Flatfish Metamorphosis 9811978581, 9789811978586

Citation preview

Baolong Bao

Flatfish Metamorphosis

Flatfish Metamorphosis

Baolong Bao

Flatfish Metamorphosis

Baolong Bao College of Aquaculture & Life Science Shanghai Ocean University Lingang New City, Shanghai, China

ISBN 978-981-19-7858-6 ISBN 978-981-19-7859-3 https://doi.org/10.1007/978-981-19-7859-3

(eBook)

© Springer Nature Singapore Pte Ltd. 2022 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore

Foreword

Developmental biology is the study of growth, development, regeneration, sexual and asexual reproduction, metamorphosis, and the growth and differentiation of stem cells in the adult organism. Such studies used to be carried out by using morphological, anatomical, and microscopic approaches, and the scope of understanding was mostly limited to answering what happens with each of these processes. The advances in molecular biology, especially the emergence and advances of genomic sciences in the last 30 years have revolutionized the levels of understanding: From understanding what happened, to understanding why things happened the way they did and how things happen, allowing the understanding of the sequence of events and the mechanisms of events. It is these advances that made it possible to publish the book Flatfish Metamorphosis by Dr. Baolong Bao published by Springer Nature Press. Flatfish are members of the order Pleuronectiformes. Many flatfish species are important fish food such as flounders, soles, turbot, plaice, and halibut. Not only they are important as nutritious seafood, so are they for the study of developmental biology. In many flatfish species, both eyes lie on one side of the head, one or the other migrating through or around the head during development. Associated with the eye migration are cranial deformation, cranial asymmetry, changes in body swimposture, lateralized behavior, dorsal fin development, elongation and regression of dorsal fin, left/right asymmetrical pigmentation, body depth changes, among other developmental changes. These developmental changes and processes offer excellent research models for the understanding of development, growth, and metamorphosis. Dr. Bao’s laboratory produced a large body of knowledge and data, from photographs and drawings to morphological and performance data, from molecular markers and sequence information to genome expression and gene pathways, and from genomic basis to sequence of events leading to such fascinating metamorphosis processes. This book is truly one of its kind of a monograph, providing in-depth analysis of metamorphosis and developmental processes at the organ, tissue, cell, and molecular levels. The book has 10 chapters, with each devoted to providing detailed coverage v

vi

Foreword

of molecular and system biology information to explain the involved biological processes and events. It is a best source book and reference book for any fish biologists, graduate students, professors, fish and aquaculture managers, and college students in general who are interested in developmental biology. Many of these processes are of evolutionary relevance because the analogies among various developmental events during evolution. Early in his career, Dr. Bao served as a postdoctoral visiting scholar in my laboratory. He never stops asking why for all phenomena of his observations and worked persistently to provide answers. Over the years, he became a famous professor at Shanghai Ocean University where his research group has made major strides toward understanding the molecular basis for metamorphosis in flatfish. This book, Flatfish Metamorphosis, is a demonstration of his outstanding work, and accumulation of the knowledge produced by his research team and others across the world. I commend this achievement and recommend highly of this book to all college students, researchers, and scholars, especially those who work in the areas of biology, fisheries, and aquaculture. Biology, Syracuse University, Syracuse, NY, USA

Zhanjiang (John) Liu

Preface

A long time ago, a flatfish with a special appearance attracted the special attention of people. The first paintings and carvings of flatfish found in the south of Spain can date back to 15,000 years B.C. (Berghahn and Bennema 2013). Pierre Belon (1553) in his work recorded six flatfish species. A flatfish was also recorded first time in an ancient Chinese book Er Ya written in 220 years B.C., in that book the flatfish were described that they usually go swimming in couples to avoid only seeing one side view, which results from both eyes on one side in one flatfish individual. Therefore, the flatfish has been regarded as one of the famous love symbols in China. I really knew the flatfish in 1995 when I was a master’s student, even I had learned some flatfish species in the Ichthyology course in college. My two advisers, Professor Jinxiang Su and Mingcheng Yin, suggested me to study the larval feeding behavior of marine fish species. Benefiting from the advances in Japanese flounder aquaculture, I choose the larval flounder as the object of my study. With the help of several people such as Professor Jilin Lei, Xuezhou Liu, and Yanwei Jiang, I came to a breeding farm in Qingdao, China. Till then, I had a real chance to observe the whole process of metamorphosis in Japanese flounder. It was amazing when I observed the right eye gradually moved to another side, and body rotation finally settled down on the water bottom. From this fascinating development, I could not help thinking why the eye can move, why the right, not the left eye gets an opportunity to move, and so on. Later, I graduated from Shanghai Ocean University and start my research career at this university. Eye migration in flatfish was still attracting me to understand the mechanism. Thanks for Japanese scientists Yasuo Inui and Satoshi Miwa, they first told us the thyroid hormone induce the metamorphosis of Japanese flounder. Likewise, thanks for B. Brewster from British Museum that his paper published in 1987 gave me a whole history reviews about various explanations for flatfish metamorphosis. To understand the molecular mechanism behind eye migration, I went to Fudan University for Ph.D. to study flatfish metamorphosis in 2001; this gave me a chance to learn molecular biology. It was at that time under the guidance of my advisor Professor Daming Ren, I started to doubt that eye migration is resulted from vii

viii

Preface

pull, instead, it should be from push. Finally, I proposed my hypothesis in my Doctoral dissertation in 2005 that over-dividing cells in the suborbital area push eye migration upwards. Since then, I started to work with my students and collaborate with colleagues in mechanisms of metamorphic events, such as in regulating eye migration, a twist of frontal bone, left-right asymmetric body pigmentation, the change of body shape, dorsal fin elongation, and resorption. These research findings are included in this book. The contribution of this knowledge is from over 20 years hardworking of my students, including but not limited to Guimei Yang, Jubin Xing, Zhonghe Ke, Wenjun Chen, Caixia Xie, Junwei Gai, Jie Chen, Xinye Chen, Xiaoyu Liu, Fen Wei, Mingyan Sun, Hui Li, Juan Xu, Lekang Li, Lei Gao, Jing Wang, Bo Zhang, Jingyuan Che, Kangkang Peng, Jianhua Sun, Jianhong Xia, Yumei Li, Yongguan Liao, and Peiyu Lu. Likewise, this knowledge benefits from the collaboration with Zhanjiang (John) Liu at Syracuse University, Songlin Chen, Changwei Shao, and Yongsheng Tian at Yellow Sea Institute, and Xiaoling Gong, Yufeng Si, and Junling Zhang at Shanghai Ocean University, especially thanks goes to Yufeng Si as she spent a lot of time to help me for revising the manuscript and copyright claim for the figures cited in this book. Moreover, it is great honor that Vice President of Syracuse University Zhanjiang (John) Liu wrote the preface for this book. I would like to show gratitude to several foundations for long-term supporting, such as the National Science Founding of China (30771668, 31072201, 31472262) gave me over a decade supporting. First-Class Discipline of Aquaculture from the Shanghai Government gives me support during this book preparation and publication as well. The seasons change fast and 27 years more have passed in a twinkling, I have become a middle-aged man. I am particularly indebted to my wife Lijun Zhang, who always encourages me to involve myself completely in the research on flatfish metamorphosis. I feel grateful for my parent; they supported me to complete my high education with their unbelievable hard work; let me have a chance to know the fascinating flatfish. This book I inscribe to my wife and my two lovely sons Frank and Jason! Shanghai, China

Baolong Bao

Contents

1

General Introduction of Flatfish Metamorphosis . . . . . . . . . . . . . . . 1.1 Brief Introduction of Metamorphosis in Various Fishes . . . . . . . 1.1.1 How Does Metamorphosis Occur in Fish? . . . . . . . . . . 1.1.2 Brief Introduction of Larval Metamorphosis in Various Fishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2 Introduction of the Metamorphic Events in Various Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2.1 Metamorphosis of Japanese Flounder . . . . . . . . . . . . . . 1.2.2 Metamorphosis of Barfin Flounder . . . . . . . . . . . . . . . 1.2.3 Metamorphosis of Slime Flounder . . . . . . . . . . . . . . . . 1.2.4 Metamorphosis of Summer Flounder . . . . . . . . . . . . . . 1.2.5 Metamorphosis of Southern Flounder . . . . . . . . . . . . . 1.2.6 Metamorphosis of Winter Flounder . . . . . . . . . . . . . . . 1.2.7 Metamorphosis of Turbot . . . . . . . . . . . . . . . . . . . . . . 1.2.8 Metamorphosis of European Plaice . . . . . . . . . . . . . . . 1.2.9 Metamorphosis of Atlantic Halibut . . . . . . . . . . . . . . . 1.2.10 Metamorphosis of Spotted Halibut . . . . . . . . . . . . . . . . 1.2.11 Metamorphosis of Brown Sole . . . . . . . . . . . . . . . . . . 1.2.12 Metamorphosis of Dover Sole . . . . . . . . . . . . . . . . . . . 1.2.13 Metamorphosis of Chinese Tongue Sole . . . . . . . . . . . 1.3 Implications of THs in Metamorphic Flatfishes . . . . . . . . . . . . . 1.3.1 Development of the Thyroid Gland and Changes in THs Level in Flatfishes . . . . . . . . . . . . . . . . . . . . . . 1.3.2 Role of THs in Tissue Development during Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.3 Sensitivity of Metamorphic Events to THs during Larval Development . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.4 Hypothalamo–Pituitary–Thyroid Axis . . . . . . . . . . . . . 1.3.5 Factors That Influence THs Level during Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 1 1 2 6 7 8 8 9 10 10 12 12 13 15 15 16 16 17 18 19 20 21 21 ix

x

Contents

1.3.6

Gene Expression Patterns of Deiodinase Enzymes and THs Receptors during Metamorphosis in Flatfishes . . . 1.4 Genes Involved in Flatfish Metamorphosis . . . . . . . . . . . . . . . 1.5 MicroRNA Expression Profile During Metamorphosis in Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.6 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

3

. .

22 24

. . .

27 30 31

Developmental Relationships among Metamorphic Events . . . . . . . 2.1 Relationship between Cranial Deformation and Eye Migration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1.1 Cranial Bones Deform Gradually During Metamorphosis in Flatfish . . . . . . . . . . . . . . . . . . . . . . 2.1.2 Cranial Asymmetry in Different Eye Variants of Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2 Relationship Between Eye Migration and Body Swim-Posture Changes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.1 Development of Lateralized Behavior During Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.2 Variants with Different Activities in the Artificial Senegalese Sole Population . . . . . . . . . . . . . . . . . . . . . 2.3 Relationship Between Eye Migration and Dorsal Fin Development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3.1 Relationship Between Eye Migration and Anterior Extension of the Dorsal Fin . . . . . . . . . . . . . . . . . . . . . 2.3.2 Relationship Between Eye Migration and Elongation and Regression of the Dorsal Fin . . . . . . . . . . . . . . . . . 2.4 Relationship Between Eye Migration and Left/Right Asymmetrical Pigmentation . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.5 Left/Right Asymmetrical Pigmentation Depends on Body Swim-Posture Change . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.6 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

39

New Tissue Models for Explaining Eye Migration . . . . . . . . . . . . . . 3.1 Diversity of Eye Location in Flatfishes . . . . . . . . . . . . . . . . . . . 3.2 The Hypotheses on the Eye Migration in Flatfishes . . . . . . . . . . 3.2.1 The Eye Migration Thought to Be Associated with Brain . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2.2 The Eye Migration Thought to Be Associated with Dorsal Fin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2.3 The Eye Migration Thought to Be the Result from the Resorption of the Part of the Cranium . . . . . . . . . . 3.2.4 The Eye Migration Thought Be Caused by a Twisting of the Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

39 39 42 46 46 46 49 49 50 50 54 54 54 57 57 59 59 60 60 61

Contents

xi

3.2.5

The Eye Migration Thought to Be Pulled by a Ligament . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2.6 Hypothesis About the Migrating Eye Forcing a Passage Through the Head . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3 Proliferating Cells in Suborbital Area Drive Eye Migration During Metamorphosis in Flatfish . . . . . . . . . . . . . . . . . . . . . . 3.3.1 Normal Metamorphic Stages Defined in Three Flatfish Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.2 Left/Right Asymmetrical Distribution of the Proliferating Cells in Suborbital Region of Left/Right Eye Before Initial Eye Migration . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.3 Eye Migration Retarded by the Inhibitor of Cell Division Microinjected into the Suborbital Area of Blind Side . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.4 Distortion of Frontal Bones Caused by Eye Movement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.5 Our Model Proposed Based on our Finding in Cell Proliferation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4 Investigation on Eye Shapes During Flatfish Metamorphosis and Adult Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.1 Change of Eye Shape During Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.2 The Deformation of Eye Morphology Shape During Metamorphosis Could Be Stopped by Colchicine . . . . . 3.4.3 The Difference of Eye Diameter Between Both Eyes in Different Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.4 The Eyes Ever Been Pushed During Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.5 The Role of Cell Apoptosis for Eye Migration During Metamorphosing Flounder . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.6 The Role of Autophagy During Eye Migration in Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.7 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

Molecular Basis of Eye Migration During Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1 Thyroid Hormone Regulating Eye Migration . . . . . . . . . . . . . . 4.1.1 Thyroid Hormone Might Mediate Eye Migration in Various Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.2 Thyroid Hormone Regulating Eye Migration Direct During Metamorphosis in Japanese Flounder . . . . . . . . 4.2 The Role of Retinoic Acid in Modulating Eye Migration Via Cross-Talk with Thyroid Hormones in Japanese Flounder . . . . .

61 62 63 63

64

65 69 71 72 73 74 75 78 80 81 86 87 91 91 91 92 98

xii

Contents

4.2.1

Does Eye Migration Regulated Only by Thyroid Hormone in Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.2 Coincident Genes Expression Patterns of the Thyroid Hormone and Retinoic Acid Signaling Pathways . . . . . 4.2.3 The Eye Migration Inhibited by Retinoic Acid in Japanese Flounder . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3 Some Genes for Cell Proliferation Might be Involved in Eye Migration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4 Environment Factors Causing Flatfish Incomplete Eye Migration During Metamorphosis . . . . . . . . . . . . . . . . . . . . . . 4.4.1 Nutrition of Live Prey . . . . . . . . . . . . . . . . . . . . . . . . 4.4.2 Vitamin A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.3 The Effect of Photoperiod on Eye Migration . . . . . . . . 4.4.4 Temperature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.5 Environment Pollution . . . . . . . . . . . . . . . . . . . . . . . . 4.5 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

6

Molecular Basis of Frontal Bones Deformation During Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.1 Deformation Process of Frontal Bones During Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2 Study History of the Molecular Basis of Frontal Bone Deformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3 The Relationship Between the Frontal Bone Deformation and Eye Migration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.4 The Roles of Cell Proliferation, Cell Apoptosis, and Cell Autophagy During the Process of Front Bone Deformation in Japanese Flounder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.5 The Molecular Basis of Front Bone Deformation on the Aspect of Cell Apoptosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.5.1 Deformation of Frontal Bones Induced by the Mechanical Force from the Contact of the Up-Migrating Eye on the Blind Side . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.5.2 Classical Apoptosis Pathway Involved in the Distortion of Frontal Bones . . . . . . . . . . . . . . . . . . . . . 5.6 The Role of Thyroid Hormone for Front Bone Deformation . . . . 5.7 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

98 99 100 105 112 112 113 114 115 115 116 116 121 121 122 123

125 127

128 129 132 133 135

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 6.1 Dorsal Fin Development in Fish . . . . . . . . . . . . . . . . . . . . . . . . 137 6.2 The Process of Dorsal Fin Ray Elongation and Regression in some Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140

Contents

The Molecular Basis of Dorsal Fin Elongation in Japanese Flounder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.1 Morphological Changes During Dorsal Fin bud Formation and Skeletogenesis Process in Japanese Flounder Larvae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.2 Cellular Origins of the Dorsal Fin bud . . . . . . . . . . . . . 6.3.3 Position and Formation of Dorsal Fin bud . . . . . . . . . . 6.3.4 Dorsal Fin bud Formation Regulated by Shh . . . . . . . . 6.3.5 Some Genes Expressed in both Dorsal fin bud and fin Fold . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.4 The Role of Thyroid Hormone in Regulating Dorsal Fin Development in Japanese Flounder . . . . . . . . . . . . . . . . . . . . . 6.4.1 The Distribution of Thyroid Hormone and Gene Expression of THs Signal Pathway in the bud During Dorsal Fin Development . . . . . . . . . . . . . . . . . . . . . . . 6.4.2 Role of the Thyroid Hormones in Dorsal Fin bud Formation and Ray Development . . . . . . . . . . . . . . . . 6.4.3 The Role of the Thyroid Hormones in Dorsal Fin Elongation and Regression During Metamorphosis of Japanese Flounder . . . . . . . . . . . . . . . . . . . . . . . . . 6.5 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

xiii

6.3

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.1 The Establishment of Left/Right Asymmetrical Pigmentation in Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.2 Hypotheses on Left/Right Asymmetrical Pigmentation in Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.2.1 Previous Hypotheses . . . . . . . . . . . . . . . . . . . . . . . . . 7.2.2 Our Hypothesis on Left/Right Asymmetrical Pigmentation in Flatfish . . . . . . . . . . . . . . . . . . . . . . . 7.3 The Roles of Phototransduction Pathways and Retinoic Acid Signaling in Establishing Asymmetric Pigmentation . . . . . . . . . 7.3.1 The Roles of Phototransduction Pathways in Establishing Asymmetric Pigmentation in Japanese Flounder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.3.2 The Roles of Retinoic Acid Signaling in Establishing Asymmetric Pigmentation in Japanese Flounder . . . . . . 7.4 Malpigmentation in Flatfish Aquaculture Industry . . . . . . . . . . . 7.4.1 Malpigmentation Pattern in Flatfish . . . . . . . . . . . . . . . 7.4.2 The Progression of Hypermelanosis in Blind Side . . . . 7.4.3 The Progression of Pseudoalbino in Ocular Side . . . . . . 7.5 Nutrition and Environmental Factors Causing Malpigmentation in Ocular Side in Flatfish Aquaculture . . . . . .

141

141 143 144 146 147 148

149 151

154 156 156 161 161 163 163 165 167

167 168 172 179 181 182 183

xiv

Contents

7.5.1 Nutrition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.5.2 Light . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.5.3 Temperature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.6 Environmental Factors Causing Staining-Type Hypermelanosis in Flatfish Aquaculture . . . . . . . . . . . . . . . . . . 7.6.1 Environmental Factors . . . . . . . . . . . . . . . . . . . . . . . . 7.6.2 Hypothesis on Occurrence of Staining-Type Hypermelanosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.7 Genetic Screening for Malpigmentation in Artificial Breeding Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.7.1 Genetic Screening for Malpigmentation in Artificial Breeding Population of Japanese Flounder . . . . . . . . . . 7.7.2 Genetic Screening for Malpigmentation in Artificial Breeding Population of Chinese Tongue Sole . . . . . . . . 7.8 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

9

Molecular Basis of Body Depth Change during Metamorphosis . . . 8.1 Brief Introduction on Body Shape Change during Early Life History in Various Fishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.2 The Body Height Increased Gradually during Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3 The Role of Cell Proliferation for the Change of Body Depth During Flatfish Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . 8.4 The Role of Thyroid Hormone in Regulating Body Depth Change in Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.1 The Body Height Change Regulated by Thyroid Hormone Via Cell Proliferation During Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.2 Strong Expression of Thyroid Hormone Receptors Along Dorsal-Ventral Margins During Metamorphosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.3 Does the Change of Body Shape During Early Development of Non-Flatfish Is Regulated by Thyroid Hormone? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.5 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Genetic Basis for Eye Migration in Flatfish . . . . . . . . . . . . . . . . . . . 9.1 Different Molecular Mechanisms to Determine Which Eye Migrates and the Migration Distance . . . . . . . . . . . . . . . . . . . . 9.2 A New Hypothesis to Explain Eye Asymmetry During Early Life History of Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.3 Is Eye Asymmetry Regulated by the Nodal-Lefty-pitx2 (NLP) Pathway? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

184 186 186 187 188 191 200 201 213 223 223 231 231 234 235 237

239

241

242 243 244 249 249 250 252

Contents

Screening of Reverse Eye Genes by Using Comparative Transcriptomic Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.5 Duplication of Thyroid Hormone Receptor TRβ Gene Found in Flatfishes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.6 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

xv

9.4

10

Evolutionary Origin of Left-Right Eye Asymmetry . . . . . . . . . . . . . 10.1 Evolutionary Debate on the Origin of Asymmetry in Flatfish . . . 10.2 Phylogenetic Pattern of Asymmetry in Flatfish . . . . . . . . . . . . . 10.3 Our Hypothesis for the Evolutionary Origin of Left-Right Eye Asymmetry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.4 Is the Evolution of Eye Migration in Flatfishes Convergent? . . . 10.5 Is it Possible That One Gene Determines Eye Asymmetry? . . . . 10.6 Inheritance of Asymmetry in Flatfish . . . . . . . . . . . . . . . . . . . . 10.7 Genome-Wide Screening for the Locus of Eye Migration in Flatfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.8 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

254 259 264 264 269 269 270 272 277 280 283 289 291 291

Chapter 1

General Introduction of Flatfish Metamorphosis

Abstract First, we provided a brief introduction to metamorphosis in various fishes. Then, we discussed the metamorphosis of 13 flatfish species. The pivotal role of thyroid hormones in regulating metamorphosis in flatfishes was emphasized. Transcriptomic analysis of mRNA and miRNA profiles was used to screen for genes related to metamorphosis in flatfishes, and the expressions of several genes were found to fluctuate during flatfish metamorphosis. Keywords Metamorphosis · Teleost · Flatfish · Thyroid hormone · Gene expression

1.1 1.1.1

Brief Introduction of Metamorphosis in Various Fishes How Does Metamorphosis Occur in Fish?

Metamorphosis is defined as “changing form,” which is the overwhelming alterations of the outer and inter shape along with a drastic shift in habitat or behavior during the life history of an animal, and these body changes are generally rapid sometime after birth. Well-known examples of metamorphosis occur in most insects and amphibians. Some remarkable examples of metamorphosis can also be commonly found in fish: flatfish undergo metamorphosis, in which the originally symmetric eyes and nostrils become asymmetric, migrating from one side to the other. Currently, there are conflicting definitions of fish metamorphosis. Some scientists believe that metamorphosis is the most obvious transition of phenotypes and the most profound shifts of ecotypes between different life stages with the characteristic of rapid transformation (Youson 1988). In contrast, it has also been suggested that teleost metamorphosis is a conserved stage of postembryonic remodeling that is controlled specifically by thyroid hormones (THs) (Power et al. 2008). McMenamin and Parichy (2013) have defined metamorphosis is an irreversible morphological and ecological transformation during postembryonic development, but it is independent of sexual maturation, sex-specific modifications, or senescence and induced by systematically acting endocrine mediators. Youson (1988) thought that two types of metamorphosis occur in fishes: one is the first or “true” metamorphosis, commonly observed in agnathans (lampreys), © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_1

1

2

1

General Introduction of Flatfish Metamorphosis

elopomorphs (eels), and pleuronectiforms (flatfishes), which is a typical indirect development that involves larval metamorphosis; the other is the secondary metamorphosis, which is a nonclassical metamorphosis that occurs during the juvenile period of some diadromous teleosts. In contrast to larval metamorphosis, this process undergoes less dramatic morphological transformations, such as smoltification in salmon and silvering in eels. Larval or first metamorphosis exhibits dramatic morphological transitions that facilitate ecological transitions: from a dispersive planktonic or pelagic larval phase to metamorphosis in an adult habitat. This ecological habitat change makes pre-metamorphic larvae typically consume resources that are completely different from those consumed by their adult forms. Pelagic larvae possess morphological specializations such as large larval fin folds and long spines that maximize survival and dispersal potential, which helps long-distance dispersal of the larvae. After metamorphosis, demersal fishes often exhibit drastic alterations in overall morphology, including head shape, body depth, and skin pigmentation. Meanwhile, larval characteristics are lost (De Jesus et al. 1998; Fukuhara and Fushimi 1988).

1.1.2

Brief Introduction of Larval Metamorphosis in Various Fishes

1.1.2.1

Metamorphosis of Lampreys

Lampreys are one of two surviving lineages of jawless fishes of the group Agnatha, residing at an important evolutionary juncture. Several dramatic external morphological changes can be observed in lamprey metamorphosis, such as changes in body shape and eye size, reformation of the larval buccal funnel (oral hood) and prebranchial region into adult oral disk and snout, fins growth, body color modification, and alterations in the branchial area, including the shape of branchiopores (Youson and Manzon 2012). On the basis of these sequential developmental feature changes, lamprey metamorphosis can be classified into seven stages (Youson and Manzon 2012). THs play an important role in the development and metamorphosis of lampreys. Increased TH concentrations in larvae may have a juvenilizing effect that prevents metamorphosis. Serum TH concentrations go up during the larval phase, peak before metamorphosis, and decrease fast at the onset of metamorphosis. Goitrogens such as potassium perchlorate (KClO4), propylthiouracil, and thiourea (TU), can inhibit TH levels and initiate precocious metamorphosis in lamprey. However, exogenous TH treatment can block goitrogen-induced metamorphosis and disrupt natural metamorphosis in lamprey (Manzon and Manzon 2017).

1.1

Brief Introduction of Metamorphosis in Various Fishes

1.1.2.2

3

Metamorphosis of Elopomorphs

Elopomorphs, such as tenpounders (Elops), tarpons (Megalops), bonefishes (Albula), spine eels (Notacanthus), apodes, and gulper eels, have a leptocephalus stage from larvae to juveniles. Larval elopomorphs have laterally compressed, transparent leaf-like body, and a relatively small head. Therefore, the larva has a special name: “leptocephalus.” Leptocephalus metamorphosis is accompanied by a decreased body length and depth, and opaque body due to thickening and skin pigmentation. Endocrinological studies on elopomorph metamorphosis are rare and focus mainly on anguilliforms. The metamorphosis of anguilliforms is regulated by THs. The initiation of metamorphosis is closely associated with the development and activation of the thyroid gland (Ozaki et al. 2000; Yamano et al. 2007); metamorphosis is characterized by elevated whole-body levels of thyroid hormones (thyroxine, T4 and triiodothyronine, T3) (Yamano et al. 1991a,b), and exogenous TH treatment can induce or accelerate the metamorphosis of leptocephali (Kitajima et al. 1967).

Metamorphosis of Elopiforms The metamorphosis of ladyfish (Elops saurus) can be divided into early, mid, and late phases (Gehringer 1959). During early metamorphosis, the body shortens while head size remains unchanged. The anal and dorsal fins are characterized by aberrantly small and underdeveloped. In the mid-stage, an evident body change is from a leaf-like to a typical fish-like appearance, and the anal and dorsal fins grow a unique shape and shift forward. In the late stage of metamorphosis, the body length increases significantly. At the end of metamorphosis, increased pigmentation causes the body to become opaque. The metamorphic process of Hawaiian ladyfish (Elops hawaiensis) is essentially similar to that of ladyfish (Sato and Yasuda 1980); an outstanding feature of E. hawaiensis metamorphosis is a comparatively longer latency between the metamorphic shortening and subsequent increase in length. Elopiform metamorphosis is prominently characterized by the quite immature larva at the end of metamorphosis, which is far from demonstrating the juvenile morphology (Tsukamoto and Okiyama 1997). The metamorphosis of tarpon (Megalops cyprinoides) leptocephali may be regulated by THs. Exogenous T4 and T3 treatment could speed up the metamorphosis of leptocephali; in contrast, TU treatment could completely inhibit leptocephalus metamorphosis, which can be reversed by exogenous T3 (Shial and Hwang 2006).

4

1

General Introduction of Flatfish Metamorphosis

Metamorphosis of Albuliforms Unlike the larval morphology of elopiforms, albuliforms exhibit juvenile-like shapes with minimal body length at the end of metamorphosis. The metamorphic period of albuliforms, for example, bonefish (Albula vulpes), can be divided into two phases: Phases IIa and IIb (Pfeiler 1986, 2008). During metamorphosis, albuliforms rapidly change from the leaf-like body appearance in Phase IIa to the juvenile morphology in Phase IIb. The rate of shrinkage of body length and loss of body weight is more quick in Phase IIa (Pfeiler 2008). By the end of metamorphosis, the body length is reduced to about 40% (Pfeiler 1984).

Metamorphosis of Anguilliforms Superorder Elopomorpha has the most various species in the order Anguilliformes. However, information on the metamorphic changes is limited to some true eels and conger eels. During the metamorphosis of conger eels (Conger myriaster), body length dropped to around 60% of the maximum length. During the early stage of metamorphosis, the eel body begins to shorten, with evident elongation of the dorsal and anal fins; during mid-metamorphosis, head size-related traits such as head length/body length ratio, head height/body length ratio increase; and at the end of metamorphosis, the ratio of body height to body length decreases (Takai 1959). After metamorphosis, eels experience dramatic morphological changes, from leaflike and transparent leptocephalus to rod-shaped and opaque juveniles. Meanwhile, the anus moves to a relatively more forward position (Yamano et al. 1991a,b). The leptocephali of the Japanese eel (Anguilla japonica) undergo metamorphosis approximately 250 days after hatching (DAH) when the body length is 50–60 mm (Tanaka et al. 2003). There are many morphological changes in the A. japonica metamorphosis, for example, extremely decreased body depth, further movement forward of the anus, anterior edges, and dorsal and anal fins. The metamorphosis is completed in about 2 weeks. THs play many roles in regulating metamorphosis in anguilliforms. A steep rise in T4 and T3 levels during early and late metamorphoses has been observed in the conger eel, Conger myriaster (Yamano et al. 1991a,b).

1.1.2.3

Metamorphosis of Groupers

The formation of spines and elongation and resorption of the dorsal and pelvic fins are characteristic features of grouper metamorphosis. The elongation and resorption of fins in grouper larvae may play a role in the maintenance of buoyancy and avoidance of predators (Moser 1981). The leopard grouper (Mycteroperca rosacea) begins to develop spines and expand the dorsal and pelvic fins between 4 and 10 DAH. During 15–20 DAH, the second spine of the dorsal fin and the first spine of each pelvic fin become evident. Pigmentation occurs in these spines, especially

1.1

Brief Introduction of Metamorphosis in Various Fishes

5

the last one-third of their lengths, saw-like teeth can also be observed in the spines. During 30–35 DAH, the three large spines get smaller. During 40–55 DAH, the long region of the dorsal and pelvic fins continues to reduce in size. At 60 DAH, larvae complete the developmental process, and exhibit morphological characteristics of this species (Martínez-Lagos and Gracia-López 2009). This resorption of the spines of the dorsal and pelvic fins during metamorphosis has also been observed in Epinephelus tauvina (Hussain and Higuchi 1980) and Epinephelus akaara (Fukuhara and Fushimi 1988). THs can play many roles in regulating metamorphosis in groupers. Treatments with different concentrations of exogenous T4 and T3 led to synchronization and shortening of the duration of metamorphosis in the grouper Epinephelus coioides (De Jesus et al. 1998). The application of 0.01–1.0 ppm of T3 or T4 is effective in increasing larval survival and hastening resorption of the dorsal and anal fins in 2–6 days (Tay et al. 1994). Moreover, 0.01 ppm of T4 is appropriate for accelerating metamorphosis and improving the survival of 3- to 4-week-old grouper larvae (De Jesus et al. 1998).

1.1.2.4

Metamorphosis of Gobiids

The blue stream goby (Sicyopterus lagocephalus) is an amphidromous fish. The adults are benthic and rheophilic in rivers; their teeth and mouth, located ventrally, are especially well adapted for nibbling algae growing on the surface of rocks. The larvae are carried to the sea after hatching; during post-larvae transition from seawater to freshwaters, the mouth is terminal for pelagic and planktonic life (Keith et al. 2008). These larvae need to undergo metamorphosis; the major changes include a change in the position of the mouth from a terminal to an almost ventral one, modification of the pectoral and caudal fins, development of body pigmentation, and spreading of scales to the anterior part of the body (Keith et al. 2008). Cranial deformation was also observed during the early development of Stimpson’s goby (Sicyopterus stimpsoni), which is an amphidromous fish. When post-larvae migrate from the ocean to rivers, metamorphosis of both the length of the snout and height and width of the head increases considerably, which is related to alterations in diet and spatial distribution between post-larvae and juveniles. The drastic morphological changes during metamorphosis of gobioid fish are under the control of THs, the levels of which are the highest when the position of the mouth changes. Moreover, exogenous T4 treatment accelerated and amplified the modification in the corner of the mouth angle. Inversely, TU treatment significantly delayed the metamorphic event in the blue stream goby (Taillebois et al. 2011).

1.1.2.5

Metamorphosis of Carapidae (Pearlfish)

Species of the tribe Carapini (Carapidae) can penetrate and live inside different invertebrate hosts such as sea cucumbers (Markle and Olney 1990). Their early life

6

1

General Introduction of Flatfish Metamorphosis

stages include the vexillifer larva stage, which corresponds to the dispersal pelagic period and is characterized by complex specialization of the dorsal fin; tenuis stage, marked by the big loss of the body and ended with the fish settlement; and juvenile stage, in which a significant reduction in length is observed (Parmentier et al. 2004b). The tenuis larvae of Carapus homei, Carapus boraborensis, and Encheliophis gracilis, while shifting from a pelagic life to a lagoon habitat, undergo metamorphosis, with about 60% reduction in body length, vertebral centra shortened gradually from the anterior to the last remaining ones, and all vertebral centra along a poster-anterior gradient decalcified progressively (Parmentier et al. 2004a).

1.1.2.6

Metamorphosis of Flatfish (Pleuronectiformes)

Flatfishes comprise a relatively large group of bottom-dwelling fishes that exhibit apparent asymmetry on both sides: both eyes are located on the same side of the head. Flatfishes are born with symmetrical bodies like many other fishes after hatching. As flatfish larvae develop, one eye moves overhead to the other side, causing both eyes locating on the same side. Lifestyle changes occur concomitantly with these changes, from free swimming to benthic life with both eyes facing up. The fish’s body is highly compressed during metamorphosis. Pigmentation of the body also becomes Asymmetric body coloration results from the intensive pigmentation on the ocular side and almost no pigmentation on the blind side. The asymmetrical features of the flatfishes combinated with the excellent background matching, very effectively accommodate a predominantly benthic existence. Like groupers, some flatfish species show elongation and shortening of the rays during dorsal fin development (De Jesus et al. 1993).

1.2

Introduction of the Metamorphic Events in Various Flatfishes

Flatfishes (Pleuronectiformes) are benthic and carnivorous, and they occur worldwide, primarily in shallow to moderate depths. Common names for flatfishes include flounder, halibut, sole, plaice, dab, sanddab, tonguefish, and turbot. About 772 extant flatfish species have been recognized in approximately 129 genera and 14 families (Nelson et al. 2016). Flatfishes are important to fisheries and contribute substantially to seafood production and livelihood. Some flatfishes are very important economic species and extensively cultured worldwide, for example, turbot (Scophthalmus maximus), Atlantic halibut (Hippoglossus hippoglossus), and Japanese flounder (Paralichthys olivaceus). Most species of flatfishes have both eyes on the right side (dextral) or the left side (sinistral). In some species, both dextral and sinistral individuals have been observed. The cranial osteology also demonstrates asymmetrical deformation. The

1.2

Introduction of the Metamorphic Events in Various Flatfishes

7

dorsal fin extends anteriorly to at least the eye in all flatfishes, except Psettodes (Ahlstrom et al. 1984). Flatfish has a widespread metamorphosis event, ranging from about 5 mm in achirine soles to more than 120 mm in some bothines. Most flatfish larvae enter metamorphosis with a body length of 10–25 mm (Ahlstrom et al. 1984). Research on the life history stages of flatfishes was first performed by Cunningham from 1887 to 1891, who described plentiful series reared from eggs collected from running-ripe females (Ahlstrom et al. 1984).

1.2.1

Metamorphosis of Japanese Flounder

Japanese flounder (Paralichthys olivaceus) is one of the most economically important carnivorous species cultured in Asia. It is benthic and lives mainly on sandy bottoms, from a few meters to about 150 m. It has been extensively cultured in Japan, China, South Korea, etc. Metamorphic process in Japanese flounder can be divided into six stages (Minami 1982). Stage D is the pre-metamorphosis stage, in which the eyes are still symmetrical. Stage E refers to the pro-metamorphosis stage, with the right eye beginning to migrate. In Stage F, the right eye migrates further, but it is not visible from the left side. In Stage G, which represents the climax of metamorphosis, part of the right eye is visible from the left side. In Stage H, the right eye migrates to the dorsal midline. The number of melanophores has a significant increase on the left side of the body, and settling behavior is observed. In Stage I, metamorphosis is completed. The right eye fully moves to the left side, resulting in both eyes located on the same side (Fig. 1.1). This classification of the metamorphic stages of the Japanese flounder has been adopted for other flatfishes. In addition, elongation and shortening of the rays are observed during dorsal fin development in Japanese flounder metamorphosis. In stage D, five elongated dorsal fin rays and six caudal fin rays are observed; in stage F, one small fin ray arises at the anterior end of the elongated dorsal fin rays, and the dorsal and anal fin rays develop; in stage G, the dorsal, anal, and caudal fin rays have

Fig. 1.1 Metamorphic stages of the Japanese flounder (adopted from Minami 1982)

8

1

General Introduction of Flatfish Metamorphosis

fully developed; and, in stage I, the dorsal elongated fin rays are observed to be resorbed completely (Fig. 1.1).

1.2.2

Metamorphosis of Barfin Flounder

The barfin flounder, Verasper moseri, is a large pleuronectiform fish that inhabits cold sea basins around northeast Japan that face the Pacific Ocean. The morphological development of the barfin flounder was examined in a laboratory-reared series by Aritaki et al. (2000). The metamorphosis, characterized by eye migration from left to right side of the head, began from 40 DAH and was completed at 60 DAH. During metamorphosis, melanophores were densely distributed on the whole body (Fig. 1.2). Unlike Japanese flounder, no elongation and shortening of the dorsal fin rays were observed during metamorphosis in the barfin flounder.

1.2.3

Metamorphosis of Slime Flounder

Morphological development of the slime flounder, Microstomus achne, from newly hatched larva to early juvenile has been demonstrated in laboratory conditions (Aritaki and Tanaka 2003). The slime flounder has a long pelagic life of about 85 DAH, and the duration of its metamorphic phase is about 40 DAH at a mean water temperature of 13.9 °C (Fig. 1.3). During metamorphosis, eye migration does not synchronize with the transition from planktonic to benthic habitat. During dorsal fin development, no elongation and shortening of the rays are observed in the slime flounder (Fig. 1.3).

Fig. 1.2 Metamorphosis of laboratory-reared barfin flounder (Aritaki et al. 2000). D, pre-flexion larva; E, notochord flexion larva, 25 DAH; F, post-flexion larva; G, post-flexion larva, 40 DAH; H, post-flexion larva, 50 DAH; I, juvenile, 60 DAH

1.2

Introduction of the Metamorphic Events in Various Flatfishes

9

Fig. 1.3 Metamorphosis of laboratory-reared slime flounder (Aritaki and Tanaka 2003). D, notochord flexion larva, 40 DAH; E, post-flexion larva, onset stage of metamorphosis, 45 DAH; F, postflexion larva, 60 DAH; G, post-flexion larva, 75 DAH; H, metamorphosed juvenile, 90 DAH

1.2.4

Metamorphosis of Summer Flounder

The summer flounder (Paralichthys dentatus) is found in bays, lagoons, and shallow coastal waters along the Atlantic coast. The adults usually prefer a hard sandy substrate where they can burrow. In the summer flounder, the transition from larva to juvenile occurs over a range of 9.5–27 mm (Keefe and Able 1993), and the eye starts to migrate about 3 weeks after hatching (Martinez and Bolker 2003). The metamorphic stages of the summer flounder are classified on the basis of the degree of eye migration (Keefe and Able 1993). Both eyes are symmetrical during pre-metamorphosis of summer flounder. During Stage E, resorption of the supraorbital bar occurs at approximately 9.5 mm, although the migration has not yet started. The right eye is slightly higher than the left eye in Stage F, and, an evident eye groove forms because of the supraorbital bar resorption (Fig. 1.4). In Stage G, the eyes look like stacked one on top of the other because the right eye has reached the dorsal midline and can be seen from the left side of the body. In Stage H, the right

Fig. 1.4 Metamorphic stages of Paralichthys dentatus (modified from Martinez and Bolker 2003). The position of the migrating right eye is shown in gray

10

1

General Introduction of Flatfish Metamorphosis

eye continues to migrate and is located in the midline of the dorsal margin of the head. By the end of Stage I, the right eye is eventually located adjacent to the left eye; melanophores are more abundant on the entire surface of the left side of the body, particularly over the body cavity. Schreiber and Specker (1998) classified metamorphosis of the summer flounder into the pro-metamorphosis stage, early climax of metamorphosis, and late climax of metamorphosis. The pro-metamorphosis stage of the summer flounder is from 32 DAH; early climax of metamorphosis, about 38 DAH; mid-climax, about 40 DAH; and late climax of metamorphosis, about 47 DAH. The juvenile stage occurs at 58 DAH. Exogenous T4 could advance the metamorphosis by a couple of days, and TU, an inhibitor of TH synthesis, could delay metamorphosis in summer flounder (Schreiber and Specker 1998).

1.2.5

Metamorphosis of Southern Flounder

The southern flounder (Paralichthys lethostigma), with a flat oval-shaped body, is the biggest flounder species found throughout the Northwest Atlantic and the Gulf of Mexico. It is a common species found over mud or silt bottoms in coastal and estuarine areas and lower reaches of rivers. Daniels (2000) observed that the right eye of the southern flounder starts to move upward approximately at 30 DAH, near the end of the larval phase. Around 60 DAH, the larval flounder settles to the bottom, and its right eye moves to the left side of the head. The upper side becomes dark, and the lower side remains white to suit its bottom-dwelling lifestyle. Depending on the movable eye location of the southern flounder, Schreiber (2006) defined the developmental stages as follows: early (6–13 days postfertilization, dpf) and late (14–19 dpf) pre-metamorphosis, no eye migration is observed; pro-metamorphosis (20–23 dpf, stage E), the right eye starts to migrate upward; early, mid, and late metamorphic climax (24–30 dpf), stage F, stage G, and stage H, respectively, right eye moves to the dorsal midline; and post-metamorphic juvenile (31 dpf, stage I), the movable eye has crossed over the dorsal midline. The right eye moves to its final position on the other side of the head (Fig. 1.5, Qin et al. 2008).

1.2.6

Metamorphosis of Winter Flounder

The range of the winter flounder (Pseudopleuronectes americanus) is limited to the western Atlantic, from the coast of Newfoundland and Labrador in the north to Georgia in the south. The winter flounder lives on a variety of substrates, such as

1.2

Introduction of the Metamorphic Events in Various Flatfishes

11

Fig. 1.5 Metamorphosis of the southern flounder (adopted from Qin et al. 2008)

Fig. 1.6 Early development of the winter flounder (adopted from the website of New Jersey Scuba Diving, https://njscuba.net/biology/sw_fish_flounders.php)

sandy, muddy, or pebbled bottoms, at fairly shallow depths, and it even ventures into the brackish waters near rivers or estuaries. During metamorphosis, the winter flounder becomes laterally compressed, with one eye migrating to the opposite side of the head, and it lies on its blind side on the ocean floor. The average length at metamorphosis is around 7.8 mm, and the average age at metamorphosis is 59.5 DAH (Fig. 1.6) (Chambers and Leggett 1987).

12

1

General Introduction of Flatfish Metamorphosis

Fig. 1.7 Metamorphic stages of the turbot (Al-Maghazachi and Gibson 1984). F. Stage 4a, 9.1 mm long. G, Stage 4c, 14.2 mm long. H, Stage 5b, 20.2 mm long. I, Stage 5d, 38.4 mm long

1.2.7

Metamorphosis of Turbot

The turbot (Scophthalmus maximus) is a flatfish naturally distributed around the European coast, from the Baltic Sea across the Atlantic Ocean and the Mediterranean Sea to the Black Sea. The turbot is caught mainly in the Atlantic area and especially in the North Sea, and it has been intensively cultured in the last decade in Europe and China. Jones (1972) provided a complete account of the larval development of turbot to the end of metamorphosis. Metamorphosis of the turbot starts at about 25 DAH (Zhu et al. 2002). A comparable staging system is proposed, including Stage 4 (asymmetry and eye migration, notochord posteriorly slanted dorsally) and Stage 5 (completion of eye migration, spines, and swim bladder resorbed). The eye migration commences in Stage 4; the right eye can be seen at a higher position than the left (Fig. 1.7F). The right eye is positioned further upward, the upper margin is visible from the left side (Fig. 1.7G), and the right eye continues to move overhead (Fig. 1.7H). Finally, the right eye is positioned away from the upper edge; the dorsal fin extends above the front of the eye (Fig. 1.7I) (Al-Maghazachi and Gibson 1984).

1.2.8

Metamorphosis of European Plaice

The European plaice, Pleuronectes platessa, is distributed in the North Sea and lives on mud and sand bottoms, from a few meters down to about 100 m, and in seas and estuaries (rarely entering freshwaters). At the onset of metamorphosis, the European plaice larva is about 63–70 DAH and a total length of about 12 mm (Ryland 1966). The eyes appear asymmetrical (Fig. 1.8A), and, later, the left eye becomes visible over the top of the head (Fig. 1.8B); the left eye keeps moving overhead when observed from the right side (Fig. 1.8C). The left eye further moves beyond the head, the pupil is visible from the top, and, finally at the end of metamorphosis, the left eye reaches its final position (Fig. 1.8D).

1.2

Introduction of the Metamorphic Events in Various Flatfishes

13

Fig. 1.8 Metamorphic stages of the European plaice (adopted from Ryland 1966). A, Asymmetry of the eyes is observed. B, Left eye just showing. C, Left eye visible over the top of the head. D, Left eye on or beyond the edge of the head

1.2.9

Metamorphosis of Atlantic Halibut

The Atlantic halibut (Hippoglossus hippoglossus) is distributed in the Atlantic, for example, from the Bay of Biscay to Spitsbergen, Barents Sea, Iceland, and eastern Greenland in the Eastern Atlantic and southwestern Greenland and Labrador in Canada to Virginia in the USA in the western Atlantic. It can reach up to 4.5 m in length and more than 300 kg in weight, and it is the largest flatfish species found worldwide. According to an eye index, eye migration during the metamorphosis of the Atlantic halibut can be defined in five stages: stage 0, both eyes overlie each other from a later view; stage 1, the dorsal rim of the left eye moves more closely to the dorsal margin, but still partly overlaps with the right eye; stage 2, the left eye is located in the middle of its initial position and the dorsal margin; stage 3, the rim of the left eye moves over the dorsal margin; stage 4, both eyes are located on the same side of the head (Shields et al. 1999; Solbakken et al. 1999). According to Sæle et al. (2004), the metamorphosis of halibut can be defined from Stage 5 to Stage 9. Stage 5 is the pre-metamorphic stage of first-feeding larvae. Stages 6 and 7 are pro-metamorphic stages, in which the body depth increases. Stage 8 is the pro-climax stage in which the left eye starts to migrate and pigmentation becomes apparent on the other side. Stage 9 refers to the peak of metamorphosis; the left eye further migrates upward, the body has clear left-right asymmetry with intense pigmentation on the right side. Stage 10 is the juvenile stage, in which the ocular side is pigmented and the blind side is no-pigmented (Fig. 1.9) (Power et al. 2008). Sæle et al. (2004) described the degree of cranial ossification during metamorphosis in the Atlantic halibut. In Fig. 1.10, ossification of the jaw occurs during pre-metamorphosis (A); further ossification of the jaw occurs during pro-metamorphosis (B); the neurocranium and viscerocranium start ossification during pro-metamorphosis (C); dorsal view demonstrates the symmetrical frontal and parietal bones (D); further ossifications occur, including some neurocranium fusion, and initial ossification of the ethmoid groups and nasal bones during

14

1

General Introduction of Flatfish Metamorphosis

Fig. 1.9 Metamorphic stages of the Atlantic halibut (From Power et al. 2008)

Fig. 1.10 Developmental stages of the Atlantic halibut on the basis of the degree of cranial ossification (Sæle et al. 2004). Different ranges of gray-level show variable degrees of calcification (thickness of bone), the darker, the thicker

pro-climax (E); dorsal view shows the twist of the frontal bone with eye migration (F); further development of the hyoid arch and structures in the preoperculum, fusion of the neurocranium, and further development of the ethmoid bones occur at climax (G); torsion of the frontal bone occurs when the migrating eye is fully relocated (H).

1.2

Introduction of the Metamorphic Events in Various Flatfishes

15

Fig. 1.11 Metamorphic stages of laboratory-reared spotted halibut (Aritaki et al. 2001). F, onset of metamorphosis, 30 DAH. G, early phase of metamorphosis, 35 DAH. H, late phase of metamorphosis, 50 DAH. I, juvenile, 60 DAH

1.2.10

Metamorphosis of Spotted Halibut

The spotted halibut (Verasper variegatus) generally lives in the East China Sea, Yellow Sea, and Bohai Bay and coastal areas of Japan and Korea. It is a demersal fish that lives on sandy and muddy bottoms in the sublittoral coastal zone. It grows fast and can reach 60 cm in length and a weight of up to 4 kg. In laboratory-reared spotted halibut, the left eye started to migrate at 30 DAH, then moves over the dorsal midline at a total length (TL) of 13.8 mm and 35 DAH, and the migrating eye was completely moved to the other side at 16.1 mm TL and 50 DAH (Fig. 1.11) (Aritaki et al. 2001).

1.2.11

Metamorphosis of Brown Sole

The brown sole, Pseudopleuronectes herzensteini, is naturally distributed throughout coastal areas in the northwestern Pacific, such as the northern part of the East China Sea, east coast of the Korean Peninsula, and mid-coastal and northern coastal areas of Japan. According to Imura et al. (2004) and Joh et al. (2011), the brown sole metamorphosis starts from post-flexion larva (stage F in Fig. 1.12); in the early phase of metamorphosis (Stage G), the left eye starts to move; then it can be seen from the right angle in Stage H; in Stage I, the pupil of the left eye moves to the midline of the head; in Stage J, the pupil of the left eye further migrates beyond the midline of the head (juvenile) (Fig. 1.12) (Aritaki and Seikai 2004).

Fig. 1.12 Morphological development of laboratory-reared brown sole during metamorphosis (adopted from Aritaki and Seikai 2004). F, post-flexion larva, onset of metamorphosis, G, postflexion larva, early phase of metamorphosis, H, post-flexion larva, late phase of metamorphosis. I, juvenile

16

1.2.12

1

General Introduction of Flatfish Metamorphosis

Metamorphosis of Dover Sole

The Pacific Dover sole (Microstomus pacificus), also called the slime sole or slippery sole, is a Pacific flatfish of the flounder family with a distribution range from Baja California to the Bering Sea. It mainly lives on mud bottoms. On the basis of the suggestions of Youson (1988), Markle et al. (1992) described four metamorphosis stages for the Dover sole. Stage 1: pre-metamorphic larvae; 6–58 mm standard length (SL). From around 10–15 mm SL, eye migration begins and body depth increases. Stage 2: metamorphic pre-competent larvae with 42–60 mm SL. Initiation of metamorphosis involves a series of morphological changes, including the mandibular dentition, eye movement, position of anterior margin of dorsal fin, position or presence/absence of posterior coracoid process, pectoral fin morphology, and asymmetrical coloration initiation. Stage 3: metamorphic competent larvae with 40–74 mm SL that present asymmetrical pigmentation, keep the coiled stomach and intestine, and have resorbed the posterior coracoid process. Stage 4: metamorphic post-competent larvae with 41–79 mm SL; shrinkage in body depth is completed. The initiation of eye migration in the Dover sole, unlike in most flounders, does not match the transition from planktonic to benthic habitat. Eye migration in the Dover sole is ceased during planktonic growth, with the left eye stopping at the dorsal rim of the head at 15–20 mm SL; the eye keeps in this position until metamorphosis.

1.2.13

Metamorphosis of Chinese Tongue Sole

The Chinese tongue sole (Cynoglossus semilaevis) lives mainly in the Yellow Sea and the East China Sea. Because of its high economic value, the tongue sole has become an important commercial fish species in China. Metamorphosis of the Chinese tongue sole is quick. Both eyes show bilateral symmetry at 13.42–13.76 mm TL and 24 DAH; the length of the crown-like larval fin extends to the greatest extent at 5.00 mm (Fig. 1.14). The right eye of the larva at 25 DAH starts to migrate upwards, and the crown-like larval fin starts to be resorbed. The right eye migrates to the vertex at 27 DAH, and it completely migrates to the left side and the crown-like larval fin disappears at 29 DAH (Fig. 1.13) (Wan et al. 2004). Scales appear from 57 DAH, and they develop completely at 79 DAH.

1.3

Implications of THs in Metamorphic Flatfishes

17

Fig. 1.13 Metamorphosis of the Chinese tongue sole (Wan et al. 2004)

1.3

Implications of THs in Metamorphic Flatfishes

Hormones are often the triggering factors for metamorphic changes. Metamorphosis is a coordinated hormonal cascade. The trigger hormone leads to the release of several other hormones that act on various tissues or organs. For example, tail regression in tadpoles can be triggered by THs. The role of hormones during metamorphosis can be researched by artificially adding these hormones to pre-metamorphic animals, for example, exogenous THs can speed up tail loss and limb growth in tadpoles. Inui and Miwa (1985) reported that exogenous TH treatment can accelerate metamorphosis, whereas treatment with TH-inhibiting goitrogens can arrest metamorphosis in the Japanese flounder. Many studies have shown that THs are involved in regulating flatfish metamorphosis, such as in the summer flounder (Schreiber and Specker 1998); this suggests that the regulation of metamorphosis by THs is conserved in flatfish. Several papers have reviewed the effects of THs on regulating flatfish metamorphosis (Tanaka et al. 1995; Power et al. 2001; Inui and Miwa 2012; Schreiber 2013; Campinho 2019).

18

1.3.1

1

General Introduction of Flatfish Metamorphosis

Development of the Thyroid Gland and Changes in THs Level in Flatfishes

Development of the thyroid gland and changes in TH level have been reported in the early life history of several flatfishes. The main form of thyroid hormone secreted by the thyroid follicles is 3,5,3′,5′-tetraiodo-L-thyronine (T4 or thyroxine) under the regulation of the pituitary gland and hypothalamus. Then, T4 is secreted into the bloodstream and travels to the target organs. Thyroid follicles are the functional units of the thyroid gland. In the Atlantic halibut, thyroid follicles were first detected in 27 DAH larvae, and both quantity and activity of the follicles increased significantly after yolk sack resorption and continued to increase during further development. Larval T3 and T4 contents increase after yolk resorption, which is consistent with the proliferation of thyroid follicles (Einarsdóttir et al. 2006). In Senegalese sole larvae, development of the thyroid gland and ontogenic appearance of THs have been investigated (Delgado et al. 2006; Klaren et al. 2008). Thyroid follicles were first observed in the larvae at 4 or 5 DAH, exclusively presented in the sub-pharyngeal area, encircling the ventral aorta. There is a clear chronology for the activation of the thyroid gland in early pre-metamorphic larvae. At the onset of metamorphosis in several flatfish species, plasma concentrations of T4 go up significantly. In the Japanese flounder, T4 was detected using a specific radioimmunoassay at the initiation of metamorphic climax. Then, a rapid rise in T4 level was detected in the mid-climax of metamorphosis, and this high level persisted until the end of climax. During post-climax of metamorphosis, T4 levels in the whole-larva decreased to about half of the peak value (Miwa et al. 1988). In the summer flounder, whole-larva T4 level increase during metamorphic climax and are associated with the developmental stage. In the Atlantic halibut, an increase in T4 level is detected at the beginning of metamorphosis, and T3 level further elevates at the peak of metamorphosis (Einarsdóttir et al. 2006). These results indicate that metamorphic climax is caused by a sudden increase in THs, which may regulate development before and after metamorphosis (Schreiber and Specker 1998). In addition, some abnormal flounders could not settle because of low serum T4 levels. After 14 days of exogenous T4 treatment of the abnormal fishes, all abnormal characteristics disappeared, and the fishes recovered (Okada et al. 2005). Atlantic halibut larvae treated with exogenous T4 showed accelerated eye migration and pigmentation (Solbakken et al. 1999). These experiments indicate that these abnormal fishes could not complete metamorphosis and had TH deficiency (Okada et al. 2005), further suggesting that TH is a mediator of flatfish metamorphosis. Development of the thyroid gland coincides with surges in T4 level during flatfish metamorphosis (Klaren et al. 2008). In the Senegalese sole, thyroid follicles increased in both number and size during metamorphosis (12–20 DAH) and presented the same characteristics as that observed in adult fishes by 30 DAH (Klaren et al. 2008). While the number of thyroid follicles returns to pre-metamorphic levels immediately after metamorphosis (Campinho et al. 2015).

1.3

Implications of THs in Metamorphic Flatfishes

1.3.2

19

Role of THs in Tissue Development during Metamorphosis

Extensive morphological and functional alterations in various organs are regulated by THs during flatfish metamorphosis (Power et al. 2008). Morphological and biochemical changes in muscular tissue have been studied in several flatfish metamorphoses (Yamano et al. 1991a,b; Inui et al. 1995). The larvaltype muscle has a small number of myofibrils, but abundant vacuoles and basophilic sarcoplasm. After metamorphosis, the muscle changes from larval to adult type with abundant myofibrils, and the vacuoles disappear. Meanwhile, changes with respect to troponin T and myosin light chains of muscle were observed during metamorphosis. Treatment with TU and exogenous T4 can change the isoforms of the myosin light chain. TH also influences the expression of the muscle gene fast TnT ( fTnT) during Atlantic halibut metamorphosis (Campinho et al. 2007). Similar changes in TnT isoform expression in the Senegalese sole, turbot, and Japanese flounder indicate that the muscle is regulated by THs (Focant et al. 2003). Altered structure and function of the gastrointestinal tract accompany changes in the diet during flatfish metamorphosis. Morphological development of the stomach during flatfish metamorphosis may be directly controlled by THs (Miwa et al. 1992; Huang et al. 1998; Gomes et al. 2015). In the Japanese flounder, the gastric glands started to develop and secretion of pepsinogen occurred during metamorphosis (Inui et al. 1995). In the summer flounder, some gastric glands were evident during early metamorphosis, pepsinogen was detected during mid-metamorphosis, and gastric glands developed during late metamorphosis (Huang et al. 1998). TU treatment suppressed the development of the gastric glands and secretion of pepsinogen, whereas exogenous T4 accelerated them in both Japanese flounder and summer flounder (Miwa et al. 1992; Huang et al. 1998). THs may play a role in regulating vestibular remodeling, which is associated with changes in flatfish swim posture during metamorphosis. Schreiber et al. (2010) reported that TH has different effects on the growth and mineralization of three types of otolith end organs (sacculus, utricle, and lagena) during southern flounder metamorphosis. TH accelerates the growth of the sacculus and utricle; however, TH induces the mineralization, but not growth, of the lagena. Methimazole could suppress endogenous TH production. Methimazole treatment completely inhibited lagena mineralization but not growth. Four vestibular-specific genes, alpha-tectorin, otogelin, otolith matrix protein, and otopetrins 1 and 2, were upregulated during spontaneous metamorphosis and/or following 72 h treatment with exogenous TH in the southern flounder (Wang et al. 2011). THs are involved in flatfish pigmentation. Japanese flounder larva treated with more than 10 nM T4 exhibited remarkable growth in albinism; the albinism rate can reach more than 90% if larvae were treated before metamorphosis. Likewise, albinism was found in Japanese flounder juveniles after T4 treatment (Yoo et al. 2000).

20

1

General Introduction of Flatfish Metamorphosis

During flatfish metamorphosis, THs are necessary for mitochondria-rich cells (MRCs). In the summer flounder metamorphosis, the impact of thyroid level changes has been found on the intracellular membranes of MRCs, mitochondria size and ultrastructure, immunoreactive (ir)-Na+,K + -ATPase, and cell size and density. Metamorphosis inhibited by TU treatment caused large “larval” type MRCs, which had weak reactivity to osmium, large electron-lucent mitochondria, and weak ir-Na+, K+ -ATPase (Schreiber and Specker 2000). THs may inhibit larval erythropoiesis and promote adult erythropoiesis in the Japanese flounder (Miwa and Inui 1991). In pre-metamorphic larvae, the erythrocytes are large, round, and with small round nuclei; at the end of metamorphosis, they are substituted with elliptical erythrocytes. THs have also been reported to induce shortening of the fin rays in metamorphosing Japanese flounder in vitro (De Jesus et al. 1990).

1.3.3

Sensitivity of Metamorphic Events to THs during Larval Development

The impacts of exogenous THs on metamorphic events and morphogenesis of summer flounder, Atlantic halibut, spotted halibut, and Japanese flounder larvae have been investigated (Schreiber and Specker 1998; Solbakken et al. 1999; Tagawa and Aritaki 2005; Yoo et al. 2008). The sensitivity of the larvae to exogenous THs at different metamorphic stages is different, and altering the TH level in the larvae at different stages has different consequences. In the summer flounder, 100 ppb T4 treatment of accelerated the late pre-metamorphic larvae transiting to pro-metamorphosis, early metamorphic climax, and mid-metamorphic climax. Unlike late pre-metamorphic larvae, pro-metamorphic larvae treated with T4 showed accelerated development to only early metamorphic climax. TU treatment could suppress the completion of metamorphosis in the early and mid-metamorphic climax, but not in the late metamorphic climax (Schreiber and Specker 1998). In epithelial cells of the stomach of summer flounder larvae, Soffientino and Specker (2003) found a critical window for the actions of exogenic T4. In Atlantic halibut, a “window of opportunity” for metamorphosis was detected, for example, pigmentation was correlated with T4 treatment after 14 days (Solbakken et al. 1999). In the spotted halibut, the occurrence of symmetrical pseudo-albino increased to more than three times when T4 was administered to hypothyroid larvae from 25 DAH (Tagawa and Aritaki 2005). If T4 treatment was started before 15 DAH or after 60 DAH, the occurrence of symmetrical ambicoloration was more than two times (Tagawa and Aritaki 2005). In the Japanese flounder, sensitivity to T4 is determined by the larval organ and larval developmental phases; larvae treated with exogenous T4 during stages E and F had premature metamorphosis, showing advanced benthic life and eye migration(Yoo et al. 2008).

1.3

Implications of THs in Metamorphic Flatfishes

1.3.4

21

Hypothalamo–Pituitary–Thyroid Axis

Generally, the synthesis and secretion of thyroid hormones are largely controlled by the hypothalamus–pituitary–thyroid axis. TSH stimulates the production of T4 and T3 in the thyroid gland, which in turn inhibits both thyrotropin-releasing hormone (TRH) and thyroid-stimulating hormone (TSH) synthesis when THs reach the hypothalamus and the hypophysis, respectively. The secretion of thyroxine can be modulated to keep a constant normal free T4 concentration in the plasma based on the physiological condition (Eales and Brown 1993). In amphibians, metamorphosis is suggested to be activated by the thyrotropic axis, composed of the brain neuropeptide corticotropin-releasing hormone (CRH), instead of the thyrotropin-releasing hormone (TRH), pituitary TSH, and THs (Dufor and Rousseau 2007). However, in flatfish, there has been no evidence that supports the function of TRH or CRH in the hypothalamic control of TH release during metamorphosis (Campinho et al. 2015). In the Japanese flounder, the activity of immunoreactive TSH (IrTSH) cells progressively raised during pre-metamorphosis and peaked in pro-metamorphic larvae; cell degranulation occurred at the peak of metamorphosis. Most IrTSH cells lost their activities in the post-climax stage. As opposed to this, the thyroid gland was in its most active period during the climax and post-climax of metamorphosis. Both IrTSH cells and thyroid gland appeared to have been activated again in the benthic, juvenile flounder after complete metamorphosis (Inui et al. 1989). The larval T4 level increased markedly after 5 h of bovine TSH treatment, peaked after 10 h, and decreased subsequently. Bovine TSH treatment also speeded up the process of metamorphic climax, like the second fin ray shortening and eye migration (Inui et al. 1989). These investigations indicate that elevated TSH level stimulates the thyroid, caused increased T4 concentrations, and further lead to climax in the flounder larvae. In addition, negative feedback regulation in the pituitary–thyroid axis occurs in the Japanese flounder (Miwa and Inui 1987a,b).

