Neural Reprogramming: Methods and Protocols (Methods in Molecular Biology, 2352) 1071616005, 9781071616000

Citation preview

Methods in Molecular Biology 2352

Henrik Ahlenius Editor

Neural Reprogramming Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Neural Reprogramming Methods and Protocols

Edited by

Henrik Ahlenius Stem Cells, Aging and Neurodegeneration Group, Faculty of Medicine, Department of Clinical Sciences, Neurology, Lund Stem Cell Center, Lund University, Lund, Sweden

Editor Henrik Ahlenius Stem Cells, Aging and Neurodegeneration Group Faculty of Medicine Department of Clinical Sciences, Neurology Lund Stem Cell Center Lund University Lund, Sweden

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1600-0 ISBN 978-1-0716-1601-7 (eBook) https://doi.org/10.1007/978-1-0716-1601-7 © Springer Science+Business Media, LLC, part of Springer Nature 2021, Corrected Publication 2022 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface The seminal discovery, by Takahashi and Yamanaka, that somatic cells can be reprogrammed to become pluripotent has led to a whole new field of research. We now know that somatic cells can be reprogrammed not only to induced pluripotent stem cells but also to other lineage-restricted progenitors or somatic cells within a specific lineage or to cells of distant lineages. The relative inaccessibility of human neural cells has previously impeded neuroscience research. Scientists were restricted to immortalized or cancer cell lines, fetal tissue, surgical resection, or post-mortem material which have been very useful and informative but all come with different limitations. Reprogramming technologies have become a real game changer making normal and patient-derived neural cells readily available for research and potential therapeutic purposes. It is now in principle possible to generate neural cells in vitro from any living human being or any bio-banked cells. For instance, mouse or human fibroblasts of the mesoderm lineage can be reprogrammed to become neurons of the ectoderm lineage by overexpression of neuronal transcription factors. The concept of reprogramming has also been applied to pluripotent or neural stem cells to fast forward differentiation to neurons, astrocytes, and oligodendroglia by the use of lineage-specific transcription factors. These technologies enable the development of potential cell replacement therapies, studies of physiological cellular processes, disease modeling, drug screening, and much more. For instance, it is now possible to generate neurons and astrocytes from somatic cells and culture them together to study synapse formation as well as neuron–glia interactions. Similarly, cocultures of reprogrammed neurons and oligodendrocytes could be used to study myelination. Neural cells can be generated directly from healthy and patientderived cells, or by first reprogramming to pluripotency. Alone or in combination with genome engineering, this offers the opportunity to study in dynamic ways neurological disorders in the dish. Currently neural cells derived from pluripotent stem cells are explored and tested in clinical trials for cell replacement therapies and extensively used for modeling of mainly monogenetic but also sporadic neurological disorders. Neural cells reprogrammed from somatic cells without going through a pluripotent stem cell stage are highly relevant for disease modeling of sporadic and late onset diseases as they, in contrast to cells derived from pluripotent stem cells, have been shown to retain aging phenotypes. Another exciting avenue is in vivo neuronal reprogramming of glial cells in the brain, which has shown in animal models promising therapeutic potential. The field of reprogramming is constantly developing, and new methods are rapidly emerging. Here we bring together a number of state-of-the-art and recent protocols to generate different types of neural cells. In addition, the book covers different aspects of functional evaluation and applications of reprogrammed neural cells as well as in silico methods to aid reprogramming. The book covers reprogramming of somatic mouse (Chapters 1–5) and human cells (Chapters 5–7) to neurons and astrocytes driven by transcription factors as well as by the use of small molecules. It also details the use of transcription factors for forward programming

v

vi

Preface

of human pluripotent stem cells to neurons, astrocytes, and oligodendrocytes (Chapters 8–11). Furthermore, we provide protocols for transcriptional profiling during neuronal reprogramming (Chapter 12) and functional assessment of reprogrammed neural cells using electrophysiology and electrochemistry (Chapters 13 and 14). In addition, the book covers protocols for combining reprogramming with protein engineering to understand transcription factor biology (Chapter 15), Crispr/Cas9 genome engineering for neural disease modeling (Chapter 16), and the establishment of human brain organotypical slice cultures which should prove useful for preclinical testing of reprogrammed neural cells (Chapter 17). The field of neural reprogramming has in the last decade opened up previously unimaginable possibilities to study the central nervous system in health and disease. The field is still in its infancy, and many findings need further validation and development. Nonetheless, we can expect to see great discoveries being made in neuroscience through the use of reprogramming technologies in the coming years. The protocols presented here provide ample experimental experience and guidance for anyone, be it experienced or beginner, to generate, validate, and apply reprogrammed neural cells in their research. Finally, I would like to extend my sincere gratitude to all authors as well as the production team during the lengthy process of making this book a reality. Lund, Sweden

Henrik Ahlenius

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v ix

1 Isolation and Neuronal Reprogramming of Mouse Embryonic Fibroblasts . . . . . Juan M. Adrian-Segarra, Bettina Weigel, and Moritz Mall 2 Direct In Vitro Reprogramming of Astrocytes into Induced Neurons . . . . . . . . . Nesrin Sharif, Filippo Calzolari, and Benedikt Berninger 3 Direct Cell Reprogramming of Mouse Fibroblasts into Functional Astrocytes Using Lentiviral Overexpression of the Transcription Factors NFIA, NFIB, and SOX9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Boning Qiu, Ruben J. de Vries, and Massimiliano Caiazzo 4 Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E Tian, Mingzi Zhang, and Yanhong Shi 5 Bcl-2-Assisted Reprogramming of Mouse Astrocytes and Human Fibroblasts into Induced Neurons. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Amel Falco, Rocı´o Bartolome´-Cabrero, and Sergio Gascon 6 Direct Conversion of Human Fibroblasts to Induced Neurons . . . . . . . . . . . . . . . Lucia Zhou-Yang, Sophie Eichhorner, Lukas Karbacher, Lena Bo¨hnke, Larissa Traxler, and Jerome Mertens 7 Generation of Induced Dopaminergic Neurons from Human Fetal Fibroblasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Emilie M. Legault and Janelle Drouin-Ouellet 8 Direct Differentiation of Functional Neurons from Human Pluripotent Stem Cells (hPSCs) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ruiqi Hu, Xiaoting Zhu, and Nan Yang 9 Generation of Motor Neurons from Human ESCs/iPSCs Using Sendai Virus Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Keiko Imamura, Jitsutaro Kawaguchi, Tsugumine Shu, and Haruhisa Inoue 10 Transcription Factor Programming of Human Pluripotent Stem Cells to Functionally Mature Astrocytes for Monocultures and Cocultures with Neurons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ella Quist, Henrik Ahlenius, and Isaac Canals 11 Single Transcription Factor-Based Differentiation Allowing Fast and Efficient Oligodendrocyte Generation via SOX10 Overexpression. . . . . . . . . Katrien Neyrinck and Juan A. Garcı´a-Leon 12 Transcriptional Profiling During Neural Conversion . . . . . . . . . . . . . . . . . . . . . . . . Yohannes Afeworki, Hannah Wollenzien, and Michael S. Kareta 13 Functional Assessment of Direct Reprogrammed Neurons In Vitro and In Vivo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Srisaiyini Kidnapillai and Daniella Rylander Ottosson

1

vii

13

31

45

57 73

97

117

127

133

149 171

183

viii

Contents

14

Neurotransmitter Release of Reprogrammed Cells Using Electrochemical Detection Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andreas Heuer 15 Combining Cell Fate Reprogramming and Protein Engineering to Study Transcription Factor Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Juan M. Adrian-Segarra, Bettina Weigel, and Moritz Mall 16 CRISPR/Cas9 Genome Engineering in Human Pluripotent Stem Cells for Modeling of Neurological Disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Isaac Canals and Henrik Ahlenius 17 Derivation of Adult Human Cortical Organotypic Slice Cultures for Coculture with Reprogrammed Neuronal Cells . . . . . . . . . . . . . . . . . . . . . . . . . Giedre Kvist Correction to: Functional Assessment of Direct Reprogrammed Neurons In Vitro and In Vivo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

201

227

237

253

C1 261

Contributors JUAN M. ADRIAN-SEGARRA • Cell Fate Engineering and Disease Modeling Group, German Cancer Research Center (DKFZ) and DKFZ-ZMBH Alliance, Heidelberg, Germany; HITBR Hector Institute for Translational Brain Research gGmbH, Heidelberg, Germany; Central Institute of Mental Health, Medical Faculty Mannheim, Heidelberg University, Mannheim, Germany YOHANNES AFEWORKI • The Functional Genomics and Bioinformatics Core, University of South Dakota, Vermillion, SD, USA HENRIK AHLENIUS • Stem Cells, Aging and Neurodegeneration Group, Faculty of Medicine, Department of Clinical Sciences, Neurology, Lund Stem Cell Center, Lund University, Lund, Sweden; Division of Neurology, Department of Clinical Sciences, University of Lund, Lund, Sweden ROCI´O BARTOLOME´-CABRERO • Department of Pharmacology and Toxicology, Faculties of Veterinary and Medicine, Complutense University of Madrid, Madrid, Spain; Department of Molecular, Cellular and Developmental Neurobiology, Instituto Cajal – CSIC, Madrid, Spain; Department of Biochemistry, Universidad Autonoma de Madrid (UAM), Instituto de Investigaciones Biomedicas Alberto Sols (CSIC-UAM), Madrid, Spain BENEDIKT BERNINGER • Institute of Physiological Chemistry, University Medical Center Johannes Gutenberg University Mainz, Mainz, Germany; Institute of Psychiatry, Psychology, and Neuroscience, Centre for Developmental Neurobiology, King’s College London, London, UK; MRC Centre for Neurodevelopmental Disorders, King’s College London, London, UK LENA BO¨HNKE • Institute of Molecular Biology and CMBI, Leopold-Franzens-University, Innsbruck, Austria; Laboratory of Genetics, The Salk Institute for Biological Studies, La Jolla, CA, USA MASSIMILIANO CAIAZZO • Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences (UIPS), Utrecht University, Utrecht, The Netherlands; Department of Molecular Medicine and Medical Biotechnology, University of Naples ‘Federico II’, Naples, Italy FILIPPO CALZOLARI • Institute of Physiological Chemistry, University Medical Center Johannes Gutenberg University Mainz, Mainz, Germany ISAAC CANALS • Stem Cells, Aging and Neurodegeneration Group, Faculty of Medicine, Department of Clinical Sciences, Neurology, Lund Stem Cell Center, Lund University, Lund, Sweden RUBEN J. DE VRIES • Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences (UIPS), Utrecht University, Utrecht, The Netherlands JANELLE DROUIN-OUELLET • Faculte´ de Pharmacie, Universite´ de Montre´al, Montreal, QC, Canada SOPHIE EICHHORNER • Institute of Molecular Biology and CMBI, Leopold-FranzensUniversity, Innsbruck, Austria AMEL FALCO • Department of Pharmacology and Toxicology, Faculties of Veterinary and Medicine, Complutense University of Madrid, Madrid, Spain; Department of Molecular, Cellular and Developmental Neurobiology, Instituto Cajal – CSIC, Madrid, Spain

ix

x

Contributors

JUAN A. GARCI´A-LEO´N • Departamento Biologia Celular, Genetica y Fisiologia, Facultad de Ciencias, Instituto de Investigacion Biomedica de Malaga-IBIMA, Universidad de Malaga, Malaga, Spain; Centro de Investigacion Biomedica en Red Sobre Enfermedades Neurodegenerativas (CIBERNED), Madrid, Spain SERGIO GASCO´N • Department of Pharmacology and Toxicology, Faculties of Veterinary and Medicine, Complutense University of Madrid, Madrid, Spain; Institute of Physiology, Department of Physiological Genomics, Biomedical Center (BMC), Ludwig-Maximilians University Munich, Planegg-Martinsried, Germany ANDREAS HEUER • Behavioural Neuroscience Laboratory, Department of Experimental Medical Sciences, Lund University, Lund, Sweden RUIQI HU • Department of Neuroscience, Icahn School of Medicine at Mount Sinai, Black Family Stem Cell Institute, Friedman Brain Institute, New York, NY, USA KEIKO IMAMURA • Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan; iPSC-Based Drug Discovery and Development Team, RIKEN BioResource Research Center (BRC), Kyoto, Japan; Medical-Risk Avoidance Based on iPS Cells Team, RIKEN Center for Advanced Intelligence Project (AIP), Kyoto, Japan HARUHISA INOUE • Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan; iPSC-Based Drug Discovery and Development Team, RIKEN BioResource Research Center (BRC), Kyoto, Japan; Medical-Risk Avoidance Based on iPS Cells Team, RIKEN Center for Advanced Intelligence Project (AIP), Kyoto, Japan; Institute for Advancement of Clinical and Translational Science, Kyoto University, Kyoto, Japan LUKAS KARBACHER • Institute of Molecular Biology and CMBI, Leopold-Franzens-University, Innsbruck, Austria MICHAEL S. KARETA • The Functional Genomics and Bioinformatics Core, University of South Dakota, Vermillion, SD, USA; Division of Basic Biomedical Sciences, Sanford School of Medicine, University of South Dakota, Vermillion, SD, USA; Genetics and Genomics Group, Sanford Research, Sioux Falls, SD, USA; Cellular Therapies and Stem Cell Biology Group, Sanford Research, Sioux Falls, SD, USA; Department of Pediatrics, Sanford School of Medicine, Sioux Falls, SD, USA; Department of Chemistry and Biochemistry, South Dakota State University, Brookings, SD, USA JITSUTARO KAWAGUCHI • R&D Center, ID Pharma Co. Ltd., Tsukuba, Japan SRISAIYINI KIDNAPILLAI • Department of Experimental Medical Science and Lund Stem Cell Centre, BMC, Lund University, Lund, Sweden GIEDRE KVIST • Lund Stem Cell Center, Lund University, Lund, Sweden EMILIE M. LEGAULT • Faculte´ de Pharmacie, Universite´ de Montre´al, Montreal, QC, Canada MORITZ MALL • Cell Fate Engineering and Disease Modeling Group, German Cancer Research Center (DKFZ) and DKFZ-ZMBH Alliance, Heidelberg, Germany; HITBR Hector Institute for Translational Brain Research gGmbH, Heidelberg, Germany; Central Institute of Mental Health, Medical Faculty Mannheim, Heidelberg University, Mannheim, Germany JEROME MERTENS • Institute of Molecular Biology and CMBI, Leopold-Franzens-University, Innsbruck, Austria; Laboratory of Genetics, The Salk Institute for Biological Studies, La Jolla, CA, USA KATRIEN NEYRINCK • Department of Development and Regeneration, Stem Cell Institute, KU Leuven, Leuven, Belgium BONING QIU • Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences (UIPS), Utrecht University, Utrecht, The Netherlands

Contributors

xi

ELLA QUIST • Stem Cells, Aging and Neurodegeneration Group, Faculty of Medicine, Department of Clinical Sciences, Neurology, Lund Stem Cell Center, Lund University, Lund, Sweden DANIELLA RYLANDER OTTOSSON • Department of Experimental Medical Science and Lund Stem Cell Centre, BMC, Lund University, Lund, Sweden NESRIN SHARIF • Institute of Physiological Chemistry, University Medical Center Johannes Gutenberg University Mainz, Mainz, Germany; International PhD Programme on Gene Regulation, Epigenetics and Genome Stability, Mainz, Germany YANHONG SHI • Division of Stem Cell Biology Research, Department of Developmental and Stem Cell Biology, Beckman Research Institute of City of Hope, Duarte, CA, USA TSUGUMINE SHU • R&D Center, ID Pharma Co. Ltd., Tsukuba, Japan E. TIAN • Division of Stem Cell Biology Research, Department of Developmental and Stem Cell Biology, Beckman Research Institute of City of Hope, Duarte, CA, USA LARISSA TRAXLER • Institute of Molecular Biology and CMBI, Leopold-Franzens-University, Innsbruck, Austria; Laboratory of Genetics, The Salk Institute for Biological Studies, La Jolla, CA, USA BETTINA WEIGEL • Cell Fate Engineering and Disease Modeling Group, German Cancer Research Center (DKFZ) and DKFZ-ZMBH Alliance, Heidelberg, Germany; HITBR Hector Institute for Translational Brain Research gGmbH, Heidelberg, Germany; Central Institute of Mental Health, Medical Faculty Mannheim, Heidelberg University, Mannheim, Germany HANNAH WOLLENZIEN • Division of Basic Biomedical Sciences, Sanford School of Medicine, University of South Dakota, Vermillion, SD, USA; Genetics and Genomics Group, Sanford Research, Sioux Falls, SD, USA NAN YANG • Department of Neuroscience, Icahn School of Medicine at Mount Sinai, Black Family Stem Cell Institute, Friedman Brain Institute, New York, NY, USA MINGZI ZHANG • Division of Stem Cell Biology Research, Department of Developmental and Stem Cell Biology, Beckman Research Institute of City of Hope, Duarte, CA, USA LUCIA ZHOU-YANG • Institute of Molecular Biology and CMBI, Leopold-FranzensUniversity, Innsbruck, Austria XIAOTING ZHU • Department of Neuroscience, Icahn School of Medicine at Mount Sinai, Black Family Stem Cell Institute, Friedman Brain Institute, New York, NY, USA

Chapter 1 Isolation and Neuronal Reprogramming of Mouse Embryonic Fibroblasts Juan M. Adrian-Segarra, Bettina Weigel, and Moritz Mall Abstract Forced expression of specific neuronal transcription factors in mouse embryonic fibroblasts (MEFs) can lead to their direct conversion into functional neurons. Direct neuronal reprogramming has become a powerful tool to characterize individual factors and molecular mechanisms involved in forced and normal neurogenesis and to generate neuronal cell types for in vitro studies. Here we provide a detailed protocol for the isolation of MEFs devoid of neural tissue and their direct reprogramming into functional neurons by overexpression of neuronal reprogramming factors (Ascl1, Brn2, and Myt1l) using lentiviral vectors. This method enables quick and efficient generation of mouse neurons in vitro for versatile functional and mechanistic characterization. Key words MEF, Cell fate conversion, Neuronal reprogramming, Ascl1, Brn2, Myt1l, Induced neurogenesis

1

Introduction Direct neuronal reprogramming is based on the same factors that operate during normal neuronal development and constitutes a powerful new tool to investigate the molecular mechanisms governing neurogenesis [1, 2]. As an example, neuronal reprogramming made it possible to identify and uncover specific functions of previously poorly characterized neuronal transcription factors [3–8]. In addition, neuronal reprogramming offers an interesting application to model neurological diseases in the culture dish [9]. Recent progress has been made to develop protocols to generate human neurons from fibroblasts or stem cells for in vitro disease modeling [10–12]. However, neuronal reprogramming of murine cells such as MEFs is still of great relevance due to the availability of many transgenic lines, which greatly facilitate studying the contributions of particular genes/risk factors to neurogenesis and neuronal function (Fig. 1).

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Juan M. Adrian-Segarra et al.

Fig. 1 (a) Live cell time-lapse microscopy of MEFs derived from TauEGFP reporter mice transduced with Ascl1, Brn2, and Myt1l at indicated time points after transgene induction using doxycycline. After 3–5 days, clear morphological changes such as rounding of the cell body and neurite extension can be observed along with induction of neuronal genes such as the TauEGFP reporter. The same cell is highlighted by an arrowhead. Scale bar 20μm. (b) Immunofluorescence microscopy images of cells reprogrammed as in (a) after 14 days and stained with antibodies against the neuronal markers TauEGFP (green) and Tuj1 (red), as well as the DNA stain DAPI (blue). Scale bar 50μm

Here we provide a detailed protocol covering all steps involved in direct neuronal reprogramming of mouse embryonic fibroblasts (MEFs), which include MEF isolation and culture, lentiviral production, MEF transduction, and neuronal reprogramming (Fig. 2a). By following this protocol, MEFs and lentiviral solutions can be prepared in less than 1 week, with fully functional reprogrammed neurons being reliably obtained after 2–3 weeks (Fig. 2b). Before undertaking this protocol, researchers should ensure compliance with their institution’s guidelines and requirements regarding both animal and biosafety level 2 lentiviral work.

2

Materials

2.1 MEF Isolation and Culture

1. Class II laminar flow hood.

2.1.1 Equipment

3. CO2 cell culture incubator (37  C, 5% CO2).

2. Dissecting microscope. 4. Surgical tools: scissors, spring scissors, forceps. 5. Freezing box providing a controlled temperature decrease rate. 6. Regular 10-cm dishes. 7. Cell culture dishes (10 and 15 cm). 8. 1.5-mL microfuge tubes. 9. Freezing vials (1 mL).

Direct Neuronal Reprogramming

3

Fig. 2 (a) Schematic overview of the distinct steps comprising MEF isolation, lentiviral transduction, and neuronal conversion described in this direct neuronal reprogramming protocol. (b) Expected timeline for the different parts of the procedure described in detail in the protocol 2.1.2 Solutions

1. Ice-cold 80% ethanol. 2. Ice-cold Hank’s Balanced Salt Solution (HBSS). 3. 0.25% trypsin-EDTA solution. 4. Fetal bovine serum (FBS). 5. 2 cryopreservation medium: FBS + 20% (v/v) dimethyl sulfoxide (DMSO). 6. MEF medium: Dulbecco’s Modified Eagle Medium (DMEM) supplemented with GlutaMAX (1), penicillin-streptomycin (1), MEM non-essential amino acids (1), sodium pyruvate (1 mM), β-mercaptoethanol (0.1 mM) (see Note 1), and bovine calf serum fortified with iron and growth-promoting factors (10% v/v).

2.1.3 Other Materials

1. Pregnant mouse of the desired strain (e.g., C57BL/6 mice) at embryonic day 13.5 (E13.5).

2.2 Lentivirus Production

1. Access to a biosafety level 2 cell culture room with laminar flow hood and CO2 incubator.

2.2.1 Equipment

2. Cell culture dishes (10 and 15 cm). 3. 30- or 50-mL sterile syringes. 4. 45-μm filters.

4

Juan M. Adrian-Segarra et al.

2.2.2 Solutions

1. Poly-L-ornithine (PO): 15 mg/L in phosphate-buffered saline (PBS). 2. PBS. 3. MEF medium (see above). 4. MEM reduced serum medium. 5. PEI master mix: 0.15μg/μL of polyethylenimine (PEI) in MEM reduced serum medium, prepared fresh.

2.2.3 Other Materials

1. Lentiviral envelope and packaging plasmids, e.g., thirdgeneration lentiviral vectors pMDLg/pRRE (Addgene#12251) and pRSV-Rev (Addgene#12253), together with an envelope vector with wide infectivity such as VSV-G (Addgene#12259) (see Note 2). 2. Lentiviral transfer plasmids encoding neuronal reprogramming factors, e.g., tetracycline-inducible Tet-O-FUW vectors containing Ascl1, Brn2, and Myt1l (Addgene#27150, 27151, and 27152), along with a reverse tetracycline-controlled transactivator (rtTA) (Addgene#26429) vector (see Note 3). 3. HEK-293T cells (see Note 4).

2.3 Neuronal Reprogramming

1. Access to a biosafety level 2 cell culture room with laminar flow hood and CO2 incubator.

2.3.1 Equipment 2.3.2 Solutions

1. Lentiviral-containing supernatants (or concentrated particles). 2. Transduction medium: MEF medium supplemented with 8μg/mL of polybrene. 3. Initial induction medium: MEF medium with 2μg/mL of doxycycline. 4. Neuronal induction medium: DMEM/F12 medium with N-2 (1) and B-27 (1) supplements, penicillin-streptomycin (1), insulin (20μg/mL), and doxycycline (2μg/mL).

2.3.3 Other Materials

3 3.1

1. MEFs.

Methods MEF Isolation

1. Sacrifice a pregnant mouse at embryonic day 13.5 (see Note 5), and spray/flush abdomen with 80% ethanol. 2. Cut open and remove the skin from the abdominal cavity with the help of large scissors and a forceps (see Note 6). 3. Cut open the abdominal cavity, extract the uterine horns containing the string of embryos, rinse them briefly in a conical

Direct Neuronal Reprogramming

5

tube containing 80% ethanol, and transfer them to a second conical tube containing ice-cold HBSS. 4. Under the laminar flow hood, transfer the uterine horns to a 10-cm dish with ice-cold HBSS. With the help of the dissecting microscope, release the embryos from the membranes enveloping them by gently tearing the membranes with two forceps, and transfer them to a new plate with ice-cold HBSS (see Note 7). 5. Using spring scissors and forceps, carefully cut the four limbs of each embryo (see Note 8), and transfer them to a microfuge tube with 1 mL of ice-cold HBSS, which is kept on ice until proceeding to the next step (see Note 9). 6. Use a pipette to carefully remove as much of the HBSS as possible from the microfuge tube containing the embryo limbs, and add 1 mL of 0.25% trypsin-EDTA. 7. Remove as much of the 0.25% trypsin-EDTA as possible, and use the small scissors to mince the limbs into smaller pieces (~50 cuts). 8. Add 1 mL of 0.25% trypsin-EDTA, and incubate in a CO2 cell culture incubator (37  C, 5% CO2) for 15 min, inverting the tubes two to three times every 5 min. 9. Use a pipette to further dissociate the limbs by pipetting up and down 10–15 times, and then add the solution to a cell culture dish with appropriate amount of pre-warmed MEF media and culture in the CO2 incubator (37  C, 5% CO2). We pool the dissociated limbs from four embryos and plate them in a 15-cm dish with 20 mL of MEF medium. In case each embryo needs to be processed individually, i.e., due to different genotypes, we plate the material from each animal in a 10-cm dish with 10 mL of MEF medium. 10. The next day, perform a medium change (to fresh, pre-warmed MEF medium) to remove dead and unattached cells (see Note 10). 11. Let the cells grow until 90–100% confluency (usually 2–3 days after isolation). 3.2 MEF Passaging and Cryopreservation

1. Once MEFs are confluent, aspirate off the medium and wash with PBS. 2. Aspirate off the PBS, add enough 0.25% trypsin-EDTA solution to cover the plate surface (see Note 11), and incubate for 2–3 min at 37  C. 3. Once the cells have detached from the plate, stop trypsinization by addition of pre-warmed MEF medium. 4. Re-plate MEF cells at a 1:4 to 1:6 ratio (first passage).

6

Juan M. Adrian-Segarra et al.

5. Let the cells grow until 90–100% confluency (usually 2–3 days), and repeat steps 1–3 to obtain a single-cell MEF suspension ready for cryopreservation (see Note 12). 6. Pellet the MEF cells by centrifugation (150 rcf, 5 min at room temperature). 7. Aspirate the supernatant and gently resuspend in FBS (1.5 mL per fully confluent 15-cm plate; see Note 13), and then slowly add the same volume of FBS + 20% DMSO. 8. Aliquot in 1-mL freezing vials, place inside a freezing container, and transfer to a 80  C freezer overnight. 9. The next day, move the cells to a liquid nitrogen tank for longterm storage (see Note 14). 3.3 Lentiviral Production

1. Coat 10-cm cell culture dishes with 5 mL of PO diluted in PBS, and incubate for a minimum of 30–60 min at 37  C (see Note 15). 2. Aspirate off the PO solution, wash PO-coated plates with PBS, and aspirate. 3. Trypsinize 70–80% confluent 293 T cells cultured in MEF medium (see steps 1–3 in Subheading 3.2) (see Notes 16 and 17). 4. Count living 293T cells in the cell suspension (see step 6 in Subheading 3.2). 5. Pellet the required amount of 293T cells (9  106 living cells per 10-cm dish; see Note 18) by centrifugation (150 rcf, 5 min). 6. Aspirate off the supernatant, resuspend in the required amount of pre-warmed MEF medium, and add to the PO-coated plates. 7. The following day, change the medium to pre-warmed MEF medium, in order to remove dead and unattached cells. 8. Prepare a master mix of the lentiviral envelope and packaging plasmids in MEM reduced serum medium. For each 10-cm plate to be transfected, we prepare 500μL of MEM reduced serum medium with 6.25μg of pMDLg/pRRE, 3.125μg of pRSV-Rev, and 3.215μg of VSV-G. 9. Aliquot the lentiviral plasmid master mix in tubes, add the desired lentiviral transfer plasmid(s) (see Note 19), and vortex (medium power). For a 10-cm plate, we add 12.5μg of transfer plasmid to 500μL of lentiviral packaging master mix. 10. Add an equal volume of freshly prepared PEI master mix (500μL for a 10-cm plate) (see Note 20), vortex (medium power), and incubate for a maximum of 15 min at room temperature.

Direct Neuronal Reprogramming

7

11. In a biosafety level 2 laminar flow hood, mix the plasmid-PEI solution by inversion, and add it to the 293T dish dropwise (1 mL into a 10-cm plate), distribute by gentle agitation, and return the cell culture dish to the 37  C incubator. 12. After 5–6 h, change the medium to fresh pre-warmed MEF medium (see Note 21). 13. (Optional) 18–24 h after this first medium change, either half or the whole supernatant volume can be harvested in conical tubes and replaced by fresh, pre-warmed MEF medium (see Notes 22 and 23). Store collected supernatant at 4  C. 14. 48 h after the first medium change, harvest the cell supernatant containing the lentivirus particles, and discard the cell culture plates (see Note 24). If a first harvest was performed after 24 h, pool together both 24- and 48-h supernatants before proceeding. 15. Pellet the cell debris (1000 rpm, 5 min at 4  C), and filter supernatant through a 45-μm filter with the help of a syringe. 16. The lentiviral-containing medium can be used fresh for MEF transduction. Alternatively, it can either be stored at 4  C for short-term use (1–7 days) or be further processed for concentration and long-term storage at 80  C (months) (see Notes 25 and 26). 3.4 MEF Transduction and Neuronal Reprogramming

1. Thaw a 1-mL vial of cryopreserved MEFs from Subheading 3.2 in a water bath at 37  C, and add the contents of the vial to 20 mL of pre-warmed MEF medium. Plate the solution in a 15-cm dish, and transfer to the 37  C incubator. 2. The next day, change the medium to remove dead and unattached cells. 3. Once the cells are 90–100% confluent (usually 2–3 days after thawing), follow steps 1–3 in Subheading 3.2 to obtain a single-cell suspension. 4. Remove a small aliquot (10–25μL) of the cell suspension, mix it with an equal amount of trypan blue solution, and add 10μL of this mixture to a cell counting chamber to estimate total and live cell numbers. 5. Re-plate MEF cells in the desired plate format for neuronal reprogramming: for 12-well plates, we usually seed 150,000 living cells per well (see Note 27). 6. The day after plating, aspirate off the medium of the MEF cells to remove dead and unattached cells, and change to pre-warmed MEF medium with 8μg/mL of polybrene (see Note 28).

8

Juan M. Adrian-Segarra et al.

7. In a biosafety level 2 laminar flow hood, prepare the lentiviral master mix by combining lentivirus-containing solutions with rtTA (if using the suggested doxycycline-inducible expression system), Brn2, Ascl1, and Myt1l supplemented with 8μg/mL of polybrene. We employ a 1:1.5:2:3.5 ratio for rtTA:Ascl1: Brn2:Myt1l and test three different total virus volumes (e.g., 150, 300, and 600μL of fresh lentivirus solution) per single well of a 12-well plate, in order to find the optimal viral load leading to adequate reprogramming without excessive cell death (see Notes 29 and 30). 8. Add the corresponding amounts of lentiviral master mix to the side of each well, distribute by gentle agitation, and place into the 37  C incubator. 9. On the following day, change the medium to pre-warmed MEF medium with 2μg/mL of doxycycline to induce gene expression (see Note 31). 10. Two days after induction of gene expression, change the medium to double the usual volume (e.g., 2 mL in a well of a 12-well plate) of neuronal induction medium supplemented with 2μg/mL of doxycycline. 11. It is recommended to harvest cells on this day to verify gene expression by immunofluorescence, in order to ensure that all transgenes present a high transduction rate, before proceeding with the reprogramming protocol. 12. Every other day until the desired endpoint of the experiment, replace half of the medium with fresh pre-warmed neuronal induction medium supplemented with 4μg/mL of doxycycline (see Note 32).

4

Notes 1. β-Mercaptoethanol is able to enhance growth and survival of several primary mouse cells, an observation that has been linked to its antioxidant and protein synthesis-promoting abilities [13]. Note that this reagent is highly toxic and should be handled using appropriate precautions. 2. These three vectors are available through Addgene: pMDLg/ pRRE (Addgene #12251), pRSV-Rev (Addgene#12253), and VSV-G (Addgene#12259). Alternatively, other lentiviral expression vectors can be used. 3. Constructs containing these three genes under the control of a tetracycline-dependent promoter have been made available through Addgene (#27150, 27151, and 27152). This particular system requires co-infection with reverse tetracyclinecontrolled transactivator (rtTA; Addgene#26429) to induce

Direct Neuronal Reprogramming

9

gene expression upon doxycycline induction. While this system allows precise control of reprogramming factor expression, non-inducible constitutive alternatives should also lead to successful reprogramming. 4. HEK-293T cells were derived from the parental HEK-293 line by stable transfection with the SV40 large T antigen, greatly increasing expression from plasmids carrying the SV40 origin of replication [14, 15]. 5. Embryonic days 13.5–15.5 are generally regarded as the optimal time for MEF isolation, but embryos can be harvested at earlier time points (starting from E8.5) if required [16]. Ensure that the animal is sacrificed in a way approved by the institution’s animal guidelines: we recommend cervical dislocation to minimize its suffering. 6. We recommend switching to another set of surgical tools after this step or alternatively cleaning them thoroughly with 80% ethanol to minimize the risk of contamination. 7. In case all embryos have the same genotype, we generally pool limbs from four embryos per 15-cm plate. If different genotypes are expected, the process can be done individually for each embryo. 8. Employing only the limbs ensures that no neural tissue is isolated along with the MEFs, making certain that the neuron-like cells observed at the end of the protocol are exclusively due to a successful reprogramming event. 9. If the mice need to be genotyped, we routinely cut the tail and transfer it to a separate tube, which will later be processed to isolate genomic DNA. 10. It is normal for small tissue clumps to be present in the culture plate at this stage: these will become dissociated after passaging the cells. 11. Usually 3 mL is sufficient for a 15-cm plate, if the plate is tilted repeatedly in different directions to ensure that the trypsinEDTA solution is evenly spread throughout the plate surface. 12. Freshly isolated MEFs usually exhibit slightly higher reprogramming efficiencies in comparison to cryopreserved cells, but both are capable of undergoing neuronal reprogramming successfully. We generate large stocks of cryopreserved cells and use them for most experiments to diminish batch-to-batch variability between different MEF preparations. However, for some assays (e.g., single-cell sequencing) in which achieving the highest possible reprogramming efficiency is critical, using freshly isolated MEFs is recommended instead. 13. In our experience, a fully confluent 15-cm plate usually yields around 20–30  106 MEF cells, and a 1-mL cryostock vial

10

Juan M. Adrian-Segarra et al.

prepared in this way will contain approximately 5–7.5  106 cells. 14. In our experience, MEFs can be preserved in this way for years without losing their reprogramming abilities. 15. The incubation time can be extended as necessary, even to overnight coating, as long as the PO solution does not completely dry. The size of the dish can be modified as long as the volume of PO solution is adjusted to cover the entire plate surface. 16. Ensuring that 293T have not become over-confluent or nutrient-deprived (pH indicator in the culture medium turning orange/yellow) at any point during the culturing process is critical to obtain high virus titers. If properly maintained, there is no strict limit to the number of passages at which 293T cells are able to produce optimal lentiviral amounts, although employing cells under passage 20 is usually recommended to guarantee maximum cell health and viability [17]. 17. Passaging 293T cells 1:2 the day before plating in PO-coated dishes can help ensure that cells are healthy and in an active growing phase. 18. The number of cells plated should be optimized depending on the cell counting device and plate size used. We aim to plate the cells to achieve ~90% confluency on the day of transfection. 19. We recommend transfecting one plate with a GFP transfer plasmid in every experiment as a control, in order to verify adequate transfection efficiency. 20. The PEI master mix in this protocol results in a 3:1 PEI:DNA ratio in the final reaction. If the results are unsatisfactory, higher PEI:DNA ratios (up to 5:1) have been shown to lead to higher transfection efficiencies and transcript expression [18]. 21. If a GFP control has been included, GFP expression should already be visible in a few cells at this point. 22. Place the harvested supernatant immediately on ice to minimize lentiviral particle degradation, as lentiviruses have been reported to have a much shorter half-life at 37  C [19]. 23. If a GFP control has been included, a successful lentiviral preparation will have at least 50% of GFP-positive cells at this point. 24. Sometimes, 293T cells easily detach from the plate while harvesting the supernatant at this point; in our experience, this has no impact on lentiviral quality. If a GFP control has been included, the majority of cells (>80%) should be GFP-positive cells.

Direct Neuronal Reprogramming

11

25. Lentiviral concentration is generally not needed for transducing cells in culture, but can be helpful to minimize storage space or if the cells to be transduced require a different cell culture medium. If lentiviral concentration is required, transfer the lentivirus-containing supernatants to clear ultracentrifuge tubes, and concentrate by centrifugation at 23,000 rcf for 90–120 min. Carefully aspirate the supernatant, add the desired volume of either PBS or DMEM (without supplements), and allow to resuspend overnight at 4  C before proceeding. 26. In the case of storing lentiviral stocks at 80  C, care should be taken to produce single-use aliquots and avoid repeated freezethaw cycles, since virus titers drop sharply after each round of freezing and thawing [19]. 27. This amount should be adjusted so that MEFs are 60–70% confluent the day after seeding to ensure optimal viral transduction. Optimize and scale accordingly for other plate formats. 28. Polybrene stocks are usually prepared at 8 mg/mL in water, sterile-filtered, dispensed into single-use aliquots, and stored at 20  C. Once thawed, aliquots can be kept at 4  C for 1–2 months without loss of activity, but should not be frozen again [20]. 29. We rarely titrate our lentivirus solutions due to the additional time and effort involved, although several methods are available to do so if desired [21]. Instead, we determine an approximate ratio among the different genes based on their relative size, since it has been shown that packaging efficiency into lentiviral particles is largely dependent on size [22]. 30. In the case of concentrated lentiviral solutions, we first dilute them in a corresponding amount of MEF medium with polybrene before performing the transduction as above. 31. We generally prepare doxycycline stocks at 2 mg/mL in water and filter-sterilize them. Doxycycline is freeze-thaw insensitive and can be stored at 20  C for months and at 4  C for weeks without detectable loss of activity, as long as it is kept protected from light (e.g., by using opaque tubes or wrapping them in aluminum foil). 32. Successful neuronal reprogramming is greatly aided by the soluble factors secreted into the cell culture medium by the nascent neuron-like cells, which makes the half-medium exchanges critical to ensure adequate reprogramming. After a week, reprogrammed cells can be co-cultured with glia to accelerate maturation [3].

12

Juan M. Adrian-Segarra et al.

References 1. Masserdotti G, Gasco´n S, Go¨tz M (2016) Direct neuronal reprogramming: learning from and for development. Development 143:2494–2510. https://doi.org/10.1242/ dev.092163 2. Colasante G, Rubio A, Massimino L, Broccoli V (2019) Direct neuronal reprogramming reveals unknown functions for known transcription factors. Front Neurosci 13:283. https://doi.org/10.3389/fnins.2019.00283 3. Vierbuchen T, Ostermeier A, Pang ZP et al (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463:1035–1041. https://doi.org/10.1038/ nature08797 4. Wapinski OL, Vierbuchen T, Qu K et al (2013) Hierarchical mechanisms for direct reprogramming of fibroblasts to neurons. Cell 155:621–635. https://doi.org/10.1016/j. cell.2013.09.028 5. Mall M, Kareta MS, Chanda S et al (2017) Myt1l safeguards neuronal identity by actively repressing many non-neuronal fates. Nature 544:245–249. https://doi.org/10.1038/ nature21722 6. Luo C, Lee QY, Wapinski O et al (2019) Global DNA methylation remodeling during direct reprogramming of fibroblasts to neurons. elife 8:e40197. https://doi.org/10. 7554/eLife.40197 7. Chanda S, Ang CE, Davila J et al (2014) Generation of induced neuronal cells by the single reprogramming factor ASCL1. Stem Cell Reports 3:282–296. https://doi.org/10. 1016/j.stemcr.2014.05.020 8. Adrian-Segarra JM, Weigel B, Mall M (2021) Combining cell fate reprogramming and protein engineering to study transcription factor functions. In: Ahlenius H (ed) Neural reprogramming: methods and protocols. Methods in molecular biology, vol 2352. Springer, New York 9. Drouin-Ouellet J, Pircs K, Barker RA et al (2017) Direct neuronal reprogramming for disease modeling studies using patient-derived neurons: what have we learned? Front Neurosci 11:530. https://doi.org/10.3389/fnins. 2017.00530 10. Pang ZP, Yang N, Vierbuchen T et al (2011) Induction of human neuronal cells by defined transcription factors. Nature 476:220–223. https://doi.org/10.1038/nature10202 11. Zhang Y, Pak C, Han Y et al (2013) Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron

78:785–798. https://doi.org/10.1016/j.neu ron.2013.05.029 12. Yang N, Chanda S, Marro S et al (2017) Generation of pure GABAergic neurons by transcription factor programming. Nat Methods 14:621–628. https://doi.org/10.1038/ nmeth.4291 13. Pruett SB, Obiri N, Kiel JL (1989) Involvement and relative importance of at least two distinct mechanisms in the effects of 2-mercaptoethanol on murine lymphocytes in culture. J Cell Physiol 141:40–45. https://doi. org/10.1002/jcp.1041410107 14. DuBridge RB, Tang P, Hsia HC et al (1987) Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol 7:379–387. https://doi.org/10.1128/ mcb.7.1.379 15. Pear WS, Nolan GP, Scott ML, Baltimore D (1993) Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 90:8392–8396. https:// doi.org/10.1073/pnas.90.18.8392 16. Xu J (2005) Preparation, culture, and immortalization of mouse embryonic fibroblasts. Curr Protoc Mol Biol 28(1):1–8 17. Elegheert J, Behiels E, Bishop B et al (2018) Lentiviral transduction of mammalian cells for fast, scalable and high-level production of soluble and membrane proteins. Nat Protoc 13:2991–3017. https://doi.org/10.1038/ s41596-018-0075-9 18. Xie Q, Xinyong G, Xianjin C, Yayu W (2013) PEI/DNA formation affects transient gene expression in suspension Chinese hamster ovary cells via a one-step transfection process. Cytotechnology 65:263–271. https://doi. org/10.1007/s10616-012-9483-9 19. Higashikawa F, Chang L (2001) Kinetic analyses of stability of simple and complex retroviral vectors. Virology 280:124–131. https:// doi.org/10.1006/viro.2000.0743 20. Murray EJ (1991) Gene transfer and expression protocols. Humana Press, Clifton, NJ 21. Kutner RH, Zhang X-Y, Reiser J (2009) Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nat Protoc 4:495–505. https://doi.org/10. 1038/nprot.2009.22 22. Kumar M, Keller B, Makalou N, Sutton RE (2001) Systematic determination of the packaging limit of lentiviral vectors. Hum Gene Ther 12:1893–1905. https://doi.org/10. 1089/104303401753153947

Chapter 2 Direct In Vitro Reprogramming of Astrocytes into Induced Neurons Nesrin Sharif, Filippo Calzolari, and Benedikt Berninger Abstract Spontaneous neuronal replacement is almost absent in the postnatal mammalian nervous system. However, several studies have shown that both early postnatal and adult astroglia can be reprogrammed in vitro or in vivo by forced expression of proneural transcription factors, such as Neurogenin-2 or Achaete-scute homolog 1 (Ascl1), to acquire a neuronal fate. The reprogramming process stably induces properties such as distinctly neuronal morphology, expression of neuron-specific proteins, and the gain of mature neuronal functional features. Direct conversion of astroglia into neurons thus possesses potential as a basis for cellbased strategies against neurological diseases. In this chapter, we describe a well-established protocol used for direct reprogramming of postnatal cortical astrocytes into functional neurons in vitro and discuss available tools and approaches to dissect molecular and cell biological mechanisms underlying the reprogramming process. Key words Proneural, Astrocyte culture, Glia-to-neuron conversion, Cell fate plasticity, Glutamatergic neuron, GABAergic neuron

1

Introduction The mammalian central nervous system (CNS) almost entirely lacks the ability to replace damaged or lost neurons, and any recovery following acute or progressive CNS damage must thus rely on the functional or structural reorganization of spared elements [1]. Replacing missing neurons may limit or reverse the effects of neuronal loss, and extensive efforts have been made toward achieving this goal [2, 3]. One approach, relying on the induction of direct reprogramming of non-neuronal cells into induced neurons (iNs), has emerged during the last decade and shows great promise. Fate conversion of CNS resident non-neuronal cells has been achieved both in vitro and in vivo [4, 5], and iNs have been shown to progressively and, at least in vitro, rapidly acquire structural and functional hallmarks of mature CNS neurons [6– 8]. Increasing evidence suggests that, in vivo, iNs can establish

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

13

14

Nesrin Sharif et al.

physiologically relevant connections, based, e.g., on the extension of appropriate axonal projections [9, 10]. Reprogramming to iNs is frequently enforced by genetic means, often via the retroviral overexpression of selected neurogenic transcription factors (TFs). Of note, successful conversion has as well been achieved by genetic perturbation of RNA-binding protein and microRNA activities and by modulation of signaling pathways and epigenetic modifiers through small molecules [10–14]. The choice of transcription factors has been mostly guided by knowledge regarding TF roles during developmental or postnatal neurogenesis [15], but recent attempts to systematically explore TF combinations for their ability to drive reprogramming from a single cell type are paving the way to less hypothesis-driven and more unbiased approaches [16, 17]. The introduction of single-cell transcriptomic and epigenomic methods has enabled significant advances in our mechanistic understanding of cell identity conversion [18–21] (and see ref. 22 for a recent review), even if much territory certainly remains to be charted. Importantly, while in vivo fate conversion allows addressing essential questions regarding, e.g., iN functional maturation and connectivity patterns and constitutes the ultimate goal for translational purposes, relatively low experimental throughput and the limited opportunity for live monitoring of reprogrammingassociated processes still limit the scope of possible in vivo investigations. On the other hand, in vitro reprogramming allows a broad and diverse set of experimental approaches that make it the ideal experimental paradigm to explore essential mechanistic questions regarding reprogramming to iNs. In fact, in vitro dissection of fate conversion mechanisms has allowed drawing parallels to developmental processes [18, 23] and led to the identification and circumvention of metabolic bottlenecks, paving the way to improved in vivo reprogramming efficiencies [24–26]. Importantly, the relative strengths of both systems can be exploited to gain new insights into the reprogramming process and the identification of variables, such as regional identity and local environments, that may affect its in vivo outcome [27]. While conversion to iNs of representatives of virtually all neural and non-neural CNS cell types has proven successful, astrocytes are currently most commonly employed. This is due to their closer lineage proximity to neurons, compared to non-neural cells, as well as to the similarities between astroglia and all known neurogenic adult neural stem cell populations [28]. Furthermore, parenchymal astrocytes in at least some CNS regions are endowed with a latent neurogenic potential that can be evoked by genetic perturbation of Notch signaling or induced by injury [29, 30], supporting the choice of astroglia as a relevant target for neuronal reprogramming. Astrocytes from the cortical gray matter are normally employed, but it is now clear that several CNS regions harbor astrocytes that can be reprogrammed to

In Vitro Astroglia-to-Neuron Reprogramming

15

neurons and that the diversity among astrocytes, as observed between and even within CNS regions [31, 32], affects the outcome of the reprogramming process [9, 27, 33, 34]. In addition, several experimental options have become accessible to investigators focusing on astroglial conversion to neurons, such as the culturing of adult human and murine astroglia under potentially more physiologically relevant serum-free conditions [35], the possibility of differentiating induced pluripotent stem cells (iPSCs) to astrocytes [36, 37], the accessibility of human astrocytes embedded in the in vivo-like setting provided by brain organoids [38], and the availability of chimeric human-murine in vivo models [39]. Our and other laboratories’ exploration of paths to iN generation from postnatal astrocytes has clarified several basic aspects of the reprogramming process, aided by a simple and reliable protocol for the establishment of primary postnatal astroglial cultures. Below, we provide the reader with a comprehensive description of the method and highlight critical aspects to be considered to successfully implement this protocol. We conclude by discussing established and novel tools and their applications to the mechanistic dissection of cell fate conversion processes.

2

Materials

2.1 Experimental Animals

1. Mouse pups between postnatal days 5 and 7 (e.g., C57BL/6J) (see Notes 1 and 2).

2.2 Media and Solutions

1. Dissection medium: Hank’s Balanced Salt Solution (HBSS) with CaCl2 and MgCl2, 10 mM HEPES.

2.2.1 Dissection of the Postnatal Mouse Neocortex 2.2.2 Primary Astroglia Culture: Preparation and Maintenance

1. Astrocyte medium: 10% (v/v) heat-inactivated FBS, 5% (v/v) heat-inactivated horse serum, 2% (v/v) B27, 10 ng/ml FGF, 10 ng/ml EGF, 2 mM GlutaMAX, 1% (v/v) penicillin/streptomycin in DMEM/F-12 (see Note 3). Prepare this medium always fresh, pre-warm at 37  C, and CO2-equilibrate before use. 2. Trypsin/EDTA 0.05% (w/v). 3. Dulbecco’s phosphate-buffered saline (PBS) without CaCl2 and MgCl2 (1, pH 7.4). 4. Trypan blue dye. 5. Poly-D-lysine (PDL) working solution: Add 1 ml of 1 mg/ml PDL to 50 ml of autoclaved PBS. Filter-sterilize the solution and store at 4  C.

16

Nesrin Sharif et al.

2.2.3 Retroviral Transduction or Plasmid Transfection of Astroglial Cells

1. Retroviruses/plasmids encoding for reprogramming factor (s) of interest and reporter of choice. 2. Differentiation medium: 2 mM GlutaMAX, 2% (v/v) B27, 1% penicillin/streptomycin in DMEM-F12. 3. Transfection medium: 2 mM GlutaMAX, 10 ng/ml FGF, 10 ng/ml EGF in Opti-MEM. 4. Lipofectamine 2000.

2.3

Equipment

1. Dissection instruments: Dumont no. 5 forceps, Dumont no. 5SF forceps, surgical scissors, spatula or spoon, disposable surgical blades. 2. Tissue culture dishes (60 mm). 3. Tissue culture flasks (25 cm2). 4. Tissue culture plates (24-well). 5. Glass coverslips. 6. Glass Pasteur pipettes. 7. Pipetus. 8. Sterile cell culture consumables: Conical centrifuge tubes (2 ml and 15 ml), pipette tips, 10 ml serological pipettes. 9. Hemocytometer. 10. Tissue culture incubator (37  C, 5% CO2), tissue culture incubator (37  C, 8–10% CO2).

3

Methods

3.1 Dissection of the Postnatal Mouse Neocortex

1. Perform all steps of the dissection of the mouse brain tissue on ice and, if possible, under sterile conditions (see Note 1). 2. Prepare a 60 mm tissue culture dish as well as a number of Falcon tubes according to the number of animals to be used containing ice-cold dissection medium, and keep them on ice until use. 3. Decapitate the postnatal mice at the age of P5–P7. Remove the whole brain from the skull, and transfer the brain into a 60 mm tissue culture dish (see Note 2). 4. Remove first most of the brain regions caudal to the forebrain with a straight cut using a blade, and discard it (Fig. 1, step 1). 5. Position the remaining part of the brain with the ventral side up in order to remove the anterior part by cutting it coronally at the level of the optic chiasm (Fig. 1, step 2). Discard the anterior part of the brain (see Note 4). 6. Separate the two hemispheres by cutting the brain along the longitudinal fissure.

In Vitro Astroglia-to-Neuron Reprogramming

17

Fig. 1 Initial dissection steps during primary astroglial culture preparation. Dorsal (upper left), ventral (upper right), and midline sagittal views with indicated approximate lines of dissection (red dashed lines) and tools of choice. Numbers refer to steps as numbered in Subheading 3.1

7. Carefully remove the meninges with fine forceps by stripping them off from the tissue surface of each hemisphere. 8. Discard the ventral telencephalon, the diencephalon, and the hippocampal formation, leaving only the neocortex. 9. Carefully separate as much as possible of the developing white matter from the dissected cortical gray matter tissue of the hemisphere, in order to ensure a high purity of the astrocyte culture (see Note 5). 10. Mince the dissected cortical hemisphere into small tissue pieces using a blade or fine forceps. Transfer them into a 15 ml conical tube containing ice-cold dissection medium. 3.2 Preparation of Astroglia Primary Culture

1. Dissociate the tissue mechanically by triturating the tissue containing solution with a fire-polished glass Pasteur pipette (approx. 10 times), obtaining a turbid single-cell suspension devoid of visible tissue chunks (see Note 6). 2. After obtaining a single-cell suspension, add ice-cold dissection medium to reach a total volume of 15 ml. 3. Centrifuge the cell suspension at 120  g (1000 r.p.m.) for 5 min at 4  C. 4. Aspirate the supernatant, and resuspend the precipitated cells with 5 ml of pre-warmed (37  C) and CO2-equilibrated astrocyte medium by gently resuspending the cellular pellet. 5. Transfer the cell suspension into an uncoated 25 cm2 tissue culture flask, and incubate the cells at 37  C with 5% CO2 for a total of 5–7 days of culturing to allow expansion of the cells.

18

Nesrin Sharif et al.

Fig. 2 Astroglia culture from the P5 postnatal cortex. After 5 days of culturing, the astrocyte culture was passaged and kept for 4 days in differentiation medium. Cells were fixed and immunostained against the astroglia marker GFAP and the neuronal marker βIII-tubulin. The culture is devoid of contaminating neurons as shown by absence of βIII-tubulin-positive cells. Scale bar, 25 μm

6. After 3 days, aspirate the medium containing tissue debris, and add 5 ml of fresh astrocyte medium. Gently shake the tissue culture flask to wash off debris, and aspirate the astrocyte medium again. Add 5 ml of fresh, pre-warmed, and CO2equilibrated astrocyte medium, and incubate the cells at 37  C with 5% CO2. 7. Under this condition, a monolayer of astroglial cells with 70–80% confluency is usually achieved within 5–7 days of culturing (Fig. 2). 3.3 Preparation of Glass Coverslips

1. Add 500 μl of PDL working solution to each well of a 24-well tissue culture plate containing a glass coverslip (see Note 7). 2. Incubate the plate for minimum 2–4 h at 37  C. 3. Aspirate the PDL working solution, and wash the coverslips thoroughly with water. 4. Dry coated coverslips, and store at 4  C until passaging of astrocytes, maximum for 1 week (see Note 8).

3.4 Passaging and Plating of Astroglial Cells

1. After cells reach a confluency of 70–80% (usually after 5–7 days in culture), aspirate the astrocyte medium, and wash the cells with 5 ml of PBS. By vigorously shaking the tissue culture flask, contaminating oligodendrocyte precursors cells (OPCs), which might have grown on top of the astroglia cell layer, can be removed. 2. Aspirate the PBS and floating cells. Add enough trypsin/ EDTA to cover the cell layer (1 ml is enough for a 25 cm2 tissue culture flask). Incubate for 5 min at 37  C. 3. In case not all cells have detached after 5 min of incubation, gently tap the flask on its sides to dislodge all adherent cells. 4. Add 5 ml of fresh, pre-warmed, and CO2-equilibrated astrocyte medium, and gently resuspend the cells by careful pipetting.

In Vitro Astroglia-to-Neuron Reprogramming

19

5. Harvest the cell suspension and transfer it into a 15 ml conical tube. 6. Centrifuge at 120  g (1000 r.p.m.) for 5 min at room temperature (RT) (20–25  C). 7. Aspirate the supernatant, and resuspend the cells in an appropriate volume of astrocyte medium by slowly pipetting up and down (around 5 times) to obtain a homogenous cell suspension. 8. Count the cells using a hemocytometer. Ideally, add trypan blue in order to exclude dead cells from the counting. We usually obtain 1.0–1.5  106 cells from one confluent 25 cm2 tissue culture flask. 9. Dilute the cell suspension to obtain 50,000–60,000 cells per 100 μl of astrocyte medium (37  C pre-warmed and CO2equilibrated). Carefully pipette 100 μl of the cell suspension directly on each pre-coated and completely dried coverslip of a 24-well plate (see Notes 9 and 10). 10. Incubate for 1–2 h at 37  C with 5% CO2. 11. After adhesion of the cells (usually after 1–2 h), add additional 400 μl of fresh, pre-warmed, and CO2-equilibrated astrocyte medium to each well. 12. Incubate cells at 37  C with 5% CO2. 3.5 Retroviral Transduction or Plasmid Transfection of Astroglial Cells

Depending on the following experiments, astrocytes can either be transduced using retroviral vectors (Part A) 4–12 h after plating or transfected with plasmids 24 h after plating (Part B) (see Note 11). When using retroviral particles, please refer to the local biosafety guidelines of your institution, and handle the viral particles under S2/BL2 conditions. Part A: Retroviral Transduction 1. Add an appropriate volume of your retroviral vectors with a titer ranging from 1  106 to 1  108 colony-forming units (c.f.u). Gently shake the tissue culture plate to homogenously distribute the viral particles (see Notes 12 and 13). 2. Incubate the cells for 24 h at 37  C with 5% CO2. Part B: Transfection 1. At the time of transfection, astrocytes should have a confluency of 70–80% in order to achieve a successful transfection. 2. Prepare fresh transfection medium. 3. Remove the astrocyte medium from the cells, and add 300 μl of pre-warmed transfection medium in each well (see Notes 14 and 15). Collect the astrocyte medium for later reuse as conditioned medium.

20

Nesrin Sharif et al.

4. Incubate the cells for at least 1 h in the incubator at 37  C with 5% CO2. 5. During incubation time, prepare the transfection mix. Avoid using conical-tipped centrifuge tubes; 2 ml centrifuge tubes are recommended. 6. For the DNA mix, prepare a master mix for all wells to be transfected with the same plasmid with 50 μl/well of transfection medium and 0.5 μg of the (retroviral) plasmid DNA/well. It is important that the maximum quantity of DNA/well is 0.5 μg; when transfecting several plasmids, the total quantity of DNA still should be 0.5 μg. 7. In a second tube, prepare a master mix for all wells to be transfected with 50 μl/well of transfection medium and 0.7 μl/well Lipofectamine 2000. 8. Mix the solutions well by inverting the centrifuge tubes a few times. Incubate for 10 min at RT. 9. Add drop by drop the lipofectamine mixture to the DNA mixture. Mix the solution by pipetting up and down. Incubate for 30 min at RT before use. 10. Add, drop by drop, 100 μl/well of the DNA/lipofectamine mix (prepared in step 9) on the cells by distributing it well through regular shaking. 11. Incubate the cells for 4 h at 37 with 5% CO2. 12. Aspirate the transfection medium, and add 250 μl of the pre-warmed and CO2-equilibrated conditioned astrocyte medium (collected in step 3) with addition of 250 μl of fresh astrocyte medium. 13. Incubate the cells for 24 h at 37  C with 5% CO2. 3.6 Astroglia-toNeuron Conversion

1. 24 h following retroviral transduction or plasmid transfection, aspirate the astrocyte medium from the cells, and add 500 μl of freshly prepared, pre-warmed (37  C), and CO2-equilibrated differentiation medium. 2. Maintain the cells in culture in differentiation medium at 37  C and 8–10% CO2 until the emergence of astroglia-derived neurons 5–7 days post-infection (d.p.i.) (see Note 16). 3. Starting 5 days after transduction or transfection, every fourth day during the differentiation and maturation period, one fifth of the medium was replaced with fresh differentiation medium, supplemented with 20 ng/ml BDNF, in order to promote synapse formation. 4. Progression along the reprogramming path can be assessed by performing immunocytochemistry stainings at various time points. Early evidence of Neurog2-driven reprogramming to

In Vitro Astroglia-to-Neuron Reprogramming

21

Fig. 3 Immunocytochemical staining of astroglial-derived neurons. Induced neurons (iNs) were obtained through forced expression of the transcription factor Neurog2 using a retroviral construct encoding for Neurog2 and DsRed in postnatal cortical astroglia, immunostained for the fluorescence reporter DsRed and the neuronal marker βIII-tubulin 7 days post-transduction. Scale bar, 25 μm

a glutamatergic iN comprises a sequential upregulation of the T-box TF Tbr2 and Tbr1, recapitulating early neurogenic steps (see Note 17). Neuron-specific marker proteins, such as Doublecortin or βIII-tubulin, can be detected 3–4 days posttransduction, while MAP2 and NeuN can be detected at later stages (starting from 10 to 14 days post-transduction) (Fig. 3). As maturation progresses, more refined features, such as synaptic proteins, can be detected. 3.7 Discussion and Prospects

We have presented one commonly employed method outlining the culturing of murine postnatal cortical astrocytes and converting them to induced neurons by ectopic overexpression of transcription factors with established roles in embryonic and adult neurogenesis. Importantly, approaches to cell identity conversion and the potential for interrogation of experimental outcomes have been undergoing very rapid and significant expansion in recent years, mostly driven by advances in sequencing technologies, but also by an expanding array of flexible experimental tools. Here we briefly discuss some of these tools and techniques and the experimental opportunities they afford, in light of their potential relevance to the mechanistic dissection of cell reprogramming events. Single-cell genomic technologies offer cell-resolution insights into transcriptional and genome accessibility dynamics, as cell reprogramming unfolds (Fig. 4; [41]). This allows interrogating intrinsic and, increasingly, cell non-autonomous [42] processes taking place as cells traverse the cell state landscape. Timed expression of reprogramming factors, via, e.g., chemogenetic modulation [26] or by placing reprogramming vector activity under control of the cell’s own regulatory networks [43], affords increasingly resolved dissection of the reprogramming process (Fig. 4). Singlefactor or low-scale library-based approaches can be undertaken to investigate the role of or discover modulators (and combinations thereof) of reprogramming. The scope of classical loss-of-function

22

Nesrin Sharif et al.

