Genetic Engineering and Cloning [1 ed.] 9789350433447, 9788183185066

Citation preview

f7~HI~ bt;IN~INt; ~I)

£Lt)NINt;

MOHAN P. ARORA M.SC., M.Phil., Ph.D., F.E.S.I., F.A.Z., F.A.S.E.A., AI.C.C.E.

[ First &tition 2006]

~ GJIimalaya CJlublishingCiflouse MUMBAI • DELHI • NAGPUR • BANGALORE • HYDERABAD

© No part of this book shall be reproduced or translated for any purpose whatsoever without permission of the publisher in wrilling.

ISBN: 978-81-83185-06-6 First Edition; 2006

Published by : Mrs. Meena Pandey For HIMAlAYA PUBLISHING HOUSE "Ramdoot", Dr. Bhalerao Marg, Girgaon, Mumbai - 400 004. Ph. : 23860170, 23863863 Fax: 022-23877178 Email: [email protected] Website: www.himpub.com Branch Offices: Delhi : "Pooja Apartments", 4-B, Murari Lal Street, Ansari Road, Darya Ganj, New Delhi - 110 002. Ph. : 011-23270392, Fax: 011-23256286

Nagpur : Kundanlal Chandak Industrial Estate, Ghat Road, Nagpur - 400 018. Ph. : 2721216, Telefax: 0712-2721215 Bangalore : No. 16/1 (Old 12/1), 1st Floor, Next to Hotel Highlands, Madhava Nagar, Race Course Road, Bangalore - 560 001. Ph. : 2281541, 2385461. Fax: 080-2286611 Hyderabad : No. 2-2-1 167/2H, 1st Floor, Near Railway Bridge, Tilak Nagar, Main Road, Hyderabad - 500 044, Ph. : 55501745, Fax: 040-27560041

CONTENTS 1.

1-19

INTRoDUcnON

Genetically Engineered Bacteria, Beneficial Bacteria, Harmful Bacteria, Applying Genetically Engineered Bacteria, Genetic Engineering of Plants, Protoplasts, Desirable Plant Traits, Genetic Engineering of Animals, Reproductive Technologies, Transgenic Animals, Introducing Genes into Animals, Chromosomal Integration of Foreign DNA, Gene Expression in Transgenic Animals, Applications of Genetic Technology, Cloning of Whole Organisms, Release of Genetically Engineered Organisms, Applications of Genetic Engineering, Commercial Possibilities, Uses in Research, Production of Useful Proteins, Genetic Engineering with Animal Viruses, Diagnosis of Hereditary Diseases, Genetic Engineering in Medicine, Somatostatin, Insulin, Human Growth Hormone, Human Growth Hormone Gene Expressed in Mice, Interferons, Blood Factor VIII, Hepatitis B Vaccine, Genetic Engineering in Agriculture, Plants with a Pesticide Gene, FrostRedUcing Bacteria, Genetic Engineering, Gene Isolation, Selection of Vector, Cloning of Desired Gene, Specific Gene Transfer, Expression of Desired Gene.

2.

20-35

INSTRUMENTATION

History of the PCR, Methodology of the PCR, Essential Features of the PCR, Design of Primers for PCR, DNA Polymerases for PCR, PCR in Practice, Optimization of the PCR Reaction, Analysis of PCR Products, Cloning PCR Products, Long-range PCR, Reverse-transcription PCR, Rapid Amplification of cDNA Ends (RACE), More Exotic PCR Techniques, PCR using mRNA Templates, Nested PCR, Inverse PCR. RAPD and Several other Acronyms, Applications of PCR, PCR Cloning Strategies, Analysis of Recombinant Clones and Rare Events, Diagnostic Applications.

3.

REsTRICTION ENn'MES IN CLONING

36-40

Restriction Enzymes, Type II Restriction Endonucleases, Uses of Restriction Endonucleases, Restriction Mapping, DNA Modifying Enzymes, Nucleases, Polymerases, Enzymes that Modify the Ends of DNA Molecule, DNA Ligase.

4.

RECOMBINANT

DNA

TECHNOLOGY

41-46

Electrophoresis, Purity and Concentration of Nucleotides, Spectroscopy, Gel Electrophoresis, Analysis by Blotting, Southern Blotting, Northern Blotting, Dot Blotting, Western Blotting.

5.

CLONING VECTORS

47 -73

Properties of a Good Vector, Properties of a Good Host, Plasmid Vectors, Host Range of Plasmids, Bacterial Transformation, Electroporation, Incompatibility of Plasmids, Purification of Plasmid DNA, Desirable Properties of Plasmid Cloning Vehicles; pBR322, a Purpose-built Cloning

Vehicle, Vectors Based on the Lambda Bacteriophage, Lambda Biology, In vitro Packaging, Insertion Vectors, Replacement Vectors, M~3 Vectors, Expression Vectors, Vectors for Cloning and Expression in Eukaryotic Cells, Yeasts, Mammalian Cells, Supervectors: YACs and BACs, Virus Vectors for Animal Cells, Advantages of Virus Vectors, Simian Virus 40 (SV40), SV40 as a Vector, COS Cells and SV40, Construction of SV40-Plasmid Vectors.

6.

74-82

ISOlATION

Lysing of Cells, Breaking up Cells and Tissues, Enzyme Treatment, Phenol-chloroform Extraction, Alcohol Precipitation, Gradient Centrifugation, Alkaline Denaturation, Column Purification, Detection and Quantification of Nucleic Acids, Gel Electrophoresis, Analytical Gel Electrophoresis, Preparative Gel Electrophoresis, Radiolabelling of Nucleic Acid, End Labelling, Nick Translation, Nucleic Acid Hybridization, Reverse Transcriptase or RNA Dependent DNA Polymerase, DNA ligases, Assay of DNA Ligase, Role of DNA Ligase.

7.

83-89

SEQUENCING

Sequencing, Sequence Analysis, Further Manipulation of the DNA Sequence, Is the sequence complete? What does it encode? What does this protein potentially look like? Some Useful Internet Addresses.

8.

90-101

SYNTHESIS OF GENE

Synthesis of RNA Chains Occurs in a Fixed Direction, DNA Dependent RNA Polymerase, Bacterial DNA-Dependent RNA Polymerase, Eukaryotic DNA Dependent RNA Polymerases, Nuclear Polymerases, Mitochondrial and Chloroplast RNA Polymerases, Prokaryotic RNA SynthesiS, Binding of RNA Polymerase to Prokaryotic Promoters, Formation of an Open Promoter Complex and the Initiation of RNA Synthesis, Elongation of RNA TranSCripts, Termination of Transcription in Prokaryotes, Independent Termination, Factor Dependent Termination, Eukaryotic RNA Synthesis, Initiation by RNA Polymerase II, Initiation by RNA Polymerase III, Initiation by RNA Polymerase I, Eukaryotic Factors, Transcription of Mitochondrial and Chloroplast Genes, RNA Polymerases and RNA Synthesis in DNA Viruses, RNA Bacteriophage, Eukaryotic RNA Viruses, Pi Carnarviruses, Rhabdovirus, Myxovirus, Reoviruses, Reteroviruses.

9.

102-111

GENE TRANSFER METHODS

Electroporation. Principle, Procedure, Applications, Microinjection, Microprojectile Shot Gun Method, Ultra Sonication, Use of Liposomes Forgene Transfer, Chemical Method of DNA Transfer, Use of Polyethylene Glycol, Transfection using Calcium Phosphate, Use of DEAE-Dextran, Use of Polycation-DMSO, Uptake of DNA by Bacterial Cells, Preparation of Competant E. coli Cells, In vitro Phage DNA into Bacterial Cells.

10.

SCREEMNG AND ANALYSIS OF RECOMBINANTS

112-123

Methods of Testing in Prenatal Screening, Non-invasive Testing Methods, Invasive Testing Methods, Sharing Diagnostic Information, Anencephaly and Spina Bifida, Maternal Serum Alpha-Fetoproteln, Newborn Screening, Carrier Screening, Detection of Autosomal Recessive Carriers, Restriction Fragment Length Polymorphisms and DNA Probes, Molecular Analysis of Huntington's Disease, Cystic Fibrosis, and Sickle-Cell Anemia, Restriction Fragment Length Analysis of the Human Growth Hormone Gene, Gene Probes for Haemophilia A, Gene Probes for Duchenne's Muscular Dystrophy.

11.

APpuCATION OF RECOMBINANT

DNA

TECHNOLOGY

124-151

Nucleic Acid Aequences as Diagnostic Tools, Detection of Sequences at the Gross Level, Comparative Sequence Analysis: Single-Nucleotide Polymorphisms (SNPs), Variable Number Tardem Repeat (VNTR) Polymorphisms, Forensic Applications of VNTRs, Historical Genetics, New Drugs and New Therapies for Genetic Diseases, Proteins as Drugs, Transgenic Animals

and Plants are Bioreactors: 'Pharming', Plants as Bioreactors, Impact of Genomics, Transgenic Animals as Models of Human Disease, Plant Breeding in the Twenty-first Century, Improving Agronomic Traits, Modification of Production Traits, Transgenic Organisms, Transgenic Plants, Why Transgenic Plants? Ti Plasmids as Vectors for Plant Celis, Making Transgenic Plants, Putting the Technology to Work, Transgenic Animals, Why Transgenic Animals? Producing Transgenic Animals, Applications of Transgenic Animal Technology. PRACTICALS

12.

ExTRAcnON OF NUCLEAR DNA

152-154

Safety Guidelines, Experimental Outline, Materials, Pre-lab Preparation, Method, Results.

13.

MITOCHONDRIAL ExTRAcrtON

155-160

Safety Guidelines, Experimental Outline, Materials, Pre-lab Preparation, Method, Isolation of Mitochondria, Assay of a Mitochondrial Marker Enzyme, Protocol Using Clinical Centrifuge Only, Results.

14.

ExTRAcnoN OF CYTOPlASMIC DNA

161-162

Safety Guidelines, Experimental Outline, Materials, Pre-lab Preparation, Method, Results.

15.

ExTRAcnON OF PlASTID

163-166

Safety Guidelines, Experimental Outline, Materials, Pre-lab Preparation, Method, Results.

16.

CEll ISOlATION

167-167

DNA Isolation, Equipment and Reagents, Method.

17.

DNA ExTRAcnON

168-169

From Single Celis Tissue, Equipment and Reagents, Method, DNA Extraction from Bulk Tissues, Equipment and Reagents, Method.

18.

DNA QUANTIFICATION

170-172

DNA Extraction and Quantification, Equipment and Reagents, Method, Fragmentation, Equipment and Reagents, Method, Ubrary Preparation, Equipment and Reagents, Method, PCR Amplification, Equipment and Reagents, Method.

19.

WHOLE CEll SEPARATION

173-174

Equipment and Reagents, Method, Amplification of Genomic DNA, Equipment and Reagents, Method. INDEX

175-179

"This page is Intentionally Left Blank"

1 INTRODUCTION Following the revolutionary developments in recombinant DNA technology and genetic engineering in the 1970s, interest turned to modifying microorganisms and multicellular plants 30d animals. Was it possible to use genetic technology to create new phenotypes with special capabilities that would benefit humans? For the most part, attention has been focussed on research with agricultural applications because of the enormous potential benefits for humankind. Astonishing changes in agricultural products are expected to occur during the 1990s. Genetic technology can be used to improve agricultural products in two general ways. First, new biochemicals can be created, using "standard" recombinant DNA (rDNA) technology, that will enhance the growth or survival of agricultural commodiaes. Vaccines, drugs, antiviral substances, food additives and growth hormones are examples of such chemicals. The importance of these products in agriculture cannot be over emphasized; for example, plant viral diseases cost U.S farmers over $2 billion a year and losses to animal viruses are even greater. There have already been some successes in this area. Antiviral treatment for serious viral diseases of economically important plants and animals have been or are being developed, and growth hormones have been used to help boost milk production in dairy

cows. A second approach involves altering the genetic material of agriculturally important microbes, plants and animals to produce new individuals or strains with enhanced biological aptitudes. Although the potential value of such organisms is incalculable, many technical difficulties must be resolved before significant advances can be expected. Paramount among these difficulties are the complexities involved in identifying genes and gene products that determine traits of interest and creating stable changes in the DNA of genetically engineered plants and animals. Nevertheless, since the mid-1980s, there has been a rapid awakening in recognizing the potential value of genetic engineering, not only in agriculture but also in research on disease, environmental science and fundamental molecular processes in plants and animals that are not yet understood. GENETICAllY ENGINEERED BACTERIA

The growth of important crops is infillenQt'Ci in nature by microorganisms in a number of different ways, both positive and negative. How can bacteria be modified to produce desired effects on plant growth and survival? Different strategies have been developed. For beneficial traits, a single gene or gene cluster is typically added to the genome in order to improve the microbe in some ways. For harmful bacteria (for example, those that cause a disease), one or more genes responsible for the undesirable trait may be removed. Examples of the genetic engineering of beneficial and harmful bacteria for agricultural uses will be considered.

2

Genetic Engineering and Cloning

Beneficial Bacteria Certain bacteria (Rhizobium spp.) can supply particular crop plants with nitrogen, a critical nutrient more commonly provided by expensive fertilizers in the United States. Plants cannot absorb nitrogen directly from the atmosphere and transform it into chemical forms they require. Industrial processes produce fertilizers with nitrogen in a usable form, and Rhizobium living in the soil in a symbiotic relationship with a limited number of plant species can also transform nitrogen into useful forms. Rhizobium forms nodules in the roots of legume plants such as peas, beans, peanuts, soybeans, clover and alfalfa, providing nitrogen to the plant and receiving nutrients in return. Since Roman times, farmers have exploited this relationship in order to increase soil fertility. Genetic engineers are attempting to identify and manipulate Rhizobium genes in order to create strains that will be more efficient in producing nitrogen or that will form associations with other plants. Since farmers spend over $1 billion a year just to fertilize com, the advantages of extending nitrogen-fixing abilities to other plants are obvious. Some bdcterial species are beneficial bec?tuse they protect plants from disease and from soils that are exceSSively acidic, salty or polluted with toxic levels of heavy metals. Others are able to break down harmful pesticides or kill weeds that compete for nutrients. As scientists learn more about the underlying mechanisms involved in such functions, it may become possible to produce microbes with improved capabilities in performing these operations. Hannful Bacteria Bacteria and other microorganisms cause diseases of agricultural plants and animals and make life miserable in other ways. How can a harmful bacterial trait be neutralized by genetic engineering? A faScinating example involves a bacterium, Pseudomonas syringae, that produces frost injury in susceptible crop species. AtmospheriC moisture condenses around dust particles, forming raindrops or snowflakes that then fall to the ground. This process is called nucleation becalAse the dust particle provides a nucleus for droplet formation. Similarly, ice forms through nucleation around a variety of particles, including certain bacterial species that live on plants. P syringae normally lives innocuously on many plants including potatoes and strawberries. However, at temperatures just above freezing, the bacteria nucleate ice crystals from water vapour in the air, and the resulting damage kills millions of dollars worth these crops every year. What accounts for this property? Why don't all bacteria cause such damage in frost-sensitive plants? Remarkably, the nucleation trait, called ice plus (lce+) was found to be caused by the protein product of a single gene in P. syringae. Codd genetic engineering be used to remove this gene? If so, would the new strain be able to colonize plants, survive and grow in a natural environment? Scientists cloned the nucleation gene, then deleted certain sections from it and finally exchanged the modified gene for the normal (lce+) gene in bacteria. The new strain, known as ice minus (lce-) was then tested in laboratory and field studies by spraying it on young potato plants. From this research, completed in 1988, it was concluded that the Ice- strain colonized plants and survived as well as Ice+ strains. In tests where an Ice- population first colonized a plant, Ice+ populations remained low. These results suggest that introducing Ice- strains into fields where commercial crops are grown may reduce damage caused by mild frost, if these strains replace or reduce Ice+ populations that cause nucleation. However, no final approval has yet been given for commercial applications of Ice-. Applying Genetically Engineered Bacteria Despite the potential benefits, the idea of applying genetically engineered microorganisms for agricultural purposes has been controversial. For example, the first proposal to field test Ice- strains of bacteria in small. expenmental fields of plants was submitted to the Recombinant DNA Advising Committee on September 17, 1982. The first authorized field studies were not conducted until April 24., 1987. In the Intervemng ftve years. there were numerous prcposal revisions, lawsuits, unauthorized testing, charges of data falSIfication. fines for procedural violations, restraining orders and other complications.

3

Introduction ~_;.;.;..:.;..::..;c:;.;..:.._...,

nucleation

:-,9ar-freezing temperature

.......

..J. ~

ice formation

I

r{

nucleating protein

_. t -

-dna

nucleating gene

_.

(a)

!

ice+

~

ice (b)

•

freezing temperature

. • .••..•

ice -

~ leaf surface

~ ice formation

leaf surface

••• ...

- .

nucleating gene

genetic engineering -

... •• ••• • • ••••

nucleating protein

..

freezing temperature

~ no ice formation

Fig. 1.1. A- "lee plus" strains of Pseudomonas bacteria that live on crop plants can nucleate water vapour present in the atmosphere. At near-freezing temperature, nucleation results in ice formation, which can result in front damage or death of the plant. B-By removing the nucleating gene from ·the bacteria, an "ice minus" strain is created that is no longer able to induce ice formation or cause this effect. C-In field experiments, leaves covered with ice plus bacteria froze while those with the genetically engineered ice minus strain did not freeze.

Why is there such controversy in this area? Answers to five questions provide a focus for considering the release of genetically engineered microorganisms. Will the altered microbe survive in the natural environment? Will it multiply? Will it spread to areas beyond the site of introduction? Can its altered genes be transferred to other species? Will the altered microbe or any species receiving its genes prove to be harmful? The general concern expressed by opponents of field testing with altered microbes is that dangerous new organisms might be released into the environment with a potential for causing harm. Proponents argue that a single or limited number of gene modifications are highly unlikely to result in the creation of a microorganism presenting any significant risk. No consensus on this subject has yet emerged among the public, although most scientists seem to favour the latter view. Geneti·:ally engineered microbes are not now projected to have significant roles in agriculture. However, one area of promise involves the development of microbial biological control agents that kill disease-carrying insects such as mosquitoes. Also, ruminants {animals such as cows and sheep} require microorganisms in their digestive tracts to ferment the forage they consume when grazing. It may be

4

Genetic Engineering and Cloning

possible to create microbes that would enhance the abilities of these animals to digest their food or even allow them to digest other plants that cannot be broken down normally. GENETIC ENGINEEmNG OF PlANTS

Plants and animals have been reproductively manipulated since the dawn of the agricultural age. At the simplest level, plants with desirable " production traits" (such as juiciness in fruits, high yields, resistance to disease) have been bred for centuries in attempts to establish varieties that produce offspring well endowed with the valued feature. This approach has a long record of success. For example, yields of corn and wheat crops have increased continuously over the past half century. However, the conventional selection methods used by plant breeders typically require years to achieve the desired result, and there appear to the limits on further progress using these techniques. Since DNA governs the expression of these desired ~haracteristics, genetic engineering may offer powerful opportunities for creating or amplifying production traits. The genetic engineering of plants involves two basic approaches, those that effect genetic changes through cell fusion and those that involve the insertion or alteration of genes in cells. The second approach is similar to the methods of rONA described for microorganisms, with one important conceptual distinction. For microbes, genetic changes are made at the cellular level, whereas for crops, changes at the cellular level must usually be reproduced stably into every cell of the plant (and its offspring) if they are to be of value. The ultimate goal of these technologies is to increase productivity significantly through a variety of means. Protoplasts A number of methods have been developed to facilitate gene transfer in plants. Protoplasts are plant cells that have had their outer cell wall removed by digestion with certain enzymes. Protoplasts of some species have developmental totipotency, the potential to regenerate a whole plant from a single cell. In genetic engineering, foreign DNA can be introduced into these "naked" cells to create new plant varieties or even species. Different methods are used to insert DNA into protoplasts: (i) two

I" -------ilUlimnmtinlilt ..........

...•.. -------. ••••••••• ~

• •••• ••••• • protoplasts

•••

'r\'--: ... ~

~

protoplasts from another variety

fused hybrid protoplast

cell wall regenerates and acallus forms

release of protoplasts from leaf cells

regeneration of hybrid plantlets

Fig. 1.2. Protoplasts (plant ceIl without the surrounding ceIl waIl) from species can be isolated or fused with a protoplast from a different species and then cultured.

