Evolutionary Gerontology and Geriatrics: Why and How We Age (Advances in Studies of Aging and Health, 2) 303073773X, 9783030737733

Citation preview

Advances in Studies of Aging and Health 2 Series Editors: Danan Gu · Qiushi Feng

Giacinto Libertini · Graziamaria Corbi Valeria Conti · Olga Shubernetskaya Nicola Ferrara

Evolutionary Gerontology and Geriatrics Why and How We Age Foreword by Alexey Olovnikov

Advances in Studies of Aging and Health Volume 2

Series Editors Danan Gu, Population Division, Headquarters of United Nations Population Division, New York, NY, USA Qiushi Feng, Sociology, AS1 04-30, National University of Singapore Sociology, AS1 04-30, Singapore, Singapore

This book series is a theme-driven compilation, publishing the latest international research findings by key topics upon roles of social, behavioral, psychological, and contextual factors in associating or determining health and wellbeing of older people, with biomedical components taken into consideration. It applies an internationally comparative perspective and a biopsychosocial framework to understand healthy, active, productive, and successful aging, in order to build up a comprehensive and practical source of knowledge for researchers and practitioners in the field of aging and health. This book series publishes original studies and tracks new research progresses by the major topics in the field of aging and health; systematically reviews recent research advancements of new concepts, frameworks, and methodology; and frameworks; explores the aging issues through an interdisciplinary perspective, and provides fresh empirical findings and theoretical insights in an internationally comparative manner. The goal is to effectively disseminate new policies and intervention practices on aging, in order for the improvement of quality of life of older persons. The major themes of this book series include but are not limited to disability, cognitive function, chronic diseases and conditions, happiness and psychological wellbeing, self-rated health, frailty, mortality, living arrangements and intergenerational transfers, retirement and pension reforms, financial health and poverty, elderly abuse and human rights, ageism, long-term care, end-of-life care, aging in place, environmental health, age‐friendly cities/communities, social participation, centenarian studies, big data in aging research, resilience and vulnerability, health life expectancies, active aging, successful aging, and healthy longevity.

More information about this series at http://www.springer.com/series/15604

Giacinto Libertini • Graziamaria Corbi • Valeria Conti • Olga Shubernetskaya • Nicola Ferrara

Evolutionary Gerontology and Geriatrics Why and How We Age Foreword by Alexey Olovnikov

Giacinto Libertini ASL NA2 Nord Italian Health National System Frattamaggiore, Napoli, Italy

Graziamaria Corbi Department of Medicine and Health Sciences University of Molise Campobasso, Italy

Valeria Conti Department of Medicine, Surgery and Dentistry University of Salerno Baronissi, Italy

Olga Shubernetskaya M.M. Shemyakin–Yu.A. Ovchinnikov Institute of Bioorganic Chemistry Moscow, Russia

Nicola Ferrara Department of Transnational Medical Sciences University of Naples Federico II Naples, Italy

ISSN 2522-5146 ISSN 2522-5154 (electronic) Advances in Studies of Aging and Health ISBN 978-3-030-73773-3 ISBN 978-3-030-73774-0 (eBook) https://doi.org/10.1007/978-3-030-73774-0 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Switzerland AG The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland

To Vladimir Petrovich Skulachev, father of the concept of phenoptosis, which is essential to understand aging

Foreword

The reader receives an important book that sums up the results achieved today by the science of aging and is rich not only in answers but also in questions needing answers. And the authors, performing the role of a collective Virgil, lead the reader through the intricacies of facts and hypotheses, which are abundant in the modern gerontology that rushes to the cherished goal of humanity. What happens to the body when earthly life has already gone to half? When does aging begin? By chance or not, did it appear in evolution? Is aging only harmful, or has some biological benefit? How and why do the structures and functions of the body change with age? What can give to medicine an understanding of evolutionary processes? Different theories give their answers to such questions. Which of them, and why are closer to the truth? All this is only a part of the book, it also offers a special view of medicine in general. Authors make a significant contribution to evolutionary medicine, a rapidly growing field, which combines the achievements of evolutionary biology and modern medical science. Following their professional interests, the authors primarily focus on evolutionary gerontology and geriatrics. This research area is interesting for doctors, gerontologists, and all biologists of a wide profile. The new views considered in the book allow a better understanding of the diseases themselves, and at the same time, they help to extract information from medical observations and to use them for further development of evolutionary biology. Noting the existence of numerous mechanisms that are compatible or incompatible with the opposite programmed and non-programmed (stochastic) aging paradigms, the authors develop their own version, namely the so-called “subtelomere-telomere theory” of aging. The book is beautifully illustrated with graphics, photos, and drawings that enrich the text. Authors use for their aims not only waterfalls of facts, ideas, and conclusions, but even geographical maps. As for geography, it clearly shows the dependence of human health on certain natural parasites that have accompanied our

vii

viii

Foreword

species throughout its long history. Before us is drawn an amazing paradox – the existence of antagonism between the presence of helminths and the development of such dangerous human pathologies as autoimmune and allergic diseases. In general, I recommend reading this book to physicians, evolutionists, and certainly those who are interested in the problems of aging. And who isn’t interested in them now? National Medical Research Center for Obstetrics, Gynecology and Perinatology, Moscow, Russia Institute of Biochemical Physics, Russian Academy of Sciences, Moscow, Russia

Alexey Olovnikov

Terminology + Abbreviations1

Hypotheses About Aging Origin Aging as an accelerating factor of evolution hypothesis Antagonistic pleiotropy h. Cessation of somatic growth h. Damage accumulation hypotheses Disposable soma h. Historical h. Mutation accumulation h. Quasi-programmed aging h. Red Queen h.

Diseases Age-related macular degeneration Alzheimer’s disease Dementia with Lewy bodies Dyskeratosis congenita Parkinson’s disease Progeroid syndromes Werner syndrome or adult progeria

AMD AD DLB DC PD PSs WS

Cell Types Endothelial progenitor cells Olfactory receptor cells Retina pigmented cells

1

EPCs ORCs RPCs

If used more than once. ix

x

Terminology + Abbreviations

Enzymes and Molecules Extrachromosomal ribosomal DNA circles Mammalian TOR Reactive oxygen species Human TER Human TERT Target of rapamycin Telomerase RNA Telomerase reverse transcriptase Telomeric repeat-containing RNA

ERCs mTOR ROS hTER hTERT TOR TER TERT TERRA

Miscellany Caloric restriction Calorie restriction mimetics Combined use of dasatinib and quercetin Hypothetical ML without the age-related increasing mortality International classification of diseases Mean duration of life Senescence-associated secretory phenotype Senescent cell anti-apoptotic pathways Telomere-subtelomere-telomerase system

CR CRMs DQ HML ICD ML SASP SCAPs TST system

Three important definitions: Telomere – A telomere, from the ancient Greek words τε λoς [télos, end] and μερoς [méros, part], is the ending part of chromosomal DNA molecule and is composed of a repeated short nucleotide sequence (motif), which is very conserved in the course of evolution (e.g., TTAGGG in vertebrates). A telomere is also understood as the association of such a repeated sequence with specialized proteins. Telomerase – Telomerase is a reverse transcriptase enzyme, that is, an enzymatic ribonucleoprotein that adds for each cycle a specific nucleotide sequence to telomeric 3' end. The sequence is defined by telomerase RNA and is the same repeated sequence of telomere. Telomerase action compensates for the incomplete duplication of DNA molecule end by the enzyme DNA polymerase, and without this action, the telomere shortens with each duplication of the DNA molecule. Subtelomere – Subtelomere, or subtelomeric region, is that part of the chromosomal DNA molecule immediately preceding the telomere. This definition accurately

Terminology + Abbreviations

xi

indicates that the subtelomere begins where the telomere ends but does not indicate the other subtelomeric end. In Chapter 5 of this book, the subtelomere is defined in functional terms as being composed of two parts: – Subtelomere R (regulatory subtelomere) composed of regulatory sequences of first level repressed in proportion to telomere shortening. – Subtelomere A (amplifier subtelomere) composed of regulatory sequences of second level regulated by the sequences of subtelomere R. Their action amplifies and multiplies the effects of subtelomere R.

Contents

1

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1 Evolutionary Medicine and “Evolutionary Gerontology and Geriatrics” . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2 Definition of Aging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3 Aging in Natural Observation . . . . . . . . . . . . . . . . . . . . . . . . . . 1.4 A Short History of Aging Theories . . . . . . . . . . . . . . . . . . . . . . 1.4.1 The Conception of Aging Up to Nineteenth Century . . . . 1.4.2 Aging Theories in the Nineteenth Century and the First Half of the Twentieth Century . . . . . . . . . . 1.4.3 Aging Theories from the Second Half of the Twentieth Century to Today . . . . . . . . . . . . . . . . 1.4.4 Classification of Aging Theories . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 1 2 4 8 8 10 16 24 25

2

Evolution and Phenoptosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1 Darwinian Definition of Natural Selection . . . . . . . . . . . . . . . . 2.2 Supra-Individual Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3 Definition of Phenoptosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4 Examples of Phenoptosis and Its Wide Diffusion . . . . . . . . . . . 2.4.1 (A) Obligatory and Rapid Phenoptosis . . . . . . . . . . . . . 2.4.2 (B) Obligatory and Slow Phenoptosis . . . . . . . . . . . . . 2.4.3 (C) Optional Phenoptosis . . . . . . . . . . . . . . . . . . . . . . 2.4.4 (D) Indirect Phenoptosis . . . . . . . . . . . . . . . . . . . . . . . 2.5 Phenoptotic Phenomena in our Species . . . . . . . . . . . . . . . . . . . 2.6 Life Tables and Phenoptosis . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . .

33 33 34 37 38 38 41 43 48 50 51 62

3

Evolutionary Medicine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1 Definition of Evolutionary Medicine . . . . . . . . . . . . . . . . . . . . 3.2 A Brief History of Evolutionary Medicine . . . . . . . . . . . . . . . . 3.3 The Concept of Normality in Evolutionary Medicine . . . . . . . . .

. . . .

69 69 69 79 xiii

xiv

Contents

3.4 3.5 3.6 3.7 3.8

The Concept of Mismatch in Evolutionary Medicine . . . . . . . . . Diseases Caused by Mismatches . . . . . . . . . . . . . . . . . . . . . . . Diseases Caused by Alterations of the Genotype . . . . . . . . . . . . The Concept of Holobiont . . . . . . . . . . . . . . . . . . . . . . . . . . . . Immune Disorders in the Interpretation of Evolutionary Medicine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.8.1 The Current “Epidemic” of Allergic Diseases . . . . . . . . 3.8.2 The Current “Epidemic” of Autoimmune Diseases . . . . 3.8.3 Causes of the Epidemic of Immune Disorders . . . . . . . 3.9 Non-evolutionary Classification of Diseases . . . . . . . . . . . . . . . 3.10 Evolutionary Classification of Diseases . . . . . . . . . . . . . . . . . . 3.11 Meaning and Aims of Evolutionary Medicine . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

4

. . . .

84 84 85 91

. . . . . . . .

92 92 93 97 106 107 111 114

The Comparison Between the Two Paradigms . . . . . . . . . . . . . . . . . 4.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2 The Paradigm of Aging as a Non-adaptive Phenomenon . . . . . . . 4.3 The Paradigm of Aging as an Adaptive Phenomenon . . . . . . . . . 4.4 Arguments and Evidence in Support or Against the Theories Pertaining to the Two Paradigms . . . . . . . . . . . . . . . 4.4.1 Absence of Unlikely Postulates . . . . . . . . . . . . . . . . . . . 4.4.2 Non-universality of Aging . . . . . . . . . . . . . . . . . . . . . . 4.4.3 Variation of Aging Rhythms in the Comparison among Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.4 Consideration of Supra-Individual Natural Selection and Phenoptotic Phenomena . . . . . . . . . . . . . . 4.4.5 Effects of Caloric Restriction on Lifespan . . . . . . . . . . . 4.4.6 Existence of Age-Related Increasing Mortality in the Wild . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.7 In the Comparison Among Species, the Inverse Relation Between Extrinsic Mortality and the Proportion of Deaths Due to Intrinsic Mortality . . . . . . . 4.4.8 Impossibility of Explaining Age-Related Fitness Decline as a Consequence of Genes that Are Harmful at a Certain Age . . . . . . . . . . . . . . . . . . . . . . . 4.4.9 Age-Related Progressive Decline of Cell Turnover Capacities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.10 Cell Senescence Program . . . . . . . . . . . . . . . . . . . . . . . 4.4.11 Gradual Cell Senescence . . . . . . . . . . . . . . . . . . . . . . . 4.4.12 General Evaluation of the Arguments Mentioned earlier . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.5 Aging as an Accelerating Factor of Evolution Theory . . . . . . . . . 4.6 Kin Selection Aging Theory . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.6.1 Definitions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.6.2 The Evolutionary Advantage of a Shorter ML . . . . . . . .

121 121 122 125 129 129 131 132 135 135 136

139

142 145 147 148 149 151 153 154 155

Contents

xv

4.6.3 4.6.4

6

. 157 . . . . . .

158 163 164 164 168 169

Subtelomere-Telomere Aging Theory . . . . . . . . . . . . . . . . . . . . . . . . 5.1 Description of the Subtelomere-Telomere Theory . . . . . . . . . . . . 5.1.1 Limits in Cell Duplication Capacities . . . . . . . . . . . . . . 5.1.2 Probabilistic Relation Between Telomere Shortening and Replicative Senescence . . . . . . . . . . . . . . . . . . . . . 5.1.3 Suggestions from the Yeast . . . . . . . . . . . . . . . . . . . . . . 5.1.4 Gradual Cell Senescence and Cell Senescence . . . . . . . . 5.1.5 Absence of Relation Between Longevity and Telomere Initial Length . . . . . . . . . . . . . . . . . . . . . 5.2 Metabolic Changes in Aging Cells . . . . . . . . . . . . . . . . . . . . . . . 5.3 Atrophic Syndrome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.4 Limits in Cell Duplication Capacities and Other Effects of the Telomere-Subtelomere-Telomerase System Explained as a General Defense Against Cancer . . . . . . . . . . . . . . . . . . . . . 5.5 The Telomere . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.6 The Telomerase Enzyme . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.7 The Subtelomere . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.8 The Heterochromatin Hood Over the Telomere . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

179 179 180

4.6.5 4.6.6 4.6.7 4.6.8 References . 5

Effects of IMICAW on ML . . . . . . . . . . . . . . . . . . . . Evolutionary Steadiness of a Gene Causing IMICAW . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . The Preliminary Conditions . . . . . . . . . . . . . . . . . . . . Two Possible Objections . . . . . . . . . . . . . . . . . . . . . . The Methuselah Effect . . . . . . . . . . . . . . . . . . . . . . . . IMICAW, IMICAC, and t-genes . . . . . . . . . . . . . . . . . ...........................................

Aging in the Human Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1 Alterations Consequent to the Actions of the TelomereSubtelomere-Telomerase System . . . . . . . . . . . . . . . . . . . . . . . . 6.1.1 Alterations of Cellular Metabolism . . . . . . . . . . . . . . . . 6.1.2 Alterations of Cell Turnover . . . . . . . . . . . . . . . . . . . . . 6.2 Direct Aging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.1 Endothelium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.2 Skin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.3 Olfactory Receptor Cells . . . . . . . . . . . . . . . . . . . . . . . 6.2.4 Other Peripheral Sensory Neuronal Cells (Excluding Olfactory Receptor Cells) . . . . . . . . . . . . . . 6.2.5 Skeletal Muscle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.6 Heart . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.7 Gastrointestinal System . . . . . . . . . . . . . . . . . . . . . . . . 6.2.8 Orofacial Tissues and Organs . . . . . . . . . . . . . . . . . . . . 6.2.9 Lungs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.10 Kidneys . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

184 185 189 194 199 200

201 207 210 212 217 225 241 241 241 243 258 258 261 262 262 263 263 265 266 267 267

xvi

7

8

Contents

6.2.11 Pancreatic β-cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.12 Bone and Joints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.13 Liver . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.14 Hematopoietic Cells and Bone Marrow . . . . . . . . . . . . . 6.2.15 Testes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3 Indirect Aging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.1 Photoreceptor Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.2 Neurons of the Central Nervous System . . . . . . . . . . . . . 6.3.3 Auditory Neurons . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.4 Crystalline Lens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.4 General Schemes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

268 268 270 271 271 271 272 272 272 273 273 276

The Elderly Subjects and Their Troubles . . . . . . . . . . . . . . . . . . . . 7.1 Evolutionary Classification of the Troubles of the Elderly . . . . . 7.2 Age-Related Fitness Decline . . . . . . . . . . . . . . . . . . . . . . . . . . 7.3 Diseases Due to Genetic Alterations . . . . . . . . . . . . . . . . . . . . . 7.4 Diseases Due to Genetic Alterations That Cause Aging-Like Syndromes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.5 Diseases Deriving from ‘Extremes’ of the Ecological Niche and Relations with Other Living Beings . . . . . . . . . . . . . 7.6 Diseases Caused by Mismatches . . . . . . . . . . . . . . . . . . . . . . . 7.7 Diseases Caused by Mismatches That Speed Up Physiological Aging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.8 Weight of Physiological Aging . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

291 291 294 297

Prevention and Treatment of the Troubles of the Elderly . . . . . . . . 8.1 Rationality of the Evolutionary Approach . . . . . . . . . . . . . . . . . 8.2 Prevention and Treatment of Diseases Identical or Similar at Any Age . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3 Acceleration of Aging: Prevention and Treatment . . . . . . . . . . . 8.4 Treatment of Physiological Aging . . . . . . . . . . . . . . . . . . . . . . 8.4.1 Telomerase Activation . . . . . . . . . . . . . . . . . . . . . . . . 8.4.2 Elimination of Senescent Cells . . . . . . . . . . . . . . . . . . 8.4.3 Anti-aging Substances and Methods . . . . . . . . . . . . . . 8.4.4 Genetic Modifications . . . . . . . . . . . . . . . . . . . . . . . . 8.4.5 Ethical Problems . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.5 Current Geriatrics and Society . . . . . . . . . . . . . . . . . . . . . . . . . 8.6 Future Geriatrics and Society . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . .

. 299 . 306 . 309 . 313 . 322 . 326 . 351 . 351 . . . . . . . . . . .

352 353 357 358 361 366 373 377 379 380 383

Contents

Appendices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Appendix: Part A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Haploid Condition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Diploid Condition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Appendix: Part B . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

xvii

. . . . . .