Fig. 4 Astroglial reprogramming to iNs provides a flexible experimental system to explore neuronal identity and functional maturation at different levels of complexity. Single-cell genomics provides insights into molecular mechanisms underlying reprogramming (a). Possible avenues of investigation comprise the combinatorial screening of potential reprogramming factors (RF) and the temporal modulation of RF activity, each providing insights into distinct aspects of the reprogramming process (b). The ability of iNs to undergo functional maturation and integration into neuronal networks can be studied using a co-culture system in which iNs are seeded with primary neurons (c)

experiments, aimed at assessing the relevance of candidate genes to the reprogramming process, relying on the full or conditional knockout of one or more genes [23], can be extended by genome-wide RNAi- or Crispr-based screening efforts [44]. Crispr-based epigenomic engineering, with its potential for genome-wide combinatorial interrogation of gene activities, offers still further avenues of discovery of modulators of the reprogramming process [45].

In Vitro Astroglia-to-Neuron Reprogramming

23

While most bulk or single-cell approaches only provide snapshots of a cell’s state, methods to predict short-term transcriptional state transitions [46, 47] or to record genomic binding events [48] can provide a temporal dimension to single-cell measurements performed during reprogramming. Even a relatively coarse mapping of molecular or morphological milestones can guide a more detailed dissection of the reprogramming process at different levels of complexity, using different tools. For example, as cells undergo reprogramming, time-lapse microscopy allows live monitoring of morphological dynamics over extended periods of time [18, 49]. The use of fluorescent reporters specific to distinct reprogramming stages [25] and the live labelling of specific cellular structures or compartments [50] can facilitate pinpointing molecular or morphological cell state transitions, respectively, which can in turn become the focus of more sophisticated investigations. Genetically encoded calcium or voltage indicators could allow long-term monitoring of functional properties of individual iNs and of their level of integration into local neuronal networks, possibly complementing and refining multi-electrode array-based approaches [51]. Finally, single-cell electrophysiological approaches and related techniques (e.g., Patch-seq; [52]) can contribute sharper, albeit less easily scalable, morphological, and functional descriptions. Co-culturing iNs during their maturation with priorly established neuronal cultures (Fig. 4) would provide a relatively simple 2D system to assess iN functional integration, with significant practical advantages over studies conducted in vivo or within whole or sliced organoids [38]. In conclusion, a multitude of tools can be deployed to investigate direct reprogramming to aid the mechanistic dissection of processes underlying the assignment, acquisition, maintenance, and restructuring of cell identity and function. Our expanded understanding of such basic aspects of cell and developmental biology will have translational repercussions on a scale we only begin to appreciate.

4

Notes 1. All experiments should be performed in accordance with institutional regulations regarding the use of animals for research purposes. 2. The current protocol is developed for an efficient neuronal conversion of astroglia prepared from the cerebral cortex of wild-type mice between postnatal days 5 and 7. Mutant (full or conditional) animals can be employed, provided that the genetic modifications do not impact on in vitro astroglial proliferative activity or viability.

24

Nesrin Sharif et al.

3. Addition of animal sera promotes growth, proliferation, as well as other features associated with reactive astrogliosis, mimicking an in vivo injury-associated state and thus significantly departing from a physiological astrocytic condition. Protocols exist for serum-free cultivation of postnatal and adult astrocytes [35], but have not been employed to attempt reprogramming, to the best of our knowledge. Applying the presented protocol, it is crucial that EGF and FGF are always added freshly to the astrocyte medium before use. 4. It is recommended to remove the anterior part of the brain in order to avoid contamination of the astroglia culture with progenitor cells from the subependymal zone and rostral migratory stream. 5. While gray matter contains predominantly protoplasmic astrocytes, white matter contains fibrous astrocytes. Our lab has not yet investigated the possibility to reprogram white matter astrocytes in vitro, but in vivo evidence indicates white matter astrocytes may be more refractory to forced reprogramming into neurons [9, 34]. 6. During mechanical dissociation of the tissue, pipette the solution very gently without generating air bubbles in order to preserve cell viability. If using a pipette instead of a glass Pasteur pipette, avoid using pipettes with a narrow diameter. 7. Rigorous preparation of coated coverslips is a crucial step for good adherence of astroglia and subsequent maintenance of generated astroglia-derived induced neurons. Glass coverslips are used due to their advantageous optical properties for subsequent analysis at an epifluorescence microscope, but can be replaced by plastic coverslips if other experiments are intended. 8. The most successful adherence of astrocytes on glass coverslips was achieved by using completely dried glass coverslips. 9. When seeding the cells on coverslips, avoid generating any air bubbles. 10. It is crucial to add fresh EGF and FGF into the astrocyte medium before seeding the cells on coverslips to ensure proliferation and thus retroviral transduction. 11. Retroviral transduction or plasmid transfection of astroglia cells in culture should be performed 5–7 days after culturing. We observed a correlation of longer time culturing periods with reduced reprogramming efficiency [26]. Tools are available to tune expression of reprogramming factors, and alternative viral vectors (e.g., lentiviral) can be employed to bypass the requirement for active proliferation imposed by the use of retroviruses.

In Vitro Astroglia-to-Neuron Reprogramming

25

12. This astroglia-to-neuron reprogramming protocol has been optimized for the use of retroviruses pseudotyped with VSV-G (vesicular stomatitis virus-glycoprotein), but ecotropic viruses can also be employed. We used replication-defective retroviral vectors comprising murine leukemia virus (MLV)derived retroviral elements (LTRs, Psi, WPRE) whose proviral transcription is driven by the synthetic compound Cytomegalovirus (CMV)/chicken beta-actin/rabbit beta-globin (CAG) promoter. Retroviral particles were produced using 293GPG cells, an inducible packaging cell system derived by stable modification of 293 HEK cells [40]. Packaging cells constitutively express essential retroviral replication machinery components (gag-pol) and can be induced to express VSV-G, thus ensuring mature virion production. Cells are grown under tetracycline (tet)-mediated repression of VSV-G expression until shortly before being transfected with the plasmid form of the retroviral vector of interest. At this point, tet concentration is halved. Full de-repression of VSV-G expression starts with medium change following transfection and results in mature virion release and gradual accumulation in the growth medium. Serial viral harvesting can be performed, starting on the second to third day after transfection and then every other day. Briefly, the virion-containing medium is collected and spun at 5000 rpm to remove cell debris, followed by filtering using a syringe-locking PVDF membrane 0.45 μm filter. The filtered medium is then spun at >15,000  g at 4  C for 1–2 h. We did not observe increased virion yields with longer centrifugation times. The supernatant is then discarded, the tube carefully dried, and the viral pellet resuspended in TBS-5 buffer, aliquoted, and stored at 80  C until use. A detailed, full, description of the employed retroviral production protocol is available upon request. 13. The best transduction efficiency of astroglial cells is normally obtained by using high-titer retroviral pseudotyped particles (viral stock concentration > 1  107 c.f.u./ml). We observed increased toxicity when adding increased volumes of low-titer viral particles. The exact amount of virus to be employed should be determined empirically and will depend on the specific experimental requirements (e.g., clonal analyses typically rely on sparse labelling, while biochemical essays will require widespread transduction). Do not repetitively freeze/thaw retroviral aliquots to prevent reducing viral titer, likely due to damage to the viral particles. 14. For the described transfection protocol, we have observed a neat performance of the transfection process when presence of serum in our transfection mix is minimal. Therefore, using reduced-serum medium is recommended.

26

Nesrin Sharif et al.

15. It is recommended not to use Opti-MEM that is older than 2 months for the preparation of transfection medium. When changing from astrocyte medium to transfection medium, try to minimize the time in which cells are without any medium. 16. Optimal neuronal maturation was achieved by incubating the cells after retroviral transduction or plasmid transfection in an 8–10% CO2 atmosphere. Moreover, throughout the astrogliato-neuron conversion and neuronal maturation period, we refrained from full medium changes and obtained with this approach the best results. 17. Distinct neuronal subtypes can be generated by using distinct neurogenic fate determinants. Ectopic expression of the transcription factor Neurog-2 instructs the generation of glutamatergic neurons from postnatal astroglia. These cells express early on the T-box transcription factors Tbr2 and Tbr1, both normally expressed during differentiation of glutamatergic neurons. Alternative differentiation trajectories—and thus marker expression—are to be expected in a reprogramming factor-specific manner.

Acknowledgments The following sources of funding from the German Research Foundation (DFG) supported work described in this chapter: CRC1080 (project number 221828878) and CRC1193 (project number 264810226). N.S. received support via a PhD fellowship granted by the Institute of Molecular Biology (IMB), Mainz. F.C. received support from Inneruniversitaere Forschungsfoerderung of the University Medical Center of Johannes Gutenberg University Mainz. References 1. Warraich Z, Kleim JA (2010) Neural plasticity: the biological substrate for neurorehabilitation. PM R 2(12 Suppl 2):S208–S219. https://doi.org/10.1016/j.pmrj.2010.10. 016 2. Grade S, Gotz M (2017) Neuronal replacement therapy: previous achievements and challenges ahead. NPJ Regen Med 2:29. https:// doi.org/10.1038/s41536-017-0033-0 3. Barker RA, Gotz M, Parmar M (2018) New approaches for brain repair-from rescue to reprogramming. Nature 557(7705):329–334. https://doi.org/10.1038/s41586-018-0087-1 4. Gascon S, Masserdotti G, Russo GL, Gotz M (2017) Direct neuronal reprogramming:

achievements, hurdles, and new roads to success. Cell Stem Cell 21(1):18–34. https://doi. org/10.1016/j.stem.2017.06.011 5. Vignoles R, Lentini C, d’Orange M, Heinrich C (2019) Direct lineage reprogramming for brain repair: breakthroughs and challenges. Trends Mol Med 25(10):897–914. https:// doi.org/10.1016/j.molmed.2019.06.006 6. Berninger B, Costa MR, Koch U, Schroeder T, Sutor B, Grothe B, Gotz M (2007) Functional properties of neurons derived from in vitro reprogrammed postnatal astroglia. J Neurosci 27(32):8654–8664. https://doi.org/10. 1523/JNEUROSCI.1615-07.2007

In Vitro Astroglia-to-Neuron Reprogramming 7. Blum R, Heinrich C, Sanchez R, Lepier A, Gundelfinger ED, Berninger B, Gotz M (2011) Neuronal network formation from reprogrammed early postnatal rat cortical glial cells. Cereb Cortex 21(2):413–424. https:// doi.org/10.1093/cercor/bhq107 8. Heinrich C, Blum R, Gascon S, Masserdotti G, Tripathi P, Sanchez R, Tiedt S, Schroeder T, Gotz M, Berninger B (2010) Directing astroglia from the cerebral cortex into subtype specific functional neurons. PLoS Biol 8(5): e1000373. https://doi.org/10.1371/journal. pbio.1000373 9. Mattugini N, Bocchi R, Scheuss V, Russo GL, Torper O, Lao CL, Gotz M (2020) Inducing different neuronal subtypes from astrocytes in the injured mouse cerebral cortex. Neuron 103:1086–1095.e1085. https://doi.org/10. 1016/j.neuron.2019.08.009 10. Zhou H, Su J, Hu X, Zhou C, Li H, Chen Z, Xiao Q, Wang B, Wu W, Sun Y, Zhou Y, Tang C, Liu F, Wang L, Feng C, Liu M, Li S, Zhang Y, Xu H, Yao H, Shi L, Yang H (2020) Glia-to-neuron conversion by CRISPR-CasRx alleviates symptoms of neurological disease in mice. Cell 181(3):590–603.e516. https://doi. org/10.1016/j.cell.2020.03.024 11. Lu YL, Yoo AS (2018) Mechanistic insights into MicroRNA-induced neuronal reprogramming of human adult fibroblasts. Front Neurosci 12:522. https://doi.org/10.3389/fnins. 2018.00522 12. Mahato B, Kaya KD, Fan Y, Sumien N, Shetty RA, Zhang W, Davis D, Mock T, Batabyal S, Ni A, Mohanty S, Han Z, Farjo R, Forster MJ, Swaroop A, Chavala SH (2020) Pharmacologic fibroblast reprogramming into photoreceptors restores vision. Nature 581(7806):83–88. https://doi.org/10.1038/s41586-020-2201-4 13. Zhang L, Yin JC, Yeh H, Ma NX, Lee G, Chen XA, Wang Y, Lin L, Chen L, Jin P, Wu GY, Chen G (2015) Small molecules efficiently reprogram human astroglial cells into functional neurons. Cell Stem Cell 17 (6):735–747. https://doi.org/10.1016/j. stem.2015.09.012 14. Qian H, Hu J, Zhang D, Meng F, Zhang X, Xue Y, Devaraj NK, Dowdy SF, Mobley WC, Cleveland DW, Fu X-D (2020) Therapeutic reversal of chemically induced parkinson disease by converting astrocytes into nigral neurons. bioRxiv:2020.2004.2006.028084. https://doi.org/10.1101/2020.04.06. 028084 15. Masserdotti G, Gascon S, Gotz M (2016) Direct neuronal reprogramming: learning from and for development. Development 143 (14):2494–2510. https://doi.org/10.1242/ dev.092163

27

16. Luginbu¨hl J, Kouno T, Nakano R, Chater TE, Sivaraman DM, Kishima M, Roudnicky F, Carninci P, Plessy C, Shin JW (2019) Decoding neuronal diversity by single-cell Convert-seq. bioRxiv:600239. https://doi.org/10.1101/ 600239 17. Tsunemoto R, Lee S, Szucs A, Chubukov P, Sokolova I, Blanchard JW, Eade KT, Bruggemann J, Wu C, Torkamani A, Sanna PP, Baldwin KK (2018) Diverse reprogramming codes for neuronal identity. Nature 557 (7705):375–380. https://doi.org/10.1038/ s41586-018-0103-5 18. Karow M, Camp JG, Falk S, Gerber T, Pataskar A, Gac-Santel M, Kageyama J, Brazovskaja A, Garding A, Fan W, Riedemann T, Casamassa A, Smiyakin A, Schichor C, Gotz M, Tiwari VK, Treutlein B, Berninger B (2018) Direct pericyte-to-neuron reprogramming via unfolding of a neural stem cell-like program. Nat Neurosci 21 (7):932–940. https://doi.org/10.1038/ s41593-018-0168-3 19. Treutlein B, Lee QY, Camp JG, Mall M, Koh W, Shariati SA, Sim S, Neff NF, Skotheim JM, Wernig M, Quake SR (2016) Dissecting direct reprogramming from fibroblast to neuron using single-cell RNA-seq. Nature 534 (7607):391–395. https://doi.org/10.1038/ nature18323 20. Aydin B, Kakumanu A, Rossillo M, MorenoEstelles M, Garipler G, Ringstad N, Flames N, Mahony S, Mazzoni EO (2019) Proneural factors Ascl1 and Neurog2 contribute to neuronal subtype identities by establishing distinct chromatin landscapes. Nat Neurosci 22 (6):897–908. https://doi.org/10.1038/ s41593-019-0399-y 21. Lee QY, Mall M, Chanda S, Zhou B, Sharma KS, Schaukowitch K, Adrian-Segarra JM, Grieder SD, Kareta MS, Wapinski OL, Ang CE, Li R, Sudhof TC, Chang HY, Wernig M (2020) Pro-neuronal activity of Myod1 due to promiscuous binding to neuronal genes. Nat Cell Biol 22(4):401–411. https://doi.org/10. 1038/s41556-020-0490-3 22. Aydin B, Mazzoni EO (2019) Cell reprogramming: the many roads to success. Annu Rev Cell Dev Biol 35:433–452. https://doi.org/ 10.1146/annurev-cellbio-100818-125127 23. Mu L, Berti L, Masserdotti G, Covic M, Michaelidis TM, Doberauer K, Merz K, Rehfeld F, Haslinger A, Wegner M, Sock E, Lefebvre V, Couillard-Despres S, Aigner L, Berninger B, Lie DC (2012) SoxC transcription factors are required for neuronal differentiation in adult hippocampal neurogenesis. J Neurosci 32(9):3067–3080. https://doi.org/ 10.1523/JNEUROSCI.4679-11.2012

28

Nesrin Sharif et al.

24. Babos KN, Galloway KE, Kisler K, Zitting M, Li Y, Shi Y, Quintino B, Chow RH, Zlokovic BV, Ichida JK (2019) Mitigating antagonism between transcription and proliferation allows near-deterministic cellular reprogramming. Cell Stem Cell 25(4):486–500.e489. https:// doi.org/10.1016/j.stem.2019.08.005 25. Gascon S, Murenu E, Masserdotti G, Ortega F, Russo GL, Petrik D, Deshpande A, Heinrich C, Karow M, Robertson SP, Schroeder T, Beckers J, Irmler M, Berndt C, Angeli JP, Conrad M, Berninger B, Gotz M (2016) Identification and successful negotiation of a metabolic checkpoint in direct neuronal reprogramming. Cell Stem Cell 18 (3):396–409. https://doi.org/10.1016/j. stem.2015.12.003 26. Masserdotti G, Gillotin S, Sutor B, Drechsel D, Irmler M, Jorgensen HF, Sass S, Theis FJ, Beckers J, Berninger B, Guillemot F, Gotz M (2015) Transcriptional mechanisms of proneural factors and REST in regulating neuronal reprogramming of astrocytes. Cell Stem Cell 17(1):74–88. https://doi.org/10.1016/j. stem.2015.05.014 ´ , Puche-Aroca L, Moreno27. Herrero-Navarro A Juan V, Sempere-Ferra`ndez A, Espinosa A, Susı´n R, Torres-Masjoan L, Leyva-Dı´az E, ˜ ate M, Lo´pezKarow M, Figueres-On Mascaraque L, Lo´pez-Atalaya JP, Berninger B, Lo´pez-Bendito G (2020) Astrocytes and neurons share brain region-specific transcriptional signatures. bioRxiv:2020.2004.2021.038737. https://doi.org/10.1101/2020.04.21. 038737 28. Kriegstein A, Alvarez-Buylla A (2009) The glial nature of embryonic and adult neural stem cells. Annu Rev Neurosci 32:149–184. https://doi.org/10.1146/annurev.neuro. 051508.135600 29. Magnusson JP, Goritz C, Tatarishvili J, Dias DO, Smith EM, Lindvall O, Kokaia Z, Frisen J (2014) A latent neurogenic program in astrocytes regulated by Notch signaling in the mouse. Science 346(6206):237–241. https:// doi.org/10.1126/science.346.6206.237 30. Nato G, Caramello A, Trova S, Avataneo V, Rolando C, Taylor V, Buffo A, Peretto P, Luzzati F (2015) Striatal astrocytes produce neuroblasts in an excitotoxic model of Huntington’s disease. Development 142 (5):840–845. https://doi.org/10.1242/dev. 116657 31. Farmer WT, Murai K (2017) Resolving astrocyte heterogeneity in the CNS. Front Cell Neurosci 11:300. https://doi.org/10.3389/ fncel.2017.00300

32. Bayraktar OA, Bartels T, Holmqvist S, Kleshchevnikov V, Martirosyan A, Polioudakis D, Ben Haim L, Young AMH, Batiuk MY, Prakash K, Brown A, Roberts K, Paredes MF, Kawaguchi R, Stockley JH, Sabeur K, Chang SM, Huang E, Hutchinson P, Ullian EM, Hemberg M, Coppola G, Holt MG, Geschwind DH, Rowitch DH (2020) Astrocyte layers in the mammalian cerebral cortex revealed by a single-cell in situ transcriptomic map. Nat Neurosci 23(4):500–509. https://doi.org/ 10.1038/s41593-020-0602-1 33. Chouchane M, Melo de Farias AR, Moura DMS, Hilscher MM, Schroeder T, Leao RN, Costa MR (2017) Lineage reprogramming of astroglial cells from different origins into distinct neuronal subtypes. Stem Cell Reports 9 (1):162–176. https://doi.org/10.1016/j. stemcr.2017.05.009 34. Liu MH, Li W, Zheng JJ, Xu YG, He Q, Chen G (2020) Differential neuronal reprogramming induced by NeuroD1 from astrocytes in grey matter versus white matter. Neural Regen Res 15(2):342–351. https://doi.org/10. 4103/1673-5374.265185 35. Zhang Y, Sloan SA, Clarke LE, Caneda C, Plaza CA, Blumenthal PD, Vogel H, Steinberg GK, Edwards MS, Li G, Duncan JA 3rd, Cheshier SH, Shuer LM, Chang EF, Grant GA, Gephart MG, Barres BA (2016) Purification and characterization of progenitor and mature human astrocytes reveals transcriptional and functional differences with mouse. Neuron 89(1):37–53. https://doi.org/10. 1016/j.neuron.2015.11.013 36. Canals I, Ginisty A, Quist E, Timmerman R, Fritze J, Miskinyte G, Monni E, Hansen MG, Hidalgo I, Bryder D, Bengzon J, Ahlenius H (2018) Rapid and efficient induction of functional astrocytes from human pluripotent stem cells. Nat Methods 15(9):693–696. https:// doi.org/10.1038/s41592-018-0103-2 37. Tchieu J, Calder EL, Guttikonda SR, Gutzwiller EM, Aromolaran KA, Steinbeck JA, Goldstein PA, Studer L (2019) NFIA is a gliogenic switch enabling rapid derivation of functional human astrocytes from pluripotent stem cells. Nat Biotechnol 37(3):267–275. https://doi. org/10.1038/s41587-019-0035-0 38. Qian X, Song H, Ming GL (2019) Brain organoids: advances, applications and challenges. Development 146(8). https://doi.org/10. 1242/dev.166074 39. Mariani JN, Zou L, Goldman SA (2019) Human glial chimeric mice to define the role of glial pathology in human disease. Methods

In Vitro Astroglia-to-Neuron Reprogramming Mol Biol 1936:311–331. https://doi.org/10. 1007/978-1-4939-9072-6_18 40. Ory DS, Neugeboren BA, Mulligan RC (1996) A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proc Natl Acad Sci U S A 93(21):11400–11406. https://doi.org/10.1073/pnas.93.21.11400 41. Morris SA (2019) The evolving concept of cell identity in the single cell era. Development 146 (12). https://doi.org/10.1242/dev.169748 42. Cang Z, Nie Q (2020) Inferring spatial and signaling relationships between cells from single cell transcriptomic data. Nat Commun 11 (1):2084. https://doi.org/10.1038/s41467020-15968-5 43. Lau S, Rylander Ottosson D, Jakobsson J, Parmar M (2014) Direct neural conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Cell Rep 9 (5):1673–1680. https://doi.org/10.1016/j. celrep.2014.11.017 44. Shalem O, Sanjana NE, Zhang F (2015) Highthroughput functional genomics using CRISPR-Cas9. Nat Rev Genet 16 (5):299–311. https://doi.org/10.1038/ nrg3899 45. Liu Y, Yu C, Daley TP, Wang F, Cao WS, Bhate S, Lin X, Still C 2nd, Liu H, Zhao D, Wang H, Xie XS, Ding S, Wong WH, Wernig M, Qi LS (2018) CRISPR activation screens systematically identify factors that drive neuronal fate and reprogramming. Cell Stem Cell 23(5):758–771.e758. https://doi.org/ 10.1016/j.stem.2018.09.003 46. Erhard F, Baptista MAP, Krammer T, Hennig T, Lange M, Arampatzi P, Jurges CS, Theis FJ, Saliba AE, Dolken L (2019) scSLAM-seq reveals core features of transcription dynamics in single cells. Nature 571 (7765):419–423. https://doi.org/10.1038/ s41586-019-1369-y 47. La Manno G, Soldatov R, Zeisel A, Braun E, Hochgerner H, Petukhov V, Lidschreiber K, Kastriti ME, Lonnerberg P, Furlan A, Fan J, Borm LE, Liu Z, van Bruggen D, Guo J, He X, Barker R, Sundstrom E, Castelo-Branco G,

29

Cramer P, Adameyko I, Linnarsson S, Kharchenko PV (2018) RNA velocity of single cells. Nature 560(7719):494–498. https://doi.org/ 10.1038/s41586-018-0414-6 48. Cammack AJ, Moudgil A, Chen J, Vasek MJ, Shabsovich M, McCullough K, Yen A, Lagunas T, Maloney SE, He J, Chen X, Hooda M, Wilkinson MN, Miller TM, Mitra RD, Dougherty JD (2020) A viral toolkit for recording transcription factor-DNA interactions in live mouse tissues. Proc Natl Acad Sci U S A 117(18):10003–10014. https://doi. org/10.1073/pnas.1918241117 49. Costa MR, Ortega F, Brill MS, Beckervordersandforth R, Petrone C, Schroeder T, Gotz M, Berninger B (2011) Continuous live imaging of adult neural stem cell division and lineage progression in vitro. Development 138(6):1057–1068. https:// doi.org/10.1242/dev.061663 50. Hilsenbeck O, Schwarzfischer M, Skylaki S, Schauberger B, Hoppe PS, Loeffler D, Kokkaliaris KD, Hastreiter S, Skylaki E, Filipczyk A, Strasser M, Buggenthin F, Feigelman JS, Krumsiek J, van den Berg AJ, Endele M, Etzrodt M, Marr C, Theis FJ, Schroeder T (2016) Software tools for single-cell tracking and quantification of cellular and molecular properties. Nat Biotechnol 34(7):703–706. https://doi.org/10.1038/nbt.3626 51. Nehme R, Zuccaro E, Ghosh SD, Li C, Sherwood JL, Pietilainen O, Barrett LE, Limone F, Worringer KA, Kommineni S, Zang Y, Cacchiarelli D, Meissner A, Adolfsson R, Haggarty S, Madison J, Muller M, Arlotta P, Fu Z, Feng G, Eggan K (2018) Combining NGN2 programming with developmental patterning generates human excitatory neurons with NMDAR-mediated synaptic transmission. Cell Rep 23(8):2509–2523. https://doi.org/ 10.1016/j.celrep.2018.04.066 52. Cadwell CR, Scala F, Li S, Livrizzi G, Shen S, Sandberg R, Jiang X, Tolias AS (2017) Multimodal profiling of single-cell morphology, electrophysiology, and gene expression using Patch-seq. Nat Protoc 12(12):2531–2553. https://doi.org/10.1038/nprot.2017.120

Chapter 3 Direct Cell Reprogramming of Mouse Fibroblasts into Functional Astrocytes Using Lentiviral Overexpression of the Transcription Factors NFIA, NFIB, and SOX9 Boning Qiu, Ruben J. de Vries, and Massimiliano Caiazzo Abstract Astrocytes play an important role in maintaining brain homeostasis and their dysfunction is involved in a number of neurological disorders. An accessible source of astrocytes is essential to model neurological diseases and potential cell therapy approaches. Cell reprogramming techniques offer possibilities to reprogram terminally differentiated cells into other cell types. By overexpressing the three astrocytic transcription factors NFIA, NFIB, and SOX9, we showed that it is possible to directly transdifferentiate fibroblasts into functional astrocytes. These induced astrocytes (iAstrocytes) express glial fibrillary acidic protein (GFAP) and S100 calcium binding protein B (S100B), as well as other astrocytic markers. Moreover, electrophysiological properties indicate that iAstrocytes are functionally comparable to native brain astrocytes. Here we describe an optimized protocol to generate iAstrocytes starting from skin fibroblasts and this approach can be adapted for a wide range of somatic cell types. Key words Cell reprogramming, Astrocytes, Fibroblasts, Lentivirus, Transcription factors

1

Introduction Astrocytes are the most abundant cell type in the central nervous system (CNS) and are essential for maintaining homeostasis of the brain. They are involved in many key processes which include coordinating synaptogenesis and neuronal firing [1, 2], nutrient and ion metabolism [3, 4], forming and maintaining the blood-brain barrier [5–7], regulating neurotransmitter transport and degradation [8, 9], and protection against oxidative stress [10]. Breakdown of these fundamental functions has been connected to multiple neurological disorders, such as Alzheimer’s disease [11], Parkinson’s disease [12], Huntington’s disease [13], lysosomal storage disorders [14], and Rett’s syndrome [15]. Easy accessibility to a source of astrocytes is a key point to carry out any astrocyte-related research. Current protocols for the generation of astrocytes use pluripotent cell (ESC/IPSC)-derived

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

31

32

Boning Qiu et al.

Fig. 1 Schematic overview of the cell reprogramming protocol. (a) On day 0, 2
105 MEF cells are seeded per well of a 6-well plate. (b) On day 1, MEFs are infected with the TetO-FUW NfiA/NfiB/SOX9 and M2rtTA viruses. (c) On day 3, cells are re-plated in new Matrigel-coated plates at 1.0
104 cells/cm2. (d) After 3 weeks of differentiation, iAstrocytes can be directly characterized or be re-plated again for other applications

neural stem cells as a starting point [16]. A number of growth factors need to be added in the medium to drive astrocyte differentiation. These methods require precise manipulation of various growth factors at different stages during differentiation which is labor-intensive and can also be time-consuming, with some taking up to 6 months [17]. Cell reprogramming techniques based on the forced overexpression of certain cell lineage transcription factors (TFs) have shown to directly convert somatic/pluripotent cells into a variety of cell types [18–24]. Here we describe a fast (2–3 weeks) and direct reprogramming protocol to differentiate induced astrocytes (iAstrocytes) from fibroblasts (Fig. 1). Fibroblasts are seeded and subsequently infected with lentivirus carrying three astrocytic TFs (NFIA, NFIB, SOX9) along with a reverse tetracycline-controlled transactivator (rtTA) virus. Overexpression of these TFs is introduced by doxycycline (DOX) addition in the medium. Two weeks later, the reprogramed cells begin to display astrocyte-like morphology and show expression of the two main astrocytic markers glial fibrillary acidic protein (GFAP) and S100 calcium binding protein B (S100B). Genetic profiling reveals that 3 week’s iAstrocytes show similar gene expression levels compared to real brain astrocytes in terms of astrocyte-related genes. Additionally, calcium imaging reveals that iAstrocytes respond to ATP/KCL/glutamate stimulation in a similar pattern as native brain astrocytes. These results demonstrate that our protocol can generate induced astrocytes by overexpressing astrocytic transcription factors NFIA, NFIB, and SOX9 in fibroblasts. This fast source of astrocytes can be instrumental for the progress of neurological disease modelling and cellbased therapies.

Direct Cell Reprogramming into Functional Astrocytes

2

33

Materials

2.1 Lentivirus Production and Validation

1. HEK 293T cells (ATCC, CRL11268). 2. HEK 293T medium: 10%(v/v) fetal bovine serum (FBS) in Dulbecco’s Modified Eagle Medium (DMEM). Store up to 4 weeks at 4  C. 3. Plasmids: (a) pMDLg/pRRE (Addgene, clone 12251). (b) pRSV-Rev (Addgene, clone 12253). (c) pMD2.G (Addgene, clone 12259). (d) FUW-M2rtTA (Addgene, clone 20342). (e) TetO-FUW-NfiA (Addgene, clone 64901). (f) TetO-FUW-NfiB (Addgene, clone 64900). (g) FUW-TetO-SOX9 (Addgene, clone 41080). 4. Plasmid maxiprep kit. 5. 3 M sodium acetate (pH 5.5) in Milli-Q H2O, filtered through 0.22μm filter. Store at room temperature (RT). 6. 95% and 75% ethanol. Store at 20  C. 7. Milli-Q H2O, filtered through 0.22μm Minisart® syringe filter. 8. 2 M CaCl2 in Milli-Q H2O, filtered through 0.22μm filter; store at 4  C. 9. 2
HBS buffer (pH 7.4): 281 mM NaCl, 100 mM HEPES, 1.5 mM Na2HPO4 in Milli-Q H2O, filtered through 0.22μm filter; store aliquots at 20  C. 10. 145 mm cell culture dishes, PS, Cellstar®. 11. MS 3 basic vortex. 12. 0.45μm filter units. 13. Ultra-Clear™ centrifuge tubes. 14. 8 mg/ml polybrene in sterile Milli-Q H2O. 15. TRIzol™ reagent. 16. Chloroform. 17. Isopropanol. 18. Nuclease-free water. 19. iScript™ cDNA Synthesis Kit. 20. iTaq™ Universal SYBR Green Supermix RT-qPCR Kit. 21. CFX96™ Real-Time PCR System C1000™ Thermal Cycler. 22. QPCR primers: (a) NfiA, Forward: CAGCCAAGTGAAGCTGACAT Reverse: CCTGATGTGACAAAGCTGTCC.

34

Boning Qiu et al.

(b) NfiB, Forward: AGCTGCTGGAAGTCGAACAT Reverse: TCTGGGGAAGAATCCTGTG. (c) SOX9, Forward: GTGCAGCACAAGAAAGACCA Reverse: CAGCGCCTTGAAGATAGCAT. 2.2 Cell Culture and Reprogramming

1. Mouse embryonic fibroblasts (MEFs) are derived from E14.5 mouse embryos [18]. 2. MEF medium: 10% (v/v) FBS, 0.1 mM Non-essential Amino Acid (NEAA), 1 mM sodium pyruvate in high glucose DMEM. Store up to 4 weeks at 4  C. 3. Matrigel® Growth Factor Reduced Basement Membrane Matrix. Thaw on ice overnight and store aliquots at 20  C. For plate coating concentration, dilute Matrigel in F12/DMEM medium based on corresponding dilution factor provided by the company for each batch. Diluted Matrigel solution can be stored for 2 weeks at 4  C (see Note 1). 4. Astrocyte induction medium: 2%(v/v) FBS, 2 mM L-glutamine, 1
N2 supplement, 1
Antibiotic-Antimycotic solution in F12/DMEM. Store up to 2 weeks at 4  C (see Note 2). 5. 10μg/ml ciliary neurotrophic factor (CNTF) in PBS containing 0.1% BSA. Store aliquots at 20  C. 6. Accutase. Once thawed from 20  C, store at 4  C for up to 2 months. 7. 1 mg/ml doxycycline hyclate (DOX) in Milli-Q H2O, filtered through 0.22μm filter. Store aliquots at 20  C (see Note 3). 8. Cell culture multiwell plates, PS clear, Cellstar®.

2.3 Immunofluorescence Staining

1. Fixation solution: 4% paraformaldehyde (PFA) in PBS. Store at 4  C. 2. Permeabilization solution: 0.1% Triton X-100 in PBS. Store at 4  C. 3. Blocking solution: 1% (m/v) BSA in PBS. Store at 4  C. 4. Washing solution: 0.1% Tween-20 in PBS. Store at 4  C. 5. Nucleus staining stock solution: 2 mg/ml Hoechst 33342 in PBS. Store aliquots at 20  C, and protect from light. Dilute this stock solution at 1:1000 in PBS to make working solution. 6. Primary antibodies: (a) GFAP monoclonal antibody (ASTRO6) (Thermo Fisher Scientific, MA5-12023). Use at 1:200 in the experiment. (b) S100 polyclonal antibody (Dako, Z0311). Use at 1:400 in the experiment.

Direct Cell Reprogramming into Functional Astrocytes

35

7. Secondary antibodies: (a) Goat anti-rabbit IgG (H + L) cross-adsorbed secondary antibody, Alexa Fluor 488. Use at 1:400 in the experiment. (b) Goat anti-mouse IgG (H + L) cross-adsorbed secondary antibody, Alexa Fluor 555. Use at 1:400 in the experiment. 8. Fluorescence microscope. 2.4

Calcium Imaging

1. Fluo-4 AM fluorescent labeling reagent in DMSO. 2. Standard bath saline solution (pH 7.3): 2 mM CaCl2, 140 mM NaCl, 1 mM MgCl2, 10 mM HEPES, 4 mM KCl, 10 mM glucose in Milli-Q H2O, filtered through 0.22μm filter. Store at 4  C. 3. ATP assay solution: 50μM ATP in standard bath saline solution. Store at 4  C for on longer than a week. 4. KCl assay solution: 65 mM KCl in standard bath saline solution. Filtered through 0.22μm filter. Store at 4  C for on longer than a week. 5. Glutamate assay solution: 100μM glutamate in standard bath saline solution. Filtered through 0.22μm filter. Store at 4  C for on longer than a week. 6. Confocal microscope.

3 3.1

Methods Virus Production

BL-2 safety practices should be followed when preparing and handling lentiviral particles. Personal protective clothing should be worn at all times. Liquid waste should be decontaminated with at least 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous waste and autoclaved. Please follow all safety guidelines from your BL-2 working facility. Below, all procedures are performed at room temperature unless specified otherwise. 1. Prepare plasmid maxipreps of all the seven plasmids mentioned in the materials section according to manufacturer’s instructions. 2. The eluted plasmid solution should be in a 50 ml Falcon tube for an additional ethanol precipitation step to concentrate the plasmids. First add 1/10th the volume equivalent to the plasmid solution of 3 M sodium acetate (pH 5.5), and mix well by inverting the tube for several times. Then add three times the

36

Boning Qiu et al.

volumes equivalent to the plasmid solution of cold (stored at 20  C) 95% ethanol, and mix well by inverting the tube or vortex. Store at 20  C for 1 h. 3. Next, centrifuge at 5000
g at 4  C for 10–15 min. After the centrifuge, aspirate supernatant carefully without disturbing the pellet. Then add 10 ml cold 75% ethanol (stored at 20  C) to wash the DNA pellet once while vortexing to detach the pellet. Centrifuge to pellet the plasmid again at 5000
g at 4  C for 5 min. 4. Next, aspirate supernatant, and dry pellet at room temperature for 1 h in a laminar flow hood. Finally resuspend plasmid DNA in small volume (300μl) sterile Milli-Q water, and measure the concentration using NanoDrop instrument. 5. The day before the transfection, seed 6.5
106 293T cells in 14.5 cm dishes in 20 ml 293T cell medium at 37  C, 5% CO2, and culture for 18 h. 6. 2 h before the transfection, change the medium for 22.5 ml of fresh high glucose HEK 293T medium in order to induce cell cycling (see Note 4). 7. Prepare in 15 ml Falcon tube the following DNA mix for each transfected dish (see Note 5). 8. For the TF-expressing virus, mix 32μg of TetO-FUW-NfiA/ NfiB/SOX9, 6.25μg of pRSV-Rev, 9μg of pMD2.G, and 12.5μg of pMDLg/pRRE in sterile Milli-Q water to make 1.05 ml. 9. For the M2rtTA virus, add 32μg of FUW-M2rtTA to the DNA mix containing the same amount of pRSV-Rev, pMD2.G, and pMDLg/pRRE. 10. Add 150μl of 2 M CaCl2 to the DNA mix and mix by pipetting 3–4 times and wait for 15 min. 11. Add 1.2 ml of the 2
HBS buffer dropwise to the calciumDNA mix while vortexing at high speed (approximately 2000 rpm). At this point, the solution should appear slightly cloudy. 12. Immediately add the 2.4 ml mix solution to the cells drop by drop across the whole dish, and gently swirl to evenly distribute the mix content (see Note 6). 13. 18 h after the transfection, some virus is already present in the medium. Change the medium for 16 ml of fresh high glucose 293T cell medium with additional 1
Antibiotic-Antimycotic solution (see Note 7). 14. The day after (approximately 48 h after the transfection), collect the supernatants for each type of viral preparation in

Direct Cell Reprogramming into Functional Astrocytes

37

50 ml Falcon tubes. Centrifuge at 850
g for 5 min to pellet cells. Collect the supernatants again, and filter through 0.45μm filter unit (see Note 8). 15. Put up to 32 ml of viral preparation in an Ultra-Clear tube, and ultracentrifuge it at 20,000
g for 2 h at 20  C. 16. Carefully discard the supernatant and turn the tubes upsidedown on absorbent paper and let dry the virus pellet for 10 min. 17. Add 80μl of PBS in each tube, and carefully pipette several times to resuspend the pellet (see Note 9). 3.2

Virus Validation

HEK 293T cells are infected with different TF-carrying viruses along with the M2rtTA virus. DOX is given in the medium to induce the overexpression. Total RNA is isolated and QPCR is performed to check the overexpression level of the TFs. 1. Seed 3
105 HEK 293T cells in 6-well plate in 2 ml HEK 293T medium at 37  C, 5% CO2, and culture overnight (see Note 10). 2. Infect the cells with either 0.5μl, 1μl, or 2μl of each of the TetO-FUW-NfiA/NfiB/SOX9 virus along with 2μl M2rtTA viruses in 1 ml fresh medium in the presence of 8μg/ml polybrene (see Note 11). Incubate for 18 h. 3. After the infection, discard the virus-containing medium, and wash the cells once with medium to get rid of any residual viruses. Add 2 ml fresh medium containing 1μg/ml DOX to induce overexpression of the TFs, and culture for 48 h. 4. 48 h later, total RNA is isolated with TRIzol™ reagent according to the manufacturer’s instructions. 5. Following RNA isolation, 1μg total RNA is used for cDNA synthesis using iScript™ cDNA Synthesis Kit according to the manufacturer’s instructions (see Note 12). Synthesized cDNA can be at least five times diluted with nuclease-free water in order to have enough material for QPCR assay. Amount per reaction (15μl)

Final concentration

iTaq™ Universal SYBR Green Supermix (2
)

7.5μl

1


Primers mix (forward and reverse)

1.5μl

300 nM each

Nuclease-free H2O

5μl

–

cDNA

1μl

–

Component

38

Boning Qiu et al.

6. Perform QPCR with cDNA template and desired primers as follows: Cycle number

Denaturation at Annealing/extension Melt curve analysis 95  C at 60  C (65–95  C)

1

30 s

–

–

2–41

5s

30 s

–

42

–

–

0.05 s per 0.5  C increment

7. Analyze the cycle threshold (Ct) values for gene expression fold change by using the ΔΔCt method [25]. The amount of virus used to bring about a 1000
fold change in gene expression is suitable for cell reprogramming experiment (see Note 13). 3.3 Reprogramming of MEFs into Induced Astrocytes

1. Seed 2
105 MEFs in a single well of a 6-well plate in 2 ml MEF medium at 37  C, 5% CO2, and culture overnight (see Note 14). 2. Infect the cells with desired amount of TetO-FUW-NfiA/ NfiB/SOX9 and M2rtTA viruses in 1 ml fresh MEF medium in the presence of 8μg/ml polybrene. Culture for 18 h. 3. After the infection, discard the virus-containing medium, and wash the cells once with medium. Add 2 ml fresh MEF medium containing 1μg/ml DOX to induce expression of the TFs, and culture overnight. 4. Coat new well plates with Matrigel for imminent re-plate procedure (step 5). Add 700μl or 300μl Matrigel to 6- and 24-well plates, respectively. Swirl to make whole area covered by Matrigel. Incubate for at least 30 min in the incubator. After Matrigel coating, discard the supernatant, and add 2 ml or 600μl fresh MEF medium to 6- and 24-well plates, respectively. 6-well or 24-well plates will be used, respectively, for transcriptional or immunocytochemical analyses. 5. Discard the medium and wash the cells once with PBS. Add 1 ml Accutase and put back to the incubator for 3–5 min to dissociate the cells. Guarantee 100% single cells by additional pipetting with 1 ml tips. Centrifuge at 200
g for 3 min to pellet cells in a 15 ml Falcon tube. Discard the supernatant and resuspend the cells in 1 ml fresh MEF medium and count the cells. Re-plate the cells at low density in new Matrigel-coated well plate and culture overnight. A desired cell density is as follows: 1
104 cells/cm2. 6. The next day, switch to astrocyte induction medium containing 1μg/ml DOX. Reprogramming lasts for 3 weeks, and 1μg/ml DOX is given in the medium throughout the whole process (see

Direct Cell Reprogramming into Functional Astrocytes

39

Note 15). Fully refresh the medium three times a week for the first 2 weeks. Refresh half of the medium three times a week for the third week (see Note 16). 7. One week after DOX initiation, 10 ng/ml CNTF is given in the medium to promote astrocyte maturation. 8. After 3 week’s reprogramming, DOX and CNTF are withdrawn from the medium. The resultant iAstrocytes are positive for GFAP and S100B. At the moment, these induced astrocytes should have gained stable phenotype and can be cultured for a few passages. 3.4 Immunofluorescence Staining

Immunofluorescence staining is carried out in 24-well plates. All procedures are performed at room temperature unless specified otherwise. 1. Cells are fixed for 25 min in 500μl 4% PFA solution followed by 1 ml PBS wash once. 2. Cells are permeabilized in 500μl permeabilization solution for 10 min followed by 1 ml PBS wash once. 3. Cells are incubated in 500μl blocking solution for 1.5 h. There is no need to wash the cells after this step. 4. Primary antibodies are diluted in blocking solution. Cells are incubated with 500μl primary antibody solution overnight at 4  C. 5. The next day, cells are washed with 1 ml washing solution for three times on a shaker (speed 500 rpm), each wash lasting 5 min. 6. Secondary antibodies are diluted in blocking solution. Cells are incubated with 500μl secondary antibody solution for 2 h in the dark. There is no need to wash the cells after this step. 7. Continue to stain the cells with 500μl nucleus staining working solution for 10 min in the dark followed by the same washing procedure in step 5. 8. After the washing, submerge the cells with new PBS. Then the cells are ready for imaging. Representative imaging of iAstrocytes is shown in Fig. 2.

3.5

Calcium Imaging

1. Cells growing in 96-well plates are incubated with 100μl medium containing 5 mM Fluo-4 AM dye for 1 h in the incubator. 2. Fluo-4 AM dye is removed, and cells are washed once with standard bath saline solution to get rid of free dye. Add 100μl new standard bath saline solution to the cells, and place the 96-well plate in the confocal microscope with incubator function turned on.

40

Boning Qiu et al.

Fig. 2 Representative images of reprogrammed iAstrocytes. The images show iAstrocytes after 3 weeks of reprogramming. The left panel shows an immunocytochemical analysis for the astrocyte markers GFAP (red) and S100b (green) and the nuclear marker Hoechst (blue). The right panel shows the morphology of the iAstrocytes in bright-field

Fig. 3 Calcium imaging of iAstrocytes. The figure shows a comparison of the calcium waves analyzed after ATP stimulation in iAstrocytes (left panel) and primary mouse astrocytes. In both panels, every colored line corresponds to single analyzed cells

3. Cells are imaged with a 20
objective for 1 min at 1 Hz to check the baseline. Laser line (Ex/Em) ¼ 494/506 nm. 4. With dispensing function of the microscope, refresh 100μl new standard bath saline solution containing either 50μM ATP, 65 mM KCl, or 100μM glutamate, and continue to image the cells for 5 min. 5. Fluorescence intensity of region of interest (ROI) is measured using ImageJ software, and data is present as ΔF/F0 [26]. Representative results of iAstrocyte calcium imaging are shown in Fig. 3.

Direct Cell Reprogramming into Functional Astrocytes

4

41

Notes 1. Any culture vessels, equipment, or tools that get in direct contact with Matrigel should be pre-cooled. 2. N2 supplement is not stable at 4  C for more than 2 weeks; thus, any medium containing N2 should be finished within 2 weeks. Also N2 stock should be made into aliquots and kept at 20  C. 3. Protect doxycycline from light by switching off hood light and using aluminum foil on the aliquots. Used aliquots can be kept at 4  C for few days; otherwise, keep them at 20  C and reuse them only once. 4. When doing transfection, plated 293T cells should be around 40–60% confluence to have good transfection efficiency and allow them to grow for further 40–48 h. 5. It is suggested to prepare a plasmid DNA mix for each type of virus in a 1.5 ml Eppendorf tube. Then split the content of the mix in the number of 15 ml Falcon tubes equal to the number of 14.5 cm dishes to be transfected. 6. Small dark precipitates should be visible by bright-field optic microscope soon after adding the transfection mix to the cells. 7. There should be no antibiotic in the medium when doing the transfection in order to prevent any additional stress to the cells, whereas after transfection antibiotic should be added in the medium to prevent any possible contaminations. 8. Filtering with 0.22μm filters could cause loss of viral particles. 9. Avoid generation of bubbles during virus resuspension. If bubbles are present, spin down the virus solution at 100
g for 5 min before freezing it. Make aliquots in 0.5 ml Eppendorf tubes that can be used in a single experiment, and store at 80  C. 10. Prepare two to three wells of cells for counting the exact cell number when doing the infection. 11. The presence of polybrene and the use of lower volume of medium greatly increase infection efficiency. 12. Isolated RNA can be additionally treated with DNase to prevent genomic DNA contamination. 13. The amount of viruses used for reprogramming should be the minimum amount that allows the infection of 100% of the cells. Therefore, it is advised to perform a concentration curve with different amount of virus and assess the percentage of infected cells by immunocytochemical analysis.

42

Boning Qiu et al.

14. Prepare two to three wells of cells for counting the exact cell number when doing the infection. 15. DOX is freshly added before medium changing. 16. When removing old medium during medium change, it is advisable to leave a thin layer of medium to prevent cells from drying, and some paracrine factors are released in the medium by cells undergoing differentiation. References 1. Baldwin KT, Eroglu C (2018) Molecular mechanisms of astrocyte-induced synaptogenesis. Curr Opin Neurobiol 45:113–120 2. Stogsdill JA, Ramirez J, Liu D et al (2017) Astrocytic neuroligins control astrocyte morphogenesis and synaptogenesis. Nature 551 (7679):192–197 3. Brown AM, Ransom BR (2007) Astrocyte glycogen and brain energy metabolism. Glia 1271:1263–1271 4. Simard M, Nedergaard M (2004) The neurobiology of glia in the context of water and ion homeostasis. Neuroscience 129:877–896 5. Bush TG, Puvanachandra N, Horner CH et al (1999) Leukocyte infiltration, neuronal degeneration, and neurite outgrowth after ablation of scar-forming, reactive astrocytes in adult transgenic mice. Neuron 23(2):297–308 6. Iadecola C, Nedergaard M (2007) Glial regulation of the cerebral microvasculature. Nat Neurosci 10(11):1369–1376 7. Zhao Z, Nelson AR, Betsholtz C et al (2015) Establishment and dysfunction of the bloodbrain barrier. Cell 163(5):1064–1078 8. Seifert G, Schilling K, Steinha¨user C (2006) Astrocyte dysfunction in neurological disorders: a molecular perspective. Nat Rev 7:194–206 9. Mahmoud S, Gharagozloo M, Simard C et al (2019) Astrocytes maintain glutamate homeostasis in the CNS by controlling the balance between glutamate uptake and release. Cells 8 (2):pii E184 10. Chen Y, Vartiainen NE, Ying W et al (2001) Astrocytes protect neurons from nitric oxide toxicity by a glutathione-dependent mechanism. J Neurochem 77(6):1601–1610 11. Nagele RG, Wegiel J, Venkataraman V et al (2004) Contribution of glial cells to the development of amyloid plaques in Alzheimer’s disease. Neurobiol Aging 25(5):663–674 12. Booth HDE, Hirst WD, Wade-martins R (2017) The role of astrocyte dysfunction in

Parkinson’s disease pathogenesis. Trends Neurosci 40(6):358–370 13. Khakh BS, Beaumont V, Cachope R et al (2017) Unravelling and exploiting astrocyte dysfunction in Huntington’s disease. Trends Neurosci 40(7):422–437 14. Di Malta C, Fryer JD, Settembre C et al (2012) Astrocyte dysfunction triggers neurodegeneration in a lysosomal storage disorder. PNAS 109 (35):E2334–E2342 15. Lioy DT, Garg SK, Monaghan CE et al (2011) A role for glia in the progression of Rett’s syndrome. Nature 475(7357):497–500 16. Emdad L, Souza SLD, Kothari HP et al (2012) Efficient differentiation of human embryonic and induced pluripotent stem cells into functional astrocytes. Stem Cells Dev 21 (3):404–410 17. Krenick R, Weick JP, Liu Y et al (2011) Specification of transplantable astroglial subtypes from human pluripotent stem cells. Nat Biotechnol 29(6):528–534 18. Caiazzo M, Dell’anno MT et al (2011) Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476(7359):224–227 19. Caiazzo M, Giannelli S, Valente P et al (2015) Direct conversion of fibroblasts into functional astrocytes by defined transcription factors. Stem Cell Reports 4(1):25–36 20. Colasante G, Lignani G, Rubio A et al (2015) Rapid conversion into functional induced forebrain GABAergic interneurons by direct genetic reprogramming. Cell Stem Cell 17 (6):719–734 21. Dell’Anno MT, Caiazzo M, Leo D et al (2014) Remote control of induced dopaminergic neurons in parkinsonian rats. J Clin Invest 124 (7):3215–3229 22. Theka I, Caiazzo M, Dvoretskova E et al (2013) Rapid generation of functional dopaminergic neurons from human iPS cells through a single step procedure employing cell lineage

Direct Cell Reprogramming into Functional Astrocytes transcription factors. Stem Cells Transl Med 2 (6):473–479 23. Pang ZP, Yang N, Vierbuchen T (2011) Induction of human neuronal cells by defined transcription factors. Nature 476(7359):220–223 24. Zhang Y, Pak C, Han Y (2013) Rapid singlestep induction of functional neurons from human pluripotent stem cells. Neuron 78 (5):785–798

43

25. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods 25(4):402–408 26. Tian E, Sun G, Sun G, Chao J, Ye P, Warden C et al (2016) Small-molecule-based lineage reprogramming creates functional astrocytes. Cell Rep 16(3):781–792

Chapter 4 Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules E Tian, Mingzi Zhang, and Yanhong Shi Abstract Astrocytes play important roles in neurodevelopment and diseases. Previous studies described ways to derive astrocytes from somatic cells by going through iPSC or iNSC/iNPC intermediates. Here we describe a method to directly convert mouse fibroblasts into functional astrocytes using small molecules without transgenes or viral transduction. The direct chemical reprogramming method described in this study provides a more rapid way to derive astrocytes from fibroblasts. Key words Direct conversion, Chemical reprogramming, Induced astrocytes, Small molecules, iPSCs, iPSC-derived astrocytes

1

Introduction Astrocyte is the most abundant glial cell type in the brain. For decades, astrocyte has been considered the supporting component in the brain [1, 2]. However, the knowledge gained about astrocytes in recent years has positioned astrocytes from the neuronal supporting cell type to one of the main components of the functional neural unit in the brain [3, 4]. Increasing evidence has revealed important functions for astrocytes in neurodevelopment and in the pathogenesis of neurological diseases [5]. Astrocyte functions range from promoting neuronal maturation, synapse formation, and plasticity to mediating glutamate clearance [3, 6]. Dysfunction of astrocytes contributes to the pathogenesis of many neurodegenerative diseases, such as Alzheimer disease [5, 7]. In addition, astrocyte dysfunction could also be the direct cause of certain neurological disorders, such as Alexander disease (AxD) [8–10]. Better understanding the role of astrocyte in cognitive function has been achieved but not yet enough to reveal the

E Tian and Mingzi Zhang contributed equally. Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

45

46

E Tian et al.

pathological relevance of astrocytes in neurodegenerative diseases. Establishing new cellular models for astrocytes will help to reveal their roles in both neurodevelopment and neurological diseases. Ectopic expression of lineage-specific factors has been shown to induce cell fate change, including reprogramming somatic cells to induced pluripotent stem cells (iPSCs) and converting one type of somatic cells to another [11–15]. Multiple protocols have been published in the last decade for differentiation of human iPSCs toward astrocytes [16–24]. Novel insights have been gained from modeling neurological diseases using human iPSC-derived astrocytes. For example, AxD has been studied using patient iPSC-derived astrocytes by several groups. It was found that AxD astrocytes exhibit increased inflammatory factor secretion and impaired extracellular ATP release [9, 10, 25]. Moreover, AxD astrocytes inhibit proliferation of human iPSC-derived oligodendrocyte progenitor cells (OPCs) in co-cultures and reduce the myelination potential of OPCs, recapitulating the key myelination defect phenotype that are observed in AxD patients but not in animal models [9]. Recently it has been shown that human iPSCderived astrocytes can be infected by SARS-CoV-2 and exhibit ApoE isoform-dependent cellular response [21]. Despite progress on iPSC differentiation into astrocytes and disease modeling using iPSC-derived astrocytes, lack of aging phenotypes in iPSC-derived brain cells, including astrocytes, constitutes a major obstacle in understanding neurodegenerative disease in which aging is the greatest risk factor [26]. Compared to brain cells differentiated from iPSCs, direct reprogramming from somatic cells, such as fibroblasts into neuronal cells, has been shown to reserve aging phenotypes [27], which makes direct reprogramming a desired candidate for studying age-related degenerative diseases. Large efforts have been devoted to directly reprogram neurons [14, 28, 29], neural stem cells [30–32], and oligodendrocytes [33, 34], but limited efforts have been invested to reprogram somatic cells into astrocytes [35, 36]. In this study, we provide a detailed protocol for making functional astrocytes from mouse fibroblasts using small molecules.

2

Materials 1. Mouse embryonic fibroblast (MEF) medium: DMEM, 10% FBS, 0.1 mM nonessential amino acids, 2 mM L-glutamine, and 100 units penicillin/streptomycin (P/S). This medium can be stored at 4
C and used within 2 weeks. 2. Mouse induced astrocyte medium (mouse iAM): Knockout DMEM with 10% knockout serum replacement, 10% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 0.1 mM β-mercaptoethanol, and 100 ng/ml FGF. The medium can be stored at 4
C and used within 2 weeks (see Note 1).

Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules

47

3. VCSTO compounds: Dissolve the compounds in DMSO, and make stock at appropriate concentrations. The compounds and their stock concentration include valproic acid (VPA) at 10 mM, CHIR99021 at 50 mM, SB-431542 at 20 mM, tranylcypromine at 100 mM, and OAC1 at 10 mM [37]. The compounds can be aliquoted into small volume and stored at 20
C (see Notes 1 and 2). 4. Complete mouse induced astrocyte medium: iAM including 500 nM VPA, 3μM CHIR99021, 10μM SB-431542, 10μM tranylcypromine, and 1μM OAC1. The concentrations described here are final concentrations. The compounds are added freshly each time medium is prepared. 5. Mouse astrocyte medium: DMEM and 10% heat-inactivated fetal bovine serum. 6. Neuronal culture medium: Neurobasal medium with 1 B27 and 2 mM L-glutamine. 7. 70% (v/v) ethanol. 8. PBS without Ca2+Mg2+. 9. Razor glade. 10. 0.05% trypsin/EDTA. 11. Matrigel.

3

Methods

3.1 Isolation of MEFs

1. Euthanize a pregnant mouse at E13.5 following an approved IACUC protocol. 2. Briefly rinse the mouse with 70% (v/v) ethanol, dissect out the uterine horns, and place them into a Petri dish containing PBS without Ca2+Mg2+ and transfer the dish into a tissue culture hood under aseptic conditions (see Note 3). 3. Separate each embryo from its placenta, and remove head and red organs, using sterile instruments. Wash the dissected tissues in PBS, and place in a clean Petri dish. Finely mince the tissues using a sterile razor blade until it becomes possible to pipette. 4. Transfer the tissues into a 50 ml Falcon tube, and add 1 ml of 0.05% trypsin/EDTA per embryo. Incubate for 15–30 min at 37
C. Shake the tube every 5 min. 5. Add about 1 volume of freshly prepared MEF medium to neutralize trypsin. 6. Centrifuge the cells with 300  g for 5 min, then carefully remove the supernatant, and resuspend the cell pellet in warm MEF medium. 7. Place tissues from three to four embryos into one 10 cm dish. Add 10 ml warm MEF medium into each dish.

48

E Tian et al.

8. After culturing for 2–3 days, cells will be about 80–90% confluent. These cells are considered P0 cells. The P0 cells can be cryopreserved using freezing medium CryoStor CS10 for future usage or continued to culture. 3.2 Direct Reprogramming Mouse Fibroblasts into Astrocytes

1. MEFs in cryopreservation vials are taken from liquid nitrogen tank and incubated at 37
C water bath for 1 to 2 min. When there is only a small piece of ice left, take out the cryopreservation vials, and rinse with 70% (v/v) ethanol (see Note 4). 2. Transfer the cells from the cryopreservation vials into a 10 ml Falcon tube, and add about five volumes of freshly prepared MEF medium to the tube. 3. Centrifuge the cells at 300  g for 5 min, then carefully remove the supernatant, and resuspend cell pellet in 5 ml warm MEF medium. 4. Plate the cells into a 10 cm dish. Continue to culture the cells in MEF medium until the cells reach about 80–90% confluency. Cells are ready to passage by then. 5. Prepare Matrigel-coated culture dishes 1 day before MEF passage. Dilute Matrigel using knockout DMEM by 1:10 ratio. Add 3 ml diluted Matrigel per dish or 1 ml for one well of a 6-well plate. 6. Plate MEFs at passages 1–2 onto Matrigel-coated culture dishes at a cell density of 3  103 cells/cm2, and culture in MEF medium (see Note 4). 7. After 24 h, change medium to mouse iAM supplemented with 500 nM VPA, 3μM CHIR99021, 10μM SB-431542, 10μM tranylcypromine, and 1μM OAC1, and culture the cells in this medium for 10 days (see Note 5). 8. Replate the cells onto Matrigel-coated plates in mouse iAM, and continue with the VCSTO compound treatment for another 15 days. 9. Switch the cells to mouse astrocyte medium (see Note 6). At the end of the compound treatment, astrocyte lineagespecific markers are analyzed by immunostaining and/or real-time PCR.

