Molecular Mechanisms of Retina Pathology and Ways of its Correction [1st ed.] 9783030501594, 9783030501600

Citation preview

Svetlana Trofimova

Molecular Mechanisms of Retina Pathology and Ways of its Correction

Molecular Mechanisms of Retina Pathology and Ways of its Correction

Svetlana Trofimova

Molecular Mechanisms of Retina Pathology and Ways of its Correction

Svetlana Trofimova St. Petersburg Institute of Bioregulation and Gerontology Saint Petersburg, Russia

ISBN 978-3-030-50159-4    ISBN 978-3-030-50160-0 (eBook) https://doi.org/10.1007/978-3-030-50160-0 © Springer Nature Switzerland AG 2020 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Switzerland AG The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland

Contents

1 Literature Review��������������������������������������������������������������������������������������   1 1.1 Age-Related Characteristics of the Retina������������������������������������������   1 1.1.1 Molecular Mechanisms of Age-Related Macular Degeneration ��������������������������������������������������������������������������   4 1.1.2 Molecular Mechanisms of Retinal Ischemia��������������������������   6 1.1.3 Molecular Mechanisms of Retinitis Pigmentosa��������������������   7 1.1.4 Conclusion������������������������������������������������������������������������������   9 1.2 Current Trends in the Treatment of Retinal Diseases ������������������������   9 1.3 Results of Modern Scientific Research in the Field of Cell Replacement Therapy Using Neuronal Stem Cells��������������������  14 1.4 Biological Effects of Peptide Bioregulators����������������������������������������  17 References����������������������������������������������������������������������������������������������������  32 2 Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology������������������������������������������������������������������������������������������  43 2.1 Results of a Study of the Induction Effects of Short Peptides on Pluripotent Embryonic Cells��������������������������������������������������������������  43 2.1.1 Methods of Morphological Assessment����������������������������������  45 2.2 The Effect of Short Peptides on the Proliferative Activity of Retinal Cells and Pigment Epithelium�������������������������������������������  50 2.2.1 Method of Preparation of Substrates for Cell Cultures����������  50 2.2.2 Method of Obtaining Cell Cultures of the Retina and Pigment Epithelium of Rats ��������������������������������������������  51 2.2.3 Drug Administration ��������������������������������������������������������������  52 2.2.4 Methods for Spectrophotometric Assessment of the Number of Living Cells in Suspension������������������������  52 2.3 Effect of Short Peptides on Expression of Markers of Differentiation of Retinal Neurons and Pigment Epithelium ��������  54 2.4 Effect of Short Peptides on the Nature of the Course of Hereditary Retinal Pigment Degeneration in Campbell Rats ������������������������������  56 References����������������������������������������������������������������������������������������������������  67 v

vi

Contents

3 Results of the Clinical Study of Short Peptides (Cytogens) in Ophthalmology������������������������������������������������������������������������������������������  69 3.1 Evaluation of the Effectiveness of Short Peptides (Cytogens) in Patients with Age-Related Macular Degeneration��������������������������  69 3.2 Evaluation of the Effectiveness of Short Peptides (Cytogens) in Patients with Retinitis Pigmentosa ������������������������������������������������  74 3.3 Conclusion������������������������������������������������������������������������������������������  83 References����������������������������������������������������������������������������������������������������  84 Conclusion����������������������������������������������������������������������������������������������������������  85 References ����������������������������������������������������������������������������������������������������������  89

Chapter 1

Literature Review

Abstract  The chapter describes age related structural features and functions of the retina, as well as modern methods of treating degenerative diseases of the retina. It is known that pathology of the retina (age-related macular degeneration, retinitis pigmentosa) is a complex problem for clinical ophthalmology. Modern methods of treating retinal diseases (laser exposure, surgical treatment, drug administration (such drugs as Lucentis, Macugen, Visudyne)) aim to only reduce the risk of new complications in the eye. It must be emphasized that pathogenetic therapy of degenerative diseases of the retina is almost absent in international ophthalmic practice, which leads to irreversible blindness in patients. Therefore, in order to search for pathogenetic treatment, numerous studies are currently underway using the achievements of molecular biology. This chapter reviews the results of various scientific studies in the field of cell replacement therapy using neuronal stem cells in order to restore the functional activity of retinal neurons. In addition, the retinoprotective effect of peptide bioregulators is described and the mechanisms of their activity are defined. For example, research results are presented showing that peptides are able to stimulate the expression of cell differentiation markers by binding to promoter regions of genes, which is necessary for the development, interaction and functioning of cells.

1.1  Age-Related Characteristics of the Retina Age-related changes in eye tissues are subject to the general laws of body aging, but at the same time, they have their own characteristics, due to the structural and functional specifics of the visual analyzer and the presence of an autoregulation mechanism in its blood supply system (Arking 1998; Wong et al. 2014). Age-related retinal pathology is largely determined by the features of its histological structure. To date, physiological and biochemical mechanisms of photo-­ activation which ensure perception and amplification of the primary light signal are known, as well as morphological features of the structure of its layers. The retina is a thin layer of tissue that lines the back of the eye on the inside. Histologically, the retina consists of ten layers of nerve cells that are morphologically and functionally interconnected. It is composed of six types of neurons and one type of glial cells © Springer Nature Switzerland AG 2020 S. Trofimova, Molecular Mechanisms of Retina Pathology and Ways of its Correction, https://doi.org/10.1007/978-3-030-50160-0_1

1

2

1  Literature Review

which form a highly organized layered structure. The main layer of the retina is a thin layer of photosensitive cells, photoreceptors (rods and cones). The main function of the retina is to convert the light signal detected by photoreceptors into an electrical impulse transmitted to the brain. Age-related dysfunction of retinal cells leads to disruption of normal nerve signal formation and, as a result, to visual impairment (Wiedemann and Kohen 1997; Singer 2014). Older people experience a decrease in visual acuity and colour perception, associated in most cases with the death of retinal neurons. Of all retinal cells, photoreceptors are most susceptible to aging. One of the reasons for this is oxidative stress (imbalance between the systems of generation and detoxification of reactive oxygen species) due to exposure to light. Ultraviolet radiation induces the formation of free radicals, which cause oxidative damage to the walls of the membranes of the retinal cells and trigger lipid peroxidation (Shaw et al. 2016). All this launches involutional processes in the retina of the eye and the occurrence of degenerative retinal changes. Additionally, age causes a physiological decrease in the number of neuronal cells in the retina. So, according to A. Neufeld (2001), this process is ongoing. Over the course of several years, he observed several species of test animals, whilst evaluating the age-related loss of ganglion cells. The research results showed that every month there was a decrease in the number of ganglion cells in the retina in all animals. Moreover, in the group of mice this indicator amounted to 2.4% of the monthly loss of ganglion cells, while in rats this indicator was lower and amounted to 1.5% of the monthly loss. However, by the end of life, this indicator reached a single value: 35% in both groups of animals. In addition, artificially induced retinal ischemia (within 75  min) further exacerbated the existing picture. There was a 20% decrease in the number of ganglion cells in the group of young animals and a 35% decrease in the group of old rats. Thus, the retinas of old animals turned out to be more sensitive to damaging agents than young ones. According to the author, a similar decrease in the number of ganglion cells with age occurs in the retina of primates, including humans. Therefore, Neufeld A. naturally concludes that age-related degenerative changes in the retina occur due to a significant decrease in the number of ganglionic retinal cells, especially under the influence of unfavourable factors (Neufeld 2001). This can explain the fact that the number of rods and cones in people aged 60 and above is twice as low as that in 20-year-olds. Similarly, there is a decrease in the number of bipolar and ganglion cells in people aged from 35 to 60. With aging, degenerative changes in the optic nerve fibres are also observed. They are replaced by connective tissue, and the inner border membrane thickens. Ganglion and bipolar cells accumulate lipids, while astrocytes actively express glial fibrillar acidic protein (Zueva 2010). According to some authors, dystrophic processes are based on the metabolic disorders of specific proteins in the pigment epithelium, as well as other layers of the retina (Curcio 2018; Friedman et al. 1998). Involutional changes in the layer of retinal pigment epithelium are expressed in a significant reduction in the number of nuclei, the sparseness of nuclear spaces, and the flattening and shortening of pigment cells. With age, morphological changes in the Bruch’s membrane occur: it thickens, appears to be curved, and sudanophilic masses and lipids start depositing. Accumulations of amyloid fibrils are found in the

1.1  Age-Related Characteristics of the Retina

3

inner collagen layer of the membrane. It has been suggested that during involutional degeneration of the retinal pigment epithelium in the cytoplasm of these cells, non-­ phagolized neuroepithelial discs accumulate, from which fibrils of the pathological amyloid protein are subsequently formed (Ermilov and Vodovozov 1995; Ermilov and Trofimenko 1998). In a test on C5BL/6 mice (2-, 9-, and 16-month old), a correlation between the degree of subretinal deposits and age was revealed (the authors evaluated the number of subretinal druses using points as an assessment unit). In 16-month-old mice this indicator was 2.5 times higher than that of young animals. In addition, according to the authors, a diet with a high content of high-density lipids, as well as ovariectomy, which leads to hormonal imbalance, can provoke destructive changes in the retina. However, lipid metabolism disturbance occurs mainly in organisms with a genetic predisposition to this, which is confirmed by the results of the experimental studies of T. Ikeda. The authors indicate that presence of a paraoxanase polymorphism gene leads to disruption of lipid metabolism and, as a consequence, the appearance of age-related macular degeneration (Ikeda et al. 2001). With the degeneration of photoreceptors, changes in the nerve layers of the retina are observed (Marc et  al. 2003). Restructuring of the nerve layers of the retina includes four stages. At the first stage, outer segments of the rods and cones are lost. At the second stage, apoptosis of the rods and cones is detected, which leads to a violation of their interaction with the network of amacrine and bipolar cells. After this, apoptosis of most neurons is induced. The remaining retinal cells search for sources of stimulating signals, which leads to the migration of bipolar and amacrine cells to the outer and inner border membranes. The retina, losing its layered structure, loses the capacity for phototransduction. At the last stage of the disease, metabolic processes are disrupted, and neurons devoid of oxygen and nutrients enter necrosis, being replaced by glial cells (Maksimova 2008; Marc et al. 2003). Thus, the dystrophic processes of the retina are based on metabolic disorders of photoreceptor proteins, pigment epithelium and retinal neurons. However, the vascular factor is also essential in the development of degeneration of the retina of the eye. It is known that age-related changes in the arterial system of the eye are always more distinct than in the venous system. With age, there is a decrease in the number of functioning vessels, especially terminal arborizations and anastomoses. The entire vascular tree with retinal ophthalmoscopy looks poor and pale. The natural tortuosity of the arteries and veins disappears; they become straightened. The lumen of the vessels narrows down evenly along the entire length; the light reflex from the vascular walls is weak; and it dims as the calibre of the vessel decreases. Fluorescein angiography data indicates a significant slowdown in blood flow in both the arterial and venous systems of the retina in people over 65 years of age. The avascular zone of the macular region becomes wider; the characteristic structure of the vascular arcade disappears. Morphological studies indicate the development of fibrosis and hyaline degeneration of the vascular wall, thickening of the basement membrane, and collagenisation of fibrils. Involutional desquamation of the vascular endothelium, elastofibrosis, and thickening of the wall as a result of fibre swelling and plasma infiltration of the intima lead to the narrowing of the lumen of the vessel. At the same time, vessels cease to

4

1  Literature Review

be flexible, become dense, rigid and lose their adaptive capabilities, including during variations in arterial and intraocular pressure as well. Anatomical and morphological degradative changes of the choroid and retina lead, respectively, to a disruption in the functional activity of the latter. According to L.  Justino et  al. (2001), with age, there is a significant decrease in bioelectric activity and an increase in the duration of nerve impulses in the retina due to involutional changes (Justino et al. 2001). According to the authors, a decrease in the intensity of transcapillary metabolism in the vessels of the retina and choroid leads to the development of senile hypoxia of the retina with a decrease in metabolic processes and, as a result, a decrease in visual functions (Shamshinova and Volkov 1999; Justino et al. 2001). All this causes the appearance of senile retinal haemorrhages, and also contributes to the occurrence of dystrophic changes in the retina (Friedman et al. 1998). According to Delori F., with age, the fundus autofluorescence spectrum shifts by 10–20 nm toward shorter wavelengths. According to the authors, this is due to an increase in the number of fluorophores in Bruch’s membrane (Delori et al. 2001). Involutional changes in the retina and choroid contribute to the appearance of senile retinoschisis, annular (engirdling) retinopathy. The outcome of a retinoschisis can be retinal detachment with all its consequences. The course of the pathological process can be slow or, alternatively, very fast with the appearance of scotomas and a decrease in visual acuity, if the process affects the macular region. But age-related changes in the retina do not in all cases lead to the development of macular degeneration (Kornzweig 1965; Sarks 1976). However, a decrease in the adaptive capabilities of the organism against the background of involutional changes creates favorable conditions for the occurrence of pathological processes in the choroid and retina (Bressler and Bressler 1995; Kornzweig 1965). Disruption in blood patency in the arterial and venous vascular bed leads to ischemic changes in the retinal tissue with the development of secondary dystrophies. The microcirculatory bed always reacts to the influence of a pathogenic factor as a single integral system. Therefore, it is extremely difficult to determine the causal link in changes observed.

1.1.1  M  olecular Mechanisms of Age-Related Macular Degeneration The main reason for the loss of central vision in the elderly is age-related macular degeneration, which is a chronic dystrophic process that affects mainly the retinal pigment epithelium. Photoreceptors are also included in the pathological process as a result of their close interaction with the retinal pigment epithelium, which leads to a decrease in central visual acuity. The pathogenesis of age-related macular degeneration is based on processes such as retinal cell aging, dystrophic changes in the intercellular matrix, impaired angiogenesis, and lipid metabolism (Shaw et al. 2016; Stone 2007).

1.1  Age-Related Characteristics of the Retina

5

It is believed that one of the causes of metabolic disorders leading to macular degeneration is an age-related increase in the amount of lipofuscin accumulating in the cells of the retinal pigment epithelium, which leads to the formation of drusen (Al-Zamil and Yassin 2017; Pauleikhoff et  al. 1990). With age, ophthalmoscopic examinations reveal discoloration of the entire fundus background with redistribution of pigment on the periphery and in the macular region, single or multiple drusen in the vitreous plate of the choroid in the form of yellowish formations throughout the fundus. Drusen are most clearly noticeable during fluorescein angiography, providing a distinctive image of hyperfluorescence in the form of separate foci with clear boundaries (Friedman et al. 1998; Karwatowski et al. 1995). An increase in the number of drusen with age leads to an even greater dysfunction of the retinal pigment epithelium, which ultimately leads to the death of photoreceptors. Involutional changes in the choroid and retina lead to disruption of the normal connection of the pigment epithelium with the Bruch membrane and the appearance of choroidal exudation. As a result, exudative detachment of the pigment epithelium develops. Violation of the barrier function of the latter leads to the occurrence of the detachment of the retinal neuroepithelium. Retinal ischemia stimulates the release of vascular endothelial growth factor (VEGF) and leads to the germination of newly formed vessels through defects of the Bruch membrane under pigment or neuroepithelium (Bhutto and Lutty 2012; Biesemeier et al. 2014). The frequency of newly formed vessel development during detachment of the pigment epithelium depends on age. Dr. Fernández-Robredo observed patients of different ages with detached pigment epithelium for 22 months. The results of his studies showed that among the patients with pigmented epithelium detachment at the age of 56 years and younger there were no cases of choroidal neovascularization during the entire observation period, while in the group of patients older than 56 years a neovascular membrane occurred in more than 35% of cases (Fernández-­ Robredo et al. 2014). The development of a subretinal neovascular membrane is accompanied by retinal haemorrhages. As a result of a long-standing detachment of the pigment epithelium, a fibrovascular scar is formed, which significantly complicates the course of the disease and leads to a significant decrease in vision. A significant role in the pathogenesis of macular degeneration is known to be assigned to a genetic predisposition. There are clinical observations showing that degenerative diseases of the retina are hereditary, therefore, they are diagnosed in patients of several generations in the same family. The presence of macular degeneration in homozygous twins also suggests the possibility of single gene expression in a large number of patients. A study of the expression of the HS70 gene in people of different age groups showed that it decreases with age. In addition, expression of this gene reduces sharply in the presence of degenerative changes in the macula. Therefore, this indicator can serve as a diagnostic criterion for the development and severity of macular degeneration (Bernstein et al. 2001). Besides that, mutations of the antagonists of the RRE65 protein localized in retinal pigment epithelial cells and participating in the reaction of 11-cis-retinol formation are presumably one of the causes of macular degeneration. An important role in

6

1  Literature Review

the pathogenesis of age-related macular degeneration of the retina is played by the mutation of genes encoding fibulins that modulate the functions of the Bruch membrane. It has been established that mutations of Fibulin 5 lead to a change in the phagocytic and lysis ability of retinal pigment epithelium, which contributes to the accumulation of lipofuscin, which in turn induces the formation of drusen. Subsequently, this leads to destruction of the Bruch membrane and atrophy of the retinal pigment epithelium (Kijlstra and Berendschot 2015; Reibaldi et al. 2016).

1.1.2  Molecular Mechanisms of Retinal Ischemia One of the most important molecular mechanisms underlying retinal degeneration is ischemia, which contributes to neuronal death and neovascularization. Neurons have different sensitivity to ischemia due to the different blood supply systems of the outer and inner cell layers of the retina. The most susceptible are ganglion cells (Akiyama et al. 2002), which means the main characteristic signs of retinal damage are their death and thinning of nerve fibers. Amacrine cells are also sensitive to ischemia, which increases the expression of the pro-inflammatory mediators COX-2 and NO (Ju et al. 2003), which are involved in ganglion cell damage. This fact suggests that there are common ischemic damage mechanisms in various classes of neurons. One of the main pathological manifestations of ischemia is an excess of glutamate, the main stimulating neurotransmitter in the retina. It is released by photoreceptors, bipolar and ganglion cells (Sharma 2007). Normally, glutamate concentration in the retina is not high: an increase in the level of glutamate for a long time leads to the death of neurons. At the molecular level, retinal ischemia induces neovascularization via VEGF.  VEGF expression is regulated by hypoxia (Plate et  al. 1992), and VEGF synthesis increases with ischemic lesions of the retina. Other signaling molecules are also involved in the stimulation of angiogenesis: FGF family, TNFα, and the insulin-like hepatocyte growth factor IGF. TGF-β family members possess an antiangiogenic property. The most important role in the formation of retinal cells is played by the TGF-β2 protein. It was found that TGF-β2 regulates the expression of transcription factors PITX2 and FOXC1, which control collagen synthesis in the stroma. TGF-β2 also regulates VEGF secretion in pES and inhibits the growth of choroid melanocytes (Firsova et al. 2011). Angiogenesis includes vasodilation and increased vascular permeability, as well as destruction of the surrounding matrix, which contributes to the proliferation of endotheliocytes, their migration and neovasculogenesis (Witmer et  al. 2003). Hypoxia is the main cause of ischemia and induces the expression of HIF-1, which stimulates the formation of VEGF, bFGF, and other neovascularization factors (Vincent et al. 2002). Development of ischemic retinal vein occlusion (iRVO) is based on circulatory disorders in the arterioles and retinal capillaries. Atherosclerotic lesions of the arterial bed are distinguished as the main component of pathogenesis.

1.1  Age-Related Characteristics of the Retina

7

An important factor of studying the causes of iRVO is the level of homocysteine​​ in blood plasma and the presence of C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, which is the main enzyme that ensures conversion of folic acid to its active form. Hyperhomocysteinemia is a risk factor for the development and progression of atherosclerosis, ischemia and heart attacks, venous and arterial thrombosis. At the moment, hyperhomocysteinemia is considered the main reason for the development of ischemic retinal vein thrombosis in young and middle age patients (Di Crecchio et al. 2004). Vitamin deficiency caused by diseases of the gastrointestinal tract contributes to an increase in homocysteine levels. ​​ The mechanisms of the prothrombogenic action of homocysteine ​​include damage to endothelial cells, followed by platelet activation and induction of lipid peroxidation, which damages the vascular wall. Circulatory disorders in the retinal veins are often accompanied by functional disorders of platelet haemostasis. The size of circulating platelet aggregates plays an important role in the pathogenesis of retinal vein thrombosis (Yamamoto et al. 2004). Various pathogenetic factors, including genetic predisposition, are involved in the formation of thrombosis of retinal veins. A correlation was established between the development of retinal vein thrombosis and the presence of mutations in the coagulation factor V genes, prothrombin and methylenetetrahydrofolate reductase. Polymorphism of factor I (fibrinogen) genes and plasminogen activator inhibitor-1 (PAI  – 1), as well as platelet receptor gene polymorphisms, are involved in the pathogenesis of vascular diseases of the eye (Tulceva 2008).