1.3.5

Factors That Influence THs Level during Metamorphosis

TH level can be influenced by various environmental factors, for example, rearing temperature can influence the TH level of spotted halibut; T4 levels during metamorphic climax were higher at lower temperatures among four temperatures (9, 12, 15, 18, and 21 °C) (Hotta et al. 2001). The role of THs in low-salinity adaptation was determined in the Japanese flounder (Hiroi et al. 1997). When flounder larvae at pre-metamorphosis or metamorphic climax were transferred from saltwater to 1/4 saltwater, whole-body levels of TH decreased significantly, indicating the possible involvement of THs in the low-salinity response during metamorphosis and transition from offshores areas to estuaries (Hiroi et al. 1997).

22

1

General Introduction of Flatfish Metamorphosis

Dietary supplementation can influence T4 production during flatfish metamorphosis. Tyrosine is the precursor of TH, and it may help to complete a successful deformation from the larva to juvenile. Pinto et al. (2010) found that dietary tyrosine supplementation effectively increased tyrosine availability and most likely TH production in the Senegalese sole at metamorphosis. In addition, Ribeiro et al. (2012) found the dietary selenium may have a positive effect on TH generation in the early life stages of the Senegalese sole. Moreover, water pollution has been found to disrupt the endocrinal balance of fishes. Polychlorinated biphenyls (PCBs) are abundantly present organochlorine pollutants eliciting adverse biological effects, such as disrupting TH homeostasis. Aroclor 1254, a type of PCB, has been found to induce hypothyroidism, significantly decrease plasma T4 and T3 concentrations, delay metamorphosis, and cause abnormal morphology in the Japanese flounder (Dong et al. 2014, 2017).

1.3.6

Gene Expression Patterns of Deiodinase Enzymes and THs Receptors during Metamorphosis in Flatfishes

T4, containing four atoms of iodine, is produced by the thyroid gland. Conversion of T4 into active T3 in peripheral tissues is catalyzed by iodothyronine deiodinase type 1 (Dio1) and 2 (Dio2). Conversely, type III deiodinase (Dio3) suppresses intracellular thyroid activity by converting T4 and T3 to the comparatively inactive forms, reverse T3 (rT3) and T2. Therefore, TH bioactivity and availability are regulated by the expression and activity of deiodinase genes. These deiodinase genes are expressed in a specific spatiotemporal manner during some flatfish metamorphosis (Campinho et al. 2012; Itoh et al. 2010; Shao et al. 2017). Isorna et al. (2009) first cloned dio2 and dio3 from the Senegalese sole and investigated the activity of deiodinase during metamorphosis. Dio2 activity increased during metamorphosis, whereas Dio3 activity decreased in the mid-late metamorphic period; these changes sustained the increase in TH concentrations observed during Senegalese sole metamorphosis. In the Japanese flounder, different deiodinase genes were found in different tissues: dio1 is expressed in the liver parenchymal cells from pro-metamorphosis to early climax; dio2 is expressed predominantly in eyes, tectum, and skeletal muscles from pro-metamorphosis to post-climax; and dio3 is expressed in skeletal muscle and gastric gland blastemas at metamorphic climax (Itoh et al. 2010). Campinho et al. (2012) found that the interaction between the hormoneactivating deiodinase Dio2 and the hormone-inactivating Dio3 has a high correlation with TH-driven developments in the Atlantic halibut. Many cellular actions of THs are mediated by nuclear TH receptors (TRs), which are ligand-dependent transcription factors that preferentially bind T3. Four subtypes of TRs were first found in the Japanese flounder: TRαA, TRαB, TRβ1, and TRβ2. TRαA and TRαB are encoded by different two genes, whereas TRβ1 and TRβ2 are the results of alternative splicing of TRβ (Yamano et al. 1994; Yamano and Inui

1.3

Implications of THs in Metamorphic Flatfishes

23

Fig. 1.14 Relative expression levels of TR genes during larval growth and metamorphosis of the Japanese flounder (Yamano and Miwa 1998). The corresponding changes in T4 and T3 levels are shown in the upper graph (Tagawa et al. 1990)

1995). TRαA gene expressions went up quickly during metamorphic climax and went down suddenly during post-climax stage in the Japanese flounder. TRβ transcripts raised during post-climax, and remained at high levels in metamorphosed juveniles (Fig. 1.14) (Yamano and Miwa 1998). Thereafter, the TRs in other flatfish species were cloned (Llewellyn et al. 1999; Marchand et al. 2004; Galay-Burgos et al. 2008; Manchado et al. 2009; Zhang et al. 2016b). The TRs expression profiles of the turbot, Atlantic halibut, and Senegalese sole are approximately similar (Marchand et al. 2004; Galay-Burgos et al. 2008; Isorna et al. 2009; Manchado et al. 2009). Differential expression of TRs during flatfish metamorphosis suggests their different roles in the tissue maturation that accompanies metamorphosis.

24

1.4

1

General Introduction of Flatfish Metamorphosis

Genes Involved in Flatfish Metamorphosis

Besides the genes that encode the deiodinase enzymes and TH receptors involved in flatfish metamorphosis, several genes showed changes in expression during flatfish metamorphosis, for example, serine- and arginine-rich splicing factor 3 (SFRS3), insulin-like growth factor I (IGF-I), and prolactin (PRL) (Zhang et al. 2011). SFRS3, screened by suppression subtraction hybridization between pre-metamorphic and metamorphosing larvae, was found to be expressed during metamorphosis in the Japanese flounder (Bao et al. 2005). SFRS3 is a member of the serine/arginine-rich (SR) class of splicing factors (Krainer et al. 1991; Kim et al. 1992; Zahler et al. 1992; Cavaloc et al. 1994; Screaton et al. 1995). Flounder SFRS3 contains a serine/arginine-rich (RS) domain and the RNA recognition motif (RRM). There is a high degree of structural conservation with its orthologues among other organisms. SFRS3 expression increased sharply in the flounder head during metamorphosis, with higher expression in Stage E (23 DAH) and much higher expression at 33 and 43 DAH compared to that in the pre-metamorphosis stage (17 DAH) (Fig. 1.15). SFRS3 was evaluated spatially using Whole-mount in situ RNA hybridization. The expression of SFRS3 was widespread in stage E, from the head to the caudal fin, although the head had a relatively weak expression. It is interesting that, as the metamorphosis progressed to stage G, SFRS3 expression increased in the anterior areas, while declining in the posterior areas. The expression of SFRS3 was predominantly restricted to the head in stage H (Fig. 1.16), which indicates SFRS3 may be involved in the Japanese flounder metamorphosis (Bao et al. 2005). Insulin-like growth factor-1 (IGF-I), a peptide hormone, has a key role in improving fish growth through direct effects on cell proliferation. The biological functions of IGF-I are regulated primarily by binding to the IGF-I receptor (IGF-IR),

Fig. 1.15 Evaluation of SFRS3 expression during early development of the Japanese flounder using quantitative RT-PCR (Bao et al. 2005)

1.4

Genes Involved in Flatfish Metamorphosis

25

Fig. 1.16 Whole-mount RNA in situ hybridization of SFRS3 in the Japanese flounder (Bao et al. 2005). Hybridization signals are shown in red. A-B, stage E; C-D, stage G; E-F, stage H

leading to an intracellular signaling response. In the Japanese flounder, IGF-IR-1 expression increases markedly from pre-metamorphosis, peak at the onset of metamorphosis, and then remain unchanged until metamorphosis completion (Zhang et al. 2011). This observation indicates the IGF-I system may play a role in the Japanese flounder metamorphosis. Prolactin (PRL) is a polypeptide hormone mainly synthesized and secreted from specialized cells of the anterior pituitary gland. To understand the role of PRL during metamorphosis, we first investigated the spatiotemporal expression patterns of prl in the Japanese flounder (Si et al. 2021). Before hatching, prl was expressed highly at 10 hpf (hours post-fertilization) and then decreased at 30 hpf and 50 hpf. After hatching, prl expression was elevated from 1 dph (days post-hatching) to 5 dph and then went down at 13 dph. During metamorphosis, prl was found marked expression elevation at 20 dph and then gradual decline until the completion of metamorphosis (Fig. 1.17). Whole-mount in situ RNA hybridization demonstrated that prl was extensively expressed before metamorphosis in the Japanese flounder, for example, in the fin fold, coronary fin anlage, intestine, myotome, gill, jaw, nostril, and pectoral fin (Fig. 1.18a–e) (Si et al. 2021). The expression pattern of PRL during dorsal fin development supports previous findings that exogenous PRL treatment can delay resorption of the dorsal fin rays in the Japanese flounder (De Jesus et al. 1994). prl showed a high expression in the orbit, gill, nostril, and jaw during pro-metamorphosis stage E. Increased prl mRNA transcripts were observed in the pterygiophore (Fig. 1.18f). prl expression patterns of the climax stage and stage E of metamorphosis were similar. While, the nostril and jaw had decreased prl expression during climax (Fig. 1.18g). During post-metamorphosis, an extensive decrease of prl expression was observed in the whole body, with some weak signals in the pterygiophore and periorbital tissues and external edge of the operculum (Fig. 1.18h).

26

1

General Introduction of Flatfish Metamorphosis

Fig. 1.17 prl mRNA levels in various development phases of the Japanese flounder, Paralichthys olivaceus (Si et al. 2021). Statistical significance is denoted by different letters above the column

Fig. 1.18 Patterns of prl distribution before and during metamorphosis in the Japanese flounder (Si et al. 2021). (a) 9 dph; (b) 13 dph; (c) 16 dph; (d) 18 dph; (e) Pre-metamorphosis; (f) Stage E, Pro-metamorphosis; (g) Stage F, Climax stage; (h) Stage G, Post-metamorphosis; gill: gill; int: intestine; cfin: coronary fin; orb: orbit; find: fin fold; pfin: pectoral fin; jaw: jaw; myo: myotome; nos: nostril; lat: lateral line; orb: orbit; sub: suborbital tissue; tfin: tail fin; pfin: pectoral fin; pte: pterygiophore. Positive signals. Are denoted by red. The scale bar is 200 μm in (a, b, c, and d), and 500 μm in e, (f, g, and h)

1.5

1.5

MicroRNA Expression Profile During Metamorphosis in Flatfishes

27

MicroRNA Expression Profile During Metamorphosis in Flatfishes

MicroRNAs (miRNA) are short-chain non-coding RNAs consisting of 19–23 nucleotides that typically bind to the 3′-untranslated regions (3’-UTRs) of target mRNAs to influence mRNA stability and translation. To screen for early metamorphosisrelated miRNAs, we conducted a comparative analysis of microRNA expression profiles of pre- and pro-metamorphosing Japanese flounders (Xie et al. 2011). cDNA libraries were constructed for 17 DAH larvae and 19 DAH larvae, representing the pre- and pro-metamorphosis stage, respectively. Sequence analysis was performed, and 29 miRNAs were identified (http://www.mirbase.org/search.shtml) including 19 conserved miRNAs belonging to 15 entries (Table 1.1). Further analysis showed four novel miRNAs (pol-miR-20c, pol-miR-23c, polmiR-130d, and pol-miR-181e) had high homologies to published miRNAs, but differed by one or more nucleotides from other species. These four miRNAs detected in only the Japanese flounder gain particular interest due to their unique sequences and possible specific targeting mechanisms (Fig. 1.19). Table 1.1 Sequence and characteristics of conserved miRNAs in the Japanese flounder (Xie et al. 2011) miRNA family Pol-miR-1 Pol-let-7

Pol-miR-9* Pol-miR-10 Pol-miR-21 Pol-miR-23 Pol-miR-26 Pol-miR-125 Pol-miR-128 Pol-miR-145 Pol-miR-181

Pol-miR-200 Pol-miR-221 Pol-miR-429 Pol-miR-724

miRNA name Pol-miR-1a Pol-let-7a Pol-let-7e Pol-miR-7f Pol-let-7j Pol-miR-9* Pol-miR-10b Pol-miR-21a Pol-miR-23a Pol-miR-26a Pol-miR125b Pol-miR-128 Pol-miR-145 Pol-miR181a Pol-miR-181f Pol-miR-200a Pol-miR-221 Pol-miR-429 Pol-miR-724

No. of clones 1 3 2 1 1 3 1 1 3 1 1

Sequence (5′-3′) UGGAAUGUAAAGAAGUAUGUA UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGAUUGAAUAGUU UGAGGUAGUAGAUUGUAUAGUU UGAGGUAGUUGUUUGUACAGUU UAAAGCUAGAUAACCGAAAGU UACCCUGUAGAACCGAAUUUGU UAGCUUAUCAGACUGGUGUUGG AUCACAUUGCCAGGGAUUUCCA UUCAAGUAAUCCAGGAUAGGCU UCCCUGAGACCCUAACUUGUGA

Length (bp) 21 22 22 22 22 21 22 22 22 22 22

2 1 1

UCACAGUGAACCGGUCUCUUU GUCCAGUUUUCCCAGGAAUCCC AACAUUCAACGCUGUCGGUGAGU

21 22 23

1 1 1 3 1

AACAUUCAACGCUGUCGGUGAGUU UAACACUGUCUGGUAACGAUGU AGCUACAUUGUCUGCUGGGUUUC UAAUACUGUCUGGUAAUGCCGU UUAAAGGGAAUUUGCGACUGUU

24 22 23 22 22

28

1

General Introduction of Flatfish Metamorphosis

Fig. 1.19 Alignment of four novel miRNAs Japanese flounder with their homologies in other species (Xie et al. 2011). Pol, Paralichthys olivaceus; fru, Fugu rubripes; tni, Tetraodon nigroviridis; dre, Danio rerio; xtr, Xenopus tropicalis; gga, Gallus gallus; eca, Equus caballus; cfa, Canis familiaris; mdo, Monodelphis domestica; has, Homo sapiens

To figure out the function of miRNAs during Japanese flounder metamorphosis, we used stem-loop qRT-PCR to quantify 22 miRNAs. Thirteen of them were expressed highly at 17 DAH, just before metamorphosis; then, after metamorphosis (19–27 DAH), their expression levels decreased. The 13 miRNAs are as follows: pol-miR-1, pol-miR-7a, pol-miR-7j, pol-miR-7e/7f, pol-miR-9*, pol-miR-21a, polmiR-20c, pol-miR-23c, pol-miR-125b, pol-miR-128, pol-miR-181a, pol-miR-181e, and pol-miR-181f (Fig. 1.20 A–N). These miRNAs may not play positive roles in metamorphic events. In contrast, the expression levels of other miRNAs such as pol-miR-10b, pol-miR-23a, pol-miR-26a, pol-miR-130d, pol-miR-145, pol-miR200a, pol-miR-429, pol-miR-221, and pol-miR-724 varied with different metamorphic stages (Fig. 1.20 O–X). The expression levels of pol-miR-10b, pol-miR-23a, pol-miR-26a, pol-miR-130d, pol-miR-145, pol-miR-200a, and pol-miR-429 were the highest at 23 DAH, then decreased quickly (Fig. 1.20 O–V), indicating these seven miRNAs may be involved in metamorphosis. Based on the miRNA targets predicted by RNA22 software (Miranda et al. 2006), a total of 24 genes were identified and expressed in pre-metamorphosing or metamorphosing flounders. Of which, atcay has stable expression all the time to not function during metamorphosis (Fig. 1.21A). Before metamorphosis from 17 DAH to 19 DAH, cyp1a1 had a decreased expression, but other genes except atcay, oaz, ahcyl, and ela2a genes, had a significantly increased expression (Fig. 1.21), indicating their important role before metamorphosis. During metamorphosis from 19 DAH to 27 DAH, a fluctuation occurred in oaz, ahcyl, ela2a, cyp1a1, elf5a2, nt5c2, cp, timm8a, tnnc2, and ck1 levels was observed (Fig. 1.21C–K), indicating the possible function during metamorphosis. cox5a, hy, me, dck, mt-nd4l, hfe, hsp71,

1.5

MicroRNA Expression Profile During Metamorphosis in Flatfishes

29

Fig. 1.20 Abundance of miRNAs during the metamorphic stages of the Japanese flounder (Xie et al. 2011). 17 DAH, Pre-metamorphosis); 19 DAH, Pro-metamorphosis; 23 DAH, Climax; 27 DAH, Post-climax. U6 snRNA was used as an internal control. Values are represented by means ± SD (n = 3). Statistical significance (P < 0.05) is denoted by different letters above the column

hadh, rps27, fabpi, lin52, nme1, and myl genes were observed to have decreased expression levels during climax metamorphosis on par with the levels during pre-metamorphosis (Fig. 1.21M–Y), indicating their unimportant role in later metamorphic events. Our investigation showed that 20 miRNAs may participate in early metamorphic events, 10 miRNAs in later metamorphic events, 9 miRNAs during metamorphosis, and 7 miRNAs during metamorphic climax, respectively in the Japanese flounder. Fu et al. (2011) used Solexa high-throughput sequencing technology to characterize 140 conserved miRNAs in the Japanese flounder. In addition, they used miRNA microarrays to identify 66 differentially expressed miRNAs between 17 and 29 DAH of the metamorphic Japanese flounder. Fu et al. (2013) found that the expression of let-7 miRNAs could be induced by exogenous THs or be arrested by TU treatment during Japanese flounder metamorphosis. One target gene of miR-17, Cdc42, was validated by the luciferase reporter assay, and miR-17 overexpression in FEC cells inhibited Cdc42 expression. Moreover, the expression of miR-17 had a negative correlation with Cdc42 levels during metamorphosis in Japanese flounders (Zhang et al. 2016a). The common target gene of miR-1 and miR-133a, HDAC4, may be regulated by THs during muscle development in

30

1

General Introduction of Flatfish Metamorphosis

Fig. 1.21 Abundance of mRNAs during the metamorphic stages of the Japanese flounder evaluated by qRT-PCR (Xie et al. 2011). 17 DAH, Pre-metamorphosis; 19 DAH, Pro-metamorphosis; 23 DAH, Climax; 27 DAH, Post-climax. The data were normalized using β-actin as an internal control. Data are expressed as means ± SD (n = 3). Different letters indicate statistically significant differences (P < 0.05)

metamorphosing Japanese flounder (Zhang et al. 2015). Wang et al. (2017) used a high-throughput sequencing strategy to identify 33 miRNAs involved in Japanese flounder albinism, and 13 upregulated and 20 downregulated miRNAs were identified in albino versus normally pigmented individuals. Recently, Li et al. (2020) found that miR-17-92 can regulate the fate of the endoderm and mesoderm by controlling gata5 during Japanese flounder metamorphosis. The miRNA expressional profiles of other flatfishes during metamorphosis have been investigated. Bizuayehu et al. (2012) identified a total of 199 conserved miRNAs during Atlantic halibut development by using SOLiD deep-sequencing technology.

1.6

Summary

We first provided a brief introduction to metamorphosis in various fishes such as lamprey, elopomorphs, groupers, gobiids, and pearlfish. Then, we discussed metamorphosis in 13 flatfish species, namely, Japanese flounder, barfin flounder, slime flounder, summer flounder, southern flounder, winter flounder, turbot, European plaice, Atlantic halibut, spotted halibut, brown sole, Dover sole, and Chinese tongue sole. The pivotal role of THs in regulating metamorphosis in flatfishes was

References

31

emphasized. Changes in TH level and the role of THs in each tissue development during metamorphosis were reviewed in this chapter. Several genes were found to change expression during flatfish metamorphosis, for example, SFRS3, IGF-I, and PRL. Finally, the miRNA profiles during metamorphosis were investigated, and several miRNAs were found to be associated with flatfish metamorphosis.

References Ahlstrom EH, Amaoka K, Hensley DA, Moser HG, Sumida BY (1984) Pleuronectiformes: development. In ontogeny and systematics of fishes. Am Soc Ichthyologists Herpetologists Ser Publ No.1:641–670 Al-Maghazachi SJ, Gibson R (1984) The developmental stage of larval turbot, Scophthalmus maximus (L.). J Exp Mar Biol Ecol 82:35–51 Aritaki M, Ohta K, Hotta Y, Tanaka M (2001) Morphological development and growth of laboratory-reared spotted halibut Verasper variegatus. Nippon Suisan Gakkaishi 67:58–66 Aritaki M, Seikai T (2004) Temperature effects on early development and occurrence of metamorphosis-related morphological abnormalities in hatchery-reared brown sole Peudopleuronectes herzensteini. Aquaculture 240:517–530 Aritaki M, Suzuki S, Watanabe K (2000) Morphological development and growth of laboratoryreared berfin flounder Verasper moseri. Nippon Suisan Gakkaishi 66:446–453 Aritaki M, Tanaka M (2003) Morphological development and growth of laboratory-reared slime flounder Microstomus achne. Nippon Suisan Gakkaishi 69:602–610 Bao B, Yang G, Liu Z, Li S, Wang Z, Ren D (2005) Isolation of SFRS3 gene and its differential expression during metamorphosis involving eye migration of Japanese flounder Paralichthys olivaceus. Biochim Biophys Acta 1725:64–70 Bizuayehu T, Lanes C, Furmanek T, Karlesn B, Fernandes J, Johansen S, Babiak L (2012) Differential expression patterns of conserved miRNA and isomiRs during Atlantic halibut development. BMC Genomics 13:11 Campinho MA (2019) Teleost Metamorphosis: The Role of Thyroid Hormone. Front Endocrinol 10:383 Campinho MA, Galay-Burgos M, Silva N, Costa RA, Alves RN, Sweeney GE (2012) Molecular and cellular changes in skin and muscle during metamorphosis of Atlantic halibut (Hippoglossus hippoglossus) are accompanied by changes in deiodianses expression. Cell Tissue Res 350:333–346 Campinho MA, Silva N, Nowell MA, Llewellyn L, Sweeney GE, Power DM (2007) Troponin T isoform expression is modulated during Atlantic halibut metamorphosis. BioMed Central Dev 7:71 Campinho MA, Silva N, Roman-Padilla J, Ponce M, Manchado M, Power DM (2015) Flatfish metamorphosis: a hypothalamic independent process? Mol Cell Endocrinol 404:16–25 Cavaloc Y, Popielarz M, Fuchs JP, Gattoni R, Stevenin J (1994) Characterization and cloning of the human splicing factor 9G8: a novel 35 kDa factor of serine/arginine protein family. EMBO J 13: 2639–2649 Chambers RC, Leggett WC (1987) Size and age at metamorphosis in marine fishes: an analysis of laboratory-reared winter flounder (Pseudopleuronectes americansus) with a review of variation in other species. Can J Fish Aquat Sci 44:1936–1947 Daniels HV (2000) Species profile: southern flounder. Southern regional aquaculture center publication no. 726. SRAC, Florida De Jesus EG, Hirano T, Inui Y (1993) Flounder metamorphosis: its regulation by various hormones. Fish Physiol Biochem 11:322–328

32

1

General Introduction of Flatfish Metamorphosis

De Jesus EG, Hirano T, Inui Y (1994) The antimetamorphic effect of prolactin in the Japanese flounder. Gen Comp Endocr 93:44–50 De Jesus EG, Inui Y, Hirano T (1990) Cortisol enhances the stimulating action of thyroid hormones on dorsal fin-ray resorption of flounder larvae in vitro. Gen Comp Endocrinol 79:167–173 De Jesus EG, Toledo JD, Simpas MS (1998) Thyroid hormones promote early metamorphosis in grouper (Epinephelus coioides) larvae. Gen Comp Endocrinol 112:10–16 Delgado JBO, Ruane NM, Pousão-Ferreira P, Dinis MT, Sarasquete C (2006) Thyroid gland development in Senegalese sole (Solea senegalensis Kaup 1858) during early life stages: a histochemical and immunohistochemical approach. Aquaculture 260(1–4):346–356 Dong Y, Tian H, Wang W, Zhang X, Liu J, Ru S (2014) Disruption of the thyroid system by the thyroid-disrupting compound Aroclor 1254 in juvenile Japanese flounder (Paralichthys olivaceus). PLoS One 9(8):e104196 Dong Y, Zhang X, Tian H, Li X, Wang W (2017) Effects of polychlorinated biphenyls on metamorphosis of a marine fish Japanese flounder (Paralichthys olivaceus) in relation to thyroid disruption. Mar Pollut Bull 119(1):325–331 Dufor S, Rousseau K (2007) Neuroendocrinology of Fish Metamorphosis and Puberty: Evolutionary and Ecophysiological Perspectives. J Mar Sci Technol 15:55–68 Eales JG, Brown SB (1993) Measurement and regulation of thyroidal status in teleost fish. Rev Fish Biol Fish 3:299–347 Einarsdóttir IE, Silva N, Power DM, Smáradóttir H, Björnsson BT (2006) Thyroid and pituitary gland development from hatching through metamorphosis of a teleost flatfish, the Atlantic halibut. Anat Embryol (Berl) 211(1):47–60 Focant B, Vanderwalle P, Huriaux F (2003) Expression of myofibrillar proteins and parvalbumin isoforms during the development of a flatfish, the common sole Solea solea: comparison with the turbot Scophthalmus maximus. Comp Biochem Physiol B-Biochem Mol Biol 135:493–502 Fu Y, Shi Z, Wang G, Zhang J, Li W, Jia L (2013) Expression of let-7 microRNAs that are involved in Japanese flounder (Paralichthys olivaceus) metamorphosis. Comp Biochem Physiol B: Biochem Mol Biol 165(2):106–113 Fu YS, Shi ZY, Mi W, Zhang JL, Jia L, Chen XW (2011) Identification and differential expression of microRNAa during metamorphosis of the Japanese flounder (Paralichthys olivaceus). PLoS One 6(7):e22957 Fukuhara O, Fushimi T (1988) Fin differentiation and squamation of artificially reared grouper, Epinephelus akaara. Aquaculture 69:379–386 Galay-Burgos M, Power DM, Llewellyn L, Seeney GE (2008) Thyroid hormone receptor expression during metamorphosis of Atlantic halibut (Hippoglossus hippoglossus). Mol Cell Endocrinol 281:56–63 Gehringer JW (1959) Early development and metamorphosis of the ten-pounder. Fish Bull 155: 615–647 Gomes AS, Alves RN, Rønnestad I, Power DM (2015) Orchestrating change: The thyroid hormones and GI-tract development in flatfish metamorphosis. Gen Comp Endocrinol 220:2–12 Hiroi J, Sakakura Y, Tagawa M, Seikai T, Tanaka M (1997) Developmental Changes in Low-Salinity Tolerance and Responses of Prolactin, Cortisol and Thyroid Hormones to Low-Salinity Environment in Larvae and Juveniles of Japanese Flounder, Paralichthys olivaceus. Zool Sci 14:987–992 Hotta Y, Aritaki M, Tagawa M, Tanaka M (2001) Changes in tissue thyroid hormone levels of metamorphosing spotted halibut Verasper variegatus reared at different temperatures. Fish Sci 67(6):1119–1124 Huang L, Schreiber AM, Soffientino B, Bengtson DA, Specker JL (1998) Metamorphosis of Summer Flounder (Paralichthys dentatus): Thyroid Status and the Timing of Gastric Gland Formation. J Exp Zool 280:413–420 Hussain NA, Higuchi M (1980) Larval rearing and development of the brown spotted grouper, Epinephelus tauvina (Forskål). Aquaculture 19:339–350

References

33

Imura K, Takatsu T, Nanjo N, Kimura O, Takahashi T (2004) Spatial distribution of brown sole Pseudopleuronectes herzensteini eggs and larvae in Mutsu Bay, Japan. Nippon Suisan Gakkaishi 70:39–47. (in Japanese with English abstract) Inui Y, Miwa S (1985) Thyroid hormone induces metamorphosis of flounder larvae. Gen Comp Endocr 60:450–454 Inui Y, Miwa S (2012) Metamorphosis of flatfish (Pleuronectiformes). In: Dufour S, Rousseau K, Kapoor BG (eds) Metamorphosis in fish. Taylor & Francis Group, pp 107–153 Inui Y, Tagawa M, Miwa S, Hirano T (1989) Effects of bovine TSH on the tissue thyroxine level and metamorphosis in prometamorphic flounder larvae. Gen Comp Endocrinol 74(3):406–410 Inui Y, Yamano K, Miwa S (1995) The role of thyroid hormone in tissue development in metamorphosing flounder. Aquaculture 135(1–3):87–98 Isorna E, Obregon MJ, Calvo RM, Vázquez R, Pendón C, Falcón J, Muñoz-Cueto JA (2009) Iodothyronine deiodinases and thyroid hormone receptors regulation during flatfish (Solea senegalensis) metamorphosis. J Exp Zool B Mol Dev Evol 312B:231–246 Itoh K, Watanabe K, Wu X, Suzuki T (2010) Three members of the iodothyronine deiodinase family, dio1, dio2 and dio3, are expressed in spatially and temporally specific patterns during metamorphosis of the flounder, Paralichthys olivaceus. Zool Sci 27(7):574–580 Joh M, Matsuda T, Satoh N, Tanaka N, Ueda Y (2011) Otolith microstructure of brown sole Pseudopleuronectes herzensteini: validation of daily ring formation and the occurrence of microstructure denoting metamorphosis. Fish Sci 773. https://doi.org/10.1007/s12562-0110382-3 Jones A (1972) Studies on egg development and larval rearing of turbot, Scophthalmus maximus L., and brill, Scophthalmus rhombus L., in the laboratory. J Mar Biol Assoc U K 52:965–986 Keefe M, Able KW (1993) Patterns of metamorphosis in summer flounder, Paralichthys dentatus. J Fish Biol 42:713–728 Keith P, Hoareau T, Lord C, Ah-Yane O, Gimonneau G, Robinet T, Valade P (2008) Characterisation of post-larval to juvenile stages, metamorphosis and recruitment of an amphidromous goby, Sicyopterus lagocephalus (Pallas) (Teleostei: Gobiidae: Sicydiinae). Mar Freshw Res 59: 876–889 Kim YJ, Zuo P, Manley JL, Baker BS (1992) The drosophila RNAbinding protein RBP1 is localized to transcriptionally active sites of chromosomes and shows a functional similarity to human splicing factor ASF/SF2. Genes Dev 6:2569–2579 Kitajima C, Sato T, Kawanishi M (1967) On the effect of thyroxine to promote the metamorphosis of a conger eel. Bull Jpn Soc Sci Fish 33:919–922 Klaren PHM, Wunderink YS, Yúfera M, Mancera JM, Flik G (2008) The thyroid gland and thyroid hormones in Senegales sole (Solea senegalensis) during early development and metamorphosis. Gen Comp Endocr 155:686–694 Krainer AR, Mayeda A, Kozak D, Binns G (1991) Functional expression of cloned human splicing factor SF2: homology to RNA-binding proteins, U1 70K, and Drosophila splicing regulators. Cell 66:383–394 Li X, Hu H, Li R, Wang Z, Qi J, Wang Z (2020) The role of miR-92 in regulating early development and metamorphosis of Japanese flounder Paralichthys olivaceus. Genes Genet Syst 95(1):1–10 Llewellyn L, Nowell MA, Ramsurn VP, Wigham T, Sweeney GE, Kristjánsson B, Halldórrson Ó (1999) Molecular cloning and developmental expression of the halibut thyroid hormone receptor-a. J Fish Biol 55:148–155 Manchado M, Infante C, Rebordinos L, Canñavate JP (2009) Molecular characterization, gene expression and transcriptional regulation of thyroid hormone receptors in Senegalese sole. Gen Comp Endocr 160:139–147 Manzon R, Manzon L (2017) Lamprey metamorphosis: thyroid hormone signaling in a basal vertebrate. Molecul Cell Endocrinol 459:28–42 Marchand O, Duffraisse M, Triqueneaux G, Safi R, Laudet V (2004) Molecular cloning and developmental expression patterns of thyroid hormone receptors and T3 target genes in the

34

1

General Introduction of Flatfish Metamorphosis

turbot (Scophtalmus maximus) during post-embryonic development. Gen Comp Endocrinol 135:345–357 Markle DF, Harris PM, Toole CL (1992) Metamorphosis and an overview of early-life-history stage in Dover sole Microstomus pacificus. Fishery Bulletin USA 90(2):285–301 Markle DF, Olney JE (1990) Systematics of the Pearlfish (Pisces: Carapidae). Bull Mar Sci 47:269– 410 Martinez GM, Bolker JA (2003) Embryonic and larval staging of summer flounder (Paralichthys dentatus). J Morphol 25:162–176 Martínez-Lagos R, Gracia-López V (2009) Morphological development and growth patterns of the leopard grouper Myceroperca rosacea during larval development. Aquac Res 41:120–128 McMenamin SK, Parichy DM (2013) Metamorphosis in Teleosts. Curr Top Dev Biol 103:127–165 Minami T (1982) The early life history of a flounder Paralichthys olivaceus. Bull Jpn Soc Sci Fish 48:1581–1588 Miranda KC, Huynh T, Tay Y, Ang YS, Tam WL, Thomson AM, Lim B, Rigoutsos I (2006) A pattern-based method for the identification of microRNA binding sites and their corresponding heteroduplexes. Cell 126(6):1203–1217 Miwa S, Inui Y (1987a) Effects of various doses of thyroxine and triiodothyronine on the metamorphosis of flounder (Paralichthys olivaceus). Gen Comp Endocr 67:356–363 Miwa S, Inui Y (1987b) Histological changes in the pituitary-thyroid axis during spontaneous and artificially-induced metamorphosis of larvae of the flounder Paralichthys olivaceus. Cell Tissue Res 249:117–123 Miwa S, Inui Y (1991) Thyroid hormones stimulates the shift of erythrocyte populations during metamorphosis of the flounder. J Exp Zool 259:222–228 Miwa S, Tagawa M, Inui Y, Hirano T (1988) Thyroxine surge in metamorphosing flounder larvae. Gen Comp Ednocr 70(1):158–163 Miwa S, Yamano K, Inui Y (1992) Thyroid hormone stimulates gastric development in flounder larvae during metamorphosis. J Exp Zool 261:424–430 Moser HG (1981) Morphological and functional aspects of marine fish larvae. In: Lasker R (ed) Marine fish larvae. Washington Sea Grant Program, pp 99–131 Nelson JS, Grande TC, Wilson MVH (2016) Fishes of the world, 5th edn. John Wiley & Sons, Inc, Hoboken, NJ Okada N, Morita T, Tanaka M, Tagawa M (2005) Thyroid hormone deficiency in abnormal larvae of the Japanese flounder Paralichthys olivaceus. Fish Sci 71:107–114 Ozaki Y, Okumura H, Kazeto Y, Ikeuchi T, Ijiri S, Nagase M, Adachi S, Yamauchi K (2000) Developmental changes in pituitary-thyroid axis, and formation of gonads n leptocephali and glass eels of Anguilla spp. Fish Sci 66:1115–1122 Parmentier E, Lecchini D, Lagardere F, Vandewalle P (2004b) Ontogenic and ecological control of metamorphosis onset in a carapid fish, Carapus homei: experimental evidence from vertebra and otolith comparisons. J Exp Zool 301A:617–628 Parmentier E, Lecchini D, Vandewalle P (2004a) Remodelling of the vertebral axis during metamorphic shrinkage in the pearlfish. J Fish Biol 64:159–169 Pfeiler E (1984) Changes in water and salt content during metamorphosis of larval bonefish (Albula). Bull Mar Sci 34:177–184 Pfeiler E (1986) Towards an explanation of the developmental strategy in leptocephalus larvae of marine teleost fishes. Environ Biol Fish 15:3–13 Pfeiler E (2008) Physiological ecology of developing bonefish larvae. In: Ault JS (ed) Biology and management of the world tarpon and bonefish fisheries. CRC Press, Boca Raton London New York, pp 179–193 Pinto W, Rodrigues V, Dinis MT, Aragão C (2010) Can dietary aromatic amino acid supplementation be beneficial during fish metamorphosis. Aquaculture 310(1–2):200–205 Power DM, Llewellyn L, Faustino M, Nowell MA, Björnsson BTh, Einarsdottir IE, MCanario AV, Sweeney GE, 2001. Thyroid hormones in growth and development of fish. Comp Biochem Physiol Part C Toxicol Pharmacol, 130(4):447–459

References

35

Power DM, Einarsdóttir IE, Pittman K, Sweeney GE, Hildahl J (2008) The molecular and endocrine basis of flatfish metamorphosis. Rev Fish Sci 16(S1):93–109 Qin Z, Lin Y, Zhang Y, Liu D, Huang R, He W (2008) Study on the early development of southern flounder Paralichthys lethostigma. J Oceanography in Taiwan Strait 27(4):472–481. (in Chinese) Ribeiro ARA, Ribeiro L, Sæle Ø, Hamre K, Dinis MT (2012) Selenium supplementation changes glutathione peroxidase activity and thyroid hormone production in Senegalese sole (Solea senegalensis) larvae. Aquac Nutr 18(5):559–567 Ryland JS (1966) Observations on the development of larvae of the plaice, Pleuronectes platelssa L, in aquaria. J Conseil 30:177–195 Sæle Ø, Solbakken JS, Watanabe K, Hamre K, Power D, Pittman K, 2004. Staging of Atlantic halibut (Hippoglossus hippoglossus L.,) from first feeding through metamorphosis, including cranial ossification independent of eye migration. Aquaculture, 239(1–4):445–465 Sato M, Yasuda F (1980) Metamorphosis of the leptocephali of the ten-pounder, Elops hawaiensis, from Ishigaki Islang, Japan. Japanese J Ichthyol 26:315–324 Schreiber AM (2013) Flatfish: an asymmetric perspective on metamorphosis. Curr Top Dev Biol 103:167–194 Schreiber AM (2006) Asymmetric craniofacial remodeling and lateralized behavior in larval flatfish. J Exp Biol 209:610–621 Schreiber AM, Specker JL (1998) Metamorphosis in the Summer Flounder (Paralichthys dentatus): Stage-Specific Developmental Response to Altered Thyroid Status. Gen Comp Endocrinol 111(2):156–166 Schreiber AM, Wang X, Tan Y, Sievers Q, Sievers B, Lee M, Burrall K (2010) Thyroid hormone mediates otolith growth and development during flatfish metamorphosis. Gen Comp Endocrinol 169:130–137 Schreiber AM, Specker JL (2000) Metamorphosis in the summer flounder, Paralichthys dentatus: thyroidal status influences gill mitochondria-rich cells. Gen Comp Endocrinol 117(2):238–250 Screaton GR, Caceres JF, Mayeda A, Bell MV, Plebanski M, Jackson DG, Bell JI, Krainer AR (1995) Identification and characterization of three members of the human SR family of premRNA splicing factors. EMBO J 14(1995):4336–4349 Shao C, Bao B, Xie Z, Chen X, Li B, Jia X, Yao Q, Ortí G, Li W, Li X, Hamre K, Xu J, Wang L, Chen F, Tian Y, Schreiber AM, Wang N, Wei F, Zhang J, Dong Z, Gao L, Gai J, Sakamoto T, Mo S, Chen W, Shi Q, Li H, Xiu Y, Li Y, Xu W, Shi Z, Zhang G, Power DM, Wang Q, Schartl M, Chen S (2017) The genome and transcriptome of Japanese flounder provide insights into flatfish asymmetry. Nat Genet 49:119–124 Shial JC, Hwang PP (2006) Thyroid hormones are necessary for the metamorphosis of tarpon Megalops cyprinoides leptocephali. J Exp Mar Biol Ecol 331:121–132 Shields RJ, Bell JG, Luizi FS, Gara B, Bromage NR, Sargent JR (1999) Natural copepods are superior to enriched Artemia nauplii as feed for halibut larvae (Hippoglossus hippoglossus) in terms of survival, pigmentation and retinal morphology: relation to dietary essential fatty acids. J Nutr 129:1186–1194 Si Y, Li H, Gong X, Bao B (2021) Isolation of prolactin gene and its differential expression during metamorphosis involving eye migration of Japanese flounder Paralichthys olivaceus. Gene 780: 145522 Soffientino B, Specker JL (2003) Age-dependent changes in the response of the stomach to thyroidal signaling in developmentally arrested larval summer flounder. Gen Comp Endocrinol 134(3):237–243 Solbakken JS, Norberg B, Watanabe K, Pittman K (1999) Thyroxine as a mediator of metamorphosis of Atlantic halibut (Hippoglossus hippoglossus L.). Environ Biol Fish 56:53–65 Tagawa M, Aritaki M (2005) Production of symmetrical flatfish by controlling the timing of thyroid hormone treatment in spotted halibut Verasper variegatus. Gen Comp Endocr 141:184–189

36

1

General Introduction of Flatfish Metamorphosis

Tagawa M, Miwa S, Inui Y, de Jesus EG, Hirano T (1990) Changes in thyroid hormone concentrations during early development and metamorphosis of the flounder Paralichthys olivaceus. Zool Sci 7:93–96 Taillebois L, Keith P, Valade P, Torres P, Baloche S, Dufour S, Rousseau K (2011) Involvement of thyroid hormones in the control of larval metamorphosis in Sicyopterus lagocephalus (Teleostei: Gobioidei) at the time of river recruitment. Gen Comp Endocr 173:281–288 Takai T (1959) Studies on the morphology, ecology ad culture of the important apodal fishes, Muraeneson cineres (Forskål) and Conger myriaster (Brevoort). J Shimonoseke College Fisheries 8:209–555 Tanaka H, Kagawa H, Ohta H, Unuma T, Nomura K (2003) The first production of glass eel in captivity: fish reproductive physiology facilitates great progress in aquaculture. Fish Physiol Biochem 28:493–497 Tanaka M, Tanangonan JB, Tagawa M, de Jesus EG, Nishida H, Nishida H, Isaka M, Kimura R, Hirano T (1995) Development of the pituitary, thyroid and interrenal gland and applications of endocrinology to the improved rearing of marine fish larvae. Aquaculture 135(1–3):111–126 Tay HC, Goh J, Yong AN, Lim HS, Chao TM, Chou R, Lam TJ (1994) Effect of thyroid hormone on metamorphosis in greasy grouper, Epinephelus tauvina. Singap J Prim Ind 22(1):35–38 Tsukamoto Y, Okiyama M (1997) Metamorphosis of the pacific tarpon, Megalops cyprinoides (Elopiformes, Megalopidae) with remarks on development patterns in the Elopomorpha. Bull Mar Sci 60:23–26 Wang N, Wang R, Wang R, Tian Y, Shao C, Jia X, Chen S (2017) The integrated analysis of RNA-seq and microRNA-seq depicts miRNA-mRNA networks involved in Japanese flounder (Paralichthys olivaceus) albinism. PLoS One 12(8):e0181761 Wan R, Jiang Y, Zhuang Z (2004) Morphological and developmental characters at the early stages of the tonguefish Cynoglossus semilaevis. Acta Zool Sin 50(1):91–102 Wang X, Tan Y, Sievers Q, Sievers B, Lee M, Burrall K, Schreiber AM (2011) Thyroid hormoneresponsive genes mediate otolith growth and development during flatfish metamorphosis. Comp Biochem Physiol Part A Mol Integrat Physiol 158:163–168 Xie C, Xu S, Yang L, Ke Z, Xing J, Gai J, Gong X, Xu L, Bao B (2011) mRNA/microRNA profile at the metamorphic stage of olive flounder (Paralichthys olivaceus). Comp Funct Genom 2011: 256038 Yamano K, Araki K, Sekikawa K, Inui Y (1994) Cloning of thyroid hormone receptor genes expressed in metamorphosing flounder. Dev Genet 15(4):378–382 Yamano K, Inui Y (1995) cDNA cloning of thyroid hormone receptor b for the Japanese flounder. Gen Comp Endocrinol 99:197–203 Yamano K, Miwa S (1998) Differential gene expression of thyroid hormone receptor alpha and beta in fish development. Gen Comp Endocri 109:75–85 Yamano K, Miwa S, Obinata T, Inui Y (1991a) Thyroid hormone regulates developmental changes in muscle during flounder metamorphosis. Gen Comp Endocrinol 81(3):464–472 Yamano K, Nomura K, Tanaka H (2007) Development of thyroid gland and changes in thyroid hormone levels in leptocephali of Japanese eel (Anguilla japonica). Aquaculture 270:499–504 Yamano K, Tagawa M, de Jesus EG, Hirano T, Miwa S, Inui Y (1991b) Changes in whole body concentrations of thyroid hormones and cortisol in metamorphosing conger eel. J Comp Physiol B 161:371–375 Yoo JH, Takeuchi T, Seikai T (2008) Sensitivity of the metamorphic events and morphogenesis of Japanese flounder Paralichthys olivaceus during larval development to thyroxine. Fish Sci 66(5):846–850 Yoo JH, Takeuchi T, Tagawa M, Seikai T (2000) Effect of Thyroid Hormones on the Stage-specific Pigmentation of the Japanese Flounder Paralichthys olivaceus. Zool Sci 17(8):1101–1106 Youson JH, Manzon RG (2012) Lamprey metamorphosis. In: Dufour S, Roussean K, Kapoor BG (eds) Metamorphosis in fish. Taylor & Francis Group, New York

References

37

Youson JH (1988) First metamorphosis. In: Hoar WS, Randall DJ (eds) Fish physiology, vol. XI. The physiology of developing fish, part B. Viviparity and posthatching juveniles. Academic Press, San Diego, pp 135–196 Zahler AM, Lane WS, Stolk JA, Roth MB (1992) SR proteins: a conserved family of pre-mRNA splicing factors. Genes Dev 6(1992):837–847 Zhang H, Fu Y, Su Y, Shi Z, Zhang J (2015) Identification and expression of HDAC4 targeted by miR-1 and miR-133a during early development in Paralichthys olivaceus. Comp Biochem Physiol B: Biochem Mol Biol 179:1–8 Zhang H, Fu Y, Shi Z, Su Y, Zhang J (2016a) miR-17 is involved in Japanese Flounder (Paralichthys olivaceus) development by targeting the Cdc42 mRNA. Comp Biochem Physiol B: Biochem Mol Biol 191:163–170 Zhang J, Shi Z, Cheng Q, Chen X (2011) Expression of insulin-like growth factor I receptors at mRNA and protein levels during metamorphosis of Japanese flounder (Paralichthys olivaceus). Gen Comp Endocrinol 173(2011):78–85 Zhang WT, Liu K, Xiang JS, Zhang LY, Liu WJ, Dong ZD, Li YZ, Li HL, Chen SL, Wang N (2016b) Molecular cloning, expression of, and regulation by thyroid-hormone receptor α A in the half-smooth tongue sole Cynoglossus semilaevis during metamorphosis. J Fish Biol 88(5): 1693–1707 Zhu J, Zhang X, Gao T, Liu G, Yang Y (2002) The metamorphosis of turbot Scophthamus maximus and morphological observation on melanophores in larval skin. J Fish China 26(3):193–200. (in Chinese)

Chapter 2

Developmental Relationships among Metamorphic Events

Abstract The relationships between major metamorphic events were discussed, namely, the relationship between cranial deformation and eye migration, eye migration and body swim-posture change, eye migration and dorsal fin development, eye migration and left/right asymmetrical pigmentation, and left/right asymmetrical pigmentation and body swim-posture change. Keywords Metamorphic events · Cranial deformation · Eye migration · Body swim-posture change · Asymmetric pigmentation · Dorsal fin

2.1 2.1.1

Relationship between Cranial Deformation and Eye Migration Cranial Bones Deform Gradually During Metamorphosis in Flatfish

During metamorphosis, some cranial bones deform gradually. We observed the development of some cranial bones during Senegalese sole metamorphosis, Solea senegalensis, through using whole-mount skull staining (Fig. 2.1). Before metamorphosis (12 days after hatching, DAH), no evident asymmetry was found in the cranial bones. After eye migration in Stage E (14 DAH), the premaxillaries, maxillaries, and dentaries showed slight left-right asymmetry, and ossification was initiated. There are few differences between the shape of both lateral ethmoid. Because the eye evidently migrated upward (Stage F, 15 DAH), the left frontal bone started regressing, and the lateral ethmoid on the left side enlarged more quickly. The front parts of the premaxillaries, maxillaries, and dentares were ossified (red in Figure 2.1c), and the rear part was cartilage (blue). The entopterygoids showed left-right asymmetry; the right side was a little smaller than the left side. In this stage, the parasphenoid appeared as a bone. At the climax of metamorphosis (Stage G, 17 DAH), the left frontal bone twisted toward the right side. Some bones, such as premaxillaries, maxillaries, dentares, ectopterygoid, and parasphenoid, ossified further. In stage H (19 DAH), the left and right front bones were located more closely. © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_2

39

40

2

Developmental Relationships among Metamorphic Events

Fig. 2.1 Skull staining for metamorphosing Senegalese sole. (a) pre-metamorphosis, 12 DAH. (A1), right view. (A2), frontal view. (A3), left view. (b) stage E, 14 DAH. (B1), right view. (B2), frontal view. (B3), left view. (c) stage F, 15 DAH. (C1), right view. (C2), frontal view. (C3), left view. (d) stage G, 17 DAH. (D1), right view. (D2), frontal view. (D3), left view. (e) stage H, 19 DAH. (E1), right view. (E2), frontal view. (E3), left view. (f) stage I, 21 DAH. (F1), right view. (F2), frontal view. (F3), left view. (g) post-metamorphosis, 24 DAH. (G1), right view. (G2), frontal view. (G3), left view. (h) post-metamorphic juvenile, 44 DAH. (H1), right view. (H2), dorsal view. (H3), left view. f frontal; le lateral ethmoid; mes mesethmoid; pmx premaxillary; mx maxillary; dent dentary; entp entopterygoid; ectp ectopterygoid; psp parasphenoid; v vomer

The front part of the mesethmoid became sharper. When the eye migrated over the dorsal middle line (Stage I, 21 DAH), the left frontal bone bent more severely and was located on the right frontal bone. Immediately after metamorphosis (24 DAH), some bones, such as premaxillaries, maxillaries, dentares, ectopterygoid, and parasphenoid, were stained red, whereas others were stained blue or no color (Fig. 2.1g). By 44 DAH, ossification of all cranial bones was completed. The time series for cranial bone ossification and left/right asymmetry is provided in Table 2.1. The major bones involved in asymmetric neurocranial remodeling have been postulated to be related to eye migration, for example, frontal bones, lateral ethmoids, supraorbital bars, and pseudomesial bar (or termed “postlateral ethmoid” by Hoshino 2006) (Schreiber 2013). The asymmetric growth of the frontal bones twists in the future ocular direction. The frontals deform progressively during metamorphosis (Wagemans et al. 1998). The summer flounder (Paralichthys lethostigma) showed slight asymmetry, such as the thinner right frontal bone and the smaller parietal bone at the start of late pre-metamorphosis These asymmetries are expanded further in late

2.1

Relationship between Cranial Deformation and Eye Migration

41

Table 2.1 Characterization of some cranial bones during metamorphosis in the Senegalese sole Metamorphic

Pre-M

E

F

G

H

I

Post-M

stage

(12 DAH)

(14 DAH)

(15 DAH)

(17 DAH)

(19 DAH)

(21 DAH)

(24

Post-M (44 DAH)

DAH) Frontal bones

/

Lateral ethmoid Premaxillary Maxillary Dentary Entopterygoid Ectopterygoid

\

\

Parasphenoid Vomer

\

Mesethmoid

Note: / no formation yet or regression; bone;

start ossification;

connective tissue;

ossification at the edge of the bone;

cartilage;

start left-right asymmetry.

pre-metamorphosis. During pro-metamorphosis, the right frontal is substantially thinner than the left, and both frontal and parietal bones deform slightly to the left. The frontal and parietal bones twist dramatically to the left from early to late climax. By late climax, the frontal bones appear similarly condensed (Schreiber 2006). The lateral ethmoid element of the blind side is hypertrophied compared to its moderate size on the ocular side. Brewster (1987) postulated that the asymmetrical cranium results from the relocation of the anterior blind side frontal to the ocular side and are accentuated by the enlargement of the blind side lateral ethmoid. The right lateral ethmoid grows to support the migrating eye during metamorphosis in the turbot, Scophthalmus maximus (Wagemans et al. 1998). During pro-metamorphosis in the summer flounder, The right lateral ethmoid of the summer flounder becomes visible during pro-metamorphosis, and further elongates disproportionately compared to the left during climax, with the right anterior parietal barb larger and protruding more prominently than the left (Schreiber 2006). Brewster (1987) postulated that the asymmetry of Pleuronectiformes cranium is mainly established by relocation of the anterior part of the frontal bone from the blind side to the ocular side and by the enlargement of the lateral ethmoid on the blind side. The hypothesis was partly supported by other researchers (Saele et al. 2006a, b; Schreiber 2006; Wagemans et al. 1998; Wagemans and Vandewalle 2001). Sæle et al. (2006b) thought that the first structures to display differentiated growth during larval development in the Atlantic halibut (Hippoglossus hippoglossus) are the dorsomedial parts of the ethmoid plate, and they are candidates for the driving

42

2

Developmental Relationships among Metamorphic Events

force in the twisting process. The next structures to display asymmetric growth related to eye migration are the frontal processes, which are found superficially between the eyes and undergo dramatic remodeling. Our laboratory has shown that deformation of frontal bones during metamorphosis depends on eye migration in the Japanese flounder, Chinese tongue sole (Cynoglossus semilaevis), and Senegalese sole (Bao et al. 2011; Sun et al. 2015). Okada et al. (2001) disagreed with the role of lateral ethmoids proposed by Brewster (1987); they proposed that the pseudomesial bar is especially important for eye migration. The pseudomesial bar develops from the “skin thickness” beneath the eye on only the blind side and grows dorsally (Okada et al. 2001). In the summer flounder, the pseudomesial bar is observed to form under only the movable eye, first becoming visible on the right side after the eye migration is almost complete (Schreiber 2006). The pseudomesial bar, termed “postlateral ethmoid” by Hoshino (2006), is the deposition of osteoblasts within a dense cell layer to form the anterior flange of the blind side frontal (dermal bone), a peculiar bone present in only flatfishes. The formation of the pseudomesial bar must be related to eye migration because it forms after the eye migrates over the dorsal midline. The pseudomesial bar was fully developed in thyroxine (T4)-treated and normal metamorphic Japanese flounders, whereas the pseudomesial bar did not show any marked changes in thiourea-treated flounders (Okada et al. 2005). Other bones, such as supraorbital bars, supraorbital canal, trabecular cartilage, and parasphenoid, exist asymmetrically after metamorphosis in some flatfish species. The left and right cartilaginous supraorbital bars have differential resorption (Okada et al. 2001; Schreiber 2006; Wagemans et al. 1998). In the summer flounder, the right supraorbital bar appears thinner earlier than the left since pro-metamorphosis (Schreiber 2006). Because these bones are not relatively close to the eye, they are thought to not play an essential role in eye migration (Okada et al. 2001). Metamorphosis seems to hardly affect the cartilaginous skeleton. In turbot, the only metamorphosis-linked asymmetry to appear during the development of the chondrocranium is the early resorption of the right taenia marginalis just before the right eye begins its migration to the left (Wagemans et al. 1998).

2.1.2

Cranial Asymmetry in Different Eye Variants of Flatfishes

Actually, it is hard to discern which occurs a little earlier: cranial deformation or eye migration. Flatfish variants with different eye locations should be useful to understand the relationship between cranial asymmetry and eye migration. We investigated eye variants in an artificial population of the Senegalese sole, which has typically dextral eye migration (Dinis et al. 1999). Four types of Senegalese sole have been described according to the direction of eye migration, final position of the

2.1

Relationship between Cranial Deformation and Eye Migration

43

Fig. 2.2 Different variants involved in eye migration in an artificial Senegalese sole population (Xing et al. 2020). (a) Normal developed juvenile with the left eye having migrated to the target location (b) Type 1-A variant. (c) Type 1-B variant. (d) Type 1-C variant. (e) Type 1-C′ variant. (f) Type 2-A variant. (g) Type 2-B variant. (h) Type 3 variant. (i) Type 4 variant. The letter with a suffix 1 represents Right view and 2 represents Left view. Bars, 1.0 mm

migrating eye, and settling sidedness (Xing et al. 2020). Type 1: left eye migrates, namely, Type 1-A (left eye moves just over the dorsal midline, with left body laid down), Type 1-B (left eye stops at the dorsal midline, with left body laid down), Type 1-C (left eye stops below the dorsal midline, with left body laid down), and Type 1-C′ (left eye stops below the dorsal midline, with right body laid down). Type 2: right eye migrates, namely, Type 2-A (right eye migrates over the dorsal midline and very close to the target location, with right body laid down) and Type 2-B (right eye stays below the dorsal midline, with right body laid down). Type 3: both eyes migrate to the dorsal midline, with left body laid down. Type 4: No eyes migrate, with left body laid down (Fig. 2.2). In the Senegalese sole wild type, some bones anteriorly located in the head are observed with apparent asymmetry on both sides, including the frontal bones and lateral ethmoid, premaxillary, maxillary, dentary, lachrymal, entopterygoid, and

44

2

Developmental Relationships among Metamorphic Events

Fig. 2.3 X-ray of Senegalese sole variants with different eye locations. (a) Wild type (b) Type 4; (c) Type 2-A; (d) Type 1-A; (e) Type 1-B; (f) Type 1-C. The letter with a suffix 1 represents Right view and 2 represents Left view

ectopterygoid bones. Likewise, Type 2-A (reverse eye migration) variants also show asymmetrical bones, but have mirror images (Fig. 2.3). Some pairs of bones, such as the premaxillary, maxillary, and dentary, present lesser left-right asymmetry than those of the wild type (Fig. 2.4). This differential left-right asymmetric degrees may be caused by the different distances of eye movement. Type 1-A and Type 1-B variants have very similar asymmetrical forms of the three pairs of bones with wild type, resulting from the left eye moving on or over the dorsal midline (Fig. 2.4). Type 1-C and Type 4 have no or minor eye migration, causing almost left-right symmetrical bones of the three pairs (Fig. 2.4). However, this assumption is clearly inapplicable to entopterygoids, which present left-right asymmetry in both wild type and Types 1-A, 1-B, 1-C, and 4 variants (Xing et al. 2020). In the Senegalese sole, left-right asymmetry of the frontal bone and lateral ethmoids is associated with migration distance of the eye, and left-right asymmetric degree of the jaw, including the premaxillary, maxillary, and dentary bones, depends on eye migration. Other studies have shown that bilaterally symmetrical flatfish variants that do not undergo eye migration lack the presence of a postlateral ethmoid and retain bilateral symmetry in all other cranial components (Okada et al. 2001, 2003; Saele et al.

2.1

Relationship between Cranial Deformation and Eye Migration

45

Fig. 2.4 Skull staining for Senegalese sole variants with different eye positions (Xing et al. 2020). (a) Wild type; (b) Type 4; (c) Type 2-A; (d) Type 1-A; (e) Type 1-B; (f) Type 1-C. The letter with a suffix 1 represents Right view and 2 represents Left view. Bars, 1.0 mm; f frontal; le lateral ethmoid; mes mesethmoid; pmx premaxillary; mx maxillary; dent dentary; entp entopterygoid; ectp ectopterygoid. Lines represent pairs of bones on the ocular side, and arrows represent pairs of bones on the blind side. Calcified bone is red, and cartilage is blue

2006a, b; Schreiber 2006). For example, both frontals are symmetrical and there is no frontal bend in bilaterally symmetric southern flounder (Schreiber 2006). Kyle (1921) proposed that eye migration causes the twist of the frontals, which finally leads to cranial asymmetry. Later, more evidence was found. Schreiber (2006) reported that asymmetrical skull development alone is not enough to drive eye migration in the southern flounder. Sæle et al. (2006b) believed that skull remodeling is caused by eye movement. In Chap. 5, we have discussed in detail how deformation of the frontal bones is induced by the migrating eye.

46

2.2 2.2.1

2

Developmental Relationships among Metamorphic Events

Relationship Between Eye Migration and Body Swim-Posture Changes Development of Lateralized Behavior During Flatfish Metamorphosis

Schreiber (2006) described the normal development of lateralized behavior during metamorphosis in the southern flounder, a sinistral flatfish. Early pre-metamorphic larvae swim in the upright posture, and late pre-metamorphic larvae predominantly swim with a 3–6° sustained tilt to the right, in the water, occasionally settling to the bottom on their future “blind” side. By the start of eye migration, pro-metamorphic larvae swim with a 10–20° right tilt. The tilt increases up to 17–26° by early climax (right eye is located halfway to the dorsal midline), shifts abruptly to a 50–80° tilt by late climax (right eye is close to the dorsal midline), and the fishes swim virtually parallel to the bottom (80–90° tilt) by the juvenile stage (right eye has moved to the dorsal midline). During metamorphosis, the flatfish spends less time swimming and more time settling. Thus, metamorphosing larvae are associated with the epibenthic or benthic community and their diet is composed of benthic or epibenthic prey items, so they should spend time on the sea bottom (Geffen et al. 2007). Settlement and metamorphosis coincide in most flatfish species, especially in the marbled sole (Pseudopleuronectes yokohamae) in which settling begins along with the start of eye migration, and the development of most of the traits associated with metamorphosis is completed after settlement (Fukuhara 1988; Joh et al. 2005). However, metamorphosis and settlement are thought to be two separate processes (Geffen et al. 2007). Schreiber (2006) suggested that tilting and settling behaviors occur independently of asymmetric eye position. He reported that lateralized feeding and sustained tilted swimming behaviors are apparent prior to eye migration, as early as the start of late pre-metamorphosis, and correspond with post-metamorphic sidedness. Extreme examples are the Dover sole (Microstomus pacificus) and slime flounder (Microstomus achne), where the metamorphosed individuals may remain pelagic for many months (Markle et al. 1992; Aritaki and Tanaka 2003).

2.2.2

Variants with Different Activities in the Artificial Senegalese Sole Population

To understand the relationship between eye location and body swim posture in flatfish, we checked swimming behaviors in Senegalese sole variants with different eye positions in a glass tank using a digital camera (Fig. 2.2, Xing et al. 2020). Postmetamorphic juveniles with different eye migration distance show various swimming behaviors. Normal-developed juveniles lay on the bottom with their left blindside most of the time (94.1%). Type 1 and Type 2 variants had less time lying on the bottom and more time swimming upwards in the water column. Type

2.2

Relationship Between Eye Migration and Body Swim-Posture Changes

47

Table 2.2 Variants with different activities in the artificial Senegalese sole population

Type Normal Type 1 variant

Type 1-A Type 1-B Type 1-C Total Type Type 2 variant 2-A Type 2-B Total Type 3 variant Type 4 variant

Number of individuals 8 2

Total video record time (in seconds) 511 269

Percentage of swimming time in water column 5.9% 2.6%

Percentage of rest time at the bottom 94.1% 97.4%

4

203

56.7%

43.3%

5

235

28.9%

71.1%

11 11

707 537

26.9% 18.1%

73.1% 81.9%

1

35

77.1%

22.9%

12

572 85 51

21.7% 84.7% 94.1%

78.3% 15.3% 5.9%

3 variants, with both eyes close to the dorsal midline, spent most of the time (84.7%) in the water column and only 15.3% of the time at the bottom. Type 4 variants, with almost no eye migration, spent 94.1% of the time swimming. Type 1-A, with eye migrated over the dorsal midline, spent 97.4% of the time at the bottom, whereas Type 1-C, whose eye did not reach the dorsal midline, spent less time (71.1%) at the bottom (Table 2.2). In conclusion, incomplete eye migration, especially the eyes on both sides (Type 3 and 4) may influence swimming behavior, which would cause the variants cannot live well in the wild (Fig. 2.5). Because they spent more time in the water and cannot adapt well to a benthic lifestyle. In contrast, even though the variants (Type 2-A) had reverse eye migration, they had similar swimming behavior with normal individuals due to their complete eye migration, suggesting they can adapt to a benthic lifestyle well. It is interesting that, in an artificial population of the starry flounder (Platichthys stellatus), asymmetry had a significant effect on the swimming performance of sinistral and dextral flounders (Bergstrom et al. 2019). These data seem to indicate a relationship between eye location and swimming behavior, but do not help in determining the relationship between eye migration and tilting and settling behaviors. However, we found a Type 1-C′ variant in which the left eye stopped under the dorsal midline and the body lay down on the right side (Fig. 2.5); this provides proof that tilting and settling behaviors are independent of asymmetric eye location, which was hypothesized by Schreiber (2006).