401 401 401 407 412 413

Chapter 1

Introduction

1.1

Evolutionary Medicine and “Evolutionary Gerontology and Geriatrics”

As medicine is an important part of biology, if “Nothing in biology makes sense, except in the light of evolution” (Dobzhansky 1973) is true, why “Nothing in medicine makes sense, except in the light of evolution” (Varki 2012) should not be true? “Evolutionary Medicine is the enterprise of using evolutionary biology to address the problems of medicine” (Nesse 2008, p. 417). Evolutionary medicine is not an alternative medicine (like homeopathy, iridology, ayurvedic medicine, naturopathy, traditional Chinese medicine, energy medicine, etc.), but a more thoroughly scientific medicine, involving the concepts of evolutionism. A medicine that ignored the principles of chemistry, for example, would be partially scientific. Similarly, a medicine that ignores the principles of evolution is partially scientific. Moreover, just as current medicine encompasses many branches, including that set of cognitions and practical applications that are the subject of gerontology and geriatrics, so too evolutionary medicine must have a similar branch that can be defined as “evolutionary gerontology and geriatrics”. The exposition and discussion of this subject clearly require a brief description and discussion of the main concepts that underlie evolutionary medicine and this will be the topic of Chapter 3 – Evolutionary medicine. However, evolutionary medicine, as it is commonly understood today (Trevathan et al. 1999, 2008; Stearns and Koella 2008), is still anchored to the traditional concepts of aging conceived as a non-adaptive phenomenon and completely disregards the concept of phenoptosis (adaptive or programmed death of an individual, see below). For a rational and convincing inclusion of gerontology and geriatrics in evolutionary medicine, it is necessary to deepen the concepts of supra-individual

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0_1

1

2

1 Introduction

selection and phenoptosis and this will be the topic of Chapter 2 – Evolution and phenoptosis. Chapter 3 – Evolutionary medicine, in which the main concepts of evolutionary medicine are outlined, will also be a useful moment to underline some crucial differences between the new and the traditional approach of evolutionary medicine.

1.2

Definition of Aging

There are two different ways to define aging. The first defines the age-related decline of biological functions as a synonym for aging. Examples of this type of definition are: Aging is . . . – “progressive loss of function accompanied by decreasing fertility and increasing mortality with advancing age” (Kirkwood and Austad 2000); – “a persistent decline in the age-specific fitness components of an organism due to internal physiological deterioration” (Rose 1991, p. 20); – “any time-dependent change which occurs after maturity of size, form, function is reached and which is distinct from daily, seasonal and other biological rhythms” (Rockstein et al. 1977). The second type of definition makes no reference to alterations of functions and describes the phenomenon simply as an age-related increase in mortality. Examples of this second type of definition are: Aging is . . . – “a general title for the group of effects that, in various phyla, lead to a decreasing expectation of life with increasing age” (Comfort 1979, p. 7); – “increasing mortality with increasing chronological age in populations in the wild” (Libertini 1988) (Fig. 1.1); – “actuarial senescence (declining survivorship with age)” (Holmes and Austad 1995); – “increasing mortality with age . . . actuarial senescence” (Nussey et al. 2013). As the decline of biological functions in natural conditions means the decline of Darwinian fitness to survive, i.e., a mortality increase, the first type of definition is equivalent to the second type if the definitions are always restricted to observations in the wild. However, the second type of definition should be preferred for various reasons. The increase in the mortality rate can be precisely defined. It is undoubtedly useful to establish the lower arbitrary value of the increase, starting from which the aging is considered to begin. It is also possible to arbitrarily establish a value of the mortality rate (or of the increase of this rate) starting from which an advanced condition of senescence (“state of senility” (Williams 1957)) begins. However, the

1.2 Definition of Aging

3

Fig. 1.1 Definition of aging as “increasing mortality with increasing chronological age in populations in the wild” (Libertini 1988). Death rates of Ache people under natural conditions (forest period) show increasing death rates starting from the period τ; data from (Hill and Hurtado 1996)

arbitrary choice of these values does not alter the concept that aging is defined on the basis of a precise parameter, the mortality rate. On the contrary, how is it possible to define objectively that the modification of a biological parameter is part of aging or not? The problem could be circumvented specifying that the modification of a biological parameter is a manifestation of aging when and to the extent that it reduces fitness, i.e., it increases mortality. Nevertheless, with this specification, the first type of definition becomes synonymous with the second, and, at this point, it is better to refer directly to mortality rates regardless of the biological alterations that cause them. The definition of aging based on biological alterations also entails the dangerous “. . . confusion of the process of senescence with the state of senility” (Williams 1957). The state of senility, i.e., the condition of serious alteration of biological functions that characterizes the advanced phases of aging, is not synonymous with aging. The distinction between aging and the senile state has been well known for some time and is excellently expressed by a Williams’ sentence: “No one would consider a man in his thirties senile, yet, according to athletic records and life tables, senescence is rampant during this decade” (Williams 1957). The confusion between aging and state of senility has led to deny and diminish the existence of aging in natural conditions and, therefore, to the conclusion that

4

1 Introduction

aging cannot be object of natural selection because of its inexistence in nature: “. . . there is scant evidence that senescence contributes significantly to mortality in the wild. . . . As a rule wild animals simply do not live long enough to grow old. Therefore, natural selection has limited opportunity to exert a direct influence over the process of senescence” (Kirkwood and Austad 2000).

1.3

Aging in Natural Observation

Until some time ago, doubts were commonly raised about the existence of aging under natural conditions. For example, in 1952, Medawar remarked, “whether animals can, or cannot, reveal an innate deterioration with age is almost literally a domestic problem; the fact is that under the exactions of natural life they do not do so. They simply do not live that long” (Medawar 1952); Rose, in 1991, stated that “. . . it is doubtful that many individuals would remain for study at the age at which laboratory populations exhibit aging.” (Rose 1991, p. 21); “Ageing rarely if ever occurs in feral animals because it is unusual for them to live long enough to experience the phenomenon. The same observation can be made for prehistoric humans. Natural selection could not select for a process like ageing when few, if any, animals ever lived long enough to participate in the selection process.” (Hayflick 2000), and just above the belief of two influential authors in 2000, has been reported (“. . . As a rule wild animals simply do not live long enough to grow old . . .” (Kirkwood and Austad 2000)). The idea that only very few individuals survived in the wild long enough to die as a consequence of aging-related mortality was considered as acceptable for a long time (Lack 1954; Berry and Bronson 1992). However, already in those years, the presence in the wild of age-related increase in mortality has long been known for various species (Libertini 1988; Finch 1990). In particular, the work of Libertini in 1988 reported data derived from previous field studies that documented aging for seven species of mammals (elephant (Laws 1966), hippopotamus (Laws 1968), waterbuck (Spinage 1970), Dall mountain sheep (Deevey Jr. 1947), zebra, warthog, impala and buffalo (Spinage 1972)). In 1998, an authoritative paper (Ricklefs 1998) further documented the age-related mortality increase for populations under natural conditions. An example of a life table with age-related increasing mortality, based on data from natural observation (Ricklefs 1998), is illustrated in Fig. 1.2. A subsequent authoritative review (Nussey et al. 2013), widely confirmed the existence of an age-related mortality increase for many species studied in the wild. In particular, the study stated that: “The recent emergence of long-term field studies presents irrefutable evidence that senescence is commonly detected in nature. We found such evidence in 175 different animal species from 340 separate studies.” (Nussey et al. 2013). It is interesting to note that one of the authors of the study, Steven Austad, is the same one who, together with Kirkwood, in 2000 denied the existence of senescence under natural conditions (Kirkwood and Austad 2000).

1.3 Aging in Natural Observation

5

Fig. 1.2 Life table and mortality of Hippopotamus amphibius, sex combined, in the wild (Data from (Ricklefs 1998)). The survivors and the high mortality in the first years are not reported

A closely related topic is the extent to which aging contributes to changing the mean duration of life span (“ML”) in natural conditions. Kirkwood and Austad (2000), as reported before, maintained that aging, being practically absent under natural conditions, had little or no influence in reducing the chances of survival, and therefore it was not a phenomenon modifiable by natural selection. This position was already untenable in 2000 as it was contradicted by data deriving from the observation of animal communities in the wild. In fact, in a 1988 work already mentioned (Libertini 1988) and based on known pre-existing data, it was shown that the ML would have doubled approximately if there had not been an age-related increase in mortality. Furthermore, excluding individuals who died during the first period of life, which is characterized by high mortality, the residual ML of the considered subpopulation (MLτ) tripled in the hypothetical absence of an increase in age-related mortality (see Table 1.1). A subsequent work of 1998 (Ricklefs 1998) also showed for a higher number of species that, under natural conditions, the proportion of deaths due to aging (Ps) was considerable and such as to reduce the duration of life significantly. After the work of Kirkwood and Austad (2000), further data have denied their firm belief. As before said, in 2013, an important work (Nussey et al. 2013) reviewed a significant number of papers demonstrating that for many species, an age-related increase in mortality exists in natural conditions and undoubtedly influences the mean duration of life. In the same year, another work (Libertini 2013) discussed data from a human population (Ache people of Paraguay) under natural conditions in a critical observational study on the field (Hill and Hurtado 1996). This study documented an age-related mortality increase that started from the third decade of life (the same

6

1 Introduction

Table 1.1 Influence of aging on ML (Table 1 in (Libertini 1988), modified; all times are in years) Species [source of data] Zebra (Spinage 1972) Hippopotamus (Laws 1968) Elephant (Laws 1966) Waterbuck (Spinage 1970) Warthog (Spinage 1972) Impala (Spinage 1972) Buffalo (Spinage 1972) Dall mountain sheep (Deevey Jr. 1947)