1.1.3  Molecular Mechanisms of Retinitis Pigmentosa It has been established that the diversity of retinitis pigmentosa (RP) forms is due to mutations in a number of genes encoding membrane proteins and photoreceptor cytoskeleton. The most common are mutations in the genes of RDS peripherin, retinol acetyltransferase (RPE65) and rhodopsin (RHO) (Michaelides et al. 2006). Mutations in the RHO gene cause from 25% to 40% of cases of all diseases characterized by peripheral photoreceptor degeneration (Illing et al. 2002). In addition, more than 100 mutations in the RHO gene were found, that result in the onset of different RP variants. There are three classes of mutations in the rhodopsin gene which lead to the development of autosomal dominant forms of retinitis pigmentosa. They are distinguished by the dysfunction of rhodopsin and the nature of its accumulation in cell culture. In class 1 mutations, the photopigment remains active, and the connection with 11-cis-retinal is not broken, while protein accumulation in the culture of embryonic cells during cultivation occurs on the cytoplasmic membrane. Class 2 mutations lead to a disruption in the structure of the photopigment and the accumulation of defective protein in the endoplasmic reticulum. Class 3 includes mutations leading to the formation of hyperphosphorylated rhodopsin, which is closely related

8

1  Literature Review

to arrestin. The resulting rhodopsin-arrestin complex disrupts the morphology of the endosomal compartment and endocyte function (Chuang et al. 2004). It was established that in most cases, autosomal dominant retinitis pigmentosa is caused by class two mutations. Thus, retinitis pigmentosa is caused by a mutation of the genes that regulate the function of the rods, which leads to their apoptosis. Programmed death of the rods leads to disruption of intercellular interactions, as a result of which cones not affected by mutations also undergo apoptosis (Banin et al. 1999). Unlike typical retinitis pigmentosa (or rod-cone dystrophy) which develops as a result of the primary loss of retinal rods and the secondary loss of cones, cone-rod dystrophy (CORD) happens in reverse order. CORD is characterized by the primary involvement of cones in the pathological process, and sometimes cones and rods at the same time, which explains the predominance of symptoms such as decreased visual acuity, impaired colour perception, photophobia and decreased sensitivity of central visual fields, and later partial loss of peripheral vision. The clinical course of CORD is usually more severe and rapidly progressive than retinitis pigmentosa, which leads to early vision loss, but in the final stage of the disease RP and CORD are clinically identical (Framme et al. 2005). To date, about 20 forms of CORD are known, as well as 13 genes in which mutations lead to its development. The main gene, mutations in which leads to this kind of retinal degeneration, is CRX (cone-rod homeobox-containing gene), a cone-rod homeobox protein located on chromosome 19q13.3. The protein encoded by this gene is a specific photoreceptor transcription factor that plays an important role in the differentiation of photoreceptor cells. It is assumed that this homeodomain protein provides the formation of the outer segment and is indispensable for the process of phototransduction, both in rods and cones. Mutations in this gene are associated with degeneration of photoreceptors, type 3 Leber congenital amaurosis (LCA3), and type 2 autosomal dominant dystrophy of rods and cones. The development of Leber amaurosis is caused by a mutation of three genes: RetGC1, involved in the phototransduction cascade; CRX and AIPL1, involved in the development of photoreceptors; and RPE65, involved in the regeneration of rhodopsin (Ramamurthy et al. 2004). Impaired expression of the RPE65 gene causes severe early retinal degeneration. According to numerous studies, the RPE65 polypeptide is expressed exclusively in pES cells, being indispensable for ensuring their metabolism. In addition, RPE65 polypeptide is an indirect participant in the visual cascade; therefore, mutations in the corresponding gene can cause the development of a wide range of retinal degenerations. According to some studies, mutations in the RPE65 gene cause 2% of all cases of autosomal recessive retinitis pigmentosa and from 7% to 16% of cases of autosomal recessive Leber congenital amaurosis (Cremers and Jose 2002). The ABCA4 gene (STRG 1, ABCR) has been identified, mutations in which lead to the emergence of an autosomal recessive form of Stargardt disease (Allikmets et al. 1997; Birch 2006). More than 400 mutations of the ABCA4 gene are known, most of which are missense mutations in highly conserved amino acid sequences. A rare form of the disease with an autosomal dominant type of inheritance is due to

1.2  Current Trends in the Treatment of Retinal Diseases

9

mutations in the ELOVL2 gene. ABCA4 is a retin specific membrane protein that is expressed in the discs of the outer segments of rods and cones. If any defects in the ABCA4 protein are present, the phototoxic metabolites of the retinal N-ret-PE and its derivative A2E accumulate in the intradiscal space. ABCA4 protein was found in both types of photoreceptors, but the disease typically manifests in the central area of the retina, where cones are located (Stone et al. 1994). Thus, three pathogenetic mechanisms of retinal degeneration can be distinguished: mutations in genes involved in the formation of proteins of the outer segments of photoreceptors, mutations in genes involved in the differentiation of photoreceptors, and impaired synthesis and disposal of trans-retinyl and cis-­ retinal esters.

1.1.4  Conclusion In clinical practice, one generally has to face a combined pathology: damage to the organ of vision and various somatic diseases (arterial hypertension, atherosclerosis, diabetes mellitus, etc.). This combination is especially common in older patients. In addition to somatic age-related diseases, low visual functions have an extremely negative effect on the quality of life of older patients, ultimately causing them to lose the ability to care for themselves. In addition, with age, the course of the main retinal diseases (myopic disease, retinitis pigmentosa, macular degeneration, etc.) becomes more intense (Kanski 2001). Therefore, preservation of residual visual functions in older patients is an extremely important task for both ophthalmology and geriatrics.

1.2  Current Trends in the Treatment of Retinal Diseases Retinal diseases (age-related macular degeneration, diabetic retinopathy, retinitis pigmentosa) are a complex problem for clinical ophthalmology. According to WHO data for 2010, in the coming century retinal pathology (along with cancer) will be the leading cause of disability in the world (Wong et al. 2014; Zhu et al. 2015). Currently, modern treatments for retinal pathology include pharmacotherapy, laser treatment and surgical treatment. Pharmacotherapy is diverse but ineffective. In some countries, in order to reduce the risk of new complications in the eye, the following drugs are used: vitamins (C, E, beta-carotene), angiotropic medication (Doxium), haemostatic drugs (Dicinone), drugs that improve blood rheological properties (Trental, Streptokinase, Heparin), glucocorticoid drugs (Triamcinolone), various biostimulants and adaptogens. The main objective of this conservative therapy is to influence the pathogenesis of retinal pathology. This explains the use of drugs that strengthen the vascular wall (angioprotectors), improve retinal trophism (adaptogens), block free radicals that

10

1  Literature Review

occur when redox processes are disturbed (antioxidants), etc. However, conservative therapy is effective only in the early stages of the process, its results are unstable: this usually helps to suspend or slow down further loss of vision, but not significantly improve it. Therefore, this treatment method is used only as a maintenance therapy (Chew et al. 2013; Ip et al. 2009). The use of anti-VEGF (vascular endothelial growth factor) drugs to treat patients with wet forms of macular degeneration and diabetic retinopathy can be considered a therapeutic breakthrough. In recent years, innovative methods of conservative treatment of retinopathy, accompanied by neovascularization, have been actively developed and implemented. Ophthalmologists have obtained access to new methods to block vascular endothelial growth factor, which is considered a key link in the process of neovascularization, as well as retinal vascular hyperfiltration. Therefore, in recent years, this therapy has become a standard in the treatment of this pathology (Enseleit et al. 2017; Peirong et al. 2013; Heier et al. 2012). VEGF is known to belong to homodimeric glycoproteins and is structurally similar to platelet growth factor. It has the ability to bind to five types of tyrosine kinase receptors. VEGF affects the vascular wall on several levels: as a factor contributing to the survival of endothelial cells, it increases vascular permeability and has the properties of a powerful vasodilator. Glomerulogenesis and renal glomerular filter function are also strictly regulated by VEGF. In addition to the physiological effect, VEGF also has other properties that are triggered by certain pathogenetic mechanisms, and include the ability to stimulate the formation of the collateral circulation necessary for the survival of cells undergoing hypoxia, as well as improving trophism in wound healing processes. However, many pathological processes, such as the development of diabetic retinopathy, tumour growth, occurrence of ischemic diseases, etc., are caused specifically by the disruptions in the VEGF-VEGFR system. The first studies showing that VEGF is a factor contributing to the development of vascular permeability in tumours were published in the early 80s of the last century. Today, anti-VEGF drugs are used as a part of the complex treatment of lung metastatic tumours. VEGF inhibitors recognize monoclonal antibodies that are capable of selectively binding to VEGF and blocking its action. As a result of this, neoangiogenesis, which can contribute to further growth, is suppressed in tumours. Recent studies have suggested that one of the methods of conservative treatment of diabetic retinopathy is a substance with anti-VEGF properties. In this clinical practice, there is a number of drugs that block the biological effect of VEGF. This group of drugs includes: Pegaptanib (a drug-selective inhibitor of VEGF165), Bevacizumab and Ranibizumab (drugs that block any VEGF isoforms). Pegaptanib (the main active ingredient of the drug Macugen) is a substance with polyethylene glycol neutralizing RNA aptamer, which has the highest affinity to VEGF165. In tests on rodents, it was proved that intravitreal administration of pegaptanics would suppress leukostasis, retinal neovascularization, as well as VEGF-mediated cell hyperfiltration. The FDA approved the use of pegaptanib in the treatment of wet age-related macular degeneration in the USA in 2004.

1.2  Current Trends in the Treatment of Retinal Diseases

11

Ranibizumab (the main active ingredient of the drug Lucentis) is specifically designed to detect neovascularization in age-related macular degeneration through changes in the structures of rat long-chain monoclonal antibodies. Unlike pegaptanib, ranibizumab is able to bind to and suppress the biological effect of any human VEGF isoforms. In models of laser-induced choroidal neovascularization, experimentally created in nonhuman primates intravitreal administration of ranibizumab blocks, new vessels emerged while the vascular permeability of existing vessels was reduced. In 2006, the FDA approved the use of ranibizumab-based drugs in the United States for oedematous wet AMD. Bevacizumab (the main active substance of the drug Avastin) is created from antibodies of VEGF laboratory mice. Like ranibizumab, it has the ability to bind to all VEGF isoforms and is used for the treatment of neovascularization in the wet form of AMD. However, the new group of therapeutic drugs (Lucentis, Avastin, Makugen) which ophthalmologists hoped could help in treating retinal pathology proved not to be completely safe for use in clinical practice. Among the ophthalmic manifestations of anti-VEGF drugs, it is worth noting endophthalmitis, lens damage and retinal detachment as the most common complications. In addition to the side effects of the intravitreal injection itself, other undesirable effects may occur. Although anti-VEGF drugs are injected directly into the vitreous through a scleral puncture, permeation of the drug into the systemic circulation is still possible. Therefore, this can lead to undesirable systemic manifestations such as hypertension or proteinuria. Any increase in blood pressure will be the result of an increase in the level of peripheral vascular resistance due to the suppression of the production of nitric oxide by endothelial cells, the formation of which stimulates VEGF through the activation of nitric oxide synthase. The same pathogenetic mechanism underlies renal dysfunction and the occurrence of proteinuria. Other complications that have been identified as a result of the use of anti-VEGF include suppression of tissue regeneration processes resulting in poor wound healing, disorders in the cardiovascular system, and infertility; cases of bleeding in the gastrointestinal tract have also been described. Thus, potential systemic complications from the use of VEGF inhibitors (including hypertension, proteinuria, impaired regeneration of wound surfaces, collateral circulation, etc.) can be life-threatening, especially in people with diabetes (Falavarjani and Nguyen 2013; Shikari et al. 2014; Afarid et al. 2018). Therefore, the use of these drugs has a number of contraindications (liver disease, porphyrin disease, decompensated arterial hypertension, unstable stenocardia, sulfanilamide intake) and cannot be recommended for all patients, as it can lead to serious complications and even greater reduction in their visual functions (Day et al. 2011; Gupta et al. 2018). Attempts at surgical treatment of macular degeneration did not lead to the expected results. Several operations were performed to transfer retinal pigment epithelium (RPE) from healthy areas of the retina to the damaged (macular) part. However, to date, this method of therapy is not used in clinical practice, due to the technical complexity of such operations, as well as the high risk of postoperative

12

1  Literature Review

complications (Stanga et al. 2002). However, this data proves that transplantation of healthy RPE cells subretinally into affected areas can be effective. New possibilities in the treatment of diseases of the posterior eye segment have emerged with the use of laser treatment. Laser coagulation is used in the treatment of central and peripheral retinal dystrophy, certain types of tumours, and vascular and inflammatory diseases. In addition, this method is used to prevent the progression of various dystrophy forms and retinal detachment. Today, laser coagulation is considered one of the main methods of combating lattice dystrophy, diabetic retinal changes, retinal vein thrombosis and the wet form of age-related macular degeneration. However, clinical cases have been described where laser coagulation can lead to the formation of fibrous tissue and worsen the course of the pathological process. Even the use of modern low-energy laser radiation, according to some authors, has several disadvantages. The biggest disadvantage is the short duration of the achieved result, as well as a decrease in effectiveness with each subsequent course of treatment (Macular photocoagulation study group: argon laser photocoagulation for senile macular degeneration 1982; Luttrull and Dorin 2012). However, while there are multiple ways to treat macular retinal degeneration and diabetic retinopathy, treatment of degenerative diseases of the retina such as, for example, retinitis pigmentosa remains a significant problem to date. On the one hand, this is due to the wide variety of its forms, and on the other hand, the lack of effective treatment methods. There are numerous theories that explain the pathogenesis of retinitis pigmentosa (Lyness et al. 1985; Johns 1994; Lam et al. 1995; Chuang et al. 2004; Weleber and Gregory-Evans 2006; Ferrari et al. 2011). The main reason for the development of the dystrophic process is heredity, but the role of immunological, autoimmune processes, metabolic disorders, exposure to light, various infections, and toxic substances is also acknowledged as a big factor (Rodrigues et al. 1986; Convers et al. 1987; Nakazawa et al. 1998; Michaelides et al. 2006; Liu et al. 2011). According to some authors, dystrophic processes are based on metabolic disorders of specific proteins in the pigment epithelium, as well as in other layers of the retina. In addition, neurotransmitters dopamine and melatonin play an important role in the pathogenesis of pigmentary degeneration. The results of physiological and biochemical studies indicate that dopamine and melatonin have a reciprocal function in the regulation of renewal of the outer segments of the photoreceptors, as well as in the processes of light and dark adaptation. Therefore, an imbalance of melatonin and dopamine can also lead to dystrophic processes in the retina (Ikeda et al. 2001). In some countries various vitamins, their derivatives and mineral supplements are used for treating retinitis pigmentosa. Vitamins A, E and rutin are the most commonly used in regular doses as antioxidants that reduce the excess activity of peroxidases in the retinal tissue (Berson et al. 1993, 2004). To improve haemodynamics by reducing blood viscosity, indirect anticoagulants are prescribed under the control of prothrombin. For senior patients, however, anticoagulants should be prescribed with great care because of the danger of haemorrhagic complications. In the presence of concurrent diseases such as hypertension, peptic ulcer, liver disease, kidney disease, anticoagulants shouldn’t be used (Rudakova and Khveshchuk 2002).

1.2  Current Trends in the Treatment of Retinal Diseases

13

There are publications that describe many more drugs used for the treatment and prevention of retinitis pigmentosa: taurine, transfer factor, acetozolamide, calcium channel blocker (diltazem), thyroid hormones, gonadotropic hormones, pituitary hormones, hyaluronidase, dimethyl sulfoxide, ganglion-acting drugs, etc. However, persistent improvement in vision or stabilization of the pathological process, as a rule, cannot be achieved (Fishman et al. 1989; Weleber and Gregory-Evans 2006). It is known that melatonin is a neurohormone that is synthesized in the pineal gland and retina at night in all mammals (Wiechmann 1986; Iuvone and Gan 1995; Cassone 1998; Herzog and Block 1999). In the retina, melatonin is synthesized by photoreceptor cells. However, the physiological role of melatonin in the retinal tissue has not yet been fully studied, although it is known that this neuropeptide regulates the daily rhythm of renewal of the outer segments of photoreceptors, is involved in the process of phagocytosis, has a neuroprotective effect and is a powerful antioxidant (Besharse and Danis 1983; Dubocovich 1983; Mayo et  al. 1998; Reiter 1997, 1998; Marchiafava and Longoni 1999; Cipolla-Neto et al. 2014). This served as the reason for using melatonin in the treatment of retinitis pigmentosa in an experiment on mice homozygous for the rds (retinal degeneration slow) gene suffering from congenital retinal pigment degeneration. Liang F. injected rds mice with melatonin at a dose of 10 mg/kg per animal for 11 weeks. At the end of the drug administration period, electrophysiological and histological studies of the retina were performed, and the effect of melatonin on apoptosis of photoreceptors was studied. According to the authors, melatonin had a pronounced protective effect on the retina of rds mice (Liang et al. 2001). In clinical practice, there have been attempts to stop the progression of the dystrophic process using revascularizing operations, the main purpose of which was aimed at restoring trophism in the retina of the sick eye. To this end, the following operations were performed: transplantation of fibres of the rectus, superior oblique and lateral rectus muscles into the suprachoroidal space, scleroplasty with a homotransplant from cadaver sclera, retroscleral buckling with an infusion of placental suspension, and symptomatic denervation. For this, sympathectomy was performed. However, all these operations did not stop the progression of the pathological process, and sometimes ended in severe complications in the form of dyscirculatory disorders (Krasnov and Belyaev 1988). Thus, the effect of these therapeutic measures (vasodilator drugs, vitamins, tissue therapy, surgical interventions) is aimed only at improving trophism in the retina. The main disadvantage of these methods is the lack of their pathogenetic orientation. Therefore, observed clinical improvement is unstable, after some time visual functions return to their original level, and the disease progresses steadily, leading the patient to blindness. In the recent decades, this issue has been studied, and new, pathogenetic approaches to treatment have been actively researched. Researchers have concentrated heavily on genetic engineering (Bennett et  al. 1998; Reichel et  al. 2001; Hauswirth et al. 2008). One of the promising methods of treating retinitis pigmentosa is based on the subretinal administration of an adenovirus capsule which contains mini-chromosomes (Kumar-Singh and Farber 1998, 2000).

14

1  Literature Review

The experience of transplantation of pigment epithelial cells and retinal neuronal cells is accumulating. The surgical method of retinal cell transplantation is based on using a layer of pigment epithelial cells in the thickness of the donor’s retina. According to the authors, the transplantation contributes to the preservation of photoreceptors, but does not affect the quality of vision (Ehinger 1998; Radtke et al. 2002). Therefore, development and research of drugs that determine the structural and functional specialization of retinal cells for the pathogenetic treatment of retinitis pigmentosa remains relevant. Among physiologically active substances, peptides with a tissue-specific action are of great interest (Khavinson 2001a, b; Datseris et al. 2018; Khavinson et al. 2019).