48

2

Developmental Relationships among Metamorphic Events

Fig. 2.5 Swimming behaviors of variants from the lab-reared population of the Senegalese sole. (a) normal juvenile at six months of age laid on its left side and spent most of its time on the ground and sucked the tank bottom tightly; (b) Type 1-A variant at six months of age, did not suck the tank bottom tightly; (c) Type 1-B variant at six months of age, swam upward often with bursts of speed. (d) Type 1-C variant at six months of age, swam upward more often and stayed upright much longer in water; (e) Type 2-A variant at six months of age, laid on its right side and spent most of its time on the ground and sucked the tank bottom tightly; (f) Type 2-B variant at 32 DAH, laid on its left side, swam around upright in a counter-clockwise circle in water; (g) Type 4 variant at six months of age, laid on its left side and often swam upright in water with a horizontal or vertical posture. (h) Type 3 variant at 32 DAH, stayed on the bottom on its left side; (i) Type 1-C′ variant at 32 DAH, laid on

2.3

Relationship Between Eye Migration and Dorsal Fin Development

2.3 2.3.1

49

Relationship Between Eye Migration and Dorsal Fin Development Relationship Between Eye Migration and Anterior Extension of the Dorsal Fin

During metamorphosis in different flatfish species, either the eye migrates first and then the dorsal fin extends anteriorly or the dorsal fin extends forward and the eye passes through a slit beneath the fin base and skull (Ahlstrom et al. 1984). Traquair (1865) observed that the anterior dorsal fin rays of metamorphosed flatfish are supported by a limited number of pterygiophores and the extension of the dorsal fin to the snout is due to their elongation. He proposed that the eye migrated before the dorsal fin extended during metamorphosis. Agassiz (1879) believed metamorphosis is accomplished in one of two ways: either the eye migrates before the dorsal fin extends or one eye migrates through the head and beneath the dorsal fin as the dorsal fin extends to the snout. The orbit of the blind side then atrophies, and a new opening forms on the ocular side to accommodate the relocated eye. Cunningham (1892) accepted Agassiz’s view (1879) and further considered that the dorsal fin extends anteriorly after eye migration, thereby preventing a reversal of the condition. Nishikawa (1897) thought the eye migrates over the cranium and below the dorsal fin. During metamorphosis of larval plate fish, Bothus lunatus, the right eye shifts to the left side of the head through a slit formed during the separation of the origin of the dorsal fin base from the cranium (Evseenko 2008). In groups such as psettodids, citharids, scophthalmids, most paralichthyids, and pleuronectids, where the dorsal fin origin in the larva is at the posterior margin of the eye or more rearward, a depression forms in the interocular region and the eye migrates over the dorsal midline anterior to the fin origin. Subsequently, the dorsal fin extends forward to its adult position (except in psettodids) (Ahlstrom et al. 1984; Brewster 1987). In the larvae of bothids and paralichthyid genera Cyclopsetta, Syacium, and Citharichthys (some species), the dorsal fin is attached to the skull anterior to the eye, and the eye migrates through a slit that forms between the fin base and skull during metamorphosis. In some metamorphosing soleids, the dorsal fin projects forward above the snout, and the eye migrates through the space between this protuberance and the skull; subsequently, the fin projection fuses to the skull (Seshappa and Bhimachar 1955, Minami 1981). This type of eye migration may be widespread among cynoglossids (Ahlstrom et al. 1984). In the common sole, Solea solea, when the migrating eye has passed the dorsal midline of the cranium, the anterior proximal pterygiophores of the dorsal fin migrate anteriorly (Brewster

 ⁄ Fig. 2.5 (continued) the right side and swam around upright in a clockwise circle in water. The number in each figure is the frames of the photo/total frames in the whole video

50

2

Developmental Relationships among Metamorphic Events

1987). In Scophthalmidae, as the eyes begin to migrate, simultaneous anterior migration of the proximal pterygiophores of the dorsal fin occurs (Brewster 1987).

2.3.2

Relationship Between Eye Migration and Elongation and Regression of the Dorsal Fin

In some flatfishes, several dorsal rays elongate first during ontogeny, and they gradually regress to the normal length; then, the eye gradually starts to migrate. For example, Leis and Rennis (1983) recorded that spiny halibut, Psettodes erumei (Psettodidae), larvae have 10 early-forming elongated dorsal rays. The sixth dorsal ray in Brachypleura novaezeelandiae (Citharidae) is elongated, and the rays anterior to the dorsal ray are assumed to be elongated. The larvae develop a crest composed of elongated anterior dorsal rays; Cynoglossus has two rays and Symphurus has usually four or five. Bothid larvae develop an elongated second dorsal ray. Bothus lunatus larvae bear a long anterior ray in the dorsal fin (Evseenko 2008). Paralichthyidae includes three genera: Paralichthys, Pseudorhombus, and Cyclopsetta. Larvae of the first two genera have elongated early-forming rays, beginning with the second dorsal ray. In the larvae of Cyclopsetta, the rays forming the dorsal crest are typically longer and stand out more abruptly than those of Paralichthys. The fin ray complement of the crest divides the assemblage into two generic pairs: Citharichthys-Etropus (with two or three elongated rays) and Cyclopsetta-Syacium (8–11 elongated dorsal rays in Cylopsetta and 5–8 in Syacium) (Ahlstrom et al. 1984).

2.4

Relationship Between Eye Migration and Left/Right Asymmetrical Pigmentation

The adult forms of Pleuronectiformes exhibit pronounced asymmetry in their integumental pigmentation after metamorphosis: the ocular side is dark brown, and the blind side is white. This asymmetric pigmentation under normal development is established after metamorphosis (Matsumoto and Seikai 1992). In the artificial Senegalese sole population, variants with different pigmentation were detected (Fig. 2.6). In the Senegalese sole wild type, pigment cells are distributed on the whole right side, but very few or none on the left side; in contrast, pigment cells are distributed only on the whole left side in the reverse eye variant (Fig. 2.6). The same observations have been reported in other normal and reverse eye flatfishes, such as the starry flounder (Hubbs and Kuronuma 1942, Bergstrom 2007, Kang et al. 2012) and European flounder (Platichthys flesus) (Fornbacke et al. 2002; Russo et al. 2012).

2.4

Relationship Between Eye Migration and Left/Right Asymmetrical Pigmentation

51

Fig. 2.6 Different pigmentation patterns in variants with different eye positions from the lab-reared population of the Senegalese sole. (a) normal developed juvenile with left eye at the target location. (b) Type 4 variant, both eyes did not experience migration. (c) Type 3 variant, both eyes experienced migration and finally located close to the dorsal midline. (d) Type 2-A variant (reverse eye variant), only the right eye experienced migration and passed over the dorsal midline and finally located very close to the target site. (e) Type 2-B variant (reverse eye variant), only the right eye experienced migration and did not pass the midline. (f) Type 1-A variant, only the left eye experienced migration and just passed over the dorsal midline. (g) Type 1-B variant, only the left eye experienced migration and finally located on the dorsal midline. (h) Type 1-C variant, only the left eye experienced migration and did not pass the midline. (i) Type 1-C′ variant, only the left eye experienced migration and did not pass the midline, but the body settled on the right side. The letter with a suffix 1 represents Right view and 2 represents Left view. Bars, 1.0 mm

In addition, the pigmentation pattern seems to be related to eye position. When the completeness of the eye migration is higher, less pigment cells are distributed on the blind side, for example, among Type 1-A, Type 1-B, Type 1-C, and Type 1-C′ or between Type 2-A and Type 2-B. The pigment cell distribution in the whole body of Type 4 in which the eye never migrated further showed a relationship between eye position and pigmentation pattern. Moreover, when both eyes migrate upwards close to the dorsal midline in Type 3, maintaining left-right symmetry, no different pigmentation patterns are observed on both sides, and pigment cells are distributed mainly in the head area (Table 2.3). It is very interesting to observe the same pigmentation pattern in Type 1-C and Type 1-C′, which show similar eye migration but opposite sidedness. It does not matter whether the blind side is up or down, there is less pigmentation on the blind side than on the ocular side. However, because only one Type 1-C′ individual was found in the artificial population (Table 2.3), we need to investigate how sidedness affects pigmentation in other flatfish populations. In other flatfish species, such as in Japanese flounder, ambicoloration has been found in some individuals that show incomplete eye migration (Fig. 2.7).

52

2

Developmental Relationships among Metamorphic Events

Table 2.3 Pigmentation patterns in variants of a laboratory-reared population of the Senegalese sole Settling sidedness Left

Preference for which eye migrated Left

Final location of migrated eye Target location

Type 1-A

Left

Left

Type 1-B

Left

Left

Just over the dorsal midline Dorsal midline

Type 1-C

Left

Left

Type 1-C′

Right

Left

Type 2-A

Right

Right

Type 2-B

Right

Right

Type 3

Left

Left and right

Type 4

Left

None

Type Wild

Below the dorsal midline Below the dorsal midline Target location Below the dorsal midline Below the dorsal midline Original site

Pigmentation Pigment cells are distributed on the whole right side, but very few or none on the left side Pigmentation on the right side as wild type, forepart about half of the left side without pigment cells Pigmentation on the right side as wild type, only the head area of the left side without pigment cells Pigmentation on the right side as wild type, only the front of the head area on the left side without pigment cells Pigmentation on the right side as wild type, only the front of the head area on the left side without pigment cells Pigment cells are distributed on the whole left side, but very few or none on the right side Pigment cells are distributed on the whole left side, but few on the right side, except for the head area and gut No difference in pigment cells distributed on both sides. Pigment cells are mainly in the head area Pigment cells are distributed over the whole body

Fig. 2.7 Japanese flounder with incomplete eye migration and ambicoloration

2.4

Relationship Between Eye Migration and Left/Right Asymmetrical Pigmentation

53

Fig. 2.8 Specimens in which the eye migration route is stopped midway by colchicine injection (Bao et al. 2011). Panel A, Chinese tongue sole with eye migrated midway. A1, blind view, A2, ocular view. Bars, 1 mm. Panel B, Japanese flounder with eye migrated midway, B1, blind view, B2, ocular view. Bars, 500 μm

The above-mentioned observation seems to indicate that the pigmentation pattern is affected by eye migration; however, when eye migration was inhibited completely or partially by colchicines in the Chinese tongue sole and Japanese flounder, their pigmentation patterns were the same as that in normal juveniles and were not affected by eye migration (Fig. 2.8, Bao et al. 2011). These results indicate eventually that the pigmentation pattern does not depend on eye migration. Variants with different eye locations can be produced in several flatfish species by treatment with exogenous thyroid hormone or its synthesis inhibitor, for example, 2-mercapto-1-methylimidazole or thiourea in the Japanese flounder and spotted halibut (Okada et al. 2005; Tagawa and Aritaki 2005). Abnormal juveniles appeared in a population of the spotted halibut, Verasper variegatus, after T4 treatment, and they had asymmetrically located eyes and were pseudo-albino, had both eyes symmetrically relocated upward and were symmetrical pseudo-albino, or had pigmentation on both sides and no upward relocation of either eye (Tagawa and Aritaki 2005). These studies showed that both eye migration and body pigmentation can be affected by the thyroid hormone. Indeed, a previous study showed that the thyroid hormone can inhibit the formation of adult melanophore in zebrafish (McMenamin et al. 2014). In the Japanese flounder, an increase in T4 content induced a higher frequency of albinism. The absence of normal coloration in Japanese flounder juveniles after exogenous T4 treatment clearly indicated the involvement of the thyroid in pigmentation in the early stages of development (Yoo et al. 2000). We have discussed in detail how the thyroid hormone affects melanophore differentiation during flatfish metamorphosis in Chap. 7. In some flatfish species, such as the spiny turbot, both eyes are located on the left or right side in the same species. Two types of pigmentation patterns occur: pigmentation on only the ocular side or on both sides. The spiny turbots showed pigmentation on both sides, which further indicates that the pattern formation of body pigmentation is not dependent on eye migration.

54

2.5

2

Developmental Relationships among Metamorphic Events

Left/Right Asymmetrical Pigmentation Depends on Body Swim-Posture Change

Because the left-right asymmetry of body pigmentation is established after the settlement of the juvenile, the asymmetry may be attributable to body swim-posture change, which causes differences between the left and right sides. In Chap. 7, we have discussed that the left-right asymmetrical pigmentation depends on the settlement.

2.6

Summary

The relationships between major metamorphic events have been discussed, namely, the relationship between cranial deformation and eye migration, eye migration and body swim-posture change, eye migration and dorsal development, eye migration and left/right asymmetrical pigmentation, and left/right asymmetrical pigmentation and body swim-posture change. We used the Senegalese sole as the example to explain that the cranial bones deform gradually during metamorphosis, compare differences in the cranial bones of Senegalese sole variants with different eye locations, record different activities of the Senegalese sole variants, and investigate the relationship between eye migration and left/right asymmetrical pigmentation in the Senegalese sole population.

References Ahlstrom EH, Amaoka K, Hensley DA, Moser HG, Sumida BY (1984) Pleuronectiformes: development. In ontogeny and systematics of fishes. Am Soc Ichthyologists Herpetologists Ser Publ No 1:641–670 Agassiz A (1879) On the young stages of bony fishes. Proc Am Acad Arts Sci 14:1–25 Aritaki M, Tanaka M (2003) Morphological development and growth of laboratory-reared slime flounder Microstomus achne. Nippon Suisan Gakkaishi 69:602–610 Bao B, Ke Z, Xing J, Peatman E, Liu Z, Xie C, Xu B, Gai J, Gong X, Yan G, Jiang Y, Tang W, Ren D (2011) Proliferating cells in suborbital tissue drive eye migration in flatfish. Dev Biol 351(1): 200–207 Bergstrom CA (2007) Morphological evidence of correlational selection and ecological segregation between dextral and sinistral forms in a polymorphic flatfish, Platichthys stellatus. J Evol Biol 20:1104–1114 Bergstrom CA, Alba J, Pacheco J, Fritz T, Tamone SL (2019) Polymorphism and multiple correlated characters: do flatfish asymmetry morphos also differ in swimming performance and metabolic rate? Ecol Evol 9:4772–4782 Brewster B (1987) Eye migration and cranial development during flatfish metamorphosis: a reappraisal (Teleoster: Pleuronectformes). J Fish Biol 31:805–833 Cunningham JT (1892) The evolution of flatfishes. Nut Sci 1(3):191–199

References

55

Dinis MT, Ribeiro L, Soares F, Sarasquete C (1999) A review on the cultivation potential of Solea senegalensis in Spain and Portugal. Aquaculture 176(1/2):27–38 Evseenko SA (2008) Early life history stages of peacock flounder Bothus lunatus (Bothidae) from the Western and central tropical Atlantic. J Ichthyol 48(7):515–524 Fornbacke M, Gombrii M, Lundberg A (2002) Sidedness frequencies in the flounder Platichthys flesus (Pleuronectiformes) along a biogeographical cline. Sarsia 87:392–395 Fukuhara O (1988) Morphological and functional development of larval and juvenile Limanda yokohamae (Pisces: Pleuronectidae) reared in the laboratory. Mar Biol 99:271–281 Geffen AJ, van der Veer HW, Nash RDM (2007) The cost of metamorphosis in flatfishes. J Sea Res 58:35–45 Hoshino K (2006) Fixing the confused term “pseudomesial bar” and homologies of pleuronectiform cranial elements, with proposals of new terms. Ichthyological Research 53:435–440 Hubbs CL, Kuronuma K (1942) Hybridization in nature between two genera of flounders in Japan. Pap Mich Acad Sci Arts Lett 27:267–306 Joh M, Takatsu T, Nakaya M, Higashitani T, Takahashi T (2005) Otolith microstructure and daily increment validation of marbled sole (Pseudopleuronectes yokohamae). Mar Biol 147:59–69 Kang DY, Lee JH, Kim WJ, Kim HC (2012) Morphological specificity in culture starry flounder Platichthys stellatus reared in artificial facility. Fisheries and Aquatic Science 15(2):117–123 Kyle HM (1921) The asymmetry, metamorphosis and origin of flatfishes. Phil Trans Roy Soc BCCXI:75–129 Leis JM, Rennis DS (1983) The larvae of Indo-Pacific coral reef fishes. New South Wales University Press/University Press of Hawaii Markle DF, Harris PM, Toole CL (1992) Metamorphosis and an overview of early-life-history stages in Dover sole Microstomus pacificus. Fish Bull US 90:285–301 Matsumoto J, Seika T (1992) Asymmetric pigmentation and pigment disorders in Pleuronectiformes (Flounders). Pigment Cell Res Suppl 2:275–282 McMenamin SK, Bain EJ, McCann AE, Patterson LB, Ds E, Waller ZP, Hamill JC, Kuhlman JA, Eisen JS, Parichy DM (2014) Thyroid hormone-dependent adult pigment cell lineage and pattern in zebrafish. Science 345:1358–1361 Minami T (1981) The early life history of a sole Heteromycterisjaponicus. Bull Jar Soc Nishikawa T (1897) On a mode of the passage of the eye in a flatfish. Annot Zool Jap Okada N, Morita T, Tanaka M, Tagawa M (2005) Thyroid hormone deficiency in abnormal larvae o the Japanese founder Paralichthys olivaceus. Fish Sci 71:107–114 Okada N, Takagi Y, Seikai T, Tanaka M, Tagawa M (2001) Asymmetrical development of bones and soft tissues during eye migration of metamorphosing Japanese flounder Paralichthys olivaceus. Cell Tissue Research 304:59–66 Okada N, Tanaka M, Tagawa M (2003) Histological study of deformity in eye location in Japanese flounder Paralichthys olivaceus. Fisheries Science (Japan) 69:777–784 Russo T, Pulcini D, Costantini D, Pedreschi D, Palamara E, Boglione C, Scardi M, Mariani S (2012) “Right” or “wrong”? Insights into the ecology of sidedness in European flounder, Platichthys flesus. J Morphol 273:337–346 Saele O, Silva N, Pittman K (2006a) Post-embryonic remodelling of neurocranial elements: a comparative study of normal versus abnormal eye migration in a flatfish, the Atlantic halibut. J Anat 209:31–41 Sæle Ø, Smaradottir H, Pittman K (2006b) Twisted story of eye migration in flatfish. J Morphol 267:730–738 Schreiber AM (2006) Asymmetric craniofacial remodelling and lateralized behaviour in larval flatfish. J Exp Biol 209:610–621 Schreiber AM (2013) Flatfish: an asymmetric perspective on metamorphosis. In: Shi Y-B (ed) Current topics in developmental biology, vol 103. Academic Press, Burlington, pp 167–194 Seshappa G, Bimachar BS (1955) Studies on the fishery and biology of the Malabar sole, Cynoglossus semifasciatus Day. Indian J Fish 2(1):180–230

56

2

Developmental Relationships among Metamorphic Events

Sun M, Wei F, Li H, Xu J, Chen X, Gong X, Tian Y, Chen S, Bao B (2015) Distortion of frontal bones results from cell apoptosis by the mechanical force from the up-migrating eye during metamorphosis in Paralichthys olivaceus. Mech Dev 136:87–98 Tagawa M, Aritaki M (2005) Production of symmetrical flatfish by controlling the timing of thyroid hormone treatment in spotted halibut Verasper variegates. Gen Comp Endocrinol 141(2005): 184–189 Traquair RH (1865) On the asymmetry of the Pleuronectidae, as elucidated by an examination of the skeleton in the turbot, halibut, and plaice. Trans Linn Soc (Lond) 25:263–296 Wagemans F, Focant B, Vandewalle P (1998) Early development of the cephalic skeleton in the turbot. J Fish Biol 52:166–204 Wagemans F, Vandewalle P (2001) Development of the bony skull in common sole: brief survey of morpho-functional aspects of ossification sequence. J Fish Biol 59:1350–1369 Xing J, Ke Z, Liu L, Li C, Gong X, Bao B (2020) Eye location, cranial asymmetry, and swimming behavior of different variants of Solea senegalensis. Aquaculture and Fisheries 5:182. https:// doi.org/10.1016/j.aaf.2019.11.003 Yoo JH, Takeuchi T, Tagawa M, Seikai T (2000) Effect of thyroid hormones on the stage-specific pigmentation of the Japanese flounder Paralichthys olivaceus. Zool Sci 17:1101–1106

Chapter 3

New Tissue Models for Explaining Eye Migration

Abstract Since Von Autenrieth (1800) gave an explanation for both eyes locating on the same side in flatfish, numerous researchers have directed their efforts towards elucidating the way of eye movement. We give a brief introduction to each hypothesis. We investigated the role of cell proliferation, cell apoptosis, and cell autophagy during metamorphosis in flatfish. Finally, we propose a tissue model to explain how the eye migrates upward. Keywords Eye migration · Cell proliferation · Cell apoptosis · Cell autophagy · Flatfish

3.1

Diversity of Eye Location in Flatfishes

All flatfishes are born with symmetrical eyes. Then the larva goes through a spectacular ontogenetic metamorphosis with one eye migrating moving from one side of the head to the other (Brewster 1987). Since preference and completeness of eye migration during metamorphosis are distinct among different individuals in the same or different flatfish species, the diversity of eye location in flatfishes can be present as different eye sideness and orbital septum (or interorbital space). Some flatfish species have both eyes locating on either left or right side in the same species. For example, species from Genus Psettodes (the most primitive living group that belongs to Pleuronectiformes) and the fossil species Heteronectes and Amphistium, have a possibly equal frequency of dextral and sinistral individuals (Friedman 2008). The proportion of flatfish displaying dextral or sinistral eyes in a natural population varies among species from virtually none in the tongue fishes (Cynoglosidae) (Munroe 1996) to as high as 100% in some starry flounder (Platichthys stellatus) populations (Policansky 1982a). It is interesting in starry flounder that the proportion of eye-sideness in natural population depends on its geographical distribution. The relative frequency of sinistral and dextral morphs of starry flounder showed a significant shift from equal numbers of both morphs in central California, to 75% sinistral morphs in Alaska and 100% sinistral morphs in Russia and northern Japan (Hubbs and Kuronuma 1942; Bergstrom 2007). Although there is moderate heritability of body asymmetry direction in starry flounder © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_3

57

58

3

New Tissue Models for Explaining Eye Migration

(Policansky 1982a; Boklage 1984), the mechanisms that maintain the geographical shift in the relative frequency of lateral morphs in this species remain an enigma. In addition, the distinct ecological gradients of lateral polymorphism throughout Europe have also been described for the congeneric European flounder (Platichthys flesus) (Fornbacke et al. 2002; Russo et al. 2012). Diversity of eye location is much higher in starry flounder than in European flounder (Bergstrom 2007). The evolution of lateral polymorphism in flatfish is rare (seven of approximately 715 species), and occurred independently throughout the order Pleuronectiformes (Munroe 2005). However, the individual with reversed eye has been reported in many natural populations of Pleuronectiformes, such as in Paralichthys californicus, Platichthys stellalus, Platichthys flesus trachurus, Platichthys flesus logdanous, Platichthys flesus septentrionalis, Platichthys flesus luscus, Tephrinectes sinensis, and Cleiathenes herzensteini (Norman 1934). Reversal asymmetry is common in reared either dextral or sinistral flatfish. It was found that 4.4% of the 1295 laboratory-reared summer flounder displayed the reversed condition (Bisbal and Bengtson 1993). In some Pleuronectid species, such as Pleuronectes herzensteini, marbled sole (Pleuronectes yokohamae), Pleuronichthys cornutus, and spotted halibut (Verasper variegatus), reversals have been frequently observed in hatchery-reared individuals, although rarely seen in wild fishes (Aritaki and Seikai 2004). In the left-eyed southern flounder (Paralichthys lethostigma), abnormal eye migration constituted 0.5–10% of fingerling reductions (Benetti et al. 2001). In the right-eyed (dextral) flounder Platichthys flesus, 29.6% showed sinistral form during artificial larval culture (López et al. 2009). The vast majority of wild-caught specimens within the genus Paralichthys are sinistral. Some species, such as Japanese flounder (Paralichthys olivaceus) (see Okada et al. 2003a, b), southern flounder (Paralichthys lethostigma) (Benetti et al. 2001; Schreiber 2006), Brazilian flounder (Paralichthys orbignyanus) (López et al. 2009), and summer flounder (Paralichthys dentatus) (Bisbal and Bengtson 1993) have been found to have much more “reversed” (dextral) asymmetric offspring when cultured in a laboratory or aquaculture environment. Other reports also showed a higher frequency of eye reverse in some artificial population of flatfish, such as in intensive hatchery-reared Black Sea flounder (Platichthys flesus luccus) in Turkey, or in culture Starry flounder (Platichthys stellatus) (Aydin 2012; Kang et al. 2012). According to the breeding experiments, it is supposed that the direction of asymmetry in populations of polymorphic flatfish is controlled by genetics (Boklage 1984; Hashimoto et al. 2002; Policansky 1982a, b), while the relative distribution and selection of dextral and sinistral forms may be influenced by environmental variables (Bergstrom 2007; Bergstrom and Palmer 2007; Russo et al. 2012). The frequency of the eye reverse in artificial breeding population of marbled sole (Pseudopleuronectes yokohamae) was supposed to be related to some factors, such as water temperature, salinity, and hormones for artificial inducement for spawning (Bi et al. 1987). The precise selective advantage of sinistral versus dextral morphology still remains unclear (Schreiber 2013).

3.2

The Hypotheses on the Eye Migration in Flatfishes

3.2

59

The Hypotheses on the Eye Migration in Flatfishes

Left-right asymmetry is very common in vertebrates, including some internal organs and external appearance. Adult flatfish present marked asymmetrical external appearance compared with the perfect symmetrical larvae. This process is called flatfish metamorphosis, which occurs during the post-larval stage and is characterized by asymmetry. The particular interest in flatfish metamorphosis to scientists is eye asymmetry due to eye migration, which varies among different species or even within the same species (Ahlstrom et al. 1984; Youson 1988). Since Von Autenrieth (1800) first depicted the cranial morphology of the plaice and tried to give an explanation of both eyes locating on the same side of the head, there are many researchers have made attempts to elucidate the way in which the eye migrates. Even though eye migration has been studied for over a century, there is no big advance in explaining eye migration until Brewster (1987) reviewed the literature and reevaluated several hypotheses for the mechanism of eye migration and cranial asymmetry in Pleuronectiforms (Brewster 1987, Traquair 1865, Giard 1877, Agassiz 1879, Willians 1901, Futch 1977, Evseenko 1978, Policansky 1982a).

3.2.1

The Eye Migration Thought to Be Associated with Brain

Since Von Autenrieth (1800) depicted the post-metamorphic cranial morphology of the plaice, Pleuronectes platessa, and thought the absence of the left forebrain resulted in both eyes locating on the same side of the head. Suzuki et al. (2009) thought lateralization of eye sideness is associated with the asymmetrical development of habenulae. They proposed that the flounder eye sideness is controlled by the nodal-lefty-pitx2 (NLP) pathway, which is thought to be responsible for the establishment on the asymmetrical orientation of the internal organs in a vertebrate. They supposed that the establishment of left/right asymmetry of eye experienced following four steps. First, pitx2 gene is expressed on the left side of the dorsal diencephalon under the regulation of nodal and lefty during the embryonic period. Second, the asymmetric expression of pitx2 contributes to asymmetric development of paired habenulae. Third, pitx2 is re-expressed at the left habenula during the pre-metamorphic stage. Then this results in the asymmetry of habenulae structure, which represents a larger right habenula compared to the left. The ventral diencephalon and eyes shift randomly and asymmetrically with habenulae, in the opposite direction in sinistral and dextral flounders (Suzuki et al. 2009). Schreiber (2013) thought that the eye movement during metamorphosis is not related to the differential innervation of dorsal and ventral midbrain targets by asymmetric habenulae structure during embryogenesis.

60

3.2.2

3

New Tissue Models for Explaining Eye Migration

The Eye Migration Thought to Be Associated with Dorsal Fin

Seshappa and Bimachar (1955) first described the development of a rostral beak to be involved in the Bengal tongue sole (Cynoglossus semifasciatus) metamorphosis. The rostral beak was considered a dorsal fin appendage that grows on the ventral side to form a fleshy hook attached to the snout. And the migrating eye shifted through a gap in the rostral beak to appear on the ocular side of the head. Houde et al. (1970) noted that the left eye of the lined sole (Achirus lineatus) moved across the dorsal midline under a hook developed from the dorsal fin. Amaoka (1972) reported that the migrating eye was inserted into a slit and emerged above the stationary eye on the ocular side of Kitahara’s Flounder (Laeops kitaharae). Evseenko (1978) found that the eye of Bothus sp. (Bothidae) migrated from the blind side to the other through a gap in the head tissues beneath the dorsal fin base. Minami (1981) discovered that the dorsal fin of bamboo sole, Heteromycteris japonicus (Soleidae) advances before the eye migrates, and then the eye moves through a gap at the base of the dorsal fin and the skull. However, Policansky (1982a) and Ahlstrom et al. (1984) consider that there are two potential mechanisms for eye migration in Pleuronectiforms, one is that the eye moves first, then the dorsal fin extends anteriorly, and the other is that the dorsal fin elongates forward and the eye moves through a gap beneath the fin base and skull.

3.2.3

The Eye Migration Thought to Be the Result from the Resorption of the Part of the Cranium

Based on the research about the turbot (Scophthalmus maximus) and plaice (Pleuronectes platessa), Thomson (1865) first reported a remarkable shifting and absorption of the cranium, almost the entire right half of the anterior frontal bone disappeared in Pleuronectes platessa. He inferred that bone resorption is a prerequisite for eye movement. However, Pfeffer (1886) presumed that the frontal was somehow resorbed by the migrating eye, and then the resorbed cartilaginous frontal was displaced during eye migration, such that dermal bone was developed in the new position of the frontal. Williams (1901, 1902) summarized that paired supraorbital bars were present in pre-metamorphosed Winter Flounder (Pleuronectes americans) and Bothus maculatus, then the bar of the prospective blind side was partially resorbed driving the eye to shift through the resulting gap during metamorphosis. Policansky (1982a) deduced that some resorption of cartilage could explain the passage of the migrating eye.

3.2

The Hypotheses on the Eye Migration in Flatfishes

3.2.4

61

The Eye Migration Thought Be Caused by a Twisting of the Skull

Rosenthal (1821) is the first one to surmise that the top eye is from the blind side but thought it was thrusted through the head to reach the position. Meckel (1822, 1824), von Beneden (1853), and Nishikawa (1897) assumed that the movable eye was repositioned through skull twist, the reverse rotation of the anterior and posterior parts of the cranium. Futch (1977) described the osteological changes of Trichopsetta ventralis (Bothidae) during metamorphosis, also supporting the hypothesis that cranial torsion and asymmetry are related to eye movement. Based on the original observations on the morphological changes of the skull during the metamorphosis in common sole (Solea solea), Buglossidium luteum, European plaice (Pleuronectes platessa), common dab (Pleuronectes limanda), European flounder (Platichthys flesus), Microstomus kitt, Scophthalmus sp., Zeugopterus punctatus, Phrynorhombus regius, and Arnoglossus sp. Brewster (1987) supported the hypothesis that the twist of skull caused the eye asymmetry. He further pointed out that the Pleuronectiform asymmetrical cranium does not result from any rotation of the anterior or posterior parts, but is caused by the relocation of the anterior blind side frontal to the ocular side and is accentuated by the enlargement of the blind side lateral ethmoid. After investigating the morphological change of skull during metamorphosis in turbot, Wagemans et al. (1998) supported the hypothesis as well. However, Steenstrup (1865) considered that the twist of cranium was not sufficient to explain both eyes locating on the same side of the head. Kyle (1921) thought that asymmetry of the cranium resulted from a distortion of the frontals caused by the migrated eye. Sæle et al. (2006) thought the process of eye migration in bilaterally symmetrical flatfish larvae starts with asymmetrical growth of the dorsomedial parts of the ethmoid plate together with the frontal bones, structures initially found in a symmetrical position between the eyes. The movement of these structures in the future ocular direction exerts a stretch on the fibroblasts in the connective tissue found between the moving structures and the eye that is to migrate. If the twisting of the skull leads to eye movement, it should start earlier than the onset of eye migration. However, it is hard to determine the initial timing difference between cranial asymmetry and eye migration based on the morphological changes. Schreiber (2006) reported that asymmetrical cranium growth alone is not sufficient to drive eye movement in Southern flounder (Paralichthys lethostigma).

3.2.5

The Eye Migration Thought to Be Pulled by a Ligament

Mayhoff (1914) hypothesized that a special subocular ligament could guide eye movement, pulling the eye migrating to the new place. Then the accurate location of the eye could be achieved by the prefrontal ossification, which pushed the migrating eye into the proper place. The ligament finally ossified to be a

62

3

New Tissue Models for Explaining Eye Migration

pseudomesial bar. Kyle (1921) agreed with Mayhoff’s opinion that a subocular ligament is responsible for eye migration. In laboratory-reared Japanese flounder, Paralichthys olivaceus, Okada et al. (2001) observed an increase in skin thickness beneath the eye only on the blind side when eye migration began, and thought the pseudomesial bar, a peculiar bone existed only in flatfishes, was developed from this thick skin and grew dorsad. These authors postulated that the asymmetrical presence and growth of the pseudomesial bar on the blind side may be responsible for right eye migration during metamorphosis in the Japanese flounder. The subocular skin was a fast-division tissue, and it looks like the ligament as Mayhoff (1914) found. Sæle et al. (2006) thought after the eye starts to migrate by the twist of skull, a dense cell population of fibroblasts ventral to the eye begins to proliferate, possibly cued by the pulling forces exerted by the eye. The increased growth ventral to the eye pushes the eye dorsally. Recently, Campinho et al. (2018) declared that it is the ossification of pseudomesial bar in blind side, not the cell proliferation, in turn driving eye migration in Senegalese sole (Solea senegalensis). Because the authors have not detected the signal of cell proliferating in pseudomesial bar in using an unspecific antibody of PCNA (Proliferating Cell Nuclear Antigen) (BrdU, a more reliable way, has not been used to detect cell proliferation), they denied the pseudomesial bar is from the fast division tissue such as the skin thickness found in Japanese flounder (Okada et al. 2001) or a dense cluster of fibroblasts beneath the eye in Atlantic halibut (Sæle et al. 2006). However, it is unconvinced that how a bone ossification could drive an eye migration? In the paper of Campinho et al. (2018), apyrase, a compound that prevents heterotypic dermal ossification in humans by inhibiting BMP signaling, was used to inhibit eye migration. The apyrase is very few used in habiting dermal ossification (only seen in Peterson et al. 2014). In fact, a number of studies have shown that apyrase could inhibit cell proliferation, such as lymphocytes and some cells in the retina (Baricordi et al. 1999; Battista et al. 2009). The apyrasetreated larvae in the study of Campinho et al. (2018) exhibited metamorphosisassociated changes in some of their structures they were smaller than the control larval sole, which means the apyrase might have impaired cell proliferation in these structures. So, the authors should check the result of apyrase inhibition carefully. Moreover, stem flatfish Amphistium and Heteronectes with incomplete orbital migration lack a pseudomesial bar (Friedman 2008), suggesting the pseudomesial bar is not initial force to drive eye migration. It is possible that in the two extinct species there occurred a proliferation of cells beneath the eye as in extant forms (Frazetta 2012).

3.2.6

Hypothesis About the Migrating Eye Forcing a Passage Through the Head

Steenstrup (1865) considered that one eye on its own initiative to obliquely thrust through the head, then to locate on the new position-the opposite side. Giard (1877)

3.3

Proliferating Cells in Suborbital Area Drive Eye Migration. . .

63

thought that the migrating eye was the “stronger” eye, enabling it to shift to the “feeble” one. These hypotheses provided us with multiple perspectives to better understand the mechanism of eye migration. Coupled with the basic physical principles, we formulated the hypothesis that the force coming from the suborbital region should be the most effective reason for driving the eye upward, and such a force might be produced by hyper-proliferating cells. Moreover, the relative tissues in suborbital area should undergo resorption to enable eye migration (Bao 2005).

3.3

Proliferating Cells in Suborbital Area Drive Eye Migration During Metamorphosis in Flatfish

Basically, the first step is to figure out what tissue prompts eye movement ahead of understanding the underlying mechanism during metamorphosis. Okada et al. (2001) reported that only the skin on the suborbital region of the migrating eye became thicker when eye movement began, and thought the pseudomesial bar developed from this thick skin and grew dorsad to push eye migration in Japanese flounder. This dense cluster of fibroblasts was also found beneath the blind eye in halibut (Hippoglossus hippoglossus) indicating its role in eye movement (Sæle et al. 2006). In my PhD Dissertation (Bao 2005), I suggested a hypothesis that the moving eye was mainly driven by the force generated by hyper-proliferating cells under the suborbital region. And I have investigated the tissue distribution pattern of cell proliferation, cell apoptosis, and cell autophagy during the metamorphosis in Japanese flounder. Later, we tested the role of cell proliferation in three different species of flatfishes (Bao et al. 2011).

3.3.1

Normal Metamorphic Stages Defined in Three Flatfish Species

Three different species of flatfish were investigated, including Senegalese sole (Solea senegalensis) (Soleidae), Chinese tongue sole (Cynoglossus semilaevis) (Cynoglossidae), and Japanese flounder (Paralichthys olivaceus) (Paralichthyidae). Enriched artemia nauplii was used to feed the larvae during the whole metamorphic stage. According to Minami (1982), metamorphosis is generally divided into six stages: Pre-metamorphosis (the stage prior to the start of eye migration); Stage E (the eye begins to migrate); Stage F (the migrating eye visible from the ocular side); Stage G (the upper edge of the migrating eye beyond the dorsal margin); Stage H (the upper edge of the migrating eye beyond the dorsal midline); and Stage I (entire migrating eye past the dorsal midline). Based on this classification, the days after hatching (DAH) corresponding metamorphosis stages were listed in Table 3.1.

64

3

New Tissue Models for Explaining Eye Migration

Table 3.1 Metamorphic stages and corresponding days after hatching in three flatfish species (Bao et al. 2011)

Species Solea senegalensis Cynoglossus semilaevis Paralichthys olivaceus

3.3.2

Pre-metamorphosis (DAH) 10 15

Metamorphosis (DAH) Stage Stage Stage E F G 14 15 16 18 19 19

Stage H 17 20

Rear temperature (°C) 18 22

17

19

25

20

21

23

Left/Right Asymmetrical Distribution of the Proliferating Cells in Suborbital Region of Left/Right Eye Before Initial Eye Migration

Cell proliferation was assessed with 5-bromo-2-deoxyuridine (BrdU) staining in three metamorphosing flatfish, Senegalese sole, Chinese tongue sole, and Japanese flounder. BrdU incorporation is a surrogate marker for DNA synthesis. The larvae were treated with 0.1% 5′-bromodeoxyuridine (BrdU) for 8 hours, cell proliferation can be detected by monoclonal anti-BrdU antibody. At the pre-metamorphosis stage, cell proliferation signals were observed in the suborbital regions on both sides and the dorsal midline surface along the head between two eyes (Fig. 3.1). In Senegalese sole, the left (blind) eye had more dividing cells under the suborbital area than the right (ocular) eye (Fig. 3.1a). Similar results were observed in Chinese tongue sole (Fig. 3.1b) and Japanese flounder (Fig. 3.1c). The proliferating cell nuclei were stained blue by BrdU, so that the number can be counted exactly. Proliferating cells in suborbital area of blind side were significantly more than that of ocular side in Senegalese sole, Chinese tongue sole, and Japanese flounder (Fig. 3.1d, P < 0.05). Interestingly, the lateral ethmoid also had strong proliferation signals (Fig. 3.1 A1, A3, B1, B3, C1, C3). The asymmetrical enlargement of the lateral ethmoid was regarded as the driving force of eye movement at later metamorphic stage. However, no cell proliferation signal was found in the frontal cartilage, the presumptive original source of force to push eye movement. Proliferating signals were predominately located in the skin of suborbital regions and along the head between two eyes in Senegalese sole, Chinese tongue sole, and Japanese flounder (Fig. 3.2). The types of proliferating cells could not be identified in the frozen sections in this study. As development goes on, the cells continue dividing into the suborbital areas and the dorsal skin along the head between two eyes in Senegalese sole, Chinese tongue sole, and Japanese flounder (Figs. 3.3 and 3.4). Asymmetric suborbital cell proliferation during eye migration was also found in the southern flounder (Paralichthys lethostigma) by using fluorescent-labeled antibodies against bromodeoxyuridine (BrdU) (Schreiber 2013), indicating this asymmetric suborbital cell proliferation existed universally in flatfishes.

3.3

Proliferating Cells in Suborbital Area Drive Eye Migration. . .

65

Fig. 3.1 Representative images of the proliferating cells with blind and ocular asymmetrical distribution in suborbital areas during pre-metamorphosis stage (Bao et al. 2011). Proliferating cells are indicated in suborbital tissues between left and right eyes in Senegalese sole, Solea senegalensis (dextrorotation, Soleidae) (panel a), Chinese tongue sole, Cynoglossus semilaevis (sinistrogyration, Cynoglossidae) (panel b), or Japanese flounder, Paralichthys olivaceus (sinistrogyration, Paralichthyidae) (panel c). Each rectangle has the same size and the enlarged views were shown on the right. (d), Quantification of dividing cells in suborbital tissues between ocular and blind side, values of each bar are represented by means ± SD (n = 3), different lowercase letters above the columns indicate significant differences (P < 0.05). dm, dorsal midline; le, lateral ethmoid. Dotted arrow shows the direction of eye migration; solid arrow shows proliferating signals

Fig. 3.2 Dorsal view of proliferating signals locating in the suborbital skin in Senegalese sole (A1), Chinese tongue sole (B1), and Japanese flounder (C1) along the ongoing movable eye route in Senegalese sole (A2), Chinese tongue sole (B2) and Japanese flounder (C2) before metamorphosis (Bao et al. 2011). Arrow shows cell proliferation signals. L, left eye; R, right eye

3.3.3

Eye Migration Retarded by the Inhibitor of Cell Division Microinjected into the Suborbital Area of Blind Side

To elucidate the function of cell proliferation, colchicine, an inhibitor of mitotic division, was microinjected into the suborbital region of the migrating eye at four,

66

3

New Tissue Models for Explaining Eye Migration

Fig. 3.3 Proliferating signals in the suborbital cells at the peak of metamorphosis in Senegalese sole at 16 DAH (Panel a), Chinese tongue sole at 20 DAH (Panel b), and Japanese flounder at 24 DAH (Panel c) (Bao et al. 2011). Arrows show extremely large numbers of proliferating cells in the suborbital region of movable eye

Fig. 3.4 Asymmetric cell proliferation in the suborbital regions during eye migration in south flounder (From Schreiber 2013). Proliferating signals are shown in the suborbital areas of the left (non-migrating) eye (a, b) and the right (migrating) eye (c, d) during the climax metamorphosis stage. Rectangular regions in (a) and (c) are magnified in (b) and (d), respectively Table 3.2 Colchicine microinjection schedule in three different flatfish species (Bao et al. 2011)

Species Solea senegalensis

Cynoglossus semilaevis

Paralichthys olivaceus

No. of injected individuals 82

Date for injection 10, 13 DAH

No. of survive individual 25

67

10, 13 DAH

46

Colchicine injected Control

186

15, 20 DAH

19

100

15, 20 DAH

27

Colchicine injected Control

210

17, 19, 21 DAH 17, 19, 21 DAH

40

Group Colchicine injected Control

115

95

Date for statistic 21 DAH 21 DAH 25 DAH 25 DAH 30 DAH 30 DAH

three, or two days prior to the onset of eye movement in Senegalese sole, Chinese tongue sole, and Japanese flounder, respectively (Table 3.2 and Fig. 3.5a). Colchicine was used at about 50 nl at 50 μg/ml in 0.75% NaCl solution. The same volume of 0.75% NaCl solution was injected in the control groups. As expected, colchicine injection inhibited eye migration. In the control group of Senegalese sole, the movable eye could successfully migrate past the dorsal midline (Stage I, 21 DAH). However, none of the larvae microinjected with colchicine had eyes migrating past the dorsal midline. Results showed that 68% of the treatment

3.3

Proliferating Cells in Suborbital Area Drive Eye Migration. . .

67

Fig. 3.5 Eye migration inhibited by microinjecting colchicine into the suborbital area of blind side (Bao et al. 2011). (a), Schematic diagram showed the specific position where colchicine was microinjected. (b), the percentage of Senegalese sole with distinct metamorphic stages at 21 DAH. (c), the percentage of Chinese tongue sole with distinct metamorphic stages at 25 DAH. (d), the percentage of Japanese flounder with distinct metamorphic stages at 30 DAH. Gray column represents the treatment group injected with colchicine; black column represents the control group injected with 0.75% NaCl solution. The upper letters displayed on the axis of abscissa indicate different metamorphic stages, stage E, stage F, stage G, stage H, and stage I, respectively. (e1), dividing cells in colchicine-microinjected Senegalese sole at 19 DAH, the suborbital area was marked by a rectangle. (e2), magnified view of rectangle region in E1. (f1), dividing cells in control larvae at stage E, the suborbital area was marked by a rectangle. (f2), magnified view of rectangle region in F1. (g), the number of dividing cells in colchicine injected group was significantly less than that in normal larvae at stage E

group (17 individuals) were at stage E without blind (left) eye migration (Fig. 3.5b). Similar results were observed in Chinese tongue sole (Fig. 3.5c) and Japanese flounder (Fig. 3.5d). Interestingly, no matter what degree eye movement was inhibited, all larvae successfully underwent metamorphosis and developed into benthic juveniles with no or partial eye shift. This indicates that eye relocation was inhibited because suborbital cells stopped dividing by microinjected colchicine but not due to a general development disruption. Colchicine arrests mitosis by interfering with microtubule formation, thereby affecting chromosome separation, but not

68

3

New Tissue Models for Explaining Eye Migration

Fig. 3.6 Colchicine treatment inhibited cell division in the suborbital tissue of migrating eye in Chinese tongue sole and Japanese flounder (Bao et al. 2011). Panel A, proliferating signals in suborbital cells of migrating eye in 25 DAH Chinese tongue sole in the experimental group. Rectangle represents the suborbital region (A1) and its zoom-in view (A2). Panel B, proliferating signals in suborbital cells of Chinese tongue sole at stage E. Rectangle represents suborbital region (B1) and its zoom-in view (B2). Panel C, proliferating signals in suborbital cells of migrating eye in 29 DAH Japanese flounder in the experimental group. Rectangle represents the suborbital region (C1) and its zoom-in view (C2). Panel D, proliferating signals in suborbital cells of Japanese flounder at stage E. Rectangle represents the suborbital region (D1) and its zoom-in view (D2)

through inhibiting DNA synthesis. Therefore, the suborbital cell proliferation can be analyzed by detecting the fluorescence signal of BrdU. However, the number of dividing cells in the suborbital area of the blind side in colchicine-microinjected Senegalese sole was less than that in the control larvae at stage E (the eye starts to move) (Fig. 3.5e, f). And there was a statistically significant difference (Fig. 3.5g, P < 0.05). Similar results were found in Chinese tongue soles and Japanese flounder (Fig. 3.6). Representative individuals of Senegalese sole, Chinese tongue sole, and Japanese flounder with eye movement inhibited completely by colchicine microinjection are shown in Fig. 3.7. Representative larvae with incomplete eye movement resulting from colchicine microinjection are shown in Fig. 3.8. Colchicine treatment results in three different species of Pleuronectiformes indicate that proliferation in the suborbital cells of the blind side was the initial force of eye migration. This is the first report of eye-symmetrical or incomplete orbital migration juveniles in Senegalese sole, Chinese tongue sole and Japanese flounder with a bottom-dwelling lifestyle.

3.3

Proliferating Cells in Suborbital Area Drive Eye Migration. . .

69

Fig. 3.7 Larvae treated with colchicine stopped eye migration (Bao et al. 2011). Panel A, Senegalese sole juveniles with symmetric eyes in colchicine treatment group (A1) and with normal asymmetric eyes in the control group (A2). Panel B, Chinese tongue sole juveniles with symmetric eyes in colchicine treatment group (B1) and with normal asymmetric eyes in control group (B2). Panel C, Japanese flounder juveniles with symmetric eyes in colchicine treatment group (C1) and with normal asymmetric eyes in the control group (C2)

Fig. 3.8 Representative juveniles with incomplete eye movement resulting from colchicine microinjection (Bao et al. 2011). Panel a, Senegalese sole. Panel b, Chinese tongue sole. Panel c, Japanese flounder

3.3.4

Distortion of Frontal Bones Caused by Eye Movement

In the above study, the highly controversial subject of the chronological order of eye movement and skull twist could be addressed by the symmetrical juveniles caused by colchicine treatment. The frontal bones maintained left/right symmetry and the lateral ethmoids are of similar size on both sides in the eye-symmetrical juvenile Senegalese sole (Fig. 3.9a), Chinese tongue sole (Fig. 3.9b), and Japanese flounder (Fig. 3.9c). The distortion of frontal bones was ever thought to be the initial force to drive eye movement during metamorphosis. However, the results suggested that skull twist was dependent on eye migration.

70

3

New Tissue Models for Explaining Eye Migration

Fig. 3.9 Alizarin Red (bone) and Alcian Blue (cartilage) staining reveal symmetry of frontal bone (f) and similar size of lateral ethmoids (le) on both sides of the head in the eye-symmetrical flatfish caused by colchicine injection (Bao et al. 2011). Panel A, Senegalese sole at 21 DAH with symmetric eyes caused by colchicine injection .. Panel B, Chinese tongue sole at 60 DAH with symmetric eyes caused by colchicine injection. Panel C, Japanese flounder at 38 DAH with symmetric eyes caused by colchicine injection. e, eye; f, frontal cartilage/bone; le, lateral ethmoid. Lines point to the bone on the ocular side. Arrows point to the bone on the blind side

In eye-symmetric flatfish Senegalese sole, Chinese tongue sole, and Japanese flounder treated with colchicines (an inhibitor of cell proliferation) in our experiment, there was no pseudomesial bar existed (Fig. 3.9, Bao et al. 2011), indicating the pseudomesial bone might be developed from a tissue with cell proliferation as observed by Okada et al. (2001), or depend on eye migration during metamorphosis in flatfish.

3.3

Proliferating Cells in Suborbital Area Drive Eye Migration. . .

3.3.5

71

Our Model Proposed Based on our Finding in Cell Proliferation

Based on the above results, we propose a novel model here to explain eye migration during flatfish metamorphosis (Fig. 3.10). At the initiation of eye migration, cells start a massive wave of proliferation along the presumptive route of eye migration, including the suborbital area (Figure 3.10a). There are more dividing cells in the suborbital skin of the migrating eye than that in the non-migrating eye. The left/right asymmetrical distribution of dividing cells in the suborbital skin may correspond to “stronger” and “feeble” eye identified in the early hypothesis proposed by Giard (1877). He thought that the “stronger” eye could move to the “feeble” eye but did not know the force behind it. The different number of proliferating cells produced unequal force on both eyes, which could interpret the eye receiving more force could migrate to another one, and the movable eye differs between different species, and even within the same species. Generally, one eye starts migrating upward when the pushing force from proliferating suborbital cells could overcome the main counteracting force from the other eye (Fig. 3.10a). During migration, suborbital cells continue proliferating and produce more pushing force to the migrating eye. At the same time, the counterforce is getting increasingly bigger when the two eyes get closer and closer (Fig. 3.10b). The migrating eye stops moving when the pushing and counteracting force achieve an equilibrium (Fig. 3.10c). As the eye migrates, the cartilage of the skull (frontal cartilage and/or supraorbital cartilage in some species) closest to the migrating route of the movable eye receives the pushing force from the migrating eye and, in response, begins twisting toward another side. In addition, the lateral ethmoid on the blind side expands larger than that on the ocular side due to the extra interspace left by eye migration.

Fig. 3.10 Schematics of eye migration in flatfish (Bao et al. 2011). (a), at the beginning of eye migration, cells start a massive wave of proliferation along the presumptive route of eye migration, including the suborbital area. The number of proliferating cells is different between both suborbital areas. The eye begins migrating upward when it receives enough pushing force from proliferating suborbital cells to overcome the main counteracting force of the other eye and along the route of ongoing eye movement. (b), During eye migration, there are more proliferating cells in the suborbital region of the migrating eye and it provides more thrust to push the eye. Meanwhile, the counterforce becomes larger as two eyes become closer. (c), when the pushing and counteracting forces achieve balanced, the migrating eye finally stops migration

72

3

New Tissue Models for Explaining Eye Migration

As we all know, flatfishes in Psettodes have different eye migration directions among different species, or within the same species. Various eye locations can be observed in natural mutant flatfish, such as reversed eye, symmetrical eyes, and both eyes on the top of the head (Schreiber 2006; Wagemans et al. 1998). These phenotypes are very easy to understand based on our model. This may be caused by the abnormal competitive force from suborbital cell proliferation between both sides. Our research indicates that eye migration is driven by the force from suborbital cell proliferation, and modifies the hypothesis that eye migration is caused by frontal bone asymmetry. These findings have important implications for understanding and explaining the left/right asymmetry of eyes in flatfishes. Meanwhile, it will help to identify genes related to cell proliferation during eye migration. Obviously, the model we proposed will help us understand the role of eye migration in the ontogenesis and evolution of Pleuronectiformes.

3.4

Investigation on Eye Shapes During Flatfish Metamorphosis and Adult Flatfish

Flatfish (Pleuronectiformes) is a highly diversified taxonomic group of the Teleostei. The total number of species presently known is over 700 (Gibson 2005). In order to adapt to a benthic lifestyle, their larvae go through metamorphosis from bilateral symmetry to asymmetry (Ahlstrom et al. 1984; Youson 1988), especially both eyes locating from both sides to the same side of the head. Different species have different orientations, with their left side facing up or right side facing up. While some species (such as spiny turbots, Psettodes) have uncertain directions of eye migration. During flatfish metamorphosis, cranial deformation and eye migration are presented almost simultaneously. Therefore, in the past decades, eye migration has been hypothesized to result from cranial asymmetry. The hypothesis proposes that the torsion of skull toward ocular side is able to pull the eye upward. Subsequently, the lateral ethmoid on the blind side becomes enlarged and could push the eye upward (Brewster 1987; Wagemans et al. 1998; Okada et al. 2001). However, Bao et al. (2011) found that eye movement is not due to cranial deformation, but rather a suborbital cell proliferation on the blind side. Importantly, skull distortions rely on eye migration. The results further suggested that the migrating eye was ever pushed, rather than pulled during metamorphosis. Based on this, the eye shape can be predicted to change, viz. the vertical diameter of the migrating eye decreases gradually while the horizontal diameter increases gradually during eye movement. To figure out this, the change of eye shape was investigated during Japanese flounder and Senegalese sole metamorphosis. In addition, a detailed analysis of eye shapes in various adult flatfishes has been performed.

3.4

Investigation on Eye Shapes During Flatfish Metamorphosis and Adult Flatfish

3.4.1

73

Change of Eye Shape During Flatfish Metamorphosis

The schematic of eye diameter measurement is illustrated in Fig. 3.11. Eye diameter is shown by transverse axis (DTA, the distance between the anterior and posterior rim of exposed eyeball) and vertical axis (DVA, the distance between the upper and lower rim of exposed eyeball). The vertical and horizontal diameter of the eye during metamorphosis were measured in Japanese flounder (Paralichthys olivaceus) and Senegalese sole (Solea senegalensis). The DTA: DVA ratio (DTA/DVA) of the migrating eye was larger than that of the non-migrating eye during every stage, and progressively increased as development proceeded (Fig. 3.12). During Stage G of Japanese

Fig. 3.11 Schematic drawing of eye diameter measurement (Li et al. 2013). (a) Adult specimen, (b) the migrating eye, (c) the non-migrating eye. Arrow represents the eye diameter in vertical axis (DVA), dotted arrow represents the eye diameter in transverse axis (DTA)

Fig. 3.12 Ratio of transverse diameter axis (DTA) to vertical diameter (DVA) in both eyes during flatfish metamorphosis (stages E, F, and G) (Li et al. 2013). (a) Japanese flounder (n = 20 for each stage), (b) Senegalese sole (n = 20 for each stage). Gray box represents the migrating eye, blank box represents the non-migrating eye. The asterisk indicates significant difference (Wilcoxon signed-ranked test) between two eyes

74

3

New Tissue Models for Explaining Eye Migration

flounder, DTA/DVA of the migrating eye was significantly higher than that of the non-migrating eye (P < 0.05) (Fig. 3.12a). During Stages E to Stage G of Senegalese sole, DTA/DVA of the migrating eye also significantly increased than that of the non-migrating eye (P < 0.05) (Figure 3.12b). Nonparametric test (Wilcoxon signedranked Test) was used to compare the significant difference of DTA/DVA between both eyes.

3.4.2

The Deformation of Eye Morphology Shape During Metamorphosis Could Be Stopped by Colchicine

As previously reported, eye migration was inhibited by microinjection of colchicine into the suborbital region of Japanese flounder and Senegalese sole (Bao et al. 2011). When Japanese flounder and Senegalese sole larvae are treated with colchicine developed to a certain degree corresponding to stage G of normal larvae in body size, the eyes remain in the original position, demonstrating eye symmetry like stage E (Fig. 3.13a, b). Unlike the higher ratio of DTA/DVA in migrating eye than that in non-migrating eye in normal larvae at stage G, the ratio of DTA/DVA in both eyes remains approximately 1.0 in colchicine-microinjected larvae of both Japanese flounder and Senegalese sole at the growth phase corresponding to stage G of normal metamorphosing larvae (Fig. 3.14a, b).

Fig. 3.13 Display of eye position in eye-symmetrical flatfish caused by colchicine microinjection and normally developed flatfish reared in the same environment (Li et al. 2013). (a) Eye-symmetrical Japanese flounder at 31 DAH (above) and normal larva at stage G (below), (b) eye-symmetrical Senegalese sole at 25 DAH (above) and normal larva at stage G (below)

3.4

Investigation on Eye Shapes During Flatfish Metamorphosis and Adult Flatfish

75

Fig. 3.14 The statistical analysis of DTA: DVA ratio between colchicine-treated and normal larvae of flatfishes (Li et al. 2013). (a) Japanese flounder (31 DAH, n = 20), (b) Senegalese sole (25 DAH, n = 7 for colchicine injected larvae, n = 20 for normal larvae). Gray box represents the migrating eye, blank box represents the non-migrating eye. The asterisk indicates significant difference (Wilcoxon signed-ranked test) between two eyes

3.4.3

The Difference of Eye Diameter Between Both Eyes in Different Flatfishes

Measurement results of characters of the preserved specimens are presented in Table 3.3. The diameter of both eyes was measured based on 87 adult flatfish specimens preserved in Ichthyology Museum of Shanghai Ocean University (Shanghai, China). This includes 26 species of six families (Cynoglossidae, Paralichthyidae, Bothidae, Pleuronectidae, Poecilopsettidae, and Soleidae). Additionally, eye diameter measurements were conducted in five species of the Perciformes, Psenopsis anomala (Centrolophidae), Pampus punctatissmus and Pampus chinensis (Stromateidae), Cubiceps squamiceps (Nomeidae), and Monodactylus argenteus (Monodactylidae) from the same museum. Notably, only the species with three or more specimens were chosen in this research. All the above specimens were preserved in 10% formalin. We identified each of the fish specimens according to Li and Wang (1995), based on the classification system of Nelson (2006). The vertical and horizontal diameters of both eyes in adult specimens were measured using a vernier caliper with 0.1 mm accuracy. The length of selected adult flatfish (20 species, six families) ranges from 58.5 to 370.0 mm in standard length. The ratio of DTA/DVA in both eyes are shown in Table 3.3. The value of DTA/DVA of the migrating eye varied from 1.09 to 1.99 with an average of 1.42, whereas that of the non-migrating eye ranged from 0.95 to 1.72 with a mean of 1.28. The DTA/DVA value of migrating eye was larger than that of the non-migrating eye in each flatfish species (Table 3.3). When referring to families, the average DTA/DVA value was 1.49 in Soleidae, 1.45 in Bothidae, 1.44 in Paralichthyidae, 1.39 in Cynoglossidae, 1.39 in Pleuronectidae, and 1.33 in Poecilopsettidae. In contrast to flatfish, five deep-bodied fish species of the Perciformes with symmetric eyes, including Psenopsis anomala (Centrolophidae), Pampus punctatissmus and Pampus chinensis (Stromateidae), Cubiceps squamiceps

Cynoglossidae

Cynoglossidae

Cynoglossidae

Cynoglossidae

Cynoglossidae

Paralichthyidae

Cynoglossus roulei

Cynoglossus melampetalus Cynoglossus bilineatus

Cynoglossus gracilis

Paraplagusia japonica

Pseudorhombus elevatus Pseudorhombus cinnamoneus Pseudorhombus neglectus Pseudorhombus levisquamis Grammatobothus polyophthalmus Crossorhombus kanekonis

SFU3208

SUF3209

SFU3213

SFU3214

SFU3231

SFU3245

SFU3260

SFU3258

SFU3250

SFU3249

Bothidae

Bothidae

Paralichthyidae

Paralichthyidae

Paralichthyidae

Cynoglossidae

Cynoglossus semilaevis

SFU3206

4

3

4

3

3

4

4

6

4

3

4

9

Specimens No. 4 Standard length (mm) 93.4-119.3 (105.9) 222.1-320.1 (283.9) 91.9-272.0 (183.2) 295.3-312.3 (310.4) 299.8-370.0 (327.5) 128.1-238.7 (192.0) 239.4-300.6 (268.7) 113.5-215.3 (152.3) 163.2-211.9 (183.4) 125.5-215.9 (158.1) 173.1-287.5 (225.6) 137.0-143.1 (139.7) 91.0-140.2 (108.7)

1

1.33-1.49 (1.41)

1.34-1.48 (1.41)

1.30-1.49 (1.41)

1.13-1.68 (1.45)

1.30-1.48 (1.42)

1.32-1.66 (1.49)

1.24-1.47 (1.34)

1.12-1.44 (1.31)

1.31-1.41 (1.36)

1.48-1.54 (1.50)

1.09-1.44 (1.28)

1.34-1.99 (1.61)

DTA/DVA (movable eye) 1.15-1.52 (1.33)

2

1.18-1.35 (1.28)

1.29-1.38 (1.35)

1.23-1.42 (1.30)

0.98-1.54 (1.33)

1.24-1.38 (1.31)

1.29-1.43 (1.37)

1.17-1.29 (1.23)

0.99-1.43 (1.12)

1.23-1.36 (1.27)

1.25-1.40 (1.34)

1.06-1.34 (1.22)

1.17-1.72 (1.46)

DTA/DVA (stationary eye) 0.95-1.32 (1.11)

3

0.070

0.275

0.109

0.048*

0.109

0.109

0.068

0.028*

0.067

0.109

0.068

0.015*

Wilcoxon signed ranked Test 0.068

3

SFU3246

Family Cynoglossidae

Species Cynoglossus puncticeps

Catalog No. SFU3205

Table 3.3 Comparison of DTA/DVA ratio between two eyes in 20 species of adult flatfish (Li et al. 2013)

76 New Tissue Models for Explaining Eye Migration

Bothidae

Bothidae

Poecilopsettidae

Pleuronectidae

Soleidae

Soleidae

Laeops lanceolata

Poecilopsetta plinthus

Eopsetta grigoriewi

Zebrias quagga

Solea ovata

SFU3279

SFU3284

SFU3289

SFU3294

SFU3296

4

8

3

4

3

4

6

100.6-147.3 (125.8) 115.2-142.8 (124.8) 103.4-131.2 (119.2) 147.1-181.5 (164.7) 192.5-289.5 (254.7) 79.8-258.1 (158.4) 58.5-80.8 (68.3)

Asterisk (*) indicates a statistically significant difference 1–3 Range, and average in parentheses 2, 3 DTA, Eye diameter in transverse axis, DVA, Eye diameter in vertical axis

SFU3273

Bothidae

Crossorhombus azureus Bothus pantherinus

SFU3262

1.27-1.67 (1.41)

1.31-1.69 (1.56)

1.23-1.53 (1.39)

1.25-1.41 (1.33)

1.38-1.63 (1.53)

1.30-1.43 (1.38)

1.45-1.61 (1.51)

1.03-1.24 (1.14)

1.09-1.64 (1.33)

1.22-1.42 (1.32)

0.98-1.23 (1.08)

1.45-1.53 (1.48)

1.18-1.34 (1.28)

1.23-1.48 (1.34)

0.068

0.012*

0.109

0.50*

0.285

0.069

0.028*

3.4 Investigation on Eye Shapes During Flatfish Metamorphosis and Adult Flatfish 77

78

3

New Tissue Models for Explaining Eye Migration

(Nomeidae), and Monodactylus argenteus (Monodactylidae), were selected to measure the vertical and horizontal diameter of the eye. The ratios of DTA/DVA in both eyes were nearly identical in these five species (Table 3.4), unlike the observations in flatfishes.

