Brassicaceae family) are examples for As (Karimi et al. 2009; Karimi and Souri 2015; Souri et al. 2017). The main tolerance strategy of I. cappadocica species to As is achieved by increasing thiol e.g. either synthesis of cysteine (Cys), glutathione (GSH), or phytochelatins (PCs) or chelation of GSH and PCs (Karimi et al. 2009; Souri et al. 2017). It has also been suggested that As‐hyperaccumulator plants such as I. cappadocica species and P. vittata species, employ different tolerance mechanisms that prevent the negative effects of As e.g. the generation of reactive oxygen species (ROS), as by‐products of photosynthesis, and thus prevent the negative effects of ROS on photosynthesis apparatus. The enhancement of the antioxidant enzymes’ activities and antioxidant compounds content are generally increased correspondingly for scavenging ROS in hyperaccumulator plants, subjected to As stress (Souri et al. 2017; Tiwari and Sarangi 2017; Souri et al. 2018). The various heavy metals accumulate in various plant parts depending on the distribution of photosynthates e.g. Ni, As, etc. are highly concentrated in epidermal cells’ vacuoles. Thus, appropriate technological progress in measurement techniques e.g. spectroscopic, colorimetric, chromatographic, etc. must be adopted to better understand the physiological aspects of hyperaccumulation to record fate and transport of heavy metals within hyperaccumulator plants. Therefore, changing the harvest time of crops to modify the crop growth cycle might be beneficial to alter photosynthetic cycles in the plant, thus, hyperaccumulation.

7.3  Heavy Metals and Chloroplast Structure

7.3 ­Heavy Metals and Chloroplast Structure Biochemical and physiological dysfunctions in plants challenged by heavy metals are generally associated with plant structural and ultrastructural modifications. For instance, photosynthetic disturbance induced by heavy metal exposure can arise from the disruption of chloroplast ultrastructure (Barceló et al. 1988; Rocchetta et al. 2007), among other causes (Parmar et  al. 2013). The effects of heavy metals on chloroplast ultrastructure might be adverse including chloroplasts being totally damaged due to the overdose of metals (Baszyńki et al. 1980; Barceló et al. 1988; Jin et al. 2008; Xu et al. 2010; Basile et al. 2012). In this part of the chapter, we explore the main modifications in the chloroplast ultrastructure induced by heavy metals and present a table ­summarizing the ultrastructure alterations in the chloroplasts resulting from different heavy metals across a number of species (Table 7.3). Table 7.3  Main alterations in chloroplast structure caused by different heavy metals across a diversity of plant species. Alterations in chloroplast structure Heavy metal

Shape‐altered chloroplast

Ag (Xu et al. 2010), Cd (Barceló et al. 1988; Jin et al. 2008; Basile et al. 2012), Cu (Sánchez‐Pardo et al. 2014), Pb (Basile et al. 2012; Semenova et al. 2017), Ni (Molas 2002), Zn (Basile et al. 2012).

Plant species

Brassica oleracea (Molas 2002), Glycine max (Sánchez‐Pardo et al. 2014), Phaseolus vulgaris (Barceló et al. 1988), Potamogeton crispus (Xu et al. 2010), Sedum alfredii H. (Jin et al. 2008), Scorpiurum circinatum Brid. (Basile et al. 2012), Triticum aestivum (Semenova et al. 2017).

Reduced chloroplast size Cd (Jin et al. 2008; Ying et al. 2010; Wang et al. 2011), Cu (Sánchez‐Pardo et al. 2014), Ni (Molas 2002), Pb (Semenova et al. 2017).

Brassica oleracea (Molas 2002), Hordeum vulgare (Wang et al. 2011), Lupinus albus L. (Sánchez‐ Pardo et al. 2014), Picris divaricate (Ying et al. 2010), Sedum alfredii (Jin et al. 2008), Triticum aestivum (Semenova et al. 2017).

Reduced chloroplast number

Cd (Wang et al. 2011), Cu (Sánchez‐ Pardo et al. 2014).

Hordeum vulgare (Wang et al. 2011), Lupinus albus (Sánchez‐ Pardo et al. 2014).

Reduced grana number

Cd (Ying et al. 2010; Wang et al. 2011), Cu (Sánchez‐Pardo et al. 2014), Ni (Molas 2002).

Brassica oleracea (Molas 2002), Glycine max (Sánchez‐Pardo et al. 2014), Hordeum vulgare (Wang et al. 2011), Picris divaricate Vant. (Ying et al. 2010).

Reduced thylakoids per granum

Cu (Sánchez‐Pardo et al. 2014), Ni (Molas 2002), Pb (Semenova et al. 2017).

Brassica oleracea (Molas 2002), Glycine max (Sánchez‐Pardo et al. 2014), Triticum aestivum (Semenova et al. 2017). (Continued)

113

114

7  Heavy Metals and Photosynthesis

Table 5.3  (Continued) Alterations in chloroplast structure Heavy metal

Plant species

Disorganized thylakoid structure

Ag (Xu et al. 2010), Cd (Barceló et al. 1988; Jin et al. 2008; Wang et al. 2011; Basile et al. 2012), Cu (Sánchez‐Pardo et al. 2014), Pb (Basile et al. 2012; Semenova et al. 2017), Zn (Basile et al. 2012).

Glycine max (Sánchez‐Pardo et al. 2014), Hordeum vulgare (Wang et al. 2011), Lupinus albus (Sánchez‐Pardo et al. 2014), Phaseolus vulgaris (Barceló et al. 1988), Potamogeton crispus (Xu et al. 2010), Scorpiurum circinatum (Basile et al. 2012), Sedum alfredii (Jin et al. 2008), Triticum aestivum (Semenova et al. 2017).

Increased number and size of plastoglobuli

Cd (Barceló et al. 1988; Jin et al. 2008; Ying et al. 2010; Wang et al. 2011), Cu (Sánchez‐Pardo et al. 2014), Pb (Basile et al. 2012), Ni (Molas 2002).

Brassica oleracea (Molas 2002), Glycine max (Sánchez‐Pardo et al. 2014), Hordeum vulgare (Wang et al. 2011), Phaseolus vulgaris (Barceló et al. 1988), Picris divaricate (Ying et al. 2010), Scorpiurum circinatum (Basile et al. 2012), Sedum alfredii (Jin et al. 2008).

Damaged chloroplast membrane

Ag (Xu et al. 2010), Cd (Barceló et al. 1988), Cu (Sánchez‐Pardo et al. 2014).

Glycine max (Sánchez‐Pardo et al. 2014), Phaseolus vulgaris (Barceló et al. 1988), Potamogeton crispus L. (Xu et al. 2010).

Many studies indicate the adverse effects of heavy metals in altering the chloroplast ultrastructure in both higher plants and algae (Baszyńki et al. 1980; Rocchetta et al. 2007; Najeeb et al. 2011). The outcome of this structural disturbance results in the modification in chloroplast number (reduction in number), chloroplast size (becomes smaller), and chloroplast thylakoid organization (Sandalio et al. 2001; Jin et al. 2008; Ying et al. 2010; Wang et  al. 2011). Such responses and their interference with photosynthetic activities along with chloroplast replication are common for certain plant species such as barley, pea, and wheat (Baryla et al. 2001; Sandalio et al. 2001; Wang et al. 2011; Semenova et al. 2017). Plants exposed to heavy metal contaminated soils experience a reduction in the number of grana and a disorganized thylakoid system (Jin et al. 2008; Ying et al. 2010; Wang et al. 2011). Further, numerous and large plastoglobuli are usually found within chloroplasts indicating plant stress (Molas 2002; Jin et al. 2008; Ying et al. 2010; Wang et al. 2011). Finally, damaged chloroplast membranes can be found under acute stress (Barceló et al. 1988). Although a large number of studies regarding ultrastructural changes in the chloroplast were performed using Cd, there are several studies testing other heavy metals such as silver (Ag), Cu, Ni, Pb, and Zn (Molas 2002; Xu et al. 2010; Basile et al. 2012; Basile et al. 2012; Sánchez‐Pardo et al. 2014; Semenova et al. 2017). The symptoms of heavy metal exposure on the chloroplast ultrastructure can differ among the different metals, and they can be found summarized in Table 7.3.

7.5  Heavy Metals and Photosynthetic Pigments

7.4 ­Heavy Metals and Gas‐Exchange Restriction in photosynthesis activities incurs not only biochemical inhibition but also a reduction in the stomatal and mesophyll conductance to CO2 (Flexas et  al. 2008). Plants which are exposed more to environments contaminated with heavy metals have higher stomatal resistance, decreased transpiration rate (E), and altered water relations (Bazzaz et al. 1974). Bean (Phaseolus vulgaris L.) plants under toxic levels of As exhibit decreased E, stomatal conductance (Gs), and net photosynthetic rate (Pn), resulting in low Pn/E ratio (Stoeva et al. 2005). Similar patterns of gas exchange occurred for lettuce (Gusman et al. 2013) and for oat (Avena sativa L.) (Stoeva and Bineva 2003). A decreased rate of gas exchange has been observed with an increased concentration of Al in the plants (Peixoto et al. 2002; Yang et al. 2015; Anjum et al. 2016). Indeed, in an experiment using a nutritive solution containing Al, it was noticed that Pn decreased in the presence of the metal in Citrus limonia Osbeck, Citrus volkameriana Pasq., Citrus reshni Osbeck, and Citrus sunki Hort. Gs was not significantly affected in C. limonia and C. volkameriana seedlings, but it was increased by the Al in C. reshni and C. sunki seedlings. The intracellular CO2 concentration (Ci) increased significantly in all seedlings with the increase in the Al concentration. However, this increase did not result in higher Pn values, possibly due to the structural damage in thylakoids triggered by Al (Pereira et al. 2000). To that end, the plant gaseous exchange has been influenced by various factors/ mechanisms based on available literature e.g. Hg plays an important role in gas exchange processes. Thus, Hg‐sensitive aquaporins facilitate CO2 diffusion across the plasma membrane of the mesophyll cells (Terashima and Ono 2002). It has also been shown that the leaves from Vicia faba L. plants reduce the conductance in CO2 diffusion from the intercellular spaces to the chloroplast stroma which is again facilitated by the presence of Hg (a known aquaporin inhibitor). An increase in the external Cu, accompanied by a decrease in gas exchange was observed in Vitis vinifera, although Ci increased in high concentrations of Cu (Cambrollé et al. 2015). Other related gas exchange parameters, further, reported being decreased, noticeably under Cd, Pb, Cr, and Zn stress (Rodriguez et al. 2015; Farooq et al. 2016; Wang et al. 2016a, b). The information regarding the combined effects of heavy metals, their toxicity, and environmental pollution in real field conditions are scant. The only information available is the effect of heavy metal contamination in photosynthetic processes in plants and how it impacts the gaseous exchange in various plant parts/cells (Moya et al. 1993; Anjum et al. 2017; Rizwan et al. 2018).

7.5 ­Heavy Metals and Photosynthetic Pigments Light absorption is the first step allowing plants to photosynthesize, and two major classes of photosynthetic pigments are responsible for capturing light in higher plants, i.e. chlorophylls and carotenoids. Chlorophylls are greenish pigments primarily responsible for the light collection and consist of a tetrapyrrole ring with Mg2+ present as a central atom and a phytol side chain as a hydrophobic membrane anchor (Heldt and Piechulla 2010). Carotenoids are red, orange or yellow pigments that absorb light and pass their energy to chlorophylls (Rowan 1989). Both classes of pigments are important

115

116

7  Heavy Metals and Photosynthesis

for photosynthesis, and if they are anyhow damaged, photosynthesis is observed to be negatively affected. For instance, the content of photosynthetic pigments across a large variety of species has long been observed to decline in response to heavy metals (Barceló et al. 1988; Kaur et al. 2018 ), lowering the photosynthetic performance of these plants. Particularly for chlorophylls, reduced levels of this molecule in response to metal stress seem to be, among others, a result of a considerable inhibition of chlorophyll biosynthesis (Xue et  al. 2013), with several reactions of the chlorophyll biosynthetic pathway being impaired (Figure 7.2). Chlorophyll biosynthesis relies on the amount of a crucial precursor, i.e. δ‐aminolevulinate (ALA), in plastids. The synthesis of ALA occurs by the reduction of glutamate and is the rate‐limiting and regulatory step of chlorophyll biosynthesis (Parmar et al. 2013). This rate‐limiting step has been demonstrated to be negatively affected by several heavy metals such as Mn, Ni, Cd, Cobalt (Co), and Pb (Myśliwa‐Kurdziel and Strzałka 2002). A further step in chlorophyll biosynthesis that has also been demonstrated to be affected by heavy metals (e.g. Al, Cd, Hg, Pb, Se) is the condensation of two molecules of ALA, catalyzed by the enzyme δ‐aminolevulinate dehydratase, to form porphobilinogen, a precursor for the synthesis of tetrapyrroles (Myśliwa‐Kurdziel and Strzałka 2002; Pereira et al. 2006; Skrebsky et al. 2008; Gupta et al. 2013). The next step, from porphobilinogen to uroporphyrinogen III, catalyzed by porphobilinogen deaminase and uroporphyrinogen III synthase, has also been shown to be harmed by heavy metals such as Co, Fe, Mn, Ni (Myśliwa‐Kurdziel and Strzałka 2002). Further down, the Mg2+ insertion into protoporphyrin IX, catalyzed Glutamate Heavy metal

δ-Aminolevulinate δ–Aminolevulinate dehydratase

Heavy metal

Porphobilinogen Porphobilinogen deaminase Heavy metal

Uroporphyrinogen synthase

Uroporphyrinogen III

Protoporphyrin IX Heavy metal

Mg2+

Magnesium chelatase

Mg-Protoporphyrin IX Heavy metal

Chlorophyllide

Chloroplast Chlorophyll

Figure 7.2  Heavy metals impair several steps of chlorophyll biosynthesis. (See color plate section for the color representation of this figure.)

7.6  Heavy Metals and Photosystems

by magnesium chelatase, has been demonstrated to be inhibited by Co, Mn, and Se (Myśliwa‐Kurdziel and Strzałka 2002). Finally, the two following reactions, i.e. from Mg‐protoporphyrin IX to protochlorophyllide and from protochlorophyllide to chlorophyllide, have been shown to be impaired by Cd, Cr, Fe, Mn, Se (Myśliwa‐Kurdziel and Strzałka 2002). In addition, chlorophyll function can be impaired through the substitution of the Mg2+ ion in the chlorophyll molecule via toxic heavy metals e.g. Zn, Cu, Cd, or Hg (Küpper et al. 1996, 1998). Most heavy‐metal‐substituted chlorophylls are unsuitable for photosynthesis due to their unstable excitation state, which interferes with the resonance energy transference from the antenna pigment complexes to the reaction centers (Karukstis 1991). Metal‐substituted chlorophylls also present lower capacity, when compared to regular chlorophylls, to release electrons from the singlet excited state (Watanabe et  al. 1985). Thus, the formation of heavy‐metal‐substituted chlorophylls can lead to a complete breakdown of the photosynthetic electron transport chain and hence the whole photosynthetic process itself (Küpper et al. 1996). While a high number of studies demonstrates the effect of heavy metals on chlorophyll molecules, the influence of metals on carotenoid content is far less studied (Kaur et al. 2018), and results showing the response of carotenoid content in plants challenged by heavy metals do not exhibit a consistent pattern. Most of the studies demonstrate that carotenoid levels decline in response to heavy metals. Some studies, however, observe increments in the carotenoid content (Parmar et al. 2013; Kaur et  al. 2018) because of a higher carotenoid biosynthesis (Soudek et  al. 2011). The increment in the carotenoid levels would be positive for the plant tolerance to heavy metals, given the activity of carotenoids as antioxidant molecules (El‐Agamey et al. 2004; Gratão et al. 2005), however, it does not seem to occur for most cases (Kaur et al. 2018).

7.6 ­Heavy Metals and Photosystems (PSI and PSII) The solar energy conversion into chemical energy is catalyzed through two multi‐­ subunit membrane protein complexes, e.g. PSI and PSII, both are susceptible to the toxic effects of heavy metals (Figure 7.3). PSI as a membrane‐bound protein complex catalyzes the oxidation of plastocyanin and the reduction of ferredoxin under light conditions (Nelson and Yocum 2006) (Figure 7.3). The main inhibitory sites in PSI are reaction center, ferredoxin‐NADP+ reductase, and iron‐sulfur centers (Kaur et  al. 2018). PSII is defined as a multi‐subunit pigment–protein complex with the enzymatic activity of light‐dependent water‐oxidizing plastoquinone reductase (Nelson and Junge 2015) (Figure 7.3). PSII is very sensitive to various pollutants and the entire photosynthetic apparatus can be affected by heavy metals (Kaur et al. 2018). In general, heavy metals disturb the function of oxygen‐evolving complexes and damage the proteins of this complex on the donor and PSII acceptor sides, the QB (quinone B) binding side, and the Pheo‐Fe‐QA (pheophytin‐iron‐quinone A), leading to a reduction in the PSII quantum yield (Mohanty et  al. 1989; Tanyolaç et  al. 2007; Karimi et  al. 2013). The decline of photochemical activities in PSII was mostly demonstrated to be accompanied via a change of thylakoid membranes (Mohanty et  al. 1989; Lidon et  al. 1993; Tanyolaç et al. 2007).

117

Stroma nH+

Heavy metals ADP + Pi hv

hv

NADP+

2H+

H+

ATP

NADPH

FNR

Cyt b6f PQ

PSII

PSI P700

P680 PQH2

e

e

e

ATP Synthase

Fd D2

D1

OEC 2H+

H 2O

½

PC

O2+ 2H+

Thylakoid lumen

Heavy metals

Figure 7.3  Overview of the light‐dependent reactions of photosynthesis. The photosynthetic system of water photolysis involving manganese stabilizing protein (OEC); the reaction center of PSII (P680); PSII proteins (D1 and D2); the oxidized and reduced plastoquinone pools (PQ and PQH); plastocyanin (PC); the reaction center of PSI (P700); ferredoxin (Fd); ferredoxin NADP+ oxidoreductase (FNR); ATP Synthase. Dotted lines show the pathways of electron and proton transport. Red lines show the effect of heavy metals on the light‐dependent reactions of photosynthesis. See insert for color representation of this figure. (See color plate section for the color representation of this figure.)

7.6  Heavy Metals and Photosystems

Photoinhibition triggered by Al occurs on both the donor and the PSII acceptor sides (Jiang et  al. 2008; Moustaka et  al. 2016). Plants of Citrus grandis L. treated with Al present photoinhibition at PSII sites and reduced quantum yield of electron transport chain from Quinone A (QA) to PSI (Jiang et al. 2008). On the other hand, Al‐induced closure of PSII reaction center decreased the ratio of oxidized to reduced QA and attenuated quantum yield and PSII excitation pressure in Triticum aestivum L. (Moustaka et al. 2016). Furthermore, oxygen evolution was strongly inhibited in barley (Hordeum vulgare L.) treated with Al (Bernier et al. 1993) (Figure 7.3). As exposure decreased the quantum yield of primary photochemistry, the quantum yield of electron transport and the yield of electron transport per trapped excitation, while decreased the performance index of PSII in Solanum melongena L. seedlings (Singh et al. 2015). The As treatment also decreased the maximum quantum yield of PSII in soybean (Glycine max (L.) Merr.) plants (Piršelová et al. 2016). Interestingly, it has been reported that the quantum efficiency of PSII appeared to be unaffected by As treatment in two species of As‐hyperaccumulators, Pteris cretica L. and I. cappadocica (Hong Bin et al. 2012; Karimi et al. 2013). Cd interfered with electron transport through PSI reducing side. The treatment of isolated chloroplasts from 21 days old maize seedlings with Cd decreased ferredoxin‐ dependent NADP+ photoreduction. The decrease in electron transport related with a low ferredoxin content is due to the low Fe uptake, induced by Cd (Siedlecka and BaszyńAski 1993). Furthermore, Cd inhibits electron transfer from redox‐active tyrosine (Tyr) residues D1‐161 in maize (Wang et al. 2009). The Cd decreased the maximum quantum yield of PSII in soybean plants (Piršelová et al. 2016) and impaired PSI and PSII activities in Lactuca sativa L. and in Schima superba Gardner and Champ (Dias et al. 2013; Chu et al. 2018). Cr affects PSII more pronouncedly in isolated chloroplasts in pea (Pisum sativum L.) (Bishnoi et al. 1993). Nevertheless, in whole plants, both the photosystems were affected. The inhibitory effect of Cr is located at two sites e.g. the oxygen‐evolving complex and QA reduction. Those Cr inhibitory effects were associated with the alteration of the turnover of D1 protein (in PSII) and the alteration of 24 and 33 kDa proteins of the oxygen‐evolving complex (Ali et al. 2006) (Figure 7.3). The Cr toxicity also declines the number of active reaction centers of PSII, decreases the rate of electron transport, and changes antenna size heterogeneity of PSII (Mathur et al. 2016). Cu is an important constituent of PSII. Nevertheless, the high levels of Cu inhibit photosynthetic electron transport, especially in PSII (Barón et al. 1995). Cu disturbed the fluorescence parameters and triggered a reduction in the pool of the final PSI electron acceptors; a decline in the total number of electron carriers per reaction center; and a decline in the parameters correlated to the flow, yield, and efficiency for the reduction of the final PSI acceptor. Accordingly, Cu decreased the total photosynthetic performance index in Alternanthera tenella Cotta. plants (Cuchiara et al. 2013). Pb toxicity also influences both PSII and PSI activity. However, it is largely accepted that PSI electron transport is less sensitive to inhibition by Pb than PSII. The Pb2+ accumulated in PSII and damaged its secondary structure, diminished the absorbance of visible light, inhibited energy transfer among amino acids within the PSII protein–pigment complex, and also decreased energy transport from tyrosine residue to chlorophyll in Spirodela polyrrhiza (L.) Schleid. plants (Qufei and Fashui 2009). In spinach (Spinacia oleracea L.), Pb2+ blocked the electron transport between plastocyanin and

119

120

7  Heavy Metals and Photosynthesis

P700, besides limiting the electron transport on the PSI donor site (Belatik et al. 2013) (Figure 7.3). Increasing levels of Hg decreased the quantum yield and electron transport of PSI and PSII, whereas it increased the limitation of the donor site in the aquatic plant Microsorum pteropus (Blume) Copel. (Deng et al. 2013). Zn disturbs the water‐oxidizing complex owing to the local competition between Zn2+ and Mn2+ on the water splitting of PSII and replacement of Mn2+ by Zn2+ (Dasgupta et al. 2008). Thus, Zn stress decreased PSII efficiency (Sagardoy et al. 2009).

7.7 ­Heavy Metals and Key Photosynthetic Enzymes Metal toxicity has long been claimed to affect the photosynthetic machinery of plants by disrupting the structure and function of photosynthetic enzymes (Aggarwal et al. 2012). Energy‐dependent enzymes, especially those involved in the carbon fixation pathway often provide targeted sites for heavy metal interaction. Deleterious effects of heavy metals on photosynthetic enzymes are generally associated with suppression of photosynthetic proteins, alteration of protein metabolism, replacement of essential cations from specific binding sites, and associated nutrient imbalance (DalCorso et al. 2013). Similar to mostly abiotic stresses, heavy metals cause stress through stomata closure resulting in a lower content of intercellular CO2, that in sequence causes deactivation of Rubisco as a key enzyme of the Calvin cycle, sucrosephosphate synthase (SPS), nitrate reductase, and as well as a decrease in the activities of δ‐aminolevulinic acid dehydratase (ALAD) and ferredoxin NADP+ reductase at the origin of chlorophyll synthesis inhibition (Chaves et al. 2009; Gupta et al. 2009; Mumm et al. 2011). Rubisco (ribulose‐1,5‐bisphosphate (RuBP) carboxylase/oxygenase), the most abundant protein in plant cells, is an enzyme which catalyzes the CO2 fixation reaction on photosynthesis forming phosphoglycerate (PGA) with the reaction of RuBP and CO2 (Parry et al. 2003). In addition, Rubisco catalyzes photorespiration forming phosphoglycolate and PGA from the reaction with O2 (Parry et al. 2003; Brini 2017). During stressful conditions such as heavy metal stress, fructose‐1,6‐bisphosphatase (FBPase) has been suggested as one of the principle enzymes that is able to decrease photosynthetic activity because it is involved in the regeneration of the Rubisco substrate, RuBP (Brini 2017). Strong binding affinities of metals to sulfhydryl (i.e. SH groups), the fundamental component of protein structure, have been most frequently reported to inactivate photosynthetic enzymes under heavy metal stress (Figure  7.4) (De Filippis and Pallaghy 1994). For instance, several studies suggested the role of SH interaction with Pb (Hampp et al. 1973), As (Singh et al. 2016), Zn (Assche and Clijsters 1983), Cu (Lidon et al. 1993), and Cd (Ernst et al. 2008; DalCorso et al. 2013) on inhibiting the activities of the Calvin cycle enzymes including RuBPC (EC # 4.1.1.39), PGA kinase (EC# 2.7.2.3.), glyceraldehyde phosphate dehydrogenase (1.2.1.13), phosphoribulokinase (EC # 2.7.1.18), and phosphofructokinase (EC # 2.7.1.11). Interaction with the essential cysteine residue of the Calvin cycle enzymes, particularly RuBPC, can also inhibit chloroplast metabolism (Siborova 1988). Furthermore, two main metal‐sensitive sites at the photosynthetic electron transport chain have been identified from in vitro experiments: (i) the NADPH

7.8  Heavy Metals and Antioxidant Defense Metal ions Metal SH

Active enzymes

SH

Active site

Covalent bond formation

S

S

Inactive enzymes

+ 2H+

Modified active site

Figure 7.4  Interaction of heavy‐metals with sulfhydryl (SH) group of enzymes. Above cartoon demonstrates how a divalent metal cation (e.g. Hg2+, Pb2+, Cu2+, As2+, and Cd2+) acts as a non‐ competitive inhibitor of photosynthetic enzymes. Source: Adapted from I Webster, available at http://slideplayer.com/slide/6281587# (See color plate section for the color representation of this figure.)

oxidoreductase at the reducing side of PSI and (ii) the water‐splitting enzymes at the oxidizing side of PSII (De Filippis et  al. 1981; Vangronsveld and Clijsters 1994). However, PSII has been proposed to be more sensitive to heavy metal stress than PSI (Clijsters and Van Assche 1985). To that end, Szalontai et al. (1999) also confirmed this assumption by demonstrating molecular rearrangements of thylakoids, where PSII machinery is situated, after heavy metal poisoning using spectroscopic techniques. Decrease of photosynthetic pigments via heavy metals are also known to indirectly affect photosynthesis (Chandra and Kang 2016). Within this context, metal toxicity has long been claimed to inhibit chlorophyll biosynthesis. Particularly two key enzymes of the chlorophyll biosynthetic pathway, protochlorophyllide reductase (EC # 1.3.1.33) and ALAD (EC # 4.2.1.24) are known to be sensitive to different heavy metals (Vallee and Ulmer 1972; Vangronsveld and Clijsters 1994). Inhibition of the activity of protochlorophyllide reductase, which catalyzes the final reductive step of chlorophyll biosynthesis, was further confirmed by a noticeable increase of protochlorophyllide concentrations in media containing sublethal concentrations of Zn, Cd, and Hg (De Filippis and Pallaghy 1976; De Filippis et al. 1981). Metal‐sensitive photosynthetic reactions are also known to cause induction of enzymes related to stress‐metabolism (Assche and Clijsters 1990). In support of this, peroxidase and several other enzymes of the intermediary metabolism are often stimulated to compensate for the oxidative reactions at the bio‐membrane. Thus, enzymes related to oxidative stress could serve as a proxy for evaluating the physiological response of plants such as photosynthesis to heavy metal toxicity.

7.8 ­Heavy Metals and Antioxidant Defense Mechanism of the Photosynthetic System Generally, heavy metals can induce the production of ROS and subsequently create oxidative stress, which can adversely affect photosynthesis. During light reactions, ROS are produced in chloroplasts within the electron transport chains of PSI and PSII, their

121

122

7  Heavy Metals and Photosynthesis

production is increased during stress, when ATP (adenosine triphosphate) synthesis is impaired and CO2 is limited (Nishiyama and Murata 2014; Gururani et  al. 2015). Furthermore, ROS are able to cause irreversible damage to photosynthetic components (Romero‐Puertas et al. 2004; Foyer and Shigeoka 2011). Moreover, heavy metals inactivate some enzymes through a high affinity with the thiol group and it forms active oxygen such as the superoxide anion (O2−), hydrogen peroxide (H2O2), and the hydroxyl radical (OH−) together with lipid peroxide, causing damage to photosynthetic processes via induction of oxidative stress (Romero‐Puertas et  al. 2004; Mendoza‐Cozatl et  al. 2005; Son et al. 2014). Most of the heavy metals are able to inhibit electron transport from pheophytin through plastoquinone QA and Fe to plastoquinone QB by altering the carrier’s structure (Figure 7.3), e.g. plastoquinone QB, or the reaction center proteins (Mohanty et al. 1989; Krupa and Baszynski 1995). On the other hand, heavy metal ions diminish the contents of cytochromes b6f, plastocyanin, and ferredoxin; as a result, the efficiency of electron transport during photosynthesis was lowered (Veeranjaneyulu and Das 1982; Seregin and Kozhevnikova 2006). Heavy metals inhibit photosynthetic processes via limiting the use of NADPH and ATP in the Calvin cycle, and also induce overproduction of ROS severely damaging the macromolecules, nucleic acids, and chloroplast pigments and membranes through lipid peroxidation (Vassilev and Yordanov 1997; Tewari et al. 2002; Rai et al. 2014; Roach and Krieger‐Liszkay 2014; Shahid et al. 2014; Karimi and Souri 2016). Several studies has shown that during heavy metals stress, ROS production can exceed the potential of the plant’s defense mechanisms, an imbalance in intracellular ROS content is well known and this results in oxidative stress (Mishra et  al. 2007; Štolfa et  al. 2015; Karimi and Souri 2016; Souri et al. 2018). Nevertheless, plants are equipped with an antioxidant system (including integral enzymatic and non‐enzymatic antioxidant production) to scavenge ROS (Ahmad et al. 2010; Foyer and Shigeoka 2011; Sharma et al. 2011; Yang et al. 2016). The action of heavy metals is accompanied by accumulation of ROS, which disturbs the balance and increases oxidative stress (Tripathy and Oelmüller 2012; Štolfa et al. 2015). When oxidative stress is not controlled by antioxidants, it could induce chlorophyll degradation, inhibition of chlorophyll biosynthesis, damage of PSII, and inactivate many chloroplast enzymes in surviving plants (Dekov et al. 2000; Papadakis et al. 2004; Souza et al. 2004; Karimi et al. 2013). Finally, increased oxidative stress results in drastically depressed PSII activity, and also electron transport, and a significant decrease in photosynthesis capacity (Karimi et al. 2013). Heavy metal tolerance in plants is associated with photosynthetic efficiency and the potential of antioxidant system (Souza et al. 2004; Mobin and Khan 2007; Tanyolaç et  al. 2007; Gupta et  al. 2009; Yadav 2010; Zhang et  al. 2015; Singh et  al. 2016). Therefore, maintaining a high level of antioxidant system and increasing photosynthesis are vital for plants to survive under heavy metal stress (Zhang et al. 2015). It has been indicated that the activation of the cellular antioxidative metabolism belongs to the general stress responses induced through heavy metals (Cuypers et  al. 2011). Plants cope with oxidative stress via using an antioxidant defense system including enzymes e.g. ascorbate peroxidase (APX, EC 1.11.1.11), catalase (CAT, 1.11.1.6), glutathione peroxidase (GPX, EC 1.11.1.9), glutathione reductase (GR, EC 1.6.4.2),

7.9  Conclusion and Further Prospects

peroxidase (POD, EC 1.11.1.7), and superoxide dismutase (SOD EC 1.15.1.1), and non‐enzymatic antioxidants such as ascorbic acid (AsA), and GSH (Mittler et al. 2004, 2011; Kumar et al. 2012; Sytar et al. 2013). In chloroplasts, the non‐enzymatic antioxidants are intermediates of the ascorbate–glutathione cycle (AGC), which plays an important role in the H2O2 scavenging pathway (Sytar et  al. 2013) (Figure  7.5). In heavy metal stress responses, there is a key role for AGC, and the importance of antioxidant responses in the AGC action and its involvement in conveying heavy metal stress have been underscored (Paradiso et al. 2008; Jozefczak et al. 2012; Shen et al. 2012; Karimi and Souri 2016; Souri et al. 2018). As shown in Figure  7.5, the AGC is composed of four enzymes namely, APX, mono‐dehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR) and GR, and two antioxidants e.g. AsA and GSH (Pandey et al. 2015). O2− is generated, when more electrons are released in the electron transport chain than the electron‐consuming capacity of the Calvin cycle (Gururani et  al. 2015). Before AGC begins SOD is a main scavenger of O2−, which is converted into oxygen and H2O2 (Alscher et al. 2002). In the first step of AGC, APX reduces H2O2 using ASC as an electron donor. Following this step, oxidized ascorbate is subsequently reduced via GSH produced from oxidized glutathione (GSSG) catalyzed through GR (at the expense of NADPH) (Pandey et al. 2015). In general, ASC is used as a substrate for APX, which catalyzes the detoxification of H2O2. Ascorbate oxidation resulting in mono‐dehydroascorbate (MDHA), which is generally converted to ASC via MDHAR (Figure 7.5). MDHA, unless quickly reduced via MDHAR, disproportionately transforms non‐enzymatically to ASC and dehydroascorbate (DHA), which is reduced spontaneously to ASC by DHAR (Nehnevajova et al. 2012; Pandey et al. 2015). GSSG is then reduced via GR, and the AGC cycle continues again (Chamseddine et  al. 2009; Nehnevajova et al. 2012).

7.9 ­Conclusion and Further Prospects The present chapter summarizes the toxicity effects of heavy metals and metalloids on plant photosynthetic performance mediated by stomatal or non‐stomatal limitations. Heavy metals/metalloids can negatively affect the activities of several photosynthetic enzymes, and lead to impairment of photosynthetic pigment biosynthesis and photosystems activity. In addition, heavy metals are able to down‐ or up‐­regulate different genes involved in photosynthesis processes. Therefore, it is important to understand the physiological, biochemical, and molecular mechanisms of plant photosynthesis in response to heavy metal stress in order to develop transgenic lines of various crops with improved photosynthetic potential under heavy metal stress. The complete explanation of several factors involved in the regulation of photosynthetic processes and its capacity under heavy metal stress and the advancement in different field areas such as metabolomics, proteomics, and transcriptomics have opened the way, at the molecular level, for the characterization of transcription factors and stress‐inducible proteins responsible for heavy metals/ metalloids tolerance.

123

SOD O2–

H2O2

ASC APX

H2O

MDHAR MDHA

NADPH

GSSG GR

DHAR DHA

GSH

NADP

Figure 7.5  The ascorbate‐glutathione cycle (AGC). Non‐enzymatic compounds: ascorbate (ASC), monodehydroascorbate (MDHA), dehydroascorbate (DHA), glutathione reduced (GSH), glutathione oxidized (GSSG). Enzymes: ascorbate peroxidase (APX), glutathione reductase (GR), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR).

­  References

­References Adriano, D.C. (2001). Trace Elements in Terrestrial Environments: Biogeochemistry, Bioavailability, and Risk of Metals, 866. Springer. Aggarwal, A., Sharma, I., Tripathi, B.N. et al. (2012). Metal toxicity and photosynthesis. In: Photosynthesis: Overviews on Recent Progress and Future Perspectives, 229–236. New Delhi: IK International Publishing House. Ahmad, P., Jaleel, C.A., Salem, M.A. et al. (2010). Roles of enzymatic and nonenzymatic antioxidants in plants during abiotic stress. Crit. Rev. Biotechnol. 30 (3): 161–175. Akhtar, M.S., Chali, B., and Azam, T. (2013). Bioremediation of arsenic and lead by plants and microbes from contaminated soil. Res. Plant Sci. 1: 68–73. Ali, N.A., Dewez, D., Didur, O., and Popovic, R. (2006). Inhibition of photosystem II photochemistry by Cr is caused by the alteration of both D1 protein and oxygen evolving complex. Photosynth. Res. 89 (2–3): 81–87. Alscher, R.G., Erturk, N., and Heath, L.S. (2002). Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 53: 1331–1341. Anjum, S.A., Ashraf, U., Khan, I. et al. (2016). Aluminum and chromium toxicity in maize: implications for agronomic attributes, net photosynthesis, physio‐biochemical oscillations, and metal accumulation in different plant parts. Water Air Soil Pollut. 227 (9): 326. Anjum, S.A., Tanveer, M., Hussain, S. et al. (2017). Alteration in growth, leaf gas exchange, and photosynthetic pigments of maize plants under combined cadmium and arsenic stress. Water Air Soil Pollut. 228 (1): 13. Aruna, J., Naga, B., and Rao, M. (2015). Remediation of heavy metal contaminated soils. Int. J. Innovative Res. Sci. Eng. Technol. 4: 5891–5895. Assche, F.V. and Clijsters, H. (1983). Multiple effects of heavy metal toxicity on photosynthesis. In: Effects of Stress on Photosynthesis. Advances in Agricultural Biotechnology, vol 3 (ed. R. Marcelle, H. Clijsters and M. van Poucke), 371–382. Dordrecht: Springer. Assche, F.V. and Clijsters, H. (1990). Effects of metals on enzyme activity in plants. Plant Cell Environ. 13 (3): 195–206. Assuncao, A.G.L., Schat, H., and Aarts, M.G.M. (2003). Thlaspi caerulescens, an attractive model species to study heavy metal hyperaccumulation in plants. New Phytol. 159: 351–360. Babst‐Kostecka, A.A., Waldmann, P., Fr_erot, H., and Vollenweider, P. (2016). Plant adaptation to metal polluted environments – physiological, morphological, and evolutionary insights from Biscutella laevigata. Environ. Exp. Bot. 127: 1–13. Baker, A.J.M. and Brooks, R.R. (1989). Terrestrial higher plants which hyperaccumulate metallic elements. Biorecovery 1: 81–126. Barceló, J., Vazquez, M.D., and Poschenrieder, C. (1988). Structural and ultrastructural disorders in cadmium‐treated bush bean plants (Phaseolus vulgaris L.). New Phytol. 108 (1): 37–49. Barón, M., Arellano, J.B., and Gorgé, J.L. (1995). Copper and photosystem II: a controversial relationship. Physiol. Plant. 94 (1): 174–180. Baryla, A., Carrier, P., Franck, F. et al. (2001). Leaf chlorosis in oilseed rape plants (Brassica napus) grown on cadmium‐polluted soil: causes and consequences for photosynthesis and growth. Planta 212 (5–6): 696–709.

125

126

7  Heavy Metals and Photosynthesis

Basile, A., Sorbo, S., Pisani, T. et al. (2012). Bioaccumulation and ultrastructural effects of Cd, Cu, Pb and Zn in the moss Scorpiurum circinatum (Brid.) Fleisch. & Loeske. Environ. Pollut. 166: 208–211. Baszyńki, T., Wajda, L., Krol, M. et al. (1980). Photosynthetic activities of cadmium‐treated tomato plants. Physiol. Plant. 48 (3): 365–370. Bazzaz, F.A., Carlson, R.W., and Rolfe, G.L. (1974). The effect of heavy metals on plants: part I. Inhibition of gas exchange in sunflower by Pb, Cd, Ni and Tl. Environ. Pollut. (1970) 7 (4): 241–246. Belatik, A., Hotchandani, S., Tajmir‐Riahi, H.A., and Carpentier, R. (2013). Alteration of the structure and function of photosystem I by Pb2+. J. Photochem. Photobiol., B 123: 41–47. Bernier, M., Popovic, R., and Carpentier, R. (1993). Mercury inhibition at the donor side of photosystem II is reversed by chloride. FEBS Lett. 321 (1): 19–23. Bishnoi, N.R., Chugh, L.K., and Sawhney, S.K. (1993). Effect of chromium on photosynthesis, respiration and nitrogen fixation in pea (Pisum sativum L.) seedlings. J. Plant Physiol. 142 (1): 25–30. Brini, F. (2017). Photosynthesis under stressful environmental conditions: existing challenges. In: Environment and Photosynthesis: A Future Prospect (ed. S. Singh), 68–91. USA: Studium Press (Pvt.), Limited a Joint venture of Studium Press. Cambrollé, J., García, J.L., Figueroa, M.E., and Cantos, M. (2015). Evaluating wild grapevine tolerance to copper toxicity. Chemosphere 120: 171–178. Chamseddine, M., Wided, B.A., Guy, H. et al. (2009). Cadmium and copper induction of oxidative stress and antioxidative response in tomato (Solanum lycopersicon) leaves. Plant Growth Regul 57: 89–99. Chandra, R. and Kang, H. (2016). Mixed heavy metal stress on photosynthesis, transpiration rate, and chlorophyll content in poplar hybrids. For. Sci. Technol. 12 (2): 55–61. Chaney, R.L., Angle, J.S., Broadhurst, C.L. et al. (2007). Improved understanding of hyperaccumulation yields commercial phytoextraction and phytomining technologies. J. Environ. Qual. 36: 1429–1443. Chaves, M.M., Flexas, J., and Pinheiro, C. (2009). Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Ann. Bot. 103: 551–560. Chu, J., Zhu, F., Chen, X. et al. (2018). Effects of cadmium on photosynthesis of Schima superba young plant detected by chlorophyll fluorescence. Environ. Sci. Pollut. Res. 25: 10679–10687. Clijsters, H.V. and Van Assche, F. (1985). Inhibition of photosynthesis by heavy metals. Photosynth. Res. 7 (1): 31–40. Cuchiara, C.C., Silva, I.M.C., Martinazzo, E.G. et al. (2013). Chlorophyll fluorescence transient analysis in Alternanthera tenella Colla plants grown in nutrient solution with different concentrations of copper. J. Agri. Sci. 5 (8): 8. Cuypers, A., Smeets, K., Ruytinx, J. et al. (2011). The cellular redox state as a modulator in cadmium and copper responses in Arabidopsis thaliana seedlings. J. Plant Physiol. 168 (4): 309–316. DalCorso, G., Manara, A., and Furini, A. (2013). An overview of heavy metal challenge in plants: from roots to shoots. Metallomics 5 (9): 1117–1132. Dasgupta, J., Ananyev, G.M., and Dismukes, G.C. (2008). Photoassembly of the water‐ oxidizing complex in photosystem II. Coord. Chem. Rev. 252 (3–4): 347–360.

­  References

De Filippis, L.F. and Pallaghy, C.K. (1976). The effect a sublethal concentration of mercury and zinc on Chlorella. I. Growth characteristic and uptake of metals. Z. Pflanzenphysiol. 78: 197–207. De Filippis, L.F. and Pallaghy, C.K. (1994). Heavy metals: sources and biological effects. In: Algae and Water Pollution (ed. L.C. Rai, J.P. Gaur and C.J. Soeder), 31–77. Stuttgart: E. Schweizerbart’sche, Verlagsbuchhandlung. De Filippis, L.F., Hampp, R., and Ziegler, H. (1981). The effect of sub‐lethal concentration of zinc, cadmium and mercury on Euglena II. Respiration, photosynthesis and photochemical activities. Arch. Microbiol. 128: 407–411. Dekov, I., Tsonev, T., and Yordanov, I. (2000). Effects of water stress and high temperature stress on the structure and activity of photosynthetic apparatus of Zea mays and Helianthus annuus. Photosynthetica 38: 361–366. Deng, C., Zhang, D., Pan, X. et al. (2013). Toxic effects of mercury on PSI and PSII activities, membrane potential and transthylakoid proton gradient in Microsorium pteropus. J. Photochem. Photobiol., B 127: 1–7. van der Ent, A., Baker, A.J.M., Reeves, R.D. et al. (2015). Agromining: farming for metals in the future? Environ. Sci. Technol. 49: 4773–4780. Dias, M.C., Monteiro, C., Moutinho‐Pereira, J. et al. (2013). Cadmium toxicity affects photosynthesis and plant growth at different levels. Acta Physiol. Plant. 35 (4): 1281–1289. Djingova, R. and Kuleff, I. (2000). Instrumental techniques for trace analysis. In: Trace Elements: Their Distribution and Effects in the Environment, 12e (ed. J.P. Vernet), 137–185. London, UK: Elsevier. El‐Agamey, A., Lowe, G.M., McGarvey, D.J. et al. (2004). Carotenoid radical chemistry and antioxidant/pro‐oxidant properties. Arch. Biochem. Biophys. 430: 37–48. Ernst, W.H., Krauss, G.J., Verkleij, J.A., and Wesenberg, D. (2008). Interaction of heavy metals with the sulphur metabolism in angiosperms from an ecological point of view. Plant Cell Environ. 31 (1): 123–143. Farooq, M.A., Ali, S., Hameed, A. et al. (2016). Cadmium stress in cotton seedlings: physiological, photosynthesis and oxidative damages alleviated by glycinebetaine. S. Afr. J. Bot. 104: 61–68. Faucon, M.‐P., Shutcha, M.N., and Meerts, P. (2007). Revisiting copper and cobalt concentrations in supposed hyperaccumulators from SC Africa: influence of washing and metal concentrations in soil. Plant Soil 301: 29–36. Fayiga, A.O. and Saha, K.U. (2016). Arsenic hyperaccumulating fern: implications for remediation of arsenic contaminated soils. Geoderma 284: 132–143. Flexas, J., Ribas‐Carbo, M., Diaz‐Espejo, A. et al. (2008). Mesophyll conductance to CO2: current knowledge and future prospects. Plant Cell Environ. 31 (5): 602–621. Foyer, C.H. and Shigeoka, S. (2011). Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiol. 155 (1): 93–100. Gratão, P.L., Polle, A., Lea, P.J., and Azevedo, R.A. (2005). Making the life of heavy metal‐ stressed plants a little easier. Funct. Plant Biol. 32 (6): 481–494. Gupta, D., Nicoloso, F., Schetinger, M. et al. (2009). Antioxidant defense mechanism in hydroponically grown Zea mays seedlings under moderate lead stress. J. Hazard. Mater. 172 (1): 479–484. Gupta, P., Jain, M., Sarangthem, J., and Gadre, R. (2013). Inhibition of 5‐aminolevulinic acid dehydratase by mercury in excised greening maize leaf segments. Plant Physiol. Biochem. 62: 63–69.

127

128

7  Heavy Metals and Photosynthesis

Gururani, M.A., Venkatesh, J., and Tran, L.‐S.P. (2015). Regulation of photosynthesis during abiotic stress‐induced photoinhibition. Mol. Plant 8: 1304–1320. Gusman, G.S., Oliveira, J.A., Farnese, F.S., and Cambraia, J. (2013). Arsenate and arsenite: the toxic effects on photosynthesis and growth of lettuce plants. Acta Physiol. Plant. 35 (4): 1201–1209. Hampp, R., Ziegler, H., and Ziegler, I. (1973). Der Einfluß von Bleiionen auf Enzyme des reduktiven Pentosephosphatcyclus. Biochem. Physiol. Pflanz. 164: 588–595. Heldt, H.W. and Piechulla, B. (2010). Plant Biochemistry, 4e. Academic Press. Hong Bin, W., Xie, F., Yan‐Zhuo, Y. et al. (2012). The effects of arsenic and induced‐ phytoextraction methods on photosynthesis in Pterisspecies with different arsenic‐ accumulating abilities. Environ. Exp. Bot. 75: 298–306. Jia, Z., Li, S., and Wang, L. (2018). Assessment of soil heavy metals for eco‐environment and human health in a rapidly urbanization area of the upper Yangtze Basin. Sci. Rep. 8: 3256. Jiang, H.X., Chen, L.S., Zheng, J.G. et al. (2008). Aluminum‐induced effects on photosystem II photochemistry in citrus leaves assessed by the chlorophyll a fluorescence transient. Tree Physiol. 28 (12): 1863–1871. Jin, X.F., Yang, X.E., Ejazul, I. et al. (2008). Effects of cadmium on ultrastructure and antioxidative defense system in hyperaccumulator and non‐hyperaccumulator ecotypes of Sedum alfredii Hance. J. Hazard. Mater. 156: 387–397. Jozefczak, M., Remans, T., Vangronsveld, J., and Cuypers, A. (2012). Glutathione is a key player in metal‐induced oxidative stress defenses. Int. J. Mol. Sci. 13 (3): 3145–3175. Kabata‐Pendias, A. (2010). Trace Elements in Soils and Plants. CRC Press. Karimi, N. and Souri, Z. (2015). Effect of phosphorus on arsenic accumulation and detoxification in arsenic hyperaccumulator, Isatis cappadocica. J. Plant Growth Regul. 34: 88–95. Karimi, N. and Souri, Z. (2016). Antioxidant enzymes and compounds complement each other during arsenic detoxification in shoots of Isatis cappadocica Desv. Chem. Ecol. 32: 937–951. Karimi, N., Ghaderian, S.M., Raab, A. et al. (2009). An arsenic accumulating, hyper‐ tolerant brassica, Isatis cappadocica Desv. New Phytol. 184: 41–47. Karimi, N., Siyahat Shayesteh, L., Ghasmpour, H., and Alavi, M. (2013). Effects of arsenic on growth, photosynthetic activity and accumulation in two new hyperaccumulating populations of Isatis cappadocica Desv. J. Plant Growth Regul. 32: 823–830. Karukstis, K.K. (1991). Chlorophyll fluorescence as a physiological probe of the photosynthetic apparatus. In: Chlorophylls (ed. H. Scheer), 770–797. Boca Raton/Ann Arbor/Boston/London: CRC Press. Kaur, P., Bali, S., Verma, V. et al. (2018). Responses of photosynthesis under metal stress. In: Environment and Photosynthesis: A Future Prospect (ed. V.P. Singh, S. SSR, P.K. Srivastava and S.M. Prasad), 241–260. Studium Press India. Keeling, S.M., Stewart, R.B., Anderson, C.W.N., and Robinson, B.H. (2003). Nickel and cobalt phytoextraction by the hyperaccumulator Berkheya coddii: implications for polymetallic phytomining and phytoremediation. Int. J. Phytorem. 5: 235–244. Khalid, S., Shahid, M., Niazi, N.K. et al. (2017). A comparison of technologies for remediation of heavy metal contaminated soils. J. Geochem. Explor. 182: 247–268. Kirpichtchikova, T.A., Manceau, A., Spadini, L. et al. (2006). Speciation and solubility of heavy metals in contaminated soil using X‐ray microfluorescence, EXAFS spectroscopy,

­  References

chemical extraction, and thermodynamic modeling. Geochim. Cosmochim. Acta 70: 2163–2190. Krupa, Z. and Baszynski, T. (1995). Some aspects of heavy metals toxicity towards photosynthetic apparatus–direct and indirect effects on light and dark reactions. Acta Physiol. Plant. 17: 177–190. Kumar, A., Prasad, M.N.V., and Sytar, O. (2012). Lead toxicity, defense strategies and associated indicative biomarkers in Talinum triangulare grown hydroponically. Chemosphere 89: 1056–1165. Küpper, H., Küpper, F., and Spiller, M. (1996). Environmental relevance of heavy metal substituted chlorophylls using the example of water plants. J. Exp. Bot. 47 (295): 259–266. Küpper, H., Küpper, F., and Spiller, M. (1998). In situ detection of heavy metal substituted chlorophylls in water plants. Photosynth. Res. 58 (2): 123–133. Lidon, F.C., Ramalho, J.C., and Henriques, F.S. (1993). Copper inhibition of rice photosynthesis. J. Plant Physiol. 142 (1): 12–17. Ma, L., Komar, K., Tu, C. et al. (2001). A fern that hyperaccumulates arsenic. Nature 409: 579. Mahar, A., Wang, P., Ali, A. et al. (2016). Challenges and opportunities in the phytoremediation of heavy metals contaminated soils: a review. Ecotoxicol. Environ. Saf. 126: 111–121. Mathur, S., Kalaji, H.M., and Jajoo, A. (2016). Investigation of deleterious effects of chromium phytotoxicity and photosynthesis in wheat plant. Photosynthetica 54 (2): 185–192. Mendoza‐Cozatl, D., Loza‐Tavera, H., Hernandez‐Navarro, A., and Moreno‐Sanchez, R. (2005). Sulfur assimilation and glutathione metabolism under cadmium stress in yeast, protists and plants. FEMS Microbiol. Rev. 29: 653–671. Mishra, K.K., Rai, U.N., and Prakash, O. (2007). Bioconcentration and phytotoxicity of Cd in Eichhornia crassipes. Environ. Monit. Assess. 130: 237–243. Mittler, R., Vanderauwera, S., Gollery, M., and Van Breusegem, F. (2004). The reactive oxygen gene network in plants. Trends Plant Sci. 9: 490–498. Mittler, R., Vanderauwera, S., Suzuki, N. et al. (2011). ROS signaling: the new wave? Trends Plant Sci. 16: 300–309. Mobin, M. and Khan, N.A. (2007). Photosynthetic activity, pigment composition and antioxidative response of two mustard (Brassica juncea) cultivars differing in photosynthetic capacity subjected to cadmium stress. J. Plant Physiol. 164 (5–3): 601–610. Mohanty, N., Vass, I., and Demeter, S. (1989). Copper toxicity affects photosystem II electron transport at the secondary quinone acceptor QB. Plant Physiol. 90: 175–179. Molas, J. (2002). Changes of chloroplast ultrastructure and total chlorophyll concentration in cabbage leaves caused by excess of organic Ni (II) complexes. Environ. Exp. Bot. 47 (2): 115–126. Morrison, R.S., Brooks, R.R., Reeves, R.D., and Malaisse, F. (1979). Copper and cobalt uptake by metallophytes from Zaire. Plant Soil 53: 535–539. Moustaka, J., Ouzounidou, G., Bayçu, G., and Moustakas, M. (2016). Aluminum resistance in wheat involves maintenance of leaf Ca2+ and Mg2+ content, decreased lipid peroxidation and Al accumulation, and low photosystem II excitation pressure. Biometals 29 (4): 611–623.

129

130

7  Heavy Metals and Photosynthesis

Moya, J.L., Ros, R., and Picazo, I. (1993). Influence of cadmium and nickel on growth, net photosynthesis and carbohydrate distribution in rice plants. Photosynth. Res. 36 (2): 75–80. Mumm, P., Wolf, T., Fromm, J. et al. (2011). Cell type‐specific regulation of ion channels within the maize stomatal complex. Plant Cell Physiol. 52: 1365–1375. Myśliwa‐Kurdziel, B. and Strzałka, K. (2002). Influence of metals on biosynthesis of photosynthetic pigments. In: Physiology and Biochemistry of Metal Toxicity and Tolerance in Plants (ed. M.N.V. Prasad and K. Strzałka), 201–227. Dordrecht: Springer. Najeeb, U., Jilanic, G., Alia, S. et al. (2011). Insights into cadmium induced physiological and ultra‐structural disorders in Juncus effusus L. and its remediation through exogenous citric acid. J. Hazard. Mater. 186: 565–574. Nehnevajova, E., Lyubenova, L., Herzig, R. et al. (2012). Metal accumulation and response of antioxidant enzymes in seedlings and adult sunflower mutants with improved metal removal traits on a metal‐contaminated soil. Environ. Exp. Bot. 76: 39–48. Nelson, N. and Junge, W. (2015). Structure and energy transfer in photosystems of oxygenic photosynthesis. Annu. Rev. Biochem. 84: 659–683. Nelson, N. and Yocum, C.F. (2006). Structure and function of photosystems I and II. Annu. Rev. Plant Biol. 57: 521–565. Nishiyama, Y. and Murata, N. (2014). Revised scheme for the mechanism of photoinhibition and its application to enhance the abiotic stress tolerance of the photosynthetic machinery. Appl. Microbiol. Biotechnol. 98: 8777–8796. Ojuederie, O.B. and Babalola, O.O. (2017). Microbial and plant‐assisted bioremediation of heavy metal polluted environments: a review. Int. J. Environ. Res. Public Health 14: 1504. Pandey, P., Singh, J., Achary, V.M.M., and Reddy, M.K. (2015). Redox homeostasis via gene families of ascorbate‐glutathione pathway. Front. Environ. Sci. 3: 25. Papadakis, I.E., Dimassi, K.N., Bosabalidis, A.M. et al. (2004). Effects of UV‐B excess on some physiological and anatomical parameters of ‘Navelina’ orange plants grafted on two rootstocks. Environ. Exp. Bot. 51: 247–257. Paradiso, A., Berardino, R., de Pinto, M.C. et al. (2008). Increase in ascorbate–glutathione metabolism as local and precocious systemic responses induced by cadmium in durum wheat plants. Plant Cell Physiol. 49 (3): 362–374. Parmar, P., Kumari, N., and Sharma, V. (2013). Structural and functional alterations in photosynthetic apparatus of plants under cadmium stress. Bot. Stud. 54 (1): 45. Parry, M.A.J., Andralojc, P.J., Mitchell, R.A.C. et al. (2003). Manipulation of rubisco: the amount, activity, function and regulation. J. Exp. Bot. 54: 1321–1333. Peixoto, H.P., Da Matta, F.M., and Da Matta, J.C. (2002). Responses of the photosynthetic apparatus to aluminum stress in two sorghum cultivars. J. Plant Nutr. 25 (4): 821–832. Pereira, W.E., de Siqueira, D.L., Martínez, C.A., and Puiatti, M. (2000). Gas exchange and chlorophyll fluorescence in four citrus rootstocks under aluminium stress. J. Plant Physiol. 157 (5): 513–520. Pereira, L.B., Tabaldi, L.A., Gonçalves, J.F. et al. (2006). Effect of aluminum on δ‐ aminolevulinic acid dehydratase (ALA‐D) and the development of cucumber (Cucumis sativus). Environ. Exp. Bot. 57: 106–115. Piršelová, B., Boleček, P., and Gálusová, T. (2016). Effect of cadmium and arsenic on chlorophyll fluorescence of selected soybean cultivars. Russ. J. Plant Physiol. 63 (4): 469–473.