1.3  R  esults of Modern Scientific Research in the Field of Cell Replacement Therapy Using Neuronal Stem Cells Modern methods of treating retinal diseases (laser exposure, surgical treatment, therapy) only aim to reduce the risk of new complications in the eye. Therefore, an alternative or additional method of pathogenetically substantiated treatment of retinal pathology may be such a direction of regenerative medicine as cell therapy. Cell therapy is the fastest growing field of medicine. The rapid progress of regenerative technologies opens up new possibilities for treating such serious diseases as diabetes mellitus, Alzheimer’s disease, multiple sclerosis, various cardiological diseases, as well as retinal pathology (Cheng et al. 2016; Kumar et al. 2016). The term “regeneration” itself comes from the Latin word “rebirth”, “regeneratio”; meaning the ability of a living organism to repair damaged or lost organs, tissues. For example, the tail of the salamander, which it can lose in order to survive, grows again over a fairly short time. But in science, two terms are used. Physiological regeneration is self-renewal of body systems, for example, a change in skin cells in humans occurs every 15–18  days; red blood cells count renews every 120 days; leukocyte count renews every 5 days; platelet count renews every 6–7 days. This renewal is a natural process necessary to ensure the vital functions of the body. Reparative regeneration is the ability to restore the body after damage. This includes the body’s ability to heal damage after injuries, burns etc. Reparative regeneration in a young and healthy person, as a rule, is at a fairly high level. It is carried out due to somatic stem cells. The tissues of the eye regenerate similarly to other human organs (Holan et al. 2015; Junyi et al. 2015). It is known that stem cells have the ability to proliferate, and are able to differentiate into almost any type of cell. Therefore, depending on their differential activity, all stem cells can be divided into the following categories: –– totipotent stem cells that differentiate into embryonic and extraembryonic tissues;

1.3  Results of Modern Scientific Research in the Field of Cell Replacement Therapy…

15

–– pluripotent stem cells that form embryonic tissues (ectoderm, endoderm and mesoderm); –– multipotent stem cells which are capable of differentiating into a limited number of cell types (eg, mesenchymal stem cells) (Trounson and DeWitt 2016). Despite being a part of the general immune system, the immune system of the eye has its own characteristics. First of all, this concerns the fact that the immune response in the tissues of the eye is reduced due to mechanisms of immunological tolerance. During evolution, a number of organs (brain, uterus, eyes, etc.) attained immune privilege. This term was introduced to denote the status of certain organs and tissues of the body in which the appearance of an antigen does not lead to an inflammatory immune response. It is known that tissue transplants are normally rejected because they are recognized as a foreign body by the immune system. But in immunoprivileged organs and tissues, the transplant rejection reaction does not occur for a long time. Due to the fact that eyes are such immunoprivileged organs, this opens up wide opportunities for the use of cell replacement therapy in the treatment of retinal pathology. This gives scientists a chance to use not only autologous, but also allogeneic cells, without fear of rapid immune rejection in the recipient (Streilein 2003). Retinal degenerative diseases such as retinitis pigmentosa (RP), age-related macular degeneration (AMD) or glaucoma are characterized by early loss of specific cell types: retinal ganglion cells (RGCs), photoreceptors or retinal pigment epithelium (RPE), respectively (Davis et al. 2016; Ferrari et al. 2011). A number of studies show that retinal neurons can integrate efficiently and achieve functional maturation, even in retinas with degenerative changes (Tucker et  al. 2014; Whiting et al. 2015). Rods and cones are afferent sensory neurons that have only one direction of synaptic communication with the next cell layer in the retina. Various forms of transplantation are used to replace dysfunctional or dead photoreceptors in animal models, including the full-thickness retina, sheets of photoreceptors (cut with a laser or vibratome), dissociated cells, including photoreceptors or RPC capable of producing them, and hPSC derivatives. Subretinal transplantation of full-thickness retina or photoreceptor sheets is technically difficult. Cell integration and synaptic re-connection of full retina transplantation was found to be less effective compared with dissociated cell transplantation (Aramant and Seiler 2004; Ghosh et al. 2004). In one study, photoreceptor precursor cells obtained from hESC were transplanted subretinally into a Crx  – /  – mouse model. The transplanted cells were implanted and integrated into the retina of the host, and an improvement in light-mediated behaviour was also observed (Lamba et al. 2009). Similar results were obtained by transplanting photoreceptors derived from hiPSC into the retina of a wild-type mouse (Lamba et al. 2010). Tucker et al. reported similar results in a model of degenerative mice, where they showed that subretinal injection of photoreceptor precursors derived from mouse iPSC facilitates retinal integration as well as improved electroretinography results (Tucker et al. 2011).

16

1  Literature Review

More than 10 years ago, the first preclinical studies of transplantation of RPE cells in animal models began. As a rule, Royal College of Surgeons (RCS) rats (which are a model of RPE-based retinal degeneration) were used (D’Cruz et al. 2000; Ramsden et  al. 2013). RCS rats have a mutation in the receptor tyrosine kinase Mertk gene, which damages the phagocytosis of the outer segment of the RPE layer, which leads to the death of the photoreceptor and, as a consequence, visual impairment. RPEs derived from ESC primates were transplanted into the subretinal space of RCS rats and retinal function recovery was observed (Haruta et al. 2004). Later, RPE cells were successfully obtained from human embryonic stem cells (hESC). The subretinal transplantation of these cells into RCS rats led to the migration of the transplanted cells into the outer nuclear layer, differentiation into immunohistochemically identifiable cells of rod photoreceptors, and improved visual function (Idelson et al. 2009; Vugler et al. 2008). In 2011, Advanced Cell Technology in the United States launched the first clinical trial (Phase I, II) to study the use of hESC RPE for treating AMD in humans. A study has shown that this therapy method is safe for humans (Schwartz et al. 2012). Over the next 3  years of research, in addition to confirming safety, data were obtained that confirmed an improvement in computer perimetry and an increase in visual acuity by 11–15 letters. At the same time, visual acuity did not change in the eyes in which hESC-based RPE transplantation was not performed (Schwartz et al. 2015). Mesenchymal stem cells (MSCs) are one of the promising cell types for use in the treatment of various diseases. MSCs have a high regenerative potential. Of the many sources of MSCs, bone marrow, adipose tissue, tooth pulp, peripheral and cord blood are most often used. Stem cells derived from adipose tissue are of particular interest to researchers (Rajashekhar 2014). There are studies on the effectiveness of stem cells obtained from adipose tissue in the treatment of dry AMD. During the study, stem cells along with platelets were introduced into the suprachoroidal space of the eye. After 6 months a significant improvement in visual acuity was achieved, as well as changes in optical coherence tomography (Limoli et al. 2016). These studies, demonstrating the isolation of progenitor cells from tissues of an adult and the successful transplantation of these stem cells into a degenerating retina, aroused wide interest among ophthalmologists and boosted development in this direction (Bhattacharya et al. 2017). As part of the London Project to Cure Blindness, carried out by researchers from the University of London together with Moorfields Eye Hospital, in 1918 the results of the first phase of a clinical trial were announced. In 2 patients with exudative age-­ related macular degeneration, a bioengineered patch containing retinal cells derived from human embryonic stem cells (hESC) was used (Cruz et al. 2018). The authors of the study developed an RPE patch comprising a fully differentiated RPE monolayer derived from human embryonic stem cells (hESC) on a coated synthetic basement membrane. Surgically, the hESC-RPE patch was delivered to the subretinal space of one eye in each of the two patients. The results of the study showed the safety of hESC-RPE patch transplantation and the absence of patch rejection. These

1.4  Biological Effects of Peptide Bioregulators

17

results were confirmed using biomicroscopy and optical coherence tomography. The treatment provided increased visual acuity by 29 and 21 letters in two patients, respectively, within 12 months. The data obtained by scientists makes it promising for further study of the transplantation of hESC-RPE patches as a regenerative strategy for age-related macular degeneration. Advances in three-dimensional (3D) bioprinting technology are very promising as well. With the help of a special printer, a bioindicator building block can be applied and layered. There are studies in which mesenchymal stem cells have been used in this 3D bioprinting technology to recreate the retina (Jha and Bharti 2015; Soleimannejad et al. 2017). A recent mouse 3D retinal organoid study showed that transplanted organoid-derived photoreceptors can survive in the subretinal space and differentially integrate into the retina of mouse models with cone-rod degeneration (Santos-Ferreira et al. 2016). Thus, great progress has been made in the use of stem cell technology for the treatment of retinal diseases. The first phases of clinical trials of transplantation of RPE cells derived from stem cells have already begun and demonstrated the safety and effectiveness of this method. 3D bioprinting technology is a promising treatment method. However, all these studies are experimental in nature and are not yet used in clinical practice (Bennis et al. 2017; Webb et al. 2016).

1.4  Biological Effects of Peptide Bioregulators The last decades of the twentieth century and the beginning of the twenty-first century in both biology and medicine have been characterized by an intensive study of the role of peptides in the life of the body. A large number of publications appeared every year about the effect of peptides on various physiological functions. Toward the end of the 1980s of the last century, the number of publications barely reached one thousand, but by 1990, it had increased by a factor of four. At the same time, by the beginning of the last decade of the twentieth century, more than 1000 peptides were isolated from various biological tissues and their structure was established. In the 1980s of the last century V.G. Morozov and V.Kh. Khavinson (Morozov and Khavinson 1983) described a new class of peptide bioregulators, called cytomedines or cell mediators. The authors developed an original technique for isolating low molecular weight peptides (cytomedines) from organs and tissues that have high tissue specificity. In accordance with the concept of peptide bioregulation, an idea was formed about the participation of endogenous peptide bioregulators in maintaining the structural and functional homeostasis of cell populations. It was established that cytomedines are peptide substances with a molecular mass of up to 10  kDa (Morozov and Khavinson 1973; Kuznik et  al. 1986; Khavinson 2002; Khavinson et al. 2011c). Initially, cytomedines were isolated from the tissues of the pineal gland, thymus and hypothalamus (Morozov and Khavinson 1974, 1981; Morozov et  al. 1977). Their main action was aimed at regulating the functioning of the

18

1  Literature Review

neuroimmunoendocrine system of the body. Then, over a relatively short period of time, cytomedines were isolated from the retina and from practically all other organs and tissues (Anisimov et al. 1987; Morozov and Khavinson 1996; Khavinson 2001a, b; Khavinson and Trofimova 2000; Khavinson et al. 1999; Khavinson et al. 2004). Subsequently, at the St. Petersburg Institute of Bioregulation and Gerontology (Russia) under the direction of Khavinson V. (Kuznik et al. 1987, 1998; Khavinson 2002, 2004; Khavinson et al. 2006), a method was developed based on the synthesis of short peptides with in vitro and in vivo basic properties of complex peptide preparations (Table 1.1), based on the analysis of the amino acid composition of peptide bioregulators isolated from animal tissues. Numerous studies have shown that the target for these compounds, representing di-, tri- and tetrapeptides, are genes (Khavinson et  al. 2011a, b, c, 2012a, b, c, d; Khavinson 2002; Khavinson et  al. 2005). As a result, these peptide bioregulators are called cytogens. Studies of cytomedines and cytogens carried out in organotypic tissue cultures revealed tissue-specific activity of peptide bioregulators. For example, during culturing fragments of the cerebral cortex of animals in the presence of a peptide preparation of Cortexin (a peptide complex isolated from calf brain cortex), an explant growth was observed. Polypeptide complexes isolated from other tissues (pineal gland, heart, thymus, etc.), which were used to control the results, did not cause changes in the growth zone of explants of the cerebral cortex (Khavinson and Chalisova 2000). Of the synthetic peptides, only Cortagen (a synthesized tetrapeptide based on the amino acid composition of a complex peptide preparation of cortexin) had a stimulating effect on rat cortex explants (Khavinson et  al. 1997). It should be noted that in tissue cultures obtained from old animals, the regulatory effect of the studied drugs was more prominent than in the tissue explants of young ones. Similar results were obtained by culturing other complex preparations and synthetic peptides (Khavinson and Chalisova 2000; Khavinson et al. 2019; Linkova et al. 2011). However, with respect to retinal explants, not only the complex peptide drug Retinalamin (isolated from the calves’ retina), but also the complex peptide bioregulator epithalamin (pineal gland extract) and its synthetic analog Epitalon had a stimulating effect (Khavinson and Chalisova 2000). This can be explained by the fact that the composition of peptides designed on the basis of amino acid analyzes of drugs isolated from the pineal gland of the brain (Epithalamin) and from the retina (Retinalamin) turned out to be completely identical. This fact indicates the presence of common regulatory metabolic mechanisms in the cells of the pineal gland and retina, which is due to their development from a single embryonic leaf (neuroectoderm) (Forsell et al. 2001). In addition, it was proved that the secretory cells of the pineal gland (pinealocytes) are homologous to the photoreceptor cells of the retina. However, in higher vertebrates and humans, pineal cells lost their ability to respond directly to light stimuli. Their response mechanism is expressed in the secretion of two humoral regulators (melatonin and serotonin) depending on the time of day (Vivien-Roels et al. 1981; White and Fisher 1989; Tosini 2000; Savaskan et al. 2002). In turn, the daily rhythm of renewal of the outer segments of the photoreceptors – rods and cones (rods renew at sunrise, cones at sunset) – also indicates the similarity of these cells (Marmor and Wolfensberger 1998).

1.4  Biological Effects of Peptide Bioregulators

19

Table 1.1  The main characteristics of short peptides developed at the St. Petersburg Institute of Bioregulation and Gerontology # 1

Name Thymogen

2

Vilon

3

Epimental (Normoftal)

4

Cartalax

5

Pinealon

6

Honluten

7

Vezugen

8

Epitalon

9

Prostamax

10 Livagen

11 Cortagen

12 Pancragen

13 Cardiogen

14 Testagen

15 Bronchogen

Formula Glu-Trp (EW) Lys-Glu (KE) Lys(Н-Glu-­ OH)-OH (έKγE) Ala-Glu-­ Asp (AED) Glu-Asp-­ Arg (EDR) Glu-Asp-­ Gly (EDG) Lys-Glu-­ Asp (KED) Ala-Glu-­ Asp-Gly (AEDG) Lys-Glu-­ Asp-Pro (KEDP) Lys-Glu-­ Asp-Ala (KEDA) Ala-Glu-­ Asp-Pro (AEDP) Lys-Glu-­ Asp-­ Trp-NH2 (KEDW) Ala-Glu-­ Asp-Arg (AEDR) Lys-Glu-­ Asp-Gly (KEDG) Ala-Glu-­ Asp-Leu (AEDL)

Total charge –1

Molecular mass, kDa 0.333

0

0.275

−7.4

0

0.275

−7.4

Joint function regulation −2

0.333

−5.2

Brain function regulation Respiratory system function regulation Vascular function regulation Neuroendocrine system and retinal function regulation Prostate function regulation

−1

0.418

−11.5

−2

0.319

−7.4

−1

0.391

−10.9

−2

0.390

−5.6

−1

0.488

−12.5

Liver function regulation

−1

0.462

−9.1

Brain function regulation

−2

0.430

−6.8

Pancreatic function regulation

0

0.576

−11.8

Myocardial function regulation

−1

0.490

−9.7

Testicular function regulation

−1

0.448

−11.3

Bronchial function regulation

−2

0.446

−1.4

Indications for use Immunomodulator Tissue regeneration stimulator Retinal function regulation

Note: The hydropathy index was calculated on a Kite-Doolittle scale

Hydropathy index −4.4

20

1  Literature Review

A further comparative study of the biological activity of cytomedines and cytogens showed a number of similar effects when they act on various organs and tissues of the body in normal and pathological conditions (Khavinson et al. 2000, 2004, 2006, 2007, 2008a, b, c, d, 2009a, b, c, 2010). As a result of peptide regulation in cells, the rate of accumulation of pathological changes (DNA damage, mutations, malignant transformation, etc.) decreases and the activity of reparative processes aimed at restoring cell homeostasis increases (Khavinson et al. 2005; Khavinson et al. 2011a, b, c). Penetrating directly into the cell nucleus, short peptides interact with the regulatory regions of DNA, due to which gene expression and protein synthesis occur. This has been proven in numerous studies (Khavinson et al. 2005; Khavinson 2002; Kolchina et al. 2019). Thus, the experimental results showed that short peptides modulate the effect of endonucleases on DNA hydrolysis in different ways, and their effect on this process can be mediated by histones. It is known that in a cell peptides must find those places in chromatin that are accessible for interaction with DNA, and this availability can be largely determined by histones, including linker histone H1. The effect of peptides on the action of these endonucleases may be due to the different specificity of the binding of peptides to DNA and the different specificity of the action of enzymes themselves (Fig. 1.1).

Fig. 1.1  Interaction of the Ala-Glu-Asp-Gly peptide with nitrogenous DNA bases (ATTTC sequence)

1.4  Biological Effects of Peptide Bioregulators

21

The dotted line indicates the hydrogen bonds between the atoms of the peptides and the DNA, the nitrogenous bases of DNA forming hydrogen bonds with the peptide are shown in bold. The DNA molecule is shown in green; the letters indicate nitrogenous bases (A – adenine, T – thymine, G – guanine, C – cytosine). In a peptide molecule, a nitrogen atom is highlighted in blue, oxygen in red, carbon atoms are gray, and polar hydrogen atoms are light gray (Khavinson et al. 2012a, b, c, d). This interaction of short peptides with DNA affects gene expression. It was revealed that many cytogens: Thymogen (Glu-Trp), Vilon (Lys-Glu), Epitalon (Ala-­ Glu-­Asp-Gly) and others are capable of influencing gene expression. Of the 15,247 genes studied, Vilon influenced 180 and Epitalon influenced 242 genes, enhancing or decreasing their expression (Fig.  1.2). 15,247 genes were studied (DNA-­ microarray technology) (maximum increase by a factor of 6.61, maximum decrease by a factor of 2.71). At the same time, Vilon, Thymogen and Epitalon are capable of altering the expression of nuclear and mitochondrial genes present in mouse hearts. Under the action of peptides, gene expression changed both upward (by a factor of 6.61) and downward (by a factor of 2.71) compared with the control group. A special group of genes that respond to the effects of the studied peptides are genes of regulatory proteins, regulation of metabolism and cell proliferation (Khavinson et al. 2009a b, c; Anisimov and Khavinson 2010; Khavinson et al. 2005). It is important to notice the important epigenetic role of peptide bioregulators in the regulation of oxidative stress. As early as 1956, Harman D. (Harman 1956) established that there is a close relationship between aging and the accumulation of free radicals that damage the cells in the body. The main role in free-radical oxidation is played by mitochondria. As is known that mitochondria have their own apparatus for repairing damaged DNA by exogenous and endogenous agents. Damage to mitochondrial DNA leads to increased synthesis of reactive oxygen species, which, in turn, is accompanied by an even more pronounced violation of the structure of mitochondrial DNA. Moreover, oxidative stress is one of the key factors in telomere (the terminal sections of the chromosome) shortening. In each division cycle, telomeres are shortened due to the inability of DNA telomerase to synthesize a copy of DNA from the very end. This phenomenon is called terminal underreplication and is one of the Fig. 1.2  The effect of peptides on gene expression in the heart of a mouse (the study was carried out jointly with the National Institute of Aging, Baltimore, USA)