τ 6 14

λmin 4.63 1.03

ML (A) 8.48 15.40

HML (B) 17.23 43.33

Ratio B/A 2.03 2.81

MLτ  τ (C) 6.73 21.69

HMLττ (D) 21.55 96.68

Ratio (D/C) 3.20 4.45

16 3

1.95 5.55

17.27 3.71

28.85 9.56

1.67 2.57

21.08 4.47

51.95 18.00

2.42 4.02

8 3 5 4

5.90 5.44 4.23 3.54

4.79 6.37 5.50 7.15

7.43 16.87 12.16 23.00

1.55 2.64 2.21 3.21

5.92 4.76 6.80 5.52

16.93 18.35 23.61 28.17

2.85 3.85 3.46 5.09

Mean ¼

2.34

Mean ¼

3.67

Legend: τ ¼ age when the death rate is the lowest; λmin ¼ mortality at the age τ; ML ¼ ML observed in the wild; HML ¼ hypothetical ML without the age-related increasing mortality; MLτ – τ ¼ [ML observed in the wild for the individuals survived at time τ] – [τ]; HMLτ – τ ¼ [hypothetical ML of the individuals survived at time τ without the age-related increasing mortality] – [τ]

period of life highlighted by Williams (1957) for modern populations). Despite the primitive conditions of life and the high mortality due to violent causes or to other causes that would be lethal at any age, about 31%, 24%, 21% and 11% of the individuals survived at the ages of 60, 65, 70 and 75 years, respectively (Hill and Hurtado 1996) (Fig. 1.3). Moreover, it was calculated the ML in the hypothetical case of no age-related mortality increase, both considering the whole population (Fig. 1.4) and considering only the survivors at the age of 20 years when the mortality was at its lowest value (Fig. 1.5). In the first case, the ML under natural conditions for the whole population was equal to 38.8 years, while hypothetically excluding any age-related mortality increase the ML reached 87.75 years with a ratio between the two values equal to 2.26. In the second case, i.e., considering only the individuals surviving at the age of 20 years (when the mortality had its lowest value, about 0.858%/year), the ML was 20 + 38.1 ¼ 58.1 years, while for the hypothetical curve where age-related increasing mortality was excluded, the ML was 20 + 116.55 ¼ 136.55 years, with a ratio between the years survived after the age of 20 years equal to 116.55/38.1 ¼ 3.059. These data were equivalent to those obtained for the other species reported in Table 1.1.

1.3 Aging in Natural Observation

7

Fig. 1.3 Survivors and death rates of Ache population (in the forest period) (Data from (Hill and Hurtado 1996))

Fig. 1.4 The continuous line shows the real life table of Ache people in the wild (forest period; data from (Hill and Hurtado 1996)), while the dashed line indicates the hypothetical life table without age-related increasing mortality. Ps area indicates the proportion of deaths due to aging (definition of Ps from (Ricklefs 1998)). Abscissas extend as far as 600 years, as at the age of 580 about 0.5% of the population would survive if the mortality is constant with a rate of 0.9%/year (about the estimated minimum mortality in natural conditions)

8

1 Introduction

Fig. 1.5 The same as in the previous figure, but only individuals surviving at the age of 20 years are considered. Abscissas extend as far as 660 years since – with a constant mortality rate of 0.9%/ year – at the age of 634 years about 0.5% of the population would survive

These studies confirmed the concept that the definition of aging as increasing mortality with increasing chronological age in populations in the wild, or other equivalent definitions, describes a phenomenon that exists in natural conditions and significantly reduces lifespan, which is a strong and essential starting point.

1.4

A Short History of Aging Theories

A brief history of the concepts and theories about aging and its interpretation is now useful and necessary. As in any historical description, the arbitrary division into periods implies in itself a subjective interpretation. Moreover, whatever are the adopted criteria, there will always be many events that temporally fall in a period but reflect the characteristics of other periods. The following parts of this section try to divide the history of aging theories into three periods.

1.4.1

The Conception of Aging Up to Nineteenth Century

As Comfort says: “. . . senescence enters human experience through the fact that man exhibits it himself. This close involvement with human fears and aspirations may account for the very extensive metaphysical literature on ageing. It certainly accounts for the profound concern with which humanity has tended to regard the subject. To a great extent human history and psychology must always have been

1.4 A Short History of Aging Theories

9

determined and moulded by the awareness that the life-span of any individual is determinate, and that the expectation of life tends to decrease with increasing age. The Oriental could say O King, live for ever! in the knowledge that every personal tyranny has its term. Every child since the emergence of language has probably asked Why did that man die? and has been told He died because he was old.” (Comfort 1979, pp. 1–2). Always, up to Darwin and beyond, the observation that every material object with time deteriorates and gradually consumes, has rooted in everyone, even in the greatest philosophers, the idea that this was true also for every living being, including man. As explained to the child, we do not age for some specific reason, but only because time passed and we became old, i.e., worn and altered, like everything else. There was no need for other explanations for such a trivially obvious category of events. In the Greek classic culture, immortality and eternal youth were prerogatives of the deities that mortals could not have. A mortal that presumed to compete with the gods, searching for being like to them, for example, aspiring to immortality, became guilty of ύβρις, namely of impious pride and arrogance toward the deity. There was also full awareness of the distinction between immortality and eternal youth. It is known the myth of Eos (Aurora), who asked Zeus (Jupiter) for the immortality of the beloved Tithonus. Zeus consented to Eos’ request, but she had forgotten to ask also for the eternal youth for the beloved. So Tithonus did not die but became ever older and decrepit until Zeus moved to pity and consented to Eos’ new request to end this torment turning Tithonus into an animal (Comfort 1979). However, a fact considered inevitable found its fantastic remedies in myths and fantasies. For example, medieval alchemists strenuously sought to obtain the philosopher’s stone that would have given both the ability to transform lead into gold and to obtain an elixir of life that would have allowed an eternal youth and immortality (Comfort 1979). Then there was the myth of the Fountain of Youth, born with Herodotus: “The Icthyophagi then in their turn questioned the king [of Ethiopians] concerning the term of life, and diet of his people, and were told that most of them lived to be a hundred and twenty years old, while some even went beyond that age – they ate boiled flesh, and had for their drink nothing but milk. When the Icthyophagi showed wonder at the number of the years, he led them to a fountain, wherein when they had washed, they found their flesh all glossy and sleek, as if they had bathed in oil – and a scent came from the spring like that of violets. The water was so weak, they said, that nothing would float in it, neither wood, nor any lighter substance, but all went to the bottom. If the account of this fountain be true, it would be their constant use of the water from it which makes them so long-lived.” [Herodotus, The histories, book III, 23]. This myth persisted in the Middle Ages (Fig. 1.6) and was reinvigorated with the discovery of the Americas. Gonzalo Fernández de Oviedo y Valdés wrote in 1535 that Ponce de Leon was looking for the waters of Bimini (in the modern Bahamas) to regain youthfulness [de Oviedo, sixteenth century, book 16, chapter XII]. In 1575, Hernando d’Escalente Fontaneda, who had lived with the Native Americans of

10

1 Introduction

Fig. 1.6 Lucas Cranach the Elder, The Fountain of Youth, 1546

Florida for 17 years, in his memoirs located the mythical waters in Florida and maintained that Ponce de León was supposed to have looked for them there (Fontaneda 1575).

1.4.2

Aging Theories in the Nineteenth Century and the First Half of the Twentieth Century

In the nineteenth century, before and after the publication of Charles Darwin’s revolutionary book (Darwin 1859), there was a flourishing of studies in every field of biology. They certainly could not miss the subject of the mechanisms underlying the progressive decay of individuals over time. Evolution by natural selection changed the conception of the whole biology and, therefore, potentially also the concepts underlying aging, but this was understood long afterward. In fact, the pivotal concept of evolution in its first Darwinian formulation, i.e., natural selection based on the “survival of the fittest” (Darwin 1869), was in clear contrast with the possibility that selection could favor something that certainly damaged the individual in a total and unequivocal way. As a matter of fact, the expression “survival of the fittest” was coined by Herbert Spencer (1864) and adopted later by Darwin in the fifth edition of his book (“Natural Selection or the Survival of the Fittest” (Darwin 1869)). However, Darwin did not rule out the possibility that natural selection could foster characters that are harmful to the individual. For example, he says: “A tribe including many members who . . .

1.4 A Short History of Aging Theories

11

Fig. 1.7 Alfred Russell Wallace (1823–1913) conceived the theory of evolution through natural selection independently from Charles Robert Darwin. His proposal and that of Darwin were jointly published in 1858

Fig. 1.8 Charles Robert Darwin (1809–1882)

were always ready to aid one another, and to sacrifice themselves for the common good, would be victorious over most other tribes; and this would be natural selection.” (Darwin 1871, p. 500). Yet, the common interpretation of Darwinian ideas was that natural selection always favored traits that were beneficial for the individual and therefore aging did not seem conceivable as a phenomenon favored by natural selection. There were only two exceptions in this unanimous chorus. Alfred Russel Wallace (Fig. 1.7), who had proposed with Charles Robert Darwin (Fig. 1.8) the evolution by natural selection, was the first to guess, with extraordinary intuition, that aging could be an adaptive phenomenon in one of his letters, written in an unspecified year

12

1 Introduction

Fig. 1.9 Friedrich Leopold August Weismann (1834–1914) is considered the second most notable evolutionary theorist of the nineteenth century, after Charles Darwin, and one of the founders of Neo-Darwinism

around 1865–1870, as reported by August Weismann: “. . . for it is evident that when one or more individuals have provided a sufficient number of successors, they themselves, as consumers of nourishment in a constantly increasing degree, are an injury to those successors. Natural selection therefore weeds them out, and in many cases favors such races as die almost immediately after they have successors.” (Wallace 1865–1870 in Weismann 1889, vol. I). This principle was later developed by the same Weismann (Fig. 1.9), who hypothesized that the anticipated death of old individuals was beneficial because this gave more space to new generations, and this favored the evolution of the species (Weismann 1889, vol. I, 1891): “. . . To put it briefly, I consider that duration of life is really dependent upon adaptation to external conditions, that its length, whether longer or shorter, is governed by the needs of the species, and that it is determined by precisely the same mechanical process of regulation as that by which the structure and functions of an organism are adapted to its environment” (Weismann 1889, pp. 6–10); “Worn out individuals are not only valueless to the species, but they are even harmful, for they take the place of those which are sound. Hence by the operation of natural selection, the life of our hypothetically immortal individual would be shortened by the amount which was useless to the species” (Weismann 1889, pp. 24–25). “. . . the reason suggested by Weismann for the evolution of ageing was an adaptive one, namely that ageing is beneficial in ridding a species of old and decrepit individuals which would otherwise compete for resources with younger ones. Thus, by natural selection the somatic cells of the organism would have come to lose their capacity for unlimited survival, and ageing of the organism as a whole would have appeared.” (Kirkwood and Cremer 1982).