3.3 Characterization of Induced Astrocytes 3.3.1 Immunocytochemistry

All procedures are performed at room temperature (RT) unless a specified temperature is indicated. 1. Cells at density of 5  103 cells/cm2 are seeded for staining on day 0. 2. On day 1 after seeding, ash cells in PBS for three times, with 5 min each, before fixing them in 4% paraformaldehyde (PFA) for 10 min. 3. Wash cells in PBS twice, with 5 min each, after fixation.

Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules

49

4. Cells are then blocked in PBS with 0.01% Triton-X 100 (PBS-T) and 3% donkey serum for 1–2 h. 5. Incubate cells with primary antibodies in PBS-T with 3% donkey serum at 4
C for overnight. Primary antibodies include GFAP (1:2000, DAKO, Z0334), S100β (1:200, NOVUS, NB110-57478), and ALDH1L1 (1:200, NeuroMab, 75-140). 6. After primary antibody staining, cells are washed with PBS for three times, with 5 min each. 7. Incubate cells with fluorescent probe-conjugated secondary antibodies for 1 h. 8. After secondary antibodies, cells are washed with PBS for three times, 5 min each, followed by incubation with DAPI diluted 1:6000 in PBS for 15 min at room temperature for nuclear staining. 9. Capture images using a fluorescence microscope. 3.3.2 Real-Time PCR

1. Extract total RNA from 5  105 cells using TRIzol reagent. 2. 1μg RNA was used for cDNAs using Tetro cDNA synthesis kit. Perform real-time PCR using DyNAmo Flash SYBR Green qPCR mix on a StepOnePlus system (Applied Biosciences) using β-actin as the reference gene. The PCR reaction starts with an initial denaturation of 95
C for 10 min, followed by 40 cycles annealing and extension stage with 95
C for 15 s and 60
C 1 min. Primers used are listed in Table 1.

3.3.3 Glutamate Uptake Assay

1. Seed astrocytes at 2  104 cells per well in a 24-well plate pre-coated with Matrigel on day 0. 2. Add 100μM L-glutamate to each well and incubate with astrocytes for 6 h. 3. Collect cell medium after 6 h of incubation. 4. Measure L-glutamate concentration in the cell medium using a Glutamate Assay Kit. 5. Measure protein quantification of cell lysates using Bradford assay kit following manufacture’s instruction (Bio-Rad). Both the samples and the standards are run in triplicates. First add 0μg, 0.4μg, 0.8μg, 1.2μg, 1.6μg, or 2.0μg BSA standard to one well of a 96-well plate, and add H2O to make a total volume of 20μL per well. Dilute samples in H2O to make sure the protein concentration is in the range of the standards, and then transfer 2μL of each diluted sample to a well in the 96-well plate followed by adding H2O to make a total volume of 20μL per well. Then add 180μL of 1 Bradford dye reagent to each well. Incubate up to 5 min, and measure absorbance at 595 nm. The protein concentration will be measured using the standard curve of BSA.

50

E Tian et al.

Table 1 Primer sequences for RT-PCR analysis of mouse induced astrocytes Gene

Forward sequence

Reverse sequence

Gfap

50 GAAGTTCGAGAACTCCGGGAG 30

50 TTAGACCGATACCACTCCTCTG 30

mS100B

50 CCCTCATTGATGTCTTCCACCA 30

50 CTTCGTCCAGCGTCTCCATCAC 30

Aldh1L1

50 GGAAGACAGCAGCCTGCCTG 30

50 CTTCACATTACTCAGGGCAC 30

NFIA

50 ACAGGTGGGGTTCCTCAATC 30

50 GAGGCTTGGTGTCTGGCATG 30

Ctnnal1

50 GGAGAAGGTCACGGAGATCG 30

50 TGAAGTCCTCCACATGCTCC 30

Ndp

50 TGGACTCTCAACGCTGCATG 30

50 GGACAGTGCTGAAGGACACC 30

Lix1

50 GGAGTTCATCATGGAGAGTG 30

50 CATTCCAGTGCAGTAGTTGG 30

Sox6

50 CTTGCCGATGTGGTGGATAC 30

50 CTCTGCAAGGCTCTCAGGTG 30

Tlr3

50 TCACTTGCTCATTCTCCCTT 30

50 GACCTCTCCATTCCTGGC 30

Let7b

50 TCGACTCGAGCCCTCTCACT GAACCTCTGTCTCC 30

50 GCGAATTCTTAATTAAAAACCACC CAATCTGTGGCTCCA 30

Col12a1

50 AGGAGTTGATGAGCAGCTTG 30

50 GGTCACGAACATTGAGCGTG 30

Col6a3

50 TCTTGAACGTGTGGCTAACC 30

50 TCTCCAGAGCACTTGCATGG 30

Col3a1

50 GCCCACAGCCTTCTACAC 30

50 CCAGGGTCACCATTTCTC 30

Col1a1

50 GCAACAGTCGCTTCACCTACA 30

50 CAATGTCCAAGGGAGCCACAT 30

P21

50 AATCCTGGTGATGTCCGACC 30

50 CAAAGTTCCACCGTTCTCGG 30

ATF4

50 GAGCTTCCTGAACAGCGAAGTG 30

50 TGGCCACCTCCAGATAGTCATC 30

P27

50 GCCTGACTCGTCAGACAATC 30

50 CGTCTGCTCCACAGTGCCAG 30

DCN

50 TGAGCTTCAACAGCATCACC 30

50 AAGTCATTTTGCCCAACTGC 30

Gadd45b

50 CCTGGCCATAGACGAAGA AG 30

50 AGCCTCTGCATGCCTGATAC 30

IFRD1

50 ACAGGCAGCTCTTGAAGGTC 30

50 AGACAGCGCTCAATGCTATC 30

TGFB1I1

50 GCCTCTGTGGCTCCTGCAATAAAC 30

50 CTTCTCGAAGAAGCTGCTGCCTC 30

TGFBI

50 CCAAGTCACCCTACCAGCTG 30

50 TCCTCTGGTACCACTGCTTG 30

TSC22D1

50 GCTGCTGCTGCTGTCTGAAC 30

50 ACATCCCTGCTCACTCTCTG 30

FOXG1

50 TGGCAACACTGCCCATTCA 30

50 GCATTTGCGCAACACAGGTTA 30

Hoxb4

50 TTCACGTGAGCACGGTAAAC 30

50 CACTTCATGCGCCGATTCTG 30

NKX2.1

50 AAAACTGCGGGGATCTGAG 30

50 TGCTTTGGACTCATCGACAT 30

Pax3

50 ACTACCCAGACATTTACACCAGG 30

50 AATGAGATGGTTGAAAGCCATCAG 30

Sox1

50 CCAAGAGACTGCGCGCGCTG 30

50 TGAGCAGCGTCTTGGTCTTG 30

Pax6

50 ACCAAAGGGTCATCGCGCCC 30

50 TGGCAGTCCTTGCGATCGGC 30

Oct4

50 TAGGTGAGCCGTCTTTCCAC 30

50 GCTTAGCCAGGTTCGAGGAT 30

Nanog

50 CAGGAGTTTGAGGGTAGCTC 30

50 CGGTTCATCATGGTACAGTC 30

Aqp4

50 TTCTCTTCGGTGCTAGGAAAC 30

50 AGGAAGCTTATGTCTCTGGTG 30

Glast1

50 CTAGTTGTCTTCTCCATGTG 30

50 AGGAGAGGCAGGACGATGAC 30

(continued)

Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules

51

Table 1 (continued) Gene

Forward sequence

Reverse sequence

Glt1

50 GCGCATGTGCGACAAGCTGG 30

50 GCGATGCCAAGCGAAGCAGC 30

36B4

50 TGGTGCTGATGGGCAAGAA 30

50 ATTCCCCCGGATATGAGGC 30

Actin

50 CCGAGCGTGGCTACAGCTTC 30

50 ACCTGGCCGTCAGGCAGCTC 30

mGfap

50 TTGTTGGTATGGAGTATAGGTT GTTGTTAT 30

50 CCTACCTTCCTCTACCCATAC TTAAACT 30

6. The glutamate uptake is calculated by subtracting the remaining glutamate concentration in the medium from 100μM of the starting glutamate concentration and presented as nmol of glutamate per mg of total proteins. 3.3.4 Ca2+ Imaging

1. Seed astrocytes on Matrigel-coated Ibidi μ-slide 8-well-chamber slides at 1  105 cells per well, and allow the cells to grow for at least 5 days until calcium imaging was performed. 2. Rinse astrocytes with artificial cerebrospinal fluid (ACSF) (124 mM NaCl, 2.5 mM KCl, 26 mM NaHCO3, 1 mM MgCl2, 2 mM CaCl2, 1.25 mM NaH2PO4, and 10 mM Dglucose solution) at 37
C for 10 min, and then incubate the cells in ACSF containing 2μM Fluo-4 AM (Invitrogen) for 20 min. 3. Subsequently, visualize astrocytes using a fluorescence motorized microscope for serial time lapse imaging. The time lapse imaging is acquired at 10 magnification and at a speed of 16 frames/s for 5 min using a fast and sensitive EMCCD camera (Hamamatsu C9100-13). 4. Around 50 s after recording, add ATP or glutamate to the cell culture for a final concentration of 3μM. 5. Capture and process the Ca2+ imaging videos using ZEN software, and perform quantification using Image-Pro Premier 9.1. The fluorescence intensity change over time is defined as ΔF/F ¼ (F  Fo)/Fo, where F is the fluorescence intensity at any time point and Fo is the baseline fluorescence intensity averaged across the whole movie for each cell.

3.4 AstrocyteNeuron Co-culture

1. Euthanize a pregnant mouse with E13.5 embryos following an approved IACUC protocol.

3.4.1 Mouse Cortical Neuron Isolation

2. Briefly rinse the mouse with 70% (v/v) ethanol, dissect out the uterine horns, and place them into a Petri dish containing PBS without Ca2+Mg2+ and transfer the dish into a tissue culture hood under aseptic conditions.

52

E Tian et al.

3. Decapitate the embryo with a sterile scalpel, and place the head in a 10 cm Petri dish containing 8 ml PBS. 4. Carefully remove the thin skin layer under dissecting microscope. Cut and remove the forming skull pieces. 5. Remove the brain from the skull and place the brain in a dish. 6. Separate two hemispheres from the midbrain and remove meninges. Isolate the cortex from the remaining inner midbrain region. 7. Finely mince the brain tissue using a sterile razor blade until it becomes possible to pipette. 8. Transfer the brain tissues into a 50 ml Falcon tube, and add 1 ml of 0.05% trypsin/EDTA per brain. Incubate at 37
C for 15–30 min. Shake the tube every 5 min to mix. 9. Add about 1 volume of freshly prepared neuronal culture medium to neutralize the trypsin. 10. Centrifuge the cells at 300  g for 5 min, then carefully remove the supernatant, and resuspend the cell pellet in warm neuronal culture medium. 11. Place cells from three to four embryos into one 10 cm dish. Add 10 ml warm neuronal culture medium into each dish. These cells are considered P0 cells. The P0 cells can be cryopreserved for future usage or continued for co-culture. 3.4.2 Astrocyte-Neuron Co-culture

1. Plate mouse cortical neurons on a layer of mouse induced astrocytes at the density of 1  104 cells/cm2. 2. After 5 days of co-culture, the co-cultured cells will be stained for Map2 and Synapsin (see immunostaining procedure in Subheading 3.3.1). 3. The Synapsin+ puncta along the Map2+ neurites will be expressed as the number of puncta per 50μm neurite length.

3.5 Astrocyte Transplantation

1. Label mouse induced astrocytes with the GFP-expressing lentivirus. Dissociate the GFP-labelled astrocytes using trypsinEDTA and resuspend in mouse astrocyte medium at 1  105 cells/μl and keep the cells on ice till transplantation (see Notes 7 and 8). 2. The perinatal mice from P1 to P5 can be used in this study. The mouse pups will be anesthetized on ice for about 7:00 min. The anesthetized mice will be placed onto the injection rack of a stereotactic instrument individually. Cells will be delivered using a 22-gauge Hamilton syringe. Two microliter cell suspensions will be injected 1 mm from the midline between the bregma and lambda and 1 mm deep into the anterior lateral ventricles of neonatal immunodeficient NSG mice (also known as NOD scid gamma mice) at the injection speed of 1μl/min.

Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules

53

3. The needles will stay at the injection site for 30 s post-injection and then be pulled back slowly. Once the transplantation is complete, mice will be allowed to recover on a heating pad and then returned to their mother once they start to breathe at a normal rate. 4. After 6 weeks, euthanize the transplanted mice by perfusing with 4% PFA for 5 min. 5. Harvest brain tissues for immunostaining.

4

Notes 1. Reagent handling: β-mercaptoethanol, PFA, VPA, and DMSO are hazardous in case of skin contact, eye contact, ingestion, and inhalation. Use personal protective equipment. 2. Make sure to add the VCSTO compounds freshly each time. 3. It is very important to disinfect mice thoroughly and keep the tissues on ice to minimize cell death or senescence before fibroblast isolation. All tissues should be used within 2 h post-isolation. 4. The initial seeding density of fibroblasts before reprogramming depends on the growth rate of each fibroblast line. It is highly recommended to optimize the seeding density when new lines of fibroblasts are used. 5. Reprogramming efficiency is highly dependent on the status of the fibroblasts. Do not use late passage fibroblasts for reprogramming to avoid low reprogramming efficiency. 6. During fibroblast culture and conversion, always add medium from the wall of the plates instead of directly to the cells. Add medium slowly to avoid disturbing the cells. When passaging cells, inactivate trypsin as soon as the cells are detached to avoid over digestion-induced decrease of cell viability. 7. When labelling mouse induced astrocyte with the GFP-expressing lentivirus, the cells need to be at 70–80% confluency. The lentiviral transduction efficiency will be compromised if the cell confluency is too high. 8. Avoid repeated freeze-thaw cycles of the lentivirus, which reduces viral titer substantially. Aliquot lentivirus to small amount for each use.

Acknowledgments We thank Drs. G. Sun and P. Ye for providing detailed information on calcium imaging and stereotaxic transplantation, respectively. This work was supported by the Louise and Herbert Horvitz

54

E Tian et al.

Charitable Foundation, the Sidell-Kagan Foundation, the Christopher Family Endowed Innovation Fund, the California Institute for Regenerative Medicine TRAN1-08525, and the National Institute of Aging of the National Institutes of Health R01 AG056305, RF1 AG061794, and R56 AG061171. Research reported in this publication was also supported by the National Cancer Institute of the National Institutes of Health under award number P30CA33572. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. References 1. Wang DD, Bordey A (2008) The astrocyte odyssey. Prog Neurobiol 86:342–367. https://doi.org/10.1016/j.pneurobio.2008. 09.015 2. Sofroniew MV, Vinters HV (2010) Astrocytes: biology and pathology. Acta Neuropathol 119:7–35. https://doi.org/10.1007/s00401009-0619-8 3. Farhy-Tselnicker I, Allen NJ (2018) Astrocytes, neurons, synapses: a tripartite view on cortical circuit development. Neural Dev 13:7. https://doi.org/10.1186/s13064-0180104-y 4. Santello M, Toni N, Volterra A (2019) Astrocyte function from information processing to cognition and cognitive impairment. Nat Neurosci 22:154–166. https://doi.org/10.1038/ s41593-018-0325-8 5. Verkhratsky A et al (2012) Neurological diseases as primary gliopathies: a reassessment of neurocentrism. ASN Neuro 4(3):e00082. https://doi.org/10.1042/AN20120010 6. Eroglu C, Barres BA (2010) Regulation of synaptic connectivity by glia. Nature 468:223–231. https://doi.org/10.1038/ nature09612 7. Molofsky AV et al (2012) Astrocytes and disease: a neurodevelopmental perspective. Genes Dev 26:891–907. https://doi.org/10.1101/ gad.188326.112 8. Messing A, Brenner M, Feany MB, Nedergaard M, Goldman JE (2012) Alexander disease. J Neurosci 32:5017–5023. https://doi.org/10. 1523/JNEUROSCI.5384-11.2012 9. Li L et al (2018) GFAP mutations in astrocytes impair oligodendrocyte progenitor proliferation and myelination in an hipsc model of alexander disease. Cell Stem Cell 23:239–251. https://doi.org/10.1016/j.stem.2018.07. 009

10. Jones JR et al (2018) Mutations in GFAP disrupt the distribution and function of organelles in human astrocytes. Cell Rep 25:947–958. https://doi.org/10.1016/j.celrep.2018.09. 08 11. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676. https://doi.org/10.1016/ j.cell.2006.07.024 12. Davis RL, Weintraub H, Lassar AB (1987) Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51:987–1000. https://doi.org/10.1016/ 0092-8674(87)90585-x 13. Takahashi K et al (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861–872. https:// doi.org/10.1016/j.cell.2007.11.019 14. Vierbuchen T et al (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463:1035–1041. https://doi. org/10.1038/nature08797 15. Shi Y, Inoue H, Wu JC, Yamanaka S (2017) Induced pluripotent stem cell technology: a decade of progress. Nat Rev Drug Discov 16:115–130. https://doi.org/10.1038/nrd. 2016.245 16. Serio A et al (2013) Astrocyte pathology and the absence of non-cell autonomy in an induced pluripotent stem cell model of TDP-43 proteinopathy. Proc Natl Acad Sci U S A 110:4697–4702. https://doi.org/10. 1073/pnas.1300398110 17. Juopperi TA et al (2012) Astrocytes generated from patient induced pluripotent stem cells recapitulate features of Huntington’s disease patient cells. Mol Brain 5:17. https://doi. org/10.1186/1756-6606-5-17

Direct Reprogramming of Fibroblasts to Astrocytes Using Small Molecules 18. Kondo T et al (2013) Modeling Alzheimer’s disease with iPSCs reveals stress phenotypes associated with intracellular Abeta and differential drug responsiveness. Cell Stem Cell 12:487–496. https://doi.org/10.1016/j. stem.2013.01.009 19. Krencik R, Zhang SC (2011) Directed differentiation of functional astroglial subtypes from human pluripotent stem cells. Nat Protoc 6:1710–1717. https://doi.org/10.1038/ nprot.2011.405 20. Shaltouki A, Peng J, Liu Q, Rao MS, Zeng X (2013) Efficient generation of astrocytes from human pluripotent stem cells in defined conditions. Stem Cells 31:941–952. https://doi. org/10.1002/stem.1334 21. Wang C et al (2021) ApoE-Isoform-Dependent SARS-CoV-2 Neurotropism and Cellular Response. Cell Stem Cell 28:331–342. https://doi.org/10.1016/j.stem.2020.12. 018 22. Li X et al (2018) Fast generation of functional subtype astrocytes from human pluripotent stem cells. Stem Cell Reports 11:998–1008. https://doi.org/10.1016/j.stemcr.2018.08. 019 23. Lundin A et al (2018) Human iPS-derived astroglia from a stable neural precursor state show improved functionality compared with conventional astrocytic models. Stem Cell Reports 10:1030–1045. https://doi.org/10. 1016/j.stemcr.2018.01.021 24. Tcw J et al (2017) An efficient platform for astrocyte differentiation from human induced pluripotent stem cells. Stem Cell Reports 9:600–614. https://doi.org/10.1016/j. stemcr.2017.06.018 25. Kondo T et al (2016) Modeling Alexander disease with patient iPSCs reveals cellular and molecular pathology of astrocytes. Acta Neuropathol Commun 4:69. https://doi.org/10. 1186/s40478-016-0337-0 26. Ziff OJ, Patani R (2019) Harnessing cellular aging in human stem cell models of amyotrophic lateral sclerosis. Aging Cell 18: e12862. https://doi.org/10.1111/acel. 12862 27. Mertens J et al (2015) Directly reprogrammed human neurons retain aging-associated transcriptomic signatures and reveal age-related

55

nucleocytoplasmic defects. Cell Stem Cell 17:705–718. https://doi.org/10.1016/j. stem.2015.09.001 28. Caiazzo M et al (2011) Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476:224–227. https://doi.org/10.1038/nature10284 29. Pang ZP et al (2011) Induction of human neuronal cells by defined transcription factors. Nature 476:220–223. https://doi.org/10. 1038/nature10202 30. Han DW et al (2012) Direct reprogramming of fibroblasts into neural stem cells by defined factors. Cell Stem Cell 10:465–472. https:// doi.org/10.1016/j.stem.2012.02.021 31. Lujan E, Chanda S, Ahlenius H, Sudhof TC, Wernig M (2012) Direct conversion of mouse fibroblasts to self-renewing, tripotent neural precursor cells. Proc Natl Acad Sci U S A 109:2527–2532. https://doi.org/10.1073/ pnas.1121003109 32. Ring KL et al (2012) Direct reprogramming of mouse and human fibroblasts into multipotent neural stem cells with a single factor. Cell Stem Cell 11:100–109. https://doi.org/10.1016/j. stem.2012.05.018 33. Najm FJ et al (2013) Transcription factormediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol 31:426–433. https://doi.org/10.1038/nbt.2561 34. Yang N et al (2013) Generation of oligodendroglial cells by direct lineage conversion. Nat Biotechnol 31:434–439. https://doi.org/10. 1038/nbt.2564 35. Caiazzo M et al (2015) Direct conversion of fibroblasts into functional astrocytes by defined transcription factors. Stem Cell Reports 4:25–36. https://doi.org/10.1016/j.stemcr. 2014.12.002 36. Tian E et al (2016) Small-molecule-based lineage reprogramming creates functional astrocytes. Cell Rep 16:781–792. https://doi.org/ 10.1016/j.celrep.2016.06.042 37. Li W et al (2012) Identification of Oct4-activating compounds that enhance reprogramming efficiency. Proc Natl Acad Sci U S A 109:20853–20858. https://doi.org/10. 1073/pnas.1219181110

Chapter 5 Bcl-2-Assisted Reprogramming of Mouse Astrocytes and Human Fibroblasts into Induced Neurons Amel Falco, Rocı´o Bartolome´-Cabrero, and Sergio Gasco´n Abstract Direct neuronal reprogramming is a promising strategy to generate various types of neurons that are, otherwise, inaccessible for researchers. However, the efficiency of neuronal conversion is highly dependent on the transcription factor used, the identity of the initial cells to convert, their species’ background, and the neuronal subtype to which cells will convert. Regardless of these conditioning factors, the apoptotic regulator Bcl-2 acts as a pan-neuronal reprogramming enhancer. Bcl-2 mediates its effect in reprogramming by preventing an overshot of oxidative stress during the acquisition of a neuronal oxidative metabolism, thus reducing cell death by ferroptosis and facilitating the phenotypic conversion. In this chapter, we outline two methods to obtain either mouse or human neurons derived from postnatal astrocytes and skin fibroblasts, respectively. The overall reprogramming strategy is based on the co-expression of Bcl-2 and the transcription factor Neurog2 that produces mostly excitatory neurons. However, the method can be easily adapted to achieve alternative neuronal subtypes by using additional transcription factors, such as Isl1 for motor neurons. Therefore, our approaches provide solid but flexible platforms to obtain human and mouse induced neurons in vitro that can be applied to basic or translational research. Key words Direct reprogramming, Disease modeling, Induced neurons, Bcl-2, Neurog2, Isl1, Primary astrocytes, Human fibroblasts, Retroviral vectors

1

Introduction Direct neuronal reprogramming is an extraordinary method to obtain different types of neurons [1–3] and provides several advantages over the methods based on induced pluripotent stem cells (iPSCs), such as more affordability in terms of time and resources, and the benefit that it can be applied in pools of cells [4], avoiding possible artifacts derived from single iPSC clones. Moreover, direct reprogramming does not imply cell rejuvenation [5, 6], which is particularly favorable to model degenerative diseases of the central nervous system (CNS), as these conditions typically manifest in old onsets [7]. Up to now, expression of specific transcription factors achieved generation of, at least, eight subtypes of induced neurons (iNs) from mouse or human cells [8, 9] and has been applied to

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

57

58

Amel Falco et al.

model about ten different neurological disorders [10]. For example, the work of Hu and collaborators [11] showed that iNs derived from familiar Alzheimer disease patient’s fibroblasts displayed abnormal Aβ production, while motor neurons derived from amyotrophic lateral sclerosis patient’s fibroblasts with FUS mutation exhibited poor survival, soma shrinkage, hypoactivity, and an inability to form neuromuscular junctions [12]. Despite its broad applicability, direct reprogramming is not routinely used to obtain neuronal cells in laboratories. Perhaps the fact that the efficiency of direct neuronal reprogramming is highly dependent on the transcription factors used for the procedure, the neuronal subtypes to which the cells will convert, and the nature of the initial cell type to convert, made the methodology barely adaptable for specific requirements in laboratories. As an example, current protocols to convert cells into specific neuron subtypes often require simultaneous expression of several reprogramming factors per cell [13, 14], but using numerous vectors to deliver the reprogramming genes reduces the efficiency of transduction and, therefore, the number of neurons generated. To overcome this limitation, recent studies showed that neuronal reprogramming can be efficiently achieved by exposing cells to small molecules [11, 15, 16], but these approaches provide little control on the neuronal subtypes generated [8]. Bearing in mind the previous considerations, approaches to obtain and study neuronal cells using direct reprogramming would highly benefit from the discovery of novel enhancers of neuronal conversion that exert their role independently of the cellular context and the transcription factors used for the process. Thus, our previous findings identified Bcl-2 as a great enhancer of neuronal conversion of various cell types, mediated by several single neurogenic transcription factors, such as Ascl1, Neurog2, or NeuroD4 [17–19]. Bcl-2 is a protein that boosts survival in cells by preventing the action of pro-apoptotic molecules such as Bax, Bak, and Bad. Therefore, mutations that lead to exacerbated expression of Bcl-2 result in an abnormally high capacity of the affected cells to survive that might cause or worsen cancer conditions [20]. However, cumulative evidence suggests that, besides its anti-apoptotic function, Bcl-2 plays additional important roles on other biological processes, such as the regulation of autophagy [21], endoplasmic reticulum homeostasis [22], cell cycle [23], and mitochondrial physiology and metabolism [24, 25]. In the context of direct reprogramming, the mechanism by which Bcl-2 enhances neuronal conversion is independent of Bax [17] and, therefore, unrelated to its anti-apoptotic effects. In the search for the cellular and molecular mechanisms by which Bcl-2 promotes neuronal reprogramming, we identified that cultured astrocytes transfected with vectors encoding the neurogenic transcription factors Ascl1 or Neurog2 pass through a metabolic switch from less to more

In vitro Direct Neuronal Reprogramming

59

oxidative phosphorylation [17, 26]. This metabolic change leads to an overshoot of reactive oxygen species (ROS) that causes cell death by ferroptosis [17], which ultimately results in a dramatic decrease of cells successfully converting into iNs. In this regard, increased expression of Bcl-2 reduces oxidative stress during the reprogramming process and, therefore, leads to an astonishing improvement of the conversion efficiency [17, 27]. Accordingly, other molecules with antioxidant activity, such as vitamin E, forskolin, and vitamin D, significantly increase the efficiency of neuronal conversion; however, Bcl-2 exhibits by far the greatest effect [17]. In this chapter, we describe two solid protocols to efficiently obtain iNs in vitro from either mouse cortical astrocytes or human skin fibroblasts, based on the combined expression of Bcl-2 and the single neurogenic factor Neurog2. Both reprogramming models are partially complementary, since feeder cortical astrocytes and conditioned medium, obtained in the first protocol, are required for the survival and maturation of human iNs, in the second protocol. Reprogramming of mouse cells is achieved by transfection of the encoding vectors, while neuronal conversion of human cells is accomplished by transduction with retroviral vectors. Each protocol generates mouse or human pools of iNs with glutamatergic predominance, however, the methods can be easily adapted to induce different neuronal subtypes, i.e., by incorporating an additional neurogenic determinant or substituting Neurog2 by an alternative reprogramming factor. To highlight the adaptability of our methods to obtain different neuronal subtypes, we propose an alternative that allows achieving a pure population of HB9+, Isl2+, and Chat+ motor neurons from human fibroblasts, by the addition of the LIM homeodomain spinal cord motor neuronal determinant, Isl1 [28].

2

Materials The chapter describes two methodologies that require the same materials, unless otherwise indicated (see Subheading 2.3). Make sure that all the plastic material, reagents, and media are originally sterile. Also, it is highly recommended to filter the media through a 0.22 μm pore size filter before using it and to employ filtered pipette tips for all culture applications.

2.1

Animals

2.2 Astrocyte Isolation

1. Astrocytes are derived from C57BL/6 mice at the age of 5–7 postnatal days (P5–P7). 1. Dissection medium: 500 mL of Hanks’ Balanced Salt Solution (HBSS) supplemented with 5 mL of 1 M HEPES (final concentration 10 mM). This medium can be stored at 4  C for up to 8 weeks.

60

Amel Falco et al.

2. Broad point dissecting forceps. 3. Dumont no. 5 forceps. 4. Dumont no. 7 forceps. 5. Blunt surgical scissors. 6. Extra-fine spring scissors. 7. Disposable surgical blades. 2.3 Cell Culture and Reprogramming 2.3.1 Common Materials for Astrocytes and Fibroblasts

1. Proliferation medium: Dulbecco’s Modified Eagle Medium/ Ham’s F-12 nutrient mixture (DMEM/F-12 with GlutaMAX) medium supplemented with 10% fetal bovine serum (FBS), 2% B-27, 100 μg/mL penicillin/streptomycin, 10 ng/mL epidermal growth factor (EGF), and 10 ng/mL fibroblast growth factor (FGF). This medium can be stored at 4  C for up to 48 h. 2. Poly-D-lysine (PDL): to prepare PDL stock, dissolve 50 mg of PDL powder in sterile deionized water at a concentration of 1 mg/mL, and filter with 0.22 μm pore size filter. Aliquot the PDL stock and store at 20  C for up to 6 months. To prepare PDL working solution, add 1 mL of the PDL stock solution to 50 mL of sterile deionized water. This solution can be stored at 4  C for up to 2 weeks. 3. Phosphate-buffered temperature (RT).

saline

1

(PBS).

Store

at

room

4. Trypsin 0.15% solution: prepare 9 mL aliquots of the 0.25% trypsin-EDTA stock, and store them at 20  C up to 24 months. To prepare the working solution, dilute each 9 mL aliquot of the stock in PBS to reach a final volume of 15 mL. Use fresh or store at 4  C for up to 1 week. 5. Counting Neubauer chamber. 6. Syringe filters (0.22 μm pore size). 7. Serological pipettes (5 and 10 mL). 8. Glass coverslips (12 mm). All the coverslips should be pre-washed in 70% ethanol for 1 h while shaking (~50 r.p. m.), transferred afterward to 100% ethanol, and dried on a paper towel under a laminar airflow, in sterile conditions. 9. Multi-well 6 (M-6) and 24 (M-24) cell culture plates. 10. T-75 and T-175 flasks. 11. Reprogramming vectors: the expression of Neurog2 and Isl1 (optional) should be directed by promoters with strong and persistent activity in mammalian cells, such as the chicken betaactin promoter (pCAG). We recommend that the Neurog2encoding vector also includes a fluorescent reporter gene to allow the visualization of the iNs with an epi-fluorescence microscope. Bcl-2 expression should be preferentially driven by promoters with a short-term activity, such as long terminal

In vitro Direct Neuronal Reprogramming

61

repeat (LTR)-driven Moloney murine leukemia virus (MMLV)-derived retroviral vectors (i.e., pMIG-derived vectors). Viral vectors used in this protocol are described in Gasco´n et al. [17]: plasmid RV-pCAG-Neurog2-RFP (not commercial, but can be substituted by the plasmid CBIGNgn2, #48708 from Addgene); plasmid pMIG-Bcl-2-IRESGFP (#8793 from Addgene); and plasmid pMXs-Isl1 (#32929 from Addgene). 2.3.2 Materials Specifically Required for Astrocyte Culture and Reprogramming

1. Differentiation medium: DMEM/F-12 with GlutaMAX supplemented with 2% B-27 and 100 μg/mL penicillinstreptomycin. This medium can be stored at 4  C for up to 48 h. 2. Transfection medium: Opti-MEM enriched with 1% GlutaMAX, 10 ng/mL EGF, and 10 ng/mL FGF. This medium should be prepared fresh shortly before use. 3. Lipofectamine 2000 (Lp2000).

2.3.3 Materials Specifically Required for Fibroblast Culture and Reprogramming

1. Primary human skin fibroblasts can be obtained from different suppliers (i.e., ATCC). 2. Human fibroblast medium: DMEM high glucose with GlutaMAX and HEPES but without sodium pyruvate, supplemented with 10% FBS, 100 μg/mL penicillin/streptomycin, 10 ng/ mL EGF, and 10 ng/mL FGF. This medium can be stored at 4  C for up to 48 h. 3. Human fibroblast differentiation medium: DMEM/F-12 with GlutaMAX, supplemented with 2% FBS, 2% B-27, 100 μg/mL penicillin/streptomycin, and 10 ng/mL EGF. This medium can be stored at 4  C for up to 48 h. 4. Collagen IV: Dilute 5 mg of collagen IV powder in 25 mL of PBS to reach a concentration of 200 mg/L. This stock solution can be stored at 20  C for up to 1 year. To prepare collagen IV working solution, thaw one aliquot of the collagen IV stock on ice, and dilute 1:10 with sterile PBS to reach a concentration of 20 mg/L. The remaining collagen working solution can be used for about 1 month if stored at 4  C. 5. Laminin: thaw the laminin solution at 2–8  C to avoid the formation of insoluble gels. Aliquot the laminin stock and store at 20  C up to 6 months. To obtain laminin working solution, dilute 25 μL of laminin stock in 5 mL of sterile deionized water. This solution can be stored at 4  C for up to 1 week. 6. Rock inhibitor: in order to prepare the stock solution, dissolve 5 mg of product powder in 1.48 mL of sterile deionized water to reach a concentration of 10 mM. Store aliquots at 20  C up to 6 months. Avoid re-freezing cycles.

62

Amel Falco et al.

7. Viral particles generated in HEK293T cells. They can be produced by the final user (see Subheading 3.5) or provided by specific companies. Vials containing retrovirus should be aliquoted and stored at 80  C. Keep aliquots on ice while using, and avoid more than three refreezing cycles.

3

Methods This chapter describes a combined protocol to culture and convert postnatal astroglia cells and human-derived fibroblast into iNs (see Fig. 1). All the procedures should be performed in a sterile environment provided by a laminar flow hood. For the manipulation of retroviruses and human cells, follow the local biosafety guidelines, bearing in mind that Bcl-2 is classified as an oncogene. When the protocol does not indicate the temperature of solutions, it should be assumed RT as default.

3.1 Isolation and Culture of Primary Cortical Astroglia from Postnatal Mice

All the dissection tools must be sterilized with 70% ethanol before using. The protocol to isolate and culture astroglial cells is a modification of the procedure described in [29] and outlines as follows: 1. Decapitate two postnatal mice with surgical scissors, and remove the skin and the top of the skull of the head. Extract the whole brain, and transfer it into a 60 mm culture dish containing 10 mL of ice-cold dissection medium. 2. Cut the brain coronally into two equal parts with a blade, and discard the anterior part containing the olfactory bulbs. 3. Using thin forceps, carefully remove and discard the meninges. 4. Separate the cerebral cortices of both hemispheres from the rest of the brain, and transfer them into a 15 mL conical tube containing 5 mL of ice-cold dissection medium. 5. With a 1 mL micropipette set to 600 μL and carrying a filter tip, pipette the mixture fast up and down a few times to mechanically disaggregate the tissue. 6. Centrifuge the cell suspension at 350 relative centrifuge force (RCF) for 5 min at 4  C. Aspirate the supernatant, and resuspend the cell pellet in 5 mL of pre-warmed (37 ºC) proliferation medium. 7. Transfer the cell suspension into a T-75 flask and make up to 15 mL with proliferation medium and tilt the flask to distribute the cells over the surface. 8. Incubate the cells at 37  C and 5% CO2. Avoid disturbing the cells during the first 24 h after seeding.

In vitro Direct Neuronal Reprogramming

63

Fig. 1 Scheme of the reprogramming protocols. Cartoon represents the combined protocol used in this chapter to obtain iNs from mouse astroglia (green box) and human fibroblasts (blue box). Both methodologies are complementary and share common materials. In brief, cortical astrocytes from 5 days postnatal mice are cultured in a T-75 flask. Five days later, cells are reseeded in M-24 plates and transfected with the reprogramming vectors encoding neurogenic factors and Bcl-2. Neuronal induction of transfected astrocytes requires 7–30 days to take place. In addition to the astroglia cultures seeded for reprogramming experiments, two T-175 flasks can be plated to produce conditioned medium that will be used to culture and reprogram human fibroblasts. For the human paradigm, fibroblasts are expanded in T-75 flasks and thereafter seeded in an M6 plate for transduction with the retroviral vectors encoding the reprogramming factors. Three days later, transduced fibroblasts are recollected and reseeded in M-24 plates containing feeder astrocytes. Astrocyte plus fibroblast co-cultures require periodic additions of astrocyte-derived conditioned medium, until neuronal conversion is fully achieved (about 60 days in vitro)

9. After 3 days in culture, remove the medium and add 10 mL of PBS. Gently shake the flask and remove/discard the PBS with the floating cells. Add 15 mL of fresh pre-warmed (37 ºC) proliferation medium. 10. Cultures reach about 75% confluence in about 5–7 days. 3.2 Passaging and Plating Astroglial Cells

When the cultures reach 70–80% confluence, astrocytes should be reseeded into new culture recipients as follows:

3.2.1 PDL Coating of Coverslips

1. Place one coverslip in each well of a M-24 plate, and add 700 μL of PDL working solution per well. 2. Incubate the solution overnight at 37  C. 3. Wash the wells twice with 500 μL sterile deionized water, and let them dry under the laminar airflow before seeding the cells. Dried plates can be stored at 4  C for up to 2 weeks.

64

Amel Falco et al.

3.2.2 Laminin Coating of PDL-Coated Coverslips Required for the Fibroblast Reprogramming Procedures

3.2.3 Passaging Astroglial Cells

1. About 1 h before seeding cells, add 500 μL of laminin working solution in each well of M-24 plates containing a PDL-covered coverslip. 2. Incubate the solution for 1 h at 37  C. 3. Wash the coverslips twice with 500 μL PBS. Keep the PBS from the last washing step, and remove it just before plating cells (see next steps). Plates cannot be stored and should be used shortly after being prepared. 1. Before passaging astroglia cultures, check that cells are healthy and not senescent (see Note 1). 2. Remove the culture medium from the flask, and wash with 5 mL of PBS. Detach contaminating oligodendrocyte precursor cells by harshly shaking the flask. 3. Remove and discard the PBS with floating cells. 4. Add 4 mL of pre-warmed (37  C) 0.15% trypsin solution, and tilt the flask to distribute the trypsin over the cells. 5. Incubate for 5 min at 37  C, and gently knock the flask on its side from time to time to dislodge the cells. 6. Once the astrocytes have detached from the flask, collect and transfer the cell suspension into a 15 mL conical tube containing 1 mL of FBS. Mix by gently flipping the 15 mL conical tube in order to neutralize the trypsin. 7. Centrifuge at 350 RCF for 5 min at 4  C. 8. Remove the supernatant, and resuspend the pellet of cells in 2 mL of proliferation medium by slowly pipetting up and down for a few times with a 5 mL serological pipette. Avoid the formation of air bubbles during the homogenization step, as this might reduce the viability of cells. 9. Determine the number of cells with a Neubauer chamber, accordingly with standard procedures. 10. Once the concentration of cells has been determined, dilute the cell suspension in fresh pre-warmed (37  C) proliferation medium to obtain a concentration of 80,000 cells per mL. 11. Seed 1 mL of cell suspension directly onto each PDL- (for reprogramming of astrocytes) or PDL-laminin- (for reprogramming of fibroblast) coated glass coverslips in the M-24 plates (see Note 4) and/or 25 mL into each T-175 flask (required for fibroblast reprogramming; see Subheading 3.5.2). Avoid formation air bubbles when seeding the cells. 12. Incubate the cells at 37  C with 5% CO2 for 24 h.

In vitro Direct Neuronal Reprogramming

3.3 Transfection of Astroglial Cells for Neuronal Conversion

65

Twenty-four hours after seeding, astrocytes plated on PDL-coated wells should reach about 70% confluence and can be transfected as follows: 1. Remove the culture medium, and add 300 μL of pre-warmed (37  C) transfection medium to each well. 2. Incubate the cells (5% CO2 and 37  C) for minimum 1 h in this medium. 3. While the cells are incubating, prepare the transfection mix (TM) solutions A and B as follows: for the TM A, add 0.2 μg of Neurog2-encoding plasmid and 0.2 μg of Bcl-2-encoding plasmid (0.4 μg of total DNA) to 50 μL of transfection medium per each well. For the TM B, add 0.7 μL of Lp2000 to 50 μL of transfection medium per each well to transfect. Scale TMs A and B according to the number of wells to transfect. Use sterile plastic tubes with an appropriate size to contain the TM solutions. 4. Shake by knocking the end of the tubes with the fingers, and incubate them for 10 min at RT. 5. Transfer the TM B on the TM A, drop by drop, while gently shaking. Next, bubble the mix with a 1 mL micropipette carrying an empty tip, to ensure that both solutions are properly mixed, and incubate for 30 min at RT. 6. Add 100 μL per well of the TM A + B, drop by drop, distributing over the whole surface, and gently shake the plate. 7. Incubate the cells for 4 h at 37  C and 5% CO2. 8. Remove the transfection medium, and add 500 μL of pre-warmed (37 ºC) proliferation medium. 9. Incubate the cells for 24 h at 37  C and 5% CO2. 10. Add 500 μL of pre-warmed (37  C) differentiation medium. 11. Incubate the cells for 24 h at 37  C and 5% CO2. 12. Replace the culture medium by pre-warmed (37  C) differentiation medium. 13. Two days after transfection, neurons can be identified by immunostaining with antibodies for neuronal hallmarks, such as DCX, β-III-tubulin, or MAP2. The acquisition of mature electrophysiological properties and the formation of vGLuT+ synapses might require 4 weeks or longer [1, 17, 18, 29].

3.4 Plating and Passaging Human Skin Fibroblasts

The procedure assumes that human cells are initially contained in a cryogenic vial stored in liquid nitrogen (see Fig. 1).

3.4.1 Collagen IV Coating of T-75 Flasks and Multi-well 6 Plates

1. Distribute 10 mL of the collagen working solution over the surface of the T-75 flasks or 1.5 mL on each M-6 plate well. 2. Incubate flasks and/or plates for 1 h at 37  C.

66

Amel Falco et al.

3. Withdraw the collagen solution with a pipette, avoiding touching the coated surfaces. Recovered collagen solution from this step can be stored at 4  C and reused once again. 4. Wash the coated surfaces thrice with 1.5 mL (M6 wells) or 10 mL (flasks) of PBS, avoiding them to dry. Remove the PBS from the last washing step just before plating cells. Plates and flasks should be used shortly after coating. 3.4.2 Culturing Human Fibroblasts in T-75 Flasks

1. Thaw quickly a cryopreserved vial containing 500,000 viable frozen human fibroblasts by placing it in a 37  C water bath. This step typically requires 2 min. 2. Retrieve the vial from the bath, clean its exterior surfaces with 75% ethanol, and place it in the sterile laminar hood. 3. In order to remove dimethyl sulfoxide (DMSO) from the cryopreservation solution, transfer the cell suspension from the vial to a 15 mL conical tube containing 10 mL of PBS, and resuspend the cells by gently inverting the tube a few times. 4. Centrifuge the conical tube at 350 RCF for 5 min at 4  C. 5. Remove supernatant and resuspend the pellet of cells with 5 mL of pre-warmed (37  C) human fibroblast medium. 6. Transfer the cell suspension in a T-75 flask containing 10 additional mL of pre-warmed (37  C) human fibroblast medium, and tilt the flask to distribute the cells over the surface. 7. Place the T-75 flask in a 37  C, 5% CO2 incubator. Avoid disturbing the cells during the first 24 h after seeding. 8. When the cells reach 80% confluence, passage them to new T-75 flasks (see next steps).

3.4.3 Expanding Human Fibroblasts in T-75 Flasks

1. Remove the medium from the flask and wash once with 15 mL of PBS. 2. Remove the PBS, add 4 mL of 0.15% trypsin solution, and tilt the flask to distribute the trypsin over the cell monolayer. Incubate for 5 min at 37  C. Gently knock the flask on its side from time to time to dislodge the cells. 3. Once cells are detached, collect and transfer the suspension into a 15 mL conical tube containing 1 mL of FBS. Neutralize the trypsin by gently flipping the tube. 4. Centrifuge at 350 RCF for 5 min at 4  C. 5. Remove the supernatant, and resuspend the pelleted cells in 6 mL of pre-warmed (37  C) human fibroblast medium by slowly pipetting up and down for a few times with a 5 mL serological pipette.

In vitro Direct Neuronal Reprogramming

67

6. Distribute the resuspended cells (6 mL) into six T-75 flasks, containing 10 mL of pre-warmed (37  C) human fibroblast medium each, at a rate of 1 mL of cell suspension per flask. 7. Place the T-75 flask in a 37  C, 5% CO2 incubator, and avoid disturbing the cells during the first 24 h after seeding. 3.5 Neuronal Reprogramming of Human Fibroblasts

3.5.1 Retroviral Transduction of Human Fibroblasts

Retroviral vectors used in this chapter were produced accordingly with the protocol described in Tashiro et al. [30]. They can be also provided by dedicated commercial services. We strongly recommend to use highly concentrated viral suspensions of 1  106 to 1  108 colony-forming units (c.f.u.)/mL. 1. Remove the cell medium from one fibroblast-containing T-75 flask (see Note 2), and resuspend the cells following the steps 1–5 described in Subheading 3.4.3. 2. Count the cell density with a Neubauer chamber. 3. Dilute the cells with pre-warmed (37  C) human fibroblast medium to reach a concentration of 25,000 cells per mL, and plate 2 mL (50,000 cells) per well of an M6 plate, previously coated with collagen solution. Plate as many M-6 wells as required, bearing in mind that each well will provide cells for six experimental replicates. 4. Culture the cells in the incubator for 24 h. After this period, fibroblasts should reach about 70% confluence. If the cultures progress slower than expected, allow them to grow for up to 24 additional hours, and re-adjust the number of plated cells for future experiments. 5. Substitute the medium of each M-6 well by 1.5 mL of fresh human fibroblasts medium, and incubate the cells for 1 additional hour. 6. Transfer and pool 50 μL of medium from each M-6 well into a 1.5 mL sterile microtube. Add 5  105 c.f.u. of the Neurog2encoding retrovirus per each 50 μL of pooled medium. Add the same number of infective particles for the suspension containing the Bcl-2-encoding vectors. In case that iNs with a motor neuronal phenotype are required, do the same with the Isl1encoding retroviral vectors. Once the viruses are pooled, pipette up and down thoroughly to homogenize the suspension with an appropriate micropipette. 7. Transfer the pooled medium containing the viral suspension back to each M-6 fibroblast-containing well, and pipette up and down 8–10 times with a 1 mL micropipette set to 600 μL. Do this step gently, with the plate slightly tilted, to avoid cells from detaching.

68

Amel Falco et al.

8. Place the plate back to the incubator. 9. Shake the plate gently every 30 min during the next 2 h. 10. Culture at 37  C, 5% CO2. 3.5.2 Using Astrocytes as Feeder Cells and to Produce Conditioned Medium for Fibroblast Reprogramming

1. One day after transduction of fibroblasts, prepare astrocyte cultures in two T-175 flasks and one M-24 plate with PDLlaminin-coated coverslips, following the steps described in Subheading 3.2.3 (see Note 3). Astrocytes cultured in the M-24 plate format will be used as feeder cells, to facilitate the conversion of fibroblasts into iNs. It is important that they reach about 75% confluency before being used (see Note 4). The two T-175 flasks will provide conditioned differentiation medium (CDM), which is crucial for the survival and maturation of human iNs (see Note 5). 2. Three days after transduction of fibroblasts, remove the culture medium, and wash each M-6 well twice with 2 mL of PBS. 3. Remove the PBS, and add 500 μL of pre-warmed (37  C) 0.15% trypsin solution over the well’s surfaces. Incubate for 5 min at 37  C. Gently knock the plate on its side from time to time to dislodge the cells. 4. Once the cells have detached from the flask, collect the trypsincell suspension, and transfer it into a 15 mL conical tube containing 500 μL of FBS. Mix gently by inverting the tube. 5. Centrifuge at 350 RCF for 5 min at 4  C. 6. Remove the supernatant, and resuspend the pellet of cells in 3 mL of proliferation medium by slowly pipetting up and down for a few times with a 5 mL serological pipette. Avoid the formation of air bubbles. 7. Distribute the cells from each M-6 well (3 mL) onto six M-24 plate wells containing astrocytes seeded on PDL-laminincoated coverslips, by adding 500 μL of fibroblast suspension per well. 8. Shake the M-24 plate gently and place it in the incubator at 37  C with 5% CO2.

3.5.3 Progression of Fibroblast-to-Neuron Conversion

1. Three days after the astrocyte plus fibroblast co-cultures are established, prepare and pre-warm (37  C) 50 mL of human fibroblast differentiation medium. 2. With a 10 mL serological pipette, carefully collect the conditioned medium from two T-175 flasks containing astrocytes (from the step 1 in Subheading 3.5.2), and transfer it into a 50 mL conical tube. To avoid astrocytes from drying out, quickly refill the two flasks with 50 mL of human fibroblast differentiation medium that was prepared in the previous step (25 mL per flask).

In vitro Direct Neuronal Reprogramming

69

Fig. 2 Time lapse of the fibroblast-to-neuron conversion. Micrographs show neuronal conversion of human fibroblasts (35-year-old donor) transduced with retroviral vectors encoding Bcl-2, Neurog2, Isl1, and the fluorescent reporter RFP, at 2, 8, and 45 days after being seeded onto astroglia feeders. Note the progressive changes in morphology, from large-flat to small-elongated shape, and the development of neuronal processes. Scale bar 100 μm

3. Return both T-175 flasks to the incubator. 4. Add 50 μL of the rock inhibitor solution (10 mM) to about 45–50 mL of collected CDM, and filter this medium through a 0.22 μm pore size filter. CDM cannot be stored and needs to be used always fresh. 5. Remove half of the medium (1 mL) from the M-24 plate wells containing the co-cultured astrocytes and fibroblasts, and carefully add the equivalent volume (1 mL) of CDM. 6. Return the M-24 plate to the incubator. 7. Neuronal conversion of fibroblasts requires medium changes (steps 2–6) every 3 days for up to 60–90 days. Fate transition of living cells can be monitored with an epi-fluorescence microscope (Fig. 2), if the reprogramming vectors encode fluorescent reporters (see Note 6). Expression of neuronal hallmarks (i.e., β-III-tubulin or HB9 in case of motor neurons) can be already detected 15–20 days after the co-cultures were established, but the expression of mature neuronal markers will require longer (i.e., synapsin 1 or synaptobrevin 2).

4

Notes 1. Do not use astrocytes that became senescent (large-flat morphology) for reprogramming experiments, as feeder cells, nor to produce conditioned medium. To avoid senescence, do not allow glial cultures to reach more than 90–100% confluence, and use them always freshly prepared. 2. Human fibroblasts should never exceed ten passaging cycles.

70

Amel Falco et al.

3. If the proportion of transduced fibroblasts (detected with red fluorescent protein (RFP) or green fluorescent protein (GFP) fluorescence) is lower than about 50% one after viral infection, re-infect the cells, and wait for 24 additional hours prior to reseeding them onto the astrocyte feeders. 4. When not all the wells of M-24 plates are required for human fibroblast reprogramming, we strongly recommend to plate the cells on the wells located at most central positions and fill the rest with water. This minimizes medium evaporation during the long time required for reprogramming to take place. 5. Since astroglia cultures might became senescent or contaminated during the time required for reprogramming of fibroblasts to take place (60–90 days), we strongly advise to keep two T-175 flasks containing astrocytes (Subheadings 3.2.3, step 11 and 3.5.2, step 1) for the production of conditioned medium. Indeed, it is also recommended to routinely prepare additional fresh cultures during the whole reprogramming process. 6. To avoid phototoxicity, do not expose living cells to fluorescent lights for long periods of time.

Acknowledgments We would like to thank Magdalena Go¨tz for resources support, Tobias Bo¨ckers for providing us the human skin fibroblasts, and Beatriz Gasco´n Jime´nez for assistance with Fig. 1. The development of the protocols described in this chapter has been funded by the Innovative Stem Cell Technologies for Personalized Medicine grant, “Modeling ALS disease in vitro”-MAIV 01EK1611A (Federal Ministry of Education and Research, BMBF-Germany); the National Programme for Research Aimed at the Challenges of Society grant, NAMRDR-RTI2018-099345-B-I00; and the budget associated to the Ramo´n y Cajal Programme RYC-2015-19185 (Ministry of Science, Innovation and Universities, Spain). References 1. Heinrich C et al (2010) Directing astroglia from the cerebral cortex into subtype specific functional neurons. PLoS Biol 8(5):e1000373 2. Dell’Anno MT et al (2014) Remote control of induced dopaminergic neurons in parkinsonian rats. J Clin Invest 124(7):3215–3229 3. Victor MB et al (2014) Generation of human striatal neurons by microRNA-dependent direct conversion of fibroblasts. Neuron 84 (2):311–323

4. Vierbuchen T, Wernig M (2011) Direct lineage conversions: unnatural but useful? Nat Biotechnol 29(10):892–907 5. Mertens J et al (2015) Directly reprogrammed human neurons retain aging-associated transcriptomic signatures and reveal age-related nucleocytoplasmic defects. Cell Stem Cell 17 (6):705–718 6. Huh CJ et al (2016) Maintenance of age in human neurons generated by microRNA-

In vitro Direct Neuronal Reprogramming based neuronal conversion of fibroblasts. Elife 5:e18648 7. de Pedro-Cuesta J et al (2015) Comparative incidence of conformational, neurodegenerative disorders. PLoS One 10(9):e0137342 8. Masserdotti G, Gascon S, Gotz M (2016) Direct neuronal reprogramming: learning from and for development. Development 143 (14):2494–2510 9. Li S et al (2019) Conversion of astrocytes and fibroblasts into functional noradrenergic neurons. Cell Rep 28(3):682–697.e7 10. Drouin-Ouellet J et al (2017) Direct neuronal reprogramming for disease modeling studies using patient-derived neurons: what have we learned? Front Neurosci 11:530 11. Hu W et al (2015) Direct conversion of normal and Alzheimer’s disease human fibroblasts into neuronal cells by small molecules. Cell Stem Cell 17(2):204–212 12. Liu ML, Zang T, Zhang CL (2016) Direct lineage reprogramming reveals disease-specific phenotypes of motor neurons from human ALS patients. Cell Rep 14(1):115–128 13. Rivetti di Val Cervo P et al (2017) Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson’s disease model. Nat Biotechnol 35 (5):444–452 14. Niu W et al (2018) Phenotypic reprogramming of striatal neurons into dopaminergic neuronlike cells in the adult mouse brain. Stem Cell Reports 11(5):1156–1170 15. Zhang L et al (2015) Small molecules efficiently reprogram human astroglial cells into functional neurons. Cell Stem Cell 17 (6):735–747 16. Li X et al (2015) Small-molecule-driven direct reprogramming of mouse fibroblasts into functional neurons. Cell Stem Cell 17(2):195–203 17. Gascon S et al (2016) Identification and successful negotiation of a metabolic checkpoint in direct neuronal reprogramming. Cell Stem Cell 18(3):396–409

71

18. Gascon S, Ortega F, Go¨tz M (2017) Transient CREB-mediated transcription is key in direct neuronal reprogramming. Neurogenesis 4(1): e1285383 19. Masserdotti G et al (2015) Transcriptional mechanisms of proneural factors and REST in regulating neuronal reprogramming of astrocytes. Cell Stem Cell 17(1):74–88 20. Perini GF et al (2018) Bcl-2 as therapeutic target for hematological malignancies. J Hematol Oncol 11(1):65 21. Pattingre S et al (2005) Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy. Cell 122(6):927–939 22. Ferdek PE et al (2012) A novel role for Bcl-2 in regulation of cellular calcium extrusion. Curr Biol 22(13):1241–1246 23. O’Reilly LA, Huang DC, Strasser A (1996) The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J 15(24):6979–6990 24. Gimenez-Cassina A, Danial NN (2015) Regulation of mitochondrial nutrient and energy metabolism by Bcl-2 family proteins. Trends Endocrinol Metab 26(4):165–175 25. Cleland MM et al (2011) Bcl-2 family interaction with the mitochondrial morphogenesis machinery. Cell Death Differ 18(2):235–247 26. Machler P et al (2016) In vivo evidence for a lactate gradient from astrocytes to neurons. Cell Metab 23(1):94–102 27. Gascon S et al (2017) Direct neuronal reprogramming: achievements, hurdles, and new roads to success. Cell Stem Cell 21(1):18–34 28. Liang X et al (2011) Isl1 is required for multiple aspects of motor neuron development. Mol Cell Neurosci 47(3):215–222 29. Heinrich C et al (2011) Generation of subtypespecific neurons from postnatal astroglia of the mouse cerebral cortex. Nat Protoc 6 (2):214–228 30. Tashiro A, Zhao C, Gage FH (2006) Retrovirus-mediated single-cell gene knockout technique in adult newborn neurons in vivo. Nat Protoc 1(6):3049–3055

Chapter 6 Direct Conversion of Human Fibroblasts to Induced Neurons Lucia Zhou-Yang, Sophie Eichhorner, Lukas Karbacher, Lena Bo¨hnke, Larissa Traxler, and Jerome Mertens Abstract Progressive aging is a physiological process that represents a central risk factor for the development of several human age-associated chronic diseases, including neurodegenerative diseases. A major focus in biomedical research is the pursuit for appropriate model systems to better model the biology of human aging and the interface between aging and disease mechanisms. Direct conversion of human fibroblasts into induced neurons (iNs) has emerged as a novel technology for the in vitro modeling of age-dependent neurological diseases. Similar to other cellular reprogramming techniques, e.g., iPSC-based cellular reprograming, direct conversion relies on the ectopic overexpression of transcription factors, typically including well-known pioneer factors. However, in contrast to alternative technologies to generate neurons, the entire process of direct conversion bypasses any proliferative or stem cell-like stage, which in fact renders it the unique aptitude of preserving age-associated hallmarks from the initial fibroblast source. In this chapter, we introduce direct conversion as a practical and easy-to-approach disease model for aging and neurodegenerative disease research. A focus here is to provide a stepwise protocol for the efficient and highly reproducible generation of iNs from adult dermal fibroblasts from human donors. Key words Induced neurons (iNs), Aging, Cell reprogramming, Direct conversion, Neurodegeneration, Neurological diseases

1

Introduction Aging describes the progressive physiological decline of a multitude of functional domains, leading to reduced bodily health and ultimately death [1–4]. Alongside the rapid increase of the global median age, aging constitutes the largest driving factor for the development of a wide range of overt chronic diseases that appear to predominantly affect the elderly population, such as neurodegenerative diseases (NDDs) [5, 6]. It can be expected that aging and NDD pathologies share some level of overlap of their key molecular and cellular mechanisms. Consequently, attempts to tackle aging in general, as opposed to targeting individual diseases

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

73

74

Lucia Zhou-Yang et al.