22

1  Literature Review

most important factors in aging. However, studies have shown that cytogens in somatic human cells induce expression of the enzymatic component of telomerase, telomerase activity and elongation of telomeres in the G1 phase of the cell cycle and thereby increase the number of cell divisions (Khavinson et al. 2003b). It has been experimentally proved that the addition of the Ala-Glu-Asp-Gly tetrapeptide to a culture of human pulmonary fibroblasts induces the expression of the telomerase gene and promotes 2.4-fold elongation of telomeres. The activation of gene expression is accompanied by an increase in the number of cell divisions by 42.5%, which demonstrates overcoming the Hayflick Limit (Khavinson et al. 2003b, 2004). In addition, cytogens stimulate the expression of mitochondrial respiratory chain protein genes. In the course of changes inherent in the expression of the mitochondrial genome under the action of short peptides, it was found that Vilon, Epithalon, Cortagen change the level of mitochondrial protein genes more than 2 times: 16 S, NADH-dehydrogenase 1, cytochrome C oxidase 1, NADH-dehydrogenase 4, NADH-dehydrogenase 5, cytochrome B (Khavinson et al. 1999, 2003a, b, c, 2012a, b, c, d). Regulation of gene expression is the most likely cause of the physiological effects of peptides, such as restoring the rhythm of melatonin secretion and, therefore, circadian rhythms (Goncharova et al. 2007). Thus, peptide bioregulators contribute to improving the energy supply of tissues, reducing the formation of reactive oxygen species, preventing or correcting age-related disorders of immune, endocrine and other functions (Khavinson et al. 2005; Khavinson et al. 2012a, b, c, d). Among the genes, the expression of which changed when peptides were introduced into the body, the genes responsible for the cellular structure, the genes encoding peptides of cell defense systems, and the genes responsible for the perception of cellular signaling systems and communication systems were identified. No less important is the effect on the genetic clones of cytokines (IL-1β, IL-2, IL-5, IL-6, IL17A, TNFα, INFγ), which determine the intensity of both the cellular and humoral units of adaptive immunity. It is known that after the action of damaging agents on cells, not only the synthesis of heat shock proteins (HSP) is activated, but also their movement inside the cell. After stress, HSPs accumulate in the most vulnerable areas of the cell: in the first 4–5 h, in the nucleus, then in the perinuclear, subarcolemma zones and along actin filaments (Pockley 2003; Wood et al. 2006; Yanagisawa et al. 1988). After damage to the cell the purpose of the accumulation of HSPs in the nucleus is to protect the genetic material, limit the degradation of preribosomes, restore the structure and function of the nucleoli, and screen the nucleo-accessible sections of DNA. HSPs perform a chaperone function, protecting cells from many stressful effects, stabilizing the native conformation of intracellular proteins. It was found that short peptides are able to enhance the gene expression of one of the main chaperones, HSP70 (Khavinson et al. 2012a, b, c, d, 2013a, b, c, d; Kuznik et al. 2011). It is known that the molecular mechanism of reducing the functional activity of retinal cells is the basis of pathological processes in the retina. A change in the expression of differentiation markers involved in retinal ontogenesis is a key factor in the violation of homeostasis and the development of various dystrophic processes in it. The results of recent years of research indicate that short peptides stimulate the

1.4  Biological Effects of Peptide Bioregulators

23

differentiation of neurons and retinal pigment epithelial cells. Thus, according to the results of immunocytochemical studies, it was found that the dipeptide (Lys-Glu) and tetrapeptide (Ala-Glu-Asp-Gly) are inducers of retinal cell differentiation, which is consistent with data from other researchers on the stimulating effect of hormones and peptides on their functional activity. So, it is known that a change in the level of expression of somatostatin affects the differentiation of bipolar cells (Casini et al. 2005). In addition, according to the literature, it is known that some peptides ADNF-9 and NAP also contribute to the increased survival of ganglion cell culture, as well as stimulation of axon growth in retinal explants (Lagreze et al. 2005). It should be noted that the dipeptide (Lys-Glu) has a greater effect on the expression of the retinal pigment epithelial cell marker TTR, which gives grounds for the use of this peptide in the treatment of cone-rod dystrophy and some other neurodegenerative diseases, while tetrapeptide (Ala-Glu-Asp-Gly) exerts the most pronounced stimulation on the expression of transcription factors Vsx1 (a marker of initial and terminal differentiation of retinal bipolar cells), Pax6 (a marker of differentiation of multipotent retinal progenitor cells) and Brn3 (a marker of differentiation ganglion cells). This provides reason to use this peptide in the treatment of diabetic retinopathy and macular degeneration (Khavinson et al. 2013b, 2014a). An important aspect in explaining the action mechanism of peptide bioregulators is an understanding of the pathways for the penetration of short peptides into the cell and the possibility of their interaction directly with DNA (Kolchina et al. 2019). It is known that short peptides (cell penetrating peptides, CPPs) are a group of peptides consisting of no more than 20 amino acid residues with a molecular weight of up to 4 kDa (Chugh et al. 2010; Pockley 2003). Under physiological conditions, CPPs are multiply charged ions. They have the ability to non-covalently bind to nucleic acids, amino acids, and peptides and transport them to their destination inside the cell (Chugh et  al. 2010). The group of CPPs can include both natural (R-PTD4, bt-NLS, Lig1-PBD-F, F (Ahx) -TAT), and short synthetic peptides (Anisimov and Khavinson 2010; Vanyushin and Ashapkin 2011), for example, Lys-­ Glu (Vilon) and Ala-Glu-Asp-Gly (Epitalon). Hydrophilic short peptides, unlike steroid hormones, can bind to hydrophilic groups of phospholipids on the outer side of the cytoplasmic membrane; group and enter the cell using a mechanism close to endocytosis (Tünnemann et  al. 2006). Alkaline peptides containing an excess of positively charged amino acid residues in the structure also tend to penetrate the cell through the membrane. The advantage of these peptides is that they easily overcome the acidic glycocalyx layer that adheres to the cell membrane (Duchardt et al. 2007; Futaki et al. 2003). For synthetic alkaline and amphiphilic peptides containing several lysine residues in the structure, the ability was shown not only to penetrate into the cell, but also to form complexes with DNA and RNA (Pockley 2003). These oligopeptides also belong to the CPPs family, as they are intended for the transport function of transferring biologically active substances through the cell membrane (Morris and Depollier 2001; Morosov and Khavinson 1997; Ohno et al. 1998; Pockley 2003). In addition to the carrier function, these peptides are capable of simultaneously condensing DNA, blocking cellular metabolism, penetrating the nucleus and binding cellular receptors. The

24

1  Literature Review

direct interaction of the peptide with the membrane is determined by the electrostatic interaction of the positively charged side groups of the amino acid residues of arginine and lysine with the negative carboxyl groups of phosphatidylserine exposed on the outside of the cytoplasmic membrane (Denisov et al. 1998). For negatively charged (carboxyl) side groups of peptides, the binding sites are positively charged groups of phosphatidylcholine and phosphatidylethanolamine. Thus, endocytosis may be the main mechanism for the penetration of short peptides through the cytoplasmic membrane. To influence gene expression, short peptides must penetrate not only the cell, but also the nucleus. An important experimental fact confirming the ability of short peptides to penetrate the cell nucleus was a study that showed that FITC-labeled di-, tri- and tetrapeptides penetrate not only the cytoplasm, but also the nucleus and nucleolus of HeLa cells. HeLa cells were incubated with FITC-labeled peptides for 12 h (Fedoreeva et al. 2010). Moreover, in cell culture samples under the influence of peptides, fluorescence was detected in the cytoplasm, nucleus and nucleolus in the form of numerous small granules, while fluorescence was not observed in control samples (Fedoreeva et al. 2010). The relative fluorescence intensity of different labelled peptides in the nuclei of HeLa cells is different. Stronger fluorescence was expressed upon incubation of cells with FITC-labeled peptides Pinealone and Epitalon, and to a lesser extent with testagen. It is known that the nucleus of eukaryotic cells has a system of transport pores (nucleopores) formed by protein complexes of nucleoporins. The inner diameter of the nucleopores is about 50  nm, therefore, they are permeable to freely diffusing low molecular weight substances with a molecular weight of up to 3.5–5 kDa, which include the Lys-Glu and Ala-­ Glu-­ Asp-Gly peptides. FITC-labeled peptides Ala-Glu-Asp-Gly, Glu-Asp-Arg, Lys-Glu-Asp-Gly actually penetrate the cytoplasm, nucleus and nucleolus of HeLa cells (Fedoreeva et al. 2010). The mechanism of their transport into the nucleus may be similar to that described for natural CPPs, however, it is possible that short peptides can be transferred to the nucleus by larger natural CPPs (Pockley 2003). The values of the charge, size and hydropathy of short peptides indicate the possibility of their penetration through the cytoplasmic and nuclear membranes. The transport of substances is determined by the combination of their steric and physico-­ chemical properties. From Table  1.1 it can be seen that the sizes of the peptide molecules differ little from each other and turn out to be significantly smaller than the sizes of the nucleopores. The relatively high hydropathy (Testagen, Pancragen, Honluten) is determined by the presence of amino acid residues of lysine and arginine, as well as amphiphilic residues that can enhance if not transport, the associated peptides with the membrane (Khavinson et al. 2012b, c, 2013d). In order to study the mechanism of interaction of the Lys-Glu and Ala-Glu-Asp-­ Gly peptides with the genome, a molecular mechanics calculation method was used that is used with different force fields (MM +, Amber99, Opls, Charmm27) (Khavinson et al. 2012c). When calculating the interaction of the considered peptides with a DNA molecule, it was assumed that DNA has a right-handed orientation of the main chain and is in the β-form. On the molecular surface of the double helix, there are large and

1.4  Biological Effects of Peptide Bioregulators

25

small grooves, 2.1 and 1.2 nm wide, respectively. It turned out that the peptides Ala-­ Glu-­Asp-Gly (a) and Lys-Glu (b) interact with DNA in both large and small grooves, however, peptides form the most energetically advantageous complexes with DNA, binding to its large groove (Fig. 1.3). The step of the peptide chain per one amino acid is 0.35 nm, and the distance between base pairs in the DNA chain is 0.34 nm. Table 1.2 presents the regulatory regions of DNA containing sites of selective binding with the peptides under consideration, and models of the interaction of Ala-Glu-Asp-Gly with the ATTTC and Lys-Glu binding site with GCAG are constructed (Fig. 1.3). The interaction of Ala-Glu-Asp-Gly with the ATTTC sequence and its complementary TAAAG can be due to Van der Waals electrostatic interactions and the formation of hydrogen bonds (Joh et  al. 2008). In this case, a network of three hydrogen bonds was formed, shaped by oxygen atoms of the main chain of alanine and a nitrogen-containing fragment of adenine, a carboxyl group of the side chain of glutamic acid and a nitrogen-containing fragment of thymine, and a carboxyl group of the side chain of aspartic acid and a nitrogen-containing fragment of

Fig. 1.3  Localization of peptides in tentative binding sites of the promoter part of genes (Khavinson et  al. 2012c): (a)  – localization of Ala-Glu-Asp-Gly in the DNA region d (GGGAAATTCCTC) 2 (PDB: 2EZD), (b)  – localization of Lys-Glu in the DNA region d (GCAGCTTCCTGC) 2 (PDB: 1QMS). The peptide molecules are shown in the form of bound beads, DNA is shown in the form of a double-stranded right-handed helix. Nitrogen atoms are shown in blue, oxygen atoms in red, and carbon atoms in grey. Nonpolar hydrogen atoms are not shown in the figure

26

1  Literature Review

Table 1.2  Peptide binding sites in promoter regions of genes Regulatory regions of genes ranging from −200 to +175 relative to the transcription initiation point ggccttcagcctccgtaacccccgctcagg gtccccaccccctgcagccctgtccctcca ggatgcatggccttgtcctgtgtgggggtg gccgagagcactgccccagccctgggtacc ttgggcaggaagctggcagaggccagggct gccattcaaacaggggcaggtggttttgcc aggaggaagttgacagttcaacttcaaaca tgggtgacgcaggccccacactgcctgctc cccgtcccacccctccctgagcacgccacc ccgccctctccctctctgagagcgagatac ccggccagacaccctcacctgcggtgccca gctgcccaggctgaggcaagagaaggccagaaaccatgcccatggg IL-2 gggatttcacctacatccattcagtcagtctttgggggtttaaagaaattccaaagagtc (human) atcagaagaggaaaaatgaaggtaatgttt tttcagacaggtaaagtctttgaaaatatg tgtaatatgtaaaacattttgacaccccca taatatttttccagaattaacagtataaat tgcatctcttgttcaagagttccctatcactctctttaatcactactcacagtaacctca actcctgccacaatgtacaggatgcaactc ctgtcttgcattgcactaagtcttgcactt gtcacaaacagtgcacctacttcaagttct acaaagaaaacacagctacaactggagcatttactgctggatttac ММР2 tgagggtggacgtagaggccaggagtagcaggcggccggggaaaagaggtggagaaagga (human) aaaaagaggagaaaagtggaggagggcgagtaggggggtggggcagagaggggcgggccc gagtgcgccccccgcccccagccccgctctgccagctccctcccagcccagccggctaca tctggcggctgccctcccttgtttccgctgcatccagacttcctcaggcggtggctggag gctgcgcatctggggctttaaacatacaaagggattgccaggacctgcggcggcggcggc ggcggcgggggctggggcgcgggggccggaccatgagccgctgagccgggcaaaccccag gccaccgagccagcgg TERT cagacgcccaggaccgcgcttcccacgtgg (human) cggagggactggggacccgggcacccgtcc tgccccttcaccttccagctccgcctcctc cgcgcggaccccgccccgtcccgacccctc ccgggtccccggcccagccccctccgggcc ctcccagcccctccccttcctttccgcggc cccgccctctcctcgcggcgcgagtttcag gcagcgctgcgtcctgctgcgcacgtggga agccctggccccggccacccccgcgatgcc gcgcgctccccgctgccgagccgtgcgctc cctgctgcgcagccactaccgcgaggtgct gccgctggccacgttcgtgcggcgcctggggccccagggctggcgg

Protein genes CD5 (human)

Peptide Ala-Glu-­ Asp-Gly, Lys-Glu

Ala-Glu-­ Asp-Gly, Lys-Glu

Ala-Glu-­ Asp-Gly, Lys-Glu

Ala-Glu-­ Asp-Gly, Lys-Glu

adenine (Fig. 1.3a). During the interaction of Lys-Glu with the GCAG sequence and its complementary CGTC, three hydrogen bonds were found: the amino group of the lysine backbone forms hydrogen bonds with the oxygen atom of guanine and the nitrogen of cytosine, adenine (Fig. 1.3b).

1.4  Biological Effects of Peptide Bioregulators

27

Using the method of molecular docking and molecular dynamics, a sequence of nucleotides was selected, with which short peptides are most likely to bind. The sequence was found based on the energy values of the complexes. So, the sequence d (CCTGCC) turned out to be the putative binding site located in the promoter region of the TPH protein gene (Fig. 1.4). The energy of the complex of the Glu-Asp-Arg (a) peptide with site d (CCTGCC) was −17.2 kcal/mol, and the Lys-Glu-Asp (b) peptide was 23.0 kcal/mol. The main contribution to the energy was made by the lysine side chain in the Lys-Glu-Asp peptide (Khavinson et al. 2014b). Constructed models of interaction of short peptides using Lys-Glu and Ala-Glu-­ Asp-Gly as examples are an important aspect for understanding their relationship with certain genes and the synthesis of the corresponding proteins (Table 1.2). So, the GCAG sequence, which, according to the simulation, Lys-Glu binds with, is repeated 10 times in the promoter region of the gene encoding the transmembrane protein CD5. It was previously established that under the action of the Lys-Glu peptide in the pineal gland, thymus and spleen, the expression of the CD5 molecule on the lymphocyte precursors changes, which indicates their proliferation and/or differentiation (Khavinson et  al. 2014b; Anisimov and Khavinson 2010). The ATTTC sequence complementary to Ala-Glu-Asp-Gly was detected 8 times in the promoter parts of the IL-2 cytokine gene, 3 times in the matrix metalloproteinase-2 (MMP2) gene, and 10 times in the TERT telomerase catalytic subunit gene. It was previously found that the tetrapeptide Ala-Glu-Asp-Gly regulates the activity of immune cells, including the production of cytokines by them, which include IL-2. In addition, Ala-Glu-Asp-Gly restores the expression of the MMP2 protein involved in the regulation of the intercellular matrix in the pineal gland and thymus and induces the expression of the telomerase gene, which leads to a 2.4-fold elongation of telomeres. Bold italics indicate putative binding sites for the Lys-Glu peptide, bold italics and underscore indicates putative binding sites for the Ala-Glu-Asp-Gly peptide to

Fig. 1.4  Model of interaction between short peptides Glu-Asp-Arg (a) and Lys-Glu-Asp (b) and site d (CCTGCC). Peptide molecules are depicted as ball and sticks, DNA molecule in the form of tubes. Dotted lines indicate hydrogen bonds between atoms

28

1  Literature Review

the genes. The promoter regions of genes were taken from the GenBank database (NCBI). CD5 is T and B cell lymphocyte receptor gene; IL-2 is interleukin 2 gene; MMP2 is matrix metalloproteinase 2 gene; TERT is telomerase catalytic subunit gene. It is now established that activation of the transcription factors is insufficient to induce expression. This process requires a second level of expression regulation associated with chromatin modification (Berger 2007; Dawson et al. 2009; Martin and Rice 2007). A prerequisite for gene transformation is the presence of active chromatin (Martin and Rice 2007), which is an extremely complex and dynamic complex in which DNA is packaged with the help of histone proteins. The density of DNA packaging depends on its methylation status and histone modification. Chromatin decondensation is required to bind transcription factors to DNA and start the DNA-synthesizing complex. Moreover, it is chromatin that determines which genes need to be expressed, and also promotes selective extraction of genetic information from DNA. As studies show (Khavinson et al. 2005), under the influence of short peptides (Vilon, Epitalon, Livagen, Prostamax, and Cortagen) in the lymphocytes of older people, heterochromatization of satellite filaments occurs, causing activation of ribosomal genes during aging. The results suggest that short peptides in the lymphocytes of older people degenerate the general (optional and structural) heterochromatin (Khavinson et al. 2013c; Lezhava et al. 2004). Thus, short peptides, penetrating the nuclear membrane, regulate gene expression and, therefore, synthesize specific protein molecules through modification of transcription factors, as well as through chromatin decondensation (Morozov et al. 2000; Khavinson et  al. 2011a, 2012b, c, 2013d; Khavinson and Morozov 2001; Khavinson 2002). High biological activity of cytomedines and cytogens made it possible to create drugs based on them. Currently, six drugs (Thymalin, Thymogen, Epithalamin, Prostatilen, Cortexin, Retinalamin) are registered in Russia and some other countries, and seven more drugs are at various stages of approval in the Ministry of Health of the Russian Federation. The long-term clinical study of peptide bioregulators has shown that many cytomedines and cytogens have a pronounced geroprotective and antitumor effect (Khavinson et al. 2005; Khavinson and Morozov 2001; Khavinson 2002; Khavinson et al. 2005). The leading peptide bioregulator (cytomedine) in ophthalmology is Retinalamin. Retinalamin is a complex of peptides isolated from the retinas of animals. The drug regulates the processes of metabolism in the retina, stimulates functions of cellular elements, helps to improve the functional interaction of the pigment epithelium and the outer segments of the photoreceptors with various retinal pathologies, enhances the activity of retinal macrophages, has a normalizing effect on blood coagulation and has a pronounced protective effect on vascular endothelium (Khavinson 2002; Khavinson et al. 2005). The active study of Retinalamin began in 1985, when it was first isolated. Over the years, numerous studies have been conducted to study its safety, retinoprotective activity, as well as its effect on the state of the human body as a whole.