­  References

Pollard, A.J., Powell, K.D., Harper, F.A., and Smith, J.A.C. (2002). The genetic basis of metal hyperaccumulation in plants. Crit. Rev. Plant Sci. 21: 539–566. Pollard, A.J., Reeves, R.D., and Baker, A.J.M. (2014). Facultative hyperaccumulation of heavy metals and metalloids. Plant Sci. 217–2018: 8–17. Prasad, M.N.V. and Strzałka, K. (1999). Impact of heavy metals on photosynthesis. In: Heavy Metal Stress in Plants, 117–138. Berlin, Heidelberg: Springer. Qufei, L. and Fashui, H. (2009). Effects of Pb2+ on the structure and function of photosystem II of Spirodela polyrrhiza. Biol. Trace Elem. Res. 129 (1–3): 251. Rai, R., Pandey, S., Shrivastava, A.K., and Pandey Rai, S. (2014). Enhanced photosynthesis and carbon metabolism favor arsenic tolerance in Artemisia annua, a medicinal plant as revealed by homology‐based proteomics. Int. J. Proteomics 163962. Reeves, R.D. (2003). Tropical hyperaccumulators of metals and their potential for phytoextraction. Plant Soil 249: 57–65. Reeves, R.D., Schwartz, C., Morel, J.L., and Edmondson, J. (2001). Distribution and metalaccumulating behavior of Thlaspi caerulescens and associated metallophytes in France. Int. J. Phytorem. 3: 145–172. Reeves, R.D., Baker, A.J., Jaffré, T. et al. (2018). A global database for plants that hyperaccumulate metal and metalloid trace elements. New Phytol. 218: 407–411. Rizwan, M., Ali, S., Abbas, T. et al. (2018). Residual effects of biochar on growth, photosynthesis and cadmium uptake in rice (Oryza sativa L.) under Cd stress with different water conditions. J. Environ. Manage. 206: 676–683. Roach, T. and Krieger‐Liszkay, A.K. (2014). Regulation of photosynthetic electron transport and photoinhibition. Curr. Protein Pept. Sci. 15 (4): 351–362. Rocchetta, I., Leonardi, P.I., Amado Filho, G.M. et al. (2007). Ultrastructure and X‐ray microanalysis of Euglena gracilis (Euglenophyta) under chromium stress. Phycologia 46 (3): 300–306. Rodriguez, E., da Conceição Santos, M., Azevedo, R. et al. (2015). Photosynthesis light‐ independent reactions are sensitive biomarkers to monitor lead phytotoxicity in a Pb‐tolerant Pisum sativum cultivar. Environ. Sci. Pollut. Res. 22 (1): 574–585. Romero‐Puertas, M.C., Rodriguez‐Serrano, M., Corpas, F.J. et al. (2004). Cadmium‐ induced subcellular accumulation of O2− and H2O2 in pea leaves. Plant Cell Environ. 27: 1122–1134. Rowan, K.S. (1989). Photosynthetic Pigments of Algae. Cambridge University Press. Sagardoy, R., Morales, F., López‐Millán, A.F. et al. (2009). Effects of zinc toxicity on sugar beet (Beta vulgaris L.) plants grown in hydroponics. Plant Biol. 11 (3): 339–350. Sánchez‐Pardo, B., Fernández‐Pascual, M., and Zornoza, P. (2014). Copper microlocalisation and changes in leaf morphology, chloroplast ultrastructure and antioxidative response in white lupin and soybean grown in copper excess. J. Plant Res. 127 (1): 119–129. Sandalio, L.M., Dalurzo, H.C., Gómez, M. et al. (2001). Cadmium‐induced changes in the growth and oxidative metabolism of pea plants. J. Exp. Bot. 52: 2115–2126. Semenova, G.A., Fomina, I.R., Kosobryukhov, A.A. et al. (2017). Mesophyll cell ultrastructure of wheat leaves etiolated by lead and selenium. J. Plant Physiol. 219: 37–44. Seregin, I.V. and Kozhevnikova, A.D. (2006). Physiological role of nickel and its toxic effects on higher plants. Russ. J. Plant Physiol. 53: 257.

131

132

7  Heavy Metals and Photosynthesis

Shahid, M., Pourrut, B., Dumat, C. et al. (2014). Heavy‐metal induced reactive oxygen species: phytotoxicity and physicochemical changes in plants. Rev. Environ. Contam. Toxicol. 232: 1–44. Sharma, I., Pati, P.K., and Bhardwaj, R. (2011). Effect of 24‐epibrassinolide on oxidative stress markers induced by nickel‐ion in Raphanus sativus L. Acta Physiol. Plant. 33: 1723. Shen, G.‐M., Zhu, C., Du, Q.‐Z., and Shangguan, L.‐N. (2012). Ascorbate‐glutathione cycle alteration in cadmium sensitive rice mutant cadB‐1. Rice Sci. 19: 185–192. Siborova, M. (1988). Cd2+ ions affect the quaternary structure of ribulose‐1,5‐bisphosphate carboxylase from barley leaves. Biochem. Physiol. Pflanz. 183: 371–378. Siedlecka, A. and BaszyńAski, T. (1993). Inhibition of electron flow around photosystem I in chloroplasts of Cd‐treated maize plants is due to Cd‐induced iron deficiency. Physiol. Plant. 87 (2): 199–202. Singh, M., Singh, V.P., Dubey, G., and Prasad, S.M. (2015). Exogenous proline application ameliorates toxic effects of arsenate in Solanum melongena L. seedlings. Ecotoxicol. Environ. Saf. 117: 164–173. Singh, S., Parihar, P., Singh, R. et al. (2016). Heavy metal tolerance in plants: role of transcriptomics, proteomics, metabolomics, and ionomics. Front. Plant Sci. 6: 1143. Skrebsky, E.C., Tabaldi, L.A., Pereira, L.B. et al. (2008). Effect of cadmium on growth, micronutrient concentration, and δ‐aminolevulinic acid dehydratase and acid phosphatase activities in plants of Pfaffia glomerata. Braz. J. Plant Physiol. 20 (4): 285–294. Son, J.A., Narayanankutty, D.P., and Roh, K.S. (2014). Influence of exogenous application of glutathione on rubisco and rubisco activase in heavy metal‐stressed tobacco plant grown in vitro. Saudi J Biol Sci. 21: 89–97. Soudek, P., Petrová, Š., and Vaněk, T. (2011). Heavy metal uptake and stress responses of hydroponically cultivated garlic (Allium sativum L.). Environ. Exp. Bot. 74: 289–295. Souri, Z., Karimi, N., and Sandalio, L.M. (2017). Arsenic hyperaccumulation strategies: an overview. Front. Cell Dev. Biol. 5: 67. Souri, Z., Karimi, N., and de Oliveira, L.M. (2018). Antioxidant enzymes responses in shoots of arsenic hyperaccumulator, Isatis cappadocica Desv., under interaction of arsenate and phosphate. Environ. Technol. 39 (10): 1316–1327. Souza, R.P., Machadoa, E.C., Silva, J.A.B. et al. (2004). Photosynthetic gas exchange, chlorophyll fluorescence, and some associated metabolic changes in cowpea (Vigna unguiculata) during water stress and recovery. Environ. Exp. Bot. 51: 45–56. Stein, R.J., Heoreth, S., de Melo, J.R.F. et al. (2017). Relationships between soil and leaf mineral composition are element‐specific, environment‐dependent and geographically structured in the emerging model Arabidopsis halleri. New Phytol. 213: 1274–1286. Sterckeman, T., Cazes, Y., Gonneau, C., and Sirguey, C. (2017). Phenotyping 60 populations of Noccaea caerulescens provides a broader knowledge of variation in traits of interest for phytoextraction. Plant Soil 418: 523–540. Stoeva, N. and Bineva, T. (2003). Oxidative changes and photosynthesis in oat plants grown in As‐contaminated soil. Bulg. J. Plant Physiol. 29 (1–2): 87–95. Stoeva, N., Berova, M., and Zlatev, Z. (2005). Effect of arsenic on some physiological parameters in bean plants. Biol. Plant. 49 (2): 293–296. Štolfa, I., Pfeiffer, T.Ž., Špoljarić, D. et al. (2015). Heavy metal‐induced oxidative stress in plants: response of the antioxidative system. In: Reactive Oxygen Species and Oxidative

­  References

Damage in Plants Under Stress (ed. D. Gupta, J. Palma and F. Corpas), 127–163. Cham: Springer. Sytar, O., Kumar, A., Latowski, D. et al. (2013). Heavy metal‐induced oxidative damage, defense reactions, and detoxification mechanisms in plants. Acta Physiol. Plant. 35: 985. Szalontai, B., Horváth, L.I., Debreczeny, M. et al. (1999). Molecular rearrangements of thylakoids after heavy metal poisoning, as seen by Fourier transform infrared (FTIR) and electron spin resonance (ESR) spectroscopy. Photosynth. Res. 61 (3): 241–252. Taiz, L. and Zeiger, E. (2002). Plant Physiology. Sunderland, MA, USA: Sinauer Associates. Tanyolaç, D., Ekmekçi, Y., and Ünalan, S. (2007). Changes in photochemical and antioxidant enzyme activities in maize (Zea mays L.) leaves exposed to excess copper. Chemosphere 67: 89–98. Terashima, I. and Ono, K. (2002). Effects of HgCl2 on CO2 dependence of leaf photosynthesis: evidence indicating involvement of aquaporins in CO2 diffusion across the plasma membrane. Plant Cell Physiol. 43 (1): 70–78. Terry, N. and Banuelos, G. (1999). Phytoremediation of Contaminated Soil and Water, 408. Boca Raton: CRC Press. Tewari, R.K., Kumar, P., Sharma, P.N., and Bisht, S.S. (2002). Modulation of oxidative stress responsive enzymes by excess cobalt. Plant Sci. 162: 381–388. Tiwari, S. and Sarangi, B.K. (2017). Comparative analysis of antioxidant response by Pteris vittata and Vetiveria zizanioides towards arsenic stress. Ecol. Eng. 100: 211–218. Tripathy, B.C. and Oelmüller, R. (2012). Reactive oxygen species generation and signaling in plants. Plant Signaling Behav. 7 (12): 1621–1633. Tume, P., Roca, N., Rubio, R. et al. (2018). An assessment of the potentially hazardous element contamination in urban soils of Arica, Chile. J. Geochem. Explor. 184: 345–357. USEPA 2000 Introduction to Phytoremediation. Tech. Rep. EPA 600/R‐99/107. Cincinnati, Ohio, USA. https://www.nrcs.usda.gov/Internet/FSE_DOCUMENTS/ nrcs142p2_053279.pdf USEPA (2007) Treatment Technologies For Site Cleanup: Annual Status Report. Tech. Rep. EPA‐542‐R‐07‐012. Washington, DC. https://www.epa.gov/sites/production/ files/2015‐09/documents/asr12_full_document.pdf USEPA (2009). National Primary Drinking Water Regulations. Tech. Rep. EPA 816‐F‐09‐004. Washington, DC, USA. https://www.epa.gov/sites/production/ files/2016‐06/documents/npwdr_complete_table.pdf Vallee, B.L. and Ulmer, D.D. (1972). Biochemical effects of mercury, cadmium, and lead. Annu. Rev. Biochem. 41 (1): 91–128. Vangronsveld, J. and Clijsters, H. (1994). Toxic effects of metals. In: Plants and the Chemical Elements. Biochemistry, Uptake, Tolerance and Toxicity (ed. M.E. Farago), 150–177. Weinheim: VCH Publishers. Vassilev, A. and Yordanov, L. (1997). Reductive analysis of factors limiting growth of cadmium‐treated plants: a review. Bulg. J. Plant Physiol. 23: 114–133. Veeranjaneyulu, K. and Das, V.S.R. (1982). Intrachloroplast localization of 65Zn and 63Ni in a Zn‐tolerant plant, Ocimum basilicum Benth. J. Exp. Bot. 33: 1161–1165. Wang, H., Zhao, S.C., Liu, R.L. et al. (2009). Changes of photosynthetic activities of maize (Zea mays L.) seedlings in response to cadmium stress. Photosynthetica 47 (2): 277–283. Wang, F., Chen, F., Cai, Y. et al. (2011). Modulation of exogenous glutathione in ultrastructure and photosynthetic performance against Cd stress in the two barley genotypes differing in Cd tolerance. Biol. Trace Elem. Res. 144 (1–3): 1275–1288.

133

134

7  Heavy Metals and Photosynthesis

Wang, X., Yang, X., Chen, S. et al. (2016a). Zinc oxide nanoparticles affect biomass accumulation and photosynthesis in Arabidopsis. Front. Plant Sci. 6: 1243. Wang, Y., Li, Y., Ma, C., and Qiu, D. (2016b). Gas exchange, photosystem II photochemistry, and the antioxidant system of longan plant (’Dimocarpus longan Lour.) leaves in response to lead (Pb) stress. Plant Omics 9 (4): 240–247. Watanabe, T., Machida, K., Suzuki, H. et al. (1985). Photoelectrochemistry of metallochlorophylls. Coord. Chem. Rev. 64: 207–224. Wood, J.M. (1974). Biological cycles for toxic elements in the environment. Science 183: 1049–1052. Wu, L.H., Liu, Y.J., Zhou, S.B. et al. (2012). Sedum plumbizincicola X.H. Guo et S.B. Zhou ex L.H. Wu (Crassulaceae): a new species from Zhejiang Province, China. Plant Syst. Evol. 299: 487–498. Wuana, R.A. and Okieimen, F.E. (2011). Heavy metals in contaminated soils: a review of sources, chemistry, risks and best available strategies for remediation. ISRN Ecol. Xu, Q.S., Hu, J.Z., Xie, K.B. et al. (2010). Accumulation and acute toxicity of silver in Potamogeton crispus L. J. Hazard. Mater. 173 (1–3): 186–193. Xue, S., Wang, J., Zhou, X. et al. (2009). A critical reappraisal of Phytolacca acinosa Roxb. (Phytolaccaceae) – a manganese‐hyperaccumulating plant. Acta Ecol. Sinica 30: 335–338. Xue, X.C., Gao, H.Y., and Zhang, L.T. (2013). Effects of cadmium on growth, photosynthetic rate and chlorophyll content in leaves of soybean seedlings. Biol. Plant 57 (3): 587–590. Yadav, S.K. (2010). Heavy metals toxicity in plants: an overview on the role of glutathione and phytochelatins in heavy metal stress tolerance of plants. S. Afr. J. Bot. 76: 167–179. Yang, M., Tan, L., Xu, Y. et al. (2015). Effect of low pH and aluminum toxicity on the photosynthetic characteristics of different fast‐growing Eucalyptus vegetatively propagated clones. PLoS One 10 (6): e0130963. Yang, X., Deng, D., Liu, K., and Yu, F. (2016). Response of enzymatic and non‐enzymatic antioxidant defense systems of Polygonum hydropiper to Mn stress. J. Cent. South Univ. 23: 793. Ying, R.R., Qiu, R.L., Tang, Y.T. et al. (2010). Cadmium tolerance of carbon assimilation enzymes and chloroplast in Zn/Cd hyperaccumulator Picris divaricata. J. Plant Physiol. 167 (2): 81–87. Zhang, Y., Xu, S., Yang, S., and Chen, Y. (2015). Salicylic acid alleviates cadmium‐induced inhibition of growth and photosynthesis through upregulating antioxidant defense system in two melon cultivars (Cucumis melo L.). Protoplasma 252 (3): 911–924.

135

8 Toward Understanding the Regulation of Photosynthesis under Abiotic Stresses: Recent Developments Syed Sarfraz Hussain Department of Biological Sciences, Forman Christian College (A Chartered University) Lahore, Pakistan

8.1 ­Introduction: Abiotic Stresses, Photosynthesis and Plant Productivity It is estimated that environmental factors may reduce crop productivity by as much as 70% (Boyer 1982). A rapid increase in world population requires a continuous increase in crop yields. However, with the available plant biodiversity and the current technologies, it would be difficult to keep pace with high population growth. Due to their sessile nature, plants are continuously subjected to several environmental constraints either due to natural events or anthropogenic activities often resulting in irreversible yield losses (Gururani et  al. 2015; Mickelbart et  al. 2015). Any environmental conditions, which reduce growth and yield below optimum levels is considered as abiotic stress. Different abiotic stresses are playing important roles in plant productivity losses. It is imperative to improve photosynthesis to ensure high yields of crop plants for improved plant productivity within limited resources under various environmental stresses (Bartels and Hussain 2008; Hussain et al. 2012). As a matter of fact, yield improvement using economically viable technological means under stress require more investment in research (Ashraf and Foolad 2007). A research based strategy would eventually respond to meet increased food demands and also help to protect the environment. However, a plant’s responses to abiotic stresses are dynamic and complex (Eberhard et  al. 2008; Foyer et al. 2012) depending on the plant organ affected by the stress. In addition, the severity of stress can have a significant effect on the nature of the response (Maayam et al. 2008; Ambavaram et al. 2014). Several abiotic stresses such as drought, extreme temperatures, salinity, UV‐radiation, high light, and increased atmospheric CO2 concentration often negatively affect photosynthesis and plant productivity. Several reports have demonstrated that several abiotic stresses result in severe damage to macromolecules such as nucleic acids, photosynthetic apparatus, proteins, and others (Ashraf and Harris 2013; Nishiyama and Murata 2014; Nouri et al. 2015; Yamori 2016). On the other hand, plants usually exposed to suboptimal growth conditions in many agricultural systems have developed certain strategies to mitigate the negative effects of abiotic stresses. Some mechanisms are involved in most stress conditions and plant type, while others Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

136

8  Photosynthesis under Abiotic Stresses

are stress and plant specific. Most of stress related effects can be partially or completely reversible depending on the severity of damage and organ involved. Increasing plant productivity for an ever increasing global population seems logical. Development of crop plants tolerant to different environmental stresses seems a promising strategy which may help satisfy growing demands for food, cloth, and shelter. Thus, obtaining more tolerant natural or transgenic plants should be a priority for plant scientists. Genetic engineering strategies overcome the bottleneck of plant breeding methods and transgenic approaches can be used in combination with conventional breeding strategies to develop enhanced stress tolerant crop plants (Capell et al. 2004; Hussain et  al. 2012, Hussain and Siddique 2014). Several studies have successfully shown transgenic plants that have been developed by transfer of one or several genes simultaneously, which are involved either in signaling/regulatory pathways or synthesis of functional/structural protectants and stress tolerance conferring proteins (Wang et al. 2003; Vinocur and Altman 2005; Valliyodan and Nguyen 2006; Bhatnagar‐Mathur et  al. 2007; Kathuria et  al. 2007; Sreenivasulu et  al. 2007; Bartels and Hussain 2008; Hussain et al. 2012). On the other hand, precise phenotyping of traits has fulfilled the gap between genotyping and phenotyping. Available high‐throughput phenotyping tools offer invaluable possibilities for precisely monitoring the appearance and development of traits under environmental stress. Despite the fact that a variety of physiological, biochemical and molecular processes are responsible for plant growth and development, photosynthesis is a specialized mechanism responsible for providing energy and organic molecules for plant productivity (Pinheiro and Chaves 2011; Ashraf and Harris 2013). Basically, plants require ingredients like light, water, carbon, and mineral nutrients for photosynthesis. Photosynthesis is an intricate and crucial function in plant productivity (Siddique et al. 2016). Plants use light energy to convert it to chemical energy during photosynthesis. Light is the sole energy source for photosynthesis (Gunawardana 2008), but excess light in combination with other stresses causes damage to photosynthetic apparatus (Foyer et al. 2012; Nath et  al. 2013). Photosynthesis represents a multistep process that consists of complex redox reactions and involves several biological pathways (Baker 2008). Photosynthesis is vulnerable to abiotic stress (drought, heat, heavy metal toxicity, and high light) which leads to overreduction of the electron transport chain (ETC), which results in photooxidation (Foyer and Noctor, 2005; Rochaix, 2011, 2013; Foyer et al. 2012; Nishiyama and Murata 2014). Naturally, plants have the ability to overcome this stress by reducing the rate of electron transport which in turn leads to conversion of excessively absorbed light into thermal energy. The term non‐photochemical quenching (NPQ) is used to describe the dissipation of excess excitation energy absorbed by chlorophyll as heat (Rochaix, 2011; Tikkanen et al. 2008, 2010, 2014; Nath et al. 2013; Spetea et al. 2014). Similarly, complex signaling and regulatory systems are involved in which stress signals travel through ion channels, signaling proteins, and secondary messengers to transmit the signals to regulatory systems (Cortleven et al. 2014; Tikkanen and Aro 2014; Tikkanen et al. 2014; Gururani et al. 2015). It is known that components of the regulatory system particularly phytohormones, transcription factors (TFs), mitogen‐activated protein kinases, and phosphatases significantly regulate the expression of many stress‐inducible genes (Foyer and Shigeoka 2011; Osakabe et al. 2014; Gururani et al. 2015). Abiotic stresses severely affect the photosystem II (PSII) protein complex of the photosynthetic machinery because photodamage to the PSII complex cannot be avoided in

8.1 Introduction

photosynthetic organisms by virtue of its importance; however, plants have developed a protective mechanism to reduce the extent of damage to the PSII complex to maintain photosynthetic efficiency (Hippler et al. 2001; Nouri and Komatsu 2013) by recovering the damaged PSII via an efficient repair system. Moreover, current data also suggest that reactive oxygen species (ROS), generated in the chloroplast under abiotic stress, do not damage the PSII complex directly but hamper the synthesis of the D1 protein of the PSII complex after stress‐induced photoinhibition (Chaves et al. 2009; Ahuja et al. 2010; Taiz and Zeigler 2010). Therefore, at present, there is increasing interest among researchers to completely explore the PSII damage repair mechanism. Based on proven facts, it is speculated that abiotic stresses continue to have a significant impact on plant productivity. Similarly, plants are continuously bombarded by various abiotic stresses therefore; they have developed limited stress protective mechanisms for maintaining photosynthesis efficiency. The ability of plants to adapt to changing environments is related to the plasticity of photosynthesis. Under natural conditions, a few plant species show tolerance to harsh environments compared to others, which is often referred to as natural biodiversity. Natural biodiversity offers, therefore, some clues to exploit that plasticity, which can be evaluated using modern high throughput molecular techniques such as “omic” technologies (Nouri et  al. 2015). An extensive search for this natural diversity would be an important target in plant sciences. This natural plasticity could then be transferred to plants with more added value. 8.1.1  Impact of Abiotic Stress on the Photosynthetic System of Plants Plants are frequently exposed to combinations of stresses. In this respect, both biotic and abiotic stresses are held responsible for huge crop yield losses (Mahajan and Tuteja 2005). In particular, abiotic stresses result in reduced crop productivity and yield losses by inhibiting photosynthesis (De Oliveira et al. 2013). High plant yield under both biotic and abiotic stresses represents an important yield stability trait. This trait has been targeted using conventional plant breeding and genetic engineering techniques (Century et al. 2008; Ambavaram et al. 2014). On the other hand, several other strategies have been proposed to boost the intrinsic plant yield and increased plant photosynthetic rate and photosynthetic assimilation capacity seems more promising (Zhu et al. 2010; Gibson et al. 2011) under abiotic stresses. Photosynthesis, the foundation of life on earth is considered as the basis of absolute yield. However, engineering photosynthetic efficiency for improved plant yield has not yet been successful (von Caemmerer and Evans 2010; Ashraf and Harris 2013; Ambavaram et al. 2014). Photosynthesis is a complex multistep process and damage at any step results in an overall reduction in plant yield. 8.1.2  Drought Stress Drought has played a primary role in limiting plant growth and development. Drought manipulates several processes including morphological, physiological, biochemical and molecular processes in plants, which results in growth inhibition, stomata closure with consecutive reduction of transpiration, a decrease in chlorophyll content, inhibition of photosynthesis, and changes in different vital proteins (Lawlor and Cornic 2002; Yordanov et al. 2003) to cope with osmotic changes in plant tissues. It usually disturbs a

137

138

8  Photosynthesis under Abiotic Stresses

plethora of vital mechanisms including reduced leaf turgor pressure, decreased stomatal conductance, and transpiration rate (Barnabas et  al. 2008; Taiz and Zeigler 2010; Xu et al. 2010). Stomatal closure is the earliest response to drought causing a decrease in mesophyll CO2 diffusion and reduction in the photosynthesis rate (Chaves et al. 2003; Liu et al. 2010). Stomatal closure and metabolic impairment results in low photosynthetic rates under water deficient conditions (Rizhsky et al. 2002; Grassi and Magnani 2005; Santos et al. 2004; Santos et al. 2006; Praxedes et al. 2006; Arve et al. 2011; Ashraf and Harris 2013; Gupta and Thind 2015). At this stage, plants lack the ability to carry out almost all the physiological, biochemical, and molecular processes (Yordanov et al. 2003; Zlatev and Lidon 2012). As a result, inhibition of photosynthesis occurs in plants within a few days of drought stress, thereby causing a significant reduction in CO2 assimilation rate and photoinhibition, which leads to reduced quantum yield efficiency of photosystem II and induces photorespiration and the generation of ROS (Ort and Baker 2002; Erice et al. 2006; Praxedes et al. 2006; Farooq et al. 2009; Liu et al. 2010; Sanda et al. 2011; Takahashi and Kinoshita 2014). However, plants tend to minimize photoinhibition by increased utilization of absorbed light energy and improving CO2 intake (Flexas and Medrano 2002). A plant’s response to drought stress depends on factors like the severity of water deficit, stage of development, cell and organ type, and plant species (Barnabas et al. 2008; Khalili and Neghavi 2017). Overall, severe drought stress will lead to failure of the plant metabolism and energy production resulting in cell death (Flexas et al. 2012; Alam et al. 2014a, b). Therefore, it is imperative for plants to maintain photosynthetic function for survival under drought stress (Virlouvet and Fromm 2014). C4 plants have shown less damage under drought than C3 plants because of higher water‐use efficiency (Hayano‐Kanashiro et al. 2009), which means C4 photosynthesis is less sensitive to water deficiency stress compared to C3 plants (Pelleschi et  al. 1997; Taub, 2000; Monneveux et al. 2006; Cabido et al. 2007; Nakabayashi et al. 2014). On the other hand, several studies have demonstrated that C4 plants under severe water deficit conditions become more sensitive to drought conditions (Medrano et al. 2002; Flexas et  al. 2004; Ripley et  al. 2007; Osborne 2008; Ripley et  al. 2010). Similarly, drought severely reduces plant chlorophyll content by inhibiting chlorophyll synthesis (Lisar et  al. 2012). Carotenes and xanthophylls are more tolerant to drought compared to chlorophyll (Niyogi et al. 1997). Photosynthesis is severely restricted by drought (Flexas et al. 2008). Therefore, activation of several key genes in different cycles of the photosynthetic pathways were reported in rice (Rabbani et al. 2003; Parker et al. 2006; Karaba et al. 2007; Zhou et al. 2007a; Moumeni et al. 2011; Ambavaram et al. 2014), maize (Hayano‐Kanashiro et al. 2009), and Arabiodopsis (Karaba et  al. 2007; Osakabe et  al. 2014; Clauw et  al. 2015). Genes involved in photosynthetic pathways were mostly not affected by stress. Wong et  al. showed that only 15% of all genes were down regulated under drought in Thellungiella (Wong et al. 2006) while several genes showing down regulation in rice were involved in regulatory mechanisms for stress recovery (Zhou et al. 2007a, b). On the other hand, gene expression analyses have revealed a plethora of information in tolerant genotypes of C3 and C4 plants. Studies have shown that genes playing vital functions in PSI and PSII as well as in the Calvin–Benson cycle such as triosephosphate isomerase, fructose‐1,6‐bisphosphatase, Rubisco small subunit and Rubisco activase were repressed in tolerant C3 (Degenkolbe et al. 2009; Moumeni et al. 2011) and also in tolerant C4 maize plants (Hayano‐Kanashiro et al. 2009) under drought stress. However,

8.1 Introduction

several common genes in photosynthesis pathways were down‐regulated in both tolerant and intolerant plant genotypes in response to drought stress. Therefore, it can be concluded that plants avoid photooxidation and generation of free radicals such as ROS that lead to negative effects on plant photosynthetic capacity (Xu et al. 2010). A huge amount of data are now available on the gene expression profiles of both model plants (Ma et al. 2006; Yamaguchi and Shinozaki‐Yamaguchi 2007) from monocots and dicots (Bray 2004; Hazen et al. 2005; Wang et al. 2007, 2011; Dinney et al. 2008; Rabello et al. 2008; Moumeni et al. 2011) under drought stress. Drought induced alterations in gene expression of a multitude of genes were extensively studied using heterogenous systems at different developmental stages including vegetative and reproductive stages under single or multiple stresses (Reddy et al. 2002; Yang et al. 2004; Gorantla et al. 2007; Wang et al. 2007; Zhou et al. 2007a, b; Degenkolbe et al. 2009; Ji et al. 2012). These studies have revealed the down regulation of most of the photosynthesis related genes including chlorophyll a/b‐binding protein CP24, PSI reaction center subunit V, protochlorophyllide reductase A, peptidyl‐prolyl cis‐trans isomerase, and others functioning in the photosynthetic pathways under drought stress in rice leaves (Wang et al. 2011). Water deficit stress decreases the level and the activity of Rubisco (Tezara et al. 1999). It has been shown that Rubisco holoenzyme is relatively stable under drought conditions (Webber et al. 1994). However, studies have shown that Arabidopsis, rice, and tomato plants exhibit a rapid decrease in the abundance of Rubisco small subunit (rbcS) transcripts (Bartholomew et  al. 1991; Williams et  al. 1994; Vu et  al. 1999). Similarly, a study showed that drought stress decreases Rubisco activity in tobacco and is primarily due to the presence of tight binding inhibitors (Parry et al. 2002). Physic nut (Jatropha curcas L.) seedlings exposed to drought revealed differential expression of sets of genes involved in PSI, PSII, and Calvin cycle components where some genes such as light‐harvesting complex proteins, and genes encoding key enzymes in the Calvin cycle, Rubisco small subunit, phosphoglycerate kinase and phosphoribulokinase were significantly down‐regulated and others involved in glycolysis and the tricarboxylic acid cycle (TCA) cycle, including 6‐phosphofructokinase, aconitate hydratase, and dihydrolipoamide succinyltransferase were up‐regulated (Zhang et al. 2015). These reports clearly showed that the disruption of photosynthetic machinery is the primary target of drought stress in plants. Water is essential for living organisms and the major medium for transporting important metabolites and nutrients (Hsiao 1973). As a result of water shortage, mineral uptake of plants is severely affected. For example, Subramanian et al. showed reduced levels of nitrogen and phosphorous in tomato plants under water deficit conditions (Subramanian et  al. 2006). Similarly, Marigold seedling also showed a reduction in phosphorous content under drought stress (Asrar and Elhindi 2011). Therefore, an integrated approach is required to study the plant metabolism dynamics, regulatory mechanisms, and photosynthetic pathways at physiological, biochemical, and molecular levels in plants under drought stress. 8.1.3  Salinity Stress The presence of salt in the soil solution reduces water uptake by roots and leads to a reduction in growth rate with stunted plants due to reduced cell expansion (Zhu 2002; Parida and Das 2005; Ranjit et al. 2016). Furthermore, excess salt drastically affects all

139

140

8  Photosynthesis under Abiotic Stresses

vital plant parts including leaves, stems, and roots (Hernandez et al. 1995; Takemura et al. 2002). Excessive salt ions around roots cause loss of cell volume and turgor, resulting in stem and root cell elongation and further reduction in plant growth (Yeo et al. 1991; Passioura and Munns 2000; Cramer 2002; Fricke and Peters 2002; Ma et al. 2014; Liu et al. 2015; Ranjit et al. 2016). Reduced leaf expansion and stomatal closure under salinity contribute 80% and 20% reduction in radish (Raphanus sativus) plant growth respectively (Marcelis and Hooijdonk 1999). Several researchers have reported similar results in tomato and rice (Mohammad et  al. 1998; Mohammadi‐Nejad et  al. 2010; Rahman et al. 2016), cotton (Meloni et al. 2001), and Brassica campestris subsp. chinensis (Memon et al. 2010) with reduced shoot weight, plant height, number of leaves per plant, root length and root surface per plant when exposed to high salt concentrations (Ranjit et al. 2016). The precise mechanism of the reduced leaf and shoot growth under salinity stress is still under investigation (Munns and Tester 2008). However, osmotic effect and ion toxicity are two main reasons of growth reduction, when plants are exposed to salt stress (Munns and Tester 2008; Chaves et al. 2009; Negi et al. 2014; Quan et al. 2017). An excessively high salt concentration (430 mM) resulted in reduced photosynthetic rate and stomatal conductance in mangrove species (Kandelia candel) with decreased plant growth (Kao et  al. 2001). Stepien and Johnson (2009) demonstrated that PSII and PSI photochemistry and the total leaf chlorophyll content in Arabidopsis thaliana were affected by high salt concentrations. On the other hand, no negative effects were noticed on the halophyte, Thellungiella salsuginea. Hence, photosynthesis is one of the major physiological processes affected by salt stress and may cause long term effects on the growth rate in plants under high salinity (Zhu 2001; Munns and Tester 2008; Rahman et al. 2016). Several plant traits such as leaf age and plant species as well as intensity and duration of the stress are the main determining factors in a plant’s response to the stress (Trupkin et al. 2017). It is noteworthy that most crop plants are glycophytes, which lack salt tolerant and are prone to total failure by salinity stress. Sobhanian et al. (2010) demonstrated the detrimental effects of salt stress in model and crop plants such as rice, wheat, soybean, potato, and Aleuropus lagopoides. They concluded that reducing photosynthesis activity under salt stress was the only common response in the plants. It is crucial to explore the molecular basis of stress tolerance (genetic variation) in important plant traits such as photosynthesis rate under high salt stress. Photosynthesis represents one of the complex pathways in plants and several genes are expected to show differential expression when exposed to salt stress (Redillas et al. 2012; Sewelam et al. 2014; Slama et  al. 2015). Recently, transcriptome analysis as a part of system biology has been extensively used to investigate global gene expression in plants under abiotic stress (Sewelam et al. 2014). Transcriptional profiling under various stresses has been carried out in different plant species, such as Arabidopsis (Maayan et  al. 2008; Blankenberg et al. 2009; Ambavaram et al. 2014), rice (Hippler et al. 2001; Nouri et al. 2013), and barley (Ahuja et al. 2010; Taiz and Zeigler 2010). In tomato, transcriptome analysis has been used to compare patterns of gene expression under salt or drought stress (Kramer 1981; Chaves et al. 2009; Prins et al. 2011). Data suggest that high salt results in ionic and osmotic stresses in plants and the expression of hundreds of stress‐responsive genes is induced by these stresses. Using Arabidopsis transcriptome analysis under salt stress, Sewelam et  al. (2014) revealed the up‐regulation of 1118 genes and 932 genes with 435 overlapping genes by osmotic and ionic stresses, while

8.1 Introduction

down‐regulation of 364 and 367 genes respectively with 154 overlapping genes was also shown. There is substantial progress in our understanding of the salinity tolerance mechanism due to modern techniques, which are helpful in the identification, isolation, and utilization of several genes with critical roles in plant salt tolerance (Quintero et al. 2011; Ren et al. 2013; Si et al. 2014; Tian et al. 2014; Srivastava et al. 2017; Trupkin et al. 2017). However, concerted efforts are required to explore regulatory mechanisms of salt tolerance in order to enhance tolerance in plants (Srivastava et al. 2017). TFs are proteins which are involved in gene expression and regulation in plants under various abiotic stresses. These proteins specifically act as a major link between stress sensory pathways to stress tolerance mechanisms in plants (Deinlein et  al. 2014). Keeping their importance in view, it is speculated that plants contain several different types of TFs which play major roles in transcriptional regulation of genes required for plant growth and development under different stresses (Bartels and Sunkar 2005; Song et al. 2012, 2016). For example, over 5% of A. thaliana’s genome is devoted to encoding more than 1500 TFs (Riechmann et  al. 2000). Lately, reports have provided exciting evidence that has allowed us to better understand the genes involved in abiotic stress response (Knight and Knight 2012; Wei et al. 2015). One of the major advances is the discovery of stress‐induced TFs (Knight and Knight 2012; Ambavaram et  al. 2014; Deinlein et al. 2014; Song et al. 2016). It is reported that plant photosynthetic efficiency can potentially be improved under stress by TF‐induced expression of a set of genes involved in photosynthesis (Song et al. 2016). Expression of a TF, HYR enhances photosynthetic efficiency of rice under multiple environmental conditions (Ambavaram et al. 2014). However, Besides, HYR, only a few TFs have been reported as positive regulators that can enhance photosynthetic capacity by activation of genes involved in photosynthetic machinery (Yang et al. 2015). Several studies have revealed that phytohormones such as abscisic acid (ABA), brassinosteroids, ethylene, gibberellic acid (GA) and jasmonic acid regulate shoot and root growth under different abiotic stresses (Achard et  al. 2006; Munns and Tester 2008; Mayzlish‐Gati et al. 2010; Peleg and Blumwald 2011; Krumova et al. 2013; Dobrikova et al. 2014; Tikkanen et al. 2014; Liu et al. 2015). Under stress, one of first responses of the plant stress tolerance is the regulation of photosynthesis for survival which is dependent on the changes of the levels of various phytohormone pathways (Kilian et al. 2007; Geng et al. 2013). It is reported that salt stress results in ABA and ethylene signaling pathways and positively affects plant growth and development by activating functions of DELLA proteins (Achard et  al. 2006). Furthermore, ABA signaling is also involved in lateral root growth in A. thaliana in the endodermis (Luo et al. 2012; Duan et al. 2013; Van der Does et al. 2017). Further, they showed that the endodermis is the point of cross talk between ABA and GA pathways, which induce root growth in salinity stress. Hence, it appears logical to consider the complex interplay between phytohormones and photosynthetic machinery in plants under different abiotic stresses. However, based on the highly complex nature of these pathways, it is hard to highlight the potential role of each phytohormone in regulating the expression of photosynthetic genes in response to salinity stress (Van der Does et al. 2017). Munns and Tester (2008) suggested that the plant stress tolerance mechanism consists of three components including osmotic tolerance, Na+ exclusion with the involvement of various Na+ transporters and ion channels and tissue tolerance through compartmentalization of excess

141

142

8  Photosynthesis under Abiotic Stresses

Na+ into vacuoles and other tissues, accumulation of compatible solutes, activation antioxidant system and plant hormones. Although several recent breakthrough advances have expanded our understanding of plant salt‐tolerance mechanisms in plants (Yang and Guo 2018), we are still far from a complete understanding, and more work is required to identify key components of the salt stress response, which may be beneficial for the development of efficient strategies to improve crop salt tolerance (Ma et al. 2014). 8.1.4  Cold Stress Plants show a significant reduction in growth and development under cold stress which ultimately limits plant yield and geographical distribution (Thomashow 1998, 1999; Jeon and Kim 2013). Plants usually exhibit two types of injuries. In chilling injury, sensitive plants show measurable physiological dysfunction at temperatures between 10 and 12 °C (Lyons 1973). For example, a sudden change in temperature (from 25 to 10 °C) results in delayed carbon transport in plants and relatively more carbon is used in respiration than growth (Barthel et al. 2014). On the other hand, freezing injury is caused to plants at temperatures below zero. Sorghum plants exposed to low temperatures (2, 5, and 8 °C) exhibited decreased growth and low nitrogen uptake and also underwent a hardening process if exposed to low temperatures for a long time (Ercoli et al. 2004). Plant cells show changes in carbohydrate and secondary metabolism and alteration in photosynthesis under low temperature stress. Plant photosynthesis is highly sensitive and adversely affected by low temperatures. Jeong et al. (2002) demonstrated a steady reduction in photosynthesis of cold sensitive rice cultivars “Milyyang23,” compared to that of cold resistant “Stejaree45” under low temperatures of 5, 10, 15, 20, and 25 °C for 16 hours. Allen and Ort (2001) revealed that oxidative damage occurs in the ETC, due to the over excitation of the reaction centers and carbon supply is inhibited due to decreases in the Rubisco activity and stomatal closure under chilling temperature. Studies have shown that PSII is more sensitive to low temperature than PSI (Huang et al. 2010; Lei et al. 2014). Damage of PSII results in reduced photosynthetic activity, leading to photodamage which ultimately causes generation of ROS. Generation of ROS leads to severe injury of PSII components under photo inhibitory conditions (Osmond 1994). On the other hand, generation of ROS may inhibit protein synthesis, necessary for the repair of photodamage. The D1 protein, required for the repair of PSII, is one of the proteins suppressed by ROS (Lei et al. 2014). The success of photosynthetic apparatus depends on the balance between damage and repair of PSII components during low temperature stress (Allakhverdiev et  al. 2008; Chen et  al. 2013). Similarly, Lei et  al. (2014) have demonstrated that many photosynthesis‐related biochemical traits such as the maximum quantum yield of PSII (Fv/Fm), the maximum photo‐oxidizable P700 (Pm), the energy distribution in PSII, and the redox state of P700 have shown significant changes in seedlings of three promising oilseed crops originating from tropical regions under cold stress. However, several diverse adaptive mechanisms have been reported to cope with low temperature stress to protect plants against chilling and freezing injuries (Chinnusamy et al. 2007). Yadav (2010) described reprogramming of gene expression in plants to re‐adjust their metabolism and developmental programs. Geographical distribution of plants enabled some plants to tolerate low nonfreezing temperatures such as temperate plants (Arabidopsis, winter wheat, and barley) are able

8.1 Introduction

to increase their cold tolerance under low temperatures (Zhao et al. 2015). While plants of tropical and subtropical origin such as maize, cassava, and soybean show no or little tolerance to cold stress and frequently exhibit chilling injury symptoms (An et al. 2012; Rodriguez et al. 2014; Tian et al. 2015). As a matter of fact, cold stress is responsible for a decline in growth and development in C4 plants. Cold stress tolerance in plants has been extensively studied in the last two decades but the complete mechanisms by which plants perceive low temperatures still remain elusive. Understanding the physiological and biochemical processes which play major roles during stress injury and stress tolerance is of immense importance for developing tolerant crop plants. Sage and McKown (2006) discussed possible reasons of poor C4 photosynthetic performance under cold stress and highlighted that several vital C4‐cycle enzymes, phosphoenolpyruvate carboxylase, and pyruvate phosphate dikinase. Lower maximum quantum yield and Rubisco inactivation show a decline in activity, which results in reduced C4 photosynthesis compared to C3 species in low temperature environments. Thus, photosynthesis of C4 plants is more severely affected than C3 plants in response to cold stress. Stress tolerance in plants is a complex phenomenon, which requires integrated events occurring at all organization levels. At the biochemical level, plants re‐establish metabolism by remodeling of cell structures and reprogramming gene expression to accommodate stress. Sharma et  al. (2005) demonstrated that hundreds of genes including photosynthesis related ones were highly down‐regulated in rice seedling at 10 °C for 72 hours, which shows the complexity of the cold tolerance mechanism in rice. Several protective mechanisms to reduce stress injury including an increase in the level of intracellular solutes, the accumulation of cryoprotectants and antioxidants, as well as the induction of antifreeze proteins and cold‐regulated (COR) proteins are actively operating in plants under stress (Uemura et al. 2003; Chen et al. 2015). The above mentioned mechanisms are a few of several which help to protect cell membranes. Cell membrane integrity under cold stress is maintained by stabilizing membrane lipids, maintaining ion homeostasis, and scavenging ROS (Yadav 2010; Hussain et al. 2012). The cold stress tolerance mechanisms have been investigated at the molecular level in the model plant Arabidopsis and also in crop plants such as maize, wheat, and barley (Morran et al. 2011; Sanghera et al. 2011; Jeon and Kim 2013). Recently, Zhang et al. (2017) have characterized physiological and transcriptomic changes in sandalwood (Santalum album L.) seedlings exposed to low temperature (4 °C) for 0–48 hours. A total of 4424 genes showed differential expression including 3075 up‐regulated and 1349 down‐regulated genes. It has been demonstrated that expression of cold‐responsive genes was increased under prolonged stress, particularly genes involved in signal transduction of phytohormones (Zhang et al. 2017). TFs play crucial roles in cold stress tolerance of plants. Plants have evolved a complex network of TFs such as C‐repeat (CRT)‐binding factor/dehydration‐responsive element binding factor (CBF/DREB)‐ dependent and CBF/DREB‐independent pathways, for acclimatization and survival under cold stress. The CBF/DREB‐mediated transcriptional pathway was one of the extensively explored mechanisms in plants under cold stress (Zhao et al. 2015). Park et  al. (2015) revealed that the number of genes (about 100) induced by CBF only accounted for a small percentage of COR genes in freezing tolerance while other cold‐ induced genes showed expression patterns similar to those of CBFs in Arabidopsis in response to a cold environment. Besides Arabidopsis, the CBF/DREB1 TFs are present in a wide array of plants, including crops, such as wild tomato and rice (Zhang et al.

143

144

8  Photosynthesis under Abiotic Stresses

2004; Ito et al. 2006), as well as woody plants, such as gray poplar, frost grape, silver birch, and cider gum (Benedict et al. 2006; Xiao et al. 2006; Welling and Palva 2008; Navarro et  al. 2009). In addition, several signaling molecules such as Ca2+, protein kinase, ROS, and hormones like abscisic acid and gibberellin play crucial roles in remodeling of gene expression under cold stress (Shi et al. 2015). 8.1.5  Heat Stress High temperatures show severe effects on growth and development of plants and often result in yield reduction in crops. Under high temperature conditions, Ben Salem‐ Fnayou et al. (2011) demonstrated that under increasing temperatures, two grapevine cultivars have greater cell wall thicknesses and a reduced carbon metabolism. By the end of this century, the vulnerability of crop plants will increase as a consequence of the greenhouse effect (Loik et al. 2000; Kipp 2007). A. thaliana showed stunted growth at high temperatures and early flower development was also induced compared to the control plants (Kipp 2007). Crop plants like tomato and common beans showed developmental defects in pollen and anther, less flowering, low fruit/seed setting, and reduced yield under heat stress (Peet et al. 1998; Porch and Jahn 2001; Cross et al. 2003). It has been found that high temperatures induce leaf senescence and high root secondary metabolite in Panax quinquefolius (Jochum et  al. 2007). Similarly heat stress decreased quantum efficiency of PSII and increased NPQ in two shrubs (Artemisia tridentata and Erigeron speciosus) and this resulted in impaired hemicelluloses and cellulose synthesis due to reduced photosynthate supply (Suwa et al. 2010). Wang et al. (2008) discovered that the benefits of elevated CO2 to photosynthesis at normal temperatures may be in part offset by negative effects during acute heat stress. Furthermore, data suggest that high temperature induces developmental aberrations in pollen and causes male sterility in rice (Endo et al. 2009). Therefore, it is necessary to find methods to produce plants able to withstand the elevated temperatures. Plants have evolved various physiological and molecular mechanisms to resist heat stress. Physiological studies have indicated that the heat tolerant rice cultivar 996 has better anther dehiscence and pollen fertility rate compared to heat sensitive 4628 cultivars under short‐ and long‐ term exposure to heat stress (Zhang et al. 2008a, b). Studies have shown that tropical and subtropical plants like rice and tomato have significantly reduced net photosynthesis rate and maximal quantum yield of PSII (Vani et al. 2001; Morales et al. 2003; Han et al. 2009; Ahsan et al. 2010; Hasanuzzaman et al. 2013). High temperatures have also severely hampered poplar growth by inducing reduction in electron transport, photosystem damage, and generation of H2O2 (Song et al. 2014). Hasanuzzaman et al. (2013) reviewed the molecular mechanisms of heat stress in different crop species. Prominent physiological traits affected under heat stress include reduction in photosynthetic pigments, decrease in leaf water potential, gas exchange and CO2 assimilation rates, stomatal conductance, intercellular CO2 concentration and total chlorophyll content. Plants tend to improve the photosynthesis rates for achieving best possible growth and development under moderate high temperature. On the other hand, the expression of several potential genes is down‐regulated under severe heat stress. Plant genes involved in important pathways such as the starch and sucrose synthesis cycle, carbon assimilation, Calvin cycles, PSI, PSII, Rubisco binding proteins and both subunits, carbonic anhydrase, electron transport proteins, and ferredoxin‐NADP reductase are down‐regulated

8.2  Overexpression of Photosynthesis Genes

following exposure to heat (Han et al. 2009; Ahsan et al. 2010). It is demonstrated that reduced photosynthesis in rice flag leaves was mainly due to inactivation of genes involved in PSII which impaired photosynthetic apparatus under heat stress (Karsten and Holzinger, 2012; Zhang et al. 2013). Several high throughput techniques like microarray, and transcriptome and metabolome analysis have been employed by researchers to systematically explore the underlying molecular mechanisms in heat stress tolerance of plants (Gonzali et  al. 2005; Yamakawa and Hakata 2010; Zhang et  al. 2012a, b, 2013). Based on the expression data from different plant species under different tissue types, developmental stages, and growth conditions, it is estimated that heat stress affects approximately 2% of the plant genome (Pego et al. 2000; Eberhard et al. 2008; Foyer et al. 2012). These genes are primarily involved in the stress response network.

8.2 ­Overexpression of Photosynthesis Related Genes and Transcription Factors Molecular and genomic analyses have facilitated gene discovery (Abe et al. 2003; Seki et al. 2001, 2007; Tran et al. 2004) and enabled genetic engineering using several functional or regulatory genes to activate or repress specific or broad pathways in response to environmental stresses in plants (Trujillo et  al. 2009; Hussain et  al. 2011). Overexpression of different structural, regulatory or photosynthesis related genes such as glycine betaine in rice and tomato (Su et al. 2006; Park et al. 2007); betaine aldehyde dehydrogenase in sweet potato (Fan et al. 2012); OsSbp cDNA from an Indica rice (Feng et al. 2007); plastidal protein synthesis elongation factor in wheat (Fu et al. 2008); chloroplast small heat shock protein in tomato (Wang et al. 2005); sucrose non‐fermenting1‐related protein kinase 2 in Arabidopsis (Zhang et al. 2010); Na+/H+ antiporter in Arabidopsis and cotton (He et  al. 2005; Brini et  al. 2007); and aquaporin in tobacco (Aharon et al. 2003) have improved plant performance under abiotic stresses. Transgenic model/crop plants have demonstrated improvement in one or more traits that are directly affected by abiotic stress conditions. TFs act as master switches in gene expression and environmental stress responses. The importance of TFs is evident from the fact that plants reserve a big portion of their genome to TFs genes. Researchers have noticed 1500 TFs so far in the Arabidopsis genome (Ratcliffe and Riechmann, 2002). These TFs can be classified into several families based on the structure of their binding domains. Of a number of TFs listed elsewhere (Saibo et al. 2009; Hussain et al. 2011), several members of the MYB, MYC, ERF, bZIP, and WRKY TF families have already been extensively studied in gene regulation under abiotic stresses (Schwechheimer et al. 1998; Singh et al. 2002; Hussain et al. 2011). Elucidation of the molecular mechanism of the gene expression for a particular trait and to find out the role of different types of TFs is a major focus for molecular biologists. In fact, manipulation of gene regulatory elements attracts huge scientific attention for genetic engineering purposes, which has shown promising results under abiotic stresses. Hussain et al. (2011) have reviewed several TFs involved in gene regulation of photosynthesis and abiotic stresses. For example, a bZIP TF designated as ABP9 (ABRE binding protein 9) specifically binds to ABRE2 motif. Zhang et al. (2008a, b) used ABP9 gene in a study to investigate its role under multiple stresses like drought and heat separately or in combination. Transgenic Arabidopsis plants carrying ABP9 exhibited a significant

145

146

8  Photosynthesis under Abiotic Stresses

increase in the photosynthetic capacity of plants under both stresses (drought and heat stresses). This is mainly attributed to several factors like the photosynthetic pigment composition, dissipating excess light energy, elevating carbon‐use efficiency, and increasing ABA content and instantaneous water use efficiency (Zhang et al. 2008a, b). In addition to this, regulation of genes responsible for protection of PSII system further highlighted the importance of ABP9 in improving the plant’s photosynthetic capacity under both stresses (Zhang et al. 2008a, b). Similarly, several studies reported HY5 (LONG HYPOCOTYL 5), a bZIP‐type TF. This TF besides other abiotic stresses was mainly involved in CAB gene regulation and expression by light (Chattopadhyay et al. 1998; Maxwell et al. 2003; Saibo et al. 2009). Furthermore, despite controlling the expression of Chl a/b, binding protein 2 (CAB2) (Maxwell et al. 2003) regulates the expression of the gene for the Rubisco small subunit (RbcS1A) (Chattopadhyay et  al. 1998, Lee et  al. 2007). Over‐expression of OsMYB4 resulted in high accumulation of glycine betaine in A. thaliana which exhibited not only stress tolerance but also maintained photosynthesis (Mattana et al. 2005), because glycine betaine has the ability to stabilize Rubisco’s structure under high salinity stress (Sakamoto and Murata 2002, Yang et al. 2005, Khafagy et al. 2009). Thus, OsMYB4 TF has an indirect effect on the regulation of photosynthetic genes under stressful environments (Ashraf and Harris 2013). Zhou and Li (2016) demonstrated that over‐expression of BpMYB106, a R2R3‐MYB TF, up‐regulates several genes involved in the photosynthesis and oxidative phosphorylation pathways. RNA‐Seq profiling further revealed that BpMYB106 directly activates the expression of a range of photosynthesis related genes in the leaves of transgenic birch (Betula platyphylla Suk.) through interacting with the MYB2 element in their promoters. As a consequence, all transgenic plants showed higher leaf water use efficiency, significantly increased net photosynthesis rate, improved growth rate, and increased plant height (Zhou and Li 2016). As a matter of fact, there is clear evidence that TFs are becoming valuable tools and likely to be a prominent part of the next generation of successful biotechnology crops (Hymus et al. 2013; Kobayashi et al. 2013).