3.4.4

The Eyes Ever Been Pushed During Flatfish Metamorphosis

According to Bao et al. (2011), the physical force from the suborbital cell proliferation drives eye migration during flatfish metamorphosis. Further research shows that the migrating eye of Japanese flounder (Paralichthys olivaceus) and Senegalese sole (Solea senegalensis) changes its shape during metamorphosis. The ratio of the horizontal diameter to the vertical diameter in migrating eye increases from initial eye migration to stage G, suggesting that the migrating eye receives the push force from cell proliferation. Colchicine (an inhibitor of cell proliferation) microinjection into the suborbital area of the migrating eye inhibited eye migration, but not larval development, because the colchicine-treated flatfish larvae underwent metamorphosis successfully and developed into demersal juveniles with symmetrical eyes (Bao et al. 2011). In colchicine-treated Japanese flounder and Senegalese sole, the ratio of the horizontal diameter to the vertical diameter between two eyes had no significant difference (Fig. 3.14), further suggesting that the migrating eye ever received the push force from the ventral area to the eye in normal flatfish larvae. We hypothesize that this may be a general phenomenon in flatfishes, which is the migrating eye shape changes by the push force, because the ratio of the horizontal diameter to the vertical diameter of the migrating eye was larger than that of non-migrating eye in all examined adult flatfishes (Table 3.3). In most instances, differentiation between both eyes could not be established due to specimen limitation (Table 3.3). While if there were more specimens, we believe that the difference will be significantly based on the trends of range values and average in DTA/DVA. DTA and DVA were approximately equal in the examined species of the Perciformes (Table 3.4). All of these results seem to support the hypothesis that eye migration is caused by the push force from the suborbital cell proliferation, which also changes the eye shape (Bao et al. 2011). These data indicate that the mechanisms of eye shape change and eye migration driven by suborbital cell proliferation are ubiquitous in flatfishes.

Species Psenopsis anomala Pampus punctatissmus Pampus chinensis Cubiceps squamiceps Monodsctylus argenteus

Monodactylidae

Stromateidae Nomeidae

Family Centrolophidae Stromateidae

4

6 3

Specimens No. 3 5

66.1–108.9 (92.7)

107.3–135.8 (121.0) 79.8–90.6 (84.7)

Standard length (mm) 134.1–140.2 (136.1) 82.5–177.6 (128.2)

1

Note: 1–3 Range, and average in parentheses a DTA Eye diameter in transverse axis, DVA Eye diameter in vertical axis

SFU2428

SFU2425 SFU2426

Catalog No. SFU2422 SFU2424

0.99–1.01 (1.00)

0.98–1.04 (1.01) 1.05–1.09 (1.07)

2 DTA/DVA (left eye) 0.97–1.00 (0.99) 0.96–1.03 (0.99)

0.99–1.02 (1.01)

0.99–1,01 (1.00) 1.03–1.09 (1.07)

3 DTA/DVA (right eye) 0.96–1.00 (0.98) 0.99–1.00 (1.00)

Table 3.4 Comparison of DTA/DVA ratio between two eyes in five deep-bodied fishes of Perciformes (Li et al. 2013)

0.783

0.785 0.216

Wilcoxon signed-ranked Test 0.414 0.336

3.4 Investigation on Eye Shapes During Flatfish Metamorphosis and Adult Flatfish 79

80

3.5

3

New Tissue Models for Explaining Eye Migration

The Role of Cell Apoptosis for Eye Migration During Metamorphosing Flounder

Cell apoptosis, also called programmed cell death, is a mechanism that allows cells to self-destruct. As cells rapidly proliferate during development, some of them undergo apoptosis, which is necessary for many stages in development. For example, apoptosis is involved in the remolding of small intestine during metamorphosis of amphibian Xenopus laevis (Ishizuya-Oka et al. 2010). During eye migration in flatfish metamorphosis, the loose organization around the eye socket was found in the process of flatfish eye migration (Brewster 1987). Therefore, we were left wondering whether the cell apoptosis play a role in eye migration during flatfish metamorphosis. Does cell apoptosis occur to loosen the tissues around the eye to facilitate eye moving upward? Whole-mount in situ TUNEL (terminal deoxynucleotidyl transferase (TdT)mediated dUTP nick-end labeling) was conducted to describe the temporal and spatial distribution of apoptotic cells during Japanese flounder metamorphosis from 13 DAH to 43 DAH (Bao et al. 2006). At pre-metamorphosis stage (17 DAH), cell apoptosis was not detected in the tissues around the eyes of blind side. It is only detected in the spine. The signal of cell apoptosis first appeared in the head only after eye initial migration, which is mainly distributed in the bones, however, it was not found in the tissues around the eye through the whole process of metamorphosis in Japanese flounder (Fig. 3.15). In addition, when the cell proliferation was inhibited by thiourea, a blocker of endosynthesis of thyroid hormone, the signal of cell apoptosis had not been blocked by thiourea (Fig. 3.16), indicating the cell apoptosis in head bone was not regulated by thyroid hormone, this is not same as eye migration, which is induced by thyroid hormone (Inui and Miwa 1985). These observations indicate that cell apoptosis is not involved in causing eye initial migration. Cell apoptosis can be found to appear clearly in the frontal bones after eye migration initial start in Japanese flounder (Fig. 3.17). However, the signal of cell apoptosis in frontal bone was not detected in colchicine-treated juvenile flounder

Fig. 3.15 Cell apoptosis distributional pattern in head during metamorphic stage of Japanese flounder (Bao et al. 2006). Red color indicates a positive signal. Black arrows indicate red areas of cell apoptosis

3.6

The Role of Autophagy During Eye Migration in Flatfish Metamorphosis

81

Fig. 3.16 Signal detection of cell proliferation and cell apoptosis during metamorphic stage in thiourea-treated Japanese flounder. Black arrows indicate areas of cell proliferation and cell apoptosis (Bao 2005)

Fig. 3.17 Cell apoptosis in the frontal bones during metamorphosis of Japanese flounder (Sun et al. 2015). Red dots mark cell apoptosis signals from the dorsal view

with left-right symmetric eyes, indicating that cell apoptosis in frontal bones depends on eye migration, when eye migration is blocked by inhibiting cell proliferation, the cell apoptosis would not be induced. This observation suggests that cell apoptosis in the frontal bones is responsible for eye migration to help eye migrate upward smoothly (Sun et al. 2015). The exact role of cell apoptosis in the deformation of frontal bones will be introduced in Chap. 5 of this book.

3.6

The Role of Autophagy During Eye Migration in Flatfish Metamorphosis

How is the role of another kind of programmed cell death, cell autophagy, on eye migration? Does cell autophagy cause the loose organization around the eye socket was found in the process of flatfish eye migration as Brewster described (1987)? Autophagy is the primary intracellular degradation system that contributes to maintaining cellular homeostasis. It proceeds by nonselective uptake of cytoplasmic

82

3

New Tissue Models for Explaining Eye Migration

constituents into membrane-bound vesicles, termed autophagosomes, which are formed by a double- or multiple-membraned cisterna that wraps around and encloses a portion of the cytoplasm. Once formed, the autophagosomes mature rapidly by fusion with lysosomes and acquire the proton pumps and lysosomal enzymes needed for degradation of the enclosed material (Mizushima and Komatsu 2011). Microtubule-associated protein 1 light chain 3 (MAP-LC3) is the clearest autophagy-related protein: LC3-II, modified from LC3, would combine with the membrane of autophagosome, and the combination of LC3-II and autophagosome is necessary to the complete closure of autophagosome. Therefore, gene lc3b is considered to be the marker gene of autophagy (Huang et al. 2010; Kabeya et al. 2000). Recent studies have indicated that autophagy is involved in the metamorphosis of some animals, such as fruit flies (Gábor et al. 2007; Liu et al. 2009; Tracy and Baehrecke 2013), silkworm (Yi et al. 2018; Romanelli et al. 2016), bees (Santos et al. 2014), tobacco moth (Facey and Lockshin 2010). In order to investigate the role of autophagy on metamorphosis, the quantitative RT-PCR was conducted to assess the levels of its marker gene expression during Japanese flounder (Paralichthys olivaceus) metamorphosis. lc3b, a marker gene of autophagy, expressed in the whole body at stage E, the beginning of metamorphosis, then its expression was significantly increased at stage F, and reached to highest at stage G, then fell down at stage H, later stage of metamorphosis (Fig. 3.18a). Wholemount in situ RNA hybridization further demonstrated that the signals intensity of lc3b expression at stage F and stage G was significantly higher than that at stage E and stage H in Paralichthys olivaceus (Fig. 3.18b), conforming to the quantitative RT-PCR results. The lc3b was also expressed in the area around both eyes during metamorphosis in Japanese flounder, Paralichthys olivaceus (Figure 3.18b) (Gao et al. 2022). At stage E, there were weak signals of lc3b expression around both eyes. As the eye migrates upward, the lc3b expression was getting stronger at stage F and stage G. Later when the eye migrated over dorsal midline of head at stage H, the lc3b expression became weak (Fig. 3.18b). Section view across both eyes demonstrated that lc3b expression was located on the skin around both eyes and along the ongoing migration route between two eyes, and it seems that a stronger signal of lc3b expression in the supraorbital area than that in suborbital area (Fig. 3.18b). Transmission electron microscopy (TEM) figures showed there were cell autophagy around both eyes, and autophagic vacuoles are indeed more in the supraorbital area than in the suborbital area (Fig. 3.19), conforming the above observation by whole-mount in situ RNA hybridization. To determine the role of autophagy in eye migration, 3-methyladenine (3-MA), a widely used inhibitor of autophagy was used to inhibit the formation of autophagosome membrane, to inhibit the activation of autophagy by inhibiting the production of PI3P (Wu 2010), it was microinjected four times into the supraorbital area of the blind side at 17, 21, 23, and 25 DAH of Japanese flounder (Fig. 3.20a). Appropriate 50 nl of 3-MA at 5 mM in 0.75% NaCl solution was injected into the supraorbital tissue of mobile eye of anesthetized larvae. Same amount of 0.75% NaCl solution was injected as a control.

3.6

The Role of Autophagy During Eye Migration in Flatfish Metamorphosis

83

Fig. 3.18 Expression patterns of lc3b at different stages during Japanese flounder metamorphosis by quantitation RT-PCR (a) and whole-mount in situ RNA hybridization (b) (Gao et al. 2022). (a) lc3b expression in the whole body; (b) magnified views of lc3b expression around both eyes in panel a; (c) section views of lc3b expression at stage F and stage G

The expression of lc3b in the area around the eye on blind side in Japanese flounder could be decreased by 3-MA at E stage. Compared to the normal metamorphic Japanese flounder, the signal of lc3b expression around movable eye in 3-MA injected individual was weaker (Fig. 3.20b) (Gao et al. 2022), indicating 3-MA indeed inhibited autophagy somewhat at injection area around the eye in this experiment. After four times of 3-MA injection, the eye migration could be slowed to some extent (Fig. 3.20c). At 35DAH, 94.9% of individuals (total 130 individuals survived) without 3-MA treatment their upper edge of the movable eye has moved beyond the dorsal midline (including stage H and I), while there were only 23.3% of individuals

84

3

New Tissue Models for Explaining Eye Migration

Fig. 3.19 Autophagic vacuoles in the tissues around the right eye in pro-metamorphosing Japanese flounder under the observation of TEM (Gao et al. 2022). Arrows show the autophagic vacuoles. (a) supraorbital area. (b) suborbital area

Fig. 3.20 Eye migration inhibited by 3-MA microinjection into the supraorbital area of blind side (Gao et al. 2022). (a) the supraorbital area of blind side where 3-MA was microinjected. (b) wholemount RNA in situ hybridization signal of lc3b in 3-MA injected and control Japanese flounder at stage E, red is signal. (c) representative individuals at 35 DAH with incomplete eye migration resulting from 3-MA microinjection. (d) the percentage of various Japanese flounder with eye inhibited in different locations at 35 DAH

3.6

The Role of Autophagy During Eye Migration in Flatfish Metamorphosis

85

in 3-MA treated group (total 93 individuals survived), no larvae with eye migration passed over the dorsal midline (Stage I) (Fig. 3.20d). One individual was at stage E with no observable movement of the eye on blind (left) side (Fig. 3.20d), 26.7% of individuals were at stage F, 50% of individuals were at stage G, and 23.3% of individuals were at stage H (Fig. 3.20d). These results showed cell autophagy plays a role in the eye migration during metamorphosis in the flounder. In order to determine the relationship of cell autophagy with cell proliferation in playing the role on eye migration, we compared the signal of lc3b around eyes between colchicine-microinjected and normal metamorphic flounder using wholemount in situ RNA hybridization. It was observed that lc3b expression became weak in the supraorbital area of eye on blind side after colchicine microinjection. Besides, the proportion of individuals having entered G phase was less than the control group (Fig. 3.21) (Gao et al. 2020), this observation indicates the eye migration upward would induce the cell autophagy in the supraorbital area, causing loosen space for eye to move upward easier. On the whole, we detected cell autophagy taking place in the tissues around both eyes during the eye migrating process of Japanese flounder by RT-qPCR and whole-

Fig. 3.21 Inhibition of eye migration decreased lc3b expression in Japanese flounders (Gao et al. 2022). (a), a schematic of the colchicine injection site. (b), whole-mount RNA in situ hybridization showing lc3b expression in colchicine injected and control samples at 24DAH, red is the signal, bars, 250 μm. (c), representative individuals at 28 DAH with incomplete eye migration in colchicine injected group, bars, 0.25 cm. (d), percentage of individuals at 28 DAH having entered G stage

86

3

New Tissue Models for Explaining Eye Migration

Fig. 3.22 Schematic drawing to explain the role of cell proliferation, autophagy, and apoptosis in eye migration during flatfish metamorphosis. (a), before eye migration is initiated, overproliferating cells in the suborbital areas start to generate upward force. (b), cell autophagy in the tissues surrounding either movable eye or stationary eye was induced by cell proliferation to help loosen space of the eye. Once the eye receives sufficient pushing force from proliferating cells in its suborbital area to overcome the counteracting force from the supraorbital area, it begins migrating upward. Then the frontal bones start to face the squashed by the up-migrating eye, causing cells there to start apoptosis. (c), as it migrates along the route between two eyes, the migrating eye gets more pushing force from additional proliferating cells in its enlarging suborbital area. Meanwhile, autophagy in area around eyes, especially around migrating eye was becoming more intense, and cells in the frontal bones keep apoptosis. (d), when the migrating eye reaches the place wherein pushing and counteracting forces are balanced, it finally stops migration. The autophagy around eyes and apoptosis in frontal bones became corresponding weakly. In some flatfish species, proliferating cells in their enlarging suborbital area finally ossified into a pseudomesial bar

mount in situ RNA hybridization with autophagy-related gene lc3b. More cell autophagy signals were found in the supraorbital area than that in the suborbital area, and eye migration could be blocked to some extent by injecting inhibitor of cell autophagy, and the cell autophagy could be induced by eye migration which was initiated by cell proliferation in the suborbital area. In summary, cell proliferation plays a major role in eye migration during flatfish metamorphosis, it generates force to push eye migration upward. Whereas cell autophagy and cell apoptosis play minor roles in eye migration, respectively. Both cell autophagy around eyes or cell apoptosis in the frontal bones depend on eye migration upward, and they respond to eye migration for assisting eye movement smoothly (Fig. 3.22).

3.7

Summary

Since Von Autenrieth (1800) tried to give an explanation on the location of both eyes on the same side of the head, there are many researchers have made attempts to elucidate the way in which the eye moves. We give a brief introduction to each hypothesis. We investigated the role of cell proliferation, cell apoptosis, and cell autophagy during metamorphosis in flatfish. Finally, we propose a tissue model to

References

87

explain how the eye migrates upward. That is cell proliferation plays a major role in eye migration during flatfish metamorphosis, it generates force to push eye migration upward. Both cell autophagy around eyes or cell apoptosis in the frontal bones depend on eye migration upward, they respond to eye migration for assisting eye movement smoothly.

References Agassiz A (1879) On the young stages of bony fishes. Proc Am Acad Arts Sci 14:1–25 Ahlstrom EH, Amaoka K, Hensley DA, Moser HG, Sumida BY (1984) Pleuronectiformes: development. In: Moser HG, Richards WJ, Cohen DM, Fahay MP, Kendall AW Jr, Richardson SL (eds) Ontogeny and systematics of fishes. Allen Lawrence, Kansas, pp 640–670 Amaoka K (1972) Studies on the larvae and juveniles of the sinistral flounders. III Laeops kitaharae. Jpn J Ichthyol 19:154–165 Aritaki M, Seikai T (2004) Temperature effects on early development and occurrence of metamorphosis-related morphological abnormalities in hatchery-reared brown sole Pseudopleuronectes herzensteini. Aquaculture 240:517–530 Aydin I (2012) The external abnormalities of hatchery-reared Black Sea flounder (Platichthys flesus luscus Pallas, 1984) in Turkey. Turk J Fish Aquat Sci 12:127–133 Bao B (2005) A new model on right eye migration in metamorphosing flounder and relative genes screened. Fudan University, Ph.D. Dissertation Bao B, Ke Z, Xing J, Peatman E, Liu Z, Xie C, Xu B, Gai J, Gong X, Yang G, Jiang Y, Tang W, Ren D (2011) Proliferating cells in suborbital tissue drive eye migration in flatfish. Dev Biol 351:200–207 Bao B, Yang G, Ren D (2006) Apoptosis in the metamorphosis of Japanese flounder Paralichthys olivaceus. Acta Zool Sin 52(2):355–361. In Chinese Baricordi OR, Melchiorri L, Adinolfi E, Falzoni S, Chiozzi P, Buell G, Virgilio FD (1999) Increased proliferation rate of lymphoid cells transfected with the P2X7ATP receptor. J Biol Chem 274:33206–33208 Battista AG et al (2009) Extracellular ADP regulates lesion-induced in vivo cell proliferation and death in the zebrafish retina. J Neurochem 111:600–613 Benetti DD, Leingang AJ, Russo R, Powell TM, Cleary D, Grabe SW, Feeley MW, Stevens OM, Main KL (2001) Development of aquaculture methods for southern flounder, Paralichthys lethostigma: I. spawning and larval culture. J Appl Aquac 11:113–133 Bergstrom CA (2007) Morphological evidence of correlational selection and ecological segregation between dextral and sinistral forms in a polymorphic flatfish, Platichthys stellatus. J Evol Biol 20:1104–1114 Bergstrom CA, Palmer AR (2007) Which way to turn? Effect of direction of body asymmetry on turning and prey strike orientation in starry flounder Platichthys stellatus (Pallas) (Pleuronectidae). J Fish Biol 71:737–748 Bi S, Zheng Z, Lin R (1987) A preliminary study on the reversal of the flatfish (Pseudopleuronectes yokohame Günther). J Fish China 11(2):93–99 Bisbal GA, Bengtson DA (1993) Reversed asymmetry in laboratory-reared summer flounder. The progressive fish-culturist 55:106–108 Boklage CE (1984) On the inheritance of directional asymmetry sidedness in the starry flounder, Platichthys stellatus, additional analyses of Policansky’s data. Behav Brain Sci 7:725–762 Brewster B (1987) Eye migration and cranial development during flatfish metamorphosis: a reappraisal (Teleostei: Pleuronectiformes). J Fish Biol 31:805–834

88

3

New Tissue Models for Explaining Eye Migration

Campinho MA, Silva N, Martins GG, Anjos L, Florindo C, Roman-Padilla J, Garcia-Cegarra A, Louro B, Manchado M, Power DM (2018) A thyroid hormone regulated asymmetric responsive Centre is correlated with eye migration during flatfish metamorphosis. Scientific Report 8:12267 Evseenko SA (1978) Some data on metamorphosis of larvae of the genus Bothus (Pisces, Bothidae) from the Caribbean Sea. Zool Zh 57:1040–1047 Facey COB, Lockshin RA (2010) The execution phase of autophagy associated PCD during insect metamorphosis. Apoptosis 15(6):639–652 Fornbacke M, Gombrii M, Lundberg A (2002) Sidedness frequencies in the flounder Platichthys flesus (Pleuronectiformes) along a biogeographical cline. Sarsia 87:392–395 Friedman M (2008) The evolutionary origin of flatfish asymmetry. Nature 454(7201):209–212 Futch CR (1977) Larvae of Trichopsetta ventralis (Pisces: Bothidae), with comments on intergeneric relationships within the Bothidae. Bull Mar Sci 27:740–757 Gao L, Huang Y, Sun M, Bao B (2022) The role of autophagy on eye migration during the metamorphosis of Paralichthys olivaceus. Cells & Development 169(2022):203751 Gábor J, Balázs E, Miklós S, Thomas PN (2007) Atg7-dependent autophagy promotes neuronal health, stress tolerance, and longevity but is dispensable for metamorphosis in drosophila. Genes Dev 21(23):3061–3066 Giard A (1877) Le developpement des Pleuronectes. Rev Sci Nut 6:133–139 Gibson RN (2005) Flatfishes: biology and exploitation. Blackwell Science, Oxford Hashimoto H, Mizuta A, Okada N, Suzuki T, Tagawa M, Tabata K, Yoshihiro Y, Sakaguchi M, Tanaka M, Toyohara H (2002) Isolation and characterization of a Japanese flounder clonal line, reversed, which exhibits reversal of metamorphic left-right asymmetry. Mech Dev 111:17–24 Houde ED, Futch CR, Detwyler R (1970) Development of the lined sole, Achirus lineatus, described from laboratory reared and Tampa Bay specimens. Florida Depr nut. Resources Mar Res Lab Tech Ser 62:1–43 Huang X, Bai HM, Chen L, Li B, Lu Y (2010) Reduced expression of LC3B-II and Beclin 1 in glioblastoma multiforme indicates a down-regulated autophagic capacity that relates to the progression of astrocytic tumors. Journal of Clinical Neuroscience Official Journal of the Neurosurgical Society of Australasia 17(12):1515–1519 Hubbs CL, Kuronuma K (1942) Hybridization in nature between two genera of flounders in Japan Papers of the Michigan Academy of Science Arts and Letters, Vol. 27 Yi H, Yang W, Wu W, Li X, Deng X, Li Q, Cao Y, Zhong Y, Huang Y (2018) BmCalpains are involved in autophagy and apoptosis during metamorphosis and after starvation in Bombyx mori. Insect Science 25(3):379–388 Inui Y, Miwa S (1985) Thyroid hormone induces metamorphosis of flounder larvae. Gen Comp Endocr 60:450–454 Ishizuya-Oka A, Hasebe T, Shi Y (2010) Apoptosis in amphibian organs during metamorphosis. Apoptosis 15(3):350–364 Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Yoshimori T (2000) LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 19(21):5720–5728 Kang DY, Lee JH, Kim WJ, Kim HC (2012) Morphological specificity in culture starry flounder Platichthys stellatus reared in artificial facility. Fisheries and Aquatic Science 15(2):117–123 Kyle HM (1921) The asymmetry, metamorphosis and origin of flatfishes. Phil Trans Roy Soc BCCXI:75–129 Li L, Zheng J, Bao B, Berendzen PB (2013) Change of eye shape during the metamorphosis in two flatfishes Paralichthys olivaceus and Solea senegalensis, with comparison of eye shape within the Pleuronectiformes. Ichthyol Res 60(2):178–183 Li S, Wang H (1995) Fauna Sinica: Ostichthyes: Pleuronectiformes, 1st edn. Science Press, Beijing, China Liu Y, Liu HH, Sheng LI (2009) Apoptosis and autophagy during Drosophila metamorphosis. Chinese Bulletin of Entomol

References

89

López AV, Müller MI, Radonic M, Bambill GA, Boccanfuso JJ, Bianca FA (2009) Larval culture technique and quality control in juveniles of flounder. Paralichthys orbignyanus (Valenciennes, 1839) in Argentina. Span J Agric Res 7:75–82 Mayhoff H (1914) Zur Ontogenese des Kopfes der Plattfishce. Zool Anz 43:389404 Meckel JF, 1822. Atiatomisch-Physiologische Beobachtungen und Untersuchungen Meckel JF (1824) Systetn der vergleichenden Anatomie. Theil2. Abt I:374–377 Minami T (1981) The early life history of a sole Heteromycterisjaponicus. Bull. Jar. Soc. Minami T (1982) The early life history of a flounder Paralichthys olivaceus (in Japanese). Bull Jpn Soc Sci Fish 48:1581–1588 Mizushima N, Komatsu M (2011) Autophagy: renovation of cells and tissues. Cell 147(4):728–741 Munroe TA (1996) First record of reversal in Symphurus vanmelleae (Pleuronectiformes: Cynoglossidae), a deep-water tongue fish from the tropical eastern Atlantic. Cybium 20:47–53 Munroe TA (2005) Systematic diversity of the Pleuronectiformes. In: Gibson RN (ed) Flatfishes: biology and exploitation. Blackwell Publishing, Oxford, pp 10–36 Nelson JS (2006) Fishes of the world, 4th edn. John Wiley & Sons, Inc., Hoboken, New Jersey Nishikawa T (1897) On a mode of the passage of the eye in a flatfish. Annot. Zool, Jap Norman JR (1934) In: Vol I, Psettodiae B, Pleuronectidae. (eds) A Systetnatic monograph of the Flarfslies (Heterosomata). British Museum (Natural History), London Okada N, Takagi Y, Seikai T, Tanaka M, Tagawa M (2001) Asymmetrical development of bones and soft tissues during eye migration of metamorphosing Japanese flounder Paralichthys olivaceus. Cell Tissue Res 304:59–66 Okada N, Takagi Y, Tanaka M, Tagawa M (2003a) Fine structure of soft and hard tissues involved in eye migration in metamorphosing Japanese flounder (Paralichthys olivaceus). Anat Rec 273A:663–668 Okada N, Tanaka M, Tagawa M (2003b) Histological study of deformity in eye location in Japanese flounder Paralichthys olivacues. Fisheries Science (Japan) 69:777–784 Peterson JR et al (2014) Treatment of heterotopic ossification through remote ATP hydrolysis. Sci Transl Med 6:255ra132 Pfeffer G (1886) Uber die Schiefheit der Pleuronectidae. Abh. Naturw. Ver, Hamburg, p 9 Policansky D (1982a) The asymmetry of flounders. Science 246:96–102 Policansky D (1982b) The asymmetry of flounders. Sci Am 246:116–122 Romanelli D, Casartelli M, Cappellozza S, Eguileor MD, Tettamanti G (2016) Roles and regulation of autophagy and apoptosis in the remodelling of the lepidopteran midgut epithelium during metamorphosis. Sci Rep 6:32939 Rosenthal F (1821) Ichthyotomische Tafeln, Berlin, pp 5–8 Russo T, Pulcini D, Costantini D, Pedreschi D, Palamara E, Boglione C et al (2012) “Right” or “wrong”? Insights into the ecology of sidedness in european flounder, Platichthys flesus. J Morphol 273:337–346 Sæle Ø, Silva N, Pittman K (2006) Post-embryonic remodelling of neurocranial elements: a comparative study of normal versus abnormal eye migration in a flatfish, the Atlantic halibut. J Anat 209:31–41 Santos DE, Azevedo DO, Campos LAO, Zanuncio JC, Serrão JE (2014) Melipona quadrifasciata (hymenoptera Apidae) fat body persists through metamorphosis with a few apoptotic cells and an increased autophagy. Protoplasma 252(2):1–9 Schreiber AM (2006) Asymmetric craniofacial remodeling and lateralized behavior in larval flatfish. J Exp Biol 209(4):610–621 Schreiber AM (2013) Flatfish: an asymmetric perspective on metamorphosis. Curr Top Dev Biol 103:167–194 Seshappa G, Bimachar BS (1955) Studies on the fishery and biology of the Malabar sole, Cynoglossus semifasciatus day. Indian Journal of Fisheries:180–230 Steenstrup J (1865) Skjaevheden hos flyndrene. K. Danske Vidensk. Selsk. Skr

90

3

New Tissue Models for Explaining Eye Migration

Sun M, Wei F, Li H, Xu J, Chen X, Gong X, Tian Y, Chen S, Bao B (2015) Distortion of frontal bones results from cell apoptosis by the mechanical force from the up-migrating eye during metamorphosis in Paralichthys olivaceus. Mech Dev 136:87–98 Suzuki et al. (2009) Metamorphic pitx2 expression in the left habenula correlated with lateralization of eye-sidedness in flounder Thomson W (1865) Notes on prof. Steenstrup’s views on the obliquity of flounders. Annls Mag Nut Hist 3(15):361–371 Tracy K, Baehrecke EH (2013) The role of autophagy in drosophila metamorphosis. Curr Top Dev Biol 103(103):101–125 Traquair RH (1865) On the asymmetry of the Pleuronectidae, as elucidated by an examination of the skeleton in the turbot, halibut, and plaice. Trans Linn Soc (Lond) 25:263–296 von Autenrieth JHF (1800) Bernerkungen uber den Ban der Scholle (Pleuronecres plaressa) insbesondere, und den Ban der Fische, hauptsachlich ihres Skelets im Allgemeinen. Arch Zool Zootom 1:47–103 von Beneden MPJ (1853) Note sur la symetrie des poissons Pleuronectesdans lejeune age. Annls Sci Nut 3e Ser 20:340–342 Wagemans F, Focant B, Vandewalle P (1998) Early development of the cephalic skeleton in the turbot. J Fish Biol 52:166–204 Williams SR (1901) The changes in the facial cartilaginous skeleton of the flatfishes, Pseudopleuronectes americanus (a dextral fish) and Bothus maculatus (sinistral). Science New Ser 13:378–379 Williams SR (1902) Changes accompanying the migration of the eye and observations on the tractus opticus and tectum opticum in Pseudopleuronectes americanus. Bull Mus Comp Zool 40:1–57 Wu YT (2010) Dual role of 3-Methyladenine in modulation of autophagy via different temporal patterns of inhibition on class I and III phosphoinositide 3-kinase. J Biol Chem 285(14): 10850–10861 Youson JH (1988) First metamorphosis. In: Hoar WS, Randall DJ (eds) Fish physiology, Excretion, ionic regulation, and metabolism, vol 1. Academic Press, San Diego, pp 135–196

Chapter 4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Abstract In Japanese flounder, eye migration is regulated by thyroid hormone through T3 binding to thyroid hormone receptors TRαA and TRβ1. Furthermore, we found that the regulation of thyroid hormone can be affected by retinoic acid. Several candidate genes under the regulation of thyroid hormone might be involved in cell proliferation around the eye on the blind side. The environmental factors associated with thyroid hormone and retinoic acid signaling pathways are under discussed as well. Keywords Eye migration · Thyroid hormone · Retinoic acid · Cell proliferation · Metamorphosis

4.1 4.1.1

Thyroid Hormone Regulating Eye Migration Thyroid Hormone Might Mediate Eye Migration in Various Flatfishes

The asymmetry of flatfishes is one of the most striking body forms among vertebrates with both eyes being located on only one side of the body. Migration of the eye occurs at the beginning of the asymmetrical development. It was proposed that the role of the thyroid hormone in metamorphosing flatfish larvae is comparable to that in amphibian metamorphosis. In Japanese flounder, Paralichthys olivaceus, it is the first report that exogenous thyroxine (T4) could accelerate the process of metamorphosis, while thiourea, an inhibitor of thyroid hormone synthesis could arrest the metamorphosis (Inui and Miwa 1985). The metamorphic events of Japanese flounder larvae are dependent on the thyroid hormone concentration, a high concentration of thyroid hormone could accelerate the migration of the eye, whereas treatments of thiourea inhibited the translocation of the eye in Japanese flounder (Miwa and Inui 1987) (Fig. 4.1). Later, the roles of thyroid hormone and its nuclear localized receptors in mediating metamorphosis of various flatfishes have been investigated, such as in Japanese flounder, summer flounder (Paralichthys dentatus), Atlantic halibut (Hippoglossus hippoglossus), spotted halibut (Verasper variegatus), © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_4

91

92

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.1 Metamorphosis arrested by thiourea in flatfish. (a) Thiourea-treated Chinese tongue sole (Cynoglossus semilarvis) with left-right symmetric eyes; (b) Thiourea-treated Japanese flounder (Paralichthys olivaceus) with left-right symmetric eyes

Senegalese sole (Solea senegalensis), and turbot (Scophtalmus maximus) (Miwa et al. 1988; De Jesus et al. 1991; Yamano and Miwa 1998; Schreiber and Specker 1998; Marchand et al. 2004; Tagawa and Aritaki 2005; Galay-Burgos et al. 2008; Klaren et al. 2008; Manchado et al. 2009). Deiodinases, enzymes that modulate the activity of thyroid hormone in peripheral tissues, have also been recently characterized in flatfish, such as in Senegalese sole and Japanese flounder (Isorna et al. 2009; Itoh et al. 2010).

4.1.2

Thyroid Hormone Regulating Eye Migration Direct During Metamorphosis in Japanese Flounder

Thyroid hormones play a pivotal role in regulating metamorphosis of fishes, however, there has been no study showing whether the thyroid hormone regulates eye migration directly during metamorphosis in flatfish. Thiourea or methimazole (MMI) can inhibit the thyroid synthesis, the administration of thiourea or methimazole could block flatfish eye migration by decreasing the level of thyroid hormone in serum, however, these treatments will not only inhibit eye migration but also arrest other metamorphosis events, keeping the fish at the larval stage (Inui and Miwa 1985; Miwa et al. 1988; De Jesus et al. 1991; Yamano and Miwa 1998; Schreiber and Specker 1998; Marchand et al. 2004; Tagawa and Aritaki 2005; Galay-Burgos et al. 2008; Klaren et al. 2008; Manchado et al. 2009). Therefore, if we thought that eye migration is regulated by thyroid hormone directly, we need to provide more data. For example, if we can inhibit the function of thyroid hormone receptors, it should be the best way. However, so far there is no blocker of thyroid hormone receptors available, and it is very difficult to knock out the gene in marine fish genomes. Actually, we have tried to knock down the gene expression of thyroid hormone receptor TRαA in suborbital area on blind side. We inject morpholino antisense oligo of trαA in suborbital area on blind side in Japanese flounder before eye migration, we have seen the eye migrating getting slower at metamorphic stage, however, the block efficiency of eye migration depended on the multi-time microinjection and electric pulse, the larvae could suffer these treatments and finally died.

4.1

Thyroid Hormone Regulating Eye Migration

93

Fig. 4.2 Whole mount immunofluorescence of T4 and T3 in the skin around the eyes of metamorphic Japanese flounder (Shao et al. 2017). T4 distribution in pre-metamorphic larva (a) and pro-metamorphic larva (b) and negative control (c). T3 distribution in pre-metamorphic larva (d) and pro-metamorphic larva (e) and negative control (f)

Indeed, it is very difficult to study the direct role of thyroid hormone through injecting antisense RNA or antibody, which is the biomacromolecule and hard to be absorbed by the cells in suborbital area. The alternative way can prove the direct role of thyroid hormone in regulating eye migration, is to check whether thyroid hormone and their receptors express in suborbital areas on the blind side, where the proliferating cells push eye migration. If it is, we can say yes. Why? On one hand, thyroid hormone distributes in the tissue associated with eye migration, in another hand, block the synthesis of thyroid hormone with thiourea or methimazole can stop the eye migration. Since triiodothyronine (T3) activity is three to four times more potent than T4, thyroid hormone, mainly T3, plays important roles during postembryonic development including fish metamorphosis. However, because of very few amounts of T3 in the whole body of larva, its distribution in different tissues during fish postembryonic development is not easy to be detected. In order to discern the distribution pattern of T4 and T3, immunofluorescence staining with T4 or T3 antibody was used. Just before metamorphosis (16 days after hatching, pre-metamorphosis stage) in Japanese flounder, few T4 could be found in the suborbital area. At the pro-metamorphosis stage (21 days after hatching), T4 signal in the area around the eyes becomes evident. Moreover, the distribution pattern present left-right asymmetrically, that is on blind side, more T4 could be found in the suborbital area than in supraorbital, vice versa on ocular side (Fig. 4.2a). Even though the signal was weak, T3 distributed left/right asymmetrically around eyes

94

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.3 Expression of three deiodinase genes in the skin around the eyes of Japanese flounder during metamorphosis (Gai and Bao 2014; Shao et al. 2017). Hybridization signals are red. (a) pre-metamorphic larva. (b) pro-metamorphic larva. (c) larva at metamorphic climax. (d) postmetamorphic juvenile

in pro-metamorphosis flounder as well (Fig. 4.2b). The distribution pattern of thyroid hormone coincided with the pattern of proliferating cells around the eyes during Japanese flounder metamorphosis (Fig. 4.2c, Bao et al. 2011). The expression of deiodinases genes during metamorphosis presents a similar pattern as the distribution of thyroid hormone. The concentration of T3 in local tissue is regulated by deiodinases. There are three types of deiodinases in Japanese flounder, deiodinase 1 (dio1), deiodinase 2 (dio2), and deiodinase 3 (dio3). T4 can be converted into the more active T3 by dio1 and dio2, and T3 can be degraded into no active T2 (Gereben et al. 2008). During metamorphosis of Japanese flounder, all three deiodinase genes expressed in the tissue around both eyes, however, dio1 did present an asymmetric pattern between suborbital and supraorbital areas. Dio2 is responsible for converting T4 to T3, its gene expression pattern is matched with the thyroid hormone distribution pattern around the eyes, and Dio3 charging for converting T3 to T2, or T4 to no active reverse T3, presents the same asymmetric pattern as well, and this pattern became progressively asymmetric with the development toward climax (Fig. 4.3), indicating local concentration of T4 and T3 to regulating eye migration mainly depend on the Dio2 and Dio3, not Dio1. Thus the availability of thyroid hormone in cells is tightly regulated by the equilibrium between the activity of dio2 and dio3, as found in Xenopus metamorphosis. Concomitant with dio2 expression, major tissue changes, such as tail resorption were detected during metamorphosis. While overexpression of dio3 in Xenopus laevis inhibits certain metamorphic changes such as tail resorption (Huang et al. 2001; Cai and Brown 2004). Thyroid hormone regulates gene transcription mostly by binding to its nuclear receptors. The amino acid sequence of the thyroid hormone receptors (TRs) is highly

4.1

Thyroid Hormone Regulating Eye Migration

95

Fig. 4.4 Asymmetric expression of trαA and trβ1 in the skin around the eyes of Japanese flounder during metamorphosis (Shao et al. 2017). Hybridization signals are red. (a) pre-metamorphic larva. (b), pro-metamorphic larva. (c) larva at metamorphic climax. (d) post-metamorphic juvenile

conserved through evolution. In mammals, there are two types of TR (α and β), whereas in Xenopus laevis, there are two TRα (A and B) and two TRβ (A and B) (Yaoita et al. 1990). There are four TR isoforms identified in Japanese flounder, including two α types (TRαA and TRαB) and two β types (TRβ1 and TRβ2). trβ1 and trβ2 are alternative splice forms of trβ, with a difference of 60-base pair deletion in trβ1 mRNA (Yamano et al. 1994; Yamano and Inui 1995). Among four TRs in Japanese flounder, trαA and trβ1 in the suborbital area had a higher expression than that in the supraorbital area on blind side (right side) at Stage G. The expression pattern in the area around eye on the ocular side (left side) was just reversed (Fig. 4.4). This specific pattern of trαA and trβ1 further provides evidence that TRαA and TRβ1 function in eye migration, and through regulating cell proliferation. However, trαB and trβ2 didn’t show significant asymmetric expression during metamorphosis in Japanese flounder (Fig. 4.5). We also performed methimazole (2-Mercapto-1-methylimidazole) treatment on pre-metamorphic larvae and found that methimazole blocked Japanese flounder metamorphosis inhibiting eye migration (Fig. 4.6). In order to see whether exogenous thyroid hormone can rescue the methimazole effect, larvae were rescued by administering T3 after methimazole treatment. The results showed that methimazole treatment for 4 days induced high mortality and dramatically slowed the progress of metamorphosis compared to control groups. No larvae of the methimazole treatment group achieved climax of metamorphosis while 63% of control larvae reached

96

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.5 Symmetric expression of trαB and trβ2 in the skin around the eyes of Japanese flounder during metamorphosis (Shao et al. 2017). Hybridization signals are red. (a) pre-metamorphic larva. (b) pro-metamorphic larva. (c) larva at metamorphic climax. (d) post-metamorphic juvenile

Fig. 4.6 Treatment with 2-Mercapto-1-methylimidazole (MMI) inhibited eye migration in Japanese flounder (Shao et al. 2017). (a) Blind side of control; (a1) increased magnification of a blind side view of the head; (b) Ocular side of control; (b1), increased magnification of an ocular side view of the head; (c) Blind side of the fish after MMI treatment; (c1), increased magnification of a blind side view of the head; (d), Ocular side of the fish after MMI treatment; (d1), increased magnification of an ocular side view of the head

metamorphic climax. After rescue by T3, about 81% and 72% of larvae treated with methimazole underwent a metamorphosis and achieved the post-metamorphic stage as the control group (Table 4.1). Therefore, exogenous thyroid hormones rescue the effect caused by methimazole treatment.

4.1

Thyroid Hormone Regulating Eye Migration

97

Table 4.1 Rescue effect of T3 on metamorphosis of Japanese flounder treated with 2-Mercapto-1methylimidazole (Shao et al. 2017) No. of larvae at 20 DAH Pre-metamorphosis 600 (group A) 800 (group A) 200 (control)

No. of larvae at 24 DAH preproclimax 100 27 0 156 82 0 0 62 106

post 0 0 0

No. of larvae at 30 DAH preproclimax 0 0 16 0 1 14 0 0 0

post42 64 142

Fig. 4.7 Expression of dio2 and dio3 in the skin around the eyes of pro-metamorphic Japanese flounder after 4-days of methimazole administration (Shao et al. 2017). Hybridization signals are red. (a1–a4), dio2 expression pattern. (b1–b4), dio3 expression pattern

Fig. 4.8 Asymmetric expression of traA and trβ1 in the skin around the eyes of pro-metamorphic Japanese flounder was downregulated after 4-days of treatment with methimazole (Shao et al. 2017). Hybridization signals are red. (a1–a4) traA expression pattern. (b1–b4) trβ1 expression pattern

How the treatment of methimazole can inhibit eye migration? In methimazoletreated flounder, the asymmetric expression pattern of dio2, dio3, trαA, and trβ1 became not evident, compared with normal metamorphosing flounder (Figs. 4.7 and 4.8). Therefore, methimazole blocked Japanese flounder metamorphosis inhibiting

98

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

eye migration might by impairing the asymmetric expression of dio2, dio3, trαA, and trβ1. It should be noted here that our above results published in 2017 (Shao et al. 2017) are the first time to show the distribution of thyroid hormones, the gene expression of deiodinases and thyroid hormone receptors (TRs) in the tissues around eyes during flatfish metamorphosis. Moreover, it is also the first time to figure out that specific deiodinases (dio2 and dio3) and thyroid hormone receptors (traA and trβ1) play the role in regulating eye migration in flatfish (Shao et al. 2017).

4.2

4.2.1

The Role of Retinoic Acid in Modulating Eye Migration Via Cross-Talk with Thyroid Hormones in Japanese Flounder Does Eye Migration Regulated Only by Thyroid Hormone in Flatfish

Beside thyroid hormone, whether there exist other hormones or molecules can regulate eye migration? Thyroid hormone receptor (TR) is regarded as the dual role during development that it generally activates the transcription of target genes in the presence of thyroid hormone and repress their transcription in its absence (Wolffe 1997). In amphibians, the metamorphosis is supposed to be regulated totally by thyroid hormone that is before metamorphosis with absence of T3, Xenopus unliganded TR and RXR (retinoid X receptor) bind the thyroid hormone response element (TRE) and recruit a corepressor complex containing NCoR (Nuclear Receptor Corepressor) and histone deacetylases (HDAC). HDACs can close chromatin, so transcription factors cannot access DNA furthermore suppressing gene expression. As the concentration of T3 increasing, more T3 enter nuclear to bind with TR, then a conformational change takes place in the heterodimer. Liganded TR releases the corepressor complex and can recruit several coactivator complexes, such as SRC/P300 coactivator complex to open the chromatin for full activation of target genes (Morvan-Dubois et al. 2008). In flatfish metamorphosis, does the thyroid hormone receptor play a dual function as well in regulating eye migration? The treatment with exogenous T4 could not induce eye migration in Japanese flounder when larvae were at new hatching to 10 days after hatching, instead, the treatment only could promote body growth (Bao et al. 1999). Moreover, the timing of exogenous thyroid hormone treatment could affect eye migration in spotted halibut (Verasper variegatuscan), indicating the timing of thyroid hormone increase might be the determining factor of “which eye to move” (Tagawa and Aritaki 2005). These observations indicate that thyroid hormone maybe not an only factor to mediate metamorphosis in flatfish. A few studies have shown that TRs and RXRs function together to mediate the regulatory effect of thyroid hormone on metamorphosis in Xenopus (Wong and Shi

4.2

The Role of Retinoic Acid in Modulating Eye Migration Via Cross-Talk. . .

99

Table 4.2 Flatfish orthologs in the retinoic acid signaling pathway enriched in the DEGs during metamorphosis (Shao et al. 2017) Gene symbol Rxra Rxrg Rarg aldh1l2 rbp2 raet1 rdh12 rbp3 Lrat

Protein annotation Retinoic acid receptor RXR-alpha-A Retinoic acid receptor RXR-gamma-B Retinoic acid receptor gamma-A Aldehyde dehydrogenase family 1 member L2 Retinol-binding protein 2 Iodotyrosine dehalogenase 1 Retinol dehydrogenase 12 Retinol-binding protein 3 Lecithin retinol acyltransferase

1995; Wang et al. 2008), however, the role of RXRs ligand 9-cis-retinoic acid (9cRA) has been not clear in regulating the metamorphosis in a vertebrate. RXR is a partner of TR-RXR heterodimer, its ligand function should not be neglected. Retinoic acid (RA) pathway genes were found enriched in metamorphic flatfishes (Shao et al. 2017). The strong positively selected genes involved in the RA system were found, such as aldh1l2 and rbp4b in Japanese flounder and aldh1l1 and rdh12 in Chinese tongue sole. Significant enrichment of RA pathway genes with differential expression were observed between pre-metamorphosis stage and metamorphic stage, including rxra, rxrg, rarg, aldh1l2, rbp2, raet1, rdh12, rbp3, and lrat, as shown in Table 4.2, indicating their involvement in asymmetry formation including eye migration.

4.2.2

Coincident Genes Expression Patterns of the Thyroid Hormone and Retinoic Acid Signaling Pathways

We hypothesized that DEGs of the RA signaling pathway might explain the acquisition of thyroid hormone signaling pathway asymmetry during metamorphosis, and that this cross-talk could be the basis for the generation of asymmetry in flatfish. Retinoic acid (RA), mainly all-trans-retinoic acid (ATRA) and 9-cis-retinoic acid (9cRA), regulate the expression of target genes via activation of two classes of nuclear retinoid receptors, the retinoic acid receptors (RARs) and the retinoid X receptors (RXRs). There exist three subtypes of RXRs (RXRα, RXRβ, and RXRγ) and three subtypes of RARs (RARα, RARβ, and RARγ) in flounder. Generally, RXRs are the receptors of 9cRA, RARs mainly are the higher affinity receptors of ATRA, but also can be the lower affinity receptors of 9cRA (Allenby et al. 1993). Retinoic acids are the derivatives of retinol (vitamin A). Retinol is first oxidized to retinaldehyde and then to retinoic acid. A number of enzymes catalyze the oxidation of retinol to retinaldehyde including alcohol dehydrogenases (ADH) as well as several enzymes (retinal dehydrogenase, RALDH) able to catalyze the oxidation

100

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

of retinaldehyde to retinoic acid. Retinoic acid catabolism is also important for controlling RA levels in cells, and it is performed by cytochrome P450 (CYP26). Since retinol, retinaldehyde, and retinoic acid are lipids, they must be bound to proteins within cells, including cellular retinol-binding protein (CRBP) and cellular retinoic acid-binding proteins (CRABP). During the metamorphosis of Japanese flounder, coincident genes expression patterns of the thyroid hormone receptors and retinoic acid receptors were found in eye migration-related tissue. Trs and rxrs were asymmetrically expressed around the Japanese flounder blind eye during metamorphosis, whereas rarα, but not the other rars, was also asymmetrically expressed (Fig. 4.9). However, only the heterodimers (rxrα/trα, rxrα/trβ, rarα/trα, and rarα/trβ) exhibited a consistent left-right asymmetric distribution in skin tissue around the eyes during the pro-metamorphosis stage (Fig. 4.9). Furthermore, the yeast two-hybrid assay shows that rxrα and rxrβ heterodimerize with trαa and trβ1, respectively, in Japanese flounder (Shao et al. 2017). Moreover, genes related to retinoic acid metabolism (such as cyp26, rbp2, aldh1, aldh2, and aldh3) indicated different expression levels of asymmetry during different metamorphic stages (Figs. 4.10 and 4.11), indicating retinoic acid might distribute around eye asymmetrically. Unfortunately, so far there is no antibody of retinoic acid available to conduct immunostaining to detect the distribution of retinoic acid around the eyes during the metamorphosis in Japanese flounder. Furthermore, the expressions of dio3, trαa, and trβ1 were suppressed when treated with the inhibitor of thyroid hormone, methimazole. As expected, methimazole treatment also reduced mRNA expressions of rxrα and rarα (Fig. 4.12), indicating a strong interaction between thyroid hormone and retinoic acid-dependent signaling. In summary, genes of the thyroid hormone and retinoic acid signaling pathways had coincident expression patterns in the region of the head most profoundly modified during metamorphosis.

4.2.3

The Eye Migration Inhibited by Retinoic Acid in Japanese Flounder

In order to further test the role of retinoic acid (RA) on the eye migration, we injected the 9-cis-RA (9cRA), ATRA (all-trans retinoic acid), 13-cis-RA (13cRA), and dimethyl sulfoxide (DMSO, control) into the suborbital area of the prospective blind side eye of pre-metamorphic Japanese flounder larvae, respectively (Fig. 4.12). Injection of 9cRA or ATRA into the suborbital area of the prospective blind side eye of pre-metamorphic Japanese flounder larvae inhibited eye migration in 95% and 97% of the larvae, respectively (Fig. 4.13a). In 9cRA treatment, 83 individuals survived: 40 pre-metamorphic larva (48%), 34 pro-metamorphic larva (41%), 5 at metamorphic climax (6%), and 4 post-metamorphic juveniles

4.2

The Role of Retinoic Acid in Modulating Eye Migration Via Cross-Talk. . .

101

Fig. 4.9 Double fluorescence in situ hybridization (D-FISH) analysis for co-expression of trαA, trβ1 and rxr, rar genes in Japanese flounder (Shao et al. 2017). The cRNA probes of trαA and trβ1 genes were labeled with biotin and detected with anti-Biotin-FITC antibodies. Rxrs (rxrα, rxrβ, and rxrγ) and rars (rarα, rarβ and rarγ) cRNA probes were labeled with digoxygenin and detected with anti-Digoxygenin-Rhodamine antibodies. Panel a–f represents the blind side and ocular side views of the results obtained with the probes trαA and trβ1 and rxrα, rxrβ, rxrγ, and rarα, rarβ, rarγ, respectively

(5%). In ATAR treatment, 99 individuals survived: 24 pre-metamorphic larva (34%), 60 pro-metamorphic larva (52%), 12 at metamorphic climax (10%), and 3 post-metamorphic juveniles (3%). Injection of a noncompeting RXRα ligand, 13cRA, inhibited eye migration in 42% of the larvae (versus 37% for the DMSO control). In 13cRA treatment, 59 individuals survived: 25 at metamorphic climax (42%), and 34 post-metamorphic juveniles (58%) (Fig. 4.13b). In the control group with DMSO treatment, 70 individuals survived: 24 at metamorphic climax (34%) and 44 post-metamorphic juveniles (63%) (Fig. 4.13b). Obviously, only 5% and 3% of pre-metamorphic larvae which were injected with either 9cRA or ATRA, respectively, in the suborbital area of the blind side eye,

102

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.10 The expression pattern of cyp26 and rbp2 in the skin around the eyes is similar to the distribution pattern of proliferating cells in the Japanese flounder (Shao et al. 2017). Hybridization signals are red. (a, d) view in pro-metamorphic larva. (b, e) view in pro-metamorphosis →climax. (c, f) view in metamorphic climax

Fig. 4.11 Asymmetric expression pattern of aldhs genes around the eyes in several metamorphic stages of Japanese flounder (Shao et al. 2017). Hybridization signals are red. (a1, a2) blind side and ocular side views in pro-metamorphic larva; (b1, b2) blind side and ocular side views in pro-metamorphosis →climax; (c1, c2), blind side and ocular side views at metamorphic climax

completed metamorphosis and developed into normal juvenile flatfish. This is significantly fewer larvae than those that completed metamorphosis following treatment with the noncompetitive RXRα ligand 13cRA (58%) and the DMSO control (63%) (P < 0.05) (Fig. 4.13b). The right eye of larvae that failed to complete

4.2

The Role of Retinoic Acid in Modulating Eye Migration Via Cross-Talk. . .

103

Fig. 4.12 The expressions pattern of rxrs and rars in the skin around the eyes of pro-metamorphic Japanese flounder after 4-days of treatment with methimazole (Shao et al. 2017). Hybridization signals are red. (a) rarα, (b) rarβ, (c) rarγ, (d) rxrα, E, rxrβ, and (f) rxrγ

Fig. 4.13 Retinoic acid inhibits eye migration in Japanese flounder (Shao et al. 2017). (a) The schematic view of injection site (red) on the blind side of Japanese flounder larvae; (b) Analysis of different developmental stages according to eye migration level at 33 DAH Japanese flounder after injection of different RA isoforms, 9cRA (n = 83), ATRA (n = 99), and 13cRA (n = 99). DMSO (n = 70) was used as the control. The P value above the bar is determined by chi-square test, suggesting the significant difference between the proportion of eye migrating relative to the control in different treatments. (c) Representative phenotypes caused through microinjecting different types of RAs. 9cRA (top left, n = 4) or ATRA (top right, n = 3) treatment had symmetrical eyes (blind side view), while 13cRA (bottom left, n = 34) treatment had asymmetrical eyes like the control group (bottom right, n = 44) (ocular side view). Scale bars, 1 mm. (d) cell proliferation in the suborbital region of the migrating eye in different treatment groups. Black arrowheads indicate the proliferating signals of the epidermal cells

104

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.14 Expression of rars and rxrs in the tissue around the eyes after microinjecting ATRA into the suborbital region on the blind side in Japanese flounder (Shao et al. 2017). (a) rarα, (b) rarβ, (c) rarγ, (d) rxrα, (e) rxrβ, and (f) rxrγ. Hybridization signals are red

metamorphosis remained on the blind side, and such larvae were pigmented on both sides (Fig. 4.13c). The suborbital cell proliferation on the blind side was notably reduced in 9cRA- and ATRA-treated larvae as compared to that in the DMSOtreated controls (Fig. 4.13c). The rarα expression, but not the expression of other rars, was upregulated after ATRA treatment, whereas the expression of the two trs was downregulated (Figs. 4.14 and 4.15). In conclusion, the interplay between retinoic acid and thyroid hormone signaling pathways could directly regulate eye migration during Japanese flounder metamorphosis (Fig. 4.16). Thyroid hormone and retinoic acid signaling molecules interact synergistically to regulate eye migration. This mechanism is reminiscent of the antagonism of ecdysteroids (Ecd) and juvenile hormone (JH) during insect metamorphosis (Dhadialla et al. 1998). In common with thyroid hormones, ecdysteroids act through a heterodimer of two nuclear receptors, the ecdysone receptor and the JH receptor ultraspiracle (USP, the orthologue of RXR) (Yao et al. 1993), and 9-cis-RA is structurally similar to the terpenoid JH (Nakamura et al. 2007; Oro et al. 1990). As can be seen, the general molecular mechanisms from invertebrates to vertebrates based on the nuclear receptor transcription factors and terpenoids. Our researches focus on the endocrine hormones and reveal their central role during metamorphosis. Moreover, the molecular mechanisms regulating early development were determined and repeated here.

4.3

Some Genes for Cell Proliferation Might be Involved in Eye Migration

105

Fig. 4.15 The expression of trs in the tissue around the eyes after microinjecting ATRA into the suborbital area on the blind side of Japanese flounder (Shao et al. 2017). Hybridization signals are red. trαA expression in larva with ATRA treatment in a whole body view (a), blind side view (a1) and ocular side view (a2). trαA expression in normal larvae, a whole body view (b), blind side view (b1) and ocular side view (b2). trβ1 expression in larva with ATRA treatment, a whole body view (c), blind side view (c1) and ocular side view (c2). trβ1 expression in normal larva, a whole body view (d), blind side view (d1) and ocular side view (d2)

4.3

Some Genes for Cell Proliferation Might be Involved in Eye Migration

So, what might be the downstream signal pathway of thyroid hormone in regulating cell proliferation of the suborbital area to drive eye movement upward? Eye migration is driven by suborbital cell proliferation of the migrating eye (Bao et al. 2011; Schreiber 2013; Sun et al. 2015; Shao et al. 2017), hence, the genes should at least express as the distribution pattern of thyroid hormone and cell proliferation around eye on blind side during flatfish metamorphosis. sfrs3, screened by suppression subtraction hybridization (SSH) between pre-metamorphosis and metamorphosing larvae, was found expressing in “skin thickness” beneath the migrating eye during metamorphic Japanese flounder (Bao et al. 2005). The expression of sfrs3 was regulated in the late G1 or early S phase during cell cycle, and there are two consensus binding sites for E2F in the promoter region of sfrs3 (Jumaa et al. 1997). Whole-mount RNA in situ hybridization showed sfrs3 was expressed in the lateral ethmoid the “skin thickness” tissues had more Sfrs3 expression than the surrounding regions at the climax of metamorphosis (stage G) (Fig. 4.17). The higher expression may be related to cell division in this region.

106

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.16 The potential interplay between thyroid hormone signaling and retinoic acid signaling during eye migration (Shao et al. 2017). The interaction between RA and T3 during metamorphosis could be considered like a competition between the liganded TRβ and RAR for heterodimerization with the liganded RXR. The heterodimer complex transduces signals by binding to TRE or RARE, leading to activation or suppression of gene transcription. 9cRA, 9-cis-RA; 13cRA, 13-cis-RA

4.3

Some Genes for Cell Proliferation Might be Involved in Eye Migration

107

Fig. 4.17 Sfrs3 expression at eye migration associated tissue (Bao et al. 2005). (a) lateral ethmoid; (b) the “skin thickness” area; (c) the enlarged view of stronger hybridization signals within the “skin thickness” area as shown in b. Le, lateral ethmoid, Tc, trabecular, Ps, parasphenoid

Insulin-like growth factor I (IGF-I), a major mediator of the growth-promoting effects of growth hormone, also has important direct effects on cell proliferation. The biological actions of IGF-I are mediated primarily through the binding to IGF-I receptor (IGF-IR), leading to intracellular signaling response. In Japanese flounder, the IGF-IR proteins also have been found specifically on the thickened skin (“skin thickness”) beneath the migrating eye (Fig. 4.18, Zhang et al. 2011), which contains over proliferation cells and may further form the pseudomesial bar (Pb). “Skin thickness” tissues in the suborbital area on the blind side expand rapidly to drive eye migration (Okada et al. 2001). In addition, type I GHR, type II GHR, and IGF-IR mRNA were found expressing in fibroblasts under eye at the onset of metamorphosis and in fully metamorphosed juveniles of Atlantic halibut, Hippoglossus hippoglossus (Hildahl et al. 2008). Histone deacetylase (HDACs) can control cell proliferation and differentiation by regulating the chromatin structure and inhibiting the activity of specific transcription factor. During intestinal metamorphosis in frog, the expression of HDAC1 as HDAC activity is strongly upregulated (Sachs et al. 2001). It is supposed that HDAC activity is likely also important for one or more steps downstream of gene activation by liganded thyroid hormone receptor (Sun et al. 2014). Interestingly, during the metamorphosis of Japanese flounder, HDAC1 expressed asymmetrically in the area around the eyes on blind side, with more expression in suborbital skin than the supraorbital skin (Fig. 4.19) (Li et al. 2014). The expression pattern of HDAC1 matched with the distribution pattern of proliferating cells and thyroid hormones, indicating it might be involved in eye migration as well. Prolactin (PRL) is a hormone mainly secreted from the anterior pituitary gland and is involved in lactogenesis in mammalian species (Hiyama et al. 2009). In vertebrates, there is evidence that prolactin is directly or indirectly involved in cell division (Ferrara et al. 1991; Clapp et al. 1993; Bole-Feysot et al. 1998; Sakamoto et al. 2005a, b; Sakamoto and McCormick 2006). Compared to standard PRL, dephosphorylation of prolactin could enhance higher cell division when detecting

108

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.18 Transverse cranial sections (a–c) and immunohistochemical localization of IGF-IRs (d– g) in the skin beneath eyes of Japanese flounder. (a) pre-metamorphosis; (b) mid-metamorphosis, abocular incrassation (ai); (c) post-metamorphosis; (a–c) R and L refer to the right and left side of larval head, D and V refer to the dorsal and ventral side of larval head. The skin beneath the eyes is in the black square area. (d) Arrow indicates an evident immunostaining in the thickened region of skin (sk) beneath the migrating eye (viz. region of the ai) at mid-metamorphosis. (e–g) Lack of immunoreactive signal in the skin beneath the non-migrating eye at mid-metamorphosis (e) as well as in the identical regions at pre- (f) and post-metamorphosis (g) (Zhang et al. 2011)

with Nb2 cell bioassay (Wang and Walker 1993). During freshwater acclimation, prolactin is expressed in the epithelia of the gastrointestinal tract and regulates cell proliferation (Sakamoto and McCormick 2006). In Japanese flounder, prl expression patterns was found specifically around the eyes during metamorphosis (Fig. 4.20). In stage E, prl is not differentially expressed between the suborbital and the supraorbital area of both eyes (Fig. 4.20a, b). There was no obvious expression in the supraorbital region of the left and right eyes from the dorsal view (Fig. 4.20c). The higher expression levels of prl was found in stage F than that in stage E. There were distinct red color signals around the periocular areas. The migrating eye has more prl expression in the suborbital region than that in the

4.3

Some Genes for Cell Proliferation Might be Involved in Eye Migration

109

Fig. 4.19 RNA hybridization signal of HDAC1 expression around both eyes in Japanese flounder. (a) metamorphic stage E; (b) metamorphic stage F; (c) metamorphic stage G; (d) metamorphic stage H (Li et al. 2014)

supraorbital region. In contrast, in non-migrating eye, the opposite is observed (Fig. 4.20d, e). The dorsal view image showed the left eye had more prl expression than the right eye (Fig. 4.20f). At stage G, the uneven expression of prl around the eyes was further enlarged compared to stage F. Prl had higher expression levels in the supraorbital region than that in the suborbital area of the non-migrating eye, whereas in the migrating eye the opposite is true (Fig. 4.20g, h). A similar phenotype of the dorsal view was observed in stage G compared to stage F (Fig. 4.20i). Stage H had similar expression patterns with stage G between the suborbital and supraorbital area (Fig. 4.20j, k). However, the asymmetry expression patterns disappeared from the dorsal view between the supraorbital areas of both eyes (Fig. 4.20l). To investigate whether proliferating cells express prl during eye migration or not, colchicine was injected into the suborbital area of the migrating eye to stop cell proliferation. In the control group (0.75% NaCl treatment), cell proliferation marked by BrdU staining showed more proliferating cells in the suborbital area than that in the supraorbital area of the migrating eye (Fig. 4.21d). In the colchicinemicroinjected group, cell proliferation around the eyes was totally suppressed as Prl expression was checked using in situ hybridization. The results suggested similar PRL expression patterns with the cell proliferating signals in Japanese flounder (Fig. 4.21).