1.4 A Short History of Aging Theories

13

So, after Wallace, Weismann proposed an adaptive meaning of aging again and was also the first to hypothesize that the mechanism underlying aging was the slowing or blocking of cell and tissue renewal (Kirkwood and Cremer 1982): “. . . death takes place because a worn-out tissue cannot forever renew itself, and because a capacity for increase by means of cell-division is not everlasting, but finite” (Weismann 1889, p. 21); “. . . the organism did not finally cease to renew the worn-out cell material because the nature of the cells did not permit them to multiply indefinitely, but because the power of multiplying indefinitely was lost when it ceased to be of use” (Weismann 1889, p. 25). However, Weismann did not explain and justify the proposal of an adaptive meaning of aging in more detail, was attacked as an anti-Darwinist even though Darwin had hypothesized the sacrifice of individuals “for the common good” (Darwin 1871, p. 500), and after a few years repudiated this idea (Weismann 1892; Kirkwood and Cremer 1982). Moreover, the hypothesis that limits in cell reproductive capacities were the main mechanism of senescence appeared falsified, a few years later, by the erroneous experiments of Carrel that seemed to demonstrate an unlimited capacity of cellular reproduction (Carrel 1912, 1913; Carrel and Ebeling 1921a). Only when Hayflick’s experiments proved false those of Carrel (Hayflick and Moorhead 1961; Hayflick 1965), this forgotten hypothesis became again acceptable. Apart from these exceptions, for long time research on the causes of aging ignored the mechanisms of evolution and tried to identify the causes of aging in a series of chemical or physical factors. In this period, about aging, while Darwinian ideas were disregarded, there was a vast array of putative causes of aging, of which many could be defined as “Damage Accumulation hypotheses”. They proposed that aging is due to the cumulative effect of damages of various kinds, e.g.: – cellular “wear and tear” (Weismann 1882; Pearl 1928; Warthin 1929); – mechanochemical deterioration of cell colloids (Bauer 1924; Bergauer 1924; Růžická 1924, 1929; Lepeschkin 1931; Szabó 1931; Dhar 1932; Marinesco 1934; Kopaczewski 1938; Georgiana 1949); – inherent changes in specified tissues: – nervous (Mühlmann 1900, 1924, 1927; Ribbert 1908; Vogt and Vogt 1946; Bab 1948); – endocrine (Lorand 1904; Gley 1922; Dunn 1946; Findley 1949; Parhon 1955); – vascular (Demange 1886); – connective (Bogomolets 1947); – toxic products of intestinal bacteria (Metchnikoff 1904, 1907; Lorand 1929; Metalnikov 1937) (Fig. 1.10); – accumulation of “metaplasm” or of metabolites (Kassowitz 1899; Jickeli 1902; Montgomery 1906; Mühlmann 1910; Molisch 1938; Lansing 1942; Heilbrunn 1943); – action of gravity (Darányi 1930); – accumulation of heavy water (Hakh and Westling 1934) (a hypothesis proposed again in 1973 (Griffiths 1973));

14

1 Introduction

Fig. 1.10 Élie Metchnikoff (1845–1916), the winner of the 1908 Nobel Prize in Physiology or Medicine with Paul Ehrlich, for his research on phagocytosis and immunity, proposed that aging is caused by toxic bacteria in the gut and that lactic acid could prolong life

– the effect of an Aristotelian “entelechy” (Driesch 1941; Bürger 1954); – metabolic theories introducing the concept of a fixed-quantity reaction or of a rate/quantity relationship in determining longevity (Loeb 1908; Rubner 1908; Robertson 1923; Pearl 1928); – attainment of a critical volume-surface relationship (Mühlmann 1910); – depletive theories relating senescence to reproduction (Orton 1929). The nineteenth century was also the epoch in which the concept of entropy (disorder of a system) and the general theorem that, in a closed system, the entropy could only increase were proposed. Consequently, by interpreting aging as a condition of greater organism disorder, the phenomenon was explained as the consequence of age-related necessarily growing disorder of the organism. This hypothesis disregarded the fact that any organism is not a closed system and can live only because it receives energy from the outside (plants from the light of the sun through photosynthesis, animals from plants and other animals, etc.). Therefore, an inevitable increase in entropy is not expected in living systems, and neither is a valid justification for aging. Yet, even today, someone tries to justify aging as being due to the inevitable increase in entropy. Hayflick (!) some years ago stated for sure: “There is a huge body of knowledge supporting the belief that age changes are characterized by increasing entropy, which results in the random loss of molecular fidelity, and accumulates to slowly overwhelm maintenance systems.” (Hayflick 2007). A different group of theories related aging to: – continuity of senescence with morphogenesis (Baer 1864; Roux 1881; Cholodkowsky 1882; Delage 1903; Warthin 1929); – cessation of somatic growth (Minot 1908; Carrel and Ebeling 1921b; Brody 1924; Bidder 1932; Lansing 1948, 1951) (Figs. 1.11 and 1.12).

1.4 A Short History of Aging Theories

15

Fig. 1.11 Charles Sedgwick Minot (1852–1914)

Fig. 1.12 George Parker Bidder III (1863–1953)

An example of how in this period the aging problem was addressed in “scientific terms” is as follows: “The Universe, by its very nature, demands mortality for the individual if the life of the species is to attain immortality through the ability to cope with the changing environment of successive ages. . . . It is evident that involution is a biologic entity equally important with evolution in the broad scheme of the immortal process of life. Its processes are as physiologic as those of growth. It is therefore inherent in the cell itself, an intrinsic, inherited quality of the germ plasm and no slur or stigma of pathologic should be cast upon this process. What its exact

16

1 Introduction

chemicophysical mechanism is will be known only when we know the nature of the energy-charge and the energy-release of the cell. We may say, therefore, that age, the major involution, is due primarily to the gradually weakening energy-charge set in action by the moment of fertilization, and is dependent upon the potential fulfilment of function by the organism. The immortality of the germ plasm rests upon the renewal of this energy charge from generation to generation.” (Warthin 1929) (reported in (Comfort 1979, p. 8)).

1.4.3

Aging Theories from the Second Half of the Twentieth Century to Today

In the second half of the twentieth century, the new idea was that the study of aging causes could not disregard the mechanisms of natural selection. Thus, some “evolutionary” theories of aging were proposed: – Mutation accumulation hypothesis. As at older ages few individuals survive, natural selection becomes increasingly weak. So harmful genes that act late in life are scarcely removed by natural selection and aging results from their combined effects (Medawar 1952; Hamilton 1966; Edney and Gill 1968; Mueller 1987; Partridge and Barton 1993) (Figs. 1.13 and 1.14). – Antagonistic pleiotropy hypothesis. It is hypothesized the existence of certain genes that are both advantageous during young or adult stage and disadvantageous at older ages. Therefore, they are only partially eliminated by natural selection and their effects at older ages are the cause of aging (Williams 1957; Rose 1991) (Figs. 1.15 and 1.16).

Fig. 1.13 Peter Brian Medawar (1915–1987)

1.4 A Short History of Aging Theories Fig. 1.14 Laurence D. Mueller

Fig. 1.15 George Cristopher Williams (1926–2010)

17

18

1 Introduction

Fig. 1.16 Michael R. Rose

Fig. 1.17 Thomas Burton L. Kirkwood (1951)

– Disposable soma hypothesis. The organism has limited energetic and metabolic resources. Therefore, the body, in the allocation of these limited resources, must divide them between the necessities of a greater reproductive capacity and those of a better efficiency of maintenance systems. The insufficiency of these systems jeopardizes the functions of the organism at older ages, and so the body (i.e., the soma) is sacrificed to meet the needs of reproduction. (Kirkwood 1977; Kirkwood and Holliday 1979) (Fig. 1.17). – Quasi-programmed senescence hypothesis (Blagosklonny 2006) (Fig. 1.18): “nature blindly selects for short-term benefits of robust developmental growth . . . aging is a wasteful and aimless continuation of developmental growth” (Blagosklonny 2013). This hypothesis appears to continue some aspects of

1.4 A Short History of Aging Theories

19

Fig. 1.18 Mikhail V. Blagosklonny

another previous theory that suggests a neuroendocrine mechanism of ageing, in particular a general hormonal imbalance due to a gradual alteration of the hypothalamic functions (Dilman 1971; Dilman and Anisimov 1979). In analogy to the Disposable soma hypothesis, it is likely that this alteration could not be eliminated from natural selection due to conflicting metabolic needs. These “evolutionary” theories of aging are united by the assumption that aging, as it is certainly harmful in individual terms, cannot be a result of natural selection like other characteristics of living beings. So, natural selection can only act against the factors that cause aging but for various reasons its action is weakened and curbed and therefore we get older. In the same period, however, other theories were proposed that explained aging as the result of natural selection at the supra-individual level. – In 1961, Aldo Carl Leopold, a botanist, proposed that aging increased the speed of evolutionary adaptability of a species: “. . . in plants senescence is a catalyst for evolutionary adaptability” (Leopold 1961). Leopold followed the hint of Weismann, again suggesting that aging favors evolution as it accelerates generation turnover. Besides, he proposed that aging was determined by specific mechanisms: “We can safely assume that there are some internal biological mechanisms which bring about decline in viability and increase in vulnerability in such populations.” (Leopold 1961). This is a clear definition of aging as a phenomenon genetically determined and programmed. – In 1988 (anticipated in 1983 in a non-peer reviewed book (Libertini 1983)), a theory was proposed that explained aging as an adaptive phenomenon. According to this hypothesis, aging was favored by natural supra-individual selection, in

20

1 Introduction

Fig. 1.19 Giacinto Libertini

Fig. 1.20 Justin M. Travis

terms of kin selection, in particular ecological conditions (spatially structured populations and K-selection) (Libertini 1988) (Fig. 1.19). This hypothesis was later reaffirmed and, among other things, for the first time, an inverse relationship between the proportion of senescent deaths and the extrinsic mortality was predicted (Libertini 2006, 2008, 2009, 2013). – In 2004 and afterward, other authors proposed theories that pointed out an evolutionary advantage for aging in spatially structured populations (Travis 2004; Martins 2011; Yang 2013; Mitteldorf and Martins 2014) (Figs. 1.20, 1.21 and 1.22). – Following Weismann’s insight, Goldsmith proposed that aging is favored by natural selection because it increases the speed of evolution, or evolvability (Goldsmith 2004, 2008) (Fig. 1.23).