5

Introduction

protoplasts from two different plant spe"ies may be stimulated to fuse and form a somatic-cell hybrid in a process called protoplast fusion; (ii) DNA may be introduced by a disease-causing cloning vector or (iii) most commonly, DNA segments are introduced into protoplasts by chemical, electrical or mechanical procedures. Genetically altered or unaltered protoplasts can be grown in media containing nutrients, vitamins and plant growth hormones to form a mass of unspecialized cells called a callus. The callus is then induced to develop into an entire plant by exposing it to appropriate hormones. Unaltered protoplasts and calluses of petunias, tobacco, tomatoes and carrots have regenerated into whole plants. However, this process has only recently been used successfully for some of the most important crop species such as legumes and cereals. One curious plant, which resulted from the experimental fusion of potato and tomato protoplasts, illustrates the scatter-shot nature of the process. The hybrid was called a Upomato." In the best of worlds, the pomato would have had the tuber of a potato and the fruit of a tomato. Alas, it turned out to be an unattractive, amorphous vegetable with no delectable properties. However, this work had value because it demonstrated that protoplast fusion could be used to produce plants with new genetic combinations. Though the future importance of the protoplast fusion technique is uncertain, it could prove to be an important procedure in some cases. Agrobacterium tumefaciens For successful genetic engineering, plant geneticists must be able to insert genes into a plant's genetic material. Remarkable progress has been made in this area. Recombinant DNA methods can be used for cloning plant genes, although it has often been difficult to identify specific DNA segments harboring genes of importance. To introduce foreign DNA or genes, a unique, natural cloning vector has been used. Most transgenic plants (those containing genes from a different species) produced so far were created using an Agrobacterium system. Agrobacterium tumefaciens is a bacterial species that normally lives in the soil. However, it can infect plant tissues exposed by wounds and cause a harmful tumorous enlargement called a crown gall that grows at the site of invasion. Research has revealed that the agent responsible for inducing these tumors is a large plasmid called the Ti (Utumor-indicing") plasmid, harbored by the bacterium. A. tumefaciens has the ability to transfer a DNA segment called the T-DNA from the Ti plasmid directly into the plant cell's chromosomes. The T-DNA encodes enzymes for the production of different amino acids and hormones that redirect normal plant cell growth patterns and eventually cause the tumors. Species of Agrobacterium can infect and induce tumors in a large number of plants. Gene to be cloned is inserted into T-ONA of a modified Ti plasmid Tral"~formed

plant cell

chromosome chromosome

Fig. 1.3. Crown gall and Agrobaclerium cumejaciens.

Gene to be

T-ONA

6

Gen,tlc Engineering and Cloning

Molecular biologists have been successful In removing crown gall-Inducing genes from plasmid T-DNA, IMSfritng beneficial genes from other species in place of those genes and transferring the new combination of genes into the chromosomes of different plants. In the first successful experiment with A. tume/aclens. a bacterial gene conveying resistance to an antibiotic was introduced into a petunia. The petunia became resistant to the antibiotic and some of Its offspring were also resistant. The Importance of this finding is that an introduced gene became a stable trait that was inherited according to Medelian expectations.

Desirable Plant Traits A number of other experiments have been conducted to examine the prospects for successfully introducing genetically engineered traits into plants that would lead to improvements in producing crops. What types of genetically determined traits would be associated with increased crop production? To date, four traits have received considerable attention-insect resistance, disease resistance, biological efficiency (for example, increased photosynthesis) and weed control. Plants are constantly under attack from herbivorous insects. Billions of dollars are spent yearly on chemical pesticides to manage agriculturally important insect pests. Might some other control strategy be possible? Many years ago, a bacterium, Bacillus thuringiensis, was found to produce a protein that was lethal to the larvae of moths and butterflies and a few other insects that consume plants. This substance has no effect on other organisms, including beneficial adult insects, animals or humans. The genes that encode the toxic protein were inserted into tomato, tobacco and cotton plants .. Field tests using the transgenic tomato and tobacco plants indicated a high level of insect control. In one experiment, tomato plants with the B. thuringier,sis genes suffered no damage from insects while control plants without B. thuringiensis genes were destroyed by insects. These results indicate a promising commercial future for the B. thuringiensis system and perhaps for other insecticidal genes. Genes for resistance against a broad spectrum of viruses have been successfully transferred into a range of plants. Transgenic tomato, tobacco and potato plants have been created that are resistant to numerous plant virus diseases. Resistance to viruses could greatly increase the production of important crops such as wheat, com, rice and soybeans. As all gardeners come to realize, weeds compete with economically important crops for space, nutrients and other soil resources. To combat undesirable plants, chemical herbicides (substances that kill plants) are widely used in agriculture. Unfortunately, prodUcing herbicides that kill weeds but not desired plants is an expensive proposition. Attempts to produce transgenic plants that are resistant to herbicides have had some success. For example, in 1990, fertile com plants were produced that contained a gene making them resistant to a specific chemical herbicide (Bialaphos). Spraying herbicides over fields with resistant crops would allow for more effective and less costly weed control but might also promote the use of herbicide chemicals in agriculture, a controversial prospect. Although a few herbicide-resistant plants have already been developed, prospects for their production and use in the future are clouded by the herbicide chemical question. Plant ·geneticists also hope to increase the photosynthetic proficiency of plants, which could result in increased crop yields without an increase in fertilizer requirements. Gene transfer in plants has become a fertile field of genetic engineering and despite some nasty technical obstacles, the future seems very promising. Agricultural scientists now expect that many genetically engineered crops, including com, soybeans, rice, cotton, s~sar tieets and tomatoes may reach the market by the mid1990s.

Problems A number of complex scientific problems have arisen in attempts to create new plants or plants with enhanced capabilities through genetic engineering. Many of the desirable properties, such as the ability to fix nitrogen. produce higher levels of plant growth hormones, or resist disease, heat and

7

Introduction

cold, are determined by the interactions of many genes. For such traits, It is difficult to Identify all of the relevant genes or gene products or to transfer such genes from one plant to another. Even for characteristics determined by a single gene, there are a number of obstacles to overcome. Most of the genetic engineering achievements to date have been confined to dlcots, flowering plants such as tomatoes, potatoes and petunias. With monocots, the group that includes the plants of greatest economic importance (for example, cereal grains such as wheat, barley, oats, rice and maize), there have been very few successes, for two primary reasons. With the exception of rice and maize, protoplasts obtained from most monocots have not regenerated into whole plants and the T-DNAA. tumefaciens vector system does not generally infect monocots. Recently, however, researchers successfully transferred a foreign gene into maize ("Indian corn"), a major cereal crop, using T-DNA. The cloned, recombinant DNA (gene) was transferred by the plasmid vector into maize protoplasts that were subjected to an electric field. Only a few (usually 1 percent or less) of the transformed protoplasts regenerated and none have been fertile. Mechanical procedures such as use of a "particle gun" (a device used to "shoot" small metal particles with DNA on their surface directly into a cell) have also been used successfully in introducing DNA into monocots. The results of these efforts are encouraging. Genes have been transferred to a cereal plant and pending resolution of the low generation rates and fertility problems, neither of which are thought to be insurmountable, this important class of crop plants may soon become a full participant in the current blossoming of plant genetic engineering. GENETIC ENGINEERING OF

ANIMALs

Commercially important animals in agriculture (cows, pigs, goats, sheep and poultry), like plants, have benefitted to some degree from the products of rONA technology such as vaccines and growth hormones. Unlike plants, whole animals cannot be regenerated from a single somatic cell that has been extracted and manipulated genetically. Only a zygote, formed at fertilization by the fusion of gametes, normally has the capacity to develop into a whole animal. For a foreign gene to be incorporated into all cells of an animal (and their offspring), it must be introduced into a sperm or an egg cell or the zygote. Although the esoteric genetic technologies have not yet been applied to farm animals on a broad scale, momentum is increasing. Also, a number of interesting reproductive technologies have already been developed that resulted in genetic improvements in livestock. Reproductive Technologies Reproductiue Technologies basica!l;,: involve controlled breeding or the direct manipulation of sex cells. Success in these areas depends on the selection of animals that have desirable, heritable traits. For beef cattle, such traits include lean steaks, high birth rate or high fertility. By successively breeding superior animals with respect to a heritable trait, there is a continuous improvement in the generntions that follow. To illustrate the power of this approach, consider that during the past three decades, the average milk yield of cows has more than doubled, while the number of dairy cows has been reduced by more than 50 percent. A somewhat more radical example involves turkeys. In the United States, there has long been heavy selection for big-breasted commercial turkeys. This trait has become so pronounced that commercial turkeys can no longer breed naturally; the big-breasted males are physically incapable of mounting a female! Artificial insemination, the manual placement of sperm into the female reproductive tract, is now the sole means of producing commercial-grade turkeys. In addition to artificial insemination, which makes use of sperm from exceptional males, a number of other reproductive technologies for livestock have been developed. Many of these involve increasing the number of eggs produced by females to form a greater number of embryos during each reproductive cycle. Excess embryos can be removed from one animal and transferred to another (perhaps in a different parts of the world). and some are stored for future use. The most notable advances in this

Genetic Engineering and Cloning

8 Prize cow provides donor embryo

J I Cells develop into embryos. Some embryos may be 'transplanted into surrogate mothers (one or two per cow). while other are frozen for later use.

