Genome Engineering for Crop Improvement (Concepts and Strategies in Plant Sciences) 3030633713, 9783030633714

Citation preview

Concepts and Strategies in Plant Sciences Series Editor: Chittaranjan Kole

Bidyut Kumar Sarmah Basanta Kumar Borah   Editors

Genome Engineering for Crop Improvement

Concepts and Strategies in Plant Sciences Series Editor Chittaranjan Kole, Raja Ramanna Fellow, Government of India, ICAR-National Institute for Plant Biotechnology, Pusa, Delhi, India

This book series highlights the spectacular advances in the concepts, techniques and tools in various areas of plant science. Individual volumes may cover topics like genome editing, phenotyping, molecular pharming, bioremediation, miRNA, fast-track breeding, crop evolution, IPR and farmers’ rights, to name just a few. The books will demonstrate how advanced strategies in plant science can be utilized to develop and improve agriculture, ecology and the environment. The series will be of interest to students, scientists and professionals working in the fields of plant genetics, genomics, breeding, biotechnology, and in the related disciplines of plant production, improvement and protection. Interested in editing a volume? Please contact Prof. Chittaranjan Kole, Series Editor, at [email protected]

More information about this series at http://www.springer.com/series/16076

Bidyut Kumar Sarmah · Basanta Kumar Borah Editors

Genome Engineering for Crop Improvement

Editors Bidyut Kumar Sarmah ICAR-National Professor Programme (Norman Borlaug Chair) and DBT-North East Centre for Agricultural Biotechnology Assam Agricultural University Jorhat, Assam, India

Basanta Kumar Borah Department of Agricultural Biotechnology and ICAR-National Professor Programme (Norman Borlaug Chair) Assam Agricultural University Jorhat, Assam, India

ISSN 2662-3188 ISSN 2662-3196 (electronic) Concepts and Strategies in Plant Sciences ISBN 978-3-030-63371-4 ISBN 978-3-030-63372-1 (eBook) https://doi.org/10.1007/978-3-030-63372-1 © Springer Nature Switzerland AG 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Switzerland AG The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland

Preface

The book Genome Engineering for Crop Improvement presents the application of non-conventional biotechnological approaches for the improvement of crop plants by modifying their genomes. It is a collaboration focussed on confronting the prime challenges in agriculture using genome engineering. The ten chapters in the book have been written with a vision to maximize the understanding of novel approaches used in the modification of plant genomes in order to address the most harrowing biotic and abiotic threats to modern agriculture. Chapter 1 illustrates photo-assimilation as key to plant yield and productivity. The significance of photo-assimilation processes or primary carbon metabolism in source and sink organs, with special emphasis on starch metabolism, is discussed. In this regard, it is possible to edit genomes for synergistic enhancement of source and sink processes towards maximizing crop productivity. A major goal of modern agriculture is manifestation of disease resistance. Resistance to bacterial, viral or fungal diseases was traditionally attained principally by chemical applications ensuing both human and environmental risks. With the advent of genome engineering tools, RNA silencing (RNA interference, RNAi) offers a safer alternative to precisely generate desired modifications. The basics of RNA interference pathways, its status vis-à-vis conventional insertion mutagenesis and generation of stably inherited phenotypes with special emphasis on wheat functional genomics is discussed in Chap. 2 of the book. Thereafter, we have highlighted RNA interference for conferring virus resistance in rice in Chap. 3. The chapter enumerates the progress of RNAi technology against ten of sixteen viruses known to infect rice plants. In Chap. 4, deployment of RNA silencing for control of fungal disease in plants with emphasis on host-induced gene silencing (HIGS) has been discussed. Viruses are one of the most potent threats to crop productivity. We have specially dedicated Chap. 5 to enlighten the readers on the intricate mechanisms that make a plant resistant or vulnerable to viral attacks. These mechanisms provide hints to develop antiviral resistance in hosts. The chapter explains about engineering gene silencing-mediated resistance against plant viruses which may be achieved transcriptionally or post-transcriptionally. In addition, an epigenetic perspective has also been detailed. Other novel transgenic approaches like genome v

vi

Preface

editing, protein/peptide-mediated virus resistance including plantibodies and aptamers, etc., have been covered as well in the chapter. The precise modern genome editing tool that emerged as a result of studying the bacterial immune response against viruses was the CRISPR-Cas machinery. Chapter 6 deals with the evolution and emergence of CRISPR-Cas technology as one of the most useful genome engineering tools. The technology has been utilized in the management of abiotic and biotic stress in plants which has been discussed in Chap. 7. The chapter presents the current regulations, future prospects and the usability of the machinery with regard to developing biotic and abiotic stress resistance in major crop plants. Food security for the ever-growing population is the prime goal of today’s agriculture. Rice and wheat still stand as the main food crops, and therefore, the challenges in their production have a direct bearing on global food security. Genome engineering is being widely applied for their improvement. We have accounted the biotic stresses in rice to be from major bacterial, viral, fungal and animate (insect and nematodes) sources. The status of genetic engineering in the development of resistance to such pests and pathogens has been elaborated in Chap. 8. So far as wheat is concerned, a major challenge in production is rust. Till now, resistance to rust has largely been achieved by identification of new sources of resistance from cultivated wheat and related wild species, mapping the traits and their transfer to popular wheat cultivars. Chapter 9 explores the recent advances in genomics and marker technologies and the possibility of conferring rust resistance to commercial wheat cultivars in a quick and precise manner using the technologies. Besides modifying the genome using transgenesis, CRISPR-Cas and RNAi technologies, the book also highlights the potential within the gene pool of crops for traits such as stress-tolerance, disease resistance. Chapter 10 reviews the potential of cisgenesis, its applications, limitations, regulatory concerns and strategies to maximize its applicability in the improvement of crops. Cisgenesis is a promising technology, in this regard, if a desired gene is available within the gene pool of a crop. In summary, the book aims to illuminate the potential, challenges and prospects of genome engineering in the improvement of major cultivated crops, bearing in mind the global goals for agriculture and food security. The editors wish to thank each and every contributor who have graciously accepted the invitation and contributed to this book. The editors also thank immensely Springer Nature for publishing this book. Jorhat, India

Bidyut Kumar Sarmah Basanta Kumar Borah

Contents

1

Source-Sink Relationships and Its Effect on Plant Productivity: Manipulation of Primary Carbon and Starch Metabolism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kaan Koper, Seon-Kap Hwang, Salvinder Singh, and Thomas W. Okita

1

2

Transgenic Approaches to Develop Virus Resistance in Rice . . . . . . . Gaurav Kumar and Indranil Dasgupta

33

3

Virus-Free Improved Food in the Era of Bacterial Immunity . . . . . . Anirban Roy, Aditi Singh, A. Abdul Kader Jailani, Dinesh Gupta, Andreas E. Voloudakis, and Sunil Kumar Mukherjee

63

4

Host-Induced Gene Silencing (HIGS): An Emerging Strategy for the Control of Fungal Plant Diseases . . . . . . . . . . . . . . . . . . . . . . . . . Manchikatla V. Rajam and Sambhavana Chauhan

97

5

Genetic Engineering for Biotic Stress Management in Rice . . . . . . . . 117 Amolkumar U. Solanke, Kirti Arora, Suhas G. Karkute, and Ram Sevak Singh Tomar

6

Genome Improvement for Rust Disease Resistance in Wheat . . . . . . 141 Rohit Mago

7

Novel Technologies for Transgenic Management for Plant Virus Resistance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163 Andreas E. Voloudakis, Sunil Kumar Mukherjee, and Anirban Roy

8

Cisgenesis: Engineering Plant Genome by Harnessing Compatible Gene Pools . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193 Bidyut Kumar Sarmah, Moloya Gohain, Basanta Kumar Borah, and Sumita Acharjee

9

Improving Biotic and Abiotic Stress Tolerance in Plants: A CRISPR-Cas Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217 Akansha Jain, Anirban Bhar, and Sampa Das vii

viii

Contents

10 RNA Interference (RNAi) in Functional Genomics of Wheat . . . . . . 239 Priyabrata Sen, Charu Lata, Kanti Kiran, and Tapan Kumar Mondal

Contributors

Sumita Acharjee Department of Agricultural Biotechnology and ICAR-National Professor Programme (Norman Borlaug Chair), Assam Agricultural University, Jorhat, India Kirti Arora ICAR-National Institute for Plant Biotechnology, New Delhi, India Anirban Bhar Division of Plant Biology, Bose Institute Centenary Campus, CIT Scheme, VII-M, Kankurgachi, Kolkata, West Bengal, India; Department of Botany, Ramakrishna Mission Vivekananda Centenary College, Rahara, Kolkata, India Basanta Kumar Borah Department of Agricultural Biotechnology and ICAR-National Professor Programme (Norman Borlaug Chair), Assam Agricultural University, Jorhat, India Sambhavana Chauhan Department of Genetics, University of Delhi South Campus, New Delhi, India Sampa Das Division of Plant Biology, Bose Institute Centenary Campus, CIT Scheme, VII-M, Kankurgachi, Kolkata, West Bengal, India Indranil Dasgupta Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India Moloya Gohain DBT-North East Centre for Agricultural Biotechnology, Assam Agricultural University, Jorhat, India Dinesh Gupta Bioinformatics Group, ICGEB, New Delhi, India Seon-Kap Hwang Institute of Biological Chemistry, Washington State University, Pullman, WA, USA A. Abdul Kader Jailani Division of Plant Pathology, IARI, New Delhi, India Akansha Jain Division of Plant Biology, Bose Institute Centenary Campus, CIT Scheme, VII-M, Kankurgachi, Kolkata, West Bengal, India

ix

x

Contributors

Suhas G. Karkute ICAR-National Institute for Plant Biotechnology, New Delhi, India Kanti Kiran ICAR-National Institute for Plant Biotechnology, New Delhi, India Kaan Koper Institute of Biological Chemistry, Washington State University, Pullman, WA, USA Gaurav Kumar Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India Charu Lata National Institute of Science Communication and Information Resources, New Delhi, India Rohit Mago Agriculture and Food, Commonwealth Scientific and Industrial Research Organisation (CSIRO), Canberra, ACT, Australia Tapan Kumar Mondal ICAR-National Institute for Plant Biotechnology, New Delhi, India Sunil Kumar Mukherjee Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India Thomas W. Okita Institute of Biological Chemistry, Washington State University, Pullman, WA, USA Manchikatla V. Rajam Department of Genetics, University of Delhi South Campus, New Delhi, India Anirban Roy Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India Bidyut Kumar Sarmah ICAR-National Professor Programme (Norman Borlaug Chair) and DBT-North East Centre for Agricultural Biotechnology, Assam Agricultural University, Jorhat, India Priyabrata Sen Department of Agricultural Biotechnology, Assam Agricultural University, Jorhat, India Aditi Singh Bioinformatics Group, ICGEB, New Delhi, India Salvinder Singh Department of Agricultural Biotechnology, Assam Agricultural University, Jorhat, Assam, India Amolkumar U. Solanke ICAR-National Institute for Plant Biotechnology, New Delhi, India Ram Sevak Singh Tomar ICAR-National Institute for Plant Biotechnology, New Delhi, India Andreas E. Voloudakis Laboratory of Plant Breeding and Biometry, Department of Crop Science, Agricultural University of Athens, Athens, Greece

Abbreviations

3PGA 6PGDH ABA ACL AFLP AGO AGO1 AGPase AgRenSeq AMCV amiRNA amiRNAs AMT APHIS atasiRNAs ATP Avr BAC BaMMV BCAT BDL BeYDV BIN2 bp BPH BR BSA BT1 b-ZIP CaMV Cas Cas 9

3-Phosphoglyceric acid 6-phosphogluconate dehydrogenase Absicisic acid Acyl carrier protein Amplified Fragment Length Polymorphism Argonaute Argonaute 1 ADP-glucose pyrophosphorylase Association Genetics with R gene enrichment sequencing Artichoke mottled crinkle virus Artificial miRNA Artificial microRNAs Aminotransferase Animal and Plant Health Inspection Service Artificial tasiRNAs Adenosine triphosphate Avirulence Bacterial Artificial Chromosome Barley mild mosaic virus Branched-Chain Amino Acid Aminotransferase Baodali Bean yellow dwarf virus Brassinosteroid Insensitive 2 Base pair Brown Planthopper Brassinosteroid Bulked Segregant Analysis Plastidial ADP-glucose transporter Basic leucine zipper Cauliflower mosaic virus CRISPR associated protein CRISPR associated protein 9 xi

xii

CBL CCP CE CI CK CLCuMuV CMV COMT CP CPMR CRISPR CRISPR/Cas9 CS CUL DArT DArtSeq DCL DCL 1 DEFp DEP1 dsRNA DST ECIP1 eGMO eIF eIF4E EIN2 EMS EST ETI Exp2 Fab FaTA FBPA FDA FSANZ GBSS GDC-H GE GES GFP Glc1P GlcDH GLH

Abbreviations

Calcineurin B-like proteins Capsid core protein Capping Enzyme Cytoplasmic Inclusion Cytokinin Cotton leaf curl Multan virus Cucumber Mosaic Virus Caffeoyl-CoA 3-O-methyltransferase Coat Protein Coat Protein-Mediated Resistance Clustered Regularly Interspaced Short Palindromic Repeats Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9 Capsaicinoid synthase Cullin-RING Ligases Diversity Arrays Technology Diversity Arrays Technology Sequencing Dicer like Dicer like 1 Polyprotein Dense and erect panicle 1 Double stranded RNA Drought and salt tolerance Ethylene insensitive 2 (EIN2) interacting protein 1 Epigenetically modified crops Eukaryotic (translation) initiation factor Eukaryotic translation initiation factor 4E Ethylene-insensitive protein 2 Ethyl Methanesulfonate Expressed Sequenced Tag Effector-Triggered Plant Immunity Expansin gene Fragment antigen binding acylACP thioesterase Fructose 1,6-bisphosphate aldolase US Food and Drug Administration Food Standards Australia New Zealand Granule-Bound Starch Synthase Glycine decarboxylase-H protein Genome editing Genome Editing Systems Green fluorescent protein Glucose-1-phosphate Glycolate dehydrogenase Green leafhopper

Abbreviations

glp GM GMO GPT GRF4 GS1 GS2 GSK2 GTP GUS gusA GWAS HAP HDA HDI HDR HIGS HMW HMW-GS hpRNAs HR IAA ICP IM iPB IR IRs IRM ISAAA JA JAZ2 JDL KAS KASP KO LMV LP LS MADS-box MAP MAPK MAPKK MARPLE

xiii

Glucagon-like peptide Genetically Modified Genetically Modified Organism Glucose-6-phosphate translocator Growth Regulating Factor 4 Glutamine Synthetase 1 Grain size on chromosome 2 Glycogen synthase kinase 2 Glucose-6-phosphate translocator Beta Glucuronidase β-glucuronidase Genome-Wide Association Studies Heme activator protein Histone deacetylase Histone deacetylase inhibitor HomologyDirected Repair Host induced gene silencing High Molecular Weight High-Molecular-Weight Glutenin Subunit Hairpin RNAs Hypersensitive response Indole-3-acetic acid Inner core protein Intracellular Movement In planta particle bombardment Intergenic Region Inverted Repeats Insect Resistance Management International Service for the Acquisition of Agri-biotech Applications Jasmonic acid Jasmonatezim domain protein 2 Judali Ketoacyl-ACP synthase Kompetitive Allele Specific PCR Knock-out Lettuce mosaic virus Larger panicle ADP-glucose pyrophosphorylase large subunit Minichromosome Maintenance Factor 1, Agamous, Deficiens, and Serum Response Factor-box Microtubule associated protein Mitogen-activated protein kinase Mitogen-activated protein kinase kinase Mobile And Real-time PLant disease

xiv

MCC MIGS miRNA MMEJ MOC MP MR MTP NABP NAC NAM NCP NGFR NGS NHEJ NHR NIa-pro NIPB NMD NPBT NPQ NPR1 NR NSP nt NTP NTT1 OCP ODM PacBio PAL PAM PAMPs PBZ PCD PCI P-DNA PDR PDS PEBP PEBV PEPC PG PGIP phasiRNAs

Abbreviations

Minor Core Capsid MiRNA induced gene silencing Micro RNA Micro-Homology-Mediated End-Joining Major Outer Capsid Movement Protein Moderate Resistance Minimal Tiling Path Nucleic Acid Binding Protein NAM, ATAF1, 2 and CUC2 No apical meristem Nucleocapsid protein Nerve growth factor receptor Next Generation Sequencing Non-homologous end joining Nonhost resistance Nuclear inclusion protein National Institute for Plant Biotechnology Nonsense mediated decay New Plant Breeding Techniques Non-photochemical quenching Pathogenesis-related gene 1 No Resistance Nucleocapsid structural protein Nucleotide Nucleotide triphosphate binding protein Adenylate translocator Outer core protein Oligonucleotide-Directed Mutagenesis Pacific Biosciences Phenylalanine ammonia lyase Protospacer-associated motif PATHOGEN associated molecular patterns Probenazole Programmed Cell Death Participatory Crop Improvement Plant-derived transfer DNA Pathogen Derived Resistance Phytoene Desaturase Phosphatidylethanolamine-binding protein Pea early browning virus Phosphoenolpyruvate carboxylase Polygalacturonase PG-inhibiting proteins Phased pattern

Abbreviations

Pho1 Pho2 Pi PIP PoPMV PPB PPi PPKL1 PPO PPV PR pri-siRNA PTGS PTI PTST1 PVX PYL QTL R RAPD RBSDV RDD RdDM RDM RDRs RDV RGA RGDD RGDV RGEN RNPs RGSV Ries-keFeS RISC RNAi RNMV RNP ROS RQC RRSV RSV RT/RNase H RTBV RTD RTL RTSV

xv

Plastidial α-glucan phosphorylase Cytosolic α-glucan phosphorylase Inorganic phosphate Plant-Incorporated Protectants Poplar mosaic virus Participatory plant breeding Pyrophosphate Serine/threonine protein phosphatase Polyphenol Oxidase Plum pox virus Pathogenesis-related Primary siRNA Post-Transcriptional Gene Silencing Pathogen or Pattern triggered immunity Protein Targeting to Starch Potato virus X Pyrabactin resistance 1-like Quantitative Trait Loci Resistance gene Random amplified polymorphic DNA Rice black-streaked dwarf virus Rice Dwarf Disease RNA dependent DNA methylation RNA-Dependent Methylation RNA dependent RNA polymerases Rice Dwarf Virus Plant resistance gene analogs Rice gall dwarf disease Rice gall dwarf virus RNA-guided engineered nucleases RNPs Rice Grassy Stunt Virus Rieske protein RNA induced silencing complex RNA interference Rice Necrosis Mosaic virus Ribonucleoproteins Reactive Oxygen Species RNA quality control Rice ragged stunt virus Rice Stripe Virus Reverse transcriptase/ribonuclease H Rice tungro bacilliform virus Rice tungro disease RNAse III like Rice Tungro Spherical Virus

xvi

RuBisCO RYMV SA SAM SAR SBE SBPase SBPH SCF scFv sgRNA shRNA SIGS siRNAs SMRT SNP SP sp. SR SRBSDV sRNAs SS SSN SSR T6P TaeIF4E TaGLP4 TaGW2 TALE TALEN tasiRNAs TaVRN2 TEV TGS TGW6 TILLING TMT1 TMV TNFR TriMV TRV TSWV TuMV TYLCV Ub

Abbreviations

Ribulose-1,5-bisphosphate carboxylase/oxygenase Rice yellow mottle virus Salicylic acid Shoot apical meristem Systemic acquired resistance Starch branching enzyme Sedoheptulose-1,7-bisphosphatase Small brown plant hopper Skp1/Cullin1/F-box Single chain variable fragment Short guide RNA Short hairpin RNA Spray induced gene silencing Small interfering RNAs Single molecule real-time Single Nucleotide Polymorphisms Structural protein Species Strong Resistance Southern rice black-streaked dwarf virus Small RNAs ADP-glucose pyrophosphorylase small subunit Sequence-Specific Nucleases Simple sequence repeats Trehalose-6-phosphate Triticum aestivum Initiation Factor 4E Triticum aestivum Germ Like protein 4 Triticum aestivum Grain Weight 2 Transcriptional activator-like effectors Transcription activator-like effector nucleases Trans acting siRNAs Triticum aestivum VERNALIZATION 2 Tobacco etch virus Transcriptional gene silencing Thousand-Grain Weight 6 Targeted Induced Local Lesions IN Genomes Tonoplast monosaccharide importer Tobacco mosaic virus Tumor Necrosis Factor Receptor Triticum Mosaic Virus Tobacco rattle virus Tomato spotted wilt virus Turnip mosaic virus Tomato yellow leaf curl virus Ubiquitin

Abbreviations

UPS USDA UTR VA vasiRNA vc VCP VIGS VPg vsiRNAs VSRs VSS VWFC WSMV WT WTP WY3 ZFN

xvii

Ubiquitin proteasome system United States Department of Agriculture Untranslated region Viroplasm associated Virus activated host siRNA Viral complementary Viroplasm component protein Virus Induced Gene Silencing Viral Genome Linked Protein Virus derived small interfering RNAs Viral Suppressors of RNA silencing Virus Silencing Suppressor von Willebrand factor type C Wheat Streak Mosaic Virus Wild type Willingness-to-pay Waiyin Zinc-Finger Nuclease

Chapter 1

Source-Sink Relationships and Its Effect on Plant Productivity: Manipulation of Primary Carbon and Starch Metabolism Kaan Koper, Seon-Kap Hwang, Salvinder Singh, and Thomas W. Okita Abstract The rate of photo-assimilation in source organs (source strength) and the rate of conversion of this photo-assimilate into end products in sink organs (sink strength) are the two key metabolic processes that determine plant productivity and yield. Enhancement of either the source or the sink processes alone will often have limited returns due to the feedback inhibition from the other process. Consequently, maximizing plant productivity requires synergistic improvement of both source and sink processes. In this chapter, we will talk about the advancements in improving plant productivity through the modification of primary carbon metabolism in source and sink organs, with special emphasis on starch metabolism. Furthermore, we will discuss the future directions for enhancing source and sink processes in crop species via the usage of modern genome editing techniques. Keywords Source · Sink · Productivity · Yield · Primary carbon metabolism · Photosynthesis · Rubisco · Calvin-Benson cycle · Starch · AGPase · Pho1 · Genome editing · CRISPR · GMO

K. Koper · S.-K. Hwang · T. W. Okita (B) Institute of Biological Chemistry, Washington State University, Pullman, WA 99164, USA e-mail: [email protected] K. Koper e-mail: [email protected] S.-K. Hwang e-mail: [email protected] S. Singh Department of Agricultural Biotechnology, Assam Agricultural University, Jorhat, Assam 785013, India e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_1

1

2

K. Koper et al.

1.1 Introduction Source-sink interactions play a significant role in plant productivity. Plant productivity for food and animal feed needs to be significantly increased by 60–120% to meet the dietary needs of the burgeoning human population worldwide (Bodirsky et al. 2015; Nations 2015; O’Neill et al. 2010; Ort et al. 2015). Such efforts will be mitigated by the threat of global warming, simultaneous erosion of arable land, and higher demand for plant-based biofuels (Pimentel and Burgess 2013). Global temperatures are expected to continue to increase by a further 1.5°C between 2030 and 2052 (Masson-Delmotte et al. 2018), which will have a major impact on cereal production. For example, yield reductions in bread wheat (Triticum aestivum) are strongly associated with increases in temperatures beyond optimal growth cycle temperatures (17–25°C) and maximum day temperatures (up to 32°C) during grain filling. Temperatures beyond these ranges may elicit stress responses and hence result in further yield reductions (Boehlein et al. 2019; Cossani and Reynolds 2012; Farooq et al. 2011; Gol et al. 2017). For wheat, the production and/or uptake, transport, storage and remobilization of the critical metabolites required for optimal growth rates and yields are dynamic processes involving feedback and feedforward sink– source interactions that can be disrupted in plants under heat stress (Asseng et al. 2017; Hütsch et al. 2019; Kumar et al. 2017). Crop yields are influenced by the plant’s capacity to capture light, to assimilate carbon, and to allocate this carbon into sink organs such as tubers/fruits/seeds as well as by agronomic practices and the environment (Long et al. 2006b; Smith et al. 2018). Crop productivity cannot reach its maximum potential unless suboptimal agronomic practices, as well as carbon assimilation (source strength) and its reallocation in sink tissues and organs, are improved (Bihmidine et al. 2013; Long et al. 2006b; Smith et al. 2018). To ensure the flow of nutrients from source organs to sink organs where they are needed, the source-sink transport system must be tightly regulated (Joana Rodrigues 2019). The balance between source and sink dynamics becomes evident when one of the processes is disturbed. Improving light quality and intensity and increasing CO2 concentration and photoperiod lead to better carbon fixation, and, in turn, enhanced plant growth and yield (Kirschbaum 2011; Long et al. 2006a; Watson et al. 2018; Yang et al. 2017; Yao et al. 2017). Photosynthesis in source organs is also stimulated by increased sink demand. However, sugars start to build up in source organs when the CO2 assimilation rate exceeds the demand by sink organs (Ainsworth and Long 2005; McCormick et al. 2006), which leads to the downregulation of photosynthesisrelated genes and photosynthetic rate (Ainsworth and Bush 2011; Chang and Zhu 2017). Thus, overall, there is a high positive correlation between source strength (carbon assimilation and export) and sink strength (end-product utilization) (Muller et al. 2011). It is evident from the existing literature that both source and sink processes co-limit whole plant carbon fluxes, and neither should be considered in isolation (Körner 2015; Ludewig and Sonnewald 2016). This view is further supported by metabolic control

1 Source-Sink Relationships and Its Effect on Plant …

3

analysis of net carbon flux in potato (Sweetlove et al. 1998) and soybean (Farrar and Jones 2000). As such, it is evident that the greatest impact on yield will be achieved via the simultaneous manipulation of both source and sink (Reynolds et al. 2012). From an engineering perspective, it is clear that increases in just the source organs will lead to a sink bottleneck and vice versa. For example, by increasing photo-assimilate production, the conversion of these photo-assimilates into sink organ biomass will become more strongly limited by the capacity of the sink to take up and utilize the photo-assimilates (Sweetlove et al. 2017). This has been convincingly demonstrated by transgenic potato lines where maximum plant productivity was only attained when the source and sink strength were simultaneously enhanced. Sink strength of potato tubers was increased by the simultaneous overexpression of the plastidial glucose6-phosphate and adenylate transporters while the source strength of leaf mesophyll tissue was enhanced by downregulating the leaf ADP-glucose pyrophosphorylase while overexpressing a cytosolic pyrophosphatase (Jonik et al. 2012). These manipulations resulted in enhanced sucrose export and source activity resulting in a doubling of starch yield in potato tubers.

1.2 Manipulation of Source for Enhanced Photosynthesis The long-standing interest in source-sink interaction arises from the potential of manipulating it for greater yields. Many manipulations have been made in modifying the activities of enzymes and transporters related to source capacity, of long and short distance transport resistance, and of photosynthesis to increase crop yield (Ludewig and Sonnewald 2016; Sweetlove et al. 2017).

1.2.1 Engineering Rubisco Enzyme Ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) is the primary enzyme in the C3 photosynthetic pathway. This carboxylating enzyme reacts not only with CO2 but also with O2 , leading to photorespiration which wastes assimilated carbon (Erb and Zarzycki 2018). Under current atmospheric conditions, O2 inhibits photosynthesis in C3 plants by as much as 40%. Under stress conditions, such as high temperature and drought, the suppression further increases through the decline of intercellular CO2 concentration due to closure of leaf stomata (Orr et al. 2017). Rubisco shows inefficiencies because of the slow CO2 -fixation rate and relatively poor specificity for CO2 over O2 . In view of these characteristics, Rubisco becomes a key engineering target to improve photosynthesis in crop plants (Carmo-Silva et al. 2015; Sharwood 2017; Whitney et al. 2011a). Whitney et al. (2011b) discovered that a single amino acid mutation acted as a catalytic “switch” converting Flaveria Rubisco from a “C3 style” enzyme to a “C4 style” and vice versa (Whitney et al. 2011b).

4

K. Koper et al.

A significant technical barrier in engineering Rubisco is that it is composed of multiple large and small subunit polypeptides encoded by the plastid and nuclear genome (Maliga and Bock 2011). Initially, research has focused on manipulating the chloroplast-encoded large subunit, which contains a catalytic site, although recent reports have highlighted the impact on catalysis by the small subunit (Atkinson et al. 2017; Ishikawa et al. 2011; Laterre et al. 2017; Morita et al. 2014). Engineering of the nucleus-encoded small subunit gene family (RbcS) is less technically challenging as nuclear transformation is already established for may plant species compared to those fewer amenable to chloroplast transformation (Bock 2015; Maliga and Bock 2011). Introduction of more efficient, foreign Rubisco proteins have not been successful to date because of complicated assembly requirements of the enzyme in the chloroplast, although important advancements have been made in co-engineering by introducing Rubisco alongside assembly chaperones (Bracher et al. 2017; Whitney et al. 2015). The Rubisco from cyanobacteria Synechococcus elongatus could support tobacco growth but only at elevated CO2 (Lin et al. 2014; Occhialini et al. 2016). However, when the cyanobacterial carbon-concentrating mechanism was also introduced together with the cyanobacterial Rubisco, the tobacco plants were capable of surviving at ambient CO2 .

1.2.2 Engineering the Calvin-Benson Cycle and Photorespiratory Pathway Several enzymes of the Calvin-Benson cycle are potential targets to enhance CO2 fixation in plants (Ainsworth et al. 2012; Feng et al. 2007; Raines 2003, 2011; Singh et al. 2014). Overexpression of sedoheptulose-1,7-bisphosphatase (SBPase) improved growth rates of tobacco and rice (Feng et al. 2007; Lefebvre et al. 2005; Rosenthal et al. 2011). Recently, Simkin et al. (2015, 2017) demonstrated improved photosynthesis and increased biomass in Arabidopsis by simultaneously manipulating three genes: SBPase, fructose-1,6-bisphosphate aldolase (FBPA) and glycine decarboxylase-H protein (GDC-H), the latter a component of the photorespiratory pathway (Simkin et al. 2015, 2017). Quantum efficiency of photosystem II and the CO2 fixation rate were significatly increased in these lines. Moreover, the coexpression of GDC-H with SBPase and FBPA resulted in a cumulative positive impact on leaf area and biomass (Simkin et al. 2017). In addition to the CalvinBenson cycle enzymes, overexpression of membrane transporters in crop species such as the IctB gene (Long et al. 2016), which encodes an inorganic carbon transporter B, is a viable approach as evidenced by the studies in soybean (Hay et al. 2017) and rice (Gong et al. 2015). Modifying the effects of photorespiration has also drawn considerable attention. Interestingly, both enhancing and bypassing photorespiration were able to enhance carbon assimilation and growth in Arabidopsis (Betti et al. 2016; Timm et al. 2015). A viable approach has been to avert CO2 and energy costs of photorespiration by

1 Source-Sink Relationships and Its Effect on Plant …

5

introducing synthetic “photorespiratory bypass” pathways in the chloroplast that direct CO2 release in the proximity of Rubisco (Kebeish et al. 2007; Maier et al. 2012). Nölke et al. (2014) demonstrated that the productivity and yields of potato (Solanum tuberosum) are increased by enhancing photosynthetic carbon fixation via expression of a polyprotein (DEFp) comprising of all three subunits (D, E, and F) of the bacterial glycolate dehydrogenase (GlcDH). Transgenic plants accumulated DEFp in the plastids, and the recombinant protein was active in planta, reducing photorespiration, and improving CO2 uptake with a significant impact on carbon metabolism (Nölke et al. 2014). The yield potential of rice (Oryza sativa L.) is limited by source capacity to fill a large number of grain ‘sinks’ produced in modern varieties. One solution to this problem is to introduce a more efficient, higher capacity photosynthetic mechanism to rice viz. the C-4 photosynthetic pathway (Furbank 2016). The C4 rice project is one of the most ambitious of such approaches (https://c4rice.org).

1.2.3 Engineering Light-Use Efficiency in Plants Major losses of energy can occur during the conversion of absorbed light energy into photochemical reactions (Stitt 2013). Conceptual analysis (Murchie and Niyogi 2011) suggested that this is an area where substantial improvement can be made. Kromdijk et al. (2016) showed that modification of the key components of the xanthophyll cycle, as well as the PsbS subunit of photosystem II, accelerated the relaxation of non-photochemical quenching (NPQ), thus enabling the tobacco plant to use light for photosynthesis as opposed for heat dissipation. This resulted in an increased rate of biomass production by as much as 20% in glasshouse-grown plants and about 15% in field-grown plants. The conservation of NPQ across plants suggests that this is a viable approach to improve the growth of other crops. A more novel approach to enhance light energy capture is by incorporating the bacterial chlorophylls found in many anoxygenic photosynthetic organisms into photosystem I or II in plants with the aim of extending the light absorption spectrum to the far red region (Blankenship et al. 2011). Alternatively, increasing the chloroplastic electron transport rates in Arabidopsis by overexpressing the Ries-keFeS protein also achieves increased biomass and seed yield (Simkin et al. 2017).

1.2.4 Engineering Enzyme Activities in Source and Sink Organs The assimilation and metabolism of nitrogen have the potential to influence source/sink activity and, correspondingly, the final yield (Good et al. 2004; Yamaya et al. 2002). Overexpression of the cytosolic glutamine synthetase 1 (GS1) gene can

6

K. Koper et al.

increase nitrogen use efficiency and crop productivity in different species (Thomsen et al. 2014). Although the enhancement differed among species and growth conditions, overexpression of a plant-specific Dof1 transcription factor led to the upregulation of multiple genes involved in carbon skeleton production including that for phosphoenolpyruvate carboxylase (PEPC), which improves N assimilation and growth especially under low N supply (Thomsen et al. 2014; Yanagisawa et al. 2004). A large number of genes/loci selected during rice breeding have been detected through analyses of genome information, many of which are related to N metabolism (Xie et al. 2015). Finally, manipulation of malate dehydrogenase and succinate dehydrogenase, two enzymes of the tricarboxylic acid cycle, produced source-mediated increases in growth and yield in tomato (Araújo et al. 2011; Nunes-Nesi et al. 2005). Many efforts to enhance sink strength has been carried out in potato and tomato using the class I patatin promoters, which confer sink-specific expression in these species (Jefferson and Bevan 1987; Rocha-Sosa et al. 1989). Transgenic potato overexpressing the plastidial transporters, glucose-6-phosphate translocator (GPT) and the adenylate translocator (NTT1) (Zhang et al. 2008), and sucrose synthase elevated tuber starch and plant dry weight. Conversely, downregulation of the plastidial adenylate kinase and uridine monophosphate synthase, which led to increased levels of adenylates and uridinylates, resulted in increased starch levels and yield (Baroja-Fernández et al. 2009; Geigenberger et al. 2005; Regierer et al. 2002). In Arabidopsis, overexpression of the tonoplast monosaccharide importer TMT1 altered cellular sugar sensing and increased biomass production (Wingenter et al. 2010). Sink activity has been shown to play a significant contribution to grain yields in the major cereal crops (McCormick et al. 2008; Slewinski 2012; Smidansky et al. 2002). In maize, the sucrose concentration of developing ears and the final yield have been significantly increased by reducing the sugar signal trehalose-6-phosphate (T6P) (Nuccio et al. 2015). Griffiths et al. (2016) showed that “chemical intervention” method can be used for exploiting T6P signaling. Although T6P is plantimpermeable, the generation of plant-permeable T6P precursors that released T6P in a light-activated manner increased grain yield and recovery from stress (Griffiths et al. 2016).

1.3 Manipulation of Starch Biosynthesis for Enhancing Sink Strength Starch biosynthesis is the most important metabolic pathway directly influencing sink strength in plants. ADP-glucose pyrophosphorylase (AGPase) is an enzyme controlling the rate-limiting step in starch biosynthesis, and thus even slight changes in the enzymatic properties of this enzyme can significantly affect starch production. In addition to AGPase, the plastidial starch phosphorylase (Pho1) can also generate a complementary carbon flux into starch. In this section, we will discuss the roles

1 Source-Sink Relationships and Its Effect on Plant …

7

of AGPase and Pho1 in starch biosynthesis in both source and sink tissues, and the engineering of these pathways to increase plant productivity and yield.

1.3.1 AGPase and Its Critical Role in Starch Biosynthesis AGPase belongs to the nucleotidyltransferase (adenylyltransferase) family and catalyzes the reaction; Glc − 1 − phosphate + ATP ⇔ ADP − glucose + PPi Plant AGPases is composed of two small and two large subunits (SS and LS) that co-assemble to form a heterotetrameric enzyme (Ballicora et al. 2003, 2004; Iglesias et al. 1993, 1994; Iglesias and Preiss 1992; Okita et al. 1990; Preiss 1984; Preiss and Romeo 1994; Preiss and Sivak 1998). The AGPase LS mainly plays a regulatory role with varying catalytic capacity depending on the isoform while the SS is both catalytic and regulatory (Cross et al. 2004; Hwang et al. 2005). In plants, the AGPase reaction constitutes the first committed step of starch synthesis, as the ADP-glucose produced by AGPase is used by starch synthases for elongating α-1,4-glucosidic chains (Ballicora et al. 2004; Iglesias and Preiss 1992; Preiss and Sivak 1998; Stark et al. 1992). Predictably, the catalytic activity of plant AGPases and, in turn, the carbon flux into starch, are tightly regulated by the energy state and metabolic needs of the cell through the use of allosteric effectors, redox state, and its expression level (Ballicora et al. 2004; Ohdan et al. 2005; Tiessen et al. 2002). The plant AGPase responds strongly to two allosteric regulators; activator 3phosphoglycerate (3PGA) and inhibitor inorganic phosphate (Pi) (Ballicora et al. 2004; Sowokinos 1981; Sowokinos and Preiss 1982; Tuncel and Okita 2013). In source tissues, the 3PGA/Pi ratio controls AGPase activity and, in turn, carbon allocation between sucrose and transitory starch synthesis. Moreover, the allosteric regulation of AGPase in sink tissues allows starch synthesis to be in sync with the influx of sucrose from source organs (Ballicora et al. 2004; Tuncel and Okita 2013). In addition to allosteric regulation, AGPases from many different species and tissues are regulated by the redox state (Ballicora et al. 2000; Fu et al. 1998; Tuncel et al. 2014). Under oxidizing conditions, AGPase activity is low due to the formation of one or more disulfide bridges, which lower catalytic activity. While under reducing conditions, disulfide bonds are disrupted and enzyme activity increases (Ballicora et al. 2000; Fu et al. 1998; Tuncel et al. 2014). In photosynthetic tissues, the redox signal that activates AGPase is generated in the light and by the increases in sugar levels (Geigenberger 2011; Hendriks et al. 2003; Kolbe et al. 2005; Michalska et al. 2009). Whereas in non-photosynthetic tissues, the redox signal is generated in response to the influx of sucrose (Geigenberger and Stitt 2000; Tiessen et al. 2002) as well as by the increases in sugar levels (Tiessen et al. 2003). Redox activation of AGPase can override constraints generated by allosteric regulation, allowing the enzyme activity to increase in response to specific external stimuli even under

8

K. Koper et al.

allosterically unfavorable conditions (Geigenberger 2011; Tiessen et al. 2002; Tuncel et al. 2014). This allows the plant to fine-tune the flux into starch biosynthesis based on its needs. The final level of control of AGPase activity is at the protein expression level. In most plant species examined, the large subunit is encoded by multiple genes while the small subunit is encoded usually by one or two genes (Crevillen et al. 2003; Georgelis et al. 2007). The expression of the AGPase large subunits is regulated both temporally and spatially (Crevillén et al. 2005; Geigenberger 2011; Ohdan et al. 2005; Tetlow et al. 2004). As AGPase hetero-tetramers formed with different large subunit isoforms exhibit different kinetic and allosteric properties (Crevillen et al. 2003; Geigenberger 2011; Tetlow et al. 2004), regulating the protein expression at the subunit level allows the formation of enzymes best suited for the cellular needs. AGPase expression is also affected by metabolites, where increasing sugar levels elevate expression (Müller-Röber et al. 1990; Sokolov et al. 1998), whereas increases in nitrate or phosphate decrease expression (Nielsen et al. 1998; Scheible et al. 1997).

1.3.2 Attempts to Increase Plant Productivity in Various Species Through the Alterations of the AGPase Pathway Under conditions where photosynthesis is not limited by temperature, light, or availability of captured CO2 , the main factor that governs plant productivity and yield is the utilization of photo-assimilate into end-products (Chen et al. 1994; Hocking and Meyer 1991; Pammenter et al. 1993; Pieters et al. 2001; Rowland-Bamford et al. 1990; Stitt and Quick 1989; Sun et al. 1999a). Overall, the capacity of a plant to convert photo-assimilates into end-products is determined by the collective ability of the organism to transport photo-assimilates from source to sink organs and convert them into “storable” end-products, such as starch, oils, and proteins (Herbers and Sonnewald 1998). Due to its critical role in initiating carbon flux into starch biosynthesis, AGPase has been extensively targeted at multiple levels to enhance starch biosynthesis and the efficiency of photo-assimilate utilization. Two main approaches have been employed to increase plant productivity through the AGPase pathway. First, increasing the overall enzymatic activity through increased AGPase abundance either by overexpression or by increasing the steady-state levels of the active enzyme by improving its heat stability (Boehlein et al. 2008; Greene and Hannah 1998). Second, increasing the overall enzymatic activity by introducing AGPases with better kinetic or allosteric properties (up-regulatory mutants). Below, we describe specific biotechnological approaches aimed to improve plant productivity through modification of the AGPase pathway.

1 Source-Sink Relationships and Its Effect on Plant …

9

1.3.3 Improving Yield Through Increasing AGPase Activity in Source Tissues In source tissues, increasing AGPase activity can improve productivity and yield through two mechanisms. First, improved AGPase activity increases the utilization of photo-assimilate into transitory starch when sucrose synthesis or transport to sink tissues are saturated. This would reduce feedback inhibition of photosynthesis by improving Pi recycling and allowing the plants to sustain higher photosynthetic efficiency under conditions where photosynthesis is not limited by environmental conditions (temperature, light, CO2 ) (Pammenter et al. 1993; Sun et al. 1999a). Second, the larger amount of transitory starch accumulated can be broken down during the night and fuel vegetative and/or reproductive growth. In Arabidopsis plants, the effect AGPase and transitory starch on photosynthesis, growth, and yield were evident for the AGPase SS (TL25) and LS (TL46) mutant lines (Sun et al. 1999b, 2002). These mutant plants showed reduced photosynthetic capacity and growth rate than the wildtype with transitory starch levels correlating with CO2 assimilation and growth rates (Sun et al. 1999b, 2002). When the TL46 mutant line was complemented with the wildtype LS gene, transitory starch level, photosynthetic rates, and yield were restored to wildtype levels (Gibson et al. 2011; Obana et al. 2006). However, when the TL46 mutants were transformed with a mutant AGPase LS with upregulated allosteric properties (increased 3PGA and lower Pi sensitivity), they exhibited higher growth, yield, and photosynthetic capacity than wildtype (Gibson et al. 2011; Obana et al. 2006). Different responses were readily evident for a maize line lacking the leaf AGPase SS (agps-m1) (Slewinski et al. 2008) and for a rice line lacking the AGPase LS (apl1) (Rösti et al. 2007). Under controlled growth conditions, both the maize (Slewinski et al. 2008) and the rice (Rösti et al. 2007) mutant lines grew similar to their wild types although transitory leaf starch accumulation was significantly reduced (Rösti et al. 2007; Slewinski et al. 2008). It is worth noting that the leaves of small grain cereals are naturally not strong leaf starch accumulators, but they instead store most of their nighttime carbon as sucrose or other soluble sugars (Hendry 1993; Huber 1981; Nakano et al. 1997; Ohashi et al. 2000). Investigation of soluble sugar levels in the leaves of starchless rice apl1 mutants showed no significant day or night time difference between the mutant and wildtype (Rösti et al. 2007). The ability of small grain cereals to store nighttime carbon as soluble sugars most likely reduce the importance of transitory starch synthesis. Diminished importance of transitory leaf starch can also be observed for the starchless mutants of Arabidopsis (Lin et al. 1988), tobacco (Nicotiana Sylvestris) (Huber and Hanson 1992), and pea (Harrison et al. 1998) that grow like wildtype under extended photoperiods, but suffer if photoperiod is shortened. Nevertheless, when the maize agps-m1 was grown under field conditions, it showed lower overall yield and growth rate despite exhibiting CO2 assimilation rates like wildtype (Schlosser et al. 2012). It is likely that the reduced carbon availability from starch degradation during the night impaired the growth of these plants

10

K. Koper et al.

(Schlosser et al. 2012). Furthermore, transformation of rice plants with upregulated potato AGPase LS gene (UpReg1) (Gibson et al. 2011), or overexpression of the maize leaf AGPase LS and SS (Oiestad et al. 2016; Schlosser et al. 2014) demonstrated the ability to improve yields by 24–29% over wild type level through improved leaf starch synthesis. Overall, this shows an intrinsic capacity to increase yield through induction of leaf starch synthesis, even for species that do not primarily store significant levels of leaf starch.

1.3.4 Improving Yield Through Increasing AGPase Activity in Sink Tissues An alternative approach to increase plant productivity and yield is to increase starch synthesis in sink tissues. This method has been a successful approach for many crop species partially because sink organs of starchy crops, such as cereal seeds and potato tubers, are economically valuable and readily harvested. In addition to their economic values, sink organs of plants generate the main pool for photo-assimilate deposition and constitute the bulk of the sink strength. Consequently, enhancing starch synthesis in sink organs increases the demand for carbon transported from the source organs. An increased sucrose consumption by the sink organs also alleviates the accumulation of sucrose in phloem or leaves, thereby minimizing the end-product inhibition of photosynthesis. Similar to source tissues, improved starch synthesis in sink tissues can be achieved by increasing overall AGPase activity. The first study for increasing starch accumulation in sink tissues through enhancing AGPase activity was accomplished in potato tubers (Stark et al. 1992). Transformation of potato plant with a mutant E. coli AGPase gene (glgC-16) resulted in a 35–60% increase in tuber starch levels (Stark et al. 1992). However, when similar studies (Sweetlove and Burrell 1996) were repeated for a different potato cultivar, no apparent increases in starch levels were detected despite a fourfold increase in transgenic glgC-16 AGPase activity versus the wildtype enzyme. Nevertheless, there was strong evidence for increased starch synthesis that was coupled with an increase in starch turnover (Sweetlove and Burrell 1996). In a comparable study (Ihemere et al. 2006), the expression of a modified glgC gene in cassava (Manihot esculenta) resulted in a 70% increase in AGPase activity and a 2.6-fold increase in tuberous root biomass. The manipulation of AGPase activity in sink tissues has been successfully accomplished in maize, rice, and wheat. In addition to AGPase localized to plastids, cereal endosperm expresses a second cytosolic enzyme activity (Hannah and James 2008). This cytosolic isoform is responsible for the majority of the AGPase activity in endosperms of cereals maize (Denyer et al. 1996), rice (Sikka et al. 2001), wheat (Burton et al. 2002) and barley (Thorbjørnsen et al. 1996). The capacity of this approach to increase seed weight was first demonstrated in maize (Giroux et al. 1996). Generation of a native LS rev6 mutant that is less sensitive

1 Source-Sink Relationships and Its Effect on Plant …

11

to Pi inhibition resulted in an 11–18% increase in average seed weight (Giroux et al. 1996). In another study (Li et al. 2011b), the small (Bt2) and large (Sh2) subunits genes of native maize AGPase were introduced to maize plants and overexpressed using endosperm-specific promoters. Overexpression of either subunit was able to improve yield, but the greatest improvement was achieved with simultaneous overexpression of both subunits. This resulted in an 18–33% increase in seed weight and an 18% increase in starch levels (Li et al. 2011b). Wang et al. (2007) introduced the E. coli AGPase mutant glgC-16 into maize endosperm. The E. coli glgC-16 AGPase has altered allosteric properties exhibiting high catalytic activity in the absence of activators or in the presence of inhibitors (Leung et al. 1986). Overexpression of this AGPase in maize endosperm resulted in a 13–25% increase in seed weight (Wang et al. 2007). A similar study (Sakulsingharoj et al. 2004) was also conducted in rice with the bacterial AGPase glgC-TM that contained additional mutations deemed to activate the enzyme even further. Overexpression of glgC-TM in rice cytosol resulted in an 11% increase in average seed weight while targeting the bacterial enzyme to rice amyloplast resulted in no improvement, signifying the negligible contribution the plastidial AGPase has on per-seed starch accumulation in cereals (Sakulsingharoj et al. 2004). In addition to yield improvements on per-seed (average seed weight) basis, enhancement of AGPase activity in cereals also resulted in an increase in total seed number with negligible increases in average seed weight. When maize plants expressed a heat-stable LS mutant rev6/hs33 (Hannah et al. 2012) or a heat-stable SS mutant (Hannah et al. 2017), increases of 64% and 35% in seed number, respectively, were apparent. The introduction of the rev6/hs33 transgene into rice and wheat yielded similar increases in seed yields. In rice (Smidansky et al. 2003), hS33/rev6 expression under the maize sh2 promoter resulted in a 19% increase in seed number and a 22% increase in total biomass. In wheat (Smidansky et al. 2002, 2007), hS33/rev6 expression resulted in a 36% increase in seed number and a 31% increase in total biomass when driven by the sh2 promoter, while an increase of 13% in total seed weight was evident with the Glutenin Dy10 promoter (Meyer et al. 2004). For wheat, however, improvements for both cases under controlled conditions translated poorly under field conditions (Meyer et al. 2007). The increase in seed number, especially in maize, was surprising as the Sh2 gene was thought to be endosperm-specific (Hannah et al. 2012). Genetic, physiological, and molecular studies of the rev6/hs33 transgenic line revealed that the increase in seed number was controlled maternally and that the effect occurred before fertilization. Overall, the evidence supports the view that expression of the rev6/hs33 transgene occurred during ovary development, enabling a higher percentage of the ovaries to avoid premature abortion and to be successfully fertilized to produce seeds (Gustin et al. 2018; Hannah et al. 2012, 2017).

12

K. Koper et al.

1.3.5 Future Directions for Improving Yield Through Metabolic Engineering Around the AGPase Pathway Although improving AGPase activity in leaves or seeds enhanced crop yields, most of these approaches employed the overexpression or transgenic introduction of one subunit (mostly the regulatory LS) to a single tissue. However, one of the few studies that overexpressed both LS and SS subunits together achieved an improvement much higher than the expression of a single gene (Li et al. 2011b). This example points to an inherent inefficiency of single subunit overexpression studies, which most likely results from the subunit with lower expression limiting active tetramer formation. More sophisticated approaches that employ the introduction of both LS and SS can further improve the yield in many of the crop species studied thus far. For example, overall efficiency can be further increased by simultaneously increasing AGPase activity in both sources and sink organs. One recent study (Oiestad et al. 2016) used this approach by overexpressing the maize AGPase LS and SS in leaves and the LS in rice endosperm. The LS in both tissues was a heat-stable mutant form that is less sensitive to Pi inhibition (Giroux et al. 1996; Greene and Hannah 1998). Overexpressing AGPase both in leaves and endosperm increased total biomass by 61%, while leaf expression alone only achieved an 24% increase (Oiestad et al. 2016). Results of this study (Oiestad et al. 2016) indicate yield can be improved by increasing the carbon flux into starch in both sources and sink organs for other crop species. Another study (Cakir et al. 2016) examined the effect of a combination of cytosolic glgC-TM AGPase activity and overexpression of plastidial ADP-glucose transporter (Bt1) in rice. Although elevated ADP-glucose levels and higher ADP-glucose transport rates within the amyloplast were detected, this approach did not translate into a marked increase in yield over the transgenic CS8 line expressing only the bacterial AGPase, indicating the presence of additional barriers limiting carbon flux into starch (Cakir et al. 2016). More in-depth studies of CS8 showed the enhanced expression of a starch-binding domain-containing protein, which was a suppressor of starch synthase III, whose protein levels were also suppressed (Cakir et al. 2016). Thus, the study showed that although the rate-limiting ADP-glucose generation step of starch synthesis can be relaxed by increasing AGPase activity, it alone does not translate into a significant increase in yield. Instead, it shifts rate-limitation to some other stromal process such as starch synthase activity. Although starch synthase activity is not limiting in wild type due to its multiple isoforms (Fujita et al. 2006, 2007), the reduction of starch synthase III levels in CS8 apparently prevents maximum increases in starch synthesis by elevated ADP-glucose levels (Cakir et al. 2016). Hence, the previous approaches by increasing AGPase activity could eventually hit a downstream barrier resulting from insufficient ADP-glucose consumption, thereby requiring additional approaches to increase SS activity.

1 Source-Sink Relationships and Its Effect on Plant …

13

1.3.6 An Alternative Starch Biosynthetic Pathway Through Pho1 Although the bulk of the carbon flux into starch in both source and sink tissues passes through the AGPase/starch synthase pathway, an alternative reaction catalyzed by plastidial starch phosphorylase (Pho1, PhoL or PhoB) can also contribute to this flux. In higher plants, two isoforms of starch phosphorylase exist, the plastidial Pho1 and the cytosolic Pho2 (Sonnewald et al. 1995). Structurally, Pho1 is very similar to Pho2 except it contains a unique 50–80 amino acid long region (L80) in the middle of the primary sequence with unknown function. If the L80 region is ignored, the protein structures of both Pho1 and Pho2 resemble that of animal or fungi glycogen phosphorylase (Hwang et al. 2016). Enzymes in this family catalyze the reversible reaction of: Pi + (α − glucan)n ⇔ Glc − 1 − phosphate + (α − glucan)n−1 In animals, fungi, and bacteria (and plant Pho2), the dominant reaction for phosphorylases is the phosphorolytic formation of glucose-1-phosphate (Glc1P) and, therefore, the enzyme functions as an α-glucan degrading enzyme (Fischer et al. 1971; Newgard et al. 1989; Shapiro and Wertheimer 1943; Wilson et al. 2010). Since earlier studies on animal and fungi phosphorylases solidified the role of this enzyme activity in glycogen degradation, the plant enzyme was also proposed to have a similar role in starch degradation, a view supported by the estimated high Pi/Glc1P ratio inside the chloroplast (Preiss and Levi 1980; Steup 1988; Zamski and Schaffer 1996). This view was also reinforced by simple in vitro kinetic analysis that supported a degradative reaction (Kruger and ap Rees 1983; Steup 1988; Zamski and Schaffer 1996). However, genetic studies in Arabidopsis (Zeeman et al. 2004) and potato (Sonnewald et al. 1995) indicated that Pho1 was not essential for starch degradation. On the other hand, growing evidence suggested a starch synthetic role for Pho1 in sink organs. Pho1 expression and activity correlated positively with starch synthesis in maize (Mu et al. 2001; Ozbun et al. 1973) and wheat (Schupp and Ziegler 2004) endosperms, and in potato tubers (Koßmann et al. 1991; St-Pierre and Brisson 1995). Detailed studies in potato tubers further verified the direct 14 C-Glc1P incorporation into starch by Pho1 (Fettke et al. 2010, 2012). The recombinant rice Pho1 also showed the ability to elongate α-glucan chains even under the Pi/Glc1P ratios that strongly favored degradation based on KM values (Hwang et al. 2010). Genetic studies in the unicellular algae, Chlamydomonas reinhardtii (Dauvillée et al. 2006), and rice (Satoh et al. 2008) also supported a biosynthetic role for Pho1. Mutations in the Pho1 gene resulted in significantly lower starch levels in both organisms, and the starch that formed had abnormal structures (Dauvillée et al. 2006; Satoh et al. 2008). In rice (Satoh et al. 2008), the influence Pho1 had on seed starch levels was temperature-dependent. At 30°C, loss of Pho1 caused the formation of seeds ranging from pseudo-normal to shrunken to severely shrunken. However,

14

K. Koper et al.

when seeds were grown under 20°C, the majority of seeds were shrunken or severely shrunken. This outcome (Satoh et al. 2008), coupled with expression profiling of rice endosperm (Ohdan et al. 2005), indicated that Pho1 participates in both starch granule initiation and maturation. Furthermore, the expression of Pho1 was elevated in mutant w24 rice lines with a missense mutation in the AGPase LS gene (Tang et al. 2016). Increased expression of Pho1 in response to lowered AGPase activity might indicate a complementation role for Pho1 under conditions where AGPase activity is insufficient.

1.3.7 Future Directions for Improving Yield Through Metabolic Engineering Around the Pho1 Pathway Overall, evidence indicates Pho1 could be a significant player in generating sink strength. In sink tissues such as the endosperms of maize (Mu et al. 2001) and rice (Satoh et al. 2008), Pho1 is a highly abundant protein that can potentially generate significant carbon flux into starch. Thus, bio-engineering approaches to improve Pho1 reaction in sink tissues could make this pathway an attractive target for improving sink strength and plant productivity. Flux through the Pho1 pathway could be increased by overexpressing the protein. Alternatively, the generation of mutant Pho1 proteins with favorable kinetic properties (lower KM and/or higher Kcat) could allow the flux through this pathway to increase without increasing protein amounts.

1.4 Genome Editing Technology to Manipulate Starch Synthesis and Plant Growth As traditional breeding methods to improve crop productivity or quality is notoriously time- and labor-intensive, more direct and precise ways to introduce desirable traits into crop plants is needed. A series of revolutionary genome editing (GE) methods have been recently developed to accelerate genetic improvement on plants (Langner et al. 2018; Osakabe and Osakabe 2015; Zhang et al. 2018). These methods have drawn much attention due to their high potentials in target-based precision gene editing. Their applications are almost limitless if proper gene transfer and regeneration procedures are established for the plant species of interest.

1 Source-Sink Relationships and Its Effect on Plant …

15

1.4.1 Examples of the GE Technology Application to Engineer Starch Quality and Productivity Starch granules are produced, stored, and mobilized in chloroplasts and amyloplasts where a collection of starch biosynthetic, modifying and degrading enzymes form a functionally intertwined network. Thus, when all possible factors are considered, the programmed genome editing of endogenous enzymes could create desired effects on starch metabolism and starch structure. Described below are examples of crop plants engineered for improvement of starch quality or productivity and are summarized in Table 1.1. Cassava (Manihot esculenta Crantz): The CRISPR/Cas9-mediated genome editing has been performed on two cassava genes, PROTEIN TARGETING TO STARCH (PTST1) and GRANULE-BOUND STARCH SYNTHASE (GBSS), which are involved in amylose biosynthesis (Bull et al. 2018). The gbss knock-out (KO) lines accumulated amylose-free starch in storage root tissues. However, none of the ptst1 KO Table 1.1 List of studies employing genome editing technologies to engineer starch metabolism Plant

Target gene

Protein or enzyme

GE method

Tissue

Delivery method

References

PROTEIN TARGETING TO STARCH

Cas9

Callus

Agrobacterium

Bull et al. (2018)

GBSS

Granule-bound starch synthase

Cas9

Callus

Agrobacterium

Bull et al. (2018)

GBSS

Granule-bound starch synthase

Cas9

Protoplast PEG

Andersson et al. (2017)

GBSS

Granule-bound starch synthase

Cas9 RNP

Protoplast PEG

Andersson et al. (2017) Waltz (2016)

Cassava PTST1

Potato

Maize

Wx1 Granule-bound (GBSS) starch synthase

Cas9

Callus

Biolistic

Rice

SSIVa

ZFN

Callus

Agrobacterium? Jung et al. (2018)

AGPL4 ADP-glucose Cas9 pyrophosphorylase L4

Callus

Agrobacterium

Lee et al. (2016)

SBEI, Starch branching SBEIIb enzyme I, IIb

Cas9

Callus

Agrobacterium

Sun et al. (2017)

SBEIIb Starch branching enzyme IIb

nCas-CD-UGI Callus

Agrobacterium

Sun et al. (2017)

PYLs

Pyrabactin resistance 1-like

Cas9

Callus

Agrobacterium

Miao et al. (2018)

PHO1

Starch phosphorylase

Cas12a

Callus

Agrobacterium

Unpublished

Starch synthase Iva

16

K. Koper et al.

lines produced amylose-free starch and had slightly reduced amylose content with an average content of 13.3% compared to 18.5% in wildtype. Potato (Solanum tuberosum L.): Tuber starch quality of potato was altered by multiallelic mutagenesis of the GBSS genes via transient expression of CRISPR/Cas9 from plasmid or via preassembled Cas9 protein-gRNA ribonucleoproteins (RNPs) after delivery into protoplasts by polyethylene glycol-mediated transformation (Andersson et al. 2017, 2018). The regenerated potato tuber contained high amylopectin starch. Maize (Zea mays L.): A commercial waxy maize (Zea mays) line was developed by knocking out the endogenous Wx1 gene encoding granule-bound starch synthase, which resulted in amylose-free starch. This waxy corn does not require USDA oversight in the United States and is exempted from GMO regulations because it no longer carries foreign genetic materials introduced by genetic manipulation (Jaganathan et al. 2018; Waltz 2016). Rice (Oryza sativa L.): (i) The zinc finger nuclease induced a double-stranded break in the starch synthase IVa (SSIVa) loci, which created a premature stop codon and substitution in the rice genome (Jung et al. 2018). The resulting rice plant showed an abolished SSIVa mRNA expression, decreased starch content, and dwarf phenotype. (ii) The OsAGPL4 gene encodes a LS of the plastidic ADP-glucose pyrophosphorylase (AGPase), which is particularly important for starch synthesis in rice pollen (Lee et al. 2007, 2016). The CRISPR/Cas9 system generated two homozygous mutants, osagpl4-2 and osagpl4-3, containing one and two nucleotide insertions, respectively (Lee et al. 2016). The AGPase activities and starch contents of the KO mutant lines were significantly reduced in mature anthers, and the mutants showed only 10– 20% fertility, indicating the loss of the AGPase L4 subunit in rice pollen resulted in partial male sterility. (iii) CRISPR/Cas9 technology individually removed two starch branching enzymes in rice, SBEI and SBEIIb. The grain sizes of the sbeIIb KO lines were significantly smaller than those of wildtype, whereas the sbeI lines showed no difference. The starch composition was dratically altered for both mutant lines. The sbeI and sbeII mutant lines produced grains containing 15% and 25% amylose, respectively. (iv) CRISPR/nCas9 (Cas9 nickase; Cas9 containing a D10A mutation) fused with a cytidine deaminase, and uracil DNA glycosylase inhibitor (UGI) introduced point mutations at the coding sequence of rice SBEIIb. However, the resulting effects of the mutations on starch were not reported (Li et al. 2017). (v) Genome editing the regulatory components of the abscisic acid (ABA) receptor (RCAR) family greatly improved seed productivity in an indirect way. Multiplex CRISPR/Cas9 was employed to disrupt gene functions in a subfamily of ABA receptor genes encoding pyrabactin resistance 1-like (PYL). Intriguingly, triple mutations in PYL1, PYL4, and PYL6 (pyl1/pyl4/pyl6) significantly improved plant growth and increased grain yield while average grain weight remained unchanged (Miao et al. 2018). (vi) CRISPR/Cas12a knocked out the expression of the plastidial starch phosphorylase, Pho1. The resulting bi-allelic mutant lines produced mildly to severely

1 Source-Sink Relationships and Its Effect on Plant …

17

shrunken seeds when grown at ambient temperature, indicating a significant reduction in starch accumulation by the KO mutations (Hwang et al., data unpublished).

1.4.2 AGPase and Pho1 as Potential Targets for Genome Editing to Improve Rice Grain Yield As explained in Sect. 1.3, the introduction and overexpression of altered AGPases tissues can increase the sink strength of the source and sink organs of crop plants. However, since all these transgenic plants carry hereditary foreign transgenes, it may not be a viable strategy for the development of agronomically important crops. With the advancements in GE technology, numerous AGPase mutants generated through traditional transformation methods can be revisited. Regeneration of these mutants through the usage of modern GE approaches would remove the regulatory constraints on transgenic plant lines containing hereditary foreign genetic elements. Table 1.2 summarizes the yield increases achieved through the modification of AGPase. These studies employed traditional genome modification and transformation approaches. Similar studies done using modern GE techniques can further improve plant productivity.

1.4.3 Quantitative Trait Loci (QTLs) as Targets for Genome Editing to Improve Grain Yield Multiple naturally occurring QTLs have the potentials to facilitate the breeding of high-yield (grain weight, grain number per panicle, and/or panicle number per plant) varieties. The QTL analysis via successive crossing and backcrossing with a phenotypically distinct cultivar can pinpoint an allele or gene responsible for the phenotype and identify loss-of-function mutations associated with signaling pathways determining seed size (Li and Li 2016). The mutations either negatively or positively affect seed size by influencing endosperm or maternal tissue growth. Here, we describe a few examples of rice QTLs, which have high applicability potential in increasing plant productivity via genome editing. GS3. This is a dominant rice QTL controlling grain length and weight and encodes a member of the phosphatidylethanolamine-binding protein (PEBP) family that negatively regulates grain length. The protein of 232 amino acids is comprised of a putative PEBP-like domain, a transmembrane region, a putative tumor necrosis factor receptor (TNFR)/nerve growth factor receptor (NGFR) family cysteine-rich domain, and a von Willebrand factor type C (VWFC) module. The GS3 gene has a point mutation (C165A substitution) which replaces Cys with a stop codon, resulting in a 178-aa truncation including part of the PEBP-like domain (Fan et al. 2006).

18

K. Koper et al.

Table 1.2 Summary of studies involving the modification of AGPase through traditional methods AGPase mutant/gene

Organism and organ

Effect

Yield increase

References

Up1,2,3

Arabidopsis thaliana leaves

Higher 3PGA, lower Pi sensitivity

26–50% more leaf dry weight

Gibson et al. (2011)

glgC-16

Potato tuber

Lower Pi sensitivity

0–60% more tuber starch

Stark et al. (1992) and Sweetlove and Burrell (1996)

glgC

Cassava tuberous Lower Pi root sensitivity

166% more tuberous root biomass

Ihemere et al. (2006)

UpReg1,2,3

Rice leaves

Higher 3PGA, lower Pi sensitivity

12–39% more grain Gibson et al. yield (2011)

Sh2r6hs

Rice leaves

Lower Pi sensitivity and higher heat stability

29% more biomass

Schlosser et al. (2014)

glgC-TM

Rice endosperm

Insensitive to Pi, fully active

11% increase in seed weight

Sakulsingharoj et al. (2004)

rev6/hs33

Rice endosperm

Lower Pi sensitivity, higher heat stability

19% increase in seed number and 22% increase total biomass

Smidansky et al. (2003)

Sh2r6hs and Bt2

Rice leaves and endosperm

Lower Pi sensitivity, higher heat stability

61% more biomass

Oiestad et al. (2016)

glgC-16

Maize endosperm

Lower Pi sensitivity

13–25% increase in Wang et al. (2007) seed weight

Rev6

Maize endosperm

Lower Pi sensitivity

11–18% increase in Giroux et al. seed weight (1996)

Bt2 and Sh2

Maize endosperm

Native overexpression

18–33% increase in Li et al. (2011b) seed weight

rev6/hs33

Maize endosperm

Lower Pi sensitivity, higher heat stability

64% increase in seed number

Hannah et al. (2012)

(continued)

qGL3-1/GL3.1/qGL3. These QTLs are associated with a rice gene that codes for a serine/threonine protein phosphatase (OsPPKL1). The japonica cultivars, CW23 and Waiyin (WY3), and indica cultivar, N411, are much larger in grain size and weight than their wildtype parents. The phenotype is due to a single nucleotide substitution (C1092A) for the CW32 qGL3-1 allele (Qi et al. 2012) and two substitutions (C1092A

1 Source-Sink Relationships and Its Effect on Plant …

19

Table 1.2 (continued) AGPase mutant/gene

Organism and organ

Effect

Yield increase

MP-QTCL

Maize endosperm

Higher activity 35% increase in and heat stability seed number

Hannah et al. (2017)

rev6/hs33

Wheat Endosperm

Lower Pi sensitivity, higher heat stability

Sakulsingharoj et al. (2004) and Smidansky et al. (2002, 2007)

36% increase in seed number and a 31% increase in total biomass

References

and C1495T) for the WY3 GL3.1 (Zhang et al. 2012) and the N411 qGL3 alleles (Zhang et al. 2012), resulting in Asp364Glu and His499Tyr mutations, respectively, in the serine/threonine protein phosphatase (OsPPKL1). The D364E mutation occurs in a conserved motif AVLDT of the Kelch repeat. OsPPKL1 downregulates the cell cycle protein, Cyclin-T1;3C, by dephosphorylating the protein and both mutations are suggested to weaken the dephosphorylation activity of OsPPKL1, which resulted in upregulation of Cyclin-T1;3C in cell cycle regulation and enhanced grain size and yield (Qi et al. 2012). GS2/GL2. Baodali (BDL), Judali (JDL), and RW1 rice cultivars produce grains with significantly increased length and width (Duan et al. 2015). This phenotype is derived from major grain size QTLs, GS2 (GRAIN SIZE ON CHROMOSOME 2) (Duan et al. 2015) and GL2 (Duan et al. 2015), which encode a Growth Regulating Factor 4 (OsGRF4), a transcription activator regulated by the microRNA, OsmiR396c. Sequence analysis revealed that the GS2/GL2 QTL contains multiple nucleotide substitutions; G4A, G219T/C220T, T1187A/C1188A, and G2991T. Among these changes, T1187A/C1188A occurs in the miR396c target site of OsGRF4. Biochemical tests showed that OsmiR396c cleaves the wild type OsGRF4 mRNA but not the OsGRF4 mRNA containing the T1187A/C1198A substitution (Duan et al. 2015). Thus, OsmiR396c is no longer able to regulate OsGRF4 transcript levels, resulting in increased expression of OsGRF4, which leads to enlarged cell size and increased cell number (Duan et al. 2015). TGW6. A 1-bp deletion of the rice indole-3-acetic acid (IAA)-glucose hydrolase encoded by THOUSAND-GRAIN WEIGHT 6 (TGW6) produces a non-functional truncated TGW6 protein. A loss of the TGW6 function results in larger grain length (Ishimaru et al. 2013). In contrast, GW2 (Song et al. 2007), GS3 (Fan et al. 2006), SW5 (Shomura et al. 2008), GS5 (Li et al. 2011a) and GW8 control the size of the spikelet hull and provide an indirect effect on endosperm growth, in turn, grain size (Ishimaru et al. 2013). GW2. This gene encodes a truncated RING-type protein with E3 ubiquitin ligase activity. The frameshift mutation caused by a 1-bp deletion at A316 abolishes GW2 function, which causes increased cell numbers leading to enhanced grain width and weight. Thus, GW2 is likely a negative regulator of cell division by ubiquitination

20

K. Koper et al.

of its target protein(s) that are subsequently degraded by proteasomes (Song et al. 2007). GW5. An 11.2-kb genomic region encodes a protein containing two IQ calmodulinbinding motifs and a domain of the unknown function (Liu et al. 2017). The GW5 protein is preferentially expressed in developing panicles and localizes to the plasma membrane. The IQ motifs repress the kinase activity of the rice GSK2 (glycogen synthase kinase 2) (Tong et al. 2012), a homolog of the Arabidopsis BRASSINOSTEROID INSENSITIVE 2 (BIN2), which phosphorylates BZR1, a positive regulator of the brassinosteroid (BR) signaling pathway. The unphosphorylated BZR1 is resistant to degradation by 26S proteasome (He et al. 2002), resulting in increased grain width and weight. GW5 indirectly stimulates the BR signaling pathway by acting upstream of GSK2 by repressing its autophosphorylation (i.e., kinase activity) (Liu et al. 2017). Grain weight can be increased by repressing the kinase activity of GSK2 (Tong et al. 2012). Gn1a. The plant hormone cytokinin (CK) positively regulates the shoot apical meristem (SAM) activity, a major determinant for seed production. OsCKX2 (or Gn1a) encodes a CK oxidase/dehydrogenase, which degrades the phytohormone. A deletion of 11-bp in the third exon of OsCKX2 stimulates CK accumulation in inflorescence meristems, which increases the number of reproductive organs leading to increased grain yield (Ashikari et al. 2005; Li et al. 2013). OsCKX2 gene expression is directly regulated by the zinc finger transcription factor, DROUGHT AND SALT TOLERANCE (DST), in the reproductive meristem. The dst mutant (DSTreg1 ) contains an ‘A’ insertion between the 214th and 215th nucleotide of the DST coding sequence, causing a translational frameshift which leaves only the first 72 residues of the total 301 amino acids intact. Interestingly, DSTreg1 acts in both OsCKX2dependent and independent manners to enhance grain production by increasing primary and secondary panicle branching and by producing more grains per panicle in both japonica and indica varieties (Li et al. 2013). LP. LARGER PANICLE (LP) encodes an ER-localized Kelch repeat-containing Fbox protein, which interacts with a rice SKP1-like protein. Two lp mutants were identified: lp-1 containing a T-to-C substitution resulting in a Ser472Pro replacement and lp-2 containing two nucleotide deletion at the C-terminal region resulting in an elongated protein with 21 additional amino acids. Both mutants downregulate CK oxidase/dehydrogenase expression, which results in the formation of larger panicles and higher grain numbers (Li et al. 2011a). DEP1. DENSE AND ERECT PANICLE1 (DEP1) encodes a phosphatidylethanolamine-binding protein-like domain protein sharing some homology with the N-terminal region of PEBP (Fan et al. 2006). A loss of 230 residues from the C-terminus of the protein results in an increased number of inflorescence and panicle meristems, leading to a higher number of primary and secondary branches. The resulting higher number of grains per panicle contributes to increased grain yield per plant, although the average grain weight was decreased (Huang et al. 2009).

1 Source-Sink Relationships and Its Effect on Plant …

21

1.4.4 Future Directions for Improving Crop Plant Yield Through Modern GE Based Approaches The CRISPR-based genome editing can generate crop plants having a significantly lower risk for hereditary transfer of unwanted genome modification compared to GMOs as the technology alters only a few nucleotides and mimics changes occurring in natural populations. Recently, the fidelity of Cas nucleases has been greatly improved to minimize off-target effects. However, in order to further reduce the longterm risk of potential off-target events to zero, the genome editing reagents deliberatively introduced into the plant system should be removed effectively by either programmed self-elimination, segregation, or an additional cut-out step. If newly generated GE crops are successfully free of foreign DNA, there will be no discernible difference between the naturally occurring mutation and the change made by GE technology. It is worthwhile to note that an emerging technology employing the RNPs of CRISPR-Cas nucleases and gRNAs, also known as RNA-guided engineered nucleases RNPs (RGEN RNPs), will be an excellent tool for DNA-free genome editing (Kanchiswamy 2016) when efficient and robust procedures for gene delivery and plant regeneration are established. Thus, if the genome-edited crops are completely free of foreign DNA as done for the waxy corn (Jaganathan et al. 2018; Waltz 2016) and potentially for lettuce (Woo et al. 2015), the genome editing technology will be more widely accepted by consumers as a crop breeding method, which will enable biologists to rapidly improve the quality and/or yields of diverse crops in the near future. The QTL analysis for rice, in particular, identified a large number of agronomically important alleles responsible for enhanced grain yield by affecting grain morphology or reproductive organs. GE technology could be exploited to edit these individual QTL genes or a myriad of the genes of interest simultaneously to bring about cumulative effects that enhance plant productivity and crop yields. Acknowledgements This work was supported by Agriculture and Food Research Initiative [grant no. 2018-67013-27458/project accession no. 1014859] from the USDA National Institute of Food and Agriculture (T.O. and S.K.H.), USDA Hatch Umbrella Project #1015621, and Hatch Regional NC-1200 Project.

References Ainsworth EA, Bush DR (2011) Carbohydrate export from the leaf: a highly regulated process and target to enhance photosynthesis and productivity. Plant Physiol 155(1):64–69 Ainsworth EA, Long SP (2005) What have we learned from 15 years of free-air CO2 enrichment (FACE)? A meta-analytic review of the responses of photosynthesis, canopy properties and plant production to rising CO2 . New Phytol 165(2):351–372 Ainsworth EA, Yendrek CR et al (2012) Accelerating yield potential in soybean: potential targets for biotechnological improvement. Plant Cell Environ 35(1):38–52

22

K. Koper et al.

Andersson M, Turesson H et al (2017) Efficient targeted multiallelic mutagenesis in tetraploid potato (Solanum tuberosum) by transient CRISPR-Cas9 expression in protoplasts. Plant Cell Rep 36(1):117–128. https://doi.org/10.1007/s00299-016-2062-3 Andersson M, Turesson H et al (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164(4):378–384. https://doi.org/10.1111/ppl.12731 Araújo WL, Nunes-Nesi A et al (2011) Antisense inhibition of the iron-sulphur subunit of succinate dehydrogenase enhances photosynthesis and growth in tomato via an organic acid–mediated effect on stomatal aperture. Plant Cell 23(2):600–627 Ashikari M, Sakakibara H et al (2005) Cytokinin oxidase regulates rice grain production. Science 309(5735):741–745. https://doi.org/10.1126/science.1113373 Asseng S, Kassie B, Labra MH, Amador C, Calderini DF (2017) Simulating the impact of source– sink manipulations in wheat. Field Crops Res 202:47–56 Atkinson N, Leitão N et al (2017) Rubisco small subunits from the unicellular green alga Chlamydomonas complement Rubisco-deficient mutants of Arabidopsis. New Phytol 214(2):655–667 Ballicora MA, Frueauf JB et al (2000) Activation of the potato tuber ADP-glucose pyrophosphorylase by thioredoxin. J Biol Chem 275(2):1315–1320 Ballicora MA, Iglesias AA et al (2003) ADP-glucose pyrophosphorylase, a regulatory enzyme for bacterial glycogen synthesis. Microbiol Mol Biol Rev MMBR 67(2):213–225. https://doi.org/10. 1128/mmbr.67.2.213-225.2003 Ballicora MA, Iglesias AA et al (2004) ADP-glucose pyrophosphorylase: a regulatory enzyme for plant starch synthesis. Photosynth Res 79(1):1–24. https://doi.org/10.1023/b:pres.0000011916. 67519.58 Baroja-Fernández E, Muñoz FJ et al (2009) Enhancing sucrose synthase activity in transgenic potato (Solanum tuberosum L.) tubers results in increased levels of starch, ADPglucose and UDPglucose and total yield. Plant Cell Physiol 50(9):1651–1662 Betti M, Bauwe H et al (2016) Manipulating photorespiration to increase plant productivity: recent advances and perspectives for crop improvement. J Exp Bot 67(10):2977–2988 Bihmidine S, Hunter CT III et al (2013) Regulation of assimilate import into sink organs: update on molecular drivers of sink strength. Front Plant Sci 4:177 Blankenship RE, Tiede DM et al (2011) Comparing photosynthetic and photovoltaic efficiencies and recognizing the potential for improvement. Science 332(6031):805–809 Bock R (2015) Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology. Annu Rev Plant Biol 66:211–241 Bodirsky BL, Rolinski S et al (2015) Global food demand scenarios for the 21st century. PLoS ONE 10(11):e0139201 Boehlein SK, Shaw JR et al (2008) Heat stability and allosteric properties of the maize endosperm ADP-glucose pyrophosphorylase are intimately intertwined. Plant Physiol 146(1):289–299. https://doi.org/10.1104/pp.107.109942 Boehlein SK, Liu P et al (2019) Effects of long-term exposure to elevated temperature on Zea mays endosperm development during grain fill. Plant J 99(1):23–40. https://doi.org/10.1111/tpj.14283 Bracher A, Whitney SM et al (2017) Biogenesis and metabolic maintenance of Rubisco. Annu Rev Plant Biol 68:29–60 Bull SE, Seung D et al (2018) Accelerated ex situ breeding of GBSS- and PTST1-edited cassava for modified starch. Sci Adv 4(9):eaat6086. https://doi.org/10.1126/sciadv.aat6086 Burton RA, Johnson PE et al (2002) Characterization of the genes encoding the cytosolic and plastidial forms of ADP-glucose pyrophosphorylase in wheat endosperm. Plant Physiol 130(3):1464–1475. https://doi.org/10.1104/pp.010363 Cakir B, Shiraishi S et al (2016) Analysis of the rice ADP-glucose transporter (OsBT1) indicates the presence of regulatory processes in the amyloplast stroma that control ADP-glucose flux into starch. Plant Physiol 170(3):1271–1283 Carmo-Silva E, Scales JC et al (2015) Optimizing Rubisco and its regulation for greater resource use efficiency. Plant Cell Environ 38(9):1817–1832

1 Source-Sink Relationships and Its Effect on Plant …

23

Chang T-G, Zhu X-G (2017) Source–sink interaction: a century old concept under the light of modern molecular systems biology. J Exp Bot 68(16):4417–4431. https://doi.org/10.1093/jxb/ erx002 Chen C, Li C et al (1994) Carbohydrate metabolism enzymes in CO2 -enriched developing rice grains of cultivars varying in grain size. Physiol Plant 90(1):79–85 Cossani CM, Reynolds M (2012) Physiological traits for improving heat tolerance in wheat. Plant Physiol 160:1710–1718 Crevillen P, Ballicora MA et al (2003) The different large subunit isoforms of Arabidopsis thaliana ADP-glucose pyrophosphorylase confer distinct kinetic and regulatory properties to the heterotetrameric enzyme. J Biol Chem 278(31):28508–28515 Crevillén P, Ventriglia T et al (2005) Differential pattern of expression and sugar regulation of Arabidopsis thaliana ADP-glucose pyrophosphorylase-encoding genes. J Biol Chem 280(9):8143–8149. https://doi.org/10.1074/jbc.M411713200 Cross JM, Clancy M et al (2004) Both subunits of ADP-glucose pyrophosphorylase are regulatory. Plant Physiol 135(1):137–144 Dauvillée D, Chochois V et al (2006) Plastidial phosphorylase is required for normal starch synthesis in Chlamydomonas reinhardtii. Plant J 48(2):274–285 Denyer K, Dunlap F et al (1996) The major form of ADP-glucose pyrophosphorylase in maize endosperm is extra-plastidial. Plant Physiol 112(2):779–785 Duan P, Ni S et al (2015) Regulation of OsGRF4 by OsmiR396 controls grain size and yield in rice. Nat Plants 2:15203. https://doi.org/10.1038/nplants.2015.203 Erb TJ, Zarzycki J (2018) A short history of RubisCO: the rise and fall (?) of nature’s predominant CO2 fixing enzyme. Curr Opin Biotechnol 49:100–107 Fan C, Xing Y et al (2006) GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor Appl Genet 112(6):1164–1171. https://doi.org/10.1007/s00122-006-0218-1 Farooq M, Palta JA, Bramley H, Siddique KHM (2011) Heat stress in wheat during reproductive and grain-filling phases. Crit Rev Plant Sci 30:491–507 Farrar J, Jones D (2000) The control of carbon acquisition by roots. New Phytol 147(1):43–53 Feng L, Wang K et al (2007) Overexpression of SBPase enhances photosynthesis against high temperature stress in transgenic rice plants. Plant Cell Rep 26(9):1635–1646 Fettke J, Albrecht T et al (2010) Glucose 1-phosphate is efficiently taken up by potato (Solanum tuberosum) tuber parenchyma cells and converted to reserve starch granules. New Phytol 185(3):663–675. https://doi.org/10.1111/j.1469-8137.2009.03126.x Fettke J, Leifels L et al (2012) Two carbon fluxes to reserve starch in potato (Solanum tuberosum L.) tuber cells are closely interconnected but differently modulated by temperature. J Exp Bot 63(8):3011–3029. https://doi.org/10.1093/jxb/ers014 Fischer EH, Heilmeyer LMG et al (1971) Phosphorylase and the control of glycogen degradation. In: Horecker BL, Stadtman ER (eds) Current topics in cellular regulation, vol 4. Academic Press, pp 211–251 Fu Y, Ballicora MA et al (1998) Mechanism of reductive activation of potato tuber ADP-glucose pyrophosphorylase. J Biol Chem 273:25045–25052 Fujita N, Yoshida M et al (2006) Function and characterization of starch synthase I using mutants in rice. Plant Physiol 140(3):1070–1084 Fujita N, Yoshida M et al (2007) Characterization of SSIIIa-deficient mutants of rice: the function of SSIIIa and pleiotropic effects by SSIIIa deficiency in the rice endosperm. Plant Physiol 144(4):2009–2023 Furbank RT (2016) Walking the C4 pathway: past, present, and future. J Exp Bot 67(14):4057–4066. https://doi.org/10.1093/jxb/erw161 Geigenberger P (2011) Regulation of starch biosynthesis in response to a fluctuating environment. Plant Physiol 155(4):1566–1577

24

K. Koper et al.

Geigenberger P, Stitt M (2000) Diurnal changes in sucrose, nucleotides, starch synthesis and AGPS transcript in growing potato tubers that are suppressed by decreased expression of sucrose phosphate synthase. Plant J 23(6):795-806X Geigenberger P, Regierer B et al (2005) Inhibition of de novo pyrimidine synthesis in growing potato tubers leads to a compensatory stimulation of the pyrimidine salvage pathway and a subsequent increase in biosynthetic performance. Plant Cell 17(7):2077–2088 Georgelis N, Braun EL et al (2007) The two AGPase subunits evolve at different rates in angiosperms, yet they are equally sensitive to activity-altering amino acid changes when expressed in bacteria. Plant Cell 19(5):1458–1472 Gibson K, Park J-S et al (2011) Exploiting leaf starch synthesis as a transient sink to elevate photosynthesis, plant productivity and yields. Plant Sci 181(3):275–281 Giroux MJ, Shaw J et al (1996) A single mutation that increases maize seed weight. Proc Natl Acad Sci USA 93(12):5824–5829. https://doi.org/10.1073/pnas.93.12.5824 Gol L, Tomé F, von Korff M (2017) Floral transitions in wheat and barley: interactions between photoperiod, abiotic stresses, and nutrient status. J Exp Bot 68:1399–1410 Gong HY, Li Y et al (2015) Transgenic rice expressing Ictb and FBP/Sbpase derived from cyanobacteria exhibits enhanced photosynthesis and mesophyll conductance to CO2 . PLoS ONE 10(10):e0140928 Good AG, Shrawat AK et al (2004) Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends Plant Sci 9(12):597–605 Greene TW, Hannah LC (1998) Enhanced stability of maize endosperm ADP-glucose pyrophosphorylase is gained through mutants that alter subunit interactions. Proc Natl Acad Sci USA 95:13342–13347 Griffiths CA, Sagar R et al (2016) Chemical intervention in plant sugar signalling increases yield and resilience. Nature 540(7634):574 Gustin JL, Boehlein SK et al (2018) Ovary abortion is prevalent in diverse maize inbred lines and is under genetic control. Sci Rep 8(1). https://doi.org/10.1038/s41598-018-31216-9 Hannah LC, James M (2008) The complexities of starch biosynthesis in cereal endosperms. Curr Opin Biotechnol 19(2):160–165 Hannah LC, Futch B et al (2012) A shrunken-2 transgene increases maize yield by acting in maternal tissues to increase the frequency of seed development. Plant Cell 24(6):2352–2363 Hannah LC, Shaw JR et al (2017) A brittle-2 transgene increases maize yield by acting in maternal tissues to increase seed number. Plant Direct 1(6):e00029. https://doi.org/10.1002/pld3.29 Harrison C, Hedley C et al (1998) Evidence that the rug3 locus of pea (Pisum sativum L.) encodes plastidial phosphoglucomutase confirms that the imported substrate for starch synthesis in pea amyloplasts is glucose-6-phosphate. Plant J 13(6):753–762 Hay WT, Bihmidine S et al (2017) Enhancing soybean photosynthetic CO2 assimilation using a cyanobacterial membrane protein, ictB. J Plant Physiol 212:58–68 He JX, Gendron JM et al (2002) The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. Proc Natl Acad Sci USA 99(15):10185–10190. https://doi.org/10.1073/pnas.152342599 Hendriks JH, Kolbe A et al (2003) ADP-glucose pyrophosphorylase is activated by posttranslational redox-modification in response to light and to sugars in leaves of Arabidopsis and other plant species. Plant Physiol 133(2):838–849 Hendry GA (1993) Evolutionary origins and natural functions of fructans—a climatological, biogeographic and mechanistic appraisal. New Phytol 123(1):3–14 Herbers K, Sonnewald U (1998) Molecular determinants of sink strength. Curr Opin Plant Biol 1(3):207–216 Hocking P, Meyer C (1991) Effects of CO2 enrichment and nitrogen stress on growth, and partitioning of dry matter and nitrogen in wheat and maize. Funct Plant Biol 18(4):339–356 Huang XZ, Qian Q et al (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet 41(4):494–497. https://doi.org/10.1038/ng.352

1 Source-Sink Relationships and Its Effect on Plant …

25

Huber SC (1981) Inter-and intra-specific variation in photosynthetic formation of starch and sucrose. Z Pflanzenphysiol 101(1):49–54 Huber SC, Hanson KR (1992) Carbon partitioning and growth of a starchless mutant of Nicotiana sylvestris. Plant Physiol 99(4):1449–1454 Hütsch BW, Jahn D, Schubert S (2019) Grain yield of wheat (Triticum aestivum L.) under long-term heat stress is sink-limited with stronger inhibition of kernel setting than grain filling. J Agron Crop Sci 205:22–32 Hwang S-K, Salamone PR et al (2005) Allosteric regulation of the higher plant ADP-glucose pyrophosphorylase is a product of synergy between the two subunits. FEBS Lett 579(5):983–990. https://doi.org/10.1016/j.febslet.2004.12.067 Hwang S-K, Nishi A et al (2010) Rice endosperm-specific plastidial α-glucan phosphorylase is important for synthesis of short-chain malto-oligosaccharides. Arch Biochem Biophys 495(1):82– 92 Hwang S-K, Singh S et al (2016) The plastidial starch phosphorylase from rice endosperm: catalytic properties at low temperature. Planta 243(4):999–1009 Iglesias AA, Preiss J (1992) Bacterial glycogen and plant starch biosynthesis. Biochem Educ 20(4):196–203. https://doi.org/10.1016/0307-4412(92)90191-n Iglesias A, Barry G et al (1993) Expression of the potato tuber ADP-glucose pyrophosphorylase in Escherichia coli. J Biol Chem 268(2):1081–1086 Iglesias AA, Charng YY et al (1994) Characterization of the kinetic, regulatory, and structural properties of ADP-glucose pyrophosphorylase from Chlamydomonas reinhardtii. Plant Physiol 104(4):1287–1294. https://doi.org/10.1104/pp.104.4.1287 Ihemere U, Arias-Garzon D et al (2006) Genetic modification of cassava for enhanced starch production. Plant Biotechnol J 4(4):453–465 Ishikawa C, Hatanaka T et al (2011) Functional incorporation of sorghum small subunit increases the catalytic turnover rate of Rubisco in transgenic rice. Plant Physiol 156(3):1603–1611 Ishimaru K, Hirotsu N et al (2013) Loss of function of the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and increases yield. Nat Genet 45(6):707–711. https://doi.org/10. 1038/ng.2612 Jaganathan D, Ramasamy K et al (2018) CRISPR for crop improvement: an update review. Front Plant Sci 9:985. https://doi.org/10.3389/fpls.2018.00985 Jefferson R, Bevan M (1987) Regulated expression of a chimeric patatin-glucuronidase fusion in tubers and induced internode cuttings of transformed potato. J Cell Biochem Joana Rodrigues JEA (2019) Source–sink regulation in crops under water deficit. Trends Plant Sci 24(7):652–663 Jonik C, Sonnewald U et al (2012) Simultaneous boosting of source and sink capacities doubles tuber starch yield of potato plants. Plant Biotechnol J 10(9):1088–1098 Jung Y-J et al (2018) Application of ZFN for site directed mutagenesis of rice SSIVa gene. Biotechnol Bioprocess Eng 23 Kanchiswamy CN (2016) DNA-free genome editing methods for targeted crop improvement. Plant Cell Rep 35(7):1469–1474. https://doi.org/10.1007/s00299-016-1982-2 Kebeish R, Niessen M et al (2007) Chloroplastic photorespiratory bypass increases photosynthesis and biomass production in Arabidopsis thaliana. Nat Biotechnol 25(5):593 Kirschbaum MU (2011) Does enhanced photosynthesis enhance growth? Lessons learned from CO2 enrichment studies. Plant Physiol 155(1):117–124 Kolbe A, Tiessen A et al (2005) Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase. Proc Natl Acad Sci 102(31):11118– 11123 Körner C (2015) Paradigm shift in plant growth control. Curr Opin Plant Biol 25:107–114 Koßmann J, Visser RG et al (1991) Cloning and expression analysis of a potato cDNA that encodes branching enzyme evidence for co-expression of starch biosynthetic genes. Mol Gen Genet MGG 230(1–2):39–44