1.4 A Short History of Aging Theories Fig. 1.21 Andrè C. Martins

Fig. 1.22 Josh Mitteldorf

Fig. 1.23 Theodore C. Goldsmith

21

22

1 Introduction

Fig. 1.24 Vladimir Skulachev

– Consistently with the idea of aging as a programmed phenomenon favored by natural selection, the damage induced by mitochondrial reactive oxygen species (mtROS) was proposed as a pivotal mechanism (Skulachev 1999a, 2001; Skulachev and Longo 2005). The same Skulachev (Fig. 1.24) in 1997 defined aging as a form of “phenoptosis”, a neologism indicating the cases of programmed death determined by the same organism (Skulachev 1997, 1999b), and a few years later defined more precisely aging as “slow phenoptosis” (Skulachev 2002). – In 2009, a theory proposed that aging was an adaptation to limit the spread of diseases by a mechanism that was analogous to the Red Queen hypothesis on the adaptive meaning of sex (Mitteldorf and Pepper 2009). In 2008, it was pointed out that there were some common logical predictions for all programmed aging theories. In fact, they predicted (i) the existence of non-aging species, i.e., without any age-related increase of mortality; (ii) in the comparison among different species, an inverse relation between the proportion of senescent deaths and extrinsic mortality; and (iii) the existence of specific, genetically determined and modulated, mechanisms that caused aging. It was also pointed out that these predictions were in clear contrast with those of non-programmed aging theories (Libertini 2008). In this same period theories classifiable in the group of Damage Accumulation hypotheses and that disregard the mechanisms of natural selection continued to be proposed. According to these theories, in a summary list, aging is due to: – accumulation of chemical damage due to DNA transcription errors (Weinert and Timiras 2003); – deleterious effects of oxidation (Molnár 1972);

1.4 A Short History of Aging Theories

23

Fig. 1.25 Denham Harman (1916–2014)

Fig. 1.26 Claudio Franceschi

– oxidative effects of free radicals on the whole body (Harman 1956; Croteau and Bohr 1997; Beckman and Ames 1998; Oliveira et al. 2010) (Fig. 1.25); – oxidative effects of free radicals on the mitochondria (Harman 1972; Miquel et al. 1980; Trifunovic et al. 2004; Balaban et al. 2005; Sanz and Stefanatos 2008); – oxidative effects of free radicals on the DNA (Bohr and Anson 1995; Weinert and Timiras 2003); – inflammatory phenomena (“inflamm-aging”) and immunological alterations related to age (Franceschi et al. 2000; Fülöp et al. 2014; Fülöp 2017; Franceschi et al. 2018) (Figs. 1.26 and 1.27), which characterize aging. They were explained not as consequences but as causes of aging.

24

1 Introduction

Fig. 1.27 Tamas Fülöp

1.4.4

Classification of Aging Theories

The theories that try to explain the causes of aging (Comfort 1979; Medvedev 1990; Weinert and Timiras 2003; Libertini 2015) may be divided in: (A) non-evolutionary; and (B) evolutionary theories, according to the non-consideration or consideration of natural selection as a possible factor that could influence or determine the aging. A second division is between: (C) non-programmed or non-adaptive aging theories; and (D) programmed or adaptive aging theories. For the theories of the first group (C), aging is due to damaging or degenerative phenomena that natural selection cannot oppose with sufficient strength. So aging is considered as a failure of natural selection. On the contrary, for the theories of the second group (D), aging, although harmful to the individual, is favored by supra-individual natural selection. Therefore, aging, since it is forged by natural selection, must be determined by mechanisms that are genetically determined and modulated and must be considered as a success of evolution. The theories of group C (non-adaptive theories) include the whole group A (non-evolutionary theories) and part of group B (evolutionary theories), while the theories of the group D (adaptive theories) are all within the group B (evolutionary theories) (see a schematization in Fig. 1.28). While the distinction between theories of the groups A and B (non-evolutionary and evolutionary theories) is not always clear-cut, the distinction between the group C and D is reliable and complete, as they have opposite premises and outcomes and

References

25

Fig. 1.28 Schematic classification of aging theories

there is no possible form of compromise. Therefore these two opposite types of interpretations of the aging phenomenon deserve the definition of opposite paradigms (Libertini 2009), in the meaning of the term defined by Kuhn (1962).

References Bab, H. (1948). The process of ageing. British Medical Journal, 1(4559), 1000–1001. Baer, K. E. (1864). Reden gehalten in wissenschaftlichen Versammlungen. St. Petersburg: Karl Röttger. Balaban, R. S., Nemoto, S., & Finkel, T. (2005). Mitochondria, oxidants, and aging. Cell, 120(4), 483–495. https://doi.org/10.1016/j.cell.2005.02.001. Bauer, E. (1924). Beiträge zum Studium der Protoplasmahysteresis und der hysteretischen Vorgänge. (Zur Kausalität des Alterns.). Archiv für Mikroskopische Anatomie und Entwicklungsmechanik, 101(4), 521–527. https://doi.org/10.1007/BF02108093. Beckman, K. B., & Ames, B. N. (1998). The free radical theory of aging matures. Physiological Reviews, 78(2), 547–581. https://doi.org/10.1152/physrev.1998.78.2.547. Bergauer, V. (1924). Beiträge zum Studium der Protoplasmahysteresis und der hysteretischen Vorgänge. (Zur Kausalität des Alterns.). Archiv für Mikroskopische Anatomie und Entwicklungsmechanik, 101(4), 489–498. https://doi.org/10.1007/BF02108088. Berry, R. J., & Bronson, F. H. (1992). Life history and bioeconomy of the house mouse. Biological Reviews of the Cambridge Philosophical Society, 67(4), 519–550. https://doi.org/10.1111/j. 1469-185x.1992.tb01192.x.

26

1 Introduction

Bidder, G. P. (1932). Senescence. British Medical Journal, 2(3742), 583–585. https://doi.org/10. 1136/bmj.2.3742.583. Blagosklonny, M. V. (2006). Aging and immortality: Quasi-programmed senescence and its pharmacologic inhibition. Cell Cycle, 5(18), 2087–2102. https://doi.org/10.4161/cc.5.18.3288. Blagosklonny, M. V. (2013). MTOR-driven quasi-programmed aging as a disposable soma theory: Blind watchmaker vs. intelligent designer. Cell Cycle, 12(12), 1842–1847. https://doi.org/10. 4161/cc.25062. Bogomolets, A. A. (1947). The prolongation of life. New York: Duell Sloan and Pearce. Bohr, V. A., & Anson, R. M. (1995). DNA damage, mutation and fine structure DNA repair in aging. Mutation Research, 338(1–6), 25–34. https://doi.org/10.1016/0921-8734(95)00008-t. Brody, S. (1924). The kinetics of senescence. The Journal of General Physiology, 6, 245–257. Bürger, M. (1954). Altern und Krankheit. Berlin: G. Thieme. Carrel, A. (1912). On the permanent life of tissue outside of the organism. Journal of Experimental Medicine, 15(5), 516–528. https://doi.org/10.1084/jem.15.5.516. Carrel, A. (1913). Contributions to the study of the mechanism of the growth of connective tissue. Journal of Experimental Medicine, 18(3), 287–298. https://doi.org/10.1084/jem.18.3.287. Carrel, A., & Ebeling, A. H. (1921a). Age and multiplication of fibroblasts. Journal of Experimental Medicine, 34(6), 599–623. https://doi.org/10.1084/jem.34.6.599. Carrel, A., & Ebeling, A. H. (1921b). Antagonistic growth principles of serum and their relation to old age. The Journal of Experimental Medicine, 38(4), 419–425. https://doi.org/10.1084/jem. 38.4.419. Cholodkowsky, T. (1882). Unsterblichkeit in der Tierwelt. Zoologischer Anzeiger, 5, 264. Comfort, A. (1979). The biology of senescence. London: Livingstone. Croteau, D. L., & Bohr, V. A. (1997). Repair of oxidative damage to nuclear and mitochondrial DNA in mammalian cells. The Journal of Biological Chemistry, 272(41), 25409–25412. https:// doi.org/10.1074/jbc.272.41.25409. Darányi, G. (1930). Fejlödés, fajfenntartás és öregedés természetben. Term Tud Közl, 62, 305–313. Darwin, C. R. (1859). On the origin of species by means of natural selection, or the preservation 1of the favoured races in the struggle for life. London: John Murray. Darwin, C. R. (1869). Origin of species (5th ed.). London: John Murray. Darwin, C. R. (1871). The descent of man, and selection in relation to sex. London: John Murray. Deevey, E. S., Jr. (1947). Life tables for natural populations of animals. The Quarterly Review of Biology, 22(4), 283–314. www.journals.uchicago.edu/doi/abs/10.1086/395888? journalCode¼qrb. Delage, Y. (1903). L’Hérédité et Les Grandes Problèmes de la Biologie générale. Paris: Schleicher Frères. Demange, E. (1886). Études cliniques et anatomo-pathologiques sur la vieillesse: leçons faites à l’Hospice Saint-Julien. Paris: Alcan. Dhar, N. R. (1932). Senescence, an inherent property of animal cells. The Quarterly Review of Biology, 7(1), 68–76. www.journals.uchicago.edu/doi/abs/10.1086/394397?journalCode¼qrb. Dilman, V. M. (1971). Age-associated elevation of hypothalamic, threshold to feedback control, and its role in development, ageine, and disease. Lancet, 1(7711), 1211–1219. https://doi.org/ 10.1016/s0140-6736(71)91721-1. Dilman, V. M., & Anisimov, V. N. (1979). Hypothalmic mechanisms of ageing and of specific age pathology--I. sensitivity threshold of hypothalamo-pituitary complex to homeostatic stimuli in the reproductive system. Experimental Gerontology, 14(4), 161–174. https://doi.org/10.1016/ 0531-5565(79)90015-9. Dobzhansky, T. (1973). Nothing in biology makes sense except in the light of evolution. The American Biology Teacher, 35(3), 125–129. Driesch, H. (1941). Zur Problematik des Alterns. Zeitschrift für Naturforschung, 3, 26–43. Dunn, C. W. (1946). Endocrines in senescence. Clinics (Phil), 5(4), 847–859. Edney, E. B., & Gill, R. W. (1968). Evolution of senescence and specific longevity. Nature, 220 (5164), 281–282. https://doi.org/10.1038/220281a0.