Cells separated

~~~ \ \ \ (i) (j) .~ E_~

o, ((ij/ ~!~,J /

I

,

J

I

. ....

.~

After a normal pregnancy. the surrogate cows give birth to genetically identical caives

The cloning process can be repeated with subsequent generations using the same genes each time so that offspring are genetically identical to their ancestors .

Fig. 1.4. Using cloning technology, herds throughout the world can be improved. These embryos can be transplanted into surrogate mothers, where they develop normal/y.

area took place in the late 1980s, when a prototype method for cloning cattle and sheep embryos was developed. The cloning method proceeds (ideally) according to the follOWing sequence: (il cells of

Introduction

9

developing embryos are separated at an early stage; (ii) each of the separated cells develops into an identical embryo; (iii) the embryos are placed into surrogate mothers, where they develop until bil1h. The early results are promising, but much further research is necessary before the cloning methods can be routinely applied in agriculture.

Transgenic Animals Scientists began to develop techniques for inserting foreign genes into higher antimals in the late 1970s. Not until the early 1980s were the first successful gene transplant experiments carried out. The introduction of foreign genes into the germ cell lines (fertilized eggs or embryos) of mammals is one of the most significant advances in the revolutionary field of genetic engineering. Embryos that integrate genes or DNA from a different species into their chromosomes may subsequently develop into transgenic animals. Transgenic mice have been used in a number of fruitful studies that have offered unprecedented insights into the ways in which DNA controls embryonic development and the functions of cells in the organisms. The transfer of foreign genes into somatic (body) cells of adult organisms is not yet an established technology. For a transgenic experiment to be a success, the following events should occur: (i) genes inserted by the vector must be integrated into the host genome, (ii) the encoded protein must be produced in specific tissues and be fully functional and (iii) any activities required to make the protein operate normally must take place (for example, molecular modifications or transport to a specific cellular site).

Introducing Genes into Animals Several experimental techniques were developed to introduce new genes into the chromosomes of mice, and recently these techniques have been extended to domestic animals. Most often, these genes were not of importance to the species but were selected because they or their encoded products, could be identified after chromosomal integration into a host to determine if the process had worked. Two techniques have been used for introducing genes into animals-virus vectors and microinjection. In using virus vectors, a foreign gene is incorporated into the viral genome, the virus is injected into an embryo, and if successful, the new gene becomes integrated into the host chromosome and the encoded protein is produced in the resulting offspring. Microinjection is the technique of inserting cloned genes or DNA strands generated by rDNA techniques into fertilized eggs or cells of an embryo using finely engineered instruments. It has been the most widely used method for creating transgenic animals. Using this procedure, between 100 and 30,000 foreign gene copies are introduced into the nucleus of a fertilized egg or into cells of a developing embryo. In a typical experiment, the injected zygote or embryo is implanted into a foster mother and allowed to develop. After birth, the offspring is subjected to specialized analyses to determine whether or not the microinjected gene became integrated.

Chromosomal Integration of Foreign DNA Usually, 10 to 30 percent of the microinjected eggs survive and develop into offspring, although higher percentages have been obtained in recent experiments. The proportions of offspring that have integrated the foreign gene has been highly variable, ranging from a few to as high as 40. percent. Some generalizations can be drawn from animal studies conducted to date: (i) the foreign gene is usually integrated into only one of the two homologous chromosomes, (ii) the number of genes integrated varies from a few to hundreds and (iii) the foreign gene is integrated into both somatic cells and gametes, eggs or sperm of the offspring. Consequently, the gene can be transmitted as a stable Mendelian trait.

Gene Expression in Transgenic Animals In an ideal experiment, the integrated gene would be expressed in a predictable and tissuespecific manner. For example, if a foreign gene from a rat encodes an enzyme normally produced in the liver, certain levels of the same enzyme would be expected in a transgenic mouse receiving the

10

GenetIc EngIneerIng and ClonIng

gene. Further, synthesis of the enzyme would be under ho:.t regulatory control and be produced by liver cells, not cells of the brain or muscle. That would Indicate that the gene had been Integrated and was operating normally. In the early studies, there was often very little evidence of regulated or tissuespecific expression of the inserted gene. However, these criteria have been satisfied in an increasing number of transgenic mouse experiments. Some examples of the successful expression of genes include insulin, a muscle protein, many immune molecules and certain enzymes and hormones.

Applications of Genetic Technology IntrodUcing foreign genes and having them expressed in recipient mammalian hosts is rapidly becoming a routine procedure. In addition to mice, fertilized eggs of rabbits, sheep and pigs have been microinjected with genes. Although transgenic technology seems to have more potential for improving plants than live-stock, there is considerable optimism about future applications in animals. There is also great promise for using transgenic technology to study both animal and human diseases, since many disorders trace their roots to the synthesis of aberrant proteins or the production of abnormal concentrations of normal proteins. Certain cancers and immune deficiencies are examples of diseases that lend themselves to study. The ability to insert genes and follow their integration and expression constitutes an extraordinarily powerful tool for learning more about fundamental biological processes. Nevertheless, such a capability has raised concerns among certain sector!> of lhe general public about scientists trespassing into areas where they may not belong.

Problems Before genetic engineering of animals can be a reality, progress must be made in several areas. The regulation and expression of genes must be better understood. Ways must be devised to control where genes are inserted into chromosomes. The complexity of traits determined by multiple genes (probably the rule for most animal characteristics of economic importance) must be unraveled. Gene identification is a serious problem in the genetic engineering of mammals; of the 100,000 or so expressed genes, the protein products of only about 1,000 have been identified. Because of these information gaps, molecular manipulations are not expected to play a Significant role in improving livestock for at least several years. CLONING OF WHOLE ORGANISMS

In the 1980s, a number of popular books were written that gave a new meaning to the term cloning. Rather than being limited to describing identical cells or molecules derived from a single ancestral cell or molecule, cloning was used to describe the production of humans from a single cell of a famous ancestor. These fictional clones were genetically identical to their illustrious father. This prospect confirmed the worst fears of certain people about genetic engineering and the road now being travelled by modern researchers. Educated citizens, however, with an ingrained skepticism about such "scientific" accounts, will demand an answer to the question, Can multicellular organisms including humans, be "cloned" from single cells? Gardeners and plant breeders have cloned plants by cutting and grafting various pieces onto recipient plants. Also, many plants reproduce sexually, which gives rise to identical progeny. Using the restricted definition-whole organisms from a single cell-some plants have been cloned by techniques already described. Thus for plants, the answer to the question is frequently yes. For higher animals, the answer to the question is, so far, generally no. In contrast to plants, very few animals reproduce asexually. To clone an animal-that is, to make an identical copy of one parent-it is necessary to remove the nucleus of a fertilized egg and replace it with the nucleus obtained from the individual to be cloned. Numerous experiments of this sort have been done with frogs. When the transplanted nuclei came from very early frog embryos, identical adult frogs developed; that is, if the nuclei of eight cells from a single embryo were injected into eight separate eggs, eight

11

Introduction

Identical frogs were produced. However, no frog has ever been cloned when the transplanted nuclei came from cells of an adult frog. Thus for frogs, It appears that once embryonic development progresses to a certain stage, the cells lose their ability to give rise to an entire organism. Experiments done with mammals offer little reason to believe that whole-organism cloning will soon be possible. As usual, there are a number of technical problems. Mammalian eggs are so small that manipulations involving nuclei are extremely difficult without causing damage. Also, little is known about embryonic developmental pathways at the molecular level and the importance of nuclear or cytoplasmic factors. To date, no reproducible experiment has shown that a mammal can be cloned by transplanting the nucleus from any single cell. Thus for technical reasons alone, the likelihood of egocentric billionaires or demented dictators leaving clones of themselves is remote. RELEASE OF GENETICALLY ENGINEERED ORGANISMS

The fundamental question of whether or not to release new strains of genetically altered microorganisms, plants and animals into the natural environment is still being debated. The case involving ice minus bacteria was considered earlier in this chapter. What about regulating the introduction of modified plants and animals that could provide important new food resources for humankind? Progress in the science of producing such organisms has exceeded our ability to establish an appropriate decision-making process. Several non-technical obstacles remain that must be addressed before genetically engineered plants and animals will become common. For example, biotechnology businesses feel that there is a critical need to set up an approval process that is straightforward and allows for the rapid change from field tests to full-scale market production of a new food commodity. Also, companies will insist on patent protection-court decisions have ruled that genetically engineered organisms can be patented-in order to recover their costs in developing new organisms. Yet problems in applying these legal decisions to all aspects of prodUcing such organisms have not been resolved completely. What about potential risks to the environment posed by genetically engineered organisms? In 1989, the Ecological Society of America published a special review article in the journal Ecology that considers this question. Recommendations from this prestigious scientific SOCiety are expected to influence the development of regulations in this area. The major points expressed in the publication were these: 1. The authors "support the timely development of environmentally sound products, such as improved agricultural varieties, fertilizers, pest control agents and microorganisms for waste treatment" that do not compromise "sound environmental management." 2. They "support and will continue to assist in the development of methods for scaling the level of oversight needed for individual cases according to objective, scientific criteria, with a goal of minimizing unnecessary regulatory burdens." 3. "Genetically engineered organisms should be evaluated and regulated according to their biological properties (phenotypes) rather than according to the genetic techniques used to produce them." 4. The tissues that must be considered before releasing such organisms into the environment "include survival and reproduction of the introduced organism, interactions with other' organisms in the environment, and effects of the introduced organism on ecosystem function." The ESA also recommended procedures for regulatory approaches and suggested that instead of the present case-by-case review for each new product, it may become possible to use a generic approval process depending on the level of risk as determined by several criteria (for example, nature of the genetic alteration, genetic stability of the alteration and survival under adverse conditions). Progress in creating genetically engineered organisms with special attributes is expected to continue at a swift pace. This subject is frequently discussed in editorials and the science sections of most major newspapers and newsmagazines. We encourage you to follow new developments in this field by reading such articles.

12

Genetic Engineering and Cloning A,pPUCATIONS OF GENETIC ENGINEERING

Recombinant DNA technology has revolutionized modem biology. Its main uses at the present time are (i) efficient production of useful proteins, (ii) creation of cells capable of synthesizing economicaly important molecules, (iii) generation of DNA and RNA sequences as research tools or in medical diagnosis, (iv) manipulation of the genotype of organisms such as plants and (v) potential correction of genetic defects in animals, including human patients (gene therapy). Some examples of these appncations follow.

Commercial Possibilities . Cells with novel phenotypes can be produced by genetic engineering, sometimes by combining the features of several different organisms. For examples, genes from different bacterial species that can metabonze some components of petroleum have been inserted into a plasmid and used to transform a species of marine bacteria, yielding an organism capable of metabolizing petroleum for use in cleaning up oil spills in the oceans. Many biotechnology companies are at work designing bacteria that can synthesize industrial chemicals or degrade industrial wastes. Bacteria have been designed that are able to compost waste more efficiently and to fix nitrogen (to improve the fertility of soil), and a great deal of effort is currently being expended to create organisms that can convert biological waste into alcohol. A number of medicinally or commercially important molecules are routinely produced in genetically engineered cells. For example, human insulin and growth hormones are produced in bacteria. Altering the genotypes of plants is an important application of recombinant DNA technology. By such means, it is possible to transfer genes from one plant species to another. These include genes affecting yield, hardness or disease resistance. There are also attempts to alter the surface structure of the roots of grains such as wheat, by introdUCing certain genes from legumes (peas, beans), to give the grains the ability that legumes possess to establish root nodules of nitrogen-fixing bacteria. If successful, this would eliminate the need for the addition of nitrogenous fertilizers to soils where grains are grown. The first engineered recombinant plant of commercial value was developed in 1985. An economically important herbicide is glyphosate, a weed killer that inhibits a particular essential enzyme in many plants. However, most herbicides cannot be applied to fields growing crops because both the crop and the weeds would be killed. (The chlorinated acids that selectively kill dicot plants but not the grasses such as maize and cereals are out of favour because of their persistence in soil, toxicity to animals and possible carcinogenicity in human beings.) The target gene of glyphosate is also present in the bacterium Salmonella typhimurium. A resistant form of the gene was obtained by mutagenesis and growth of Salmonella in the presence of glyphosate. Then the gene was cloned in E. coli and recloned in the T DNA of Agrobacterium. Transformation of plants with the glyphosate-resistant gene has yielded varieties of maize, cotton and tobacco that are resistant to the herbicide. Thus, fields of these crops can be sprayed with glyphosate at any stage of growth of the crop. The weeds are killed but the crop is unharmed. Genetic engineering can also be used to control insect pests. For example, the black cutworm causes extensive crop damage and is usually combatted with noxious insecticides. The bacterium Bacillus thuringiensis produces a protein that is lethal to the black cutworm, but the bacterium does not normally grow in association with the plants that are damaged by the worm. However, the gene coding for the lethal protein has been introduced into the soil bacterium Pseudomonas flurescens, which lives in association with maize and soybean roots. Inoculation of soil with the engineered P. fluorescens helps control the black cutworm and reduces crop damage. Uses in Research Recombinant DNA technology has become an essential research tool in modem molecular genetics. Reverse genetics makes it possible to isolate and alter a gene at will and introduce it back into a living cell or even the germ line. Besides saving time and labor, reverse genetics enables the construction of

Introduction

13

mutants that cannot in practice be formed in any other way. An example is the formation of double mutants of animal viruses, which undergo crossing-over at such a low frequency that mutations can rarely be recombined by genetic crosses. The greatest effect of recombinant DNA on basic research has been in the study of eukaryotic gene regulation and development, and many of the principles of regulation and development summarized.

Production of Useful Proteins Among the most important applications of genetic engineering is the production of large quantities of particular proteins that are otherwise difficult to obtain (for example, proteins of which there are only a few molecules per cell or that are present in only a small number of cells or only in human cells). The method is simple in principle. A DNA sequence coding for the desired protein is cloned in a vector adjacent to a bacterial promoter. This step is usually done with cDNA because cDNA has all the coding sequences spliced together in the right order. Using a vector with a high copy number ensures that many copies of the coding sequence will present in each bacterial cell, which can result in synthesis of the gene product at concentrations ranging from 1 to 5 percent of the total cellular protein. In practice, production of large quantities of a protein in bacterial cells is straightforward, but there ate often problems because many eukaryotic proteins are unstable, do not fold properly or fail to undergo necessary chemical modification in bacterial cells. Several approaches to solving these problems have been taken with some degree of success. One approach uses a plasmid containing the E. coli lac region, cleaved in the lacZ gene by a restriction enzyme that makes blunt ends. Either cDNA or a synthetic DNA molecule that codes for the desired amino acid sequence is inserted into the lacZ gene, so that the eukaryotic protein is syntheSized as the terminal region of b-galactosidase, from which it can be cleaved. The first example of this approach resulted in a synthetic gene capable of yielding a 14-reside polypeptide hormone-somatostatinwhich is synthesized in vivo in the mammalian hypothalamus. The procedure, applicable to most short polypeptides, was the following. By chemical techniques, a double-stranded DNA molecule was synthesized containing 51 base pairs; and the base sequence of the coding strand wasTAC-(42 bases encoding somatostatin)-ACTATC. The vector was the plasmid pBR322, modified to contain the lac promoter-operator region and a part of the lacZ gene coding for only the amino-terminal segment of b-galactosidase. The vector was cleaved at a site in the lacZ segment by a restriction enzyme that leaves blunt ends and the synthetic DNA molecule was ligated to the cleaved plasmid. The AUG linking the lacZ coding sequence with that of somatostatin was not used for initiation; rather, it specified an internal methionine. The mRNA terminated with two stop codons, UGA and UAG. The protein produced from this mRNA consists of the amino-terminal segment of b-galactosidase coupled by methionine to somatostatin. The protein was purified and treated with cyanogen bromide, a reagent that cleaves proteins only at the carboxyl side of methionine. In this way, the methionine linker remained attached to the ~-galactosidase fragment and the somatostatin was released and could be purified. Use of a methionine linker followed by cleavage with cyanogen bromide is a useful technique for separating any short polypeptide that does not itself contain methionine. Other linkers and cleavage reagents can be used for polypeptides that do contain methionine. Proteins that do not fold or become modified properly in bacterial cells can also be produced in genetically engineered cells of yeast or any other suitable eukaryote. Taking yeast as an example, one procedure uses a genetically engineered plasmid called a shuttle vector containing sequences from both E. coli and yeast and capable of undergOing replication and segregation in both organisms. Cloning is done in E. coli because it is easier than in yeast for a variety of technical reasons, and then the plasmid is isolated and transferred to yeast for expression of the cloned gene. In yeast or mammalian cells, the protein-folding and processing problems are sometimes substantially reduced or eliminated.

14

Genetic Engineering

and Cloning

Genetic Engineering with Animal Vlruse. Genetic engineering of animal cells often makes use of tetrovlruses because their reverse transcriptase makes a double-stranded DNA copy of the viral RNA genome, which then becomes Inserted Into the chromosomes of the cell. DNA-to-RNA transcription occurs only after the DNA copy is inserted. The infected host cell survives the infection, retaining the retrovlral DNA in its genome. These features of retroviruses make them convenient vectors for the genetic manipulation of animal cells, including those of birds, rodents, monkeys and human beings. Genetic engineering with retroviruses allows the possibility of altering the genotype of animal cells. Because a wide variety of retroviruses are known, including several that infect human cells, genetic defects may be corrected by these procedures in the future. However, many retroviruses contain a gene that results in uncontrolled growth of the infected cell, thereby causing a tumor. When retrovirus vectors are used for genetic engineering, the tumor-causing gene is first deleted. The deletion also provides the space needed for incorporation of foreign DNA sequences. The recombinant DNA procedure employed with retroviruses consists of synthesis in the laboratory of double-stranded DNA from the viral RNA, through use of reverse transcriptase. The DNA is then cleaved with a restriction enzyme and by the techniques already described, foreign DNA is inserted. Transformation yields cells with the recombinant retroviral DNA permanently inserted into the genome. In this way, the genotype of the cells can be altered. For example, human cells from patients with Lesch-Nyhan syndrome are deficient in the synthesis of purines because they lack the enzyme HPRT. These cells can b~ converted to produce HPrT in vitro by transformation with recombinant DNA with the use of retrovirus vectors. The exciting potential of this technique lies in the possibility of correcting genetic defects-for example, restoring the ability of a diabetic person to make insulin or correcting immunological deficiencies. This technique has been termed gene therapy. However, a number of major problems stand in the way of gene therapy becoming a practical technique in medicine; for example, there is no reliable way to ensure that a gene will be inserted in the appropriate target cell or target tissue, and there is as yet no reliable means to regulate the expression of the inserted genes. A major breakthrough in disease prevention has been the development of synthetic vaccines. Production of certain vaccines, such as anti-hepatitis B, has been difficult because of the extreme hazards of working with large quantities of the active virus. The danger is prevented by cloning and producing the viral antigen in a non-pathogenic organism. Vaccinia virus (the anti-smallpox agent) has been very useful for this purpose. VIral antigens are often on the surface of virus particles and some of these antigens can be engineered mto the coat of vaccinia. For example, engineered vaccinia with surface antigens of hepatItis B, influenza virus and vesicular stomatitis virus (which kills cattle, horses and pigs) have produced useful vaccines in animal tests. A surface antigen of Plasmodium falciparum, the parasite that causes malana. has also been placed in the vaccinia coat, and this may lead to an anti-malaria vaccine.

Diagnosis of Hereditary Diseases Probes derived by recombmant DNA methods are widely used in prenatal detection of disease; for example, in detecting cystic fibroSIS. Huntington disease, sickle-cell anaemia and many other genetic disorders. In some cases, probes denved from the gene itself are used and, in other cases, restriction fragment polymorphisms genetically linked to the disease gene are employed. If the disease gene itself, or a region close to it in the chromosome differs from the normal chromosome in the position of one or more cleavage sites for restnctlon enzymes, then these differences can be detected with Southern blots, with the use of cloned DNA from the r~gion as the probe. The genotype of the foetus can be determined from the restriction fragments present in its DNA. These techniques are very sensitive and can be carried out as soon as tissue from the foetus-or even from the placenta-they can be obtained.

Introduction

15 GENETIC ENGINEERING IN MEDICINE

To date, scientists have cloned recombinant DNA plasmids using a wide variety of species as a source of DNA. Species used as DNA sources Include humans, rabbits, chickens, mice, fish, frogs, flies, plants, yeast and bacterial viruses. DNA taken from the extinct woolly mammoth, an Egyptian mummy and a museum specimen of the extinct quagga (a zebra like animal) has also been used. The information gained by creating recombinant plasmids and by studying the closed sequences of DNA from the various species will be used for the benefit of humankind in problem areas of disease control, inheritable birth defects, energy resources, plant and animal productivity and in a wide variety of commercial and health-related industries.