110

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Fig. 4.20 The prl expression patterns around the eyes from left (non-migrating, a, d, g, j), right (migrating, b, e, h, k), and dorsal (c, f, i, l) view in stage E, F, G, H during Japanese flounder metamorphosis. Red signals are generated by in situ hybridization. Scale bar, 200 μm (Si et al. 2021) Fig. 4.21 Prl expression and cell proliferation suppressed by colchicine microinjection into the suborbital area of the migrating eye in Japanese flounder. In situ hybridization shows the PRL expression in colchicine (a) and NaCl (b) microinjected larvae. BrdU immunostaining shows the proliferating cell status in colchicine microinjected (c) and normal (d) Japanese flounder. Scale bar = 200 μm (Si et al. 2021)

4.3

Some Genes for Cell Proliferation Might be Involved in Eye Migration

111

Fig. 4.22 PRL expression and cell proliferation of the migrating eye treated with methimazole (MMI) and 9cRA during Japanese flounder metamorphosis (Si et al. 2021). In situ hybridization shows that PRL expression in MMI treatment (a), MMI control (b), 9cRA microinjection (c), and 9cRA control (d) in Japanese flounder. BrdU immunostaining shows the cell proliferation status in MMI treatment (e), MMI control (f), 9cRA microinjection (g), and 9cRA control (h) in Japanese flounder correspondingly. Scale bar = 200 μm

To further figure out whether prolactin is involved in the thyroid hormone and retinoic acid-induced signaling pathway, methimazole (MMI, an inhibitor of TH synthesis) and 9cRA (antagonizes the function of TRαA and TRβ1) were used to treat the flounder larvae during Stage F. BrdU immunostaining and in situ hybridization was performed to determine cell proliferation and PRL expression pattern of the migrating eye. The cell proliferation and PRL expression around the migrating eye were suppressed and reduced after MMI and 9cRA treatment, respectively, when compared to the DMSO-treated control group (Fig. 4.22). In conclusion, the proliferating cells staining by BrdU is consistent with PRL expression. Colchicine injection into the suborbital area of the migrating eye inhibited cell proliferation and further reduced PRL expression simultaneously. The data suggests that prolactin plays a role in cell division during eye migration. Moreover, PRL expression was also significantly suppressed in the suborbital tissue of the migrating eye after methimazole and 9cRA treatment. This showed that prolactin may be regulated by thyroid hormone or retinoic acid signaling pathway during eye migration in Japanese flounder. However, the underlying biological mechanism for prolactin remains unclear. There are several clues that prolactin acts through activating the MAP kinase pathway (Bole-Feysot et al. 1998; Kawauchi et al. 2009) or activates Prolactin-responsive genes through binding to specific promoters, thus causing cell proliferation (Whittington and Wilson 2013). Thus, these genes provided some information on the downstream of thyroid hormone involved in flatfish metamorphosis. In the future, it is necessary to further

112

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

clarify the detailed mechanism of how these genes work in regulating cell proliferation in suborbital skin during flatfish metamorphosis.

4.4

Environment Factors Causing Flatfish Incomplete Eye Migration During Metamorphosis

Since the eye migration is regulated by the cross-talk between thyroid hormone signaling and retinoic acid signaling (Shao et al. 2017), the environmental factors associated with these two signaling pathways will affect eye migration, including the synthesis of thyroid hormone and retinoic acid, and their heterodimer receptor TRs and RXRs.

4.4.1

Nutrition of Live Prey

Researches on Atlantic halibut, turbot, and Japanese flounder have reported greater metamorphic success when larvae before metamorphosis were fed natural marine zooplankton composed mostly of copepods compared with Artemia (Seikai 1985; McEvoy et al. 1998; Pittman et al. 1998; Shields et al. 1999; Sæle et al. 2003). Some nutrition are required for fish to synthesize thyroid hormone. The essential amino acid phenylalanine is converted to tyrosine which forms the backbone of the hormone and to which iodine is attached to form thyroxine T4. T4 is converted to the more active T3, by the enzyme deiodinase which contains selenium. Deficiency of these nutrients phenylalanine, tyrosine, iodine, or selenium could therefore lead to lowered synthesis of thyroid hormones. There was no difference in phenylalanine, tyrosine, or selenium between Artemia and copepods. One possible reason might be that copepods contain up to 700 times (60–350 μg iodine/g dry weight) more iodine than Artemia nauplii (0.5–4.6 μg/g dry weight) (Hamre et al. 2008a, b). An iodine deficiency can lead to goiter or hypothyroidism and is characterized by low T4 levels. Iodine enrichment of live feed prevented Senegalese sole larvae from developing thyroid hyperlasia (Ribeiro et al. 2012). Compared to copepods, second possible reason is that eye migration error might be Artemia with very low levels of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), and high levels of arachidonic acid (ARA) (Hamre et al. 2005). In yellowtail flounder (Limanda ferruginea), eye migration was improved from 47% to 75% complete when the larvae were fed a diet high in DHA and EPA and low in ARA compared with a diet high in DHA only (Copeman et al. 2002). A diet deficient in n-3 polyunsaturated fatty acids caused cessation of metamorphosis in turbot (Estevez and Kanazawa 1995). These data indicate that long-chain polyunsaturated fatty acids such as DHA together with EPA, are required for the correct development of the hypothalamus and the pituitary to regulate thyroid

4.4

Environment Factors Causing Flatfish Incomplete Eye Migration. . .

113

gland to synthesize thyroid hormone (Hamre et al. 2005). The fatty acids might not affect the role of T3 or retinoic acid in eye migration via their receptors (PPARs, peroxisomal proliferator-activated receptor), even PPAR can bind with RXR. However, because the eye migration is mediated by the heterodimer TR/RXR, only those molecules binding competitively with thyroid hormone or retinoic acid will not affect eye migration directly. Likewise, high dietary ARA, causing high Prostaglandin E2 (PGE2) production, binds with PPARγ, inducing a high percent of pseudoalbino and cranial deform in Senegalese sole, but will not affect the eye migration (Boglino et al. 2014). Insufficient energy supplementation for metamorphosis could be a possible reason for impaired eye migration as well. Since flatfish during metamorphosis need high energy expenditure, low-lipid enriched Artemia caused high mortality in Atlantic halibut. In view of the importance of total lipid reserves to the nutritional status of fish larvae (Fraser et al. 1989), energy limitation resulting from insufficient lipid has been suggested as a possible cause of impaired eye migration (Gara et al. 1998; Hamre et al. 2007). Inhibition of thyroid function is one of endocrine responses to food deprivation, with reduced levels of circulating thyroid hormones, reduced sensitivity of the thyroidea to thyrotropin stimulation and inhibition of the conversion of T4 to the active form, T3, catalyzed by the enzyme deiodinase. These responses in a milder form than those found in food deprivation may occur in larvae with energy limitation (MacKenzie et al. 1998). In summary, deficiency of iodine, an unbalanced dietary fatty acid composition, and insufficient energy supplementation, may explain why flatfish larvae fed with Artemia often have impaired eye migration.

4.4.2

Vitamin A

Retinoic acid including 9cRA and ATRA have been tested to affect eye migration via inhibiting the role of thyroid hormone (Shao et al. 2017). Retinoic acid is the derivative of vitamin A (retinol), a fat-soluble vitamin that is not de novo synthesized by fishes, and thus, the imbalance amount of vitamin A supplied in dietary might affect eye migration. In Atlantic halibut, the levels of the active forms of vitamin A (free retinol and retinal) were similar in larvae fed Artemia and copepods (Hamre et al. 2005), indicating that the requirement for vitamin A is met in this flatfish larvae fed Artemia. However, the dietary vitamin A effects on flatfish mainly affected skeleton development and pigmentation via both exposure of larvae or feeding of larvae with different vitamin A levels (Fernández and Gisbert 2011; Femández et al. 2017). No difference in eye migration was found at the end of the trial between fed of dietary vitamin A excess and control in Senegalese sole (Femández et al. 2009; Femández et al. 2017). These results tell us that the amount of vitamin A in these studies maybe not enough to interrupt the role of thyroid hormone in eye migration through competitively binding TR/RXR heterodimer.

114

4.4.3

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

The Effect of Photoperiod on Eye Migration

Since the synthesis of retinoic acid is mediated by light (McCaffery et al. 1996), light intensity or photoperiod might be able to effect the eye migration in flatfish. The effect of photoperiod on the induction of metamorphosis in Atlantic halibut has been investigated by Solbakken and Pittman (2004). Larvae were reared from first feeding (44 days after hatching, DAH) until 66 DAH under continuous illumination to the beginning of metamorphosis. Thereafter, the larvae were divided into two groups: one further exposed to continuous light (24 L:0D), the other given a 12 L:12D regime, the experiment was terminated at 116 DAH. The decrease in photoperiod at commencement of metamorphosis briefly stimulated eye migration in Atlantic halibut. The eye migration to standard length ratio was significantly higher under 12 L:12D than in larvae under continuous light at 116 DAH. This result in Atlantic halibut was further observed by another research group (Harboe et al. 2009). Twenty-seven percent of the fry reared under continuous light conditions had complete eye migration, whereas in juveniles reared under shifting light and darkness conditions (17 L:7D), complete eye migration, whereas in juveniles reared under shifting light and darkness conditions, complete eye migration was 85% (Harboe et al. 2009). These two observations in Atlantic halibut indicate flatfish under a long period of daylight will produce more retinoic acid, which will impair the role of thyroid hormone in regulating eye migration in flatfish. The life cycle of Atlantic halibut in nature has not been clarified but it is assumed that they metamorphose and settle in mid- or later summer. Photoperiod seems to be an environmental cue for the induction of metamorphosis in flatfish larvae (Solbakken and Pittman 2004). Because pre-settlement larvae are probably a great distance from their settlement site, cues for metamorphosis are likely to be the season as suggested for Dover sole (Microstomus pacificus) larvae (Markle et al. 1992). Atlantic salmon (Salmo salar) parrs do not smoltify completely under a continuous light regime (Saunders et al. 1985) and require a short period with a diel light regime as a cue for smoltification when the parr reach a certain size (Thrush et al. 1994). If the nature metamorphose of flatfish metamorphosis occurs in the summer with a longer daylight length, then the photoperiod might be a cue of flatfish settlement. Also, this is the attempt to modify the metamorphic rate of flatfish through the use of photoperiod cues. Incomplete eye migration is one of the major problems in the intensive production of juvenile flatfish. In Atlantic halibut, more than 60% of an average juvenile population reared according to best practice suffers from this abnormality (Harboe et al. 2009). In commercial production, these fish are discharged and represent a substantial economic loss and a large welfare problem. Controlling diurnal light and dark periods is a measure to dramatically reduce incomplete eye migration in Atlantic halibut (Solbakken and Pittman 2004; Harboe et al. 2009).

4.4

Environment Factors Causing Flatfish Incomplete Eye Migration. . .

4.4.4

115

Temperature

Because thyroid hormone level of the fish body is corrected with the rearing temperature (Hotta et al. 2001a, b), these metamorphic events such as eye migration, which is regulated by thyroid hormone, might be affected by water temperature. In spotted halibut, Verasper variegatus (Hotta et al. 2001a) and brown sole, Pleuronectes herzensteini (Hotta et al. 2001b) were found to have a timing of thyroxine T4 surge, their T4 levels changed with the shift of rearing temperature, and the frequency occurrences of morphological abnormalities positively correlated with the T4 peak levels and rearing temperatures. In hatchery-reared brown sole, the highest incidence of normal at 21 °C was obtained among the different temperatures (6, 9, 12, 15, 18, 21, and 24 °C) during metamorphosis (Aritaki and Seikai 2004). The metamorphic-related morphological abnormalities include the eye location and body color. Among the larvae of the flounder Platichthys flesus luscus reared under four different water temperatures (15, 18, 21, and 24 °C), the incidence was significantly higher at 24 °C. The rearing temperature not only influences growth and survival during larval development but also reversed asymmetry in the flounder at the metamorphosis (Aydin et al. 2015).

4.4.5

Environment Pollution

Thyroid-disrupting chemicals (TDCs) such as planar halogenated aromatic hydrocarbons, polycyclic aromatic hydrocarbons (PAHs), heavy metals, and steroids have the potential to affect thyroid status (Brown et al. 2004; Rolland 2000). Therefore, TDCs that alter larval thyroid hormone levels may affect larval metamorphosis in flatfish. Polychlorinated biphenyls (PCBs), which are frequently detected in aquatic environments, influence the morphology of the thyroid gland and the levels of circulating thyroid hormones in fish (Adams et al. 2000). Delayed metamorphosis following exposure to PCBs has already been observed in flatfish. For example, early life stage exposure to PCB 126 can delay metamorphic progress in common sole (Solea solea) and summer flounder (Paralichthys dentatus) (Foekema et al. 2008; Soffientino et al. 2010). Treatment with Aroclor 1254 delayed the increase in thyroid hormone and retarded metamorphic processes in Japanese flounder. Eye migration was inhibited in larvae treated with Aroclor 1254 (Dong et al. 2017).

116

4.5

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Summary

Flatfish have the most extreme asymmetric body morphology of vertebrates, during metamorphosis, one eye migrates to the contralateral side of the skull. The eye migration is regulated by thyroid hormone through T3 binding the two of thyroid hormone receptors TRαA and TRβ1. The regulation of thyroid hormone can be affected by retinoic acid, whose level depends on diurnal light cycle. Several candidate genes under the regulation of thyroid hormone might be involved in cell proliferation around the eye on blind side. The environmental factors associated with these two signaling pathways such as prey nutrition, photoperiod, water temperature, and water pollution, will affect the synthesis of thyroid hormone and retinoic acid, and their heterodimer receptor TRs and RXRs, will cause flatfish incomplete eye migration during metamorphosis.

References Adams BA, Cyr DG, Eales JG (2000) Thyroid hormone deiodination in tissues of American plaice, Hippoglossoides platessoides: characterization and short-term responses to polychlorinated biphenyls (PCBs) 77 and 126. Comp Biochem Physiol Part C Toxicol Pharmacol 127:367–378 Allenby G, Bocquel MT, Saunders M, Kazmer S, Speck J, Rosenberger M, Lovey A, Kastner P, Grippo JF, Chambon P, Levin AR (1993) Retinoic acid receptors and retinoic X receptors: interaction s with endogenous retinoic acids. Proc Natl Acad Sci U S A 90:30–34 Aritaki M, Seikai T (2004) Temperature effects on early development and occurrence of metamorphosis-related morphological abnormalities in hatchery-reared brown sole Pseudopleuronectes herzensteini. Aquaculture 240:517–530 Aydin Ì, Küҫük E, Sahin T, Kumlu M (2015) Effect of temperature on reversed asymmetry in hatchery-reared flounder (Platichthys flesus luscus Pallas, 1811). Turkish J Fish Aquat Sci 15:1– 2 Bao B, Ke Z, Xing J, Peatman E, Liu Z, Xie C, Xu B, Gai J, Gong X, Yang G (2011) Proliferating cells in suborbital tissue drive eye migration in flatfish. Dev Biol 351:200–207 Bao B, Yang G, Liu Z, Li S, Wang Z, Ren D (2005) Isolation of SFRS3 gene and its differential expression during metamorphosis involving eye migration of Japanese flounder Paralichthys olivaceus. Biochim Biophys Acta, Gen Subj 1725(1):64–70 Bao B, Zhang Z, Gong X, Wang X (1999) The effects of exogenous thyroxine (T4) and cortisone on the growth, development and metamorphosis of Paralichthys olivaceus during early development stage. J Shanghai Fish Univ 8(3):242–246 Boglino A, Wishkerman A, Darias M, de la Iglesia P, Estévez AKB, Gisbert E (2014) The effects of dietary arachidonic acid on Senegalese sole morphogenesis: a synthesis of recent findings. Aquaculture 432(2014):443–452 Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev 19:225–268 Brown SB, Adams BA, Cyr DG, Eales JG (2004) Contaminant effects on the teleost fish thyroid. Environ Toxicol Chem 23:1680–1701 Cai L, Brown DD (2004) Expression of type II iodothyronine deiodinase marks the time that a tissue responds to thyroid hormone-induced metamorphosis in Xenopus laevis. Dev Biol 266: 87–95

References

117

Clapp C, Martial JA, Guzman RC, Rentierdelure F, Weiner RI (1993) The 16-kilodalton N-terminal fragment of human prolactin is a potent inhibitor of angiogenesis. Endocrinology 133:1292– 1299 Copeman LA, Parrish CC, Brown JA, Harel M (2002) Effects of docosahexaenoic, eicosapentaenoic and arachidonic acids on the early growth, survival, lipid composition and pigmentation of yellowtail flounder (Limanda ferruginea): a live food enrichment experiment. Aquaculture 210:285–304 De Jesus EG, Hirano T, Inui Y (1991) Changes in cortisol and thyroid hormone concentrations during early development and metamorphosis in the Japanese flounder, Paralichthys olivaceus. Gen Comp Endocrinol 82:369–376 Dhadialla TS, Carlson GR, Le DP (1998) New insecticides with ecdysteroidal and juvenile hormone activity. Annu Rev Entomol 43:545–569 Dong Y, Zhang X, Tian H, Li X, Wang W, Ru S (2017) Effects of polychlorinated biphenyls on metamorphosis of a marine fish Japanese flounder (Paralichthys olivaceus) in relation to thyroid disruption. Mar Pollut Bull 119(2017):325–331 Estevez A, Kanazawa A (1995) Effect of n-3 PUFA and vitamin A artemia enrichment on pigmentation success of turbot, Scophthalmus maximus (L.). Aquac Nutr 1:159–168 Femández I, Ortiz-Delgado JB, Darias MJ, Hontoria F, Andree KB, Manchado M, Sarasquete C, Gisbert E (2017) Vitamin A affects flatfish development in a thyroid hormone signaling and metamorphic stage dependent manner. Front Physiol 8:458 Femández I, Pitmentel MS, Ortiz-Delgado JB, Hontoria F, Sarasquete C, Estévez A, ZamboninoInfante JL, Gisbert E (2009) Effect of dietary vitamin a on Senegalese sole (Solea senegalensis) skeletogenesis and larva quality. Aquaculture 295:250–265 Fernández I, Gisbert E (2011) The effect of vitamin A on flatfish development and skeletogenesis: a review. Aquaculture 315(2011):34–48 Ferrara N, Clapp C, Weiner RI (1991) The 16K fragment of prolactin specifically inhibits basal or fibroblast growth factor stimulated growth of capillary endothelial cells. Endocrinology 129: 896–900 Foekema EM, Deerenberg CM, Murk AJ (2008) Prolonged ELS test with the marine flatfish sole (Solea solea) shows delayed toxic effects of previous exposure to PCB 126. Aquat Toxicol 90: 197–203 Fraser AJ, Sargent JR, Gamble JC (1989) Lipid class and fatty acid composition of Calanus finmarchicus (Gunnerus), Pseudocalanus sp. and Temora longicornis Muller from a nutrientenriched seawater enclosure. J Exp Mar Biol Ecol 130(1):81–92 Gai J, Bao B (2014) Expression pattern of Dio1 during the post-embryo development in Paralichthys olivaceus. J Shanghai Ocean Univ 23(3):321–325. (In Chinese) Galay-Burgos M, Power DM, Llewellyn L, Sweeney GE (2008) Thyroid hormone receptor expression during metamorphosis of Atlantic halibut (Hippoglossus hippoglossus). Mol Cell Endocrinol 281:56–63 Gara B, Shield RJ, McEvoy L (1998) Feeding strategies to achieve correct metamorphosis of Atlantic halibut, Hippoglossus hippoglossus L., using enriched artemia. Aquac Res 29:935–948 Gereben B, Zavacki AM, Ribich S, Kim BW, Huang SA, Simonides WS, Zeold A, Bianco AC (2008) Cellular and molecular basis of deiodinase-regulated thyroid hormone signaling. Endocr Rev 29:898–938 Hamre K, Holen E, Moren M (2007) Pigmentation and eye migration in Atlantic halibut (Hippoglossus hippoglossus L.) larvae: new findings and hypotheses. Aquac Nutr 13:65–80 Hamre K, Mollan TA, Sæle Ø, Erstad B (2008a) Rotifers enriched with iodine and selenium increase survival in Atlantic cod (Gadus morhua) larvae. Aquaculture 284:190–195 Hamre K, Moren M, Solbakken J, Opstad I, Pittman K (2005) The impact of nutrition on metamorphosis in Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 250(3-4): 555–565

118

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Hamre K, Srivastava A, Ronnestad I, Mangor-Jensen A, Stoss J (2008b) Several micronutrients in the rotifer Brachionus sp may not fulfil the nutritional requirements of marine fish larvae. Aquac Nutr 14:51–60 Harboe T, Mangor-Jensen A, Moren M, Hamre K, RØnnestad I (2009) Control of light condition affects the feeding regime and enables successful eye migration in Atlantic halibut juveniles. Aquaculture 290(3-4):250–255 Hildahl J, Power DM, Björnsson BT, Einarsdóttir IE (2008) Involvement of growth hormoneinsulin-like growth factor I system in cranial remodeling during halibut metamorphosis as indicated by tissue- and stage-specific receptor gene expression and the presence of growth hormone receptor protein. Cell Tissue Res 332:211–225 Hiyama G, Kansaku N, Kinoshita M, Sasanami T, Nakamura A, Noda K, Tsukada A, Shimada Ka Zadworny D (2009) Changes in post-translational modifications of prolactin during development and reproductive cycles in the chicken. Gen Comp Endocrinol 161:238–245 Hotta Y, Aritaki M, Tagawa M, Tanaka M (2001a) Changes in tissue thyroid hormone levels of metamorphosing spotted halibut Verasper variegaters reared at different temperatures. Fish Sci 67:1119–1124 Hotta Y, Aritaki M, Tagawa M, Tanaka M (2001b) Thyroid hormones in metamorphosing larvae of brown sole Pleuronectes herzensteini reared at different temperatures. Nippon Suisan Gakkaishi 67:1120–1121 Huang H, Cai L, Remo BF, Brown DD (2001) Timing of metamorphosis and the onset of the negative feedback loop between the thyroid gland and the pituitary is controlled by type II iodothyronine deiodinase in Xenopus laevis. Proc Natl Acad Sci U S A 98:7348–7353 Inui Y, Miwa S (1985) Thyroid hormone induces metamorphosis of flounder larvae. Gen Comp Endocrinol 60:450–454 Isorna E, Obregon MJ, Calvo RM, Vázquez R, Pendón C, Falcón J, Muñoz-Cueto JA (2009) Iodothyronine deiodinases and thyroid hormone receptors regulation during flatfish (Solea senegalensis) metamorphosis. J Exp Zool B Mol Dev Evol 312B:231–246 Itoh K, Watanabe K, Wu X, Suzuki T (2010) Three members of the iodothyronine deiodinase family, dio1, dio2 and dio3, are expressed in spatially and temporally specific patterns during metamorphosis of the flounder, Paralichthys olivaceus. Zool Sci 27:574–580 Jumaa H, Guenet JL, Nielsen PJ (1997) Regulated expression and RNA processing of transcripts from the Srp20 splicing factor gene during the cell cycle. Mol Cell Biol 17(1997):3116–3124 Kawauchi H, Sower SA, Moriyama S (2009) Chapter 5 The neuroendocrine regulation of prolactin and somatolactin secretion in fish. In: Bernier NJ, Kraak GVD, Farrell AP, Brauner CJ (eds) Fish physiology. Academic Press, pp 197–234 Klaren PH, Wunderink YS, Yúfera M, Mancera JM, Flik G (2008) The thyroid gland and thyroid hormones in Senegalese sole (Solea senegalensis) during early development and metamorphosis. Gen Comp Endocrinol 155(2008):686–694 Li H, Xu Y, Bao B (2014) Different expression pattern of HDAC1 before and during the process of metamorphosis in Paralichthys olivaceus. J Shanghai Ocean Univ 23(5):641–648. (in Chinese) MacKenzie DS, VanPutte CM, Leiner KA (1998) Nutrient regulation of endocrine function in fish. Aquaculture 161:3–25 Manchado M, Infante C, Rebordinos L, Canavate JP (2009) Molecular characterization, gene expression and transcriptional regulation of thyroid hormone receptors in Senegalese sole. Gen Comp Endocrinol 160:139–147 Marchand O, Duffraisse M, Triqueneaux G, Safi R, Laudet V (2004) Molecular cloning and developmental expression patterns of thyroid hormone receptors and T3 target genes in the turbot (Scophtalmus maximus) during post-embryonic development. Gen Comp Endocrinol 135:345–357 Markle DF, Harris PM, Toole CL (1992) Metamorphosis and an overview of early-life-history stages in dover sole Microstomus pacificus. Fish Bull 90:285–301 McCaffery P, Mey J, Dräger UC (1996) Light-mediated retinoic acid production. Proc Natl Acad Sci U S A 93:12570–12574

References

119

McEvoy LA, Næss T, Bell JG, Lie Ø (1998) Lipid and fatty acid composition of normal and malpigmented Atlantic halibut (Hippoglossus hippoglossus) fed enriched artemia: a comparison with fry fed wild copepods. Aquaculture 163:237–250 Miwa S, Inui Y (1987) Effects of various doses of thyroxine and triiodothyronine on the metamorphosis of flounder (Paralichthys olivaceus). Gen Comp Endocrinol 67:356–363 Miwa S, Tagawa M, Inui Y, Hirano T (1988) Thyroxine surge in metamorphosing flounder larvae. Gen Comp Endocrinol 70:158–163 Morvan-Dubois G, Demeneix BA, Sachs LM (2008) Xenopus laevis as a model for studying thyroid hormone signalling: from development to metamorphosis. Mol Cell Endocrinol 293(1-2):71 Nakamura A, Stiebler R, Fantappié MR, Fialho E, Masuda H, Oliveira MF (2007) Effects of retinoids and juvenoids on moult and on phenoloxidase activity in the blood-sucking insect Rhodnius prolixus. Acta Trop 103:222–230 Okada N, Takagi Y, Seikai T, Tanaka M, Tagawa M (2001) Asymmetrical development of bones and soft tissues during eye migration of metamorphosing Japanese flounder, Paralichthys olivaceus. Cell Tiss Res 304:59–66 Oro AE, McKeown M, Evans RM (1990) Relationship between the product of the drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature 347:298–301 Pittman KA, Jelmert A, Næss T, Harboe T, Watanabe K (1998) Plasticity of viable postmetamorphic forms of farmed Atlantic halibut, Hippoglossus hippoglossus L. Aquac Res 29:949–954 Ribeiro ARA, Ribeiro L, Sæle Ø, Dinis MT, Moren M (2012) Iodine and selenium supplementation increased survival and changed thyroid hormone status in Senegalese sole (Solea senegalensis) larvae reared in a recirculation system. Fish Physiol Biochem 38:725–734 Rolland RM (2000) A review of chemically-induced alterations in thyroid and vitamin A status from field studies of wildlife and fish. J Wildl Dis 36:615–635 Sachs LM, Amano T, Touse N, Shi YB (2001) Involvement of histone deacetylase at two distinct steps in gene regulation during intestinal development in Xenopus laevis. Dev Dyn 222(2): 280–291 Sæle Ø, Solbakken JS, Watanabe K, Hamre K, Pittman K (2003) The effect of diet on ossification and eye migration in Atlantic halibut larvae (Hippoglossus hippoglossus L.). Aquaculture 220: 683–696 Sakamoto T, Amano M, Hyodo S, Moriyama S, Takahashi A, Kawauchi H, Ando M (2005a) Expression of prolactin-releasing peptide and prolactin in the euryhaline mudskippers (Periophthalmus modestus): prolactin-releasing peptide as a primary regulator of prolactin. J Mol Endocrinol 34:825–834 Sakamoto T, McCormick S (2006) Prolactin and growth hormone in fish osmoregulation. Gen Comp Endocrinol 147:24–30 Sakamoto T, Oda A, Narita K, Takahashi H, Oda T, Fujiwara J, Godo W (2005b) Prolactin: fishy tales of its primary regulator and function. Ann N Y Acad Sci 1040:184–188 Saunders RL, Henderson EB, Harmon PR (1985) Effects of photoperiod on juvenile growth and smolting of Atlantic salmon and subsequent survival and growth in sea cages. Aquaculture 45: 55–66 Schreiber AM (2013) Flatfish: an asymmetric perspective on metamorphosis. Curr Top Dev Biol 103:167–194 Schreiber AM, Specker JL (1998) Metamorphosis in the summer flounder (Paralichthys dentatus): stage-specific developmental response to altered thyroid status. Gen Comp Endocrinol 111: 156–166 Seikai T (1985) Reduction in occurrence frequency of albinism in juvenile flounder, Paralichthys olivaceus, hatchery-reared on wild zooplankton. Nippon Suisan Gakkaishi 51:1261–1268 Shao C, Bao B, Xie Z, Chen X, Li B, Jia X, Yao Q, Ortí G, Li W, Li X, Hamre K, Xu J, Wang L, Chen F, Tian Y, Schreiber AM, Wang N, Wei F, Zhang J, Dong Z, Gao L, Gai J, Sakamoto T, Mo S, Chen W, Shi Q, Li H, Xiu Y, Li Y, Xu W, Shi Z, Zhang G, Power DM, Wang Q,

120

4

Molecular Basis of Eye Migration During Flatfish Metamorphosis

Schartl M, Chen S (2017) The genome and transcriptome of Japanese flounder provide insights into flatfish asymmetry. Nat Genet 49:119–124 Shields RJ, Bell JG, Luizi FS, Gara B, Bromage NR, Sargent JR (1999) Natural copepods are superior to enriched Artemia nauplii as feed for halibut larvae (Hippoglossus hippoglossus) in terms of survival, pigmentation and retinal morphology: relation to dietary essential fatty acids. J Nutr 129:1186–1194 Si Y, Li H, Gong X, Bao B (2021) Isolation of prolactin gene and its differential expression during metamorphosis involving eye migration of Japanese flounder Paralichthys olivaceus. Gene 780: 145522. https://doi.org/10.1016/j.gene.2021.145522 Soffientino B, Nacci DE, Specker JL (2010) Effects of the dioxin-like PCB 126 on larval summer flounder (Paralichthys dentatus). Comp Biochem Physiol, Part C: Toxicol Pharmacol 152:9–17 Solbakken JS, Pittman K (2004) Photoperiodic modulation of metamorphosis in Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 232(1-4):613–625 Sun G, Fu L, Shi Y (2014) Epigenetic regulation of thyroid hormone-induced adult intestinal stem cell development during anuran metamorphosis. Cell Biosci 4:73 Sun M, Wei F, Li H, Xu J, Chen X, Gong X, Tian Y, Chen S, Bao B (2015) Distortion of frontal bones results from cell apoptosis by the mechanical force from the up-migrating eye during metamorphosis in Paralichthys olivaceus. Mech Dev 136:87–98 Tagawa M, Aritaki M (2005) Production of symmetrical flatfish by controlling the timing of thyroid hormone treatment in spotted halibut Verasper variegatus. Gen Comp Endocrinol 141(2005): 184–189 Thrush MA, Duncan NJ, Bromage NR (1994) The use of photoperiod in the production of out-ofseason Atlantic salmon (Salmo salar) smolts. Aquaculture 121:29–44 Wang Y, Walker AM (1993) Dephosphorylation of standard prolactin produces a more biologically active molecule: evidence for antagonism between nonphosphorylated and phosphorylated prolactin in the stimulation of Nb2 cell proliferation. Endocrinology 133:2156–2160 Wang X, Matsuda H, Shi YB (2008) Developmental regulation and function of thyroid hormone receptor and 9-cis retinoic acid receptors during Xenopus tropicalis metamorphosis. Endocrinology 149:5610–5618 Whittington CM, Wilson AB (2013) The role of prolactin in fish reproduction [J]. Gen Comp Endocrinol 191(9):123–136 Wolffe AP (1997) Sinful repression. Nature 387:16–17 Wong J, Shi YB (1995) Coordinated regulation of and transcriptional activation by Xenopus thyroid hormone and retinoid X receptors. J Biol Chem 270:18479–18483 Yamano K, Araki K, Sekikawa K, Inui Y (1994) Cloning of thyroid hormone receptor genes expressed in metamorphosing flounder. Dev Genet 15(4):378–382 Yamano K, Inui Y (1995) cDNA cloning of thyroid hormone receptor b for the Japanese flounder. Gen Comp Endocrinol 99:197–203 Yamano K, Miwa S (1998) Differential gene expression of thyroid hormone receptor alpha and beta in fish development. Gen Comp Endocrinol 109:75–85 Yao TP et al (1993) Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366:476–479 Yaoita Y, Shi YB, Brown DD (1990) Xenopus laevis alpha and beta thyroid hormone receptors. Proc Natl Acad Sci U S A 87:7090–7094 Zhang J, Shi Z, Cheng Q, Chen X (2011) Expression of insulin-like growth factor I receptors at mRNA and protein levels during metamorphosis of Japanese flounder (Paralichthys olivaceus). Gen Comp Endocrinol 173(2011):78–85

Chapter 5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

Abstract The twist of the frontal bones results from cell apoptosis, instead of cell autophagy or cell proliferation during Japanese flounder metamorphosis. Apoptosis in the frontal bones is driven by the mechanical force provided by eye migration, not directly regulated by thyroid hormone. The mechanical force from the up-migrating eye signals through FAK to downstream molecules that are integrated into the BMP-2 signal pathway. Cell apoptosis is activated by the intrinsic mitochondrial pathway. Keywords Frontal bone · Cell apoptosis · Signal pathway · Thyroid hormone

5.1

Deformation Process of Frontal Bones During Flatfish Metamorphosis

The morphological changes of the frontal bones have been documented in some flatfish metamorphosis, such as in turbot, common sole, and so on (Wagemans et al. 1998; Wagemans and Vandewalle 2001). So far, the detailed deformation process of frontal bones was documented during southern flounder (Paralichthys lethostigma) metamorphosis by Schreiber (2006). Asymmetry is first presented at the initiation of late pre-metamorphosis (Fig. 5.1a) when the right frontal bone appears slightly thinner, and these asymmetries are exaggerated further into late pre-metamorphosis (Fig. 5.1b). During pro-metamorphosis (Fig. 5.1c), the right frontal is substantially thinner than the left and frontals deform slightly to the left. From early to late climax, the frontal bones deform dramatically to the left (Fig. 5.1d–f). However, because the start of eye migration is not determined precisely, it is difficult to be sure which one is earlier between initial migration of eye and initial deformation of frontal bone. The ossification of frontals in different flatfish species seems to be different. In Pleuronectidae, such as Pleuronectes platessa, Pleuronectes limanda, Platichthys flesus, and Microstomus kitt, once the left eye has begun migration, the frontals start to ossify along their anterior margin; the right frontal commences ossification before the left. In Scophthalmidae, eye migration begins when a tube of loose skin © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_5

121

122

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

Fig. 5.1 Deformation process of frontal bones during flounder metamorphosis (Schreiber 2006). (a–f), frontal views; (a’–f’) right sagital views; (a”–f″) left sagital views. (a) early pre-metamorphosis, 12 dpf; (b) late pre-metamorphosis, 16 dpf; (c) pro-metamorphosis (start of eye migration), 20 dpf; (d) early metamorphic climax, 22 dpf; (e) late metamorphic climax, 24 dpf; (f) post-metamorphic juvenile (migrating eye has crossed the dorsal midline), 26 dpf. Frontal bones, closed arrow; LP, left parietal bone; RP, right parietal bone; pseudomesial bar, broken line; dorsal fin, open arrow; lateral ethmoid, white arrowhead; anterior parietal barb, black arrowhead

surrounds either the migrating eye or both eyes. Ossification of the frontals begins once the eyes become surrounded by a tube of skin (Brewster 1987). During metamorphosis in common sole, Solea solea, once the eye has migrated to the dorsal surface of the head, the frontal ossify in an anterior-posterior direction.

5.2

Study History of the Molecular Basis of Frontal Bone Deformation

Actually, there are only a few studies on the molecular basis of frontal bone deformation during flatfish metamorphosis. By measuring the activity of TRAP (Tartrate-resistant acid phosphatase), which is the main lytic enzyme to resolve minerals in bone, it was found that the activity of frontal bone TRAP was much stronger on the blind side than on the ocular side in Atlantic halibut, Hippoglossus hippoglossus. However, there was no difference between both frontal bones process

5.3

The Relationship Between the Frontal Bone Deformation and Eye Migration

123

in abnormal metamorphosing larvae with arrested eye migration (Sæle et al. 2006a). Sæle et al. (2006b) found osteoclastic remodeling of the frontal process to accommodate the migrated eye in Atlantic halibut, and supposed this activity should be a result of eye migration. Hildahl et al. (2008) proposed that the growth hormone (GH)—insulin-like growth factor I (IGF-I) system participates in cranial remodeling via stimulating bone growth and resorption, during metamorphosis, supported by GHR (growth hormone receptor) and IGF-IR (insulin-like growth factor I receptor) gene expression and by the presence of GHR protein in frontal bones at the beginning of halibut metamorphosis. The GH content of the head increases throughout the development of Atlantic halibut larvae (Einarsdóttir et al. 2007), whereas IGF-I body content increases until late pre-metamorphosis (stage 7) and decreases after the onset of metamorphosis (stage 8; Hildahl et al. 2007). In Japanese flounder (Paralichthys olivaceus), IGF-I mRNA and IGF-IR-I were also found to increase just before metamorphosis, and decrease until the metamorphic climax (Zhang et al. 2011a, b). Since GH injection does not affect the rate of metamorphosis in Japanese flounder (de Jesus et al. 1994), Hildahl et al. (2008) thought the role of GH is probably not initiating or rate limiting for the metamorphosis process but rather involves stimulatory interaction with other regulatory factors, such as thyroid hormone. Thyroid hormones could possibly stimulate the GH—IGF-I system during flatfish metamorphosis.

5.3

The Relationship Between the Frontal Bone Deformation and Eye Migration

Flatfish (Pleuronectiformes) goes through metamorphosis from a perfect symmetrical shape to an asymmetrical external appearance during early development (Munroe 2005; Chen et al. 2014). Eye migration from one side to the other is the most visible variation during metamorphosis (Schreiber 2013). It was commonly accepted that the asymmetrical and deformity of the skull (the frontal bone, lateral ethmoid, and pseudomesial bar in some species) is the leading cause of eye migration during flatfish metamorphosis (Brewster 1987; Wagemans et al. 1998; Okada et al. 2001, 2003). While contrasting perspectives emerged. There was evidence suggesting that asymmetrical cranial development alone is insufficiently effective to drive eye movement in Southern flounder (Paralichthys lethostigma) (Schreiber 2006). Sæle et al. (2006a) thought the process of eye migration starts with asymmetrical growth of the dorsomedial parts of the ethmoid plate together with the frontal bones. After eye initial migration upward, the frontal bones will be remodeled to accommodate the eye. However, Kyle (1921) proposed that eye migration causes the twist of the frontals, which finally leads to cranial asymmetry. Here comes the question. The twist of frontal bones is a cause or consequence of eye migration?

124

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

Fig. 5.2 Alizarin Red (bone) and Alcian Blue (cartilage) staining reveal symmetry of frontal bone (f) and similar size of lateral ethmoids (le) on both sides of the head in the eye-symmetrical flatfish caused by colchicine injection (Bao et al. 2011). Panel a, Senegalese sole at 21 DAH with symmetric eyes caused by colchicine injection. Panel b, Chinese tongue sole at 60 DAH with symmetric eyes caused by colchicine injection. Panel c, Japanese flounder at 38 DAH with symmetric eyes caused by colchicine injection. e, eye; f, frontal cartilage/bone; le, lateral ethmoid. Lines point to the bone on the ocular side. Arrows point to the bone on the blind side

Eye migration could be specifically inhibited by colchicine microinjection into the suborbital tissue of the migrating eye. In order to figure out the chronological order of eye migration and cranial asymmetry (including the twist of frontals), eye-symmetrical larvae were generated by colchicine microinjection in Solea senegalensis, Cynoglossus semilaevis, and Paralichthys olivaceus (Bao et al. 2011). Results showed that the skull kept bilaterally symmetric without the twist of frontal cartilage when the eyes are symmetrical in colchicine-treated S. senegalensis, C. semilaevis, and P. olivaceus (Fig. 5.2). The observation indicates that eye migrates before the twist of frontal bones during metamorphosis (Bao et al. 2011). The twist of the frontal bones might in turn promote the smooth upward migration of the eye.

5.4

5.4

The Roles of Cell Proliferation, Cell Apoptosis, and Cell Autophagy. . .

125

The Roles of Cell Proliferation, Cell Apoptosis, and Cell Autophagy During the Process of Front Bone Deformation in Japanese Flounder

Bone staining was used to characterize the ossification and deformation of the frontal bones during different metamorphic stages of Japanese flounder (Fig. 5.3a). In the beginning, the frontal bones were not ossified and deformed as shown in Fig. 5.3a1. At stage F, a rift was observed between the left and right frontal bones, with an evident distortion more prominently on the right (blind) side (Fig. 5.3a2). At stage G,

Fig. 5.3 Cell apoptosis analysis in the frontal bones during Japanese flounder metamorphosis (Sun et al. 2015). (a) Bone staining demonstrates the frontal bone deformation process at different metamorphosis stages. Dorsal views of juveniles at stage E (a1), stage F (a2), stage G (a3), and eye-symmetrical juveniles caused by colchicine injection (a4). (b) Cell apoptosis detected by TUNEL at stage E (b1 and b5), stage F (b2 and b6), stage G (b3 and b7), eye-symmetrical juveniles (b4 and b8). b1–b4, dorsal views; b5–b8, longitudinal section views. (c) Dual-color fluorescent microscopy assay showing colocation of osteoblast and cell apoptosis. c1 is bright field. The green color corresponds to the Col10a1 expression (marker gene of osteoblasts, c2), and the red color to the signals of cell apoptosis (c3) in longitudinal sections at stage F. Merge of fluorescence signals are shown (c4). F, frontal bones; ME, migrating eye; SE, stationary eye. Arrow represents the frontal bones

126

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

distortion of the right frontal bone became more severe (Fig. 5.3a3). In the eye-symmetrical juveniles treated with colchicine, no distortion took place in both frontal bones (Fig. 5.3a4). To obtain a comprehensive understanding of molecular mechanisms that lead to the distortion of the frontal bones, cell apoptosis, proliferation, and autophagy in frontal bones were detected during Japanese flounder metamorphosis (Bao et al. 2006; Sun et al. 2015) (Fig. 5.3b). Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) is an in situ terminal labeling method for DNA fracture to detect cell apoptosis. The major observation suggested that the distortion of frontal bones was mostly caused by cell apoptosis during Japanese flounder metamorphosis (Fig. 5.3b). At stage E, cell apoptosis was observed in both left and right frontal bones, but a larger fraction of apoptotic cells was present in the right frontal bone (Fig. 5.3b1). At Stages F and G, cell apoptosis asymmetry between left and right frontal bones became more distinct with much more apoptotic cells on the blind side (Fig. 5.3b2, b3). As shown in Fig. 5.3b4, no cell apoptosis was tested in the frontal bones of colchicine-treated Japanese flounder (Fig. 5.3b4). The longitudinal sections further indicate the cell apoptosis signal in the frontal bones (Fig. 5.3b5–b8). Two-color fluorescence assay showed the localization of Col10a1 (marker gene of osteoblasts, green fluorescent signal in Fig. 5.3c1, c2) and the red fluorescent signals of cell apoptosis (Fig. 5.3c3). Merge signals were magnified to demonstrate colocalization (Fig. 5.3c4), suggesting apoptosis in some osteoblast cells of the frontal bones likely leads to the distortion of the frontal bones. To figure out if cell autophagy is involved in the twist of the frontal bones during metamorphosis, the expression of two marker genes of cell autophagy, MAP1-LC3B and becline-1, were detected. Results showed no expressions were examined in metamorphosing Japanese flounder (Fig. 5.4a, b), which suggests that cell apoptosis, but not cell autophagy plays a role in the twist of frontal bones during metamorphosis. Cell proliferations were detected around both eyes and along the eye migration route (Bao et al. 2011; Schreiber 2013). However, there were no cell proliferation signals detected in the frontal bones during metamorphosis by section in situ hybridization (Fig. 5.4c), indicating that cell proliferation did not take part in the deformation of the frontal bones during metamorphosis. It is well known that osteoblasts are critical players in the regulation of bone formation and bone remodeling (Hock et al. 2001; Xing and Boyce 2005). The asymmetrical apoptosis signal was determined in the frontal bone with much more on the blind side. Col10a1 (the marker gene for osteoblasts) was co-expressed with cell apoptosis signals (Albertson et al. 2010). The above observations suggested that cell apoptosis induction by mechanical signals from eye migration may be responsible for the deformation of the frontal bone.

5.5

The Molecular Basis of Front Bone Deformation on the Aspect of Cell Apoptosis

127

Fig. 5.4 Cell autophagy and proliferation analysis in frontal bone deformation during Japanese flounder metamorphosis (Sun et al. 2015). The expression of cell autophagy marker genes, MAP1LC3B (dorsal view in panel a) and becline-1 (dorsal view in panel b), were not detected in frontal bones by in situ hybridization. (c) Red (BrdU) marks the proliferating cells. No BrdU labeling was detectable within frontal bones during metamorphosis. (c1–c3), dorsal views; (c4–c6), longitudinal section views through the frontal bones. F, frontal bones; ME, migrating eye; SE, stationary eye. Arrow represents the frontal bones

5.5

The Molecular Basis of Front Bone Deformation on the Aspect of Cell Apoptosis

Previous evidence has shown that deformation of the frontal bone is caused by eye movement. During this process, osteoblasts and other cells of the frontal bones receive a mechanic force generated by the up-migrating eye, which might induce cell apoptosis, indirectly causing the “deformated” appearance. The role of mechanical stimulation in bone remodeling is well documented (Andreassen et al. 2001). FAK (focal adhesion kinase) is an integrin-associated cytoplasmic protein tyrosine

128

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

kinase that regulates cellular adhesion, motility, proliferation, and survival in various types of cells (Alahari et al. 2002; Wong et al. 2012). FAK interacts with the large conductance calcium-activated hSloK+ channel in focal adhesion complexes of human osteoblasts (Rezzonico et al. 2003). GTPases, such as RAS and RAF, are activated by mechanical force in osteoblast-like cells (Fan et al. 2006). The BMP-2induced signaling pathway results in the expression of three transcription factors related to osteogenesis (Lee et al. 2003). Mechanical stimulation was found to strengthen BMP-2 signal pathway, resulting in the induction of osteocyte apoptosis (Kopf et al. 2012; Hyzy et al. 2012).

5.5.1

Deformation of Frontal Bones Induced by the Mechanical Force from the Contact of the Up-Migrating Eye on the Blind Side

FAK, RAS, RAF, and BMP-2 play important roles in regulating the mechanical force. To determine whether the distortion of frontal bones is caused by the mechanical force from the mobile eye squeezing, the expression of FAK, RAS, RAF, and BMP-2 were detected. By in situ hybridization analysis, they are observed to be expressed in the frontal bones during Japanese flounder metamorphosis, whereas, asymmetrical expression of either FAK or BMP-2 was corresponding with the signal distribution of cell apoptosis in frontal bones (Fig. 5.5). After the initial eye migration, a significant upregulation of FAK or BMP-2 expression on the blind side was detected on the blind side than that on the ocular side. Eye movement and twist of frontal bones were stopped after colchicine injection. At the same time, the expression of FAK and BMP-2 was also inhibited, indicating that twist of the frontal bones due to cell apoptosis relies on eye migration upward through perceiving mechanical force. Accumulating evidence indicates that mechanical signals play a vital role in the regulation of cell apoptosis (Grinnell et al. 1999; Hsieh and Nguyen 2005; Egerbacher et al. 2008). Physical forces are known to function by binding to the cell surface receptors such as integrins, focal adhesion proteins, and the cytoskeleton, which in turn activate a series of protein kinase pathways, such as p38 MAPK and JNK/SAPK pathways, which could magnify the signals and activate caspases associated to apoptosis (Hsieh and Nguyen 2005). The distribution of FAK, RAS, and RAF expression was asymmetric between left and right frontal bones, which is similar to the distribution pattern of cell apoptosis signals during metamorphosis. This suggests FAK, RAS, and RAF might participate in sensing mechanical force. Colchicine treatments suppress eye movement and the expression of FAK, RAS, and RAF, which further indicates that mechanical force induces high expression of genes associated with cell apoptosis in frontal bones during normal metamorphosis.

5.5

The Molecular Basis of Front Bone Deformation on the Aspect of Cell Apoptosis

129

Fig. 5.5 Whole-mount RNA in situ hybridization analyses on the expression of genes (FAK, RAS, RAF, BMP-2)sensitive to the mechanical force in frontal bones of metamorphic Japanese flounder or juveniles with symmetrical eyes caused by colchicine treatment (Dorsal views in a1–a4, b1–b4, c1–c4, d1–d4; longitudinal section views in a5, b5, c5, and d5 at stage F. F, frontal bones; ME, migrating eye; SE, stationary eye. Arrow represents frontal bones (Sun et al. 2015)

5.5.2

Classical Apoptosis Pathway Involved in the Distortion of Frontal Bones

There are two main signaling pathways of apoptosis: Bcl-2-controlled intrinsic pathway and extrinsic pathway which is mediated by death receptors. The intrinsic (also called the BCL-2-regulated or mitochondrial) apoptotic pathway can be regulated by the Bcl-2 family of proteins that govern the release of cytochrome c from the mitochondria. The extrinsic pathway is activated by certain members of the TNF family of ligands that bind to so-called “death receptors” (members of the TNF receptor family with an intracellular “death domain”) on the cell surface, triggering a cascade of intracellular events that result in cell death. The Bcl-2 family consists of the major apoptotic proteins which control the mitochondrial membrane permeability, such as antiapoptotic protein (Bcl-2) and proapoptotic protein (Bax). BAX was expressed in the frontal bones during the metamorphic Japanese flounder (Fig. 5.6a).

130

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

Fig. 5.6 Whole-mount RNA in situ hybridization analyses on the expression of genes (BAX, Apaf1, Caspase-9, and Caspase-3) associated with the classic apoptosis signal pathway in frontal bones of metamorphic Japanese flounder or juveniles with symmetrical eyes caused by colchicine treatment. Dorsal views in a1–a4, b1–b4, c1–c4, d1–d4; longitudinal section views in a5, b5, c5, and d5 at stage F. F, frontal bones; ME, migrating eye; SE, stationary eye. Arrow represents frontal bones (Sun et al. 2015)

Apaf1 is one of the key regulators in the mitochondrial apoptotic pathway, and the loss of Apaf1 leads to cellular resistance against the apoptotic signals. In situ hybridization demonstrated the expression of Apaf1 in the frontal bones (Fig. 5.6b) and no expression of death receptors, including FASL and TNFR1 (Fig. 5.7). Both of the two apoptosis pathways are mediated by caspases, a family of intracellular cysteine proteases. Results showed the expression of the initiator caspase-9 and executor caspase-3 (Figs. 5.6c, d and 5.8), which indicates BAX-Apaf1-Caspase9-Caspase3 transduction pathway might mediate apoptosis in frontal bones during metamorphosis. Conversely, there are no expressions of those genes in symmetric frontal bones of colchicine-microinjected individuals (Fig. 5.6a4, b4, c4, d4), indicating that this signaling pathway is relying on eye movement in Japanese flounder. Apoptosis is mainly triggered by the activation of caspases through complex signaling, which includes death receptor (extrinsic) and mitochondrial dependent (intrinsic) (Los et al. 1999, Danial and Korsmeyer 2004). It has been reported that

5.5

The Molecular Basis of Front Bone Deformation on the Aspect of Cell Apoptosis

131

Fig. 5.7 Whole-mount RNA in situ hybridization analyses on the expression signal of death receptor genes (FASL and TNFR1) related to the extrinsic apoptosis signal in frontal bones during Japanese flounder metamorphosis (Sun et al. 2015). Dorsal views on a (FASL) and b (TNFR1). ME, migrating eye; SE, stationary eye

Fig. 5.8 Immunohistochemistry analyses on the distribution of Caspase-3 protein using antiCaspase3 antibodies in frontal bones during Japanese flounder metamorphosis (Sun et al. 2015). Dorsal views of stage E (a), stage F (b), and stage G (c). ME, migrating eye; SE, stationary eye. Arrow represents the frontal bones

frontal bones do not express functional death ligand genes (FASL or TNFR1), suggesting that the extrinsic pathway is not involved in cell apoptosis. On the contrary, Bax, Apaf1, or caspase-9, as crucial regulators of the mitochondrial

132

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

pathway, were detected in asymmetrical frontal bones during metamorphosis, suggesting that the activation of FAK-mediated intrinsic mitochondrial pathway leads to cell apoptosis in frontal bones. Apoptosis- and mechanosensing-related genes had no expression in frontal bones of eye-symmetrical juveniles treated with colchicine, which indicated that physical force generated through eye migration induces cell apoptosis, further causing distortion of frontal bones during metamorphosis. BMP-2 promotes osteoblasts apoptosis by induction of mitochondrial cytochrome c release and caspase-9, -3, -6, and -7 expressions through a protein kinase C-dependent signaling pathway (Hay et al. 2001), and these genes expressed with a pattern similar to cell apoptosis in the frontal bones of metamorphic juveniles, suggesting that BMP-2 regulates osteoblast apoptosis in frontal bones during metamorphosis. In addition, BMP-2 expression was inhibited in eye-symmetrical individuals, indicating that physical force can promote BMP-2 expression, activate the BMP-2 signal pathway, and then induce osteoblasts apoptosis in the frontal bones.

5.6

The Role of Thyroid Hormone for Front Bone Deformation

Thyroid hormone (TH) could induce flatfish metamorphosis. While it has been shown that TH could not regulate cell apoptosis in frontal bones directly. To determine whether TH regulates distortion of the frontal bone directly or indirectly, the distribution of T4 or T3 was detected in the frontal bones of metamorphic flounder (Fig. 5.9). However, immunostaining showed that neither T4 nor T3 was expressed in the frontal bones (Fig. 5.10a, b), Moreover, TRαA, TRαB, TRβ1, and TRβ2, four known receptors of thyroid hormone, were not expressed either (Fig. 5.10c, d, e, f). These results suggested that cell apoptosis was not directly induced by TH, another signaling pathway may be involved in the modulation of cell apoptosis in frontal bones. In conclusion, neither THs nor their receptors were expressed in frontal bones during Japanese flounder metamorphosis, indicating deformation and cell apoptosis of frontal bones were not directly induced by THs (Bao et al. 2011; Sun et al. 2015). However, THs directly regulate cell apoptosis of tail regression and intestinal remodeling during amphibian metamorphosis (Ishizuya-Oka 2011), suggesting the different roles of THs involved in cell apoptosis during metamorphosis.

5.7

Summary

133

Fig. 5.9 Whole-mount immunolocalization during T4 (a), T3 (b), and expression patterns of TRαA (c), TRαB (d), TRβ1 (e), and TRβ2 (f) at meta morphic stage F

5.7

Summary

It is well known that craniofacial remodeling, including eye migration, is one of the most remarkable features during flatfish metamorphosis. The asymmetry of the skull was mostly due to the twist of the frontal bones, which depends on eye migration. The underlying mechanism behind distortion of the frontal bones is cell apoptosis, rather than cell autophagy or cell proliferation. Cell apoptosis in the frontal bones is induced by the mechanical force generated from eye migration upward through FAK to downstream molecules integrated into the BMP-2 signal pathway. The intrinsic mitochondrial pathway but not the extrinsic death receptor is involved in cell apoptosis. Additionally, thyroid hormones directly induce cell apoptosis during amphibian metamorphosis but not cell apoptosis during frontal bone deformation

134

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

Fig. 5.10 Distribution patterns of thyroid hormones and their receptors in frontal bones during Japanese flounder metamorphosis (Sun et al. 2015). No T4 (a) and T3 (b) exist in frontal bones by immunohistochemical staining. No expression of TRαA (c), TRαB (d), TRβ1 (e), and TRβ2 (f) in frontal bones during metamorphosis using in situ hybridization. Dorsal view; ME, migrating eye; SE, stationary eye

in flatfish metamorphosis. These findings may help comprehend the regulation of frontal bone deformation during flatfish metamorphosis, and suggest that the asymmetry of the cranium, or at least the distortion of frontal bones, is an outcome rather than a cause of eye migration.