References

27

Finch, C. E. (1990). Longevity, senescence, and the genome. Chicago: University of Chicago Press. Findley, T. (1949). Role of neurohypophysis in the pathogenesis of hypertension and some allied disorders associated with ageing. The American Journal of Medicine, 7(1), 70–84. https://doi. org/10.1016/0002-9343(49)90484-2. Fontaneda, H. D. (1575). Memoir of D.oHernando D’Escalente Fontaneda respecting Florida. Fontaneda’s Memoir, translation by Buckingham Smith (1854), Jerry Wilkinson, Keys (FL). Franceschi, C., Bonafè, M., Valensin, S., Olivieri, F., De Luca, M., Ottaviani, E., & De Benedictis, G. (2000). Inflamm-aging. An evolutionary perspective on immunosenescence. Annals of the New York Academy of Sciences, 908, 244–254. https://doi.org/10.1111/j.1749-6632.2000. tb06651.x. Franceschi, C., Garagnani, P., Morsiani, C., Conte, M., Santoro, A., Grignolio, A., Monti, D., Capri, M., & Salvioli, S. (2018). The continuum of aging and age-related diseases: Common mechanisms but different rates. Front Med (Lausanne), 5, 61. https://doi.org/10.3389/fmed.2018. 00061. Fülöp, T. (2017). Immunosenescence and inflammaging: An intricate connection. Innovation in Aging, 1(Suppl 1), 961. https://doi.org/10.1093/geroni/igx004.3465. Fülöp, T., Witkowski, J. M., Pawelec, G., Alan, C., & Larbi, A. (2014). On the immunological theory of aging. Interdisciplinary Topics in Gerontology, 39, 163–176. https://doi.org/10.1159/ 000358904. Georgiana, M. (1949). Longevity of the parasitic wasp, Habrobracon uglandis Ashmead. The American Naturalist, 83(808), 39–48. www.journals.uchicago.edu/doi/abs/10.1086/281591. Gley, E. (1922). Senescence et endocrinologie. Bulletin de L’Académie Nationale de Médecine, 87, 285–291. Goldsmith, T. C. (2004). Aging as an evolved characteristic – Weismann’s theory reconsidered. Medical Hypotheses, 62(2), 304–308. https://doi.org/10.1016/S0306-9877(03)00337-2. Goldsmith, T. C. (2008). Aging, evolvability, and the individual benefit requirement; medical implications of aging theory controversies. Journal of Theoretical Biology, 252(4), 764–768. https://doi.org/10.1016/j.jtbi.2008.02.035. Griffiths, T. R. (1973). A new unifying theory for the initiation of aging mechanisms and processes. Mechanisms of Ageing and Development, 2(4), 295–307. https://doi.org/10.1016/0047-6374 (73)90024-9. Hakh, I. W., & Westling, E. H. (1934). A possible cause of old age. Science, 79(2045), 231. https:// doi.org/10.1126/science.79.2045.231. Hamilton, W. D. (1966). The moulding of senescence by natural selection. Journal of Theoretical Biology, 12(1), 12–45. https://doi.org/10.1016/0022-5193(66)90184-6. Harman, D. (1956). Aging: A theory based on free radical and radiation chemistry. Journal of Gerontology, 11(3), 298–300. https://doi.org/10.1093/geronj/11.3.298. Harman, D. (1972). The biologic clock: The mitochondria? Journal of the American Geriatrics Society, 20(4), 145–147. https://doi.org/10.1111/j.1532-5415.1972.tb00787.x. Hayflick, L. (1965). The limited in vitro lifetime of human diploid cell strains. Experimental Cell Research, 37, 614–636. https://doi.org/10.1016/0014-4827(65)90211-9. Hayflick, L. (2000). The future of ageing. Nature, 408(6809), 267–269. https://doi.org/10.1038/ 35041709. Hayflick, L. (2007). Entropy explains aging, genetic determinism explains longevity, and undefined terminology explains misunderstanding both. PLoS Genetics, 3(12), e220. https://doi.org/10. 1371/journal.pgen.0030220. Hayflick, L., & Moorhead, P. S. (1961). The serial cultivation of human diploid cell strains. Experimental Cell Research, 25, 585–621. https://doi.org/10.1016/0014-4827(61)90192-6. Heilbrunn, L. V. (1943). An outline of general physiology (2nd ed.). Philadelphia/London: W. B. Saunders. Hill, K., & Hurtado, A. M. (1996). Ache life history. New York: Aldine De Gruyter.

28

1 Introduction

Holmes, D. J., & Austad, S. N. (1995). Birds as animal models for the comparative biology of aging: A prospectus. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 50(2), B59–B66. https://doi.org/10.1093/gerona/50a.2.b59. Jickeli, C. F. (1902). Die Unvollkommenheit des Stoffwechsels als Veranlassung für Vermehrung, Wachstum, Differenzierung, Rückbildung und Tod der Lebewesen im Kampf ums Dasein. Berlin: Friedländer. Kassowitz, M. (1899). Allgemeine Biologie. Wien: M. Perles. Kirkwood, T. B. (1977). Evolution of ageing. Nature, 270(5635), 301–304. https://doi.org/10.1038/ 270301a0. Kirkwood, T. B., & Austad, S. N. (2000). Why do we age? Nature, 408(6809), 233–238. https://doi. org/10.1038/35041682. Kirkwood, T. B., & Cremer, T. (1982). Cytogerontology since 1881: A reappraisal of august Weissmann and a review of modern progress. Human Genetics, 60(2), 101–121. https://doi. org/10.1007/bf00569695. Kirkwood, T. B., & Holliday, R. (1979). The evolution of ageing and longevity. Proceedings of the Royal Society of London – Series B: Biological Sciences, 205(1161), 531–546. https://doi.org/ 10.1098/rspb.1979.0083. Kopaczewski, W. (1938). Problème de vieillissement: recherches sur les colloides. Protoplasma, 30 (1), 291–308. Kuhn, T. S. (1962). The structure of scientific revolutions. Chicago: The University of Chicago Press. Lack, D. (1954). The natural regulation of animal numbers. Oxford: Clarendon Press. Lansing, A. I. (1942). Some effects of hydrogen ion concentration, total salt concentration, calcium and citrate on longevity and fecundity in the rotifer. Journal of Experimental Zoology, 91(2), 195–211. https://doi.org/10.1002/jez.1400910206. Lansing, A. I. (1948). Evidence for aging as a consequence of growth cessation. Proceedings of the National Academy of Sciences of the United States of America, 34, 304–310. https://doi.org/10. 1073/pnas.34.6.304. Lansing, A. I. (1951). Some physiological aspects of ageing. Physiological Reviews, 31(3), 274–284. https://doi.org/10.1152/physrev.1951.31.3.274. Laws, R. M. (1966). Age criteria for the African elephant, Loxodonta a. africana. African Journal of Wildlife Research, 4(1), 1–37. https://doi.org/10.1111/j.1365-2028.1966.tb00878.x. Laws, R. M. (1968). Dentition and ageing of the hippopotamus. African Journal of Wildlife Research, 6(1), 19–52. https://doi.org/10.1111/j.1365-2028.1968.tb00899.x. Leopold, A. C. (1961). Senescence in plant development. Science, 134(3492), 1727–1732. https:// doi.org/10.1126/science.134.3492.1727. Lepeschkin, W. W. (1931). Death and its causes. The Quarterly Review of Biology, 6(2), 167–177. www.journals.uchicago.edu/doi/abs/10.1086/394375?journalCode¼qrb. Libertini, G. (1983). Ragionamenti evoluzionistici [Book in Italian]. Naples: Società Editrice Napoletana. English edition (2011): Evolutionary arguments on aging, disease, and other topics. Azinet Press, Crownsville (MD). Libertini, G. (1988). An adaptive theory of the increasing mortality with increasing chronological age in populations in the wild. Journal of Theoretical Biology, 132(2), 145–162. https://doi.org/ 10.1016/s0022-5193(88)80153-x. Libertini, G. (2006). Evolutionary explanations of the “actuarial senescence in the wild” and of the “state of senility”. ScientificWorldJournal, 6, 1086–1108. https://doi.org/10.1100/tsw.2006. 209. Libertini, G. (2008). Empirical evidence for various evolutionary hypotheses on species demonstrating increasing mortality with increasing chronological age in the wild. ScientificWorldJournal, 8, 183–193. https://doi.org/10.1100/tsw.2008.36. Libertini, G. (2009). The role of telomere-telomerase system in age-related fitness decline, a tameable process. In L. Mancini (Ed.), Telomeres: Function, shortening and lengthening (pp. 77–132). New York: Nova Science Publ.

