Frontiers in Human Genetics: Diseases and Technologies. Expanded and Updated Proceedings of the International Symposium on Human Genetics and Gene Therapy Held in Singapore 1999 9789810244583, 9810244584

Citation preview

FRONTIERS IN HUMAN GENETICS DISEASES AND TECHNOLOGIES

FRONTIERS IN HUMAN GENETICS DISEASES AND TECHNOLOGIES With a Foreword from Lap-Chee Tsui President o f the H u m a n G e n o m e O r g a n i z a t i o n (HUGO)

zzy

Expanded and Updated from the Proceedings of the International Symposium on Human Genetics and Gene Therapy, Singapore

Editors

Lai Poh San, Coral National University of Singapore

Eric P H Yap Defence Medical Research Institute, Singapore

b

zyx zyxwvu World Scientific

Singapore New Jersey. London Hong Kong

Published by

zyxwvutsrq zyxwvutsr

World Scientific Publishing Co. Pte. Ltd.

P 0 Box 128, Farrer Road, Singapore 91 2805

USA ofice: Suite lB, 1060 Main Street, River Edge, NJ 07661

UK oflice: 57 Shelton Street, Covent Garden, London WC2H 9HE

British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library

zyxwvutsrq zyxwvut

FRONTIERS IN HUMAN GENETICS Diseases and Technologies

Copyright 0 2001 by World Scientific Publishing Co. Pte. Ltd All rights reserved. This book, or parts thereoJ may not be reproduced in any fiwm or by any means, electronic or mechunical, including photocopying, recording or any information storage and retrieval system now known or to be invented, without written permission from the Publisher.

For photocopying of material in this volume, please pay a copying fee through the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers, MA 01923, USA. In this case permission to photocopy is not required from the publisher.

ISBN 981-02-4458-4

Printed in Singapore.

LIST OF CORRESPONDING AUTHORS

zy

zyxwvu

Thuan D. Bui Membrane Biology Laboratory Institute of Molecular and Cell Biology 30 Medical Drive Singapore 1 17609 E-mail: dtbui@ imcb.nus.edu.sg Peh Yean Cheah Department of Colorectal Surgery Singapore General Hospital Outram Road Singapore 169608 E-mail: [email protected] Betty,Cheng BioInformatics Centre National University of Singapore Lower Kent Ridge Road Singapore 1 19260 E-mail: [email protected] Eva Maria C. Cutiongco Department of Paediatrics University of the Philippines College of Medicine 547 Pedro Gil Street Ermita, Manila 1000 Philippines E-mail: [email protected]

V

vi

zyxwvutsrqpo

Suthat Fucharoen Thalassemia Research Center Institute of Science and Technology for Research and Development Mahidol University, Salaya Campus 25/25 M.3, Puttamonthon 4 Road Puttamonthon, Nakornpathom 73 I70 Thai land E-mail: [email protected]. th

zyxwvut zyxwv zyxwv zyxw

Jiro Fujimoto First Department of Surgery Hyogo College of Medicine Nishinomiya 663-850 1 Japan E-mail: [email protected]

Leena A. Gole Department of Obstetrics and Gynaecology National University of Singapore Lower Kent Ridge Road Singapore I 19074 E-mail: obggolel@n us.edu.sg Akinobu Gotoh Department of Urology Kobe University School of Medicine 7-5-2 Kusunoki-cho Chuo-ku, Kobe 650-001 7 Japan E-mail: gotoh@med. kobe-t4.ac.jp

vii

Kam Man Hui Gene Vector Laboratory Division of Cellular and Molecular Research National Cancer Centre 1 1 Hospital Drive Singapore 169610 E-mail: [email protected]

zy

zyxwvu zyxwvu zyxwv zyxwv

Mohd. Nizam Isa Human Genetics Unit School of Medicine Universiti Sains Malaysia 16150 Kubang Kerian Kelantan, Malaysia E-mail:zam@kb. usrn.my

Yasufumi Kaneda Division of Gene Therapy Science Graduate School of Medicine Osaka University Suita, Osaka 565-0871 Japan E-mail:[email protected] Pandjassarame Kangueane BioInformatics Centre #02-07 MD7 Medical Drive National University of Singapore Lower Kent Ridge Road Singapore 1 19260 E-mail:[email protected]. edu.sg

viii

zyxwvut zyxwvu zyxwvu

zyxwvut zyxwv

P.N.Kantaputra

Department of Pediatric Dentistry Faculty of Dentistry Chiang Mai University Chiang Mai 50200 Thailand E-mail: dnpdi00 [email protected]

Siok Im Koh Chemical Process & Biotechnology Department Singapore Polytechnic 500 Dover Road Singapore 13965 1 E-mail: [email protected] Oi Lian Kon Division of Medical Sciences National Cancer Centre 1 1 Hospital Drive Singapore 1696 10 E-mail: [email protected] Poh San Lai Department of Paediatrics National University of Singapore Lower Kent Ridge Road Singapore 1 19074 E-mail: [email protected]

IX

zy

zyxwvu zyxwv zyxwvu

Ann S.G. Lee Division of Medical Sciences National Cancer Centre 1 1 Hospital Drive Singapore 1 696 10 E-mail: [email protected]

Joy Y.Lee Department of Paediatrics University of the Philippines College of Medicine 547 Pedro Gil Street Ermita, Manila 1000 Philippines E-mail:joyyaplito@hotmail. corn

Masafumi Matsuo Division of Genetics International Center for Medical Research Kobe University School of Medicine 7-5- 1 Kusunoki-cho Chuo-ku, Kobe 650-00 17 Japan E-mail: [email protected]

zyxwvu zyxw zyxw

Vernon M.S. Oh Division of Clinical Pharmacology & Therapeutics Department of Medicine National University Hospital 5 Lower Kent Ridge Road Singapore 1 19074 E-mail: [email protected]

X

zyxwvutsrqpon

Carmencita D. Padilla Department of Paediatrics University of the Philippines College of Medicine 547 Pedro Gil Street Ermita, Manila 1000 Philippines E-mail: [email protected]

zyxwvut

Purnomo Suryantoro Pediatric Department Faculty of Medicine Gadjah Mada University Sekip Utara Yogyakarta 55281 Indonesia E-mail: [email protected]

zyxwvu zyxwvut zyxw

Stacey K.H. Tay Department of Paediatrics National University of Singapore Lower Kent Ridge Road Singapore 1 19074 E-mail: [email protected]

Stephen D. Wilton Australian Neuromuscular Research Institute 4‘” Floor “A” Block QE II Medical Centre Nedlands WA 6009 Australia E-mail: [email protected]

zy

zyxwvut zyxwvu xi

Lim Soon Wong Kent Ridge Digital Labs 21 Heng Mui Keng Terrace Singapore 1 196 13 E-mail: limsoon@krdl. org.sg

Eric P.H. Yap Defence Medical Research Institute Defence Science & Technology Agency 10 Medical Drive Singapore 1 17597 E-mail: nmiv3@nus,edu.sg

FOREWORD

zyx

zyx

The most exciting development in human genetics in recent years has been our ability to study diseases at the molecular level. The precise DNA sequence alterations and protein defects are now known for many singlegene Mendelian disorders and some forms of cancers. As the Human Genome Project has just completed its draft sequencing phase, we can look forward to an explosion of molecular genetic information on human diseases, especially those with a multifactorial etiology. Since the spectrum of gene mutations and DNA sequence variations often varies among different geographic regions and ethnic groups, it is important to develop efficient and affordable technologies for the collection of baseline data for individual communities. In addition, while the utility of our current knowledge from human disease gene research has initially been limited to DNA diagnosis and carrier detection, we should look forward to novel treatments and rational therapies in the near future. Gene therapy represents a promising approach in the latter regard where some initial success has been reported, but much development is required before its impact can be fully recognized. I congratulate Poh San and Eric for their tremendous effort in assembling this valuable volume of articles contributed by a group of young researchers in the Asia Pacific region. The book indeed captures a snapshot of the diverse approaches and solutions being developed at the frontiers of human genetics. It will be a valuable reference for researchers and students in molecular genetics and medicine as well as professionals in the biotechnology and pharmaceutical industries. Lap-Chee Tsui President, Human Genome Organisation (HUGO) Geneticist-in-Chiefand H.E. Sellers Chair in Cystic Fibrosis, The Hospital for Sick Children, Toronto, 200 1

xiii

PREFACE

zyx

zyxwvu zy zy zyxw

We are witnessing, at this transition between millennia, some exciting developments in human genetics research and discovery. While there has been unprecedented exposure in the public media of the human genome mapping project and its potential impact on human health and society, we have too, in the scientific communities, been awed by the rapid pace of progress as well as the new challenges and opportunities that this wealth in new biological information provides. This book was therefore born out of the need to document these discoveries in human genetics and molecular medicine, both as a practical help to those researching at the bench, as well as to capture a snapshot of the state-of-the-art in this rapidly evolving field. The title reflects the how’s (Technologies) and why’s (Diseases) that drive and motivate genetics research respectively. Three areas were picked to reflect major trends in genetics research, into which the contributions of this book have been arranged. The first section, Emerging Technologies, highlights the importance of new techniques and tools of genetic analysis that have increased the throughput of generating biological information. Some of these have found their way into clinical practice (e.g. fluorescent in situ hybridization) while others are being used to hasten the geneltarget discovery process (e.g. single nucleotide polymorphisms, discovery and genotyping). Research at the interface between biology and the physical/engineering sciences has resulted in advances in miniaturization (e.g. microelectromechanical systems and lab-on-chips), highly parallel processing (e.g. microarrays) and biological computation (e.g. data integration and prediction of macromolecular structures). The second section, Genes & Diseases, deals with the discovery of disease genes and their significance. Some genes of known cellular function have yet to be implicated in disease (e.g. SNARES), while on the other hand, there are syndromes in search of genes (e.g. mesomelic

xv

xvi

zyxwvutsrqp

dysplasia). In yet others, the gene has been identified and established. For the latter, the challenges include developing efficient mutation screening methods for diagnosis (e.g. dystrophin and retinoblastoma); applying these tests in a clinical and public health setting particularly in developing economies (e.g. ambiguous genitalia, maple syrup urine disease, congenital adrenal hyperplasia); and determining the allelic diversity in different populations (e.g. thalassaemia, G6PD-deficiency, familial adenomatous polyposis). Establishing the genotype-phenotype correlation in these Mendelian diseases is important for genetic intervention in the form of screening, counseling and therapy. The search for the genetic aetiologies for human diseases has also gradually progressed from defining the causative genes for Mendelian syndromes to elucidating susceptibility genes of complex genetic traits. Affected relative pair study designs and non-parametric statistical tools have allowed the analysis of common multifactorial diseases such as myopia, hypertension and neoplasia, and infections. The third section on Gene Therapy describes the nascent and rapidly evolving field of gene-based therapeutics for hitherto intractable genetic diseases. One of the basic challenges in this area is the development of effective and safe approaches for delivering genetic material to the specific cells of the patient. The various gene delivery methods and vehicles described here include naked DNA, liposomes, viral vectors and targeted delivery. Various approaches are also being attempted (e.g. antisense oligonucleotides, plasmid DNA, gene conversion) on several target tissues (e.g. muscle, liver, prostate). Part of the content for this book is derived from an earlier conference: The International Symposium on Human Genetics and Gene Therapy, held in Singapore in February 1999. This meeting was organized by the Biomedical Research and Experimental Therapeutics Society of Singapore, the Singapore Society for Microbiology and Biotechnology and the Singapore Society for Biochemistry and Molecular Biology with the National University of Singapore and the International Center for Medical

xvii

Research, Kobe University School of Medicine, Japan, as co-hosts. Financial sponsorship for the meeting and the proceedings in this book by the Japan Society for the Promotion of Science is gratefully acknowledged. While the original abstracts of presented papers are appended, the full papers have been extensively updated and revised. We wish to thank the scientists and clinicians who have kindly taken the time to contribute papers for this book. We are also grateful to Professor Lap-Chee Tsui, the President of the Human Genome Organisation (HUGO) for his support and encouragement of human genetics efforts in the region, and for authoring the Foreword. The artwork on the front cover was designed by Jimmy Low. Finally, Lim Sook Cheng and Alan Pui from World Scientific have eased this project from conception through the editorial hurdles to final print, and are therefore responsible to no small extent for the successful delivery of this publication.

The Editors

zy

zy zy zyxwvu

zyxw zyx zy zyxwvuts

List of Corresponding Authors Foreword

xiii

Preface

xv

4

V

I

Emerging Technologies

1.

FISH for the Obstetrician and Gynaecologist: A Rapid and Reliable Tool Aiding Clinical Analysis LA Gole, C Anandakumar, YC Wong and A Biswas

3

In silico Detection and PCR Confirmation of Novel Single Nucleotide Polymorphism (SNP) in Tissue Inhibitor of Matrix Metalloproteinase-2 (TIMP-2) SI Koh, CS Lim, GCH Tay, HM Lim, SGK Seah, SSM Tan, RYY Yong, HM Wu and EPH Yap

19

2.

3.

4.

5.

A Novel Method of Genotyping Single Nucleotide Polymorphisms (SNP) Using Melt Curve Analysis on a Capillary Thermocycler S-MAng and EPH Yap BioMEMsPLab-on-a-Chip”: Towards a Cheaper, More Rapid, Portable and ‘Automated’ High-Throughput Genotyping TC Ayi and EPH Yap

37

53 73

Silico Biotech P Kanguene and MK Sakharkar

xix

xx

zyxwvutsrqp zyxwvuts zyx

zyxwvu zyxw

Bioinforniatics Integration Simplified: The Kleisli Way LS Wong

79

7.

Issues in Secondary Structure Prediction Quality B Cheng

91

II

Genes & Diseases

8.

An Integrative Approach to the Identification Characterisation of Human SNARE GS27 TD Bui and WJ Hong

6.

9.

and

The Identification of SRY Gene as a Clinical Investigative Tool for Sex Ambiguity: An Experience in H.U.S.M. MN Isa and MZ Fuziah

10. GGPD Deficiency and Application of the MPTP Technique

101

Ill

121

PS Lai, T Shirakawa, K Nishiyama, M Mutsuo, R Joseph and SH Quak 1 1.

Glucose-6-Phosphate-Dehydrogenase (G6PD) Deficiency: Preliminary Report of the Multiplex PCR Tandem Forward Primers (MPTP) for Indonesian Yogyakarta Cases P Suryantoro, Tusmini, K Nishiyama, T Shirakuwa and M Matsua

139

12. Congenital Adrenal Hyperplasia: A Review of 13 Cases

zyx

Detected by Newborn Screening JY Lee, CD Padilla, C Fagela-Domingo, SC Cua and LR Abad 13. Analysis of Deletion Breakpoints in Dystrophin Transcripts

HH Khng, PS Low, WL Lee, HT 0n.g and PS Lai

151

I59

zyxwvutsr zyxw xxi

In Vitro Protein Translation in a Patient with Duchenne Muscular Dystrophy SKH Tay, HH Khng, WL Lee, PS Low and PS Lai

14. Confirmation of Predicted Mutational Effect by

15.

16.

173

zyxwvutsr zyx Maple Syrup Urine Disease: A Report of 26 Cases in the Philippines CD Padilla, CLT Silao and JY Lee

185

zyxwv

The Heterogeneity of Thalassemia in Southeast Asia S Fucharoen and P Winichagoon

17. Linkage Analysis of Mesomelic Dysplasia, Kantaputra Type PN Kantaputra, A4 Fujimoto, S Kondo, H Tomita, N Niikawa,

195

205

S Ikegawa, T Takagi, Y Nakamura, Y Fukushima, S Sonta, M Matsuo, T Ishida, T Matsumoto, H-X Deng, M D’urso, V Ventruto, MM Rinaldi, LO Langer Jr and RJ Gorlin 18.

Genetics and Susceptibility to Tuberculosis: A Review EMC Cutiongco

19.

Loss of Heterozygosity of the Chromosomal Region 1 lq22q23 in Primary Tumours of the Central Nervous System ASG Lee, TKY Lee, S Tohari, APC Chang, J Wang, YWShen, TT Ye0 and J Khoo

219

225

zyxwvutsrq RBI Gene Mutations with Constitutional Origin R Rong, YFL Ling, AEJ Yeoh, TC Quah, PS Low and PS Lai

233

Molecular and Clinical Profiles of Singapore Familial Adenomatous Polyposis Patients X Cao, KW EM,F Seow-Choen and PY Cheah

245

20. Identification of

21.

xxii

zyxwvutsrqpo zyxw

zyxwvu zyx zyxwv zy z zyxwv

22. Linkage of Dopamine Receptor D2 (DRDZ) Markers with Essential Hypertension in Singaporean Chinese Subjects VMS Oh, HM Wu, EPH Yap, X Zhou and EA Taylor 111

Gene Therapy

23. Molecular Medicine - Potential Therapies for Genetic Diseases SD Wilton 24. Development of HVJ-L'iposomes and Cancer Gene Therapy Y Kaneda 25.

26 I

Current Status of Development to Improve the Efficiency and Targeting Specificity of Liposomes for Gene Therapy KM Hui and H Gao

26. Naked Plasmids: Muscling into Gene Transfer

275 287

301

323

OL Kon, SHL Lok, IBH Tun and EWT Poh 27. Antisense Oligonucleotides as a Therapy for Duchenne Muscular Dystrophy S D Wilton 28. Treatment of Duchenne Muscular Dystrophy at the mRNA Level

335

347

MMatsuo and Y Takeshimu 29. Strategy of Gene Therapy for Liver Cirrhosis and Liver

Cancer J Fujimoto

357

zy zy

zyxwvu xxiii

30. Gene Therapy for Prostate Cancer; Development of Tissue

Specific Promoter-Based Gene Therapy A Gotoh, T Shirakawa, Y Wada, S-C KO, CH Kao, LWK Chung and S Kamidono.

IV Abstracts

363

377

I EMERGING TECHNOLOGIES

zyxwvuts zyxwvu zyxwv zyx zyxwvu zy

FRONTIERS IN HUMAN GENETICS Diseases and Technologies 0 2001 by World Scientific Publishing Co. Re. Ltd.

3

FISH FOR THE OBSTETRICIAN AND GYNAECOLOGIST: A RAPID AND RELIABLE TOOL AIDING CLINICAL ANALYSIS LEENA A GOLE*, C ANANDAKUMAR, YEE CHEE WONG and A BISWAS Department of Obstetrics and Gynaecology National University of Singapore *E-mail :[email protected]

Routine cytogenetic techniques of karyotyping and banding chromosomes have been the usual convcntional testing procedures for detection of chromosomal anomalies in prenatal diagnostics. With the advent of molecular techniques of fluorescence in situ hybridization, the field of cytogenetics has been revolutionalized. Detection of some genes on chromosomes, which previously could not be detected by cytogenetics can now be visualized. Also, samples from which chromosomes in the metaphase plate maybe difficult to obtain, can be probed by FISH in all stages of the cell cycle. Hence applications in preimplantation genetics are increasing rapidly. The rapidity and efficiency of the technique makes it very attractive. This article reviews the applications as well as drawbacks of the FISH technique in different areas, mainly in prenatal and preimplantation diagnosis. Keywords: fluorescence in situ hybridization, prenatal diagnosis, preimplantation genetic diagnosis

* Corresponding author

4

zyxwvut zyxw

I INTRODUCTION

zyxw z zy z

Prenatal diagnosis is an important tool for the genetic evaluation of the unborn child. The conventional testing procedures have been a cytogenetic analysis of chorion villus biopsies starting from 6 to 10 weeks of gestation, amniotic fluid at 16 to 18 weeks with a reporting time of 2 to 3 weeks providing a final diagnosis at 20 to 21 weeks, or chromosome analysis on foetal blood or alternative fluids at 20 to 26 weeks of pregnancy. With the current trend of working towards non-invasive methods and rapid reporting time, so as to avoid undue anxiety to the patient, major advances are taking place in this field to provide a genetic diagnosis using early amniocentesis (EA) at 1 1 to 14 weeks. No doubt the existing banding techniques make possible the detection of minor chromosomal rearrangements, but the technique is still limited where localisation of genes is concerned, as the smallest band is yet a few thousand bases. With the advent of molecular biology techniques e.g. fluorescence in situ hybridization (FISH), in conjunction with conventional cytogenetics, there is immense additional knowledge pouring into the existing data. FISH' - is becoming more and more relevant as an important hture tool in prenatal and preimplantation genetic diagnosis. This technique can be applied to whole chromosome spreads as well as interphase cells. The potential use of this novel FISH technique in the diagnosis of numerical and structural chromosomal aberrations in routine karyotyping for prenatal and preimplantation diagnosis is immense.