1.4  Biological Effects of Peptide Bioregulators

29

The aim of one of the first studies was to study the effect of Retinalamin (in various concentrations) on immunity indicators, blood rheological properties, and also safety. The data obtained indicated the absence of acute or chronic toxicity of Retinalamin, as well as any complications after the use of this peptide. Results were obtained on the normalizing effect of the drug on the state of the hemocoagulation system. In addition, the immunomodulatory effect of Retinalamin has been shown. Under its influence, the expression of receptors on T and B lymphocytes significantly increased, as well as the phagocytic activity of neutrophils (Dneprovskaya and Kharintseva 1988; Khavinson et al. 2005). Based on the concept of bioregulatory therapy, which suggests that polypeptides from various organs increase the resistance of these organs to the action of pathological agents, a series of experiments have been carried out proving the retinoprotective property of Retinalamin. Based on experimental models of retinal dystrophy created, the effect of Retinalamin on the course of pathological processes was investigated. The drug had a pronounced therapeutic effect in toxic retinal dystrophy caused by the introduction of a 3% potassium iodide solution. With ophthalmoscopy in experimental rabbits treated with Retinalamin, a decrease in the size of dystrophic foci and retinal edema was observed. Clinical data was confirmed by histological examination (Dneprovskaya and Kharintseva 1988). In the early 1990s, a lot of experimental work was done to study the effect of Retinalamin on the regeneration processes of the neuroreceptor apparatus of the eye. For this purpose, rats suffering from genetically determined retinal pigment degeneration were taken as an experimental model. The data obtained testified to the ability of Retinalamin to inhibit the development of the dystrophic process of the retina. This lead to the use of Retinalamin in patients with retinitis pigmentosa. (Danilichev et  al. 1992; Khavinson and Trofimova 2000). Studies have been conducted to assess the combined use of Retinalamin with microsurgical treatment of the eye for injuries of the cornea and retina and their consequences. To this end, experimental models have been created to study reparative processes in the cornea and retina. The research results showed that under the action of the peptide, the restoration of the damaged epithelial, stromal and endothelial layers of the cornea was reduced by a factor of 1,5–2 (according to endothelial microscopy). With through wounds of the cornea, in addition to accelerating reparative regeneration, peptide bioregulators increased the strength of the forming corneal scar by a factor of 1.8, and strengthened the function of local immunity (according to the lysosomal-cationic test, by a factor of 2.2–2.5). The use of Retinalamin in experimental laser damage to the retina, as well as in toxic dystrophy caused by the action of monoiodoacetic acid, made it possible to obtain a therapeutic effect in almost 80% of experimental animals. This manifests itself in a acceleration by a factor of 2–2.5 (compared with the control group) of retinal defect coverage by cells pigment epithelium, preventing the further development of the pathological process, as well as reducing (according to the electroretinogram) the degree of inhibition of the functional state of the retina (Danilichev and Maksimov 1994; Khavinson and Maksimov 1994; Khavinson and Trofimova 2000). Retinalamin had a normalizing effect on the course of experimental retinal vein thrombosis caused

30

1  Literature Review

by the introduction of thrombin (Kharintseva 1996). In the control group, a histological examination of rabbit eyes revealed significant pathological changes characteristic for retinal vein thrombosis: extensive plasma and haemorrhages, in the inner granular layer were observed fragmentation of associative neurons, extensive foci of necrosis covering all layers of the retina, and retinal detachment over a large length. When using Retinalamin, the histological picture improved significantly: retinal edema was observed only in the outer layers, haemorrhages were practically absent, massive foci of necrosis were not present, and only single neurons were destroyed. Thus, the data obtained also testified to the retinoprotective activity of Retinalamin. The results of these experimental studies justified the use of Retinalamin in therapy in patients with various diseases of the retina (Trofimova et al. 2006). Retinalamin has been used in treating patients with various pathologies of the retina (age-related macular degeneration, retinitis pigmentosa, diabetic retinopathy and other diseases) since the beginning of the 1990s. The first clinical studies on the use of the peptide retinoprotector were carried out in the ophthalmology clinic of the Military Medical Academy. (Zhuravleva 1992; Danilichev and Maksimov 1994; Khavinson and Trofimova 2000). The criteria for evaluating the effectiveness of treatment with a peptide drug were the results of visometry (visual acuity), computer perimetry, fundus fluorescein angiography, biomicroscopy, and ophthalmoscopy. Studies showed that Retinalamin has a pronounced retinoprotective property and is completely safe for humans. Further long-term studies of the use of Retinalamin in patients with retinal pathology confirmed the data obtained (Trofimova and Khavinson 2002a; Neroev and Zaitseva 2015). In 2017, a meta-­ analysis of clinical studies of the use of Retinalamin in patients with a dry form of age-related macular degeneration was carried out. For the meta-analysis, 320 scientific articles describing the action of Retinalamin were used and published between 2006 and 2017. The study showed that Retinalamin contributes to a significant increase in visual acuity. According to the analysis, visual acuity after treatment did not decrease for 6 months. In addition, a repeated course of Retinalamin contributed to an increase and prolongation of the positive effect at various stages of macular degeneration in a period of up to 1 year (Yerichev et al. 2017). Retinalamin has been proven to be an effective drug in the rehabilitation of patients with retinal detachment in the postoperative period. Its use made it possible to stabilize and maintain at a certain level the electrophysiological parameters of the retina during the entire period of observation of the patients. In addition, the treatment contributed to a significant increase in visual acuity, as well as an increase in visocontrastometry. A high clinical effect was obtained with the use of Retinalamin with retinal hypercoagulation after laser exposure. With laser burns, during treatment with the peptide, the electrical sensitivity of the retina increased, and the ERG returned to normal. Often with eye injuries, despite the satisfactory restoration of the anatomical integrity of the structures of the eyeball, the outcome of the treatment depends on the restoration of the functional capabilities of the neurosensory apparatus of the eye and, in particular, the retina. The combined use of peptide bioregulators (Retinalamin, Thymalin, Cortexin) and microsurgical treatment in

1.4  Biological Effects of Peptide Bioregulators

31

most cases allowed an organ-preserving effect on the eye, and in 64.6% of cases even increased visual functions (Zozulya and Maksimov 1997; Gavrilova et  al. 2004; Egorov 2017). Data on the high clinical effect of the use of Cortexin and Retinalamin with partial optic atrophy have been obtained. The use of these drugs contributed to increasing the electrical sensitivity of the retina and lowering the thresholds of perception of the optic nerve (Khavinson and Trofimova 2000). The complex use of peptide bioregulators (Retinalamin, Epitalamin, Cortexin) in patients with diabetic retinopathy made it possible to achieve a positive clinical effect in 90% of cases. Regular use of a complex of peptide drugs can stop the progression of the pathological process. In addition, it is possible to increase visual function by increasing the functional activity of the retina and improving retinal blood flow (according to fluorescein angiography, electrophysiological studies of the retina), normalize carbohydrate metabolism and the immune status of patients (Trofimova and Khavinson 2001, 2002b). Due to the fact that Retinalamin is a powerful retinoprotector, it has a positive clinical effect in the treatment of retinitis pigmentosa. Regular use of Retinalamin allows not only to stabilize the pathological process, but also to improve the clinical course of the disease (Trofimova and Neroeva 2004). Under the action of Retinalamin, an increase in the functional activity of the retina occurs (according to electroretinographic research), which helps to increase visual acuity, expand the boundaries of the visual field, reduce the number of scotomas, increase the threshold of light sensitivity and improve colour perception. With an increase in the number of courses, the positive effect intensifies (Trofimova et al. 2004). Retinalamin is currently widely used to treat various pathologies of the retina and by Order of the Minister of Health of the Russian Federation of December 24, 2012 No. 1520 N was included in the standards for the treatment of retinal pathology. Many years of experience using peptide bioregulators in ophthalmology and other areas of medicine confirm their high biological activity. It has been established that the integrated use of bioregulators leads to the restoration of the basic physiological functions of the cardiovascular, bronchopulmonary, and immune systems, normalizes liver functions, carbohydrate metabolism, melatonin levels, and telomere lengths. The use of a complex of peptides (according to the results of 15 years of clinical research) led to the restoration of basic physiological functions, increased physical performance, reduced morbidity and mortality in patients by 45% (Anisimov and Khavinson 2010). It should be noted that over the course of 35 years 45 million people have received peptide treatment. It must be emphasized that peptide bioregulators produce no allergic or adverse reactions, both during treatment or over repeated courses.

32

1  Literature Review

References Afarid, M., A.S. Sarvestani, F. Rahat, and A. Azimi. 2018. Intravitreal injection of bevacizumab: Review of our previous experience. Iranian Journal of Pharmaceutical Research 17 (3): 1093–1098. Akiyama, H., T. Nakazawa, M. Shimura, et al. 2002. Presence of mitogen-activated protein kinase in retinal Muller cells and its neuroprotective effect ischemia reperfusion injury. Neuroreport 13: 2103–2107. Allikmets, R., N. Shroyer, N. Singh, et al. 1997. Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration. Science 277: 1805–1807. Al-Zamil, W.M., and S.A. Yassin. 2017. Recent developments in age-related macular degeneration: A review. Clinical Interventions in Aging 12: 1313–1330. https://doi.org/10.2147/CIA. S143508. Anisimov, V.N., and V.Kh. Khavinson. 2010. Peptide bioregulation of aging: Results and prospects. Biogerontology 11: 139–149. Anisimov, V.N., V.G. Morozov, and V.Kh. Khavinson. 1987. Influence of the thymus polypeptide factors, bone marrow, epiphysis and blood vessels on life expectancy and tumor development in mice. Report of the USSR Academy of Sciences 293 (4): 1000–1004. Aramant, R.B., and M.J. Seiler. 2004. Retinal transplantation – Advantages of intact fetal sheets. Eye Research 23: 475–494. Arking, R. 1998. Biology of aging. Observations and principles. 2nd ed, 486. Sunderland: Sinauer. Banin, E., A.V. Cideciyan, T.S. Aleman, et al. 1999. Retinal rod photoreceptor-specific gene mutation perturbs cone pathway development. Neuron 23: 549–557. Bennett, J., Y. Zeng, R. Bajwa, L. Klatt, et al. 1998. Adenovirus-mediated delivery of rhodopsin-­ promoted bcl-2 results in a delay in photoreceptor cell death in the rd/rd mouse. Gene Therapy 5: 1156–1164. Bennis, A., J.G. Jacobs, L.A.E. Catsburg, et al. 2017. Stem cell derived retinal pigment epithelium: The role of pigmentation as maturation marker and gene expression profile comparison with human endogenous retinal pigment epithelium. Stem Cell Reviews and Reports 13 (5): 659–669. Berger, S.L. 2007. The complex language of chromatin regulation during transcription. Nature 447: 407–412. Bernstein, S., Smith Lois, Richard I. Somilari, and Guo Yan. eds. 2001. Age-related retinal gene expression changes and ARMD. In Abstract of conference on “Aging retina and early degeneration”, Boston, 28. Berson, E.L., B. Rosner, and M.A. Sandberg. 1993. A randomized trial of vitamin A and vitamin E supplementation for retinitis pigmentosa. Archives of Ophthalmology 111: 761–772. ———. 2004. Clinical trial of docosahexaenoic acid in patients with retinitis pigmentosa receiving vitamin A treatment. Archives of Ophthalmology 122 (9): 1297–1305. Besharse, J., and D.A.  Danis. 1983. Melatonin delays photoreceptor degeneration in the rd/rd. Science 219: 1341–1344. Bhattacharya, S., R.  Gangaraju, and E.  Chaum. 2017. Recent advances in retinal stem cell therapy. Current Molecular Biology Reports 3 (3): 172–182. https://doi.org/10.1007/ s40610-017-0069-3. Bhutto, I., and G.  Lutty. 2012. Understanding age-related macular degeneration (AMD): Relationships between the photoreceptor/retinal pigment epithelium/Bruch’s membrane/choriocapillaris complex. Molecular Aspects of Medicine 33: 295–317. https://doi.org/10.1016/j. mam.2012.04.005. Biesemeier, A., T.  Taubitz, S.  Julien, et  al. 2014. Choriocapillaris breakdown precedes retinal degeneration in age-related macular degeneration. Neurobiology of Aging 35 (11): 2562–2573. https://doi.org/10.1016/j.neurobiolaging.2014.05.003. Birch, D.G. 2006. Stargardt disease. In Principles and practice of clinical electrophysiology of vision, ed. J. Heckenlively and G. Arden, 727–734. London: The MIT Press.

References

33

Bressler, N.M., and S.B. Bressler. 1995. Preventive ophthalmology: Age-related macular degeneration. Ophthalmology 102: 1206–1211. Casini, G., E. Catalani, M. Dal Monte, and P. Bagnoli. 2005. Functional aspects of the somatostatinergic system in the retina and the potential therapeutic role of somatostatin in retinal disease. Histology and Histopathology 20 (2): 615–632. Cassone, V.M. 1998. Melatonin’s role in vertebrate circadian rhythms. Chronobiology International 15 (5): 457–473. Cheng, S.K., E.Y.  Park, and A.  Pehar. 2016. Current progress of human trials using stem cell therapy as a treatment for diabetes mellitus. American Journal of Stem Cells 5: 74–86. PMID: 27853629. Chew, E., T. Clemons, E. Agrón, R. Sperduto, J. SanGiovanni, N. Kurinij, and M. Davis. 2013. Long-term effects of vitamins C, E, beta-carotene and zinc on age-related macular degeneration. AREDS report No. 35. Ophthalmology 120: 1604–1611. https://doi.org/10.1016/j. ophtha.2013.01.021. Chuang, J.-Z., C. Vega, and W. Jun. 2004. Structural and functional impairment of endocytic pathways by retinitis pigmentosa mutant rhodopsin-arrestin complexes. The Journal of Clinical Investigation 114: 131–140. Chugh, A., F. Eudes, and Y.S. Shim. 2010. Cell-penetrating peptides: Nanocarrier for macromolecule delivery in living cells. IUBMB Life 62: 183–193. Cipolla-Neto, J., F.G. Amaral, S.C. Afeche, D.X. Tan, R.J. Reiter, et al. 2014. Melatonin, energy metabolism, and obesity: A review. Journal of Pineal Research 56 (4): 371–381. Convers, C.A., T. McLachlan, and A.C. Bow. 1987. Lipid metabolism in retinis pigmentosa. In Progress in clinical and biological research, vol. 247, 93–101. Cremers, F., and A.  Jose. 2002. Molecular genetics of Leber congenital amaurosis. Human Molecular Genetics 11 (10): 1169–1176. Cruz, L., K.  Fynes, O.  Georgiadis, et  al. 2018. Phase 1 clinical study of an embryonic stem cell-derived retinal pigment epithelium patch in age-related macular degeneration. Nature Biotechnology 36 (4): 328–337. https://doi.org/10.1038/nbt.4114. Curcio, C.A. 2018. Antecedents of soft drusen, the specific deposits of age-related macular degeneration, in the biology of human macula. Investigative Ophthalmology & Visual Science 59: AMD182–AMD194. https://doi.org/10.1167/iovs.18-24883. D’Cruz, P.M., D. Yasumura, J. Weir, M.T. Matthes, H. Abderrahim, M.M. LaVail, and D. Vollrath. 2000. Mutation of the receptor tyrosine kinase gene Mertk in the retinal dystrophic RCS rat. Human Molecular Genetics 9: 645–651. https://doi.org/10.1093/hmg/9.4.64. Danilichev, V.F., and I.B. Maksimov. 1994. Eye injuries and diseases: Use of enzymes and peptide bioregulators, 223. Minsk: Science and Technology. Danilichev, V.F., V.Kh. Khavinson, and L.A.  Vasilyeva. 1992. Treatment of peripheral pigment tapetoretinal abiotrophy. Ophthalmology Magazine 3: 172–178. Datseris, Y., R. Diamanti, and S. Trofimova. 2018. Retinoprotectiv effect of peptide bioregulators in treatment of retinitis pigmentosa. In Book of abstracts international symposium of experts «Effective current approaches in anti-aging medicine and gerontology», 30–33, Sweden, 13–14 April. Davis, B.M., L. Crawley, M. Pahlitzsch, F. Javaid, and M.F. Cordeiro. 2016. Glaucoma: The retina and beyond. Acta Neuropathologica 132: 807–826. https://doi.org/10.1007/s00401-016-1609-2. Dawson, M.A., A.J. Bannister, B. Gottgens, et al. 2009. JAK2 phosphorylates histone H3Y41 and excludes HPI alpha from chromatin. Nature 461: 819–822. Day, S., K. Acquah, and P. Mruthyunjaya. 2011. Ocular complications after anti-vascular endothelial growth factor therapy in medicare patients with age-related macular degeneration. American Journal of Ophthalmology 152 (2): 266–272. Delori, F., G. Douglas Goger, and R. Sparrow. 2001. Janet Spectral characteristics of retinal autofluorescence in aging and of A2E in cultured RPE cells. In Abstract of Conference on “Aging retina and early degeneration”, Boston, 21

34

1  Literature Review

Denisov, G., S. Wanaski, P. Luan, et al. 1998. Binding of basic peptides to membranes produces lateral domains enriched in the acidic lipids phosphatidylserine and phosphatidylinositol 4.5-bisphosphate: An electro-static model and experimental results. Biophysical Journal 74 (2): 731–744. Di Crecchio, L., M.B. Parodi, and G. Sanguinetti. 2004. Hyperhomocysteinemia and the methylenetetrahydrofolate reductase 677C-T mutation in patients under 50 years of age affected by central retinal vein occlusion. Ophthalmology 111 (5): 940–945. Dneprovskaya, A.I., and S.V. Kharintseva. 1988. Influence of peptides from the retina on the state of hemostasis, immunity and the course of experimental retinopathy. In Cytomedines, Under the editorship of B.I. Kuznik, 35–36. Chita: Chitin State Medical University. Dubocovich, M.L. 1983. Melatonin is a potent modulator of dopamine release in the retina. Nature 306: 782–784. Duchardt, F., M. Fotin-Mleczek, H. Schwarz, et al. 2007. A comprehensive model for the cellular uptake of cationic cell-penetrating peptides. Traffic 8: 848–866. Egorov, E.A. 2017. Retinalamin for varios ophthalmic disorders: Clinical experience. RMJ Clinical Ophthalmology 1: 35–38. Ehinger, B. 1998. Transplantation of photoreceptors and of full thickness retina. In Abstracts of 10th world conference of IRPA. (International Retinitis Pigmentosa Association.), Lugano, 16. Enseleit, F., S. Michels, I. Sudano, et al. 2017. SAVE-AMD: Safety of VEGF inhibitors in age-related macular degeneration. Ophthalmologica 238 (4): 205–216. https://doi.org/10.1159/000478665. Ermilov, V.V., and O.V. Trofimenko. 1998. Senile local isolated amyloidosis of the eye as a sign of age-related pathology. Successes of Gerontology 2: 117–119. Ermilov, V.V., and A.M. Vodovozov. 1995. The Role of local amyloidosis of the eye ground tissues in the pathogenesis of senile maculopathy. Bulletin of Ophthalmology 111 (4): 24–27. Falavarjani, K.G., and Q.D.  Nguyen. 2013. Adverse events and complications associated with intravitreal injection of anti-VEGF agents: A review of literature. Eye (London, England) 27 (7): 787–794. Fedoreeva, L.I., I.I. Kireev, V.Kh. Khavinson, and B.F. Vanyushin. 2010. Penetration of short fluorescence labeled peptides into the nucleus in HeLa cells and in vitro specific interaction of the peptides with deoxyribo-oligonucleotides and DNA. Biochemistry 76: 1210–1219. Fernández-Robredo, Р., А. Sancho, S. Johnen, et al. 2014. Current treatment limitations in age-­ related macular degeneration and future approaches based on cell therapy and tissue engineering. Journal of Ophthalmology: 510285. https://doi.org/10.1155/2014/510285. Ferrari, S., E. Iorio, V. Barbaro, D. Ponzin, F.S. Sorrentino, and F. Parmeggiani. 2011. Retinitis pigmentosa: Genes and disease mechanisms. Current Genomics 12: 238–249. Firsova, N.V., Y.V. Markitantova, Y.A. Smirnova, I.G. Panova, and R.D, Zinovieva. 2011. Analysis of TGFbeta2 expression in human eye tissues in prenatal development. In Izvestiya RAS. The biology series, vol. 1, 16–23. Fishman, G.A., L.D.  Gilbert, and R.G.  Fiscella. 1989. Acetazolamide for treatment of chronic macular edema in retinitis pigmentosa. Archives of Ophthalmology 107: 1445–1452. Forsell, J., P. Ekstrom, L.N. Flamarique, and B. Holmqvist. 2001. Expression of pineal ultraviolet and green-like opsins in the pineal organ and retina of teleosts. The Journal of Experimental Biology 204 (14): 2517–2525. Framme, C., J. Roider, H.G. Sachs, et al. 2005. Noninvasive imaging and monitoring of retinal pigment epithelium patterns using fundus autofluorescence—Review. Current Medical Imaging Reviews 1: 89–103. Friedman, P.K., R. Pineda, and P.K. Kaiser. 1998. The Massachusetts eye and ear infirmary illustrate manual of ophthalmology, 432. Philadelphia: W.B. Saunders. Futaki, S., S.  Goto, and Y.  Sugiura. 2003. Membrane permeability commonly shared among arginine-­rich peptides. Journal of Molecular Recognition 16 (5): 260–264. Gavrilova, N.A., T.N.  Fedorova, S.V.  Trofimova, I.V.  Pimenov, and N.I.  Lanevskaya. 2004. Influence of cytomedins on hemostatic and antioxidant potentials in patients with early stages of diabetic retinopathy. Experimental and Clinical Pharmacology 5: 25–27.

