Live Cell Imaging: Methods and Protocols (Methods in Molecular Biology, 2274) 1071612573, 9781071612576

Citation preview

Methods in Molecular Biology 2274

Sung-Bae Kim Editor

Live Cell Imaging Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Live Cell Imaging Methods and Protocols

Edited by

Sung-Bae Kim National Institute of Advanced Industrial Science and Technology, Research Institute for Environmental Management Technology, Tsukuba, Japan

Editor Sung-Bae Kim National Institute of Advanced Industrial Science and Technology Research Institute for Environmental Management Technology Tsukuba, Japan

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1257-6 ISBN 978-1-0716-1258-3 (eBook) https://doi.org/10.1007/978-1-0716-1258-3 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Live cells are an intriguing target to elucidate their true nature as the smallest unit of life. Each cellular function comprises complicated networks of numerous molecules and proteins in the cells. A current trend in molecular imaging points to a deeper understanding of such intracellular molecular events involving life phenomena. The corresponding imaging techniques have been intensively studied during the past decade. Particularly, nonradioactive optical readouts such as small organic indicators, modified substrates, and reporter proteins like fluorescent proteins or luciferases have revolutionized imaging and analysis of intracellular molecular events with higher spatiotemporal resolution. The present book highlights recent advances in molecular imaging techniques and protocols, which may be immediately useful in global biolaboratories. The chapters are categorized into seven parts according to the reporter materials, that is (1) Imaging with Passive Optical Readouts, (2) Imaging with Activatable Bioluminescent Probes, (3) Imaging with Functional Substrates and Luciferases, (4) Imaging with Organic Fluorescent Probes, (5) Imaging with BRET Probes, (6) Imaging with FRET Probes, and (7) Imaging with Advanced Instrumentation. We hope that this book plays a role in directing and inspiring researchers into creating smarter, next-generation imaging techniques, being truly quantitative, highly sensitive, and readily comprehended. All these efforts on advanced molecular imaging will engender a deeper understanding of biological systems and will break new ground in the research fields of life science. I am greatly honored to work with the contributors of this book. Their chapters truly reflect the hottest research protocols to date, and they generously accepted providing one or two chapters for this book. I am thankful to Professor John Walker and Dr. Fujii for their timely advice and support. Finally, I owe a special thank you to Young-Eun, my wife, and Yun and Hun, my children, for their endless support. I hope that this book provides comprehensive guidance to researchers and technicians on how to image specific molecular events in living mammalian cells or animal models. Tsukuba, Japan

Sung-Bae Kim

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

IMAGING WITH PASSIVE OPTICAL READOUTS

1 Fluorescent Labeling of the Nuclear Envelope Without Relying on Inner Nuclear Membrane Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Toshiyuki Taniyama and Shinji Sueda 2 Quantitative Analysis of Membrane Receptor Trafficking Manipulated by Optogenetic Tools . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Osamu Takenouchi, Hideaki Yoshimura, and Takeaki Ozawa 3 Simultaneous Detection of Four Cell Cycle Phases with Live Fluorescence Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bryce T. Bajar and Michael Z. Lin 4 A Murine Bone Metastasis Model Using Caudal Artery Injection and Bioluminescence Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Takahiro Kuchimaru and Shinae Kizaka-Kondoh 5 A New Lineage of Artificial Luciferases for Mammalian Cell Imaging. . . . . . . . . . Sung-Bae Kim and Rika Fujii 6 Use of Bacterial Luciferase as a Reporter Gene in Eukaryotic Systems . . . . . . . . . Jittima Phonbuppha, Ruchanok Tinikul, and Pimchai Chaiyen

PART II

10

3

15

25

37 43 53

IMAGING WITH ACTIVATABLE BIOLUMINESCENT PROBES

7 Quantitative Determination and Imaging of Gαq Signaling in Live Cells via Split-Luciferase Complementation . . . . . . . . . . . . . . . . . . . . . . . . . . . . ¨ nther Bernhardt Timo Littmann, Takeaki Ozawa, and Gu 8 A Split-Luciferase-Based Cell Fusion Assay for Evaluating the Myogenesis-Promoting Effects of Bioactive Molecules. . . . . . . . . . . . . . . . . . . . . . . Qiaojing Li, Hideaki Yoshimura, and Takeaki Ozawa 9 Development of a Single Fluorescent Protein-Based Green Glucose Indicator by Semirational Molecular Design and Molecular Evolution . . . . . . . . . Marie Mita, Devina Wongso, Hiroshi Ueda, Takashi Tsuboi, and Tetsuya Kitaguchi

PART III

v xi

69

79

89

IMAGING WITH FUNCTIONAL SUBSTRATES AND LUCIFERASES

Near-Infrared Bioluminescence Imaging of Animal Cells with Through-Bond Energy Transfer Cassette . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103 Masahiro Abe, Ryo Nishihara, Sung-Bae Kim, and Koji Suzuki

vii

viii

11

12

Contents

Azide- and Dye-Conjugated Coelenterazine Analogues for Imaging Mammalian Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111 Ryo Nishihara, Emi Hoshino, Yoshiki Kakudate, Koji Suzuki, and Sung-Bae Kim Luciferase-Specific Coelenterazine Analogues for Optical Cross Talk-Free Bioassays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127 Ryo Nishihara, Masahiro Abe, Koji Suzuki, and Sung-Bae Kim

PART IV 13

14

15

16

17

18

19

20

Live Imaging of Virus-Infected Cells by Using a Sialidase Fluorogenic Probe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tadanobu Takahashi, Yuuki Kurebayashi, Tadamune Otsubo, Kiyoshi Ikeda, Akira Minami, and Takashi Suzuki Live-Cell Imaging of Sirtuin Activity Using a One-Step Fluorescence Probe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mitsuyasu Kawaguchi and Hidehiko Nakagawa Live-Cell Fluorescence Imaging of Microtubules by Using a Tau-Derived Peptide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hiroshi Inaba and Kazunori Matsuura Discovery of the Environment-Sensitive Near-Infrared (NIR) Fluorogenic Ligand for α1-Adrenergic Receptors Imaging In Vivo . . . . . . . . . . . . Zhao Ma, Lupei Du, and Minyong Li Rapid and Sensitive Detection of Cancer Cells with Activatable Fluorescent Probes for Enzyme Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kyohhei Fujita, Mako Kamiya, and Yasuteru Urano Detection of Intracellular Reactive Oxidative Species Using the Fluorescent Probe Hydroxyphenyl Fluorescein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Wataru Sugimoto, Daisuke Miyoshi, and Keiko Kawauchi Development of Near-Infrared Fluorescent Mg2+ Probe and Application to Multicolor Imaging of Intracellular Signals . . . . . . . . . . . . . . . . . . . Yutaka Shindo, Yuma Ikeda, Yuki Hiruta, Daniel Citterio, and Kotaro Oka Long-Term Mg2+ Imaging in Live Cells with a Targetable Fluorescent Probe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Priya Ranjan Sahoo, Toshiyuki Kowada, and Shin Mizukami

PART V 21

22

IMAGING WITH ORGANIC FLUORESCENT PROBES 141

155

169

181

193

207

217

237

IMAGING WITH BRET PROBES

Highly Bright NIR-BRET System for Imaging Molecular Events in Live Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247 Ryo Nishihara, Koji Suzuki, Sung-Bae Kim, and Ramasamy Paulmurugan Ligand-Activatable BRET9 Probes for Imaging Molecular Events in Living Mammalian Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 261 Sung-Bae Kim, Rika Fujii, and Ramasamy Paulmurugan

Contents

23

24

25

26

Manipulation of Actin Cytoskeleton by Intracellular-Targeted ROS Generation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tetsuya Ishimoto and Hisashi Mori Bioluminescence Imaging of Neuronal Network Dynamics Using Aequorin-Based Calcium Sensors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sandrine Picaud, Bertrand Lambolez, and Ludovic Tricoire Method for Detecting Emission Spectral Change of Bioluminescent Ratiometric Indicators by a Smartphone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mitsuru Hattori, Tomoki Matsuda, and Takeharu Nagai Bioluminescence Resonance Energy Transfer (BRET) Imaging in Living Cells: Image Acquisition and Quantification . . . . . . . . . . . . . . . . . . . . . . . . . Hiroyuki Kobayashi and Michel Bouvier

PART VI 27 28

29

31

32

271

281

295

305

IMAGING WITH FRET PROBES

GPCR Signaling Regulation in Dictyostelium Chemotaxis. . . . . . . . . . . . . . . . . . . . 317 Yoichiro Kamimura and Masahiro Ueda Live-Cell Imaging Technique to Visualize DAMPs Release During Regulated Cell Death . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 337 Mai Yamagishi and Yoshitaka Shirasaki Time-Lapse Imaging of Necroptosis and DAMP Release at Single-Cell Resolution. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 353 Shin Murai, Yoshitaka Shirasaki, and Hiroyasu Nakano

PART VII 30

ix

IMAGING WITH ADVANCED INSTRUMENTATION

High-Throughput Whole-Plate Imaging of Cells for Multiple Biological Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367 Uday Kumar Sukumar, Frezghi Habte, Tarik F. Massoud, and Ramasamy Paulmurugan Pinhole Closure Improves Spatial Resolution in Confocal Scanning Microscopy. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 385 Akira Kitamura Workflows of the Single-Molecule Imaging Analysis in Living Cells: Tutorial Guidance to the Measurement of the Drug Effects on a GPCR . . . . . . . 391 Masataka Yanagawa and Yasushi Sako

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

443

Contributors MASAHIRO ABE • Department of Applied Chemistry, Faculty of Science and Technology, Keio University, Yokohama, Japan BRYCE T. BAJAR • Department of Biological Chemistry, Medical Scientist Training Program, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, CA, USA GU¨NTHER BERNHARDT • Institute of Pharmacy, University of Regensburg, Regensburg, Germany MICHEL BOUVIER • Institute for Research in Immunology and Cancer (IRIC), Universite´ de Montre´al, Montre´al, QC, Canada PIMCHAI CHAIYEN • School of Biomolecular Science & Engineering, Vidyasirimedhi Institute of Science and Technology (VISTEC), Rayong, Thailand DANIEL CITTERIO • Department of Applied Chemistry, Keio University, Yokohama, Kanagawa, Japan LUPEI DU • Department of Medicinal Chemistry, Key Laboratory of Chemical Biology of Natural Products (MOE), School of Pharmacy, Cheeloo College of Medicine, Shandong University, Jinan, Shandong, China RIKA FUJII • Research Institute for Environmental Management Technology, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Japan KYOHHEI FUJITA • Graduate School of Medicine, The University of Tokyo, Tokyo, Japan FREZGHI HABTE • Molecular Imaging Program at Stanford, Bio-X Program, Stanford University School of Medicine, Palo Alto, CA, USA MITSURU HATTORI • The Institute of Scientific and Industrial Research (SANKEN), Osaka University, Ibaraki, Japan YUKI HIRUTA • Department of Applied Chemistry, Keio University, Yokohama, Kanagawa, Japan EMI HOSHINO • Department of Applied Chemistry, Faculty of Science and Technology, Keio University, Yokohama, Kanagawa, Japan KIYOSHI IKEDA • Department of Organic Chemistry, School of Pharmaceutical Sciences, Hiroshima International University, Hiroshima, Japan YUMA IKEDA • Department of Applied Chemistry, Keio University, Yokohama, Kanagawa, Japan HIROSHI INABA • Department of Chemistry and Biotechnology, Graduate School of Engineering, Tottori University, Tottori, Japan; Centre for Research on Green Sustainable Chemistry, Tottori University, Tottori, Japan TETSUYA ISHIMOTO • University of Toyama, Toyama, Japan YOSHIKI KAKUDATE • Department of Applied Chemistry, Faculty of Science and Technology, Keio University, Yokohama, Kanagawa, Japan YOICHIRO KAMIMURA • Laboratory for Cell Signaling Dynamics, BDR (Biosystems and Dynamics Research Center), RIKEN, Suita, Osaka, Japan; Laboratory of Single Molecular Biology, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka, Japan MAKO KAMIYA • Graduate School of Medicine, The University of Tokyo, Tokyo, Japan; PRESTO, Japan Science and Technology Agency, Saitama, Japan

xi

xii

Contributors

MITSUYASU KAWAGUCHI • Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi, Japan KEIKO KAWAUCHI • Frontiers of Innovative Research in Science and Technology, Konan University, Kobe, Japan SUNG-BAE KIM • Research Institute for Environmental Management Technology, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Japan; Molecular Imaging Program at Stanford, Bio-X Program, Stanford University School of Medicine, Palo Alto, CA, USA TETSUYA KITAGUCHI • Cell Signaling Group, WASEDA Bioscience Research Institute in Singapore (WABIOS), Singapore, Singapore; Laboratory for Chemistry and Life Science, Institute of Innovative Research, Tokyo Institute of Technology, Yokohama, Kanagawa, Japan AKIRA KITAMURA • Laboratory of Molecular Cell Dynamics, Faculty of Advanced Life Science, Hokkaido University, Sapporo, Japan SHINAE KIZAKA-KONDOH • Life Science and Technology, Tokyo Institute o f Technology, Yokohama, Kanazawa, Japan HIROYUKI KOBAYASHI • Institute for Research in Immunology and Cancer (IRIC), Universite´ de Montre´al, Montre´al, QC, Canada TOSHIYUKI KOWADA • Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai, Miyagi, Japan TAKAHIRO KUCHIMARU • School of Life Science and Technology, Tokyo Institute of Technology, Yokohama, Kanagawa, Japan; Center for Molecular Medicine, Jichi Medical University, Tochigi, Japan YUUKI KUREBAYASHI • Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan BERTRAND LAMBOLEZ • Neuroscience Paris Seine—Institut de Biologie Paris Seine (NPS-IBPS), Sorbonne Universite´, Paris, France MINYONG LI • Department of Medicinal Chemistry, Key Laboratory of Chemical Biology of Natural Products (MOE), School of Pharmacy, Cheeloo College of Medicine, Shandong University, Jinan, Shandong, China; State Key Laboratory of Microbial Technology, Shandong University, Jinan, Shandong, China QIAOJING LI • Department of Chemistry, School of Science, The University of Tokyo, Tokyo, Japan MICHAEL Z. LIN • Department of Neurobiology, Stanford University, Stanford, CA, USA; Department of Bioengineering, Stanford University, Stanford, CA, USA TIMO LITTMANN • Institute of Pharmacy, University of Regensburg, Regensburg, Germany ZHAO MA • Department of Medicinal Chemistry, Key Laboratory of Chemical Biology of Natural Products (MOE), School of Pharmacy, Cheeloo College of Medicine, Shandong University, Jinan, Shandong, China; Department of Biochemistry and Molecular Medicine, UC Davis Comprehensive Cancer Center, University of California, Sacramento, Davis, CA, USA TARIK F. MASSOUD • Molecular Imaging Program at Stanford, Bio-X Program, Stanford University School of Medicine, Palo Alto, CA, USA TOMOKI MATSUDA • The Institute of Scientific and Industrial Research (SANKEN), Osaka University, Ibaraki, Japan KAZUNORI MATSUURA • Department of Chemistry and Biotechnology, Graduate School of Engineering, Tottori University, Tottori, Japan; Centre for Research on Green Sustainable Chemistry, Tottori University, Tottori, Japan

Contributors

xiii

AKIRA MINAMI • Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan MARIE MITA • Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo, Tokyo, Japan DAISUKE MIYOSHI • Frontiers of Innovative Research in Science and Technology, Konan University, Kobe, Japan SHIN MIZUKAMI • Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai, Miyagi, Japan HISASHI MORI • University of Toyama, Toyama, Japan SHIN MURAI • Toho University School of Medicine, Ota-ku, Tokyo, Japan TAKEHARU NAGAI • The Institute of Scientific and Industrial Research (SANKEN), Osaka University, Ibaraki, Japan HIDEHIKO NAKAGAWA • Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi, Japan HIROYASU NAKANO • Department of Biochemistry, Toho University School of Medicine, Otaku, Tokyo, Japan RYO NISHIHARA • Department of Applied Chemistry, Faculty of Science and Technology, Keio University, Yokohama, Japan KOTARO OKA • Department of Biosciences and Informatics, Keio University, Yokohama, Kanagawa, Japan; Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan; Waseda Research Institute for Science and Engineering, Tokyo, Japan TADAMUNE OTSUBO • Department of Organic Chemistry, School of Pharmaceutical Sciences, Hiroshima International University, Hiroshima, Japan TAKEAKI OZAWA • Department of Chemistry, School of Science, The University of Tokyo, Tokyo, Japan RAMASAMY PAULMURUGAN • Molecular Imaging Program at Stanford, Bio-X Program, Stanford University School of Medicine, Palo Alto, CA, USA JITTIMA PHONBUPPHA • School of Biomolecular Science & Engineering, Vidyasirimedhi Institute of Science and Technology (VISTEC), Rayong, Thailand SANDRINE PICAUD • Neuroscience Paris Seine—Institut de Biologie Paris Seine (NPS-IBPS), Sorbonne Universite´, Paris, France PRIYA RANJAN SAHOO • Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai, Miyagi, Japan YASUSHI SAKO • Cellular Informatics Laboratory, RIKEN Cluster for Pioneering Research, Saitama, Japan YUTAKA SHINDO • Department of Biosciences and Informatics, Keio University, Yokohama, Kanagawa, Japan YOSHITAKA SHIRASAKI • Graduate School of Pharmaceutical Sciences, The University of Tokyo, Bunkyo-ku, Tokyo, Japan SHINJI SUEDA • Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Japan WATARU SUGIMOTO • Frontiers of Innovative Research in Science and Technology, Konan University, Kobe, Japan UDAY KUMAR SUKUMAR • Molecular Imaging Program at Stanford, Bio-X Program, Stanford University School of Medicine, Palo Alto, CA, USA KOJI SUZUKI • Department of Applied Chemistry, Faculty of Science and Technology, Keio University, Yokohama, Japan

xiv

Contributors

TAKASHI SUZUKI • Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan TADANOBU TAKAHASHI • Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan OSAMU TAKENOUCHI • Department of Chemistry, School of Science, The University of Tokyo, Tokyo, Japan; Laboratory for Chromosome Segregation, RIKEN Center for Biosystems Dynamics Research (BDR), Kobe, Japan TOSHIYUKI TANIYAMA • Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Japan RUCHANOK TINIKUL • Department of Biochemistry and Center for Excellence in Protein and Enzyme Technology, Faculty of Science, Mahidol University, Bangkok, Thailand LUDOVIC TRICOIRE • Neuroscience Paris Seine—Institut de Biologie Paris Seine (NPS-IBPS), Sorbonne Universite´, Paris, France TAKASHI TSUBOI • Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo, Tokyo, Japan HIROSHI UEDA • Laboratory for Chemistry and Life Science, Institute of Innovative Research, Tokyo Institute of Technology, Yokohama, Kanagawa, Japan MASAHIRO UEDA • Laboratory for Cell Signaling Dynamics, BDR (Biosystems and Dynamics Research Center), RIKEN, Suita, Osaka, Japan; Laboratory of Single Molecular Biology, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka, Japan YASUTERU URANO • Graduate School of Medicine, The University of Tokyo, Tokyo, Japan; Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan; CREST, Japan Agency for Medical Research and Development, Tokyo, Japan; CREST, Japan Agency for Medical Research and Development, Tokyo, Japan DEVINA WONGSO • Cell Signaling Group, WASEDA Bioscience Research Institute in Singapore (WABIOS), Singapore, Singapore MAI YAMAGISHI • Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Bunkyo City, Japan MASATAKA YANAGAWA • Cellular Informatics Laboratory, RIKEN Cluster for Pioneering Research, Saitama, Japan HIDEAKI YOSHIMURA • Department of Chemistry, School of Science, The University of Tokyo, Tokyo, Japan

Part I Imaging with Passive Optical Readouts

Chapter 1 Fluorescent Labeling of the Nuclear Envelope Without Relying on Inner Nuclear Membrane Proteins Toshiyuki Taniyama and Shinji Sueda Abstract The nuclear envelope (NE), a double membrane that separates nuclear components from the cytoplasm, undergoes a breakdown and reformation during cell division. To trace NE dynamics, the NE needs to be labeled with a fluorescent marker, and for this purpose, markers based on inner nuclear membrane (INM) proteins are normally used. However, NE labeling with INM proteins has some limitations. Here, we introduce a protocol for fluorescent labeling and imaging of NE that does not rely on INM proteins, along with protocols for simultaneously imaging two nuclear components and for time-lapse imaging of labeled cells. Key words Nuclear envelope, Fluorescence imaging, Fluorescent labeling, Inner nuclear membrane protein, Biotinylation, Fluorescent protein

1

Introduction The nuclear envelope (NE) is a principal cellular structure comprising the double membrane, which regulates the traffic of various molecules between the nucleoplasm and the cytoplasm. It is well known that the NE undergoes a breakdown and reformation during mitosis in animal cells; however, the detailed mechanisms underlying these processes are not yet fully understood [1–4]. To trace NE dynamics in living cells, the NE needs to be specifically labeled with an appropriate fluorescent marker. For this purpose, markers based on the inner nuclear membrane (INM) proteins are normally used [5–7]; INM proteins are nuclear proteins associated with or embedded in the INM of the NE. In this approach, the INM proteins fused to a fluorescent protein are expressed in desired cells, and their movement is traced by fluorescence (FL) microscopy. However, INM fusion proteins interact with nuclear components, and thus exhibit peculiar localization through those interactions. Moreover, their overexpression could perturb the function of the nucleus. To circumvent these problems, we have

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

3

4

Toshiyuki Taniyama and Shinji Sueda

developed a method for labeling the NE that does not use INM proteins [8]. In this protocol, NE labeling is achieved by localizing the green fluorescent protein (GFP) on the INM by using the biotinylation reaction from archaeon Sulfolobus tokodaii. In biotinylation, biotin protein ligase (BPL) mediates the attachment of biotin to the specific lysine residue of biotin carboxyl carrier protein (BCCP) [9, 10]. Biotinylation from S. tokodaii has a unique property by which BPL forms an extremely stable complex with its product, biotinylated BCCP [11, 12]. In NE labeling, BPL is anchored on the surface of the cell membrane facing the cytoplasm or nucleoplasm by expressing it as a fusion protein with a single transmembrane domain (TM) of the human platelet-derived growth factor receptor (see Fig. 1); the resulting fusion protein is referred to as TM-BPL. TM-BPL is distributed in the membrane network of the cell, including the INM. On the other hand, BCCP is expressed as a fusion protein with GFP carrying the nuclear localization signal (NLS); the resulting fusion protein is referred to as BCCP-GFPNLS. These fusion proteins are expressed in mammalian cells by introducing the expression plasmids for the respective fusion proteins into cells with transfection reagents (see Fig. 1). In the cells expressing both fusion proteins, BCCP-GFP-NLS is transferred into the nucleus and trapped on the INM through the complexation between BPL and BCCP moieties via biotinylation, which results in the selective labeling of the NE in the living cells. With this method, we succeeded in the fluorescent labeling of the NE in living mammalian cells and clearly visualized the behavior of the NE during mitosis [8]. In this chapter, we describe a unique protocol for NE labeling based on S. tokodaii biotinylation. We also introduce the simultaneous labeling of the NE and the nuclear lamina along with the three-dimensional reconstruction of the labeled cells by confocal laser scanning microscopy (CLSM). The nuclear lamina is a fibrillar network inside the nucleus [13, 14]. To label it, Lamin A, fused to red fluorescent protein mApple, is coexpressed with TM-BPL and BCCP-GFP-NLS in the cells. We also describe the protocol for the time-lapse imaging of labeled cells.

2

Materials

2.1 Preparation of Cells for FL Imaging

1. HeLa cells (JCRB Cell Bank, Ibaraki, Japan) (see Note 1). Store at 80  C. 2. Dulbecco’s modified Eagle’s medium (DMEM) (see Note 2). Store at 4  C. 3. Fetal bovine serum (FBS) (see Note 3). Store at

20  C.

Fluorescent Labeling of the Nuclear Envelope

5

Fig. 1 FL labeling of the NE based on S. tokodaii biotinylation. TM-BPL and BCCP-GFP-NLS are coexpressed in a mammalian cell by DNA transfection with the expression plasmids for the respective fusion proteins. TM-BPL is distributed in the membrane network of the cell, including the INM. BCCP-GFP-NLS is trapped on the INM through the complexation between BPL and BCCP moieties. ER and ONM represent the endoplasmic reticulum and the outer nuclear membrane, respectively. NPC represents the nuclear pore complex

4. Penicillin-streptomycin solution: 10,000 U/mL penicillin and 10 mg streptomycin/mL (see Note 4). Store at 20  C. 5. Phosphate-buffered saline (PBS) (see Note 5). Store at 4  C. 6. Poly-L-lysine solution: 0.1 mg/mL solution. Store at 4  C. 7. Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific, Rockford, IL, USA) (see Note 6). Store at 4  C. 8. Lipofectamine 2000 (Thermo Fisher Scientific). Store at 4  C. 9. X-tremeGENE 9 (Roche, Basel, Switzerland). Store at 4  C. 10. Hoechst 34580 solution: 1 mg/mL solution in water. Store at 20  C. 11. Leibovitz’s L-15 medium. Store at 4  C. 12. 35 mm glass bottom dish (see Note 7). 2.2 Instruments for FL Imaging

For live-cell FL imaging, an inverted FL microscope is necessary (see Note 8). The FL microscope used in our laboratory was equipped as follows: 1. Inverted microscope IX83 (Olympus, Tokyo, Japan). 2. Confocal laser (Olympus).

scanning

system

FLUOVIEW

FV1200

3. Nomarski differential interference contrast (DIC) system. 4. Objective lens UPLSAPO60XO: 1.35NA.

6

Toshiyuki Taniyama and Shinji Sueda

5. Laser sources: diode lasers 405, 473, 559, 635 nm. 6. FL channels: blue channels, excitation with 405 nm laser and detection with a band-pass filter (430–455 nm); green channels, excitation with 473 nm laser and detection with a bandpass filter (490–540 nm); red channels, excitation with 559 nm laser and detection with a band-pass filter (575–675 nm) (see Note 9). 7. Z-drift compensator IX3-ZDC (see Note 10). 8. Stage top incubator (Tokai Hit, Fujinomiya, Japan) (see Note 11).

3

Methods

3.1 FL Imaging of the NE

1. Maintain HeLa cells in DMEM supplemented with 10% FBS and appropriate antibiotics at 37  C under 5% CO2 in a CO2 incubator (see Note 12). 2. Prepare a 35 mm glass bottom dish coated with poly-L-lysine through the following steps 3–6. 3. Add 0.2 mL of a 0.1 mg/mL poly-L-lysine solution on the surface of the glass. 4. Incubate for 10 min at room temperature. 5. Remove the poly-L-lysine solution and wash the dish with PBS twice. 6. Add 2 mL of DMEM containing 10% FBS. 7. Seed the cells on the poly-L-lysine-coated dish containing medium (see Note 13). 8. Allow the cells to grow to approximately 5  105 cells per dish for 24 h at 37  C in a CO2 incubator. 9. Transfect the cells with the expression plasmids for TM-BPL and BCCP-GFP-NLS using an appropriate transfection reagent (see Note 14) through the following steps 10–14. 10. Dilute the stock solution of plasmid DNAs in 250 μL of OptiMEM I Reduced Serum Medium. 11. Dilute the appropriate amount of a transfection reagent in 250 μL of Opti-MEM I Reduced Serum Medium and incubate it for 5 min at room temperature. 12. Mix the diluted plasmid DNAs with the diluted transfection reagent and incubate it for 20 min at room temperature. 13. Add 500 μL of the mixture to the cell culture medium in the dish and mix it gently by rocking the dish back and forth. 14. Incubate the cells for 24 h at 37  C in a CO2 incubator.

Fluorescent Labeling of the Nuclear Envelope

7

Fig. 2 An example of the imaging of cells expressing TM-BPL and BCCP-GFPNLS. HeLa cells were grown on a 35 mm glass bottom dish and then transfected with 2 and 1 μg of the expression plasmids for TM-BPL and BCCP-GFP-NLS, respectively, using Lipofectamine 2000. Twenty-four hours after transfection, the cells were stained with Hoechst 34580 and observed with a confocal microscope on green (upper left) and blue (upper right) channels for GFP and Hoechst, respectively. The lower left panel represents an overlay of images from both channels. The lower right panel is a DIC image of the cells. Scale bar, 10 μm. (Reprinted (adapted) from Taniyama et al. [8] with permission from American Chemical Society)

15. Twenty-four hours after transfection, replace the culture medium with fresh DMEM containing 10% FBS. 16. Stain the cells with Hoechst 34580 by adding the stock solution of the dye to the medium at a final concentration of 1 μg/ mL (see Note 15). 17. Incubate the cells for 30 min at 37  C in a CO2 incubator. 18. Replace the culture medium with fresh DMEM containing 10% FBS. 19. Observe the cells by FL microscopy and find appropriate labeled cells. 20. Record FL images of the cells on green and blue channels for GFP and Hoechst, respectively (see Fig. 2, see Note 16). 3.2 Simultaneous Imaging of Two Nuclear Components and 3D Reconstruction

1. Grow the cells on a glass bottom dish coated with poly-L-lysine according to the procedure mentioned in Subheading 3.1. 2. Transfect the cells with the expression plasmids for TM-BPL and BCCP-GFP-NLS along with the expression plasmid for a

8

Toshiyuki Taniyama and Shinji Sueda

Fig. 3 An example of simultaneous imaging of the NE and the nuclear lamina. HeLa cells were grown on a 35 mm glass bottom dish and then transfected with 2, 1, and 2 μg of the expression plasmids for TM-BPL, BCCP-GFP-NLS, and mApple-Lamin A, respectively, using X-tremeGENE 9. Twenty-four hours after transfection, a series of sectional images were recorded from the bottom to the top of the labeled cells at an interval of 0.25 μm with a confocal microscope on green and red channels for GFP and mApple, respectively. (a) Sectional images of the cells at a given z-depth. The left and middle panels represent images on green and red channels, respectively. The right panel is a DIC image of the cells. (b) Three-dimensional reconstruction from a series of sectional images. Three-dimensional images of a labeled cell in the boxed region of panel (a) were reconstructed by stacking 40 sectional images on green and red channels. The left and right panels represent the projection images from the z-direction on green and red channels, respectively, along with the orthogonal views in the xz- and yz-planes. A nucleoplasmic reticulum (NR) formed by the invagination across the nucleus was observed in the xz-plane on both channels; the NR is regarded as a common feature of eukaryotic cells [15, 16]. Scale bars, 10 μm. (Reprinted (adapted) from Taniyama et al. [8] with permission from American Chemical Society)

fusion protein of mApple with Lamin A (mApple-Lamin A) according to the procedure mentioned in Subheading 3.1 (see Note 17). 3. Twenty-four hours after transfection, replace the culture medium with fresh DMEM containing 10% FBS.

Fluorescent Labeling of the Nuclear Envelope

9

4. Observe the cells with a confocal microscope and find appropriate labeled cells. 5. Record a series of sectional FL images from the bottom to the top of the labeled cells at an appropriate interval on green and red channels for GFP and mApple, respectively (see Fig. 3, see Note 18). 6. Reconstruct three-dimensional images by stacking the sectional images from each channel in the z-direction by ImageJ (see Note 19) through the following steps 7–9. 7. (Optional) Open a series of sectional images from a single channel by running the command “Image Sequence.” 8. (Optional) Run the command “Z-project” to acquire a projection image from the z-direction (see Note 20). 9. (Optional) Save the file in an appropriate format. 3.3 Time-Lapse Imaging of the Cells

1. Grow the cells on a glass bottom dish coated with poly-L-lysine according to the procedure mentioned in Subheading 3.1. 2. Transfect the cells with the expression plasmids for the desired marker proteins according to the procedure mentioned in Subheading 3.1. 3. Twenty-four hours after transfection, replace the culture medium with Leibovitz’s L-15 medium containing 10% FBS (see Note 21). 4. Observe the cells with a FL microscope and focus on an appropriate labeled cell (see Note 22). 5. Record a series of images at regular time intervals on the desired FL channels (see Fig. 4, see Note 23). 6. Analyze the image data obtained. Time-lapse movies can be constructed by assembling each imaging frame with appropriate software. For example, time-lapse movies can be constructed with ImageJ through the following steps 7–9. 7. (Optional) Open a time-lapse sequence by running the command “Image Sequence.” 8. (Optional) Adjust the size (number of pixels) of image data by running the command “Size.” 9. (Optional) Save the file in AVI format. At that time, set an appropriate frame rate.

10

Toshiyuki Taniyama and Shinji Sueda

Fig. 4 An example of time-lapse imaging of labeled cells. HeLa cells were grown on a 35 mm glass bottom dish and then transfected with 2, 1, and 2 μg of the expression plasmids for TM-BPL, BCCP-GFP-NLS, and mApple-Lamin A, respectively, using X-tremeGENE 9. Twenty-four hours after transfection, a series of images were recorded every 15 min with a confocal microscope on green and red channels for GFP and mApple, respectively. The first and second columns from the left represent time-lapse sequences of the cell recorded from prophase to cytokinesis on green and red channels, respectively. The third column from the left is an overlay of images from both channels. The right column shows DIC images of the cell. Scale bars, 10 μm. (Reprinted (adapted) from Taniyama et al. [8] with permission from American Chemical Society)

Fluorescent Labeling of the Nuclear Envelope

4

11

Notes 1. Cell lines provided by official suppliers should be employed in experiments to prevent the use of contaminated cells. 2. DMEM containing phenol red can be used for FL imaging by CLSM because phenol red does not significantly influence FL imaging with a confocal microscope. 3. FBS alternatives, such FetalClone (Hyclone Laboratories, Logan, UT, USA), can also be used depending on the experiments. 4. Add the stock solution to culture medium at a final concentration of 100 U/mL penicillin and 0.1 mg/mL streptomycin (100 times dilution with a culture medium). Store at 4  C. 5. We prepare 1 PBS by diluting 10 PBS with sterilized water. 6. This medium is used for the dilution of transfection reagents. 7. To maintain a sufficient number of cells on the glass surface, the use of a good quality glass bottom dish is recommended. We employed it provided by AGC Techno Glass (Shizuoka, Japan). 8. To acquire high-quality imaging data and sectional images, the use of a confocal microscope is recommended. 9. An appropriate combination of lasers and detection filters must be selected depending on the optical properties of the fluorescent dyes. 10. For extended time-lapse imaging, the use of a z-drift compensation system is recommended to maintain the focus on the target cell. 11. For long-term observation of the cells, a stage top incubation system is necessary. With the use of Leibovitz’s L-15 medium as a culture medium, the pH of the culture medium can be maintained without a supply of CO2 to the medium. 12. To maintain mammalian cells, the use of a culture medium supplemented with antibiotics is recommended. We usually use a culture medium containing 100 U/mL penicillin and 0.1 mg/mL streptomycin. 13. The amount of cells to be seeded depends on the species of cells and culture conditions. To control the number of cells on the dish, check the rate of cell growth in advance and count the number of cells before seeding. 14. We used Lipofectamine 2000 or X-tremeGENE 9 as a transfection reagent. Conditions for transfection depend on the species of cells and culture conditions. In the case of transfection of HeLa cells with Lipofectamine 2000 or X-tremeGENE 9, sufficient transfection efficiency was observed when the

12

Toshiyuki Taniyama and Shinji Sueda

plasmid DNA and the transfection reagent were mixed at a ratio of 1 (DNA μg): 2 (transfection reagent μL). In the NE labeling with TM-BPL and BCCP-GFP-NLS, the expression levels of both fusion proteins are crucial. As the overexpression of BCCP-GFP-NLS can cause significant background noise for NE labeling, the expression of BCCP-GFP-NLS should be maintained at a lower level than that of TM-BPL. Considering this point, we used twice the amount of plasmid of TM-BPL to that of BCCP-GFP-NLS (2 μg TM-BPL and 1 μg BCCP-GFPNLS for the experiment with a 35 mm dish). 15. Cells were treated with a fluorescent Hoechst dye to stain the chromosomes in cells. Several kinds of Hoechst dyes are available. We used Hoechst 34580 (maximum excitation wavelength 392 nm, maximum emission wavelength 440 nm) considering the optical equipment on the FL microscope. 16. When cells at interphase or prophase are observed, the FL from GFP is observed mainly at the nuclear rim, that is, outline of the FL from Hoechst (Fig. 2). Minor FL from GFP is also observed from the membrane network outside the nucleus, which derives from the BCCP-GFP-NLS trapped on the membrane outside the nucleus through complexation with TM-BPL. To acquire high resolution images, it is necessary to use an objective lens with a high numerical aperture (NA; typically NA  1.3 for oil immersion). Irradiation of excitation light to the sample should be minimized to avoid the photobleaching of the fluorescent dyes. DIC images or phasecontrast images should be recorded along with FL images to check the conditions of the target cells. 17. We typically transfected HeLa cells with 2, 1, and 2 μg of expression plasmids for TM-BPL, BCCP-GFP-NLS, and mApple-Lamin A, respectively, for experiments with a 35 mm dish. We used Lipofectamine 2000 or X-tremeGENE 9 as a transfection reagent and succeeded in labeling in both cases; however, in our experiments using HeLa cells, the transfected cells seemed to be in better conditions when X-tremeGENE 9 was used. 18. We typically recorded 40 sectional images from the bottom to the top of the cell at 0.25 μm intervals to acquire the whole image of the cell with adequate resolution. 19. To process image data, ImageJ software can be used instead of the original software provided by the microscope manufactures. Fiji (a distribution of ImageJ) is especially useful. Fiji includes many useful plugins, and the original files of microscope manufactures can be processed directly.

Fluorescent Labeling of the Nuclear Envelope

13

20. Orthogonal views are obtained by running the command “Orthogonal Views,” or a three-dimensional view is obtained by running the command “3D Project.” 21. We used Leibovitz’s L-15 medium to maintain the pH of the culture medium during observation without a supply of CO2 to the medium. 22. For time-lapse imaging, the treatment of cells with Hoechst dyes should be avoided. We observed cell death during mitosis when cells were treated with Hoechst 34580. 23. We typically recorded a time-lapse sequence every 2 or 15 min to observe the process of cell division. During observation, cells should be maintained under moist conditions at 37  C in a chamber equipped with a heater, installed on the stage of the microscope. To maintain a focus on the target cell, the use of a z-drift compensator is recommended. DIC images or phase-contrast images should be recorded along with FL images to check the conditions of the target cells.

Acknowledgments We thank the Bioimaging Engineering Group of Kyushu Institute of Technology for the technical support. This work was supported by JSPS KAKENHI Grant Number 18K05177. References 1. Schellhaus AK, De Magistris P, Antonin W (2016) Nuclear reformation at the end of mitosis. J Mol Biol 428:1962–1985 2. Katta SS, Smoyer CJ, Jaspersen SL (2014) Destination: inner nuclear membrane. Trends Cell Biol 24:221–229 3. Larijani B, Poccia DL (2009) Nuclear envelope formation: mind the gaps. Annu Rev Biophys 38:107–124 4. Anderson DJ, Hetzer MW (2008) The life cycle of the metazoan nuclear envelope. Curr Opin Cell Biol 20:386–392 5. Ellenberg J, Siggia ED, Moreira JE, Smith CL, Presley JF, Worman HJ, Lippincott-Schwartz J (1997) Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis. J Cell Biol 138:1193–1206 6. Puhka M, Vihinen H, Joensuu M, Jokitalo E (2007) Endoplasmic reticulum remains continuous and undergoes sheet-to-tubule transformation during cell division in mammalian cells. J Cell Biol 179:895–909

7. Haraguchi T, Koujin T, Hayakawa T, Kaneda T, Tsutsumi C, Imamoto N, Akazawa C, Sukegawa J, Yoneda Y, Hiraoka Y (2000) Live fluorescence imaging reveals early recruitment of emerin, LBR, RanBP2, and Nup153 to reforming functional nuclear envelopes. J Cell Sci 113:779–794 8. Taniyama T, Tsuda N, Sueda S (2018) Fluorescent labeling of the nuclear envelope by localizing GFP on the inner nuclear membrane. ACS Chem Biol 13:1463–1469 9. Chapman-Smith A, Cronan JE Jr (1999) In vivo enzymatic protein biotinylation. Biomol Eng 16:119–125 10. Li YQ, Sueda S, Kondo H, Kawarabayasi Y (2006) A unique biotin carboxyl carrier protein in archaeon Sulfolobus tokodaii. FEBS Lett 580:1536–1540 11. Sueda S, Tanaka H, Yamagishi M (2009) A biotin-based protein tagging system. Anal Biochem 393:189–195 12. Ikeda T, Miyao H, Sueda S (2014) Ultrasensitive biotin assay of a noncompetitive format in

14

Toshiyuki Taniyama and Shinji Sueda

a homogeneous solution based on resonance energy transfer induced by a protein-protein interaction. Anal Chem 86:5673–5677 13. Stuurman N, Heins S, Aebi U (1998) Nuclear lamins: their structure, assembly, and interactions. J Struct Biol 122:42–66 14. Broers JLV, Machiels BM, van Eys GJJM, Kuijpers HJH, Manders EMM, van Driel R, Ramaekers FCS (1999) Dynamics of the

nuclear lamina as monitored by GFP-tagged A-type lamins. J Cell Sci 112:3463–3475 15. Malhas A, Goulbourne C, Vaux DJ (2011) The nucleoplasmic reticulum: form and function. Trends Cell Biol 21:362–373 16. Prunuske AJ, Ullman KS (2006) The nuclear envelope: form and reformation. Curr Opin Cell Biol 18:108–116

Chapter 2 Quantitative Analysis of Membrane Receptor Trafficking Manipulated by Optogenetic Tools Osamu Takenouchi, Hideaki Yoshimura, and Takeaki Ozawa Abstract Membrane receptors play a crucial role in transmitting external signals inside cells. Signal molecule-bound receptors activate multiple downstream pathways, the dynamics of which are modulated by intracellular trafficking. A significant contribution of β-arrestin to intracellular trafficking has been suggested, but the underlying mechanism is poorly understood. Here, we describe a protocol for manipulating β-arrestinregulated membrane receptor trafficking using photo-induced dimerization of cryptochrome-2 from Arabidopsis thaliana and its binding partner CIBN. Additionally, the protocol guides analytical methods to quantify the changes in localization and modification of membrane receptors during trafficking. Key words Optogenetics, Intracellular trafficking, Membrane receptor, GPCR , β-Arrestin, Cryptochrome

1

Introduction Intracellular trafficking of membrane receptors plays an essential role in regulating cell responses to extracellular signals [1, 2]. Cellsurface membrane receptors activate downstream pathways upon stimulation by extracellular signals, followed by the sequestration of the receptors from the cell surface via β-arrestin-dependent internalization [3–5]. Some of these internalized receptors are recycled back to the cell surface, while others are delivered to lysosomes for degradation. Therefore, the dynamic range and kinetics of the downstream signals are primarily defined by intracellular trafficking. Previous studies using live imaging analysis have suggested that the intracellular trafficking of receptors depends on the timing of the dissociation of β-arrestin from receptors [6, 7]. However, the lack of methods to artificially control β-arrestin-receptor interactions has prevented a detailed analysis of the trafficking mechanism. Dimerizers, which form protein complexes upon specific stimulations, are versatile tools for controlling protein-protein interactions [8, 9]. The protein pair of FKBP and FRB is a representative

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

15

16

Osamu Takenouchi et al.

dimerizer that forms a complex upon stimulation with rapamycin [10]. Owing to its high affinity, the FKBP-FRB pair has been used for the manipulation and analysis of various biological phenomena [11, 12]. A recent study, however, revealed that this high affinity might hamper the dissociation of the formed complex even after washing to remove rapamycin [13]. To overcome this problem, photodimerizers, which reversibly form a dimer upon light stimulation, have recently been isolated from plants, such as Arabidopsis thaliana [14, 15]. Cryptochrome-2 (CRY) is a photodimerizer that interacts with its partner protein CIBN upon stimulation by blue light [16, 17]. The CRY-CIBN complex dissociates in the absence of blue light, which is beneficial for mimicking the reversible interaction between membrane receptors and β-arrestin. We have shown that the CRY-CIBN system is a useful tool for manipulating the intracellular trafficking of various membrane receptors, such as G protein-coupled receptors (GPCRs) and a growth factor receptor [18]. The protocol described in this chapter introduces a method to manipulate the intracellular trafficking of a representative GPCR, β2-adrenergic receptor (ADRB2). The protocol exemplifies that the attachment of CIBN and CRY to ADRB2 and β-arrestin, respectively, enables a direct and reversible control of the ADRB2–β-arrestin interaction, where the fusion proteins CIBN-ADRB2 and CRY–β-arrestin were named ADRB2CIBN and ArrestinCRY, respectively. The examples show that blue light stimulation promotes the interaction between ADRB2CIBN and ArrestinCRY, and initiates endocytosis and intracellular trafficking of the resulting complex. Under dark conditions, ArrestinCRY dissociates from ADRB2CIBN , and the latter is recycled to the cell membrane. Prolonged light exposure directs ADRB2CIBN toward lysosomal degradation (see Fig. 1). Additionally, the protocol guides how to analyze (1) the time-course alteration of trafficking-related proteins’ localization and (2) changes in the signal pathway under light-regulated conditions.

2

Materials

2.1 Cell Culture and Transfection

1. HEK293 cells or HEK293 cells stably expressing ADRB2CIB and ArrestinCRY (see Note 1). 2. Dulbecco’s modified Eagle medium (DMEM, FUJIFILM Wako Pure Chemical Industry, Japan). 3. Fetal bovine serum (FBS, Sigma-Aldrich). 4. Penicillin/streptomycin (Thermo Fisher Scientific, USA). 5. Poly-L-lysine-coated glass bottom 35-mm dish (Iwaki, Japan). 6. Poly-L-lysine-coated polystyrene 35-mm dish (Iwaki, Japan).

Optogenetic Regulation of Membrane Receptor Trafficking

a

b

ADRB2

CIBN β-arrestin

2

15

30

Magnified

ADRB2CIB

Light

CRY

Irradiation (min) 0

Cell Membrane

17

Endocytosis

Recycling

Degradation

Dark

ArrestinCRY

Light Lysosome

Merge

Endosome

Fig. 1 Optical control of the intracellular trafficking of ADRB2. (a) Schematic of the optical control system. CIBN-fused ADRB2 (ADRB2CIBN ) is localized on the cell surface. Upon blue-light irradiation, the CRY-CIBN interaction leads to the attachment of β-arrestin to the cell membrane, triggering endocytosis of ADRB2CIBN. Prolonged light irradiation promotes the trafficking of ADRB2CIBN toward the lysosome, whereas under dark conditions, it is recycled to the cell membrane. (b) Laser-scanning confocal fluorescence microscope images of ADRB2CIBN and ArrestinCRY upon photoirradiation [18]. (Adapted from Takenouchi et al. [18] with permission from Springer Nature)

7. 0.05% phenol red-free trypsin–EDTA (Thermo Fisher Scientific). 8. Lipofectamine LTX with PLUS reagent (Thermo Fisher Scientific). 2.2

Plasmids

1. pcDNA3.1/V5-His(B) vector encoding ADRB2CIB, where ADRB2CIB contains a SNAP-tag (New England Biolabs, USA), ADRB2 (1–413 amino acids (A.A.), NM_000024.5), and CIBN (1–171 A.A., NM_119618) (see Note 2). 2. pcDNA4/myc-His(B) vector encoding ArrestinCRY, where ArrestinCRY is composed of CRYPHR (1–498 A.A., NM_100320), mCherry, and β-arrestin 2 (1–409 A.A., MN_004313).