26

K. Koper et al.

Kromdijk J, Głowacka K et al (2016). Improving photosynthesis and crop productivity by accelerating recovery from photoprotection. Science 354(6314):857–861 Kruger NJ, ap Rees T (1983) Properties of α-glucan phosphorylase from pea chloroplasts. Phytochemistry 22(9):1891–1898. https://doi.org/10.1016/0031-9422(83)80007-7 Kumar RR, Goswami S, Shamim M et al (2017) Biochemical defense response: characterizing the plasticity of source and sink in spring wheat under terminal heat stress. Front Plant Sci 8:1603 Langner T, Kamoun S et al (2018) CRISPR crops: plant genome editing toward disease resistance. Annu Rev Phytopathol 56(56):479–512. https://doi.org/10.1146/annurev-phyto-080417-050158 Laterre R, Pottier M et al (2017) Photosynthetic trichomes contain a specific Rubisco with a modified pH-dependent activity. Plant Physiol 173(4):2110–2120 Lee S-K, Hwang S-K et al (2007) Identification of the ADP-glucose pyrophosphorylase isoforms essential for starch synthesis in the leaf and seed endosperm of rice (Oryza sativa L.). Plant Mol Biol 65(4):531–546 Lee SK, Eom JS et al (2016) Plastidic phosphoglucomutase and ADP-glucose pyrophosphorylase mutants impair starch synthesis in rice pollen grains and cause male sterility. J Exp Bot 67(18):5557–5569. https://doi.org/10.1093/jxb/erw324 Lefebvre S, Lawson T et al (2005) Increased sedoheptulose-1, 7-bisphosphatase activity in transgenic tobacco plants stimulates photosynthesis and growth from an early stage in development. Plant Physiol 138(1):451–460 Leung P, Lee Y-M et al (1986) Cloning and expression of the Escherichia coli glgC gene from a mutant containing an ADPglucose pyrophosphorylase with altered allosteric properties. J Bacteriol 167(1):82–88 Li N, Li Y (2016) Signaling pathways of seed size control in plants. Curr Opin Plant Biol 33:23–32. https://doi.org/10.1016/j.pbi.2016.05.008 Li M, Tang D et al (2011a) Mutations in the F-box gene LARGER PANICLE improve the panicle architecture and enhance the grain yield in rice. Plant Biotechnol J 9(9):1002–1013. https://doi. org/10.1111/j.1467-7652.2011.00610.x Li N, Zhang S et al (2011b) Over-expression of AGPase genes enhances seed weight and starch content in transgenic maize. Planta 233(2):241–250 Li SY, Zhao BR et al (2013) Rice zinc finger protein DST enhances grain production through controlling Gn1a/OsCKX2 expression. Proc Natl Acad Sci USA 110(8):3167–3172. https://doi. org/10.1073/pnas.1300359110 Li J, Sun Y et al (2017) Generation of targeted point mutations in rice by a modified CRISPR/Cas9 system. Mol Plant 10(3):526–529. https://doi.org/10.1016/j.molp.2016.12.001 Lin T-P, Caspar T et al (1988) Isolation and characterization of a starchless mutant of Arabidopsis thaliana (L.) Heynh lacking ADPglucose pyrophosphorylase activity. Plant Physiol 86(4):1131– 1135 Lin MT, Occhialini A et al (2014) A faster Rubisco with potential to increase photosynthesis in crops. Nature 513(7519):547 Liu J, Chen J et al (2017) GW5 acts in the brassinosteroid signalling pathway to regulate grain width and weight in rice. Nat Plants 3:17043. https://doi.org/10.1038/nplants.2017.43 Long SP, Ainsworth EA et al (2006a) Food for thought: lower-than-expected crop yield stimulation with rising CO2 concentrations. Science 312(5782):1918–1921 Long SP, Zhu XG et al (2006b) Can improvement in photosynthesis increase crop yields? Plant Cell Environ 29(3):315–330 Long BM, Rae BD et al (2016) Cyanobacterial CO2 -concentrating mechanism components: function and prospects for plant metabolic engineering. Curr Opin Plant Biol 31:1–8 Ludewig F, Sonnewald U (2016) Demand for food as driver for plant sink development. J Plant Physiol 203:110–115 Maier A, Fahnenstich H et al (2012) Transgenic introduction of a glycolate oxidative cycle into A. thaliana chloroplasts leads to growth improvement. Front Plant Sci 3:38 Maliga P, Bock R (2011) Plastid biotechnology: food, fuel, and medicine for the 21st century. Plant Physiol 155(4):1501–1510

1 Source-Sink Relationships and Its Effect on Plant …

27

Masson-Delmotte T et al (2018) IPCC, 2018: Summary for Policymakers. In: Global warming of 1.5 C. An IPCC Special Report on the impacts of global warming of 1.5 C above pre-industrial levels and related global greenhouse gas emission pathways, in the context of strengthening the global. World Meteorological Organization, Geneva, Tech. Rep McCormick AJ, Cramer MD et al (2006) Sink strength regulates photosynthesis in sugarcane. New Phytol 171(4):759–770. https://doi.org/10.1111/j.1469-8137.2006.01785.x McCormick A, Watt D et al (2008) Supply and demand: sink regulation of sugar accumulation in sugarcane. J Exp Bot 60(2):357–364 Meyer FD, Smidansky ED et al (2004) The maize Sh2r6hs ADP-glucose pyrophosphorylase (AGP) large subunit confers enhanced AGP properties in transgenic wheat (Triticum aestivum). Plant Sci 167(4):899–911 Meyer F, Talbert L et al (2007) Field evaluation of transgenic wheat expressing a modified ADPglucose pyrophosphorylase large subunit. Crop Sci 47(1):336–342 Miao C, Xiao L et al (2018) Mutations in a subfamily of abscisic acid receptor genes promote rice growth and productivity. Proc Natl Acad Sci USA 115(23):6058–6063. https://doi.org/10.1073/ pnas.1804774115 Michalska J, Zauber H et al (2009) NTRC links built-in thioredoxin to light and sucrose in regulating starch synthesis in chloroplasts and amyloplasts. Proc Natl Acad Sci 106(24):9908–9913 Morita K, Hatanaka T et al (2014) Unusual small subunit that is not expressed in photosynthetic cells alters the catalytic properties of Rubisco in rice. Plant Physiol 164(1):69–79 Mu HH, Yu Y et al (2001) Purification and characterization of the maize amyloplast stromal 112kDa starch phosphorylase. Arch Biochem Biophys 388(1):155–164. https://doi.org/10.1006/abbi. 2000.2267 Muller B, Pantin F et al (2011) Water deficits uncouple growth from photosynthesis, increase C content, and modify the relationships between C and growth in sink organs. J Exp Bot 62(6):1715– 1729 Müller-Röber BT, Koßmann J et al (1990) One of two different ADP-glucose pyrophosphorylase genes from potato responds strongly to elevated levels of sucrose. Mol Gen Genet MGG 224(1):136–146 Murchie EH, Niyogi KK (2011) Manipulation of photoprotection to improve plant photosynthesis. Plant Physiol 155(1):86–92 Nakano H, Makino A et al (1997) The effect of elevated partial pressures of CO2 on the relationship between photosynthetic capacity and N content in rice leaves. Plant Physiol 115(1):191–198 Nations U (2015) World population prospects. The 2015 revision, key findings and advanced tables. Working paper no. ESA7P/WP.241. 2015. 2 Newgard CB, Hwang PK et al (1989) The family of glycogen phosphorylases: structure and function. Crit Rev Biochem Mol Biol 24(1):69–99 Nielsen TH, Krapp A et al (1998) The sugar-mediated regulation of genes encoding the small subunit of Rubisco and the regulatory subunit of ADP glucose pyrophosphorylase is modified by phosphate and nitrogen. Plant Cell Environ 21(5):443–454 Nölke G, Houdelet M et al (2014) The expression of a recombinant glycolate dehydrogenase polyprotein in potato (Solanum tuberosum) plastids strongly enhances photosynthesis and tuber yield. Plant Biotechnol J 12(6):734–742 Nuccio ML, Wu J et al (2015) Expression of trehalose-6-phosphate phosphatase in maize ears improves yield in well-watered and drought conditions. Nat Biotechnol 33(8):862 Nunes-Nesi A, Carrari F et al (2005) Enhanced photosynthetic performance and growth as a consequence of decreasing mitochondrial malate dehydrogenase activity in transgenic tomato plants. Plant Physiol 137(2):611–622 O’Neill BC, Dalton M et al (2010) Global demographic trends and future carbon emissions. Proc Natl Acad Sci 107(41):17521–17526 Obana Y, Omoto D et al (2006) Enhanced turnover of transitory starch by expression of up-regulated ADP-glucose pyrophosphorylases in Arabidopsis thaliana. Plant Sci 170(1):1–11

28

K. Koper et al.

Occhialini A, Lin MT et al (2016) Transgenic tobacco plants with improved cyanobacterial Rubisco expression but no extra assembly factors grow at near wild-type rates if provided with elevated CO2 . Plant J 85(1):148–160 Ohashi K, Makino A et al (2000) Growth and carbon utilization in rice plants under conditions of physiologically low temperature and irradiance. Funct Plant Biol 27(2):99–107 Ohdan T, Francisco PB Jr et al (2005) Expression profiling of genes involved in starch synthesis in sink and source organs of rice. J Exp Bot 56(422):3229–3244. https://doi.org/10.1093/jxb/eri292 Oiestad AJ, Martin JM et al (2016) Overexpression of ADP-glucose pyrophosphorylase in both leaf and seed tissue synergistically increase biomass and seed number in rice (Oryza sativa ssp. japonica). Funct Plant Biol 43(12):1194–1204 Okita TW, Nakata PA et al (1990) The subunit structure of potato tuber ADPglucose pyrophosphorylase. Plant Physiol 93(2):785–790. https://doi.org/10.1104/pp.93.2.785 Orr DJ, Pereira AM et al (2017) Engineering photosynthesis: progress and perspectives. F1000Research 6 Ort DR, Merchant SS et al (2015) Redesigning photosynthesis to sustainably meet global food and bioenergy demand. Proc Natl Acad Sci 112(28):8529–8536 Osakabe Y, Osakabe K (2015) Genome editing with engineered nucleases in plants. Plant Cell Physiol 56(3):389–400. https://doi.org/10.1093/pcp/pcu170 Ozbun JL, Hawker JS et al (1973) Starch synthetase, phosphorylase, ADPglucose pyrophosphorylase, and UDPglucose pyrophosphorylase in developing maize kernels. Plant Physiol 51(1):1–5. https://doi.org/10.1104/pp.51.1.1 Pammenter NW, Loreto F et al (1993) End product feedback effects on photosynthetic electron transport. Photosynth Res 35(1):5–14. https://doi.org/10.1007/BF02185407 Pieters AJ, Paul MJ et al (2001) Low sink demand limits photosynthesis under Pi deficiency. J Exp Bot 52(358):1083–1091. https://doi.org/10.1093/jexbot/52.358.1083 Pimentel D, Burgess M (2013) Soil erosion threatens food production. Agriculture 3(3):443–463 Preiss J (1984) Bacterial glycogen synthesis and its regulation. Annu Rev Microbiol 38(1):419–458. https://doi.org/10.1146/annurev.mi.38.100184.002223 Preiss J, Levi C (1980) Starch biosynthesis and degradation. In: Carbohydrates: structure and function. Elsevier, pp 371–423 Preiss J, Romeo T (1994) Molecular biology and regulatory aspects of glycogen biosynthesis in Bacteria11A glossary for this chapter appears on pp. 326–327. In: Cohn WE, Moldave K (eds) Progress in nucleic acid research and molecular biology, vol 47. Academic Press, pp 299–329 Preiss J, Sivak MN (1998) Biochemistry, molecular biology and regulation of starch synthesis. In: Setlow JK (ed) Genetic engineering: principles and methods. Springer US, Boston, pp 177–223 Qi P, Lin YS et al (2012) The novel quantitative trait locus GL3.1 controls rice grain size and yield by regulating Cyclin-T1;3. Cell Res 22(12):1666–1680. https://doi.org/10.1038/cr.2012.151 Raines CA (2003) The Calvin cycle revisited. Photosynth Res 75(1):1–10 Raines CA (2011) Increasing photosynthetic carbon assimilation in C3 plants to improve crop yield: current and future strategies. Plant Physiol 155(1):36–42 Regierer B, Fernie AR et al (2002) Starch content and yield increase as a result of altering adenylate pools in transgenic plants. Nat Biotechnol 20(12):1256 Reynolds M, Foulkes J et al (2012) Achieving yield gains in wheat. Plant Cell Environ 35(10):1799– 1823 Rocha-Sosa M, Sonnewald U et al (1989) Both developmental and metabolic signals activate the promoter of a class I patatin gene. EMBO J 8(1):23–29 Rosenthal DM, Locke AM et al (2011) Over-expressing the C 3 photosynthesis cycle enzyme sedoheptulose-1-7 bisphosphatase improves photosynthetic carbon gain and yield under fully open air CO2 fumigation (FACE). BMC Plant Biol 11(1):123 Rösti S, Fahy B et al (2007) A mutant of rice lacking the leaf large subunit of ADP-glucose pyrophosphorylase has drastically reduced leaf starch content but grows normally. Funct Plant Biol 34(6):480–489

1 Source-Sink Relationships and Its Effect on Plant …

29

Rowland-Bamford AJ, Allen LH Jr et al (1990) Carbon dioxide effects on carbohydrate status and partitioning in rice. J Exp Bot 41(12):1601–1608 Sakulsingharoj C, Choi S-B et al (2004) Engineering starch biosynthesis for increasing rice seed weight: the role of the cytoplasmic ADP-glucose pyrophosphorylase. Plant Sci 167(6):1323–1333 Satoh H, Shibahara K et al (2008) Mutation of the plastidial α-glucan phosphorylase gene in rice affects the synthesis and structure of starch in the endosperm. Plant Cell 20(7):1833–1849. https:// doi.org/10.1105/tpc.107.054007 Scheible W-R, Gonzalez-Fontes A et al (1997) Nitrate acts as a signal to induce organic acid metabolism and repress starch metabolism in tobacco. Plant Cell 9(5):783–798 Schlosser AJ, Martin JM et al (2012) The maize leaf starch mutation agps-m1 has diminished field growth and productivity. Crop Sci 52(2):700–706 Schlosser AJ, Martin JM et al (2014) Enhanced rice growth is conferred by increased leaf ADPglucose pyrophosphorylase activity. J Plant Physiol Pathol 2(4) Schupp N, Ziegler P (2004) The relation of starch phosphorylases to starch metabolism in wheat. Plant Cell Physiol 45(10):1471–1484 Shapiro B, Wertheimer E (1943) Phosphorolysis and synthesis of glycogen in animal tissues. Biochem J 37(3):397–403. https://doi.org/10.1042/bj0370397 Sharwood RE (2017) Engineering chloroplasts to improve Rubisco catalysis: prospects for translating improvements into food and fiber crops. New Phytol 213(2):494–510 Shomura A, Izawa T et al (2008) Deletion in a gene associated with grain size increased yields during rice domestication. Nat Genet 40(8):1023–1028. https://doi.org/10.1038/ng.169 Sikka VK, Choi S-B et al (2001) Subcellular compartmentation and allosteric regulation of the rice endosperm ADPglucose pyrophosphorylase. Plant Sci. 161:461–468 Simkin AJ, McAusland L et al (2015) Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco. J Exp Bot 66(13):4075–4090 Simkin AJ, McAusland L et al (2017) Overexpression of the RieskeFeS protein increases electron transport rates and biomass yield. Plant Physiol 175(1):134–145 Singh J, Pandey P et al (2014) Enhancing C3 photosynthesis: an outlook on feasible interventions for crop improvement. Plant Biotechnol J 12(9):1217–1230 Slewinski TL (2012) Non-structural carbohydrate partitioning in grass stems: a target to increase yield stability, stress tolerance, and biofuel production. J Exp Bot 63(13):4647–4670 Slewinski TL, Ma Y et al (2008) Determining the role of Tie-dyed1 in starch metabolism: epistasis analysis with a maize ADP-glucose pyrophosphorylase mutant lacking leaf starch. J Hered 99(6):661–666 Smidansky ED, Clancy M et al (2002) Enhanced ADP-glucose pyrophosphorylase activity in wheat endosperm increases seed yield. Proc Natl Acad Sci 99(3):1724–1729 Smidansky ED, Martin JM et al (2003) Seed yield and plant biomass increases in rice are conferred by deregulation of endosperm ADP-glucose pyrophosphorylase. Planta 216(4):656–664 Smidansky ED, Meyer FD et al (2007) Expression of a modified ADP-glucose pyrophosphorylase large subunit in wheat seeds stimulates photosynthesis and carbon metabolism. Planta 225(4):965–976 Smith MR, Rao IM et al (2018) Source-sink relationships in crop plants and their influence on yield development and nutritional quality. Front Plant Sci 9 Sokolov LN, Déjardin A et al (1998) Sugars and light/dark exposure trigger differential regulation of ADP-glucose pyrophosphorylase genes in Arabidopsis thaliana (thale cress). Biochem J 336(3):681–687 Song XJ, Huang W et al (2007) A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat Genet 39(5):623–630. https://doi.org/10.1038/ng2014 Sonnewald U, Basner A et al (1995) A second L-type isozyme of potato glucan phosphorylase: cloning, antisense inhibition and expression analysis. Plant Mol Biol 27(3):567–576 Sowokinos JR (1981) Pyrophosphorylases in Solanum tuberosum: II. Catalytic properties and regulation of ADP-glucose and UDP-glucose pyrophosphorylase activities in potatoes. Plant Physiol 68(4):924–929. https://doi.org/10.1104/pp.68.4.924

30

K. Koper et al.

Sowokinos JR, Preiss J (1982) Pyrophosphorylases in Solanum tuberosum: III. Purification, physical, and catalytic properties of adpglucose pyrophosphorylase in potatoes. Plant Physiol 69(6):1459–1466. https://doi.org/10.1104/pp.69.6.1459 Stark DM, Timmerman KP et al (1992) Regulation of the amount of starch in plant tissues by ADP glucose pyrophosphorylase. Science 258(5080):287–292. https://doi.org/10.1126/science. 258.5080.287 Steup M (1988) Starch degradation. Biochem Plants 14:255–296 Stitt M (2013) Progress in understanding and engineering primary plant metabolism. Curr Opin Biotechnol 24(2):229–238 Stitt M, Quick WP (1989) Photosynthetic carbon partitioning: its regulation and possibilities for manipulation. Physiol Plant 77(4):633–641. https://doi.org/10.1111/j.1399-3054.1989.tb05402.x St-Pierre B, Brisson N (1995) Induction of the plastidic starch-phosphorylase gene in potato storage sink tissue. Planta 195(3):339–344 Sun J, Edwards GE et al (1999a) Feedback inhibition of photosynthesis in rice measured by O2 dependent transients. Photosynth Res 59(2):187–200. https://doi.org/10.1023/a:1006180102395 Sun J, Okita TW et al (1999b) Modification of carbon partitioning, photosynthetic capacity, and O2 sensitivity in Arabidopsis plants with low ADP-glucose pyrophosphorylase activity. Plant Physiol 119(1):267–276 Sun J, Gibson KM et al (2002) Interactions of nitrate and CO2 enrichment on growth, carbohydrates, and Rubisco in Arabidopsis starch mutants. Significance of starch and hexose. Plant Physiol 130(3):1573–1583 Sun YW, Jiao GA et al (2017) Generation of high-amylose rice through CRISPR/Cas9-mediated targeted mutagenesis of starch branching enzymes. Front Plant Sci 8. https://doi.org/10.3389/ Fpls.2017.00298 Sweetlove LJ, Burrell MM (1996) Starch metabolism in tubers of transgenic potato (Solanum tuberosum) with increased ADPglucose pyrophosphorylase. Biochem J 320(2):493–498 Sweetlove LJ, Kossmann J et al (1998) The control of source to sink carbon flux during tuber development in potato. Plant J 15(5):697–706 Sweetlove LJ, Nielsen J et al (2017) Engineering central metabolism—a grand challenge for plant biologists. Plant J 90(4):749–763 Tang X-J, Peng C et al (2016) ADP-glucose pyrophosphorylase large subunit 2 is essential for storage substance accumulation and subunit interactions in rice endosperm. Plant Sci 249:70–83 Tetlow IJ, Morell MK et al (2004) Recent developments in understanding the regulation of starch metabolism in higher plants. J Exp Bot 55(406):2131–2145 Thomsen HC, Eriksson D et al (2014) Cytosolic glutamine synthetase: a target for improvement of crop nitrogen use efficiency? Trends Plant Sci 19(10):656–663 Thorbjørnsen T, Villand P et al (1996) Distinct isoforms of ADPglucose pyrophosphorylase occur inside and outside the amyloplasts in barley endosperm. Plant J 10(2):243–250 Tiessen A, Hendriks JH et al (2002) Starch synthesis in potato tubers is regulated by posttranslational redox modification of ADP-glucose pyrophosphorylase: a novel regulatory mechanism linking starch synthesis to the sucrose supply. Plant Cell 14(9):2191–2213 Tiessen A, Prescha K et al (2003) Evidence that SNF1-related kinase and hexokinase are involved in separate sugar-signalling pathways modulating post-translational redox activation of ADPglucose pyrophosphorylase in potato tubers. Plant J 35(4):490–500 Timm S, Wittmiß M et al (2015) Mitochondrial dihydrolipoyl dehydrogenase activity shapes photosynthesis and photorespiration of Arabidopsis thaliana. Plant Cell 27(7):1968–1984 Tong H, Liu L et al (2012) DWARF AND LOW-TILLERING acts as a direct downstream target of a GSK3/SHAGGY-like kinase to mediate brassinosteroid responses in rice. Plant Cell 24(6):2562– 2577 Tuncel A, Okita TW (2013) Improving starch yield in cereals by over-expression of ADPglucose pyrophosphorylase: expectations and unanticipated outcomes. Plant Sci 211:52–60. https://doi. org/10.1016/j.plantsci.2013.06.009

1 Source-Sink Relationships and Its Effect on Plant …

31

Tuncel A, Cakir B et al (2014) The role of the large subunit in redox regulation of the rice endosperm ADP-glucose pyrophosphorylase. FEBS J 281(21):4951–4963. https://doi.org/10. 1111/febs.13041 Waltz E (2016) CRISPR-edited crops free to enter market, skip regulation. Nat Biotechnol 34(6):582. https://doi.org/10.1038/nbt0616-582 Wang Z, Chen X et al (2007) Increasing maize seed weight by enhancing the cytoplasmic ADPglucose pyrophosphorylase activity in transgenic maize plants. Plant Cell Tissue Organ Cult 88(1):83–92 Watson A, Ghosh S et al (2018) Speed breeding is a powerful tool to accelerate crop research and breeding. Nat Plants 4(1):23 Whitney SM, Houtz RL et al (2011a) Advancing our understanding and capacity to engineer nature’s CO2 -sequestering enzyme, Rubisco. Plant Physiol 155(1):27–35 Whitney SM, Sharwood RE et al (2011b) Isoleucine 309 acts as a C4 catalytic switch that increases ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco) carboxylation rate in Flaveria. Proc Natl Acad Sci 108(35):14688–14693 Whitney SM, Birch R et al (2015) Improving recombinant Rubisco biogenesis, plant photosynthesis and growth by coexpressing its ancillary RAF1 chaperone. Proc Natl Acad Sci 112(11):3564– 3569 Wilson WA, Roach PJ et al (2010) Regulation of glycogen metabolism in yeast and bacteria. FEMS Microbiol Rev 34(6):952–985. https://doi.org/10.1111/j.1574-6976.2010.00220.x Wingenter K, Schulz A et al (2010) Increased activity of the vacuolar monosaccharide transporter TMT1 alters cellular sugar partitioning, sugar signaling, and seed yield in Arabidopsis. Plant Physiol 154(2):665–677 Woo JW, Kim J et al (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33(11):1162–1164. https://doi.org/10.1038/nbt.3389 Xie W, Wang G et al (2015) Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection. Proc Natl Acad Sci 112(39):E5411–E5419 Yamaya T, Obara M et al (2002) Genetic manipulation and quantitative-trait loci mapping for nitrogen recycling in rice. J Exp Bot 53(370):917–925 Yanagisawa S, Akiyama A et al (2004) Metabolic engineering with Dof1 transcription factor in plants: improved nitrogen assimilation and growth under low-nitrogen conditions. Proc Natl Acad Sci 101(20):7833–7838 Yang L, Wang L et al (2017) Effects of light quality on growth and development, photosynthetic characteristics and content of carbohydrates in tobacco (Nicotiana tabacum L.) plants. Photosynthetica 55(3):467–477 Yao X-Y, Liu X-Y et al (2017) Effects of light intensity on leaf microstructure and growth of rape seedlings cultivated under a combination of red and blue LEDs. J Integr Agric 16(1):97–105 Zamski E, Schaffer AA (1996) Photoassimilate distribution in plants and crops: source–sink relationships. Books in soils Zeeman SC, Thorneycroft D et al (2004) Plastidial α-glucan phosphorylase is not required for starch degradation in Arabidopsis leaves but has a role in the tolerance of abiotic stress. Plant Physiol 135(2):849–858 Zhang L, Häusler RE et al (2008) Overriding the co-limiting import of carbon and energy into tuber amyloplasts increases the starch content and yield of transgenic potato plants. Plant Biotechnol J 6(5):453–464 Zhang X, Wang J et al (2012) Rare allele of OsPPKL1 associated with grain length causes extra-large grain and a significant yield increase in rice. Proc Natl Acad Sci USA 109(52):21534–21539. https://doi.org/10.1073/pnas.1219776110 Zhang Y, Massel K et al (2018) Applications and potential of genome editing in crop improvement. Genome Biol 19(1):210. https://doi.org/10.1186/s13059-018-1586-y

Chapter 2

Transgenic Approaches to Develop Virus Resistance in Rice Gaurav Kumar and Indranil Dasgupta

Abstract Rice (Oryza sp.) is one of the most important food crops in the tropical areas of the world. Viral infections are serious constraints in rice production in certain parts of the world. There are about 16 viruses reported to date, which cause significant yield loss to rice. They belong to different geographical regions, show genome variability, and have widely different transmission characteristics and symptom development. Although the use of conventional/natural genetic resistance in plants is always considered the most appropriate strategy against the pathogen, in case of rice-virus pathology such examples are very rare. Since the last three decades, the concepts of pathogen-derived resistance and RNA interference have proved to be effective to develop virus-resistant transgenic rice plants. The present chapter collates the various transgenic approaches used to provide broad-spectrum transgenic resistance in rice against viruses. Keywords Rice · Biotic stress · dsRNA viruses · Viral genomes · Virus resistance in rice

2.1 Introduction Rice (Oryza sativa sp.) as a food crop comprises a major share of the total calorie intake of the human population. A significant proportion of the world’s population depends upon rice as their staple food. Of the total rice consumption of the world, 90% is in Asia alone. Rice is increasingly becoming important in other parts of the world too, both in terms of consumption and yield (Fairhurst and Dobermann 2002; Shahzadi et al. 2018). Parallelly, viruses are emerging as important constraints to rice production, mainly in Asian countries. G. Kumar · I. Dasgupta (B) Department of Plant Molecular Biology, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021, India e-mail: [email protected] G. Kumar e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_2

33

34

G. Kumar and I. Dasgupta

Deployment of genetic resistance in rice against viruses has not been promising and there is always a question over the efficiency and durability of the resistance (Gallois et al. 2018). The concept of Pathogen Derived Resistance (PDR), proposed in the 1980s (Sanford and Johnston 1985), have fuelled several attempts to confer resistance by the use of transgenic plants containing virus-derived genome fragments or full-length genes (Beachy 1993; Wilson 1993; Baulcombe 1996; Lomonossoff 1995). Both protein-mediated and RNA-mediated strategies of PDR have been used for generating virus resistance transgenic plants. The movement protein (MP), the coat protein (CP), protease, or the viral replicase genes have been mostly exploited for initiating successful PDR. In a majority of cases, the proteins or their parts act as a dominant-negative competitor during the infection of virus (Padidam et al. 1999). There are also reports, in which some other sequences such as satellite RNA or antisense RNA has also been reported to confer viral resistance (Hull 1994; Baulcombe 1996; Palukaitis and Zaitlin 1997). More recently, the phenomenon of RNA-interference (RNAi) has been used to obtain virus resistance in plants. RNAi is an evolutionarily conserved, sequence-specific natural defense mechanism of the cell, targeting aberrant nucleic acids such as cellular or viral doublestranded RNA (dsRNA; Baulcombe 2004). Its function is hallmarked by the accumulation of virus-derived siRNAs (vsiRNAs) upon viral infection (Hamilton and Baulcombe 1999; Molnár et al. 2005; Pantaleo et al. 2007; Donaire et al. 2008, 2009; Ruiz-Ferrer and Voinnet 2009; Qu 2010; Szittya et al. 2010). As a counter-defense, most viruses employ one or more mechanisms to suppress the RNAi-dependent host antiviral mechanism. Almost all plant virus genera contain several viral suppressors of RNA silencing (VSRs), which are quite diverse and often show no sequence similarity among each other. VSRs are known to interact with key components of the RNAi pathway. VSRs work by either mimicking the cellular functions of the RNAi pathway components (Burgyán and Havelda 2011) or bringing about their transcriptional repression (Ren et al. 2010) often resulting in weakened host RNAi response. RNAi can occur at the level of ongoing transcription resulting in transcriptional inhibition (transcriptional gene silencing, TGS) or at the post-transcriptional level (post-transcriptional gene silencing, PTGS). TGS can be caused when the doublestranded RNA (dsRNA) molecule encompasses the promoter sequences and PTGS by a dsRNA molecule derived from open reading frame (Costa et al. 2013). During viral infection, the generated viral siRNAs can lead to the silencing of the viral genome itself. The dsRNA formed as intermediates during the replication of RNA viruses or the RNA transcript of a DNA virus forming strong secondary structures, such as stem-loops and overlaps in transcripts derived from bidirectionally arranged viral genes. However, it has been observed that the resistance displayed can be variable when different viral genes of the same virus are targeted (Shimizu et al. 2009, 2011). At present, there are sixteen species of viruses reported to infect rice plants viz. Rice black-streaked dwarf virus, Rice bunchy stunt virus, Rice dwarf virus, Rice gall dwarf virus, Rice giallume virus, Rice grassy stunt virus, Rice hoja Blanca virus, Rice necrosis mosaic virus, Rice ragged stunt virus, Rice stripe necrosis virus, Rice stripe

2 Transgenic Approaches to Develop Virus Resistance in Rice

35

virus, Rice transitory yellowing virus, Rice tungro bacilliform virus, Rice tungro spherical virus, Rice yellow mottle virus, and Southern Rice black-streaked dwarf virus (Hibino 1996; Zhou et al. 2008). Here, we discuss the rice viruses for which transgenic rice plants have been generated to date and the progress achieved.

2.2 Rice Black-Streaked Dwarf Virus (RBSDV) The species Rice black-streaked dwarf virus (RBSDV; genus: Fijivirus; family: Reoviridae) is transmitted persistently and propagatively by the Small Brown Plant Hopper (SBPH; Laodelphax striatellus). RBSDV has a wide host range, infecting barley, maize, rice, sorghum, wheat, and several other Poaceous plants (Ruan et al. 1984; Hibino 1996; Matsukura et al. 2019). SBPH is reported to transmit the virus even from the frozen infected leaves (Zhou et al. 2011). RBSDV can artificially be transmitted in vitro to rice, maize, sorghum, and wheat (Ishii and Yoshimura 1973). RBSDV causes the black-streaked dwarf and maize rough dwarf diseases (Fang et al. 2001; Bai et al. 2002). The symptoms in rice include severe stunting, and other growth abnormalities such as darkening of complete leaves or veins with waxy gall on the side (Hibino 1996; Fang et al. 2001). The genome consists of a dsRNA with 10 segments (S1–S10) surrounded by an icosahederal shaped virus particle (Zhang et al. 2001; Wang et al. 2003). Segments S1–S4 encode for single proteins P1 (RNA dependent RNA polymerase), P2 (inner core protein), P3 (capping enzyme function), and P4 (outer shell protein with spiked appearance) respectively. The segments S5, S7, and S9 encode for two proteins each (P5-1 viroplasm associated), P7-1 (tubular structure forming) and P9-1 (viroplasm matrix protein) respectively while the functions of P5-2, P7-2, and P9-2 are still not clear (Isogai et al. 1998; Zhang et al. 2008a, b; Liu et al. 2011; Wang et al. 2011; Akita et al. 2012). The single ORFs each from S6, S8, and S10 segments code for P6 (viroplasm associated), P8 (minor core capsid protein), and P10 (main outer protein of the capsid) respectively (Isogai et al. 1998; Zhang et al. 2001). In rice cultivar Nipponbare, a 500 bp fragment from the 5 end of the P9-1 protein when introduced as a dsRNA construct, rendered the plant asymptomatic after 4 weeks post-inoculation (wpi) of RBSDV.No significant amount of virus was detectable even at late stages of infection, compared to the severely affected nontransgenic plants with a significant amount of virus load (Shimizu et al. 2011). The viral protein P5-1 inhibits the ubiquitination activity of Skp1/Cullin1/F-box (SCF) complex E3 ligases through interaction with OsCSN5A, a rice gene that regulates the function of a most common type of E3 ligase, Cullin-RING Ligases (CUL), hindering the RUBylation\deRUBylation of CUL1, thus leading to an inhibition of Jasmonic acid (JA) response pathway and an enhancement of RBSDV infection in rice. The transgenic lines with increased expression of OsCSN5A showed milder RBSDV symptoms than that shown by the RBSDV-inoculated WT control plants (He et al. 2020). Homozygous T5 transgenic lines, which had RNAi construct against S7-2 or S8 encoding for P7-2 and P8 respectively, showed high resistance against

36

G. Kumar and I. Dasgupta

RBSDV under field infection pressure from viruliferous SBPH (Ahmed et al. 2017). Strong resistance to RBSDV was also achieved in transgenic lines harboring a hairpin RNA (hpRNA) construct against the S1, S2, S6, and S10 genes. The hpRNA gave rise to abundant levels of viral siRNA, the deep sequencing of which showed their emergence from the selected viral gene sequence (Wang et al. 2016). Overexpression of the rice gene OsGSK2 a brassinosteroid (BR) signaling component which negatively regulates the BR signaling pathway in transgenic plants, showed a marked decrease in RBSDV susceptibility (He et al. 2017). The role of abscisic acid (ABA) in providing antiviral resistance in plants is already reported (Alazem and Lin 2017). In contrast, upon RBSDV infection, ABA plays a negative role in modulating the plant defense against the virus. Transgenic plants defective in ABA biosynthetic pathway gene Osnced3 accumulated a low level of RBSDV mRNA and protein (Xie et al. 2018). The rice gene OsABI-LIKE2 (OsABIL2) plays a negative role in ABA signaling through a type of 2c protein phosphatase that it encodes (Li et al. 2015). Transgenic rice plants over-expressing OsABIL2 showed less symptoms upon RBSDV infection compared to wild type (Xie et al. 2018), due to impaired ABA signaling. In another study, the transgenic lines OEP10 expressing the RBSDV P10 gene (OEP10) driven by the Cauliflower mosaic virus (CaMV) 35S promoter, showed reduced symptoms, disease incidence, and accumulation of viral RNA (Zhang et al. 2019). The genome structure, along with the various transgenic strategies to obtain resistance against RBSDV, is shown in Fig. 2.1.

2.3 Rice Dwarf Virus (RDV) The species Rice Dwarf Virus (RDV; genus: Phytoreovirus; family: Reoviridae; Lida 1972) causes Rice dwarf disease (RDD) in rice. RDV has a wide host range of organisms, ranging from fungi, non-rice plants, insects, several vertebrates, and human (Boccardo and Milne 1984). In rice, symptoms of RDD include height reduction, chlorotic specks on leaves which eventually become short and dark, increased tillering, delayed or incomplete panicle emergence (Hibino 1996). The principal vector for RDV transmission is the leafhopper Nephotettix cincticeps that transfers it persistently and propagatively, however, other vectors, such as Recilia dorsalis, or some other species of Nephotettix are also known to exist (Hibino 1996; Attoui et al. 2012). The virus replicates both in the vector as well as the main plant host (Suzuki et al. 1994). A shelled, spherical, double-layered, and icosahedral virus particle structure of about 70 nm encapsidates a 12 segmented dsRNA that encodes for seven structural (P1, P2, P3, P5, P7, P8, and P9) and five non-structural proteins (Pns4, Pns6, Pns10, Pns11, and Pns12) respectively (Suzuki et al. 1994, 1996; Omura and Yan 1999; Nakagawa et al. 2003; Zhong et al. 2003; Wei et al. 2006). The inner core-shell is made up of P1, P3, P5, and P7 proteins while the protein P2, P8, and P9 form the outer shell (Naitow et al. 1999; Omura and Yan 1999). Replication of the viral genome, i.e. a new dsRNA genome synthesis starts with initial aggregation and

2 Transgenic Approaches to Develop Virus Resistance in Rice

37

Fig. 2.1 a Structure of a complete genome of RBSDV showing all the segments. ‘Line’ indicates the genomic dsRNA of the virus. ‘Boxes’ denotes the gene encoded by the respective segment. ‘Arrow’ indicates the 500 bp fragment taken from the 5 end of each segment to design the RNAi construct. VA—Viroplasm associated, MP—Movement Protein, MCC—Minor Core Capsid. Horizontal arrow indicates the RNAi construct designed for the particular gene. Immune—No symptoms and no virus detected by ELISA. SR—Strong Resistance, plants show optimal growth with weak and delayed symptoms. b (i) The overexpression of OsCSN5A overcomes its interaction with P5-1 viral protein and thus does not inhibit the JA pathway leading to mild RBSDV symptoms. (ii, iii, iv) The upside line arrow indicates the overexpression while the downside line arrow indicates the antisense mutant line. (V) The overexpression of P10 protein of virus under CaMV 35S promoter in rice resulted in enhanced tolerance to virus

packaging of the 12 viral mRNA that corresponds to the 12 dsRNA segments, which is then followed by synthesis of the negative strand. The protein of the core assembles first assisting the viral mRNA formation and subsequently, the outer shell proteins assemble to form a protective covering of the mature virion (Zhong et al. 2003; Wei et al. 2006; Miyazaki et al. 2010). The RNA polymerase function is carried out by the P1 protein (Suzuki et al. 1992). The P2 protein is important in viral transmission via a vector (Zhu et al. 2005), viral attachment, and entry into the host plant cell through endocytosis of the clatharin-coated vesicles (Tomaru et al. 1997; Omura et al. 1998; Wei et al. 2007). The P2 protein forms a spike-like structure on the outer coat that enables the virus to attach to the host cell (Miyazaki et al. 2015). The P2 protein was found to reprogram the initiation of auxin signaling pathway through its interaction with (Aux/IAA) protein OsIAA10, thereby, causing morphogenetic alterations in rice resulting in enhanced virus infection (Jin et al. 2016). The intercellular movement of RDV is facilitated by the viroplasm associated Pns6 protein (Li et al. 2004). The non-structural protein Pns10 is known to function as a viral suppressor of RNA silencing (Ren et al. 2010) and pathogen-vector specificity determinant (Chen et al. 2015b).

38

G. Kumar and I. Dasgupta

Variable amounts of resistances were observed when 500-bp fragments from the 5 end of the RDV genes were introduced as constructs, capable of producing dsRNA (Shimizu et al. 2009; Sasaya et al. 2014). Viral genes, when expressed to produce dsRNA, gave rise to varying levels of viral resistance. The transgenic plants that have dsRNA construct corresponding to Pns4 (intercellular movement protein also involved in viral infection and replication in insect vector; Chen et al. 2015c), Pns6 and Pns8 (main proteins of the outer capsid), Pns11 (unknown function) and Pns12 (viroplasm associated, and main regulator for viral replication and infection in its insect vector; Chen et al. 2015d) proteins showed high resistance against RDV, the plants being completely asymptomatic with no virus detection through ELISA. On the other hand, the plants with dsRNA construct against virus P2 and P9 (outer capsid protein), P5 and P7 (capping enzyme and nucleic acid binding protein) and Pns10 (silencing suppressor) proteins, showed no resistance, (Suzuki et al. 1990a, b, 1991, 1992a, b; Suzuki 1993; Uyeda et al. 1994; Zhong et al. 2003; Li et al. 2004; Cao et al. 2005). As explained earlier, the P2 protein interacts with OsIAA10 and enhances the virus infection, transgenic plants in which the expression of OsIAA10 was downregulated using a dsRNA derived from the entire coding region of the OsIAA10, showed reduced levels of RDV infection and symptoms (Jin et al. 2016). The genome structure along with the various transgenic strategies used against RDV is shown in Fig. 2.2.

2.4 Rice Gall Dwarf Virus (RGDV) The species Rice gall dwarf virus (RGDV ) is a member of Phytoreovirus group of family Reoviridae (Omura et al. 1982; Uyeda et al. 1995). Since its first report from Thailand (Omura 1980) and then from the parts of China and Southeast Asian countries, it has been associated with the Rice gall dwarf disease (RGDD), leading to severe yield loss (Putta et al. 1980; Inoue and Omura 1982; Fan et al. 1983). Later, the virus has also been reported from other provinces of China such as Hainan and Guangxi and Guangdong (Zhang et al. 2008a, b; Fan et al. 2010). RGDV is transmitted in a persistent-propagative transovarial manner by a hemipteran zigzag leafhopper, Recilia dorsalis (Motsch) and Nephotettix nigropictus (Stal) of family Cicadellidae (Inoue and Omura 1982; Morinaka et al. 1982; Fan et al. 1983; Boccardo and Milne 1984; Xie and Lin 1984). RGDV has an adverse effect on its vector R. dorsalis in terms of their survival rate, emergence rate, fecundity, and longevity that hinders the spread of the virus through restricting the population of viruliferous vectors (Chen et al. 2016). The symptoms of infection of RGDV include severe stunting dark green discolorations on leaf blades, delayed flowering, poorly developed panicles which are either half-filled with grains or are empty (Fan et al. 1983). The leaves often possess a 2 mm × 0.4–0.5 mm whitish gall like structure on the outer leaf sheaths and undersides of the leaf base (Putta et al. 1980; Omura 1980). The particle of RGDV is double-layered, icosahedral and about 65–70 nm in diameter that encapsidates a 12 segmented (S1–S12) dsRNA genome (Omura et al. 1982;

2 Transgenic Approaches to Develop Virus Resistance in Rice

39

Fig. 2.2 a Structure of the complete genome of the Rice dwarf virus showing all the segments. ‘Line’ indicates the genomic dsRNA of the virus. ‘Boxes’ denotes the gene encoded by the respective segment. ‘Arrow’ indicates the 500 bp fragment taken from the 5 end of each segment to design the RNAi construct. IM—Intracellular Movement, CE—Capping Enzyme, MP—Movement Protein, NABP—Nucleic Acid Binding Protein, MOC—major Outer Capsid, VSR—Virus Silencing Suppressor. Immune—No symptoms and no virus detected by ELISA. SR—Strong Resistance, plants show optimal growth with weak and delayed symptoms. MR—Moderate Resistance, delayed appearance of symptoms. NR—No Resistance, plants with typical RDV symptom, and accumulation similar to the control non-transgenic plants. b Interaction between the P2 protein of RDV and the rice OsIAA10 gene increases the virus infection. Virus infection is reduced upon introducing a dsRNA against OsIAA10

Boccardo and Milne 1984; Hibi et al. 1984; Boccardo et al. 1985). The structural proteins P1, P2, P3, P5, P6, and P8 are encoded by the segments S1, S2, S3, S5, S6, and S8, respectively, of the viral genome (Hibi et al. 1984; Boccardo et al. 1985). The accessory non-structural proteins Pns4, Pns7, Pns9, Pns10, Pns11, and Pns12 are encoded by the remaining segments (Hibi et al. 1984; Boccardo et al. 1985; Koganezawa et al. 1990; Noda et al. 1991; Moriyasu et al. 2000, 2007). The viral

40

G. Kumar and I. Dasgupta

inclusions formed by these non-structural proteins are known to play important role in propagation via vectors (Hogenhout et al. 2008). For instance, Pns7, 9, and 12 forms a major viroplasm component, where the virus replicates, and the assemblage of progeny virions takes place in the gut cells of insect vectors (Wei et al. 2009; Akita et al. 2011). Pns11, in addition to its silencing suppressor activity (Shen et al. 2012), also helps in tubule formation facilitating intercellular virus spread in the host (Akita et al. 2011). The functions of Pns4 and Pns10 are still not clear. To control the disease incidence and prevent huge crop loss due to RGDV infection, RNAi approach has been used. As stated earlier for RDV, another reovirus, the transgenic plants having RNAi construct against the main viroplasm-associated proteins were found to show resistance (Shimizu et al. 2009; Sasaya et al. 2014). Pns9 is known to play a major role in the assembly of viroplasms for persistent infection in the virus vector (Zheng et al. 2015). Transgenic plants transformed with hairpin RNA generated from 500 bp fragment taken from the 5 end of the S9 gene that encodes for Pns9 protein were completely symptomless even till the harvest stage. RGDV could not be detected by ELISA in these plants and the resistance was manifested by the presence of transgene specific siRNA. In comparison, non-transgenic control showed characteristic RGDV symptoms (Shimizu et al. 2012). The genome map of the RGDV and the above mentioned transgenic strategy is shown in Fig. 2.3. Fig. 2.3 Structure of complete genome of the RGDV showing all the segments. ‘Line’ indicates the genomic dsRNA of the virus. ‘Boxes’ denotes the gene encoded by the respective segment. ‘Arrow’ indicates the 500 bp fragment taken from the 5 end of segment 9 to design the RNAi construct. ICP—Inner core protein; OCP—Outer core protein; CCP—Capsid core protein; VCP—Viroplasm component protein; VSR—Virus Silencing Suppressor, Immune—No symptoms and no virus detected by ELISA

2 Transgenic Approaches to Develop Virus Resistance in Rice

41

2.5 Rice Grassy Stunt Virus (RGSV) Previously known by the name the species Rice rosette virus, Rice Grassy Stunt Virus (RGSV; genus: Tenuivirus) is a causal organism of grassy stunt disease (Bergonia et al. 1966; Rivera et al. 1966; Toriyama 1985; Hibino 1986; Falk and Tsai 1998). The virus is transmitted by the vector brown planthopper Nilaparvata lugens along with N.bakeri and N. muiri species (Hibino 1986, 1996). Symptoms of grassy stunt disease include reduced plant height, increase in tillering, pale yellow, short and narrow leaves with brown spots and absence of panicles, or if present, are empty or bear dark brown grains. If the infection occurs at the later stages, the leaves become severely yellow in color with dark brown panicles and abortive kernels (Rivera et al. 1966; Ching-Chung 1982; Mariappan et al. 1984). The virus was first reported from regions of China, Japan, and Taiwan and subsequently from South and Southeast Asian regions (Hibino 1990). RGSV outbreaks were reported in the 1970s and 1980s from parts of India, Indonesia, Japan, and Philippines (Mariappan et al. 1984; Iwasaki et al. 1985; Hibino 1990). The RGSV particle appears like a circular thread of width around 6–8 nm and a contour length of 200–2400 nm. The genome is composed of 6 ssRNA (RNA 1–6) which differ by size and exhibit an ambisense coding behavior Each RNA segment has 2 ORFs, hence in total, there are 12 ORFs (Kormelink et al. 2011; Shirako et al. 2011). The viral RNA-dependant RNA polymerase (RdRp) shows a 5 -endonuclease activity and transcription occurs through the cap-snatching mechanism (Shimizu et al. 1996). The genomic RNA of RGSV associates with the nucleoprotein, which is encoded by the ORF of the viral negative sense RNA5 (Toriyama et al. 1997) to form a ribonucleoprotein complex (Falk and Tsai 1998). The PC1 protein, encoded by viral complementary (vc) RNA1 strand, is believed to be an RdRp, the PC5 and PC6 proteins encoded by vcRNa5 and vcRNA6, function as structural and movement proteins respectively (Hiraguri et al. 2011; Kormelink et al. 2011; Shirako et al. 2011). RGSV P5 protein hijacks the host CIPK/25 by interacting with host CBL-CIPK Ca2+ signaling network. CBL-CIPK plays a key role in ion metabolism particularly potassium and sodium. Hence, RGSV-affected rice plants have low potassium content (Xu et al. 2006; Weinl and Kudla 2009; Luan et al. 2009; Wang and Wu 2013; Xiong et al. 2017). P5, along with P2 protein also shows silencing suppression property against the host RNAi defense mechanism (Netsu et al. 2015; Nguyen et al. 2015). The RNAi-based transgenic plants targeting the nucleocapsid protein PC5 and movement protein pc6, remained asymptomatic even after four weeks postinoculation, compared to control wild type plants, which showed severe characteristic RGSV symptoms. The transgene-specific siRNAs accumulated to a significant extent (Shimizu et al. 2013). The genome map of the RGSV and the above mentioned transgenic strategy is shown in Fig. 2.4a.

42

G. Kumar and I. Dasgupta

Fig. 2.4 a Structure of complete genome of RGSV showing all the segments. ‘Line’ indicates the genomic dsRNA of the virus. ‘Boxes’ denotes the gene encoded by the respective segment. ‘Arrow’ indicates the 500 bp fragment taken from the 5 end of each segment to design the RNAi construct. vRNA—Viral RNA, vcRNA—Viral complementary RNA, RdRp—RNA dependent RNA polymerase, NSP—Nucleocapsid structural protein, MP—Movement Protein, VSR—Virus Silencing Suppressor. b (i) Structure of complete bipartite genome of RNMV showing both RNA1 and RNA2. ‘Line’ indicates the genomic RNA of the virus. ‘Boxes’ denotes the protein encoded by the respective segment. VPg—Viral protein genome-linked, CI—Cytoplasmic Inclusion protein, NIa-pro— Nuclear inclusion protein, RdRp—RNA dependent RNA polymerase, CP—Coat Protein. (ii) Effect of overexpression (indicated by the arrow pointing upside) of gene encoding for heme activator protein in rice over RNMV

2.6 Rice Necrosis Mosaic Virus (RNMV) Incidence of infection by the species Rice necrosis mosaic virus (RNMV; genus: Bymovirus; family: Potyviridae) in rice was first reported from regions of Japan and later from Cuttack, India (Ghosh 1980). It is transmitted by Polymyxa graminis, a soil-borne plasmodiophoromycete (a fungus). The fungal spores from the infected plants act as the source of infection (Inouye and Fujii 1977; Usugi et al. 1989). Plants exhibit stunting, with a reduced number of tillers, shrub-like bushy appearance, yellow flecks on leaves, white streaks on the lower side of the leaves and lower stem, and its sheath having abundant necrotic flecks (Badge et al. 1997). RNMV has a

2 Transgenic Approaches to Develop Virus Resistance in Rice

43

bipartite, (+)-sense RNA genome with two RNA (RNA1 and RNA2; Adams et al. 2011). The virus is flexous, rod-shaped filamentous in shape, which is about 13 nm in diameter and has two nodal lengths of about 275 and 550 nm (Inouye and Fujii 1977). Both RNA1 and RNA2 are polyadenylated at the 3 end and have a covalently bound viral-genome-linked protein (VPg) at the 5 end (Adams et al. 2011). RNMV is serologically related and has sequence similarity to other by moviruses such as Barley mild mosaic virus (BaMMV; 56% nucleotide identity) and Oat mosaic virus, Barley yellow mosaic virus, and Wheat yellow mosaic virus (around 46% nucleotide identities, Usugi and Saito 1976; Wagh et al. 2016). RNA1 is 7178 nucleotides long with two ORFs, one small and one large. The large ORF encodes for a polyprotein of around 258 kDa. RNA 2 is 3579 nucleotide long and encodes for a polyprotein of about 110 kDa (Wagh et al. 2016). RNAi-based transgenic resistance against RNMV has not been reported. However, OsHAP2E, a probenazole induced heme activator protein was examined for its putative role in providing resistance against RNMV. Heme activator protein (HAP) are known for their function in regulating plant growth and development along with conferring biotic and abiotic resistance to the plant. The rice HAP gene (OsHAP2E) is upregulated upon treatment with probenazole (PBZ) which is a chemical inducer of disease resistance. The role of HAP was examined for biotic stress resistance against bacteria and fungi (Alam et al. 2015a) and viruses (Alam et al. 2015b) by overexpressing in rice. Upon RNMV infection the OsHAP2E gene was upregulated in both leaves and entire shoot. Over-expression ofOsHAP2E gene in transgenic rice plants showed a significantly low level of virus accumulation and was symptomless as compared to the wild type control plants, thus making it a potential candidate gene for generating RNMV resistant rice plants (Alam et al. 2015b). The genome map of the RNMV and the above-mentioned transgenic strategy is shown in Fig. 2.4b.

2.7 Rice Ragged Stunt Virus (RRSV) The virus belonging to the speciesRice ragged stunt virus (RRSV), an oryzavirus (family: Reoviridae) causes ragged stunt disease of rice (Hibino 1979; Milne et al. 1982). First reported in 1976 from Indonesia, the disease also occurs in China, Japan, Malaysia, Philippines, Sri Lanka, Taiwan, Thailand, and Vietnam (Hibino 1979; Chen et al. 1979; Shinkai et al. 1980). RRSV is transmitted in a persistent and propagative manner by Nilaparvata lugens, the brown planthopper, and some of its related species (Hibino 1979; Milne et al. 1982). Infected plants display vein swelling, are stunted, show galls on the lower leaf surface or on the outer side of the leaf sheath, and leaves are jagged on edges or are twisted at tips. Infected host cells often show numerous inclusion bodies consisting of a viroplasmic matrix and many virus particles. (Hibino 1996). The RRSV virus particle has an overall diameter of about 70 nm out of which 50 nm is the polyhedral central core particle and 10–20 nm high are the flat spikes that surround it (Chen et al. 1997). RRSV genome consists of 10 segments (S1S10) of dsRNA that encodes for five major proteins (Chen et al. 1989; Hagiwara

44

G. Kumar and I. Dasgupta

et al. 1986). Structural proteins are encoded by the segments S3, S5, S8, and S9, S4 encodes for polymerase, while S7 and S10 encode for nonstructural proteins (Upadhyaya et al. 1995, 1998, 2001). Segments S6 and S9 also encode proteins that have silencing-suppressor activities (Nguyen et al. 2015). Rice plants were transformed with a suitable expression vector carrying the RRSV genome segments S5, S7, S8, and S9 in both sense and antisense orientation. The transgenic plants with sense orientation of viral gene under the control of maize ubiquitin promoter or rice actin promoter showed detectable levels of transgene-specific protein accumulation and the plants showed significant resistance against RRSV ranging from delayed symptom appearance to complete plant immunity (Upadhyaya et al. 1996, 1998, 2001). Resistance in rice against RRSV was also achieved by expressing the 39 kDa outer capsid spike protein of the virus in transgenic plants, where, it inhibited the virus-carrying capacity of the vector. It was found that the virus titer in the insect vector which was first fed upon transgenic plants and after that on RRSV-infected plants was low and was inversely proportional to the expression levels of the 39 kDa viral protein in the transgenic plants (Chaogang et al. 2003). RNAi was induced in insect vector by feeding it on dsRNAs targeting the nonstructural protein 6 (Pns6) encoded by S6 fragment, resulting in inhibition of viral multiplication in the vector and ultimately inhibited its transmission ability (Chen et al. 2015). The genome map of the RRSV and the transgenic strategies are shown in Fig. 2.5.

2.8 Rice Stripe Virus (RSV) Viruses belonging to the species Rice stripe virus (RSV; genus: Tenuivirus; Toriyama et al. 1994) are a serious threat to rice crops in East, South, and Southeast Asian Countries (Hibino 1996). In addition to rice as its main host, RSV is also known to infect other Poaceae family members such as foxtail millet, maize, oat, and wheat (Falk and Tsai 1998; Lian et al. 2011). RSV was initially reported from China, Japan, Korea, and Taiwan (Abo and Sy 1997; Lee et al. 2008). RSV transmission from infected to healthy plants takes place through small brown planthopper, Laodelphax striatellus in a persistent, propagative, and transovarial manner. Symptoms of RSV infection include leaves with chlorosis and necrosis with the mottled appearance and early wilting (Hibino 1996; Falk and Tsai 1998). RSV has circular filamentous particles with a width of around 9 nm and variable length of 510, 610, 840, or 2110 nm (Shimizu et al. 1996). The genome of RSV comprises of four ssRNAs (RNA1–4) that encode for seven proteins (Ishikawa et al. 1989). RNA 1 is the largest negative-sense RNA and has a single ORF in the vcRNA1. It encodes for a 337 kDa protein which is an RdRP (Barbier et al. 1992; Toriyama et al. 1994). RNA 2–4 shows ambisense coding mechanism. A 22.8 kDa protein P2 and 94 kDa protein PC2 are encoded by the vcRNA2 (Takahashi et al. 1993; Zhu et al. 1991, 92). The vRNA3 encodes for a 23.9 kDA non-structural protein P3 and the vcRNA3 encodes for a 35 kDa CP (Hayano et al. 1990; Kakutani et al. 1991). The vRNA4 encodes for a 20.5 kDa disease-specific SP protein and the vcRNA4 encodes for 32 kDa movement protein.

2 Transgenic Approaches to Develop Virus Resistance in Rice

45

Fig. 2.5 a Structure of complete genome of the RRSV showing all the segments. ‘Line’ indicates the genomic dsRNA of the virus. ‘Boxes’ denotes the protein encoded by the respective segment. ‘Horizontal Line Arrow’ indicates the fragment taken in S—sense and A—Antisense orientation from each segment to design the RNAi construct. SP—Structural protein, MAP—Microtubuleassociated protein, VSR—Virus Silencing Suppressor, RdRp—RNA dependent RNA polymerase, ICP—Inner core protein, OCP—Outer core protein. b A dsRNA construct targeting viral protein inhibited its transmission through vector

The 5 and 3 terminal sequences show sequence similarity with each other (Hayano et al. 1990; Kakutani et al. 1991; Takahashi et al. 1990). Transgenic approaches to gain resistance against RSV had been extensively used and are exceptionally successful to provide immunity to plant. Japonica rice varieties Kinuhikari and Nipponbare when transformed with the CP gene showed significant levels of resistance. Plants showing high levels of transgene expression were completely symptomless, upon challenge inoculation (Hayakawa et al. 1992). Following this, the transgenic plants expressing the CP gene from a Chinese isolate of RSV was also analyzed for its resistance. These plants showed resistance comparable to earlier reports (Yan et al. 1997). Several reports of CP-mediated transgenic resistance against RSV exist in literature (Ma et al. 2011; Park et al. 2012; Shimizu et al. 2011; Zhang et al. 2012; Zhou et al. 2012). In addition, transgenic plants having a dsRNA construct against viral CP showed significant resistance (Park et al. 2012). Transgenic plants having RNAi against CP, SP, or both CP/SP were analyzed for their resistance and it was found that the plants that expressed the combination CP/SP showed comparatively more resistance against RSV, compared to when they were introduced individually as RNAi construct (Ma et al. 2011). A similar transgenic approach having RNAi construct against CP and SP of RSV was

46

G. Kumar and I. Dasgupta

used in two of the japonica varieties Guanglingxiangjing and Suyunuo. The plants, thus obtained, showed almost complete suppression of CP and SP transcripts and plants remained asymptomatic, with optimum agronomic traits (Zhou et al. 2012). Shimizu et al. (2011) generated transgenic plants targeting all seven genes of RSV by RNAi construct having inverted repeats (IR). While the transgenic lines that had IR construct against glycoproteins and non-structural proteins did not appear to be resistant, the lines, which had IR construct against CP and MP showed strong resistance to RSV. Transgenic plants targeting the RSV silencing suppressor proteins NS2 and NS3 were also generated by combining NS2 and NS3 by overlapping PCR. Transgenic plants upon RSV inoculation showed about 10–20 days delay in the first appearance of RSV symptoms and around 30–50% lower level of RSV accumulation (Zheng et al. 2014). In another study, it was found that the RSV-derived siRNA (vsiRNA4A) targets eukaryotic elongation factor 4 (eIF4) and down-regulates its expression resulting in RSV like symptoms (leaf twisting and stunting) along with deficient flowers. The transgenic line in which the eIF4 was over-expressed, driven under CaMV 35S promoter, showed no symptoms of RSV (Shi et al. 2016). RSV-resistant transgenic rice, which was generated by introducing an inverted repeat construct that targets RSV nucleocapsid protein (NCP) gene showed significant resistance. In addition, the NGS-generated siRNA profile in such RSV-resistant plants showed an enormous amount of siRNAs derived from the transgene as the prime reason for RSV resistance (Li et al. 2016). A reduction in osa-miR171b was observed in the case of RSV-infected rice plants, which was then related to symptom development. The transgenic lines in which the osa-miR171b was over-expressed through an artificial miRNA (amiRNA) method based on the osa-MIR528 precursor, showed extensive vegetative growth and low virus accumulation (Tong et al. 2017). The silencing suppressor NS3 protein of RSV was demonstrated to interact with OsCIPK30, a CBL (calcineurin B-like proteins)-interaction protein kinase. The transgenic rice lines, in which the OsCIPK30 was over-expressed, showed delayed and mild RSV symptoms. These lines also showed increased expression of pathogenesisrelated (PR) genes strengthening another line of defense against RSV (Liu et al. 2017). Transgenic N. benthamiana plants having an RNAi construct against NS3 protein showed reduced RSV accumulation. This actually happened theoretically due to the dual function of the RNAi construct, one in inhibiting the virus through RNAi mechanism and another targeting the virus silencing suppressor and making it inactive to minimize the virus counter-attack (Wu et al. 2018). The genome map of the RSV and the transgenic strategies are shown in Fig. 2.6.

2.9 Rice Tungro Bacilliform Virus (RTBV) Rice tungro bacilliform virus (RTBV ) belongs to genus Tungrovirus of family Caulimoviridae and is a pararetrovirus. RTBV along with Rice tungro spherical virus (RTSV ), a member of the Family Secoviridae, Genus Waikavirus, causes

2 Transgenic Approaches to Develop Virus Resistance in Rice

47

Fig. 2.6 Structure of the complete genome of the RSV showing all the segments and the various transgenic approaches used against RSV. ‘Line’ indicates the genomic dsRNA of the virus. ‘Boxes’ denotes the gene encoded by the respective segment. ‘Arrow’ indicates the 500 bp fragment taken from the 5 end of each segment to design the RNAi construct. MP—Movement Protein, CP—Coat Protein, NCP—Nucleocapsid protein, VSR—Virus Silencing Suppressor

the devastating Rice tungro disease (RTD), mainly in South and Southeast Asia (Hibino et al. 1978; Jones et al. 1991; Hay et al. 1991; Lockhart 1990; Shen et al. 1993). RTBV is widespread in South and Southeast Asian countries causing huge economic loss to rice crops (Rivera and Ou 1967; Raychaudhuri et al. 1967; Herdt 1991). RTBV is vectored by Green leafhopper (GLH, Nephotettix virescens) already carrying the RNA virus RTSV. RTBV cannot be transmitted by GLH independent of RTSV (Cabauatan and Hibino 1985). RTD-affected plants are stunted and show yellow-orange leaf discoloration (Rivera and Ou 1967). Between the two RTDcausing viruses, RTBV causes most of the symptoms.This has been demonstrated by agroinoculation (agrobacterium-mediated transfer of a cloned viral genome to a plant) of rice plants with a cloned RTBV DNA (Dasgupta et al. 1991). RTBV is a plant parareterovirus, replicating by reverse transcription mechanism and has an approximately 8 kb DNA genome which is circular and double-stranded (Jones et al. 1991; Qu et al. 1991). RTBV genome has four ORFs, viz. ORF I (P24), ORF II (P12), ORF III (P194), and ORF IV (P46) named according to the sizes of the proteins they encode (Hay et al. 1991). The first three ORFs are arranged compactly with an overlapping start and stop signal (ATGA; Hay et al. 1991). The fourth ORF is however separated by a short non-coding intergenic region and is expressed from a spliced RNA (Fütterer et al. 1994). The ORF III encodes for a large poly-protein that is subsequently cleaved to produce four different proteins viz. movement protein, coat protein, a protease, and an RT/RNaseH which is a viral replicase (Hay et al. 1991). ORF I and ORF IV are also separated by an intergenic region which includes the single RTBV promoter, the signal for polyadenylation, various short ORFs, and

48

G. Kumar and I. Dasgupta

the splice donor site (Qu et al. 1991). ORF I interacts with D1 protein of the host and affects the Fe/Zn homeostasis thus regulating host photosynthesis process leading to symptom development (Srilatha et al. 2019). Many attempts of making tungro-resistant transgenic rice have been reported to date. Some of the initial attempts of transforming the rice varieties IR64, Kinuhikari, TN1, and Taipei 309 with several antiviral constructs targeting RTBV ORF I, polymerase, coat protein, protease, RNase H, and genes expressing antisense to RTBV RNA did not lead to any significant RTBV resistance (Azzam and Chancellor 2002). There are two reports of the generation of RNAi-based transgenic plants RTBV resistance in recent years. The first was that using RTBV ORF IV (Tyagi et al. 2008) and the second was based upon expressing RTBV CP (Ganesan et al. 2009). Both the transgenic lines showed resistance against Tungro, manifested by less tungro symptoms, low viral titer, and the presence of transgene-specific siRNA compared to wild type. The transgenic rice plant having a dsRNA construct generated by Tyagi et al. (2008) was subsequently used for back-crossing into several popular high yielding but tungro susceptible rice varieties of India. These varieties ASD-16, BPT-5204, CR 1009, Khitish, and Shatabdi also showed significant resistance against RTBV (Roy et al. 2012; Jyothsna et al. 2013; Valarmathi et al. 2016; Kumar et al. 2019). Dual RNAi approach in a single construct against both RTBV and RTSV, having an RNAi construct against RTBV replicase showed reduction in symptoms and decrease in virus titer (Sharma et al. 2018). Another approach to develop transgenic plants against RTBV involved the use of host transcription factors. The RTBV Philippines isolate promoter was shown to interact with two basic leucine zipper (b-ZIP) type rice transcription factors, RF2a and RF2b (Dai et al. 2006). Hence, it was speculated that virus use these host transcription factors for its own transcription and the host is devoid of these transcription factors which might be playing role in various development and growth process. Antisense lines to these transcription factors in a normal healthy rice plant showed almost similar symptoms to that of RTBV infected plants. The over-expression transgenic lines for these transcription factors therefore showed almost absence of viral symptoms (Dai et al. 2008) or enhanced tolerance (Estiati et al. 2018). The genome map of the RTBV and the transgenic strategies are shown in Fig. 2.7a.

2.10 Rice Tungro Spherical Virus (RTSV) The RNA virus counterpart of the rice tungro virus complex is represented by viruses belonging to the species Rice tungro spherical virus (RTSV ). Taxonomically, RTSV relates to the order: Picornavirales, family: Secoviridae, and the Genus: Waikavirus. RTSV is also transmitted by GLH (Cabauatan and Hibino 1985). The genome of RTSV is approximately 12 kb in length, is monopartite, and is represented by a positive-sense RNA (Shen et al. 1993). The virion particle is isometric in outline and possesses an icosahedral symmetry with a diameter of around 30–33 nm (Gálvez

2 Transgenic Approaches to Develop Virus Resistance in Rice

49

Fig. 2.7 a (i) Genome organization of RTBV. Innermost circle-8 kb dsDNA. Numbers on inner circle—position of the nucleotide (×1000) on the genome. D1 and D2—Sites of two discontinuity approximately marked. The different proteins encoded by ORF III poly-protein have been marked. MP: Movement protein; CP: Coat protein; PR: Protease and RT/RNase H: Reverse transcriptase/ribonuclease H. Arc in purple—pre-genomic RNA. Blue arc—spliced ORF IV RNA. Dotted arcs—Intronic region of the transcript. (ii) The various transgenic strategies used against RTBV. b (i) Genome organization of RTSV. The single line—polyadenylated RNA, boxes—coding regions. The amino acids present at the cleavage sites are indicated below the boxes. Red dotted line—TGA stop codon in sORF II. Spiked line below the genome—3473 amino acids long polyprotein. VPg: Viral protein of the genome; P1: Leader protein 1; CP1-3: Coat protein 1–3; NTP: Nucleotide triphosphate binding protein; Pro: Protease; Pol: RNA dependent RNA polymerase; sORF: short ORF (ii) The various transgenic strategies used against RTSV

1968). The presence of a large polyprotein gene is revealed upon sequence analysis of RTSV RNA. This polyprotein gene encodes for three coat proteins, an RNA binding protein, a proteinase, and an RNA polymerase (Shen et al. 1993; Zhang et al. 1993). The genomic RNA is 3 polyadenylated and a VPg molecule is speculated to be attached at the 5 end. A characteristic ‘replication block’ is present in the RTSV genome that has a [Hel-Pro-Pol] like arrangement involving a type III helicase, the 3C-like proteinase, and a type I RdRp (Goldbach 1987).

50

G. Kumar and I. Dasgupta

Since RTSV mediates the GLH transmission of the RTBV-RTSV complex, transgenic plants against RTSV inhibit the GLH-mediated transmission of the complex. When the RTSV replicase gene was expressed in transgenic rice plants in both sense and antisense orientation, The former plants showed partial resistance while the latter, plants having replicase in antisense orientation, showed complete immunity (Huet et al. 1999). In another report, where the transgenic plants were generated with three RTSV coat proteins expressing individually or together, a partial resistance was observed in all cases and no additive effect was observed in plants due to presence of more than one coat protein (Sivamani et al. 1999). In another case, two distinct approaches against RTSV were used, namely, PDR and RNA-mediated resistance. For this, two constructs i.e. one containing the un-translatable coat protein (CP1-3) gene and another with partial replicase gene in antisense were engineered. The transgenic plants harboring these constructs showed moderate to sub-optimal resistance against RTSV (Verma et al. 2012). More recently, transgenic rice plants harboring a 500-bp inverted repeat fragments of different RTSV proteins showed generation of siRNA from the hairpin RNA that was transcribed from the transgenes, although the resistant nature of the transformed plants was not evaluated (Le et al. 2015). A recent report has targeted both RTBV and RTSV together, by using a dual RNAi approach in a single construct. In this report it was shown that RNAi constructs against RTSV replicase showed reduction in symptoms and decrease in virus titer (Sharma et al. 2018). A highly resistant phenotype against the tungro disease was obtained using an RNAi construct against RTSV CP3. The transgenic lines thus obtained failed to transmit the virus complex, indicating that CP3 might be the key protein involved in virus transmission via GLH making it an important candidate to generate tungro resistant plants (Malathi et al. 2019). The translation initiation factor 4 gamma gene (eIF4G) is known to act as a recessive resistance gene against RTSV. Mutation in eIF4G in RTSV-susceptible IR64 variety using the CRISPR/CAS9 system resulted in RTSV resistance and enhanced yield (Macovei et al. 2018). The genome map of the RTSV and the transgenic strategies are shown in Fig. 2.7a.

2.11 Rice Yellow Mottle Virus (RYMV) Rice yellow mottle virus (RYMV; genus: Sobemovirus; family: Sobemoviridae) was first reported from Kenya in 1966 and is now a major pathogen of rice in the African continent with a severity range of 5–100% (Bakker 1970, 1974, 1975; Rossel et al. 1982; Alegbejo et al. 2006). RYMV causes stunting, mottled and yellow-orange discolored leaf, reduction in tiller number, non-uniform flowering, and sterility. RYMV is transmitted in a semi-persistent manner by chrysomelid beetles, including Chaetocnema pulla, Sesselia pussilla, and Trichispa sericea (Bakker 1974, 1975) and long-horned grasshopper Conocephalus merumontanus. The secondary spread of the virus can be through direct contact between plants, fluid from diseased to healthy plants, or through RYMV contaminated hands. The disease severity depends upon virus strain, plant age, genotype, and environmental factors (Bakker 1970, 1974,

2 Transgenic Approaches to Develop Virus Resistance in Rice

51

1975; Konaté et al. 1997; Abo et al. 2003; Sarra and Peters 2003; Traoré et al. 2006). RYMV genome is around 4.5 kb, single-stranded positive-sense RNA encapsidated in a polyhedral particle with a diameter of about 30 nm. The poly-A tail is absent in the RNA that encodes for four ORFs (Yassi et al. 1994). At the 5 end is the ORF 1 that encodes for a protein P1 that is involved in virus movement (Bonneau et al. 1998) and also acts as an RNA silencing suppressor (Voinnet et al. 1999). ORF 2 encodes for a central polyprotein representing the viral protease, the helicase, and the RdRp. ORF 4 encodes for the coat protein while the function of ORF3 is not yet known (Brugidou et al. 1995). In addition, there are three non-coding regions one each at 5 and 3 end and one between ORF1 and ORF2 (Fargette et al. 2004). A number of transgenic approaches have been used successfully against RYMV to date. Transgenic Japonica rice (vr. Taipei 309) which contained viral coat protein expressed under ubiquitin promoter showed the transgene product accumulation resulting in RYMV resistance to some extent leading to delay in symptom development (Kouassi et al. 1997). Another transgenic line with the same strategy but targeting the RdRp of RYMV, showed resistance against a range of RYMV strains from different regions of Africa (Pinto et al. 1999). Analysis of the transgenic lines in most cases revealed a successful RNA-based mechanism associated with posttranscriptional gene silencing. Transgenic lines expressing the CP gene of RYMV along with its other mutant forms driven by ubiquitin promoter were developed. These included transgenic plants expressing CP, deletion mutants of CP, untranslatable CP mRNA, and antisense CP sequences. The lines having antisense CP and untranslatable form of CP mRNAs showed a delay of 8 days in virus accumulation and low virus level compared to the control untransformed plants. The lines expressing wild type CP and deleted CP did not show any significant viral resistance (Kouassi et al. 2006). The genome map of the RYMV and the transgenic strategies are shown in Fig. 2.8. In the above paragraphs, the use of various transgenic strategies to obtain virus resistance in rice, have been described. These are mainly based on the phenomenon of RNAi, the natural anti-viral disease resistance pathway in many organisms. There are also a few examples, where genes of rice have been overexpressed to achieve viral resistance. An example of the use of genome editing technology to achieve virus resistance has also been described. Most of the experiments were restricted to the laboratory. It can be hoped that some of the above strategies and transgenic lines will be used in the near future for testing under field conditions and will be released for cultivation if found suitable.

52

G. Kumar and I. Dasgupta

Fig. 2.8 a Genome organization of RYMV. The genomic RNA is organized into five proteincoding ORFs: ORF1, ORF2a, ORF2b, ORF3, and the newly identified ORFx. gRNA—Genomic RNA, sgRNA—Sub-genomic RNA, VPg—Viral protein genome-linked, CP—Coat Protein, PRO— protease, POL—RNA-dependent RNA polymerase. b The various transgenic strategies used against RYMV

Acknowledgements GK acknowledges the Research Associateship of Council of Scientific and Industrial Research, New Delhi. This work was supported by the J. C. Bose Fellowship, Science and Engineering Research Board, Department of Science and Technology, Government of India to ID.

References Abo ME, Sy AA (1997) Rice virus diseases: epidemiology and management strategies. J Sustain Agric 11:113–134 Abo ME, Alegbejo MD, Sy AA et al (2003) The host range of Rice yellow mottle virus genus Sobemovirus in Cote d’Ivoire. Samaru J Agric Res 9:67-78 Adams MJ, Zerbini FM, French R et al (2011) Family potyviridae. In: Virus taxonomy: ninth report of the international committee on taxonomy of viruses, pp 1069–1089 Ahmed MMS, Bian S, Wang M et al (2017) RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice. Transgenic Res 26:197–207 Akita F, Miyazaki N, Hibino H et al (2011) Viroplasm matrix protein Pns9 from rice gall dwarf virus forms an octameric cylindrical structure. J Gen Virol 92:2214–2221 Akita F, Higashiura A, Shimizu T et al (2012) Crystallographic analysis reveals octamerization of viroplasm matrix protein P9-1 of Rice black streaked dwarf virus. J Virol 86(2):746–756 Alam MM, Tanaka T, Nakamura H et al (2015a) Overexpression of a rice heme activator protein gene (OsHAP2E) confers resistance to pathogens, salinity and drought, and increases photosynthesis and tiller number. Plant Biotechnol J 13(1):1171–1172 Alam MM, Nakamura H, Ichikawa H et al (2015b) Overexpression of OsHAP2E for a CCAATbinding factor confers resistance to Cucumber mosaic virus and Rice necrosis mosaic virus. J Gen plant Pathol 81:32–41

2 Transgenic Approaches to Develop Virus Resistance in Rice

53

Alazem M, Lin N-S (2017) Antiviral roles of abscisic acid in plants. Front Plant Sci 8:1760 Alegbejo MD, Raji BA, Abubakar IU, Banwo OO (2006) Rice yellow mottle virus disease, a new disease of rice in Zamfara, Nigeria. Int Rice Res Notes 31(39):39–39 Attoui H, Becnel J, Belaganahalli S et al (2012) Part II: the viruses—the double stranded RNA viruses-family Reoviridae, pp 541–637 Azzam O, Chancellor TC (2002) The biology, epidemiology, and management of rice tungro disease in Asia. Plant Dis 86:88–100. https://doi.org/10.1094/PDIS.2002.86.2.88 Badge JL, Kashiwazaki S, Lock S, Foster GD (1997) A bymovirus PCR primer and partial nucleotide sequence provides further evidence for the recognition of rice necrosis mosaic virus as a bymovirus. Eur J Plant Pathol 103:721–724 Bai F, Yan J, Qu Z et al (2002) Phylogenetic analysis reveals that a dwarfing disease on different cereal crops in China is due to rice black streaked dwarf virus (RBSDV). Virus Genes 25:201–206 Bakker W (1970) Rice yellow mottle, a mechanically transmissible virus disease of rice in Kenya. Netherlands J Plant Pathol 76:53–63 Bakker W (1974) Characterization and ecological aspects of rice yellow mottle virus in Kenya. 152 The Netherlands: agricultural research, doctoral thesis, University of Wageningen Bakker W (1975) Rice yellow mottle virus. C Descr Plant Viruses 149:1–4 Barbier P, Takahashi M, Nakamura I et al (1992) Solubilization and promoter analysis of RNA polymerase from rice stripe virus. J Virol 66:6171–6174 Baulcombe D (1996) Mechanisms of pathogen-derived resistance to viruses in transgenic plants. Plant Cell 8:1833–1844. https://doi.org/10.1105/tpc.8.10.1833 Baulcombe D (2004) RNA silencing in plants. Nature 431:356–363 Beachy RN (1993) Transgenic resistance to plant viruses. In: Seminars in virology (United Kingdom) Bergonia HT, Capule NM, Novero EP, Galica CA (1966) Rice rosette, a new disease in the Philippines. Philipp J Plant Ind 31:47–52 Boccardo G, Milne RG (1984) Plant reovirus group. CMI/AAB descriptions of plant viruses no. 294 Boccardo G, Milne RG, Disthaporn S et al (1985) Morphology and nucleic acid of rice gall dwarf virus. Intervirology 23:167–171 Bonneau C, Brugidou C, Chen L et al (1998) Expression of the rice yellow mottle virus P1 protein in vitro and in vivo and its involvement in virus spread. Virology 244:79–86 Brugidou C, Holt C, Yassi MNA et al (1995) Synthesis of an infectious full-length cDNA clone of rice yellow mottle virus and mutagenesis of the coat protein. Virology 206:108–115 Burgyán J, Havelda Z (2011) Viral suppressors of RNA silencing. Trends Plant Sci 16:265–272 Cabauatan PQ, Hibino H (1985) Transmission of rice tungro bacilliform and spherical viruses by Nephotettix virescens distant. Philipp Phytopathol 21 Cao X, Zhou P, Zhang X et al (2005) Identification of an RNA silencing suppressor from a plant double-stranded RNA virus. J Virol 79:13018–13027 Chaogang S, Jianhua W, Guoying Z et al (2003) Ectopic expression of the spike protein of Rice Ragged Stunt Oryzavirus in transgenic rice plants inhibits transmission of the virus to insects. Mol Breed 11:295–301 Chen CC, Chiu RJ, Wang ES (1979) Rice ragged stunt: a virus disease new to Taiwan. Plant Prot Bull (Taiwan) 21:447 Chen CC, Chen MJ, Chiu RJ, Hsu HT (1989) Morphological comparisons of Echinochloa ragged stunt and rice ragged stunt viruses by electron microscopy. Phytopathology 79:235–241 Chen CC, Chen MJ, Chiu RJ, Hsu HT (1997) Rice ragged stunt virus (Oryzavirus) possesses an outer shell and A-spikes. Plant Prot Bull 39:383–388 Chen H, Li J, Liu Y et al (2015a) Interference of the expression of viral nonstructural protein Pns6 of rice ragged stunt virus (RRSV) inhibits it’s multiplication in Nilaparvata lugens. J Agric Biotechnol 23:1486–1493

54

G. Kumar and I. Dasgupta

Chen Q, Wang H, Ren T et al (2015b) Interaction between non-structural protein Pns10 of rice dwarf virus and cytoplasmic actin of leafhoppers is correlated with insect vector specificity. J Gen Virol 96:933–938 Chen Q, Zhang L, Chen H et al (2015c) Nonstructural protein Pns4 of rice dwarf virus is essential for viral infection in its insect vector. Virol J 12:211. https://doi.org/10.1186/s12985-015-0438-6 Chen Y, Lu C, Li M et al (2015d) Adverse Effects of Rice gall dwarf virus upon its Insect Vector Recilia dorsalis (Hemiptera: Cicadellidae). Plant Dis 100:784–790. https://doi.org/10. 1094/PDIS-06-15-0713-RE Chen Y, Lu C, Li M et al (2016) Adverse effects of rice gall dwarf virus upon its insect vector Recilia dorsalis (Hemiptera: Cicadellidae). Plant Dis 100(4):784–790 Ching-Chung C (1982) Three symptomatologic types of rice virus diseases related to grassy stunt in Taiwan. Plant Dis 66:15 Costa AT, Bravo JP, Makiyama RK et al (2013) Viral counter defense X antiviral immunity in plants: mechanisms for survival. In: Current issues in molecular virology-viral genetics and biotechnological applications. IntechOpen Dai S, Zhang Z, Bick J, Beachy RN (2006) Essential role of the Box II cis element and cognate host factors in regulating the promoter of Rice tungro bacilliform virus. J Gen Virol 87:715–722 Dai S, Wei X, Alfonso AA et al (2008) Transgenic rice plants that overexpress transcription factors RF2a and RF2b are tolerant to rice tungro virus replication and disease. Proc Natl Acad Sci 105:21012–21016 Dasgupta I, Hull R, Eastop S et al (1991) Rice tungro bacilliform virus DNA independently infects rice after Agrobacterium-mediated transfer. J Gen Virol 72:1215–1221. https://doi.org/10.1099/ 0022-1317-72-6-1215 Donaire L, Barajas D, Martínez-García B et al (2008) Structural and genetic requirements for the biogenesis of tobacco rattle virus-derived small interfering RNAs. J Virol. 82(11):5167-5177 Donaire L, Wang Y, Gonzalez-Ibeas D et al (2009) Deep-sequencing of plant viral small RNAs reveals effective and widespread targeting of viral genomes. Virology 392:203–214. https://doi. org/10.1016/j.virol.2009.07.005 Estiati A, Astuti D, Widyajayantie D, Nugroho S (2018) Overexpression of RF2a in transgenic rice plants cultivar IR64 enhances tolerance to rice tungro virus. J Crop Sci Biotechnol 21:291–299. https://doi.org/10.1007/s12892-018-0058-0 Fairhurst T, Dobermann A (2002) Rice in the global food supply. World 5:349–454 Falk BW, Tsai JH (1998) Biology and molecular biology of viruses in the genus Tenuivirus. Annu Rev Phytopathol 36:139–163 Fan H, Zhang SG, He XZ et al (1983) Rice gall dwarf: a new virus disease epidemic in the west of Guangdong province of south China. Acta Phytopathol Sin 13:1–6 Fan G, Gao F, Wei T et al (2010) Expression of rice gall dwarf virus outer coat protein gene (S8) in insect cells. Virol Sin 25:401–408 Fang S, Yu J, Feng J et al (2001) Identification of rice black-streaked dwarf fijivirus in maize with rough dwarf disease in China. Arch Virol 146:167–170 Fargette D, Pinel A, Abubakar Z et al (2004) Inferring the evolutionary history of Rice yellow mottle virus from genomic, phylogenetic, and phylogeographic studies. J Virol 78:3252–3261 Fütterer J, Potrykus I, Brau MPV et al (1994) Splicing in a plant pararetrovirus. Virology. https:// doi.org/10.1006/viro.1994.1078 Gallois J-L, Moury B, German-Retana S (2018) Role of the genetic background in resistance to plant viruses. Int J Mol Sci 19:2856 Gálvez GE (1968) Purification and characterization of rice tungro virus by analytical densitygradient centrifugation. Virology 35:418–426. https://doi.org/10.1016/0042-6822(68)90220-1 Ganesan U, Suri SS, Rajasubramaniam S et al (2009) Transgenic expression of coat protein gene of Rice tungro bacilliform virus in rice reduces the accumulation of viral DNA in inoculated plants. Virus Genes 39:113–119. https://doi.org/10.1007/s11262-009-0359-9 Ghosh SK (1980) Rice necrosis mosaic. Proc Plant Sci 89:291–299

2 Transgenic Approaches to Develop Virus Resistance in Rice

55

Goldbach R (1987) Genome similarities between plant and animal RNA viruses. Microbiol Sci 4:197–202 Hagiwara K, Minobe Y, Nozu Y et al (1986) Component proteins and structure of rice ragged stunt virus. J Gen Virol 67:1711–1715 Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science (80-) 286:950–952. https://doi.org/10.1126/science.286.5441.950 Hay JM, Jones MC, Blakebrough ML et al (1991) An analysis of the sequence of an infectious clone of rice tungro bacilliform virus, a plant pararetrovirus. Nucleic Acids Res 19:2615–2621. https://doi.org/10.1093/nar/19.10.2615 Hayakawa T, Zhu Y, Itoh K et al (1992) Genetically engineered rice resistant to rice stripe virus, an insect-transmitted virus. Proc Natl Acad Sci 89:9865–9869 Hayano Y, Kakutani T, Hayashi T, Minobe Y (1990) Coding strategy of rice stripe virus: major nonstructural protein is encoded in viral RNA segment 4 and coat protein in RNA complementary to segment 3. Virology 177:372–374 He Y, Zhang H, Sun Z et al (2017) Jasmonic acid-mediated defense suppresses brassinosteroidmediated susceptibility to Rice black streaked dwarf virus infection in rice. New Phytol 214:388– 399 He L, Chen X, Yang J et al (2020) Rice black-streaked dwarf virus encoded P5–1 regulates the ubiquitination activity of SCF E3 ligases and inhibits jasmonate signaling to benefit its infection in rice. New Phytol 225(2):896–912 Herdt RW (1991) Research priorities for rice biotechnology. Rice Biotechnol 6:19–54 Hibi T, Omura T, Saito Y (1984) Double-stranded RNA of rice gall dwarf virus. J Gen Virol 65:1585–1590 Hibino H (1979) Rice ragged stunt, a new virus disease occurring in tropical Asia. Rev Plant Prot Res 12:98–110 Hibino H (1986) Rice grassy stunt virus. Trop Agric Res Ser 19:165–171 Hibino H (1990) Insect-borne viruses of rice. In: Advances in disease vector research. Springer, pp 209–241 Hibino H (1996) Biology and epidemiology of rice viruses. Annu Rev Phytopathol 32:249–274. https://doi.org/10.1146/annurev.phyto.34.1.249 Hibino H, Roechan M, Sudarisman S (1978) Association of two types of virus particles with penyakithabang (tungro disease) of rice in Indonesia. Phytopathology 68:1412–1416. https://doi. org/10.1094/Phyto-68-1412 Hiraguri A, Netsu O, Shimizu T et al (2011) The nonstructural protein pC6 of rice grassy stunt virus trans-complements the cell-to-cell spread of a movement-defective tomato mosaic virus. Arch Virol 156:911–916 Hogenhout SA, Ammar E-D, Whitfield AE, Redinbaugh MG (2008) Insect vector interactions with persistently transmitted viruses. Annu Rev Phytopathol 46:327–359 Huet H, Mahendra S, Wang J et al (1999) Near immunity to rice tungro spherical virus achieved in rice by a replicase-mediated resistance strategy. Phytopathology 89:1022–1027. https://doi.org/ 10.1094/PHYTO.1999.89.11.1022 Hull R (1994) Resistance to plant viruses: obtaining gene by non-conventional approaches. Euphytica 75:195–205 Inoue H, Omura T (1982) Transmission of rice gall dwarf virus by the green rice leafhopper. Plant Dis 66:57–59 Inouye T, Fujii S (1977) Rice necrosis mosaic virus. In: Descriptions of plant viruses, Ser. No. 172. Commonwealth Mycological Institute, Surrey, p 4 Ishii M, Yoshimura S (1973) Epidemiological studies on the rice black-streaked dwarf virus in Kanto-Tosan district, Japan. J Cent Agric Exp Stn 61–121 Ishikawa K, Omura T, Hibino H (1989) Morphological characteristics of rice stripe virus. J Gen Virol 70:3465–3468 Isogai M, Uyeda I, Lee BC (1998) Detection and assignment of proteins encoded by rice black streaked dwarf fijivirus S7, S8, S9 and S10. J Gen Virol 79:1487–1494

56

G. Kumar and I. Dasgupta

Iwasaki M, Nakano M, Shinkai A (1985) Detection of rice grassy stunt virus in planthopper vectors and rice plants by ELISA. Japanese J Phytopathol 51:450–458 Jin L, Qin Q, Wang Y et al (2016) Rice dwarf virus P2 protein hijacks auxin signaling by directly targeting the rice OsIAA10 protein, enhancing viral infection and disease development. PLoS Pathog 12:e1005847 Jones MC, Gough K, Dasgupta I et al (1991) Rice tungro disease is caused by an RNA and a DNA virus. J Gen Virol 72:757–761. https://doi.org/10.1099/0022-1317-72-4-757 Jyothsna M, Manonmani S, Rabindran R et al (2013) Introgression of transgenic resistance for rice tungro disease into mega variety, ASD 16 of Tamil Nadu through marker assisted backcross breeding. Madras Agric J 100:70–74 Kakutani T, Hayano Y, Hayashi T, Minobe Y (1991) Ambisense segment 3 of rice stripe virus: the first instance of a virus containing two ambisense segments. J Gen Virol 72:465–468 Koganezawa H, Hibino H, Motoyoshi F et al (1990) Nucleotide sequence of segment S9 of the genome of rice gall dwarf virus. J Gen Virol 71:1861–1863 Konaté G, Traore O, Coulibaly MM (1997) Characterization of rice yellow mottle virus isolates in Sudano-Sahelian areas. Arch Virol 142:1117–1124 Kormelink R, Garcia ML, Goodin M et al (2011) Negative-strand RNA viruses: the plant-infecting counterparts. Virus Res 162:184–202 Kouassi N, Brugidou C, Chen L et al (1997) Transgenic rice plants expressing rice yellow mottle virus coat protein gene. Int Rice Res Notes 22:14–15 Kouassi NK, Chen L, Siré C et al (2006) Expression of rice yellow mottle virus coat protein enhances virus infection in transgenic plants. Arch Virol 151:2111–2122 Kumar G, Jyothsna M, Valarmathi P et al (2019) Assessment of resistance to rice tungro disease in popular rice varieties in India by introgression of a transgene against Rice tungro bacilliform virus. Arch Virol 1–9 Le DT, Chu HD, Sasaya T (2015) Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus. GM Crops Food 6:47–53. https://doi.org/10.1080/21645698. 2015.1025188 Lee B-C, Yoon Y-N, Hong S-J et al (2008) Analysis on the occurrence of Rice stripe virus. Res Plant Dis 14:210–213 Li Y, Bao YM, Wei CH et al (2004) Rice dwarf phytoreovirus segment S6-encoded nonstructural protein has a cell-to-cell movement function. J Virol 78:5382–5389 Li C, Shen H, Wang T et al (2015) ABA regulates subcellular redistribution of OsABI-LIKE2, a negative regulator in ABA signaling, to control root architecture and drought resistance in Oryza sativa. Plant Cell Physiol 56(12):2396–2408 Li LI, Cheng GUO, Biao W et al (2016) RNAi-mediated transgenic rice resistance to Rice stripe virus. J Integr Agric 15:2539–2549 Lian S, Jonson MG, Cho W-K et al (2011) Generation of antibodies against Rice stripe virus proteins based on recombinant proteins and synthetic polypeptides. Plant Pathol J 27:37–43 Lida TT (1972) Rice dwarf virus. CMI/AAB descriptions of plant viruses 102 Liu Y, Jia D, Chen H et al (2011) The P7–1 protein of southern rice black-streaked dwarf virus, a fijivirus, induces the formation of tubular structures in insect cells. Arch Virol 156:1729–1736 Liu Z, Li X, Sun F et al (2017) Overexpression of OsCIPK30 enhances plant tolerance to Rice stripe virus. Front Microbiol 8:2322 Lockhart BEL (1990) Evidence for a double-stranded circular DNA genome in a second group of plant viruses. Phytopathology 80:127–131 Lomonossoff GP (1995) Pathogen-derived resistance to plant viruses. Annu Rev Phytopathol 33:323–343 Luan S, Lan W, Lee SC (2009) Potassium nutrition, sodium toxicity, and calcium signaling: connections through the CBL–CIPK network. Curr Opin Plant Biol 12:339–346 Ma J, Song Y, Wu B et al (2011) Production of transgenic rice new germplasm with strong resistance against two isolations of Rice stripe virus by RNA interference. Transgenic Res 20:1367–1377. https://doi.org/10.1007/s11248-011-9502-1

2 Transgenic Approaches to Develop Virus Resistance in Rice

57

Macovei A, Sevilla NR, Cantos C et al (2018) Novel alleles of rice eIF4G generated by CRISPR/Cas9-targeted mutagenesis confer resistance to Rice tungro spherical virus. Plant Biotechnol J 16:1918–1927 Malathi P, Muzammil SA, Krishnaveni D et al (2019) Coat protein 3 of Rice tungro spherical virus is the key target gene for development of RNAi mediated tungro disease resistance in rice. Agri Gene 12:100084 Mariappan V, Hibino H, Shanmugam N (1984) A new rice virus disease in India. Int Rice Res Newsl 9:9–10 Matsukura K, Sanada-Morimura S, Fujii T, Matsumura M (2019) Potential risks of poaceous plants as infectious sources of Rice black-streaked dwarf virus transmitted by the small brown planthopper, Laodelphax striatellus. Plant Dis 103:1244–1248 Milne RG, Boccardo G, Ling KC (1982) Rice ragged stunt virus. C Descr Plant Viruses 16:248 Miyazaki N, Wu B, Hagiwara K et al (2010) The functional organization of the internal components of Rice dwarf virus. J Biochem 147:843–850 Miyazaki N, Higashiura A, Higashiura T et al (2015) Electron microscopic imaging revealed the flexible filamentous structure of the cell attachment protein P2 of Rice dwarf virus located around the icosahedral 5-fold axes. J Biochem 159:181–190 Molnár A, Csorba T, Lakatos L et al (2005) Plant virus-derived small interfering RNAs originate predominantly from highly structured single-stranded viral RNAs. J Virol 79:7812–7818 Morinaka T, Putta M, Chettanachit D et al (1982) Transmission of rice gall dwarf virus by cicadellid leafhoppers Recilia dorsalis and Nephotettix nigropictus in Thailand. Plant Dis 66:703–704 Moriyasu Y, Ishikawa K, Kikuchi A et al (2000) Sequence analysis of Pns11, a nonstructural protein of rice gall dwarf virus, and its expression and detection in infected rice plants and vector insects. Virus Genes 20:237–241 Moriyasu Y, Maruyama-Funatsuki W, Kikuchi A et al (2007) Molecular analysis of the genome segments S1, S4, S6, S7 and S12 of a Rice gall dwarf virus isolate from Thailand; completion of the genomic sequence. Arch Virol 152:1315–1322 Naitow H, Morimoto Y, Mizuno H et al (1999) A low-resolution structure of rice dwarf virus determined by ab initio phasing. Acta Crystallogr Sect D Biol Crystallogr 55:77–84 Nakagawa A, Miyazaki N, Taka J et al (2003) The atomic structure of rice dwarf virus reveals the self-assembly mechanism of component proteins. Structure 11:1227–1238 Netsu O, Hiraguri A, Uehara-Ichiki T et al (2015) Functional comparison of RNA silencing suppressor between the p5 protein of rice grassy stunt virus and the p3 protein of rice stripe virus. Virus Res 203:10–19 Nguyen TD, Lacombe S, Bangratz M et al (2015) p2 of Rice grassy stunt virus (RGSV) and p6 and p9 of Rice ragged stunt virus (RRSV) isolates from Vietnam exert suppressor activity on the RNA silencing pathway. Virus Genes 51:267–275 Noda H, Ishikawa K, Hibino H et al (1991) Nucleotide sequences of genome segments S8, encoding a capsid protein, and S10, encoding a 36K protein, of rice gall dwarf virus. J Gen Virol 72:2837– 2842 Omura T (1980) Observations on rice gall dwarf, a new virus disease. Int Rice Res Newsl 5:11–12 Omura T, Yan J (1999) Role of outer capsid proteins in transmission of Phytoreovirus by insect vectors. Adv Virus Res 54:15–43 Omura T, Morinaka T, Inoue H, Saito Y (1982) Purification and some properties of rice gall dwarf virus, a new phytoreovirus. Phytopathology 72:241–246 Omura T, Yan J, Zhong B et al (1998) The P2 protein of rice dwarf phytoreovirus is required for adsorption of the virus to cells of the insect vector. J Virol 72:9370–9373 Padidam M, Sawyer S, Fauquet CM (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218–225. https://doi.org/10.1006/viro.1999.0056 Palukaitis P, Zaitlin M (1997) Replicase-mediated resistance to plant virus disease. Adv Virus Res 48:349–377 Pantaleo V, Szittya G, Burgyán J (2007) Molecular bases of viral RNA targeting by viral small interfering RNA-programmed RISC. J Virol 81:3797–3806