(interventional gerontology or geroscience), have already become a center of interest in both academic and modern industrial research [7, 8]. Long-lived post-mitotic cells (mature and terminally differentiated), such as neurons, are mainly formed during the early stages of human development and persist functional in the long term (replaced rarely, or not at all), which reinforces their particular susceptibility to progressive aging. In fact, post-mitotic neurons in the central nervous system suffer from irreversible declines in neuroplasticity and cognition late in life, which likely leads to severe neuronal cell loss due to cumulative DNA damage among other facts and worst-case scenario, neurodegeneration [9–13]. In order to address the longstanding question of how progressive human aging can cause persistent damage leading to decreased functionality, a detailed molecular characterization of individual age-related NDDs is underway, and unremitting efforts have been made in developing experimental drugs for their translation into clinical trials. Yet, the vast majority of age-associated NDDs still lack effective disease-modifying therapies, which might in large part be limited by the lack of predictive model systems. Specifically, the inaccessibility of live brain tissue has prevented us from functionally and molecularly studying vital human neurons with varying genotypes and under different conditions. Further, although human post-mortem brain samples hold significant information, and new technologies are emerging to extract that information better, they likely suffer from significant molecular decay during long and variable post-mortem intervals. Also, post-mortem samples offer virtually no room for manipulation or functional assays (e.g., genetic engineering or drug testing). And as an additional disadvantage, post-mortem samples by design represent end-stage phenomena, making it particularly difficult to elucidate disease-triggering mechanisms during the earlier episodes [14, 15]. In consequence, scientists have put great emphasis on using animal models, which has prompted the research in age-related NDDs. However, they carry several important limitations: (1) popular laboratory model animals have relatively short natural life spans in comparison to humans; (2) it is difficult to reproduce the same etiopathogenesis of the disease; (3) the physio-anatomical organization differs considerably between animal models and humans, which limits the transferability of the results and, in particular, for predicting drug responses [16–19]; (4) transgenic animals are a tremendously helpful option, but likely suffer from exaggerated protein levels of xenogenic (not from the same species) human transgenes, and the known disease-causing genes that are introduced into these animals typically represent only a small fraction of human cases [16, 17, 20]; and (5) because NDDs often develop spontaneously with no clear genetic cause, animal models are often merely used to study inherited NDDs. This last point is of extreme importance because, in

Direct Conversion of Human Fibroblasts to Induced Neurons

75

many NDDs, e.g., Alzheimer’s disease, 95% of the known cases rather have a sporadic etiology [21], which unfortunately is unlikely to be reproduced in animal models. The abovementioned circumstances highlight the unmet need for novel models that account both human (cell) physiology and age as important factors. Such models would be very valuable to complement existent models in the pursuit of understanding the bridge between human aging and disease. In this context, new promising approaches are arising for in vitro disease modeling, and the generation of cultures that contain authentic reflections of human neurons as “patient-in-the-dish” disease models has attracted widespread attention and is becoming the up-to-date gold standard in aging research [22–25]. Consistently, a major turning point in in vitro disease modeling has been marked by cell fate “reprogramming” or “conversion” technologies. These approaches rely on the intentional modulation of cell identityspecifying components, genomic, epigenomic, transcriptomic, proteomic, and metabolomic facets of a cell, to an extent that functional and morphological features become fundamentally changed [26–28]. A groundbreaking example of cell reprogramming was demonstrated when Kazutoshi Takahashi and Shinya Yamanaka revealed that overexpression of the four transcription factors (TFs) Oct 3/4, Sox2, Klf4, and c-Myc (OSKM) can induce a pluripotent state in mouse and human somatic cells. This has led to the discovery of the so-called induced pluripotent stem cells (iPSCs) [29, 30], which hold the potential to be subsequently differentiated into cells of distinct cell lines, including human neurons. The success of the iPSC approach fueled the establishment of refined differentiation strategies, providing patient-derived neural cells, including various types of neural stem cells, neuronal subtypes, oligodendrocytes, and others [30–37]. Encouraged by the popularity of iPSC-based models, the remarkable technology of “transdifferentiation or direct conversion” has experienced a revival and has gone under rapid development in the recent years. With this alternative technique, fully differentiated somatic cells can be directly changed into another cell type while bypassing an intermediate stem cell-like or embryolike pluripotent state [28]. Back in the 1980s, pioneering work was already done by the ectopic overexpression of the TF myoblast determination (MyoD), which could directly convert fibroblasts into cells with muscle cell-specific morphological and functional features [38]. This impressive discovery has led to the next milestone in the field of direct conversion. In 2010, the group of Marius Wernig succeeded in directly converting mouse and later human fibroblasts into induced neurons (iNs) by overexpressing neural fate-specific TFs, including Ascl1, Brn2, Myt1l, and NeuroD1 [39, 40]. In contrast to iPSC-based differentiation, direct conversion is rather a one-step process, and the changes in the epigenetic

76

Lucia Zhou-Yang et al.

status and chromatin remodeling are dictated by the ectopic overexpression of cell type-specific pioneer TFs [41]. The difference is marked by the fact that conversion pioneer TFs have the unique ability to bind to closed chromatin regions of fully differentiated somatic cells and ultimately activate neuronal linage-inducing genes [41]. As a consequence, the epigenetic landscape and cellular identity are directed toward the neuronal fate, a process that appears to bypass neuronal progenitor cell stages as we know them from development [23, 28, 42]. In the recent years, different combinations of pro-neuronal pioneer TF have been extensively explored for the establishment of refined conversion protocols, toward higher conversion efficiencies, better ease of use, and specific neuronal subtype outcomes [22, 23, 43–45]. Remarkably, although the best defined pioneer TFs for direct iN conversion up-to-date are Ascl1, Ngn2, and NeuroD1 [40, 44, 46–48], they often are insufficient when left alone. Commonly, secondary non-pioneer TFs (unable to induce transdifferentiation on their own) can be co-expressed together with pioneer TFs or become expressed endogenously downstream of pioneer TFs during the early stages of iN conversion, e.g., Brn2 [49]. These secondary TFs aid in activating the neuronal transcription program, considerably increasing conversion outcomes, and improve functional properties of iNs in otherwise weaker conversion protocols [43, 46, 49–51]. Some secondary TFs appear to repress non-neuronal transcription rather than activating transcription, thereby safeguarding the iN fate during the process—the myelin transcription factor-1-like protein (Myt1l) is a prominent example [52]. Noteworthy, direct conversion has also been explored using TF-free approaches. For example, relying on the fact that neuronal genes are actively repressed in non-neuronal cells, manipulation of the “anti-neuro” REST-complex by knocking down REST components can induce neuronal features from fibroblasts [27, 53– 59]. Additionally, another widely used strategy which boosts conversion efficiencies in combination with pioneer TFs is the use of small molecules, likely adapted from differentiation protocols. The idea is to modulate signaling pathways to, firstly, repress non-neuronal identities of the starting population and, secondly, promote neuronal fate-stabilizing signaling [32, 43, 44, 60, 61]. Indeed, inhibiting TGF-β/ALK/SMAD and GSK3β signaling [32, 43] and cAMP promotion [43, 44, 62, 63] using small molecules have been found to substantially boost the conversion process, and cocktails of small molecule boosters have been largely incorporated into several iN conversion protocols [45, 63]. For a more detailed molecular, genetic, and chemical characterization on iN direct conversion, please refer to [22–24, 45, 64] and closely related references therein. Most importantly, recent and extensive studies have pointed out the unique aptitude of iNs to preserve a broad range of age-associated features from the starting cell source: genomic

Direct Conversion of Human Fibroblasts to Induced Neurons

77

instability, DNA damage, impairment of long-lived cellular structures, impaired energy metabolism, unbalanced epigenetic and transcriptional control, as well as mitochondrial aging features [22, 24, 57, 60, 65–68]. During iPSC reprogramming however, the derived cells have been shown repeatedly to be epigenetically and functionally reset to an early embryonic state, and consequently, aging features are efficiently reversed (reset in telomere size, gene expression, oxidative stress, and mitochondrial metabolism among others) [2, 22, 69–71]. This phenomenon of cellular rejuvenation is, in fact, the very difference between cell reprogramming and transdifferentiation when it comes to studying age-related diseases using in vitro models. Because aging is a highly complex process, “introducing” the many facets of aging into otherwise rejuvenated cells is challenging [72–74]. Thus, although iPSC-based techniques come as advantageous for studying diseases with a strong genetic background [35, 75, 76], the cherished aspect of “age preservation” in iNs has been received as a blessing in aging research. In this chapter, we describe a stepwise protocol for the production of donor-specific, fully functional iNs from human dermal fibroblasts (Fig. 1). To start with, a straightforward procedure is presented for the derivation of fibroblasts from skin punch biopsies from human donors and the later cell line establishment. This includes fibroblast maintenance, splitting, freezing, and stock build-up. Next, to prepare the cells for direct conversion into iNs, the here presented protocol relies on the co-overexpression of two pro-neuronal pioneer TFs, namely, Ngn2 and Ascl1, which are delivered to the cells using a lentiviral vector system, referred as “UNA” (Fig. 2a). This lentiviral vector is an “all-in-one system,” which means that it carries Ngn2 and Ascl1 linked via a 2A peptide sequence under the control of the doxycycline-inducible tetOn promoter, the reverse tetracycline transactivator (rtTA) sequence driven by the strong and ubiquitous Ubiquitin-C (UbC) promoter, and a PGK promoter-driven puromycin resistance gene for later chemical selection [45]. For this, the steps for the lentivirus vector production for UNA, fibroblast transduction, and later puromycin selection, to achieve a pure “UNA-fibroblast” cultures, will be covered in detail. The direct conversion to iNs is then achieved by using “NC conversion media,” which includes doxycycline in combination with a defined cocktail of small molecule-based pathway modulators: Noggin (inhibition of TGF-b/ALK/SMAD signaling), LDN-193189, A83-1 and SB-431542 (ALK inhibitors), CHIR-99021 (GSK3β inhibitor), forskolin, and db-cAMP (cAMP boosters) [43, 45, 60]. After a timepoint of 21 days on NC conversion media, the initial iN conversion can be considered to be achieved. This protocol generates fully functional neurons with the corresponding phenotypic features and functionality (e.g., electrophysiological properties), being the vast majority

78

Lucia Zhou-Yang et al.

Fig. 1 Schematic overview of the stepwise protocol for direct conversion of human dermal fibroblasts to induced neurons (iNs). (1) A small skin punch biopsy is obtained from a human donor and (2) processed for the derivation of dermal fibroblast cultures, which are subsequently expanded and backed up. (3) Fibroblasts are transduced in the next step with an inducible lentiviral vector, namely, UNA-lentivirus, for the delivery of two pioneer conversion transcription factors, Ngn2 and Ascl1, resulting in UNA-fibroblast cultures. (4) Successfully transduced cells are selected under puromycin treatment, subsequently expanded and backed up. (5) Prior to direct conversion, a step of “pool-split” is required in order to achieve high cell densities of the starting cultures, which will later greatly benefit the efficiency and quality of the conversion process. (6) The direct conversion of UNA-fibroblasts to neurons involves the use of doxycycline to induce the expression of the pro-neural TFs, combined with a cocktail of small molecules, which helps to regulate appropriate neuronalspecific signaling pathways, therefore boosting the conversion. (7) At a timepoint of 21 days, the initial iN conversion can be considered achieved and be used for a wide array of applications, e.g., fluorescenceactivated cell sorting (FACS), to achieve cultures of purified neurons

glutamatergic neurons and GABAergic neurons in a minor fraction. With conversion efficiencies ranking from 40 to up to 80%, this highly reproducible protocol gives rise to a sufficient number of iNs suitable for a wide array of downstream applications: imaging, NGS applications (e.g., RNA sequencing, ATAC sequencing, etc.),

Direct Conversion of Human Fibroblasts to Induced Neurons

79

Fig. 2 (a) Schematic of “UNA” lentiviral system which allows for the inducible co-overexpression of Ngn2 and Ascl1 for iN conversion. UNA is under the control of the doxycycline-inducible tetOn promoter, the reverse tetracycline transactivator (rtTA) sequence driven by the strong and ubiquitous Ubiquitin-C (UbC) promoter, and a PGK promoter-driven puromycin resistance gene for later chemical selection. (b) Representative brightfield images of fibroblasts at (I) 70%, (II) 100%, and (III) 300% confluency following pool-split. (c) Representative bright-field images of morphological changes fibroblasts undergo during direct conversion. Around day 13, condensed somata and often outgrowth of the first neurite-like extensions should be apparent. Scale bars represent 100μm

80

Lucia Zhou-Yang et al.

complex co-cultures (e.g., with astrocytes), electrophysiology assays, single-cell processing pipelines, drug treatment, mass-specbased methods, and many more. Here, to conclude this chapter, we will describe the protocol for live-cell fluorescence-activated cell sorting (FACS), in order to obtain real cultures of purified iNs.

2

Materials

2.1 Derivation of Dermal Fibroblast from Skin Punch Biopsy

1. Skin punch biopsies from human donors, under informed consent and following relevant governmental and institutional ethics regulations. 2. Fibroblast derivation media (FDM): Dulbecco’s Modified Eagle Medium/ Nutrient Mixture F-12 (DMEM/F12) supplemented with 15% fetal bovine serum (FBS), 1% non-essential amino acids (NEAA), 1% GlutaMAX, 1% AntibioticAntifungal (anti-anti), and 10 ng/mL FGF2. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. 3. Enzyme digestion mix (EDM): FDM media containing 1 mg/ mL Dispase and 1 mg/mL Collagenase I. Prepare and filter using a 0.22 μm filter for sterilization. Make aliquots of 1 mL in 1.5 mL Eppendorf tubes, and store at 20
C upon use.

2.2 Fibroblast Thawing, Splitting, and Freezing

1. Dermal fibroblast cultures. 2. TFM media: Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 15% FBS and 1% NEAA. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. 3. TrypLE reagent for dissociating attached cells. 4. Cell freezing media: Mix 90% FBS with 10% dimethyl sulfoxide (DMSO). Prepare and filter using a 0.22 μm filter for sterilization. Store at 20
C upon use and keep in cold before use.

2.3 UNA-Lentivirus Production

1. HEK293T cells. 2. MEF media: DMEM supplemented with 10% FBS and 1% NEAA. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. 3. Lentiviral plasmids: psPAX2 (Plasmid #12260 on Addgene) and pMD2.G (Plasmid #12259 on Addgene). Store at 20
C upon use to avoid recombination events of the plasmids. 4. UNA plasmid (Plasmid #127289 on Addgene). Store at 20
C upon use to avoid recombination events of the plasmid.

Direct Conversion of Human Fibroblasts to Induced Neurons

81

5. Opti-MEM. 6. Polyethylenimine (PEI). 7. Poly-L-ornithine (PO)-coated 145/20 mm culture dishes: Use 1:1000 PO in PBS. Put 5 mL of PO in PBS in a 145/20 mm culture dish, make sure this covers the entire dish surface, and place in incubator at 37
C for at least 30 min to 1 h. Before use, wash three times with 5 mL of PBS each, without disturbing the surface of the dish. 2.4 Fibroblast Transduction with UNA-Lentivirus

1. UNA-lentivirus vector. Store at 80
C upon use to avoid fluctuations on virus viability. 2. Dermal fibroblast cultures. 3. Polybrene. 4. TFM media: DMEM supplemented with 15% FBS and 1% NEAA. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. 5. TFM-P media: DMEM supplemented with 15% FBS, 1% NEAA, and 1 μg/mL puromycin. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. For puromycin setup: Reconstitute at a stock concentration of 3 mg/mL in sterile water. Store at 20
C upon use.

2.5 Direct Conversion to iNs

1. UNA-fibroblast cultures (generated in this protocol). 2. TFM-P media: DMEM supplemented with 15% FBS, 1% NEAA, and 1 μg/mL puromycin. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. 3. NC conversion media: DMEM/F12 and Neurobasal-A medium (use 1:1) supplemented with 2% B27, 1% N2, 1 μg/ mL laminin, 100 μg/mL db-cAMP, 2 μg/mL doxycycline, 100 ng/mL Noggin, 0.5 μM LDN-193189, 0.5 μM A83-1, 3 μM CHIR-99021, 5 μM forskolin, and 10 μM SB-431542. Prepare and filter using a 0.22 μm filter for sterilization. Store at 4
C up to 1 month. For molecule setup: Doxycycline: Reconstitute at a stock concentration of 10 mg/mL in sterile water. Store at 20
C upon use. db-cAMP: Reconstitute at a stock concentration of 200 mg/mL in PBS + 0.1% BSA. Store at 20
C upon use. Noggin: Reconstitute at a stock concentration of 0.5 μg/ mL in PBS + 0.1% BSA. Store at 20
C upon use. LDN-193189: Reconstitute at a stock concentration of 10 mM in DMSO. Store at 20
C upon use. A83-1: Reconstitute at a stock concentration of 10 mM in DMSO. Store at 20
C upon use.

82

Lucia Zhou-Yang et al.

CHIR-99021: Reconstitute at a stock concentration of 50 mM in DMSO. Store at 20
C upon use. Forskolin: Reconstitute at a stock concentration of 30 mM in DMSO. Store at 20
C upon use. SB-431542: Reconstitute at a stock concentration of 20 mM in DMSO. Store at 20
C upon use. 4. BP-GBCL neuronal maturation media: BrainPhys supplemented with 2% B27, 1% N2, 20 ng/mL GDNF, 20 ng/mL BDNF, 500 μg/mL db-cAMP, and 1 μg/mL laminin. Prepare and filter using a 0.22 μm filter. Store at 4
C up to 1 month. 2.6 Live-Cell FluorescenceActivated Cell Sorting (FACS)

1. Induced neurons following a 21-day conversion. 2. Geltrex-coated plates: coat 96-well plates with Geltrex at a concentration of 1:160 in cold DMEM/F12. 3. Cyto buffer: for 1000 mL, dissolve 43,25 g myo-inositol in 800 mL distilled water, add 200 mL of 1 PBS and 5 g of polyvinyl alcohol in small portions. Filter through 0.2 μm filter for sterilization. Store buffer at 4
C up to 6 months. 4. Cyto-5% KOSR buffer: add 5% of KnockOut Serum Replacement to Cyto buffer. 5. TrypLE++ buffer: TrypLE supplemented with 0.01 U/mL DNase I Recombinant RNase-free from Sigma-Aldrich (product no. 04716728001) and 10 μM ROCK inhibitor. 6. Antibody solution: PSA-NCAM-PE antibody (use 1:100) in Cyto-5% KOSR buffer. 7. PBS +++: PBS supplemented with 0.01 U/mL DNase I Recombinant RNase-free from Sigma-Aldrich (product no. 04716728001), 5 mM EDTA, 30 μM DAPI, and 10 μM ROCK inhibitor. 8. BP-GBCL (maturation media) supplemented with 10 μM ROCK inhibitor, 10 μM zVAD, and 1% anti-anti.

3

Methods

3.1 Derivation of Dermal Fibroblasts from Skin Punch Biopsy

1. Collect a small skin punch biopsy (usually 3–5 mm) from a donor in a clinical environment, and place into a sterile 15 mL tube containing at least 2 mL of fresh FDM (see Note 1). This is typically performed or supervised by a trained physician, following the respective governmental and institutional ethics regulations. 2. Transfer the 15 mL tube containing FDM and skin punch biopsy under a tissue culture hood for processing. Every procedure from this point on should be performed under strict aseptic conditions.

Direct Conversion of Human Fibroblasts to Induced Neurons

83

3. Thaw a 1.5 mL Eppendorf tube containing 1 mL of EDM at room temperature. 4. Gently pick up the entire punch biopsy with a sterile pipette, and transfer into the 1.5 mL Eppendorf tube containing 1 mL of EDM. Place in incubator set at 37
C/5% CO2 for a 12–15h incubation. 5. The following day, the EDM should have become hazy from floating cells that have detached from the chuck. The remaining solid biopsy chunk is now carefully removed from the EDM and transferred to one well of a 24-well plate containing FDM for a first washing step (the hazy EDM contains valuable cells and is saved for later steps). The transferred biopsy chunk is subjected to another wash by placing it into another 24-well with fresh media, and then transfer to a new empty 24-well (see Note 2). Place the plate to a 37
C incubator, and incubate for 20 min in order to allow the biopsy to adhere to the plate, without adding media to the well containing the biopsy chunk. 6. In the meanwhile, transfer the remaining 1 mL of hazy EDM (from the beginning of step 5) to a 15 mL tube containing 4 mL of FDM, and centrifuge at 270  g for 3 min to pellet. 7. Collect the supernatant, and plate it evenly on 4–6 empty wells of the 24-well plate (each well should contain 1 mL). Next, resuspend the pellet with 1 mL FDM, and transfer to one empty 24-well plate. Wash the 15 mL tube with 1 mL FDM media, and plate on another empty well. 8. Following the 20 min incubation period on step 5, gently feed the well(s) containing biopsy chunk with 180 μL of FDM by slowly pipetting media against the wall of the well, without disturbing the biopsy chunk (see Note 3). 9. By now, you probably have two 24-well plates, one containing the chunks from step 8 and one containing cells in suspension from step 7. Gently transfer both plates back to the 37
C 5% CO2 incubator, and do not disturb during the next 48 h. 10. After 48 h, feed all the wells with fresh FDM media every other day: with 1 mL for the cells and 180 μL for the chunk(s), respectively. Fibroblast cell clusters and layers should emerge in the cultures or slowly grow out of the chunks within 3–5 days (see Note 4). 11. Once the wells reach around 90% confluence, passage each well of the 24-well plate to one well of a 6-well plate (we consider this passage one) (see Note 5). Follow the steps for splitting fibroblasts described in Subheading 3.2. 12. Once the 1  6-well reaches around 90% confluence (3–5 days), passage 1:6 to one entire 6-well plate (we consider this passage 2).

84

Lucia Zhou-Yang et al.

13. Once these “passage 2” 6-wells reach around 90% confluence (in 3–5 days), freeze cells, and create a stock of the cell line, ready to be thawed and used when necessary. Follow the steps for freezing fibroblasts described in Subheading 3.2. 14. After passage 2, when cultures appear stable, FDM media can be switched to TFM media. 3.2 Fibroblast Thawing, Splitting, and Freezing 3.2.1 Thawing Fibroblasts

1. Prepare in advance a 15 mL tube, and add 9 mL of DMEM at room temperature. 2. Take the vial to thaw from 80
C freezer, and thaw by gentle agitation on water bath preheated at 37
C (see Note 6). 3. When only a small piece of ice is left in the vial, decontaminate by spraying with 70% ethanol, dry the vial with paper tissue, and transfer to tissue culture hood. 4. Transfer all the content of the vial into the previously prepared 15 mL tube containing 9 mL of DMEM. 5. Take 1 mL of DMEM, and flush out the remaining cells in the cryovial, collect, and transfer again to the 15 mL tube. 6. Spin down cells at 270  g for 3 min and discard supernatant. 7. Resuspend pellet in TFM media and plate on fresh plate. The seeding density on each well of a 6-well plate should be approximately 0.3  106 cells. 8. Distribute evenly and place back to 37
C incubator. 9. Follow a schedule of medium change every other day using TFM media.

3.2.2 Passaging Fibroblasts (Splitting)

1. Aspirate media completely from each 100% confluent well of the 6-well plate to split (Fig. 2b, II). 2. Add 1 mL of PBS to each 6-well to wash and remove FBS proteins that inhibit or compete for TrypLE. 3. Aspirate PBS. 4. Add 0.5 mL of TrypLE to each 6-well, and transfer to 37
C to incubate for approximately 5 min until cells detach from the plate. In case cells are not detaching, tap very gently on the side of the plate to help the detachment. 5. Collect the cells and transfer them to a 15 mL tube. Flush out the remaining cells using TFM (this contains FBS and helps to neutralize the TrypLE), collect, and transfer to the 15 mL tube. 6. Spin down cells at 270  g for 3 min and discard supernatant. 7. Resuspend with TFM media and plate on fresh wells at a 1:2 or 1:3 area ratio (see Note 7). 8. Distribute evenly and place back to 37
C incubator. 9. Keep a schedule of medium change every other day with TFM media.

Direct Conversion of Human Fibroblasts to Induced Neurons 3.2.3 Freezing Fibroblasts

85

1. Aspirate media completely from each well of the 6-well plate to freeze. 2. Add 1 mL of PBS to each well to wash and aspirate. 3. Add 0.5 mL of TrypLE of each well, and transfer to 37
C to incubate for approximately 5 min until cell detach from the plate. 4. Collect the cells and transfer to a 15 mL tube. Flush out the remaining cells using TFM, collect, and transfer to the 15 mL tube. 5. Spin down cells at 270  g for 3 min and discard supernatant. 6. Resuspend cell pellet in freezing media (90% FBS + 10% DMSO), and distribute 1 mL per freezing vial. Put on dry ice immediately. Each confluent 6-well contains approximately 1.2  106 cells, and each 6-well goes to one freezing vial (see Note 8). 7. Transfer to 80
C and storage. Optionally but not required, a stepwise freezing can be done, with a 20
C freezing step for 2 h and then transfer vials to 80
C or using Mr. Frosty at 80
C overnight.

3.3 UNA-Lentivirus Production 3.3.1 HEK 293T Cell Preparation

1. Thaw a vial of HEK 293T cells on 145/20 mm culture dishes. The seeding density on each dish should be approximately 5  106 cells, cultured with 15 mL of MEF media/dish and keeping a schedule of medium change every other day with MEF media. 2. Keep expanding HEK cells with 1:3 split ratios until reaching four confluent 145/20 mm culture dishes. 3. Prepare 12 PO-coated 145/20 mm culture dishes. 4. Split again 1:3 each of the four confluent dishes, but this time, on the previously PO-coated 145/20 mm culture dishes (see Note 9) (note that appropriate backup cells should be always kept in culture for the next round of virus production if necessary). When cells reach 50–70% confluency, proceed to transfection with plasmids.

3.3.2 Transfection of HEK293T

1. Calculate the exact amount of each plasmid needed according to the following: UNA plasmid: (15 μg  no. of dishes/plasmid concentration in ng/μL)  1000. psPAX2 plasmid: (11 μg  no of dishes/plasmid concentration in ng/μL)  1000. pMD2.G plasmid: (5 μg  no of dishes/plasmid concentration in ng/μL)  1000.

86

Lucia Zhou-Yang et al.

For example: if the UNA plasmid has a concentration of 1971.2 ng/μL, then the amount of plasmid needed should be calculated as (15 μg  12/1971.2 ng/μ L)  1000 ¼ 91.3 μL of UNA plasmid for transfecting 12 dishes of HEK293T cells. 2. Prepare a 15 mL tube containing 12 mL of Opti-MEM. 3. Add to the prepared Opti-MEM: 0.1 mg/mL of polyethylenimine (PEI) with the appropriate quantity of each plasmid previously calculated. Mix thoroughly until Opti-MEM appears to foam. 4. Let the mixture (Opti-MEM + PEI + plasmids) settle down for 5 min at room temperature. 5. After 5 min, apply dropwise 1 mL of the mixture (OptiMEM + PEI + plasmids) to each of the 12 PO-coated 145/20 mm culture dishes with HEK293T cells at approximately 70% confluency. 6. Distribute evenly and place back to incubator at 37
C for a 5–8-h incubation. 7. After 5–8 h, replace the medium of each of the dishes with fresh MEF medium (15 mL/dish), and place the 12 dishes back to the incubator for a 3-day incubation. Do not disturb the cells during this 3-day time period (see Note 10). 3.3.3 UNA-Lentivirus Harvesting

1. After 3 days, filter the supernatant of each of the dishes using a 0.22 μm Steritop/Stericup in order to discard all the cell debris. The supernatant of each of the 12 dishes can be combined together, obtaining a final volume of approximately 180 mL (see Note 11). 2. Distribute all the filtered supernatant in 6 polypropylene conical tubes with proper adaptors for the ultracentrifuge. Use the system of choice depending on each laboratory’s setups for virus production (see Note 12). 3. Place the 6 polypropylene conical tubes filled up with virus supernatant and placed in their corresponding adaptors in an ultracentrifuge, and spin at 68,198  g for 2 h at 4
C. 4. Prepare in advance a bottle containing at least 250 mL of 50% sodium hypochlorite solution. 5. After centrifugation, place 6 polypropylene conical tubes back to cell culture hood, and discard supernatant (by transferring supernatant to the bottle containing 50% sodium hypochlorite, to neutralize remaining virus) without disturbing the pellet (the pellet usually appears as a very small colored dot at the bottom of the tube).

Direct Conversion of Human Fibroblasts to Induced Neurons

87

6. Carefully resuspend the pellet of each tube with 80 μL of PBS + 1% BSA, and transfer to freezing vials. 7. Store the freezing vials, each containing 80 μL of virus suspension, at 80
C freezer. 3.4 Fibroblast Transduction with UNA-Lentivirus

When fibroblast cultures reach a confluency of around 70–85%, they can be transduced with lentiviral vectors for UNA (Fig. 2b, I) (see Notes 13 and 14). 1. Thaw a vial containing UNA-lentivirus vector at room temperature (see Note 10). 2. Prepare a 15 mL tube containing TFM. The amount of TFM is calculated for 1.2–1.5 mL per 6-well to be transduced. For example, if 3 wells are going to be transduced, then around 3.6 mL of TFM should be prepared. 3. Add the transduction enhancing detergent Polybrene (final concentration of 4 μg/mL) and appropriate amounts of UNA-lentivirus (see Note 15) to the previously prepared TFM. Mix carefully by pipetting gently up and down the mixture. Strictly avoid bubbles and any spilling. 4. Aspirate the old media from the wells to be transduced, and replace with the virus- and polybrene-containing TFM. 5. Incubate overnight and up to 24 h at 37
C in 5% CO2. 6. The next day, replace media with fresh TFM without the UNA-lentivirus or polybrene. As usual, check the morphology of the cells to screen for any adverse effects caused by the virus preparation or the polybrene (see Note 16). 7. Leave the transduced cells undisturbed for the next 48–72 h. 8. After 48–72 h, change media to TFM-P (TFM plus puromycin). In case the cells have reached confluency, e.g., after these 72 h (most probably), split them 1:2, and use TFM-P right away instead of TFM when re-plating (see Note 17). 9. Expand and back up transduced fibroblasts following standard cell culture techniques using TFM-P media, to establish pure “UNA-fibroblast” cultures. Hereafter, this protocol will be adapted for culturing UNA-fibroblasts in T75 culture flasks with TFM-P Media, instead of culture plates.

3.5 Direct Conversion to iNs

For iN conversion, the starting cell culture needs to be more confluent than usual. For this, what is usually done is to pool together fibroblasts at 100% confluency following a ratio of 3:1. For example, 3 confluent T75 flasks will be pooled into 1 T75 yielding 300% confluency the day after pooling (Fig. 2b, III, 2c, day 0) (see Notes 18 and 19). For “pool-splitting” and to start the conversion:

88

Lucia Zhou-Yang et al.

1. Aspirate media completely from 3 T75 culture flask of UNA-fibroblasts at 100% confluency (a confluent T75 flask should contain approximately a density of 8.4  106 cells). 2. Add 3 mL PBS to each flask to wash off remaining media and aspirate. 3. Add 2 mL of TrypLE to each flask, and place back to the incubator at 37
C for 10–15 min until cells detach (see Note 20). 4. Collect cells from all 3 T75 flasks and combine them in one 50 mL tube. 5. Wash each flask with 3 mL of TFM-P to collect remaining cells, and transfer to the 50 mL tube. 6. Spin down the cells at 270  g for 3 min and discard supernatant. 7. Resuspend the cells with 12 mL of TFM-P media, and plate in one fresh T75 flask (at this point, cells are at 300% confluency and should be around 24  106 cells) (Fig. 2b, III, c, day 0). 8. Place the new T75 flask back to the incubator at 37
C. 9. The following day, replace the TFM-P media with NC conversion media, and this is considered day 0 of conversion. 10. For a timepoint of 21 days after switching to NC conversion media, keep a medium changing schedule of every other day. 11. Around day 10 on NC conversion media, initial neuron-like morphologies, including condensed soma and often outgrowth of the first neurite-like extensions should be apparent (Fig. 2c, day 13). In general, after 21 days on conversion media, the conversion process can be considered to be achieved. In order to promote further maturation of the iNs, NC conversion media can then be switched to BP-GBCL maturation media, containing molecules that better promote neuronal maturation and survival. At this point, iNs are ready to be used for further downstream assays depending on the individual project (e.g., electrophysiology, calcium imaging, live-cell imaging, or immunostainings). 3.6 Live-Cell FluorescenceActivated Cell Sorting (FACS)

At a timepoint of 21 days under conversion, to purify iNs from the fibroblasts that remain after conversion, flow cytometry sorting following live antibody staining for polysialylated neuronal cell adhesion molecule (PSA-NCAM) can be performed (see Note 21). 1. Prewarm PBS, TrypLE++, and Cyto+5%KOSR buffers at RT or on 37
C water bath. 2. Remove media from each flask to be sorted. 3. Add 3 mL of PBS to wash off remaining media and aspirate.

Direct Conversion of Human Fibroblasts to Induced Neurons

89

4. Add 2 mL of TrypLE ++ buffer, and incubate plate at 37
C for 10–20 min until the cells lift and float as single cells. Do not apply sheer/mechanical force to detach the cells. 5. Gently collect the cells to a 15 mL tube. Take 5 mL of CytoKOSR buffer, flush out the remaining cells, and collect to the 15 mL tube. 6. Spin down the cells for 5 min at 270  g and discard supernatant. 7. Resuspend cell pellet with 200 μL of antibody solution containing human PSA-NCAM-PE antibody (at a concentration of 1:100), and stain for 45 min to 1 h in the dark at room temperature. 8. After staining, add 5 mL of Cyto-KOSR buffer, and resuspend the pellet to wash off and dilute the remaining antibodies. 9. Spin down for 5 min at 270  g and discard supernatant. 10. Resuspend cell pellet in 200 μL of PBS+++ buffer (see Note 22). 11. Sort the PSA-NCAM-positive cells (iNs) and DAPI-negative (live) cells using FACS, collecting them in a tube containing BP-GBCL maturation media. From each T75 flask, around 1  106 iNs can be expected to be collected. 12. After sorting, cells can be plated at a density of 150,000–200,000 cells for each well of a 96-well Geltrexcoated plate with BP-GBCL maturation media supplemented with 10 μM ROCK inhibitor, 10 μM zVAD, and 1% antianti. The next day, do a medium change using fresh BP-GBCL maturation media without ROCK inhibitor, zVAD and anti-anti. Keep a schedule of medium change every other day until the experiment endpoint. Alternatively, collected iNs can be directly pelleted down and frozen at 80
C for biomolecular experiments, sorted directly into TRIzol LS for RNA isolation, or processed for many other downstream applications.

4

Notes 1. After collection, it is recommended that skin punch biopsies are processed right away on the same day of collection from donor. If not possible, biopsy chunks can be stored in FDM at 4
C overnight and processed the following day. 2. The epidermal layer will often detach from the chunks during the washes or following the digestion. If this occurs, the epidermal layer can be omitted as it is not a good source for fibroblast cultures.

90

Lucia Zhou-Yang et al.

3. The media should not cover the entire biopsy piece but should rather cover the bottom of the well and keep an outgrowing monolayer moist. 4. Make sure that the incubator’s humidity is guaranteed at all times. This is particularly important because the small amount of media in the biopsy chunk wells will evaporate easily. 5. It is possible that some wells might not appear to have pure fibroblast growing (e.g., mixed with other cell types, such as fat cells that came with the punch biopsy); in this case, wash with PBS carefully in each media change or choose the healthylooking confluent wells and proceed to the next step. Discard the remaining wells. 6. Note that the cap of the freezing vial should remain above the water, to avoid contamination. Thawing should be rapid, approximately 1 min until a small piece of ice is remaining. 7. Fibroblasts are commonly cultured between 50% and 100% confluency and need to be split one day after reaching 100% confluency (Fig. 2b, II). Splitting ratios are typically 1:2 or 1:3, depending on the overall proliferating rate of the cells: if the cultures look healthy and fast proliferating, then proceed to 1:3 ratio split. In case cells are growing slower than usual, then split 1:2 to reduce cell stress due to lack of cell contact after splitting. 8. Cells will suffer from DMSO at room temperature; minimize the time at room temperature, and quickly transfer to the 80
C freezer. It is recommended that the freezing medium is kept at 4
C until the very moment of use. 9. When seeding cells on PO-coated dishes, cell attachment is very strong and requires very long incubation times with TrypLE to detach them for splitting, which can cause damage to the cells overall. For this reason, during regular HEK293T cell expansion and splitting, the dishes do not need to be coated in advance. However, only in the last round of splitting (4:12) prior to transfection with plasmids, then it is recommended to pre-coat the plates with PO, which overall benefits the cells during transfection. 10. From this step on, every step done during the lentivirus production should follow strict and appropriate BCL2 biosafety training and guidance, including having proper personal protective equipment (PPE). Further, the ready availability of an agent to neutralize the virus (e.g., 50% sodium hypochlorite) is required, to deactivate every discarded product or material that has been in contact with the lentivirus (e.g., mediums, tubes, tips, dishes, etc.). 11. Pilot experiments, including lentiviral tittering and assessment of MOIs, might be required to find virus concentrations appropriate for your laboratory setting. It is recommended to titter

Direct Conversion of Human Fibroblasts to Induced Neurons

91

using a comparable GFP (or other FP)-containing virus to transduce fibroblasts (from our experience, tittering on other cell types is not very predictive for fibroblast transduction). Tittering is recommended especially when creating big batches of lentivectors used for consecutive experiments over a long time. In addition, semi-quantitative kits, e.g., Lenti-X GoStix Plus (from Takara Bio), have been found to be easy to perform and useful for comparing past and new lentivirus preparations. 12. After distributing the supernatant in ultracentrifuge tubes, it is highly important to check that each tube has exactly the same weight by using a balance. Plain media can be added to equilibrate the weight. 13. At 50% and below, the cells lack cell-cell signaling, making the cells more prone to virus- or detergent-induced toxicity. On the other hand, at too high densities of around 100%, the transduction efficiency will not be as efficient. 14. Because the UNA-fibroblasts grow and expand like normal wild-type fibroblasts, they can be equally well expanded and backed up. It is thus advisable to generate the first lines of UNA-fibroblasts from early passages already (typically passages 3–5) after derivation from skin punch biopsy, which will then last for a longer time. 15. Although different across laboratories, depending on the desired method for virus tittering (see Note 11), from our experience, each aliquot of 80 μL of UNA-lentivirus can be used to transduce approximately 8–16 wells of a 6–well plate to achieve good transduction efficiencies. 16. In many labs, the first two media changes after transduction are still considered as an elevated biosafety category, which should be considered when disposing waste media and trash. 17. Only a very small portion of cells (less than 20%) should die due to lentivirus transduction or puromycin treatment, and the cultures shouldn’t show signs of severe toxic effects. Thus, cultures may reach full confluency within their typical time (4–7 days). However, in case a large proportion of the cells die, and the culture needs to recover significantly, we suggest considering transduction as failed and should be repeated, although those cultures might still generate iNs after recovery. Typically, failed transductions due to low virus titers, stressed fibroblast cultures, or even toxic contaminant particles during virus preparation are also possible. 18. It is not recommended to start conversion of the fibroblasts before at least 3–5 passages after being transduced with UNA-lentivirus. It is possible that that stressed state of the fibroblasts after transduction might affect the conversion

92

Lucia Zhou-Yang et al.

process. It is recommended to keep track not only of the total number of passages that the cell line has but, in addition, also of the number of passages after transduction. 19. Direct iN conversion does not involve a highly expandable intermediate stage (e.g., neural stem cells stage); therefore, the number of cells depends entirely on the fibroblast proliferation prior to conversion. In order to achieve a suitable number of iNs for downstream experiments, the starting fibroblasts should be seeded at higher densities than normally, which also would benefit cell-cell contact during conversion, improving iNs’ cell survival, and the overall conversion efficiency. 20. Do not apply sheer force to detach the cells; it is much better to incubate them for longer time periods in TrypLE instead. 21. The longer the cells are cultured in the original plate on NC media or maturation media, the neurons get more mature and acquire long and delicate extensions and are prone to form cell clusters (Fig. 2c, day 30). Therefore, it is not recommended to sort the cells under those circumstances due to cell clumping issues such as difficulty to sort for single cells. It is recommended to process the cells on day 21 or used for downstream analysis as soon as possible. 22. The Cyto buffer containing myo-inositol and polyvinyl alcohol favors cell survival during the long process of sample preparation and cell sorting. However, due to its high density, it can de-stabilize the sorting process once the sample is loaded on FACs. It is then recommended to resuspend the cells in PBS++ + instead before loading into FACs machine. References 1. Yankner BA, Lu T, Loerch P (2008) The aging brain. Annu Rev Pathol Mech Dis 3:41–66. https://doi.org/10.1146/annurev.path mechdis.2.010506.092044 2. Mahmoudi S, Brunet A (2012) Aging and reprogramming: a two-way street. Curr Opin Cell Biol 24:744–756 3. Dong X, Milholland B, Vijg J (2016) Evidence for a limit to human lifespan. Nature 538:257–259. https://doi.org/10.1038/ nature19793 4. Gladyshev VN (2016) Aging: progressive decline in fitness due to the rising deleteriome adjusted by genetic, environmental, and stochastic processes. Aging Cell 15:594–602 5. Niccoli T, Partridge L (2012) Ageing as a risk factor for disease. Curr Biol 22:R741–R752. https://doi.org/10.1016/j.cub.2012.07.024

6. Maslov AY, Vijg J (2009) Genome instability, cancer and aging. Biochim Biophys Acta 1790:963–969 7. Newman JC, Milman S, Hashmi SK, Austad SN, Kirkland JL, Halter JB, Barzilai N (2016) Strategies and challenges in clinical trials targeting human aging. J Gerontol A Biol Sci Med Sci 71:1424–1434 8. Kennedy BK, Berger SL, Brunet A, Campisi J, Cuervo AM, Epel ES, Franceschi C, Lithgow GJ, Morimoto RI, Pessin JE, Rando TA, Richardson A, Schadt EE, Wyss-Coray T, Sierra F (2014) Geroscience: linking aging to chronic disease. Cell 159:709–713 9. Chow H, Herrup K (2015) Genomic integrity and the ageing brain. Nat Rev Neurosci 16:672–684. https://doi.org/10.1038/ nrn4020

Direct Conversion of Human Fibroblasts to Induced Neurons 10. Bhardwaj RD, Curtis MA, Spalding KL, Buchholz BA, Fink D, Bjo¨rk-Eriksson T, Nordborg C, Gage FH, Druid H, Eriksson PS, Frise´n J (2006) Neocortical neurogenesis in humans is restricted to development. Proc Natl Acad Sci U S A 103:12564–12568. https://doi.org/10.1073/pnas.0605177103 11. Jaarsma D, van der Pluijm I, de Waard MC, Haasdijk ED, Brandt R, Vermeij M, Rijksen Y, Maas A, van Steeg H, Hoeijmakers JHJ, van der Horst GTJ (2011) Age-related neuronal degeneration: complementary roles of nucleotide excision repair and transcription-coupled repair in preventing neuropathology. PLoS Genet 7:e1002405. https://doi.org/10. 1371/journal.pgen.1002405 12. Bishop NA, Lu T, Yankner BA (2010) Neural mechanisms of ageing and cognitive decline. Nature 464(7288):529–535. https://doi. org/10.1038/nature08983 13. Campisi J, Warner HR (2001) Aging in mitotic and post-mitotic cells. Adv Cell Aging Gerontol 4:1–16. https://doi.org/10.1016/S15663124(01)04024-X 14. Gelderman HT, Boer L, Naujocks T, IJzermans ACM, Duijst WLJM (2018) The development of a post-mortem interval estimation for human remains found on land in the Netherlands. Int J Legal Med 132:863–873. https://doi.org/10. 1007/s00414-017-1700-9 15. Gomez-Nicola D, Boche D (2015) Postmortem analysis of neuroinflammatory changes in human Alzheimer’s disease. Alzheimers Res Ther 7:42. https://doi.org/10. 1186/s13195-015-0126-1 16. Jucker M (2010) The benefits and limitations of animal models for translational research in neurodegenerative diseases. Nat Med 16 (11):1210–1214. https://doi.org/10.1038/ nm.2224 17. Mitchell SJ, Scheibye-Knudsen M, Longo DL, De Cabo R (2015) Animal models of aging research: implications for human aging and age-related diseases. Annu Rev Anim Biosci 3:283–303. https://doi.org/10.1146/ annurev-animal-022114-110829 18. Becker RE, Greig NH, Giacobini E (2008) Why do so many drugs for Alzheimer’s disease fail in development? Time for new methods and new practices? J Alzheimers Dis 15:303–325. https://doi.org/10.3233/JAD2008-15213 19. Mehta D, Jackson R, Paul G, Shi J, Sabbagh M (2017) Why do trials for Alzheimer’s disease drugs keep failing? A discontinued drug perspective for 2010-2015. Expert Opin Investig Drugs 26:735–739. https://doi.org/10. 1080/13543784.2017.1323868

93

20. Kitazawa M, Medeiros R, LaFerla FM (2012) Transgenic mouse models of Alzheimer disease: developing a better model as a tool for therapeutic interventions. Curr Pharm Des 18:1131–1147. https://doi.org/10.2174/ 138161212799315786 21. Querfurth HW, LaFerla FM (2010) Alzheimer’s disease. N Engl J Med 362:329–344 22. Mertens J, Reid D, Lau S, Kim Y, Gage FH (2018) Aging in a dish: iPSC-derived and directly induced neurons for studying brain aging and age-related neurodegenerative diseases. Annu Rev Genet 52:271–293. https:// doi.org/10.1146/annurev-genet-120417031534 23. Mertens J, Marchetto MC, Bardy C, Gage FH (2016) Evaluating cell reprogramming, differentiation and conversion technologies in neuroscience. Nat Rev Neurosci 17:424–437 24. Bo¨hnke L, Traxler L, Herdy JR, Mertens J (2018) Human neurons to model aging: a dish best served old. Drug Discov Today Dis Model 27:43–49 25. Traxler L, Edenhofer F, Mertens J (2019) Next-generation disease modeling with direct conversion: a new path to old neurons. FEBS Lett 1873-3468:13678. https://doi.org/10. 1002/1873-3468.13678 26. Graf T, Enver T (2009) Forcing cells to change lineages. Nature 462:587–594 27. Mall M, Wernig M (2017) The novel tool of cell reprogramming for applications in molecular medicine. J Mol Med 95:695–703 28. Chambers SM, Studer L (2011) Cell fate plug and play: direct reprogramming and induced pluripotency. Cell 145:827–830 29. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861–872. https://doi.org/10.1016/j. cell.2007.11.019 30. Okita K, Ichisaka T, Yamanaka S (2007) Generation of germline-competent induced pluripotent stem cells. Nature 448:313–317. https://doi.org/10.1038/nature05934 31. Park IH, Arora N, Huo H, Maherali N, Ahfeldt T, Shimamura A, Lensch MW, Cowan C, Hochedlinger K, Daley GQ (2008) Disease-specific induced pluripotent stem cells. Cell 134:877–886. https://doi.org/10.1016/ j.cell.2008.07.041 32. Chambers SM, Fasano CA, Papapetrou EP, Tomishima M, Sadelain M, Studer L (2009) Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD

94

Lucia Zhou-Yang et al.

signaling. Nat Biotechnol 27:275–280. https://doi.org/10.1038/nbt.1529 33. Hu BY, Du ZW, Zhang SC (2009) Differentiation of human oligodendrocytes from pluripotent stem cells. Nat Protoc 4:1614–1622. https://doi.org/10.1038/nprot.2009.186 34. Krencik R, Weick JP, Liu Y, Zhang ZJ, Zhang SC (2011) Specification of transplantable astroglial subtypes from human pluripotent stem cells. Nat Biotechnol 29:528–534. https://doi.org/10.1038/nbt.1877 35. Kriks S, Shim JW, Piao J, Ganat YM, Wakeman DR, Xie Z, Carrillo-Reid L, Auyeung G, Antonacci C, Buch A, Yang L, Beal MF, Surmeier DJ, Kordower JH, Tabar V, Studer L (2011) Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease. Nature 480:547–551. https://doi.org/10.1038/ nature10648 36. Kriks S, Shim J-W, Piao J, Ganat YM, Wakeman DR, Xie Z, Carrillo-Reid L, Auyeung G, Antonacci C, Buch A, Yang L, Beal MF, Surmeier DJ, Kordower JH, Tabar V, Studer L (2012) Floor plate-derived dopamine neurons from hESCs efficiently engraft in animal models of PD. Nature 480:547–551. https://doi. org/10.1038/nature10648.Floor 37. Staerk J, Dawlaty MM, Gao Q, Maetzel D, Hanna J, Sommer CA, Mostoslavsky G, Jaenisch R (2010) Reprogramming of human peripheral blood cells to induced pluripotent stem cells. Cell Stem Cell 7:20–24. https:// doi.org/10.1016/j.stem.2010.06.002 38. Davis RL, Weintraub H, Lassar AB (1987) Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51:987–1000. https://doi.org/10.1016/ 0092-8674(87)90585-X 39. Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Su¨dhof TC, Wernig M (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463:1035–1041. https://doi.org/10.1038/ nature08797 40. Pang ZP, Yang N, Vierbuchen T, Ostermeier A, Fuentes DR, Yang TQ, Citri A, Sebastiano V, Marro S, Su¨dhof TC, Wernig M (2011) Induction of human neuronal cells by defined transcription factors. Nature 476:220–223 41. Wapinski OL, Vierbuchen T, Qu K, Lee QY, Chanda S, Fuentes DR, Giresi PG, Ng YH, Marro S, Neff NF, Drechsel D, Martynoga B, Castro DS, Webb AE, Su¨dhof TC, Brunet A, Guillemot F, Chang HY, Wernig M (2013) Hierarchical mechanisms for direct

reprogramming of fibroblasts to neurons. Cell 155:621. https://doi.org/10.1016/j.cell. 2013.09.028 42. Vierbuchen T, Wernig M (2011) Direct lineage conversions: unnatural but useful? Nat Biotechnol 29:892–907 43. Ladewig J, Mertens J, Kesavan J, Doerr J, Poppe D, Glaue F, Herms S, Wernet P, Ko¨gler G, Mu¨ller FJ, Koch P, Bru¨stle O (2012) Small molecules enable highly efficient neuronal conversion of human fibroblasts. Nat Methods 9:575–578. https://doi.org/10. 1038/nmeth.1972 44. Liu ML, Zang T, Zou Y, Chang JC, Gibson JR, Huber KM, Zhang CL (2013) Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic neurons. Nat Commun 4:2183. https://doi.org/10. 1038/ncomms3183 45. Herdy J, Schafer S, Kim Y, Ansari Z, Zangwill D, Ku M, Paquola A, Lee H, Mertens J, Gage FH (2019) Chemical modulation of transcriptionally enriched signaling pathways to optimize the conversion of fibroblasts into neurons. elife 8:e41356. https:// doi.org/10.7554/eLife.41356 46. Matsuda T, Irie T, Katsurabayashi S, Hayashi Y, Nagai T, Hamazaki N, Adefuin AMD, Miura F, Ito T, Kimura H, Shirahige K, Takeda T, Iwasaki K, Imamura T, Nakashima K (2019) Pioneer factor NeuroD1 rearranges transcriptional and epigenetic profiles to execute microglia-neuron conversion. Neuron 101:472–485.e7. https://doi.org/10.1016/j. neuron.2018.12.010 47. Iwafuchi-Doi M, Zaret KS (2014) Pioneer transcription factors in cell reprogramming. Genes Dev 28:2679–2692 48. Aydin B, Kakumanu A, Rossillo M, MorenoEstelle´s M, Garipler G, Ringstad N, Flames N, Mahony S, Mazzoni EO (2019) Proneural factors Ascl1 and Neurog2 contribute to neuronal subtype identities by establishing distinct chromatin landscapes. Nat Neurosci 22:897–908. https://doi.org/10.1038/s41593-019-0399-y 49. Wapinski OL, Lee QY, Chen AC, Li R, Corces MR, Ang CE, Treutlein B, Xiang C, Baubet V, Suchy FP, Sankar V, Sim S, Quake SR, Dahmane N, Wernig M, Chang HY (2017) Rapid chromatin switch in the direct reprogramming of fibroblasts to neurons. Cell Rep 20:3236–3247. https://doi.org/10.1016/j. celrep.2017.09.011 50. Treutlein B, Lee QY, Camp JG, Mall M, Koh W, Shariati SAM, Sim S, Neff NF, Skotheim JM, Wernig M, Quake SR (2016) Dissecting direct reprogramming from

Direct Conversion of Human Fibroblasts to Induced Neurons fibroblast to neuron using single-cell RNA-seq. Nature 534:391–395. https://doi.org/10. 1038/nature18323 51. Chanda S, Ang CE, Davila J, Pak C, Mall M, Lee QY, Ahlenius H, Jung SW, Su¨dhof TC, Wernig M (2014) Generation of induced neuronal cells by the single reprogramming factor ASCL1. Stem Cell Reports 3:282–296. https://doi.org/10.1016/j.stemcr.2014.05. 020 52. Mall M, Kareta MS, Chanda S, Ahlenius H, Perotti N, Zhou B, Grieder SD, Ge X, Drake S, Euong Ang C, Walker BM, Vierbuchen T, Fuentes DR, Brennecke P, Nitta KR, Jolma A, Steinmetz LM, Taipale J, Su¨dhof TC, Wernig M (2017) Myt1l safeguards neuronal identity by actively repressing many non-neuronal fates. Nature 544:245–249. https://doi.org/10.1038/ nature21722 53. Drouin-Ouellet J, Lau S, Bratta˚s PL, Rylander Ottosson D, Pircs K, Grassi DA, Collins LM, Vuono R, Andersson Sjo¨land A, WestergrenThorsson G, Graff C, Minthon L, Toresson H, Barker RA, Jakobsson J, Parmar M (2017) REST suppression mediates neural conversion of adult human fibroblasts via microRNA-dependent and -independent pathways. EMBO Mol Med 9:1117–1131. https:// doi.org/10.15252/emmm.201607471 54. Xue Y, Qian H, Hu J, Zhou B, Zhou Y, Hu X, Karakhanyan A, Pang Z, Fu XD (2016) Sequential regulatory loops as key gatekeepers for neuronal reprogramming in human cells. Nat Neurosci 19:807–815. https://doi.org/ 10.1038/nn.4297 55. Xue Y, Ouyang K, Huang J, Zhou Y, Ouyang H, Li H, Wang G, Wu Q, Wei C, Bi Y, Jiang L, Cai Z, Sun H, Zhang K, Zhang Y, Chen J, Fu XD (2013) Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated MicroRNA circuits. Cell 152:82–96. https://doi.org/10.1016/j.cell. 2012.11.045 56. Lau S, RylanderOttosson D, Jakobsson J, Parmar M (2014) Direct neural conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Cell Rep 9:1673–1680. https://doi.org/10.1016/j.cel rep.2014.11.017 57. Huh CJ, Zhang B, Victor MB, Dahiya S, Batista LFZ, Horvath S, Yoo AS (2016) Maintenance of age in human neurons generated by microRNA-based neuronal conversion of fibroblasts. elife 5:e18648. https://doi.org/ 10.7554/eLife.18648 58. Victor MB, Richner M, Hermanstyne TO, Ransdell JL, Sobieski C, Deng PY, Klyachko

95

VA, Nerbonne JM, Yoo AS (2014) Generation of human striatal neurons by MicroRNAdependent direct conversion of fibroblasts. Neuron 84:311–323. https://doi.org/10. 1016/j.neuron.2014.10.016 59. Masserdotti G, Gillotin S, Sutor B, Drechsel D, Irmler M, Jørgensen HF, Sass S, Theis FJ, Beckers J, Berninger B, Guillemot F, Go¨tz M (2015) Transcriptional mechanisms of proneural factors and REST in regulating neuronal reprogramming of astrocytes. Cell Stem Cell 17:74–88. https://doi.org/10.1016/j.stem. 2015.05.014 60. Mertens J, Paquola ACM, Ku M, Hatch E, Bo¨hnke L, Ladjevardi S, McGrath S, Campbell B, Lee H, Herdy JR, Gonc¸alves JT, Toda T, Kim Y, Winkler J, Yao J, Hetzer MW, Gage FH (2015) Directly reprogrammed human neurons retain aging-associated transcriptomic signatures and reveal age-related nucleocytoplasmic defects. Cell Stem Cell 17:705–718. https://doi.org/10.1016/j. stem.2015.09.001 61. Pfisterer U, Ek F, Lang S, Soneji S, Olsson R, Parmar M (2016) Small molecules increase direct neural conversion of human fibroblasts. Sci Rep 6. https://doi.org/10.1038/ srep38290 62. Gasco´n S, Murenu E, Masserdotti G, Ortega F, Russo GL, Petrik D, Deshpande A, Heinrich C, Karow M, Robertson SP, Schroeder T, Beckers J, Irmler M, Berndt C, Angeli JPF, Conrad M, Berninger B, Go¨tz M (2016) Identification and successful negotiation of a metabolic checkpoint in direct neuronal reprogramming. Cell Stem Cell 18:396–409. https://doi.org/10.1016/j.stem.2015.12. 003 63. Smith DK, Yang J, Liu ML, Zhang CL (2016) Small molecules modulate chromatin accessibility to promote NEUROG2-mediated fibroblast-to-neuron reprogramming. Stem Cell Reports 7:955–969. https://doi.org/10. 1016/j.stemcr.2016.09.013 64. Traxler L, Edenhofer F, Mertens J (2019) Next-generation disease modeling with direct conversion: a new path to old neurons. FEBS Lett 593:3316–3337 65. Tang Y, Liu ML, Zang T, Zhang CL (2017) Direct reprogramming rather than iPSC-based reprogramming maintains aging hallmarks in human motor neurons. Front Mol Neurosci 10:359. https://doi.org/10.3389/fnmol. 2017.00359 66. Victor MB, Richner M, Olsen HE, Lee SW, Monteys AM, Ma C, Huh CJ, Zhang B, Davidson BL, Yang XW, Yoo AS (2018) Striatal neurons directly converted from Huntington’s

96

Lucia Zhou-Yang et al.

disease patient fibroblasts recapitulate age-associated disease phenotypes. Nat Neurosci 21:341–352. https://doi.org/10.1038/ s41593-018-0075-7 67. Kim Y, Zheng X, Ansari Z, Bunnell MC, Herdy JR, Traxler L, Lee H, Paquola ACM, Blithikioti C, Ku M, Schlachetzki JCM, Winkler J, Edenhofer F, Glass CK, Paucar AA, Jaeger BN, Pham S, Boyer L, Campbell BC, Hunter T, Mertens J, Gage FH (2018) Mitochondrial aging defects emerge in directly reprogrammed human neurons due to their metabolic profile. Cell Rep 23:2550–2558. https://doi.org/10.1016/j.celrep.2018.04. 105 68. Luo C, Lee QY, Wapinski O, Castanon R, Nery JR, Mall M, Kareta MS, Cullen SM, Goodell MA, Chang HY, Wernig M, Ecker JR (2019) Global DNA methylation remodeling during direct reprogramming of fibroblasts to neurons. elife 8:e40197. https://doi.org/10. 7554/eLife.40197 69. Lapasset L, Milhavet O, Prieur A, Besnard E, ¨ t-Hamou N, Leschik J, Pellestor F, Babled A, A Ramirez JM, De Vos J, Lehmann S, Lemaitre JM (2011) Rejuvenating senescent and centenarian human cells by reprogramming through the pluripotent state. Genes Dev 25:2248–2253. https://doi.org/10.1101/ gad.173922.111 70. Meissner A, Mikkelsen TS, Gu H, Wernig M, Hanna J, Sivachenko A, Zhang X, Bernstein BE, Nusbaum C, Jaffe DB, Gnirke A, Jaenisch R, Lander ES (2008) Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 454:766–770. https://doi.org/10.1038/nature07107 71. Maherali N, Sridharan R, Xie W, Utikal J, Eminli S, Arnold K, Stadtfeld M,

Yachechko R, Tchieu J, Jaenisch R, Plath K, Hochedlinger K (2007) Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1:55–70. https://doi. org/10.1016/j.stem.2007.05.014 72. Miller JD, Ganat YM, Kishinevsky S, Bowman RL, Liu B, Tu EY, Mandal PK, Vera E, Shim JW, Kriks S, Taldone T, Fusaki N, Tomishima MJ, Krainc D, Milner TA, Rossi DJ, Studer L (2013) Human iPSC-based modeling of lateonset disease via progerin-induced aging. Cell Stem Cell 13:691–705. https://doi.org/10. 1016/j.stem.2013.11.006 73. Vera E, Bosco N, Studer L (2016) Generating late-onset human iPSC-based disease models by inducing neuronal age-related phenotypes through telomerase manipulation. Cell Rep 17:1184–1192. https://doi.org/10.1016/j. celrep.2016.09.062 74. Zhu L, Sun C, Ren J, Wang G, Ma R, Sun L, Yang D, Gao S, Ning K, Wang Z, Chen X, Chen S, Zhu H, Gao Z, Xu J (2019) Stressinduced precocious aging in PD-patient iPSCderived NSCs may underlie the pathophysiology of Parkinson’s disease. Cell Death Dis 10:105. https://doi.org/10.1038/s41419019-1313-y 75. Shi Y, Kirwan P, Livesey FJ (2012) Directed differentiation of human pluripotent stem cells to cerebral cortex neurons and neural networks. Nat Protoc 7:1836–1846. https://doi. org/10.1038/nprot.2012.116 76. Du ZW, Chen H, Liu H, Lu J, Qian K, Huang CTL, Zhong X, Fan F, Zhang SC (2015) Generation and expansion of highly pure motor neuron progenitors from human pluripotent stem cells. Nat Commun 6. https://doi.org/ 10.1038/ncomms7626

Chapter 7 Generation of Induced Dopaminergic Neurons from Human Fetal Fibroblasts Emilie M. Legault and Janelle Drouin-Ouellet Abstract Since the first demonstration of direct dopaminergic neuronal reprogramming, over a dozen methods have been developed to generate induced dopaminergic neurons from various sources of cells. Here, we first present an overview of the different methods to generate induced neurons of a generic type and of different subtypes, with a particular focus on induced dopaminergic neurons generated from human fibroblasts. We then describe a protocol to generate induced dopaminergic neurons from commercially available human fetal lung fibroblasts. These cells could serve for various biomedical application, including regenerative medicine for conditions such as Parkinson’s disease. Key words Direct reprogramming, Dopaminergic neurons, Induced neurons, Human fetal fibroblasts, Viral vectors, Transcription factors

1

Introduction

1.1 Direct Induction of Neurons

Direct reprogramming toward the neuronal lineage consists in the conversion of a non-neuronal somatic cell type to a neuron, without a pluripotent intermediate or a proliferative neural precursor stage [1]. This type of reprogramming was first achieved in 2010 using mouse embryonic fibroblasts (MEFs) [2] and has since been the object of dozens of reports describing new methods to generate different neuronal subtypes, underlying lineage reprogramming mechanisms, as well as various biomedical applications of the technology. Thus far, the potential of direct neuronal reprogramming has been mostly explored for regenerative medicine (reviewed in [3]) and disease modeling (reviewed in [4]). This chapter focuses on human cells, given their relevance to potential clinical applications. Most of the literature, however, suggests that direct reprogramming strategies that are successful with human cells also work with rodent cells, although the opposite does not always apply or it results in a dramatic decrease in efficiency and maturation [5, 6]. In addition, induced neural progenitor cells can be

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

97

98

Emilie M. Legault and Janelle Drouin-Ouellet

generated [7–10] and further differentiated to mature neurons of different subtypes, including dopaminergic (DA) [11, 12], resulting in an expandable source of cells which could be favorable for the use of direct reprogramming for regenerative medicine. This chapter, however, focuses on direct reprogramming of fibroblasts to DA neurons, without a progenitor stage. Although much progress has been made in the last decade to improve the technology of direct reprogramming of human fibroblasts to neurons, it still faces many challenges. Because direct neuronal reprogramming can be done in absence of cell division [13] or a proliferating stem cell intermediate, the number of induced neurons (iNs) obtained is largely dependent on the conversion efficiency. Furthermore, it is becoming very clear that the direct lineage reprogramming of human somatic cells is more complex than the reprogramming of rodent cells, as it requires additional reprogramming factors [6], faces more complex reprogramming barriers [5], and operates on a longer and potentially different maturation process [14, 15]. Moreover, conversion efficiency is much lower with somatic cells from aged donors [5], which has been of great hurdle for using patient material to study diseases associated with aging, such as neurodegenerative disorders. Another aspect that complexifies the development of direct neuronal reprogramming technologies is that the starting source of somatic cell also influences on the reprogramming efficiency. For instance, while the exact same three reprogramming factors (Ascl1, Brn2, Myt1L; ABM) are sufficient to generate iNs from hepatocytes (endoderm) as well as from fibroblasts (ectoderm), hepatocytes appear to be more resistant to the lineage switch [16]. Interestingly, differences have been reported even within lineages from the same germ layer, where human lung fibroblasts are more permissive to direct neuronal reprogramming than human dermal fibroblasts [17]. Nevertheless, the development of methods with human embryonic or fetal fibroblasts has been of great insight to understand the different factors driving lineage reprogramming to a pan-neuronal phenotype, but also to subtype-specific neurons. Fully reprogrammed iNs have a distinct neuronal morphology, express neuron-specific gene products, and exhibit action potentials and synaptic transmission. They also acquire an epigenomic signature of mammalian post-mitotic neurons [18] while maintaining most of the epigenetic signature related to the age of the cell [19– 21]. The generation of iNs has classically been done through the forced expression of transcription factors delivered using lentiviral vectors (Fig. 1). Successful strategies involve the use of constitutive or inducible expression of proneural basic Helix-Loop-Helix (bHLH) transcription factors, such as Ascl1 and Ngn2 [22, 23], in combination with secondary factors (e.g., Brn2, Myt1L) [2, 6] and/or with subtype-specifying transcription factors (e.g., Lmx1a/

Generation of Induced Dopaminergic Neurons

99

Fig. 1 Direct conversion of human fibroblasts to different neuronal subtypes. (1) The forced expression of different transcription factors through lentiviral vector delivery in addition to (2) small molecules and growth factors to the medium reprograms human fibroblasts to (3) induced neurons, the subtype of which depends on the transcription factors delivered and can also be influenced by small molecules. Abbreviations: i5HTs induced serotoninergic neurons, iDANs induced dopaminergic neurons, iMNs induced motor neurons, iNs induced neurons, iNAs induced noradrenergic neurons, iSNs induced sensory neurons, iMSNs induced medium spiny neurons

b, FoxA2, Otx2 in the case of the DA subtype) [5, 24]. Other successful methods include the expression of neuronal-specific microRNAs (miRNAs) [25–27], the repression of polypyrimidine tract-binding protein (PTB), a protein regulating RNA processing [14, 15], and the addition of epigenetic regulators and small molecules, either in combination with transcription factor delivery or alone [22, 28–31]. By introducing neuronal-specific miR-9/9* and miR-124, human fibroblasts can be reprogrammed into cells with neuronal morphologies expressing the pan-neuronal marker MAP2. While these phenotypic changes are truly remarkable, the miRNAs alone are not sufficient to induce functional iNs. However, the addition of the transcription factors NeuroD2, Ascl1, and Myt1L greatly increases the conversion efficiency and leads to the generation of iNs from fetal and adult human fibroblasts harboring all the major functional properties of neurons, including synapse formation [27]. Moreover, the use of a single vector containing Ascl1 and Brn2 is sufficient to generate iNs from fetal human fibroblasts but is insufficient to achieve the same result in adult human fibroblasts. It was shown that iNs from adult fibroblasts can be generated through the overexpression of Ascl1 and Brn2 only when combined with miR-9/9* and miR-124 overexpression or REST repression [32] and that the combination of all three approaches favors functional maturation of iNs in human adult cells [33]. Small molecules known to have a role in neural induction through the inhibition of glycogen synthase kinase-3b and SMAD

100

Emilie M. Legault and Janelle Drouin-Ouellet

signaling have also been shown to be important in the reprogramming process, in some instance by increasing the neuronal yield by a up to 50-folds and the neuronal purity of up to 17-folds in a postnatal fibroblast line [30]. Several other small molecules acting on neuronal signaling pathways and epigenetic or metabolic processes have also been identified to improve the conversion efficiency (reviewed in [34]). Over the years, many other approaches have been successful in improving the conversion efficiency. Parameters that have been identified as effective include reprogramming under hypoxic conditions [35]; using substrate topography [36]; adding signaling adaptor proteins [37] or lifting reprogramming barriers such as INK4A/ARF [38], REST [32, 39, 40], HES1, and PRRX2 [17]; promoting neuronal-specific demethylation [41]; exposing the cells to an electromagnetic field [42]; or inducing the canonical BCL2 signaling [43]. It is still unclear, however, to what extent the improvement of conversion by these strategies depends on the starting cell type, species and age, and whether combining these approaches would result in an optimal environment for direct neuronal reprogramming. 1.2 Direct Induction of iNs with Pan-Neuronal Properties

The different methods used to reprogram fibroblasts to neurons generate iNs expressing the generic properties of excitatory and inhibitory neurons. This phenotype probably pertains to the role of the pioneer neural transcription factors Ascl1 and Ngn2 in glutamatergic and GABAergic development, which has been shown to be context dependent. For instance, Ngn2 is sufficient to induce the glutamatergic phenotype in the embryonic neocortex [44– 46]. Similarly, Ascl1 is required for the differentiation of a subset of early-born glutamatergic neurons [47]. On the other hand, Ascl1 is required for the generation of GABAergic neurons, most notably in the medial ganglionic eminence [48, 49]. In the context of direct neural reprogramming, Ascl1 has been established as a pioneer factor by directly accessing the chromatin in fibroblasts [50], acting alone [51] or in combination with other transcription factors to convert mouse and human fibroblasts [2, 5, 24, 52– 54]. Glutamatergic iNs can be generated from fibroblasts using the ABM cocktail or from astrocytes by enforced expression of Ngn2, thus indicating that the starting cell type strongly determines the reprogramming conditions and factors required to trigger successful conversion [2, 40]. This implies that although both strategies generate a glutamatergic phenotype, different reprogramming mechanisms are underlying the process. Perhaps not surprisingly, Ascl1 and Ngn2 give rise to a mixture of predominantly glutamatergic and GABAergic neurons [30, 55]. It could mean that these fates are a default fate as it has been suggested for embryonic stem cell (ESC) differentiation systems [56, 57] and that the addition of subtype-specific transcription factors could

Generation of Induced Dopaminergic Neurons

101

direct cells into other desired subtypes [24, 53] (Fig. 1). For example, the addition of Dlx2 to Ascl1-driven reprogramming induces neurons with GABAergic neurotransmitter specification [58]. This is also supported by the fact that other methods have also shown to generate a glutamatergic and GABAergic phenotype, such as the repression of PTB using shRNAs, which induces the upregulation of proneural bHLH transcription factors [14]. Nevertheless, the identification and the combination of Ngn2 with Ascl1 as two proneuronal pioneer transcription factors that can induce a pan-neuronal neuronal identity in non-neuronal cells have been key in the advancement of this technology [22, 30, 55]. 1.3 Direct Induction of Subtype-Specific Neurons

Building on the strategies used to generate neurons without a clear subtype specificity, multiple efforts have been deployed to synthesize different neuronal subtypes. The successful generation of specific neuronal subtypes has largely benefited from knowledge of normal development of these cells as most methods have used the forced expression of fate determinant transcription factors to obtain the desired subtype. To date, many neuronal subtypes have been generated from human fibroblasts, including dopaminergic (DA) [5, 17, 24, 59–62], cholinergic [22] and spinal motor [53], peripheral sensory [63, 64], serotoninergic [65, 66], medium spiny [67], noradrenergic [68], and forebrain GABAergic interneurons [69].