8.3 ­Conclusions and Future Perspectives Environmental stresses are great challenges for the growth and development of plants and it is evident from the above discussion that environmental stresses result in a huge reduction in photosynthetic performance of plants (Rahnama et  al. 2010; Taiz and Zeiger 2010). Commercially improved crop performance under drought conditions has been challenging because of the multitude of factors that influence photosynthetic pathways (Gowik et al. 2011; Brautigam et al. 2011). Several studies have shown that reduction in damage to photosynthetic apparatus significantly decreases assimilates and ultimately reduces crop yield. Response to the specific stress is highly dependent on the level of tolerance or susceptibility of plants to the stress which is mostly controlled by the expression of nuclear genes and proteins. Nevertheless, advances in genomic tools for discovery and functional analysis, together with high‐throughput sequencing technologies, have increased the possibility of achieving stress tolerant plants (Kulahoglu et al. 2014). These high throughput techniques have enabled the identification of several crucial genes related to the plant’s response to environmental stresses and many of

­  References

these genes have already been shown to be effective for engineering stress tolerance in model plants (Bartels and Hussain 2008; Hussain et al. 2011, 2012). The improvement of photosynthetic performance is a promising strategy to improve crop yield and might replicate the gains of the Green Revolution (Schuler et al. 2016). There are four major multi‐subunit protein complexes in the process of photosynthesis. Abiotic stresses severely affect all these complexes. However, researchers have highlighted the significant role which PSII plays under different stresses. Therefore, research strategies should be directed more toward strengthening the photosynthesis system, especially to PSII. Improvements in the photosynthetic performance of C3 plants, to put it on a par with that of C4 plants, has been the premier goal of plant biotechnology (Wang et al. 2014a, b). Previous efforts to engineer C3 plants overexpressing multiple C4 enzymes have met with limited success because of the lack of detailed mechanistic knowledge. However, due to the complexity of traits, several multinational research consortia have now set out to improve the productivity of crops, such as rice and wheat, by introducing in them the C4 photosynthetic pathway (Hibberd et al. 2008; Zhu et al. 2008; Ghannoum et al. 2011; Kajala et  al. 2012; von Caemmerer et  al. 2012; Wang et  al. 2013). In fact, the improvement of photosynthetic performance represents a promising strategy to tackle yield related problems and might serve as the foundation of a second green revolution in future (Schuler et al. 2016).

­References Abe, H., Urao, T., Ito, T. et al. (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63–78. Achard, P., Cheng, H., Grauwe, L.D. et al. (2006). Integration of plant responses to environmentally activated phytohormonal signals. Science 311: 9194. Aharon, R., Shahak, Y., Wininger, S. et al. (2003). Overexpression of a plasma membrane aquaporin in transgenic tobacco improves plant vigor under favorable growth conditions but not under drought or salt stress. Plant Cell 15: 439–447. Ahsan, N., Donnart, T., Nouri, M.Z., and Komatsu, S. (2010). Tissue‐specific defense and thermo‐adaptive mechanisms of soybean seedlings under heat stress revealed by proteomic approach. J. Proteome Res. 9: 4189–4204. Ahuja, I., de Vos, R.C., Bones, A.M., and Hall, R.D. (2010). Plant molecular stress responses face climate change. Trends Plant Sci. 15: 664–674. Alam, M.M., Nahar, K., Hasanuzzaman, M., and Fujita, M. (2014a). Exogenous jasmonic acid modulates the physiology, antioxidant defense and glyoxalase systems in imparting drought stress tolerance in different Brassica species. Plant Biotech Rep 8: 279–293. Alam, M.M., Nahar, K., Hasanuzzaman, M., and Fujita, M. (2014b). Trehalose‐induced drought stress tolerance: A comparative study among different Brassica species. Plant Om 7: 271–283. Allakhverdiev, S.I., Kreslavski, V.D., Klimov, V.V. et al. (2008). Heat stress: an overview of molecular responses in photosynthesis. Photosynth. Res. 98: 541–550. Allen, D.J. and Ort, D.R. (2001). Impacts of chilling temperatures on photosynthesis in warm‐climate plants. Trends Plant Sci. 9: 36–42.

147

148

8  Photosynthesis under Abiotic Stresses

Ambavaram, M.M.R., BAsu, S., Krishnan, A. et al. (2014). Coordinated regulation of photosynthesis in rice increases yield and tolerance to environmental stress. Nat. Commun. 5: 5302. An, D., Yang, J., and Zhang, P. (2012). Transcriptome profiling of low temperature‐treated cassava apical shoots showed dynamic responses of tropical plant to cold stress. BMC Genomics 13: 64. Arve, L.E.L., Torre, S.L., Olsen, J.E.L., and Tanino, K.K. (2011). Stomatal responses to drought stress and air humidity. In: Abiotic Stress in Plants – Mechanisms and Adaptations (ed. A. Shanker and B. Venkateswarlu), 267–280. IntechOpen. Ashraf, M. and Foolad, M.R. (2007). Roles of glycinebetaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 59: 206–216. Ashraf, M. and Harris, P.J.C. (2013). Photosynthesis under stressful environments: An overview. Photosynthetica 51: 163–190. Asrar, A.W.A. and Elhindi, K.M. (2011). Alleviation of drought stress of marigold (Tagetes erecta) plants by using arbuscular mycorrhizal fungi. Saudi J. Biol. Sci. 18: 93–98. Baker, N.R. (2008). Chlorophyll fluorescence: a probe of photosynthesis in vivo. Annu. Rev. Plant Biol. 59: 89–113. Barnabas, B., Jager, K., and Feher, A. (2008). The effect of drought and heat stress on reproductive processes in cereals. Plant Cell Environ. 31: 11–38. Bartels, D. and Hussain, S.S. (2008). Current status and implications of engineering drought tolerance in plants using transgenic approaches. CAB Rev: Perspect Agric Vet Sci Nutr Nat Resour. 3: 020. Bartels, D. and Sunkar, R. (2005). Drought and salt tolerance in plants. Crit. Rev. Plant Sci. 24: 23–58. Barthel, M., Cieraad, E., Zakharova, A., and Hunt, J.E. (2014). Sudden cold temperature delays plant carbon transport and shifts allocation from growth to respiratory demand. Biogeosciences 11: 1425–1433. Bartholomew, D.M., Bartley, G.E., and Scolnik, P.A. (1991). Abscisic acid control of rbcS and cab transcription in tomato leaves. Plant Physiol. 96: 291–296. Ben Salem‐Fnayou, A., Bouamama, B., Ghorbel, A., and Mliki, A. (2011). Investigations on the leaf anatomy and ultrastructure of grapevine (Vitis vinifera) under heat stress. Microsc. Res. Tech. 74: 756–762. Benedict, C., Skinner, J.S., Meng, R. et al. (2006). The CBF1‐dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp. Plant Cell Environ. 29: 1259–1272. Bhatnagar‐Mathur, P., Devi, M.J., Reddy, D.S. et al. (2007). Stress‐inducible expression of AtDREB1A in transgenic peanut (Arachis Hypogaea L.) increases transpiration efficiency under water‐limiting conditions. Plant Cell Rep. 26: 2071–2082. Blankenburg, M., Haberland, L., Elvers, H.D. et al. (2009). High‐throughput omics technologies: potential tools for the investigation of influences of EMF on biological systems. Curr. Genomics 10: 86–92. Boyer, J.S. (1982). Plant productivity and environment. Science 218: 443–448. Brautigam, A., Kajala, K., Wullenweber, J. et al. (2011). An mRNA blueprint for C4 photosynthesis derived from comparative transcriptomics of closely related C3 and C4 species. Plant Physiol. 155: 142–156. Bray, E.A. (2004). Genes commonly regulated by water‐deficit stress in Arabidopsis thaliana. J. Exp. Bot. 55: 2331–2341.

­  References

Brini, F., Hanin, M., Mezghani, I. et al. (2007). Overexpression of wheat Na+/H+antiporter TNHX1 and H+−pyrophosphatase TVP1 improve salt‐ and drought‐stress tolerance in Arabidopsis thaliana plants. J. Exp. Bot. 58: 301–308. Cabido, M., Pons, E., Cantero, J.J. et al. (2007). Photosynthetic pathway variation among C 4 grasses along a precipitation gradient in Argentina. J. Biogeogr. 35: 131–140. Capell, T., Bassie, L., and Christou, P. (2004). Modulation of the polyamine biosynthetic pathway in transgenic rice confers tolerance to drought stress. Proc. Natl. Acad. Sci. U. S. A. 101: 9909–9914. Century, K., Reuber, T.L., and Ratcliffe, O.J. (2008). Regulating the regulators: the future prospects for transcription‐factor‐based agricultural biotechnology products. Plant Physiol. 147: 20–29. Chattopadhyay, S., Ang, L.H., Puente, P. et al. (1998). Arabidopsis bZIP protein HY5 directly interacts with light‐responsive promoters in mediating light control of gene expression. Plant Cell 10: 673–683. Chaves, M.M., Flexas, J., and Pinheiro, C. (2009). Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Ann. Bot. 103: 551–560. Chaves, M.M., Maroco, J.P., and Pereira, J.S. (2003). Understanding plant responses to drought‐from genes to the whole plant. Funct. Plant Biol. 30: 239–264. Chen, H., Chen, X., Chen, D. et al. (2015). Comparison of the low temperature transcriptomes of two tomato genotypes that differ in freezing tolerance: Solanum lycopersicum and Solanum habrochaites. BMC Plant Biol. 15: 132. Chen, K., Chen, L., Fan, J., and Fu, J. (2013). Alleviation of heat damage to photosystem II by nitric oxide in tall fescue. Photosynth. Res. 116: 21–31. Chinnusamy, V., Zhu, J., and Zhu, J.K. (2007). Cold stress regulation of gene expression in plants. Trends Plant Sci. 12: 444–451. Clauw, P., Coppens, F., De Beuf, K. et al. (2015). Leaf responses to mild drought stress in natural variants of Arabidopsis thaliana. Plant Physiol. 167: 800–816. Cortleven, A., Nitschke, S., Klaumunzer, M. et al. (2014). A novel protective function for cytokinin in the light stress response in mediated by the ARABIDOPSIS HISTIDINE KINASE2 and ARABIDOPSIS HISTIDINE KINASE3 receptors. Plant Physiol. 164: 1470–1483. Cramer, G. (2002). Sodium‐calcium interactions under salinity stress. In: Salinity. Environment‐Plants‐ Molecules (ed. A. Lauchli and U. Luttge), 205–227. Dordrecht: Kluwer Academic Publishers. Cross, R.H., Mckay, S.A.B., Mchughen, A., and Bonham‐Smith, P.C. (2003). Heat‐stress effects on reproduction and seed set in Linum usitatissimum L. (flax). Plant Cell Environ. 26: 1013–1020. De Oliveira, A.B., Mendes Alencar, N.L., and Gomes‐Filho, E. (2013). Comparison between the water and salt stress effects on plant growth and development. In: Responses of Organisms to Water Stress. (ed. S. Akinci), 67–94. InTechopen. Degenkolbe, T., Do, P.T., Zuther, E. et al. (2009). Expression profiling of rice cultivars differing in their tolerance to long‐term drought stress. Plant Mol. Biol. 69: 133–153. Deinlein, U., Stephan, A.B., Horie, T. et al. (2014). Plant salt‐tolerance mechanisms. Trends Plant Sci. 19: 371–379. Dinneny, J.R., Long, T.A., Wang, J.Y. et al. (2008). Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science 320: 942–945.

149

150

8  Photosynthesis under Abiotic Stresses

Dobrikova, A.G., Vladkova, R.S., Rashkov, G.D. et al. (2014). Effects of exogenous 24‐ epibrassinolide on the photosynthetic membranes under non‐stress conditions. Plant Physiol. Biochem. 80: 75–82. Duan, L., Dietrich, D., Ng, C.H. et al. (2013). Endodermal ABA Signaling promotes lateral root quiescence during salt stress in Arabidopsis seedlings. Plant Cell Online. 25: 324–341. Eberhard, S., Finazzi, G., and Wollman, F.A. (2008). The dynamics of photosynthesis. Annu. Rev. Genet. 42: 463–515. Endo, M., Tsuchiya, T., Hamada, K. et al. (2009). High temperatures cause male sterility in rice plants with transcriptional alterations during pollen development. Plant Cell Physiol. 50: 1911–1922. Ercoli, L., Mariotti, M., Masoni, A., and Arduini, I. (2004). Growth responses of sorghum plants to chilling temperature and duration of exposure. Eur. J. Agron. 21: 93–103. Erice, G., Irigoyen, J.J., Pérez, P. et al. (2006). Effect of elevated CO2, temperature and drought on photosynthesis of nodulated alfalfa during a cutting regrowth cycle. Physiol. Plant. 126: 458–468. Fan, W., Zhang, M., Zhang, H., and Zhang, P. (2012). Improved tolerance to various abiotic stresses in transgenic sweet potato (Ipomoea batatas) expressing spinach betaine aldehyde dehydrogenase. PLoS One 7: e37344. Farooq, M., Wahid, A., Kobayashi, N. et al. (2009). Plant drought stress: effects, mechanisms and management. Agron Sust Develop. 29: 185–212. Feng, L.L., Han, Y.J., Liu, G. et al. (2007). Overexpression of sedoheptulose‐1, 7‐ bisphosphatase enhances photosynthesis and growth under salt stress in transgenic rice plants. Funct. Plant Biol. 34: 822–834. Flexas, J., Bota, J., Loreto, F. et al. (2004). Diffusive and metabolic limitations to photosynthesis under drought and salinity in C(3) plants. Plant Bio. 6: 269–279. Flexas, J., Galle, A., Galmes, J. et al. (2012). The response of photosynthesis to soil water stress. In: Plant Responses to Drought Stress: From Morphological to Molecular Features (ed. R. Aroca), 27–36. Berlin: Springer‐Verlag. Flexas, J., Ribas‐Carbo, M., Diaz‐Espejo, A. et al. (2008). Mesophyll conductance to CO2: current knowledge and future prospects. Plant Cell Environ. 31: 602–612. Flexas, J. and Medrano, H. (2002). Drought‐inhibition of photosynthesis in C3 plants: Stomatal and non‐stomatal limitations revisited. Ann. Bot. 89: 183–189. Foyer, C.H. and Noctor, G. (2005). Redox homeostasis and antioxidant signalling: a metabolic Interface between stress perception and physiological responses. Plant Cell Online 17: 1866–1875. Foyer, C.H. and Shigeoka, S. (2011). Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiol. 155: 93–100. Foyer, C.H., Neukermans, J., Queval, G. et al. (2012). Photosynthetic control of electron transport and the regulation of gene expression. J. Exp. Bot. 63: 1637–1661. Fricke, W. and Peters, W.S. (2002). The biophysics of leaf growth in salt‐stressed barley. A study at the cell level. Plant Physiol. 129: 374–388. Fu, J., Momcilović, I., Clemente, T.E. et al. (2008). Heterologous expression of a plastid EF‐Tu reduces protein thermal aggregation and enhances CO2 fixation in wheat (Triticum aestivum) following heat stress. Plant Mol. Biol. 68: 277–288. Geng, Y., Wu, R., Wee, C.W. et al. (2013). A spatio‐temporal understanding of growth regulation during the salt stress response in Arabidopsis. Plant Cell 25: 2132–2154.

­  References

Ghannoum, O., Evans, J.R., and von Caemmerer, S. (2011). Nitrogen and water use efficiency of C4 plants. In: C4 Photosynthesis and Related CO2 Concentrating Mechanisms (ed. A.S. Raghavendra and R.F. Sage), 129–146. Netherlands: Springer. Gibson, K., Park, J.S., Nagai, Y. et al. (2011). Exploiting leaf starch synthesis as a transient sink to elevate photosynthesis, plant productivity and yields. Plant Sci. 181: 275–281. Gonzali, S., Loreti, E., Novi, G. et al. (2005). The use of microarrays to study the anaerobic response in Arabidopsis. Ann. Bot. 96: 661–668. Gorantla, M., Babu, P.R., Lachagari, V.B.R. et al. (2007). Identification of stress‐responsive genes in an indica rice (Oryza sativa L.) using ESTs generated from drought‐stressed seedlings. J. Exp. Bot. 58: 253–265. Gowik, U., Brautigam, A., Weber, K.L. et al. (2011). Evolution of C4 photosynthesis in the genus Flaveria: how many and which genes does it take to make C4? Plant Cell 23: 2087–2105. Grassi, G. and Magnani, F. (2005). Stomatal, mesophyll conductance and biochemical limitations to photosynthesis as affected by drought and leaf ontogeny in ash and oak trees. Plant Cell Env. 28: 834–849. Gunawardana, D. (2008). Supercharging the rice engine. Rice Today 7: 20–21. Gupta, N. and Thind, S. (2015). Improving photosynthetic performance of bread wheat under field drought stress by foliar applied glycine betaine. J Agric Sci Tech. 17: 75–86. Gururani, M.A., Mohanta, T.K., and Bae, H. (2015). Current understanding of the interplay between phytohormones and photosynthesis under environmental stress. Int. J. Mol. Sci. 16: 19055–19085. Han, F., Chen, H., Li, X.J. et al. (2009). A comparative proteomic analysis of rice seedlings under various high‐temperature stresses. Biochim. Biophys. Acta 1794: 1625–1634. Hasanuzzaman, M., Nahar, K., Alam, M.M. et al. (2013). Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int. J. Mol. Sci. 14: 9643–9684. Hayano‐Kanashiro, C., Calderon‐Vazquez, C., Ibarra‐Laclette, E. et al. (2009). Analysis of gene expression and physiological responses in three Mexican maize landraces under drought stress and recovery irrigation. PLoS One 4: e7531. Hazen, S.P., Pathan, M.S., Sanchez, A. et al. (2005). Expression profiling of rice segregating for drought tolerance QTLs using a rice genome array. Funct. Integr. Genom. 5: 104–116. He, C., Yan, J., Shen, G. et al. (2005). Expression of an Arabidopsis vacuolar sodium/proton antiporter gene in cotton improves photosynthetic performance under salt conditions and increases fiber yield in the field. Plant Cell Physiol. 46: 1848–1854. Hernandez, J.A., Olmos, E., Corpas, F.J. et al. (1995). Salt‐induced oxidative stress in chloroplasts of pea plants. Plant Sci. 105: 151–167. Hibberd, J.M., Sheehy, J.E., and Langdale, J.A. (2008). Using C4 photosynthesis to increase the yield of rice‐rationale and feasibility. Curr. Opin. Plant Biol. 11: 228–231. Hippler, M., Klein, J., Fink, A. et al. (2001). Towards functional proteomics of membrane protein complexes: analysis of thylakoid membranes from Chlamydomonas reinhardtii. Plant J. 28: 595–606. Hsiao, T.C. (1973). Plant responses to water stress. Annu. Rev. Plant Physiol. 24: 519–570. Huang, W., Zhang, S.B., and Cao, K.F. (2010). Stimulation of cyclic electron flow during recovery after chilling‐induced photoinhibition of PSII. Plant Cell Physiol. 51: 1922–1928. Hussain, S.S., Kayani, M.A., and Amjad, M. (2011). Transcription factors as tools to engineer enhanced drought stress tolerance in plants. Biotechnol. Prog. 27: 297–306.

151

152

8  Photosynthesis under Abiotic Stresses

Hussain, S.S., Raza, H., Afzal, I., and Kayani, M.A. (2012). Transgenic plants for abiotic stress tolerance: current status. Arch. Agron. Soil Sci. 58: 693–721. Hussain, S.S. and Siddique, K.H.M.L.S. (2014). Towards integration of bacterial genomics in plants for enhanced abiotic stress tolerance: clues from transgenics. Adv. Environ. Res. 33: 65–122. Hymus, G.J., Cai, S., Kohl, E.A. et al. (2013). Application of HB17, an Arabidopsis classII homeodomain‐leucine zipper transcription factor, to regulate chloroplast number and photosynthetic capacity. J. Exp. Bot. 64: 4479–4490. Ito, Y., Katsura, K., Maruyama, K. et al. (2006). Functional analysis of rice DREB1/CBF‐ type transcription factors involved in cold‐responsive gene expression in transgenic rice. Plant Cell Physiol. 47: 141–153. Jeon, J. and Kim, J. (2013). Cold stress signaling networks in Arabidopsis. J. Plant Biol. 56: 69–76. Jeong, S.W., Choi, S.M., Lee, D.S. et al. (2002). Differential susceptibility of photosynthesis to light‐cold stress in rice (Oryza sativa L.) depends on the capacity for photochemical dissipation of light. Mol. Cells 13: 419–428. Ji, K., Wanga, Y., Sunb, W. et al. (2012). Drought‐responsive mechanisms in rice genotypes with contrasting drought tolerance during reproductive stage. J. Plant Physiol. 169: 336–344. Jochum, G.M., Mudge, K.W., and Thomas, R.B. (2007). Elevated temperatures increase leaf senescence and root secondary metabolite concentrations in the understory herb Panax quinquefolius (Araliaceae). Am. J. Bot. 94: 819–826. Kajala, K., Brown, N.J., Williams, B.P. et al. (2012). Multiple Arabidopsis genes primed for recruitment into C4 photosynthesis. Plant J. 69: 47–56. Kao, W.Y., Tsai, H., and Tsai, T.T. (2001). Effect of NaCl and nitrogen availability on growth and photosynthesis of seedlings of a mangrove species, Kandelia candel (L.) Druce. J. Plant Physiol. 158: 841–846. Karaba, A., Dixit, S., Greco, R. et al. (2007). Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene. Proc. Natl. Acad. Sci. U. S. A. 104: 15270–15275. Karsten, U. and Holzinger, A. (2012). Light, temperature, and desiccation effects on photosynthetic activity, and drought‐induced ultrastructural changes in the green alga Klebsormidium dissectum (Streptophyta) from a high alpine soil crust. Microb. Ecol. 63: 51–63. Kathuria, H., Giri, J., Tyagi, H., and Tyagi, A.K. (2007). Advances in transgenic rice biotechnology. Crit. Rev. Plant Sci. 26: 65–103. Khafagy, M.A., Arafa, A.A., and El‐Banna, M.F. (2009). Glycinebetaine and ascorbic acid can alleviate the harmful effects of NaCl salinity in sweet pepper. Aust. J. Crop. Sci. 3: 257–267. Khalili, M. and Naghavi, M.R. (2017). Proteins involved in the molecular mechanisms of plant photosynthesis under drought stress. Inter J Agri Biosci 6: 42–48. Kilian, J., Whitehead, D., Horak, J. et al. (2007). The AtGenExpress global stress expression data set: protocols, evaluation and model data analysis of UV‐B light, drought and cold stress responses. Plant J. 50: 347–363. Kipp, E. (2007). Heat stress effects on growth and development in three ecozypes of varying latitude of Arabidopsis. Appl. Ecol. Environ. Res. 6: 1–14.

­  References

Knight, M.R. and Knight, H. (2012). Low‐temperature perception leading to gene expression and cold tolerance in higher plants. New Phytol. 195: 737–751. Kobayashi, K., Sasaki, D., Noguchi, K. et al. (2013). Photosynthesis of root chloroplasts developed in Arabidopsis lines overexpressing GOLDEN2‐LIKE transcription factors. Plant Cell Physiol. 54: 1365–1377. Kramer, P.J. (1981). Carbon‐dioxide concentration, photosynthesis, and dry‐matter production. Bioscience 31: 29–33. Krumova, S., Zhiponova, M., Dankov, K. et al. (2013). Brassinosteroids regulate the thylakoid membrane architecture and the photosystem II function. J. Photochem. Photobiol. B Biol. 126: 97–104. Kulahoglu, C., Denton, A.K., Sommer, M. et al. (2014). Comparative transcriptome atlases reveal altered gene expression modules between two Cleomaceae C3 and C4 plant species. Plant Cell 26: 3243–3260. Lawlor, D.W. and Cornic, G. (2002). Photosynthetic carbon assimilation and associated metabolism in relation to water deficits in higher plants. Plant Cell Environ. 25: 275–294. Lee, Y.P., Kim, S.H., Bang, J.W. et al. (2007). Enhanced tolerance to oxidative stress in transgenic tobacco plants expressing three antioxidant enzymes in chloroplasts. Plant Cell Rep. 26: 591–598. Lei, Y., Zheng, Y., Dai, K. et al. (2014). Different responses of photosystem I and photosystem II in three tropical oilseed crops exposed to chilling stress and subsequent recovery. Trees 28: 923–933. Lisar, S.Y.S., Motafakkerazad, R., Hossain, M.M., and Rahman, I.M.M. (2012). Water stress in plants: causes, effects and responses. In: Water Stress. Janeza Trdine 9, vol. 51000 (ed. I.M.M. Rahman and H. Hasegawa), 1–15. Croatia: Rijeka. Liu, C.C., Liu, Y.G., Guo, K. et al. (2010). Influence of drought intensity on the response of six woody karst species subjected to successive cycles of drought and rewatering. Physiol. Plant. 139: 39–54. Liu, W., Li, R.J., Han, T.T. et al. (2015). Salt stress reduces root meristem size by nitric oxide‐mediated modulation of auxin accumulation and signaling in Arabidopsis. Plant Physiol. 168: 343–356. Loik, M.E., Redar, S.P., and Harte, J. (2000). Photosynthetic responses to a climate‐warming manipulation for contrasting meadow species in the rocky mountains, Colorado, USA. Funct. Ecol. 14: 166–175. Luo, M., Wang, Y.Y., Liu, X. et al. (2012). HD2C interacts with HDA6 and is involved in ABA and salt stress response in Arabidopsis. J. Exp. Bot. 63: 3297–3306. Lyons, J.M. (1973). Chilling injury in plants. Annu. Rev. Plant Physiol. 24: 445–466. Ma, D.M., Xu, W.R., Li, H.W. et al. (2014). Coexpression of the Arabidopsis SOS genes enhances salt tolerance in transgenic tall fescue (Festuca arundinacea Schreb.). Protoplasma 251: 219–231. Ma, S.S., Gong, Q.Q., and Bohnert, H.J. (2006). Dissecting salt stress pathways. J. Exp. Bot. 57: 1097–1107. Maayan, I., Shaya, F., Ratner, K. et al. (2008). Photosynthetic activity during olive (Olea europaea) leaf development correlates with plastid biogenesis and RuBisCO levels. Physiol. Plant. 134: 547–558. Mahajan, S. and Tuteja, N. (2005). Cold, salinity and drought stresses: an overview. Arch. Biochem. Biophys. 444: 139–158.

153

154

8  Photosynthesis under Abiotic Stresses

Marcelis, L.F.M. and Hooijdonk, J.V. (1999). Effect of salinity on growth, water use and nutrient use in radish (Raphanus sativus L.). Plant Soil 215: 57–64. Mattana, M., Biazzi, E., Consonni, R. et al. (2005). Overexpression of Osmyb4 enhances compatible solute accumulation and increases stress tolerance of Arabidopsis thaliana. Physiol. Plant. 125: 212–223. Maxwell, B.B., Andersson, C.R., Poole, D.S. et al. (2003). HY5, circadian clock‐associated 1, and a cis‐element, DET1 dark response element, mediate DET1 regulation of chlorophyll a/b‐binding protein 2 expression. Plant Physiol. 133: 1565–1577. Mayzlish‐Gati, E., LekKala, S.P., Resnick, N. et al. (2010). Strigolactones are positive regulators of light‐harvesting genes in tomato. J. Exp. Bot. 61: 3129–3136. Medrano, H., Escalona, J.M., Bota, J. et al. (2002). Regulation of photosynthesis of C3 plants in response to progressive drought: Stomatal conductance as a reference parameter. Ann. Bot. 89: 895–905. Meloni, D.A., Oliva, M.A., Ruiz, H.A., and Martinez, C.A. (2001). Contribution of proline and inorganic solutes to osmotic adjustment in cotton under salt stress. J. Plant Nutr. 24: 599–612. Memon, S.A., Hou, X., and Wang, L. (2010). Morphological analysis of salt stress response of pak choi. Electron. J. Environ. Agric. Food Chem. 9: 248–254. Mickelbart, M.V., Hasegawa, P.M., and Bailey‐Serres, J. (2015). Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat. Rev. Genet. 16: 237–251. Mohammad, M., Shibli, R., Ajlouni, M., and Nimri, L. (1998). Tomato root and shoot responses to salt stress under different levels of phosphorus nutrition. J. Plant Nutr. 21: 1667–1680. Mohammadi‐Nejad, G., Singh, R., Arzani, A. et al. (2010). Evaluation of salinity tolerance in rice genotypes. Int. J. Plant Prod. 4: 199–208. Monneveux, P., Rekika, D., Acevedo, E., and Merah, O. (2006). Effect of drought on leaf gas exchange, carbon isotope discrimination, transpiration efficiency and productivity in field grown durum wheat genotypes. Plant Sci. 170: 867–872. Morales, D., Rodriguez, P., Dellamico, J. et al. (2003). High‐temperature preconditioning and thermal shock imposition affects water relations, gas exchange and root hydraulic conductivity in tomato. Biol. Plant. 47: 203–208. Morran, S., Eini, O., Pyvovarenko, T. et al. (2011). Improvement of stress tolerance of wheat and barley by modulation of expression of DREB/CBF factors. Plant Biotechnol. J. 9: 230–249. Moumeni, A., Satoh, K., Kondoh, H. et al. (2011). Comparative analysis of root transcriptome profiles of two pairs of drought‐tolerant and susceptible rice near‐ isogenic lines under different drought stress. BMC Plant Biol. 11: 174. Munns, R. and Tester, M. (2008). Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 59: 651–681. Nakabayashi, R., Yonekura‐Sakakibara, K., Urano, K. et al. (2014). Enhancement of oxidative and drought tolerance in Arabidopsis by over‐accumulation of antioxidant flavonoids. Plant J. 77: 367–379. Nath, K., Jajoo, A., Poudyal, R.S. et al. (2013). Towards a critical understanding of the photosystem II repair mechanism and its regulation during stress conditions. FEBS Lett. 587: 3372–3381. Navarro, M., Marque, G., Ayax, C. et al. (2009). Complementary regulation of four Eucalyptus CBF genes under various cold conditions. J. Exp. Bot. 60: 2713–2724.

­  References

Negi, J., Hashimoto‐Sugimoto, M., Kusumi, K., and Iba, K. (2014). New approaches to the biology of stomatal guard cells. Plant Cell Physiol. 55: 241–250. Nishiyama, Y. and Murata, N. (2014). Revised scheme for the mechanism of photoinhibition and its application to enhance the abiotic stress tolerance of the photosynthetic machinery. Appl. Microbio. Biotechnol. 98: 8777–8796. Niyogi, K.K., Bjorkman, O., and Grossman, A.R. (1997). The roles of specific xanthophylls in photoprotection. Proc. Natl. Acad. Sci. 94: 14162–14167. Nouri, M.Z., Moumeni, A., and Komatsu, S. (2015). Abiotic stresses: insight into gene regulation and protein expression in photosynthetic pathways of plants. Int. J. Mol. Sci. 16: 20392–20416. Nouri, M.Z. and Komatsu, S. (2013). Subcellular protein overexpression to develop abiotic stress tolerant plants. Front. Plant Sci. 4: 2. Ort, D.R. and Baker, N.R. (2002). A photoprotective for O2 as an alternative electron sink in photosynthesis. Curr. Opin. Plant Biol. 5: 193–198. Osakabe, Y., Osakabe, K., Shinozaki, S., and Tran, L.S.P. (2014). Response of plants to water stress. Front. Plant Sci. 5: 86. Osborne, C.P. (2008). Atmosphere, ecology and evolution: what drove the Miocene expansion of C4 grasslands? J. Ecol. 96: 35–45. Osmond, C.B. (1994). What Is Photoinhibition? Some Insights from Comparisons of Shade and Sun Plants, in: Photoinhibition of Photosynthesis from Molecular Mechanisms to the Field (ed. N.R. Baker and J.R. Bowyer), 189–258. Oxford: Bios Scientific Publishers. Parida, A.K. and Das, A.B. (2005). Salt tolerance and salinity effects on plants: a review. Ecotoxicol. Environ. Saf. 60: 324–349. Park, E.J., Jeknić, Z., Pino, M.T. et al. (2007). Glycinebetaine accumulation is more effective in chloroplasts than in the cytosol for protecting transgenic tomato plants against abiotic stress. Plant Cell Environ. 30: 994–1005. Park, S., Lee, C.M., Doherty, C.J. et al. (2015). Regulation of the Arabidopsis CBF regulon by a complex low‐temperature regulatory network. Plant J. 82: 193–207. Parker, R., Flowers, T.J., Moore, A.L., and Harpham, N.V.J. (2006). An accurate and reproducible method for proteome profiling of the effects of salt stress in the rice leaf lamina. J. Exp. Bot. 57: 1109–1118. Parry, M.A.J., Andralojc, P.J., Khan, S. et al. (2002). Rubisco activity: effects of drought stress. Ann. Bot. 89: 833–839. Passioura, J.B. and Munns, R. (2000). Rapid environmental changes that affect leaf water status induce transient surges or pauses in leaf expansion rate. Funct. Plant Biol. 27: 941–948. Peet, M.M., Sato, S., and Gardner, R.G. (1998). Comparing heat stress effects on male‐ fertile and male sterile tomatoes. Plant Cell Environ. 21: 225–231. Pego, J.V., Kortstee, A.J., Huijser, C., and Smeekens, S.C.M. (2000). Photosynthesis, sugars and the regulation of gene expression. J. Exp. Bot. 51: 407–416. Peleg, Z. and Blumwald, E. (2011). Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol. 14: 290–295. Pelleschi, S., Rocher, J.P., and Prioul, J.L. (1997). Effects of water restriction on carbohydrate metabolism and photosynthesis in mature maize leaves. Plant Cell Environ. 20: 493–503. Pinheiro, C. and Chaves, M.M. (2011). Photosynthesis and drought: can we make metabolic connections from available data? J. Exp. Bot. 62: 869–882.

155

156

8  Photosynthesis under Abiotic Stresses

Porch, T.G. and Jahn, M. (2001). Effects of high‐temperature stress on microsporogenesis in heat sensitive and heat‐tolerant genotypes of Phaseolus vulgaris. Plant Cell Environ. 24: 723–731. Praxedes, S.C., DaMatta, F.M., Loureiro, M.E. et al. (2006). Effects of long‐term soil drought on photosynthesis and carbohydrate metabolism in mature robusta coffee (Coffea canephora Pierre var. kouillou) leaves. Env. Exp. Bot. 56: 263–273. Prins, A., Mukubi, J.M., Pellny, T.K. et al. (2011). Acclimation to high CO2 in maize is related to water status and dependent on leaf rank. Plant Cell Environ. 34: 314–331. Quan, R., Wang, J., Yang, D. et al. (2017). EIN3 and SOS2 synergistically modulate plant salt tolerance. Sci. Rep. 7: 44637–44647. Quintero, F.J., Martinez‐Atienza, J., Villalta, I. et al. (2011). Activation of the plasma membraneNa+/H+ antiporter salt‐Overly‐sensitive 1 (SOS1) by phosphorylation of an autoinhibitory C‐terminal domain. Proc. Natl. Acad. Sci. U.S.A 108: 2611–2616. Rabbani, M.A., Maruyama, K., Abe, H. et al. (2003). Monitoring expression profiles of rice genes under cold, drought, and high‐salinity stresses and abscisic acid application using cDNA microarray and RNA get‐blot analyses. Plant Physiol. 133: 1755–1767. Rabello, A.R., Guimarães, C.M., Rangel, P.H.N. et al. (2008). Identification of drought‐ responsive genes in roots of upland rice (Oryza sativa L.). BMC Genom. 9: 485. Rahman, A., Hossain, M.S., Mahmud, J.A. et al. (2016). Manganese‐induced salt stress tolerance in rice seedlings: regulation of ion homeostasis, antioxidant defense and glyoxalase systems. Physiol. Mol. Biol. Plants 22: 291–306. Rahnama, A., Poustini, K., Tavakkol‐Afshari, R., and Tavakoli, A. (2010). Growth and stomatal responses of bread wheat genotypes in tolerance to salt stress. Int. J. Biol. Life Sci. 6: 216–221. Ranjit, S.L., Manish, P., and Penna, S. (2016). Early osmotic, antioxidant, ionic, and redox responses to salinity in leaves and roots of Indian mustard (Brassica juncea L.). Protoplasma 253: 101–110. Ratcliffe, O.J. and Riechmann, J.L. (2002). Arabidopsis transcription factors and the regulation of flowering time: a genomic perspective. Curr. Issues Mol. Biol. 4: 77–91. Reddy, A.R., Ramakrishna, W., Sekhar, A.C. et al. (2002). Novel genes are enriched in normalized cDNA libraries from drought‐stressed seedlings of rice (Oryza sativa L. subsp. indica cv. Nagina 22). Genome 45: 204–211. Redillas, M.C.F.R., Park, S.H., Lee, J.W. et al. (2012). Accumulation of trehalose increases soluble sugar contents in rice plants conferring tolerance to drought and salt stress. Plant Biotechnology Reports 6: 89–96. Ren, X.L., Qi, G.N., Feng, H.Q. et al. (2013). Calcineurin B‐like protein CBL10 directly interacts with AKT1 and modulates K+ homeostasis in Arabidopsis. Plant J. 74: 258–266. Riechmann, J.L., Heard, J., Martin, G. et al. (2000). Arabidopsis transcription factors: genome‐wide comparative analysis among eukaryotes. Science 290: 2105–2110. Ripley, B., Frole, K., and Gilbert, M. (2010). Differences in drought sensitivities and photosynthetic limitations between co‐occurring C3 and C4 (NADP‐ME) Panicoid grasses. Ann. Bot. 105: 493–503. Ripley, B.S., Gilbert, M.E., Ibrahim, D.G., and Osborne, C.P. (2007). Drought constraints on C4 photosynthesis: stomatal and metabolic limitations in C3 and C4 subspecies of Alloteropsis semialata. J. Exp. Bot. 58: 1351–1363.

­  References

Rizhsky, L., Liang, H., and Mittler, R. (2002). The combined effect of drought stress and heat shock on gene expression in tobacco. Plant Physiol. 130: 1143–1151. Rochaix, J.D. (2011). Assembly of the photosynthetic apparatus. Plant Physiol. 155: 1493–1500. Rochaix, J.D. (2013). Redox regulation of thylakoid protein kinases and photosynthetic gene expression. Antioxid. Redox Signal. 18: 21842201. Rodríguez, V.M., Butrón, A., Rady, M.O.A. et al. (2014). Identification of quantitative trait loci involved in the response to cold stress in maize (Zea mays L.). Mol. Breed. 33: 363–371. Sage, R.F. and McKown, A.D. (2006). Is C4 photosynthesis less phenotypically plastic than C3 photosynthesis? J. Exp. Bot. 57: 303–317. Saibo, N.J.M., Lourenco, T., and Oliveira, M.M. (2009). Transcription factors and regulation of photosynthetic and related metabolism under environmental stresses. Ann. Bot. 103: 609–623. Sakamoto, A. and Murata, N. (2002). The role of glycinebetaine in the protection of plants from stress: clues from transgenic plants. Plant Cell Environ. 25: 163–171. Sanda, S., Yoshida, K., Kuwano, M. et al. (2011). Responses of the photosynthetic electron transport system to excess light energy caused by water deficit in wild watermelon. Physiol. Plant. 142: 247–264. Sanghera, G.S., Wani, S.H., Hussain, W., and Singh, N.B. (2011). Engineering cold stress tolerance in crop plants. Curr. Genomics 12: 30–43. Santos, M.G., Ribeiro, R.V., Oliveira, R.F., and Pimentel, C. (2004). Gas exchange and yield response to foliar phosphorus application in Phaseolus vulgaris L. under drought stress. Brazilian J. Plant Physiol. Londrina 16: 171–179. Santos, M.G., Ribeiro, R.V., Oliveira, R.F., and Machado EC Pimentel, C. (2006). The role of inorganic phosphate on photosynthesis recovery of common bean after a mild drought deficit. Plant Sci. 170: 659–664. Schuler, M.L., Montegazza, O., and Weber, A.P.M. (2016). Engineering C4 photosynthesis into C3 chasis in the synthetic biology age. Plant J. 87: 51–65. Schwechheimer, C., Zourelidou, M., and Bevan, M.W. (1998). Plant transcription factor studies. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 127–150. Seki, M., Narusaka, M., Abe, M. et al. (2001). Monitoring the expression pattern of 1300 Arabidopsis under drought and cold stresses by using a full length cDNA microarray. Plant Cell 13: 62–72. Seki, M., Umezawa, T., Urano, K., and Shinozaki, K. (2007). Regulatory metabolic networks in drought stress responses. Curr. Opin. Plant Biol. 10: 296–302. Sewelam, N., Oshima, Y., Mitsuda, N., and Ohmetakagi, M. (2014). A step towards understanding plant responses to multiple environmental stresses: a genome‐wide study. Plant Cell Environ. 37: 2024–2035. Sharma, P., Sharma, N., and Deswal, R. (2005). The molecular biology of the low temperature response in plants. BioEssays 27: 1048–1059. Shi, Y.T., Ding, Y.L., and Yang, S.H. (2015). Cold signal transduction and its interplay with phytohormones during cold acclimation. Plant Cell Physiol. 56: 7–15. Shinozaki, K. and Yamaguchi‐Shinozaki, K. (2007). Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 58: 221–227. Si, J., Zhou, T., Bo, W. et al. (2014). Genome‐wide analysis of salt‐responsive and novel microRNAs in Populus euphratica by deep sequencing. BMC Genet. 15: 1–11.

157

158

8  Photosynthesis under Abiotic Stresses

Siddique, Z., Jan, S., Imadi, S.R. et al. (2016). Drought stress and photosynthesis in plants. In: Water Stress and Crop Plants: A Sustainable Approach (ed. P. Ahmad), 1–11. John Wiley & Sons. Singh, K., Foley, R.C., and On˜ate‐Sa’nchez, L. (2002). Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 5: 430–436. Slama, I., Abdelly, C., Bouchereau, A. et al. (2015). Diversity, distribution and roles of osmoprotective compounds accumulated in halophytes under abiotic stress. Ann. Bot. 1153: 433–447. Sobhanian, H., Razavizadeh, R., Nanjo, Y. et al. (2010). Proteome analysis of soybean leaves, hypocotyls and roots under salt stress. Proteome Sci. 8: 19. Song, L., Huang, S.C., Wise, A. et al. (2016). A transcription factor hierarchy defines an environmental stress response network. Science 354: 1550. Song, Y., Ji, D., Li, S. et al. (2012). The dynamic changes of DNA methylation and histone modifications of salt responsive transcription factor genes in soybean. PLoS One 7: e41274. Song, Y., Chen, Q., Ci, D. et al. (2014). Effects of high temperature on photosynthesis and related gene expression in poplar. BMC Plant Biol. 14: 111. Spetea, C., Rintameki, E., and Schoefs, B. (2014). Changing the light environment: chloroplast signaling and response mechanisms. Philos. Trans. R Soc. Lon. B: Biol. Sci. 369: 20130220. Sreenivasulu, N., Sopory, S.K., and Kavi Kishor, P.B. (2007). Deciphering the regulatory mechanisms of abiotic stress tolerance in plants by genomic approaches. Gene 388: 1–13. Srivastava, A.K., Sablok, G., Hackenberg, M. et al. (2017). Thiourea priming enhances salt tolerance through coordinated regulation of microRNAs and hormones in Brassica juncea. Sci. Rep. 7: 45490. Stepien, P. and Johnson, G.N. (2009). Contrasting responses of photosynthesis to salt stress in theglycophyte Arabidopsis and the halophyte Thellungiella: a role of the plastid terminal oxidase as an alternative electron sink. Plant Physiol. 49: 1154–1165. Su, J., Hirji, R., Zhang, L. et al. (2006). Evaluation of the stress‐inducible production of choline oxidase in transgenic rice as a strategy for producing the stress‐protectant glycine betaine. J. Exp. Bot. 57: 1129–1135. Subramanian, K.S., Santhanakrishnan, P., and Balasubramanian, P. (2006). Responses of field grown tomato plants to arbuscular mycorrhizal fungal colonization under varying intensities of drought stress. Sci. Hortic. 107: 245–253. Suwa, R., Hakata, H., Hara, H. et al. (2010). High temperature effects on photosynthate partitioning and sugar metabolism during ear expansion in maize (Zea mays L.) genotypes. Plant Physiol. Biochem. 48: 124–130. Taiz, L. and Zeiger, E. (2010). Plant Physiology, 5e. Sunderland, MA, USA: Sinauer Associates. Takahashi, Y. and Kinoshita, T. (2014). Stomatal function has an element of hysteresis. New Phytol. 205: 455–457. Takemura, T., Hanagata, N., Dubinsky, Z., and Karube, I. (2002). Molecular characterization and response to salt stress of mRNAs encoding cytosolic Cu/Zn superoxide dismutase and catalase from Bruguiera gymnorrhiza. Trees 16: 94–99. Taub, D.R. (2000). Climate and the U.S. distribution of C4 grass subfamilies and decarboxylation variants of C4 photosynthesis. Am. J. Bot. 87: 1211–1215.

­  References

Tezara, W., Mitchell, V.J., Driscoll, S.D., and Lawlor, D.W. (1999). Water stress inhibits plant photosynthesis by decreasing coupling factor and ATP. Nature 401: 914–917. Thomashow, M.F. (1998). Role of cold‐responsive genes in plant freezing tolerance. Plant Physiol. 118: 1–8. Thomashow, M.F. (1999). Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50: 571–599. Tian, Y., Tian, Y., Luo, X. et al. (2014). Identification and characterization of microRNAs related to salt stress in broccoli, using high‐throughput sequencing and bioinformatics analysis. BMC Plant Biol. 14: 1–13. Tian, X., Liu, Y., Huang, Z. et al. (2015). Comparative proteomic analysis of seedling leaves of cold‐tolerant and ‐sensitive spring soybean cultivars. Mol. Biol. Rep. 42: 581–601. Tikkanen, M., Grieco, M., Kangasjarvi, S., and Aro, E.M. (2010). Thylakoid protein phosphorylation in higher plant chloroplasts optimizes electron transfer under fluctuating light. Plant Physiol. 152: 723–735. Tikkanen, M., Mekala, N.R., and Aro, A.M. (2014). Photosystem II photoinhibition‐repair cycle protects photosystem I from irreversible damage. Biochim. Biophys. Acta 1837: 210–215. Tikkanen, M., Nurmi, M., Kangasjarvi, S., and Aro, E.M. (2008). Core protein phosphorylation facilitates the repair of photodamaged photosystem II at high light. Biochim. Biophys. Acta 1777: 1432–1437. Tikkanen, M. and Aro, E.M. (2014). Integrative regulatory network of plant thylakoid energy transduction. Trends Plant Sci. 19: 10–17. Tran, L.S., Nakashima, K., Sakuma, Y. et al. (2004). Isolation and functional analysis of Arabidopsis stress inducible NAC transcription factors that bind to a drought responsive cis‐element in the early responsive to dehydration stress 1 promoter. Plant Cell 16: 2481–2498. Trujillo, L., Menendez, C., Ochogavia, M.E. et al. (2009). Engineering drought and salt tolerance in plants using SodERF3, a novel sugarcane ethylene responsive factor. Biotechnologia Aplicada. 26: 168–171. Trupkin, S.A., Auge, G.A., Zhu, J.K. et al. (2017). SALT OVERLY SENSITIVE 2 (SOS2) and interacting partners SOS3 and ABSCISIC ACID–INSENSITIVE 2 (ABI2) promote red‐light‐dependent germination and seedling deetiolation in Arabidopsis. Int. J. Plant Sci. 178: 485–493. Uemura, M., Warren, G., and Steponkus, P.L. (2003). Freezing sensitivity in the sfr4 mutant of Arabidopsis is due to low sugar content and is manifested by loss of osmotic responsiveness. Plant Physiol. 131: 1800–1807. Valliyodan, B. and Nguyen, H. (2006). Understanding regulatory networks and engineering for enhanced drought tolerance in plants. Curr. Opin. Plant Biol. 9: 1–7. Van der Does, D., Boutrot, F., Engelsdorf, T. et al. (2017). The Arabidopsis leucine‐rich repeat receptor kinase MIK2/LRR‐KISS connects cell wall integrity sensing, root growth and response to abiotic and biotic stresses. PLoS Genet. 13: e1006832. Vani, B., PardhaSaradhi, P., and Mohanty, P. (2001). Alteration in chloroplast structure and thylakoid membrane composition due to in vivo heat treatment of rice seedlings: correlation with the functional changes. J. Plant Physiol. 158: 583–592. Vinocur, B. and Altman, A. (2005). Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations. Curr. Opin. Biotechnol. 16: 123–132.

159

160

8  Photosynthesis under Abiotic Stresses

Virlouvet, L. and Fromm, M. (2014). Physiological and transcriptional memory in guard cells during repetitive dehydration stress. New Phytol. 205: 596–607. von Caemmerer, S., Quick, W.P., and Furbank, R.T. (2012). The development of C4 Rice: current progress and future challenges. Science 336: 1671–1672. von Caemmerer, S. and Evans, J.R. (2010). Enhancing C3 photosynthesis. Plant Physiol. 154: 589–592. Vu, J.C.V., Gesch, R.W., Hartwell Allen, L. Jr. et al. (1999). C02 enrichment delays a rapid, drought‐induced decrease in Rubisco small subunit transcript abundance. J. Plant Physiol. 155: 139–142. Wang, W.X., Vinocur, B., and Altman, A. (2003). Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 219: 1–14. Wang, D., Heckathorn, S.A., Barua, D. et al. (2008). Effects of elevated CO2 on the tolerance of photosynthesis to acute heat stress in C3, C4, and CAM species. Am. J. Bot. 95: 165–176. Wang, D., Pan, Y., Zhao, X. et al. (2011). Genome‐wide temporal‐spatial gene expression profiling of drought responsiveness in rice. BMC Genomics 12: 149. Wang, H., Zhang, H., and Li, Z. (2007). Analysis of gene expression profile induced by water stress in upland rice (Oryza sativa L. var. IRAT109) seedlings using subtractive expressed sequence tags library. J. Integr. Plant Biol. 49: 1455–1463. Wang, L., Czedik‐Eysenberg, A., Mertz, R.A. et al. (2014a). Comparative analyses of C4 and C3 photosynthesis in developing leaves of maize and rice. Nat. Biotechnol. 32: 1158–1165. Wang, L., Zhao, C.M., Wang, Y.J., and Liu, J. (2005). Overexpression of chloroplast‐ localized small molecular heat‐shock protein enhances chilling tolerance in tomato plant. J. Plant Physiol. Mol. Biol 31: 167–174. Wang, P., Kelly, S., Fouracre, J.P., and Langdale, J.A. (2013). Genome‐wide transcript analysis of early maize leaf development reveals gene cohorts associated with the differentiation of C4 Kranz anatomy. Plant J. 4: 481–495. Wang, Y., Brautigam, A., Weber, A.P.M., and Zhu, X.G. (2014b). Three distinct biochemical subtypes of C4 photosynthesis? A modelling analysis. J. Exp. Bot. 65: 3567–3578. Webber, A.N., Nie, G.Y., and Long, S.P. (1994). Acclimation of photosynthetic proteins to rising atmospheric CO2. Photosynth. Res. 39: 413–425. Wei, W., Li, Q.T., Chu, Y.N. et al. (2015). Melatonin enhances plant growth and abiotic stress tolerance in soybean plants. J. Exp. Bot. 66: 695–707. Welling, A. and Palva, E.T. (2008). Involvement of CBF transcription factors in winter hardiness in birch. Plant Physiol. 147: 1199–1211. Williams, J., Bulman, M., and Neill, S. (1994). Wilt‐induced ABA biosynthesis, gene expression and down‐regulation of Rbcs messenger‐RNA levels in Arabidopsis thaliana. Physiol. Plant. 91: 177–182. Wong, C.E., Li, Y., Labbe, A. et al. (2006). Transcriptional profiling implicates novel interactions between abiotic stress and hormonal responses in Thellungiella, a close relative of Arabidopsis. Plant Physiol. 140: 1437–1450. Xiao, H., Siddiqua, M., Braybrook, S., and Nassuth, A. (2006). Three grape CBF/DREB1 genes respond to low temperature, drought and abscisic acid. Plant Cell Environ. 29: 1410–1421. Xu, Z., Zhou, G., and Shimizu, H. (2010). Plant responses to drought and rewatering. Plant Signal. Behav. 5: 649–654.

­  References

Yadav, S.K. (2010). Cold stress tolerance mechanisms in plants. A review. Agronomy Sustain. Dev. 30: 515–527. Yamakawa, H. and Hakata, M. (2010). Atlas of rice grain filling‐related metabolism under high temperature: joint analysis of metabolome and transcriptome demonstrated inhibition of starch accumulation and induction of amino acid accumulation. Plant Cell Physiol. 51: 795–809. Yamori, W. (2016). Photosynthetic response to fluctuating environments and photoprotective strategies under abioticstress. J. Plant Res. 129: 379–395. Yang, C., Ma, B., He, S.J. et al. (2015). MAOHUZI6/ETHYLENE INSENSITIVE3‐LIKE1 and ETHYLENE INSENSITIVE3‐LIKE2 regulate ethylene response of roots and coleoptiles and negatively affect salt tolerance in rice. Plant Physiol. 169: 148–165. Yang, Y. and Guo, Y. (2018). Elucidating the molecular mechanisms mediating plant salt stress responses. New Phytol. 217: 523–539. Yang, L., Zheng, B., Mao, C. et al. (2004). Analysis of transcripts that are differentially expressed in three sectors of the rice root system under water deficit. Mol. Gen. Genom. 272: 433–442. Yang, X., Liang, Z., and Lu, C. (2005). Genetic engineering of the biosynthesis of glycinebetaine enhances photosynthesis against high temperature stress in transgenic tobacco plants. Plant Physiol. 138: 2299–2309. Yeo, A.R., Lee, S., Izard, P. et al. (1991). Short and long‐term effects of salinity on leaf growth in rice (Oryza sativa L.). J. Exp. Bot. 42: 881–889. Yordanov, I., Velikova, V., and Tsonev, T. (2003). Plant responses to drought and stress tolerance. Bulg. J. Plant Physiol. 38: 187–206. Zhang, W., Rerksiri, W., Liu, A. et al. (2013). Transcriptome profile reveals heat response mechanism at molecular and metabolic levels in rice flag leaf. Gene 530: 185–192. Zhang, X., da Silva, J.A.T., Niu, M. et al. (2017). Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves. Scientific Report 7: 42165. Zhang, X., Wollenweber, B., Jiang, D. et al. (2008a). Water deficit and heat shock effects on photosynthesis of a transgenic Arabidopsis thaliana constitutively expressing ABP9, a bZIP transcription factor. J. Exp. Bot. 59: 839–848. Zhang, C., Zhang, L., Zhang, S. et al. (2015). Global analysis of gene expression profiles in physic nut (Jatropha curcas L.) seedlings exposed to drought stress. BMC Plant Biol. 15: 17. Zhang, G., Zhang, G.L., Chen, L.Y. et al. (2008b). Effects of high temperature stress on pollen characters and anther microstructure of rice. Acta Ecol. Sin. 28: 1089–1097. Zhang, H., Mao, X., Wang, C., and Jing, R. (2010). Overexpression of a common wheat gene TaSnRK2.8 enhances tolerance to drought, salt and low temperature in Arabidopsis. PLoS ONE 30: e16041. Zhang, L., Zhao, G., Jia, J. et al. (2012b). Molecular characterization of 60 isolated wheat MYB genes and analysis of their expression during abiotic stress. J. Exp. Bot. 63: 203–214. Zhang, X., Fowler, S.G., Cheng, H. et al. (2004). Freezing‐sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing‐tolerant Arabidopsis. Plant J. 39: 905–919. Zhang, X., Li, J., Liu, A. et al. (2012a). Expression profile in rice panicle: insights into heat response mechanism at reproductive stage. PLoS One 7: e49652.

161

162

8  Photosynthesis under Abiotic Stresses

Zhao, C.Z., Lang, Z.B., and Zhu, J.K. (2015). Cold responsive gene transcription becomes more complex. Trends Plant Sci. 20: 466–468. Zhou, C. and Li, C. (2016). A novel R2R3‐MYB transcription factor BpMYB106 of birch (Betula platyphylla) confers increased photosynthesis and growth rate through up‐ regulating photosynthetic gene expression. Front. Plant Sci. 7: 315. Zhou, Y., Lam, H.M., and Zhang, J. (2007a). Inhibition of photosynthesis and energy dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58: 1207–1217. Zhou, J., Wang, X., Jiao, Y. et al. (2007b). Global genome expression analysis of rice in response to drought and high‐salinity stresses in shoot, flag leaf, and panicle. Plant Mol. Biol. 63: 591–608. Zhu, J.K. (2001). Plant salt tolerance. Trends Plant Sci. 6: 66–71. Zhu, J.K. (2002). Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53: 247–273. Zhu, X.G., Long, S.P., and Ort, D.R. (2010). Improving photosynthetic efficiency for greater yield. Annu. Rev. Plant Biol. 61: 235–261. Zhu, X.G., Long, S.P., and Ort, D.R. (2008). What is the maximum efficiency with which photosynthesis can convert solar energy into biomass? Curr. Opin. Biotechnol. 19: 153–159. Zlatev, Z. and Lidon, F.C. (2012). An overview on drought induced changes in plant growth, water relations and photosynthesis. Emir. J. Food Agric. 24: 57–72.