2 PRENATAL DIAGNOSIS Prenatal diagnosis with special reference to FISH, can be offered at differing gestational ages, the final aim being to analyse the chromosomes of the foetus. However, the target tissue differs. This maybe chorionic villus, amniotic fluid, foetal blood or alternative fluid samples e.g. fluids from cystic hygromas, ascites or pleural cavities based upon gestational age. Depending on which phase the cells are to be analysed, whether interphase or metaphase, specific probes can be utilised. By and large, interphase analysis is most commonly used for numerical anomalies, whilst metaphase analysis gives more definitive results for

zy zyxwv 5

structural anomalies. Since numerical anomalies, e.g. trisomies and monosomies especially involving the chromosomes 13,18,2 1, X and Y account for 90%of the abnormal foetuses, this is a very important application in prenatal diagnosis. Some sex-linked disorders require the necessity of prenatal diagnosis of foetal sex. Numerical anomalies include all the disorders caused due to presence or absence of extra chromosomes e.g. Down syndrome resulting from an extra chromosome 21, Patau syndrome due to trisomy of chromosome 13, Edwards syndrome due to trisomy 18 or Turner syndrome due to lack of one X chromosome. Repetitive sequences for the centromeric regions of 13, 18,21, X and for the long arm of Y produce distinct signals in metaphase as well as interphase cell^.^-^ Structural abnormalities are those due to translocations, deletions, amplifications or inversions of chromosomal fragments. With the use of painting probes, translocations in cultured leucocytes of foetal blood, alternative fluids and amniocytes can be easily detected, but more so in metaphase ~ells.’-~Used in conjunction with routine Giemsa banding, translocations involving a specific chromosome can be ascertained especially with the use of appropriate painting probes. Analysis of reciprocal translocations by chromosome painting has some limitations. As not all libraries have equal specificity and sensitivity in detecting different chromosomal regions, caution should be exercised during selection. However with the refinement of techniques, this problem will soon be minimised. Deletions of the targeted region can be detected by loss of signals, whereas amplification can be detected by an increase in the area of the hybridization domain. Locus specific probes can detect presence or deletions of specific loci e.g. DiGeorge region (22ql1.2), Prader-Willi/Angelman chromosome region probes (1 5qll-13)etc. Vysis (USA), Boehringer Mannheim (Germany) and Cytocell (U.K) are some of the commercial manufacturers for FISH probes.

6

zyxwvut

zyxw zy zy

3 APPLICATIONS IN PRENATAL DIAGNOSIS 3.1 Chorion Villus Biopsy

Sampling of chorion villi from the foetus is performed from 8 to 10 weeks of gestation onwards. The biopsy is usually taken under ultrasound guidance via transabdominal approach. The overnight short-term culture protocol is the most popular method to reduce reporting time, in spite of a slight increase in the rates of mosaicism as compared to the long-term cultures (1.26% v/s 0.66%). The number of metaphases and quality of chromosomes obtained is many times of very poor standards. Thus FISH can be useful for detection of suspected chromosomal anomalies even on the interphase cells of the villus sample. In fact FISH has been utilised to assess the effects of maternal cell contamination’’ on the sensitivity of prenatal diagnosis, with a conclusion that given a thorough dissection of villi, this issue does not pose any major problems in the results. However, the culture of chorionic villi still remains unpopular compared to the amniotic cell culture because of the artefacts and false positives and negatives generated.

3.2 Amniotic Fluid

zyxwv

Amniocentesis is usually performed at 16 to 18 weeks of gestation, however early amniocentesis from 11 to 14 weeks is being increasingly used. Routine culturing procedures for karyotyping take from 2-3 weeks. In comparison to this, FISH when carried out on uncultured amniocytes, results in a diagnosis within a few hours for the detection of a specific chromosomal abnormality. Use of multicolor FISH can facilitate diagnosis of upto 5 to 7 different chromosomes on the same This is a very significant application most appropriate for prenatal diagnosis. It overcomes the drawbacks of metaphase analysis, which requires cells to be cultured, which is labour intensive and time consuming. Using the probes for the most commonly occurring aneuploidies, e.g. 13, 18,21 and the sex chromosomes X and Y, FISH can be used as pre-screen for detection of aneunloidies and the sex of the foetus in uncultured amniocytes (Figs. 1a and b). The drawback of the technique is that all cells in the population

zy zyx 7

zyxwvu

may not show the trisomic signal due to chance overlap of the hybridization domains. Also mosaicism is not reliably detected. A comprehensive and all encompassing test is still the G-banded karyotype, which gives a detailed cytogenetic analysis of all the chromosomes. However, with the advent of MFISH, all 46 chromosomes can be painted at the same time and all minor translocations deletions etc can be detected. Hence, though presently FISH is mainly used as complementation to routine cytogenetics, it will evolve into a powerful technique with the advance of sophisticated image analyzers and painting probes.

3.3 Foetal Blood Lymphocytes Foetal blood analysis is routinely carried out in later gestational ages of 20 to 22 weeks as the viable cell populations in the amniotic fluid decrease with advancing gestational age. To minimise maternal blood contamination, blood is drawn from the cord or hepatic portal vein of the foetus. The lymphocytes are then cultured for routine cytogenetic analysis. FISH can be used to confirm any suspected chromosomal anomalies on the metaphase chromosomes (Fig. 1d) or it can also be used on uncultured lymphocytes.

3.4 Alternative Fluids

Alternative fluids e.g. serous fluids from cystic hygromas, the pleural filled cavities around the lungs or the abdominal region are a plentiful source of lymphocytes which can be utilised as an alternative to traditional amniotic fluid or foetal blood cultures, especially in pregnancies complicated by cystic hygromas or hydrops fetalis, where sometimes obtaining them can be difficult due to obstructions by large cysts or oligohydramnios. Along with the conventional culturing techniques, FISH can be carried out on these cells too, especially where metaphases maybe of poor quality as is the case most of the time13 - 15 or on uncultured cells for interphase analysis.

zyxwvut

8

zyxwvu zyx

3.5 Foetal Cells in Maternal Peripheral Blood

Compared to chorion villus biopsy, amniocentesis, foetal blood or alternative fluids, all of which are invasive techniques, prenatal detection of chromosomal anomalies in foetal cells in the maternal peripheral circulation is a relatively non-invasive technique. With the use of fluorescence activated cell sorters and antibodies specific for fetal cells, nucleated erythrocytes, which are foetal in origin, can be separated and probed with FISH for aneuploidies of chromosomes of interest, thereby eliminating a lot of laborious techniques previously used.'6317 The major limitation of the current technology available for prevention of genetic diseases is that selective abortion is the only choice after prenatal diagnosis. The development of new methods for diagnosis of genetic disease in the early stages of development of the human zygote and embryo (before implantation) is particularly needed for couples, who cannot accept the termination of a pregnancy and have a high recurrent risk for offspring with inherited diseases, e.g. X-linked diseases or translocation carriers. Preimplantation genetic diagnosis will make it possible to overcome the most sensitive problem in the management of genetic disease - the problem of abortion.

zyxw zy

4 PREIMPLANTATION GENETIC DIAGNOSIS (PGD) From diagnosing the post-implantation foetus for prenatal genetic anomalies by chorion villus biopsies and early amniotic fluids, a step ahead would be preimplantation diagnosis of human gametes and embryos. PGD could be, in principle, used the same as prenatal diagnosis, but at the moment is justified for high risk pregnancies. Rapid advances have recently taken place in this field to attempt to genetically diagnose the preimplantation embryo (day 3). With the advent of the assisted reproductive technologies (ART) e.g. in vitro fertilisationembryo replacement (IVF-ER), gamete intrafallopian transfer (GIFT), tuba1 embryo transfer (TET) and intracytoplasmic sperm injection (ICSI), the problem of infertility in the majority of childless couples has been alleviated. However, a fair percentage of oocytes fail to fertilize in some patients and poor-quality embryos with abnormal cleavage and moderate to severe fragmentation are

zy

9

produced. These do not implant or are unable to sustain implantation after replacement. Chromoiomal imbalance has been implicated for the high frequency of early embryonic loss and first trimester abortions. There are two main approaches for the genetic diagnosis before implantation. Either gametes i.e. sperms or oocytescan be analysed or secondly embryonic cells at various stages maybe analysed: However karyotypic analysis of chromosomes in all the above samples is very tedious and inconsistent. FISH has proved to be very useful in this aspect.

zy

zyxwv

4.1 FISH on Sperm

Especially in cases scheduled for ICSI, oligozoospermia, asthenozoospermia, teratozoospermia or oligoasthenoteratozoospermia(OATS) are very cGmmon parameters. Many times there may be a high possibility that there are chromosomal abnormalities in the gonads, which may not be detected in the blood but may be present in the sperm. At such times it would be more advisable to carry out an analysis on the sperm before using them for ICSI. Though it is not feasible to use the sperm, which has been analysed, a gross percentage abnormality can be detected in the sample and the patient advised accordingly. A recent report of 12 ICSI pregnancies of which three sets were twins, found five cases of sex chromosomal aneuploidy,18two cases of 47,XXY, two of 45,Xand one mosaic 45,X/46,X,dic Y. The parents of the cytogenetically abnormal foetuses had normal lymphocyte karyotypes. From this it was postulated that the fathers could have been mosaics with an aneuploid cell line confined to the germ tissue. It has long been noted that the frequency of chromosomal abnormality is increased in males selected for infertility and the trend is inversely proportional to the sperm concentration.” Karyotyping sperm, however, is very laborious and is usually done by allowing human sperm to fertilize zona-free hamster ova and then karyotyping decondensed sperm head preparations within the hamster ooplasmic matrix with approx. only 60% success. FISH can be carried out directly on sperm relatively easily. However, the nuclei of mature spermatozoa are highly condensed and protected with interprotamine disulfide bridges. The success of FISH relies on the partial decondensation of the sperm chromatin. The current procedures for sperm

zyxw

10

zyxwvutsr zyxw

zyxwv zyxwvu

decondensation entail the use of reducing agents as well as detergents such as DTT (Fig. lc) along with Triton X.

4.2 FISH on Oocytes

The majority of age-related non-disjunction occurs during maternal meoisis. Since direct analysis of the oocyte will result in destruction of the oocyte, polar body analysis and transfer of embryos derived from oocytes or pre-embryos with euploid polar bodies should drastically reduce the chances of an IVF couple giving birth to a child with a chromosomal aneuploidy. With the advanced techniques of micromanipulation, first and second polar bodies can be removed and subjected to FISH probes. A study on 45 IVF patients of advanced maternal age has been carried out by Verlinsky*’ 155 of 228 biopsied oocytes could be analysed, of which 23.2% were chromosomally abnormal. A similar correlation was found by Plachot” by routine cytogenetic analysis, in which the mean incidence of aneuploidy and structural anomalies was 25.6% and 2.8% respectively.

4.3 FISH on Embryos

z zyxwvu

Very few existing studies on the cytogenetic analysis of embryos2* are documented in literature due to the low cell numbers, quality of metaphases and problems associated with spreading and banding. With the application of FISH and the commercial availability of probes for chromosomes - 13,18,21,X and Y , it is possible to use multiprobe single cell analysis on metaphases, even poor quality ones, for these embryos. A single 8 to 10 cell embryo at the cleavage stage can be biopsied for the removal of 1 or 2 blastomeres, which are subjected to FISH. This same embryo at the blastocyst stage can again be manipulated and some cells may-be removed for ~onfirmation.~~ The only disadvantage being that these biopsied cells may not be representative of the entire embryo. Double target in situ hybridization has been performed with X & Y specific probes on embryos to check sex24.25,as well as with autosomal probes to detect specific chromosomal aneuploidy and mosaicism.26 The use of multicolor FISH has

11

zy

zyxwvu zyxwv zyxwvu zyxwvutsr

recently contributed to the confirmation of the incidence of numerical rearrangements in abnormal human embryos generated in N F programmes and provided explanations to some of the causes of IVF failures in some patients.27 Centromeric probes allow precise counting of chromosomes from blastomeres and as such give more reliable and accurate information on numerical rearrangements compared to the conventional method of fixation of embryos. With the introduction of FISH, preimplantation genetic diagnosis on single cells has been made feasible.

5 A BRIEF DESCRIPTION OF THE FISH TECHNIQUE

Fluorescence in situ hybridization entails the deposition of fluorescent molecules in the nucleus at the sites of specific DNA sequences. Specific DNA or RNA sequences of choice are labelled with reporter molecules. These "probes" and the target chromosomes are denatured. Complementary sequences in the probe and target are then allowed to reanneal. After washing and incubation with fluorescently labelled affinity reagents, a signal is made visible at the site of probe hybridization. Depending on how the probe is labelled, it can be detected directly or indirectly. For example, fluorochromes such as fluorescein can be directly coupled onto the probe and so visualised immediately, under the fluorescence microscope after hybridization to the target DNA. Indirect procedures require that the modified probe be detected by immunocytochemical means. For example, biotinylated d-UTP incorporated in the probe is detected by the fluorescein avidin anti-avidin system. The basic technique' comprises of preparation of the probe, preparation of the tissue, hybridization of probe to the tissue, stringent washes and visualisation of the probe. The three main types of probes, which can be used, are satellite probes for repeat sequences, whole chromosome painting probes and locus probes.

12

5.1 Centromeric Probes

zyxw zyxw

These are tandemly repeated sequences, several hundred to thousand times in the centromeric regions about lo6 to lo8 bp in size. On most human chromosomes, some part of the repeated sequence is sufficiently different, that FISH with a probe to the variant region produces a signal that is intense and chromosome-specific. Centromeric probes have now been isolated and cloned for human chromosomes and are commercially available for all the chromosomes.

5.2 Whole Chromosome Probes These comprise of many different elements distributed more or less continuously over one chromosome so that the chromosome targeted by the probe appears continuously stained or painted. Translocations can be effectively detected, the only drawback being that not all libraries have equal specificity and sensitivity in detecting different chromosomal regions.

5.3 Locus Specific Probes These are the most powerful approach to structural aberrations e.g. gene deletion or amplification in both metaphase and interphase cells. Once the important loci in a particular genetic disease have been identified, they can be studied using FISH with probes to this region. Ideally the probes should range from 15-50 kb.

6 CONCLUSION Taking into account the powerful diagnostic capacity of the FISH technique, it could be used in prenatal diagnosis with a very practical and logical approach of carrying it out on the CVB (8-10 weeks) or early amniotic fluids (1 1-14 weeks) for a rapid diagnosis in emergency situations. In later weeks it could be done on routine amniotic or alternative fluids at 16-20 weeks. Confirmatory

13

zyxw zyxwv zyxwv zyxw zyxwv zyxwv

tests can be done on foetal blood at 22-26 weeks. Conversely even before the prenatal period, FISH can be used on embryos for preimplantation genetic diagnosis. This could be the treatment of choice in the future, especially for translocation carriers or for the detection of sex in sex linked disorders. FISH on biopsied blastomeres before replacement of embryos would give hope for the birth of a normal child. As image analysis becomes more and more powerful, smaller regions on chromosomes will be detected. With the advent of commercial probes on the market, FISH will be easier to perform and can be widely used.

Acknowledgements

This study was funded by the National Medical Research Council Research projects NMRC RP 3960353 and RP 3690025.

References

Gole LA, Bongso A, Fluorescent in situ hybridization -Examples of its applications in clinical cytogenetics. Singapore Medical Journal 1997; 38; 388-390. 2. Tkachuk DC, Pinkel D, Kuo WL, Weier HU, Gray JW. Clinical applications of fluorescence in situ hybridisation. GATA 1991; 8(2): 6774. 3 . Trask BJ. Fluorescence in situ hybridisation: applications in cytogenetics and gene mapping. TZG 1991; 7(5): 149-154. 4. Aviram-Goldring A, Daniely M, Chaki R, Lipitz S, Barkai G, Goldman B, Advanced FISH with directly labeled X, Y and 18 DNA probes as a tool for rapid prenatal diagnosis. Reprod Med 1999;44(6): 497-503. 1.

zy

14

5.

zyxwvutsrq zyxwvuts

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

Gersen SL, Carelli MP, Klinger KW, Ward BE, Rapid prenatal diagnosis of 14 cases of triploidy using FISH with multiple probes. Prenatal Diagn 1995; 15: 1-5. Verlinsky Y, Ginsberg N,Chmura M, Freidine M, White M, Strom C, Kuliev A, Cross hybridization of the chromosome 13/21 alpha satellite DNA probe to chromosome 22 in the prenatal screening of common chromosomal aneuploidies by FISH. Prenatal Diagn 1995; 15: 83 1-834. Rosenberg C, Blakemore KJ, Kearns WG, Giraldez RA et al. Analysis of reciprocal translocations by chromosome painting: Applications and limitations of the technique. Am J Hum Genet 1992; 50: 700-705. Speleman F, Van Roy N, Wiegant Joop et al. Detection of subtle translocations by fluorescence in situ hybridisation. Clin Genet 1992; 41: 169-1 74. Tucker JD, Morgan WF, Awa AA, Bauchinger M, Blakey D, A proposed system for scoring structural aberrations detected by chromosome painting. Cytogenet Cell Genet 1995; 68: 2 1 1-22 1. Bryndorf T, Christensen B, Xiang Y , Philip J.Prenata1 diagnosis by FISH on chorionic villus cells; non-significance of maternal cell contamination. Fetal Diagn Ther 1994; 9(2);73-76. Ried T, Landes G, Dackowski W, Klinger K, Ward DC, Multicolor fluorescence in situ hybridisation for the simultaneous detection of probe sets for chromosomes 13,18, 21, X and Y in uncultured amniotic fluid cells. Hum Mol Genet 1992; l(5): 307-313. Ried T, Baldini A, Rand TC, Ward DC, Simultaneous visualisation of seven different DNA probes by in-situ hybridization using combinatorial fluorescence and digital imaging microscopy. Proc Natl Acad Sci 1992; 89: 1388-1392. Gole LA, Anandakumar C, Bongso A, Chua TM, Wong YC, Ratnam SS, Analysis of cystic hygroma, ascitic and pleural fluid by conventional lymphocyte culturing and fluorescent in situ hybridization. Prenatal Diagn 1997; 17(12): 1151-1157. Wax JR, Blakemore KJ, Soloski MJ, Gibson M, Stetten G. Fetal ascitic fluid: A new source of lymphocytes for rapid chromosomal analysis. Obst Gynaecol1992: 80; 533-535. Ville Y, Borghi E, Pons JC, Lelorc’H M. Fetal karyotype from cystic

zy zyxw

zyxwvuts

zy zyxwvu zyxw

zyxwvu zyxwvu zyx zy 15

hygroma fluid. Prenatal Diagn 1992; 12: 139-143. 16. Gaenshirt D, Garritsen HSP, Holzgreve W. Prenatal diagnosis using fetal cells in the maternal circulation. Fetal and Maternal Medicine review 1995; 7: 77-85. 17. Bischoff FZ, Lewis DE, Nguyen DD, Muerrell S,Schober W, Scott J, Simpson JL, Elias S, Prenatal diagnosis with use of fetal cells isolated from maternal blood : Five color fluorescent in situ nybridization analysis on flow sorted cells for chromosomes X,Y 13, I 8 and 2 1. A m J Obstet Gynec 1998; 179(1): 203-209. 18. In’t Veld P, Brandenburg H, Verhoeff A, Sex chromosomal abnormalities and intracytoplasmic sperm injection. Lancet 1995; 346(8977): 773. 19. Persson JW, Peters GB, Saunders DM, Genetic consequences of ICSI. Human Reprod 1996; ll(5): 921-932. 20. Verlinsky Yu, Kuliev Anver M yPreimplantation Diagnosis of Genetic Diseases: A New Technique in Assisted Reproduction,

Wiley-Liss, New York, 1993. 2 1. Plachot M, Cytogenetic analysis of oocytes and embryos. Ann Acad Med 1992; 21(4): 538-544. 22. Bongso A., Fong C.Y., Ng SC., Ratnam S., Lim J, Preimplantation genetics: Chromosomes of fragmented human embryos. Fertil Steril 1991; 56(1): 66-70. 23. Muggleton Harris AL, Glazier AM, Pickering S, Wall M, Genetic diagnosis using polymerase chain reaction and fluorescent in situ hybridization analysis of biopsied cells from both the cleavage and blastocyst stages of individual cultured human preimplantation embryos. Human Reprod 1995; 10( 1); 183-1 92. 24. Pellicer A, Rubio C, Vidal F, Minguez Y, Gimenez C, Egozcue J, Remohi J, Simon C, In vitro fertilization plus preimplantation genetic diagnosis in patients with recurrent miscarriage: an analysis of chromosome abnormalities in human preimplantation embryos. Fertil Steril 1998; 71(6); 1033-1 039. 25. Munne S, Magli C, Bahce M, Fung J, Legator M, Morrison L, Cohert J, Gianaroli L, Preimplantation diagnosis of the aneuploidies most commonly found in spontaneous abortions and live births: XY, 13, 14, 15, 16, 18,21, 22. Prenat Diagn 1998; 18(13): 1459-1 466.