1.3.1 Induced Cholinergic and Spinal Motor Neurons

Son et al. [53] were among the firsts to generate subtype-specific iNs by converting fibroblasts to motor neurons (MNs) without passing through a proliferative neural progenitor state. This was achieved using eight transcription factors (Ascl1, Ngn2, NeuroD1, Brn2, Myt1L, Lhx3, Isl1, and HB9) and gave rise to human iNs expressing the enzyme CHAT. Importantly, these cells express functional voltage-gated sodium and potassium channels, can fire action potentials (APs), and respond appropriately to the major excitatory and inhibitory inputs. Of note, this method has also been successfully used with adult human fibroblasts for disease modeling of spinal muscular atrophy [70]. Using a more reductionist approach, induced cholinergic neurons have been generated using Ngn2 in addition to two small molecules: forskolin and dorsomorphin. The addition of Sox1 enabled efficient conversion of postnatal and adult human skin fibroblasts [22]. Building on this protocol, the same group has later added two important motor neuron fate determinants, Isl1 and Lhx3, to generate human adult iMNs that resemble more closely bona fide motor neurons, and obtained neurons expressing the neuronal markers TUJ1, MAP2, NF200, and Synaptotagmin 1, as well as the cholinergic markers HB9, CHAT, and VACHT. These iMNs exhibit similar excitability, including action potential firing threshold, frequency, half-width, amplitude, and the delay of the first spike [71], in addition to

102

Emilie M. Legault and Janelle Drouin-Ouellet

maintaining aging hallmarks [20]. Finally, human fetal lung fibroblasts have also been converted to motor neurons using five small molecules (kenpaullone, forskolin, Y27632, purmorphamine, and retinoic acid), without the forced expression of transcription factors and without passing through a neural progenitor cell stage [72]. 1.3.2 Peripheral Sensory Neurons

Two methods for the synthesis of peripheral sensory neurons (iSNs) have been described. In the first method, five transcription factors (Ascl1, Myt1l, Klf7, Isl2, Ngn1) can reprogram human fibroblasts into noxious stimulus-detecting (nociceptor) neurons expressing TUJ1, NF200, and peripherin. These cells exhibit aspects of SN functionality, such as different combinations of slow and persistent tetrodotoxin-resistant sodium currents, consistent with NaV1.8 and NaV1.9 contributions [64]. In the other method, a transient expression of Brn3a with either Ngn1 or Ngn2 reprograms human embryonic fibroblasts to iSNs that acquire physiological properties of mature sensory neurons expressing MAP2 and TUJ1, as well as insulin gene enhancer protein (ISL1) and either the TRKA, TRKB, or TRKC receptor, indicating the generation of different subsets of iSNs [63].

1.3.3 Serotoninergic

Induced serotoninergic neurons (i5HTs) can be generated using two different methods [65, 66]. In the first described method, the forced expression of the transcription factors Ascl1, Foxa2, Lmx1b, and Fev in primary human fibroblasts, combined to a p53 knockdown in hypoxic condition, produces i5THs expressing TUJ1, MAP2, NEUN, and Syntaxin 1, as well as markers of serotoninergic neurons including 5HT, TPH2, AADC, VMAT2, SERT, and ALDH1A1. Genes responsible for the synthesis (Tph1, Tph2, and Aadc), vesicular sequestration (Slc18a2 [Vmat2]), reuptake (Slc6a4 [Sert]), and degradation (Aldh1a1, Maoa, and Maob) of serotonin, as well as serotonin autoreceptors (Htr1a and Htr1b), are also expressed by these cells. The i5HTs also exhibit active serotonergic synaptic transmission, Ca2+-dependent release of serotonin, and selective uptake of this neurotransmitter [66]. In the second method, Ascl1, Ngn2, Lmx1b, Fev, Gata2, and Nkx2.2 generate i5THs that are comparable with 5HT neurons of the raphe nuclei in their expression profile, in addition to firing spontaneous APs, releasing 5HT, and being responsive to selective reuptake inhibitors [65].

1.3.4 Medium Spiny Neurons

The co-expression of miR-9/9*-124 with the transcription factors Ctip2, Dlx1, Dlx2, and Myt1l converts cells to medium spiny neurons (iMSNs) that express the neuronal markers TUJ1, MAP2, TAU, and NCAM1, some components of voltage-gated sodium channels (SCN2A and SCN3A), as well as the GABAergic markers DARPP-32, GAD65/GAD67, and GABA

Generation of Induced Dopaminergic Neurons

103

[26, 67]. iMSNs also express genes associated with striatonigral (Drd1, Chrm4, and Tac1) and striatopallidal (Drd2, Penk, and Gpr6) neurons, as well as Shank3, which has been shown to be important for the synaptic function of MSNs. These iMSNs display membrane properties similar to endogenous MSNs and, when grafted to the mouse brain, can form axonal projections, in addition to maintaining characteristics of aging [73]. 1.3.5 Forebrain GABAergic Neurons

The forced expression of five transcription factors (Foxg1, Sox2, Ascl1, Dlx5, and Lhx6), in combination with the expression of the anti-apoptotic factor Bcl2 to enhance cell survival, have been reported to convert human fibroblasts into induced GABAergic neurons [69]. These cells express the neuronal marker TUJ1 as well as GABA and parvalbumin, with a proportion exhibiting voltage-gated Na+ and K+ currents and producing repetitive APs.

1.3.6 Noradrenergic

Induced noradrenergic neuron (iNAs) are the latest neuronal subtype to be generated. A combination of seven transcription factors (Ascl1, Phox2b, Tfap2a, Gata3, Hand2, Nurr1, and Phox2a), in addition to the anti-apoptotic factor Bcl2l1, is able to generate iNAs by direct reprogramming of human foreskin fibroblasts. Cells reprogrammed to iNAs are double TH- and dopamine beathydroxylase (DBH)-positive and also co-express Synapsin 1 and VMAT2. Importantly, they release noradrenaline (NA) upon stimulation, show inward currents, and fire APs following step voltage and current injection. In addition, iNAs express genes of a noradrenergic identity, including Ddc, Slc6a2, neuropeptide genes Npy and Gal, and neurotrophic receptor Ret [68].

1.4 Direct Induction of Dopaminergic Neurons

Ventral midbrain DA neurons are implicated in the control of voluntary movement and body posture and in the modulation of cognitive and emotional/rewarding behaviors. For decades, the therapeutic approach aiming at repairing the DA brain circuitry lost by the death of midbrain DA neurons in Parkinson’s disease through the replacement of these neurons has been developed and optimized [74]. Perhaps because of this, DA neurons are the neuronal subtype that has received the most attention in terms of development of direct reprogramming methods to generate them, with to date at least nine methods having been developed to generate this subtype from human fibroblasts (see Table 1). Although there exist multiple types of DA neurons in different regions of the brain, the substantia nigra (A9) and ventral tegmental area (VTA) (A10) identities, and how they develop, have been the most studied given their different vulnerability to Parkinson’s disease despite their close proximity [75]. However, specifying induced DA neurons to a clear substantia nigra (A9) or VTA (A10) identity remains very challenging and is further complicated due to the current lack of markers to decipher between the two populations. Nevertheless,

hFLFs, aHDFs

hEFs, hFLFs, hFFs

hFLFs

hEFs, hFLFs

hFFs

hFLFs, hEFs

[5]

[24]

[60]

[62]

[37]

[61]

References Cell source

Ascl1, Brn2a, Myt1l, Lmx1a, Lmx1b, FoxA2, Otx2

Myt1l, Brn2, miR124, SH2B1

Ascl1, Brn2, Myt1l, FoxA2, Lmx1a, Lmx1b, Otx2

Protein expressed

Gene expressed

Functionality

~10% TH+

TH

TuJ1, NeuN, Synapsin 1, TH

69.9
2.6% TH+ cells at d28

N/A

TH

N/A

Tuj1, TH, DDC, DAT, EN1, VMAT2

N/A

N/A

N/A

EN1, TH, VMAT2, DAT

hEFs and hFLFs: MAP2, N/A Tuj1, TH, AADC, Nurr1

KCl-induced release DA release

Calcium influx activity upon glutamate stimulation

N/A

DA synthesis, DAT-mediated DA uptake. Current induced and APs blocked by TTX. D2R antagonist promotes AP firing and depolarization and increases the input resistance and DA release. Inward Na+/ outward K+ currents

hEFs: ~30% of the iNs showed spontaneous APs

hFLFs: Tuj1 (d18; 10
4%), hFLFs: Tuj1, TH, aHDFs: Immature electrophysiological properties, at TH (d18; 6
2%); MAP2; aHDFs: Tuj1, ALDH1A1, d18; Na+ and K+ currents suppressed by aHDFs: TuJ1 (5
1%), TH ALDH1A1, TH, AADC, TTX and 4-AP TH (3
1%) AADC, VMAT2, VMAT2, DAT DAT

Purity

Ascl1, Ngn2, 40% DDC+ (d20) Sox2, Nurr1, Pitx3

Ascl1, Brn2, Myt1l, Lmx1a, FoxA2

Ascl1, Nurr1, Lmx1a

Reprogramming factors

Table 1 Methods to generate induced DA neurons

Dox-regulated lentiviruses, induction at d5

Dox-regulated lentiviruses

Dox-regulated lentiviruses

Transduction of Lmx1a and FoxA2 three days after Ascl1, Brn2 and Myt1l

Dox-regulated lentiviruses

Methods particularities

104 Emilie M. Legault and Janelle Drouin-Ouellet

hFLFs, nHDFs, aHDFs

[17]

Tuj1+ cells (31.1
1.9%) and TH+ cells (15.4
1.1%) TH, TuJ1, AADC, ALDH1A1, DAT, VMAT2, Pitx3, Nurr1, FoxA2, En1, MAP2, NeuN, Syntaxin 1

Ascl1, Nurr1, hFLFs: TuJ1+ cells: TH, MAP2, TuJ1 Lmx1a, 87.0
6.1%; TH+ cells: miR124 and 56.5
3.9%; aHDFs: p53 shRNA TuJ1+ cells: 48.0
3.3%; TH+ cells: 11.7
1.5%

Ascl1, Nurr1, Lmx1a, miRNA124, p53 shRNA

N/A

N/A

N/A

Dox-regulated lentiviruses (except a constitutively active lentivirus for p53 shRNA)

DA synthesis and KCl-induced release, Dox-regulated decreased by the a D2R agonist lentiviruses quinpirole. ERK phosphorylation blocked (except a by a D2R antagonist. DA uptake, blocked constitutively by a DAT inhibitor. Voltage-dependent active lentivirus Na+ and K+ currents, evoked APs, for p53 shRNA) spontaneous APs, and spontaneous excitatory postsynaptic currents

Abbreviations: aHDFs adult human dermal fibroblasts, APs action potentials, DA dopamine, DAT dopamine transporter, DDC DOPA decarboxylase, Dox doxycycline, hEFs human embryonic fibroblasts, hFFs human foreskin fibroblasts, hFLFs human fetal lung fibroblasts, iNs induced neurons, MAP2 microtubule-associated protein 2, nHDFs neonatal human dermal fibroblasts, TH tyrosine hydroxylase, TTX tetrodotoxin

hFLFs, aHDFs

[59]

Generation of Induced Dopaminergic Neurons 105

106

Emilie M. Legault and Janelle Drouin-Ouellet

based on developmental studies, DA fate determinant transcription factors that dictate the DA specification have been identified and have proven to be paramount in the induction of fibroblasts to induced DA neurons. These include Otx2, involved in early patterning, as well as FoxA1/2, instructing the commitment of the progenitor cells; Lmx1a/b, Ascl1, and Ngn2 that are important for progenitor cell differentiation; and Pitx3 and Nurr1, involved in the maturation and long-term survival of midbrain DA neurons [76]. Ascl1, Lmx1a, and Nurr1 are the minimal combination of transcription factors able to generate human induced DA neurons exhibiting gene expression and functional profiles of DA neurons in vitro [5]. This conversion can be significantly enhanced when combined with a p53 knockdown [59]. This method leads to human induced DA neurons expressing the neuronal marker TUJ1, in addition to the DA markers TH, ALDH1A1, AADC, VMAT2, and DAT. These cells exhibit dopamine uptake, which can be blocked by a selective inhibitor of dopamine transporter, have voltage-dependent Na+ and K+ currents, can fire evoked and spontaneous APs, and can show spontaneous excitatory postsynaptic currents [59]. Multiple other cocktails of reprogramming factors have shown to successfully convert human fibroblasts to induced DA neurons (Table 1), some of which in combination with external factors such as exposure to an electromagnetic field [42] or with a knockdown of reprogramming barriers [17]. The protocol described below uses the factors identified in [24, 61, 62] to provide a source of induced DA neurons from human fetal lung fibroblasts expressing the neuronal markers TUJ1 and MAP2, as well as the DA markers TH, AADC, and NURR1 in 25 days (Fig. 2). Furthermore, they are electrophysiologically functional, release DA, and can survive transplantation in the rat brain [24, 61, 62].

Fig. 2 Timeline of experiments. Abbreviations: D day, dox doxycycline, ENM early neuronal medium, LNM late neuronal medium, MEF mouse embryonic fibroblast

Generation of Induced Dopaminergic Neurons

2

107

Materials 1. HFL1. 2. 24-well plates. 3. T75 flasks. 4. 500 ml filter unit with 0.22μm membrane. 5. Cell counter. 6. 1 ml cryogenic tubes. 7. Controlled-rate freezing container (e.g., CoolCell LX Cell Freezing Container). 8. Disinfectant solution capable of neutralizing lentiviruses. 9. Sterile 0.01% (m/V) gelatin aqueous solution. 10. MEF medium (see Table 2 for composition). 11. Freezing medium (see Table 2 for composition). 12. Early neuronal medium (ENM) (see Note 1 and Table 2 for composition). 13. Late neuronal medium (LNM) (see Note 1 and Table 2 for composition). 14. Lentiviral vectors containing Ascl1, Brn2a, Myt1l, Lmx1a, Lmx1b, FoxA2, and Otx2 (Addgene; Cat. 27150, 27151, 27152, 33013, 35001, 33014, 34997).

3

Methods

3.1 Seeding of Human Fetal Lung Fibroblasts for Conversion to Induced DA Neurons

1. Thaw a vial containing human fetal lung fibroblasts in a water bath at 37  C, until only a small piece of frozen congelation medium is remaining (see Notes 2 and 3). 2. Quickly transfer the content of the vial to a 15 ml tube containing at least 4 ml of MEF medium. Centrifuge for 5 min at 400  g. 3. Discard the supernatant and resuspend the cells in 1 ml of fresh MEF medium. 4. Transfer the cell suspension to a T75 flask containing 9 ml of MEF medium, and put the flask in the incubator at 37  C in 5% CO2. 5. The next day, do a full medium change with fresh MEF medium. 6. Expand the fibroblasts until they have reached about 95% confluency. Change the medium twice a week (see Note 4).

108

Emilie M. Legault and Janelle Drouin-Ouellet

Table 2 Media composition

Medium name

Component

MEF medium

DMEM + GlutaMAX Penicillin/streptomycin Fetal bovine serum (FBS) Doxycycline

Freezing medium

Stock concentration

Working concentration

N/A 10,000 U/ml N/A

N/A 100 U/ml 10%

2 mg/ml

2μg/ml

MEF medium Fetal bovine serum (FBS) DMSO

N/A N/A

45% 45%

N/A

10%

NDiff 227 medium GDNF NT3 db-cAMP CHIR99021 SB431542 Noggin LDN-193189 LM-22A4 Doxycycline

N/A 20μm/ml 10μg/ml 50 mM 10 mM 20 mM 100μg/ml 10 mM 20 mM 2 mg/ml

N/A 2 ng/ml 10 ng/ml 0.5 mM 2μM 10μM 0.5μg/ml 0.5μM 2μM 2μg/ml

Late neuronal medium (LNM) NDiff 227 medium LM-22A4 GDNF NT3 db-cAMP

N/A 20 mM 20μm/ml 10μg/ml 50 mM

N/A 2μM 2 ng/ml 10 ng/ml 0.5 mM

Early neuronal medium (ENM)

3.2 Plating the Cells for Reprogramming

1. In a 24-well plate, add 250μl of the 0.1% gelatin solution to each well. Incubate overnight 37  C. 2. The following day, vacuum the medium of the T75 flask containing the cells. Wash once with DPBS, and then dissociate the cells with 1 ml trypsin 0.05% at 37  C for about 3 min or until all the cells are detached and dissociated. 3. Add 3 ml of MEF medium to neutralize the trypsin, and then transfer the full 4 ml to a 15 ml tube. Flush out the cells a second time with an extra 3 ml of MEF medium, and then transfer to the same tube. 4. Spin the cells at 400  g for 5 min, and then discard the supernatant. Resuspend the cells in 1 ml of fresh MEF. 5. Count the cells with a cell counter. To ensure a good conversion efficiency, the overall viability should not be lower than 90%.

Generation of Induced Dopaminergic Neurons

109

6. Prepare a cell suspension of 40,000 cells per ml of medium. The total volume will depend on the number of wells to be plated (500μl per well +10%). 7. Vacuum the gelatin solution from the wells, and then wash each well twice with DPBS. 8. Quickly, to prevent the gelatin from drying, mix the cell suspension, and immediately transfer 500μl to each well. Fill the remaining wells with 1 ml of sterile water to prevent evaporation during the conversion. Incubate the cells overnight. 3.3 Fibroblast’s Freezing

1. Centrifuge the remaining cell suspension (from Subheading 3.2, step 4) for 5 min at 400  g. 2. Meanwhile, prepare the required volume of freezing medium to obtain a final cell concentration of about 500,000 cells/ml. 3. Resuspend the cells in freezing medium, and quickly distribute 1 ml of the suspension to each cryogenic tube. 4. Transfer the cryovials in a controlled-rate freezing container and store at 80  C. Transfer the cryogenic tubes at 140  C or in a liquid nitrogen tank the following day for long-term storage.

3.4 Viral Transduction (Day 0) and Conversion Induction (Day 5)

Note: All steps from Subheading 3.4 should be performed according to level 2 biohazard standard operating procedures. 1. Thaw at room temperature the vials containing the seven doxycycline (Dox)-regulated lentiviral vectors containing the seven transgenes (Ascl1, Brn2a, Myt1l, Lmx1a, Lmx1b, FoxA2, and Otx2) that will be used for the neural conversion. 2. Prepare the necessary volume of Dox-free MEF medium to a disposable sterile tube or bottle (500μlnumber of wells to transduce +10%). 3. Calculate the volume of each virus required for a transduction at multiplicity of infection (MOI) of 5 (for each of the 7 transgenes) and a MOI of 10 for the transactivator (FuW.rtTASM2). Use the following formula to do so: Volume of virus ðμlÞ ¼

Number of cells to infect  MOI  1000 μl Virus titer ðpfuÞ

4. Add the appropriate volume of each virus to the MEF medium prepared in step 2. Mix by inverting the tube. 5. Vacuum the medium contained in each well. Add 500μl of the virus-containing medium to each well. Incubate overnight at 37  C in 5% CO2. 6. The next day (on day 1), replace the medium contained in each well with fresh, virus-free, and Dox-free MEF medium, and incubate for 48 h (until day 3) before repeating this step.

110

Emilie M. Legault and Janelle Drouin-Ouellet

3.5 Cell Maintenance During Reprogramming

1. On day 5, change the full 500μl of medium of each well for 500μl of Dox-containing MEF medium, and incubate the plate at 37  C in 5% CO2. 2. On day 7, 2 days after transgene activation, change the full 500μl of medium of each well for early neuronal medium (ENM) containing Dox. 3. Every second to third day, change about 375μl of the early neuronal medium containing Dox in each well, and then put back in the incubator. Do so until experimental endpoint is reached (see Note 5).

4

Notes 1. It is recommended to prepare the ENM and LNM fresh. Both these media, as well as the aliquoted stock solutions of small molecules and growth factors, can be kept up to 1 month at 4  C. 2. The manipulations described in this protocol must be done in a biological safety cabinet, under sterile conditions. Wearing protection including gloves and a lab coat when handling the cells is highly recommended. 3. Regular testing for mycoplasma contamination is highly recommended, as it could affect the efficiency of conversion as well as cell growth and viability rate. 4. For optimal conversion efficiency, it is recommended that the cells have not been sub-cultured more than three times prior to seeding for reprogramming. 5. Note that the neuronal marker Tuj1 or MAP2 as well as neuritic extensions of a cell appear early in the reprogramming process but do not necessarily mean a full neuronal conversion. Long-term cultures of the cells are needed for appearance of mature functional neuronal properties.

References 1. Treutlein B, Lee QY, Camp JG, Mall M, Koh W, Shariati SA, Sim S, Neff NF, Skotheim JM, Wernig M, Quake SR (2016) Dissecting direct reprogramming from fibroblast to neuron using single-cell RNA-seq. Nature 534 (7607):391–395. https://doi.org/10.1038/ nature18323 2. Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Sudhof TC, Wernig M (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463

(7284):1035–1041. https://doi.org/10. 1038/nature08797 3. Grealish S, Drouin-Ouellet J, Parmar M (2016) Brain repair and reprogramming: the route to clinical translation. J Intern Med 280 (3):265–275. https://doi.org/10.1111/joim. 12475 4. Drouin-Ouellet J, Pircs K, Barker RA, Jakobsson J, Parmar M (2017) Direct neuronal reprogramming for disease modeling studies using patient-derived neurons: what have we

Generation of Induced Dopaminergic Neurons learned? Front Neurosci 11:530. https://doi. org/10.3389/fnins.2017.00530 5. Caiazzo M, Dell’Anno MT, Dvoretskova E, Lazarevic D, Taverna S, Leo D, Sotnikova TD, Menegon A, Roncaglia P, Colciago G, Russo G, Carninci P, Pezzoli G, Gainetdinov RR, Gustincich S, Dityatev A, Broccoli V (2011) Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476(7359):224–227. https://doi.org/10.1038/nature10284 6. Pang ZP, Yang N, Vierbuchen T, Ostermeier A, Fuentes DR, Yang TQ, Citri A, Sebastiano V, Marro S, Sudhof TC, Wernig M (2011) Induction of human neuronal cells by defined transcription factors. Nature 476 (7359):220–223. https://doi.org/10.1038/ nature10202 7. Han DW, Tapia N, Hermann A, Hemmer K, Hoing S, Arauzo-Bravo MJ, Zaehres H, Wu G, Frank S, Moritz S, Greber B, Yang JH, Lee HT, Schwamborn JC, Storch A, Scholer HR (2012) Direct reprogramming of fibroblasts into neural stem cells by defined factors. Cell Stem Cell 10(4):465–472. https://doi.org/10.1016/j. stem.2012.02.021 8. Mitchell R, Szabo E, Shapovalova Z, Aslostovar L, Makondo K, Bhatia M (2014) Molecular evidence for OCT4-induced plasticity in adult human fibroblasts required for direct cell fate conversion to lineage specific progenitors. Stem Cells 32(8):2178–2187. https://doi.org/10.1002/stem.1721 9. Thier M, Worsdorfer P, Lakes YB, Gorris R, Herms S, Opitz T, Seiferling D, Quandel T, Hoffmann P, Nothen MM, Brustle O, Edenhofer F (2012) Direct conversion of fibroblasts into stably expandable neural stem cells. Cell Stem Cell 10(4):473–479. https://doi.org/ 10.1016/j.stem.2012.03.003 10. Zou Q, Yan Q, Zhong J, Wang K, Sun H, Yi X, Lai L (2014) Direct conversion of human fibroblasts into neuronal restricted progenitors. J Biol Chem 289(8):5250–5260. https://doi.org/10.1074/jbc.M113.516112 11. Lim MS, Chang MY, Kim SM, Yi SH, Suh-Kim H, Jung SJ, Kim MJ, Kim JH, Lee YS, Lee SY, Kim DW, Lee SH, Park CH (2015) Generation of dopamine neurons from rodent fibroblasts through the expandable neural precursor cell stage. J Biol Chem 290 (28):17401–17414. https://doi.org/10. 1074/jbc.M114.629808 12. Mirakhori F, Zeynali B, Rassouli H, Salekdeh GH, Baharvand H (2015) Direct conversion of human fibroblasts into dopaminergic neural progenitor-like cells using TAT-mediated protein transduction of recombinant factors.

111

Biochem Biophys Res Commun 459 (4):655–661. https://doi.org/10.1016/j. bbrc.2015.02.166 13. Fishman VS, Shnayder TA, Orishchenko KE, Bader M, Alenina N, Serov OL (2015) Cell divisions are not essential for the direct conversion of fibroblasts into neuronal cells. Cell Cycle 14(8):1188–1196. https://doi.org/10. 1080/15384101.2015.1012875 14. Xue Y, Ouyang K, Huang J, Zhou Y, Ouyang H, Li H, Wang G, Wu Q, Wei C, Bi Y, Jiang L, Cai Z, Sun H, Zhang K, Zhang Y, Chen J, Fu XD (2013) Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell 152(1–2):82–96. https://doi.org/10.1016/j. cell.2012.11.045 15. Xue Y, Qian H, Hu J, Zhou B, Zhou Y, Hu X, Karakhanyan A, Pang Z, Fu XD (2016) Sequential regulatory loops as key gatekeepers for neuronal reprogramming in human cells. Nat Neurosci 19(6):807–815. https://doi. org/10.1038/nn.4297 16. Marro S, Pang ZP, Yang N, Tsai MC, Qu K, Chang HY, Sudhof TC, Wernig M (2011) Direct lineage conversion of terminally differentiated hepatocytes to functional neurons. Cell Stem Cell 9(4):374–382. https://doi. org/10.1016/j.stem.2011.09.002 17. Li H, Jiang H, Yin X, Bard JE, Zhang B, Feng J (2019) Attenuation of PRRX2 and HEY2 enables efficient conversion of adult human skin fibroblasts to neurons. Biochem Biophys Res Commun 516(3):765–769. https://doi. org/10.1016/j.bbrc.2019.06.089 18. Luo C, Lee QY, Wapinski O, Castanon R, Nery JR, Mall M, Kareta MS, Cullen SM, Goodell MA, Chang HY, Wernig M, Ecker JR (2019) Global DNA methylation remodeling during direct reprogramming of fibroblasts to neurons. elife 8:e40197. https://doi.org/10. 7554/eLife.40197 19. Huh CJ, Zhang B, Victor MB, Dahiya S, Batista LF, Horvath S, Yoo AS (2016) Maintenance of age in human neurons generated by microRNA-based neuronal conversion of fibroblasts. Elife 5:e18648. https://doi.org/ 10.7554/eLife.18648 20. Tang Y, Liu ML, Zang T, Zhang CL (2017) Direct reprogramming rather than iPSC-based reprogramming maintains aging hallmarks in human motor neurons. Front Mol Neurosci 10:359. https://doi.org/10.3389/fnmol. 2017.00359 21. Yang Y, Jiao J, Gao R, Le R, Kou X, Zhao Y, Wang H, Gao S, Wang Y (2015) Enhanced rejuvenation in induced pluripotent stem cellderived neurons compared with directly

112

Emilie M. Legault and Janelle Drouin-Ouellet

converted neurons from an aged mouse. Stem Cells Dev 24(23):2767–2777. https://doi. org/10.1089/scd.2015.0137 22. Liu ML, Zang T, Zou Y, Chang JC, Gibson JR, Huber KM, Zhang CL (2013) Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic neurons. Nat Commun 4:2183. https://doi.org/10. 1038/ncomms3183 23. Smith DK, Yang J, Liu ML, Zhang CL (2016) Small molecules modulate chromatin accessibility to promote NEUROG2-mediated fibroblast-to-neuron reprogramming. Stem Cell Reports 7(5):955–969. https://doi.org/ 10.1016/j.stemcr.2016.09.013 24. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M (2011) Direct conversion of human fibroblasts to dopaminergic neurons. Proc Natl Acad Sci U S A 108(25):10343–10348. https://doi.org/ 10.1073/pnas.1105135108 25. Abernathy DG, Kim WK, McCoy MJ, Lake AM, Ouwenga R, Lee SW, Xing X, Li D, Lee HJ, Heuckeroth RO, Dougherty JD, Wang T, Yoo AS (2017) MicroRNAs induce a permissive chromatin environment that enables neuronal subtype-specific reprogramming of adult human fibroblasts. Cell Stem Cell 21 (3):332–348.e339. https://doi.org/10. 1016/j.stem.2017.08.002 26. Victor MB, Richner M, Hermanstyne TO, Ransdell JL, Sobieski C, Deng PY, Klyachko VA, Nerbonne JM, Yoo AS (2014) Generation of human striatal neurons by microRNAdependent direct conversion of fibroblasts. Neuron 84(2):311–323. https://doi.org/10. 1016/j.neuron.2014.10.016 27. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR (2011) MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476 (7359):228–231. https://doi.org/10.1038/ nature10323 28. Dai P, Harada Y, Takamatsu T (2015) Highly efficient direct conversion of human fibroblasts to neuronal cells by chemical compounds. J Clin Biochem Nutr 56(3):166–170. https:// doi.org/10.3164/jcbn.15-39 29. Hu W, Qiu B, Guan W, Wang Q, Wang M, Li W, Gao L, Shen L, Huang Y, Xie G, Zhao H, Jin Y, Tang B, Yu Y, Zhao J, Pei G (2015) Direct conversion of normal and Alzheimer’s disease human fibroblasts into neuronal cells by small molecules. Cell Stem Cell 17 (2):204–212. https://doi.org/10.1016/j. stem.2015.07.006

30. Ladewig J, Mertens J, Kesavan J, Doerr J, Poppe D, Glaue F, Herms S, Wernet P, Kogler G, Muller FJ, Koch P, Brustle O (2012) Small molecules enable highly efficient neuronal conversion of human fibroblasts. Nat Methods 9(6):575–578. https://doi.org/10. 1038/nmeth.1972 31. Pfisterer U, Ek F, Lang S, Soneji S, Olsson R, Parmar M (2016) Small molecules increase direct neural conversion of human fibroblasts. Sci Rep 6:38290. https://doi.org/10.1038/ srep38290 32. Drouin-Ouellet J, Lau S, Brattas PL, Rylander Ottosson D, Pircs K, Grassi DA, Collins LM, Vuono R, Andersson Sjoland A, WestergrenThorsson G, Graff C, Minthon L, Toresson H, Barker RA, Jakobsson J, Parmar M (2017) REST suppression mediates neural conversion of adult human fibroblasts via microRNA-dependent and -independent pathways. EMBO Mol Med 9(8):1117–1131. https://doi.org/10.15252/emmm. 201607471 33. Birtele M, Sharma Y, Kidnapillai S, Lau S, Stoker T, Barker RA, Rylander Ottosson D, Drouin-Ouellet J, Parmar M (2019) Dual modulation of neuron-specific microRNAs and the REST complex promotes functional maturation of human adult induced neurons. FEBS Lett 593(23):3370–3380. https://doi. org/10.1002/1873-3468.13612 34. Qin H, Zhao A, Fu X (2017) Small molecules for reprogramming and transdifferentiation. Cell Mol Life Sci 74(19):3553–3575. https:// doi.org/10.1007/s00018-017-2586-x 35. Davila J, Chanda S, Ang CE, Sudhof TC, Wernig M (2013) Acute reduction in oxygen tension enhances the induction of neurons from human fibroblasts. J Neurosci Methods 216 (2):104–109. https://doi.org/10.1016/j. jneumeth.2013.03.020 36. Kulangara K, Adler AF, Wang H, Chellappan M, Hammett E, Yasuda R, Leong KW (2014) The effect of substrate topography on direct reprogramming of fibroblasts to induced neurons. Biomaterials 35 (20):5327–5336. https://doi.org/10.1016/j. biomaterials.2014.03.034 37. Hsu YC, Chen SL, Wang YJ, Chen YH, Wang DY, Chen L, Chen CH, Chen HH, Chiu IM (2014) Signaling adaptor protein SH2B1 enhances neurite outgrowth and accelerates the maturation of human induced neurons. Stem Cells Transl Med 3(6):713–722. https://doi.org/10.5966/sctm.2013-0111 38. Price JD, Park KY, Chen J, Salinas RD, Cho MJ, Kriegstein AR, Lim DA (2014) The Ink4a/Arf locus is a barrier to direct neuronal

Generation of Induced Dopaminergic Neurons transdifferentiation. J Neurosci 34 (37):12560–12567. https://doi.org/10. 1523/JNEUROSCI.3159-13.2014 39. Lee SW, Oh YM, Lu YL, Kim WK, Yoo AS (2018) MicroRNAs overcome cell fate barrier by reducing EZH2-controlled REST stability during neuronal conversion of human adult fibroblasts. Dev Cell 46(1):73–84.e77. https://doi.org/10.1016/j.devcel.2018.06. 007 40. Masserdotti G, Gillotin S, Sutor B, Drechsel D, Irmler M, Jorgensen HF, Sass S, Theis FJ, Beckers J, Berninger B, Guillemot F, Gotz M (2015) Transcriptional mechanisms of proneural factors and REST in regulating neuronal reprogramming of astrocytes. Cell Stem Cell 17(1):74–88. https://doi.org/10.1016/j. stem.2015.05.014 41. Zhang J, Chen S, Zhang D, Shi Z, Li H, Zhao T, Hu B, Zhou Q, Jiao J (2016) Tet3mediated DNA demethylation contributes to the direct conversion of fibroblast to functional neuron. Cell Rep 17(9):2326–2339. https:// doi.org/10.1016/j.celrep.2016.10.081 42. Yoo J, Lee E, Kim HY, Youn DH, Jung J, Kim H, Chang Y, Lee W, Shin J, Baek S, Jang W, Jun W, Kim S, Hong J, Park HJ, Lengner CJ, Moh SH, Kwon Y, Kim J (2017) Electromagnetized gold nanoparticles mediate direct lineage reprogramming into induced dopamine neurons in vivo for Parkinson’s disease therapy. Nat Nanotechnol 12 (10):1006–1014. https://doi.org/10.1038/ nnano.2017.133 43. Gascon S, Murenu E, Masserdotti G, Ortega F, Russo GL, Petrik D, Deshpande A, Heinrich C, Karow M, Robertson SP, Schroeder T, Beckers J, Irmler M, Berndt C, Angeli JP, Conrad M, Berninger B, Gotz M (2016) Identification and successful negotiation of a metabolic checkpoint in direct neuronal reprogramming. Cell Stem Cell 18 (3):396–409. https://doi.org/10.1016/j. stem.2015.12.003 44. Fode C, Ma Q, Casarosa S, Ang SL, Anderson DJ, Guillemot F (2000) A role for neural determination genes in specifying the dorsoventral identity of telencephalic neurons. Genes Dev 14(1):67–80 45. Mattar P, Langevin LM, Markham K, Klenin N, Shivji S, Zinyk D, Schuurmans C (2008) Basic helix-loop-helix transcription factors cooperate to specify a cortical projection neuron identity. Mol Cell Biol 28 (5):1456–1469. https://doi.org/10.1128/ MCB.01510-07 46. Parras CM, Schuurmans C, Scardigli R, Kim J, Anderson DJ, Guillemot F (2002) Divergent

113

functions of the proneural genes Mash1 and Ngn2 in the specification of neuronal subtype identity. Genes Dev 16(3):324–338. https:// doi.org/10.1101/gad.940902 47. Dixit R, Zimmer C, Waclaw RR, Mattar P, Shaker T, Kovach C, Logan C, Campbell K, Guillemot F, Schuurmans C (2011) Ascl1 participates in Cajal-Retzius cell development in the neocortex. Cereb Cortex 21 (11):2599–2611. https://doi.org/10.1093/ cercor/bhr046 48. Casarosa S, Fode C, Guillemot F (1999) Mash1 regulates neurogenesis in the ventral telencephalon. Development 126(3):525–534 49. Horton S, Meredith A, Richardson JA, Johnson JE (1999) Correct coordination of neuronal differentiation events in ventral forebrain requires the bHLH factor MASH1. Mol Cell Neurosci 14(4–5):355–369. https://doi.org/ 10.1006/mcne.1999.0791 50. Wapinski OL, Vierbuchen T, Qu K, Lee QY, Chanda S, Fuentes DR, Giresi PG, Ng YH, Marro S, Neff NF, Drechsel D, Martynoga B, Castro DS, Webb AE, Sudhof TC, Brunet A, Guillemot F, Chang HY, Wernig M (2013) Hierarchical mechanisms for direct reprogramming of fibroblasts to neurons. Cell 155 (3):621–635. https://doi.org/10.1016/j.cell. 2013.09.028 51. Chanda S, Ang CE, Davila J, Pak C, Mall M, Lee QY, Ahlenius H, Jung SW, Sudhof TC, Wernig M (2014) Generation of induced neuronal cells by the single reprogramming factor ASCL1. Stem Cell Reports 3(2):282–296. https://doi.org/10.1016/j.stemcr.2014.05. 020 52. Kim J, Su SC, Wang H, Cheng AW, Cassady JP, Lodato MA, Lengner CJ, Chung CY, Dawlaty MM, Tsai LH, Jaenisch R (2011) Functional integration of dopaminergic neurons directly converted from mouse fibroblasts. Cell Stem Cell 9(5):413–419. https://doi.org/10. 1016/j.stem.2011.09.011 53. Son EY, Ichida JK, Wainger BJ, Toma JS, Rafuse VF, Woolf CJ, Eggan K (2011) Conversion of mouse and human fibroblasts into functional spinal motor neurons. Cell Stem Cell 9 (3):205–218. https://doi.org/10.1016/j. stem.2011.07.014 54. Wang P, Zhang HL, Li W, Sha H, Xu C, Yao L, Tang Q, Tang H, Chen L, Zhu J (2014) Generation of patient-specific induced neuronal cells using a direct reprogramming strategy. Stem Cells Dev 23(1):16–23. https://doi. org/10.1089/scd.2013.0131 55. Mertens J, Paquola ACM, Ku M, Hatch E, Bohnke L, Ladjevardi S, McGrath S, Campbell B, Lee H, Herdy JR, Goncalves JT,

114

Emilie M. Legault and Janelle Drouin-Ouellet

Toda T, Kim Y, Winkler J, Yao J, Hetzer MW, Gage FH (2015) Directly reprogrammed human neurons retain aging-associated transcriptomic signatures and reveal age-related nucleocytoplasmic defects. Cell Stem Cell 17 (6):705–718. https://doi.org/10.1016/j. stem.2015.09.001 56. Gaspard N, Bouschet T, Hourez R, Dimidschstein J, Naeije G, van den Ameele J, Espuny-Camacho I, Herpoel A, Passante L, Schiffmann SN, Gaillard A, Vanderhaeghen P (2008) An intrinsic mechanism of corticogenesis from embryonic stem cells. Nature 455 (7211):351–357. https://doi.org/10.1038/ nature07287 57. Tropepe V, Hitoshi S, Sirard C, Mak TW, Rossant J, van der Kooy D (2001) Direct neural fate specification from embryonic stem cells: a primitive mammalian neural stem cell stage acquired through a default mechanism. Neuron 30(1):65–78. https://doi.org/10.1016/ s0896-6273(01)00263-x 58. Yang N, Chanda S, Marro S, Ng YH, Janas JA, Haag D, Ang CE, Tang Y, Flores Q, Mall M, Wapinski O, Li M, Ahlenius H, Rubenstein JL, Chang HY, Buylla AA, Sudhof TC, Wernig M (2017) Generation of pure GABAergic neurons by transcription factor programming. Nat Methods 14(6):621–628. https://doi. org/10.1038/nmeth.4291 59. Jiang H, Xu Z, Zhong P, Ren Y, Liang G, Schilling HA, Hu Z, Zhang Y, Wang X, Chen S, Yan Z, Feng J (2015) Cell cycle and p53 gate the direct conversion of human fibroblasts to dopaminergic neurons. Nat Commun 6:10100. https://doi.org/10.1038/ ncomms10100 60. Liu X, Li F, Stubblefield EA, Blanchard B, Richards TL, Larson GA, He Y, Huang Q, Tan AC, Zhang D, Benke TA, Sladek JR, Zahniser NR, Li CY (2012) Direct reprogramming of human fibroblasts into dopaminergic neuron-like cells. Cell Res 22(2):321–332. https://doi.org/10.1038/cr.2011.181 61. Pereira M, Pfisterer U, Rylander D, Torper O, Lau S, Lundblad M, Grealish S, Parmar M (2014) Highly efficient generation of induced neurons from human fibroblasts that survive transplantation into the adult rat brain. Sci Rep 4:6330. https://doi.org/10.1038/ srep06330 62. Torper O, Pfisterer U, Wolf DA, Pereira M, Lau S, Jakobsson J, Bjorklund A, Grealish S, Parmar M (2013) Generation of induced neurons via direct conversion in vivo. Proc Natl Acad Sci U S A 110(17):7038–7043. https:// doi.org/10.1073/pnas.1303829110

63. Blanchard JW, Eade KT, Szucs A, Lo Sardo V, Tsunemoto RK, Williams D, Sanna PP, Baldwin KK (2015) Selective conversion of fibroblasts into peripheral sensory neurons. Nat Neurosci 18(1):25–35. https://doi.org/10. 1038/nn.3887 64. Wainger BJ, Buttermore ED, Oliveira JT, Mellin C, Lee S, Saber WA, Wang AJ, Ichida JK, Chiu IM, Barrett L, Huebner EA, Bilgin C, Tsujimoto N, Brenneis C, Kapur K, Rubin LL, Eggan K, Woolf CJ (2015) Modeling pain in vitro using nociceptor neurons reprogrammed from fibroblasts. Nat Neurosci 18 (1):17–24. https://doi.org/10.1038/nn. 3886 65. Vadodaria KC, Mertens J, Paquola A, Bardy C, Li X, Jappelli R, Fung L, Marchetto MC, Hamm M, Gorris M, Koch P, Gage FH (2016) Generation of functional human serotonergic neurons from fibroblasts. Mol Psychiatry 21(1):49–61. https://doi.org/10.1038/ mp.2015.161 66. Xu Z, Jiang H, Zhong P, Yan Z, Chen S, Feng J (2016) Direct conversion of human fibroblasts to induced serotonergic neurons. Mol Psychiatry 21(1):62–70. https://doi.org/10.1038/ mp.2015.101 67. Richner M, Victor MB, Liu Y, Abernathy D, Yoo AS (2015) MicroRNA-based conversion of human fibroblasts into striatal medium spiny neurons. Nat Protoc 10 (10):1543–1555. https://doi.org/10.1038/ nprot.2015.102 68. Li S, Shi Y, Yao X, Wang X, Shen L, Rao Z, Yuan J, Liu Y, Zhou Z, Zhang Z, Liu F, Han S, Geng J, Yang H, Cheng L (2019) Conversion of astrocytes and fibroblasts into functional noradrenergic neurons. Cell Rep 28 (3):682–697.e687. https://doi.org/10. 1016/j.celrep.2019.06.042 69. Colasante G, Lignani G, Rubio A, Medrihan L, Yekhlef L, Sessa A, Massimino L, Giannelli SG, Sacchetti S, Caiazzo M, Leo D, Alexopoulou D, Dell’Anno MT, Ciabatti E, Orlando M, Studer M, Dahl A, Gainetdinov RR, Taverna S, Benfenati F, Broccoli V (2015) Rapid conversion of fibroblasts into functional forebrain GABAergic interneurons by direct genetic reprogramming. Cell Stem Cell 17(6):719–734. https://doi.org/10. 1016/j.stem.2015.09.002 70. Zhang QJ, Li JJ, Lin X, Lu YQ, Guo XX, Dong EL, Zhao M, He J, Wang N, Chen WJ (2017) Modeling the phenotype of spinal muscular atrophy by the direct conversion of human fibroblasts to motor neurons. Oncotarget 8

Generation of Induced Dopaminergic Neurons (7):10945–10953. https://doi.org/10. 18632/oncotarget.14641 71. Liu ML, Zang T, Zhang CL (2016) Direct lineage reprogramming reveals disease-specific phenotypes of motor neurons from human ALS patients. Cell Rep 14(1):115–128. https://doi.org/10.1016/j.celrep.2015.12. 018 72. Qin H, Zhao A, Ma K, Fu X (2018) Chemical conversion of human and mouse fibroblasts into motor neurons. Sci China Life Sci 61 (10):1151–1167. https://doi.org/10.1007/ s11427-018-9359-8 73. Victor MB, Richner M, Olsen HE, Lee SW, Monteys AM, Ma C, Huh CJ, Zhang B, Davidson BL, Yang XW, Yoo AS (2018) Striatal neurons directly converted from Huntington’s disease patient fibroblasts recapitulate age-associated disease phenotypes. Nat

115

Neurosci 21(3):341–352. https://doi.org/ 10.1038/s41593-018-0075-7 74. Barker RA, Drouin-Ouellet J, Parmar M (2015) Cell-based therapies for Parkinson disease-past insights and future potential. Nat Rev Neurol 11(9):492–503. https://doi.org/ 10.1038/nrneurol.2015.123 75. McRitchie DA, Hardman CD, Halliday GM (1996) Cytoarchitectural distribution of calcium binding proteins in midbrain dopaminergic regions of rats and humans. J Comp Neurol 364(1):121–150. https://doi.org/10.1002/( SICI)1096-9861(19960101)364:13.0.CO;2-1 76. Arenas E, Denham M, Villaescusa JC (2015) How to make a midbrain dopaminergic neuron. Development 142(11):1918–1936. https://doi.org/10.1242/dev.097394

Chapter 8 Direct Differentiation of Functional Neurons from Human Pluripotent Stem Cells (hPSCs) Ruiqi Hu, Xiaoting Zhu, and Nan Yang Abstract Somatic cell nuclear transfer and in vitro induction of pluripotency in somatic cells by defined factors provided unambiguous evidence that the epigenetic state of terminally differentiated somatic cells is not static and can be reversed to a more primitive one. Inspired by these results, stem cell biologists have identified approaches to directly convert fibroblasts into induced neuronal (iN) cells, indicating that direct lineage conversions are possible between distantly related cell types. More recently, we took advantages of pro-neurogenic capacity of iN factors and developed methods to rapidly derive functionally mature neurons directly from human pluripotent stem cells (hPSCs) through a brief induction of defined transcription factors. In this chapter, we describe the detailed methods used to attain the direct conversion from hPSCs to glutamatergic and GABAergic iN cells. Key words Direct differentiation, Transcription factors, Pluripotent stem cells, Induced neuronal cells, Glutamatergic, GABAergic

1

Introduction The generation of induced pluripotent stem cells (iPSCs) and their in vitro differentiation into potentially any desired cell type hold great promise in studying human disease [1–3]. Particularly, given the lack of alternative sources, substantial effort has been attributed toward the development of methods that convert pluripotent stem cells (PSCs) into neurons that could provide a foundation for studying healthy human neurons and neurons derived from patients with a variety of neurological disorders. Among the many innovative ideas proposed to achieve this goal, one that is particularly interesting to us involves cell fate conversion. As early as the mid-1960s, cell transplantation experiments suggested that the state of cells could be altered in response to the extracellular environment [4, 5]. Change of cell identity by nuclear reprogramming has been achieved by three distinct experimental routes: somatic cell nuclear transfer (SCNF), cell fusion, and transcription factor

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

117

118

Ruiqi Hu et al.

Fig. 1 Lentiviral vectors and timeline for iN cell induction. To make glutamatergic iN cells, lentiviruses expressing rtTA and a fused Ngn2-T2A-puromycin resistance gene are used. To make GABAergic iNs, hPSCs are transduced with three viruses expressing a fused Ascl1-T2A-puromycin resistance gene, a Dlx2hygromycin resistance gene, and rtTA. After adding doxycycline to induce transgene expression, antibiotics are added to enrich transduced cells. iN cells are detached and re-plated onto coverslips to culture together with mouse primary glial cells to enhance maturation and synapse formation. After 2 weeks of transgene induction, doxycycline is removed

transduction [6–8]. Inspired by the pioneering work, in 2010, we developed a method to directly convert fibroblasts into functional neurons, namely, induced neuronal (iN) cells, using defined transcription factors [9, 10]. Intriguingly, when the “iN factors” were expressed in human embryonic stem (ES) cells and iPSCs, we observed rapid generation of neurons [10]. This observation led to the successful development of two robust protocols to obtain glutamatergic and GABAergic neurons from human PSCs (Figs. 1 and 2) [11, 12], which are now broadly used by research groups.

2

Materials The following specific items are required for this protocol. General tissue culture equipment and reagents are not listed. All cell culture medium and supplements are obtained from Thermo Fisher Scientific unless stated otherwise.

2.1 Lentivirus Production

1. DNA plasmids: Tet-O-Ngn2-puromycin (Addgene, plasmid #52047); Tet-O-FUW-Ascl1 (Addgene, plasmid #27150); Tet-O-FUW-Dlx2-hygromycin (Addgene, plasmid #97330); Tet-O-FUW-Myt1l (optional) (Addgene, plasmid #27152); Tet-O-FUW-EGFP (optional) (Addgene, plasmid 30,130);

Directed Neuronal Differentiation from Human Stem Cells

119

Fig. 2 Expression of neuronal- and subtype-specific markers by glutamatergic and GABAergic iN cells. iN cells display neuronal morphologies within a week after transgene induction. Synaptic marker proteins and neuronal subtype genes are detected in neurons after being co-cultured with glia

FUW-M2rtTA (Addgene, plasmid #20342); pRSV-rev (Addgene, plasmid #12253); pMDLg/pRRE (Addgene, plasmid #12251); pMD2.G (Addgene, plasmid #12259). 2. HEK293T cells (ATCC, CRL-11268). 3. Polyornithine (100
stock): Dissolve 100 mg in 67 mL water. Filter with 0.22 μm filter and store at 20  C. Dilute the stock in distilled water, and filter into sterile bottle to make the working solution. Store at 4  C for up to 3 months. 4. Lentivirus freezing media (2
): 1 M sucrose in DMEM; sterilize with 0.22 μm filter and keep at 4  C for up to 2 months. 5. Polyethylenimine (PEI, 10
stock) (see Note 1): Dissolve 10 mg/mL PEI in 200 mL sterile ddH2O at 80  C, and adjust the pH value to 7.2. Aliquot and store at 20  C. To make the working solution, dilute the stock using PBS, sterilize by filtration using a 0.22 μm filter, and store at 4  C for up to 4 months. 2.2 Mouse Glial Cell Isolation Reagents

1. Dissociation solution: 5 mL HBSS, 80 μL papain (Worthington), 0.5 μM EDTA, 1 μM CaCl2. Filter with a 0.22 μm filter and place at 37  C until the solution is clear

120

Ruiqi Hu et al.

2. DNase solution: 10 mg/mL in sterile water, adjust pH to 7.3, filter with 0.22 μM syringe filter, aliquot, and store at 20  C 3. Cytosine arabinose (Ara-C): Dissolve 12 mg Ara-C in 50 mL sterile water. Filter with 0.22 M filter. Aliquot and store at 20  C 2.3

Cell Culture

1. MEF medium: Add 50 mL calf serum (final concentration 10% vol/vol), 5 mL 100
sodium pyruvate, 5 mL 100
nonessential amino acid (NEAA), and 4 μL 2-mercaptoethanol (Sigma) into 440 mL DMEM. Sterilize with 0.22 μm bottle top filter into sterile bottles. Store at 4  C for up to 1 month. 2. StemFlex™ Medium. 3. Geltrex™ LDEV-Free Reduced Growth Factor Basement Membrane Matrix. (See Note 2.) 4. Thiazovivin (5000
stock): Add 3.2 mL DMSO to a 10 mg bottle. Make 50 μL aliquots and store at 80  C to 20  C. 5. Doxycycline (1000
stock): To make 5 mL of 2 mg/mL stock solution, dissolve 10 mg of doxycycline in 5 mL distilled water. Sterilize with a 0.22 μm filter. Aliquot and store at 20  C. Protect from light. 6. BDNF (1000
stock): Dissolve 20 μg/mL recombinant human BDNF in sterile 0.1% BSA/PBS. Keep aliquots at 80  C. 7. N2 medium: Add 5 mL N2 supplement and 5 mL NEAA into 490 mL DMEM/F12 medium. Store at 4  C for up to 1 month. 8. Neural growth medium: To make 50 mL, use 45 mL Neurobasal medium, 1 mL B27 supplement, glutamine (final concentration 2 mM), and 0.5 mL fetal bovine serum. 9. Neural maturation medium: To make 50 mL, use 45 mL Neurobasal-A medium, 1 mL B27 supplement, glutamine (final concentration 2 mM), and 1 mL fetal bovine serum. Add Ara-C (final concentration 2 μM) and 50 μL BDNF. Store at 4  C for up to 14 days. 10. Puromycin (1000
stock) 1 mg/mL. 11. Hygromycin (250
stock) 50 mg/mL. 12. Accutase.

2.4 Immunofluorescence

1. 4% paraformaldehyde solution in PBS. 2. 0.2% Triton X-100 in PBS: To prepare 1 L, add 2 mL Triton X-100 into 1 L PBS and mix. 3. Antibodies: TUJ1(Beta-III-tubulin), MAP2, Synapsin I, Gad67, GABA, and Gad2. 4. Blocking buffer: To make 20 mL, dissolve 0.8 g bovine serum albumin and 0.2 mL calf serum in D-PBS.