2.3

Antibodies

1. Antibodies against Rab5, Rab7, LAMP1, and V5 tag. 2. Alexa Fluor 488-conjugated Goat anti-rabbit IgG secondary antibody (Thermo Fisher Scientific). 3. ECL anti-rabbit antibody (GE Healthcare, USA).

2.4 Live Imaging of ADRB2CIB

linked

to

HRP

1. SNAP-Surface Alexa Fluor 647 (New England Biolabs). 2. PBS ( ) and PBS (+). 3. Phenol red-free DMEM with HEPES, pH 7.4 (FUJIFILM Wako Pure Chemical Industry). 4. Confocal microscope (IX81, FV1000D, Olympus).

18

2.5

Osamu Takenouchi et al.

Immunostaining

1. LED device (TH-211  200BL, CCS Inc., Japan). 2. Formaldehyde. 3. Polyoxyethylene sorbitan monolaurate (Tween 20).

2.6

Western Blotting

1. Scraper. 2. Sample buffer: 125 mM Tris, pH 6.8, 10% glycerol, 4% SDS, 0.006% bromophenol blue, and 10% mercaptoethanol. 3. Nitrocellulose blotting membranes (GE Healthcare, USA). 4. Blocking buffer: 1% skim milk in Tris-buffered saline with Tween 20 (TBST). 5. SuperSignal West Femto (Thermo Scientific, USA). 6. Image analyzer (ImageQuant LAS 4000, GE Healthcare).

2.7 Immunoprecipitation

1. Lysis buffer: 50 mM HEPES, pH 7.5, 0.5% NP-40, 250 mM NaCl, 2 mM EDTA, 10% glycerol, 1 mM sodium orthovanadate, 1 mM sodium fluoride, 1 mM PMSF, 10 mg/ml leupeptin, and MG132 proteasome inhibitor. 2. Protein G Sepharose (GE Healthcare).

3

Methods

3.1 Cell Cultivation and Transfection

1. Culture HEK293 cells in DMEM containing 10% FBS and 1% penicillin/streptomycin and keep the cell confluency between 20% and 80%. 2. Trypsinize the cells with 0.05% phenol red-free trypsin–EDTA. 3. Count the cell number and add 5  105 cells to poly-L-lysinecoated glass bottom (for live imaging and immunostaining) or polystyrene 35 mm dishes (for the other experiments) (see Note 3). 4. Incubate the cells for at least 12 h at 37  C and 5% CO2 in a humidified incubator.

3.2

Transfection

1. Prepare two 1.5 mL microcentrifuge tubes (tubes 1 and 2). 2. To tube 1 (Sol 1), add 125 μL Opti-MEM, 1 μg plasmid DNA, and 2.5 μL of PLUS reagent. 3. To tube 2 (Sol 2), add 125 μL Opti-MEM and 5 μL Lipofectamine LTX. 4. Combine Sol 1 and Sol 2 and mix by gently pipetting up and down. Then, incubate the mixture for 5 min at room temperature (RT). 5. Carefully add the mixtures to the cells (see Note 4).

Optogenetic Regulation of Membrane Receptor Trafficking

19

6. Incubate the cells for 24 h at 37  C and 5% CO2 in an incubator. 3.3 Live Imaging of ADRB2CIB and ArrestinCRY Trafficking Using Confocal Microscopy

1. Add 0.5 μM SNAP-Surface Alexa Fluor 647 to the DMEM medium and incubate the HEK293 cells expressing ADRB2CIB and ArrstinCRY for 30 min at 37  C (see Note 5). 2. Wash the cells with PBS ( ) three times. 3. Add 2 mL prewarmed (at 37  C) phenol red-free DMEM. 4. Place the dish on the microscope stage. 5. Acquire cell images every 1 min for 2 h. 6. To activate CRY, the cells were stimulated using a 440 nm laser of the microscope at 0.5% output with a scan speed of 2.0 μs/pixel (see Note 6).

3.4 ELISA Assay to Quantify the Amount of ADRB2CIB on the Cell Surface

1. Stimulate the HEK293 cells expressing ADRB2CIB and ArrestinCRY with blue light at 3 mW/cm2 using a LED device at 37  C in a humidified incubator (see Fig. 2) (see Note 7). 2. Wash the cells three times with PBS (+). 3. Fix the cells using 4% formaldehyde. 4. For blocking, treat the cells with gelatin from cold-water fish skin for 1 h. 5. Label the SNAP-tag on the cell surface with the anti-SNAP-tag antibody for 1 h. 6. Wash the cells twice with PBS (+). 7. Add the ECL anti-rabbit antibody and incubate for 1 h at RT. 8. Wash the cells three times with PBS (+). 9. Add 300 μL TMB solution and incubate the mixture for 30 min at RT. 10. Add 350 μL of 2 M sulfuric acid and incubate for a further 30 min at RT. 11. Measure the OD450 of 100 μL of the solution using a microplate reader. 12. Calculate the amount of ADRB2CIB on the cell surface using the following formula:

OD ODmock = ODbasal ODmock  100, where ODmock and ODbasal are the ODs of nonstimulated naı¨ve HEK293 cells and nonstimulated transfected HEK293 cells, respectively.

3.5 Immunostaining of ADRB2CIB and Endosomes

1. Add SNAP-Surface Alexa Fluor 647 to the medium to a final concentration of 0.5 μM and incubate the HEK293 cells expressing ADRB2CIB and ArrestinCRY for 30 min at 37  C.

20

Osamu Takenouchi et al.

Fig. 2 LED irradiation system for optogenetics. A blue-light LED device (TH-211  200BL, CCS Inc.) was placed in a CO2 incubator to irradiate samples at 37  C and 5% CO2

2. Wash the cells three times with PBS (+). 3. Stimulate the cells with blue light at 3 mW/cm2 using a LED device at 37  C in a humidified incubator. 4. Fix the cells using 4% formaldehyde. 5. Incubate the cells with 0.1% Tween 20 for 3 min. 6. For blocking, treat the cells with gelatin from 0.2% cold-water fish skin for 1 h. 7. Label the trafficking proteins (Rab5, Rab7, and LAMP1) on the cell surface with the corresponding antibodies overnight at 4  C. 8. Wash the cells three times with PBS (+). 9. Next, add 1 μL of the secondary antibody (Alexa Fluor 488-conjugated Goat anti-rabbit IgG secondary antibody) to each dish and gently shake for 1 h at RT. 10. Wash the cells three times with PBS (+). 11. Examine the cells under a confocal microscope. 12. Determine the degree of colocalization of ADRB2CIB and endosomes/lysosomes using the JACoP plug-in for ImageJ [19]. 3.6

Western Blotting

1. Stimulate the HEK293 cells expressing ADRB2CIB and ArrestinCRY with blue light at 3 mW/cm2 using a LED device at 37  C in a humidified incubator. 2. Harvest the cells using 200 μL sample buffer.

Optogenetic Regulation of Membrane Receptor Trafficking

21

3. To decrease the viscosity of the lysate, sonicate the lysate for 2 min at 4  C. 4. Next, heat the sample at 65  C for 10 min (see Note 8). 5. Load 10–25 μL of each sample into the wells of a 10% acrylamide gel (see Note 9). 6. Perform electrophoresis at 125 V (constant voltage). 7. Transfer the proteins to a nitrocellulose membrane. 8. To block nonspecific binding of antibodies, incubate the membrane with the blocking buffer for 1 h at 4  C. 9. Then, discard the old blocking buffer and replace it with blocking buffer containing the primary antibodies. 10. Gently shake the mixture for 1 h at 4  C. 11. After four washes with TBST at RT, shake the membrane for a further 4 min. 12. Add TBST containing 1% skim milk and 2 μL of ECL antirabbit antibody linked to HRP (dilution ratio, 1:5000). 13. Gently shake the mixture for 1 h at 4  C. 14. Wash four times with TBST at RT. 15. Detect the bands with an image analyzer. 3.7 Detection of Ubiquitinated ADRB2CIB by Immunoprecipitation

1. Stimulate the HEK293 cells expressing ADRB2CIB and ArrestinCRY with blue light at 3 mW/cm2 using a LED device at 37  C in a humidified incubator. 2. Harvest the cells using 200 μL lysis buffer on ice. 3. Sonicate the lysate for 2 min. 4. Add 2 μL of anti-V5 antibody and gently shake the mixture for 1 h at 4  C. 5. Add 50 μL protein G Sepharose suspension and shake for an additional hour. 6. Wash the formed precipitate three times with 1 mL lysis buffer. 7. Add 100 μL sample buffer and vortex the sample. 8. Move to Subheading 3.6, step 3.

4

Notes 1. Deviations in transfection efficiency cause large fluctuations in the data. Cell lines stably expressing ArrestinCRY and CIBNfused membrane receptors will improve reproducibility of the results. 2. The gene encoding ADRB2CIB was inserted between the HindIII and XhoI sites in pcDNA3.1/V5-His(B). SNAP-tag

22

Osamu Takenouchi et al.

contains a membrane-targeting signal sequence derived from the 5-HT3A receptor (amino acid sequence: MRLCIPQVL LALFLSMLTGPGEG ). The gene encoding ArrestinCRY was inserted between the BamHI and XbaI sites in pcDNA4/mycHis(B). 3. To uniformly seed the cells on dishes, carefully pipette the cell suspension up and down 5–10 times before seeding. 4. Transfection with lipofectamine may cause severe cell toxicity or detachment of the cells from the dish. Ensure that the DNA mixture is uniformly distributed throughout the dish. Additionally, the amounts of transfected plasmid DNA and lipofectamine should be optimized in case the cell death is significant. 5. Light in an experimental room does not affect the CRY function; however, the light in a clean bench should be switched off to minimize false-positive interactions (or the background drifts). 6. Green fluorescent labeling materials, such as GFP, should be avoided because CRY forms dimers with CIBN upon stimulation with excitation light for the green fluorescent molecule (CRY can also be activated by 514 nm lasers). 7. High-intensity LEDs and long irradiation times generate heat that may induce undesirable side effects during the experiments. To avoid these, the LED device should be detached from the samples (e.g., by irradiation from the ceiling of an incubator). 8. The heating temperature should be suppressed by 65  C. Excess heating leads to undesirable aggregation of the membrane receptors in the lysate. These aggregated receptors cannot be detected properly by western blotting. 9. The sample should be uniform and of low viscosity. References 1. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2:107–117 2. Hutagalung AH, Novick PJ (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91:119–149 3. Moore CAC, Milano SK, Benovic JL (2007) Regulation of receptor trafficking by GRKs and arrestins. Annu Rev Physiol 69:451–482 4. Lin FT, Daaka Y, Lefkowitz RJ (1999) β-Arrestins regulate mitogenic signaling and clathrin-mediated endocytosis of the insulinlike growth factor I receptor. J Biol Chem 273:31640–31643

5. Chen W, Kirkbride KC, How T et al (2003) β-Arrestin 2 mediates endocytosis of type III TGF-β receptor and downregulation of its signaling. Science 301:1394–1397 6. Zhang J, Barak LS, Anborgh PH et al (1999) Cellular trafficking of G protein-coupled receptor/β-arrestin endocytic complexes. J Biol Chem 274:10999–11006 7. Oakley RH, Laporte SA, Holt JA et al (1999) Association of β-arrestin with G proteincoupled receptors during clathrin-mediated endocytosis dictates the profile of receptor resensitization. J Biol Chem 274:32248–32257

Optogenetic Regulation of Membrane Receptor Trafficking 8. Fegan A, White B, Carlson JCT et al (2010) Chemically controlled protein assembly: techniques and applications. Chem Rev 110:3315–3336 9. Derose R, Miyamoto T, Inoue T (2013) Manipulating signaling at well: chemically inducible dimerization (CID) techniques resolve problems in cell biology. Pflugers Arch Eur J Physiol 465:409–417 10. Banaszynski LA, Liu CW, Wandless TJ (2005) Characterization of the FKBP-rapamycin-FRB ternary complex. J Am Chem Soc 127:4715–4721 11. Inoue T, Heo WD, Grimley JS et al (2005) An inducible translocation strategy to rapidly activate and inhibit small GTPase signaling pathways. Nat Methods 2:415–418 12. Terrillon S, Bouvier M (2004) Receptor activity-independent recruitment of ß-arrestin 2 reveals specific signalling modes. EMBO J 23:3950–3961 13. Lin YC, Nihongaki Y, Liu TY et al (2013) Rapidly reversible manipulation of molecular

23

activity with dual chemical dimerizers. Angew Chem Int Ed Engl 52:6450–6454 14. Tischer D, Weiner OD (2014) Illuminating cell signalling with optogenetic tools. Nat Rev Mol Cell Biol 15:551–558 15. Zhang K, Cui B (2015) Optogenetic control of intracellular signaling pathways. Trends Biotechnol 33:92–100 16. Kennedy MJ, Hughes RM, Peteya LA et al (2010) Rapid blue-light-mediated induction of protein interactions in living cells. Nat Methods 7:973–975 17. Nguyen MK, Kim CY, Kim JM et al (2016) Optogenetic oligomerization of Rab GTPases regulates intracellular membrane trafficking. Nat Chem Biol 12:431–436 18. Takenouchi O, Yoshimura H, Ozawa T (2018) Unique roles of β-arrestin in GPCR trafficking revealed by photoinducible dimerizers. Sci Rep 8:677 19. Bolte S, Cordelie`res FP (2006) A guided tour into subcellular colocalization analysis in light microscopy. J Microsc 224:213–232

Chapter 3 Simultaneous Detection of Four Cell Cycle Phases with Live Fluorescence Imaging Bryce T. Bajar and Michael Z. Lin Abstract Visualizing progression through the cell cycle provides valuable information for the study of development, tissue maintenance, and dysregulated growth in proliferative diseases, such as cancer. Developments in fluorescent biosensors have facilitated dynamic tracking of molecular processes, including the cell cycle. The genetically encoded set of fluorescent indicators, Fucci4, enables the visualization of transitions between each cell cycle phase. Here, we describe a method to track progression through each cell cycle phase using Fucci4 in live epifluorescence imaging. In principle, this approach can be adapted to in vitro time-lapse imaging of any four spectrally resolvable fluorescent indicators. Key words Fluorescence microscopy, Cell cycle, Genetically encoded fluorescent indicator, Live-cell imaging, Multichannel imaging

1

Introduction The cell cycle is central to development and tissue maintenance. By contrast, dysregulation of the cell cycle contributes to disease progression in dysplastic and neoplastic growth [1]. Each cell cycle phase is tightly regulated by proteins that mediate DNA damage checkpoints and ensure orderly transitions through each phase [2, 3]. Thus, the ability to track the cell cycle throughout its phase transitions would be useful in both physiological and pathological contexts. Genetically encoded fluorescent indicators have made possible the visualization of a variety of cellular processes, including the cell cycle. Notably, the fluorescent ubiquitination-based cell cycle indicator, Fucci, uses two fluorescent reporters to visualize the G1/S transition and the G2/M transition [4]. Both reporters that comprise Fucci rely on polyubiquitin-based degradation of a fluorescent protein to indicate changes in cell cycle phase. The G1/S transition is marked by the loss of a fluorescent protein tagged to the degron of Cdt, while the G2/M transition is marked by the loss of a

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

25

26

Bryce T. Bajar and Michael Z. Lin

fluorescent protein tagged to the degron of geminin. Thus, Fucci functions as an intensiometric reporter, where the intensity of fluorescence (FL) indicates the cell cycle phase rather than a change in the localization or aggregation of FL. Fucci reporters have been used to observe cell cycle dynamics in neural development, cell migration, stem cell differentiation, and cancer, among other contexts [4–7]. Methods to report cell cycle stage may be particularly useful in identifying therapeutic targets for cancer, as cell cycle proteins are commonly dysregulated in human cancers [8, 9]. Since the development of the original Fucci, a number of ubiquitination-based intensiometric cell cycle reporters have been introduced [10–14]. Here, we will focus on the use of Fucci4, which adds the following features to the original Fucci: first, an intensiometric reporter for the S/G2 transition is used based on the degron of stem-loop binding protein (SLBP); second, a reporter for the M-phase is used based on aggregation of histone H1.0; third, the fluorescent proteins fused to the Cdt and geminin degrons are altered to enable simultaneous visualization of all four reporters without spectral interference [11]. Fucci4 can be used to resolve all phases of the cell cycle with either time-lapse or snapshot imaging in both in vitro [11] and in vivo [15] contexts. Here, we describe a protocol to visualize cell cycle progression with Fucci4 using time-lapse epifluorescence imaging. First, we produce lentivirus and use lentiviral transduction to produce cell lines that express all four Fucci4 indicators. Next, we prepare cells for imaging in vitro. Finally, we perform time-lapse epifluorescence imaging to observe cell cycle progression in Fucci4-expressing cells. This protocol assumes basic familiarity with sterile tissue culture technique. Although this protocol is optimized for use with Fucci4 in a select number of adherent cell lines, it may be adapted for use in other multichannel time-lapse experiments.

2

Materials

2.1 Plasmids (See Fig. 1)

1. Indicators for detection of M/G1 transition and G1/S transition: pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt (30-120) (available on Addgene, #83841). 2. Indicators for detection of S/G2 transition and G2/M transition: pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1mMaroon1 (available on Addgene, #83842). 3. Third-generation lentivirus packaging system (available commercially, e.g., Addgene): (a) pCMV-VSV-G. (b) pRSV-REV. (c) pMDLg/pRRE.

Live Imaging of Four Cell Cycle Phases

27

pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1

CMV Promoter

mTurquoise2

SLBP(18-126)

IRES

Histone H1.0

mMaroon1

pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)

CMV Promoter

Clover

Geminin(1-110)

IRES

mKO2

hCdt(30-120)

Fig. 1 Fucci4 plasmid schematics. pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 is a plasmid ready for lentiviral packaging that contains two fluorescent reporters: mTurquoise2-SLBP(18-126) for the S/G2 transition and histone H1.0-mMaroon1 for the M-phase transition, under control of the CMV promoter and an internal ribosome entry site (IRES). pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) is a plasmid ready for lentiviral packaging that contains two additional reporters: Clover-Geminin(1-110) for the M/G1 transition and mKO2-Cdt(30-120) for the G1/S transition. Translational regulatory sequences are indicated in gray, fluorescent proteins are indicated in their respective emission color, linkers are indicated in black, and reporter regulatory fragments are indicated in white. Full plasmid sequences are available on Addgene

2.2 Imaging Equipment

1. Inverted epifluorescence microscope (e.g., Zeiss Axiovert 200M). (a) 20 air objective preferred for long-term imaging. (b) Filters: cyan, ex 440/10 nm (Chroma), em 472/30 (Semrock); green, ex 490/10 nm (Chroma), 525/30 nm (Semrock); orange, ex 545/10 (Omega), em 575/25 nm (Chroma); far-red, 610/10 nm (Omega), em 665/65 nm (Chroma) Note 1, Fig. 2a, b).

nm em nm ex (see

(c) Environmental chamber with temperature and CO2 control (e.g., ImageXpress IXMicro system (Axon Instruments)). (d) Charge-coupled device camera (e.g., Hamamatsu OrcaER). (e) Light source (e.g., Exfo metal-halide light source). (f) Microscopy software (e.g., MicroManager (Open Imaging) together with ImageJ). 2.3 Tissue Culture Reagents

1. Culture medium: (a) Dulbecco’s modified Eagle medium (DMEM) without phenol red. (b) 10% fetal bovine serum (FBS). (c) 1% penicillin/streptomycin. (d) 1% glutamine. 2. Live-cell imaging medium (see Note 2): (a) FluoroBrite DMEM (Life Technologies).

28

Bryce T. Bajar and Michael Z. Lin

Normalized ex.

A 1.0

FP excitation/emission spectrum filter transmission spectrum mTurquoise2 Clover mKO2 mMaroon1

0.5 0.0 350 400 450 500 550 600 650 700 Wavelength (nm) B

G

Y O R

Normalized em.

mTurquoise2 Clover mKO2 mMaroon1 1.0 0.5 0.0 400 450 500 550 600 650 700 750 Wavelength (nm)

mTurq2-

Clover-

mKO2-

Histone1-

SLBP

Geminin

hCdt

mMaroon1

far-red

orange

green

cyan

B

Fig. 2 Fluorophores and filters for four-color time-lapse imaging. (a) mTurquoise2, Clover, mKO2, and mMaroon1 can be imaged without bleed-through, using the appropriate excitation (above) and emission (below) filters. Excitation filters are: 440/10 nm for CFP, 490/10 nm for GFP, 545/10 nm for OFP, and 610/10 nm for far-RFP. Emission filters are: 472/30 nm for CFP, 525/30 nm for GFP, 575/25 nm for OFP, and 665/65 nm for far-RFP. The spectrum above the emission chart indicates definitions for blue (B), green (G), yellow (Y), orange (O), and red (R) in the CRC Handbook of Fundamental Spectroscopic Correlation Charts. (b) Mouse NIH3T3 cells expressing mTurquoise2-SLBP, Clover-Geminin(1-110), mKO2-Cdt(30-120), or H1.0mMaroon1 were each imaged in cyan, green, orange, and far-red channels. Images were acquired with exposure times of 100 ms for cyan, 50 ms for green, 25 ms for orange, and 200 ms for far-red, then scaled for display to the first 256 counts above background in each channel. Scale bar, 10 m. (Adapted from Bajar et al. [11] with permission from Springer Nature)

Live Imaging of Four Cell Cycle Phases

29

(b) 10% FBS. (c) 2.5% HEPES buffer. (d) 1% sodium pyruvate. 3. Opti-MEM Reduced-Serum Media (Life Technologies) or equivalent. 4. Tris-EDTA buffer. 5. CaCl2. 6. Trypsin-EDTA 0.25%. 7. Polybrene. 8. Hank’s balanced salt solution (HBSS). 9. HEK293T cells for lentivirus production. 10. Fibronectin. 11. Cell line of interest for lentiviral transduction and imaging. 2.4 Tissue Culture Equipment

1. Sterile laminar flow cabinet. 2. 12- and 6-well culture plates. 3. 15 cm culture plates. 4. 1.7 mL snap-cap microcentrifuge tubes. 5. Pasteur pipettes. 6. 0.45 μm filters with 2 mL disposable syringe. 7. 2 mL long-term storage cryogenic tubes. 8. Glass bottom 8-well chamber slides (e.g., Nunc Lab-Tek slides).

3

Methods

3.1 Lentiviral Packaging

The following steps should be performed in a sterile laminar flow cabinet (see Note 3): 1. Plate 1.2  107 HEK293T cells in 20 mL of culture medium on a 15 cm plate 24 h before transfection. On the day of transfection, HEK293T cells should be at ~70% confluency. In general, use two 15 cm plates per virus. Ensure that cells are well maintained and of low passage number. 2. Mix the following plasmids (prepared w/EndoFree Qiagen Kits) in a FACS tube. The plasmids should be in EndoFree TE at a concentration of 0.5 mg/mL (see Note 4). For third-generation lentiviral packaging system: 20 μg vector (i.e., either Fucci4 component). 10 μg pCMV-VSV-G. 10 μg pRSV-REV.

30

Bryce T. Bajar and Michael Z. Lin

10 μg pMDLg/pRRE. 3. Add 400 μL 1.25 M CaCl2 and 1.5 mL H2O and mix by tapping gently. 4. Add 2 mL of 2 HBSS dropwise to DNA mixture while bubbling with a Pasteur pipette. Incubate for 5 min. 5. Working one plate at a time, take a plate of 293T out of the incubator and add transfection mixture dropwise throughout the plate. Gently swirl plate from front to back and return plate to incubator. 6. After 3–8 h, remove media, wash gently with PBS (optional), and add 15 mL warm culture medium onto plate and place in incubator. 7. After 48 h of transfection, harvest viral supernatant. 8. Filter viral supernatant through a 0.45 μm filter with syringe attached. To increase viral yield, prime 0.45 μm filters by adding ~500 μL of culture medium through the filter prior to filtering viral supernatant. 9. Titer virus (see Note 5). 10. Aliquot or use virus. Virus should be aliquoted into cryogenic tubes, flash-frozen in liquid nitrogen and stored in a 80  C freezer. There should be no change in titer with freezingconcentrated virus. Minimize freeze-thaw cycles, as titer can be significantly reduced after refreezing. 3.2 Lentiviral Transduction

The following steps should be performed in a sterile laminar flow cabinet. Note: lentivirus is a biosafety level 2 agent. Use personal protective equipment and disposal procedures as per institutional biosafety requirements. 1. Plate cells of interest in 12-well plates and wait for ~50–60% confluency (see Note 6). 2. For each well, prepare a clean 1.7 mL tube with the following infection medium: (a) Equal titer of geminin-Cdt virus and SLBP-H1 virus. Use freshly made or freshly thawed lentivirus warmed to 37  C. (b) 8 μg/mL polybrene. (c) DMEM without serum added for a final volume of 500 μL. 3. Replace culture medium with infection medium. 4. Twenty four hours posttransduction, change media to normal culture medium.

Live Imaging of Four Cell Cycle Phases

31

5. Lentivirus requires at least 2 days for complete expression. Proceed to Subheading 3.3 > 2 days posttransduction. 3.3

Cell Seeding

The following steps should be performed in a sterile laminar flow cabinet: 1. If the cell of interest requires fibronectin coating of growth surface, add a minimal volume of fibronectin diluted to desired concentration (e.g., 5 μg/mL) in DMEM without serum, and allow to air dry by incubating at room temperature for 45 min (see Note 7). 2. Plate 10,000 cells/chamber of an 8-well chamber slide in culture medium. Add cells dropwise throughout the bottom surface of the chamber (see Note 8). 3. Once full volume has been added to each well, gently shake the slide sideways and back-and-forth. Do not rotate the slide in a circular motion, as this will concentrate the cells in the center of the slide. 4. Leave the slide in the laminar flow cabinet for 5–10 min at room temperature to allow the cells to settle, then move the slide into the incubator. 5. Incubate for 18 h at 37  C (see Note 9).

3.4

Imaging

1. Serum starve cells for 6 h to roughly synchronize division times by exchanging culture medium for DMEM without serum and incubating in 37  C incubator. 2. Turn on the microscope at least 1 h before imaging, and the environmental chamber at least 10 min before imaging. Turning on the microscope and environmental chamber prior to imaging minimizes z-drift from thermal expansion during long imaging sessions. 3. Initialize temperature controller and CO2 mixing system at least 10 min before imaging. Depending on the system used, this includes ensuring appropriate CO2 flow is achieved, and that the environment maintains humidity and stable temperature at 37  C. 4. After serum starvation is complete, remove DMEM, wash twice with HBSS, and fill wells to the top with live-cell imaging medium. The volume added in this step allows cells to be imaged for over 36 h without significant media evaporation. 5. Fasten the slide onto the microscope stage and place the environmental chamber cover over it (if applicable). Ensure that the room lights are off and will not be turned on during image acquisition. 6. Start microscopy software and set to 20 air objective.

32

Bryce T. Bajar and Michael Z. Lin

7. Image multiple positions within each well to increase the number of cells imaged. Use the bright-field channel to identify regions of interest. To identify cells with expression of both viruses, check for FL, using the orange and far-red channels, to avoid phototoxicity with blue-shifted excitation light. Choose positions with high levels of double-labeled cells and ~30% confluency (see Note 10). 8. Run a test to ensure that samples are in focus in each channel. Due to optical differences in each filter set, each channel may have a small z-offset that must be corrected during image acquisition. To identify this offset, take a z-stack of ~10 μm to find the offset between channels, and adjust for that z-offset for individual channels (e.g., for MicroManager, this is found under the Channels option of multi-D acquisition). 9. Enable acquisition for all four imaging channels and select appropriate exposure times for each channel. Maximize signalto-noise ratio while minimizing photobleaching, cytotoxicity, and signal saturation (see Note 11). 10. Begin image acquisition. Typically, we perform time-lapse capture for over 36 h. Monitor imaging session occasionally (see Note 12).

4

Notes 1. These recommended filters have been selected to provide no bleed-through between fluorophores (see Fig. 2a, b) [11]. 2. We strongly prefer a live-cell imaging solution based on FluoroBrite DMEM or an equivalent medium. Background FL in blue and green wavelengths primarily comes from serum; however, serum is required for cell viability and normal division rates. FluoroBrite DMEM allows for inclusion of 10% FBS, without introducing significant levels of blue-green background FL (see Fig. 3a, b). We compared viability of cells in our live-cell imaging solution versus a previously used imaging solution (DMEM without phenol red, 1% FBS, 2.5% HEPES, 1% NaPyr). In our live-cell imaging solution, >90% of HeLa cells are viable through 30 h of imaging, with all visualized cells dividing at least once; by contrast, in the alternate imaging solution, ~75% cells were viable through 30 h of imaging, and about half of visualized cells divided at least once.

Live Imaging of Four Cell Cycle Phases

A

33

alternate imaging medium live cell imaging medium

Green channel

0

B

Raw fluorescence counts

1500

Background fluorescence 1400 Raw Fluorescence Units

green 1200

orange

1000 800 600 400 200 0 100ms

300ms

500ms

Alternate Imaging Medium

100ms

300ms

500ms

Live Cell Imaging Medium

Fig. 3 Background fluorescence (FL) in live-cell imaging medium. (a) Nonbackground-subtracted FL micrographs of HeLa cells expressing Clover, imaged in live-cell imaging medium (right) or in an alternate imaging medium (left) composed of the following: DMEM without phenol red, 1% FBS, 2.5% HEPES buffer, and 1% sodium pyruvate. Green channel shown, captured with 100 ms exposure time using the following filters: ex: 490/10 nm, em: 525/30 nm. Each image displays raw FL between 0 and 1500 counts, resulting in saturation of green FL in some cells. In our experience, this alternate imaging medium offered the lowest background and highest rate of division, prior to the characterization of live-cell imaging medium. Scale bar, 20 m. (b) Raw FL counts of background FL in live-cell imaging medium compared to alternate imaging medium in green and orange channels assessed across exposure times using the following filters: green, ex: 490/10 nm, em: 525/30 nm; orange, ex: 545/10, em: 575/25 nm. Average values derived from three 20  20 pixel regions of interest selected in background areas of captured images. Error bars represent standard deviation

3. Plasmid purity is crucial to transfection. Plasmids should be prepared via midiprep or maxiprep using a high-quality DNA purification kit. 4. Lentivirus is a biosafety level 2 agent. Use personal protective equipment and disposal procedures as per institutional biosafety requirements.

34

Bryce T. Bajar and Michael Z. Lin

5. In practice, we do not commonly titer virus, since our protocol gives us fairly reproducible multiplicity of infection. Instead, for 12-well plates of 50–60% confluent cells, we prepare 500 μL of infection media containing 200 μL of each virus and 100 μL DMEM with 8 μg/mL polybrene. This gives us ~30–40% double-infected cells. If desired, stable cell selection can be performed to purify double-infected populations. 6. This protocol has been optimized for use with HeLa, HEK293, U2Os, and NIH3T3 adherent cell lines; growth and seeding conditions may differ for other cell types, and imaging has not been performed with suspension cell cultures. 7. In our experience, coating glass bottom plates with fibronectin had mixed results. HeLa cells displayed higher viability and normal division rates in the absence of fibronectin coating, while NIH3T3 cells displayed higher viability with coating. The requirement to coat glass bottom plates with fibronectin must be assessed on a cell-type-specific basis. 8. This density results in )” symbol at the beginning. 6. Merits of the synthesis of the whole cDNAs by order are as follows: (1) One may order codon-optimized cDNA constructs for the maximal expression efficiency according to the origin of the host cell lines. (2) It is easy to add some small organelle localization tags or epitopes to the constructs. (3) One may bypass the so-called label license of some gene sellers, which is designed to deprive the user rights more than their patent claims. 7. It is recommended to use a spectrophotometer that can simultaneously acquire all emitted photons (wavelengths) ranging from 391 to 789 nm to minimize the intensity loss by the BL decay. The integration time may be variable according to the BL intensities.

Artificial Luciferases for Cell Imaging

51

Acknowledgments This work was partly supported by JSPS KAKENHI Grants: Numbers 26288088, 15KK0029, 17H01215, 21H04948, and 24225001. References 1. Hastings JW (1996) Chemistries and colors of bioluminescent reactions: a review. Gene 173 (1 Spec No):5–11 2. Loening AM, Wu AM, Gambhir SS (2007) Red-shifted Renilla reniformis luciferase variants for imaging in living subjects. Nat Methods 4(8):641–643 3. Kim SB (2012) Labor-effective manipulation of marine and beetle luciferases for bioassays. Protein Eng Des Sel 25(6):261–269. https:// doi.org/10.1093/protein/gzs016 4. Kim SB, Torimura M, Tao H (2013) Creation of artificial luciferases for bioassays. Bioconjug Chem 24:2067–2075. https://doi.org/10. 1021/bc400411h 5. Lehmann M, Loch C, Middendorf A, Studer D, Lassen SF, Pasamontes L, van Loon APGM, Wyss M (2002) The consensus concept for thermostability engineering of proteins: further proof of concept. Protein Eng 15(5):403–411 6. Loening AM, Fenn TD, Wu AM, Gambhir SS (2006) Consensus guided mutagenesis of

Renilla luciferase yields enhanced stability and light output. Protein Eng Des Sel 19 (9):391–400. https://doi.org/10.1093/pro tein/gzl023 7. Takenaka Y, Noda-Ogura A, Imanishi T, Yamaguchi A, Gojobori T, Shigeri Y (2013) Computational analysis and functional expression of ancestral copepod luciferase. Gene 528 (2):201–205 8. Takenaka Y, Yamaguchi A, Tsuruoka N, Torimura M, Gojobori T, Shigeri Y (2012) Evolution of bioluminescence in marine planktonic copepods. Mol Biol Evol 29 (6):1669–1681. https://doi.org/10.1093/ molbev/mss009 9. Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: a sequence logo generator. Genome Res 14(6):1188–1190 10. Kim SB, Nishihara R, Citterio D, Suzuki K (2017) Fabrication of a new lineage of artificial luciferases from natural luciferase pools. ACS Comb Sci 19(9):594–599. https://doi.org/ 10.1021/acscombsci.7b00081

Chapter 6 Use of Bacterial Luciferase as a Reporter Gene in Eukaryotic Systems Jittima Phonbuppha, Ruchanok Tinikul, and Pimchai Chaiyen Abstract Reporter gene assays are powerful tools for monitoring dynamic molecular changes and for evaluating the responses that occur at the genetic elements within cells in response to exogenous molecules. In general, various protein systems can be used as reporter genes, including luciferases. Here, the present protocol introduces a unique reporter gene system for monitoring molecular events in cells using bacterial luciferase (lux), which can generate blue-green light suitable for gene reporter applications with the highest cost performance. The protocol also guides the assay conditions and necessary components for using of lux gene (lux) as a eukaryotic reporter system. The lux system can be applied to monitor variety of molecular events inside mammalian cellular systems. Key words Bacterial luciferase (lux), Bioluminescence, Reporter gene, Responsive element, Cell signaling pathways

1

Introduction Reporter gene assays are useful tools for monitoring dynamic changes within cells for analysis of cis-acting genetic elements, visualizing cellular phenomena associated with cellular signaling pathways, tracking gene therapy, and visualizing target gene expression, thus providing important information on normal cellular function and disease progression [1, 2]. Signals generated from gene reporters rely on two main functional elements. The first element is a promoter sequence, which regulates transcription of its associated gene. The second element is a reporter gene that translates cellular phenomena into a measurable signal [3]. In general, firefly luciferase (FLuc), Renilla luciferase (RLuc), Gaussia luciferase (GLuc), or green fluorescent protein (GFP) are commonly used as reporter proteins because they can detect changes within cells with high sensitivities, with detection limits down to atto units (10
18 U) [4]. However, several obstacles are generally found with reporter genes. In the case of fluorescent proteins, such

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

53

54

Jittima Phonbuppha et al.

as GFP, input of excitation light energy is required to generate fluorescence output signals, which can lead to high background signals, photobleaching, and phototoxicity, compromising the quality of the signal-to-background ratios and decreasing the sensitivity of the assay [4, 5]. The use of luciferases, which are enzymes catalyzing bioluminescent reactions, can overcome obstacles caused by fluorescent proteins. Nevertheless, the cost of the assays employing these luciferases are generally high due to their expensive substrates [6]. The poor cost performance limits the broad use of these systems among consumers in the industries. Alternatively, a gene encoding bacterial luciferase (lux) can be used as a reporter system, as it uses common laboratory reagents as the substrates. The cost of bacterial luciferase (lux) assays is thus much cheaper than those employing other luciferases. In this chapter, we introduce the protocols using the lux as a gene reporter in eukaryotic systems are described. Lux is an enzyme that catalyzes bioluminescence (BL) with maximum emission at 490 nm using long-chain aldehyde, reduced flavin, and molecular oxygen as substrates. Lux is a heterodimeric enzyme comprising of α and β subunits encoded by two separated luxA and luxB genes that generally are not suitable for mammalian expression [7]. To apply lux as a reporter gene in a mammalian cell, an engineered fusion lux was created by fusing the two nonidentical subunits with a peptide linker, allowing the enzyme to be overexpressed as a single fusion protein. However, several initial attempts to express the fusion lux gene in mammalian cellular systems did not show promising results due to problems with protein stability and protein folding [8, 9]. More recent improvement of the expression of the lux fusion protein could be achieved by using a thermostable lux with an appropriate linker and codon usage optimization [10– 12]. Here, we describe detailed laboratory protocols for the transfection process and assay recipes for using the engineered lux as a reporter protein to screen bioactive small molecules associated with cellular signaling pathways. The reporter gene assay based on the lux system is useful for monitoring molecular events with a wide dynamic range within the cells, demonstrating its potential applicability in eukaryotic systems. This system gives signals of detection comparable to other luciferase reporters with the strongest cost performance.

2

Materials

2.1 Cell Culture Medium

Compositions of cell culture medium used should fit well with each different cell line. Any types of cell line can be used throughout this protocol. Human embryonic kidney cells (HEK293T cells) are used throughout this chapter that is maintained with Dulbecco’s

Bacterial Luciferase Reporter Gene

55

modified Eagle medium (DMEM), supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution. The cell culture medium described here and throughout this chapter are based on guidelines recommended by suppliers, such as the American Type Culture Collection (ATCC). 2.2 Cell Plating Reagents

1. 0.05% (w/v) trypsin-EDTA solution (see Note 1).

2.3 Transfection Reagents

1. Opti-MEM reduced-serum medium (Fujifilm Wako Pure chemical).

2. 1 phosphate-buffered saline (PBS), pH 7.4 (see Note 2).

2. Lipofectamine®3000 transfection reagent (Life Technologies). 3. A recombinant pGL3 vector encoding the lux reporter gene expressed under the control of a promoter sequence linked to a responsive element referred to as the pGL3-response element (lux/promoter) (see Note 3). 4. pRL-TK vector encoding the RLuc gene expressed under a control by a constitutive TK promoter (see Note 4). 2.4 Reagents for Measuring Transfected Cells

1. 1 lux lysis buffer (see Note 5): 1% (w/v) CHAPS, 0.5% (w/v) EDTA, and 10% (v/v) glycerol in 50 mM sodium phosphate buffer pH 7.0. 2. Lux assay cocktails (see Note 6): 10 μM flavin mononucleotide (FMN), 20 μM decanal, 200 μM NADH, and 200 μM HPA in 50 mM sodium phosphate buffer pH 7.0. 3. C1 reductase (see Note 7): 50 mU of C1 reductase per assay reaction (see Note 8). 4. Renilla luciferase assay system, Promega Corporation (see Note 9).

2.5 Cell Culture Equipment

2.6

BL Equipment

1. Class II biological safety cabinet. 2. Incubator supplied with an appropriate concentration of carbon dioxide gas. Because lux catalyzes BL emission with a maximum wavelength around 490 nm, any equipment capable of detecting light is suitable for measuring the BL signals from the lux reaction, such as a spectrofluorometer or luminometer. For more accurate measurement, the equipment should be equipped with a dispenser for automatic injection and mixing of the lux reagent cocktails with cell lysate (see Note 10) so that light emitted at the beginning period can be captured by the machine. For high-throughput screening, a multiwell plate reader is suitable with dispenser for automatic injection and continuous reading.

56

3

Jittima Phonbuppha et al.

Methods

3.1 Seeding Cells for Transient Transfection

Cells must be maintained in an appropriate culture medium and seeded in any types of 96-well microplate, including black-frame, white-frame, or clear-frame microplates for 1 day prior to performing transfection. All steps should be performed in a class II biological safety cabinet to prevent contamination. 1. Completely remove and discard the growth medium from the culture vessel. 2. Gently add 2–10 mL of 1 PBS buffer to wash the cells (see Note 11). 3. Add 500–1000 μL of 0.05% trypsin-EDTA solution to detach the cells. 4. Gently swirl the trypsin-EDTA solution to thoroughly cover the cell layer. 5. Incubate the vessel at room temperature (RT) for 2–3 min (see Note 12). 6. Add 1–10 mL of appropriate medium (see Note 13). 7. Gently disperse the medium by pipetting it over the cell layer surface several times (see Note 14). 8. Measure the number of viable cells using a hemocytometer, coulter counter, or equivalent apparatus. 9. Resuspend the harvested cells in a 96-well microplate (see Note 15) in 200 μL of the appropriate medium to reach ~80% of confluency at time of transfection (see Note 16). 10. Incubate the cells at 37  C under 5% CO2 for 24 h.

3.2 Transient Transfection

This transient transfection protocol is compatible with a 96-well microplate (see Note 15). All steps should be performed in a class II biological safety cabinet to prevent contamination. 1. Pipette 0.15 μL lipofectamine®3000 and mix with 5 μL of prewarmed Opti-MEM medium in microcentrifuge tube Number 1 (see Note 17) and mix them well, the amount of which is a suitable dose for single-well transfection. 2. In microcentrifuge tube Number 2, prepare a solution consisting of 100 ng of pGL3-responsive element (lux/promoter), 10 ng of pRL-TK vector (see Note 18), and 0.2 μL of P3000® reagent in 5 μL of prewarmed Opti-MEM (see Note 19). Mix the solution well, the amount of which is a dose for single-well transfection. 3. Add 5 μL of the diluted DNA (prepared in step 2) into 5 μL of diluted lipofectamine®3000 (prepared in step 1). Mix the solution gently.

Bacterial Luciferase Reporter Gene

57

4. Incubate the mixed solution from step 3 for 5 min at RT to allow complete formation of DNA-lipid complex. 5. Add 10 μL of the DNA-lipid complex to the seeded cells on each well (Subheading 3.1) that are maintained in a fresh culture medium without any antibiotic (see Note 20). 6. Incubate the transfected cells at 37  C and 5% CO2 for 24 h to allow complete delivery of DNA into the cells. 3.3 Activator Screening

All steps should be performed in a class II biological safety cabinet to prevent contamination. 1. Completely remove the growth medium (Subheading 3.2). 2. Gently add 100–200 μL of fresh medium dissolving a test compound (analyte) (see Note 21) to the transfected cells. 3. For the control reaction, add the equivalent volume of fresh medium dissolving vehicle such as DMSO (see Note 22). 4. Incubate the cells at 37  C and 5% CO2 for 5 h to allow stimulation of the cell signaling pathway by the test compounds (see Note 23). 5. Completely remove all the medium from the treated cells. 6. Gently add 100–500 μL of 1 PBS buffer (rinsing solution) to wash the cells (see Note 11). 7. Briefly swirl the culture plate to remove any detached cells and residual growth medium. 8. Completely remove the rinsing solution from step 6. 9. Add 10–100 μL of lux lysis buffer to lyse the treated cells (see Note 24). 10. Rock the culture plate at RT for 15 min (see Note 25). 11. Transfer the lysate from step 9 to a fresh tube or plate for further handling and storage (see Note 26).

3.4 Inhibitor Screening

All steps should be performed in a class II biological safety cabinet to prevent contamination. 1. Completely remove the growth medium from the culture plate (Subheading 3.2). 2. Gently add 100–200 μL of a fresh medium containing a test compound (see Note 21) to the cells. 3. For the control reaction, add an equal volume of fresh medium, dissolving the vehicle, such as DMSO (see Note 22). 4. Incubate the treated cells at 37  C and 5% CO2 for 30 min to allow the test compounds to inhibit the cell signaling pathway. 5. Add an appropriate concentration of agonists to the treated cells to stimulate the cell signaling pathway (see Note 27).

58

Jittima Phonbuppha et al.

6. Further incubate the treated cells at 37  C and 5% CO2 for 5 h to allow complete stimulation of the cell signaling pathways to take place (see Note 23). 7. Completely remove the treatment medium. 8. Gently add 100–500 μL of 1 PBS buffer to wash the cells (see Note 11). 9. Briefly swirl the culture plate to remove dead cells and residual growth medium. 10. Completely remove the rinsing solution from step 8. 11. Add 10–100 μL of lux lysis buffer to lyse the treated cells (see Note 24). 12. Rock the culture plate at RT for 15 min (see Note 25). 13. Transfer the lysate to a fresh tube or plate for further handling and storage (see Note 26). 3.5 Lux Assay Activity

1. Add 5 μL of lysate solution (see Note 28) and 50 mU of C1 reductase into the 96-well black-frame microplate (see Note 29). 2. Measure BL intensities by autonomous injection of 100 μL of a lux assay cocktail into the cell lysate and C1 solution in a 96-well black-frame microplate (prepared in step 1) using a luminometer or equivalent instrument. 3. Monitor emitted BL signals for 10 s with a 2 s delay time. 4. Integrate the emission signals beneath the peak area with a window X-axis of 10 s (see Note 30) and report as a value of relative light units (RLUs).

3.6 RLuc Assay Activity

1. Add 5 μL of cell lysate (see Note 28) into a 96-well black-frame microplate (see Note 29). 2. Measure the BL intensities of the reaction resulting from autonomous injection of 100 μL of the Renilla luciferase assay system (see Note 22) into the cell lysate solution in a 96-well black-frame microplate using a luminometer or related instrument. 3. Monitor BL signals for 10 s with a 2 s delay. 4. Integrate the BL signals beneath the peak area with a window X-axis of 10 s (see Note 30) and report the values as RLUs.