163

9 Current Understanding of the Regulatory Roles of miRNAs for Enhancing Photosynthesis in Plants Under Environmental Stresses Syed Sarfraz Hussain1, Meeshaw Hussain2, Muhammad Irfan1, and Bujun Shi3 1

Department of Biological Sciences, Forman Christian College (A Chartered University), Lahore, Pakistan Institute of Molecular Biology & Biotechnology, Bahauddin Zakariya University, Multan, Pakistan 3 School of Agriculture, Food & Wine, Waite Campus, University of Adelaide, Adelaide, SA, Australia 2

9.1 ­Introduction: Interaction Between miRNAs and Plant Growth/Functional Diversity of miRNAs and Their Impact in Plant Growth World population is increasing exponentially. It is expected to reach over nine billion by 2050 from a current population of seven billion (Hussain et al. 2011b). This means that food production around the globe must increase by 70% by 2050 in order to feed the world (Tester and Langridge 2010; Qin et al. 2011; Hussain et al. 2018b). Cereals are the most widely grown and consumed staple foods around the globe, with three species alone (maize, rice, and wheat) contributing for about 90% of the world production. It is worth mentioning here that plant growth, development, and yield ultimately depend on photosynthesis. All life around the globe depends directly or indirectly on photosynthesis for their existence. It is a process in which all oxygenic photosynthetic organisms extract their energy from photons by binding carbon dioxide and water into organic compounds (Chaves et al. 2009; Biswal et al. 2011; Nishiyama and Murata 2014; Siddique et al. 2016). Cyanobacteria, algae, and plants are the universal photosynthetic organisms which produce food, oxygen, and energy for growth and survival which are in fact derived from photosynthesis (Nath et  al. 2013; Nishiyama and Murata 2014; Yamori 2016). The leaf is an important organ having all the necessary machinery for completing the process of photosynthesis and provides the basis (energy) for growth of the whole plant. It is reported that higher CO2 potentially increases photosynthesis in plant leaves (22.6%) during the growing season, suggesting that increasing photosynthesis can ultimately increase plant productivity and yield (Ambavaram et al. 2014). However, several factors contribute toward the production of plant biomass such as the ability of leaves to capture the sun’s rays (solar energy) and convert it into chemical energy. The use of this energy into vegetative tissues results in accumulation of plant biomass. Development of biomass in the vegetative stage of plant growth can be considered as the ultimate expression of its metabolic activities (Meyer et al. 2007; Ambavaram et al. 2014). Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

164

9  Regulatory Roles of miRNAs

The functional diversity and genome‐wide presence of small RNAs (sRNAs) as regulators of gene expression in living organisms can safely be attributed to their crucial performance (Carrington and Ambros 2003; Lai et al. 2003; Bartel 2004; Sunkar et al. 2008). Historically, the concept of sRNA molecules as gene expression regulators is of a long‐standing nature (Jacob and Monod 1961; Britten and Davidson 1969). However, recent breakthroughs in identification and characterization of sRNAs and ultimate regulatory mechanisms, played crucial roles in the understanding of complex gene networks in plants (Reyes and Chua 2007; Schommer et al. 2008; Subramanian et al. 2008; Liu et  al. 2009a, b). These sRNAs encompass many different classes of non‐coding RNAs, which include short interfering RNAs (siRNAs), small nucleolar RNAs (snoRNAs), small nuclear RNAs (snRNAs), and microRNAs (miRNAs) derived from other elements such as transfer RNAs, ribosome RNAs, and so on. Each class of these sRNAs has their own properties and functions (Hamilton and Baulcombe 1999; Brodersen and Voinnet 2009). miRNAs represent the greatest proportion of endogenous regulatory sRNAs in plants (Schwab et  al. 2005, 2006) and have received the greatest extent of scientific exploration to date. The availability of complete genome sequences due to high throughput sequencing methods and improved computational and experimental protocols speed up the rate of miRNA identification in crop plants (Yao et  al. 2007; Subramanian et al. 2008; Jagadeeswaran et al. 2009; Lelandais‐Briere et al. 2009; Joshi et al. 2010; Zhao et al. 2010; Schreiber et al. 2011; Kim et al. 2012; Li et al. 2012; Wang et al. 2012; Zhang et al. 2012; Liang et al. 2013; Lin and Lai 2013). miRNAs are around 22 nucleotides in length and down‐regulate gene expression at the levels of translational, transcription, and post‐transcription (Brodersen et  al. 2008; Chellappan et  al. 2010; Gielen et al. 2012). Studies have shown that miRNAs regulate almost every aspect of plant development and growth (Willmann and Poethig 2007; Mathieu et al. 2009). miRNA genes are abundant in plants. Their intriguing expression patterns suggest that miRNAs might play pivotal roles in stress tolerances. Numerous studies have revealed that almost all plant biological and metabolic processes are controlled by plant miRNAs (Comai and Zhang 2012; Khraiwesh et al. 2012; Sun 2012; Turner et al. 2013; Jin et al. 2013) including seed germination (Reyes and Chua 2007), leaf morphogenesis and polarity (Mallory et al. 2004; Chitwood et al. 2007; Chuck et al. 2007; Nogueira et al. 2009; Wang et al. 2011a, b, c), floral differentiation and development (Llave et al. 2002; Achard et al. 2004; Ru et al. 2006; Wu et al. 2006; Zhao et al. 2007), developmental phase transition (Jones‐Rhoades et al. 2006; Chuck et al. 2009), sex determination (Chen 2004; Chuck et  al. 2009), plant growth and development (Chen et  al. 2004; Chen 2005; Willmann and Poethig 2005; Jones‐Rhoades et al. 2006; Mallory and Vaucheret 2006; Nogueira et al. 2006; Lelandais‐Briere et al. 2010; Rubio‐Somoza and Weigel 2011), root development (Zhang et  al. 2005; Gutierrez et  al. 2009), and phytohormone signaling (Achard et al. 2004; Guo et al. 2005; Reyes and Chua 2007; Lu and Huang 2008; Meng et  al. 2009). As a matter of fact, miRNA regulatory activity in plants has immediate implications in normal growth and development (Chuck et al. 2009). Besides developmental roles, a huge collection of data revealed that miRNAs are involved in various biotic (Voinnet 2009; Molnar et al. 2009) and abiotic stress responses, (Alptekin et al. 2017) including drought (Trindale et al. 2010; Wang et al. 2011a, b, c; Hussain and Shi 2014; Hussain et al. 2015; Shi and Hussain 2016; Zhou et al. 2018), salinity (Ding et al. 2009; Liu et al. 2008; Hussain and Shi 2014; Shriram et al. 2016; Banerjee et al. 2017; Kumar et al. 2018), cold (Jin et al. 2010), nutrition deficiency (Fujii et al. 2005; Bari et al.

9.2  miRNAs Involved in Photosynthesis

2006; Pant et al. 2008; Liang et al. 2010), heavy metal stress (Srivastava et al. 2005; Zhou et al. 2008; Wang et al. 2013; Qiu et al. 2016), oxidative stress (Sunkar et al. 2008), and mechanical stress (Lu et al. 2005).

9.2 ­miRNAs Involved in Photosynthesis and Other Downstream Biological Processes Little evidence is available so far about the involvement of sRNA in the regulation of photosynthesis in photosynthetic organisms such as plants, algae, or cyanobacteria. Cyanobacteria are frequently the dominant primary producers in aquatic ecosystems. Recent years have witnessed comprehensive transcriptome analyses which identified hundreds of regulatory sRNA candidates in many model cyanobacteria (Mitschke et al. 2011a; Billis et al. 2014; Kopf et al. 2014b; Kopf et al. 2015a; Flaherty et al. 2011; Mitschke et al. 2011b; Vijayan et al. 2011; Pfreundt et al. 2014; Voss et al. 2013; Kopf et al. 2015b; Gierga et al. 2012; Steglich et al. 2008; Thompson et al. 2011; Waldbauer et al. 2012; Voigt et al. 2014; Wu et al. 2015, 2016). RNA sequencing (RNA‐seq) (Mitschke et al. 2011a, b; Waldbauer et  al. 2012; Voss et  al. 2013; Billis et  al. 2014; Kopf et  al. 2014b; Pfreundt et al. 2014; Voigt et al. 2014) and microarray‐based approaches (Steglich et al. 2008; Georg et al. 2009; Gierga et al. 2012) plus computational prediction and subsequent experimental verification (Axmann et  al. 2005; Voss et  al. 2009; Ionescu et  al. 2010) have been utilized to identify regulatory RNA candidates in cyanobacteria. For example, biocomputational prediction (Voss et al. 2009), tiling microarrays (Georg et al. 2009), and pyrosequencing of Synechocystis 6803 transcripts (Mitschke et al. 2011a) showed the presence of several hundred candidate sRNAs in the genome of a cyanobacterial model system. SyR1 (Synechocystis RNA1) was found to be one of the most abundant sRNAs in these screens and later investigation revealed that high‐light and CO2 depletion treatment are responsible for up‐regulation of this sRNA (Georg et al. 2009; Kopf et al. 2014a). Based on the data presented in this study, the previous name of this sRNA, SyrR1, was replaced by PsrR1 (for photosynthesis regulatory RNA1). The combination of microarray and advanced computational target prediction analysis of PsrR1 overexpression (Wright et  al. 2013, 2014) yielded 26 possible target mRNAs. Furthermore, it is interesting to note that the majority of these target candidates may be functionally linked to photosynthesis or thylakoid membrane function. Computational and experimental data conclusively established that PsrR1 controls photosynthetic functions in cyanobacteria. C4 photosynthesis represents as a complex but efficient biochemical trait that speeds up biomass accumulation in plants. It is assumed that the trait has evolved independently multiple times within the angiosperms (Moore 1982; Sage et  al. 1999, 2011, 2012). Experimental data have shown that C4 crop plants have increased radiation, water, and nitrogen use efficiency, and have a faster photosynthesis rate than C3 crops (Zhu et al. 2008; Ghannoum et al. 2011). Based on these and many other advantages, researchers suggested the possibility of integrating the C4 pathway into C3 plants, which could be used to enhance yield. Several international research groups have set out to improve plant productivity by genetically engineering the C4 photosynthetic pathway in cereal crops (Hibberd et al. 2008; Kajala et al. 2011; von Caemmerer et al. 2012). Improvement of crop yield by enhanced photosynthetic performance seems an

165

166

9  Regulatory Roles of miRNAs

attractive and promising strategy. Recently, a comprehensive study provided useful information for the understanding of the roles of miRNAs in specific biological processes of leaf tissues during the evolution of the C4 pathway (Gao et al. 2017). Plant material used in this study belongs to the genus Cleome which contains a phylogenetic progression from C3 to C4 photosynthesis. This genus provides important clues regarding genetic, morphological, and physiological changes between the two photosynthetic pathways during the evolutionary activity. Cleome gynandra is a C4 photosynthesis species, while Cleome hassleriana is a C3 species. Phylogenetically, Arabidopsis thaliana, which is a well‐known C3 model plant, is a near relative to both C. gynandra and C. hassleriana. These three plant species share high sequence similarities. Approximately 70% of the RNA‐seq reads of C. gynandra and C. hassleriana matched approximately 55.3% of the genes in the A. thaliana. Researchers used high‐throughput sequencing technology to identify and characterize the miRNAs in the leaf tissues of C. gynandra and C. hassleriana to extract useful information pointing to molecular changes that occurred during the evolutionary process of these plants. High‐throughput sequencing identified 94 and 102 known miRNAs in C. gynandra and C. hassleriana, respectively, of which 91 are common, while 67 miRNAs showed significant differential expression between these two species. Bioinformatic analysis further revealed that these miRNAs may be involved in vital biological processes including glycol‐metabolism and photosynthesis (Gao et  al. 2017). Additionally, four novel miRNAs were detected, including three in each plant species. Roles of miRNAs in leaf development are well documented in many plant species (Chitwood et al. 2009). Many studies have provided deep insights into miRNA‐mediated regulation of PHABULOSA\PHAVOLUTA during leaf formation into the mechanisms of miRNA regulatory pathways (Mallory et al. 2004; Chitwood et al. 2009). The role of miRNAs in regulating organ formation is continued with determined roles for miRNAs in petal and root formation (Chen 2004; Llave et al. 2002). Similarly, sunlight is a major environmental signal influencing many aspects of plant growth and development. Some miRNAs have been expected to be involved in light responses, e.g. HY5, which is involved in light responsive transcription. In Arabidopsis, HY5 was known to regulate eight miRNA genes. It is further revealed that plant photosynthesis is heavily influenced by light which is regulated by miRNAs as above. Based on the evidence on the role of miRNAs in C3 photosynthesis in general, researchers are working to explore the role of miRNAs in the regulation of C4 photosynthesis.

9.3 ­Abiotic Stresses Drastically Affect Photosynthesis and Plant Productivity Under natural conditions, plants are frequently exposed to combinations of stresses. Apart from other stresses, biotic and abiotic stresses result in huge crop yield losses (Mahajan and Tuteja 2005; Hussain et al. 2011a, b). Photosynthesis is the primary target of all environmental stresses (Foyer and Shigeoka 2011; Osakabe et al. 2014; Gururani et al. 2015). Abiotic stresses such as drought, salinity, extreme temperature, and nutrition deficiency are responsible for significant reductions in crop productivity partly through inhibiting photosynthesis (Hussain et  al. 2011b, 2012, 2014, 2018a,c; De Oliveira et al. 2013; Dhar et al. 2014; ; Fahad et al. 2017; Zandalinas et al. 2018; ). On the

9.3  Abiotic Stresses Affect Photosynthesis

other hand, these stresses induce differential expression of thousands of protein‐coding genes (Kreps et al. 2002; Zhu 2002; Dos Reis et al. 2012; Forestan et al. 2016; Annacondia et al. 2018; Filichkin et al. 2018). High plant yield under environmental stresses represents an important yield stability trait. Therefore, extensive efforts have identified several genetic elements in crop plants under different abiotic stresses (Hussain et  al. 2011a, b; Hussain et al. 2012; Hussain and Shi 2014). This trait has been targeted using conventional plant breeding and genetic engineering techniques (Century et al. 2008; Ambavaram et al. 2014; Hussain et al. 2014). On the other hand, many researchers have used novel strategies to boost the intrinsic plant yield and increased plant photosynthetic rate and photosynthetic assimilation capacity seems promising (Zhu et al. 2010; Gibson et  al. 2011) under abiotic stresses. Photosynthesis, the foundation of life on earth, is considered as the basis of absolute yield and is heavily affected by abiotic stresses. However, engineering photosynthetic efficiency for improved plant yield has met with limited success (von Caemmerer and Evans 2010; Ashraf and Harris 2013; Ambavaram et  al. 2014). Photosynthesis is a highly complex, multistep process, and damage at any step results in significant overall reduction in crop yield. The following description provides a snapshot of negative effects of abiotic stresses on the photosynthesis. Photosynthesis is severely restricted by drought (Flexas et  al. 2008). Consequently activation of several key genes in different phases of the photosynthetic pathways were reported in rice (Rabbani et al. 2003; Parker et al. 2006; Karaba et al. 2007; Zhou et al. 2007; Moumeni et al. 2011; Ambavaram et al. 2014), maize (Hayano‐Kanashiro et al. 2009), and Arabidopsis (Karaba et al. 2007; Osakabe et al. 2014; Clauw et al. 2015). Huge data are now available on the gene expression profiles of model plants (Ma et al. 2006; Shinozaki and Yamaguchi‐Shinozaki 2007) from monocots and dicots (Bray 2004; Hazen et al. 2005; Wang et al. 2007a, b, 2011a,b; Dinneny et al. 2008; Rabello et al. 2008; Moumeni et  al. 2011) under drought stress. Drought stress induced changes in gene expression of a multitude of genes was extensively studied using heterogeneous systems at different developmental stages including vegetative and reproductive stages under single or multiple stresses (Reddy et  al. 2002; Yang et  al. 2004; Gorantla et  al. 2007; Wang et al. 2007a,b; Zhou et al. 2007; Degenkolbe et al. 2009; Ji et al. 2012). These studies have revealed the down regulation of most of photosynthesis related genes including chlorophyll a/b‐binding protein CP24, photosystem I (PSI) reaction center subunit V, protochlorophyllide reductase A, peptidyl‐prolyl cis‐trans isomerase, and others functioning in the photosynthetic pathways under drought stress in rice leaves (Wang et al. 2011a,b,c). However, several common genes in the photosynthesis pathway were down‐ regulated in both tolerant and intolerant plant genotypes in response to drought stress. Drought stress limits CO2 supply by stomatal closure; ultimately limiting photosynthesis (Flexas and Medrano 2002; Chaves et al. 2009). On the other hand, excessive salt ions around roots cause loss of cell volume and turgor, resulting in stem and root cell elongation and further reduction in plant growth (Yeo et al. 1991; Passioura and Munns 2000; Cramer 2002; Fricke and Peters 2002; Ma et al. 2014; Liu et al. 2015; Ranjit et al. 2016). Several researchers have reported similar results in tomato and rice (Mohammad et al. 1998; Mohammadi‐Nejad et al. 2010; Sobhanian et al. 2010; Rahman et al. 2016), cotton (Meloni et  al. 2001), and Brassica campestris sp. chinensis (Memon et  al. 2010) with reduced shoot weight, plant height, number of leaves per plant, root length, and root surface per plant when exposed to high salt concentrations (Ranjit et  al. 2016).

167

168

9  Regulatory Roles of miRNAs

Photosynthesis represents one of the complex pathways in plants and several genes are expected to show differential expression when exposed to salt stress (Redillas et  al. 2012; Sewelam et al. 2014; Slama et al. 2015). Therefore, it can be concluded that plants avoid photooxidation and generation of free radicals such as reactive oxygen species (ROS) that lead to negative effects on the plant’s photosynthetic capacity (Xu et al. 2010). Sharma et al. (2005) demonstrated that hundreds of genes including photosynthesis related genes were highly down‐regulated in rice seedlings at 10 °C for 72 hours, which shows the complexity of the cold tolerance mechanism in rice. Several protective mechanisms to reduce stress injury including an increase in the level of intracellular solutes, the accumulation of cryoprotectants and antioxidants, as well as the induction of antifreeze proteins and cold‐regulated (COR) proteins are actively operating in plants under stress (Uemura et al. 2003; Chen et al. 2015). Similarly, cell membrane integrity is maintained by stabilizing membrane lipids, maintaining ion homeostasis and scavenging ROS under cold stress (Yadav 2010; Hussain et al. 2012). At the biochemical level, plants re‐establish metabolism by remodeling of cell structures and reprogramming gene expression to accommodate stress. Recently, transcriptome analysis as a part of system biology has been extensively used to investigate global gene expression in plants under abiotic stress (Sewelam et al. 2014). Transcriptional profiling under various stresses has been carried out in different plant species, such as Arabidopsis (Maayan et  al. 2008; Blankenburg et al. 2009; Ambavaram et al. 2014), rice (Hippler et al. 2001; Nouri and Komatsu 2013), and barley (Ahuja et al. 2010; Taiz and Zeiger 2010). In tomato, transcriptome analysis has been used to compare patterns of gene expression under salt or drought stress (Kramer 1981; Chaves et al. 2009; Prins et al. 2011). Data suggest that high salt results in ionic and osmotic stresses in plants and the expression of hundreds of stress‐responsive genes is induced by these stresses.

9.4 ­Genome Wide miRNA Profiling Under Abiotic Stresses The last decade has witnessed one of the most exciting revolutions in biology which is related to the identification, isolation, and functional characterization of sRNAs, particularly miRNAs and their effect on regulation of gene expression (Lelandais‐Briere et al. 2010; Hussain et al. 2014). Huge data suggest that 19–24 nt long miRNAs play vital roles as regulators of all biological and metabolic processes which have strongly changed our understanding of gene regulation (Trindale et  al. 2010; Cuperus et  al. 2011; Khraiwesh et al. 2012; Hussain and Shi 2014; Ferdous et al. 2015), plant development, and architecture control, including stem cell proliferation, leaf development, floral initiation and development, responses to environmental stresses, and defense (Willmann and Poethig 2005; Jones‐Rhoades et al. 2006; Mallory and Vaucheret 2006; Sunkar et al. 2007; Garcia 2008; Garcia and Frampton 2008; Chuck et al. 2009; Trindale et al. 2010; Cuperus et al. 2011; Khraiwesh et al. 2012; Sun 2012; Amaral et al. 2013; May et al. 2013; Zhang and Li 2013; Hussain et al. 2014; Ferdous et al. 2015; Shriram et al. 2016; Alptekin et al. 2017; Liu et al. 2017; Pan et al. 2018; Song et al. 2018). Using different high‐throughput techniques like next generation sequencing, and computational and experimental approaches, many groups have reported the regulatory function of several miRNAs in crucial plant growth, developmental, and reproductive processes (Llave et al. 2002; Palatnik et al. 2003; Aukerman and Sakai 2003; Chen

9.4  Genome Wide miRNA Profiling

2004; Laufs et al. 2004; Mallory et al. 2004; Guo et al. 2005; Kim et al. 2005; Achard et al. 2004; Juarez et al. 2004; Lauter et al. 2005; Jones‐Rhoades et al. 2006; Nikovics et al. 2006; Wang et al. 2007a,b). These developments diverted the attention of researchers toward exploring the stress‐related miRNAs in plants (Reinhart et  al. 2002; Jones‐ Rhoades and Bartel 2004; Sunkar and Zhu 2004; Lu et al. 2005; Fujii et al. 2005; Aung et al. 2006; Chiou et al. 2006). Therefore, high‐throughput methods are currently widely adopted for the discovery of stress‐related miRNAs in plants. miRNAs were first identified from the following model plants: A. thaliana, Nicotiana tabacum, Oryza sativa, Physcomitrella patens, Populus trichocarpa, Vitis vinifera (Billoud et  al. 2005; Li and Zhang 2016; Lu et al. 2005; Zhao et al. 2007). This is because the complete genomes of these model plants were available due to the use of high‐throughput sequencing technologies. Following the model plants, the rate of miRNA identification in crop plants such as alfalfa, maize, cotton, wheat, oilseed rape, soybean, Sorghum, peanut, pumpkin, and barley has rapidly increased owing to the use of high‐throughput sequencing methods and improved computational and experimental protocols (Yao et al. 2007; Xie et al. 2007; Buhtz et  al. 2008; Pant et  al. 2008; Jagadeeswaran et  al. 2009; Lelandais‐Briere et al. 2009; Subramanian et al. 2008; Joshi et al. 2010; Zhao et al. 2010; Schreiber et al. 2011). Similarly, hundreds of miRNAs have been identified in model and crop plants which were induced by different abiotic stresses (Jones‐Rhoades and Bartel 2004; Sunkar and Zhu 2004; Lu et  al. 2005; Zhao et  al. 2007; Arenas‐Huertero et  al. 2009; Jagadeeswaran et al. 2009; Jia et al. 2009; Liu et al. 2009a,b; Trindale et al. 2010; Frazier et al. 2011; Kantar et al. 2011; Zhang et al. 2011). The plethora of plant miRNA targets a large number of genes involved in biological and metabolic processes including plant growth and development as well as responses to environmental stresses, defense, and pathogen invasion (Chen et al. 2004; Chen 2005; Willmann and Poethig 2005; Zhang et al. 2005, 2007; Jones‐Rhoades et al. 2006; Mallory and Vaucheret 2006; Nogueira et al. 2006; Sunkar et  al. 2006; Laporte et  al. 2007; Wang and Li 2007; Berger et  al. 2009; Chitwood et al. 2009; Chuck et al. 2009; Hsieh et al. 2009; Husbands et al. 2009; Meng et al. 2009; Liu and Chen 2009; Todesco et al. 2010). However, the precise functional mechanisms of miRNAs remain to be elucidated and concerted efforts are needed. Furthermore, it is amazing to note that most of the stress‐induced miRNAs are evolutionarily conserved, pointing to the fact that miRNA‐mediated regularity responses to environmental stresses in plants may be evolutionarily conserved (Sunkar et al. 2008; Sun 2012). The use of microarray method has identified miRNAs in different plants such as A. thaliana, O. sativa, and Populus tremula under abiotic stresses (Zhao et al. 2007; Liu et al. 2008; Zhou et al. 2010). Although several miRNAs showed differential expression on microarray, analysis revealed significant up‐regulation of miR169g under drought stress and has become the topic of intense research. As a matter of fact, the presence of two drought responsive elements (DRE) in the promoter region of miR169g suggested that miR169g may be regulated directly by rice CBF/DREB transcription factors (Dubouzet et al. 2003; Zhao et al. 2007). In another study, systematic expression analysis of miRNAs under abiotic stresses in two‐week‐old Arabidopsis seedlings showed significant expression of 10, 4, and 10 miRNAs regulated by high salinity, drought, and cold, respectively (Liu et al. 2008). Computational analysis of stress‐regulated miRNAs revealed the presence of sequence motifs (AREs, anaerobic induction elements, ABREs, abscisic acid (ABA)‐response elements) among the promoters of many miRNAs,

169

170

9  Regulatory Roles of miRNAs

further suggesting that these miRNAs may be involved in various stress response processes (Liu et al. 2008). Ding et al. (2009) identified 98 miRNAs from 27 families revealing significant changes in expression under salt stress in salt tolerant and salt sensitive maize lines. MiR168 showed a salt stress responsive pattern similar to that in Arabidopsis. Microarray analysis in P. tremula showed expression dynamics of miR398 under salt stress with high to low and final accumulation of the miR398 level during different stages of stress (Jia et  al. 2009). However, this expression pattern was absent in Arabidopsis where miR398 expression was steadily suppressed. Similarly in a comprehensive study, Zhou et al. (2010) used microarray for genome‐wide identification and analysis of miRNAs responsive to drought in rice; across a wide range of development stages from tillering to inflorescence formation. Significantly more miRNA sequences were included in the microarray chip because more miRNAs were available in miRBase in 2010. Overall, the results showed that 14 miRNAs were up‐regulated while 16 miRNAs were down‐regulated at different developmental stages under drought stress (Zhou et al. 2010). This study also analyzed the promoters of 18 miRNAs in order to reveal a relationship between a drought‐induced miRNA, target gene, and the relevant promoter. Similarly, several other studies used other high throughput techniques for exploring the miRNA profiles in response to salinity, cold, drought, auxins, mechanical, and submergence stresses (Ding et al. 2009; Jia et al. 2009; Liu et al. 2009a,b, Rajagopalan et al. 2006; Fahlgren et al. 2007; Lu et al. 2008; Sunkar et al. 2008). Although a large number of plant miRNAs have been identified and their corresponding targets were in silico predicted, the roles of some of these miRNAs in diverse physiological processes have not been elucidated yet.

9.5 ­Functional Characterization of miRNAs Associated with Photosynthesis It is well documented that miRNAs affect gene expression in multiple ways such as single miRNA can potentially be targeting multiple genes, and occasionally multiple miRNAs may act synergistically to regulate the single gene. For example, over 184 miRNAs have been identified in Arabidopsis which are predicted to regulate more than 600 genes including 225 known targets (Griffiths‐Jones et al. 2008; Alves et al. 2009; Hussain et al. 2014). This, together with hundreds of different miRNA genes, indicates that miRNAs may have a substantial impact on the challenging and complex plant traits such as regulation of plant growth, development, responses to environmental stresses, and plant defense (Jones‐Rhoades et  al. 2006; Garcia and Frampton 2008; Rubio‐Somoza and Weigel 2011; Comai and Zhang 2012; Khraiwesh et al. 2012; Sun 2012). Research in functional characterization of miRNAs and related pathways will help researchers in understanding the genetic mechanisms underlying these complex traits (Sun 2012; Liang et al. 2013; Hussain et al. 2014). The fact that miRNAs are important in gene regulation and expression will make miRNAs able to serve as a reservoir of useful genes for tackling challenging stresses in plant production and protection (Jones‐Rhoades et al. 2006; Laporte et al. 2007; Chitwood et al. 2009; Chuck et al. 2009; Jiao et al. 2010; Huang et al. 2012; Sun 2012; Liang et al. 2013; Zhou et al. 2013; Hussain et al. 2014; Reichel et al. 2015; Huang et al. 2016; Tang and Chu 2017).

9.5  Functional Characterization of miRNAs

Due to advances in experimental and computational techniques, a huge number of miRNAs, along with their potential target genes, have been identified in different plant species. The regulatory roles of these miRNAs in diverse physiological processes are under intense research. In fact, molecular methods were used to study some of these miRNAs for their roles in the regulation of target genes (Llave et al. 2002; Reinhart et al. 2002; Chen 2004; Laufs et al. 2004; Duan et al. 2006; Jagadeeswaran et al. 2009; Zhang et al. 2013; Hussain et al. 2014; Wang et al. 2014; Yuan et al. 2015; Zhao et al. 2015; Wu et al. 2017). However, the current state of knowledge in miRNA research has revealed that the regulatory roles of plant miRNAs have been established through the loss and gain of function mutants and overexpression or by generating transgenic plants that express miRNA resistant versions for identifying target genes and their roles in plants (Park et al. 2005; Schwab et al. 2005; Gandikota et al. 2007; Ori et al. 2007; Nag et al. 2009; Li et al. 2010; Khan et al. 2011; Bustos‐Sanmamed et al. 2013; Turner et al. 2013; Yang et al. 2013; Zhou et al. 2013; Hussain et al. 2014; Wang et al. 2015; Zhao et al. 2016). Photosynthesis is the prime target of all abiotic stresses. Plant photosynthetic performance is negatively affected by drought and salinity stresses, whereas respiration activity is enhanced under stress (Rizhsky et al. 2002; Shinozaki and Yamaguchi‐Shinozaki 2007). Synthesis of starch for energy by CO2 and H2O are important biochemical processes for plant growth. Different stresses progressively reduce plant photosynthetic activity and CO2 assimilation. MiR397 is predicted to target β‐fructofuranosidase, which takes part in starch and sucrose metabolism (Zhou et al. 2010). Thus, the differential expression of miR397 in tolerant and sensitive genotypes of soybean plays a role in the reductive carboxylate cycle (CO2 fixation) and energy supply under water deficit conditions (Zhou et al. 2010; Kulcheski et al. 2011). In addition, miR397 and miR857 are predicted to target a laccase gene resulting in lignin biosynthesis and secondary growth of vascular tissues in Arabidopsis (Wang et  al. 2014; Zhao et  al. 2015). Furthermore, Zhang et al. (2013) showed that miR397a and miR397b influence panicle architecture, and increase grain size and yield in rice. However, deep investigations are needed to explore the specific role of miR397 in photosynthesis. Similarly, Studies have shown that miR398 is involved in the mitochondrial respiratory pathway and plays a significant role by down‐regulating cytochrome C oxidase subunit V (COX5b) in the regulation of respiration (Jones‐Rhoades and Bartel 2004; Sunkar and Zhu 2004). miR398 was upregulated in Medicago truncatula (Trindale et al. 2010) and Triticum dicoccoides (Kantar et al. 2011) under drought stress. Taken together, increased levels of miR398 led to the downregulation of COX5b transcripts under water deficit, suggesting the important role of miR398 in the regulation of mitochondrial respiration (Trindade et  al. 2010). Alteration in different miRNAs expression seems crucial for the attenuation of plant growth development under stress. However, contrasting/conflicting findings highlight the importance of detailed characterization of stress‐regulated miRNAs in plants (Hussain et al. 2014). Most of the miRNAs known so far are conserved in diverse plant species, making it convenient to target the same trait in different plants (Pan et al. 2018). miR408 is one of the most conserved miRNA families and has, so far, been annotated in over 30 plant species (Yamasaki et  al. 2007, 2009; Axtell and Bowman 2008; Cuperus et  al. 2011; Kozomara and Griffiths‐Jones 2011; Zhang and Li 2013; Zhang et al. 2017), indicating that miR408 is playing some fundamental function in plants. Several researchers have

171

172

9  Regulatory Roles of miRNAs

reported the differential expression of miR408 in response to a variety of environmental stresses in diverse plant species (Sunkar and Zhu 2004; Lu et al. 2005; Yamasaki et al. 2007; Abdel‐Ghany and Pilon 2008; Trindade et al. 2010; Kantar et al. 2010; Li et al. 2010; Sunkar et al. 2012; Mutum et al. 2013; Zhang and Li 2013; Rajwanshi et al. 2014; Zhang et al. 2014; Hajyzadeh et al. 2015; Ma et al. 2015; Zhang et al. 2017). Knowledge contributed by some previous investigations revealed that increased accumulation of miR408 promotes several plant traits including vegetative growth, increased leaf area, petiole length, heading time, plant height, and biomass yield as well as biosynthesis of pigments in different plants (Zhang et al. 2011, 2014; Zhang and Li 2013; Zhao et al. 2016). Copper (Cu) plays crucial roles in plant growth and development. In several vital physiological processes including photosynthesis, nitrogen fixation, seed production, hormone perception, and carbohydrate distribution (Pilon et al. 2006; Pilon 2017), copper works as cofactor of many proteins and enzymes. A growing body of evidence has indicated that miR408 potentially targets many genes of copper‐ binding proteins that are classified into two distinct families of phytocyanin and laccase. Plastocyanin is a copper binding protein and functions as a mobile electron transporter in the light reaction of photosynthesis (Zhang et al. 2014; Pan et al. 2018; Song et al. 2018) in eukaryotic photosynthetic organisms (Raven et al. 1999; Joliot and Joliot 2006). These observations lead to the conclusion that miR408 might be involved in plant reproduction. Further characterization of miR408 at physiological and molecular level for better understanding of the biological function of miR408 is needed. Recently, Pan et al. (2018) generated transgenic Arabidopsis, tobacco, and rice plants and comprehensively explored the role of miR408 in enhancing photosynthetic performance of transgenic plants. Molecular and biochemical analyses proved that a high expression level of miR408 significantly enhanced photosynthetic performance of all three transgenic plants. Additionally, field trials of rice transgenic plants overexpressing miR408 revealed increased grain weight and grain yield (Zhang et al. 2017). At the same time, another study by Song et al. (2018) provided convincing evidence of the involvement of miR408 in various plant growth stages, suggesting its functional role in biomass production and seed yield in Arabidopsis. Taken together, the above two studies conclusively proved that miR408 can be of potential interest as a candidate gene in developing new traits like enhanced photosynthetic performance, increased biomass, and high yield in agricultural crops through breeding or genetic engineering.

9.6 ­miRNAs and Shoot/Tiller Development The diversity of the miRNA genes and expression patterns have demonstrated that development of almost all vital plant tissues and organs is controlled by specific miRNAs (Zhang et  al. 2006; Axtell and Bartel 2005). The shoot apical meristem (SAM) consists of totipotent cells which are responsible for development of lateral organs. Lateral organs such as leaves, branches/tillers, and floral organs are initiated as primordial on the flanks of the SAM or floral meristems. Meristems are classified as determinate or indeterminate types. For example, floral meristems are determinate because the growth is terminated after the initiation of flower organs and branch meristems are usually indeterminate (Chuck et al. 2009).

9.7  miRNAs in Root Development

Recently, transgenic plants overexpressing miR171 showed multiple developmental aberrations including a reduction in shoot branching (Song et al. 2010). However, Wang et  al. (2010) showed that miR171c negatively regulate shoot branching by targeting GRAB gene family members (SCL6‐II, SCL6‐III, SCL6‐IV). Transgenic plants overexpressing miR171c exhibited reduced shoot branching which is consistent with SCL6‐II, SCL6‐III, SCL6‐IV triple mutant plants. On the other hand, the expression of miRNA‐ resistant version of targets rescued the miRNA‐overexpressing phenotype. These data suggest the important role of the miR171c/SCL6 pathway in the regulation of shoot branching in plants. miRNA 165/166 is very similar in sequence and plays a primary role in meristem formation (Kim 2005; Axtell et al. 2006). The targets of Arabidopsis miR165/166 group include five members of HD‐ZIP111 transcription factor genes such as REVOLUTA (REV), PHABULOSA (PHB), PHAVOLUTA (PHV), CORONA (CNA)/ATHB15, and ATHB8 (Juarez et al. 2004; Kidner and Martienssen 2004; Mallory et al. 2004; Kim et al. 2005; Williams et  al. 2005; Byrne 2006). It is further reported that these genes have overlapping functions in controlling meristem development via the WUS‐CLV pathway. Interestingly, the mRNA level of REV was unaltered in the menT mutant while even elevated in the Jba‐1D mutant (Kim et al. 2005; Williams et al. 2005). Several studies showed the antagonistic relationship between REV mRNA and other HD‐ZIP111 genes (Prigge et al. 2005; Williams et al. 2005). In addition, REV genes play a significant role in apical meristem initiation in Arabidopsis (Liu and Chen 2009). Wang et al. (2006) demonstrated that mutation in REV genes exhibits severely reduced branching at the vegetative as well as reproductive stage. Based on the above results, it seems that REV functions as a positive regulator for branching. This can further be exploited in monocotyledonous plants because branching refers to tillers. For this purpose, target mimicry can be developed for inhibiting the miR165/166, resulting in elevated REV mRNA to increase the number of tillers per plant. However, this is speculation and significant efforts are needed to bring it true. On the other hand, if this strategy works, there are several other important targets for improving agronomic traits which ultimately affect crop yields.

9.7 ­miRNAs in Root Development Global climate change, water scarcity and soil nutrients are major factors in reducing crop yield under abiotic stresses (de Dorlodot et al. 2007). Negative effects of these factors on yield can be minimized by manipulation of root system architecture (RSA) toward root distribution in soil for water and nutrient uptake. RSA refers to the spatial configuration of different types of roots in root. It has been shown to affect salt stress tolerance, nutrient efficiency, and plant yield in agricultural crops (de Dorlodot et al. 2007; Hammer et al. 2009; Hirel et al. 2007; Lynch 2007). Therefore a subtle change in the plant’s root system can greatly affect the yield. Besides several regulatory genes, a plethora of miRNA has been reported to affect root development (Guo et  al. 2005; Wang et al. 2005; Gutierrez et al. 2009). Experimental evidence supports the role of miRNA in root cap formation, adventitious, and lateral root development through auxin signaling and related pathways (Sorin

173

174

9  Regulatory Roles of miRNAs

et al. 2005; Wang et al. 2005). The auxin signaling pathway is itself tightly regulated and conserved among many plants like Arabidopsis, rice, poplar, alfalfa, and lotus. It is further shown that a number of genes in the auxin signaling cascade are potential targets of miRNAs. Auxin responsive factor 10 and 16 (ARF10 and ARF16) are involved in root cap formation to mediate the direction of root tip growth. MiR160 was suggested to play a significant role in lateral root development in Arabidopsis by targeting downstream ARF10 and ARF16. In addition, in the absence of miR160 mediated regulation of these factors, different organs including roots exhibited growth aberration (Wang et al. 2005; Liu et  al. 2007). Furthermore, plants expressing a miRNA resistant version of ARF17, another target of miR160, accumulated high ARF17 mRNA and displayed developmental defects including decreased root branching and reduced primary root length in Arabidopsis (Mallory et al. 2005). This clearly indicates that transgenic plants expressing either miR160 or ARF17 (miRNA resistant version) show altered expression of three ARFs which shed light on the role of miR160 in maintaining proper auxin signaling homeostasis crucial for lateral and adventitious root development (Sorin et  al. 2005; De Smet et al. 2006). Five members of a family of genes encoding NAM/ATAF/CUC(NAC)‐domain transcription factors are predicted targets of miR164 (Jones‐Rhoades et al. 2002; Laufs et al. 2004; Guo et  al. 2005). Of these, NAC1 encodes the transcription factor which act downstream of TIR1 to transmit auxin signals for lateral root development. Prolonged auxin treatment results in miR164 guided cleavage of endogenous and transgenic NAC1 mRNA (Guo et al. 2005) resulting in decreased lateral root emergence. On the other hand, Arabidopsis mir164a and mir164b mutant plants expressed less miR164 and more NAC1 mRNA and ultimately produced more lateral roots. In contrast, inducible expression of miR164 by auxin result in decreased NAC1 transcripts and reduced lateral root emergence (Guo et al. 2005; Laufs et al. 2004; Jones‐Rhoades et al. 2002). These results suggest a feedback mechanism between auxin signaling, miR164 expression and lateral root formation. Recently, three studies suggested that miR390‐TAS3 derived tasiRNA and ARF2/3/4 integrate with auxin signaling to regulate lateral root growth (Marin et al. 2010; Yoon et al. 2010a,b). Simultaneous impairment of ARF2/3/4 function with an amiRNA (artificial microRNA) reduced the expression of miR390 and vice versa. This suggested that the tasiRNA‐ARFs targets contribute differentially to miR390 expression. Thus, It is clearly shown that tasiRNA inhibit ARF2/3/4 thus releasing repression of lateral root growth, derived from miR390 guided cleavage of the TAS3 precursor (Chen and Xiong 2010). While miR166, plays a major role in posttranscriptional regulation of several HD‐ ZIP111 genes in roots of leguminous plants. Overexpression of miR166 in M. truncatula caused a sharp decrease in lateral root number and significantly affected legume root architecture (Boualem et  al. 2008). However further detailed analysis to validate the potential role of miR166 in lateral root branching still needs to be elucidated in non‐ leguminous plants. Alternatively, through their potential roles in mineral nutrition or stress responses, miRNA may indirectly be involved in the control of root architecture and its adaptation to the environment. Substantial data indicate that miRNA169 and miR398 are expressed in the roots of rice and Arabidopsis respectively (Sunkar et al. 2006; Zhao et al. 2007). Upon drought stress, miR169g, a member of miR169 family is induced and induction is more prominent in roots than in shoots. Similarly, miR398 showed high expression in

9.9  miRNAs in Hormone Signaling

the roots during Cu/Zn homeostasis through its posttranscriptional effects on CSD (Cu/Zn superoxide dismutase) genes (Yamasaki et al. 2007). Similarly miR399, miR395, and miR398 are induced by mineral deficiency in the soil and mineral deficiency strongly affects root architecture in Arabidopsis (Fujii et  al. 2005; Kawashima et  al. 2009; Abdel‐Ghany and Pilon 2008; Jovanovic et al. 2008). However, extensive efforts are needed to explore the regulatory roles of root development/root system remodeling in future. As more efforts to uncover miRNA functions are made, more novel processes will be found to be controlled by these multifaceted molecules.

9.8 ­miRNAs in Controlling Stomatal Density The picture that emerges from analysis of the non‐conserved Arabidopsis miRNAs appears to suggest that miRNAs play a significant regulatory role in numerous developmental processes (Hunter and Poethig 2003). For example, current data suggest that miRNAs not only affect leaf shape but also support cell differentiation within the leaf including control of stomatal stem cells (Kutter et al. 2007). Previous reports showed that MADS box transcription factor Agamous‐Like 16 (AGL16) accumulates in stomatal guard cells (Alvarez‐Buylla et al. 2000) which indicates that AGL16 has stomata related functions. Bioinformatic analysis showed that miR824 aligned best with the distinct region within AGL16. This clearly suggests that miR824 targets the AGL16 transcript and a role has recently been assigned to miR824 in the patterning of stomata complexes in Arabidopsis (Kutter et  al. 2007). Over‐expression of AGL16 has no obvious effect. Plants overexpressing a miR824 resistant version of AGL16 developed higher order stomatal complexes as a result of several extra satellite meristemoid. In contrast, plants that overexpress miR824 produced very few meristemoid which is probably due to miRNA pathway dependent repression of AGL16. Taken together, it is clear that both miR824 and AGL16 are expressed in the meristemoid lineage (Kutter et al. 2007). Although no function for AGL16 is known, it is proposed that AGL16 is involved in satellite formation. However, both miR824 and AGL16 are not expressed simultaneously in the same cell type while miR824 expression was found in the satellite meristemoid and guard mother cells (GMCs), AGL16 was only found in young stomatal cells. Natural selection favors low stomatal density in plants especially grown in water limited conditions. Likewise, other environmental factors such as salt stress can also modify stomatal density (Rozema et al. 1991). Stomata play a vital role in the ability of land plants to balance water loss and also contribute toward photosynthetic performance. Hence, global environmental changes affect stomatal density and function in plants. This study showed the regulation of AGL16 by miR824 in stomatal complexes to control the pattern and density of stomata on the leaf surface.

9.9 ­miRNAs in Hormone Signaling Almost all developmental processes in plants are regulated by a network of events that are further regulated by different phytohormones and interactions among different hormonal pathways modulate their effects. Auxin is identified as a key hormone which

175

176

9  Regulatory Roles of miRNAs

regulates a host of plant developmental and physiological processes including root and shoot architecture, organ patterning, vascular differentiation, embryogenesis and organogenesis (Quint and Gray 2006; Able 2007; Vieten et  al. 2007). Recently, plant miRNAs have been found to regulate key components of hormone homeostasis, hormone signaling pathways, and several plant responses to hormones (Jones‐Rhoades and Bartel 2004; Sorin et  al. 2005). At present, several AUXIN RESPONSIVE FACTORS (ARFs) have been confirmed as targets of miRNAs. MiR167 targets ARF6 and ARF8 mRNAs while ARF10, ARF16, and ARF17 mRNAs are targets of miR160 (Jones‐Rhoades et al. 2002; Kasschau et al. 2003; Jones‐Rhoades and Bartel 2004; Vazquez et al. 2004; Mallory et al. 2005; Yang et al. 2006; Wu et al. 2006). In Arabidopsis, ARF6 and ARF8 regulate ovule and anther development (Ru et al. 2006; Wu et al. 2006). While ARF10, ARF16, and ARF17 are essential in root, leaf, and flower organ development (Mallory et al. 2005; Wang et al. 2005; Liu et al. 2007). In addition, miR160 and miR167 also regulates GH3 expression (Mallory et al. 2005; Yang et al. 2006) suggesting that miR167‐ ARF10/16/17 signals and miR160‐ARF6/8 signals may share the same GH3 genes. Recently, experimental evidence has also indicated the involvement of miR164, miR168, miR169, miR319, and miR393 in auxin signaling (Navarro et al. 2006; Guo et al. 2005; Liu et al. 2009a,b; Subramanian et al. 2008). Similarly, Zhang et al. (2005) reported that several miRNAs are also regulated by other phytohormones like ABA, gibberellic acid (GA), jasmonic acid (JA), and salicylic acid (SA). Based on these findings, it is proposed that auxin homeostasis in particular, is regulated coordinately by convergence of the signals from different miRNAs. However, further investigation of the regulatory pathways of these miRNAs might offer a new insight in elucidating the molecular details of some of the signal integration events between these hormones (Schommer et al. 2008).

9.10 ­miRNAs in Controlling Nodule Development in Leguminous Crops The symbiotic association between leguminous plants and nitrogen‐fixing bacteria (rhizobia) results in the formation of special structures called nodules in roots. The interaction between symbionts begins with the exchange of chemical signals. Root nodules originate from root cortical cells that are stimulated by rhizobia to re‐enter mitosis and a mature nitrogen‐fixing nodule forms in two to three weeks (Downie and Walker 1999; Gage 2004; Geurts et al. 2005; Stacey et al. 2006; Combier et al. 2006). All physiological and cytological events in the process of nodule development have been determined and characterized (Subramanian et  al. 2008). There is little progress in identification of molecular determinants and regulatory networks responsible for nodule development and function (Simon et al. 2009). In addition, the functions of miRNAs during nodule development and establishment of symbiosis have been largely unexplored. Recently, several studies using high throughput and computational analysis identified 100 novel miRNA candidates and 25 conserved families in M. truncatula (Szittya et al. 2008; Jagadeeswaran et al. 2009; Lelandais‐Briere et al. 2009; Zhou et al. 2009). Similarly in soybean, 42 conserved and 87 novel miRNAs have been reported (Subramanian et al. 2008; Wang et  al. 2009; Joshi et  al. 2010; Liu and Chen 2010). However, functional

9.11  Conclusion and Future Perspective

characterization has not been carried out for any of the novel miRNAs other than tissue specific expression analysis (Jagadeeswaran et al. 2009; Joshi et al. 2010). Transcriptome analysis in M. truncatula showed MtHAP2‐1 is strongly up‐regulated during nodule development (Combier et al. 2006). Detailed characterization of the Mt‐ HAP2‐1 gene using RNAi showed a reduction in Mt‐HAP2‐1 expression, which ultimately arrested nodule development and nitrogen fixation. Based on the earlier predictions, which suggested that HAP2‐1 transcription factors are potential targets of miR169 in Arabidopsis (Jones‐Rhoades and Bartel 2004). Computational analysis also identified miR169 with stable stem loop in M. truncatula. Overexpression of Mt‐ miR169a in transgenic Medicago roots under a constitutive promoter led to an increased accumulation of mature miR169 and this coincides with a reduction in Mt‐HAP2‐1 transcript level. MiR169 mediated cleavage of target Mt‐HAP2‐1 mRNA was then obtained by 5′ RACE‐PCR. In addition, miR166 posttranscriptionally regulate HD‐ ZIP‐III transcription factors which are associated with nodule formation. Overexpression of miR166 led to a reduced number of symbiotic nodules and lateral roots possibly because of the mispatterning of vascular bundles (Williams et al. 2005; Boualem et al. 2008). miR166 may have a general role in regulating development of secondary organs in plants which can also be considered in the regulation of legume root architecture. The above discussion clearly suggests that miRNAs play important roles in nodule development and nitrogen fixation in leguminous plants. This ultimately affects crop plant yields. Therefore, engineering a non‐cleavable RNA to sequester miR169 and miR166 would allow plants to fix more nitrogen through root nodules, thereby securing sufficient edaphic resources for development resulting in higher yields.

9.11 ­Conclusion and Future Perspective As a matter of fact, crop productivity, regarded as an absolute measure of the photosynthetic efficiency of plants and photosynthesis, is accepted as the foundation of life on earth (Ambavaram et  al. 2014). It should be noted that actual plants’ photosynthetic efficiency is rather low from 0.1% to 8% because of inefficient conversion of solar light to chemical energy (Zhu et al. 2010). Similarly, attempts to increase the yield by direct improvement of photosynthetic efficiency has not met with success yet. Genetically modified plants (GMPs) offer a reasonable solution to overcome this limitation. GMPs can be produced with higher photosynthetic efficiencies and enhanced growth rates. In this regard, it becomes desirable to explore candidate genes that can confer stress tolerance without restricting the plant growth and yield. Recently published papers have clearly demonstrated that diverse plants (Arabidopsis, tobacco, and rice) overexpressing miR408 showed increased photosynthetic activity and significantly higher biomass and seed yield (Pan et  al. 2018; Song et  al. 2018). Similarly, overexpression of miR408 led to improved tolerance to various abiotic stresses in Arabidopsis (Zhang et al. 2014; Hajyzadeh et al. 2015; Ma et al. 2015). It is noteworthy that the miR408 transgenic plants could be resistant to stress conditions. The findings presented here have several important implications. Together with previous results, the current state of knowledge reveals that miR408 may act as a link between plant growth, development, and stress response, and play a crucial role in plant survival. Overall,

177

178

9  Regulatory Roles of miRNAs

transgenic plants overexpressing miR408 demonstrated improved photosynthetic rate, seed yield, and tolerance to abiotic stresses. It is logical to use this miRNA in combination with the existing gene pool to create super traits in plants (Jiao et al. 2010; Miura et al. 2010; Huang et al. 2012; Zhang et al. 2013; Huang et al. 2016). There are several examples in the literature whereby two miRNAs showed synergistic effects resulting in improved plant traits (Wang et al. 2015). Therefore, it is conceivable that miR408 can be used in combination with other miRNAs for desirable outcomes (Reichel et al. 2015; Tang and Chu 2017).

­References Abdel‐Ghany, S.E. and Pilon, M. (2008). MicroRNA‐mediated systemic down‐regulation of copper protein expression in response to low copper availability in Arabidopsis. J. Biol. Chem. 283: 15932–15945. Able, S. (2007). Auxin in surfacing. ACS Chem. Biol. 2: 380–384. Achard, P., Herr, A., Baulcombe, D.C., and Harberd, N.P. (2004). Modulation of floral development by a gibberellin‐regulated microRNA. Development 131: 3357–3365. Ahuja, I., de Vos, R.C., Bones, A.M., and Hall, R.D. (2010). Plant molecular stress responses face climate change. Trends Plant Sci. 15: 664–674. Alptekin, B., Langridge, P., and Budak, H. (2017). Abiotic stress miRNomes in triticeae. Funct. Integr. Genomics 17: 145–170. Alvarez‐Buylla, E.R., Liljegren, S.J., Pelaz, S. et al. (2000). MADS‐box gene evolution beyond flowers: expression in pollen, endosperm, guard cells, roots and trichomes. Plant J. 24: 457–466. Alves, L. Jr., Niemeier, S., Hauenschild, A. et al. (2009). Comprehensive prediction of novel microRNA targets in Arabidopsis thaliana. Nucleic Acids Res. 37: 4010–4021. Amaral, P.P., Dinger, M.E., and Mattick, J.S. (2013). Non‐coding RNAs in homeostasis, disease and stress responses: an evolutionary perspective. Brief. Funct. Genomics 12: 254–278. Ambavaram, M.M.R., Basu, S., Krishnan, A. et al. (2014). Coordinated regulation of photosynthesis in rice increases yield and tolerance to environmental stress. Nat. Commun. 5: 5302. Annacondia, M.L., Mageroy, M.H., and Martinez, G. (2018). Stress response regulation by epigenetic mechanisms: changing of the guards. Plant Physiol. 162: 239–250. Arenas‐Huertero, C., Perez, B., Rabanal, F. et al. (2009). Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress. Plant Mol. Biol. 70: 385–400. Ashraf, M. and Harris, P.J.C. (2013). Photosynthesis under stressful environments: an overview. Photosynthetica 51: 163–190. Aukerman, M.J. and Sakai, H. (2003). Regulation of flowering time and floral organ identity by a microRNA and its APETALA2‐like target genes. Plant Cell 15: 2730–2741. Aung, K., Lin, S.I., Wu, C.C. et al. (2006). pho2, a phosphate over accumulator, is caused by a nonsense mutation in a microRNA399 target gene. Plant Physiol. 141: 1000–1011. Axmann, I.M., Kensche, P., Vogel, J. et al. (2005). Identification of cyanobacterial non‐ coding RNAs by comparative genome analysis. Genome Biol. 6: R73. Axtell, M.J. and Bartel, D.P. (2005). Antiquity of microRNAs and their targets in land plants. Plant Cell 17: 1658–1673.