16

zyxwvutsr zyx z

zyxw zy

26. Coonen E, Harper JC, Ramaekers FCS, Delhanty JDA et al. Presence of chromosomal mosaicism in abnormal preimplantation embryos detected by fluorescence in situ hybridisation. Hum Genet 1994; 94: 609-61 5. 27. Munne Santiago, Andrew L, Rosenwaks Z, Grifo J, Cohen J. Diagnosis of major chromosome aneuploidies in human preimplantation embryos. Hum Reprod 1993; 8( 12): 2 1 85-2 19 1 .

17

zy

zyxwvutsrq zy

Fig 1 :(a) Uncultured foetal blood showing trisomy 21 (b) Uncultured amniocytes with two signals for chromosome 18 and a single signal for X and Y (c) FISH on sperms showing abnormal disomic sperms in the center (d) Cultured foetal blood showing a metaphase with trisomy 2 1 .

zy zyxwvutsrq zyxwvut zyxwvu zyxwv

zyxwvu

FRONTIERS IN HUMAN GENETICS Diseases and Technologies 0 2001 by World Scientific Publishing Co. Pte. Ltd.

19

IN SILICO DETECTION AND PCR CONFIRMATION OF NOVEL SINGLE NUCLEOTIDE POLYMORPHISM (SNP) IN TISSUE INHIBITOR OF MATRIX METALLOPROTE1NASE-2 (TIMP-2) si KOH’J, cs LIM’, GCH TAY’,

zyx

HM L I M ~SGK , SEAH~,SSM TAN^, RYY YONG~, HM WUt and EPH YAPt

‘Chemical Process & Biotechnology Department, Singapore Polytechnic, 500 Dover Road, Singapore 139651. tDefence Medical Research Institute, Defence Science & Technology Agency, I0 Medical Drive, Singapore I I7597

Single-nucleotide polymorphisms (SNP) are an important class of DNA polymorphisms as they are common, have relatively low mutation rates, and can be genotyped using rapid high throughput methods. Currently efforts are underway to discover and map SNP in the human genome. We report here a novel in silico approach to predict the presence of novel SNP in a specific gene, and demonstrate its utility in a candidate gene for myopia, the tissue inhibitor of metalloproteinase-2 (TIMP-2) gene. TIMP-2 proteins are inhibitors of metalloproteinases that are responsible for the degeneration of connective tissue including the sclera tissue of ocular globe. TheTIMP-2 gene is located on chromosome 17q25 and is encoded by five exons spanning 83 kb of genomic DNA. No intragenic or flanking DNA markers had previously been reported. Genomic, cDNA and EST (expressed sequence tags) sequences were obtained from DNA databases, and multiply aligned using sequence analysis software. Several putative sequence variants were found, and two were studied further by direct sequencing and PCR genotyping. New restriction sites were introduced by deliberate primer mismatches and PCR samples were genotyped by restriction digestion (“artificial RFLP”). The presence of one polymorphism in exon 3 was confirmed both by sequencing and by PCR genotyping of 187 unrelated individuals of Chinese descent. Allelic frequencies were 0.27 and 0.73, and observed heterozygosity was close to 0.40, This approach for in silico detection and ex silico confirmation of novel polymorphisms is extremely rapid and can be generalised to any gene, EST or genomic sequences. These polymorphisms may serve as useful markers for maps and for localising disease genes by linkage and association analysis. Keywords: SNP polymorphism, sclera tissue degeneration, artificial RFLP, ex silico confirmation

* Corresponding author

zy

20

zyxwvuts zyxw

1 INTRODUCTION

The study of DNA polymorphism (variation) provides information on our evolutionary history and on fundamental genetic mechanisms such as mutation, gene conversion and genetic drift. It also allows one to identify regions that may have functional important or related to development of rare genetic diseases. Study of human genetics has traditionally relied on classical (non-DNA) or protein polymorhisims, and important insights has been gained from direct analyses on DNA polymorphisms (viz. RFLP, dinucleotide polymorphisms, microsatellite DNA, VNTR studies) over the last ten years. Single-nucleotide polymorphisms (SNP) are an important class of DNA polymorhpism. It has been estimated that random single base-substitutions occur once every 100 to 1000 nucleotides, approximately once in every 500 bases or so.' Many of these substitutions occur frequently within introns, non-coding regions (flanking regions) of genes, pseudogenes, and wobble bases of codons. Sequences of functionally importance such as promoters, enhancers, other regulatory regions and coding regions especially the first and second base of codons are much more conserved and stable unless there is a selective advantage. Current efforts are underway to discover the presence of novel SNP sites that are important in disease linkage and evolutionary studies. Because of the huge size of human genome, it is unwise to embark on the costly approach of sequencing hundreds of individuals in different loci. A more useful compromise is to adopt less expensive methods to a few chosen loci. In this study, we attempt to analyse the single-nucleotide polymorphism (SNP) in one of the candidate genes for myopia -the tissue inhibitor of metalloproteinase-2 (TIMP-2) via a novel approach and confirm it by an ex silico approach using PCR technique. We predicted the presence of novel SNP sites in three different region of the TIMP-2 gene. TIMP-2 proteins are inhibitors of metalloproteinases that are responsible for the degeneration of connective tissue including the sclera tissue of ocular globe. TIMP-2 gene is located on chromosome 17q25 and is encoded by five exons spanning 83 kb of genomic DNA. No intragenic or flanking DNA markers had previously been reported.

zyxwvu

zyxw zyxwvu zy zyxw zyxwv 21

2 MATERIALS AND METHODS 2.1 Genomic DNA Isolation

Blood (10 ml) was drawn into tubes with anticoagulants, and genomic DNA was isolated from several populations of Chinese descent (case controls include normal & myopes; paediatric and adult myopes; members from 42 families) using Qiagen blood kit. Concentration of DNA was assessed spectophotometrically. Working solution of DNA was prepared in nanopure water to a concentration of 100 pg/pl and stored at -20°C until needed.

2.2 Primers and PCR Condition

Confirmation of predicted SNP site at exon 3B were done by DNA sequencing as well as by PCR method using the designed primers described in Tables 1 and 2. PCR amplification was carried out on a Perkin Elmer GeneAmp PCR System 9600 thermal cycler. A 5O-pl PCR reaction contained 10 mM Tris, pH 8.3, 50 mM KCI, 1.5 mM MgC12, 0.2 mM each of dATP, dTTP, dCTP, dGTP, 2.5 units of AmpliTaq DNA polymerase (Cetus), approximately 100 pg of target DNA and 10 pM primers. The cycling parameters were as described in Table 3.

2.3 Agarose Gel Electrophoresis of PCR Products

A volume of 8 p1 of the amplified PCR products were digested by the respective restriction enzymes, PstI for exon 3A and Fnu4HI for exon 3B according to the manufacturer’s instruction. The digested products were analysed by 4% (three parts Sigma typeIA agarose to one part of FMC Nusieve agarose) gels. Gels were stained in ethidium bromide and photographed under UV light. The expected genotypes of each locus are detailed in Table 2.

22

zyxwvutsr Table 1 Base sequence of designed primers and the estimated T,

zyxw zyxwvutsrqp zyxw Sequences / Artificially Generated RE Sites

Primer

El (forward)

5’ GCC CCC GAG ACA AAG AGG AG 3’

E2 (reverse)

5’ GCA TTG CAA AAC GCC TGCTG 3’

I

FnulHI site

5’ ...GCJAGC.. 3’

I

2o

I

61

I

zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFED

-~ ~

T,OC

Length (nucleotide)

E3A 1 (forward)

5 ’ ACA CGG CCC CCT CCT CTG

3’

E3A2 (reverse)

5 ’ GGC TGA TGG CCC CAC TCA 3’

E3B I (forward)

5 ’ TGG GAA CGG AAT TCA CCA A 3’

E3B2 (reverse)

5’ ‘TTC TTT CCT CCA ACG TGCAG

Pst I site

18

57

18

55

19

51

2o

55

zyxw 1 1

5 ’ ..CTGCA&G..3’

3’ FnudHl site 5’ ..GC&TGC..3’

Table 2 Primer characteristics and expected products after RE treatment. Primer

Length (nt)

Predicted SNP Site / Position

Engineered RE site at the Primer

Amplicon

Possible Size of Alleles ARer Digestion

None

None

Exon I

299 (allele 1)

FnulHl G C J NGC

299 bp

280 + 19 (allele 2)

Pstl

Exon 3A

97 (allele 1)

97 bp

20 + 77 (allele 2)

Exon 3B I57 bp

157 (allele 1 ) 139 + 18 (allele 2)

26411hnt: A (non-cutter) G (cutter) 1391hnt:

1 iiZ!: 1 ii 1

T (non-cutter) C (cutter)

CTGCAJG

155Ih Nonent: A (non-cutter) G (cutter)

FnulHl GC&NGC

None

I

zy zyx 23

Table 3 PCR amplification conditions for the three primer pairs

zyxwvutsr I

I

No of cycle

I

35 cycles

35 cycles

35 cycles

Final extension

72°C

5

72°C

5

72°C

5

Soaking

4°C

Infinite

4°C

Infinite

4°C

Infinite

2.4 Confirmation of Exon 3B SNP by Sequencing

DNA sequencing were carried out on three individuals of genotypes 1 1, 12 and 22 using the fluorescent ABI PRISMTM Dye Terminator Cycle Sequencing Kit. The gel was run in an ABI PRISMTMautomated DNA sequencer.

3 RESULTS AND DISCUSSION 3.1 Predicted SNP Sites on Exons 1 and 3 of TIMP-2 Gene

zy

We obtained four mRNA sequences for human TIMP-2 from the Genbank databases, (HUMANTIMP3, HUMMET, HUMTIMP2 and HSTIMP2M) and aligned these sequences to look for polymorphisms along the five exons of TIMP-2. By adopting biocomputing approach, we predicted three potential SNP loci located in exons 1 and 3 of TIMP-2 gene. Two of the G-

24

zyxwvuts zyxwvut

zyxwv

A SNP loci found in exons 1 and 3B are silent (i.e. no change in amino acid) whilst the other T-C SNP loci located in exon 3A results in an amino acid substitution (alanine H= valine; Fig. 1).

Exon 1 SNP:

zyx zyxw zyx

G-A polymorphism at position 264Ithnucleotide is a silent SNP. Primer E2

4

FnulHl site

------- gtg cac ccc cdag cag g--------(cutter) ___--_--_--_--_-_ ccA (non-cutter) _____________r____

___--_---_---_--_ Pro

Protein level:

__-________________c

No change in amino acid (silent SNP).

NB: We have not been able to establish the existence of ihis SNP as the PCR was not successful.

Reference: Genbank Accession No. U44381 (Exon I) .....................................................................................................................

Exon 3A SNP: C-T polymorphism at position 139Ihnucleotide causes an amino acid substitution. Primer 3A1

fst I site

------gcc ccc tcc tcg tct g>g

tgt ggg------(cutter) (Aid

zyxwvut ............................. g& ____________---_ (non-cutter) (Val)

Protein level: Ala Val substitution ..................................................................................................................... f)

Exon 3B SNP: G-A polymorphism at position 155Ih nucleotide is also a silent SNP. Primer 3B2

4

FnulHl site

---------- gtc tcC cdtg gac---------___---------- (cutter)

---------- gtc tcA c tg gac_____-_---________(non-cutter) Protein level:

-------------- Ser .................... No change in amino acid (silent SNP). ~~

~

~~~~

Reference: Genbank Accession No. U44383 (Exon 3)

Fig. 1 Predicted three potential SNP sites at TIMP-2 gene based on Genbank data (HUMANTIMP3, HUMMET, HUMTIMP2)

zy z

zy zyx zyx zyxwv 25

3.2 Designing Primers to Create Artificial RFLP to Map SNP Loci

Restriction sites mapping and designing of modified primers were carried out using DNAStar Laser gene softwares. One of the bases at primers E2, E3A1 and E3B2 was modified in order to generate artificial Fnu4HZ, Pstl and Fnu4HI sites respectively near their 3’ ends. The expected genotypes of the three SNP loci are detailed in Fig. 1. 3.3 Confirmation of Predicted SNP Loci by PCR

(9 Exon I SNP locus - unable to reconfirm using PCR

Several attempts were used to amplifL the exon 1 SNP region using a combination of DMSO, etc., but we failed to amplifL the expected PCR products. On analyses, we discovered that our exon 1 forward and reverse primers could assume a number of intra- and inter-secondary structures. A total of 4 hairpins and 12 dimers for forward primer whilst 8 hairpins and 9 dimers were found in the reversed primer (data not shown). The extensive secondary structures of the primer pairs may have hindered the amplification process.

(i9 Exon 3A SNP locw shows no significant dijjfetence in 23 individuals ’ by PCR genotyping We were unable to detect any significant differences amongst 23 unrelated individuals with respect to this SNP locus on exon 3A. All the PCR products from a small population screened were all cleaved by enzyme PstI to give a 20 and 77 bp fragments (Fig. 2) implying that they all have a cytosine (C) residue at position 139 in both the alleles. As the SNP site in this region causes an amino acid substitution (Ala *Val), it may be a potential useful SNP marker. More works need to be done on screening a larger population including other ethnic groups before we exclude this SNP locus as potential useful marker for myopia linkage and association analyses.

26

zyxwvuts zyxw zyx 1

U

3

2

C

U

C

U

4

C

U

C M l M 2

zyxwvutsr zyxwv

97 bp 77 bp

Fig. 2 A representative gel showing no significant difference between individuals of the population screened with respect to exon 3A Pstl SNP. Note that all the samples are cleaved by fstl enzyme. 1-4 represent four unrelated individuals whilst MI, 20 bp marker and M2 is pGEM DNA marker.

zyxwv zyxw

(iii) Novel SNP site found at exon 3B

Table 4A shows the genotype data collected from 187 unrelated individuals of Chinese descent. Three different genotypes were evident (Fig. 3) and we use digital representation to denote the two alleles (allele 1 remains uncut' whilst allele 2 is cut by the enzyme). Hence, homozygotes genotype 11 has both alleles remained uncut by enzyme FnulHl (expected size: 157 bp) whilst genotype 22, has both alleles being cut (shorter band, 139 bp). Heterozygotes, 12, has one of its alleles cut (139 bp) and the other remains uncut (1 57 bp). 3.3 Estimation of Allele Frequencies and Statistical Analyses

Since the above experiment unequivocally distinguished the alleles in this locus, allelic frequencies were estimated by the gene count method, which are also the maximum likelihood estimates. Agreement with the HardyWeinberg expectations of genotype frequencies was determined by the chi-

27

zy

GENOTYPE:

-157 -139

bp (allele 1) bp (allele 2)

zy

Fig. 3 A representative gel showing different genotypes of G-A polymorphisms in exon 3B SNP locus. All three genotypes (1 1, 12 and 22) are evidence in this gel. MI represents 20 bp DNA size marker.

zyxwvu zy

Genotypes

SNP (Exon 3B)

Control

12

AIG

41

22

GIG

Total

45

92

Myopes

Total

zyxw 35

76 (40.6%)

53

98 (52.41%)

95

187

Effective number of alleles in this sample population I / (0.5241 + 00699) = 1.78.

= Reciprocal of the observed homozygosity =

square test based on total heterozygosity at the locus. The levels of significance of the test procedure were determined empirically by a permutation-based simulation method. Briefly, it involved reconstruction of genotype frequencies by random shuffling of the two alleles. From every

28

zyxwvutsrq zyxwvut

replication of shuffling, a new genotype frequency distribution was used to compute the respective test criteria. Table 4B shows allelic frequencies of the 187 unrelated individuals of Chinese descents. There is no significant different between the normal control and the myopic groups in this population (Table 4C).

Table 4B Allelic frequencies in the case studies of 187 unrelated individual9

zyxwvutsrq zyxw z zyx zyxw

Table 4C Testing for significant difference between the normal and myope controls

Genotypes I1 12

22 Total

I

Control

Myopes

YOFreq.

YOFreq.

6.52

7.37

44.56

36.84

48.91 100

I

55.79 100

Deviation

Deviation2 Control

+ 0.85 - 7.72

I

+6.88

0.1 108

1.3375

I

0.9678

x2= 2.4161

I

zy zyxwvu 29

52.41% (98 out of 187 individuals of Chinese descent) has a GC basepair at position 155 in both their alleles whilst 40.6% (76 out of 187) has a GC pair in one of the two alleles (Table 4A). Only about 7% of the population surveyed have an AT basepair at the equivalent position. The genotypes in this sample are conforming to the frequencies expected for a Hardy-Weinberg population within statistically acceptable limits (Table 4D).

zyxwvut zyxwvu

Table 4D Testing for Hardy-Weinberg equilbrium of the population of 187 unrelated individuals

Genotypes

Observed cases

(based on allele frequencies)

(Obs - Exp)’ EXP

11

13

14

0.0714

12

76

74

0.05405

22

I

I

98

Expected cases

I

Degree of freedom = 2; Probability = 90-95%

99

I

0.0101

x2=0.1356

Comment: This is not a significant value and we may accept the hypothesis that the sample (hence presumably the population from which it was drawn) is conforming to the equilibrium distribution of genotype.

The allelic frequencies of the G-A SNP in exon 3B were calculated to be 0.73 (G) and 0.27 (A), respectively, with a heterozygosity of approx. 0.40 (Table 4D) based on the data observed in 187 unrelated individuals. 3.4 Other Populations Surveyed at This SNP Locus in Exon 3B

Data were also collected from another set of local Chinese population comprising 42 individuals from 21 families (fathers and mothers, presumably they are non-related) as well as 41 adults and 249 paediatric myopes. We computed the allele frequencies and determined whether the

30

zyxwvutsr

zyxwv

genotypes distribution in these different populations are in HWE equilibrium. Our results show that all the three groups produce nonsignificant chi-value and hence, the sampled population are all conforming to the HWE (Tables 5 , 6 and 7). Table 8 summarises the allelic frequencies and the percentage heterozygosities in all the four different populations surveyed.

Table 5A Genotype distribution amongst 42 unrelated individuals (fathers and mothers of 21 families) with unknown phenotypes

Genotypes

SNP

No of individuals

I1

AIA

2

12

AIG

20

47.6%

22

G/G

20

47.6%

42

100%

Total

Observed Genotype Frequency 4.76%

zy

Table 5B Allelic and genotype frequencies of the 42 unrelated individuals from 21 families (fathers and mothers)

Allele

No of Occurrence

Allele Frequency

Genotype Frequency

Expected Genotype number (Based on allelic Frequency)

z zy

0.08 162

Homozygotes 11: 3

0.5102

Homozygotes 22: 2 1

Heterozygosity (He) = 0.4082

Genotypes

Observed Cases

11

2

12

20

22

20

Expected Cases (based on allele frequencies)

Degree of freedom = 2; Probability = 70 - 80%

Obs - Exp

(Obs - Exp)’

EXP

zyxw 0.3333

3

-1

21

-1

18

+2

0.04762 0.2222

2’ = 0.6031

Genotype

SMl Plate

SM2 Plate

SM3 Plate

Total

11

2

4

4

10

12

37

32

27

96

22

55

58

57

170

zyxwvu

Total

94

94

88

249

No of Occurrences

Allele Frequencies

Genotype Frequencies

116

0.2101

0.04414

2

436

0.7899

0.6239

Total

552

1 .ooo

0.66804

Allele 1

zy

zy zyxwv 31

Heterozygosity = 0.33196

32

zyxwvutsr zyx zyxwvuts

Table 6C Testing for Hardy-Weinberg equilibrium of the above 249 paediatric myopes

Genotypes

Observed Cases

Expected Cases (based on allele frequencies)

Obs - Exp

11

10

11

-1

(Obs - Exp)’ EXP 0.0909

12

96

83

+I3

2.036 1

22

170

155

+I5

1.452

x2= 3.5786

Degree of freedom = 2; Probability = 10 - 20%

Comment: Though the probability value is low, it is still within the acceptable statistical range. Hence, we conclude that the distribution of genotypes in the population studied conform to HardyWeinberg equilibrium (HWE).

Table 7A Alleles and genotypes frequencies distributions in adult myopes sample

population

z zyxw

Table 7B Testing for Hardy-Weinberg equilibrium of the above adult myope population

Expected Cases (based on allele frequencies) 4

Obs - Exp

11

Observed Cases 5

12

15

17

-2

22

21

20

+1

Genotypes

Degree of freedom = 2; Probability = 70 - 80%

+I

(Obs - Exp)’ EXP 0.25 0.2353

0.05

x2 = 0.5353

Comment: This population has a very high probability to be the same as the expected frequencies of genotypes. Hence, we conclude that the distributions of genotypes in this population are in accordance to Hardy-Weinberg equilibrium (HWE).

33

Table 8 Summary of the allele frequencies in different populations

zyxwvuts zyxwvu zy

Allele 1

Control

Myopes

Adult

116

131

I

No of individuals studied

92

Heterozygosity

0.4099

II

2

Paediatric Myopes

141

436

57

I

60

42

II

42

276

95

0.3828

Average heterozygosity

0.33196

0.4239

0.3320

0.3761

3.5 Confirmation of SNP at Exon 3B by Sequencing

The three genotypes of exon 3B SNP comprises two homozygotes (1 1 and 22) and the heterozygote (1 2) were confirmed by fluorescence sequencing method using ABI PRISMTMDye Terminator Cycle Sequencing Kit and a ABI PRISMTMautomated DNA Sequencer. This confirms our prediction of the presence of the G-A polymorphism in exon 3B of TIMP-2 gene. 3.6 Myopic Families Studies

By the use of digits to denote alleles in the population, we can in principle analyse parentage based on simple Mendelian rules. For example, if the mother has genotype 11, and the child 12, then the true father must have contributed allele 2 and be of genotype 12 or 22, but not 11. With this principle, we have observed that the inheritance patterns of this SNP locus in exon 3B follows Mendelian inheritance for all our 90 individuals obtained from 22 different Chinese families. Figure 4 illustrates the transmission of the SNP exon 3B locus in a Chinese family with 3 children.

34

zyxwvutsr

zyxwvutsrq

Fig. 4 Transmission of exon 3B SNP in a Chinese family with three children. Note that its inheritance pattern is typical to that of Mendelian genetics.

3.7 SNP Polymorphism and Its Implications Single basepair substitutions occur much more frequently than VNTR loci, STRs, GC or CA dinucleotide repeats, etc. The rate has been estimated to be on an average of one nucleotide per every 500 bp.' It is believed that two unrelated individuals are likely to differ at several million nucleotide sites and that alternations at approximately 95% of the sites in the entire genome have very little effect on Darwinian fitness. SNP sites are common in human genome but their potential usefulness as genetic markers for case and linkage analysis are yet to be established. This study demonstrates the rapid method of screening for useful SNP, which can be generalized to any gene and any disease association analysis.

4 CONCLUSIONS Of the three SNP loci predicted, we are unable to establish the exon 1 SNP G-A polymorphism at this moment as the PCR condition has not been worked out despite several attempts.

zy zyxwvu 35

As for exon 3A SNP C-T polymorphism, it does not seem to exist at the 0.05 frequency level in our Chinese descent. However, since we only screened 20+ individuals here, the data may not truly reflect its nonexistence. This SNP site may be potentially important, because it results in an Ala to Val substitution or vice versa. More works are therefore needed to screen a larger Chinese and other ethnic populations before we exclude this site to be a functional polymorphism marker. In conclusion, we have discovered and confirmed it by DNA sequencing a new SNP at exon 3B in our local Chinese population. However, this SNP marker does not show any linkage or association to myopia, as there is no significant between normal and myopes population in terms of its genotypes distribution. The genotypes distribution at this locus does conform very well with the Hardy-Weinberg equilibrium suggesting that it could serve as a useful genetic marker for other genetic or evolutionary studies. It may be worthwhile to screen other ethnic populations at this SNP locus before we exclude exon 3B SNP to case association to myopia. Nevertheless, this study shows the potential application of biocomputing technique to speed up the discovery of genetic markers in linkage and association analysis. The approach adopted here to discover useful SNP sites is extremely rapid and could be generalised to any gene, EST or genomic sequences. With the same approach, we may generate more useful SNP sites at other regions of TIMP-2 gene for future myopic case association analysis. Acknowledgements

The authors would like to acknowledge the financial supports provided by the Singapore Polytechnic, Singapore Totalisator Board (1 1-27801-45-2458) and the Defence Medical Research Institute (DMRI). In addition, we would like to thank the staff of the Singapore Eye Research Institute for helping us to collect the blood specimens used in this study. We thank the staff of DMRI for allowing us to work in their well-equipped laboratories. Their most cordial companion-ship, constructive discussion, and technical assistance during the course of the project were very much appreciated.

36

zyxwvuts zyxwv

References 1.

Kimura M,. Neutral evolution. International Symposium on “Evolution of Life” 1990, held in Kyoto, Japan. 26-28.

zyxwv zyxw

2.

Bardien S, Ramesar R, Bhattacharya S, Greenberg J, Retinitis pigmentosa locus on 17q (RP17): fine localisation to 17q22 and exclusion of the PDGE and TIMP2 genes. Hum Genet 101 (1): 13-17.

3.

Hammani K, B’lakis A, Morsette D, Bowcock AM, Schmutte C, Henriet P, DeClerck YA, Structure and characterization of the human tissue inhibitor of metalloproteinase-2 gene. J Biol Chem 1996; 271:25498-25505.

4.

Rada JA, Brenza HL, Increased latent gelatinase activity in the sclera of visually deprived chicks. Invest Uphthal Visual Sci, 1995; 36 (8): 1555-1564.

5.

NCBI database accession number 505593; U44381 and U44383.

6.

Stetler-Stevenson WG, Brown PD, Onisto M, Levy AT, Liotta LA, Tissue inhibitor of metalloproteinase-2 (TIMP-2) mRNA expression in tumor cell lines and human tumor tissues. J Biol Chem 1990; 265 (23): 13933-13938.

zyxwvuts zyxwvu zyxwv zyxw zyxw zyx

FRONTIERS IN HUMAN GENETICS Diseases and Technologies 0 2001 by World Scientific Publishing Co. Re. Ltd.

37

A NOVEL METHOD OF GENOTYPING SINGLE NUCLEOTIDE POLYMORPHISMS (SNP) USING MELT CURVE ANALYSIS ON A CAPILLARY THERMOCYCLER SOON-MENG ANG and ERIC P.H. YAP*

Defence Medical Research Institute. Defence Science & Technology Agency, 10 Medical Drive, Singapore I I7597 *E-mail: [email protected] We report the development of a homogenous assay for the genotyping of singlenucleotide polymorphisms (SNPs), utilizing a fluorescent dsDNA-binding dye. Termed TM-shifi genotyping, this method combines multiplex allele-specific PCR with sequence differentiation based on the melting temperatures of amplification products. Allele-specific primers differing in length were used with a common reverse primer in a single-tube assay. PCR amplification followed by melt curve analysis was performed with a fluorescent dsDNA-binding dye on a real-time capillary thermocycler. Genotyping was carried out in a single-tube homogeneous assay in 25 minutes. We compared the accuracy and efficiency of this TM genotyping method with conventional restriction fragment genotyping of a novel single nucleotide polymorphism in the Jagged! (JAGI) gene. The flexibility, economy and accuracy of this new method for genotyping polymorphisms could make it useful for a variety of research and diagnostic applications. Keywords: genotyping, S N P , allele-specific, multiplex, fluorescent

* Corresponding author

38

zyxwvut zyxw

I INTRODUCTION

Disease susceptibility and severity, in addition to many human traits such as drug handling ability, have been linked to single nucleotide polymorphisms (SNPs) at many distinct loci. Susceptibility genes have been identified in multigenic multifactorial diseases such as familial Creutzfeldt-Jakob disease, malaria, breast cancer, and familial hyperinsulinism. SNPs are also being used for association and linkage studies of candidate genes for polygenic diseases and in genome-wide scans’ . Owing to their utility in disease gene mapping and their potential biological significance, SNPs in coding, intronic, promoter and intergenic sequences are being rapidly identified, either in silico by biocomputing prediction, or by mutation screening and sequencing. However, current limitations lie in the verification of these candidate SNPs, and in the rapid and economical genotyping of large numbers of samples. A biocomputing approach for novel SNPs discovery can facilitate the initial discovery process, and a standard PCR-RFLP method can be used for verification purposes. However, low-cost techniques for rapid genotyping are needed. The Juggedl gene (JAGI) on chromosome 2 0 ~ 1 2encodes a transmembrane receptor homologous to the Notch protein in Drosophilu melanogaster, a protein with multiple roles in cell differentiation and cell fate decisions. The systemic abnormalities seen in patients with Alagille syndrome (AGS), an autosomal dominant disease with liver, heart and vertebral formation abnormalities have been linked to mutations in this gene2. A novel SNP, C3417T, was predicted in exon 26 of the Juggedl gene by alignment and filtering of EST and genomic sequences (Ang & Yap, unpublished), and confirmed by sequencing of genomic DNA samples from a local population. DNA samples had also been genotyped by PCR-RFLP which verified the polymorphisms at these positions3. We describe here the development of an allele-specific genotyping method combining multiplex PCR with melting temperature (TM) analysis on a real-time fluorescent thermocycler. Using a fluorescent dsDNA-binding dye, SYBR@ Green I, a method was developed which required minimal optimization, and which can be applied to other polymorphisms of interest. Amplification and melting curve analysis were carried out in the same

zyx zyxwvu zyxwvu zy

zy zyx 39

capillary tube without manual intervention making this homogeneous assay ideal for applications requiring high throughput genotyping.

2 METHODS 2.1 Genomic DNA

zyx zy zyx

Blood samples were drawn from 46 random individuals of Chinese ethnic backgrounds, and DNA samples extracted using the Qiagen Blood Midi Kit (Qiagen). DNA samples were quantitated on a UV-spectrophotometer at 260nm-280nm, and 5-1 OOng of DNA used in each 10 pl reaction.

2.2 Allele-Specific Primer Design

Allele-specific primers were designed in a fashion such as seen in Fig 1. The bases at the 3’ end of the forward primers were designed to be either C allele-specific, or T allele-specific. The T-specific primer (1 5T) was 15nt long, while the C-specific primer was designed to be 20nt long. Two types of C-specific primers were tried, one with the entire sequence “complementary” to the target sequence (20C), and the second with an arbitrary “generic” 5’ tail comprising G and C (20GC). A common 15-mer reverse primer (15R) was used with both forward primers in a multiplexed assay. To aid allele discrimination, the Stoffel fragment of Tuq DNA polymerase was used to prevent 5‘ exonuclease activity interfering with the a1lele-specific amp]ification4. 2.3 PCR Product Amplification and Melting Curve Analysis

All PCR reactions were performed in lop1 volumes with long of genomic DNA in composite glass-plastic capillaries on the real-time fluorescent PCR machine, the LightCyclerTM(Roche Diagnostics). Allele-specific PCR reactions were individually optimized with known controls to give specific products without primer-dimer or other non-specific amplification. Hotstart PCR reactions were set up as follows: 0.09 pM of either the generic-tailed (20GC) or the complementary (20C) C-specific forward primer, 0.36 pM of the shorter T-specific forward and the common reverse primer; 2 units of

40

zyxwvutsr

zyxw

Stoffel polymerase (Perkin Elmer) incubated with an equivalent amount of TaqStartTMantibody (Clontech); 1X Stoffel buffer (Perkin Elmer, 10 mM KCL, 10 mM Tris-HCI at pH 8.3); 2.5 mM MgCI2; 250 pM each dATP, dCTP, dGTP and dTTP; 500 pg Bovine Serum Albumin (New England Biolabs); 0.05% Tween-20 (Roche Molecular Biochemicals); and 1X SYBR@Green I (FMC Bioproducts). The generic-tailed C-specific forward primer was GCCGGCCCATCAAGGATTAC (20GC), the complementary C-specific forward primer was CGGTCCCCATCAAGGATTAC(20C); the shorter T-specific forward primer CCCATCAAGGATTAT (1 5T); and the common reverse primer GGAGTTCTTGTTCTC (1 5R). For the generic 20GC allele-specific amplification (20GC/15T15R), an initial incubation of 90 sec at 95°C was followed by a PCR step of 0 sec denaturation at 95°C followed by 6 sec annealindextension at 51°C for 5 initial cycles, after which the denaturation temperature was lowered to 85°C for 0 sec and 51°C for 6 sec in a run of 30 more cycles. Online analysis of fluorescence was performed during PCR. After the final denaturation, the DNA was then reannealed for 30 sec at 56"C, followed by gradual melting at 0.2"C/sec till 85°C. The PCR products were then cooled at 40°C for 30 sec. Fluorescent emission in each capillary was acquired by the software provided by the manufacturer and monitored onscreen during each annealindextension step and continuously monitored during the melting program. SYBR Green I binds preferentially to dsDNA with a fluorescent emission wavelength which is monitored in the F1 channel of the LightCyclerTM.As the amount of dsDNA varies during PCR and melting curve analysis, this dsDNA dye can be used to monitor the quantity as well as sequence of the PCR products. The second method using the complementary 20C primer (20GCI15T-15R) required a slightly different thermal protocol. This was because the optimal annealing temperatures for 20GC and 15T were different. After an initial denaturation of 120sec at 95"C, alternating cycles (which we termed Iflip-fop') were used to amplify both the shorter Tproducts as well as the longer-tailed C-products under conditions optimal for each set of primers. This consisted of denaturation at 95°C for 0 sec followed by 7 sec annealing at 48"C, then denaturation at 95°C for 0 sec with a following step of 58°C for 4 sec. This was performed for 8 cycles