Somatostatin Somatostatin is a hypothalmic hormone, fourteen amino acids in lengths. Its function is to inhibit the release of insulin and human growth hormones from the human pituitary gland. Somatostatin produced by the cloned synthetic human gene was identical to the natural hormone. Each E. coli cell produces about ten thousand somatostatin molecules. Prior to successful recDNA production, the hormone was obtained from sheep brain. One milligram of the hormone was extracted from 500,000 sheep brains; the same amount was extracted from a four-litre culture of recombinant E. coli cells.

Insulin Insulin is used to treat insluin-dependent diabetes. It is made up of fifty-one amino acids arranged in an A chain of twenty-one amino acids and B chain of thirty amino acids. These chains are held together by disulfide cross-linkages. As in the case of somatostatin, synthetic "genes" were produced by knowing the amino acid sequence of the A and B chains. Each "gene" was inserted into its own pBR322 plasmid, and the plasmids were then inserted into E. coli. After separate A and B polypeptides were produced, they were harvested and purified. Prior to recDNA-produced insluin, the only source of insulin was the pancreas of pigs and cows. Insulin (Humulin) is the first of a number of products of recombinant DNA technology to reach the commercial market. It was approved for medical use in humans in 1982. Human Growth Honnone There are many causes of short stature, but only short stature due to hyposomatotropism (too little somatotropin) is treatable with human growth honnone (HGH), a polypeptide of 191 amino acids. At least 3,500 children and adolescents in the country have a pituitary gland that does not secrete sufficient amounts of growth hormone. Without treatment, affected individuals would only grow to about four feet. Until recently, children with the disorder have been treated with hormone extracted from human pituitary glands, which, if given early enough, enables them to grow to about normal height. Because of the short supply of the hormone, however, once a male reached the height of five feet, six inches and a female five feet, four inches, treatment was stopped. Normally, about fifty thousand human pituitary glands are processed annually to provide sufficient growth hormone for affected children. However, in the spring of 1985, growth hormone deficient children faced a crisis. Growth hormone extracted from cadavers (dead bodies) was contaminated with a virus that causes Creutzfeldt-Jakob disease, a rare brain infection. Fortunately, recDNA human hormone was available and was given FDA approval for marketing as Protropin. Protropin is produced in a procedure similar to that used in the production of somatostatin and insulin. It is the second recDNA product to be approved for commercial use. Human Growth Honnone Gene Expressed in Mice Prior to the production of Protropin, Richard Palmiter and colleagues (1983) fused the human growth hormone gene with the promoter or regulatory region of the mouse gene for methallothionein1. The plasmid pBR322 was used to carry the fused human-mouse DNA (genes) into E. coli for cloning. Multiple copies of the fused human-mouse "gene" DNA were micro-injected mto fertilized

16

Genetic Engineering and Cloning

mouse eggs. Seventy percent of the mice that incorporated the fused DNA into their chromosomes produced high levels of the human growth hormone (HGH) and grew Significantly larger than the control, or noninjected mice. Mice that accept foreign DNA via microinjection are referred to as transgenic mice. The recDNA HGH-mouse DNA was expressed in all mouse tissue tested, but the amount produced varied with tissue type. This suggests that the expression of the HGH DNA is influenced by environment and perhaps its location within the mouse DNA. Parallel studies by this research group demonstrated that the rapid growth phenotype of transgenic mice is transmitted into the next generation and that all mice that inherit the fused HGH-mouse gene grow two or three times faster than mice that do not inherit the gene.

Interferons Interferons (INFs) are small proteins produced by eukaryotic cells in the presence of viruses or certain chemicals. All living cells of an organism, including differentiating cells like those of the brain and the immune system, are able to produce interferons. Currently, interferon research is so diversified that it is difficult to list all the human diseases and cancer drugs with which it is involved. Belated recognition of the various types of INF resulted in the use of a "mixed bag" of interferons in the early trials of interferon cancer therapy. Perhaps this is why early INF therapy was so disappointing. Recent clinical trials using purified sub-species of INF have shown, however, that the different INFs alone or in combination are somewhat effective. In 1986, alpha interferon was approved for the treptment of hairy-cell leukemia. Clearly, with regard to its therapeutic effects, interferon is not yet to cancer what penicillin is to bacterial infections, but INF shows promise in so many human diseases that its continued use appears certain. The artificial synthesis of genes for somatostatin, insulin and HGH is straightforward: from the protein, a researcher worked backward to decipher the sequence of mRNA nucleotides and then built the cDNA "gene". The synthesiS of INF was much more difficult and costly. Production of interferon from white blood cells initially cost fifty million dollars per ounce, and in the early days of interferon research, it would have literally taken many thousands of litres of whole blood to extract one ounce or 28 grams of interferon. Continued research identified three major types of INF, but nothing was known of their amino acid sequences. Messenger RNAs for the different INFs were isolated and the mRNAs were used to synthesize cDNAs, which were then inserted into the pBR322 plasmids for ampnfication and subsequent production of industrial INFs. Blood Factor VIII Blood factor VIII is critical in the arrest of bleeding, regardless of the type of injury. It is one of over a dozen factors present in human plasma or released from cells that when triggered, begin a cascade of reactions. These chemical reactions convert soluble protein (fibrinogen) into an insoluble fibrin that clots the blood flow. The deficiency of any of the proteins involved in blood coagulation stops the cascade and allows the bleeding to continue. When the gene for blood factor VIII mutates and little or no factor VIII is produced, a severe bleeding disorder called haemophilia A is demonstrated. In 1984, nine investigators pooled their talents at a commercial biotechnology company to make a recombinant DNA from which factor VIII was produced. The gene consists of 186,000 base pairs. The base pairs contain twenty-six exons (DNA coding regions) ranging in size from 69-3,106 bp long and introns (DNA non-coding regions) as long as 32,400 bp. Hepatitis B Vaccine In July of 1986, the Food and Drug Administration (FDA) approved the first genetically engineered vaccine for humans: hepatitis B virus vaccine. Hepatitis B is a virus that causes an incurable and

17

Introduction

sometimes fatal liver disease. It strikes an estimated 200,000 new victims every year in the United States. The vaccine, called Recombivax HB, is made by inserting a gene from the hepatitis B virus into yeast. The yeast cells then manufacture large amounts of the viral protein, which forms the basis of the new vaccine against this hepatitis virus. GENETIC ENGINEERING IN AGRICULTURE

The goal of genetic engineering of plants is to isolate beneficial genes from one species and introduce them into another plant species. For example, a major effort is currently under way to genetically engineer monocot and dicot plants to herbicide resistance. The problems of plant genetic engineering, however, are very different from the genetic engineering of plasmids, which are inserted into bacterial cells to produce usable medical products. Although plant genes can readily be cloned in bacteria for a number of reasons, it is difficult to insert the cloned DNA into a plant chromosome for functional purposes. Plant species have several times more DNA in their cell nuclei than humans or other anim~; many plants also have polyploid sets of chromosomes; and the genes for most of the important plant traits are unknown. In other words, plants appear to be genetically more complex. Perhaps the most difficult and unresolved problem at the moment is that there are only two reliable naturally occurring vectors to carry engineered DNA into plant cells. One is a plasmid found ·in the bacterium Agrobacterium tumejacians. The plasmid of this bacterium, called Ti for tumor inducing, naturally transfers tumor-inducing DNA (tDNA) into plants, causing their cells to divert some of their organic carbon and nitrogen into synthesis of opines, which are nutrients the bacteria can metabolize. During this metabolic "takeover," the plant cells are also stimulated into uncontrolled division, forming plant tumors called crown galls. In one early attempt at genetic engineering-to produce a "sunbean" plant-genes from a bean plant were engineered into the Ti plasmid and carried into a sunflower plant. The Ti plasmid was incorporated into one of the plant's chromosomes, but the "sunbean" plant experiment failed because the sunflower plant was unhealthy and covered with brown tumors, products of the Ti plasmid genes. The cancer-producing properties of the Ti plasmid were then neutralized and recombined with pBR322, the antibiotic-carrying plasmid of bacteria. The recombined Ti plasmid carried the antibiotic gene into plants for expression. Scientists are now using this technique to transplant other beneficial gene~ into plants. A second bacterial plasmid, pUC8, was discovered by Paszkowski and colleagues. The DNA of pUC8 was found to integrate into tobacco, tomato and potato plants. It remains to be seen, however, whether pUC8 or Ti plasmid will function in the major monocotyledonous cereal crop plants. Plants with a Pesticide Gene In late 1986, the U.S. Department of Agriculture, Animal and Plant Health Inspection Services gave permission for the first open-air field test of a genetically engineered plant containing a pesticide producing gene. The experiment involves tobacco plants that carry a gene from the bacterium Bacillus thuringiensis. The bacterial gene successfully codes for the production of a protein that is toxic to a broad spectrum of caterpillars that feed on plant leaves. Greenhouse tests have been very successful. Providing that field tests are successful, other plants such as cotton and com, will also be the subject of similar gene splicing. The hybrid seed would then be sold in the early 1990s. Frost-Reducing Bacteria During the winters of 1983 and 1984, the citrus and vegetable growers in the South-east lost millions of dollars because of early freezes. Recently, however, Stephen Lindow engineered a strain of Pseudomonas syringe (a bacterium that normally lives on plants) that will prevent ice-crystal formation on plants at temperatures as low as '23°F. Because most frost damage to plants occurs between 2530°F, this bacterium has great potential economic value. Naturally occurring Pseudomonas syringe has been used for years in the production of artificial snow at ski resorts. P. syringe, called SnowMax, produces and excretes a protein that serves as a

Genetic Engineering and Cloning

18

nucleus around which water freezes. ThJ texture and amount of snow produced by snow guns Is determined by the number of bacteria per millllltre of water used In the snow gun. Lindow and his colleagues identified and excised the gene in P. syringe that produces the protein that serves as a nucleus for the formation of ice crystals. They then developed an experiment to determine whether the neutered organisms they called "ice minus," when sprayed on plants as soon as they emerged from the soil, would take over the niche usually occupied by the naturally occurring P syringe, effectively keeping them off the plants and thereby reducing frost damage. In April of 1987. Pseudomonas syringe was used in field trials in California. In separate field tests, strawberry and potato seedlings were sprayed with P syringe to determine if the genetically engineered bacteria would colonize plant leaves and forestall frost formation. Some of the questions to be answered by these preliminary investigations are: 1. Will the genetically altered organisms survive in nature? 2. Will they spread beyond the area of application? 3. Will they transfer their genes into other organisms? 4. Will they tum out to be harmful to the sprayed plants? 5. Will they reduce frost damage? Preliminary results from Lindow's work suggest that sprayed plants were more resistant to frost damage and that the organisms did not move beyond the perimeter of the sprayed area. Additional experiments planned for the frost season of 1988 should reveal the efficacy of these genetically altered organisms with respect to the preceding questions. In 1987, Arthur Kelman, representing the U.S. National Academy of Sciences, wrote in the academy's white paper report on the release of genetically-engineered organisms into the environmentthat enough is now known about the nature of these organisms and their relationship to each other and to other organisms to allow their release for field testing. He stated that "accumulated experience in plant and animal breeding of the conventional kind shows that artificially bred organisms are at a disadvantage in the wild." This suggests that these engineered organisms are at a competitive disadvantage in the wild. GENETIC ENGINEERING

Genetic engineering is the most fundamental mechanisms of biotechnologies and is a recent offshoot of biotechnological research. It involves gene splicing, recombinant DNA cloning and tissue culture technology. The technique overall involves into two steps: 1. The in vitro incorporation of the gene or segment of DNA of interest into a small, self-replicating chromosomes and, 2. The introduction of the recombinant minichromosome into a host cell where it will replicate. Step one involves synthesis of recombinant DNA and step two is the Gene cloning. These two, recombinant DNA and gene cloning technologies are the most powerful tools developed in field of biology. Genetic engineering involves manipulation of the genetic material of an organism to give an altered expression of our choice. It deals with identification and isolation of desired gene and then joining this gene of interest into another organism. The desired gene expresses itself in that organism by the gene product. Various steps of genetic engineering are:

Gene Isolation Desired gene is identified, isolated and pUrified. This DNA of interest is also called donor DNA or target DNA. Selection of Vector A vector is a self-replicating molecule of DNA or replicon to which desired gene is linked. Vector molecule with foreign DNA inserted is known as chimeric DNA. Vector ~cts as carrier and

Introduction

19

transports the gene Into the host cell. Thus, It Is also known as a cloning vehicle or a carrier molecule. Suitable vector Is Identified for a system; commonly used vectors are plasmlds and viral DNA molecule. However, recent techniques Involve physical delivery of DNA by various methods.

Cloning of Desired Gene Multiple copies of desired gene can be obtained by placing them in host cell with the help of vectors. Here, the desired gene along with the vector is amplified. Large number of identical copies of gene of interest are produced for subsequent gene transfer into target cell. Now, gene cloning is a fast and mechanized process, using polymerase chain reacton (PCR) machines.

Spedfic Gene Transfer The' gene of interest is finally transferred to host cells. Transformed cells are selected, multiplied and produce transgenic plants by tissue culture technique.

Expression of Desired Gene The desired gene produce, the product in new environment of host, thus the desired traits. Genetic engineering includes the propagation of chimeric DNA in a different host organism. The ability to cross natural species barriers and place genes from any organism in an unrelated host organism is one important feature of gene manipulation. A second important feature is the fact that a defined arid relatively small piece of DNA is propagated in host organism. Thus, genetic engineering opened the door to a range of molecular biological opportunities including nucleotide sequence determination, site-directed mutagenesis, and manipulation of gene sequences to ensure very highlevel expression of an encoded polypeptide in a host organism. If used wisely genetic engineering promises to enhance the quality of human life. However, only future will determine the scope and final outcome of this technology.

2 INSTRUMENTATION Sometimes scientific discovery is made that changes the whole course of the development of a subject. In the field of molecular biology, we can mark several major milestones-the emergence of bacterial genetics, the discovery of the mechanism of DNA replication, the double helix and the genetic code, restriction enzymes, and finally the techniques of recombinant DNA. Many of these areas of molecular biology have been awarded by the Nobel Prize in either Chemistry or in Medicine and Physiology. One of the major advancement in molecular genetics has been the growth of a technique which allows the rapid and relatively cheap amplification of the amount of DNA present in a sample. This technique is called polymerase chain reaction or peR. This methadology was first introduced by Kary Mullis in 1984, but has become widely and extensively used in virtually every molecular genetics laboratory. Kary Mullis was awarded the Nobel prize in Chemistry in 1993. The PCR technique produces a similar result to DNA cloning-the selective amplification of a DNA sequence-and has become such an important part of the genetic engineer's toolkit that in many situations it has essentially replaced traditional cloning methodology. In this chapter we will look at some of the techniques and applications of PCR technology. HISTORY OF THE

peR

By the late 1970s, the basics for PCR were in place. In 1979, Kary Mullis joined the Cetus Corporation in California. He was working on oligonucleotide synthesis, which by the early 1980s had become an automated and somewhat tedious process. Thus, he was free to investigate other ideas. As started working on oligonucleotides, and the main thrust of his work was to try to develop a modified version of the dideoxy sequencing procedure. His thoughts were therefore occupied with oligonucleotides, DNA templates and DNA polymerase. Lc.te one Friday night in April 1983, Mullis was driving with a friend, and was thinking about his moulfied sequencing experiments. He was, in fact, trying to establish if extension of oligonucleotide primers by DNA polymerase could be used to 'mop up' unwanted dNTPs in the solution, which would otherwise get in the way of his dideoxy experiment. Suddenly he realised that the sequence would effectively be duplicated, if two primers were involved, and they served to enable extension of the DNA templates. Fortunately, he had also been writing computer programs that required reiterative loops - and realised that sequential repetition of his copying reaction (although not what was intended in his experimental system!) could provide many copies of the DNA sequence. Some checking of the figures confirmed that the exponential increase achieved was indeed 2", where n is the number of cycles. The PCR had been discovered. It was proved by further work that the theory worked when it was applied to a variety of DNA templates. In the spring of 1984, Mullis presented his work as a poster at the annual Cetus Scientific

21

instrumentation

Table 2.1. Some milestones In molecular biology recognized by the award of the Nobel prize. Year

Prize

Reclplent{s)

Awarded for studies on

1958

C M and P

Primary structure of proteins Genetic recombination in bacteria Gene action

1959

M and P

1962

C

Frederick Sanger Joshua Lederberg George W. Beadle Edward L. Tatum Arthur Kornberg Severo Ochoa John C. Kendrew Max F. Perutz Francis H.C. Crick James D. Watson Maurice H.F. Wilkins Francois Jacob Andre M. Lwoff Jacques L. Monod H. Gobind Khorana Robert W. Holley Max Delbruck Alfred D. Hershey Salvador E. Luria David Baltimore Renato Dulbecco Howard M. Temin Werner Arber Daniel Nathans Hamilton O. Smith Paul Berg Walter Gilbert Frederick Sanger Aaron KIug George Kohler Cesar Milstein Niels K. Jerne Thomas R. Cech Sydney Altman J. Michael Bishop Harold Varmus Kary B. Mullis Michael Smith Richard J. Roberts Philip A. Sharp

M and P

1965

M and P

1968

M and P

1969

M and P

1975

M and P

1978

M and P

1980

C

1982 1984

C M and P

1989

C M and P

1993

C M and P

Synthesis of DNA and RNA 3D structure of globular proteins 3D structure of DNA (the double helix)

Operon theory for bacterial gene expression

The elucidation of the genetic code and its role in protein synthesis Structure and replication of viruses

Reverse transcriptase and tumor viruses

Restriction endonuc1eases

Recombinant DNA technology DNA sequencing Structure of nucleic acid/protein complexes Monoclonal antibodies Antibody formation Catalytic RNA Genes involved in malignancy The polymerase chain reaction Site-directed mutagenesis Split genes and RNA processing

Note: 'C' and 'M and P' refer to nobel prize in Chemistry and Medicine and Physiology respectively.

22

Genetic Engineering and Cloning

Meeting. In his account of the discovery of peR in Scientific American (April 1990), he recalls how Joshua Lederberg discussed his results and appeared to react in a way that was to become familiar-the 'why didn't I think of that' acceptance of a discovery that is brilliant in its simplicity. The peR technique has been adopted by scientists over the past 15 years in a design similar to that for recombinant DNA technology itself. The acceptance and use of a procedure can best be demonstrated by looking at the number of published scientific papers in which the technique is used. This impressive increase in use confirms the importance of PCR, which is now established as one of the major techniques for gene manipulation and analysis. METHODOLOGY OF THE

peR

As outlined above, the polymerase chain reaction is very simple in theory. DNA duplex melts or separates when they are subjected to heat. If the single-stranded sequences can be copied by a DNA polymerase, the original First cycle products

----_._---------------_._----------DNA template

1 Addprimers

t

:,, :,

----------------------_. ----_. ---_..

,,

~ 1

t

Anneal

5' ------.--------..,.,.,.,,---------'3' 3

Primer 2

--J-.J.IoI.I,---------------'S' S'urrt3'

1

.------.

l

Extension

:JJtltlT.lllllllllllli IIIII1111111111111111111111111 i II j 1IIIII1111111 i 1111111111111111111111111111111111111

cr[IJ)DC

!

Further cycles of denaturation, annealing and extension

Fig. 2.1. Polymerase chain reaction-first cycle. 1

Denature and re-anneal

prim_er_1,u,D"Tr.L.L.L..._ _ _ _ _ _ _ S'

-

S'-------M'TT'!'--:am Primer 2 -----. 3'

-----'5

t

3,.JJ,W5'

Primer 1

S' -------------:amM'TT'!''=''pr~im-er~2------·3'

3'-----'

,: :,, :, ,,

!

IIIIIIIIIIII! 111111 IIIII1111111 il II! IIIIIIIIIIII! II! crallIII!,.~ 51

------

Primer 2

\"', ....................................... ~r!r:!'_e!_! .......................................................... _,I'

jT'!'j

3

.,

-

-s,------- 3'

~I ltIfli])IJ't'f'.li1""11"'111""11"'' j""Ii""'IIIm-jI""'III~II;"III~!I""'11,"'11""II,,,,,,,!1m) !

Denature

,,,~M_M __ --------------.---------------------------------_~, ,

1

Extension

DNA sequence is effectively duplicated. If this is repeated many times, there is an exponential increase in the number of copies of the starting sequence. The length of the fragment is defined by the 5' ends of the primers, which helps to ensure that a homogeneous population of DNA molecules is produced. Thus, the target sequence becomes greatly enlarged after relatively few cycles, which produces enough of the sequence for identification and further processing.

Essential Features of the PCR There are two requirements for peR , New product stops at in addition to a DNA sequence for 5 IIII! 11111 I! 11111 11111 II! IIII! I! III II! I end of template amplification. First, a primer is required. In New product stops'riia~tTTTTTTTTT!TTTT!TTTT!TTTT!TTTT!M'TT'!'--- _____ • 3' practice, two primers are required, one for end of template' 1111111111111111I1111111111111111I11111s' each strand of the duplex. The primers should ~ ~ !I! II! III I! ! j II! II! IIIII11II jl I j III I!! III!!!!! I! III! UUIII].,s' flank the target sequence, so some sequence information is needed if selective amplification I Further cycles of t annealing and extension is to be achieved. The primers are produced as oligonucleotides, and are added to the _IIIIIII!IIIIIIIIIIIIIII!!III'_ reaction in excess, so that each of the Primer 1 Primer 2 Amplified product primers is always available following the denaturation step. The availability of a Fig. 2.2. Polymerase chain reaction--second cycle. ;'I~-rrrnnlllllllllllllllll! IIIIIIIIIIIIIII!II! II! 111115

1

3'------

-----·3'

.

23

Instrumentation

thermostable form of DNA polymerase is the second requirement that makes life much easier for the operator. This is purified from the thermophilic bacterium Thermus aquaticus, which are found in hot springs. The use of Taq polymerase means that the PCR procedure can be automated, as there is no need to add fresh polymerase after each denaturation step, as would be the case if a heatsensitive enzyme was used. In addition to these two 5' - - - - - -_ _ _ _ _critical components, the usual mix of the correct :=yprimer 1 RE site Primer2'V'" buffer composition and the availability of the four RE sit.,;,e_.,j,j,i,I....._ _ _ _ _ _ _ _ _ 5' dNTPs is needed to make sure that copying of the DNA strands is not stalled due to inactivation of the 1st cycle extension enzyme or lack of monomers. 5' - - - - - - . ; . . . ._ _ _ _-

::::n:u::

I t

'5'

@