Directed Neuronal Differentiation from Human Stem Cells

3

121

Methods

3.1 Lentivirus Production

Caution: Infectious viral particles will be produced following transfection. BSL-2/2+ level safety precautions are essential for the following steps. 1. 16–24 h prior to transfection, plate 5.0
106 HEK293T cells in 5 mL of MEF media on polyornithine-coated 10 cm plates (see Note 3). 2. Remove media and add 9 mL fresh MEF media. 3. For every 10 cm plate of virus produced, prepare Tube A (total volume ¼ 500 μL) by mixing 10 μg of lentiviral plasmid (e.g., Tet-O-FUW Ascl1-puro), 5 μg of pMDLg/pRRE, 2.5 μg of pRSV-rev, and 2.5 μg of pMD2.G in Opti-MEM and Tube B (total volume ¼ 500 μL) with Opti-MEM and 60 μL 1 PEI (3 μL/μg) (see Note 4). For glutaminergic iN cell induction, prepare Tet-O-Ngn2-puro virus and FUW-RtTA virus; for GABAergic iN cell generation, prepare Tet-O-FUW-Ascl1puromycin, Tet-O-FUW-Dlx2-hygromycin, and FUW-RtTA viruses. Add Tube A into B, and mix by briefly vortexing the tube. Incubate the mixed solution for 15–20 min at room temperature. 4. Lightly mix solution, and add 1 mL dropwise to each plate of HEK293T cells (cells should be >80% confluent). 5. 6 hours after transfection, remove the medium, wash once with D-PBS, and add 5 mL of fresh MEF media. If TetO-FUWEGFP is included, the GFP should be visible already. 6. Harvest viral supernatant 24 h later (30 h after transfection), filter through 0.45 μm cellulose acetate filter, and centrifuge at 50,000
g for 1.5 hours at 4  C to concentrate the viral particles (see Note 5). 7. Reconstitute the pellet in 50 μL DMEM (to obtain a 100
concentrated virus stock), and store at 4  C for up to 2 weeks. Alternatively, the concentrated virus can be mixed at 1:1 ratio with 2
lentivirus freezing media and kept at 80  C for longterm storage. 8. Titration of each reprogramming factor will require six wells of a 12-well dish. Each reprogramming factor must be titrated together with FUW-RtTA virus, and the infection efficiency should be measured 48 h after the addition of doxycycline using immunofluorescence with appropriate antibodies for each factor. An approximate starting point for hES/iPS cells would be to perform a dilution series across the six wells using a range of 0.5–5 μL/virus in 1 mL media/well. Fix and stain cells 48 h after the addition of doxycycline using standard procedures. Determine infection efficiency for each reprogramming

122

Ruiqi Hu et al.

factor by estimating the fraction of infected cells, and use DAPI staining to mark all nuclei. Optimal reprogramming efficiencies will be achieved when approximately 80–90% of cells express Ngn2, Ascl1, and Dlx2. 3.2 Glial Cell Isolation

1. Anesthetize postnatal day 3 pups on ice (see Notes 6 and 7). Remove heads from pups with surgical scissors, and place in a 10 cm tissue culture dish (2–3 brains for each 10 cm tissue culture dish). To prepare a significant number of cells, at least three pups are required. 2. Remove mouse heads one at a time, and place in a 15 cm dish cover to remove the brain from the skull. Then put the brain in a 3 cm dish filled with cold HBSS, dissect the cortices from the brain, and separate the two hemispheres. Remove the meninges using fine tweezers, and place the hemisphere into a 15 mL Falcon tube filled with cold HBSS, and put the tube on ice (see Note 8). 3. After collecting all the hemispheres from three pups, remove the HBSS, and add 5 mL dissociation solution (see Note 9). Put the tube in the incubator 37  C for 15 min, and shake the tube every 5 min. 4. Remove the dissociation solution with caution, and wash the tissue twice with MEF media. Caution: the mixture is very sticky, and move the solution cautiously to avoid losing the material. 5. Add 1 mL MEF media, and use a pipette to triturate the tissue and another 4 mL of MEF media to transfer through a 0.40 μm cell strainer into a 50 mL Falcon tube with 5 mL MEF media. Plate onto a 10 cm plate. 6. Change the media on the next day. 7. Passage the cells in MEF media in 10 cm dishes before using them for experiments to avoid neuron contamination. When the cells are confluent, add Ara-C (4 μM) in the media, and the cells are good to use until 3–4-week-old (see Notes 10 and 11).

3.3

Transduction

1. (Day 1) Plate human ES/iPS cells in Matrigel-coated 6-well plate 1 day before infection. Aspirate all of the media, and immediately add enough Accutase to cover the cells. Leave the plate in the 37  C incubator for 5–15 min. After cells detach, collect the cells by centrifugation at 180
g for 5 min. Resuspend the cells, take an aliquot of the cell suspension to determine the viable cell density, and plate 5
104 to 1
105 cells/well using StemFlex medium with thiazovivin. 2. (Day 0) On the day of transduction, remove the StemFlex from the culture, and add 1 mL of fresh StemFlex that contains the required lentivirus combinations (Fig. 1) (see Note 12).

Directed Neuronal Differentiation from Human Stem Cells

123

3. (Day 1) After 16–18 h, remove the virus-containing media, and add N2 media with doxycycline. 4. (Day 2) 48 h after transfection, change the media with N2 media with doxycycline and proper antibiotics (Fig. 1). Optional: Change the media with N2 media with doxycycline and proper antibiotics on day 4 to remove the dead cells. 5. (Day 5) Change the media with N2 media with doxycycline and Ara-C (4 μM). 3.4 iN Cell Maturation

1. (Days 7–8 after viral transduction) Plate iN cells together with mouse glial cells on Geltrex-coated coverslips. Dissociate primary mouse glial culture (passage 1) from a 10 cm dish with trypsin/EDTA, and the cells are enough to be split onto 36–48 coverslips. Dissociate iN cells with Accutase, adjust the iN cell number to 1.5–2
105, and mix the cells with mouse glial cells in 0.6 mL neural growth medium with doxycycline onto one coverslip (see Note 13). 2. (Day 9 or 10) Change half of the media using growth medium with doxycycline. When the glial cells grow to ~80–90% confluent, add Ara-C (2 μM) into the growth medium. 3. (Day 15) Replace ~75% of the growth medium with neural maturation medium containing Ara-C and BDNF. 4. (Days 18–42) Change half of the media (0.3 mL) every 3–4 days. (See Note 14.)

3.5 Basic Characterization of iN Cells Using Immunofluorescence Analysis

iN cells with immature neuronal morphology should be visible within 5–7 days after doxycycline induction. Such cells express pan-neuronal markers including Tuj1 and MAP2. We also detected the protein expression of GABAergic neuron-specific gene GAD67 using Western blot (data not shown) as early as 2 weeks after Ascl1 and Dlx2 expression. However, another 1–2 weeks are needed for iN cells to acquire mature characteristics such as firing of action potentials, synaptic activity, and expression of mature markers such as Synapsin and vGAT. 1. Remove culture medium and wash the plate with D-PBS. Add 4% PFA/D-PBS, and incubate for 10 min at room temperature to fix the cells. 2. Wash the plate three times with D-PBS. 3. Add 0.2% Triton X-100/D-PBS, and incubate for 5 min at room temperature to permeabilize the cells. 4. Wash the plate three times with D-PBS. 5. Add blocking buffer and incubate for 1 h at room temperature. 6. Remove the blocking buffer, and add primary antibody diluted in blocking buffer to appropriate concentration, and incubate for 2 h at room temperature or overnight at 4  C.

124

Ruiqi Hu et al.

7. Remove the primary antibody solution, and wash the plate three times with D-PBS. 8. Add secondary antibody diluted in blocking buffer to appropriate concentration, and incubate for 1 h at room temperature. 9. Remove the secondary antibody solution, and wash the plate three times with D-PBS. For the first wash, use D-PBS containing DAPI to stain the nuclei.

4

Notes 1. PEI condenses DNA into positively charged particles that are brought into the cell via endocytosis. Inside the cell, osmotic swelling bursts the vesicle and releases the polymer-DNA complex (polyplex) into the cytoplasm. Once the polyplex unpacks, the DNA is free to diffuse to the nucleus [13, 14]. PEI is extremely cytotoxic to cells; therefore, it is critical to remove the medium containing PEI and wash the plates 6 h after transfection. 2. Thaw Geltrex Matrix in a refrigerator at 2–8  C overnight. When working with smaller volumes of Geltrex Matrix, dispense appropriate required working volumes, and store at 80  C to 20  C. Avoid multiple freeze/thaw cycles. When working with a whole tube of Geltrex Matrix (5 mL), it is not necessary to keep it on ice if used within 5 min and the environmental temperature does not exceed 25  C. However, partial tubes and aliquots should be kept on ice to prevent gelling. 3. High-passage HEK/293T cells can result in low viral titer regardless of the transfection efficiency. Wash the polyornithine-coated plates with D-PBS before seeding the cells. 4. For each batch of PEI solution, use Tet-O-EGFP plasmid with lentiviral packaging plasmids to optimize transfection. Make identical transfection reactions, and test PEI amounts from 40 to 120 μL in increments of 10 μL. To achieve efficient lentiviral production, transfection efficiency should be at least 70%. Many factors can dramatically alter the transfection efficiecy, such as changes in the amount of total DNA, the tissue culture plate size, the amount of media on the cells, cell density, or the timing of the media change before the transfection. 5. At this point, transfection efficiency can be measured by imaging EGFP expression using a fluorescence microscope. 6. All procedures with live animals should adhere to relevant institutional guidelines for animal welfare.

Directed Neuronal Differentiation from Human Stem Cells

125

7. Timed pregnant mice can be ordered from commercial suppliers or timed mating can be set up in-house. 8. When making glial cell culture, it is critical to remove the meninges thoroughly; otherwise, fibroblasts can outgrow glia. 9. It is critical that the dissection solution is pre-warmed until the solution is clear. DNase in the dissociation solution is to reduce the stickiness of the mix. 10. Glial cells can be cryopreserved at passage 0 or 1. 11. Glial cells are required to promote the functional maturation of iN cells. 12. Human PSCs can be efficiently transduced without polybrene. 13. If excessive cell death is observed, thiazovivin can be included when iN cells are dissociated and seeded. It is also worth noting that different human ES/iPS cell lines may behave differently during splitting or viral transduction. The optimal cell number for the experiment should be determined. 14. If excessive cell death occurs during maturation, it is possible that too much virus is used or the glia cell density is low. References 1. Hanna JH, Saha K, Jaenisch R (2010) Pluripotency and cellular reprogramming: facts, hypotheses, unresolved issues. Cell 143 (4):508–525. https://doi.org/10.1016/j.cell. 2010.10.008 2. Okita K, Yamanaka S (2011) Induced pluripotent stem cells: opportunities and challenges. Philos Trans R Soc Lond Ser B Biol Sci 366 (1575):2198–2207. https://doi.org/10. 1098/rstb.2011.0016 3. Blanpain C, Daley GQ, Hochedlinger K, Passegue E, Rossant J, Yamanaka S (2012) Stem cells assessed. Nat Rev Mol Cell Biol 13 (7):471–476. https://doi.org/10.1038/ nrm3371 4. Gehring W (1967) Clonal analysis of determination dynamics in cultures of imaginal disks in Drosophila melanogaster. Dev Biol 16 (5):438–456. https://doi.org/10.1016/ 0012-1606(67)90058-9 5. Hadorn E (1966) Constancy, variation and type of determination and differentiation in cells from male genitalia rudiments of Drosophila melanogaster in permanent culture in vivo. Dev Biol 13(3):424–509. https://doi. org/10.1016/0012-1606(66)90058-3 6. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.

Cell 126(4):663–676. https://doi.org/10. 1016/j.cell.2006.07.024 7. Brazelton TR, Rossi FM, Keshet GI, Blau HM (2000) From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290(5497):1775–1779. https://doi.org/10. 1126/science.290.5497.1775 8. Gurdon JB (2006) From nuclear transfer to nuclear reprogramming: the reversal of cell differentiation. Annu Rev Cell Dev Biol 22:1–22. https://doi.org/10.1146/annurev.cellbio.22. 090805.140144 9. Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Sudhof TC, Wernig M (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463 (7284):1035–1041. https://doi.org/10. 1038/nature08797 10. Pang ZP, Yang N, Vierbuchen T, Ostermeier A, Fuentes DR, Yang TQ, Citri A, Sebastiano V, Marro S, Sudhof TC, Wernig M (2011) Induction of human neuronal cells by defined transcription factors. Nature 476 (7359):220–223. https://doi.org/10.1038/ nature10202 11. Zhang Y, Pak C, Han Y, Ahlenius H, Zhang Z, Chanda S, Marro S, Patzke C, Acuna C, Covy J, Xu W, Yang N, Danko T, Chen L, Wernig M, Sudhof TC (2013) Rapid single-

126

Ruiqi Hu et al.

step induction of functional neurons from human pluripotent stem cells. Neuron 78 (5):785–798. https://doi.org/10.1016/j.neu ron.2013.05.029 12. Yang N, Chanda S, Marro S, Ng YH, Janas JA, Haag D, Ang CE, Tang Y, Flores Q, Mall M, Wapinski O, Li M, Ahlenius H, Rubenstein JL, Chang HY, Buylla AA, Sudhof TC, Wernig M (2017) Generation of pure GABAergic neurons by transcription factor programming. Nat Methods 14(6):621–628. https://doi. org/10.1038/nmeth.4291

13. Rudolph C, Lausier J, Naundorf S, Muller RH, Rosenecker J (2000) In vivo gene delivery to the lung using polyethylenimine and fractured polyamidoamine dendrimers. J Gene Med 2 (4):269–278. https://doi.org/10.1002/ 1521-2254(200007/08)2:43.0.CO;2-F 14. Akinc A, Thomas M, Klibanov AM, Langer R (2005) Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. J Gene Med 7(5):657–663. https://doi.org/10.1002/jgm.696

Chapter 9 Generation of Motor Neurons from Human ESCs/iPSCs Using Sendai Virus Vectors Keiko Imamura, Jitsutaro Kawaguchi, Tsugumine Shu, and Haruhisa Inoue Abstract Human motor neurons are important materials for the research of the pathogenesis and drug discovery of motor neuron diseases. Various methods to generate motor neurons (MNs) from embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) by the addition of signaling molecules have been reported. However, they require multiple steps and complicated processes. Here we describe an approach for generating human MNs from ESCs/iPSCs using a single Sendai virus vector encoding three transcription factors—Lhx3, Ngn2, and Isl1. This approach enabled us to generate MNs in one step, adding Sendai virus vector in culture medium. This simple method significantly reduces the efforts to generate MNs, and it provides a useful tool for motor neuron disease research. Key words Sendai virus, Motor neuron, iPSC, ESC, Direct conversion

1

Introduction Effective medications for motor neuron diseases are limited, and basic research regarding pathogenesis and drug discovery is required. It stands to reason that we cannot obtain living motor neurons (MNs) from patients. Thus, it is useful to utilize MNs generated from embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) for the research of motor neuron diseases. While several methods for generating MNs from ESCs/iPSCs using chemical compounds including retinoic acid (RA) and Sonic hedgehog (Shh) [1, 2], relaying on developmental principles and requiring changing the combinations of signaling molecules at multiple steps, have been reported, long-time culture periods and complicated handling for MN differentiation are needed. Thus, establishment of a simple method to generate MNs from ESCs/ iPSCs has been expected. Hester et al. reported a differentiation method using adenoviral vectors that encode the transcription factors LIM/homeobox

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

127

128

Keiko Imamura et al.

protein 3 (Lhx3), neurogenin 2 (Ngn2), and islet-1 (Isl1) [3]. These three transcription factors have been reported to have an important role in the generation of MNs in the development [4]. These transcription factors were transduced into neural progenitor cells after differentiation from ESCs/iPSCs, and MNs were obtained 11 days after the transduction. To develop a simpler method, we introduced three transcription factors Lhx3, Ngn2, and Isl1 into ESCs/iPSCs by piggyBac vectors, and we succeeded in the rapid generation of MNs directly from ESCs/iPSCs within 7 days [5]. Furthermore, this method established the cell line harboring a doxycycline-inducible system that enabled robust generation of MNs for compound screening [5]. However, we might consider the genomic integration of the vector genes containing the possibility to influence the behaviors of the transduced cells. Therefore, we focused on the Sendai virus (SeV), which possesses a single-stranded negative sense RNA as the genome, a member of the family Paramyxoviridae, also called hemagglutinating virus of Japan (HVJ) or murine parainfluenza virus 1 (mPIV1) [6]. SeV vectors have several merits for gene delivery; there is no risk of genome integration in the host cells replicating in the cytoplasm with highly efficient transduction and expression levels of transgenes [6]. SeV vector has the ability to enter broad types of cells via sialic acid on the host cell surface [7], while it is nonpathogenic in humans [8], showing that SeV vectors have the potential to develop gene therapy and vaccine delivery [9]. Thus, we established a method for generation of MNs by transducing Lhx3, Ngn2, and Isl1 to ESCs/iPSCs using a SeV vector [10] (Fig. 1).

Fig. 1 SeV vector genome structure and direct conversion. SeV vector enters the cytoplasm of ESCs/iPSCs, and three transcription factors Lhx3, Ngn2, and Isl1 are translated, followed by direct conversion from ESCs/iPSCs to MNs within 7 days. NP nucleoprotein, P phosphoprotein, M matrix protein, HN hemagglutininneuraminidase, L large protein

Motor Neuron Generation by Sendai Virus

2

129

Materials

2.1 Culture of ESCs/ iPSCs

1. Human ESCs /iPSCs.

2.1.1 Cells 2.1.2 Reagents

1. StemFit (AK02N or AK03N). 2. iMatrix-511. 3. TrypLE Select. 4. Phosphate Buffered Saline.

2.1.3 Instruments

1. 6-well plates. 2. 15 mL conical tubes. 3. Cell scrapers. 4. Plastic pipettes.

2.2 Generation of MNs

1. Phosphate Buffered Saline.

2.2.1 Reagents

3. MN medium; 1:1 mixture of Neurobasal Medium and DMEM/F12, supplemented with 0.5% N2, 1% B27, 1μM retinoic acid, 1μM smoothened agonist, 10 ng/mL brainderived neurotrophic factor, 10 ng/mL glial cell-derived neurotrophic factor, and 10 ng/mL neurotrophin-3.

2. Accumax dissociation solution.

4. Y-27632; 10 mM stock in H2O. 5. SeV vector (SeV(PM) Lhx3-Ngn2-Isl1/TSΔF or SeV-L-N-I) (ID Pharma) [11, 12]. 2.2.2 Instruments

1. 96-well plates/24-well plates. 2. 15 mL conical tubes.

2.3

Immunostaining

2.3.1 Reagents

1. Phosphate Buffered Saline. 2. 4% Paraformaldehyde Phosphate Buffer Solution. 3. Triton X-100. 4. Bovine serum albumin. 5. Antibodies (see Table 1). 6. 40 ,6-Diamidino-2-Phenylindole (DAPI); 1 mg/mL stock in H2O.

130

Keiko Imamura et al.

Table 1 Primary antibody Target name

Host

Source

Cat. no.

Dilution

HB9

Mouse

Developmental Studies Hybridoma Bank

81.5C10

1:200

β3-Tubulin

Rabbit

Cell Signaling Technology

#5568

1:1000

NF-H

Mouse

BioLegend

#SMI-32P

1:1000

MAP2

Rabbit

Cell Signaling Technology

#8707

1:1000

3

Methods

3.1 Culture of Human ESCs/iPSCs

We describe the protocol for the culture of human ESCs/iPSCs under feeder-free conditions [13]. 1. To coat the 6-well plate, add 1.5 mL of PBS with 4.8μg/well of laminin-511 E8, and incubate at 37  C for at least 60 min (plates can be left overnight at 37  C). 2. Aspirate off the medium from ESCs/iPSCs cultured in a well of a 6-well plate, and add 1 mL of PBS to wash ESCs/iPSCs. 3. Remove PBS, add 300μL/well of 0.5 TrypLE Select spreading well over the surface, and incubate the plates at 37  C for 4 min. 4. Remove TrypLE Select and wash with 1 mL PBS. 5. Remove PBS, add 1 mL/well of StemFit medium, and detach cells with a cell scraper or by pipetting. 6. Collect cells in a 1.5 mL tube and count them by trypan blue exclusion. 7. Plate 13,000 live cells in one well of a laminin-coated 6-well plate with StemFit medium including 10μM Y-27632. 8. Culture plates at 37  C. 9. Next day, change to culture medium without Y-27632, and then change medium every other day.

3.2 Generation of MNs from Human ESCs/iPSCs

We describe the protocol for the generation of MNs from human ESCs/iPSCs [10]. 1. Thaw Matrigel on ice, dilute 20-fold in cold PBS or medium, and add to desired amount of wells in 24-well plates or 96-well plates. 2. Incubate plate at room temperature for 2 h. 3. Aspirate off the medium from the ESCs/iPSCs cultured dish, and add 1 mL of PBS to wash ESCs/iPSCs.

Motor Neuron Generation by Sendai Virus

131

4. Remove PBS, add 700μL/well of Accumax to spread well over the surface, and incubate the plates at 37  C for 5–10 min until most of the cells are detached. 5. Add 2 mL/well of StemFit medium and detach the cells by pipetting. 6. Collect cells in a 15 mL tube, centrifuge at 200  g for 3 min at room temperature, and count cells by trypan blue exclusion. 7. Transfer 5.0  104 or 2.0  105 cells onto Matrigel-coated 96-well or 24-well plates with MN medium containing 10μM Y-27632. At the same time, ESCs/iPSCs were infected with SeV at multiplicity of infections (MOIs) of 5 or 10. 8. Change medium to MN medium without Y-27632 on Day 1, and then change every 3 days. 9. Confirm MN generation from Day 7 to Day 14 by immunostaining. 3.3

Immunostaining

1. Fix cells with 4% paraformaldehyde (pH 7.4) for 20 min. 2. Permeabilize cells with 0.2% Triton X-100, and block nonspecific binding sites with 0.2% BSA. 3. Incubate with primary antibodies at 4  C overnight. 4. Wash with PBS twice. 5. Incubate with secondary antibodies at room temperature for 1 h. 6. Wash with PBS twice. 7. Add DAPI and wash twice. 8. Acquire image by appropriate microscopes.

4

Notes 1. Ratio of MNs in total cells depends on the infection efficiency of SeV vector [10]. It is important to adjust MOI in each experiment, because high MOI decreases the number of surviving cells. 2. For coculture with myogenic cells including the Hu5/E18 cell line to generate neuromuscular junctions, iPSC-derived MNs generated by SeV could be transferred on myogenic cells on Day 7 after dissociation by Accumax and could be cultured with MN medium. Fix with 4% paraformaldehyde on Day 14 followed by immunocytochemistry using αBTX to identify neuromuscular junctions.

132

Keiko Imamura et al.

References 1. Maury Y, Come J, Piskorowski RA et al (2015) Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nat Biotechnol 33(1):89–96 2. Shimojo D, Onodera K, Doi-Torii Y et al (2015) Rapid, efficient, and simple motor neuron differentiation from human pluripotent stem cells. Mol Brain 8(1):79 3. Hester ME, Murtha MJ, Song S et al (2011) Rapid and efficient generation of functional motor neurons from human pluripotent stem cells using gene delivered transcription factor codes. Mol Ther 19:1905–1912 4. Lee S, Cuvillier JM, Lee B, Shen R, Lee JW, Lee SK (2012) Fusion protein Isl1-Lhx3 specifies motor neuron fate by inducing motor neuron genes and concomitantly suppressing the interneuron programs. Proc Natl Acad Sci U S A 109(9):3383–3388 5. Imamura K, Izumi Y, Watanabe A et al (2017) The Src/c-Abl pathway is a potential therapeutic target in amyotrophic lateral sclerosis. Sci Transl Med 9(391):eaaf3962 6. Nakanishi M, Otsu M (2012) Development of Sendai virus vectors and their potential applications in gene therapy and regenerative medicine. Curr Gene Ther 12(5):410–416 7. Wu PS, Ledeen RW, Udem S, Isaacson YA (1980) Nature of the Sendai virus receptor:

glycoprotein versus ganglioside. J Virol 33 (1):304–310 8. Slobod KS, Shenep JL, Lujan-Zilbermann J et al (2004) Safety and immunogenicity of intranasal murine parainfluenza virus type 1 (Sendai virus) in healthy human adults. Vaccine 22(23–24):3182–3186 9. Takeuchi H, Imamura K, Ji B et al (2020) Nasal vaccine delivery attenuates brain pathology and cognitive impairment in tauopathy model mice. NPJ Vaccines 5:28 10. Goto K, Imamura K, Komatsu K et al (2017) Simple derivation of spinal motor neurons from ESCs/iPSCs using sendai virus vectors. Mol Ther Methods Clin Dev 4:115–125 11. Li HO, Zhu YF, Asakawa M et al (2000) A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression. J Virol 74 (14):6564–6569 12. Fusaki N, Ban H, Nishiyama A, Saeki K, Hasegawa M (2009) Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc Jpn Acad Ser B Phys Biol Sci 85(8):348–362 13. Nakagawa M, Taniguchi Y, Senda S et al (2014) A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep 4:3594

Chapter 10 Transcription Factor Programming of Human Pluripotent Stem Cells to Functionally Mature Astrocytes for Monocultures and Cocultures with Neurons Ella Quist, Henrik Ahlenius, and Isaac Canals Abstract Astrocytes are essential cells for normal brain functionality and have recently emerged as key players in many neurological diseases. However, the limited availability of human primary astrocytes for cell culture studies hinders our understanding of their physiology and precise role in disease development and progression. Here, we describe a detailed step-by-step protocol to rapidly and efficiently generate functionally mature induced astrocytes (iAs) from human embryonic and induced pluripotent stem cells (hES/iPSCs). Astrocyte induction is accomplished by ectopic lentiviral expression of two gliogenic transcription factors, Sox9 and Nfib. iAs exhibit morphology features as well as gene and protein expression similar to human mature astrocytes and display important astrocytic functions, such as glutamate uptake, propagation of calcium waves, expression of various cytokines after stimulation, and support of synapse formation and function, making them suitable models for studying the role of astrocytes in health and disease. Moreover, we describe a procedure for cryopreservation of iAs for long-term storage or shipping. Finally, we provide the required information needed to set up cocultures with human induced neurons (iNs, also described in this book), generated from hES/iPSCs, to generate cocultures, allowing studies on astrocyte-neuron interactions and providing new insights in astrocyte-associated disease mechanisms. Key words Astrocytes, Stem cells, Direct conversion, Reprogramming, Astrocyte-neuron cocultures

1

Introduction Astrocytes are a heterogeneous group of cells that perform essential and diverse functions in the brain [1–3]. Although for many years they were thought to be passive supportive cells for neurons, research over the last two decades has changed that view, demonstrating their active role in regulating brain activity and homeostasis [2, 3]. During development astrocytes participate in forming neuronal networks by promoting synapse formation and stabilization as well as their refinement through elimination of less active synapses [4, 5]. In the adult brain, astrocytes control both synaptic plasticity and transmission [4, 5] by regulating ionic and neurotransmitter

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

133

134

Ella Quist et al.

balance at the synapse through various membrane transporter proteins that allow them to buffer extracellular ions and take up neurotransmitters from the synaptic cleft, thereby preventing neuroexcitotoxicity [3, 5, 6]. Moreover, recent evidence showed that astrocytes directly modulate neuronal activity through release of synaptically active molecules, such as ATP, glutamate, and D-serine [1–4]. In addition, astrocytes interconnect through gap junctions to form an astrocytic syncytia, important to coordinate metabolite turnover and ionic balance [3, 7–9]. Through the syncytia, astrocytes display intracellular calcium waves, which appear to have functional effects on both astrocyte-astrocyte communication and regulation of neuronal function [3, 5, 10, 11]. Astrocytes also extend endfeets to ensheath capillaries and participate in the formation and maintenance of the blood-brain barrier, as well as secret factors that regulate changes in local blood flow in response to energetic demand due to neuronal activity [2, 3, 12]. The contact with blood vessels allows astrocytes to take up glucose from the blood and distribute energy metabolites to other central nervous system (CNS) cells, especially neurons, through the proposed astrocyte-neuron lactate shuttle [3, 6]. In addition, astrocytes are the main reserve for glycogen in the brain, which is used to fuel neurons during prolonged periods of intense neuronal activity [3]. Furthermore, astrocytes have a key role in regulating CNS inflammation through a wide spectrum of functions, ranging from release of pro- and anti-inflammatory molecules upon stimuli to the formation of the glial scar, which constitutes a physical barrier for infectious agents [3]. Due to the essential functions carried out by astrocytes and their close interplay with neurons, their involvement in neurological disease is notable. In recent years, research has shown that astrocytes are affected and, in some cases, a causing factor in several neurological diseases [7, 13]. Astrocytes respond to all kind of insults to the CNS through reactive gliosis, a process that can have both beneficial and detrimental effects on surrounding cells and is a pathological hallmark of the diseased brain [3]. Moreover, disease-specific astrocyte-associated effects have been demonstrated in neurodevelopmental diseases, such as Rett’s syndrome, fragile X mental retardation, and leukodystrophies [1–3, 7], and their role in epilepsy and neurodegenerative disease, such as frontotemporal dementia, Huntington, amyotrophic lateral sclerosis (ALS), and Alzheimer’s disease [1–3, 7, 14], is now being investigated. The underlying mechanisms by which astrocytes are involved in disease development remain largely unknown mainly due to difficulties to obtain relevant cells. Traditionally postmortem tissue and animal models, typically rodents, have been used in astrocyte biology studies. Although these systems can be informative, postmortem tissue mirrors only the end stage of the disease, whereas murine astrocytes are clearly smaller and less complex [15]. Moreover,

Generation of Human Functional Astrocytes

135

human-specific subtypes of astrocytes have been identified, suggesting the possibility that some astrocytic functions are displayed only by human astrocytes [15, 16]. Human astrocytes propagate calcium waves four times faster than rodent, and in contrast to mouse, human adult astrocytes respond to extracellular glutamate [15, 16]. In addition, RNA-seq experiments have also revealed expression of human-specific genes in astrocytes [16]. Altogether, the use of relevant human astrocytic models is essential to understand their physiology including their regulation of neuronal functionality and also their involvement in disease development and progression [2]. Differentiation of human embryonic stem cells (hESC) and patient-derived induced pluripotent stem cells (hiPSC) are common tools to generate specific cell types for studies of human cell biology [17]. Astrocyte differentiation protocols which use instructive factors and molecules are time-consuming and labor-intensive, and the resulting astrocytes are rarely well characterized [18]. An alternative to traditional differentiation is overexpression of cell lineage-specific key transcription factors (TFs) [19]. This TF programming approach has been demonstrated to efficiently and rapidly generate neurons from hES/iPSCs [20] as well as other cell types either by direct programming of hES/hiPSCs or direct conversion from one somatic cell type to another [21, 22]. Inspired by this, we sought to generate a source of human astrocytes that can be used to study astrocyte biology and their involvement in disease. Through lentiviral overexpression of the gliogenic TFs Sox9 and Nfib [2, 23] in hESCs and hiPSCs, we successfully generated functional and mature astrocytes (iAs) with high yield and purity. As early as 7 days post-transduction, a homogeneous population of iAs expressing S100B, GFAP, and VIM was obtained. Moreover, at 14 days, iAs had molecular signatures and functional properties closely resembling those of human adult astrocytes. iAs showed expression of several astrocytic markers both at the mRNA and protein level, took up glutamate, formed functional gap junctions, propagated calcium waves, supported synapse formation, responded to cytokine stimulation, and integrated into the mouse brain after transplantation [18]. This method can now readily be used to generate patient-specific astrocytes to study their role in neurological disorders using hiPSC or by combining CRISPR/ Cas9 gene editing in hESC to create disease-associated mutations followed by astrocytic induction [18, 24]. In this chapter, we provide a detailed step-by-step protocol on how to generate iAs and include up-to-date technical details that we consider advantageous. We describe how iAs can be cryopreserved, a helpful procedure to facilitate timing of experiments as well as allowing to exchange iAs between labs. Finally, we describe thoroughly how to set up cocultures with human glutamatergic and/or GABAergic induced neurons (iNs, described in Chapter 8) to study

136

Ella Quist et al.

astrocyte-neuronal interactions. These cocultures can be informative to identify causative or modulating astrocyte factors that contribute to impaired neuronal function as well as potential neuronal factors that affect astrocyte functionality [2]. Similar coculture systems, using either traditional hiPSC differentiation or murine cells, have been used to gain insights of the role of astrocytes in ALS [25, 26] and Fragile X mental retardation [27] and will now be possible in a more rapid set up and, importantly, in an exclusively human setting.

2

Materials Use cell culture grade reagents and sterile cell culture material and work under aseptic conditions when preparing reagents and during cell culture. Filter all solutions for factor reconstitution and media with 0.22 μm filters right after preparation. Do not filter reconstituted factors unless specifically stated.

2.1

Equipment

1. Ultracentrifuge. 2. Ultracentrifuge swinging-bucket rotor. 3. Ultracentrifuge tubes. 4. Cell strainers 40 μm pore size. 5. Cell Freezing Container. 6. Glass coverslips 13 mm diameter. 7. Munktell Filtrak™ Grade 3 qualitative filter papers.

2.2

Factors

1. Recombinant Human FGF-basic: Reconstitute at 20 μg/ml in sterile PBS containing 0.1% BSA, aliquot, and store at
20  C. 2. Recombinant Human CNTF: Reconstitute at 10 μg/ml in sterile 10 mM sodium phosphate containing 0.1% BSA, aliquot, and store at
20  C. 3. Recombinant Human BMP-4: Reconstitute at 10 μg/ml in sterile 4 mM HCl containing 0.1% BSA, aliquot, and store at
20  C. 4. Dibutyryl cyclic-AMP sodium salt: Reconstitute at 200 mM in Milli-Q water, filter, aliquot, and store at
20  C and protected from light. Discard aliquots after thawing if not used immediately. 5. N-Acetyl-L-cysteine: Reconstitute at 50 mg/ml in Milli-Q water, filter, aliquot, and store at
20  C. 6. Recombinant Human Heparin-Binding EGF-like Growth Factor: Reconstitute at 50 μg/ml in sterile PBS containing 0.1% BSA, aliquot, and store at
20  C.

Generation of Human Functional Astrocytes

137

7. Recombinant Human NT-3: Reconstitute at 10 μg/ml in sterile PBS containing 0.1% BSA, aliquot, and store at
20  C. 8. Recombinant Human/Murine/Rat BDNF: Reconstitute at 10 μg/ml in sterile PBS containing 0.1% BSA, aliquot, and store at
20  C. 2.3

Reagents

1. Polybrene. 2. DPBS, no calcium, no magnesium. 3. BSA 7.5%. 4. Accutase. 5. ROCK inhibitor Y27632: Prepare a 10 mM stock solution by dissolving 1 mg in 294 μl sterile Milli-Q water. 6. Puromycin. 7. Hygromycin. 8. Doxycycline: Prepare a 25 mg/ml stock solution by dissolving 250 mg of doxycycline hyclate in 10 ml of Milli-Q water, filter, aliquot, and store at
20  C and protected from light. 9. hESC-qualified Matrigel: Thaw on ice overnight at 4  C and aliquot using precooled tips while keeping the Matrigel on ice. Store aliquots at
80  C. 10. Growth Factor Reduced (GFR) Matrigel: Thaw on ice overnight at 4  C and aliquot using precooled tips while keeping the Matrigel on ice. Store aliquots at
80  C. 11. Poly-L-Ornithine 0.1 mg/ml: Aliquot and store at
20  C. 12. Poly-D-lysine 1 mg/ml: Aliquot and store at
20  C. 13. Fibronectin: Reconstitute in Milli-Q water for a final concentration of 1 mg/ml, aliquot, and store at
20  C. 14. Laminin mouse protein: Aliquot and store at
20  C. 15. 20 -Deoxy-5-fluorouridine (FUDR): Prepare a 40 mM stock solution by dissolving 100 mg in 10 ml of MEM containing 5 mg/ml of uridine. Filter, aliquot, and store at
20  C.

2.4

Solutions

1. 2.5 M CaCl2: Completely dissolve 277.45 g of CaCl2 in 1 l of sterile Milli-Q water. Filter, aliquot, and store at 4  C. 2. 2 HeBS Buffer: Completely dissolve 16.36 g of NaCl, 11.9 g of HEPES, and 0.213 g of anhydrous Na2HPO4 in 800 ml of Milli-Q water. Adjust pH to 7.0 using 5–10 M NaOH. Add Milli-Q water up to 1000 ml, and check pH again (it is very important that it is 7.00 at RT). Filter, aliquot, and store at
20  C. 3. 0.1 TE buffer: Mix 998.8 ml of Milli-Q water, 1 ml of Tris-Cl 1 M pH 8.0, and 0.2 ml of EDTA 0.5 M pH 8.0. Filter and store at +4  C.

138

Ella Quist et al.

4. Solution pH 4: Dissolve 1.64 g of sodium acetate and 110.98 mg of CaCl2 in 1000 ml of Milli-Q water, and adjust pH to 4.0. Filter and store up to 3 months at +4  C. Discard if precipitates are found in the solution. 2.5

Media

1. mTeSR™1. 2. STEM-CELLBANKER®. 3. CryoStor® CS10. 4. 293T medium: DMEM with GlutaMAX supplemented with 10% v/v FBS, 1 mM sodium pyruvate, and 1 MEM NEAA. Filter and add 100 U/ml Penicillin-Streptomycin. Keep at 4  C and use within 2 weeks. 5. Expansion Medium: DMEM/F-12 with GlutaMAX supplemented with 10% v/v FBS and 1 N-2. Filter and keep at 4  C. Use within 2 weeks. 6. FGF Medium: Neurobasal supplemented with 1% v/v FBS, 1 B-27, 1 MEM NEAA, and 1 GlutaMAX. Filter and keep at 4  C. Use within 2 weeks. Add 8 ng/ml FGF-basic, 5 ng/ml CNTF, and 10 ng/ml BMP-4 immediately before use. 7. Maturation Medium: 1:1 DMEM/F-12 with GlutaMAX and Neurobasal supplemented with 1 N-2, 1 mM sodium pyruvate, and 0.5 GlutaMAX. Filter and add 5 μg/ml N-Acetyl-Lcysteine and 5 ng/ml Heparin-Binding EGF-like Growth Factor. Keep at 4  C and use within 2 weeks. Add 10 ng/ml CNTF, 10 ng/ml BMP-4, and 1 mM cAMP immediately before use. 8. Neuronal Medium: BrainPhys supplemented with 1 N-2 and 1 B-27. Filter and keep at 4  C. Use within 2 weeks. Add 10 ng/ml of NT-3 and 10 ng/ml of BDNF immediately before use. 9. Coculture medium: 1:1 mix of Neuronal Medium and Maturation Medium.

2.6

Plasmids

1. pMD2.G (Addgene #12259). 2. pRSV-Rev (Addgene #12253). 3. pMDLg/pRRE (Addgene #12251). 4. M2-rtTA (Addgene #20342). 5. tetO.Sox9.Puro (Addgene #117269). 6. tetO.Nfib.Hygro (Addgene #117271). 7. pTet-O-Ngn2-puro (Addgene #52047). 8. TetO-Ascl1-puro (Addgene #97329). 9. DLX2-hygro (Addgene #97330).

Generation of Human Functional Astrocytes

3

139

Methods

3.1 Lentivirus Production

Prior to starting the protocol, generate high-yield transfectionquality plasmids using Qiagen Plasmid Maxi, Giga, or similar kit. Perform all the following steps in biosafety level 2-approved facilities and in accordance to local legislation: Day 1 1. Culture HEK 293T cells in T175 flasks with 293T medium until they reach around 80% confluence. For each virus to be produced, two flasks are needed (see Note 1). 2. Change medium at least 2 h before transfection by aspirating medium and adding 20 ml of fresh 293T medium to each flask. 3. Transfection: (a) Add the required volume of 0.1 TE buffer for each vector of interest, according to Table 1, into a 15 ml conical tube (see Notes 2 and 3). (b) Add packing plasmids and the vector of interest to the 0.1 TE buffer. (c) Add 290 μl of 2.5 M CaCl2 drop by drop to each tube while vortexing thoroughly. (d) Add 2900 μl of 2 HeBS drop by drop to each tube while vortexing thoroughly. (e) Incubate at RT for 10 min. (f) Divide the mixture into the two T175 flasks with HEK 293T cells by gently and drop by drop adding half of the mixture to each flask over the entire growth area. Carefully tilt the flasks to evenly spread the transfection mixture.

Table 1 Amounts of each vector required for production of one virus (two T175 flasks) and the resulting required volume of 0.1 Buffer TE to be used. The volume of each vector depends on DNA concentration of each preparation Plasmid

Amount

Volume (μl)

PMDLg/pRRE

30 μg

Preparation dependent

pMD2.G (VSVG)

22 μg

Preparation dependent

pRSV-Rev

15 μg

Preparation dependent

Vector of interest (rtTA, Sox9, etc.)

75 μg

Preparation dependent

Sum volume of plasmids

X

0.1 Buffer TE

2610-X

140

Ella Quist et al.

Day 2 4. Change medium and add 15–19 ml fresh medium per flask (see Note 4). Day 3 5. After a minimum of 24 h, collect supernatant containing lentiviral particles by pooling the medium from the two flasks for each virus into one 50 ml tube. 6. Centrifuge supernatant for 5 min at 230  g to pellet unwanted cells. 7. Pass supernatant through a 0.45 μm filter using a syringe into a new 50 ml tube in order to further remove unwanted debris (see Note 5). 8. Transfer each supernatant into an ultracentrifuge tube, and place them inside the ultracentrifuge buckets carefully. If needed to balance, fill a tube with medium, and place it into the corresponding bucket. 9. Centrifuge at 68,300  g for 2 h at 4  C to pellet virus particles. 10. Gently aspirate supernatant. 11. Add 100 μl of DMEM to the virus pellet without resuspending, and leave to dissolve overnight at 4  C (see Note 6). Day 4 12. Resuspend the virus pellet and aliquot in small volumes (5–20 μl). 13. Use the virus fresh, within 2 weeks, or store directly at
80  C. Avoid freeze-thaw cycles (see Note 7). 3.2 Glass Coverslip Cleaning

For steps 1–6, working in a sterile cell culture hood is not required. 1. Transfer 100–200 glass coverslips into a 50 ml tube and add 30 ml acetone. Leave in constant gentle agitation for 20 min. 2. Remove acetone and add 40 ml 96–100% ethanol. Leave in agitation for 20 min. 3. Remove ethanol and add 40 ml 70% ethanol. Leave in agitation for 20 min. 4. Repeat step 3 with fresh 70% ethanol. 5. Remove ethanol, and distribute the coverslips individually on filter papers using tweezers to create a multilayer pile with filter paper containing coverslips inside a glass petri dish of a size similar to the filter papers (see Note 8). 6. Sterilize by autoclaving the pile in the glass recipient. 7. After cooling down, carefully transfer the coverslips to a sterile 50 ml tube inside a cell culture hood.

Generation of Human Functional Astrocytes Dox

Ubiq.

+

rtTA

141

rtTA

TetO Sox9 T2A EGFP puro TetO Dox

rtTA

an al ys is

Day -2 Medium

in v i r a fe l ct io n ad d D ox se le ct io n re p an late al ys an is al ys is an al ys is

pl hES at C in g

TetO Nfib IRES EGFP hygro TetO

-1

21

mTeSR1

0

1

6 7 EM

10 FGF

14 DM

Fig. 1 Schematic representation of the vectors used (top) and protocol to generate iAs (bottom). Adapted from [18] 3.3

Generation of iAs

A schematic representation of the protocol can be found in Fig. 1. Day
2 1. Prepare coating before splitting the cells by thawing GFR Matrigel aliquots in the fridge, dilute in cold cell culture medium at 0.083 μg/ml, and add 1 ml in each well of a 6-well plate. Incubate for at least 1 h at 37  C. 2. Dissociate hPSCs at 80% confluency grown on ES-qualified Matrigel-coated 6-well plates by adding 400 μl Accutase per well, and incubate at 37  C until cells detach. 3. Collect cells with 600 μl mTeSR1 medium per well. 4. Pellet cells by centrifugation for 5 min at 300  g. 5. Aspirate supernatant and resuspend cells in 1–2 ml of fresh mTeSR1. Determine cell count and viability. 6. Seed 4  105 cells in GFR Matrigel-coated 6-well plates in mTeSR1 containing 10 μM ROCK inhibitor (see Note 9). Day
1 7. Aspirate medium, and add 2 ml of fresh mTeSR1 containing 8–12 μg/ml of polybrene per well to enhance lentiviral infection efficacy (see Note 10). Add 1 μl of each virus (rtTA, Nfib, and Sox9) per well (see Note 11). Day 0 8. Aspirate medium, and add 2 ml of fresh mTeSR1 containing 2.5 μg/ml of Doxycycline per well to induce expression of Sox9 and Nfib. Days 1 and 2 9. Aspirate medium, and add 2 ml of fresh Expansion Medium containing 2.5 μg/ml of Doxycycline, 1.25 μg/ml of

142

Ella Quist et al.

puromycin, and 200 μg/ml of hygromycin per well to select for infected cells (see Note 12). Day 3 10. Aspirate all medium, and add 2 ml of 3:4 of Expansion Medium and 1:4 of FGF Medium containing 2.5 μg/ml of Doxycycline and 200 μg/ml of hygromycin per well. Day 4 11. Aspirate all medium, and add 2 ml of 1:1 of Expansion Medium and FGF Medium containing 2.5 μg/ml of Doxycycline and 200 μg/ml of hygromycin per well. Day 5 12. Aspirate all medium, and add 2 ml of 1:4 of Expansion Medium and 3:4 of FGF Medium containing 2.5 μg/ml of Doxycycline and 200 μg/ml of hygromycin per well. Day 6 13. Aspirate all medium, and add 2 ml of FGF Medium containing 2.5 μg/ml of Doxycycline per well. Day 7 14. Prepare coating before splitting the cells. For glass bottom dishes or coverslips, add Poly-D-lysine (100 μg/ml in Milli-Q water) to the glass surface and incubate 2 h at RT. Remove the Poly-D-lysine solution, and add enough Fibronectin (10 μg/ ml in DPBS) to cover the surface, and incubate at 37  C for 1–2 h. Remove Fibronectin and plate cells immediately (see Note 13). For plastic surfaces, coat with 0.083 μg/ml of GFR-Matrigel for at least 1 h at 37  C, aspirate Matrigel, and plate cells immediately. 15. Dissociate cells by adding 400 μl Accutase per well, and incubate at 37  C until a single cell solution is obtained. 16. Collect cells by adding 600 μl of FGF Medium per well, mix, and transfer the content to a tube. 17. Pellet cells by centrifugation for 5 min at 300  g. 18. Determine cell counts and viability. 19. Seed cells on coated coverslips, petri dishes, or wells according to desired output (see Note 14). Use the necessary amount of FGF Medium containing 2.5 μg/ml of Doxycycline. Day 8 20. Aspirate all medium, and add fresh FGF Medium containing 2.5 μg/ml of Doxycycline.

Generation of Human Functional Astrocytes

143

Fig. 2 Time-lapse images of iAs generation. Representative images in bright field and green fluorescence, showing a time lapse of the conversion of hESCs transduced with inducible Sox9 and Nfib vectors together with an inducible GFP vector. Scale bar ¼ 100μm

Day 10 and onward 21. Aspirate half of the medium, and add the same amount of Maturation Medium containing 2.5 μg/ml of Doxycycline. From here on, change half of the Maturation Medium every 2–3 days (see Note 15). Representative time-lapse images of the differentiation and maturation can be found in Fig. 2. For suggestion of how to characterize obtained iAs, we refer to Canals et al. [18].

144

3.4

Ella Quist et al.

Cryopreservation

3.4.1 Freezing Procedure

1. Culture iAs as described in Subheading 3.3 until day 21. 2. Wash cells with 3 ml DPBS per well. 3. Dissociate cells by adding 500 μl Accutase per well, and incubate at 37  C for about 5 min or until a single cell solution is obtained. 4. Collect cells by adding 2.5 ml Maturation Medium without CNTF, BMP-4, and cAMP supplemented with 0.1% BSA per well, mix, and transfer the content to a 15 ml tube. Pool two wells of iAs into one 15 ml tube. 5. Pellet cells by centrifugation for 5 min at 300  g. 6. Carefully remove supernatant. 7. Optional: Resuspend cell pellet in 1 ml Maturation Medium without CNTF, BMP-4, and cAMP supplemented with 0.1% BSA, determine cell count and viability, transfer cell suspension to a 1.5 ml Eppendorf tube, and pellet cells again by centrifugation for 5 min at 300  g. 8. Resuspend cell pellet in 1 ml cryopreservation medium of choice (see Note 16), and transfer cells to a cryovial. 9. Place cryovial in a cell freezing container for 1 day at
80  C. Thereafter, transfer cryovials to a
150  C freezer or to a liquid nitrogen tank for long-term storage.

3.4.2 Thawing Procedure

1. Immerse the cryovial containing iAs in a 37  C water bath. 2. When almost completely thawed, add the content to 9 ml of Maturation media without CNTF, BMP-4, and cAMP supplemented with 0.1% BSA. 3. Pellet cells by centrifugation for 8 min at 300  g. 4. Aspirate supernatant and resuspend cell pellet in 1 ml Maturation Medium. 5. Determine cell count and viability. 6. Seed cells according to desired number and surface (see Note 14) in Maturation Medium containing 2.5 μg/ml of Doxycycline. 7. Maintain cells by changing half of the Maturation Medium supplemented with 2.5 μg/ml of Doxycycline every 2–3 days.

3.5 Cocultures with iNs

1. Generate iAs as described above and excitatory iN and/or inhibitory iN as previously described [20, 28] (see Chapter 8). Ideally, all cell types should be generated from the same lines simultaneously. 2. Prepare the coating the day before plating cells together. Apply a drop of 100 μl Poly-D-lysine (100 μg/ml in Milli-Q) on the coverslip, and carefully spread the drop to cover as much of the

Generation of Human Functional Astrocytes

145

coverslip as possible. Incubate for 2 h at RT. Gently remove the Poly-D-lysine solution with a pipette, and add laminin (10 μg/ ml in Solution pH 4). Incubate at 37  C overnight (see Note 13). 3. On day 7 for both iAs and iN protocols, seed both cell types together. Dissociate iAs as described in day 7 steps 14–17 of the protocol. Dissociate iNs as follows: (a) Wash iNs with DPBS. (b) Dissociate iNs by adding 400 μl Accutase per well, and leave for 10 min at 37  C. (c) Mix iNs by pipetting up and down. Leave for additional 10 min at 37  C. (d) Collect iNs by adding 600 μl of Neuronal Medium per well, mix, and transfer the cell suspension to a tube. (e) Pellet iNs by centrifugation for 5 min at 300  g. (f) Aspirate supernatant, and resuspend cell pellet in Neuronal Medium containing 2.5 μg/ml of Doxycycline, 10 ng/ml of NT-3, and 10 ng/ml of BDNF. (g) Pass the cell suspension through a 40 μm strainer. (h) Determine cell count and viability. 4. Seed iNs and iAs in combination on coated coverslips. Plating 100,000–200,000 total cells per coverslip with a neuron:astrocyte ratio of 3:1 is recommended (see Note 17). Gently remove the laminin coating with a pipette, apply a drop of cell suspension, and place the cells in the incubator. Once the cells have attached, add 400 μl of a 1:1 mix of Neuronal Medium and FGF Medium supplemented with 2.5 μg/ml of Doxycycline. 5. The day after, do a full medium change with a 1:1 mix of Neuronal Medium and FGF Medium supplemented with 2.5 μg/ml of Doxycycline. 6. From here on, change very carefully using a P1000 half of the medium with coculture medium supplemented with 2.5 μg/ml of Doxycycline every 2–3 days. Supplement medium with 40 μM of FUDR to reach a final concentration of 20 μM in the wells until day 21 for inhibiting astrocyte proliferation (see Note 18). Cocultures can be kept for at least 8 weeks (Fig. 3, see Note 19).

4

Notes 1. 293T cells can be seeded in Poly-L-Ornithine coated T175 flasks for better attachment to the growth surface. Apply 10 ml Poly-L-Ornithine (2 μg/ml in Milli-Q) per T175 flask.

146

Ella Quist et al.

Fig. 3 Cocultures of iAs and excitatory iNs. Representative image of a neuron-astrocyte coculture with welldistributed iNs positive for β-III-tub and iAs labeled with GFP. Scale bar ¼ 100μm

Leave at RT for 1–2 h. Remove and wash once with DPBS before plating the cells. For expansion of 293T cells, coating of flasks is not recommended. 2. Do not scale up the plasmid mix in the same tube. The volumes indicated are optimal for the best transfection of two T175 flasks. 3. In order to monitor transfection efficiency, it is advisable to include a fluorescent reporter vector, such as tetO-GFP, in separate T175 flasks, for each virus production. 4. Do not add less than 15 or more than 19 ml per flask because Beckman ultracentrifuge tubes are made to work in the range of 30–38 ml to avoid collapse during centrifugation. 5. It is possible to leave the collected supernatant ON at 4  C and perform the centrifugation the day after. 6. The virus pellet can be left to dissolve at +4  C for at least 2 h, but it is advisable to let it dissolve ON. 7. With each thawing-freezing cycle, the virus titer will decrease. Avoid using viruses that have been thawed more than twice. 8. To avoid coverslips to stick together, do not put them too close to each other. Once there are a proper number of coverslips on a filter paper, a new filter paper is placed on top, and more coverslips are distributed, creating a multilayer pile of filter papers with coverslips. 9. It is recommended to try different amounts of cells to find the density that better allow good transcription factor programming of each specific hPSC line. 10. The transduction enhancing effect of polybrene is clear when using hESC but can be toxic to some hiPSC lines; it is therefore recommended to avoid using polybrene for hiPSCs.

Generation of Human Functional Astrocytes

147

11. It is recommended to try different amounts of virus for each production, ranging from 0.5 to 2 μl due to batch-to-batch titer variations. 12. It is recommended to titrate the minimum concentration of puromycin and hygromycin in combination that efficiently kills non-transduced cells for each specific cell line. 13. When plating on coverslips, carefully spread the drop to cover as much of the coverslip as possible. After coating, gently remove it with a pipette, and add a drop of cell suspension. Allow the cells to attach (1–4 h), and then fill up with FGF Medium containing 2.5 μg/ml of Doxycycline. It is important to keep the coating only on the glass surface to facilitate cell attachment to the glass. 14. Replating on plastic surfaces can be done after coating with 0.083 mg/ml GFR-Matrigel diluted in DMEM/F12 for at least 1 h at 37  C. For coverslips and other glass surfaces, coat with 0.167 mg/ml GFR-Matrigel or with PDL and Fibronectin as described in Subheading 3.3, step 13. 15. To avoid the use of serum, it is possible to use Maturation Medium starting on day 1. In that case, medium with all factors is supplemented with FGF during the first 8 days of the protocol, and cAMP is only added from day 9. iAs can be passaged again at later time points (14–21 days) from plastic to glass, showing better attachment and morphology than compared to iAs plated on glass at day 7. 16. Use of STEM-CELLBANKER® or CryoStor® CS10 is highly recommended. Decreased survival was observed with DMEM/F12 supplemented 15% knockout replacement serum and 10% DMSO. 17. When replating with excitatory and inhibitory neurons to generate tri-cultures, we suggest using a ratio of 2:1:1 (excitatory iN, inhibitory iN, iAs). 18. Avoiding astrocyte proliferation in the cocultures from days 9 to 21 (final maturation) will allow to keep the proportion of cells plated. GFP-labeled iAs can be generated to better visualize correct spreading of iAs on the coverslip. 19. For extended times, if signs of detachment appear, laminin can be added at 10 μg/ml in one medium change. References 1. Chandrasekaran A et al (2016) Astrocyte differentiation of human pluripotent stem cells: new tools for neurological disorder research. Front Cell Neurosci 10:215 2. Molofsky AV et al (2012) Astrocytes and disease: a neurodevelopmental perspective. Genes Dev 26(9):891–907

3. Sofroniew MV, Vinters HV (2010) Astrocytes: biology and pathology. Acta Neuropathol 119 (1):7–35 4. Barker AJ, Ullian EM (2010) Astrocytes and synaptic plasticity. Neuroscientist 16(1):40–50

148

Ella Quist et al.