References

35

Ghosh, F., F.  Wong, K.  Johansson, A.  Bruun, and R.M.  Petters. 2004. Transplantation of full-thickness retina in the rhodopsin transgenic pig. Retina 24: 98–109. https://doi. org/10.1097/00006982-200402000-00014. Goncharova, N.D., V.Kh Khavinson, and B.A. Lapin. 2007. Pineal gland and age-related pathology (mechanisms and correction), 168. Nauka: SPb. Gupta, A., J.K. Sun, and P.S. Silva. 2018. Complications of intravitreous injections in patients with diabetes. Seminars in Ophthalmology 33 (1): 42–50. Harman, D. 1956. Aging: A theory based on free radical and radiation chemistry. Journal of Gerontology 3: 298–300. Haruta, M., Y. Sasai, H. Kawasaki, K. Amemiya, S. Ooto, M. Kitada, H. Suemori, N. Nakatsuji, C. Ide, and Y. Honda. 2004. In vitro and in vivo characterization of pigment epithelial cells differentiated from primate embryonic stem cells. Investigative Ophthalmology & Visual Science 45: 1020–1025. https://doi.org/10.1167/iovs.03-1034. Hauswirth, W.W., T.S. Aleman, and S. Kaushal. 2008. Treatment of Leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: Short-term results of a phase I trial. Human Gene Therapy 19 (10): 979–990. Heier, J.S., D.M.  Brown, V.  Chong, J.-F.  Korobelnik, P.K.  Kaiser, Q.D.  Nguyen, B.  Kirchhof, A. Ho, Y. Ogura, G.D. Yancopoulos, et al. 2012. Intravitreal aflibercept (VEGF trap-eye) in wet agerelated macular degeneration. Ophthalmology 119: 2537–2548. Herzog, E.D., and G.D. Block. 1999. Keeping an eye on retinal cloks. Chronobiology International 16: 229–247. Holan, V., P.  Trosan, and C.  Cejka. 2015. A comparative study of the therapeutic potential of mesen-chymal stem cells and limbal epithelial stem cells for ocular surface reconstruction. Stem Cells Translational Medicine 4 (9): 1052–1046. https://doi.org/10.5966/sctm.2015-0039. Idelson, M., R. Alper, A. Obolensky, E. Ben-Shushan, I. Hemo, N. Yachimovich-Cohen, H. Khaner, Y. Smith, O. Wiser, M. Gropp, et al. 2009. Directed differentiation of human embryonic stem cells into functional retinal pigment epithelium cells. Cell Stem Cell 5: 396–408. https://doi. org/10.1016/j.stem.2009.07.002CrossR. Ikeda, T., H. Obayashi, G. Hasegawa, et al. 2001. Paraoxonase gene polymorphisms and plasma oxidized low-density lipoprotein level as possible risk factors for exudative age-related macular degeneration. American Journal of Ophthalmology 132 (2): 191–195. Illing, M., R. Rajan, and N. Bence. 2002. A rhodopsin mutant linked to autosomal dominant retinitis picmentosa is prone to aggregate and interacts with the ubiquitin proteasome system. The Journal of Biological Chemistry 277: 34150–34160. Ip, M.S., I.U. Scott, P.C. VanVeldhuisen, N.L. Oden, and B.A. Blodi. 2009. A randomized trial comparing the efficacy and safety of intravitreal triamcinolone with observation to treat vision loss associated with macular edema secondary to central retinal vein occlusion: The standard care vs corticosteroid for retinal vein occlusion (SCORE) study report 5. Archives of Ophthalmology 127: 1101–1114. Iuvone, P.M., and J. Gan. 1995. Functional interaction of melatonin receptors and D1 dopamine receptors in cultured chick retinal neurons. The Journal of Neuroscience 15: 2179–2185. Jha, B.S., and K. Bharti. 2015. Regenerating retinal pigment epithelial cells to cure blindness: A road towards personalized artificial tissue. Current Stem Cell Reports 1 (2): 79–91. https://doi. org/10.1007/s40778-015-0014-4. Joh, N.H., A.  Min, S.  Faham, et  al. 2008. Modest stabilization by most hydrogen-bonded side chain interactions in membrane proteins. Nature (Great Britain) 453 (7199): 1266–1270. Johns, D.R. 1994. Mt DNA mutations and ophthalmological disease. In: Molecular genetics of ocular diseases, ed. J.L. Wiggs, 201–217. New York: Wiley – Liss. Ju, W.K., K.Y. Kim, and A.H. Neufeld. 2003. Increased activity of cyclooxygenase-2 signals early neurodegenerative events in the rat retina following transient ischemia. Experimental Eye Research 77: 137–145.

36

1  Literature Review

Junyi, L., L. Na, and J. Yan. 2015. Mesenchymal stem cells secrete brain-derived neurotrophic factor and promote retinal ganglion cell survival after traumatic optic neuropathy. Craniofacial Surgery 26 (2): 548–552. https://doi.org/10.1097/SCS.0000000000001348. Justino, L., H. Kergoat, and M.J. Kergoat. 2001. Changes in the retinocortical evoked potentials in subjects 75 years of age and older. Clinical Neurophysiology 112 (7): 1343–1348. Kanski, J.J. 2001. Systemic diseases and the eye, 249. MOSBY. Karwatowski, W., T. Jeffries, V. Dauance, et al. 1995. Preparation of Bruch’s membrane and analysis of the age-related changes in the structural collagens. The British Journal of Ophthalmology 79: 944–952. Kharintseva, S.V. 1996. Influence of retilin on the course of experimental vascular thrombosis of the conjunctiva and retina. In Regulatory peptides in norm and pathology (cytomedins): Course of scientific works, under the editorship of B.I. Kuznik, 28–30. Chita: Chitin Medical Academy. Khavinson, V. 2001a. Tissue-spesific effect of the peptides. Bulletin of Experimental Biology and Medicine 132 (2): 807–808. Khavinson, V.Kh. 2001b. Tissue-specific peptides action. Bulletin of Experimental Biology and Medicine 132 (8): 228–229. ———. 2002. Peptides and ageing. Neuroendocrinology Letters (Special Issue): 144. ———. 2004. Tetrapeptide revealing geroprotective effect, pharmacological substance on its basis, and the method of its application/US patent N 6.727.227. Khavinson, V.Kh., and N.I. Chalisova. 2000. Studies of cytomedines in organotypic nerve tissue culture. Neuroscience and Behavioral Physiology 30 (3): 261–265. Khavinson, V.Kh., and I.B. Maksimov. 1994. Use of retinol for the treatment of retinal diseases. Military Medical Magazine 7: 62–63. Khavinson, V.Kh., and V.G. Morozov. 2001. Epiphysis and thymus peptides in the regulation of ageing, 160. SPb.: ICF “Foliant”. Khavinson V.Kh., Izmaylov D.M., Obukhova L.K., Malinin V.V. 2000. Effect of epitalon on the lifespan increase in Drosophila meloanogaster // Mech. Ageing Dev. Vol. 120. P. 141–149. Khavinson, V. Kh., and S.V. Trofimova. 2000. Peptide bioregulators in ophthalmology, 46. SPb. Khavinson, V.Kh, N.I. Chalisova, and V.B. Okulov. 1997. The peptides from the brain promotes neurite growth in tissue culture. Primary Sensory Neuron 2: 43–49. Khavinson, V.Kh., V.M. Hokkanen, and S.V. Trofimova. 1999. Peptide bioregulators in the treatment of diabetic retinopathy, 118. SPb.: Folio. Khavinson, V.H., V.A. Barinov, A.V. Arutyunyan, and V.V. Malinin. 2003a. Free radical oxidation and aging, 328. Nauka: SPb. Khavinson, V.Kh, I.E. Bondarev, and A.A. Butyugov. 2003b. Peptide Epitalon induces telomerase activity and telomere elongation in human somatic cells. Bulletin of Experimental Biology and Medicine 135 (6): 692–695. Khavinson, V.Kh, T.A. Lezhava, J.R. Monaselidze, T.A. Jokhadze, N.A. Dvalis, N.K. Bablishvili, and S.V.  Trofimova. 2003c. Peptide Epitalon activates chromatin at the old age. Neuroendocrinology Letters 24 (5): 329–333. Khavinson, V.Kh, I.E.  Bondarev, A.A.  Butyugov, and T.D.  Smirnova. 2004. Peptide helps to overcome the limit of division of human somatic cells. Bulletin of Experimental Biology and Medicine 137 (5): 613–616. Khavinson, V.Kh., S.V. Anisimov, V.V. Malinin, and V.N. Anisimov. 2005. Peptide regulation of genome and ageing. / /Moscow: RAMS. P.: 208. Khavinson, V.Kh., E.I. Grigoriev, V.V. Malinin, and G.A. Ryzhak. Peptide substance revealing a stress protective effect, pharmaceutical composition on its base and the method of its application. Patent US 8,071,556 dated 23.05.2006. Khavinson V.Kh., V.G. Morozov, V.V. Malinin, and E.I. Grigoriev. 2007. Tetrapeptide stimulating functional activity of neurons, pharmacological agent based thereon and method of use thereof. Patent US N 7.189.701. Khavinson, V.Kh., V.V. Malinin, and G.A. Ryzhak. 2008a. Pharmaceutical substance normalizing cartilaginous tissue functions and method for producing the same. Patent ЕА 010724.

References

37

Khavinson, V.Kh., G.A.  Ryzhak, E.I.  Grigoriev, and I.Yu. Ryadnova. 2008b. Peptide substance restoring function of respiratory organs. European patent. ЕР 1758922. ———. 2008c. Peptide substance restoring myocardium function. European patent. ЕР 1758923. ———. 2008d. Peptide substance restoring myocardium function. US 7,662,789. Khavinson, V.Kh., E.I. Grigoriev, V.V. Malinin, and G.A. Ryzhak. 2009a. Peptide substance stimulating regeneration of central nervous system neurons, pharmaceutical composition on its base, and the method of its application. European patent. ЕР 2024388. Khavinson, V.Kh., V.V. Malinin, E.I. Grigoriev, and G.A. Ryzhak. 2009b. Tetrapeptide regulating blood glucose level in diabetes mellitus. US patent N 7.491.703. Khavinson, V.Kh., G.A. Ryzhak, E.I. Grigoriev., and I.Yu. Ryadnova. 2009c. Peptide substance restoring respiratory organs function. Patent US 7.625.870. Khavinson V.Kh., E.I. Grigoriev, V.V. Malinin, and G.A. Ryzhak. 2010. Peptide, pharmaceutical composition, and a method of treating microcirculation disorders. US patent N 7. 851.449. Khavinson, V.Kh, V.V. Malinin, and B.F. Vanyushin. 2011a. Role of peptides in epigenetic regulation of gene activity in ontogenesis. Bulletin of Experimental Biology and Medicine 10: 452–457. Khavinson, V.Kh, L.I. Fedoreeva, and B.F. Vanyshin. 2011b. Short peptides modulate the effect of endonucleases of wheat seedling. Biochemistry, Biophysics and Molecular Biology 437 (1): 124. Khavinson, V.Kh, N.S.  Linkova, A.V.  Trofimov, V.O.  Polyakova, N.N.  Sevostyanova, and I.M. Kvetnoy. 2011c. Peptides regulate cortical thymocytes differentiation, proliferation, and apoptosis. Biology Bulletin Reviews 1 (4): 390–394. Khavinson, V.Kh, B.I. Kuznik, and G.A. Ryzhak. 2012a. Peptide regulators – A new class of geroprotectors. Message 1. The results of experimental investigations. Successes of Gerontology 25 (4): 696–708. Khavinson, V.Kh., A.  Yu. Soloviev., D.  V. Zhilinsky., and others. 2012b. Epigenetic aspects of peptide regulation of aging, vol. 1, 11–22. Khavinson, V.Kh, S.I. Tarnovskaya, N.S. Linkova, and others. 2012c. Short peptides that penetrate the cell: A model of interaction with promoter sites of genes. Bulletin of Experimental Biology and Medicine 9: 391–396. Khavinson, V.Kh, N.S. Linkova, and V.E. Pronyaeva. 2012d. Method of creating a monolayer of cells based on organotypic culture for testing physiologically active substances. Bulletin of Experimental Biology and Medicine 2: 759–763. Khavinson, V.Kh, B.I.  Kuznik, N.S.  Linkova, and V.E.  Pronyaeva. 2013a. Influence of peptide regulators and cytokines on life expectancy and age-related changes in the hemostatic system. Suction of Phisiology Sciences 44 (1): 39–53. Khavinson, V.Kh, Y. Soloveva, S.I. Tarnovskaya, and N.S. Linkova. 2013b. Mechanism of biological activity of short peptides: Cell penetration and epigenetic regulation of gene expression. Biology Bulletin Reviews 3: 451–455. Khavinson, V.Kh, V.E.  Pronyaeva, N.S.  Linkova, and S.V.  Trofimova. 2013c. Peptidergic regulation differentiation of retinal embryonic cells. Cell Technologies in Biology and Medicine 1: 57–60. Khavinson, V.Kh, A. Yu Soloviev, S.I. Tarnovskaya, and N.S. Linkova. 2013d. Mechanism of biological activity of short peptides. Cell penetration and epigenetic regulation of gene expression. Suction Model Biology 2: 197–203. Khavinson, V.Kh, V.E.  Pronyaeva, N.S.  Linkova, S.V.  Trofimova, and R.S.  Umnov. 2014a. Molecular aspects of peptide regulation of retinal functions in retinitis pigmentosa. Human Physiology 40 (1): 129–134. Khavinson, V.Kh, N.S. Linkova, S.I. Tarnovskaya, R.S. Umnov, E.V. Elashkina, and A.O. Durnova. 2014b. Short peptides stimulate serotonin expression in cortical cells. Bulletin of Experimental Biology and Medicine 1: 89–93.

38

1  Literature Review

Khavinson, V., S. Trofimova, A. Trofimov, and I. Solomin. 2019. Molecular-physiological aspects of regulatory effect of peptide retinoprotectors. Stem Cell Reviews and Reports: 4. https://doi. org/10.1007/s12015-019-09882-7. Khavinson, V.Kh., V.V. Malinin, and E.I. Grigoriev. Tetrapeptide regulating prostate functions and its compositions and methods. EP № 1 353 939 B1 from 25.08.2004. Kijlstra, A., and T.T. Berendschot. 2015. Age-related macular degeneration: A complementopathy. Ophthalmic Research 54 (2): 64–73. https://doi.org/10.1159/000432401. Kolchina, N., V. Khavinson, N. Linkova, A. Yakimov, D. Baitin, A. Afanasyeva, and M. Petukhov. 2019. Systematic search for structural motifs of peptide binding to double-stranded DNA. Nucleic Acids Research 47 (20): 10553–10563. https://doi.org/10.1093/narlgkz850. Kornzweig, A.L. 1965. The eye in old age. American Journal of Ophthalmology 60 (5): 835–843. Krasnov, M.L., and V.S. Belyaev. 1988. Guide to eye surgery, ed. M. Meditsina, 221. Kumar, A., K. Narayanan, and R.K. Chaudhary. 2016. Current perspective of stem cell therapy in neurodegenerative and metabolic diseases. Molecular Neurobiology 54: 7276–7296. https:// doi.org/10.1007/s12035-016-0217-4. Kumar-Singh, R., and D.B.  Farber. 1998. Encapsidated adenovirus minichromosome-mediated delivery of genes to the retina: application to the rescue of photoreceptor degeneration. Human Molecular Genetics 7 (12): 1893–1990. ———. 2000. Construction and use of enecapsidated adenovirus minichromosomes (gutted vectors) for gene delivery to photoreceptors. Methods in Enzymology 316: 734–743. Kuznik, B.I., V.P. Mishchenko, V.Kh. Khavinson, et al. 1986. Influence of the polypeptide factor of the vascular wall on the state of the hemostatic system in experimental peroxidation syndrome. Pharmacology and Toxicology 6: 39–43. Kuznik, B.I., V.G.  Morozov, V.Kh. Khavinson, and others. 1987. Vascular wall as an efferent regulator of immunogenesis, hemostasis, kallikrein-kinin system and regenerative processes. Physiology Journal of the USSR 4: 499–505. Kuznik, B.I., V.G.  Morozov, and V.Kh. Khavinson. 1998. Tsitomediny (25-year experience of experimental and clinical research)., 310. Nauka: SPb. Kuznik, B.I., A.V. Pateyuk, N.S. Rusaeva, et al. 2011. Effects of peptides Lys-Glu-Asp-Gly and Ala-Glu-Asp-Gly on hormonal activity and structure of the thyroid gland in hypophysectomized young chickens and old hens. Bulletin of Experimental Biology and Medicine 150 (4): 495–499. Lagreze, W.A., A. Pielen, R. Steingart, G. Schlunck, H.D. Hofmann, I. Gozes, M. Kirsch, et al. 2005. The peptides ADNF-9 and NAP increase survival and neurite outgrowth of rat retinal ganglion cells in vitro. Investigative Ophthalmology & Visual Science 46 (3): 933–938. Lam, B.L., K. Vandenburgh, V.C. Sheffield, et al. 1995. Retinitis pigmentosa associated with a dominant mutation in cordon 46 of the peripherin/ RDS gene (Arginin-46-stop). The American Journal of Ophthalmology 119: 65–71. Lamba, D.A., J. Gust, and T.A. Reh. 2009. Transplantation of human embryonic stem cell-derived photoreceptors restores some visual function in Crx-deficient mice. Cell Stem Cell 4: 73–79. Lamba, D.A., A. McUsic, R.K. Hirata, P.-R. Wang, D. Russell, and T.A. Reh. 2010. Generation, purification and transplantation of photoreceptors derived from human induced pluripotent stem cells. PLoS ONE 5: e8763. https://doi.org/10.1371/journal.pone.0008763. Lezhava, T., V.  Khavinson, J.  Monaselidze, T.  Jokhadze, N.  Dvalishvili, N.  Bablishvili, and S. Barbakadze. 2004. Bioregulator Vilon-induced reactivation of chromatin in cultured lymphocytes from old people. Biogerontology 5: 73–79. Liang, F., T.S.  Aleman, Z.  Yang, A.V.  Cideciyan, et  al. 2001. Melatonin delays photoreceptor degeneration in the rds/rds mous. Neurology Report 12 (5): 1011–1014. Limoli, P.G., C. Limoli, E.M. Vingolo, et al. 2016. Cell surgery and growth factors in dry age-­ related macular degeneration: Visual prognosis and morphological study. Oncotarget 7 (30): 46913–46923. https://doi.org/10.18632/oncotarget.10442.