In operation, the PCR is very simple. In the 5'.. begining of the process, the target DNA and reaction "_-------__..." ~tm~______------_. components are usually mixed together. To denature .5' the DNA, the tube is heated to around 90oC. As ~ 5' the temperature drops, primers will anneal to their target sequences on the single-stranded DNA, and Taq polymerase will start to copy the template strands. By a further denaturation step, the cycle gets 2nd cycle extension completed and restarts again. By USing a programmable heating system called mill!!!!! II11IIII IIIIIIII!IIIIIII !!!iii thennal cycle, automation of PCR cycle of operation can be achieved. This takes small microcentrifuge 1IIIIilil!lliI!!IiI!(jII!!!III!IIIIiII!~' tubes in which the reactants are placed. Thin-walled I Further cycles tubes allows more rapid temperature changes than RE site standard tubes or plates. According to the particular reaction conditions required for a given experiment, 1111111111111111111111111111111111111111111111: various thermal cycling patterns can be set, but in i RE site general the cycle of events forms the basis of the amplification stage of the PCR process. Although Cut at restriction site and thermal cyclers are simple devices, they have to ligate to a suitable vector provide accurate control of temperature, and similar rates of heating and cooling for tubes in different Fig. 2.3. Adding restriction sites to a PeR product. parts of the heating block. More sophisticated devices provide a greater range of control patterns than the simpler versions, such as variable rates of heating and cooling, and heated lids to enclose the tubes in a sealed environment. There is the possibility of evaporation of liquid during the PCR if a heated lid is not used. A layer of mineral or silicone oil on top of the reactants can avoid this, although sometimes there could be a problem of contamination of the tube contents with oil. A final practical step in setting up a PCR protocol is general house-keeping and manipulation of samples. As the technique is designed to amplify small amounts of DNA, even trace pollutants or contaminants can sometimes interfere drastically with an experiment. Regarding cleanliness while carrying out a PCR, the operator should be fastidious or a very high l~"el. Also, even the aerosols created by pipetting reagents can lead to cross-contamination, so a good technique is needed. It is best if a sterile hood or flow cabinet can be set aside for setting up the PCR reactions, with a separate area used for post-reaction processing. Mainly when the analysis is being carried out in medical or forensic applications, accurate labelling of tubes is required and the quality control procedures are also important.

X

'"

tI

A\5'

t

Design of Primers for peR From many commercial sources, oligonucleotide primers can be purchased and in a few days can be produced to order. In designing primers, there are several aspects that have to be considered. Perhaps most obvious is the sequence of the primer-more specifically, where does the sequence

24

Genetic Engineering and Cloning

information come from? (a) Selecting the sequence It may be derived from amino acid sequence Phe - Leu - Pro - Ser -IAla • Lye· Trp • Ala - Tyr - Asp - Pro I amino acid sequence data, number of codons 2 ® 4 ® 4 2 4 2 2 4 in which case the degenper amino acid eracy of the genetic code better sequence avoid has to be considered. In prodUCing the primer, two (b) Mixed probe synthesis methods can be adopted. Ala Lys Trp Ala Tyr Asp Pro A mixed probe can be GCAAAATGGGCATACGACCC proved, with the 'correct' G G G T T sequence represented as a C C small proportion of the T T number of 4 x 2 x 1 x 4 x 2 x 2 x 1 = 128 mixture by incorporating possibilities a mixture of bases at the wobble position. Altema- (c) Using Inosine as the degenerate base Ala Lys Trp Ala Tyr Asp Pro tively in the degenerate GC IAAATGGGC ITACGACCC codons, the basic inosine G T T (which pairs equally well 1x2x1x1x2x2x1=8 with any of the other number of bases) can be incorporated possibilities as the third base. Fig. 2.4. Primer design. In (a) the amino acid sequence and number of codons per If th~"'1>rimer seamino acid are shown. Those amino acids with six codons (circled) are best aooided. The boxed sequence Is therefore selected. In (b) a mixed probe Is

quence is taken from an synthesized by including the appropriate mixture of dNfPs for each degenerate already known DNA sepOSition. In (c) Inosine (1) Is used to replace the fourfold degenerate-bases. quence, this may be from giving eight possible sequences. the same gene from a different organism, or may be from a cloned DNA that has been sequenced during previous experimental work. There are some general information which should be taken into consideration regardless of the source of the sequence information for the primers. The length of the primer is vital. It should be long enough to ensure stable hybridisation to the target sequence at the required temperature. Although calculation of the melting temperature (Tm) can be used to provide information about annealing temperatures, this is often best determined empirically. The primer must also be long enough to ensure that it is a unique sequence in the genome from which the target DNA is taken. For most applications, primer lengths of around 20-30 nuc1eotides are usually sufficient. With regard to the base composition and sequence of primers, repetitive sequences should be aVOided, and also areas of single-base sequence. Primers should not contain areas of internal complementary sequence, or regions of sequence overlap with other primers. As extension of PCR products occurs from the 3' termini of the primer, it is this region that is critical with respect to fidelity and stability of pairing with the target sequence. At the 5' end, some 'looseness' of primer design can be accommodated, and this can sometimes be used to incorporate design features such as restriction sites at the 5' end of the primer.

DNA Polymerases for peR Originally, the Klenow fragment of DNA polymerase was used for PCR, but this is thermolabile and needs addition of fresh enzyme for each extension phase of the cycle. This was inefficient in that the operator had to be present at the machine for the duration of the process, and a lot of enzyme was needed. Also, as extension was carried out at 37°C, primers could bind to non-target regions, generating a high background of non-specific amplified products. These problems were solved by the availability of Taq polymerase. Today, a wide variety of thermostable polymerases is available for PCR, sold under licence from Hoffman LaRoche (who hold the patent rights for the use of Taq

25

Instrumentation

polymerase in PCR). These include several versions of recombinant Taq polymerases, as well as enzymes from Thermus Ilauus (TIl polymerase) and Thermus thermophilus (Tth polymerase). The key features needed for a DNA polymerase include processlulty (affinity for the template, which determines the number of bases Incorporated before dissociation), fidelity of incorporation, rate of synthesis and the half-life of the enzyme at different temperatures. In theory the variations in these aspects shown by different enzymes should make choice of a polymerase a difficult one; in reality, a particular source is chosen and conditions adjusted empirically to optimise the activity of the enzyme.

Of the features mentioned above, fidelity of incorporation of nucleotides is perhaps the most critical. Obviously, an error-prone enzyme will generate mutated versions of the target sequence out of proportion to the basal rate of mis-incorporation, given the repetitive cycling nature of the reaction. In theory, an error rate of 1 in 104 in a millionfold amplification would produce mutant sequences in around a third of the products. Thus, steps often need to be taken to identify and avoid such mutated sequences in cases where high fidelity copying is essential.

peR

IN PRACTICE

PCR was performed by manually transferring tubes between thermostat-controlled water baths during the initial stages of its development. It was clear that this was not desirable for the reproducibiUty of the reaction (nor for the mental well-being of the operator). Therefore, the launching of peR as a revolUtionary new technology was associated with the development of the programmable thermocycler. These instruments are based on metal heating blocks with holes for the PCR tubes. These blocks are designed to switch between the programmed series of temperature steps with great speed and precision by a combination of heating and cooling systems. The use of small (0.2-0.5 ml), thin-walled tubes helps to make sure a rapid change of temperature. Alternatively, microtitre trays are used for larger numbers of samples. Because the PCR reaction is performed in a small volume (typically 25-50 Ill), and because of the high temperatures involved, it can be easily imagined that the water would quickly evaporate and end up on the inside of the lid rather than on the bottom of the tube. This can be prevented by two different ways: the first one is to place a drop of mineral oil over the reaction; an alternative and less messy method is to heat the lids of the tubes to prevent condensation.

Optimization of the peR Reaction The importance of the annealing temperature in PCR has already been discussed. Binding of the primers to the target will not be stable enough for amplification to take place if the temperature is too high. If it is too low, the system will become too tolerant of partial primer-target mismatches, and will therefore be non-specific. The most important PCR parameter is the design of the primers. The primers must be chosen to define a target of appropriate length. As far as possible, complementarity to other targets in the template mix should be avoided. To a degree, this can be pre-empted by database searches of putative sequences, but often it is, at least in part, a matter of trial and error. The primers should also not anneal to themselves or to one another, and should be unable to form stable secondary structures. Computer programs are there to check that the chosen sequences are suitable in these respects. Just as conserved gene areas can be used to syntheSize 'guessmers' for library screening, they can also be used to produce degenerate pools of PCR primers. In this way, it is often possible to amplify a new gene by this method if two regions within a gene are known or can be predicted by an educated guess. This can be used for the cloning of a known gene from another species, or for discovering a novel gene that is related to one that is previously known. It is of course important to remember that the flanking sequences of the product are determined by the primer and not by the template. The concentration of magnesium ions, a necessary cofactor for the enzyme is another important factor. A higher magnesium concentration gives a higher yield, but also a lower specificity.

26

Genetic Engineering and Cloning

Analysis of peR Products The products of a peR reaction can be analysed nonnally by running out the samples in an agarose electrophoresis gel. This allows the user to make certain that only one band is obtained in each reaction, which is usually the aim. By comparing the size of the amplified band to a molecular weight standard, it is also possible to ascertain that the molecular weight is the same as the predicted one (which is usually known). The assumption is that if the band is the predicted size, then it probably corresponds to the predicted fragment-an assumption which occasionally leads to the wrong track. If the result is important, it is worth checking the identity of the band. On the other hand, a band of a different size can be obtained from that predicted. Sometimes specific amplification product (of the correct size) is found together with a strong band of low molecu1ar weight. These low molecular weight bands are called primer dimers, and are produced by binding of the primers to each other. They can usually be ignored, but due (amongst other things) to competition between primer-primer and primer-template binding, the tendency of primers to produce dimers can cause problems with a peR. Another effect may be an amplification that appears to be specific (as shown by the absence of a band of that size in control reactions), but gives a product of the wrong size. This may indicate that one or both of the primers is binqing at a different DNA template position, producing an artefactual product. This 1IIIIlIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII may also be manifested as a specific band together with a more or less complex mixture of non-specific ones. In these cases, greater specificity may be Anneal first primers obtained by adjusting one or more of the peR 5' ----------""TT'ITTTTr--parameters. 3' UlllllL Primer 2 3'_ _ _ _ _ _ _ _ _ _ 5' Alternatively, to enhance the specificity (and/ prime_r_1...mmr......"..101... or the sensitivity) of the peR, nested peR may be used. A small aliquot of the original reaction is Amplification transferred to a second, 'nested' peR reaction in Primary 1"I'1I1"I'1IImllm,,~II""II""II""III"I'III"I'II';'lIlmll~II""""""""11""111"1',,1"1',,1"1'111"'"1 amplification nested peR. One or both primers are replaced product with a second set of primers which will bind specifically within the desired amplification product Anneal secondary primers in the nested peR reaction. In this way, the WllPrimer4 undesirable ones which have typically been Primer3mm amplified because of a coincidental sequence similarity in the region of the original primers, will , Amplification normally disappear. In order to provide certainity about the identity 11111111111111111111111 Nested PCR product of a peR product, in particular if the exact molecular weight is not known, the gel may be Fig. 2.5. Nested PCR. blotted and hybridized with a probe complementary to the expected product. Alternatively, because of the remarkable recent progress in sequencing technology, many people find it faster, easier, and cheaper to perfonn direct sequencing on the peR product.

t

t I

*

CLONING PCR PRODUCTS

Although PCR is commonly used merely to detect the presence of a specific sequence in different templates, it is also often employed for the amplification of such sequences as a convenient way of obtaining a specific product for cloning. When the starting material is very scarce, this is especially important as in such cases the conventional routes (for example constructing and screening a gene library) are impossible. It might be expected from the so far description, that the peR products would be blunt-ended, and could therefore be cloned by normal blunt-ended cloning. In practice, this is often not very

27

Instrumentation

successful. Not only is blunt-ended cloning comparatively inefficient, compared with cloning stickyended fragments, but also, as described below, Taq polymerase often tends to add a non-specific adenosine residue to the 3' ends of the product. Therefore, the product not blunt-ended, and cloning with a blunt-ended vector will fail. Even the use of linkers will be unsuccessful in this situation. One way around this has already been alluded to. This is to use a modified primer that contains an additional restriction enzyme recognition site in its 5' end. The resulting products can be cut and ligated to a plasmid that has been cut with the same enzyme, with great efficiency. For cloning larger PCR fragment, this is mainly useful.

~i iII""I II I~li!Ii Ii II III~

~

r-Mmllmli'TIII'TIIITl'II~1:wr:11"IIIml '1 imim'l i~

@

..

,

RE site

jiilillllllll~llllillillll RE site Cut

1

r--:----.".-.,..,

Using modified primers

!AI iii II III illl~1 IIIIIIIIIIIB

----osure. X-irradiation is most often used in the late second and third trimesters of pregnancy. At this time, the bone structure of the foetus has become sufficiently dense to show up on the X-ray photograph. Prior to the use of ultrasonography, X-irradiation was frequently used in suspected cases of dwarfism, intrauterine growth retardation and osteogenesis imperfecta or "brittle bone" disease. The major problem in the use of X-irradiation is that there is "no absolutely safe level" of X-irradiation. Exposure of the foetus to X-irradiation may cause a mutation in the foetal pregamete cells or in other body tissues or increase the risk of the foetus to later develop childhood leukemia or central nervous system disorders. Ultrasonography was first reported in 1954 when Howry and colleagues used this diagnostic tool to explore structures of the human body. The use of ultrasound (sonar) is based upon the fact that pulses of ultrasound are reflected differently at the boundaries of media that differ in penetrability; and the difference is determined by the density of each medium and the velocity of the ultrasound

113

Screening and Analysis of Recombinants

passing through it. The reflections of ultrasound waves from the boundary between bone and soft tissue, for example, would return with a greater intensity than those from the boundary between the kidney and other soft tissues. The variations in reflections, when combined electronically and projected on a television screen, create an image of the foetus or any other area under study. Ultrasound is a non-ionizing radio wavelength that, after over thirty years of use in scanning pregnancies, has not been positively linked to or associated with any foetal defect. In prenatal screening, the ultrasound transducer, covered with a gel, is passed back and forth over the woman's abdomen, producing multiple views of the foetus on a screen. Photographs of the different foetal parts can be taken for measurement and analysis. Ultrasonography is used to establish the gestational age or to locate foetal structures before amniocentesis or foetoscopy is performed. Ultrasound has, for the most part, replaced the use of X-irradiation in prenatal testing procedures.

Invasive Testing Methods The prenatal testing methods of foetoscopy, amniocentesis and chronic villus biopsy (CVB) are invasive. CVB, foetoscopy and amniocentesis require the penetration of the pregnant uterus. Foetoscopy or aminoscopy is the direct visualization of the foetus and placenta in utero. It is a valuable aid in obtaining foetal blood and tissue samples for chromosome and biochemical analysis.

aspiration of foetal blood

...

foetal vein

Fig. 10.1. Foetoscopy. The physician peers through a teloscope equippeci with a fibre-optic lens.

Genetic Engineering and Cloning

114

The most common reason for foetoscopy is to determine if foetal bladder obstruction is an isolated event or part of a wider spectrum of foetal problems. The procedure was first introduced in 1973. The procedure involves the use of a thin, small-caliber, fibre-optic (light-transmitting) tube called a foetoscope. The physician first locates the foetus and placenta using ultrasound. Then, under local anaesthesia, a small incision is made in the abdomen and the foetoscope is inserted into the amniotic sac. The field of vision is very small, but an experienced operator can view the external parts of the foetus for morphological abnormalities. Foetoscopy is usually performed between eighteen and twenty-two weeks of gestation. This procedure has a significant risk attached to it. After foetoscopy is performed, about 15 percent of pregnancies spontaneously abort, about 10 percent result in amniotic fluid loss that may cause compression malformations and urinary tract problems, and about 7 percent result in physical injury to .the foetus. Becaue of these risks, foetoscopy is restricted to relatively few medical centres and in done only if no other options are available. Amniocentesis is the withdrawal of aminotic fluid through a long needle inserted through the uterine wall into the amniotic sac. The technique is relatively painless; a local anaesthetic is not required with the insertion of the needle along the midline of the abdomen. Once the needle enters the amniotic sac, the positive pressure often forces the fluid to fill up the syringe. Usually 2-20 millilitres of fluid are taken, but the amount may vary from 2-55 millilitres, depending on the age of the foetus. The object of the procedure is to obtain a sample of the fluid and foetal cells that have sloughed off from the foetus into the amniotic fluid. Certain bie-chemical tests, such as determining the level of alpha-foetoprotein (AFP) present at different gestational ages, may be run solely on the fluid. In general, however, amniocentesis is performed to obtain foetal cells for assessing foetal cell biochemistry, chromosomes and DNA. Cells extracted from the amniotic fluid may be used immediately or they may be cultured for several weeks, harvested and then used for various tests. Amniocentesis: transabdominal withdrawal of amniotic fluid (2 to 20 ml)

cavity

I

Examples: • ! Sex chromatin I (Barr body) Tumer's syndrome I Klinefelter'S syndrome XYY syndrome Multiple XXX syndromes Biochemistry Examples: Mucopolysaccharidosis Methylmalonic aciduria Adrenogenital syndrome Hyaline rnembran'~ disease

\

Examples: Down's syndrome Trisomy 13 Trisomy 18 Cri-du-chat syndrome Long arm 18 deletion Short arm 18 deletion Turner's syndrome Klinefelter's syndrome Cell culturing for later karyotype analysis and.biochemicaJ and DNA studies

~~---~.~ Uncultured fetal cells Biochemistry and DNA analysis

Viral studies Viruses cultured from amniotic fluid

Biochemistry Examples: Galactosemia M8Jfan's syndrome Cystic fibrosis Hurter's syndrome Hunter's syndrome Gaucher'S disease HomocystiAtlria HyjJervalinemia Cystinosis

Fig. 10.2 . Amniocentesis ond prenatal detection of genetic abnormalities.

Screening and Analysis of Recombinants

115

The risk to the foetus via the transabdominal route is considered low. Spontaneous abortion occurs in about 1 in 200-400 amniocenteses (about 0.5 percent) . The major risk to the foetus is being struck by the needle. In the United States, however, almost all amniocenteses are preceded by ultrasonography to locate pockets of amniotic fluid, the foetus and the placenta. Because some maternal bleeding into the amniotic sac may occur during amniocentesis, the Rh antigen compatibility of the parents should always be established prior to the aminocentesis. The risks of the procedure to the mother are infection, post-amniocentesis bleeding and/or medical problems associated with miscarriage. Occurrence of such maternal complications is considered to be less than 1 to 100. The optimum time for an amniocentesis is at about sixteen weeks from the last menstrual period, based on the amount of amniotic fluid present in the amniotic sac (about 10-20 ml of an average total of 150 rnI present is withdrawn for test purposes), the stage of foetal development and the time necessary to perfonn cytogenetic studies. Cell culture and karyotype analysis usually take from two to six weeks. In a small percentage of cases, the cell culture fails and a second amniocentesis is perfonned. Elective abortion pennissible by law extends for six months or twenty-four weeks of pregnancy. Thus, a chromosome analysis must be completed prior to twenty-four weeks in order to offer prospective parents a choice of whether to continue the pregnanr.y. By early 1988, over five hundred thousand genetic amniocenteses had been perfonned in the United States. About 85 percent of the amniocenteses were done for prenatal chromosome studies, primarily on pregnant women over the age of thirty-four. About 15 percent was performed to detect metabolic diseases and neural tube defects. Overall, amniocentesis is considered to be a low risk, safe procedure for both mother and foetus. Chorionic villus biopsy is the sampling of chorionic villi, which are the functional units of the foetal portion of the placenta. The chorion is the outennost foetal membrane and is composed of trophoblast lined with mesodenn. The section of the chorion that maintains villi as the foetus ages is called the chorion frondosum because of the frondlike appearance of the villi. The villi project into the large blood vessels of the decidua basalis through which the maternal blood flows. Blood vessels that fonn within the villi as they grow become connected with blood vessels that are forming in the chorion, in the body stalk and within the body of the embryo. Because the chorionic villi are so mitotically active, a villi sample of 10-30 mg can be directly used for chromosome analysis and for bio-chemical and DNA recomobination studies. The timeconsuming procedure of cell culture may be eliminated. A diagnosis of foetal sex and various chromosome abnonnalities can be obtained within hours after the sample is obtained. Clearly, it is preferable to identify genetic abnonnalities before the twelvth week of gestation so that patients may opt for first-trimester termination of pregnancy, which is simpler, safer and less psychologically stressful than the second-trimester amniocentesis procedure. Appreciation of the advantages inherent in CVB, if the procedure can be performed as safely as amniocentesis, make it the choice prenatal method for obtaining foetal cells. One serious drawback, however, is that CVB does not provide the physician with a sample of amniotic fluid . Biochemical tests on the amniotic fluid are ess,~ntial, for example, in the detennination of alpha-foetoprotein for pregnancies where there is a high riS{ for neural tube defect. Another problem is the occurrence of foetal villi cell cytogenetic mosaicism, ,vhich presents problems in diagnostic interpretation and difficulty in obtaining high-quality chromosome preparations without resorting to longer tenn tissue culture. CVB i~. performed by passing a soft polyethylene catheter transcervically into the chorion frondosum, \ ,hich contains the villi. Using a mild suction, the fingerlike projections of villi are aspirated into the ca :heter. The catheter is withdrawn and the sample of tissue, after being inspected for maternal tissue contamination, is used in·test determinations. The CVB procedure was first used in China in about 1965 and in Russia in 1975 to detennine foetal sex. The procedure was next tried in England and Italy in 1980. In 1983, the procedure was used at the Michael Reese Hospital in

Genetic Engineering and Cloning

116

amniotic mAmnr::ln,,,,_ fetus

~iiSa!~~~~~ tenaculum

speculum Fig. 10.3. Chorionic vii/us biopsy. Cross sectionai view of the CVB procedure being performed with the aid of realtime ultrasonography.

Chicago. CVB is now being perfonned at over a dozen medical centres in the United States and in over seventy medical centres worldwide. Although CVB is less invasive than amniocentesis, to date it has shown about an eight times greater risk of spontaneous abortion and maternal infection. A risk of 3 .9 percent has been calculated from CVB perfonned through May 1989 on over sixty thousand pregnancies. Because the percentage risk in the use of CVB is significantly higher than for amniocentesis, CVB is considered experimental and is not provided on a routine basis in the United States. SHARING DIAGNOSTIC INFORMATION

There is now variety of techniques collectively referred to as methods for prenatal screening. The results from each testing method offer the physician different infonnation about the development of the foetus. After prenatal testing, the physician uses the infonnation gained to decide on whether a foetus at risk is affected with a specific disease, but not on whether the foetus is nonnal. The physician and/or genetic counselor then discuss the diagnostic infonnation with the prospective parents. The goals of prenatal diagnosis are: (i) to offer the couple whose pregnancy is at risk the option of having a "nonnal" child and (ii) through counseling, to prepare the prospective parents who wish to continue the pregnancy for the emotional, medical, and economic problems that may be associated with prenatally diagnosed birth defect. If an abnonnal foetus ha$ been confinned, the parents are offered counseling about the prospects of the coming child's developmental limitations, along with the anticipated postnatal course of treatment and the degree of ultimate disability or recovery expected. Based on the diagnostic infonnation provided and their individual moral standards, some parents choose elective abortion, whereas others opt to continue the pregnancy and undertake appropriate postnatal therapy. Using the technology and methodology currently available, over two hundred fifty metabolic and congenital disorders can be prenatally detected. This number may double by 1990 as a result of recombinant DNA technology now available in the field of prenatal diagnosis. The prenatal testing now available using restriction fragment length polymorphisms (RFLPs).