5. Allen NJ, Eroglu C (2017) Cell biology of astrocyte-synapse interactions. Neuron 96 (3):697–708 6. Magistretti PJ et al (1999) Energy on demand. Science 283(5401):496–497 7. Almad A, Maragakis NJ (2018) A stocked toolbox for understanding the role of astrocytes in disease. Nat Rev Neurol 14:351–362 8. Fischer G, Kettenmann H (1985) Cultured astrocytes form a syncytium after maturation. Exp Cell Res 159(2):273–279 9. Massa PT, Mugnaini E (1985) Cell-cell junctional interactions and characteristic plasma membrane features of cultured rat glial cells. Neuroscience 14(2):695–709 10. Newman EA, Zahs KR (1997) Calcium waves in retinal glial cells. Science 275 (5301):844–847 11. Parpura V et al (1994) Glutamate-mediated astrocyte-neuron signalling. Nature 369 (6483):744–747 12. Nedergaard M, Ransom B, Goldman SA (2003) New roles for astrocytes: redefining the functional architecture of the brain. Trends Neurosci 26(10):523–530 13. Liddelow SA, Sofroniew MV (2019) Astrocytes usurp neurons as a disease focus. Nat Neurosci 22(4):512–513 14. Hallmann AL et al (2017) Astrocyte pathology in a human neural stem cell model of frontotemporal dementia caused by mutant TAU protein. Sci Rep 7:42991 15. Oberheim NA et al (2009) Uniquely hominid features of adult human astrocytes. J Neurosci 29(10):3276–3287 16. Zhang Y et al (2016) Purification and characterization of progenitor and mature human astrocytes reveals transcriptional and functional differences with mouse. Neuron 89(1):37–53 17. Liu G et al (2020) Advances in pluripotent stem cells: history, mechanisms, technologies, and applications. Stem Cell Rev Rep 16 (1):3–32

18. Canals I et al (2018) Rapid and efficient induction of functional astrocytes from human pluripotent stem cells. Nat Methods 15 (9):693–696 19. Vierbuchen T, Wernig M (2011) Direct lineage conversions: unnatural but useful? Nat Biotechnol 29(10):892–907 20. Zhang Y et al (2013) Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron 78(5):785–798 21. Xu J, Du Y, Deng H (2015) Direct lineage reprogramming: strategies, mechanisms, and applications. Cell Stem Cell 16(2):119–134 22. Flitsch LJ, Laupman KE, Bru¨stle O (2020) Transcription factor-based fate specification and forward programming for neural regeneration. Front Cell Neurosci 14:121 23. Caiazzo M et al (2015) Direct conversion of fibroblasts into functional astrocytes by defined transcription factors. Stem Cell Reports 4 (1):25–36 24. Gao L et al (2019) Mitochondria are dynamically transferring between human neural cells and alexander disease-associated GFAP mutations impair the astrocytic transfer. Front Cell Neurosci 13:316 25. Serio A et al (2013) Astrocyte pathology and the absence of non-cell autonomy in an induced pluripotent stem cell model of TDP-43 proteinopathy. Proc Natl Acad Sci U S A 110(12):4697–4702 26. Nagai M et al (2007) Astrocytes expressing ALS-linked mutated SOD1 release factors selectively toxic to motor neurons. Nat Neurosci 10(5):615–622 27. Jacobs S, Nathwani M, Doering LC (2010) Fragile X astrocytes induce developmental delays in dendrite maturation and synaptic protein expression. BMC Neurosci 11:132 28. Yang N et al (2017) Generation of pure GABAergic neurons by transcription factor programming. Nat Methods 14(6):621–628

Chapter 11 Single Transcription Factor-Based Differentiation Allowing Fast and Efficient Oligodendrocyte Generation via SOX10 Overexpression Katrien Neyrinck and Juan A. Garcı´a-Leo´n Abstract Oligodendrocytes are the main glial cell type in the central nervous system supporting the axonal part of neurons via myelin and lactate delivery. Both the conductive myelin formation and the energy support via lactate can be affected in diseases, such as multiple sclerosis and amyotrophic lateral sclerosis, respectively. Therefore, human disease modeling is needed to gain more mechanistic insights to drive drug discovery research. Here, patient-derived induced pluripotent stem cells (iPSCs) serve as a necessary tool providing an infinite cell source for patient-specific disease modeling, which allows investigation of oligodendrocyte involvement in human disease. Small molecule-based differentiation protocols to generate oligodendrocytes from pluripotent stem cells can last more than 90 days. Here, we provide a transcription factor-based, fast and efficient protocol for generating O4+ oligodendrocytes in just 20–24 days. After a neural induction phase of 8–12 days, SOX10 is overexpressed either with the use of lentiviral vectors or via engineered iPSCs, which inducibly overexpress SOX10 after doxycycline addition. Using this last method, a pure O4+ cell population is achieved after keeping the SOX10-overexpressing neural stem cells in culture for an additional 10 days. Furthermore, these O4+ cells can be co-cultured with iPSC-derived cortical neurons in 384-well format, allowing pro-myelinating drug screens. In conclusion, we provide a fast and efficient oligodendrocyte differentiation protocol allowing both in vitro human disease modeling and a high-throughput co-culture system for drug discovery. Key words Oligodendrocytes, Induced pluripotent stem cells, Differentiation protocol, SOX10, Recombinase-mediated cassette exchange, Neuron-oligodendrocyte co-culture

1

Introduction Oligodendrocytes are the myelinating glial cells in the central nervous system. By providing axons with this multilayered lipid-rich sheet (myelin), action potentials can propagate fast and efficiently along the axons of neurons. Myelin abnormalities are present in patients suffering from demyelinating diseases, like multiple sclerosis and others, which points out the importance of oligodendroglial cells in the central nervous system [1]. In addition to the

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

149

150

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

conductive myelin sheet, oligodendrocytes also provide lactate to the myelinated part of the axons via monocarboxylate transporter 1 (MCT1) to fuel mitochondrial oxidative phosphorylation [2]. This supportive metabolic function is known to be affected in the neurodegenerative disease amyotrophic lateral sclerosis (ALS), as reduced MCT1 levels are observed in oligodendrocytes from these patients [3]. To gain more insights in the exact role of oligodendrocytes in disease and possible drug target discovery, the use of patient-derived induced pluripotent stem cells (iPSCs) serves as a necessary tool [4]. Differentiated iPSCs retain the genetic characteristics of the patient from which they derive, allowing the discovery of cell-type-specific mechanisms implicated in human disease. Several protocols to generate iPSC-derived oligodendrocytes have been developed, which aim to recreate the signaling and cues present during the development of the human brain. In general, all protocols first involve a neural induction phase—mostly via dual SMAD inhibition [5]—together with retinoic acid addition and sonic hedgehog pathway activation to induce a ventralizing cue, as one oligodendrogenic niche is present in the ventral part of the spinal cord, from where oligodendrocyte precursor cells (OPCs) arise. Next, oligodendrocyte-specific growth factors are used to guide further OPC formation and maturation [6, 7]. However, these small molecule-based protocols can last for more than 90 days [8–10]. Therefore, transcription factor overexpression in addition to the use of small molecules can drive and speed up the differentiation process. Previous work by Ehrlich et al. showed that combined lentiviral overexpression of SOX10, OLIG2, and NKX6.2 in neural precursor cells allows the generation of O4+ cells after 28 days with an efficiency of 70% [11]. However, after an extensive lentiviral transcription factor screen, our group showed recently that only SOX10 overexpression is sufficient for O4+ oligodendrocyte generation in a total amount of 20–24 days (10 days from the neural precursor stage) [12]. In addition, we showed the advantage of introducing a doxycycline-inducible SOX10 gene inside the AAVS1 locus via recombinase-mediated cassette exchange (RMCE), to generate a 100% pure O4+ cell population [13]. Via this genome-engineering technique, no insertional mutagenesis is possible and every cell has the capacity to overexpress SOX10 upon doxycycline treatment, resulting in a pure oligodendrocyte population. Moreover, we show the possibility of co-culturing the generated O4+ cells with iPSC-derived cortical neurons in 384-well format to allow drug screening for pro-myelinating factors in a high-throughput way [12]. In short, the generation of oligodendrocytes via overexpression of the single-factor SOX10 involves a neural induction phase via dual SMAD inhibition and retinoic acid exposure for 8 days to mimic neural stem cell formation in the spinal cord. Consecutively,

Fast and Efficient Oligodendrocyte Differentiation Protocol

151

the sonic hedgehog pathway is activated by smoothened agonist as a ventralizing signal [14]. At this point, neural stem cells are generated being already prone for oligodendrocyte formation. In these ventralized neural stem cells, SOX10 is overexpressed either via the use of lentiviral vectors or RMCE-engineered cell lines. Afterward, the cells are cultured for an additional 10 days in differentiation medium containing PDGF-AA, neurotrophin-3, cAMP, biotin, IGF-1, HGF, and triiodo-L-thyronine to drive oligodendrocyte specification. In addition, doxycycline is supplemented to the medium to sustain SOX10 expression. Next, O4+ cell purification is performed by magnetic cell separation (MACS). However, this purification step is not needed when using inducible SOX10 engineered iPSC lines. Lastly, the obtained O4+ cells can co-cultured with maturing iPSC-derived cortical neurons, which are generated via a protocol adapted from Shi et al. [15]. In this way, myelination can be assessed by determining MBP expression as a surrogate of myelin formation. In conclusion, we are able to generate fast and efficiently a pure oligodendrocyte population expressing O4 in a total amount of 20–24 days from iPSC stage. This allows in vitro disease modeling to gain more mechanistic insights for pathologies involving oligodendrocyte dysfunction like multiple sclerosis or amyotrophic lateral sclerosis. Moreover, a high-throughput co-culture system with cortical neurons can be set up, enabling the screen of drug candidates involved in (re)myelination.

2 2.1

Materials Lab Materials

1. FUW-TetO-SOX10 plasmid (Addgene: Catalogue #115242). 2. FUW-TetO-eGFP plasmid (Addgene: Catalogue #115495). 3. FUW-M2rtTA plasmid (Addgene: Catalogue #20342). 4. Packaging plasmid psPAX2 (Addgene: Catalogue #12260). 5. Envelope plasmid pMD2.G (Addgene: Catalogue #12259). 6. pZ:F3-P TetOn 3f-tdT-F plasmid (Addgene: Catalogue # 112668). 7. FLPe-expressing plasmid (pFLPe) (Thermo Scientific). 8. LB agar. 9. Ampicillin. 10. SOC medium. 11. Plasmid Maxiprep Kit. 12. Plasmid Miniprep Kit. 13. Quick Gel Extraction Kit. 14. Gibson Assembly® Cloning Kit.

152

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

15. Human Stem Cell Nucleofector Kit™ 2. 16. 0.05% trypsin-EDTA. 17. Opti-MEM. 18. FuGENE® HD transfection reagent. 19. Phosphate-buffered saline (PBS). 20. Accutase. 21. RevitaCell Supplement. 22. Y-27632 in solution (rock inhibitor). 23. Essential 8™ Flex Medium Kit. 24. mTeSR™1 maintenance medium. 25. hESC-qualified Matrigel. 26. UtraPure™ 0.5 M EDTA pH 8.0. 27. Puromycin dihydrochloride from Streptomyces alboniger: Prepare a stock solution by diluting the powder in PBS until a concentration of 500 ng/μl. Filter the solution using a stericup and aliquot into smaller volumes of approximately 500 μl. Store at
20  C, and once thawed, it can be kept at 4  C for 1 week. Prevent freeze-thaw cycles. 28. Fialuridine (FIAU): Prepare a stock solution by diluting the powder in DMSO until a concentration of 5 mM. Aliquot into smaller volumes of approximately 500 μl. Store at
20  C, and once thawed, it can be kept at 4  C for 1 week. Prevent freezethaw cycles. 29. Doxycycline hyclate: Prepare a stock solution by diluting the powder in PBS until a concentration of 1 mg/ml. Filter the solution using a stericup and aliquot into smaller volumes of approximately 500 μl. Store at
20  C, and once thawed, it can be kept at 4  C for 1 week. Prevent freeze-thaw cycles. 30. Agarose. 31. Tris-acetate-EDTA (TAE) buffer. 32. Competent bacteria. 33. FGF-2. 34. Poly-L-ornithine hydrobromide. 35. Laminin. 36. Dimethyl sulfoxide (DMSO). 37. Profreeze-CDM. 38. Anti-O4 microbeads (Miltenyi). 39. Anti-O4-APC (Miltenyi). 40. Dispase. 41. Paraformaldehyde (PFA).

Fast and Efficient Oligodendrocyte Differentiation Protocol

153

42. BspTI restriction enzyme. 43. MluI restriction enzyme. 44. Master hPSC line containing a FRT-cassette which can be used for RMCE [13]. 2.2 Buffers, Solutions, and Media

All the stock solutions of the cytokines, growth factors, and small molecules should be prepared according to the manufacturer’s instructions and stored in small aliquots at
20  C. Once thawed, they can be either stored at 4  C for 1 week or frozen one more time at
20  C (after which they cannot be stored at 4  C anymore). 1. LB medium: Dissolve 20 g LB broth in 1 l demineralized water and autoclave before use. 2. HEK medium: DMEM with high glucose and GlutaMAX™ Supplement, 10% fetal bovine serum, 1 penicillinstreptomycin, 1 sodium pyruvate. Filter the medium using a 500 ml stericup filter, and store the medium for a maximum time of 1 month at 4  C. 3. Basal medium: DMEM/F-12 with GlutaMAX™ supplemented with 1 N2 supplement, 1 B27 supplement without vitamin A, 25 μg/ml human insulin solution (10 mg/ml stock), 5 μM 2-mercaptoethanol (50 mM stock), 1 MEM nonessential amino acids (NEAA), 1 penicillin-streptomycin. Filter the medium using a 500 ml stericup filter, and store the medium for a maximum time of 1 month at 4  C. 4. MACS buffer: MACS BSA stock solution (Miltenyi) diluted 1/20 in autoMACS Rinsing Solution (Miltenyi). Filter the medium using a 500 ml stericup filter, and store the medium for a maximum time of 1 month at 4  C. 5. Neural Maintenance Medium (NMM): 1:1 mixture of Neurobasal Medium and DMEM/F-12 with GlutaMAX™, supplemented with 0.5 B27 supplement with vitamin A, 0.5 N2 supplement, 0.5 GlutaMAX, 0.5 penicillin-streptomycin, 0.5 MEM nonessential amino acids (NEAA), 5 μg/ml human insulin solution (10 mg/ml stock), 5 μM 2-mercaptoethanol (50 mM stock), 500 μM sodium pyruvate (100 mM stock). Filter the medium using a 500 ml stericup filter, and store the medium for a maximum time of 1 month at 4  C. 6. Day 0 medium: The abovementioned basal medium supplemented with 100 nM retinoic acid (33.2 mM stock), 1 μM LDN-193189 (10 mM stock), and 10 μM SB-431542 (10 mM stock). Filter the medium using a stericup filter of the appropriate volume. This medium should be prepared fresh daily. 7. Day 8 medium: The abovementioned basal medium supplemented with 100 nM retinoic acid (33.2 mM stock) and 1 μM

154

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

smoothened agonist (1 mM stock). Filter the medium using a stericup filter of the appropriate volume. This medium should be prepared fresh daily. 8. Oligodendrocyte medium: The abovementioned basal medium supplemented with 10 ng/ml PDGF-AA (100 μg/ml stock), 10 ng/ml IGF-1 (10 μg/ml stock), 5 ng/ml HGF (10 μg/ml stock), 10 ng/ml NT-3 (100 μg/ml stock), 60 ng/ml T3 (20 μg/ml stock), 100 ng/ml biotin (1 mg/ml stock), and 1 μM db-cAMP (10 mM stock). Filter the medium using a stericup filter of the appropriate volume, and store the medium for a maximum time of 2 weeks at 4  C. 9. Neural induction medium: The abovementioned NMM supplemented with 1 μM LDN-193189 (10 mM stock) and 10 μM SB-431542 (10 mM stock). Filter the medium using a stericup filter of the appropriate volume. This medium should be prepared fresh daily. 10. Co-culture medium: The abovementioned NMM supplemented with 100 ng/ml of biotin (1 mg/ml stock), 1 μM db-cAMP (10 mM stock), 25 μg/ml insulin (10 mg/ml stock), 60 ng/ml T3 (20 μg/ml stock), and 20 μg/ml L-ascorbic acid (200 μM stock). Filter the medium using a stericup filter of the appropriate volume, and store the medium for a maximum time of 2 weeks at 4  C. 2.3

Equipment

1.
80  C freezer. 2.
20  C freezer. 3. 4  C refrigerator. 4. CO2 cell culture incubator. 5. Class II biological safety cabinet. 6. Flow cytometer. 7. Nucleocounter. 8. NanoDrop spectrophotometer. 9. Amaxa Nucleofector device. 10. Warm water bath (37  C). 11. Pipettes. 12. Electronic pipettors. 13. Pipette tips EasyLoad. 14. 5, 10, and 25 ml pipettes. 15. Cell scrapers. 16. 75 cm2/150 cm2 U-shape cell culture flask. 17. 6- and 12-well plates, tissue-culture treated. 18. 10 cm petri dishes.

Fast and Efficient Oligodendrocyte Differentiation Protocol

155

19. 15 and 50 ml Falcon tubes 20. Cryogenic tubes. 21. Mr. Frosty Freezing containers. 22. 5 ml polypropylene round-bottom tubes. 23. Stericup filters (250 and 500 ml). 24. 40 μm cell strainer. 25. Centrifuge that fits for Falcon tubes. 26. 0.45 μm syringe filter. 27. LS columns with plunger (Miltenyi). 28. MACS MultiStand (Miltenyi). 29. MidiMACS Separator (Miltenyi).

3

Methods

3.1 Generation of Inducible SOX10 Lentiviral Particles 3.1.1 Lentiviral Particle Production

Before generating lentiviral particles, inducible lentiviral plasmids need to be created. The plasmids needed for making the lentiviral vectors are FUW-TetO-SOX10 (the transgene that needs to be overexpressed), FUW-M2rtTA (the transactivator needed for doxycycline-inducible overexpression), FUW-TetO-eGFP (used for lentiviral titration), FUW-M2rtTA-eGFP (the FUW-M2rtTA plasmid in which M2rtTA is replaced by eGFP; used for lentiviral titration), psPAX2 (packaging of lentiviral vector), and pMD2.G (enveloping of lentiviral vector). 1. Plate the bacteria containing the plasmid FUW-TetO-SOX10, FUW-TetO-eGFP, FUW-M2rtTA, FUW-M2rtTA-eGFP, psPAX2, or pMD2.G that you received from Addgene on LB-agar supplemented with ampicillin. 2. Incubate at 37  C overnight. 3. Pick bacterial colonies with a sterile pipette tip and inoculate each time a single colony in 3 ml LB medium supplemented with 100 μg/ml ampicillin. The bacterial plates with remaining colonies can be stored at 4  C. 4. Incubate 6 h at 37  C while shaking. 5. Add the bacterial suspension to 200 ml of LB medium supplemented with 100 μg/ml ampicillin. 6. Incubate at 37  C overnight while shaking. 7. Purify the plasmid from the bacterial suspension using a Maxiprep Kit by following the manufacturer’s instructions. Once the plasmids are ready, lentiviral vectors can be created using HEK293T cells.

156

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

8. Culture HEK293T cells in HEK medium using T75 or T150 flasks. 9. Detach the cells by incubating them in 0.05% trypsin for 5 min at 37  C. 10. Add HEK medium (four times the volume of trypsin) to the cells to inactivate the trypsin and collect all the cells in a Falcon tube. 11. Centrifuge at 300  g for 5 min at room temperature (RT). 12. Resuspend the cells to a concentration of 8  105 cells/ml and add 10 ml of cell suspension in a sterile 10 cm petri dish (see Note 1). 13. The next day, HEK293T cells should be 90% confluent to start the transfection. 14. Make for each petri dish the following mixture in a FACS tube: (a) 500 μl OPTIMEM (b) 1.5 μg pMD2.G plasmid (c) 3.5 μg psPAX2 plasmid (d) 6 μg plasmid of interest (FUW-TetO-SOX10, FUW-TetO-eGFP, FUW-M2rtTA, or FUW-M2rtTA-eGFP) (e) 27.5 μl FuGENE (2.5 μl/μg). 15. Incubate the mixture for 20 min at RT. 16. Add each mixture to 10 ml HEK medium, and replace very gently the medium of the HEK293T cells with this mixture. 17. Incubate the cells 6–8 h at 37  C. 18. Remove the medium from the cells. Wash very gently with PBS and add fresh HEK medium on the cells (see Note 2). Incubate the cells for 48 h at 37  C. 19. Collect the cell medium containing the lentiviral vector particles and pass through a 0.45 μm filter. 20. Aliquot in volumes between 200 and 1000 μl and store at
80  C (see Note 3). 3.1.2 Lentiviral Particle Titration

To determine the optimal concentration of the FUW-TetO-SOX10 and FUW-M2rtTA lentiviral vector during the oligodendrocyte differentiation, the FUW-TetO-eGFP and FUW-M2rtTA-eGFP lentiviral vectors are, respectively, used for a titration experiment, assuming that the MOIs of the vectors are similar to their eGFP containing derivatives. This titration is performed on hPSC-derived neural stem cells, which are generated during the first 12 days of the oligodendrocyte differentiation protocol (see Note 4).

Fast and Efficient Oligodendrocyte Differentiation Protocol

157

21. Put a cryogenic vial containing approximately two to three million hPSCs—in colony form—in a warm water bath at 37  C until a small ice crystal is left inside the vial. 22. Add the cells to a Falcon tube containing 10 ml E8 Flex (see Note 5). 23. Centrifuge at 300  g for 5 min at RT. 24. Remove supernatant and resuspend pellet gently in 2 ml E8 Flex containing 1 RevitaCell. Add this cell suspension in a Matrigel-coated well of a 6-well plate. 25. Change the medium the next day to 2 ml E8 flex. From then on, change the medium every other day with 2 ml E8 Flex or 4 ml if you want to avoid medium changes during the weekend. 26. When the hPSCs reach 70–90% confluency, they can be passaged by removing the medium and adding 1 ml of 0.5 mM EDTA on top of the cells for 2 min at RT. 27. Remove the EDTA and add 1 ml E8 Flex on the cells. 28. Loosen the hPSC colonies by using a cell scraper and divide the cells 1:4–1:8 in Matrigel-coated 6-well plates using 2 ml E8 Flex medium per well. 29. The day after passaging the hPSC colonies, change the medium of the cells to mTeSR1. 30. When the cells reach 70–90% confluency, remove mTeSR1 from the cells and add 1 ml Accutase per well for 7–15 min at 37  C. 31. Using a P-1000 pipette, resuspend the cells gently until they become single-cell and collect in a Falcon tube. 32. Wash each well with 2 ml mTeSR1 medium and add to the Falcon tube containing the cells. 33. Centrifuge at 300  g for 5 min at RT. 34. Resuspend the cells in 1 ml mTeSR1 medium supplemented with 1 RevitaCell and count the amount of living cells. 35. Dilute the cells to a concentration of 125,000 cells/ml, and add 2 ml of cell suspension in each Matrigel-coated well of a 6-well plate (see Note 6). 36. Leave the cells for 48 h at 37  C, after which small colonies of hPSCs should be formed. 37. Remove the mTeSR1 medium from the cells and replace with 2 ml/well day 0 medium. This is considered as day 0 of the differentiation. 38. Replace the day 0 medium every day until day 7 of differentiation. Use 2 ml medium/well.

158

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

39. At day 8 of differentiation. Replace the medium with 2 ml day 8 medium. 40. Replace with fresh day 8 medium every day until day 11 of differentiation (see Note 7). 41. At day 11 of differentiation, prepare poly-L-ornithine/laminin coated 12-well plates. Do this by first covering the wells with 0.5 ml of 50 μg/ml poly-L-ornithine (diluted in PBS) for 1–3 h at 37  C. Next, remove the poly-L-ornithine solution and wash the wells with PBS 2–3 times. After this, cover the wells with 0.5 ml of 10 μg/ml laminin at 37  C overnight. 42. At day12 of differentiation, remove the medium and add 1 ml Accutase/well for 7–15 min at 37  C. 43. Gently resuspend the cells using a P-1000 pipette until they become single cells and collect cells in a Falcon tube. 44. Wash each well with 2 ml of basal medium and add to the Falcon tube which contains the cells. 45. Centrifuge at 300  g for 5 min at RT. 46. Resuspend the cells in 1 ml day 8 medium supplemented with 1 RevitaCell. Count the amount of living cells. 47. Dilute the cells to a concentration of 250,000 cells/ml, and add 1 ml of cell suspension in each poly-L-ornithine/laminincoated well of a 12-well plate (see Note 6). 48. The day after seeding the cells in a 12-well plate, dilute the FUW-M2rtTA-eGFP lentiviral vector at 30 μl/ml in day 8 medium. 49. Use this lentiviral vector-containing medium to perform 6 serial 1/5 dilutions, and add the different dilutions on the cell to transduce them (1 dilution/well). Also, leave 1 well untransduced as a negative control. 50. After 16–20 h of incubation, remove the medium from the cells. Wash with PBS and add fresh day 8 medium on the cells. 51. Culture the cells for 2 more days. 52. To detach the cells, incubate them with 1 ml/well of Accutase for 7–15 min at 37  C. 53. Using a P-1000 pipette, resuspend the cells gently until they become single-cell and collect each well in a seperate Falcon tube. 54. Wash each well with 1 ml basal medium and add to the Falcon tube containing the cells. 55. Centrifuge at 300  g for 5 min at RT. 56. Resuspend the cells in 300 μl PBS inside a FACS tube. 57. Use flow cytometry to determine the percentage of eGFP+ cells.

Fast and Efficient Oligodendrocyte Differentiation Protocol

159

Fig. 1 Linear regression method to calculate the concentration of lentiviral vectors to use during oligodendrocyte differentiation. (a) After adding a 1/5 dilution series of FUW-M2rtTA-eGFP lentiviral vectors on neural stem cells, determine GFP expression via flow cytometry after 3 days. Plot the results of the GFP expression for each concentration, and calculate the exact function via linear regression. Now, the viral vector concentration to use can be calculated for obtaining 100% GFP+ cells which corresponds with an MOI ¼ 1. This represents the concentration of FUW-M2rtTA lentiviral vector to be used. (b) Exactly the same is performed for the FUW-TetOeGFP lentiviral vector (in the presence of FUW-M2rtTA to inducibly activate the expression of eGFP from the CMV-tetO promotor), which represents the vector FUW-TetO-SOX10 during the actual differentiation

58. Calculate the lentiviral vector concentration needed in theory to obtain 100% eGFP+ cells which corresponds with an MOI of 1 by using linear regression (Fig. 1). 59. Now, repeat the same titration experiment (steps 48–58) with the FUW-TetO-eGFP lentiviral vector, but include the FUW-M2rtTA lentiviral vector at an MOI of 2 and 1 μg/ml of doxycycline to the culture medium. The presence of both M2rtTA and doxycycline is need to inducibly activate the expression of eGFP from the CMV-tetO promotor. 3.2 RecombinaseMediated Cassette Exchange (RMCE) to Generate DoxycyclineInducible SOX10 Overexpression hPSC Line

To start, the plasmid used for RMCE (Fig. 2) containing the coding sequence (CDS) of SOX10 needs to be generated: 1. Start from the pZ:F3-P TetOn 3f-tdT-F plasmid described in Ordovas et al. [13] (Fig. 3) and in parallel design a gBlock® (IDT) that contains the SOX10 CDS and plasmid overhangs (see Table 1 for the exact sequence). 2. Digest the pZ:F3-P TetOn 3f-tdT-F plasmid to cut out the CDS of tdT with BspTI and MluI using the optimal conditions specified by the Double Digest calculator of ThermoFisher Scientific.

160

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

Fig. 2 Recombinase-mediated cassette exchange to implement a gene of interest (GOI) in the AAVS1 locus. (a) First the FRT-containing cassette with a GFP coding sequence, a hygromycin resistance gene, and the coding sequence for thymidine kinase are inserted in the AAVS1 locus via the use of ZFNs. (b) Second, a cassette containing your gene of interest can be exchanged with the FRT-containing cassette by the use of FLPe recombinase. (Adapted from [13])

Fig. 3 Starting plasmid for recombinase-mediated cassette exchange. For inducible overexpression of your gene (tdT in this case), a tetracycline responsive element (TRE) is added upstream. In addition, m2rtTA will be constitutively expressed from a CAGGS promotor. (Adapted from [13])

3. Load the digestion product on a 1% agarose gel (diluted in 1 TAE buffer) for 30 min at 200 V. 4. Two bands at 9 kb and 1.4 kb should be visible. Cut out the largest band (9 kb), which contains the core of the plasmid, and purify the DNA by using the Gel Extraction Kit according to the manufacturer’s instructions. 5. Measure the DNA concentration using a NanoDrop spectrophotometer. 6. Set up the following reaction to include the SOX10-containing gBlock®:

Fast and Efficient Oligodendrocyte Differentiation Protocol

161

Table 1 SOX10 CDS with pZ:F3-P TetOn 3f-tdT-F plasmid overhang sequences (in bold) cagagctcgtttagtgaaccgtcagatcgcttaaggccaccATGGCGGAGGAGCAGGACCTATCGGAGGTGGAGCT GAGCCCCGTGGGCTCGGAGGAGCCCCGCTGCCTGTCCCCGGGGAGCGCGCCCTCGCTA GGGCCCGACGGCGGCGGCGGCGGATCGGGCCTGCGAGCCAGCCCGGGGCCAGGCGAG CTGGGCAAGGTCAAGAAGGAGCAGCAGGACGGCGAGGCGGACGATGACAAGTTCCCCG TGTGCATCCGCGAGGCCGTCAGCCAGGTGCTCAGCGGCTACGACTGGACGCTGGTGCC CATGCCCGTGCGCGTCAACGGCGCCAGCAAAAGCAAGCCGCACGTCAAGCGGCCCATG AACGCCTTCATGGTGTGGGCTCAGGCAGCGCGCAGGAAGCTCGCGGACCAGTACCCGC ACCTGCACAACGCTGAGCTCAGCAAGACGCTGGGCAAGCTCTGGAGGCTGCTGAACGAA AGTGACAAGCGCCCCTTCATCGAGGAGGCTGAGCGGCTCCGTATGCAGCACAAGAAAGA CCACCCGGACTACAAGTACCAGCCCAGGCGGCGGAAGAACGGGAAGGCCGCCCAGGGC GAGGCGGAGTGCCCCGGTGGGGAGGCCGAGCAAGGTGGGACCGCCGCCATCCAGGCC CACTACAAGAGCGCCCACTTGGACCACCGGCACCCAGGAGAGGGCTCCCCCATGTCAGA TGGGAACCCCGAGCACCCCTCAGGCCAGAGCCATGGCCCACCCACCCCTCCAACCACCC CGAAGACAGAGCTGCAGTCGGGCAAGGCAGACCCGAAGCGGGACGGGCGCTCCATGGG GGAGGGCGGGAAGCCTCACATCGACTTCGGCAACGTGGACATTGGTGAGATCAGCCAC GAGGTAATGTCCAACATGGAGACCTTTGATGTGGCTGAGTTGGACCAGTACCTGCCGCC CAATGGGCACCCAGGCCATGTGAGCAGCTACTCAGCAGCCGGCTATGGGCTGGGCAGT GCCCTGGCCGTGGCCAGTGGACACTCCGCCTGGATCTCCAAGCCACCAGGCGTGGCTC TGCCCACGGTCTCACCACCTGGTGTGGATGCCAAAGCCCAGGTGAAGACAGAGACCGCG GGGCCCCAGGGGCCCCCACACTACACCGACCAGCCATCCACCTCACAGATCGCCTACAC CTCCCTCAGCCTGCCCCACTATGGCTCAGCCTTCCCCTCCATCTCCCGCCCCCAGTTTG ACTACTCTGACCATCAGCCCTCAGGACCCTATTATGGCCACTCGGGCCAGGCCTCTGGC CTCTACTCGGCCTTCTCCTATATGGGGCCCTCGCAGCGGCCCCTCTACACGGCCATCTC TGACCCCAGCCCCTCAGGGCCCCAGTCCCACAGCCCCACACACTGGGAGCAGCCAGTA TATACGACACTGTCCCGGCCCTAAacgcgtgggggaggctaactgaaacacgga

(a) Purified plasmid core: 100 ng. (b) gBlock double-stranded DNA insert: 40 ng. (c) Gibson Assembly Master Mix: 10 μl. (d) Add nuclease-free water until total volume of 20 μl. 7. Incubate at 50  C for 1 h. 8. To transform the reaction product inside the competent bacteria; first thaw the competent bacteria on ice. 9. Add 5 μl of reaction product to 50 μl of competent bacteria for 30 min on ice. 10. Perform a heat shock by incubating the mixture for 40 s at 42  C followed by a 2-min incubation on ice. 11. Add 300 μl SOC medium to the competent bacteria that have taken up the plasmid, and incubate at 37  C for 30–120 min while shaking. 12. Plate the bacteria-containing solution on LB-agar supplemented with ampicillin. 13. Incubate at 37  C overnight while shaking.

162

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

14. For each plasmid, pick three bacterial colonies with a sterile pipette tip, add a few bacteria on a new LB-agar plate with ampicillin, and put the tip that contains the rest of the bacteria in 3 ml LB medium supplemented with 100 μg/ml ampicillin. Store the new bacterial plates you created at 4  C. 15. Incubate the LB-bacteria mixture overnight at 37  C while shaking. 16. The next morning, isolate the plasmid DNA form the bacteria by using the miniprep kit according to the manufacturer’s instructions. 17. Validate the insertion of SOX10 CDS in each construct by Sanger sequencing using the following primers:t (a) SOX10 CDS forward CAAGTTCCCCGT-30 .

1:

50 -

GACGATGA

(b) SOX10 CDS reverse 1: 50 - CTTGTAGTGGGCCTG GATGG-30 . (c) SOX10 CDS forward GACTTCGG-30 .

2:

50 - AAGCCTCACATC

(d) SOX10 CDS reverse 2: 50 - TAGGGTCCTGAGGGCT GATG-30 . 18. From the construct that contains the correct sequence, expand the bacterial colonies and purify the DNA by following steps 3–7 described in Subheading 3.1.1. Once, the pZ:F3-P TetOn 3f-SOX10-F plasmid is generated, it can be inserted via RMCE inside the AAVS1 locus of the master cell line: 19. Thaw and culture the master hPSC line containing the FRT cassette as described in Subheading 3.1.2, steps 21–28. 20. When the cells reach 70–90% confluency, change the medium to 2 ml/well mTeSR1 supplemented with 2 μl/ml rock inhibitor at least 1 h before nucleofection. 21. Prepare in a sterile 1.5 ml tube a mix of 2 μg FLPe-containing plasmid and 5–8 μg pZ:F3-P TetOn 3f-SOX10-F plasmid (max. volume of 10 μl). 22. Remove mTeSR1 from the cells and add 1 ml Accutase per well for 7–15 min at 37  C. 23. Using a P-1000 pipette, resuspend the cells gently until they become single cell and collect in a Falcon tube containing 10 ml E8 Flex medium. 24. Take an aliquot of the cells to count them, and centrifuge the rest of cells at 300  g for 5 min at RT. 25. Remove supernatant and resuspend the cells in 1 ml/million cells of PBS.

Fast and Efficient Oligodendrocyte Differentiation Protocol

163

26. Transfer 1.5 ml of cells (corresponding with 1.5 million cells) to a separate falcon tube (see Note 8). 27. Centrifuge at 300  g for 5 min at RT. 28. Remove supernatant and resuspend cells gently in 100 μl transfection solution from the hESC Nucleofector Solution Kit 2. 29. Transfer the cell solution to the tube containing both FLPe plasmid and pZ:F3-P TetOn 3f-SOX10-F plasmid. Mix gently and avoid generating air bubbles. 30. Transfer the cell-plasmid mix to the transfector cuvette without generating air bubbles and introduce the cuvette into the Nucleofector. 31. Apply program A13 (for cells cultured on feeders) or F16 (for cells cultured feeder-free). 32. Take the cuvette out of the Nucleofector machine, and aspirate very gently the cells with 500 μl mTeSR1 supplemented with 2 μl/ml rock inhibitor by using a sterile Pasteur pipette. 33. Dropwise distribute the cells from the Pasteur pipette into a Matrigel-coated well of a 6-well plate filled with 1.5 ml mTeSR1 medium supplemented with 2 μl/ml rock inhibitor. 34. The next day, change the medium to E8 Flex supplemented with 1 RevitaCell. 35. Perform daily medium changes with E8 Flex, and when small colonies are starting to form, the selection can start. 36. When small colonies are starting to form, start puromycin selection by replacing the medium with E8 Flex supplemented with 120 ng/ml puromycin. 37. Increase the concentration of puromycin every day with blocks of 20–50 ng/ml until a concentration of 250 ng/ml is reached (see Note 9). 38. Once a concentration of 250 ng/ml is reached, change the medium to E8 Flex supplemented with 0.5 μM fialuridine (FIAU). Change the medium daily and maintain FIAU for no more than 7 continuous days (see Note 10). 39. The living hPSCs colonies that remain after both puromycin and FIAU selection have inserted the pZ:F3-P TetOn 3f-SOX10-F plasmid. This can be checked via flow cytometry as the master cell line contained GFP, which has disappeared after the RMCE process. 3.3 Differentiation of hPSCs Toward O4+ Early Oligodendrocytes

1. Thaw and culture the hPSCs as described in Subheading 3.1.2, steps 21–28. 2. Generate NSCs as described in Subheading 3.1.2, steps 29–47.

164

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

3. At this stage, the cells—which are neural stem cells—can be frozen into cryogenic tubes in day 8 medium supplemented with 1 RevitaCell and 10% of DMSO. First, store the cryogenic tubes containing the cells in a Mr. Frosty Freezing container at
80  C overnight. Next, store the cells at
170  C. 4. (a) When differentiating cells that have the SOX10 transgene integrated in the AAVS1 locus via a doxycycline-inducible manner: Remove the medium at day 13 and replace with 1 ml/well of oligodendrocyte medium supplemented with 3 μg/ml doxycycline to induce SOX10 expression. Replace with fresh oligodendrocyte medium every other day for the next 10–15 days (see Note 11). (b) When differentiating cells via lentiviral overexpression of SOX10: Remove the medium and replace with 1 ml/well of the same fresh medium supplemented with SOX10- and rtTA lentiviral vector at the optimal concentration calculated beforehand during the viral titration experiment (see Note 2). For this transduction, an MOI of 1.5 for both vectors is suggested. After 16–20 h incubation, wash the wells with PBS and replace the medium with 1 ml/well of oligodendrocyte medium supplemented with 1 μg/ml doxycycline to induce SOX10 expression. Replace the medium every other day for the next 10–15 days. 5. After approximately 7 days of SOX10 overexpression, early oligodendrocytes are becoming visible, which can be identified as individual cells that take up more space in the culture dish (Fig. 4). After 10–15 days of SOX10 overexpression, O4+ cells can be collected and frozen.

Fig. 4 Representative image of O4+ cells generated at day 24 of the oligodendrocyte differentiation protocol. Microscopic picture with 20 magnification at day 24 of the oligodendrocyte differentiation. Red arrows indicate the O4+ cells that are being formed

Fast and Efficient Oligodendrocyte Differentiation Protocol 3.3.1 MACS Purification

165

If cells were differentiated via lentiviral SOX10 overexpression, first O4+ cells need to be purified via magnetic cell separation. This purification step is not needed when using the genome-engineered cells as a 100% pure population is generated. 1. Remove medium and add 0.5 ml of Accutase to each well for 7–15 min at 37  C. 2. Gently resuspend the cells using a P-1000 pipette until they become single cells and collect cells in a Falcon tube. 3. Wash each well with 1 ml of basal medium and add to the Falcon tube which contains the cells. 4. Centrifuge at 300  g for 5 min at RT. 5. Resuspend in MACS buffer: 90 μl/107 cells (see Note 12). 6. Add 10 μl of O4-binding microbeads per 90 μl MACS buffer and mix. 7. Incubate 15–30 min at 4  C. 8. Add 3 ml MACS buffer and centrifuge at 300  g for 5 min at RT. 9. Resuspend in 1 ml MACS buffer and filter the cells through a pre-wet 40 μm nylon filter to get rid of all the cell clumps (see Note 13). 10. Put an LS column inside the MACS separator and wash the column with 3 ml of MACS buffer. 11. When all the MACS buffer went through the column, add the cell suspension on top, and add three times 3 ml of MACS buffer on the column. 12. Remove the column from the MACS separator and place it in a 15 ml Falcon tube. 13. Add two times 5 ml of MACS buffer inside the column, and each time push the buffer together with cells through the column by using a plunger. Now the O4+ cells are collected in the 15 ml Falcon tube (see Note 14). 14. Centrifuge at 300  g for 5 min at RT. 15. Resuspend the cells in 1 ml oligodendrocyte medium supplemented with the optimized concentration of doxycycline (see Note 11).

3.3.2 Cryopreservation of O4+ Cells

1. If genome-engineered cells were used for differentiation, cells need to be detached first using Accutase as described in steps 1–4 of Subheading 3.3.1 and resuspended in oligodendrocyte medium supplemented with the optimized concentration of doxycycline (see Note 11). 2. Count the living cells.

166

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

3. Dilute the cell suspension 1/2 in Profreeze medium supplemented with 15% DMSO and add into a cryogenic tube. First leave the cells overnight at
80  C in Mr. Frosty Freezing containers. The next day, transfer the cryogenic vials containing the cells to
170  C for long-time storage. 3.4 Generation of Cortical Neurons and Co-culturing with Early Oligodendrocytes

To allow the O4+ early oligodendrocytes to mature further and to be able to assess myelination, they need to be co-cultured together with neurons. 1. Thaw, culture, and seed normal, non-gene-edited hPSCs as described in Subheading 3.1.2, steps 21–35. The only difference is to seed 2.5 million cells per well of a 6-well plate. 2. Change to fresh mTeSR1 medium the next day (2 ml/well). 3. The following day, change the medium to neural induction medium. This is considered day 0 of the differentiation. 4. Replace with fresh neural induction medium daily until day 10 of differentiation (see Note 15). 5. At day 11, the cells need to be passaged using dispase to purify the neural rosettes. For this, 1 ml of medium is removed from the cells (6-well plate) and 100 μl of dispase is added to the cells. 6. Incubate 3 min at 37  C. 7. Break down the neuroepithelial cell sheet by gently pipetting up and down, using a P-1000 pipette, and collect the cells in a Falcon tube containing approximately 10 ml of NMM (see Note 16). 8. Wait 3–5 min to allow the cell clumps to sink toward the bottom of the Falcon tube. 9. Remove the supernatant and again add 10 ml of NMM. 10. Repeat steps 7–9 three times and afterwards plate the cell clumps 1:2 to a Matrigel-coated 6-well plate in NMM supplemented with 20 ng/ml FGF-2. 11. This dispase procedure (steps 5–10) needs to be repeated two more times. Perform these two dispase steps when cells have reached >80% confluency (3–5 days after the previous passaging with dispase). Also, use NMM medium without FGF-2 addition and passage the cells 1:1 during these two dispase steps. 12. At day 30–33 of differentiation, cells can be cryopreserved by loosening the cells with Accutase and resuspending them into a cryogenic vial in NMM supplemented with 20 ng/ml FGF-2, 10% DMSO, and 1 RevitaCell. 13. The day 30–33 neuroprogenitor cells are cultured for an additional 20 days in NMM with medium changes every other day. During these 20 days, cells can be passaged 1:2 using Accutase (see Note 17).

Fast and Efficient Oligodendrocyte Differentiation Protocol

167

14. At day 50 of differentiation, remove the medium from the cells and add 1 ml Accutase per well for 7–15 min at 37  C. 15. Using a P-1000 pipette, resuspend the cells gently until they become single-cell and collect in a Falcon tube. 16. Wash each well with 2 ml of NMM and add to the Falcon tube containing the cells. 17. Centrifuge at 300  g for 5 min at RT. 18. Resuspend the cells in 1 ml NMM and count the amount of living cells. 19. Plate 50,000 cells/cm2 in poly-L-ornithine/laminin coated wells using NMM (see Note 18). 20. Culture the cells for 10–14 days using NMM until neural network formation becomes visible. 21. At this point, the O4+ early oligodendrocytes can be added to the cortical neurons. Either freshly differentiated cells or cryopreserved cells can be used. 22. Centrifuge the O4+ cells at 300  g for 5 min and resuspend in co-culture medium supplemented with 1 RevitaCell and 10 μg/ml laminin. 23. Add 50,000 cells/cm2 to the cortical neurons. This density should be optimized for every different cell line used. 24. After 3 h (when cells are attached), add 1 μg/ml doxycycline to the co-culture medium. 25. Keep the cells in culture for at least 10 days using the co-culture medium, by performing half medium changes (remove half amount of the medium and add the same amount of fresh medium) to avoid cell detachment. The first 6 days supplement the medium with 1 μg/ml doxycycline. 26. Fix the co-culture for future immunostainings with 4% PFA for 8–15 min at RT. Afterward, remove the PFA solution and add PBS on the cells.

4

Notes 1. Depending on the amount of lentiviral vector you want to make, you can seed HEK cells in more petri dishes. From 1 petri dish, you can collect 10 ml of lentiviral vectors, which can be used at a concentration of approximately 20 μl/ml (this is an estimation based on own lab experience, and the exact concentration needs to be assessed via a titration experiment). 2. From this moment, you should work in dedicated biological safety II cabinets avoiding the cross-contaminations of cells

168

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

with and without lentiviral vectors. Cells should be cultured in dedicated and isolated cabinets before moving to “clean” cabinets. 3. Always thaw lentiviral vectors on ice. Before adding them to a cell culture, gently pipette the aliquot of viral vectors up and down using a P-1000 pipette. Do not freeze-thaw the aliquot of lentiviral vector suspension. 4. An alternative way to decide which concentration of lentiviral vectors to use during the oligodendrocyte differentiation protocol is to perform the differentiation protocol as explained in Subheading 3.3, by using a dilution series of FUW-M2rtTA lentiviral vector against a dilution series of FUW-TetO-SOX10 lentiviral vector. At the end of differentiation, flow cytometry, using an anti-O4-APC antibody, can be performed. Use the combination of lentiviral vector concentrations that generates the highest amount of APC—and thus O4—expressing cells. 5. When you are working with hPSCs in colony form, do not resuspend using a P-1000 pipette as this will break up the colonies. Always use a larger 5 ml pipette. 6. During the oligodendrocyte differentiation protocol, a singlecell seeding step is performed two times (at day
2 and day 12). For each different cell line, seeding densities need to be optimized. The optimal seeding density at day
2 is achieved when cells reached 100% confluency around day 4 or day 5 of differentiation (Fig. 5). At day 12 of differentiation, seeding density depends on whether SOX10 overexpression is lentiviral-mediated or via RMCE-edited iPSC lines. For lentiviral SOX10 overexpression at day 13, small groups of three to ten cells should be visible, as a lower cell amount will not tolerate the lentiviral vector stress (Fig. 5). If SOX10 is overexpressed from the AAVS1 locus, a lower amount of cells can be seeded as they can be attached single-cell (not in groups) (Fig. 5). 7. Alternatively, at day 5 of neural induction, 1 μM of smoothened agonist can be added to the day 0 medium until day 8 of

Fig. 5 Representative microscopic pictures during oligodendrocyte differentiation. To optimize seeding densities at the start (day
2) and day 12 of differentiation, representative microscopic pictures are shown

Fast and Efficient Oligodendrocyte Differentiation Protocol

169

differentiation. At day 8, the cells can be seeded exactly as would be performed on day 12 of differentiation. 8. Different cell amounts can be seeded when performing a nucleofection. As cell attachment at a single-cell level can vary from cell line to cell line. 9. During the puromycin selection, it is possible to passage the cells when they reach 70–90% confluency. 10. Another—more cautious—way to perform the FIAU selection is to expose the cells for 1 day. Afterward change the medium to E8 Flex and let the cells recover for 3–5 days (cell death will only become visible after 48 h). Next, GFP expression can be assessed via flow cytometry to check which percentage of the cells has undergone RMCE. If more than 10% of the cells are still expressing GFP, the previous steps can be repeated until GFP-negative cells are obtained. 11. For every cell line used for oligodendrocyte differentiation via SOX10 overexpression from the AAVS1 locus, the doxycycline concentration needs to be optimized. For this, perform the differentiation as usual, and add different concentrations of doxycycline (ranging between 0.5 and 7 μg/ml) to the cells at day 13 (three wells of a 12-well plate per condition!3 technical replicates). Continue the differentiation as usual, and assess at the end via flow cytometry the percentage of O4+ cells. Use the doxycycline concentration that generates between 90% and 100% O4+ cells. 12. Use the same MACS buffer for only 1 month. Always keep MACS buffer cold (approximately at 4  C) during the entire purification procedure. However, do not freeze MACS buffer, as ice crystals will obstruct the MACS columns. 13. If you are collecting a high amount of cells (>50  106 cells), resuspend in a higher volume of MACS buffer to dilute the cells further and avoid clump formation. In addition, use cells of approximately two full 12-well plates for 1 MACS column (more will increase the chance of obstructing the column). Use more columns when necessary. 14. To assess the purity of O4+ cells after MACS purification, flow cytometry can be performed by using an anti-O4-APC antibody. 15. If the cell sheet is becoming dense and the medium colors yellow the next day, the volume of medium per well can be increased to 5 ml (6-well plate). Also, perform the medium changes gently, as the cell sheet can detach. 16. During the dispase steps, pipette very gently to avoid disrupting the cell clumps that represent the neural rosettes.

170

Katrien Neyrinck and Juan A. Garcı´a-Leo´n

17. The culturing period of 20 days can be flexible. Culturing the cells between 10 and 30 days (so day 40–60 neurons are generated) is also possible. 18. This co-culture system can be applied in a high-throughput system (96- or 384-well plate). When using a 96-well format, 5000 cortical neurons per well need to be seeded. For 384-well plates, 2000 neurons per well are sufficient. References 1. Trapp BD, Nave K (2008) Multiple sclerosis: an immune or neurodegenerative disorder? Annu Rev Neurosci 31:247–269 2. Philips T, Rothstein JD (2017) Oligodendroglia: metabolic supporters of neurons. J Clin Invest 127(9):3271–3280 3. Lee Y, Morrison BM, Li Y, Lengacher S, Farah MH, Hoffman PN et al (2012) Oligodendroglia metabolically support axons and contribute to neurodegeneration. Nature 487 (7408):443–448 4. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K et al (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131 (5):861–872 5. Chambers SM, Fasano CA, Papapetrou EP, Tomishima M, Sadelain M, Studer L (2009) Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol 27(3):275–280 6. Goldman SA, Kuypers NJ (2015) How to make an oligodendrocyte. Development 142 (23):3983–3995 7. Gaspard N, Vanderhaeghen P (2010) Mechanisms of neural specification from embryonic stem cells. Curr Opin Neurobiol 20(1):37–43 8. Wang S, Bates J, Li X, Schanz S, Chandlermilitello D, Levine C et al (2013) Clinical progress progenitor cells can myelinate and rescue a mouse model of congenital hypomyelination. Stem Cell 12(2):252–264 9. Livesey MR, Magnani D, Cleary EM, Vasistha NA, James OT, Selvaraj BT et al (2016) Maturation and electrophysiological properties of

human pluripotent stem cell-derived oligodendrocytes. Stem Cells 34(4):1040–1053 10. Douvaras P, Wang J, Zimmer M, Hanchuk S, O’Bara MA, Sadiq S et al (2014) Efficient generation of myelinating oligodendrocytes from primary progressive multiple sclerosis patients by induced pluripotent stem cells. Stem Cell Reports 3(2):250–259 11. Ehrlich M, Mozafari S, Glatza M, Starost L, Velychko S, Hallmann A-L et al (2017) Rapid and efficient generation of oligodendrocytes from human induced pluripotent stem cells using transcription factors. Proc Natl Acad Sci 114(11):E2243–E2252 12. Garcı´a-Leo´n JA, Kumar M, Boon R, Chau D, One J, Wolfs E et al (2018) SOX10 single transcription factor-based fast and efficient generation of oligodendrocytes from human pluripotent stem cells. Stem Cell Reports 10 (2):655–672 13. Ordova´s L, Boon R, Pistoni M, Chen Y, Wolfs E, Guo W et al (2015) Efficient recombinase-mediated cassette exchange in hPSCs to study the hepatocyte lineage reveals AAVS1 locus-mediated transgene inhibition. Stem Cell Reports 5(5):918–931 14. Marti E, Bumcrot DA, Takada R, Mcmahon AP (1995) Requirement of 19K form of Sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature 375 (May):322–325 15. Shi Y, Kirwan P, Livesey FJ (2012) Directed differentiation of human pluripotent stem cells to cerebral cortex neurons and neural networks. Nat Protoc 7(10):1836–1846

Chapter 12 Transcriptional Profiling During Neural Conversion Yohannes Afeworki, Hannah Wollenzien, and Michael S. Kareta Abstract The processes that underlie neuronal conversion ultimately involve a reorganization of transcriptional networks to establish a neuronal cell fate. As such, transcriptional profiling is a key component toward understanding this process. In this chapter, we will discuss methods of elucidating transcriptional networks during neuronal reprogramming and considerations that should be incorporated in experimental design. Key words Neuronal conversion, Induced neurons, Transcriptional profiling, RNA-seq

1

Introduction Cellular reprogramming is a powerful process that harnesses the potential of the genome to alter a cell’s identity. Typically, the direct conversion process involves the transfer of cDNAs, mRNAs, or proteins that harbor master regulator activities or small molecules that influence master regulator function to a differentiated cell type to drive the conversion of that cell to one of a different lineage, without going through a pluripotent intermediate. This approach utilizes the existing genetic material in a cell to lead to transcriptomic changes that drive cell fate conversion. One of the first and best-studied systems for understanding direct conversion is the formation of induced neuronal (iN) cells. Reported in 2010 from the lab of Marius Wernig, the first account of fully functional iN cells being induced from mouse fibroblasts used a three-factor reprogramming cocktail [1]. Since then, a number of groups have recapitulated this process, with slightly different combinations of factors and culture conditions using both human and mouse differentiated cells as source material [1–9]. Generally, reprogramming of iN cells is defined and characterized by a number of morphological, molecular, and functional parameters [7]; however, given that the factors supplied to drive reprogramming are often transcriptional regulators such as Ascl1, transcriptional profiling should serve as a powerful tool for the understanding of transcriptional

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

171

172

Yohannes Afeworki et al.

states of these cells [5, 6, 10, 11]. Transcriptomic profiling of reprogrammed cells allows for the understanding of the complex transcriptomic changes that occur during cell fate switching, aids in understanding lineage hierarchies, and identifies transcriptional targets of the reprogramming factors. A powerful player in the field of transcriptomic profiling, RNA sequencing served for many years as the foremost technique in understanding gene expression at a tissue level. In this method of bulk transcriptomics, the expression of all RNAs in the cellular population is sequenced and used to generate an expression profile of the sample, allowing for the evaluation of transcriptional networks that are activated or repressed during the reprogramming process [12]. Bulk RNA sequencing at various time points throughout the reprogramming process has been used to uncover lineage pathways that emerge as these cells are reprogrammed [13]. The transcriptomic data gained from bulk RNA sequencing can be used to determine in an unbiased manner the fate of reprogrammed cells and illuminate the intermediate states that were traversed during reprogramming [10, 14, 15]. While bulk RNA sequencing is an important tool for understanding the transcriptome of iN cells, it does not account for the heterogeneity of cellular populations that occurs in tissues or during the reprogramming process. Bulk approaches average the contribution of the transcriptome of all the cells, which can lead to the masking of rare populations within the sample. An emergent powerhouse in transcriptomic analysis, single-cell RNA sequencing (scRNA-seq) instead evaluates the transcriptome of each individual cell in a population and, using complex bioinformatics tools, can stratify individual populations of cells within a sample to determine a more complete picture of the state of these cells. Using scRNAseq, we have the ability to evaluate differential gene expression within a sample, draw lineage maps, and identify rare or novel populations [16–18]. scRNA-seq has been used in the field of iN differentiation and has helped to identify the transcriptional networks that “prime” a cell for differentiation and create a comprehensive profile of transcriptional reprogramming states [19]. Using scRNA-seq to uncover the lineage path and single-cell transcriptomes regulated at various time points throughout reprogramming has led to the comprehensive characterization of clonal populations and heterogeneity present during iN reprogramming [5]. While scRNA sequencing is a powerful tool for transcriptional profiling, due to its high sensitivity, special considerations must be taken to ensure analysis faithfully recapitulates the biological phenotypes [16, 18, 20]. This protocol will describe the general methods and considerations that should be considered in the transcriptomic analysis of iN transcriptome analysis. Due to the wide variety of methods to prepare samples for transcriptomic analysis, and since many of these involve the use of proprietary kits with established protocols,

Transcriptional Profiling During Neural Conversion

173

we will instead focus on the sample design considerations and downstream data analysis in regard to understanding the changes in the transcriptome during neuronal reprogramming.

2

Materials 1. Basic RNA-extraction methods such as Trizol to isolate RNA for bulk RNA-seq or scRNA-seq library preparation platforms such as a 10 Chromium Controller (10 Genomics, Pleasanton, CA, USA) or a Fluidigm C1 system (Fluidigm, South San Francisco, CA, USA). 2. Large computational resources that run on a Unix environment for most command-line software. An installation of R is required for many computational tools and can be run in a Unix, Windows, or iOS environment [21].

3

Methods

3.1 Bulk RNA-Seq of Reprogrammed Cells

Study designs in cell reprogramming typically involve time course sampling to monitor changes in expression profile as cell differentiation progresses. A minimum of three replicate samples from each time point is required for statistically reasonable results. For studies involving bulk RNA-seq, differential gene expression analysis is typically followed by downstream pathway enrichment analysis. Bioinformatics analysis pipeline is depicted in Fig. 1, and the details of the steps involved are provided below:

RNA-seq reads

Quality assessment (Fastqc)

Trimming (Trimmomatic)

Read mapping (STAR)

Per gene read count (STAR, Rsubread)

Differential expression analysis (DESeq2)

Fig. 1 Analysis pipeline for bulk RNA-seq

Enrichment analysis (Goseq)

174

Yohannes Afeworki et al.

(a) Checking the quality of sequencing. Raw reads from sequencer are typically in the form of fastq format and come in general with adapter sequences clipped. Nevertheless, it is a good practice to first do quality assessment of the reads and check for presence of adapter contamination. The most commonly used tool for quality is FASTQC [22] and for trimming Trimmomatic [23]. (b) Alignment to reference genome. There are several widely used packages for alignment of reads to the reference genome, including Hisat2 [24] and STAR [25]. (c) Read counting. Reads mapping to genomic regions (genes) are counted using several commonly used packages such as featurecounts in Rsubread package [26] and HTseq-count [27]. STAR aligner has “quantoMode” option in the mapping stage that counts reads. (d) Differential gene expression. A full statistical model of expression in relation to condition and time points and their interaction (Expression ~ Condition + Time + Time * Condition) and a reduced model (Expression ~ Condition + Time) are run in DESeq2 [28]. Then, a likelihood ratio test between the full and reduced models evaluates changes in expression between conditions at any time points beyond the first. This can be followed by clustering analysis to identify groups of genes that share a similar expression profile in time. Other packages that are frequently used and have capabilities for the two abovementioned tests are EdgeR [29] and limma [30]. An alternative approach is to model expression as a continuous function of time to find genes that show significant difference in their pattern or to cluster genes based on their similarity of expression trajectory in time. The R packages maSigPro [31] and ImpulseDE2 [32] perform well for identifying significant changes in time and between conditions. The python package DPGP (Dirichlet process Gaussian process mixture model) can be used to identify groups of genes with similar temporal trajectory [33]. (e) Gene set enrichment. Pathway analysis in RNA-seq data is primarily done using the hypergeometric test, evaluating overrepresentation of pathways given the differentially expressed genes. However, there is a length bias in the probability of being differentially expressed (DE), which is inherent in RNAseq data. This combined with the difference in length distribution of genes within pathways leads to a bias in enrichment analysis. The result is that pathways that are disproportionately composed of large genes will more likely be declared enriched in all conditions, making the analysis lack specificity to the condition being investigated. By controlling for gene length,

Transcriptional Profiling During Neural Conversion

175

the package GOseq [34] yields enrichment results that are more relevant to the study at hand. Commonly used and publicly available gene sets include the Gene Ontology Consortium [35, 36], the Kyoto Encyclopedia of Genes and Genomes (KEGG) [37], and a collection of gene sets at the Broad Institute [38]. 3.2 Single-Cell Transcriptomic Analysis of Neuronal Conversion

Singe-cell RNA-seq data suffers from high technical variability that arises during sample processing. This can be minimized by ensuring that multiple biological replicates are mixed in each batch [39]. Cells within batches are later assigned to samples based on unique genotypes, for example, using Demuxlet [40]. scRNA-seq analysis pipeline is different from the bulk RNA-seq in the preprocessing stages and in the statistical analysis of the expression data. scRNA-seq data is typically multiplexed with unique identifiers provided for each cell and sometimes for individual transcripts. Preprocessing steps are thus required to assign reads to their respective unique cells. Subsequent steps are similar to bulk RNA-seq analysis. Statistical analysis of scRNA data initially is a classification problem with the objective being to find unique groupings of the cells based on their similar expressions. Once groupings are identified, differential expression tests between groups are used to find unique markers for each unique cell group. Bioinformatics analysis pipeline is depicted in Fig. 2, and the details of the steps involved are provided below: (a) Demultiplexing of reads. Many sequencers supply individual fastq files for each sample/cell. In some cases, one fastq file containing all cell barcodes and sample mapping is provided. In this case, demultiplexing tools such as Sabre [41], UmiTools [42], and zUmi [43] are used to allocate reads to their respective samples, strip the barcode and UMI from the reads, and create individual fastq files for each cell. (b) Alignment to reference genome. Unlike bulk RNA-seq, scRNAseq dataset comprises thousands of cells. As a result, the mapping step requires fast algorithms to get results in reasonable time. STAR and Kallisto are the two fast aligners that are routinely used in scRNA-seq data analysis [25, 44]. (c) Quality control of cells. Indicators of poor quality cells include prevalence of large number of mitochondrial genes and very low or very large numbers of genes [45]. Prevalence of mitochondrial genes is an indicator that the cell was not viable. Very low number of detected genes implies that the starting material is an empty droplet. While large number of genes implies multiple cells in a droplet. To retain good quality cells based on the above criteria, it is best practice to explore each dataset and find outlier cells to remove from the dataset.

176

Yohannes Afeworki et al. RNA-seq reads

Quality assessment (Fastqc)

Demultiplexing (zUMI, cellranger, umitools)

Alignment (STAR, Kallisto)

Read count (STAR, Rsubread)

Quality control of cells

Unsupervised clustering (Seurat)

Marker identification

Identification of cell types (labelling)

Temporal progression (Monocle)

Fig. 2 Analysis pipeline for scRNA-seq

The R package Seurat [46] has procedures to explore and visualize the distribution of the number of genes and percentage mitochondrial genes. These can be used to set cutoff points relevant to the data at hand. Good quality cells also tend to have higher mapping rate, lower number of duplicates, and lower ERCC spike-in to exonic read count ratio [45]. Since these metrics are likely to differ from study to study, a reasonable approach is to explore their distribution (e.g., distribution of number of unique mappers) across all cells and remove cells that are outliers [e.g., see ref. 47]. (d) Normalization. Choice of normalization along with the library preparation method has the biggest effect on the downstream analysis of differential expression in scRNA-seq

Transcriptional Profiling During Neural Conversion

177

data [48]. Normalization methods developed for bulk RNAseq data are usually not appropriate for scRNA-seq data [49]. Methods developed for scRNA-seq include BASiCS [50], GRM [51], SCnorm [52], and Scran [53]. Using simulated data, Vallejos et al. [49] and Vieth et al. [48] evaluated bulk-based and scRNA-specific methods and found that Scran and SCnorm provided a better normalization with stable number of highly variable genes for clustering. The widely used scRNA analysis package Seurat has built-in log-normalization methods. For robust results, data is first normalized using methods specific to scRNA such as Scran or SCnorm. The normalized data can then be fed into popular scRNA tools such as Seurat. (e) Clustering of cells. Unsupervised clustering methods and dimension reduction techniques are combined to partition cells into distinct groups based on distance. Among the dimension reduction techniques typically used are principal component analysis (PCA), tSNE, and UMAP. These also are critical in data visualizations on lower number of dimensions for assessing cell clusters. (f) Marker gene identification and labeling. Once the unique cells are identified, tests are conducted to find marker genes that are differentially expressed in each group in contrast to the others. The AllMarkers function in Seurat (R package) conducts DE test and has options for different types of tests including negative binomial as in DEseq2. To label the cell types, marker genes from each cell type are compared with markers from known cells. Where available, correlation analysis between the identified cell types and gene expression data from known cell types or from bulk RNA-seq data from tissues enriched with cells of interest can be used as a strong indicator of cell identity. One can also conduct pathway enrichment analysis for each identified cell type to determine their putative functions. Confidence on the identity of the cell types can be strengthened if evidence from presence of markers, high correlation, and presence of cell-specific pathways is combined. (g) Ordering of cells based on expression trajectory. There is a large selection of methods for ordering of cells based on the progression of their expression [54]. The choice of which methods to use depends on the kind of trajectory one is looking for, i.e., linear, cyclic, or tree. In their extensive evaluation of 29 different methods, Saelens et al. [54] found that methods perform well in correctly detecting trajectories they were originally designed for. Based on their results, the authors provide a practical guideline for choosing an appropriate tool. For example, reCAT [55] outperforms other methods when the underlying trajectory is a cycle, while Monocle DDRTree [56–

178

Yohannes Afeworki et al.