References

39

Linkova, N.S., V.Kh. Khavinson, N.I.  Chalisova, A.S.  Katanugina, and E.A.  Koncevaya. 2011. Peptidergic stimulation of differentiation of pineal immune cells. Bulletin of Experimental Biology and Medicine 3: 124–127. Liu, M.M., J. Tuo, and C.-C. Chan. 2011. Gene therapy for ocular diseases. The British Journal of Ophthalmology 95 (5): 604–612. Luttrull, J.K., and G. Dorin. 2012. Subthreshold diode micropulse laser photocoagulation (SDM) as invisible retinal phototherapy for diabetic macular edema: A review. Current Diabetes Reviews 8 (4): 274–284. субпороговой лазерной микроимпульсной фотокоагуляции (SDM). Lyness, A.L., W. Ernst, M.P. Quinlan, et al. 1985. A clinical, phychophysical and electroretinographic survey of patients with autosomal dominant retinitis pigmentosa. British Journal of Ophthalmology 69: 326–339. Macular photocoagulation study group: argon laser phothocoagulation for senile macular degeneration. 1982. Archives of Ophthalmology 100: 912–918. Maksimova, E.M. 2008. Retinal neurotransmitters and rearrangements in the neural layers of the retina during photoreceptor degeneration. Sensory Systems 22 (1): 36–51. Marc, R.E., B.W. Jones, C.B. Watt, and E. Strettoi. 2003. Neural remodeling in retinal degeneration. Progress in Retinal and Eye Research 22: 607–655. Marchiafava, P.L., and B. Longoni. 1999. Melatonin as antioxioxidant in retinal photoreceptors. Journal of Pineal Research 26: 184–189. Marmor, M.F., and T.J. Wolfensberger. 1998. The retinal pigment epithelium: Function and disease. New York: Oxford University Press. 135 p. Martin, M.E., and K.G. Rice. 2007. Peptide-guided gene delivery. The AAPS Journal 9 (1): 18–29. Mayo, J.C., R.M. Sainz, H. Uria, I. Antolin, et al. 1998. Melatonin prevents apoptosis induced by 6-hydroxydopamine in neuronal cells: Implicayions for Parkinson’s disease. Pineal Research 24: 179–192. Michaelides, M., A.J.  Hardcastle, D.M.  Hunt, et  al. 2006. Progressive cone and cone-rod dystrophies: Phenotypes and under- lying molecular genetic basis. Survey of Ophthalmology 51: 232–258. Morosov, V.G., and V.Kh. Khavinson. 1997. Natural and sinthetic thymic peptides as therapeutics for immune dysfunction. International Journal of Immunopharmacology 19 (9/10): 501–505. Morozov, V.G., and V.Kh. Khavinson. 1973. Influence of substances isolated from the hypothalamus on immunogenesis and morphological blood composition. Experimental Surgery and Anesthesiology 1: 19–22. ———. 1974. The effect of the epiphysis extract from the course of experimental tumors and leukemias. The Experimental Surgery 1: 34–38. Morozov, V.G., and V.Kh Khavinson. 1981. Isolation of lymphocytes and thymus polypeptides, that regulate the processes of intercellular cooperation in the immune system, from the bone marrow. Report of the USSR Academy of Sciences 261 (1): 235–239. Morozov, V.G., and V.Kh. Khavinson. 1983. A new class of biological regulators of multicellular systems – Cytomedins. Suction Model Biology 96 (3): 339–346. ———. 1996. Peptide bioregulators (25-year experience of experimental and clinical study), 74. Nauka: SPb. Morozov, V.G., V.Kh. Khavinson, and O.A. Pisarev. 1977. Isolation from the thymus and study of the factor nature stimulating immunogenesis. Report of the USSR Academy of Sciences 233 (3): 491–494. Morozov, V.G., V.Kh. Khavinson, and V.V. Malinin. 2000. Peptide timelinelite, 158. Nauka: SPb. Morris, M.C., and J. Depollier. 2001. A peptide carrier for the delivery of biologically active proteins into mammalian cells. Nature Biotechnology 19: 1173–1176. Nakazawa, M., Y. Wada, and M. Tamai. 1998. Arresting gene mutations in autosomal recessive retinitis pigmentosa. Archives of Ophthalmology 116: 498–501. Neroev, V.V., and O.V. Zaitseva. 2015. Investigations in the effectiveness of retinalamin in age-­ related macular degeneration therapy: A review. Russian Ophthalmological Journal 4: 79–82.

40

1  Literature Review

Neufeld, A. 2001. Aging is risk factor for the loss of retinal ganglion cell. In Abstract of conference on “Aging retina and early degeneration”, Boston, 23. Ohno, M., M. Fornered, and I.W. Mattaj. 1998. Nucleocytoplasmic transport: The last 200 nanometers. Cell 92 (2): 327–336. Pauleikhoff, D., C.A. Harper, J. Marshall, and A.C. Bird. 1990. Aging changes in Bruch’s membrane. A Histochemical and Morphologic Study: 171–178. Peirong, Huang, Wenquan Niu, Zhentian Ni, Renzuo Wang, and Xiaodong Sun. 2013. A meta-­ analysis of anti-vascular endothelial growth factor remedy for Macular Edema Secondary to Central Retinal Vein Occlusion. Published: December 23, 2013. https://doi.org/10.1371/journal.pone.0082454. Plate, K.H., G. Breier, H.A. Weich, and W. Risau. 1992. Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature 359: 845–848. Pockley, A.G. 2003. Heat shock proteins as regulators of the immune response. Lancet 362 (9382): 469–476. Radtke, N., R. Armant, M. Seller, and H. Petry. 2002. Transplantation of intact sheets of fetal neural retina with its retinal pigment epithelium in retinitis pigmentosa patients. American Journal of Ophthalmology 133 (4): 544–550. Rajashekhar, G. 2014. Mesenchymal stem cells: New players in retinopathy therapy. Frontiers in Endocrinology 5: 59. https://doi.org/10.3389/fendo.2014.00059. Ramamurthy, V., G.A.  Niemi, T.A.  Reh, and J.B.  Hurley. 2004. Leber congenital amaurosis linked to AIPL1: A mouse model reveals de- stabilization of cGMP phosphodiesterase. PNAS 101: 13901. Ramsden, C.M., M.B. Powner, A.-J.F. Carr, M.J.K. Smart, L. da Cruz, and P.J. Coffey. 2013. Stem cells in retinal regeneration: Past, present and future. Development 140: 2576–2585. https://doi. org/10.1242/dev.092270. Reibaldi, M., A.  Longo, A.  Pulvirenti, et  al. 2016. Geo-epidemiology of age-related macular degeneration: New clues into the pathogenesis. American Journal of Ophthalmology 161: 78–93. https://doi.org/10.1016/j.ajo.2015.09.031. Reichel, M.B., J.  Bainbridge, D.  Baker, A.J.  Thrasher, S.S.  Bhattacharya, and R.R.  Ali. 2001. An immune response after intraocular administration of a β-galactosidase reporter gene slows retinal degeneration in the RD mouse. The British Journal of Ophthalmology 85: 341–344. Reiter, R.J. 1997. Antioxidants actions of melatonin. Advances in Pharmacology 38: 103–117. ———. 1998. Oxidative damage in the central nervous system: Protection by melatonin. Progress in Neurobiology 56 (3): 359–384. Rodrigues, M.M., B. Wiggert, M.O.M. Tso, et al. 1986. Retinitis pigmentosa: Immunohistochrmical and biochemical studies of the retina. Canadian Journal of Ophthalmology 21: 79–83. Rudakova, A.V., and P.F. Khveshchuk. 2002. Modern pharmacotherapy: Evidence of effectiveness, 256. SPb.: VmedA. Santos-Ferreira, T., S. Llonch, O. Borsch, K. Postel, J. Haas, and M. Ader. 2016. Retinal transplantation of photoreceptors results in donor–host cytoplasmic exchange. Nature Communications 7. Article number: 13028. Sarks, S.H. 1976. Agreeing and degeneration in the macular region. A clinico-pathological study. British Journal of Ophthalmology 60 (5): 324–341. Savaskan, E., A.  Wirz-Justice, G.  Oliveri, et  al. 2002. Distribution of melatonin MT1 receptor immunoreactivity in human retina. The Journal of Histochemistry and Cytochemistry 50 (4): 519–525. Schwartz, S.D., J.-P.  Hubschman, G.  Heilwell, V.  Franco-Cardenas, C.K.  Pan, R.M.  Ostrick, E.  Mickunas, R.  Gay, I.  Klimanskaya, and R.  Lanza. 2012. Embryonic stem cell trials for macular degeneration: A preliminary report. Lancet 379: 713–720. https://doi.org/10.1016/ S0140-6736(12)60028-2. Schwartz, S., C. Regillo, B. Lam, D. Eliott, P. Rosenfeld, N. Gregori, J.-P. Hubschman, J. Davis, G.  Heilwell, and M.  Spirn. 2015. Human embryonic stem cell-derived retinal pigment epithelium in patients with age-related macular degeneration and Stargardt’s macular dystrophy:

References

41

Follow-up of two open-label phase 1/2 studies. Lancet 385: 509–516. https://doi.org/10.1016/ S0140-6736(14)61376-3. Shamshinova, A.M., and V.V. Volkov. 1999. Functional methods of research in ophthalmology, 416. Moscow: Meditsina. Sharma, R.K. 2007. Molecular neurobiology of retinal degeneration. In Handbook of neurochemistry and molecular neurobiology. Sensory neurochemistry, 47–92. Shaw, P.X., T. Stiles, C. Douglas, et al. 2016. Oxidative stress, innate immunity, and age-related macular degeneration. AIMS Molecular Science 3 (2): 196–221. https://doi.org/10.3934/ molsci.2016.2.196. Shikari, H., P.S. Silva, and J.K. Sun. 2014. Complications of intravitreal injections in patients with diabetes. Seminars in Ophthalmology 29 (5–6): 276–289. Singer, M. 2014. Advances in the management of macular degeneration. F1000Prime Reports 6: 29. https://doi.org/10.12703/P6-29. Soleimannejad, M., S. Ebrahimi-Barough, S. Nadri, et al. 2017. Retina tissue engineering by conjunctiva mesenchymal stem cells encapsulated in fibrin gel: Hypotheses on novel approach to retinal diseases treatment. Medical Hypotheses 101: 75–77. https://doi.org/10.1016/j. mehy.2017.02.019. Stanga, P.E., A. Kychenthal, F.W. Fitzke, A.S. Halfyard, R. Chan, A.C. Bird, and G.W. Aylward. 2002. Retinal pigment epithelium translocation after choroidal neovascular membrane removal in age-related macular degeneration. Opthalmology 109: 1492–1498. Stone, E.M. 2007. Macular degeneration. Annual Review of Medicine 58: 477–490. Stone, E.M., B.E. Nichols, A.E. Kimura, et al. 1994. Clinical features of a Stargardt-like dominant progressive macular dystrophy with genetic linkage to chromosome 6q. Archives of Ophthalmology 112: 765–772. Streilein, J.W. 2003. Ocular immune privilege: Therapeutic opportunities from an experiment of nature. Nature Reviews. Immunology 3 (11): 879–889. https://doi.org/10.1038/nri1224. Tosini, G. 2000. Melatonin circadian rhythm in the retina of mammals. Chronobiology International 17: 599–612. Trofimova, S.V., and V.Kh. Khavinson. 2001. The effectiveness of bioregulators in the treatment of diabetic retinopathy. West Ophthalmology 3: 115–135. Trofimova, S., and V. Khavinson. 2002a. Application of retinalamin in exudativ age-related macular degeneration. In: 4th international symposium on ocular pharmacology and pharmaceutical: Abstract, Spain, 10. Trofimova, S.V., and V.Kh. Khavinson. 2002b. Peptide bioregulators: A new approach for treating diabetic retinopathy. Acta Ophthalmologica 80 (4): 452. Trofimova, S.V., and V.V. Neroeva. 2004. Influence of Retinalamin on the course of retinal pigment degeneration in elderly and senile persons. Almanac “Gerontology and Geriatrics” 3: 188–191. Trofimova, S.V., I.B. Maksimov, and V.V. Neroev. 2004. Regulatory action of retinal peptides, 160. Foliant: SPb. Trofimova, S.V., T.A.  Khludeeva, O.M.  Ivko, and A.D.  Anas. 2006. Influence of bioregulatory therapy on the quality of life of elderly people with retinal pathology. Successes of Gerontology 18: 96–99. Trounson, A., and N.D.  DeWitt. 2016. Pluripotent stem cells progressing to the clinic. Nature Reviews Molecular Cell Biology 17 (3): 194–200. https://doi.org/10.1038/nrm.2016.10. Tucker, B.A., I.H.  Park, S.D.  Qi, H.J.  Klassen, C.  Jiang, J.  Yao, S.  Redenti, G.Q.  Daley, and M.J. Young. 2011. Transplantation of adult mouse iPS cell-derived photoreceptor precursors restores retinal structure and function in degenerative mice. PLoS ONE 6: e18992. https://doi. org/10.1371/journal.pone.0018992. Tucker, B.A., R.F.  Mullins, and E.M.  Stone. 2014. Stem cells for investigation and treatment of inherited retinal disease. Human Molecular Genetics 23: 9–16. https://doi.org/10.1093/ hmg/ddu124. Tulceva, S.N. 2008. Significance of polymorphisms of platelet glycoprotein receptor genes in the pathogenesis of retinal vein thrombosis. Ophthalmology Statements 1 (4): 5–12.

42

1  Literature Review

Tünnemann, G., R.M. Martin, S. Haupt, et al. 2006. Cargo-dependent mode of uptake and bioavailability of TAT-containing proteins and peptides in living cells. The FASEB Journal 20: 1775–1784. Vanyushin, B.F., and V.V. Ashapkin. 2011. DNA methylation in higher plants: Past, present and future. Biochimica et Biophysica Acta 1809 (8): 360. Vincent, K.A., O. Feron, and R.A. Kelly. 2002. Harnessing the response to tissue hypoxia: HIF-1 alpha and therapeutic angiogenesis. Trends in Cardiovascular Medicine 12: 362–367. Vivien-Roels, B., P. Pevet, M.P. Dubois, J. Arendt, et al. 1981. Immunogistochemical evidence for the presence of melatonin in the pineal gland, the retina and the Harderian gland. Cell and Tissue Research 217: 105–115. Vugler, A., A.J.  Carr, J.  Lawrence, L.L.  Chen, K.  Burrell, A.  Wright, P.  Lundh, M.  Semo, A. Ahmado, C. Gias, et al. 2008. Elucidating the phenomenon of HESC-derived RPE: Anatomy of cell genesis, expansion and retinal transplantation. Experimental Neurology 214: 347–361. Webb, S., C. Gabrelow, J. Pierce, et al. 2016. Retinoic acid receptor signaling preserves tendon stem cell characteristics and prevents spontaneous differentiation in vitro. Stem Cell Research & Therapy 7: 7–45. Weleber, R.G., and K. Gregory-Evans. 2006. Retinitis pigmentosa and allied disorders. Retina. 4th ed, 394–485. Philadelphia: Elsevier. White, M.P., and L.J. Fisher. 1989. Effect of exogenous melatonin on circadian disc shedding in the albino rat retina. Vision Research 29: 167–179. Whiting, P., J. Kerby, and P. Coffey. 2015. Progressing a human embryonic stem-cell-based regenerative medicine therapy towards the clinic. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 370: 20140375. https://doi.org/10.1098/rstb.2014.0375. Wiechmann, A.F. 1986. Melatonin: Parallels in pineal gland and retina. Experimental Eye Research 42 (6): 507–527. Wiedemann, P., and L. Kohen. 1997. Macular and retinal diseases. Recent advances in diagnosis and therapy. Leipzig: Karger. 100 p. Witmer, A.N., G.F. Vrensen, C.J. Van Noorden, and R.O. Schlin-Gemann. 2003. Vascular endothelial growth factors and angiogen- esis in eye disease. Progress in Retinal and Eye Research 22: 1–29. Wong, W.L., Х. Su, and Х. Li. 2014. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis. The Lancet Global Health 2: 106–116. https://doi.org/10.1016/S2214-109X(13)70145-1. Wood, M.A., J.D. Hawk, and T. Abel. 2006. Combinatorial chromatin modifications and memory storage: A code for memory? Learning & Memory 13: 241–244. Yamamoto, T., K. Motohiro, and N. Yokoi. 2004. Comparative effect of antiplatelet therapy in retinal vein occlusion evaluated by the particle-counting method using light scattering. American Journal of Ophthalmology 138 (5): 809–817. Yanagisawa, M., H. Kurihara, S. Kimura, et al. 1988. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature (Great Britain) 98 (21): 2235–2240. Yerichev, V.P., S. Yu Petrov, and A.V. Volzhanin. 2017. Meta-analysis of clinical studies of the retinoprotective therapy effectiveness in the “dry” form of AMD using Retinalamin on the dynamics of visual acuity. Clinical Ophthalmology 4: 219–226. Zhu, Q., Z. Liu, C. Wang, et al. 2015. Lentiviral-mediated growth-associated protein-43 modification of bone marrow mesenchymal stem cells improves traumatic optic neuropathy in rats. Molecular Medicine Reports 12 (4): 5691–5700. Zhuravleva, L.V. 1992. Retina preparation in the treatment of central involutional macular degeneration. In Abstracts from the international symposium. “Peptide bioregulators  – cytomedines”, 60–61. Military Medical Academy named after Kirov S. M. SPb. Zozulya, T.A., and I.B. Maksimov. 1997. Use of peptide bioregulators in the complex treatment of gunshot eye injuries. In Actual problems of military and extreme medicine: Source of scientific works, 57–58. Moscow. Zueva, M.V. 2010. Aging of the retina. Russian Ophthalmological Journal 2: 53–61.

Chapter 2

Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology

Abstract  The results of experimental studies presented in this chapter show that short peptides have induction effect on undifferentiated stem cells. Moreover, after exposure of short peptides to undifferentiated tissue, neural differentiation is triggered. In addition, according to the results of immunocytochemical studies, it was confirmed that short peptides induce retinal cell differentiation, which is consistent with the data from other researchers on the stimulating effect of hormones and peptides on their functional activity. Therefore, knowledge of these molecular mechanisms allows a targeted approach to treatment of various retinal pathologies depending on the main lesion location in the retina and application of the developed treatment algorithm for various retinal pathologies (age-related macular degeneration, retinitis pigmentosa, etc.) using a complex of peptide bioregulators.

Animals were kept in accordance with the Good Laboratory Practice (GLP) regulations and in accordance with the European Directive 86/609/EEC [Council of the European Communities. Council Directive 86/609/EEC of 24 November 1986 on the approximation of laws, regulations and administrative provisions of the Member States regarding the protection of animals used for experimental and other scientific purposes. Off J Eur Communities L 358: 1–28]. The experimental protocols were approved by the Commission for the Humane Treatment of Animals of the St. Petersburg Institute of Bioregulation and Gerontology (Russia).

2.1  R  esults of a Study of the Induction Effects of Short Peptides on Pluripotent Embryonic Cells Widespread use of retinals in the treatment of retinal pathology is due to its high biological activity, especially its neural induction activity. Due to the fact, based on the amino acid analysis of retinalamin, several short peptides were synthesized that also have a powerful retinoprotective effect: Epitalon (Ala-Glu-Asp-Gly) and © Springer Nature Switzerland AG 2020 S. Trofimova, Molecular Mechanisms of Retina Pathology and Ways of its Correction, https://doi.org/10.1007/978-3-030-50160-0_2

43

44

2  Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology

Epimental (Normoftal) Lys (H-Glu-OH) -OH), it can be assumed that they also have induction properties. The problem of the emergence of many cell types during the development of an organism from a fertilized egg, i.e. the problem of differentiation of tissues and the molecular factors that determine differentiation has always been one of the most difficult and interesting in developmental biology. Back in the 60s of the last century, H.  Tiedemann, through biochemical analysis, established that the basis of induction is the effect of low molecular weight proteins (Tiedemann and Becker 1961). Further studies, over many years of effort by Asashima M. and Smith J., focused on more accurate identification. The desired substance was the already known natural product of the vessels of adult animals: activin (tgf-β). However, this discovery not only completed many years of work, but also posed new questions for researchers. In addition to activin (tgf-β), many other agents also cause mesodermal differentiation. The difference is that in relation to the axes of the vertebral body, some agents predominantly induce tissues of the upper levels, while others induce lower. The same effect can be achieved by using different concentrations of the same substance (Asashima 1994). However, in addition to the method of biochemical isolation of the desired induction factors, the method of influence by proteins secreted by living tissue cells is used. According to some authors, such an influence is possible either externally (Lopashov and Zemchikhina 2000; Lopashov et  al. 1997), or directly on the polypotent tissue of the ectoderm of the early gastrula, which allows the most accurate study of the effect of tissue-specific factors (Lopashov and Zemchikhina 2000). The question arises; to what extent the presence of substances such as activin (tgf-β) can cause an entire set of different tissue-specific differentiations or if other substances such as, for example, short peptides also take part in these changes? The induction effect of short peptides (Epitalon, Epimental (Normoftal) and Livagen) on pluripotent embryonic tissue was studied. The embryos of Xenopus Laevis spur frogs were used as an experimental object. Caviar was obtained using artificial stimulation of the male and female gonadotropin. For this purpose, pairs were selected from the existing herd of frogs, which over the past 6 months gave full-fledged caviar, i.e. caviar in which the number of live eggs was at least 70%. Then, the selected male and female’s spinal lymphatic bags were injected with 200 units and 400 units gonadotropin, respectively. The ectoderm of the early gastrula of Xenopus Laevis was used as a test system (a pluripotent tissue capable of certain differentiation under the influence of an inducing agent). The technique for isolating the ectoderm of the early gastrula implies mandatory sterilization of the embryos. For this, the embryo was first placed in 70 ° alcohol for 30 s, then washed 2 times in sterile water and placed in a sterile 3.5 cm diameter Petri dish with sterile Niu-Twitti saline solution with the addition of antibiotics. After sterilization, all membranes were removed from the embryo, then the researchers started to isolate the parts of the embryo tissue necessary for the experiments.