Screening and Analysis of Recombinants

117

Anencephaly and Spina Bifida One child with a neural tube defect is born every two and one-half hours in the United States. Two important prenatal genetic neural tube defects, anencephaly (absence of brain tissue) and spina bifida (defective spine) have a collective frequency of about 1 in 1,000 live births. Neural tube defects are screened by determining the level of alpha-foetoprotein (AFP) either in maternal serum or within the amniotic fluid. AFP is a protein synthesized in the liver, yolk sac and gastrointestinal tract of the foetus. The amount of AFP produced by the foetus gradually rises during early pregnancy and normally levels off at between fourteen and sixteen weeks of gestation. After this time, the AFP level slowly declines in both the maternal serum and amniotic fluid. In some pregnancies, however, the AFP level does not increase with the time of gestation and remains low. In other pregnancies, AFP reaches a higher than normal level and remains high or continues to increase, reaching very high levels at birth. Either low or sustained high levels of AFP suggest that the foetus has a chromosome aneuploidy, usually a trisomy such as trisomy 21 or mosaicism. Low AFP levels indkate that the foetus is at risk for spontaneous abortion, premature labour or stillbirth. High AFP levels have been associated with over two dozen foetal conditions. Of these, the most frequent and devastating to a newborn are the neural tube defects. Neural tube defects are multifactorially inherited. About 90 percent of neural tube-defective children are bom into families with negative histories for neural tube defects. Generally, if the spine is exposed in a sac of membranes (called a meningomyelocele), there will be some physical paralysis. The extent of paralysis is determined by the location of the meningomyelocele and damage to the spinal nerves. Recently, investigators developed a combined antibody/radioimmunoassay AFP test. The test is very sensitive and and can detect AFP in maternal blood at nine weeks of pregnancy. This more precise AFP determination gives the physicians a five to seven week edge over previous procedures in determining if the pregnancy is at risk for AFP-associated problems. Maternal Serum Alpha-Fetoprotein AFP levels in blood and aminotic fluid are different during each week of pregnancy. The AFP level must be evaluated. therefore, in relation to a "normal" level for the particular gestational age; inaccurate assessment of gestational age can lead to an incorrect interpretation of the AFP level. For these reasons, testing the level of AFP in a pregnant woman's blood-itself a fairly simple invasive test-is only the first step in prenatal screening for neural tube defects and is not in itself diagnostic. If a raised MSAFP (maternal serum) is found, a repeat blood test is done. If that too is positive, it is followed by an ultrasound examination to confirm gestational age and to determine whether multiple foetuses or foetal death is causing thp positive test results. If these explanations of elevated AFP levels are eliminated, amniocentesis and a measurement of AFP in the amniotic fluid are performed. The expense, risks and limited availability of amniocentesis restrict its usefulness as a screening tool for neural tube defects in the general population. However, MSAFP testing is inexpensive, rapid and can be used as the first step in the mass screening of pregnancies for neural tube defects. California MSAFP Screening Program Because AFP determinations are easily made, in the United States, the AFP test was the first to be used in mass screening for prenatal defect. In April of 1986, the state of California by legislation initiated perhaps the largest voluntary prenatal screening program in medical history. The statewide program expects to screen some 300,000 women per year. The program is designed to identify prospective mothers under the age of thirty-five who are not candidates for an amniocentesis. The screening involves the mandatory participation of at least 2,200 physicians. The program is designed to be self-supporting and does not rely on state or federal financing. The logistics of this endeavour are staggering and data gathered will be studied by those favouring mass MSAFP screening in other states.

Genetic Engineering and Cloning

118

The goals of California's MSAFP screening program are to improve the outcomes of high-risk pregnancies through early detection of problems, to offer women the choice of abortion or special obstetric services at a perinatal centre when severe malformations are discovered and to cut the costs of medical care. From the medical malpractice standpoint, the program also establishes that offering the tests to patients is part of the standard of obstetric care in the state. NEWBORN ScREENING

Defects in the metabolism that causes diseases like aminoaciduria, galactosemia or diseases caused by defects in the uric acid cycle are most often compensated for prenatally by maternal-placental mechanisms. Although such infants appear normal at birth, in early infancy, they develop a disease that may prove lethal or that may damage the central nervous system. If the infant survives, it may be severely retarded or neurologically impaired or both. After individual tests were constructed to detect the various inborn errors of metabolism, it became possible to screen newborns. Prior to 1959, newborn or neonatal genetic screening tests were available for only a small number of inherited metabolic disorders like alkaptonuria and phenylketonuria (PKU) and the electrophoretic detection of sickle-cell haemoglobin. In 1959, it was recognized that a specific chromosome abnormality caused a specific newborn defect-Down's syndrome. This marked the beginning of testing for foetal, newborn and adult chromosome abnormalities. In 1961, Robert Guthrie developed a simple, inexpensive PKU test that allowed for the first mass genetic screening of newborns in the United States. The test proved to be so successful that forty states have mandatory PKU testing; seven states have regulations that provide for the PKU test and three states have voluntary PKU testing. Once a system was in place for collecting, testing, and reporting on blood samples from newborns for PKU, it followed that this same system could be used to test newborns for other metabolic errors of metabolism. Today, all fifty states test newborns for PKU; forty-one states provide for the testing of hypothyroidism; twenty-five states test for galactosemia; eleven states test for homocystinuria and thirteen states test for maple syrup urine disease (MSUD). To provide but one example of the mass screening capabilities, data from the state of California on the screening of PKU from mid1900 to mid-1986 show that California had screened over 2.3 million births. One hundred of these babies demonstrated PKU. This is an incidence of 1 case of PKU per 23,349 live-born infants, or about seventeen new cases of PKU per year. Ninety-seven percent of all California births are tested; fewer than four hundred families a year refuse the screening test. PKU babies are placed on a PKU diet by the eleventh day of life. In terms of lifetime care costs, the state estimates it saves about thirty-three dollars for each dollar spent in the PKU screening program. For some disorders, such as congenital hypothyroidism, early treatment, dietary or otherwise, can clearly prevent the clinical expression of the disease and/or to improve the quality of life. For others, however, the benefits of early detection are either unclear (for example, in sickle-cell anaemia) or unknown (as in histidinemia). Histidinemia and a few other inborn errors in metabolism that occur with twice the frequency of PKU appear to have little or no effect on the phenotype. In other cases, such as MSUD. screening presents especially difficult ethical dilemmas since early diagnosis followed by costly treatment may only delay an inevitable death by a few, very burdened years. Although statewide newborn screening programs have proVided a great deal of data that has been useful in evaluating the genetic, bio-chemical and clinical characteristics of metabolic disorders, for at least some conditions, some families may prefer not to receive the information. Overall, one of the most recognizable benefits to state-mandated or voluntary screening programs is the prevention in cases of mental retardation that accompany inborn errors of metabolism such as PKU, MSUD, tyrosinemIa. homocystinuria, galactosemia and hypothyroidism. Early detection of such metabolic disorders allOVJs for the manipulation of the child's environment before brain damage and r~ardation occur..

Screening and Analysis 0/ Recombinants

119

Carrier Screening Individuals who carry one mutant and one normal gene for a given trait are genetically heterozygous. The mutant or recessive gene is not expressed in the heterozygous state, but is carried in the genotype. Each person carries between four and eight of these rare defective genes. In most cases, individuals learn that they are recessive gene carriers after having a child born with a birth defect. Carrier screening can detect heterozygotes for recessive disorders prior to the birth of a defective child. If a child is born with a genetic defect, carrier screening can be used by the child's relatives to learn whether they also risk having children with the same genetic problem. Carrier screening, on a mass scale, began in the United States in the ealy 1970s with two genetic disorders: sickle-cell anaemia and Tay-Sachs disease. Since then, a relatively small number of other recessive diseases have also been screened. With the successful use of carrier screening came a new concept in preventive health care. The prospective parents who are found to be carriers have an option: they may choose whether to initiate an at-risk pregnancy. Only a small percentage of recessive diseases can be screened. For those recessive dise~ that can be screened, the question is whether they occur with sufficient frequency to make such screenings cost-effective. It appears that mass screening of carriers is effective, but only in particular ethnic groups where, for reasons of geographical and social or religious restrictions, disease occurrence is high enough to make screening cost-effective.

Disease

Live-Birth Incidence

Carrier Frequency

Sickle-cell anaemia Adrenal congenital hyperplasia Cystic fibrosis Tay-Sachs disease Phenylketonuria

1 1 1 1 1

1 1 1 1 1

in in in in in

400 600 2,000 4,500 15,000

in in in in in

10 13 25 30 100

An outstanding example of carrier screening and its effectiveness in reducing the number of severely defective newborns is the Toy-Sachs carrier screening program. In 1970, a pilot Tay-Sachs carrier screening program was started within the Hebrew population of the Baltimore-Washington area. At the time, there were over 240,000 Hebrews in the area, 80,000 of whom were of the childbearing age (eighteen to forty-three). Prior to the announcement of the program, 98 percent of the Hebrew population in the Baltimore-Washington area had never heard of Tay-Sachs disease. Within a few months, ninety-five percent of the Hebrew population was aware of it and a significant number volunteered to be screened. Between May and September 1971, 7,800 individuals were screened. Of these, four couples were identified as carriers. FollOwing the success of the Baltmore-Washington pilot program, carrier screening for TaySachs spread rapidly. By June of 1981, a total of 350,000 Hebrew adults had been screened voluntarily in 102 centres throughout the world. The screening detected 337 carrier couples, for whom a total of 912 pregnancies were monitored prenatally, and 202 foetuses were found to have Tay-Sachs. Prior to 1970, between fifty and one hundred Tay-Sachs children were born per year, whereas a total of thirteen children were born with Tay-Sachs disease in North America in 1980. Given the high carrier frequency for particular recessive diseases in given ethnic groups, it is of major importance to detect autosomal and X-linked carriers of those mutant genes. In so doing, prospective parents have alternatives with regard to having a family.

Detection of Autosomal Recessive Carriers Detection of carriers for specific inherited diseases currently consists of (i) analysis of family pedigrees, wherein the pedigree can demonstrate the parents of a defective child ard definite carriers

120

Genetic Engineering and Cloning

or probable carners; (ii) biochemical testing of individuals for the level of haemoglobin or a given enzyme, substrate or chemical excretion; (iii) direct clinical obselVations, as many carriers will demonstrate some clinical evidence of their genotype; (iv) radiology to look for minor bone deformities; (v) microscopic analysis of tissue to detect structural changes and most recently (vi) determining familial transmission of restriction fragment length polymorphisms (RFLPs-pronounced reflips) and using specially prepared DNA probes to detect subtle changes in the DNA of the carrier.

Restriction Fragment Length Polymorphisms and DNA Probes RFLPs are often referred to as marker DNA, that is, a segment of DNA that lies near an unidentified location of a gene that causes a genetic disease. If the marker DNA or RFLP is consistently inherited by victims of the disease, it signals that the defective gene must be near the marker. Therefore, genetic markers serve as landmarks for the hidden genes in diagnostic testing. They also define the region on the chromosome where the gene must be and narrow the effort to isolate the defective gene itself. Tests for individual diseases are created by locating a series of RFLPs that tightly encompass the suspected disease locus. Using RFLPs as DNA probes, it is theoretically possible to detect most of the diseases caused by single gene mutations. By early 1988, using specific RFLPs as gene probes, commercial testing was established for the prenatal detection of twenty-six autosomal recessive or X-linked recessive diseases such as cystic fibrosis, sickle-cell anaemia, phenylketonuria and Huntington's disease-and of X-linked disorders-retinitis pigmentosa (vision gradually lost), ornithine transcarbamylase deficiency (accumulation of ammonia resulting in mental retardation, cerebral palsy, and early death) and Duchenne's muscula dystrophy. In addition, the "recessive oncogene" responsible for the genetic predisposition to retinoblastoma was discovered. Currently, more than fifty commercial companies are using or planning to use gene probes to locate defective human genes. Present tests indicate only whether a foetus of a family that already has a child with a given disease will also carry the defective gene. Tests that can screen a large population of pregnant women for a certain disease cannot be divised until the actual genes for the disease are identified and cloned. That there are about 3.3 million live births per year in the United States gives some idea of the potential market for genetic screening. Because of the rapidly expanding use of RFLPs and genetic probes for prenatal, neonatal and carrier genetic screening, five examples of the use of these techniques are provided. Molecular Analysis of Huntington's Disease, Cystic Fibrosis, and Sickle-Cell Anemia Routinely. 25 to 60 mg (micrograms) of DNA can be obtained from the leukocytes in each millilitre of whoie blood. and 10-20 ml of blood should provide sufficient DNA for many analyses. Foetal DNA can be obtamed from cultured (two or three weeks of growth) or uncultured amniotic fluid foetal fibroblast cells. After DNA is isolated, a smali amount (S mg) is digested with one of the various restriction endonucleases, depending on the indication for the study. About once in every 2S0-base sequence, a mutation occurs, making each person's DNA as individual as his or her fingerprints. Most of these mutations are harmless and go unnoticed. OccaSionally, however, a mutation occurs at a restriction site. When it does, the endonuclease will not cut at that site. For example, an endonuclease that makes a cut between adenine and thymine will bypass the site if a mutation has substituted cytosine for thymine. The resulting DNA fragment will be longer than a fragment cut from a stretch of DNA in which the mutation has not occurred. However, because both fragments share many of the same base sequences, they will attract the same DNA probe. Each size of the fragment constitutes a haplotype. A particular RFLP may have any number of haplotypes, depending on restriction site mutations. RFLP haplotypes, like any other allele, are inherited two-to-a-person-one from each parent. As such, RFLPs, when found near a region that carries a defective gene, may serve as genetic markers for that gene. Using genetic probes to pinpomt RFLP, marker DNA becomes meaningful when a person is heterozygous for RFLP. The DNA fragment to which a probe hybridizes on one chromosome is

Screening and Analysis of Recombinants

121

different in length from the fragment to which it hybridizes on the homologue. Not just any heterozygote will do, however. For a RFLP to mark a gene, it must be present on the same chromosome as the gene and not on the other homologue. In this phase, the RFLP and the disease-causing gene are said to be coupling. If, instead, the RFLP is on one homologue and the gene on the other homologue (an arrangement called repulsion), the RFLP will segregate from the gene of interest during meiosis and the predictive potential of the RFLP is lost. A Southern blot cannot distinguish between a heterozygote in coupling and repulsion. This requires a shift from molecular genetics to transmission genetics and use of pedigree analysis. For the dominant diseases in which inheriting a single allele is sufficient to cause symptoms such as Huntington's disease, a RFLP is indeed a marker if it shows up in all relatives who have the disease, but not in those who are healthy. Dominant disorders often have a late onset of symptoms, so that the presence of the marker in someone too young to show symptoms or in a foetus is a sign of what will come. For an autosomal recessive condition such as cystic fibrosis, one marker from each parent is present in an affected child. If those same two marked chromosomes are later detected in a foetus, a diagnosis is made. Sex-linked disorders are marked by a single RFLP on the X-chromosome in males and by two RFLPs in females. It is a change in the restriction sites within the beta-haemoglobin gene that allows for the detection of heterozygous (carrier) parents and the determination of whether a foetus will be born with sicklecell anaemia. The mutation of A to T in the base sequence of the beta-haemoglobin gene eliminates a restriction site for the endonuclease MstII. The mutation in the haemoglobin can be detected by digesting mutant (sickle cell) and normal DNA with MstII and performing Southern blot hybridization. MstII generates, from the chromosome carrying normal DNA, a 1.1 kilobase beta-haemoglobin gene RFLP; from a chromosome- carrying sickle-cell DNA, the RFLP is a 1.3 kilobase fragment. Thus, homozygous normal DNA yields two 1.1 kb RFLPs, a carrier has one of each, and an affected person, two 1.3 kb RFLPs. Because all sickle-cell alleles bear the same base change, the test works for anyone, without the need for testing the DNA of relatives. Similar RFLP site analysis has now been achieved for many genes, including the human growth hormone gene discussed in the next section. Restriction Fragment Length Analysis of the Human Growth Hormone Gene Human growth disorders are reflected in a phenotype of tall or short stature. Short stature can be caused by a variety of environmental, genetic or abnormal chromosome-associated syndromes. Genetic disorders involving the production of growth hormone are now easily diagnosed because, through RFLP analysis, the growth hormone gene located on chromosome 17 can be examined. In a report by John Phillips (1985), DNA was obtained from all twelve members of three families. Two of the families were closely related, and the third remotely related. From the three families, collectively, four of the children were affected with isolated growth hormone deficiency lA (IGHD-IA). Family DNA samples were cleaved with the endonuclease BamHI, which produced a number of fragments representing the growth hormone and adjacent genetic material. From previous restriction fragment length DNA analysis, it was known that one fragment with a length of 3.8 kb (3,800 bases) included the growth hormone gene. A comparison of autoradiographs clearly showed that the 3.8 kb fragment band containing the growth hormone gene was missing in each of the affected children. The 3.8 kb fragment band was present in the normal parent of the children, but appeared with about half the intensity when compared to the controls, which implies that the parents are heterozygous. Although it could have been concluded that the parents were carriers based on Mendelian recessive gene genetics, the bands offered very striking confirmation. More important, however, the fragment bands revealed that of the three normal children, two were IGHD-IA heterozygous carriers (like their parents) and one was homozygous normal. In terms of later life genetic counseling, this is very important information for the children to have.

122

Genetic Engineering and Cloning

An addition spin-off from these findings-that the genE: was deleted or missing in the affected children-afforded an explanation as to why some children make antibodies to deactivate exogenous growth honnones and stop the child's growth, while other children do not make the HGH antibody. If the IGHD-1A gene is missing, the body never had the opportunity to index its "immunological bank," it will not recognize the administered honnone, and therefore, it will treat the honnone like any other foreign protein-by making antibodies against it. The availability and use of RFLPs in genetic diagnosis is a giant step forward in prenatal diagnosis and carrier detection for a number of human genetic diseases and in helping to locate defective gene loci. The use of RFLPs, however, is time consuming and generally requires DNA analysis of relatives. For genes having a known location, like those for haemophil1ia A and Duchenne's muscular dystrophy, DNA probes made specifically for these genes allow direct individual analysis.

Gene Probes for Haemophilia A Blood factor VIII:C gene is currently one of the largest genes known. It is 186,000 pairs long, consisting of twenty-six exons, seven TAQ 1 enzyme restriction sites and encodes a protein containing 2,351 amino acids. Haemophilia A accounts for about 85 percent of all haemophiliacs. Collectively, there are over 100,000 cases of haemophilia A and B in the United States. In 30 percent of the cases, there is no family history of the disease, meaning that 3 of every 10 cases occur by fresh mutation. Seven of 10 cases are, in general, due to female carriers giving rise to haemophiliac sons. About 1 in 10,000 live male births is a haemophilic. Each year, about four hundred couples in the United States are at risk for producing a hemophiliac child. The gene for factor VIII:C has been isolated and cloned. The availability of the cloned factor VIII gene probes has allowed researchers to accurately locate the molecular cause of haemophilia in an increasing number of haemophiliacs, and has provided a less complicated system than the RFLP system for prenatal diagnosis and detection of female carriers of haemophilia. Recent analysis of the DNA by Antonarakis (1987) of several hundred haemophiliacs, using gene probes, has revealed fifteen deletions of part of the gene, each removing one or more exons, two insertions and twelve point mutations. The deletions range from 1 percent to about 99 percent of the gene. the majority of these deletions were associated with severe expression of the disease. In five of the point mutations, located at different sites in the gene, the DNA codin CGA (for arginine) mutated to TGA, a tennination codin. Thus, five of the twelve mutations result in th production of an incomplete protein. Another point mutation occurred in an intron, producing a splicing error. This splicing error produced an abnonnal mRNA (contains a piece of intron), which in tum produced an abnonnal protein. In this case, the patient's factor VIII level is about 20 percent of nonnal and the disease is mild. Studies of the haemophilia gene bring out an interesting yet logical phenomenon. This ia a large gene, about three times the length of the average gene. Thus, it appears that the larger the gene, the more things that can go wrong, and the more that can go wrong, the more that will go wrong.

Gene Probes for Duchenne's Muscular Dystrophy In 1985, Kunkel and colleagues began a molecular search for the Duchenne's MD gene. They used DNA from a male ~uchenne' s MD patient that demonstrated a deletion of DNA from the Xp21 region. DNA fragments from the Xp21 region of this male's DNA were used to hybridize with DNA extracted from a nonnal persons Xp21 region. Nonnally, DNA hybridizes in a complementary fashion, but because of the deletion of bases in the male patient's Xp21 region, there was no DNA to hybridize to the nonnal gene area. The gap of unhybridized DNA to the nonnal DNA revealed the location of the Duchenne's MD gene then made complementary to the nonnal gene site, and those DNA probes were then used to detennine how much of this gene region was deleted or mutated in a Duchenne's MD patient or in definite or suspected carriers. This work was then expanded to include the identification of allelic Becker's MD patients and carriers (Brown et al. 1985). Using DNA probes, 98 percent accuracy has been achieved in prenatal diagnosis and in carrier detection

Screening and Analysis of Recombinants

123