3.7

Data Analysis

1. Normalize the lux activity measured under each condition with their internal control activity and referred to as normalized lux activity (see Note 31). Normalized Lux activity ¼

RLU of Lux RLU of their internal control ðRlucÞ

Bacterial Luciferase Reporter Gene

4

59

Notes 1. The trypsin concentration may be variable according to the types of animal cells. This should be done according to the manufacturer’s instruction. 2. The PBS buffer is isotonic and nontoxic to animal cell culture. It is generally used to wash off the residual serum in the animal cell culture before the trypsinization process. 3. The lux reporter gene encodes the lux enzyme from Vibrio campbelli (Vc) that was genetically engineered to be a single fusion enzyme containing α and β subunits. The α and β subunits were fused with a decapeptide linker, allowing monocistronic expression of a single peptide in mammalian cells [10]. Codon usage of the fusion lux gene was also optimized to improve the translation efficiency for expression in human cells [13]. The engineered lux reporter gene showed high expression efficiency in animal cells with adequate and reliable detection signals. Under the control of a responsive element, such as the NF-κB signaling pathway, the response signal of the lux activity relies directly on the strength of NF-κB activator and inhibitor [13]. 4. The RLuc gene is used as an internal control vector for normalizing nonspecific factors, such as variation of cell plating and transfection efficiency, pipetting inconsistencies, and toxicity that may affect lux expression. The normalized data allow results to be compared with greater confidence. It is also possible to use other reporter genes, such as β-galactosidase as an internal control, ensuring that they do not interfere with the lux activities. 5. The lux lysis buffer can be prepared as a 5 concentrate and stored at
20  C. The 1 working solution can be prepared by adding one volume of 5 lux lysis buffer to four volumes of distilled water and thoroughly mixed. The diluted lux lysis buffer (1) may be stored at 4  C for up to 1 month. 6. The C1 reductase generates FMNH
in situ. As FMNH
is used as a substrate in the lux reaction, light is then generated, which can be measured by a luminometer (see Fig. 1). An assay cocktail should be freshly prepared to avoid instability of compounds, such as aldehyde and FMNH
. The aldehyde solution stock can be prepared by dissolving aldehyde in methanol. Keep in mind that a final concentration of methanol in the cocktail assay solution should be kept at less than 1% (v/v) to minimize the effects of methanol on enzyme reactions. In all cases, the preincubation of lux enzyme and aldehyde should be avoided because aldehyde binding to lux can form a dead-end binary complex of lux and aldehyde. It should also be noted

60

Jittima Phonbuppha et al.

Fig. 1 Bacterial luciferase reaction and FMNH
supplying system by C1 reductase

that aldehyde concentrations should be optimized first before conducting a large number of tests in order to maximize signals gained. 7. The C1 reductase catalyzes FMN reduction using NADH as an electron donor to yield reduced FMN (FMNH
), a substrate for the lux reaction. Direct addition of FMNH- to the system is impossible because the compound is unstable under aerobic conditions. The C1 reductase was expressed and purified according to previous reports and recently was engineered to be more thermotolerant [14, 15]. The amount of C1 reductase used in the lux assay reaction should be optimized to be appropriate for supplying FMNH
so that the assay can be used to measure a wide range of lux concentrations expressed in mammalian cells. Over supplying FMNH
in the system may result in low-light yield because surplus FMNH
in the system can react with oxygen to generate H2O2 from the reaction of FMNH
and oxygen [16]. Alternatively, our recent work has shown that chemical reduction of FMN by 1-benzyl-1,4-dihydronicotinamide (BNAH) can also be used for assaying lux gene expression in eukaryotic cell lysate (see Fig. 2). This minimized chemoenzymatic cascade can also serve as a more simplified FMNH
providing system instead of the enzymatic reaction of C1 reductase [17]. BNAH (CAS RN: 952-92-1) can be purchased from Tokyo Chemical Industry (TCI). 8. The enzyme unit (U) refers to the amount of enzyme that catalyzes conversion of 1 μmole of substrate per minute under specified conditions of an assay method. The lux assay reaction requires 50 mU of C1 reductase, that is, the amount of C1 reductase that can catalyze oxidation of 50  10
3 μmole of NADH per minute. For example, if a concentration of C1 reductase is 10 mU/μL, 5 μL of C1 reductase should be added into the reaction mixture to supply FMNH
to the lux reaction. Please note that a specific activity of C1 reductase (U/mg of enzyme) may be varied in each batch of preparation.

Bacterial Luciferase Reporter Gene

61

Fig. 2 The minimized chemoenzymatic cascades of bacterial luciferase and their BNAH-supplying system

Therefore, C1 activity assay should be done for each enzyme batch. 9. The RLuc catalyzes oxidative decarboxylation of coelenterazine in the presence of O2 to yield oxyluciferin and CO2 with the concomitant emission of blue light around 480 nm. The Renilla luciferase assay system is a proprietary technology from Promega Cooperation, which has been optimized to reduce the effects of coelenterazine autoluminescence. Selfprepared assay reagents can also be done in house, but the formulation should be fine-tuned for each laboratory. 10. Lux catalyzes the oxidation of long-chain aldehyde using FMNH
and molecular oxygen as substrates to yield bluegreen light at 490 nm. The in vitro assay reaction generally proceeds in a single turnover manner. Thus, the luminescence of lux is characterized as flash BL, in which light is rapidly generated and gradually decays within 2 min. Using a dispenser to add the lux reagent cocktail allows automatic detection of BL light and reduces bias during the measurement. 11. The serum in the cell culture medium contains proteases, which may inhibit the activity of trypsin during the trypsinization process. Washing the cells with 1 PBS is a crucial step to get rid of residual serum in order to facilitate the full catalytic activities of trypsin. 12. Observation of the cells under a microscope is necessary to ensure that >95% of the cells are detached. The detached cells should appear rounded and floating. Longer incubation periods (10 min) should be avoided, as it is harmful to the cells. However, incubation of adherent cells with trypsin at 37  C can promote cell detachment.

62

Jittima Phonbuppha et al.

13. The cell culture medium consisting of FBS should be added into the vessel. The natural protease in FBS blocks the trypsin activity. 14. Most of the cells should be dispersed as single cells. 15. The bottom area of the multiwell plate is variable. The amounts of both vectors and lipofectamine®3000 reagent should be adjusted according to the bottom area of the multiwell plate per the manufacturer’s instructions at the time of purchase. 16. For a 96-well microplate, seeding cells between 0.5  104 and 2  104 cells per well will provide optimal confluence for transfection at 24 h postseeding. However, different cell types and sources may give different doubling times, which should be investigated before setting up screening experiments. 17. Dilution of lipofectamine®3000 in Opti-MEM medium beforehand may be convenient as a master-mix solution for multiple transfection reactions. 18. Low to medium RLuc activity is enough for normalizing the nonspecific factors that may occur during the transfection. The amount of the internal control vector used is recommended to be at least tenfold lower than the lux vector so that it does not interfere with the lux activity. However, the amount of the internal control vector may be variable according to the cell types, and the optimization is generally required beforehand. Other types of reporter genes, such as a β-galactosidase, can be used as an internal control vector. They should be optimized for an appropriate transfection ratio. 19. It is convenient to prepare a master-mix solution of pGL3response element (lux/promoter) vector, pRL-TK vector, and P3000® reagent in prewarmed Opti-MEM for multiple transfection reactions. 20. The presence of antibiotic during transfection may have adverse effects on transfection efficiency and the overall cell death of the transfected cells. 21. The test compounds should be diluted in an appropriate volume of the cell culture medium that is enough to avoid interference from the solvents of the stock solutions. Various concentrations of the test compounds are useful to determine the half maximal effective concentration (EC50)/half maximal inhibitory concentration (IC50) if needed. 22. A control study is needed to investigate the basal reporter gene activity by adding only appropriate cell culture medium without any test compounds into transfected cells. The basal reporter gene activity is used to compare the increase of reporter gene activity upon investigation of the activities of the test compounds.

Bacterial Luciferase Reporter Gene

63

Table 1 Recommended volumes of 13 lux lysis buffer for different types of multiwell plates Multiwell plate size

1 lux lysis buffer per well

24-Well plate

100

48-Well plate

65

96-Well plate

20

23. Stimulation of a cell signaling pathway by test compounds within 5 h time periods is sufficient to differentiate between basal and induced activities. However, the reaction can be stimulated over a longer period of time in order to allow higher or lower expression of the reporter gene that shows similar results with 5 h incubation. 24. A minimum volume of 1 lux lysis buffer is defined as the buffer volume, which can completely cover the cell surface, and it does not result in significant dilution of soluble proteins. The recommended volume of lux lysis buffer to be added per well is shown in Table 1. 25. Treatment of the cultured cells with lux lysis buffer results in completely disruption of the cell membranes within 15 min. However, some different types of cells may exhibit greater resistance to lux lysis buffer. Optimization of the treatment conditions may be useful. Some lysis buffers, such as those containing triton X-100, can inhibit lux activity. 26. The lysate solution can be stored at
80  C without any loss of lux activity after the thawing process. The lux lysis buffer recommended for use here can also protect lux activity during the freeze-thaw process for up to three cycles without significant activity loss. 27. Stimulation of the cell signaling pathways by their agonists is necessary to investigate the efficiency of each inhibitor. The concentration of the agonists used should be optimized, and at least 80% of the agonist concentration required to fully activate the signal pathway should be supplied to the cells during the inhibitor screening experiments. 28. Expression levels of lux protein can be various, according to the animal cell types. The volume of lysate solution can be optimized to gain the maximum BL signals and must be compatible with the instrumentations. The volume of the lysate solution should be constant throughout all the experiments. 29. Measurement of the reporter gene activity can be performed in a 96-well black-frame microplate or single tube assay systems. Similar volumes of lux assay cocktails are used in both assay

64

Jittima Phonbuppha et al.

Fig. 3 Kinetics of lux activity. The reagents used in the lux reaction consists of 10 M FMN, 20 M decanal, 200 M NADH, and 200 M HPA. The reaction can be started by mixing this solution with 5 L of cell lysate and 50 mU of C1 reductase. The luminescence signals can be monitored for 30 s with 2 s delay using a luminometer, such as an AB-2350 microplate luminometer Octa (ATTO Corporation, Japan)

platforms. For 96-well microplate assays, both white-frame and black-frame microplates can be used for measuring the reporter gene activities. A 96-well black assay plate provides better prevention of possible light interference generated from either nonspecific light sources or BL from adjacent reaction wells, which may occur under the conditions which generate strong BL light. 30. The luminescence of lux is characterized as flash BL, in which light is rapidly generated and gradually decays (see Fig. 3). The BL signals beneath the peak area can be integrated for comparing lux activities under each test conditions. In general, the highest peak of BL intensity lasts for about 2 s. Therefore, a typical integration time of 10 s (see Fig. 3, yellow area) is generally good for obtaining lux BL signals. This integration time may be shorter or longer than 10 s, but the same value should be kept throughout experiments. 31. The normalized lux activity allows data comparisons with greater confidence than those without normalization.

Acknowledgments This work was supported by grants from Vidyasirimedhi Institute of Science and technology (VISTEC) to P.C. and J.P, Center of Excellence on Medical Biotechnology (CEMB), S&T Postgraduate Education and Research Development Office (PERDO), Office of Higher Education Commission (OHEC) Thailand to P.C. and R. T., and Mahidol University to R.T.

Bacterial Luciferase Reporter Gene

65

References 1. Kang JH, Chung J-K (2008) Moleculargenetic imaging based on reporter gene expression. J Nucl Med 49:164S 2. Allard ST, Kopish K (2008) Luciferase reporter assays: powerful, adaptable tools for cell biology research. Cell Notes 21:23–26 3. Naylor LH (1999) Reporter gene technology: the future looks bright. Biochem Pharmacol 58 (5):749–757 4. Roda A, Pasini P, Mirasoli M, Michelini E, Guardigli M (2004) Biotechnological applications of bioluminescence and chemiluminescence. Trends Biotechnol 22(6):295–303 5. Thorne N, Inglese J, Auld DS (2010) Illuminating insights into firefly luciferase and other bioluminescent reporters used in chemical biology. Chem Biol 17(6):646–657 6. Kim JE, Kalimuthu S, Ahn B-C (2015) In vivo cell tracking with bioluminescence imaging. Nucl Med Mol Imaging 49(1):3–10 7. Suadee C, Nijvipakul S, Svasti J, Entsch B, Ballou DP, Chaiyen P (2007) Luciferase from Vibrio campbellii is more thermostable and binds reduced FMN better than its homologues. J Biochem 142(4):539–552 8. Olsson O, Escher A, Sandberg G, Schell J, Koncz C, Szalay AA (1989) Engineering of monomeric bacterial luciferases by fusion of luxA and luxB genes in Vibrio harveyi. Gene 81(2):335–347 9. Boylan M, Pelletier J, Meighen E (1989) Fused bacterial luciferase subunits catalyze light emission in eukaryotes and prokaryotes. J Biol Chem 264(4):1915–1918 10. Tinikul R, Thotsaporn K, Thaveekarn W, Jitrapakdee S, Chaiyen P (2012) The fusion Vibrio campbellii luciferase as a eukaryotic gene reporter. J Biotechnol 162 (2–3):346–353

11. Patterson SS, Dionisi HM, Gupta RK, Sayler GS (2005) Codon optimization of bacterial luciferase (lux) for expression in mammalian cells. J Ind Microbiol Biotechnol 32 (3):115–123 12. Westerlund-Karlsson A, Saviranta P, Karp M (2002) Generation of thermostable monomeric luciferases from Photorhabdus luminescens. Biochem Biophys Res Commun 296 (5):1072–1076 13. Phonbuppha J, Tinikul R, Ohmiya Y, Chaiyen P (2021) FLUX Flavin luciferase as a reporter genee for mammalian cells with high sensitivity and affordable cost. Manuscript in preparation 14. Chaiyen P, Suadee C, Wilairat P (2001) A novel two-protein component flavoprotein hydroxylase: p-Hydroxyphenylacetate hydroxylase from Acinetobacter baumannii. Eur J Biochem 268(21):5550–5561 15. Maenpuen S, Pongsupasa V, Pensook W, Anuwan P, Kraivisitkul N, Pinthong C, Phonbuppha J, Luanloet T, Wijma HJ, Fraaije MW (2019) Creating flavin reductase variants with thermostable and solvent-tolerant properties by rational-design engineering. Chembiochem 21(10):1481–1491 16. Tinikul R, Pitsawong W, Sucharitakul J, Nijvipakul S, Ballou DP, Chaiyen P (2013) The transfer of reduced flavin mononucleotide from LuxG oxidoreductase to luciferase occurs via free diffusion. Biochemistry 52 (39):6834–6843 17. Phonbuppha J, Tinikul R, Wongnate T, Intasian P, Paul C, Chaiyen P (2020) A minimized chemoenzymatic cascade for bacterial luciferase in bioreporter applications. Chembiochem 21(14):2073-2079

Part II Imaging with Activatable Bioluminescent Probes

Chapter 7 Quantitative Determination and Imaging of Gαq Signaling in Live Cells via Split-Luciferase Complementation Timo Littmann, Takeaki Ozawa, and Gu¨nther Bernhardt Abstract G Protein-coupled receptors (GPCRs) transduce signals elicited by bioactive chemical agents (ligands), such as hormones, neurotransmitters, or cytokines, across the cellular membrane. Upon ligand binding, the receptor undergoes structural rearrangements, which cause the activation of G proteins. This triggers the activation of signaling cascades involving amplification, which takes place after every stage of the cascade. Consequently, signals from early stages can be masked when the activation of the signaling cascade is probed remote (distal) from the receptor. This led to the development of several techniques, which probe the activation of such signaling cascades as proximal to the receptor as possible. However, these methods often require specialized equipment or are limited in throughput. By applying split-luciferase complementation to the interaction between the Gαq protein and its effector the phospholipase C-β3 (PLC-β3), we introduce a protocol with a conventional plate reader at high throughput. The method is applicable to live cells and additionally allows imaging of the probe by bioluminescence microscopy. Key words GPCR , Gαq mediated signaling, Split-luciferase complementation, Bioluminescence, Ligand characterization, Live-cell imaging

1

Introduction Common procedures to determine the activation of a G proteincoupled receptor (GPCR) involve the quantification of second messengers, such as cyclic adenosine monophosphate (cAMP) [1, 2] or inositol phosphates [3, 4]. A commonly employed alternative is to perform reporter gene assays [5]. However, distal readouts, for example, the enzymatic activity of a conveniently measurable gene product, such as β-galactosidase or luciferase, can be affected by signal amplification, potentially masking the true efficacy of analyzed agonists [5]. For a more proximal determination of GPCR activation, radiometric assays, such as the [35S] GTPγS assay [6] or FRET/BRET-based assays [7, 8], can be used. However, these techniques are compromised by major

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

69

70

Timo Littmann et al.

disadvantages, including the availability of specialized reagents or materials and/or a low sample throughput. To bridge this gap, we adopted split-luciferase complementation to the interaction of the Gαq protein with its effector, the phospholipase C-β3 (PLC-β3). Several times split-luciferase assays proved useful to probe the activation of GPCR-signaling pathways with medium-to-high throughput [2, 4, 9]. A modified red (λmax ¼ 613 nm) light-emitting click beetle luciferase (CBR) from Pyrophorus plagiophthalamus Germar, 1841 was split into two fragments, from which one was subsequently fused to the N-terminus of the PLC-β3, and the other one was integrated into a flexible loop region of Gαq (see Fig. 1). The resulting sensor, consisting of both fusion proteins, was stably expressed in HEK293T cells. The present protocol guides how to quantify the activation of several Gαq-coupling receptors (e.g., histamine H1 receptor, neurotensin NTS1 receptor) in live cells, either using a plate reader or using a microscope equipped with an appropriate camera (e.g., EMCCD).

2

Materials 1. pCBR-control vector (Promega, Japan). 2. pcDNA4 vector (Thermo Scientific, Germany). 3. pIRESpuro3 vector (Clontech, France). 4. pcDNA3.1 plasmid encoding Gαq (Missouri cDNA resource center, MO, USA). 5. Restriction endonucleases (New England Biolabs, Germany). 6. NEBuilder kit for Gibson assemblies (New England Biolabs, Germany). 7. TOP10 E. coli strain (Thermo Scientific, Germany). 8. X-tremeGENE HP (Roche, Germany). 9. HEK293T cells. 10. Dulbecco’s modified Eagle’s medium (DMEM) (SigmaAldrich, Germany). 11. Leibovitz’s L-15 medium (L-15) (Gibco, Germany). 12. Fetal calf serum (FCS) (Merck Biochrom, Germany). 13. Trypsin and geneticin (G418) (Merck Biochrom, Germany). 14. Puromycin (Invivogen, France). 15. Hanks’ balanced salt solution (HBSS) (Gibco, Germany). 16. Substrate solution: D-luciferin potassium salt (Wako, Japan or Pierce, Germany), which is dissolved in HBSS (final concentration: 400 mM). 17. 6-Well plates, 75 and 175 cm2 flasks (Sarstedt, Germany). 18. 35 mm2 glass bottom dishes (Iwaki, Japan).

Quantifying Gαq Activation in Live Cells via Split-uciferase. . .

71

Fig. 1 Schematic illustration of the assay principle. Gαq and the PLC-β3 are tagged using two enzymatically inactive luciferase fragments. Upon activation of a GPCR by an agonistic ligand, a GDP/GTP exchange occurs within the Gαq subunit, leading to its dissociation from the receptor. Thereupon, it interacts with the effector protein PLC-β3, leading to the reconstitution of the enzymatically active luciferase. When a substrate is provided, light emission directly proportional to the degree of interaction of the two proteins is observed. (Reproduced with modification from Littmann et al. [12] with permission from Springer Nature)

3

Methods

3.1 Generation of the pIRESpuro3 1. Remove the SacI sites of the pcDNA3.1 Gαq plasmid by sitedirected

CBRN-PLC-β3-2A-Gαq(123) Vector

mutagenesis PCR. 2. Linearize the plasmid between the codons for amino acid 123 and 124 of Gαq by PCR using primers 1 and 2 (see Table 1), which introduce a BamHI and a SacI site to the termini of the linearized construct. 3. In another PCR, add these restriction sites to the C-terminal part (CBRC, corresponding to amino acids 394–542) of CBR using the pCBR-control plasmid (see Note 1) and primers 3 and 4. 4. Ligate and amplify both fragments in E. coli TOP10. 5. Subclone the construct into the pIRESpuro3 vector using primers 5 and 6 as well as NheI and NotI, which yields the pIRESpuro3 Gαq(A123) vector (see Note 2). 6. To construct the second part of the probe, add the restriction sites HindIII and BamHI to the N-terminal part of CBR (CBRN, corresponding to amino acids 1–416) through a PCR using primers 7 and 8. 7. Subclone the resulting construct into the pcDNA4 (V5-His) FLucN-FKBP vector described by Hida et al. [10] by replacing the FLucN with CBRN. 8. Digest the resulting vector using the restriction enzymes BamHI and SacII.

Sequence (50 –30 ) gaggatccTTTGAGAATCCATATGTAGATGC ggagctccctccaccgccactAGCAGACACCTTCTCCAC gggagctcCAAGGGTTATGTCAATAACG gcggatcctccaccgccactACCGCCGGCCTTCAC gatcgctagcCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATG ACTCTGGAGTCCATCATG actgagcggccgcTTAGACCAGATTGTACTCCTTCAG cttaagcttccaccATGGTAAAGCGTGAGAAAAATGTC ctggatccgccgcctccactacctccaccgccactgcccccaccaccATGCAACCAGCCGTCGTC ggcggtggaggtagtggaggcggcggatccagtggcATGGCGGGCGCCCAGC TTAGGGATAGGCTTACCTTCGAACCcGAGCTGCGTGTTCTCCTCC ACCCAAGCTTGGTACCGAGCTCGGATCGATccaccATGGTAAAGCGTGAGAAAAATGTC TCCTCCACGTCTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTC CCGTAGAATCGAGACCGAGG

Primer

1

2

3

4

5

6

7

8

9

10

11

12

Table 1 Primers used for cloning

Quantifying Gαq Activation in Live Cells via Split-uciferase. . .

73

9. Amplify the cDNA encoding PLC-β3 through a PCR using primers 9 and 10 (see Note 3). 10. Perform a Gibson assembly using the NEBuilder kit with the digested vector and the PCR product to obtain the pcDNA4 CBRN-PLC-β3 vector. 11. Linearize the pIRESpuro3 Gαq(A123) with NheI. 12. Use the pcDNA4 CBRN-PLC-β3 vector as a template in a PCR using primers 11 and 12, affording CBRN-PLC-β3 (see Note 4). 13. Combine both fragments in another Gibson assembly using the NEBuilder kit to yield the final pIRESpuro3 CBRN-PLC-β 3-2A-Gαq(A123) vector (see Notes 5 and 6).

3.2 Generation of Stably Transfected Cells

1. Initiate transfection of the HEK293T cells with the plasmid encoding the probe by seeding 2 mL of a cell suspension at a density of 3  105 cells/mL into one well of a 6-well plate. 2. Incubate the cells at 37  C (in a humidified atmosphere containing 5% CO2) overnight. 3. On the next day, mix 2 μg of plasmid DNA with 200 μL of DMEM, before adding 6 μL of X-tremeGENE HP. 4. Incubate this solution at RT for 15 min and add it dropwise to the cells. 5. After gentle shaking, place the plate into the CO2 incubator again and incubate the cells at 37  C for another 48 h. 6. Detach the cells using trypsin/EDTA, centrifuge (700  g, 5 min), and resuspend the pellet in 30 mL of DMEM, supplemented with 10% FCS and 0.75 μg/mL puromycin. 7. Seed the cells into a 175 cm2 flask and monitor growth for 2 weeks by replacing the culture medium every 3 days (see Note 7). 8. Detach the cells and transfer them into routine culture for maintenance (see Note 8). 9. Carry out the transfection with the cDNA encoding the receptors similarly. However, use G418 as a selection antibiotic at a final concentration of 600 μg/mL instead of puromycin.

3.3 Using the Gαq Probe for Ligand Characterization

1. Cultivate the cells expressing the probe and a receptor of interest in DMEM with 10% FCS and the abovementioned antibiotics (5% CO2, saturated water atmosphere) (see Note 9). 2. On the day before performing an assay, detach the cells from the flask by trypsinization and centrifuge them (700  g, 5 min).

74

Timo Littmann et al.

Fig. 2 Example of the data analysis workflow demonstrated at the hH1R. The raw data are initially corrected for interwell variability by dividing each data point by the one recorded immediately before ligand addition (time point 0). Afterwards, a correction is performed by dividing all curves by the one obtained for the solvent control. This step corrects for small drifts in the assay. Finally, values corresponding to the plateau of each curve are plotted against the ligand concentration, which elicited the corresponding effect and a concentration response curve is constructed. (Reproduced with modification from Littmann et al. [12] with permission from Springer Nature)

3. Resuspend the pellet in Leibovitz’s L-15 (see Note 10), supplemented with 10% FCS, and adjust the density of the suspension to 1.25  106 cells/mL. 4. Seed 80 μL of this suspension into each well of a microtiter plate. 5. Incubate the plate at 37  C in a regular atmosphere (without additional CO2) overnight. 6. On the following day, add 10 μL of a D-luciferin (see Notes 11 and 12) solution (10 mM, dissolved in HBSS) to the cells, and place the plate in a (prewarmed) microplate reader, thermostated at 37  C (see Note 13). 7. After an equilibration period of 10 min, record the basal luminescence (baseline) of the cells by continuously measuring the entire plate with an integration time of 1 s per well for ten cycles (see Note 14). 8. Add 10 μL of the compounds under investigation to each well. Measure the luminescence intensity for another 30 cycles (50 min).

Quantifying Gαq Activation in Live Cells via Split-uciferase. . .

75

9. Before analysis, reduce the data in two steps (see Fig. 2): Firstly, to reduce interwell variability (see Note 15), for each well, divide all recorded data points by the last data point of the baseline. Secondly, divide the baseline-corrected curves by a curve from a solvent control to compensate solvent effects. 10. Construct concentration-response curves by plotting the corrected intensities reached after stimulation (values corresponding to the plateau) against each respective concentration of the employed ligand (agonist). 11. (Optional) For improved comparability between assays, include a positive control (see Note 16), such as the endogenous agonist of the receptor under investigation, alongside the solvent control. 3.4 Employing the Gαq Probe in Bioluminescence Imaging

1. Seed cells in 3 mL of DMEM (10% FCS) at a density of 106 cells per 35 mm cell culture dish. 2. Incubate at 37  C (5% CO2) overnight. 3. Add 30 μL of a 1 M HEPES solution (see Note 10) and 7.5 μL of a 400 mM D-luciferin solution. 4. Transfer the cells to a microscope, equipped with a heatable stage set to 37  C (see Note 13) and a super-cooled EMCCD camera. 5. The integration time of the individual images is determined by the light sensitivity of the employed camera (see Note 17). 6. Before adding an agonist (see Note 18), which activates the probe, record one frame of the background luminescence.

4

Notes 1. An advantage of choosing a red light-emitting luciferase (localized on one end of the visible light spectrum) is that it allows for a convenient prospective implementation of the resulting technique in a multiparametric readout, involving, for example, another luciferase emitting-blue light. 2. The overhang of primer 5 adds a part of a P2A autoproteolysis [11] site to the construct, which is responsible for the autodissection of the two parts of the probe, when expressed. 3. These primers add 20 bp to both ends of the construct overlapping with the digested CBRN-containing vector, which are exploited in the subsequent Gibson assembly. 4. On both ends of this construct, 30 bp overlap with the linearized pIRESpuro3 Gαq(A123). Primer 12 also includes the second half of the P2A site.

76

Timo Littmann et al.

5. You may confirm the autocleavage of the resulting protein using immunoblotting [12]. 6. An advantage of the probe is that a receptor under investigation does not need to be tagged or genetically modified. 7. If no distinct colonial growth is observed after 2 weeks, the concentration of the respective selection antibiotic can be increased to intensify selection pressure. We successfully raised the concentrations up to 1 μg/mL (puromycin) and up to 1 mg/mL (G418) in the case of HEK293T cells, without a noticeable retardation of cell growth. 8. In our hands, a heterogeneous cell population, obtained after the transfection procedure, already showed robust S/B values and performed well in combination with a broad variety of receptors. Therefore, a laborious single-clone selection is unnecessary. 9. Keep a stock culture under antibiotic selection pressure in a 75 cm2 flask. From this stock, 175 cm2 flask cultures can be prepared without antibiotics (optional), which can then be used for assays. 10. A stringent maintenance of the physiological pH is crucial for assay performance. Therefore, either add HEPES to the DMEM, if CO2 gassing is not feasible, or use Leibovitz’s L-15 as assay medium. Leibovitz’s L-15 medium provides sufficient buffer capacity in a regular atmosphere without external gassing (on the contrary, additional CO2 is detrimental). If necessary, HEPES can be added to L-15 as well (check osmolarity). 11. We recommend performing the assay using live cells with an assay medium supplemented with D-luciferin. Although splitluciferase assays, based on firefly-type luciferases, are frequently lysis-based (endpoint detection), we experienced a considerably increased S/B ratio when performing live cell measurements. 12. The quality of the D-luciferin potassium salt is crucial for assay performance. Material from Wako or Pierce showed the best results in our hands. 13. Assay performance is negatively influenced when the temperature is lower than 37  C. 14. When antagonistic activities should be determined, we recommend adding solutions of serially diluted antagonists prior to determining the baseline. 15. Interwell variability can have a variety of different reasons: (a) Subtle differences, for example, in cell density or D-luciferin amount in each well.

Quantifying Gαq Activation in Live Cells via Split-uciferase. . .

77

(b) A nonuniform evaporation of medium (edge effect). (c) Pipetting errors (electronic multichannel dispensers help keeping this low). 16. The positive control should be employed at a concentration, at which maximal activation of the receptor of interest is expected. 17. We experienced that integration times can vary between a few seconds and a few minutes, strongly depending on the quality of the camera. 18. Caution: Do neither move the cell culture dish nor disturb the cell layer at its bottom when adding the agonist with a pipette.

Acknowledgments A PhD position awarded to T.L. from the International Doctoral Program “Receptor Dynamics” Elite Network of Bavaria is gratefully acknowledged. This study was supported by the Graduate Training Program GRK 1910 (“Medicinal Chemistry of Selective GPCR Ligands”) of the Deutsche Forschungsgemeinschaft (T.L., G.B.). References 1. Gabriel D, Vernier M, Pfeifer MJ, Dasen B, Tenaillon L, Bouhelal R (2003) High throughput screening technologies for direct cyclic AMP measurement. Assay Drug Dev Technol 1(2):291–303. https://doi.org/10.1089/ 15406580360545107 2. Takeuchi M, Nagaoka Y, Yamada T, Takakura H, Ozawa T (2010) Ratiometric bioluminescence indicators for monitoring cyclic adenosine 30 ,50 -monophosphate in live cells based on luciferase-fragment complementation. Anal Chem 82(22):9306–9313. https:// doi.org/10.1021/ac102692u 3. Trinquet E, Fink M, Bazin H, Grillet F, Maurin F, Bourrier E, Ansanay H, Leroy C, Michaud A, Durroux T, Maurel D, Malhaire F, Goudet C, Pin JP, Naval M, Hernout O, Chre´tien F, Chapleur Y, Mathis G (2006) D-myo-inositol 1-phosphate as a surrogate of D-myo-inositol 1,4,5-tris phosphate to monitor G protein-coupled receptor activation. Anal Biochem 358(1):126–135. https:// doi.org/10.1016/j.ab.2006.08.002 4. Ataei F, Torkzadeh-Mahani M, Hosseinkhani S (2013) A novel luminescent biosensor for rapid monitoring of IP3 by split-luciferase complementary assay. Biosens Bioelectron

41:642–648. https://doi.org/10.1016/j. bios.2012.09.037 5. Nordemann U, Wifling D, Schnell D, Bernhardt G, Stark H, Seifert R, Buschauer A (2013) Luciferase reporter gene assay on human, murine, and rat histamine H4 receptor orthologs: correlations and discrepancies between distal and proximal readouts. PLoS One 8(9):e73961. https://doi.org/10.1371/ journal.pone.0073961 6. Wifling D, Lo¨ffel K, Nordemann U, Strasser A, Bernhardt G, Dove S, Seifert R, Buschauer A (2015) Molecular determinants for the high constitutive activity of the human histamine H4 receptor: functional studies on orthologues and mutants. Br J Pharmacol 172(3):785–798. https://doi.org/10.1111/bph.12801 7. Bu¨nemann M, Frank M, Lohse MJ (2003) G-protein activation in intact cells involves subunit rearrangement rather than dissociation. Proc Natl Acad Sci U S A 100 (26):16077–16082. https://doi.org/10. 1073/pnas.2536719100 8. Gale´s C, Rebois RV, Hogue M, Trieu P, Breit A, He´bert TE, Bouvier M (2005) Realtime monitoring of receptor and G-protein interactions in living cells. Nat Methods 2

78

Timo Littmann et al.

(3):177–184. https://doi.org/10.1038/ nmeth743 9. Misawa N, Kafi AK, Hattori M, Miura K, Masuda K, Ozawa T (2010) Rapid and highsensitivity cell-based assays of protein-protein interactions using split click beetle luciferase complementation: an approach to the study of G protein-coupled receptors. Anal Chem 82 (6):2552–2560. https://doi.org/10.1021/ ac100104q 10. Hida N, Awais M, Takeuchi M, Ueno N, Tashiro M, Takagi C, Singh T, Hayashi M, Ohmiya Y, Ozawa T (2009) High-sensitivity real-time imaging of dual protein-protein interactions in living subjects using multicolor

luciferases. PLoS One 4(6):e5868. https:// doi.org/10.1371/journal.pone.0005868 11. Kim JH, Lee SR, Li LH, Park HJ, Park JH, Lee KY, Kim MK, Shin BA, Choi SY (2011) High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One 6(4):e18556. https://doi.org/10.1371/journal.pone. 0018556 12. Littmann T, Ozawa T, Hoffmann C, Buschauer A, Bernhardt G (2018) A split luciferase-based probe for quantitative proximal determination of Gαq signaling in live cells. Sci Rep 8(1). https://doi.org/10.1038/ s41598-018-35615-w

Chapter 8 A Split-Luciferase-Based Cell Fusion Assay for Evaluating the Myogenesis-Promoting Effects of Bioactive Molecules Qiaojing Li, Hideaki Yoshimura, and Takeaki Ozawa Abstract A split-luciferase-based cell fusion assay enables high-throughput screening of myogenesis-promoting chemicals in chemical libraries. The assay consists of two C2C12 myoblast-derived cell lines (N- and C-cells), each of which stably expresses either an N- or C-terminal split-firefly luciferase (FLuc) fragment fused to a naturally split DnaE intein (N- and C-probes, respectively). The fusion of N- and C-cells during myogenesis induces bioluminescence (BL) in the cytosol due to a stable reconstitution of the split-FLuc. Thus, the myogenesis-promoting effects of a chemical compound can be determined through the enhanced BL intensity. Here, we describe the preparation of N- and C-cells and determination of the myogenesispromoting effects of imatinib using a 96-well microplate-based assay. Key words 96-Well microplate-based assay, Split luciferase reconstitution, Firefly luciferase, Protein splicing, DnaE intein, Myogenesis, Cell fusion, C2C12 myoblast, Imatinib

1

Introduction In the split-luciferase-based cell fusion assay, two genetically encoded probes based on protein trans-splicing and split-luciferase reconstitution techniques [1, 2] were designed. The pair of probe proteins consists of split-firefly luciferase (FLuc) fragments and a naturally split DnaE intein from the cyanobacterium Synechocystis sp. PCC 6803 [3]. FLuc was split at the position between 415 and 416 amino acids, producing amino- and carboxyl-terminal fragments: FLucN and FLucC, respectively. The split DnaE inteins comprise 123 amino acids in the N-terminal fragment (DnaEn) and 36 amino acids in the C-terminal fragment (DnaEc). Some of their fusion protein complexes possess the ability to spontaneously ligate the N- and C-exteins [4]. FLucN was fused to the N-terminus of DnaEn (abbreviated to N-probe), whereas FLucC was fused to the C-terminus of DnaEc (abbreviated to C-probe) (see Fig. 1a).

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

79

80

Qiaojing Li et al.

Fig. 1 Schematic diagram of the split-luciferase-based cell fusion assay. (a) The cDNA constructs of the Nand C-probes. (b) The working mechanism of N- and C-probes to reconstitute the split-FLuc in the process of myogenesis. (Reprinted from Li et al. [5] with permission from the Royal Society of Chemistry)

To evaluate the myogenesis-promoting effects of chemical compounds, two stable cell lines expressing either N- or C-probes were established based on the C2C12 myoblast cell line [6] (named N- and C-cells, respectively). When myogenesis occurs in a mixture of N- and C-cells, the fusion of N- and C-cells during myogenesis allows the N-probes to encounter the C-probes in the cytoplasm. Then, a protein trans-splicing reaction occurs between the adjacent DnaEn and DnaEc, resulting in the reconstitution of FLucN and FLucC via a peptide bond-splicing between the serine (S) and cysteine (C) [7] (see Fig. 1b). The bioluminescence (BL) intensity generated by the reconstituted FLuc quantitatively represents the progress in cell fusion and, therefore, indicates the extent of myogenesis. Thus, cell fusion assay based on the C2C12-derived N- and C-cells can be used to determine the myogenesis-promoting effects of chemical compounds. Here, we describe the unique protocols on a 96-well microplate-based cell fusion assay that determines the myogenesispromoting effects of a series of concentrations (1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 μmol/L) of imatinib. We exemplify myogenesis with insulin-like growth factor 1 (IGF-1) and tumor necrosis factor alpha (TNFα) that have been used as the myogenesis-promotion and -negative controls, respectively (see Fig. 2a). We also show that 6.0 μmol/L imatinib possesses the highest myogenesis-promoting effect (see Fig. 2b).

A Split-Luciferase-Based Cell Fusion Assay System

81

Fig. 2 The 96-well microplate assay for determining the myogenesis-promoting effects of imatinib. (a) The microplate layout matrix for the assay. (b) Characterization of the BL intensities with varying concentrations of imatinib. The BL intensities are shown as the relative values to that of the myogenesis control (
SD, n ¼ 5). (Reprinted from Li et al. [5] with permission from the Royal Society of Chemistry)

2

Materials

2.1 Preparation of Retroviruses

1. pMXs-IRES-Puro retroviral expression vector. 2. The N-probe (pFLucN-DnaEn-V5) and C-probe (pDnaEcFLucC-Myc) plasmids, where the cDNA constructs for the probes were inserted between the BamHI and EcoRI restriction sites on the pMXs-IRES-Puro retroviral expression vector (see Fig. 1a). 3. TansIT-LT1 transfection reagent (Mirus Bio; WI, USA). 4. Platinum-A retroviral packing (Plat-A) cells.

82

Qiaojing Li et al.

5. Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 4.5 g/L glucose, L-glutamine, and 4-(2-hydroxyethyl)-1piperazineethanesulfonic acid (HEPES) without sodium pyruvate (Nacalai Tesque Inc.; Kyoto, Japan). 6. Plat-A culture medium: DMEM supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich Corp.; MO, USA), 100 U/mL penicillin-100 μg/mL streptomycin (Gibco BRL; MD, USA), 1 μg/mL puromycin (Invitrogen Corp.; CA, USA), and 10 μg/mL blasticidin (Invitrogen Corp.). 7. Transfection/infection medium: DMEM supplemented with 10% FBS. 8. Phosphate-buffered saline (PBS). 9. Cell stripping reagent: 0.5 g/L trypsin/0.53 mmol/L Ethylenediaminetetraacetic acid (EDTA) solution (Nacalai Tesque Inc.). 2.2 Preparation of N-Cell and C-Cell

1. C2C12 cells (ATCC; VA, USA). 2. C2C12 culture medium: DMEM (4.5 g/L glucose) supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. 3. Proliferation medium (for N- and C-cells): DMEM supplemented with 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, and 2.5 μg/mL puromycin (see Note 1). 4. Transfection/infection medium, PBS, and cell-stripping reagent used are the same as described in Subheading 2.1.

2.3 96-Well MicroplateBased Assay 2.3.1 Day 0: Proliferation 2.3.2 Days 2 and 4: Differentiation and Compound Addition

1. A white opaque 96-well microplate (see Note 2). 2. The same proliferation medium, transfection/infection medium, PBS, and cell-stripping reagents as described in Subheading 2.1. 1. Differentiation medium (Myogenesis control, see Note 3): DMEM supplemented with 1% horse serum (Gibco BRL), 100 U/mL penicillin, 100 μg/mL streptomycin, and 2.5 μg/ mL puromycin. 2. TNFα-containing medium (20 ng/mL, myogenesis-negative control, see Note 4): TNFα dissolved in the differentiation medium to a concentration of 20 ng/mL. The volume needed for one well is 200 μL. Here, for five repeats, prepare 1100 μL solution fresh before use (see Note 5). 3. IGF-1-containing medium (10 ng/mL, myogenesispromotion control, see Note 6): IGF-1 dissolved in the differentiation medium to a concentration of 10 ng/mL. The

A Split-Luciferase-Based Cell Fusion Assay System

83

volume needed for one well is 200 μL. Here, for five repeats, prepare 1100 μL solution fresh before use. 4. Imatinib-containing media (1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 μmol/L): imatinib dissolved in the differentiation medium to prepare a series of concentrations. The volume needed for one well is 200 μL. Here, for five repeats, prepare 1100 μL solution fresh before use (see Note 7). 2.3.3 Day 6: BL Measurement

1. Phenol red-free DMEM (Gibco BRL). Store at 4  C (see Note 8). 2. Substrate solution: D-luciferin dissolved in phenol red-free DMEM to a concentration of 1.0 mmol/L (see Note 9). Wrap the tube with aluminum foil to keep the solution in the dark. The volume needed for one well is 100 μL. Here, for 60 wells, prepare 6.5 mL solution fresh before use.

3

Methods

3.1 Preparation of Retroviruses Harboring the N- or C-Probe RNAs

Culture the cells at 37  C and 5% CO2 atmosphere. 1. Resuscitate and culture Plat-A cells in Plat-A culture medium for more than three passages and less than ten passages (see Note 10). 2. Culture 3  106 Plat-A cells in a 60 mm culture dish in the transfection/infection medium for 18–24 h. 3. Transfect the retroviral expression vector (pFLucN-DnaEn-V5 or pDnaEc-FLucC-Myc) into the Plat-A cells using the TransIT-LT1 transfection reagent according to the manufacturer’s protocol. The transfection solution consists of 11.25 μL TransIT-LT1 reagent, 3.5 μg plasmid in 400 mL Opti-MEM, and the incubation time is 30 min. 4. Culture the cells for 48 h. 5. Collect the medium containing the retroviruses by micropipette. Use it fresh or make aliquots and store at 30  C (see Note 11).

3.2 Preparation of Nand C-Cells

1. Resuscitate and culture C2C12 cells in C2C12 culture medium for three passages (see Note 12). 2. Culture 1.5  105 C2C12 cells in a 100 mm culture dish with the transfection/infection medium for 18–24 h. 3. Infect the C2C12 cells with N- or C-probe retroviruses by adding 0.5 mL retrovirus-containing medium to the culture dish and incubate for 48 h. 4. Select the C2C12 cells harboring the N- or C-probes (N- or C-cells) as follows: seed 1.5  105 infected cells in a fresh

84

Qiaojing Li et al.

100 mm culture dish with the proliferation medium for 72 h; repeat the subculture for three passages, harvest, and store the surviving cells in liquid nitrogen (see Note 13). 3.3 The 96-Well Microplate Assay

Proliferation of the Cell (Day 0) 1. Resuscitate and culture the N- and C-cells in the proliferation medium for three passages, and prepare the third-passage Nand C-cells in a 100 mm culture dish at about 70% confluence (see Note 14).

2. Remove the medium and add 2 mL PBS to wash the cells. Repeat the wash once (see Note 15). 3. Strip the cells from the dish by adding 1 mL trypsin/ 0.53 mmol/L EDTA solution, and incubate the dish at 37  C and 5% CO2 atmosphere for 1 min (see Note 16). 4. Add 1 mL proliferation medium to the dish to stop stripping. 5. Collect the stripped cells in a 15 mL centrifuge tube and centrifuge at 200  g for 2 min (room temperature: 25  C). 6. Remove the supernatant from the centrifuge tube, followed by addition of 1 mL of the proliferation medium to the tube and resuspension of the cells (see Note 17). 7. Count the numbers of N- and C-cells. 8. Prepare a 1:1 (n/n) mixture of N- and C-cells in the proliferation medium to a final concentration of 1.4  105 cells/mL (0.7  105 cells/mL for each cell type). Adjust the volume depending on the assay scale. Hence, prepare 7 mL cell suspension in a 15 mL centrifuge tube for a 96-well microplate assay, of which 60 wells are to be used (see Fig. 2a). 9. Invert the tube to mix the cells thoroughly and seed 1.4  104 mixed cells per well into a 96-well microplate by adding 100 μL cell mixture to each well (see Note 18). 10. Culture the cells for 48 h (till the cells reach confluency). Start Cell Differentiation and Compound Addition (Day 2) 11. Prepare the compound-containing media.

12. Remove the proliferation medium and add 100 μL PBS to each well to wash the cells. Remove the PBS finally (see Note 19). 13. Initiate cell differentiation by adding 200 μL TNFα, IGF-1-, or imatinib-containing medium to the corresponding wells (see Fig. 2a). 14. Incubate the cells at 37  C and 5% CO2 atmosphere for 48 h. Change Media (Day 4) 15. Prepare the compound-containing media.

A Split-Luciferase-Based Cell Fusion Assay System

85

16. Remove the old medium from each well and add 200 μL fresh corresponding medium to each well without washing. 17. Incubate the cells at 37  C and 5% CO2 atmosphere for 48 h. Measurement of BL Intensity (Day 6) 18. Prepare the substrate solution.

19. After removing the medium, wash the wells with 200 μL PBS twice (see Note 20). 20. Add 100 μL substrate solution to every test well and measure the BL intensities using a microplate reader immediately. The settings are as follows: measure the BL signal well by well; the measurement time is 1 s per well; after all the signal from all test wells are measured, repeat the measurement from the beginning four more times; the total measuring time for a 96-well microplate is set as 10 min (see Note 21). Evaluate the BL intensities of each well by averaging the five measurements.

4

Notes 1. This is the C2C12 culture medium supplemented with 2.5 μg/ mL puromycin, which is used for selecting and maintaining the N- and C-cells. We named this “proliferation medium” to distinguish it from the differentiation medium used in the assay. 2. Use an opaque microplate for measuring BL intensities. To decrease the absorption of the BL signal, a white microplate is more suitable than a black one. 3. Culture the cells without myogenesis inhibition or promotion reagents for use as the myogenesis control. 4. Treat the cells with 20 ng/mL TNFα-containing medium for use as the myogenesis-negative control. The cells remain alive in the medium, but myogenesis is almost inhibited. Estimate cell fusion without inhibition or promotion by comparing the BL signal intensities between the myogenesis-positive and -negative controls. 5. Theoretically, the net consumption volume is 1000 μL for five repeat measurements; however, we recommend preparing a slightly excess amount of the solution, considering the potential loss in the process of the experiment. 6. The differentiation medium supplemented with 10 ng/mL IGF-1 (IGF-1-containing medium) significantly promotes cell fusion in the myogenesis-promotion controls. The Z0 -factor of the 96-well microplate assay has been determined to be >0.4

86

Qiaojing Li et al.