58

G. Kumar and I. Dasgupta

Park H-M, Choi M-S, Kwak D-Y et al (2012) Suppression of NS3 and MP is important for the stable inheritance of RNAi-mediated Rice stripe virus (RSV) resistance obtained by targeting the fully complementary RSV-CP gene. Mol Cells 33:43–51 Pinto YM, Kok RA, Baulcombe DC (1999) Resistance to rice yellow mottle virus (RYMV) in cultivated African rice varieties containing RYMV transgenes. Nat Biotechnol 17:702–707 Putta M, Chettanachit D, Morinaka T et al (1980) Gall dwarf—a new rice virus disease in Thailand. Int Rice Res Newsl 5:10–11 Qu F (2010) Antiviral role of plant-encoded RNA-dependent RNA polymerases revisited with deep sequencing of small interfering RNAs of virus origin. Mol Plant Microbe Interact 23:1248–1252. https://doi.org/10.1094/MPMI-06-10-0124 Qu R, Bhattacharyya M, Laco GS et al (1991) Characterization of the genome of rice tungro bacilliform virus: comparison with Commelina yellow mottle virus and caulimoviruses. Virology 185:354–364 Raychaudhuri SP, Mishra MD, Ghosh A (1967) Preliminary note on transmission of virus disease resembling tungro of rice in India and other virus-like symptoms. Plant Dis Rep 51:300–301 Ren B, Guo Y, Gao F et al (2010) Multiple functions of Rice dwarf phytoreovirus Pns10 in suppressing systemic RNA silencing. J Virol 84:12914–12923. https://doi.org/10.1128/JVI.008 64-10 Rivera CT, Ou SH (1967) Transmission studies of the two strains of rice tungro virus. Plant Dis Rep 51:877–881 Rivera CT, Ou SH, Iida TT (1966) Grassy stunt disease of Rice and its transmission by the planthopper Nilaparvata lugens Stal. Plant Dis Report 50:453–456 Rossel HW, Thottapilly G, Buddenhagen IW (1982) Occurrence of rice yellow mottle virus in two important rice-growing areas of Nigeria. FAO Plant Prot Bull 30:137–139 Roy S, Banerjee A, Tarafdar J et al (2012) Transfer of transgenes for resistance to rice tungro disease into high-yielding rice cultivars through gene-based marker-assisted selection. J Agric Sci 150:610–618 Ruan YL, Chen SX, Lin RF et al (1984) A study of rice black-streaked dwarf virus disease. Zhejiang Agric Sci 185–187 Ruiz-Ferrer V, Voinnet O (2009) Roles of plant small RNAs in biotic stress responses. Annu Rev Plant Biol 60:485–510 Sanford JC, Johnston SA (1985) The concept of parasite-derived resistance—deriving resistance genes from the parasite’s own genome. J Theor Biol 113:395–405. https://doi.org/10.1016/S00225193(85)80234-4 Sarra S, Peters D (2003) Rice yellow mottle virus is transmitted by cows, donkeys, and grass rats in irrigated rice crops. Plant Dis 87:804–808 Sasaya T, Nakazono-Nagaoka E, Saika H et al (2014) Transgenic strategies to confer resistance against viruses in rice plants. Front Microbiol 4:409. https://doi.org/10.3389/fmicb.2013.00409 Shahzadi N, Akhter M, Haider Z et al (2018) Rice in Pakistan: present scenario, trade, problems and prospects. Int J Agric Stat Sci 14:1–6 Sharma S, Kumar G, Dasgupta I (2018) Simultaneous resistance against the two viruses causing rice tungro disease using RNA interference. Virus Res 255:157–164. https://doi.org/10.1016/j. virusres.2018.07.011 Shen P, Kaniewska M, Smith C, Beachy RN (1993) Nucleotide sequence and genomic organization of rice tungro spherical virus. Virology 193:621–630. https://doi.org/10.1006/viro.1993.1170 Shen W-J, Ruan X-L, Li X-S et al (2012) RNA silencing suppressor Pns11 of rice gall dwarf virus induces virus-like symptoms in transgenic rice. Arch Virol 157:1531–1539. https://doi.org/10. 1007/s00705-012-1339-2 Shi B, Lin L, Wang S et al (2016) Identification and regulation of host genes related to Rice stripe virus symptom production. New Phytol 209:1106–1119 Shimizu T, Toriyama S, Takahashi M et al (1996) Non-viral sequences at the 5 termini of mRNAs derived from virus-sense and virus-complementary sequences of the ambisense RNA segments of rice stripe tenuivirus. J Gen Virol 77:541–546

2 Transgenic Approaches to Develop Virus Resistance in Rice

59

Shimizu T, Yoshii M, Wei T et al (2009) Silencing by RNAi of the gene for Pns12, a viroplasm matrix protein of Rice dwarf virus, results in strong resistance of transgenic rice plants to the virus. Plant Biotechnol J 7:24–32 Shimizu T, Nakazono-Nagaoka E, Uehara-Ichiki T et al (2011) Targeting specific genes for RNA interference is crucial to the development of strong resistance to Rice stripe virus. Plant Biotechnol J 9:503–512 Shimizu T, Nakazono-Nagaoka E, Akita F et al (2012) Hairpin RNA derived from the gene for Pns9, a viroplasm matrix protein of Rice gall dwarf virus, confers strong resistance to virus infection in transgenic rice plants. J Biotechnol 157:421–427 Shimizu T, Ogamino T, Hiraguri A et al (2013) Strong resistance against Rice grassy stunt virus is induced in transgenic rice plants expressing double-stranded RNA of the viral genes for nucleocapsid or movement proteins as targets for RNA interference. Phytopathology 103:513–519 Shinkai A, Nakano M, Iwasai M (1980) Occurrence of rice ragged stunt disease in Kyushu, Japan. Ann Phytopathol Soc Jpn 46:411 Shirako Y, Falk BW, Haenni AL (2011) Genus tenuivirus. In: Virus taxonomy: classification and nomenclature of viruses: ninth report international committee on taxonomy of viruses, pp 771–776 Sivamani E, Huet H, Shen P et al (1999) Rice plant (Oryza sativa L.) containing Rice tungro spherical virus (RTSV) coat protein transgenes are resistant to virus infection. Mol Breed 5:177–185. https:// doi.org/10.1023/A:1009633816713 Srilatha P, Yousuf F, Methre R et al (2019) Physical interaction of RTBV ORFI with D1 protein of Oryza sativa and Fe/Zn homeostasis play a key role in symptoms development during rice tungro disease to facilitate the insect mediated virus transmission. Virology 526:117–124 Suzuki N (1993) In vitro translation of rice dwarf phytoreovirus genome segments S4 to S10. Arch Virol 130:201–208 Suzuki N, Watanabe Y, Kusano T, Kitagawa Y (1990a) Sequence analysis of rice dwarf phytoreovirus genome segments S4, S5, and S6: comparison with the equivalent wound tumor virus segments. Virology 179:446–454 Suzuki N, Watanabe Y, Kusano T, Kitagawa Y (1990b) Sequence analysis of the rice dwarf phytoreovirus segment S3 transcript encoding for the major structural core protein of 114 kDa. Virology 179:455–459 Suzuki N, Harada M, Kusano T (1991) Molecular analysis of rice dwarf phytoreovirus segment S11 corresponding to wound tumour phytoreovirus segment S12. J Gen Virol 72:2233–2237 Suzuki N, Tanimura M, Watanabe Y et al (1992) Molecular analysis of rice dwarf phytoreovirus segment S1: interviral homology of the putative RNA-dependent RNA polymerase between plant-and animal-infecting reoviruses. Virology 190(1):240–247 Suzuki N, Sugawara M, Kusano T (1992a) Rice dwarf phytoreovirus segment S12 transcript is tricistronic in vitro. Virology 191:992–995 Suzuki N, Tanimura M, Watanabe Y et al (1992b) Molecular analysis of rice dwarf phytoreovirus segment S1: interviral homology of the putative RNA-dependent RNA polymerase between plantand animal-infecting reoviruses. Virology 190:240–247 Suzuki N, Sugawara M, Kusano T et al (1994) Immunodetection of rice dwarf phytoreoviral proteins in both insect and plant hosts. Virology 202:41–48 Suzuki N, Kusano T, Matsuura Y, Omura T (1996) Novel NTP binding property of rice dwarf phytoreovirus minor core protein P5. Virology 219:471–474 Szittya G, Moxon S, Pantaleo V et al (2010) Structural and functional analysis of viral siRNAs. PLoS Pathog 6:4 Takahashi M, Toriyama S, Kikuchi Y et al (1990) Complementarity between the 5 - and 3 -terminal sequences of rice stripe virus RNAs. J Gen Virol 71:2817–2821 Takahashi M, Toriyama S, Hamamatsu C, Ishihama A (1993) Nucleotide sequence and possible ambisense coding strategy of rice stripe virus RNA segment 2. J Gen Virol 74:769–773 Tomaru M, Maruyama W, Kikuchi A et al (1997) The loss of outer capsid protein P2 results in nontransmissibility by the insect vector of rice dwarf phytoreovirus. J Virol 71:8019–8023

60

G. Kumar and I. Dasgupta

Tong A, Yuan Q, Wang S et al (2017) Altered accumulation of osa-miR171b contributes to rice stripe virus infection by regulating disease symptoms. J Exp Bot 68:4357–4367 Toriyama S (1985) Purification and biochemical properties of rice grassy stunt virus. Ann Phytopathol Soc Japan 51:59 Toriyama S, Takahashi M, Sano Y et al (1994) Nucleotide sequence of RNA 1, the largest genomic segment of rice stripe virus, the prototype of the tenuiviruses. J Gen Virol 75:3569–3579 Toriyama S, Kimishima T, Takahashi M (1997) The proteins encoded by rice grassy stunt virus RNA5 and RNA6 are only distantly related to the corresponding proteins of other members of the genus Tenuivirus. J Gen Virol 78:2355–2363 Traoré O, Pinel A, Hébrard E et al (2006) Occurrence of resistance-breaking isolates of Rice yellow mottle virus in West and Central Africa. Plant Dis 90:259–263 Tyagi H, Rajasubramaniam S, Rajam MV, Dasgupta I (2008) RNA-interference in rice against Rice tungro bacilliform virus results in its decreased accumulation in inoculated rice plants. Transgenic Res 17:897–904. https://doi.org/10.1007/s11248-008-9174-7 Upadhyaya NM, Yang M, Kositratana W et al (1995) Molecular analysis of rice ragged stunt oryzavirus segment 9 and sequence conservation among isolates from Thailand and India. Arch Virol 140:1945–1956 Upadhyaya NM, Ramm K, Yang M et al (1996) Rice ragged stunt virus synthetic resistance genes and japonica rice transformation. In: Third international rice genetics symposium, Manila, 16–20 Oct 1995. IRRI Upadhyaya NM, Ramm K, Gellatly JA et al (1998) Rice ragged stunt oryzavirus genome segment S4 could encode an RNA dependent RNA polymerase and a second protein of unknown function. Arch Virol 143:1815–1822 Upadhyaya NM, Li Z, Wang MB et al (2001) Engineering for virus resistance in rice. Rice Genet IV 405 Usugi T, Saito Y (1976) Purification and serological properties of barley yellow mosaic virus and wheat yellow mosaic virus. Japanese J Phytopathol 42:12–20 Usugi T, Kashiwazaki S, Omura T, Tsuchizaki T (1989) Some properties of nucleic acids and coat proteins of soil-borne filamentous viruses. Japanese J Phytopathol 55:26–31 Uyeda I, Suda N, Yamada N et al (1994) Nucleotide sequence of rice dwarf phytoreovirus genome segment 2: completion of sequence analyses of rice dwarf virus. Intervirology 37:6–11 Uyeda I, Kimura I, Shikata E (1995) Characterization of genome structure and establishment of vector cell lines for plant reoviruses. Adv Virus Res 45:249–279 Valarmathi P, Kumar G, Robin S et al (2016) Evaluation of virus resistance and agronomic performance of rice cultivar ASD 16 after transfer of transgene against Rice tungro bacilliform virus by backcross breeding. Virus Genes 52:521–529. https://doi.org/10.1007/s11262-016-1318-x Verma V, Sharma S, Devi SV et al (2012) Delay in virus accumulation and low virus transmission from transgenic rice plants expressing rice tungro spherical virus RNA. Virus Genes 45:350–359. https://doi.org/10.1007/s11262-012-0787-9 Voinnet O, Pinto YM, Baulcombe DC (1999) Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc Natl Acad Sci 96:14147–14152 Wang ZH, Fang SG, Xu JL et al (2003) Sequence analysis of the complete genome of rice blackstreaked dwarf virus isolated from maize with rough dwarf disease. Virus Genes 27(2):163-168 Wagh SG, Kobayashi K, Yaeno T et al (2016) Rice necrosis mosaic virus, a fungal transmitted Bymovirus: complete nucleotide sequence of the genomic RNAs and subgrouping of bymoviruses. J Gen Plant Pathol 82:38–42 Wang Y, Wu W-H (2013) Potassium transport and signaling in higher plants. Annu Rev Plant Biol 64:451–476 Wang Q, Tao T, Zhang Y et al (2011) Rice black-streaked dwarf virus P6 self-interacts to form punctate, viroplasm-like structures in the cytoplasm and recruits viroplasm-associated protein P9–1. Virol J 8:24 Wang F, Li W, Zhu J et al (2016) Hairpin RNA targeting multiple viral genes confers strong resistance to rice black-streaked dwarf virus. Int J Mol Sci 17:705. https://doi.org/10.3390/ijms17050705

2 Transgenic Approaches to Develop Virus Resistance in Rice

61

Wei T, Shimizu T, Hagiwara K et al (2006) Pns12 protein of Rice dwarf virus is essential for formation of viroplasms and nucleation of viral-assembly complexes. J Gen Virol 87:429–438 Wei T, Chen H, Ichiki-Uehara T et al (2007) Entry of Rice dwarf virus into cultured cells of its insect vector involves clathrin-mediated endocytosis. J Virol 81:7811–7815 Wei T, Uehara-Ichiki T, Miyazaki N et al (2009) Association of Rice gall dwarf virus with microtubules is necessary for viral release from cultured insect vector cells. J Virol 83:10830–10835 Weinl S, Kudla J (2009) The CBL–CIPK Ca2+ -decoding signaling network: function and perspectives. New Phytol 184:517–528 Wilson TM (1993) Strategies to protect crop plants against viruses: pathogen-derived resistance blossoms. Proc Natl Acad Sci 90:3134–3141 Wu G, Zheng G, Hu Q et al (2018) NS3 protein from rice stripe virus affects the expression of endogenous genes in Nicotiana benthamiana. Virol J 15:105 Xie LH, Lin QY (1984) Progress in the research of virus diseases of rice in China. Sci Agric Sin (China) Xie K, Li L, Zhang H et al (2018) Abscisic acid negatively modulates plant defence against rice black-streaked dwarf virus infection by suppressing the jasmonate pathway and regulating reactive oxygen species levels in rice. Plant Cell Environ 41:2504–2514. https://doi.org/10.1111/pce. 13372 Xiong G, Liu X, Qiu P et al (2017) Rice grassy stunt virus p5 interacts with two protein components of the plant-specific CBL–CIPK Ca+2 signaling network of rice. Virus Genes 1–8 Xu J, Li H-D, Chen L-Q et al (2006) A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis. Cell 125:1347–1360 Yan Y, Wang J, Qiu B, Tian B (1997) Resistance to rice stripe virus couferred by expression of coat protein in transgenic indica rice plants regenerated from bombarded suspension culture. Virol Sin 12:260–269 Yassi MNA, Ritzenthaler C, Brugidou C et al (1994) Nucleotide sequence and genome characterization of rice yellow mottle virus RNA. J Gen Virol 75:249–257 Zhang S, Jones MC, Barker P et al (1993) Molecular cloning and sequencing of coat proteinencoding cDNA of rice tungro spherical virus—a plant picornavirus. Virus Genes 7:121–132 Zhang HM, Chen JP, Adams MJ (2001) Molecular characterisation of segments 1 to 6 of Rice black-streaked dwarf virus from China provides the complete genome. Arch Virol 146:2331–2339 Zhang H-M, Yang J, Chen J-P, Adams MJ (2008a) A black-streaked dwarf disease on rice in China is caused by a novel fijivirus. Arch Virol 153:1893–1898 Zhang H-M, Xin X, Yang J et al (2008b) Completion of the sequence of rice gall dwarf virus from Guangxi, China. Arch Virol 153:1737–1741 Zhang C, Song Y, Jiang F et al (2012) Virus resistance obtained in transgenic tobacco and rice by RNA interference using promoters with distinct activity. Biol Plant 56:742–748 Zhang H, Tan X, He Y et al (2019) Rice black-streaked dwarf virus P10 acts as either a synergistic or antagonistic determinant during superinfection with related or unrelated virus. Mol Plant Pathol 20:641–655 Zheng LP, Lin C, Xie LY et al (2014) Construction of rice stripe virus NS2 and NS3 Co-RNAi transgenic rice and disease-resistance analysis. Chin J Virol 30(6):661–667 Zheng L, Chen H, Liu H et al (2015) Assembly of viroplasms by viral nonstructural protein Pns9 is essential for persistent infection of rice gall dwarf virus in its insect vector. Virus Res 196:162–169 Zhong B, Kikuchi A, Moriyasu Y et al (2003) A minor outer capsid protein, P9, of Rice dwarf virus. Arch Virol 148:2275–2280 Zhou G, Wen J, Cai D et al (2008) Southern rice black-streaked dwarf virus: a new proposed Fijivirus species in the family Reoviridae. Chin Sci Bull 53:3677–3685 Zhou T, Wu L, Wanf Y et al (2011) Transmission of rice black-streaked dwarf virus from frozen infected leaves to healthy rice plants by small brown planthopper (Laodelphax striatellus). Rice Sci 18:152–156. https://doi.org/10.1016/S1672-6308(11)60022-X Zhou Y, Yuan Y, Yuan F et al (2012) RNAi-directed down-regulation of RSV results in increased resistance in rice (Oryza sativa L.). Biotechnol Lett 34:965–972

62

G. Kumar and I. Dasgupta

Zhu Y, Hayakawa T, Toriyama S, Takahashi M (1991) Complete nucleotide sequence of RNA 3 of rice stripe virus: an ambisense coding strategy. J Gen Virol 72:763–767 Zhu S, Gao F, Cao X et al (2005) The rice dwarf virus P2 protein interacts with ent-kaurene oxidases in vivo, leading to reduced biosynthesis of gibberellins and rice dwarf symptoms. Plant Physiol 139:1935–1945

Chapter 3

Virus-Free Improved Food in the Era of Bacterial Immunity Anirban Roy, Aditi Singh, A. Abdul Kader Jailani, Dinesh Gupta, Andreas E. Voloudakis, and Sunil Kumar Mukherjee

Abstract Prokaryotic cells defend themselves against bacteriophages and invasive plasmids deploying CRISPR-Cas machinery. The principles of CRISPR-Cas system have been briefly outlined here. One of the finest discoveries in the field of biotechnology is the demonstration that the CRISPR-Cas system, albeit in a modified form, also works well in the eukaryotic cells. The effector factors like Cas9 and Cas13 along with the guide RNAs have been engineered in plant cells to interfere directly with DNA and RNA viruses, respectively, thereby generating effective plant defense against the viruses. A few examples of such defense have been summarized in this chapter. A thermodynamic treatment of site-selectivity of Cas9-mediated DNA cleavage has been developed. Though the CRISPR-Cas system provides a robust weapon in the armory of anti-virus strategy, a few limitations of the system overshadow the advantages of the CRISPR-Cas system. These limitations have been discussed in the perspective section and need to be overcome for commercial exploitation of the virus tolerant plants.

A. Roy · A. A. K. Jailani · S. K. Mukherjee (B) Division of Plant Pathology, IARI, Pusa, New Delhi 110012, India e-mail: [email protected] A. Roy e-mail: [email protected] A. A. K. Jailani e-mail: [email protected] A. Singh · D. Gupta Bioinformatics Group, ICGEB, Aruna Asaf Ali Marg, New Delhi 110066, India e-mail: [email protected] D. Gupta e-mail: [email protected] A. E. Voloudakis Laboratory of Plant Breeding and Biometry, Agricultural University of Athens, 11855 Athens, Greece e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_3

63

64

A. Roy et al.

Keywords Bacterial immunity · CRISPR-Cas · Virus tolerant plants · Crop improvement

3.1 Introduction Crops provide lifeline to human population, the continuous growth of which is posing severe threats to food security. Threats are also aggravated by climatic vagaries and various forms of plant diseases. Viruses are the epicenters of at least half of the plant diseases and devastate agricultural production (Anderson et al. 2004). Thus, all the efforts to increase agri-productivity, an activity that is considered a must to feed the hungry billions, are spoiled by phytopathogenic viruses. As the plant hosts are diverse, different types of viruses are also available in nature, and moreover, they also evolve fast due to the error proneness during duplication of their genomes and underplay of recombination mechanisms. These processes eventually broaden the hostranges, impacting the final yield. Following Baltimore’s classification system, they can be grouped in types II through type VI (Hull 2014). Accordingly, plant viruses consisting of genomes of ssDNA, dsDNA, +ve ssRNA, −ve ssRNA, reverse transcribing ssRNA or dsDNA, etc. are known. Of these, +ve ssRNA containing viruses are most abundant and include genera like Bromovirus, Cucumovirus, Potexvirus, Potyvirus, Tobamovirus, Tombusvirus, and others (Garcia-Ruiz 2018). More than a thousand plant-infecting viruses are currently known that cause a range of disease symptoms including plant death and crop yield reduction to the tune of at least 30 billion dollars annually on a global scale (Sastry and Zitter 2014). Because of the presence of natural barriers like cuticles, cell-walls, etc., viruses infect plants with difficulty and can do so only through plant wounds or using the help of insect vectors, which are the major sources of virus transmitters. The field-based virus control strategies are not effective which include various agricultural practices, a spray of insecticides, etc. The strategies of spraying insecticides and other pesticides are not ecologically friendly and help the emergence of insecticide-resistant vectors (Romay and Bragard 2017). Moreover, no agro-chemicals are known to directly checkmate the viruses. Hence, novel antiviral strategies need to be explored (Nicaise 2014; Voloudakis et al. 2015) and references within. One of the effective, durable, broad-spectrum antiviral roadmaps could be to engineer molecular resistance against plant viruses. Despite the presence of thousands of viruses, the occurrence of plant diseases is rather an exception than a common outcome as plants are genetically endowed with the power to resist the viral pathogenesis (Pallas and Garcia 2011). Following the entry of viruses in plant cells, pathogen triggered immunity (PTI) comes into foreplay as hormones like salicylic acid (SA) or antimicrobial peptides provide the first layer of resistance. If the viral effectors overcome the first level of immunity, effector-triggered plant immunity (ETI) manifests in the next level in various forms. We will mention two such ETI factors very briefly in the following.

3 Virus-Free Improved Food in the Era of Bacterial Immunity

65

Following the expression of viral proteins, a few of those are recognized by the host immunity factors known as the dominant R proteins having NBS-LRR domain structures. The viral proteins, recognized by the plants’ R proteins, are known as Avr proteins. This recognition activates the R proteins as explained in the ‘guard model’ (Soosaar et al. 2005). Following this recognition, a cascade of signaling events occurs, leading to the hypersensitive response (HR) which causes local death of the infected cells. In this way, the infecting virus gets localized and cannot spread further. The first antiviral R gene was known from tobacco (N gene) that acts to resist TMV virus and recognizes the helicase domain of TMV-RDR protein. Since then many antiviral R genes have been cloned and characterized well by biochemical means. The R genes derived from plants can be transferred to closely related species to confer heterologous viral resistance. Many good reviews on structure and function as well as applications of the antiviral R genes are available (Nicaise 2014; Pallas and Garcia 2011; Calil and Fontes 2016). The R-Avr interaction is very specific and thus cannot be used for global antiviral activity. Moreover, the viruses mutate fast causing loss of interaction and resulting in viral susceptibility of the host. Thus, this interaction, despite being very strong, cannot offer durable resistance. Besides the dominant R genes, another set of dominant resistant genes are also known. These are the non NBS-LRR, RTM genes (for restricted TEV movement), and five of them are known in Arabidopsis, which restrict long-distance movement of potyviruses like Tobacco etch virus (TEV), Lettuce mosaic virus (LMV), and Plum pox virus (PPV) (Cosson et al. 2010). Tomato Tm-1 gene, conferring resistance to TMV, also falls in this class. A large number of recessive host genes conferring virus resistance are also known and a few of them have been used in engineering virus resistance (Hashimoto et al. 2016). The next class of ETI factors is the so-called RNAi factors, which regulate viral gene expression and act as major plant defense factors. During the growth of either RNA- or DNA-viruses inside the host cells, viral dsRNAs come up either as a result of genome duplication or transcription. Host RDRs also contribute to the formation of viral dsRNAs. The host RNAi factors, especially the Dicers, cleave the dsRNAs in small vsiRNAs (virus-derived small interfering RNAs), which in turn slice the homologous viral mRNAs using another set of RNAi factors (RISC complex) and inhibit biogenesis of viral proteins, thus negating viral growth. The biogenesis and function of the vsiRNAs are, in turn, fine-tuned by virus-encoded RNAi-suppressors. The vsiRNAs-loaded RISC can also target host mRNAs (off-target effect) for suppression of antiviral defense or elicitation of disease symptoms (Moissiard and Voinnet 2006; Smith et al. 2011). Thus, the disease formation or lack of it is controlled and orchestrated by a complex set of RNAi-reactions. These processes have been detailed in many reviews (Agrawal et al. 2003; Sanan-Mishra et al. 2017). Engineering of RNAi-based virus resistance in crop plants has been achieved in many laboratories across the world and a few of them are already in commercial cultivation (Younis et al. 2014). However, this approach has also a few limitations. Virus encoded RNAi suppressors often frustrate the RNAi design, fast evolution of viruses spoil the target site selection, the strength of knock-down is generally not up to the mark and the process is associated with a lot of off-target effects. These limitations thus do not allow

66

A. Roy et al.

generating durable virus-resistant transgenics at the expected rates. A non-transgenic approach, exploiting RNAi, has been proposed and designated RNA-based vaccination (Voloudakis et al. 2015), which is based on exogenous application onto plant surfaces of dsRNAs, prepared in vitro or ex vivo, using the target virus sequences. Such a method presents several advantages to transgenic RNAi such as the fast deployment for emerging virus variants, without any need for lengthy production of transgenics, application to crops that are recalcitrant to transgenesis, and application in areas of the world that cultivation of transgenic plants is prohibited. To overcome the above-mentioned limitations, new tools in the armory of antiviral strategies have been adopted since the last decade that is collectively called Genome Editing Systems (GES). These include Mega nucleases like zinc finger nucleases, Talens, etc., the merits and demerits of which have been described in detail in many reviews (e.g., Chen et al. 2019). The latest and most promising GES is the CRISPRCas adaptive immunity system.

3.2 Principles of CRISPR-Cas System 3.2.1 CRISPR-Cas for Bacterial Immunity Many eubacteria and archaea harbor CRISPR locus in their genomes, using which they defend against invading subcellular parasites like bacteriophages and conjugating plasmids. The CRISPR locus consists of three essential modules, namely the CRISPR array of repeats and interspersed sequences called spacers, an upstream sequences encoding proteins, named as Cas proteins which control activities of CRISPR-related activities and a most upstream sequence encoding a non-coding RNA, called transcription activator or TraCrRNA (Fig. 3.1) in case of some of the Cas proteins like Cas9. The repeats in the CRISPR array are palindromic in nature and about 30 base-pair long while the spacer-sequences are derived in part from the snippets of DNA of the invading extra chromosomal elements. The spacers are also of almost the same size as the repeats but have varied sequences depending on the genome sequence of invading pathogen(s) and serve as ‘molecular memories’ of past invasions. The spacers help bacteria to fend off the viruses whose genome sequence(s) match with the spacers(s). The CRISPR array transcribes in a direction opposite to that of the TraCrRNA that is partly complementary to the repeat sequence of the array (CrRNA). Many Cas proteins are known depending on the bacterial systems and their modes of operations are gradually emerging although the structure and function of a few of them are known in great detail. CRISPR activities can be broadly divided into three major steps (Fig. 3.1). We will use S. pyogenes, a human pathogenic bacterium, as a model system to illustrate the steps. First, the acquisition stage where snippets of DNA of the invading element are excised using the Cas enzymes (mostly Cas1 and Cas2) and are integrated into the bacterial CRISPR locus in a polarized manner, i.e. nearest to the leader sequence of

3 Virus-Free Improved Food in the Era of Bacterial Immunity

67

CRISPR array by the processes, the biochemical details of which are still emerging. The RecBCD enzymes and the AddAB proteins are known to be involved in this step in gram-negative and gram-positive bacteria, respectively (Ivancie-Ba´ce et al. 2015). The second stage is the transcription of CRISPR array (Pre-CrRNA) and abundant transcript formation by the tracer locus (TraCrRNA). These two types of transcripts hybridize with each other and get processed in their turns mostly by RNase III enzyme, which acts in coordination with other RNases of bacteria. The mature

68

A. Roy et al.

Fig. 3.1 Schematic representation of mechanism of CRISPR-Cas9 activity in prokaryotic system. Mechanistically three cardinal steps can be defined, viz. Adaptation; Transcription and Maturation; and Interference. CRISPR-Cas array in the bacterial genome has been shown. The repeats are shown as arrowheads in Midas gold color, whereas the spacers derived from molecular parasites are shown in different colored boxes. Different Cas genes are shown in cylindrical arrowhead with turquoise color. TraCrRNA gene is marked at the upstream of the Cas cassette. The respective direction of the transcription of various genes is shown by bent arrows. At the adaptation phase, snippets (indigo curve line) of invading bacteriophage DNA are inserted as new spacers (spacer n) at the 5 end of the CRISPR array. The excision from bacteriophage DNA and its insertion in CRISPR array is possibly carried out by a complex of Cas1/Cas2 proteins. The initial event of transcription from the array results in formation of pre-CrRNA and Pre-TraCrRNA. These two types of transcripts interact with each other and are processed by different host factors, resulting in maturation of CrRNAs-TraCrRNA hybrid. Intermediate steps of processing of these two RNA entities during their maturation are also shown. At the interference step, the activity of Cas9 protein is revealed. Different functional domains of Cas9 protein are mentioned and represented by different colors. The Cas9 protein forms active complex with the matured CrRNA-TraCrRNA hybrid, resulting in formation of a site-specific DNA endonuclease, which is guided by the spacer RNA to target the bacteriophage DNA at a specific complementary site preceded by a protospacer adjucent motif (PAM). The HNH domain of Cas9 cleaves the DNA of local DNA-RNA hybrid at 3’ nucleotides upstream of the PAM site whereas the RuvC domain of Cas9 cleaves the displaced ssDNA, thus forming a double-strand break (shown at the bottom of the figure) in bacteriophage DNA. In this way, the bacteria is immunized against invading bacteriophage

forms of CRISPR RNA (CrRNA) and TraCrRNA are about 40 nt and 70 nt long, respectively and these two remain in the form of a hybrid molecule. This hybrid makes a complex with a Cas protein (e.g. Cas9) and turns the complex into an active site-specific DNA endo-nuclease which then gets ready for the third stage, namely the interference stage. The Cas complex is guided to a DNA sequence (proto-spacer) complementary to the spacer RNA sequence of CrRNA. If the proto-spacer harbors a motif called PAM (NGG sequence) at the 3 end, the Cas complex binds tightly at this sequence forming an R-loop. The spacer part of CrRNA forms an RNA-DNA hybrid and the non-complementary strand of DNA gets looped out. Three (3) nt downstream of the PAM motif, the non-complementary DNA strand is cleaved by RUV domain of Cas9 and the other DNA strand (duplexed with RNA) is cleaved by the HNH domain of Cas9, resulting in a blunt-ended cut in the target DNA at a very specific site. If the target DNA is the same as that of the invading bacteriophages, phage DNA gets cleaved at specific sites and thus gets eliminated within the bacteria. In this process, the bacteria become phage resistant and thus the CRISPR factors and processes confer immunity to the bacteria. Many different CRISPR systems are known in the bacterial world and these can be broadly divided into two classes depending on the content of their Cas proteins and nature of interference complexes. Class 1 systems employ a combination of Cas proteins at the interference step, while the Class II systems need only a single large protein with several domains for a similar enzymatic reaction. Both systems are further subdivided into three types, each depending on their signature Cas proteins: class I includes types I, III, and IV, while class II consists of types II, V, and VI (Chen et al. 2019; Wang et al. 2019). These six types are further subdivided into 33 subtypes.

3 Virus-Free Improved Food in the Era of Bacterial Immunity

69

In this article, we would mention only those systems which have found applications in virus control. Thus, we would focus mostly on type II systems for targeting DNA and marginally discuss type VI which targets ssRNA viruses. Virus control, in turn, could be achieved by targeting virus sensitive host genes or viral-genes as well as sequences. The former host part will be separately dealt in Chap. 10 of this book and hence we will focus on targeting only the viral sequences.

3.2.2 CRISPR-Cas Applied to Eukaryotic Kingdom The Cas9 protein, derived from S. pyogenes (Sp-Cas9), is by far the most used tool for editing related biotechnological work; its orthologs from other bacteria, namely, Staphylococcus aureus (SaCas9), Streptococcus thermophiles (StCas9), and Neisseria meningitides (NmCas9), have also been used for genome editing. The Cas9 protein with its various domains generally recognizes the NGG sequence of the target DNA as the PAM motif; the protein can also be engineered to recognize altered PAM motifs to broaden the scope of targeting. Thus VQR-Cas9 (NGA PAM), EQR-Cas9 (NGAG PAM), VRER-Cas9 (NGCG PAM), SaKKH-Cas9 (NNNRRT PAM), phage assisted continuous evolution of SpCas9 variant for broadened PAM compatibility (NG, GAA, and GTA PAM) and SpCas9-NG (NG PAM), etc. have been developed (Chen et al. 2019). However, the SpCRISPR-Cas9 system was the first one to be used to demonstrate the specific DNA cleavage in vitro and in eukaryotic cells (Jinek et al. 2012; Mali et al. 2013) and these findings are considered as the most important milestones in the biotechnological history of CRISPR-Cas. The in vitro studies revealed that the spacer sequences of CrRNA could be customized and programmed to cleave the DNA with matching complementary sequences and appropriate PAM motif. These studies also revealed that the spacer sequence could be trimmed down to 20 nucleotides without loss of cleavage activity and the two-component RNA system (CrRNA and TraCrRNA) could be replaced by about an 80 nt long single guide RNA (gRNA) molecule having a customized RNA sequence (20 nt as a variable component for targeting the DNA template) fused covalently with the fixed sequence of the TraCrRNA serving as a matrix for Cas9 attachment. The Cas9 is an inactive nuclease and undergoes a conformational change after attaching with the gRNA and converts itself to site-specific DNA cleaver producing double-stranded blunt-ended breaks (DSB) at the specific site of the target DNA both in vitro and in vivo (Fig. 3.2). Another Class II, type Va enzyme, namely, Cpf1, much smaller than Cas 9 in size, has also been used for editing DNA. It uses a T-rich PAM site and the gRNA of about 45 nts long. Downstream of the PAM site, Cpf1 makes a staggered cut in target DNA, creating a 5 nt 5 -overhang at 18 nucleotide 3 of the PAM site. To broaden the recognition of the PAM sites, Cpf1 variants have also been generated. The engineered Cpf1s are AsCpf1-RR (TYCV PAM), AsCpf1-RVR (TATV PAM), LbCpf1-RR (CCCC and TYCV PAM), and LbCpf1-RVR (TATG PAM) (Chen et al. 2019). Though Cpf1 has been used in plant gene editing, it has not been used yet for virus control. In eukaryotic cells, the broken ends of DNA or chromosome are

70

A. Roy et al.

protected and are eventually repaired by one of two major repair pathways: (1) Nonhomologous end joining (NHEJ), (2) Homology directed recombination (HDR) as illustrated in Fig. 3.2. Cells can handle many breakpoints at the same time, thus providing an opportunity for multiplexed editing. The NHEJ machinery is very efficient but introduces mutations, insertions, or deletions (in-del) around the breakpoint(s). As a result, following repair, the target genes or sequences are rendered

3 Virus-Free Improved Food in the Era of Bacterial Immunity

71

Fig. 3.2 Schematic diagram illustrating the mechanism of CRISPR-Cas9 technology for genome editing in eukaryotic cells. Cas9 proteins have several important domains including the HNH and RuvC, which take part in double-strand DNA break (DSB) but are catalytically inactive in native conditions. The gRNA comprises a 20 nucleotide spacer that is complementary to the target DNA sequence, preceding the PAM motif, and an additional sequence of TraCrRNA that form a hairpin loop and a scaffold structure of TraCrRNA. The gRNA upon binding with Cas9 induces a conformational change in the enzyme through a clockwise swing of different domains of Cas9 (shown by thin curvy line arrows at different steps). The PAM interacting domain of the enzyme then searches the PAM motif in the target DNA and when proper PAM recognition followed by complementary DNA recognition between spacer and target DNA occurs, a local unwinding of target DNA takes place, resulting in a three-stranded structure where one of the parental DNA strands loops out. The loop increases and a DNA-gRNA hybrid formation occur in such a way that the hybrid strand comes in contact with HNH domain and the looped single strand of target DNA binds the RuvC domain. A DSB (marked as * on DNA) occurs due to the dual nuclease activity of Cas9. Inside the eukaryotic cell, the DSB is protected and eventually repaired by two processes (shown by two long arrows). In the process of repair, (i) either the cleaved ends of the target DNA joins through non-homologous end joining (NHEJ) by the action of DNA ligase IV and results in incorporation of mutation, deletion, and addition or (ii) if a donor DNA template with flaking complementary sequence of the cleaved DNA present, homologous recombination process comes in action so that new DNA (or often called as repair template) gets integrated at the cleaved point, through homology directed repair (HDR)

nonfunctional. The second pathway, namely HDR, is a bit less efficient in plants and occurs in the S or G2 phase of the cell-cycle and uses either a sister chromatid or exogenous repair template having homology to the flanking region of the broken DNA. In this way, a new mutation or a functional gene can be knocked-in at the break-site and perhaps this may be termed as true editing. Many plant genes have been changed using the editing technology, but instances of HDR-mediated editing are very few. Most of the plant viruses have RNA genomes, either with double-stranded or single-stranded conformation. Hence specific RNA targeting is required to control these viruses. However, RNA editing is not as easy as DNA editing and is fraught with several limitations. Recently three type2 Cas9 proteins with RNA cleavage activity are reported and these are SauCas9 from Staphylococcus aureus, CjCas9 from Campylobacter jejuni and NmeCas9 from Neisseria meningitides and this cleave both double- and single-stranded RNA (Dugar et al. 2018; Rousseau et al. 2018; Strutt et al. 2018). The TraCrRNA and CrRNA guide the proteins to cleave the ssRNA. The CjCas9 uses its HNH domain to cleave RNA. The precise rules for RNA-targeting and cleaving are still to emerge. The fourth Cas9 from Francisella novicida (FnCas9) has been shown also to target and interfere with ssRNA (Sampson et al. 2013). The Fn Cas9 has been employed to inhibit infection by human papilloma virus (HPV, an ssRNA virus) using RNA-guided RNA targeting methodology (Price et al. 2015). The Cas13 protein of type VI is a potent ssRNA cleaver using a single CrRNA. The Cas13 can be divided into four subtypes: Cas13a, Cas13b, Cas13c, and Cas13d for type VIa, VIb, VIc, and VId, respectively. The protospacer flanking sites (PFS) are important for RNA cleavage-site recognition and Cas13a requires the 3 PFS of H (i.e., A/C/T), while Cas13b requires both the 3 PFS of NAN or NNA (N = A/C/G/T)

72

A. Roy et al.

and the 5 PFS of D (i.e., A/C) (Abudayyeh et al. 2016; Smargon et al. 2017; Zhang et al. 2018a). Cas13 possesses two higher eukaryote and prokaryote nucleotidebinding (HEPN) domains for RNA cleavage activity. The structural studies reveal that Cas13 possesses two independent domains of RNase activities: one used for maturation of CrRNA and the other for cleavage of target ssRNA (Zhang et al. 2018a). The Cas13-mediated cleavage can be regulated by accessory proteins. For example, Csx27 reduces Cas 13b’s nuclease activity while Csx28 enhances the nuclease activity (Smargon et al. 2017). The WYL1 ortholog increases the nuclease activity of Cas13d in its turn (Yan et al. 2018). However, there are problems associated with Cas13 activity. Cleavage of target RNA by Cas13 activates colateral RNase activity, which destroys the nearby RNAs nonspecifically, causing programmed cell death (PCD). Till now, we have discussed nature of the editing agents, i.e., the Cas proteins and the gRNAs. In order to generate the editing events in plants, the process of delivery of these reagents in plants is highly important. The plasmid vectors expressing Cas proteins and gRNAs can be introduced in plants by transfection in protoplasts or agro bacteria-mediated transfer. The ribo-protein complex (RNP) of Cas protein and gRNA can be transferred in plants by particle bombardment in plant cells or by transfection in protoplasts followed by plant regeneration. Virus-mediated vectors can also be used and these are the preferred routes for delivery of gRNAs till now. These deliveries involve two major pathways, namely transient or stable expression in plants. For stable expression, the components need to get integrated into plant chromosomes in uncontrolled manner and eventually remain as a source of offtarget effects in the same and progeny generations. Hence, transgene-free editing is preferred. The transgene-free derivatives are achieved through genetic segregation using selfing and crossing. Alternatively, the suicide genes CMS2 and BARNASE can be used to kill transgene-containing pollen and embryos of the T0 plant (He et al. 2018). Another transgene-free technique has been developed where the in vitro produced gRNA-Cas protein RNP complexes are introduced either by the particle bombardment or protoplast transfusion method. Though the frequency of editing is low in such methods, the probability of having off-target effects is minimized. These techniques have been successfully used for editing events in maize, grape, apple, wheat and potato etc. (Woo et al. 2015; Svitashev et al. 2016; Malnoy et al. 2016; Andersson et al. 2018; Liang et al. 2018).

3 Virus-Free Improved Food in the Era of Bacterial Immunity

73

3.3 CRISPR-Cas9 Strategy Against DNA Viruses Infecting Plants 3.3.1 GE Strategy Against Geminiviruses CRISPR-Cas9 technology has been widely used to edit several plant genes to generate improved crops. In the following, we would discuss the use of this technology to develop virus disease-free plants by interfering with viral elements, and thus producing protected and improved crops. Plant DNA viruses could be targeted by CRISPR-Cas9 system, which could directly destroy their genomic integrity and reduce the virus accumulation. Plant DNA viruses may have single or double-stranded circular DNA genome (ss or dsDNA). While the members of the family Caulimoviridae (genus: Caulimovirus and Badnavirus) have dsDNA circular genome, those belonging to the family Nanoviridae (genus: Nanovirus and Babuvirus) and Geminiviridae have either one or multiple ssDNA genomic component(s). As per the recent taxonomic classification, geminiviruses are grouped into 9 genera namely, Becurtovirus, Begomovirus, Capulavirus, Curtovirus, Eragovirus, Grablovirus, Mastrevirus, Topocuvirus, Turncurtovirus, on the basis of their genome organization, the types of virus transmitting insect vector and the host plants they infect (Zerbini et al. 2017). Among these genera, the genus Begomovirus comprises of 388 species and has the largest number of species under any known viral genus. Begomoviruses have mono- or bi-partite genome (ca. 2.7–ca. 5.4 kb), are encapsidated in twin icosahedra particles measuring 30 × 20 nm, transmitted by whitefly (Bemisiatabaci), and generally infect dicot plants. Begomoviruses cause yellow mosaic, yellow vein mosaic, and leaf curl diseases in crop plants and weeds and cause heavy yield loss for many agricultural crops especially vegetables, legumes, and fiber crops throughout the world (Mansoor 2003; Varma and Malathi 2003). Bipartite begomoviruses are present in both hemispheres, but the majority of the monopartite begomoviruses appear to have evolved only in the Eastern hemisphere. All the bipartite begomoviruses have similar genome organization. The genomes of bipartite begomoviruses consist of two components, referred to as DNA A and DNA B, each 2.5–2.7 kb in size (Fig. 3.3a (iv)). Monopartite begomoviruses have only one genomic component in close resemblance to that of DNA A of bipartite begomoviruses (Fig. 3.3a (iii)). The DNA A component of the bipartite begomoviruses and the genome of monopartite begomoviruses can replicate autonomously and produce virions, but the bipartite begomoviruses require the DNA B component for cell-tocell movement. Some monopartite begomoviral genomes have one or more types of satellite molecules that contain no viral sequences except non-coding intergenic region sequences (probably of viral origin) that are required for replication. The DNA A and DNA B components share approximately 200 bp of sequence within the intergenic region, encompassing the conserved stem-loop and TAATATTAC sequence that serves as the origin of DNA replication. In DNA A of bipartite begomoviruses and the genome of monopartite begomoviruses, virion-sense strand encodes the coat protein (CP, ORF AV1/V1) that encapsidates the virion-sense ssDNA and may be

74

A. Roy et al.

Fig. 3.3 Genome organization of DNA viruses and their management. a Genome organization of some of the geminiviruses with ssDNA genome [(i)–(iv)] and the same for caulimovirus (type: cauliflower mosaic virus) with dsDNA genome (v) are shown. (I) and (II) display the ORFs and replication origins of ssDNA containing Mastrevirus and Curtovirus respectively. (III) Shows the ORFs and origin of replication of monopartitite begomoviruses. The virion of such viruses also contains the circular beta satellite ssDNA. (IV) The bipartite DNA genomes containing begomoviruses with their ORFs are shown. The replication origins of satellite DNAs (alpha and beta) and primary ssDNA genomes are shown by stem-loop structures. (V) The ORFs of dsDNA containing CaMV viruses are shown. b The management of ssDNA containing geminiviruses using gRNA-Cas9 system. (I) The host plant leaf infected by viruses that are transmitted by whitefly vectors is shown. (II) A representative leaf cell harboring overexpressed Cas9 and gRNA in the nucleus (Nu) is shown. The plant chromosome flanking the gRNA/Cas9 is shown by the wavy line. This cell allows cytosolic (Cyt) decapsidation of viral ssDNA which eventually travels in the nucleus to undergo several round of rolling circle replication. (III) The DNA replication results in generating both ss- and ds-DNA forms (ss and RFs) of viral genome. The preexisting gRNA guides the Cas9 protein to act at the on viral DNA site which is also marked by PAM motif. (IV) Cas9 cleaves the circular DNA at the appropriate site shown by an arrow. Following cleavage, cellular repair processes generate mutations, deletions, and additions across the cleavage point and rejoin the DNA

involved in virus movement, and ORF AV2/V2, which has also been implicated in virus movement and acts as a silencing suppressor (Fig. 3.3a). The New World bipartite viruses lack an AV2 ORF. The DNA A complementary-sense strand encodes the replication-associated protein (Rep, ORF AC1/C1), a transcriptional activator protein (TrAP, ORF AC2/C2) that also acts as a silencing suppressor, a replication enhancer protein (REn, ORF AC3/C3) and C4 protein (ORF AC4/C4), which is a major symptom determinant and also acts as silencing suppressor. Rep initiates viral DNA replication by binding to reiterated motifs (iterons) within the intergenic region (IR) and introducing a nick into the conserved TAATATT/AC sequence. DNA B of bipartite begomoviruses encodes a nuclear shuttle protein (NSP, ORF BV1) on the virion-sense strand and a movement protein (MP, ORF BC1) on the complementarysense strand. All of these genes along with the intergenic region can be targeted by CRISPR-Cas9 machinery to devise strategy for their management. Besides the

3 Virus-Free Improved Food in the Era of Bacterial Immunity

75

begomoviruses other two important genera of ssDNA viruses where the CRISPRCas9 was applied are Mastrevirus and Curtovirus. The Mastrevirus genome consists of a single-component of circular ssDNA, 2.6–2.8 kb in size (Fig. 3.3a (i)). Their genomes encode four proteins. The virion-sense strand encodes two proteins, coat protein (CP, ORF V1) that encapsidates the virion-sense ssDNA and acts as a nuclear shuttle protein for viral DNA, and the movement protein (MP, ORF V2), that functions in cell-to-cell movement. The genomes of curtoviruses consist of a single circular ssDNA component, 2.9–3.0 kb in size. Their genomes encode six to seven proteins (Fig. 3.3a (ii)). Three proteins encoded on the virion-sense strand are the coat protein (CP, ORF V1), that encapsidates the virion-sense ssDNA and is involved in virus movement and insect vector transmission, the V2 a movement protein (MP), and the V3 that is involved in the regulation of the relative levels of ssDNA and dsDNA. The complementary-sense strand encodes the replication-associated protein (Rep, ORF C1), required for the initiation of viral DNA replication, C2 protein that acts as a pathogenicity factor in some hosts, a replication enhancer protein (REn, ORF C3) and C4 protein (ORF C4), an important symptom determinant. Geminiviruses have circular ssDNA within the virion particle but the viral DNAs are converted to doublestranded replicative forms with the help of host factors during the course of infection. The double-stranded DNA eventually replicates several times by rolling circle mode of replication and only these forms of DNA are targets of editing by Cas9. Other than the ssDNA viruses CRISPR-Cas9 has also been applied against Caulimovirus, a dsDNA virus. Caulimoviruses have monopartite, open circular, dsDNA of about 8.0 kb in size (Fig. 3.3a (v)). They encode 6–7 proteins. The proteins encoded by ORF 1 are involved in cell-to-cell movement (movement protein), ORF 2 in aphid transmission, ORF 3 in production of virion-associated protein, ORF 4 in encapsidation (coat protein), ORF 5 in replication (replicase), and ORF 6 is involved in translation reinitiation (Tav) (Fig. 3.3a). One of the early attempts to confer immunity against a monopartitite Begomovirus, namely, Tomato yellow leaf curl virus (TYLCV) infecting Nicotiana benthamiana, was made by employing CRISPR-Cas9 system (Ali et al. 2015). The authors used plants over-expressing Cas9 which were guided by individual gRNAs directed at three different regions of the viral genome separately, namely the protospacers of C1/C4 (RCR II-motif in Rep protein), IR (non-coding DNA replication origin), and V2 (coat protein). The gRNAs were delivered via TRV vectors to the leaves of N. benthamiana and were controlled by the promoter derived from Pea early browning virus (PEBV). The gRNA treated plants were challenge-inoculated by an infectious clone of TYLCV and subsequently monitored for symptom development in the inoculated and systemic regions of the plant as well as the level of virus titers using RCA and qRT-PCR assays. In most cases of virus-challenged plants, a significant reduction of symptoms (yellowing, curling, and stunting) occurred, and in a few cases the symptoms disappeared altogether. The viral genomic titers were also diminished very significantly compared to the infected control plants which were not treated with gRNAs. DNA sequencing of the edited viruses revealed that viral DNAs were cleaved at the expected sites, i.e., the targeted sites of gRNAs and following

76

A. Roy et al.

cleavages, various in-dels in the viral genome were detected, the deletion products being the predominant ones (Fig. 3.3b). Though all the gRNAs exhibited virus interference, the IR-gRNA was most effective of all. When the IR-region was targeted, the accumulation of both single- and double-strand viral DNA was severely affected. It was reasoned that the mutations introduced in the IR region will incapacitate viral DNA replication and hence is the disappearance of disease and viral titers. The mechanism of ssDNA virus interference has been briefly sketched in Fig. 3.3b. Over the last few years, the use of CRISPR-Cas9 editing for the management of ssDNA and dsDNA viruses was reported (Ali et al. 2015, 2016; Baltes et al. 2015; Ji et al. 2015; Liu et al. 2018; Mehta et al. 2019). Table 3.1 summarizes the CRISPR-Cas9 approaches as applied to different ss- and ds-DNA plant viruses. Examples include Bean yellow dwarf virus (BeYDV, genus Mastrevirus) in N. benthamiana (Baltes et al. 2015), Beet severe curly top virus (BSCTV, genus Curtovirus) in Arabidopsis thaliana and in N. benthamiana (Ji et al. 2015) and Tomato yellow leaf curl virus (TYLCV, genus Begomovirus) in N. benthamiana (Ali et al. 2015). The gRNA-Cas9 system was also successful in simultaneously targeting three geminiviruses: Beet curly top virus (BCTV) (genus Curtovirus), Merremia mosaic virus (MeMV) and TYLCV (genus Begomovirus) when gRNAs specific for the IR sequence of each virus were used (Ali et al. 2015). Ali et al. (2016) demonstrated the efficiency of genome editing in Cotton leaf curl Kokhran virus (CLCuKoV) and MeMV, and evaluated the efficiency of the CRISPR-Cas9 machinery for targeting different coding and non-coding sequences of geminivirus genomes. Mehta et al. (2019) applied the CRISPR–Cas approach in cassava. Unexpectedly, they found that the CRISPR-Cas9 system was insufficient to confer resistance to cassava against African cassava mosaic virus (ACMV) due to the development of escape mutants, which may give rise to the expansion of new virus variants. In these entire investigations, different virus genes or the intergenic regions were targeted using CRISPRCas9. Many other geminiviruses have been directly interfered with using gRNA-Cas9 and Table 3.1 shows the list of those viruses.

3.3.1.1

Thermodynamic Consideration of Site-Selectivity of Cas9 Enzyme for DNA Targeting

The data presented by Baltes et al. and others (Baltes et al. 2015; Ali et al. 2015; Ji et al. 2015) clearly indicate that Cas9-mediated cleavage of DNA is dependent on the target DNA-sites or the sequence of the gRNAs. The preferred sites are those where the cleavage is very strong and the possibility of mutant generation for biological activity is minimal. Most of the authors reasoned that the mutant formation at the preferred site would render mutant DNA biologically non-functional. Besides this, we wanted to explore the thermodynamic reasoning, if any, behind the site-selection of cleavage activity. We argued that the frequency of formation of the RNA-DNA hybrid might be a governing factor for site-selection. More frequent or strong hybrid formation will

3 Virus-Free Improved Food in the Era of Bacterial Immunity

77

Table 3.1 Summary of progress in CRISPR-Cas9 mediated interference of ssDNA viruses of plant Virus resistance

Plants

Target gene

Cas9-gRNA expression

TYLCV, MeMV

N. bethamiana (Nb)

CP, Rep, IR

Cas9—stable IR best target expression, site gRNAs—TRV based vector

BSCTV

N. bethamiana 43 target sites (Nb) Arabidopsis distributed in thaliana (At) IR, Rep, and CP

Transient expression of Cas9 and gRNAs (43 Nos.) in Nb Stable expression of one gRNA-Cas9 construct each in Nb and At

Best Ji et al. interference at (2015) Rep for transient assay. In case of stable expression, interference effect was dependent on Cas9 expression level

BeYDV

N. bethamiana (Nb)

11 gRNAs from six target regions including RBS, hairpin, nonanucleotide sequence, and three Rep motifs

Transient expression of all gRNA-Cas9 and transgenic expression of two best gRNA-Cas9 modules

Best target at Baltes et al. rep binding (2015) site (RBS) and RCR-III motif of Rep

CLCuKov, N. bethamiana MeMV, (Nb) severe and mild strains of TYLCV, BCTV

For CLCuKov, CP, Rep, IR; for other viruses only IR

Cas9—stable expression, gRNAs—TRV based vector

Least escape mutant formation at IR

Ali et al. (2016)

ACMV

One gRNA spanning AC2-AC3 region

Stable expression

Least interference due to escape mutant formation. Biased conclusion because of single-site selection

Mehta et al. (2019)

Two gRNAs: one each from IR and Rep

Stable expression of both Cas9 and gRNAs

Both sites gave effective interference

Yin et al. (2019)

Cassava

CLCuMuV N. bethamiana (Nb)

Remark

References Ali et al. (2015)

(continued)

78

A. Roy et al.

Table 3.1 (continued) Virus resistance

Plants

Target gene

Cas9-gRNA expression

Remark

References

ChiLCV

N. bethamiana (Nb)

Six gRNAs: two each from IR, V2-V1 overlap, C4-C1 overlap

Transient expression of multiplexed gRNAs

Duplexed Roy et al. gRNA (2019) targeting C4-C1 overlap and V2-V1 overlap reduces virus accumulation significantly and attenuates symptoms greatly No escape mutant detected

Legends TYLCV tomato yellow leaf curl virus; BSCTV beet severe curly top virus; BeYDV bean yellow dwarf virus; CLCuKov cotton leaf curl Kokhran virus; MeMV Merremia mosaic virus; BCTV beet curly top virus; ACMV African cassava mosaic virus; CLCuMuV cotton leaf curl Multan virus; ChiLCV Chilli leaf curl virus; TRV tobacco rattle virus

enhance the probability of Cas9-cleavage. The frequency of hybrid formation will in turn be determined by the stability of the hybrid. Hence, for every given site (Table 3.2), we calculated the Tm of the DNA-DNA and RNA-DNA hybrid forms following published methodologies (https://bioinf.fisica.ufmg.br/app/comparetm.pl; Weber 2013, 2014). We especially looked at the parameter T, which is the difference of Tm between the DNA-DNA and RNA-DNA forms, i.e. T = (Tm) DNA-DNA − (Tm) RNA-DNA for every single gRNA. Figure 3.4 shows that a trend line could be Table 3.2 gRNA sequences versus cutting efficiency (Baltes et al. 2015) S. No.

gRNA sequences

Delta-T

Relative cutting efficiency

1

GGUAAUAUUAAAUUCG GCGU

14.4

50

2

AAAGCACUCGCGAUAAGGGG

2.52

60

3

CUGCCUCCAUGCCUCCACGC

5.02

70

4

CUUGAUUACAUAUCAAAGGA

13.31

70

5

CGUCCUUUGAUAUGUAAUCA

18.14

30

6

GCUGGAGAAGAGCAUGAUAG

1.06

85

7

AUGAGCACUUGGGAUAGGUA

2.79

40

8

GCGUGGAGGCAUGGAGGCAG

−0.63

70

9

GAAGUCUUUGCGACAAGGGG

6.31

40

10

CACGCCGAAUUUAAUAUUAC

16.26

10

11

CGCGAGUGCUUUAGCACGAG

15.99

20

3 Virus-Free Improved Food in the Era of Bacterial Immunity

79

Realitive cutting efficiency ( %GFP loss)

Cutting eff and Delta-T

-5

90 80 70 60 50 40 30 20 10 0

0

5

10

15

20

Delta-T

Fig. 3.4 Relative cutting efficiency as a function of delta-T. Delta-T for each gRNA, as listed in Table 3.2, has been computed and represented in the X-axis of Fig. 3.4. The corresponding cutting efficiency, derived from the data mentioned in Baltes et al. (2015), has been shown in the Y-axis of Fig. 3.4. A trend line, as shown, can be drawn considering all the plotted points

drawn after plotting the data shown in Table 3.2. The trend line shows that high cleavage strength corresponds to low T. Conversely, the sites with high T will be the ones with low probability of Cas9-mediated cleavage. Making use of the hypothesis that the sites with low T will represent the ones with high probability of cleavage, we wanted to predict the sites of high and low cutting in the genome of another Begomovirus, i.e., Chili leaf curl virus (ChiLCV_MK882926). We found that there are 45 sites with PAM motif in the viral strand and accordingly 45 gRNA sequences could be made. Similarly, there are 37 sites with PAM motif on the complementary strand and 37 gRNA sequences are possible. In all, there could be 82 cleavage sites on the double-stranded DNA of ChiLCV. We calculated T for all the sites and Table 3.3A, C show the predicted sites with high cleavage activity on the viral (+) and complementary strands (−), respectively. Similarly, Table 3.3B, D show the predicted sites of low cutting. Combining the data, we can predict the sites of very high (Table 3.3E) and very low cutting (Table 3.3F). These predictions may not be very accurate as the contributions of free energy of binding by Cas9 protein have not been considered. Though these predictions need further improvement, these give an approximate idea of site-selectivity of gRNA guided Cas9-mediated cleavage.

80

A. Roy et al.

Table 3.3 Predicted sites of high and low cleavage in ChiLCV genome S. No.

gRNA sequences

Region

Delta T

A. High cutters with PAM on viral strand (+) 1

UACAUAUGCUCCAGACACUC

AV2

2

ACAGAAGCCCAGAUGUUCCU

AV2

3.36 4.41

3

UCGAAAGAAGAAGAACAAAA

AC1

4.52

4

CUCUGCCUGAGCUGCAGUGA

AC2

5.45

5

AAUAUGAACAGCCGCAGUCU

AC1/AC2

7.12

6

UAUAUAGUGUGAGUACCAAA

IR

7.35

B. Low cutters with PAM on viral strand (+) 1

GUCUCCGUUUUUUUCCACAU

AC1

23.05

2

CUCAUAGCUUAAUUAUUUCA

IR

21.10

3

CUUUCUCCCUUAAUAUAUUG

AC1

20.05

4

CAUUAGUUAAGAAGUUCGUU

AV1

20.03 −1.58

C. High cutters with PAM on complementary strand (−) 1

GUGCCCCUACUACAGAACCA

AC2/AC3

2

ACUCCUGCACCUCUACUCCA

AC1

2.61

3

ACAUGUACCGCACAUGAGUG

AV1

5.61

4

UCAGACUCCGACAUUCCAGC

AC2/AC3

6.70

D. Low cutters with PAM on complementary strand (−) 1

UUGUUUUUCCUCUUUGUAUU

AC1

26.24

2

CCGUUUAAGUUUUAAGUUUA

IR

24.58

3

AUUUCCAGCGUAAGUUAUUU

AC1

20.83

4

GUUUCCUUCUAUCGCCCUUA

AC1

19.50 −1.58

E. Probable zones of very high cutting 1

GUGCCCCUACUACAGAACCA (−)

AC2/AC3

2

ACUCCUGCACCUCUACUCCA (−)

AC1

2.61

3

UACAUAUGCUCCAGACACUC (+)

AV2

3.36

F. Zones with lowest cutting probability 1

UUGUUUUUCCUCUUUGUAUU (−)

AC1

26.24

2

CCGUUUAAGUUUUAAGUUUA (−)

IR

24.58

3

GUCUCCGUUUUUUUCCACAU (+)

AC1

23.05

3 Virus-Free Improved Food in the Era of Bacterial Immunity

81

3.3.2 GE Strategy Against CaMV Cauliflower mosaic virus (CaMV) causes devastating disease mainly in Brassicaceae family of crops and the onset of the disease is marked by light coloring in leaves that often go unnoticed. The effect of the disease is much more pronounced in winter than in summer. CaMV induces a variety of systemic symptoms such as mosaic, necrotic lesions on leaf surfaces, stunted growth, and deformation of the overall plant structure. The nature and extent of symptoms depend on the viral strain, host ecotype, and environmental conditions. The virus is vectored by aphids like Myzus persicae and sensitizes the infected plants to other fungal diseases like Downy mildew. CaMV is a pararetrovirus with an 8 kb long double-stranded genome encoding at least seven ORFs. The sixth ORF encodes P6 protein and participates in various metabolic functions useful for the virus and also very important in the development of disease. Following infection, siRNAs of all sizes are produced extensively from the viral genome (vsiRNAs) that do not affect viral replication but bind to plant defense machinery like AGO1/AGO4 and inactivate host defense (Blevins et al. 2011). Management of this virus is not easy and recently CRISPR/Cas9 system has been employed successfully to limit the viral disease (Liu et al. 2018). Arabidopsis plants were transformed with a construct harboring Cas9 and a linear array of sequences encoding six gRNAs which targeted about 400 bp at the 5 end of the CP sequence of CaMV. The Cas9 DNA was under the control of Arabidopsis UBQ10 promoter while each gRNA was expressed from At Pol III U6 promoter. The transformed Arabidopsis plants lacking Cas9 but overproducing the gRNAs were used as controls. The test and control transformed plants were treated with purified virions by mechanical inoculation and the symptom generation in the systemic leaves was monitored. The control plants developed chlorosis and vein clearing quickly and gradually the whole plants were stunted and severely diseased. But about 90% of Cas9/gRNA overproducing plants remained symptomless for a long time post-viral inoculation. No viral DNA could be detected in the symptomless plants. In very few transgenic plants, however, symptoms appeared with delay and reduced viral titer. DNA sequencing of editing viruses revealed degradation at the expected sites followed by large deletions and in a few cases insertion of wild type CP sequences. Such insertions could be the result of recombination between the edited and wild type CP sequences derived from input infecting viruses. As vsiRNAs are generated to a high extent following viral infection, the authors examined the role of these small RNAs in interference of the virus; and these small RNAs along with the ones generated from the gRNAs were ineffective to control the infecting virus. The authors also speculated that the results of immunization would have been even more dramatic should they have targeted the noncoding sequences of the virus. Thus, the CRISPRCas9 system provides a great arsenal in the management of CaMV.

82

A. Roy et al.

3.3.3 GE Strategy Against Pro-Viruses The editing technology could also be applied to cure the plants of the menace of proviruses. The B genome of banana houses the DNA of Banana streak virus (BSV) in multiple copies and in various orientations; and in time of stress (like water, high-temperature stress) and tissue culture conditions, the integrated BSV genomes recombine and pop out of the host chromosome. The BSV genome then starts multiplying as episomes of about 8 kb size with three ORFs, causing the symptoms of chlorotic streaks in the banana leaves and splitting of the pseudostems. The plantains and many other banana varieties, which serve as staple food in Africa and other places, are often susceptible to BSVs and thus control of BSVs is of immediate need. Tripathi et al. applied editing technology on Gonja Manjaya plaintain (AAB genome) (Tripathi et al. 2019). They transformed the banana plant with a DNA construct harboring the Ubi promoter-driven Cas9 and three gRNAs, each of which was under the control of U6 promoter. Each of the gRNAs targeted the BSVORFs at specific sites. Many edited events were scored and all edited plants were tested for their abilities to excise out the BSV genome and exhibit the streak-disease in leaves following water–stress. Seventy-five percent of the edited events did not show streak symptoms in comparison to the non-edited control plants. The excision of BSV genome was also inhibited. The plants, which were edited at all the three ORFs, were not only streak disease-resistant themselves but their clonal progenies also did not show any emergence of infective BSVs. The insertions and deletions (indels) were the major forms of editing across the target sites. The off-target analysis of a few representatives edited plants did not show any significant Cas9-mediated cutting in banana genome, revealing the robust selection of gRNA sequences.

3.4 CRISPR-Cas Interference Against RNA Viruses The cultivated and domesticated plants and crops are susceptible mostly to RNA viruses. About 17% of the plant viruses are DNA viruses and RNA viruses contribute to the rest. Nearly 65% of the plant viruses have positive-sense single-stranded while 10% of the viruses have negative-sense RNA genome. Plant viruses cause an annual crop loss of USD 60 billion dollar worldwide. Moreover, the RNA genomes of viruses undergo evolutionary changes very fast. The misincorporation rate during genome replication could be as high as 2–3 × 10−03 per base per generation. The processes of recombination also aid significantly in generating new forms of viral genomes. The recombinogenic capacities of different viruses are different but hover around 1–2 × 10−04 per base per round of replication (Elena et al. 2011). These changes cause novel viruses to appear with a vastly changed spectrum of host susceptibility. These changes give rise to the phenomena like species jump, spillover, etc., which have caused devastating epidemics in the past. For example, the appearance of necrogenic strains of Cucumber mosaic virus (CMV) on tomato crops caused epidemics in

3 Virus-Free Improved Food in the Era of Bacterial Immunity

83

eastern Spain about 20 years ago (Escriu et al. 2000). Thus, control of RNA viruses is of great consequences to global agriculture. For programmable RNA-guided RNA-targeting either in vitro or in vivo, mainly two CRISPR-Cas effector enzymes, namely, Cas13a (Cas13a from Leptotrichia wadei (LwaCas13a) or Cas13a from Leptotrichia shahii (LshCas13a)) and FnCas9 (Cas9 from Francisella novicida) have been used. These enzymes demonstrated their ability to inhibit the single-stranded or double-stranded RNA genomes of the viruses belonging to few genres, namely, potyviridae, cucumoviridae, and tobamoviridae, in both transient and stable expression assays. However, the modes of inhibition of these two enzymes are different: Cas13a degrades the RNA at the target sites whereas FnCas9 binds to the target RNA site tightly without slicing the template so that the translation or transcription from the RNA template remains blocked. Cas13a amino-acid sequence reveals presence of two higher eukaryotes and prokaryotes nucleotide-binding domains (HEPN) and these domains determine the RNase activity of the enzyme. The enzyme needs 28nt long spacer sequence as the guide-RNA (gRNA), which guides the enzyme to the specific target site of singlestranded RNA for cleavage. The cleavage occurs both in vitro and in vivo with the protospacer flanking sequence of A, U or C. The secondary structure of the target sequence modulates the RNase activity of the enzyme and the ‘U’ residues of multiple sites within the secondary structure of the ssRNA target are preferentially cleaved. The enzyme can accommodate only one mismatch but not two in the middle of RNARNA pairing, thus pointing to a requirement of central seed sequence. Aman et al. have used this enzyme to inactivate a species of the potyvirus, namely Turnip mosaic virus (TuMV) when the virus was allowed to infect the model plant N. benthamiana (Aman et al. 2018a). In nature, TuMV has a very wide host range, infecting at least 318 species in 156 genera of 43 families which include various cultivated Cruciferae (cabbage, cauliflower, radish, turnip) and numerous wild plants such as C. bursa-pastoris or Stellaria media. TuMV induces symptoms like mottling in broad, yellow, circular, and irregular areas, turning the oldest leaves bright yellow all over. Though the variability of the TuMV strains is extremely wide, phylogenetic analyses have revealed that all the worldwide isolates can be grouped in four major groups, namely, basal-B (Brassica), basal-BR (Brassica/Raphanus), Asian-BR, and world-B. Aman et al. used the UK1 isolate as its genome sequence was available. TuMV has filamentous and flexous particle structure with an average length of 720 nm harboring a singlestranded RNA molecule of about 10,000 nucleotides (Fig. 3.5a (ii)). Within the host, the viral RNA genome is translated as a single polyprotein which eventually gets cleaved in about ten polypeptides by the virus-encoded proteases. For the ease of tracking the virus in plants, Aman et al. prepared a recombinant TuMV-GFP virus where GFP was placed in between P1 and Hc-Pro ORFs. Aman et al. prepared the agro clone harboring the construct that expresses the codon-optimized Lsh Cas13a. First, in a transient over-expression system, the Pea early browning viral (PEBV) promoter-driven gRNAs (CrRNAs) were delivered near the agro-infiltration zone of N. benthamiana plants through the TRV viral vehicle. The CrRNAs targeted the viral regions, namely HC-Pro, CP and GFP separately or in combinations. During

84

A. Roy et al.

Fig. 3.5 Genome organization of ssRNA viruses and their management. a Monopartite genomes with their ORFs are shown for Tobamoviruses (type: TMV) and Potyviruses (type: TuMV, PVY, etc.) in (i) and (ii) respectively. The tripartite genome with the ORFs for Cucumovirus (type: CMV) is shown in (iii). b Mechanism of Cr-RNA and Cas13a action on ssRNA genome. The plant chromosome harboring the Cr-RNA and Cas13a cassette is shown by wavy line. The Mechanism is illustrated stepwise. At step (1), poly CrRNA and Cas13a RNA are formed in the nucleus. The Cas13a protein (shown in blue) is found both the nucleus (Nu) and cytosol (Cyt). In step (2), Cas13a protein acts on poly CrRNAs and splits them into single Cr-RNAs 9 (step 3) as shown in gold, blue, and grey colors. In step (4), the CrRNA and Cas13a form complexes which are guided to the incoming viral ssRNA within the cytosol (5). In step (6), the Cas13a complex latches on the protospacer with an appropriate flanking motif and initiates the RNA cleavage activity. The viral RNA genome gets eventually degenerated into pieces of RNAs (step 7), resulting in cellular tolerance against the virus

3 Virus-Free Improved Food in the Era of Bacterial Immunity

85

agro-infiltration, co-inoculation with the infectious TuMV-GFP clones was carried out and the fate of virus expressed GFP was monitored in the systemic leaves. The plants with CrRNA targeting the Hc-Pro region exhibited the largest reduction in the GFP level. The reduction in viral titer was quantitated by various molecular techniques. This result was also further validated by stable expression of Cas13a in transgenic tobacco plants. Moreover, the group showed that the Cas13a enzyme could also process poly-CrRNA in singlet functional Cr-RNAs (Fig. 3.5b). The same group also engineered Arabidopsis plants to stably express Cas13a and individual CrRNAs that are complementary to four different regions of TuMVGFP. The 35S promoter drove the Cas13a while At-U6-26 promoter controlled the expression of cr-RNA. Thus, four different types of transgenics were developed and each was challenged with the TuMV-GFP virus to examine the protective power of the transgenics. The transgenics expressing the CrRNA, targeting the HC-Pro region, showed the best virus-inhibition capability. The virus inhibition property was retained through generations (T2) and thus the transgenic plants clearly inherited the virus resistance characteristics (Aman et al. 2018b). Zhan et al. have used Lsh Cas13a to defend potato crops against the deadly pathogen, i.e. PVY virus (Zhan et al. 2019). Potato with its yearly global production of 400 million tons is a major food crop ranking fourth after rice, wheat, and corn but it suffers a serious limitation in production due to PVY virus. In some fields, loss to the tune of 80% has been reported and there are no effective measures to manage the virus. The symptoms induced by PVY include mosaic, mottled, and crinkled leaves as well as leaf and vein necrosis (Karasev and Gray 2013). PVY belongs to the genus potyviruses and the genomic ontological structure is similar to that of TuMV. Due to its high mutagenic and recombination rates, the diversity of the virus is very high, which is a principal reason for difficulty to contain this virus. On the basis of phylogeny, the PVY strains can be grouped into four major classes, namely, PVYo , PVYn , PVYntn , PVYn : etc. As conventional breeding and RNAi-mediated transgenics provided limited success in managing the virus, Lsh Cas13a has been used to generate durable, broad-spectrum resistant potato. Zhan et al. (2019) first looked for the conserved regions of most of the PVY strains and found 14 such regions having a length of 28 nucleotides or more. Four such regions were selected to design the CrRNAs that targeted important viral genes, namely P3, CI, NIb, and CP regions. The CrRNAs were also tagged with oligo-A rich tail to facilitate nuclear export since the virus will be present in the cytosol of the infected plant cell. The potato transgenics were made that stably expressed LshCas13a under the control of UBQ 10 promoter along with each of the four types of CrRNAs, which in their turn, were driven by At U6 promoter. The transgenics were challenged first with the most virulent PVY° strain and tested for virus interference. The majority of the transgenics showed a good amount of resistance and the resistance was found to be highly linked with the expression amount of the Cas13a protein. Each of the highest expressors of Cas13a of the four types of transgenics was next selected for broad-spectrum virus resistance. Every transgenics inhibited the viruses to a great extent and showed no symptoms even after 25 days post virus challenge. The transgenic of each type that was designed to target four different regions reduced

86

A. Roy et al.

the virus titers by more than 50 fold compared to non-transgenic wild type plant. Both PVY and TuMV belong to the same genus but the profiles of virus interference in the two cases are different. For TuMV, virus interference was site-selective, whereas no such site-selectivity was observed for interference with PVY. The difference could be due to the design of CrRNAs (with nuclear export) and also selection of the transgenics (highest expression) for virus inhibition. It is noteworthy that the genomes of the transgenics were free from any off-target effects as the Cas13a enzymes were localized only in cytosol. In another report, Zhang et al. used LshCas13a to confer RNA virus resistance in both dicot and monocot plants and crops (Zhang et al. 2019). The mentioned enzyme was stably expressed in tobacco along with one of the five CrRNAs that targeted five regions of TMV (Fig. 3.5a (i)). All types of tobacco transgenics successfully defended themselves against challenge TMV and showed no symptoms. The transgenics reduced the virus titer by at least fivefold compared to the non-transgenic ones. Rice plants suffer yield loss due to many viruses, for example, Southern rice black-streaked dwarf virus (SRBSDV) causes a striking disease on rice in several East Asian countries, Rice stripe mosaic virus (RSMV) is a novel cytorhabdovirus and pose a new threat to rice production in south China. Zhang et al. developed transgenic rice lines overexpressing LshCas13a under the control of UBI promoter and CrRNAs, which were individually driven by Os-U6 promoter. The CrRNAs targeted various regions of the viruses of both types. The rice transgenics, when challenged with the viruses, showed mild symptoms in both cases compared to the non-transformed ones. This is first report of interference against rice viruses in rice itself. The transgenics were advanced to the T3 generations and the virus resistance was found to be stably inherited. In one of the early attempts to develop resistance against RNA viruses like TMV and CMV (Fig. 3.5a (iii)) in tobacco or Arabidopsis using the CRISPR-Cas technology, Zhang et al. employed a variant of Cas9, i.e. FnCas9 (Zhang et al. 2018b). The genome of CMV is tripartite whereas the genome of TMV is monopartite but both are positive-sense RNA plant viruses that infect many plant species (Palukaitis and García-Arenal 2003). Zhang et al. prepared vector constructs harboring the FnCas9 driven by enhanced 35S promoter along with a guide RNA (gRNA) which was under the control of At U6 promoter. For CMV, 23 candidate sites were chosen spanning the whole genome and for TMV, only 3 sites were chosen to design gRNAs, each of which was 20 nt long. In a transient assay system, the virus inhibition was observed in N. benthamiana with all the gRNAs and the interference was found to the extent of 40–60% compared to the case of control vectors without any FnCas9/gRNA. These data also revealed that FnCas9 does not require any PAM motif for site recognition. Subsequently, the three vectors with high performing gRNAs were chosen for further resistance analysis against CMV. In all cases, virus inhibition was found both in inoculated and systemic tobacco leaves. The Cas9 based immuno-precipitates of the extracts from CMV-infected leaves revealed the clear presence of the viral genome and gRNAs, thus pointing to tight binding of viral RNAs with Cas9. The Cas9, which was made defective in its RNase activity, was also equally inhibitory

3 Virus-Free Improved Food in the Era of Bacterial Immunity

87

for virus replication and spread. But the mutated Cas9 defective in the RNA binding capacity failed to provide virus interference. Thus, the FnCas9 binding alone but not its catalytic cleavage activity is responsible for virus inhibition. It was conjectured that Cas9 binding blocked viral replication, translation etc. exhibiting the phenotype of virus interference. The above-mentioned three constructs were also used to generate transgenic Arabidopsis plants. T2 transgenic homozygous lines for each construct, and the control wild-type Arabidopsis, were chosen and infected with CMV by mechanical inoculation. The control plants developed severe symptoms including leaf deformity and delayed growth two weeks post CMV inoculation. The transgenic lines showed very mild symptoms and a few did not show any obvious symptoms. The measurement of viral genomes revealed reduction of viral replication by at least a factor of 5 compared to the nontransgenic control. The resistant lines were advanced to T6 generations, which were challenged with CMV to demonstrate the clear inheritance of resistance. Table 3.4 enlists the RNA viruses that have been interfered with by CrRNA-Cas based system. The brief mechanism of interference with ssRNA viruses by Cas13a has been displayed in Fig. 3.5b.

3.5 Perspective CRISPR-Cas system stands tallest amongst all silencing technologies as of now and provides the latest and strongest antiviral strategies. The effecter proteins are derived from the prokaryotic sources and analogous proteins are unknown in the eukaryotic kingdom. When these are allowed to work in the eukaryotic environment, the immediate threat of developing resistance against these factors are minimal as the eukaryotic systems have not gotten the chance to evolve with these prokaryotic factors. In this sense, CRISPR-Cas system also provides durable antiviral principles. Following viral infection in plant cells, vsiRNAs are generated. The role of these small RNAs in the context of Cas-mediated interference activity needs to be investigated. It needs to be clearly deciphered if these are antagonistic or synergistic with the Cas factors. In the case of CaMV only (Liu et al. 2018), as mentioned earlier, vsiRNAs have been subjected to proper examination and the authors were of the opinion that vsiRNAs contribute little in Cas9-mediated cleavage of viral DNA. But in many other events, the investigations have fallen silent. Moreover, there is always a possibility that the expressed gRNAs within the plant cells are converted to double-stranded RNAs by cellular RNA dependent RNA polymerases that subsequently suffer dicing and thus the abundance of the available gRNAs might diminish. All of these possibilities should be revisited using various sorts of RNAi mutants. Many plants have acquired significant tolerance against geminiviruses upon application of CRISPR-Cas9 system. There is a family of viruses belonging to nanoviridae whose biochemical events resemble those of geminiviruses. The Nanoviridae family has two genera: Nanovirus and Babuvirus which primarily infect legume and banana plants, respectively. The viruses belonging to Babuvirus genus have caused huge epidemic in banana industry on many different islands at different time points in

Plants

N. benthamiana (Nb), A. thaliana

N. benthamiana (Nb)

A. thaliana

N. benthamiana (Nb) Rice

Virus resistance

CMV, TMV

TuMV

TuMV

TMV, SRBSDV (rice), RSMV (rice)

5 CrRNAs against TMV, 3 CrRNAs against SRBSDV 3 CrRNAs against RSMV

HC-Pro and CP

HC-Pro and CP

For CMV, total 23 sites in 3 genomic RNAs (7 each) including 2 in 3 UTR For TMV, 3 sites in coding region

Target gene

HC-Pro site provided best interference

FnCas9 did not cleave viral RNA but blocked transcription and translation of viral template gRNAs from RNA-1, RNA-3, and 3 UTR showed superior result

Remarks

Aman et al. (2018b)

Aman et al. (2018a)

Zhang et al. (2018b)

References

(continued)

For TMV transient All sites showed effective Zhang et al. (2019) expression of both interference Cas13a and CrRNAs For rice stable expression of Cas13a and CrRNAs

Stable expression of both HC-Pro site provided Cas13a and CrRNAs best interference

Cas13a transient and stable expression CrRNA/Poly CrRNA expressed from TRV vector

Transient expression of FnCas9-gRNAs in Nb Stable expression of superior 3 gRNAs (against CMV) with FnCas9 in Arabidopsis

Cas13a/FnCas9-gRNA expression

Table 3.4 Summary of progress in CRISPR-Cas9 mediated interference of ssRNA and dsRNA viruses of plant

88 A. Roy et al.

Potato

PVY

Cas13a/FnCas9-gRNA expression

4 CrRNAs corresponding to Stable expression of P3, CI, CP and NIb Cas13a and CrRNAs

Target gene For resistance assay, highest expressor of Cas13a transgenic lines were chosen. No preference for any particular CrRNA

Remarks Zhan et al. (2019)

References

Legends CMV cucumber mosaic virus; TMV tobacco mosaic virus; TuMV Turnip mosaic virus; SRBSDV southern rice black-streaked dwarf virus (dsRNA genome); RSMV rice stripe mosaic virus (dsRNA genome), PVY potato virus Y

Plants

Virus resistance

Table 3.4 (continued)

3 Virus-Free Improved Food in the Era of Bacterial Immunity 89

90

A. Roy et al.

history. Managing these viruses pose difficulty and thus require intervention of new technologies. The Nanoviridae genome consists of multiple segments of circular, single-stranded DNA of 1 kb each totaling about 8.1 kb in length. There are between 6 and 11 components of DNA depending on the genus, and four components encode only one variety of replication protein each. All the components have a stem-loop structure in common and it harbors an invariant 9-mer-replication origin sequence. When infected, plant cell nuclei support replication of the viral DNA genome by rolling circle principles, converting the single-stranded DNA from first to a doublestrand replicative one. If gRNA could be targeted at this crucial replication origin site, following the examples from geminiviruses, the indels produced following the Cas9 activity might make replication origin inactive, thereby eliminating the virus subsequently. Hence this is an area where research activity could be focused. Like all other silencing technologies, CRISPR-Cas system is also fraught with dangers of off-target effects in the host chromosome along with formation of escape mutations in the viral genome. The problem of escape mutation could be partly solved by targeting multiple gRNAs for cleavage at the viral genome, as large deletions will render the viral genome completely ineffective (Roy et al. 2019). But multiplexing gRNAs will also increase the quantum of off-target effects as each gRNA will contribute its share in such effects. Attempts have been made to reduce the off-target effects by a few means. An expressed gRNA might pair with host chromosomal sites having appropriate PAM sites with few mismatches and Cas9 might cleave generating in-dels at the cut sites. Such indels are the sources of unwanted off-target effects. Intense research activities are being carried out to reduce or eliminate such off-target effects. In one case, mutant Cas9s have been generated which fail to recognize mismatches and is thus very specific at the site where gRNAs guide them. Slaymaker et al. have introduced three mutations within the nt-groove, which weakens Cas9’s non-target strand stabilization and therefore increase stringency of guide RNA.DNA complementation for nuclease activation (Slaymaker et al. 2015). Secondly, the gRNAs can also be expressed by virus inducible promoters to inhibit the constitutive activity of the gRNAs and it has been observed that the inducible gRNAs are good enough to bring down host chromosomal off-target effects several fold (Ji et al. 2018). Thirdly, the anti-Cas9 factors could also be used to reduce off-target effects as these factors interact with Cas9 and hamper the specific DNA cleaving activity of Cas9. In such cases, Cas9 cannot be recycled and gets localized at the site-directed by gRNA. Fourthly, Ran et al. described a novel way to reduce off-target effects (Ran et al. 2013). They used a D10A mutant Cas9 which makes a nick only instead of a double-strand break. They used a pair of gRNAs that target opposing strands of DNA and thus Cas9 makes a staggered cut in target DNA, which is repaired by a relatively Fidel BER pathway (Base Excision Repair) rather than NHEJ pathway. This technique has been observed to cut down off-target effects by 50–1500 fold in mammalian cells. Besides these, suitable gRNA sequences could also be designed which are thermodynamically very stable following binding at the protospacer sites, thus reducing off-target effects (Tycko et al. 2016).

3 Virus-Free Improved Food in the Era of Bacterial Immunity

91

Harnessing the benefit of CRISPR-Cas9 tool largely depends on the successful and efficient delivery of genome editing reagents (Cas9 protein and gRNA) into plant cells. Presently applications of the CRISPR-Cas9 system in plants bank on three major ways of their delivery: (i) conventional transgenic procedure, (ii) DNA free delivery of gRNA-Cas9 ribonucleoprotein complex, and (iii) Plant virus-derived vector-based transient but systemic delivery of gRNAs into a Cas9 overexpressing plant. Transgenic means of delivery of CRISPR-Cas9 tools have its own limitations like non-suitability for all plant types, longer time requirements, exhibition of somatic variation, and biosafety concern. To avoid the problems associated with the callus culture etc. in planta method can be adopted (Yasmeen et al. 2008). However, such in planta method is not suitable for all plant types as there are inherent drawbacks related to reproducibility and efficiency of the procedure. To broaden the scope for transformation of resilient plants, Rhizobium and other bacterial vectors can be tried. Biolistic delivery through in planta particle bombardment (iPB) is another alternative method developed in wheat (Hamada et al. 2017). Another important aspect is to find out the transgene-free edited plant. The selection is very tedious and not often give the desired plant type. To improve the delivery platforms, recently gRNA-Cas has been delivered directly to protoplast as ribonucleoprotein (RNP) complex, which can edit the targeted gene without being integrated into the genome, resulting in regeneration of transgene-free edited plants from single protoplast cells. Such DNAfree genome editing has been achieved in several crops, including lettuce, maize, and wheat (Woo et al. 2015; Svitashev et al. 2016; Liang et al. 2017; Kim et al. 2017; Lee et al. 2018). The method is often inefficient, thus limiting the exploitation of this technology to produce DNA-free edited plants. Nanoparticles-based delivery of RNP has also been demonstrated (Cunningham et al. 2018). Though the DNA free delivery holds a promise for editing of the plant gene(s), which are responsible for virus establishment, the technology is not at all suitable for directly targeting the plant virus as most of the plant viruses do not integrate into the plant genome (with a few exceptions). The third delivery platform includes autonomously replicating DNA and RNA virus-based vectors, which can carry the gRNA into its genome and efficiently express them throughout the plants without being integrated into the genome (Zaidi and Mansoor 2017). RNA virus-based vectors are more suitable for this purpose than their DNA virus-based counterparts as they do not integrate into the plant genome, thus avoiding unintended genome integration. Therefore, plants treated with RNA viruses are considered to be transgene-free edited plants. One such virus-based vector is Tobacco rattle virus (TRV), which is widely used for delivering genome-editing reagents into plant. Several geminiviruses have also been used for this purpose. However, there are two major concern of such delivery, firstly, the transgenic expression of Cas gene cannot be avoided, as the size of the Cas genes is too big for a cargo to be loaded onto any plant virus genome; secondly, the possibility of gRNA silencing may be an issue for their successful expression as plant viruses. In the years to come many more Cas factors will be discovered from eubacteria and archea; and employing protein engineering, known Cas proteins will be developed with enriched target specificity, removing the bulk of off-target effects. Improved

92

A. Roy et al.

delivery techniques will also be available so that all kinds of crops could be subjected to CRISPR-Cas related manipulations. These are not mere academic activities but are very important for commercial realization of improved crops. However, it is not difficult to dream of a near-future where food or food products, free of known viruses, will be available aplenty.

References Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DBT, Shmakov S, Makarova KS, Semenova E, Minakhin L, Severinov K, Regev A, Lander ES, Koonin EV, Zhang F (2016) C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 353. https://doi.org/10.1126/science.aaf5573 Agrawal N, Dasaradhi PVN, Mohmmed A, Malhotra P, Bhatnagar RK, Mukherjee SK (2003) RNA interference: biology, mechanism, and applications. Microbiol Mol Biol Rev 67:657–685. https:// doi.org/10.1128/mmbr.67.4.657-685.2003 Ali Z, Abulfaraj A, Idris A, Ali S, Tashkandi M, Mahfouz MM (2015) CRISPR/Cas9-mediated viral interference in plants. Genome Biol 16. https://doi.org/10.1186/s13059-015-0799-6 Ali Z, Ali S, Tashkandi M, Zaidi SS-E-A, Mahfouz MM (2016) CRISPR/Cas9-mediated immunity to geminiviruses: differential interference and evasion. Sci Rep 6. https://doi.org/10.1038/sre p26912 Aman R, Ali Z, Butt H, Mahas A, Aljedaani F, Khan MZ, Ding S, Mahfouz M (2018a) RNA virus interference via CRISPR/Cas13a system in plants. Genome Biol 19. https://doi.org/10.1186/s13 059-017-1381-1 Aman R, Mahas A, Butt H, Aljedaani F, Mahfouz M (2018b) Engineering RNA virus interference via the CRISPR/Cas13 machinery in arabidopsis. Viruses 10:732 Anderson PK, Cunningham AA, Patel NG, Morales FJ, Epstein PR, Daszak P (2004) Emerging infectious diseases of plants: pathogen pollution, climate change and agrotechnology drivers. Trends Ecol Evol 19:535–544. https://doi.org/10.1016/j.tree.2004.07.021 Andersson M, Turesson H, Olsson N, Fält A-S, Ohlsson P, Gonzalez MN, Samuelsson M, Hofvander P (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiol Plant 164:378–384. https://doi.org/10.1111/ppl.12731 Baltes NJ, Hummel AW, Konecna E, Cegan R, Bruns AN, Bisaro DM, Voytas DF (2015) Conferring resistance to geminiviruses with the CRISPR–Cas prokaryotic immune system. Nat Plants 1. https://doi.org/10.1038/nplants.2015.145 Blevins T, Rajeswaran R, Aregger M, Borah BK, Schepetilnikov M, Baerlocher L, Farinelli L, Meins F, Hohn T, Pooggin MM (2011) Massive production of small RNAs from a non-coding region of cauliflower mosaic virus in plant defense and viral counter-defense. Nucleic Acids Res 39:5003–5014. https://doi.org/10.1093/nar/gkr119 Calil IP, Fontes EPB (2016) Plant immunity against viruses: antiviral immune receptors in focus. Ann Bot. https://doi.org/10.1093/aob/mcw200 Chen K, Wang Y, Zhang R, Zhang H, Gao C (2019) CRISPR/Cas genome editing and precision plant breeding in agriculture. Annu Rev Plant Biol 70:667–697. https://doi.org/10.1146/annurevarplant-050718-100049 Cosson P, Sofer L, Le QH, Léger V, Schurdi-Levraud V, Whitham SA, Yamamoto ML, Gopalan S, Gall OL, Candresse T, Carrington JC, Revers F (2010) RTM3, which controls long-distance movement of potyviruses, is a member of a new plant gene family encoding a meprin and TRAF homology domain-containing protein. Plant Physiol 154:222–232. https://doi.org/10.1104/pp. 110.155754

3 Virus-Free Improved Food in the Era of Bacterial Immunity

93

Cunningham FJ, Goh NS, Demirer GS, Matos JL, Landry MP (2018) Nanoparticle-mediated delivery towards advancing plant genetic engineering. Trends Biotechnol. 36:882–897. https:// doi.org/10.1016/j.tibtech.2018.03.009 Dugar G, Leenay RT, Eisenbart SK, Bischler T, Aul BU, Beisel CL, Sharma CM (2018) CRISPR RNA-dependent binding and cleavage of endogenous RNAs by the Campylobacter jejuni Cas9. Mol Cell 69. https://doi.org/10.1016/j.molcel.2018.01.032 Elena SF, Bedhomme S, Carrasco P, Cuevas JM, Iglesia FDL, Lafforgue G, Lali´c J, Pròsper À, Tromas N, Zwart MP (2011) The evolutionary genetics of emerging plant RNA viruses. Mol Plant Microbe Interact 24:287–293. https://doi.org/10.1094/mpmi-09-10-0214 Escriu F, Fraile A, García-Arenal F (2000) Evolution of virulence in natural populations of the satellite RNA of cucumber mosaic virus. Phytopathology 90:480–485. https://doi.org/10.1094/ phyto.2000.90.5.480 Garcia-Ruiz H (2018) Susceptibility genes to plant viruses. Viruses 10:484. https://doi.org/10.3390/ v10090484 Hamada H, Linghu Q, Nagira Y, Miki R, Taoka N, Imai R (2017) Author correction: an in planta biolistic method for stable wheat transformation. Sci Rep 7. https://doi.org/10.1038/s41598-01717188-2 Hashimoto M, Neriya Y, Yamaji Y, Namba S (2016) Recessive resistance to plant viruses: potential resistance genes beyond translation initiation factors. Front Microbiol 7. https://doi.org/10.3389/ fmicb.2016.01695 He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y (2018) Programmed self-elimination of the CRISPR/Cas9 construct greatly accelerates the isolation of edited and transgene-free rice plants. Mol Plant 11:1210–1213. https://doi.org/10.1016/j.molp.2018.05.005 Hull R (2014). Plant Virol. https://doi.org/10.1016/c2010-0-64974-1 Ivancie-Ba´ce I, Cass SD, Wearne SJ, Bolt EL (2015) Different genome stability proteins underpin primed and naïve adaptation in E. coli CRISPR-Cas immunity. Nucleic Acids Res 43:10821– 10830. https://doi.org/10.1093/nar/gkv1213 Ji X, Si X, Zhang Y, Zhang H, Zhang F, Gao C (2018) Conferring DNA virus resistance with high specificity in plants using virus-inducible genome-editing system. Genome Biol 19:197–203. https://doi.org/10.1186/s13059-018-1580-4 Ji X, Zhang H, Zhang Y, Wang Y, Gao C (2015) Establishing a CRISPR–Cas-like immune system conferring DNA virus resistance in plants. Nat Plants 1. https://doi.org/10.1038/nplants.2015.144 Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dualRNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821. https:// doi.org/10.1126/science.1225829 Karasev AV, Gray SM (2013) Continuous and emerging challenges of potato virus Y in potato. Annu Rev Phytopathol 51:571–586. https://doi.org/10.1146/annurev-phyto-082712-102332 Kim H, Kim S-T, Ryu J, Kang B-C, Kim J-S, Kim S-G (2017) CRISPR/Cpf1-mediated DNA-free plant genome editing. Nat Commun 8:14406. https://doi.org/10.1038/ncomms14406 Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim Y-H, Lee K, Jung I, Kim D, Kim S, Kim J-S (2018) Directed evolution of CRISPR-Cas9 to increase its specificity. Nat Commun 9. https://doi.org/ 10.1038/s41467-018-05477-x Liang Z, Chen K, Li T, Zhang Y, Wang Y, Zhao Q, Liu J, Zhang H, Liu C, Ran Y, Gao C (2017) Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat Commun 8. https://doi.org/10.1038/ncomms14261 Liang Z, Chen K, Zhang Y, Liu J, Yin K, Qiu J-L, Gao C (2018) Genome editing of bread wheat using biolistic delivery of CRISPR/Cas9 in vitro transcripts or ribonucleoproteins. Nat Protoc 13:413–430. https://doi.org/10.1038/nprot.2017.145 Liu H, Soyars CL, Li J, Fei Q, He G, Peterson BA, Meyers BC, Nimchuk ZL, Wang X (2018) CRISPR/Cas9-mediated resistance to cauliflower mosaic virus. Plant Direct 2. https://doi.org/10. 1002/pld3.47

94

A. Roy et al.

Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM (2013) RNAguided human genome engineering via Cas9. Science 339:823–826. https://doi.org/10.1126/sci ence.1232033 Malnoy M, Viola R, Jung M-H, Koo O-J, Kim S, Kim J-S, Velasco R, Kanchiswamy CN (2016) DNA-free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Front Plant Sci 7. https://doi.org/10.3389/fpls.2016.01904 Mansoor S (2003) Geminivirus disease complexes: an emerging threat. Trends Plant Sci 8:128–134. https://doi.org/10.1016/s1360-1385(03)00007-4 Mehta D, Stürchler A, Anjanappa RB, Zaidi SS-E-A, Hirsch-Hoffmann M, Gruissem W, Vanderschuren H (2019) Linking CRISPR-Cas9 interference in cassava to the evolution of editing-resistant geminiviruses. Genome Biol 20. https://doi.org/10.1186/s13059-019-1678-3 Moissiard G, Voinnet O (2006) RNA silencing of host transcripts by cauliflower mosaic virus requires coordinated action of the four Arabidopsis Dicer-like proteins. Proc Natl Acad Sci 103:19593–19598. https://doi.org/10.1073/pnas.0604627103 Nicaise VR (2014) Crop immunity against viruses: outcomes and future challenges. Front Plant Sci 5. https://doi.org/10.3389/fpls.2014.00660 Pallas V, Garcia JA (2011) How do plant viruses induce disease? Interactions and interference with host components. J Gen Virol 92:2691–2705. https://doi.org/10.1099/vir.0.034603-0 Palukaitis P, García-Arenal F (2003) Cucumoviruses. In: Advances in virus research, pp 241–323. https://doi.org/10.1016/s0065-3527(03)62005-1 Price AA, Sampson TR, Ratner HK, Grakoui A, Weiss DS (2015) Cas9-mediated targeting of viral RNA in eukaryotic cells. Proc Natl Acad Sci 112:6164–6169. https://doi.org/10.1073/pnas.142 2340112 Ran FA, Hsu PD, Lin C-Y, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang F (2013) Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380–1389. https://doi.org/10.1016/j.cell.2013.08.021 Romay G, Bragard C (2017) Antiviral defenses in plants through genome editing. Front Microbiol 8. https://doi.org/10.3389/fmicb.2017.00047 Rousseau BA, Hou Z, Gramelspacher MJ, Zhang Y (2018) Programmable RNA cleavage and recognition by a natural CRISPR-Cas9 system from Neisseria meningitidis. Mol Cell 69. https:// doi.org/10.1016/j.molcel.2018.01.025 Roy A, Zhai Y, Ortiz J, Neff M, Ml M, Mukherjee SK, Pappu HR (2019) Multiplexed editing of a begomovirus genome restricts escape mutant formation and disease development. PLoS ONE. https://doi.org/10.1371/journal.pone.0223765 Sampson TR, Saroj SD, Llewellyn AC, Tzeng Y-L, Weiss DS (2013) A CRISPR/Cas system mediates bacterial innate immune evasion and virulence. Nature 497:254–257. https://doi.org/10.1038/ nature12048 Sanan-Mishra N, Chakraborty S, Gupta D, Mukherjee SK (2017) RNAi suppressors: biology and mechanisms. In: Plant epigenetics RNA technologies, pp 199–230. https://doi.org/10.1007/9783-319-55520-1_11 Sastry KS, Zitter TA (2014) Management of virus and viroid diseases of crops in the tropics. In: Plant virus and viroid diseases in the tropics, pp 149–480. https://doi.org/10.1007/978-94-0077820-7_2 Slaymaker IM, Gao L, Zetsche B, Scott DA, Yan WX, Zhang F (2015) Rationally engineered Cas9 nucleases with improved specificity. Science 351:84–88. https://doi.org/10.1126/science. aad5227 Smargon AA, Cox DB, Pyzocha NK, Zheng K, Slaymaker IM, Gootenberg JS, Abudayyeh OA, Essletzbichler P, Shmakov S, Makarova KS, Koonin EV, Zhang F (2017) Cas13b is a type VI-B CRISPR-associated RNA-guided RNase differentially regulated by accessory proteins Csx27 and Csx28. Mol Cell 65. https://doi.org/10.1016/j.molcel.2016.12.023 Smith NA, Eamens AL, Wang M-B (2011) Viral small interfering RNAs target host genes to mediate disease symptoms in plants. PLoS Pathog 7. https://doi.org/10.1371/journal.ppat.1002022

3 Virus-Free Improved Food in the Era of Bacterial Immunity

95

Soosaar JLM, Burch-Smith TM, Dinesh-Kumar SP (2005) Mechanisms of plant resistance to viruses. Nat Rev Microbiol 3:789–798. https://doi.org/10.1038/nrmicro1239 Strutt SC, Torrez RM, Kaya E, Negrete OA, Doudna JA (2018) RNA-dependent RNA targeting by CRISPR-Cas9. eLife 7. https://doi.org/10.7554/elife.32724 Svitashev S, Schwartz C, Lenderts B, Young JK, Cigan AM (2016) Genome editing in maize directed by CRISPR–Cas9 ribonucleoprotein complexes. Nat Commun 7. https://doi.org/10.1038/ ncomms13274 Tripathi JN, Ntui VO, Ron M, Muiruri SK, Britt A, Tripathi L (2019) CRISPR/Cas9 editing of endogenous banana streak virus in the B genome of Musa spp. overcomes a major challenge in banana breeding. Commun Biol 2. https://doi.org/10.1038/s42003-019-0288-7 Tycko J, Myer VE, Hsu PD (2016) Methods for optimizing CRISPR-Cas9 genome editing specificity. Mol Cell 63:355–370. https://doi.org/10.1016/j.molcel.2016.07.004 Varma A, Malathi VG (2003) Emerging geminivirus problems: a serious threat to crop production. Ann Appl Biol 142:145–164. https://doi.org/10.1111/j.1744-7348.2003.tb00240.x Voloudakis AE, Holeva MC, Peter Sarin L, Bamford DH, Vargas M, Poranen MM, Tenllado F, Sarin LP, Tenllado F (2015) Efficient double-stranded RNA production methods for utilization in plant virus control. Methods Mol Biol 1236:255–274 Wang F, Wang L, Zou X, Duan S, Li Z, Deng Z, Luo J, Lee SY, Chen S (2019) Advances in CRISPRCas systems for RNA targeting, tracking and editing. Biotechnol Adv 37:708–729. https://doi. org/10.1016/j.biotechadv.2019.03.016 Weber G (2013) TfReg: calculating DNA and RNA melting temperatures and opening profiles with mesoscopic models. Bioinformatics 29:1345–1347. https://doi.org/10.1093/bioinformatics/ btt133 Weber G (2014) Optimization method for obtaining nearest-neighbour DNA entropies and enthalpies directly from melting temperatures. Bioinformatics 31:871–877. https://doi.org/10. 1093/bioinformatics/btu751 Woo JW, Kim J, Kwon SI, Corvalán C, Cho SW, Kim H, Kim S-G, Kim S-T, Choe S, Kim J-S (2015) DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33:1162–1164. https://doi.org/10.1038/nbt.3389 Yan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, Scott DA (2018) Cas13d is a compact RNA-targeting type VI CRISPR effector positively modulated by a WYL-domaincontaining accessory protein. Mol Cell 70. https://doi.org/10.1016/j.molcel.2018.02.028 Yasmeen A, Mirza B, Inayatullah S, Safdar N, Jamil M, Ali S, Choudhry MF (2008) In planta transformation of tomato. Plant Mol Biol Rep 27:20–28. https://doi.org/10.1007/s11105-0080044-5 Yin K, Han T, Xie K, Zhao J, Song J, Liu Y (2019) Engineer complete resistance to cotton leaf curl Multan virus by the CRISPR/Cas9 system in Nicotiana benthamiana. Phytopathol Res 1. https:// doi.org/10.1186/s42483-019-0017-7 Younis A, Siddique MI, Kim C-K, Lim K-B (2014) RNA interference (RNAi) induced gene silencing: a promising approach of hi-tech plant breeding. Int J Biol Sci 10:1150–1158. https:// doi.org/10.7150/ijbs.10452 Zaidi SS-E-A, Mansoor S (2017) Viral vectors for plant genome engineering. Front Plant Sci 8. https://doi.org/10.3389/fpls.2017.00539 Zerbini FM, Briddon RW, Idris A, Martin DP, Moriones E, Navas-Castillo J, Rivera-Bustamante R, Roumagnac P, Varsani A (2017) ICTV virus taxonomy profile: geminiviridae. J Gen Virol 98:131–133. https://doi.org/10.1099/jgv.0.000738 Zhan X, Zhang F, Zhong Z, Chen R, Wang Y, Chang L, Bock R, Nie B, Zhang J (2019) Generation of virus-resistant potato plants by RNA genome targeting. Plant Biotechnol J 17:1814–1822. https://doi.org/10.1111/pbi.13102 Zhang C, Konermann S, Brideau NJ, Lotfy P, Wu X, Novick SJ, Strutzenberg T, Griffin PR, Hsu PD, Lyumkis D (2018a) Structural basis for the RNA-guided ribonuclease activity of CRISPR-Cas13d. Cell 175. https://doi.org/10.1016/j.cell.2018.09.001

96

A. Roy et al.

Zhang T, Zheng Q, Yi X, An H, Zhao Y, Ma S, Zhou G (2018b) Establishing RNA virus resistance in plants by harnessing CRISPR immune system. Plant Biotechnol J 16:1415–1423. https://doi. org/10.1111/pbi.12881 Zhang T, Zhao Y, Ye J, Cao X, Xu C, Chen B, An H, Jiao Y, Zhang F, Yang X, Zhou G (2019) Establishing CRISPR/Cas13a immune system conferring RNA virus resistance in both dicot and monocot plants. Plant Biotechnol J 17:1185–1187. https://doi.org/10.1111/pbi.13095

Chapter 4

Host-Induced Gene Silencing (HIGS): An Emerging Strategy for the Control of Fungal Plant Diseases Manchikatla V. Rajam and Sambhavana Chauhan

Abstract Fungal pathogens are the important bio-agents that cause severe diseases in plants like blight, anthracnose, rots, mildews, wilting, rusts, and many more. Due to the progression and fast spreading of disease, several nations face huge economic loss due to loss in crop productivity. This has made the threatening image to the food security sectors, and therefore a demand for technology that is fast and robust for disease management in crop plants has risen. RNA interference (RNAi) approach has been shown to be a potent and novel alternative for disease control by expressing small RNAs (sRNAs) against a vital pathogen gene. Recently, inter-kingdom cross-talk of sRNAs between plants and fungi has been identified as bidirectional, where plant express sRNAs to gain resistance against pathogen and pathogen suppresses the RNAi-derived immunity in the host. In this regard, Host Induced Gene Silencing (HIGS) has shown promising results where host-derived immunity is attained by rendering small interfering RNAs (sRNA) into the pathogen for silencing of the targeting genes that are involved in pathogenicity and virulence. This strategy has been exploited to explain the transfer of sRNAs from the host plant to fungal pathogens by utilizing RNAi machinery to suppress the target genes and thereby inhibit the growth of pathogen and control disease spread. In this review, we have discussed the mechanism by which plants endure immunity against fungal pathogens using HIGS and sRNA cross-talk between host plants and pathogens in disease management. Keywords RNA interference · Host-induced gene silencing · Small RNA trafficking · Environmental RNAi · Fungal pathogens · Plant disease control

M. V. Rajam (B) · S. Chauhan Department of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021, India e-mail: [email protected] S. Chauhan e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_4

97

98

M. V. Rajam and S. Chauhan

4.1 Introduction Plants being immobile have to face the extremely harsh environmental conditions or nature’s fury than any other living organism, which led to their evolution that has brought up physical, chemical and biological changes to cope with the stressed conditions (Bohnert et al. 1995; Munné-Bosch 2005). But still, the biotic stresses cause immense loss to crop productivity, which is directly affecting the feeding of a large population. Hunger, the biggest threat to humanity has brought up agricultural scientists together across the world to work towards crop improvement in terms of the high quality and quantity of food crops at a minimum price. To fight against fungal pathogens, many practices have been adapted, including the crop rotation to increase the soil nutrients and inhibit the growth of harmful microbes (Curl 1963; Hendrix et al. 1992), fungicide spraying in the field (Waard et al. 1993), and plant breeding for gaining resistance by screening and selecting the desired trait (Singh et al. 2018). But none of the strategies gave promising results as crop rotation involved time and resources in growing the non-essential crops (Chongtham et al. 2017), the use of agrochemicals has serious health implications for humans and the environment (Waard et al. 1993; Hirooka and Ishii 2013). Although plant breeding is a potential and sustainable approach to create variations by fixing the gene of interest in the desired plant background, it is intense, laborious, time-consuming as it involves generations to fix the trait and widely dependent on the gene pool of limited resistant cultivars (Bradshaw 2017). Because of the small life cycle and high selection pressure, the pathogens evolved faster than the host plants and the non-virulent strains undergoes mutations or gain virulence factor by horizontal gene transfer from virulent strains (Möller and Stukenbrock 2017). Therefore, there is an urgent need for a fast, robust, and cost-effective approach to boost plant immunity for imparting pathogen resistance within host plants. Recently, RNA interference (RNAi) has proven to be a promising approach to understand the cross-talk between host plants and pathogens for crop improvement and disease management (Kamthan et al. 2015; Cai et al. 2018a, 2019). RNAi has been exploited to raise transgenic cropsexpressingdsRNA [small interfering RNA (siRNA)] to gain resistance against viruses (Pooggin et al. 2003; Bonfim et al. 2007; Shimizu et al. 2009; Patil et al. 2011), fungal pathogens (Nowara et al. 2010; Koch et al. 2013; Pliego et al. 2013; Ghag et al. 2014; Sanju et al. 2015; Dou et al. 2020; Singh et al. 2020), nematodeparasites (Huang et al. 2006; Fairbairn et al. 2007) and insect pests (Mao et al. 2007; Kumar et al. 2012; Hajeri et al. 2014). This ensured host-derived immunity against biotic agents or hostderived gene silencing (HIGS) of important pathogenic genes within the host plant by expressing siRNAs processed from dsRNA. HIGS has opened up a new platform to raise pathogen-resistant plants by targeting pathogen-specific genes without introducing foreign protein in the host plant, which may be advantageous as it is very unlikely that the pathogen would gain resistance (Rajam 2012; Mamta and Rajam 2017).

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

99

This review has highlighted the research conducted so far on HIGS as an approach to generate fungal pathogen-resistant plant transgenics and trafficking of sRNAs between host plants and fungal pathogens.

4.2 Gene Silencing Mechanism of RNAi The plant has RNAi-based defense mechanism or intrinsic immunity against viruses, which was first demonstrated by Dougherty et al. (1994) where they have challenged transgenic tobacco with the virus and conferred resistance by complementarity based degradation of viral RNA. Later, Ratcliff and group (Ratcliff et al. 1997) explained that viruses are the initiators of plant RNAi as an antiviral response. This host-induced immunity against the deadly viruses was taken forward to host induced gene silencing (HIGS) approach by raising transgenic plants resistant to pathogens by expressing dsRNA using RNAi construct harboring pathogen-specific gene. RNAi was first studied as co-suppression of transgene along with homologous endogene when tried to overexpress chalcone synthase (chsA) gene in petunia (Napoli et al. 1990). It was discovered that the expression of dsRNA against unc22 in Caenorhabditis elegans has resulted in a twitching phenotype as a loss-of-function effect (Fire et al. 1998). RNAi is a phenomenon by which the gene expression is prevented at transcriptional (Transcriptional Gene Silencing or TGS) or post-transcriptional level (Post-transcriptional gene silencing or PTGS) by expressing the dsRNA against the homologous sequence. The RNAi-mediated PTGS of GUS and GFP in Nicotiana tabaccum transgenic lines was effective with a significant reduction in transcript levels and accumulation of 25 bp antisense RNA against the target mRNAs (Hamilton and Baulcombe 1999). HIGS works by in planta expression of dsRNA by transforming RNAi-hp construct using Agrobacterium or viruses against the pathogen-specific genes in the host plant. The small RNAs (sRNAs) or small interfering RNAs (siRNAs) produced from dsRNA targets and down-regulate the expression of cognate mRNAs in the pathogen and thereby controls the disease spread. The sRNAs undergo TGS: DNA methylation of cis-elements in the promoter region or PTGS: silencing of transcripts in the cytoplasm to alter the expression levels, depending on the size of the sRNA produced from 21 to 25 bp (Hamilton et al. 2002). Based on biogenesis sRNAs are divided into siRNAs and miRNAs (Hammond et al. 2000; Zamore et al. 2000). The dsRNA formed from endogene or transgene, exported to the cytoplasm where it is recognized by RNase III, Dicer or Dicer-like (DCL1) protein that has four domains named as C-terminus dsRNA-binding domain, aminoterminal-helicase domain, and two catalytic domains RNase III motifs and PAZ domain (Bernstein et al. 2001). The RNase III domain from bacterial produces the 11 bp nucleotides whereas the presence of two subunits of the catalytic domain generates 21–22 bp stretch of siRNA duplex (Blaszczyk et al. 2001). The siRNA duplex is then loaded to a multiprotein complex called RNA-induced silencing complex or RISC (Hammond et al. 2000; Nykänen et al. 2001). R2D2 in Drosophila and RDE-4 in C. elegans were utilized to explain the siRNA loading to RISC (Liu et al. 2003) and unwinding

100

M. V. Rajam and S. Chauhan

of siRNA requires ATP as a source of energy to catalyze the reaction (Nykänen et al. 2001). The RISC retained the antisense strand of siRNA duplex and the whole complex scan for sequence homology and target the cognate mRNAs (Martinez et al. 2002; Schwarz et al. 2002). The RISC associates with Argonaute protein with PAZ and PIWI domains (Cerutti 2000) where PAZ is RNA binding domain (Lingel et al. 2003; Song et al. 2003; Yan et al. 2003) and PIWI has an RNase H activity (Liu et al. 2004; Song et al. 2004). Together the entire complex leads to endonucleolytic cleavage of the siRNA and mRNA hybridized strands from the center of the siRNA strand and thereby exposing the unprotected ends of mRNAs for subsequent degradation by the exonucleases present in the cytosol (Elbashir et al. 2001; Martinez et al. 2002) (Fig. 4.1).

Fig. 4.1 RNAi-mediated gene silencing mechanism. Source Tamilarasan and Rajam (2013)

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

101

The RNAi silencing signal is amplified by RNA dependent RNA Polymerase (RdRPs) in C. elegans called transitive RNAi, where siRNAs act as the primers (based on stringent 5 polarity) for amplification of the dsRNA and the amplified dsRNA is cleaved by Dicer to form secondary siRNAs (Sijen et al. 2001). The presence of these RdRPs enhances the PTGS of pathogen-specific genes and makes the RNAi more effective. The homologs of RdRPs from tomato (Solanum lycopersicum) were isolated (Schiebel et al. 1993a, b, 1998) and it was found that RdRPs in Nicotiana and Arabidopsis amplify target gene to synthesize dsRNA by utilizing the primary siRNAs from either 5 end or 3 end for secondary siRNA production (Vaistij et al. 2002). The perusal of literature shows that RNAi is involved in plethora of important physiological functions such as defense mechanism, translocation of mobile genetic elements and epigenetic changes, cell cycle regulation, and developmental pathways (Collins et al. 1989; Lindbo et al. 1993; Tabara et al. 1999; Grishok et al. 2000; Volpe et al. 2003; Liu et al. 2007; Segers et al. 2007; Cervantes et al. 2013; Torres-Martínez and Ruiz-Vázquez 2017). RNAi has proven to be a potential tool for functional genomics studies in fungi (Kadotani et al. 2003; Goldoni et al. 2004; Khatri and Rajam 2007; Barnes et al. 2008; Nakayashiki and Nguyen 2008; de Haro et al. 2009; Chang et al. 2012; Dumesic et al. 2013) and other systems (Matthew 2004; Scherr and Eder 2004; Sugimoto 2004; Rosso et al. 2009; Bellés 2010; McGinnis 2010).

4.3 HIGS: An Emerging Approach for Fungal Disease Control in Plants Fungal pathogens cause a significant yield loss (more than 70%) of crop plants globally. Currently, RNAi or HIGS based approaches are being used not only for functional genomics studies but also for the development of fungal resistant crop plants (Qi et al. 2019). HIGS involves the silencing of vital genes in plant pathogens by expressing dsRNA using hairpin RNAi construct against specific genes of the pathogen in the host plant (Rajam 2012; Qi et al. 2019). In other words, siRNAsderived from the expressed dsRNA in the host plant silence the genes of the target pathogens. The concept of HIGS for the control of fungal pathogens in plants is schematically represented in Fig. 4.2. There is number of reports of the use of HIGS for the control of a variety of fungal pathogens in crop plants. Brachypodium distachyon and wheat transgenics expressing dsRNA against protein kinases (Fg00677 and Fg08731) and β-1, 3-glucan synthase (Gls1) of F. graminearum and F. culmorum showed reduced pathogenicity by altering the expression levels of the pathogen-specific genes and thereby gained resistance against Fusarium Head Blight disease, respectively (Chen et al. 2016; He et al. 2019). Similarly, wheat T2 transgenics lines expressing RNAi constructs or dsRNA against MAPK1 and CYC1 of Puccinia triticina showed resistance against leaf rust infection by reducing the severity of infection (Panwar et al. 2018). Targeting pathogen-specific

102

M. V. Rajam and S. Chauhan

RNAi

Fusarium oxysporum Target Gene, e.g., ODC (key gene Involved in Polyamine Biosynthesis)

RNAi Cloning of target fungal gene & making RNAi construct

At mediated Tomato transformation with Hair-pin RNAi construct Challenging of transgenic plants with fungal spores and up-take of siRNAs by invading fungal pathogen

Arrest of fungal growth and disease establishment Fungal resistant Tomato plant

Activation of RNAi machinary & target mRNA degradation in the fungi

Fig. 4.2 The concept of HIGS for developing fungal resistant crop plants

MAP kinase conferred resistance against Puccinia triticina, Rhizoctonia solani and P. striiformis, and it was shown to be a vital target for HIGS in controlling rust and sheath blight disease in wheat and rice, respectively (Tiwari et al. 2017; Zhu et al. 2017b; Panwar et al. 2018). The banana cultivars gained resistance against deadly Fusarium wilt disease by expressing ihpRNA and hpRNA against pathogen-specific C-24 sterol methyltransferase (ERG6), cyto-chrome P450 lanosterol C-14a-demethylase (ERG11), Velvet (VEL), and Fusarium transcription factor 1 (FTF1) in the transgenic lines and showed effective RNAi mediated silencing of F. oxysporum sp. cubense genes (Ghag et al. 2014; Dou et al. 2020). Similarly, tomato wilt disease was controlled by expressing hpRNA construct against FOW2, chsV and ODC in tomato (Bharti et al. 2017; Singh et al. 2020). HIGS was shown effective in controlling V. dahliae from colonizing Arabidopsis, Nicotiana, tomato, and cotton plants by targeting hydrophobins (VdH1), adenylate kinase (AK), Ave1, Sge1, NLP1, and G protein signaling gene (VdRGS1) and inhibited growth of F. verticillioides and barley powdery mildew Blumeria graminis by suppressing disease progression (Nowara et al. 2010; Tinoco et al. 2010; Zhang et al. 2016; Song and Thomma 2018; Xu et al. 2018; Su et al. 2020). The Oomycetes Phytopthora infestans, is a devastating fungal pathogen that has evolved to suppress the plant immunity by releasing effector molecules within the host and targeting one of the important effector molecules Ar3a using RNAi showed resistance against late blight disease in potato (Sanju et al. 2015). Similarly, other Puccinia species affecting wheat were controlled by RNAi-mediated

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

103

targeting of MAPK, cyclophilin, calcineurin regulatory subunit, PsFUZ7, and CPK1 (Panwar et al. 2013, 2018; Zhu et al. 2017b; Qi et al. 2018; Dubey et al. 2019). In maize, aflatoxin contamination was reduced by targeting versicolorin dehydrogenase, alpha-amylase (amy1), and aflatoxin biosynthesis transcription factor (aflR) genes of Aspergillus flavus (Masanga et al. 2015; Gilbert et al. 2018; Raruang et al. 2020). Majumdar et al. (2017) have reviewed the importance of RNAi for the control of mycotoxins contamination in crop plants. HIGS is an effective approach to deliver resistance in plants against a different range of pathogens by targeting the vital genes as summarized in Table 4.1.

4.4 Small RNA Trafficking and Environment RNA Application for Fungal Disease Control in Plants RNAi is well reported in plants (Elmayan et al. 1998; Dalmay et al. 2000; Mourrain et al. 2000) and fungi (Cogoni and Macino 1997, 1999; Catalanotto et al. 2002). Plants use RNAi for antiviral defense which was later shown to be suppressed by potyvirus (Pruss et al. 1997; Vance and Vaucheret 2001). HIGS mediated silencing of pathogen-specific genes increased resistance in plants (as discussed in the above section) and the silencing signals were translocated from plants to the pathogen. This suggested the cross-kingdom transfer of sRNAs for defense in host plant and pathogen interactions (Jin and Guo 2018; Wang and Dean 2020; Weiberg et al. 2014). The pathogens also deliver sRNAs into the host plant to suppress plant triggered immunity by RNAi (Knip et al. 2014; Wang et al. 2015). The cross-talk between the organisms is bidirectional as the plant evolves for defense against pathogens (Cai et al. 2018a, b, 2019) (Fig. 4.3) and pathogens like Botrytis cinerea evolved for penetrance, virulence, and development (Weiberg et al. 2014). It was also reported that cotton plants increase the accumulation of miR166 and miR159, which can be exported to the fungal hyphae for specific silencing of virulence genes in response to infection with Verticillium dahlia. Wang and Dean (2020) discussed several mechanisms for sRNAs trafficking and described evidence for their transport through naked form, combined with RNA-binding proteins or enclosed by vesicles. The sRNAs regulate defense in plants by activating PTI or PAMP triggered immunity (Li et al. 2010; Zhang et al. 2011) and ETI or effector-triggered immunity (Zhai et al. 2011; Shivaprasad et al. 2012). The expression of sRNAs either up-regulates or downregulates in response to pathogen attack to release a defense signal (Ruiz-Ferrer and Voinnet 2009; Weiberg and Jin 2015). Upon Pseudomonas syringae infection, the miR393 loaded on AGO2 and suppress the expression of MEMB12 in host plant and supports the secretion of pathogenesis-related proteins (Zhang et al. 2011). Whereas, AGO1 is a positive regulator of plant immunity and interacts with the sense strand of miR393 to target Auxin receptor in defense to bacterial infection (Navarro et al. 2006). The B. cinerea produces sRNAs against DCL1 and DCL2 of Arabidopsis

Capsicum annuum L.

Colletotrichum gloeosporioides

Oryza sativa

Brachypodium distachyon

Arabidopsis thaliana

Zea mays B104

Triticum aestivum cv. Thatcher

Arabidopsis thaliana and Solanum lycopersicum

Gossypium hirsutum

Magnaporthe oryzae

Fusarium graminearum

Botrytis cinerea

Aspergillus flavus

Puccinia trticina

Verticillium dahliae

Verticillium dahlia

Fusarium oxysporum f. sp. lycopersici Solanum lycopersicum

Adenylate kinase (AK)

Zn(II)2Cys6 family putative transcription regulator (FOW2)

G protein signalling gene (VdRGS1)

NLP1

Sge1

Ave1

Calcineurin regulatory subunit

Cyclophilin

MAPK

Alpha-amylase (amy1)

Target of rapamycin (TOR)

Casein kinase I (CK1)

Casein kinase II (CK2)

Activator protein (AP1)

Ornithine decarboxylase (ODC)

Nicotiana benthamiana

Versicolorin dehydrogenase

Verticillium dahliae

Zea mays L.

Conidial morphology 1 (COM1)

Cyto-chrome P450 lanosterol C-14a-demethylase (ERG11)

C-24 sterol methyltransferase (ERG6)

Targeted gene

Fusarium oxysporum f. sp. lycopersici Solanum lycopersicum

Aspergillus flavus

Musa spp.

Fusarium oxysporum f. sp. Cubense TR4

Solanum lycopersicum

Host

Pathogen

Table 4.1 Summary of work done on HIGS based approaches for plant fungal disease control Source

Bharti et al. (2017)

Xu et al. (2018)

(continued)

Song and Thomma (2018)

Panwar et al. (2013) and Panwar et al. (2018)

Gilbert et al. (2018)

Xiong et al. (2019)

He et al. (2019)

Guo et al. (2019)

Su et al. (2020)

Singh et al. (2020)

Raruang et al. (2020)

Mahto et al. (2020)

Dou et al. (2020)

104 M. V. Rajam and S. Chauhan

Triticum aestivum

Triticum aestivum

Sclerotinia sclerotiorum

Spring wheat Triticum aestivum cv. Apogee

Gossypium

Rhizoctonia solani

Triticum aestivum L. Yangmai 15

Lactuca sativa L

Arabidopsis thaliana

Nicotiana tabacum ‘Xanthi’

Fusarium culmorum

Verticillium dahliae

Festuca arundinacea Schreb

Fusarium graminearum

Bremia lactucae

Fusarium oxysporum f. sp. conglutinans

Oryza sativa

Rhizoctonia solani

Puccinia striiformis f. sp. tritici

Triticum aestivum

Puccinia striiformis f. sp. tritici

Rhizoctonia cerealis

Host

Pathogen

Table 4.1 (continued)

12-oxophytodienoate-10,11-reductase gene (OPR)

F. oxysporum Wilt 2 (FOW2)

F-box protein Required for Pathogenicity 1 (FRP1)

Cellulose Synthase (CES1)

Highly Abundant Message 34 (HAM34)

Chitin synthase (Chs) 3b

Ubiquitin E3 ligase

Cohesin complex subunit Psm1

Importin beta-1 subunit

RNA polymerase

Hu et al. (2015)

(continued)

Govindarajulu et al. (2015)

Cheng et al. (2015)

Zhou et al. (2016)

Zhang et al. (2016)

Chen et al. (2016)

Verticillium dahliae hygrophobins1 (VdH1)

Andrade et al. (2016)

β-1, 3-glucan synthase gene Gls1

Zhu et al. (2017b)

Zhu et al. (2017a)

Tiwari et al. (2017)

Qi et al. (2018)

Source

Chitin synthase (chs)

MAPKK Gene PsFUZ7

NB-LRR gene RCR1

Pathogenecity MAP kinase (PMK1 and PMK2)

CPK1, a PKA catalytic subunit gene

Chitin synthase V (chsV)

Targeted gene

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy … 105

Kufri Khyati and Kufri Pukhraj

Musa spp.

Hordeum vulgare

Hordeum vulgare

Hordeum vulgare cv Golden Promise 1,3-b-glucanosyltransferase 1

Phytophthora infestans

Fusarium oxysporum f. sp. cubense

Fusarium graminearum

Blumeria graminis f. sp. hordei

Blumeria graminis

Hordeum vulgare cv pallas

Hordeum vulgare cv I mlo5

Zea Mays

Aspergillus flavus

Avra10

40S Ribosomal protein

Endosomal cargo receptor

Vacuolar Ser protease

NADH-ubiquinone oxidoreductase

Heat shock protein 70

ADP/ATP carrier protein

Blumeraeffecror candidate (BEC1005, BEC1011 and BEC1054)

Cytochrome P450 lanosterol C-14α-demethylase (CYP51)

Fusarium transcription factor 1 (FTF1)

Velvet (VEL)

Avr3a

Aflatoxin biosynthesis transcription factor aflR

Pectinesterase (PEC)

Cellulose synthase A2 (CESA2)

Nowara et al. (2010)

Pliego et al. (2013)

Koch et al. (2013)

Ghag et al. (2014)

Sanju et al. (2015)

Masanga et al. (2015)

Source Jahan et al. (2015)

Targeted gene

Phytophthora infestans

G protein β-subunit (GPB1)

Host

Solanum tuberosum

Pathogen

Table 4.1 (continued)

106 M. V. Rajam and S. Chauhan

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

107

Fig. 4.3 Plant RNAi-mediated HIGS and interaction between a plant cell and fungal pathogen. Colonization by fungus or plant resistance depends on which organism, pathogen, or host plant, is able to overcome the defense response of the other during the host-pathogen interaction. Plant sRNAs are produced as a result of normal defense response that can cross plant and fungal barriers either through vesicles or RNA uptake transporters. The vesicles release the sRNAs after entering the fungus and initiate HIGS. Source Majumdar et al. (2017)

and tomato and suppresses the host immunity by hijacking AGO1 of plants (Wang et al. 2016). The reduction in pathogenecity was shown by applying dsRNA on the surface of fruits, flower, and leaves (Wang et al. 2016). Rhizobium also utilizes host AGO1 for targeting nodulation responsive genes and by delivering tRNA derived sRNA fragments (tRFs) into soybean and enhance nodulation (Qiao et al. 2017; Cai et al. 2019). This showed the effective cross-kingdom trafficking of sRNAs between plants and fungal pathogens (Cai et al. 2018a, b, 2019). The DNA methylation plays a crucial role in the regulation of sRNA a cross kingdom during biotic stress as A. thaliana lines with mutations in RNAdirected DNA Methylation (RdDM) genes such as methyltransferases (ddc), Pol IV subunit nrpd1a, chromatin remodeling protein (drd-1), and the dicer triple mutant (dcl2/dcl3/dcl4), showed resistance against P. syringae (Dowen et al. 2012). But the A. thaliana RdDM mutants nrpd1, nrpe1, ago4, drd1, rdr2, drm1, drm2, and nrpd2 showed susceptibility towards F. oxysporum, B. cinerea, and Plectospherella cucumerina (Lopez et al. 2011; Le et al. 2014). This suggested host-derived sRNA regulation of RdDM in CG and nonCG rich regions is essential for cross-talk between plant and pathogens, which either might be effective to control diseases or can suppress plant immunity (Weiberg and Jin 2015). The pathogen resistance attained by delivering the dsRNA produced by the transgenic plants into the pathogen has shown to be a promising approach. But in order to generate stable transgenic lines, it requires a lot of expenses, generations to grow for the stability of transgene, field trials, allergenicity testing and most importantly it has clear a regulatory process for GM plants before release. In all these procedures, it takes a lot of time and money investment. On the contrary, environment RNAi (application of dsRNA as spray) could be fruitful as it does not undergo any genomic manipulations in the crop plants and can target multiple targets and pathogens at the

108

M. V. Rajam and S. Chauhan

same time (Song et al. 2018; Wang and Jin 2017). It might reduce the selection pressure on the pathogens and slow down their rate of evolution but there is no proof of concept. If the pathogen undergoes mutations in specific genes still the gene silencing will be effective and efficient as the targeting of cognate RNA molecule does not require complete 100% complementarity (Waterhouse et al. 2001). This can easily be achieved by spraying dsRNAs as a fungicide at an optimum concentration on the plants, which will be taken up by the pathogen and induce the RNAi mediated gene silencing of endogenous genes. As, spraying dsRNA against CYP3, Myo-5, AGO, and DCL of F. asiaticum, F. graminearum, F. tricinctum and F. oxysporum on plants have shown reduced pathogenicity and controlled disease spread (Koch et al. 2016; Wang and Jin 2017; Song et al. 2018; Werner et al. 2020). The Spray-Induced Gene Silencing (SIGS) of pathogen-specific genes can be exploited further as an upcoming approach in disease control and management (Wang and Jin 2017).

4.5 Conclusions and Future Perspectives To meet the growing demands of food with an increase in population, it becomes of utmost importance to advance the technologies in order to accelerate disease management along with crop yield. HIGS has shown to be a promising approach to control disease spread in plants as it involves the strategy where the genome database information of pathogen is utilized to target the pathogen-specific genes by the host plant. The only challenge here is to identify the vital gene involved in pathogen virulence and then gene-specific targeting is achieved by selecting the off-target free region to avoid unintended effects on any beneficial organism or host plant. The targeting of genes involved in the growth and development of fungal pathogens can help in reducing the selection pressure and fast evolution among pathogens. HIGS was shown to be helpful in gaining resistance against a range of pathogens at the same time by targeting the conserved gene (Koch et al. 2013). The genomics, transcriptomics, and metabolomics databases have helped in critical scrutiny of the target genes to ensure the target specificity of RNAi-hp construct prior to the plant engineering experiments which ensure the intended results in less time. Although the HIGS derived fungal resistant promises a long-lasting approach, before the broad implementation of this technology the serious implications have to be tested like the full understanding of the mechanism by which the process can be regulated. HIGS has been widely studied in biotrophic fungi but the rendering of RNA molecules from host to pathogen in hemibiotrophic and necrotrophic has to be further enlightened with the efficacy and durability of resistance in the field. The pathogens being opportunist evolves faster in continuous combat with host plants and HIGS can help in providing durable resistance for a long time by designing silencing constructs targeting the viral gene or entire gene family of one or more pathogens at the same time. This controls the disease spread in plants and inhibit the pathogen growth and multiplication and thereby endure plant resistance.

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

109

It has been substantially demonstrated that pathogens can be controlled by sRNAs targeting their vital genes like pathogenicity genes. This strategy is based on the recent discovery that the interaction of host plants with their pathogens depends on bidirectional trafficking of sRNAs and cross-kingdom RNAi. This employs the spray of sRNA (siRNA) or dsRNA (environmental RNAi—SIGS) can be used for disease control, which appears to be eco-friendly as it is a non-transgenic approach. However, the mechanism by which pathogens and their host plants execute the transfer of sRNAs still unclear, and this warrants further studies to understand the mechanisms of sRNA movement between host plants and their interacting pathogens. Also, additional studies are required to assess the adverse effects of sRNAs, if any on humans and animals as well as environment. Acknowledgements We are grateful to the Department of Biotechnology (DBT), New Delhi for generous support for my RNAi research programs in the lab. SC acknowledges the Fellowship of Non-NET University Grants Commission (UGC), New Delhi. MVR is grateful to the UGC for the award of BSR Faculty Fellowship. We also thank the UGC for SAP (DRS-III) and DST-FIST (Level 2) programmes, and DU-DST PURSE (Phase II) grant.

References Andrade C, Tinoco M, Rieth A, Maia F, Aragão F (2016) Host-induced gene silencing in the necrotrophic fungal pathogen Sclerotinia sclerotiorum. Plant Pathol 65:626–632 Barnes SE, Alcocer MJ, Archer DB (2008) siRNA as a molecular tool for use in Aspergillus niger. Biotechnol Lett 30:885–890 Bellés X (2010) Beyond Drosophila: RNAi in vivo and functional genomics in insects. Annu Rev Entomol 55:111–128 Bernstein E, Caudy AA, Hammond SM, Hannon GJ (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363–366 Bharti P, Jyoti P, Kapoor P, Sharma V, Shanmugam V, Yadav SK (2017) Host-induced silencing of pathogenicity genes enhances resistance to Fusarium oxysporum wilt in tomato. Mol Biotechnol 59:343–352 Blaszczyk J, Tropea JE, Bubunenko M, Routzahn KM, Waugh DS, Court DL, Ji X (2001) Crystallographic and modeling studies of RNase III suggest a mechanism for double-stranded RNA cleavage. Structure 9:1225–1236 Bohnert HJ, Nelson DE, Jensen RG (1995) Adaptations to environmental stresses. Plant Cell 7:1099 Bonfim K, Faria JC, Nogueira EO, Mendes ÉA, Aragão FJ (2007) RNAi-mediated resistance to Bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris). Mol Plant-Microbe Interact 20:717–726 Bradshaw JE (2017) Review and analysis of limitations in ways to improve conventional potato breeding. Potato Res 60:171–193 Cai Q, He B, Kogel K-H, Jin H (2018a) Cross-kingdom RNA trafficking and environmental RNAi— nature’s blueprint for modern crop protection strategies. Curr Opin Microbiol 46:58–64 Cai Q, Qiao L, Wang M, He B, Lin F-M, Palmquist J, Huang S-D, Jin H (2018b) Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes. Science 360:1126–1129 Cai Q, He B, Weiberg A, Buck AH, Jin H (2019) Small RNAs and extracellular vesicles: new mechanisms of cross-species communication and innovative tools for disease control. PLoS Pathol 15:e1008090. https://doi.org/10.1371/journal.ppat.1008090

110

M. V. Rajam and S. Chauhan

Catalanotto C, Azzalin G, Macino G, Cogoni C (2002) Involvement of small RNAs and role of the qde genes in the gene silencing pathway in Neurospora. Genes Dev 16:790–795 Cerutti L (2000) Domains in gene silencing and cell differentiation proteins: the novel PAZ domain and redefinition of the Piwi domain. Trends Biochem Sci 25:481–482 Cervantes M, Vila A, Nicolás FE, Moxon S, de Haro JP, Dalmay T, Torres-Martínez S, Ruiz-Vázquez RM (2013) A single argonaute gene participates in exogenous and endogenous RNAi and controls cellular functions in the basal fungus Mucorcircinelloides. PloS ONE 8:e69283. https://doi.org/ 10.1371/journal.pone.0069283 Chang S-S, Zhang Z, Liu Y (2012) RNA interference pathways in fungi: mechanisms and functions. Annu Rev Microbiol 66:305–323 Chen W, Kastner C, Nowara D, Oliveira-Garcia E, Rutten T, Zhao Y, Deising HB, Kumlehn J, Schweizer P (2016) Host-induced silencing of Fusarium culmorum genes protects wheat from infection. J Exp Bot 67:4979–4991 Cheng W, Song XS, Li HP, Cao LH, Sun K, Qiu XL, Xu YB, Yang P, Huang T, Zhang JB (2015) Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat. Plant Biotechnol J13:1335–1345 Chongtham IR, Bergkvist G, Watson CA, Sandström E, Bengtsson J, Öborn I (2017) Factors influencing crop rotation strategies on organic farms with different time periods since conversion to organic production. Biol Agric Hortic 33:14–27 Cogoni C, Macino G (1997) Isolation of quelling-defective (qde) mutants impaired in posttranscriptional transgene-induced gene silencing in Neurosporacrassa. Proc Natl Acad Sci USA 94:10233–10238 Cogoni C, Macino G (1999) Gene silencing in Neurosporacrassa requires a protein homologous to RNA-dependent RNA polymerase. Nature 399:166–169 Collins J, Forbes E, Anderson P (1989) The Tc3 family of transposable genetic elements in Caenorhabditis elegans. Genetics 121:47–55 Curl EA (1963) Control of plant diseases by crop rotation. Bot Rev 29:413–479 Dalmay T, Hamilton A, Rudd S, Angell S, Baulcombe DC (2000) An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101:543–553 de Haro JP, Calo S, Cervantes M, Nicolás FE, Torres-Martínez S, Ruiz-Vázquez RM (2009) A single dicer gene is required for efficient gene silencing associated with two classes of small antisense RNAs in Mucorcircinelloides. Eukaryot Cell 8:1486–1497 Dou T, Shao X, Hu C, Liu S, Sheng O, Bi F, Deng G, Ding L, Li C, Dong T (2020) Host-induced gene silencing of Foc TR 4 ERG 6/11 genes exhibits superior resistance to Fusarium wilt of banana. Plant Biotechnol J 18:11–13 Dougherty W, Lindbo J, Smith H, Parks T, Swaney S, Proebsting W (1994) RNA-mediated virus resistance in transgenic plants: exploitation of a cellular pathway possibly involved in RNA degradation. Mol Plant Microbe Interact 7:544–552 Dowen RH, Pelizzola M, Schmitz RJ, Lister R, Dowen JM, Nery JR, Dixon JE, Ecker JR (2012) Widespread dynamic DNA methylation in response to biotic stress. Proc Natl Acad Sci USA 109:E2183–E2191 Dubey H, Kiran K, Jaswal R, Jain P, Kayastha AM, Bhardwaj SC, Mondal TK, Sharma TR (2019) Discovery and profiling of small RNAs from Puccinia triticina by deep sequencing and identification of their potential targets in wheat. Funct Integr Genomics 19:391–407 Dumesic PA, Natarajan P, Chen C, Drinnenberg IA, Schiller BJ, Thompson J, Moresco JJ, Yates JR III, Bartel DP, Madhani HD (2013) Stalled spliceosomes are a signal for RNAi-mediated genome defense. Cell 152:957–968 Elbashir SM, Lendeckel W, Tuschl T (2001) RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15:188–200 Elmayan T, Balzergue S, Béon F, Bourdon V, Daubremet J, Guénet Y, Mourrain P, Palauqui JC, Vernhettes S, Vialle T (1998) Arabidopsis mutants impaired in cosuppression. Plant Cell 10:1747–1757

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

111

Fairbairn DJ, Cavallaro AS, Bernard M, Mahalinga-Iyer J, Graham MW, Botella JR (2007) Hostdelivered RNAi: an effective strategy to silence genes in plant parasitic nematodes. Planta 226:1525–1533 Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806–811 Ghag SB, Shekhawat UK, Ganapathi TR (2014) Host-induced post-transcriptional hairpin RNAmediated gene silencing of vital fungal genes confers efficient resistance against Fusarium wilt in banana. Plant Biotechnol J12:541–553 Gilbert MK, Majumdar R, Rajasekaran K, Chen Z-Y, Wei Q, Sickler CM, Lebar MD, Cary JW, Frame BR, Wang K (2018) RNA interference-based silencing of the alpha-amylase (amy1) gene in Aspergillus flavus decreases fungal growth and aflatoxin production in maize kernels. Planta 247:1465–1473 Goldoni M, Azzalin G, Macino G, Cogoni C (2004) Efficient gene silencing by expression of double stranded RNA in Neurosporacrassa. Fungal Genet Biol 41:1016–1024 Govindarajulu M, Epstein L, Wroblewski T, Michelmore RW (2015) Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnol J 13:875–883 Grishok A, Tabara H, Mello CC (2000) Genetic requirements for inheritance of RNAi in C. elegans. Science 287:2494–2497 Guo X, Li Y, Fan J, Xiong H, Xu F, Shi J, Shi Y, Wang W (2019) Host-induced gene silencing of MoAP1 confers increased resistance to Magnaporthe oryzae. Front Plant Sci 10:433 Hajeri S, Killiny N, El-Mohtar C, Dawson WO, Gowda S (2014) Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorinacitri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing). J Biotechnol 176:42–49 Hamilton A, Voinnet O, Chappell L, Baulcombe D (2002) Two classes of short interfering RNA in RNA silencing. EMBO J 21:4671–4679 Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950–952 Hammond SM, BernsteinE BD, Hannon GJ (2000) An RNA-directed nuclease mediates posttranscriptional gene silencing in Drosophila cells. Nature 404:293–296 He F, Zhang R, Zhao J, Qi T, Kang Z, Guo J (2019) Host-induced silencing of Fusarium graminearum genes enhances the resistance of Brachypodium distachyon to Fusarium head blight. Front Plant Sci 10:1362 Hendrix JW, Jones K, Nesmith W (1992) Control of pathogenic mycorrhizal fungi in maintenance of soil productivity by crop rotation. J Prod Agric 5:383–386 Hirooka T, Ishii H (2013) Chemical control of plant diseases. J Gen Plant Pathol 79:390–401 Hu Z, Parekh U, Maruta N, Trusov Y, Botella JR (2015) Down-regulation of Fusarium oxysporum endogenous genes by host-delivered RNA interference enhances disease resistance. Front Chem 3:1 Huang G, Allen R, Davis EL, Baum TJ, Hussey RS (2006) Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene. Proc Natl Acad Sci USA 103:14302–14306 Jahan SN, Åsman AK, Corcoran P, Fogelqvist J, Vetukuri RR, Dixelius C (2015) Plant-mediated gene silencing restricts growth of the potato late blight pathogen Phytophthora infestans. J Exp Bot 66:2785–2794 Jin Y, Guo HS (2018) Plant small RNAs responsive to fungal pathogen infection. In: Ma W, Wolpert T (eds) Plant pathogenic fungi and oomycetes. Methods Mol Biol, vol 1848. Humana Press, New York Kadotani N, Nakayashiki H, Tosa Y, Mayama S (2003) RNA silencing in the phytopathogenic fungus Magnaporthe oryzae. Mol Plant Microbe Interact 16:769–776 Kamthan A, Chaudhuri A, Kamthan M, Datta A (2015) Small RNAs in plants: recent development and application for crop improvement. Front Plant Sci 6:208. https://doi.org/10.3389/fpls.2015. 00208

112

M. V. Rajam and S. Chauhan

Khatri M, Rajam MV (2007) Targeting polyamines of Aspergillus nidulans by siRNA specific to fungal ornithine decarboxylase gene. Med Mycol 45:211–220 Knip M, Constantin ME, Thordal-Christensen H (2014) Trans-kingdom cross-talk: small RNAs on the move. PLoS Genet 10 Koch A, Kumar N, Weber L, Keller H, Imani J, Kogel K-H (2013) Host-induced gene silencing of cytochrome P450 lanosterol C14α-demethylase–encoding genes confers strong resistance to Fusarium species. Proc Natl Acad Sci USA 110:19324–19329 Koch A, Biedenkopf D, Furch A, Weber L, Rossbach O, Abdellatef E, Linicus L, Johannsmeier J, Jelonek L, Goesmann A (2016) An RNAi-based control of Fusarium graminearum infections through spraying of long dsRNAs involves a plant passage and is controlled by the fungal silencing machinery. PLoS Pathog 12:e1005901 Kumar P, Pandit SS, Baldwin IT (2012) Tobacco virus vector: a rapid and transient means of silencing Manducasexta genes by plant mediated RNA interference. PloS One 7 Le T-N, Schumann U, Smith NA, Tiwari S, Au PCK, Zhu Q-H, Taylor JM, Kazan K, Llewellyn DJ, Zhang R (2014) DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis. Genome Biol 15:458 Li Y, Zhang Q, Zhang J, Wu L, Qi Y, Zhou J-M (2010) Identification of microRNAs involved in pathogen-associated molecular pattern-triggered plant innate immunity. Plant Physiol 152:2222– 2231 Lindbo JA, Silva-Rosales L, Proebsting WM, Dougherty WG (1993) Induction of a highly specific antiviral state in transgenic plants: implications for regulation of gene expression and virus resistance. Plant Cell 5:1749–1759 Lingel A, Simon B, Izaurralde E, Sattler M (2003) Structure and nucleic-acid binding of the Drosophila Argonaute 2 PAZ domain. Nature 426:465–469 Liu J, Carmell MA, Rivas FV, Marsden CG, Thomson JM, Song J-J, Hammond SM, JoshuaTor L, Hannon GJ (2004) Argonaute 2 is the catalytic engine of mammalian RNAi. Science 305:1437–1441 Liu Q, Rand TA, Kalidas S, Du F, Kim H-E, Smith DP, Wang X (2003) R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway. Science 301:1921–1925 Liu Y, Taverna SD, Muratore TL, Shabanowitz J, Hunt DF, Allis CD (2007) RNAi-dependent H3K27 methylation is required for heterochromatin formation and DNA elimination in Tetrahymena. Genes Dev 21:1530–1545 Lopez A, Ramírez V, Garcia-Andrade J, Flors V, Vera P (2011) The RNA silencing enzyme RNA polymerase V is required for plant immunity. PLoS Genet 7 Mahto BK, Singh A, Pareek M, Rajam MV, Dhar-Ray S, Reddy PM (2020) Host-induced silencing of the Colletotrichum gloeosporioides conidial morphology 1 gene (CgCOM1) confers resistance against Anthracnose disease in chilli and tomato. bioRxiv Majumdar R, Rajasekaran K, Cary JW (2017) RNA interference (RNAi) as a potential tool for control of mycotoxin contamination in crop plants: concepts and considerations. Front Plant Sci 8:200. https://doi.org/10.3389/fpls.2017.00200 Mamta B, Rajam M (2017) RNAi technology: a new platform for crop pest control. Physiol Mol Biol Plant 23:487–501 Mao Y-B, Cai W-J, Wang J-W, Hong G-J, Tao X-Y, Wang L-J, Huang Y-P, Chen X-Y (2007) Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol 25:1307–1313 Martinez J, Patkaniowska A, Urlaub H, Lührmann R, Tuschl T (2002) Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110:563–574 Masanga JO, Matheka JM, Omer RA, Ommeh SC, Monda EO, Alakonya AE (2015) Downregulation of transcription factor aflR in Aspergillus flavus confers reduction to aflatoxin accumulation in transgenic maize with alteration of host plant architecture. Plant Cell Rep 34:1379–1387 Matthew L (2004) RNAi for plant functional genomics. Inter J Genom 5:240–244 McGinnis KM (2010) RNAi for functional genomics in plants. Brief Funct Genom 9:111–117

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

113

Möller M, Stukenbrock EH (2017) Evolution and genome architecture in fungal plant pathogens. Nat Rev Microbiol 15:756 Mourrain P, Béclin C, Elmayan T, Feuerbach F, Godon C, Morel J-B, Jouette D, Lacombe A-M, Nikic S, Picault N (2000) Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101:533–542 Munné-Bosch S (2005) The role of α-tocopherol in plant stress tolerance. J Plant Physiol 162:743– 748 Nakayashiki H, Nguyen QB (2008) RNA interference: roles in fungal biology. Curr Opin Microbiol 11:494–502 Napoli C, Lemieux C, Jorgensen R (1990) Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2:279–289 Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JD (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312:436–439 Nowara D, Gay A, Lacomme C, Shaw J, Ridout C, Douchkov D, Hensel G, Kumlehn J, Schweizer P (2010) HIGS: host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell 22:3130–3141 Nykänen A, Haley B, Zamore PD (2001) ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 107:309–321 Panwar V, McCallum B, Bakkeren G (2013) Host-induced gene silencing of wheat leaf rust fungus Puccinia triticina pathogenicity genes mediated by the Barley stripe mosaic virus. Plant Mol Biol 81:595–608 Panwar V, Jordan M, McCallum B, Bakkeren G (2018) Host induced silencing of essential genes in Puccinia triticina through transgenic expression of RNA i sequences reduces severity of leaf rust infection in wheat. Plant Biotechnol J16:1013–1023 Patil BL, Ogwok E, Wagaba H, Mohammed IU, Yadav JS, Bagewadi B, Taylor NJ, Kreuze JF, Maruthi M, Alicai T (2011) RNAi mediated resistance to diverse isolates belonging to two virus species involved in Cassava brown streak disease. Mol Plant Pathol 12:31–41 Pliego C, Nowara D, Bonciani G, Gheorghe DM, Xu R, Surana P, Whigham E, Nettleton D, Bogdanove AJ, Wise RP (2013) Host-induced gene silencing in barley powdery mildew reveals a class of ribonuclease-like effectors. Mol Plant Microbe Interact 26:633–642 Pooggin M, Shivaprasad P, Veluthambi K, Hohn T (2003) RNAi targeting of DNA virus in plants. Nat Biotechnol 21:131–132 Pruss G, Ge X, Shi XM, Carrington JC, Vance VB (1997) Plant viral synergism: the potyviral genome encodes a broad-range pathogenicity enhancer that transactivates replication of heterologous viruses. Plant Cell 9:859–868 Qi T, Zhu X, Tan C, Liu P, Guo J, Kang Z, Guo J (2018) Host induced gene silencing of an important pathogenicity factor P s CPK 1 in Puccinia striiformis f. sp. tritici enhances resistance of wheat to stripe rust. Plant Biotechnol J 16:797–807 Qi T, Guo J, Peng H, Liu P, Kang Z, Guo J (2019) Host-induced gene silencing: a powerful strategy to control diseases of wheat and barley. Int J Mol Sci 20:206. https://doi.org/10.3390/ijms20 010206 Qiao Z, Brechenmacher L, Smith B, Strout GW, Mangin W, Taylor C, Russell SD, Stacey G, Libault M (2017) The GmFWL1 (FW2-2-like) nodulation gene encodes a plasma membrane microdomain-associated protein. Plant Cell Environ 40:1442–1455 Rajam MV (2012) Host induced silencing of fungal pathogen genes: An emerging strategy for disease control in crop plants. Cell Dev. Biol 1:e118. https://doi.org/10.4172/2168-9296.100 0e118 Raruang Y, Omolehin O, Hu D, Wei Q, Han Z-Q, Rajasekaran K, Cary JW, Wang K, Chen Z-Y (2020) Host induced gene silencing targeting Aspergillus flavus aflM reduced aflatoxin contamination in transgenic maize under field conditions. Front Microbiol 11:754 Ratcliff F, Harrison BD, Baulcombe DC (1997) A similarity between viral defense and gene silencing in plants. Science 276:1558–1560

114

M. V. Rajam and S. Chauhan

Rosso M-N, Jones J, Abad P (2009) RNAi and functional genomics in plant parasitic nematodes. Annu Rev Phytopathol 47:207–232 Ruiz-Ferrer V, Voinnet O (2009) Roles of plant small RNAs in biotic stress responses. Annu Rev Plant Biol 60:485–510 Sanju S, Siddappa S, Thakur A, Shukla PK, Srivastava N, Pattanayak D, Sharma S, Singh B (2015) Funct Integr Genom 15:697–706 Scherr M, Eder M (2004) RNAi in functional genomics. Curr Opin Mol Ther 6:129–135 Schiebel W, Haas B, Marinkovi´c S, Klanner A, Sänger H (1993a) RNA-directed RNA polymerase from tomato leaves. I. Purification and physical properties. J Biol Chem 268:11851–11857 Schiebel W, Haas B, Marinkovi´c S, Klanner A, Sänger H (1993b) RNA-directed RNA polymerase from tomato leaves. II. Catalytic in vitro properties. J Biol Chem 268:11858–11867 Schiebel W, Pélissier T, Riedel L, Thalmeir S, Schiebel R, Kempe D, Lottspeich F, Sänger HL, Wassenegger M (1998) Isolation of an RNA-directed RNA polymerase–specific cDNA clone from tomato. Plant Cell 10:2087–2101 Schwarz DS, Hutvágner G, Haley B, Zamore PD (2002) Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways. Mol Cell 10:537–548 Segers GC, Zhang X, Deng F, Sun Q, Nuss DL (2007) Evidence that RNA silencing functions as an antiviral defense mechanism in fungi. Proc Natl Acad Sci USA 104:12902–12906 Shimizu T, Yoshii M, Wei T, Hirochika H, Omura T (2009) Silencing by RNAi of the gene for Pns12, a viroplasm matrix protein of Rice dwarf virus, results in strong resistance of transgenic rice plants to the virus. Plant Biotechnol J 7:24–32 Shivaprasad PV, Chen H-M, Patel K, Bond DM, Santos BA, Baulcombe DC (2012) A microRNA superfamily regulates nucleotide binding site–leucine-rich repeats and other mRNAs. Plant Cell 24:859–874 Sijen T, Fleenor J, Simmer F, Thijssen KL, Parrish S, Timmons L, Plasterk RH, Fire A (2001) On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 107:465–476 Singh B, Mehta S, Tiwari M, Bhatia S (2018) Legume breeding for fungal resistance: a lesson to learn. Mol Approach Plant Improv 1:159–180 Singh N, Mukherjee SK, Rajam MV (2020) Silencing of the ornithine decarboxylase gene of Fusarium oxysporum f. sp. lycopersici by host-induced RNAi confers resistance to Fusarium wilt in tomato. Plant Mol Biol Rep. https://doi.org/10.1007/s11105-020-01205-2 Song J-J, Liu J, Tolia NH, Schneiderman J, Smith SK, Martienssen RA, Hannon GJ, Joshua-Tor L (2003) The crystal structure of the Argonaute 2 PAZ domain reveals an RNA binding motif in RNAi effector complexes. Nat Struct Mol Biol 10:1026–1032 Song J-J, Smith SK, Hannon GJ, Joshua-Tor L (2004) Crystal structure of Argonaute and its implications for RISC slicer activity. Science 305:1434–1437 Song XS, Gu KX, Duan XX, Xiao XM, Hou YP, Duan YB, Wang JX, Yu N, Zhou MG (2018) Secondary amplification of siRNA machinery limits the application of spray-induced gene silencing. Mol Plant Pathol 19:2543–2560 Song Y, Thomma BP (2018) Host-induced gene silencing compromises Verticillium wilt in tomato and Arabidopsis. Mol Plant Pathol 19:77–89 Su X, Lu G, Li X, Rehman L, Liu W, Sun G, Guo H, Wang G, Cheng H (2020) Host-induced gene silencing of an adenylate kinase gene involved in fungal energy metabolism improves plant resistance to Verticillium dahliae. Biomolecules 10:127 Sugimoto A (2004) High-throughput RNAi in Caenorhabditis elegans: genome-wide screens an functional genomics. Differentiation 72:81–91 Tabara H, Sarkissian M, Kelly WG, Fleenor J, Grishok A, Timmons L, Fire A Mello CC (1999) The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123–132 Tamilarasan S, Rajam MV (2013) Engineering crop plants for nematode resistance through hostderived RNA interference. Cell Dev Biol 2:2. https://doi.org/10.4172/2168-9296.1000114 Tinoco MLP, Dias BB, Dall’Astta RC, Pamphile JA, Aragão FJ (2010) In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biol 8:27

4 Host-Induced Gene Silencing (HIGS): An Emerging Strategy …

115

Tiwari IM, Jesuraj A, Kamboj R, Devanna B, Botella JR, Sharma T (2017) Host delivered RNAi, an efficient approach to increase rice resistance to sheath blight pathogen (Rhizoctonia solani). Sci Rep 7:1–14 Torres-Martínez S, Ruiz-Vázquez RM (2017) The RNAi universe in fungi: a varied landscape of small RNAs and biological functions. Annu Rev Microbiol 71:371–391 Vaistij FE, Jones L, Baulcombe DC (2002) Spreading of RNA targeting and DNA methylation in RNA silencing requires transcription of the target gene and a putative RNA-dependent RNA polymerase. Plant Cell 14:857–867 Vance V, Vaucheret H (2001) RNA silencing in plants—defense and counterdefense. Science 292:2277–2280 Volpe T, Schramke V, Hamilton GL, White SA, Teng G, Martienssen RA, Allshire RC (2003) RNA interference is required for normal centromere function in fission yeast. Chrom Res 11:137–146 Waard M, Georgopoulos S, Hollomon D, Ishii H, Leroux P, Ragsdale N, Schwinn F (1993) Chemical control of plant diseases: problems and prospects. Annu Rev Phytopathol 31:403–421 Wang M, Jin H (2017) Spray-induced gene silencing: a powerful innovative strategy for crop protection. Trends Microbiol 25:4–6 Wang M, Dean RA (2020) Movement of small RNAs in and between plants and fungi. Mol Plant Pathol 21:589–601 Wang M, Weiberg A, Jin H (2015) Pathogen small RNAs: a new class of effectors for pathogen attacks. Mol Plant Pathol 16:219–223 Wang M, Weiberg A, Lin F-M, Thomma BP, Huang H-D, Jin H (2016) Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection. Nat Plants 2:1–10 Waterhouse PM, Wang M-B, Lough T (2001) Gene silencing as an adaptive defence against viruses. Nature 411:834–842 Weiberg A, Jin H (2015) Small RNAs—the secret agents in the plant–pathogen interactions. Curr Opin Plant Biol 26:87–94 Weiberg A, Wang M, Bellinger M, Jin H (2014) Small RNAs: a new paradigm in plant-microbe interactions. Annu Rev Phytopathol 52:495–516 Werner BT, Gaffar FY, Schuemann J, Biedenkopf D, Koch AM (2020) RNA-spray-mediated silencing of Fusarium graminearum AGO and DCL genes improve barley disease resistance. Front Plant Sci 11 Xiong F, Liu M, Zhuo F, Yin H, Deng K, Feng S, Liu Y, Luo X, Feng L, Zhang S (2019) Hostinduced gene silencing of BcTOR in Botrytis cinerea enhances plant resistance to grey mould. Mol Plant Pathol 20:1722–1739 Xu J, Wang X, Li Y, Zeng J, Wang G, Deng C, Guo W (2018) Host-induced gene silencing of a regulator of G protein signalling gene (Vd RGS 1) confers resistance to Verticillium wilt in cotton. Plant Biotechnol J16:1629–1643 Yan KS, Yan S, Farooq A, Han A, Zeng L, Zhou M-M (2003) Structure and conserved RNA binding of the PAZ domain. Nature 426:469–474 Zamore PD, Tuschl T, Sharp PA, Bartel DP (2000) RNAi: double-stranded RNA directs the ATPdependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25–33 Zhai J, Jeong D-H, De Paoli E, Park S, Rosen BD, Li Y, González AJ, Yan Z, Kitto SL, Grusak MA (2011) MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs. Genes Dev 25:2540–2553 Zhang T, Jin Y, Zhao J-H, Gao F, Zhou B-J, Fang Y-Y, Guo H-S (2016) Host-induced gene silencing of the target gene in fungal cells confers effective resistance to the cotton wilt disease pathogen Verticillium dahliae. Mol Plant 9:939–942 Zhang X, Zhao H, Gao S, Wang W-C, Katiyar-Agarwal S, Huang H-D, Raikhel N, Jin H (2011) Arabidopsis Argonaute 2 regulates innate immunity via miRNA393∗-mediated silencing of a Golgi-localized SNARE gene, MEMB12. Mol Cell 42:356–366 Zhou B, Bailey A, Niblett C, Qu R (2016) Control of brown patch (Rhizoctonia solani) in tall fescue (Festuca arundinacea Schreb.) by host induced gene silencing. Plant Cell Rep 35:791–802

116

M. V. Rajam and S. Chauhan

Zhu X, Lu C, Du L, Ye X, Liu X, Coules A, Zhang Z (2017a) The wheat NB-LRR gene Ta RCR 1 is required for host defence response to the necrotrophic fungal pathogen Rhizoctonia cerealis. Plant Biotechnol J 15:674–687 Zhu X, Qi T, Yang Q, He F, Tan C, Ma W, Voegele RT, Kang Z, Guo J (2017b) Host-induced gene silencing of the MAPKK gene PsFUZ7 confers stable resistance to wheat stripe rust. Plant Physiol 175:1853–1863

Chapter 5

Genetic Engineering for Biotic Stress Management in Rice Amolkumar U. Solanke, Kirti Arora, Suhas G. Karkute, and Ram Sevak Singh Tomar

Abstract Rice yield is affected by various biotic stresses including fungi, bacteria, viruses, parasites, nematodes, weeds and insects, posing a major threat to global food security. Therefore, one of the major objectives of rice breeders is to develop rice cultivars resistant to biotic stresses and it has been achieved to large extent through traditional and molecular breeding approaches. However, frequent breakdown of resistance to these biotic stresses is a challenging issue and therefore, continuous efforts are needed to develop cultivars with durable resistance. Recently, genetic engineering technologies like transgenics and RNAi have enabled breeders to develop such durable resistance in rice against number of bacterial, fungal and viral diseases by utilizing the genes conferring resistance to trait and isolated from various organisms like plants, animals, microbes, etc. Genetic engineering is more preferred in some of the cases as it has advantages like requirement of lesser duration, no linkage drag and no crossing barrier compared to molecular breeding. Although varieties developed through genetic engineering require prior regulation before commercialization, it has the enormous potential to develop plants resistant/tolerant to biotic stresses. Present status of use of genetic engineering for developing biotic stress resistance in rice is briefly described in this chapter. Keywords Biotic stress · Genetic engineering · Rice · Transgenic · Disease · Insects

A. U. Solanke (B) · K. Arora · S. G. Karkute · R. S. S. Tomar ICAR-National Institute for Plant Biotechnology, Pusa Campus, New Delhi 110012, India e-mail: [email protected] K. Arora e-mail: [email protected] S. G. Karkute e-mail: [email protected] R. S. S. Tomar e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_5

117

118

A. U. Solanke et al.

5.1 Introduction Rice (Oryza sativa L.) is one of the most abundant and widely grown crops in the world. Rice cultivation is allied to human progress and it has played a significant role in human nutrition and culture for the past 100 centuries (IRGSP 2005). Rice is an important staple food crop and needs continuous improvement to fulfil the growing demand of the continuously rising population. With the advent of an increase in several environmental stresses, rice production has been severely hampered. Rice breeding programs are highly aided by standardized molecular biology tools in rice along with the availability of fine genetic maps and transformation and regeneration protocols (Sasaki and Burr 2000). Rice is considered a model organism for cereal crops because of its extensive similarity with other family members of Poaceae. Oryza is a genus belonging to the tribe Oryzae of a Poaceae family. The taxonomy of rice has been characterized as Kingdom: Plants, Subkingdom: Vascular plants, Superdivision: Seed plants, Division: Flowering plants, Class: Monocotyledons, Subclass: Commelinidae, Order: Cyperales, Family: Poaceae, Genus: Oryza L. The genus Oryza consists of 22 distinct species broadly grouped into four complexes viz., sativa, officinalis, ridley, and meyeriana. Among these species, only Oryza sativa and Oryza glaberrima are widely cultivated There are twenty-one wild species of genus Oryza (Khush et al. 1977), and ten recognized genome types in rice namely, AA, BB, CC, BBCC, CCDD, EE, FF, GG, HHJJ, HHKK. In the past decade, rice has been a model for comparative genomics of plants as well as for cereal genomics and broad molecular biology studies. Many factors are responsible for declaring it as a model plant. This economically important cereal remains not merely an academic pursuit but established itself to find future prospects. Recent advancements in biotechnology could be used for improvement in rice production by unlocking the genetic and physiological mechanism of the rice plant to expand its geographical adaptation and to overcome various biotic and abiotic constraints. Rice breeding programs are mainly focused on improving the nutrition, quality and yield of grains along with several other important agronomic traits like early maturity, resistance to various environmental stresses, nutrient use efficiency, resistance to lodging and shattering, etc. In this chapter, we are mainly focusing on the biotechnological efforts to improve rice crops against various biotic stresses.

5.2 Biotic Stresses in Rice Plants are often encountered with several other organisms in their whole life cycle and these organisms such as fungi, bacteria, viruses, parasites, nematodes, weeds, insects, etc. cause significant damages to plant yield. Biotic stress affects overall growth and development of plants, quantity and quality of seeds, and ultimately it affects yield (Dresselhaus and Huckelhoven 2018). Among the biotic stresses of rice, diseases and insect pests are a serious threat to production and productivity (Fig. 5.1). The International Rice Research Institute (IRRI), Philippines, estimates

5 Genetic Engineering for Biotic Stress Management in Rice

119

Fig. 5.1 Various pathogens of rice

that in order to feed the increasing global population, rice production must escalate by one third by the year 2020 (IRRI 1989). Recent report by Wani and Sah (2014) shows that there is a requirement of 25% more rice by 2030 for ensuring food security. To ensure global food security, sustainable rice production is very important and therefore, it is essential to develop rice cultivars that are resistant or tolerant to biotic stresses. To encounter the challenges arising due to various biotic stresses and sustainable yield, rice-growing area needs to be enhanced, however, the increasing population resulting in increased urbanization is a major hurdle. On the other hand, it is necessary to develop and grow biotic stress resistance cultivars that can yield comparatively better in stress conditions. Breeding programs in rice for developing resistance against different biotic factors utilize several landraces and wild relatives as a source of resistance genes. The foremost aim of breeders or biotechnologists is to identify the genomic loci or genes responsible for conferring resistance to disease or pests. Such fully characterized genes can be further transferred to superior cultivars through traditional breeding where the natural crossing is possible. However, many times the gene pool lacks the potential genes that can be transferred through breeding. Under these conditions, the genes from other systems can be effectively utilized and transferred in superior cultivars by using genetic engineering to develop transgenic crops.

5.3 Genetic Engineering or Transgenic Technology Since the beginning of genetic engineering era, this technology has been considered as one of the most potential technologies for crop improvement. It has the potential of increasing yield as well as minimizing crop losses due to several environmental stresses. Transgenic technology is successful in large number of crops and the products range from insect-resistant to herbicide-resistant, virus-resistant, better oil quality, drought-tolerant, etc. Transgenic crops are growing worldwide in more

120

A. U. Solanke et al.

than 26 countries on 185.1 million hectares (ISAAA 2016) which shows its potential and wide acceptance. The prerequisite for any transgenic crop development is to have well-characterized genes and promoters responsible for governing resistance to particular biotic stress. A large number of genes playing a vital role in resistance to various biotic stresses has been cloned and characterized using modern genomics and molecular biology tools. Rice plants have been successfully transformed by many of these significantly promising genes to make the plants stress-tolerant or disease resistant. Evaluation of these transgenic rice plants under greenhouses as well as field conditions is being carried out in different countries for biosafety analysis. Thus, transgenic technology is one of the most potential technologies for the rice improvement program.

5.4 Resistance to Bacterial Diseases Bacterial diseases in rice are also serious challenges that severely impact rice yield. Bacterial blight is one of the most destructive diseases and severe threats to rice production and it is caused by Xanthomonas oryzae pv. Oryzae. To develop resistance against bacterial blight in rice, 10 R genes have been characterized so far (Table 5.1). Some of the R genes have been successfully transferred from resistant line to susceptible line through marker-assisted backcross breeding. For example, xa5, xa13, and Xa21 genes from Swarna Bacterial Blight resistant pyramid line were transferred to elite deep-water Jalmagna cultivar (Pradhan et al. 2015). Pathogenesisrelated (PR) genes are vital for disease resistance and their expression is mainly regulated by ethylene-responsive (ERF) transcription factors (Grennan 2008). Another important resistance providing gene is Oryza cystatin1 (OC1) which is a protease inhibitor in rice seeds and has been transferred to various crops such as rice (Duan et al. 1996), wheat (Altpeter et al. 1999), oilseed rape (Rahbe et al. 2003) and eggplant (Ribeiro et al. 2006). In eukaryotic organisms, stress response is mediated by mitogen-activated protein kinase (MAPK) cascade. One such stress-responsive gene OsMAPK5 which is induced by abscisic acid, pathogen infection, and abiotic stresses have been cloned and characterized from rice. The characterization of this gene was done by over-expression by 35S promoter as well as by suppression using RNA interference. OsMAPK5 gene is a negative regulator of PR genes as RNAi transgenic lines constitutively expressed these PR genes. These transgenic plants exhibited significant resistance against bacterial (Burkholderia glumae) and fungal (Magnaporthe grisea) pathogens. However, there observed a negative impact on tolerance to drought, salt, and cold which was significantly reduced in these plants. Over-expression lines, in contrast, showed positive impact on these abiotic stresses due to increased kinase activity. Thus, OsMAPK5 is a positive regulator of abiotic stress tolerance and a negative regulator of disease resistance through modulating the expression of PR genes (Xiong and Yang 2003).

Rice variety

Nipponbare and Taipei309

Taipei309

Nipponbare and Kitaake

Nipponbare

Zhongua 11

Nipponbare and Mudanjiang 8

Zhongua 11 and Minghui63

Nipponbare

Oryza ssp. accessions

Nipponbare

Sr. No

1

2

3

4

5

6

7

8

9

10

Xa10

xa41(t)

Xa26/3

xa25

Xa23

xa13

xa5

Xa1

Xa21

Xa27

R gene

Recessive

Dominant

Dominant

Dominant

Dominant/recessive

Dominant

TAL effector

TAL effector

Leucine-rich repeat protein kinase

Dominant

Recessive

Dominant

Plasma membrane protein of Recessive MtN3/saliva family

TALE binding homology

Plasma membrane protein of Recessive MtN3/saliva family

Gamma subunit of transcription factor IIA

NB-LRR

LRR and Serine protein kinase domain

Family of type III effectors

Type of R genes

Table 5.1 R genes conferring resistance against bacterial blight disease in rice

Sun et al. (2004)

Liu et al. (2011)

Wang et al. (2015)

Chu et al. (2006)

Iyer and McCouch (2004)

Yoshimura et al. (1998)

Song et al. (1995)

Gu et al. (2005)

References

Agrobacterium mediated

Tian et al. (2014)

Beckman coulter genomics Hutin et al. (2015) sequencing

Agrobacterium-mediated

Agrobacterium mediated

Map-based cloning and Agrobacterium mediated

Agrobacterium-mediated

Map-based cloning

PEG mediated protoplast transformation

Biolistic

Agrobacterium mediated

Cloning/transformation method

5 Genetic Engineering for Biotic Stress Management in Rice 121

122

A. U. Solanke et al.

5.5 Resistance to Fungal Diseases Among the various fungal diseases, blast disease caused by Magnaporthe oryzae is the most devastating, and dwindle yield by as much as 75% in infected areas (Ou 1985). The competence of M. oryzae to suppress plant immune system and ability to modify host metabolism and cell signalling is the key feature of its virulent lifestyle which makes it a model phytopathogen. It is a filamentous, heterothallic, ascomycete fungus and has the ability to grow away from the host plant in standard growth media. The fungus is extensively studied by classical genetics and it is easily and efficiently transformed with several selectable markers (Talbot 2003). Traditionally, the fungal diseases are controlled by low-cost remedial strategies such as use of uninfected seeds, low doses of nitrogen fertilizers, burning of plant remains after harvesting, etc. But these strategies are least effective in eliminating the infections once epidemic spreads at large-scale under field conditions. Although several integrated management practices like cultural, mechanical and chemical have been reported to manage the disease, the management through host resistance is considered as one of the best methods (Hulbert et al. 2001). Resistance is actually a result of incompatible interaction between host and the pathogen. However, complete resistance needs unified functioning of biochemical as well as genetic factors to stay protected against pathogen. Rice crop season is highly favourable to Magnaporthe pathogen which is of highly variable nature and therefore, it is difficult to manage rice blast disease by the use of resistant cultivars (Ou 1980). Due to these reasons, blast-resistant varieties do not sustain in the disease-prone areas and results in breakdown of resistance within only 2–3 years of their introduction (Bonman et al. 1992). Though blast genetics study started in the early 1910s, Pib was the first gene cloned for blast resistance in 1999 by a group of Takuji Sasaki in japan (Wang et al. 1999). In the next two decades, a total of twenty-four blast resistance genes have been mapped, cloned, and characterized in rice (Sharma et al. 2012; Devanna et al. 2014). Second gene to be cloned was Pi-ta, with simultaneous cloning and characterization of the corresponding Avr-Pi-ta gene from M. Oryzae (Bryan et al. 2000). After a gap of five years, third gene Pi-k h (now designated as Pi54) was cloned and characterized from Indica rice line Tetep which is prevalent in Northwestern Himalayan region of India (Sharma et al. 2005a). This gene provides resistance to different strains of M. Oryzae. Other orthologs of Pi54 i.e. Pi54rh and Pi54of were also cloned and characterized showing broad-spectrum resistance against various isolates of M. oryzae (Das et al. 2012; Devanna et al. 2014). Till date, more than 100 R genes have been identified and amongst them, 24 are cloned (Tables 5.2 and 5.3). The OsNAC6 gene which belongs to NAC transcription factor family is upregulated by wounding, blast disease and abiotic stresses such as cold drought and salt. Rice plants transformed with OsNAC6 are significantly tolerant to dehydration and high salt along with resistance to blast disease. However, these transgenic plants showed growth retardation and a severe impact on reproductive yields. Thus, transcription factor OsNAC6 is a potential transcriptional activator of genes governing biotic and abiotic stress response in plants (Nakashima et al. 2007). Secondary

5 Genetic Engineering for Biotic Stress Management in Rice

123

Table 5.2 Identified rice blast resistance genes S. No. Gene

Chromosome Position (bp) number

Source cultivar

1

Pita2

12

10,078,620–13,211,331 Shimokita (J)

Japan

1969

2

Piis1

11

2,840,211–19,029,573

Imochi Shirazu (J)

Japan

1970

3

Piis2

–

–

Imochi Shirazu (J)

Japan

1970

4

Piis2

–

–

Imochi Shirazu (J)

–

1970

5

Piis3

–

–

Imochi Shirazu (J)

–

1970

6

Pikur1

4

24,611,955–33,558,479 Kuroka (J)

Japan

1970

7

Pise

11

5,740,642–16,730,739

Sensho (J)

Japan

1970

8

Pise2

–

–

Sensho (J)

Japan

1970

9

Pise3

–

–

Sensho (J)

Japan

1970

10

Pia

11

4,073,024–8,078,510

Aichi Asahi (J)

Japan

1971

11

Pif

11

24,695,583–28,462,103 Chugoku 31-1 (J) Japan

1971

12

Pii

9

2,291,804–28,431,560

Ishikari Shiroke Japan (J), Fujisaka 5 (J)

1971

13

Mpiz

11

4,073,024–16,730,739

Zenith (J)

Japan

1976

14

Piz

6

10,155,975–10,517,612 Zenith (J), Fukunishiki (J), Toride 1 (J), Tadukan (I)

Japan

1976

15

Pish

1

33,381,385–35,283,446 Shin 2 (J)

Japan

1985

16

Pish

11

33,381,385–35,283,446 Nipponbare (J)

Japan

1985

17

Pikur2

11

2,840,211–18,372,685

Japan

1988

18

Pi1

11

26,498,854–28,374,448 LAC23 (J)

Philippines 1992

19

Pi3(t)

6

–

Pai-kan-tao (J)

Philippines 1992

20

Pi6(t)

12

4,053,339–18,867,450

Apura (I)

USA

1993

21

Pi(t)

4

–

P167

–

1994

22

Pi11

8

–

Zhai-Ya-Quing8 (I)

China

1994

23

Pi12

12

6,988,220–15,120,464

K80-R-Hang Jiao-Zhan (J), Moroberekan (J)

Japan

1994

24

Pizh

8

4,372,113–21,012,219

Zhai-Ya-Quing8 (I)

China

1994

25

PBR

11

–

St-No 1 (J)

Japan

1995

26

Pi20

12

6,988,220–10,603,823

IR24 (I)

Philippines 1996

27

Pi17

7

22,250,443–24,995,083 DJ123 (I)

Philippines 1996

28

Pi14(t)

2

1–6,725,831

Japan

Kuroka (J)

Maowangu

Country

Year

1996 (continued)

124

A. U. Solanke et al.

Table 5.2 (continued) S. No. Gene

Chromosome Position (bp) number

Source cultivar

Country

Year

29

Pi19(t)

12

8,826,555–13,417,087

Aichi Asahi (J)

Japan

1996

30

Pi157

12

8,826,555–18,050,447

Moroberekan (J)

India

1996

31

Pi10

5

14,521,809–18,854,305 Tongil (I)

India

1996

32

Pi22(t)

6

4,897,048–6,023,472

Suweon365 (J)

Korea

1996

33

Pi62(t)

12

2,426,648–18,050,026

Yashiro-mochi (J)

Japan

1996

34

Pi67

–

–

Tsuyuake

Philippines 1996

35

Pi8

6

6,230,045–8,751,256

Kasalath (I)

Japan

36

Pib2

11

26,796,917–28,376,959 Lemont (J)

Philippines 1996

37

Pii1

6

2,291,804–28,431,560

Fujisaka 5 (J)

Japan

1996

38

Pikm

11

27,314,916–27,532,928 Tsuyuake (J)

China

1996

39

Pitq2

2

–

Teqing (I)

USA

1996

40

Pitq3

3

–

Teqing (I)

USA

1996

41

Pitq4

4

–

Teqing (I)

USA

1996

42

Pi23

5

10,755,867–19,175,845 Suweon365 (J)

Korea

1997

43

Pii2

9

1,022,662–7,222,779

Ishikari Shiroke (J)

Japan

1997

44

Pi16(t)

2

1–6,725,831

Aus373 (I)

Japan

1999

45

Pi44

11

20,549,800–26,004,823 Moroberekan (J)

USA

1999

46

Pib

2

35,107,768–35,112,900 Tohoku IL9 (J)

Japan

1999

47

Pi18(t)

11

26,796,917–28,376,959 Suweon365 (J)

Korea

2000

48

Pilm2

11

13,635,033–28,377,565 Lemont (J)

USA

2000

49

Pita

12

10,603,772–10,609,330 Tadukan (I), Yashiro-mochi (J)

USA

2000

50

Pitq1

6

28,599,181–30,327,854 Tequing (I)

USA

2000

51

Pi-tq5

2

34,614,264–35,662,091 Tequing (I)

USA

2000

52

Pitq6

12

5,758,663–7,731,471

Tequing (I)

USA

2000

53

pi21

4

5,242,654–5,556,378

Owarihatamochi (J)

Japan

2001

54

Pi25

6

18,080,056–19,257,588 Gumei 2 (I)

China

2001

55

PiCO39(t) 11

6,304,007–6,888,870

CO39 (I)

USA

2002

56

Pi26(t)

5

2,069,318–2,760,202

Azucena (J)

France

2003

57

Pi27

1

5,556,378–744,329

Q14 (I)

France

2003

58

Pi15

9

9,641,358–9,685,993

GA25 (J)

China

2003

59

Pi24(t)

1

5,242,654–5,556,378

Azuenca (J)

France

2003

60

Pi25(t)

2

34,360,810–37,725,160 IR64 (I)

France

2003

61

Pi32(t)

12

13,103,039–18,867,450 IR64 (I)

France

2003

62

Pi5(t)

9

–

Philippines 2003

Moroberekan (J)

1996

(continued)

5 Genetic Engineering for Biotic Stress Management in Rice

125

Table 5.2 (continued) S. No. Gene

Chromosome Position (bp) number

Source cultivar

Country

Year

63

Pi27(t)

6

6,230,045–6,976,491

IR64 (I)

France

2003

64

Pi28(t)

10

19,565,132–22,667,948 IR64 (I)

France

2003

65

Pi29(t)

8

9,664,057–16,241,105

IR64 (I)

France

2003

66

Pi33

8

5,915,858–6,152,906

IR64 (I)

France

2003

67

Pi30(t)

11

441,392–6,578,785

IR64 (I)

France

2003

68

Pi31(t)

12

7,731,471–11,915,469

IR64 (I)

France

2003

69

Pi35(t)

1

–

Hokkai 188 (J)

Japan

2004

70

Pid(t)1

2

20,143,072–22,595,831 Digu (I)

China

2004

71

Pid2

6

17,159,337–17,163,868 Digu (I)

China

2004

72

Pig(t)

2

34,346,727–35,135,783 Guangchangzhan China (I)

2004

73

PiGD1

8

–

Sanhuangzhan 2 (I)

China

2004

74

PiGD-2

10

–

Sanhuangzhan 2 (I)

China

2004

75

PiGD3

12

–

Sanhuangzhan 2 (I)

China

2004

76

Piks

11

27,314,916–27,532,928 Shin 2 (J)

Japan

2004

77

Pitp(t)

1

25,135,400–28,667,306 Tetep (I)

India

2004

78

Pi26

6

8,751,256–11,676,579

Gumei 2 (I)

China

2005

79

Pi36

8

2,870,061–2,884,353

Q61 (I)

China

2005

80

Pi37

1

33,110,281–33,489,931 St-No 1 (J)

China

2005

81

Pikh (Pi54)

11

24,761,902–24,762,922 Tetep (I)

India

2005

82

Piy1(t)

2

–

Yanxian No 1 (I)

China

2005

83

Piy2(t)

2

–

Yanxian No 1 (I)

China

2005

84

Pi38

11

19,137,900–21,979,485 Tadukan (I)

India

2006

85

Pigm(t)

6

10,367,751–10,421,545 Gumei4 (I)

China

2006

86

Pikp

11

27,314,916–27,532,928 HR22 (I)

China

2006

87

Pi34

11

19,423,000–19,490,000 Chubu32 (J)

88

Pi39(t)

4, 12

89

Pi40(t)

6

16,274,830–17,531,111 O. australiensis (W)

Philippines 2007

90

Pir2-3(t)

2

–

IR64 (I)

Indonesia

2008

91

Pirf2-1(t)

2

–

O. rufipogon(W)

Indonesia

2008

92

Pi41

12

33,110,281–34,005,652 93–11 (I)

China

2009

93

Pb1

11

21,711,437–21,361,768 Modan (I)

Japan

Chubu 111 (J), Q15 (I)

Japan

2007

China

2007

2009 (continued)

126

A. U. Solanke et al.

Table 5.2 (continued) S. No. Gene

Chromosome Position (bp) number

Source cultivar

Country

Year

94

Pit

1

Tjahaja (I), K59 (I)

Japan

2009

95

Pi42(t)

12

19,565,132–22,667,948 DHR9 (I)

India

2010

96

Pik

11

27,314,916–27,532,928 Kusabue (I)

China

2010

97

Pikg

11

27,314,916–27,532,928 GA20 (J)

Japan

2010

98

Pi47

11

–

Xiangzi 3150 (I)

China

2011

99

Pi48

12

–

Xiangzi 3150 (I)

China

2011

100

Pi13(t)

6

12,456,009–16,303,608 O. minuta (W), Kasalath (I), Maowangu

Philippines 1992, 1996

101

Pi9

6

10,386,510–10,389,466 O. minuta(W)

China

2,270,216–3,043,185

1992, 2006

Source Adapted from Sharma et al. (2012)

metabolites like phytoalexins are also one of the targets for enhancing the resistance against diseases in plants. Phytoalexins play a very important role in defense mechanisms in many plant species. To increase the synthesis of phytoalexin in grapes, plants were transformed with stilbene synthase gene (STS) of Vst1 which is a key enzyme for phytoalexin synthesis (Coutos-Thévenot et al. 2001). The plants showed significant resistance to Pyricularia oryzae. Phytoalexin synthesis also occurs in rice in response to UV and blast infection and its synthesis is regulated by MAPK cascade, especially OsMAPKK6 gene (Wankhede et al. 2013). When rice plants are exposed to UV radiation, expression of phytoalexin gets increased. Owing to its role in phytoalexin synthesis, OsMAPKK6 gene was overexpressed in transgenic rice line and the plants could show increased phytoalexin content. Another most important fungal disease of rice affecting the grain yield is sheath blight which is caused by Rhizoctonia solani. Depending on the extent of infection, crop stage at which it is infected and favourable environmental conditions, sheath blight results in crop losses of up to 50% (Savary et al. 2000). The self-defense system of plants is activated when the plant is encountered by any pathogen which leads to production of several PR proteins like chitinases, glucanases, thaumatin-like proteins, etc. Chitinase gene cloned in rice provides resistance against sheath blight (Lin et al. 1995; Itoh et al. 2003). In an attempt to develop sheath blight resistance in rice, basic chitinase gene and a ribosome-inactivating protein were coexpressed in rice and the resulting transgenic plants showed a significant reduction in the incidence of sheath blight (Kim et al. 2003). Various defense responsive genes cloned for sheath blight resistance are given in Table 5.4.

5 Genetic Engineering for Biotic Stress Management in Rice

127

Table 5.3 Cloning and characterization of blast resistance genes in rice Sr. No.