for these muscular dystrophies. Because so much is now known about the DMD locus, it is believed that successful gene therapy will occur in the near future. The DMD gene is the longest human gene found to date. It spans over two million base pairs (2,000 kb) on the short arm of the X chromosome-band Xp21-and neither its S' nor 3' end have been identified. The mRNA transcript is 14 kb. A protein, dystrophin, has been recently identified by Hoffman and colleagues (1987). Dystrophin is present in normal muscle tissue but absent from affected persons. To date, sixty exons have been mapped, with the total expected to be about one hundred (Robertson 1987). About SO percent of the mutations found with the use of DMD probes are deletions and were located in the distal half of the gene. The high percentage of DMD cases that result because of a deletion means that at least half of prenatal diagnosis should be possible without genetic linkage analysis. In addition, it has been reported that there may not be a simple relationship between the location or the extent of the gene deletion. For example, a Becker's MD (an allelic from of the DMD gene) patient, age sixty-one and still walking, has a deletion of at least a third of the gene and includes deletions that, in other patients, cause DMD. Genetic screening programs as presented in this chapter must be coupled with genetic counseling that makes it clear to individuals that faulty genes are part and parcel of human biology; that individuals have no say in their inheritance; that, in most cases, they cannot be certain as to which of their genes will enter their offspring or how those genes will perform in a new biological environment; and that chance, an unguided, uncontrollable event, plays a large part in human reproduction.

11 APPLICATION OF RECOMBINANT

DNA

TECHNOLOGY Biotechnology is not new. Ancient civilizations, such as the Babylonians, the Romans and the Chinese practised the making of beer, wine, bread, yoghurt and cheese. Much, much later came vaccines, the production of basic chemicals (e.g. glycerol, citric acid, lactic acid) and the production and development of antibiotics. In each of these instances, existing qualities of microorganisms were used. For example, Penicillium species naturally make penicillin. By repeated rounded of mutation and selection, coupled with optimization of the growth medium, scientists have increased the yield of penicillin. Similarly, sexual crosses between related plant species have created high-yielding and disease-resistant varieties of cereals. These improved cereals represent new combinations of genes and alleles already living in wild strains. There was a major paradigm shift with the progress of gene manipulation techniques in 1970s. For the first time, microorganisms could be made to synthesize compounds that they had never synthesized before, e.g., insulin production iIf E. coli. Soon all sorts of commercially or therapeutically useful proteins were being made in bacteria, principally E. coli, and thus the modern biotechnology industry was born. There was a concomitant e~pansion of the biotechnology industry to exploit the new opportunities being provided as the techniques developed for manipulating genes in bacteria were extended to plants and animals. Today th~re are many different facets to the commercial exploitation of gene manipulation techniques. NUCLEIC ACID AEQUENCES AS DIAGNOSTIC TOOLS

There are two separate methods of using the nucleic acid sequence diagnostically. The first is to determine whether a specific, relatively long sequence is present in or absent from a test sample. A good instance of such an application is the diagnosis of infectious disease. By choosing proper probes, one can ascertain in a single step which, if any, microorganisms are present in a sample. Alternatively, a search could be made for the presence of known antibiotic-resistance determinants so that an proper therapeutic regime can be instituted. In the second way in which sequences are used diagnostically, the aim is to determine the Similarity of sequences from different individuals. Good instances of this approach are prenatal diagnosis of genetic disease and forensic profiling ('DNA fingerprinting') .

Detection of Sequences at the Gross Level Imagine that a seriously ill individual has a disorael' of the gastrointestinal tract. A likely cause is a microbial infection and there are a number of candidate organisms. The question is, which organism

125

Application of Recombinant DNA Technology Transgenic animals

Nucleic acids

,, 0,'

c:'

'e: Lo' ai'

~

Fig. 11.1. The different ways that recombinant DNA technology has been exploited.

is present and to which antibiotics is it susceptible? The sooner one has an answer to these questions, the sooner can effective therapy begin. Conventionally, in such a case, a stool specimen would be cultured on a types of different media and would be examined microscopically and tested with different immunological reagents. A simpler approach is to test the sample with a battery of probes and determine which, if any, hybridize in a simple dot-blot assay. It is possible to vary the stringency of the hybridization reaction to accommodate any sequence differences that might exist between the probe and the target with such a simple format. The downside of this approach is that if one wishes to test the sample with 10 different probes, then 10 different dot blots are needed; otherwise there is no way of determining which probe has bound to the target. Another disadvantage of this approach is that sufficient target DNA must be present in the sample to enable a signal to be detected on hybridization. By using polymerase chain reaction (PCR), both these problems can be overcome. The sample DNA is immobilized on a membrane and hybridized with a selection of labelled probes in a conventional dot blot assay. An alternative is a 'reverse dot blot', where the probes are immobilized on the membrane and hybridized with the sample. In this way, only one hybridization step is needed, because each probe occupies a unique position on the membrane. The sample DNA requires to be labelled and this can be achieved using the PCR for this approach to work. This has the added benefit of amplifying the sample, thereby minimizing the amount of target DNA needed. The downside of this approach is that the amplification step needs to be done with multiple pairs of primers (multiplex PCR), one for each target sequence. Although multiplex PCR is now an established technique, considerable optimization is needed for each application. The major problems encountered are poor sensitivity or specificity and/or preferential amplification of certain specific targets. Because of the formation of primer dimers. the presence of more than one primer pair in the reaction increases the chance of obtaining spurious amplification products. Such non-specific products may be

126

Genetic Engineering and Cloning

amplified more efficiently than the Conventional dot blot wanted target. Clearly, to avoid this Membrane problem, the design of each primer is crucial. Another important feature is that all primer pairs should enable similar amplification efficiencies for their respective targets. Despite the difficulties noted above, multiplex PCR has been used successfully in the diagnosis of infectious diseases. For instance, Heredia et al. (1996) have used the technique to simultaneously examine blood for the presence of HIV-l. HIV-2, human T-cell lymphotropic virus Reverse dot blot (HTLV-I) and HTLV-II. Similarly, Grondahl et al. (1999) have used the technique to identify which of the ProbeE ProbeD Probes ProbeC Probe A nine different organisms is responsible Labelled for respiratory infections. Once the test DNA identity of a microorganism in a specimen is known by the microbiologists, he/she can select those antibiotics that might be effective, prOvided that the organism in question does not carry multiple drug-resistance determinants. Fig. 11.2. Comparison 0/ conventional dot blot assay with reverse dot The presence of these determinants blot method. can also be established utilizing multiplex PCR. Alternatively, if a virus causes the infection, one can monitor the progress of the infection by using quantitative PCR. This approach has been used to monitor cytomegalovirus infections in kidney-transplant patients. By the rapid progress in the sequencing of microbial genomes, the progress of multiplex PCR technology is being facilitated, since the data generated enable sepecies-specific or sequences to be identified.

~:QJ

o

o

o

o

o

I

o

o

o

o

Comparative Sequence Analysis: Single-Nucleotide Polymorphisms (SNPs) There is a need to determine which alleles of a specific locus are being carried by the foetus, i.e. is the foetus homozygous for the normal or the deleterious allele or is it heterozygous in the prenatal diagnosis CI genetic disorders. In forensic DNA, profiling the requirement is to match DNA from the perpetrator of a crime with that of a suspect. In each case, a definitive answer could be obtained by sequencing the relevant samples of DNA. While this is possible, it is not practicable for mass screening. An alternative could be to detect hybridization of specific probes. This has been done for the detection of sickle-cell anaemia by Conner et al. (1983). They synthesized two 19-mer oligonucleotides, one of which was complementary to the amino-terminal region of the normal ~-globin {~A) gene and the other of which was complementary to the sickle-cell ~-globin gene (~S). Those oligonucleotides were radio-labelled and used to probe Southern blots. The probes can smoothly differentiate the normal and mutant alleles under appropriate conditions. The DNA from normal homozygotes only hybridized with the ~A probe and DNA from sickle-cell homozygotes only hybridized with the ~s probe. DNA of heterozygotes hybridized with both probes. These experiments, therefore, showed that oligonucleotide hybridization probes can discriminate between a fully complementary DNA and one having a single mismatched base. In the can producer 250-800 litres of milk, so the production potential is significant

Table 11.3. Some recombinant proteins produced in the secretions of animal bioreactors. System

Species

Product

Milk

Mouse

Blood serum

Rabbit Sheep Goat Rabbit Pig Mouse Mouse

Sheep ~-lactoglobulin Human tissue-plasminogen activator Human urokinase Human growth hormone Human fibrinogen Human nerve growth factor Spider silk Human erythropoietin Human er-speed centrifuge equipped with a fixed angle rotor (e.g. Sorvall SS34). Other comparable centrifuges will perform equally well, but specified speeds and times of centrifugation might have to be changed slightly. The operations manuals for your particular centrifuge and rotor will explain these changes. If a super-speed centrifuge is not available, consider the alternative protocol for cell fractionation described below. The assay of mitochondrial marker enzyme activity requires the use of a spectrophotometer with a band width of 5 nm or less. Before using the cytochrome c solution in the assay, check to see that it is completely reduced. To do this, add 1 or 2 crystals of sodium dithionate to 1 ml of cytochrome c stock solution. Transfer solution to the spectrophotometer cuvette and measure its absorbance at 550 nm and 565 nm. The AssclA56S ratio should be 9-10. A blender is required for tissue homogenization. A standard household blender will work well, but the blades should be as sharp as possible (some laboratories have been known to modify their blenders by replacing the standard blades with razor blades!). Plant material The protocols in this unit all call for the use of pea seedlings as starting material. The seed is relatively inexpensive and easy to grow. For best results, use fresh seed. Seedlings should be about seven days old for the lab. To plant, soak seed overnight in a large container. Sow the seeds on a layer of about 1.5 inches of wet horticultural grade vermiculite in a standard nursery flat (21 x 10 x 2 inches). The seed can be sown thickly - nearly touching one another. (We usually use a 500 ml beaker-full of dry seed to plant one flat. At harvest, you can expect about 300 9 of root materiaL)

157

Mitochondrial Extraction

vesicles

cisternae

outer inner membrane membrane

lumen ofER

space

Fig. 13.1. Mitochondria and endoplasmic reticulum.

Cover the seed with 0.5-1 inch of vermiculite and water well. Cover the flat with plastic wrap to hold in moisture until the seedlings begin to emerge. Once the seedlings have emerged and the plastic has been removed, keep well-watered. The seedlings can be grown in the lab on a window sill, in a growth chamber or in the greenhouse. Shoot material, not used in this exercise should be saved, air dried or freeze dried, and stored for genomic DNA isolation.

Solutions required Homogenization Buffer 70 mM sucrose 220 mM mannitol 0.5 g/l Bovine Serum Albumin 2.0 mM HEPES pH 7.4 0.1 M potassium phosphate buffer, pH 7.4 0.8M ascorbic acid 4% triton X-lOO 5 mg/ml cytochrome c Sodium dithionate crystals METHOD

Isolation of Mitochondria All solutions should be kept ice-cold. Keep cell homogenate on ice while you are working. 1. Harvest 5 grams of 7 -day-old pea roots, shake off vermiculite in which they are growing, and rinse in a beaker of distilled water. 2. Chop the roots into small pieces with a razor blade or scissors and put into a chilled blender with 20 ml ice-cold homogenization buffer. (Note: More than one 5 gram batch of roots can be

158

Genetic Engineering and Cloning

homogenized at a time. If several lab groups are sharing the blender, they should use 20 ml of buffer for each 5 grams of roots homogenized, then divide the homogenate. 3. Homogenize the tissue with five 2-3 second bursts of the blender at high speed. 4. Filter the homogenate through four layers of cheesecloth plus one layer of Miracloth. It may be necessary to squeeze the filtrate through the cloth. Wear gloves. 5. Pour the filtrate into a centrifuge tube, balance against a tube of water or against a tube from another lab group, and centrifuge at 4°C, 700 x g, 10 minutes (2500 rpm in a Sorvall SS34 rotor). 6. Decant the supernatant into a clean centrifuge tube and centrifuge at 4°C, 10,000 x g, 10 minutes (9500 rpm in a Sorvall 5534 rotor). 7. Decant the supernatant from the tube into a beaker and save it on ice. You will use it for the next experiment. The pellet at the bottom of the centrifuge tube should contain isolated mitochondria. Wash them by gently resuspending them in 20 ml of fresh homogenization buffer. This is most easily done by pipetting 1-2 ml of the buffer into the tube and us!ng a small paint brush to break up the pellet. Once the pellet is resuspended In this small volume, it can be diluted with the remaining 18-19 ml of buffer. 8. Recentrifuge the washed mitochondria as in step 6 above. 9. Discard the supernatant from this spin and resuspend the mitochondrial pellet in 5 ml of homogenization buffer. Assay of a Mitochondrial Marker Enzyme 1. From the ice bucket, remove 0.2 ml of the mitochondria preparation to each of two small test tubes and 0.2 ml of the 10,000 x g supernatant to one small test tube and allow them to come to room temperature on the lab bench. To one of the tubes containing mitochondria, add 0.8 ml of potassium phosphate buffer (a 1/5 dilution). To the other tube of mitochondria, add 1.8 ml buffer (a 1/10 dilution). 2. Assemble four reaction mixtures in four small test tubes: Reaction Mixture (in each test tube) 0.1 M potassium phosphate buffer, pH 7.4 50 III 4% Triton X-100 25 III 5 mg/ml cytochrome c 50 III Distilled water 675 III Sample to be assayed (mitochondria dilutions or supernatant) 200 III 3. One of the four tubes above contains no sample to be assayed. Transfer the contents of this tube to a cuvette and use it as a blank in the spectrophotometer. If your spectrophotometer requires a reference cuvette, blank the cuvettes with water and use the contents of this tuba as your reference. 4. To perform the assay, transfer a reaction mix containing sample to a cuvette and place into the spectrophotometer. Record the absorbance at 550 nm at 20 second intervals for one mInute to determine the rate of the reaction in the absence of substrate. This value (the slope of this line) will be used in step 7 below as a correction factor in your calculation of the rate of the enzymecatalyzed reaction. If your spectrophotometer uses a reference cuvette, this step is not necessary. 5. Start the reaction by removing the cuvette from the spectrophotometer and adding 10 III of 0.8M ascorbic acid. Mix contents of the cuvette by Inversion and qUickly replace the cuvette in the spectrophotometer. Record the absorbance at 550 nm at 20 second intervals for 2 minutes. 6. Repeat steps 4 and 5 for each sample to be assayed. 7. Calculate the rate of cytochrome c oxidation by each of the samples:

Mitochondrial Extraction

159

Change in absorbance / minute - Change in absorbance / minute Rae=------~-----------------------=--------------------t Molar absorptivity of cytochrome x path length of light through the cuvette Molar absorptivity of cytochrome c = 18.5 X 106 M-I Path length through cuvette is usually 1 cm. The units attached to rate are moles of cytochrome c oxidized per minute. In general, this value would be reported as rnicromoles cytochrome c oxidized per minute, thus, calculation is simplified to: R t _ Change in absorbance / minute (corrected as above) ae18.5 Note: Enzyme activity is usually reported In the literature as specific activity. This is a way of standardizing the reporting of enzyme activity since the exact molar concentration of enzyme in the preparation being assayed is not known. How is specific activity related to the rate of reaction just calculated? Specific activity = rate/ mg protein (total) in the assay mixture. Protocol U~ing Clinical Centrifuge Only Objectives 1. Separate a cell homogenate into several fractions by differential centrifugation. 2. Compare the composition of the fractions by microscopy. 3. Assay mitochondrial activity in the fractions by a qualitative assay. All solutions should be ice-cold. Keep samples on ice at the lab bench if possible. 1. Harvest whole pea seedlings and wash in distilled water to remove planting material. Blot dry with paper towels. 2. Weigh out about 50 grams of seedlings, chop them into small pieces with a razor blade or scissors and transfer them to a chilled blender. Add 250 ml ice-cold homogenization buffer. 3. Homogenize tic;sue with five, 2-3 second burst of the blender at high speed. 4. Divide homogenate among lab groups. Each group should have 20-25 ml (enough for two, 1015 ml centrifuge tubes). 5. Filter the homogenate through four layers of cheesecloth plus one layer of miracloth into a beaker on ice. Gently squeeze the cloth to remove most of the liqUid. Wear gloves. Save the residue in the cheesecloth for examination later. Note: Homogenization of tissue and filtration step can be done prior to class by the instructor. 6. Divide filtrate in 2 centrifuge tubes. Tubes should be filled to same level to keep centrifuge balanced. Label tubes 1 and 2. 7. Centrifuge for three minutes at 200 x g . Start timing when the centrifuge rotor reaches top speed. Allow the rotor to coast to a stop when three minutes are up. 8. Remove the tubes from the rotor. Decant the supernatant from tube 2 into a clean tube (label the new tube 3). Save the pellet in tube 2 on ice. Add buffer to tube 3 to balance it against tube 1. 9. Return the tubes (1 and 3) to the centrifuge and spin at 700 x g for 10 minutes. 10. Remove the tubes from the rotor. 11. Decant the supernatant from tube 3 into a fresh tube (label 4). Save the pelleted material in tube 3. 12. Prepare wet-mount slides of the cell fractions (residue In cheesecloth and tubes 1-4) and examine them on the microscope. The residue in the cheesecloth consists largely of unbroken pieces of seedling tissue, cell debris, etc. Tube 2 contains material pelleted at low speed (200 x g) from the homogenate. Can you identify any of these components? Add a drop of iodine solution to the edge of the coverslip of your slide. Any starch grains present should tum blue-black in the presence of iodine. The pellet in tube 3 was separated from the homogenate at higher speed

160

Genetic Engineering and Cloning

(700 x g) and f9r a longer time (10 minutes) than that in tube 2. How is this pellet different from the pellet in tube 2? Are any of the components present in these two pellets the same? The supernatant in tube 4 should be relatively clear. Only the smallest cell components remain in this solution. Prepare a wet-mount slide of this supernatant. Add a drop of Janus green stain. With the stain, at high magnification, mitochondria appear as tiny, dark specks. Examine tube 1. This tube shows a history of the entire experiment and illustrates the principle behind differential centrifugation. The sediments at the bottom of the tube are arranged in layers. The largest, most dense cell components are at the tube's bottom. Additional layers of sediment were added to the pellet by higher centrifugal forces applied for longer periods of time. Only the tiniest of particles remain in solution at the end of the experiment. 13. Assay the activity of mitochondria. To demonstrate that mitochondria remain in the supernatant of the high speed spin (tube 4) and that they have been separated efficiently from other cell components, perform the following experiment: As you know, mitochondria are the subcellular sites of respiration. The activities of these organelles thus consume oxygen. Methylene blue dye is blue in the presence of oxygen, but is colorless when reduced (Le. when oxygen is removed from it). In this experiment, the presence of mitochondria is detected by the disappearance of blue color from the reaction mixture. Prepare 3 test tubes according to the chart which follows: Reaction 2 Reaction 3 Reaction 1 (Control) Component Buffer 3 ml 3rn1 6rn1 Pellet in tube 3 (resuspended in buffer) 3 rnI Supernatant from" tube 4 3 rnI Methylene Blue 2-3 drops 2-3 drops 2-3 drqps Mix each of the tubes well, then add 1 rnI of vegetable or mineral oil to the top of each. Incubate the tubes in a 37°C water bath several hours to overnight. Compare the tubes and record your observations.

Results The experiment is generally very reliable. Use of pea roots rather than shoots avoids possible problems with chloroplast contamination. Although different portions of pea seedlings are used in modules 6 and 8 of this unit, don't be tempted to save unused tissue from one experiment for the other experiment unless it can be used immediately. Fresh tissue gives the best results. Seedlings should be about seven days old (in any case, not older than twelve days). Yield of mitochondria is difficult to predict and depends on a number of factors including the effectiveness of homogenization. For this reason, two dilutions of the mitochondrial fraction are assayed for marker enzyme activity.

14 EXTRACTION OF CYTOPLASMIC

DNA

The DNA of plant cells is found in three distinct genomes. First, there is nuclear DNA, familiar as the DNA that makes up the chromosomes. But mitochondria and chloroplasts each have DNAs of their own. These genomes are closed circular DNA molecules encoding many of the enzymes necessary for the function of the organelles. Because of the importance of mitochondria and chloroplasts to the cell, their DNA is of interest to molecular biologists and biotechnologists. The chloroplast DNA of several species of plants have been cloned and sequenced in their entirety. In at least one organism (the green alga Chlorella), chloroplast as well as nuclear genomes have been genetically transformed. In this laboratory exercise, DNA will be isolated from chloroplasts and compared with total DNA. The objectives of this exercise are: . 1. To isolate DNA from chloroplasts, and 2. To compare chloroplast DNA to genomic DNA. Safety Guidelines Some reagents used in this protocol are potential hazards. CTAB, cetyl-trimethyiammonium bromide, is a strong detergent and can cause bums to the skin. Chloroform is toxic by inhalation or contact with skin. Follow instructor's direction for proper handling! disposal of these materials. Experimental Outline Day 1 DNA isolation (2 hrs.) Add EB buffer to chloroplast prep Incubate 1 hr, 65°C Extract with chloroform Precipitate DNA Resuspend in Buffer Day 2 Compare DNA from chloroplast to genomic DNA. Restriction Digest of DNA (optional) 'i'0ur gel, load cut and uncut DNA's Materials EB {extraction buffer): 50 mM Tris pH 8.0,1% CTAB, 50 mM E;D,JA, 1 mM 1,10-0phenanthroline, 0.7 M NaCI, 0.1% beta-mercaptoethanol Chloroform Isopropyl alcohol TE buffer: 10 mM Tris pH 8.0,1 mM EDTA

162

Genetic Engineering and Cloning

Centrifuge Tubes Water Bath (65°C) Centrifuge

Pre-Iab Preparation No special preparation beyond the requirements for those exercises is required for this activity.

Method 1. Start with the frozen chloroplast preparation. Typically, this sample will have a volume of several milliliters. For each milliliter of chloroplasts, add 4 ml EB. If necessary, transfer the mixture to a capped centrifuge tube of at least twice the volume of the chloroplasts and EB. 2. Incubate the mixture at 65°C for 1 hr. 3. Remove the tube from the water bath and allow to coolon the bench top for several minutes before proceeding. 4. Add an approximately equal volume of chloroform to the tube, recap and mix by inversion. 5. Centrifuge the tube at > 3500 x g for 10 minutes. 6. Upon its removal from the centrifuge, the tube contents will have separated into two distinct layers. Using a pipette, transfer the upper (aqueous) layer into a fresh centrifuge tube. (This tube should be of the same size as that used in the first step.) The lower (organic) layer is hazardous waste. Follow your instructor's directions for proper disposal. 7. Add 0.6 ml of isopropanol for each rrJ of DNA-containing extract in the centrifuge tube. Mix by inversion. 8. Centrifuge at > 10,000 x g for 20 minutes. 9. After centrifugation, decant the liquid in the tube away from the Fig. 14.1. A nonsupercoiled DNA-containing pellet. Stand the tube upside down on a paper covalent circle having towel or "Kimwipe" for several minutes to allow the liquid to drain. 36 turns of the helix. The tube's inside can be wiped carefully to remove liquid, but take care not to dislodge the DNA pellet. Results The yield of chloroplast DNA is expected to be low and will depend in some measure on the quality of the chloroplast preparation produced by the students. Also note that chloroplast DNA may not cut well with restriction endonucleases. Still, it is likely that at least one lab group or individual will get results that can be shared with the rest of the class; Some of the students will accept this activity as a challenge. Since it is teamed with an examination of total DNA, none of the students will be completely without results. The exercise is worth a try if for no other reason than it will give the students some experience in working with very small quantities of DNA.

15 EXTRACTION OF PlASTID Chloroplasts are the subcellular sites of photosynthesis, the process by which green plants, using energy from light, produce carbohydrate and oxygen from carbon dioxide and water. Under the microscope, chloroplasts are recognized as bean-shaped, membrane-bound, green (chlorophyll-containing) organelles. In this experiment, chloroplasts will be isolated from a cell homogenate by density gradient centrifugation. A measurement of the amount of chlorophyll in the preparation will be used to assess yield of intact chloroplasts. Finally, the chloroplasts will be saved for the isolation of DNA. Safety Guidelines Follow standard laboratory safety practices. Experimental Outline Prepare sucrose gradients (30 min) Harvest pea tissue and process sample (30 min) Apply sample to gradient and centrifuge (30 min) Retrieve chloroplasts from gradient and assay yield (30 min)