(0.44
0.05, mean
SD) when 10 ng/mL IGF-1 and 0.1% dimethyl sulfoxide (DMSO) were used as the positive and negative controls, indicating that the 96-well microplate assay has sufficient robustness to identify chemical compounds that promote myogenesis with the same efficacy as that of IGF-1 [5, 8]. 7. Imatinib is soluble in DMSO at 25 mg/mL with slight warming, but very poorly soluble in water (20 μmol/L). Therefore, prepare the imatinib stock solution in DMSO. After dilution, the DMSO concentration in the medium should be 0.1% (v/v), which has been proven to have no effect on the myogenesis of N- and C-cells. Treat samples with other compounds such that the DMSO concentration is always 0.1% (v/v). 8. Use phenol red-free DMEM in the substrate solution for BL measurement to prevent the absorption of BL signal by phenol red. 9. 1.0 mmol/L D-luciferin is excessive for BL determination. When conducting a large-scale screening, you may reduce Dluciferin concentration to 0.2 mmol/L to save the test cost. 10. The passage number affects the characteristics of the cell line over time [9–14]. To minimize passage-dependent effects, we recommend using less than ten passage cells. 11. The infection efficiency of retroviruses decreases after storage, even at 30  C. Therefore, we recommend using fresh retroviruses for infection as possible. 12. Passage-dependent effects lead to variation in the proliferation rates and differentiation ability of C2C12 cells. In order to retain the differentiation ability of the derived N- and C-cell lines, use early passage C2C12 cells as possible. 13. In order to use the C2C12-derived N- and C-cells within ten passages (counted from the beginning of the C2C12 cell line), it is recommended to start the 96-well microplate assay with the early stage cultures from the N- and C-cell stocks. Therefore, make sufficient cell stocks beforehand for your study. 14. The appropriate culture dish size should be chosen depending on the required number of cells in the assay. A 100 mm culture dish culturing N- or C-cells at about 70% confluence contains approximately the same as the amount for seeding into two whole 96-well microplates. 15. Add PBS gently against the wall of the dish to avoid cell detachment from the dish. 16. The C2C12 cells attach to the dish strongly, and tapping the dish mildly helps to detach most of the cells from the dish.

A Split-Luciferase-Based Cell Fusion Assay System

87

17. Pipetting ten times with a 1 mL micropipette is sufficient to prepare the suspension. Take care not to generate too many bubbles while pipetting. 18. Use a multichannel pipette to quickly seed the cells and to avoid cell sedimentation, as it may result in inconsistent cell numbers in the wells. 19. To prevent the cell detachment, remove the PBS gently using a pipette. Avoid sucking up using aspirators. 20. After washing, no phenol red should remain in the wells. 21. The BL signal reaches a plateau within 10 min. References 1. Ozawa T, Kaihara A, Sato M, Tachihara K, Umezawa Y (2001) Split luciferase as an optical probe for detecting protein-protein interactions in mammalian cells based on protein splicing. Anal Chem 73:2516–2521 2. Yoshimura H, Ozawa T (2014) Methods of split reporter reconstitution for the analysis of biomolecules. Chem Rec 14:492–501 3. Kanno A, Yamanaka Y, Hirano H, Umezawa Y, Ozawa T (2007) Cyclic luciferase for real-time sensing of caspase-3 activities in living mammals. Angew Chem Int Ed Engl 46:7595–7599 4. Wu H, Hu Z, Liu XQ (1998) Protein transsplicing by a split intein encoded in a split DnaE gene of Synechocystis sp. PCC 6803. Biochemistry 95:9226–9231 5. Li Q, Yoshimura H, Komiya M, Tajiri K, Uesugi M, Hata Y, Ozawa T (2018) A robust split-luciferase-based cell fusion screening for discovering myogenesis-promoting molecules. Analyst 143:3472–3480 6. Burattini S, Ferri P, Battistelli M, Curci R, Luchetti F, Falcieri E (2004) C2C12 murine myoblasts as a model of skeletal muscle development: morpho-functional characterization. Eur J Histochem 48:223–233 7. Volkmann G, Iwaı¨ H (2010) Protein transsplicing and its use in structural biology: opportunities and limitations. Mol Biosyst 6:2110–2121 8. Miles RR, Perry W, Haas JV, Mosior MK, Cho MN, Wang JWJ, Yu P, Calley J, Yue Y, Carter Q, Han B, Foxworthy P, Kowala MC, Ryan TP,

Solenberg PJ, Michael LF (2013) Genomewide screen for modulation of hepatic apolipoprotein A-I (ApoA-I) secretion. J Biol Chem 288:6386–6396 9. Esquenet M, Swinnen JV, Heyns W, Verhoeven G (1997) LNCaP prostatic adenocarcinoma cells derived from high and low passage numbers display divergent responses not only to androgens, but also to retinoids. J Steroid Biochem Mol Biol 62:391–399 10. Briske-Anderson MJ, Finley JW, Newman SM (1997) Influence of culture time and passage number on morphological and physiological development of Caco-2 cells. Proc Soc Exp Biol Med 214:248–257 11. Chang-Liu CM, Woloschak GE (1997) Effect of passage number on cellular response to DNA-damaging agents: cell survival and gene expression. Cancer Lett 113:77–86 12. Yu H, Cook TJ, Sinko PJ (1997) Evidence for diminished functional expression of intestinal transporters in Caco-2 cell monolayers at high passages. Pharm Res 14:757–762 13. Wenger SL, Senft JR, Sargent LM, Bamezai R, Bairwa N, Grant SG (2004) Comparison of established cell lines at different passages by karyotype and comparative genomic hybridization. Biosci Rep 24:631–639 14. Sambuy Y, De Angelis I, Ranaldi G, Scarino ML, Stammati A, Zucco F (2005) The Caco2 cell line as a model of the intestinal barrier; influence of cell and culture-related factors on Caco-2 cell functional characteristics. Cell Biol Toxicol 21:1–26

Chapter 9 Development of a Single Fluorescent Protein-Based Green Glucose Indicator by Semirational Molecular Design and Molecular Evolution Marie Mita, Devina Wongso, Hiroshi Ueda, Takashi Tsuboi, and Tetsuya Kitaguchi Abstract Advances in live-cell imaging have been accelerated by the development of various fluorescent indicators. However, indicators that are suitable for multicolor imaging remain a challenge to develop. Herein, we have developed a single fluorescent protein (FP)-based indicator using a semirational molecular design and a molecular evolution approach. We first inserted a ligand-binding domain into the vicinity of an FP chromophore to convert the conformational change induced by ligand binding into a change in fluorescence intensity. We then optimized the linker regions between the FP and the ligand-binding domain to greatly expand the dynamic range (F/F0) of the indicator. Our design and optimization methods are highly versatile and can be used to develop any single FP-based indicators, which will further advance the utility of live-cell imaging. Key words Single FP-based indicator, Fluorescent protein, Chromophore, Molecular evolution, Overlap PCR, Glucose

1

Introduction Numerous indicators based on fluorescent proteins (FPs) are available to visualize the spatiotemporal dynamics of intracellular molecules in living cells. These indicators can be divided into two major categories: Fo¨rster resonance energy transfer (FRET)-based indicators and single FP-based indicators. FRET-based indicators need two emissions to be measured in order to quantify intracellular molecules. Conversely, single FP-based indicators only require one emission to visualize the dynamics. This feature renders single FP-based indicators suitable for multicolor imaging to understand hierarchical and mutual relationships between intracellular molecules at a high spatiotemporal resolution.

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2374, https://doi.org/10.1007/978-1-0716-1258-3_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

89

90

Marie Mita et al.

Single FP-based indicators usually have a structure, in which two domains (a ligand-binding domain (LBD) and a LBD (with ligand)-binding domain) are fused at both ends of a circularly permuted GFP (cpGFP), as represented by GCaMP [1]. The necessity for this structure to possess two domains has made it difficult to develop a new single-FP indicator because not many interacting domains that respond to ligand binding have been found. As such, we aimed to establish a development technology for single FP-based indicators based on inserting one LBD in the vicinity of the FP chromophore, as implemented in the design of Ca2+ indicator Camgaroo [2] (see Fig. 1). Through our various trials, we found that the dynamic range (F/F0) of insertion-type single FP-based indicators can be significantly increased by optimizing the length and amino acid sequence of the linkers between the FP and the LBD. Based on these findings, the present chapter provides a stepby-step guide for developing a single FP-based glucose indicator (named as Green Glifon) as an example by site-directed random mutagenesis using overlap PCR [3].

2

Materials

2.1 Linker Length Optimization

1. FLIPglu-170nDelta13 in pRSET-B vector [4] (Addgene, Watertown, MA, USA; #13562). 2. APP-Citrine in pRSET-A vector (see Fig. 2, pRSET-A: Thermo Fisher Scientific, Waltham, MA, USA, mouse amyloid-β precursor protein (APP): NM_001198823.1, amino acids 190–286, Citrine: [2]). 3. Forward and reverse primers (see Fig. 3). 4. EcoRI and SacII restriction enzymes. 5. Escherichia coli Mach-1 strain (Thermo Fisher Scientific). 6. PrimeSTAR HS DNA polymerase, 5
PrimeSTAR buffer, dNTP mixture (Takara Bio Inc., Shiga, Japan). 7. DNA clean-up system. 8. Agarose powder. 9. TBE buffer: 0.445 M Tris, 0.445 M borate, 0.01 M EDTA. 10. Ligation high Ver.2 (Toyobo Co., Ltd, Osaka, Japan). 11. Luria-Bertani (LB) medium and agar. 12. Ampicillin. 13. Escherichia coli JM109 (DE3) strain (Promega, Madison, WI, USA). 14. Plasmid purification kit. 15. Phosphate-buffered saline Ca2+, Mg2+-free, pH 7.4 (PBS()).

Single FP-Based Indicator by Molecular Evolution

91

Fluorescent protein 1

145

238 (aa)

144 145

cpFP-type

Insertion-type

cf. GCaMP

cf. Camgaroo

238 1

144

1

144

Ligand

145

238

Ligand

Fig. 1 Molecular designs of single FP-based indicators. The two types of single FP-based indicators are shown. The circularly permuted (cp) FP-type (left) has two binding domains fused at both ends of the circularly permuted GFP. The insertion-type (right) has one ligand-binding domain inserted into an FP. The fluorescence intensity of both indicators changes following ligand binding or dissociation

T7 promoter

6x Histidine-tag

APP

Citrine

(Sac II, Eco RI site)

pRSET-A vector T7 promoter

c c c g c c a a a t t a a t a c g a c t c a c t a t a g g g a g a c c a c a a c g g t t t c c c t c t a g a a a t a a t t t t g t t t a a c t t t a a g a a g g a g a t a t a c a t 6x His-tag M R G S H H H H H H G M A S M T G G Q Q M G R D L Y D D D D a t g c g g g g t t c t c a t c a t c a t c a t c a t c a t g g t a t g g c t a g c a t g a c t g g t g g a c a g c a a a t g g g t c g g g a t c t g t a c g a c g a t g a c g a t APP K D R W G S A E E S D S V D S A D A E E D D S D V W W G G A a a g g a t c g a t g g g g a t c t g c c g a g g a a a g c g a c a g c g t g g a t t c t g c g g a t g c a g a g g a g g a t g a c t c t g a t g t c t g g t g g g g t g g a g c g D

T

D

Y

A

D

G

G

E

D

K

V

V

E

V

A

E

E

E

E

V

A

D

V

E

E

E

E

A

D

g a g a c a g a c t a c g c t g a t g g c g g t g a a g a c a a a g t a g t a g a a g t c g c c g a a g a g g a g g a a g t g g c t g a t a t t g a g g a a g a g g a a g c t g a t D

D

E

D

V

E

D

G

D

E

V

E

E

E

A

E

E

P

Y

E

E

A

T

E

R

T

T

S

T

A

g a t g a t g a g g a t g t g g a g g a t g g g g a c g a g g t g g a g g a g g a g g c c g a g g a g c c c t a c g a a g a g g c c a c c g a g a g a a c a a c c a g c a c t g c c Citrine T T T T T T T E S V E E V G S E L E M V S K G E E L F T G V a c c a c c a c c a c a a c c a c c a c t g a g t c c g t g g a g g a g g t g g g a t c c g a g c t c g a g a t g g t g a g c a a g g g c g a g g a g c t g t t c a c c g g g g t g Bam HI Xho I V P I L V E L D G D V N G H K F S V S G E G E G D A T Y G K g t g c c c a t c c t g g t c g a g c t g g a c g g c g a c g t a a a c g g c c a c a a g t t c a g c g t g t c c g g c g a g g g c g a g g g c g a t g c c a c c t a c g g c a a g L

T

L

K

F

I

C

T

T

G

K

L

P

V

P

W

P

T

L

V

T

T

F

G

Y

G

L

M

C

F

c t g a c c c t g a a g t t c a t c t g c a c c a c c g g c a a g c t g c c c g t g c c c t g g c c c a c c c t c g t g a c c a c c t t c g g c t a c g g c c t g a t g t g c t t c A

R

Y

P

D

H

M

K

Q

H

D

F

F

K

S

A

M

P

E

G

Y

V

Q

E

R

T

I

F

F

K

g c c c g c t a c c c c g a c c a c a t g a a g c a g c a c g a c t t c t t c a a g t c c g c c a t g c c c g a a g g c t a c g t c c a g g a g c g c a c c a t g t t c t t c a a g D

D

G

N

Y

K

T

R

A

E

V

K

F

E

G

D

T

L

V

N

R

I

E

L

K

G

I

D

F

K

g a c g a c g g c a a c t a c a a g a c c c g c g c c g a g g t g a a g t t c g a g g g c g a c a c c c t g g t g a a c c g c a t c g a g c t g a a g g g c a t c g a c t t c a a g E

D

G

N

I

L

G

H

K

L

E

Y

N

L

R

G

E

F

N

S

H

N

V

Y

I

M

A

D

K

Q

g a g g a c g g c a a c a t c c t g g g g c a c a a g c t g g a g t a c a a c c t c c g c g g a g a a t t c a a c a g c c a c a a c g t c t a t a t c a t g g c c g a c a a g c a g Sac II Eco RI K N G I K V N F K I R H N I E D G S V Q L A D H Y Q Q N T P a a g a a c g g c a t c a a g g t g a a c t t c a a g a t c c g c c a c a a c a t c g a g g a c g g c a g c g t g c a g c t c g c c g a c c a c t a c c a g c a g a a c a a c c c c I

G

D

G

P

V

L

L

P

D

N

H

Y

L

S

Y

Q

S

A

L

S

K

D

P

N

E

K

R

D

H

a t c g g c g a c g g c c c c g t g c t g c t g c c c g a c a a c c a c t a c c t g a g c t a c c a g t c c g c c c t g a g c a a a g a c c c c a a c g a g a a g c g c g a t c a c M

V

L

L

E

F

V

T

A

A

G

I

T

L

G

M

D

E

L

Y

K

*

a t g g t c c t g c t g g a g t t c g t g a c c g c c g c c g g g a t c a c t c t c g g c a t g g a c g a g c t g t a c a a g t a a t t c g a a g c t t g a t c c g g c t g c t a a Hin dIII

Fig. 2 The insertion-type indicator backbone. A DNA fragment of the FP, Citrine, cloned into a pRSET-A vector is used to develop the glucose indicator. Two restriction enzyme sites SacII and EcoRI are introduced into the DNA sequence encoding the edge of the Citrine seventh β-sheet in the vicinity of the chromophore. The ligandbinding domain is inserted into this region. The super acidic region of mouse amyloid-β precursor protein (APP) (NM_001198823.1, amino acids 190–286) is fused to the N-terminal of Citrine to increase protein solubility under the expression of Escherichia coli

92

Marie Mita et al.

a

g c c c t c a a a a a a g a a c t a c a a g c c a a c a a g a a g g a a c t c g c a c a a A L K K E L Q A N K K E L A Q c g a a a t t t c t t c c t c a a c g t c c g t t t a t t t t t t c t c a a t c g c g t c

for C-linker Rv primer

for N-linker Fw primer

c t a a a a t g g g a a t t a c a a g c a t t a a a g a a a g a a t t a g c c c a a L K W E L Q A L K K E L A Q a a c t t c a c c c t c g a a g t c c g c g a g t t t t t c c t c g a c c g t g t c

b

N-linker Insertion Fw primer (N + 3) Insertion Fw primer (N + 2) Insertion Fw primer (N + 1) Fw primer (N + -- 0) Deletion Fw primer (N -- 1) Deletion Fw primer (N -- 2) Deletion Fw primer (N -- 3)

C-linker Insertion Rv primer (C + 3) Insertion Rv primer (C + 2) Insertion Rv primer (C + 1) Rv primer (C + -- 0) Deletion Rv primer (C -- 1) Deletion Rv primer (C -- 2) Deletion Rv primer (C -- 3)

Anneal Linker Extra Sac II gcc c cgc gga tta gcc caa gct gat act cgc att ggt gt gcc c cgc gga gcc caa gct gat act cgc att ggt gt gcc c cgc gga caa gct gat act cgc att ggt gt

gcc c cgc gga gct gat act cgc att ggt gt gcc c cgc gga gat act cgc att ggt gta ac gcc c cgc gga act cgc att ggt gta aca at gcc c cgc gga cgc att ggt gta aca atc ta

Extra Eco RI Linker Anneal g gaa ttc ctt taa agc ttt ctt gct gaa ctc agc ca g gaa ttc taa agc ttt ctt gct gaa ctc agc ca g gaa ttc agc ttt ctt gct gaa ctc agc ca g gaa ttc ttt ctt gct gaa ctc agc ca g gaa ttc ctt gct gaa ctc agc cag gt g gaa ttc gct gaa ctc agc cag gtt gt g gaa ttc gaa ctc agc cag gtt gtc tt

Fig. 3 Primer sequences for linker length optimization. (a) The amino acid and DNA sequences of the α-helical leucine zipper [6] used to link the FP and ligandbinding domain. Distinct codons are used in the Fw (Forward) and Rv (Reverse) primers to prevent PCR failure due to primer annealing in both sequences. (b) Example primer sequences for linker length optimization. The primers include extra nucleotides to improve restriction enzyme recognition and digestion, linker sequences (red and blue), and annealing sequences. The length of the annealing sequence is usually 18–25 bases, and the GC content is 8–12 bases. The primers used to insert or delete >4 amino acids are also designed according to this criterion

16. Q55 ultrasonic homogenizer (Qsonica L.L.C., Newtown, CT, USA). 17. Fluorescence spectrophotometer. 2.2 Random Mutagenesis to Optimize the Linker Amino Acid Sequence

1. N, C-optimized indicator in pRSET-A Vector (from Subheading 3.1). 2. Outer Fw primer-A, mutation Rv primer-A (carrying MNN for random mutation) (see Fig. 5). 3. Mutation Fw primer-B (carrying NNK for random mutation), outer Rv primer-B (see Fig. 5). 4. Inner Fw primer, inner Rv primer (see Fig. 5). 5. HindIII, XhoI restriction enzymes. 6. All materials as indicated in Subheading 2.1, items 6–17. 7. Ni-NTA beads (Qiagen, Venlo, Netherlands).

Single FP-Based Indicator by Molecular Evolution

8. PD-10 gel filtration Buckinghamshire, UK). 2.3 Cell Culture and Fluorescence Imaging

column

(GE

93

Healthcare,

1. High glucose Dulbecco’s modified Eagle’s medium (DMEM). 2. Fetal bovine serum (FBS). 3. Penicillin (100 U/mL) and streptomycin (0.1 mg/mL). 4. Poly-L-lysine. 5. Lipofectamine 2000 transfection reagent (Life Technologies, Carlsbad, CA, USA). 6. Opti-MEM. 7. Modified Ringer’s buffer (RB): 140 mM NaCl, 3.6 mM KCl, 0.5 mM NaH2PO4, 0.5 mM MgSO4, 1.5 mM CaCl2, 10 mM HEPES, 2 mM NaHCO3, pH 7.4. 8. Perfusion device. 9. Fluorescence inverted microscope equipped with a xenon lamp, 40
objective lens (UApo/340, NA ¼ 1.35, Olympus, Tokyo, Japan), filter set (excitation filter 460–495 nm, emission filter 510–550 nm, dichroic mirror 505 nm), and an EM-CCD camera. 10. MetaMorph CA, USA).

3

software

(Molecular

Devices,

Sunnyvale,

Methods

3.1 Linker Length Optimization Screen

1. First, optimize the linker length on one side (i.e., the N-linker or the C-linker) according to the following procedure: Set up a PCR (50 μL) using PrimeSTAR HS DNA polymerase with 13 primer pairs (N  0 and C  0, N  0 and C + 3 to C  3, N + 3 to N  3 and C  0; see Fig. 3) and FLIPglu170nDelta13 (carrying the D-galactose-binding periplasmic protein coding sequence MglB) as a template for amplifying glucose-binding domain DNA fragments with different linker lengths flanked with SacII and EcoRI recognition sites (see Notes 1–3). 2. Set up the following PCR cycling conditions: denaturation step (95  C, 2 min), followed by 30 cycles of denaturation (95  C, 30 s), annealing (55  C, 30 s), and extension (72  C, 1 min). 3. Clean up the PCR fragments (50 μL, 13 samples) using a DNA clean-up system, and elute the amplicons in 50 μL H2O. 4. Digest the PCR fragments (50 μL, 13 samples) and APP-Citrine in pRSET-A vector (2 μg in 50 μL) with SacII and EcoRI overnight at 37  C. 5. Load the digested products (50 μL) into a 1% agarose gel and separate the products by electrophoresis in TBE buffer for

94

Marie Mita et al.

30 min at 100 V. Ensure that the fragments are of the correct size, then excise and extract the products using a DNA clean-up system and elute in 50 μL H2O. 6. Prepare the ligation reactions by combining the linearized vector (1 μL), PCR fragments (3 μL), and ligation high Ver.2 (4 μL). Mix well and incubate the reaction at 16  C for 2 h. 7. Transform the ligation reactions (8 μL) into E. coli Mach-1 (50 μL), spread the transformation mix on an LB agar plate containing 50 μg/mL ampicillin, and incubate overnight at 37  C. 8. Pick up individual bacterial colonies into 3 mL LB medium containing 50 μg/mL ampicillin. Then, incubate the sample overnight at 37  C by shaking at 250 rpm. 9. Extract the plasmid DNAs using a plasmid purification kit, and check the DNA sequences of the 13 candidates for the glucose indicator. 10. Transform the 13 plasmids into E. coli JM109 (DE3) (50 μL) for protein expression, spread the transformation mix on an LB agar plate containing 50 μg/mL ampicillin, and incubate overnight at 37  C. 11. Pick up one colony from each plate and transfer to 3 mL LB medium containing 50 μg/mL ampicillin. Incubate the sample for 4 days at 20  C by shaking at 250 rpm (see Note 4). 12. Collect the bacteria culture into a 2 mL tube and centrifuge at 16,000
g for 5 min at 4  C. Discard the supernatant and resuspend the bacteria pellets in 700 μL PBS(), pH 7.4. 13. Lyse the bacteria using an ultrasonic homogenizer (30% power with 20 cycles of 1 s ON and 1 s OFF). Then, centrifuge the sample at 16,000
g for 5 min at 4  C. 14. Dilute 100 μL of the supernatant in 395 μL PBS(), and measure the fluorescence intensity using a fluorescence spectrophotometer. Set the excitation wavelength to 480 nm, and measure the fluorescence at wavelength ranging from 500 to 600 nm. The emission peak is usually observed around 530 nm. 15. Add 5 μL 1 M glucose to the sample (final concentration, 10 mM) and repeat the measurement. 16. Calculate the F/F0 by dividing the fluorescence intensity at the peak after glucose addition with the basal intensity before glucose addition. 17. Identify the candidate with the largest F/F0 (i.e., C-optimized, C  2 aa; see Fig. 4) and change the linker length of the opposite side by PCR (Subheading 3.1 steps 1–9). If the linker length is suboptimal in terms of F/F0 expansion, then design

Single FP-Based Indicator by Molecular Evolution N-linker MglB (24-332)

N-linker length (C + -- 0 aa)

1.7 1.6 1.5 1.4 1.3 1.2 1.1 1.0

(146-238) C-linker length (N + -- 0 aa)

- 6 aa - 5 aa - 4 aa - 3 aa - 2 aa - 1 aa 0 aa + 1 aa + 2 aa + 3 aa + 4 aa + 5 aa + 6 aa

F / F0

Citrine (1-144)

C-linker

- 6 aa - 5 aa - 4 aa - 3 aa No peak - 2 aa - 1 aa 0 aa + 1 aa + 2 aa + 3 aa + 4 aa + 5 aa + 6 aa

Prototype

95

C - 2 aa MglB (24-330)

(146-238)

N-linker length (C - 2 aa)

1.7 1.6 1.5 1.4 1.3 1.2 1.1 1.0

N,C-optimized

+ 6 aa

+ 4 aa

+ 3 aa

+ 2 aa

0 aa

+ 1 aa

- 1 aa

- 2 aa

N+ -- 0 aa, C - 2 aa - 3 aa

F / F0

Citrine (1-144)

+ 5 aa

C-optimized

Fig. 4 F/F0 expansion by linker length optimization. (Adapted from Mita et al. [3] with permission from American Chemical Society.) A schematic of a prototype indicator and the change in fluorescence intensity after N-linkers and C-linkers are inserted/deleted. The responses to 10 mM glucose are compared between the candidates with different linker lengths; the C  2 aa deletion mutant elicited the maximum F/F0 (C-optimized). The optimization process is repeated by fixing the C-linker length at 2 aa and screening the effects of N-linkers of varying lengths. The candidate with the largest F/F0, N  0 aa linker is selected. Finally, The N, C-optimized indicator (N  0 aa, C  2 aa) is obtained

new primers to insert or delete more amino acids. Refer to Note 5 for more details. 18. Optimize the linker length of the opposite site (i.e., N-linker) as in Subheading 3.1, steps 10–16, and select the candidate with the largest F/F0 as the glucose indicator candidate (i.e., N, C-optimized, N  0 aa, C  2 aa; see Fig. 4). 3.2 Site-Directed Random Mutagenesis to the Linker Amino Acid Sequence

1. Design primers to optimize the amino acid sequence of one of the linker regions (i.e., N-linker). The primers should carry NNK in the sense strand and MNN in the antisense strand to introduce a random mutation at one chosen site (see Fig. 5a). Refer to Note 6 for more details. 2. Perform the first PCR (50 μL) using the two primer sets (outer Fw primer-A and mutation Rv primer-A, mutation Fw primerB and outer Rv primer-B), and use the N, C-optimized plasmid as the template. The PCR cycling conditions are as described in Subheading 3.1, step 2.

96

Marie Mita et al.

a

Outer Fw primer-A

Inner Fw primer

Mutation Fw primer-B

Citrine N L R G A MglB

Citrine Inner Rv primer

Mutation Rv primer-A

1st PCR

Outer Rv primer-B

Outer Fw primer-A Mutation Rv primer-A

taatacgactcactataggg atc agc tcc MMN gag gtt gta ctc cag ctt

Mutation Fw primer-B Outer Rv primer-B

tac aac ctc NNK gga gct gat act cgc att tagagcttgacggggaaagc

2nd PCR

Inner Fw primer Inner Rv primer

M:a/c K:g/t N:a/c/g/t

gtatggctagcatgactggt ctagttattgctcagcggtg

b

c Citrine

MglB

Citrine

N-linker

C-linker

F / F0

Y N L R G A D T R

E F S E F N S

1.6

F G L L G V D T S

E F S E V D S

3.3

* *

*

*

*

* *

Fig. 5 F/F0 expansion by molecular evolution. (Adapted from Mita et al. [3] with permission from American Chemical Society). (a) A schematic showing site-directed random mutation and one representative example primer set for creating a mutation. The mutation primers consist of an annealing sequence for overlap PCR (second PCR), a random mutation (Fw; NNK, Rv; MNN), and an annealing sequence for the first PCR. The two fragments amplified by outer Fw primer-A and mutation Rv primer-A pair and outer Fw primer-B and mutation Rv primer-B pair in the first PCR are used as a template for the second PCR to obtain a single fragment (amplified by inner Fw primer and inner Rv primer) carrying the site-directed random mutations. (b) A schematic of the N, C-optimized (N  0 aa, C  2 aa) candidate and the change in fluorescence intensity after introducing point mutations into the N-linker and C-linker regions. The asterisks indicate the introduced point mutations. After linker amino acids optimization, the final candidate exhibits an expanded F/F0 of 3.3. (c) The excitation and emission spectral properties of purified Green Glifon600 in the presence (solid line) or absence (dashed line) of 10 mM glucose. The florescence intensity (FI) is normalized to the peak in the absence of glucose. The dynamic range of purified Green Glifon600 shows a ~7-fold increase in the presence of 10 mM glucose

3. Load the PCR products (10 μL) into a 1% agarose gel and separate by electrophoresis in TBE buffer for 30 min at 100 V. Ensure that the fragments are of the correct size, then excise and extract the products using a DNA clean-up system and elute in 50 μL H2O. 4. Perform the second PCR (50 μL) with the appropriate primer set (inner Fw primer, inner Rv primer) and 1 μL of each of the two products from the previous step (Subheading 3.2, step 3) as the template. Set up and run the PCR according to the conditions described in Subheading 3.1, step 2. 5. Clean up, digest, extract, and ligate the PCR product into the linearized APP-Citrine pRSET-A vector as described in

Single FP-Based Indicator by Molecular Evolution

97

Subheading 3.1, steps 3–6, with the exception of using XhoI and HindIII rather than SacII and EcoRI. 6. Transform the ligation reaction into E. coli JM109 (DE3) (50 μL), spread the transformation mix on an LB agar plate containing 50 μg/mL ampicillin, and incubate overnight at 37  C. 7. Pick 48 individual bacterial colonies, obtain the supernatant, and measure the fluorescence intensity as detailed in Subheading 3.1, steps 11–16. Refer to Note 7 for more details. 8. Identify the candidate with the largest F/F0, isolate the DNA using a plasmid purification kit from the remaining bacteria culture, and check the DNA sequence. 9. Use the selected candidate as the template to induce random mutations into the linker sequence of the opposite site (i.e., C-linker). Repeat Subheading 3.2, steps 1–9 until F/F0 reaches 3.0 (see Fig. 5b). 10. To adjust the binding affinity (EC50) of the glucose indicator, design primers to introduce a point mutation at residue F39 in the glucose-binding domain [5] and its adjacent residue N38. 11. Evaluate the dose-response curve for all candidates and select the candidate with the desired affinity (N38Y/F39Y) as the final glucose indicator, Green Glifon600. 12. For further characterization (see Fig. 5c), purify the histidinetagged Green Glifon600 using Ni-NTA beads, followed by gel filtration. 3.3 Fluorescence Live-Cell Imaging

1. Use XhoI and HindIII to clone the Green Glifon600 into the pcDNA3.1() vector for expression in mammalian cells. 2. Culture HeLa cells in high-glucose DMEM supplemented with glutamine, sodium pyruvate, 10% (v/v) FBS, 100 U/mL penicillin, and 0.1 mg/mL streptomycin (culture medium) in a humidified incubator at 37  C with 5% CO2. 3. Coat 35 mm glass-bottomed dishes with 1 mg/mL poly-Llysine for 30 min, and then wash the dishes three times with PBS(). 4. Seed 1.0
105 HeLa cells on the coated glass-bottomed dishes and incubate for 2 days. The cells should be 80–90% confluent on the day of transfection. 5. Prepare the transfection mixture by adding 1.5 μg Green Glifon600 plasmid and 3 μL Lipofectamine 2000 transfection reagent into 200 μL Opti-MEM. Carefully add the mixture to the glass area of the dishes containing HeLa cells in 1 mL culture medium.

98

Marie Mita et al.

a Cells Perfusion device

RB

x40 objective lens (UApo/340, NA = 1.35)

Excitation filter (460-495 nm) Xenon lamp

Waste

Dichroic mirror (505 nm) Filter set

Emission filter (510-550 nm) EM-CCD camera

c

b

Fig. 6 The microscope and live-cell imaging setup. (Adapted from Mita et al. [3] with permission from American Chemical Society.) (a) A fluorescence microscope equipped with an oil immersion
40 objective lens (UApo/340,
40, NA ¼ 1.35), an EM-CCD camera, and a xenon lamp is needed for live-cell imaging. Modified Ringer’s buffer (RB) is perfused into the dish containing the cells. Fluorescence images are acquired using a filter set with an excitation filter of 460–495 nm, an emission filter of 510–550 nm, and a dichroic mirror of 505 nm. (b) Sequential images of HeLa cells expressing Green Glifon600 are captured during 3 and 25 mM glucose stimulation. RB containing 0 mM glucose is perfused in the nonstimulation periods. (c) A time course of fluorescence intensity changes in HeLa cells expressing Green Glifon600. The data represent the means  standard deviation (n ¼ 15 cells from three independent experiments). The white and black bars indicate the 3 and 25 mM glucose stimulation periods, respectively. Here, Green Glifon600 reversibly responds to glucose stimulation

6. Incubate the cells with the transfection mixture at 37  C for 4 h. 7. Replace the medium with 2 mL fresh culture medium, and incubate the cells at 32  C for 2 days for optimal chromophore maturation. Refer to Note 8 for more details. 8. Wash the cells with 1 mL RB (modified Ringer’s buffer), and observe the cells in 1 mL RB under a fluorescence inverted microscope (see Fig. 6a). 9. Constantly replace the RB (1.5 mL/min) in the dish using a perfusion device, and change the medium to RB containing 3 or 25 mM glucose for 2 min during periodic glucose stimulation (see Fig. 6a). 10. Acquire the images every 5 s, using MetaMorph software.

Single FP-Based Indicator by Molecular Evolution

99

11. Calculate the basal fluorescence by averaging the fluorescence intensity during the 30 s before glucose introduction. Normalize the fluorescence intensity of each cell during imaging by dividing the intensity by the basal fluorescence. Plot the change in fluorescence intensity over time (see Fig. 6b, c).

4

Notes 1. An annealing length of 18–25 bases and a GC content of 8–12 bases are recommended when designing the primers. 2. The addition of an extra nucleotide at the 50 -terminal end of the primer is recommended for efficient restriction enzyme digestion (e.g., EcoRI; g, SacII; gcc). 3. The codon usage for amino acids of the leucine zipper linker should differ between the forward primers and reverse primers to avoid PCR failure (see Fig. 3). 4. Do not add IPTG to the E. coli culture for induction. IPTG causes excessive protein production, which may lead to serious aggregation. Basal protein expression even in the absence of IPTG is sufficient. 5. To introduce a longer amino acid sequence, use N + 3 aa or C + 3 aa as the template and design the primers to add the additional amino acid extension. The addition of >4 amino acids is not recommended, as the primer will be too long, and the chance of PCR success is decreased. For example, to create N + 6 aa, use N + 3 aa as the template and design a primer for the additional three amino acids to reach a total of six added amino acids. 6. For the overlap PCR (second PCR), the overlap sequence of the two fragments should be 18–25 bases (including NNK), and the GC contents should be 8–9 bases (not including NNK). 7. The screening of the 48 candidates usually covers 15–18 amino acid variants. Selecting more candidates will increase the probability of obtaining all 20 amino acid variants, but more time will be needed for the analysis. 8. The optimal cell incubation conditions after transfection for chromophore maturation are 28–30  C for 24–48 h. Adhering to these conditions will lead to a better indicator response.

Acknowledgments This work was supported by a Grant-in-Aid for Scientific Research (JP15H04191 to H.U., JP17K08529 to T.T., JP16K01922,

100

Marie Mita et al.

JP18H04832 to T.K.), The Precise Measurement Technology Promotion Foundation (to T.T.), the Nakatani Foundation (to T.T.), and the Sasakawa Scientific Research Grant from the Japan Science Society (2018-4018 to M.M.). References 1. Nakai J, Ohkura M, Imoto K (2001) A high signal-to-noise Ca2+ probe composed of a single green fluorescent protein. Nat Biotechnol 19 (2):137–141. https://doi.org/10.1038/84397 2. Baird GS, Zacharias DA, Tsien RY (1999) Circular permutation and receptor insertion within green fluorescent proteins. Proc Natl Acad Sci U S A 96(20):11241–11246. https://doi.org/10. 1073/pnas.96.20.11241 3. Mita M, Ito M, Harada K, Sugawara I, Ueda H, Tsuboi T, Kitaguchi T (2019) Green fluorescent protein-based glucose indicators report glucose dynamics in living cells. Anal Chem 91 (7):4821–4830. https://doi.org/10.1021/acs. analchem.9b00447 4. Deuschle K, Okumoto S, Fehr M, Looger LL, Kozhukh L, Frommer WB (2005) Construction

and optimization of a family of genetically encoded metabolite sensors by semirational protein engineering. Protein Sci 14(9):2304–2314. https://doi.org/10.1110/ps.051508105 5. Sakaguchi-Mikami A, Taneoka A, Yamoto R, Ferri S, Sode K (2008) Engineering of ligand specificity of periplasmic-binding protein for glucose sensing. Biotechnol Lett 30 (8):1453–1460. https://doi.org/10.1007/ s10529-008-9712-7 6. Ghosh I, Hamilton AD, Regan L (2000) Antiparallel leucine zipper-directed protein reassembly: application to the green fluorescent protein. J Am Chem Soc 122(23):5658–5659. https:// doi.org/10.1021/ja994421w

Part III Imaging with Functional Substrates and Luciferases

Chapter 10 Near-Infrared Bioluminescence Imaging of Animal Cells with Through-Bond Energy Transfer Cassette Masahiro Abe, Ryo Nishihara, Sung-Bae Kim, and Koji Suzuki Abstract Coelenterazine (CTZ) is the most general substrate for marine luciferases. The present protocol introduces a near-infrared (NIR) bioluminescence (BL) imaging of mammalian cells with a cyanine-5 (Cy5) dye-conjugated CTZ. This unique Cy5-conjugated CTZ, named Cy5-CTZ, can act as a dual optical readout emitting both fluorescence (FL) and BL. The Cy5-CTZ exerts through-bond energy transfer (TBET)-based imaging modalities for mammalian cells. This novel derivative, Cy5-CTZ, is intrinsically fluorescent and emits NIR-shifted BL when reacting with an appropriate luciferase, such as Renilla luciferase (RLuc). The protocol exemplifies a unique live-cell imaging with Cy5-CTZ that is optically stable in physiological samples and rapidly permeabilize through plasma membrane and emit NIR-BL in live mammalian cells. Keywords Bioluminescence (BL), Cyanine-5 (Cy5), Through-bond energy transfer (TBET), Near infrared (NIR), Coelenterazine (CTZ)

1

Introduction Bioluminescence (BL) is emerging as a rapid, simple, and noninvasive imaging modality for mammalian cells [1]. Among the known optical readouts, BL is highly sensitive with better signal-to-background (S/B) ratio and does not require excitation light and complex instrumentation unlike the fluorescence (FL)-based systems [2]. Renilla luciferase (RLuc) has been broadly used in bioassays. But the emission wavelengths remain in the blue-green region (400–550 nm) [3], which limit it’s in vivo applications due to tissue attenuation of light by blood hemoglobin and other biological molecules. Thus, expanding the optical emission wavelength toward red or near infrared (NIR) contributes to the utility. The major cell imaging strategies comprise fluorescence resonance energy transfer (FRET) and bioluminescence resonance energy transfer (BRET) that were used for biological applications,

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

103

104

Masahiro Abe et al.

such as studying structural (protein folding) and functional (protein-protein interactions) changes in proteins [2]. For example, studies on BRET have been used to achieve NIR emission by physically conjugating infrared fluorescent proteins or quantum dots with optimal luciferases [4, 5]. However, these conventional strategies have two conceptually controversial requirements, that is, (1) a large spectral overlap between the energy donor and acceptor is required for efficient energy transfer [6] and (2) in contrast, less spectral overlap is advantageous for achieving better imaging resolution with minimal optical cross talk. To address to this contradiction, we here introduce a new NIR-BL imaging strategy based on a through-bond energy transfer (TBET) system, which requires no spectral overlap and exhibits faster energy transfer rates than the conventional through-space energy transfer (e.g., BRET and FRET) systems. TBET can occur, even in case that the through-space energy transfer does not take place, if the donor and acceptor are connected appropriately by an electronically conjugated linker as typified by an acetylene linker [7]. Hence, one can select any dye and obtain significantly red-shifted emission independent of spectral overlap. The present protocol introduces a novel coelenterazine (CTZ) analogue allowing TBET, named Cy5-CTZ, where the C-6 position of CTZ was chemically conjugated to Cy5 via an acetylene linker [8]. Cy5 was exemplified because (1) it is a representative of widely used organic dyes, (2) it has almost no spectral overlap with CTZ, guaranteeing minimal optical crosstalks, and (3) it is an efficient energy acceptor, whose emission is located in the NIR region. The C-6 position of CTZ was selected as the site for modification because our previous study revealed that RLuc variants can tolerate CTZs with modification at the C-6 position, for example, 6-pi-CTZ (see Fig. 1b) [9]. An acetylene linker was selected as the bridge after careful consideration of the requirements, such as (a) the linker must maintain π conjugation for TBET, (b) the linker has to avoid a coplanar conformation between the energy donor and acceptor [10, 11]. The present protocol highlights the experimental details from the characterization of the optical properties of Cy5-CTZ to the practical applications.

2

Materials

2.1 Reagents and Lab Equipments

1. Fluorescent dye, Cyanine-5 (Cy5). 2. Cy5-conjugated CTZ (Cy5-CTZ). 3. pcDNA3.1(+) vector encoding one of the luciferases: native RLuc, RLuc8, RLuc8.6-535SG, Gaussia luciferase (GLuc),

NIR Imaging with Through-Bond Energy Transfer

105

Fig. 1 The chemical structures of CTZ and its analogues and the corresponding optical spectra. (A) The chemical structures of native CTZ (CTZ) (a), CTZ derivatives (6-pi-CTZs) (b), cyanine dyes (d, e), and the synthesized Cy5-CTZ conjugate (c). (B) Absorption spectra of the Cy5-CTZ conjugate (red) and free Cy5 dye (yellow). The spectrum of the Cy5-CTZ conjugate is clearly red-shifted, compared to those of CTZ (blue) and Cy5 alone. (C) CL and BL spectra of native CTZ and the Cy5-CTZ conjugate. The BL spectra were taken in the presence of RLuc8.6-535SG. Most of the resonance energy is found to be transferred to the NIR region (pink shadow). (Reprinted from Abe et al. [8] with permission from John Wiley & Sons, Inc.)

artificial luciferase 16 (ALuc16), artificial luciferase 23 (ALuc23), and artificial luciferase 49 (ALuc49). 4. African green monkey kidney-derived cells, COS-7. 5. Woman breast cancer-derived MDA-MB-231 cells. 6. 24-Well microplate. 7. 96-Well black-frame optical bottom microplate. 8. 6-Well cell culture dishes. 9. 6-Well microslide (μ-Slide VI0.4, ibidi). 10. The cell culture media: Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and a mixture of penicillin/streptomycin mixture (P/S). 11. Phosphate-buffered saline (PBS): 0.137 M NaCl, 2.7 mM KCl, 0.01 M Na2HPO4, and 1.8 mM KH2PO4, pH 7.4. 12. Lysis buffer (E291A, Promega). 13. Dimethyl sulfoxide (DMSO). 14. Methanol (MeOH). 15. Human whole blood (Biopredic International). 16. Transfection reagent, TransIT-LT1 (Mirus).

106

Masahiro Abe et al.

17. 200 μL PCR tube. 18. Multichannel micropipette. 2.2

Instrumentation

1. UV-vis absorption spectrophotometer (UV). 2. Spectrophotometer (AB-1850 LumiFL Spectrocapture, ATTO). 3. CO2 incubator. 4. IVIS Lumina II imaging system (Perkin Elmer). 5. FL microscope. 6. Microplate reader.

2.3

Software

1. Image analysis software, ImageJ (NIH). 2. Living Image 4.5.5 (Caliper).

3

Methods

3.1 UV-Vis Absorption Measurements (See Fig. 1B)

1. Dissolve Cy5 and Cy5-CTZ in MeOH and PBS, respectively (final concentration: 10 μM, 100 μL). 2. Add 100 μL of the solutions to a 96-well black-frame optical bottom microplate and set the microplate on the tray of a spectral scanning-type microplate reader. 3. Measure UV-vis absorption spectra with the microplate reader.

3.2 Chemiluminescence Spectra (See Fig. 1C)

1. Prepare a stock solution of CTZ or Cy5-CTZ (in MeOH and PBS, 20 μM). 2. Transfer 100 μL of the stock solution to a 200 μL PCR tube. 3. Add 100 μL of DMSO to the tube to initiate the chemiluminescence. 4. Immediately measure the chemiluminescence spectra of the mixture with a spectrophotometer (see Note 1). 5. Calculate energy transfer efficiency by the ratio of relative luminescence area of donor and acceptor.

3.3 Preparation of Mammalian Cells Expressing Marine Luciferases

1. Culture African green monkey kidney-derived COS-7 cells in a 24-well microplate. 2. Transiently transfect the COS-7 cells with an pcDNA 3.1(+) vector encoding wild-type RLuc, RLuc8, or RLuc8.6-535SG, using a transfection reagent. 3. Incubate the cells for 48 h and then lyse them for 15–20 min with a lysis buffer (see Note 2).

3.4 Bioluminescence Spectra (See Fig. 1C)

1. Prepare a stock solution of CTZ or Cy5-CTZ (in MeOH and PBS, 20 μM).

NIR Imaging with Through-Bond Energy Transfer

107

2. Mix 200 μL of the substrate solution with 5 μL of each cell lysate that was prepared according to Subheading 3.3. 3. Measure the consequent BL spectra immediately with a spectrophotometer. 3.5 Passive Diffusion Kinetics of Cy5-CTZ and Cy5 into Mammalian MDA-MB-231 Cells (See Fig. 2a)

1. Plate mammalian MDA-MB-231 cells stably expressing RLuc8.6-535SG in a 6-well microslide (see Note 3). 2. Incubate the microslide in a CO2 incubator to reach 70% confluence. 3. Replace the medium in the microslide with 60μL of a fresh one dissolving Cy5-CTZ or Cy5 alone, and mount the slide on the sample stage of a FL microscope. 4. Determine the corresponding FL images every 2 min during 30 min with the FL microscope (see Note 4). 5. Analyze the total FL intensity variance of the FL images according to time using a specific image analysis software, ImageJ.