Gene

Donor cultivar

Chromosome

Cloning strategy Domain combination

Year

1

Pib

Tohoku IL9 (J)

2

MB

NBS-LRR

1999

2

Pita

Tadukan (I)

12

MB

NBS-LRR

2000

3

Pi54 (Pi-kh)

Tetep (I)

11

MB

Rudimentary, NBS-LRR

2005

4

Pid-2

Digu (I)

6

MB

Lectin receptor 2006

5

Pi9

O. minuta, 75-1-127 (I)

6

MB

NBS-LRR

2006

6

Pi-2

5173 (I) Fukunishiki 1

6

MB

NBS-LRR

2006

7

Piz-t

Toride1 (J)

6

MB

NBS-LRR

2006

8

Pi36

Kasalath (I)

8

MB

CC-NBS-LRR

2007

9

Pi37

St. No. 1 (J)

1

MB In silico

NBS-LRR

2008

10

Pikm

Tsuyake (J)

11

MB

NBS-LRR

2008

11

Pi5

RIL260

9

MB

CC-NBS-LRR

2009

12

Pit

Tjaha (J)

1

MB

CC-NBS-LRR

2009

13

Pid3

Digu (I)

6

In silico NBS-LRR homology based

14

pi21

Owarihatamochi

4

MB

Non NBS-LRR 2009

15

Pis-h

Nipponbare (J)

1

Mutant screening

CC-NBS-LRR

2010

16

Pb1

Modan (I)

11

MB

CC-NBS-LRR

2010

17

Pi-k

Kusabu

11

MB

CC-NBS-LRR

2011

18

Pik-p

K60 (J)

11

MB In silico

CC-NBS-LRR

2011

19

Pia

Sasamishiki (W)

11

Multifaceted, genomics approach

CC-NBS-LRR

2011

20

NLS-1

Zhongsi2 (I)

11

MB

CC-NBS-LRR

2011

21

Pi25

Gumei2 (I)

6

In silico MB

CC-NBS-LRR

2011

22

Pi54rh

O. rhizomatis

–

Allele mining

Rudimentary, CC-NBS-LRR

2012

23

Pid3-A4

Oryza rufipogon

–

Allele mining

CC-NBS-LRR

2013

24

Pi54of

Oryza officinalis

–

Allele mining

Rudimentary, CC-NBS-LRR

2014

MB: Molecular Breeding

2009

128

A. U. Solanke et al.

Table 5.4 Various defense responsive genes cloned for resistance against sheath blight Sr. Gene cloned No.

Method used

Variety transformed

Resistance against

References

1

Chitinase

PEG mediated protoplast transformation

Indica rice cv. ChinsurahBoro II

Rhizoctonia solani

Lin et al. (1995)

2

Class-1 chitinase chi11

Agrobacterium mediated transformation

Basmati122, Tulsi, Vaidehi

Rhizoctonia solani

Datta et al. (2000)

3

RC7

Biolistics and PEG mediated transformation

cv. IR72, IR64, Rhizoctonia IR68899B, solani ChinsurahBoroII

Datta et al. (2001)

4

chi11

Agrobacterium mediated transformation

cv. Pusa Basmati1

Rhizoctonia solani

Kumar et al. (2003)

5

chi11

Agrobacterium mediated transformation

cv. Pusa Basmati1

Rhizoctonia solani

Sridevi et al. (2003)

6

RC24

Sexual crossing

Zhongda 2

Rhizoctonia solani

Yuan et al. (2004)

7

tlp and chi11

Biolistics ADT38 and mediated IR50 co-transformation

Rhizoctonia solani and Sarocladium oryzae

Kalpana et al. (2006)

8

chi11 and tlp-D34

Biolistic method

PB1 and ADT38 Rhizoctonia solani

Maruthasalam et al. (2007)

9

RC7

Agrobacterium mediated transformation

Local cultivars

Rhizoctonia solani

NandaKumar et al. (2007)

10

chi11 and tobacco β_1,3 glucanase

Agrobacterium mediated transformation

cv. Pusa Basmati1

Rhizoctonia solani

Sridevi et al. (2008)

11

Endochitinase gene (cht42) from Trichoderma virens

Agrobacterium mediated transformation

cv. Pusa Basmati1

Rhizoctonia solani

Shah et al. (2009)

12

Momordica charantia classI (MCChi11)

Agrobacterium mediated transformation

JinHui35 (Oryza Rhizoctonia Li et al. sativa subsp. solani and (2009) indica) Magnaporthe grisea

13

chi11 and tlp-D34

Agrobacterium mediated transformation

White ponni

Rhizoctonia solani

Shah et al. (2013)

14

Chitinase Biolistic method (LOC_Os11g47510)

Japonica cv. Taipei309

Rhizoctonia solani

Richa et al. (2017)

5 Genetic Engineering for Biotic Stress Management in Rice

129

5.6 Resistance to Viral Diseases Several viruses such as Rice dwarf virus (RDV), Rice black streaked dwarf virus (RBSDV), Rice stripe virus (RSV), Rice tungro bacilliform virus, Rice tungro spherical virus, etc. affects the rice crop and the result is a significant loss in yield. Leafhoppers and planthoppers are the major insect vectors for transmission of these viruses. It is more difficult to control the viruses that can multiply in insects and gets transmitted transovarially. There are examples of severe devastation of rice due to infection with Rice grassy stunt virus (RGSV) and Rice ragged stunt virus (RRSV) recently in Vietnam during 2006–2007 where 485,000 hectares of paddy fields were severely affected (Cabauatan et al. 2009). This caused the loss of 828,000 tons of rice costing around US$120 million. Therefore, viruses are a serious threat to rice production. Considering the magnitude of losses caused by viruses in rice, it is enormously important to manage the viral disease for ensuring global food security. Genetic engineering would pave the way to the solution of these problems and is one of the most promising approaches for improved resistance against diseases and harmful insects. Development of resistance to viruses is generally achieved by using the concept of pathogen-derived resistance. This includes expression of part of the viral genome in plants that effectively prevents or reduces the infection of that particular virus. Based on this strategy, transgenic rice plants were developed to confer resistance to Rice stripe virus (Hayakawa et al. 1992) and Rice yellow mottle virus (RYMV) (Pinto et al. 1999). Another innate resistance mechanism of viral resistance in plants is RNA interference (RNAi) or RNA silencing where RNA of a virus acts as a potential trigger to induce resistance against viruses. Large number of eukaryotic organisms have evolutionarily conserved RNA interference mechanism which acts in a sequence-specific manner for silencing the gene expression and it is generally induced by dsRNA (Baulcombe 2004). Induction of RNAi by dsRNA involves dicing of dsRNA by dicer endonuclease into small interfering RNAs (siRNAs) that are 21–24 nucleotides in length (Fusaro et al. 2006). RNA induced silencing complex (RISC) is then formed by incorporating these small siRNAs. RISC guides either degradation of complementary mRNAs or represses their translation in sequence-specific manner. One of the most efficient ways to produce the virus-specific dsRNA in plants for developing resistance against viruses is to form it in the form of hairpin structure and there are specialized vectors developed for this purpose (Bonfim et al. 2007). Comparatively, use of RNAi approach targeting different viral genes is less effective for developing virus resistance. The resistance level achieved by RNAi varies from complete resistance without any symptoms or delayed symptoms or absence of resistance which depends on target of virus genome (Shimizu et al. 2009, 2011b). Therefore, to achieve strong resistance against viruses in RNAi transgenic plants, it is very important to identify the best target for RNAi. For example, genes coding for nucleocapsid and movement proteins of Rice stripe virus (RSV) were found to be highly effective targets for RNAi in developing RSV resistant plants. Transgenic plants with RNAi construct targeting pC5 (nucleocapsid) or pC6 (movement protein) genes of RGSV

130

A. U. Solanke et al.

showed no proliferation of virus particles. A similar strategy of targeting these two genes by RNAi can be applied to impart resistance against other plant viruses of Tenuivirus genus (Shimizu et al. 2013). Spreading of Rice tungro bacilliform virus (RTBV) which causes rice tungro disease is aided by Rice tungro spherical virus (RTSV). However, RTSV which is also known as Rice waika virus do not cause visible symptoms after infection to rice. Therefore, strategy has been devised to develop significant resistance against RTBV and other related viruses by developing transgenic rice plants that can produce small interfering RNAs targeting RTSV sequences (Le et al. 2015). Types of resistance developed by genetic engineering to different viruses are tabulated in Table 5.5.

5.7 Resistance to Insects Insect pests are more hazardous to agriculture as they directly affect both vegetative as well as productive growth of crops worldwide (Karthikeyan et al. 2011), leading to the global loss of 15% (Maxmen 2013). Barley trypsin inhibitor gene was cloned in rice to confer resistance against insects by Alfonso-Rubi et al. (2003). Transgenic expression leads to the production of several protein inhibitors in field crops that provide resistance against agriculturally important pests. Some of the examples are transgenic rice expressing cowpea-TI inhibits growth of Chilo suppressalis (Xu et al. 2010) and Potato II (T/C-I) inhibitor transferred in rice provide resistance against M. sexta (Jongsma et al. 1995). These rice plants produced toxins to the level of 0.05% of a total soluble protein and showed significant resistance against striped stem borer (Chilo suppressalis) and rice leaf folder (Cnaphalocrocis mainsails) (Fujimoto et al. 1993). Similarly, transgenic plants of aromatic rice varieties Basmati 370 and M 7 containing Cry II(a) showed resistance to yellow stem borer (Scirpophaga incertulas) and rice leaf folder (Maqbool et al. 1998). The cry family of gene contains several different kinds of cry proteins functional against different families of insects. Many of these cry proteins have been utilized to develop transgenic plants. For example, Indica and Japonica rice genotypes were transformed with truncated form of Cry1A(b) gene by microprojectile bombardment as well as protoplast systems to impart insect resistance (Datta et al. 1998). Transgenic rice plants harbouring Cry1A(c) gene showed considerable resistance against yellow stem borer (Nayak et al. 1997) whereas plants carrying Cry1A(b) gene showed resistance for both yellow stem borer and striped stem borer (Ghareyazie et al. 1997). Synthetic Cry1A(c) gene has been introduced in some elite rice breeding lines such as Pusa Basmati 1, IR64 and Karnal local to develop insect resistance in them (Khanna and Raina 2002). The whole plant assays at vegetative stage and growing on cut stems of these Bt transgenic lines with Bt titres of 0.1% of total soluble protein resulted in 100% mortality of yellow stem borer larvae. Considering the potential of such transgenic rice lines expressing the Bt toxin of Bacillus thuringiensis, their commercialization is expected in near future. Various cry genes transferred in rice for genetic improvement and resistance to different categories of insect are given in Table 5.6.

5 Genetic Engineering for Biotic Stress Management in Rice

131

Table 5.5 Virus resistance in rice plants Sr. Rice variety No.

Virus

Mode of Method of resistance virus development/study transmittance

References

1

Japonica

Rice stripe virus

Insect Expression of coat transmitted protein gene (planthopper)

Hayakawa et al. (1992)

2

Japonica cv. Nipponbare

Rice dwarf virus

Leaf hoppers

RNA interference (Pns12)

Shimizu et al. (2009)

3

Japonica rice cultivar ‘Dongling No.1’

Rice dwarf virus

Leaf hoppers

Ribozyme mediated RNAi

Han et al. (2000)

4

Indica rice cv. Pusa Basmati1 (PB1)

Rice tungro virus

Brown leaf Elisa, western blotting hopper, green leaf hopper

Saha et al. (2006)

5

Indica rice

Rice yellow mottle virus

Bettles

Molecular mapping

Albar et al. (2006)

6

Nipponbare

Rice dwarf virus

Leaf hoppers

Agrobacterium mediated Yoshii transformation et al. (2009)

7

Oryza sativa L.

Rice tungro spherical virus

Green leaf hopper

Molecular mapping

Sebastian et al. (1996)

8

Japonica

Rice stripe Tenuivirus and Rice dwarf Phytoreovirus

Small RNA cloning and sequencing

Wu et al. (2015)

9

3 cv. of Oryza sativa (IR64, Azucena, and Gigante) and 4 cvs of O. glaberrima (Tog5681, Tog5673, CG14, and SG329)

Rice yellow mottle virus

Beetles

Elisa, segregation analysis

Ndjiondjop et al. (1999)

10

Japonica variety, Azucena and Indica variety IR64

Rice yellow mottle virus III

Beetles

QTL mapping and marker assisted introgression

Ahmadi et al. (2001)

11

Japonica cv. Nipponbare

Rice stripe virus

Insect transmitted (plant hopper)

Agrobacterium mediated Shimizu transformation and RNA et al. interference (pC1, p2, (2011b) pC2, p3, pC3, p4 and pC4)

12

Japonica cv. Unkwang

Rice tungro spherical virus

Green leaf hopper

SNP mapping

Lee et al. (2010)

13

Japonica cultivar Kitaake

Rice black streaked dwarf virus

Brown plant hopper

RNA interference and illumina sequencing

Wang et al. (2016) (continued)

132

A. U. Solanke et al.

Table 5.5 (continued) Sr. Rice variety No.

Virus

Mode of Method of resistance virus development/study transmittance

References

14

Japonica cultivar Koshihikari

Rice strip virus

Insect Agrobacterium mediated Wang et al. transmitted transformation (2014) (planthopper)

15

Japonica cv. Nipponbare

Rice black streaked dwarf virus

Brown plant hopper

Agrobacterium mediated Shimizu transformation and RNA et al. interference (2011a)

16

Japonica variety, Wuyujing 3,

Rice black streaked dwarf virus

Brown plant hopper

Agrobacterium mediated Ahmed transformation and RNA et al. interference (S7-2 or S8) (2017)

17

Rice stripe Plant hoppers Artificial microRNAs virus and rice (coat protein genes) black streaked dwarf virus

18

Rice black streaked dwarf virus

Brown plant hopper

RNA interference (p9-1) Shimizu et al. (2011a)

19

Rice gall dwarf virus

Leaf hoppers

RNA interference (Pns9) Shimizu et al. (2012)

20

Rice tungro spherical virus

Green leaf hopper

RNA interference (CP1, CP2, CP3, and NTP)

Le et al. (2015)

21

Rice grassy stunt virus

Plant hoppers RNA interference (pC5, pC6)

Shimizu et al. (2013)

22

Rice tungro Green leaf spherical hopper virus and rice tungro bacilli virus

RNA interference (siRNAs)

Sun et al. (2016)

Sharma et al. (2018)

In addition to leaf-eating insects, sucking pests like Leaf folder (Cnaphalocrocis medinalis) and planthoppers (Nilaparvata lugens and Sogatella furcifera) severely affects rice crop. Among these, brown planthopper (BPH) is severe threat to rice production due to its destructive nature and thus it causes annual loss of billions of dollars (Piper 2011; Cheng et al. 2013). Cultivars developed through traditional breeding shows promising results, however, there is frequent and rapid breakdown of BPH resistance (Cheng et al. 2013). Therefore, it is necessary to identify novel and effective BPH resistance genes conferring durable resistance. To control these sap-sucking insects, plant lectins are promising proteins and are effective against Hemipteran insects. Therefore, strategy of increasing amount of lectins in plant tissues is one of the potential ways to impart insect resistance in plants. Garlic lectin

5 Genetic Engineering for Biotic Stress Management in Rice

133

Table 5.6 Genetic improvement of rice for insect resistance Sr. No.

Gene

Target

References

1

cry1Ab or cry1Ac

YSBa , SSBb

Shu et al. (2000)

2

cry1Aa or cry1Ab

SSB

Breitler et al. (2004)

3

cry1Ab and cry1Ac

YSB

Ramesh et al. (2004)

4

cry1Ab

SSB

Cotsaftis et al. (2002) RLFc

5

cry1Ab

YSB and

6

cry, and RC7

YSB, sheath blight

Datta et al. (2003)

7

gna and cry1Ac

Homopteran, coleopteran, and lepidopteran insects

Nagadhara et al. (2003)

8

Itr1

Rice weevil

Alfonso-Rubi et al. (2003)

9

cry1Ac and cry2A

YSB and RLF

Mahmood-ur-Rahman et al. (2007)

10

Bt and CpT1

Insect resistance

Rong et al. (2007)

11

Bt, protease inhibitors, enzymes, and plant lectins

Insect resistance

Deka and Barthakur (2010)

12

cry2Aa

Insect resistance

Wang et al. (2012)

13

cry1Ab

Insect resistance

Wang et al. (2014)

a YSB

yellow stem borer,

b SSB

stripe stem borer,

c RLF

Bashir et al. (2005)

rice leaf folder

gene (ASAL) has been evaluated against chewing (lepidopteran) and sap-sucking (homopteran) insects and found providing resistance against these insects. Allium leaf agglutinin (ASAL) has insecticidal activities against various insects. Transgenic rice plants developed using the ASAL gene exhibited resistance to planthoppers (Saha et al. 2006). Another gene Galanthus nivalis (snow drop) agglutinin (GNA) introduced in rice confers resistance against brown planthopper (Nilaparvata lugens) (Li et al. 2005). Chandrasekhar et al. (2014) also developed transgenic rice plants showing resistance to sap-sucking brown planthopper (Nilaparvata lugens). These homozygous T2 transgenic plants showed strong resistance against hoppers as compared to wild type. The insect bioassay showed reduced survival rate (~74– 83%), slow development, and less fecundity. The major advantage of the transgenic plants was no growth penalty or no adverse effect on phenotypes but plants were highly resistant to insects. Bph3 is another important gene for imparting BPH resistance in rice. There are three genes in cluster known as Bph3 which encodes plasma membrane-localized lectin receptor kinases (OsLecRK1-OsLecRK3). These lectin receptor kinases are responsible for broad-spectrum and durable resistance. Thus, Bph3 is the potential genetic resource that can be transferred to susceptible rice varieties by molecular breeding or recombinant DNA technologies to enhance their resistance against BPH and also white back planthopper (Liu et al. 2015). BPH29, a resistance gene with B3 DNA binding domain showed resistance against Brown planthopper by activating salicylic acid signalling pathway and represses the

134

A. U. Solanke et al.

jasmonic acid/ethylene-dependent pathway, similar to defense response shown by biotrophic pathogens (Wang et al. 2015). A brown planthopper resistance gene, BPH9 was isolated and widely used in rice breeding. Expression of this gene in rice plants confers resistance against BPH and reduces the damages. Interestingly, there is lot of allelic variation observed in this gene locus and a particular allele is responsible for resistance against a particular BPH population. This is critical for rice plants to cope with the continuous evolution of insect populations with varied virulence.

5.8 Herbicide Resistance in Rice for Controlling Weeds Herbicide resistance is the first major achievement using genetic engineering approaches in plants against weeds. One of the major strategies for developing herbicide resistance in plants is to over-express the target gene of the herbicide. This strategy has been utilized to develop glyphosate-resistant transgenic rice plants by over-expressing a native 5-enolpyruvylshikimate-3-phosphate synthase (epsps) gene (Wang et al. 2014). One of the major concerns for developing herbicide resistance or such novel traits in plants is transgene flow from transgenic plants to related weed species or elite cultivars. For example, in one such case, flow of a transgene from transgenic rice plants resistant to glufosinate to improved cultivars and weed relatives has been observed. The highest frequency of gene was noticed in the case of weedy rice which raises the threats of developing superweeds. Therefore, it is highly necessary to destroy and control the weedy rice in the fields where transgenic herbicide-resistant rice plants are grown. This will ensure the prevention of development of superweeds.

5.9 Conclusion Owing to the severity of damage caused by biotic stresses in rice, their management, and development of biotic stress-tolerant genotypes is an essential part of rice breeding program. Along with molecular breeding, transgenic technology has huge potential for development of stress-tolerant varieties. Transgenic technology has added advantages like less time and horizontal gene transfer, however, the transgenic plants are subjected to biosafety analysis prior to their commercialization. Transgenic plants in rice have been developed for resistance against devastating fungal diseases like rice blast, bacterial diseases like bacterial blight, and viral diseases. Insect resistance and herbicide resistance are also major traits that are introduced in rice plants. Rapid greenhouse and field trials and in-depth biosafety analysis will ensure their safe landing in farmers field as well as consumers’ plate in near future.

5 Genetic Engineering for Biotic Stress Management in Rice

135

References Ahmadi N, Albar L, Pressoir G et al (2001) Genetic basis and mapping of the resistance to Rice yellow mottle virus. III. Analysis of QTL efficiency in introgressed progenies confirmed the hypothesis of complementary epistasis between two resistance QTLs. Theor Appl Genet 103(6– 7):1084–1092 Ahmed MM, Bian S, Wang M et al (2017) RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice. Transgenic Res 26(2):197–207 Albar L, Bangratz-Reyser M, Hebrard E et al (2006) Mutations in the eIF (iso) 4G translation initiation factor confer high resistance of rice to Rice yellow mottle virus. Plant J 47(3):417–426 Alfonso-Rubí J, Ortego F, Castañera P, et al (2003) Transgenic expression of trypsin inhibitor CMe from barley in indica and japonica rice, confers resistance to the rice weevil sitophilus oryzae. Transgenic Res 12:23–31 Altpeter F, Diaz I, McAuslane H, Gaddour K, Carbonero P, Vasil IK (1999) Increased insect resistance in transgenic wheat stably expressing trypsin inhibitor CMe. Mol Breed 5(1):53–63 Bashir K, Husnain T, Fatima T, Riaz N, Makhdoom R, Riazuddin S (2005) Novel indica basmati line (B-370) expressing two unrelated genes of Bacillus thuringiensis is highly resistant to two lepidopteran insects in the field. Crop Prot 24(10):870–879 Baulcombe D (2004) RNA silencing in plants. Nature 431(7006):356–363 Bonfim K, Faria JC, Nogueira EO, Mendes ÉA, Aragão FJ (2007) RNAi-mediated resistance to Bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris). Mol Plant-Microbe Interact 20(6):717–726 Bonman JM, KhusGS, Nalson RJ (1992) Breeding rice for resistant to pests. Ann Rev Phytopatholo 30:507–528 Breitler JC, Vassal JM, Del Mar Catala M, Meynard D, Marfà V, Melé E, ... Messeguer J (2004) Bt rice harbouring cry genes controlled by a constitutive or wound-inducible promoter: protection and transgene expression under Mediterranean field conditions. Plant Biotechnol J 2(5):417–430 Bryan GT, Wu KS, Farrall L, Jia Y, Hershey HP, McAdams SA, ... Valent B (2000) A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12(11):2033–2045 Cabauatan PQ, Cabunagan RC, Choi IR, Heong KL, Hardy B (2009) Planthoppers: new threats to the sustainability of intensive rice production systems in Asia. In: KL Heong, Hardy B (eds) IRRI, pp 357–368. Los Baños Chandrasekhar K, Vijayalakshmi M, Vani K, Kaul T, Reddy MK (2014) Phloem-specific expression of the lectin gene from Allium sativum confers resistance to the sap-sucker Nilaparvata lugens. Biotechnol Lett 36(5):1059–1067. https://doi.org/10.1007/s10529-014-1459-8. Epub 2014 Feb 22. PMID: 24563293 Cheng X, Zhu L, He G (2013) Towards understanding of molecular interactions between rice and the brown planthopper. Mol Plant 6(3):621–634 Chu Z, Yuan M, Yao J et al (2006) Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev 20(10):1250–1255 Cotsaftis O, Sallaud C, Breitler JC, et al (2002) Transposon-mediated generation of T-DNA- and marker-free rice plants expressing a Bt endotoxin gene. Mol Breed 10:165–180. https://doi.org/ 10.1023/A:1020380305904 Coutos-Thévenot P, Poinssot B, Bonomelli A, Yean H, Breda C, Buffard D, Esnault R, Hain R, Boulay M (2001) In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst 1 gene under the control of a pathogen-inducible PR 10 promoter. J Exp Bot 52:901–910 Das A, Soubam D, Singh PK, Thakur S, Singh NK, Sharma TR (2012) A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae. Funct Integr Genomics 12(2):215–228

136

A. U. Solanke et al.

Datta K, Vasquez A, Tu J et al (1998) Constitutive and tissue-specific differential expression of the cryIA (b) gene in transgenic rice plants conferring resistance to rice insect pest. Theor Appl Genet 97(1–2):20–30 Datta K, Koukolikova-Nicola Z, Baisakh N et al (2000) Agrobacterium-mediated engineering for sheath blight resistance of indica rice cultivars from different ecosystems. Theor Appl Genet 100(6):832–839 Datta K, Tu J, Oliva N et al (2001) Enhanced resistance to sheath blight by constitutive expression of infection-related rice chitinase in transgenic elite indica rice cultivars. Plant Sci 160(3):405–414 Datta SK, Chandel G, Tu J, Baisakh N, Datta K (2003) Engineering of Bt transgenic rice for insect pest protection. J New Seeds 5(2–3):77–91 Deka S, Barthakur S (2010) Overview on current status of biotechnological interventions on yellow stem borer Scirpophaga incertulas (Lepidoptera: Crambidae) resistance in rice. Biotechnol Adv 28:70–81 Devanna NB, Vijayan J, Sharma TR (2014) The blast resistance gene Pi54 of cloned from Oryza officinalis interacts with Avr-Pi54 through its novel non-LRR domains. PloS One 9(8):e104840 Dresselhaus T, Huckelhoven R (2018) Biotic and abiotic stress responses in crop plants. Agronomy 8:267 Duan X, Li X, Xue Q, Abo-EI-Saad M, Xu D, Wu R (1996) Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant. Nature Biotechnol 14(4):494– 498 Fujimoto H, Itoh K, Yamamoto M et al (1993) Insect resistant rice generated by introduction of a modified δ-endotoxin gene of Bacillus thuringiensis. Bio/Technology 11(10):1151 Fusaro AF, Matthew L, Smith NA, Curtin SJ, Dedic-Hagan J, Ellacott GA, Watson JM, Wang MB, Brosnan C, Carroll BJ, et al (2006) RNA interference-inducing hairpin RNAs in plants act through the viral defence pathway. EMBO Rep 7:1168–1175 Ghareyazie B, Alinia F, Menguito CA et al (1997) Enhanced resistance to two stem borers in an aromatic rice containing a synthetic cryIA (b) gene. Mol Breed 3(5):401–414 Grennan AK (2008) Ethylene response factors in jasmonate signaling and defense response. Plant Physiol 146:1457–1458 Gu K, Yang B, Tian D et al (2005) R gene expression induced by a type-III effector triggers disease resistance in rice. Nature 435(7045):1122 Han S, Wu Z, Yang H et al (2000) Ribozyme-mediated resistance to rice dwarf virus and the transgene silencing in the progeny of transgenic rice plants. Transgenic Res 9(3):195–203 Hayakawa T, Zhu Y, Itoh K, Kimura Y, Izawa T, Shimamoto K, Toriyama S (1992) Genetically engineered rice resistant to rice stripe virus, an insect-transmitted virus. Proc Nat Acad Sci 89(20):9865–9869 Hulbert SH, Webb CA, Smith SM, Sun Q (2001) Resistance gene complexes: evolution and utilization. Annual Review of Phytopathol 39(1)285–312 Hutin M, Sabot F, Ghesquiere A et al (2015) A knowledge-based molecular screen uncovers a broadspectrum OsSWEET14 resistance allele to bacterial blight from wild rice. Plant J 84(4):694–703 Itoh Y, Takahashi K, Takizawa H et al (2003) Family 19 chitinase of Streptomyces griseus HUT6037 increases plant resistance to the fungal disease. Biosci Biotechnol Biochem 67(4):847–855 Iyer AS, McCouch SR (2004) The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Mol Plant Microbe Interact 17(12):1348–1354 IRGSP (2005) The map-based sequence of the rice genome. Nature 436(7052):793 IRRI (1989) IRRI toward 2000 and beyond ISAAA (2016) Global status of commercialized Biotech/GM crops: 2016. ISAAA Brief No. 52. ISAAA: Ithaca, NY Jongsma MA, Bakker PL, Peters J et al (1995) Adaptation of Spodoptera exigua larvae to plant proteinase inhibitors by induction of gut proteinase activity insensitive to inhibition. Proc Natl Acad Sci USA 92(17):8041–8045 Kalpana K, Maruthasalam S, Rajesh T et al (2006) Engineering sheath blight resistance in elite indica rice cultivars using genes encoding defense proteins. Plant Sci 170(2):203–215

5 Genetic Engineering for Biotic Stress Management in Rice

137

Karthikeyan A, Sudha M, Pandiyan M et al (2011) Screening of MYMV resistant mungbean (Vigna radiata (L) Wilczek) progenies through agroinoculation. Int J Plant Pathol 2(3):115–125 Khanna HK, Raina SK (2002) Elite indica transgenic rice plants expressing modified Cry1Ac endotoxin of Bacillus thuringiensis show enhanced resistance to yellow stem borer (Scirpophaga incertulas). Transgenic Res 11(4):411–423 Kim JK, Jang IC, Wu R (2003) Co-expression of a modified maize ribosome-inactivating protein and a rice basic chitinase gene in transgenic rice plants confers enhanced resistance to sheath blight. Transgenic Res 12(4):475–484 Khush GS (1977) Disease and insect resistance in rice. Adv Agron 29:265–341 Kumar KK, Poovannan K, Nandakumar R et al (2003) A high throughput functional expression assay system for a defence gene conferring transgenic resistance on rice against the sheath blight pathogen, Rhizoctonia solani. Plant Sci 165(5):969–976 Le DT, Chu HD, Sasaya T (2015) Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus. GM Crops Food 6(1):47–53 Lee JH, Muhsin M, Atienza GA et al (2010) Single nucleotide polymorphisms in a gene for translation initiation factor (eIF4G) of rice (Oryza sativa) associated with resistance to Rice tungro spherical virus. Mol Plant Microbe Interact 23(1):29–38 Li G, Xu X, Xing H, Zhu H, Fan Q (2005) Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+ sbti transgenes. Pest Manage Sci Formerly Pestic Sci 61(4):390–396 Li P, Pei Y, Sang X et al (2009) Transgenic indica rice expressing a bitter melon (Momordica charantia) class I chitinase gene (McCHIT1) confers enhanced resistance to Magnaporthe grisea and Rhizoctonia solani. Eur J Plant Pathol 125(4):533 Lin W, Anuratha CS, Datta K et al (1995) Genetic engineering of rice for resistance to sheath blight. Bio/Technology 13(7):686 Liu Q, Yuan M, Zhou YAN et al (2011) A paralog of the MtN3/saliva family recessively confers race-specific resistance to Xanthomonas oryzae in rice. Plant Cell Environ 34(11):1958–1969 Liu YQ, Wu H, Chen H, et al (2015) A gene cluster encoding lectin receptor kinases confers broadspectrum and durable insect resistance in rice. Nat Biotechnol 33:301–305. https://doi.org/ 10.1038/nbt.3069 Maqbool SB, Husnain T, Riazuddin S et al (1998) Effective control of yellow stem borer and rice leaf folder in transgenic rice indica varieties Basmati 370 and M 7 using the novel δ-endotoxin cry2A Bacillus thuringiensis gene. Mol Breed 4(6):501–507 Maruthasalam S, Kalpana K, Kumar KK et al (2007) Pyramiding transgenic resistance in elite indica rice cultivars against the sheath blight and bacterial blight. Plant Cell Rep 26(6):791–804 Maxmen A (2013) Crop pests: under attack. Nature 501(7468):S15–S17 Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Krishnaiah NV, Sarma NP, ... Rao KV (2003) Transgenic indica rice resistant to sap-sucking insects. Plant Biotechnol J 1(3):231–240 Nakashima K, Tran LSP, Van Nguyen D et al (2007) Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice. Plant J 51(4):617–630 Nandakumar R, Babu S, Kalpana K et al (2007) Agrobacterium-mediated transformation of indica rice with chitinase gene for enhanced sheath blight resistance. Biol Plant 51(1):142–148 Nayak P, Basu D, Das S et al (1997) Transgenic elite indica rice plants expressing CryIAc ∂-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incertulas). Proc Natl Acad Sci USA 94(6):2111–2116 Ndjiondjop MN, Albar L, Fargette D et al (1999) The genetic basis of high resistance to rice yellow mottle virus (RYMV) in cultivars of two cultivated rice species. Plant Dis 83(10):931–935 Ou SH, SH O (1980) Pathogen variability and host resistance in rice blast disease Ou SH (1985) Rice diseases. IRRI Pinto YM, Kok RA, Baulcombe DC (1999) Resistance to rice yellow mottle virus (RYMV) in cultivated African rice varieties containing RYMV transgenes. Nat Biotechnol 17(7):702

138

A. U. Solanke et al.

Piper R (2011) Pests: a guide to the world’s most maligned, yet misunderstood creatures. Greenwood Press, California Pradhan SK, Nayak DK, Mohanty S et al (2015) Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna. Rice 8(1):19 Rahbe Y, Deraison C, Bonade-Bottino M, Girard C, Nardon C, Jouanin L (2003) Effects of the cysteine protease inhibitor oryzacystatin on different expression (OC-I) on different aphids and reduced performance of Myzus persicae on OC-I expressing transgenic oilseed rape. Plant Sci 164:441–450 Ramesh S, Nagadhara D, Reddy VD, Rao KV (2004) Production of transgenic indica rice resistant to yellow stem borer and sap-sucking insects, using super-binary vectors of Agrobacterium tumefaciens. Plant Sci 166(4):1077–1085 Ribeiro AD, Pereira EJ, Galvan TL, Picanco MC, Picoli ED, Da Silva DJH, ... Otoni WC (2006) Effect of eggplant transformed with oryzacystatin gene on Myzus persicae and Macrosiphum euphorbiae. J Appl Entomol 130(2):84–90 Richa K, Tiwari IM, Devanna BN, Botella JR, Sharma V, Sharma TR (2017) Novel chitinase gene LOC_Os11g47510 from indica rice Tetep provides enhanced resistance against sheath blight pathogen Rhizoctonia solani in rice. Front Plant Sci 8:596 Rong J, Lu BR, Song Z, Su J, Snow AA, Zhang X, ... Wang F (2007) Dramatic reduction of crop-tocrop gene flow within a short distance from transgenic rice fields. New Phytolog 173(2):346–353 Saha P, Dasgupta I, Das S (2006) A novel approach for developing resistance in rice against phloem limited viruses by antagonizing the phloem feeding hemipteran vectors. Plant Mol Biol 62(4– 5):735–752 Sasaki T, Burr B (2000) International rice genome sequencing project: the effort to completely sequence the rice genome. Curr Opin Plant Biol 3:138–141 Savary S, Willocquet L, Elazegui FA, Castilla NP, Teng PS (2000) Rice pest constraints in tropical Asia: quantification of yield losses due to rice pests in a range of production situations. Plant Dis 84(3):357–369 Sebastian LS, Ikeda R, Huang N et al (1996) Molecular mapping of resistance to rice tungro spherical virus and green leafhopper. Phytopathology 86(1):25–30 Shah JM, Raghupathy V, Veluthambi K (2009) Enhanced sheath blight resistance in transgenic rice expressing an endochitinase gene from Trichoderma virens. Biotechnol Lett 31(2):239 Shah JM, Singh R, Veluthambi K (2013) Transgenic rice lines constitutively co-expressing tlp-D34 and chi11 display enhancement of sheath blight resistance. Biol Plant 57(2):351–358 Sharma TR, Shanker P, Singh BK, Jana TK, Madhav MS, Gaikwad K, Singh NK, ... Rathour R (2005) Molecular mapping of rice blast resistance gene Pi-k h in the rice variety Tetep. J Plant Biochem Biotechnol 14(2):127–133 Sharma TR, Rai AK, Gupta SK, Vijayan J, Devanna BN, Ray S (2012) Rice blast management through host-plant resistance: retrospect and prospects. Agricult Res 1(1):37–52 Sharma S, Kumar G, Dasgupta I (2018) Simultaneous resistance against the two viruses causing rice tungro disease using RNA interference. Virus Res 255:157–164 Shimizu T, Yoshii M, Wei T et al (2009) Silencing by RNAi of the gene for Pns12, a viroplasm matrix protein of Rice dwarf virus, results in strong resistance of transgenic rice plants to the virus. Plant Biotechol J 7(1):24–32 Shimizu T, Nakazono-Nagaoka E, Akita F et al (2011a) Immunity to rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein. Virus Res 160(1–2):400–403 Shimizu T, Nakazono-Nagaoka E, Uehara-Ichiki T et al (2011b) Targeting specific genes for RNA interference is crucial to the development of strong resistance to rice stripe virus. Plant Biotechnol J 9(4):503–512 Shimizu T, Nakazono-Nagaoka E, Akita F et al (2012) Hairpin RNA derived from the gene for Pns9, a viroplasm matrix protein of rice gall dwarf virus, confers strong resistance to virus infection in transgenic rice plants. J Biotechnol 157(3):421–427

5 Genetic Engineering for Biotic Stress Management in Rice

139

Shimizu T, Ogamino T, Hiraguri A et al (2013) Strong resistance against rice grassy stunt virus is induced in transgenic rice plants expressing double-stranded RNA of the viral genes for nucleocapsid or movement proteins as targets for RNA interference. Phytopathology 103(5):513–519 Shu Q, Ye G, Cui H, et al (2000) Transgenic rice plants with a synthetic cry1Ab gene from Bacillus thuringiensis were highly resistant to eight lepidopteran rice pest species. Molecular Breeding 6:433–439. https://doi.org/10.1023/A:1009658024114 Song WY, Wang GL, Chen LL et al (1995) A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270(5243):1804–1806 Sridevi G, Sabapathi N, Meena P et al (2003) Transgenic indica rice variety Pusa Basmati 1 constitutively expressing a rice chitinase gene exhibits enhanced resistance to Rhizoctonia solani. J Plant Biochem Biotechnol 12(2):93–101 Sridevi G, Parameswari C, Sabapathi N et al (2008) Combined expression of chitinase and β-1, 3glucanase genes in indica rice (Oryza sativa L.) enhances resistance against Rhizoctonia solani. Plant Sci 175(3):283–290 Sun X, Cao Y, Yang Z et al (2004) Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein. Plant J 37(4):517–527 Sun L, Lin C, Du J et al (2016) Dimeric artificial microRNAs mediate high resistance to RSV and RBSDV in transgenic rice plants. Plant Cell Tissue Organ Cult 126(1):127–139 Talbot NJ (2003) On the trail of a cereal killer: exploring the biology of Magnaporthe grisea. Ann Rev Microbiol 57(1):177–202 Tian D, Wang J, Zeng X et al (2014) The rice TAL effector-dependent resistance protein XA10 triggers cell death and calcium depletion in the endoplasmic reticulum. Plant Cell 26(1):497–515 Wang Z-X, Yano M, Yamanouchi U, Iwamoto M, Monna L, Hayasaka H, Katayose Y, Sasaki Takuji (1999) The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J 19:55–64 Wang Y, Li Y, Romeis J, Chen X, Zhang J, Chen H, Peng Y (2012) Consumption of Bt rice pollen expressing Cry2Aa does not cause adverse effects on adult Chrysoperla sinica Tjeder (Neuroptera: Chrysopidae). Biol Control 61(3):246–251 Wang Q, Liu Y, He J et al (2014) STV11 encodes a sulphotransferase and confers durable resistance to rice stripe virus. Nature Commun 5(1):1–8 Wang C, Zhang X, Fan Y et al (2015) XA23 is an executor R protein and confers broad-spectrum disease resistance in rice. Mol Plant 8(2):290–302 Wang F, Li W, Zhu J et al (2016) Hairpin RNA targeting multiple viral genes confers strong resistance to rice black-streaked dwarf virus. Int J Mol Sci 17(5):705 Wani SH, Sah SK (2014) Biotechnology and abiotic stress tolerance in rice. J Rice Res 2:e105 Wankhede DP, Misra M, Singh P, Sinha AK (2013) Rice mitogen activated protein kinase kinase and mitogen activated protein kinase interaction network revealed by in-silico docking and yeast two-hybrid approaches. PloS One 8(5):e65011 Wu J, Yang Z, Wang Y et al (2015) Viral-inducible Argonaute18 confers broad-spectrum virus resistance in rice by sequestering a host microRNA. Elife 4:e05733. https://doi.org/10.7554/ eLife.05733 Xiong L, Yang Y (2003) Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid–inducible mitogen-activated protein kinase. Plant Cell 15(3):745–759 Xu L, Wang Z, Zhang J et al (2010) Cross-resistance of Cry1Ab-selected Asian corn borer to other Cry toxins. J Appl Entomol 134(5):429–438 Yoshii M, Shimizu T, Yamazaki M et al (2009) Disruption of a novel gene for a NAC-domain protein in rice confers resistance to rice dwarf virus. Plant J 57(4):615–625 Yoshimura S, Yamanouchi U, Katayose Y et al (1998) Expression of Xa1, a bacterial blightresistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci USA 95(4):1663– 1668 Yuan HX, Xu XP, Zhang JZ et al (2004) Characteristics of resistance to rice sheath blight of zhongda 2, a transgenic rice line as modified by gene “RC24.” Rice Sci 11(4):177–180

Chapter 6

Genome Improvement for Rust Disease Resistance in Wheat Rohit Mago

Abstract Improvement of wheat to meet global food demand has been the focus of plant breeders for over a century and breeding for rust resistance has been an important part of this effort. While, identification of new sources of resistance from cultivated wheat and related wild species, mapping and their transfer to bread wheat cultivars remains the major technique to achieve rust resistance. Recent advances in genomics and marker technologies have meant that these genes could be transferred to commercial wheat cultivars much quickly and precisely. The current chapter discusses how the advances in mapping, sequencing, genomics, and related technologies have shaped this change how upcoming technologies like gene editing would further help in achieving these goals. Keywords Resistance · Stem rust · Leaf rust · Stripe rust · Mapping · Single nucleotide polymorphism (SNP) · Gene editing

6.1 Introduction Wheat accounts for 21% of global food calories and about 20% of proteins intake (Shewry and Hey 2015). As the world population inches towards 9.7 billion people by 2050 (FAO 2017) there is increasing pressure to enhance crop yields to meet global food demand. Agricultural production more than tripled between 1960 and 2015, owing in part to productivity-enhancing Green Revolution technologies and a significant expansion in the use of land, water, and other natural resources for agricultural purposes. While, historically, much bigger increases in agricultural production have

R. Mago (B) Agriculture and Food, Commonwealth Scientific and Industrial Research Organisation (CSIRO), GPO Box 1700, Canberra, ACT 2601, Australia e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_6

141

142

R. Mago

been achieved in comparable periods. Despite overall improvements in agricultural efficiency, yield increases are slowing due to climate change and so maintaining the historic pace of production increases may be difficult under stressed land and water resources (FAO 2011). Thus, there is an urgency to work towards the improvement of important food crops including wheat under these conditions. Among other factors that effect wheat production, fungal and other pests pose a major constraint toward achieving higher yield. Among these pathogens, rust caused by the fungus of Puccinia sp., which includes stem or black rust [P. graminis f. sp. tritici (Pgt)], leaf or brown rust [P. triticina Eriks. (Pt)] and stripe or yellow rust [P. stiriiformis (Pst)] is one of the most destructive diseases of wheat, barley and triticale (Leonard and Szabo 2005; Park 2007), posing major threat to crop yield and quality in all growing regions of the world. In Australia alone, losses from wheat rust diseases amount to more than a billion dollars per year (Figueroa et al. 2018; Klymiuk et al. 2018). The recently evolved races of wheat stem rust and stripe rust fungus in parts of Africa, Asia, and Europe (Hubbard et al. 2015; Bhattacharya 2017) are a menace to food security due to their ability to spread rapidly and overcome resistance in cultivated wheat varieties. Genetic resistance provides chemical-free disease control to fight against these pathogens by using plant resistance genes that are effective against a specific pathogen in a crop. Breeding for resistance remains the most sustainable and effective method of controlling rust diseases. Two classes of genes are used for breeding rust-resistant wheat. The first class of resistance (R) genes, are pathogen race-specific in nature, effective at all plant growth stages (also known as All-stage resistance gene ASR or race-specific or seedling resistance). The second category consists of Adult Plant Resistance genes (APR) because resistance is usually functional only in adult plants, and, in comparison to most R genes, the levels of resistance conferred by APR genes are only partial and allows considerable disease development (Ellis et al. 2014). In addition, some APR genes provide resistance to all isolates of a rust pathogen species (race non-specific) while others provide resistance to multiple fungal pathogens. Race-specific genes generally follow Flor’s gene-for-gene hypothesis (Flor 1971). Two genes are necessary for the expression of resistance; the R gene in the host and the corresponding avirulence (Avr) effector gene in the rust pathogen. Each R gene confers resistance to pathogen strains carrying the corresponding avirulence effector (Avr) gene. Thus, the efficacy of R genes is pathogen strain-dependent and the ability of the pathogen to overcome resistance by mutation of the Avr gene leading to loss of recognition by the corresponding R gene. Thus, the continued ability of pathogen to defeat these resistance genes means that a continuous supply of new genes is required to outpace the pathogens. Therefore, several efforts are directed towards identifying new sources of rust resistance, isolating rust-resistance genes in crop plants, and understanding how to best deploy them to provide durability against the pathogen (Periyannan et al. 2017). Only a few APR genes have been isolated from wheat and encode receptor proteins that either directly or indirectly interact with pathogen Avr proteins. Because of the

6 Genome Improvement for Rust Disease Resistance in Wheat

143

partial nature of resistance provided by APR genes, they need to be combined with race-specific R genes to do provide sufficient resistance against the rust pathogen. Wild relatives of wheat and landraces are an important repertoire of new genes that can be bred into current commercial varieties. However, identifying and transferring these genes from wild species is a time-consuming and expensive process and, in some cases, may not possible due to sexual incompatibility. The best way to achieve crop protection is to by breeding multiple R genes using marker-assisted selection or ideally, clone these genes and introduce them into cultivated varieties, as gene stacks with several effective R genes in a single locus (Mago et al. 2011). Cloning of R genes is a long, tedious and time-consuming process and can take several years. This method relies on development of single gene segregating families for mapping to a chromosome using molecular markers, using BAC libraries to prepare a physical map of the region. Followed by sequencing and annotation to identify candidate gene/s and validation of the gene with help of loss of function mutants and or complementation. The maize Rp1D was the first rust resistance gene to be cloned in cereals (Collins et al. 1999). Since, then several stems, leaf and stripe rust resistance genes including both seedling and APR genes have been cloned (Krattinger et al. 2009; Periyannan et al. 2013; Mago et al. 2015; Moore et al. 2015). Map-based cloning and functional genetic studies in model plant systems have been much easier with the availability of whole-genome sequences due to their small genome size. However, in crops with large polyploid genomes like wheat, cloning genes and deploying them for crop improvement presents special challenges. In addition, most agriculturally important genes, including those conferring resistance to rust pathogens, are crop-specific. Bread wheat (Triticum aestivum L., 2n = 6x = 42, genome formula AABBDD) is hexaploid and has a genome size of 16 Gb (Arumuganathan and Earle 1991). On other hand, the tetraploid durum wheat (T. durum Desf., 2n = 4x = 28, genome formula AABB) has a genome size of 12 Gb. With an average ratio of 4.4 Mb/cM of physical/genetic distance (Faris and Gill 2002), mapbased cloning in wheat is almost an impossible task. In addition, the highly repetitive nature of wheat genome has meant that advances in wheat genomics have lagged other major cereals (Uauy 2017). Recent technological developments in the field of Next Generation Sequencing (NGS) through advancements in the areas of molecular biology and technical engineering (Buermans and Dunnen 2014). The ability to parallelly run sequencing reactions and reduced cost has significantly increased the total number of sequence reads produced per run. However, in spite of advancements in NGS technology, and the use of sophisticated bioinformatic algorithms it is often difficult to accurately map, or assemble, short reads originating from regions harboring structural variation (SV), high guanine-cytosine (GC) content, repetitive sequences, or sequences with multiple homologous elements within the genome due to the short-read lengths (∼150–300 bp) (Treangen and Salzberg 2011). The new long-read sequencing and assembly methods, however, can largely overcome these barriers. Two long-read sequencing technologies have become available. These, include the single-molecule real-time (SMRT) sequencing by Pacific Biosciences (PacBio) and Nanopore sequencing by Oxford Nanopore Technologies Inc (Clarke et al. 2009; Eid et al. 2009; Mantere et al. 2019). While only a few rust resistance

144

R. Mago

genes have been isolated until recently, advancements in genomics in combination with bioinformatics and technology have the possibility to transform wheat breeding significantly and increase the speed and precision at which new cultivars can be bred (Keller et al. 2018). In this chapter, we discuss how the new technologies have evolved and will help in better and rapid identification of new rust resistance genes and their cloning, deployment, and improvement of wheat.

6.2 Wheat Genome Sequencing Plant genome sequencing methods have evolved rapidly since the first plant genome project, Arabidopsis thaliana (Arabidopsis Genome Initiative2000). All initial plant genome projects (Rice, Maize and Brachypodium) utilized the Sanger sequencing platform of dideoxy sequencing (Sanger et al. 1977) and either large insert clones such as Yeast Artificial Chromosomes (YAC) or Bacterial Artificial Chromosome (BAC) clones that were used for shotgun sequencing or by direct whole-genome shotgun sequencing. The random reads, from a BAC or from the whole genome, were assembled using genome assembly software into a consensus sequence that represents the original DNA. One of the biggest bottlenecks of Sanger sequencing was low output and high cost. The technological advances in areas of computer science and genomics in the early part of twenty-first century led to the development of Next-generation Sequencing (NGS) platforms (Buell 2008). The most popular of these include Roache 454 and Illumina platforms. Compared to Sanger sequencing these NGS technologies produce over 1000-fold more sequence per day and are costeffective, making them the technologies of choice for whole-genome sequencing. The first, whole-genome assemblies of the hexaploid bread-wheat ‘Chinese Spring’ and the wild diploid wheat relative’s einkorn (Triticum urartu) and goatgrass (Aegilops tauschii) were generated using short-read Roche 454 and Illumina sequencing methods (Brenchley et al. 2012; Jia et al. 2013; Ling et al. 2013; IWGSC 2014, Luo et al. 2017). This provided a first snapshot of the wheat genome and its gene space; however, these assemblies are highly fragmented and consist of thousands of unordered scaffolds. The large genome size, polyploidy, and large proportion of repetitive DNA meant that whole-genome sequencing in wheat was not easy. Progress in the area of cytogenetics came to rescue by the ability to flow sort individual wheat chromosomes. Wang et al. (1992) published the first flow karyotyping of wheat chromosomes and analyzed chromosomes isolated from cell suspension culture. Doležel et al. (2005a, b) and later Molnár et al. (2014) reported individual chromosome sorting of bread wheat, its diploid progenitors. These advancements were exploited to construct chromosomespecific BAC libraries (Šimková et al. 2008; Šafáˇr et al. 2010). Such libraries have simplified the task of physical map construction, cloning, and targeted development of genetic markers. Wheat chromosome 3B was the first chromosome to be sorted successfully due to its large size. A 3B physical map was generated using BAC clones originating from the purified 3B chromosome (Paux et al. 2008). BAC clones

6 Genome Improvement for Rust Disease Resistance in Wheat

145

were selected by a minimal tiling path (MTP) approach and sequenced. The final pseudomolecule of 3B was 774 megabases (Mb) in length and carried 5326 proteincoding genes (Choulet et al. 2014). Further, developments and improvements have since led to chromosome-specific BAC resources for all wheat chromosomes helping the wheat genomics (Šafáˇr et al. 2010). A similar approach was used to construct a physical map of the APR stem rust resistance, Sr2 locus (Mago et al. 2014). The first Chinese Spring wheat draft sequence released by IWGSC (2014) was generated from short-read sequencing of single isolated chromosome arms. This approach reduced the complexity of assembling a highly redundant genome and enabled the differentiation of genes present in multiple copies and highly conserved homologs. However, the short-read sequence nature of NGS technologies meant that genome sequence was separated into non-overlapping contigs. New sequencing technologies (also known as long-read sequencing or third-generation sequencing) have since been developed. These include Pacific Biosciences (PacBio) and Oxford Nanopore Technology. Both these technologies work by reading the nucleotide sequences at the single-molecule level producing long read lengths. Clavijo et al. (2017) generated a new wheat whole-genome shotgun sequence assembly using a combination of optimized data types and an assembly algorithm designed to deal with large and complex genomes. The annotation combined strand-specific Illumina RNAseq and Pacific Biosciences (PacBio) full-length cDNAs to identify 104,000 highconfidence protein-coding genes and 10,000 non-coding RNA genes. This assembly represented 78% of wheat genome. Later Zimin et al. (2017) produced the first near-complete assembly of T. aestivum, using deep sequencing coverage from a combination of short Illumina reads and very long Pacific Biosciences reads. More recently (IWGSC 2018), released the first high quality fully annotated reference genome of bread wheat (Chinese Spring). This reference has approximately 108,000 annotated genes on 21 wheat chromosomes (Pennisi 2018) and nearly 2.8% (~480 Mb) of this sequence is still unanchored. An improved version of the reference wheat genome has been completed recently (https://www.wheatgenome.org/News/ Latest-news/IWGSC-RefSeq-v2.0-now-available-at-URGI). This improvement has been achieved using whole-genome optical maps and contigs assembled from wholegenome-shotgun (WGS) to the long-read PacBio SMRT reads (Zimin et al. 2017). This has greatly helped to detect and resolve chimeric scaffolds, anchor unassigned scaffolds, correct ambiguities in positions and orientations of scaffolds, create superscaffolds, and estimate gap sizes more accurately. PacBio contigs were used for gap closing. Nearly 10% of the unanchored sequence from RefSeq v1.0 has been resolved in the new assembly. The annotated reference sequence of wheat is a resource that will drive innovation in the wheat improvement and lay the foundation for accelerating wheat research and application through improved understanding of wheat biology and genomics-assisted breeding. The successful delivery of the Chinese Spring sequence by IWGSC has further led to understanding the diversity in the wheat genome by the way of the ‘10 + Wheat Genomes Project’ (https://www.10wheatgenomes.com) which was established by the G20 group of nations. This project aims to characterize the wheat ‘pan genome’ by sequencing multiple wheat genomes. In addition to assembled genomes, it will

146

R. Mago

also generate annotated gene models based on electronic prediction and experimental transcriptome data. This will also help with functional characterization of bread wheat genome.

6.3 Genetic Mapping and Molecular Markers To exploit the vast repertoire of rust resistance genes in the wheat gene pool, including the wild progenitors, for improvement of cultivated wheat depends on precise mapping of resistance on a high-resolution genetic map. Recent advances in the area of genetic mapping and genomics have provided a new tool for selecting desirable genes including that for rust resistance via their linkage to easily detectable molecular markers. This has been possible due to advances in development of very high-resolution genetic maps of wheat which are essential for introgressing favourable alleles in elite material and development of improved varieties. The tighter the linkage of the marker to the R gene, the more chances that it will be useful for marker-assisted selection (MAS; Paux et al. 2012). Traditionally, improvement of plant varieties was done by selection based on phenotype. One of the first genetic linkage maps in wheat was made for homoeologous chromosome 7 using RFLP (restriction fragment length polymorphism) markers(Chao et al. 1989). Prior to this, most of the rust resistance genes were assigned to different wheat chromosomes based on the genetic stocks which carried deletions, translocations, substitutions, or duplications of chromosome arm/s (Sears 1954, 1966; Sears and Leogering 1968; The et al. 1979; Hare and McIntosh 1979; McIntosh et al. 1980; McIntosh et al. 1995; Endo and Gill 1996). RFLP analysis was one of the first techniques to be widely used for detecting variation at the DNA sequence level. This revolutionized genetic mapping. RFLP relies on the comparison of band profiles generated after restriction enzyme digestion in DNA molecules. Diverse mutations that might have occurred in DNA molecules, lead to fragments of variable lengths upon digestion with restriction enzyme. These differences in fragment lengths can be seen after gel electrophoresis, hybridization, and visualization. The high conservation of gene sequences during evolution also allowed the use of RFLP markers derived from one species in genetic mapping experiments to be used in closely related species for comparative genetic mapping experiments for the Poaceae family (Van Deynze et al. 1995; Gale and Devos 1998). Several rust resistance genes were mapped using RFLP-based mapping (Schachermayr et al. 1994). While RFLP was a big step for genetic mapping and marker-assisted selection at the time, it was time-consuming, laborious, and required large quantities of DNA. Advances in molecular genetics methodology led to development of Polymerase Chain Reaction (PCR) technology. PCR allowed amplification of a small piece of DNA allowing it to be studied in detail. This led to development of several other marker platforms, including RAPD (Random amplified polymorphic DNA), Simple sequence repeats (SSR) or microsatellite markers, amplified fragment length polymorphism (AFLP), and expressed sequenced tag (EST) markers. RAPD markers are

6 Genome Improvement for Rust Disease Resistance in Wheat

147

DNA fragments generated by PCR amplification of random segments of genomic DNA with a single primer of arbitrary nucleotide sequence. Several RAPD-based markers liked to rust resistance genes from wild relatives and progenitors were reported by various groups (Schachermayr et al. 1995; Sun et al. 1997) these were the first PCR-based markers to be used for marker-assisted selection of rust resistance genes. However, RAPD based markers were generally dominant, and showed lot of variation between laboratories, and could be difficult to interpret. A microsatellite or Simple Sequence Repeat (SSR) is a small stretch of repetitive DNA in which certain DNA motifs (ranging in length from 1–6 bp or more) is repeated, typically between 5–50 times. Microsatellites occur at thousands of locations within the genome, show a high level of polymorphism and are generally co-dominant in nature. SSR markers are mostly chromosome specific Röder et al. (1998) published the first wheat microsatellite map. Additional SSR markers were further identified by other groups (Gupta et al. 2002; Song et al. 2005). The SSR markers were integrated with the previous RFLP based genetic maps to increase the marker density and were widely used for mapping of R genes. SSR markers linked to several rust resistance genes were identified and resulted in large-scale markerassisted of breeding for wheat improvement (Wang et al. 2002; Spielmeyer et al. 2003; Khan et al. 2005; Rosewarne et al. 2006). The availability of deletion stocks of all the 21 wheat chromosomes and SSR markers helped to establish a deletion bin based genetic- physical maps of wheat chromosomes (Sourdille et al. 2004). AFLP or Amplified Fragment Length Polymorphisms is another PCR-based tool used for DNA fingerprinting (Vos et al. 1995). AFLP has higher reproducibility, resolution, and sensitivity at the whole genome level compared to other techniques. Between 50 and 100 fragments could be amplified at one time. Polymorphic bands could be further cloned and converted to a simple PCR-based Sequence Characterized Amplified Region (SCAR) marker. In addition, no prior sequence information was required for amplification. AFLP was widely used in development of markers for rust resistance genes intogressed from wild relatives. For example, markers linked to rust resistance genes Lr46/Yr29, Sr24, Sr26, Sr32, and Sr39 were generated using AFLP and are still useful in marker-assisted selection of these genes (William et al. 2003; Mago et al. 2005, 2009, 2013). However, one of the difficulties with AFLP was the dominant nature of the markers and possible non-homology of comigrating fragments belonging to different loci. Expressed sequence tags (ESTs) are short cDNA sequences that ‘mark’ the gene from which the messenger RNA (mRNA) has originated. Typically, anonymous ESTs were sequenced to yield a 200–700 bp sequence that can be used to search DNA and protein databases for similar genes (Adams et al. 1991). EST polymorphisms typically arise either from the presence/absence of the allelic gene copies (insertions/deletions or indels) or from mutations between the allelic copies as Single Nucleotide Polymorphisms (SNPs). Lazo et al. (2004) generated the first EST resource for wheat. Nearly 115,000 ESTs were identified and 16,000 were physically assigned to wheat chromosomes using aneuploid and deletion stocks. EST markers have been very useful in mapping R genes using comparative genomics (Kota et al. 2006; Simons et al. 2011). Additionally, some ESTs were also found to

148

R. Mago

contain SSRs and successfully converted as diagnostic markers for rust resistance genes (Wang et al. 2008). Diversity Arrays Technology (DArT) was initially used as a hybridization-based genotyping tool that does not require sequence information and uses microarray technology to identify and type several thousands of dominant markers in parallel (Kilian et al. 2005; https://www.diversityarrays.com). However, with technological advances and low cost, DArT currently deploys the sequencing (DArtSeq) of the representations on the Next Generation Sequencing (NGS) platforms. DArT markers have been widely utilized for saturation of markers for mapping in wheat (Akbari et al. 2006; Wenzl et al. 2010) and for association of rust resistance in wheat and other wild relatives (Crossa et al. 2007; Millet et al. 2014). Single nucleotide polymorphisms (SNPs) are the most frequent type of polymorphism in genomes. They provide a huge number of useful markers for many genetic analyses including detection of marker-trait associations in quantitative trait locus (QTL) mapping experiments, genome-wide association studies (GWAS), and applications like marker-assisted selection. Advances in NGS have significantly facilitated the discovery of SNPs. Currently, SNPs based markers are most favored in breeding programs because of their abundance and high-throughput detection capacities. Cavanagh et al. (2013) generated a high-throughput array to interrogate 9000 gene-associated SNPs in a worldwide sample of 2994 accessions of hexaploid wheat including landraces and modern cultivars. Wang S et al. developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. Other larger arrays e.g. the 820 K Axiom array (Winfield et al. 2016; Allen et al. 2017) and a 660 k array (Zhou et al. 2018) have been released. You et al. (2011) achieved geome-wide SNP discovery in the Aegilops tauschii genome using next-generation sequencing without a reference genome sequence. Methods such as bulked segregant analysis (BSA), selective genotyping (SG), and whole-genome scanning have all be used for mapping and identifying markers for several rust resistance genes using the Infinium SNP bead chip arrays or a combination of technologies. The APR stem rust resistance gene Sr56 was mapped on chromosome 5BL by Bansal et al. (2014) by SSR markers initially, the map was further saturated using DArT and SNP markers. Using 90 K SNP mapping, a QTL for APR stem rust resistance from durum wheat has been mapped (Mago et al. unpublished). Using the SNP arrays not only provides a high-throughput, high-density genetic map but together with the high throughput non-gel-based KASP (Kompetitive AlleleSpecific PCR; He et al. 2014; https://www.biosearchtech.com) assay, has made this the technology of choice for MAS. KASP is based on an exclusive, competitive allele-specific PCR which is used for identification and assessment of SNPs or deletions (InDels) using a fluorescence-based reporting system. The KASP technology is suitable for use on a variety of equipment platforms and allows flexibility in terms of the number of SNPs and the number of samples able to be analyzed. Several, KASP markers linked to rust R genes have been developed from the SNPs identified from the wheat 90 k SNP array and are being widely used for MAS (Aoun et al. 2019; Gessese et al. 2019; Hiebert et al. 2016; Mago et al. 2019; Pakeerathan et al. 2019).

6 Genome Improvement for Rust Disease Resistance in Wheat

149

6.4 Cloning of Rust Resistance Genes Gene cloning or isolation is the technique of locating the gene in the genome and making copies of the gene for in vitro analysis. This helps to reveal its nucleotide sequence, the protein it encodes (Keller et al. 2018). Once cloned, the sequence of the R gene helps to design a gene-specific molecular marker for MAS, thus facilitating rapid and precise transfer of the gene to elite cultivars through breeding or transgenesis. In addition, the cloned gene sequences can be used to determine their presence in other cultivars and identify their homologs. Cloned gene sequence also forms the basis for deciphering the molecular function of plant pathogen interactions, which will ultimately help to protect wheat from pathogens. In the past 25 years, there has been a worldwide concerted effort to clone genes responsible for rust resistance in wheat. While the underlying requirement for the development of genetic material has mainly remained unchanged during this period, the technological advances in genomics, and computing during this period has expedited cloning. In wheat, the first all stage rust resistance genes to be cloned were Lr10 (Feuillet et al. 2003) and Lr21 (Huang et al. 2003). Both these genes were cloned using mapbased or positional cloning technique. This involved identifying molecular markers that lie close to gene and using the power of genetic recombination to move closer to the gene in a stepwise manner until co-segregating marker/sare found. The next step required random fragmentation of the genomic DNA from the wheat accession carrying the resistance gene and cloning into a large insert, Cosmid, or bacterial artificial chromosome (BAC) to make a library. Each BAC clone could accommodate 100– 200 kb fragments, a Cosmid could carry 30–50 kb inserts. The markers co-segregating with the gene were then used to screen the library to identify clones that span the region carrying the locus. In the case of Lr10, a BAC contig of 450 kb comprising 4 overlapping clones between the recombining markers were sequenced to identify the gene. Map-based cloning was also used to clone the multi pathogen APR genes Lr34 and Lr67 (Krattinger et al. 2009; Moore et al. 2015) and the temperaturesensitive stripe rust resistance gene, Yr36 (Fu et al. 2009). The race-specific stem rust resistance genes Sr33 (Periyannan et al. 2013) and Sr50 (Mago et al. 2015) were the first to be cloned from wheat and rye, respectively, also using map-based cloning technique. More recently, genes Yr15 (Klymiuk et al. 2018) and Sr60 (Chen et al. 2020) have also been identified using the positional cloning approach. However, positional cloning is a time-consuming process and may not be possible especially in cases where the resistance gene is present in a chromosomal region closer to centromere where recombination is suppressed or is present on translocations which do not recombine. The cloned sequences of the wheat all-stage resistance genes showed that majority of them contained the nucleotide-binding site (NBS)—leucine-rich repeat (LRR) conserved domains. With resources available through the sequencing of wheat genomes, it was then possible to scan the genome for the presence of NBS-LRR (NLR) sequences in the genome and use association mapping to identify any NLR linked to resistance. About 3500 NLR sequences have been identified in the Chinese

150

R. Mago

Spring genome. Steuernagel et al. (2016) used a three-step method (MutRenSeq) that combines chemical mutagenesis with exome capture and sequencing for rapid R gene cloning. A cereal NLR bait library containing 60,000 120-mer RNA probes with ≥95% identity to predicted NLR genes present in the Triticeae species was designed. A barcoded short insert (500–700 bp) libraries from genomic DNA of the wild type and 4–6 mutants were prepared and NLR capture was performed. Quantitative PCR on the enriched libraries indicated a 500- to 1,000-fold increase in NLRs relative to other genes. The enriched libraries were pooled and sequenced them using Illumina short-read sequencing-by-synthesis technology. Reads from different mutants were compared to the wild-type assembly and searched for NLR–associated contigs containing mutations (single-nucleotide variants (SNVs) or deletions). Stem rust resistance genes Sr22 and Sr45 were cloned using MutRenSeq (Steuernagel et al. 2016). The technique has been successfully used in cloning several other rust resistance genes e.g. Sr26 and Sr61 (Zhang et al., unpublished), Sr27 (Mago et al., unpublished). MutRenSeq is useful in cloning genes especially from wild relatives of wheat which are difficult to transfer to bread wheat due to sexual incompatibility and completely independent of map-based cloning. All the current R gene cloning methods require segregating lines that carry single R genes or mutant progenies, which may be difficult to generate for many wild relatives due to poor agronomic traits. Arora et al. (2019) exploited natural pangenome variation in a wild diploid wheat by combining association genetics with R gene enrichment sequencing (AgRenSeq) to clone four stem rust resistance genes in 6 months. RenSeq combined with diversity panels is therefore a major advance in isolating R genes for engineering broad-spectrum resistance in crops. Although, very useful in identification of several R genes, one of the biggest disadvantages of using an NLR enrichment library-based approaches (MutRenSeq and AgRenSeq) is that the NLR responsible for resistance may have significantly diverged and thus not represented in the bait library, also if the resistance was encoded by a non-NLR R protein it would not be picked up. For example, two recently cloned R genes, Yr15 (Klymiuk et al. 2018) which encodes for a protein belonging to tandem kinase-pseudokinase family, and Sr60 (Chen et al. 2020) which encodes for a protein with two putative kinase domains could not have been identified using these techniques. Both Yr15 and Sr60 have been cloned using the positional or map-based cloning technique. One of the limitations of positional cloning is the construction of BAC libraries and making the physical map of the locus. To overcome this bottleneck, SánchezMartín et al. (2016) used a combination of mutation and chromosome sequencing to identify the resistance gene Pm2, conferring resistance against powdery mildew. MutChromSeq, uses a complexity reduction approach based on flow sorting and sequencing of mutant chromosomes, to identify induced mutations by comparison to parental chromosomes. In another strategy, Thind et al. (2017) cloned the leaf rust resistance gene Lr22a using targeted chromosome-based cloning via long-range assembly (TACCA), which used a combination of short-read Illumina sequencing

6 Genome Improvement for Rust Disease Resistance in Wheat

151

and chromosome contact maps of in vitro reconstituted chromosomes. The chromosome carrying the resistance genes was flow-sorted and nonamplified high molecular weight DNA was then used for sequencing and Chicago long-range scaffolding (Putnam et al. 2016). This allowed the generation of mega base-sized scaffolds spanning the target region within a few months compared to BAC by BAC assembly of the locus. While NLR enrichment-based strategies may be extremely useful in identification of most R genes, positional cloning coupled with chromosome sequencing would still be the best strategy for identification of APR and genes encoding nonNLR proteins. These Target-enrichment and sequencing (TEnSeq) techniques have revolutionized rust gene cloning (Zhang et al. 2020) and are especially useful in cloning APR genes. The availability of several cloned genes has provided novel possibilities in providing durable resistance through conventional breeding and transgenesis (Wulff and Moscou 2014). Markers linked to or from the cloned resistance genes play a major role in combining several resistance genes and delivering rust resilient wheats (Mago et al. 2011; Mundt 2018) by MAS. Introducing cloned genes into cultivated wheat variety overcomes the barrier of sexual incompatibility especially if the resistance is present in distant relative which may be very difficult using conventional breeding. Also, using transgene avoids the transfer of any unwanted characters which may be associated with the gene. In a recent study, Luo et al. (2021) managed to combine up to 5 cloned rust resistance genes in a single transgene cassette. Wheat plants carrying the cassette were found to be highly resistant to rust pathogens used and detailed analysis showed that all the R genes in the cassette were expressed. The biggest advantage of using the transgene cassette instead of the gene stack is that all the genes in the transgene cassette segregate as a single unit, while the genes in the stack would segregate. Also, the individual genes within the cassette can be replaced in case of appearance of virulence on the gene or for use in a growing region.

6.5 Genome Editing The ability to maneuver gene function is crucial for basic plant research and for the generation of improved crop varieties. To increase the range of variation for traits, breeders have been exploring the use of mutations and the integration of chromosomal fragments from wild relatives into wheat varieties. Natural mutations, wide crosses, hybridization, and random mutagenesis using physical (X-ray or γ radiation) or chemical [ethyl methanesulfonate (EMS) or sodium azide] agents have been frequently used to generate variability. Although mutational breeding has resulted in significant improvements in various agronomic traits including rust resistance, these methods are generally labor intensive, time-consuming, and non-specific. Recent advances in genetic engineering technologies especially, gene editing offer relatively simple, accurate, and affordable solutions to achieve durable resistance (Pixley et al. 2019). Using these technologies, one can determine the DNA sequence modifications that are required in the cultivated variety and then introduce this genetic

152

R. Mago

variation precisely and rapidly. All the currently available genome editing technologies rest on the cell’s ability to repair DNA double-stranded breaks (DSB) which are introduced at or near a site where DNA sequence modification is required, using sequence-specific nucleases (SSNs). A DSB is can be repaired by either by ‘nonhomologous end-joining’ (NHEJ), in which the cell essentially polishes the two ends of broken DNA and seals them back together, often producing a frameshift. An alternate method of DSB repair is homology-directed repair (HDR) which can be used to insert desired SNPs or sequences. Both of which could lead to either loss or gain of function. Currently, four classes of SSNs are being used for genome editing, these include Meganucleases, zinc-finger nucleases (ZFNs), TAL (transcription-activator-like) effector nucleases (TALENs), and CRISPR (clustered regularly interspaced palindromic repeat) RNA–guided Cas (CRISPR-associated protein) endonucleases. Since the genome editing technologies are relatively new, only a few reports are available at present of their use in developing rust resistance wheat and disease resistance in general. Meganucleases are naturally occurring enzymes that bind and cleave large DNA sequence targets (12 to 40 bp). They can be engineered to recognize new sites; however, changes in target site specificity are difficult to achieve and often result in a reduction of catalytic activity; this has hindered their widespread use. ZFNs are a class of engineered DNA-binding proteins that facilitate targeted editing. A ZFN is a heterodimer in which each subunit contains a zinc finger domain and a FokI endonuclease domain. The FokI domains must dimerize for activity, thus increasing target specificity by ensuring that two proximal DNA-binding events must occur to achieve a DSB. Until now, the application of engineered nucleases for targeted genome modification in plants has been mostly reported for targeted gene knockout, which exploits the error-prone NHEJ repair pathway to generate lossof-function alleles. Ran et al., (2018) used ZFN-mediated, NHEJ-directed editing of a native gene in wheat to introduce, a specific single amino acid change into the coding sequence of acetohydroxyacid synthase to confer resistance to imidazolinone herbicides using a supplied DNA repair template. TAL (transcription-activator-like) effector nucleases -TALENs comprise a nonspecific DNA-cleaving nuclease integrated with a DNA-binding domain that can be easily engineered. This allows TALENs to target essentially any sequence, making them easier to engineer compared to ZFNs. Wang Y et al. used TALENS to introduce targeted mutations in the three homoeoalleles that encode Mildew-Resistance Locus (MLO) proteins in wheat leading to resistance against the wheat powdery mildew pathogen. MLO proteins were previously were shown to repress defenses against powdery mildew diseases in Barley (Piffanelli et al. 2004) and Arabidopsis (Consonni et al. 2006). The large size of TALENs, along with the requirement for a pair of proteins to recognize antiparallel DNA strands and induce a DSB, makes TALENs less favourable for multiplex gene editing. The CRISPR/Cas9 system uses a guide RNA that base pairs with a specific chromosomal target sequence. The resulting RNA/DNA complex is then cleaved by the Cas9 nuclease. DNA targeting through base-pairing avoids the need to engineer a

6 Genome Improvement for Rust Disease Resistance in Wheat

153

sequence-specific zinc finger or TAL effector array leading to genome engineering with much higher efficiency. Thus, making CRISPR/Cas9- based editing the SSN of choice. Thus, opening a wide array of possible applications that can eventually be utilized in plant pathology and resistance breeding (Langner et al. 2018). In a recent study in rice, Oliva et al. (2019) achieved broad-spectrum resistance to bacterial blight using CRISPR/Cas9-mediated genome editing to introduce mutations in all three SWEET gene promoters, the expression of which is required for disease susceptibility. A total of five promoter mutations was simultaneously introduced. A CRISPR-Cas9-based multiplexed gene editing was used to generate heritable mutations in the TaGW2, TaLpx-1, and TaMLO genes of hexaploid wheat (Wang et al. 2018). Currently, majority of gene editing is focused on creating mutations or knockouts of genes, however, one of the biggest potential use in rust disease management will be pseudogene reactivation and gene insertion which will be beneficial in introducing a functional allele in breeding programs. This is laborious through conventional breeding if wild relatives or unimproved germplasm is the only other available source. In a recent study Luo et al. (2019) reported TALEN-mediated gene editing in wheat to restore the activity of a pseudogene of leaf rust resistance gene Lr21. While the ORF was successfully restored, resistance gene function was not, possibly due to editing footprints in this case. Despite several advantages of genome-edited crops, many factors limit the utilization of the gene-editing technologies including intellectual property issues, public concern, and regulatory strains. For example, until now CRISPR–Cas9, was restricted in practice because the techniques were governed by the same rules as conventional genetic modifications, which require approval from regulatory authorities. In a recent announcement the Australian government has deregulated the use of gene-editing techniques in plants, animals, and human cell lines that do not introduce new genetic material (Mallapaty 2019). While Gene-editing technologies that do use a template, or that insert other genetic material into the cell, will continue to be regulated. Similar approach has been adapted by the US Department of Agriculture (USDA) which will not regulate plants that have been modified through genome editing while regulating transgenic plants, which contain artificially inserted genes from other species. The European Union on other hand has decided to consider all gene-edited events as genetically modified.

6.6 Pathogen Genomics The emergence of stem rust race Ug99, in Uganda in 1998 (Pretorius et al. 2000) and its subsequent spread and gain of virulence against a vast number of R genes sounded alarm bells across the wheat-growing regions of the world. Ug99 was virulent on over 90% of cultivated wheats worldwide (Singh et al. 2015). In addition, new races of nonUg99 group of Pgt have appeared in East Africa and Western Europe (Saunders et al. 2019). Recently, outbreaks of aggressive pathotypes of wheat stripe rust have been reported in Australia (Wellings et al. 2003). These incidences have been a motivation

154

R. Mago

for active research in the fight against this deadly fungus in UK and Western Europe (Hubbard et al. 2015; Bueno-Sancho et al. 2017). While most of the research in the area of rust disease management has been focused on the identification of new sources of resistance in the host until now. It is important to understand the reason behind the aggressiveness of these new isolates in certain geographical regions which would help in the deployment of the most suited wheat varieties for those regions. The wheat rust fungal pathogens are obligate biotrophs with complex life cycles. In the wheat-growing season they undergo uninterrupted asexual reproduction through infectious (only in wheat) dikaryotic urediniospores. At the end of wheat-growing season, they produce dikaryotic teliospores, the only form in which pathogen can overwinter independent of a host. Teliospores undergo karyogamy (fusion of the nuclei) and meiosis to form four haploid basidiospores- a source of genetic recombination in the rust life cycle. Basidiospores can infect the only barberry where they germinate and produce haploid mycelium and pycnia. The pycnia produce haploid gametes pycniospores and the receptive hypae. Receptive hypae of the opposite mating type can be fertilized by pycniospore to produce dikaryotic mycelium and this recombination can lead to the emergence of novel genotypes with additional virulence on new R genes. New virulence can also arise by accumulation of mutations in the avirulence (Avr) genes in an asexually reproducing rust isolate.It is speculated that DNA exchange between the two nuclei in rusts may play a role in avoiding recognition by the plant immune system. Virulence on stem rust resistance gene Sr50 arose by replacement of an ~2.5 Mbp region of chromosome in one karyon with corresponding region of the chromosome in the other karyon (Chen et al. 2017). Recently, Li et al. (2019) have produced fully haplotype resolved genome assemblies for Pgt Ug99 and an Australian Pgt isolate 21–0 using PacBio long-read sequences in conjunction with Hi-C, a Chromosome Conformation Capture technique (Belon et al. 2012). This study established that Ug99 arose by somatic hybridization and nuclear exchange between dikaryons and that it shares one haploid nucleus genotype with Pgt 21–0, with no recombination or chromosome reassortment. These findings indicate that nuclear exchange between dikaryotes can generate genetic diversity and facilitate the emergence of new lineages in asexual fungal populations. Long-distance spore dispersal can rapidly spread novel rust genotypes (Wingen et al. 2013) with the advancement of the most vigorous genotype-driven into wheat growing areas by subsequent asexual reproduction. Rust pathotyping is traditionally done by taking any new isolates appearing in farmers fields and then carefully phenotyping, using set wheat lines (differentials) carrying one or more resistance genes. Based on the virulence/avirulence profile of a pathogen one can then decide which wheat varieties to deploy. While this method has been effectively used by pathologists, recent advances in genomics and sequencing technologies can, not only help in the identification of the Avr genes but also help predict which genes may be useful in the field over a longer period of time. For example, cloning of AvrSr50 showed that virulence in the mutants occurred due to loss-of-heterozygosity events (Chen et al. 2017). It is possible that heterozygosity for AvrSr50 (Avr/avr) may have influenced certain Pgt lineages to the more rapid

6 Genome Improvement for Rust Disease Resistance in Wheat

155

evolution of virulence toward Sr50 (avr/avr). This information can help to decide which resistance genes may be suitable for deployment in a specific geographic location. Additionally, cloning of Avr genes also provides molecular markers that can be useful to survey the spatiotemporal distribution of these genes in rust populations and forecast the evolution of virulence. Bueno-Sancho et al. (2017) used transcriptome genotyping of European stripe rust field isolates to show that races of yellow rust that recently emerged in Europe were like populations identified on a global scale. Moreover, seasonal and varietal specificity in genetic groups of Pst was also studied. Knowing which wheat varieties are susceptible to specific rust isolates prevalent at certain times of the year could help agronomists to guide disease management strategies. The capacity to distinguish between isolates in a pathogen population virulence profiles is often essential to inform disease management approaches. Using the sequence information from 301 global Pst isolates Radhakrishnan et al. (2019), identified a set of 242 genes and assessed them for SNP polymorphism. This helped to develop a Mobile And Realtime PLant disEase (MARPLE) diagnostics, a portable, genomics-based, point-ofcare tool tailored to identify individual strains of complex fungal plant pathogens. Using MARPLE on field samples in Ethiopia the authors managed to identify individual strains, assign strains to distinct genetic lineages that have been shown to correlate tightly with their virulence profiles, and monitor genes of importance, within a short time frame of 48 h. Similar, strategies are being planned for other wheat rusts and will have wider implications on controlling this devastating disease and help towards achieving global food demand. Acknowledgements I am thankful to Dr. Sambasivam Periyannan for useful suggestions and Dr. Narayana Upadhyaya for suggestions and valuable comments on the manuscript.