­  References

Axtell, M.J. and Bowman, J.L. (2008). Evolution of plant microRNAs and their targets. Trends Plant Sci. 13: 343–349. Axtell, M.J., Jan, C., Rajagopalan, R., and Bartel, D.P. (2006). A two‐hit trigger for siRNA biogenesis in plants. Cell 127: 565–577. Banerjee, S., Sirohi, A., Ansari, A.A., and Gill, S.S. (2017). Role of small RNAs in abiotic stress responses in plants. Plant Gene 11: 180–189. Bari, R., Datt, P.B., Stit, M., and Scheible, W.R. (2006). PHO2, microRNA399, and PHR1 define a phosphate‐signaling pathway in plants. Plant Physiol. 141: 988–999. Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297. Berger, Y., Harpaz‐Saad, S., Brand, A. et al. (2009). The NAC‐domain transcription factor GOBLET specifies leaflet boundaries in compound tomato leaves. Development 136: 823–832. Billis, K., Billini, M., Tripp, H.J. et al. (2014). Comparative transcriptomics between Synechococcus PCC 7942 and Synechocystis PCC 6803 provide insights into mechanisms of stress acclimation. PLoS One 9: e109738. Billoud, B., De Paepe, R., Baulcombe, D., and Boccara, M. (2005). Identification of new small non‐coding RNAs from tobacco and Arabidopsis. Biochimie 87: 905–910. Biswal, B., Joshi, P.N., Raval, M.K., and Biswal, U.C. (2011). Photosynthesis, a global sensor of environmental stress in green plants: stress signaling and adaptation. Curr. Sci. 101: 47–56. Blankenburg, M., Haberland, L., Elvers, H.D. et al. (2009). High‐throughput omics technologies: potential tools for the investigation of influences of EMF on biological systems. Curr. Genomics 10: 86–92. Boualem, A., Laporte, P., Jovanovic, M. et al. (2008). MicroRNA166 controls root and nodule development in Medicago truncatula. Plant J. 54: 876–887. Bray, E.A. (2004). Genes commonly regulated by water‐deficit stress in Arabidopsis thaliana. J. Exp. Bot. 55: 2331–2341. Britten, J. and Davidson, E.H. (1969). Gene regulation for higher cells: a theory. Science 165: 349–357. Brodersen, P. and Voinnet, O. (2009). Revisiting the principles of microRNA target recognition and mode of action. Nat. Rev. Mol. Cell Biol. 10: 141–148. Brodersen, P., Achard, L.S., Rasmussen, M.B. et al. (2008). Widespread translational inhibition by plant miRNAs and siRNAs. Science 320: 1185–1190. Buhtz, A., Springer, F., Chappell, L. et al. (2008). Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53: 739–749. Bustos‐Sanmamed, P., Mao, G., Deng, Y. et al. (2013). Overexpression of miR160 affects root growth and nitrogen‐fixing nodule number in Medicago truncatula. Funct. Plant Biol. 40: 1208–1220. Byrne, M.E. (2006). Shoot meristem function and leaf polarity: the role of class III HD‐ZIP genes. PLoS Genet. 2: e89. von Caemmerer, S. and Evans, J.R. (2010). Enhancing C3 photosynthesis. Plant Physiol. 154: 589–592. von Caemmerer, S., Quick, W.P., and Furbank, R.T. (2012). The development of C4 Rice: current progress and future challenges. Science 336: 1671–1672. Carrington, J.C. and Ambros, V. (2003). Role of microRNAs in plant and animal development. Science 301: 336–338.

179

180

9  Regulatory Roles of miRNAs

Century, K., Reuber, T.L., and Ratcliffe, O.J. (2008). Regulating the regulators: the future prospects for transcription factor‐based agricultural biotechnology products. Plant Physiol. 147: 20–29. Chaves, M.M., Flexas, J., and Pinheiro, C. (2009). Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Ann. Bot. 103: 551–560. Chellappan, P., Xia, J., Zhou, X. et al. (2010). siRNAs from miRNA sites mediate DNA methylation of target genes. Nucleic Acids Res. 38: 6883–6894. Chen, X. (2004). A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303: 2022–2025. Chen, X. (2005). MicroRNA biogenesis and function in plants. FEBS Lett. 579: 5923–5931. Chen, H. and Xiong, L. (2010). The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation. Plant Cell Environ. 33: 2180–2190. Chen, Y., Lohuis, D., Goldbach, R., and Prins, M. (2004). High frequency induction of RNA‐mediated resistance against Cucumber mosaic virus using inverted repeat constructs. Mol. Breed. 14: 215–226. Chen, H., Chen, X., Chen, D. et al. (2015). Comparison of the low temperature transcriptomes of two tomato genotypes that differ in freezing tolerance: Solanum lycopersicum and Solanum habrochaites. BMC Plant Biol. 15: 132. Chiou, T.J., Aung, K., Lin, S.I. et al. (2006). Regulation of phosphate homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412–421. Chitwood, D.H., Guo, M., Nogueira, F.T., and Timmermanns, M.C. (2007). Establishing leaf polarity: the role of small RNAs and positional signals in the shoot apex. Development 134: 813–823. Chitwood, D.H., Nogueira, F.T., Howell, M.D. et al. (2009). Pattern formation via small RNA mobility. Genes Dev. 23: 549–554. Chuck, G., Candela, H., and Hake, S. (2009). Big impacts by small RNAs in plant development. Curr. Opin. Plant Biol. 12: 81–86. Chuck, G., Meeley, R., and Hake, S. (2007). The maize tasselseed4 microRNAcontrols sex determination and meristem cell fate by targeting Tasselseed6 indeterminate spikelet1. Nat. Genet. 39: 1517–1521. Clauw, P., Coppens, F., De Beuf, K. et al. (2015). Leaf responses to mild drought stress in natural variants of Arabidopsis thaliana. Plant Physiol. 167: 800–816. Comai, L. and Zhang, B. (2012). MicroRNAs: key gene regulators with versatile functions. Plant Mol. Biol. 80: 1. Combier, J.P., Frugier, F., Billy, F.D. et al. (2006). MtHAP2‐1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. Genes Dev. 20: 3084–3088. Cramer, G. (2002). Sodium‐calcium interactions under salinity stress. In: Salinity. Environment‐Plants‐Molecules (ed. A. Lauchli and U. Luttge), 205–227. Dordrecht: Kluwer Academic Publishers. Cuperus, J.T., Fahlgren, N., and Carrington, J.C. (2011). Evolution and functional diversification of MIRNA genes. Plant Cell 23: 431–442. De Oliveira, A.B., Mendes Alencar, N.L., and Gomes‐Filho, E. (2013). Comparison between the water and salt stress effects on plant growth and development. In: Responses of Organisms to Water Stress (ed. S. Akinci), 67–94. IntechOpen.

­  References

De Smet, I., Vanneste, S., Inzé, D., and Beeckman, T. (2006). Lateral root initiation or the birth of a new meristem. Plant Mol. Biol. 60: 871–887. Degenkolbe, T., Do, P.T., Zuther, E. et al. (2009). Expression profiling of rice cultivars differing in their tolerance to long‐term drought stress. Plant Mol. Biol. 69: 133–153. Dhar, M.K., Visha, P., Sharma, R., and Kaul, S. (2014). Epigenetic dynamics: role of epimarks and underlying machinery in plants exposed to abiotic stress. Int. J. Genomics 2014: 187146. Ding, D., Zhang, L., Wang, H. et al. (2009). Differential expression of miRNAs in response to salt stress in maize roots. Ann. Bot. 103: 29–38. Dinneny, J.R., Long, T.A., Wang, J.Y. et al. (2008). Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science 320: 942–945. Dubouzet, J.G., Sakuma, Y., Ito, Y. et al. (2003). OsDREB genes in rice, Oryza sativa L, encode transcription activators that function in drought‐, high salt‐ and cold responsive gene expression. Plant J. 33: 751–763. de Dorlodot, S., Forster, B., Pagès, L. et al. (2007). Root system architecture: opportunities and constraints for genetic improvement of crops. Trends Plant Sci. 12: 474–481. Dos Reis, S.P., Lima, A.M., and de Souza, C.R.B. (2012). Recent molecular advances on downstream plant responses to abiotic stress. Int. J. Mol. Sci. 13: 8628–8647. Downie, J.A. and Walker, S.A. (1999). Plant responses to nodulation factors. Curr. Opin. Plant Biol. 2: 483–489. Duan, C.G., Wang, C.H., and Guo, H.S. (2006). Regulation of microRNA on plant development and viral infection. Chin. Sci. Bull. 51: 269–278. Fahad, S., Bajwa, A.A., Nazir, U. et al. (2017). Crop production under drought and heat stress: plant responses and management options. Front. Plant Sci. 8: 1147. Fahlgren, N., Howell, M.D., Kasschau, K., and Chapman, E. (2007). High‐throughput sequencing of Arabidopsis microRNAs. PLoS One 2: 219–223. Ferdous, J., Hussain, S.S., and Shi, B. (2015). Role of microRNAs in plant drought tolerance. Plant Biotechnol. J. 13: 293–305. Filichkin, S.A., Hamilton, M., Dharmawardhana, P.D. et al. (2018). Abiotic stresses modulate landscape of poplar transcriptome via alternative splicing, differential intron retention, and isoform ratio switching. Front. Plant Sci. 9: 5. Flaherty, B.L., Van Nieuwerburgh, F., Head, S.R., and Golden, J.W. (2011). Directional RNA deep sequencing sheds new light on the transcriptional response of Anabaena sp. strain PCC 7120 to combined‐nitrogen deprivation. BMC Genomics 12: 332. Flexas, J. and Medrano, H. (2002). Drought‐inhibition of photosynthesis in C3 plants: stomatal and non‐stomatal limitations revisited. Ann. Bot. 89: 183–189. Flexas, J., Ribas‐Carbo, M., Diaz‐Espejo, A. et al. (2008). Mesophyll conductance to CO2: current knowledge and future prospects. Plant Cell Environ. 31: 602–612. Forestan, C., Cigliano, R.A., Farinati, S. et al. (2016). Stress‐induced epigenetic mediated maize transcriptome regulation study by means of transcriptome reannotation and differential expression analysis. Sci. Rep. 6: 30446. Foyer, C.H. and Shigeoka, S. (2011). Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiol. 155: 93–100. Frazier, T.P., Sun, G., Burklew, C.E., and Zhang, B. (2011). Salt and drought stresses induce the aberrant expression of microRNA genes in tobacco. Mol. Biotechnol. 49: 159–165. Fricke, W. and Peters, W.S. (2002). The biophysics of leaf growth in salt‐stressed barley. A study at the cell level. Plant Physiol. 129: 374–388.

181

182

9  Regulatory Roles of miRNAs

Fujii, H., Chiou, T.J., Lin, S.I. et al. (2005). A miRNA involved in phosphate‐starvation response in Arabidopsis. Curr. Biol. 15: 2038–2043. Gage, D.J. (2004). Infection and invasion of roots by symbiotic, nitrogen‐fixing rhizobia during nodulation of temperate legumes. Microbiol. Mol. Biol. Rev. 68: 280–300. Gandikota, M., Birkenbihl, R.P., Hohmann, S. et al. (2007). The miRNA156/157 recognition element in the 3′ UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J. 49: 683–693. Gao, S., Zhao, W., Li, X. et al. (2017). Identification and characterization of miRNAs in two closely related C4 and C3 species of Cleome by high throughput sequencing. Sci. Rep. 7: 46552. Garcia, D. (2008). A miracle in plant development: role of microRNAs in cell differentiation and patterning. Semin. Cell Dev. Biol. 19: 586–595. Garcia, P. and Frampton, J. (2008). Hematopoietic lineage commitment: miRNAs add specificity to a widely expressed transcription factor. Dev. Cell 14: 815–816. Georg, J., Voss, B., Scholz, I. et al. (2009). Evidence for a major role of antisense RNAs in cyanobacterial gene regulation. Mol. Syst. Biol. 5: 305. Geurts, R., Fedorova, E., and Bisseling, T. (2005). Nod factor signaling genes and their function in early stages of Rhizobium infection. Curr. Opin. Plant Biol. 8: 346–352. Ghannoum, O., Evans, J.R., and von Caemmerer, S. (2011). Nitrogen and water use efficiency of C4 plants. In: C4 Photosynthesis and Related CO2 Concentrating Mechanisms (ed. A.S. Raghavendra and R.F. Sage), 129–146. Netherlands: Springer. Gibson, K., Park, J.S., Nagai, Y. et al. (2011). Exploiting leaf starch synthesis as a transient sink to elevate photosynthesis, plant productivity and yields. Plant Sci. 181: 275–281. Gielen, H., Remans, T., Vangronsveld, J., and Cuypers, A. (2012). MicroRNAs in metal stress: specific roles or secondary responses. Int. J. Mol. Sci. 13: 15826–15847. Gierga, G., Voss, B., and Hess, W.R. (2012). Non‐coding RNAs in marine Synechococcus and their regulation under environmentally relevant stress conditions. ISME J. 6: 1544–1557. Gorantla, M., Babu, P.R., Lachagari, V.B.R. et al. (2007). Identification of stress‐responsive genes in an indica rice (Oryza sativa L.) using ESTs generated from drought‐stressed seedlings. J. Exp. Bot. 58: 253–265. Griffiths‐Jones, S., Saini, H.K., van Dongen, S., and Enright, A.J. (2008). miRBase: tools for microRNA genomics. Nucleic Acids Res. 36: D154–D158. Guo, H.S., Xie, Q., Fei, J.F., and Chua, N.H. (2005). MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell 17: 1376–1386. Gururani, M.A., Mohanta, T.K., and Bae, H. (2015). Current understanding of the interplay between phytohormones and photosynthesis under environmental stress. Int. J. Mol. Sci. 16: 19055–19085. Gutierrez, L., Bussell, J.D., Pacurar, D.I. et al. (2009). Phenotypic plasticity of adventitious rooting in Arabidopsis is controlled by complex regulation of AUXIN RESPONSE FACTOR transcripts and microRNA abundance. Plant Cell 21: 3119–3132. Hajyzadeh, M., Turktas, A., Khawar, K.M., and Unver, T. (2015). miR408 overexpression causes increased drought tolerance in chickpea. Gene 555: 186–193. Hamilton, A.J. and Baulcombe, D.C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286: 950–952.

­  References

Hammer, G.L., Doug, Z., McLean, G. et al. (2009). Can changes in canopy and/or root system architecture explain historical maize yield trends in the U.S. corn belt? Crop Sci. 49: 299–312. Hayano‐Kanashiro, C., Calderon‐Vazquez, C., Ibarra‐Laclette, E. et al. (2009). Analysis of gene expression and physiological responses in three Mexican maize landraces under drought stress and recovery irrigation. PLoS One 4: e7531. Hazen, S.P., Pathan, M.S., Sanchez, A. et al. (2005). Expression profiling of rice segregating for drought tolerance QTLs using a rice genome array. Funct. Integr. Genomics 5: 104–116. Hibberd, J.M., Sheehy, J.E., and Langdale, J.A. (2008). Using C4 photosynthesis to increase the yield of rice‐rationale and feasibility. Curr. Opin. Plant Biol. 11: 228–231. Hippler, M., Klein, J., Fink, A. et al. (2001). Towards functional proteomics of membrane protein complexes: analysis of thylakoid membranes from Chlamydomonas reinhardtii. Plant J. 28: 595–606. Hirel, B., Le Gouis, J., Ney, B., and Gallais, A. (2007). The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. J. Exp. Bot. 58: 2369–2387. Hsieh, L.C., Lin, S.I., Shih, A.C.C. et al. (2009). Uncovering small RNA‐mediated responses to phosphate deficiency in Arabidopsis by deep sequencing. Plant Physiol. 151: 2120–2132. Huang, X., Zhao, Y., Wei, X. et al. (2012). Genome‐wide association study of flowering time and grain yield traits in a worldwide collection of rice germplasm. Nat. Genet. 44: 2–39. Huang, X., Yang, S., Gong, J. et al. (2016). Genomic architecture of heterosis for yield traits in rice. Nature 537: 629–633. Hunter, C. and Poethig, R.S. (2003). Missing links:miRNAs and plant development. Curr. Opin. Genet. Dev. 13: 371–378. Husbands, A.Y., Chitwood, D.H., Plavskin, Y., and Timmermanns, M.C. (2009). Signals and pre‐patterns: new insights into organ polarity in plants. Genes Dev. 23: 1986–1997. Hussain, S.S. and Shi, B. (2014). Role of miRNAs in abiotic and biotic stresses in plants. In: Emerging Technologies and Management of Crop Stress Tolerance: Vol 1: Biological Techniques (ed. P. Ahmad and S. Rasool), 181–207. USA: Elsevier. Hussain, S.S., Iqbal, M.T., Arif, M.A., and Amjad, M. (2011a). Beyond osmolytes and transcription factors: drought tolerance in plants via protective proteins and aquaporins. Biol. Plant. 55: 401–413. Hussain, S.S., Kayani, M.A., and Amjad, M. (2011b). Transcription factors as tools to engineer enhanced drought stress tolerance in plants. Biotechnol. Progr. 27: 297–306. Hussain, S.S., Raza, H., Afzal, I., and Kayani, M.A. (2012). Transgenic plants for abiotic stress tolerance: current status. Arch. Agron. Soil Sci. 58: 693–721. Hussain, S.S., Siddique, K.H.M., and Lopato, S. (2014). Towards integration of bacterial genomics in plants for enhanced abiotic stress tolerance: clues from transgenics. Adv. Environ. Res. 33: 65–122. Hussain, S.S., Ali, M., and Shi, B. (2015). MiRNA mediated regulatory functions under abiotic stresses in legumes. In: Legumes under Environmental Stress: Yield, Improvement and Adaptation (ed. P. Ahmad and M. Azoozor), 231–245. UK: Wiley. Hussain, H.A., Hussain, S., Khaliq, A. et al. (2018a). Chilling and drought stresses in crop plants: Implications, cross talk, and potential management opportunities. Front. Plant Sci. 9: 393.

183

184

9  Regulatory Roles of miRNAs

Hussain, S.S., Hussain, M., Irfan, M., and Siddique, K.M. (2018b). Legume, microbiome and regulatory functions of miRNAs in systematic regulation of symbiosis. In: Microbiome: Stress Response and Microbes for Sustainable Agriculture (ed. P. Ahmad and D. Egamberdieva), 255–282. Singapore: Springer. Hussain, S.S., Mehnaz, S., and Siddique, K.M. (2018c). Harnessing the plant microbiome for improved abiotic stress tolerance. In: Microbiome: Stress Response and Microbes for Sustainable Agriculture (ed. P. Ahmad and D. Egamberdieva), 21–43. Singapore: Springer. Ionescu, D., Voss, B., Oren, A. et al. (2010). Heterocyst‐specific transcription of NsiR1, a non‐coding RNA encoded in a tandem array of direct repeats in cyanobacteria. J. Mol. Biol. 398: 177–188. Jacob, F. and Monod, J. (1961). Genetic regulatory mechanisms in the synthesis of proteins. J. Mol. Biol. 3: 318–356. Jagadeeswaran, G., Saini, A., and Sunkar, R. (2009). Biotic and abiotic stress down‐regulate miR398 expression in Arabidopsis. Planta 229: 1009–1014. Ji, K., Wanga, Y., Sunb, W. et al. (2012). Drought‐responsive mechanisms in rice genotypes with contrasting drought tolerance during reproductive stage. J. Plant Physiol. 169: 336–344. Jia, X., Wang, W.X., Ren, L. et al. (2009). Differential and dynamic regulation of miR398 in response to ABA and salt stress in Populus tremula and Arabidopsis thaliana. Plant Mol. Biol. 71: 51–59. Jiao, Y., Wang, Y., Xue, D. et al. (2010). Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 42: 541–544. Jin, T., Chang, Q., Li, W. et al. (2010). Stress‐inducible expression of GmDREB1 conferred salt tolerance in transgenic alfalfa. Plant Cell, Tissue Organ Cult. 100: 219–227. Jin, D., Wang, Y., Zhao, Y., and Chen, M. (2013). MicroRNAs and their cross talks in plant development. J. Genet. Genomics 40: 161–170. Joliot, P. and Joliot, A. (2006). Cyclic electron flow in C3 plants. Biochim. Biophys. Acta 1757: 362–368. Jones‐Rhoades, M.W. and Bartel, D.P. (2004). Computational identification of plant microRNAs and their targets, including a stress‐induced miRNA. Mol. Cell 14: 787–799. Jones‐Rhoades, M.W., Reinhart, B.J., Lim, L.P. et al. (2002). Prediction of plant microRNA targets. Cell 110: 513–520. Jones‐Rhoades, M.W., Bartel, D.P., and Bartel, B. (2006). MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 57: 19–53. Joshi, J., Yan, Z., Libault, M. et al. (2010). Prediction of novel miRNAs and associated target genes in Glycine max. BMC Bioinf. 11: S14. Jovanovic, M., Lefebvre, V., Laporte, P. et al. (2008). How the environment regulates root architecture in dicots. Adv. Bot. Res. 46: 35–74. Juarez, M.T., Kui, J.S., Thomas, J. et al. (2004). MicroRNA‐mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 824: 84–88. Kajala, K., Covshoff, S., Karki, S. et al. (2011). Strategies for engineering a two‐celled C(4) photosynthetic pathway into rice. J. Exp. Bot. 62: 3001–3010. Kantar, M., Unver, T., and Budak, H. (2010). Regulation of barley miRNAs upon dehydration stress correlated with target gene expression. Funct. Integr. Genomics 10: 493–507.

­  References

Kantar, M., Lucas, S.J., and Budak, H. (2011). miRNA expression patterns of Triticum dicoccoides in response to shock drought stress. Planta 233: 471–484. Karaba, A., Dixit, S., Greco, R. et al. (2007). Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene. Proc. Natl. Acad. Sci. U.S.A. 104: 15270–15275. Kasschau, K.D., Xie, Z., Allen, E. et al. (2003). P1/HC‐Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function extent of virus invasion. RNA silencing involves recognition and processing of double‐stranded RNA. Dev. Cell 4: 205–217. Kawashima, C.G., Yoshimoto, N., Maruyama‐Nakashita, A. et al. (2009). Sulphur starvation induces the expression of microRNA‐395 and one of its target genes but in different cell types. Plant J. 57: 313–321. Khan, G.A., Declerck, M., Sorin, C. et al. (2011). MicroRNAs as regulators root development and architecture. Plant Mol. Biol. 77: 47–58. Khraiwesh, B., Zhu, J.K., and Zhu, J. (2012). Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim. Biophys. Acta 1819: 137–148. Kidner, C.A. and Martienssen, R.A. (2004). Spatially restricted microRNA directs leaf polarity through ARGONAUTE1. Nature 428: 81–84. Kim, J.Y. (2005). Regulation of short‐distance transport of RNA and protein. Curr. Opin. Plant Biol. 8: 45–52. Kim, J., Jung, J.H., Reyes, J.L. et al. (2005). MicroRNA‐directed cleavage of ATHB15 mRNA regulates vascular development in Arabidopsis inflorescence stems. Plant J. 42: 84–94. Kim, B., Yu, H.J., Park, S.G. et al. (2012). Identification and profiling of novel microRNAs in the Brassica rapa genome based of small RNA deep sequencing. BMC Plant Biol. 12: 218. Kopf, M., Klähn, S., Pade, N. et al. (2014a). Comparative genome analysis of the closely related Synechocystis strains PCC 6714 and PCC 6803. DNA Res. 21: 255–266. Kopf, M., Klahn, S., Scholz, I. et al. (2014b). Comparative analysis of the primary transcriptome of Synechocystis sp. PCC 6803. DNA Res. 21: 527–539. Kopf, M., Klähn, S., Scholz, I. et al. (2015a). Variations in the non‐coding transcriptome as a driver of inter‐strain divergence and physiological adaptation in bacteria. Sci. Rep. 5: 9560. Kopf, M., Möke, F., Bauwe, H. et al. (2015b). Expression profiling of the bloomforming cyanobacterium Nodularia spumigena CCY9414 under high light and oxidative stress conditions. ISME J. 9: 2142–2152. Kozomara, A. and Griffiths‐Jones, S. (2011). miRBase: integrating microRNA annotation and deep‐sequencing data. Nucleic Acids Res. 39: D152–D157. Kramer, P.J. (1981). Carbon‐dioxide concentration, photosynthesis, and dry‐matter production. Bioscience 31: 29–33. Kreps, J.A., Wu, Y., Chang, H.S. et al. (2002). Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol. 130: 2129–2141. Kulcheski, F.R., de Oliveira, L.F., Molina, L.G. et al. (2011). Identification of novel soybean microRNAs involved in abiotic and biotic stresses. BMC Genomics 12: 307. Kumar, V., Khare, T., Shriram, V., and Wani, S.H. (2018). Plant small RNAs: the essential epigenetic regulators of gene expression for salt‐stress responses and tolerance. Plant Cell Rep. 37: 61–75.

185

186

9  Regulatory Roles of miRNAs

Kutter, C., Schob, H., Stadler, M. et al. (2007). MicroRNA‐mediated regulation of stomatal development in Arabidopsis. Plant Cell 19: 2417–2429. Lai, E.C., Tomancak, P., Williams, R.W., and Rubin, G.M. (2003). Computational identification of Drosophila microRNA genes. Genome Biol. 4: R42. Laporte, P., Merchan, F., Amor, B.B. et al. (2007). Riboregulators in plant development. Biochem. Soc. Trans. 35: 1638–1642. Laufs, P., Peaucelle, A., Morin, H., and Traas, J. (2004). MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems. Development 131: 4311–4322. Lauter, N., Kampani, A., Carlson, S. et al. (2005). MicroRNA172 down regulates glossy15 to promote vegetative phase change in maize. Proc. Natl. Acad. Sci. U.S.A. 102: 9412–9417. Lelandais‐Briere, C., Naya, L., Sallet, E. et al. (2009). Genome‐wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules. Plant Cell 21: 2780–2796. Lelandais‐Briere, C., Sorin, C., Declerck, M. et al. (2010). Small RBA diversity in plants and its impact in development. Curr. Genomics 11: 14–23. Li, C. and Zhang, B.H. (2016). MicroRNAs in control of plant development. J. Cell. Physiol. 231: 303–313. Li, H., Deng, Y., Wu, T. et al. (2010). Misexpression of miR482, miR1512, and miR1515 increases soybean nodulation. Plant Physiol. 153: 1759–1770. Li, T., Chen, J., Qiu, S. et al. (2012). Deep sequencing and microarray hybridization to identify conserved and species specific microRNAs during somatic embryogenesis in hybrid yellow poplar. PLoS One 7: e43451. Liang, G., Yang, F., and Yu, D. (2010). MicroRNA395 mediates regulation of sulfate accumulation and allocation in Arabidopsis thaliana. Plant J. 62: 1046–1057. Liang, L., Li, Y., He, H. et al. (2013). Identification of miRNAs and miRNA‐mediated regulatory pathways in Carica papaya. Planta 238: 739–752. Lin, Y. and Lai, Z.X. (2013). Comparative analysis reveals dynamic changes in miRNA and their targets and expression during somatic embryogenesis in longan (Dinocarpus longan Lour.). PLoS One 8: e60337. Liu, Q. and Chen, Y.Q. (2009). Insights into the mechanism of plant development: interactions of miRNAs pathway with phytohormone response. Biochem. Biophys. Res. Commun. 384: 1–5. Liu, Q. and Chen, Y.Q. (2010). A new mechanism in plant engineering: the potential roles of microRNAs in molecular breeding for crop improvement. Biotechnol. Adv. 28: 301–307. Liu, P.P., Montgomery, T.A., Fahlgren, N. et al. (2007). Repression of AUXIN RESPONSIVE FACTOR 10 by microRNA160 is critical for seed germination and post‐germination stages. Plant J. 52: 133–146. Liu, H.H., Tian, X., Li, Y.J. et al. (2008). Microarray‐based analysis of stress‐regulated microRNAs in Arabidopsis thaliana. RNA 14: 836–843. Liu, D., Song, Y., Chen, Z., and Yu, D. (2009a). Ectopic expression of miR396 supresses GRF target gene expression and alter leaf growth in Arabidopsis. Physiol. Plant. 136: 223–236. Liu, Q., Zhang, Y.C., Wang, C.Y. et al. (2009b). Expression analysis of phytohormone‐ regulated microRNAs in rice, implying their regulation roles in plant hormone signaling. FEBS Lett. 583: 723–728.

­  References

Liu, W., Li, R.J., Han, T.T. et al. (2015). Salt stress reduces root meristem size by nitric oxide‐mediated modulation of auxin accumulation and signaling in Arabidopsis. Plant Physiol. 168: 343–356. Liu, M., Yu, H., Zhao, G. et al. (2017). Profiling of drought‐responsive microRNA and mRNA in tomato using high‐throughput sequencing. BMC Genomics 18: 481. Llave, C., Xie, Z., Kasschau, K.D., and Carrington, J.C. (2002). Cleavage of Scarecrow‐like mRNA targets directed by a class of Arabidopsis miRNA. Science 297: 2053–2056. Lu, X.Y. and Huang, X.L. (2008). Plant miRNAs and abiotic stress responses. Biochem. Biophys. Res. Commun. 368: 458–462. Lu, S., Sun, Y.H., Shi, R. et al. (2005). Novel and mechanical stress‐responsive microRNAs in Populus trichocarpa that are absent from Arabidopsis. Plant Cell 17: 2186–2203. Lu, S., Sun, Y.H., and Chiang, V.L. (2008). Stress‐responsive microRNAs in Populus. Plant J. 55: 131–151. Lynch, J.P. (2007). Roots of the second green revolution. Aust. J. Bot. 55: 493–512. Ma, S.S., Gong, Q.Q., and Bohnert, H.J. (2006). Dissecting salt stress pathways. J. Exp. Bot. 57: 1097–1107. Ma, D.M., Xu, W.R., Li, H.W. et al. (2014). Coexpression of the Arabidopsis SOS genes enhances salt tolerance in transgenic tall fescue (Festuca arundinacea Schreb.). Protoplasma 251: 219–231. Ma, C., Burd, S., and Lers, A. (2015). miR408 is involved in abiotic stress responses in Arabidopsis. Plant J. 84: 169–187. Maayan, I., Shaya, F., Ratner, K. et al. (2008). Photosynthetic activity during olive (Olea europaea) leaf development correlates with plastid biogenesis and RuBisCO levels. Physiol. Plant. 134: 547–558. Mahajan, S. and Tuteja, N. (2005). Cold, salinity and drought stresses: an overview. Arch. Biochem. Biophys. 444: 139–158. Mallory, A.C. and Vaucheret, H. (2006). Functions of microRNAs and related small RNAs in plants. Nat. Genet. 38: 31–36. Mallory, A.C., Reinhart, B.J., Jones‐Rhoades, M.W. et al. (2004). MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5′ region. EMBO J. 23: 3356–3364. Mallory, A.C., Bartel, D.P., and Bartel, B. (2005). MicroRNA‐directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes. Plant Cell 17: 1360–1375. Marin, E., Jouannet, V., Herz, A. et al. (2010). miR390, Arabidopsis TAS3 tasiRNAs, and AUXIN RESPONSE FACTORS targets define an autoregulatory network quantitatively regulating lateral root growth. Plant Cell 22: 1104–1117. Mathieu, J., Yant, L.J., Muerdter, F. et al. (2009). Repression of flowering by the miR172 target SMZ. PLoS Biol. 7: e1000148. May, P., Liao, W., Wu, Y. et al. (2013). The effects of carbon dioxide and temperature on microRNA expression in Arabidopsis development. Nat. Commun. 4: 2145. Meloni, D.A., Oliva, M.A., Ruiz, H.A., and Martinez, C.A. (2001). Contribution of proline and inorganic solutes to osmotic adjustment in cotton under salt stress. J. Plant Nutr. 24: 599–612. Memon, S.A., Hou, X., and Wang, L. (2010). Morphological analysis of salt stress response of pak choi. Electron. J. Environ. Agric. Food Chem. 9: 248–254.

187

188

9  Regulatory Roles of miRNAs

Meng, Y., Huang, F., Shi, Q. et al. (2009). Genome‐wide survey of rice microRNAs and microRNA‐target pairs in the root of a novel auxin–resistant mutant. Planta 230: 883–898. Meyer, R.C., Steinfath, M., Lisec, J. et al. (2007). The metabolic signature related to high plant growth rate in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U.S.A. 104: 4759–4764. Mitschke, J., Georg, J., Scholz, I. et al. (2011a). An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp. PCC6803. Proc. Natl. Acad. Sci. U.S.A. 108: 2124–2129. Mitschke, J., Vioque, A., Haas, F. et al. (2011b). Dynamics of transcriptional start site selection during nitrogen stress‐induced cell differentiation in Anabaena sp. PCC7120. Proc. Natl. Acad. Sci. U.S.A. 108: 20130–20135. Miura, K., Ikeda, M., Matsubara, A. et al. (2010). OsSPL14 promotes panicle branching and higher grain productivity in rice. Nat. Genet. 42: 545–549. Mohammad, M., Shibli, R., Ajlouni, M., and Nimri, L. (1998). Tomato root and shoot responses to salt stress under different levels of phosphorus nutrition. J. Plant Nutr. 21: 1667–1680. Mohammadi‐Nejad, G., Singh, R., Arzani, A. et al. (2010). Evaluation of salinity tolerance in rice genotypes. Int. J. Plant Prod. 4: 199–208. Molnar, A., Basset, A., Theunemann, E. et al. (2009). Highly specific gene silencing by artificial microRNAs in the unicellular alga Chlamydomonas reinhardtii. Plant J. 58: 1–10. Moore, P.D. (1982). Evolution of photosynthetic pathways in flowering plants. Nature 295: 647–648. Moumeni, A., Satoh, K., Kondoh, H. et al. (2011). Comparative analysis of root transcriptome profiles of two pairs of drought‐tolerant and susceptible rice near‐ isogenic lines under different drought stress. BMC Plant Biol. 11: 174. Mutum, R.D., Balyan, S.C., Kansal, S. et al. (2013). Evolution of variety‐specific regulatory scheme for expression of osamiR408 in indica rice varieties under drought stress. FEBS J. 280: 1717–1730. Nag, A., King, S., and Jack, T. (2009). miR319a targeting of TCP4 is critical for petal growth and development in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 106: 22534–22539. Nath, K., Jajoo, A., Poudyal, R.S. et al. (2013). Towards a critical understanding of the photosystem II repair mechanism and its regulation during stress conditions. FEBS Lett. 587: 3372–3381. Navarro, L., Dunoyer, P., Jay, F. et al. (2006). A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312: 436–439. Nikovics, K., Blein, T., Peaucelle, A. et al. (2006). The balance between the MIR164A and CUC2 genes controls leaf margin serration in Arabidopsis. Plant Cell 18: 2929–2945. Nishiyama, Y. and Murata, N. (2014). Revised scheme for the mechanism of photoinhibition and its application to enhance the abiotic stress tolerance of the photosynthetic machinery. Appl. Microbiol. Biotechnol. 98: 8777–8796. Nogueira, F.T., Sarkar, A.K., Chitwood, D.H., and Timmermanns, M.C. (2006). Organ polarity in plants is specified through the opposing activity of two distinct small regulatory RNAs. Cold Spring Harbor Symp. Quant. Biol. 71: 157–164. Nogueira, F.T., Chitwood, D.H., Madi, S. et al. (2009). Regulation of small RNA accumulation in the maize shoot apex. PLoS Genet. 5: e1000320.

­  References

Nouri, M.Z. and Komatsu, S. (2013). Subcellular protein overexpression to develop abiotic stress tolerant plants. Front. Plant Sci. 4: 2. Ori, N., Cohen, A.R., Etzioni, A. et al. (2007). Regulation of LANCEOLATE by miR319 is required for compound‐leaf development in tomato. Nat. Genet. 39: 787–791. Osakabe, Y., Osakabe, K., Shinozaki, S., and Tran, L.S.P. (2014). Response of plants to water stress. Front. Plant Sci. 5: 86. Palatnik, J.F., Allen, E., Wu, X. et al. (2003). Control of leaf morphogenesis by microRNAs. Nature 425: 257–263. Pan, J., Huang, D., Guo, Z. et al. (2018). Overexpression of microRNA408 enhances photosynthesis, growth and yield in diverse plants. J. Integr. Plant Biol. 60: 323–340. Pant, B.D., Buhtz, A., Kehr, J., and Scheible, W.R. (2008). MicroRNA399 is a long‐distance signal for the regulation of plant phosphate homeostasis. Plant J. 53: 31–38. Park, M.Y., Wuu, G., Gozalez‐Sulser, A. et al. (2005). Nuclear processing and export of microRNAs in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 102: 3691–3696. Parker, R., Flowers, T.J., Moore, A.L., and Harpham, N.V.J. (2006). An accurate and reproducible method for proteome profiling of the effects of salt stress in the rice leaf lamina. J. Exp. Bot. 57: 1109–1118. Passioura, J.B. and Munns, R. (2000). Rapid environmental changes that affect leaf water status induce transient surges or pauses in leaf expansion rate. Funct. Plant Biol. 27: 941–948. Pfreundt, U., Kopf, M., Belkin, N. et al. (2014). The primary transcriptome of the marine diazotroph Trichodesmium erythraeum IMS101. Sci. Rep. 4: 6187. Pilon, M. (2017). The copper microRNAs. New Phytol. 213: 1030–1035. Pilon, M., Abdel‐Ghany, S.E., Cohu, C.M. et al. (2006). Copper cofactor delivery in plant cells. Curr. Opin. Plant Biol. 9: 256–263. Prigge, M.J., Otsuga, D., Alono, J.M. et al. (2005). ClassIII homeodomain‐leucine zipper gene family members have overlapping, antagonistic, and distinct roles in Arabidopsis development. Plant Cell 17: 61–76. Prins, A., Mukubi, J.M., Pellny, T.K. et al. (2011). Acclimation to high CO2 in maize is related to water status and dependent on leaf rank. Plant Cell Environ. 34: 314–331. Qin, F., Shinozaki, K., and Yamaguchi‐Shinozaki, K. (2011). Achievements and challenges in understanding plant abiotic stress responses and tolerance. Plant Cell Physiol. 52: 1569–1582. Qiu, Z., Hai, B., Guo, J. et al. (2016). Characterization of wheat miRNAs and their target genes responsive to cadmium stress. Plant Physiol. Biochem. 101: 60–67. Quint, M. and Gray, W.M. (2006). Auxin signaling. Curr. Opin. Plant Biol. 9: 448–453. Rabbani, M.A., Maruyama, K., Abe, H. et al. (2003). Monitoring expression profiles of rice genes under cold, drought, and high‐salinity stresses and abscisic acid application using cDNA microarray and RNA get‐blot analyses. Plant Physiol. 133: 1755–1767. Rabello, A.R., Guimarães, C.M., Rangel, P.H.N. et al. (2008). Identification of drought‐ responsive genes in roots of upland rice (Oryza sativa L.). BMC Genomics 9: 485. Rahman, A., Hossain, M.S., Mahmud, J.A. et al. (2016). Manganese‐induced salt stress tolerance in rice seedlings: regulation of ion homeostasis, antioxidant defense and glyoxalase systems. Physiol. Mol. Biol. Plants 22: 291–306. Rajagopalan, R., Vaucheret, H., Trejo, J., and Bartel, D.P. (2006). A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 20: 3407–3425.

189

190

9  Regulatory Roles of miRNAs

Rajwanshi, R., Chakraborty, S., Jayanandi, K. et al. (2014). Orthologous plant microRNAs: microregulators with great potential for improving stress tolerance in plants. Theor. Appl. Genet. 127: 2525–2543. Ranjit, S.L., Manish, P., and Penna, S. (2016). Early osmotic, antioxidant, ionic, and redox responses to salinity in leaves and roots of Indian mustard (Brassica juncea L.). Protoplasma 253: 101–110. Raven, J.A., Evans, M.C.W., and Korb, R.E. (1999). The role of trace metals in photosynthetic electron transport in O2‐evolving organisms. Photosynth. Res. 60: 111–149. Reddy, A.R., Ramakrishna, W., Sekhar, A.C. et al. (2002). Novel genes are enriched in normalized cDNA libraries from drought‐stressed seedlings of rice (Oryza sativa L. subsp. indica cv. Nagina 22). Genome 45: 204–211. Redillas, M.C.F.R., Park, S.H., Lee, J.W. et al. (2012). Accumulation of trehalose increases soluble sugar contents in rice plants conferring tolerance to drought and salt stress. Plant Biotechnol. Rep. 6: 89–96. Reichel, M., Li, Y., Li, J., and Millar, A.A. (2015). Inhibiting plant microRNA activity: molecular SPONGEs, target MIMICs and STTMs all display variable efficacies against target microRNAs. Plant Biotechnol. J. 13: 915–926. Reinhart, B.J., Weinstein, E.G., Rhoades, M.W. et al. (2002). MicroRNAs in plants. Genes Dev. 16: 1616–1626. Reyes, J.L. and Chua, N.H. (2007). ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 49: 592–606. Rizhsky, L., Liang, H., and Mittler, R. (2002). The combined effect of drought stress and heat shock on gene expression in tobacco. Plant Physiol. 130: 1143–1151. Rozema, J., Lenssen, G.M., Arp, W.J., and van de Staay, J.W.M. (1991). Global change, the impact of the greenhouse effect (atmospheric CO2 enrichment) and the increased UV‐B radiation on terrestrial plants. In: Ecological Responses to Environmental Stresses (ed. J. Rozema and J.A.C. Verkleij), 220–231. Dordrecht: Kluwer Academics. Ru, P., Xu, L., Ma, H., and Huang, H. (2006). Plant fertility defects induced by the enhanced expression of microRNA167. Cell Res. 16: 457–465. Rubio‐Somoza, I. and Weigel, D. (2011). MicroRNA networks and developmental plasticity in plants. Trends Plant Sci. 16: 258–264. Sage, R.F., Li, M.R., and Monson, R.K. (1999). The taxonomic distribution of C4 photosynthesis. In: C4 Plant Biology (ed. R.F. Sage and R.K. Monson), 554–582. San Diego: Academic Press. Sage, R.F., Christin, P.A., and Edwards, E.J. (2011). The C4 plant lineages of planet Earth. J. Exp. Bot. 62: 3155–3169. Sage, R.F., Sage, T.L., and Kocacinar, F. (2012). Photorespiration and the evolution of C4 photosynthesis. Annu. Rev. Plant Biol. 63: 19–47. Schommer, C., Palatnik, J.F., Aggarwal, P. et al. (2008). Control of jasmonate biosynthesis and senescence by miR319 targets. PLoS Biol. 6: e230. Schreiber, A.W., Shi, B.J., Huang, C.Y. et al. (2011). Discovery of barley miRNAs through deep sequencing of short reads. BMC Genomics 12: 129. Schwab, R., Palatnik, J.F., Riester, M. et al. (2005). Specific effects of microRNAs on the plant transcriptome. Dev. Cell 8: 517–527. Schwab, R., Ossowski, S., Riester, M. et al. (2006). Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18: 1121–1133.

­  References

Sewelam, N., Oshima, Y., Mitsuda, N., and Ohmetakagi, M. (2014). A step towards understanding plant responses to multiple environmental stresses: a genome‐wide study. Plant Cell Environ. 37: 2024–2035. Sharma, P., Sharma, N., and Deswal, R. (2005). The molecular biology of the low temperature response in plants. Bioessays 27: 1048–1059. Shi, B.J. and Hussain, S.S. (2016). MiRNA/siRNA‐based approaches to enhance drought tolerance of barley and wheat under drought stress. In: Water Stress and Crop Plants: A Sustainable Approach (ed. P. Ahmad and S.P. Rasool), 248–260. USA: Elsevier. Shinozaki, K. and Yamaguchi‐Shinozaki, K. (2007). Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 58: 221–227. Shriram, V., Kumar, V., Devarumath, R.M. et al. (2016). MicroRNAs as potential targets for abiotic stress tolerance in plants. Front. Plant Sci. 7: 817. Siddique, Z., Jan, S., Imadi, S.R. et al. (2016). Drought stress and photosynthesis in plants. In: Water Stress and Crop Plants: A Sustainable Approach (ed. P. Ahmad), 1–11. Wiley. Simon, A.S., Meyers, B.C., and Sherrier, D.J. (2009). MicroRNAs in the rhizobia legume symbiosis. Plant Physiol. 151: 1002–1008. Slama, I., Abdelly, C., Bouchereau, A. et al. (2015). Diversity, distribution and roles of osmoprotective compounds accumulated in halophytes under abiotic stress. Ann. Bot. 1153: 433–447. Sobhanian, H., Razavizadeh, R., Nanjo, Y. et al. (2010). Proteome analysis of soybean leaves, hypocotyls and roots under salt stress. Proteome Sci. 8: 19. Song, L., Axtell, M.J., and Fedoroff, N.V. (2010). RNA secondary structural determinants of miRNA precursor processing in Arabidopsis. Curr. Biol. 20: 34–41. Song, Z., Zhang, L., Wang, Y. et al. (2018). Constitutive expression of miR408 improves biomass and seed yield in Arabidopsis. Front. Plant Sci. 8: 2114. Sorin, C., Bussell, J.D., Camus, I. et al. (2005). Auxin and light control of adventitious rooting in Arabidopsis require ARGONAUTE1. Plant Cell 17: 1376–1386. Srivastava, R., Pisareva, T., and Norling, B. (2005). Proteomic studies of the thylakoid membrane of Synechocystis sp. PCC 6803. Proteomics 5: 49054916. Stacey, G., Libault, M., Brechenmacher, L. et al. (2006). Genetics and functional genomics of legume nodulation. Curr. Opin. Plant Biol. 9: 110–121. Steglich, C., Futschik, M.E., Lindell, D. et al. (2008). The challenge of regulation in a minimal photoautotroph: non‐coding RNAs in Prochlorococcus. PLoS Genet. 4: e1000173. Subramanian, S., Fu, Y., Sunkar, R. et al. (2008). Novel and nodulation‐regulated microRNAs in soybean roots. BMC Genomics 9: 160. Sun, G. (2012). MicroRNAs and their diverse functions in plants. Plant Mol. Biol. 80: 17–36. Sunkar, R. and Zhu, J.K. (2004). Novel and stress‐regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 16: 2001–2019. Sunkar, R., Kapoor, A., and Zhu, J.K. (2006). Posttranscriptional induction of Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell 18: 2051–2065. Sunkar, R., Chinnusamy, V., Zhu, J., and Zhu, J.K. (2007). Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci. 12: 301–309. Sunkar, R., Zhou, X., Zheng, Y. et al. (2008). Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biol. 8: 25.

191

192

9  Regulatory Roles of miRNAs

Sunkar, S., Li, Y.F., and Jagadeeswaran, G. (2012). Functions of microRNAs in plant stress responses. Trends Plant Sci. 17: 196–203. Szittya, G., Moxon, S., Santos, D.M. et al. (2008). High‐throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families. BMC Genomics 9: 593. Taiz, L. and Zeiger, E. (2010). Plant Physiology, 5e. Sunderland, MA, USA: Sinauer Associates. Tang, J. and Chu, C. (2017). MicroRNAs in crop improvement: finetuners for complex traits. Nat. Plants 3: 17077. Tester, M. and Langridge, P. (2010). Breeding technologies to increase crop production in a changing world. Science 327: 818–822. Thompson, A.W., Huang, K., Saito, M.A., and Chisholm, S.W. (2011). Transcriptome response of high‐ and low‐light‐adapted Prochlorococcus strains to changing iron availability. ISME J. 5: 1580–1594. Todesco, M., Rubio‐somoza, I., Paz‐ares, J., and Weigel, D. (2010). A collection of target mimics for comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet. 6: 7. Trindale, I., Capitao, C., Dalmay, T. et al. (2010). miR398 and miR408 are up‐regulated in response to water deficit in Medicago truncatula. Planta 231: 705–716. Turner, M., Nizampatnam, N.R., Baron, M. et al. (2013). Ectopic expression of miR160 results in auxin hypersensitivity, cytokinin hyposensitivity, and inhibition of symbiotic nodule development in soybean. Plant Physiol. 162: 2042–2055. Uemura, M., Warren, G., and Steponkus, P.L. (2003). Freezing sensitivity in the sfr4 mutant of Arabidopsis is due to low sugar content and is manifested by loss of osmotic responsiveness. Plant Physiol. 131: 1800–1807. Vazquez, F., Vaucheret, H., Rajagopalan, R. et al. (2004). Endogenous trans‐acting siRNAs regulate the accumulation of Arabidopsis mRNAs. Mol. Cell 16: 69–79. Vieten, A., Sauer, M., Brewer, P.B., and Friml, J. (2007). Molecular and cellular aspects of auxin‐transport‐mediated development. Trends Plant Sci. 12: 160–168. Vijayan, V., Jain, I.H., and O’Shea, E.K. (2011). A high resolution map of a cyanobacterial transcriptome. Genome Biol. 12: R47. Voigt, K., Sharma, C.M., Mitschke, J. et al. (2014). Comparative transcriptomics of two environmentally relevant cyanobacteria reveals unexpected transcriptome diversity. ISME J. 8: 2056–2068. Voinnet, O. (2009). Origin, biogenesis and activity of plant microRNAs. Cell 136: 669–687. Voss, B., Georg, J., Schön, V. et al. (2009). Biocomputational prediction of non‐coding RNAs in model cyanobacteria. BMC Genomics 10: 123. Voss, B., Bolhuis, H., Fewer, D.P. et al. (2013). Insights into the physiology and ecology of the brackish‐water‐adapted Cyanobacterium Nodularia spumigena CCY9414 based on a genometranscriptome analysis. PLoS One 8: e60224. Waldbauer, J.R., Rodrigue, S., Coleman, M.L., and Chisholm, S.W. (2012). Transcriptome and proteome dynamics of a light‐dark synchronized bacterial cell cycle. PLoS One 7: e43432. Wang, C. and Li, Q.Z. (2007). Identification of differentially expressed miRNAs during the development of Chinese murine mammary gland. J. Genet. Genomics 34: 966–973. Wang, J.W., Wang, L.J., Mao, Y.B. et al. (2005). Control of root cap formation by microRNA‐targeted auxin response factors in Arabidopsis. Plant Cell 17: 2204–2216.

­  References

Wang, Y., Hindemitt, T., and Mayer, K.F. (2006). Significant sequence similarities in promoters and precursors of Arabidopsis thaliana non‐conserved microRNAs. Bioinformatics 22: 2585–2589. Wang, H., Zhang, H., and Li, Z. (2007a). Analysis of gene expression profile induced by water stress in upland rice (Oryza sativa L. var. IRAT109) seedlings using subtractive expressed sequence tags library. J. Integr. Plant Biol. 49: 1455–1463. Wang, Y., Chen, X., and Xiang, C.B. (2007b). Stomatal density and bio‐water saving. J. Integr. Plant Biol. 57: 477–496. Wang, J.W., Czech, B., and Weigel, D. (2009). miR156‐regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 138: 738–749. Wang, L., Mai, Y.X., Zhang, Y.C. et al. (2010). MicroRNA171c‐targeted SCL6‐II, SCL6‐III, and SCL6‐IV genes regulate shoot branching in Arabidopsis. Mol. Plant 5: 794–806. Wang, D., Pan, Y., Zhao, X. et al. (2011a). Genome‐wide temporal‐spatial gene expression profiling of drought responsiveness in rice. BMC Genomics 12: 149. Wang, L., Gu, X., Xu, D. et al. (2011b). miR396‐targeted AtGRF transcription factors are required for coordination of cell division and differentiation during leaf development in Arabidopsis. J. Exp. Bot. 62: 761–773. Wang, T., Chen, L., Ahao, M. et al. (2011c). Identification of drought responsive microRNAs in Medicago truncatula by genome‐wide high throughput sequencing. BMC Genomics 12: 367. Wang, J., Yang, X., Xu, H. et al. (2012). Identification and characterization of microRNAs and their target genes in Brassica oleracea. Gene 505: 300–308. Wang, B., Sun, Y.F., Song, N. et al. (2013). Identification of UV‐B induced microRNAs in wheat. Genet. Mol. Res. 12: 4213–4221. Wang, C.Y., Zhang, S., Yu, Y. et al. (2014). MiR397b regulates both lignin content and seed number in Arabidopsis via modulating a laccase involved in lignin biosynthesis. Plant Biotechnol. J. 12: 1132–1142. Wang, L., Sun, S., Jin, J. et al. (2015). Coordinated regulation of vegetative and reproductive branching in rice. Proc. Natl. Acad. Sci. U.S.A. 112: 15504–15509. Williams, L., Grigg, S.P., Xie, M. et al. (2005). Regulation of Arabidopsis shoots apical meristem and lateral organ formation by microRNA miR166g and its AtHDZIP target genes. Development 132: 3657–3668. Willmann, M.R. and Poethig, R.S. (2005). Time to grow up: the temporal role of small RNAs in plants. Curr. Opin. Plant Biol. 8: 548–552. Willmann, M.R. and Poethig, R.S. (2007). Conservation and evolution of miRNA regulatory programs in plant development. Curr. Opin. Plant Biol. 10: 503–511. Wright, P.R., Richter, A.S., Papenfort, K. et al. (2013). Comparative genomics boosts target prediction for bacterial small RNAs. Proc. Natl. Acad. Sci. U.S.A. 110: E3487–E3496. Wright, P.R., Georg, J., Mann, M. et al. (2014). CopraRNA and IntaRNA: predicting small RNA targets, networks and interaction domains. Nucleic Acids Res. 42: W119–W123. Wu, M.F., Tian, Q., and Reed, J.W. (2006). Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development 133: 4211–4218. Wu, Z., Stone, J.D., Storchova, H., and Sloan, D.B. (2015). High transcript abundance, RNA editing and small RNAs in intergenic regions within the massive mitochondrial genome of the angiosperm, Silene noctiflora. BMC Genomics 16: 938.

193

194

9  Regulatory Roles of miRNAs

Wu, C.Y., Li, Q.Z., and Feng, Z.X. (2016). Non‐coding RNA identification based on topology secondary structure and reading frame in organelle genome level. Genomics 107: 9–15. Wu, J., Yang, R., Yang, Z. et al. (2017). ROS accumulation and antiviral defence control by microRNA528 in rice. Nat. Plants 3: 16203. Xie, F.L., Huang, S.Q., Guo, K. et al. (2007). Computational identification of novel microRNA and targets in Brassica napus. FEBS Lett. 58: 1464–1474. Xu, Z., Zhou, G., and Shimizu, H. (2010). Plant responses to drought and rewatering. Plant Signaling Behav. 5: 649–654. Yadav, S.K. (2010). Cold stress tolerance mechanisms in plants. A review. Agron. Sustainable Dev. 30: 515–527. Yamasaki, Y., Abdel‐Ghany, S.E., Cohu, C.M. et al. (2007). Regulation of copper homeostasis by microRNA in Arabidopsis. J. Biol. Chem. 282: 16369–16378. Yamasaki, H., Hayashi, M., Fukazawa, M. et al. (2009). SQUAMOSA promoter binding protein‐ like7 is a central regulator for copper homeostasis in Arabidopsis. Plant Cell 21: 347–361. Yamori, W. (2016). Photosynthetic response to fluctuating environments and photoprotective strategies under abioticstress. J. Plant Res. 129: 379–395. Yang, L., Zheng, B., Mao, C. et al. (2004). Analysis of transcripts that are differentially expressed in three sectors of the rice root system under water deficit. Mol. Genet. Genomics 272: 433–442. Yang, J.H., Han, S.J., Yoon, E.K., and Lee, W.S. (2006). Evidence of an auxin signal pathway, microRNA167‐ARF8‐GH3, and its response to exogenous auxin in cultured rice cells. Nucleic Acids Res. 34: 1892–1899. Yang, C., Li, D., Mao, D. et al. (2013). Overexpression of microRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerance in rice (Oryza sativa L.). Plant Cell Environ. 36: 2207–2218. Yao, Y., Guo, G., Ni, Z. et al. (2007). Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 8: R96. Yeo, A.R., Lee, S., Izard, P. et al. (1991). Short and long‐term effects of salinity on leaf growth in rice (Oryza sativa L.). J. Exp. Bot. 42: 881–889. Yoon, E.K., Yang, J.H., and Lee, W.S. (2010a). Auxin and abscisic acid response of AUXIN RESPONSE FACTOR 3 in Arabidopsis lateral root development. J. Plant Biol. 53: 150–154. Yoon, E.K., Yang, J.H., Lim, J. et al. (2010b). Auxin regulation of the miR390‐dependent transacting small interfering RNA pathways in Arabidopsis lateral root development. Nucleic Acids Res. 38: 1382–1391. Yuan, S., Li, Z., Li, D. et al. (2015). Constitutive expression of rice MicroRNA528 alters plant development and enhances tolerance to salinity stress and nitrogen starvation in creeping bentgrass. Plant Physiol. 169: 576–593. Zandalinas, S.I., Mittler, R., Balfagón, D. et al. (2018). Plant adaptations to the combination of drought and high temperatures. Physiol. Plant. 162: 2–12. Zhang, H. and Li, L. (2013). SQUAMOSA promoter binding protein‐like7 regulated microRNA408 is required for vegetative development in Arabidopsis. Plant J. 74: 98–109. Zhang, B.H., Pan, X.P., Wang, Q.L. et al. (2005). Identification and characterization of new plant microRNAs using EST analysis. Cell Res. 15: 336–360. Zhang, B.H., Pan, X.P., Cobb, G.P., and Anderson, T.A. (2006). Plant microRNA: a small regulatory molecule with big impact. Dev. Biol. 289: 3–16.