58], Slingshot [59], and TSCAN [60] perform well if the underlying trajectory is a more complex branching tree. Slingshot and TSCAN perform well when the underlying trajectory is a bifurcation. For discovering linear trajectories, SCOR PIOUS [61] performs better. Besides finding the trajectory, some of these tools provide functions to find genes that cause bifurcation (Slingshot) or show marked changes along the trajectory, e.g., Monocle DDRTree, Slingshot, and TSCAN. A recently developed tool, tradeSeq [62], can be used downstream of the above packages to detect differential expression of genes along a lineage or between lineages. Using general additive models, tradeSeq fits gene expression as a continuous function of pseudotime, which affords flexibility in identifying marker genes at different points. (h) Elucidating differentially regulated genetic networks. Pathway enrichment analysis in scRNA is conducted similarly as in bulk RNA-seq data using the package GOseq [34]. Pathway enrichment analysis on marker genes of each unique cell type can help to highlight differences in function between cells. Similarly, pathways enriched in genes that cause bifurcation events or genes that show significant changes along lineages can be identified. In these cases, these biological processes are the putative causes of the branching events or the differentiation of the cells.

Acknowledgments This work was supported by an Institutional Development Award (IDeA) from the National Institute of General Medical Sciences of the National Institutes of Health under grant number P20GM103620 (to M.K. and Y.T.) and by the National Institutes of Health grant number R01CA233661 supported by the National Cancer Institute and the National Institute of General Medical Sciences (to M.K.). References 1. Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Sudhof TC, Wernig M (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463 (7284):1035–1041. https://doi.org/10. 1038/nature08797; nature08797 [pii] 2. Ambasudhan R, Talantova M, Coleman R, Yuan X, Zhu S, Lipton SA, Ding S (2011) Direct reprogramming of adult human fibroblasts to functional neurons under defined conditions. Cell Stem Cell 9(2):113–118. https:// doi.org/10.1016/j.stem.2011.07.002

3. Marro S, Pang ZP, Yang N, Tsai MC, Qu K, Chang HY, Sudhof TC, Wernig M (2011) Direct lineage conversion of terminally differentiated hepatocytes to functional neurons. Cell Stem Cell 9(4):374–382. https://doi. org/10.1016/j.stem.2011.09.002 4. Pang ZP, Yang N, Vierbuchen T, Ostermeier A, Fuentes DR, Yang TQ, Citri A, Sebastiano V, Marro S, Sudhof TC, Wernig M (2011) Induction of human neuronal cells by defined transcription factors. Nature 476

Transcriptional Profiling During Neural Conversion (7359):220–223. https://doi.org/10.1038/ nature10202 5. Treutlein B, Lee QY, Camp JG, Mall M, Koh W, Shariati SA, Sim S, Neff NF, Skotheim JM, Wernig M, Quake SR (2016) Dissecting direct reprogramming from fibroblast to neuron using single-cell RNA-seq. Nature 534 (7607):391–395. https://doi.org/10.1038/ nature18323 6. Tsunemoto R, Lee S, Szucs A, Chubukov P, Sokolova I, Blanchard JW, Eade KT, Bruggemann J, Wu C, Torkamani A, Sanna PP, Baldwin KK (2018) Diverse reprogramming codes for neuronal identity. Nature 557 (7705):375–380. https://doi.org/10.1038/ s41586-018-0103-5 7. Yang N, Ng YH, Pang ZP, Sudhof TC, Wernig M (2011) Induced neuronal cells: how to make and define a neuron. Cell Stem Cell 9 (6):517–525. https://doi.org/10.1016/j. stem.2011.11.015 8. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR (2011) MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476 (7359):228–231. https://doi.org/10.1038/ nature10323 9. Chanda S, Ang CE, Davila J, Pak C, Mall M, Lee QY, Ahlenius H, Jung SW, Sudhof TC, Wernig M (2014) Generation of induced neuronal cells by the single reprogramming factor ASCL1. Stem Cell Reports 3(2):282–296. https://doi.org/10.1016/j.stemcr.2014.05. 020 10. Lin M, Lachman HM, Zheng D (2016) Transcriptomics analysis of iPSC-derived neurons and modeling of neuropsychiatric disorders. Mol Cell Neurosci 73:32–42. https://doi. org/10.1016/j.mcn.2015.11.009 11. Tekin H, Simmons S, Cummings B, Gao L, Adiconis X, Hession CC, Ghoshal A, Dionne D, Choudhury SR, Yesilyurt V, Sanjana NE, Shi X, Lu C, Heidenreich M, Pan JQ, Levin JZ, Zhang F (2018) Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons. Nat Biomed Eng 2(7):540–554. https://doi.org/10.1038/ s41551-018-0219-9 12. Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10(1):57–63. https:// doi.org/10.1038/nrg2484 13. Wapinski OL, Vierbuchen T, Qu K, Lee QY, Chanda S, Fuentes DR, Giresi PG, Ng YH, Marro S, Neff NF, Drechsel D, Martynoga B, Castro DS, Webb AE, Sudhof TC, Brunet A, Guillemot F, Chang HY, Wernig M (2013)

179

Hierarchical mechanisms for direct reprogramming of fibroblasts to neurons. Cell 155 (3):621–635. https://doi.org/10.1016/j.cell. 2013.09.028 14. Hjelm BE, Salhia B, Kurdoglu A, Szelinger S, Reiman RA, Sue LI, Beach TG, Huentelman MJ, Craig DW (2013) In vitro-differentiated neural cell cultures progress towards donoridentical brain tissue. Hum Mol Genet 22 (17):3534–3546. https://doi.org/10.1093/ hmg/ddt208 15. Stein JL, de la Torre-Ubieta L, Tian Y, Parikshak NN, Hernandez IA, Marchetto MC, Baker DK, Lu D, Hinman CR, Lowe JK, Wexler EM, Muotri AR, Gage FH, Kosik KS, Geschwind DH (2014) A quantitative framework to evaluate modeling of cortical development by neural stem cells. Neuron 83 (1):69–86. https://doi.org/10.1016/j.neu ron.2014.05.035 16. Kulkarni A, Anderson AG, Merullo DP, Konopka G (2019) Beyond bulk: a review of single cell transcriptomics methodologies and applications. Curr Opin Biotechnol 58:129–136. https://doi.org/10.1016/j. copbio.2019.03.001 17. Stark R, Grzelak M, Hadfield J (2019) RNA sequencing: the teenage years. Nat Rev Genet 20(11):631–656. https://doi.org/10.1038/ s41576-019-0150-2 18. Hwang B, Lee JH, Bang D (2018) Single-cell RNA sequencing technologies and bioinformatics pipelines. Exp Mol Med 50(8):96. https://doi.org/10.1038/s12276-018-00718 19. Nguyen QH, Lukowski SW, Chiu HS, Senabouth A, Bruxner TJC, Christ AN, Palpant NJ, Powell JE (2018) Single-cell RNA-seq of human induced pluripotent stem cells reveals cellular heterogeneity and cell state transitions between subpopulations. Genome Res 28(7):1053–1066. https://doi.org/10. 1101/gr.223925.117 20. Ziegenhain C, Vieth B, Parekh S, Reinius B, Guillaumet-Adkins A, Smets M, Leonhardt H, Heyn H, Hellmann I, Enard W (2017) Comparative Analysis of Single-Cell RNA Sequencing Methods. Mol Cell 65(4):631–643. e634. https://doi.org/10.1016/j.molcel.2017.01. 023 21. Core Team R (2017) R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna. https://www.R-project.org/ 22. Andrews S (2010) FastQC: a quality control tool for high throughput sequence data. Babraham Institute. http://www.bioinformatics. babraham.ac.uk/projects/fastqc

180

Yohannes Afeworki et al.

23. Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30 (15):2114–2120. https://doi.org/10.1093/ bioinformatics/btu170 24. Kim D, Langmead B, Salzberg SL (2015) HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12(4):357–360. https://doi.org/10.1038/nmeth.3317 25. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29(1):15–21. https:// doi.org/10.1093/bioinformatics/bts635 26. Liao Y, Smyth GK, Shi W (2019) The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res 47(8): e47. https://doi.org/10.1093/nar/gkz114 27. Anders S, Pyl PT, Huber W (2015) HTSeq—a Python framework to work with highthroughput sequencing data. Bioinformatics 31(2):166–169. https://doi.org/10.1093/ bioinformatics/btu638 28. Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15(12):550. https://doi.org/10.1186/ s13059-014-0550-8 29. Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26 (1):139–140. https://doi.org/10.1093/bioin formatics/btp616 30. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK (2015) limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43 (7):e47. https://doi.org/10.1093/nar/ gkv007 31. Nueda MJ, Tarazona S, Conesa A (2014) Next maSigPro: updating maSigPro bioconductor package for RNA-seq time series. Bioinformatics 30(18):2598–2602. https://doi.org/10. 1093/bioinformatics/btu333 32. Fischer DS, Theis FJ, Yosef N (2018) Impulse model-based differential expression analysis of time course sequencing data. Nucleic Acids Res 46(20):e119. https://doi.org/10.1093/nar/ gky675. PubMed PMID: 30102402; PMCID: PMC6237758 33. McDowell IC, Manandhar D, Vockley CM, Schmid AK, Reddy TE, Engelhardt BE (2018) Clustering gene expression time series data using an infinite Gaussian process mixture model. PLoS Comput Biol 14(1):e1005896.

https://doi.org/10.1371/journal.pcbi. 1005896 34. Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol 11 (2):R14. https://doi.org/10.1186/gb-201011-2-r14 35. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G (2000) Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25(1):25–29. https://doi.org/10.1038/75556 36. Gene Ontology Consortium (2004) The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res 32(Supplemental 1):D258–D261 37. Kanehisa M, Goto S (2000) KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 28(1):27–30. https://doi.org/10. 1093/nar/28.1.27 38. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102(43):15545–15550. https://doi.org/10.1073/pnas.0506580102 39. Hicks SC, Townes FW, Teng M, Irizarry RA (2018) Missing data and technical variability in single-cell RNA-sequencing experiments. Biostatistics 19(4):562–578. https://doi.org/10. 1093/biostatistics/kxx053 40. Kang HM, Subramaniam M, Targ S, Nguyen M, Maliskova L, McCarthy E, Wan E, Wong S, Byrnes L, Lanata CM, Gate RE, Mostafavi S, Marson A, Zaitlen N, Criswell LA, Ye CJ (2018) Multiplexed droplet singlecell RNA-sequencing using natural genetic variation. Nat Biotechnol 36(1):89–94. https:// doi.org/10.1038/nbt.4042 41. Nowosad J, Stepinski T (2018) Spatial association between regionalizations using the information-theoretical V-measure. Int J Geogr Inf Sci 32(12):2386–2401. https:// doi.org/10.1080/13658816.2018.1511794 42. Smith T, Heger A, Sudbery I (2017) UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res 27 (3):491–499. https://doi.org/10.1101/gr. 209601.116

Transcriptional Profiling During Neural Conversion 43. Parekh S, Ziegenhain C, Vieth B, Enard W, Hellmann I (2018) zUMIs—a fast and flexible pipeline to process RNA sequencing data with UMIs. bioRxiv:153940. https://doi.org/10. 1101/153940 44. Bray NL, Pimentel H, Melsted P, Pachter L (2016) Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol 34 (5):525–527. https://doi.org/10.1038/nbt. 3519 45. Ilicic T, Kim JK, Kolodziejczyk AA, Bagger FO, McCarthy DJ, Marioni JC, Teichmann SA (2016) Classification of low quality cells from single-cell RNA-seq data. Genome Biol 17:29. https://doi.org/10.1186/s13059016-0888-1 46. Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM 3rd, Hao Y, Stoeckius M, Smibert P, Satija R (2019) Comprehensive integration of single-cell data. Cell 177(7):1888–1902.e1821. https://doi.org/ 10.1016/j.cell.2019.05.031 47. Kumar RM, Cahan P, Shalek AK, Satija R, DaleyKeyser A, Li H, Zhang J, Pardee K, Gennert D, Trombetta JJ, Ferrante TC, Regev A, Daley GQ, Collins JJ (2014) Deconstructing transcriptional heterogeneity in pluripotent stem cells. Nature 516(7529):56–61. https://doi.org/10.1038/nature13920 48. Vieth B, Parekh S, Ziegenhain C, Enard W, Hellmann I (2019) A systematic evaluation of single cell RNA-seq analysis pipelines. Nat Commun 10(1):4667. https://doi.org/10. 1038/s41467-019-12266-7 49. Vallejos CA, Risso D, Scialdone A, Dudoit S, Marioni JC (2017) Normalizing single-cell RNA sequencing data: challenges and opportunities. Nat Methods 14(6):565–571. https://doi.org/10.1038/nmeth.4292 50. Vallejos CA, Marioni JC, Richardson S (2015) BASiCS: Bayesian analysis of single-cell sequencing data. PLoS Comput Biol 11(6): e1004333. https://doi.org/10.1371/journal. pcbi.1004333 51. Ding B, Zheng L, Zhu Y, Li N, Jia H, Ai R, Wildberg A, Wang W (2015) Normalization and noise reduction for single cell RNA-seq experiments. Bioinformatics 31 (13):2225–2227. https://doi.org/10.1093/ bioinformatics/btv122 52. Bacher R, Chu LF, Leng N, Gasch AP, Thomson JA, Stewart RM, Newton M, Kendziorski C (2017) SCnorm: robust normalization of single-cell RNA-seq data. Nat Methods 14 (6):584–586. https://doi.org/10.1038/ nmeth.4263

181

53. Lun AT, McCarthy DJ, Marioni JC (2016) A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor. F1000Res 5:2122. https://doi.org/10. 12688/f1000research.9501.2 54. Saelens W, Cannoodt R, Todorov H, Saeys Y (2019) A comparison of single-cell trajectory inference methods. Nat Biotechnol 37 (5):547–554. https://doi.org/10.1038/ s41587-019-0071-9 55. Liu Z, Lou H, Xie K, Wang H, Chen N, Aparicio OM, Zhang MQ, Jiang R, Chen T (2017) Reconstructing cell cycle pseudo time-series via single-cell transcriptome data. Nat Commun 8 (1):22. https://doi.org/10.1038/s41467017-00039-z 56. Trapnell C, Cacchiarelli D, Grimsby J, Pokharel P, Li S, Morse M, Lennon NJ, Livak KJ, Mikkelsen TS, Rinn JL (2014) The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat Biotechnol 32(4):381–386. https:// doi.org/10.1038/nbt.2859 57. Qiu X, Hill A, Packer J, Lin D, Ma YA, Trapnell C (2017) Single-cell mRNA quantification and differential analysis with Census. Nat Methods 14(3):309–315. https://doi.org/10.1038/ nmeth.4150 58. Qiu X, Mao Q, Tang Y, Wang L, Chawla R, Pliner HA, Trapnell C (2017) Reversed graph embedding resolves complex single-cell trajectories. Nat Methods 14(10):979–982. https:// doi.org/10.1038/nmeth.4402 59. Street K, Risso D, Fletcher RB, Das D, Ngai J, Yosef N, Purdom E, Dudoit S (2018) Slingshot: cell lineage and pseudotime inference for single-cell transcriptomics. BMC Genomics 19 (1):477. https://doi.org/10.1186/s12864018-4772-0 60. Ji Z, Ji H (2016) TSCAN: pseudo-time reconstruction and evaluation in single-cell RNA-seq analysis. Nucleic Acids Res 44(13):e117. https://doi.org/10.1093/nar/gkw430 61. Cannoodt R, Saelens W, Sichien D, Tavernier S, Janssens S, Guilliams M, Lambrecht B, Preter KD, Saeys Y (2016) SCORPIUS improves trajectory inference and identifies novel modules in dendritic cell development. bioRxiv:079509. https://doi.org/ 10.1101/079509 62. Van den Berge K, Roux de Bezieux H, Street K, Saelens W, Cannoodt R, Saeys Y, Dudoit S, Clement L (2020) Trajectory-based differential expression analysis for single-cell sequencing data. Nat Commun 11(1):1201. https:// doi.org/10.1038/s41467-020-14766-3

Chapter 13 Functional Assessment of Direct Reprogrammed Neurons In Vitro and In Vivo Srisaiyini Kidnapillai and Daniella Rylander Ottosson Abstract Direct reprogramming is an emerging research field where you can generate neurons from a somatic cell, such as a skin or glial cell by overexpressing neurogenic transcription factors. This technique allows fast generation of subtype-specific and functional neurons from both human and mouse cells. Despite the fact that neurons have been successfully generated both in vitro and in vivo, a more extensive analysis of the induced neurons including phenotypic functional identity or gradual maturity is still lacking. This is an important step for a further development of induced neurons towards cell therapy or disease modeling of neurological diseases. In this protocol, we describe a method for functional assessment of direct reprogrammed neuronal cells both in vitro and in vivo. Using a synapsin-driven reporter, our protocol allows for a direct identification of the reprogrammed neurons that permits functional assessment using patch-clamp electrophysiology. For in vitro reprogramming we further provide an optimized coating condition that allows a long-term maturation of human induced neurons in vitro. Key words iNs, Regeneration, Stem cells, Transdifferentiation, Glia, Direct conversion, Fibroblast, AAV, Lentivirus, GFP reporter, Striatum, Intracerebral injections, Action potential, Postsynaptic activity, iPSC

1

Introduction The human brain lacks the substantial ability to produce new neurons during adulthood. Therefore, exogenous cell resources are essential for any potential restoration of impaired or lost neurons such as that in neurological disorders. Various sources such as primary tissue, stem cells, and reprogrammed cells have been extensively explored for generating human neurons over the years [1–3], and many advances have been made in the field following the pioneering findings of Takahashi and Yamanaka, which demonstrated that simply the overexpression of four transcription factors

The original version of this chapter was revised. The correction to this chapter is available at https://doi.org/ 10.1007/978-1-0716-1601-7_18 Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021, Corrected Publication 2022

183

184

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

was able to reprogram somatic cells into induced pluripotent stem cells (iPSCs) [4]. Independent of the cell source for generating neurons, cell reprogramming strategies provide alternate avenues for both disease modeling and personalized cell therapy of neurological disorders [1, 3]. One of the recent advances is direct reprogramming that allows somatic cells such as skin or glial cells to be directly reprogrammed into functional neurons without passing through a pluripotent intermediate state [5, 6]. This permits the generation of induced neurons (iNs) in situ in the brain by targeting resident cells with viral vectors and thereby provides an attractive method for brain repair in patients with neurological diseases [1, 7]. Various neuronal subtypes have today been derived using direct reprogramming for both mouse and human cells [8–12]. Even though several reports have shown successful reprogramming in different brain regions using both human and mouse somatic cells as starting population [5, 6, 9, 11, 13, 14], the precise phenotype or functionality of iNs has not yet been explored in detail. Before considering iNs for cell therapy or disease modeling, the detailed functionality of iNs must be determined and compared to appropriate controls. In order to understand the function of a neuron and its surrounding connections, physiological properties of transmembrane voltages and currents can be assessed with electrophysiology [15]. The development of experimental electrophysiology dates back to the seventeenth century [16, 17], but it was not until Neher and Sakmann developed a tool named patch clamp that the electrical activity of neurons could be recorded with glass micropipettes [18–20]. Patch-clamp electrophysiology has made a tremendous impact on neuroscience and allows the phenotypic characterization [21], synaptic input, and the functional maturity (Fig. 3) of neurons by the measurements of membrane intrinsic properties, action potentials (AP) and firing patterns, presence of voltage-gated sodium and potassium currents, and spontaneous postsynaptic activity. Moreover, electrophysiological technique can be combined with cell-specific stimulation, e.g., optogenetics, morphological analysis, and recently developed single-cell sequencing, i.e., Patch-seq, in order to assess the full nature of neurons and their surrounding brain circuits. Notably, patch-clamp electrophysiology constitutes an essential tool for assessing the all these parameters also from newly derived neurons generated from stem-cell or cell reprogramming techniques [22]. In here we demonstrate a protocol to assess the functional aspects of iNs derived from in vitro and in vivo reprogramming (Fig. 1). We have optimized the functional assessments of human iNs using specific long-term coating conditions for in vitro culture and established a cell-specific labeling to distinguish iNs from the surrounding cells [23, 24]. Our method uses a synapsin-GFP lentiviral promoter for in vitro condition that not only increases the

Functional Assessment of iN

185

Fig. 1 Overview of direct reprogramming in vivo and in vitro and functional assessments of iN. For in vivo reprogramming Cre-transgenic mice are intracerebrally injected with AAV viral vectors containing reprogramming factors and Syn-GFP. Resident glia cells (Cre positive) will allow reprogramming into GFP+ iNs that can be selected and patched for functional assessments in brain tissue sections. For in vitro reprogramming human (or mouse) somatic cells, e.g., skin fibroblasts, are targeted using lentiviral vector containing reprogramming factors and Syn-GFP. Cells convert cells into GFP+ iNs in long-term cell cultures that can be functionally assessed using patch-clamp electrophysiology. iNs induced neurons, AAV adeno-associated virus, Syn synapsin, GFP green fluorescent protein

throughput of the electrophysiological assessment by selecting only the mature (synapsin-expressing) neurons but also provides a proof of concept of a successful conversion. For in vivo reprogramming in the brain, we describe a synapsin-driven FLEX GFP reporter to identify reprogrammed neurons for functional assessment [25] (Fig. 1).

2

Materials

2.1 Lentiviral Production

1. Biosafety cabinet.

2.1.1 Equipment

3. Ultracentrifuge: Beckman Optima LE-80K.

2. Humidified 5% CO2 37
C incubator. 4. Beckman Rotor: SW32 Ti. 5. Ultra-Clear™ Centrifuge Tubes: Beckman Coulter. 6. T175 flasks. 7. Centrifuge for 1.5 mL tubes. 8. Filter 0.22 μm. 9. Quantitative polymerase chain reaction (qPCR): Roche, LightCycler® 480 System.

186

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

2.1.2 Reagents

1. HEK293T cells. 2. 293T medium: DMEM (Dulbecco’s Modified Eagle Medium) Glutamax, 10% FBS, Penicillin–Streptomycin. 3. Transfection mixture (per batch): Packaging plasmids (7.5 μg pMDL (Addgene, 12251), 3.9 μg psRev (Addgene, 12253), 5.5 μg pMD2G (Addgene, 12259)), transfer vector (GFP-Syn, Addgene, 30456), 102–132 μL polyethylenimine (1 μg/μL, Polysciences, 23966), 3.5 mL 293T medium. 4. Dulbecco’s Phosphate Buffered Saline (DPBS). 5. Trypsin-EDTA (0.5%): dilute to 0.05% in DPBS. 6. DNeasy Blood and Tissue Kit. 7. Albumin primers: Forward primer (TGAAACATACGTTCCC AAAGAGTTT), reverse primer (CTCTCCTTCTCAGAAA GTGTGCATAT), probe (50 Fam-TGCTGAAACATTCA 0 CCTTCCATGCAGA-Tamra 3 ). 8. WPRE primers: Forward primer (GGCACTGACAATTCCG TGGT), reverse primer (AGGGACGTAGCAGAAGGACG), probe (50 Fam-ACGTCCTTTCCATGGCTGCTCGC0 Tamra-3 ). 9. PCR mastermix per reaction: 0.95 M of forward primer, 0.95 M of reverse primer, 0.7 M TaqMan probe, and ddH2O.

2.2 AdenoAssociated Virus (AAV) Production 2.2.1 Equipment

1. Biosafety cabinet. 2. Humidified 5% CO2 37
C incubator. 3. T175 flasks. 4. Ultracentrifuge: Beckman Optima LE-80K. 5. Beckman Rotor: SW32 Ti. 6. Ultra-Clear™ Centrifuge Tubes: Beckman Coulter (344058). 7. Filter 0.22 μm. 8. Centrifuge: Thermo Fisher Scientific (Sorvall ST16). 9. Vortex mixer. 10. Polymerase chain reaction (PCR) thermal cycler. 11. Quantitative PCR (qPCR): Roche, LightCycler® 480 System.

2.2.2 Reagents

1. pAAV-CA-FLEX: Addgene (38042). 2. GFP-Syn: Addgene (30456). 3. LoxP (FLEX) sequence 1: GATCTccataacttcgtataaagtatcctat acgaagttatatcaaaataggaagaccaatgcttcaccatcgacccgaattgccaagcat caccatcgacccataacttcgtataatgtatgctatacgaagttatactagtcccgggaag gcgaagacgcggaagaggctctaga. 4. LoxP (FLEX) sequence 2: tactagtataacttcgtataggatactttatacg aagttatcattgggattcttcctattttgatccaagcatcaccatcgaccctctagtccacat

Functional Assessment of iN

187

ctcaccatcgacccataacttcgtatagcatacattatacgaagttatgtccctcgaagag gttcgaattcgtttaaacGGTACCTCGAC. 5. Milli-Q water. 6. AAV transfection mixture: Add equimolar quantities of vector plasmid and pDG series helper plasmids (Plasmid Factory; pDP5 (PF435), pDP6 (PF436)) with a total amount of 72 μg per T175 flask. Add Tris-EDTA buffer (TE buffer, 10 mM Tris–HCl), 1 mM EDTA to a final volume of 144 μL. Top up with Milli-Q to a final volume of 1296 μL and mix. To this mixture, add 144 μL of 2.5 M CaCl2 and mix. Then, add 1.92 μL of HEPES Buffered Saline (1.5 mM Na2HPO4,140 mM NaCl, 50 mM HEPES) to the DNA solution and vortex. Leave the AAV transfection mixture at RT for 1 min before adding to 239T medium. 7. Endotoxin-free plasmid DNA isolation kits. 8. Ultracentrifuge Sealing Tubes: Beckman Coulter, Quick-Seal® Polypropylene Tube. 9. Lysis buffer: 50 mM Tris–HCl pH 8.5, 150 mM NaCl, 1 mM MgCl2. 10. Iodixanol Elution (IE) buffer: 20 mM Tris–HCl pH 8.0, 15 mM NaCl. 11. Elution buffer: 20 mM Tris–HCl pH 8.0, 250 mM NaCl. 12. OptiPrep™ Density (D1556-250ML).

Gradient

Medium:

Sigma-Aldrich

13. 10 mL syringe-18G needle: BD (305064). 14. Anion exchange filter: PALL Laboratory (MSTG25Q6). 15. Centrifugal filter unit: Merck (Z740210-24EA). 16. Glass vials: Novatech (30209.1232). 17. Forward primer for inverted terminal repeat (ITR) sequence: CGGCCTCAGFGAGCGA. 18. Reverse primer for inverted terminal repeat (ITR) sequence: GGAACCCCTAGTGATGGAGTT. 19. 50 FAM/30 BHQ1 probe: Jena Bioscience, CACTCCCTCTC TGCGCGCTCG. 20. Filter 0.22 μm. 2.3

Cell Culture

2.3.1 Equipment

1. Laminar flow hood. 2. Humidified 5% CO2 37
C incubator. 3. Glass coverslips: NeuVitro (GG-12-1.5-oz). 4. Sonicator: Bransonic Model B200 cleaner. 5. Sterile 24-well plates. 6. Orbital shaker.

188

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

2.3.2 Reagents

1. Poly-L-ornithine. 2. Fibronectin. 3. Laminin. 4. Dulbecco’s Phosphate Buffered Saline (DPBS). 5. 95% ethanol. 6. 70% nitric acid. 7. Concentrated hydrochloric acid. 8. Milli-Q water.

2.4 Electrophysiology

1. A patch-clamp rig equipped with Clampfit and MultiClamp software: Molecular Devices.

2.4.1 Equipment

2. Borosilicate glass pipettes with filament: Sutter Instrument (B150-86-10), 100 mm long with 1.5 mm outer and 0.86 mm inner diameters. 3. Glass capillary puller: Sutter Instrument (P-1000). 4. Vibratome: Leica (VT1000 S). 5. Water bath. 6. Inverted fluorescence microscope.

2.4.2 Solutions

1. 10 stock Krebs solution or artificial cerebrospinal fluid (ACSF; for in vitro recordings): Dissolve 119 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4·H2O, 2.5 mM CaCl2·6H2O, and 1.3 mM MgSO4·7H2O dissolved in 1 L Milli-Q water. To make 1 Ringer solution, mix 2.18 mM NaHCO3 and 4.95 mM glucose with 100 mL of the 10 Krebs solution, and top up to 1 L with Milli-Q water. 2. 10 Krebs solution/ACSF (for in vivo recordings): Dissolve 126 mM NaCl, 2.5 mM KCl, 1.2 mM NaH2PO4·H2O, 1.3 mM MgCl2·6H2O, and 2.4 mM CaCl2·6H2O dissolved in 1 L Milli-Q water. To make 1 Ringer solution, mix 1.85 mM NaHCO3 and 2 mM glucose with 100 mL of the 10 Krebs solution, and top up to 1 L with Milli-Q water. 3. Bubble the 1 Ringer solution with a 95% O2 to 5% CO2 gas mixture for at least 1 h. Adjust the pH to 7.4 with KOH and maintain osmolarity between 290 and 310 mOsm. For tissue preparation (perfusion, dissection, and cutting), make sure the 1 Ringer solution is ice-cold. For recording of tissue sections or cell culture, keep Ringer at room temperature (RT) or 35–37
C if needed. 4. Intracellular solution (for current-clamp recordings): Dissolve 122.5 mM K-D-gluconate, 12.5 mM KCl, 0.2 mM EGTA, 10 mM HEPES, 8 mM NaCl, 2 mM MgATP, and 0.3 mM

Functional Assessment of iN

189

Na3GTP in 100 mL Milli-Q water on ice. Adjust the pH to 7.3 with KOH. Aliquot in 1.5 mL tubes and store at 20
C until use. 5. Biocytin filling: Dissolve 1 mg biocytin (epsilon-biotinoyl-Llysine, Mw 372.48 g/mol, Sigma-Aldrich) in 1 mL of intracellular solution, vortex, and filter before use. 6. Picrotoxin: Dissolve picrotoxin (Mw 602.59 g/mol, Merck) in 5 mL DMSO (Sigma-Aldrich; D2438) to make 100 mM stock solution, aliquot in small volumes, and store in the freezer until use. For recordings use 50 μM final concentration in Krebs solution. 7. NBQX: The molecular weight of NBQX (Abcam Biochemicals) varies between batches, and therefore, dissolve the required amount of NBQX to make 5 mM stock solution. Aliquot in small volumes and store in the freezer until use. For recordings use 5 μM final concentration in Krebs solution. 8. D-AP5: Dissolve D-AP5 (Mw 197.13 g/mol, Abcam Biochemicals) in 0.1 M NaOH to make a 0.1 M stock solution. Aliquot in small volumes and store in the freezer until use. For recordings use 50 μm final concentration in Krebs solution. 9. 4% PFA solution (paraformaldehyde, Mw 30.03 g/mol, Merck Millipore (1040051000)): In a chemical hood, heat 500 mL of 0.2 M NaOH to 60
C on a heating block, and add 40 g of PFA. Stir gently until the PFA is dissolved. To this mixture, add 380 mL of 0.2 M Na2HPO4 (Na2HPO4·2H2O, Mw 177.99 g/mol, Sigma-Aldrich) and 120 mL of 0.2 M NaH2PO4 (NaH2PO4·H2O, Mw 137.99 g/mol, SigmaAldrich) to make up to 1 L and mix well. Once it cools down, filter the solution and adjust the pH to 7.4. Aliquot in suitable volumes and store at 20
C. Thawed PFA can be stored at 4
C. 10. Phosphate-buffered saline (PBS). 11. 0.02 M potassium phosphate-buffered saline (KPBS). 12. Blocking solution: 0.1% Triton™ X-100 (Fisher Scientific, 10254640) and 5% normal donkey serum (Sigma-Aldrich, S30-100ML) in 0.02 M KPBS. 13. DMSO: Sigma (D2438).

3

Methods

3.1 Coverslip Preparation for Long-Term In vitro Cultures

1. All the steps have to be carried out in a fume hood, unless stated otherwise, while wearing personal protective equipment. 2. Place glass coverslips at the bottom of a glass dish without them touching each other.

190

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

3. Add enough general cleaning detergent to immerse the coverslips without an overspill, and place the glass dish onto an orbital shaker at a low speed for 2 h. 4. Wash the coverslips with Milli-Q water six times for 30 min each. 5. Keep the coverslips covered in 95% ethanol for 2 h. 6. Discard the ethanol, let the coverslips dry completely, and transfer them into a glass beaker. 7. Add enough 70% nitric acid to fully submerge the coverslips, and transfer the beaker into a sonicator bath for 1 h. 8. Remove the nitric acid, and wash the coverslips with Milli-Q water three times (see Note 1). 9. Remove as much water as possible from the beaker, and add enough concentrated hydrochloric acid to submerge the coverslips; swirl the beaker and carefully seal it with paraffin film. 10. Sonicate the beaker for 1 h (50–60 Hz, 30 W). 11. Remove as much hydrochloric acid as possible, and rinse the coverslips with Milli-Q water twice. 12. Take the coverslips out of the fume hood, and wash at least 20 times with Milli-Q water to remove hydrochloric acid. 13. Dry the coverslips, and place them into each well of a sterile 24-well plate; leave the plate overnight under ultraviolet light. 14. Coat the 24-well plate with PFL (poly-L-ornithine 15 μg/mL, fibronectin 5 μg/mL, and laminin 5 μg/mL). Firstly, coat the plate with poly-L-ornithine (300 μL/well) overnight at 37
C in 5% CO2. Aspirate and dry the plate, add about 60 μL of laminin in the middle of the well, and swirl around, making sure the coverslip is coated. Leave the plate at 37
C in 5% CO2 for at least 3 h or overnight. Wash thrice with DPBS, add 500 μL of fibronectin, and leave the plate overnight at 37
C in 5% CO2. 15. Wash the plate once with DPBS before seeding the cells at the required density for direct reprogramming as per your reprogramming protocol. 3.2 Labeling of iNs In Vitro 3.2.1 Lentiviral Production

1. To generate lentiviral vectors, seed 12.5 million HEK293T cells per T175 flask with 20 mL of 293T medium (1 batch of virus ¼ 2 T175 flasks) as described before [26]. 2. When they are 75–90% confluent, aspirate the medium, and add 16.2 mL of fresh medium. 3. Into each flask, add 1.8 mL of transfection mixture. 4. Swirl around gently and incubate for 45 h at 5% CO2 37
C.

Functional Assessment of iN

191

5. After 45 h, collect the cell supernatant from each batch in 50 mL falcon tubes, and spin at 800  g for 10 min at 4
C. 6. Filter the centrifuged supernatant through a 0.22 μm filter. 7. Transfer the supernatant to centrifuge tubes, and balance them carefully with 5 μg or less difference in weight. 8. Ultracentrifuge the samples at 19,500 RPM for 2 h at 4
C. 9. Discard the supernatant, resuspend the virus with 100 μL of cold DPBS, and leave at 4
C for at least 2 h or overnight before aliquoting and storing at 80
C. 3.2.2 Lentiviral Titration

1. In a 6-well plate, add 50,000 293T cells per well, and incubate overnight at 5% CO2 37
C. 2. For each virus and reference virus labeled with fluorescence marker, infect three wells each with 0.3 μL, 1 μL, and 3 μL virus. Keep three wells without virus as negative control. 3. Incubate the plates for 48–72 h. 4. Aspirate the media, add 500 μL trypsin per well, and incubate until the cells detach. 5. Add 500 μL 293T media per well to neutralize the trypsin, and transfer the content to a 1.5 mL tube. 6. Spin at 400  g for 5 min and discard the supernatant. 7. Resuspend the pellet with 200 μL PBS and vortex to mix. 8. Extract gDNA using Qiagen DNeasy Blood and Tissue Kit. 9. Determine the titer of the produced virus with qPCR using mastermix containing forward and reverse primers for albumin, WPRE, TaqMan probe, and dH2O.

3.2.3 Viral Transduction

1. Transduce cells that you are reprogramming at an optimal multiplicity of infection (MOI) 1 to 2 weeks prior to electrophysiological recordings.

3.3 Labeling of iNs In Vivo

1. To produce Cre-inducible AAV vectors, reversely insert cDNA for GFP and the desired reprogramming factors flanked by two pairs of heterotypical, antiparallel LoxP flip-excision (FLEX) sequences using a backbone such as pAAV-Ca-FLEX or similar.

3.3.1 AAV Vector Cloning

2. To insert each cDNA to the backbone, carry out PCR followed by insertion with restriction enzymes. GFP is inserted under the control of a synapsin promoter, whereas reprogramming factors are inserted under the control of a ubiquitously expressed chicken beta actin (CBA or CA) promoter (see Note 2). 3. To screen the cloned constructs, carry out sequencing and restriction analysis prior to viral production.

192

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

3.3.2 AAV Vector Production

1. To generate AAV vectors, seed 3  106 HEK293T cells per T175 flask with 20 mL of 293T medium (1 batch of virus ¼ 5 T175 flasks) as described before [25]. 2. When the cells are 75–90% confluent, aspirate the medium, and add 28 mL of fresh medium. 3. Into each flask, add 2 mL of AAV transfection mixture. 4. Swirl around gently and incubate for 72 h at 5% CO2 37
C. 5. After 72 h, discard the cell supernatant, and add 5 mL of harvest buffer to each flask to detach the cells. 6. Collect the cells in a 50 mL centrifuge tube. Rinse the flasks with 4 mL of DPBS and add to the centrifuge tube. Centrifuge at 1000  g for 5 min at 4
C. 7. After centrifugation, discard the supernatant. Vortex and resuspend the pellets in 15 mL lysis buffer. 8. Freeze the cell lysate on dry ice for 15 min and store in a 20
C freezer. The cell lysate needs to be thawed in a 37
C water bath before use.

3.3.3 AAV Viral Vector Purification

1. In this protocol, we use iodixanol gradient ultracentrifugation method to purify AAV viral vectors [27]. 2. Transfer the thawed cell lysate to ultracentrifuge sealing tubes, and ultracentrifuge at 350,000  g for 1 h and 45 min at RT. 3. Using a 10 mL syringe fitted with 18G needle, approach 2 mm below the 40/60% phase border with the bevel facing upward, and extract the phase that contains the AAV. Stop before the protein band after 5–6 mL has been extracted. 4. Store the extracted gradient extract in sterile glass bottles at 4
C. Avoid storing longer than overnight. 5. Carry out a threefold dilution of the gradient extract by slowly adding 12 mL of Iodixanol Elution (IE) buffer. Mix gently by swirling. 6. In order to purify and concentrate the diluted gradient extract, slowly (1 drop/s) pass it through an anion exchange filter. Wash the filter with an additional 3 mL of IE buffer. 7. Transfer the contents to a centrifugal filter unit containing 1–2 mL of elution buffer. Top up with DPBS to make it 4 mL. Centrifuge at 2000  g at RT until the filter is left with less than 0.5 mL of the extract. 8. Discard the liquid from the collection tube, refill the filter unit with 4 mL of DPBS, and centrifuge again. This step should be repeated two more times. After the final centrifugation step, ensure that the final volume of the concentrated AAV vector is about 200 μL.

Functional Assessment of iN

193

9. Pipette the 200 μL concentrated vector, and pass it through a 0.22 μm filter to sterilize it. Aliquot the 200 μL AAV vector in a 9 mm glass vial with interlocked insert. For long-term storage, keep the vectors at 80
C or at 4
C if used within 2 weeks. 3.3.4 AAV Titration

1. Determine the titer of the produced virus with a standard qPCR with primers for inverted terminal repeat (ITR) sequence and a 50 FAM/30 BHQ1 probe for ITR sequence. A successful AAV virus production gives stocks with titers in the minimum range of 3E+13 to 7E+13 Units/mL.

3.3.5 AAV Preparation for Surgery

1. Before stereotaxic surgery, prepare the viral mixture with the reprogramming vectors together with the reporter vector Syn-FLEX-GFP. Add each one of the viral stocks to the final mix, so that the final viral solution has 5% of each reprogramming factors and 10% of the reporter construct made up in PBS (see Note 3).

3.4 Tissue Slice Preparation for In Vivo iNs

1. Prepare ice-cold and oxygenated (95% O2 and 5% CO2) 1 Ringer solution (see Note 4). 2. Calibrate the vibratome (Vibracheck) with a fresh razor blade. 3. Turn on the cooling block of the vibratome (or add ice to the surrounding chamber). 4. Fill the cutting chamber with 1 Ringer solution, and begin oxygenating it with 95% O2 and 5% CO2 at least 30 min before use. 5. Fill a petri dish with oxygenated Krebs solution, and place it on ice along with the blade, scissors, and mounting plate (see Note 5). 6. Anesthetize the mouse, and perform a transcardial perfusion on the animal with ice-cold Krebs solution for 2–3 min (at a rate of 10–20 mL/min) (see Note 6). 7. Quickly, but cautiously, dissect the brain out, and place it upside down in the petri dish that contains 1 Ringer solution and placed on ice. 8. Make a coronal cut along the mid cerebellum of the brain, and glue this side onto the ice-cold mounting plate for cutting on the vibratome. 9. Place carefully the glued brain into the buffer chamber of the vibratome (see Note 7). 10. Begin cutting from the most rostral part of the brain at high speed, and approach the area of interest switching at slow speed (0.10 mm/s). Then, cut the area of interest (e.g., the striatum) at 275 μm at slow speed.

194

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

11. Following each cut, carefully remove the non-injected striatal side (e.g., with a bended needle). 12. Transfer the side of interest into a vial containing a bottom net with oxygenated Ringer solution at RT that is placed in a water bath. Keep this at RT until all sections are cut. 13. Once all the sections are cut, gradually increase the temperature of the water bath to 37
C, and leave it for 30 min. Then, turn off the heater, and let it cool down to RT (see Note 8). 3.5 Whole-Cell Patch-Clamp Recordings

1. Transfer the first tissue section or coverslip to the recording chamber immersed in a continuous flow of respective 1 Ringer solution gassed with 95% O2 and 5% CO2. 2. Mount the section or coverslip with light weights and bring down the objective. 3. For in vivo recordings, find the region of interest under the microscope, look for GFP-positive (i.e., reprogrammed) neurons, and double check the neuronal morphology in bright field. Select a neuron that is morphologically extensive with a clean surface and not covered by fiber bundles or blood vessels. 4. For in vitro recordings, search for GFP-labeled (reprogrammed) neurons under the microscope, and double check the neuronal morphology with bright field. 5. Prepare a couple of borosilicate glass pipettes (3–7 MΩ) for patching using a glass pipette puller, and fill with intracellular solution just before attaching to the electrode. Prepare more pipettes during recording if needed. 6. Attach the glass pipette to the recording electrode and lower the tip into the solution. Check the resistance of the electrode on the MultiClamp software. Then, gently approach the cell with the pipette, keeping a small positive pressure in the electrode to prevent clogging the tip (see Note 9). 7. For in vivo recordings, carefully wash the surrounding tissue using positive pressure of the electrode, and reach the cell with the electrode. 8. Position the electrode on top of the cell and lower it until it touches the membrane. Create a Giga-Ω seal between the electrode and cell membrane using negative pressure. 9. Then, with negative pressure pulses, break the membrane to create a whole-cell patch (see Note 10). 10. Immediately after rupturing the cells and breaking in, monitor and note down the membrane intrinsic properties (membrane capacitance, input resistance, resting membrane potentials) in current-clamp mode. These parameters indicate the neuronal phenotype of the cell and its neuronal maturation [7].

Functional Assessment of iN

195

11. In current-clamp mode, sustain the cell between 60 mV and 80 mV, and inject 500 ms currents from 20 pA to +90 pA, with 10 pA increments to induce AP (Fig. 2), which is indicative of neuronal function (and sometimes characteristic to neuronal subtype (Kawaguchi)). 12. Switch to voltage clamp, and measure the inward sodium and delayed rectifying potassium currents at depolarizing steps of 10 mV (see Note 11, Fig. 2) to assess the presence of voltagegated sodium and potassium channels on the membrane. The increasing expression of these channels is seen with increasing currents and indicates neuronal phenotype. 13. In voltage-clamp mode, record spontaneous postsynaptic activity at 70 mV, which is a measurement of synaptic integration and postsynaptic connections between neurons. 14. After attaining a steady baseline, add Picrotoxin, a GABAA receptor antagonist, to the Krebs solution to block GABAergic signaling and distinguish only excitatory events (add a 100 mM stock solution of Picrotoxin to a final concentration of 50 μM in another buffer syringe attached to the chamber perfusion).

Fig. 2 Patch-clamp electrophysiological recordings of iN. Human iN (a) and mouse iN (b) can be identified for their GFP expression and patched for electrophysiological recordings. (c) To assess their neuronal function, current-induced action potential (AP) is measured. Parameters such as AP threshold, amplitude, afterhyperpolarization (AHP), and interspike interval determine functional maturation and subtype specificity, e.g., different firing pattern. (d) In addition, inward and outward rectifying currents can be measured, indicating expression of membrane voltage-gated sodium (Na+) and potassium (K+) channels on the neuronal membrane. Postsynaptic activity indicates synaptic integration. (e) These events can be blocked with either glutamate and/or GABA antagonists to distinguish excitatory and inhibitory postsynaptic current (EPSC and IPSC). Modified from Giacomoni et al. [28] and Douin-Ouellet [29]

196

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

15. Block the glutamatergic postsynaptic event by adding to the Krebs solution NBQX, an AMPA antagonist (5 mM stock solution, use a final concentration of 5 μM), and D-AP5, an NMDA antagonist (0.1 M stock solution, use a final concentration of 50 μM). Leave it for another 20 min, and then wash out with Krebs solution. Remove the tissue section or coverslip from the chamber (see Note 12). 3.6 Post Hoc Identification of Cells

1. In order to link morphology of iNs with the electrophysiological properties, fill the cell gradually with intracellular solution containing biocytin during the recording, and retain the patch for at least 20 min. 2. At the end of the recording when biocytin has sufficiently diffused into the cell, remove the electrode very gently, and detach the cell membrane from the tip of the electrode. 3. Place the coverslip or tissue sections in 4% PFA for at least 20 min or overnight at 4
C correspondingly. 4. Wash coverslips or tissue sections with KPBS. 5. Permeabilize and incubate with blocking solution for 1 h at RT. 6. Incubate cells or tissue sections with primary antibodies diluted in blocking solution overnight at 4
C. 7. Apply fluorophore-conjugated secondary antibodies diluted in blocking solution for 2 h at RT. 8. Wash with KPBS, and incubate the coverslip or tissue sections in Cy3-conjugated streptavidin diluted in blocking solution for 30 min or 2 h, respectively, at RT to visualize biocytin-filled cells. 9. Wash twice with KPBS, and counterstain with DAPI diluted in KPBS (1:1000) for 10 min at RT. 10. Wash once with KPBS and mount with a mounting media. 11. Take pictures using an inverted fluorescence microscope.

3.7 Analysis of Functional Characteristics of iNs 3.7.1 Post Hoc Analysis of iNs

1. Determine the input resistance by measuring the voltage trace induced by a 500-ms-long 100 pA current injection. The resistance is calculated by means of Ohm’s law: R ¼ V/I, where I is the current step (10 pA) and V is determined from the recorded trace (in voltage). 2. Assess the ability to generate AP using current step injections as in Subheading 3.5, step 11. The maximum number of APs can further be compared between maturational stage as in Fig. 3 and plotted as a function of current injections. 3. Detect the AP threshold at the onset of AP and the amplitude as the delta voltage from threshold to AP peak. Measure the afterhyperpolarizing potential (AHP) as the voltage difference between the AHP peak and the AP threshold and the half AP amplitude width according to Fig. 2.

Functional Assessment of iN

Abortive Firing

Immature

Single AP

Transitional

197

Repetetive AP

Mature

Fig. 3 Gradual maturation in firing capabilities of iNs. One example of how the functional maturation of iNs can be measured is through the gradual increase in firing capabilities. Immature neurons show no ability to fire action potential (AP), whereas a neuron in a transitional state fires single AP. Repetitive AP is not shown until the neuron is fully mature

4. To identify the fast-inward sodium (Na+) current, induce the current traces by 10 mV voltage steps, and plot as a function of voltage. Similarly, measure the presence of outward sustained potassium (K+) current at voltage steps from 70 to +40 mV (Fig. 2). Compare the tilt of the curve between different neurons or groups. 5. Carry out an off-line analysis of spontaneous excitatory postsynaptic currents (EPSC) and inhibitory postsynaptic currents (IPSC) with the use of threshold-event detection (>5 pA) in the analysis program (Fig. 2). Align a baseline of 2–3-min-long continuous current trace, and determine the frequency of events and the average amplitude in the analysis program for comparison and to assess iNs postsynaptic input.

4

Notes 1. Acids should always be added to water, not vice versa as it can cause violent reactions. 2. Make sure to have endotoxin-free DNA by using specific endotoxin-free plasmid DNA isolation kits as endotoxins can inhibit transfection. 3. The AAV vector mixes can be stored at 4
C and kept for future use. 4. Prepare 1 Ringer solution on the same day of the recordings from the 10 Krebs solution by diluting in Milli-Q water and adding NaHCO3 and glucose. 5. The tissue preparation needs to be carried out correctly, and it is essential to achieve good electrophysiological recordings. The room needs to be prepared carefully, and all the tools required for the perfusion and dissection need to be placed on ice.

198

Srisaiyini Kidnapillai and Daniella Rylander Ottosson

6. In order to acclimatize the mouse, it needs to be brought to the perfusion room at least 1 h prior to the procedure as stress has adverse effects on the condition of the brain tissue sections. 7. Be cautious with the razor blade when placing or handling the vibratome for your own safety and also for not touching the blade that has been calibrated. 8. At this step, following tissue dissection, you can stop until you are ready to record. The sections can be kept for 4–6 h. 9. Be careful to keep track of the cell while lowering the electrode and not to bleach the fluorescence in the cell if it contains GFP. Switch off the fluorescence lamp when it is not required. 10. Reprogrammed neurons are sensitive. When reaching a Giga-Ω seal or opening the cell membrane, do not put too much negative pressure. Be mindful that patching in older animals commands practice and patience as their connective tissue is denser and it is more challenging to visualize the neurons. 11. Voltage-clamp recordings are better measured using a different intracellular solution (i.e., cesium-based internal), made with reagents that clamp the membrane more efficiently. However, in the case of reprogrammed neurons, the number of cells and tissue sections that you can record from is limited. Therefore, it is better to record both in current clamp and voltage clamp from the same cell. 12. Be careful not to have any positive pressure in the electrode, which could obliterate the successive morphological analysis of the cells. References 1. Barker RA, Go¨tz M, Parmar M (2018) New approaches for brain repair—from rescue to reprogramming. Nature 557(7705):329–334. https://doi.org/10.1038/s41586-018-0087-1 2. Southwell DG et al (2014) Interneurons from embryonic development to cell-based therapy. Science 344(6180):1240622. https://doi. org/10.1126/science.1240622 3. Parmar M, Torper O, Drouin-Ouellet J (2019) Cell-based therapy for Parkinson’s disease: a journey through decades toward the light side of the force. Eur J Neurosci 49(4):463–471. https://doi.org/10.1111/ejn.14109 4. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126(4):663–676. https://doi.org/10. 1016/j.cell.2006.07.024

5. Pfisterer U et al (2011) Efficient induction of functional neurons from adult human fibroblasts. Cell Cycle 10(19):3311–3316. https://doi.org/10.4161/cc.10.19.17584 6. Vierbuchen T et al (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463(7284):1035–1041. https://doi.org/10.1038/nature08797 7. Pereira M, Birtele M, Rylander Ottosson D (2019) Direct reprogramming into interneurons: potential for brain repair. Cell Mol Life Sci 76(20):3953–3967. https://doi.org/10. 1007/s00018-019-03193-3 8. Torper O et al (2015) In vivo reprogramming of striatal NG2 glia into functional neurons that integrate into local host circuitry. Cell Rep 12(3):474–481. https://doi.org/10. 1016/j.celrep.2015.06.040

Functional Assessment of iN 9. Pereira M et al (2014) Highly efficient generation of induced neurons from human fibroblasts that survive transplantation into the adult rat brain. Sci Rep 4:6330. https://doi. org/10.1038/srep06330 10. Guo Z et al (2014) In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer’s disease model. Cell Stem Cell 14(2):188–202. https://doi.org/10.1016/j.stem.2013.12. 001 11. Su Z et al (2014) In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nat Commun 5(1):3338. https://doi. org/10.1038/ncomms4338 12. Pang ZP et al (2011) Induction of human neuronal cells by defined transcription factors. Nature 476(7359):220–223. https://doi.org/ 10.1038/nature10202 13. Grande A et al (2013) Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nat Commun 4(1):2373. https://doi.org/10.1038/ncomms3373 14. Torper O et al (2013) Generation of induced neurons via direct conversion in vivo. Proc Natl Acad Sci U S A 110(17):7038–7043. https:// doi.org/10.1073/pnas.1303829110 15. Scanziani M, H€ausser M (2009) Electrophysiology in the age of light. Nature 461:930. https://doi.org/10.1038/nature08540 16. Verkhratsky A, Krishtal OA, Petersen OH (2006) From Galvani to patch clamp: the development of electrophysiology. Pflugers Arch 453(3):233–247. https://doi.org/10. 1007/s00424-006-0169-z 17. Galvani L (1791) De viribus electricitatis in motu musculari commentarius. Bon Sci Art Inst Acad Comm 7:363–418 18. Neher E, Sakmann B (1976) Single-channel currents recorded from membrane of denervated frog muscle fibres. Nature 260 (5554):799–802. https://doi.org/10.1038/ 260799a0 19. Hamill OP et al (1981) Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 391(2):85–100 20. Edwards FA et al (1989) A thin slice preparation for patch clamp recordings from neurones of the mammalian central nervous system. Pflugers Arch 414(5):600–612

199

21. Kawaguchi Y, Kubota Y (1993) Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28kimmunoreactive neurons in layer V of rat frontal cortex. J Neurophysiol 70(1):387–396. https://doi.org/10.1152/jn.1993.70.1.387 22. Hansen MG et al (2019) In vitro functional characterization of human neurons and astrocytes using calcium imaging and electrophysiology. Methods Mol Biol 1919:73–88. https://doi.org/10.1007/978-1-4939-90078_6 23. Birtele M et al (2019) Dual modulation of neuron-specific microRNAs and the REST complex promotes functional maturation of human adult induced neurons. 0 (0). FEBS Lett 593(23):3370–3380. https://doi.org/ 10.1002/1873-3468.13612 24. Shrigley S et al (2018) Simple generation of a high yield culture of induced neurons from human adult skin fibroblasts. J Vis Exp 132:56904. https://doi.org/10.3791/56904 25. Pereira M, Birtele M, Ottosson DR (2019) In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J Vis Exp 148:e59465. https://doi.org/10.3791/59465 26. Zufferey R et al (1997) Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15(9):871–875. https://doi.org/10.1038/nbt0997-871 27. Crosson SM et al (2018) Helper-free production of laboratory grade AAV and purification by Iodixanol density gradient centrifugation. Mol Ther Methods Clin Dev 10:1–7. https:// doi.org/10.1016/j.omtm.2018.05.001 28. Giacomoni J, Bruzelius A, Stamouli CA, Rylander Ottosson D (2020) Direct conversion of human stem cell-derived GlialProgenitor cells into GABAergic interneurons. Cells 9 (11) 29. Drouin-Ouellet J, Lau S, Brattas PL, Rylander Ottosson D, Pircs K, Grassi DA, Collins LM, Vuono R, Andersson Sjoland A, WestergrenThorsson G, Graff C, Minthon L, Toresson H, Barker RA, Jakobsson J, Parmar M (2017) REST suppression mediates neural conversion of adult human fibroblasts via microRNAdependent and -independent pathways. EMBO Mol Med 9(8):1117–1131

Chapter 14 Neurotransmitter Release of Reprogrammed Cells Using Electrochemical Detection Methods Andreas Heuer Abstract The detection of neurotransmitter release from reprogrammed human cell is an important demonstration of their functionality. Electrochemistry has the distinct advantages over alternative methods that it allows for the measuring of the analyte of interest at a high temporal resolution. This is necessary for fast events, such as neurotransmitter release and reuptake, which happen in the order of milliseconds to seconds. The precise description of these kinetic events can lead to insights into the function of cells in health and disease and allows for the exploration of events that might be missed using methods that look at absolute concentration values or methods that have a slower sampling rate. In the present chapter, we describe the use of constant potential amperometry and enzyme-coated multielectrode arrays for the detection of glutamate in vitro. These biosensors have the distinct advantage of “self-referencing,” a method providing high selectivity while retaining outstanding temporal resolution. Here, we provide a step-by-step user guide for a commercially available system and its application for in vitro systems such as reprogrammed cells. Key words Electrochemistry, Amperometry, Biosensor, Glutamate, Enzyme-based, Astrocytes, MEA, In vitro, Neurotransmitter reuptake, Stem cells, Reprogramming

1

Introduction Glutamate is one of the most abundant excitatory neurotransmitters in the brain, and aberrant regulation of glutamate signaling has been implicated in many neurodegenerative and neuropsychiatric brain disorders, such as Alzheimer’s disease [1, 2], Huntington’s disease [3, 4], ALS [5], epilepsy [6], schizophrenia [7, 8], as well as mood disorders, such as depression, anxiety, and many more [9, 10]. Recent developments in reprogramming technologies enable the direct conversion of various cell types into neurons and glia, which enables the study of cellular processes in health and disease [11–14]. An in-depth analysis of the kinetics of glutamate release and reuptake in the temporal resolution these events take place is essential for the understanding of therapeutic targets.

Henrik Ahlenius (ed.), Neural Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 2352, https://doi.org/10.1007/978-1-0716-1601-7_14, © Springer Science+Business Media, LLC, part of Springer Nature 2021

201

202

Andreas Heuer

There are several methods available to measure the amount of glutamate that is released such as HPLC and electrochemistry. Whereas the former does allow for a quantification of the total amount of glutamate, the technique is limited by its temporal resolution (magnitude of minutes). Neurotransmitter release and reuptake kinetics are very fast and happen in an order of milliseconds to seconds. Electrochemical detection methods, such as constant potential amperometry as described in the present chapter, do allow for the analysis of these very fast glutamatergic events. Due to the small size of the electrode (high spatial resolution), low limits of detection (changes from baseline), and temporal resolution (fast changes in glutamate levels during release and reuptake), electrochemistry is an ideal technology to be employed for the investigation of these events. In the present chapter, we describe the use of a commercially available electrochemistry system, which can be set up and implemented with minimal training. Although the theoretical and practical skills necessary for developing such a system are demanding, in our hands the implementation of the system obtained by our group has allowed us to record various neurotransmitters in various settings. Obtaining electrodes through a commercial supplier rather than inhouse-made electrodes furthermore allows for a great deal of standardization between laboratories. The electrodes used by our group are obtained from the Centre for Microelectrode Technology (CenMet; http://www. ukycenmet.com/) based at Kentucky University, KY, USA. They are mass fabricated by photolithography (see [15]), which allows for small recording sites as well as different geometric arrangements thereof (see Fig. 1). These different geometric arrangements do allow for the simultaneous recordings from different cellular layers as well as of different analytes of interest by applying enzyme coatings that are selective for a certain analyte (as discussed below). For a full description of the different electrode configurations that are currently available, the reader is referred to (http://www. ukycenmet.com/ceramic-based-microelectrode-arrays/). Electrochemistry is based on the principle that molecules can be oxidized/reduced directly at the working electrode surface and that the currents that are generated are linear to the concentration of the electroactive molecules. In brief, a potential is applied between the working electrode and the reference electrode, which are in ionic conduct. Molecules, which are electroactive at the given potential, will be oxidized or reduced directly at the surface of the working electrode. The electrons, which are donated (oxidation) or received (reduction) at the electrode surface, generate currents which are linear to the concentration of the electroactive molecules (Faradaic currents). By using calibration steps before conducting the actual recordings, one can determine the selectivity and sensitivity of the electrode to the analyte of interest as well as interferents. For an in-depth background on the electrochemical principle

Electrochemical Detection of Glutamate from Reprogrammed Cells

D Uptake rate

C

Amplitude

B

Concentration (μM)

A

203

T50

T80

T100

Time (sec)

TR TTotal

Fig. 1 (a) Photograph of the recording tip of a MEA array. The white box indicates the magnified area shown in (b). (b) High-power photograph of the Pt recording sites of an S2-type MEA. Note the side-by-side configuration of the respective channels. This allows for some redundancy during the recording procedures should one site be compromised. (b) High-power photograph of a Trk-8-type MEA. This configuration allows for the simultaneous recordings of multiple cell layers. Note that these electrodes are available in different geometrical configurations, i.e., 1 mm spacing between recording sites. For a full description of geometrical configurations, visit the website of the manufacturer (www. http://www.ukycenmet.com/ceramic-basedmicroelectrode-arrays/). (d) Example of a glutamate trace recorded in the prefrontal cortex of anesthetized rats including the main parameters that can be analyzed. Amplitude, peak dopamine release; TR, time between release onset and reach of peak amplitude (release rate in μM/sec); T50, time (in sec) for the signal to decrease by 50%; T80, time (in sec) for the signal to decrease by 80%; T100, time (in sec) for the signal to decrease by 100%; Ttotal, time (in sec) for the signal to return to baseline levels; reuptake rate, MichaelisMenten first-order rate constant (slope of natural log concentration vs. time pot peak maximum) x peak amplitude (μM/sec); linear rise rate (μM/sec) is calculated as peak amplitude (μM)/TR(sec); total amount of extracellular analyte is calculated as area under the curve (AUC) from moment of release stimulation until the signal returns to baseline. All parameters are easily calculated by the F.A.S.T. software

and various electrochemical techniques available, such as chronoamperometry, fast-scan cyclic voltammetry, and constantpotential amperometry, the reader is referred to excellent work by [16–19]. In the current protocol described here, we employ constant potential electrochemistry, which has the fastest temporal resolution (