References

135

References Alahari SK, Reddig PJ, Juliano R (2002) Biological aspects of signal transduction by cell adhesion receptors. Int Rev Cytol 220:145–184 Albertson RC, Yan Y, Titus TA, Pisano E, Vacchi M, Yelick PC, Detrich HW III, Postlethwait JH (2010) Molecular pedomorphism underlies craniofacial skeletal evolution in Antarctic notothenioid fishes. BMC Evol Biol 10:4 Andreassen TT, Fledelius C, Ejersted C, Oxlund H (2001) Increases in callus formation and mechanical strength of healing fractures in old rats treated with parathyroid hormone. Acta Orthop 72:304–307 Bao B, Ke Z, Xing J, Peatman E, Liu Z, Xie C, Xu B, Gai J, Gong X, Yang G (2011) Proliferating cells in suborbital tissue drive eye migration in flatfish. Dev Biol 351:200–207 Bao B, Yang G, Ren D (2006) Apoptosis in the metamorphosis of Japanese flounder Paralichthys olivaceus. Acta Zool Sin 52:355–361 Brewster B (1987) Eye migration and cranial development during flatfish metamorphosis: a reappraisal (Teleostei: Pleuronectiformes). J Fish Biol 31:805–834 Chen S, Zhang G, Shao C, Huang Q, Liu G, Zhang P, Song W, An N, Chalopin D, Volff JN, Hong Y, Li Q, Sha Z, Zhou H, Xie M, Yu Q, Liu Y, Xiang H, Wang N, Wu K, Yang C, Zhou Q, Liao X, Yang L, Hu Q, Zhang J, Meng L, Jin L, Tian Y, Lian J, Yang J, Miao G, Liu S, Liang Z, Yan F, Li Y, Sun B, Zhang H, Zhang J, Zhu Y, Du M, Zhao Y, Schartl M, Tang Q, Wang J (2014) Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat Genet 46:253–260 Danial NN, Korsmeyer SJ (2004) Cell death: critical control points. Cell 116:205–219 Egerbacher M, Arnoczky SP, Caballero O, Lavagnino M, Gardner KL (2008) Loss of homeostatic tension induces apoptosis in tendon cells: an in vitro study. Clin Orthop Relat Res 466:1562– 1568 Einarsdóttir IE, Anjos L, Hildahi J, Björnsson BT, Power DM (2007) Isolation of Atlantic halibut pituitary hormones by continuous elution electrophoresis followed by fingerprint identification, and assessment of growth hormone content during larval development. Gen Comp Endocrinol 150:355–363 Fan X, Rahnert JA, Murphy TC, Nanes MS, Greenfield EM, Rubin J (2006) Response to mechanical strain in an immortalized pre-osteoblast cell is dependent on ERK1/2. J Cell Physiol 207:454–460 Grinnell F, Zhou M, Carlson MA, Abrams JM (1999) Release of mechanical tension triggers apoptosis of human fibroblasts in a model of regressing granulation tissue. Exp Cell Res 248: 608–619 Hay E, Lemonnier J, Fromigue O, Marie PJ (2001) Bone morphogenetic protein-2 promotes osteoblast apoptosis through a Smad-independent, protein kinase C-dependent signaling pathway. J Biol Chem 276:29028–29036 Hildahl J, Galay-Burgos M, Sweeney G, Einarsdóttir IE, Björnsson BT (2007) Identification of two isoforms of Atlantic halibut insulin-like growth factor-I receptor genes and quantitative gene expression during metamorphosis. Comp Biochem Physiol Part B 147:395–401 Hildahl J, Power DM, Björnsson BT, Einarsdóttir IE (2008) Involvement of growth hormoneinsulin-like growth factor I system in cranial remodeling during halibut metamorphosis as indicated by tissue- and stage-specific receptor gene expression and the presence of growth hormone receptor protein. Cell Tiss Res 332:211–225 Hock JM, Krishnan V, Onyia JE, Bidwell JP, Milas J, Stanislaus D (2001) Osteoblast apoptosis and bone turnover. J Bone Miner Res 16:975–984 Hsieh MH, Nguyen HT (2005) Molecular mechanism of apoptosis induced by mechanical forces. Int Rev Cytol 245:45–90 Hyzy SL, Olivares NR, Schwartz Z, Boyan BD (2012) BMP2 induces osteoblast apoptosis in a maturation state and noggin-dependent manner. J Cell Biochem 113:3236–3245

136

5

Molecular Basis of Frontal Bones Deformation During Metamorphosis

Ishizuya-Oka A (2011) Amphibian organ remodelling during metamorphosis: insight into thyroid hormone-induced apoptosis. Develop Growth Differ 53:202–212 de Jesus EG, Hirano T, Inui Y (1994) The anti-metamorphic effect of prolactin in the Japanese flounder. Gen Comp Endocrinol 93:44–50 Kopf J, Petersen A, Duda GN, Knaus P (2012) BMP2 and mechanical loading cooperatively regulate immediate early signalling events in the BMP pathway. BMC Biol 10:37 Kyle HM (1921) The asymmetry, metamorphosis and origin of flatfish. Phil Trans Roy Soc Lond (B) 211:75–129 Lee MH, Kwon TG, Park HS, Wozney JM, Ryoo HM (2003) BMP-2-induced Osterix expression is mediated by Dlx5 but is independent of Runx2. Biochem Biophys Res Commun 309:689–694 Los M, Wesselborg S, Schulze-Osthoff K (1999) The role of caspases in development, immunity, and apoptotic signal transduction: lessons from knockout mice. Immunity 10:629–639 Munroe TA (2005) Systematic diversity of the Pleuronectiformes. In: Gibson RN (ed) Flatfish: biology and exploitation, pp 10–36 Okada N, Takagi Y, Seikai T, Tanaka M, Tagawa M (2001) Asymmetrical development of bones and soft tissues during eye migration of metamorphosing Japanese flounder, Paralichthys olivaceus. Cell Tissue Res 304:59–66 Okada N, Takagi Y, Tanaka M, Tagawa M (2003) Fine structure of soft and hard tissues involved in eye migration in metamorphosing Japanese flounder (Paralichthys olivaceus). Anat Rec A 273A:663–668 Rezzonico R, Cayatte C, Bourget PI, Romey G, Belhacene N, Loubat A, Rocchi S, Van Obberghen E, Girault JA, Rossi B (2003) Focal adhesion kinase pp125FAK interacts with the large conductance calcium-activated hSlo potassium channel in human osteoblasts: potential role in mechanotransduction. J Bone Miner Res 18:1863–1871 Sæle Ø, Silva N, Pittman K (2006b) Post-embryonic remodelling of neurocranial elements: a comparative study of normal versus abnormal eye migration in a flatfish, the Atlantic halibut. J Anat 209:31–41 Sæle Ø, Smáradóttir H, Pittman K (2006a) Twisted story of eye migration in flatfish. J Morphol 267:730–738 Schreiber AM (2006) Asymmetric craniofacial remodelling and lateralized behavior in larval flatfish. J Exp Biol 209:610–621 Schreiber AM (2013) Flatfish: an asymmetric perspective on metamorphosis. Curr Top Dev Biol 103:167–194 Sun M, Wei F, Li H, Xu J, Chen X, Gong X, Tian Y, Chen S, Bao B (2015) Distortion of frontal bones results from cell apoptosis by the mechanical force from the up-migrating eye during metamorphosis in Paralichthys olivaceus. Mech Dev 136:87–98 Wagemans F, Focant B, Vandewalle P (1998) Early development of the cephalic skeleton in the turbot. J Fish Biol 52:166–204 Wagemans F, Vandewalle P (2001) Development of the bony skull in common sole: brief survey of morpho-functional aspects of ossification sequence. J Fish Biol 59:1350–1369 Wong VW, Rustad KC, Akaishi S, Sorkin M, Glotzbach JP, Januszyk M, Nelson ER, Levi K, Paterno J, Vial IN (2012) Focal adhesion kinase links mechanical force to skin fibrosis via inflammatory signaling. Nat Med 18:148–152 Xing L, Boyce BF (2005) Regulation of apoptosis in osteoclasts and osteoblastic cells. Biochem Biophys Res Commun 328:709–720 Zhang J, Shi Z, Cheng Q, Chen X (2011a) Expression of insulin-like growth factor I receptors at mRNA and protein levels during metamorphosis of Japanese flounder (Paralichthys olivaceus). Gen Comp Endocrinol 173:78–85 Zhang J, Shi Z, Fu Y, Cheng Q (2011b) Gene expression and thyroid hormone regulated transcript of IGF-I during metamorphosis of the flounder, Paralichthys olivaceus. Acta Hydrob Sin 2: 355–359

Chapter 6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Abstract In some flatfish species, the dorsal fin rays at the anterior part are first elongating gradually, and look like dorsal crest. As the metamorphosis starts, fin rays of the dorsal crest are becoming shorter, finally the lengths of these rays are similar to other rays in dorsal fin. Thyroid hormone plays important role during these processes. Molecular markers showed the existence of neural crest cells, scleroblasts, and sclerotomes in the dorsal fin bud. Hoxds, FGF8, Wnt7, and Shh were found expressed in dorsal fin bud. During the elongation and regression of crown-like fin ray in metamorphosis flounder, Dio1 and Dio3 might play different roles in the elongation and regression of crown-like fin rays during metamorphosis of Japanese flounder. In addition, TRαA might participate the elongation of rays and TRβ2 might play a role in the regression of crown-like fin ray. Keywords Dorsal fin · Dorsal crest · Thyroid hormone · Metamorphosis · Flounder

6.1

Dorsal Fin Development in Fish

Dorsal fin, like caudal and annular fins, a kind of median fins, distributing along the anterior to posterior axis are found from Agnatha (lampreys and hagfish) and Gnathostomata to teleosts (Coates 1994; Donoghue et al. 2000). The embryonic fin fold is simple in structure, which is the precursor of the adult media fins. Adult dorsal fin possess a skeletal system consisting of three elements of endoskeletons (proximal, media, and distal radials) and lepidotrichia. The fin skeletons form during the larval development and concomitantly with skeletogenesis, the fin fold transforms into adult dorsal fin (Suzuki et al. 2003). Development of the median fins can be divided into three distinct stages (Fig. 6.1) (Mabee et al. 2002). Stage 1, a successive fin fold is fully formed along the dorsal and ventral midline. Stage 2, the positions of the presumptive median fins are fixed along the anterior-posterior axis of the fin fold. Subsequently, the fin fold degenerates with fin development. Stage 3, the fin rays and radials start to differentiate. As described in zebrafish embryogenesis, the median fin folds develop first, then are replaced by four different fins, the unpaired anal, dorsal, and tail fins. Specifically, the bud of the anal fin is first observed as a bulge caused by mesenchyme thickness in © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_6

137

138

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Fig. 6.1 Three phases of development of the median fin modules. Phase 1, larval fin fold. Phase 2, fin positioning. Phase 3a: The endoskeletal radials (blue) differentiate beneath presumptive fin regions. Phase 3b: The exoskeletal fin rays (red) differentiate in concert with the endoskeletal radials (Mabee et al. 2002)

5.2–5.5 mm larvae. The bud of the dorsal fin develops at a later time in 5.5–5.8 mm larvae (Parichy et al. 2009). The emergence of the fin bud described in stage 2 signifies the position of adult fin formation and is the base for subsequent fin rays differentiation (Mabee et al. 2002). However, studies on 118 mutations influencing zebrafish larval fin formation showed that most mutants survive to adulthood with normal fins, indicating that there were distinct differentiation processes between embryonic fin fold and adult fin formation (van Eeden et al. 1996). To better understand adult median fin development, further attention should be paid to bud formation. The apical ectodermal ridge (AER) is an essential signaling center governing vertebrate limb development. AER is the origin of the buds in the paired fins of teleosts (Saunders 1948; Grandel and Schulte-Merker 1998). The AER then becomes an apical ectodermal fold (AEF) (Akimenko et al. 1994; Akimenko et al. 1995; Monnot et al. 1999; Abe et al. 2007; Grandel et al. 2000). In the cat shark (Scyliorhinus canicula), an apical ectodermal ridge (AER)-like structure beneath the fin fold is the base of bud formation in adult median fin. Specifically, median fins are predominantly derived from somatic (paraxial) mesoderm, whereas paired appendages arise from lateral plate mesoderm. In addition, the shark median and paired fins share the same genetic development program (Freitas et al. 2006). In zebrafish, the fin fold mesenchyme is originally thought to arise from neural crest cells (Smith et al. 1994). This opinion was later overturned by Lee et al. (2013a). So far, fin bud formation and its cellular origin have not been thoroughly studied in teleosts because they are located within larval fin folds and hardly observed during adult median fin development (Mabee et al. 2002; Suzuki et al. 2003; van Eeden et al. 1996). In Japanese flounder, Paralichthys olivaceus, the early larvae at 6 dpf (days postfertilization) are medially fringed by a fin fold along the dorsal, caudal and ventral part of the trunk and tail (Fig. 6.2a, b). The front of the dorsal fin fold is located just beyond the midbrain. At 15 dpf, the skeletogenesis of the dorsal fin fold begins from the anterior portion as the chondrogenesis of proximal radials (Fig. 6.2c). The

6.1

Dorsal Fin Development in Fish

139

Fig. 6.2 Developmental process of the dorsal fin in Japanese flounder larvae (adopted from Suzuki et al. 2003). Blue color shows cartilages, red color shows ossified bones. (a, b) 6 dpf. (c, d) 15 and 17 dpf. (e–g) 20 dpf. (i) 40 dpf. Eye migration has finished. pf, pectoral fin. ff, fin fold. pr, proximal radius. le, lepidortrichia. n, neural tube. df, dorsal fin

proximal radials continue to develop as cartilaginous bars along the proximal part of the fin fold in the caudal direction up to 20 dpf (Fig. 6.2e). After the formation of the proximal radials, distal radials form as cartilaginous nodules between the distal ends of proximal radials (Fig. 6.2f). After chondrogenesis of radials, lepidotrichia form by fibrous ossification from the anterior part of the fin fold at 15–25 dpf (Fig. 6.2d, g). The limited area of fin fold at the border between the dorsal and caudal fins does not form skeletons and has been absorbed when lepidotrichia formation completes (Fig. 6.2i) (Suzuki et al. 2003).

140

6.2

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

The Process of Dorsal Fin Ray Elongation and Regression in some Flatfishes

In some flatfish species, the dorsal fin rays at the anterior part are first elongating gradually, look like a dorsal crest. As the metamorphosis start, fin rays of the dorsal crest are becoming shorter, finally the lengths of these rays are similar to other rays in dorsal fin. Prolonging of dorsal fin near the head might help larvae keep body balance and swimming condition (Cai et al. 2006). However, only Platichthys stellatus, Hippoglossus hipoglossus, Verasper moseri, and Verasper variefatus have been reported to have the prolonging of dorsal fin (Policansky and Sieswerda 1979; Pittman et al. 1990; Aritaki et al. 2000; Aritaki et al. 2001). In the Chinese tongue sole (Cynoglossus semilaevis), a 2-day-old larva presented the crown-like larval fin. In 24 days after hatching, the length of the crown-like larval fin has extended longest. Thereafter, the crown-like larval fin in a 25-day-old larva started to resorption, and developing at 29 days old, it finally disappeared (Liu and Zhuang 2014). Ahlstrom et al. (1984) reviewed the development of Pleuronectiformes. In Psettodidae, Psettodes erumei has 10 early-forming elongate dorsal rays based on five specimens (3.0–8.7 mm). In five specimens 4.0–8.0 mm of Brachypleura novaezeelandiae (Citharidae), the sixth dorsal ray is elongate and the rays anterior to it are assumed to be elongate. Larvae of these groups (Paralichthys, Hippoglossina, Xystreurys, Pseudorhombus, Tarphops) in Paralichthyidae are noted for a dorsal crest including elongate early forming rays, beginning with the second dorsal ray. Larvae of the Cyclopsetta assemblage are morphologically similar to those of the Paralichthys and Pseudorhombus assemblages, but differ in spination and fin ray development. The rays forming the dorsal crest are typically longer and stand out more abruptly compared with Paralichthys and associated genera. The group of Citharichthys-Etropus has either two or three elongate rays, except for two species that lack a crest altogether. Species of Syacium have 58 elongate dorsal rays and 8–11 occur in Cyclopsetta. In Bothidae, Bothid larvae all develop an elongate second dorsal ray. Larvae of Trichopsetta, Engyophrys, Taeniopsetta have a complete complement of head spines, the second dorsal fin ray is slightly or moderately elongate. In the species of Arnoglosssus, the second dorsal ray is usually moderately elongate, but can be greatly elongate and ornamented. Larvae of Monolene are elongate, lack head spines, and have an elongate ornamented second dorsal ray. In Cynoglossidae, Cynoglossid larvae develop a crest consisting of elongate anterior dorsal rays, two rays in Cynoglossus, and usually four or five in Symphurus (Fig. 6.3).

6.3

The Molecular Basis of Dorsal Fin Elongation in Japanese Flounder

141

Fig. 6.3 Some species of flatfish larvae have elongate dorsal rays (pictures adopted from the review by Ahlstrom et al. 1984)

6.3

The Molecular Basis of Dorsal Fin Elongation in Japanese Flounder

During dorsal fin development in Japanese flounder (Paralichthys olivaceus), the early differentiation of chondrocytes and scleroblasts has been investigated by Suzuki et al. (2003). However, the initial formation of the dorsal fin bud has not been thoroughly studied.

6.3.1

Morphological Changes During Dorsal Fin bud Formation and Skeletogenesis Process in Japanese Flounder Larvae

Fin development is a complex process with the interaction of fin bud and skeletogenesis. Figure 6.4 showed the morphological characters during dorsal fin bud formation and skeletogenesis process in Japanese flounder larvae (Chen et al. 2017). In the very beginning, a continuous fin fold was formed along the dorsal and ventral midline at 3 days post-hatch (DPH) larvae (Fig. 6.4a1). At the same time, a very small fold, AER, was observed at its basal stratum of the presumptive dorsal fin (Fig. 6.4a6, a11). When developed to 6 DPH, The bud became more apparent and the AEF formation was obvious near the head (Fig. 6.4a7, a12). At 9 DPH, the bud grew larger and a nick arose in the bud position of fin fold (Fig. 6.4a8). HE staining showed that several sections were formed based on the bud, then differentiated into the pterygiophores, including proximal, medial, and distal radials (Fig. 6.4a13). At 13 DPH, the bud grew out of the fin fold and formed into what would later become four rays (Fig. 6.4a9). The four sections of the future pterygiophores at the extending base of the bud had also developed noticeably, called as the crown-like larval fin

142

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Fig. 6.4 Morphological changes during dorsal fin bud formation and skeletogenesis process in Japanese flounder larvae (Chen et al. 2017). (a) Whole body view, enlarged view, and HE staining images at 3, 6, 9, 13, and 16 days post-hatch (DPH) larvae. Inset of A13 and A14 showed the enlarged view of fin bud. AER (apical ectodermal ridge), AEF (apical ectodermal fold), FB (fin bud), FF (fin fold), and FR (fin ray). (b). Alcian Blue and Alizarin Red S staining to mark cartilage and bone formation at 16 DPH and 19 DPH, respectively. Arrow represents the fin ray (FR)

(Fig. 6.4a14). At around 16 DPH, five pterygiophores and five rays were observed (Fig. 6.4a10). At the same time, the pterygiophores and rays could be stained by Alcian blue to mark cartilage (Fig. 6.4b1, b3). The numbers of pterygiophores and rays further increased at 19 DPH. Rays could be stained as red by alizarin red S, indicating that rays started to ossify into lepidotrichia (Fig. 6.4b2, b4).

6.3

The Molecular Basis of Dorsal Fin Elongation in Japanese Flounder

6.3.2

143

Cellular Origins of the Dorsal Fin bud

The dorsal fin bud formation in Japanese flounder shares the same process with AEF formation during paired fins development in teleosts. To investigate the cellular origins based on dorsal fin bud development, the expression of different cell type markers was checked by whole-mount in situ hybridization. Scleraxis (sclerotomerelated helix-loop-helix type transcription factor), a marker of sclerotomal cells, was expressed in the AER at the presumptive dorsal fin site in 3 DPH Japanese flounder larvae (Fig. 6.5a1). While the expression decreased during the later bud formation and skeletogenesis (Fig. 6.5a2–a7) (Chen et al. 2017). To see whether neural crest cells are involved in dorsal fin bud formation, the expression patterns of neural crest cell markers, Slug, Hnk-1, and Msx2, were determined during the early developmental stages of Japanese flounder. All three genes were expressed in the AER of 3 DPH larvae. Persistent expression also occurred throughout the whole process of dorsal fin bud formation and later

Fig. 6.5 Expression patterns of cell marker genes in the bud during dorsal fin development of Japanese flounder. Gene expression signal is represented by red (Chen et al. 2017). Sclerotomal cells are marked by Scleraxis (a1–a7); Neural crest cells are marked by Slug (b1–b7), Hnk-1 (c1– c7), and Msx2 (d1–d7); Scleroblasts are marked by Col10a1 (e1–e7). Insets are the enlarged view of AEF in a6, b6, c6, d6, and e6. AER denotes apical ectodermal ridge, AEF denotes apical ectodermal fold, FB denotes fin bud, FF denotes fin fold, FR denotes fin ray, and PF denotes pectoral fin

144

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

skeletogenesis (Fig. 6.5b–d). By comparison, Slug was more highly expressed than Hnk-1 and Msx2 during the development of dorsal fin (Fig. 6.5b). Another difference is that Msx2 expressed more weakly than Hnk-1 and Slug in the fin fold of 6, 9, and 13 DPH larvae, respectively (Fig. 6.5d). Lepidotrichia is formed with bone-forming cells (scleroblasts) that synthesize and secrete the collagen matrix plus accomplish the mineralization of bone matrix. To figure out the role of scleroblasts during dorsal fin development in Japanese flounder, Col10a1, the marker of scleroblasts, was investigated. Col10a1 had high expression through the whole developmental period of fin from 3 to 16 DPH (Fig. 6.5e). In addition, all marker genes were observed to be expressed in the pectoral fin at 3 DPH larvae, suggesting that sclerotomal cells, neural crest cells, and scleroblasts contribute to the pectoral fin development (Fig. 6.5a1, b1, c1, d1, e1). The pectoral fin bud is thought to derive from mesenchymal cells of the lateral plate mesoderm (Grandel and Schulte-Merker 1998; Wood and Thorogood 1984). This mesenchyme then generates the fin endoskeleton (Bouvet 1971). Neural crest cells and somite-derived cells are considered to play roles in the median fin ray formation (Smith et al. 1994; Freitas et al. 2006; Neyt et al. 2000; Freitas et al. 2006; Cole and Currie 2007; Shimada et al. 2013). Zebrafish fin rays were thought to derive from paraxial mesoderm but not neural crest (Lee et al. 2013a, b). In Japanese flounder, expression of cell type markers indicated the involvement of neural crest cells, scleroblasts, and sclerotome in the dorsal fin bud and fin ray formation. Slug and Col10a1 exhibited strong expression during dorsal fin skeletogenesis, suggesting that neural crest cells and scleroblasts primarily take part in adult dorsal fin ray development.

6.3.3

Position and Formation of Dorsal Fin bud

The Hox genes, especially Hoxd9-Hoxd13, participate in setting up the anteriorposterior axis and define the position of AP limb bud formation (Sordino et al. 1995; Nelson et al. 1996). The forelimbs of tetrapod and the pectoral fins of zebrafish (Ahn and Ho 2008), paddlefish (Davis et al. 2007), and cat shark (Freitas et al. 2007) utilize similar gene networks during development, late-phase 5’hoxd gene expression pattern. In 3 DPH Japanese flounder larvae, the AER at the presumptive dorsal fin position had Hoxd10 expression, indicating Hoxd10 might play a role to determine the position of bud formation. By comparison, the pectoral fin had the expression of Hoxd9, Hoxd10, and Hoxd12, but not Hoxd11 (Fig. 6.6a1, b1, c1, d1) (Chen et al. 2017). In 6 DPH larvae, Hoxd9–Hoxd12 genes were expressed in the dorsal fin bud, with a relatively higher expression of Hoxd10 (Fig. 6.6a2, b2, c2, d2). Hoxd9 and Hoxd11 were also expressed in the dorsal fin fold (Fig. 6.6a2, c2). In 9 DPH larvae, the dorsal fin fold primarily expressed Hoxd9 and Hoxd11 (Fig. 6.6a3, c3), while the dorsal fin bud and its base had weak expression of Hoxd10 and Hoxd12 (Fig. 6.6b3, d3). In 13 DPH larvae, Hoxd10 was mostly expressed at the bud base for future

6.3

The Molecular Basis of Dorsal Fin Elongation in Japanese Flounder

145

Fig. 6.6 Expression patterns of Hoxds genes in the bud during Japanese flounder dorsal fin development (Chen et al. 2017). Red signal denotes gene expression. Insets are the enlarged view of AEF in a6, b6, c6, and d6. AER denotes apical ectodermal ridge, AEF denotes apical ectodermal fold, FB denotes fin bud, FF denotes fin fold, FR denotes fin ray, PF denotes pectoral fin

pterygiophores (Fig. 6.6b4), however, others were mostly expressed in fin rays (Fig. 6.6a4, c4, d4). When developed to 16 DPH, the expression of Hoxd9 and Hoxd11 remained unchanged compared to 13 DPH larvae. Hoxd10 was the most strongly expressed gene in the fin ray and Hoxd12 in pterygiophores (Fig. 6.6b5, d5). The skeletogenesis of dorsal fin from anterior to posterior results in its prolonging and shortening during the early development stages of some flatfishes, such as Japanese flounder. The study of Hoxd10 evolution in Pleuronectiformes enables a better understanding of dorsal fin development and metamorphosis. The regionalized expression of 5’Hoxd gene differs between Japanese flounders and other fishes. In cat shark, the characteristic of the first dorsal fin region is the expression of Hoxd9 and Hoxd10, while additional expression of Hoxd12 is the characteristic of the second dorsal and anal regions. In Japanese flounder, Hoxd9– Hoxd12 are not restricted to fins. Hoxd13 could not be cloned from Japanese flounder in this study. In addition, the expression patterns of 5’Hoxd genes did not reveal the spatially ordered location in the dorsal fin bud of Japanese flounder (Fig. 6.6). This is different from zebrafish, which had Hoxd9–Hoxd13 expressed from the anterior bud to posterior in order (Ahn and Ho 2008).

146

6.3.4

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Dorsal Fin bud Formation Regulated by Shh

According to the regulatory mechanisms reported on the formation of limb buds (Freitas et al. 2006; Kawakami et al. 2003; Gibert et al. 2006; Marí-Beffa and Murciano 2010), genes involved in Wnt and Shh (Sonic Hedgehog) signaling pathways were studied in Japanese flounder. FGF8 (Fibroblast growth factor 8) and Wnt7a possessed very similar expression patterns during the bud formation and skeletogenesis in Japanese flounder (Fig. 6.7a1–a14) (Chen et al. 2017). There were FGF8 and Wnt7a expressions in the AER at the presumptive dorsal fin position and the pectoral fin of 3 DPH larvae

Fig. 6.7 The dorsal fin bud formation regulated by Shh during the early development of Japanese flounder (Chen et al. 2017). (a) Expression patterns of FGF8, Wnt7a, and Shh during dorsal fin bud formation. Insets are the enlarged view of AEF in a6, a13, and a20. AER, apical ectodermal ridge; AEF, apical ectodermal fold; FB, fin bud; FF, fin fold; FR, fin ray; PF, pectoral fin. (b) Expression patterns of FGF8, Wnt7a, and Shh in cyclopamine-treated larvae. Red signal denotes gene expression. CP larva, Cyclopamine-treated larva

6.3

The Molecular Basis of Dorsal Fin Elongation in Japanese Flounder

147

(Fig. 6.7a1, a8). The expressions gradually weakened in the forming bud at 6 and 9 DPH (Fig. 6.7a2, a3, a9, a10) and focused on the outer tissue of ray during skeletogenesis at 13 and 16 DPH (Fig. 6.7a4, a5, a11, a12). In contrast to the expression patterns of FGF8 and Wnt7a, Shh had relatively strong expression in the AER of the assumed dorsal fin area at 3 DPH (Fig. 6.7a15) and the distal part of the dorsal fin bud at 9 DPH (Fig. 6.7a17), and later in fin ray and pterygiophores during skeletogenesis at 13 and 16 DPH (Fig. 6.7a18–a19). Beyond that, FGF8, Wnt7a, and Shh also had weak expressions in the fin fold (Fig. 6.7a). To further delineate the role of Shh during dorsal fin bud formation, cyclopamine, the Hh pathway inhibitor, was used to treat the 4 DPH larval at 17.5 °C for 72 h with a concentration of 120 Mm (Wang et al. 2015). The dorsal fin bud formation was totally inhibited by cyclopamine potentially through combination with Smoothened protein (Fig. 6.7b1–b2), compared to the normal larvae at 6 DPH (Fig. 6.7b4–b5). Meanwhile, FGF8, Wnt7a, and Shh had no strong expressions in the treatment group (Fig. 6.7b3, b7, b9). AET is necessary for the specification and outgrowth of the pectoral fin. The cat shark and lamprey developed the median fin fold probably via an AER-like structure (Freitas et al. 2006). FGF8 and Wnt7 play pivotal roles in the early fin bud formation, promoting AER development in the paired appendages (Lewandoski et al. 2000; Kawakami et al. 2003; Sanz-Ezquerro and Tickle 2003; Parr and McMahon 1995; Fernández-Teráan and Ros 2008). In Japanese flounder, FGF8 and Wnt7 expressed at the AER and later at the AEF, suggesting conserved functions of FGF8 and Wnt7 during the dorsal fin bud formation. Additionally, Shh was initially expressed at the AER of 3 DPH larvae. The Hh pathway inhibitor cyclopamine could stop the dorsal fin bud formation and inhibit shh expression, suggesting SHH plays a crucial role during bud formation. Cyclopamine could also suppress FGF8 and Wnt7 expressions, indicating the interaction of FGF8, Wnt7, and shh during dorsal fin development.

6.3.5

Some Genes Expressed in both Dorsal fin bud and fin Fold

There were some genes, such as Msx2, Shh, FGF8, Wnt7, Hoxd9, and Hoxd11, were reported to be expressed in both dorsal fin bud and fin fold of Japanese flounder, suggesting the dual roles in fin development. In Japanese flounder, the msx2-positive cells existed at the proximal part of the fin fold (Suzuki et al. 2003). In zebrafish, both epidermal and mesenchymal cells of median fin fold and pectoral fin buds had the expression of Msx2 (Akimenko et al. 1995). Whole-mount in situ hybridization demonstrated Shh expression in the fin fold of Japanese flounder (Suzuki et al. 2003). Although the expressions of FGF8 and Wnt7a were not directly observed in median fin fold, FGF8 overexpression via beads implantation could induce the morphological change with ectopic median fin fold-like structure, indicating FGF8

148

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

also acted in median fin fold (Abe et al. 2007). In Japanese flounder, Hoxd genes expression could be observed in ectodermal parts of AER or AF of dorsal fin bud, however, the cat shark had Hoxd genes expression in a mesenchymal component in an anteroposteriorly nested pattern along the dorsal and ventral fin folds (Freitas et al. 2006). In addition, Hoxd9 and Hoxd11 had an expression in fin fold of Japanese flounder. In fact, few reports showed Hoxd expression in the fin fold, such as in American paddlefish (Polyodon spathula) (Tulenko et al. 2016).

6.4

The Role of Thyroid Hormone in Regulating Dorsal Fin Development in Japanese Flounder

The elongation and shortening of the fin rays during metamorphosis of flatfishes may be parallel to the appearance and resorption of the tadpole tail during amphibian metamorphosis. Since the tail regression is regulated by thyroid hormones (THs) during amphibian metamorphosis, and the thyroid hormones are known to play an important role during flatfish metamorphosis (Power et al. 2001; Shao et al. 2017), several studies have reported the role of thyroid hormone during the elongation and shortening of the dorsal fin rays in the Japanese flounder. Low thyroid hormone levels are associated with the prometamorphosis phase during which the dorsal fin rays elongate, and high thyroid hormone levels are associated with the metamorphic climax, at which point the rays are resorbed (Miwa and Inui 1987; de Jesus et al. 1993). In addition, in vitro experiments have shown that the levels of exogenous thyroid hormone, both thyroxine (T4) and triiodothyronine (T3), can directly stimulate fin ray shortening in the larval flounder (de Jesus et al. 1990; de Jesus et al. 1993; Okada et al. 2003). However, the role of thyroid hormone in the early development of the dorsal fin in flatfish is unclear. Treatment with exogenous thyroid hormone has been shown to induce premature differentiation of the fin in several fish species. For example, it was shown that in the zebrafish (Danio rerio), exogenous thyroid hormone treatment induces premature differentiation of the pectoral fins (Brown 1997). Further, goitrogens, which are inhibitors of thyroid hormone synthesis, can stunt the growth of both pectoral and pelvic paired fins in zebrafish (Brown 1997). In the African large barb (Barbus intermedius), it was shown that high thyroid hormone levels can induce premature ossification of the fins and promote premature appearance of the fin rays (Shkil et al. 2010). Further, high thyroid hormone levels are also associated with accelerated growth, drastic curving, and (sometimes) distal fusion of the fin ray segments in the African barb (Labeobarbus intermedius) (Shkil et al. 2012), and with fin regeneration in the Japanese medaka (Oryzias latipes) (Sekimizu et al. 2007). The gene expression of Dio1 (type I deiodinase) in the dorsal bud in the Japanese flounder, indicates the role of thyroid hormone in dorsal fin development in this species (Gai and Bao 2014). However, the signaling pathways of thyroid hormones that play a role in fin development have not been elucidated yet.

6.4

The Role of Thyroid Hormone in Regulating Dorsal Fin Development. . .

149

In order to investigate the role of thyroid hormone on dorsal fin development, the distribution of THs and the gene expression of thyroid hormone signal pathway factors such as deiodinases and thyroid hormone receptors during dorsal bud formation, ray elongation, and regression were examined in the Japanese flounder.

6.4.1

The Distribution of Thyroid Hormone and Gene Expression of THs Signal Pathway in the bud During Dorsal Fin Development

The whole-mount immunohistochemistry was used to detect the distribution of thyroid hormone via incubation with monoclonal anti-T4 or anti-T3 antibody. Both T4 and T3 were detected at the base of the dorsal fin bud in the 3-DAH (days after hatching) larvae of Japanese flounder. Later, the T4 and T3 signals were mainly detected in the distal part of bud or ray (Fig. 6.8) (Liu 2015). Even though the T3 signal was not as intense as the T4 signal, their distribution patterns were very similar during dorsal fin development (Fig. 6.8). In addition, in the 3- and 6-DAH larvae, T4 was evidently distributed in the dorsal fin fold. Iodothyronine deiodinases regulate the activity of thyroid hormone via removal of specific iodine moieties from the precursor molecule T4: Dio1 (type 1 iodothyronine deiodinase) and Dio2 (type 2 iodothyronine deiodinase) catalyze the conversion of T4 to the more functional T3, and Dio3 (type 3 iodothyronine deiodinase) catalyzes the conversion of T4 and T3 to the inactive metabolites rT3 or T2 (Jarque and Piña 2014). Thus, deiodinases control the local thyroid hormone concentration, which is particularly critical for developing structures (MarshArmstrong et al. 1999; Bianco and Kim 2006). The iodothyronine deiodinases genes displayed different expression patterns during dorsal fin development in Japanese flounder. Weak expression of only Dio1 was observed at the base of the dorsal fin bud in the 3-DAH larvae, but Dio1

Fig. 6.8 Immunohistochemistry analysis of thyroid hormone distribution in the dorsal fin bud of the Japanese flounder (Liu 2015). The T3 or T4 immunostaining signals are in blond. AER apical ectodermal ridge, AEF apical ectodermal fold, FB fin bud, FF fin fold, FR fin ray. Bar = 100 μm

150

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Fig. 6.9 Gene expression of deiodinases in the fin bud during dorsal fin development in the Japanese flounder (Liu 2015). The gene expression signal is in red. AER apical ectodermal ridge, AEF apical ectodermal fold, FB fin bud, FF fin fold, FR fin ray

expression was abundant in the fin bud in the 6-DAH larvae (Fig. 6.9). The expressions of Dio2 and Dio3 in the dorsal fin bud was evident from 6 DAH. Dio1 was detected before Dio2 and Dio3 (at 3 DAH). Thus, the local concentration of T3 might be particularly important for the initial formation of the dorsal fin bud, because Dio1 can not only generate T3 from T4, but also convert T4 to the inactive rT3 (Jarque and Piña 2014). The expression signals of the three deiodinases were observed during late dorsal fin development: Dio1 and Dio3 were expressed at the edge of the fin ray, whereas Dio2 was expressed in the ray during the process of fin ray formation at 13 and 16 DAH (Fig. 6.9). Dio1 was detected before Dio2 and Dio3 (at 3 DAH), thus, the local concentration of T3 might be particularly important for the initial formation of the dorsal fin bud, because Dio1 can not only generate T3 from T4, but also convert T4 to the inactive rT3 (Jarque and Piña 2014). The iodothyronine deiodinases seem to play an important role in dorsal fin development in the Japanese flounder via their regulatory effect on the local thyroid hormone concentration. The gene expression patterns of four types of thyroid hormone receptors during dorsal fin development were investigated using RNA whole-mount in situ hybridization (Liu 2015). First, only TRβ2 was weakly expressed at the base of the dorsal fin bud in the 3-DAH larvae of Japanese flounder. Later, in the 6-DAH larvae, weak expression of the other genes was detected in the dorsal fin bud. TRαA and TRαB were expressed in the ray, whereas the expression of TRβ1 and TRβ2 was limited to the edge of the fin ray at 13 DAH. TRα, especially TRαB, was expressed to a higher extent than the TRβ genes at 16 DAH (Fig. 6.10). Overall, the spatial and temporal expression patterns of four types of thyroid hormone receptor genes, that is, TRαA, TRαB, TRβ1, and TRβ2, exhibited considerable differences. TRβ2 was detected before the other thyroid hormone receptor genes. Further, TRαA and TRαB were expressed in the ray, whereas TRβ1 and TRβ2 expressions were limited to the edge

6.4

The Role of Thyroid Hormone in Regulating Dorsal Fin Development. . .

151

Fig. 6.10 Expression of thyroid hormone receptor genes during dorsal fin development in the Japanese flounder (Liu 2015). The gene expression signal is in red. AER apical ectodermal ridge, AEF apical ectodermal fold, FB fin bud, FF fin fold, FR fin ray, PF pectoral fin

of the fin ray. Thus, these thyroid hormone receptors seem to play vastly different roles in dorsal fin development in the Japanese flounder.

6.4.2

Role of the Thyroid Hormones in Dorsal Fin bud Formation and Ray Development

As observed in other flatfishes, in the Japanese flounder, too, the first thyroid follicle is observed at 4 DAH (Tanaka et al. 1995; Padrós and Crespo 1996; Ortiz Delgado et al. 2006); this is also indicative of the time point at which T4 is synthesized by the thyroid gland. After the larvae had hatched, 3 mM of methimazole, an inhibitor of endogenous thyroid hormone synthesis, was administered daily for 4 days in the Japanese flounder, from 4 DAH to 8 DAH and from 10 DAH to 14 DAH. Treatment of the 4-DAH larvae with methimazole (an inhibitor of thyroid hormone synthesis) for 4 days could inhibit the endosynthesis of thyroid hormone and outgrowth of the dorsal fin bud at 8 DAH (Fig. 6.11a). Furthermore, after bud formation, 4-day methimazole treatment of the 10-DAH larvae inhibited formation of the fin ray at 14 DAH (Fig. 6.11a). These findings indicate that the synthesis of T4 and T3 was blocked (Fig. 6.11b); thus, thyroid hormone may regulate not only bud formation and but also ray formation. In agreement with this finding, fluctuations in the local concentration of THs on treatment with exogenous T4 or methimazole during dorsal fin development have been found to cause deformations in zebrafish, the African

152

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Fig. 6.11 Inhibition of dorsal fin bud formation by methimazole and expression of the key genes in dorsal fin bud formation in methimazole-treated Japanese flounder (Liu 2015). (a) Dorsal fin bud and fin ray were not formed in 8- and 14-DAH Japanese flounder after 4-day methimazole treatment. (b) Distribution of T4 and T3 in the dorsal fin in 14-DAH Japanese flounder after 4 days of methimazole treatment (MMI larva) and in normal larva. The T4 or T3 immunostaining signal is in red. (c) Inhibition of the expression of the key genes associated with dorsal fin bud formation in 8-DAH Japanese flounder after 4-day methimazole treatment. Gene expression signals are in red. FB fin bud, FF fin fold, FR fin ray

large barb, and the African barb (Brown 1997; Shkil et al. 2010; Shkil et al. 2012). To confirm these findings, some key genes associated with bud formation, such as Fgf8, Wnt7a, Shh, Hoxd10, and hoxc6, were expressed in the bud in normal larvae and were inhibited in methimazole-treated larvae of Japanese flounder (Fig. 6.11c). With regard to the underlying mechanisms, these findings indicate the role of the Fgf8, Wnt7a, Shh, Hoxd10, and hoxc6 genes (Fig. 6.11) in these effects of thyroid hormone. These genes are known to be crucial for controlling the early development

6.4

The Role of Thyroid Hormone in Regulating Dorsal Fin Development. . .

153

Fig. 6.12 Inhibition of the formation of the dorsal fin bud and ray by methimazole in zebrafish (Liu 2015). (a) Distribution of T4 and T3 in the dorsal fin in 15-DAH zebrafish after 8 days of methimazole treatment (MMI larva) and in normal larva. The T4 or T3 immunostaining signals are in red. (b) Formation of the dorsal fin bud and fin ray was inhibited in 15-DAH and 20-DAH zebrafish treated with methimazole. AER apical ectodermal ridge, FB fin bud, FR fin ray

of fins (Chen et al. 2017; Suzuki et al. 2003; Abe et al. 2007; Freitas et al. 2007; Fernández-Teráan and Ros 2008). In order to understand whether the mechanism of thyroid hormone regulation of dorsal fin development exists in other teleosts, we conducted methimazole experiments in zebrafish too. In the zebrafish, at post-fertilization 120 h, a row of follicles is formed along the anterior-posterior axis at the pharyngeal midline, as indicated by T4 immunostaining (Alt et al. 2006). Thus, in the zebrafish, T4 is synthesized later, at 7 DAH. Zebrafish larvae were treated with 5 mM of methimazole from 7 DAH to 15 DAH and from 7 DAH to 20 DAH, respectively. Methimazole treatment was started in 7-DAH zebrafish, as a very small bud is initially formed at this time point. After 8 or 13 days of methimazole administration, dorsal fin bud outgrowth was inhibited at 15 DAH and fin ray formation was inhibited at 20 DAH (Fig. 6.12a) (Liu 2015). In contrast, the fin bud was formed at 15 DAH and the ray was formed at 20 DAH in the larvae that were not treated with methimazole (Fig. 6.12b). Thus, in zebrafish, too, T3 and T4 synthesis was blocked with methimazole, and this indicates the involvement of THs in dorsal fin development in zebrafish. These findings were the basis for our methimazole (TH inhibitor) experiments, which demonstrated that T4 or T3 synthesized by the thyroid gland regulates dorsal bud formation in the Japanese flounder and zebrafish.

154

6.4.3

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

The Role of the Thyroid Hormones in Dorsal Fin Elongation and Regression During Metamorphosis of Japanese Flounder

After eye initial migration at metamorphic stage E (21 DAHs) in Japanese flounder, the crown-like larval fin ray continued elongation, at metamorphic stage F, the length of crown-like larval fin extended longest. Thereafter, the crown-like larval fin started to resorption, at the end of metamorphosis, the crown-like fin ray finally disappeared (Fig. 6.13). The whole-mount immunohistochemistry with monoclonal anti-T4 or anti-T3 antibody showed both T4 and T3 were distributed in crown-like fin ray during the metamorphic process in Japanese flounder. T4 distribution pattern was similar to that of T3, but the signal of T4 was stronger than that of T3. Wholemount RNA in situ hybridization showed that the iodothyronine deiodinases genes displayed different expression patterns in dorsal fin elongate and regression during metamorphosis of Japanese flounder. Dio1 and Dio3 could be found expression during the whole metamorphic process, while Dio1 has not expressed at all (Fig. 6.13). During the elongation of crown-like fin ray, more expression of Dio3 was found in crown-like fin ray and endoskeletal radials than that of Dio1, when to

Fig. 6.13 The distribution of thyroid hormone and gene expression of deiodinases in dorsal fin elongate and regression during metamorphosis of Japanese flounder (Xing 2010; Gai 2012). The T3 or T4 immunostaining signals are in blond. The gene expression signal is in red. Bar, 1 mm

6.4

The Role of Thyroid Hormone in Regulating Dorsal Fin Development. . .

155

Fig. 6.14 The gene expression of thyroid hormone receptors in dorsal fin elongate and regression during metamorphosis of Japanese flounder (Ke 2011). The gene expression signal is in red. Bar, 1 mm

the regression stage of crown-like fin ray, the expression of Dio1 began stronger than that of Dio3 (Fig. 6.13). These observations indicate that Dio1 and Dio3 might play different roles in the elongation and regression of crown-like fin ray during metamorphosis of Japanese flounder. This possible mechanism might be different from the tail regression in tadpole metamorphosis, where Dio2 plays a major role (Cai and Brown 2004). The gene expression patterns of four types of thyroid hormone receptors in dorsal fin elongate and regression during metamorphosis of Japanese flounder were investigated as well. TRαB and TRβ1 expressed stably through the whole metamorphic process in crown-like fin ray and endoskeletal radials. The other two types of thyroid hormone receptors performed differently obviously. TRαA expressed stronger in endoskeletal radials during the elongation of crown-like fin ray, and late became weak in the regression process of crown-like fin ray (Metamorphic stage G). On contrary to TRαA, the expression of TRβ2 has not been detected in the elongation process, but late became strongly in the regression process of crown-like fin ray (Metamorphic stage G) (Fig. 6.14), these findings indicate that TRαA might participate in the elongation of ray and TRβ2 might play a role on the regression of crownlike fin ray in Japanese flounder.

156

6.5

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Summary

In some flatfish species, the dorsal fin rays at the anterior part are first elongating gradually, look like dorsal crest. As the metamorphosis start, fin rays of the dorsal crest are becoming shorter, finally the lengths of these rays are similar to other rays in dorsal fin. For larva with a deep-body shape, prolonging of dorsal fin close to the head might aid larvae to keep the body perpendicular while out at sea. Later, becoming short should help body rotation in order to start metamorphosis on the sea bed. We investigated the development of dorsal fin in Japanese flounder. Molecular markers showed the existence of neural crest cells, scleroblasts and sclerotomes in the dorsal fin bud. Hoxds, FGF8, Wnt7, and Shh were found expressed in dorsal fin bud, indicating that common basic molecular mechanisms of paired appendage might be utilized by median fins. Thyroid hormone plays an important role in dorsal fin development, during bud formation, fin ray formation, elongation, and regression in flatfishes, such as in Japanese flounder. The larvae with treatment with the thyroid hormone inhibitor could not form the bud and thereafter radials and fin rays of dorsal fin. During the elongation and regression of crown-like fin ray in metamorphosis flounder, Dio1 and Dio3 might play different roles in the elongation and regression of crown-like fin ray during metamorphosis of Japanese flounder, and this possible mechanism might be different from the tail regression in tadpole metamorphosis, where Dio2 plays a major role. In addition, TRαA might participate the elongation of ray and TRβ2 might play a role in the regression of crown-like fin ray.

References Abe G, Ide H, Tamura K (2007) Function of FGF signalling in the developmental process of the median fin fold in zebrafish. Dev Biol 304:355–366 Ahlstrom EH, Amaoka K, Hensley DA, Moser HG, Sumida BY (1984) Pleuronectiformes: development. In ontogeny and systematics of fishes. Am Soc Ichthyologists Herpetologists Ser Publ 1:641–670 Ahn DG, Ho RK (2008) Tri-phasic expression of posterior hox genes during development of in zebrafish: implications for the evolution of vertebrate paired appendages. Dev Biol 322:220– 233 Akimenko MA, Ekker M, Wegner J, Lin W, Westerfield M (1994) Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J Neurosci 14:3475–3486 Akimenko MA, Johnson SL, Westerfield M, Ekker M (1995) Differential induction of four msx homeobox genes during fin development and regeneration in zebrafish. Development 121:347– 357 Alt B, Reibe S, Feitosa NM, Elsalini OA, Wendl T, Rohr KB (2006) Analysis of origin and growth of the thyroid gland in zebrafish. Dev Dyn 235:1872–1883 Aritaki M, Ohta K, Hotta Y, Tanaka M (2001) Morphological development and growth of laboratory-reared spotted halibut Verasper variefatus. Nippon Suisan Gakk 67:58–66

References

157

Aritaki M, Suzuki S, Watanabe K (2000) Morphological development and growth of laboratoryreared Barfin flounder Verasper moseri. Nippon Suisan Gakk 66:446–453 Bianco AC, Kim BW (2006) Deiodinases: implications of the local control of thyroid hormone action. J Clin Invest 116:2571–2579 Bouvet J (1971) Establishment of the fate map of the pectoral fin bud of the indigene trout (Salmo trutta fario L.) by using removals and coloured marks. Ann Embryol Morph 3:315–328 Brown DD (1997) The role of thyroid hormone in zebrafish and axolotl development. Proc Natl Acad Sci U S A 94:13011–13016 Cai L, Brown DD (2004) Expression of type II iodothyronine deiodinase marks the time that a tissue responds to thyroid hormone-induced metamorphosis in Xenopus laevis. Dev Biol 266: 87–95 Cai W, Liu X, Ma X, Xu Y, Zhan W (2006) Development and degeneration of swimming bladder and crown-like larval fin in the early life stage of Cynoglossus semilaevis Günther. Mar Fish Res 27:94–98. (in Chinese) Chen J, Liu X, Yao X, Gao F, Bao B (2017) Dorsal fin development in flounder, Paralichthys olivaceus: bud formation and its cellular origin. Gene Expr Patterns 25-26:22–28 Coates MI (1994) The origin of vertebrate limbs. Dev Suppl 120:169–180 Cole NJ, Currie PD (2007) Insights from sharks: evolutionary and developmental models of fin development. Dev Dyn 236:2421–2431 Davis MC, Dahn RD, Shubin NH (2007) An autopodial-like pattern of hox expression in the fins of a basal actinopterygian fish. Nature 447:473–476 Donoghue PCJ, Forey PL, Aldridge RJ (2000) Conodont affinity and chordate phylogeny. Biol Rev Camb Philos Soc 75:191–251 van Eeden FJ, Granato M, Schach U, Brand M, Furutani-Seiki M, Haffter P, Hammerschmidt M, Heisenberg CP, Jiang YJ, Kane DA, Kelsh RN, Mullins MC, Odenthal J, Warga RM, NüssleinVolhard C (1996) Genetic analysis of fin formation in the zebrafish, Danio rerio. Development 123:255–262 Fernández-Teráan M, Ros MA (2008) The apical ectodermal ridge: morphological aspects and signaling pathways. Int J Dev Biol 52:857–871 Freitas R, Zhang G, Cohn MJ (2006) Evidence that mechanisms of fin development evolved in the midline of early vertebrates. Nature 442:1033–1037 Freitas R, Zhang G, Cohn MJ (2007) Biphasic Hoxd gene expression in shark paired fins reveals an ancient origin of the distal limb domain. PLoS One 2:e754 Gai J (2012) The Spatio-temporal Expression Pattern of Three Iodothyronine Deiodinases during Metamorphosis of Paralichthys olivaceus. Master Thesis of Shanghai Ocean University Gai J, Bao B (2014) Expression pattern of Dio1 during the post-embryo development in Paralichthys olivaceus. J Shanghai Ocean Univ 23:321–328. (In Chinese with English abstract) Gibert Y, Gajewski A, Meyer A, Begemann G (2006) Induction and prepatterning of the zebrafish pectoral fin bud requires axial retinoic acid signaling. Development 133:2649–2659 Grandel H, Draper BW, Schulte-Merker S (2000) Dackel acts in the ectoderm of the zebrafish pectoral fin bud to maintain AER signaling. Development 127:4169–4178 Grandel H, Schulte-Merker S (1998) The development of the paired fins in the zebrafish (Danio rerio). Mech Dev 79:99–120 Jarque S, Piña B (2014) Deiodinases and thyroid metabolism disruption in teleost fish. Environ Res 135:361–375 de Jesus EG, Hirano T, Inui Y (1993) Flounder metamorphosis: its regulation by various hormones. Fish Physiol Biochem 11:323–328 de Jesus EG, Inui Y, Hirano T (1990) Cortisol enhances the stimulating action of thyroid hormones on dorsal fin-ray resorption of flounder larvae in vitro. Gen Comp Endocrinol 79:167–173 Kawakami Y, Rodríguez-León J, Koth CM, Büscher D, Itoh T, Raya A, Ng JK, Esteban CR, Takahashi S, Henrique D, Schwarz MF, Asahara H, Izpisúa Belmonte JC (2003) MKP3 mediates the cellular response to FGF8 signalling in the vertebrate limb. Nat Cell Biol 5:513– 519

158

6

Molecular Basis of Dorsal Fin Elongation and Regression During Metamorphosis

Ke Z (2011) The role of cell proliferation and spatio-temporal expression pattern of thyroid hormone receptor during metamorphosis of flatfish. Master Thesis of Shanghai Ocean University Lee RT, Knapik EW, Thiery JP, Carney TJ (2013b) An exclusively mesodermal origin of fin mesenchyme demonstrates that zebrafish trunk neural crest does not generate ectomesenchyme. Development 140:2923–2932 Lee RT, Thiery JP, Carney TJ (2013a) Dermal fin rays and scales derive from mesoderm, not neural crest. Curr Biol 23:R336–R337 Lewandoski M, Sun X, Martin GR (2000) Fgf8 signalling from the AER is essential for normal limb development. Nat Genet 26:460–463 Liu X (2015) The comparative study on the development of fish dorsal fin and adipose fin. Master Thesis of Shanghai Ocean University Liu XZ and Zhuang ZM (2014) Reproduction biology and culture technology of tongue sole. China Agriculture Press (in Chinese) Mabee PM, Crotwell PL, Bird NC, Burke AC (2002) Evolution of median fin modules in the axial skeleton of fishes. J Exp Zool 294:77–90 Marí-Beffa M, Murciano C (2010) Dermoskeleton morphogenesis in zebrafish fins. Dev Dyn 239: 2779–2794 Marsh-Armstrong N, Huang H, Remo BF, Liu T, Brown DD (1999) Asymmetric growth and development of the Xenopus laevis retina during metamorphosis is controlled by type III deiodinase. Neuron 24:871–878 Miwa S, Inui Y (1987) Effects of various doses of thyroxine and triiodothyronine on the metamorphosis of flounder (Paralichthys olivaceus). Gen Comp Endocrinol 167(3):356–363 Monnot MJ, Babin PJ, Poleo G, Andre M, Laforest L, Ballagny C, Akimenko MA (1999) Epidermal expression of Apolipoprotein E gene during fin and scale development and fin regeneration in zebrafish. Dev Dyn 214:207–215 Nelson CE, Morgan BA, Burke AC, Laufer E, DiMambro E, Murtaugh LC, Gonzales E, Tessarollo L, Parada LF, Tabin C (1996) Analysis of Hox gene expression in the chick limb bud. Development 122:1449–1466 Neyt C, Jagla K, Thisse C, Thisse B, Haines L, Currie PD (2000) Evolutionary origins of vertebrate appendicular muscle. Nature 408:82–86 Okada N, Tanaka M, Tagawa M (2003) Bone development during metamorphosis of the Japanese flounder (Paralichthys olivaceus): differential responses to thyroid hormone. The Big Fish Bang. Proceedings of the 26th Annual Larval Fish Conference. Postboks 1870 Nordnes, N-5817, Bergen, Norway: Institute of Marine Research, 177–187 Ortiz Delgado JB, Ruane NM, Pousão-Ferreira P, Dinis MT, Sarasquete C (2006) Thyroid gland development in Senegalese sole (Solea senegalensis Kaup 1858) during early life stages: a histochemical and immunohistochemical approach. Aquaculture 260:346–356 Padrós F, Crespo S (1996) Ontogeny of the lymphoid organs in the turbot Scophthalmus maximus; a light and electrón microscopy study. Aquaculture 144:1–16 Parichy DM, Elizondo MR, Mills MG, Gordon TN, Engeszer RE (2009) Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn 238:2975–3015 Parr BA, McMahon AP (1995) Dorsalizing signal Wnt-7a required for normal polarity of D-V and A-P axes of mouse limb. Nature 374:350–353 Pittman K, Skiftesvik AB, Berg L (1990) Morphological and behavioural development of halibut, Hippoglossus hipoglossus L.1arvae. J Fish Biol 37:455–472 Policansky D, Sieswerda P (1979) Early life history of the starry flounder, Platichthys stellatus, reared through metamorphosis in the laboratory. Trans Amer Fish Soc 108:326–327 Power DM, Llewellyn L, Faustino M, Nowell MA, Björnsson BT, Einarsdottir IE, MCanario AV, Sweeney GE (2001) Thyroid hormones in growth and development of fish. Comp Biochem Phys C 130:447–459 Sanz-Ezquerro JJ, Tickle C (2003) Digital development and morphogenesis. J Anat 202:51–58

References

159

Saunders JW (1948) The proximo-distal sequence of origin of parts of the chick wing and the role of the ectoderm. J Exp Zool 108:363–403 Sekimizu K, Tagawa M, Takeda H (2007) Defective fin regeneration in medaka fish (Oryzias latipes) with hypothyroidism. Zool Sci 24:693–699 Shao C, Bao B, Xie Z, Chen X, Li B, Jia X, Yao Q, Ortí G, Li W, Li X, Hamre K, Xu J, Wang L, Chen F, Tian Y, Schreiber AM, Wang N, Wei F, Zhang J, Dong Z, Gao L, Gai J, Sakamoto T, Mo S, Chen W, Shi Q, Li H, Xiu Y, Li Y, Xu W, Shi Z, Zhang G, Power DM, Wang Q, Schartl M, Chen S (2017) The genome and transcriptome of Japanese flounder provide insights into flatfish asymmetry. Nat Genet 49:119–124 Shimada A, Kawanishi T, Kaneko T, Yoshihara H, Yano T, Inohaya K, Kinoshita M, Kamei Y, Tamura K, Takeda H (2013) Trunk exoskeleton in teleosts is mesodermal in origin. Nat Commun 4:1639 Shkil FN, Borisov VB, Abdissa B, Smirnov SV (2010) Role of thyroid hormone in the ontogeny and morphological diversification of Barbus intermedius sensu Banister, 1973 of Lake tana in Ethiopia. Russ J Dev Biol 41:369–380 Shkil FN, Kapitanova DV, Borisov VB, Abdissa B, Smirnov SV (2012) Thyroid hormone in skeletal development of cyprinids: effects and morphological consequences. J Appl Ichthyol 28: 398–405 Smith M, Hickman A, Amanze D, Lumsden A, Thorogood P (1994) Trunk neural crest origin of caudal fin mesenchyme in the Zebrafish Branchydanio rerio. Proc R Soc Lond B 256:137–145 Sordino P, van der Hoeven F, Duboule D (1995) Hox gene expression in teleost fins and the origin of vertebrate digits. Nature 375:678–681 Suzuki T, Haga Y, Takeuchi T, Uji S, Hashimoto H, Kurokawa T (2003) Differentiation of chondrocytes and scleroblasts during dorsal fin skeletogenesis in flounder larvae. Develop Growth Differ 45:435–448 Tanaka M, Tanangonan JB, Tagawa M, de Jesus EG, Nishida H, Isaka M, Kimura R, Hirano T (1995) Development of the pituitary, thyroid and interrenal glands and application of endocrinology to the improved rearing of marine fish larvae. Aquaculture 135:111–126 Tulenko FJ, Augustus GJ, Massey JL, Sims SE, Mazan S, DavisM C (2016) HoxD expression in the fin-fold compartment of basal gnathostomes and implications for paired appendage evolution. Sci Rep 6:22720 Wang J, Cao J, Dickson AL, Poss KD (2015) Epicardial regeneration is guided by cardiac outflow tract and hedgehog signaling. Nature 522(7555):226–230 Wood A, Thorogood P (1984) An analysis of in vitro cell migration during teleost fin morphogenesis. J Cell Sci 66:205–222 Xing J (2010) The distribution of the thyroid hormone (T4 and T3) in the metamorphosing Oliver Flounder (Paralichthys olivaceus). Master Thesis of Shanghai Ocean University

Chapter 7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Abstract We introduce the establishment of left/right asymmetrical pigmentation during flatfish metamorphosis, then propose our hypotheses on left/right asymmetrical pigmentation in flatfish. We reviewed the nutrition and environmental factors causing malpigmentation in ocular side of flatfish aquaculture, then we hypothesized the mechanism of malpigmentation in ocular side of flatfish. We emphasized the staining-type hypermelanosis in flatfish aquaculture and assumed that high occurrence of hypermelanosis is attributed to water flow and higher density. Finally, based on our hypothesis we identified two SNPs related to hypermelanosis and three SNPs responsible for both pseudoalbinism and hypermelanosis in Japanese flounder, and three SNPs associated with pseudoalbinism in Chinese tongue sole. Keywords Pigmentation · Metamorphosis · Malpigmentation · SNPs · Flatfish

7.1

The Establishment of Left/Right Asymmetrical Pigmentation in Flatfish

Pigmentation has been extensively studied in flatfish, for example, Japanese flounder (Paralichthys olivaceus), summer flounder (Paralichthys dentatus), Southern flounder (Paralichthys lethostigma), turbot (Scophthalmus maximus), plaice (Pleuronectes platessa), and Atlantic halibut (Hippoglossus hippoglossus) (Baker et al. 1998; Denson and Smith 1997; Estévez et al. 1997; Næss and Lie 1998; Seikai 1992). The adult forms of flatfish like the Japanese flounder manifest a pronounced asymmetry in their skin pigmentation after metamorphosis, the ocular side is dark brown and the blind side is white. This asymmetric pigmentation occurring under normal development is known to be established after metamorphosis (Matsumoto and Seikai 1992). Flounder have three types of chromatophores: dark melanophores, yellow xanthophores, and silver iridescent iridophores (Watanabe et al. 2008). Body coloration asymmetry develops during metamorphosis via differentiation of melanophores and xanthophores on the ocular side, and iridophores on both lateral sides (Seikai et al. 1987; Matsumoto and Seikai 1992; Shikano et al. 2005). As in © Springer Nature Singapore Pte Ltd. 2022 B. Bao, Flatfish Metamorphosis, https://doi.org/10.1007/978-981-19-7859-3_7

161

162

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.1 Pigmentation changes during ontogeny in summer flounder (Bolker et al. 2005). (a) Newly hatched larvae with a bilaterally symmetrical body. (b) Magnified view of sparsely scattered dendritic melanophores in a. (c) pre-metamorphic larvae at stage E with bilaterally symmetrical body. (d) Magnified view of larger melanophores and xanthophores distributed along the trunk and fin edges in c. (e) The ocular side of the juvenile. (f) Magnified view of e showing dominant melanophores, xanthophores, and iridophores. (g) The blind side of the juvenile. (h) Magnified view of h showing the exclusive iridophores

zebrafish, melanophores in flounder can be divided into larval and adult-type melanophores based on their morphology and differentiation stage. Larval melanophores are relatively large and are distributed on both lateral sides in larvae. Adulttype melanophores, which are much smaller than the larval type, appear for the first time on the ocular side during metamorphosis, to produce body coloration asymmetry (Matsumoto and Seikai 1992). Fish chromatoblasts are the precursor cells of chromatophores; they emerge from the dorsal neural crest cells during embryogenesis, and migrate and proliferate to populate the skin. In flatfish, adult-type melanophores are considered to differentiate from melanoblasts during metamorphosis. The spatially heterogeneous distribution of adult-type melanophores resulted in the left-right asymmetric pigment pattern of adult flatfish (Seikai et al. 1987, 1992, Matsumot and Seikai 1992, Hamre et al. 2007). In addition, the number of xanthophores dramatically raise on the ocular side during metamorphosis and brings about the asymmetric pigment pattern. While iridophores arise on both sides with different patterns, aggregation forms patches on the ocular side and dispersion on the blind side, which cause specific coloration in flatfishes (Seikai et al. 1987; Matsumoto and Seikai 1992). In summer flounder, newly hatched larvae are characterized by symmetrical pigmentation, like the body shape. During early development, more and more melanophores and xanthophores come out, and dendritic iridophores are dispersed over the trunk. The adult-type pigmentation pattern progresses during metamorphosis. Body coloration develops on the basis of the number of melanophores. The ocular side becomes densely populated by larval and adult melanophores. In which, only the adult-type melanophores differentiate on the ocular side throughout metamorphosis and contribute to the adult dark color (Fig. 7.1). By comparison, there are no melanophores and xanthophores on the blind side after metamorphosis (Bolker et al. 2005).

7.2

Hypotheses on Left/Right Asymmetrical Pigmentation in Flatfish

163

Similar observation was identified in barfin flounder (Verasper moseri). There were 80 larval-type melanophores/mm2 on both sides before eye migration, and the density decreased consistently with development to a level of 25 cells/mm2. At each stage, no significant difference was observed between the ocular and blind sides. In contrast, adult-type melanophores appeared only on the ocular side from the settlement of barfin flounder at a level of 300 cells/mm2 (Yoshikawa et al. 2013). In Japanese flounder, the chromatoblasts distributed on the dorsal and ventral margins of the flank migrate to the lateral side continuously throughout the larval stage and then differentiate into the adult-type cytochromes which form the adulttype pigment pattern after metamorphosis (Yamada et al. 2010). Despite the symmetrical supply of chromatoblasts to the left and right lateral sides, the asymmetrical pigment pattern is caused by the asymmetrical development of adult-type pigment cells. During metamorphosis, gch2 probe marked the melanoblasts and xanthoblasts migrating from the dorsal margin of the fin to the skin via the myoseptum by whole mount in situ hybridization in Japanese flounder. The myoseptum of the blind side had fewer gch2-positive cells compared to the skin and myoseptum of the ocular side (Washio et al. 2013). In different species of flatfishes, adult pigmentation patterns are established in different ways (Bolker and Hill 2000). In Japanese flounder, adult chromocytes first appear on the trunk before emerging along the dorsal fin fold, and finally show up over the rest of the body (Seikai et al. 1987). Diamond turbot (Hypsopsetta guttulata) had pigment cells first appearing on the dorsal and dorsolateral surfaces of the body and tail (Orton 1953). In adult green land halibut (Reinhardtius hippoglossoides), pigment cells are distributed on both sides, then fade away on the blind side after a short time. Later, melanophores on the blind side differentiate to re-established the adult pattern with a unique morphology (Norman 1934; Burton 1988). Both the global patterning mechanism and the local tissue environment contribute to the development of normal pigmentation. Global metamorphic initiation causes extreme asymmetrical morphology, and determines the pathway skin follows, ocular- or blind-side (Bolker et al. 2005). While the individual chromocytes within the skin differentiate depending not only on global signals mentioned above but also on their histological niche (Zuasti 2002).

7.2 7.2.1

Hypotheses on Left/Right Asymmetrical Pigmentation in Flatfish Previous Hypotheses

There are several hypotheses that try to explain the normal asymmetrical pigmentation and malpigmentation in flatfish. Kanazawa (1993) suggested that dietary is an important factor. The deficiency of dietary leads to retinal dysplasia, in turn, to visual

164

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

defects, then results in disabled hormonal signals demanded for melanoblast differentiation. Seikai and colleagues thought that chromatoblast histological environment contributes to their appropriate development. An abnormal histological environment may lead to the failure of ocular pigmentation (Seikai 1992; Seikai and Matsumoto 1994). Bolker and Hill (2000) thought that chromatoblasts may have two possible destinies during metamorphosis, differentiation, or disappearance, which are regulated by both intrinsic and extrinsic factors. The intrinsic “clock” triggers melanocyte differentiation at appropriate developmental times. While the extrinsic factors, such as larval diet, light exposure, hormonal signals, and local tissue environment, play a role in chromatoblasts differentiation. Yamada et al. (2010) reported that the asymmetrical pigmentation pattern is caused by the bilateral asymmetry of organization environment, thus regulating the survival, proliferation, layout, and differentiation latent chromoblasts between the left and right side. Isojima and Tagawa (2014) demonstrated the process of one-way differentiation from blind- to ocularside characteristics by transplanting pigmented and nonpigmented scales into the ocular and blind sides of Japanese flounder. An ocular-side transplantation site induced ocular-side pigmentation in transplanted white scales which were originally from the blind side, while a blind-side site did not induce blind-side coloration in black scales which were originally from the ocular side. They proposed the presence of OCI (ocular-side characteristics inducer) on the black scales and/or in the tissue beneath the black scales. So, what kinds of organizational environments or ocular-side characteristics inducer present the left-right asymmetry in flatfish? Hamre et al. (2007) proposed a hypothesis that the interaction between RXR and PPAR and their ligands are responsible for the melanophore development. The left-right pigmentation pattern is established via a gradient of retinoic acid, which is generated by specialized cells related to the eyes. These cells can produce retinoic acid from retinaldehyde and cover the ocular side along with eye migration. Retinoic acid binds the PPAR-RXR nuclear receptor complex and regulates gene transcription responsible for pigment cell development and differentiation. Hamre et al. (2007) postulated that a combination of long-chain n-3 unsaturated fatty acids deficiency and relative arachidonic acid (ARA) abundance in dietary primarily result in malpigmentation in intensively cultured Atlantic halibut. The right gene expression can occur because of the low concentration of RXR and PPAR dimer when fatty acids supply is scarce. The hypothesis is interesting and seems to be supported by the fact that impaired eye migration often causes ambicolored juveniles (Hamre et al. 2007). However, the specialized cells have not been identified yet, which were supposed to be associated with the eyes and use retinaldehyde to produce retinoic acid.