References Adams MD, Kelley JM, Gocayne JD et al (1991) Complementary DNA sequencing:expressed sequence tags and human genome project. Science 252:1651–1656 Allen AM, Winfield MO, Burridge AJ et al (2017) Characterization of a wheat breeders’ array suitable for high-throughput SNP genotyping of global accessions of hexaploid bread wheat (Triticum aestivum). Plant Biotech J 15:390–401. https://doi.org/10.1111/pbi.12635 Akbari M, Wenzl P, Caig V et al (2006) Diversity arrays technology (DArT) for high-throughput profiling of the hexaploid wheat genome. Theor Appl Genet 113:1409–1420 Aoun M, Kolmer JA, Rouse MN et al (2019) Mapping of novel leaf rust and stem rust resistance genes in the Portuguese durum wheat landrace PI 192051. G3 (Bethesda) 9:2535–2547. https:// doi.org/10.1534/g3.119.400292 Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:796–815 Arora S, Steuernagel B, Gaurav K et al (2019) Resistance gene cloning from a wild crop relative by sequence capture and association genetics. Nat Biotech 37:139–143. https://doi.org/10.1038/ s41587-018-0007-9

156

R. Mago

Arumuganathan K, Earle ED (1991) Estimation of nuclear DNA content of plants by flow cytometry. Plant Mol Biol Rep 9:208–221 Bansal U, Bariana H, Wong D et al (2014) Molecular mapping of an adult plant stem rust resistance gene Sr56 in winter wheat cultivar Arina. Theor Appl Genet 127:1441–1448. https://doi.org/10. 1007/s00122-014-2311-1 Bhattacharya S (2017) Deadly new wheat disease threatens Europe’s crops. Nature 542:145–146 Belton JM, McCord RP, Gibcus JH et al (2012) Hi-C: a comprehensive technique to capture the conformation of genomes. Methods 58:268–276. https://doi.org/10.1016/j.ymeth.2012.05.001 Brenchley R, Spannagl M, Pfeifer M et al (2012) Analysis of the bread wheat genome using whole-genome shotgun sequencing. Nature 491:705–710 Buell CR (2008) Plant genome sequencing methods. Mol Life Sci. https://doi.org/10.1007/978-14614-6436-5_102-2 Bueno-Sancho V, Persoons A, Hubbard A et al (2017) Pathogenomic analysis of wheat yellow rust lineages detects seasonal variation and host specificity. Genome Biol Evol 9:3282–3296. https:// doi.org/10.1093/gbe/evx241 Buermans HPJ, den Dunnen JT (2014) Next generation sequencing technology: advances and applications. Biochem Biophys Acta 1842:1932–1941 Cavanagh CR, Chao S, Wang S et al (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars. Proc Natl Acad Sci, USA 110:8057–8062 Chao S, Sharp PJ, Worland AJ et al (1989) RFLP-based genetic maps of wheat homoeologous group 7 chromosomes. Theor Appl Genet 78:495–504 Chen J, Upadhyaya NM, Ortiz D et al (2017) Loss of AvrSr50 by somatic exchange in stem rust leads to virulence for Sr50 resistance in wheat. Science 358:1607–1610. https://doi.org/10.1126/ science.aao4810 Chen S, Rouse MN, Zhang W et al (2020) Wheat gene Sr60 encodes a protein with two putative kinase domains that confers resistance to stem rust. New Phytol 225(2):948–959. https://doi.org/ 10.1111/nph.16169 Epub 2019 Oct 19 Choulet F, Alberti A, Theil S et al (2014) Structural and functional partitioning of bread wheat chromosome 3B. Science 345:1249721. https://doi.org/10.1126/science.1249721 Clarke J, Wu HC, Jayasinghe L et al (2009) Continuous base identification for single-molecule nanopore DNA sequencing. Nat Nanotechnol 4:265–270. https://doi.org/10.1038/nnano.2009.12 Clavijo BJ, Venturini L, Schudoma C et al (2017) An improved assembly and annotation of the allohexaploid wheat genome identifies complete families of agronomic genes and provides genomic evidence for chromosomal translocations. Genome Res 27:885–896. https://doi.org/10.1101/gr. 217117.116 Collins NC, Drake J, Ayliffe M et al (1999) Molecular characterisation of the maize Rp1-D rust resistance haplotype and its mutants. Plant Cell 11:1365–1376 Consonni C, Humphry ME, Hartmann HA et al (2006) Conserved requirement for a plant host cell protein in powdery mildew pathogenesis. Nat Genet 38:716–720 Crossa J, Burgueño J, Dreisigacker S et al (2007) Association analysis of historical bread wheat germplasm using additive genetic covariance of relatives and population structure. Genetics 177:1889–1913. https://doi.org/10.1534/genetics.107.078659 Dolezel J, Kubalakova M, Bartos J, Macas J (2005) Chromosome flow sorting and physical mapping. In: Meksem K, Kahl G (eds) The handbook of plant genome mapping. Genetic and physical mapping. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, pp 151–171 Dolezel J, Kubalakova M, Suchankova P et al (2005) Flow cytogenetic analysis of the wheat genome. In: Tsunewaki K (ed) Frontiers of wheat bioscience hundredth memorial issue of wheat information service. Yokohama, Kihara Memorial Yokohama Foundation for the Advancement of Life Sciences, pp 3–15 Eid J, Fehr A, Gray J et al (2009) Real-time DNA sequencing from single polymerase molecules. Science 323:133–138. https://doi.org/10.1126/science.1162986

6 Genome Improvement for Rust Disease Resistance in Wheat

157

Ellis JG, Lagudah ES, Spielmeyer W et al (2014) The past, present and future of breeding rust resistant wheat. Front Plant Sci 5:641. https://doi.org/10.3389/fpls.2014.00641 Endo TR, Gill BS (1996) The deletion stocks of common wheat. J Hered 87:295–307. https://doi. org/10.1093 FAO (2011) The state of the world’s land and water resources for food and agriculture (SOLAW)— Managing systems at risk. Food and Agriculture Organization of the United Nations, Rome and Earthscan, London FAO (2017) The future of food and agriculture-trends and challenges. https://www.fao.org/3/a-i65 83e.pdf Faris JD, Gill BS (2002) Genomic targeting and high-resolution mapping of the domestication gene Q in wheat. Genome 45:706–718 Feuillet C, Travella S, Stein N et al (2003) Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc Natl Acad Sci, USA 100:15253–15258 Figueroa M, Hammond-Kosack KE, Solomon PA (2018) A review of wheat diseases—a field perspective. Mol Pl Pathol 19:1523–1536. https://doi.org/10.1111/mpp.12618 Flor HH (1971) Current status of the gene-for-gene concept. Ann RvPhytopathol. 9:275–296. https:// doi.org/10.1146/annurev.py.09.090171.001423 Fu D, Uauy C, Distelfeld A et al (2009) A kinase-START gene confers temperature dependent resistance to wheat stripe rust. Science 323:1357–1360 Gale MD, Devos KM (1998) Comparative genetics in the grasses. Proc Natl Acad Sci USA95:1971– 1974. https://doi.org/10.1073/pnas.95.5.1971 Gessese M, Bariana H, Wong D et al (2019) Molecular mapping of stripe rust resistance gene Yr81 in a common wheat landrace Aus27430. Pl Dis 103:1166–1171. https://doi.org/10.1094/PDIS06-18-1055-RE Gupta P, Balyan H, Edwards K et al (2002) Genetic mapping of 66 new microsatellite (SSR) loci in bread wheat. Theor Appl Genet 105:413–422 Hare RA, McIntosh RA (1979) Genetic and cytogenetic studies of durable adult-plant resistances in ‘Hope’ and related cultivars to wheat rusts. Zeitschrift für Pflanzenzüchtung 83:350–367 He C, Holme J, Anthony A (2014) SNP genotyping: The KASP assay. In: Fleury D, Whitford R (eds) Crop breeding. Methods in molecular biology (Methods and Protocols), vol 1145. Humana Press, New York, NY, pp 75–86 Hiebert CW, Kassa MT, McCartney CA et al (2016) Genetics and mapping of seedling resistance to Ug99 stem rust in winter wheat cultivar Triumph 64 and differentiation of SrTmp, SrCad, and Sr42. Theor Appl Genet 129:2171–2177. https://doi.org/10.1007/s00122-016-2765-4 Huang L, Brooks SA, Li W et al (2003) Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 164:655–664 Hubbard A, Lewis CM, Yoshida K et al (2015) Field pathogenomics reveals the emergence of a diverse wheat yellow rust population. Genome Biol 16:23. https://doi.org/10.1186/s13059-0150590-8 International Wheat Genome Sequencing Consortium (2014) A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 345:1251788. https://doi.org/ 10.1126/science.1251788 IWGSC (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 361: eaar7191 Jia J, Zhao S, Kong X et al (2013) Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation. Nature 496:91–95 Keller B, Wicker T, Krattinger SG (2018) Advances in wheat and pathogen genomics: Implications for disease control. Annu Rev Phytopathol 56:67–87 Khan RR, Bariana HS, Dholakia BB et al (2005) Molecular mapping of stem and leaf rust resistance in wheat. Theor Appl Genet 111:846–850 Kilian A, Huttner E, Wenzl P et al (2005) The fast and the cheap: SNP and DArT-based whole genome profiling for crop improvement. In: Tuberosa R, Phillips RL, Gale M (eds) In the wake

158

R. Mago

of the double helix: from the green revolution to the gene revolution bologna. Avenue media, Bologna, pp 443–461 Klymiuk V, Yaniv E, Huang L et al (2018) Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat Comm 9:3735. https://doi.org/10.1038/s41 467-018-06138-9 Kota R, Spielmeyer W, McIntosh RA, Lagudah ES (2006) Fine genetic mapping fails to dissociate durable stem rust resistance gene Sr2 from pseudo-black chaff in common wheat (Triticum aestivum L.). Theor Appl Genet 112:492–499 Krattinger SG, Lagudah ES, Spielmeyer W et al (2009) A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science 323:1360–1363. https://doi.org/10. 1126/science.1166453 Langner T, Kamoun S, Belhaj K (2018) CRISPR crops: plant genome editing toward disease resistance. Annu Rev Phytopathol 56:479–512. https://doi.org/10.1146/annurev-phyto-080417050158 Leonard KJ, Szabo LJ (2005) Stem rust of small grains and grasses caused by Puccinia graminis. Mol Plant Pathol. 6:99–111. https://doi.org/10.1111/j.1364-3703.2005.00273.x Lazo GR, Chao S, Hummel DD et al (2004) Development of an expressed sequence tag (EST) resource for wheat (Triticum aestivum L.): EST generation, unigene analysis, probe selection and bioinformatics for a 16,000-locus bin-delineated map. Genetics 168:585–593. https://doi.org/10. 1534/genetics.104.034777 Li F, Upadhyaya NM, Sperschneider J et al (2019) Emergence of the Ug99 lineage of the wheat stem rust pathogen through somatic hybridisation. Nat Commun 10:5068. https://doi.org/10.1038/s41 467-019-12927-7 Ling HQ, Zhao S, Liu D et al (2013) Draft genome of the wheat A-genome progenitor Triticum urartu. Nature 496:87–90 Luo M-C, Gu YQ, Puiu D et al (2017) Genome sequence of the progenitor of the wheat D genome Aegilops tauschii. Nature 551:498–502. https://doi.org/10.1038/nature24486 Luo M, Li H, Chakraborty S et al (2019) Efficient TALEN-mediated gene editing in wheat. Plant Biotechnol J 17(11):2026–2028. https://doi.org/10.1111/pbi.13169 Epub 2019 Jun 6 Luo, M., Xie, L., Chakraborty, S. et al. A five-transgene cassette confers broad-spectrum resistance to a fungal rust pathogen in wheat. Nat Biotechnol (2021). https://doi.org/10.1038/s41587-02000770-x Mago R, Bariana HS, Dundas IS et al (2005) Development of broadly useful PCR-markers for the wheat stem rust resistance genes Sr24 and Sr26. Theor Appl Genet 111:496–504 Mago R, Zhang P, Bariana HS et al (2009) Development of wheat lines carrying stem rust resistance gene Sr39 with reduced Aegilops speltoides chromatin and simple PCR markers for markerassisted selection. Theor Appl Genet 124:65–70 Mago R, Lawrence GJ, Ellis JG (2011) The application of DNA marker and doubled-haploid technology for stacking multiple stem rust resistance genes in wheat. Mol Breed 27:329–335 Mago R, Verlin D, Zhang P et al (2013) Development of wheat-Aegilops speltoides recombinants and simple PCR-based markers for Sr32 and a new stem rust resistance gene on the 2S#1 chromosome. Theor Appl Genet 126:2943–2955. https://doi.org/10.1007/s00122-013-2184-8 Mago R, Tabe L, Vautrin S et al (2014) Major haplotype divergence including multiple germin-like protein genes, at the wheat Sr2 adult plant stem rust resistance locus. BMC Pl Bio 14:379. https:// doi.org/10.1186/s12870-014-0379-z Mago R, Zhang P, Vautrin S et al (2015) The wheat Sr50 gene reveals rich diversity at a cereal disease resistance locus. Nat Plants 1:15186. https://doi.org/10.1038/nplants.2015.186 Mago R, Zhang P, Xia X et al (2019) Transfer of stem rust resistance gene SrB from Thinopyrumponticum into wheat and development of a closely linked PCR-based marker. Theor Appl Genet 132:371–382. https://doi.org/10.1007/s00122-018-3224-1 Mallapaty S (2019) Australian gene-editing rules adopt ‘middle ground’. Nature. https://doi.org/ 10.1038/d41586-019-01282-8

6 Genome Improvement for Rust Disease Resistance in Wheat

159

Mantere T, Kersten S, Hoischen A (2019) Long-Read sequencing emerging in medical genetics. Front Genet https://doi.org/10.3389/fgene.2019.00426 McIntosh RA, Partridge M, Hare RA (1980) Telocentric mapping of Sr12 in wheat chromosome 3B. Cereal Res Comm 8:321–324 McIntosh R, Wellings C, Park RF (1995) Wheat rusts: an atlas of resistance genes. CSIRO Publishing, Australia. https://doi.org/10.1007/978-94-011-0083-0 Millet E, Manisterski J, Ben-Yehuda P et al (2014) Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.) Genome 57:1–8. https://doi.org/10.1139/gen-2014-0004 Molnár I, Kubaláková M, Šimková H et al (2014) Flow cytometric chromosome sorting from diploid progenitors of bread wheat, T. urartu, Ae. speltoides and Ae. Tauschii. Theor Appl Genet 127:1091–1104 Moore JW, Herrera-Foessel S, Lan C et al (2015) A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet 47:1494–1498. https://doi.org/10. 1038/ng.3439 Mundt CC (2018) Pyramiding for resistance durability:theory and practice. Phytopathology 108:792–802. https://doi.org/10.1094/PHYTO-12-17-0426-RVW Oliva R, Ji C, Atienza-Grande G et al (2019) Broad-spectrum resistance to bacterial blight in rice using genome editing. Nat Biotechnol 37:1344–1350. https://doi.org/10.1038/s41587-0190267-z Pakeerathan K, Bariana H, Qureshi N et al (2019) Identification of a new source of stripe rust resistance Yr82 in wheat. Theor Appl Genet 132:3169–3176. https://doi.org/10.1007/s00122019-03416-y Park RF (2007) Stem rust of wheat in Australia. Aus J Ag Res 58:558–566. https://doi.org/10.1071/ AR07117 Paux E, Sourdille P, Salse J et al (2008) A physical map of the 1-gigabase bread wheat chromosome 3B. Science 322:101–104 Paux E, Sourdille P, Mackay I, Feuillet C (2012) Sequence-based marker development in wheat: advances and applications to breeding. Biotech Adv 30:1071–1088. https://doi.org/10.1016/j.bio techadv.2011.09.015 Pennisi E (2018) Detailed genome maps paths to better wheat: chromosome-by-chromosome sequence helps navigate crop’s genomic complexity. Science 361(6403):635. https://doi.org/10. 1126/science.361.6403.635 Periyannan S, Moore J, Ayliffe M et al (2013) The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99. Science 341:786–788. https://doi.org/10.1126/ science.1239028 Periyannan S, Milne RJ, Figueroa M et al (2017) An overview of genetic rust resistance: from broad to specific mechanisms. PLoS Pathog 13(7):e1006380 Piffanelli P, Ramsay L, Waugh R et al (2004) A barley cultivation-associated polymorphism conveys resistance to powdery mildew. Nature 430:887–891 Pixley KV, Falck-Zepeda JB, Giller KE et al (2019) Genome editing, gene drives, and synthetic biology: will they contribute to disease-resistant crops, and who will benefit? Annu Rev Phytopathol 57:165–188. https://doi.org/10.1146/annurev-phyto-080417-045954 Putnam NH, O’Connell BL, Stites JC et al (2016) Chromosome-scale shotgun assembly using an in vitro method for long-range linkage. Genome Res 26:342–350 Pretorius ZA, Singh RP, Wagoire WW, Payne TS (2000) Detection of virulence to wheat stem rust resistance gene Sr31 in Pucciniagraminisf. sp. Tritici in Uganda. Plant Dis 84:203 Radhakrishnan GV, Cook NM, Bueno-Sancho V et al (2019) MARPLE, a point-of-care, strain-level disease diagnostics and surveillance tool for complex fungal pathogens. BMC Biol 17:65. https:// doi.org/10.1186/s12915-019-0684-y Ran Y, Patron N, Kay P et al (2018) Zinc finger nuclease-mediated precision genome editing of an endogenous gene in hexaploid bread wheat (Triticum aestivum) using a DNA repair template. Plant Biotechnol J16:2088–2101. https://doi.org/10.1111/pbi.12941

160

R. Mago

Röder MS, Korzun V, Wendehake K et al (1998) A microsatellite map of wheat. Genetics 149:2007– 2023 Rosewarne GM, Singh RP, Huerta-Espino J et al (2006) Leaf tip necrosis, molecular markers and β1-proteasome subunits associated with the slow rusting resistance genes Lr46/Yr29. Theor Appl Genet 112:500–508 Šafáˇr J, Šimková H, Kubaláková M et al (2010) Development of chromosome-specific BAC resources for genomics of bread wheat. Cytogenet Genome Res 129:211–223. https://doi.org/ 10.1159/000313072 Sánchez-Martín J, Steuernagel B, Ghosh S et al (2016) Rapid gene isolation in barley and wheat by mutant chromosome sequencing. Genome Biol 17:221 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci, USA 74:5463–5467. https://doi.org/10.1073/pnas.74.12.5463 Saunders DGO, Pretorius ZA, Hovmøller MS (2019) Tackling the re-emergence of wheat stem rust in Western Europe. Commun Biol 2:51. https://doi.org/10.1038/s42003-019-0294-9 Schachermayr G, Siedler H, Gale MD et al (1994) Identification and localization of molecular markers linked to the Lr9 leaf rust resistance gene of wheat. Theor Appl Genet 88:110–115 Schachermayr GM, Messmer MM, Feuillet C et al (1995) Identification of molecular markers linked to the Agropyronelongatum-derived leaf rust resistance gene Lr24 in wheat. Theor Appl Genet 90:982–990 Sears ER (1954) The Aneuploids of common wheat. University of Missouri, College of Agriculture. Agric Exp Stn Res Bull 572 Sears ER (1966) Nullisomic-tetrasomic combinations in hexaploid wheat. In: Riley R, Lewis KR (eds) Chromosome manipulations and plant genetics. Springer, Boston, MA, pp 29–45 Sears ER, Loegering WQ (1968) Mapping of stem-rust genes Sr9 and Sr16 of wheat. Crop Sci 8:371–373 Shewry PR, Hey SJ (2015) The contribution of wheat to human diet and health. Food Energy Secur 4(3):178–202. https://doi.org/10.1002/fes3.64 Šimková, H, Šafáˇr J, Suchánková P et al (2008) Resource for genomics of Triticeae: BAC library specific for the short arm of rye (Secale cereal L.) chromosome 1R (1RS). BMC Genomics 9:23. https://doi.org/10.1186/1471-2164-9-237 Simons K, Abate Z, Chao S et al (2011) Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.). Theor Appl Genet 122:649–658. https://doi. org/10.1007/s00122-010-1444-0 Singh RP, Hodson DP, Jin Y et al (2015) Emergence and spread of new races of wheat stem rust fungus: continued threat to food security and prospects of genetic control. Phytopathology 105:872–884. https://doi.org/10.1094/PHYTO-01-15-0030-FI Song QJ, Shi JR, Singh S et al (2005) Development and mapping of microsatellite (SSR) markers in wheat. Theor Appl Genet 110:550–560 Sourdille P, Singh S, Cadalen T et al (2004) Microsatellite-based deletion bin system for the establishment of genetic-physical map relationships in wheat (Triticum aestivum L.). Funct Integr Genomics 4:12–25 Spielmeyer W, Sharp PJ, Lagudah ES (2003) Identification and validation of markers linked to broad-spectrum stem rust resistance gene Sr2 in wheat (Triticum aestivum L.). Crop Sci 43:333– 336 Steuernagel B, Periyannan SK, Hernandez-Pinzon I et al (2016) Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture. Nat Biotechnol 34:652–655 Sun GL, Fahima T, Korol AB et al (1997) Identification of molecular markers linked to the Yr15 stripe rust resistance gene of wheat originated in wild emmer wheat, Triticum dicoccoides. Theor Appl Genet 95:622–628 The TT, McIntosh RA, Bennett FGA (1979) Cytogenetical studies in wheat IX. Monosomic analyses, telocentric mapping and linkage relationships of genes Sr21, Pm4, and Mle. Aus J Bio Sci 32:115–125

6 Genome Improvement for Rust Disease Resistance in Wheat

161

Thind AK, Wicker T, Šimková H et al (2017) Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly. Nat Biotechnol 35:793–796. https://doi.org/ 10.1038/nbt.3877 Treangen TJ, Salzberg SL (2011) Repetitive DNA and next-generation sequencing: computational challenges and solutions. Nat Rev Genet 13:36–46. https://doi.org/10.1038/nrg3117 Uauy C (2017) Wheat genomics comes of age. Cur Op Pl Biol 36:142–148. https://doi.org/10.1016/ j.pbi.2017.01.007 Van Deynze AE, Nelson JC, Yglesias ES et al (1995) Comparative mapping in grasses. Wheat Relationships. Mol Gen Genet 248:744–754 Vos P, Hogers R, Bleeker M et al (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23:4407–4414. https://doi.org/10.1093/nar/23.21.4407 Wang ML, Leitch AR, Schwarzacher T et al (1992) Construction of a chromosome-enriched HpaII library from flow-sorted wheat chromosomes. Nucleic Acids Res 20:1897–1901 Wang L, Ma J, Zhou R et al (2002) Molecular tagging of the yellow rust resistance gene Yr10 in common wheat, PI178383 (Triticum aestivum L.). Euphytica 124:71–73 Wang C, Zhang Y, Han D et al (2008) SSR and STS markers for wheat stripe rust resistance gene Yr26. Euphytica 158:359–366 Wang S, Wong D, Forrest K et al (2014) Characterization of polyploid wheat genomic diversity using a high-density 90,000 single nucleotide polymorphism array. Pl Biotechnol J 12:787–796. https://doi.org/10.1111/pbi.12183 Wang Y, Cheng X, Shan Q et al (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol 32:947–951. https:// doi.org/10.1038/nbt.2969 Wang W, Pan Q, He F et al (2018) Transgenerational CRISPR-Cas9 activity facilitates multiplex gene editing in allopolyploid wheat. CRISPR J 1:65–74 Wellings CR, Wright DG, Keiper F, Loughman R (2003) First detection of wheat stripe rust in Western Australia: evidence for a foreign incursion. Australas Pl Pathol 32:321–322 Wenzl P, Suchánková P, Carling J et al (2010) Isolated chromosomes as a new and efficient source of DArT markers for the saturation of genetic maps. Theor Appl Genet 121:465. https://doi.org/ 10.1007/s00122-010-1323-8 William M, Singh RP, Huerta Espino J et al (2003) Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene Yr29 in wheat. Phytopathology 93:153–159 Winfield MO, Allen AM, Burridge AJ et al (2016) High-density SNP genotyping array for hexaploid wheat and its secondary and tertiary gene pool. Plant Biotechnol J 14:1195–1206. https://doi.org/ 10.1111/pbi.12485 Wingen LU, Shaw MW, Brown JKM (2013) Long-distance dispersal and its influence on adaptation to host resistance in a heterogeneous landscape. Plant Pathol 62:9–20. https://doi.org/10.1111/j. 1365-3059.2012.02621.x Wulff BB, Moscou MJ (2014) Strategies for transferring resistance into wheat: from wide crosses to GM cassettes. Front Plant Sci 5:692 You FM, Huo N, Deal KR et al (2011) Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome sequence. BMC Genomics 12:59 Zhang J, Zhang P, Dodds P et al (2020) How Target-Sequence Enrichment and Sequencing (TEnSeq) pipelines have catalyzed resistance gene cloning in the wheat-rust pathosystem. Front Plant Sci 11:67. https://doi.org/10.3389/fpls.2020.00678 Zhou S, Zhang J, Che Y et al (2018) Construction of AgropyronGaertn. genetic linkage maps using a wheat 660K SNP array reveals a homoeologous relationship with the wheat genome. Plant Biotech J 16:818–827 Zimin AV, Puiu D, Hall R et al (2017) The first near-complete assembly of the hexaploid bread wheat genome, Triticum aestivum. Gigascience 6:1–7. https://doi.org/10.1093/gigascience/gix097

Chapter 7

Novel Technologies for Transgenic Management for Plant Virus Resistance Andreas E. Voloudakis, Sunil Kumar Mukherjee, and Anirban Roy

Abstract Global food security is threatened by the rapidly growing human population, by plant pests and diseases, and by climate change. It is estimated that US$ 60 billion loss in crop yields (10–15% global crop yield reduction) each year is due to plant viral diseases. More importantly, viral agents are determined to be responsible for half of the emerging plant diseases worldwide. Plant virus control is accomplished mainly by chemical applications aiming at the vectors transmitting the virus to a new plant contributing to the epidemiology of the disease. The use of chemicals, in some cases, has a significant negative environmental impact and poses human risks, and thus other friendlier strategies of virus control need to be developed. Towards this direction RNA silencing (RNA interference, RNAi), a conserved endogenous pathway of all higher eukaryotes, is exploited as an antiviral method. The silencing inducer molecule is the double-stranded RNA (dsRNA) and the slicing of the target RNA is directed by specific virus-derived small interfering RNAs (vsiRNAs) in collaboration with host-encoded Argonaute enzymes. DsRNAand artificial microRNA-mediated resistance has been exploited in transgenic plants to develop resistance against viruses. The current research efforts (computational and biochemical) focus on determining the more efficacious inducer of RNAi. In this respect, the contribution of the next-generation sequencing and bioinformatics analyses play a crucial role. The antiviral arsenal includes also the novel approach of genome editing for conferring the desired antiviral status in the host plant. This method involves less side-effects on the host gene expression as compared to RNAi related treatments. However, the DNA sequence to be modified (edited) needs to be A. E. Voloudakis (B) Laboratory of Plant Breeding and Biometry, Department of Crop Science, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Greece e-mail: [email protected] S. K. Mukherjee · A. Roy Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi 110066, India e-mail: [email protected] A. Roy e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_7

163

164

A. E. Voloudakis et al.

determined in a laborious and time-consuming process prior to the actual modification. It is vital to determine the molecular/biochemical attributes in the specific plant-virus interaction that will shift the balance towards the resistance of the host to the invading virus. Keywords RNAi · dsRNA · siRNA · RNA silencing · Antiviral resistance · Genome editing

7.1 Introduction Food security and agricultural sustainability are threatened by plant pests and diseases with global yield reduction of 20–40% annually (FAO estimates). The importance of viral diseases in crop production is, even to date, incomplete due to the wide range of crop/plants infected and the agro-ecologies studied, the evolution of pathogenic virus strains or strain combinations, the spread of viruses and virus vectors into new areas -due to human activities and climate change-the variable intensity of relevant research worldwide, and the lack of data on losses plant viruses cause. Nevertheless, it is accepted that plant viruses cause serious damage in agriculture worldwide, with the economic damage estimated to be US$60 billion loss in crop yields worldwide each year (https://en.wikipedia.org/wiki/Plantvirus#citenote-1). This is possibly an underestimated value since crop losses are also caused without obvious exhibition of viral symptoms or due to misinterpretation of viral symptoms for other effects (e.g. plant nutrient deficiencies). Loebenstein (2009) estimated that reduction in global crop yields each year due to plant viruses range 10–15%. Important is also the estimation that viral agents are responsible for half of the emerging plant diseases (Anderson et al. 2004). The control of plant virus and the epidemics they cause is accomplished mainly by chemical control of virus vectors, but it has a significant environmental impact and human risks; Other strategies of virus control include one or a combination of the means (Fig. 7.1) that will be discussed below. Although plants possess numerous methods to resist viral infection, viruses have also evolved means to overcome such resistance. Therefore, in order to shift the balance of host resistance against the invading virus, it is vital to explore the molecular/biochemical attributes of plant-virus interactions. It has become obvious that next-generation sequencing and subsequent bioinformatics analysis have advanced our understanding of small RNA biology. The usefulness of Genomics and in particular the advent of next-generation sequencing, at an affordable cost, should be appreciated in our days where we have in our possession a great amount of genetic information available. Recently, genome editing (CRISPR/Cas 9 and other methods) in plants has been proposed to generate virus resistance (Zaidi et al. 2016), thus increasing the number of approaches available for virus protection. This precision engineering could be accomplished via transgenesis or by employing autonomously replicating virus-based vectors (DNA and RNA viruses) that deliver genome-editing reagents in plants (Zaidi and Mansoor

7 Novel Technologies for Transgenic Management for Plant Virus …

165

Fig. 7.1 Schematic representation of the methods to develop plant resistance against viruses. Blue colored boxes indicate the transgenic approaches; red-colored boxes indicate the non-transgenic approaches. miRNA: micro RNA; vasiRNA: virus activated host siRNA

2017). For example, genome editing against geminiviruses has been achieved (Ali et al. 2016). Resistance against potyviruses was achieved through genome editing of the host-encoded translation initiation factors (eIFs) of the 4E/4G family (Chandrasekaran et al. 2016; Pyott et al. 2016), taking thus advantage of the translational control of plant immunity (Machado et al. 2017).

7.1.1 Plant Resistance to Viruses Viruses depend heavily on host proteins (replication and translational machinery, assistance in virus transport, virion formation) and designated proviral factors to complete their life cycle. In the absence of all the host-encoded proviral factors, where immunity occurs in all cultivars of a particular plant species against all biotypes of a virus, the nonhost resistance (NHR) is established. In the opposite case, the invading virus is armed with the cellular components for infection establishment. NHR is considered the most durable and efficient resistance in plants, however, it has not completely elucidated (Lee et al. 2017). Genes involved in NHR (Fonseca

166

A. E. Voloudakis et al.

and Mysore 2019) could be introgressed or engineered to achieve durable resistance in crops. Plants have evolved several approaches to resist pathogen infection. The host resistance against viruses is mounted at different levels and by various mechanisms, with a number of them still remaining uncharacterized. Resistance against viruses in plants could be established by minimal virus multiplication or by prevention of virus moving outside of the inoculated cells, or by confining the invading virus in a necrotic lesion (outcome of the multicellular hypersensitive response [HR], a type of innate resistance) at the entry site in an interaction designated as incompatible interaction, with the virus replication being reduced in the initially infected cells. Plants undergoing an HR also exhibit systemic acquired resistance (SAR), a pathogen-nonspecific resistance (Gilliland et al. 2006). Robust host resistance against plant pathogens, such as viruses, could be mounted by the deployment of resistance (R) genes (dominant or recessive) where such genetic material exists in the respective host [for reviews see (Soosaar et al. 2005; de Ronde et al. 2014)]. The resistance genes (R) that are deployed usually are monogenic dominant (i.e. Nucleotide-Binding Site and Leucine-Rich Repeat [NBS-LRR] genes) that mostly encode proteins that -directly or indirectly- recognize virally-encoded effectors (avirulence factors, Avr). Pathogens, through some specific gene products, are perceived by two defense systems, namely the pattern-triggered immunity (PTI) and the effector-triggered immunity (ETI) (Tsuda and Katagiri 2010). Lately, it was shown that dsRNA molecules, produced during the life cycle of RNA viruses, are recognized by plants as pathogen-associated molecular patterns (PAMPs) (Niehl and Heinlein 2019) and induce antiviral PTI, thus including PTI in the defense arsenal of plants against plant viruses (Nicaise and Candresse 2016; Niehl et al. 2016). Interestingly, recessive resistance is more frequently found against plant viruses than for other pathogens (Wang and Krishnaswamy 2012); proviral genes mostly fall in the category of recessive resistance genes (more durable). Plants have evolved translational defense mechanisms that impair viral infection, with the host-mediated translational suppression described as an efficient means to specifically suppress viral mRNA translation. Plants have evolved mutations in genes encoding eIFs, which are normally required for viral mRNA translation and infection, and due to functional redundancy of the eIF isoforms, loss-of-function mutations of one isoform could provide virus resistance without compromising plant cell translation and thus growth. As a result, mutation through gene editing of the eIF isoform providing viral resistance (see below) could develop resistant plants (Schmitt-Keichinger 2019). Although a number of recessive host genes conferring virus resistance have been used to engineer virus resistance (Hashimoto et al. 2016), there is a need to identify, characterize more host factors involved in plant-virus interaction and assess their application potential for viral disease control. The main drawbacks of using resistance genes are the time and cost required to develop a resistant cultivar as well as the unavoidable genetic background alteration by conventional breeding, with genetic engineering providing some advantage (Kang et al. 2005). The specificity of dominant R genes is usually confined to a virus

7 Novel Technologies for Transgenic Management for Plant Virus …

167

species or group of highly related species. Unfortunately, there is no natural resistance germplasm available (or not yet identified) for all viruses of economic importance, and that renders the need for alternative means of resistance to be developed. Although genetic resistance is considered to be the most effective approach to control plant pathogens, its durability remains questionable as the viral pathogen frequently overcomes the R-mediated resistance by incorporating a simple point mutation in the Avr product/effector that could result in failure of recognition by the receptor leading to the productive infection. The durability of the resistance against pathogens is a major objective for plant breeding, with resistance against plant viruses requiring to being more durable than other pathogens. The rise of resistance-breaking strains depends on the evolutionary potential of the virus (García-Arenal and McDonald 2003). As the above mechanisms of resistance are considered short-lived, the increase of resistance durability by employing novel strategies is of primary importance. Sometimes plants manifest tolerance to viruses, in which they may exhibit mild or no symptoms as a result of an infection (Bruening 2006). Genes conferring virus tolerance could be numerous and are genetically recessive (Fraser 1990, 1992; Kang et al. 2005; Bruening 2006; Maule et al. 2007). In most cases studied, tolerance is usually associated with a reduced viral titer in the plants. Recovery from infection is observed in some pathosystems, where the initial symptoms of virus infection are replaced by healthy-appearing plant tissue. Exhibition of recovery is associated with reduced virus titers and sequence-specific resistance established ahead of the virus infection in upper, newly formed leaves (Ratcliff 1997; Ratcliff et al. 1999). Although the molecular basis for the exhibition of the recovery phenotype in plants has not been completely unveiled, the role of RNAi has implicated i.e. failure of the virus to prevent antiviral RNAi from being established in the new growth (Ghoshal and Sanfaçon 2015). Plants establish a very strong defense against viruses mostly at the posttranscriptional level, a process known as RNA interference (RNAi), contributing to the innate immune plant response. Viruses in order to bypass this highly potent plant resistance mechanism have evolved virus suppressors of RNAi (VSR), which are functional at various steps of the host’s RNAi pathway (Burgyán and Havelda 2011). RNAi will be discussed in detail later in this chapter. RNA decay pathways compose a conserved mechanism that aids in the endogenous gene expression control via the elimination of dysfunctional transcripts leading to the desired mRNA quality and abundance. With increase in our knowledge of mRNA decay and RNAi, it becomes more apparent that there is a genetic overlap between the two pathways (Christie et al. 2011). RNA quality control (RQC) and RNAi pathways interplay, with the degradation of aberrant RNAs by RQC preventing their entry in the RNAi pathway and thus reducing the amounts of siRNAs produced from those RNAs. Recently, it was found that coat and movement proteins of Tobacco mosaic virus (TMV) play a key role in inducing RNA decay pathways in tobacco impairing RNAi, presumably due to the reduction of the viral siRNAs produced that would lead to malfunction of the siRNA amplification step of RNAi (Conti et al. 2017). Nonsense-mediated decay (NMD), a host RQC mechanism, was proposed to serve

168

A. E. Voloudakis et al.

as a general viral restriction mechanism in plants (Garcia et al. 2014). Study of this plant resistance mechanism, which operates independently of the RNAi mechanism (for RNAi see below), is genetically based and poorly characterized in plants up to now. Cross protection in plants against viruses is a well-known ‘immunization’ phenomenon where a mild virus isolate, upon inoculation onto its host, can protect the host plant against a severe isolate of the same virus (Gal-On and Shiboleth 2006). The molecular mechanism of cross-protection still remains unclear, although several lines of evidence imply that the resistance could be protein- and/or RNA-mediated. Cross protection (and host genetic resistance) against a virus could be at risk if another virus of heterologous genomic sequences infects the same host plant. There are several reports of plant virus synergism in the field (e.g. potyvirus-PVX, CMVTYLCV, etc.). In such a case one virus could suppress the resistance against another virus leading to disease epidemic. Pathogen derived resistance (PDR) (Sanford and Johnston 1985) is considered a scientific development of the above-mentioned cross-protection method. The first attempt to utilize the concept of PDR, namely the introduction of small or long fragments of the virus genome into the plant host genome, resulted in the pioneering work on coat-protein mediated resistance against Tobacco mosaic virus by the Beachy lab (Abel et al. 1986). Since then, multiple strategies have been developed to engineer resistance into transgenic plants. This includes the expression of the target protein (protein-based resistance) or the corresponding RNA molecule (RNA-mediated resistance). PDR has been investigated and used for more than 25 years (Gottula and Fuchs 2009).

7.1.2 Plant Susceptibility to Viruses The outcome of several plant-virus interactions is the establishment of infection, where the invading virus is exploiting the cellular factors of the permissive host. The permissive host harbors all the genetic information encoding for the proviral factors that would support virus infection; these genes were designated as susceptibility (S) genes. Some of these S genes are not necessary for the growth and development of the host or there is a functional redundancy with other genes (see the case of eIF translation factors). The search of susceptibility genes in plant-virus interactions has attracted the interest of the scientific community, especially with the advent of RNAi and genome editing technologies. Such searches in the genomics era, with the bioinformatics tools available, are relatively easy since both transcriptomics and proteomics analyses of plant-virus interactions indicate swelling in the number of potential targets for modification. An up to date list of nonessential proviral factors could be found in (Garcia-Ruiz 2018).

7 Novel Technologies for Transgenic Management for Plant Virus …

169

In addition, experimental procedures such as the yeast-2-hybrid technique, proteomics are tools available to identify host factors that interact with plant viral proteins and/or genome. Plant-virus interactome analysis (e.g. Brizard et al. 2006) could provide host proteins as potential proviral factors; functional validation of which needs to be performed to confirm their positive involvement in infection establishment. Furthermore, one needs to exclude side-effects, if any, that may arise upon modification of a gene having a vital role in plant metabolism and development. Due to their recessive characteristics and heritability, loss-of-susceptibility genes are considered challenging in breeding programs (Pavan et al. 2010). Strategies to develop resistance targeting S genes include TILLING (Targeted Induced Local Lesions IN Genomes), RNAi, and genome editing (Schmitt-Keichinger 2019). Altering the structure or function of a S gene product could provide a broad-spectrum and durable resistance (like the non-host resistance) since the plant-virus compatibility, required for infection, would be lost. Genome edited S genes could be used in resistance breeding as they affect either the viral transcription initiation or alter the proviral function of the translated protein, rendering plants resistant to virus and such an approach is designated as the S-gene approach. S-gene-mediated resistance often accompanies a fitness cost (side-effect), such as reduced growth, yield, fertility, early senescence, and reduced tolerance to abiotic stress, since the S genes usually have function other than their contribution to plant-virus compatibility. As the fitness cost threatens to be the biggest bottleneck in S-gene-mediated resistance (Zaidi et al. 2018), a one-by-one assessment is required in order to determine the usefulness of a modified S gene [S-gene usability scheme proposed by (van Schie and Takken 2014)].

7.1.3 Other Plant Resistance Mechanisms Against Viruses Autophagy is an evolutionarily conserved catabolic process that recycles damaged or unwanted cellular components, and it is required for cellular homeostasis (implicated in the regulation of programmed cell death) and stress tolerance. Although autophagy contributes to plant antiviral immunity, its involvement has not fully clarified as yet. In animals, autophagy exerts its antiviral role against ‘non-self’, such as viruses, by directly degrading virus particles or individual proteins. Successful viruses have evolved means to counteract autophagy. Furthermore, autophagy pathways are exploited by viruses in various ways such as the transport of virions, generation of metabolites and energy for viral replication or suppression of host cell death. The accumulating knowledge, over the past few years, regarding the plant viruses suggests that they interact with autophagy pathways in a similar manner as their animal counterparts. Autophagy could be either antiviral through recognition of viral gene products and lead to their degradation (see TMV, CaMV, CMV, CLCuMuV, TuMV), or could be proviral through the counter-defense pathway administered by the virus and subsequent manipulation of the same (CaMV, TuMV, RSV, Poleovirus,

170

A. E. Voloudakis et al.

Geminivirus) (see Fig. 7.1 in Kushwaha et al. 2019). However, the mechanisms that underlie the specific recognition of the viral material are far from being determined. Further research is mandated to elucidate the plant autophagy receptors and identify the post-translational ‘signatures’ that will result in the cargo to be recognized. It is also important to determine to what extent autophagic degradation of host factors is involved in antiviral defense [e.g. ATG6/Beclin1- (Li et al. 2018); ARGONAUTE1 (Derrien et al. 2012)]. RNA methylation was recently linked to mRNA silencing and/or mRNA decay in plants. In particular, based on co-localization studies, the A. thaliana m6 Ademethylase was suggested to be involved in mRNA silencing and/or mRNA decay (Martínez-Pérez et al. 2017), representing a strategy of controlling cytoplasmicreplicating plant viruses and as a result modulating infection, similar to animal viruses. Ubiquitination, a posttranslational, reversible, and versatile modification of proteins by ubiquitin (Ub) and subsequent degradation by the ubiquitin–proteasome system (UPS) has emerged as a major regulatory process in virtually all aspects of cell biology (Lee et al. 2017). Plant viruses have evolved many ways to exploit/interfere with the UPS system (Alcaide-Loridan and Jupin 2012). Viral proteins exploit the UPS (for examples see Table 1 in Alcaide-Loridan and Jupin 2012) by targeting cellular proteins for degradation, for the benefit of the virus. In other cases, viral proteins are the targets for ubiquitination (for example see Table 2 in Alcaide-Loridan and Jupin 2012). Such ubiquitinations or de-ubiquitinations could constitute another level of regulation of viral infection. A system-wide analysis of the ubiquitination networks that are linked to viral infection is required to determine which modification represents a defense response of the host against the infecting virus. An antiviral strategy may involve the use of small molecules that interact with Ub-related enzymes that are involved in viral infectivity.

7.2 RNAi-Mediated Plant Virus Resistance RNA interference (RNAi) or RNA silencing is an endogenous, sequence-specific, gene expression control mechanism that is present in almost all eukaryotes (Waterhouse et al. 2001; Baulcombe 2004; Csorba et al. 2009). RNAi was first recognized in plants in early 1990s, where it was called post-transcriptional gene silencing (PTGS) (Vaucheret et al. 2001; Lindbo 2012) (see next section). RNAi is triggered by double-stranded RNA (dsRNA) precursor molecules that are detected by the Dicer-like (DCL) proteins -that possess RNase type III-like activityand get cleaved into small RNA (sRNA) duplexes, designated as short interfering (si) RNAs. The majority of the siRNAs have a length of 21 to 24 nucleotides (nt) (Bernstein et al. 2001; Blevins et al. 2006) with specific end-chemistry. The siRNAs, by specifically interacting with a member of the Argonaute (AGO) family of proteins (Hutvagner and Simard 2008), are subsequently incorporated into the effector RNA

7 Novel Technologies for Transgenic Management for Plant Virus …

171

inducing silencing complexes (RISCs). The one strand (passenger strand) of the siRNA is degraded by the innate endonuclease RNase H-like activity of the AGO proteins. The remaining strand (guide strand) serves as the guide molecule that allows RISC to interact in a highly sequence-specific manner with its complementary target mRNA and cleave the target mRNA (Baumberger and Baulcombe 2005). RNA-dependent RNA polymerases (RDRs) (Ding 2010) are enzymes that use single-stranded RNAs as templates to create the complementary strand, thus producing new transitive dsRNA molecules. These transitive duplexes, are in turn, recognized by DCL proteins, generating secondary siRNAs and, as a result, amplifying the pool of siRNAs that can exert an antiviral silencing effect (Garcia-Ruiz et al. 2010; Wang et al. 2010). Research investigation has shown that the cleavage efficiency of the vsiRNAs (the siRNAs of viral origin) varies greatly. Therefore, it is important to identify the most efficient functional siRNAs either by bioinformatics analyses (Kurreck 2006) or biochemical analysis (Gago-Zachert et al. 2019). Gago-Zachert et al. (2019) very recently, in a proof of concept experiment, demonstrated the use of Nicotiana tabacum BY2 cells lysate (BYL), AGO1- & AGO2-immuno-precipitates and subsequent NGS analysis of the small RNAs of the precipitates to select the vsiRNAs with high in vitro cleavage capacity. Notably, the sequences of the selected vsiRNAs exhibited high antiviral activity in plants when they were administered as amiRNAs. Most viruses probably encode RNA silencing suppressors, which prevent one or more steps associated with RNAi (Li and Ding 2006). Silencing suppressors were also found to occur in host plants (Gy et al. 2007). Moreover, plants encode RNAse III-like (RTL) proteins that lack DCL-specific domains (Shamandi et al. 2015), with their role under investigation. For example, RTL1 was up-regulated in Arabidopsis upon virus infection, with its role as anti- or pro-viral needing elucidation. RTL1 was found to suppress the host’s siRNA production pathway by cleaving dsRNA molecules prior to the activities of DCL2, DCL3, and DCL4. It is noteworthy that viral proteins that suppress RNAi were also able to inhibit RTL1 enzymatic activity (Shamandi et al. 2015).

7.2.1 Post-Transcriptional Gene Silencing-Mediated Resistance Against Viruses PTGS (Vaucheret et al. 2001) is an important defense mechanism against viruses that are triggered by viral dsRNA molecules. These dsRNA precursors may arise from replicative viral intermediates, from RNA secondary structures of the viral genome, from the annealing of sense and anti-sense RNAs, or from the action of host RDRs (Ding 2010). The above-mentioned RNAi procedure applies to both RNA and DNA genomes of plant viruses (Baumberger and Baulcombe 2005). RNAi plays a key role in plant defense against viruses (Wang et al. 2012) and has therefore been exploited in plant biotechnology to induce resistance via transgenesis

172

A. E. Voloudakis et al.

(Duan et al. 2012). Genetic material introduced in the host genome includes DNA encoding for hairpin RNAs (hpRNAs), artificial microRNAs (amiRNAs), dsRNA, or siRNAs. The selection of the genetic material was made easy due to the enriched sequence information available for plant viruses, as a result of genomic analyses and the use of next-generation sequencing. It should be noted that viruses have evolved suppressors of RNAi (for a review see Csorba et al. 2015) in order to escape the RNAi mechanism. One could imagine that an evolutionary arms race between hosts and viruses exists with RNAi in the central part. The specificity of RNAi was initially described as high due to the sequence homology of the siRNA with the target mRNA. However, this needs to be revisited since some reports have shown non-specific effects (unintended gene silencing) that are designated as off-target effects (Senthil-Kumar and Mysore 2011). Such unintended gene silencing could affect the outcome of functional gene analyses where RNAi is used as a reverse genetics tool, as well as affect gene expression in non-target organisms (e.g. human and animals) when dsRNA is applied. For the precise selection of sequences to be used in RNAi, bioinformatics tools (e.g. https://plantgrn.noble. org/pssRNAit/) have been developed that perform scanning in genomes of host or non-target organisms for off-target sequences enabling, as a result, the design of more specific RNAi constructs. Biochemical methods for determining efficient cleaving siRNAs were recently documented (Gago-Zachert et al. 2019). RNAi-mediated resistance in transgenic plants could be overcome in the presence of non-targeted virus that possesses an RSS (Simón-Mateo and García 2011). Therefore, the mixed infections in nature are extremely crucial for overcoming the transgenically mounted resistance against a target virus. RNAi could have unpredictable off-target effects (see production of secondary siRNAs, tasiRNAs, etc.) and this may be a great disadvantage of this approach as opposed to stable gene modifications such as the genome editing strategy (Gaj et al. 2013). Here, we provide guidelines to the use of a dominant-negative mutant strategy for the study of host factors and compare the advantages and limitations with other methods.

7.2.2 Transcriptional Gene Silencing-Mediated Resistance Against Viruses RNA-mediated transcriptional gene silencing (TGS) is a conserved phenomenon that occurs in fungi, plants, and animals (Vaucheret and Fagard 2001). In plants, RNAmediated TGS was reported first by Wassenegger et al. (1994), designated as RNAdirected DNA methylation (RdDM), a process essential for suppressing transposons, repairing DNA damage caused by stress, stabilizing the genome and maintaining cell identity, as well as defending against exogenous DNAs (e.g. transgenes). Plants produce 24-nt-long small interfering (si) RNAs and long non-coding (lnc) RNAs (80-nt long) to direct de novo DNA methylation and thus TGS.

7 Novel Technologies for Transgenic Management for Plant Virus …

173

RdDM is mediated by two plant-specific DNA-dependent RNA polymerases, Pol IV and Pol V; Pol IV functions to initiate siRNA biogenesis, while Pol V generates scaffold transcripts that recruit downstream RdDM factors (Pooggin 2013). It was recently found that a class of Dicer-independent non-coding RNAs largely guides RdDM in plants and that siRNAs are required to maintain DNA methylation at only a subset of loci (Yang et al. 2016). RdDM being a nuclear branch of the plant RNA silencing machinery regulates gene expression and defends against invasive nucleic acids such as transposons, transgenes, and viruses. Transcriptional arrest of viral mini-chromosomes (Ghoshal and Sanfaçon 2015) could lead to reduction in infection. However, there is evidence indicating that DNA viruses (geminiviruses and pararetoviruses) most likely evade or suppress RdDM (Pooggin 2013). Specialized mechanisms of replication and silencing evasion could rescue viral DNA mini-chromosomes from repressive methylation, established by the RdDM pathway, interfering thus with the desirable transcriptional and post-transcriptional silencing of viral genes. Epigenetic modifications (i.e. DNA methylation, histone modification) could be useful in an era of epigenetically modified crops (eGMO) that would exhibit desired traits such as resistance to biotic factors. Such eGMO crops are thought to be regulated as non-transgenic and thus acceptable for cultivation worldwide. Issues for further research are the induction and the maintenance of these modifications. The mechanism of heritability of the epigenetic modifications [e.g. trans-generational TGS maintenance (Molinier et al. 2006; Boyko et al. 2010)] is an important issue to be explored, but it does not seem to constitute a universal phenomenon in A. thaliana (Pecinka and Mittelsten Scheid 2012).

7.2.3 MiRNA-Mediated Resistance MicroRNAs (miRNAs) consist of one of the two categories of small non-coding RNAs that regulate gene expression, thus playing a pivotal role in plant development and physiology. They are small (21–22 nt long), non-coding RNAs and their biogenesis depends on Dicer-like 1 (DCL1) (Wang et al. 2019b) with few exceptions, providing flexibility in regulation of gene expression. The mature miRNA is usually loaded into Argonaute 1 (AGO1), forming the RNA-induced silencing complex (RISC) that leads to target mRNA cleavage or translation inhibition (de Felippes 2019). It was recently shown that secondary small interfering RNAs (siRNAs) are produced, upon the synthesis of dsRNAs (aided by RDR6, SGS3, SDE5), exhibiting a characteristic phased pattern (phasiRNAs), that could be involved in miRNAmediated gene expression regulation, acting in cis or in trans [designated as transacting siRNAs (tasiRNAs)] [see Fig. 7.2 in de Felippes 2019). The biogenesis of tasiRNAs is under intense investigation since it provides novel means for regulation of gene expression (de Felippes 2019). The benefit of such an indirect role of miRNA -via the generation of secondary siRNAs- provides advantages in gene expression

174

A. E. Voloudakis et al.

miRNA precursor

DCL1

mature 21 nt miRNAs

miR390

22 nt asymmetric miRNAs

AGO1

AGO1

> Transla) on inhibi) on

AGO7

AGO1/7

AGO1/7

AGO1

AAA

Ribosome

AAA

SGS3

AAA

SGS3

SDE5

SDE5

RDR6

or

RDR6

> PTGS

DCL4

AGO1

DCL4

AAA

AA A

non-phased siRNAs

phased siRNAs

AGO AAA A AA

Fig. 7.2 MicroRNA-mediated gene silencing. Adapted from (de Felippes 2019). Blue colored shapes are indicating Argonaute proteins; green-colored shapes are indicating Dicer-like proteins

regulation such as amplification, enhancement (targeting in cis), and diversification of gene silencing (targeting in trans) via a sequence- and function-unrelated synchronous gene silencing (de Felippes 2019). In addition, miRNA activity expands to the 22-nt-long small RNAs and also has the ability to function under less than 100% homology with its target. Furthermore, miRNA-mediated production of 24-nt-long

7 Novel Technologies for Transgenic Management for Plant Virus …

175

sRNAs leads to DNA methylation and TGS (see above) adding an extra level of regulation of gene expression. Artificial miRNAs (amiRNAs) have been developed containing the desired sequences with homology to the genomes of plant viruses. These amiRNAs were introduced in transgenic plants and conferred resistance against targeted viruses (Niu et al. 2006; Ai et al. 2011; Vu et al. 2013). AmiRNAs could be designed in silico for high specificity and prevention of off-target effect [P-SAMS, https://p-sams.car ringtonlab.org (Fahlgren et al. 2016)]; a detailed description of amiRNA designing and high-throughput generation of constructs could be found in Carbonell (2019a). In addition, it was found that certain structural features in amiRNAs may increase resistance (Zhang et al. 2019). MiRNA-induced gene silencing (MIGS) could be triggered by 22-nt-long miRNAs such as miR173 (in A. thaliana & closely related species), miR1514a.2, as well as the 21-nt-long miR390 (De Felippes et al. 2012) that is fused upstream (in cis) of the targeted sequence (triggering the production of phasiRNAs from target transcripts leading to gene silencing). MIGS (Fig. 7.1 in Carbonell 2019b) has been widely used to confer antiviral resistance as well as in gene function studies (for example, see Table 1 in Carbonell 2019b). Resistance against tomato leaf curl viruses has been developed both in tobacco and tomato using the principles of phasiRNAs (Singh et al. 2015, 2019). It should be noted that diverse miRNAs function as negative transcriptional regulators of targeted NBS-LRR genes in plants. Study of this miRNA-NBS-LRR regulatory system in 70 plants resulted in the observation that duplicated NBS-LRRs from different gene families periodically gave birth to new miRNAs. Most of these newly emerged miRNAs target the same conserved, encoded protein motif of the NBSLRRs; therefore diversification of NBS-LRR resistance genes directs the evolution (convergent) of the miRNAs that target them (Zhang et al. 2016).

7.2.4 TasiRNA-Mediated Plant Resistance Many secondary 21-nt-long siRNAs are produced by successive DCL cleavage and are called phased siRNAs (phasiRNAs). A portion of these secondary siRNAs are able to repress one or more targets in trans (in distance to their locus of origin) and thus were designated trans-acting siRNAs (tasiRNAs); most tasiRNAs belong to the phasiRNAs. Non-coding RNA molecules, from PHAS (or TAS) genes, were found to give rise to phasiRNAs (their biogenesis is initiated when 22-nt-long miRNAs cleave singlestranded target RNAs) downregulating different genes having sequence homology with the mature phasiRNAs. Gene families of tasiRNAs have been identified in A. thaliana, as well as other plants; this area of research is under intense investigation in order to discover secondary siRNA-producing loci (TAS or PHAS loci). TasiRNAs are involved in gene silencing in trans, but also cleave the transcript of origin in cis acting as regulatory feedback machinery.

176

A. E. Voloudakis et al.

Furthermore, the requirement of elements such as RDR6, SGS3, SDE5, and AGO7 to be present in the same cell, raises the possibility of another level of regulation in the production of phasiRNAs. The structure of the pre-miRNA has been exploited for gene expression control purposes, adding to the armoire available, which include the amiRNA and hpRNAi systems (see Fig. 3 in de Felippes 2019). Artificial tasiRNAs (atasiRNAs) or synthetic tasiRNAs (syn-tasiRNAs) have also been developed to exploit the miRNA-triggered biogenesis of secondary siRNAs to downregulate plant genes and control virus as well as viroid infections (Carbonell 2019b). In this method, a control sequence required for biogenesis of tasiRNA is introduced at either the 5 end or both at the 5 and 3 ends of the desired transcript. The advantage of this technique is the fact that one precursor TAS-like transcript could contain a number of tasiRNAs each targeting a different sequence. This method has the advantage of achieving high levels of specificity and thus low off-targeting effect. AtasiRNAs or syn-tasiRNAs could be engineered in a TAS precursor that upon processing into phasiRNAs the 5 -U siRNAs will be incorporated into AGO1 for silencing; such an approach could be multiplexed for silencing of multiple transcripts (with sequence homology or not) at one or more sites (for examples see Table 1 in Carbonell 2019b) leading to highly specific silencing as well as less prone for resistance breaking development. Furthermore, spatio-temporal expression of TAS transgenes, by using specialized promoters, would allow silencing to occur in desired space and time. The design of atasiRNAs is simple and has been automated (Carbonell et al. 2014; Carbonell 2019a) rendering this approach attractive for gene silencing.

7.2.5 VasiRNA-Mediated Plant Resistance It has been well established that virus infection perturbs the physiological RNA (messenger and small RNA) metabolism of the host plant. Virus-derived siRNAs are small RNAs that derive from the virus genome and have the ability to silence endogenous genes (e.g. Miozzi et al. 2013; Yang et al. 2018) via PTGS. Furthermore, host virus-activated siRNAs (vasiRNAs) have been identified in A. thaliana-CMV (Cucumber mosaic virus) pathosystem (Cao et al. 2014) and recently in tomatoTYLCV (Tomato yellow leaf curl virus) pathosystem (Nitin et al., unpublished data). VasiRNAs are thought to constitute another sequence-specific antiviral mechanism (Cao et al. 2014). In particular, an increase in two tomato TYLCV-induced vasiRNAs was corelated with a decrease in targeted host gene expression (Nitin et al., unpublished data).

7 Novel Technologies for Transgenic Management for Plant Virus …

177

7.3 Epigenetics-Mediated Plant Virus Resistance Plants have evolved multiple mechanisms to respond to viral infection. These responses have been studied in detail at the level of host immune response and antiviral RNA silencing (RNAi). However, information about epigenetic reprogramming is in its infancy and it is an area of intense research. Epigenetic modification that deals with heritable alterations in the phenotype without changes in DNA sequence offer significant advantages in areas where alteration of phenotype through transgenic means gives rise to concerns on biosafety aspect.

7.3.1 Viral Infection Reprograms Host Methylome RNA-dependent DNA methylation (RdDM) is the major pathway that leads to epigenetic modification in host plants. RdDM was identified (Wassenegger et al. 1994), its complexity was highlighted (Matzke and Mosher 2014); and the RdDM pathway has been thoroughly described in Arabidopsis (Zhang et al. 2018). It has been shown that environmental factors are a major force shaping plant epigenomes (Wang et al. 2019a). However, recent studies have shown that epigenetic modifications could also occur in plants upon viral infections (Diezma-Navas et al. 2019). It has been demonstrated that the genes involved in the RdDM pathway, such as RDR2, Pol V, AGO6 were activated in the TRV-infected Arabidopsis. Besides those genes, down- and up-regulation of ROS1 demethylase and MET1 methyltransferase were also observed at 7 and 14 dpi, respectively. The data thus supported the idea that methylation and demethylation occur in response to viral infections. Furthermore, several transposon elements (ATCOPIA93, ATGP2N, ATREP5), located in disease resistance clusters, were found activated/derepressed in TRV-infected Arabidopsis (Diezma-Navas et al. 2019), suggesting that these promoter-associated transposon elements may influence expression of disease resistance genes. DNA methylation ultimately leads to TGS. Since similar data were obtained with defense genes of Arabidopsis to fungal pathogens, a general working model was proposed where transcriptional repression of resistance genes occur in the absence of pathogen, but DNA demethylation activates defense response. To this extent, increased cytosine methylation was detected at a promoter sequence of the RCY1 gene (NBS-LRR category of R genes) that correlated with compromised resistance to CMV(Cucumber mosaic virus) in A. thaliana (Sato et al. 2017).

7.3.2 Methylation of Viral Genomes and Proteins Plant DNA viruses (e.g. Geminiviridae family possessing ssDNA genomes) could be targeted via DNA methylation of their genomes. Such DNA methylation of DNA

178

A. E. Voloudakis et al.

viral genomes is also important for basic research focusing on DNA methylation in plants. In addition, such DNA methylation results in TGS that restricts in planta proliferation of the virus, a result that provides plant resistance against the invading virus. TGS reduces transcription and movement of the DNA virus leading to host recovery (no disease phenotype in the new growth) with the virus titer to be very low to non-detectable (Rodriguez-Negrete et al. 2009). In addition to TGS, the transcriptional product from the DNA viral genome could be subject to PTGS (Wang et al. 2012). Episomal pararetroviruses could generate pre-genomic RNA from integrated DNA in the host genome and such an event could be prevented by RdDM (Pooggin 2013). The discovery that some virus-encoded RNA silencing suppressors (e.g. C2/AC2, C4/AC4, and V2/AV2 [Geminiviruses], HC-Pro [Potyviruses], 2b [Cucumoviruses] act as inhibitors of virus genome methylation and regulators of DNA methylation allow these proteins to affect the dynamics of DNA methylation in the plant-virus interactions. RNA methylation, namely RNA-based N6 -methyladenosine (m6 A) was demonstrated to control cytoplasmic replicating RNA virus (Brocard et al. 2017). As mentioned above, the A. thaliana m6 A-demethylase was suggested to be involved in mRNA silencing and/or mRNA decay, modulating infection (Martínez-Pérez et al. 2017). Protein methylation, of CMV 1a protein has been reported that promotes the systemic spread of the virus in tobacco (Kim et al. 2008). These authors reported the identification of a novel methyltransferase (Tcoi1) responsible for such CMV 1a protein methylation; reduction of Tcoi1 expression resulted in a decrease in CMV infection. Histone methylation has not been reported as yet to be triggered by Geminiviruses although it is RdDM dependent. However, recently TYLCV V2 was found to interact with histone deacetylase 6 and suppress methylation-mediated TGS in plants (Wang et al. 2018a). In addition, CLCuMuV (Cotton leaf curl Multan virus) V2 directly interacts with Nicotiana benthamiana AGO4 (NbAGO4), and can suppress RdDM and TGS (Wang et al. 2019c).

7.3.3 Methylation of Host Genes-Mediated Plant Resistance The methylome of both host and virus is altered during plant-virus interaction. Virusinduced host plant genes are transcriptionally regulated via DNA methylation (Ding and Wang 2015). CMV (Cucumber mosaic virus)-infected tobacco had differential methylated regions, enriched with CHH sequence contexts, 80% of which are located on the gene body to regulate gene expression temporarily (Wang et al. 2018b). It was found

7 Novel Technologies for Transgenic Management for Plant Virus …

179

that the methylated genes depressed by methyltransferase inhibition largely overlapped with methylated genes in response to viral invasion. In case the specific desirable DNA methylation status is primed prior to virus invasion, the antiviral plant resistance would presumably be mounted leading to epigenetic-mediated resistance.

7.4 Genome Editing of Host Genes for Plant Virus Resistance Genome editing (GE) is a novel approach that could modify a small number of nucleotides using sequence-specific nucleases in a gene/target. The GE systems (GES) include the Meganucleases, ZFNs, TALENs, and CRISPR/Cas9 (Chen et al. 2019) and could induce DNA modifications via stable or non-stable Agrobacteriummediated transformation by targeting directly the virus genome or the host genetic information that is needed for the completion of the virus life cycle. All the abovementioned GE systems have been used for antiviral defense in plants (Romay and Bragard 2017; Langner et al. 2018) in order to achieve precision resistance breeding. The majority of the GE efforts for antiviral defenses target Geminiviruses and Potyviruses. Compared with other plant’s viral disease management strategies (e.g. RNAi), this system is more accurate, more stable in gene expression regulation, has less off-target effects, and-most importantly-could have a broader spectrum and durable resistance to the virus. The CRISPR/Cas approach dominates the GE area since its more affordable, simple, and efficient when compared to the ZFNs and TALENs. The examples where GE was used to modify susceptibility genes of hosts are limited -as yet- since the proviral factors of the host need extensive functional studies. GE of susceptibility genes of hosts against plant viruses using the CRISPR/Cas approaches mainly restricted to the well-established translation factor eIF family that has been established to interact with viral protein and RNA (Sanfaçon 2015). In this respect, Cucumber vein yellowing virus (Ipomovirus, Potyviridae) (Pyott et al. 2016) and Zucchini yellow mosaic virus, Papaya ringspot virus, and Turnip mosaic virus (Potyvirus, Potyviridae) (Pyott et al. 2016) were found to be controlled upon GE of the eIF translation factor. Efforts employing protein–protein interaction techniques such as yeast-2-hybrid will identify the potential target genes as well as the gene position of the DNA modification.

7.4.1 Resistance Genes Plant resistance genes have the ability to evolve at a faster pace than the rest of the plant genome in order to cope with their rapidly evolving pathogens.

180

A. E. Voloudakis et al.

Engineering resistance gene variants encoding proteins that recognize a broader range of effectors using in vitro DNA evolution or rational design or exploitation of domains in resistant proteins that could act as effector baits would add to the resistance gene arsenal for use in resistance breeding. Advances in the understanding of the function of resistant proteins would provide the opportunity to develop synthetic immune receptors. Directed evolution has been tried to improve a plant disease resistance gene in a stepwise manner (Harris et al. 2013). These authors have improved in vitro (artificial evolution) the binding capability of Rx protein (a NB-LRR resistance protein) extending the resistance to another strain of PVX (Potato virus X) as well as to the distantly related PoPMV (Poplar mosaic virus). The cost/benefit trade-offs of the developed mutant proteins should always be studied [(a necrosis spreading mutation (involving cost) had to be mitigated by another mutation in Rx (Harris et al. 2013)]. Plant resistance gene analogs (RGAs) (Sekhwal et al. 2015) provide a wealth of natural genetic variation that could be useful in providing resistance through gene evolution (natural or artificial).

7.4.2 Susceptibility Genes S genes could function as negative regulators of immunity or encode proteins involved in plant development. Impairment of S genes could lead to recessive resistance (e.g. mlo in barley-mildew resistance). Candidate S-gene products could be targets of pathogen effectors (binding or modifying) with the modified S-gene product suppressing the immunity pathway leading to disease. CRISPR/Cas9 was employed to develop genetic resistance against Turnip mosaic virus (TuMV) in A. thaliana by deletion of eIF(iso)4E (Pyott et al. 2016) and against Cucumber vein yellowing virus, Zucchini yellow mosaic virus and Papaya ring spot mosaic virus-W in cucumber by disrupting eIF4E (Chandrasekaran et al. 2016). Along the same lines, it was shown that activation of the trans-membrane immune receptor NIK1 [nuclear shuttle protein (NSP)-interacting kinase 1] promotes the down-regulation of translational machinery associated genes, culminating in the inhibition of viral and host mRNAs translation, which causes an increase in tolerance to begomoviruses (Zorzatto et al. 2015).

7.4.3 Concerns on Genome Editing Considerations on genome editing include the specificity (or the off-target effects), the metabolic cost involved with the modification, and the possible interaction with the endogenous RNAi mechanism (gRNA may be converted in planta to dsRNA by RdRPs and thus subjected to dicing resulting in gRNA reduction).

7 Novel Technologies for Transgenic Management for Plant Virus …

181

The disease resistance that would result from modification of S genes is mostly recessive and associated with some fitness cost, the latter being a concern for achieving high-yielding crops (Zaidi et al. 2018). Concerns in the scientific community raised that the European Court of Justice ruled on 25 July 2018 (Case C-528/16) that gene-edited crops should be subject to the same stringent regulations that govern conventional genetically modified (GM) organisms (Callaway 2018; Ledford 2019), extending the GMO directive (2001/18) to the gene-edited organisms. This EU’s highest court decision has raised comments and a dispute (Gelinsky and Hilbeck 2018) with the regulatory framework for precision breeding currently to be evolving in EU (Eriksson 2019).

7.5 Protein/Peptide-Mediated Virus Resistance 7.5.1 Plantibodies Antibodies produced in plants were first described by Hiatt (Hiatt et al. 1989) and were designated as plantibodies. Plantibodies is one of the major groups of pharmaceutical proteins produced in plants (Ma et al. 2003). Many different forms of recombinant antibodies (intact antibodies, Fab, scFv, diabody) were functionally expressed in different plants. Such molecules, with a specificity in recognition of the coat protein, replicase or protease, and movement proteins of viruses could be utilized to neutralize plant viruses resulting in the plantibody-mediated resistance in plants (Liao et al. 2006). Expression of antibodies in the plant cytoplasm is generally difficult but has been circumvented by using scFv that are needing minor post-translational processing. Such cytoplasmic expression of recombinant antibodies against a plant virus is favored since most processes of plant viral infection occur in the plant cytosol. Transgenic tobacco expressing scFVs against the coat protein of AMCV (Artichoke mottled crinkle virus) in the cytoplasm showed reduction of the viral infection (Tavladoraki et al. 1993). A similar approach with TMV resulted in reduction of viral infectivity by 90% (Zimmermann et al. 1998). Transgenic plants expressing recombinant antibodies on plant cell surface showed resistance to TMV (Schillberg et al. 2000). Transgenic tobacco expressing scFV antibodies against a conserved domain of RNAdependent RNA polymerase (virus-encoded) exhibited high levels of resistance to four plant viruses from different genera (Boonrod et al. 2004), paving the way to achieve broad-spectrum resistance. Production of bivalent biscFv antibodies (Fischer et al. 1999) may generate improved resistance against plant viruses. There are several considerations associated with the use of the plantibodymediated virus resistance, such as Identification and isolation of the gene encoding the recombinant antibody, plant transformation and regeneration of transgenic plants of the desired species, expression, and assembly of recombinant functionally active

182

A. E. Voloudakis et al.

antibody in transgenic plants, cellular compartment localization as well as degradation of recombinant antibody in plant cytosol (Liao et al. 2006). However, the plantibody approach has limited potential risk for speeding up virus evolution and thus has lesser chance to create new virulent viruses as compared to the pathogen-derived resistance approaches (Aaziz and Tepfer 1999; Tepfer et al. 2015).

7.5.2 Aptamers Peptide aptamers are short peptides (20–30 aa) designed or selected from a random peptide library to bind to specific proteins and thus interfering with the function of those proteins (Colas et al. 1996). Application of peptide aptamers to impart resistance against plant viruses has been reviewed earlier (Sera 2017). Expression of aptamers in the cytoplasm has an advantage as compared to plantibody production in the cytoplasm. In addition, this approach would have minimal deleterious effects on the host as compared to the expression of functional viral proteins (e.g. in some cases of PDR) since peptide aptamers contain only minimum functional domains. The peptide aptamer technology was first applied targeting the nucleoprotein of Tomato spotted wilt virus (TSWV) (Rudolph et al. 2003). It was shown that when a selected 29 aa-long aptamer was expressed in transgenic plants it exhibited complete resistance to TSWV infection. Peptide aptamers that bind to Geminivirus replication proteins were found to confer resistance against Tomato yellow leaf curl virus and Tomato mottle virus infection in tomato (Reyes et al. 2013). Other examples could be found in Table 1 (Sera 2017). In addition, targeting of evolutionary conserved functions of viral proteins in planta could engineer broad-spectrum resistance. Besides the peptide aptamers, other types of peptides/proteins, namely cationic peptides and artificial zinc finger proteins, have been suggested as potential tools to confer plant virus resistance by inhibiting functions of viral proteins (Sera 2017). One of the most important considerations associated with the use of aptamers is the selection of functionally efficient aptamers (by random peptide library, phage display, mRNA display, ribosome display, yeast-two-hybrid system). A directed evolution (Lassner 2001) approach could be employed in order to improve the binding efficiency of aptamers to the targeted viral proteins.

7.6 Conclusions and Future Prospects Conventional plant breeding and genetic engineering approaches have been used to generate virus-resistant plants. Although conventional resistance breeding has improved the productivity of some crops, serious limitations such as the few sources of natural resistance, the genetic nature of the resistance, and the time required for

7 Novel Technologies for Transgenic Management for Plant Virus …

183

a breeding program to complete, discourage its use. Furthermore, resistant-breaking viral mutants, the association with a satellite or the synergy with another virus in planta (mixed viral infections), as well as the change in local climate could also be considered key issues for resistance failure in the field when developed cultivars are released. Several transgenic strategies based on PDR have been suggested (amiRNA, antisense RNA, RNAi, mutant viral proteins). Other genetic engineering strategies that confer some level of resistance include virus-inducible expression of toxic proteins to kill infected cells, proteins binding to viral replication origins, and proteins that bind to virus particles and interfere with insect transmission. A new transgene-based hostinduced gene silencing (HIGS) strategy was developed in order to protect plants from vectors of plant viruses such as insects (Hunter et al. 2012) and nematodes (Tamilarasan 2012). In this method, the transgenic plant produces dsRNA or siRNAs of a key endogenous gene of the insect; uptake of these dsRNA/siRNAs will lead to the silencing of the gene in the insect and as a result reduction of the pest population, which is a desirable outcome that greatly affects virus disease epidemics. Basic research in biochemical pathways that may exist prior to and/or in parallel or interplay with the RNAi pathway will spark new ideas for virus control. Advances in the area of plant amplicon discovery could lead to the development of molecules/vehicles that could produce dsRNAs in planta continuously, thus contributing in a long-lasting resistance. Circular molecules have been computationally identified in plants and this could pave the way of developing useful amplicons. A non-transgenic approach, taking advantage of the highly potent antiviral RNAi has been found to confer resistance in several pathosystems (Voloudakis et al. 2015; Mitter et al. 2017; Kaldis et al. 2018; Konakalla et al. 2019; Namgial et al. 2019; Vadlamudi et al. 2020). Such exogenous application of dsRNA could be an alternative in parts of the world where transgenics are not allowed for cultivation, in cases of recalcitrant to transgenesis crops, and for faster response to the development of a virus epidemic. Besides the practical benefits of the ‘dsRNA vaccination’, such a method offers the advantage of a quick screen of RNAi-efficient molecules (e.g. determine the minimum length needed for an efficient RNAi construct) and of selecting those constructs having a low risk for off-target effects. Such a novel method could be introduced in the armoire of methods to improve plant resistance against invading viruses. The exceptional evolutionary plasticity of RNA viruses threatens the durability of the resistance based on RNAi [e.g. conferred by amiRNAs (Martínez et al. 2012)]. The use of NGS and bioinformatics analyses has shown that viral populations not experiencing strong selective pressure, from e.g. an antiviral amiRNA, may already contain enough genetic variability in the target sequence to escape plant resistance. NGS analysis of population dynamics of virus escape mutants in RNAi-mediated resistant plants showed that viral populations exposed to sub-inhibitory concentrations of an e.g. antiviral amiRNA speed up this process (Martínez et al. 2012). The same authors conclude that viral evolution in fully susceptible plants results from an

184

A. E. Voloudakis et al.

equilibrium between mutation and genetic drift, whereas evolution in partially resistant plants originates from more complex dynamics involving mutation, selection, and drift (Martínez et al. 2012). Efforts leading to intervention in virus evolution will be instrumental for a durable resistance phenotype. Natural plant virus genetic diversity plays a crucial role in the development of new diseases on cultivated plants, especially in a temperature-changing environment. Investigations deciphering the existing diversity of plant viruses (e.g. RodríguezNegrete et al. 2019) in nature becomes easier with the use of NGS technologies (especially the single-molecule NGS) rendering ecogenomics, an emerging research sector in plant-virus interactions. Such analyses will deepen our knowledge of viral diversity, evolution, and could assist in the selection of the most effective means of resistance. Genome editing offers a great promise for precision breeding in agriculture as a whole, including the development of virus-resistant crops. Development of dominant-negative gene-edited proteins (e.g. mutated or amino-terminally truncated Rep protein) would be desirable. Specificity in gene editing is of primary importance since off-target effects proposed cause biosafety concerns, and as a result, discovery of the means (e.g. computational analysis, etc.) that would limit off-target effects are of first priority. GE may be associated with a metabolic cost in plants and this needs to be determined and addressed. The interaction of GE with RNAi (vsiRNAs) should be unveiled since gRNAs of GE maybe converted in planta to dsRNA by RdRPs and thus subjected to dicing resulting in gRNA reduction rendering GE less efficient. Epigenetics-mediated resistance seems to be another approach to be used in the future when the induction of RdDM (and chromatin modifications) and heritability are more controllable. The issue of heritability (e.g. trans-generational TGS maintenance) has been debated and it is not to be a universal phenomenon (Pecinka and Mittelsten Scheid 2012). Priming epigenetic control of defense signaling in plants (Espinas et al. 2016) would be highly advantageous. From the above-mentioned discussions, it becomes evident that in order for plant resistance against viruses to be mounted an orchestrated regulation in gene expression of the host is required. One or a combination of the available resistance mechanisms could be exploited in order to achieve a resistance phenotype. Acknowledgements Members of the Voloudakis’ group at the Agricultural University of Athens, Greece are acknowledged for their research contributions and discussions. Part of the data presented in this review have been obtained in the frame of the projects: (a) ‘Pythagoras II’ funded by General Secretariat of Research and Technology of Greece. (b) ‘sRNAvac’ funded by General Secretariat of Research and Technology of Greece. (c) ‘COST FA0806 funded by Cooperation in Science & Technology (COST), EU. (d) ‘Erasmus Mundus Action BRAVE’ funded by Education, Audiovisual and Culture Executive Agency, EU.

7 Novel Technologies for Transgenic Management for Plant Virus …

185

References Aaziz R, Tepfer M (1999) Recombination in RNA viruses and in virus-resistant transgenic plants. J Gen Virol 80:1339–1346 Abel P, Nelson R, De B, Hoffmann N, Rogers S, Fraley R, Beachy R (1986) Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232:738–743 Ai T, Zhang L, Gao Z, Zhu CX, Guo X (2011) Highly efficient virus resistance mediated by artificial microRNAs that target the suppressor of PVX and PVY in plants. Plant Biol 13:304–316 Alcaide-Loridan C, Jupin I (2012) Ubiquitin and plant viruses, let’s play together! Plant Physiol 160:72–82 Ali Z, Ali S, Tashkandi M, Zaidi SSEA, Mahfouz MM (2016) CRISPR/Cas9-mediated immunity to geminiviruses: differential interference and evasion. Sci Rep. https://doi.org/10.1038/srep26912 Anderson PK, Cunningham AA, Patel NG, Morales FJ, Epstein PR, Daszak P (2004) Emerging infectious diseases of plants: pathogen pollution, climate change and agrotechnology drivers. Trends Ecol Evol 19:535–544 Baulcombe D (2004) RNA silencing in plants. Nature 431:356–363 Baumberger N, Baulcombe DC (2005) Arabidopsis ARGONAUTE1 is an RNA Slicer that selectively recruits microRNAs and short interfering RNAs. Proc Natl Acad Sci 102:11928–11933 Bernstein E, Caudy AA, Hammond SM, Hannon GJ (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363–366 Blevins T, Rajeswaran R, Shivaprasad PV, Beknazariants D, Si-Ammour A, Park H-S, Vazquez F, Robertson D, Meins F, Hohn T et al (2006) Four plant dicers mediate viral small RNA biogenesis and DNA virus induced silencing. Nucleic Acids Res 34:6233–6246 Boonrod K, Galetzka D, Nagy PD, Conrad U, Krczal G (2004) Single-chain antibodies against a plant viral RNA-dependent RNA polymerase confer virus resistance. Nat Biotechnol 22:856–862 Boyko A, Blevins T, Yao Y, Golubov A, Bilichak A, Ilnytskyy Y, Hollander J, Meins F, Kovalchuk I (2010) Transgenerational adaptation of arabidopsis to stress requires DNA methylation and the function of dicer-like proteins. PLoS ONE 5:e9514 Brizard JP, Brugidou C, Carapito C, Delalande F, Van Dorsselaer A, Brugidou C (2006) Proteome analysis of plant-virus interactome: comprehensive data for virus multiplication inside their hosts. Mol Cell Proteomics 5:2279–2297 Brocard M, Ruggieri A, Locker N (2017) m6A RNA methylation, a new hallmark in virus-host interactions. J Gen Virol 98:2207–2214 Bruening G (2006) Resistance to infection. In: Loebenstein G, Carr JP (eds) Nature resistance mechanics plants to viruses. Springer, Netherlands Dordrecht, pp 211–240 Burgyán J, Havelda Z (2011) Viral suppressors of RNA silencing. Trends Plant Sci 16:265–272 Callaway E (2018) CRISPR plants now subject to tough GM laws in European union. Nature 560:16 Cao M, Du P, Wang X, Yu Y-Q, Qiu Y-H, Li W, Gal-On A, Zhou C, Li Y, Ding S-W (2014) Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis. Proc Natl Acad Sci USA 111:14613–14618 Carbonell A (2019a) Design and high-throughput generation of artificial small RNA constructs for plants. Methods Mol Biol 247–260 Carbonell A (2019) Secondary small interfering RNA-based silencing tools in plants: an update. Front Plant Sci 10:1–5 Carbonell A, Takeda A, Fahlgren N, Johnson SC, Cuperus JT, Carrington JC (2014) New generation of artificial microRNA and synthetic trans-acting small interfering RNA vectors for efficient gene silencing in Arabidopsis. Plant Physiol 165:15–29 Chandrasekaran J, Brumin M, Wolf D, Leibman D, Klap C, Pearlsman M, Sherman A, Arazi T, Gal-On A (2016) Development of broad virus resistance in non-transgenic cucumber using CRISPR/Cas9 technology. Mol Plant Pathol 17:1140–1153 Chen K, Wang Y, Zhang R, Zhang H, Gao C (2019) CRISPR/Cas genome editing and precision plant breeding in agriculture. Annu Rev Plant Biol 70:667–697

186

A. E. Voloudakis et al.

Christie M, Brosnan CA, Rothnagel JA, Carroll BJ (2011) RNA Decay and RNA silencing in plants: competition or collaboration? Front Plant Sci. https://doi.org/10.3389/fpls.2011.00099 Colas P, Cohen B, Jessen T, Grishina I, McCoy J, Brent R (1996) Genetic selection of peptide aptamers that recognize and inhibit cyclin-dependent kinase 2. Nature 380:548–550 Conti G, Zavallo D, Venturuzzi AL, Rodriguez MC, Crespi M, Asurmendi S (2017) TMV induces RNA decay pathways to modulate gene silencing and disease symptoms. Plant J 89:73–84 Csorba T, Kontra L, Burgyán J (2015) Viral silencing suppressors: tools forged to fine-tune hostpathogen coexistence. Virology 479–480:85–103 Csorba T, Pantaleo V, Burgyán J (2009) RNA silencing: an antiviral mechanism. Adv Virus Res 75:35–71 De Felippes FF, Wang JW, Weigel D (2012) MIGS: MiRNA-induced gene silencing. Plant J 70:541– 547 de Ronde D, Butterbach P, Kormelink R (2014) Dominant resistance against plant viruses. Front Plant Sci. https://doi.org/10.3389/fpls.2014.00307 de Felippes FF (2019) Gene regulation mediated by microRNA-triggered secondary small RNAs in plants. Plants 8:112 Derrien B, Baumberger N, Schepetilnikov M, Viotti C, De Cillia J, Ziegler-Graff V, Isono E, Schumacher K, Genschik P (2012) Degradation of the antiviral component ARGONAUTE1 by the autophagy pathway. Proc Natl Acad Sci USA 109:15942–15946 Diezma-Navas L, Pérez-González A, Artaza H, Alonso L, Caro E, Llave C, Ruiz-Ferrer V (2019) Crosstalk between epigenetic silencing and infection by tobacco rattle virus in Arabidopsis. Mol Plant Pathol 20:1439–1452 Ding B, Wang G-L (2015) Chromatin versus pathogens: the function of epigenetics in plant immunity. Front Plant Sci 6:1–8 Ding S-W (2010) RNA-based antiviral immunity. Nat Rev Immunol 10:632–644 Duan C-G, Fang Y-Y, Zhou B-J, Zhao J-H, Hou W-N, Zhu H, Ding S-W, Guo H-S (2012) Suppression of Arabidopsis ARGONAUTE1-mediated slicing, transgene-induced RNA silencing, and DNA methylation by distinct domains of the cucumber mosaic virus 2b protein. Plant Cell 24:259–274 Eriksson D (2019) The evolving EU regulatory framework for precision breeding. Theor Appl Genet 132:569–573 Espinas NA, Saze H, Saijo Y (2016) Epigenetic control of defense signaling and priming in plants. Front Plant Sci 7:1–7 Fahlgren N, Hill ST, Carrington JC, Carbonell A (2016) P-SAMS: a web site for plant artificial microRNA and synthetic trans-acting small interfering RNA design. Bioinformatics 32:157–158 Fischer R, Schumann D, Zimmermann S, Drossard J, Sack M, Schillberg S (1999) Expression and characterization of bispecific single-chain Fv fragments produced in transgenic plants. Eur J Biochem 262:810–816 Fonseca JP, Mysore KS (2019) Genes involved in nonhost disease resistance as a key to engineer durable resistance in crops. Plant Sci 279:108–116 Fraser RSS (1992) The genetics of plant-virus interactions: implications for plant breeding. Euphytica 63:175–185 Fraser RSS (1990) The genetics of resistance to plant viruses. Annu Rev Phytopathol 28:179–200 Gago-Zachert S, Schuck J, Weinholdt C, Knoblich M, Pantaleo V, Grosse I, Gursinsky T, Behrens SE (2019) Highly efficacious antiviral protection of plants by small interfering RNAs identified in vitro. Nucleic Acids Res 47:9343–9357 Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol 31:397–405 Gal-On A, Shiboleth YM (2006) Cross-protection. In: Loebenstein G, Carr JP (eds) Nature resistance mechanics. Plants to viruses. Springer, Netherlands, Dordrecht, pp 261–288 García-Arenal F, Mcdonald BA (2003) An analysis of the durability of resistance to plant viruses. Phytopathology 93:941–952 Garcia-Ruiz H (2018) Susceptibility genes to plant viruses. Viruses 10:484

7 Novel Technologies for Transgenic Management for Plant Virus …

187

Garcia-Ruiz H, Takeda A, Chapman EJ, Sullivan CM, Fahlgren N, Brempelis KJ, Carrington JC (2010) Arabidopsis RNA-dependent RNA polymerases and dicer-like proteins in antiviral defense and small interfering RNA biogenesis during turnip mosaic virus infection. Plant Cell 22:481–496 Garcia D, Garcia S, Voinnet O (2014) Nonsense-mediated decay serves as a general viral restriction mechanism in plants. Cell Host Microbe 16:391–402 Gelinsky E, Hilbeck A (2018) European court of justice ruling regarding new genetic engineering methods scientifically justified: a commentary on the biased reporting about the recent ruling. Environ Sci Eur 30:52 Ghoshal B, Sanfaçon H (2015) Symptom recovery in virus-infected plants: revisiting the role of RNA silencing mechanisms. Virology 479–480:167–179 Gilliland A, Murphy AM, Carr JP (2006) Induced resistance mechanisms. Nat Resist Mech Plants Viruses 125–145 Gottula J, Fuchs M (2009) Toward a quarter century of pathogen-derived resistance and practical approaches to plant virus disease control. Advance virus research. Elsevier pp 161–183 Gy I, Gasciolli V, Lauressergues D, Morel JB, Gombert J, Proux F, Proux C, Vaucheret H, Mallory AC (2007) Arabidopsis FIERY1, XRN2, and XRN3 are endogenous RNA silencing suppressors. Plant Cell 19:3451–3461 Harris CJ, Slootweg EJ, Goverse A, Baulcombe DC (2013) Stepwise artificial evolution of a plant disease resistance gene. Proc Natl Acad Sci USA 110:21189–21194 Hashimoto M, Neriya Y, Yamaji Y, Namba S (2016) Recessive resistance to plant viruses: potential resistance genes beyond translation initiation factors. Front Microbiol. https://doi.org/10.3389/ fmicb.2016.01695 Hiatt A, Cafferkey R, Bowdish K (1989) Production of antibodies in transgenic plants. Nature 342:76–78 Hunter WB, Glick E, Paldi N, Bextine BR (2012) Advances in RNA interference: dsRNA treatment in trees and grapevines for insect pest suppression. Southwest Entomol 37:85–87 Hutvagner G, Simard MJ (2008) Argonaute proteins: key players in RNA silencing. Nat Rev Mol Cell Biol 9:22–32 Kaldis A, Berbati M, Melita O, Reppa C, Holeva M, Otten P, Voloudakis A (2018) Exogenously applied dsRNA molecules deriving from the Zucchini yellow mosaic virus (ZYMV) genome move systemically and protect cucurbits against ZYMV. Mol Plant Pathol 19:883–895 Kang B, Yeam I, Jahn MM (2005) Genetics of plant virus resistance. Annu Rev Phytopathol 43:581– 621 Kim MJ, Huh SU, Ham B-K, Paek K-H (2008) A novel methyltransferase methylates cucumber mosaic virus 1a protein and promotes systemic spread. J Virol 82:4823–4833 Konakalla NC, Kaldis A, Masarapu H, Voloudakis AE (2019) Topical application of double stranded RNA molecules deriving from Sesbania mosaic virus (SeMV) CP and MP genes protects Sesbania plants against SeMV. Eur J Plant Pathol 155:1345–1352 Kurreck J (2006) siRNA efficiency: structure or sequence-that is the question. J Biomed Biotechnol 2006:1–7 Kushwaha NK, Hafrén A, Hofius D (2019) Autophagy-virus interplay in plants: from antiviral recognition to proviral manipulation. Mol Plant Pathol 20:1211–1216 Langner T, Kamoun S, Belhaj K (2018) CRISPR crops: plant genome editing toward disease resistance. Annu Rev Phytopathol 56:479–512 Lassner M (2001) Directed molecular evolution in plant improvement. Curr Opin Plant Biol 4:152– 156 Ledford H (2019) EU regulators face CRISPR crop condundrum. Nature 572:15 Lee H-A, Lee H-Y, Seo E, Lee J, Kim S-B, Oh S, Choi E, Choi E, Lee SE, Choi D (2017) Current understandings of plant nonhost resistance. Mol Plant-Microbe Interact 30:5–15 Li F, Ding S-W (2006) Virus counterdefense: diverse strategies for evading the RNA-silencing immunity. Annu Rev Microbiol 60:503–531 Li F, Zhang C, Li Y, Wu G, Hou X, Zhou X, Wang A (2018) Beclin1 restricts RNA virus infection in plants through suppression and degradation of the viral polymerase. Nat Commun 9:1–17

188

A. E. Voloudakis et al.

Liao Y-C, Pingli H, Senzhao C, Yao M-J, Zhang J-B, Liu J-L (2006) Plantibodies: a novel strategy to create pathogen-resistant plants. Biotechnol Genet Eng Rev 23:253–272 Lindbo JA (2012) A historical overview of RNAi in plants. In: Watson JM, Wang M-B (eds) Humana press. Totowa, NJ, pp 1–16 Loebenstein G (2009) Plant virus diseases: Economic aspect. In: Regenmortel MHV, Mahy BWJ (eds) Desk Encyc. Academic Press, Desk Encyclopedia of Plant and Fungal, pp 426–430 Ma JK, Drake PMW, Christou P (2003) The production of recombinant pharmaceutical proteins in plants. Nat Rev Genet 4:794–805 Machado JPB, Calil IP, Santos AA, Fontes EPB (2017) Translational control in plant antiviral immunity. Genet Mol Biol 40:292–304 Martínez-Pérez M, Aparicio F, López-Gresa MP, Bellés JM, Sánchez-Navarro JA, Pallás V (2017) Arabidopsis m6A demethylase activity modulates viral infection of a plant virus and the m6A abundance in its genomic RNAs. Proc Natl Acad Sci USA 114:10755–10760 Martínez F, Lafforgue G, Morelli MJ, González-Candelas F, Chua NH, Daròs JA, Elena SF (2012) Ultradeep sequencing analysis of population dynamics of virus escape mutants in RNAi-mediated resistant plants. Mol Biol Evol 29:3297–3307 Matzke MA, Mosher RA (2014) RNA-directed DNA methylation: an epigenetic pathway of increasing complexity. Nat Rev Genet 15:394–408 Maule AJ, Caranta C, Boulton MI (2007) Sources of natural resistance to plant viruses: status and prospects. Mol Plant Pathol 8:223–231 Miozzi L, Gambino G, Burgyan J, Pantaleo V (2013) Genome-wide identification of viral and host transcripts targeted by viral siRNAs in Vitis vinifera. Mol Plant Pathol 14:30–43 Mitter N, Worrall EA, Robinson KE, Li P, Jain RG, Taochy C, Fletcher SJ, Carroll BJ, Lu GQ, Xu ZP (2017) Clay nanosheets for topical delivery of RNAi for sustained protection against plant viruses. Nat Plants. https://doi.org/10.1038/nplants.2016.207 Molinier J, Ries G, Zipfel C, Hohn B (2006) Transgeneration memory of stress in plants. Nature 442:1046–1049 Namgial T, Kaldis A, Chakraborty S, Voloudakis A (2019) Topical application of double-stranded RNA molecules containing sequences of tomato leaf curl virus and cucumber mosaic virus confers protection against the cognate viruses. Physiol Mol Plant Pathol. https://doi.org/10.1016/j.pmpp. 2019.101432 Nicaise V, Candresse T (2016) Plum pox virus capsid protein suppresses plant pathogen-associated molecular pattern (PAMP)-triggered immunity. Mol Plant Pathol 18:878–886 Niehl A, Heinlein M (2019) Perception of double-stranded RNA in plant antiviral immunity. Mol Plant Pathol 20:1203–1210 Niehl A, Wyrsch I, Boller T, Heinlein M (2016) Double-stranded RNAs induce a pattern-triggered immune signaling pathway in plants. New Phytol 211:1008–1019 Niu QW, Lin SS, Reyes JL, Chen KC, Wu HW, Yeh SD, Chua NH (2006) Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nat Biotechnol 24:1420– 1428 Pavan S, Jacobsen E, Visser RGF, Bai Y (2010) Loss of susceptibility as a novel breeding strategy for durable and broad-spectrum resistance. Mol Breed 25:1–12 Pecinka A, Mittelsten Scheid O (2012) Stress-induced chromatin changes: a critical view on their heritability. Plant Cell Physiol 53:801–808 Pooggin M (2013) How can plant DNA viruses evade siRNA-directed DNA methylation and silencing? Int J Mol Sci 14:15233–15259 Pyott DE, Sheehan E, Molnar A (2016) Engineering of CRISPR/Cas9-mediated potyvirus resistance in transgene-free Arabidopsis plants. Mol Plant Pathol 17:1276–1288 Ratcliff F (1997) A similarity between viral defense and gene silencing in plants. Science 276:1558– 1560 Ratcliff FG, MacFarlane SA, Baulcombe DC (1999) Gene silencing without DNA: RNA-mediated cross-protection between viruses. Plant Cell 11:1207–1215

7 Novel Technologies for Transgenic Management for Plant Virus …

189

Reyes MI, Nash TE, Dallas MM, Ascencio-Ibanez JT, Hanley-Bowdoin L (2013) Peptide aptamers that bind to geminivirus replication proteins confer a resistance phenotype to tomato yellow leaf curl virus and tomato mottle virus infection in tomato. J Virol 87:9691–9706 Rodriguez-Negrete EA, Carrillo-Tripp J, Rivera-Bustamante RF (2009) RNA silencing against geminivirus: complementary action of posttranscriptional gene silencing and transcriptional gene silencing in host recovery. J Virol 83:1332–1340 Rodríguez-Negrete EA, Morales-Aguilar JJ, Domínguez-Duran G, Torres-Devora G, CamachoBeltrán E, Leyva-López NE, Voloudakis AE, Bejarano ER, Méndez-Lozano J (2019) Highthroughput sequencing reveals differential begomovirus species diversity in non-cultivated plants in northern-pacific Mexico. Viruses 11:594 Romay G, Bragard C (2017) Antiviral defenses in plants through genome editing. Front Microbiol. https://doi.org/10.3389/fmicb.2017.00047 Rudolph C, Schreier PH, Uhrig JF (2003) Peptide-mediated broad-spectrum plant resistance to tospoviruses. Proc Natl Acad Sci USA 100:4429–4434 Sanfaçon H (2015) Plant translation factors and virus resistance. Viruses 7:3392–3419 Sanford JC, Johnston SA (1985) The concept of parasite-derived resistance-deriving resistance genes from the parasite’s own genome. J Theor Biol 113:395–405 Sato Y, Miyashita S, Ando S, Takahashi H (2017) Increased cytosine methylation at promoter of the NB-LRR class R gene RCY1 correlated with compromised resistance to cucumber mosaic virus in EMS-generated src mutants of Arabidopsis thaliana. Physiol Mol Plant Pathol 100:151–162 Schillberg S, Zimmermann S, Findlay K, Fischer R (2000) Plasma membrane display of anti-viral single chain Fv fragments confers resistance to tobacco mosaic virus. Mol Breed 6:317–326 Schmitt-Keichinger C (2019) Manipulating cellular factors to combat viruses: a case study from the plant eukaryotic translation initiation factors eIF4. Front Microbiol 10:1–8 Sekhwal MK, Li P, Lam I, Wang X, Cloutier S, You FM (2015) Disease resistance gene analogs (RGAs) in plants. Int J Mol Sci 16:19248–19290 Senthil-Kumar M, Mysore KS (2011) Virus-induced gene silencing can persist for more than 2years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnol J 9:797–806 Sera T (2017) Use of peptide aptamers, cationic peptides and artificial zinc finger proteins to generate resistance to plant viruses. Curr Opin Virol 26:120–124 Shamandi N, Zytnicki M, Charbonnel C, Elvira-Matelot E, Bochnakian A, Comella P, Mallory AC, Lepère G, Sáez-Vásquez J, Vaucheret H (2015) Plants encode a general siRNA suppressor that is induced and suppressed by viruses. PLOS Biol 13:e1002326 Simón-Mateo C, García JA (2011) Antiviral strategies in plants based on RNA silencing. Biochim Biophys Acta Gene Regul Mech 1809:722–731 Singh A, Mohorianu I, Green D, Dalmay T, Dasgupta I, Mukherjee SK (2019) Artificially induced phased siRNAs promote virus resistance in transgenic plants. Virology 537:208–215 Singh A, Taneja J, Dasgupta I, Mukherjee SK (2015) Development of plants resistant to tomato geminiviruses using artificial trans-acting small interfering RNA. Mol Plant Pathol 16:724–734 Soosaar JLM, Burch-Smith TM, Dinesh-Kumar SP (2005) Mechanisms of plant resistance to viruses. Nat Rev Microbiol 3:789–798 Tamilarasan S (2012) Engineering crop plants for nematode resistance through host-derived RNA interference. Cell Dev Biol https://doi.org/10.4172/2168-9296.1000114 Tavladoraki P, Benvenuto E, Trinca S, De Martinis D, Cattaneo A, Galeffi P (1993) Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature 366:469–472 Tepfer M, Jacquemond M, García-Arenal F (2015) A critical evaluation of whether recombination in virus-resistant transgenic plants will lead to the emergence of novel viral diseases. New Phytol 207:536–541 Tsuda K, Katagiri F (2010) Comparing signaling mechanisms engaged in pattern-triggered and effector-triggered immunity. Curr Opin Plant Biol 13:459–465

190

A. E. Voloudakis et al.

van Schie CCN, Takken FLW (2014) Susceptibility genes 101: how to be a good host. Annu Rev Phytopathol 52:551–581 Vadlamudi T, Patil BL, Kaldis A, Sai Gopal DVR, Mishra R, Berbati M, Voloudakis A (2020) DsRNA-mediated protection against two isolates of papaya ringspot virus through topical application of dsRNA in papaya. J Virol Methods 275:113750 Vaucheret H, Béclin C, Fagard M (2001) Post-transcriptional gene silencing in plants. J Cell Sci 114:3083–3091 Vaucheret H, Fagard M (2001) Transcriptional gene silencing in plants: targets, inducers and regulators. Trends Genet 17:29–35 Voloudakis AE, Holeva MC, Sarin LP, Bamford DH, Vargas M, Poranen MM, Tenllado F (2015) Efficient double-stranded RNA production methods for utilization in plant virus control. Methods Molecular Biology. Springer, New York, United States, pp 255–274 Van VuT, Roy Choudhury N, Mukherjee SK (2013) Transgenic tomato plants expressing artificial microRNAs for silencing the pre-coat and coat proteins of a begomovirus, tomato leaf curl New Delhi virus, show tolerance to virus infection. Virus Res 172:35–45 Wang A, Krishnaswamy S (2012) Eukaryotic translation initiation factor 4E-mediated recessive resistance to plant viruses and its utility in crop improvement. Mol Plant Pathol 13:795–803 Wang B, Yang X, Wang Y, Xie Y, Zhou X (2018) Tomato yellow leaf curl virus V2 interacts with host histone deacetylase 6 to suppress methylation-mediated transcriptional gene silencing in plants. J Virol 92:e00036-e118 Wang C, Wang C, Xu W, Zou J, Qiu Y, Kong J, Yang Y, Zhang B, Zhu S (2018) Epigenetic changes in the regulation of Nicotiana tabacum response to cucumber mosaic virus infection and symptom recovery through single-base resolution methylomes. Viruses 10:402 Wang C, Wang C, Zou J, Yang Y, Li Z, Zhu S (2019) Epigenetics in the plant–virus interaction. Plant Cell Rep 38:1031–1038 Wang J, Mei J, Ren G (2019) Plant microRNAs: Biogenesis, homeostasis, and degradation. Front Plant Sci 10:1–12 Wang M-B, Masuta C, Smith NA, Shimura H (2012) RNA silencing and plant viral diseases. Mol Plant-Microbe Interact 25:1275–1285 Wang X-B, Wu Q, Ito T, Cillo F, Li W-X, Chen X, Yu J-L, Ding S-W (2010) RNAi-mediated viral immunity requires amplification of virus-derived siRNAs in Arabidopsis thaliana. Proc Natl Acad Sci USA 107:484–489 Wang Y, Wu Y, Gong Q, Ismayil A, Yuan Y, Lian B, Jia Q, Han M, Deng H, Hong Y et al (2019) Geminiviral V2 protein suppresses transcriptional gene silencing through interaction with AGO4. J Virol 93:e01675-e1718 Wassenegger M, Heimes S, Riedel L, Sänger HL (1994) RNA-directed de novo methylation of genomic sequences in plants. Cell 76:567–576 Waterhouse PM, Wang M-B, Lough T (2001) Gene silencing as an adaptive defence against viruses. Nature 411:834–842 Yang DL, Zhang G, Tang K, Li J, Yang L, Huang H, Zhang H, Zhu JK (2016) Dicer-independent RNA-directed DNA methylation in Arabidopsis. Cell Res 26:66–82 Yang M, Xu Z, Zhao W, Liu Q, Li Q, Lu L, Liu R, Zhang X, Cui F (2018) Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus. BMC Plant Biol 18:1–13 Zaidi SS-A, Mansoor S (2017) Viral vectors for plant genome engineering. Front Plant Sci. https:// doi.org/10.3389/fpls.2017.00539 Zaidi SS-A, Mukhtar MS, Mansoor S (2018) Genome editing: targeting susceptibility genes for plant disease resistance. Trends Biotechnol 36:898–906 Zaidi SS-A, Tashkandi M, Mansoor S, Mahfouz MM (2016) Engineering plant immunity: using CRISPR/Cas9 to generate virus resistance. Front Plant Sci. https://doi.org/10.3389/fpls.2016. 01673 Zhang H, Feng H, Lu X, Wang C, Yang W, Li F (2019) An asymmetric bulge enhances artificial micro RNA-mediated virus resistance. Plant Biotechnol J pbi. 13250

7 Novel Technologies for Transgenic Management for Plant Virus …

191

Zhang H, Lang Z, Zhu JK (2018) Dynamics and function of DNA methylation in plants. Nat Rev Mol Cell Biol 19:489–506 Zhang Y, Xia R, Kuang H, Meyers BC (2016) The diversification of plant NBS-LRR defense genes directs the evolution of microRNAs that target them. Mol Biol Evol 33:2692–2705 Zimmermann S, Schillberg S, Liao YC, Fisher R (1998) Intracellular expression of TMV-specific single-chain Fv fragments leads to improved virus resistance in Nicotiana tabacum. Mol Breed 4:369–379 Zorzatto C, Machado JPB, Lopes KVG, Nascimento KJT, Pereira WA, Brustolini OJB, Reis PAB, Calil IP, Deguchi M, Sachetto-Martins G et al (2015) NIK1-mediated translation suppression functions as a plant antiviral immunity mechanism. Nature 520:679–682

Chapter 8

Cisgenesis: Engineering Plant Genome by Harnessing Compatible Gene Pools Bidyut Kumar Sarmah, Moloya Gohain, Basanta Kumar Borah, and Sumita Acharjee

Abstract The intermixing of hereditary material between crossable species occurs invariably in nature. Today, genome engineering tools integrated with plant breeding, allow precise intermixing of genetic traits for the improvement of crop species. However, this requires the identification of candidate gene(s) from genetic resources within or outside the gene pool. When the genes and regulatory elements are derived from compatible species, as is in nature, it is called cisgenesis. Development of cisgenic crops requires genome information of the target plant; identification, isolation, characterization, and cloning of the desired gene(s) from a cross-compatible donor and a vector system for the precise delivery into the recipient. Cisgenesis has been successfully used to enhance crop yield; resistance against important biotic and abiotic stresses and to enhance biomass of trees for biofuel production. Application of cisgenesis in a wide variety of crops requires novel strategies and detailed survey of their genetically compatible relatives. Additionally, mining of genes associated with target traits needs to be explored along with strong promoter systems for optimum expression of the target genes. In this chapter, we review the potential of cisgenesis, its applications, advantages, limitations, regulatory concerns, and strategies to maximize its applicability in the improvement of crops.