Materials Pea seedlings Homogenization buffer 10 mM KCI 1 mM MgCI 2 1 % (w/v) Dextran T40 1 % (w/v) Ficoll 0.1 % (w/v) Bovine Serum Albumin Make to volume with 30% (w/w) sucrose in 0.1 M Tricine buffer, pH 7.5 Ice bucket Cheesecloth and Miracloth (Calbiochem) Centrifuge tubes Sucrose (gradient) solutions (w/w, prepared in 0.1 M Tricine buffer, pH 7.5) 60%, 50%, 40%, 30% Pasteur pipettes Blender

164

Genetic Engineering and Cloning

Centrifuges (clinical and super speed) Spectrophotometer

Pre-lab Preparation TImetable of events The exercise can be divided into four parts: (1) preparation of sucrose gradients, (2) sample preparation, (3) centrifugation, and (4) analysis of results. Each of these activities will require approximately 30 minutes. Equipment requirements The protocol described here is written to be used with a refrigerated, super-speed centrifuge (e.g. Sorvall RC series) equipped with a swinging bucket rotor (e.g. Sorvall HB4). Other comparable centrifuges will perform equally well, but specified speeds and times of centrifugation might have to be changed slightly. The operations manuals for your particular centrifuge and rotor will explain these changes. The assay of chlorophyll content in gradient fractions requires the use of a spectrophotometer or colorimeter. A blender is required for tissue homogenization. A standard household blender will work well, but the blades should be as sharp as possible (some laboratories have been known to modify their blenders by replacing the standard blades with razor blades!). Plant Material : The protocols in this unit all call for the use of pea seedlings as starting material. The seed is relatively inexpensive and easy to grow. For best results, use fresh seed. Seedlings should be about seven days old for the lab. To plant. soak seed overnight in a large container. Sow the seeds on a layer of about 1.5 inches of wet horticultural grade vermiculite in a standard nursery flat (21 x 10 x 2 inches), The seed can be sown thickly nearly touching one another. (yJe usually use a 500 m1 beaker-full of dry seed to plant one flat. At harvest, you can expect about 300 g of shoot tissue from such a planting.) Cover the seed with 0.5-1 inch of vermiculite and water well. Cover the flat spherical bodies

Fig. 15.1. Chloroplast.

Extraction of Plastid

165

with plastic wrap to hold in moisture until the seedlings begin to emerge. Once the seedlings have emerged and the plastic has been removed, keep well-watered. The seedlings can be grown in the lab on a window sill, in a growth chamber or in the greenhouse. For best results, however, do not grow the seedlings under intense light. Under very bright lights, chloroplasts tend to accumulate large granules of starch and these can do damage during blending and centrifugation. Solutions required Homogenization Buffer 10 mM KCI 1 mM MgCI 2 1 % (w/v) Dextran T40 1 % (w/v) Ficoll 0.1 % (w/v) Bovine Serum Albumin Make to volume with 30% (w/w) sucrose in O.lM Tricine buffer, pH 7.5 Sucrose (gradient) Solutions 60%,50%,40%, and 30% sucrose (w/w) in O.lM Tricine buffer, pH 7.5

Method All solutions should be ice-cold. Keep solutions. samples, gradients. etc. on ice while you are working. 1. Prepare two sucrose gradients in 50 ml centrifuge tubes. (a) Pipette 5 ml 60% sucrose solution into bottom of each tube. (b) Layer 5 ml50% sucrose, then 10 ml40% sucrose into each tube. Layers should be distinct from one another if you are careful. (Hint: Tip the tube as you add each layer of sucrose. Let tip of the pipette just touch the surface of liquid in tube.) (c) With the tip of a pasteur pipette or stirring rod, gently mix at the interface of the 50% and 40% layers to diffuse slightly. (d) Layer 5 ml 30% sucrose on top of the gradient. (e) Keep the gradients on ice while you prepare tissue sample . .? l:iarvest 5 grams of 7-day-old pea seedlings at the soil line with a razor blade. 3. Chop the tissue into small pieces with a razor blade or scissors and transfer them to a chilled blender containing 20 ml ice-cold homogenization buffer. (Note: More than one 5 g batch of seedlings can be blended at a time. If several lab groups are sharing the blender, they should use 20 ml of buffer for each 5 g of seedlings homogenized, then divide the homogenate.) 4. Homogenize with five 2-3 second bursts of the blender at high speed. 5. Filter the homogenate into a beaker (on ice) through four layers of cheesecloth, squeezing the cloth gently to remove most of the liquid (wear gloves). 6. Re-filter the first filtrate through one layer of Miracloth, moistened in homogenization buffer, by gravity. Do not squeeze. You may want to prepare a wet-mount slide of the residue left in the cheesecloth or Miracloth for the microscope. What have you removed from the homogenate by filtration? 7. Layer 10 ml of the filtrate onto the top of each of your gradients (prepared in step 1). Check to see that the two gradients are balanced against one another. If necessary, add homogenization buffer to make the tubes balance. Centrifuge at 4°C in HB4 rotor, 4000 rpm for 5 minutes, then increase speed to 10,000 rpm for 10 minutes. Allow the centrifuge to coast to a stop. Carefully remove your gradients from the rotor.

166

Genetic Engineering and Cloning

8. You should see two green bands in the gradient. The green band toward the bottom of the tube is the fraction containing intact chloroplasts. Remove the top of the gradi~ht carefully with a pasteur pipet. Save the two chlorophyll-containing fractions in clean tub~~'on ice. 9. Prepare wet-mount slides of the chlorophyll-containing fractions and examine on the microscope. What differences do you notice between them? 10. Assay chlorophyll content of the two green bands. For each sample: (a) Into a clean centrifuge tube. pipette 50 III of the gradient fraction to be assayed and 0.95 ml distilled water. (b) Add 4 ml acetone. (c) Centrifuge in a clinical centrifuge, 5 minutes. (d) Measure the absorbance of the solution in a spectrophotometer at 652 nm. (The appropriate blank for this measurement is 80% acetone in water.) (e) Calculate chlorophyll content: A6s2 x 29 = Ilg chlorophyll/10 III chloroplast fraction. 11. Freeze the intact chloroplast fraction to save for DNA isolation. Results Make a diagram of your gradient. Have materials other than chloroplasts banded in the tube? Where are they? What do they look like? Why was the cell homogenate filtered before being loaded on the gradient? What was removed by filtration? What 'fraction of the chloroplasts in the homogenate have you isolated intact? After centrifugation, the gradients should show two bands of chlorophyll. The upper of the two contains broken chloroplasts and membrane fragments. The lower of the bands (about three quarters of the distance to the bottom of the tube) contains intact chloroplasts. Probably the most frequent cause of a poor yield of intact chloroplasts is over-blending. Using any type of homogenizer to disrupt tissue is a trade-off between efficiency in breaking cells open and generating so much shear in the solution that organelles are also disrupted. If you plan to use the chloroplasts from this prep for DNA isolation avoid contaminating the intact chloroplast fraction with broken chloroplasts. Also, try to retrieve the intact chloroplast fraction from the gradient in as small a volume as possible.

16 CELL ISOlATION Molecular analysis in tumor pathology should be performed in precisely determined areas within homogeneous tumor cells. The analysis of tumor-specific genetic alterations can be compromised by the presence of normal cells, Thus, contamination by stromal and inflammatory cells should be minimized. For reliable microsatellite analysis and detection of chromosomal deletions by loss of heterozygosity (LOH) studies, a tumor cell content of at least 80% is required. In order to obtain such high cell content from small tissue samples, accurate tissue microdissection is important. The spectrum of microdissection techniques ranges from manual approaches (needle microdissection) to the use of a micromanipulator and laser-assisted microdissection. These procedures are prerequisites for isolation of contamination-free, morphologically defined, pure cell populations from histologically heterogeneous tumor areas. The DNA used in these experiments was extracted from histological tissue sections using laser microdissection. Investigation of laser-microdissected lesions, which provide only relatively low tumor cell numbers, requires pre-amplification of the DNA using WGA when multiple microsatellite markers are to be analyzed.

DNA

ISOLATION

Equipment and Reagents QlAamp DNA Mini Kit (Qiagen) 10 x Expand HiFi PCR Buffer No.3 (Roche) Proteinase K (20 mg/ml) (Merck) Tween 20 (Merck) Nuclease-free water (Sigma) Gelatine (PCR Optimization Kit; Roche) Method 1. For isolation of DNA from 50-1000 cells, lyse the microdissected cells by the addition of 1 ~l of lOx Expand HiFi Buffer No.3 (final concentration 1 x), 0.5% Tween 20 (final concentration) and 1 ~l proteinase K (20 (~g), made up to a final volume of 10 ~l with nuclease-free water. Vortex the sample briefly and incubate for 4 hat 50°C, followed by 15 min at 94°C. or For isolation of DNA from more than 1000 cells, extract DNA using the QlAamp DNA Mini Kit, according to the manufacturer's specifications. Increase the DNA yield by eluting the DNA twice with 100 ~l of 70°C pre-heated water. Use a 10 ~l aliquot (or 10-100 ng DNA) for the I-PEP-PCR.

2. Quantify the DNA yield using a standard spectrophotometer by measuring the absorbance at 260 nm.

-----------------

17

DNA .EXTRACTION FROM SINGLE CELLS TISSUE

Equipment and Reagents

Phosphate-buffered saline (PBS) One-Phor-All Buffer Plus (Amersham Biosciences) Tween 20 (Sigma) igepal/Nonidet-P40 (Sigma) Proteinase K (10 mg/ml) Sterile, purified water (Sigma) Microcentrifuge Block heater or thermocycler Single-cell isolation buffer (1 x PBS; 0.5% Igepa\) Proteinase K digestion buffer (0.30 III of One-Phor-All Buffer Plus; 0.13 III of 10% Tween 20; 0.13 III of 10% Igepal; 0.26 III of proteinase K (10 mg/m\); 2.18 III of Hp; per sample)

Method 1. Transfer single whole cells, obtained by micromanipulation, into 1 III of single-ceU isolation buffer in a PCR tube. 2. Add 2 III of proteinase K digestion buffer and incubate the reaction for 15 hat 42DC. 3. Heat inactivate the proteinase K by placing the reaction at 80DC for 10 min. 4. Spin the reaction in a microcentrifuge to collect droplets formed by evaporation.

DNA

ExTRACTION FROM BULK TISSUES

Equipment and Reagents

QlAamp DNA Mini Kit (Qiagen) Sterile. purified water (Sigma) 1% agarose gel containing 10 nglml ethidium bromide 6 x loading dye [Ficoll-400 (Amersham Biosciences); 0.25% Orange G (Sigma)) Equipment and reagents for agarose gel electrophoresis including 1 x TBE agarose gel running buffer (89 mM Tris-HCl (pH 8.5); 89 mM boric acid; 2 mM EDTAJ UV light source and gel documentation system Spectrophotometer

DNA Extraction

169

Microcentrifuge Block heater or thermocyder

Method 1. Extract genomic DNA from tissue sections using the QlAamp DNA Mini Kit following the manufacturer's instructions with a modification to the elution step. 2. Elute the genomic DNA in purified water to prevent interference in subsequent reaction steps due to buffer incompatibilities. 3. Quantify genomic DNA by spectrophotometry or another method. 4. Analyze 200-300 ng by agarose gel electrophoresis to assess the DNA quality and degree of degradation.

18

DNA DNA

QUANTIFICATION

EXTRACTION AND QUANTIFICATION

Equipment and Reagents QlAamp DNA Blood Midi Kit (Qiagen) QlAamp DNA Blood Mini Kit (Qiagen) 1% Agarose gel containing 10 ng/ml ethidium bromide 6 x Orange loading dye solution (Fermentas) Equipment and reagents for agarose gel electrophoresis including 1 x TBE agarose gel running buffer (10.8 g/1 Tris base; 5.5 g/1 boric acid; 4 ml/1 0.5 M EDTA, pH 8.0; diluted from a 10 x stock) (Sigma) UV light source RediPlate 96 PicoGreen dsDNA Quantitation Kit (Invitrogen) Fluorescence-based microplate readers or fluorometer Method 1. Extract DNA from up to 2 ml of whole blood using the QlAamp DNA Blood Midi Kit, following the manufacturer,'s instructions. 2. Extract DNA from tissue sections (four sections of 5 Ilm thickness) using the QlAamp DNA BloOd Mini Kit, following the manufacturer's instructions. 3. Determine the size of the DNA by analyzing a 5 III aliquot by agarose gel electrophoresis (1% agarose gel containing 10 ng/ml of ethidium bromide). This will also assess the degree of DNA degradation. Detect the DNA under UV light. 4. Dilute the DNA extracted from blood 1:4000 in sterile water and from tissue sections 1:1000 in sterile water for quantification. 5. Quantify the DNA concentration using the RediPlate 96 PicoGreen dsDNA Quantitation Kit (or similar kit) in conjunction with a fluorescence-based microplate reader, following the manufacturer's instructions. 6. Prepare DNA solutions at a concentration of 1 ng/Ill for DNA from fresh tissue or cells. When using DNA extracted from fixed tissue, prepare the DNA solution at a concentration of 10 ng/Ill. FRAGMENTATION

Equipment and Reagents 0.2 ml Flat-cap tubes (ABgene) Strips of eight Thermo-Tubes and flat-cap strips (ABgene)

II

171

DNA Quantification

Thenno-Fast 96 Semi-Skirted PCR Plate (ABgene) GenomePlex Whole Genome Amplification Kit (Sigma) Thennal cycler

Method 1. Combine 10 f.!l of DNA sample (final concentration 10-100 ng) with 1 f.!l of 10 x Fragmentation Buffer (blue-capped tube) from the GenomePlex Whole Genome Amplification' Kit in a 0.2 ml flat-cap tube or a multi-well strip/96-well PCR plate. 2. Mix the sample by either pi petting or brief vortexing. 3. Consolidate the sample by centrifugation (5-10 s). 4. Incubate at 95°C for 4 min in a thermal cycler. 5. Following incubation,' cool the sample on ice for 5 min. LIBRARY PREPARATION

Equipment and Reagents GenomePlex Whole Genome Amplification Kit (Sigma) Thennal cycler Method 1. Add 2 f.!l of 1 x Library Preparation Buffer (green-capped tube) and 1 f.!l of Library Stabilization Solution (yellow-capped tube) to each sample. 2. Mix the sample by either pipetting or brief vortexing. 3. Consolidate the sample by centrifugation (5-10 s). 4. Incubate at 95°C for 2 min in a thermal cycler. 5. Following incubation, cool the sample on ice for 5 min and consolidate by centrifugation (5-10 s). 6. Add 1 f.!l of Library Preparation Enzyme (orange-capped tube), mix by pipetting or vortexing, and centrifuge briefly. 7. Incubate the samples in a thennal cycler using the following conditions: 16°C for 20 min, 24°C for 20 min, 37°C for 20 min, and 75°C for 5 min. 8. Store the reaction mixtures at -20°C for up to 3 days or continue with PCR amplification.

peR

AMpUFICATION

Equipment and Reagents JumpStart Taq DNA Polymerase (Sigma) or BD TITANIUM Taq DNA Polymerase (BD Clontech). 100 bp DNA ladder (Invitrogen) 1% Agarose gel containing 10 ng/ml ethidium bromide 6 x Orange loading dye solution (Fermentas) Equipment and reagents for agarose gel electrophoresis including 1 x TBE agarose gel running buffer (Sigma) Method 1. The volume of reaction constituents for this stage is dependent on the source of Taq DNA polymerase being used: JumpStart or BD TITANIUM. Both enzymes give comparable DNA yields'. Per reaction, combine 7.5 f.!l of lOx Amplification Master Mix (red-capped tube)' 47.5 f.!l of sterile water, 5 f.!l of JumpStart Taq DNA polymerase and the 15 f.!l from the library preparation step. or

172

2. 3. 4.

5. 6.

Genetic Engineering and Cloning

Per reaction, combine 7.5 III of lOx Amplification Master Mix (red-capped tube), 51.75 III of sterile water, 0.75 J!l of BD TITANIUM Taq DNA polymerase and the 15 III from the library preparation step. Mix the reaction constituents thoroughly by pipetting or vortexing, and centrifuge briefly. Use the following PCR profile for amplification: initial denaturation at 95°C for 3 min, followed by 14 cycles of denaturation at 94°C for 15 s and annealing/extension at 65°C for 5 min. Determine the size of the product by mixing 5 III of the reaction mix with 1 III of 6 x orange loading dye solution and resolving the aliquot by agarose gel electrophoresis (1 % agarose gel containing 10 ng/ml of ethidium bromide) alongside 4 III of a molecular weight marker (100 bp DNA ladder). Detect the DNA smears under UV light. Store the reaction mixtures at -20°C prior to purification.

19 WHOLE CELL SEPARATION Equipment and Reagents Nycodenz (1.3 g/rnlj Sigma) 0.9% NaCI . 1: 1 Ethanol/PBS (50 ml 1000% ethanol and 50 ml PBS (Sigma))

Method 1. 2. 3. 4. 5. 6.

7. 8. 9. 10. 11. 12.

Transfer 300 ~l of Nycodenz to a 2 ml Eppendorf tube and place; the tube at 40C for 5 min. Mix 1 g of soil with 5 ml of 0.9% NaCI and vortex the sample for 1 min. Leave the suspension at 4°C for 10 min. Vortex for 10 s. Place 600 ~l of the slurry on top of the Nycodenz. Centrifuge the Eppendorf tube for 10 min at 10 000 g. Transfer 600 ~l of the middle (and top) phase to a fresh tube. Centrifuge the Eppendorf tube at 10 000 g at 4°C for 2 min and discard the supernatant. Add 1 ml of 0.9% NaCI and mix well. Centrifuge the Eppendorf tube at 10 000 g at 4°C for 2 min and discard the supernatant. Resuspend the pellet in 500 ~l of 1:1 ethanol/PBS. Place the sample at -20°C for 8 h. AMpUflCATION OF GENOMIC

DNA

Equipment and Reagents 22 x 22 mm cover slide (Coming) Vaseline TE buffer (10 mM Tris-HCl (pH 8)j 1 mM EDTA) REPLI-g Kit (Qiagen)

Method 1. After the slides have dried, carefully apply Vaseline to the border of the cover slide on the side where the probed cells are situated. Mount the cover slide underneath the 3 mm microscope slide so that the cover slide covers the hole of the microscope slide. The probed cells on the cover slide should face inwards in the wl:!ll that is formed. 2. Apply moderate pressure to the cover slide to ensure that it forms a watertight well. 3. Fill the well with TE buffer (pH 8) and mount it in the inverse microscope.

174

Genetic Engineering and Cloning

4. Using the microinjector, fill the tip of the microcapillary with sterile TE buffer and manipulate it into the well of the microscope slide. 5. After having located the target cell-as identified by a positive probe signal-manipulate the tip of the micrcx:apillary close to the target cell and suck up the cell in the microcapillary by lowering the pressure inside the microcapillary by means of the microinjector (if necessary apply moderate force to the cell using the microcapillan) to loosen the cell from the glass surface). 6. Remove the microcapillary from the micromanipulator' and inject the captured cell into 13 ~l of . sterile TE buffer (pH 8) in a PCR vial. 7. Freeze-thaw the isolated cell five times in TE buffer and spin down the mixture after the final thaw cycle. This step lyses Archaea cells. 8. Carry out steps with the denaturation solution and neutralization solution, which is required for denaturation of the DNA template as well as for cell lysis. 9. Carry out MDA, follOwing the instructions for a 50 ~l MDA reaction in the REPU-g Kit (Qiagen).

INDEX A a-antitrypsin, 151 A. tumefaciens, 5, 6, 7, 142, 143 AFP,117 Agarose, 41 Agrobacterium, 5, 12, 102, 132, 136, 143 Agrobacterium tumefaciens,. 5, 17, 142 Alkaline phosphatase, 39 Alpha-foetoprotein, 117 Alzheimer's disease, 149 Aminoscopy, 113 Amniocentesis, 114 Anchor, 29 Anencephaly, 117 Antibiotic-carrying plasmid, 17 Antisene technology, 145 Antonarakis, 122 Aqueous phase, 76 Arabidopsis, 140 Arabidopsis thaliana, 83 Arbitrarily primed PCR, 32 Artificial insemination, 7 Artificial methods, 102 Aspergillus fumigatus, 140 Assembly PCR, 34 Automated sequencing equipment, 84 Autonomously replicating sequence, 68 Autoradiogram, 80 Autoradiography, 44 B

p-carotene, 146 p-lactoglobulin, 151 B. thuringiensis, 6 Bacillus, 138

Bacillus subtilis, 83, 92 Bacillus thuringiensis, 6, 12, 17, 138, 144 Back-translate, 86 Bal 31, 38 Becker's MD, 122 Biolystic gun method, 106 Blood coagulation factor IX, 150 Blood factor VIII, 16 Blumenthal, 101 Botrytic cinerea, 137 Brown, 98 Bt plants, 144 Burgess, 92 C Callus,S Calmodulin, 87 Calumoviruses, 142 Chankinbon, 97 Chemical methods, 102 Chimaeric, 148 Chladosporium fulwm, 137 Chorion, 115 Chorion frondosum, 115 Chorionic villi, 115 Chorionic villus biopsy, 115 . Cleared lysate, 53 Cloning, 10 Cloning vector, 47 Cohesive end sites, 60 Competence, 52 Competitor RT-PCR, 31 Complementing, 51 Conjugation, 52 Consensue, 93

Genetic Engineering and Cloning

176 Consensus, 93 Cosmids, 64 Creutzfeldt-Jakob disease, 15 Crick. 90 Cross-protection, 136 Crown gall, 5, 17 Crown gall disease, 142 Cryptic, 48

o DeleI, 127 Decidua basalis, 115 Deliberate release experiment, 144 Deoxyribonuclease, 38 Detect. 35 Developmental totipotency, 4 Disarmed. 143 Disease modelling, 133 DNA coding regions, 16 DNA dependent RNA polymerase, 90 DNA ligase, 40, 49 DNA non-coding regions, 16 DNA polymerase I, 39 DNA polymerases, 49 Dot blotting, 45 Drosophila, 149 Drosophila melanogaster, 83, 149 Duchenne's muscular dystrophy, 122 Dyrkla, 134 E E. coli, 12, 13, 15, 40, 45, 46, 47, 48, 49, 50, 51, 52, 53, 56, 58, 64, 65, 67, 68, 69, 70, 71, 73. 75, 92, 93. 104, 110, 111. 124, 139, 142 E. coli lac, 13 Early gene, 100 Eco,37 Ecology, 11 EF hand, 87 Effective, 125 Electrical methods, 102 Electroinjection, 104 Electrophoresis, 41 EMBL,87 Endonucleases. 36 Engineered DNA, 17 Enhances, 97 EPSP synthase, 144 EPSPS, 144 Epstein-Barr virus, 100

Escherichia coli, 37, 83 Existing, 124 Exons, 16 Exonucleases, 38 Expasy, 86 Expression vector, 46, 65 F Factor dependent termination, 96 Fibrinogen, 16, 151 Fidelity, 25 Fingers, 98 Ravr Savr, 145 Fluorescently labelled, 85 Foetoscope, 114 Foetoscopy, 113, G

Galactosemia, 118 Galanthus nivalis, 138 Geminiviruses, 142 Genbank, 87 Gene cloning, 18 Gene protection technology, 146 Gene therapy, 14, 133 Genetic Computer Group, 88 Genetic screening, 112. Genetic trait control technology, 146 Genetic use restriction technology, 146 Genetically modified foods, 141 Glyphosate, 144 GMOs, 141 Goldstone, 91 Green fluorescent protein, 151 H Haemophilia A, 16, 122 Haemophilus influenzae, 83 Hairy-cell leukemia, 16 Half-life, 25 Haplotype, 120 Hawley, 94 Hayward, 96 Helicases, 49 Helicobacter pylori, 83 Helper cells, 70 Hepatitis B virus vaccine, 16 Hexamer, 96 Hoffman, 123 Homocystinuria, 118 Host, 47

177

Index Host factor, 101 Howry. 112 Human factor IX. 151 Human Genome Project. 83 Human growth hormone. 15 Humulin. 15 Huntington's disease, 121 Hyposomatotropism, 15 Hypothyroidism, 118 I Ice minus, 2 Ice plus, 2 Ice-forming bacteria, 144 Ice-minus bacteria, 144 Immunological bank, 122 In trans, 70 In utero, 112, 113 In vitro, 14, 18, 47, 56, 61, 63, 111, 142 In vivo, 13, 27, 34, 59 Independence termination, 96 INFs, 16 Inosine, 24 Insert, 63 Insertional inactivation, 52 Integrase, 70 Intercalating dye. 42 Intercalation, 77 Interferons, 16 Internal, 31 lntrons, 16 Invasive, 112 Inverse peR, 32

J John Phillips, 121 K Klenow fragment, 39, 84 Knock-in, 150 Knock-out, 150 Kunkel. 122 L

Lewis, 92 Ligation, 27 Lindow, 18 Lipofection, 107 Liposomes, 107 Long terminal repeats, 70 Lysogeny, 58 Lytic-lysogenic decision, 59

M

Macroprojectile, 107 Maple syrup urine disease, 118 Mass, 99 Maxam-Gilbert method, 83 Meningomyelocele, 117 Methionine, 13 Microinjection, 9 Microprojectile, 107 Mini-Ti, 143 Minibrain, 134 Minichromosome, 18 MKMD,150 Monocots, 7 Mouse Knock-out, 150 Mouse mammary tumour, 149 MstII, 127 MSUD, 118 Multiple cloning site, 51, 57 Mus musculis, 83 Mutation Database, 150 N

N. benthamiana, 137 Narcissus pseudonarcissus, 140 Natural methods, 102 Nature, 144 Neonatal genetic screening, 118 Nested, 31 Neural tube defects, 117 Nlcotiana, 109 Nicotiana benthamlana, 136 NMR,88 Noninvasive, 112 Nopaline, 142 Nos, 142 Nucleases, 36 Nucleation, 2

o Octopine, 142 Oligonucleotide synthesizer, 83 Oncomouse, 149 Open complex, 93 Open reading frame, 86 Opines, 142 Organic phase, 76 Origin of replication, 49 Orphan receptors, 88 Oryza sativa, 83 Othale, 96

178

P P. fluorescens, 12 P. syringae. 17. 18 Packaging, 60 Packaging limits, 60 Paszkowski, 17 Patch, 134 Paul, 98 PCR, 20 Penicillium, 124 Peptidestructure, 88 Petunia, 109 Petunia hybrida, 135 Phage display, 65 Pharm animal, 147, 151 Pharming, 147, 151 Physical methods, 102 Phytophthora infestans, 137 Pichia, 68 Plaques, 60 Plasmid, 17, 48 Plasmodium falciparum, 14 Platt, 96 Polyacrylamide, 42 Polygalacturonase, 145 Polygenic, 141 Polylinkers, 57 Polymerase chain reaction, 20 Polynucleotide kinase, 39 Post coitwn, 105 Pribnou Box, 93 Primer dimers, 26 Primers, 101 Processivity. 25 Promiscuous. 49 Promoters, 92 Pronuclei, 147 Prosite, 87 Prostate mouse, 149 Protoplast fusion, 5 Protoplasts, 4 Protropin, 15 Pseudomonas flurescens, 12 Pseudomonas syringae, 2, 137, 144 R

R. solani, 137 Radioactive probe!', 80 Radiolabel, 84

Genetic Engineering and Cloning

Random amplification of polymorphic DNA, 32 RAPD-PCR, 32 Rapid amplification of cDNA ends, 29 Rate of synthesis, 25 Rattus norvegicus, 83 Real-time PCR" 35 Recombinant DNA, 18 Recombivax HB, 17 Relaxed plasmids, /48 Replacement vector, 62 Replicative form, 64 Restriction enzymes, 36 Restriction fragment length polymorphisms, 120 Restriction mapping, 38 Retroviral, 70 Reverse transcriptase, 39, 81 Reverse transcriptase, 70 Reverse transcriptase PCR, 30 RFLPs, 120 Rhizobium, 2 Rhizoctonia solani, 137 Ribonucleases, 38 Richard Palmiter, 15 Robert Guthrie, 118 Roberts, 96 Rolling-circle replication, 59 Roundup, 144 Roundup-ready, 145

S S. cerevisiae, 68, 69 S. hygtroscopicus, 136 S I-nuclease , 38 Saccharomyces cerevisiae, 68, 83 Salmonella, 12, 49 Salmonella typhimurium, 12 Sanger dideoxy method, 83 Scientific American, 22 Sequence, 23 Severe combined immunodeficiency syndrome, 149 Short gun method, 106 Shuttle plasmid, 50 Shuttle vector, 13, 68 Sigma factor, 91 Site-directed mutagenesis, 34 SnowMax, 17 Somatic-cell hybrid, 5 Somatostatin, 15 Specific, 133

Index

Spectrophotometer. 42 Spectrum, 42 Spina bifida, 117 Stable trait, 6 Staphylococcus aureus, 49 Stem-loop, 86 Stephen Lindow, 17 Streptococcus mutans, 133 Streptomyces, 48 Streptomyces hygroscopicus, 135 Stringency, 44 Stringent plasmids, 48 Stuffer fragment, 63 Sunbean, 17 Superinfection immunity, 58 Swiss-Port, 87 Symptoms, 133 T T-DNA, 5, 142 Tay-Sachs, 119 tDNA, 17 Technology protection system, 146 Terminal transferase, 39 Terminator technology, 146 Thermal cycle, 23 Thermus aquaticus, 23, 84 Thermus flavus, 25 Thermus thermophilus, 25 Theta, 59 Ti plasmid, 17, 142 Tissue plasminogen activator, 150 Traitor technology, 146

179 Transcription, 90 Transcriptional fusion, 65 Transduction, 52 Transgene, 102 Transgenesis, 102 Transgenic, 140, 147 Transgenic animals, 9 Transgenic mice, 16 Transgenic plants,S Translation, 90 Translational fusion, 65 Tumbleweed, 144 Tumor-indUcing DNA, 17

U Ultra sonication, 107 Ultracentrifugation, 76 Ultrasonography, 112 Undulated, 134 Unique sequence, 24 V Vaccinia, 27 Vector, 17, 47 W Watson, 90 Watson-Crick, 95 Weisz, 91 Western blotting, 46 Whey acid protein, 151 X X-irradiation, 112 X-ray diffraction, 88 Xenotranplantation, 133, 151