zyxwv

41

zy

zyxwv

(8x2). This methodology had the effect of priming and amplifying a template base from which further amplification can take place without the preferential binding of the longer-tailed forward primer over the shorter one. 35 cycles of amplification were then carried out at a lower 85°C denaturation for 0 sec with a 5 1 "C 7 sec annealing step. Subsequent steps were the same as above. 2.4 Data Analysis

Melting curves (Figs 2a and b) were generated automatically using the polynomial function of the software. The plots of raw fluorescence (F) data against cycle number, and -dF/dT against temperature allowed monitoring of product yield and melt profiles respectively. Unlike CCD-based sequence detectors, the capillary-to-capillary and cycle-to-cycle variation in the LightCyclerTMwas minimal, and raw fluorescence data was monitored above the initial baseline fluorescence in each capillary. Melting peaks (comparable to TM)and peak heights were automatically calculated by the software. Scatter graphs were constructed for the 46 samples genotyped with both the generic and the genomic methods. Two peaks, one at 71-72°C represented the shorter T-specific forward primer in combination with the reverse primer, the other 75-77°C representing either the GC-tailed 20GC or 20C forward primer with the reverse primer was observed. For plotting of the scatter graphs, the two peaks were compared relative to each other, and either peak was taken as a fraction of the larger peak. In both these cases the -dF/dT fluorescent peak value at 68°C was taken as the baseline and peaks above this value at 71, 77°C were then calculated. Therefore in Fig 2, homozygotes for the T-allele had only T-specific PCR products which consisted of 7 1-72°C peaks only, heterozygotes had both T-specific and C-specific peaks of 7 ~ 7 2 ° Cand 75-77"C, while C-homozygotes had only C-specific 7 6 7 7 ° C products.

42

zyxwvutsr

zyxw zyx zyxwvuts zyxwvu zy

3. RESULTS

3.1 Assay Optimization

We used a multiplex format involving the use of two allele-specific primers and a common reverse primer so that genotyping could be performed in a single tube. A 15nt T-allele specific primer (1 5T) was combined with a 20nt C-allele specific primer (20C for the complementary tail, 20GC for the noncomplementary tail). The polymorphic base was positioned at the 3' end of the primer for maximum allele-specificity (Fig 1). The entire amplicon was kept as small as feasible (about 35-50bp), so that the 5bp difference in amplicon sizes made a significant difference to melting temperature. Optimization of both these assays differed due to the composition of the 5' tail. The 20C/15T-I5R assay utilizing the 20C complementary primer with the 15T primer and the common reverse primer was optimized using a molar ratio of 1:4 of 20C:lST primers in order to reduce the preferential binding of the longer primer. However, the 2 primer-pairs had different optimal annealing temperatures, making it difficult to find a common protocol in which both 20C-15R and 15T-15R primer pairs were equally optimal. To overcome this problem, we developed a novel protocol which we have termed 'If2ip-jlop" PCR, where in the initial cycles of the PCR, alternating cycles had different annealing temperatures corresponding to the temperatures at which each primer pair worked best. Two alternate cycles of 95OC-58"C and 95"C-49"C were used for the first 8 cycles. At 58°C only the 20C-15R primer pair would anneal, and at 49°C although both 2OC-15R and I5T-15R primer pairs would bind, the 4: 1 molar ratio in favour of the 15T primer would bias the reaction towards the T allele. This would have the effect of amplifying each allele by about 28 fold. Subsequent cycles then utilized a denaturation step of 85°C which was sufficient for denaturation of PCR products but not genomic DNA, therefore increasing the specificity of this assay5. The 5 1"C annealing temperature allowed both primer pairs to work at approximately equal efficiency when amplifying the PCR products formed during the initial cycles. The optimization for the 2OGC/15T-l5R assay utilizing the 20GC generic tail was more straightforward. In theory both the 20GC and 15T

zy

zyxwvut 43

primers would have more similar annealing temperatures, and amplification of the genomic DNA in the initial cycles could be carried out without having to use the 'yip-flop" protocol to overcome the problem seen with the other assay. However, similar bias for the longer 20GC primer was seen in the amplification of PCR products as the 5' five nucleotides would be incorporated into products. Hence excess 15T primer was used at a molar ratio of 4: 1. In both these assays it was also important that the 20GC and 20C primers were used at limiting concentrations. Potential problems of primer-dimer products, which could be confused with the desired product, were avoided by the use of a hot-start protocol such as using TaqStartTMantibody. These assays were tested for their effectiveness in genotyping samples at different DNA concentrations, and though both these assays were effective from 5-100 ng of genomic DNA, it was found that the optimal amount of genomic DNA required was 10 ng. The allele-specificity of these primers was tested in combinations containing only one of each forward primers, such as 20GC-l5R, 20C-l5R, and 15T-15R sets. In separate experiments, these primer sets would only amplify the specific alleles. Non-specific amplification occurred after 1.5-2 times the number of PCR cycles required for the specific templates. A negative sample containing all the reagents but without DNA was used in each experiment to monitor the accumulation of primer-dimer products; with the use of TaqStartTMantibody, primer-dimers were not detectable.

zyxwvu

3.2 SNP Genotyping

zy

We tested the accuracy and efficiency of genotyping with both complementary-based and generic-based assays. The three genotypes for the JAG1 C34 17T polymorphism yielded distinct melting peaks in both assays, the 15T-15R product had a melting peak of 71-72"C, while the longer 20C15R and 20GC-15R products had melting peaks of 76-77°C. These temperatures were reproducible in all experiments, with the 1"C variability due to pipetting errors affecting salt concentrations or fluorescence. Using the 20GC/15T-l5R assay, we genotyped 46 random DNA samples from ethnic Chinese which had been genotyped previously at the same SNP using PCR-RFLP. These samples were genotyped in a "single-

44

zyxwvuts

zyxwv zy zyxwvuts zyx

blind” format where the results were compared to the previously obtained results. On the basis of melting curve analysis of PCR products postamplification, all 8 homozygote CC, 21 heterozygote CT and 17 homozygote TT samples were genotyped correctly (Fig 2a). In the heterozygote, the mean height of the secondary peak as a fraction of the major peak was 0.514 (SD = 0.210). This is shown in the scatter plot of Figure 3a in which the 3 genotypes are well clustered. Using the 20C/15T-l5Rassay, the same 46 DNA samples were also correctly genotyped (Fig 2b). In the heterozygote, the mean height of the secondary peak as a fraction of the major one was 0.432 (SD = 0.0753). (Fig 3 b). 20c

CGGTCCCCATCAAGGATTA~

7 CTCTTGTTCTTGAGG

15R

20GC

GCCGG

z zyxwvutsr 15T

CCCATCAAGGATTAT

CTCTTGTTCTTGAGG

15R

Fig 1 Design of allele-specific primers, the complementary 20C forward primer, the generic 20GC primer, the 15T primer and the 15R common reverse primer.

45

"$4,

zy

zyxwvutsrqpo zyxwvutsrqpon zyxwvutsrqpo zyxwv zyxw bit

14,

dP

It$

H:

0s)

ID)

112

X>

W)

tL9

M2

N4

Ul

kc

TwnpenCm(C)

(a) Generic assay

Fig. 2 Melting peaks (-dF/dT) corresponding to the TM of the PCR products. Amplification with the 20-mer generic or complementary C-specific primers in combination with the 15mer reverse primer resulted in a melting peak at 76-77"C, while amplification of the 15-mer T-specific primer with the 15-mer reverse primer resulted in a melting peak at 71-72°C.

46

zyxwvutsrq

zyxwvu zyxwv

(b) Complementary assay

Fig. 2 (Continued)

: 4

0

0.2

0.4

z

zyxwvutsrqpo zyxwvutsrq zyxwvutsrq 0 6

0.8

1

1.2

P a a k 1 at 11 de

(a) Scatter plot of CC, CT and 'IT genotypes using the generic assay

0

0.2

0.4

zyxwvutsrq 0 6

0.B

I

1.2

Peak 1 at 11 ds

(b) Scatter plot of CC, CT and TT genotypes using the complementary assay Fig. 3 Scatter plots of each of the three genotypes as analyzed with each assay format, generic and complementary. Samples were scored for the presence of melting peaks at 71OC and 77OC, and taken as a fraction of the largest peak.

zyxwv

zyxwvu z zy

4 DISCUSSION

We have developed a rapid and homogenous assay for SNP genotyping. This assay uses only dsDNA-binding dye and does not require the synthesis of fluorescent-labeled primers or probes, making it economical. It has been tested on 46 random DNA samples and correlated well with data previously obtained by PCR-RFLP using both assay formats, with all samples successfully amplified and correctly genotyped. Although results derived from both these assays clustered in three unambiguous and distinct regions (Figs 3a and 3b), corresponding to separate genotypes, there were differences in the results obtained with both assays. The complementary assay using 20C-15T-15R was more accurate in genotyping heterozygotes, with a tighter cluster as seen in Fig 3b. This is reflected in the smaller standard deviation. However, this assay required more optimization as the two primers had different annealing temperatures. We had tried to overcome this to some extent through the use of the novel 'Iflip-flop"PCR in the initial cycles to non-competitively amplify each allele. The use of a lower denaturation temperature of 850C4 also increased yield and specificity. However, the 'Iflip-flop"part of the PCR protocol requiring individual optimization of each primer pair before they can be combined in a multiplexed set of 2OC/15T-l5R. The number of initial cycles for this marker was 8, the number of ''Jip-JIop"cycles may need to be changed. Lastly, the molar ratio of the longer 20C primer in relation to the 15T primer in both these assays was 1:4 in this case, but this ratio could also be varied. Therefore, this assay, although it is more specific than the non-homologous assay in genotyping heterozygotes, requires more pre-multiplexing optimization. There may be other multiplex PCR applications in which "flipflop" protocol would be advantageous, such as multiplexing primer pairs from different genes, with different annealing temperatures. The non-homologous set of 20GC-15T-15R requires minimal optimization due to the similar sequences. The generic tail would 'flap' up during initial amplification of genomic DNA, and the bound sequences would have similar annealing temperatures in the initial cycles. A molar excess of 15T over 20GC primer is still required. However, in comparison, only a single optimization of either 20GC-15R or 15T-15R primer pairs is

zy

zyxwvu zyxw 49

required before multiplexing is possible, and only the molar ratio would need to be optimized, minimizing upstream optimization time. The stringency of the PCR amplification was also aided by the use of the Stoffe13 fragment of Tag polymerase, an enzyme lacking the 3'-5' exonuclease activity required for proof-reading capability. This enzyme allows the mismatch at the terminal 3' nucleotide to discriminate between different alleles, and yet remains uncleaved during proof-reading. The technique of TMshift genotyping was first reported by Germer and Higuchi6 who used allele-specific PCR with the addition of a GC-rich tail' to increase product differentiation. The TM of PCR products are dependent on both GC composition as well as the length of the PCR product5. Therefore the influence of GC-tails depends on the total PCR product composition and length. This earlier work had the problem of primer-dimers with melting profiles similar to that obtained from template amplifications, complicating the interpretation of genotypes. With small PCR products such as this 30-35mer fragments, it was expected that we may have problems with primer-dimers. However, we also utilized TaqStart antibody, which through binding of the Stoffel fragment at low temperatures prevents amplification of primer-dimers but whose binding activity is inactivated once temperatures are raised >70°C. Due to the need to optimize the molar ratio of primers, we used limiting amounts of the longer primer, therefore overall primer concentrations were minimal. Low primer concentrations had the effect of minimizing amplification of primer-dimers, resulting in no amplification of primer-dimers in most cases. We were able to perform as many as 60-70 cycles without non-specific amplification of primer-dimers, increasing the confidence of genotyping results. This obviates the need for post-PCR analysis such as gel electrophoresis, with potential problems of carry over contamination. Short PCR products can now be distinguished by the gain in fluorescence of PCR products, which would otherwise not be possible by conventional means. The interpretation of results used in these assays is based on the analysis -dF/dT, the change of fluorescence in relation to time as compared to the usual fluorescence with respect to time. We were able to look at melting peaks, which corresponds to the TM of DNA. Due to the inter-assay variation of f 0.5"C which is seen with the LightCyclerTM,we used a

zyxwvu

50

zyxwvuts

baseline fluorescence at 68"C, a temperature corresponding in most samples to the base of the melting peaks. This allowed us to compensate for intraassay variation and capillary variation, while allowing us the ability to subtract base I i ne fluorescence, In contrast to hybridization probe based assays, our assays relied on an economical detection method, the fluorescent dsDNA binding dye SYBR@Green I. The expense and optimization required of custom labeled probes makes it uneconomical for high-throughput genotyping. Compared with conventional PCR amplification, there are few additional reagents required. On the LightCyclerTM,32 samples can be genotyped in 25 minutes for both amplification and melting curve analysis, per working day 12-13 runs can be carried out with preparation time included, a total of 384 samples per day. This technique can thus be applied for high-throughput genotyping. Even higher throughput would be possible on 96-well or 384well format fluorometric thermocyclers. The speed for this assay allows rapid detection of mutations for rapid diagnosis of genetic disease. It appears probable that these two assays can be readily applied to other genes and SNPs. While GC-rich target templates may not be as easily genotyped, keeping the PCR product small may help maintain the melt curve differences of the two alleles. In conclusion, we have therefore developed two protocols, with different optimization requirements and accuracies, for the genotyping of DNA polymorphisms. Key features of these assays are the use of Stoffel fragment for fidelity, maintaining a small target size for the PCR product, the use of TaqStart antibody to minimize primer-dimers, the use of melting curve analysis and the lower denaturation temperature after five cycles. The value of SNPs in mapping and linkage studies, and in disease gene and pharmacogenetic analyses emphasize the importance of having a rapid, economical yet easily optimizable and flexible assay with high-throughput capabilities for SNP genotyping.

zyxw

zyxwv zyxwvutsrq zyxwvu zy 51

Acknowledgements

We wish to thank Shirley Seah for the initial PCR-RFLP based genotyping of the many samples and for the results of the population studies. We wish to thank Poh-San Lai for reviewing the manuscript and providing valuable advice and comments.

References

1. Kruglyak, L. The use of a genetic map of biallelic markers in linkage studies. Nut. Genet. 1997 17:21-24 2. Oda, T., Elkahloun, A.G., Pike, B.L., Okajima, K., Krantz, I.D., Genin, A., Piccoli, D.A., Meltzer, P.S., Spinner, N.B., Collins, F.S. and

Chandrasekharappa, S.C. Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nut. Genet. 1997 16:235-242

3. Seah S.G.K., Lai P.S., and Yap E.P.H. Identification and characterization of single nucleotide polymorphisms in Juggedl, the candidate gene for Alagille syndrome and congenital heart defects. In abstracts of the combined annual Scientific meeting of the Biomedical Research and Experimental Therapeutics Society of Singapore, Singapore Society for Biochemistry and Molecular Biology and Singapore Society of Microbiology and Biotechnology, 13-14 August 1999, Singapore, pg 36

4. Lawyer, F.C., Stoffel, S., Saiki, R.K., Chang, S.Y., Landre, P.A., Abramson, R.D. and Gelfand D.H. High-level expression, purification, and enzymatic characterization of full-length Thermus Aquaticus DNA polymerase and a truncated form deficient in 5’ to 3’ exonuclease. PCR Methods Applic 1993 2~275-287

zyxwv

5. Yap, E.P.H. and McGee J.O’D. Short PCR product yields improved by lower denaturation temperatures. Nucl. Acids Res. 1991 19: 17 13

52

zyxwvutsr

zyxw zy

6. Germer, S. and Higuchi, R. Single-tube genotyping without oligonucleotide probes. Genome Research 1999 9:72-78

7. Sheffield, V.C., Cox, D.R., Lerman, L.S. and Myers R.M. Attachment of a 40-base pair G + C rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc. Natl. Acad. Sci. 1989 86:232236

zyxwvu zyxwvu zyxwvu zyxw zyx zyxw zy zyxw

FRONTIERS IN HUMAN GENETICS Diseases and Technologies 0 2001 by World Scientific Publishing Co. Re. Ltd.

53

Bl0MEMSI“LAB-ON-A-CHIP”: TOWARDS A CHEAPER, MORE RAPID, PORTABLE AND ‘AUTOMATED’ HIGH-THROUGHPUT GENOTYPING TECK CHOON AYIt and ERIC PENG HUAT YAP*.* Defence Medical Research Institute, Defence Science & Technology Agency 10 Medicai Drive, Singa ore 1I7597 tE-mail: [email protected]; e-mail: [email protected]

f

’

With the completion of the human genome project, scientists will face the daunting

task of analysing the function of all human genes obtained from the project. Global analysis of gene expression and DNA polymorphisms and mutations, however, are facilitated with the development of tools such as microarrays and “Lab-on-a-Chip’’ systems. This chapter gives an overview of the BioMEMs/ “Lab-on-a-Chip’’ systems, the components that constitute such systems and some commercial chip systems currently being developed or sold. Keywords: BioMEMs, “lab-on-a-chip”, microarray, chip components, commercial chip systems

I INTRODUCTION 1.I Mapping of Genes for Diseases and Traits The sequencing of the entire human genome will provide the scientific community with the genetic blue print of mankind. With the advent of bioinfonnatics, genome sequences are already publicly available over the world-wide-web. We are now approaching the threshold of a new and exciting era. In this post-human genome project era, geneticists will be using data derived from the project to find genes that control human behaviour and physical attributes, or whose mutations cause diseases. Genetic markers for these phenotypes may exist as STRs (short tandem repeats), VNTRs (variable number tandem repeats), SNPs (single nucleotide polymorphisms),

zyxwv

Corresponding author

chromosome deletions, rearrangements, etc., in both the extragenic regions, as well as in the genes themselves. Of these markers, the STRs, VNTRs, and SNPs are the most useful because they are highly polymorphic among individuals. SNPs in particular are estimated to occur at least once every lkb interval of the human genome, and probably are the most informative, if all of them could be mapped. Indeed, such efforts are underway right now, with the NIH and a consortium of public labs and pharmaceutical companies among others, being involved (www.ncbi.nlm.nih.gov/SNP, and http://snp.cshl.org). The existence of markers associated with the phenotype of interest as determined from linkage analysis, indicate the presence of a gene or genes nearby. Having an integrated genetic and physical map and the location of all the genes in the human genome will enable identification of candidate genes rapidly. Thus, identifying disease genes by positional cloning will be made easier with the completion of the Human Genome Project. Current methods of genotyping STRs and VNTRs, involve PCR and either polyacrylamide slab gel or capillary electrophoresis (CE), to separate the different DNA fragments according to their sizes. This approach is amenable to multiplexing. SNPs, on the other hand, are genotyped by PCR followed by DNA sequencing, RFLP, primer extension, or a variety of homogeneous single-tube assays or physical separation methods such as mass spectrometry or denaturing HPLC. Other novel approaches do not require prior DNA amplification e.g. the Invader Assay technology developed by Third Wave Technologies (www.twt.com, Madison, WI, USA). In order to find the markers for a phenotype that is caused by polymorphisms or mutations in multiple genes, such as the case in myopia, genome wide screening of thousands of genetic markers in large sample sets can be daunting and highly labour intensive. However, with the use of robots, e.g. the Biomek series from Beckman (www.beckman.com, Fullerton, CA, USA) and high-throughput 96 samples CAE (Capillary Array Electrophoresis) systems, e.g. MegaBace 1000 (Molecular Dynamics, www.moleculardynamics.com, Sunnyvale, CA, USA) and ABI PRISM@ 3700 DNA Analyzer (PE Biosystems, www.pebio.com, Foster City, CA, USA), such analyses have become manageable. Alternatively, promising new technologies such as microarray and BioMEMSILab-on-a-Chip may be used to speed up gene or marker identification, reduce consumable and manpower costs, and increase throughput and accuracy.