B. K. Sarmah (B) ICAR-National Professor Programme (Norman Borlaug Chair) and DBT-North East Centre for Agricultural Biotechnology, Assam Agricultural University, Jorhat 785013, India e-mail: [email protected] M. Gohain DBT-North East Centre for Agricultural Biotechnology, Assam Agricultural University, Jorhat, India e-mail: [email protected] B. K. Borah · S. Acharjee Department of Agricultural Biotechnology and ICAR-National Professor Programme (Norman Borlaug Chair), Assam Agricultural University, Jorhat, India e-mail: [email protected] S. Acharjee e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_8

193

194

B. K. Sarmah et al.

Keywords Cisgenesis · Genetic engineering · Gene pool · Cross compatible · Crop improvement

8.1 Introduction It is now possible to integrate traits of interest into genomes through Genome Engineering tools. Complex genomic architectures have been accurately modified with genes from distant sources. ‘Cisgenesis’ opens avenues for trait discovery and genome engineering within a gene pool. This chapter highlights the fundamentals of cisgenesis, ongoing research, risks, and benefits of the technology, and potential applications towards the improvement of crops. Improvement of crops relied largely on farmers until the last century. Over the years, crop domestication resulted in a combination of unconscious and conscious selection of superior traits such as plant architecture, yield, quality fruits or seeds; or tolerance to adverse biotic and abiotic stresses. In conventional breeding approach, desirable traits are incorporated into cultivated crops by crossing superior parents of a species or by introgressing superior gene(s) from closely related crop plants. Since the beginning of civilization plant breeding methods has invariably involved interbreeding of hereditary material which was gradually understood in the light of genetics. The plant breeding technologies favored selective breeding, introgressive hybridization, mutagenesis, while tissue culture techniques such as haploid technology, somatic hybridization, cybridization complemented the breeding process. These techniques caused random changes in the genome; however, selection helped in identifying superior or desirable genetic variation. Typically, crossbreeding or hybridization was the traditional method of choice for crop improvement. Hybridization may occur either between different varieties of the same species (e.g. between flowering and non-flowering potato plants) or between two different species (e.g. between Triticum and Secale to produce Triticale) (Sink et al. 1992). In somatic hybridization in vitro fusion of isolated protoplasts forms a somatic hybrid plant. The first somatic hybrid was reported by Carlson and coworkers in 1972 between Nicotiana glauca and Nicotiana langsdorfi species of Tobacco. A common somatic hybrid is the Pomato which is the cross of Potato and Tomato (Melchers et al. 1978). In hybridization, compatibility among species is critical in obtaining desired hybrids. Species compatibility within a genus varies considerably with different types of crops. Figure 8.1 summarizes the assessment of compatibility in gene pools based on the ‘three-gene pool’, a concept outlined by Harlan and de Wet (1971). The Primary gene pool includes wild progenitors of crop plants, cultivated races, landraces, biological species, subspecies, and their weedy relatives. Plant breeders normally confine themselves to the primary gene pool where introgression and intermating occur naturally with complete chromosomal pairing. The Secondary gene pool includes relatively distant species that can be crossed with the primary gene pool to result in incomplete chromosomal pairing and partial F1 sterility. The Tertiary

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

195

Fig. 8.1 Assessment of compatibility in gene pools: Evolutionary proximity eases crossing or hybridization in traditional plant breeding. Likewise, genes and their regulatory elements are derived from the same gene pool of a plant in cisgenesis and intragenesis. While cisgenesis preserves the native regulatory elements of a gene, intragenesis allows novel combinations of the genes with regulatory elements from compatible species within the gene pool (Harlan and de Wet 1971)

gene pool is marked with pre- and post-zygotic barriers that cause partial or complete failure of hybridization. The sexual compatibility is marginal and progenies show severe F1 sterility. Legumes like pigeon pea, chickpea, and soybean have rich reservoirs of tertiary gene pools. The Quaternary gene pool may include uncultivated species of a genus including microorganisms. For example, wild perennial species of Glycine and common bean produce nonviable or completely sterile F1 s. The secondary, tertiary, and quaternary gene pools are mostly based on phylogenetic relationships (Singh et al. 2007). Michelmore further added a Quinternary gene pool (Michelmore 2003) which included novel alleles and gene transfers mediated via

196

B. K. Sarmah et al.

processes such as DNA shuffling. This classification of a crop and its related species based on ‘gene pool’ (Graham 2013) guided the choice of germplasm resources for crop improvement (Harlan and de Wet 1971). Traditional breeding practices have successfully incorporated traits into elite germplasm with a visible impact on production. However, traditional breeding methods limit exchanges of genes only between the same species or closely related species. The advantage was the plants resulting from such traditional breeding methods could be released into the farmers’ fields directly without any regulation. Often desired traits in a target plant required novel genes that neither occurred naturally nor could be introduced through traditional breeding. Such an exchange of genetic material from distant species was made possible through recombinant DNA technology that eventually led to change in the genome of the organism. In other words, recombinant DNA technology had the first clues to engineer the genome. This was followed by a marked transition in plant breeding technologies. Over the years, advanced and efficient genome sequencing and genotyping technologies allowed the identification and isolation of gene(s) for the desired trait. Simultaneously, one could determine specific changes in the DNA sequence associated with improvement of a trait. Genetic engineering tools viz., recombinant DNA technology and site-directed mutagenesis were extensively used to tailor such changes in a targeted manner. Genes associated with economically important traits such as crop yield, resilience to environmental challenges like heat, drought, salinity, submergence, etc. response of plants to disease and insect infestations, and enhanced nutritional quality, were widely identified and isolated from different species. This gave way to ‘genetechnology-based plant breeding’ which in the words of Eriksson et al. “presented a virtually unlimited source of genetic variation”(Eriksson et al. 2014). Modern crop improvement strategies aim at increasing genetic variations in a steady manner. The conventional and gene-technology based crop-breeding strategies may be summarized in Fig. 8.2. In 1983, crop genetic engineering started when a bacterial gene was expressed in tobacco (Fraley et al. 1983) and the first genetically modified (GM) food crop, Falvr Savr (Meyer 1995) tomato, with longer shelf life, was commercialized by Calgene company in 1994 (Holme et al. 2013). The mixing of genetic material from species that do not otherwise cross in nature raises major concern among consumers when the release of such GM crops arises. Such concerns necessitated techniques restricted to the “breeders’ gene pool” for the improvement of crops. The “breeders’ gene pool” comprises all genes in a population that a conventional breeder uses for the improvement of crops. The concept of cisgenesis hailed a period of hope for gene technology as cisgenic plants were likened to traditionally bred plants and became relatively more acceptable to consumers as compared to other genetically modified crops. The dire need to raise consumer awareness and explore native gene pools for the scientists makes it necessary to understand the detail of the cisgenic technology.

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

197

Fig. 8.2 Methods for improvement of crops: crop improvement strategies aim at a steady increase in the genetic diversity of the plant species. Genetic variations may be introduced traditionally employing conventional breeding methods or by the intervention of genetic engineering in a precise manner

8.2 Cisgenesis: The Concept and Related Terminologies Henk J. Schouten and Henk Jochemsen (Jochemsen 2000) first introduced the term ‘cisgenesis’ in the book ‘ Toetsen en begrenzen. Een ethische en politieke beoordeling van de moderne biotechnologie’ and in 2004, Jan Schaart of Wageningen University used it in his Ph.D. thesis. ‘Cisgenesis’ is a genetic modification in which the gene of interest (cisgene) is obtained from a donor or host plant that belongs to the same species as the recipient or is a crossable and sexually compatible relative. A ‘cisgene’ includes its introns, flanked by its native promoter and terminator. One or more cisgenes may occur in cisgenic plants without any foreign gene(s) or transgenes. As such, cisgenesis modifies the genomic architecture of a plant retaining the integrity of the breeders’ gene pool as traditionally bred plants. In this technique, target genes are isolated and introduced with their native regulatory elements from crossable species or from the host plant itself using recombinant DNA technology. The source of the target gene may be from a primary, secondary, or

198

B. K. Sarmah et al.

even the tertiary and quaternary gene pools. The integration of the ‘cisgene’ occurs in a normal sense orientation in the host crop’s genome. The method used to integrate cisgenes into the host plant’s genome is crucial. If the gene cassettes are inserted via gene gun or particle bombardment method, only the specific gene cassette integrates into the genome. However, when the delivery is via Agrobacterium-mediated transformation the desired gene cassette integrates within the Plant-derived transfer DNA (P-DNA) borders (Holme et al. 2013). Such integration of non-crop genetic sequences as selection markers, vector backbone has to be avoided as far as possible in cisgenesis. The use of T-DNA (or P-DNA) has been claimed to be safe since such sequences are non-coding and occur naturally within several plant genomes (Rommens 2004; Rommens et al. 2004; Schouten et al. 2006). The cisgenic strategy was used by Gao et al. (2019) to increase the activity of cytosolic glutamine synthetase (GS1) in barley. Cytosolic GS1 plays a key role in nitrogen (N) metabolism. Transformation of barley with an extra copy of native HvGS1-1 increased its expression and GS1 enzyme activity. The increased GS1 activity provides an effective means of improving grain yield and nitrogen utilization efficiency. Additionally, the cisgenic overexpression of GS1 also prevents declining grain protein concentration under elevated carbon dioxide levels. A related technology to confer traits from compatible gene pools is “intragenesis”. While cisgenesis, includes the gene of interest flanked by the native promoter and terminator, in intragenesis, the elements regulating the gene of interest, maybe from the same species or from a cross-compatible species (Lusser et al. 2012). Novel combinations of native coding and regulatory sequences are made using genetic modification techniques in the recipient plant. This approach has been described by Rommens and coworkers (Rommens et al. 2004, 2000, 2007; Rommens 2007). Intragenesis has been widely applied in potato (Espinoza et al. 2013). Raw potatoes contain amino acid asparagine, which is a known precursor of acrylamide, a carcinogen. When cooked at high temperatures, sugars react with amino acids, including asparagine, in a chemical process known as the Maillard reaction. The resulting flavor and color though widely preferred, poses a risk of cancer due to the production of acrylamide. The J R Simplot company developed Innate® potato using intragenic modifications to silence the genes; asparagine synthetase-1, polyphenol oxidase-5, potato phosphorylase L, and the starch-associated R1. Innate® potato has reduced levels of free asparagine, lower content of reducing sugars, and reduced browning phenotype/black spot bruising (Powers et al. 2017). The Innate® Hibernate has foliar late blight resistance in addition to the above traits (Jones 2015). These intragenic potato varieties were approved in March 2016 by the US Department of Agriculture (USDA), Canadian Food Inspection Agency (CFIA), and Health Canada with acceptance from both farmers and consumers. If a genetic modification involves a gene of interest obtained from a sexually incompatible donor, the process is called “transgenesis”. This includes a gene of interest and regulatory sequences from donors other than crossable plants, including microorganisms, animals, or maybe synthetically designed, and is known as a ‘transgene’. Consequently, these genes constitute a novel gene pool for plant breeding.

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

199

Genetic modifications may also be achieved by ‘knockdown’ or ‘editing’ of existing genes instead of insertion of additional genes. Such a crop that is genomeedited is called “subgenic”(Wang et al. 2014) and the technology associated with development of subgenic crops (Sticklen 2015) includes molecular splicing, gene editing, genome editing, etc. Such genome modification techniques with increased precision contribute to the New Plant Breeding Techniques (NPBT) (Zaidi et al. 2019). An ensemble of techniques constitutes the NPBTs: The clustered regularly interspaced short palindromic repeats (CRISPR–CRISPR associated protein (Cas9) has been widely used in plant breeding (Haque et al. 2018; Langner et al. 2018; Karkute et al. 2017; Khatodia et al. 2016, 2017; Scheben et al. 2017; Singh et al. 2016); transcription activator-like effector nucleases (TALENs), zincfinger nucleases (ZFNs) and meganucleases, RNA-dependent methylation (RDM), oligonucleotide-directed mutagenesis (ODM), reverse breeding, grafting on GM rootstock and agroinfiltration. A major feature of these techniques is that they allow the introduction of new traits in a timely and cost-effective manner. NBPTs have been used in commercial applications including herbicide-tolerant canola created with ODM and grown by farmers in Canada and the USA (Kleter et al. 2019). TALEN and CRISPR-Cas9 technologies have been used to confer resistance against powdery mildew in hexaploid bread wheat (Wang et al. 2014).

8.3 Pre-Requisites for Development of Cisgenic-Crops The pre-requisites for the development of cisgenic crop are: i. The genome sequence information of the target crop. ii. The target gene associated with the desired trait has to be identified, isolated, characterized, and cloned from a cross-compatible donor crop. iii. A clean vector system for the precise delivery of the gene of interest into the recipient plant. A clean vector delivery system ensures the integration of only the gene of interest and not the selection marker or the vector backbone. In recent years, novel transformation protocols for co-transformation (McKnight et al. 1987) without selection markers or with removable marker genes (de Vetten et al. 2003; Schaart et al. 2004, 2016) have been successfully employed. In practice, cisgenesis has been applied to propagate heterozygous crops as potato (de Vetten et al. 2003, 2004, 2000, 2006; Rommens 2004, 2006, 2007; Rommens et al. 2007), apple (De Marchi et al. 2019; Vanblaere et al. 2014, 2011), strawberry (Schaart et al. 2004, 2016), perennial ryegrass (Bajaj et al. 2008), alfalfa (Weeks et al. 2008), barley (Holme et al. 2012), durum wheat (Gadaleta et al. 2008) and even poplar (Han et al. 2013), etc. without disturbing the fundamental genetic framework of the host plant.

200

B. K. Sarmah et al.

8.4 Target Traits and Breeding Goals for Cisgenic Crops The choice of traits for crop improvement depends upon the breeding goals which closely relate to global challenges in agriculture: Shrinking of arable land, adverse cropping conditions, food, and nutritional security for an ever-increasing population are to name a few. Mitigation of such global issues demands comprehensive breeding goals. • • • • •

Enhanced crop productivity. Improved disease and insect pest resistance. Improved tolerance to abiotic stresses. Increased nutritional value. Resilience to climate change.

Cisgenesis has been recognized as a useful strategy in enhancing crop yield, establishing resistance against important diseases and pests in fruit and vegetables (e.g. apple scab and fire blight cedar apple rust in apple, resistance against root-knot nematodes in peach, late blight in potato). It is known to be used for increased biomass of trees (Harfouche et al. 2011) for biofuel production in poplars. Cisgenesis has also been employed for the manipulation of pathways for induction of anthocyanin accumulation to enhance red color and fleshy pulp in apples. Table 8.1 enlists the target crop plants, genes, and traits introduced through cisgenesis. Given below are the major examples:

8.4.1 Plant Incorporated Protectants (PIP) Genetically engineered crops are often of two categories, herbicide-tolerant and plant-incorporated protectants (PIPs). Plants can be given genes that help them produce substances to fight pests. These self-made pesticides are called “plantincorporated protectants” (PIPs). PIP-producing crops are categorized as GM or “genetically engineered” (GE). Corn, soybeans, cotton, potatoes, and plums are some of the crops that can be made to produce PIPs.

8.4.2 Disease Resistance The plants which express genes from close wild relatives i.e. cisgenic plants, are also being generated to obtain resistance genes that were lost over years of crop domestication.

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

201

Table 8.1 Genetically engineered crop plants through cisgenesis SI. No.

Species

Trait

Gene

Donor

Status

1.

Apple (Vanblaere et al. 2011)

Apple scab resistance

HcrVf2

Malus floribunda

Field evaluation

2.

Apple (Espley et al. 2007)

Anthocyanin accumulation/red colour

MdMYB10

Malus floribunda

Field evaluation

3.

Barley (Holme et al. 2012)

Phytase activity

HvPAPhy_a

Hordeum vulgare

Field evaluation

4.

Barley (Kichey Nitrogen use et al. 2009) efficiency

gTIP2 and gGS1a

Hordeum vulgare

Field evaluation

5.

Rye-Grass (Bajaj et al. 2008)

Lolium perenne

Field evaluation

6.

Poplar Gibberellin (Varshney et al. metabolism 2013)

PtGA20ox7, PtGA2ox2,Pt RGL1_1, PtRGL1_2 and PtGAI1

Populus trichocarpa clone Nisqually-1

Field evaluation

7.

Potato (Park et al. 2005; Vossen et al. 2016)

Rpi-blb1, Rpi-blb2, Rpi-blb3

Solanum bulbocastanum

8.

Potato Late blight (Jacobsen et al. resistance 2009)

Rpi-vnt1

Solanum venturi

9.

Potato (el-Kharbotly et al. 1994; Huang et al. 2004)

R2,R3a, R3b,R5, R6, R7, R8,R9, R10, R11

Solanum demissum

10.

Potato Late blight (Jacobsen et al. resistance 2009)

Rpi-pra1

Solanum papita

J R Simplot Developed Innate® lines. e.g. Traits of Innate® Hibernate include lowered free asparagine, reduced black spot, lowered reducing sugars and foliar late blight resistance. This has been commercialized since 2017 in the USA and Canada

11.

Potato Late blight (Jacobsen et al. resistance 2009)

Rpi-sto1

Solanum stoloferum

12.

Potato (Ewing et al. 2000)

Late blight resistance

Rpi-ber1

Solanum berthaultii

13.

Potato (Kuhl et al. 2001)

Late blight resistance

Rpi-pnt1

Solanum pinnatosectum

14.

Potato (Paal et al. 2004)

Nematode Gro1-4 resistance (G. rostochiensis)

Solanum tuberosum

Field evaluation

15.

Strawberry (Schaart et al. 2004)

Fruit Rot (Botrytis cinerea)

–

Field evaluation

Drought tolerance Lpvp1

Late blight resistance

Late blight resistance

PGIP

202

8.4.2.1

B. K. Sarmah et al.

Wheat Resistant to Stem Rust

The Wheat Stem Rust Initiative, for example, is currently generating cisgenic versions of wheat, which possess multiple resistance genes to the fungal pathogen Puccinia graminis f. sp. tritici Ugg99 from wild relatives (Singh et al. 2016).

8.4.2.2

Apples Resistant to Scab

The genomic region for scab resistance, HcrVf2, in cisgenic Apple lines cv. Gala, was isolated from the wild relative Malus floribunda. The 242 bp segment from its 5 UTR and 220-bp from its 3 UTR constituted the ORF. The nptII gene for kanamycin selection was removed through dexamethasone-induced recombination and thus resulted in marker-free lines (Vanblaere et al. 2014, 2011). Conventional breeding took about 50 years to develop scab resistant apples. In conventionally hybridized crops, linkage drag tremendously slows down the breeding process, more so, if the gene of interest is tightly linked to one or more deleterious genes, genetically. Cisgenesis reduced this time interval. The cisgenic apple trees are currently under multi-level assessment in field trials (Schlathölter et al. 2019). Since 2015, there has been a progressive scenario for biotech apples. Golden, Granny, and Fuji are the Arctic® Hat Trick developed by Okanagan Specialty Fruits and approved by the US Food and Drug Administration (FDA) and Animal and Plant Health Inspection Service (APHIS) in 2015 Canada (Waltz 2015). Apples turn brown due to the production of the enzyme polyphenol oxidase (PPO). Silencing of the PPO gene prevents such browning for as long as three weeks. The agency declared the apples safe, pest free with no significant impact of deregulation on the human environment. The increase in area under biotech apples from 80 hectares in 2016 to 101 hectares in 2017 reflects acceptance among farmers and consumers.

8.4.2.3

Potato Resistant to Late Blight

Late blight is caused by Phytophthora infestans and is one of the prime biotic challenges in potato cultivation. Resistance genes were stacked from various wild species, including Solanum demissum and S. bulbocastanum to confer durable resistance against potato-late-blight (Jo et al. 2014). In recent years, several resistance genes have been screened and isolated from native donors along with S. demissum (Huang et al. 2004; van der Vossen et al. 2003; Vossen et al. 2016) to allow gene pyramiding in susceptible elite potato cultivars by cisgenesis.

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

8.4.2.4

203

Strawberries Resistant to Gray Mould

Botrytis cinerea causes gray mould in strawberry that leads to significant yield loss. The polygalacturonase (PG) enzyme helps the fungus break the cell wall. PGinhibiting proteins (PGIP) are expressed as a common defense mechanism. Endogenous PGIP-gene was isolated from strawberry and overexpressed under fruit-specific expansin gene (Exp2) promoter, by Schaart in (2004).

8.4.3 Abiotic Stress Tolerance Traits such as abiotic stress tolerance are usually polygenic and therefore complex. The introgression of a single gene is generally thought to be insufficient to generate stress-tolerant lines (Varshney et al. 2013). Gene pyramiding is considered necessary in most cases and cisgenesis is not expected to play a significant role in the improvement of stress tolerance. However, in 2010, the Public Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV, Mexico) announced the development of cisgenic maize with enhanced adaptation to severe drought and extreme temperatures. A maize plant produces sugars such as trehalose under drought stress, which can be broken by the glycoside hydrolase enzyme trehalase. When this sugar remains unbroken, the plant shows enhanced adaptation to drought stress. Hence, antisense RNA expression was used for silencing trehalase in the popular maize inbred line B73 (derived from Iowa Stiff Stalk Synthetic). The CINVESTAV announcement indicated that their cisgenic maize (CIEA-9) required 20% less water, endured high temperatures (up to 50 °C), and had better flowering plus ears than local cultivars. CIEA9 seeds also germinated at 8 °C, demonstrating their ability to withstand cold at early development stages. The promising results led CINVESTAV file a petition for field-testing of CIEA-9 (Cabrera Ponce et al. 2011) which was conducted in Sinaloa (northwest Mexico) (Ortiz et al. 2014). In cotton (Gossypium hirsutum) metallothionein GhMT3a expression is upregulated by stresses associated with salt, drought, and low temperature. Other stressors include heavy metals, ethylene, abscisic acid, and reactive oxygen species (ROS) (Xue et al. 2009) to be explored for cisgenic intervention.

8.4.4 Nutritional Enhancement Phytases are phosphatases that ensure availability of stored phosphates in seeds. Holme et al. 2012 chose a barley phytase (HvPAPhy) synthesized specifically during seed development and thereby responsible for most of the phytase activity in the mature grain. They achieved a marker-free status of cisgenic barley with improved phytase activity (Holme et al. 2012). Simultaneously, they also tested whether it was possible to improve a particular quality trait by the insertion of extra gene copies

204

B. K. Sarmah et al.

from the species itself. Holmes and coworkers achieved a 2.8 fold increase in the phytase activity of the grain, stable over three generations. Thus, increasing dosage by the insertion of extra copies of an endogenous gene could be a useful tool for crop improvement. This is particularly important for monogastric animals like pigs and poultry that lack phytase activity in their digestive tract. When normal barley is fed, the unused phytic acid is excreted out as such into the environment leading to algal growth and eutrophication. Accordingly, increase in phytase potential in feed crops like barley increases phosphate bioavailability. In another study, Paul et al. developed iron biofortified rice grain through the overexpression of endogenous ferritin gene under the control of endosperm specific GlutelinA2 (OsGluA2) promoter (Paul et al. 2012). In the genetically transformed aromatic indica rice cultivar, Pusa-sugandhi II, their milled seeds had 7.8-fold of ferritin overexpression, which contributed to 2.09and 1.37-fold of iron and zinc accumulation respectively. The localization of iron in the endosperm of T3 seeds confirmed the tissue-specific activity of GluA2 promoter. Transformed and untransformed plants showed no difference in their agronomic traits. Overexpression of rice endogenous ferritin gene is a step toward cisgenic approach and can act as an effective tool for iron biofortification. Zinc deficiency in human is a global challenge. Zinc biofortification of staple crops could combat this challenge. Using a cisgenic approach the barley plasma membrane Ptype ATPase Zn transporter, HvHMA2 was shown to be an efficient candidate for mineral biofortification resulting in a doubling of a wide range of nutrients including Zn, iron (Fe), and magnesium (Mg) in the inner endosperm (Noeparvar et al. 2016).

8.5 Advantages and Limitations 8.5.1 Maintains Integrity of Gene Pool Cisgenesis restricts to the gene pool of the recipient species as no foreign genes are incorporated. Changes that are likely may also be incurred by traditional breeding in a period over centuries. In the exact words of the pioneers (Schouten et al. 2006), the cisgenesis fundamentally “respects species barriers” and therefore has been argued to be similar to traditionally bred plants. Consequently, cisgenic plants are supposed to be as safe as traditionally bred plants.

8.5.2 Eliminates Linkage Drag The simultaneous transfer of DNA sequences closely associated with the gene of a desired trait, is linkage drag. When a wild plant is crossed with an elite cultivar through introgression, the former passes not only the gene of interest to the progeny but also other neighboring genes that may or may not be deleterious in nature.

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

205

Breeding processes slow down tremendously if the gene of interest is linked to one or more genes. Recurrent backcrossing is conducted with the cultivated plant and simultaneous selection of traits to generate a genotype not linked to any undesired genes. Contrastingly, cisgenesis involves the precise identification, isolation characterization, and transfer of the desired gene from the donor plant to the recipient in a single step enhancing the speed of breeding even for multiple genes. For example, stacking resistance genes originating from the same chromosomal position in different species or accession as employed in Phytopthora-resistant potato (Zhu et al. 2012). Cisgene micro translocation involves transfer of a cisgene in a single step eliminating linkage drag; insertion-related side effects may be overcome by normal selection; stacking resistance genes from a compatible gene pool is more feasible.

8.5.3 Curtails Breeding Period Traditional plant breeding may take decades to develop a plant variety with the desired trait (s). Six major independent genes conferring resistance to Venturia inaequalis have been identified in apple germplasm: Vf from Malus floribunda 821, Vm from M. micromalus, Vb from M. baccata Hansen’s no. 2, Vbj from M. baccata var. jackii, Vr from M. pumila R12740–7A, and Va from the Antonovaka PI 1,726,623(Biggs 1990; Williams et al. 1969). The scab resistance gene Vf was introduced into a cultivated apple from the wild variety during the early 1950s (Hough et al. 1953; Schmidt et al. 2005). The new apple varieties from such breeding programmes over five decades failed in terms of taste and texture compared to the susceptible top varieties. This was due to linkage drag. Recently, the Vf gene been cloned (Belfanti et al. 2004), and transferred to elite varieties using cisgenesis resulting in scab-resistant apples, relatively faster.

8.5.4 Restricts Position Effect Recombinant DNA technology differs from meiotic recombination. The insertion of the donor sequence into the genome at a previously unknown position might affect epigenetic factors such as DNA methylation that may in turn influence gene expression. The flanking regions are often prone to translocations or rearrangements (Forsbach et al. 2003). Off-target effects may prove deleterious. A counterargument relates naturally occurring transposons (Helitron transposons in maize) (Lai et al. 2005) and inadvertent reorganization of the genome induced by abiotic stress, interspecies hybridization (Madlung et al. 2004), pathogen attack or traditional breeding (Li et al. 2017; Lin et al. 1999). It is argued that larger changes at the DNA occur due to mutagenesis than at the integration site of a cisgene or transgene (Cecchini et al. 1998; Shirley et al. 1992). Additionally, the European Union exempts mutation breeding from regulations for release of GMO into the environment. Exemptions

206

B. K. Sarmah et al.

apply if and only if techniques applied have long been used consistently and safely and does not apply to techniques “which have appeared or have been mostly developed since the Directive was adopted”. So, techniques developed after adoption of the Directive in the year 2001 are not exempted from the obligations of GMO law.

8.5.5 Limitations There are few limitations associated with cisgenic technology. The foremost limitation is the inability to introduce traits outside the sexually compatible gene pool (Schouten et al. 2006). For traits available within a gene pool, mining of desired genes needs an exhaustive survey. To this, protocols may have to be innovated for plants where such technology has not been applied earlier. Another concern is the elimination of vector-backbone in transformants and production of marker-free technology, the protocols for which may not be readily available in all crop species. Cisgenesis also limits the choice of regulatory elements for maximal expression of the desired gene. As such, the desired gene may not always be optimally expressed under the native promoter. In such a condition, the intragenic or transgenic technology has an added advantage.

8.6 Potential Cisgenic Crops with Improved Traits for Future 8.6.1 Insect Resistant Grain Legumes Helicoverpa armigera, commonly known as cotton bollworm, tomato fruitworm, or legume pod borer, is a major pest of several crops including legumes as chickpea (Cicer arietinum) and pigeonpea (Cajanus cajan). An estimated loss of about US$ 400 million occurs annually in India and over US$ 1 billion in the semi-arid tropics. The incessant use of insecticides has not only made the pests resistant but also has been detrimental to the environment. Transgenic chickpea resistant to Helicoverpa armigera is being generated but stringent GMO regulations have held them back from moving forward into farmers’ hands. These transgenics have been developed using Cry gene(s) from a bacterium, Bacillus thuringiensis. In order to have better Insect Resistance Management (IRM), it is important to develop insect-resistant chickpeas with a functionally different gene. A cisgenic approach has been adopted towards the same goal. Different accessions of wild relatives of chickpea have been reported to have inherent resistance against Helicoverpa armigera (Sharma et al. 2005).Wild relatives of Cicer arietinum as C. bijugum, C. reticulatum, C. judaicum, C. pinnatifidium, C. microphyllum and C. cuneatum have been reported to exhibit high levels of resistance to H. armigera (Sharma et al. 2005). Accessions belonging

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

207

to C. bijugum, C. pinnatifidum and C. echinospermum have also shown resistance to the bruchid Collasobruchus chinensis (Sharma 2008). Many of these accessions can be explored for genes that impart pest resistance. We have deployed such a cisgenic approach in our laboratory, wherein wild relatives of chickpea are being exploited for discovering gene (s) for insect resistance and transferring potential insect resistance genes into chickpea, expressing them at high level in flower and pod wall using native regulatory elements. The key defense genes known in chickpea are protease inhibitor, amylase inhibitor, hydroxymethyl transferase, endo-1,4-D-glucanase. Strong pod and flower specific promoter sequences are being obtained from chickpea to construct cisgenic vector capable of high expression of chickpea defense gene (s) (Vasantrao et al. 2019) Likewise, wild relatives of pigeonpea such as Cajanus scarabaeoides, C. sericeus, C. acutifolius, C. albicans, Rhynchosia aurea, R. bracteata and Flemingia bracteata are also highly resistant to H. armigera. Some of the wild relatives of pigeonpea have also shown resistance to pod fly (Melanagromyza obtusa) and pod wasp (Tanaostigmodes cajaninae) (Sharma et al. 2006). Using a similar strategy as in cisgenic super chickpea, pest-resistant cisgenic pigeonpea is being attempted at National Institute for Plant Biotechnology (NIPB), New Delhi.

8.6.2 Blast Resistant Rice The rice blast disease resistance gene, Pi9 was incorporated into an elite US rice variety by cisgenesis (Tamang et al. 2018). The selectable marker gene in the final product was removed and a co-transformation system eliminated the hygromycin resistance-encoding gene as a selection marker from the rice line. At the T1 generation after selfing the T0 cisgenic line, individual rice plants containing the Pi9 gene were verified to lack the hygromycin gene (Tamang et al. 2018). Likewise, protocols may be uniquely tailored for crops to obtain cisgenic lines without any trace of a selectable marker gene.

8.6.3 Spicy Tomatoes Researchers from the Federal University of Viçosa in Brazil explored the possibility of engineering spicy tomatoes. The goal was to mass-produce capsaicinoids, which are secondary metabolites that give chilli peppers their spicy flavor and have been proven to have health benefits. The capsaicinoid biosynthesis in tomato has to be turned on. Pungency results from higher expression levels of capsaicinoid biosynthesis genes in the placental septum of pungent cultivars. Compared to chili peppers, in tomato some genes have lower levels of expression (PAL; C4H; ACL, acyl carrier protein, and AMT, aminotransferase); some have lower expression levels with temporally restricted expression (COMT, caffeoyl-CoA 3-O-methyltransferase; and FaTA, acylACP thioesterase), in addition to KAS; and two genes (BCAT, branched-chain

208

B. K. Sarmah et al.

amino acid aminotransferase, and CS, capsaicinoid synthase) are not expressed at all and would allow simultaneous upregulation of the expression of PAL, KAS, COMT, and FaTA. Increasing the expression of PAL, KAS, COMT, and FaTA, activating the expression of BCAT and CS by a rapid assembly of the Transcriptional activator-like effectors (TALE) genes into a single T-DNA vector using a MultiSite Gateway recombination system, helped achieve pungency in tomato. TALE is a set of proteins secreted by pathogenic bacteria, Xanthomonas spp., when they infect host plants. In the transgenic tomato plant targeted replacement of promoters was proven to be effective using a constitutive 35S promoter inserted in ANT1 gene that regulates anthocyanin production. In the cisgenic strategy, an endogenous tomato fruit-specific promoter could replace the promoter regions of the inactive genes in the capsaicinoid pathway to produce cisgenic tomato plants with transcriptionally active genes. Such a concept waits for actual experimentation to confirm if transcript levels achieved would result in the functional activation of the capsaicinoid pathway (Naves et al. 2019).

8.6.4 Fire Blight Resistant Apple Gaucher Matthieu et al. (2019), aimed at finding fire blight pathogen Erwinia amylovora (Ea)-inducible or moderately constitutive promoters in apple (Gaucher et al. 2019). They focused on polyphenoloxidase genes (PPO) which encode oxidative enzymes and can be upregulated during fire blight pathogen (Ea) infection. Ten PPO and two PPO-like sequences in the apple genome were identified and the promoters of MdPPO16 (pPPO16) and MdKFDV02 PPO-like (pKFDV02) were characterized for their potential as Ea-inducible and low constitutive regulatory sequences respectively. They found pPPO16, the first Ea-inducible promoter cloned from apple, a useful component for intragenic strategies to create fire blight resistant apple genotypes.

8.6.5 Other Crops Several indigenous varieties of fruits, vegetables, medicinal and aromatic plants are found in the Northeastern region of India. Such plants may be a promising source of useful genes for improvement of vegetable or fruit crops using cisgenesis approach. For example, fruits like cherry tomatoes (Solanum lycopersicum var. cerasiforme) are known to be salt-tolerant (Caro et al. 1991). Although the addition of salt to the tomato plant (Solanum lycopersicum) improves fruit quality, there is a negative effect on its growth and production. Therefore, a strategy for the development of cisgenic tomato tolerant to salinity stress could involve the identification and isolation of the gene that confers salt tolerance in cherry tomatoes followed by transferring such gene into cultivated tomatoes through genetic transformation technology.

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

209

A vital consideration in cisgenesis is the design of constructs and the targeted location where the desired gene is intended to express. The constructs may be targeted extra chromosomally that replicate autonomously or may be integrated into the host’s genome (Ahmad et al. 2016). Inheritance of the integrative kind is more stable compared to the extra chromosomal vectors. In the development of cisgenic crops, alternative marker and excision systems are also being developed to avoid the presence of the bacterial selection marker in the final product. An example of climate-smart crop is the heat-tolerant maize (Ribeiro et al. 2020). Increase in temperature affects the number of kernels that develop and the accumulation of seed storage molecules during grain filling, thereby reducing the overall yield. The maize chloroplast-localized 6-phosphogluconate dehydrogenase (6PGDH), PGD3, is critical for endosperm starch accumulation. Ribeiro et al. (2020), targeted heat-stable 6PGDH to endosperm amyloplasts by fusing the Waxy1 chloroplast targeting peptide coding sequence to the Pgd1 and Pgd2 open reading frames developing transgenic maize plants. The WPGD1 and WPGD2 transgenes could mitigate grain yield losses in high-temperature conditions at night by increasing kernel number both in vitro and in the field. Likewise, for the target trait of improved heat tolerance for plastid-localized 6PGDH, it is possible to develop germplasm with beneficial alleles in the Pentose Phosphate Pathway using cisgenic constructs. The plastid directed transformation coupled with cisgenesis could pave a promising pathway to developing heat-tolerant cisgenic maize in the long run. Cereal crops such as rice, wheat, and maize hold the reins to food security globally. The prospective applications of cisgenesis in these crops may include conferring dehydration-stress tolerance, regulatory elements encoding transcription factors, salt-tolerance genes, and low iron content (Heller 2007). To combat the impacts of climate change, this technology may target genes for improvement of several agronomic properties including, early flowering, speeding up sprouting time, shortening of generation time, augment nutrient content like carotenoids, iron, amino acids and reduction of antinutritive factors, in foods. The food processing industry and the pharmaceutical industry are yet to tap the potential while genes within a target gene pool may have answers to several agricultural and industrial challenges.

8.7 Regulations for Cisgenesis The release of GM crops in the environment and the market requires regulatory approval from different regulatory bodies in different countries. On regulation of GMcrops two treaties play a major role: worldwide the Cartagena Protocol on Biosafety (2000) and in Europe, the European Directive 2001/18/EC (2001). For cisgenesis, as Jacobsen and Schouten argue, the societal acceptance and regulation (orgware) is a major player (Jacobsen and Schouten 2009). For process-based regulations relating to GM organisms, traditional breeding is the accepted baseline. Traditional plant breeding includes approaches such as interspecific crosses, bridge crosses among species, and techniques such as embryo rescue.

210

B. K. Sarmah et al.

Therefore, cisgenesis would include the genes keeping their native promoters as in traditional breeding (European Parliament 2001). Furthermore, the beneficial alleles are conveyed to a recipient plant from crossable species in the case of cisgenics; therefore, the product obtained is similar to that from conventional breeding (Hou et al. 2014) imposing no risk upon the environment. If one considers the products of cisgenesis more similar to those of traditional breeding, cisgenesis may be argued to be exempt from GMO frameworks and regulated as traditional bred. In a recent debate over the “slippery slope of cisgenesis”, it has been cautioned not to underestimate the need for expertise and time in the creation of case-specific cisgenic products with marker-free constructs and clones comprising endogenous promoters and terminators and free from vector backbones (Eriksson et al. 2014). A novel approach could emerge from stacking copies of native genes and widening variance in the genetic architecture of plants available to breeders. According to Schouten and coworkers the use of cisgenesis could be seriously hindered inspite of its advantages if regulators fail to differentiate between cisgenic and transgenic plants. Standpoints on cisgenic crops It is crucial to consider immediate challenges when taking a stance on cisgenic crops. With the rise of global population from 7.6 billion in 2017 to an expected 11.2 billion by 2100, there is an urgent call to reverse the state of hunger and malnutrition. Another impending constraint is climate change which is likely to cause a drastic decline in major crop production from cereals, pulses to legumes. Conventional plant breeding techniques may not live up to the racing demand for food and nutrition. In the wake of such a crisis, biotechnology is an undeniable rescue towards food and nutritional security. In the improvement of crops using genome engineering tools, the assessment of safety concerns, environmental risks, and health issues is imperative (Espinoza et al. 2013). GMO regulations are designed upon risk assessments with genes from outside a gene pool. The GMO Directive excludes somatic hybridization, mutagenesis, cross-breeding, polyploidy induction, and in vitro fertilization from sexually compatible plants as per the European Parliament. The longstanding argument remains if prospects of genetic engineering in crop improvement and the regulatory bindings demand a product-based or a process-based classification. There is a need for more precise communication of the sources of genetic variability used in gene technology-based breeding. Much of the liberalization of public opinion on GMO relies on communicating government policies to the public with the dissemination of a scientific perspective. In a 2010 report of the EU Commission, the public acceptance of cisgenic crops was surveyed. It was found that cisgenic apples resistant to scab, canker, and mildew were positively perceived than the transgenic apples (Gaskell et al. 2010). The cisgenic potato line ‘Modena’, overexpressing amylopectin, developed by a Dutch Company, Avebe, in the EU, was released in the Netherlands after initial resistance. The European Union considers both cisgenically and transgenically bred crops as genetically modified organism (GMO). Labeling is deemed mandatory. A survey

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

211

was conducted by a team of international researchers led by Lawton L. Nalley from Ghent University to evaluate the willingness-to-pay (WTP) for cisgenic or transgenic crops among European consumers. A significantly higher WTP was observed in over 3000 participants from Belgium, France, and the Netherlands, for rice labeled as GM compared to rice labeled as cisgenic. It indicated that the process of cisgenesis was more acceptable. In France, higher WTP was seen for rice with environmental benefits compared to conventional rice. The diversity of perceptions in GMOs will help in further demarcating regulations for GMO labeling and trade policies (Delwaide et al. 2015). Although policy makers and regulators do not directly control intellectual property and consumer acceptance, Schouten et al., claim it sensible to regulate cisgenic plants differently from transgenic plants. Self-evidently, cisgenic plants should be confirmed for unintended modifications and off-target integrations, such as a backbone gene from a plasmid. The presence of a foreign DNA even if, unintentionally introduced, could make it a transgenic. In a recent development, Brazil sought active cooperation with Gulf States on research and development of GM food. In 2018, Brazil expanded the area cultivated with GM crops by 1.1 million hectares increasing from 50.2 million hectares in 2017 to 51.3 million hectares. About 93% of their GM crops include cotton, corn, soybean, and sugarcane. Efforts are being made towards other crops such as tomato, carrot, and important vegetables. Argentina has developed policies for genome-edited plants, essentially for new varieties to be assessed on a case-by-case basis, if there is no new combination of genetic material and no transgenes have been used, the product will not be regulated as a GMO. In Canada, plants with ‘novel traits’ are covered by the Plant Protection Act (1990), regardless of the technology used to produce them and the cultivation of a sulfonylurea-tolerant oilseed rape variety produced by Oligonucleotide-Directed Mutagenesis (ODM) was approved by the Canadian Food Inspection Agency as early as 2013. Participatory plant breeding (PPB) and participatory crop improvement (PCI) consider the opinions of farmers in crop improvement programmes contributing to both decision-making and research. The participation of farmers may be helpful in achieving consumer acceptance of gene–technology-based breeding strategies. Additionally, their knowledge and evaluation of target environment could add to the effectiveness of PPB. In 2012, the Food Standards Australia New Zealand (FSANZ) constituted a panel of expert who grouped new plant breeding techniques into three categories: Cisgenesis/intragenesis, targeted addition or replacement of genes using ZFN technology, and GM rootstock grafting are in Category 1. The derived food from cisgenic or intragenic technology would be similar to that produced using standard transgenic techniques. The panel highlighted that in the case of cisgenesis and intragenesis, a simplified form of food safety assessment may be warranted because the transferred genes will be derived from the same or a closely related species likely used as food and with a history of safe use (Poltronieri and Reca 2015). In India, the framework for GM/biotech crops is described by the Department of Biotechnology, which consists of

212

B. K. Sarmah et al.

1. ‘Rules and Policies’ with Rules 1989 under Environment Protection Act (1986) and Seed Policy (2002), 2. ‘Guidelines’ for Recombinant DNA (1990) and for Research in Transgenic Crops (1998). In a recent survey, Indian consumers were reported to accept cisgenically bred rice (Shew et al. 2016). According to the consumers, (i) cisgenic and GM products should not be regulated as distinct from one another in India; (ii) cisgenic and GM foods should be labeled as such; and (iii) labeling GM and cisgenic foods as ‘no fungicide’ may enhance the marketability of GM rice in India. In the current stance on regulatory protocols for GM crops, gene technology could be a boon on many fronts considering the high level of food insecurity and the overwhelming challenges faced by farmers in the developing world.

8.8 Conclusion Given the changing face of global acceptance of GM crops both among farmers and consumers, genetically improved crops will soon find a place in our fields. With the potential of cisgenesis in accelerating the breeding process in plants harboring durable multigenic resistance, regulatory exemption would undeniably enhance both the economic and environmental scenarios in agriculture. Besides, cisgenesis could be instrumental to the second evergreen revolution, much needed in traditional plant breeding for global food and nutritional security.

References Ahmad N, Michoux F, Lössl AG, Nixon PJ et al (2016) Challenges and perspectives in commercializing plastid transformation technology. J Exp Bot 67(21):5945–5960. https://doi.org/10.1093/ jxb/erw360 Bajaj S, Puthigae S, et al (2008) Towards engineering drought tolerance in perennial ryegrass using its own genome. Paper presented at the 6th Canadian plant genomics workshop Belfanti E, Silfverberg-Dilworth E, Tartarini S, Patocchi A, Barbieri M, Zhu J, Vinatzer BA, Gianfranceschi L, Gessler C, Sansavini S (2004) The HcrVf2 gene from a wild apple confers scab resistance to a transgenic cultivated variety. Proc Natl Acad Sci 101(3):886–890 Biggs A (1990) Apple scab. Compendium of apple and pear diseases. pp 6–9 Caro M, Cruz V et al (1991) Salinity tolerance of normal-fruited and cherry tomato cultivars. Plant Soil 136(2):249–255 Cecchini E, Mulligan BJ et al (1998) Characterization of gamma irradiation-induced deletion mutations at a selectable locus in Arabidopsis. Mutat Res/Fundam Mol Mech Mutagen 401(1–2):199–206 De Marchi E, Cavaliere A et al (2019) Can consumer food choices contribute to reduce environmental impact? The case of cisgenic apples. Sci Total Environ 681:155–162. https://doi.org/10. 1016/j.scitotenv.2019.05.119

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

213

de Vetten N, Wolters A-M et al (2003) A transformation method for obtaining marker-free plants of a cross-pollinating and vegetatively propagated crop. Nat Biotechnol 21(4):439 Delwaide AC, Nalley LL et al (2015) Revisiting GMOs: are there differences in European consumers’ acceptance and valuation for cisgenically versus transgenically bred rice? PLoS ONE 10(5):e0126060. https://doi.org/10.1371/journal.pone.0126060 El-Kharbotly A, Leonards-Schippers C et al (1994) Segregation analysis and RFLP mapping of the R1 and R3 alleles conferring race-specific resistance to Phytophthora infestans in progeny of dihaploid potato parents. Mol Gen Genet 242(6):749–754. https://doi.org/10.1007/bf00283432 Eriksson D, Stymne S et al (2014) The slippery slope of cisgenesis. Nat Biotechnol 32(8):727. https://doi.org/10.1038/nbt.2980 Espinoza C, Schlechter R et al (2013) Cisgenesis and intragenesis: new tools for improving crops. Biol Res 46(4):323–331. https://doi.org/10.4067/S0716-97602013000400003 Espley RV, Hellens RP et al (2007) Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J 49(3):414–427. https://doi.org/10.1111/j.1365313X.2006.02964.x Ewing EE, Šimko I et al (2000) Genetic mapping from field tests of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii. Mol Breeding 6(1):25–36 Forsbach A, Schubert D et al (2003) A comprehensive characterization of single-copy T-DNA insertions in the Arabidopsis thaliana genome. Plant Mol Biol 52(1):161–176 Fraley RT, Rogers SG et al (1983) Expression of bacterial genes in plant cells. Proc Natl Acad Sci U S A 80(15):4803–4807. https://doi.org/10.1073/pnas.80.15.4803 Gadaleta A, Giancaspro A et al (2008) A transgenic durum wheat line that is free of marker genes and expresses 1Dy10. J Cereal Sci 48(2):439–445 Gaskell G, Stares S et al (2010) Europeans and biotechnology in 2010. Winds of change? Gaucher M, Righetti L et al (2019) An Erwinia amylovora inducible promoter for intragenic improvement of apple fire blight resistance. bioRxiv. 767772 Graham L (2013) Lonely ideas: can Russia compete? MIT Press Han X, Ma S et al (2013) Efficient agrobacterium-mediated transformation of hybrid poplar populus davidiana dode x populus bollena Lauche. Int J Mol Sci 14(2):2515–2528. https://doi.org/10.3390/ ijms14022515 Haque E, Taniguchi H et al (2018) Application of CRISPR/Cas9 genome editing technology for the improvement of crops cultivated in tropical climates: recent progress, prospects, and challenges. Front Plant Sci 9:617. https://doi.org/10.3389/fpls.2018.00617 Harfouche A, Meilan R et al (2011) Tree genetic engineering and applications to sustainable forestry and biomass production. Trends Biotechnol 29(1):9–17. https://doi.org/10.1016/j.tibtech.2010. 09.003 Harlan JR, de Wet JM (1971) Toward a rational classification of cultivated plants. Taxon 509–517 Heller KJ (2007) Genetically engineered food: methods and detection. Wiley Holme IB, Dionisio G et al (2012) Cisgenic barley with improved phytase activity. Plant Biotechnol J 10(2):237–247. https://doi.org/10.1111/j.1467-7652.2011.00660.x Holme IB, Wendt T et al (2013) Intragenesis and cisgenesis as alternatives to transgenic crop development. Plant Biotechnol J 11(4):395–407. https://doi.org/10.1111/pbi.12055 Hou H, Atlihan N et al (2014) New biotechnology enhances the application of cisgenesis in plant breeding. Front Plant Sci 5:389. https://doi.org/10.3389/fpls.2014.00389 Hough L, Shay J, et al (1953) Apple scab resistance from Malus-Floribunda Sieb. Paper presented at the proceedings of the American society for horticultural science. Huang S, Vleeshouwers VG et al (2004) The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities. Mol Plant Microbe Interact 17(4):428–435. https://doi.org/10.1094/MPMI.2004.17.4.428 Jacobsen E, Schouten HJ (2009) Cisgenesis: an important sub-invention for traditional plant breeding companies. Euphytica 170(1–2):235

214

B. K. Sarmah et al.

Jacobsen E, van der Vossen E et al (2009) Plant disease resistance: breeding and transgenic approaches. Encyclopedia of microbiology. Elsevier, Oxford, pp 597–612 Jo KR, Kim CJ et al (2014) Development of late blight resistant potatoes by cisgene stacking. BMC Biotechnol 14:50. https://doi.org/10.1186/1472-6750-14-50 Jochemsen H (2000) Toetsen en begrenzen: een ethische en politieke beoordeling van de moderne biotechnologie: Wetenschappelijke Instituten van GPV en RPF (ChristenUnie) Jones HD (2015) Challenging regulations: managing risks in crop biotechnology. Food and Energy Security 4(2):87 Karkute SG, Singh AK et al (2017) CRISPR/Cas9 Mediated genome engineering for improvement of horticultural crops. Front Plant Sci 8:1635. https://doi.org/10.3389/fpls.2017.01635 Khatodia S, Bhatotia K et al (2016) The CRISPR/Cas genome-editing tool: application in improvement of crops. Front Plant Sci 7:506. https://doi.org/10.3389/fpls.2016.00506 Khatodia S, Bhatotia K et al (2017) Development of CRISPR/Cas9 mediated virus resistance in agriculturally important crops. Bioengineered 8(3):274–279. https://doi.org/10.1080/21655979. 2017.1297347 Kichey T, Holme I et al (2009) Improving nitrogen use efficiency in barley (Hordeum vulgare L.) through the cisgenic approach Kleter GA, Kuiper HA et al (2019) Gene-edited crops: towards a harmonized safety assessment. Trends Biotechnol 37(5):443–447. https://doi.org/10.1016/j.tibtech.2018.11.014 Kuhl J, Hanneman R et al (2001) Characterization and mapping of Rpi1, a late-blight resistance locus from diploid (1EBN) Mexican Solanum pinnatisectum. Mol Genet Genomics 265(6):977–985 Lai J, Li Y et al (2005) Gene movement by Helitron transposons contributes to the haplotype variability of maize. Proc Natl Acad Sci USA 102(25):9068–9073. https://doi.org/10.1073/pnas. 0502923102 Langner T, Kamoun S et al (2018) CRISPR crops: plant genome editing toward disease resistance. Annu Rev Phytopathol 56:479–512. https://doi.org/10.1146/annurev-phyto-080417-050158 Li R, Quan S et al (2017) Molecular characterization of genetically-modified crops: challenges and strategies. Biotechnol Adv 35(2):302–309. https://doi.org/10.1016/j.biotechadv.2017.01.005 Lin X, Kaul S et al (1999) Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature 402(6763):761 Lusser M, Parisi C et al (2012) Deployment of new biotechnologies in plant breeding. Nat Biotechnol 30(3):231–239. https://doi.org/10.1038/nbt.2142 Madlung A, Comai L (2004) The effect of stress on genome regulation and structure. Ann Bot 94(4):481–495 McKnight TD, Lillis MT et al (1987) Segregation of genes transferred to one plant cell from two separate Agrobacterium strains. Plant Mol Biol 8(6):439–445. https://doi.org/10.1007/BF0001 7989 Melchers G, Sacristán MD et al (1978) Somatic hybrid plants of potato and tomato regenerated from fused protoplasts. Carlsberg Research Commun 43(4):203 Meyer R (1995) Detection of genetically engineered plants by polymerase chain reaction (PCR) using the FLAVR SAVR tomato as an example. Z Lebensm Unters Forsch 201(6):583–586 Michelmore RW (2003) The impact zone: genomics and breeding for durable disease resistance. Curr Opin Plant Biol 6(4):397–404 Naves ER, de Avila Silva L et al (2019) Capsaicinoids: pungency beyond capsicum. Trends Plant Sci 24(2):109–120. https://doi.org/10.1016/j.tplants.2018.11.001 Noeparvar S, Darbani B et al (2016) Targeted expression of HvHMA2 increases the mineral content of the inner endosperm in barley. Plant Biotechnol J Ortiz R, Jarvis A et al (2014). Plant genetic engineering, climate change and food security Paal J, Henselewski H et al (2004) Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach. Plant J 38(2):285–297

8 Cisgenesis: Engineering Plant Genome by Harnessing Compatible …

215

Park TH, Gros J et al (2005) The late blight resistance locus Rpi-bib3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on chromosome 4 of potato. Mol Plant Microbe Interact 18(7):722–729. https://doi.org/10.1094/MPMI-18-0722 Paul S, Ali N et al (2012) Molecular breeding of Osfer 2 gene to increase iron nutrition in rice grain. GM Crops Food 3(4):310–316. https://doi.org/10.4161/gmcr.22104 Poltronieri P, Reca IB (2015) Genetically modified plants. Cisgenesis. RNA transfer: rootstock to shoot delivery, Mutagenesis and non-GM advanced breeding methods Powers SJ, Mottram DS, Curtis A, Halford NG (2017) Acrylamide levels in potato crisps in Europe from 2002 to 2016. Food Additives Contaminants: Part A 34(12):2085–2100 Ribeiro C, Hennen-Bierwagen T et al (2020). Engineering 6-phosphogluconate dehydrogenase to improve heat tolerance in maize seed development. bioRxiv Rommens CM (2004) All-native DNA transformation: a new approach to plant genetic engineering. Trends Plant Sci 9(9):457–464. https://doi.org/10.1016/j.tplants.2004.07.001 Rommens CM (2006) Kanamycin resistance in plants: an unexpected trait controlled by a potentially multifaceted gene. Trends Plant Sci 11(7):317–319. https://doi.org/10.1016/j.tplants.2006.05.002 Rommens CM (2007) Intragenic crop improvement: combining the benefits of traditional breeding and genetic engineering. J Agric Food Chem 55(11):4281–4288. https://doi.org/10.1021/jf0 706631 Rommens CM, Haring MA et al (2007) The intragenic approach as a new extension to traditional plant breeding. Trends Plant Sci 12(9):397–403. https://doi.org/10.1016/j.tplants.2007.08.001 Rommens CM, Humara JM et al (2004) Crop improvement through modification of the plant’s own genome. Plant Physiol 135(1):421–431. https://doi.org/10.1104/pp.104.040949 Rommens CM, Kishore GM (2000) Exploiting the full potential of disease-resistance genes for agricultural use. Curr Opin Biotechnol 11(2):120–125 Rommens CM, Ye J et al (2006) Improving potato storage and processing characteristics through all-native DNA transformation. J Agric Food Chem 54(26):9882–9887. https://doi.org/10.1021/ jf062477l Schaart JG, Krens FA et al (2004) Effective production of marker-free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnol J 2(3):233–240. https://doi.org/10.1111/j.1467-7652.2004.00067.x Schaart JG, van de Wiel CCM et al (2016) Opportunities for products of new plant breeding techniques. Trends Plant Sci 21(5):438–449. https://doi.org/10.1016/j.tplants.2015.11.006 Scheben A, Wolter F et al (2017) Towards CRISPR/Cas crops—bringing together genomics and genome editing. New Phytol 216(3):682–698. https://doi.org/10.1111/nph.14702 Schlathölter I, Broggini GA et al (2019) Multi-level assessment of field-grown cisgenic apple trees. Paper presented at the XV EUCARPIA symposium on fruit breeding and genetics Schmidt, H., & Van de Weg, W. (2005). Breeding. In Fundamentals of temperate zone tree fruit production (pp. 136–155): Backhuys Publishers. Schouten HJ, Krens FA et al (2006) Cisgenic plants are similar to traditionally bred plants: international regulations for genetically modified organisms should be altered to exempt cisgenesis. EMBO Rep 7(8):750–753. https://doi.org/10.1038/sj.embor.7400769 Sharma (2008) Biotechnological approaches for pest management and ecological sustainability. CRC Press Sharma HC, Pampapathy G, Lanka SK, Ridsdill-Smith TJ (2005) Exploitation of wild cicer reticulatum germplasm for resistance to Helicoverpa armigera. J Econ Entomol 98(6):2246–2253. https://doi.org/10.1093/jee/98.6.2246 Sharma KK, Sreelatha G, Dayal S (2006) Pigeonpea (Cajanus cajan L. Millsp.). Methods Mol Biol 343:359–367. https://doi.org/10.1385/1-59745-130-4:359 Shew AM, Nalley LL et al (2016) Are all GMOs the same? Consumer acceptance of cisgenic rice in India. Plant Biotechnol J 14(1):4–7. https://doi.org/10.1111/pbi.12442 Shirley BW, Hanley S et al (1992) Effects of ionizing radiation on a plant genome: analysis of two Arabidopsis transparent testa mutations. Plant Cell 4(3):333–347

216

B. K. Sarmah et al.

Singh A, Chakraborty D et al (2016) CRISPR/Cas9: a historical and chemical biology perspective of targeted genome engineering. Chem Soc Rev 45(24):6666–6684. https://doi.org/10.1039/c6c s00197a Singh RJ, Chung GH et al (2007) Landmark research in legumes. Genome 50(6):525–537. https:// doi.org/10.1139/g07-037 Sink KC, Jain RK, Chowdhury JB (1992) Somatic cell hybridization. In: Distant hybridization of crop plants. Springer, Berlin, Heidelberg pp 168–198 Sticklen M (2015) Transgenic, cisgenic, intragenic and subgenic crops. Adv Crop Sci Tech 3(2):e123 Tamang T, Park J, Kakeshpour T, Valent B, Jia Y, Want G, Park S (2018) Development of selectable marker-free cisgenic rice plants expressing a blast resistance gene Pi9. World Con-Gress Vitro Biology 54:544 van der Vossen E, Sikkema A et al (2003) An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. Plant J 36(6):867–882 Vanblaere T, Flachowsky H et al (2014) Molecular characterization of cisgenic lines of apple ‘Gala’ carrying the Rvi6 scab resistance gene. Plant Biotechnol J 12(1):2–9. https://doi.org/10.1111/pbi. 12110 Vanblaere T, Szankowski I et al (2011) The development of a cisgenic apple plant. J Biotechnol 154(4):304–311. https://doi.org/10.1016/j.jbiotec.2011.05.013 Varshney RK, Song C et al (2013) Draft genome sequence of chickpea (Cicer arietinum) provides a resource for trait improvement. Nat Biotechnol 31(3):240–246. https://doi.org/10.1038/nbt.2491 Vasantrao JM, Baruah IK et al (2019) Transcript profiling of chickpea pod wall revealed the expression of floral homeotic gene AGAMOUS-like X2 (CaAGLX2). Mol Biol Rep. https://doi.org/10. 1007/s11033-019-05005-0 Vossen JH, van Arkel G et al (2016) The Solanum demissum R8 late blight resistance gene is an Sw-5 homologue that has been deployed worldwide in late blight resistant varieties. Theor Appl Genet 129(9):1785–1796. https://doi.org/10.1007/s00122-016-2740-0 Waltz E (2015) Nonbrowning gm apple cleared for market. Nat Biotechnol 33(4):326+ Wang Y, Cheng X et al (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol 32(9):947–951. https:// doi.org/10.1038/nbt.2969 Weeks JT, Ye J et al (2008) Development of an in planta method for transformation of alfalfa (Medicago sativa). Transgenic Res 17(4):587–597. https://doi.org/10.1007/s11248-007-9132-9 Williams E, Kuc J (1969) Resistance in Malus to Venturia inaequalis. Annu Rev Phytopathol 7(1):223–246 Xue T, Li X et al (2009) Cotton metallothionein GhMT3a, a reactive oxygen species scavenger, increased tolerance against abiotic stress in transgenic tobacco and yeast. J Exp Bot 60(1):339– 349. https://doi.org/10.1093/jxb/ern291 Zaidi SS, Vanderschuren H et al (2019) New plant breeding technologies for food security. Science 363(6434):1390–1391. https://doi.org/10.1126/science.aav6316 Zhu S, Li Y et al (2012) Functional stacking of three resistance genes against Phytophthora infestans in potato. Transgenic Res 21(1):89–99. https://doi.org/10.1007/s11248-011-9510-1

Chapter 9

Improving Biotic and Abiotic Stress Tolerance in Plants: A CRISPR-Cas Approach Akansha Jain, Anirban Bhar, and Sampa Das

Abstract Genome editing technologies have advanced speedily in the past few years and have become one of the most paramount tools in the management of abiotic and biotic stress-related damages of the plant species at the genetic level. The clustered regularly interspaced short palindrome repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) RNA-guided DNA endonuclease has the potential to edit genomes in living cells and is much easier to carry out and has outdone other gene editing tools. In this chapter, we summarize how CRISPR enables genome editing and the recent advances made in CRISPR-based technologies, especially in crop protection. We also discuss the regulatory viewpoint regarding the fate of CRISPR/Cas9 in developing biotic and abiotic resistance in crop plants and future challenges. Keywords Abiotic stress · Biotic stress · CRISPR-cas technology · Genome editing · Targeted mutagenesis

#Akansha Jain and Anirban Bhar contributed equally to the work. A. Jain · A. Bhar · S. Das (B) Division of Plant Biology, Bose Institute Centenary Campus, CIT Scheme, VII-M, P 1/12, Kankurgachi, Kolkata 700054, West Bengal, India e-mail: [email protected]; [email protected] A. Jain e-mail: [email protected] A. Bhar e-mail: [email protected] A. Bhar Department of Botany, Ramakrishna Mission Vivekananda Centenary College, Rahara, West Bengal, Kolkata 700118, India © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_9

217

218

A. Jain et al.

9.1 Introduction The ever-increasing world population demands an increase in the food supply. This challenge needs to be consigned feasibly by designing new crop varieties with a greater yield, improved disease resilience and enhanced salinity and drought tolerance. Genetic engineering has plentiful applications in crop plants, as they can improve the quality and quantity of food and can also enhance tolerance to abiotic and biotic stress. In comparison to conventional breeding, genetic engineering eases the transfer of the desired genes from one organism to another organism, contributing to the generation of new crops for breeding purposes, with desired traits. However, the development of genetically modified crops requires regulatory approval to protect human, animal health and environmental safety (National Academies of Sciences, Engineering, and Medicine 2016). The provision to genome and transcriptome sequences caused a shift in plant breeding activities (Borrelli et al. 2018). Markers designed on the basis of single nucleotide polymorphisms (SNPs) are extensively used in plant breeding, generating massive data for the discovery of quantitative trait loci (QTL). QTLs are selected in plants along with major resistance (R) genes to provide resistance against pathogens. New breeding techniques are gaining increasing interest in various fields including developmental biology, biotic and abiotic stress tolerance (Nelson et al. 2018). These new techniques include compelling molecular techniques for explicit genetic modifications of gene targets. It exploits site-directed nucleases to create double-strand breaks at desired location in DNA strand. Host cells repair system, repair doublestrand breaks (DSBs) using (a) either by small insertions or deletions by the way nonhomologous end joining (NHEJ), which can occur during any phase of the cell cycle, (drawback include occasional inaccurate repair) or (b) micro-homology-mediated end-joining (MMEJ) or (c) homology-directed repair (HDR), which mostly occurs during late S phase or G2 phase and uses another closely matching DNA sequence to repair the DSB (Das et al. 2019; Vu et al. 2019). Meganucleases (MNs), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR-Cas9 correspond to the four types of nucleases used in genome editing. Meganucleases are not preferred for genome editing as they are expensive and lack clear correspondence between sequence-specific meganuclease and their target DNA sequence specificity (Hsu et al. 2015). Similarly, ZFN are costlier to construct and has a higher probability of inaccurate cleavage of target DNA (Puchta and Hohn 2010). TALENs, on the other hand, are labour-intensive, and selection of TALEN sites requires a T before the 5 - end of the target sequences (Abdallah et al. 2016). The CRISPR/Cas9 was originally described from Streptococcus pyogenes (SpCas9) as a type II-A bacterial adaptive immunity (Jinek et al. 2012; Langner et al. 2018). The CRISPR/Cas9 RNA-guided endonuclease recognizes the aimed DNA via Watson–Crick base pairing and is a two-component organization where a single guide RNA (sgRNA) can bind to Cas9 nuclease and target-specific DNA (Khatodia et al. 2016). It also needs a protospacer adjacent motif (PAM) sequence (5 -NGG-3 ) to prompt DSB at the aimed site and to limit the target sequence in the

9 Improving Biotic and Abiotic Stress Tolerance …

219

gene of interest (Borrelli et al. 2018). The tremendous increase in the application of CRISPR-Cas9 makes it evident that this technology is simple to use relatively cheaper with a greater success rate in genome editing in comparison to the other accessible nucleases. The utilization of CRISPR-Cas9 in genome engineering has become a robust means for future improvement of abiotic stress tolerance and plant disease resistance (Borrelli et al. 2018). In plants, the widely tried substitute to SpCas9 is Cpf1 from Prevotella and Francisella with the PAM sequence TTTV, where “V” can be A, C or G (Endo et al. 2016). In a recent study, in rice two sgRNA expression cassette(s) were precisely introduced inside plant binary vectors by a single round of PCR amplification and a single LR reaction or Golden Gate cloning (Liu et al. 2020). The best part of using the CRISPR/Cas9 tool is that it can be used for the development of non-transgenic genome-edited plants to confer stress resistance. In the present chapter, we discuss the recent advances in abiotic stress tolerance and disease resistance against phytopathogens using the CRISPR/Cas9 tool and future need for advancement for its better utilization in genome editing.

9.2 CRISPR-Cas System CRISPR-Cas system consists of an assemble of Cas genes and CRISPR array. The CRISPR array is composed of repeat sequence interspaced by short variable sequences (spacers). CRISPR-Cas9 system works in three steps in reaction to foreign DNA (i) acquisition stage—the foreign genetic elements are integrated inside the host CRISPR array as new spacer and function as memory devices (Rhun et al. 2019); (ii) expression stage—Cas genes are translated into proteins, and CRISPR arrays are first transcribed as precursor CRISPR RNA (pre-crRNA) and later into mature CRISPR RNAs (crRNAs) with both the repeat and spacer; (iii) interference stage—crRNA and Cas proteins direct the nucleolytic activity of certain Cas enzymes to mediate cleavage of invading nucleic acid (Fig. 9.1).

Fig. 9.1 CRISPR-Cas system: The Cas9 protein with a customizable single-guided RNA (sgRNA) used for subsequent non-homologous end-joining (NHEJ) process and homologous recombination (HR) pathway

220

A. Jain et al.

9.3 Classification CRISPR-Cas systems present miraculous diversification in terms of content, locus architecture, definite sequences and machinery involved (Koonin et al. 2017). CRISPR-Cas organization has been divided into two classes, six types and many subtypes according to their cas gene sequence, the sequence of the repeats and the organization of the CRISPR loci (Makarova et al. 2015). The two classes vary in the design conventions of the effector module. Class 1 consists of diversified type I, type III, with the effector modules being intricate complexes that consist of multiple Cas protein subunits that are depicted in many archaea but are low prevalent in bacteria (Makarova et al. 2020). Class 2 have relatively uncomplicated organization, with a single, large, multidomain and multifunctional Cas effector.

9.4 CRISPR-Cas in Biotic Stress Tolerance Plant pathogen incorporates viruses, bacteria, fungi and insects; they can infect plants causing disease and severe damage. Recently, CRISPR/Cas genome engineering has been extensively used to address a lot of agronomic challenges, including disease resistance. CRISPR-Cas9 system has been operated to provide disease-resistant or disease-free plants. Recently, a large number of studies establishing the capacity of the CRISPR/Cas systems in improving resistance to plant pathogens are reported (Table 9.1) and discussed below.

9.4.1 Viruses Viral resistance by CRISPR/Cas9 system has been mainly achieved by directly aiming the viral genome and/or indirectly by modifying the plant’s vulnerable factors. Most of the reports involving CRISPR-Cas9 genome editing in viruses are accomplished by targeting the ssDNA of the geminiviruses (Ali et al. 2015, 2016; Baltes et al. 2015; Ji et al. 2015). CRISPR/Cas9 was first utilized to develop resistance against beet severe curly top virus (BSCTV) in Arabidopsis and Nicotiana benthamiana plants overexpressing sgRNA-Cas9 (Ji et al. 2015). Transgenic N. benthamiana plants constitutively expressing Cas9 and sgRNA-Cas9 showed alleviated tolerance and reduced symptoms against bean yellow dwarf virus (BeYDV) (Baltes et al. (2015). Similarly, Ali et al. (2015) used sgRNA overexpressing the Cas9 endonuclease in N. benthamiana for aiming the viral capsid protein (CP), the RCRII motif of the replication protein (Rep) and the intergenic region (IR) of tomato yellow leaf curl virus (TYLCV). Ali et al. (2016) later showed that sgRNA/Cas9 complex modified locations in the coding regions caused the origination of virus variants efficient in replicating and systemic movement.

9 Improving Biotic and Abiotic Stress Tolerance …

221

Table 9.1 Application of CRISPR-Cas9 genome editing system for inducing viral, fungal and bacterial resistance Organism Name

Plant name

Target genes/region

References

BSCTV

Nicotiana benthamiana

LIR and Rep/RepA

Ji et al. (2015)

BeYDV

Arabidopsis and N.benthamiana

CP, Rep, and IR

Baltes et al. (2015)

TYLCV, BCTV, MeMV

N.benthamiana

CP, RCR II motif of Rep and IR

Ali et al. (2015)

CVYV, ZYMV, PRSVW

Cucumis sativus

eIF4E

Chandrasekaran et al. (2016)

TuMV

N. benthamiana

GFP, HC-Pro, CP

Aman et al. (2018)

TYLCV

Solanum lycopersicum

CP and Rep

Tashkandi et al. (2018)

RTSV

Oryza sativa var. indica cv. IR64

eIF4G

Macovei et al. (2018)

Powdery mildew fungus, Triticum aestivum Blumeria graminis f. sp. Tritici

TaMLO-A1

Wang et al. (2014)

Rice blast disease, Magnaporthe oryzae

Oryza sativa L. japonica (var. Kuiku131)

OsERF922

Wang et al. (2016)

Powdery mildew fungus, Oidium neolycopersici

S. lycopersicum

SlMlo1

Nekrasov et al. (2017)

Phytopthora palmivora

Carica papaya

PpalEPIC8

Gumtow et al. (2018)

Fusarium oxysporum, Fusarium wilt

S, lycopersicum

Solyc08g075770

Prihatna et al. (2018)

Bacterial blight, Xanthomonas oryzae pv. oryzae

Oryza sativa

OsSWEET13

Zhou et al. (2015)

Pseudomonas syringae, Xanthomonas spp., and Phytophthora capsica

S. lycopersicum

Exon-3, SlDMR6–1

de Toledo et al. (2016)

Fire blight, Erwinia amylovora Malus domestica

DIPM 1, 2, 4

Malnoy et al. (2016)

Citrus canker, Xanthomonas citri

Citrus paradisi

CsLOB1

Jia et al. (2016a)

Pseudomonas syringae pv. tomato DC3000

S. lycopersicum

SlJAZ2

Ortigosa et al. (2019)

Viral Resistance

Fungal Resistance

Bacterial Resistance

222

A. Jain et al.

CRISPR/Cas9-based editing of S-genes in the papaya plant was found to provide resistance against Papaya ringspot virus (PRSV) (Green and Hu 2017). CRISPRCas9 tool was also applied to produce transgenic tomato plants resistant to the tomato yellow leaf curl virus by editing the CP and replicase loci of the viral genome. The genetically engineered tomatoes were more resistant to viral interference and assembled lower viral genomic DNA compared to wild-type plants (Tashkandi et al. 2018). In course of time, new nucleases were discovered which are capable of binding to and cutting RNA, such as FnCas9 from Francisella novicida (Hirano et al. 2016; Green and Hu 2017) and LwaCas13a from Leptotrichia wadei (Abudayyeh et al. 2017; Green and Hu 2017). Abudayyeh et al. (2017) also reported heterologous expression of LwaCas13a in mammalian and plant cells for intended knockdown of reporter or endogenous transcripts. The N. benthamiana and Arabidopsis plants expressing FnCas9 and sgRNA specific for cucumber mosaic virus (CMV) or tobacco mosaic virus (TMV), respectively, recorded a significant decrease in virus load and disease symptoms till T6 generation (Zhang et al. 2018). Aman et al. (2018) used CRISPR-Cas13a for engineering obstructions to Turnip Mosaic Virus (TuMV) in N. benthamiana. CRISPR/Cas9 tool was also applied for knockout important gene Dicer-like 2 (DCL2) in tomato. The dcl2 mutants were susceptible to potato virus X, tobacco mosaic virus and tomato mosaic virus, indicating the role of DCL2 is conferring resistance to RNA viruses (Wang et al. 2018a; b). Cassava brown streak disease is an important disease in cassava provoked by the family of virus Potyviridae. The disease development requires the interaction of viral genome-linked protein (VPg) and plant’s eukaryotic translation initiation factor 4E (eIF4E) isoforms. CRISPR/Cas9-arbitrated editing of cassava eIF4E isoforms (nCBP-1 and nCBP-2) resulted in enhanced resistance response to the virus (Gomez et al.2017). Editing eIF4E of cucumber within non-homologous regions improved resistance against potyviruses in homozygous T3 lines (Chandrasekaran et al. 2016). Similar resistance in rice against rice tungro spherical virus (RTSV) was achieved by targeting the eIF4 gamma (eIF4G) gene (Macovei et al. 2018). The benefits of knocking out the host susceptibility genes are relatively simple, and it makes a loss in the viral life cycle in a form of recessive resistance, preventing virus evolution. However, it has drawbacks like decreasing plant vigour, aiding the selection of virus variants shattering barriers to resistance (Abdul-Razzak et al. 2009).

9.4.2 Fungi Fungal pathogens can cause huge damage to plants by causing various diseases such as powdery mildew, smut, rust, rot, early blight, late blight, wilt disease, etc. Apart from causing diseases, they can also cause huge loss by the production of mycotoxins. Several strategies have been adopted in genetic engineering, but editing is majorly done by targeting the S genes. The mildew resistant locus O (Mlo) encodes

9 Improving Biotic and Abiotic Stress Tolerance …

223

a plasma membrane-associated protein with seven transmembrane domains (S gene locus), conferring susceptibility to powdery mildew causing fungi (Acevedo-Garcia et al. 2014). Application of CRISPR/Cas9 technology in bread wheat plants at MLO homeoalleles, TaMLO-A1, improved resistance against Blumeria graminis f. sp. tritici challenge (Wang et al. 2014). Tomelo, a non-transgenic tomato variety resistant to the powdery mildew fungus, Oidium neolycopersici has been designed applying the CRISPR/Cas9 system. The researchers aimed the SlMlo1 locus in tomato utilizing the double sgRNA strategy (Nekrasov et al. 2017). In rice, OsERF922 an APETELA2/ethylene response factor (AP2/ERF)-type transcription factor shows up upon infection with blast fungus, Magnaporthe oryzae (Liu et al. 2012). CRISPR/Cas9-based engineering of the OsERF922 gene was also used in rice to induce tolerance against the blast pathogen (Wang et al. 2016). Phytopthora palmivora is capable of infecting all parts of papaya despite of the plant having a high amount of papain (a cysteine protease). The fungal pathogen encloses cysteine inhibitors, which allows them to overcome papain-mediated resistance. CRISPR/Cas9, mediated mutation of a cysteine protease inhibitor, cystatin (PpalEPIC8) in P. palmivora, was found to increase its susceptibility to papain indicating its role in fungal virulence by constraining papain (Gumtow et al. 2018). Similarly, CRISPR-Cas9 was utilized to knockout the Solyc08g075770 gene in tomato. The plants displayed susceptibility to Fusarium wilt indicating the role of the gene in wilt tolerance (Prihatna et al. 2018). In a similar study, mitogen-activated protein kinase 3 (MAPK3) was reported to huddle resistance to Botrytis cinerea by applying CRISPR-Cas9 technology (Zhang et al. 2018). In grapevine, mildew resistance locus O 7 (MLO7) and WRKY transcription factor 52 (WRKY52) are two genes functioning in resistance against Erysiphe necator and B. cinerea resistance, respectively. CRISPR-Cas9-mediated loss-of-function mutants for these two genes indicated enhanced immunity (Malnoy et al. 2016; Wang et al. 2018c). Genome editing was also used to arrest the banana streak virus, and it was observed that 75% of the mutated plants remained asymptomatic as compared to control plants (Tripathi et al. 2019).

9.4.3 Bacteria Plant pathogenic bacteria are challenging to manage, primarily because of their late detection and the absence of suitable chemical control methods along with fast multiplication rate. Also, very few studies are available related to the utilization of CRISPR/CAS9 for bacterial resistance in crops. CRISPR/Cas9 editing of OsSWEET13 (a sucrose transporter gene) has been carried in rice to induce resistance against Xanthomonas oryzae pv. oryzae (Zhou et al. 2015). OsSWEET13 is a susceptibility (S) gene that interacts with X. oryzae effector protein, PthXo2, causing susceptibility. Zhou et al. (2015) transferred the OsSWEET13 allele from indica rice IR24 to japonica rice causing disease susceptibility, whereas mutations using CRISPR/Cas9 made the plants resistant to bacterial blight.

224

A. Jain et al.

CRISPR-Cas9 tool has been utilized in tomato to inactivate the downy mildew resistant 6 (DMR6) and noticed that dmr6 mutants displayed resistance against plant pathogens, viz. Pseudomonas syringae, Xanthomonas spp., and Phytophthora capsica (de Toledo et al. 2016). Erwinia amylovora, pathogenicity effector (DspE) associates with receptor-like serine/threonine kinases produced by DspE-interacting proteins of Malus (DIPM) genesDIPM 1, 2, 3, 4 (Borejsza-Wysocka et al. 2006). CRISPR/Cas9 was used to target DIPM 1, 2 and 4 genes in apple protoplast to establish resistance against E. amylovora (Malnoy et al. 2016). CRISPR/Cas9 technology has also been employed on citrus plants to develop resistance to citrus canker caused by Xanthomonas citri subsp. citri (Xcc). Canker-resistant mutants with the decrease in disease symptoms were developed by mutating the PthA4 effector binding elements in the promoter of the Lateral Organ Boundaries 1 (CsLOB1) gene in Duncan grapefruit (Jia et al. 2016a). The entire omission of the EBEPthA4 sequence from both CsLOB1 alleles enhanced resistance to citrus bacterial canker in Wanjincheng orange (Peng et al. 2017). In a recent investigation, CRISPR-Cas9 was used to produce tomato plants with dominant Jasmonatezim domain protein 2 (JAZ2) repressors lacking the jasmonate associated (Jas) domain (JAZ2jas). These edited repressors afford resistance to Pseudomonas syringae even in the field conditions (Ortigosa et al. 2019). Recently, a rapid, cost-effective method has also been developed to screen different cytosine base editors to induce Cas9-independent deamination in bacteria and in human cells (Doman et al. 2020).

9.4.4 Insects Development of insect resistance in plants using CRISPR-Cas technology is challenging largely because of the unavailability of the genome sequence of insects as well as lack of standard embryonic microinjection techniques. Although CRISPR technology has been used in different insects including Diptera, Lepidoptera and Coleoptera, but its application on Lepidoptera insect, Spodoptera litura is very successful. Abdominal-A (Slabd-A) was targeted in S. litura by CRISPR-Cas9 technology which leads to anomalous segmentation and ectopic pigmentation during larval development (Bi et al. 2016). BT toxin, Cry 2Ab is very well known for its insecticidal effect by binding with brush border membrane vesicle (BBMVs) within insect midgut. CRISPR-Cas9-based targeted mutagenesis of ABC transporter protein (HaABCA2) in two lepidopteran insects, Helicoverpa armigera and Helicoverpa punctigera confirmed the interaction of Cry2Ab protein with ABC transporter protein in these two insects (Wang et al. 2017a).

9 Improving Biotic and Abiotic Stress Tolerance …

225

9.5 CRISPR-Cas in Abiotic Stress Tolerance Development of transgenic plants to counteract different major abiotic stress minimizes crop yield loss, but the sustainability of these resistant transgenes in the germplasm is a major challenge (Parray et al. 2019). Largely uniform target possibility in all most every location of the genome provides the versatility of this technique to combat abiotic stresses tactfully. The advent of CRISPR-Cas9 technology has revolutionized abiotic stress research with large number of studies which had opened wide possibilities in this regard (Fig. 9.2; Table 9.2). Modern improvements minimize the adverse effects of CRISPR/Cas9-mediated targeted editing due to “offtarget” mutations and increase its specificity towards a particular gene. However, the application of CRISPR/Cas9 to combat abiotic stress in plants is less abundant than its use to counteract biotic stresses.

Fig. 9.2 Abiotic stress response pathway: Network showing interaction among different abiotic stresses in the plant. The major signalling hubs primarily targeted by CRISPR-Cas technology are emphasized; red boxes demonstrate drought response network, blue boxes represent salinity stress network, whereas orange and green boxes exhibit heat and cold stress network respectively

226

A. Jain et al.

Table 9.2 Application of CRISPR-Cas9 genome editing system for abiotic stress tolerance Stress

Plant name

Targeted genes/region

References

Drought

Maize

ARGOS8

Shi et al. (2017)

Tomato

SlNPR1

Li et al. (2019a)

Tomato

SlMAPK3

Wang et al. (2017b)

Rice

SAPK2

Lou et al. (2017)

Wheat

TaDREB2, TaDREB3

Kim et al. (2018)

Rice

OsMIR408, OsMIR528, miR815a/b/c, miR820a/b/c

Zhou et al. (2017)

Rice

POsRAV2

Duan et al. (2016)

Rice

NHX, SOS1

Farhat et al. (2019)

Rice

OsRR22

Zhang et al. (2019a)

Rice

SAPK1, SAPK2

Lou et al. (2018)

Rice

HDA19, HDA5/14/15/18

Ueda et al. (2017)

Rice

OTS1

Sadanandom et al. (2015)

Arabidopsis sp

ECIP1

Lei et al. (2011)

Glycine max

GmDrb2a, GmDrb2b

Curtin et al. (2018)

Salinity

Medicago truncatula

MtHEN1

Curtin et al. (2018)

Heat

Rice

HSA1, FLN2

Qiu et al. (2018)

Cold

Rice

OsANN3

Shen et al. (2017)

Arabidopsis sp

CBF1, CBF2, CBF3

Jia et al. (2016b)

Tomato

SlCBF1

Li et al. (2018)

Rice

TCD10

Wu et al. (2016)

Rice

OsPRP1

Nawaz et al. (2019)

Rice

OsAOC

Nguyen et al. (2020)

Rice

OsPIN5b,GS3, OsMYB30

Zeng et al. (2020)

Drought, oxidative stress and genotoxicity

Arabidopsis sp, Maize

PARP, NUDX

Njuguna et al. (2017)

Salt, drought, heat and cold stress

Different crop plants

AP2/ERF super family

Debbarma et al. (2019)

Multiple stress

(continued)

9 Improving Biotic and Abiotic Stress Tolerance …

227

Table 9.2 (continued) Stress

Plant name

Targeted genes/region

References

Drought, salinity and cold stress

Arabidopsis

UGT79B2, UGT79B3

Li et al. (2017)

Salt, drought, and oxidative stress

Rice

OsNCED3

Huang et al. (2018)

Salt, drought, cold, UV light and ABA

Glycine max

GmMYB12B2

Li et al. (2016); Khan et al. (2018)

9.5.1 Drought Drought is considered to be the most prevalent abiotic stress affecting plants which cause major devastation in crop yields worldwide. Additionally, global climate change enhances the effect of drought in a deleterious way that leads scientists to concern more about generating drought-tolerant crop varieties to ensure future production. Mining of drought-resistant genes and their introduction into the genome of susceptible varieties is most commonly practiced to answer this age-old problem. In the past few years, many attempts had been taken to tackle drought stress in plants using CRISPR-Cas9 technology. ARGOS8 is a negative regulator of the ethylene response pathway and transgenic lines over expressing ARGOS8 had low ethylene sensitivity that causes increased drought tolerance in maize. Different drought-resistant natural genotypes have been screened for ARGOS8, and within these genotypes, very low level of expression was detected. To overcome this, the CRISPR-Cas9-dependent advanced breeding programme has been employed to express ARGOS8 under moderately expressing constitutive promoter GOS2 (Shi et al. 2017). Non-expresser of pathogenesis-related gene 1 (NPR1) is a well-known regulator in plant biotic stress. In tomato plants, it had been shown that CRISPR-Cas9dependent mutation in the SINPR1 gene causes reduced drought stress. This gene is expected to control drought stress through SIGST, SIDHN and SIDREB simultaneously (Li et al. 2019a). In a separate study, it was demonstrated that CRISPR-Cas9dependent mutation in SIMAPK3 leads to enhanced symptoms of drought stress and reduced expression of SILOX, SIGST and SIDREB (Wang et al. 2017b). Probably, SIMAPK3 regulates drought-dependent expression of DREB and other associated transcription factors in NPR1-dependent pathway. Absicisic acid (ABA) is considered to be the major stress hormone that regulates drought and salinity stress primarily through stomatal closure and reduced water loss in plants. SNF 1-related protein kinase 2 (SnRK2) has long been known for its role in ABA-dependent developmental events in plants. CRISPR/Cas9-dependent lossof-function mutation in osmotic stress/ABA-activated protein kinase 2 (SAPK2) showed enhanced susceptibility towards drought in rice. Rice SAPK2 induced drought tolerance through the expression of OsRab16a, OsRab21, OsbZIP23, OsLEA3, OsDREB1 and slow anion channel (SLAC) linked genes OsSLAC1 and

228

A. Jain et al.

OsSLAC7 (Lou et al. 2017). Drought tolerance was also achieved successfully in polyploid plants using CRISPR/Cas9 intervened targeted genome engineering. In wheat, CRISPR/Cas9 had been employed to mutate dehydration-responsive elementbinding protein 2 (TaDREB2) and ethylene-responsive factor 3 (TaERF3) (Kim et al. 2018). ABA-responsive element-binding protein 1/ABRE binding factor 2 (AREB1/ABF2) is a positive regulator for drought tolerance. Paixão et al. (2019) tried to develop a CRISPR activated system (CRISPRa) that targets AREB1. Firstly, stable transgenic plants expressing chimeric dCas9 histone acetyltransferase 1 (HAT1) were generated. This CRISPRa dCas9 HAT system was proved to be a very valuable system to improve drought tolerance in plants (Paixão et al. 2019). The utilization of CRISPR/Cas9 technology to improve drought tolerance in legume crop is largely absent but TALEN as well as CRISPR/Cas9 tool has now been applied in legume crop in different aspects (Curtin et al. 2018; Popoola et al. 2019; Wang et al. 2017c; Ji et al. 2019; Gao et al. 2018).

9.5.2 Salinity Salt stress also causes major devastation in crop yield that mimics physiological effects similar to drought stress in plants. Rice production is seriously affected by salinity stress; hence, CRISPR/Cas9-mediated salt stress management is mostly concentrated in rice plants. Micro-RNAs have complex interaction regulatory networks in plants to counteract stress pathways. Simultaneous mutation in different miRNA genes is very much difficult to carry out in plants. In rice OsMIR408, OsMIR528 and miRNA gene families, miR815a/b/c and miR820a/b/c were aimed by CRISPR/Cas9 to demonstrate their role in salt stress (Zhou et al. 2017). AP2/ERF domain-containing RAV (related to ABI3/VP1) transcription factors are associated with different abiotic stresses in plants. OsRAV2 was known to be induced in high salinity but not through KCl, cold stress, ABA or other osmotic factors. CRISPR/Cas9 intervened targeted mutagenesis in the promoter region of OsRAV2 (POsRAV2 ) demonstrated that the GT1 element located in the POsRAV2 site is responsible for salt tolerance (Duan et al. 2016). CRISPR-Cas9-mediated genetic engineering of NHX and SOS1 transporters has been employed to demonstrate their role in salt stress in rice (Farhat et al. 2019). In a separate investigation, the OsRR22 gene was aimed through CRISPR/Cas9 to develop salinity resistance in rice (Zhang et al. 2019a). Sucrose non-fermenting 1-related protein kinase, SAPK1 and SAPK2 mutation imposed by CRISPR/Cas9 leads to reduced sensitivity towards salt and enhance salinity stress tolerance by inducing antioxidant enzyme system (Lou et al. 2018). Histone deacetylase (HDA) inhibitor (HDI) provides salt tolerance in rice plants. CRISPR/Cas9-dependent targeted mutation of class I HDAC (HDA19) and class II HDACs (HDA5/14/ 15/18) explained that the influence of HDA19 is more pronounced than that of class II HDACs (Ueda et al. 2017). Overly tolerant to salt1 (OTS1) is a class of SUMO protease family protein, targeted mutagenesis of which conferred enhanced salt tolerance in rice (Zhang et al. 2019b). In Arabidopsis,

9 Improving Biotic and Abiotic Stress Tolerance …

229

CRISPR technology revealed that the MA3 domain-containing ethylene insensitive 2 (EIN2) interacting protein 1 (ECIP1) was involved in salt tolerance (Lei et al. 2011). Studies regarding salt tolerance in legumes using CRISPR/Cas9 technology are still elusive. Recently, CRISPR/Cas9 and TALEN-mediated mutation in GmDrb2a and GmDrb2b (Glycine max) and Medicago truncatula Hua enhancer1 (MtHEN1) were employed to generate heritable mutations to study small RNA processing in leguminous plants (Curtin et al. 2018).

9.5.3 Heat Increasing environmental temperature and rapid climate change adversely affect plant populations globally (Chauhan et al. 2014). The effect of climate change is more deleterious in crop plants rather than wild plants. Studies regarding the application of CRISPR/Cas9 technology to manage heat stress in plants are limited. In a study, it had been shown that increased temperature in Arabidopsis leads to greater efficiency in targeted mutation using the CRISPR/Cas9 system. Streptococcus pyrogenes Cas9 (SpCas9) activity created a better DNA double-stranded break at 37 °C than lower temperature (LeBlanc et al. 2018). Recently, transient expression of CRISPR/Cas9 has been utilized to improve precision in genome editing. In rice, inducible CRISPR/Cas9 system was developed by expressing Cas9 governed by soybean heat shock promoter (HsCas9) and sgRNA under rice ubiquitin 3 promoter. HsCas9 expressing rice plants showed not only higher mutagenesis after heat shock treatment in comparison to constitutively expressing Cas9, but these mutations were also heritable to their progeny (Nandy et al. 2019). Heat stress also has a direct correlation with chloroplast biogenesis in plants. Heat-sensitive albino1 (hsa1) directly controls fructokinase like protein2 (FLN2) during chloroplast development. CRISPR/Cas9-mediated deletion of HSA1 leads to enhanced heat sensitivity as well as faster greening recovery as compared to the original hsa1 allele in rice (Qiu et al. 2018).

9.5.4 Cold Chilling or cold stress is also an important abiotic stress factor in crop plants. Plant annexins are Ca+2 -dependent phospholipid proteins present in multiple gene families in plants. They are involved in varied developmental events. CRISPR/Cas9-mediated targeted editing of rice annexin, OsANN3, suggested its effect in cold tolerance in rice (Shen et al. 2017). On the other hand, C-repeat binding factors (CBFs) are well known for their association with cold stress, but lack of “null cbf ” mutants made it impossible to determine their specific functions in cold stress. CRISPR/Cas9 technology was applied to create cbf1, cbf2 and cbf3 (cbfs) triple mutant to determine many unresolved puzzles in the cold stress pathway (Jia et al. 2016b). Similarly, targeted

230

A. Jain et al.

mutagenesis of Solanum lycopersicum C-repeat binding factor1 (SlCBF1) exhibited enhanced chilling injury symptoms in tomato plants (Li et al. 2018). Map-mediated cloning with subsequent RNA interference and CRISPR/Cas9-based silencing of thermosensitive chlorophyll-deficient mutant 10 (tcd10) enhanced chilling stress in rice (Wu et al. 2016). In a separate study with rice plants, the involvement of prolinerich proteins (PRPs) to combat low-temperature stress was seen. It was evident that CRISPR/Cas9-mediated knock out OsPrp1 plants exhibited enhanced nutrient leakage, less antioxidant activity, low proline and chlorophyll synthesis. The chilling sensitivity due to OsPrp1 can be alleviated by external salicylic acid (SA) treatment (Nawaz et al. 2019). In plants, SA and JA (jasmonic acid) pathway acts antagonistically (Bhar et al. 2018). Allene oxidase cyclase (OsAOC) is a single copy gene in rice that is prominently involved in the JA biosynthetic pathway. CRISPR/Cas9 mediated silencing of the OsAOC gene leads to JA impaired rice plants, showing enhanced chilling tolerance (Nguyen et al. 2020). In rice, the simultaneous mutation in Ospin5b (panicle length gene), gs3 (grain size gene), Osmyb30 exhibited increased cold stress associated with high panicle length and grain size (Zeng et al. 2020). CRISPR/Cas9 approach has also been utilized for improvements of cold sensitivity in maize (Hillmann 2019). CRISPR/Cas9 genome engineering technology was also used to enhance glycerol uptake in wine yeast during ice wine production (Muysson et al. 2019). This technology has a wide possibility to improve osmoticum concentration in plant cytosol to combat chilling stress in other crop plants.

9.5.5 Multiple Abiotic Stresses Different abiotic stresses have similar physiological effects as well as they share a common gene interaction pathway in plants. In this regard, targeting a gene and/or genes to combat multiple stress factors is trending nowadays in plant stress management studies. RNAi-mediated down-regulation and CRISPR/Cas9-mediated knockdown of two poly-ADP-ribosylation metabolic pathway proteins, poly(ADP-ribose) polymerase (PARP) and ADP-ribose specific Nudix hydrolase (NUDX) revealed their novel function in resilience to drought stress, oxidative stress and genotoxic stress in Arabidopsis and maize (Njuguna et al. 2017). Multiplex CRISPR/Cas9 of a negative regulatory gene, ethylene response factor, AP2/ERF superfamily proteins demonstrated consorted effect in multiple stress tolerance, i.e. salt, drought, heat and cold (Debbarma et al. 2019). UDP-glucosyltransferases (UGTs) are the largest known GT family protein in plants, liable for the transfer of sugar moieties to wide numbers of small molecules. UGT79B2 and UGT79B3 from Arabidopsis are known to control several abiotic stresses like drought, salt, cold stress, etc. Over expression, as well as CRISPR/Cas9-induced mutation of these two genes, suggested their role in anthocyanin biosynthesis pathway, as anthocyanin rhamnosyltransferases, which in turn regulated by CBF1 during multiple abiotic stress tolerance (Li et al. 2017). Another study indicated the role of rice 9-cis-epoxy-carotenoid dioxygenase3 (OsNCED3) implicated in salt, drought and oxidative stress tolerance (Huang et al.

9 Improving Biotic and Abiotic Stress Tolerance …

231

2018). A soybean R2R3-MYB transcription factor GmMYB12B2 has also been reported to be involved in multiple stress tolerance, e.g. salt, drought, chilling, UV radiation in transgenic Arabidopsis plants (Li et al. 2016). Knockdown mutation of GmMYB12B2 also incurred pronounced susceptibility towards drought, cold and ABA responses (Khan et al. 2018). Another novel MYB transcription factor, GmMYBJ1 also showed tolerance against drought and cold in Arabidopsis, and recently, this novel MYB transcription factor became an interesting candidate to combat multiple abiotic stresses (Su et al. 2014, Li et al. 2019b).