­  References

Zhang, B.H., Wang, Q.L., and Pan, X.P. (2007). MicroRNAS and their regulatory roles in animals and plants. J. Cell. Physiol. 210: 279–289. Zhang, X., Zou, Z., Gong, P. et al. (2011). Over‐expression of microRNA169 confers enhanced drought tolerance to tomato. Biotechnol. Lett. 33: 403–409. Zhang, J., Zhang, S., Han, S. et al. (2012). Genome‐wide identification of microRNAs in larch and stage‐specific modulation of 11 conserved microRNAs and their targets during somatic embryogenesis. Planta 236: 647–657. Zhang, Y.C., Yu, Y., Wang, C.Y. et al. (2013). Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching. Nat. Biotechnol. 31: 848–852. Zhang, H., Zhao, X., Li, J. et al. (2014). MicroRNA408 is critical for the HY5‐SPL7 gene network that mediates the coordinated response to light and copper. Plant Cell 26: 4933–4953. Zhang, J.P., Yu, Y., Feng, Y.Z. et al. (2017). MiR408 regulates grain yield and photosynthesis via a phytocyanin protein. Plant Physiol. 175: 1175–1185. Zhao, B., Liang, R., Ge, L. et al. (2007). Identification of drought‐induced microRNAs in rice. Biochem. Biophys. Res. Commun. 354: 585–590. Zhao, C.Z., Xia, H., Frazier, T.P. et al. (2010). Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.). BMC Plant Biol. 10: 3. Zhao, Y., Lin, S., Qiu, Z. et al. (2015). MicroRNA857 is involved in the regulation of secondary growth of vascular tissues in Arabidopsis. Plant Physiol. 169: 2539–2552. Zhao, X.Y., Hong, P., Wu, J.Y. et al. (2016). The tae‐miR408‐mediated control of TaTOC1 genes transcription is required for the regulation of heading time in wheat. Plant Physiol. 170: 1578–1594. Zhou, Y., Lam, H.M., and Zhang, J. (2007). Inhibition of photosynthesis and energy dissipation induced by water and high light stresses in rice. J. Exp. Bot. 58: 1207–1217. Zhou, Z.S., Huang, S.Q., and Yang, Z.M. (2008). Bioinformatic identification and expression analysis of new microRNAs from Mecicago truncatula. Biochem. Biophys. Res. Commun. 374: 538–542. Zhou, X., Sunkar, R., Jin, H. et al. (2009). Genome‐wide identification and analysis of small RNAs originated from natural antisense transcripts in Oryza sativa. Genomic Res. 19: 70–78. Zhou, L., Liu, Y., Liu, Z. et al. (2010). Genome‐wide identification and analysis of drought‐ responsive microRNAs in Oryza sativa. J. Exp. Bot. 61: 4157–4168. Zhou, M., Li, D., Li, Z. et al. (2013). Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. Plant Physiol. 161: 1375–1391. Zhou, H., Hussain, S.S., Hackenberg, M. et al. (2018). Identification and characterization of a previously unknown drought tolerance‐associated miRNA in barley. Plant J. 95: 138–149. Zhu, J.K. (2002). Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53: 247–273. Zhu, X.G., Long, S.P., and Ort, D.R. (2008). What is the maximum efficiency with which photosynthesis can convert solar energy into biomass? Curr. Opin. Biotechnol. 19: 153–159. Zhu, X.G., Long, S.P., and Ort, D.R. (2010). Improving photosynthetic efficiency for greater yield. Annu. Rev. Plant Biol. 61: 235–261.

195

197

10 Mineral Mobilizing Bacteria Mediated Regulation of Secondary Metabolites for Proper Photosynthesis in Maize Under Stress Yachana Jha Department of Biotechnology, Genetics and Bioinformatics, N. V. Patel College of Pure and Applied Sciences, S. P. University, V V Nagar, Anand, Gujarat, India

10.1 ­Introduction In plants, the levels and composition of secondary metabolites differ as per their genotype; environmental factors like relative humidity, temperature, light intensity, environmental variation, seasonal changes; and other agronomical conditions (Reyes‐Carmona et al. 2005). Agronomical conditions like soil type, its nutrients, salt, and water status can also change the composition of secondary metabolites of the plant under stress. Secondary metabolites are complex chemical compounds, which do not have any direct effect on the plant’s normal growth, progression, or reproduction. The main function of such chemical compounds is as a natural defense mechanism against pathogens, parasites, predators, and diseases as well as to overcome interspecies competition to ensure better survival (coloring agents, attractive smells, etc.). Plants are continuously affected by a variety of environmental factors, as biotic factors include other organisms such as symbionts, parasites, pathogens, herbivores, and abiotic factors include parameters and resources that determine plant growth, like temperature, relative humidity, light, availability of water, mineral nutrients, and CO2, as well as wind, ionizing radiation, or pollutants (Schulze et al. 2005). In plants, one of the most important physiological processes is photosynthesis, which is affected by various environmental factors in all its phases. In photosynthesis various plant cell components like the photosystems, photosynthetic pigments, and the electron transport system are involved as stated by Ashraf and Harris (2013), and any alteration at any phase of photosynthesis, affects the overall process. Photosynthesis is one of the most important physiological processes involved in the synthesis of photoassimilates, that act as a substrate/intermediate for all other metabolic pathways. The photo‐assimilate are used during respiration to produce carbon precursors/intermediates, nicotinamide adenine dinucleotide phosphate (NADPH) and nicotinamide adenine dinucleotide (NADH) and chemical energy, adenosine triphosphate (ATP), for plants. The photoassimilate and ATP produced by respiration act as precursors and are the main source of secondary metabolites (Li et al. 2017). The main metabolic processes like generation of ribulose 1,5‐bisphosphate (RuBP) and ribulose Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

198

10  Mineral Mobilizing Bacteria Regulation

1,5‐bisphosphate carboxylase/oxygenase (Rubisco) carboxylation has a regulatory effect on photosynthesis. The activity of Rubisco increases to increase the rate of photosynthesis in plants, but also to modify the segregation of photoassimilates for the biosynthesis of secondary metabolites under abiotic stress. On one hand, abiotic stress increases photosynthesis and respiration for higher accumulation of biomass, but on the other hand, increased photosynthesis and respiration results in altered allocation of resources for the production of secondary metabolites, causing higher biosynthesis of secondary metabolites. The production of secondary metabolites completely depends on the type and concentration of plant nutrients (Strik 2008). The types and amount of nutrients in the soil are major factors in determining the yield as well as the quality of a plant’s secondary metabolites (Cakmak 2010). Mineral mobilizing microorganisms are an essential part of the soil, and also have a significant role in mineral mobilization in soil to provide important minerals like K, P, Zn, and Fe to the plants after its solubilization. Such mineral mobilizing bacteria (MMB) have immense potential for steady solubilization of the fixed minerals in soil for its continuous supply for plants. Moreover, the stability of the MMB in the soil is necessary for a constant supply of minerals for growth and development. So plants inoculated with MMB can enhance photosynthesis under stress and it is correlated with changes in plant physiology. MMB regulate nutrient status, chlorophyll content, and carbohydrate/sugar concentration of the plant and modulate secondary metabolites under stress to help in the survival of plants. In this sense, MMB can be used to improve photosynthesis, plant health, and growth rate, not only by induction as well as modifying secondary metabolites for the better survival of the plant, without contaminating the environment under stress.

10.2 ­Isolation and Inoculation of Mineral Mobilizing Bacteria Minerals are required for growth and development of autotrophic plants, so a sufficient supply of mineral nutrients is essential for suitable plant growth. Even in the presence of a sufficient amount of such mineral nutrients in the soil, plants face a deficiency of them due to the unavailability of them. However, accessibility of mineral nutrients like P, Cu, K, Fe, and Zn are usually low in calcareous soils. The soil bacteria have a critical role in increasing the availability of such mineral nutrients to the plant. MMB are a group of soil bacteria, which reside in the plant rhizosphere and activate plant growth and development in their hosts. MMB are free living bacteria belong to the most imperative and agronomically important soil microbes (Bhattacharyya and Jha 2012). MMB have the potential to solubilize the mineral nutrients by acidification/mobilization to convert them into an available form to facilitate the growth and development of plants. MMB can be a suitable option as a biofertilizer to enhance the nutrient status of plants by mineral solubilization, associative nitrogen fixation, siderophores production, and increasing the absorptivity and bio‐availability of nutrients in the rhizosphere. Bacterial genera such as Pseudomonas, Bacillus, and Brevibacillus are potential genera for non‐ leguminous plant growth promotion. The rhizosphere soil and Suaeda nudiflora wild mosque plant root from Khambhat near the seashore of Gujarat were used for the isolation of two bacterial isolates as our previously published method (Jha et al. 2011a). The soil sample was tested by water extraction method in the SICART (Sophisticated

10.2  Isolation and Inoculation of Mineral Mobilizing Bacteria

Figure 10.1  Agarose gel showing the amplified 16S rDNA of isolates, where M = 100 bp marker, L1 = Pseudomonas aeruginosa, and L2 = Bacillus megaterium.

Instrumentation Centre for Applied Research and Testing) laboratory. The bacterial isolates are identified by molecular analysis by sequencing of 16S rDNA sequence by using total genomic DNA of the isolates and 16S rDNA specific primers 16S F: 5′AGAGTTTGATCCTGGCTCAG3′ and 16S R: 5′AGGTTACCTTGTTACGACTT3′ for amplification of the DNA. A distinct band of about 1500 bp are obtained for both the isolates in agarose gel (Figure 10.1). The comparison of the 16S rDNA sequence of isolates has been done using BLAST software for the construction of phylogenetic trees. The root isolate has been identified by nucleotides homology and phylogenetic analysis as Pseudomonas aeruginosa (GenBank Accession Number: JQ790515) and Bacillus megaterium (GeneBank Accession Number: JQ790514). Both isolates are non‐symbiotic having the ability to fix atmospheric nitrogen as well as solubilization of mineral nutrients. Pioneer 30 V92 seeds have been used for inoculation with isolates as per our previously published method and surface sterilized by frequent washing with sterile distilled water. The fully washed seeds are kept on tryptone glucose yeast extract agar medium under sterile conditions and incubated in the dark at 30 °C to check for possible contamination. The sprouted seed, devoid of any contamination, was utilized for bacterial inoculation, to study its effect on various biochemical parameters. The seedlings were transferred to culture tubes in the presence of bacteria at a concentration of 6 × 108 cfu ml−1, containing 400  ml Hoagland’s nutrient medium. The co‐inoculated tubes are incubated in a growth chamber at 27 °C in a 12 hour light–dark cycle and the  presence of MMB in the root was confirmed using TTC (triphenyl tetrazolium ­chloride) staining.

199

200

10  Mineral Mobilizing Bacteria Regulation

10.2.1  Mineral Mobilizing Bacteria Mediated Regulation of Nutrients for Secondary Metabolites Production and Photosynthesis Enhanced production of secondary metabolites and reduced plant growth in comparison to photosynthesis is a common effect of stress, as carbon fixed is mainly assigned for secondary metabolites production. As per the theory of functional balance (Hendrik et al. 2012), when there are limited aboveground resources, such as CO2 and sunlight, carbon assimilation is affected, and the plant relocates biomass to shoots. Similarly, when below ground resources such as nutrients and water are limited, the plant relocates biomass to roots. But under prolonged stress, the nutrients allocated to secondary metabolites are predominantly reverted back to maintain cell osmotic balance to continue photosynthesis in the plant. The plant’s nutrient acquisition is adversely affected by stress, particularly in the root, causing a substantial decrease in the dry biomass of shoots. The photosynthetic photon flux density is also affected by the nutrient uptake in the plant; the nutrient concentration of the plant directly depends on photosynthesis. The collaboration of MMB and their consequence on the natural growth response of plants under stress is complex. In our study, the foliar contents of N, P, K, Na, and Ca in MMB inoculated plant were assessed using 1 g of plant material digested in a tri‐acid mixture in a ratio of 9 : 3 : 1 using digital flame photometry with a specific filter. The non‐inoculated control plants show a higher foliar Na concentration, while the plants inoculated with the MMB show a higher P concentration under stress. The plants inoculated with MMB alone and in combination show higher levels of K. As K is an osmotically active solute, it contributes to water absorption in the cell and whole plant (Table 10.1) and helps stressed plants to maintain central metabolic activities like photosynthesis for their survival. The most interesting finding is that MMB inoculated plants show reduced cation uptake, helping in alleviating stress in the plants, which is supported by Ashraf (2004). The plant membrane properties and ion transport were affected by the interactions of cations like Na+ and Ca2+, which led to a change in the Table 10.1  Effect of MMB on minerals concentration in maize under stress (n = 5). Treatment

N (mg kg−1)

P (mg kg−1)

K (mg kg−1)

Na (mg kg−1) Ca (mg kg−1)

Normal Control

19.1

1885.1

58 710

720.2

12 674

Control + B. megaterium

20.4

1939.1

60 131

714.3

10 541

Control + P. aeruginosa

23.8

2091.3

64 223

704.7

11 787

Control + B. megaterium + P. aeruginosa

24.2

2193.2

71 142

691.3

13 263

Stressed Control

10.2

2458.1

32 174

972.1

19 221

Control + B. megaterium

11.3

2547.4

33 232

682.2

14 728

Control + P. aeruginosa

13.6

2638.1

34 241

632.3

16 234

Control + B. megaterium + P. aeruginosa

14.5

2698.7

35 716

562.4

17 245

10.2  Isolation and Inoculation of Mineral Mobilizing Bacteria

cytoplasmic Ca2+ activity and are responsible for the change in many physiological activities such as ion transport, nutrient uptake, and water holding, as well as photosynthesis under stress. In our study, inoculations of plants with MMB always have higher N2 and carbon concentrations under normal and stress conditions. The levels of some compounds such as phenolic compounds, are directly connected to secondary metabolism and have a complex response to nutrient deficiency. Deficiencies of important nutrients like potassium, nitrogen, phosphorus, sulfur, and zinc are frequently responsible for production of higher concentration of secondary metabolites, while high nitrogen concentration usually reduces phenolic accumulation in plants (Gershenzon 1983), which is easily regulated and maintained by MMB. The plants inoculated with MMB, can converse forbearance to the plant against antagonistic environmental conditions and increase the availability of nutrients, this helps the  plant to overcome stress by regulating secondary metabolite production and the accumulation of soluble sugar to provide protection against osmotic stress. Photosynthesis is a significant source of precursors for the synthesis of secondary metabolites, having a wide range of metabolic activities as protection, signaling, and defense against abiotic and biotic stress. The nitrogen‐rich amino acids are precursors for the synthesis of alkaloids, acetyl CoA for terpenoids, and phenylpropanoids from phenylalanine or other glycolytic intermediates. While some secondary metabolites including phenylpropanoids are carbon‐rich, others including alkaloids contain ­nitrogen as shown in Figure 10.2. The carbon–nutrient balance hypothesis given by van Dam et al. (1996) and states that in nitrogen‐limited plants, secondary metabolism is directed toward carbon‐rich metabolites, and nitrogen‐rich metabolites in carbon‐limited plants. MMB having the ability for N2 fixation are better able to regulate the two for the survival of plants under stress. The impact of a decreased carbon supply on the types and levels of different secondary metabolites in response to the changes in the endogenous pools of primary metabolites under inhibited photosynthesis, show a steady modification from carbon‐ to nitrogen‐containing secondary metabolites. While an upsurge in the sugar : amino acid ratio is associated with an increase in the comparative levels of carbon‐rich metabolites. However, an equivalent change in amino acid and sugar levels is correlated with an overall increase in the levels of secondary metabolites, irrespective of whether they are nitrogen‐rich or carbon‐rich. Lattanzio et al. (2009) reported that, the secondary metabolite content, like phenolic and rosmarinic acid, in plants (Origanum vulgare L.) increased under nutrient deficiency. So nutrient deficiency has a noticeable consequence on secondary metabolites in plant cells. 10.2.2  Mineral Mobilizing Bacteria Mediated Regulation of Chlorophyll Content for Secondary Metabolites Production and Photosynthesis The growth of plants has been regulated by a multitude of molecular, biochemical, and physiological processes and photosynthesis is one of most important metabolic processes necessary for plant growth and development. The chemical energy required for all metabolic processes is derived from the process of photosynthesis, where light energy is converted into a usable form of chemical energy. The process of photosynthesis is considerably hampered under stressful environments, which alter the concentration of photosynthetic pigments as well as the ultrastructure of the organelles and

201

202

10  Mineral Mobilizing Bacteria Regulation Primary metabolic pathway of carbon CO2

Primary metabolic products

Corresponding secondary metabolic products

O2

Aminoglycoside antibiotics

Photosynthesis

Complex polysaccharides Sugar

Carbohydrate Glycosides Erythrose 4-P

Glycolysis

Phosphoenol pyruvate

Shikimate

Proteins Phenylpropanoids

Pyruvate

Peptides

Aromatic and aliphatic amino acid

Penicillins Alkaloids

Acetyl CoA

Malonyl CoA

Fatty acids

Waxes and fats Tetracycline

TCA Cycle

Anthraquinon

Isoperene

Erythromycine CO2

Squalene

Terpenoids Steroids

Figure 10.2  Interrelationship of biosynthetic pathways leading to secondary metabolite production.

concentration of various pigments (Wu and Kubota 2008). Among the pigments, chlorophyll is the most important for photosynthesis and is responsible for the absorption of sunlight as a source of energy. It is present in and around the photosystems, which remain embedded in the thylakoid membranes of chloroplasts. Chlorophyll can be estimated in fresh leaves with 80% acetone. The extract is prepared by placing fresh leaves in the acetone until the leaves are completely bleached and is then centrifuged for 10 minutes at 13 000 rpm. The extract has been used for estimation of chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoid at 663, 645, and 470  nm, respectively, using a spectrophotometer. The results showed increased photosynthetic pigments in MMB inoculated plants compared to the control plants (Table 10.2). As the levels of N2 increased, chlorophyll a, b and total chlorophyll increased, indicating that chlorophyll content is influenced by nitrogen concentration. MMB having nitrogen fixing ability must enhance the concentration of N2 in plants, which results in high levels of

10.2  Isolation and Inoculation of Mineral Mobilizing Bacteria

Table 10.2  Effect of MMB on the total chlorophyll content, chlorophyll a, chlorophyll b, and carotenoid content of maize under stress (n = 5).

Treatment

Total chlorophyll content (g kg−1)

Chl a (g kg−1)

Chl b (g kg−1)

Carotenoid (mg kg−1)

Control

1.92

0.63

0.71

1.91

Control + B. megaterium

2.11

0.94

0.84

2.04

Control + P. aeruginosa

2.54

0.79

0.92

2.38

Control + B. megaterium + P. aeruginosa

2.63

0.82

1.12

2.42

Control

1.03

0.24

0.47

1.02

Control + B. megaterium

1.27

0.26

0.63

1.13

Control + P. aeruginosa

1.49

0.22

0.78

1.36

Control + B. megaterium + P. aeruginosa

1.57

0.27

0.83

1.45

Normal

Stressed

chlorophylls and carotenoids. Enhanced nitrogen directly increasing chlorophyll ­content has been reported by Suza and Valio (2003). Carotenoids play an important role as a precursor in signaling during the plant’s development and are necessary for photoprotection of photosynthesis under stress. MMB have the potential to improve nutritional quality and plant yield by regulating photosynthesis (Jha and Subramanian 2013a). Chlorophyll and related pigments are adversely related with secondary metabolites. Competition between secondary metabolites and chlorophyll contents fits well with the prediction of protein competition model, where secondary metabolites content is controlled by the competition between protein and secondary metabolites biosynthesis pathway and its metabolites regulation. So competition has been established between chlorophyll content and secondary metabolites. The chlorophyll content and secondary metabolites are inversely proportional to each other, indicating a steady shift of investment from protein to polyphenolics production (Meyer et al. 2006). The MMB inoculated plants competed for the production of chlorophyll content against the production of secondary metabolites under stress in the present study. Similarly, under low irradiance, the production of secondary metabolites of Orthosiphon stimaneus increased due to higher availability of phenylalanine, which is a precursor for protein and secondary metabolites production. Whereas under low nitrogen levels, the production of secondary metabolites is more prioritized, due to the limited production of protein as shown by limited chlorophyll production (Affendy et al. 2010). 10.2.3  Mineral Mobilizing Bacteria Mediated Regulation of Carbon/Sugar Metabolites for Secondary Metabolites Production and Photosynthesis Plant growth is affected by numerous environmental factors and has a direct effect on several metabolic pathways, and therefore also alters the bioactive compounds for

203

204

10  Mineral Mobilizing Bacteria Regulation

secondary metabolite production. The process of photosynthesis of the entire plant is regulated by carbon metabolites i.e. by influencing leaf development and senescence. An increasing carbon level can be sensed by sugar‐sensing mechanisms that may affect plant growth. The expression of the cyclin genes is induced by glucose and sucrose like sugars to control the cell cycle. Riou‐Khamlichi et al. (2002) reported that enhanced carbon/ sugar content stimulates meristematic cell division, but regulation of sugar metabolism is complex, collaborative, and reliant on various other factors. The expression of genes encoding for photosynthetic components may be affected by concentrations of carbon/ sugar metabolites in two different ways. Any decrease in sugar concentration leads to the activation of gene expression to enhance photosynthetic capacity. But the succeeding increase in sugar concentration in plants causes the suppression of photosynthetic component genes and finally photosynthesis itself under excess production of sugar, which exceeds the plant’s capacity to utilize it. The main benefit of sugar‐mediated regulation of gene expression for photosynthetic components is that under sugar deficient conditions it will revert back to enhance the sugar output as well as photosynthesis. In the present study, the total sugar was estimated using the method of Ibrahim and Jaafar (2012) using a spectrophotometer. Enhanced concentration of sugar was shown in MMB inoculated plants compared to control plants (Table  10.3). The extra carbohydrates accumulated may be directed for secondary metabolite production like flavonoids and phenolics as per our previous report (Jha and Subramanian 2018a). The phenolic compounds are produced through the shikimic acid pathway, which requires carbohydrates as the basic component. In plants, the extra carbohydrates derived from the pentose phosphate pathway and glycolysis are utilized for the production of aromatic amino acids. Ghasemzadeh et al. (2010) also reported that the accumulation of carbohydrates acts as a precursor for secondary metabolite production. The plants inoculated with MMB have an enhanced production of carbon‐based secondary metabolites in the present study, which is due to regulation of carbon between carbohydrate source and sink. The higher production of secondary metabolites takes place in MMB inoculated plants due to the higher source‐sink ratio. The production of secondary metabolites is a synchronized sequence of coupled enzymatic reactions that utilizes primary/central metabolites as precursor/intermediates. Secondary metabolism is a highly organized and integrated pathway, which affects morphological, biochemical, and developmental pathways of the plant by regulating the entire plant metabolic network. Carbon metabolites not only have a regulatory role in photosynthesis, but also have a critical role in gene expression related to diverse functions like adverse environmental conditions, infection with pathogens, accumulation of storage proteins, carbohydrates, and lipids as well as nitrogen metabolism. It has been well reported that an increase in the concentration of carbohydrates results in downward regulation of sugar mobilizing and photosynthesis genes in plants. Similarly, a decrease in the concentration of carbohydrates results in the up‐regulation/induction of sugar mobilizing and photosynthesis genes. So there is a coordinated mechanism for the regulation of gene expression by this machinery (Lee et al. 2009), and carbohydrate metabolite refereed regulation of gene expression is a basic and essential mechanism, perhaps mutual to all higher plants and is well regulated by MMB under stress for the survival of the plants. The regulatory mechanism of photosynthesis may serve to establish balance between the customized distribution of resources and the flow of sugar in plants to confirm survival, growth, and completion of the life cycle.

206

10  Mineral Mobilizing Bacteria Regulation

10.2.4  Mineral Mobilizing Bacteria Mediated Regulation of Nitrogen Metabolites for Secondary Metabolites Production and Photosynthesis Photosynthesis is affected by many environmental factors, such as atmospheric CO2 concentration, light incidence, temperature, and water availability. With any change in the supply of nitrogen and carbon, several main metabolites of nitrogen and carbon metabolism also equivalently change. Any stress which inhibits photosynthesis, will result in a decrease in carbohydrates, inhibit nitrate assimilation, and cause a fall in amino acid levels (Matt et al. 2002). In plants, the accumulation of carbohydrate takes place mostly in the form of soluble sugar, starch, and amino acids in nitrogen limited plants. Furthermore, the specific leaf nitrogen content positively affects photosynthesis, which is partly related to nitrogen partitioning in photosynthetic enzymes, pigment content, and the size, number and composition of chloroplasts. Leaf senescence is also influenced by N2 and is related to a decline in photosynthetic capacity. Plants will take nitrogen in the form of nitrate and ammonium by the roots and accumulate it in the shoots, while MMB are the only organisms having the ability to fix atmospheric nitrogen and when they are associated with plants, they will help in N2 assimilation (Jha and Subramanian 2013b). Otherwise, the accumulation of inorganic nitrogen is a costly mechanism, as it needs reducing equivalents, ATP and C skeletons. N2 concentration was determined by colorimetry after the Kjeldahl digestion and results showed that nitrogen concentration is higher in the plants inoculated with the MMB either alone or in a mixture, compared to the control under normal as well stress conditions (Table 10.1). The level of phenylpropanoid metabolites showed an intensive increase and lignification of control plants was also observed, which reduced in MMB inoculated plants (Figure 10.3). Deficiency of nitrogen causes a massive change in secondary metabolism in plants. Nitrogen deficiency resulted in a remarkable decrease in the levels of aromatic amino acids. Under enhanced concentration of phenylpropanoids in nitrogen‐ deficient plants resulting in a high concentration of carbohydrates, which stimulate the production of secondary metabolites, may be the possible mechanism. If carbohydrate concentrations fall due to reduced photosynthesis under stress, it causes a parallel reduction in amino acid pools, it may be either due to the breakdown of amino acids to regulate respiration or due to the restricted availability of carbon skeletons for amino acid synthesis (Usadel et al. 2008). Under a sufficient supply of nitrogen, there is a shift in the allocation of photosynthetic carbon toward amino acids and organic acid synthesis under stress. This indicates that, the carbon and nitrogen allocation pathway is

(a)

(b)

(c)

Figure 10.3  Effect of MMB on lignin in maize cell under stress (n = 5), where (a) = control, (b) = inoculated with Pseudomonas aeruginosa, and (c) = Bacillus megaterium.

10.2  Isolation and Inoculation of Mineral Mobilizing Bacteria

coordinated for the sufficient supply of carbon skeleton to facilitate biosynthesis of amino acids without hampering plant growth. 10.2.5  Mineral Mobilizing Bacteria Mediated Regulation of Secondary Metabolites Production and Photosynthesis Under Biotic Stress Plants are under constant pressures being sessile, and face challenges by the group of biological, chemical, and environmental challenges. Thus, plants have been forced to develop their own physical and biochemical metabolic protective methods for survival of multilevels and types of stresses. Such stresses activate a protective mechanism including the mechanism of hypersensitive response (Montillet et al. 2005) and the stimulation of pathogenesis related (PR) proteins. Plants rapidly induce PR proteins in response to infection or wounding and they abundantly accumulate at the site of infection. Protection against pathogen infection or herbivores are usually provided by secondary metabolites. The carbon/nitrogen balance theory states that, the biosynthesis of carbon‐based protective compounds and carbohydrates might be affected by the rate of photosynthesis under stress. Biocontrol using MMB can be a suitable alternative as a protective agent against plant diseases as well as to maintain photosynthesis. Systemic plant resistance induced by MMB as the elicitor, represents induced systemic resistance (ISR), and is able to provide protection to the plant against a variety of pathogens by induction of PR proteins like β‐1,3‐glucanases, phenyl ammonia lyase, and peroxidases (Jha et  al. 2011b). Plants also stimulate the formation of physical barriers such as callose and lignin as well as the production of phytoalexins. The results of the present study showed that, plants inoculated with MMB have better induction of PR proteins like phenylalanine ammonia lyase (PAL), β‐1,3‐glucanases, and phenolic compounds compared to non‐inoculated plants, which is due to its earlier elicitation effect in response to infection (Table 10.3). A small number of elicitors can stimulate the biosynthesis of defense metabolites to protect the plant against a wide variety of pathogens. From the study it is evident that reduced photosynthesis and poor carbon supply in plants reduces the production of phenolic compounds, resulting in enhanced susceptibility toward pathogens. The metabolic profiling of two rice cultivars inoculated with MMB under stress, showed an improved profile of secondary metabolites with various phenolic metabolites such as hydroxycinnamic derivatives and flavonoids, which were derived from the main metabolites (Chamam et al. 2013). The study showed that different types of MMB‐crop combinations cause varied changes in plant metabolite as a specific response. However, plant roots associated with MMB have altered the composition of secondary metabolites in shoots, showing its systemic effect in helping plant to survive under stress. Therefore, there is a coordinated relationship between photosynthesis, production of secondary metabolites, and growth of plants under different stress environments. MMB play a significant role in managing a plant’s growth to acquire the maximal yield of biomass and secondary metabolites such as phytomedicinal compounds. 10.2.6  Mineral Mobilizing Bacteria Mediated Regulation of Secondary Metabolites Production and Photosynthesis Under Abiotic Stress Stressful environments are responsible for the wide alteration of biochemical, physiological, and molecular activity of the plant. Photosynthesis is the most important and essential

207

208

10  Mineral Mobilizing Bacteria Regulation

physiological process in green plants and is badly affected by stress in all its phases. As there are different components involved in photosynthesis, damage to any component due to stress affects the overall photosynthetic ability of green plants. Biosynthesis of secondary metabolites and plant growth is significantly affected by environmental factors. Environmental stress has a negative effect on a plant’s growth and productivity. Plant secondary metabolites have a critical role during the interaction of plants with abiotic stresses. Environmental stress adversely affects photosynthesis with subsequent enhancement in the production of secondary metabolites and natural antioxidant phenolic compounds as a protective mechanism against the reactive oxygen species generated under stress (Arbona et al. 2013). Reduced photosynthesis results in reduced assimilation of photosynthetic carbon, consequently causing reduced plant cell lignification. The severe reduced cell wall lignification due to reduced photosynthesis can hamper the plant’s growth. As plant growth and development depend on their cell walls, cell water content to is needed to provide shape and strength to cells. Reduced cell wall lignification affects the cell connectivity and stomatal conductance, resulting in collapsed xylem phenotype and conceded vascular integrity, which finally decreases hydraulic conductivity and increases the chance of wall failure. Analysis of the levels of sugar and starch has revealed that photosynthesis is responsible for higher assimilation of carbon and considerably reduced cell wall lignification, which ascribes that lignification is not carbon limited, instead, limiting photosynthesis. In the present study the total lignin and lignin monomers were quantified using thioglycolic acid and alkaline nitrobenzene peroxidation respectively (Van Der Rest et al. 2006). In this study, both lignin and lignin monomers increased in inoculated plants both in the normal and stressed states (Table 10.3). Martinez et al. (2004) reported that the highest accumulation of lignin monomers has been observed in the plants treated with P. aeruginosa. Phenolics are the most common secondary metabolite and widely distributed in plants, having one or more aromatic rings with one or more hydroxyl groups. In the present study, the leaf extract is used for the determination of the total phenol content using gallic acid for the standard using a spectrophotometer (absorbance 735  nm). This study showed that inoculation of MMB alone is sufficient to increase the phenolic content in maize plants under normal condition, and no further increase in it has been recorded under stressed condition. The synthesis of phenolics in ginger can be increased and affected by abiotic stress, which has been reported by Ghasemzadeh et al. (2010). Different abiotic stresses produce different secondary plant products in plants to cope with environmental changes, but inoculation with MMB regulates and modulates both the primary as well as the secondary metabolites of the plant for the better survival of plant, especially under stress (Jha 2017). Worldwide variations in environmental conditions have impacted endogenous plant metabolites for the survival of plant. However, many secondary metabolites are produced by the plant and are stress dependent or species specific for its adaptation. Plant products like flavonoids, methyl‐jasmonate polyamines, jasmonic acid, glycine betaine, and so on to help plants to adapt in an adverse environment. Such phytochemical derivatives of secondary metabolism confer a multitude of adaptive and evolutionary advantages to the producing plants (Bilgin et al. 2010). 10.2.7  Mineral Mobilizing Bacteria Mediated Regulation of Gene Expression for Secondary Metabolites Production and Photosynthesis In plant leaves, light‐harvesting complexes absorb light energy and transfer it to ­photosystem centers with successive redox reactions; this is known as photosynthesis

10.2  Isolation and Inoculation of Mineral Mobilizing Bacteria

(Baker 2008). Environmental stress causes photooxidation due to remarkable reduction of electron transport chain (Nishiyama and Murata 2014). Stress signals recognized by plant cell receptors can stimulate a series of molecular events to transmit information to various regulatory molecules via secondary messengers, signaling proteins, or ion channels (Choudhary et al. 2012). Plants may apply mechanisms e.g. production of secondary metabolites, decreasing electron transport rate, or inducing defensive genes. The plant’s regulatory system consists of different components, including transcription factors (TFs), phytohormones, mitogen‐activated protein kinases or phosphatases or photosynthetic protein kinases, which regulate stress‐responsive gene expression (Osakabe et al. 2014). The up‐regulation of defense‐related pathways is remunerated by the down‐regulation of genes involved in other metabolic pathways to establish a favorable energy balance in plants. So under stress, genes for photosynthesis and chlorophyll biosynthesis have been down‐regulated (Bilgin et  al. 2010). Plant secondary metabolites have a significant role in developing adaptability and resistance for the survival of plants. A plant’s accumulation of such metabolites are often produced by primary metabolites such as amino acids, carbohydrates, and lipids. Adaptive responses of the plant are directly controlled by inherent and biological features. The physiological changes due to stress results in production of hormones, the synthesis of new proteins as signaling molecules having direct or indirect action against stress, is the possible resistance mechanism of the plant. Such proteins include β‐1,3‐glucanases and catalase involved in plant protection under biotic and abiotic stress respectively. The β‐1,3‐glucanases are more interesting enzymes as they directly act on the bonds of β‐1,3‐glucans, which are a structural component of fungal cell walls and are able to protect the plant from fungal infection. It is hormonally and developmentally regulated to protect plants from pathogen infection. β‐1,3‐glucanase with catalase has an efficient fungicidal activity and directly inhibits the growth of invading phytopathogens. Catalase has an important role in plant metabolism and defense, but also acts as a signal receptor and catalyzes the dismutation of H2O2 into H2O and O2. Catalase is meant to metabolize stress‐provoked H2O2 in order to maintain cellular concentrations of H2O2 for the growth and development of plants (Anjum et al. 2014). Catalase also has a significant role in modulating the release of photorespiratory CO2 relative to net photosynthesis, as photorespiration increases significantly compared to net photosynthesis under stress. Since such changes in plants are associated with differential gene expression, so the total RNA was isolated from stress and control plants, after one week of inoculation with MMB for analyzing induction of genes by MMB in plants under stress. The mRNA was converted into cDNA and genes were subsequently amplified by PCR with specific primers. In order to amplify β‐1,3‐glucanase genes, two degenerate primers for β‐1,3‐glucanase forward 5′‐GTGTCTGCTATGGCGTTGTCG‐3′ and reverse 5′‐GGTTCTCGTTGAACATGGCGA‐3′ were designed. Accordingly a 1.05 kb DNA segment was amplified for β‐1,3‐glucanases (data already communicated) having accession no HM569719.1. Similarly, a catalase gene was amplified using forward primer TTAATCAGCCATGGATCCT, and reverse primer AGCAGATTGCAACGCTGATC″. A band of 2 kb was obtained which was sequenced and submitted to the NCBI data bank having accession no. JX875103. This study reports changes in gene expression in the plant induced by the MMB under stress. It is therefore surprising that induction of stress related genes can be induced prior to biotic and abiotic stress, i.e. merely by

209

210

10  Mineral Mobilizing Bacteria Regulation

inoculation with MMB (Jha et  al. 2014). The physical damage to plant tissue under biotic stress facilitates entry of pathogens and can activate different plant stress response pathways, which also helps plants under abiotic stress. So the biotic and abiotic stress response in plants is a coordinated mechanism for the protection of plants under stress. So most stress‐related proteins have coordinated biochemical activities, although some  proteins have significant functions and importance in both types of stress. The biotic and abiotic stress conditions show similar physiological effects, and hence co‐regulation of defense genes has been selected during evolution for plant adaptability. Protein analysis data of MMB inoculated plants show induction of many small proteins under both normal as well as stress conditions for its establishment in the host plant and to provide protection to it against stress. MMB‐mediated phyto‐stimulation mechanism help us to find most proficient strains which will efficiently function under different agro‐ecological conditions for sustainable agriculture (Jha and Subramanian 2018b). The genes involved in secondary metabolism also provide ideas for the selection of new beneficial traits as a “genetic playing field” that allows natural selection. Secondary metabolites production relies on primary metabolism to acquire the required energy, enzymes, substrates, and cellular machinery, which helps in the survival of plants under adverse conditions (Roze et al. 2011).

10.3 ­Conclusion The plant’s defense mechanism requires lot of energy derived from primary metabolic processes like photosynthesis. Stress influences the growth of the plant by affecting its photosynthetic activity and secondary metabolite production and induction of various genes. MMB in the soil mitigate the adverse effects of stress by enhancing photosynthesis as well as plant biomass in a more time‐sensitive and cost‐effective manner, by modulating the level of primary as well as secondary metabolites. Photosynthesis is the main physiological event that can generate various types of primary metabolites, which can be diverted into various different secondary metabolites for the survival of plant under adverse conditions. But MMB are the group of bacteria which help the plant to develop tolerance against various different types of stress simultaneously, by fine adjustment of metabolites for its host. Research directed toward the application of MMB under stress encourages commercialization of inoculants for stress tolerance. The influence of climate change affects plant ontogeny, adaptation, and productivity, directly by influencing photosynthesis. Secondary metabolites are functional plant metabolites that are dispensable for plant development but indispensable for the survival of the plant and they are also regulated by MMB. The systems biology approach to investigating plant–microbe interactions in response to environmental stimuli, opens up new prospects to understand the regulatory networks of plant stress tolerance modulated by such bacteria.

­References Affendy, H., Aminuddin, M., Azmy, M. et al. (2010). Effects of light intensity on Orthosiphon stamineus Benth treated with different organic fertilizers. Int. J. Agric. Res. 5: 201–207.

­  References

Anjum, N.A., Gill, S.S., Gill, R. et al. (2014). Metal/metalloid stress tolerance in plants: role of ascorbate, its redox couple, and associated enzymes. Protoplasma 251: 165–1283. Arbona, V., Manzi, M., Ollas, C.D., and Gómez‐Cadenas, A. (2013). Metabolomics as a tool to investigate abiotic stress tolerance in plants. Int. J. Mol. Sci. 14: 4885–4911. Ashraf, M. (2004). Some important physiological selection criteria for salt tolerance in plants. Flora 199: 361–376. Ashraf, M. and Harris, P.J.C. (2013). Photosynthesis under stressful environments. An overview. Photosynthetica 51: 163–190. Baker, N.R. (2008). Chlorophyll fluorescence: a probe of photosynthesis in vivo. Annu. Rev. Plant Biol. 59: 89–113. Bhattacharyya, P.N. and Jha, D.K. (2012). Plant growth‐promoting rhizobacteria (PGPR): emergence in agriculture. World J. Microbiol. Biotechnol. 28: 1327–1350. Bilgin, D.D., Zavala, J.A., Zhu, J. et al. (2010). Biotic stress globally downregulates photosynthesis genes. Plant Cell Environ. 33: 1597–1613. Cakmak, I. (2010). Potassium for better crop production and quality. Plant Soil 335: 1–2. Chamam, A., Sanguin, H., Bellvert, F. et al. (2013). Plant secondary metabolite profiling evidences strain‐dependent effect in the Azospirillum‐Oryza sativa association. Phytochem. Lett. 87: 65–77. Choudhary, P., Yu, J.Q., Yamaguchi‐Shinozaki, K. et al. (2012). Benefits of brassinosteroid crosstalk. Trends Plant Sci. 17: 594–605. Gershenzon, J. (1983). Changes in levels of plant secondary metabolites under water and nutrient stress. Recent Adv. Phytochem. 18: 273–320. Ghasemzadeh, A., Jaafar, H.Z.E., and Rahmat, A. (2010). Elevated carbon dioxide increases contents of flavonoids and phenolic compounds, and antioxidant activities in Malaysian young ginger (Zingiber officinale Roscoe.) varieties. Molecules 15: 7907–7922. Hendrik, P., Karl, J.N., Peter, B. et al. (2012). Biomass allocation to leaves, stems and roots: meta‐analyses of inter specific variation and environmental control. New Phytol. 193: 30–50. Ibrahim, M.H. and Jaafar, H.Z.E. (2012). Primary, secondary metabolites, H2O2, malondialdehyde and photosynthetic responses of Orthosiphon stimaneus Benth to different irradiance levels. Molecules 17: 1159–1176. Jha, Y. (2017). Cell water content and lignification in maize regulated by rhizobacteria under salinity. Braz. J. Biol. Sci. 4: 9–18. Jha, Y. and Subramanian, R.B. (2013a). Paddy physiology and enzymes level is regulated by rhizobacteria under saline stress. J. Appl. Bot. Food Qual. 85: 168–173. Jha, Y. and Subramanian, R.B. (2013b). Paddy inoculated with PGPR show better growth physiology and nutrient content under salinity. Chil. J. Agric. Res. 73: 213–219. Jha, Y. and Subramanian, R.B. (2018a). Effect of root‐associated bacteria on soluble sugar metabolism in plant under environmental stress. In: Plant Metabolites and Regulation Under Environmental Stress (ed. P. Ahmad, M.A. Ahanger and M.N. Alyemeni), 231–240. Academic Press, Elsevier. Jha, Y. and Subramanian, R.B. (2018b). From interaction to gene induction: an eco‐friendly mechanism of PGPR‐mediated stress management in the plant. In: Plant Microbiome: Stress Response (ed. D. Egamberdieva and P. Ahmad), 217–232. Springer. Jha, Y., Subramanian, R.B., and Patel, S. (2011a). Combination of endophytic and rhizospheric plant growth promoting rhizobacteria in Oryza sativa shows higher accumulation of osmoprotectant against saline stress. Acta Physiol. Plant. 33: 797–802.

211

212

10  Mineral Mobilizing Bacteria Regulation

Jha, Y., Subramanian, R.B., and Patel, S. (2011b). Endophytic bacteria induced enzymes against M. grisea in O. sativa under biotic stress. Afr. J. Basic Appl. Sci. 3: 136–146. Jha, Y., Sablok, G., Subbarao, N. et al. (2014). Bacterial‐induced expression of RAB18 protein in Orzya sativa salinity stress and insights into molecular interaction with GTP ligand. J. Mol. Recognit. 27: 521–527. Lattanzio, V., Cardinali, A., Ruta, C. et al. (2009). Relationship of secondary metabolism to growth in oregano (Origanum vulgare L.) shoot cultures under nutritional stress. Environ. Exp. Bot. 65: 54–62. Lee, Y.L., Xu, X., Wallenstein, S., and Chen, J. (2009). Gene expression profiles of the one‐carbon metabolism pathway. J. Genet. Genomics 36: 277–282. Li, X., Zhang, L., Ahammed, G.J. et al. (2017). Stimulation in primary and secondary metabolism by elevated carbon dioxide alters green tea quality in Camellia sinensis L. Sci. Rep. 7: 7937. Martinez, D., Larrondo, L.F., and Putnam, N. (2004). Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22: 695–700. Matt, P., Krapp, A., Haake, V. et al. (2002). Decreased Rubisco activity leads to dramatic changes of nitrate metabolism, amino acid metabolism and the levels of phenylpropanoids and nicotine in tobacco antisense RBCS transformants. Plant J. 30: 663–677. Meyer, S., Cerovic, Z.G., Goulas, Y. et al. (2006). Relationship between assessed polyphenols and chlorophyll contents and leaf mass per area ratio in woody plants. Plant Cell Environ. 29: 1338–1134. Montillet, J.L., Chamnongpol, S., Rusterucci, C. et al. (2005). Fatty acid hydroperoxides and H2O2 in the execution of hypersensitive cell death in tobacco leaves. Plant Physiol. 138: 1516–1526. Nishiyama, Y. and Murata, N. (2014). Revised scheme for the mechanism of photoinhibition and its application to enhance the abiotic stress tolerance of the photosynthetic machinery. Appl. Microbiol. Biotechnol. 98: 8777–8796. Osakabe, Y., Yamaguchi‐Shinozaki, K., Shinozaki, K., and Tran, L.S. (2014). ABA control of plant macroelement membrane transport systems in response to water deficit and high salinity. New Phytol. 202: 35–49. Reyes‐Carmona, J., Yousef, G.G., Martınez‐Peniche, R.A., and Lila, M.A. (2005). Antioxidant capacity offruit extracts of blackberry (Rubus sp.) produced in different climatic regions. J. Food Sci. 70: 497–503. Riou‐Khamlichi, C., Menges, M., Healy, J.M.S., and Murray, J.A.H. (2002). Sugar control of the plant cell cycle: differential regulation of Arabidopsis D‐type cyclin gene expression. Mol. Cell Biol. 20: 4513–4521. Roze, L.V., Chanda, A., and Linz, J.E. (2011). Compartmentalization and molecular traffic in secondary metabolism: a new understanding of established cellular processes. Fungal Genet. Biol. 48: 35–48. Schulze, E.D., Beck, E., and Müller‐Hohenstein, K. (2005). Plant Ecology, 277–311. New York: Springer‐Verlag. Strik BC (2008). A review of nitrogen nutrition of Rubus. Proceedings of the IXth International Rubus and Ribes Symposium, Pucon, Chile, pp. 403–410. Suza, R. and Valio, I.F.M. (2003). Leaf optical properties as affected by shade in samplings of six tropical tree species differing in successional status. Braz. J. Plant Physiol. 15: 49–54.

­  References

Usadel, B., Bläsing, O., Gibon, Y. et al. (2008). Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. Plant Physiol. 146: 1834–1861. van Dam, N.M., Witte, L., Theuring, C., and Hartmann, T. (1996). Distribution, biosynthesis and turnover of pyrrolizidine alkaloids in Cynoglossum officinale. Phytochemistry 39: 287–292. Van Der Rest, B., Danoun, S., Boudet, A.M., and Rochange, S.F. (2006). Down‐regulation of cinnamoyl‐CoA reductase in tomato (Solanum lycopersicum L.) induces dramatic changes in soluble phenolic pools. J. Exp. Bot. 57: 1399–1411. Wu, M. and Kubota, C. (2008). Effects of high electrical conductivity of nutrient solution and its application timing on lycopene, chlorophyll and sugar concentrations of hydroponic tomatoes during ripening. Sci. Hortic. 116: 122–129.

213

215

11 Role of Plant Hormones in Improving Photosynthesis Belur Satyan Kumudini and Savita Veeranagouda Patil Department of Biotechnology, School of Sciences, JAIN (Deemed-to-be University), Bengaluru, India

11.1 ­Introduction Plants have evolved a complex mechanism to sense, respond, and adapt to circumvent the diverse environmental stresses. These stresses affect the functioning of the plant and results in yield loss, a serious issue which influences the productivity of agricultural and the world farming community. It also affects plant nutrition products, which are the goal of the agricultural stakeholders to the developing populace and cultivable land scarcity (Gururani et al. 2015; Pandey et al. 2016; Verma et al. 2016; Ahmad et al. 2018). The chemical messengers produced during the regulation of physiological processes in the life cycle of a plant, from germination to senescence, are regarded as plant hormones. They are also referred to as phytohormones or plant growth regulators, as they directly influence the growth and development of the whole plant and simultaneously coordinate the plant’s response during abiotic and biotic stresses (Gururani et al. 2015; Wani et al. 2016; Screpanti et al. 2016; Bucker‐Neto et al. 2017). There are a number of phytohormones influencing physiological responses. Some of the major/classical phytohormones are auxin, cytokinins (CK), gibberellins/gibberllic acid (GA), abscisic acid (ABA), and ethylene which were discovered during the first half of the nineteenth century. The other plant growth regulators, identified more recently are strigolactones, brassinosteroids, nitric oxide (NO), jasmonic acid (JA), and salicylic acid (SA), as reported by Santner and Estelle (2009), Pandey et al. (2016), and Siddiqui et al. (2018). With varying contributions to the plant physiological processes, they are produced at various sites and are transported to another (Went and Thimann 1937; Siddiqui et al. 2018). Furthermore, phytohormones control the process, not only by their concentrations, but also by the changes in the cell sensitivity (Trewavas and Cleland 1983). These natural compounds are affective at concentrations far below those of vitamins or other nutrients (Weyers and Paterson 2001; Gaspar et al. 2003). In this review an attempt has been made to combine the studies on the regulations of various hormones during stress (both biotic and abiotic), which influence photosynthesis. The regulation of these regulators will reveal the plant’s way of defending itself against physiological changes, Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

216

11  Role of Plant Hormones in Photosynthesis

thereby continuing with the progression of photosynthetic activity to mitigate stress conditions.

11.2 ­Phytohormones: Watchdogs of Plant Growth and Development The concept of phytohormones in regulation of plant physiology and development was developed much early in the twentieth century. The details of induction, production, transport, and function of phytohormones has been well documented with modern day molecular and genetic tools (Weyers and Paterson 2001; Gaspar et al. 2003; Hayat et al. 2007; Ali et al. 2008; Fujita et al. 2006; Wilkinson et al. 2012; Amrine et al. 2015; Wani et al. 2016; Li et al. 2017). The plant physiologist, Sachs called these molecules “organ forming substances” (Meidner 1985), which were later termed as “hormone” by Fitting (1909), to describe the post‐flowering phenomenon in orchids. A chain of naturally occurring compounds with similar functions were discovered and exclaimed as “plant hormones” which were grouped on the basis of chemical structure and/or physiological effect (Weyers and Paterson 2001). The following is the list of plant hormones along with their date of discovery in a plant tissue: ethylene (ripe apples; Gane 1934), auxins (Oats; Haagan‐Smit et al. 1942), GA (Runnerbean; MacMillan and Suter 1958), cytokinins (Maize; Letham 1963), ABA (Sycamore; Cornforth et al. 1965), brassinosteroids (Rapeseed; Grove et al. 1979), and jasmonates (Wormwood; Ueda and Kato 1980). 11.2.1 Auxins Auxin is one of the major and vital hormones synthesized by microorganisms and plants (Sethia et al. 2015). Most of the bioactive naturally occurring auxin‐like effects were discovered through indole‐3‐acetic acid (IAA), an endogenous auxin, extensively studied for its effect even at nanomolar concentrations (Woodward and Bartel 2005). Various other conjugates of IAA are indole‐3‐butyric acid (IBA), indole‐3‐acetyl aspartate, 4‐chloro‐indole acetic acid, phenylacetic acid, and indole‐3‐acetaldehyde. IAA is synthesized predominantly in the leaf primordia, in young leaves, and during seed development from tryptophan. Auxin transport is from one cell to the other, involving vascular tissues (cambium and procambium) in epidermal cells and is transported through phloem to the roots (Davies 2004). Cell division in cambium is stimulated by IAA along with cytokinin. Cell enlargement, stem growth, root initiation on stem cuttings, differentiation of vascular tissue (xylem and phloem) and differentiation of roots in tissue culture are induced by IAA. Auxin possesses a tropistic response (root and shoot bending in response to light and gravity), apical dominance, leaf senescence, and abscission of fruit. It induces fruit setting and growth, ripening, promotes flowering, and femaleness in dioecious flowers (Hauvermale et al. 2012). Concentrations of auxin and cytokinin are inversely correlated in plants, and treatment with the former can rapidly inhibit cytokinin biosynthesis, which is employed for in vitro induction of root and shoot development (Eklof et al. 1997; Nordstrom et al. 2004). Exposure to exogenous auxin stimulates ethylene (induction of gene encoding 1‐aminocyclopropane‐1‐ carboxylate [ACC] deaminase) and GA production, conversely ethylene inhibits auxin

11.2 Phytohormones

transport (Abel et al. 1995; Woodward and Bartel 2005). A positive response is observed in plant steroids when brassinosteroids are applied exogenously (Kim et  al. 2000) in maize, while, on exposure to ABA, IAA levels are decreased and esterified IAA conjugates were formed in muskmelon (Dunlap and Robacker 1990). 11.2.2  Gibberellins or Gibberellic Acids They are a group of phytohormones which are tetracyclic diterpenoids and regulate various functions in plant growth and development (Gantait et al. 2015). GAs are produced in developing seeds and young tissues of shoots from glyceraldehyde‐3‐­phosphate. The site of synthesis starts in chloroplasts and subsequently involves cytoplasmic membranes and is transported through the vascular tissues (Davies 2004). Geranyl diphosphate is the key precursor for the production of a large number of GAs (>130), although the function of only a few are known (Takahashi et al. 1991; Yamaguchi 2008; Daviere and Achard 2013). Production of GA is regulated by deactivation, resulting by the introduction of methyl, hydroxyl, or other functional groups. GA stimulates cell division, cell elongation and hyper elongation of stems thereby resulting in an increase of plant height (Hauvermale et al. 2012). Light and cold induced seed germination is also activated by GA during germination. It also stimulates various enzymes (amylase) in germinating cereal grains and induces maleness in dioecious flowers. External application of GA induces fruit setting and growth. Extensive studies by physiologists and molecular geneticists, shows that GA is the master regulator of plant growth, markedly during abiotic stress viz., salinity, temperature, light (Ashraf et al. 2002; Shah 2007; Khan et al. 2010; Gururani et al. 2015), and biotic stress (Claeys et al. 2013; Colebrook et al. 2014; Verma et al. 2016). 11.2.3 Cytokinins Cytokinins are a class of plant hormones which play a major role during the cell cycle and developmental mechanisms in plants. After the discovery, Skoog and Miller (1957) revealed the role of auxin–cytokinin in plant morphogenesis under in vitro conditions, which later has become a necessary component in plant studies (Werner et  al. 2001). These are adenine derivatives, with the chemical structure of N6‐­ substituted purine derivatives (which occur as zeatin and also as ribosides and ribotides) in root tips and developing seeds. The naturally occurring cytokinins are isopentenyladenine, zeatin, and dihydro zeatin, which are found in higher plants. The transport of the hormone is from roots to shoots via xylem (Mok and Mok 1994; Davies 2004). Exogenous application of cytokinin induces cell division during tissue culture along with auxin, resulting in morphogenesis, crown gall, and shoot initiation. Cytokinin delays chlorophyll breakdown and attenuates leaf senescence and enhances stomatal opening. It helps in chlorophyll accumulation and promotes the conversion of etioplasts into chloroplasts, thereby increasing photosynthetic activity (Arteca 1996; Kulaeva and Prokoptseva 2004). Studies by Heyl et al. (2006) and Kudo et al. (2010) indicate that there are two types of cytokinin activities in plants  –  the local activity (paracrine/autocrine), which regulates cell division and signaling activity, which controls functional changes in long distances (endocrine) from root to shoot. Cytokinins also influence gene expression in chloroplasts, regulating photosynthesis.