zyxw

z z

zy zyx 55

zy zyxwvu

1.2 lmmunogeneticsand Pharmacogenetics

Genetic polymorphism also plays a role in the ability of individuals to resist infection and to metabolise drugs. It also influences the virulence of a pathogen, and may be used for the identification of the variant pathogen. As an example of immunogenetics, a variant of the CCR-5 chemokine receptor with a 32 base pair deletion, promotes resistance towards HIV infection.'.2 In contrast, a variant of the CX3CRI receptor affecting only two amino acids, progresses towards full blown AIDS more rapidly than other hap lo type^.^ As for pharmacogenetics, polymorphisms in cytochrome p450 enzymes e.g. CYPZC19, CYP2D6, etc. affect the proteins' abilities to metabolise drugs. This lead to a scenario where drug dosages can be tailored to an individual based on one's P450 genotype, thus avoiding adverse drug reactions caused by an inability to detoxify the drug4, or subtherapeutic dosing due to increase clearance. It is obvious that both microarrays and BioMEMsLab-on-a-Chip will rival and surpass traditional technology in genotyping genes involved in immunity and drug metabolism. Briefly, a DNA microarray is constructed by spotting thousands of DNA fragments derived from PCRs or libraries, or even oligonucleotides onto silicone chips, glass slides or membranes, whose surfaces are chemically treated to bind the DNAs. A robot called a microarrayer is used to spot the DNA solution, down to a volume of less than one nanolitre per spot as a two dimensional (X, Y) grid on a surface. Each spot represents a distinct DNA entity e.g. one position (1,l) may be spotted with actin DNA, another (1'2) spotted with p53 DNA, etc. Simultaneous hybridisation of the microarray with cDNAs from test and control cells, each labelled with a different fluorophore, then facilitates the quantification of the different expression levels of each gene that had been spotted onto the microarray. Besides spotting, light directed chemical synthesis of oligonucleotides on a chip using photolithography, as pioneered by Affymetrix (www.affymetrix.com, Santa Clara, CA, USA), allows one to attach oligonucleotides to a chip at a density which surpasses the microarrays constructed by spotting. There are numerous literature and review articles written on microarrays due to the rapid development in this In a point-of-care setting however, BioMEMsfLab-on-a-Chip has an advantage over microarrays and other traditional technology because of its combination of low cost, speed, portability, low sample and reagent consumption, automation, and high-throughput parallel analysis of samples. In analysing samples, BioMEMsLab-on-a-Chip devices may be fabricated to incorporate

56

zyxwvutsr

zyxwv zyxw zy

a sample preparation component and a sample analysis component that uses either micro CE (capillary electrophoresis) for both DNA fragment length analysis and DNA sequencing or micro PCR (polymerase chain reaction) or electronic addressable arrays, e.g. Nanogen’s array (www.nanogen.com, San Diego, CA, USA).

1.3 Other Applications

Besides the applications described above, BioMEMs and MEMs have also found applications in the field of in-vivo drug d e l i ~ e r y ,i ~m m u n o a ~ s a y s , ~ ~ cell separation,l0 patterned cell attachment and growth,” patterned delivery of protein to a surface,’* isoelectric focussing of proteins,13 SDS gel electrophoresis of protein~,’~ and combinatorial chemical ~ynthesis.’~ Since this chapter discusses the application of BioMEMs and “Lab-on-a-Chip” systems for genotyping, none of these other applications will be discussed indepth. This overview discusses in length each component that constitutes a BioMEMdLab-on-a-Chip system, and compares some commercial chip systems that are currently being developed or sold. The systems discussed will also include Nanogen’s “Lab-on-a-Chip” microelectrode array, and Protogene’s (www.protogene.com, Menlo Park, CA, USA) ink-jet printing (MEMs) technologies that can be use to create microarray on glass slides or membranes.

2. BlOMEMS/“LAB-ON-A-C HIP” BioMEMs (Biomedical MicroElectroMechanical system) is a “Lab-on-aChip” micro-machine with the potential to analyse biological samples cheaply and rapidly in a parallel, high-throughput and automated manner. Due to their small size, BioMEMs has many advantages as compared to conventional devices for preparing and analysing biological samples (Table 1). MEMs (MicroElectroMechanical systems) microchip which encompasses BioMEMs, is already an established field and products that incorporate MEMs are found, for example, in the device that triggers inflation of airbags in car, the head of the ink-jet printer and the chemical sensor in a portable blood-analyser.16 Instead of chemical analysis, BioMEMs involves the analysis of biological samples. The term “Lab-on-a-Chip” is generally used

57

zy

to define both MEMs for analysing chemicals and BioMEMs. Another term favoured by most authors to describe “Lab-on-a-Chip”, is micro Total Analysis System or pTAS. “Lab-on-a-Chip” systems are produced using technologies derived from the microelectronic industries and incorporate microfluidics, microfilters, microreactors, microseperation columns, microfabricated pumps and other microcomponents, depending on the microchip’s application. A fully integrated system with sample preparation, delivery, analysis and data output can be potentially built into BioMEMs. Hence BioMEMs are automated devices. However, all current commercially available BioMEMs have a ‘desk-top’ or benchtop unit besides the chip itself. This is for either sample preparation or data output for humans to read and access e.g. Cepheid’s GeneXpert (www.cepheid.com, Sunnyvale, CAY USA) or Agilent’s 2 100 Bioanalyzer (www.chem.agilent.com, Palo Alto, CA, USA). Currently most BioMEMs do not have the ability to simultaneously analyse as many genes as micro array^.'^ In contrast to microarrays which analyse DNA or RNA samples based on their ability to hybridise with probes immobilised on the microarray, the stringency of which is controlled by temperature and laser, BioMEMs show more flexibility. BioMEMs can analyse DNA samples by selective amplification using micro-PCR in micro-wells or micro-CE separation, depending on the applications.

zyxwvu zyxwv Table 1 Advantages of “lab-on-a-chip”

“Lab-on-a-Chip’’ has many advantages compared to conventional analysis system, due to its small size. Microchannels ranging between 5 and 200pM in width and depth have these properties:

zy

Rapid heat transfer that allows rapid cooling and heating time. Improved speed and efficiency of separation on micro CE. Reduced reagent consumption. Electroosmotic pumping which allows for valveless systems and less external pumping. This applies only to silica based chips. Highly portable and disposable. Amenable to parallelization with multiple separation channels, built-in chambers, etc.

Besides “Lab-on-a-Chip”, there are also “Lab-on-a-Disc” and “Labon-a-Card” systems. An example of a “Lab-on-a-Disc” is the Gamera BioscienceRecan LabCD (www.tecan.com), which is still under

58

zyxwvutsrq

z zyx zyxwvu zy

development. This is a compact disc (CD) based pTAS that uses the centrifugal force of a spinning CD to move liquids. An example of a “Labon-a-Card” is PEBiosystem’s RT-PCR card which is still under development. 2.1 The Components of a “Lab-on-a-Chip” 2.1.1 Chip materials

Many types of material were used for the fabrication of chips, from silicon and siloxane to different types of polymer, e.g. PDMS or poly(dimethylsiloxane), PMMA or poly(methy1 methacrylate), polyamide, polycarbonate, polyethylene, etc. Each one of them has their own advantages and disadvantages. Early systems used silicon-based substrates because fabrication technologies were available from the microelectronic industries. Fused silica, quartz and glass are transparent, amenable to photolithographic and wet etching fabrication (Figure l), dissipate Joule heat more rapidly than plastic materials and exhibit electroosmotic flow (EOF, refer section 2.1.3). These are popular materials for fabricating micro CE (micro Capillary Electrophoresis) based de~ices.’’-’~The silanol groups on silicon based device, however, will adsorb proteins and is suitable for PCR reaction without prior surface modifications. For silicon devices, the most reproducible results can be obtained by creating a layer of thermal oxide (silicon dioxide) on the ~ u r f a c e . Silanisation ~~-~~ of the surface has also been attempted but PCR results tend to be less reproducible when compared to thermal oxide coating.24 For mass production of disposable chips, silicon, fused silica, quartz and glass based “Lab-on-a-Chip” are comparatively more expensive than polymer based chip. Polymers can be fabricated using different molding technologies such as hot embossing, injection molding and casting. The polymers are usually hydrophobic and do not support EOF, but electrophoresis in a microchannel filled with gel or polymer solution e.g. linear polyacrylamide (LPA) can still be carried out (refer section 2.1.3). A review on polymer based microchips and their method of fabrications has been reported by Becker H and Gartner C (2000).27 Another popular and cheaper material for chip construction is the use of elastomer, poly (dimethylsiloxane) or PDMS. PDMS is an excellent material for fabrication of “Lab-on-a-Chip”. Using replica plating, features on the micron scale can be reproduced with high fidelity with PDMS. Multiple devices can be produced rapidly from a single master with only the

zyxw

59

minimal use of d e a n room facilities. PDMS cures at lower temperatures, exhibits reversible deformity and seals reversibly to itself and other materials on contact. It also seals irreversibly upon exposure to an air plasma, is optically transparent to wavelengths up to 280 nm, non-toxic to mammalian cells culture, and its hydrophobic surface upon plasma oxidation supports EOF. Fabrication uses the soft lithography techniques of rapid prototyping and replica molding. A review on fabrication of microfluidic systems using PDMS has been published by McDonald JC and co-workers (2000).28

+

zy

zyxwv zyx

UV Light

+ Photoresist + Metal

+ Glass/Silica Metal and photoresist layers are deposited onto glass substrate. Mask layer is UV irradiated to transfer the channel pattern.

The UV exposed photoresist layer is removed and the uncovered metal layer is etched away.

zyxw zyxwvu

Appropriate etchant e.g Hydrofluoric acid or Ammonium fluoride is used to etch channel pattern on glass/silica surface.

The top plate is thermal bonded after removal of the metal and photoresist layers.

Fig. 1 Generic approach to chip fabrication using photolithography and wet etching. [Adapted from McCreedy T. (2000) Trends in Analytical Chemistry 19(6).]

2.1.2 Sample preparation To fabricate a truly integrated “Lab-on-a-Chip”, it is not enough just to have sample separation and detection. Preparation of materials for analysis from biological fluids and the environment e.g. bacteria from soil, water and air,

60

zyxwvutsr

zyxw zyxwvu

consumes time and usually involves multiple centrifugation steps. Most of the time the samples are diluted and need to be concentrated before analysis. Some of these materials may be biohazardous and it may thus be safer to automate the isolation process. As an example, preparation of DNA or RNA from HIV infected whole blood for PCR or RT-PCR analysis uses a gradient centrifugation step in Ficoll-Hypaque to separate blood plasma from white blood cells (WBCs) and red blood cells (RBCs) before concentrating the WBCs into a 'buffy coat'. Further processing of the plasma and 'buffy coat' is required to obtain RNA or DNA for RT-PCR or PCR reaction. There are many commercial kits available to isolate DNA and RNA from whole blood, e.g. kits from Qiagen (www.qiagen.com, Hilden, Germany) and Promega (www.promega.com, Madison, WI, USA). A sample preparation component is required in a "Lab-on-a-Chip" to act as an interface between a biological or environmental sample with volumes ranging from microliters to millilitres. The sample preparation component must be able to separate and concentrate, and/or extract DNA, RNA or proteins, such that the microfluidic system can then be transfered to the sample analysis component of the chip. Examples of sample preparation components are as follows: (i)

A series of weir-type filters have been fabricated for the separation of WBC from whole blood on silicon chambers that also double up as PCR chambers.29Typically only 3.5pL of whole blood is used for WBC isolation. Whole blood is pumped through the chip at 0.035pl/second, and after the initial filtration, lml of PBS is pumped through the chip at 8mVhour to wash. Micro PCR with primers against exon 6 of the dystrophin gene has been conducted with the result being analysed separately on CE.

(ii)

Preparation of DNA for PCR analysis from bacterial spores on a microfluidic cartridge with an integrated minisonicator has also been rep~rted.~' The cartridge is programmed to deliver 5pl of lysate and 20pl of PCR reagent into a PCR tube, and then the PCR reaction subsequently analysed separately on a PCR machine.

(iii)

Dielectrophoretic separation (refer to section 2.1.3) of E. coIi from whole blood has also been perf~rmed.~' The separated E. coli is subjected to electronic high-voltage pulses to lyse the bacteria, followed by proteolytic digestion on a single fabricated

zy

61

zy

zyx zyxw

microelectrode array chip. The lysate, which contains DNA, RNA and proteins, is manually transferred and further examined by electronically enhanced hybridization on a separate microelectrode array chip (refer to section 2.1.3.4). No PCR is involved. (iv)

Separation of fluorescent and non-fluorescent E. coli on a microfabricated Fluorescence-Activated Cell Sorter (FACS)?2

(v)

A thin porous silicate micromembrane structure constructed between two microchannels for the concentration of DNA.I9 This membrane allows ionic current to pass but prevent larger DNA molecules from crossing. The entrapped DNA is injected into a micro CE channel, separated and then analysed.

2.1.3 Sample analysis: delivery and separation (microfluidics), and det8CtiOf7.

Microfluidics is the manipulation of liquids and gases in microchannels with cross-sectional dimensions in the order of 10-1OOpM. For biological analysis, microfluidics usually involve liquids. Electrokinetic pumping or electrokinetically driven transport is the sum of the electrophoretic and electroosmotic forces acting on liquids in the microchannels (Figure 2). Electroosmotic flow or EOF can reach velocities of 5 c d m i n or greater. The rate of electroosmotic flow is generally greater than electrophoretic migration of the individual ions and this effectively becomes the mobile phase pump of capillary zone electrophoresis (CZE). There are other pumping mechanisms available with low flow rate e.g. silicon or plastic diaphragm pumps with piezoelectric activators, but this technique of pumping may introduce backpressure leading to leakage. External pumps, excluding syringes, are bulky, expensive and not mobile. They often require much more engineering efforts. The MEMs community has evaluated and utilised an abundance of pumping principles to move

zyxwv zyxw

Micro CE makes use of microfluidics to move liquids through bare capillaries or capillaries filled with sieving matrix e.g. hydroxyethyl cellulose (HEC) and LPA. Indeed, CZE makes use of electroosmosis to separate molecules based on their net charges in a bare glass or silica capillary (Figure 2). As an example, a microfabricated device uses a balance of capillary action and EOF to separate Hind11 digested h DNA into different sizes and

62

zyxwvutsrq

z zyxw zyxwvutsrqp zyxwvutsrq

detection can be achieved down to a single molecule For applications such as DNA fragment length analysis and DNA sequencing, in order to better resolve DNA fragments, microcapillaries have been filled with relatively viscous sieving matrix such as HEC, LPA, poly(ethy1eneoxide) (PEO) and poly(dimethylacry1amide) (PDMA). The presence of a sieving No Electupromti Flow

4-

+

WKtrophonhc Fbw

zyxwvu ~

-

No Cmsnt: Ims am mmhnIydk4nbukd

zyx I

1

T m 0muule

Turd = t m u k Wlanthemaacuuent Negattnalychqsdunso~s p c i e s m b d t h s am& Pbahnlychrgsd YINor spcles m b d the camcds WKtmm~Flow

+An&

*

-

Tm 0mvls #dwve i 3, Sllanols (SWgmuprm caplluymll M lonred No C m n t P b n h l y c h q e d YINor s cles rn altmckd b ngahwl chnigc S d d r (SO)on suface &k?slfimdsllua caplla~yto&na &ubL layr

Fgm2 L p b n o f c h l g e d nnhcubsnaelctraphomsu; a d sbclrmsmoss

matrix suppresses EOF by decreasing the zeta potential of silica and this reduces the probability of the viscous polymer being ejected out of the capillary by EOF. For silicone, fused silica or glass "Lab-on-a-Chi " a popular approach uses a modification of the Hjerten procedur$ 'to covalently crosslink the capillaries with the sieving matrix LPA to reduce the effect of EOF. 36,23,21 Separation of cell and bacteria in microcapillary is powered by another mechanism, the dielectrophoretic field-flow-fractionation (DEPFFF). Dielectrophoretic field-flow fractionation has been used to separate cells based on their dielectric properties and sedimentation rates. Interdigitated electrodes are used to apply an alternating (AC) electrical field and the cells become levitated to different equilibrium height under the opposing influence of dielectrophoretic and sedimentation forces. When

63

zy

zyx zyxwvu zyxwv zyxwvuts z zyx zy

liquid that carries cells is moved through the interdigitated electrodes, the cells would levitate and travel at different velocities through the channel based on their degree of levitation, and separate. As an example, DEP-FFF have been used to enrich T-lymphocytes from a mixture of T-lymphocytes and MDA435, a human breast cancer cell line.” Separation of E. Cali from whole blood using dielectrophoresis on a microelectrode array chip which do not contain microchannels for directing the flow of liquid is also possible (refer to section 2. I 3.41.~’ Below are some examples of “Lab-on-a-Chip” systems used for the analysis of DNA. 2.1.3.1 Micro PCR for the amplification and detection of DNA

(i)

Continuous-Flow PCR on a Three zones, made of thermostated copper blocks are kept at 9SoC,77OC and 6OOC. A standard fused silica capillary, 40 pM deep and 90 pM wide, is fabricated, looping around the three zones. Sample and PCR reagents are introduced via three inlets and precision syringe pump forces the liquid through the three zones in a controlled loop, effectively thermal cycling and amplifying the samples 20 rounds in 4 minutes. The amplicon is then analysed and detected on agarose slab gel electrophoresis. This approach has been used to amplify and detect a I76 base pair DNA fragment from the DNA gyrase gene of Neisseria gonorrhoeae.

(ii)

PCR and real-time quantitation of p-actin amplicons from human genomic DNA using Taqman chemistry has been done on silicon chips with a layer of thermal oxide.26 Bacterial DNA have been amplified by PCR on surface treated silicon chips and the C. jejuni amplicons analysed by agarose slab gel electrophoresi~.~~*~~

(iii)

Infrared-Mediated Thermc~cycling,~~ is a non-contact method for the rapid thermocycling of PCR mixtures in chip-like glass chambers using a tungsten lamp as an inexpensive infrared radiation source for heating and solenoid gated compressed air as coolant. Amplicons of T-cell receptor P-chain from IR-mediated PCR are analysed by both conventional CE and agarose slab gel electrophoresis.

64

zyxwvuts zyxwvuz

zyxwv zyx zyxw zyx

2.1.3.2 Micro CE for the analysis of DNA fragment length and DNA sequence

(i)

The separation and detection of multiplexed PCR samples containing the four loci CSFIPO, TPOX THOI and vWA of STR, are done in less than 2 minutes on a micro CE filled with an LPA matrix operated under denaturing conditions at 50"C.23 Laser induced fluorescence is used for detection of the fragments. Separation and detection on micro CE constitutes a 10 to 100 fold improvement in speed relative to normal capillary or slab gel system. Separation and detection of Herpes Simplex Virus PCR amplicons from clinical samples have also been achieved with micro CE in less than 110 seconds per sample per run.39

(ii)