9.6 Conclusion As population increase, increasing pathogenic eruption, abiotic stresses and changes in climate pose a serious threat to crop production, both in terms of quality and quantity. Genetic engineering has immensely helped to cope up with numerous biotic or abiotic stresses. The availability of genome sequences of many plants and progress in genome engineering techniques has allowed prospects to modify any required trait. New techniques are much needed to further boost crop production to fulfil the increasing global food requirement (Haque et al. 2018). Genome editing has been revolutionized with the advent of the CRISPR/Cas9 tool. It has shown encouraging results to rapidly solve rising challenges in agriculture. CRISPR/Cas9 genome engineering is one of the most expeditiously looming systems in plant sciences. In contrast to other genome editing techniques, CRISPR/Cas9 is faster, more accurate, less costlier and powerful tool in engineering genomes (Fig. 9.3). CRISPR-Cas9 will apparently dodge the current GM regulations system as the Cas9 protein-guide RNA complexes get promptly decomposed in the reproducing cell cultures (Parmar et al. 2017). In this scenario, we may expect higher global approval of the CRISPR modified crops in contrast to the transgenic crops as CRISPR-edited crop does not necessarily contain any foreign gene and thus ensure food security. However, the rise of CRISPR based genome-engineering crops faces resentment due to non-approval by public and stringent regulatory obstructions by the government for its commercialization (Yamamoto et al. 2018). It may be noted that the basic principles of addressing regulatory issues related to commercialization of genetically engineered crops are consensus; however, some guidelines are varying from one country to another depending on the socio-economic status of the particular nation. From a regulatory point of view, developing resistance by (1) direct introgression of foreign gene, and (2) genome editing techniques are of two categories. Biosafety assignment of these two categories of plants is not to be treated similarly. The sustainability of such genome-edited plants in subsequent generations is to be ensured to achieve the full benefit of this valuable technology. With further progress in the CRISPR-Cas9 system and the formation of an assessment means, more nations might be enthusiastic towards comprehensive consideration of CRISPR-edited crops. Explicit use of CRISPR-Cas9 can improve our understandings of stress-regulated gene functions, gene-regulatory networks and genes involved in stress adaptation.

232

A. Jain et al.

Fig. 9.3 Schematic diagram showing different strategies to combat major abiotic and biotic stress in plants. The possible advantages of CRISPR-Cas technology over other techniques are also highlighted

9.7 Future Prospects Genetic engineering has provided a vast array of stress tolerance strategies that have brought unbelievable advances in crop production and safety. Genome editing can contribute to plants’ defence response by modifying the genes that confer the host susceptible towards the pathogen or by editing pathogenicity genes in the genome of the causal pathogen. CRISPR/Cas9 technology has come out as a dynamic technique for crop improvement due to its easiness, feasibility and flexibility. It can provide an overview of the actual sequential mechanism of pathogenesis by knockdown, insertions, deletions, replacement, fine-tuning of different genes involved during pathogen infection. It is also essential to assess the mutated plants in the field for several generations to ensure the stability of gene editing and to check its impact on plant vigour and yield. Application of functional genomics, next-generation sequencing, bioinformatics along the progress made in CRISPR/CAS system will concede the generation of crops with improved agronomic traits especially stress resistance capability. Acknowledgements AJ acknowledges Department of Science and Technology Women Scientist scheme (SR/WOS-A/LS-377/2018) for financial support. SD acknowledges Indian National Science Academy for her senior scientist fellowship.

9 Improving Biotic and Abiotic Stress Tolerance …

233

References Abdallah NA, Prakash CS, McHughen AG (2016) Genome editing for crop improvement: challenges and opportunities. GM Crops Food 6(4):183–205 Abdul-Razzak A, Guiraud T, Peypelut M et al (2009) Involvement of the cylindrical inclusion (CI) protein in the overcoming of an eIF4E-mediated resistance against Lettuce mosaic potyvirus. Mol Plant Pathol 10:109–113. https://doi.org/10.1111/j.1364-3703.2008.00513.x Abudayyeh OO, Gootenberg JS, Essletzbichler P et al (2017) RNA targeting with CRISPR-Cas13. Nature 550(7675):280–284 Acevedo-Garcia J, Kusch S, Panstruga R (2014) Magical mystery tour: MLO proteins in plant immunity and beyond. New Phytol 204:273–281 Ali Z, Abulfaraj A, Idris A et al (2015) CRISPR/Cas9-mediated viral interference in plants. Genome Biol 16:238. https://doi.org/10.1186/s13059-015-0799-6 Ali Z, Ali S, Tashkandi M et al (2016) CRISPR/Cas9-mediated immunity to geminiviruses: differential interference and evasion. Sci Rep 6:26912. https://doi.org/10.1038/srep26912 Aman R, Ali Z, Butt H et al (2018) RNA virus interference via CRISPR/Cas13a system in plants. Genome Biol 19(1):1. https://doi.org/10.1186/s13059-017-1381-1 Baltes NJ, Hummel AW, Konecna E et al (2015) Conferring resistance to geminiviruses with the CRISPR–Cas prokaryotic immune system. Nat Plants 1:15145. https://doi.org/10.1038/nplants. 2015.145 Bhar A, Chatterjee M, Gupta S et al (2018) Salicylic acid regulates systemic defense signaling in chickpea during Fusarium oxysporum f. sp. ciceri Race 1 infection. Plant Mol Biol Rep 36(2):162–175 Bi HL, Xu J, Tan AJ et al (2016) CRISPR/Cas9 mediated targeted gene mutagenesis in Spodoptera litura. Insect Sci 23:469–477 Borejsza-Wysocka EE, Malnoy M, Aldwinckle HS et al (2006) The fire blight resistance of apple clones in which DspE-interacting proteins are silenced. Acta Hortic 704:509–514. https://doi. org/10.17660/ActaHortic.2006.704.80 Borrelli VMG, Brambilla V, Rogowsky P et al (2018) The enhancement of plant disease resistance using CRISPR/Cas9 technology. Front Plant Sci 9:1245. https://doi.org/10.3389/fpls.2018.01245 Chandrasekaran J, Brumin M, Wolf D et al (2016) Development of broad virus resistance in nontransgenic cucumber using CRISPR/Cas9 technology. Mol Plant Pathol 17:1140–1153. https:// doi.org/10.1111/mpp.12375 Chauhan BS, Mahajan G, Randhawa RK et al (2014) Global warming and its possible impact on agriculture in India. Adv Agron 123:65–121 Curtin SJ, Xiong Y, Michno JM et al (2018) Crispr/Cas9 and Talens generate heritable mutations for genes involved in small rna processing of Glycine max and Medicago truncatula. Plant Biotechnol J 16(6):1125–1137 Das A, Sharma N, Prasad M (2019) Cas9: a novel weapon in the arsenal to combat plant diseases. Front Plant Sci https://doi.org/10.3389/fpls.2018.02008 de Toledo TD, Brail Q, Dahlbeck D et al (2016) CRISPR-Cas9 mediated mutagenesis of a DMR6 ortholog in tomato confers broad-spectrum disease resistance. BioRxiv https://doi.org/10.1101/ 064824 Debbarma J, Sarki YN, Saikia B et al (2019) Ethylene response factor (ERF) family proteins in abiotic stresses and CRISPR–Cas9 genome editing of ERFs for multiple abiotic stress tolerance in crop plants: a review. Mol Biotechnol 61(2):153–172 Doman JL, Raguram A, Newby GA et al (2020) Evaluation and minimization of Cas9-independent off-target DNA editing by cytosine base editors. Nat Biotechnol. https://doi.org/10.1038/s41587020-0414-6. Duan YB, Li J, Qin RY et al (2016) Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis. Plant Mol Biol 90(1– 2):49–62

234

A. Jain et al.

Endo A, Masafumi M, Kaya H et al (2016) Efficient targeted mutagenesis of rice and tobacco genomes using Cpf1 from Francisella novicida. Sci Rep 6:38169 Farhat S, Jain N, Singh N et al (2019) CRISPR-Cas9 directed genome engineering for enhancing salt stress tolerance in rice. Semin Cell Dev Biol Academic Press. https://doi.org/10.1016/j.sem cdb.2019.05.003 Gao R, Feyissa BA, Croft M et al (2018) Gene editing by CRISPR/Cas9 in the obligatory outcrossing Medicago sativa. Planta 247(4):1043–1050 Gomez MA, Lin ZD, Moll T et al (2017) Simultaneous CRISPR/Cas9-mediated editing of cassava elF4E isoforms nCBP-1 and nCBP-2 confers elevated resistance to cassava brown streak disease. BioRxiv 209874. https://doi.org/10.1101/209874 Green JC, Hu SJ (2017) Editing plants for virus resistance using CRISPR-Cas. Acta Virol 61:138– 142. https://doi.org/10.4149/av_2017_02_02 Gumtow R, Wu D, Uchida J et al (2018) A Phytophthora palmivora extracellular cystatin-like protease inhibitor targets papain to contribute to virulence on papaya. Mol Plant Microbe Interact 31:363–373. https://doi.org/10.1094/MPMI-06-17-0131-FI Haque E, Taniguchi H, Hassan MM et al (2018) Application of CRISPR/Cas9 genome editing technology for the improvement of crops cultivated in tropical climates: recent progress, prospects, and challenges. Front Plant Sci 9:617. https://doi.org/10.3389/fpls.2018.00617 Hillmann K (2019) Looking for maize genes involved in cold response: producing knockouts for Arabidopsis homologs of maize candidate genes using a CRISPR/Cas9 approach. Departmental Honors Projects. 82. https://digitalcommons.hamline.edu/dhp/82 Hirano H, Gootenberg JS, Horii T et al (2016) Structure and engineering of Francisella novicida Cas9. Cell 164:950–961 Hsu PD, Lander ES, Zhang F (2015) Development and applications of CRISPR-Cas9 for genome engineering Cell. 157(6):1262–1278. https://doi.org/10.1016/j.cell.2014.05.010 Huang Y, Guo Y, Liu Y et al (2018) 9-cis-Epoxycarotenoid dioxygenase 3 regulates plant growth and enhances multi-abiotic stress tolerance in rice. Front Plant Sci 9:162 Ji X, Zhang H, Zhang Y et al (2015) Establishing a CRISPR-Cas-like immune system conferring DNA virus resistance in plants. Nat Plants 1:15144. https://doi.org/10.1038/nplants.2015.144 Ji J, Zhang C, Sun Z, Wang L et al (2019) Genome editing in cowpea Vigna unguiculata using CRISPR-Cas9. Int J Mol Sci 20(10):2471 Jia Y, Ding Y, Shi Y et al (2016a) The cbfs triple mutants reveal the essential functions of CBFs in cold acclimation and allow the definition of CBF regulons in Arabidopsis. New Phytol 212(2):345–353 Jia H, Orbovic V, Jones JB et al (2016b) Modification of the PthA4 effector binding elements in Type I CsLOB1 promoter using Cas9/sgRNA to produce transgenic Duncan grapefruit alleviating Xcc1pthA4:dCsLOB1.3 infection. Plant Biotechnol J 14:1291–1301. https://doi.org/10.1111/pbi. 12495 Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821 Khan SA, Li MZ, Wang SM et al (2018) Revisiting the role of plant transcription factors in the battle against abiotic stress. Int J Mol Sci 19(6):1634 Khatodia S, Bhatotia K, Passricha N et al (2016) The CRISPR/Cas genome-editing tool: application in improvement of crops. Front Plant Sci 7:506. https://doi.org/10.3389/fpls.2016.00506 Kim D, Alptekin B, Budak H (2018) CRISPR/Cas9 genome editing in wheat. Funct Integr Genomic 18(1):31–41 Koonin EV, Makarova KS, Zhang F (2017) Diversity, classification and evolution of CRISPR-Cas systems. Curr Opin Microbiol 37:67–78. https://doi.org/10.1016/j.mib.2017.05.008 Langner T, Kamoun S, Belhaj K (2018) CRISPR Crops: plant genome editing toward disease resistance. Annu Rev Phytopathol 56:479–512. https://doi.org/10.1146/annurev-phyto-080417050158 LeBlanc C, Zhang F, Mendez J et al (2018) Increased efficiency of targeted mutagenesis by CRISPR/Cas9 in plants using heat stress. Plant J 93(2):377–386

9 Improving Biotic and Abiotic Stress Tolerance …

235

Lei G, Shen M, Li ZG et al (2011) EIN2 regulates salt stress response and interacts with a MA3 domain-containing protein ECIP1 in Arabidopsis. Plant Cell Environ 34(10):1678–1692 Li XW, Wang Y, Yan F et al (2016) Overexpression of soybean R2R3-MYB transcription factor, GmMYB12B2, and tolerance to UV radiation and salt stress in transgenic Arabidopsis. Genet Mol Res 15(10):4238 Li P, Li YJ, Zhang FJ et al (2017) The Arabidopsis UDP-glycosyltransferases UGT79B2 and UGT79B3, contribute to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. Plant J 89(1):85–103 Li R, Zhang L, Wang L et al (2018) Reduction of tomato-plant chilling tolerance by CRISPR–Cas9mediated SlCBF1 mutagenesis. J Agri Food Chem 66(34):9042–9051 Li R, Liu C, Zhao R et al (2019a) CRISPR/Cas9-Mediated SlNPR1 mutagenesis reduces tomato plant drought tolerance. BMC Plant Biol 19(1):38 Li J, Han G, Sun C et al (2019b) Research advances of MYB transcription factors in plant stress resistance and breeding. Plant Signal Behav 14(8):1613131 Liu D, Chen X, Liu J et al (2012) The rice ERF transcription factor OsERF922 negatively regulates resistance to Magnaporthe oryzae and salt tolerance. J Exp Bot 63(10):3899–3911. https://doi. org/10.1093/jxb/ers079 Liu X, Zhou X, Li K et al (2020) A simple and efficient cloning system for CRISPR/Cas9-mediated genome editing in rice. Peer J 8:e8491. https://doi.org/10.7717/peerj.8491 Lou D, Wang H, Liang G et al (2017) OsSAPK2 confers abscisic acid sensitivity and tolerance to drought stress in rice. Front Plant Sci 8:993 Lou D, Wang H, Yu D (2018) The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice. BMC Plant Biol 18(1):203 Macovei A, Sevilla NR, Cantos C et al (2018) Novel alleles of rice eIF4G generated by CRISPR/Cas9-targeted mutagenesis confer resistance to Rice tungro spherical virus. Plant Biotechnol J 16:1918–1927. https://doi.org/10.1111/pbi.12927 Makarova KS, Wolf YI, Alkhnbashi OS et al (2015) An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol 13:722–736 Makarova KS, Wolf YI, Koonin EV et al (2020) Classification and Nomenclature of CRISPR-Cas Systems: Where from Here? The CRISPR. 1(5). https://doi.org/10.1089/crispr.2018.0033 Malnoy M, Viola R, Jung MH (2016) DNA free genetically edited grapevine and apple protoplast using CRISPR/Cas9 ribonucleoproteins. Front Plant Sci 7:1904. https://doi.org/10.3389/ fpls.2016.01904 Muysson J, Miller L, Allie R et al (2019) The Use of CRISPR-Cas9 genome editing to determine the importance of glycerol uptake in wine yeast during icewine fermentation. Fermentation 5(4):93 Nandy S, Pathak B, Zhao S et al (2019) Heat-shock-inducible CRISPR/Cas9 system generates heritable mutations in rice. Plant Direct 3(5):e00145 National Academies of Sciences, Engineering, and Medicine; Division on Earth and Life Studies; Board on Agriculture and Natural Resources; Committee on Genetically Engineered Crops: Past Experience and Future Prospects. Genetically Engineered Crops: Experiences and Prospects. Washington (DC): National Academies Press (US); (2016) Committee on genetically engineered crops: past experience and future prospects. Available from: https://www.ncbi.nlm.nih.gov/books/ NBK424541/ Nawaz G, Han Y, Usman B et al (2019) Knockout of OsPRP1, a gene encoding proline-rich protein, confers enhanced cold sensitivity in rice (Oryza sativa L.) at the seedling stage. 3 Biotech 9(7):254 Nekrasov V, Wang C, Win J et al (2017) Rapid generation of a transgene-free powdery mildew resistant tomato by genome deletion. Sci Rep 7:482. https://doi.org/10.1038/s41598-017-005 78-x Nelson R, Wiesner-Hanks T, Wisser R et al (2018) Navigating complexity to breed disease-resistant crops. Nat Rev Genet 19:21–33. https://doi.org/10.1038/nrg.2017.82 Nguyen TH, Mai HTT, Moukouanga D et al (2020) A. CRISPR/Cas9-mediated Gene editing of the Jasmonate biosynthesis OsAOC gene in rice. Methods Mol Biol 2085:199–209

236

A. Jain et al.

Njuguna E, Coussens G, Aesaert S et al (2017) Modulation of energy homeostasis in maize and Arabidopsis to develop lines tolerant to drought, genotoxic and oxidative stresses. Afrika Focus 30(2). https://doi.org/10.21825/af.v30i2.8080 Ortigosa A, Gimenez-Ibanez S, Leonhardt N et al (2019) Design of a bacterial speck resistant tomato by CRISPR/Cas9-mediated editing ofSlJAZ2. Plant Biotechnol J 17:665–673 Paixão JFR, Gillet FX, Ribeiro TP et al (2019) Improved drought stress tolerance in Arabidopsis by CRISPR/dCas9 fusion with a Histone AcetylTransferase. Sci Rep 9(1):1–9 Parmar N, Singh KH, Sharma D et al (2017) Genetic engineering strategies for biotic and abiotic stress tolerance and quality enhancement in horticultural crops: a comprehensive review. 3 Biotech 7(4):239. https://doi.org/10.1007/s13205-017-0870-y Parray JA, Mir MY, Shameem N (2019) Plant biotechnology: tool for sustainable agriculture. Sustainable agriculture: biotechniques in plant biology. Springer, Singapore, pp 1–50 Peng A, Chen S, Lei T et al (2017) Engineering canker resistant plants through CRISPR/Cas9targeted editing of the susceptibility gene CsLOB1 promoter in citrus. Plant Biotechnol J 15:1509– 1519. https://doi.org/10.1111/pbi.12733 Popoola J, Ojuederie O, Omonhinmin C et al (2019) Neglected and underutilized legume crops: improvement and future prospects. In: Recent advances in grain crops research. IntechOpen. https://doi.org/10.5771/intechopen.87069 Prihatna C, Barbetti MJ, Barker SJ (2018) A novel tomato Fusarium Wilt tolerance gene. Front Microbiol 9:1226 Puchta H, Hohn B (2010) Breaking news: Plants mutate right on target. Proc Natl Acad Sci 107(26):11657–11658. https://doi.org/10.1073/pnas.1006364107 Qiu Z, Kang S, He L et al (2018) The newly identified heat-stress sensitive albino 1 gene affects chloroplast development in rice. Plant Sci 267:168–179 Rhun AL, Escalera-Maurer A, Bratoviˇc M et al (2019) CRISPR-Cas in Streptococcus pyogenes. RNA Biol 16(4):380–389 Sadanandom A, Ádám É, Orosa B et al (2015) SUMOylation of phytochrome-B negatively regulates light-induced signaling in Arabidopsis thaliana. Proc Natl Acad Sci USA 112(35):11108–11113 Shen C, Que Z, Xia Y et al (2017) Knock out of the annexin gene OsAnn3 via CRISPR/Cas9mediated genome editing decreased cold tolerance in rice. J Plant Biol 60(6):539–547 Shi J, Gao H, Wang H et al (2017) ARGOS 8 variants generated by CRISPR-Cas9 improve maize grain yield under field drought stress conditions. Plant Biotechnol J 15(2):207–216 Su LT, Li JW, Liu DQ et al (2014) A novel MYB transcription factor, GmMYBJ1, from soybean confers drought and cold tolerance in Arabidopsis thaliana. Gene 538(1):46–55 Tashkandi M, Ali Z, Aljedaani F et al (2018) Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato. Plant Signal Behav 13:e1525996 Tripathi JN, Ntui VO, Ron M et al (2019) CRISPR/Cas9 editing of endogenous banana streak virus in the B genome of Musa spp overcomes a major challenge in banana breeding. Commun Biol 2:46 Ueda M, Matsui A, Tanaka M et al (2017) The distinct roles of class I and II RPD3-like histone deacetylases in salinity stress response. Plant Physiol 175(4):1760–1773 Vu TV, Sung YW, Kim J et al (2019) Challenges and perspectives in homology-directed gene targeting in monocot plants. Rice 12:95 Wang Y, Cheng X, Shan Q et al (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol 32:947–951. https:// doi.org/10.1038/nbt.2969 Wang F, Wang C, Liu P et al (2016) Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PLoS ONE 11(4):e0154027. https:// doi.org/10.1371/journal.pone.0154027 Wang J, Wang H, Liu S et al (2017a) CRISPR/Cas9 mediated genome editing of Helicoverpa armigera with mutations of an ABC transporter gene HaABCA2 confers resistance to Bacillus thuringiensis Cry2A toxins. Insects Biochem Mol Biol 87:147–153

9 Improving Biotic and Abiotic Stress Tolerance …

237

Wang L, Chen L, Li R et al (2017b) Reduced drought tolerance by CRISPR/Cas9-mediated SlMAPK3 mutagenesis in tomato plants. J Agri Food Chem 65(39):8674–8682 Wang L, Wang L, Zhou Y et al (2017c) Use of CRISPR/Cas9 for symbiotic nitrogen fixation research in legumes. Prog Mol Biol Transl Sci 149:187–213 Wang Z, Hardcastle TJ, Canto Pastor A et al (2018a) A novel DCL2-dependent miRNA pathway in tomato affects susceptibility to RNA viruses. Gene Dev 32:1155–1160 Wang T, Deng Z, Zhang X et al (2018b) Tomato DCL2b is required for the biosynthesis of 22-nt small RNAs, the resulting secondary siRNAs, and the host defense against ToMV. Hortic Res 5:62 Wang X, Tu M, Wang D et al (2018c) CRISPR/Cas9-mediated efficient targeted mutagenesis in grape in the first generation. Plant Biotechnol J 16:844–855 Wu L, Wu J, Liu Y et al (2016) The rice pentatricopeptide repeat gene TCD10 is needed for chloroplast development under cold stress. Rice 9(1):1–13 Yamamoto T, Kashojiya S, Kamimura S et al (2018) Application and development of genome editing technologies to the Solanaceae plants. Plant Physiol Biochem 131:37–46 Zeng Y, Wen J, Zhao W et al (2020) Rational improvement of rice yield and cold tolerance by editing the three genes OsPIN5b, GS3 and OsMYB30 with the CRISPR-Cas9 system. Front Plant Sci 10:1663 Zhang S, Wang L, Zhao R et al (2018) Knockout of SlMAPK3 reduced disease resistance to Botrytis cinerea in tomato plants. J Agric Food Chem 66:8949–8956 Zhang A, Liu Y, Wang F et al (2019a) Enhanced rice salinity tolerance via CRISPR/Cas9-targeted mutagenesis of the OsRR22 gene. Mol Breed 39(3):47 Zhang C, Srivastava AK, Sadanandom A (2019b) Targeted mutagenesis of the SUMO protease, Overly Tolerant to Salt1 in rice through CRISPR/Cas9-mediated genome editing reveals a major role of this SUMO protease in salt tolerance. BioRxiv 555706. https://doi.org/10.1101/555706 Zhou J, Peng Z, Long J et al (2015) Gene targeting by the TAL effector PthXo2 reveals cryptic resistance gene for bacterial blight of rice. Plant J 82:632–643. https://doi.org/10.1111/tpj.12838 Zhou J, Deng K, Cheng Y et al (2017) CRISPR-Cas9 based genome editing reveals new insights into microRNA function and regulation in rice. Front Plant Sci 8:1598

Chapter 10

RNA Interference (RNAi) in Functional Genomics of Wheat Priyabrata Sen, Charu Lata, Kanti Kiran, and Tapan Kumar Mondal

Abstract Post-genomic era of biology is faced with a major challenge in deciphering the gene function out of enormous amount of data generated by NGS technology, in addition to large number of EST sequences, available in the public domain. Among many approaches, one important approach is to knock out the gene and analysis of the visible effect of loss of gene function. RNA interference (RNAi), as a reverse genetic approach currently in use for studies of gene function, holds a great promise in this context. The efficacy of RNAi as tool for functional genomics study has already been successfully demonstrated in Caenorhabditis elegans. With the availability of comprehensive resources of genomic sequence data and knowledge of the biological mechanism of RNAi, use of RNAi in functional genomics is quickly gaining space and popularity. Results from the study of transgene-induced RNAi suggests many variables that should be considered while designing experiment to decipher gene function. Keywords RNA interference · Functional genomics · Gene silencing · Triticum aestivum · siRNA

P. Sen (B) Department of Agricultural Biotechnology, Assam Agricultural University, Jorhat 785013, India e-mail: [email protected] C. Lata National Institute of Science Communication and Information Resources, New Delhi 110012, India e-mail: [email protected] K. Kiran · T. K. Mondal ICAR-National Institute for Plant Biotechnology, LBS building, Pusa Campus, New Delhi 110012, India e-mail: [email protected] T. K. Mondal e-mail: [email protected] © Springer Nature Switzerland AG 2021 B. K. Sarmah and B. K. Borah (eds.), Genome Engineering for Crop Improvement, Concepts and Strategies in Plant Sciences, https://doi.org/10.1007/978-3-030-63372-1_10

239

240

P. Sen et al.

10.1 Introduction Gene regulation mediated by RNA interference (RNAi) is a well-established phenomenon by now. The phenomenon mediated by small interfering RNAs (siRNAs) initially discovered as a natural antiviral defence in plants, fungi, and invertebrates now become a promising tool to regulate gene expression. In addition to antiviral defence, other diversified role, viz. regulation of gene expression and the condensation of chromatin into heterochromatin, has also been established. RNAi machinery can be harnessed to shut off the cognate mRNA by introducing exogenous small interfering RNAs (siRNAs). Understanding the molecular processes of RNAi lead to the development of artificial RNA silencing technology using hairpin RNA, artificial micro-RNA, etc. These RNA silencing technologies have already been widely used for genetic improvement of crop plants and greatly diversified in plants to cope with different functional requirements. Abundance and diversity of plant miRNAs, make it most potent mediator of most of the biological processes in plants, if not all. Extensive studies of plant miRNA hold great promise in deciphering their role in gene regulation. RNAi becomes most widely utilized tool for reverse genetics approach and functional genomics. Initial RNAi approach in plants was to confer resistance against viral disease. Later on, this technology was also utilized to confer resistance against fungi, bacteria, nematode and insect pest. Since initial discovery, experiments in model systems contributed to rapid advancements in our understanding of the underlying mechanisms of RNA-induced gene silencing processes. Multiple pathways and the mediators through which RNAi can exert its effect in gene regulation have also been deciphered. Thus, soon the transgene-induced RNAi becomes an efficient tool to generate knock out lines to decipher the gene function. Since then, transgene-induced gene silencing by RNAi has been extensively used across plant kingdom.

10.2 Mechanism of RNAi Silencing RNAi is a potential tool for regulation of the gene function by knocking down the gene action. RNAi is a naturally occurring phenomenon found exclusively in eukaryotes. The key component of RNAi machinery is the dsRNA that leads to the inactivation of target mRNA and prevents protein synthesis. RNAi is conserved and ubiquitous pathway of gene silencing in both transcriptional and post-transcriptional stages. Double-stranded RNA (dsRNA) or hairpin-structured RNA (hpRNA) together with Dicer or Dicer-like (DCL) and Argonaute (AGO) family involves in RNAi machinery. There are two types of RNAi-mediated gene silencing phenomena are identified: transcriptional gene silencing (TGS) that downregulates the transcription due to promoter methylation (Cogoni and Macino 1999; Wassenegger et al. 1994) and posttranscriptional gene silencing (PTGS) that involves sequence-specific RNA degradation (Fire 1999). In PTGS RNA silencing pathway, Dicer or DCL protein processed

10 RNA Interference (RNAi) in Functional Genomics of Wheat

241

dsRNA or hpRNA into 20–24 nucleotide (nt) small RNA (sRNA) duplex with 2-nt 3 overhangs at both ends. The incorporation of one strand of the sRNA duplex into Argonaute protein results in formation of RNA-induced silencing complex (RISC). Under the guidance of sRNA molecule, the RISC binds to the complementary region of targeted mRNA, and the AGO protein then cleave the target mRNA. In TGS pathway, siRNAs incorporates into the RNAi-induced transcriptional silencing (RITS) complex involves in DNA methylation and transcriptional silencing.

10.2.1 Mechanism of PTGS The PTGS of RNAi mechanism is a two-phase process, such as initiation and execution. The first phase involves the biosynthesis of dsRNA components (si-RNA or miRNA), and the second phase executes the silencing of target mRNA by degradation or translation inhibition.

10.2.1.1

Initiation

The RNAi-mediated gene silencing pathway can be activated by both exogenous and endogenous short dsRNA molecules in the cytoplasm. Primary siRNA or prisiRNA, the precursor of siRNAs, is cleaved with the enzyme Dicer to form si-RNA with 2–3-nt 3 overhang (Zamore et al. 2000). In case of miRNA, Drosha and Pasha involve in generation of pre-miRNA from pri-miRNA by trimming the end of stemloop structure inside the nucleus. The pre-miRNA is transported to the cytoplasm by Ran-GTP-mediated exportin-5 nuclear transporter. In cytoplasm, it is cleaved by Dicer to form miRNA. Processing of exogenous RNAs (si-RNA) is cytoplasmic and endogenous RNA is nuclear as well as cytoplasmic. In nucleus, the primary miRNA (pri-miRNA) is transcribed from miRNA gene, and such transcripts are ≈1000-nt long with multiple hairpin loop (Saini et al. 2007). The endonucleolytic cleavage of pri-miRNA by Drosha, an RNase III family enzyme, results in formation of ≈65- to 70-nt precursor miRNA (pre-miRNA) (Han et al. 2009), which is transported to cytoplasm with the help of Exportin-5 and RanGTP (Lund et al. 2004). In the cytoplasm, the processing pathways converge for endogenous miRNAs and for typically exogenous siRNAs. Both types of RNAi precursors are trimmed down by Dicer to a dsRNA duplex of ≈20–24-nt with 2-nt 3 overhang (Schwarz et al. 2003). One strand of the dsRNA is loaded onto an Argonaute protein for the formation of RISC complex.

242

10.2.1.2

P. Sen et al.

Execution

After the biosynthesis of dsRNA, the second stage of RNAi machinery begins. One strand of the siRNA (the guide strand) is loaded onto an Argonaute protein in the RNA-induced silencing complex (RISC). The RISC-loading complex is a ternary complex consisting of an Argonaute protein, Dicer and a dsRNA-binding protein (known as TRBP in humans). During loading, the non-guide (passenger) strand of dsRNA is cleaved by an Argonaute protein and the guide strand of siRNA that contain complementary sequence with the target RNA is loaded into the RISC complex for chopping of target mRNA. Dicer cleaves the pre-miRNA by forming a double-stranded miRNA with one guide strand, and another one is passenger strand. In this case, the guide strand is loaded onto an AGO protein to form RITS complex (Hammond 2005). Here, the guide strand is partially complementary to sequences of target RNA. Due to lack of complementation, it leads to suppress the translation of target mRNA by removal of mRNA poly(A) tails (deadenylation), which leads to mRNA degradation.

10.2.2 Mechanism of TGS RNAi-mediated gene silencing can trigger transcriptional gene silencing. It is the result of histone modification that creates heterochromatin environment around the gene to make it inaccessible to transcriptional machinery. The posttranslational modification of histone tails (e.g. methylation of lysine 9 of histone H3) makes the genomic region vulnerable for heterochromatin formation. Recent evidence suggests that siRNAs can regulate gene function by transcriptional gene silencing in the genomes of certain species. In this case after cutting with Dicer guide strand of siRNA is loaded onto RNAi-induced transcriptional silencing complex (RITS). RITS complex consists of RNase H-like argonaute that binds siRNA, a chromodomain protein Chp1 that binds with the methylated lycin residue of histon H3 and an Argonaute-interacting protein Tas3 which can also bind to Chp1. The RITS complex binds with target chromatin and downregulates the transcriptional procedure by DNA methylation of heterochromatic sites (Verdel et al. 2009). RITS was discovered in the fission yeast Schizosaccharomyces pombe that plays a critical role in formation and maintenance of higher-order chromatin structure and function.

10.3 RNAi Pathways and Vector The RNA silencing pathway is diversified in species to species to meet up different functional needs. Various members of AGO, DCL, RDR and dsRBP protein families play the key role in executing different types of RNAi-mediated gene silencing machinery. There are four types of RNAi pathways which are observed in different

10 RNA Interference (RNAi) in Functional Genomics of Wheat

243

organisms: miRNA pathway, siRNA pathway, tasiRNA pathway and tasiRNA pathway.

10.3.1 The miRNA Pathway miRNAs are endogenous sRNAs by origin. Primary miRNA (pri-miRNA) is transcribed from MIR genes by RNA polymerase II in nucleus. The pri-miRNA is having an imperfect “fold-back” stem-loop structure due to the presence of intramolecular sequence complementarity. In general, the pri-miRNA is cleaved with the enzymes Drosha and Pasha to form premature miRNA (pre-miRNA), which is transported from nucleus to cytoplasm with the help of exportin 5. In cytoplasm, the pre-miRNA (≈70 nt) is recognised by Dicer which trims the hairpin loop of premiRNA and produce mature miRNA duplex (miRNA:guide strand and miRNA*: passenger strand). But, there are some exceptions like in case of Arabidopsis the formation of pre-miRNA from pri-miRNA is facilitated by DCL1 in nucleus (Lu and Fedoroff 2000) and the formation of mature miRNA duplex is formed by the combine action of DCL1and HYL1 (Vazquez et al. 2004). The 3 terminal nucleotides of the mature miRNA duplex are methylated by the RNA methylase HUA ENHANCER1 (HEN1) to avoid degradation (Eamens et al. 2009). In the cytoplasm, the guide strand of miRNA is loaded onto AGO1 to form RISC complex that binds with the target mRNA for post-transcriptional gene silencing. In plants, the miRNA gene silencing ends up with mRNA cleavage but in animals it has been reported that miRNA causes translational repression (Mallory and Vaucheret 2010).

10.3.2 The siRNA Pathway For the study of functional genomics, dsRNA molecules are used to induce RNAi machinery to silence the gene action. siRNAs are exogenous by origin. Generally, the precursor of siRNA is long dsRNA which is cut with the Dicer enzyme in the cytoplasm for the formation of mature siRNA of 21-24nt size with 2nt 3 overhang in both the sides and 5 phosphate group. The modification of siRNA is cytoplasmic. The duplex siRNA is having one guide strand and one passenger strand. The guide strand is having perfect sequence complementary with the target mRNA sequence and is loaded onto Argonaute protein to form RISC complex (Schwarz et al. 2003). The RISC complex then binds with the target mRNA sequence and cleaves the mRNA to inhibit translation and silence the gene action.

244

P. Sen et al.

10.3.3 The Transacting siRNA Pathway tasiRNAs are noncoding transcripts transcribed from TAS gene by RNA polymerase II in nucleus (Millar and Waterhouse 2005). 22-nt miRNAs are found to initiate the biogenesis of tasiRNAs. The miRNA facilitates the cleavage of TAS precursor RNA to form dsRNA by RDR6. After that dsRNA is processed by DCL4 into 21nt siRNAs (Hiraguri et al. 2005). For stability, tasiRNAs are methylated by HEN1 (Li et al. 2005). The tasiRNAs interacts with AGO1 or AGO7 proteins. In case of Arabidopsis, miR173 and miR390 are found to trigger tasiRNA synthesis that regulates the auxin response in phase transition from juvenile to reproductive stages (Axtell et al. 2007). phasiRNA (tasiRNA-like siRNAs) has been identified in several plant species. phasiRNAs and tasiRNAs share similarity in their size, and biogenesis procedure. phasiRNAs are reported to be involved in stress-responsive expression pattern of plant defence genes (Zhai et al. 2011).

10.3.4 The rasiRNA Pathway Repeat-associated siRNA pathway is also known as RNA-dependent DNA methylation pathway that involves RNAi machinery for translational gene silencing. Methylated and highly repetitive DNA is transcribed by RNA polymerase IV, and the transcript is converted into dsRNA by RDR2. After that the dsRNA is modified by DCL3 into 24 rasiRNAs. The 3 -OH group of terminal nucleotide of this siRNA is also methylated by HEN1 (Li et al. 2005). The guide strand of siRNA is loaded onto AGO4 to form RISC complex, and it binds with the target DNA. The rasi RNA silence the target repetitive DNA by DNA methylation (Chan et al. 2005). The DNA methylation is facilitated by the combine action of SNF2-like chromatin remodelling protein, defective in RNA-directed DNA methylation1 (DRD1) and domains rearranged methylase2 (DRM2; Cao et al. 2003).

10.4 RNAi Vectors RNAi vectors are introduced in organisms not only for functional genomics studies but also confer resistance against harmful microbes. RNAi can be induced in mammalian cells by direct introduction of dsRNAs. But for plant cells, transformation with RNAi vector that contains the RNAi construct is essential. The plant RNAi vector contains inverted repeats bearing target sequence which are separated by a spacer fragment. Construction of RNAi vector is a tedious process as the sense and antisense strand have to be subcloned into a binary vector. pHANNIBAL (Wesley et al. 2001), pKANNIBAL (Helliwell and Waterhouse 2005), pSAT (Yelin et al. 2007) and pSH (Hirai et al. 2007) are the conventional RNAi vectors where the

10 RNA Interference (RNAi) in Functional Genomics of Wheat

245

PCR products of the target gene are produced by using primers with restriction sites and cloned in both upstream and downstream of spacer arm to form hairpin construct. High-throughput plant RNAi vectors facilitate single-step construction of RNAi vector. Through gateway recombination technology (Earley et al. 2006), inverted repeats are assembled in case of pHELLSGATE (Helliwell et al. 2003) and pANDA vectors. Here at first the target, gene is amplified with primers flanking attB1 and attB2 sites, and then, PCR products are recombined into two cloning sites with attP1 and attP2 sequences by BP clonase. The single-step vector construction method is easy, but the efficiency of silencing is low (Karimi et al. 2007), and for these reasons, two-step recombination procedure that leaves short sequences on the RNAi vector has been developed for efficient silencing (Helliwell et al. 2002). The introduction of RNAi machinery sometimes can be lethal for the organism if it interferes with the essential gene action. Inducible RNAi vectors have been developed for transient and local silencing. In case of ethanol-inducible RNAi system, the hpRNA expression is dependent on alcA promoter. RNAi vector with an oestradiol inducible Cre recombinase induces hpRNA expression in response of application of oestradiol. The modified pHELLSGATE vector, under the control of the pOp6 promoter is used as inducible RNAi vector (Wielopolska et al. 2005). The new RNAi vector artificial microRNAs (amiRNAs) has structural similarity with miRNA (Schwab et al. 2006). In case of amiRNA duplex, miRNA sequences is the inserted target sequence and miRNA* is the complementary sequence (Schwab et al. 2006) designed for developing silencing mechanism. WMD (Web MicroRNA Designer) provides a platform for designing amiRNAs (Niu et al. 2006). In tobacco, the amiRNA developed against 2b gene of CMV confers resistance against CMV infection (Qu et al. 2007).

10.5 Dicer: Role in RNAi Dicer-like (DCL) RNase type III enzymes are most important for RNAi-mediated gene silencing by siRNA and miRNA. Dicer modifies dsRNAs in the cytoplasm so that guide strand of dsRNA can be loaded onto RISC or RITS complex. It helps in ATP-dependent siRNA generation. Dicer is a large (~220-kDa) multi-domain protein that includes an N-terminal putative DExH/DEAH box RNA helicase/ATPase domain, PAZ domain, Tandem RNAse-III domains, dsRNA-binding domain. The core of Dicer is comprised of an RNase III domain with a C-terminal dsRBD (Shabalina and Koonin 2008). Class III Dicer enzymes cleave dsRNA by using a pseudo-dimer of RNase III domain (MacRae and Doudna 2007). The PAZ domain of this enzyme recognizes the end of dsRNA (Ma et al. 2004). The PAZ together with RNase III domain acts as a molecular ruler for proper processing of dsRNA required for the silencing machinery. The superfamily 2 helicase domain of Dicer (≥600-aa) that belongs to the eukaryotic RIG-I family of helicases is mostly found at its N terminus (Zou et al. 2009). In case of Drosophila, the helicase domain recognises miRNA or siRNA precursors. In

246

P. Sen et al.

humans, the Dicer’s helicase domain contains TRBP, a binding site for a dsRBP. Other than its dicing function, the domain structure of Dicer may vary between different species. The absence of helicase domain and PAZ domain was found in Giardia intestinalis (MacRae and Doudna 2007) and Kluyveromyces polysporus, respectively. Drosophila is having a pair of Dicer enzymes to develop parallel processing pathways for siRNAs and miRNAs (Cenik et al. 2011). In case of Arabidopsis thaliana, it involves DCL1 for generation of 21-nt miRNAs and DCL2,3,4 for processing of siRNAs of 22, 24 or 21 nt, respectively (Qin et al. 2010). The function of helicase domain of Dicer is found in case of Drosophila, where Dicer-2 and Dicer-1 modifies siRNA precursors and pre-miRNA hairpins, respectively (Cenik et al. 2011). The helicase domain of Dicer-2 translocates the enzyme through active transportation along with dsRNA for generation of multiple siRNA duplexes from a single precursor helix (Cenik et al. 2011). Moreover, this helicase domain promotes the processing of those dsRNA substrates that are lacking of 2-nt 3 terminal overhang (Welker et al. 2011). The Dicer-1 helicase domain is unable to translocate along with dsRNA due to the absence of DExH/D lobe. The domain recognises the hairpin loop of pre-miRNA hairpins (Tsutsumi et al. 2011). In Drosophila, the parallel processing pathways for siRNA and miRNA are observed. But in humans, a single Dicer is implicated for the medication both precursors. The reorientation of the RNase III nuclease core with respect to the PAZ domain makes it accessible for the modification of both siRNA and miRNA. In case of pre-miRNAs, the PAZ domain recognizes the 2-nt overhang and the helicase recognizes the hairpin’s loop for modifying it to mature miRNA. For siRNA, the helicase domain puts the precursor helix towards the catalytic centre to generate multiple siRNAs. Drosophila Dicer-2 and human Dicer share archaeological similarity (Lau et al. 2012). The key function of Dicer is to recognize and trim the dsRNA precursors to generate dsRNAs of a specific length (≈21–25 nt) (Bernstein et al. 2001). The active site of Dicer that binds with the RNA helix contains four acidic residues that involve in phosphodiester hydrolysis of each RNA strand in presence of Mg++ ion. The end of precursor dsRNA (a 2-nt overhang on the 3-terminus and a phosphate-bearing 5terminus) is recognized by the Dicer’s PAZ domain (Ma et al. 2004). The PAZ domain helps in maintaining a proper length of dsRNA (21–25 nt) at time of cleavage by RNase III domain of Dicer. The role of PAZ domain behind the length of dsRNA was first time observed in G. intestinalis (MacRae and Doudna 2007). In the RISC complex, Dicer is associated with an Argonaute protein and a dsRBP (TRBP in humans). The dsRBPs interacts with Dicer’s helicase domain in the region located between the DExD/H and helicase C lobes (Daniels et al. 2009). Argonaute joins the complex takes between PIWI domain and RNase III domain (Sasaki and Shimizu 2007; Tahbaz et al. 2004). The Argonaute-interacting site of Dicer is conserved only in vertebrates (Sasaki and Shimizu 2007). A. thaliana evolved a different strategy that includes DCL1 and DRB1 (also known as HYL1) for the binding of dsRNA precursors (Qin et al. 2010).

10 RNA Interference (RNAi) in Functional Genomics of Wheat

247

10.6 Role of RNAi Silencing in Raising Stably Inherited Phenotypes The first wheat transgenic plants studies based on RNAi was published in the year 2004 (targeting the wheat vernalisation gene, TaVRN2 (Yan et al. 2004a, b) and later in 2005 targeting the gene TaVRN1 in 2005 (Loukoianov et al. 2005a, b). These studies not only standardized the RNAi protocol in wheat but also provided the most vital information about the molecular mechanisms of flowering timing and vernalisation in wheat. These reports along with the high amylase content wheat were able to generate wheat transgenic through RNAi but could not succeed in demonstrating the phenotypic stability over generations (Regina et al 2006). Nevertheless, in the same year (Travella et al 2006) and subsequent years (Yao et al. 2007) by introducing dsRNA-expressing constructs for expression of genes encoding Phytoene Desaturase (PDS), Ethylene Insensitive 2 (EIN2) and by using synthetic microRNA constructs instead of large fragments for silencing genes (Yao et al. 2007) were greatly successful in developing true stable wheat phenotypes. These early studies laid the foundation of developing stable wheat phenotypes by using RNAi technology. Further, the application of RNAi has made immense contribution for manipulating various traits of wheat beneficial for its better production, protection and quality. In order to achieve this, various strategies of implementing RNAi-based technology with diverse sets of genes were considered and demonstrated by different groups worldwide (Borisjuk et al. 2019). With the emerging advanced genome editing methods to improve the crop plants like wheat by understanding and utilizing the functions of genes, the scope of RNAi-induced gene silencing either by long double-stranded (dsRNA) or short-hairpin RNA (shRNA) gene-specific homologous precursors including other strategies revolving around RNAi-based technology shall remain one of the best and efficient methods to impart stable wheat phenotypes for all essential traits to be modified.

10.7 RNAi-Induced Silencing as an Efficient Tool to Study Wheat Functional Genomics Identification of gene function in crop plants, especially in wheat with a large size and complex genome, is slow and difficult (Flavell et al. 1974); moreover, the complexity of genetically transformed wheat is even difficult. Wheat is a hexaploid crop, and homologous gene usually masks the genetic mutations created; therefore, mutationalbased approach has been immensely difficult and less successful. Few attempts of past decade could not demonstrate alterations in gene function by delivering specific dsRNA into single epidermal cells in wheat based on the transient expression studies (Schweizer et al. 2000; Christensen et al. 2004; Douchkov et al. 2005). Later several studies successfully demonstrated the usage of RNAi in stably inherited wheat phenotypes (Yan et al. 2004a, b; Loukoianov et al. 2005a, b; Dubcovsky et al. 2006; Li et al.

248

P. Sen et al.

2005a, b Regina et al 2006; Uauy et al. 2006b; Travella et al 2006; Yao et al. 2007). Gil-Humanes et al. (2008a, b, c; 2010) in their initial studies demonstrated the use of RNAi technology in downregulating groups of proteins such as gliadins and glutenins which are encoded by multigene families. Further, the group was able to downregulate γ-gliadins in three commercial lines by RNAi-mediated gene silencing (Gil-Humanes et al. 2012a, b, c). Improved wheat grain in terms of better flour and dough properties, nutritional content such as increased lysine levels by either lowering the gliadins levels or expressing rye secalins in wheat background by efficient and successful use of RNAi silencing proved to be very beneficial (Gil-Humanes et al. 2014; Blechl et al. 2016; Chai et al. 2016a, b). For an example, silencing of ω-5 gliadins expression levels by RNAi technology resulted in improved flour quality (Altenbach and Allen 2011; Altenbach et al. 2014a, b; 2015). The same group (Altenbach et al. 2019a, b) recently have also demonstrated new improved wheat quality by decreasing the expression levels of ω-1,2 gliadins by RNAi silencing method. Similarly, various combinations of RNAi constustructs were used to silence the expression of α-, γand ω-gliadins, which resulted in removal of CD epitopes within the immunogenic α- and ω-gliadins whereas keeping the total starch and protein content intact within the grains (Barro et al. 2016a, 2016b). Presently, several other studies are in progress and focusing on efficient usage of RNAi technology with a broad aim to improve the crop like in the area of better nutrient quality, disease resistance, stress tolerance, etc.

10.8 Application of RNAi-Induced Silencing in Wheat Wheat is a difficult crop due to the presence of very complex genome; therefore, the earliest studies on wheat improvement were all based on transient expressions studies. RNAi-based studies targeting wheat epidermal cells by single cell transient RNAsilencing assay was among the first attempts of such studies (Schweizer et al. 2000). They used dsRNA of reporter genes like gusA (GUS), gfp and fusion of gfp: glp and showed sequence-specific interference of their respective target genes. Another study showed the use of hairpin construct to elucidate the effect of the target gene TaGLP4 on plant defence response (Christensen et al. 2004). Yao et al. (2007) discovered monocot-specific targets for miRNAs in wheat; they demonstrated that synthetic microRNA constructs could be used as alternative for gene silencing instead of large RNA fragments. This proved to be a vital information for the functional genomics studies for the complex genome like wheat. Stable transformations in wheat using RNAi approach was first reported by Yan et al. (2004a, b) for the VRN2 (vernalization gene), Since the work of Yan et al. (2004a, b), several strategies and research areas are found, where application of RNAi has been utilized to improve the wheat crop. These approaches could be categorized into three major areas, namely biotic stress management like tolerance against pathogens such as fungus, nematodes, apihids, etc.; abiotic stress management like temperature, light, soil or physiological effects, etc., and finally the area of nutritional enhancement, i.e. bio-fortification, for example

10 RNA Interference (RNAi) in Functional Genomics of Wheat

249

the use of RNAi to alter wheat grain size, nutrient content and quality (Regina et al 2006; Uauy et al 2006; Li et al. 2018a, b; Zhao et al 2016; Barro et al. 2016a, b; Yue et al. 2008a, b). There are numerous pathogens and a broad range of pest species that infect and cause damage to wheat, and to control this, RNAi technology has been widely applied in the crop against these pathogens (fungal and insect diseases) and pest species by using virus and host-induced gene silencing (HIGS) methods (Lee et al 2012; Nowara et al 2012, Cheng et al. 2015a, b; Chen et al 2015; Song et al 2018; Zhu et al. 2017a, b; Qi et al 2018; Panwar et al. 2018; Zhao et al 2018; Xu et a 2017; Fu et 2014). Yue et al. (2008a, b) provided the method to develop a better quality of wheat flour by silencing the 1Dx5 High molecular weight glutenin subunit (HMWGS) gene. This study also provided information on reducing the gluten content by simultaneous suppression of corresponding homologous genes (all five HMW-GS) present in wheat by RNAi technology. Application of RNAi can either be done by using precise plant dsRNA to produce RISC and thereby inhibiting the expressions of the proteins essentially required for a successful infection or by targeting the parasites like nematodes, insects, fungi, etc. These parasites while feeding on plants let the dsRNA enter their gut which in turn initiate the process of RNAi against their own genes and plant remain unharmed (Charlton et al. 2010; Fairbairn et al. 2007; Dalzell et al. 2010; Duan et al. 2012; Li et al. 2010, 2015). The precise dsRNA required in both of the above approaches is mostly achieved by raising transgenic plants capable to produce them on their own (Zhang et al. 2015; Chen et al 2016). In some instances, the appropriate dsRNA could also be provided externally by spraying methods, root soaking or applying on clay nano-particles, etc. (Heidebrecht 2017; Li et al. 2015; Joga et al. 2016; Mitter et al. 2017). The wheat eIF complex component knockdown by using the RNAi hairpin approach form two genes, viz. TaeIF(iso)4E and TaeIF4E to develop resistance to WSMV and TriMV, was a great effort in the area of providing resistance to multiple viruses (Rupp et al. 2019). Importantly, the group also was awarded patent for this work.

10.9 Importance and Impact of RNAi in Improving Wheat Crop as a Novel Approach Traditional methods like plant breeding and insertional mutagenesis used to improve crop plants by gene and/or trait manipulations are quite time consuming and labour intensive; advanced biotechnological methods involving core molecular biology have since then become more popular due to their less time consuming and accurate results. RNAi-induced silencing to alter gene expressions for the diverse quality traits in crops is one such beneficial approach. Raising stable transgenic phenotypes in hexaploid wheat has been a rather difficult process. RNAi-induced gene silencing studies in wheat where multigene families and homoeologous genes could be silenced have served immensely for functional studies (Travella et al 2006). Rupp et al (2019) proved that resistance to multiple viruses could be achieved by designing a

250

P. Sen et al.

single, endogenous transgene in wheat which also could be considered as a beneficial evidence of the concept for gene editing methods. Decoding the whole genome leads to the identification of thousands genes. Revealing their functions has been a major challenge since then. Gene knockout experiments in order to induce mutant lines could define the function of such genes and solve the problems. Insertional mutagenesis and RNAi both are useful for the above said. RNAi in contrast to insertional mutagenesis has scored more for it is less time consuming, less labour intensive and more specific. The homologous dsRNA formed post-RNA degradation is sequence specific to the target gene (Baulcombe 2004; Carthew 2001). Additionally, several to all genes of either homologous genes in polyploids or from a multigene family could be silenced at once (Miki et al. 2005). Presently, genome editing methods are the most exploited biotechnological tool used in all sectors of biological research for manipulating genes by knockout experiments. Nevertheless, the impact of RNAi to improve crop plants has significantly become a permanent steady-state approach as well. RNAi just is not restricted to the areas of abiotic/biotic stresses, bio-elimination and bio-fortification, instead it also has made its impact in areas like plant male sterility, alterations in plant morphology, gene alterations related to reduced content of toxic compounds and food allergens, increase in synthesis of secondary metabolites, etc., considering to the biosafety risks that persists among all GM crops developed by RNAi or otherwise, accurate and precise biosafety measures would be required in order to get them finally released.

10.10 Metabolic Genes, Proteins Targeted Through RNAi-Based Silencing in Wheat List of genes and proteins targeted through RNAi-based silencing (both transgeneand host-induced gene silencing) is listed in Tables 10.1, 10.2, respectively.

10.11 Advantages of Using RNAi Silencing in Wheat Crop There are several advantages of using RNAi silencing in wheat. Stable RNAi transformation can be effectively used for the target genes associated with prolonged developmental pathways such as senescence (Uauy et al. 2006) or vernalization (Yan et al. 2004a, b). Further, stable RNAi transformation is additionally advantageous for testing epistatic interactions between different genes using the transgenic plants in various crosses or to examine the effects of transgene in contrasting genetic backgrounds. However, when it is possible to evaluate the response of target genes transiently in leaves, VIGS can be aptly used and favoured over stable RNAi transformation.

10 RNA Interference (RNAi) in Functional Genomics of Wheat

251

Table 10.1 Summary of transgene-induced-dsRNA silencing studies in wheat Target loci Gene and Function

Promoter

Detection

Phenotype

LOX

Lipoxygenase

pGlu: glutenin gene

qRT-PCR

Lower LOX Cao et al. activity and less (2020) lipid peroxidation in the grains

TaCKX1

Regulation of cytokinin content

Maize Ubi promoter

qRT-PCR

Higher spike number, grain number and grain yield

Jabło´nski et al. (2020)

TaCKX2.4

CKX is regarded as a negative regulator of cytokinin

ProOsActin

qRT-PCR

Increased grain numbers per spike in wheat

Li et al. (2018a, b)

γ -gliadins Extensibility and viscosity of gluten

Maize Ubi

SDS-PAGE

Reduced levels of g-gliadins

Gil-Humanes et al. (2008)

1Dx5

Seed storage protein

Maize Ubi

Southern blot

Reduced gluten Yue et al. and mixing (2007) quality

SBE-IIa

Starch branching enzyme

HMWG, A

Immunoblotting Reduced amylopectin content

Regina et al. (2006)

SBE-IIb

Starch branching enzyme

HMWG, A

Immunoblotting No detectable phenotype

Regina et al. (2006)

EIN2

Transmembrane Maize Ubi qRT-PCR protein promoter, B

PDS

Phytoene desaturase enzyme

Maize Ubi promoter

GPC

NAM, NAC transcription factor

35S + Adh1 qRT-PCR

Delayed senescence, reduced grain protein, Zn and Fe

Uauy et al. (2006a, b)

VRN1

MADS, K-box domain protein

35S + Adh1 qRT-PCR intron

Delayed flowering time

Loukoianov et al. (2005a, b)

GBSSI

Granule bound starch synthase enzyme

Maize Ubi qRT-PCR promoter, A

Reduced amylose content

Li et al. (2005a, b)

Ethylene insensitivity

References

Travella et al. (2006)

Immunoblotting Photobleaching Travella et al. (2006)

(continued)

252

P. Sen et al.

Table 10.1 (continued) Target loci Gene and Function

Promoter

VRN2

35S + Adh1 qRT-PCR intron

ZCCT1, Zinc finger, CCT domain protein

Detection

Phenotype

References

Accelerated flowering time

Yan et al. (2004a, b)

Another significant advantage of RNAi in wheat is that a single RNAi construct can be effectively utilized for silencing multiple members of a gene family or multiple genes sharing contiguous sequence identity considering its polyploidy genome with several homoeologous copies for every gene. Further, RNAi technology can be very efficiently used for understanding the functional role(s) of the target genes in wheat as large number of phenotypic differences can be observed in RNAi experiments providing useful know-how on the quantitative variances at transcript levels and their effects thereof. Besides, the total silencing of target genes by RNAi leading to lethality or severe phenotypes with variable pleiotropic effects can be an added advantage for enabling a superior understanding of gene function because in such cases intermediary degrees of transcript downregulation could have reduced amounts of acute effects. RNAi has tremendous utility in developing wheat varieties resistant to various pathogens such as viruses, fungi and bacteria, as well as insect pests and nematodes. It can also be very effectively utilized for developing nutritionally enriched and biofortified wheat varieties as this technology promises organ/tissue specific silencing.

10.12 Limitations and Risk Management Involving RNAi-Based Silencing in Wheat Crop Although RNAi has proven very effective in generating insect and disease resistance lines, there are also certain limitations to application of RNAi technology in wheat, and therefore, subsequent risk management for RNAi-based silencing is also important. Some of the limitations and strategies to overcome the same are mentioned below:

10.12.1 Contiguous Sequence Identity The presence of uninterrupted stretches of identical sequences is important both for trigger sequences and their target genes. Plants in response to RNAi produce 21–26nt siRNAs from the cleavage of dsRNA suggesting that at least a contiguous 21-nt identical sequence is a must between a trigger and its target gene for an effective silencing to take place (Qi et al. 2005; McGinnis et al. 2007; Fu et al. 2007a, b). In

Fungi

PsCPK1

PsFuz7

PtMAPK1 and PtCYC1

Puccinia striiformis f. sp. tritici

Puccinia striiformis f. sp. tritici

Puccinia striiformis

Chitin synthase 3b

Fusarium graminearum

Maize Ubi

Maize Ubi

β-1, 3-glucan synthase

Fusarium culmorum FcGls1

Chs3b

Maize Ubi

Maize Ubi

CaMV35S

–

MAP kinase, cyclophilin

MAP kinase kinase

PKA catalytic subunit

Receptor-like protein kinases

TaCRK2

Maize Ubi

Puccinia triticina

Maize Ubi

Microtubule array

Coat protein

Maize Ubi

Promoter

Blumeria graminis f. β-tub sp. tritici

Coat protein gene

WSMV

RNA helicase

Gene and Function

Artificial microRNA Maize Ubi (amiRNA)

TaeIF(iso)4E and TaeIF4G

Viruses

Wheat streak mosaic Pre-miR395 virus (WSMV)

Target loci

WSMV and Triticum mosaic virus (TriMV)

Pathogen

Enhanced resistance

Enhanced resistance

Enhanced resistance

Enhanced resistance

Northern blot Stable resistance

qRT-PCR

RNA blots

Northern Blot Stable resistance

(continued)

Cheng et al. (2015a, b)

Chen et al. (2016)

Panwar et al. (2018, )

Zhu et al. (2017a, b)

Qi et al. (2018)

Gu et al. (2019)

Schaefer et al. (2020)

Fahim et al. (2012)

Consistent resistance Cruz et al. (2014)

Southern blot Stable resistance

qRT-PCR

qRT-PCR

References

Resistant Rupp et al. (2019) to WSMV, TriMV, and mixed infections of both

Phenotype

Southern blot Stable resistance

DAS-ELISA

qRT-PCR

Detection

Table 10.2 Summary of genes and proteins targeted in wheat by using host-induced gene silencing

10 RNA Interference (RNAi) in Functional Genomics of Wheat 253

Insects

Target loci

Gene and Function

Sitobion avenae

Pratylenchus spp.

CbE E4

pat-10, unc-87

HSP90, ICL, and Mi-cpl-1

Carboxylesterase gene

qRT-PCR

Detection Reduced Virulence

Phenotype

CaMV35S

Maize Ubi

rbcS

qRT-PCR

qRT-PCR

qRT-PCR

RNA blot

Impaired tolerance of phoxim insecticides

Reduced reproduction

Reduced reproduction

Reduced Virulence

trpC promoter Southern blot Failed to induce the expanded necrosis symptom

CaMV35S

Promoter

Troponin C (Pat-10) – and Calponin (unc-87)

Heat-shock protein 90, isocitrate lyase, and Mi-cpl-1

Virulence effector

Blumeria graminis

Avra10

Encodes a proteinaceous HST

BEC1011,BEC1054, Effectors BEC1038, BEC1016,BEC1005, BEC1019, BEC1040, and BEC1018

Cochliobolus sativus ToxA

Blumeria graminis

Nematode Meloidogyne incognita

Pathogen

Table 10.2 (continued)

Xu et al. (2014)

Tan et al. (2013)

Isabela et al. (2014)

Nowara et al. (2010)

Leng et al. (2011)

Pliego et al. (2013)

References

254 P. Sen et al.

10 RNA Interference (RNAi) in Functional Genomics of Wheat

255

contrast, several studies have reported that overall sequence identity is important and not continuous stretch of identical sequences which implies that greater the complete sequence identity, higher the chances of finding contiguous 21 identical nucleotides. In this context, wheat homeologous genes share 95% sequence homology indicating that in a 200–500 bp trigger size the homeologues will have a high probability of having contiguous 21-nt sequences among them indicating that a single homeoallele as trigger sequence may be able to simultaneously silence all three homeologues (Fu et al. 2007a, b). The same has been confirmed in few studies wherein downregulation of PDS, EIN2 and NAM by a single construct has been reported (Travella et al. 2006; Uauy et al. 2006a, b). Similarly in order to investigate the role of TaGW2 which encodes an E3 RNA ligase during grain development in wheat, RNAi was performed to downregulate all three homeologues present in A, B and D genomes (Bednarek et al. 2012). However, exceptions have also been reported in wheat high molecular weight (HMW) glutenin genes owing to their high sequence diversity and repetitive nature (Yue et al. 2008a, b). Thus, suggesting the fact that many a times mere presence of contiguous stretch of 21-nt may not be sufficient for triggering RNAi-mediated downregulation. Other than sequence identity, target gene stability, GC content and RNA hairpin melting temperature also significantly affects RNAi trigger efficacy (Yang et al. 2018; Reynolds et al. 2004). Further, it would be interesting to conduct experiments to better understand the role of trigger sequence(s) on RNAi efficacy, viz. by creating artificial RNAi triggers of identical sequences with mutations every 19–23-nt or by creating RNAi triggers with distinct identical stretch of 19–23 nt, but no sequence identity for rest of the sequence, and analyzing the effects. These studies would be very beneficial in case of wheat which is a hexaploid with high gene duplication events and thus higher chances of targeting unintended paralogous genes (Fu et al. 2007a, b).

10.12.2 Selection of RNAi Trigger Region/Site Selection of RNAi trigger region is very crucial for any RNAi experiment and largely depends upon the objective of the study. Exclusion of conserved domain(s) from the RNAi trigger region is very important if one aims at only silencing a particular target gene and its homeologues and not other paralogous genes. In this context, nonconserved coding regions and 3 UTR have been successfully exploited for silencing individual members of the multigene families in wheat, e.g. NAC, MADS-Box, storage protein encoding genes, etc. However, when the aim is to knockdown all genes of a multigene family, it is desirable to use the conserved domain/region as an RNAi trigger targeting several members of a gene family concurrently. Further, with the availability of the wheat whole genome sequence, designing of preferred RNAi trigger construct has become less cumbersome and quite convenient.

256

P. Sen et al.

10.12.3 Size of the RNAi Trigger RNAi trigger size can be another limitation which needs to be taken care of while designing the construct. It is more crucial in those cases where the target gene is comprised of short fragments of non-conserved regions only. In such cases, it becomes essential to have knowledge of the least possible trigger size capable of inducing effective gene silencing. Though there are evidences that even a short dsRNA trigger of 23-nt can effectively induce silencing in plants (Thomas et al. 2001), however in case of wheat being a polyploidy, a trigger size of ~ 200–500 bp has been documented as effective in many studies (Fu et al. 2007a, b). Further, Scofield et al. (2005) showed that for VIGS, approximately 120 bp trigger size can effectively induce gene silencing, indicating that a minimum of 120 bp RNAi trigger size is desirable. However, as far as maximum RNAi trigger size is concerned, it can be up to 683 bp in wheat and even higher in other plants (Li et al. 2005a, b; Fu et al. 2007a, b). However, this cannot be considered a standard criterion for selecting trigger size in wheat and other plants and requires thorough experimentations.

10.12.4 Silencing Efficiency of the RNAi RNAi silencing efficiency is also an important criterion to be considered while planning any experiment. The silencing efficiency of RNAi has been reported to be variable ranging from 29–10% depending upon the plants, developmental stage and other experimental conditions making it unpredictable to determine the minimum number of transgenic events for obtaining the desired phenotype (Fu et al. 2007a, b). Therefore, it is always desirable to analyse a sizeable number of transgenic events for a more accurate, reliable and robust RNAi results in any plant and more importantly in wheat due to its polyploid nature.

10.12.5 Off-Target Effects Dealing with undesirable phenotypes/traits due to off-target effects can be a grappling issue, especially in the case of noncoding small RNA-mediated gene silencing used for engineering broad spectrum resistance against pathogens and insect pests in plants. It is therefore crucial to design an effective RNAi construct aimed at silencing a particular gene/group of genes and screening a large number of transgenic events for desirable phenotype in wheat.

10 RNA Interference (RNAi) in Functional Genomics of Wheat

257

10.12.6 Other Limitations In case of using VIGS system, the gene of interest may only express under certain environmental conditions/developmental stages which may not be suitable for virus replication/infection or there may be certain wheat varieties which may be resistant to the virus restraining the genotype(s) to be used for this system. In these cases, careful selection of target genes as well as wheat genotypes is a must.

10.12.7 Ethical Issues Other than these, there are many significant challenges towards the development and commercialization of genetically modified (GM) crops utilizing RNAi-based technology in India and many other nations. Most importantly, RNAi causes heterochromatin formation via transcriptional gene silencing and chromatin modification which might become hereditary causing potential biosafety risks. Another major concern is the selection of transformed plants using antibiotic selectable markers. The use of such antibiotic resistance markers may lead to development of antibiotic-resistant microbes evoking environmental concerns though the use of NptII in vectors whch is generally considered safe. Therefore, the varieties developed through RNAi should be assessed for risks associated to food and environment safety. Also, there is a need to design customized vectors as per the requirements of the crop improvement programs. Remarkable efforts for accomplishing scientific breakthroughs along with consistent efforts by the scientist, policy makers and government for acceptance of GM crops by the public amongst other ethical issues needs to be given importance for making RNAi-based crops a success.

10.13 Conclusions and Future Perspectives Wheat being a staple cereal crop has always seen a high demand which has further been projected to increase at 1.6% per annum by 2050 owing to an increase in global population and prosperity. Subsequently, average wheat productivity needs to be escalated to nearly 5 tonnes ha−1 from the present 3.3 tonnes ha−1 (Borisjuk et al. 2019). Further, wheat has a complex hexaploid genome which makes the crop improvement programs directed towards enhancing its production and productivity, heavily dependent upon sound knowledge and application of various functional genomic tools. Therefore, it becomes absolutely necessary to identify potential candidate genes and proteins, their structure and function at different developmental stages of wheat in order to utilize them for higher grain yield, improved quality and stress resistance. Once identified, plant biologists and biotechnologists can genetically manipulate the structure and function of selected candidate genes.

258

P. Sen et al.

Apart from transgenic technology, two very effective genetic manipulation tools are CRISPR/Cas9 and RNAi. RNAi technology in wheat has been very effectively used to target and manipulate a large number of genes involved in signalling, transcriptional regulation, metabolic pathways, storage, developmental processes and stress responses. The RNAi responses have also been reported in various tissues such as seeds and leaves as well as developmental stages such as seedling, grain-filling and senescence in wheat. Further, wheat RNAi has been reported to be stably inherited and sequence specific. RNAi is a proven and effective tool for hexaploid wheat with multiple homoeologous copies for each gene owing to the fact that a single RNAi construct can silent multiple genes sharing identical sequences simultaneously. RNAi also helps in precise understanding of gene functions owing to quantitative variances in transcript levels of the target gene as well as degree of lethality or intense phenotypes with pleiotropic effects. Further, considering the wide applications of RNAi in pest and disease resistance in wheat, it is obvious that the possibility of RNAi-induced resistance is as wide and versatile as the number of pathogens and pests infecting wheat and causing yield loss. Finally, with the completion of whole genome sequencing of wheat and availability of unprecedented amounts of sequence information, the role of RNAi in wheat functional genomics is definitely going to be imperative for determining gene functions. In addition, extensive evaluation of stable RNAi lines in field conditions will be very beneficial in developing wheat cultivars with better pest and pathogen resistance as well as enhanced nutritional quality. It can thus be concluded that RNAi technology could be very instrumental for crop improvement in general and wheat improvement in particular, which will contribute to agriculture productivity to a great extent.

References Altenbach SB, Allen PV (2011) Transformation of the US bread wheat “Butte 86” and silencing of omega-5 gliadin genes. GM Crops 2–1:66–73 Altenbach SB, Tanaka CK, Allen PV (2014a) Quantitative proteomic analysis of wheat grain proteins reveals differential effects of silencing of omega- 5 gliadin genes in transgenic lines. J Cereal Sci 59:118–125 Altenbach SB, Tanaka CK, Seabourn BW (2014b) Silencing of omega-5 gliadins in transgenic wheat eliminates a major source of environmental variability and improves dough mixing properties of flour. BMC Plant Biol 14:393. https://doi.org/10.1186/s12870-014-0393-1 Altenbach SB, Tanaka CK, Pineau F, Lupi R, Drouet M, Beaudouin E et al (2015) Assessment of the allergenic potential of transgenic wheat (Triticum aestivum) with reduced levels of ω5-gliadins, the major sensitizing allergen in wheat-dependent exercise-induced anaphylaxis. J Agric Food Chem 63:9323–9332. https://doi.org/10.1021/acs.jafc.5b03557 Altenbach SB, Chang HC, Simon-Buss A, Mohr T, Huo N, Gu YQ (2019a) Exploiting the reference genome sequence of hexaploid wheat: a proteomic study offlour proteins from the cultivar Chinese Spring. Func Integr Genomics https://doi.org/10.1007/s10142-019-00694-z Altenbach SB, Chang HC, Yu XB, Seabourn BW, Green PH, Alaedini A (2019b) Elimination of omega-1,2 gliadins from bread wheat (Triticum aestivum) flour: effects on immunogenic potential and end-use Quality. Front Plant Sci 10:580

10 RNA Interference (RNAi) in Functional Genomics of Wheat

259

Axtell MJ, Synder JA, Bartel DP (2007) Common functions for diverse small RNAs of land plants. Plant Cell 19(6):1750–1769 Barro F, Iehisa JC, Giménez MJ, García-Molina MD, Ozuna CV, Comino I et al (2016) Targeting of prolamins by RNAi in bread wheat: effectiveness of seven silencing-fragment combinations for obtaining lines devoid of coeliac disease epitopes from highly immunogenic gliadins. Plant Biotechnol J 14:986–996 Barro F, Iehisa JC, Giménez MJ et al (2016) Targeting of prolamins by RNAi in bread wheat: effectiveness of seven silencing-fragment combinations for obtaining lines devoid of coeliac disease epitopes from highly immunogenic gliadins. Plant Biotechnol J 14(3):986–996 Baulcombe DC (2004) RNA silencing in plants. Nature 431:356–363 Bednarek J, Boulaflous A, Girousse C, Ravel C, Tassy C, Barret P, Bouzidi MF, Mouzeyar S (2012) Down-regulation of the TaGW2 gene by RNA interference results in decreased grain size and weight in wheat. J Exp Bot 63(16):5945–5955 Bernstein E, Caudy AA, Hammond SM, Hannon GJ (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409(6818):363–366 Blechl A, Beecher B, Vensel W, Tanaka C, Altenbach S (2016) RNA interference targeting rye secalins alters flour protein composition in a wheat variety carrying 1BL1RS translocation. J Cereal Sci 68:172–180 Borisjuk N, Kishchenko O, Eliby S, Schramm C, Anderson P, Jatayev S, Kurishbayev A, Shavrukov Y (2019) Genetic modification for wheat improvement: from transgenesis to genome editing. Biomed Res Int 2019:6216304. https://doi.org/10.1155/2019/6216304 Cao X, Aufsatz W, Zilberman D, Mette MF, Huang MS, Matzke M, Jacobsen SE (2003) Role of the DRM and CMT3 methyltransferases in RNA-directed DNA methylation. Curr Biol 13:2212–2217 Cao X, Dong Z, Tian D, Dong L, Qian W, Liu J, Liu X, Qin H, Zhai W, Gao C, Zhang K, Wang D (2020) Development and characterization of marker-free and transgene insertion site-defined transgenic wheat with improved grain storability and fatty acid content. Plant Biotechnol J 18:129–140 Carthew RW (2001) Gene silencing by double-stranded RNA. Curr Opin Cell Biol 13:244–248 Cenik ES, Fukunaga R, Lu G, Dutcher R, Wang Y (2011) Phosphate and R2D2 restrict the substrate specificity of Dicer-2, an ATP-driven ribonuclease. Mol Cell 42:172–184 Chan SW, Henderson IR, Jacobsen SE (2005) Gardening the genome: DNA methylation in Arabidopsis thaliana. Nat Rev Genet 6:351–360 Chai JF, Zhang CM, Ma XY, Wang HB (2016a) Molecular identification of ω-secalin gene expression activity in a wheat 1B/1R translocation cultivar. J Integr Agric 15:2712–2718 Chai JF, Wang HB, Ma XY, Zhang CM, Dong FS (2016b) Effect of ω-secalin gene silencing on processing quality of wheat 1B/1R translocation line. Acta Agron Sin 42:627–632 Chen Y, Gao Q, Huang M et al (2015) Characterization of RNA silencing components in the plant pathogenic fungus fusarium graminearum. Sci Rep 5(12500) Chen W, Kastner C, Nowara D, Oliveira-Garcia E, Rutten T, Zhao Y, Deising HB, Kumlehn J, Schweizer P (2016) Host-induced silencing of Fusarium culmorum genes protects wheat from infection. J Exp Bot 67:4979–4991 Cheng W, Song X, Li H, Cao L, Sun K, Qiu X, Xu Y, Yang P, Huang T, Zhang J (2015) Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight andseedling blight in wheat. Plant Biotechnol J 13:1335–1345 Cheng W, Song X, Li H et al (2015) Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to fusarium head blight and seedling blight in wheat. Plant Biotechnol J 13(9):1335–1345 Christensen AB, Thordal-Christensen H, Zimmermann G, Gjetting T, Lyngkjær MF, Dudler R, Schweizer P (2004) The Germinlike protein GLP4 exhibits superoxide dismutase activity and is an important component of quantitative resistance in wheat and barley. Mol Plant Microbe Interact 17:109–117 Cogoni C, Macino G (1999) Gene silencing in Neurospora crassa requires a protein homologous to RNA-dependent RNA polymerase. Nature 399:166–169

260

P. Sen et al.

Cruz LF, Rupp JLS, Trick HN, Fellers JP (2014) Stable resistance to Wheat streak mosaic virus in wheat mediated by RNAi. Vitro Cell Dev Plant 50:665–672 Daniels SM, Melendez CE, Scarborough RJ, Daher A, Christensen HS (2009) Characterization of the TRBP domain required for Dicer interaction and function in RNA interference. BMC Mol Biol. 10(1):38 Douchkov D, Nowara D, Zierold U, Schweizer P (2005) A high-throughput gene-silencing system for the functional assessment of defenserelated genes in barley epidermal cells. Mol Plant Microbe Interact 18:755–761 Dubcovsky J, Loukoianov A, Fu D, Valarik M, Sanchez A, Yan L (2006) Effect of photoperiod on the regulation of wheat vernalization genes VRN1 and VRN2. Plant Mol Biol 60:469–480 Eamens AL, Smith NA, Curtin SJ, Wang M, Waterhouse PM (2009) The Arabidopsis thaliana double-stranded RNA binding protein DRB1 directs guide strand selection from microRNA duplexes. RNA 2219–2235 Earley KW, Haag JR, Pontes O (2006) Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45:616–629 Fahim M, Millar AA, Wood CC, Larkin PJ (2012) Resistance to Wheat streak mosaic virus generated by expression of an artificial polycistronic microRNA in wheat. Plant Biotechnol J 10:150–163 Fire A (1999) RNA-triggered gene silencing. Trends Genet 15(9):358–363 Flavell RB, Bennett MD, Smith JB, Smith DB (1974) Genome size and proportion of repeated nucleotide sequence DNA in plants. Biochem Genet 12:257–269 Fu D, Uauy C, Blechl A, Dubcosky J (2007) RNA interference for wheat functional analysis. Transgenic Res 16:689–701 Fu D, Uauy C, Blechl A, Dubcovsky J (2007) RNA interference for wheat functional gene analysis. Transgenic Res 16(6):689–701. https://doi.org/10.1007/s11248-007-9150-7 Fu M, Xu M, Zhou T et al (2014) Transgenic expression of a functional fragment of harpin protein Hpa1 in wheat induces the phloem-based defence against English grain aphid. J Exp Bot 65(6):1439–1453 Gil-Humanes J, Pistón F, Hernando A, Alvarez JB, Shewry PR, Barro F (2008) Silencing of ggliadins by RNA interference (RNAi) in bread wheat. J Cereal Sci 48:565–568 Gil-Humanes J, Pistón F, Hernando A, Alvarez JB, Shewry PR et al (2008) Silencing of c-gliadins by RNA interference (RNAi) in bread wheat. J Cereal Sci 48:565–568 Gil-Humanes J, Pistón F, Hernando A, Álvarez JB, Shewry PR, Barro F (2008) Silencing of γgliadins by RNA interference (RNAi) in bread wheat. J Cereal Sci 48:565–568 Gil-Humanes J, Pistón F, Tollefsen S, Sollid LM, Barro F (2010) Effective shutdown in the expression of celiac disease-related wheat gliadin T-cell epitopes by RNA interference. Proc Natl Acad Sci USA 107:17023–17028 Gil-Humanes J, Pistón F, Giménez MJ, Martín A, Barro F (2012a) The introgression of RNAi silencing of γ-gliadins into commercial lines of bread wheat changes the mixing and technological properties of the dough. PLoS ONE 7:e45937 Gil-Humanes J, Pistón F, Rosell CM, Barro F (2012b) Significant downregulation of c-gliadins has minor effect on gluten and starch properties of bread wheat. J Cereal Sci https://doi.org/10.1016/ j.jcs.2012.02.009 Gil-Humanes J, Pistón F, Giménez MJ, Martín A, Barro F (2012b) The Introgression of RNAi Silencing of c-Gliadins into Commercial Lines of Bread Wheat Changes the Mixing and Technological Properties of the Dough. PLoS ONE 7(9):e45937. https://doi.org/10.1371/journal.pone. 0045937 Gil-Humanes J, Pistón F, Barro F, Rosell CM (2014) The shutdown of celiac disease-related gliadin epitopes in bread wheat by RNAi provides flours with increased stability and better tolerance to over-mixing. PLoS ONE 9:e91931 Hammond SM (2005) Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett 579(26):5822–5829 Han J, Pedersen JS, Kwon SC, Belair CD, Kim YK, Yeom KH, Haussler D, Blelloch R, Kim VN (2009) Posttranscriptional crossregulation between Drosha and DGCR8. Cell 136(1):75–84

10 RNA Interference (RNAi) in Functional Genomics of Wheat

261

Heidebrecht RW Jr (2017) Delivery strategies: RNA interference in agriculture and human health. Pest Manag Sci 73:686–691 Helliwell CA, Waterhouse PM (2003) Constructs and methods for highthroughput gene silencing in plants. Methods 30:289–295 Helliwell CA, Waterhouse PM (2005) Constructs and methods for hairpin RNA-mediated gene silencing in plants. Methods Enzymol 392:24–35 Helliwell CA, Wesley SV, Wielopolska AJ, Waterhouse PM (2002) Highthroughput vectors for efficient gene silencing in plants. Funct Plant Biol 29:1217–1225 Hiraguri A, Itoh R, Kondo N, Nomura Y, Aizawa D, Murai Y, Koiwa H, Seki M, Shinozaki K, Fukuhara T (2005) Specific interactions between Dicer-like proteins and HYL1/DRB family dsRNA-binding proteins in Arabidopsis thaliana. Plant Mol Biol 57:173–188 Hirai S, Oka S, Adachi E, Kodama H (2007) The effects of spacer sequences on silencing efficiency of plant RNAi vectors. Plant Cell Rep 26:651–659 Isabela TL-T, Junior JDAS, Martins-de-Sa D, Viana AAB, Carneiro RMDG, Togawa RC, AlmeidaEngler Jd, Batista JAN, Silva MCM, Fragoso RR, Grossi-de-Sa MF (2014) knock-down of heatshock protein 90 and isocitrate lyase gene expression reduced root-knot nematode production. Am Phytopathol Soc 105(5):629 Jabło´nski B, Ogonowska H, Szala K, Bajguz A, Orczyk W, Nadolska-Orczyk A (2020) Silencing of TaCKX1 mediates expression of other TaCKX genes to increase grain yield in wheat. BioRxiv https://doi.org/10.1101/2020.01.07.897421 Joga MR, Zotti MJ, Smagghe G, Christiaens O (2016) RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: what we know so far. Front Physiol 7:553 Karimi M, Depicker A, Hilson P (2007) Recombinational cloning with plant gateway vectors. Plant Physiol 145:1144–1154 Lau P-W, Guiley KZ, De N, Potter CS, Carragher B, MacRae IJ (2012) The molecular architecture of human Dicer. Nat Struct Mol Biol 19(4):436–440 Lee W, Hammond-Kosack KE, Kanyuka K (2012) Barley stripe mosaic virus-mediated tools for investigating gene function in cereal plants and their pathogens: virus-induced gene silencing, host-mediated gene silencing, and virus-mediated overexpression of heterologous protein. Plant Physiol 160(2):582–590 Leng Y, Wu C, Liu Z, Friesen TL, Rasmussen JB, Zhong S (2011) RNA-mediated gene silencing in the cereal fungal pathogen Cochliobolus sativus. Mol Plant Pathol 12(2):289–298 Li JR, Zhao W, Li QZ, Ye XG, An BY, Li X, Zhang XS (2005) RNA silencing of Waxy gene results in low levels of amylose in the seeds of transgenic wheat (Triticum aestivum L.). Acta Genet Sin 32:846–854 Li J, Yang Z, Yu B, Liu J, Chen X (2005) Methylation protects miRNAs and siRNAs from a 3’-end uridylation activity in Arabidopsis. Curr Biol 15:1501–1507 Li H, Guan R, Guo H, Miao X (2015) New insights into an RNAi approach for plant defence against piercing-sucking and stem-borer insect pests. Plant Cell Environ 2015(38):2277–2285. https:// doi.org/10.1111/pce.12546 Li Y, Song G, Gao J, Zhang S, Zhang R, Li W, Chen M, Liu M, Xia X, Risacher T, Li G (2018) Enhancement of grain number per spike by RNA interference of cytokinin oxidase 2 gene in bread wheat. Hereditas 155:33 Li Y, Song G, Gao J et al (2018) Enhancement of grain number per spike by RNA interference of cytokinin oxidase 2 gene in bread wheat. Hereditas 155(33) Loukoianov A, Yan L, Blechl A, Sanchez A, Dubcovsky J (2005) Regulation of VRN-1 vernalization genes in normal and transgenic polyploid wheat. Plant Physiol 138:2364–2373 Loukoianov A, Yan L, Blechl A (2005) Regulation of VRN-1 vernalization genes in normal and transgenic polyploid wheat. Plant Physiol 138(4):2364–2373 Lu C, Fedoroff N (2000) A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin. Plant Cell 12:2351–2366 Lund E, Güttinger S, Calado A, Dahlberg JE, Kutay U (2004) Nuclear export of microRNA precursors. Science 303(5654):95–98

262

P. Sen et al.

Ma J-B, Ye K, Patel DJ (2004) Structural basis for overhang-specific small interfering RNA recognition by the PAZ domain. Nature 429(6989):318–322 MacRae IJ, Doudna JA (2007) Ribonuclease revisited: structural insights into ribonuclease III family enzymes. Curr Opin Struct Biol 17(1):138–145 Mallory A, Vaucheret H (2010) Form, function, and regulation of Argonaute proteins. Plant Cell 22:3879–3889 McGinnis K, Murphy N, Carlson AR, Akula A, Akula C, Basinger H, Carlson M, Hermanson P, Kovacevic N, McGill MA, Seshadri V, Yoyokie J, Cone K, Kaeppler HF, Kaeppler SM, Springer NM (2007) Assessing the efficiency of RNA interference for maize functional genomics. Plant Physiol 143:1441–1451 Miki D, Itoh R, Shimamoto K (2005) RNA silencing of single and multiple members in a gene family of rice. Plant Physiol 138:1903–1913 Millar AA, Waterhouse PM (2005) Plant and animal microRNAs: similarities and differences. Funct Integr Genomics 5:129–135 Mitter N, Worrall EA, Robinson KE, Li P, Jain RG, Taochy C et al (2017) Clay nanosheets for topical delivery of RNAi for sustained protection against plant viruses. Nat. Plants 3:16207. https://doi. org/10.1038/nplants.2016.207 Niu QW, Lin SS, Reyes JL (2006) Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nat Biotecnol 24:1420–1428 Nowara D, Gay A, Lacomme C, Shaw J, Ridout C, Douchkov D, Hensel G, Kumlehn J, Schweizer P (2010) HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell 22:3130–3141 Nowara D, Gay A, Lacomme C et al (2012) HIGS: host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. e Plant Cell 22(9):3130–3141 Panwar V, Jordan M, McCallum B, Bakkeren G (2018) Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat. Plant Biotechnol J 16:1013–1023 Pliego C, Nowara D, Bonciani G, Gheorghe DM, Xu R (2013) Host-induced gene silencing in barley powdery mildew reveals a class of ribonuclease-like effectors. Mol Plant Microbe Interact 26:633–642 Qi Y, Denli AM, Hannon GJ (2005) Biochemical specialization within Arabidopsis RNA silencing pathways. Mol Cell 19:421–428 Qi T, Zhu X, Tan C, Liu P, Guo J, Kang Z, Guo J (2018) Host-induced gene silencing of an important pathogenicity factor PsCPK1 in Puccinia striiformis f. sp. tritici enhances resistance of wheat to stripe rust. Plant Biotech J 16:797–807 Qin H, Chen F, Huan X, Machida S, Song J, Yuan YA (2010) Structure of the Arabidopsis thaliana DCL4 DUF283 domain reveals a noncanonical double-stranded RNA-binding fold for proteinprotein interaction. RNA 16(3):474–481 Qu J, Ye J, Fang R (2007) Artificial microRNA-mediated virus resistance in plants. J Virol 81:6690– 6699 Regina A, Bird A, Topping D, Bowden S, Freeman J, Barsby T, Kosar-Hashemi B, Li Z, Rahman S, Morell M (2006) High-amylose wheat generated by RNA interference improves indices of large-bowel health in rats. Proc Natl Acad Sci USA 103:3546–3551 Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A (2004) Rational siRNA design for RNA interference. Nat Biotech 22:326–330 Rupp JS, Cruz L, Trick HN, Fellers JP (2019) RNAi-mediated silencing of endogenous wheat genes EIF(Iso)4E–2 and EIF4G induce resistance to multiple RNA viruses in transgenic wheat. Crop Sci 59:2642–2651 Saini HK, Griffiths-Jones S, Enright AJ (2007) Genomic analysis of human microRNA transcripts. Proc Natl Acad Sci USA 104:19–24 Sasaki T, Shimizu N (2007) Evolutionary conservation of a unique amino acid sequence in human DICER protein essential for binding to Argonaute family proteins. Gene 396(2):312–320

10 RNA Interference (RNAi) in Functional Genomics of Wheat

263

Schaefer LH, Parlange F, Buchmann G, Jung E, Wehrli A, Herren G, Müller MC, Stehlin J, Schmid R, Wicker T, Keller B, Bourras S (2020) Cross-kingdom RNAi of pathogen effectors leads to quantitative adult plant resistance in wheat. Front Plant Sci 11:253 Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18:1121–1133 Schwarz DS, Hutvágner G, Du T, Xu Z, Aronin N, Zamore PD (2003) Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199–208 Schweizer P, Pokorny J, Schulze-Lefert P, Dudler R (2000) Doublestranded RNA interferes with gene function at the single-cell level in cereals. Plant J 24:895–903 Scofield SR, Huang L, Brandt AS, Gill BS (2005) Development of a virus-induced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol 138:2165–2173 Shabalina SA, Koonin EV (2008) Origins and evolution of eukaryotic RNA interference. Trends Ecol Evol 23(10):578–587 Song X, Gu K, Duan X et al (2018) A myosin5 dsRNA that reduces the fungicide resistance and pathogenicity of fusarium asiaticum. Pestic Biochem Physiol 150:1–9 Tahbaz N, Kolb FA, Zhang H, Jaronczyk K, Filipowicz W, Hobman TC (2004) Characterization of the interactions between mammalian PAZ PIWI domain proteins and Dicer. EMBO Rep 5(2):189– 194 Tan JCH, Jones MGK, Fosu-Nyarko J (2013) Gene silencing in root lesion nematodes (Pratylenchus spp.) significantly reduces reproduction in a plant host. Exp Parasitol 133:166–178 Thomas CL, Jones L, Baulcombe DC, Maule AJ (2001) Size constraints for targeting posttranscriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J 25:417–425 Travella S, Klimm TE, Keller B (2006) RNA interference based gene silencing as an efficient tool for functional genomics in hexaploid bread wheat. Plant Physiol 142:6–20 Tsutsumi A, Kawamata T, Izumi N, Seitz H, Tomari Y (2011) Recognition of the pre-miRNA structure by Drosophila Dicer-1. Nat Struct Mol Biol 18(10):1153–1158 Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006a) A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 314:1298–1301 Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006b) A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 314(5803):1298–1301 Vazquez F, Vaucheret H, Rajagopalan R, Lepers C, Gasciolli V, Mallory AC, Hilbert JL, Bartel DP, Crete P (2004) Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis mRNAs. Mol Cell 16:69–79 Verdel A, Vavasseur A, Gorrec ML, Todeschini LT (2009) Common themes in siRNA-mediated epigenetic silencing pathway. Int J Dev Biol 53(2–3):245–257 Waseenegger M, Heimes S, Riedel L, Sanger HL (1994) RNA-directed de novo methylation of genomic sequences in plants. Cell 76:567–576 Welker NC, Maity TS, Ye X, Aruscavage PJ, Krauchuk AA (2011) Dicer’s helicase domain discriminates dsRNA termini to promote an altered reaction mode. Mol Cell 41(5):589–599 Wesley SV, Helliwell CA, Smith NA (2001) Construct design for efficient, effective and highthoughput gene silencing in plants. Plant J 27:581–590 Wielopolska A, Townley H, Moore I, Waterhouse P, Helliwell C (2005) A high-throughput inducible RNAi vector for plants. Plant Biotechnol J 3:583–590 Xu L, Duan X, Lv Y, Zhang X, Nie Z, Xie C, Ni Z, Liang R (2014) Silencing of an aphid carboxylesterase gene by use of plant-mediated RNAi impairs Sitobion avenae tolerance of Phoxim insecticides. Transgenic Res 23:389–396 Xu L, Hou Q, Zhao Y et al (2017) Silencing of a lipase maturation factor 2-like gene by wheatmediated RNAi reduces the survivability and reproductive capacity of the grain aphid, sitobion avenae. Arch Insect Biochem Physiol 95(3): article e21392

264

P. Sen et al.

Yan L, Loukoianov A, Blechl A, Tranquilli G, Ramakrishna W, SanMiguel P, Bennetzen JL, Echenique V, Dubcovsky J (2004) The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science 303:1640–1644 Yan L, Loukoianov A, Blechl A et al (2004) ThewheatVRN2 gene is a flowering repressor downregulated by vernalization. Science 303(5664):1640–1644 Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK et al (2007) Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 8(R96). https://doi.org/10.1186/gb-2007-86-r96 Yang D, Xu X, Zhao H, Yang S, Wang X, Zhao D, Diao Q, Hou C (2018) Diverse factors affecting efficiency of RNAi in honey bee viruses. Front Genet 9:384. https://doi.org/10.3389/fgene.2018. 00384 Yelin MD, Chung SM, Frankman EL, Tzfira T (2007) pSAT RNA interference vectors: a modular series for multiple gene down-regulation in plants. Plant Physiol 145:1272–1281 Yue SJ, Li H, Li YW, Zhu YF, Guo JK, Liu YJ, Chen Y, Jia X (2008) Generation of transgenic wheat lines with altered expression levels of 1Dx5 high-molecular weight glutenin subunit by RNA interference. J Cereal Sci 47:153–161 Yue S, Li H, Li Y et al (2008) Generation of transgenic wheat lines with altered expression levels of 1Dx5 high-molecular weight glutenin subunit by RNA interference. J Cereal Sci 47(2):153–161 Zamore PD, Tuschl T, Sharp PA, Bartel DP (2000) RNAi: Double-stranded RNA directs the ATP dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101(1):25–33 Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC (2011) MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs. Gene Dev 25(23):2540–2553 Zhang J, Khan SA, Hasse C, Ruf S, Heckel DG, Bock R (2015) Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science 347:991–994. https://doi. org/10.1126/science.1261680 Zhao XY, Hong P, Wu JY et al (2016) The tae-miR408-mediated control of TaTOC1 genes transcription is required for the regulation of heading time in wheat. Plant Physiol 170:1578–1594 Zhao Y, Sui X, Xu L et al (2018) Plant-mediatedRNAi of grain aphid CHS1 gene confers common wheat resistance against aphids. Pest Manag Sci 74(12):2754–2760 Zhu X, Qi T, Yang Q, He F, Tan C, Ma W, Voegele RT, Kang Z, Guo J (2017) Host-induced gene silencing of the MAPKK gene PsFUZ7 confers stable resistance to wheat stripe rust. Plant Physiol 175:1853–1863 Zhu X, Qi T, Yang Q et al (2017) Host-induced gene silencing of the MAPKK gene PsFUZ7 confers stable resistance to wheat stripe rust. Plant Physiol 175(4):1853–1863 Zou J, Chang M, Nie P, Secombes CJ (2009) Origin and evolution of the RIG-I like RNA helicase gene family. BMC Evol Biol 9:85