3.6 Determination of Luciferase-Specific Bioluminescence of Cy5-CTZ (See Fig. 2b)

1. Plate mammalian MDA-MB-231 cells on 6-well cell culture dishes to reach 80% confluence. 2. Transiently transfect the cells in each well with a pcDNA3.1 (+) vector encoding each luciferase, that is, GLuc, RLuc, RLuc8, RLuc8.6-535SG, ALuc16, ALuc16-DEVD-MLS, ALuc23, and ALuc49. 3. Subculture the cells into a 96-well black-frame optical bottom microplate (see Note 5). 4. Prepare the substrate solution through dissolving Cy5-CTZ with PBS (final concentration: 2 μM). 5. After elimination of the cell culture media in the microplate, simultaneously inject 50 μL of the substrate solution into the wells of the microplate using a multichannel micropipette (see Note 6). 6. Immediately determine the BL images with an IVIS Lumina II imaging system.

3.7 Kinetic Profiles of Bioluminescence Intensities (Fig. 3a)

1. Prepare the substrate solution through dissolving CTZ (final concentration: 4 μM) or Cy5-CTZ (final concentration: 40 μM) with PBS. 2. Separately prepare the luciferase lysates according to Subheading 3.3. 3. Place an aliquot of each cell lysate (4 μL) on each well of a 96-well black-frame optical bottom microplate.

108

Masahiro Abe et al.

Fig. 2 (a) FL images of live MDA-MB-231 cells plated on a microslide showing cellular diffusion kinetics of Cy5-CTZ. The lower panel shows the relative optical intensities of the cells treated with Cy5 or Cy5-CTZ measured over time. RFU means Relative FL Unit. (b) Comparison of the absolute BL intensities of live MDA-MB-231 cells expressing the designated luciferase after treatment of the Cy5-CTZ conjugate. The bar graph on the lower panel highlights the absolute BL intensities from the cells that are cultured in a 96-well microplate (n ¼ 3). The p-values (Student’s T-test) are ** ¼ Filter > Median. 4. Subtract the background signals by following the steps: Process > Subtract Background (see Note 11). 5. (Optional) Adjust the contrast by following the steps: Image > Adjust > Brightness/Contrast. 6. Generate region of interest (ROI) and apply it to the image by following the steps: Analyze > Tools > ROI Manager > Add. 7. Label the stacks by following the steps: Image > Stacks > Label (see Note 12).

Long-Term Cell Imaging

241

b

a

0h

1h

2h

4h

7h

10 h

14 h

24 h

BF MGH

MGH Hoechst 33342

Hoechst 33342

Merge

Fig. 2 Long-term images of MGH(AM). (a) Long-term imaging of Mg2+ levels with MGH(AM) localized in the nuclei for 24 h. (b) Time course of the relative FL intensity of MGH(AM) and Hoechst 33342 in a single cell. (Reproduced from Matsui et al. [1] with permission from The Royal Society of Chemistry)

8. Add a scale bar to each of the image slices by following the steps: Analyze > Tool > Scale bar. 9. Deploy the appropriate images according to appropriate time duration by following the steps: Edit > Copy to system and paste in a desired format. 10. (Optional) Extract the FL intensity values from the respective channel and plot them in a graph over time by following the steps: Image > Stack > Plot Z-axis Profile and arrange the data with an appropriate data analytics software, such as Excel.

4

Notes 1. The authors recommend to subculture HEK293T cells every 3 days (ca. 80% confluence) using trypsinethylenediaminetetraacetic acid (EDTA) solution. 2. It is recommended to warm up Opti-MEM solution at 37  C prior to transfection. In a microtube (1.5 mL), mix 120 μL of the Opti-MEM, 2.7 μL of pcDNA3.1(+)-Halo-NLS (900 ng/ μL), and 5 μL of P3000. Separately, in another 1.5 mL tube, mix 120 μL of Opti-MEM and 3.8 μL of lipofectamine 3000. Mix both solutions and incubate at room temperature for 5 min. Add the mixture to the cell culture dish and incubate for 3 h in CO2 incubator at 37  C. 3. Take extra care of the detachment of the HEK293T cells during the washing step, since HEK293T cells are easily detached. The authors recommend using HBSS (+), that is, a Hank’s balanced salt solution containing Ca2+ and Mg2+ without phenol red, to maintain osmotic pressure and pH in the cells. 4. It is recommended to adjust the incubation time according to the dye properties and its subsequent optical response. The

242

Priya Ranjan Sahoo et al.

reagent amount needs to be optimized beforehand for specific measurements. 5. The long-term imaging requires strict maintenance of live cells throughout the experiment to keep the normal cell morphology [5]. It is better to use an LED (or laser) power as low as possible in order to prevent both cell death and photobleaching of dyes. The experimental setup with low laser power, low exposure time, and proper dietary medium is important for facilitating the cell growth and for keeping the cells healthy enough for long-term imaging. 6. For long-term imaging, we recommend keeping appropriate humidity in the CO2 incubator during the experiment. Sufficient humidity inside the incubator helps in minimizing the evaporation of the medium. 7. Objective lens with a greater numerical aperture is always preferred after due correction of its chromatic aberration. 8. For acquiring reliable images for a long-term period, it is recommended to minimize the pH variance of the medium and avoid air bubbles in the immersion oil. Further, it is recommended to use a bright-field microscopic observation mode, such as phase contrast or differential interference contrast (DIC), because continuous exposure of the FL excitation light may cause artifactual photobleaching. 9. In this protocol, an LED-based spinning disk confocal system is used. When using a conventional confocal laser scanning microscope (CLSM), select a suitable laser power and adjust the other parameters (e.g., high voltage (HV), gain and offset, etc.) accordingly to avoid saturation of the FL intensity. Accurate adjustment of the gain and offset parameters is crucial for the best quality images. It is important to set the scanning resolution at 1024  1024 pixels or higher for acquiring better quality images. 10. Before proceeding the steps, set a time interval of the acquired images and the total recording period of time-lapse series. Acquisition time and recording time intervals may be optimized according to the research aims. It is advisable to adjust the acquisition time and recording time intervals to suit the research aims. 11. The rolling ball radius should be optimized by checking if the radius size is suitable by commanding [Analyze > Plot Profile]. As an alternative method for the background subtraction, select a reference region as a ROI, where no cells should exist, and subtract the average FL value of the ROI from the image by using ‘Subtract Measured Background’ plugin [6].

Long-Term Cell Imaging

243

12. Select the format of time display (e.g., 00:00:00 as HH:MM: SS) and time interval (as per Note 10) in the label stacks window. Time will be displayed on each image, which is suitable for arranging images. References 1. Matsui Y, Funato Y, Imamura H, Miki H, Mizukami S, Kikuchi K (2017) Visualization of long-term Mg2+ dynamics in apoptotic cells using a novel targetable fluorescent probe. Chem Sci 8(12):8255–8264. https://doi.org/ 10.1039/C7SC03954A 2. Bolgioni AF, Vittoria MA, Ganem NJ (2018) Long-term live-cell imaging to assess cell fate in response to paclitaxel. J Vis Exp (135). https:// doi.org/10.3791/57383 3. Maeshima K, Matsuda T, Shindo Y, Imamura H, Tamura S, Imai R, Kawakami S, Nagashima R, Soga T, Noji H, Oka K, Nagai T (2018) A transient rise in free Mg(2+) ions released from ATP-Mg hydrolysis contributes to mitotic chromosome condensation. Curr Biol 28 (3):444–451.e6. https://doi.org/10.1016/j. cub.2017.12.035

4. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A (2012) Fiji: an opensource platform for biological-image analysis. Nat Methods 9(7):676–682. https://doi.org/ 10.1038/nmeth.2019 5. Coutu DL, Schroeder T (2013) Probing cellular processes by long-term live imaging--historic problems and current solutions. J Cell Sci 126 (Pt 17):3805–3815. https://doi.org/10.1242/ jcs.118349 6. Goedhart J (2019) Step-by-step instruction to quantify fluorescence intensities from time-lapse imaging experiments: Subtract_Measured_Background.ijm. GitHub. https://github. com/JoachimGoedhart/Quantify-Intensityfrom-Timelapse

Part V Imaging with BRET Probes

Chapter 21 Highly Bright NIR-BRET System for Imaging Molecular Events in Live Cells Ryo Nishihara, Koji Suzuki, Sung-Bae Kim, and Ramasamy Paulmurugan Abstract The present protocol demonstrates a novel mammalian cell imaging platform exerting a bioluminescence resonance energy transfer (BRET) system. This platform achieves a ~300 nm blue-to-near infrared shift of the emission (NIR-BRET) with the development of a unique coelenterazine (CTZ) derivative named BBlue2.3 and a fusion reporter protein probe named iRFP-RLuc8.6-535SG. The best NIR-BRET shift was achieved by tuning the blue emission peak of BBlue2.3 to a Soret band of the iRFP. In mammalian cells, BBlue2.3 emits light that is ~50-fold brighter than DeepBlueC in cell imaging when combined with RLuc8.6-535SG. This NIR-BRET platform is sufficiently brighter to be used for imaging live mammalian cells at single-cell level, and also for imaging metastases in deep tissues in live mice without generating considerable autoluminescence. This unique optical platform provides the brightest NIR-BLI template that can be used for imaging a diverse group of cellular events in living subjects. Key words Bioluminescence imaging (BLI), Bioluminescence resonance energy transfer (BRET), Coelenterazine derivatives, Blue-to-near infrared shift, Metastasis

1

Introduction Bioluminescence imaging (BLI) has emerged as a standard optical imaging technique for visualizing a diverse group of molecular events in mammalian cells [1–4]. The advantage of BLI over fluorescence imaging (FLI) is mainly due to its lower background signals because of the absence of an excitation light source needed for illumination, resulting better signal-to-noise (S/N) ratio when compared to other methods [5]. On the other hand, BLI suffers from light attenuation in tissues in the visible region and the availability of a limited palette of colors. The light atteHighly Bright NIR-BRET System for Imaging Molecularnuation is significantly reduced with lights in the emission wavelength of over 700 nm [6]. As one of the efficient imaging systems, the scheme of bioluminescence resonance energy transfer (BRET) was previously introduced [7–9], in which the resonance energy (RE) of a luciferase is

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_21, © Springer Science+Business Media, LLC, part of Springer Nature 2021

247

248

Ryo Nishihara et al.

transferred to the adjacent fluorescent protein (FP), which emits light at a higher wavelength. This allows for the use of fluorescent proteins for the assay without the excitation lights for illumination, which avoids the background signal. The fabrication of an efficient BRET system has potential to extend the available color palettes with improved optical properties. It has been well documented in the literature that synthetic coelenterazine (CTZ) derivatives with Renilla luciferase variant 8 (RLuc8) as luciferase provide an effective, blue-shifted BLI system emitting light around 400 nm [10]. However, most of these BLI systems have not shown practical optical advantages over the standard imaging methodology with the use of native CTZ for imaging in living mice, owing to weaker red luminescence emission of the BLI system. Recently, a family of phytochrome-driven red fluorescent proteins (iRFPs) have been established for light emissions in NIR region [11, 12]. The iRFP was also linked to RLuc8 and illuminated with CTZ as substrate to achieve BRET with light emissions in the NIR region but showed limited improvement [13]. Hence, we developed a new group of CTZ derivatives, named Bottle Blue (BBlue), and identified BBluc2.3 by screening a library of compounds as efficient substrate, which provided much stronger BRET signal when combined with iRFP-RLuc8.6SG. This protocol is aimed to introduce a NIR BRET-based cell imaging system with a 300 nm blue-to-NIR shift (400–717 nm) through combining a unique probe (iRFP-RLuc8.6-535SG) and 18 novel bright blue-illuminating CTZ analogues (see Fig. 1). This NIR-BRET system provides in cellulo and in vivo imaging modalities with light emission at 717 nm, which is greatly brighter than conventional ones (see Figs. 1–3). This NIR-BRET system can exert live-cell imaging at single-cell level and deep-tissue imaging of molecular events in the complex context of live cells within animal models without severe tissue attenuation and autoluminescence.

2

Materials

2.1 Reagents and Lab Equipment

1. pcDNA3.1(+) vector encoding RLuc8.6-535SG (RLuc8.6SG), iRFP-RLuc8.6SG, mCherry or iRFP-ER-RLuc8.6SG. 2. pHAGE-UBI-dTomato-CMV-MCS vector. 3. cDNA templates encoding Renilla RLuc8.6-535, RLuc8.6-535SG.

luciferase

variants:

4. Restriction enzymes: HindIII, BamHI, and XhoI. 5. Mammalian COS-7, HeLa, and MDA-MB-231 cells. 6. Culture medium: Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 0.1% streptomycin.

NIR-BRET Imaging for Mammalian Cells

249

(A) CTZ and its analogues 2 6 BBlue1.2

1.0

BBlue2.3

HindIII

XhoI

(4) XhoI

(2)

0.5 0 250 450 650 Wavelength [nm]

(D) BL spectra Normalized BLI

XhoI

HindIII

1.0

BBlue2.1

(C) cDNA constructs

RLuc8 bioluminescence HindIII iRFP713 absorbance (1) iRFP713 emission

HindIII

HindIII

XhoI

(3)

HindIII

0.5 0 350 450 550 650 Wavelength [nm]

XhoI

BamHI BamHI

XhoI

(6)

(F) BL / FL images

(E) BL spectra nCTZ BBlue1.2 BBlue2.3

BamHI

(5)

Bioluminescence [x10 5RLU]

Normalized signal

(B) BL / FL

BBlue1.6

12 8 4 0 350

Cytosol Nucleus

BBlue2.3 (5.71)

BL

BBlue2.1 (5.05) BBlue1.6 (4.96) FL BBlue1.2 (4.29) 450 550 Wavelength [nm]

Overlay

nCTZ

Without NLS With NLS

Fig. 1 (a) Chemical structures of native CTZ and newly synthesized CTZ derivatives by us: that is, BBlue1.2, BBlue1.6, BBlue2.1, and BBlue2.3. (b) Superimposed BL spectrum of RLuc8 on the excitation and emission spectra of iRFP. (c) The cDNA constructs encoding fusion protein probes emitting bioluminescence. (d) Normalized BL spectra of selected CTZ derivatives with RLuc8.6-535SG. (e) BL spectra of COS-7 cells expressing RLuc8.6-535SG that was reacted with the newly synthesized CTZ analogues (n ¼ 3). The numbers in parentheses mean the Log P values of each compound (cLog P), where P means each lipid-water partition coefficient. (f) BL and FL images of live HeLa cells expressing RLuc8.6-535SG. RLuc8.6-535SG is sequestered in the nucleus and the cytosol by fusing it with and without a nuclear localization signal peptide (NLS), respectively. The BL image was taken in the presence of BBlue2.3. The reference FL signal was captured by exciting mCherry with light 565 nm (Scale bars: 25μm)

7. Calcium phosphate transfection kit. 8. VSVG: A pseudotyped glycoprotein of lentivirus. 9. VPR: Viral protein R. 10. Transfection reagent, TransIT-LT1. 11. Passive lysis buffer (Promega). 12. Phosphate-buffered saline (PBS), pH 5.8. 13. Hank’s balanced salt solution (HBSS).

250

Ryo Nishihara et al.

14. Native CTZ and its derivatives: CTZ, BBlue1.2, BBlue1.6, BBlue2.1, BBlue2.3, Prolume Purple, Prolume Purple 2, DBlueC. 15. The agonist and antagonist of estrogen receptor (ER): 17β-estradiol (E2), 4-hydroxytamoxifen (OHT), diarylpropiolnitrile (DPN), methyl-piperidino-pyrazole (MPP), raloxifene (RAL), 4,4,4-(4-propyl-[1H])-pyrazole-1,3,5-triyl)trisphenol (PPT), tetrahydrochrysene (THC). 16. Bovine serum albumin (BSA). 17. Polyethylene glycol 400 (PEG400). 18. Multichannel micropipette. 19. 96-Well black-frame optical-bottom microplate. 20. Glass-bottom cell culture dish. 21. Ligation kit. 22. Ethyl alcohol. 23. Dimethyl Sulofoxide (DMSO). 24. 10-cm cell culture dish. 25. Cell counter. 26. Trypsine. 27. The saline cocktail supplemented with 35% PEG400 and 10% ethyl alcohol. 2.2

Instrumentations

1. Thermal cycler. 2. CO2 incubator. 3. Luminometer (Berthold Technologies, Germany). 4. A precision spectrophotometer (AB-1850 spectrophotometer, ATTO). 5. Cooled Monochrome (Olympus DP30).

CCD

Microscope

camera

6. IVIS optical imaging system (IVIS Lumina optical imaging system). 7. Lago X spectral optical imaging system with customized filter sets. 2.3

Software

1. Prism ver. 8.4 (GraphPad). 2. Living Image 4.5.5 (Caliper). 3. Aura ver 2.2.0 (Spectral Instruments Imaging).

2.4

Animals

1. NOD-SCID scid gamma (NSG)-recipient mouse carrying human peripheral mononuclear cells (NSG-hPBMC), abbreviated as NSG mouse.

NIR-BRET Imaging for Mammalian Cells

3

251

Methods

3.1 Construction of Three Different Mammalian Expression Plasmids Encoding RLuc8.6-535SG, iRFP-RLuc8.6-535SG, or iRFP-ERRLuc8.6-535SG (See Fig. 1c)

1. For constructing the NIR-BRET imaging probes illustrated in Fig. 1c, draw a blueprint to show the whole cDNA sequences of the probes from start-to-stop codons (see Note 1). 2. Design the corresponding primers according to the blueprint to introduce (1) unique restriction sites HindIII/XhoI to the terminals of cDNA encoding RLuc8.6-535SG or a nucleus localization signal (NLS)-linked RLuc8.6-535SG; (2) unique restriction sites HindIII/XhoI to the terminals of cDNA encoding mCherry or a nucleus localization signal (NLS)linked mCherry; (3) unique restriction sites HindIII/BamHI to the terminals of cDNA encoding iRFP; (4) unique restriction sites BamHI/XhoI to the terminals of cDNA encoding RLuc8.6-535SG; and (5) unique restriction sites BamHI/ BamHI to the terminals of cDNA encoding ER LBD (see Note 2). 3. Synthesize a series of the corresponding cDNA segments encoding each domain, that is, iRFP, RLuc8.6-535SG, and the ER LBD using a polymerase chain reaction (PCR) with the custom-made primer pairs and purify them. 4. Double digest the cDNA segments with the corresponding restriction enzyme pairs and purify them. 5. Likewise, double digest appropriate restriction sites with HindIII/XhoI in the multicloning sites (MCS) of a mammalian expression vector, such as pcDNA3.1(+) vector or pHAGEUBI-dTomato-CMV-MCS vector, and purify them (see Note 3). 6. Ligate the cDNA segments with a ligation kit, and subclone them into the prepared mammalian expression vectors. 7. Confirm the fidelity of the clones with a genetic sequence analyzer.

3.2 Bioluminescence Spectra Measurement of CTZ Derivatives with RLuc8.6-535SG (See Fig. 1d, e)

1. Culture human cervical cancer-derived HeLa cells into a glass bottom culture dish to reach 80% confluence by keeping in a 5% CO2 incubator at 37  C. 2. Transfect the HeLa cells with the pcDNA3.1(+) vectors encoding RLuc8.6-535SG using a transfection reagent by following the manufacturer’s protocol. 3. Incubate for 24 h in a CO2 incubator. 4. Separately, prepare the substrate solution (originally dissolved in ethyl alcohol at a concentration of 10 mM) that is a HBSS buffer dissolving 10 μM of CTZ or one of the Bottle Blue series CTZ derivatives (see Note 4). 5. Inject 200 μL of the substrate solution into the glass-bottom culture dish.

252

Ryo Nishihara et al.

6. Set the dish in the sample holder of the precision spectrophotometer. 7. Measure the whole wavelength intensities ranging from 350 to 780 nm with a minute of integration time. 3.3 Bioluminescence Imaging of Living Single Mammalian Cells Using Microscope CCD-Camera (See Fig. 1f)

1. Transfect HeLa cells in glass-bottom culture dishes with RLuc8.6-535 or NLS-linked RLuc8.6-535SG and incubate them at 37  C under 5% CO2 for 48 h. 2. Separately, transfect HeLa cells in glass-bottom culture dishes with mCherry or NLS-linked mCherry and incubate them at the same culture condition. 3. Prepare the substrate solution that is a HBSS buffer dissolving BBlue2.3 (final concentration: 20 μM). 4. Wash the cells with HBSS and suspend in HBSS (100 μL) (covering the central glass bottom part of the dish). 5. Add 100 μL of the substrate solution to the glass-bottom dish (final concentration of luciferin: 10 μM) and record BL images for less than 1 min of integration time with an Olympus DP30 cooled monochrome CCD microscope camera with a 100 objective lens. 6. Simultaneously obtain the reference fluorescence images by exciting mCherry with 565 nm before addition of luciferins (exposure time ¼ 2 s).

3.4 Characterization of the Optimal BRET Spectra of CTZ Derivatives (See Fig. 2a, b)

1. Transfect human cervical cancer-derived HeLa cells with one of the pcDNA3.1(+) vectors encoding iRFP-RLuc8.6-535SG constructs (d0–d8) using a transfection reagent. 2. Incubate the cells for 24 h in a CO2 incubator. 3. Lyse the cells with a lysis buffer. 4. Separately, prepare the substrate solution that is a HBSS buffer dissolving 10 μM of CTZ. 5. Mix an aliquot of the lysate (10 μL) with 200 μL of the substrate solution in a microtube. 6. Set the mixture in the sample holder of the precision spectrophotometer (see Note 5). 7. Measure the whole wavelength intensities ranging from 350 to 780 nm with a minute of integration time.

3.5 Characterization of the BRET Efficiency of iRFPRLuc8.6-535SG (d0– d8) According to the Flexible Linker Lengths (See Fig. 2c)

1. Transfect MDA-MB-231 cells with the pcDNA3.1(+) vectors encoding iRFP-RLuc8.6-535SG or iRFP-ER-RLuc8.6535SG using a transfection reagent. 2. Incubate the cells for 24 h in a CO2 incubator. 3. Lyse the cells with a lysis buffer (Promega) (see Note 6). 4. Prepare the substrate solution through diluting CTZ stock solution in a HBSS buffer to a final concentration: 10 μM.

NIR-BRET Imaging for Mammalian Cells

253

Fig. 2 (a) Schematic diagram of the iRFP-RLuc8.6-535SG structure with a highlighted junction region (gray) between iRFP (pink) and RLuc8.6-535SG (blue), where the linker length was characterized for the highest BRET efficiency. (b) Spectral variance of iRFP-RLuc8.6-535SG according to the linker lengths. (c) The spontaneous BRET signal observed in MDA-MB-231 cells expressing iRFP-RLuc8.6-535SG or iRFP-ERRLuc8.6-535SG when reacting with BBlue2.3 (n ¼ 3). Inset illustrates the molecular structures of the fusion protein probes. (d) Variance of the BL intensities of iRFP-ER-RLuc8.6-535SG fusion protein in response to 1μM of a ligand (E2, OHT, DPN, MPP, RAL, PPT, and THC) or a vehicle (0.1% DMSO) as a control (n ¼ 3). (e) Enhanced BLI images of the cells expressing iRFP-ER-RLuc8.6-535SG according to the concentrations of raloxifene (RAL)

5. Mix an aliquot of the cell lysate (4 μL) with 50 μL of the substrate solution and immediately measure the initial BLI for the first a few seconds with a luminometer. 3.6 Establishment of a Mammalian Cell Line Stably Expressing the Probe

1. Produce respective lentiviral stock expressing iRFP-RLuc8.6SG or iRFP-ER-RLuc8.6-535SG by cotransfecting HEK293T cells with three-vector transfection system (i.e., pHAGE-UBI-dTomato-CMV vector with iRFP-RLuc-8.6SG or iRFP-ER-RLuc8.6-535SG with VPR and VSVG) by adopting the calcium-phosphate transfection method. 2. Use the concentrated pure virus after titration to generate various stable cell lines by transduction. 3. Conduct three continuous passages of the transduced cells. 4. Conduct FACS sorting for obtaining clonal population of the cell line with uniform expression for the delivered reporter for further studies.

254

Ryo Nishihara et al.

3.7 Ligand-Driven BL Intensities of MDAMB-231 Cells Encoding iRFP-RLuc8.6-535SG or iRFPER-RLuc8.6-535SG (See Fig. 2d)

1. Seed the MDA-MB-231 cells stably expressing iRFP-RLuc8.6535SG or iRFP-ER-RLuc8.6-535SG in 10 cm culture dishes and incubate until the cells reach 90% confluence. 2. Subculture the cells into a 96-well black-frame optical-bottom microplate until the cells reach 90% confluence in a CO2 incubator. 3. Prepare a stimulation solution that is made by dissolving a vehicle (0.1% DMSO) or one of the estrogen agonists and antagonists, that is, E2, OHT, DPN, MPP, RAL, PPT, or THC (final concentration: 1 μM) in the culture medium (see Note 7). 4. Stimulate the cells for 20 min with the stimulation solution (see Note 8). 5. Decant the stimulation solution from the microplate and lyse the cells with 40 μL of a lysis buffer for 20 min. 6. Prepare the substrate solution that is a PBS with CTZ to a final concentration of 2 μM. 7. Mix 4 μL of the cell lysate with 50 μL of the substrate solution and immediately measure the BL intensities with an IVIS Lumina optical imaging system and analyze with a specific image analysis program, Living Image ver. 4.5 (Caliper).

3.8 Dose-Dependent BL Intensities of the MDA-MB231 Cells Encoding iRFPER-RLuc8.6-535SG (See Fig. 2e)

1. Seed the MDA-MB-231 cells stably expressing iRFP-RLuc8.6535SG or iRFP-ER-RLuc8.6-535SG in 10-cm cell culture dishes and incubate until the cells reach 90% confluence. 2. Subculture the cells into a 96-well black-frame optical-bottom microplate until the cells reach 90% confluence in a CO2 incubator. 3. Prepare a stimulation solution that is made by dissolving a vehicle (0.1% DMSO) or varying concentrations of the antagonists RAL ranging from 106 to 1012 M in the culture medium. 4. Stimulate the cells with the stimulation solution for 20 min. 5. Decant the stimulation solution from the microplate and lyse the cells with 40 μL of lysis buffer for 20 min. 6. Prepare the substrate solution that is a PBS solution dissolving to a final concentration of 2 μM CTZ or other analogues. 7. Inject 50 μL of the substrate solution into the microplate and immediately measure the BL intensities with an IVIS imaging system and analyze with the specific image analysis program, Living Image ver. 4.5.

NIR-BRET Imaging for Mammalian Cells

3.9 Quantitative Determination of the Substrate’s Sensitivity Based on Cell Numbers (See Fig. 3a)

255

1. Seed the MDA-MB-231 cells stably expressing iRFP-RLuc8.6535SG in 10-cm cell culture dishes and incubate until the cells reach 90% confluence. 2. Trypsinize and harvest the cells and resuspend in a PBS buffer. 3. Count the cells concentrations using a cell counter and adjust the cell numbers to a concentration of 100,000 per 40 μL. 4. Dilute the cells counting 20,000 every two folds by 10 with a PBS buffer on a 96-well black-frame optical-bottom microplate to a final volume of 40 μL. 5. Prepare the substrate solutions that are PBS solutions dissolving DBlueC, BBlue2.3, Prolume Purple, or Prolume Purple 2 (final concentration: 2 μM) (see Note 9). 6. After simultaneous injection of 40 μL of the prepared substrate solutions with a multichannel pipette, integrate the corresponding optical intensities with the IVIS optical imaging system with the open filter window.

3.10 Evaluation of Lung-Trapped Tumor Cells Expressing iRFP-RLuc8.6-535SG by NIR-BRET Imaging in Living Mice (See Fig. 3b)

1. House NSG mice more than 1 day in a calm animal breeding facility (see Notes 10 and 11). 2. Separately, culture the MDA-MB-231 cells stably expressing iRFP-RLuc8.6-535SG in 10-cm cell culture dishes and incubate until the cells reach 90% confluence. 3. Trypsinize and harvest the cells and resuspend in a PBS buffer. 4. Anesthetize the mice and inject the cells (5  105) in 100 μL PBS intravenously (IV) to NSG mice carrying human immune cells by tail vein. 5. House the mice in a cage for 2 weeks for the tumors to grow in different internal organs, majorly in the lungs. 6. Prepare the substrate solution through dissolving CTZ and BBLue2.3 with a saline cocktail (50 μg of BBLue2.3 in 100 μL saline cocktail) (see Note 12). 7. Anesthetize the BALB/c nude mice (nu/nu) again. 8. Inject intraperitoneally (IP) with the saline cocktail carrying CTZ or BBLue2.3. 9. Obtain the corresponding supine images with an animal imaging system (Lago X spectral imaging instruments) equipped with a 659 nm long-pass filter and analyze with a specific image analyzing software (Aura ver 2.2.0).

3.11 Bioluminescence Imaging of Tumor Xenografts Expressing iRFP-RLuc8.6SG in Mouse (See Fig. 3c)

1. Seed the MDA-MB-231 cells stably expressing RLuc8.6535SG or iRFP-RLuc8.6-535SG in 10-cm cell culture dishes and incubate until the cells reach 90% confluence. 2. Trypsinize and harvest the cells and resuspend in a PBS buffer. 3. Count the cells concentrations using a cell counter.

256

Ryo Nishihara et al.

Fig. 3 (a) The BL image of living MDA-MB-231 cells expressing iRFP-RLuc8.6-535SG with representative CTZ analogues. The magnified image of the region of interest (ROI) highlights the individual cells at the 10-cell spot. ROI means a region of interest. (b) The BL image of mice bearing tumor xenografts of MDA-MB-231 cells stably expressing RLuc8.6-535SG (upper) or iRFP-RLuc8.6-535SG (lower) under a 659 nm LP filter. (c) Comparison of the tissue permeability of the NIR BL signals in animal models bearing tumor xenografts of MDA-MB-231 cells stably expressing RLuc8.6-535SG (left flank) or iRFP-RLuc8.6-535SG (right flank) (n ¼ 5). The relative optical intensities were summarized in the bar graph in the right panel. (d) The ex vivo images of the tumor xenografts and the liver tissues under open or 659 nm long-pass (695 nm LP) filters. The red arrows indicate the metastasis in liver

4. Implant 5  106 cells stably expressing RLuc8.6SG or iRFPRLuc8.6SG subcutaneously (s.c.) on the left or right flank of the hind limbs of living NSG mice on day 0. 5. House the mice in a cage for 2 weeks until the tumors grew to a size in the range 150–250 mm3. 6. Prepare substrate solutions: that is, 50 μg of BBlue2.3 in 100 μL saline cocktail supplemented with 35% PEG400 and 10% ethanol (n ¼ 3). 7. To image the tumors, anesthetize the mice by standard gas anesthesia method (2% isoflurane with oxygen flow of 0.8–1 L/min) and IP inject with 100 μL of the substrate solution.

NIR-BRET Imaging for Mammalian Cells

257

8. Capture the corresponding BL images of the tumor xenografts in prone or supine position with an animal imaging system (Lago X spectral imaging instruments) equipped with open or a 659 nm long-pass filter. 9. To quantify the number of emitted photons, draw regions of interest (ROI) over the area of the tumors, and record the maximum photons per second per square centimeter per steradian (p/s/cm2/sr) using the specific software Aura (ver 2.2.0). 3.12 Ex Vivo Imaging of Tumor Xenografts Expressing iRFP-RLuc8.6SG (See Fig. 3d)

1. Further house the mice used in Subheading 3.11 for 3 more weeks until the tumor metastasizes into different organs. 2. Sacrifice the mice and extract the tumor tissues on each flank and tissues of other organs (liver, lungs, heart, kidney, and spleen). 3. Display the tumor and tissues of organs on a rectangular microdish. 4. Prepare substrate solutions: that is, 50 μg of BBlue2.3 in 100 μL saline cocktail supplemented with 35% PEG400 and 10% ethanol (n ¼ 3). 5. Immerse the tissues with an aliquot of the substrate solution. 6. Immediately determine the optical images with an image analyzer (Lago X spectral imaging instruments) and analyze with the specific software, Aura (ver 2.2.0).

4

Notes 1. The cDNA sequence information of the individual fragments, that is, iRFP, Renilla luciferase 8.6-535SG (RLuc8.6-535SG), the ligand-binding domain of human estrogen receptor (ER-LBD), can be obtained from the public databases, such as National Center for Biotechnology Information (NCBI), USA. 2. The linker length can extend through modifying the primer lengths or conducting multiple PCR reactions. 3. pcDNA3.1(+) vector was used for transient expression of the probes, whereas pHAGE-UBI-dTomato-CMV-MCS was a lentiviral vector used for establishing stable cell lines. 4. We recommend storing CTZ and its analogues at 30  C in the solid state and protect from light before use because it is easily decomposed in an aerobic condition. In case they are stored as ethanol stock solution, a trace of HCl enhances the chemical stability.

258

Ryo Nishihara et al.

5. As the bioluminescence intensities decay rapidly, we recommend a spectrophotometer acquiring whole wavelength light for accuracy. 6. Some lysis buffers in market can comprise detergents that can hamper the luciferase activities. It is recommended to check it beforehand. 7. High DMSO ratios in buffers can cause autoluminescence by enhancing the membrane permeability-associated rapid intracellular entry of substrates. We recommend reducing DMSO below 0.1% to avoid nonspecific signal. 8. For steroid hormones, incubation of 20 min is optimal. During the incubation time, the steroid is passively diffused into the cellular compartments of the live cells and reaches the plateau. 9. As CTZ analogues have one or two hydroxy groups, deprotonation of the hydroxy groups in a basic condition can hamper the plasma membrane permeation of live cells. A substrate solution with weak acidic pH is recommended for BL imaging of live cells. 10. All animal handling has to adhere to a corresponding guidance of the authority for the care and use of laboratory animals. 11. Mice need to stay calm for at least 1 day for reducing their stress and anxiety before experiments. 12. Some CTZ analogues have poor aqueous solubility and suffer by precipitation. Recommended is a saline cocktail supplemented with 35% polyethylene glycol 400 (PEG400) and 10% ethanol as a final concentration.

Acknowledgments This work was partly supported by JSPS KAKENHI Grants: Numbers 26288088, 15KK0029, 17H01215, 21H04948, and 24225001. Parts of this work are reproduced from [14] with permission. References 1. Close DM, Xu TT, Sayler GS, Ripp S (2011) In vivo bioluminescent imaging (BLI): noninvasive visualization and interrogation of biological processes in living animals. Sensors (Basel) 11(1):180–206 2. Thorne N, Inglese J, Auldl DS (2010) Illuminating insights into firefly luciferase and other bioluminescent reporters used in chemical biology. Chem Biol 17(6):646–657 3. Prescher JA, Contag CH (2010) Guided by the light: visualizing biomolecular processes in living animals with bioluminescence. Curr Opin

Chem Biol 14(1):80–89. https://doi.org/10. 1016/j.cbpa.2009.11.001. S1367-5931(09) 00183-5 [pii] 4. Ozawa T, Yoshimura H, Kim SB (2013) Advances in fluorescence and bioluminescence imaging. Anal Chem 85(2):590–609. https:// doi.org/10.1021/Ac3031724 5. Hoshino H, Nakajima Y, Ohmiya Y (2007) Luciferase-YFP fusion tag with enhanced emission for single-cell luminescence imaging. Nat Methods 4(8):637–639

NIR-BRET Imaging for Mammalian Cells 6. Kojima R, Takakura H, Ozawa T, Tada Y, Nagano T, Urano Y (2013) Rational design and development of near-infrared-emitting firefly luciferins available in vivo. Angew Chem Int Ed Engl 52(4):1175–1179. https://doi.org/10.1002/anie.201205151 7. Saito K, Chang YF, Horikawa K, Hatsugai N, Higuchi Y, Hashida M, Yoshida Y, Matsuda T, Arai Y, Nagai T (2012) Luminescent proteins for high-speed single-cell and whole-body imaging. Nat Commun 3:1262. https://doi. org/10.1038/Ncomms2248 8. Suzuki K, Kimura T, Shinoda H, Bai GR, Daniels MJ, Arai Y, Nakano M, Nagai T (2016) Five-colour variants of bright luminescent protein for real-time multicolour bioimaging. Nat Commun 7:13718 9. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T (2015) Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Proc Natl Acad Sci U S A 112(14):4352–4356 10. Nishihara R, Suzuki H, Hoshino E, Suganuma S, Sato M, Saitoh T, Nishiyama S, Iwasawa N, Citterioa D, Suzuki K (2014) Bioluminescent coelenterazine derivatives with

259

imidazopyrazinone C-6 extended substitution. Chem Commun 51:391–394 11. Filonov GS, Piatkevich KD, Ting LM, Zhang JH, Kim K, Verkhusha VV (2011) Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat Biotechnol 29(8):757 12. Yu D, Gustafson WC, Han C, Lafaye C, Noirclerc-Savoye M, Ge WP, Thayer DA, Huang H, Kornberg TB, Royant A, Jan LY, Jan YN, Weiss WA, Shu XK (2014) An improved monomeric-infrared fluorescent protein for neuronal and tumour brain imaging. Nat Commun 5:3626 13. Rumyantsev KA, Turoverov KK, Verkhusha VV (2016) Near-infrared bioluminescent proteins for two-color multimodal imaging. Sci Rep 6:36588. https://doi.org/10.1038/ srep36588 14. Nishihara R, Paulmurugan R, Nakajima T, Yamamoto E, Natarajan A, Afjei R, Hiruta Y, Iwasawa N, Nishiyama S, Citterio D, Sato M, Kim SB, Suzuki K (2019) Highly bright and stable NIR-BRET with blue-shifted coelenterazine derivatives for deep-tissue imaging of molecular events in vivo. Theranostics 9 (9):2646–2661. https://doi.org/10.7150/ thno.32219

Chapter 22 Ligand-Activatable BRET9 Probes for Imaging Molecular Events in Living Mammalian Cells Sung-Bae Kim, Rika Fujii, and Ramasamy Paulmurugan Abstract Bioluminescence resonance energy transfer (BRET) is a commonly used assay system for studying proteinprotein interactions. The present protocol introduces a conceptually unique ligand-activatable BRET system (termed BRET9), where a full-length artificial luciferase variant 23 (ALuc23), acting as the energy donor, is sandwiched in between a protein pair of interest, FRB and FKBP, and further linked to a fluorescent protein as the energy acceptor for studying protein-protein interaction. A specific ligand, rapamycin, which initiates intramolecular interactions of FRB and FKBP inside the probe, which develops molecular strain in the sandwiched ALuc23 to complete its folding, thus, the probe system greatly enhances both the overall bioluminescence (BL) spectrum and the BRET signal in the far-red (FR) region. This new BRET system provides a robust ligand-activatable platform that efficiently reports FR-BL signals in mammalian cells. Key words Protein–protein interactions, Artificial luciferase, Bioluminescence, In vitro assay, Bioluminescence resonance energy transfer

1

Introduction Fluorescence (FL) and bioluminescence (BL) resonance energy transfer (F/BRET) assay systems have been broadly utilized for imaging intracellular protein-protein interactions (PPIs) [1, 2]. To date, many versions of BRET systems have been reported with varying designations starting from BRET1 to BRET8 [3, 4]. However, only a few BRET combinations comprising successful donor and acceptor pairs have been effectively utilized in practice. Renilla luciferase (RLuc) and its variants have been the widely used energy donors of the most successful BRET systems. Gaussia luciferase (GLuc), NanoLuc, and Cypridina (Vargula) luciferase (VLuc) have also been reported as energy donors in many BRET assays [5–8]. While these advanced BRET systems have been modified for animal imaging modalities, they still have fundamental issues

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_22, © Springer Science+Business Media, LLC, part of Springer Nature 2021

261

262

Sung-Bae Kim et al.

requiring attention and further improvements. BRET systems intrinsically necessitate sufficient overlap between the donor emission and acceptor excitation spectra for efficient energy transfer. However, this proximity inevitably raises the overall background intensity as well as the optical cross talk between the spectra. The present protocol addresses this shortcoming by engineering a ligand-activatable BRET imaging probe for measuring PPIs in animal models. The energy donor is designed to carry a full-length artificial luciferase variant 23 (named ALuc23 and A23) sandwiched between two proteins of interest under study for their interaction, that is, FRB and FKBP12. The probe further linked to a far-red (FR)-emitting fluorescent protein (FP) acting as the energy acceptor in the BRET system. The ALuc23 inside the fusion protein remains incompletely folded due to the tension created by the attached proteins, and thus the initial background BL intensity is low. Once rapamycin activates the FRB-FKBP12 interaction, the tensed ALuc23 inside the probe dramatically completes its folding, which enhances both the overall spectral BL intensities and BRET signal in the FR region. The present protocol exemplifies the performance of this probe and its optical spectra in vitro, and then shows its use in imaging rapamycin-induced FRB-FKBP12 interaction in living animal model.

2

Materials

2.1 Reagents and Lab Supplies

1. cDNA templates encoding FKBP-rapamycin-binding domain of mTOR (FRB, 94 aa, PDB: 1AUE_A)), artificial luciferase 23 (ALuc 23, GenBank: MF817968), and FK506-binding protein (FKBP12, 109 aa, GenBank: AAP36774). 2. cDNA templates encoding FPs: that is, mCherry (mChe), mNeptune (mNep), mOrange (mOrg), mPlum, and mRasberry (mRasb). 3. Restriction enzymes: that is, NheI, BamHI, AgeI, KpnI, XhoI, and XbaI. Primer sets for polymerase chain reactions (PCR): NheI/ BamHI or AgeI/BamHI sites at the ends of the gene encoding FRB; BamHI/KpnI sites at the ends of the gene encoding ALuc23; KpnI/XhoI or XhoI/XbaI sites at the ends of the gene encoding FKBP12; and XhoI/XbaI, KpnI/XhoI or NheI/AgeI sites at the ends of the cDNA fragment encoding each FP. 4. Ligation kit. 5. pHAGE-UBI-dTomato-CMV-MCS vector expressing pseudotyped glycoprotein of lentivirus. 6. pcDNA3.1(+) puromycin vector.

BRET9 Probes for Live Cell Imaging

263

7. VPR: viral protein R. 8. Lipofection reagent (TransIT-LT1). 9. Rapamycin (Rapa). 10. Passive lysis buffer (Promega). 11. PBS buffer, pH 5.8. 12. Native coelenterazine (CTZ). 13. HEK293T cells (NCBI). 14. MDA-MB-231 cells (NCBI). 15. Culture media: Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and a mixture of penicillin and streptomycin (P/S). 16. BALB/c nude mice. 17. Polyethylene glycol (PEG400). 18. Dimethyl sulfoxide (DMSO). 19. 6-well cell culture plates. 20. 10-cm cell culture dishes. 21. 96-well black-frame clear-bottom microplate. 22. Alcohol. 23. Trypsine. 24. Martigel. 2.2

Instrumentations

1. Thermal cycler. 2. Genetic sequence analyzer. 3. CO2 incubator. 4. IVIS Lumina II imaging system equipped with a Cy5.5 bandpass filter. 5. Microplate reader equipped with a series of band-pass filters ranging from 398 nm to 653 nm in 15 nm increments. 6. Lago in vivo Instruments).

2.3

Software

imaging

instrument

(Spectral

Imaging

1. Living Image 4.5.5 (Caliper). 2. Prism 8.0.1 (Graphpad). 3. Aura Ver. 2.2.0 (Spectral Instruments Imaging).

3

Methods

3.1 Construction of a Series of Plasmid Vectors Encoding BRET9 Probes

1. Prepare cDNA templates encoding the following proteins: FRB, ALuc23, FKBP12, and the FPs: that is, mCherry (mChe), mNeptune (mNep), mOrange (mOrg), mPlum, and mRasberry (mRasb) (see Note 1).

264

Sung-Bae Kim et al.

Fig. 1 (a) Schematic illustration of cDNA constructs encoding the BRET probes. The right panel shows the corresponding working mechanisms after expression of TP2.4 in response to rapamycin. FP fluorescent protein, ALuc23 artificial luciferase variant 23, mOrg mOrange, mRas mRasberry, mChe mCherry, mNep mNeptune, Rapa rapamycin. (b) The excitation and emission spectra of fluorescent proteins (lines), which were superimposed on the emission spectrum of ALuc23 (blue shadows). The far-red (FR) region was marked with a reddish shadow. (Reprinted from Kim et al. (2020) [9] with permission from The Royal Society of Chemistry)

2. Draw a blueprint to specify the whole cDNA sequences of the constructs as shown in Fig. 1a. 3. Generate all the cDNA fragments by PCR with appropriate primer sets to introduce unique restriction sites at the 50 and 30 ends. 4. Digest the corresponding cDNA blocks with the respective restriction enzymes, purify, and ligate into the corresponding restriction enzyme-digested mammalian expression vector (pcDNA3.1(+)-Puro vector). 5. Name the expressed single-chain probes as version 1 (v1)_ [abbreviation of FP], version 2 (v2)_[abbreviation of FP], or version 3 (v3)_[abbreviation of FP] according to the category number and the FP name. 6. Ensure the fidelity of all the cDNA constructs by testing with a genetic sequence analyzer (Eurofins genomics).

BRET9 Probes for Live Cell Imaging

(B) Spectra transiently Transfected

80 60

Rapa

40

3x10 p/s/cm/sr

wavelength (nm)

BL 14 Bluev2_mChe (-) v2_mChe (+) 12 v2_mPlum (-) v2_mPlum (+) 10 8 6 4 2 0

BRET 12%

413 443 473 503 533 563 593 623 653

7x10 3x10

Red 11% BRET

413 443 473 503 533 563 593 623 653

0

FWHM = 90 nm

veh

20

a BRET

3x10

TP2.4 (-) TP2.4 (+) v2_mChe (-) v2_mChe (+) v2_mPlum (-) v2_mPlum (+)

Blue 120 4% 100

percentage (%)

FRB-A23 + FKBP-mPlumv1_mOrgv1_mRasv1_mChev1_mNepv1_mPlumv2_mOrgv2_mRasv2_mChev2_mNepv2_mPlumv3_mOrgv3_mRasv3_mChev3_mNepv3_mPlum-

Cy5.5 filter Open filter Rapa (-) Rapa (+) Rapa (-) Rapa (+)

Relative intensity (%)

(A) Optical Images with MDA-MB231 cells

265

wavelength (nm)

Fig. 2 (a) The absolute BL image of BRET9 probes transiently expressed in MDA-MB-231 cells (n ¼ 3). The left image was obtained with an open filter, whereas the right image was obtained with a Cy5.5 band-pass filter (695 – 770 nm). The Rapa (+) and () denote the presence or absence of rapamycin, respectively. (b) The BL spectra of MDA-MB-231 cells transiently expressing TP2.4, v2_mChe, or v2_mPlum in the presence or absence of rapamycin (106 M). FWHM full width at half maximum (n ¼ 3). Inset “a” highlights the contribution of BRET in the spectra of (b). The spectra show the percentage gaps after subtraction of the spectrum intensity of TP2.4 from that of v2_mPlum or v2_mChe. The peak of v2_mChe shifts from blue (~500 nm) to red (~620 nm) in the presence of rapamycin (n ¼ 3). The signs (+) and () means the presence and absence of rapamycin, respectively. (Reprinted from Kim et al. (2020) [9] with permission from The Royal Society of Chemistry) 3.2 Characterization of BRET9 Series Probes in the Presence or Absence of Rapamycin (See Fig. 2a)

1. Culture MDA-MB-231 cells in 6-well culture plates (Nunc) and incubate until they reach 80% confluency. 2. Transiently transfect the cells with a lipofection cocktail (TransIT-LT1) dissolving each plasmid encoding (1) category 1 probe, (2) category 2 probe, or (3) category 3 probe. 3. Incubate the cells for 1 day. 4. Trypsinize and harvest the cells and subculture them in 96-well black-frame clear-bottom microplates, and incubate overnight. 5. Stimulate the cells with vehicle (0.1% alcohol) or 106 M rapamycin for 5 h (see Note 2).