217

218

11  Role of Plant Hormones in Photosynthesis

Studies on Arabidopsis by Gordon et al. (2009) revealed that the application of auxin up‐regulated the expression of cytokinin receptor genes, regulating protein transcription during plant growth and development. 11.2.4 Ethylene It is synthesized from methionine in various tissues in response to stress and is involved in “triple response” (leaf abscission, fruit ripening, and senescence) in seedlings. Ethylene is converted to S‐adenosylmethionine (SAM) by SAM synthetase and subsequently forms 1‐aminocyclopropane‐1‐carboxylic acid (ACC) by ACC synthetase, a regulatory step releasing 5′‐methylthioadenosine (MTA), salvaged to methionine. ACC is degraded by ACC oxidase in the presence of oxygen to form ethylene, carbon dioxide and cyanide (Yang and Hoffman 1984). Ethylene diffuses from its site of synthesis (tissues undergoing senescence or ripening) maintaining the apical hook in seedlings and stimulates various defenses against biotic and abiotic stresses. It also affects root and shoot growth, differentiation, and adventitious root formation. Ethylene also induces femaleness in dioecious flowers, flower opening, leaf and fruit abscission, and fruit ripening (Arteca 1996; Guo and Ecker 2004; Morris et al. 2004; Wang and Irving 2011). Under stressful conditions it inhibits root growth and development, and reduces shoot/leaf expansion and photosynthesis (Rajala and Peltonen‐ Sainio 2001; Sharp 2002; Pierik et  al. 2006). Desikan et  al. (2006) experimentally determined the role of ethylene in stomatal closure in Arabidopsis. Similar studies by Vysotskaya et al. (2011) on tomato plants in environmentally‐induced ethylene accumulation also suggest that ethylene antagonizes drought and ABA‐induced stomatal closure, which is supported by other studies (Tanaka et  al. 2005; Wilkinson and Davies 2009). 11.2.5  Abscisic Acid ABA was earlier named as “abscisin” based on its role in leaf abscission. It is a major plant hormone, which is produced in response to abiotic stress for plant adaptation (Davies 2004; Wang and Irving 2011; Wani et al. 2016). ABA is produced in response to drought/water stress in mature leaves and roots from glyceraldehyde‐3‐phosphate via isopentenyl diphosphate and carotenoids (Normanly et al. 2004). Plant developmental stages viz., seed dormancy, embryo maturation, stomatal closure, and senescence are regulated by ABA. It induces storage protein synthesis in seeds and promotes tolerance under stress (Davies 2004; Wasilewska et al. 2008; Klinger et al. 2010; Gururani et al. 2015). ABA regulates photosynthesis and mobilization of the photosynthate pool between source and sink tissues (Pinheiro et al. 2011; Barickman et al. 2014). A rapid increase in ABA levels was observed to activate signaling pathways and modifying gene expression (dehydrins, late embryogenesis abundant [LEA] proteins and other protective proteins) and transcriptionally regulate up to 10% of protein‐encoding genes (Wani et al. 2016). Under water deficit conditions, ABA is involved in root growth promotion and architectural modifications. It also regulates the cell turgor maintenance, and the synthesis of osmoprotectants and antioxidant enzymes (Chaves et al. 2003). ABA also plays a role in salinity (Zhu et al. 2011) and heavy metal stress responses detailed in Table 11.1.

11.2 Phytohormones

Table 11.1  Studies on the regulation of photosynthetic machinery by phytohormones in different plants under heavy metal stress.

Hormones

Heavy metal

Ethylene

Cadmium

Solanum Ethylene signaling along with NR lycopersicum L. (ethylene insensitive never ripe) receptor can modulate biochemical pathways of oxidative stress and induce photosynthesis by signaling.

Monteiroa et al. 2011

IAA GA3

Copper

Helianthus annuus L.

IAA decreased the toxic effects of 80 μM of copper in roots, which increased root length and root hair formation. GA3 application ameliorated the toxic effect only in shoots. IAA and GA3 application resulted in stability of the light harvesting complex of PSII reaction centers, lessened the Cu effect on photosynthetic activity and improved water use efficiency.

Filová et al. 2013

Brassinosteroid Cadmium

Solanum lycopersicum

Brassinosteroid application neutralized the damaging effects of cadmium on plants, which exhibited a negative impact on the antioxidant system.

Hayat et al. 2012

ABA

Cadmium

Typha latifolia L. Phragmites australis (Cav.) Trin. ex Steud. Oryza sativa L.

Application of heavy metals increased the endogenous levels of ABA.

Fediuc et al. 2005

ABA

Arsenic

Oryza sativa

Transcriptome analysis revealed the expression of ABA biosynthesis genes OsNCED2 and OsNCED3, also the up‐regulation of ABA signaling genes.

Xin et al. 2005

Auxin

Copper

Sunflower

Increased ability of energy trapping by PSII reaction centers.

Ouzounidou and Ilias 2005

BRs

Cadmium

Brassica juncea Higher chlorophyll accumulation.

Plant

Effect

Reference

Hayat et al. 2007

Aluminum Mungbean

Higher net photosynthesis rate and improved stomatal conductivity.

Ali et al. 2008

Ethylene

Cadmium

Mustard

Increased activity of Rubisco and maximal quantum efficiency.

Masood et al. 2012

GA

Copper

Sunflower

Efficiency of PSII reaction centers in energy trapping.

Ouzounidou and Ilias 2005

219

220

11  Role of Plant Hormones in Photosynthesis

11.2.6  Jasmonic Acid Jasmonates (JA, methyl jasmonate and jasmonoyl‐isoleucine) act as plant growth regulators and are abundant in plants. They have a cyclopentanone ring structure, derived from the oxygenation of polyunsaturated fatty acids (PUFAs) mediated by lipoxygenase (LOX). JA is synthesized through the octadecanoid pathway, involving the translocation of lipid‐intermediates from chloroplast membranes to cytoplasm and then to peroxisomes (Kombrink 2012; Leon 2013; Wani et al. 2016; Per et al. 2018) during the metabolism of membrane fatty acids (Pirbalouti et al. 2014). These compounds are involved in reproductive processes, senescence, secondary metabolism, and defense responses, which are crucial in plant development and survival (Seo et al. 2001; Kang et al. 2005; Chen et al. 2011; Fahad et al. 2015; Per et al. 2018). They play a pivotal role during seed germination, seedling development and flowering, senescence, growth inhibition, and fruit ripening (Per et al. 2018). In addition to the developmental processes, JA activates plant defense mechanisms against pathogenic attack (Cheong and Choi 2003; Antico et al. 2012; Sorokan et al. 2013; Kumudini et al. 2018) and other abiotic stresses like, heavy metals (Maksymiec et al. 2005), heat (Clarke et al. 2009), drought (Brossa et al. 2011; Seo et al. 2011), and salinity (Dong et al. 2013; Zhao et al. 2014; Qiu et al. 2014). JA acts on plants under stress conditions by complex networking with other phytohormones (Wasternack and Strnad 2016). 11.2.7  Salicylic Acid It is a well‐known naturally synthesized phenolic acid during plant defense and regulates plant growth, fruit ripening, and development (Wani et  al. 2016) by regulating pigment accumulation, maintenance of chloroplast structure, stomatal closure and Rubisco activity (Vicente and Plasencia 2011; Gururani et al. 2015). SA is synthesized via two pathways: phenylalanine and isochorismate pathway, the former is more common in most plants (Wani et al. 2016). At lower concentrations, SA enhances antioxidant levels in plants and causes cell death at higher concentrations. SA induces the genes encoding the production of antioxidants, chaperones, heat shock proteins, and secondary metabolites (cytochrome P450, cinnamyl alcohol dehydrogenase, and sinapyl alcohol dehydrogenase) as reported by Jumali et al. (2011). 11.2.8 Brassinosteroids This is a family of 40 naturally occurring plant steroid hormones, which play important roles in various physiological processes. They induce a plethora of cellular responses viz., cell expansion and elongation, photomorphogenesis, stem elongation, pollen tube growth, xylem differentiation, leaf epinasty, and root inhibition. Proton pump activation, induction of ethylene biosynthesis, regulation of photosynthesis‐ related gene expression, and adaptive responses to environmental stress are activated. It regulates the architecture of the plant, stomata formation and senescence under various conditions (Mandava 1988). Brassinosteroids are classified according to the number of structural carbons as described by Vardhini (2014). The most widely used brassinosteroids are 28‐homobrassinolide and 24‐epibrassinolide (Bucker‐Neto et al. 2017).

11.3 Photosynthesis

11.2.9 Strigolactones They belong to the family of semiochemicals – biologically active molecules that disseminate information between individual organisms (Zwanenburg and Pospíšil 2013). It was first isolated from the root exudates of Gossypium hirsutum L. in early 1966 and termed as strigol (Cook et al. 1966; Screpanti et al. 2016; Zwanenburg et al. 2016), whose structure was further elucidated in 1972. Later in 1992, a compound called sorgolactone, structurally similar to strigol was isolated from the root exudates of Striga and Sorghum (Hauck et al. 1992). Strigolactones contain three fused rings (ABC scaffold). Many of the terrestrial plants, including the higher and non‐vascular plants (moss, liverworts, and stoneworts) synthesize strigolactones which are different structurally (Kohlen et al. 2011; Screpanti et al. 2016).

11.3 ­Photosynthesis It is a multistep controlled process wherein the solar energy is arrested by chlorophyll, electrons are excited and carbon‐di‐oxide is assimilated to synthesize carbohydrates and liberate oxygen by reduction of water to NADP+ (nicotinamide adenine dinucleotide phosphate) (Pan et al. 2012; Gururani et al. 2015; Kumudini et al. 2018; Siddiqui et al. 2018). It is the key phenomenon, occurring in all green plants (lower and higher) and photosynthetic bacteria (Taiz and Zeiger 2010; Pan et al. 2012; Ashraf and Harris 2013). Photosynthesis includes two key steps – the light reaction where light energy is converted into ATP (adenosine triphosphate) and NADPH, and oxygen is released, and the dark reaction where carbon dioxide is fixed into carbohydrates by utilizing the products of the light reactions (Lawlor 2001; Taiz and Zeiger 2010; Dulai et al. 2011). Carbon dioxide is fixed by two main pathways (C3 and C4) on the basis of which plants are also categorized (Ashraf and Harris 2013). The chloroplast is known as the factory for the photosynthetic mechanism (light and dark reactions). However, recent studies have elucidated the role of mitochondria in the efficient maintenance of the process (Nunes‐Nesi et al. 2008). As a process of production of carbohydrates during day light, starch granules are accumulated in chloroplasts, the excess of which is continuously distributed as sucrose to tissue sinks (developing leaves, roots, meristems, fruits, and flowers) via the phloem, which are incapable of producing sufficient amounts of assimilates. Hence, a coordinated sequence of production, allocation, and utilization of assimilates is necessary for plant growth and development (Kocal et al. 2008; Selvaraj and Fofana 2012). In the process, a source and sink imbalance in the complete plant is due to the carbohydrate assimilation in the leaves leading to the decreased expression of photosynthetic genes and accelerated leaf senescence (Paul and Foyer 2001). The imbalance can be due to the abiotic (heavy metal, salinity, drought, heat, or osmotic imbalance) and biotic (pathogens – viruses, fungi, bacteria, pests, and nematodes) stresses, which regulates/triggers the enzymes involved in the photosynthetic mechanism. Major enzymes viz., Rubisco, Rubisco activase, fructose‐1,6‐bisphosphatase, phosphoenolpyruvate carboxylase, NADP malic enzyme, and pyruvate orthophosphate dikinase, are known to influence the photosynthetic machinery under environmental stress, either increasing/decreasing enzymatic activities, discussed in detail by Ashraf and Harris (2013).

221

222

11  Role of Plant Hormones in Photosynthesis

11.3.1  Role of Plant Hormones in Photosynthesis Chloroplasts contain chlorophyll, which is the site of photosynthesis and is one of the key organelles enmeshed in plant growth and development. Chlorophyll is primarily biosynthesized from glutamate, which is then converted to 5‐aminolevulinic acid (ALA) and further converted to protochlorophyllide (Pchlide). NADPH protochlorophyllide oxidoreductase (POR), a rate‐limiting enzyme, is photoactivated and catalyzes the conversion of Pchlide to chlorophyllide. Pchlide is further esterified to form mature chlorophyll under light conditions, when seedlings grown in the dark are exposed to light (Fujita 1996; Reinbothe et al. 2010; Tanaka et al. 2011). Elevated levels of Pchlide are extremely phototoxic. Photooxidative damage in seedlings due to increased production of reactive oxygen species (ROS) induced by free Pchlide, hinders chlorophyll conversion, regulating photosynthesis during plant development (op den Camp et  al. 2003; Huq et al. 2004; Chen et al. 2013; Zhong et al. 2014). Pchlide accumulation is repressed and expression of PORA and PORB genes are induced by ethylene in the etiolated seedlings, mediating the transcription factors (EIN3/EIL1) in the ethylene signaling pathway. De‐etiolation is also regulated by GA and inhibition of GA signaling induces partial photomorphogenesis in dark. DELLAs are a subfamily transcriptional regulators, which negatively regulate GA signaling and repress GA‐mediated responses (Alabadi et al. 2004, 2008; Jiang and Fu 2007). Application of cytokinin to Arabidopsis induces partial differentiation of chloroplasts and expansion of cotyledons (Chory et al. 1994; Vandenbussche et al. 2007). Expression of chloroplast‐related genes are induced by the GATA family of transcription factors (GNC and CGA1/GNL). In the presence of cytokinin, seedlings grown in the dark had plastids that were larger in size and lens‐shaped, containing prothylakoid membranes, whereas the absence of cytokinin displayed small etioplasts with prolamellar bodies (Chory et al. 1994). A report by Cortleven et al. (2016) indicated that cytokinin mediated etioplast‐to‐chloroplast transition by promoting characteristic ultrastructural changes. Cytokinin is also related to increased protein levels of HY5, a junction between light and cytokinin signaling pathways (Liu et al. 2017). HY5 protein accumulation is repressed in roots via IAA14 (auxin) and regulatory targets like ARFs (auxin responsive factors). Auxin also represses chlorophyll genes in detached roots which are known to be activated by cytokinins, showing a negative proportional hormone relationship (Kobayashi et al. 2017). Gene expression studies by Sun et al. (2010) on brassinosteroid‐insensitive bri1‐116 seedlings revealed the upregulation of chlorophyll biosynthesis genes. The crosstalk between the light signaling pathways and brassinosteroids is mediated through the GATA2 transcriptional factor (Luo et al. 2010). The role of strigolactones is also reported during light signaling via the nuclear localization of COP1, jasmonates inhibit COP1 activity, promoting photomorphogenesis (Liu et al. 2017) in tomato plants. Nevertheless, the complex linkages in physiological and molecular signaling networks of these hormones is enormous and difficult to apprehend the precise role of each of the hormones in regulation of photosynthesis during stress. Anthropogenic activities have significantly contributed to additional stresses to the ecosystem, which are responsible for the depreciation of biodiversity. Both abiotic and biotic stresses generate free radicals, which are harmful to the physiology of the plant. Hence, use of hormones to regulate/ameliorate the stress is a better

11.4  Phytohormones and Abiotic Stress

option. In the subsequent sections, efforts have been made to highlight the role of hormones in different stress mechanisms.

11.4 ­Phytohormones and Abiotic Stress Tolerance vis‐à‐vis Photosynthesis Abiotic stress results in photooxidation due to over‐reduction of the electron transport chain (ETC). To resist this mechanism, plants convert excessive absorption of light energy to thermal energy, thereby achieving an optimal rate of electron transport. Photosystem II (PSII), in all photosynthetic organisms is the most invincible complex during abiotic stress. Photo damage to the PSII complex is recovered by the PSII repairing system. Besides generation of ROS in chloroplasts during abiotic stress, damage to PSII, which is insignificant, but impedes D1 protein synthesis (Gururani et al. 2015). The crosstalk between the diverse groups of hormones under stress conditions, marks the difficulty in exploiting the key functions of each of the hormonal pathways, in regulating photosynthesis and PSII damage repair. The regulation of plant physiological processes under abiotic stress is maintained by a plant osmolyte, glycine betaine, by stabilizing the PSII complex and prevents lipid and enzyme degradation during the maintenance of the ETC (Prasad and Saradhi 2004; Chen and Murata 2011; Adams et al. 2013). Hüner et al. (2014) suggests that concentration of glycine betaine influences the production of stress responsive hormones and enzymes endogenously. Hence the accumulation of glycine betaine is associated with the signaling mechanism of ABA, ethylene, and SA under different conditions (Wang et al. 2010; Gururani et al. 2015). Several hormones have been studied to induce gene expression in photosynthetic responses, PSII complex, and the accumulation of chlorophyll during abiotic stress (heavy metal, salinity, and drought), which is discussed in detail in the subsequent sections. 11.4.1  Heavy Metals The bio‐active metals are classified into two groups based on their physiochemical properties into redox (Cr, Cu, Mn, and Fe) and non‐redox metals (Cd, Ni, Hg, Zn, and Al). Heavy metals induce ROS and oxidative stress resulting in disequilibrium between pro and antioxidant homeostasis (Jozefczak et al. 2012). Cadmium, a highly toxic heavy metal, retards photosynthesis by hindering chlorophyll synthesis and water balance, and it also induces stomatal closure (Siddiqui et al. 2018). It has been reported that levels of chlorophyllase (a chlorophyll degrading enzyme) increase, which consequently reduces photosynthesis (Rady 2011). Studies by Bal and Kasprzak (2002), suggest that increased concentrations of nickel ions bind to lipids, and lipids induce oxidative damage. Exogenous application of 24‐ epiEBL ameliorated nickel stress in Brassica juncea (L.) Czern by augmenting the antioxidant levels (Kanwar et  al. 2013). Similar findings were noticed, augmenting with 28‐homoBL (wheat) and 24‐epiBL (Raphanus sativus Bailey and Vigna radiata (L.) R.  Wilczek) under nickel toxicity (Yusuf et  al. 2010; Sharma et  al. 2011; Yusuf et al. 2012).

223

224

11  Role of Plant Hormones in Photosynthesis

Copper is one of the bioactive metals present in trace amounts in fungicides, fertilizers, and pesticides, applied to agricultural fields, which poses a serious threat to plants (Chen et al. 2000; Küpper et al. 2009). It is also an important element in electron transport during photosynthesis, mitochondrial respiration, oxidative stress response, hormone signaling, and cell wall modifications (Siddiqui et al. 2018). Other metals like chromium and aluminum also have an impact on photosynthetic processes. Photosynthetic pigments (chlorophyll and carotenoids) and PSII quantum yield declined in radish seedlings under chromium stress (Zayed and Terry 2003). Lesser concentrations of aluminum decrease the stomatal conductance and internal carbon dioxide concentrations, regulating the photosynthetic machinery (Ali et  al. 2008). Various studies have been carried out to determine the effect of phytohormones on heavy metal stress tolerance in accordance with the photosynthetic machinery (Table 11.1). Phytohormones are known to ameliorate heavy metal toxicity in plants by mediating the physiological processes. 11.4.2 Salinity Salinity is one of the key abiotic stresses, which is an agricultural constraint affecting plant growth, development, and productivity (Gao et  al. 2008; Turkan and Demiral 2009). Deposition of water soluble salts such as sodium chloride, sodium carbonate, and calcium chloride results in saline soils (Nawaz et al. 2010), resulting in osmotic stress, ion toxicity, and disruption to the uptake and translocation of minerals (Fariduddin et al. 2014). Reports on the breakdown of chlorophyll under salinity stress are attributed toward the increased levels of toxic sodium ions (Pinheiro et al. 2008; Li et al. 2010; Yang et al. 2011). Likewise, a reduction in Chl a and b was reported in different crops like alfalfa (Winicov and Seemann 1990), castor bean (Pinheiro et  al. 2008), sunflower (Ashraf and Sultana 2000; Akram and Ashraf 2011), and wheat (Arfan et al. 2007; Perveen et al. 2010). Reports on sugar cane, revealed that the imposition of salt stress at various stages of plant growth caused a remarkable reduction in chlorophyll and carotenoids wherein the salt‐tolerant plants exhibit higher membrane stability and photosynthetic pigments (Gomathi and Rakkiyapan 2011). Hence these pigments can be employed as a selection criterion for salt tolerance in many crops (alfalfa, wheat, pea, melon, sunflower, proso millet, and hot pepper) as studied by Ashraf and Harris (2013). Use of phytohormones in the regulation of photosynthesis during salinity stress has been shown to increase plant growth and development. Brassinosteroids (HBL) applied on B. juncea, subjected to saline conditions, showed increased photosynthesis (Hayat et al. 2012). Ekinci et al. (2012) demonstrated that treatment with brassinosteroids alleviated the chlorophyll content damaged due to concentrations of sodium chloride. The net photosynthetic rate, stomatal conductance, transpiration rate, and water use efficiency were restored by 24‐EBL which were reduced under saline conditions (Ali et al. 2008; Rady 2011). Similar studies were carried out on rice and cabbage by Zhu et al. (2011), where ABA use enhanced PSII efficiency. Ethylene has been used in most of the studies to alleviate the salinity stress in mustard and tobacco plants, improving the efficiency of photosynthetic nitrogen and sulfur, and PSII quantum yield in turn increased the net photosynthetic rate (Wi et  al. 2010; Nazar et  al. 2014). Increased IAA levels affected plant growth and increased the germination percentage under salinity stress

11.5  Deciphering the Role of Phytohormones

(Nishma et al. 2014). GA is the most common plant hormone, involved in regulation of plant physiology under salinity stress. Stomatal conductance increased the energy trapping ability of PSII reaction centers. Photosynthetic efficiency and photosynthetic rate were increased in wheat (Ashraf et al. 2002), mustard (Shah 2007), and linseed plants (Khan et al. 2010) under salinity stress. The biotic stress hormones JA and SA are also reported to increase tolerance toward salinity stress in rice, pea, and barley, increasing the leaf water potential, Rubisco activity, improved variable and maximum fluorescence, and the net photosynthetic rate (Kang et al. 2005; Yusuf et al. 2008; Liu et al. 2014; Nazar et al. 2015). 11.4.3 Drought This is the plant state in which the availability of water decreases, a condition unfavorable for plant growth and development, which is known as drought (Zhu 2002). It is the  most severe abiotic stress presently affecting agriculture due to low rainfall and highwater‐­deficit conditions (Pieterse et  al. 2012). Drought stress reduces photosynthetic pigment synthesis, stomatal conductance and the whole photosynthetic process by deterioration of thylakoid membranes, thereby resulting in an imbalance in the physiological and molecular processes (Jaleel et  al. 2008; Hasanuzzaman et  al. 2012; Ashraf and Harris 2013; Fariduddin et  al. 2014; Ahmad et  al. 2018). However, the decrease in chlorophyll content resulted in the accelerated breakdown by chlorophyllase and peroxidase enzymes rather than its reduced rate of synthesis (Harpaz‐Saad et al. 2007; Kaewsuksaeng 2011). It was also observed that a reduction of Chl b is found to be greater than Chl a during drought stress (Jaleel et al. 2008; Jain et al. 2010). Under low water conditions, ROS levels increase resulting in a decrease of carotenoid concentrations (Sofo et al. 2005; Prasad et al. 2005), which were restored on the application of brassinosteroids in tomato plants (Behnamnia et al. 2009). However, reports on the use of different hormones having up‐regulated the photosynthetic activity and plant growth in various crops have been evidenced (Table 11.2). Water stress poses a great threat to plants by decreasing the PSII quantum yield, water use efficiency, relative water content, and chlorophyll content (Zhang et al. 2008; Yuan et al. 2010; Li et al. 2012; Hu et al. 2013; Janeczko et al. 2016).

11.5 ­Deciphering the Role of Phytohormones in Perceiving Photosynthesis During Biotic Stress The pool size of the metabolic intermediates altered as plant defense responses are triggered during biotic interactions. This is likely to influence the photosynthetic mechanism, to meet up to the needs of the plant cell (Kumudini et al. 2018). In this regard, two hypotheses have been proposed. First, from a supply and demand standpoint, the rate of photosynthesis may increase the supply of skeletal carbons and energy, reducing their equivalents for plant defense. Second, a reduction in disposable cellular activities during resistance response, produces defense‐related compounds reducing photosynthetic rates until the termination of pathogen progression (Somssich and Hahlbrock 1998; Kumudini et al. 2018). Various mechanisms are involved in plant–pathogen interactions in different host–pathogen models.

225

226

11  Role of Plant Hormones in Photosynthesis

Table 11.2  Studies on plant hormones regulating the photosynthetic machinery in different plants under drought stress. Hormones

Plant

Effect

References

ABA

Common bean, tobacco, beetroot, maize

Improved PSII efficiency.

Haisel et al. 2006

ABA

Rice

Improved non‐photochemical quenching and PSII efficiency.

Du et al. 2010

ABA

Chinese tea

Improved non‐photochemical quenching and slower decline in PSII efficiency.

Guan et al. 2015

Auxin

Arabidopsis

Improved electron transfer rate, photochemical quenching, maximal photochemical yield.

Tognetti et al. 2010

Brassinosteroids

Cucumber

Higher PSII efficiency, improved non‐ photochemical quenching.

Yu et al. 2004

Brassinosteroids

Pepper

Improved utilization of PSII antennae, reduced drought‐induced photoinhibition.

Hu et al. 2013

Cytokinins

Maize

Increased electron transport of PSII, higher photosynthetic performance index, energy absorption, and trapped excitation energy.

Shao et al. 2010

Cytokinins

Tobacco

Increased expression of PSII associated genes.

Rivero et al. 2010

Strigolactones

Arabidopsis

Increased PSII gene expression.

Van Ha et al. 2014

Pathogen entry into the host can be passive – through natural openings (abrasions or wounds, stomata, hydathodes, or lenticels). Biotrophic interactions include the development of specialized structures – haustoria, which cause significant structural damage to the host tissue (Selvaraj and Fofana 2012). Plant pathogens affect the host’s physiology either directly by secretion of lytic enzymes viz., chitinase, amylase, cellulase, pectinase, and lipase (Patil et al. 2016), and toxins or via host responses (Tonelli et al. 2011). It has been reported that most foliar diseases impact the photosynthetic machinery, as they are directly related to the photosynthetic pigments and machinery (Ashraf and Harris 2013). The down‐regulation of effective PSII quantum yield in compatible interactions with biotrophic and necrotrophic pathogens has been reported using chlorophyll fluorescence analysis (Kumudini et al. 2017). Biotrophic interactions are those such as Albugo candida (Chou et al. 2000), Blumeria graminis (Scholes and Rolfe 1996; Swarbrick et al. 2006), Pseudomonas syringae (Bonfig et al. 2006), and Puccinia coronata. Examples of necrotrophs are the fungus Botrytis cinerea (Berger et al. 2004), and viruses like abutilon mosaic virus and tobacco mosaic virus (Balachandran et  al. 1994; Lohaus et  al. 2000; Perez‐Bueno et al. 2006). Various other studies (Table 11.3) on the regulation of diseases by plant hormones have been reported, which regulates photosynthesis and influences the developmental processes of the plant, and also in turn, plant production and yield.

11.6  Interplay Between the Phytohormones

Table 11.3  Phytohormonal regulation of photosynthesis in different plants during biotic stress. Hormones

Plant

Pathogen

Effect

References

SA

Cocoa

Moniliophthora perniciosa (Stahel) Aime and Phillips‐Mora

Increased hypersensitive reactions and cell necrosis at the site of infection.

Kilaru et al. 2007

GA, SA

Oryza sativa

Magnaporthe grisea (T.T. Hebert) M.E. Barr

Increased disease resistance in treated plants.

Yang et al. 2008

SA, JA

Sorghum bicolor (L.) Moench

Chilo partellus Swinhoe

Increased resistance in plants with higher antioxidant activities.

Hussain et al. 2013

JA, SA

Oryza sativa

Magnaporthe grisea

Up‐regulation of SA and JA genes during defense response.

Tamaoki et al. 2013

Ethylene, auxin, JA

Oryza sativa

Rhizoctonia solani J.G. Kühn

Involved in induction of resistance against sheath blight.

Ghosh et al. 2017

11.6 ­Interplay Between the Phytohormones to Facilitate Photosynthesis Under Stress Many of the plant functional and physiological responses throughout the life cycle are regulated by the plant hormones or plant growth regulators (Gururani et al. 2015; Wani et  al. 2016; Per et  al. 2018). Hence to sustain the equilibrium between growth and defense systems in plants, signal crosstalk between hormones and regulatory networks is a key challenge for plant biologists. The plant hormones act either independently or through signaling mechanisms, which are interrelated. Notably, the synergistic and antagonistic crosstalk of these hormones modulates the biosynthesis of certain molecules which are responsible in stress responses (Robert‐Seilaniantz et al. 2007; Kazan 2015; Hu et al. 2017). Topical studies on photosynthetic machinery and plant hormones have shown the interplay between the latter and cellular redox homeostasis to regulate photosynthesis under stress conditions (Peleg and Blumwald 2011; Gururani et al. 2015). Thompson et  al. (2000) suggest that overaccumulation and external application of hormones exhibit completely different effects on plant physiology. Auxin stimulates GA biosynthesis, whereas suppresses ABA and ethylene biosynthesis in plants (Wang and Irving 2011). Overexpression of the ABA gene negatively affected the biosynthesis of auxin and GAs regulating the development of the tomato plants (Nitsch et al. 2009). Numerous studies have been carried out to postulate the signaling mechanisms involved in the interplay of plant hormones in plant stress management under abiotic conditions (Xia et al. 2015; Pandey et al. 2016; Screpanti et al. 2016; Bucker‐Neto et al. 2017; Ahmad et al. 2018; Per et al. 2018; Siddiqui et al. 2018). These studies encourage the plant biologists to employ the modern‐day omics (genomics, transcriptomics, proteomics, ionomics, lipidomics, metabolomics, and bioinformatics) approach to detail the hormonal effects on plant growth and development and manipulate the same for increasing the stress tolerance capacity.

227

228

11  Role of Plant Hormones in Photosynthesis

11.7 ­Conclusion and Future Prospects At present, research targets are to study the role of plant hormones as long‐distance chemical signals under stress and natural conditions, and the interplay and application of the same. It is important to investigate the varied functions of phytohormones in the context of plants and environmental stresses in future. Also, the mere understanding of hormones and the role in signaling crosstalk at the cell, tissue, and organ levels has to be unfolded. Studies have revealed that the use of plant growth promoting rhizobacteria (PGPR) with high IAA production, fluorescent Pseudomonads and Bacillus spp., in seed priming increased the in vitro germination and vigor index under salinity stress (Nishma et  al. 2014) and under normal conditions (Subramanian and Satyan 2014). Studies on drought stress in Cucumber using Bacillus isolates induced plant growth promotion and other parameters like total chlorophyll content (Govardhana and Satyan 2016). Ragi seed priming with fluorescent pseudomonad isolates alleviated the chromium stress compared to the unprimed plants with increased antioxidant and proline content (Varsha and Kumudini 2016). The fluorescent Pseudomonas isolates have proven to induce disease resistance against ragi blast disease, by up‐regulating the pathogenesis related proteins viz., β‐1,3‐glucanase and chitinase at early hours post challenge inoculation (Patil et al. 2016). These studies imply the use of PGPR, which are efficient in IAA production and also in increasing stress (biotic and abiotic) tolerance resistance, can be of greater interest in the management of the same due to climate change. Various studies are reviewed by Wani et al. (2016), suggesting phytohormone engineering to enhance the stress (abiotic and biotic) tolerance and to provide novel approaches to sustainable agriculture with variable environmental changes worldwide. Hence the use of the available molecular and genetic data to alleviate the stress response by engineering the multiple stress responsive genes is of utmost priority for molecular biologists. Thus, the use of technologies in determining the patterns of signaling by plant hormones under environmental stress can create a new avenue in crop production and yield increases to feed populations with scarce land availability.

­Acknowledgments Authors apologize to all whose relevant work cannot be quoted in this chapter due to space constraints. Authors acknowledge JAIN (Deemed-to-be University), Bengaluru and DST‐SERB, Government of India, for research funding (YSS/2015/001905).

­References Abel, S., Nguyen, M.D., and Theologis, A. (1995). The PS‐IAA4/5‐like family of early auxin‐inducible mRNAs in Arabidopsis thaliana. J. Mol. Biol. 251: 533–549. Adams, W.W., Muller, O., Cohu, C.M., and Demmig‐Adams, B. (2013). May photoinhibition be a consequence, rather than a cause, of limited plant productivity? Photosynth. Res. 117: 31–44.

­  References

Ahmad, F., Singh, A., and Kamal, A. (2018). Crosstalk of brassinosteroids with other phytohormones under various abiotic stresses. J. Appl. Biol. Biotechnol. 6: 56–62. Akram, N.A. and Ashraf, M. (2011). Improvement in growth, chlorophyll pigments and photosynthetic performance in salt‐stressed plants of sunflower (Helianthus annuus L.) by foliar application of 5‐aminolevulinic acid. Agrochimica 55: 94–104. Alabadi, D., Gallego‐Bartolome, J., Orlando, L. et al. (2008). Gibberellins modulate light signaling pathways to prevent Arabidopsis seedling de‐etiolation in darkness. Plant J. 53: 324–335. Alabadi, D., Gil, J., Blazquez, M.A., and Garcia‐Martinez, J.L. (2004). Gibberellins repress photomorphogenesis in darkness. Plant Physiol. 134: 1050–1057. Ali, B., Hayat, S., Fariduddin, Q., and Ahmad, A. (2008). 24‐epibrassinolide protects against the stress generated by salinity and nickel in Brassica juncea. Chemosphere 72: 1387–1392. Amrine, K.C.H., Blanco‐Ulate, B., and Cantu, D. (2015). Discovery of core biotic stress responsive genes in Arabidopsis by weighted gene co‐expression network analysis. PLoS ONE 10: e0118731. Antico, C.J., Colon, C., Banks, Y., and Ramonell, K.M. (2012). Insights into the role of jasmonic acid‐mediated defenses against necrotrophic and biotrophic fungal pathogens. Front. Biol. 7: 48–56. Arfan, M., Athar, H.R., and Ashraf, M. (2007). Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in differently adapted spring wheat cultivars under salt stress? J. Plant Physiol. 6: 685–694. Arteca, R. (1996). Plant Growth Substances: Principles and Applications. New York: Chapman & Hall. Ashraf, M. and Harris, P.J.C. (2013). Photosynthesis under stressful environments: an overview. Photosynthetica 51: 163–190. Ashraf, M., Karim, F., and Rasul, E. (2002). Interactive effects of gibberellic acid (GA3) and salt stress on growth, ion accumulation and photosynthetic capacity of two spring wheat (Triticum aestivum L.) cultivars differing in salt tolerance. Plant Growth Regul. 36: 49–59. Ashraf, M. and Sultana, R. (2000). Combination effect of NaCl salinity and N‐form on mineral composition of sunflower plants. Biol. Plant. 43: 615–619. Bal, W. and Kasprzak, K.S. (2002). Induction of oxidative DNA damage by carcinogenic metals. Toxicol. Lett. 127: 55–62. Balachandran, S., Osmond, C.B., and Daley, P.F. (1994). Diagnosis of the earliest strain‐specific interactions between tobacco mosaic virus and chloroplasts of tobacco leaves in vivo by means of chlorophyll fluorescence imaging. Plant Physiol. 104: 1059–1065. Barickman, T.C., Kopsell, D.A., and Sams, C.E. (2014). Abscisic acid increases carotenoid and chlorophyll concentrations in leaves and fruit of two tomato genotypes. J. Am. Soc. Hortic. Sci. 139: 261–266. Behnamnia, M., Kalantari, K.M., and Rezanejad, F. (2009). Exogenous application of brassinosteroid alleviates drought‐induced oxidative stress in Lycopersicon esculentum L. Gen. Appl. Plant Physiol. 35: 22–34. Berger, S., Papadopoulos, M., Schreiber, U. et al. (2004). Complex regulation of gene expression, photosynthesis and sugar levels by pathogen infection in tomato. Physiol. Plant. 122: 419–428.

229

230

11  Role of Plant Hormones in Photosynthesis

Bonfig, K.B., Schreiber, U., Gabler, A. et al. (2006). Infection with virulent and avirulent P. syringae strains differentially affects photosynthesis and sink metabolism in Arabidopsis leaves. Planta 225: 1–12. Brossa, R., López‐Carbonell, M., Jubany‐Marí, T., and Alegre, L. (2011). Interplay between abscisic acid and jasmonic acid and its role in water‐oxidative stress in wild‐type, ABA‐deficient, JA‐deficient, and ascorbate‐deficient Arabidopsis plants. J. Plant Growth Regul. 30: 322–333. Bucker‐Neto, L., Paiva, A.L.S., Machado, R.D. et al. (2017). Interactions between plant hormones and heavy metals responses. Genet. Mol. Biol. 40: 373–386. Chaves, M.M., Maroco, J.P., and Pereira, J.S. (2003). Understanding plant responses to drought: from genes to the whole plant. Funct. Plant Biol. 30: 239–264. Chen, D., Xu, G., Tang, W. et al. (2013). Antagonistic basic helix‐loop‐helix/bZIP transcription factors form transcriptional modules that integrate light and reactive oxygen species signaling in Arabidopsis. Plant Cell 25: 1657–1673. Chen, L.M., Lin, C.C., and Kao, C.H. (2000). Copper toxicity in rice seedlings: changes in antioxidative enzyme activities, H2O2 level, and cell wall peroxidase activity in roots. Bot. Bull. Acad. Sin. 41: 99–103. Chen, Q., Sun, J., Zhai, Q. et al. (2011). The basic helix‐loop‐helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate‐mediated modulation of the root stem cell niche in Arabidopsis. Plant Cell 23: 3335–3352. Chen, T.H.H. and Murata, N. (2011). Glycinebetaine protects plants against abiotic stress: mechanisms and biotechnological applications. Plant Cell Environ. 34: 1–20. Cheong, J. and Choi, Y.D. (2003). Methyl jasmonate as a vital substance in plants. Trends Genet. 19: 409–413. Chory, J., Reinecke, D., Sim, S. et al. (1994). A role for cytokinins in de‐etiolation in Arabidopsis (det mutants have an altered response to cytokinins). Plant Physiol. 104: 339–347. Chou, H.M., Bundock, N., Rolfe, S.A., and Scholes, J.D. (2000). Infection of Arabidopsis thaliana leaves with Albugo candida (white blister rust) causes a reprogramming of host metabolism. Mol. Plant Pathol. 1: 99–113. Claeys, H., De Bodt, S., and Inzé, D. (2013). Gibberellins and DELLAs: central nodes in growth regulatory networks. Trends Plant Sci. https://doi.org/10.1016/j. tplants.2013.10.001. Clarke, S.M., Cristescu, S.M., Miersch, O. et al. (2009). Jasmonates act with salicylic acid to confer basal thermo tolerance in Arabidopsisthal liana. New Phytol. 182: 175–187. Colebrook, E.H., Thomas, S.G., Phillips, A.L., and Hedden, P. (2014). The role of gibberellin signalling in plant responses to abiotic stress. J. Exp. Bot. 217: 67–75. Cook, C.E., Whichard, L.P., Turner, B., and Wall, M.E. (1966). Germination of witchweed (Striga lutea Lour.): isolation and properties of a potent stimulant. Science 154: 1189–1190. Cornforth, J.W., Milborrow, B.V., and Ryback, G. (1965). Synthesis of (±)‐abscisin II. Nature 206: 715. Cortleven, A., Marg, I., Yamburenko, M.V. et al. (2016). Cytokinin regulates the etioplast‐ chloroplast transition through the two‐component signaling system and activation of chloroplast‐related genes. Plant Physiol. 172: 464–478. Daviere, J.M. and Achard, P. (2013). Gibberellin signalling in plants. Development 140: 1147–1151.

­  References

Davies, P.J. (2004). The plant hormones: Their nature, occurrence, and functions. In: Plant Hormones Biosynthesis, Signal Transduction, Action! (ed. P.J. Davies), 1–35. Kluwer Academic Publishers. Desikan, R., Last, K., Harrett‐Williams, R. et al. (2006). Ethylene‐induced stomatal closure in Arabidopsis occurs via AtrbohF‐mediated hydrogen peroxide synthesis. Plant J. 47: 907–916. Dong, W., Wang, M., Xu, F. et al. (2013). Wheat oxophytodienoate reductase gene TaOPR1 confers salinity tolerance via enhancement of abscisic acid signaling and reactive oxygen species scavenging. Plant Physiol. 161: 1217–1228. Du, H., Wang, N., Cui, F. et al. (2010). Characterization of the β‐carotene hydroxylase gene DSM2 conferring drought and oxidative stress resistance by increasing xanthophylls and abscisic acid synthesis in rice. Plant Physiol. 154: 1304–1318. Dulai, S., Molnár, I., and Molnár‐Láng, M. (2011). Changes of photosynthetic parameters in wheat/barley introgression lines during salt stress. Acta Biol. Szeged. 55: 73–75. Dunlap, J.R. and Robacker, K.M. (1990). Abscisic acid alters the metabolism of indole‐3‐ acetic acid in senescing flowers of Cucumis melo L. Plant Physiol. 94: 870–874. Ekinci, M., Yildirim, E., and Dursun, A. (2012). Mitigation of salt stress in lettuce (Lactuca sativa L. var. Crispa) by seed and foliar 24‐epibrassinolide treatments. HortScience 47: 631–636. Eklof, S., Astot, C., Blackwell, J. et al. (1997). Auxin‐cytokinin interactions in wild‐type and transgenic tobacco. Plant Cell Physiol. 38: 225–235. Fahad, S.S., Hussain, A., Matloob, F.A. et al. (2015). Phytohormones and plant responses to salinity stress: a review. Plant Growth Regul. 75: 391–404. Fariduddin, Q., Yusuf, M., Ahmad, I., and Ahmad, A. (2014). Brassinosteroids and their role in response of plants to abiotic stresses. Biol. Plant. 58: 9–17. Fediuc, E., Lips, S.H., and Erdei, L. (2005). O‐acetylserine (thiol) lyase activity in Phragmites and Typha plants under cadmium and NaCl stress conditions and the involvement of ABA in the stress response. J. Plant Physiol. 162: 865–872. Filová, A., Sytar, O., and Krivosudska, E. (2013). Effects of brassinosteroid on the induction of physiological changes in Helianthus annuus L. under copper stress. Acta Univ. Agric. Silvic. Mendel. Brun. 61: 623–629. Fitting, H. (1909). Die Beeinflussing der Orchideenblüten Durch die Bestäubung und Durch Andere Umstände. Zeitschrift für Botanik 1: 1–86. Fujita, M., Fujita, Y., Noutoshi, Y. et al. (2006). Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9: 436–442. Fujita, Y. (1996). Protochlorophyllide reduction: a key step in the greening of plants. Plant Cell Physiol. 37: 411–421. Gane, R. (1934). Production of ethylene by some ripening fruits. Nature 134: 1008. Gantait, S., Sinniah, U.R., Ali, M.N., and Sahu, N.C. (2015). Gibberellins ‐ a multifaceted hormone in plant growth regulatory network. Curr. Protein Pept. Sci. 16: 406–412. Gao, Y., Wang, S., Asami, T., and Chen, J.G. (2008). Loss‐of‐function mutations in the Arabidopsis heterotrimeric G‐protein alpha subunit enhance the developmental defects of brassinosteroid signaling and biosynthesis mutants. Plant Cell Physiol. 49: 1013–1024. Gaspar, T., Kevers, C., Faivre‐Rampant, O. et al. (2003). Changing concepts in plant hormone action. In Vitro Cell. Dev. Biol. Plant 39: 85–106.

231

232

11  Role of Plant Hormones in Photosynthesis

Ghosh, S., Kanwar, P., and Jha, G. (2017). Alterations in rice chloroplast integrity, photosynthesis and metabolome associated with pathogenesis of Rhizoctonia solani. Scientific Reports 7: 41610. https://doi.org/10.1038/srep4161. Gomathi, R. and Rakkiyapan, P. (2011). Comparative lipid peroxidation, leaf membrane thermostability, and antioxidant system in four sugarcane genotypes differing in salt tolerance. Int. J. Plant Physiol. Biochem. 3: 67–74. Gordon, S.P., Chickarmane, V.S., Ohno, C., and Meyerowitz, E.M. (2009). Multiple feedback loops through cytokinin signalling control stem cell number within the Arabidopsis shoot meristem. Proc. Natl. Acad. Sci. U.S.A. 106: 16529–16534. Govardhana, M. and Satyan, K.B. (2016). Isolation and characterization of drought‐tolerant PGPR from rhizoplane of drought prone areas and enhancement of plant growth promotion in cucumber. Acta Biol. Indica 5: 93–100. Grove, M.D., Spencer, G.F., Rohwedder, W.K. et al. (1979). Brassionlide, a plant growth‐ promoting steroid isolated from Brassica napus pollen. Nature 281: 216–217. Guan, C., Ji, J., Zhang, X. et al. (2015). Positive feedback regulation of a Lycium chinense‐ derived VDE gene by drought‐induced endogenous ABA, and over‐expression of this VDE gene improve drought‐induced photo‐damage in Arabidopsis. J. Plant Physiol. 175: 26–36. Guo, H. and Ecker, J.R. (2004). The ethylene signalling pathway: new insights. Curr. Opin. Plant Biol. 7: 40–49. Gururani, M.A., Mohanta, T.K., and Bae, H. (2015). Current understanding of the interplay between phytohormones and photosynthesis under environmental stress. Int. J. Mol. Sci. 16: 19055–19085. Haagan‐Smit, A.J., Leach, W.D., and Bergren, W.R. (1942). The estimation, isolation and identification of auxins in plant tissues. Am. J. Bot. 29: 500–506. Haisel, D., Pospíšilová, J., Synková, H. et al. (2006). Effects of abscisic acid or benzyladenine on pigment contents, chlorophyll fluorescence, and chloroplast ultrastructure during water stress and after rehydration. Photosynthetica 44: 606–614. Harpaz‐Saad, S., Azoulay, T., Arazi, T. et al. (2007). Chlorophyllase is a rate‐limiting enzyme in chlorophyll catabolism and is post translationally regulated. Plant Cell 19: 1007–1022. Hasanuzzaman, M., Hossain, M.A., da Silva, J.A., and Fujita, M. (2012). Plant response and tolerance to abiotic oxidative stress: antioxidant defense is a key factor. In: Crop Stress and its Management: Perspectives and Strategies (ed. B. Venkateswarlu, A.K. Shanker, C. Shanker and M. Maheswari), 261–315. Springer Netherlands. Hauck, C., Müller, S., and Schildknecht, H. (1992). A germination stimulant produced for parasitic flowering plants from Sorghum bicolor, a genuine host plant. J. Plant Physiol. 139: 474–478. Hauvermale, A.L., Ariizumi, T., and Steber, C.M. (2012). Gibberellin signalling: a theme and variations on DELLA repression. Plant Physiol. 160: 83–92. Hayat, S., Ali, B., Hasan, S.A., and Ahmad, A. (2007). Effect of 28‐homobrassinolide on salinity induced changes in Brassica juncea. Turk. J. Biol. 31: 141–146. Hayat, S., Hayat, Q., Alyemeni, M.N. et al. (2012). Role of proline under changing environments: a review. Plant Signal. Behav. 7: 1456–1466. Heyl, A., Werner, T., and Schmulling, T. (2006). Cytokinin metabolism and signal transduction. In: Plant Hormone Signaling (ed. P. Hedden and S.G. Thomas), 93–124. Oxford: Blackwell Publishing Ltd.

­  References

Hu, W.H., Yan, X.H., Xiao, Y.A. et al. (2013). 24‐Epibrassinosteroid alleviate drought‐ induced inhibition of photosynthesis in Capsicum annuum. Sci. Hortic. 150: 232–237. Hu, Y., Jiang, Y., Han, X. et al. (2017). Jasmonate regulates leaf senescence and tolerance to cold stress: crosstalk with other phytohormones. J. Exp. Bot. 68: 1361–1369. Hüner, N.P.A., Dahal, K., Kurepin, L.V. et al. (2014). Potential for increased photosynthetic performance and crop productivity in response to climate change: role of CBFs and gibberellic acid. Front. Chem. https://doi.org/10.3389/fchem.2014.00018. Huq, E., Al‐Sady, B., Hudson, M. et al. (2004). Phytochrome‐interacting factor 1 is a critical bHLH regulator of chlorophyll biosynthesis. Science 305: 1937–1941. Hussain, B., War, A.R., and Sharma, H.C. (2013). Jasmonic and salicylic acid‐induced resistance in sorghum against the stem borer Chilo partellus. Phytoparasitica https:// doi.org/10.1007/s12600‐013‐0343‐8. Jain, M., Tiwary, S., and Gadre, R. (2010). Sorbitol‐induced changes in various growth and biochemical parameters in maize. Plant Soil Environ. 56: 263–267. Jaleel, C.A., Manivannan, P., Lakshmanan, G.M.A. et al. (2008). Alterations in morphological parameters and photosynthetic pigment responses of Catharanthus roseus under soil water deficit. Colloids Surf., B 61: 298–303. Janeczko, A., Gruszka, D., Pociecha, E. et al. (2016). Physiological and biochemical characterisation of watered and drought‐stressed barley mutants in the HvDWARF gene encoding C6‐oxidase involved in brassinosteroid biosynthesis. Plant Physiol. Biochem. 99: 126–141. Jiang, C. and Fu, X. (2007). GA action: turning on de‐DELLA repressing signaling. Curr. Opin. Plant Biol. 10: 461–465. Jozefczak, M., Remans, T., Vangronsveld, J., and Cuypers, A. (2012). Glutathione is a key player in metal‐induced oxidative stress defences. Int. J. Mol. Sci. 13: 3145–3175. Jumali, S.S., Said, I.M., Ismail, I., and Zainal, Z. (2011). Genes induced by high concentration of salicylic acid in Mitragyna speciose. Aust J Crop Sci 5: 296. Kaewsuksaeng, S. (2011). Chlorophyll degradation in horticultural crops. Walailak J. Sci. Technol. 8: 9–19. Kang, D.J., Seo, Y.J., Lee, J.D. et al. (2005). Jasmonic acid differentially affects growth, ion uptake and abscisic acid concentration in salt‐tolerant and salt‐sensitive rice cultivars. J. Agron. Crop Sci. 191: 273–282. Kanwar, M.K., Bhardwaj, R., Chowdhary, S.P. et al. (2013). Isolation and characterization of 24‐Epibrassinolide from Brassica juncea L. and its effects on growth, Ni ion uptake, antioxidant defense of Brassica plants and in vitro cytotoxicity. Acta Physiol. Plant. 35: 1351–1362. Kazan, K. (2015). Diverse roles of jasmonates and ethylene in abiotic stress tolerance. Trends Plant Sci. 20: 219–229. Khan, M.N., Siddiqui, M.H., Mohammad, F. et al. (2010). Calcium chloride and gibberellic acid protect linseed (Linum usitatissimum L.) from NaCl stress by inducing antioxidative defence system and osmoprotectant accumulation. Acta Physiol. Plant. 32: 121–132. Kilaru, A., Bailey, B.A., and Hasenstein, K.H. (2007). Moniliophthora perniciosa produces hormones and alters endogenous auxin and salicylic acid in infected cocoa leaves. FEMS Microbiol. Lett. 274: 238–244. Kim, S.K., Chang, S.C., Lee, E.J. et al. (2000). Involvement of brassinosteroids in the gravitropic response of primary root of maize. Plant Physiol. 123: 997–1004.

233

234

11  Role of Plant Hormones in Photosynthesis

Klinger, J.P., Batelli, G., and Zhu, J.K. (2010). ABA receptors: the START of a new paradigm in phytohormone signalling. J. Exp. Bot. 61: 3199–3210. Kobayashi, K., Ohnishi, A., Sasaki, D. et al. (2017). Shoot removal induces chloroplast development in roots via cytokinin signaling. Plant Physiol. 173: 2340–2355. Kocal, N., Sonnewald, U., and Sonnewald, S. (2008). Cell wall‐bound invertase limits sucrose export and is involved in symptom development and inhibition of photosynthesis during compatible interaction between tomato and Xanthomonas campestris pv vesicatoria. Plant Physiol. 148: 1523–1536. Kohlen, W., Charnikhova, T., Liu, Q. et al. (2011). Strigolactones are transported through the xylem and play a key role in shoot architectural response to phosphate deficiency in nonarbuscular mycorrhizal host Arabidopsis. Plant Physiol. 155: 974–987. Kombrink, E. (2012). Chemical and genetic exploration of jasmonate biosynthesis and signaling paths. Planta 236: 1351–1366. Kudo, T., Kiba, T., and Sakakibara, H. (2010). Metabolism and long‐distance translocation of cytokinins. J. Integr. Plant Biol. 52: 53–60. Kulaeva, O.N. and Prokoptseva, O.S. (2004). Recent advances in the study of mechanisms of action of phytohormones. Biochemistry (Mosc) 69: 233–247. Kumudini, B.S., Jayamohan, N.S., and Patil, S.V. (2017). Integrated mechanisms of plant disease containment by rhizospheric bacteria: unravelling the signal crosstalk between plant and fluorescent Pseudomonas. In: Agriculturally Important Microbes for Sustainable Agriculture (ed. V.S. Meena, P.K. Mishra, J.K. Bisht and A. Pattanayak), 263–291. Singapore: Springer Nature. Kumudini, B.S., Jayamohan, N.S., Patil, S.V., and Govardhana, M. (2018). Primary plant metabolism during plant‐pathogen interactions and its role in defense. In: Plant Metabolites and Regulation under Environmental Stress (ed. P. Ahmad, M.A. Ahanger, V.P. Singh, et al.), 215–229. Elsevier: Academic Press. Küpper, H., Götz, B., Mijovilovich, A. et al. (2009). Complexation and toxicity of copper in higher plants. I. Characterization of copper accumulation, speciation, and toxicity in Crassula helmsii as a new copper accumulator. Plant Physiol. 151: 702–714. Lawlor, D.W. (2001). Photosynthesis, 3e. Oxford: Scientific Publishers Limited. Leon, J. (2013). Role of plant peroxisomes in the production of jasmonic acid‐based signals. Subcell. Biochem. 69: 299–313. Letham, D.S. (1963). Zeatin, a factor inducing cell division from Zea mays. Life Sci. 8: 569–573. Li, J., Li, C., and Smith, S.M. (eds.) (2017). Hormone Metabolism and Signaling in Plants. Elsevier. Li, T., Zhang, Y., Liu, H. et al. (2010). Stable expression of Arabidopsis vacuolar Na+/H+ antiporter gene AtNHX1 and salt tolerance in transgenic soybean for over six generations. Chin. Sci. Bull. 55: 1127–1134. Li, Y.H., Liu, Y.J., Xu, X.L. et al. (2012). Effect of 24‐epibrassinolide on drought stress‐ induced changes in Chorispora bungeana. Biol. Plant. 56: 192–196. Liu, S., Dong, Y., Xu, L., and Kong, J. (2014). Effects of foliar applications of nitric oxide and salicylic acid on salt‐induced changes in photosynthesis and antioxidative metabolism of cotton seedlings. Plant Growth Regul. 73: 67–78. Liu, X., Li, Y., and Zhong, S. (2017). Interplay between light and plant hormones in the control of Arabidopsis seedling chlorophyll biosynthesis. Front. Plant Sci. https://doi. org/10.3389/fpls.2017.01433.

­  References

Lohaus, G., Heldt, H.W., and Osmond, C.B. (2000). Infection with phloem limited Abutilon mosaic virus causes localized carbohydrate accumulation in leaves of Abutilon striatum: relationships to symptom development and effects on chlorophyll fluorescence quenching during photosynthetic induction. Plant Biol. 2: 161–167. Luo, X.M., Lin, W.H., Zhu, S. et al. (2010). Integration of light and brassinosteroid‐ signaling pathways by a GATA transcription factor in Arabidopsis. Dev. Cell 19: 872–883. MacMillan, J. and Suter, P.J. (1958). The occurrence of gibberellin A1 in higher plants: isolation from the seed of runner bean (Phaseolus multiflorus). Naturwissenschaften 45: 46. Maksymiec, W., Wianowska, D., Dawidowicz, A.L. et al. (2005). The level of jasmonic acid in Arabidopsis thaliana and Phaseolus coccineus plants under heavy metal stress. J. Plant Physiol. 162: 1338–1346. Mandava, N.B. (1988). Plant growth promoting brassinosteroids. Ann. Rev. Plant Physiol. Plant Mol. Biol. 39: 23–52. Masood, A., Iqbal, N., and Khan, N.A. (2012). Role of ethylene in alleviation of cadmium‐ induced photosynthetic capacity inhibition by sulfur in mustard. Plant Cell Environ. 35: 524–533. Meidner, H. (1985). Historical sketches 6. J. Exp. Bot. 36: 1017–1018. Mok, D.W.S. and Mok, M.C. (1994). Cytokinins: Chemistry, Activity and Function. Boca Raton, FL: CRC Press. Monteiroa, C., Carvalhoa, R.F., Grataoa, P.L. et al. (2011). Biochemical responses of the ethylene‐insensitive never ripe tomato mutant subjected to cadmium and sodium stresses. Environ. Exp. Bot. 71: 306–320. Morris, D.A., Friml, J., and Zažímalová, E. (2004). The functioning of hormones in plant growth and development. In: Plant Hormones Biosynthesis, Signal Transduction, Action! (ed. P.J. Davies), 437–470. Kluwer Academic Publishers. Nawaz, K., Hussain, K., Majeed, A. et al. (2010). Fatality of salt stress to plants: morphological physiological and biochemical aspects. Afr. J. Biotechnol. 9: 5475–5480. Nazar, R., Khan, M.I.R., Iqbal, N. et al. (2014). Involvement of ethylene in reversal of salt‐inhibited photosynthesis by sulfur in mustard. Physiol. Plant. 152: 331–344. Nazar, R., Umar, S., Khan, N.A., and Sareer, O. (2015). Salicylic acid supplementation improves photosynthesis and growth in mustard through changes in proline accumulation and ethylene formation under drought stress. S. Afr. J. Bot. 98: 84–94. Nishma, K.S., Adrisyanti, B., Anusha, S.H. et al. (2014). Induced growth promotion under in vitro salt stress tolerance on Solanum lycopersicum by fluorescent pseudomonads associated with rhizosphere. Int. J. Appl. Sci. Eng. Res. 3: 422–430. Nitsch, L.M.C., Oplaat, C., Feron, R. et al. (2009). Abscisic acid levels in tomato ovaries are regulated by LeNCED1 and SlCYP707A1. Planta 229: 1335–1346. Nordstrom, A., Tarkowski, P., Tarkowska, D. et al. (2004). Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin‐ cytokinin‐regulated development. Proc. Natl. Acad. Sci. U.S.A. 101: 8039–8044. Normanly, J., Slovin, J.P., and Cohen, J.D. (2004). Hormone biosynthesis, metabolism and its regulation. In: Plant Hormones Biosynthesis, Signal Transduction, Action! (ed. P.J. Davies), 36–62. Kluwer Academic Publishers. Nunes‐Nesi, A., Sulpice, R., Gibon, Y., and Fernie, A.R. (2008). The enigmatic contribution of mitochondrial function in photosynthesis. J. Exptl. Bot. 59: 1675–1684.