The use of ultrafast denaturing electrophoresis in short capillaries filled with the sieving matrix, agarose (BRE, No. 1503; FMC Bioproduct, ME, USA) and urea has been reported to separate and detect STR polymorphism in the endothelin 1 gene. Using this approach, the resolution of two fragments with a difference of 2 nucleotides is achieved in a capillary in 42 seconds at a temperature of 60°C implying that dinucleotide repeat polymorphism can be resolved on microcapillary. Compared to conventional slab gel electrophoresis, denaturing micro CE and laser-induced fluorescence detection resulted in a reduction of analysis time by a factor of 200.40

(iii)

DNA sequencing of single stranded M13mp18 plasmid on a chip has been successfully attempted by Liu and colleagues.2' Single-base resolution of DNA fragments extending over 500 bases was achieved with denaturing electrophoresis using microcapillaries filled with the sieving matrix LPA and urea, with temperatures ranging from 35°C to 40"C, and a run time of under 20 minutes. Four-colour fluorescence is detected using a laser confocal fluorescence detection system. In contrast to the rapidity of the micro CE separation and detection, conventional slab gel electrophoresis requires an overnight run time.

(iv)

A 96 wells microplate with integrated micro CAE separation channels has been fabricated on a microchip by Simpson and colleagues.20The micro CAE chip is used to analyse the C282Y polymorphism which introduces a RsuI restriction site in the HFE

zy zy 65

zyxw zyxwvut zyxwv zy zyx zyxwvu gene, a gene correlated with hereditary hemochromatosis (HCC).4’942 DNA isolated from peripheral blood and a segment of the HFE exon containing the variant is amplified by conventional PCR. Separation and detection of 96 samples is achieved in less than 8 minutes and thi high throughput analysis is 50 to 100 times greater than co ventional slab gels.

2.1.3.3 Micro PCR and micro CE on a chip for the ampiification, defection and analysis of DNA fragments

(i)

(ii)

Deletions causing Duchennemecker muscular dystrophy, are detected using a silicon-glass chip for locus-specific, multiplex micro PCR of the dystrophin gene exons. The amplified DNA is manually transferred and analysed by micro CE on another

Waters LC and colleagues have constructed some integrated micro PCR and micro CE Micro PCR is performed on h bacteriophages DNA, whole E. coli or E. coli’s DNA on a glass chip and the DNA was stained with the dye, TO-PRO (Molecular Probes, Inc., www.probes.com, Eugene, OR, USA). The PCR product, while still on the chip, is transferred electrophoretically into the injection valve using the pinched sample injection technique?’ The samples are resolved on micro CE with either HEC or PDMA sieving matrices in less than 3 minutes.

2. I . 3.4 EIectric field directed hybridization

Nanogen pioneered the use of electric field to concentrate and hybridise DNA to its complementary probe pre-immobilised at specific locations or addresses on a microelectrode a r r a ~ . ~The ~ . ~ microelectrode ’ array is coated with a permeation layer, a layer of agarose with covalently attached streptavidin. The permeation layer acts as a physical barrier which separate DNA molecules in solution from the harmful reaction that often occur at the electrode’s surface while allowing small ions to pass through to maintain conductance. A DNA molecule which has a net negative charge due to its phosphate backbone at neutral pH, is attracted and directed to a specific electrode by charging that electrode positive. Biotinylated single stranded DNA oligonucleotide probes are loaded sequentially and directed to specific locations or addresses of the microelectrode array where they are immobilised by binding to streptavidin. Fluorescence-labelled DNA samples

66

zyxwvutsr

z zyx zy zyxwvu zy

are then introduced, targeted and concentrated at specific addresses of the microelectrode array pre-immobilised with the appropriate probes for hybridisation. Single mismatch mutation is differentiated from wild type DNA samples after hybridisation by reversing the polarity of the electrode from positive to negative and applying pulse electric currents. The interaction of mismatch DNA with the probe is considerably weaker compared to wild type DNA samples, and hence the mismatch DNA is easily repel by the current. Compared to passive hybridisation, electronic hybridisation shows greater sensitivity, speed and specificity. Strand displacement amplification (SDA)48 is an isothermal DNA amplification technology that is compatible with the microelectrode array chip format.49 Decaplex anchored SDA has been used to amplify and detect human Factor V, HFE (hemochromatosis), TNF-a, Cypl9 (aromatase), Fas ligand and bacterial parC, Pseudomonas 's, Salmonella s, and E. colis gyrA, and Chlamydia trachomatis, from a mixtures of DNA templates. Similarly, RT-SDA has been used to amplify and detect Factor V, Fas ligand, TNF-a, and interleukin 1-p from in-vitro synthesised RNA templates.

zyxw

2.1.3.5 Ink jet and bubble jet printing ofmicroarray

The humble ink-jet or bubble-jet printer's printheads are MEMs, which use either rapid and extreme heating and cooling, or the vibration of a piezoelectric membrane to generate and eject ink droplets onto print media. They have been transformed into microarraying devices because the printheads could eject precise spots down to picolitres volume onto specific locations on a membrane or a glass slide. Oligonucleotides have been spotted using this printing approach as described by some authors.5035'In-situ synthesis of oligonucleotide microarray on chemically treated membrane using conventional phosphoramidite chemistry, which has a higher coupling yield compared to light directed chemistry, is currently being developed by Protogene and Rosetta inpharmatics (www.rii.com, Kirkland, WA, USA). This approach uses the printer to deliver small volume of either A, C, G or T phosphoramidites and other chemicals used by DNA synthesisers to make oligonucleotides onto precise locations or spots on a membrane or glass slide, where chemical coupling will take place to generate the microarray.

3 SOME COMMERCIAL “LAB-ON-A-CHIP” SYSTEM BEING DEVELOPED OR SOLD 3.1 Cepheid’s GeneXpert (Prototype)

zy

zyxw zy 67

Cepheid’s “Lab-on-a-Chip” cartridge is an automated and truly integrated system which uses microfluidics to do sample preparation on 5 ml of urine in less than 5 minutes, and includes filtration, cell lysis, DNA extraction, and addition of pre-loaded assay specific PCR reagents. The extracted DNA and PCR reaction mixture is delivered automatically to a closed, integrated reaction tube, where it undergoes rapid thermal cycling, PCR amplification and real-time optical detection using the Taqman chemistry in a Cepheid ICORE@ desktop module. This current system is designed for the detection of Chlamydia in urine and a prototype is available from Cepheid.

3.2 Agilent 2100 Bioanalyzem (Benchtop Module) and Calipher Labchip0 Kit

Agilent and Calipher technologies (w.calipertech.com, Mountain View, CA, USA) have jointly developed various Labchip@ systems based on micro CE, for the analysis of DNA and RNA fragments. Agilent builds the benchtop modules and Calipher makes the chips, which will be available on the market soon. 3.3 Aclara Biosciences and Cellomics

Aclara Biosciences (www.aclara.com, Mountain View, CA, USA) and Cellomics (www.cellomics.com, Pittsbur h PA, USA) are jointly developing the CellChipTMsystem. CellChi:‘ uses microfluidics to enable massive numbers of parallel live-cell assays to be performed on a chip, for a broad range of applications including the discovery of new drugs and stratification of patients for effective therapies and basic research. Aclara is also developing disposable plastic chips for microCE DNA fragment length analysis. 3.4 Micronics

Micronics (www.micronics.net, Redmond, WA, USA) is a medical diagnostic company employing microfluidics to develop a Micro Flow

68

zyxwvutsr

zyxwv

Cytometer system and a micro separation and extraction device, the HFilterTM,for separating and isolating cells from mixed cells population such as blood. Beside cell isolation systems, the T-SensorTMis being developed for clinical chemistry to identify metabolites, drugs, etc. in complex mixtures such as blood. 3.5 Nanogen

See section 2.1.3.4. 3.6 Protogene and Rosetta lnpharmatics

See section 2.1.3.5

4 SummarylConclusions BioMEMs/’ Lab-on-a-Chip” devices potentially could have many applications for the analysis of different type of biomolecules and cell types, using different combinations of sample preparation and sample analysis modules. Currently, most systems are designed to analyse DNA or RNA via PCR or RT-PCR coupled with CE, or hybridisation to oligonucleotide probes laden electrodes. Sample preparation usually involves the separation of cells using fabricated microfilters and DEP-FFF in capillaries or electrodes. This is followed by whole cell PCR or DNA extraction from cells. Although BioMEMsP’Lab-on-a-Chip” can potentially be used for gene expression studies via quantitative RT-PCR, the future of these chips lies in genotyping applications. Major efforts are currently underway to find all human SNPs for use as genetic markers. Armed with this information on SNPs, BioMEMd’Lab-on-a-Chip” devices can be fabricated for use by medical practitioners to diagnose multiple patients in a point-of-care setting for disease susceptibility, Alternatively, a patient may make a self diagnosis as Lab-on-Chips are automated devices. Indeed, major electronic companies such as Motorola and Hewlett Packard have invested substantially in BioMEMsP’Lab-on-a-Chip” research and development, hoping to reap the 2-

- r -.._ L

z

zyxw zyxw

_.-..A

zy zyxwvutsrqponm zyxwvut zyxw 69

References

1 . Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, MacDonald ME, Stuhlmann H, Koup RA and Landau NR, Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV1 infection, Cell 1996; 86(3): 367-377. 2. Dean M, Carrington M, Winkler C, Huttley GA, Smith MW, Allikmets R, Goedert JJ, Buchbinder SP, et. al., Genetic restriction of HIV-I infection and progression to AIDS by a deletion allele of the CKR5 structural gene, Science 1996; 273: 1856-1862. 3. Faure S, Meyer L, Costagliola D, Vaneensberghe C, Genin E, Autran B, et. al., Rapid progression to AIDS in HIV+ individuals with a structural variant of the chemokine receptor CX3CR1, Science 2000; 287: 2274 - 2277. 4. Wolf CR and Smith G, Pharmacogenetics, Br Med Bull 1999; 55(2): 366-386. 5. Schena M (Ed.), Microarray Biochip Technology, Eaton Publishing Company, Natick, MA, USA, 2000. 6. The Chipping Forest, Nature Genetics 1999; 21(Suppl): 3-60. 7. Santini JT, Cima MJ and Langer R, A controlled-release microchip, Nature 1999; 397: 335-338. 8. Chiem N and Harrison DJ, Microchip-based capillary electrophoresis for immunoassays: analysis of monoclonal antibodies and theophylline, Analytical Chemistry 1997; 69(3): 373-378. 9. Colyer CL, Tang T, Chiem N and Harrison DJ, Clinical potential of microchip capillary electrophoresis systems, Electrophoresis 1997; 18: 1733- 174 1 . 10. Wang XB, Yang J, Huang Y, Vykoukal J, Becker FF and Gascoyne PRC, Cell separation by dielectrophoretic field-flow-fractionation, Analytical Chemistry 2000;72(4): 832-839. 1 1 . Kane RS, Takayama S, Ostuni E, Ingber DE and Whitesides GM, Patterning proteins and cells using soft lithography, Biomaterials 1999; 20: 2363-2376. 12. Delamarche E, Bernard A, Schmid H, Michel B and Biebuyck H, Patterned delivery of immunoglobulins to surfaces using microfluidic networks, Science 1997; 276: 779-78 1 . 13. Hofmann 0, Chi D, Cruickshank KA and Muller UR, Adaptation of capillary isoelectric focusing to microchannels on a glass chip, Analytical Chemistry 1999; 71(3): 678-686. 14. Yao S, Anex DS, Caldwell WB, Arnold DW, Smith KB and Schultz PG, SDS capillary gel electrophoresis of proteins in microfabricated channels, PNAS 1999; 96: 5372-5377.

z

70

zyxwvutsr zyxwvu

z zyxwvu

15. Dewitt S, Synthesis on a Chip in Strategic Use of Combinatorial Chemistry, IBC, Frankfurt, June 1998. 16. Kopp MU, Crabtree HJ and Manz A, Developments in technology and applications of microsystems, Current Opinion in Chemical Biology 1997; 1: 4 10-4 19. 17. Sanders GHW and Manz A, Chip-based microsystems for genomic and proteomic analysis, Trends in Analytical Chemistry 2000; 19(6): 364-378. 18. McCreedy T, Fabrication techniques and materials commonly used for the production of microreactors and micro total analytical systems, Trends in Analytical Chemistry 2000; 19(6): 396-40 1. 19. Khandurina J, Jacobson SC, Waters LC, Foote RS, and Ramsey JM, Microfabricated porous membrane structure for sample concentration and electrophoretic analysis, Analytical Chemistry 1999; 71(9): 1815-1819. 20. Simpson PC, Roach D, Wooley AT, Thorsen T, Johnston R, Sensabaugh GF, and Mathies RA, High-throughput genetic analysis using microfabricated 96-sample capillary array electrophoresis microplates, PNAS 1998; 95: 2256-226 1. 21. Liu S, Shi Y, Ja WW, and Mathies RA, Optimization of high-speed DNA sequencing on microfabricated capillary electrophoresis channels, Analytical Chemistry 1999; 71(3): 566-573. 22. Woolley AT, Hadley D, Landre P, DeMello AJ, Mathies RA and Northrup MA, Functional integration of PCR amplification and capillary electrophoresis in a microfabricated DNA analysis device, Analytical Chemistry 1996; 68: 408 140 86. 23. Schmalzing D, Koutny L, Adourian A, Belgrader P, Matsudaira P, Ehrlich D, DNA typing in thirty seconds with a microfabricated device, PNAS 1997; 94: 10273-10278. 24. Shoffner MA, Cheng J, Hvichia GE, Kricka LJ and Wilding P, Chip PCR. I. Surface passivation of microfabricated silicon-glass chips for PCR, Nucleic Acids Research 1996; 24(2): 375-379. 25. Cheng J, Shoffner MA, Hvichia GE, Kricka LJ and Wilding P, Chip PCR. 11. Investigation of different PCR amplification systems in microbabricated siliconglass chips, Nucleic Acids Research 1996; 24(2): 380-385. 26. Taylor TB, Winn-Deen ES, Picozza E, Woudenberg TM and Albin M, Optimization of the performance of the polymerase chain reaction in siliconbased microstructures, Nucleic Acids Research 1997; 25(15): 3 164-3168. 27. Beker H and Gartner C, Polymer microfabrication methods for microfluidic analytical applications, Electrophoresis 2000; 21(1): 12-26.

zy zy

zyxwvu zyxwvu 71

28. McDonald JC, Duffy DC, Anderson JR, Chiu DT, Wu H, Schueller OJA and Whitesides GM, Fabrication of microfluidic systems in poly(dimethylsiloxane), Electrophoresis 2000; 21(1): 27-40. 29. Wilding P, Kricka LJ, Cheng J, Hvichia G, Schoffner MA and Fortina P, Integrated cell isolation and polymerase chain reaction analysis using silicon microfilter chambers, Analytical Biochemistry 1998; 257: 95-1 00. 30. Belgrader P, Okuzumi, M, Pourahmadi, F, Borkholder D, and Northrup MA, A microfluidic cartridge to prepare spores for PCR analysis, Biosensors and Bioelectronics 2000; 1 4 849-852. 31. Cheng J, Sheldon EL, Wu L, Uribe A, Gerrue LO, Carrino J, Heller MJ, and O’Connell JP, Preparation and hybridization analysis of DNA/RNA from E. coli on microfabricated bioelectronic chips, Nature Biotechnology 1998; 16: 541-546. 32. Fu AY, Spence C, Scherer A, Arnold FH, and Quake SR, A microfabricated fluorescence-activated cell sorter, Nature Biotechnology 1999; 17: 1109-111 1. 33. Shoji S, in H. Becker and A. Manz (eds.), Microsystem Technologv in Chemishy and Life Science, 1998: 164 34. Chou HP, Spence C, Scherer A and Quake S, A microfabricated device for sizing and sorting DNA molecules, PNAS 1999; 96: 1 1 13. 35. Hjerten S , J . Chrornatogr 1985; 347: 191-198. 36. Cheng J, Waters LC, Fortina P, Hvichia G, Jacobson SC, Ramsey JM, Kricka LJ and Wilding P, Degenerate oligonucleotide primed-polymerase chain reaction and capillary electrophoretic analysis of human DNA on microchip-based devices, Analytical Biochemistry 1998; 257: 101-1 06. 37. Kopp MU, De Mello AJ, Manz A, Chemical amplification: continuous-flow PCR on a chip, Science 1998; 280: 1046-1048. 38. Oda RP, Strausbauch MA, Huhmer AFR, Borson N, Jurrens SR, Craighead J, Wettstein PJ, Eckloff B, Kline B and Landers JP, Infrared-mediated thermocycling for ultrafast polymerase chain reaction amplification of DNA, Analytical Chemistry 1998; 70: 436 1-4368. 39. Hofgartner WT, Huhmer AFR, Landers JP and Kant JA, Rapid diagnosis of herpes simplex encephalitis using microchip electrophoresis of PCR products, Clinical Chemise 1999; 45(12): 2120-2128. 40. Klephrnik K, Mali 2, Pribyla L, Blazkovh M, Vasku A and Bocek P, Ultrafast detection of microsatellite repeat polymorphism in endothelin 1 gene by electrophoresis in short capillaries, Electrophoresis 2000; 21(1): 23 8-246. 4 I . Calandro L, Thorsen T, Barcellos L, Griggs J, Baer D and Sensabaugh GF, Blood Cells Mol. Dis. 1996; 22: 194a- 194b. 42. Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, Doming0 R Jr, Ellis MC, Fullan A, et. al., A novel MHC class I-

zyxw -

zyxwvu zyxw

72

zyxwvutsrq zyx z

like gene is mutated in patients with hereditary haemochromatosis, Nature Genet. 1996; 13(4): 399-408. 43. Waters LC, Jacobson SC, Kroutchinina N, Khandurina J, Foote RS, and Ramsey JM, Multiple sample PCR amplification and electrophoretic analysis on a microchip, Analytical Chemistry 1998; 70(24): 5 172-5 176. 44. Waters LC, Jacobson SC, Kroutchinina N, Khandurina J, Foote RS, and Ramsey JM, Microchip device for cell lysis, multiplex PCR amplification, and electrophoretic sizing, Analytical Chemistry 1998; 70(1): 158-1 62. 45. Jacobson SC, Hergenroder R, Koutny LB, Warmack RJ and Ramsey JM, Analytical Chemistry 1994; 66: 1 107-1 1 13. 46. Sosnowski RG, Tu E, Butler WF, O’Connell JPO and Heller MJ, Rapid determination of single base mismatch mutations in DNA hybrids by direct electric field control, PNAS 1997; 94: 1 1 19-1 123. 47. Edman CF, Raymond DE, Wu DJ, Tu E, Sosnowski RG, Butler WF, Nerenberg M and Heller MJ, Electric field directed nucleic acid hybridization on microchips, Nucleic Acids Research 1997,25: 4907-49 14. 48. Walker GT, Little MC, Nadeau JG and Shank DD, Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system, PNAS 1992; 89: 392-396. 49. Westin L, Xu X, Miller C, Wang L, Edman CF and Nerenberg M, Anchored multiplex amplification on a microelectronic chip array, Nature BiotechnoZogy 2000; 18: 199-204. 50. Stimpson DI, Cooley PW, Knepper SM and Wallace DB, Parallel production of oligonucleotide arrays using membranes and reagent jet printing, Biotechniques 1998,25: 886-890. 51. Okamoto T, Suzuki T and Yamamoto N, Microarray fabrication with covalent attachment of DNA using bubble jet technology, Nature Biotechnology 2000; 18: 438-44 1.

zyxwvut

zyxwvut zyxwvutsrq zyxwvuts zyxwvu zyxwvut

FRONTIERS IN HUMAN GENETICS Diseases and Technologies 0 2001 by World Scientific Publishing Co. Pte. Ltd.

73

SlLlCO BIOTECH

zyxwv

PANDJASSARAME KANGUEANE**t*5 and MEENA K SAKHARKAR$ Biolnformatics Centre, #02-07,MD7,Medical Drive National University of Singapore, Singapore I i9260 *Department of Microbiology, MD4,Medical Drive National University of Singapore, Singapore I I9260 E-mail: [email protected], #[email protected]

The advancements in molecular biology have made biotechnology a billion-dollar business over the,last two decades. Recent developments in instrumentation, nano-technology and information technology have provided the biomedical research community with enormous amounts of diverse information governing biological systems. Consequently, there is an urgent need for information storage, curation, analysis and retrieval (ISCAR) using bioinformatics tools. Though the very definition of bioinformatics is debatable, there is a general agreement about the importance of certain fundamental concepts. Broadly, bioinformatics is the marriage between modem biology and information technology to glean new knowledge from redundant databases. Bioinformatics helps researchers gather, standardize, combine and manipulate data to tease out the knowledge they contain. In future, it will guide in performing in silico biotechnological experiments to aid biomedical research and application. Hence “SILICO BIOTECH” highlights the simple relationships between different disciplines that govern the complex drug discovery process and its relevance in health care. Keywords: health care, biomedicine, silico-biotech, bioinformatics, biotechnology, information technology

Corresponding author.

74

zyxwvut zyxw

1 INTRODUCTION

Intellectual revolution creates new visions, new ideas and new hopes for a better social living. When new fields emerge from new ideas, old words are usually not adequate to describe these fields. “Silico Biotechnology” and “Bioinformatics” are best described with examples rather than with single words or short phrases. Unlike chemistry and physics, mathematical theories and quantitative methods (except statistics) have played a secondary role in the creation of knowledge in biomedicine. Most of the advancement in biomedicine has been due to improvements in experimental tools. Results are qualitative hence descriptive models are formulated and tested. Comparatively, biologists often have inadequate backgrounds in mathematics but are very strong with respect to laboratory tools and, more importantly, with respect to the interpretation of laboratory data from complex systems. Engineers usually possess a very good background in physical and mathematical sciences. Theories lead to mathematical formulation and comparing the predicted response to experimental data tests the validity of the theory. Biologists are usually better at the formation of testable hypothesis, experimental design and data interpretation from complex systems. Engineers are typically unfamiliar with the experimental techniques used by biologists. Hence, the skills of engineers and biomedical scientists are complementary. To convert the promises of genetic engineering for new processes to make new products requires the integration of these skills. Developments in gen~mics’-~, ~ t e o m i c s ~ , pharrnacogenomic~~.~, nanote~hnology~,~ and bio-informatics’O. will pave the way for an information revolution in biology and medicine, which will result in personalized health care. A bioinformatics professional needs solid understanding of biotechnology, information technology and mathematics. An ideal bioinformatics professional can create a virtual skeleton for in silico biotechnological experimentation based on individual genetic constitution. Thus, “Silico Biotech” would serve as a platform for disease diagnosis, treatment and prevention.