2.1  Results of a Study of the Induction Effects of Short Peptides on Pluripotent…

45

Testing on the ectoderm of the early gastrula was carried out in a standard way. At stage 10.5, sections were cut out from the roof of the segmentation cavity of the early gastrula of Xenopus Laevis without touching the edge ectoderm in order to exclude the induction effect of the surrounding tissues. The selected areas were placed in test solutions (Retinalamin, Epitalon, Livagen) for 60  min, until they coagulated into closed vesicles. Then, the explants were transferred into sterile Niu-­ Twitti solution with antibiotics and cultured in a CO2 incubator WTB Binder CB (Germany) for 4–5 days at a temperature of 20 °C. As a control, the roofs of the segmentation cavity of early Xenopus Laevis gastrula in stage 10.5 were incubated in sterile Niu-Twitti saline solution in the same way. All peptides (Retinalamin, Epitalon and Livagen) were studied at concentrations of 2, 10, 20, 50, 100, 200 ng/ ml, and each concentration in 40 cultures and 20 cultures was taken as a control. Since it was necessary to take into account the dependence of induction signal perception by polypotent cells on the geometry of the tissue at the time of perception, several experimental design schemes were used. 1. The ectoderm of the stage 10.5 early gastrula was placed in the test solution with the active side up for 1  h, where it gradually collapsed. Then, the coagulated ectoderm was placed into a physiological Niu-Twitti saline solution for amphibians with antibiotics and cultured as described above. 2. The ectoderm of the stage 10.5 early gastrula was placed in the test solution with the active side on the filter and pressed down from above, which did not allow the ectoderm to curl up before 1 h of exposure. Next, the load was removed, and the ectoderm was placed into a physiological Niu-Twitty solution with antibiotics and cultivated as described above. 3. The ectoderm of the stage 10.5 early gastrula was placed in the test solution with the active side up and pressed with a load, which did not allow the ectoderm to curl before 1 h of exposure. Next, the load was removed, and the ectoderm was placed in a physiological Niu-Twitty solution with antibiotics and cultivated as described above. As a result of processing the data obtained in experiment 1, it became clear that the geometry of the tissue at the time of perception of the induction signal does not affect the resulting differentiation of the tissue. Therefore, the following experiments were performed according to scheme 1.

2.1.1  Methods of Morphological Assessment Morphological studies were performed to evaluate the effect of peptides on the differentiation processes of the ectoderm of the early gastrula of Xenopus Laevis. For this purpose, all experimental and control explants were fixed with Buen fluid. Deparaffinized sections with a thickness of 5 μm were stained with azocarmine with Mallory dyeing.

46

2  Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology

Immunochemical studies were performed using antibodies against acidic fibrillar glial bovine protein (Dakоpatts, code Z 334, 1:30) as primary antibodies, and antibodies against rabbit IG labelled with FITC (Sigma, 1:30) as secondary antibodies. The processing of specimens was carried out as follows. Glass with slices enclosed in balsam was washed from the Canada balsam, then through a series of alcohols of decreasing strength, the glass with slices was brought to the TRIS HCl 50  mM wash buffer (pH  =  8.6). Then, primary antibodies were applied onto the surface of the slices for 1.5 h, after which they were treated with wash buffer for 1 h. Secondary antibodies were applied for 1 h, followed by treatment of the slices with wash buffer. The stained specimen was enclosed in a Cristal/Mount immunohistochemical stain (Biomeda corporation, cat. No. MO2). Immunochemical staining of specimens with antibodies to muscle α-actin was carried out in a similar way. Antibodies to α-actin obtained on a mouse hybridoma were used as primary antibodies. As secondary antibodies, antibodies against mouse IG are labelled with FITC at a 1:30 dilution (Sigma). Inactivation buffer with horse serum (20%) was used for dilution of antibodies. The immunochemical staining of specimens with antibodies to light neurofilaments of 62–75 kDa was carried out in a similar way. Antibodies to NF (neurofilaments) of 62–75 kDa obtained from a rabbit at a 1: 20 dilution (Sigma) were used as primary antibodies. Secondary antibodies are anti-rabbit IG antibodies labelled with FITC at a 1:30 dilution (Sigma). Inactivation buffer +20% horse serum was used for antibody dilution. The immunochemical staining of specimens with antibodies to Ca 2 ++ bound retina protein reverin was carried out in a similar manner. As primary antibodies, antibodies to reverin obtained from a rabbit at a 1:20 dilution were used. As secondary antibodies, antibodies against rabbit IG labeled with FITC at a dilution of 1:30 (Sigma). Inactivation buffer with horse serum (20%) was used for dilution of antibodies. In the study of the induction activity of Epitalon on the cells of the polypotent tissue of the ectoderm of the early gastrula Xenopus laevis, it was proved that it has a neural induction activity. After the effect of the drug on the ectoderm of the early gastrula, neural differentiation starts (Fig. 2.1). After exposure to Epitalon (100 ng/ ml 1 h.) It was stained with hematoxylin-eosin, (× 250). The concentration of the Epitalon at which differentiation of the nervous tissue occurs is 10 ng/ml, 50 ng/ml and 100 ng/ml. At other concentrations of the drug, differentiation does not develop (Table 2.1). Another systemic peptide Epimental (Normoftal), as well as Epitalon, has induction activity. When studying the induction activity of Epimental (Normoftal) on the cells of the polypotent tissue ectoderm of the early gastrula of Xenopus Laevis, it was proved that it also has neural induction activity (Table 2.2). The proportion of ectoderm induced by the action of short peptides is low, about 12–15%, but is specific for peptide substances. Livagen tetrapeptide (Lys-Glu-Asp-Ala), synthesized in the laboratory of peptide chemistry of the St. Petersburg Institute of Bioregulation and Gerontology, was

2.1  Results of a Study of the Induction Effects of Short Peptides on Pluripotent…

47

Fig. 2.1  Ectoderm of early gastrula. Five days after exposure to Epitalon (100  ng/ml, 1  h). Hematoxylin-eosin stain, × 250 AE atypical epidermis, NT nerve tissue Table 2.1  Epitalon-induced tissues in the polypotent tissue of the early gastrula ectoderm in concentration dependence Epitalon concentration (ng/ml) Control 200 100 50 20 10 2

Total number of studied cultures 20 40 40 40 40 40 40

Number of cultures taken into account during processing 20 35 37 33 35 36 35

Tissues (%) AE Ep NT 100 – – 100 – – 100 12 10 100 15 10 100 – – 100 15 12 100 – –

Note: AE is atypical epidermis, Ep is epidermis, NT is nerve tissue

taken as a control peptide. Livagen is obtained by directed chemical synthesis based on the amino acid composition of a complex preparation isolated from liver. It is known that this peptide significantly increases the level of protein synthesis in old animals in hepatocytes. The study revealed that livagen has mesodermal induction activity. As shown in Table 2.3, after the action of this peptide on the ectoderm of the early gastrula, only mesoderm differentiation is triggered. Livagen concentration at which muscle tissue differentiation occurs is 20 ng/ml and 200 ng/ml (Figs. 2.2 and 2.3).

48

2  Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology

Table 2.2  Tissues induced by Epimental (Normoftal) in the concentration-dependent pluripotent tissue of the ectoderm of the early gastrula Epimental concentration (ng/ml) Control 200 100 50 20 10 2

Total number of studied cultures 20 40 40 40 40 40 40

Number of cultures taken into account during processing 20 36 39 34 35 36 36

Tissues (%) AE Ep NT 100 – – 100 – – 100 12 9 100 13 10 100 14 12 100 – – 100 – –

Note: AE is atypical epidermis, Ep is epidermis, NT is nerve tissue Table 2.3  Livagen-induced tissues in the polypotent tissue of the early gastrula ectoderm in concentration dependence Livagen concentration (ng/ml) Control 200 100 50 20 10 2

Total number of studied cultures 40 40 40 40 40 40 40

Number of cultures taken into account during processing 40 38 37 35 35 39 35

Tissues (%) AE Ep 100 – 100 26 100 5 100 – 100 – 100 7 100 10

S – 14 – – 12 – –

Note: AE is atypical epidermis, Ep is epidermis, S is somites

At other concentrations of the drug, mesodermal differentiation does not occur. An analysis of the results shows that the short peptides Epitalon, Epimental (Normoftal) and Livagen have induction activity. In polypotent tissue, under the influence of Epitalon and Epimental (Normoftal), differentiation of the neural tissue is triggered, and the influence of Livagen affects mesoderm tissue. Thus, work with pluripotent tissues showed the ability of short peptides, consisting of only a few amino acids, to trigger tissue differentiation in normal developing embryonic tissue. The data obtained indicates the presence of signaling (communication) properties of short peptides capable of triggering one or another differentiation. The pronounced tissue specificity of the induction effect of the studied peptides suggests their special role in the process of embryonic development and tissue differentiation. It should be noted that when peptidic drugs affect pluripotent cells, there is an effect on embryonic cells in cultures, the number of receptors on the membrane of which is maximum and specific. This determines the properties of the polypotent tissue, the cells of which at this moment are waiting not for a signal to the beginning of active proliferation, but for a signal that triggers a specific cascade of cell transformations, the result of which are differentiated cells of the body. In addition, the ability of

2.1  Results of a Study of the Induction Effects of Short Peptides on Pluripotent…

49

Fig. 2.2  Ectoderm of early gastrula. Five days after exposure to livagen (200  ng/ml, 1  h). Hematoxylin-eosin stain, × 250 Ae atypical epidermis, S somites

Fig. 2.3  Expression of muscle α-activin in the culture of ectoderm of early gastrula 5 days after exposure to livagen (200 ng/ml, 1 h.). Fluorescence immunohistochemical method, × 250

50

2  Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology

Epitalon and Epimental (Normoftal) to trigger differentiation of neural tissue explains why a positive clinical effect can be observed with the use of these peptides in the treatment of degenerative diseases of the retina.

2.2  T  he Effect of Short Peptides on the Proliferative Activity of Retinal Cells and Pigment Epithelium It is known that there are two classes of biologically active substances: growth factors (stimulating cell growth in cell cultures) and induction factors (controlling ways of cell differentiation during embryogenesis) (Asashima et al. 1990; Lopashov et al. 1997). All of them are low molecular weight proteins. The emergence of a separate class of drugs, peptide regulators with a molecular mass of 1–10 kDa, isolated from various organs and tissues, as well as short peptides synthesized based on them, has expanded the range of regulatory factors involved in the most complex processes of cellular interactions (Khavinson 2002). For a deeper understanding of the retinoprotective effect of short peptides, the proliferative activity of peptides (Epimental (Normoftal), Epitalon) on cell cultures of the retina and pigment epithelium of Wistar rats was studied. Primary cell cultures of the Wistar rat retina and pigment epithelium were used as an experimental object.

2.2.1  Method of Preparation of Substrates for Cell Cultures Collagen type 1 manufactured by Sigma (cat. C 9879) served as a substrate for culturing retinal cells and pigment epithelium. Collagen was diluted to a concentration specified by the manufacturer, the solution was sterilized by passing through a 0.22 μm filter produced by Costar (cat. No. 8110). Then it was introduced into 24 sterile wells of the plates and dried in sterile laminars until completely dry. The culture medium was added to the wells of coated and dried collagen plates and kept there for 20 min. Then the medium was drained and a suspension of cells was introduced in a certain concentration in the required volume of the medium. 24-wells tablets produced by Costar (USA), (cat. No. 3524), were used as cultivating dishes. The size of the well corresponds (according to the manufacturer) to the optimal (300 μl) and maximum (600 μl) volumes of medium for cell culture. Medium 199 was used as a culture medium with 10% serum albumin and the addition of a standard set of antibiotics (penicillin – 30 mg/l, streptomycin 250 mg/ ml, gentamicin – 70 μg/l). Before use, the prepared culture medium was sterilized by passing through an ultrafilter with 0.22 μm pores. As is known, serum albumin contains components that can support the survival and growth of many mammalian cells in culture. The main functions of albumin are the transfer of lipids, hormones,

2.2  The Effect of Short Peptides on the Proliferative Activity of Retinal Cells…

51

minerals, providing osmotic pressure and buffer capacity. Mammalian serum containing a large number of growth factors and hormones was not added to the medium. The use of such a medium provides better reproducibility of the results due to the greater stability of the medium, a decrease in the influence of additional proteins on the results of biological testing, and the viability and growth of various types of cells of the primary culture are maintained without predominant stimulation of individual cell populations.

2.2.2  M  ethod of Obtaining Cell Cultures of the Retina and Pigment Epithelium of Rats Primary cell cultures of the retina and pigment epithelium of rats were used as an experimental object. Primary culture cells are usually heterogeneous, characterized by a small proliferative pool (as can be clearly seen in the control samples) and obtained from tissue in  vitro before the first passage. To obtain the primary cell culture, retina and pigment epithelium were isolated, homogenized, and placed in a sterile Petri dish with Versene solution for 30  min. Then, Versene solution was replaced with a solution of 0.25% trypsin prepared on Versene solution, and the homogenized cell cultures were kept there for another 30 min. After that, the culture medium was added to the Petri dish in a volume twice the volume of the trypsin solution. Then excess tissue was removed. The cell suspension was collected in a test tube and centrifuged for 5  min at 2000  rpm. The supernatant was drained, bringing the volume of culture medium in a test tube to 1 ml. Tissue cells were carefully suspended in 1  ml of medium, and 6  μl of the suspension was added to a Goryaev chamber to calculate cell concentration. Knowing the concentration of cells in 1 ml of the suspension, the volume of suspension introduced into one well was calculated. The choice for testing the activity of drugs on cell cultures of the retina and pigment epithelium was based on their single source of origin during embryogenesis, but in a different anatomical structure of tissues. If both the retina and the pigment epithelium are neural derivatives, then there is a significant difference in the structure of the tissues. The retina is represented by several cellular elements, including glial, while the pigment epithelium is represented by cells of only one type. It could be assumed that tissues of a single origin, despite a different structure, should exhibit a single proliferative activity when using the same drugs at the same concentration to stimulate them. In this experiment, based on data from preliminary experiments on culturing the cells of the retina and pigment epithelium of adult rats, 300,000 cells of either the retina or pigment epithelium were introduced into each culture well. Epimental (Normoftal) and Epitalon were used at working concentrations of 2, 10, 20, 50, 100, 200 ng/ml. When making preparations, it was taken into account that the increase in the volume of fluid in each well should be the same. Drugs were introduced from low to high concentrations.

52

2  Results of Experimental Studies of Short Peptides (Cytogens) in Ophthalmology

2.2.3  Drug Administration The experiment lasted for 1  month. Drugs in the required concentration were introduced 2 times per week, on Mondays and Fridays. Primary data was obtained 1 time per week, on Saturday. For each preparation, 8 tablets with 24 wells each were delivered, of which 4 tablets contained retinal cells and 4 contained pigment epithelial cells. All tablets were seeded with cells at the same time. One plate contained three repetitions in concentrations and one row (6 wells) for control. Each week, 1 tablet was fixed for 1 preparation and 1 type of tissue. In total, the experiment had 16 tablets of 24 wells, that is, 384 measurements. Cells were incubated in a CO2 incubator WTB Binder CB (Germany) at 100% humidity at a temperature of 37 ° C.

2.2.4  Methods for Spectrophotometric Assessment of the Number of Living Cells in Suspension To determine the mitogenic tissue-specific activity of the studied drugs on cell culture of the retina and pigment epithelium, a spectrophotometric method was used to determine the number of living cells in suspension. The optical density was determined using a Multiskan Ex Primary EIA V. 2.1-0 instrument with Labsystems Genesis V3.03 software in 96-well Costar plates with a flat bottom at an incident light wavelength of 650 nm. 400 μl of the test suspension was added to each well. To obtain a sample with a certain periodicity, the following actions were performed with each experimental unit (well) with a culture medium containing both floating and partially sunken on collagen substrate cells. The medium was suspended and the suspension was collected in an Eppendorf tube. Versene solution was added three times to the well, suspended and the suspension was collected in the same tube. Then, 0.25% trypsin solution in Versene solution was added to the well and after 15 min culture medium was added, the volume of which was 2 times the volume of the trypsin solution. The contents of the well were suspended and the solution was transferred to the same tube. The cell suspension was centrifuged for 10 min at 4000 rpm The supernatant was discarded, 100 μl supernatant was added, suspended, after which 100 μl suspension was obtained. 200 μl of a 0.75% solution of methylene blue in 75° ethanol was added to it and held for 30 min at room temperature. The resulting suspension was centrifuged for 10  min at 4000  rpm. The supernatant was discarded, the stained cells were washed with distilled water, followed by centrifugation 3 times. Then, the supernatant was again drained and 0.5 ml of 0.5  M HCl in 50° ethanol was added to the stained cell pellet. As a result, a sample was obtained to determine optical density. Using the calibration curve of the dependence of optical density on the concentration of cells in the suspension, the number of cells in the resulting

2.2  The Effect of Short Peptides on the Proliferative Activity of Retinal Cells…

53

suspension was calculated. The dependence of the number of cells in suspension on the concentration of the studied drug, taking into account the control, was expressed in the form of tables and graphs (K1, development of cell culture without the influence of studied factors). Analysis of the effects of the studied peptides on retinal and pigment epithelial cell cultures showed a statistically significant dependence of the mitogenic activity of cells on the concentration of Epimental (Normoftal) and Epitalon. It was found that pigment epithelial cells proliferate somewhat more actively than retinal cells. The results obtained after the first week of cultivation showed that the greatest mitogenic activity is observed when the retinal and pigment epithelial cells are exposed to Epimental (Normoftal) in concentrations of 10 and 20 ng/ml (Tables 2.3 and 2.4). After a week of cultivation, when Epitalon acted on retinal cell cultures, the maximum mitogenic activity was observed at concentrations of 10 and 100 ng/ml, and on pigment epithelium cells at concentrations of 10 and 20 ng/ml (Tables 2.4 and 2.5). Mitogenic activity of pigment epithelial cells and retina when exposed to Epimental (Normoftal) over the next 3 weeks was maximum at concentrations of 20 and 50 ng/ml. When exposed to Epitalon cell cultures for the next 3 weeks, the most active cell proliferation was observed at concentrations of 2 and 10  ng/ml (Tables 2.4 and 2.5). The obtained data indicates the ability of the studied peptide preparations, Epimental (Normoftal) and Epitalon, to cause specific proliferation of tissue cells of the retina and pigment epithelium culture in a specific concentration. When exposed to differentiated cells of an adult organism in a short-term culture, proliferative activity of cells is observed, however, their tissue specificity is also maintained. It must be emphasized that the proliferation process does not suppress Table 2.4  Retinal cell growth dynamics in rat eye tissue culture under the influence of peptides

Study medication Control Epimental (Normoftal)

Epitalon

Concentration (ng/ ml) – 2 10 20 50 100 200 2 10 20 50 100 200

Number of cells (×106/ml) Days 7 14 21 0.3 ± 0.01 2.9 ± 0.11 4.5 ± 0.20 0.5 ± 0.03 3.75 ± 0.35 5.0 ± 0.40 4.2 ± 0.29* 4.7 ± 0.24 8.8 ± 1.50* 3.9 ± 0.14* 7.9 ± 0.37* 20.9 ± 0.76* 3.0 ± 0.37* 8.9 ± 0.16* 26.3 ± 0.91* 2.9 ± 0.33* 8.1 ± 0.23* 15.8 ± 1.31* 2.7 ± 1.60* 2.50 ± 0.11 6.4 ± 2.46* 0.2 ± 0.05 4.5 ± 0.36* 33.4 ± 0.91* 4.6 ± 0.23* 5.5 ± 0.10* 34.5 ± 0.29* 2.7 ± 0.14* 4.4 ± 0.20* 9.5 ± 0.53* 0.7 ± 0.09* 1.5 ± 0.22 4.8 ± 0.32 4.6 ± 0.20* 6.7 ± 0.31* 8.6 ± 0.25* 1.5 ± 0.16* 4.9 ± 0.21* 6.7 ± 0.21

Note: * P