266

Sung-Bae Kim et al.

6. Lyse the cells with an aliquot of a commercial passive lysis buffer (50 μL) (Promega) for 20 min. 7. Prepare the substrate solution through dissolving CTZ with an aliquot of a PBS buffer (pH 5.8) (final concentration ¼ 10 μg/ mL). 8. Inject the substrate solution into the lysates in a fresh 96-well black-frame clear-bottom microplate using a multichannel micropipette (see Note 3). 9. Immediately determine the corresponding optical intensities using an IVIS Lumina II imaging system equipped with open and Cy5.5 band-pass filters (Caliper). 10. Analyze the BL images using the Live Image 4.5.5 analysis software (Caliper). 3.3 Determination of the Bioluminescence Spectra of v2_mChe and v2_mPlum in the Presence of Rapamycin (See Fig. 2b)

1. Culture MDA-MB-231 cells in a 6-well cell culture plates and incubate until they reach 80% confluency. 2. Transiently transfect the cells with a lipofection reagent dissolving each plasmid encoding (1) v2_mChe, (2) v2_mPlum, or (3) Tension Probe 2.4 (TP2.4) as a control. 3. Incubate the cells for 1 day. 4. Trypsinize and harvest the cells and subculture them in 96-well black-frame clear-bottom microplates, and incubate overnight. 5. Lyse the cells in the microplate using 40 μL of a lysis buffer. 6. Prepare the substrate solution through dissolving CTZ with a PBS buffer (pH 5.8) (final concentration ¼ 10 μg/mL). 7. Simultaneously inject 40 μL of the substrate solution into the microplate using a multichannel micropipette. 8. Determine the BL spectra with a microplate reader equipped with a series of band-pass filters (Spark 10 M, TECAN) with various revolving optical filters ranging from 398 nm to 653 nm in 15 nm increments (each filter has a 15 nm bandpass window). The integration time per filter is 1 s (see Note 4). 9. Subtract the intensities of v2_mChe or v2_mPlum by the intensities of TP2.4 at each wavelength range to confirm the contribution of BRET (see Note 5).

3.4 Establishment of MDA-MB-231 Cells Stably Expressing the Control and Acting Probes

1. For creating lentiviral vectors, first digest and purify the cDNA fragments encoding TP2.4 and v2_mChe from the pcDNA3.1 (+) vectors encoding the constructs using NheI/XhoI or NheI/ XbaI restriction enzymes (see Note 6). 2. Separately, prepare pHAGE-UBI-dTomato-CMV-MCS vector digested with NheI/XhoI or NheI/XbaI restriction enzymes. 3. Ligate the dissected cDNA fragments encoding v2_mChe into the pHAGE-UBI-dTomato-CMV-MCS vector.

BRET9 Probes for Live Cell Imaging

267

4. Confirm the sequential fidelity of the vectors using a genetic sequence analyzer. 5. Produce respective lentiviral stock expressing v2_mChe by cotransfecting HEK293T cells with three-vector transfection system (i.e., pHAGE-UBI-dTomato-CMV vector with v2_mChe, VPR, and VSVG) by adopting the calcium phosphate transfection method for producing lentivirus. 6. Obtain the concentrated pure virus after titration to generate various stable cell lines by transduction. 7. After three continuous passages, FACS sorts the cells for clonal populations of cells having uniform expression. 8. Culture the screened cells in a 10-cm cell culture dishes. 9. Finally, name them as v2_mChe clones #1 and #2, respectively. 3.5 Determination of Rapamycin Dose-Response Curves Using MDA-MB-231 Cells Stably Expressing v2_mChe Clones #1 and #2 (See Fig. 3a)

1. Seed the MDA-MB-231 cells stably expressing v2_mChe clones #1 or #2 in 96-well black-frame clear-bottom microplates at a concentration of 5000 cells/well in 100 μL complete medium, and incubate for 1 day. 2. Replace the culture media in the plate with a fresh medium dissolving varying concentrations of rapamycin ranging from 109.5 M to 106.5 M or the vehicle (0.1% alcohol) and incubate further for 5 h. 3. After removal of the culture media, lyse the cells using 40 μL of passive lysis buffer (Promega) for 20 min. 4. Prepare the substrate solution through dissolving CTZ in a PBS buffer, pH 5.8 (final concentration ¼ 10 μg/mL). 5. Determine the corresponding BL intensities using the IVIS Lumina II imaging system (Caliper) after injection of 40μL of the substrate solution. 6. Analyze the corresponding calibration curves using the specific software Live Image 4.5.5 (Caliper) and Prism 8.0.1 (GraphPad).

3.6 In Vivo BL Imaging of Rapamycin Recognition of v2_mChe in Living Mice

1. Purchase 8-week-old female BALB/c nude mice from a laboratory animal provider (Charles River, Wilmington). 2. House five animals in each cage under a light-dark (12 h/12 h) cycle with ad libitum access to water and food. 3. Separately culture MDA-MB-231 cells stably expressing v2_mChe or TP2.4 in 10 cm culture dishes. 4. Trypsinize and harvest the cells, and suspend the cells in 50 μL of PBS and mix with 50 μL Matrigel. 5. Anesthetize the mice under inhalation anesthesia induced by a 4% (and maintained by 2.3%) mixture of isoflurane in oxygen administered through nose cones.

268

Sung-Bae Kim et al.

Fig. 3 Characterization of MDA-MB-231 cells stably expressing v2_mChe clones #1 and #2. (a) Rapamycin dose-response curves of MDA-MB-231 cells stably expressing v2_mChe clones #1 and #2. Inset “a” shows the corresponding optical images. (b) Molecular imaging of mice carrying xenografts of MDA-MB-231 cells stably expressing v2_mChe (right tumor site of each mouse) and its control, TP2.4 (left tumor site of each mouse). In both tumors, dTomato expressed under a ubiquitin promoter served as a tumor volume/viability reporter. FL images were obtained for measuring tumor volume/viability, while BL images were obtained for determining rapamycin-activatable BRET signals (n ¼ 3). (c) The statistical analysis of the BL images of mice. Three and two mice groups were allocated to rapamycin and vehicle stimulation, respectively. Inset “a” highlights the structural differences between TP2.4 and v2_mChe, and the working mechanism of v2_mChe. The p-value (student’s T-test) is ∗ ∗  0.01. (Reprinted from Kim et al. (2020) [9] with permission from The Royal Society of Chemistry)

6. Implant subcutaneously (s.c.) the MDA-MB-231 cells stably expressing v2_mChe or TP2.4 on either lower flank of the mice on day 0 (5  106 cells in 50 μL PBS plus 50 μL medium growth factor Matrigel). 7. Wait for 2 weeks until the tumors grew to a size in the range 150 – 250 mm3. Approximately, on day 14, randomly divide the mice to acting and reference groups. 8. Stimulate the three mice in the acting group with 100 μg rapamycin dissolved in 100 μL of a physiological saline containing 20% PEG400 cocktail and inject i.p., whereas the two mice in the reference group are injected with the same amount of the cocktail carrying vehicle (1% DMSO and 10% PEG400). 9. Store the mice further for 16 h. 10. Prepare the substrate solution through dissolving CTZ in a PBS solution, pH 5.8 (50 μg nCTZ in 100 μL PBS).

BRET9 Probes for Live Cell Imaging

269

11. Anesthetize the mice using standard gas anesthesia (2% isoflurane, with oxygen at 0.8–1.0 L/min) and are i.v. injected with the substrate solution. 12. Acquire the corresponding BL images of the tumor xenografts in the prone position using the Lago instrument (Spectral Imaging Instruments). 13. As a control for determining the tumor size of each xenograft in mice, obtain FL images using the Lago instrument (Spectral Instruments Imaging) under the setting of 535 nm excitation for dTomato signal and 610 nm emission acquisition (see Note 7). 14. To quantify the number of emitted photons, draw ROI over the tumors and generate the maximum photons per second per square centimeter per steradian (p/s/cm2/sr) using the specific software, Aura (ver 2.2.0).

4

Notes 1. The cDNA templates can be synthesized by custom-ordering to a genomic service provider. 2. Incubation of rapamycin for more than 4 h is recommended for sufficient diffusion into the cells. 3. A black-frame microplate is highly recommended for minimizing the background BL intensities, reflection, and well-to-well diffusion of signal. 4. The BL spectra can be determined with any other instrumentation for capturing BL spectra, including spectrophotometers besides the microplate reader. 5. The only difference between TP2.4 and the other constructs is whether it has a FP or not. One may calculate the contribution of BRET with FP through simply subtracting the spectrum of TP2.4 from the whole spectrum. 6. Mammalian cell lines stably expressing TP2.4 or v2_mChe need to be established for more quantitative evaluation of the BL intensities and animal studies. 7. The cell numbers in the tumor sites can be easily estimated with the fluorescence intensity. It is because the cells stably expressing dTomato using pHAGE-UBI-dTomato-CMV-MCS vector were used for the study.

270

Sung-Bae Kim et al.

Acknowledgments This work was partly supported by JSPS KAKENHI Grants: Numbers 26288088, 15KK0029, 17H01215, 21H04948, and 24225001. References 1. Ozawa T, Yoshimura H, Kim SB (2013) Advances in fluorescence and bioluminescence imaging. Anal Chem 85(2):590–609. https:// doi.org/10.1021/Ac3031724 2. Okamoto K, Sako Y (2017) Recent advances in FRET for the study of protein interactions and dynamics. Curr Opin Struct Biol 46:16–23. https://doi.org/10.1016/j.sbi.2017.03.010 3. Dragulescu-Andrasi A, Chan CT, De A, Massoud TF, Gambhir SS (2011) Bioluminescence resonance energy transfer (BRET) imaging of protein-protein interactions within deep tissues of living subjects. Proc Natl Acad Sci U S A 108 (29):12060–12065. https://doi.org/10.1073/ pnas.1100923108 4. Sun SH, Yang XB, Wang Y, Shen XH (2016) In vivo analysis of protein-protein interactions with bioluminescence resonance energy transfer (BRET): Progress and prospects. Int J Mol Sci 17(10):1704 5. Li FY, Yu JP, Zhang ZP, Cui ZQ, Wang DB, Wei HP, Zhang XE (2013) Use of hGluc/tdTomato pair for sensitive BRET-sensing of protease with high solution media tolerance. Talanta 109:141–146

6. Machleidt T, Woodroofe CC, Schwinn MK, Mendez J, Robers MB, Zirnmerman K, Otto P, Daniels DL, Kirkland TA, Wood KV (2015) NanoBRET-A novel BRET platform for the analysis of protein-protein interactions. ACS Chem Biol 10(8):1797–1804 7. Otsuji T, Okuda-Ashitaka E, Kojima S, Akiyama H, Ito S, Ohmiya Y (2004) Monitoring for dynamic biological processing by intramolecular bioluminescence resonance energy transfer system using secreted luciferase. Anal Biochem 329(2):230–237 8. Hiblot J, Yu QLY, Sabbadini MDB, Reymond L, Xue L, Schena A, Sallin O, Hill N, Griss R, Johnsson K (2017) Luciferases with tunable emission wavelengths. Angew Chem Int Ed 56(46):14556–14560 9. Kim SB, Fujii R, Natarajan A, Massoud TF, Paulmurugan R (2020) Ligand-activated BRET9 imaging for measuring protein-protein interactions in living mice. Chem Commun 56 (2):281–284. https://doi.org/10.1039/ c9cc07634d

Chapter 23 Manipulation of Actin Cytoskeleton by Intracellular-Targeted ROS Generation Tetsuya Ishimoto and Hisashi Mori Abstract A method to generate small amount of reactive oxygen species (ROSs) at intracellular targeted region has great potential to manipulate the function of particular proteins. The present protocol introduces a fusion protein that consisted of firefly luciferase (FLuc), photosensitizer protein KillerRed and F-actin-targeting peptide Lifeact (Lifeact-KillerFirefly) to generate ROSs in the vicinity of F-actin and found that morphological change in F-actin structure was induced by the fusion protein after luciferin treatment. This manipulating and imaging method is of use to analyze the role of the locally generated ROSs on the function of intracellular proteins. Key words Firefly luciferase (FLuc), KillerRed, Reactive oxygen species, Bioluminescence resonance energy transfer, Actin polymerization, Cofilin-actin rod, Photosensitizer protein, HEK293T

1

Introduction Highly demanded is a protocol to manipulate the function of particular protein in the living cells for fundamental biological and applied biomedical researches. Chromophore-assisted light inactivation (CALI) technique is one of the protein-based techniques that generates reactive oxygen species (ROSs) in response to laser irradiation and inactivates the protein or ablates the cells [1]. However, laser in the CALI technique is known to cause phototoxicity, and thus hampers a long-term imaging of the molecular events. To overcome these disadvantages of conventional CALI technique, we developed a new protocol using nontoxic bioluminescence (BL). FLuc is activated by its substrate luciferin (emission maximum of 560 nm) [2, 3]. The luciferase-luciferin reaction has long been used to monitor transcription in vitro and in vivo [4–6]. In the technique we describe here, we fused FLuc with a genetically encoded photosensitizing fluorescent protein, named KillerRed, which was originally developed by mutation of hydrozoan

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_23, © Springer Science+Business Media, LLC, part of Springer Nature 2021

271

272

Tetsuya Ishimoto and Hisashi Mori KillerRed

Firefly luciferase

Red fluorescence Light (540-580 nm)

Light (560 nm) luciferin

O2 O2 KillerFirefly

BRET ①Luciferin-dependent light emission

③ROS generation O 2-

O2-

②Excitation of KillerRed

Fig. 1 Principle of the KillerFirefly. (Upper left) KillerRed protein is a genetically encoded photosensitizing fluorescent protein, which generates ROS when excited by yellow light. (Upper right) FLuc emits light (maximum at 560 nm) depending on luciferin, a substrate molecule. (Lower) Fusion protein, named KillerFirefly, consists of KillerRed and FLuc, which generates ROSs via bioluminescent resonance energy transfer (BRET) from FLuc

chromoprotein anm2CP [7, 8]. KillerRed generates O2
when irradiated by green light and has been used in CALI techniques to kill the cells [9–12]. In the present protocol, we introduce a fusion protein, named KillerFirefly, which is colocalized with F-actin when expressed with fused F-actin-binding peptide Lifeact in human HEK293T cells (see Fig. 1). We further demonstrate that an Factin-targeted generation of ROSs could induce any change in cellular morphology of actin cytoskeleton after luciferin treatment (see Fig. 2).

2

Materials

2.1 Cell Culture, Transfection, and Luciferin Treatment

1. HEK293T cell (see Note 1). 2. Dulbecco’s modified Eagle medium (DMEM) with phenol red (Nacalai). 3. Fetal bovine serum (Gibco): heat inactivated at 56  C for 30 min for usage. 4. Phosphate-buffered saline (PBS): 137 mM NaCl, 8.1 mM Na2HPO4, 2.68 mM KCl, 1.47 mM KH2PO4, pH 7.4. 5. 0.25% trypsin EDTA. 6. 0.2% polyethylenimine (Nacalai).

A New Technique to Generate Local ROS

273

luciferin

O2 O2-

O2 -

O2 -

O2 -

O2 -

luciferin F-actin lifeact

O2 O2 -

O2 -

O2 -

O2-

lifeact

O2 -

7.5μｍ

Fig. 2 Targeted generation of reactive oxygen species in the vicinity of F-actin-upregulated actin polymerization to make rod-like structure (lower right panel). Control experiment without F-actin-binding peptide Lifeact (upper right panel), luciferin (lower left panel), or both (upper left panel) did not

7. Lipofectamine 3000 (Invitrogen) (see Note 2). 8. P3000 solution, which is supplied in Lipofectamine 3000 package. 9. Plastic culture dish (6 cm diameter, Falcon). 10. Glass bottom culture dish (Iwaki) (see Note 3). 11. Plasmid that encodes Lifeact-KillerFirefly (see Note 4). 12. D-Luciferin. 13. Water bath (37  C). 14. CO2 incubator (Sanyo). 15. Hemocytometer. 2.2 Spectrum Measurement

1. 96-well microplate (Nunclon Delta Surface, Thermo Fisher). 2. Cell scraper (Iwaki). 3. BioMasher (Nippi). 4. Tris-buffer:100 mM Tris–HCl pH 8.0. 5. SpectraMax i3 (Molecular devices).

2.3 Cytochemical Staining and Image Acquisition

1. 4% paraformaldehyde/PBS. 2. 1% bovine serum albumin (BSA)/PBS. 3. Confocal microscopy (Leica, TCS-SP5). 4. ActinGreen 488 ReadyProbes reagent (Thermo Fisher). 5. Anti-cofilin monoclonal antibody (Abcam, 1:100). 6. Anti-mouse IgG secondary antibody (Alexa488-conjugated).

274

3

Tetsuya Ishimoto and Hisashi Mori

Methods

3.1 Cell Culture, Transfection, and Luciferin Treatment

1. Cultivate HEK293T cells in 6 cm plastic culture dishes up to 70–80% confluency in prior to the passage. 2. For the stable adhesion of HEK293T cells, add 1 mL of 0.2% polyethylenimine (see Note 5) into glass bottom culture dish and wait for 5 min in the clean bench. 3. After 5 min incubation, wash the dish with 2 mL of distilled water for ten times to completely remove remaining polyethylenimine. 4. Then dry the dishes in the clean bench. 5. Trypsinize the HEK293T cell on the plastic culture dishes in step 1 by incubating with 0.25% trypsin EDTA for 2 min in the clean bench at room temperature (RT). 6. After removing the trypsin solution, add 5 mL of DMEM supplemented with 10% FBS to inactivate trypsin and suspend the cells by gentle pipetting. 7. Centrifuge the cell suspension (200  g, 3 min) and discard the supernatant to remove remaining trypsin. 8. Resuspend the cells with 2 mL of DMEM supplemented with 10% FBS and count the cell number using hemocytometer (see Note 6). 9. Sow the HEK293T cells on the polyethylenimine-coated glass bottom culture dish (1.0  105/dish) with 2 mL of DMEM supplemented with 10% FBS and incubate at 37  C in 5% CO2. 10. Transfect the cells with the plasmid encoding LifeactKillerFirefly (see Note 7) using Lipofectamine 3000 for 24 h after sowing HEK293T cells according to the following procedures: (1) Add 3.75 μL of Lipofectamine 3000 reagent in 125 μL of Opti-MEM and mix well (solution 1). (2) Dilute 2.5 μg of plasmid DNA in the 125 μL of Opti-MEM. Then, (3) add 5 μL of P3000 reagent to the DNA diluent and mix well (solution 2). 11. Mix these two solutions 1 and 2 well and incubate for 20 min at RT. 12. Add DNA-lipofectamine 3000 complex solution to the cells. 13. Forty eight hours after transfection, add luciferin (2 mM) and continue to incubate for 24 h to induce BL, followed by ROS generation in the vicinity of F-actin (see Note 8). 14. (Optional) If you do not need spectrum measurement, skip the “Subheading 3.2”.

A New Technique to Generate Local ROS

3.2 Spectrum Measurement

275

1. Harvest KillerFirefly-expressing HEK293T using a cell scraper and homogenize them using BioMasher in a Tris–HCl buffer (100 mM, pH 8.0) (see Note 9). 2. Transfer the Lifeact-KillerFirefly protein to a 96-well microplate, then add an aliquot of D-luciferin (final concentration: 1 mM) to each well. 3. Measure the spectra using SpectraMax i3 and calculate the corresponding BRET ratios (emission at 610 nm/emission at 560 nm) (see Note 10).

3.3 Cytochemical Staining and Image Acquisition

1. If additional staining to Lifeact-KillerFirefly imaging is required, fix the HEK293T cells with 4% paraformaldehyde in PBS for 10 min at RT and wash twice with PBS (see Note 11). 2. For the endogenous F-actin staining, dilute ActinGreen 488 ReadyProbes reagent 20 times with a PBS buffer and incubate the fixed cells in the step 1 with the diluent at RT for 30 min (see Note 12). 3. For the cofilin immunostaining, dilute the primary antibody against cofilin with PBS supplemented with 1% BSA. 4. Incubate the fixed cells with the antibody solution at 4  C for 12 h (see Note 12). 5. Replace the antibody solution to PBS and incubate for 10 min. Repeat this process once again. 6. Then incubate the cells with Alexa488-conjugated secondary antibody (1:500) in the PBS supplemented with 1% BSA for 1 h at RT (see Note 12). After the staining, replace the staining solution with PBS. 7. Acquire fluorescence images using a laser confocal microscopy system (see Note 13). Analyze the data using a specific software of the microscopy system (Leica application suite).

4

Notes 1. In addition to HEK293T cells, we observed an increase in actin polymerization in HeLa and CHO cells, which was induced by the Lifeact-KillerFirefly and luciferin treatment. This result suggests that KillerFirefly has an effect on actin polymerization, which is common to many cell types. It is recommended to use Lipofectamine 3000 (Invitrogen) and Trans-IT CHO (Mirus) for the transfection of HeLa and CHO cells, respectively. 2. HEK293T cells have high transfection efficiency (~90%) with Lipofectamine 3000. The other transfection agents but Lipofectamine 3000 may cause structurally changed images in actin cytoskeleton. 3. As HEK293T cells are less adhesive on glass bottom culture dishes than plastic, a surface coating step may be necessary

276

Tetsuya Ishimoto and Hisashi Mori

beforehand in case of glass bottom culture dishes. The glass area is centered in the dishes and surrounded by a plastic area. There are two types of center glasses (12 mm and 27 mm). We used 12 mm center-type culture dishes for the imaging experiments because it can minimize the staining solution volume. 4. For the construction of the plasmid, the cDNA fragment of FLuc (luc2, Promega) was subcloned into the 30 -terminus of KillerRed mammalian-expressing vector (pKillerRed-N, Evrogen) using conventional gene ligation techniques. And the cDNA fragment encoding the F-actin-binding peptide (Lifeact: MGVADLIKKFESISKEE ) was genetically fused to the 50 -terminal of the cDNA encoding KillerFirefly, a fusion protein of the FLuc and KillerRed. The plasmid is available on request. 5. Prepare 2% stock solution of polyethylenimine and filter it using a 0.4-μm pore filter. Dilute the stock solution with water to constitute 0.1% prior to use. The stock solution may be stored at 4  C. 6. Resuspend the HEK293T cells by pipetting ten times using a P1000 micropipette. However, avoid too much pipetting for the good viability of the cells. 7. In this chapter, the effect of local ROS generation by KillerFirefly is exemplified using a Lifeact peptide, which is an Factin-localizing tag. Through choosing other peptide tags that are known as cell-localization signals, intracellular ROS generation is regionally controllable. For example, we showed the images of nuclear and mitochondria localization of KillerFirefly in the previous paper [13]. SuperNova, a monomer-type photosensitizer protein [14], which was developed by point mutation of KillerRed, can be used for this KillerFirefly technique instead of KillerRed. We previously confirmed that fusion protein consisting of SuperNova and FLuc works in HEK293T cells. We used a combination of KillerRed and FLuc for the KillerFirefly technique. Other combination of photosensitizer and luciferase may be available to generate ROS at specific intracellular compartments. For example, as miniSOG [15] is a photosensitizer protein, which is excited by blue light, a fusion protein of miniSOG with a blue light-emitting luciferase, such as Renilla luciferase, may work. 8. In this study, 2 mM of D-luciferin was used to generate ROS. It is considered that the ROS generation levels are proportional to the concentration of D-luciferin. This view suggests that the level of the change in actin cytoskeleton is controllable by the concentration of D-luciferin.

A New Technique to Generate Local ROS

277

9. The spectrum of the FLuc is easily affected by pH. Therefore, 100 mM Tris–HCl buffer is recommended for the spectrum measurement with stabilized pH. 10. The BRET ratio was calculated using the intensity of the emission peak of KillerRed (610 nm) and that of the FLuc (560 nm). We observed that the shape of the spectra emitted by KillerFirefly is changed after D-luciferin treatment [13]. This result confirms that ROS is generated by KillerFirefly via the BRET effect after D-luciferin treatment. However, the efficiency of the BRET effect is lower than the other BRET probes previously reported [16]. We constructed several proteins similar to LifeactKillerFirefly as described in this chapter by swapping the location of KillerRed and FLuc or by inserting linker sequences between KillerRed and FLuc. However, we did not find a remarkable increase in the BRET ratio, comparing to that of the original Lifeact-KillerFirefly. 11. If you do not need additional staining, live-cell fluorescent imaging of Lifeact-KillerFirefly can be performed after replacement of the culture medium to PBS. 12. A humid plastic chamber or Tupperware with a moist paper towel at the bottom is recommended during the incubation to avoid evaporation. 13. Unlike conventional CALI techniques, a short-period treatment of D-luciferin did not induce any notable changes in the actin structure. This may be interpreted as Lifeact-KillerFirefly emits very little amount of ROS, compared to conventional CALI techniques. A morphological change in the actin structure begins 4 h after D-luciferin treatment. If you have an appropriate device, such as a CO2-controlled stage-top incubation chamber, time-lapse imaging can be performed. In that case, the medium should be phenol red-free. F- and G-actins in the D-luciferin-treated cells can be separated by ultracentrifugation and analyzed by a Western blotting analysis to examine whether F-actin content is upregulated in Lifeact-KillerFirefly-expressing cells after D-luciferin treatment. An assay with Lifeact-KillerFirefly-expressing cells treated with D-luciferin is exemplified in Fig. 3. Only LifeactKillerFirefly (red signal)-expressing cells exhibit a rod-like actin structure. Considering the rod-like structure shown in Fig. 3, which is colocalized with a cofilin signal (Fig. 4), this structure is regarded as a cofilin-actin rod [17–19].

278

Tetsuya Ishimoto and Hisashi Mori

7.5μｍ Fig. 3 Green signal represents endogenous F-actin visualized by ActinGreen. Red signal represents Lifeact-KillerFirefly fluorescence. Rod-like structures of F-actin were seen only in cells expressing Lifeact-KillerFirefly with luciferin (arrows), not in Lifeact-KillerFirefly-absent cells (arrowheads) Cofilin

Lifeact-KillerFirefly

5μｍ

Fig. 4 Localization of cofilin in Lifeact-KillerFirefly-expressing cells after treatment with luciferin. Green and red signals represent cofilin immunoreactivity and Lifeact-KillerFirefly, respectively

Acknowledgments This study was supported by Japan Society for the Promotion of Science (JSPS 16K01912).

A New Technique to Generate Local ROS

279

References 1. Jacobson K, Rajfur Z, Vitriol E, Hahn K (2008) Chromophore-assisted laser inactivation in cell biology. Trends Cell Biol 18:443–450 2. de Wet JR, Wood KV, Helinski DR, DeLuca M (1985) Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc Natl Acad Sci U S A 82:7870–7873 3. Nguyen VT, Morange M, Bensaude O (1988) Firefly luciferase luminescence assays using scintillation counters for quantitation in transfected mammalian cells. Anal Biochem 171:404–408 4. Ishimoto T, Mano H, Mori H (2015) In vivo imaging of CREB phosphorylation in awakemouse brain. Sci Rep 5:9757 5. Maggi A, Ottobrini L, Biserni A, Lucignani G, Ciana P (2004) Techniques: reporter mice: a new way to look at drug action. Trends Pharmacol Sci 25:337–342 6. Izumi H, Ishimoto T, Yamamoto H, Mori H (2019) Bioluminescence imaging of arc expression in mouse brain under acute and chronic exposure to pesticides. Neurotoxicology 71:52–59 7. Bulina ME, Chudakov DM, Britanova OV, Yanushevich YG, Staroverov DB, Chepurnykh TV, Merzlyak EM, Shkrob MA, Lukyanov S, Lukyanov KA (2006) A genetically encoded photosensitizer. Nat Biotechnol 24:95–99 8. Bulina ME, Lukyanov KA, Britanova OV, Onichtchouk D, Lukyanov S, Chudakov DM (2006) Chromophore-assisted light inactivation (CALI) using the phototoxic fluorescent protein KillerRed. Nat Protoc 1:947–953 9. Williams DC, Bejjani RE, Ramirez PM, Coakley S, Kim SA, Lee H, Wen Q, Samuel A, Lu H, Hilliard MA, Hammarlund M (2013) Rapid and permanent neuronal inactivation in vivo via subcellular generation of reactive oxygen with the use of KillerRed. Cell Rep 5:553–563 10. Kobayashi J, Shidara H, Morisawa Y, Kawakami M, Tanahashi Y, Hotta K, Oka K (2013) A method for selective ablation of

neurons in C. elegans using the phototoxic fluorescent protein, KillerRed. Neurosci Lett 548:261–264 11. Liao ZX, Li YC, Lu HM, Sung HW (2014) A genetically encoded KillerRed protein as an intrinsically generated photosensitizer for photodynamic therapy. Biomaterials 35:500–508 12. Sun L, Tan R, Xu J, LaFace J, Gao Y, Xiao Y, Attar M, Neumann C, Li GM, Su B, Liu Y, Nakajima S, Levine AS, Lan L (2015) Targeted DNA damage at individual telomeres disrupts their integrity and triggers cell death. Nucleic Acids Res 43:6334–6347 13. Ishimoto T, Mori H (2019) A new bioluminescence-based tool for modulating target proteins in live cells. Sci Rep 9:18239 14. Takemoto K, Matsuda T, Sakai N, Fu D, Noda M, Uchiyama S, Kotera I, Arai Y, Horiuchi M, Fukui K, Ayabe T, Inagaki F, Suzuki H, Nagai T (2013) SuperNova, a monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation. Sci Rep 3:2629 15. Shu X, Lev-Ram V, Deerinck TJ, Qi Y, Ramko EB, Davidson MW, Jin Y, Ellisman MH, Tsien RY (2011) A genetically encoded tag for correlated light and electron microscopy of intact cells, tissues, and organisms. PLoS Biol 9: e1001041 16. Hoshino H, Nakajima Y, Ohmiya Y (2007) Luciferase-YFP fusion tag with enhanced emission for single-cell luminescence imaging. Nat Methods 4:637–639 17. Kim JS, Huang TY, Bokoch GM (2009) Reactive oxygen species regulate a slingshot-cofilin activation pathway. Mol Biol Cell 20:2650–2660 18. Wilson C, Terman JR, Gonzalez-Billault C, Ahmed G (2016) Actin filaments-a target for redox regulation. Cytoskeleton (Hoboken) 73:577–595 19. Bamburg JR, Bernstein BW (2016) Actin dynamics and cofilin-actin rods in Alzheimer’s disease. Cytoskeleton (Hoboken) 73:477–497

Chapter 24 Bioluminescence Imaging of Neuronal Network Dynamics Using Aequorin-Based Calcium Sensors Sandrine Picaud, Bertrand Lambolez, and Ludovic Tricoire Abstract Optogenetic calcium sensors enable the imaging in real-time of the activities of single or multiple neurons in brain slices and in vivo. Bioluminescent probes engineered from the natural calcium sensor aequorin do not require illumination, are virtually devoid of background signal, and exhibit wide dynamic range and low cytotoxicity. These probes are thus well suited for long-duration, whole-field recordings of multiple neurons simultaneously. Here, we describe a protocol for monitoring and analyzing the dynamics of neuronal ensembles using whole-field bioluminescence imaging of an aequorin-based sensor in brain slice. Key words Bioluminescence, Genetically encoded probe, GFP-aequorin, Calcium imaging, Neuron, Neuronal ensemble, Viral transfer, Coelenterazine (CTZ)

1

Introduction Optogenetic Ca2+ sensors allow the imaging of transient intracellular Ca2+ increases associated with neuronal activities using fluorescence (FL) or bioluminescence (BL) microscopy [1, 2]. Unlike FL sensors, imaging using BL sensors does not require optical sectioning and scanning (typically acquired at 5–10 full frame/s), hence avoiding a significant loss of information when imaging activities of neuronal ensembles. BL sensors are based on luciferases, which are enzymes that catalyze light emission from the reaction with small organic compounds called luciferins [3]. BL imaging thus does not require illumination, hence its low invasiveness and absence of phototoxicity, but critically depends on luciferin availability. Aequorin, isolated from jellyfish Aequorea species, has been used for decades as BL indicator of Ca2+ physiology in numerous cell types and biological species [4]. It is a stable reaction-intermediate formed with the luciferase apoaequorin and the luciferin coelenterazine (CTZ), which emits blue light upon Ca2+ binding [3, 5]. The rapid kinetics of Ca2+ binding to and unbinding from aequorin makes it a suitable indicator of rapid Ca2+

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_24, © Springer Science+Business Media, LLC, part of Springer Nature 2021

281

282

Sandrine Picaud et al.

transients [6]. Aequorin belongs to the family of photoproteins, which contain three EF-hand Ca2+-binding sites and share high structural and functional homology [3, 5]. The properties of photoproteins differ from those of other luciferase/luciferin reactions [3] with two-fold implications for BL imaging experiments using aequorin-based sensors. First, the apoaequorin-CTZ complex forms slowly, whereas the BL reaction occurs as a rapid flash, whose intensity increases with Ca2+ concentration, and proceeds to completion in the continuous presence of Ca2+ [6–9]. Aequorin is thus generally reconstituted prior to imaging through incubation of cells or tissue for at least 30 min [10–12] with CTZ concentrations (5–10 μM) below cytotoxicity threshold (~20 μM, Refs. 13, 14). In vivo, the BL of aequorin-based sensors is detectable 15 min after intravenous injection of CTZ and reaches a plateau after 45 min [15]. These procedures enable the imaging in tissue slices and in vivo for several hours without recharging aequorin [10, 15– 17]. In contrast, other luciferases have much faster turnover rates, yielding high BL intensities that allow imaging at higher spatiotemporal resolution than achieved with aequorin-based sensors (see e.g., [18, 19] for Nano-lantern-based Ca2+ sensors). However, the requirement of these other luciferases for the continuous presence of luciferin (20–40 μM CTZ for Nano-lantern-based Ca2+ sensors, [18, 19]) is an important drawback, notably because of luciferin toxicity and instability [13, 14]. Second, the aequorin complex is stable below Ca2+-binding threshold, and aequorin BL intensity varies by several orders of magnitude in the (0.1 μM to 1 mM) Ca2+ concentration range [20]. As a result, the BL of aequorin-based sensors has far lower background signal and has wide dynamic range [12, 17] than sensors based on other luciferases (see e.g., [18, 19]). Aequorin-based BL imaging is thus endowed with high contrast, allowing the detection of discrete events on whole-field signals, and the acquisition of whole-field imaging data in a very compact format through the encoding of only active pixel coordinates (see below and [12, 17]). The GFP-aequorin (GA) is a FL and BL fusion protein, with improved light output and stability of aequorin, which enables Ca2+ imaging from single cells to whole animals of diverse species [12, 15–17, 21–24]. Bioluminescence resonance energy transfer (BRET) from aequorin to GFP [25] shifts GA light emission to the green, further shift occurring upon fusion of aequorin with yellow or red FL proteins [21, 26, 27]. GA minimally alters cellular processes, and behaves as a low-affinity, supralinear indicator of intracellular Ca2+ transients [12, 15, 17, 24]. It has been targeted to various cell types using conditional alleles in transgenic animals or through viral transfer, and addressed to different subcellular compartments [10, 15, 16, 22, 24].

Bioluminescence Imaging of Neuronal Networks

283

In the present chapter, we provide unique protocols used in our laboratory to perform whole-field BL imaging of neuronal ensemble activities in brain slices expressing cytosolic GA after transduction with a recombinant Sindbis pseudovirus [17]. The description of slice preparation and viral transduction, reported elsewhere [28, 29], has been kept to the minimum, whereas sections dealing with BL data acquisition, handling, and analysis are detailed.

2

Materials

2.1 Expression Vector and Animals

1. Recombinant Sindbis pseudovirions encoding GA (Sin-GA; see Notes 1 and 2). 2. Rats or mice (see Note 3).

2.2 Materials for the Preparation of Acute Slices

1. 10
artificial cerebrospinal fluid (ACSF): 1260 mM NaCl, 25 mM KCl, 12.5 mM NaH2PO4, 260 mM NaHCO3. Weigh 146.1 g NaCl, 3.73 g KCl, 3 g anhydrous NaH2PO4, 43.7 g NaHCO3, and dissolve in 2 L deionized H2O. Store at 4  C for up to 2 weeks. 2. ACSF: 126 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 2 mM CaCl2, 1 mM MgCl2, 26 mM NaHCO3, 20 mM Dglucose, and 5 mM Na pyruvate. Add in this order 750 mL H2O, glucose, 100 mL 10
ACSF, 2 mL CaCl2 1 M, 1 mL MgCl2 1 M, and 0.55 g Na pyruvate. Adjust to 1 L and filter on 0.22 μm membrane. This solution is prepared daily and saturated with carbogen (95% O2, 5% CO2) for 20 min before use. 3. Slicing solution: ACSF supplemented with 1 mM kynurenic acid (Sigma, cat. no. K3375) and bubbled with carbogen. To help dissolve kynurenic acid, sonicate for 5–10 min in an ultrasound bath. 4. Dissection tools: Scissors for initial dissection, long, thin scissors for removing skin, short scissors for cutting skull, short, blunt forceps for removing skull, rounded spatula for removing brain, scalpel and blade for dividing brain, rounded spatula for transferring brain halves. 5. Small parts: Adhesive cyanoacrylate (e.g., Loctite 406), stainless steel blade (Campden Instruments Ltd., Part N. 752/1/ SS) or razor blade (Gillette blue extra), plastic petri dish (diameter 35 mm), Pasteur pipette for manipulating brain slices. 6. Anesthetics: ketamine (100 mg/kg body weight) and xylazine (10 mg/kg body weight). In a 5 mL tube, add 125 μL Rampun® 0.2% (xylazine), 250 μL Imalgene® 1000 (ketamine), and 2.125 mL NaCl 0.9%. Use this solution at 100 μL per 10 g body weight. Store this solution at 4  C.

284

Sandrine Picaud et al.

2.3 Materials for Overnight Transduction of Acute Brain Slices with Sin-GA

1. Slice culture medium: Mix 250 mL minimal essential medium (MEM; Invitrogen-Life technologies, cat. no. 32360026), 250 mL 1
Hank’s balanced salt solution (HBSS; Invitrogen-Life technologies, cat. no. 24020091), 5 mL penicillin-streptomycin (P: 10,000 U/mL, S: 10,000 mg/ mL), and 2.75 g D-glucose. Filter-sterilize (Steritop, Millipore), aliquot in 50 mL tube, and store at 4  C for up to 2 months. 2. Millicell culture plate inserts (Millipore, cat. no. PICMORG) (see Note 4). 3. Sin-GA. Recombinant pseudovirions are stored at 80  C (see Note 5). 4. Native CTZ-free base (Prolume, Cat# 303 NF-CTZ-FB) stock solution at 1.25 mM in ethanol (see Note 6).

2.4

Instrumentation

1. Laminar flow cabinet and a 5% CO2 incubator maintained at 35  C. 2. Vibrating slicer Microsystems).

(e.g.,

VT1000S

or

VT1200;

Leica

3. Incubation chamber: a submerged chamber ensuring sufficient oxygenation of the tissue during the recovery period. Usually made of a small plastic cylinder ending in a nylon net. 4. Grid of nylon threads glued to a U-shaped platinum frame to maintain the slice at the bottom of the recording chamber. 5. Imaging setup (see Fig. 1, and Note 7): (a) Upright microscope (BX51WI Olympus) equipped with water immersion objectives. (b) Intensified CCD video camera (ICCD225; 768
576 pixels; Photek, St Leonards on Sea, UK) controlled by the data acquisition software IFS32 (Photek). (c) Mercury lamp (Olympus) or LED (Thorlabs) for GFP fluorescence excitation. (d) GFP filter set (e.g., Chroma technology, cat no 41018, or Semrock, cat no GFP-30LP-B-000). (e) Recording chamber and a perfusion system. (f) Homemade dark box housing the setup to avoid light noise. 6. Electrical extracellular stimulation (optional, see Note 8): (a) Micromanipulator (e.g., Mini 25 3 axes, Luigs and Neumann, Germany). (b) Concentric bipolar electrode (e.g., CBBSE75, FHC). (c) Constant current Digitimer, UKs).

stimulation

unit

(e.g.,

DS2A,

Bioluminescence Imaging of Neuronal Networks

285

Fig. 1 Schematic representation of a setup for BL recordings. Prior to imaging, samples are visualized by GFP epifluorescence using GFP filter set. Filters reside in a filter wheel (not shown), thus they can be removed from the light path during BL acquisition. FL image is acquired with the low-gain mode of the ICCD camera. The BL data comprise the pixel coordinates (X, Y ) of each light event together with the time information as the frame number

3

Methods

3.1 Preparation of Acute Slices from Neocortex and Transduction with Sin-GA

We use 13–17-day-old rats and mice to prepare slices for overnight transduction with Sindbis virus. For a more detailed protocol, see [28]. 1. Place a 250 mL bottle of slicing solution in the freezer until ice appears. 2. Transfer the bottle containing the half-frozen slicing solution in a bucket of ice water mix. 3. Bubble the slicing solution with carbogen for 20 min. 4. Put ice water mix around the slicing chamber to keep it cold throughout the slicing procedure. 5. Anesthetize the animal with ketamine/xylazine, kill by decapitation, and then rapidly submerge the head in a Petri dish containing ice-cold, oxygenated cutting solution. 6. Cut the scalp and push it aside. Using small scissors, cut the skull from the vertebral foramen to the frontal lobes, and then make four lateral cuts from midline, two anterior and two posterior. Open the skull from midline with blunt forceps. 7. For parasagittal sections, using a scalpel blade, make lateral cuts between olfactory bulb and frontal cortex, and between cerebellum and occipital cortex, then rostro-caudal between the two hemispheres.

286

Sandrine Picaud et al.

Fig. 2 10 slicing stage. We use a homemade slicing stage to compensate for brain surface curvature. The rostro-caudal axis is parallel to the blade edge and the dorsal part of the brain (i.e., the cortex) is closest to the blade. (Reproduced from Tricoire and Lambolez (2014) [28] with permission from Springer Nature)

8. Extract brain halves from the skull with a spatula and glue onto a thin film of cyanoacrylate spread on the cooled slicing stage as shown in Fig. 2 (see Note 9). 9. Transfer and screw the stage with the block of tissue in the slicing chamber, and submerge with ice-cold slicing solution continuously bubbled with carbogen at low rate. 10. Cut 300 μm slices (250 μm for mice) with blade-fast vibration (approximately 60–70 Hz, amplitude is 0.8 mm), and slow progression through tissue (0.1–0.2 mm s1). 11. Once the blade has moved through cortex and hippocampus, release the slice by cutting with a thin-folded needle and restart sectioning. 12. Using an inverted Pasteur pipette broken at the narrow tip and mounted on a rubber bulb, transfer the slices into the incubation chamber and let them recover in slicing solution for 30 min at room temperature. 13. During recovery, add 1.2 mL of slice culture medium in a 35 mm Petri dish, place a Millicell insert in the dish (remove any bubble from under the insert) and place the dish in a 5% CO2 incubator. 14. Transfer slices onto the insert with inverted Pasteur pipette and remove excess slicing solution to leave a thin layer of fluid above the slice. 15. Slices are transduced by adding 5 μL of Sin-GA viral solution onto the slice and incubating overnight at 35  C in a standard incubator with humidified 5% CO2 atmosphere. 16. Thirty min after Sin-GA application, add CTZ (final concentration: 10 μM) to the slice culture medium for reconstitution of the aequorin moiety (see Note 10).

Bioluminescence Imaging of Neuronal Networks

3.2 Bioluminescence Imaging

287

1. The next day, pour some carbogen-saturated ACSF onto the insert with inverted Pasteur pipette, gently detach the slices using a thin paintbrush, and transfer into an incubation chamber filled with carbogen-saturated ACSF. 2. Let slices equilibrate for at least 1 h at room temperature in the dark (see Note 11). 3. Transfer one slice into the recording chamber perfused at 1–2 mL/min with carbogen-saturated ACSF. 4. Stop inflow and suction, gently put the slice at the bottom of the chamber, place a grid onto the slice, and resume perfusion. Recordings are typically performed 15–24 h after viral transduction, either at room temperature or at 32–34  C (see Note 12). 5. Using a low magnification objective (e.g., 10
), scan the slice under FL microscopy to locate a region with the desired expression pattern. 6. Optionally, position the tip of the stimulation electrode on top of the slice (see Note 13). 7. Change the objective if necessary and using the low-gain acquisition mode of the camera, take a FL picture of GA expression in the imaging field. 8. When investigating the spatial properties of ensemble responses, set the slice in the recording chamber so that X and Y axes have a biological relevance. 9. For the cortex, orient the slice so that the cortical surface (the pia) is parallel to the X-axis (horizontal axis of the field of view). Thus, the dorso-ventral axis of the cortex is parallel to the Y axis. 10. Remove the GFP filter cube from the light path, turn off any unnecessary source of light in the room, and close the dark box. Switch on the high-gain mode of the camera and start BL recording (see Note 14). 11. Save the file, switch back to the low-gain mode, and take a new FL picture of the imaging field in order to detect possible drift of the slice during the recording. 12. Optionally, for post-hoc histological analysis, transfer the slice into a 24-well plate containing 4% paraformaldehyde in PBS and incubate overnight at 4  C. The next day, replace fixative by PBS.

288

Sandrine Picaud et al.

3.3 Data Acquisition and Handling

1. Preliminary recordings have to be performed to evaluate which acquisition mode of the camera is the most suitable, depending on the spatial- and temporal-light density emitted by the sample. The Photek camera we use can run under two acquisition modes, “photon counting” or “binary slice” (see Note 15). 2. Select the acquisition mode of the camera, which is most appropriate for the imaging experiment, and start recording (see Note 16).