’

zy z z

2 EVOLUTION OF SlLlCO BIOTECH Before the industrial production of penicillin, almost no chemical engineer sought specialized training in the life sciences. With the advent of modern antibiotics, the concept of biochemical engineering was established. The

75

penicillin process also emanated a paradigm for bioprocess development and biochemical engineering. Biochemical engineering means the extension of chemical engineering principles to systems using biological catalyst to bring about desired chemical transformations. The use of recombinant DNA technology (rDNA) to improve a biochemical process lead to the creation of a new discipline called Biotechnology.'2 In otherwords, the use of rDNA technology to improve a "process" (chemical) is called biotechnology. This discipline draws professionals from electrical, mechanical, industrial, environmental, and chemical engineering. The recent success of the international scientific community in decoding the genetic blueprint of the entire human genome13 has lead to a post genomics era, where there is an overarching need for an intellectual fusion 9f biomedicine and information technology. The proposed marriage between biomedicine and information technology in a productive way is cardinal for knowledge discovery from information repositories. Bioinformatics plays a crucial role in data manipulation, data curation and knowledge extraction, thus bridging the gap between disparate information sources for subsequent improvements in biomedicine and health care. The knowledge base generated using bioinformatics tools will serve as input variables for in-silico biotechnological simulation specific for individual's genetic constitution. A schematic representation for silico biotech evolution is illustrated in Fig. 1. In Fig. 1, the integral components of silico biotech and the underlying disciplines fundamental to its development are clearly shown, showing its true inter-disciplinary nature.

zy

zyxwv

76

zyxwvut

zyx --a

z Bldnfamstlm

1

zyxwvut

Fig. I Silico Biotech evolution

The convergence of genomic technology and computational advances are leading to innovative uses of existing data for rational drug designi4. Information is the key because life at the molecular level can be understood as a process in which information is communicated between cellular compartments and adapted by a balanced process of selection. Mapping the connection between gene sequences and macroscopic life is fundamentally a problem of describing and modeling biological information processes. Simulation of molecular processes in cells using structured mathematical models and subsequent prediction of drug effects in humans will advance pharmaceutical research and speed up clinical trials. For an imaginary patient to benefit from the fruits of silico biotech it is imperative to tie rDNA technology with genome computationi5and legal regulations'6.

3 CONCLUSION From genomics to combinatorial chemistry, scientific advances are poised to revolutionize drug discovery and health care. New chemical and biological

77

zy

approaches are changing the way in which therapeutic agents are discovered, developed and administered. The complete mapping of human genes to their function in the context of disease and immunity using genomics, proteomics and pharmacogenomics techniques will ultimately result in the rational identification of individual specific drug targets. For example, SNPs, short for single nucleotide polymorphisms are places along the chromosomes where the genetic code tends to vary from one person to another by just a single base. SNPs in genes or control regions may influence susceptibility to common diseases. SNPs promised to pinpoint the genes involved in common diseases such as hypertension, cancer and diabetes. Also, molecular modeling of the minor histocompatibility antigenI7 HA-1 peptides binding to HLA alleles will be useful as an aid for defining a wider pool of HLA alleles in which HA-1 disparities among donor-recipient pairs can be investigated.'* Systematic quantification of the differences in function as a result of allelic variation within each of a protein family specific to a tissue or organ or system will lead to the development of a methodology for generation of a library of potential drug candidates in silico. The successful sampling of drug targets from a pool of chemical/biological entities using computational tools will result in faster and effective treatment of diseases.

zyxw zyxwvu zy

Acknowledgements We wish to express our sincere appreciation to all members of the research centre for discussions on the subject of this article, especially to A/P Tan Tin Wee, Director, BioInformatics Centre, National University of Singapore, Singapore and Dr Prasanna R. Kolatkar, Chairman, Research Council, BioInformatics Centre, Singapore.

References 1.

2.

Fleischmann RD, Adams MD, White 0, Clayton RA, Kirkness EF, Kerlavage AR, Bult CJ, Tomb JF, Dougherty BAY Merrick JM, Whole-genome random sequencing and assembly of Haemophilus injluenzae Rd., Science 1995; 269: 496-5 12. U.S. Department of Health and Human Services and Department of Energy, Understanding Our Genetic Inheritance. The US Human Genome Project: The First Five Years (April 1990).

zyx

78

3. 4.

5. 6. 7. 8. 9. 10.

11. 12. 13. 14. 15. 16. 17.

18.

zyxwv zyxw z zyxwvz

Collins, FS, Galas D, A New Five-Year Plan for the US Human Genome Project, Science 1993; 262: 43-46. Collins FS, Patrinos A, Jordan E, Chakravarti A, Gesteland R, Walters L, A New Five-Year Plan for the US Human Genome Project: 19982003, Science 1998; 282: 682-689. James P, Protein identification in the post-genome era: the rapid rise of proteomics, Quarterly Reviews in Biophysics 1997; 30: 279-33 1. Marshall A, Genset-Abbott deal heralds pharmacogenomics era, Nature Biotechnology 1g97; 15: 829-830. Housman D, Ledley FD, Why pharmacogenomics? Why now?, Nature Biotechnology 1998; 16: 492-493, Freedman DH, Exploiting the nanotechnology of life, Science 1991; 254: 1308-1310. Bethell D, Schiffrin DJ, Supramolecular chemistry, Nanotechnology and nucleotides, Nature 1996; 382: 58 1. Altman RB, A curriculum for bioinformatics: the time is ripe, Bioinformatics 1998; 14: 549-550. Franklin J, Bioinformatics changing the face of information, Annals of the New York Academy of Sciences 1993; 700: 145-152. Kristapsons MZ, Iakobson IuO, Symposium on biotechnology and bioengineering, Mikrobiologiia 1978; 47: 1 129-1 132. http://www.ornl .gov/TechResources/Human-Genome/home.html Drews J, Drug Discovery: A Historical Perspective, Science 2000; 287: 1960-1964. Sander C, Genomic Medicine and the future of Health care, Science 2000; 287: 1977-1978. Barton JH. Reforming the patent system, Science 2000; 287: 19331934. den Haan JM, Meadows LM, Wang W, Pool J, Blokland E, Bishop TL, Reinhardus C, Shabanowitz J, Offringa R, Hunt DF, Engelhard VH, Goulmy E, The minor histocompatibility antigen HA-1 : a diallelic gene with a single amino acid polymorphism, Science 1998; 279: 1054-1 057. Ren EC, Kangueane P, Kolatkar P, Lin MT, Tseng LH, Hansen JA, Molecular modeling of the minor histocompatibility antigen HA-1 peptides binding to HLA-A alleles, Tissue Antigens 2000; 55: 24-30.

zyxwvutsrq z zyxwvut zyxwvu zyxwv

FRONTIERS IN HUMAN GENETICS Diseases and Technologies 0 2001 by World Scientific Publishing Co. Pte. Ltd.

79

BlOlNFORMATlCS INTEGRATION SIMPLIFIED: THE KLElSLl WAY LIMSOON WONG Kent Ridge Digital Labs 21 Heng Mui Keng Terrace, Singapore 119613 E-mail: limsoon@krdl. orgsg

The power of the bioinformatics integration system called KRIS, better known as Kleisli, is reviewed through a series of examples. Keywords:bioinformatics, data integration, scripting

1 INTRODUCTION The Kleisli system was developed as a general solution to broad-scale data integration problems. Wong and his collaborators used the bioinformatics arena as the first testbed of his system and succeeded in making an impression on the field2,314We provide here an account of the system. Many problems in modern bioinformatics involve (a) accessing complex heterogeneous data sources that are geographically dispersed, (b) multiple sequential steps, and (c) passing information smoothly between these steps. Simple retrieval of data is not sufficient for modern bioinformatics. With the rapid growth of experimental data, in order to investigate a specific biological problem, the challenge is how to automate the process of manipulating and re-structuring of the information derived from various databases. This may require combining data derived from multiple public sources and local (private) sources and feeding the retrieved data into various application programs such as gene finding, protein structural prediction, functional domain or motif identification, phylogenetic tree construction, etc. All these procedures require specific input data sets and data formats. As observed by Baker and Brass, many existing biology data retrieval systems are not fully up to the demand of flexible and painless data integration. This is where the power of Kleisli comes into play. Kleisli is a powerful data integration system, implemented on top 596

80

zyxwvuts

of a robust modern functional programming technology. The system interfaces to a large number of data sources relevant to bioinformatics and uses a self-describing data model to allow data derived from different sources to be flexibly combined. There are more than two hundred Merely providing an biological databases and servers in the Internet. interface to a collection of databases and analysis software is often not useful if it requires tedious programming to make use of the interface, as is the case with CORBA. lo Kleisli goes one step further and provides a high-level query language called Collection Programming Language (CPL), based on elegant mathematical principles. l 1 > l 2 CPL offers a rich data model and many high-level operators to express complex queries and tranformations on these biology databases and analysis software in a straightforward manner that does not require extensive programming skill.

Many bioinformatics queries involving multiple databases and analysis software in multiple steps have a simple expression in CPL and are efficiently executed by Kleisli. In order to properly appreciate the virtue of the system, it is necessary to see some real-life examples. We describe below four queries taken from the many that were posed to us. These examples exercise many aspects of Kleisli and involves integration across Entrez, scop, l3 HMMER, l4 WU-BLAST2, l5 Gapped BLAST, l 6 patents, proteins, DNA sequences, feature tables, etc. We hope the succintness of these examples is sufficient illustration of the power, flexibility, and simplicity of the Kleisli system.

zyxw zyxw

Section 2 is our first example, which asks what proportion of human mature peptides have prolines at their N-terminal. This simple example serves as a quick introduction to the basic syntax of CPL. Section 3 is our second example, which collects samples of TPR domains and uses these samples to contruct a model to recognize other TPR domains in Swissprot sequences. Section 4 is our third example, which asks what other protein sequences in the same superfamily of a given protein sequence have been patented. Section 5 is our last example, which selects from a file of pufferfish DNA fragments those that have no homology to vertebrate protein sequences but have some indirect relationship to some human or mouse ESTs. Section 6 rounds up the presentation by

zy zyxw zyxw zyxwvutsrq zyxwvu 81

briefly discussing the architecture of the Kleisli system.

2

EXAMPLE: PROLINE AT N-TERMINAL

The first of our four examples is this query: What proportion of mature peptides from human have prolines at their N-terminal? Its implementation in Kleisli/CPL is given below.

1. { string-span (x.#sequence, f.#start, f.#end) 2. I \x intron 2 (1,515 bp) D K Q S V H intron 3 (860 bp) Superfect > Fugene. The addition of cholesterol to Dotap and Superfect further improved efficiency by 3.8 fold and 2.6 fold respectively. Both in vitro and in vivo expression was observed 15

392

zyxwvutsr zyxwv zyxwv zy zyxw

minutes after exposure of the Dotap+ cholesteroVDNA complex to cells. Protein production although detectable after I hour, peaked only after 48 hrs. Interestingly exprepion was sustained up to 30 days in vivo and was localised in the bladder. Nuclear and cytoplasmic analysis showed that with the Dotap+cholesterol complex DNA was found in both the nucleus and cytoplasm. TEM analysis in vivo showed no accumulation of agent or lipid. From our data, it appears that Dotap+ cholesterol is the best agent for the transfection of urothelial cells in vitro and in vivo.

zyxwvutsr zyxwvut zyxw

Progestins inhibit the growth of MDA-MB-231 cells transfected with progesterone receptor cDNA Valerie C.L. Lin*, Eng Hen Ng', Swee Eng Aw*, Michelle G.K. Tan*, Esther H.L. Ngt, Vivian S.W. Chon* and Gay Hui Ho* *Department of Clinical Research, and 'Department of General Surgery, Singapore General Hospital Republic of Singapore I69608

Since progesterone exerts its effects mainly via estrogen-dependent progesterone receptor (PgR), the expression of progesterone's effects may be overshadowed by the priming effect of estrogen. PgR expression vectors were transfected into ER-aand PgR-negative breast cancer cells MDA-MB-231 so that the functions of progesterone can be studied independent of estrogens and ER. Eight stable transfectant clones expressing both PgR isoform A and B were studied for their growth response to progesterone and its analogues. While progesterone had no effect on growth in the control transfectant, the hormone markedly inhibited DNA synthesis and cell growth in all PgR-transfectants dose-dependently from 10"'- 1 O'6 M. This growth inhibition was associated with an arrest of cells in the GO/Gl phase of the cell cycle. Progestins medroxyprogesterone acetate, Org2058, R5020 also strongly inhibited DNA synthesis and their doses required for maximal inhibition of 60 - 70% were I O-I7 M, I O-I3 M and I 0-7M, respectively. Antiprogestin ZK98299 alone had no effect, but the compound was capable of counteracting the inhibitory effect of progesterone. In contrast, RU486 inhibited DNA synthesis and it showed no further effects when it was used concurrently with progesterone. These results indicate that progestins are per se antiproliferative via a PgR-mediated mechanism in breast cancer cells. More importantly, we have shown that progestins may exert

z

zy zyxw 393

zy zyxwvutsrqp zyxwvut

effective inhibitory control over the cell growth if the PgR expression is reactivated in ER- and PgR-negative breast cancer cells.

Strategies for EBV vaccine design using computational tools

zyxwv zyxwvuts

P. Kangueane', M.K. Sakharkar', K.S. Lim', Lin Kui', E.C. Rent, V, B r u d and P.R. Kolatkar' *BioInforrnatics Centre, 'Department of Microbiology, tKent Ridge Digital Laboratoty, National University of Singapore. Singapore

The Epstein Barr virus (EBV) is a human y herpes virus associated with a number of clinical manifestations in humans. These include nasopharyngeal carcinoma (NPC), Burkitt's lymphoma (BL), pseudo-lymphomatous lung carcinoma and gastric carcinoma. EBV has also been associated with 30% of Hodgkin's disease and 20% of breast cancer tumors. Worldwide, EBV has infected 50-90% of human population. An effective vaccine is lacking; hence there is an urgent need for EBV vaccine development.

Advances in molecular immunology and biotechnology show that short peptides that are targets of immune recognition are potent vaccine candidates. The mapping of different regions of the viral antigen to a specific immune response is crucial for the design of synthetic peptide vaccines. The high polymorphism of HLA among the human population and the allelic variation between individuals has made the identification of peptidic targets a complex task. To date, nearly 500 HLA class-I and more than 400 HLA class-I1 allelic variants have been assigned. Several synthetic peptides corresponding to a number of different epitopes have to be incorporated in such a vaccine. Computational methods provide means to determine specific vaccine components efficiently. The relevant techniques for determining EBV vaccine components include protein sequence alignment, matrix models, artificial neural networks, homology modeling and protein threading. We have used Kleisli Related Integration System (KRIS) for data integration and sequence information retrieval. This poster highlights the strategies defined for EBV vaccine design using computational tools.

394

zyxw zyxwvutsrq zyxwvut zyxwvuts zyxw zyxw

Rare mutations in low density lipoprotein receptor gene detected by denaturing gradient gel electrophoresis and direct two Malay women with familial sequencing in hypercholesterolaemia Seng Tzer Jing and Evelyn Koay

Department uf Pathology, Nationul University of Singapore

Familial hypercholesterolaemia (FH) is an autosomal dominant inherited disorder caused by mutations in the low density lipoprotein receptor (LDLR) gene that lead to elevated plasma levels of LDL cholesterol, accelerated atherosclerosis and premature coronary artery disease. Molecular methods have an advantage over serum lipid profiling in providing an accurate diagnosis of FH by defining the mutation involved and allowing early detection of asymptomatic carriers of the mutation within the same family. Eight patients were recruited for this study on the basis of high plasma LDL cholesterol levels. Initial mutation screening was performed by denaturing gradient gel electrophoresis (DGGE). Each of the 18 exons and the promoter region was amplified by polymerase chain reaction (PCR) using optimised pairs of primers with a GC-clamp in either the 5 ’ or 3’ end. An aberrant DGGE pattern in the exon 9 region was detected in two female Malay patients. Cycle sequencing of exon 9 was performed using the Dye Terminator Ready Reaction Mix (Perkin Elmer). A GyC sequence variation in codon 1284 of the LDLR gene was found, resulting in a Asny Lys change in the LDLR protein sequence. This mutation has been recently reported in South Africans [ I , 21, but it has not been previously found in Asians. Our results indicate that DGGE is a reliable screening method for detecting the presence of sequence variation in the LDLR gene, defining the specific region of the gene that requires sequence analysis, thereby facilitating the rapid molecular diagnosis of FH.

zy

z zyxwv zyxwvutsrq zyxwvuts zyxwv zy 395

Genetic analysis of four short tandem repeats loci for three ethnic groups in Singapore

W.F. Tan-Siew*,S. Y. Chuah', Violet P.E. Phang', S. T. Chow' *Department of Scientijc Services, Institute of Science and Forensic Medicine, I I Outram Road, Singapore 169078. tDepartment of Biological Sciences, National University of Singapore, Kent Ridge, Singapore I 17600.

Allele and genotype frequencies for four tetrameric short tandem (STR) loci were determined for three population groups - Chinese, Malays and Indians - in Singapore. The technique uses multiplex polymerase chain reaction (PCR) and electrophoresis of the PCR products in denaturing polyacrylamide gels coupled with fluorescent-based detection. The loci are HUMTHOI, HUMfes, HUMvWA and HUMF13A. Statistical evaluations on these four loci indicated that the samples met the Hardy-Weinberg. In addition, there was no evidence for association of alleles between the four loci. The product of allele fiequencies from the data from the sample populations in this study can be used in forensic analyses to estimate the frequency of the STR DNA genotype.

zyxw zy

Non-parametric linkage analysis of dopamine D2 receptor and essential hypertension in Singaporean Chinese sib-pairs Yap E.P.H.*, Wu H.M.', Zhou X.', Taylor E.A.' and Oh V.M.S.' 'Defence Medical Research Institute, Singapore: 'Dept of Medicine, National University of Singapore, Singapore

Abnormalities in the dopaminergic system have been demonstrated in rat models of hypertension and are implicated in the pathogenesis of hypertension in humans. Dopamine has a diverse range central and peripheral effects (including the

396

zyxwvuts

regulation of renal natriuresis and vasomotor tone, and the control of catecholamine, vasopressin and renin-angiotensin-aldosteronesecretion). These are mediated by two classes of receptors (Dl/D5 and D2/D3/D4). We investigated the role of the dopamine D2 receptor (DRD2) in this genetic linkage study of essential (idiopathic) hypertension. Forty-nine sib-pairs concordant for hypertension and of Chinese descent were recruited as part of the NUSIGHT study, with a hrther 190 ethnic-matched samples serving as population controls. Two polymorphism$ in the coding region (Ser3 1 I , Ncol) and a 3’ marker (TaqIA) were genotyped by PCRRFLP. Non-parametric single-point linkage analysis of each of these markers was carried out. There was an increased sharing of alleles identical by state at the TaqIA locus (p=0.0025). This interesting finding suggests that DRD2 could be involved in hypertension in this population. Further studies using more polymorphic markers and larger samples sizes are warranted.