235

236

11  Role of Plant Hormones in Photosynthesis

op den Camp, R.G.L., Przybyla, D., Ochsenbein, C. et al. (2003). Rapid induction of distinct stress responses after therelease of singlet oxygen in Arabidopsis. Plant Cell 15: 2320–2332. Ouzounidou, G. and Ilias, I. (2005). Hormone‐induced protection of sunflower photosynthetic apparatus against copper toxicity. Biol. Plantarum 49: 223–228. Pan, J., Lin, S., and Woodbury, N.W. (2012). Bacteriochlorophyll excited‐state quenching pathways in bacterial reaction centers with the primary donor oxidized. J. Phys. Chem. B 116: 2014–2022. Pandey, A., Sharma, M., and Pandey, G.K. (2016). Emerging roles of strigolactones in plant responses to stress and development. Front. Plant Sci. https://doi.org/10.3389/ fpls.2016.00434. Patil, S.V., Jayamohan, N.S., and Kumudini, B.S. (2016). Strategic assessment of multiple plant growth promotion traits for shortlisting of fluorescent Pseudomonas spp. and seed priming against ragi blast disease. Plant Growth Regul. https://doi.org/10.1007/ s10725‐016‐0171‐1. Paul, M.J. and Foyer, C.H. (2001). Sink regulation of photosynthesis. J. Exptl. Bot. 52: 1383–1400. Peleg, Z. and Blumwald, E. (2011). Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol. 14: 290–295. Per, T.S., Khanb, M.I.R., Anjuma, N.A. et al. (2018). Jasmonates in plants under abiotic stresses: crosstalk with other phytohormones matters. Environ. Exp. Bot. 145: 104–120. Perez‐Bueno, M.L., Ciscato, M., VandeVen, M. et al. (2006). Imaging viral infection: studies on Nicotiana benthamiana plants infected with the pepper mild mottle tobamovirus. Photosynth. Res. 90: 111–123. Perveen, S., Shahbaz, M., and Ashraf, M. (2010). Regulation in gas exchange and quantum yield of photosystem II (PSII) in salt‐stressed and non‐stressed wheat plants raised from seed treated with triacontanol. Pak. J. Bot. 42: 3073–3081. Pierik, R., Tholen, D., Poorter, H. et al. (2006). The Janus face of ethylene: growth inhibition and stimulation. Trends Plant Sci. 11: 176–183. Pieterse, C.M.J., Van der Does, D., Zamioudis, C. et al. (2012). Hormonal modulation of plant immunity. Annu. Rev. Cell Dev. Biol. 28: 489–521. Pinheiro, C., Antonio, C., Ortuno, M.F. et al. (2011). Initial water deficit effects on Lupinus albus photosynthetic performance, carbon metabolism, and hormonal balance: metabolic reorganization prior to early stress responses. J. Exp. Bot. 62: 4965–4974. Pinheiro, H.A., Silva, J.V., Endres, L. et al. (2008). Leaf gas exchange, chloroplastic pigments and dry matter accumulation in castor bean (Ricinus communis L.) seedlings subjected to salt stress conditions. Ind. Crops Prod. 27: 385–392. Pirbalouti, G.A., Sajjadi, S.E., and Parang, K. (2014). A review (research and patents) on jasmonic acid and its derivatives. Arch. Pharm. 347: 229–239. Prasad, K.V.S.K. and Saradhi, P.P. (2004). Enhanced tolerance to photoinhibition in transgenic plants through targeting of glycinebetaine biosynthesis into the chloroplasts. Plant Sci. 166: 1197–1212. Prasad, S.M., Dwivedi, R., and Zeeshan, M. (2005). Growth, photosynthetic electron transport, and antioxidant responses of young soybean seedlings to simultaneous exposure of nickel and UV‐B stress. Photosynthetica 43: 177–185. Qiu, Z., Guo, J., Zhu, A. et al. (2014). Exogenous jasmonic acid can enhance tolerance of wheat seedlings to salt stress. Ecotoxicol. Environ. Saf. 104: 202–208.

­  References

Rady, M.M. (2011). Effect of 24‐epibrassinolide on growth, yield, antioxidant system and cadmium content of bean (Phaseolus vulgaris L.) plants under salinity and cadmium stress. Sci. Hortic. 129: 232–237. Rajala, A. and Peltonen‐Sainio, P. (2001). Plant growth regulator effects on spring cereal root and shoot growth. Agron. J. 93: 936–943. Reinbothe, C., El Bakkouri, M., Buhr, F. et al. (2010). Chlorophyll biosynthesis: spotlight on protochlorophyllide reduction. Trends Plant Sci. 15: 614–624. Rivero, R.M., Gimeno, J., van Deynze, A. et al. (2010). Enhanced cytokinin synthesis in tobacco plants expressing PSARK: IPT prevents the degradation of photosynthetic protein complexes during drought. Plant Cell Physiol. 51: 1929–1941. Robert‐Seilaniantz, A., Navarro, L., Bari, R., and Jones, J.D. (2007). Pathological hormone imbalances. Curr. Opin. Plant Biol. 10: 372–379. Santner, A. and Estelle, M. (2009). Recent advances and emerging trends in plant hormone signalling. Nature 459: 1071–1078. Scholes, J.D. and Rolfe, S.A. (1996). Photosynthesis in localised regions of oat leaves infected with crown rust (Puccinia coronata): quantitative imaging of chlorophyll fluorescence. Planta 199: 573–558. Screpanti, C., Fonné‐Pfister, R., Lumbroso, A. et al. (2016). Strigolactone derivatives for potential crop enhancement applications. Bioorg. Med. Chem. Lett. 26: 2392–2400. Selvaraj, K. and Fofana, B. (2012). An overview of plant photosynthesis modulation by pathogen attacks. In: Advances in Photosynthesis – Fundamental Aspects (ed. M. Najafpour). IntechOpen. ISBN: 978‐953‐307‐928‐8. Seo, H.S., Song, J.T., Cheong, J.J. et al. (2001). Jasmonic acid carboxyl methyltransferase: A key enzyme for jasmonate‐regulated plant responses. Proc. Natl. Acad. Sci. USA 98: 4788–4793. Seo, J.S., Joo, J., Kim, M.J. et al. (2011). OsbHLH148, a basic helix‐loop‐helix protein, interacts with OsJAZ proteins in a jasmonate signaling pathway leading to drought tolerance in rice. Plant J. 65: 907–921. Sethia, B., Mustafa, M., Manohar, S. et al. (2015). Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences. Indian J. Exp. Biol. 53: 342–349. Shah, S.H. (2007). Effects of salt stress on mustard as affected by gibberellic acid application. Gen. Appl. Plant Physiol. 33: 97–106. Shao, R., Wang, K., and Shangguan, Z. (2010). Cytokinin‐induced photosynthetic adaptability of Zea mays L. to drought stress associated with nitric oxide signal: probed by ESR spectroscopy and fast OJIP fluorescence rise. J. Plant Physiol. 167: 472–479. Sharma, I., Pati, P.K., and Bhardwaj, R. (2011). Effect of 24‐epi‐brassinolide on oxidative stress markers induced by nickel‐ ion in Raphanus sativus L. Acta Physiol. Plant. 33: 1723–1735. Sharp, R.E. (2002). Interaction with ethylene: changing views on the role of abscisic acid in root and shoot growth responses to water stress. Plant Cell Environ. 25: 211–222. Siddiqui, H., Hayat, S., and Bajguz, A. (2018). Regulation of photosynthesis by brassinosteroids in plants. Acta Physiol. Plant. https://doi.org/10.1007/ s11738‐018‐2639‐2. Skoog, F. and Miller, C.O. (1957). Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp. Soc. Exp. Biol. 11: 118–131.

237

238

11  Role of Plant Hormones in Photosynthesis

Sofo, A., Dichio, B., Xiloyannis, C., and Masia, A. (2005). Antioxidant defences in olive trees during drought stress: changes in activity of some antioxidant enzymes. Funct. Plant Biol. 32: 45–53. Somssich, I.E. and Hahlbrock, K. (1998). Pathogen defence in plants–a paradigm of biological complexity. Trends Plant Sci. 3: 86–90. Sorokan, A.V., Burkhanova, G.F., and Maksimov, I.V. (2013). The interplay between salicylic and jasmonic acid during phytopathogenesis. In: Salicylic acid (ed. S. Hayat and A. Ahmad). Dordrecht: Springer. Subramanian, J. and Satyan, K. (2014). Isolation and selection of fluorescent pseudomonads based on multiple plant growth promotion traits and siderotyping. Chil. J. Agr. Res. 74: 319–325. Sun, Y., Fan, X.Y., Cao, D.M. et al. (2010). Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis. Dev. Cell 19: 765–777. Swarbrick, P.J., Schulze‐Lefert, P., and Scholes, J.D. (2006). Metabolic consequences of susceptibility and resistance (race‐specific and broad‐spectrum) in barley leaves challenged with powdery mildew. Plant Cell Environ. 29: 1061–1076. Taiz, L. and Zeiger, E. (2010). Plant Physiology, 5e. Sunderland: Sinauer Associates. Takahashi, N., Phinney, B.O., and MacMillan, J. (1991). Gibberellins. New York: Springer‐Verlag. Tamaoki, D., Seo, S., Yamada, S. et al. (2013). Jasmonic acid and salicylic acid activate a common defense system in rice. Plant Signal Behav. 8 (6): e24260. Tanaka, R., Kobayashi, K., and Masuda, T. (2011). Tetrapyrrole metabolism in Arabidopsis thaliana. Arabidopsis Book https://doi.org/10.1199/tab.0145. Tanaka, Y., Sano, T., Tamaoki, M. et al. (2005). Ethylene inhibits abscisic acid‐induced stomatal closure in Arabidopsis. Plant Physiol. 138: 2337–2343. Thompson, A.J., Jackson, A.C., Symonds, R.C. et al. (2000). Ectopic expression of a tomato 9‐cis‐epoxycarotenoid dioxygenase gene causes over‐production of abscisic acid. Plant J. 23: 363–374. Tognetti, V.B., van Aken, O., Morreel, K. et al. (2010). Perturbation of indole‐3‐butyric acid homeostasis by the UDP‐glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell 22: 2660–2679. Tonelli, M.L., Furlan, A., Taurian, T. et al. (2011). Peanut priming induced by biocontrol agents. Physiol. Mol. Plant Pathol. 75: 100–105. Trewavas, A.J. and Cleland, R.E. (1983). Is plant development regulated by changes in the concentration of growth substances or by changes in the sensitivity to growth substances? Trends Biochem. Sci. 8: 354–357. Turkan, I. and Demiral, T. (2009). Recent developments in understanding salinity tolerance. Environ. Exp. Bot. 67: 2–9. Ueda, J. and Kato, J. (1980). Isolation and identification of a senescence‐promoting substance from wormwood Artemisia absinthium L. Plant Physiol. 66: 246–249. Van Ha, C., Leyva‐González, M.A., Osakabe, Y. et al. (2014). Positive regulatory role of strigolactone in plant responses to drought and salt stress. Proc. Natl. Acad. Sci. U.S.A. 111: 851–856. Vandenbussche, F., Habricot, Y., Condiff, A.S. et al. (2007). HY5 is a point of convergence between cryptochrome and cytokinin signalling pathways in Arabidopsis thaliana. Plant J. 49: 428–441.

­  References

Vardhini, B.V. (2014). Brassinosteroids role for amino acids, peptides and amines modulation in stressed plants – a review. In: Plant Adaptation to Environmental Change: Significance of Amino Acids and their Derivatives (ed. N.A. Anjum, S.S. Gill and R. Gill), 300–316. Wallingford: CAB International. Varsha, T. and Kumudini, B.S. (2016). Fluorescent Pseudomonas mediated alleviation of trivalent chromium toxicity in ragi through enhanced antioxidant activities. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. https://doi.org/10.1007/s40011‐016‐0816‐x. Verma, V., Ravindran, P., and Kumar, P.P. (2016). Plant hormone‐mediated regulation of stress responses. BMC Plant Biol. https://doi.org/10.1186/s12870‐016‐0771‐y. Vicente, M.R. and Plasencia, J. (2011). Salicylic acid beyond defence: its role in plant growth and development. J. Exp. Bot. 62: 3321–3338. Vysotskaya, L., Wilkinson, S., Davies, W.J. et al. (2011). The effect of competition from neighbours on stomatal conductance in lettuce and tomato plants. Plant Cell Environ. 34: 729–737. Wang, L.J., Fan, L., Loescher, W. et al. (2010). Salicylic acid alleviates decreases in photosynthesis under heat stress and accelerates recovery in grapevine leaves. BMC Plant Biol. https://doi.org/10.1186/1471‐2229‐10‐34. Wang, Y.H. and Irving, H.R. (2011). Developing a model of plant hormone interactions. Plant Signalling Behav. 6: 494–500. Wani, S.H., Kumarb, V., Shriramc, V., and Sah, S.K. (2016). Phytohormones and their metabolic engineering for abiotic stress tolerance in crop plants. Crop J. 4: 162–176. Wasilewska, A., Vlad, F., Sirichandra, C. et al. (2008). An update on abscisic acid signaling in plants and more…. Mol. Plant 1: 198–217. Wasternack, C. and Strnad, M. (2016). Jasmonate signaling in plant stress responses and development–active and inactive compounds. New Biotechnol. 33: 604–613. Went, F.W. and Thimann, K.V. (1937). Phytohormones. New York: The MacMillan Co. Werner, T., Motyka, V., Strnad, M., and Schmulling, T. (2001). Regulation of plant growth by cytokinin. Proc. Natl. Acad. Sci. U.S.A. 98: 10487–10492. Weyers, J.D.B. and Paterson, N.W. (2001). Plant hormones and the control of physiological processes. New Phytol. 152: 375–407. Wi, S.J., Jang, S.J., and Park, K.Y. (2010). Inhibition of biphasic ethylene production enhances tolerance to abiotic stress by reducing the accumulation of reactive oxygen species in Nicotiana tabacum. Mol. Cells 30: 37–49. Wilkinson, S. and Davies, W.J. (2009). Ozone suppresses soil drying‐ and abscisic acid (ABA)‐induced stomatal closure via an ethylene‐ dependent mechanism. Plant Cell Environ. 32: 949–959. Wilkinson, S., Kudoyarova, G.R., Veselov, D.S. et al. (2012). Plant hormone interactions: Innovative targets for crop breeding and management. J. Exp. Bot. 63: 3499–3509. Winicov, I. and Seemann, J.R. (1990). Expression of genes for photosynthesis and the relationship to salt tolerance of Alfalfa (Medicago sativa) cells. Plant Cell Physiol. 31: 1155–1161. Woodward, A.W. and Bartel, B. (2005). Auxin regulation, action and interaction. Ann. Bot. 95: 707–735. Xia, X., Zhou, Y., Shi, K. et al. (2015). Interplay between reactive oxygen species and hormones in the control of plant development and stress tolerance. J. Exp. Bot. 66: 2839–2856.

239

240

11  Role of Plant Hormones in Photosynthesis

Xin, Z., Zhao, Y., and Zheng, Z.L. (2005). Transcriptome analysis reveals specific modulation of abscisic acid signaling by ROP10 small GTPase in Arabidopsis. Plant Physiol. 139: 1350–1365. Yamaguchi, S. (2008). Gibberellin metabolism and its regulation. Annu. Rev. Plant Biol. 59: 225–251. Yang, D.L., Li, Q., Deng, Y. et al. (2008). Altered disease development in the eui mutants and Eui overexpressors indicates that gibberellins negatively regulate rice basal disease resistance. Mol. Plant. 1: 528–537. Yang, J.Y., Zheng, W., Tian, Y. et al. (2011). Effects of various mixed salt‐alkaline stresses on growth, photosynthesis, and photosynthetic pigment concentrations of Medicago ruthenica seedlings. Photosynthetica 49: 275–284. Yang, S.F. and Hoffman, N.E. (1984). Ethylene biosynthesis and its regulation in higher plants. Annu. Rev. Plant Physiol. 35: 155–189. Yu, J.Q., Huang, L.F., Hu, W.H. et al. (2004). A role for brassinosteroids in the regulation of photosynthesis in Cucumis sativus. J. Exp. Bot. 55: 1135–1143. Yuan, G.F., Jia, C.G., Li, Z. et al. (2010). Effect of brassinosteroids on drought resistance and abscisic acid concentration in tomato under water stress. Sci. Hortic. 126: 103–108. Yusuf, M., Fariduddin, Q., and Ahmad, A. (2012). 24‐Epibrassinolide modulates growth, nodulation, antioxidant system, and osmolyte in tolerant and sensitive varieties of Vigna radiata under different levels of nickel: a shotgun approach. Plant Physiol. Biochem. 57: 143–153. Yusuf, M., Fariduddin, Q., Hayat, S. et al. (2010). Protective response of 28‐ Homobrassinolide in cultivars of Triticum aestivum with different levels of nickel. Arch. Environ. Contam. Toxicol. 60: 68–76. Yusuf, M., Hasan, S.A., Ali, B. et al. (2008). Effect of salicylic acid on salinity‐induced changes in Brassica juncea. J. Integr. Plant Biol. 50: 1096–1102. Zayed, A.M. and Terry, N. (2003). Chromium in the environment: factors affecting biological remediation. Plant Soil 249: 139–156. Zhang, M.C., Zhai, Z.X., Tian, X.L. et al. (2008). Brassinolide alleviated the adverse effect of water deficits on photosynthesis and the antioxidant of soybean (Glycine max L.). Plant Growth Regul. 56: 257–264. Zhao, Y., Dong, W., Zhang, N. et al. (2014). A wheat allene oxide cyclase gene enhances salinity tolerance via jasmonate signaling. Plant Physiol. 164: 1068–1076. Zhong, S., Shi, H., Xue, C. et al. (2014). Ethylene‐orchestrated circuitry coordinates a seedling’s response to soil cover and etiolated growth. Proc. Natl. Acad. Sci. U.S.A. 111: 3913–3920. Zhu, J.K. (2002). Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53: 247–273. Zhu, S.Q., Chen, M.W., Ji, B.H. et al. (2011). Roles of xanthophylls and exogenous ABA in protection against NaCl‐induced photodamage in rice (Oryza sativa L.) and cabbage (Brassica campestris). J. Exp. Bot. 62: 4617–4625. Zwanenburg, B. and Pospíšil, T. (2013). Structure and activity of strigolactones: new plant hormones with a rich future. Mol. Plant 6: 38–62. Zwanenburg, B., Pospisil, T., and Zeljkovic, S.C. (2016). Strigolactones: new plant hormones in action. Planta 243: 1311–1326.

241

12 Promising Monitoring Techniques for Plant Science: Thermal and Chlorophyll Fluorescence Imaging Aykut Saglam1, Laury Chaerle2, Dominique Van Der Straeten2, and Roland Valcke3 1

Department of Molecular Biology and Genetics, Karadeniz Technical Univeristy, Trabzon, Turkey Department of Physiology, Laboratory of Functional Plant Biology, Ghent University, K. L. Ledeganckstraat, Ghent Belgium 3 Laboratory of Molecular and Physical Plant Physiology, Faculty of Sciences, Hasselt University, Diepenbeek, Belgium 2

­Abbreviations AFPs antifreeze proteins ai active ingredient HR hypersensitive response Chl‐FI chlorophyll fluorescence imaging DCMU 3‐(3,4‐dichlorophenyl)‐1,1‐dimethylurea qE energy dependent non‐photochemical quenching IR infrared IRGA infrared gas analysis NPQ non‐photochemical quenching ΦPSII photochemical yield of photosystem ΙΙ PsbS photosystem II subunit S Gs stomatal conductance TMV tobacco mosaic virus

12.1 ­Introduction Plants are exposed to a variety of environmental stresses that can occur simultaneously; major stress factors being infection, herbivory, temperature (heat or cold), water (drought of flooding), radiation (visible or UV), chemical stress (mineral salts or pollutants), mechanical stress (wind or soil movements), and electrical or magnetic fields. Moreover, stresses in general have additive and interactive effects. The ability of plants to resist these stresses simultaneously can be an important factor in plant growth and survival in a stressful environment (Borges and Sandalio 2015). Photosynthesis, Productivity, and Environmental Stress, First Edition. Edited by Parvaiz Ahmad, Mohammad Abass Ahanger, Mohammed Nasser Alyemeni, and Pravej Alam © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

242

12  Promising Monitoring Techniques

The research field of “stress imaging” aims to develop and apply a monitoring system integrating techniques that can be used for both early stress diagnosis and for analysis of plant health. Analyzing and understanding dynamic processes at the whole plant level require methods that permit to quantify parameters within a functional and intact system (McAusland et al. 2013). Recent major steps forward in understanding spatial and temporal changes in photosynthesis and transpiration in plants displaying stress responses are linked to the increasing application of non‐contact methods to quantify heterogeneity in the response of parameters linked to these two key plant physiological processes. Progress in imaging techniques permits us to visualize spatial and temporal plant responses to various stresses, which cannot be readily revealed by randomly chosen point measurements (Humplík et al. 2015). In particular, at the level of an intact leaf, thermal imaging and chlorophyll fluorescence imaging techniques are widely used to assess heterogeneity in plant responses. In this review, thermal and chlorophyll fluorescence imaging techniques and their potential applications to stress detection and monitoring are discussed. First, thermal imaging and its diverse applications will be reviewed. Thereafter chlorophyll fluorescence imaging will be presented as a method to visualize different environmental stresses.

12.2 ­Thermal Imaging All objects spontaneously emit infrared radiation in proportion to their surface temperature. Thermography is defined as the technique of measuring the emitted infrared radiation and displaying this information as a visual color or grayscale intensity image. The infrared (IR) spectrum consist of the near IR (0.75–3 μm), middle IR (3–6 μm), far IR (6–15 μm), and extreme IR (15–30 μm) spectral regions. A portable or handheld thermal imager captures either the middle (Short Wave detector: SW) or the far IR (Long Wave detector: LW) portion of this radiated energy and provides a calibrated temperature representation. By combining infrared sensing and computer technologies, thermograms (heat pictures) are generated, which clearly visualize temperature differences (Iyer et al. 2002). Thermal infrared energy is invisible for the human eye, because its wavelength is too long to be detected (Esmaeili et al. 2016). Thermal radiation is the part of the electromagnetic spectrum that we perceive as heat. In the infrared world, everything with a temperature above absolute zero emits heat. The higher the object’s temperature, the higher the amount of IR radiation emitted. Infrared imaging thus allows us to detect information that our eyes cannot reveal. Thermal imaging monitors temperature distribution at the plant level. Leaf temperature measured using thermography provides a powerful monitoring tool for physiological changes upon infection, abiotic stress, or mechanical destruction of the leaf tissue. The basis underlying most uses of leaf temperature as a monitoring tool is that leaf temperature is strongly affected by transpiration, which itself is primarily regulated by stomatal conductance, with leaf temperature increasing as transpiration rate decreases (Jones 2004). Leaf temperature is a particularly sensitive indicator of changes in stomatal conductance because latent heat loss is a large component of the overall leaf energy balance that determines leaf temperature (Jones 1992). Current thermal camera models

12.2  Thermal Imaging

commonly have a temperature resolution of 0.1 °C, which is adequate to reveal transpirational changes or heterogeneity at the leaf surface (Al‐doski et al. 2016). Spatial resolution, however, is rather limited in comparison with the currently available cameras for the visual spectrum, but proved to be sufficient for leaf to plant level monitoring, and can be compensated for by automation approaches in which multiple images are captured (Chaerle et al. 2007a). In the following subsections, thermal imaging system and its applications on environmental stresses will be discussed. An infrared thermal imaging system is comprised of a thermal camera equipped with infrared detectors, a signal processing unit, and an image acquisition system, usually a computer. The infrared detectors absorb the infrared energy emitted by the object and convert it into an electrical signal. The electrical signal is sent to the signal processing unit which translates the information into a thermal image. Most of the thermal imaging devices scan at a rate of 30 times per second and can sense temperatures ranging from −20 to 1500 °C, but the temperature range can still be increased by using filters (Meola and Carlomagno 2004). Detectors are the most important part of a thermal imaging system, which convert the radiant energy into electrical signals proportional to the amount of radiation falling on them. There are two types of detectors: thermal and photon detectors. In thermal detectors, infrared radiation heats up the detector element resulting in a temperature rise, which is taken as a measure of the radiation falling on the object. In photon detectors, incident radiation interacts at an atomic or molecular level with the material of the detector to produce charge carriers that generate a voltage across the detector element or a change in its electrical resistance. The various types of photon detectors used are cadmium mercury telluride (CMT), indium antimonide, platinum silicide, and quantum well devices. Among the two types, photon detectors provide greater sensitivity than thermal detectors (Rogalski 2012). Thermal imaging devices can be classified into uncooled and cooled. The uncooled thermal imaging device is the most common one and the infrared detector elements are contained in a unit that operates at room temperature. They are less expensive, but their resolution and image quality tend to be lower than the cooled device. In the cooled thermal imaging device, the sensor elements are contained in a unit which is maintained below 0 °C. They have a very high resolution and can detect temperature difference as low as 0.1 °C but they are expensive. Cooled thermal imaging devices are used in military and aerospace applications. An infrared imaging system is evaluated based on thermal sensitivity, scan speed, image resolution, and intensity resolution. 12.2.1  Plant Water Status and Drought Stress The recognition that leaf temperature tends to increase when plants are under drought stress and stomata close (Raschke 1960), led to a major effort in the 1970s and 1980s to develop thermal plant stress sensing methods, based on the newly developed non‐­ imaging infrared thermometers (Jackson 1982). The alternative approach, using a ­thermal imaging method was able to reveal temperature changes in leaves under water stress (Hashimoto et al. 1984). Continuous determination of canopy stomatal conductance based on leaf surface temperature as recorded by thermography is shown to be within  reach, when the environmental factors implicated in stomatal regulation are determined in parallel (Guilioni et al. 2008; Blonquist et al. 2009). The effect of heat and

243

244

12  Promising Monitoring Techniques

drought on stomatal behavior of 2–4‐week‐old legumes, bean (Phaseolus vulgaris L.) and red clover (Trifolium pratense L.), was investigated (Reynolds‐Henne et al. 2010). Drought stress was induced by complete water deficit or with polyethylene glycol (PEG) and abscisic acid (ABA) application to mimic plant drought response. Heat stress was simulated by a heated water bath (leaf segments) and infrared and halogen lighting (whole plants). Stomatal opening was either measured directly or determined using thermal imaging as a proxy. At high photosynthetically active radiation (PAR), drought and moderate heat caused increased leaf temperatures and temperature oscillations (±3–4 °C), attributed to the opening and closing of stomata. At low PAR, heat led to leaf temperature oscillations in control plants, whereas the application of drought caused stomatal closure, increasing the leaf temperature to 39 °C. This study helps to illustrate stomatal plasticity and the interplay between leaf gas‐exchange and maintaining favorable metabolic conditions (water status and temperature) within the leaf. Ballester et al. (2013) conducted an experiment to predict the effect of water deficit stress on fresh fruit weight at harvest in Clementina de Nules citrus trees by comparing sap flow and canopy temperature (Tc) measurements with more classical methods like stem water potential (Ψs) or Gs. They have suggested that Tc was correlated with fruit weight better than s and Gs. In addition, sap flow and canopy temperature could be used as water stress indicators in citrus orchards. Moreover, canopy monitoring by thermal imaging was found to be a useful tool to avoid exceeding plant water stress levels in citrus trees under deficit stress. In addition, thermal imaging allowed the measurement of a high number of trees and the integration of a large number of leaves in the measurement. Different subtropical maize genotypes were screened by thermal imaging with respect to their tolerance to water stress (Romano et al. 2011). Thermal images of the canopy of 92 different maize genotypes were acquired on two different days in the time interval between anthesis and blister stages (grain filling), whereby each picture contained five  plots of different genotypes and canopy temperatures calculated for each plot. Significantly, lower canopy temperatures were found in well‐watered genotypes compared with water‐stressed genotypes. Furthermore, significant differences between genotypes under water stress were detected using thermal images. It may be concluded that genotypes better adapted to drought conditions exhibited lower temperatures. In conclusion, thermography can be applied for studying plant–water relations at water shortage (Figure 12.1). (a)

(b)

25.1°C 25 24 23 22 21

23.4 °C

23.6 °C

20 19.8°C

Figure 12.1  Thermal and color visual images of Ctenanthe setosa exposed to water deficit stress for 30 days. In panel (a) and (b), the plant on the left is well‐watered and the plant on the right is not given water for 30 days. (See color plate section for the color representation of this figure.)

12.2  Thermal Imaging

12.2.2  Salt Stress The potential of thermal imaging was utilized for the screening of large numbers of genotypes varying for stomatal traits, specifically those related to salt tolerance (Sirault et al. 2009). There was a strong curvilinear relationship between direct measurements of stomatal conductance and leaf temperature of barley (Hordeum vulgare L.) grown in a range of salt concentrations. This indicated that thermography accurately reflected the physiological status of salt‐stressed barley seedlings. 12.2.3  Herbicide Stress The herbicide DCMU (3‐(3,4‐dichlorophenyl)‐1,1‐dimethylurea) is typically used in conjunction with chlorophyll fluorescence imaging, to reveal its blocking action on photosynthetic electron transport, as it is being taken up by the transpiration stream and gradually transported into the leaf. Using thermal imaging, Messinger et al. (2006) have assessed the distribution of stomatal conductance in response to DCMU treatment and observed that the areas affected by DCMU displayed higher temperatures due to low conductance as a result of reduced evaporative heat loss. This finding further added to the evidence that the rate of photosynthetic electron transport is implicated in the stomatal response to the intercellular CO2 concentration. Effects of photosystem II (PSII)‐inhibiting herbicide diuron (DCMU) on tobacco was studied by thermal imaging (Chaerle et al. 2003). DCMU was applied as droplets on the tobacco leaf surface. Immediately after topical application of diuron droplets on the adaxial side of a tobacco leaf, a local increase in leaf surface temperature at the site of treatment was visualized with thermography. Stomatal closure upon local DCMU treatment is the more likely cause for an increase in leaf surface temperature. On the other hand, Basta herbicide treatment on P. vulgaris plants was examined by thermal imaging. Sixty minutes after foliar application, leaf temperatures increased gradually. This treatment caused stomatal closing (Takayama and Omasa 2005). The ability to monitor plants by thermal imagers from the emergence of a presymptomatic effect of herbicide treatment until the appearance of visual symptoms permits correlation of the early stress indications with the final damage (Figure 12.2). 12.2.4  Air Humidity and Air Pollutants Stomatal pores of higher plants close in response to a decrease in atmospheric relative humidity (RH). To identify Arabidopsis genes involved in stomatal response to reduced RH, M2 plants from an EMS‐mutagenized population were screened by thermography, and two mutant lines 7C and 30A were identified by comparing with wild type Columbia Col‐2 (Xie et al. 2006). When these lines were subjected to a lower RH, they displayed a lower leaf temperature compared to the wild type. It was subsequently proven by genetic analyses that these phenotypes resulted from single recessive mutations in the OST1 (open stomata) and ABA2 (ABA‐deficient) genes, for respectively the 7C and 30A mutants. These results indicate that the OST1 and ABA2 genes are required to reduce stomatal aperture as a response to decreasing RH. Thermal imaging was used to reveal the influence of air pollutants on leaf temperature and thus transpiration. Failure to rapidly close stomata as a response to air pollutants typically increases the subsequent damage. The effect of ozone and the

245

246

12  Promising Monitoring Techniques (a)

Figure 12.2  Thermal and color reflectance images of primary bean leaves fed on a 1 mg l−1 linuron solution; panels (a), (b), and (c) show the evolution of the effect, respectively, 8, 12, and 38 hours after first symptom appearance. Scale bar ¼ 10 mm. (See color plate section for the color representation of this figure.)

(b)

(c)

influence of daylight length was assessed in Trifolium subterraneum L. (a typical ozone damage indicator plant) by using a statistical approach based on principal component analysis of the distribution of leaf lamina temperatures (Vollsnes et al. 2009). This multivariate statistical technique resulted in finding that long day treated plants typically were more sensitive than plants grown under short day conditions. In addition, the uniform T increase of the leaf surface temperature as a reaction to ozone exposure indicated there was no correlation with the subsequently formed localized necrotic spots. To characterize the signaling cascade involved, and in particular the role of the tobacco mitogen activated protein kinase 4 protein (NtMPK4) in ozone tolerance, Gomi et  al. (2005) generated NtMPK4‐silenced and salicylic acid induced protein kinase kinase (SIPKK) overexpressing tobacco plants. NtMPK4 is known to be activated by SIPKK, thus providing tools to have increased levels of MPK4 under ozone stress conditions. Thermography indicated that the silenced plants had a lower leaf temperature than wild type plants after ozone exposure, while SIPKK overexpressing plants had higher temperature values than wild type. This work confirmed that NtMAPK4 activity was needed for normal regulation of stomatal closure. 12.2.5  Ice Nucleation and Freezing Infrared thermography has been used in numerous studies to characterize factors involved in ice nucleation and propagation in specific plant species (Gusta et al. 2004).

12.2  Thermal Imaging

When ice first forms, leaf temperature rises rapidly, as a result of the release of the latent heat of freezing of water (0.33 kJ or 80 cal g−1). Temperature remains at that level until all the extracellular water is frozen (Taiz and Zeiger 2003). When that point is reached, heat release stops, and the temperature begin to decrease again. As the temperature drops further, ice forms in the intercellular spaces, and thermal energy (0.33 kJ or 80 cal g−1) is released again. Infrared thermography allows one to visualize the freezing process directly (Wisniewski et al. 2003). Since this method is non‐intrusive, it avoids any influence on the pattern of freezing that would be induced by attaching measuring probes such as thermocouples. Infrared thermography thus offers a versatile method for studying ice nucleation and propagation in plants. Freezing injury is a significant problem in plant production. Understanding how freezing develops throughout the plant could assist in the development of screening processes. Infrared thermal imaging has been useful for visualizing the sensitivity of tissues to freezing; roots froze first, then crowns and finally leaves (Stier et al. 2003). Root systems froze bidirectionally while freezing in shoots and leaves proceeded only acropetally. Freezing propagated quickly through tissues, particularly roots were very sensitive. Infrared thermography was also used to observe freezing in acclimated and non‐acclimated winter rye leaves. To produce cold‐acclimated plants comparable in physiological age to the non‐acclimated plants, plants grown in non‐acclimating conditions for one week were transferred to a low temperature (5 °C day and 2 °C night). Thereafter 10‐ml droplets of ice+ (nucleating) bacteria (Pseudomonas syringae van Hall 1902) were applied mid‐leaf, and the leaves were placed in a dark, environmental chamber controlled at 0 °C. Next the chamber was cooled to −1.5 °C and held constant until all droplets had frozen. Then, the temperature was lowered by 0.05–0.10 °C min−1 and freezing of winter rye (Secale cereale L.) leaves was observed in real time using thermography (Griffith et al. 2005). 12.2.6  Plant–Pathogen Interactions Infection by fungi and other microorganisms in most cases affects the surface structure of leaves. In general, this surface damage early in the infection process causes accelerated water loss, and ultimately leads to necrosis and drying of the leaves. Therefore, infrared imaging is able to differentiate healthy and infected leaves at pre‐ visual stages. After fungal infection of plants under laboratory conditions, thermography allowed to monitor variations of the surface temperature. Hellebrand et al. (2006) infected wheat plants with either powdery mildew or with stripe rust. In the case of stripe rust infection, the temperature differences between healthy and infected plants were below 0.1 K. In contrast, powdery mildew infection clearly induced bigger temperature changes. When the powdery mildew mycelia became visible, the temperature of the plant leaves decreased. After a few days, the average temperature of these infected plant parts was 0.2–0.9 K lower than the average temperature of healthy plants. Disease progress of downy mildew (Pseudoperonospora cubensis [Berkely and Curtis] Rostovtsev) on cucumber leaves, as observed with infrared thermography, depends on transpiration changes caused by the infection (Lindenthal et al. 2005). P. cubensis colonized the leaves and caused a decrease in leaf temperature of up to 0.8 °C compared to control plants. In infected tissue, damaged cells did not regulate stomatal movement

247

248

12  Promising Monitoring Techniques

anymore, leading to permanent sub‐optimal opening, finally resulting in drying of tissues. Oerke et al. (2011) assessed scab disease on apple leaves by thermal imaging. Venturia inaequalis (cooke) Winter colonizes apple leaves below the cuticle (sub‐cuticularly) causing scab disease. The suitability of digital infrared thermography for sensing and quantifying apple scab was assessed by investigating the effects of V. inaequalis on the water balance of apple leaves in relation to the disease stage and the severity of scab. Transpiration was measured by infrared thermo‐imaging to evaluate spatial heterogeneity of the leaves in response to localized infections. Subcuticular growth of the pathogen caused localized decreases in leaf temperature before symptoms appeared that significantly increased the maximum temperature difference (MTD) of leaves. Leaf transpiration was increased by all stages of scab development, therefore, MTD may be used not only for the differentiation between diseased and non‐diseased leaves, but also for disease quantification, e.g. in screening systems and monitoring in precision agriculture. Using thermography, a temperature increase at sites of the hypersensitive response (HR) to tobacco mosaic virus (TMV) infection was revealed, coinciding with localized salicylic acid (SA) accumulation (Chaerle et al. 1999). In contrast, Cercospora leaf spot, a necrotrophic fungal infection of sugar beet characterized by the formation of dark circular necrotic spots, leads to cool thermal effects at the infection sites (Figure 12.3) (Chaerle et  al. 2004). Botrytis fungal infection in common bean proved to induce a surface temperature increase of limited intensity (Chaerle et al. 2007b). These indicate thermal imaging to produce specific signatures for plant–pathogen interactions, is usable as a fingerprint for early disease identification. Early detection of diseases will be beneficial for optimal crop management.

6.5 DPI

7 DPI

7.5 DPI

8 DPI

9 DPI

14 DPI

10 mm

Figure 12.3  Thermal imaging of Cercospora‐lesion development in sugar beet leaves. Panels depict six different time points in days post inoculation (6.5, 7.0, 7.5, 8.0, 9.0, and 14 DPI). (See color plate section for the color representation of this figure.)

12.3  Chlorophyll Fluorescence Imaging

12.2.7  Herbivory Effects With the use of new imaging technologies we are beginning to understand how photosynthesis and water balance are modulated in undamaged tissue following herbivory. Connecting these alterations in physiology to changes in gene transcription and hormonal signaling will increase our ability to estimate whole‐plant responses to herbivory, and will improve our estimates of the impact of herbivory on higher levels of biological organization, such as yield loss and assessments of overall ecosystem productivity (Nabity et al. 2009). Primary productivity removed by herbivoric insects ranges from 5% to 30% of yield (Mattson and Addy 1975). Loss of productivity is generally estimated as the amount of leaf tissue removed. However, this approach does not take into account the reality that herbivory affects photosynthesis of the remaining leaf parts (Zangerl et al. 2002). To determine whether the different types of damage by an insect differentially affect photosynthesis in Arabidopsis leaves, two larval stages of cabbage looper caterpillars (Trichoplusia ni Hübner) were compared by thermal imaging (Tang et al. 2006). The mode of feeding by different instars (larval stages) determined the photosynthetic response to herbivory, which appeared to be mediated by the level of water stress associated with herbivore damage. The larger amount of cut edges associated with smaller holes made by first instars lead to a sustained lower leaf temperature revealed under dark conditions. First instars caused a deeper depression in the rate of carbon assimilation than fourth instars, potentially by accelerating the rate of water loss near damaged tissues and inducing water stress and subsequent stomatal closure. Thermal imaging can be used efficiently to quantify the effects of herbivory on the spatial pattern of water loss and to achieve greater insight into mechanisms contributing to the indirect suppression of photosynthesis.

12.3 ­Chlorophyll Fluorescence Imaging Beginning with experiments of Kautsky and Hirsch (1931), measurements of Chl fluorescence emission have been highly successful in enhancing our understanding of photosynthesis, and become one of the most widely used tools for monitoring photosynthetic performance (Maxwell and Johnson 2000). Non‐invasive measurement of photosynthesis by chlorophyll a fluorometry (Baker 2008) may potentially provide a means to determine plant viability and performance in response to stress. Chlorophyll fluorescence has been utilized for non‐invasive analyses of stress‐induced perturbations to photosynthesis for several decades (Conroy et al. 1986). Indeed, dissection and analysis of the rapid polyphasic chlorophyll a fluorescence transient OJIP, a technique applied previously to measure tolerance to light (Oukarroum and Strasser 2004) and chilling (Strauss et  al. 2006) stresses, was recently employed to assess the response of several barley cultivars to non‐lethal drought stress (Oukarroum et al. 2007). However, OJIP was not an imaging technique. Rapid progress has recently been made due to advancements in the technology of light emission, imaging detectors, and rapid data handling have allowed Chl fluorescence to be effective, simple to use, and affordable (Baker and Rosenqvist 2004). Detector array technology introduced by Omasa et  al. (1987) has led to capture a two‐dimensional image of thousands of fluorescence transients to be analyzed from

249

250

12  Promising Monitoring Techniques

leaves. The capacity to resolve photosynthetic performance over the surface of a leaf distinguishes Chl fluorescence imaging from integrative methods such as gas exchange or non‐imaging Chl fluorometry (Govindjee and Nedbal 2000). Not surprisingly, the molecular and physiological processes that alter the yield of Chl fluorescence can vary over the surface of a leaf, giving rise to spatial heterogeneity that can be detected by imaging (Lichtenthaler et al. 2005). Fluorescence heterogeneity can be caused by environmental stresses (Genty and Meyer 1995). Under such conditions, Chl fluorescence imaging provides a non‐invasive tool to reveal and understand spatial heterogeneity in leaf performance. Fluorescence imaging is currently employed to visualize photosynthetic heterogeneity caused by localized abiotic and biotic stresses (Quilliam et al. 2006; Pineda et al. 2008). Fluorescence imaging is also used to reveal local effects of abiotic stress, such as the effect of temperatures or drought on plant performance (Guidi and Degl’Innocenti 2011). Fluorescence imaging is able to reveal a wide range of internal plant characteristics that induce emission heterogeneity due to differences in physiology including changes in the nutritional state (Langsdorf et al. 2000), pigment distribution, and morphology (Hoque and Remus 1994; Takahashi et al. 1994). A distinct Chl fluorescence signature provides a rapid means to screen for mutant plants (Codrea et al. 2010). In addition, the fact that Chl fluorescence can be imaged from the molecular level to grasslands, crops, and forests, opens the way to scale photosynthetic performance from the membrane, to the chloroplast, to the leaf, and eventually to the field. The aim of this chapter is to describe methodology used to image Chl fluorescence of leaves and discuss selected applications that illustrate advantages offered by imaging analysis. Imaging Chl fluorescence is composed of four basic processes: image capture, image segmentation, analysis, and data visualization. The majority of Chl fluorescence imaging systems are based on cameras that utilize a charge‐coupled device (CCD) sensor to image captured Chl fluorescence emission. All Chl fluorescence imaging systems that measure Fm and Fm′ use one or more light sources to provide: (i) actinic illumination that drives photochemistry and induces the fluorescence transient, (ii) saturating multiple turnover pulses to measure Fm and Fm′, and (iii) measuring flashes to excite background Chl fluorescence during imaging (Nedbal and Koblížek 2005). The measuring light is usually provided by LEDs, which serve as a versatile light source in Chl fluorescence imaging (Küpper et al. 2000). The duration of flashes from LEDs can be controlled down to the sub‐microsecond range, and irradiance levels can be set from low irradiance to light exceeding sunlight (Nedbal et al. 1999). Also, actinic illumination is usually provided by LEDs. Saturating pulses can be generated either by LEDs or by another light source, e.g. a halogen lamp. Detailed information about the light sources, detectors, their properties, and use in Chl fluorescence imaging has been recently reviewed (Oxborough 2004). The software that drives the instrumentation and analysis is a critical factor in determining the usefulness of the Chl imaging fluorimeter (Nedbal and Whitmarsh 2004). It controls the light sources, image capture sequences and further data handling. The common technique is to visualize the distribution of the Chl fluorescence signal over the selected areas in false scale colors. For this purpose, the black‐ white scale or the visible spectrum of sunlight is used (where the white or red color represents the highest signal and the black or blue color represents the lowest signal). The spectrum of false scale colors is typically divided into 256 levels (Oxborough 2004). The red Chl fluorescence emission can be recorded together with the blue and green

12.3  Chlorophyll Fluorescence Imaging

fluorescence (400–630 nm) emissions, which primarily arises from hydroxycinnamic acids bound to the cell walls and could reveal effects of various stresses on leaves (Buschmann et  al. 2000). Recently, a high resolution, ultraviolet (UV) laser‐induced fluorescence (LIF) imaging system was developed, which images all four fluorescence bands: blue, green, red, and far‐red (Lichtenthaler and Miehé 1997). The advantage of this system was that it simultaneously recorded the LIF signatures for several hundred pixels over the whole leaf area, or even of several leaves or plants. With this technique it has been shown that the blue and green fluorescence emission was not evenly distributed over the leaf area, but primarily emanates from the main and side veins. Using the image processing system, the various fluorescence ratios (blue : red, blue : far‐red, blue : green) and the chlorophyll fluorescence ratio (red : far‐red) were calculated for each of the several hundred pixels of the leaf area. In this way, the differences in fluorescence emissions in the four fluorescence bands could be quantitated in relative proportions. 12.3.1  Drought Stress The negative impact of drought stress on photosynthesis is well‐documented, with carbon assimilation declining progressively with increasing water deficit as a result of both stomatal and metabolic limitations (Flexas and Medrano 2002). Woo et al. (2008) tested the response of major photosynthetic parameters to increasing water deficit in Arabidopsis with the objective of developing a rapid, reproducible, accurate, and non‐ invasive method for monitoring plant viability in response to prolonged drought. They have developed a procedure that allows a quantitative and precise determination of viability in intact, drought‐stressed Arabidopsis plants. The accuracy and general application of this technique has been demonstrated in different wild type cultivars and in mutant lines that possess differences in drought performance or altered photosynthetic characteristics. Meyer and Genty (1999) investigated the contribution of changes in stomatal conductance and metabolism in determining heterogeneous photosynthesis inhibition during dehydration and ABA feeding using detached leaves of Rosa rubiginosa L. The steady‐state and maximal rates of electron transport under a transient high CO2 concentration were monitored using chlorophyll fluorescence imaging. They concluded that low CO2 availability reduced the capacity of ribulose‐1,5‐bisphosphate carboxylase‐oxygenase (Rubisco) to drive electron transport. Calatayud et  al. (2006) examined spatial‐temporal changes using chlorophyll (Chl) a fluorescence imaging in leaves of rose plants (Rosa x hybrida) cv. Grand Gala for nine days, under progressive water stress. In summary, Chl fluorescence imaging was a useful and intuitive technique in the context of plant photosynthetic performance, reported in this paper, under slow and progressive plant water stress. Moreover, together with the Fs/Fo parameter this technique makes the early detection of water stress in greenhouse rose plants possible and it could also be applied to irrigation management. The photoprotection mechanism of the endangered Cistaceae species Tuberaria major (Willk.) P. Silva and Rozeira under high temperature and drought was studied (Osório et al. 2013). ФPSII increased significantly in heat stress (32 °C) applied to well‐ watered plants (HT). This increase was accompanied by a significant decrease in non‐photochemical quenching (NPQ) as compared to control plants. However, ФPSII decreased when drought stress was applied to HT plants. In addition, a significant increase in NPQ was observed. Although T. major was protected from oxidative

251

252

12  Promising Monitoring Techniques

stress damage during drought by energy dissipation mechanisms even though its photosynthetic capacity was reduced under drought and heat. In summary T. major was well equipped with photoprotection mechanisms against environmental stresses. On the other hand, a combination of fluorescence imaging and thermal imaging to study the stomatal conductance and photosynthetic activity may allow an improved discrimination of the changes in photosynthetic activity due to closed stomata during drought stress. 12.3.2  Light Stress To determine the functional roles of anthocyanins in leaves in vivo, supplemental anthocyanins from purple sweet potato (Ipomoea batatas Lam.) were infiltrated into leaves of Arabidopsis thaliana (L.) Heynh. double mutant of the ecotype Landsberg erecta (tt3tt4) deficient in anthocyanin biosynthesis. Chlorophyll fluorescence imaging showed that anthocyanins significantly ameliorated the inactivation of photosystem II during prolonged high‐light (1300 μmol m−2 s−1) exposure (Zeng et al. 2010). The response to photoinhibition of photosynthesis and subsequent recovery was examined in plants of P. vulgaris cultivar “Pinto” exposed to charcoal‐filtered air or to ozone (O3) at 150 nl l−1 either for three hours, or for five hours (Guidi and Degl’Innocenti 2011). The responses were analyzed using chlorophyll fluorescence imaging and by conventional fluorometry. Compared to control plants maintained in charcoal‐filtered air, in plants exposed for three hours to O3 and then subjected to high light treatment, the results show an increased tolerance to photoinhibition. 12.3.3  Herbicide Stress Stomata integrate the different environmental stimulus a plant is exposed to, and accordingly regulate their opening which consequently determines transpiration level and associated leaf temperature. When varying single parameters in an otherwise constant measuring environment (e.g. in an environmentally controlled growth room), stomatal conductance (Gs) typically declines in response to increasing intercellular CO2 concentration (ci) (Messinger et  al. 2006). However, the mechanisms underlying this response are not fully understood. The role of photosynthetic electron transport in the stomatal response to ci in intact leaves of cocklebur (Xanthium strumarium L.) plants was investigated by examining the responses of Gs and net CO2 assimilation rate to ci in light and darkness, and in the presence or absence of the photosystem II inhibitor DCMU. When the herbicide DCMU was applied to a leaf via the transpiration stream, photosynthetic CO2 uptake declined gradually over several hours. This decline in photosynthetic rate was accompanied by a decrease in Gs. Fluorescence images were taken concurrently with gas‐exchange measurements to assess the spatial distribution of photosynthesis in response to DCMU. These images show distinct areas with near‐zero quantum yield for PSII (ΦPSII) spreading out from the veins. The proportion of the leaf with near‐zero ΦPSII was directly proportional to the percent reduction in photosynthesis as measured by gas exchange (which provides a direct measure of CO2 assimilation). This supports the conclusion that the areas with near‐zero ΦPSII had near‐zero photosynthesis. These results show that the gradual decline in photosynthesis observed in gas‐exchange data was caused by an increase in the proportion of the leaf for which

12.3  Chlorophyll Fluorescence Imaging

photosynthesis was severely inhibited, rather than by a slow uniform decline in photosynthesis for the entire leaf (Messinger et al. 2006). Woodyard et  al. (2009) evaluated a pre‐application of atrazine followed by a post‐ application of mesotrione for potential interactions in both site‐of‐action‐based triazine resistant (TR) redroot pigweed and metabolism‐based atrazine‐resistant (AR) velvetleaf. Synergism was detected in reducing biomass of the TR redroot pigweed but not in the AR velvetleaf with metabolism‐based resistance. The second objective of this study was to evaluate the joint activity of mesotrione and atrazine in a tank‐mix application in the AR velvetleaf biotype. Greenhouse studies with the AR biotype indicated that synergism resulted from a tank mix with a constant mesotrione rate of 3.2 g aiha−1 in mixture with atrazine ranging from 126 to 13 440 g aiha−1. Chlorophyll fluorescence imaging also revealed a synergistic interaction on the AR biotype when 3.2 g ha−1 of mesotrione was applied with 126 g ha−1 of atrazine beginning 36 hours after treatment and persisting through 72 hours. In situ effects of glufosinate (Basta), one of the most popular commercially available foliar application‐type herbicides, on kidney bean (P. vulgaris) leaves were analyzed with chlorophyll fluorescence imaging. Immediately after the Basta treatment, CO2 assimilation rate and ΦPSII, which represents the photochemical yield of photosystem ΙΙ, decreased, and NPQ, which represents the heat dissipation of excess absorbed light energy, increased in the treated area. These results demonstrated that the early diagnosis of invisible photosynthetic injury caused by Basta was feasible by using Chl‐FI (Takayama et al. 2003). Similarly Chaerle et al. (2003) showed high‐contrast chlorophyll a fluorescence imaging (CFI) is the method of choice for early visualization of diuron herbicide‐induced effects (Figure 12.4). In Arabidopsis, diuron was applied to the upper surface of an A. thaliana leaf then transport of the herbicide was examined by Chl‐FI. Chl florescence increased first in the young upper leaves followed by all petioles and leaf petioles. The applicability of this screening technique for metabolic perturbations in monocotyledonous species was demonstrated by treating Agrostis tenuis Sibth. seedlings with Imazapyr, an inhibitor of branched‐chain amino acid synthesis. Evaluations of seedling growth were made from measurements of the area of chlorophyll fluorescence emission in images of plants growing in 96‐well plates. Decreased seedling growth related directly to herbicide induced changes in the imaged chlorophyll fluorescence parameters (Barbagallo et al. 2003). Herbicides have been advantageously used as an inducer of dynamic changes in photosynthetic related parameters derived from chlorophyll fluorescence images. The use of the PSII‐inhibiting compound DCMU was mentioned in the previous section; the reactive oxygen species (ROS) generating herbicide methyl viologen, which inhibits electron transport beyond PSI, has been widely used in studies on oxidative stress resistance. Chlorophyll fluorescence emission and antioxidative capability in detached leaves of the wild‐type A. thaliana ecotype Landsberg erecta (Ler) and in three mutants deficient in anthocyanin biosynthesis (tt3, tt4, and tt3‐tt4  –  transparent testa) were investigated under photooxidative stress induced by methyl viologen (also known as the PSI electron acceptor herbicide paraquat) in the light (Shao et  al. 2008). The results indicating a decrease in chlorophyll fluorescence parameters, including ΦPSII, correlated with the level of anthocyanins in the abovementioned Arabidopsis mutants, demonstrate that anthocyanins might, along with other antioxidants, efficiently protect the

253

254

12  Promising Monitoring Techniques (a)

(b)

(c)

(d)

Figure 12.4  Chlorophyll a fluorescence imaging of diuron transport in Arabidopsis ecotype Col‐0. (a), Leaves before treatment; (b), 4 hours after treatment; (c), 6 hours after diuron application; (d), 10 hours after diuron application. Scale bar ¼ 10 mm (a).

photosynthetic apparatus against photooxidative damage. Interestingly it was also revealed that PSII was transiently reversibly deactivated (showing a transient recovery of ΦPSII) during this type of oxidative stress. Such dynamic analysis with chlorophyll fluorescence imaging permits to gain insight in the temporal reactions plants can display in order to cope efficiently with transient and moderate stress situations. 12.3.4  Air Pollutants Experimental investigations of ozone (O3) effects on plants have commonly used short, acute (O3) exposure (>100 ppb, on the order of hours), while in field crops, damage is more likely caused by chronic exposure (