3.4

Data Analysis

1. Check compatibility between data acquisition and analysis software (see Note 17). 2. Define the type and number of ROI you wish to analyze. The first part of the analysis is to extract light signal of ROI from the data file. You can define ROI in a systematic way, such as an array of identical small ROI (e.g., square) covering the whole field of view. In Ref. 17, we used an 18
24 array of square ROI, each ROI corresponding to a 60
60 μm square on the slice (whole imaging field with 10
objective: 1.4 mm
1 mm, see Fig. 3). For the next steps, we will illustrate different types of data analysis based on arrays of ROI. Alternatively, you can define ROI using predefined shapes (circle, square, polygon, etc.) or draw them manually (see Note 18). 3. Extract light signal of each ROI from the data file. At this stage, it is convenient to store the intensity versus time signals in a single table (see Fig. 3). It is important to be able to map each signal to each corresponding ROI. 4. In order to manipulate easily these data, import this table in a software that allows to manipulate column/row, perform mathematical operations, and generate images and graphs (e.g., MATLAB, Igor, R, Origin). 5. Convert the intensity versus timetable in image (e.g., with the function “image()” in MATLAB). This representation, called raster plot, provides an easy way to visualize the spatiotemporal dynamics of BL signals in the whole field (see Fig. 3). Time is represented in one dimension, space (i.e., ROIs) in the other dimension, and light intensity is color-coded. Spatial and temporal correlations can thus be identified (see Note 19). 6. Optionally, perform other kinds of analysis from the intensity vs. timetable to compare light responses of different ROI over time. For example, calculating a cross-correlation table provides a quantitative tool to analyze similarity between the activities of different ROI. Alternatively, using unsupervised clustering (see Ref. 17) and plotting a hierarchical tree allow sorting and grouping together ROI that exhibit similar activity patterns.

Bioluminescence Imaging of Neuronal Networks

289

Fig. 3 General procedure for bioluminescence imaging data analysis

4

Notes 1. GA has been expressed using diverse viral vectors or in transgenic mice lines [10, 15]. We use Sindbis vectors to transduce acute brain slices because they allow fast expression (within 6–12 h) of transgenes at high level, selectively into neurons [12, 17, 30–32]. Our GA sequence (Genbank accession number: EF212028) is similar to that originally reported [21], except for a few amino acid substitutions in the GFP moiety, and full codon optimization of the apoaequorin sequence for better expression in mammalian cells [12]. The GA coding sequence is inserted in the pSinRep5 vector [31] downstream the subgenomic promoter. Detailed protocols for the production of Sindbis recombinant pseudovisions can be found elsewhere [29, 33].

290

Sandrine Picaud et al.

2. Recombinant Sindbis viruses are classified as a Biosafety Level2 (BL-2) agent by the NIH Recombinant DNA Advisory Committee. Recommended precautions include standard microbiological practices, laboratory coats, inactivation of all infectious waste, limited access to working areas, protective gloves, posted biohazard signs, class I or II biological safety cabinets, and proper training of personnel involved in manipulation. Sindbis viruses can be inactivated by organic solvents, bleach, or autoclaving. 3. We use Wistar rats or mice with C57/Bl6 genetic background. All animal experiments must be performed in accordance with the guidelines from relevant authorities. 4. Millicell inserts fit into 35 mm Petri dishes and are suitable for the handling of the slices because of their low walls. 5. We typically use recombinant Sindbis viral stocks with titers ranging 107–108 transducing units/mL, which are enough for slice transduction or for in vivo injection. 6. Store CTZ stock solution at 80  C. Caution: Manipulate CTZ in the dark, as it is photo-sensitive. 7. We use 10
(N.A. ¼ 0.3) and 60
(N.A. ¼ 0.9) water immersion objectives for light acquisition. Following visualization of GFP fluorescence, GFP filters are removed from light path during BL recordings. 8. The stimulus wave form is provided by a TTL signal either by the software pClamp through a digidata A/D converter (Axon Instruments) or by a signal generator (AccuPulse, World Precision Instrument). 9. We use a homemade slicing stage with a 10 slope that takes cortical surface curvature into account (see Fig. 2). 10. Overnight incubation with CTZ starting from the time of viral transduction results in visible enhancement of GA fluorescence as compared to 3 h incubation after overnight expression presumably because aequorin is more stable than apoaequorin in cellulo [33]. The reconstituted GA pool is sufficient to record continuously for over 1.5 h without recharging with CTZ [17]. 11. This step is necessary to avoid drift along the Z-axis during recording. 12. Given that the Sindbis virus does not diffuse deeply into the slice (50%). Avoid introducing air bubbles while mixing. 31. We recommend optimizing sphere polymerization time based on volume, final corning Matrigel matrix-protein concentration, and culture medium. Typically, it takes at least 10 min for 80 μL mixture volume to solidify. 32. 96-well plate with its hydrophobic property allows the cell droplet to form a near-sphere structure.

384

Uday Kumar Sukumar et al.

Acknowledgments The Canary Center at Stanford, Department of Radiology for facility and resources. We also thank SCi3 small animal imaging service center, Stanford University School of Medicine for providing imaging facilities and data analysis support. We also acknowledge Drs. Sharon Hori and Rajendran J.C. Bose for their contributions in some of the experiments. This research was supported by NIH R01CA209888, NIH R21EB022298, the Focused Ultrasound Society, and the Ben and Catherine Ivy Foundation. This work was also supported by the Center for Cancer Nanotechnology Excellence for Translational Diagnostics (CCNE-TD) at Stanford University through an award (Grant no: U54 CA199075) from the National Cancer Institute (NCI) of the National Institutes of Health (NIH). NIH S10OD023518 Award for the Celigo S Imaging Cytometer (200BFFL-S) is acknowledged. References 1. Luo X (2019) Subwavelength artificial structures: opening a new era for engineering optics. Adv Mater 31(4):e1804680 2. Ngu JC, Kim SH (2019) Robotic surgery in colorectal cancer: the way forward or a passing fad. J Gastrointest Oncol 10(6):1222–1228 3. Bu L, Shen B, Cheng Z (2014) Fluorescent imaging of cancerous tissues for targeted surgery. Adv Drug Deliv Rev 76:21–38 4. Lavis LD, Raines RT (2008) Bright ideas for chemical biology. ACS Chem Biol 3 (3):142–155

5. Tsien RY (2010) Nobel lecture: constructing and exploiting the fluorescent protein paintbox. Integr Biol (Camb) 2(2-3):77–93 6. Bose RJC, Uday Kumar S, Zeng Y, Afjei R, Robinson E, Lau K, Bermudez A, Habte F, Pitteri SJ, Sinclair R, Willmann JK, Massoud TF, Gambhir SS, Paulmurugan R (2018) Tumor cell-derived extracellular vesicle-coated nanocarriers: an efficient theranostic platform for the cancer-specific delivery of anti-miR-21 and imaging agents. ACS Nano 12 (11):10817–10832

Chapter 31 Pinhole Closure Improves Spatial Resolution in Confocal Scanning Microscopy Akira Kitamura Abstract Confocal microscopy is a simple, super-resolution technique, which does not produce a marked increase in resolution compared to other advanced techniques, such as super-resolution nanoscopy. Here, we present a simple protocol to acquire “slightly, but easily resolved” images by pinhole closure ( Adjust > Brightness/Contrast).

388

Akira Kitamura

1.0 AU

0.31 AU

Fig. 1 Comparison between confocal and super-resolution images. Indirect immunofluorescence images visualizing a translocon channel in the outer membrane of mitochondria (TOM20) in Neuro2a cells. The same field was observed with conventional pinhole size (1 AU; left) or pinhole closure (0.31 AU; right). Pinhole closure images were subsequently processed using a Gaussian blur filter. The pseudocolor scale is represented as a bar (bottom left, in each images). Bar ¼ 0.4 μm

3. Change the pixel scale to 4096
4096 (width
height) without interpolation (scaleup) [Image > Scale]. 4. Open the “Gaussian Blur” filter windows (Process > Filters > Gaussian Blur) (see Note 6). 5. Set the “sigma radius” (pixel) setting to 2–4 with “Preview” mode (see Note 7). 6. Save the image as “TIFF” (see Note 8) (see Fig. 1).

4

Notes 1. It is important to select the right thickness of the coverslip to avoid spherical aberrations. Almost all objective lenses, including the Plan-Apochromat 63
, are designed for use with no. 1S (also known as no. 1.5) coverslip (0.17 mm thickness). 2. We used APD as the detector for FCS in the ConfoCor3 system. However, GaAsP photomultiplier tubes are suitable alternatives to APD; GaAsP PMTs are usually included in many confocal laser scanning microscopes, such as the LSM980 and 880 (Carl Zeiss). When imaging using the ConfoCor3 system with APDs, users need to purchase an appropriate license for the software ZEN (Carl Zeiss). 3. We recommend objective lenses with high-numerical apertures (NA), such as the Plan-Apochromat type and oil-immersion, owing to their high-spatial resolution. Magnification of the objectives is not important in scanning microscopy due to the availability of the digital zoom feature.

Resolution Improvement in Confocal Scanning Microscopy

389

4. Since it is not possible to change the gain of the APD, the FL intensity should be modified using laser power setting (transmission value). 5. One may expect high FL through increasing the laser intensity. Meanwhile, to avoid damage to the detector, the power must be carefully increased from the lowest setting. If the FL intensity is too high even in the lowest setting, the proteins expressed in the Neuro2a cells may be decomposed. 6. Although the image can be satisfactorily presented by the above process alone, a “Gaussian Blur” filter may be useful (steps 4– 7) if the image has a ragged impression due to the shot noise. 7. The increased “sigma” value as the processing parameter worsens the spatial resolution. As the shot noise almost disappears at a setting of 4 pixels (considering the pixel size), a value of 4 or less is appropriate. 8. Typical super-resolution images acquired using this procedure are reported in ref. 8.

Acknowledgments This work was supported by a Japan Society for Promotion of Science (JSPS) Grant-in-Aid for the Promotion of Joint International Research (Fostering Joint International Research) (16KK0156), by a JSPS Grant-in-Aid for Scientific Research (C) (18 K06201), by a grant from Canon Foundation, by a Japan Science and Technology Agency (JST) Competitive Funding Program for Adaptable and Seamless Technology Transfer Program through Target-driven R&D (A-STEP) (VP30318089120). References 1. Conchello JA, Lichtman JW (2005) Optical sectioning microscopy. Nat Methods 2 (12):920–931. https://doi.org/10.1038/ nmeth815 2. Sheppard CJR (1988) Super-resolution in confocal imaging. Optik 80(2):53–54 3. Sahl SJ, Hell SW, Jakobs S (2017) Fluorescence nanoscopy in cell biology. Nat Rev Mol Cell Biol 18(11):685–701. https://doi.org/10.1038/ nrm.2017.71 4. Becker W, Su B, Holub O, Weisshart K (2011) FLIM and FCS detection in laser scanning microscopes: increased efficiency by GaAsP hybrid detectors. Microsc Res Tech 74 (9):804–811. https://doi.org/10.1002/jemt. 20959 5. Lawrence WG, Varadi G, Entine G, Podniesinski E, Wallace PK (2008) Enhanced red- and near-infrared detection in flow cytometry using avalanche photodiodes. Cytom A 73

(8):767–776. https://doi.org/10.1002/cyto.a. 20595 6. Kitamura A, Nakayama Y, Shibasaki A, Taki A, Yuno S, Takeda K, Yahara M, Tanabe N, Kinjo M (2016) Interaction of RNA with a C-terminal fragment of the amyotrophic lateral sclerosisassociated TDP43 reduces cytotoxicity. Sci Rep 6:19230. https://doi.org/10.1038/srep19230 7. Kitamura A, Shimizu H, Kinjo M (2018) Determination of cytoplasmic optineurin foci sizes using image correlation spectroscopy. J Biochem 164(3):223–229. https://doi.org/10.1093/ jb/mvy044 8. Kitamura A, Iwasaki N, Kinjo M (2018) Molecular chaperone HSP70 prevents formation of inclusion bodies of the 25-kDa C-terminal fragment of TDP-43 by preventing aggregate accumulation. Cell Stress Chaperones 23 (6):1177–1183. https://doi.org/10.1007/ s12192-018-0930-1

Chapter 32 Workflows of the Single-Molecule Imaging Analysis in Living Cells: Tutorial Guidance to the Measurement of the Drug Effects on a GPCR Masataka Yanagawa and Yasushi Sako Abstract Single-molecule imaging (SMI) is a powerful method to measure the dynamics of membrane proteins on the cell membrane. The single-molecule tracking (SMT) analysis provides information about the diffusion dynamics, the oligomer size distribution, and the particle density change. The affinity and on/off-rate of a protein–protein interaction can be estimated from the dual-color SMI analysis. However, it is difficult for trainees to determine quantitative information from the SMI movies. The present protocol guides the detailed workflows to measure the drug-activated dynamics of a G protein-coupled receptor (GPCR) and metabotropic glutamate receptor 3 (mGluR3), by using the total internal reflection fluorescence microscopy (TIRFM). This tutorial guidance comprises an open-source software, named smDynamicsAnalyzer, with which one can easily analyze the SMT dataset by just following the workflows after building a designated folder structure (https://github.com/masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). Key words Single-molecule imaging, TIRFM, GPCR, ImageJ, Single-molecule tracking analysis, VBHMM, smDynamicsAnalyzer, Diffusion dynamics, Oligomer size distribution, Colocalization analysis

1

Introduction G protein-coupled receptors (GPCRs) are major drug targets, for example, 34% of small molecule drugs target 6% of ~800 kinds of human GPCRs [1, 2]. Evaluation of the drug effects on a given GPCR often relies on monitoring cellular responses evoked by the drug-activated receptor [3]. However, such conventional approaches are difficult to investigate the drug effects on the GPCRs whose signaling pathways are unclear, including ~80 nonolfactory orphan GPCRs [2]. We recently demonstrated that the diffusion dynamics of GPCRs in the plasma membrane (PM) is a versatile index to

Supplementary Information: The online version of this chapter (https://doi.org/10.1007/978-1-0716-12583_32) contains supplementary material, which is available to authorized users. Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3_32, © Springer Science+Business Media, LLC, part of Springer Nature 2021

391

392

Masataka Yanagawa and Yasushi Sako

evaluate the drug effects on GPCRs [4]. We reported that commonly observed is agonist-dependent decrease of the average diffusion coefficient of various GPCRs, regardless of the receptor family and of the G protein-coupling selectivity. We also revealed that the agonist-induced variance in the diffusion coefficient of GPCR is partly related to the G protein coupling and the recruitment into the clathrin-coated pit (CCP) by dual-color single-molecule imaging (SMI) analysis. The activation-dependent decrease of the diffusion coefficient is also commonly observed with the epidermal growth factor receptor (EGFR) [5] and TRPV1 channel [6]. Therefore, the diffusion coefficient is a key index reflecting the functional states of various membrane receptors. Here, we describe the detailed protocols to determine the molecular dynamics of GPCRs in living cells with the total internal reflection fluorescence microscopy (TIRFM). TIRFM is a common SMI method [7–10], in which the fluorophore-labeled molecules within a limited depth, ~200 nm above the coverslip, are illuminated by the evanescent field on the glass-water interface (see Fig. 1). This feature is suitable for observing various membrane proteins, such as GPCRs and G proteins, and has been used for the analysis of the dynamics of various GPCRs in the precedent studies [4, 11–16]. TIRFM allows us to selectively monitor the membrane proteins in the basal PM due to the reduction of the background fluorescence (FL) from the intracellular compartment and the apical membrane of the cell. When the density of the fluorophorelabeled molecule does not largely exceed 1/μm2, trajectories of the bright spots from single-molecules (or oligomeric particles) can be distinguished from one another. The single-molecule tracking (SMT) analysis provides information on the localization, trajectory, and FL intensity of each particle. The particle density in the PM can be quantified from the localization data. The diffusion parameters can be obtained from the meansquared displacement (MSD)-Δt plot of the trajectories and from the histogram analysis of step-size. The Variational BayesianHidden Markov Model (VB-HMM) clustering analysis of the trajectories provides advanced parameters of diffusion, including the number of diffusion states, the diffusion coefficient, and the fraction of each state in addition to the transition rate constants from a state to another. Statistics of the starting time and the length of trajectories provide information about on/off-rate constants of molecules. The distribution of oligomeric states of the molecules can be estimated from the FL intensity histogram analysis. Furthermore, the dual-color SMI analyzes make it possible to quantify the diffusion parameters of two interacting molecules. To date, various SMT analysis programs are available [17]; however, few programs have been published to calculate various kinetic parameters above from a large amount of the SMT dataset, and to perform a comparative analysis. This situation would make it

Laser 1

Laser 2

Single-Molecule Imaging Analysis

Epi illumination

Cell

Water

TIRF illumination Evanescent field → Cover glass → Immersion oil →

Beam expander 45°

393

Objective lens 60x, NA 1.49

45°

← Back focal plane of objective lens

λ/4 phase plate

Rotating beam TIRF illum.

Microscope Excitation filter

∆r evanescent (1.33-1.49)

Field stop↓ Auto focus unit→

DM

Shutter Lens 4

ND filter f4

Tube lens

Epi/

Conventional Oblique illum. TIRF illum. r water (1.33)

Mirror Fluorescence image

r NA (1.49)

4x relay lens → Dual-color single-molecule image

Dichroic mirror

Emission filter 1↓ Mirror→

Mirror

DM

f3

← Emission filter 2

f1

Y-scanner

f1

Lens 1

f2

f2

Lens 2

X-scanner

EM CCD 2

f3

EM CCD 1

Lens 3

5 µm

Fig. 1 Optical configuration for the dual-color TIRFM. The images at the back focal plane of objective lens are taken by a charge-coupled device (CCD) camera (Thorlab, 8051C-USB) through C-mount camera microscope adapter (MeCan, NYCZ). The dual-color single-molecule image is an example of TMR-labeled mGluR3 (red) and EGFP-labeled clathrin-light chain (CLC) (green)

difficult for trainees to perform SMI analysis. Furthermore, the sample throughput of the SMI has been increased due to the development of the automated SMI system [5, 18], and the image analysis has become the rate-limiting phase of the experiments. Considering these situations, the present protocol guides how to analyze the SMT dataset with our unique open-source software, named smDynamicsAnalyzer that can determine a series of kinetic parameters from the SMT dataset simply by following the designated steps after building an appropriate folder structure (https:// github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer).As the tutorial guidance, we exemplify the analyzes of metabotropic glutamate receptor 3 (mGluR3), a class C GPCR, and the clathrin-light chain (CLC) in detail.

394

2

Masataka Yanagawa and Yasushi Sako

Materials

2.1 Plasmid DNA (pDNA) Vector Encoding HaloTag/ SNAP-Tag/GFP-Fusion

pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or seamless ligation cloning extract (SLiCE) from Escherichia coli [19].

2.2

Human embryonic kidney cells 293 (HEK293 cells) (see Note 2).

Cells

2.3 Medium, Buffer, and Reagents

1. Medium A (culture medium): Dulbecco’s modified Eagle medium: nutrient mixture F-12 (DMEM/F12) (or DMEM) containing phenol red supplemented with 15 mM HEPES (pH 7.3), 29 mM NaHCO3, and 10% fetal bovine serum (FBS). 2. Medium B (medium for the FL-staining): DMEM/F12 or DMEM without phenol red and NaHCO3 supplemented with 15 mM HEPES (pH 7.3) and 10% FBS. 3. Buffer A (measurement buffer): Hanks’ balanced salt solution with 15 mM HEPES (pH 7.3) and 0.01% BSA without NaHCO3. 4. Ligands: LY341495 (Tocris), LY379268 (Tocris). 5
ligand solution: a buffer A solution for stimulating a target GPCR, which is prepared by dissolving each ligand in buffer A to be a five-fold higher concentration. 5. Opti-MEM (Gibco) 6. Lipofectamine 3000, and P3000 regents (Thermo Fisher) 7. A neutral detergent solution (e.g., 2% Clean-Ace S/water, AsOne)

2.4 FL Dyes (See Note 3)

1. HaloTag ligands (Promega): HaloTag TMR, Janelia Fluor 549 (JF549), SaraFluor 650 (SF650, old product name: Stella Fluor 650) ligands, which are commercially available for the intracellular staining and the SMI. 2. SNAP-tag ligands (NEB): SNAP-Cell TMR-star and 647-SiR ligands, which are commercially available for the intracellular staining and the SMI.

2.5 Equipment for TIRFM (See Fig. 1)

1. An inverted fluorescence microscope (e.g., TE2000, TiE, Ti2E, Nikon, and IX81, IX83, Olympus). 2. An oil-immersion objective with numerical aperture (NA) over 1.33 (e.g., PlanApo 60
, NA 1.49, Nikon, and Apo N 60
, NA 1.49, Olympus). 3. Lasers with an enough power and suitable wavelength to the fluorophores (see Note 4).

Single-Molecule Imaging Analysis

395

4. Optical shutter and its driver to turn the laser on and off (e.g., LS6 and VMM-D3, Uniblitz). 5. Optics to adjust the angle of the laser from epi-illumination to TIRF illumination (see Note 5). 6. Dichroic and emission filters suitable for each laser and fluorophore (see Note 6). 7. Intermediate magnification lens (4
for 60
objective) between the microscope and cameras. 8. EM-CCD camera (e.g., ImagEM, Hamamatsu) or sCMOS camera (e.g., ORCA-Flash4.0, Hamamatsu). Two cameras are used for the dual-color imaging. 9. A two-channel imaging system (W-view Gemini-2C, Hamamatsu) for the dual-color imaging. 10. A computer with a specific software (e.g., MetaMorph, Molecular Devices, or AIS, Zido) to control the optics, the microscope, and the cameras. 11. Coverslips (Matsunami, 25 mm round, No. 1; 0.13–0.17 mm thickness). 12. Attofluor cell chamber (Invitrogen).

3

Methods

3.1 Preparation of Coverslips for the SMI in Living Cells (See Note 7)

1. Prepare coverslips for Attofluor cell chamber. 2. Incubate the coverslips in a neutral detergent solution in a glass beaker with continuous sonication for 60–120 min. 3. Replace the detergent solution in the coverslip with fresh water several times followed by 5 min sonication. 4. Immerse the coverslips into the concentrated sulfuric acid in a glass bottle with glass lid and incubate for 16 h. 5. Take out the coverslips from the concentrated sulfuric acid and put them into fresh water in a glass beaker. 6. Refresh the water several times followed by 5 min sonication. 7. Repeat step 6 three times. 8. Wrap the coverslips in the glass beaker with aluminum foil lid and sterilize them with Autoclave to avoid contaminations. 9. Incubate the coverslips in 3 mL medium A on a 60 mm culture dish for 16 h before seeding cells to increase the cell adhesion (coverslip dish).

3.2 Transfection by Lipofectamine 3000 (See Note 8)

1. Culture HEK293 cells to be 100% confluence in a 10 cm culture dish on the day before the SMI.

396

Masataka Yanagawa and Yasushi Sako

2. Prepare a transfection mixture A in a microtube according to the following recipe: Opti-MEM (Gibco): 60 μL. Lipofectamine 3000 reagent: 2.5 μL. 3. Prepare a transfection mixture B in a microtube according to the following recipe: Opti-MEM: 60 μL. pDNA vector: 0.1 μg in case carrying CMVd1 promoter, (or 0.02 μg in case carrying CMV promoter) (see Note 9), P3000 reagent: 0.2 μL (i.e., 2-fold of the amount of pDNA) (see Note 10). 4. Mix the mixtures A and B and further incubate for 15 min at room temperature (mixture A + B). 5. Trypsinize the cells from the 10 cm culture dish with 1 mL 0.25% trypsin-EDTA/PBS after 5 mL PBS rinse. 6. Aspirate the trypsin-EDTA/PBS, and detach cells with medium A by pipetting. 7. Suspend the 8
106 cells into 4 mL medium A. 8. Remove the medium A from the coverslip dish (see Subheading 2.5), and add 2.5 mL of fresh medium A. 9. Mix 500μL of the suspended 1
106 cells with the mixture A + B, and apply it on the coverslip dish. 10. Incubate overnight at 37  C in 5% CO2 incubator (day 0). 3.3 HaloTag/ SNAP-tag Staining (See Note 11)

1. Prepare the ligand solution by dissolving HaloTag or SNAPtag ligands with DMSO to be 100μM. 2. Freeze and stock an aliquot of the ligand solution in different tubes before use to avoid repeated freeze-thawing. 3. Dilute the ligand solution to be 10–300 nM in 2 mL medium B per coverslip dish (staining solution). 4. Aspirate the medium A by suction from the coverslip dish, the cells of which were transfected on day 0, and add the staining solution carefully for avoiding detachment of the cells. 5. Incubate for 15 min at 37  C in 5% CO2 incubator. 6. Aspirate the staining solution by suction and add 3 mL medium B carefully. 7. Prepare a new 6 cm culture dish containing 3 mL of medium B and transfer the coverslips to the fresh culture dish from the stained dish. 8. Discard the medium B from the dish by suction and add 3 mL of fresh medium B carefully. 9. Incubate for 15 min at 37  C in 5% CO2 incubator.

Single-Molecule Imaging Analysis

397

10. Repeat steps 8 and 9 three times. 11. Transfer a coverslip to the Attofluor cell chamber. 12. Carefully wash out the coverslip three times with 400 μL buffer A using a micropipette for avoiding detachment. 13. Add 400 μL of fresh buffer A to the coverslip and set the chamber on the sample stage of the microscope. 14. Add 100 μL of the 5
ligand solution 15 min before imaging in the case of the measurement of a steady state of dynamics of GPCR. 15. In the case of the time-lapse imaging of the same cells, add 100 μL of the 5
ligand solution between the time-points. 3.4 Single-Molecule Imaging (SMI)

1. Turn on all the equipment (microscope, camera, laser, shutter, and PC) and warm up until the camera’s cooling temperature reaches to the appropriate set point (e.g., ImagEM: 65  C). 2. Set an appropriate objective lens to the microscope and adjust the correction ring to the proper position. 3. Set the dichroic and emission filters to the proper position. 4. Activate an imaging software in the PC. 5. Drip the immersion oil (e.g., IMMOIL-F30CC, Olympus) on the objective lens. 6. Mount the sample on the oil. If any, eliminate bubbles between the objective and the coverslip. 7. Acquire standard images of multicolor beads (e.g., TetraSpeck, Thermo Fisher) for the dual-color imaging to calibrate and merge two channels. Adjust optics in the two-channel imaging system according to the manufacturer’s manual (see Note 12). 8. Adjust the laser angle to an optimal position (see Note 13). 9. Adjust the camera settings to a high enough sensitivity to detect photons from a single fluorophore (an example setting of ImagEM: exposure time: 30.5 ms, EM gain: 200, spot noise reduction: on). 10. Adjust the lens focus manually, and then keep it using an autofocus system (e.g., Nikon PFS, Olympus ZDC, Zido PAF). 11. Adjust the field stop to the center of the camera’s field of view and widen the aperture to the minimum necessary. 12. Search suitable cells with the density of single-molecule less than 1/μm2. 13. Record movies of ~20 cells for 100–400 frames per cell (3–12 s with 30.5 ms exposure time) during 15–30 min after ligand stimulation in the case of measuring a steady state of dynamics of GPCR.

398

Masataka Yanagawa and Yasushi Sako

14. Acquire time-lapse movies of ~20 cells for 100 frames per cell at each time point using the multidimensional acquisition mode with the journal (see Note 14). 3.5 Image Processing by ImageJ

1. Run background subtraction through following the path: Process>subtract background>rolling ball radius: 25 pixels. 2. Run running average through following the path (optional processing): Plugins>Stacks>Running_ZProjector>Size: 2, Type: average intensity. (Running_ZProjector plugin can be download from Vale Lab homepage, http://valelab.ucsf.edu/~nstuurman/ ijplugins/). 3. Set brightness and contrast through following the path (see Note 15): Image>Adjust>Brightness/Contrast>Set (e.g., min: 0, max: 800). 4. Save as tif and/or avi files through following the path (see Note 15): File>Save As>Tif. File>Save As>Avi (compression: none, frame rate: 33 fps). Alternatively, 1. Download the BatchImageProcessingSMT.ijm file (see Note 16, https://github.com/masataka-yanagawa/ImageJ-macroImageProcessingSMT) and put it into the macro folder of ImageJ. 2. Install the macro file through following the path: “Plugins>Macro>Install” and select the ijm file. 3. Run the macro “ImageProcessingSMT.” 4. Select a folder where multiple tif files are stored. 5. Check the check boxes for the required processing items and enter the parameters. 6. Push OK button. 7. Save the processed tif and/or avi files with a suffix in the same folder.

3.6 Additional Image Processing by ImageJ for the Dual-Color Analysis

1. Split channel 1 and channel 2 if the format of tif files is 1024
512 pixel (pix) (e.g., the imaging data taken by two ImagEMs using the Metamorph). (a) Install the macro file as shown above. (b) Run the macro “Split2ch.”

Single-Molecule Imaging Analysis

399

Fig. 2 Screenshot of the AAS: (a) SMT analysis program (Tracking2D). (b) Illustration of SMT analysis algorithm

400

Masataka Yanagawa and Yasushi Sako

(c) Select a folder where multiple tif files (1024
512 pix) are stored. (d) Processed tif files with the suffix “-ch1” or “-ch2” are saved in the same folder. (e) Run the macro “ImageProcessingSMT” to the split images as shown above. 2. Composite two channels (see Note 17): (a) Install the macro file as shown above. (b) Make two subfolders, named “C1” and “C2,” below the same folder. (c) Move multiple tif files with the suffix “-ch1” and “-ch2” to “C1” and “C2” folders, respectively. (d) Run the macro “Composite2ch.” (e) Select the folder where “C1” and “C2” are stored. (f) Processed tif files with the suffix “_composite” are automatically saved in the selected folder. 3. Align two channels by using affine transformation (see Note 18): (a) Open the multicolor bead image composited and calculate parameters of affine transformation through following the path: Plugins>jars>GridAligner>Push “Calculate from Image” button. (b) Open the single-molecule image composited and push “Apply” button. Save the aligned image through following the path if necessary: File>Save As>tif and/or avi. (c) Split two channels of the aligned image through following the path: Image>Color>Split Channels. (d) Save each channel of the aligned image through following the path: File>Save As>tif and/or avi. By using the AAS (Zido, https://zido.co.jp/en/), one may skip Steps 2 and 3 as follows: (a) Install and activate the AAS (user authentication is required). (b) Push “Start this analysis” button on the “Affine Transformation” (see Fig. 2a). (c) Make “affine1,” “affine 2,” and “data” folders. (d) Put the ch1 and the ch2 of the multicolor bead images in the “affine1” and “affine 2” folders, respectively.

Single-Molecule Imaging Analysis

401

(e) Put the ch2 of the single-molecule images before affine transformation. (f) Enter the parameters for the single-particle detection to analyze the localization of the bright spots of the ch1 and the ch2 of the multicolor bead images (see Subheading 3.6 for the detailed algorism)(e.g., region of interest (ROI) size: 12 pix, scan length: 3 pix, connection distance: 8 pix, light intensity threshold 1:500, light intensity threshold 2:500). (g) Click “Start analyze” button, then all the images in “data” folder will be output in the “data2” folder after affine transformation. 3.7 Single-Molecule Tracking (SMT) Analysis by AAS (See Note 19)

1. Put all the multiple tif (8 or 16 bit) files to be analyzed within a folder. 2. Install and activate the AAS (Zido, https://zido.co.jp/en/). 3. Push “Start This Analysis” button on the “Tracking2D.” 4. Enter the parameters for the SMT analysis (see Fig. 2). 5. Select output options of AAS. 6. Push “Start Analyze” button, then the AAS outputs the analysis results (csv and tif files) in the same folder. 7. Perform the VB-HMM analysis of the diffusion dynamics (optional).

3.8 Analysis of the Single-Molecule Dynamics of GPCRs by Using smDynamicsAnalyzer 3.8.1 Installation of Igor and Building a Folder Structure to Use smDynamicsAnalyzer (See Note 20)

1. Download and install Igor Pro 8 (abbreviated to Igor hereafter) (https://www.wavemetrics.com/products/igorpro). 2. Download the smDynamicsAnalyzer.pxp file (https://github. com/masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). Open it by double click. Increase the resolution of the screen if the parameter and analysis button panels cannot fit into the screen (see Fig. 3a). 3. Set parameters in the parameter panel (see Note 21). 4. Select an input format (see Fig. 3a, and Note 22). 5. Store the data files taken under the same condition in a single folder (see Fig. 3b). At least three files are required to calculate the statistics. Do not open the csv or xlsx files by excel when starting the analysis on the smDynamicsAnalyzer. 6. Build a folder structure as shown in Fig. 3b. In this example, five folders (“A1”–“A5”), each of which containing the 20 xlsx files with G-count format, are built under “LY34” folder. 7. Check the input format checkbox in the “Measurements/SMT parameters” panel to fit the data format (see Fig. 3a).

402

Masataka Yanagawa and Yasushi Sako

Fig. 3 Summary of the use of the smDynamicsAnalyzer. (a) Screenshots of the parameter panel (top) and the analysis button panel (bottom). The basic workflow is depicted as a flow chart. (b) The folder structure containing the SMT data sets to load into the smDynamicsAnalyzer. The AAS (csv file) and the G-count (xlsx file) formats are exemplified

Single-Molecule Imaging Analysis

403

8. Push “Total Basic Analysis” button and select the folder containing the subfolders to be compared, then all the analyzes of the selected folder are automatically performed (see Subheadings 3.8.12, 3.8.21, and Note 23). 3.8.2 Respective Analysis of the AAS and G-Count Data Formats: Total Analysis of the Data in a Folder (See Fig. 4a)

1. Make a folder containing at least three sample data files. In Fig. 4, we made a “test” folder containing three xlsx files (test1, test2, test3) with G-count format for the test run to set proper parameters. 2. Click the “Respective Analysis” button after setting the parameters in the parameter panel. 3. Input an arbitrary “Sample Name” (e.g., “test”) in the pop-up panel, and then click the “continue” button. 4. Select the folder containing the data files (e.g., the “test” folder). 5. Click the “Respective Analysis” button, which starts all the macros in the box below sequentially. Load ! Trace ! MSD-dt!Hist D!Intensity ! Density ! Off-rate ! On-rate ! stats (see Subheadings 3.8.3–3.8.11 regarding each macro). 6. Temporarily ignore the error and wait until the macro finishes if you get an error message caused by the poor fitting of the graph during the process. Push “continue” button in case you set the debugger on. 7. Restart the macro, if a poor curve fitting error pops up, by clicking the appropriate button again after changing the parameters in the parameter panel (e.g., click “MSD-dt” button if a poor curve fitting error pops up in the process of MSD-Δt plot analysis.). 8. Perform the parameter optimization until no more error signs are posted in the fitting results for each item (see Note 24).

3.8.3 Load: Load Input Data (See Fig. 4b)

1. Click the “Load” button after building a folder structure as shown in Subheading 3.8.2. 2. Input an arbitrary “Sample Name” (e.g., “test”) in the pop-up panel, and then click the “continue” button. 3. Select the folder containing the data files (e.g., the “test” folder), where the macro automatically creates “Sample Name” folder under the root folder, then “Folder Name” folders under “Sample Name” folder in Igor, that is, “Folder Name” ¼ “Sample Name” + file number. and the macro also makes waves that are loaded from a data file into the “Folder Name” folder and outputs tables loaded (see Notes 25–29).

404

Masataka Yanagawa and Yasushi Sako 7HVWUXQZLWK DWOHDVWWHVWGDWD

D

5HVSHFWLYH$QDO\VLV  3XW WHVW GDWD ILOHV LQ D IROGHU DW OHDVW  ILOHV IRU VWDWV

 &OLFN

/RDG

/RDGGDWDILOHVLQWKHVHOHFWHGIROGHU

7UDFH

2XWSXW;Color>Arrange Channels. 18. The GridAligner automatically generates the image with the suffix “aligned” after affine transformation. This process is time-consuming because the GridAligner does not support the batch processing. We recommend an alternative affine

Single-Molecule Imaging Analysis

425

transformation program in a shareware package for the SMI analysis: Auto Analysis System (AAS), Zido (https://zido.co. jp/en/). 19. We previously used G-count software (G-angstrom) for SMT analysis [4], but the G-count does not support the batch processing. One may use the AAS (Zido, https://zido.co.jp/ en/) too for SMT analysis with a similar algorism to G-count. The VB-HMM analysis can be performed with a LabViewbased homemade program as previously described in detail [4]. The VB-HMM analysis enables to assign a diffusion state to each step of the trajectories. The clustering algorism is based on the following assumptions: (1) the diffusion states of molecules are in a steady state among several states with different diffusion coefficients, (2) the transition from one state to the other follows a Markov process. The number of the diffusion states can be estimated from a comparison of the lower-bound values of the likelihood that are calculated based on the VB expectation-maximization algorithm [4]. Here, we provide an example of raw data after VB-HMM analysis of TMR-labeled mGluR3 and GFP-labeled clathrin light chain (CLC) (https:// github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer). The latest AAS after version 2.4 incorporates the fast VBHMM analysis option. The vbSPT is a similar program that is available as an open-source software working in MATLAB (http://vbspt.sourceforge.net/) [21]. The parameter settings in the AAS are as follows: (a) Parameters for single-molecule detection within a frame of the multiple tif image. As shown in Fig. 2b, the image of each frame is scanned with a square ROI (N
N pix) sliding with a scan size (M pix). In each ROI, the following “2D Gaussian function on a primary plane” is used to fit and detect the bright spots with an intensity over the threshold (Imin):
 I x, y; x g , y g , σ x , σ y , I max , a, b, I back 0
2 1  2 y  y g C B x  xg ¼ I max exp @  A þ ax þ by þ I back, 2σ x 2 2σ y 2 where (xg yg) is the centroid of a bright spot that has a peak intensity Imax. The 2D Gaussian fitting can be done by the Levenberg-Marquardt method. The bright spot is assumed to be on an inclined plane described by ax + by + Iback. We found that M should be lower than N/4 to reduce detection errors at ROI boundaries. Imin depends on the experimental and image processing conditions. Increase the Imin if

426

Masataka Yanagawa and Yasushi Sako

the noise spots are over detected. Decrease the Imin if the bright spots, which can be detected by eye, are not detected (e.g., ROI size (N): 12 pix, scan length (M): 3 pix, light intensity threshold (Imin): 20). (b) Parameters for connecting coordinates of a spot over frames to make trajectories. When two spots detected in successive frames are within the “connection distance (D)” and within the “connection longest frame (L),” they are connected as a trajectory of a single molecule. If there are more than two spots meeting the criteria above, the closest spots are connected. If the two spots in frame i and frame i + L are connected as a trajectory, and if there are no spots corresponding the trajectory in frames between i and i + L, the localization and the intensity of the spot in frames between i and i + L are linearly complemented by the data of spots in the frame i and frame i + L. The trajectories shorter than minimum trajectory length (m) are deleted to reduce the false-positive detection of noise spots. For example, connection longest frame (L): 2 frames. Connection distance (D): 8 pix. Trace minimum frame number (m): 3 frames (over 15 frames are recommended for VB-HMM analysis). The higher L and D values are set, the more misconnected are the trajectories of different molecules. In contrast, the lower L and D values are set, the less detected are the trajectories with a high-diffusion coefficient. AAS can output the following files when the check boxes for the required items are checked: (a) Trajectory files: the csv (see Fig. 2b) and/or binary files of trajectories. (b) Image files to check the result: 8-bit tif files with ROIs on the spots detected (see Fig. 2b). (c) Statistics of each multiple tif file: MSD within frames (Δt ¼ frame rate
frames). Displacement histogram within a frame time. Intensity histogram of all the spots. We do not output (iii) because the more advanced analysis can be performed by using homemade program “smDynamicsAnalyzer” in Igor Pro 8.0 as a platform (see Subheading 3.7). Many SMT programs in various platforms are available now as alternatives to the AAS and G-count (e.g., TrackMate in ImageJ/Fiji, Spot Tracking in Icy, SMTracker in MatLab). Every program has its own unique merits. Chenouard et al. compared the performances of the 14 methods of the SMT

Single-Molecule Imaging Analysis

427

analysis to simulation data with various signal-to-noise (S/N) ratios [17]. The performance of each program is influenced by the S/N ratios of the simulation data. Moreover, noise properties in the experimental data are even more complicated than ones in the simulation data. No matter what programs, it is important to make sure that the output trajectories from a sample movie match the trajectories of the spots followed by your naked eyes. If there is an obvious difference between them, consider changing the parameters or the program to use. We consider that the differences in the diffusion dynamics of GPCRs proposed in the previous reports [4, 11–16] may be partly due to the differences in these parameters or the algorisms of SMT analysis. The comprehensive SMI analysis of GPCRs by the same platform is required to reveal the similarity and diversity of the dynamics of GPCRs. The advantages of AAS are that it supports batch processing and parallel computing modes to speed up the SMT analysis, which is even advantageous for handling such large data. 20. One may freely customize and use the macro with suitable citations of this chapter. For more detailed instructions, refer to the supplementary PDF file uploaded to the following URL (https://github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer). 21. In the “Measurement/SMT Parameters” section, input the proper values regarding the measurement setting and SMT analysis (e.g., Set “Frame rate [sec]” as 0.0305 when the exposure time was 30.5 ms. Set “Frame number” as 100 when the files analyzed by SMT were 100 frames. Set “Pixel Size [um/pix] as 0.067 when the pixel size was 67 nm/pixel. Set “Min frame” as 15 when the minimum frame of trajectories in the SMT analysis was 15 frames, which corresponds to “trace minimum frame number” in the AAS.). For other sections, a parameter optimization by using test data is required to get proper fitting results before starting “Total Basic Analysis” (see Subheading 3.8.21). 22. Three input formats are available (AAS.csv, G-count.xlsx, and HMM.xlsx). If you use other SMT or clustering program, refer to the sample files (https://github.com/masataka-yanagawa/ IgorPro8-smDynamicsAnalyzer) and modify the file format to one of the formats. The smDynamicsAnalyzer loads information about the time point of spots detected [frame] (column B in AAS.csv, column C in G-count.xlsx, and column G in HMM.xlsx), the X-coordinate [pix] (column C in AAS.csv, column D in G-count.xlsx, and column B in HMM.xlsx), the Y-coordinate

428

Masataka Yanagawa and Yasushi Sako

[pix] (column E in AAS.csv, column F in G-count.xlsx, and column C in HMM.xlsx), and the raw intensity after subtracting the background plane (column K in AAS.csv, column F in G-count.xlsx, and column D in HMM.xlsx) (see Figs. 3b and 9a). In addition, the smDynamicsAnalyzer loads the diffusionstate parameters estimated from the VB-HMM clustering analysis. The transition array highlighted by green is related to the probability of the state transition within a step. The area highlighted by yellow and orange corresponds to the mean stepsize, which is related to the diffusion coefficient [μm2/s], and the initial fraction of each state in trajectories, respectively (see Fig. 9a). 23. The “Total Basic Analysis” starts “Respective analysis” of each folder (e.g., A1 to A5) in the selected folder (e.g., “LY34” folder), followed by “Comparison Analysis” (see Subheadings 3.8.13–3.8.20). The experimental file is automatically saved after “Respective analysis” and “Comparison Analysis.” Note that the demo version of Igor is not able to save, so an error will appear. 24. You can skip the parameter optimization process if you do not use the item, although you will get an error message. 25. Refer to the Fig. S1 in the supplementary PDF file uploaded to the following URL as well (https://github.com/masatakayanagawa/IgorPro8-smDynamicsAnalyzer).The filename of the csv/xlsx file is irrelevant to the “Folder Name” in Igor. 26. Push “Ctrl+B” to open the Igor data browser. You can delete an item by right click and select “delete object.” You cannot delete a folder from the data browser if you are opening tables or graphs containing a wave in the folder. 27. Push “Ctrl+8” to close all the tables in Igor before you delete the folder. 28. Push “Ctrl+9” to close all the graphs in Igor before you delete the folder. 29. To import data from other Igor files that are analyzed by the smDynamicsAnalyzer beforehand, click “Brows Expt.” button in the Igor data browser and select the Igor file. You can drag and drop the data folders from the browsing file to the current file. 30. Push “Ctrl+D” to duplicate a selected item. 31. Refer to the Figs. S2 and S3 in the supplementary PDF file uploaded to the following URL as well (https://github.com/ masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). This macro assumes 512
512 pix images. Change the display range by using “Modify Axis” panel, which will pop-up after double clicking the X or Y axis of a graph if required.

Single-Molecule Imaging Analysis

429

32. The parameter settings for the MSD-Δt plot analysis are as below. Refer to Figs. S4, S5, and S6 in the supplementary PDF file uploaded to the following URL as well (https:// github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer). (a) “Range [frames]” and “Threshold [%]” in Fig. 3a determine the maximum value of Δt. (b) If the checkbox “Time Average” in Fig. 3a is checked, the macro calculates the time- and ensemble-averaged MSD of all the trajectories in each “Folder Name” folder; otherwise, the macro calculates the ensemble-averaged MSD. The time-averaged MSD within time nΔt of each trajectory is calculated by the following function: MSDðnΔt Þ ¼

i XN 1n h 1 2 2 , ð x ð j Δt þ nΔt Þ  x ð j Δt Þ Þ þ ð y ð j Δt þ nΔt Þ  y ð j Δt Þ Þ j ¼1 N 1n

ð1Þ where n is the length of frames, Δt is the frame rate, and N is the total frame number of the trajectory. The non-time-averaged MSD within time nΔt of each trajectory is calculated by the following function: MSDðnΔt Þ ¼ ðx ðnΔt Þ  x ð0ÞÞ2 þ ðy ðnΔt Þ  y ð0ÞÞ2 ,

ð2Þ

then, the ensemble-averaged MSD () is calculated by the following function: 1 XM MSDðnΔt Þ, ð3Þ < MSDðnΔt Þ >¼ i¼1 M where M is the total number of trajectories. (c) “Frame of Davg“in Fig. 3a specifies the point of Δt to calculate the MSD and Davg to be compared in “Comparison Analysis” (see Subheadings 3.8.13, 3.8.14, and 3.8.20). The Davg is calculated based on the two-dimensional diffusion equation as follows: D avg ðnΔt Þ ¼

< MSDðnΔt Þ > 4nΔt

ð4Þ

(d) The MSD-Δt plots are fitted using the following two equations: MSDðΔt Þ ¼ 4D 0 Δt α  4ε2 ,    L2 12D 0 Δt 1  exp MSDðΔt Þ ¼  4ε2 : 3 L2

ð5Þ ð6Þ

430

Masataka Yanagawa and Yasushi Sako

Only the fitting results of Eq. (6) are used in “Comparative Analysis.” The fitting results of Eq. (5) can be checked in the “fit_D_Alph_m” wave in the “Matrix” folder in each “Folder Name” folder. (e) If the fitting results are of less quality, change the initial parameters (D0, α, L, ε) and click the “MSD-Δt” button again to reanalyze them. Repeat it until there are no more error messages. (f) D0 is related to the initial slope of the MSD-Δt plot (4D0 is the initial slope of Eq. 1, when α ¼ 1, and of Eq. 5). (g) α is an index reflecting a diffusion mode. If α ¼ 1, the molecules exhibit the simple Brownian diffusion in the average. If α > 1, the molecules exhibit the directed diffusion mode in the average. If α < 1, the molecules exhibit the confined diffusion mode in the average. (h) L is the confinement length of the confined diffusion. (i) ε is an error term that depends on the positional accuracy of the SMT analysis. If the checkbox “Fix ε” is checked, the input value is calculated as a fixed constant in the curve fitting; otherwise, the input value is calculated as an initial value. 33. The parameter settings for the displacement histogram analysis are as below. Refer to Figs. S7, S8, and S9 in the supplementary PDF file uploaded to the following URL as well (https:// github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer). (a) “Bin [um]” and “Dim” determine the X-axis range of the displacement histogram. (b) The displacement histograms are fitted using the following equation: P ðr Þ ¼

  r r 2 exp : A i¼1 i 2D i Δt 4D i Δt

Xn

(c) “r” is the mean displacement (r ¼ (Δt).