7.2

Hypotheses on Left/Right Asymmetrical Pigmentation in Flatfish

7.2.2

165

Our Hypothesis on Left/Right Asymmetrical Pigmentation in Flatfish

The unexpected expression of the visual opsins in the skin during metamorphosing Japanese flounder was observed in our lab (Fig. 7.2). Generally, there are four cone opsins (rh2, lws, sws1, and sws2) and one rod opsin (rh1) in teleost. In Japanese flounder, each visual only has one copy in genome (Shao et al. 2017a, b). Whole mount in situ RNA hybridization showed that rh1 (Fig. 7.2), rh2, lws (Fig. 7.3), sws1, and sws2 (Fig. 7.4) expressed not only in the eyes but also in skin, fin, jaw, gill, gut, etc. during the metamorphosis in Japanese flounder (Shao et al. 2017a, b). In addition, the expression of these opsin genes in skin was observed in other flatfish metamorphosis stages (Fig. 7.5). And recently, opsins in the skin of the adult octopus have been related to eye-independent color changes (Ramirez and Oakley 2015), giving us an inspiration that visual opsins in the skin may translate illumination differences between ocular side and blind side after settlement of flatfish juvenile, then affect the concentration difference of retinoic acid between both sides, which is supposed by Hamre et al. (2007) to modulate gene transcription related to pigment cell development and differentiation. Moreover, opsin has been reported to be able to regulate the synthesis of RA (McCaffery et al. 1996). We hypothesized that the body tilts during metamorphosis may cause increased light exposure on the ocular side, induce the bilateral retinoic acid gradient, lead to exclusive distribution of adult chromatophores on the ocular side, finally present asymmetrical pigmentation (Fig. 7.6).

Fig. 7.2 Expressional pattern of the rhodopsin (rh1) gene during metamorphosis of Japanese flounder (Shao et al. 2017a, b). (a) Pre-metamorphic larva. (b) Pro-metamorphic larva. (c) Metamorphic climax. (d) Post-metamorphic juvenile. Hybridization signals are red

166

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.3 Expressional pattern of lws and rh2 during metamorphosis of Japanese flounder (Shao et al. 2017a, b). Hybridization signals are red

Fig. 7.4 Expressional pattern of sws2 and sws1 during metamorphosis of Japanese flounder (Shao et al. 2017a, b). Hybridization signals are red

7.3

The Roles of Phototransduction Pathways and Retinoic Acid Signaling. . .

167

Fig. 7.5 Expressional patterns of rod and cone opsin genes during the metamorphosis in Cynoglossus semilaevis, Platichthys stellatus, and Solea senegalensis. (a) lws in C. semilaevis; (b) the large view of a; (c) rh2 in P. stellatus; (d) rh1 in S. senegalensis; (e) rh1 in the eyes of S. senegalensis; (f) rh1 in C. semilaevis; (g) lws in P. stellatus; (h) sws1 in S. senegalensis; (I) sws1 in the eye of S. senegalensis; (j) lws in S. senegalensis; (k) lws in the eye of S. senegalensis; (l) sws2 in S. senegalensis (Shao et al. 2017a, b)

7.3

7.3.1

The Roles of Phototransduction Pathways and Retinoic Acid Signaling in Establishing Asymmetric Pigmentation The Roles of Phototransduction Pathways in Establishing Asymmetric Pigmentation in Japanese Flounder

To test our hypothesis, light with different wavelengths, including white light were used to irradiate on both sides of the skin in pre-metamorphic larvae. Under white light, there were not many chromatophores distributed sporadically on both sides in 38 days after hatching (DAH) larva. The number of chromatosomes increased significantly in subsequent stages. Adult-type pigment cells begin to proliferate at 50 DAH, presenting symmetrical pigmentation at 100 DAH (Fig. 7.7). Light of medium and long wavelengths (red, yellow, and green) resulted in a small number of pigment spots to emerge on the blind side, while light at short

168

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.6 Our hypotheses on the establishment of ocular/blind or left/right asymmetrical pigmentation in flatfish (Zhang et al., 2022)

wavelengths (blue and violet) induced a large number of pigment cells to arise (Fig. 7.8 and Table 7.1). In addition, the ubiquitous expression of genes involved in the phototransduction pathway (rh1, rh2, lws, sws1, and sws2) in the skin is not limited to flatfish. In situ hybridization revealed that opsins (sws2 and rh2) are expressed both in the skin and eye of zebrafish (Fig. 7.9). Using qPCR we also detected expression of sws1 and sws2 in the skin of other fish species including Salmo salar, Scomberomorus niphonius, Cololabis saira, and Hemirhamphus quoyi (Fig. 7.10), suggesting that the expression of opsins in the skin is a universal phenomenon in teleost species and that the establishment of dorsal/ventral pigmentation pattern (left/right pattern in flatfish), named countershading, may be mediated by these visual opsins in the skin. We have confirmed that blue light can induce the formation of melanophores, in sws2-/- zebrafish, the number of melanophores in the dorsal skin was less than wild zebrafish under about 80 days blue light irradiation (Yao 2019).

7.3.2

The Roles of Retinoic Acid Signaling in Establishing Asymmetric Pigmentation in Japanese Flounder

To test the role of retinoic acid (RA) in establishing asymmetric pigmentation in Japanese flounder, we first detected components of a RA-induced pathway,

7.3

The Roles of Phototransduction Pathways and Retinoic Acid Signaling. . .

169

Fig. 7.7 The pigment cell distribution on ocular and blind skin of Japanese flounder after irradiation with white light from both upper and bottom of the tank (Shao et al. 2017a, b). (a1, b1, c1), and D1 show blind side after 38, 50, 80, and 100 days after exposure, respectively. (a1-1, b1-1, and c1-1) are increased magnification of (a1, b1, and c1), respectively. (a2, b2, c2, and d2) show ocular side after 38, 50 80, and 100 days after exposure, respectively. (a2-1, b2-1, and c2-1) are increased magnification of (a2, b2, and c2), respectively

including aldh1, aldh2, and aldh3 gene expression. aldh1 had a high expression before metamorphosis and decreased during pre-metamorphosis, and then reached a maximum at the climax stage. aldh2 was also highly expressed before metamorphosis and then decreased to a relatively low level during metamorphosis. aldh3 expression peaked post-metamorphosis (Fig. 7.11). aldh3 but not the other aldhs was upregulated on the ocular side compared to the blind side in post-metamorphic stages (Fig. 7.12). Real-time RT qPCR further confirmed that aldh3 expressed significantly higher in the skin on ocular side in post-metamorphic juveniles (Fig. 7.13). Since the RA synthesis depends on aldh, left-right asymmetric expression of aldh3 indicates there might exist the left-right asymmetric RA gradients after metamorphosis flounder. There is no commercial retinoic acid antibody available for in site identification. Instead, we used UPLC-MS/MS to determine the concentration of retinoic acids in the colored (ocular) and uncolored (blind) skin of juvenile fish. All-trans retinoic acid (ATRA, 0.0396 ng/mg) and 9-cis-RA (9cRA, 0.1430 ng/mg) in the ocular skin had significantly higher concentration than ATRA (0.0036 ng/mg) and 9cRA (0.0172 ng/mg) in the blind skin, respectively (Fig. 7.14). So indeed, there exist the left-right asymmetric RA gradients in the skin of post-metamorphic flounder.

170

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.8 The pigment cell distribution on ocular and blind skin of Japanese flounder after irradiation with blue light from both upper and bottom of the tank (Shao et al. 2017a, b). (a, c, e, and g show blind side after 38, 50, 80, and 100 days after exposure, respectively. (a1, c1, e1, and g1) are an increased magnification of (a, c, e, and g), respectively. (b, d, f, and h) show ocular side after 38, 50, 80, and 100 days after exposure, respectively. (b1, d1, f1, and h1) are an increased magnification of (b, d, f, and h), respectively Table 7.1 Rate of pigmental cell formation after irradiation of Japanese flounder with different wavelengths of light on the dorsal and ventral surface (Shao et al. 2017a, b)

DAH days after hatching, PBS pigmentation of the blind side, MP malpigmentation

7.3

The Roles of Phototransduction Pathways and Retinoic Acid Signaling. . .

171

Fig. 7.9 Expression pattern of sws2 and rh2 in the skin and eye of zebrafish (Shao et al. 2017a, b). Hybridization signals are red. (a) In situ hybridization of sws2 and rh2, Black boxes represent the increased magnification for the corresponding figures; (b) RT-PCR analysis of sws2 and rh2, M, marker

Retinoic acids, ATRA or 9cRA need to bind their receptors RARs or RXRs to play the physiological roles. Among these receptors, the rxra, but not the other rars, or rxrs, was upregulated on the ocular side compared to the blind side in postmetamorphic stages (Fig. 7.15), indicating that retinoic acid, mainly 9cRA might regulate ongoing pigmentation. In order to further validate the role of retinoic acid in regulating the pigmentation, we injected 9cRA, ATRA, or retinol into the dermal skin of the blind side in pre-metamorphic Japanese flounder to determine whether pigmentation would be affected (Fig. 7.16). The 9cRA and ATRA treatments increased the number of adulttype chromatophores on the blind side of post-metamorphic fish, whereas retinol and DMSO treatments resulted in only a few adult-type chromatophores (Fig. 7.17). Like the result of retinoic acid injection, there was even distribution of adult-type pigment cells on both sides of the skin. This indicates that photoreceptors exposed to blue light may stimulate RA production. Most notably, eye migration stopped under blue light illumination (Fig. 7.18), which means excessive RA was really synthesized under long-time illumination of blue light. Retinoic acid can not only promote the development of adult-type chromatophores, but also inhibit eye migration by impairing the role of thyroid hormone. This can also explain there is a link between

172

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.10 Expression of sws1 and sws2 in skin on the back side and ventral side of non-flatfish (Shao et al. 2017a, b). (a) sws2 expression in Salmo salar. (b) sws2 expression in Cololabis saira. (c) sws1 expression in Salmo salar. (d) sws1 expression in Hemirhamphus quoyi. (e) sws1 expression in Scomberomorus niphonius

disabled eye migration and the failure to develop an asymmetric skin pigmentation pattern in flatfish (Hamre et al. 2007). The gene kit, which is related to pigment cell development, was co-expressed with the genes for blue-sensitive rho protein (sws2) and rxra in pigment cells (Fig. 7.19). This indicates that SWS2 plays a role in promoting retinoic acid synthesis, and then regulates rxra to establish the left-right asymmetrical pigmentation in flatfish. Finally, the mechanism of establishing asymmetric pigmentation in Japanese flounder is shown in Fig. 7.20. The body tilts during metamorphosis increase blue light exposure on the ocular side, then photoreceptor cell modulates the left/right RA gradient through SWS2 due to the body tilt. This would cause an exclusive distribution of adult pigment cells on the ocular skin during pro-metamorphosis (Fig. 7.20).

7.4

Malpigmentation in Flatfish Aquaculture Industry

Under rearing conditions in the hatchery, there is abnormal pigmentation in flatfish, such as hypomelanosis (pseudoalbinism) on the ocular side and hypermelanosis (ambicoloration) on the blind side (Matsumoto and Seikai 1992, Seikai and

7.4

Malpigmentation in Flatfish Aquaculture Industry

173

Fig. 7.11 Relative gene expression of aldhs in different developmental stages of the Japanese flounder (Shao et al. 2017a, b). Hybridization signals are red. Graphs present the relative transcript abundance determined by qPCR of aldh1-3 in early developmental stages and during metamorphosis. Bars represent the standard deviation

174

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.12 Expression patterns of aldhs in the skin of the Japanese flounder (Shao et al. 2017a, b). Hybridization signals are red. (a) aldh3 expressed in pre-metamorphic larva. (a3, a4, a5, or a6) is increased magnification of the part of blind side (a1) or ocular side (a2), respectively. (b) aldh3 expressed at the post-metamorphic stage. (b3, b4, b5, or b6) is increased magnification of the part of blind side (b1) or ocular side (b2), respectively. aldh1 (c) and aldh2 (d) genes expressed in the skin on both sides. There were no significant differences in signal expression on the blind and ocular side skin in pre-metamorphic larvae (c1, c2, d1, d2) and post-metamorphic juveniles (c3, c4, d3, d4)

Fig. 7.13 The expression of aldh3 in the skin of post-metamorphic juveniles Japanese flounder (a) and adults (b) determined by qPCR analysis (Shao et al. 2017a, b)

7.4

Malpigmentation in Flatfish Aquaculture Industry

175

Fig. 7.14 The retinoic acid (RA) concentration in the skin of post-metamorphic Japanese flounder (Shao et al. 2017a, b). RA concentration gradients were detected using UPLCMS/MS in S-MRM mode with m/z 301.2/123.2. One-way ANOVA indicated that there were significant differences between ocular and blind sides for RA concentration gradients

Fig. 7.15 The undifferentiated expressions of rar and rxr genes on both sides in Japanese flounder. Hybridization signals are red. (a), rara; (b), rarb; (c), rarg; (d), rxra; (e), rxrb; (f), rxrg. (a1, b1, c1, d1, e1, and f1) are pre-metamorphic larva, (a2, b2, c2, d2, e2, and f2) are post-metamorphic juveniles (Shao et al. 2017a, b)

176

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.16 The effect of retinoic acid-microinjection on pigment cells. (I) The retinoic acidmicroinjection site on the skin of blind side of Japanese flounder. (II) Quantity of pigment cells after RA treatment (Shao et al. 2017a, b)

Fig. 7.17 Formation of adult chromatophores following microinjection of retinoic acid into the skin on the blind side of Japanese flounder. (a1-1) Increased magnification of the rectangular area of blind side after retinol injection in (a1); (a2-1) increased magnification of the rectangular area of ocular side in (a2). (b1-1) Increased magnification of the rectangular area of blind side after 9cRA injection in (b1; b2-1) increased magnification of the rectangular area of ocular side in (b2). (c1-1) Increased magnification of the rectangular area of blind side after ATRA injection in (c1; c2-1) increased magnification of the rectangular area of ocular side in (c2). (d1-1) Increased magnification of the rectangular area of blind side after DMSO injection in (d1; d2-1) increased magnification of the rectangular area of ocular side in (d2) (Shao et al. 2017a, b)

7.4

Malpigmentation in Flatfish Aquaculture Industry

177

Fig. 7.18 The distribution of adult pigment cells on the blind and ocular side of 100 DAH juvenile Japanese flounder in blue light illumination and control group. Insets show magnified views of adult chromatophores (Shao et al. 2017a, b)

Fig. 7.19 Co-expression of rxra, kit, and sws2 in the pigment cells of skin in post-metamorphic flounder. rxra, kit, and sws2 mRNA were detected with digoxygenin (red), biotin (green), and fluorescein (blue), respectively (Shao et al. 2017a, b)

Fig. 7.20 Mechanism on the establishment of left/right asymmetrical pigmentation in Japanese flounder

178

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Matsumoto 1994, Venizelos and Benetti 1999, Bolker and Hill 2000, Hamre et al. 2007). Pigment anomalies are often incurred as either hypomelanosis characterized by the total or partial absence of the brownish coloration on the ocular side, or hypermelanosis in the blind with the total or partial brownish coloration on the blind side (Yamada et al. 2010). There have been many reports on the body color abnormalities in different kinds of farmed flatfishes, such as turbot (Reitan 1994), Japanese flounder (Yoo et al. 2000; Seikai 1992; Seikai et al. 1987), Senegalese sole (Solea senegalensis)(Villalta et al. 2005; Darias et al. 2013), starry flounder (Platichthy stellatus) (Kang et al. 2012), Spotted halibut (Verasper variegates) (Yamada et al. 2011), European plaice (Pleuronectes platessa) (Dickey-Collas 2005), California flounder (Paralichthys californicus) (Vizcaíno-Ochoa et al. 2010), Brown sole (Aritaki 1991), Acbirus lineatus (Houde 1971), frog flounder (Pleuronichthys cornutus) (Kitajima et al. 1987), verfin flounder (Verasper moseri), stone flounder (Kareius bicoloratus), cresthead flounder (Pseudopleuronectes schrenki), willowy flounder (Glyptocephalus kitaharai), slime flounder (Microstomus achne) (Aritaki 1995), and so on. Specifically, the malpigmentation on the ocular skin has been observed from 24.5% to 100% in hatchery-reared Japanese flounder (Seikai et al. 1987) and from 1% to 35.6% in Atlantic halibut (Næss and Lie 1998) and from 1% to 5% in Chilean flounder (Paralichthys adspersus) (Silva 2001). Nearly 100% malpigmented fish have been observed in tank-cultured summer flounder and Southern flounder (Stickney and White 1975). Blind-side pigmentation has been occurred 95% of hatchery-reared Japanese flounder (Tominaga and Watanabe 1998) and from 0.8% to 12.8% in Atlantic halibut (Næss and Lie 1998). In hatchery-reared Black Sea flounder (Platichthys flesus), juveniles represented more than 35% ocular-side malpigmentation and about 7% bind side pigmentation (Aydin 2012). The incidences of albinism and hypermelanosis are 10.1% and 91.7% in artificial starry flounder, respectively (Kang et al. 2012). Mass production of these seedlings is undertaken for enhancement of the coastal fisheries. The body pigmental anomalies particularly albinism will contribute to poor survival rates because the lack of cryptic coloration makes albino juveniles easier to be caught by predators in the wild. In New Zealand turbot (Colistium nudipinnis), juvenile with abnormal pigmentation is more susceptible to the ciliate Trichodina sp. (Diggles 2000). Moreover, pigmental anomalies diminishes the commercial value of the flatfish (Matsumoto and Seikai 1992, Bolker and Hill 2000). The market value of flounders with hypermelanosis, both those reared to harvest size in aquaculture systems and those released into the sea for recapture by fishermen, is about 20–70% lower than that of fish with normal coloration (Mizutani et al. 2020).

7.4

Malpigmentation in Flatfish Aquaculture Industry

7.4.1

Malpigmentation Pattern in Flatfish

7.4.1.1

Types of Pigmentation Defects

179

There are many types of body color abnormalities in flatfish (Seikai 1985, Yamanome et al. 2005). Albinism, pseudoalbinism, or hypomelanism are characterized by different degrees of chromocyte deficiency on the ocular side. Staining, spotting, or ambicoloration are characterized by excess pigmentation on the blind side. The distinct appearances are caused by different numbers of melanophores and xanthophores. Compared to normal summer flounder (Paralichthys dentatus) (Fig. 7.21a, b), albinic ones (Fig. 7.21c, d) have a severe reduction in the number of melanophores

Fig. 7.21 Normal and abnormal pigmentation patterns in summer flounder (Bolker et al. 2005). Normal (a, b), albino (c, d), patchy (e, f), ambicolored (g, h), and stained (i, j)

180

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

and xanthophores on both sides of the body. It is almost completely white on the ocular side (Bolker et al. 2005). It is common that there are some black patches remaining on the ocular side, especially around the mouth and operculum of albinic individuals in summer flounder and other species. There are many variable patterns in the occurrence of albinism. For example, the pigment cells are most likely located on the ocular side from the tip of the snout to the margin of the eyes, and along the trunk in Japanese flounder, Atlantic halibut, plaice, and southern flounder (Seikai et al. 1987; Gara et al. 1998; Næss and Lie 1998. von Ubisch 1951; Denson and Smith 1997). Denson and Smith (1997) reported that strong light exposure compensated partial albino in southern flounder under low light through pigmentation acquisition after metamorphosis. The result indicates that partial albinos preserved the ability to repair defective pigmentation. The differentiation of melanophores required the stimulation of increased light levels. Ambicoloration of flatfishes can be divided into three types: staining typically presenting as a hyperpigmented patch with irregular borders that gradually enlarges on the blind side; presence of dark spots or disconnected dark areas; and true ambicoloration, in which the blind side pigmentation mimics the normal pattern on the ocular side (Norman 1934). True ambicoloration and spots appear at the end of metamorphosis. Ambicolored fish (Fig. 7.21g, h) shows similar dark pigmentation on the blind side with that on the ocular side (Bolker et al. 2005). The pigmentation pattern of ambicoloration is the total or partial distribution of chromocytes on the blind side, and the normal distribution on the ocular side. Partial ambicoloration is more common and accounts for a high proportion of farmed Japanese flounder (Tominaga and Watnabe 1998). Staining is a color anomaly that occurs after the completion of metamorphosis, which expresses itself as darkened areas on the blind side of the fish (Isojima et al. 2014). Staining develops in juveniles cultured in sinks without sandy substrata after a long time (Stickney and White 1975, Iwata and Kikuchi 1998), and can also be induced by illumination (Seikai 1991). The pattern of staining on the blind side is complex and highly variable like albinism (von Ubisch 1951, Seikai 1992). Stained fish (Fig. 7.21i, j) usually have normal pigmentation on the ocular side, but develop light gray or brown patches on the blind side (Bolker et al. 2005). Staining occurs most commonly in the areas extending from the dorsal and ventral edges inward toward the midline, and from the caudal peduncle forward (Kikuchi and Makino 1990; Seikai 1980). Compared to ambicoloration, the pigmentation pattern of staining on the blind side is not as intense as normal pigmentation on the ocular side. Without distinct patterns, staining occurs well after metamorphosis, and is much more labile (Ottesen and Strand 1996, Seikai and Matsumoto 1991, Stickney and White 1975). Albinism is common in the population fed by particular diets. High rates of albinism have been reported in Japanese flounder (Seikai et al. 1987; Kanazawa 1993), plaice (Dickey-Collas 2005), turbot (Dhert et al. 1994), and Atlantic halibut (Gara et al. 1998). In previous studies, Artemia feed before metamorphosis caused 97–100% albinistic Japanese flounder larvae, however, wild zooplankton feed resulted in less than 2% malpigmented larvae (Seikai 1985). Since the 1970s, the

7.4

Malpigmentation in Flatfish Aquaculture Industry

181

rate of albinism in hatchery populations has gone down significantly due to the diet improvement. Staining on the blind side happens frequently in hatchery-reared fish after metamorphosis, although related researches were not as thorough as albinism (Tominaga and Watnabe 1998). Seikai (1991) reported that fluorescent light exposure could induce staining on the blind skin of juvenile Japanese flounders. Excessive pigmentation emerged gradually on the blind side of juvenile Atlantic halibut cultured in tanks with smooth bottom (Ottesen and Strand 1996). It takes several months for summer flounder to develop pigmentation on the blind side (Stickney and White 1975). By comparing the histological results of malpigmented skin in three flatfishes, we can see some commonalities. The skin of albino fish on the ocular side is closely similar to the normal skin on the blind side in Japanese flounder (Seikai et al. 1987, Seikai 1992, Seikai and Matsumot 1994). In albino plaice, the ocular side skin has few melanophores, but a normal complement of xanthophores and iridophores, which resembles the blind-side skin (Roberts et al. 1971). Oppositely, the blind side of ambicolored winter flounder has typical ocular-side histology and pigmentation (Burton 1988). In a single ambicolored specimen of Xystreuris rasile, it also supports Norman’s original description that true ambicoloration presents ocular side patterns on the blind side (Norman 1934). Suzuki, however, has argued that malpigmentation on the blind side of hatchery-reared Japanese flounder may follow a unique developmental pathway (Suzuki 1994). In general, ocular side albino patches are similar to normal blind-side skin in Japanese flounder and plaice (Robert et al. 1971; Seikai et al. 1987; Seikai 1992; Seikai and Matsumoto 1994), and blindside dark patches resemble normal ocular side skin in winter flounder and Xystreuris rasile (Burton 1988; Diaz de Astarloa 1995).

7.4.2

The Progression of Hypermelanosis in Blind Side

The progression of staining-type hypermelanosis in normally metamorphosed juveniles was examined in the Japanese flounder. The order of occurrence was as follows: (1) pigmentation expanding from the tail base to the front; (2) pigmentation expanding from the base of pectoral and pelvic fins until the two areas connected; and (3) pigmentation expanding from the center of the head to the body center (Fig. 7.22) (Isojima et al. 2013b). Staining area is proportionate to time as development goes on (Kang and Kim 2012b), but darkening is usually stopped at about 8–10 weeks in all individuals. The progression of staining does not continue until adulthood, but only continues for about 2 months (Ohta 2004; Isojima et al. 2013b). The individuals with earlier staining occurrences have smaller body size at the end of the study (Isojima et al. 2013b). The malpigmentation on the blind side of starry flounder was initially observed at about 2 cm in length and 100 mg in weight, and the pigmented domain on the blind-side skin was continually broadened by the

182

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.22 Typical pattern of staining expansion. Black area represents the pigmented areas. Stainstarted individuals, 5.4-cm body length at 0 week and 12.4 cm body length at the 10th week (Isojima et al. 2013b)

differentiation of pigmented cells (melanophores and xanthophores) with growth (Kang et al. 2014).

7.4.3

The Progression of Pseudoalbino in Ocular Side

The progression of pseudoalbino in the ocular side is actually the darkening process on the ocular side. Based on the observation of Isojima et al. (2013a), there were two types of Japanese flounder. Type A is characterized by the darkening from the trunk to the head. Type B is characterized by the simultaneous darkening of the head and the trunk. In both types, the anterior base of the dorsal fin is barely darkened. When mentioned the trunk pigmentation, darkening of the trunk follows a typical manner

7.5

Nutrition and Environmental Factors Causing Malpigmentation in Ocular. . .

183

Fig. 7.23 Two typical patterns of pigment expansion on the ocular side of pseudoalbino Paralichthys olivaceus. Black areas represent pigmentated areas. Type A is pigmentation from trunk to head, Type B is simultaneous pigmentation of trunk and head (Isojima et al. 2013a)

from the tail to the head (Fig. 7.23). However, these two pigmentation types on the ocular side are only reported in pseudoalbino Paralichthys olivaceus but not reported in other flatfish species (Bolker et al. 2005; Guillot et al. 2012).

7.5

Nutrition and Environmental Factors Causing Malpigmentation in Ocular Side in Flatfish Aquaculture

9cRA plays a physiological role through binding to its nuclear receptor RXRs. RXR needs to be combined with RAR, or TR (thyroid hormone receptor), or VDR (vitamin D3 receptor), or PPARγ (peroxisome proliferators-activated receptors) (Kang and Kim 2012a), to form heterodimers that bind to the retinoic acid response element (RARE) to enhance or depress gene transcription (Itoh et al. 2012; Mizusawa et al. 2011). For example, flounder treated with exogenous thyroid hormone had high frequency of pseudoalbino (Seikai et al. 1987; Yoo et al. 2000; Aritaki and Seikai 2004; Tagawa and Aritaki 2005). T3 may impair the role of 9cRA via binding RXR/TR, as it found in zebrafish can inhibit the formation of adult-type melanophores (McMenamin et al. 2014). Therefore, based on the mechanism of left/right asymmetrical pigmentation establishment in Japanese flounder (Shao et al. 2017a, b), the environmental factors such as vitamin A in the feeder, or light especial blue light, can directly affect the 9cRA metabolism and further pigment cell development; and other factors such as

184

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.24 Our hypotheses on malpigmentation in the ocular side of flatfish (Zhang et al. 2022).

thyroid hormone, vitamin D3, or polyunsaturated fatty acid (PUFA) can indirectly affect the regulation of retinoic acid on the target gene for pigment cell development (Fig. 7.24). There are numerous, in particular, PUFA or their derivatives called eicosanoids are natural ligands of PPARγ (Marion-Letellier et al. 2016). In short, inappropriate amount of ligands of thyroid hormone receptors, vitamin D3 receptor, or PPARγ can indirectly affect the regulation role of retinoic acid during the formation of adult-type melanophores (Fig. 7.25).

7.5.1

Nutrition

Hatchery-reared flatfish larvae are commonly fed rotifers (Brachionus plicatilis), followed by Artemia until metamorphosis. The larval diet until metamorphosis is thought to be critical for normal pigmentation, although there is no unanimity as to the exact nature of its effect.

7.5

Nutrition and Environmental Factors Causing Malpigmentation in Ocular. . .

185

Fig. 7.25 The retinoid X receptor RXRs formed heterodimer with other nuclear receptors (RARs, TRs, VDR, or PPARγ) (Marion-Letellier et al. 2016)

7.5.1.1

Vitamin A

Vitamin A, a precursor of retinoic acid, will lead to abnormal body color with high levels in feed (Guillot et al. 2012; Jeong et al. 2010). This may be caused by destroying retinoic acid gradients on the left and right skin (Hubbs and Hubbs 1945; Houde 1971). For example, the effect of Artemia nauplii enriched with different levels of vitamin A (VA) palmitate has proved to increase the occurrence of hypermelanosis on the blind side of Japanese flounder Paralichthys olivaceus (Tarui et al. 2006).

7.5.1.2

Vitamin D3

Vitamin D3 plays a major role in calcium homeostasis and bone formation and is known to regulate cell proliferation and differentiation. Vitamin D3 compound, 1,25-dihydroxyvitamin D3 was found to play a role in inducing hypermelanosis on the blind side and vertebral deformity in juvenile Japanese flounders (Haga et al. 2004).

7.5.1.3

Polyunsaturated Fatty Acid

After binding to a ligand, PPARγ forms a heterodimer with the retinoid X receptor (RXR), recruits coactivator such as PPARγ coactivator 1-α (PGC-1α) and binds to

186

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

the peroxisome proliferator response element (PPRE) gene promoter, leading to regulation of gene transcription. There are numerous natural PPARγ ligands, PPARγ is able to bind a variety of lipophilic acids, such as arachidonic acid (ARA), eicosapentaenoic acid (EPA) (Marion-Letellier et al. 2016). Routine enrichment with docosahexaenoic acid DHA and arachidonic acid ARA has been reported to be able to induce pigment abnormalities in flatfish (Kanazawa, 1991; Dhert et al. 1994; Villalta et al. 2005). Kanazawa (1991) found that melanin formation in marbled sole (Limanda yokohamae) was suppressed without DHA in the diet. Dhert et al. (1994) reported that the highest pigmentation level was obtained when turbot fry were fed diets with high levels of DHA. High arachidonic acid in feeder caused a high frequency of pseudoalbino in flounder and Sole (Estévez et al. 1997; Villalta et al. 2005; Lund et al. 2007; Boglino et al. 2013). Prostaglandin E2 or Prostaglandin E3 (PGE2, PGE3), derived enzymatically from the fatty acid arachidonic acid, can bind the receptor PPARγ.

7.5.2

Light

It is supposed that light intensity plays a critical role in the normal development of pigmentation in flatfish (Venizelos and Benetti 1999). Gartner (1986) noted that developmental anomalies, including hypomelanosis, appear to occur most often in species or families of flatfishes that inhabit shallow waters and suggested that the depth of occurrence of a flatfish species may be linked to the frequency of abnormalities. Inappropriate lighting may be responsible for the prevalence of pigment abnormalities in hatchery-reared populations as well. When light intensity was increased at day 37 after hatching, partially albinic southern flounder (P. lethostigma) showed a significant increase in normal pigmentation (Denson and Smith 1997). However, too strong a light intensity at metamorphosis may also lead to albinism and ambicoloration (von Ubisch 1951). Moreover, after continuous 24-h illumination, abnormal pigmentation appears at a high ratio and that skin color of the flounder was paler than in natural light conditions (Itoh et al. 2012). Seikai et al. (1987) demonstrated that melanogenesis can indeed be stimulated by ultraviolet-B irradiation on both the ocular and blind sides of P. olivaceus, unequivocally resulting in ambicoloration (Matsumoto and Ishii 1986). UV B irradiation can induce melanophore differentiation in stone flounder (Matsumoto and Seika 1992). UV A irradiation has little effect on melanophore differentiation on both sides of the body (Matsumoto and Ishii 1986).

7.5.3

Temperature

Relationships between temperatures and frequency occurrences of normal, pseudoalbino, and ambicolorate fish were investigated in hatchery-reared brown

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

187

sole Pseudopleuronectes herzensteini by Aritake and Seikai (2004). The frequency of occurrence of normal fish increased notably at high temperature and showed the highest (73.8%) at 21 °C. On the other hand, the frequency occurrence of pseudoalbinic fish showed a reverse tendency to those of normal fish. The highest was about 75–80% at 12 °C, whereas they decreased in either temperature direction from 12 °C. The frequency occurrence of ambicolorate fish was lower than 20% in all temperatures. Spotted halibut and Japanese flounder also showed that pseudoalbinism could be reduced by increasing temperature (Tsuzaki 1995; Seikai et al. 1986), suggesting that if reared flatfishes showed slower growth and development than the wild flatfishes, we can increase the temperature to improve the appearance of normal fish (Aritake and Seikai 2004). Based on the observation that the levels of T4 changed with the shift of rearing temperature, and the frequency occurrences of morphological abnormalities positively correlated with the T4 peak levels and rearing temperatures in Spotted halibut and brown sole (Hotta et al. 2001); Aritake and Seikai (2004) postulated that the increase of normal flatfishes by elevating the temperature might induce the level of T4. We agree that the increase in the temperature may improve the appearance of normal fish. However, we do not think the flatfish reared at lower temperatures with a higher occurrence of pseudoalbinism is caused by low level of T4, because T3 can inhibit the formation of adult-type melanophore (McMenamin et al. 2014), and in fact, the eye in pseudoalbinism brown sole in the experiment of Aritake and Seikai (2004) was greatly moved or both eyes moved, that indicates the pseudoalbinism should not be the result of the shortage of thyroid hormone. Other flatfish with uncompleted eye, generally own malpigmentation as well (Cerdà and Manchado 2013; Xing et al. 2020). In summary, in normal flatfish the skin pigmentation of ocular side may be mainly caused by the light from the water surface, especially the blue light, which is via inducing the synthesis of retinoic acid. The inappropriate environmental factors, such as nutrition and temperature, will impact the role of retinoic acid to induce the pigmentation in ocular side, causing pseudoalbino or ambicoloration.

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in Flatfish Aquaculture

Several physical and ecological factors including rearing density, tank color, and the tank bottom, have been supposed to be involved in malpigmentation in flatfish, especially in staining-type hypermelanosis.

188

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

7.6.1

Environmental Factors

7.6.1.1

Rearing Density

Hypermelanosis results in patches on the blind side with the process of irreversible and continuous differentiation and development of chromatophores (Kang and Kim, 2012b), and it appears more common in flatfishes at high stocking density (Bolker and Hill 2000; Venizelos and Benetti 1999). Takahashi (1994) reported an expansion of malpigmentation reared at high density. Kang and Kim (2012a) compared the malpigmentation rate under two different rearing density, and found the ratio of pigmented area and ambicolored fish number in both groups significantly increased with the percentage of coverage area (PCA). Specifically, both darkened area ratio and ambicolored fish ratio were significantly greater under 450 fish/m2 density than under 150 fish/m2 density from 30 to 60 days; while, no significant differences in malpigmentation were found between the two density groups at the end of the experiment, when the PCA (>300%) increased significantly over time. This result suggested that hypermelanosis on the blind side appeared and increased within a specific range of total biomass (or PCA) among fish. Thus, the high density caused by growth led to hypermelanosis development in both groups cultured in dark tanks without burrowing bottom substrates. Ambicolored flounders have been reported experiencing greater stress levels than normal colored ones, Kang and Kim (2012a) suggested that high rearing densities may induce crowding stress and then lead to malpigmentation in flatfish. There is another guess that hypermelanosis is a result of a crowding response which stimulates the recurrence of cells that once served as a defensive camouflage role on the blind side. Since the hypermelanosis tends to be more severe when flatfish juveniles are reared at high stocking densities, a more stressful culture conditions, Matsuda et al. (2018) investigated the possible contribution of stress-induced cortisol production to this phenomenon. Orally administered cortisol to Japanese flounder can promote hypermelanosis in a dose-dependent manner.

7.6.1.2

Background Color

In asymmetrical Pleuronectiforms, background color affected hypermelanosis on the blind side through different densities. The barfin flounder cultured in brightly colored tanks at low density (initial density 30 fish/ton) for several months reduced blind-side hypermelanosis (Amiya et al. 2005; Yamanome et al. 2005). Hypermelanosis on the blind side of Japanese flounder Paralichthys olivaceus can be diminished by rearing in a white tank (Yamanome et al. 2007). However, in the study of Kang and Kim (2012a), the bright background color completely suppressed blind-side pigmentation in olive flounder at low density, but not high density although it was time dependent (the first 60 days) (Fig. 7.26). Which is partially

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

189

Fig. 7.26 Blind-side characteristics of olive flounders cultured in three types of tanks (dark-green background and flat bottom, white background and flat bottom, and dark-green background and substratum bottom) for 120 days (Kang and Kim 2012a)

consistent with results reported by Takahashi (1994) that suggested that abnormal pigmentation increases with stocking density (Diggles 2000).

7.6.1.3

Burrowing Substratum

The sandy bottom substratum showed a consistent and strong suppression of flatfish hypermelanosis under low-density indoor culture (Estévez et al. 2001; Iwata and Kikuchi 1998; Ottesen and Strand, 1996; Kang and Kim 2012a, 2013a, b, c; Isojima et al. 2013b, 2014). Once sand was removed, hypermelanosis happened again, which suggested a strong but temporary effect of bottom sand and the absence of time limitation in the staining progression (Iosjima et al. 2014). However, sandy bottom is not practical for use in commercial rearing systems, because of its hard cleaning, especially in terms of washing out residual food and excrement. Kang and Kim (2012a) showed that burrowing substratum had a positive effect on preventing blindside staining in developing olive flounders. Small gravel (diameter of 4–6 mm) were adopted as a burrowing substratum that does not have the disadvantages of sand. A lower level of staining (less than 2%) was found in the fish under a gravel burrowing substratum. The presence of a burrowing substratum may have the function of preventing abnormal pigmentation in ultrahigh-density farmed flounders. Nakata et al. (2017) confirmed the inhibition of hypermelanosis in Japanese flounder using a commercially available corrugated sheet, and proposed that the contact between the blind skin and the bottom may be beneficial to hypermelanosis suppression. Most recently, one more effective way to be developed to prevent hypermelanosis by culturing Japanese flounder in net-lined tanks (Fig. 7.27) (Mizutani et al. 2020). Before hypermelanosis, the juveniles were transferred to the net-lined tank with a 4-mm mesh of size 4 mm. After 2 months, the ratio of hypermelanosis area to the blind skin area was only 0.5%, which was about 1/40th of the ratio in normal fish cultured in an ordinary tank (20%) (Fig. 7.28). The utilization of a larger mesh size (12 mm) could further decrease the pigmentation development, such as in the axilla area (the area covered by the pectoral fin), where smaller-sized mesh (mesh size

190

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.27 Schematic diagrams of the experimental setup (Mizutani et al. 2020). (a) Experiment 1: effect of a net-lined rearing tank on juvenile Japanese flounder before hypermelanosis emergence. (b) Experiment 2: hypermelanosis inhibition in the axilla area. X represents pectoral fin ablation on the blind side; Control, intact juveniles in a tank without a net lining; finless, pectoral fin-ablated juveniles in a tank without a net lining; net, intact juveniles in a tank with a standard net lining; finless+net, pectoral fin-ablated juveniles in a tank with a standard net lining; large mesh, intact juveniles in a tank with a large mesh size net lining; sand, intact juveniles in a tank with a 1-cm deep sandy bottom

Fig. 7.28 Blind side images of juvenile Japanese flounder reared in the control tank without a net lining (a) and the net-lined tank (b, net) (Mizutani et al. 2020)

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

191

4 mm) could not prevent the pigmentation. Mizutani et al. (2020) proposed that net-lined rearing tanks with larger-sized mesh could be used to prevent hypermelanosis in Japanese flounder aquaculture systems. However, this kind of tank also has disadvantages. It was found that juveniles cultured in net-lined tanks showed slower growth and different body proportions compared to those normal juveniles. Previous study showed that the body depth during flatfish metamorphosis is regulated by thyroid hormones (Xu et al. 2016). This may explain why juveniles cultured in net-lined tanks grew slower.

7.6.2

Hypothesis on Occurrence of Staining-Type Hypermelanosis

Hypermelanosis is the most prominent phenotype in various color abnormalities of flatfishes cultured in hatcheries. The staining-type hypermelanosis is a major problem of hatchery-reared individuals, and it is difficult to engage in prevention on the industrial scale of flatfish, such as in Japanese flounder and Chinese tongue sole (Mizutani et al. 2020; Zhang et al. 2022). This pigmentation may arise in any area on the blind skin but are most typical for the marginal area, the axilla area, the abdominal area, and the head area (Fig. 7.29). The occurrence of staining-type hypermelanosis is difficult to explain with the above hypothesis. Nakata et al. (2017) found the dimpled floor of tank with 12 hollows (depth: 1–2 cm and diameter: 5–10 cm) had an effect on inhibiting hypermelanosis in Japanese flounder. Based on this observation, they supposed that the darkened area on the blind side was caused by its lack of floor contact. They estimated the areas with floor contact on the blind side of juveniles. Figure 7.30 showed flatfish reared in the flat floor of tank (a, c), the contact areas with the floor focused on only the center of the trunk on the blind skin. On the dimpled surfaces (Fig. 7.30b), the floor contact area expanded from the central trunk to the entire blind area, including body margin. On corrugated sheets (polycarbonate slate, pitch 130 mm, depth 36 mm), the floor contact area was restricted to the dorsal and ventral margins of the body but not the central trunk (Fig. 7.30d).

Fig. 7.29 The typical hypermelanosis appears in four areas independently on the blind skin: the marginal area, the axilla area, the abdominal area, and the head area (follow Mizutani et al. 2020)

192

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.30 The correlation between the floor contact area and darkened area on the blind side (Nakata et al. 2017)

Hypermelanosis is the abnormal proliferation of pigment cells mainly occurring along the body margins and the base of the pectoral fins on the blind skin of juveniles cultured on flat, dimpled, and corrugated floors (Fig. 7.30). This finding seems supporting their hypothesis that stimulation produced by contact inhibited melanin production in the contact area in a certain way (Nakata et al. 2017). However, the margin of the blind side, which is the contant area when using corrugated plates, became dark to some extent (Fig. 7.30), this nonconsistence of hypermelanosis area and contact area maybe indicate that body contact maybe not an exact factor to be capable to inhibit hypermelanosis. Mizutani et al. (2020) found that net-lined rearing tanks could prevent Japanese flounder hypermelanosis. However, the melanin production in axilla area was not easy to be inhibited, this was postulated that the pectoral fin would block the contact between the blind corresponding skin and the floor, then induce hypermelanosis. So, Mizutani et al. (2020) examined the effect of pectoral fin ablation, however, it had no significant effect on hypermelanosis with or without a net lining. This is another observation indicating that hypermelanosis might be directly inhibited by body contact. Kang and Kim (2013c) observed the absence of shelter in which flounder can burrow or hide induces blind-side hypermelanosis, and that flounder consistently burrow beneath the substratum to prevent malpigmentation. Blind-side non-pigmented flounders, which were cultured in a gravel substratum tank for 2 years from the hatching stage, were selected to identify the relative contributions of fish burrowing behavior into gravel substratum and skin acupressure due to a custom-made embossed bottom (Fig. 7.31a). The malpigmentation ratios were significantly different among the three groups. When compared to the value on the initial day, the ratios in the flat-bottomed (control) and embossed groups increased significantly by day 90, but the ratio in the gravel group remained low (Fig. 7.31b). This result showed that the burrowing of flounder into gravel was more important than the stimulus of rough gravel on blind skin to prevent blind-side hypermelanosis. So, what induces the blind-side hypermelanosis in flatfish? It is interesting that besides the left-right asymmetric pigmentation, there exists different types of scales between two sides of flatfish body as well. Normally, cycloid scales are only present on the blind side of flounder, and ctenoid scales are only on the ocular side. The main

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

193

Fig. 7.31 Diagrams of three bottom types of aquarium (a). Flat bottom, a custom-made embossed bottom (cylindrical bump: mean height 50 mm and mean diameter 20 mm), and a gravel bottom (4–6 mm in diameter; 8–10 cm in thickness). Pigmented area ratio of blind side in Japanese flounder reared in three bottom types of aquariums (b) (Kang and Kim 2013c)

difference between ctenoid and cycloid is cteniis only in the posterior field of ctenoid scale. Both types of scales are formed after metamorphosis in flatfish, and the cycloid formed first on both sides, then the cycloid scales developed into ctenoid scales on the normal ocular side while remained original status on the normal blind side (Norman 1934; Zhu et al. 2004). We found in adult Japanese flounder, there are only typical cycloid scales on blind side, and only typical ctenoid scales on ocular side. In juvenile flounder (100 days after hatching), there existed five types of scales (Fig. 7.32). Type I is a cycloid with less radii and circuli; Type II is a typic cycloid with more radii and circuli; Type V is a typic ctenoid with cteniis. Type III and Type

194

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.32 Transitional scales between cycloid and ctenoid scale in juvenile flounder (Wang et al. 2017)

Fig. 7.33 Cycloid scales in albino area of ocular side in Japanese flounder (Wang et al. 2017). Bars of the fish, 1 cm; Bars of scale, 200 μm

IV seem to scale with transitional morphological features between typical cycloid scale and ctenoid scale. Several broken circulis and small ctenii-like structure in posterior field can be seen in type III scale. We can see a first typic ctenii in the posterior field of type IV (Wang et al. 2017). In malpigmentation flatfish, cycloid or ctenoid scale is not always on blind side or ocular side. Scales present in hypomelanized ocular-side skins are cycloid as observed in the normal, non-melanized blind side (Seikai 1980). In Japanese flounder, cycloid scales were found abnormally in the albino area of the ocular side of juveniles (Wang et al. 2017) (Fig. 7.33). Ambicolored fish have areas on the blind side with adult-type pigment cells and ctenoid scales, instead of a few larval pigment cells and cycloid scales. Ctenoid scales were found abnormally on the blind side in the darkened area of the blind side of juveniles (Seikai 1979; Suzuki 1994; Zhu et al. 2004; Isojima et al. 2013b; Peng et al. 2019).

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

195

Fig. 7.34 The proportion of ctenii in the scales of the hypermelanosis specimens (Peng et al. 2019). BOB normal skin on the ocular side, BbB melanized skin on the blind side, BbC normal skin on the blind side

In addition, it has been reported that ctenoid scales with fewer spines were found on the stained area near the boundary to the normal area (Seikai 1979; Isojima et al. 2013b; Peng et al. 2019). We investigated the correlation between the adult-type pigment cells and ctenoid scales in Japanese flounder (Peng et al. 2019). In normal skin on the ocular side (BOB), the density of melanophore is highest at around 400 per square centimeter (Fig. 7.34a) and all the scales are ctenoid with at least five cteniies (Fig. 7.34c). In melanized skin on the blind side (BbB) the number of melanophores is around 250 per square centimeter (Fig. 7.34a, b), there are two types of scales: 24% are cycloids and 76% are ctenoids, and the number of ctenii is less than five (Fig. 7.34c). In normal skin on the blind side (BbC) there are almost no melanophores and all the scales are cycloids (Fig. 7.34c). Zhu et al. (2004) observed that the scales on different positions of recovering albino fish showed the development of scales from immature cycloid scales to mature ctenoid scales following the recovery of pigmentation in Japanese flounder. Isojima et al. (2013b) found that on the blind side of all examined individuals of Japanese flounder, the presence of ctenoid-scale-covered areas was confirmed almost exclusively within darkened areas (Fig. 7.35). It is suggested that a close relationship existed between the occurrence of pigmentation and development of scales (Kikuchi and Makino 1990, Isojima et al. 2013b). We further approved that staining and a shift to ctenoid scales have a strong relationship in Japanese flounder (Fig. 7.36, Peng et al. 2019). Ctenoid scales with fewer spines were found on the stained area near the boundary to the normal area.

196

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.35 Typical example showing the similarity between the ctenoid scale area at 11th week (a) and darkened area at third week (b) (Isojima et al. 2013b)

Fig. 7.36 Melanophore type and scale type of skin in different parts of the skin in hypermelanosis Japanese flounder (Peng et al. 2019). (a) Collecting positions on the ocular side and blind side. (1) Ocular side and (2) blind side. (a) Melanized skin, (b) the skin near the melanized skin, (c) the normal skin. (b) Melanophore types in different parts of skin. (1) Melanophore on the ocular side; (2) melanophore on the melanized blind side; (3) melanophore near the melanized skin on the blind side; (4) melanophore on the normal blind side; (a) adult-type melanophore; (b) larval-type melanophore. (c) Scales type of skin in different parts. (1) scale on the ocular side; (2) melanophore on the melanized blind side; (3) scale near the melanized skin on the blind side;(4) scale on the normal blind side

Generally, the staining started earlier than the appearance of ctenoid scales on the blind side (Isojima et al. 2013b; Zhu et al. 2004), suggesting that the shift to ctenoid scales stops independently from that of staining, but it may not exclude the possibility that a same factor to induce staining or the shift of cycloid scale to ctenoid scale. Whether it is possible that the water flow instead of body contact is more

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

197

Fig. 7.37 Data statistics of cycloid and ctenoid scales at different sites in two species of croakers (Wang et al. 2017)

possible factor to be able to induce hypermelanosis in the blind side? We suppose the water flow might be the factor we are looking for. As a benthic fish, flatfish are usually found half‐buried in sand. Their blind side has less contact to water flow, whereas the ocular side often has frequent contact with water flow contacting the body surface. Besides the difference in light density received from the sea surface between the ocular side and blind side, the contact intensity with water flow might be another difference between the two sides among the various environmental factors. So far, there seems to be no study on the direct relationship between water flow and fish pigmentation. The darkening of the blind side mainly starts from the caudal peduncle area, and extends forward along the bases of the dorsal and anal fins (Isojima et al. 2013b; Kang and Kim 2012b), this can give us a common understanding that more fast water flows through the tail skin surface resulting from the tail swinging up and down than other body parts, may cause first emerge of skin staining. Likewise, there is no report about whether water flow can induce fish cycloid into ctenoid. We have ever investigated the distributional difference of ctenoids and cycloids in different body areas, such as large yellow croaker (Larimichthys crocea) and small yellow croaker (Pseudosciaena polyactis). We found a big difference in the numbers of cycloid scales or ctenoid scales along the anterior-posterior axis, instead of along the left-right axis or dorsal-ventral axis in these two fish species. The number of cycloid scales decreased gradually from the head to tail, on the contrary, the number of ctenoid scales increased gradually from anterior to posterior (Fig. 7.37) (Wang et al. 2017). In addition, the transitional morphological features between the typical cycloid scale and ctenoid scale also existed in Larimichthys crocea and Pseudosciaena polyactis, as we found in Japanese flounder (Fig. 7.38, Wang et al. 2017). More distribution of ctenoid scales in the rear of body suggests that the oscillation of rear part of body might be able to induce the cycloid scale development into the ctenoid scale, which can help fish to generator water vortex to improve swimming efficiency. Kang and Kim (2012a) showed that adding a burrowing substratum in artificial rearing tanks could cause a high level of prepro-melanin concentrating hormone (MCH) or low prepro-proopiomelanocortin (POMC) in the brain and pituitary contributed to restraining hypermelanosis expansion on the blind side of olive

198

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.38 Transitional scales between cycloid and ctenoid scales in two species of croakers (Wang et al. 2017) Fig. 7.39 Expression levels of the RALDHs gene in different skin areas (Peng et al. 2020). BbB, melanized skin on the blind side; BbC, normal skin on the blind side. “*”, P < 0.05

flounder. In fish, MCH can depress alpha-MSH, stimulate somatolactin release, and depress ACTH release (Kawauchi 2006). However, they had not measured the expression level of MCH and POMC in skin, which determine the local pigmentation status. We found RALDH1 and RALDH3 were significantly higher expressions in the staining area than that in the normal bind side area (Fig. 7.39, Peng et al. 2020). Retinoic acid can induce POMC gene expression in fish skin. Therefore, it is possible that water flow may induce the synthesis of retinoic acid in the local area of blind side. In summary, hyperpigmentation or staining happen with high frequency in artificial flatfish culture under a running water system. Even though we need more researches in the future, the hyperactivity of flatfish in this raise system resulting from various appropriate environmental factors may be common to cause more water flow through the blind side, which may stimulate staining to happen. Fast water flow in a running water system will stimulate flatfish to swim in the water column, or move on the tank bottom more often. Other appropriate environmental factors stimulating flatfish hyperactivity should be improved, such as high density

7.6

Environmental Factors Causing Staining-Type Hypermelanosis in. . .

199

Fig. 7.40 Hypothesis on staining in the blind side (Zhang et al. 2022)

will make flatfish uncomfortable in raise system (Fig. 7.40). On another hand, juveniles with genetic defects, such as juvenile with incomplete eye migration, are not willing to stay on the tank bottom, just like we observed in the artificial population of Senegal sole with a high frequency of hyperpigmentation (Xing et al. 2020). Rearing in the sand bottom or burrow bottom can help flatfish avoid fast water flow through blind side of the body. Find more practice measures to prevent flatfish hyperactivity is imperative. To replace running water with high-level dissolve oxygen water is a kind of considerable way. On other hand, it is possible for us to select a breed of the flatfish strain with less hyperpigmentation for flatfish industry.

200

7.7

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

Knowledge of genetic effects will be important for understanding the mechanism of phenotypic determination of body coloration. In Japanese flounder, 12 genes containing 21 SNP loci, which were associated with pigment synthesis, such as alcohol dehydrogenase and retinoid X receptor-beta, have been identified in normal and hypermelanotic skin using RNA-seq (Paterson et al. 2013). Sawayama and Takagi (2010) characterized the body color variants in the Japanese flounder, Paralichthys olivaceus. The microsatellite DNA marker-based relationships using sibship reconstruction approaches indicated that two half-sibs predominantly generated most yellowish individuals. Sibship reconstruction suggested that the yellowish individuals identified in a hatchery population of Japanese flounder may have arisen via genetic effects. Assessing the parentage of abnormal fish used in seed production, and the removal of parents generating abnormal fish would represent a new strategy for retrospective selective breeding. Liu et al. (2018) identified and mapped 10 albinism-related genes through a linkage map related to albinism of Chinese tongue sole, Cynoglossus semilaevis with simple sequence repeat (SSR), and tyr2 gene is one of them. Our research uncovered the roles of retinoic acid signaling and phototransduction pathways in the formation of left-right asymmetrical pigmentation in Japanese flounder (Shao et al. 2017a, b). Abnormal body color could be induced by rising levels of vitamin A, a precursor of retinoic acid, in the feed (Guillot et al. 2012; Jeong et al. 2010; Suzuki et al. 2009). This is likely caused by the differential distribution of retinoic acid levels on both skins (Hubbs and Hubbs 1945; Houde 1971). 9cRA and ATRA require binding to their nuclear receptors to perform their functions. There are three types of nuclear receptors for 9cRA, including RXR alpha, RXR beta, and RXR gamma. There are three types of nuclear receptors for ATRA, including RAR alpha, RAR beta, and RAR gamma. RXR can form homodimers or heterodimers with other receptors such as RAR, thyroid hormone receptor, vitamin D3 receptor, or peroxisome proliferator-activated receptor (PPAR) (Kang and Kim 2012a), and regulate the transcription of target genes by binding to retinoic acid responsive elements in their promoter regions, thereby regulating various biological phenomena (Itoh et al. 2012; Mizusawa et al. 2011). On one hand, inappropriate amount of ligands of thyroid hormone receptors, vitamin D3 receptor, or PPARγ can indirectly regulate retinoic acid function during the formation of adult-type melanophores. Exogenous thyroid hormone treatment can produce flounders with not only abnormal eye position (Seikai 1980) but also abnormal body color (Seikai et al. 1987). Besides, a high level of vitamin D3 in the diet might induce hypermelanosis on the blind side (Tarui et al. 2010). In another hand, the gene mutation involved in these signal pathways, such as in the “Retinol metabolism” pathway, “Thyroid hormone synthesis” pathway, “PPAR signaling pathway,” “Arachidonic acid metabolism” pathway, “Phototransduction” pathway, “Melanogenesis” pathway might be associated with the regulation of body color.

7.7

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

201

SNPs are the potential target sites for molecular breeding. Therefore, the screening of hypermelanosis-associated SNPs is important for parental screening and the elimination of abnormal body color in flatfish.

7.7.1

Genetic Screening for Malpigmentation in Artificial Breeding Population of Japanese Flounder

In order to identify the malpigmentation SNP loci in the artificial population of Japanese flounder, the skin transcriptome data were analyzed from different parts of normal and hypermelanotic Japanese flounders (Peng et al. 2020). Through RNA-sequencing, 16,815,695 clean reads for sample A (the ocular side of the normal fish), 17,974,191 for sample B (pigmented skin, blind side of the hypermelanotic fish), and 21,654,643 for sample C (non-pigmented skin, blind side of the hypermelanotic fish) were obtained, with total nucleotides more than 5 GB (NCBI: PRJNA587412). In total, 10,386 unigenes were mapped into 265 KEGG database pathways, including six pigment metabolism-related KEGG pathways, Arachidonic acid metabolism, Thyroid hormone synthesis, Phototransduction, Melanogenesis, Retinol metabolism, and PPAR signaling pathway. A total of 206 SNPs from 59 genes were identified within the six pigment metabolism-related KEGG pathways mentioned above. Finally, we performed the analysis using the 21 SNPs in the coding region. In order to validate the SNPs, 13 primer pairs were designed to genotype the genes from 14 normal and 16 hypermelanotic samples. There was a significantly different genotype distributions for two SNP loci, 3004 (named ATF-3004-G/A) and 3155 (named ATF-3155-C/T) loci, within the cyclic AMP-dependent transcription factor (ATF)-4-like gene (NCBI, GeneID: 109639271) between the normal and hypermelanotic flounders (Fig. 7.41) (Peng et al. 2020).

Fig. 7.41 The representative sequencing chromatographs of two SNP loci: ATF 4-3004-G/A locus (left) and ATF 4-3155-C/T locus (right) based on 14 normal and 16 hypermelanotic Japanese flounder (Peng et al. 2020)

202

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

For ATF-3004-G/A locus, 71.43% of the normal Japanese flounder showed the homozygous wild-type GG genotype, 21.43% showed the heterozygous GA genotype, and the remaining 7.14% were variant homozygous AA genotype. While the predominant genotypes of hypermelanotic Japanese flounder were GA (37.5%) and AA (37.5%). Moreover, the 3004G and 3004A allele frequencies were, respectively, 82.14% and 17.86% in normal fish and 43.75% and 56.25% in hypermelanotic fish. There was a statistically significant difference in the distribution of the genotype of the normal and hypermelanotic flounders (Fisher Exact Test, p = 0.03). Therefore, this SNP locus is associated with hypermelanosis of the flounder (Table 7.2) (Peng et al. 2020). When mentioned to ATF-3155-C/T locus, 100% of the normal Japanese flounder showed the homozygous wild-type CC genotype. While the predominant genotypes of hypermelanotic Japanese flounders were CT (62.5%), CC (31.25%), and TT (6.25%). Allele frequencies in this locus were also investigated: 100% (C) and 0% (T) in normal fish as well as 62.5% (C) and 37.5% (T) in hypermelanotic fish. A highly significant difference in the genotype distribution was found between the normal and hypermelanotic flounders (Fisher exact test, p = 0.0001 < 0.01), which suggests that the SNP locus is related to hypermelanosis of the flounder (Table 7.3) (Peng et al. 2020). SNP markers were further verified in 102 samples, half normal and half hypermelanotic flounders, including the 30 samples genotyped previously. Results showed that the normal flounder had 64.71% GG homozygous, 29.41% GA, and 5.88% AA at the ATF-3004-G/A locus. In hypermelanotic flounder, the predominant genotypes were 46% GA heterozygous, followed by 38% GG and 16% AA. The allele frequency for G and A were 79.41% and 20.59%, respectively, in normal fish, as well as 61% and 39% in hypermelanotic ones. There was still a significant difference in the genotype distribution between the normal and hypermelanotic flounders (Fisher’s Exact Test, P < 0.05), which is consistent with the previous results (Table 7.4). For the locus ATF-3155-C/T, CC homozygous was the predominant genotype in normal flounder, accounting for 92.16%. In hypermelanotic flounder, the predominant genotype was CT (52.94%). A significant difference in the genotype distribution was found between the normal and hypermelanotic flounders at this locus (P < 0.01; Table 7.5). The Linkage disequilibrium analysis showed that a strong linkage disequilibrium existed between ATF-3004-G/A and ATF-3155-C/T (d′ = 0.94, r2 = 0.594). The two SNP loci may be associated with the hypermelanosis on the blind side of Japanese flounder SHEsis online analysis software was used to conduct the linkage disequilibrium analysis of four haplotypes based on two SNPs. As shown in Table 7.6, frequencies of A-C haplotype and G-C haplotype were higher in normal group than those in hypermelanosis group ( p < 0.05). Whereas A-T haplotype frequency in hypermelanosis group was markedly higher than that in normal group ( p < 0.01). This revealed that A-T haplotype is closely related to the hypermelanosis in Japanese flounder. A-C and G-C haplotypes are referred to as the protective

Num 14 16

(GG) 10 4

(GA) 3 6 (AA) 1 6

Genotype frequency (%) GG GA AA 71.43 21.43 7.14 37.5 37.5 25 P 0.03 HWE-P 0.60 0.64

Num 14 16

(CC) 14 5

(CT) 0 10

(TT) 0 1

Genotypes frequency(%) CC CT TT 100 0 0 31.25 62.5 6.25 P 0.0001 HWE-P – 0.41

Num 52 50

(GG) 33 19

(GA) 15 23

(AA) 3 8

Genotypes frequency (%) GG GA AA 64.71 29.41 5.88 38 46 16

P 0.022

HWE-P 0.77 0.97

Sample Normal Hypermelanosis

Num 51 51

(CC) 47 23

(CT) 4 27

(TT) 0 1

Genotypes frequency (%) CC CT TT 92.16 7.84 0 45.10 52.94 1.96

P 0.0001

HWE-P 0.95 0.09

Table 7.5 Genotype distribution at the ATF-3155-C/T locus among 102 Japanese flounder individuals (Peng et al. 2020)

Sample Normal Hypermelanosis

P 0.0001

Allele frequency (%) C T 96.08 3.92 71.57 28.43

Allele frequency (%) G A 79.41 20.59 61 39

P 0.0001

P 0.008

Allele frequency(%) C T P 100 0 0.0001 62.5 37.5

Allele frequency (%) G A 82.14 17.86 43.75 56.25

Table 7.4 Genotype distribution related to ATF-3004-G/A locus among 102 Japanese flounder individuals (Peng et al. 2020)

sample Normal Hypermelanosis

Table 7.3 Genotype distribution related to ATF-3155-C/T locus among 30 Japanese flounder individuals (Peng et al. 2020)

Sample Normal Hypermelanosis

Table 7.2 Genotype distribution related to ATF-3004-G/A locus among 30 Japanese flounder individuals (Peng et al. 2020)

7.7 Genetic Screening for Malpigmentation in Artificial Breeding Flatfish 203

204

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Table 7.6 Four haplotype frequencies based on two SNPs of ATF4 gene between the normal and hypermelanosis group in Japanese flounder (Peng et al. 2020) Haplotype A-C A-T G-C G-T

H (%) 10.12(0.099) 28.88(0.283) 61.88(0.607) 1.12(0.011)

N (%) 21.38(0.206) 4.62(0.044) 75.62(0.727) 2.38(0.023)

X2 4.672 21.27 3.97 –

P 0.0306 4.05E-06 0.0463 –

OR (95%CI) 0.418 (0.187–0.937) 8.427 (3.013–23.571) 0.546 (0.300–0.993) –

haplotypes for normal body color, which kept the low risk of hypermelanosis in Japanese flounder. Activating transcription factor 4 (ATF4) is a member of the ATF/CREB transcription factor family and is involved in thyroid hormone synthesis and melanin synthesis. Thyroid hormones play a crucial role in the regulation of pigmentation patterns by participating in melanin synthesis and regulating the melanocytestimulating hormone (MSH), which is involved in melanin synthesis and pigment movement (McMenamin et al. 2014). ATF4 regulates melanin synthesis through alpha-MSH, which promotes melanin production in melanocytes. α-MSH binds to melanocortin receptor 1 (MC1R) and increases the cAMP level by stimulating adenylyl cyclase. cAMP phosphorylates the CREB transcription factor, which in turn promotes MITF activation, which consequently triggers the transcription of downstream melanogenic genes such as TYR and TYRP (Bang et al. 2017; Chen et al. 2018). It was determined that ATF4 was highly expressed in the blind-side skin of hypermelanotic flounder, regardless of whether or not the skin is pigmented. But both non-pigmented and pigmented skin on the blind side showed no significant differences in ARF4 expression (Fig. 7.42). In addition, we also screened three SNP loci belonging to 2 genes (Table 7.7). The two SNPs c.2440C>T (P.V605I) and c.2271-96T>C belong to itpr2 gene, located in exon 16 and the non-coding region, respectively. The SNP locus c.2406C>A (P. H798N) is located in the exon 13 of ac6 gene. 88.89% of normal Japanese flounders were homozygous for the TT genotype of c.2440C>T (P.V605I). While the hypermelanotic and pseudoalbino genotypes were predominantly CC homozygous, accounting for up to 100% and 87.5%, respectively. The genotype distribution in normal flounders differed significantly from that in the hypermelanotic and pseudoalbino ones (P < 0.01). The genotypes of c.227196T>C SNP locus were consistent with the data in the c.2440C>T (P.V605I) locus, excluding a different genotype in one pseudoalbino individual. The results indicated that the two SNPs loci are highly linked. For c.2406C>A (P.H798N) locus, 68.75% of the normal Japanese flounder showed the homozygous wild-type AA genotype, and 31.25% showed the heterozygous AC genotype. The dominant genotype of hypermelanotic individuals was CC (62.5%), and the remaining was AC (37.5%). Whereas the dominant genotype of pseudoalbino samples was AC heterozygote (64.29%), followed by mutant CC (21.42%) and wild homozygous AA (14.29%), respectively. This SNP locus also has highly significant differences in genotype distribution between the normal flounder and the melanized flounder

7.7

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

205

Fig. 7.42 Expression of ATF4 in the skin of normal and hypermelanotic Japanese flounder (Peng et al. 2020). (HOp pigmented area on ocular side of hypermelanosis flounder, HBp pigmented area on blind side of hypermelanosis flounder, HBnp non-pigmented area on blind side of hypermelanosis flounder, NOp pigmented area on ocular side of normal flounder, NBnp non-pigmented area on blind side of normal flounder. Sampling areas of normal and hypermelanosis fish are shown using red squares in the blind side (a) and ocular side (b) of normal flounder, and in the blind side (c) and ocular side (d) of hypermelanosis flounder

(P < 0.01) (Table 7.7 and Fig. 7.43), which suggested that the SNP locus was related to pseudoabino and hypermelanosis in flounder (Zhang et al. 2021). Analyses were conducted in more Japanese flounder (43 normal, 43 hypermelanotic, and 44 pseudoalbino samples). For the c.2440C>A (P.V605I) locus, normal fish had 67.65% TT genotype, followed by TC (14.71%) and CC (17.63%). CC mutant genotype accounted for 80.65% of hypermelanotic flounder, and was the predominant genotype. For the c.2271-96T>C locus, the predominant genotypes were 67.65% TT wild-type homozygous in normal samples, 80.65% CC mutant homozygous in hypermelanotic samples, 43.59% TC and 48.71% CC genotypes pseudoalbino samples. For the c.2406C>A (P.H798N) locus, 81.40% of normal flounders showed homozygous AA genotype, and the remaining 18.6% were AC genotype. The majority of hypermelanotic and pseudoalbino samples were CC mutant genotypes, the ratio was 55.81% and 56.82%, respectively, followed by a similar proportion of AC and AA genotypes, respectively, in both groups. There was also a significant difference in genotype distribution in all three

ac6 c.2406C>A (P. H798N) 16

16

Hypermelanosis

8

Pseudoalbinism

Normal

8

Hypermelanosis

9

Pseudoalbinism

11

8

Hypermelanosis

Normal

Number 11

Group Normal

Genotype Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant

Number of Samples TT 8 TC 0 CC 3 TT 0 TC 0 CC 8 TT 0 TC 1 CC 7 TT 8 TC 0 CC 3 TT 0 TC 0 CC 8 TT 0 TC 0 CC 8 AA 11 AC 5 CC 0 AA 0 AC 6 CC 10 Frequency/% 88.89 0 11.11 0 0 100 0 12.5 87.5 88.89 0 11.11 0 0 100 0 0 100 68.75 31.25 0 0 37.5 62.5 21.09**

–

10.05**

10.05**

–

10.39**

10.05**

X2 test value X20.05 = 5.991X20.01 = 9.21 –

7

itpr2 c.2271-96T/C

SNP locus itpr2 c.2440C > T(P.V6051)

Table 7.7 Genotype distribution at 3 SNP loci among normal, hypermelanosis, and pseudoalbinism flounder (Zhang et al. 2021)

206 Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Pseudoalbinism

14

Homozygous Heterozygote Mutant

AA AC CC

2 9 3

14.29 64.29 21.42

10.29**

7.7 Genetic Screening for Malpigmentation in Artificial Breeding Flatfish 207

208

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.43 The representative sequencing chromatographs of 3 SNPs loci, C.2440C>A (P. V605I) (a), C.2271-96T>C (b) and C.2406C>A (P.H798N) (c) in the normal, pseudoalbino, and hypermelanotic Japanese flounder, respectively (Zhang et al. 2021)

SNP loci between normal and hypermelanotic flounder. The finding is consistent with the result got with fewer samples (Table 7.8) (Zhang et al. 2021). To further identify the function of ITPR2 and AC6, their expression levels were examined in different body parts among normal, hypermelanotic, and pseudoalbino flounders. In normal fish, there was no significant difference in ITPR2 expression between the ocular and blind skin, however, a lower AC6 expression level in the blind skin than that in the ocular skin. In hypermelanotic fish, the pigmented skin on blind side has more ITPR2 and AC6 expressions than the non-pigment skin on the blind side, as well as the pigmented skin on the ocular side (P < 0.01), suggesting the specific high expression of ITPR2 and AC6 in hyperpigmented blind skin. In pseudoalbino fish, there were relatively higher levels of expressions of ITPR2 and AC6 genes in pigmented skin of the ocular side than that in non-pigmented skin of both ocular and blind sides, indicating the positive correlation between the two genes and skin pigmentation in pseudoalbino fish (Fig. 7.44).

ac6-2677-C/A

itpr2-554-T/C

SNP locus itpr2-7032-C/T

43

43

Hypermelanosis

39

Pseudoalbinism

Normal

31

Hypermelanosis

39

Pseudoalbinism

34

31

Hypermelanosis

Normal

Number 34

Group Normal

Genotype Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant

Number of Samples TT 23 TC 5 CC 6 TT 0 TC 6 CC 25 TT 6 TC 20 CC 13 TT 23 TC 5 CC 6 TT 0 TC 6 CC 25 TT 3 TC 17 CC 19 AA 35 AC 8 CC 0 AA 3 AC 16 CC 24

Frequency/% 67.65 14.71 17.63 0 19.35 80.65 15.38 51.28 33.34 67.65 14.71 17.64 0 19.35 80.65 7.70 43.59 48.71 81.40 18.6 0 6.98 37.21 55.81

Table 7.8 Genotype distribution in three different SNPs loci among more samples of Japanese flounder (Zhang et al. 2021)

53.61**

–

28.48**

34.67**

–

21.30**

34.67**

(continued)

X2 test ValueX20.05 = 5.991 X20.01 = 9.21 –

7.7 Genetic Screening for Malpigmentation in Artificial Breeding Flatfish 209

SNP locus

Group Pseudoalbinism

Table 7.8 (continued)

Number 44

Genotype Homozygous Heterozygote Mutant

Number of Samples AA 2 AC 17 CC 25

Frequency/% 4.55 38.63 56.82

X2 test ValueX20.05 = 5.991 X20.01 = 9.21 57.67**

210 7 Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

7.7

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

211

Fig. 7.44 Differential expressions of ITPR2 and AC6 in the skin of normal and malpigmented Japanese flounder (Zhang et al. 2021). NB: the blind side of normal fish; NO: the ocular side of normal fish; HBB: the pigmented skin on the blind side of hypermelanotic fish; HBW: the non-pigmented skin on the blind side of hypermelanotic fish; HOB: the pigmented skin on the ocular side of hypermelanotic fish; PAOB: the pigmented skin on the ocular side of pseudoalbino fish; PAOW: the non-pigmented skin on the ocular side of pseudoalbino fish; PABW: the non-pigmented skin on the blind side of pseudoalbino fish; Significant difference at 0.05 level (*) or at 0.01 level(**)

The predicted three-dimensional structures of AC6 and ITPR2 protein were determined using the SWISS-MODEL server (http://www.expasy.org/swissmod/ SWISS-MODEL.html) (Fig. 7.45). We analyzed the experimental 3D structure of wildtype and mutant to understand the possible effect of mutations through the Swiss PDB viewer. The results showed no obvious change between wild-type and mutant proteins in both genes, indicating that the overall spatial folding and conformation of the mutants was the same as the wild-type proteins. For AC protein, the mutation site

212

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.45 Protein structure prediction using SWISS-MODEL for AC6 and ITPR2 genes. (a) AC6 protein structure before amino acid mutation. (a) AC6 protein structure after amino acid mutation, with histidine transformed into Asparagine; (b) ITPR2 protein model before amino acid mutation. (b) Mutation protein structure with amino acid changed from valine to isoleucine. The altered hydrogen bond is indicated with a red arrow (Zhang et al. 2021)

was located in the irregularly curled region, which made the 798th amino acid change from wild-type histidine (basic amino acid) to Asparagine (hydrophilic amino acid). No hydrogen bonds were found among the 798th, 799th, and 800th amino acids in the wild-type AC protein, while a new hydrogen bond was formed between mutated 798th amino acid and the 799th and 800th amino acids in the variant AC protein, which resulted in the transformation of the secondary structure from irregular curl to the α-helix (Fig. 7.45a). For ITPR2 protein, the 726th amino acid mutated from valine (hydrophobic amino acid) to isoleucine (hydrophobic amino acid), leading to a hydrogen bond broken between the 726th valine and 730th arginine (Fig. 7.45b) (Zhang et al. 2021). AC6 has been shown to play important role in melanin synthesis (Chen et al. 2018; Bang et al. 2017). It can be activated by the heterodimer formed by alphaMSH binding to melanocortin 1 receptor (Mc1R), and then stimulates the cyclic adenosine monophosphate (cAMP) levels in cells (Burton et al. 2000). Increased cAMP levels activate protein Kinase A (PKA), which in turn phosphorylates cAMP response element-binding protein (CREB), which is translocated into the nucleus activating CREB-dependent transcription of microphthalmia transcription factor (MITF). MITF) is an important regulator of melanocyte survival and development, and MITF controls their transcription by binding to tyrosinase (TYR) and TYR-related proteins 1 (TYRP1) and 2 (TYRP2) promoter regions, which are

7.7

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

213

predominantly involved in melanin synthesis, which is further promoted by alphaMSHs in melanocytes (Itoh et al. 2012; Oshima et al. 2001). In this study, the expression patterns of ITPR2 and AC6 in different pigmentation skins are consistent in both hypermelanotic and pseudoalbino fish, suggesting they have a synergetic regulating function in Japanese flounder body color formation. In pseudoalbino fish, AC6 and ITPR6 expressions were positively related to skin pigmentation levels, but there was no such trend in hypermelanotic fish. AC6 and ITPR6 were highly expressed in blind-pigmented skin in hypermelanotic fish, suggesting the particularity of the mechanism of hypermelanotic skin on the blind side. SNPs in ITPR2 and AC6 may be related to the abnormal body color in Japanese flounder. The mutation of the 726th amino acid in ITPR2 protein caused by c.2440C>A (P. V605I) locus broke the hydrogen bond between the 726th valine and the 730th arginine. The architectural changes would affect the normal biological function of the protein. ITPR2 is responsible for thyroid hormone synthesis by affecting thyroid hormone secretion, and regulating melanin synthesis and distribution, and, in turn, resulting in body color abnormality in Japanese flounder. The single missense mutation at 798th amino acid of AC6 protein changed from a basic histidine into a hydrophilic asparagine, resulting in the formation of new hydrogen bonds among 798th, 799th, and 800th amino acids. Moreover, the 3D structure was changed in the mutant protein compared with the wild-type protein, with a change from an irregular curl to an α helix at 784–789 position. Changing the structure of individual proteins could potentially affect their activity, stability, localization, and/or binding partners. AC6 directly participates in the regulation of melanin synthesis. The mutation of AC6 could impair the biological function of AC6 protein, resulting in abnormal melanin synthesis, which would affect the body color of flounder. Unfortunately, no study about the effects of ITPR2 and AC6 mutations on flounder body color is presently available, which should be investigated further. Above all, two SNPs, ATF4-3004-G/A and ATF4-3155-C/T were first identified to be associated with hypermelanosis in Japanese flounder, and three SNPs located on two body color-related metabolic pathway genes were also identified in both hypermelanosis and pseudoalbinism Japanese flounder. These five SNPs may be used for screening and eliminating abnormal parents for Japanese flounder reproduction and breeding.

7.7.2

Genetic Screening for Malpigmentation in Artificial Breeding Population of Chinese Tongue Sole

Chinese tongue sole or half-smooth tongue sole (Cynoglossus semilaevis) is another important artificially cultured fish species in China. However, in aquaculture production, the abnormal body color phenomenon has seriously affected the market price of commercial fish, and the abnormal body color has become a restricting factor for the development of the tongue sole industry. Li et al. (2021) found the existence of genetic variation of blind-side hypermelanosis in tongue sole with three different models, respectively, this indicates a potential for future selective breeding

214

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

of tongue sole. We also adopted a similar stratagem to identify malpigmentationassociated SNPs in C. semilaevis as we had done in Japanese flounder (Sun 2021). The pigmented skin tissues (labelled A1, A2, and A3) and non-pigmented skin (labelled B1, B2, and B3) from three hypermelanotic tongue soles were used for de novo transcriptome sequencing. The number of SNPs in A1–A3 and B1–B3 six samples ranged from 103,839 to 166,377; the total number of SNPs was 837,540. The number of heterozygous mutations was higher than that of homozygous mutations in all six samples. According to the screening criteria mentioned in Sect. 2.3, 813 differential SNPs were identified in six Kyoto Encyclopedia of Genes and Genome (KEGG) pathways associated with body color. We only considered the missense SNP loci that occurred in the coding region; thus, 79 differential SNPs remained. Consequently, the genotyping distribution of three SNP loci showed significant differences between the normal and pseudoalbino tongue sole. The three SNPs located in ertB, tyr, and alox5 genes were named ertB-160-C/T, tyr-473-G/A, and alox5–1178-C/T, respectively. The dominant genotype of ertB160-C/T in normal C. semilaevis was homozygous CC (50%), with the other genotypes being heterozygous CT (31.25%) and mutant TT (18.75%). The dominant genotype of ertB-160-C/T in hyperpigmented and pseudoalbino individuals was the homozygous TT genotype, accounting for 31.25% and 13.33%, respectively, and the heterozygous CT genotype accounted for 37.5% and 73.33%, respectively. Chi-square test indicated a significant difference in genotype distribution between normal and pseudoalbino Chinese tongue soles (P < 0.05). The dominant genotype of tyr-473-G/A in normal tongue soles was GG homozygous GG (81.25%), whereas heterozygous GA and mutant AA genotypes accounted for 12.5% and 6.25%, respectively. The dominant genotypes of tyr-473-G/A in hyperpigmented and pseudoalbino individuals were homozygous GG (87.5% and 33.33%, respectively), for heterozygous GA (12.5% and 60%, respectively), and mutant AA (0% and 6.67%, respectively; Table 7.9). Pearson’s Chi-square test showed a significant difference in genotype distribution between normal and pseudoalbino tongue soles (P < 0.05). The dominant genotype of alox5-1178-C/T in normal tongue soles was homozygous CC (21.43%), together with the heterozygous CT (50%), and mutant TT (28.57%) genotypes; in hyperpigmented and pseudoalbino individuals, the dominant genotype was homozygous TT (50% and 68.75%, respectively), with the heterozygous CT genotype accounting for 37.5% and 31.25%, respectively (P < 0.05; Fig. 7.46). A total of 181 Chinese tongue sole samples (from 65 normal, 64 hyperpigmented, and 52 pseudoalbino individuals) were obtained to further verify the three SNPs (Table 7.10). At the ertB-160-C/T locus, 58.33% of normal fish had the CC genotype, whereas 33.33% and 8.33% had the CT and TT genotypes, respectively. The percentage of heterozygous CT and mutant CC genotypes was equal (40.74%) in hyperpigmented fish. The dominant genotypes in pseudoalbino fish were CT and TT, accounting for 62.75% and 11.76%, respectively. At the tyr-473-G/A locus, the dominant genotype in normal fish was homozygous GG, accounting for 74.51% of individuals; in hyperpigmented fish, GG and GA accounted for 72.55% and 21.57%,

alox5-1178-C/T

tyr-473-G/A

SNP locus ertB-160-C/T

14

16

16

Hypermelanosis

Pseudoalbinism

15

Pseudoalbinism

Normal

16

Hypermelanosis

15

Pseudoalbinism

16

16

Hypermelanosis

Normal

Number 16

Group Normal

Genotype Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant

Number of samples CC 8 CT 5 TT 3 CC 5 CT 6 TT 5 CC 2 CT 11 TT 2 GG 13 GA 2 AA 1 GG 14 GA 2 AA 5 GG 9 GA 1 AA 8 CC 3 CT 7 TT 4 CC 2 CT 6 TT 8 CC 0 CT 5 TT 11

Frequency/% 50 31.25 18.75 31.25 37.5 31.25 13.33 73.33 13.33 81.25 12.5 6.25 87.5 12.5 0 33.33 60 6.67 21.43 50 28.57 12.5 37.5 50 0 31.25 68.75

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

6.5*

1.48

–

7.986*

1.037

–

6.02*

1.28

X2 test ValueX20.05 = 5.991X20.01 = 9.21 –

Table 7.9 Statistical analyses of genotype distribution at 3 SNP loci among first batch samples of Cynoglossus semilaevis (Sun 2021)

7.7 215

216

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.46 Genotype sequencing results for the SNP loci itpr2-7032-C/T, itpr2-554-T/C, and ac6-2677-C/A in 16 normal,16 pseudoalbino, and 16 hyperpigmented Cynoglossus semilaevis, respectively (Sun 2021)

respectively. In pseudoalbino individuals, the GG and GA genotypes accounted for 43.14% and 47.06%, respectively. At the alox5-1178-C/T locus, the CT and TT genotypes accounted for 56.92% and 33.85%, respectively, in the normal individuals and 43.75% and 39.06%, respectively, in hyperpigmented fish. The dominant genotypes TT and CT in pseudoalbino individuals accounted for 48.08% and 51.92%, respectively. Chi-square test showed a significant difference in the

alox5-1178-C/T

tyr-473-G/A

SNP locus ertB-160-C/T

65

64

Hypermelanosis

51

Pseudoalbinism

Normal

51

Hypermelanosis

51

Pseudoalbinism

51

54

Hypermelanosis

Normal

Number 60

Group Normal

Genotype Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant Homozygous Heterozygote Mutant

Number of samples CC 35 CT 20 TT 5 CC 22 CT 22 TT 10 CC 13 CT 32 TT 6 GG 38 GA 8 AA 5 GG 37 GA 11 AA 3 GG 22 GA 24 AA 5 CC 6 CT 37 TT 22 CC 11 CT 28 TT 25

Frequency/% 58.33 33.33 8.33 40.74 40.74 18.52 25.49 62.75 11.76 74.51 15.69 9.80 72.55 21.57 5.88 43.14 47.06 9.80 9.23 56.92 33.85 17.19 43.75 39.06 2.9

–

12.27**

0.99

–

12.29**

4.42

(continued)

X2 test ValueX20.05 = 5.991 X20.01 = 9.21 –

Table 7.10 Genotype distribution among second batch (additional) samples of Cynoglossus semilaevis at three single nucleotide polymorphism loci (Sun 2021)

7.7 Genetic Screening for Malpigmentation in Artificial Breeding Flatfish 217

SNP locus

Group Pseudoalbinism

Table 7.10 (continued)

Number 52

Genotype Homozygous Heterozygote Mutant

Number of samples CC 0 CT 27 TT 25

Frequency/% 0 51.92 48.08

X2 test ValueX20.05 = 5.991 X20.01 = 9.21 6.39*

218 7 Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

7.7

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

219

genotype distribution of the three SNP loci between normal and pseudoalbino tongue soles, which is consistent with the results of a smaller number of samples. However, there were no significant differences in the genotype distribution between normal and hyperpigmented tongue soles. Three pairs of primers were designed to perform qRT-PCR to investigate the expression levels of ertB, tyr, and alox5 genes in differently colored body parts in two fish types (normal and pseudoalbino). There was no significant difference in the mRNA expression of ertB in different body parts of normal Chinese tongue sole; in pseudoalbino tongue sole, ertB mRNA expression in the blind-side tissue was significantly higher than that in the ocular-side tissue. However, there was no significant difference in differently pigmented areas on the ocular side in pseudoalbino fish. The mRNA expression patterns of tyr were consistent between normal fish and pseudoalbino tongue sole, showing a positive correlation with melanin distribution; tyr expression levels in the pigmented parts were significantly higher than those in non-pigmented parts on the ocular side and blind side in both normal and pseudoalbino individuals. In addition, the mRNA expression pattern of alox5 in normal fish and pseudoalbino fish was similar; in both types of fish, the expression level of alox5 on the blind side was significantly higher than that on the ocular side. Notably, in pseudoalbino fish, the expression level of alox5 in the albino area on the ocular side was considerably higher than that in the white skin on the blind side (Fig. 7.47). It seems that alox5 expression level is negatively correlated with melanin levels. The 3D structures of wild-type Ert-B, Tyr, and Alox5 proteins of Chinese tongue sole and those containing SNPs were predicted by SWISS-MODEL online tools. The total coding (CDS) region of ert-B gene was 1239 bp, encoding 412 amino acids; at the 160th amino acid position, proline (Pro) was mutated to serine (Ser). The CDS of tyr gene was 1584 bp, encoding 527 amino acids; at the 473rd amino acid position glycine (Gly) was mutated to glutamic acid (Glu). The full-length cDNA of alox5 gene was 1324 bp, encoding 440 amino acids; at the 1178th amino acid position, alanine (Ala) was mutated to valine (Val). The tertiary structures of the Ert-B, Tyr, and Alox5 proteins were predicted using SWISS-MODEL. Figure 7.48a shows the tertiary structure of the Ert-B protein when the 160th amino acid is pro and ser, respectively; the overall folding level of the tertiary structures is similar, but there is a slight difference—the tail fold (indicated by the red arrow) does not connect with the protein macromolecule (Fig. 7.48a), whereas the tail part in connects with the protein macromolecule (Fig. 7.48a). Figure 7.48c shows the tertiary structure of the Tyr protein when the 473rd amino acid is Gly and Glu, respectively; the overall folding level of the protein tertiary structures is similar, but there are slight differences—the two protein folds (indicated by the red arrows) in Fig. 7.48b are more complex, whereas the two protein folds in Fig. 7.48b are relatively simple. Figure 7.48c shows the tertiary structures of the Alox5 protein when the 1178th amino acid is Ala and Val, respectively; the folding levels of the protein tertiary structures are similar, but there are certain differences—the protein folding levels (indicated by the red arrows) are relatively simple in Fig. 7.48c and

220

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

Fig. 7.47 Expression levels of ertB, tyr, and alox5 genes in differently colored body parts in normal and pseudoalbino Cynoglossus semilaevis (Sun 2021). Significant difference at 0.05 level (*) or at 0.01 level (**). O normal skin of ocular side, OP non-pigmental skin of ocular side, B normal skin of blind side (Sun 2021)

Fig. 7.48 Tertiary structure prediction for Chinese tongue sole endothelin receptor type B-like (ert-B), tyrosinase (tyr), and arachidonate 5-lipoxygenase (alox5) genes in the normal and single nucleotide polymorphism mutations using SWISS-MODEL. (a) Ert-B protein structure before amino acid substitution. (a) Ert-B protein structure after amino acid substitution, with proline changed to serine; (b) Tyr protein structure before amino acid substitution (b) Tyr protein structure with amino acid changed from glycine to glutamic acid. The altered hydrogen bond is indicated with a red arrow. (c) Alox5 protein structure before amino acid substitution (c) Alox5 protein structure with amino acid changed from Ala and Val amino acid. The altered hydrogen bond is indicated with a red arrow (Sun 2021)

7.7

Genetic Screening for Malpigmentation in Artificial Breeding Flatfish

221

relatively complex in Fig. 7.48c. The amino acid substitution mutation in the three genes resulted in changes in the tertiary structures of respective proteins. Three genes (ert-b, tyr, alox5) containing three SNPs and involved in two body color-related metabolic pathways were found to be responsible for pseudoalbinism. Endothelin-1 (Edn1) is one of the targets of uneven melanin deposition in skin cells. Endothelin type B receptor (Ednrb) is the receptor of Edn1, and their binding causes the hydrolysis of inositol polyphosphate to form inositol triphosphate (Ip3). Ip3 can activate intracellular Ca2+, whereas diacylglycerol activates Pkc by activating phospholipase Cγ. Activated Pkc phosphorylates threonine protein kinase (Raf-1), and Raf-1 transmits signals to mitogen-activated protein kinase (Mapk), which sequentially activates and phosphorylates mitogen-activated (Mek), extracellular signal-regulated kinase (Erk), and ribosomal S6 kinase (Rsk). Finally, the phosphorylated Rsk carries the signal to cAMP response element-binding protein (Creb). Phosphorylated Creb binds to the mitf gene promoter such that mitf is transcribed and translated and finally acts on tyr gene, resulting in melanin production. Simultaneously, activated Pkc also increases cAMP levels through a-Msh and melanocortin receptor 1 (Mc1r) (Li et al. 2020). cAMP activates Pka through signal transduction, and activated Pka causes Creb phosphorylation. Phosphorylated Creb acts on the mitf gene, leading to melanin production. The second gene we screened in this study, tyr is located further downstream of the melanin-related signaling pathways. The tyr gene is a member of the tyrosinase-related gene family and plays a role in melanin synthesis. The expression level and activity of Tyr directly affect the expression of eumelanin and melatonin, which then affect body coloration in animals. In mammals, tyr gene mutations— especially the missense SNPs—are associated with skin albinism, with higher expression of tyr in dark-skinned individuals than in light-skinned individuals. In zebrafish, Danio rerio, editing the CDS region of the tyr gene had a significant effect on the phenotype, whereas editing the non-poly-A tail signal region in the 3′-UTR had no significant effect on the phenotype. Liu et al. (2017) identified and mapped 10 albinismrelated genes with simple sequence repeats (SSRs) through a linkage map related to albinism in Chinese tongue sole, and tyr2 gene is one of these genes. The results of our study are consistent with the findings of these previous studies. We found that the tyr gene associated with abnormal body coloration was differentially expressed in dark skin and albino skin, and the expression level was positively correlated with pigmentation. Moreover, the SNP was also located in the CDS region of tyr gene, which is consistent with the results of tyr gene editing study in zebrafish. Alox5 (arachidonate 5-lipoxygenase), also known as 5-LO, 5-LOX, 5LPG, and LOG5, is a member of the arachidonate lipoxygenase family. 5-LO encoded by alox5 is an initial catalytic enzyme for the formation of inflammatory mediators, leukotrienes (Lts), and lipoxins (Lxs). Eicosane compounds such as leukotrienes, prostaglandins, and thromboxanes regulate a series of important physiological metabolic pathways. Estévez et al. (2001) reported that feeding Japanese flounder with arachidonic acid (ARA)-fortified diet may lead to the emergence of albino juveniles owing to the differential production and release rates of MSH and ACTH. In the early stage of metamorphosis, feeding ARA-fortified diet resulted in a high proportion of abnormal body color (approximately 80% individuals), and 37–45% of

222

7

Molecular Basis of Left/Right Asymmetrical Pigmentation during Metamorphosis

the total juveniles were found to be albino. Koven et al. (2001) found that gilthead seabream fed with ARA before an environmental change was able to resist the adverse effects of environmental change more effectively than fish fed with ARA after the environmental change. This may be because juvenile gilthead fish use ARA to synthesize cell membrane phospholipids, and the environmental change activates phospholipases, which initiate a series of biochemical reactions to produce ARA with high biological activity, which regulates the adaptation of the fish to the new environment. Other studies have shown that ARA improves the stress tolerance of fish to acute stimulation but does not affect stress resistance to chronic stimulation. An Eicosapentaenoic acid (EPA)-to-Arachidonic acid (ARA) ratio 3.84). The total chi-square value of 31.567, with 20 degrees of freedom, is not significantly different from the chance variation at 5% level (31.410), suggesting the genetic model is probably compatible with the observed data (McManus 1984). McManus (1984) thought an intracellular “signpost,” which points to a particular form of asymmetry, exists. Allele A that produces asymmetric phenotype P and allele B that produces the mirror image ~P are supposed to be able to read the “signpost.” Policansky (1982b) questioned the existence of the signpost. If it is a cytoplasmic asymmetry and it can itself become genetically reversed, how does that locus work? We agree with Policansky’s question Policansky (1982b) that the “signpost” proposed by McManus added a layer of complexity, as the signpost cannot differentiate between left and right. The signpost would not be in the cytoplasm; it may be a secretory protein involved in the evagination, and it may determine the left-right location along the neural tube by diffusion. In non-flatfishes, the secretory protein can determine the optic vesicle with left-right symmetric evagination of optic vesicle, for example, by diffusing along the neural tube. In flatfish, the gene that encodes the secretory protein with missense mutation causes changes in the amino acids and a few changes to the property of the protein and further causes the protein to diffuse with deviation to the right or left (Fig. 10.9). How can the left and right sides be unequal from birth? A molecular gradient can provide a natural resolution. Corballis (1984) thought that two parallel with situs inversus, in which the organs may develop with reversed asymmetry. A simple gradient which, if reversed, results in a reversal of complex structural and functional asymmetries. Our model for explaining situs inversus of the eyes, just like Corballis (1984), is provided in Fig. 10.9. Protein P0, which is secreted by the neural tube, can induce the formation of the initial eye field. In non-flatfishes, P0 diffuses equally to the left and right sides, and, finally, the eyes show left-right symmetry. In dextral flatfishes, the protein P1, homologue of P0, diffuses more to the left side than to the right side, which finally results in dextral eyes. In contrast, another protein, P2, in sinistral flatfishes diffuses more to the right side than to the left side.

Japanese fish

DC

DD

SS

60La

82L

91R

97L

48.2% 50% 0.071 – 100%

– 62.5%

Males 61La SS – 87.5%

86.9% 87.5% 1.508

– 37.5%

62La SC 83.1% 75% 2.219 – 50% 57.1% 37.5% 1.105 23.9% 25% 0.143 – 70%

85L DS/CC – 62.5% 38.8% 37.5% 0.014 32.3% 25% 3.4973 75.3% 75% 0.011

87R DS/CC – 62.5% 57.1% 50% 1.290 36.8% 37.5% 0.073 – 87.5%

89R SC – 75% 41.8% 37.5% 2.157 17.5% 25% 2.594 – 75%

95R DS/CC – 62.5%

50.8% 50% 0.032 – 100%

– 62.5%

96L SS – 87.5%

98L SC 78.5% 75% 4.771 51.0% 50% 0.0769 41.5% 37.5% 1.26 83.3% 87.5% 3.422

10

a

Females

Genotype SC

59La SS 86.8% 87.5% 0.038 72.0% 62.5% 6.782 48.4% 50% 0.5 – 100%

Table 10.3 Statistics about observed and expected proportions of left offspring (McManus 1984)

286 Evolutionary Origin of Left-Right Eye Asymmetry

10.6

Inheritance of Asymmetry in Flatfish

287

Fig. 10.9 Our model to explain situs inversus of the eyes. NT neural tube, OV optic vesicle, OC optic cup

To explain the flatfish cross data of Policansky (1982b); McManus (1984) introduced a third allele C in the same locus as alleles A and B; this triallelic genetic model seems to be compatible with the observed data (Table 10.3). McManus (1984) supposed the third allele C may be unable to read the signpost, chance factors alone will determine whether the individuals will be P or ~P, and, overall, the population of offspring will be of a racemic mixture. The introduction of the third allele makes the genetic model more difficult to explain with respect to the development process. Here, we have proposed a new hypothesis. We supposed that the left-right symmetry of the eyes is determined by one locus, named P. In the flatfish ancestor, 100% of the fishes had left-right symmetry of the eyes, which is determined by the allele P0 (Fig. 10.10). In the ancestral species Heteronectes and Amphistium and the most primitive living Psettodes, dextral and sinistral morphs within each species occurred at an approximately equal frequency (Hubbs and Hubbs 1944; Das and Mishra 1989; Hussain 1990; Friedman 2008), and locus P must mutate from P0 into P1 or P2 to break the left-right symmetry of the eyes; here, we have proposed that P1 is responsible for sinistral and P2 for dextral. One allele of locus P1 or P2 must have undergone DNA methylation, because only if one of them is under the silence of transcription, the approximately equal frequency of eye dextral or sinistral in the same species is possible (Fig. 10.10). Therefore, on the basis of our postulation, locus P seems to have a monoallelic expression: specific or random monoallelic expression. This is a type of transgenerational epigenetic inheritance, which is the epigenetic effect on the phenotype that can be passed down to subsequent generations and cannot be explained by changes in the primary DNA sequence and Mendelian genetics (Daxinger and Whitelaw 2012). Genomic imprinting, a type of specific monoallelic expression in diploid eukaryotic organisms, is determined by marks placed during gametogenesis, depending on whether it has been inherited from the mother or father (Martin and McGowan 1995). In mammals and flowering plants, genomic imprinting is often associated with methylation marks passed from the parents to the offspring. Genomic imprinting has also been reported in fishes (McGowan and Martin 1997). A study reported the inheritance of a transgene locus in zebrafish and demonstrated that its methylation was affected by the sex of the parent that contributed to the allele (Martin and McGowan 1995). The identification of a parent-of-origin-specific effect on the methylation of a transgene in fish is extremely similar to the process of genomic imprinting in mammals, which suggests that genomic imprinting exists in zebrafish.

288

10

Evolutionary Origin of Left-Right Eye Asymmetry

Fig. 10.10 Our hypothesis to explain the inheritance of eye left-right asymmetry on the basis of one locus and DNA methylation. In the ancestor of flatfishes, left-right eye symmetry is supposed to be determined by P0. The locus P must mutate from P0 into P1 or P2 in flatfishes to break the leftright symmetry of the eyes; here, we have proposed that P1 is responsible for sinistral and P2 for dextral. One allele of the locus P1 or P2 must have undergone DNA methylation, because only if one of them is under the silence of transcription, the approximately equal frequency of eye dextral or sinistral in the same species is possible

Genomic imprinting is not the only widespread form of monoallelic expression. In human genomes, 5–10% autosomal loci show “random monoallelic expression,” in which a randomly selected allele is inactive in different cells throughout the body (Chess 2013). For random monoallelic expressions of genes, such as X chromosome-inactivated genes or some autosomal genes, the initial random choice between alleles is followed by a stable mitotic transmission of monoallelic expression (Chess 2013). It is unclear how the transgenerational epigenetic inheritance of locus P occurs in the flatfish genome. Generally, most of the epigenetic marks are erased and reset by epigenetic reprogramming between generations (Daxinger and Whitelaw 2012; Feng et al. 2010). However, the erasure of epigenetic marks is not a universal rule in animals. The inheritance of parental DNA methylation in offspring embryos has been reported in zebrafish (Jiang et al. 2013; Potok et al. 2013). In the half-smooth tongue sole, new DNA methylation patterns may be established in bipotential germ

10.7

Genome-Wide Screening for the Locus of Eye Migration in Flatfish

289

cells when the juvenile fishes incubate at high temperatures. These new methylation patterns are then imprinted in the genome and not erased and reset during the development of new generations, so they appear in the offspring (Shao et al. 2014). Therefore, it is possible that locus P is methylated to determine eye migration in the flatfish genome, and it may be passed to the next generation. The DNA methylation of locus P in flatfish may be associated with environmental factors, as reported by Policansky (1982b).

10.7

Genome-Wide Screening for the Locus of Eye Migration in Flatfish

To understand the evolutionary origin of left-right asymmetry in flatfish, it is better to identify the locus that determines eye migration. Several available flatfish genomic resources provide a great chance to screen the locus. For example, genomes of the Chinese tongue sole, Japanese flounder, turbot, and Psettodes erumei have been sequenced (Chen et al. 2014; Figueras et al. 2016; Shao et al. 2017; Xu et al. 2020; Lü et al. 2021). The integrative resources of whole-genome sequencing projects, genetic maps, and transcriptomes will also provide information to study the karyotype evolution of flatfish and analyze specific transcriptome sequences associated with the evolutionary diversification of this group, which should be further validated using functional analyses (Robledo et al. 2017). To date, few studies on genome-wide screening for the locus that determines eye migration in flatfish have been conducted. Liu et al. (2017) reported candidate gene rps6kb2 as a novel metamorphosis-related gene, and it encodes ribosomal protein S6 kinase 2, a member of the family of AGC kinases. They first established a family of Chinese tongue soles. In this family, the male parent was selected from a group of fishes derived from a wild population, and the female parent was selected from a cultured population. Two hundred and thirty-one 1-year-old offspring with three different phenotypes were obtained: 178 specimens that were albino but showed normal eye migration, 23 specimens with both albino phenotype and abnormal eye migration (eyes on both sides of the head), and 32 normal specimens. In this family, 9.87% of individuals showed abnormal eye migration, and 86.27% of individuals exhibited albinism. Song et al. (2012) constructed a basic linkage map by spreading a total of 169 SSR markers on a high-density genetic linkage map. They first reconstructed a low-density SSR linkage map to anchor the metamorphosis-related loci to linkage group LG13 (corresponding to LG10 of a Chinese tongue sole highdensity microsatellite marker linkage map), and they then increased the marker density to obtain accurate locations. To identify metamorphosis-related candidate genes, 25 markers were located on LG10 with 88.88% chromosome coverage, and locus q-10 M (small genetic distance of 0.9 cM; 1.8 M physical area) was detected. When compared with the whole genome of the Chinese tongue sole (Chen et al. 2014), 80 genes were obtained, including rps6kb2. However, the expression pattern

290

10

Evolutionary Origin of Left-Right Eye Asymmetry

of rps6kb2 is not involved in eye migration because its expression has not been found in the tissues associated with eye migration during metamorphosis. Even with the whole-genome sequences of three flatfish species, it is still a big challenge to identify locus P in these flatfish genomes. On the basis of our postulation that locus P should be methylated in the flatfish genome, it may not be easy to locate P by using genome-wide association studies (GWAS). This is because there may be a low correlation between the SNP of locus P and the phenotype of eye-sidedness. When we try to establish a family from a pair of parents with different eye-sidedness, sinistral or dextral eye, in the same species, such as in the Chinese tongue sole, Japanese flounder, and turbot, a relatively high frequency of eye reversal would be observed in the offspring. We propose that whole-genome methylation should be first investigated; then, we suggest that deep sequencing of whole genomes should be conducted for these offspring with different eye-sidedness. We hope that the strategy of combining whole-genome methylation and family-based designs for GWAS will work well. Some specific flatfish species show a high frequency of eye reversal in their populations and, correspondingly, a relatively high gene frequency for the mutant allele of locus P in the population. For example, we can try to screen for the locus in a natural population of Psettodes erumei, with both eyes on the left or right side at an equal frequency, or the starry flounder, with a particularly high ratio of eye reversal in certain geographic regions in the wild and variation in the proportion of left-eyed (sinistral) morphs from 50% in California to 100% in Japan (Bergstrom 2007). It is a sin that so far there is no whole-genome sequence available. Another challenge is how to determine the role of the allele of locus P. Because eye-sidedness does not obey the role of Mendelian inheritance, more experiments need to be performed to determine the role of locus P in eye migration. Genome editing techniques have recently been widely used in model fishes such as zebrafish and medaka and several other freshwater fishes. However, the transgenic technologies for marine fishes need to be developed further because of the almost insurmountable problems presented by the general fragility of the embryos and high mortalities. In flatfish species, only Cui et al. (2017) developed a microinjection technique for flatfish embryos and successfully produced a gene knockout for dmrt1 by using transcription activator-like effector nuclease-mediated genome editing (Cui et al. 2017). Thus, it is not easy to use a genome editing tool to test the function of the allele of locus P. We may try to treat neuro-embryos of flatfish with an inhibitor of DNA methyltransferases, such as 5-aza-2′-deoxycytidine; if the methylation of the candidate allele decreases while the frequency of eye reversal increases, the allele can be determined to be associated with eye migration.

References

10.8

291

Summary

Since Charles Darwin published his famous book “The Origin of Species” in 1859, there has been much debate on the origin of asymmetry in flatfishes. The upper binocular vision would be very helpful for bottom dwellers, so we proposed a hypothesis for the adaptive evolution of flatfishes. The selective advantage of new flatfish species is determined by the completeness of eye migration, but the direction of eye migration does not affect the selective advantage. Is the evolution of eye migration in flatfishes convergent? We have found the caudal tendon-like muscle in Psettodes erumei and other classic flatfishes, and it is different from that in scombrids; the caudal tendon-like muscles present left-right asymmetry in flatfishes. There is much debate on whether pleuronectiforms exhibit monophyly or polyphyly. We think which eye migrates is determined by one gene, and we further proposed a hypothesis to explain the inheritance of left-right eye asymmetry on the basis of one locus and DNA methylation.

References Amaoka K (1969) Studies on the sinistral flounders found in the waters around Japan—taxonomy, anatomy, and phylogeny. J Shimonoseki Univ Fish 18(2):65–340 Bao B, Ke Z, Xing J, Peatman E, Liu Z, Xie C, Xu B, Gai J, Gong X, Yan G, Jiang Y, Tang W, Ren D (2011) Proliferating cells in suborbital tissue drive eye migration in flatfish. Dev Biol 351: 200–207 Berendzen PB, Dimmick WW (2002) Phylogenetic relationships of Pleuronectiformes based on molecular evidence. Copeia 2002:642–652 Bergstrom CA (2007) Morphological evidence of correlational selection and ecological segregation between dextral and sinistral forms in a polymorphic flatfish, Platichthys stellatus. J Evol Biol 20:1104–1114 Betancur-R R, Li C, Munroe TA, Ballesteros JA, Orti G (2013a) Addressing gene tree discordance and non-stationarity to resolve a multi-locus phylogeny of the flatfishes (Teleostei: Pleuronectiformes). Syst Biol 62(5):763–785 Betancur-R R, Broughton RE, Wiley EO, Carpenter K, Lopez JA, Li C, Holcroft NI, Arcila D, Sanciangco M, Cureton JC, Zhang F, Buser T, Campbell MA, Ballesteros JA, Roa-Varon A, Willis S, Borde WC, Rowley T, Reneau PC, Hough DJ, Lu G, Grande T, Arratia G, Orti G (2013b) The tree of life and a new classification of bony fishes. PLoS Curr 5:1–54 Betancur-R R, Ortí G (2014) Molecular evidence for the monophyly of flatfishes (carangimorpharia: Pleuronectiformes). Mol Phylogenet Evol 73:18–22 Bielen H, Houart C (2012) BMP signaling protects telencephalic fate by repressing eye identity and its Cxcr4-dependent morphogenesis. Dev Cell 23:812–822 Blot J (1969) Les poissons fossiles du Monte Bolca. Classe’s jusqu’ici dans les familles des Carangidae, Menidae, Ephippidae, Scatophagidae. Mem Mus Civ Stor Nat Verona 1:1–525 Brown KE, Keller PJ, Ramialison M, Rembold M, Stelzer EHK, Loosli F, Wittbrodt J (2010) Nlcam modulates midline convergence during anterior neural plate morphogenesis. Dev Biol 339:14–25 Bruno DW, Fraser CO (1988) A case of reversal in the common dab, Limanda limanda (L.). J Fish Biol 32:483–484

292

10

Evolutionary Origin of Left-Right Eye Asymmetry

Campbell M, Pakorn T, Chanet B, Chen WJ (2020) The distribution of the recessus orbitalis across flatfishes (order: Pleuronectiformes). J Fish Biol 97(1):293–297 Campbell MA, Chanet B, Chen JN, Lee MY, Chen WJ (2019) Origins and relationships of the Pleuronectoidei: molecular and morphological analysis of living and fossil taxa. Zool Scr 48: 640–656 Campbell MA, Chen WJ, López JA (2013) Are flatfishes (Pleuronectiformes) monophyletic? Mol Phylogenet Evol 69(3):664–673 Cao D, Chen S, Yan J, Liu C, Wang Z, Yan J (2016) Morphological variations analysis of reciprocal hybrids from Platichthys stellatus and Kareius bicoloratus. J Fish Sci China 23(4):871–881. (in Chinese) Daxinger L, Whitelaw E (2012) Understanding transgenerational epigenetic inheritance via the gametes in mammals. Nat Rev Genet 13:153–162 Cavodeassi F, Carreira-Barbosa F, Young RM, Concha ML, Allende ML, Houart C, Tada M, Wilson SW (2005) Early stages of zebrafish eye formation require the coordinated activity of Wnt11, Fz5, and the Wnt/beta-catenin pathway. Neuron 47:43–56 Chabanaud P (1937) Les téléostéens dyssymétriques du Mokkatam Inférieur de Tourah. Mémoires présentés à l'Institut d'Égypte 31:1–122 Chabanaud P (1949) Le problème de la phylogénèse des Heterosomata. Bull Inst Oceanogr 950:1– 24 Chapleau F (1993) Pleuronectiform relationships: a cladistic reassessment. Bull Mar Sci 52(1): 516–540 Chen S, Zhang G, Shao C, Huang Q, Liu G, Zhang P, Song W, An N, Chalopin D, Volff JN, Hong Y, Li Q, Sha Z, Zhou H, Xie M, Yu Q, Liu Y, Xiang H, Wang N, Wu K, Yang C, Zhou Q, Liao X, Yang L, Hu Q, Zhang J, Meng L, Jin L, Tian Y, Lian J, Yang J, Miao G, Liu S, Liang Z, Yan F, Li Y, Sun B, Zhang H, Zhang J, Zhu Y, Du M, Zhao Y, Schartl M, Tang Q, Wang J (2014) Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat Genet 46:253–260 Chen WJ, Bonillo C, Lecointre G (2003) Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa. Mol Phylogenet Evol 26(2):262–288 Chess A (2013) Random and Non-Random Monoallelic Expression. Neuropsychopharmacol 38: 55–61 Cooper JA, Chapleau F (1998) Monophyly and intrarelationships of the family Pleuronectidae (Pleuronectiformes), with a revised classification. Fish Bull 96(4):686–726 Corballis MC (1984) Human laterality: matters of pedigree. Behav Brain Sci 7:4 Cui Z, Liu Y, Wang W, Wang Q, Zhang N, Lin F, Wang N, Shao C, Dong Z, Li Y, Yang Y, Hu M, Li H, Gao F, Wei Z, Meng L, Liu Y, Wei M, Zhu Y, Guo H, Cheng CHK, Schartl M, Chen S (2017) Genome editing reveals dmrt1 as an essential male sex-determining gene in Chinese tongue sole (Cynoglossus semilaevis). Sci Rep 7:42213 Darwin CR (1859) On the origin of species by means of natural selection, or the preservation of favoured races in the struggle for life, 1st edn. John Murray, London Darwin CR (1872) On the origin of species by means of natural selection, 6th edn. John Murray, London Das M, Mishra B (1989) Observation on the occurrence of dimorphic forms of Psettodes erumei (Bloch & Schn.), an Indian halibut. Indian J Fish 36(4):337–338 Dawkins R (1986) The blind watchmaker: why the evidence of evolution reveals a universe without design. Norton, New York Dettai A, Lecointre G (2005) Further support for the clades obtained by multiple molecular phylogenies in the acanthomorph bush. C.R. Biol 328:674–689 Díaz de Astarloa JM (1997) A case of reversal in Paralichthys orbignyanus a shallow-water flounder from the South-Western Atlantic. J Fish Biol 50:900–902

References

293

England SJ, Blanchard GB, Mahadevan L, Adams RJ (2006) A dynamic fate map of the forebrain shows how vertebrate eyes form and explains two causes of cyclopia. Development 133:4613– 4617 Esteve P, Lopez-Rios J, Bovolenta P (2004) SFRP1 is required for the proper establishment of the eye field in the medaka fish. Mech Dev 121:687–701 Feng S, Jacobsen SE, Reik W (2010) Epigenetic reprogramming in plant and animal development. Science 330:622–627 Figueras A, Robledo D, Corvelo A, Hermida M, Pereiro P, Rubiolo JA, Gómez-Garrido J, Carreté L, Bello X, Gut M, Gut IG, Marcet-Houben M, Forn-Cuní G, Galán B, García JL, Abal-Fabeiro JL, Pardo BG, Taboada X, Fernández C, Vlasova A, Hermoso-Pulido A, Guigo R, Alvarez-Dios JA, Gómez-Tato A, Viñas A, Maside X, Gabaldón T, Novoa B, Bouza C, Alioto T, Martínez P (2016) Whole genome sequencing of turbot (Scophthalmus maximus; Pleuronectiformes): a fish adapted to demersal life. DNA Res 23:181–192 Frazzetta TH (2012) Flatfishes, turtles, and bolyerine snakes: evolution by small steps or large, or both? Evol Biol 39:30–60 Friedman M (2008) The evolutionary origin of flatfish asymmetry. Nature 454:209–212 Friedman M (2012) Osteology of Heteronectes chaneti (Acanthomorpha, Pleuronectiformes), an Eocene stem flatfish, with a discussion of flatfish sister-group relationships. J Vert Paleontol 32(4):735–756 Gemballa S, Hagen K, Röder K, Rolf M, Treiber K (2003) Structure and evolution of the horizontal septum in vertebrates. J Evol Biol 16:966–975 Goldschmidt R (1933) Some aspects of evolution. Science 78(2033):539–547 Goldschmidt R (1940) The material basis of evolution. Yale Univ Press, New Haven, p 1940 Goto T (2009) Reversals in two dextral flounder species, Microstomus achne and Cleisthenes pinetorum (Pleuronectida; Teleostei) from Japan. J Fish Biol 74(3):669–673 Hagen O, Vieira-Johnston VLA, Solberg C, Johnston IA (2008) Myotube production in fast myotomal muscle is switched-off at shorter body lengths in male than female Atlantic halibut Hippoglossus hippoglossus (L.) resulting in a lower final fibre number. J Fish Biol 73:139–152 Harrington RC, Faircloth BC, Eytan RI, Smith WL, Near TJ, Alfaro ME, Friedman M (2016) Phylogenomic analysis of carangimorph fishes reveals flatfish asymmetry arose in a blink of the evolutionary eye. BMC Evol Biol 16(1):224 Hensley D, Ahlstrom E (1984) Pleuronectiformes: relationships. In: Moser H, Richards W, Cohen D, Fahay M, Kendell A, Richardson S (eds) Ontogeny and systematics of fishes. American Society of Ichthyologists and Herpetologists, pp 670–687 Hensley DA (1999) Psettoididae. Spiny Turbots. In: Carpenter KE, Niem V (eds) FAO identification guide for fishery purposes. The Wesern Central Pacific. Food and Agriculture Organization of the United Nations, Rome, pp 3792–3793 Hoshino K (2001) Monophyly of the Citharidae (Pleuronectoidei: Pleuronectiformes: Teleostei) with considerations on pleuronectoid phylogeny. Ichthyol Res 48:391–404 Hubbs CL, Hubbs LC (1944) Bilateral asymmetry and bilateral variation in fishes. Pap Mich Acad Sci Arts Lett:229–311 Hubbs CL, Hubbs LC (1945) Bilateral asymmetry and bilateral variation in fishes. Pap Mich Acad Sci Arts Lett 30:229–310 Hubbs CL, Kuronuma K (1942) Hybridization in nature between two genera of flounders in Japan. Pap Mich Acad Sci Arts Lett 27:267–306 Hussain SM (1990) Biology of Psettodes erumei (schneider, 1801) and Pseudorhombus arsius (Hamilton, 1822) from the northern Arabian sea. Indian J Fish 37(1):63–66 Inui Y, Miwa S (1985) Thyroid hormone induces metamorphosis of flounder larvae. Gen Comp Endocrinol 60:450–454 Janvier P (2008) Squint of the fossil flatfish. Nature 454(10):169–170 Jiang L, Zhang J, Wang J-J, Wang L, Zhang L, Li G, Yang X, Ma X, Sun X, Cai J (2013) Sperm, but not oocyte, DNA methylome is inherited by zebrafish early embryos. Cell 153:773–784

294

10

Evolutionary Origin of Left-Right Eye Asymmetry

Johnston IA (2004) Development of molecular tools for investigating muscle growth and flesh quality in halibut. In: Johnston IA, Norberg B, Solberg C (eds) Halibut farming from a to Z. Bodø University College, Bodø, Norway, pp 259–265 Kanou K, Kohno H, Sano M (2004) Morphological and functional development of characters associated with settlement in the yellowfin goby, Acanthogobius flavimanus. Ichthyol Res 51(3):213–221 Kyle HM (1921) The asymmetry, metamorphosis and origin of flatfishes. Philos Trans R Soc Lond B 211:75–129, pls 4-10 Lee YD, Na OS et al (1997) Growth and sexual phenomena of the hybrid between olive flounder and spotted flounder. J Aquac 10(2):179–187 Li B, Dettaï A, Cruaud C, Couloux A, Desoutter-Meniger M, Lecointre G (2009) RNF213, a new nuclear marker for acanthomorph phylogeny. Mol Phylogenet Evol 50:345–363 Li J, Zhang Q, Qi J, Wang X, Wang Z (2006) Embryonic and larval development in hybrid between Paralichthys olivaceus(♀) and Verasper variegates(♂). J Fish Sci China 13(5):732–739 Schultz LP, Smith RT (1936) Is Inopsetta ischyra (Jordan and Gilbert), from Puget Sound, Washington, a hybrid flatfish? Copeia 1936:199–203 Li S, Wang H (1995) Fauna Sinica: Pisces, Order Pleuronectiformes. Science Press, Beijing. (abstract in English) Little AG, Lougheed SC, Moyes CD (2010) Evolutionary affinity of billfishes (Xiphiidae and Istiophoridae) and flatfishes (Plueronectiformes): independent and trans-subordinal origins of endothermy in teleost fishes. Mol Phylogenet Evol 56:897–904 Liu Y, Wei M, Guo H, Shao C, Meng L, Xu Wang N, Wang L, Power DM, Hou J, Mahboob S, Cui Z, Yang Y, Li Y, Zhao F, Chen S (2017) Locus mapping, molecular cloning, and expression analysis of rps6kb2, a novel metamorphosis related gene in Chinese tongue sole (Cynoglossus semilaevis). Mar Biotechnol 19(5):497–516 Loosli F, Staub W, Finger-Baier K, Ober E, Verkade H, Wittbrodt J, Baier H (2003) Loss of eyes in zebrafish caused by mutation of chokh/rx3. EMBO Rep 4:894–899 Loosli F, Winkler S, Burgtorf C, Wurmbach E, Ansorge W, Henrich T, Grabher C, Arendt D, Carl M, Krone A et al (2001) Medaka eyeless is the key factor linking retinal determination and eye growth. Development 128:4035–4044 Lü Z, Gong L, Ren Y, Chen Y, Wang Z, Liu L, Li H, Chen X, Li Z, Luo H, Jiang H, Zeng Y, Wang Y, Wang K, Zhang C, Jiang H, Wan W, Qin Y, Zhang J, Zhu L, Shi W, He S, Mao B, Wang W, Kong X, Li Y (2021) Large-scale sequencing of flatfish genomes provides insights into the polyphyletic origin of their specialized body plan. Nat Genet 53:742–751 Manabe H, Ide M, Shinomiya A (2000) Mating system of the lefteye flounder, Engyprosopon grandisquama. Ichthyol Res 47(1):69–74 Manabe H, Ide M, Shinomiya A, Sunobe T (2005) Long-term territoriality and mate acquisition in the lefteye flounder Engyprosopon grandisquama. Ichthyol Res 52(1):90–93 Martin CC, McGowan RA (1995) Parent-of-origin specific effects on the methylation of a transgene in the zebrafish, Danio rerio. Dev Genet 17:233–239 Martinez-Morales JR, Wittbrodt J (2009) Shaping the vertebrate eye. Curr Opin Genet Dev 19:511– 517 Maurus D, Heligon C, Burger-Schwarzler A, Brandli AW, Kuhl M (2005) Noncanonical Wnt-4 signaling and EAF2 are required for eye development in Xenopus laevis. EMBO J 24:1181– 1191 McGowan RA, Martin CC (1997) DNA methylation and genome imprinting in the zebrafish, Danio rerio: some evolutionary ramifications. Biochem Cell Biol 75:499–506 McManus IC (1984) Inheritance of asymmetries in man and flatfish. Behav Brain Sci 7(04): 731–733 Mivart St GJ (1871) On the genesis of species. Appleton, New York Moore KB, Mood K, Daar IO, Moody SA (2004) Morphogenetic movements underlying eye field formation require interactions between the FGF and ephrinB1 signaling pathways. Dev Cell 6: 55–67

References

295

Munroe TA (2014) Systematic diversity of the Pleuronectiformes. In: Gibson RN, Nash RDM, Geffen AJ, Van der Veer HW (eds) Flatfishes: biology and exploitation, 2nd edn. WileyBlackwell, Oxford, UK, pp 13–51 Near TJ, Eytan RI, Dornburg A, Kuhn KL, Moore JA, Davis MP, Wainwright PC, Friedman M, Smith WL (2012) Resolution of ray-finned fish phylogeny and timing of diversification. Proc Natl Acad Sci U S A 109(34):13698–13703 Nelson JS, Grande TC, Wilson MVH (2016) Fishes of the world, 5th edn. John Wiley & Sons, Inc., Hoboken, New Jersey Norman JR (1934) A systematic monograph of the flatfishes (Heterosomata). Printed by order of the Trustees of the British Museum, London, p 1934 Palmer AR (1996) From symmetry to asymmetry: phylogenetic patterns of asymmetry variation in animals and their evolutionary significance. Proc Natl Acac Sci U S A 93:14279–14286 Palmer AR (2004) Symmetry breaking and the evolution of development. Science 306:828–833 Policansky D (1982a) Flatfishes and the inheritance of asymmetry. Behav Brain Sci 5:262–265 Policansky D (1982b) Gene knows left from right? Behav Brain Sci 5(2):733 Potok ME, Nix DA, Parnell TJ, Cairns BR (2013) Reprogramming the maternal zebrafish genome after fertilization to match the paternal methylation pattern. Cell 153:759–772 Rembold M, Loosli F, Adams RJ, Wittbrodt J (2006) Individual cell migration serves as the driving force for optic vesicle evagination. Science 313:1130–1134 Robledo D, Hermid M, Rubiolo JA, Fernández C, Blanco A, Bouza C, Martínez P (2017) Integrating genomic resources of flatfish (Pleuronectiformes) to boost aquaculture production. Comp Biochem Physiol Part D Genomics Proteomics 21:41–55 Sawayama E, Takagi M (2010) Estimation of the causative effects of reversed abnormality in Japanese flounder Paralichthys olivaceus by DNA parentage analysis. Aquac Res 58(4): 441–446. (in Japanese) Schreiber AM (2006) Asymmetric craniofacial remodeling and lateralized behavior in larval flatfish. J Exp Biol 209:610–621 Schreiber AM (2013) Flatfish: An asymmetric perspective on metamorphosis. Curr Top Dev Biol 103:167–194 Shadwick RE, Rapoport HS, Fenger JM (2002) Structure and function of tuna tail tendons. Comp Biochem Physiol A Mol Integr Physiol 133:1109–1125 Shao C, Bao B, Xie Z, Chen X, Li B, Jia X, Yao Q, Ortí G, Li W, Li X, Hamre K, Xu J, Wang L, Chen F, Tian Y, Schreiber AM, Wang N, Wei F, Zhang J, Dong Z, Gao L, Gai J, Sakamoto T, Mo S, Chen W, Shi Q, Li H, Xiu Y, Li Y, Xu W, Shi Z, Zhang G, Power DM, Wang Q, Schartl M, Chen S (2017) The genome and transcriptome of Japanese flounder provide insights into flatfish asymmetry. Nat Genet 49:119–124 Shao C, Li Q, Chen S, Zhang P, Lian J, Hu Q, Sun B, Jin L, Liu S, Wang Z, Zhao H, Jin Z, Liang Z, Li Y, Zheng Q, Zhang Y, Wang J, Zhang G (2014) Epigenetic modification and inheritance in sexual reversal of fish. Genome Res 24(4):604–615 Shi W, Chen S, Kong X, Si L, Gong L, Zhang Y, Yu H (2018) Flatfish monophyly refereed by the relationship of Psettodes in Carangimorphariae. BMC Genomics 19:400 Sinn R, Wittbrodt J (2013) An eye on eye development. Mech Develop 130:347–358 Smith WL, Wheeler WC (2006) Venom evolution widespread in fishes: a phylogenetic road map for the bioprospecting of piscine venoms. J Hered 97:206–217 Song W, Li Y, Zhao Y, Liu Y, Niu Y, Pang R, Miao G, Liao X, Shao C, Gao F, Chen S (2012) Construction of a high-density microsatellite genetic linkage map and mapping of sexual and growth-related traits in halfsmooth tongue sole (Cynoglossus semilaevis). PLoS One 7:e52097 Stigloher C, Ninkovic J, Laplante M, Geling A, Tannhauser B, Topp S, Kikuta H, Becker TS, Houart C, Bally-Cuif L (2006) Segregation of telencephalic and eye-field identities inside the zebrafish forebrain territory is controlled by Rx3. Development 133:2925–2935 von Ubisch L (1951) Untersuchungen über Pleuronektiden. II. Ambikoloration, Inversion und Bilateraliteit. Wilhelm Roux Arch Entwickl Mech Org 145:1–61

296

10

Evolutionary Origin of Left-Right Eye Asymmetry

von Wahlert G (1965) The role of ecological factors in the origin of higher levels of organization. Syst Zool 14:288–300 Walters V (1961) Is flatfish asymmetry transmitted cytoplasmically? Copeia 1961:485–486 Wang Z, Wang X, Zhang Q (2003) Interfamilial hybridization between Paralichthys olivaceus and Kareius bicoloratus I. early development and growth characters. J Fish Sci China 10(7):30–37 Wei F, Chen J, Chen X, Bao B (2017) Comparative analysis with the neurula transcriptomes of two species of flatfishes Platichthys stellatus and Paralichthys olivaceus. Gene 596:147–153 Westneat MW, Hoese W, Pell CA, Wainwright SA (1993) The horizontal septum: mechanisms of force transfer in locomotion of scombrid fishes (Scombridae, Perciformes). J Morph 217:183– 204 White J (1962) A reversed ambicolorate postlarval gulf flounder, Paralichthys albigutta. Copeia 1962(4):854 Xing J, Ke Z, Liu L, Li C, Gong X, Bao B (2020) Eye location, cranial asymmetry, and swimming behavior of different variants of Solea senegalensis. Aquac Fish 5(4):182–186 Xu X, Shao C, Xu H, Zhou Q, You F, Wang N, Li W, Li M, Chen S (2020) Draft genomes of female and male turbot Scophthalmus maximus. Sci Data 7:90. https://doi.org/10.1038/s41597-0200426-6 Zimmer C (2008) The evolution of extraordinary eyes: the cases of flatfishes and stalk-eyed flies. Evolution 1:487–492