ð7Þ

pffiffiffiffiffiffiffiffiffiffiffiffi MSD) within a frame

(d) “Di” is the diffusion coefficient of the i-th state. (e) “Ai” is a coefficient that is related to the fraction of the i-th state. (f) “n” is the number of the states. (g) “Min” and “Max” specify the range of “n” in the fitting function. Enter the natural number between 1 and 5. When you set the “Min” and “Max” values as “2” and “4,” the displacement histogram is fitted with the two-,

Single-Molecule Imaging Analysis

431

three-, and four-state models. Then, the model with the lowest Akaike information criterion (AIC) value is selected. AIC is defined as follows:     AIC ¼ n log 2πσ 2 þ 1 þ 2ðp þ 1Þ,

ð8Þ

where n is the number of data points for the curve fitting, σ 2 is the residual sum of squares (RSS), and p is the number of free parameters. (h) To compare the fitting results among data from different cells, the fitting model should be fixed. It is recommended to select the model first by changing the number of states, then to do all the analyses with the selected number of states. Set the “Min” and “Max” values to the same value to fix the state number. (i) The fitting result is sensitive to the initial values. If the fitting results are of less quality, change the initial values (A1–A5, D1–D5) and click the “Hist D” button to reanalyze them. Repeat it until there are no more error messages. (j) In the HMM format analysis, each displacement histogram of the diffusion state is fitted with the function of the one-state model of Eq. (7), where n ¼ 1. In this step, it is possible to visualize what kinds of step-size distribution are assigned to each diffusion state by VB-HMM analysis. 34. The parameter settings for the intensity histogram analysis are as below. Refer to the Figs. S10, S11, and S12 in the supplementary PDF file uploaded to the following URL as well (https://github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer). (a) “Bin” and “Dim” determine the X-axis range of the intensity histogram. (b) The intensity histograms are fitted using the following equation: P ðx Þ ¼

  ðx  nI Þ2 A exp  : n¼1 n 2nσ 2

XN

ð9Þ

(c) “I” and “σ” in the equation are the mean and standard deviation (SD) of the intensity of a single fluorophore, respectively. “Mean” and “SD” in the parameter panel correspond to I and σ, respectively, in the curve fitting. When the checkbox “Fix Mean & SD” is activated, I and σ are fixed to the input values; otherwise, the input values are calculated as the initial values of the curve fitting. (d) “An” is a coefficient that is connected to the fraction of the n-th state.

432

Masataka Yanagawa and Yasushi Sako

(e) “n” is the oligomer size. (f) “N” is the maximum oligomer size to be considered in the model. (g) “AIC: Min” and “Max” specify the range of “N” in the fitting function. Enter the natural number between 1 and 20. When you set the “Min” and “Max” values as “2” and “16,” the displacement histogram is fitted with the 2–16state models. Then, the model with the lowest AIC value is selected (Eq. 8). (h) To compare the fitting results among data from different cells, they should be taken from the same fitting model. It is recommended to select an appropriate model first by changing the number of states, then to do all the analyses with the selected number of states. Set the “Min” and “Max” values to the same value as the appropriate number of states in order to fix the state number. (i) Check the fitting results to confirm that the Mean and SD values are within the appropriate range for a singlemolecule intensity. In the cases of (1), the number of states in the fitting model is too large or (2) the initial value is too small from the single-molecule intensity; the Mean and SD values are often estimated as less than half of the singlemolecule intensity. It is usually difficult to estimate the number of states just from the AIC comparison in that situation. To determine the single-molecule intensity precisely, a control experiment is required, where a monomeric protein, such as CD86 with the same FL label, is measured in the same settings. (j) In the HMM format analysis, all the intensity histograms in the graph are globally fitted using the Eq. (9), where the I and σ are set as global variables. 35. The parameter settings for the density analysis are as below. Refer to the Figs. S13 and S14 in the supplementary PDF file uploaded to the following URL as well for more details (https://github.com/masataka-yanagawa/IgorPro8smDynamicsAnalyzer). (a) “Bin [um]” and “Dim” in Fig. 5a determine the X-axis range of the local density plots. (b) “Start” and “End” in Fig. 5a define the range of the frames to be analyzed. The particle localization within the selected frames is plotted in the XY-plot as red dots (see Fig. 5b, Start: 30–End: 60). The “Start” frame should be more than “Min frame,” and the “End” frame should be less than “Frame Number–Min frame,” where the “Min frame” is the parameter in the

Single-Molecule Imaging Analysis

433

“Measurement/SMT parameters” section on the parameter panel (see Fig. 3a). In the SMT analysis, the lengths of the trajectories are biased at around both ends of the movies because the trajectories are broken off at both ends. To avoid such an edge effect in the SMT analysis, it is better to exclude the edge frames of the movies from the range of the density analysis. Because the density analysis of long frames is timeconsuming, we recommend for “Start” to set “Min frame” and for “End” to set “Min frame+5”. (c) The mean local density plots are calculated from the distribution of the localization coordinates in each frame based on the following function: d avg ðr Þ ¼

1 Xn N Pi ðr Þ , i¼1 πr 2 n

ð10Þ

where “n” is the number of localization within the frame, and NPi(r) is the number of points N within a distance r of point i. Namely, the red curves in Fig. 5b correspond to the mean local density around in the vicinity of r from each localization within a frame are plotted against r. (d) When r is less than the distance from the most adjacent spot, the mean density function is defined as follows: davg(r) ¼ 1/πr2. When r is more than that, the mean local density becomes closer to the mean density of spots in the cell. If the region of the cell were infinitely extended, the limit of the mean local density function would converge to the mean density. In reality, because the cell has the edge, the mean local density function reaches a plateau, followed by the convergence to 0. The mean local density function decreases inversely proportional to πr2 when r becomes larger than the long-axis radius of the cell. (e) Consequently, the mean density of the spots in the cell within each frame can be approximately estimated as the plateau value of the mean local density function. The plateau value is estimated from the first-order difference of the mean local density curves (the blue curves in Fig. 5c). The mean local density at the peak of the blue curves is adopted as the mean density of each frame. rdmax is the distance which gives the mean density. (f) “Smoothing: frames” in Fig. 5a is a parameter to find peak (rdmax) in the middle panel. The blue curves are plotted after smoothing by a moving average with the window width of the input value to find the peak properly. Increase it if the peak detection was improper due to the noise.

434

Masataka Yanagawa and Yasushi Sako

(g) The blue circles with rdmax are plotted around each localization in Fig. 5b. The region of the circles does not cover the cell region if the peak detection is improper. (h) The estimated density and area surrounding the spots (cell area) in each frame are plotted in Fig. 5d. The cell area is estimated as “number of spots/density.” The average values of all the analyzed frames are used as the representative values of the density and area of the cell in the “Comparison analysis” (see Subheading 3.8.19). (i) The mean density of spots is often calculated by dividing the number of spots by the area of the cell region that is manually enclosed around the spots (see Fig. 5e). However, the “by-hand method” is time-consuming and difficult to reproduce. The density-analysis macro automatically provides the mean density of spots comparable to that estimated from the conventional “by-hand method” (see Fig. 5e). Even the analysis of a single-frame can provide estimation results that are comparable to those of manual analysis (see Fig. 5e). 36. The interpretation of “On-rate” and “Off-rate”: The terms “On-rate” and “Off-rate” are intended to analyze the on- and off-rates of a cytoplasmic protein to the PM in a steady state, or of a protein in solution to the coverslip in vitro. For example, we previously analyzed the changes of the on- and off-rates of wild-type and mutants of Sos [22], Raf [23], and RalGDS [24] proteins to the PM upon EGFR activation, which suggested the role of each domain of the proteins in the interaction with signaling molecules, such as Ras (see Fig. 6a). In the case of the analysis of a membrane protein, including GPCR, the terms “On-rate” and “Off-rate” are considered to be inverse to the reality in a steady state. For example, one of the trajectories ends when two molecules associate to form a dimer, which is counted as an event regarding “Off-rate”. In contrast, when a new trajectory starts when the dimer dissociates into two monomers, it is counted as an event regarding “On-rate” (see Fig. 6b). 37. The parameter settings for the off-rate analysis are as below. Refer to the Figs. S15 and S16 in the supplementary PDF file uploaded to the following URL as well (https://github.com/ masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). (a) The decay curves are fitted using the following equation: P ðt Þ ¼

  t A exp : i¼1 i τi

Xn

ð11Þ

Single-Molecule Imaging Analysis

435

(b) “Ai” is a coefficient that is related to the fraction of the i-th state. The input values “A1”–“A5” in the parameter panel are calculated as the initial values of the curve fitting. (c) “τi” is the exponential decay time constant of the i-th state. The input values “Tau1”–“Tau5” in the parameter panel are calculated as the initial values of the curve fitting. (d) “n” is the maximum number of exponential to be considered in the model. (e) “Min” and “Max” specify the range of “n” in the fitting function. Enter the natural number between 1 and 5. When you set the “Min” and “Max” values as “1” and “3,” the displacement histogram is fitted with the single-, double-, and triple-exponential functions. Then, the model with the lowest AIC value is selected. (f) If the check box “Frame Edge Correction” is checked, the decay curve plot is created except for the trajectories that start in the first frame or end in the last frame to avoid the edge effect of SMT analysis. 38. The parameter settings for the on-rate analysis are as below. Refer to the Figs. S17 and S18 in the supplementary PDF file uploaded to the following URL as well (https://github.com/ masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). (a) The cumulative event number plots are fitted using the following equation:

 t f ðt Þ ¼ V 0 1  exp : tau

ð12Þ

(b) “V0” is the initial slope of the cumulative event number plot. The input value in the parameter panel is calculated as the initial value of the curve fitting. (c) “Tau” is the exponential decay time constant, which is required when the cumulative event number plot is not linear due to the photobleaching. The input value in the parameter panel is calculated as the initial value of the curve fitting. (d) The on-rate is calculated as V0/Areacell. If the check box “Fix Area [μm2]” is unchecked, the area of cell estimated from the density analysis is assigned to Areacell (see Note 35); otherwise, Areacell was fixed as the input value. The latter is useful for in vitro single-molecule analysis or for the analysis of a cell region cropped to a certain size. 39. Refer to the Figs. S19 and S20 in the supplementary PDF file uploaded to the following URL as well (https://github.com/ masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). Matrix folder contains a side-by-side matrix wave of each analysis

436

Masataka Yanagawa and Yasushi Sako

results in the “Folder Name” folders. Results folder contains the stats waves with suffix “mean,” “sd,” “sem,” and “n.” At least three data are required for the calculation of the stats waves. 40. In the case of “Total Basic Analysis,” the name of each folder (e.g., “A1”–“A5”) is entered as “Sample Name” in the macros automatically. Do not set too long folder names and/or folder names with space. 41. In the example in Fig. 7, the five folders “A1”–“A5” are sequentially analyzed by the “Respective Analysis” as shown in the Subheadings 3.8.2–3.8.11. Then, “Comparison Analysis” that outputs graphs and tables that compare the analysis results in the Matrix or Results folders (see Subheadings 3.8.13–3.8.20). 42. Refer to the Figs. S21 and S22 in the supplementary PDF file uploaded to the following URL as well (https://github.com/ masataka-yanagawa/IgorPro8-smDynamicsAnalyzer). Preexistence of “Comparison” folder in the Igor data browser sometimes causes an error. If you get an error message, delete the “Comparison” folder under the root folder (open data browser (Ctrl + B), right click the “Comparison” folder, and select “delete object”) (see Notes 26–28). 43. The multiple comparison macros run the program built into Igor as shown below: ANOVA1: Statistics > One-way ANOVA test (Welch test, Alpha: 0.05). Dunnett test: Statistics > Multicomparison test > Dunnett (Alpha: 0.05, tail: mean1 ¼ mean2). The left most group in the violin/box plot is selected as the control wave. Tukey test: Statistics > Multicomparison test > Tukey (Alpha: 0.05). Dunn test: Statistics > Multicomparison test > Nonparametric multiple contrasts > Dunn-Holland-Wolfe test (Alpha: 0.05, tail: mean1 ¼ mean2). 44. The violin/box plot is a graph that the violin and box plots are merged. One can remove any of the plots by right clicking the graph and selecting “Remove from Graph.” The format of the plots can be changed through following the path: “Graph>Modify Box Plot” or “Graph>Modify Violin Plot.” The default settings of the plots are as follows: Violin Plot: Bandwidth Method: Silverman, Kernel: Gaussian, show data points as open circle, show Mean as closed diamond.

Single-Molecule Imaging Analysis

437

Box Plot: Whisker Method: One standard deviation, Quartile Method: Tukey, show Median as line, show data as open circle, show outliers as open-red circle, show mean as red diamond. 45. In the 2D plot of Fig. 8v, the mean oligomer size of mGluR3 shows a positive correlation to the particle density as previously described in [4]. Each point corresponds to the data from the cell. The dashed lines show linear fitting of the points in the same “Sample Name” folder. 46. The example data in Fig. 10 are the TMR channel data in the dual-color SMI of mGluR3-TMR and the CLC-EGFP (see Fig. 1). The VB-HMM data in two ligand conditions (Inactive: 100 nM LY341495, and Active: 100 μM LY379268) are compared. 47. The agonist induces decrease of the diffusion coefficient of mGluR3 in the immobile, slow, and medium states to a statistically significant extent as observed (see Fig. 10e–g), which is consistent with the MSD-Δt plots (see Fig. 10a–c). 48. The agonist induces decrease of the medium-state fraction of mGluR3 and increase of the immobile-state fraction to a statistically significant extent as observed (see Fig. 10i, k). 49. The macro also generates the line graphs of the partial oligomer size distribution of each diffusion state that is normalized with the total sum of all the four states. Namely, the plotted values are the product of “percentile of each oligomer size in each state” and “fraction of each state.”s. 50. The example data in Figs. 11 and 12 shows the dual-color SMI of mGluR3-TMR and the CLC-EGFP (see Fig. 1). The VB-HMM data were compared in two ligand conditions (Inactive: 100 nM LY341495 and Active: 100 μM LY379268). In advance, we performed “Total Basic Analysis” of TMR channel (“mGlu3_LY34” & “mGlu3_LY37”) as shown in Subheading 3.8.21 and of GFP channel (“CLC_LY34” & “CLC_LY37”). 51. The parameter settings for the colocalization analysis are as below. The parameters, “Max distance [nm]” and “Max D ratio,” are the thresholds to define colocalization (see Fig. 11a). The colocalization of two particles is detected if the two particles are within the “Max distance [nm]” in the same frame and if the diffusion coefficient ratio of the two particles is less than “Max D ratio.” When judging the ratio of the diffusion coefficient of two particles (D1/D2) are less than “Max D ratio” or not, the D1/ D2 is calculated from the step size (r1 and r2) between two frames, where D1/D2 ¼ (r1/r2)2 and D1 > D2. If you do not

438

Masataka Yanagawa and Yasushi Sako

want to set the “Max D ratio” condition, set the value large enough to ignore it. Here, we set the “Max distance [nm]” as 100 nm based on the localization accuracy (20–30 nm in each channel) and “Max D ratio” as 100 to reduce the detection of random colocalization. If the checkbox “Same HMM D-state” is checked (see Fig. 11a), the colocalization is defined as the two particles meeting the criteria: (1) the distance between two particles is within the “Max distance [nm]” in the same frame, and (2) the two particles are in the same diffusion state. In this case, the macro ignores the “Max D ratio” condition. To avoid the fragmentation of the colocalization trajectory due to the photoblinking of the fluorophores and/or an analytical error, a noncolocalization frame sandwiched between two colocalization frames is defined as a colocalization frame in the macro. 52. The “Find Col.” macro automatically creates the “Col” and “EC” folders under the root folder (see Fig. 11a). The trajectories, where any length of colocalization is detected, are displayed in red (SampleName1) and green (SampleName2) in the XY plots. These trajectories are stored in the “SampleName1” and “SampleName2” subfolders in the “Col” folder. Trajectories in the colocalization frames, which were extracted into the “SampleName1” and “SampleName2” subfolders in the “EC” folder, are displaced in yellow in the XY plots (see Fig. 11b). All the colocalization analysis results are stored in the “EC” folder. 53. The “Hist D” macro in the “Colocalization Analysis” automatically performs the analysis as described in the Subheading 3.8.25 (see Note 33) using the waves in the “SampleName1” and “SampleName2” subfolders inside the “EC” folder. The small number of the colocalization frames often causes a curvefitting error. Ignore the error and skip this process in that case. 54. The “On-rate” macro in the “Colocalization Analysis” automatically performs the analysis as described in the Subheading 3.8.10 (see Note 38) using the waves in the “SampleName1” and “SampleName2” subfolders inside the “EC” folder. 55. The “Off-rate” macro in the “Colocalization Analysis” automatically performs the analysis as described in the Subheading 3.8.9 (see Note 37) using the waves in the “SampleName1” and “SampleName2” folders inside the “EC” folder. 56. These macros are not included in the “Colocalization Analysis.”

Single-Molecule Imaging Analysis

439

57. In the “Intensity” analysis, the same analysis in the Subheading 3.8.23 is performed in the “SampleName1” and “SampleName2” subfolders inside the “EC” folder. 58. In the example in Fig. 12, the “CLC_LY34” and “CLC_LY37” folders are moved to “Package” folder by drag and drop to compare the “mGlu3_LY34” and “mGlu3_LY37” folders (see Fig. 12a). 59. In the way of the “Comparison Parameters” analysis after “Colocalization Analysis,” error signs may pop up if “Comparison” folder exists inside the “EC” folder. If you get an error message, delete the “Comparison” folder in the “EC” folder (Open data browser (Ctrl+B), right click the “Comparison” folder, and select “delete object”). 60. “Pcol” macro outputs the violin/box plots of the colocalization rate (percent total steps) and of the binding affinity (KB), which were calculated in the “Find Col.” analysis (see Subheading 3.8.31). In the example, the Pcol and KB were significantly increased upon activation of mGluR3 (see Fig. 12b, c). The Pcol and KB were defined as follows: P col ¼

½Ch1˜ nCh2 ½Ch1tot

or P col ¼

KB ¼

½Ch1˜ nCh2 , ½Ch1½Ch2

½Ch1˜ nCh2 ½Ch2tot

ð13Þ ð14Þ

where [ch1·ch2] ¼ (the number of the colocalization frames)/Areacell, [ch1]tot ¼ (the total step number of ch1)/ Areacell, [ch2]tot ¼ (the total step number of ch2)/Areacell, [ch1] ¼ [ch1]tot  [ch1·ch2], and [ch2] ¼ [ch2]tot  [ch1·ch2]. The Areacell was estimated from the density analysis (see Note 35 and Fig. 5). 61. “On-rate” macro outputs the violin/box plots of the on-event rate parameter. In the example, the association rate between mGluR3 and CLC is increased to a statistically significant extent upon activation (see Fig. 12d). 62. “Off-rate” macro outputs the mean-decay curves of the colocalization duration (mean  sem of the cells) and the violin/ box plots of the off-rate parameters. In the example, the decay time constants of the mGluR3/CLC complex are increased to a statistically significant extent upon activation (see Fig. 12e). 63. “D ratio” macro outputs the violin/box plots of the fractions of each diffusion state in the colocalize steps, where the sum of the ratio of four states should be 100%. In the example, significantly observed is the increase in the immobile-state fraction and decreases in the medium- and the

440

Masataka Yanagawa and Yasushi Sako

fast-state fractions in the colocalization frames of mGluR3 upon its activation (see Fig. 12f–i). Then, the macro also outputs the violin/box plots of the product of “Dratio” and “Pcol,” where the sum of the colocalization ratio of four states is “Pcol.” In the example, the increases of immobile-, slow-, and medium-state fractions are observed to a statistically significant extent due to the increase of mGluR3/CLC complex upon activation (see Fig. 12j–m).

Acknowledgments We thank J. Nathans (Johns Hopkins University) for providing us with the HEK293S cell line, M. Murata for the cDNA of EGFPtagged CLC, and R. D. Vale (University of California San Francisco) for plugins of ImageJ. This work was supported by the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (Grants-in-Aid for Scientific Research 19H05647 for Y. S and 16K18533, 20K05760 for M.Y.), and RIKEN Pioneering Project, Integrated Lipidology, and Glycolipidologue Initiative for Y. S., and a designated donation to M.Y. References 1. Santos R, Ursu O, Gaulton A, Bento AP, Donadi RS, Bologa CG et al (2017) A comprehensive map of molecular drug targets. Nat Rev Drug Discov 16(1):19–34. https://doi. org/10.1038/nrd.2016.230 2. Tang XL, Wang Y, Li DL, Luo J, Liu MY (2012) Orphan G protein-coupled receptors (GPCRs): biological functions and potential drug targets. Acta Pharmacol Sin 33 (3):363–371. https://doi.org/10.1038/aps. 2011.210 3. Zhang R, Xie X (2012) Tools for GPCR drug discovery. Acta Pharmacol Sin 33(3):372–384. https://doi.org/10.1038/aps.2011.173 4. Yanagawa M, Hiroshima M, Togashi Y, Abe M, Yamashita T, Shichida Y et al (2018) Singlemolecule diffusion-based estimation of ligand effects on G protein-coupled receptors. Sci Signal 11(548). https://doi.org/10.1126/ scisignal.aao1917 5. Yasui M, Hiroshima M, Kozuka J, Sako Y, Ueda M (2018) Automated single-molecule imaging in living cells. Nat Commun 9 (1):3061. https://doi.org/10.1038/s41467018-05524-7 6. Senning EN, Gordon SE (2015) Activity and Ca2+ regulate the mobility of TRPV1 channels

in the plasma membrane of sensory neurons. Elife 4:e03819. https://doi.org/10.7554/ eLife.03819 7. Sako Y, Minoguchi S, Yanagida T (2000) Single-molecule imaging of EGFR signaling on the surface of living cells. Nat Cell Biol 2 (3):168–172. https://doi.org/10.1038/ 35004044 8. Miyanaga Y, Matsuoka S, Ueda M (2009) Single-molecule imaging techniques to visualize chemotactic signaling events on the membrane of living Dictyostelium cells. Methods Mol Biol 571:417–435. https://doi.org/10. 1007/978-1-60761-198-1_28 9. Hiroshima M, Saeki Y, Okada-Hatakeyama M, Sako Y (2012) Dynamically varying interactions between heregulin and ErbB proteins detected by single-molecule analysis in living cells. Proc Natl Acad Sci U S A 109 (35):13984–13989. https://doi.org/10. 1073/pnas.1200464109 10. Hiroshima M, Pack CG, Kaizu K, Takahashi K, Ueda M, Sako Y (2018) Transient acceleration of epidermal growth factor receptor dynamics produces higher-order signaling clusters. J Mol Biol 430(9):1386–1401. https://doi.org/10. 1016/j.jmb.2018.02.018

Single-Molecule Imaging Analysis 11. Hern JA, Baig AH, Mashanov GI, Birdsall B, Corrie JE, Lazareno S et al (2010) Formation and dissociation of M1 muscarinic receptor dimers seen by total internal reflection fluorescence imaging of single molecules. Proc Natl Acad Sci U S A 107(6):2693–2698. https:// doi.org/10.1073/pnas.0907915107 12. Kasai RS, Suzuki KG, Prossnitz ER, KoyamaHonda I, Nakada C, Fujiwara TK et al (2011) Full characterization of GPCR monomer dimer dynamic equilibrium by single-molecule imaging. J Cell Biol 192(3):463–480. https://doi. org/10.1083/jcb.201009128 13. Calebiro D, Rieken F, Wagner J, Sungkaworn T, Zabel U, Borzi A et al (2013) Single-molecule analysis of fluorescently labeled G protein-coupled receptors reveals complexes with distinct dynamics and organization. Proc Natl Acad Sci U S A 110 (2):743–748. https://doi.org/10.1073/pnas. 1205798110 14. Tabor A, Weisenburger S, Banerjee A, Purkayastha N, Kaindl JM, Hubner H et al (2016) Visualization and ligand-induced modulation of dopamine receptor dimerization at the single molecule level. Sci Rep 6:33233. https://doi.org/10.1038/srep33233 15. Ge B, Lao J, Li J, Chen Y, Song Y, Huang F (2017) Single-molecule imaging reveals dimerization/oligomerization of CXCR4 on plasma membrane closely related to its function. Sci Rep 7(1):16873. https://doi.org/10.1038/ s41598-017-16802-7 16. Sungkaworn T, Jobin ML, Burnecki K, Weron A, Lohse MJ, Calebiro D (2017) Single-molecule imaging reveals receptor G protein interactions at cell surface hot spots. Nature 550(7677):543–547. https://doi. org/10.1038/nature24264 17. Chenouard N, Smal I, de Chaumont F, Maska M, Sbalzarini IF, Gong Y et al (2014) Objective comparison of particle tracking methods. Nat Methods 11(3):281–289. https://doi.org/10.1038/nmeth.2808

441

18. Hiroshima M, Yasui M, Ueda M (2020) Largescale single-molecule imaging aided by artificial intelligence. Microscopy (Oxf) 69(2):69–78. https://doi.org/10.1093/jmicro/dfz116 19. Motohashi K (2017) Seamless ligation cloning extract (SLiCE) method using cell lysates from laboratory Escherichia coli strains and its application to SLiP site-directed mutagenesis. Methods Mol Biol 1498:349–357. https:// doi.org/10.1007/978-1-4939-6472-7_23 20. Bosch PJ, Correa IR Jr, Sonntag MH, Ibach J, Brunsveld L, Kanger JS et al (2014) Evaluation of fluorophores to label SNAP-tag-fused proteins for multicolor single-molecule tracking microscopy in live cells. Biophys J 107 (4):803–814. https://doi.org/10.1016/j.bpj. 2014.06.040 21. Persson F, Linden M, Unoson C, Elf J (2013) Extracting intracellular diffusive states and transition rates from single-molecule tracking data. Nat Methods 10(3):265–269. https:// doi.org/10.1038/nmeth.2367 22. Nakamura Y, Hibino K, Yanagida T, Sako Y (2016) Switching of the positive feedback for RAS activation by a concerted function of SOS membrane association domains. Biophys Physicobiol 13:1–11. https://doi.org/10.2142/ biophysico.13.0_1 23. Hibino K, Shibata T, Yanagida T, Sako Y (2011) Activation kinetics of RAF protein in the ternary complex of RAF, RAS-GTP, and kinase on the plasma membrane of living cells: single-molecule imaging analysis. J Biol Chem 286(42):36460–36468. https://doi.org/10. 1074/jbc.M111.262675 24. Yoshizawa R, Umeki N, Yanagawa M, Murata M, Sako Y (2017) Single-molecule fluorescence imaging of RalGDS on cell surfaces during signal transduction from Ras to Ral. Biophys Physicobiol 14:75–84. https:// doi.org/10.2142/biophysico.14.0_75

INDEX 0-9, and Symbols 6-pi-OH-2H-CTZ ...................................... 130, 134, 135 6-pi-OH-CTZ ...................................................... 130, 135 96-well microplate-based assay ................................80–86 α1-adrenergic receptor (α1-AR) .................................. 181 β-arrestin ....................................................................15–17 β-galactosidase ................................................69, 196, 198 β2-adrenergic receptor (ADRB2) ...................16, 17, 421 γ-glutamyltranspeptidase (GGT) ................................194, 196, 197, 199

A Actin cytoskeleton................................................ 271–277 Actin polymerization............................................ 273, 275 Activatable probes ......................................................... 194 Aminopeptidases .................................194, 196, 197, 199 Apoptosis ....................................155, 337, 338, 354, 368 Artificial luciferase (ALuc) ..............................45, 47, 121, 125, 262, 264 Artificial luciferase 16 (ALuc16) .......................... 48, 105, 107, 115, 119, 121, 125, 131, 134–136 Artificial luciferase 23 (ALuc23) ........................ 105, 107, 119, 131, 134, 136, 262–264 ATP .............................................230, 231, 233, 342, 346 Azide-modified CTZ at the C-2 position (2-N3-CTZ)..................................... 114, 117, 120

B Bacterial luciferases (lux) ..........................................53–64 BCCP-GFP-NLS................................................ 4, 6, 7, 12 Bioluminescence (BL) firefly luciferases......................................................... 38 imaging ........................................................ 37–41, 75, 103–109, 247, 252, 255, 281–292, 309 in vivo ............................................................. 267–269 spectra .............................................. 49–106, 251, 266 Bioluminescence resonance energy transfer (BRET) ........................................... 103, 104, 111, 112, 121, 247, 248, 252, 253, 261, 262, 264–266, 268, 272, 275, 277, 282, 296, 297, 305–314 Biotin carboxyl carrier protein (BCCP)........................... 4 Biotinylation ...................................................................... 4 Bone metastasis .........................................................37–41

Bottle Blue 2.3 (BBlue2.3) ....................... 249, 250, 252, 253, 255, 256 Breast cancer...................................................41, 199, 370 BTP3..................................................................... 141, 142 BTP3-Neu5Ac............................ 142, 145–147, 151, 152

C C2C12 myoblast ............................................................. 80 Ca2+ ............................................................. 156, 217, 226, 227, 281–292, 297–302 Calcium imaging ........................................................... 281 Calcium sensors.................................................... 281–292 Camera..................................................27, 70, 74, 77, 93, 115, 121, 131, 134, 183, 199, 249, 284, 285, 287, 288, 291, 292, 295, 296, 298–300, 302, 306–308, 310–312, 321, 339, 355, 393, 395, 397 Cancer imaging ................................... 195–196, 199–202 Carboxypeptidases................................................ 194, 196 Caudal artery injection .............................................37–41 Cell cycle....................................................................25–34 Cell death ................................................. 13, 22, 62, 151, 237, 242, 341, 350, 375, 379 Cell fusion .................................................................79–87 Cell imaging ......................................... 27, 31, 32, 43–51, 103, 108, 112, 218, 233, 248, 337–352, 369, 381, 385 Cell signaling pathways...................................... 57, 58, 63 Chemotaxis........................................................... 317–335 Chromophore-assisted light inactivation (CALI) technique ........................................................... 271 Chromophores ................................................90, 98, 114, 218, 232 Circularly permuted GFP ............................................... 90 Click beetle luciferase green (CBgreen) ...................... 135 Coelenterazine (CTZ) ............................... 44, 47, 48, 61, 104, 105, 107, 111–125, 127–137, 248–252, 254–256, 258, 263, 266–268, 281, 282, 286, 290, 307, 311 Coelenterazine (CTZ) analogue .................................. 104 Coelenterazine-h (CTZh) ..............................44, 48, 297, 299, 300, 311 Cofilin-actin rod............................................................ 277 Colocalization analysis ............................... 415, 417–419, 437–439 Confocal laser scanning microscopy ........................4, 175

Sung-Bae Kim (ed.), Live Cell Imaging: Methods and Protocols, Methods in Molecular Biology, vol. 2274, https://doi.org/10.1007/978-1-0716-1258-3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

443

LIVE CELL IMAGING: METHODS

444 Index

AND

PROTOCOLS

Confocal microscope ................................... 9, 11, 17, 20, 183, 210, 212, 228, 229, 231, 239, 385, 386 Confocal microscopy ................................. 187, 212, 213, 273, 275, 385 Copepod luciferases ......................... 44, 45, 49, 123, 129 Cy5-conjugated CTZ (Cy5-CTZ)..................... 104, 105, 107, 108 COS-7 cells................................................. 44, 47, 48, 50, 105, 106, 114, 119, 121, 122, 129, 131, 134, 135, 144, 149, 150, 152, 248, 249 Cryptochrome ................................................................. 16 Cyanine 5 (Cy5)............................................................ 182 Cyclic adenosine monophosphate (cAMP) .................. 69, 318, 319, 321–323, 325, 328–333 Cypridina luciferase (CLuc) ................................ 135, 136 Cytoskeletons ................................................................ 169 Cytotoxicity .................................... 32, 34, 169, 170, 282

Fluorescence imaging ....................................... 25–35, 93, 169–178, 247 Fluorescence microscope ....................195, 196, 199, 394 Fluorescence microscopy .............................................. 339 Fluorescence probe .............................................. 155–167 Fluorescent indicators ..................................................... 25 Fluorescent labeling .......................................................... 4 Fluorescent probes .............................................. 169–171, 193–205, 207–214, 217, 218, 230, 237–243 Fluorescent proteins............................................ 3, 25, 26, 41, 53, 54, 89, 104, 203, 248, 262, 264, 271, 272, 296, 318, 354, 386, 387, 421 Fluorogenic ligand ............................................... 181–191 Fo¨rster resonance energy transfer (FRET) ................... 69, 89, 103, 104, 305, 306, 321, 330, 331, 334, 338, 350, 354, 356–362 Fucci4 ........................................................................26, 29

D

G

Dabcyl-PH-SE...................................................... 158, 165 Damage-associated molecular patterns (DAMPs) .................................................. 337–354 Dictyostelium discoideum ............................................ 318 Diffusion dynamics .............................391, 400, 423, 427 D-luciferin .................................................. 38–40, 74, 76, 83, 86, 131, 135, 273, 275–277 DnaE inteins.................................................................... 79 Drug resistance..................................................... 145, 151

Gαq-coupling receptor .................................................... 70 Gαq protein ..................................................................... 70 G protein ...................................................... 16, 181, 317, 318, 327–329, 331, 391, 392 G protein-coupled receptor (GPCR)...............16, 69, 77, 305, 317, 318, 391–440 Gaussia luciferase (GLuc) .................................44, 47, 48, 53, 104, 107, 119, 121, 134–136, 261 Genetically-encoded fluorescent indicators ................... 25 Genetically encoded probe .................................... 79, 230 GFP-aequorin (GA) ...................................................... 282 g-glutamyl hydroxymethyl rhodamine green (gGluHMRG) .................................................... 196–199 Gip1 ............................................................ 318–321, 325, 327, 329, 331–333 Glucose ...............................................44, 82, 89–99, 114, 155, 181, 283, 319 Glycosidases................................................. 194, 196, 199 GPCR signaling............................................................. 319 Green fluorescent protein (GFP) ........................... 4, 7, 9, 12, 22, 53, 54, 162, 170, 183, 188, 191, 282, 284, 285, 287, 289, 290, 306, 310, 320, 377, 387, 394, 422, 437 Gα2 .....................................................318, 319, 321–323, 327, 329, 330, 333, 334

E EM-CCD................................................74, 93, 306, 307, 311, 312, 339, 355, 395 Environment-sensitive ......................................... 181–191 Epifluorescence imaging ...........................................26, 34 Esophageal cancer ....................................... 194, 200, 201 Estrogen receptor (ER) ..................................49, 50, 123, 131, 136, 250, 251, 256

F F-actin .........................................272, 274, 275, 277, 278 Firefly luciferase (FLuc) ............................. 38, 39, 41, 53, 79, 80, 135, 271, 272, 276, 277 FITC-conjugated CTZ at the C2 position (2-FITC-CTZ) ......................................... 118, 121 FITC-conjugated CTZ at the C6 position (6-FITC-CTZ) ................................ 118, 121, 124 FK506 binding protein (FKBP)....................15, 131, 136 FKBP-Rapamycin-Binding domain of mTOR (FRB) ......................... 15, 16, 131, 136, 262, 263 Flavin mononucleotide (FMN) ................................55, 60 Fluorescein isothiocyanate (FITC) ............ 114, 118, 199 Fluorescence (FL) detection antibody........................338, 339, 346, 350

H Hank’s balanced salt solution (HBSS)....................29–31, 48, 70, 74, 123, 195, 196, 219, 227–229, 231, 238–241, 249, 251, 252, 284, 307–309 HEK293 cells ........................................... 16, 18–21, 156, 162, 166, 187, 313, 394, 395

LIVE CELL IMAGING: METHODS HEK293T.............................................29, 54, 70, 73, 76, 238, 239, 241, 253, 267, 272, 274–276, 307, 382, 421 Heterotrimeric G proteins................................... 317–319 High throughput .................................... 55, 70, 129, 368 HMGB1...................................... 349, 352, 354, 359–361 Hoechst 33342 ................................................... 171, 175, 176, 238–241, 370, 374–376, 380, 381, 383 Human parainfluenza virus......................... 141, 144, 151 Hydroxymethyl rhodamine green (HMRG) ...... 197, 199 Hydroxyphenyl fluorescein.................................. 207–214

I IL-1β .................................. 340–342, 346, 348, 349, 352 Image analysis.........................................45, 49, 105, 107, 132, 212, 254, 292, 306, 393 ImageJ....................................................... 8, 9, 12, 20, 27, 105, 107, 199, 212, 240, 303, 320, 355, 386, 398, 424, 426, 440 Imaging....................................................... 4, 5, 8, 11, 13, 26, 27, 29, 31, 32, 34, 37–42, 69–77, 99, 103–125, 127, 141–153, 155–166, 169, 170, 174, 175, 178, 179, 181–191, 194–201, 203, 204, 210, 212, 214, 217–234, 237–243, 247–258, 261–271, 275–277, 281–292, 305–314, 338, 341, 347, 351–362, 367–384, 387, 388, 395, 397, 398, 416, 422, 423 Imaging probes .................................................... 251, 262 Imatinib .............................................................. 80, 83, 86 Immunoassay................................................................. 354 Indicators.................................................... 25, 26, 89–98, 156, 281, 282, 295–303, 309 Infected cells.........................................83, 141, 145, 148, 151, 152, 212 Influenza virus .....................................143–147, 150, 151 A virus ............................................ 143–147, 150, 151 B virus ............................................143, 146, 150, 151 Inner nuclear membrane protein (INM)................... 3–13 Insulin-like growth factor 1 (IGF-1) ......... 80, 82, 85, 86 Intracardiac (IC) injection.............................................. 37 Intracellular trafficking .............................................15, 16

K KillerRed..............................................271, 272, 276, 277 KMG-500 .....................................................218–228, 231 KST-F-DA ........................................... 156–162, 164–166

L Laser scanning microscopy ........................................... 388 Live-cell imaging of secretion activity (LCI-S) ..........338, 339, 342, 346–347, 352, 354–356, 360, 362

AND

PROTOCOLS Index 445

Ligand....................................................... 75, 77, 90, 136, 181, 182, 186, 253, 317, 319, 323, 331, 394, 396, 397, 409, 416, 420, 421, 423, 437 Ligand binding domain (LBD)............................ 90, 131, 136, 251 Ligand characterization ............................................73–75 Live cell imaging ...................................96, 196, 199, 240 Live imaging ............................................ 15, 18, 152, 319 Long-term imaging probes .......................................... 237 Luciferases ...................................................43–50, 53–64, 69, 70, 74, 76, 79, 104, 105, 107, 108, 112, 119, 121, 124, 127, 129, 131, 134, 136, 247, 248, 258, 261, 262, 276, 281, 282, 295, 296, 307–310 Luciferin .................................................74, 76, 112, 131, 252, 271–275, 278, 281, 282 Luminescence ............................................. 48, 61, 64, 74, 105, 248, 298, 301, 309, 313

M Magnesium ions (Mg2+) ....................... 90, 166, 217–234 mCherry (mChe) .................................17, 249, 251, 252, 262–264, 357, 359 Membrane receptors ........................................ 15–22, 392 Metabotropic glutamate receptor 3 (mGluR3) .........393, 405, 409, 411, 413–416, 418, 420, 425, 437, 439, 440 Metastasis............................................... 37, 197–199, 256 Mg2+ levels ........................................................... 239, 241 Mg2+-selective probe .................................................... 217 Microfabricated well array (MWA) .............................338, 340, 345–347, 351 Microscopy ............................................................ 3, 7, 27, 31, 156, 275, 281, 287, 338, 339, 359, 368, 383, 385–389 Microtubules ........................................................ 169–178 Mitochondrial membrane potential .................... 230, 233 mNeptune (mNep) .............................................. 262–264 Molecular evolution ..................................................89–98 Molecular Tension Probe 2.4 (TP2.4) .......................131, 135, 136, 265–268 mOrange (mOrg)................................................. 262–264 Mouse amyloid β precursor protein (APP) ................... 90 mPlum .................................................................. 262, 263 mRasberry (mRasb) ............................................. 262–264 Multi-channel imaging ............................... 395, 397, 422 Multi-color imaging..............................89, 217, 218, 230 Multi-well formats ........................................................ 377 Mumps virus................................................ 141, 144, 151 Murine model............................................................37–41 Myogenesis .................................................. 80, 82, 85, 86

LIVE CELL IMAGING: METHODS

446 Index

AND

PROTOCOLS

N NanoLuc (NLuc) ....................................... 122, 295–297, 302, 310, 311, 313 Native coelenterazine (nCTZ) .......................44, 48, 114, 131, 263, 268 Near-infrared (NIR)............................................ 103, 104, 181–191, 217–234, 248, 256 Necroptosis..........................................337, 350, 353–362 Neuraminidases ............................................................. 141 Neuronal Ensembles ............................................ 281, 283 Neurons ............................................................... 228–231, 233, 289, 292 Newcastle disease virus ............................... 141, 144, 151 Nile red-conjugated CTZ at the C2 position (2-Nile-Red-CTZ) ................................... 113, 120 Nile red-conjugated CTZ at the C6 position (6-Nile-Red-CTZ) ................................... 113, 120 Nuclear envelopes ....................................................... 3–13

O Oligomer size distribution..................411, 415, 423, 437 Oncogenic RAS............................................................. 208 Optogenetics .................................................... 15–22, 281 ORCA-R..................................... 296–298, 300, 301, 303 ORCA-Y ..................................... 296–298, 300, 301, 303 Overlap PCR .............................................................90, 98

P Paramyxovirus ...................................................... 150, 151 Peptides .................................................... 54, 59, 80, 123, 136, 150, 157, 170, 171, 173, 174, 177, 249, 272, 273, 276, 317, 355 Photon counting ......................................... 288, 291, 312 Photosensitizer protein................................................. 276 Phospholipase C‑β3 (PLC‑β3) .......................... 70, 71, 73 Pinhole.................................................................. 385–388 Prostate cancer ...................................................... 41, 181, 194, 196, 197, 204 Prostate specific membrane antigen (PSMA) .............194, 196, 197, 199, 203, 204 Protein-protein interaction (PPI) ................................ 311 Protein splicing .........................................................79, 80 Pyroptosis .................................................... 337, 338, 350

Renilla luciferase (RLuc)............................ 44, 47, 53, 55, 58, 59, 61, 62, 103–105, 107, 115, 119, 120, 248, 261, 276, 306, 310 Renilla luciferase 8.6-535SG (RLuc8.6-535SG) .......104, 105, 107, 248, 249, 251–253, 255, 256 Renilla reniformis luciferase (RLuc) ............................ 310 Renilla reniformis luciferase 8 (RLuc8) .....................104, 105, 107, 121, 136, 248, 249, 256, 311 Renilla reniformis luciferase 8.6-535 (RLuc8.6-535) ............................................ 44, 47, 48, 119, 121, 122, 134, 135, 248, 252 Renilla reniformis luciferase variant 8 (RLuc8) .......... 129 Reporter-gene assay ........................................................ 54 Reporter genes ........................................... 38, 53–64, 69, 368, 371, 375, 380 Responsive element...................................................55, 59

S Sandwich immunoassay ................................................ 338 Sendai virus.................................................. 141, 144, 151 Sensor for caspase-1 activation based on FRET (SCAT1)............................................................. 351 Sensor for MLKL activation by RIPK3 based on FRET (SMART) ........................340, 352, 354, 359, 361 Sialidase fluorogenic probes ................................ 141–153 Sialidases ..................................... 141, 142, 145, 150–152 Sindbis virus ......................................................... 285, 290 Single-cell imagingofsecretion activity (LCI-S) .........338, 339, 342, 346, 347, 352, 354, 355, 360, 362 Single-chain probes ..................................... 129, 135, 264 Single FP-based indicator .........................................89–91 Single-molecule imaging (SMI) .......................... 391–440 Single-molecule tracking (SMT) ........................ 392, 393, 399, 401, 402, 407, 412, 424–427, 430, 433, 435 Si-rhodamine ................................................................. 218 SIRT inhibitors ............................................................. 166 SIRT1 .......................................................... 155, 156, 162 Sirtuins.................................................................. 155–166 Smartphones......................................................... 295–303 smDynamicsAnalyzer ................................. 393, 400–419, 426–428 Split-luciferase complementation .............................69–77 Split luciferase reconstitution ......................................... 79 Super-resolution microscopy ........................................ 385 SYTOX-Orange...................................355, 357, 361, 362

R Reactive oxygen species (ROS) .......................... 207, 208, 210, 212, 213, 271–278 Red fluorescent protein (RFP) ......................28, 203, 358 Red fluorescent protein (iRFP) .............................. 4, 248, 249, 251, 253, 256 Reduced flavin mononucleotide (FMNH-) ............59–61 Regulated cell death............................................. 337–352

T Tau-derived peptide ............................................. 169–179 Tetramethylrhodamine ........................................ 170, 220 The endoplasmic reticulum (ER)............... 5, 45, 49, 136 The rapamycin-binding domain of mTOR (FRB)...... 131 Time-lapse .......................... 4, 8, 11, 13, 26, 32, 34, 229, 231, 240, 242, 277, 328, 347, 351, 397, 398, 424

LIVE CELL IMAGING: METHODS Total internal reflection fluorescence microscopy (TIRFM) ..................................359, 392–394, 421 Total internal reflection microscopy ............................ 338 Transform ..................................................................94, 97 Tubulin .........................................................169–171, 175 Tumor necrosis factor alpha (TNFα) ............................. 80

V Variational Bayesian-Hidden Markov Model (VB-HMM) 392, 400, 415, 425, 426, 428, 431, 437

AND

PROTOCOLS Index 447

Version 2 of mCherry (V2_mChe) ..................... 265–268 Version 2 of mPlum (V2_mPlum) ...................... 265, 266 Viral transfer .................................................................. 282 Virus isolation ............................................................... 152

W WebLogo ...................................................................45, 49 Whole-plate imaging............................................ 367–383 Wide dynamic range .................... 54, 281, 282, 317, 318