References

29

Libertini, G. (2013). Evidence for aging theories from the study of a hunter-gatherer people (Ache of Paraguay). Biochemistry (Mosc), 78(9), 1023–1032. https://doi.org/10.1134/ S0006297913090083. Libertini, G. (2015). Non-programmed versus programmed aging paradigm. Current Aging Science, 8(1), 56–68. https://doi.org/10.2174/1874609808666150422111623. Loeb, J. (1908). Über den Temperaturkoeffizienten für die Lebensdauer kaltblütiger Tiere und über die Ursache des natürlichen Todes. Pflügers Archiv, 124(6–8), 411–426. Lorand, A. (1904). Quelques considérations sur les causes de sénilité. C R Social Biology (Paris), 57, 500–507. Lorand, A. (1929). Le rôle de l’auto-intoxication intestinale dans la production de la vieillesse. Clinique (Paris, France), 24, 205–207. Marinesco, G. (1934). Nouvelle contribution à l’étude du mécanisme de la vieillesse. Bulletin of Academic Médicine (Paris), 1(1), 761–772. Martins, A. C. (2011). Change and aging senescence as an adaptation. PLoS One, 6(9), e24328. https://doi.org/10.1371/journal.pone.0024328. Medawar, P. B. (1952). An unsolved problem in biology. London: H. K. Lewis. Reprinted in: Medawar PB (1957) The uniqueness of the individual. Methuen, London. Medvedev, Z. A. (1990). An attempt at a rational classification of theories of ageing. Biological Reviews of the Cambridge Philosophical Society, 65(3), 375–398. https://doi.org/10.1111/j. 1469-185x.1990.tb01428.x. Metalnikov, S. (1937). La lutte contre la mort. Paris: Gallimard. Metchnikoff, E. (1904). The nature of man. London: Heinemann. Metchnikoff, E. (1907). The prolongation of life – Optimistic studies. London: Heinemann. Minot, C. S. (1908). The problem of age, growth, and death; A study of cytomorphosis, based on lectures at the Lowell Institute, March 1907, London (1913). Moderne Probleme der Biologie, Jena. Miquel, J., Economos, A. C., Fleming, J., & Johnson, J. E., Jr. (1980). Mitochondrial role in cell aging. Experimental Gerontology, 15(6), 575–591. https://doi.org/10.1016/0531-5565(80) 90010-8. Mitteldorf, J., & Martins, A. C. (2014). Programmed life span in the context of evolvability. The American Naturalist, 184(3), 289–302. https://doi.org/10.1086/677387. Mitteldorf, J., & Pepper, J. (2009). Senescence as an adaptation to limit the spread of disease. Journal of Theoretical Biology, 260(2), 186–195. https://doi.org/10.1016/j.jtbi.2009.05.013. Molisch, H. (1938). The longevity of plants. New York: Botanical Garden. Molnár, K. (1972). Subbiological aspects of aging and the concept of cathode protection. Mechanisms of Ageing and Development, 1, 319–326. https://doi.org/10.1016/0047-6374(72)90077-2. Montgomery, T. H. (1906). On reproduction, animal life cycles and the biological unit. Transaction of Texas Academic Science, 9. Mueller, L. D. (1987). Evolution of accelerated senescence in laboratory populations of Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 84(7), 1974–1977. https://doi.org/10.1073/pnas.84.7.1974. Mühlmann, M. S. (1900). Über die Ursache des Alterns. Wiesbaden: Bergman. Mühlmann, M. S. (1910). Das Altern und der physiologische Tod. Samml Anat Physiol Vortr, 1, 455. Mühlmann, M. S. (1924). Meine Theorie des Alterns und des Todes; zugleich zur Abwehr. Virchows Archiv, 253, 225–238. Mühlmann, M. S. (1927). Wachstum, Altern und Tod. Über die Ursache des Alterns und des Todes. Ergcb Anat EntwGesch (Anat Abt), 27, 1. Nesse, R. M. (2008). The importance of evolution for medicine. In W. R. Trevathan, E. O. Smith, & J. J. McKenna (Eds.), Evolutionary medicine and health: New perspectives (pp. 416–431). New York: Oxford University Press.

30

1 Introduction

Nussey, D. H., Froy, H., Lemaitre, J. F., Gaillard, J. M., & Austad, S. N. (2013). Senescence in natural populations of animals: Widespread evidence and its implications for bio-gerontology. Ageing Research Reviews, 12(1), 214–225. https://doi.org/10.1016/j.arr.2012.07.004. Oliveira, B. F., Nogueira-Machado, J.-A., & Chaves, M. M. (2010). The role of oxidative stress in the aging process. TheScientificWorld Journal, 10, 1121–1128. https://doi.org/10.1100/tsw. 2010.94. Orton, J. H. (1929). Reproduction and death in invertebrates and fishes. Nature, 123(3088), 14–15. Parhon, C. I. (1955). Biologia vîrstelor; cercetări clinice şi experimentale. Bucharest: Editura Academiei Republicii Populare Romîne. Partridge, L., & Barton, N. H. (1993). Optimality, mutation and the evolution of ageing. Nature, 362(6418), 305–311. https://doi.org/10.1038/362305a0. Pearl, R. (1928). The rate of living. New York: Knopf. Ribbert, H. (1908). Der Tod aus Altersschwäche. Bonn: Cohen. Ricklefs, R. E. (1998). Evolutionary theories of aging: Confirmation of a fundamental prediction, with implications for the genetic basis and evolution of life span. The American Naturalist, 152 (1), 24–44. https://doi.org/10.1086/286147. Robertson, T. B. (1923). The chemical basis of growth and senescence. Philadelphia: Lippincott. Rockstein, M., Chesky, J. A., & Sussman, M. (1977). Comparative biology and evolution of aging. In C. E. Finch & L. Hayflick (Eds.), Handbook of the biology of aging (pp. 3–34). New York: Van Nostrand Reinhold Company. Rose, M. R. (1991). Evolutionary biology of aging. Oxford: Oxford University Press. Roux, W. (1881). Der Kampf der Teile im Organismus. Leipzig: Engelmann. Rubner, M. (1908). Probleme des Wachstums und der Lebensdauer. Mitt Ges Inn Med (Wien), 7, 58–81. Růžická, V. (1924). Beiträge zum Studium der Protoplasmahysteresis und der hysteretischen Vorgänge (Zur Kausalität des Alterns). Arch Mikr Anat Entw, 101(4), 459–482. Růžická, V. (1929). Beiträge zum Studium der Protoplasmahysteresis und der hysteretischen Vorgänge (Zur Kausalität des Alterns). Arch EntwMeck Org, 116(1), 104–122. Sanz, A., & Stefanatos, R. K. (2008). The mitochondrial free radical theory of aging: A critical view. Current Aging Science, 1(1), 10–21. https://doi.org/10.2174/1874609810801010010. Skulachev, V. P. (1997). Aging is a specific biological function rather than the result of a disorder in complex living systems: Biochemical evidence in support of Weismann’s hypothesis. Biochemistry (Mosc), 62(11), 1191–1195. http://protein.bio.msu.ru/biokhimiya/contents/v62/full/ 62111394.html. Skulachev, V. P. (1999a). Mitochondrial physiology and pathology; concepts of programmed death of organelles, cells and organisms. Molecular Aspects of Medicine, 20(3), 139–184. https://doi. org/10.1016/s0098-2997(99)00008-4. Skulachev, V. P. (1999b). Phenoptosis: Programmed death of an organism. Biochemistry (Mosc), 64(12), 1418–1426. http://protein.bio.msu.ru/biokhimiya/contents/v64/full/64121679.html. Skulachev, V. P. (2001). The programmed death phenomena, aging, and the samurai law of biology. Experimental Gerontology, 36(7), 995–1024. https://doi.org/10.1016/s0531-5565(01) 00109-7. Skulachev, V. P. (2002). Programmed death phenomena: From organelle to organism. Annals of the New York Academy of Sciences, 959, 214–237. https://doi.org/10.1111/j.1749-6632.2002. tb02095.x. Skulachev, V. P., & Longo, V. D. (2005). Aging as a mitochondria-mediated atavistic program: Can aging be switched off? Annals of the New York Academy of Sciences, 1057, 145–164. https:// doi.org/10.1196/annals.1356.009. Spencer, H. (1864). The principles of biology. London: Williams and Norgate. Spinage, C. A. (1970). Population dynamics of the Uganda Defassa Waterbuck (Kobus defassa Ugandae Neumann) in the Queen Elizabeth park, Uganda. The Journal of Animal Ecology, 39 (1), 51–78. www.jstor.org/stable/2889?seq¼1.

References

31

Spinage, C. A. (1972). African ungulate life tables. Ecology, 53(4), 645–652. https://doi.org/10. 2307/1934778. Stearns, S. C., & Koella, J. C. (Eds.). (2008). Evolution in health and disease (2nd ed.). New York: Oxford University Press. Szabó, I. (1931). The three types of mortality curves. Quart Rev Biol, 6(4), 462–463. www.journals. uchicago.edu/doi/abs/10.1086/394390?journalCode¼qrb. Travis, J. M. (2004). The evolution of programmed death in a spatially structured population. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 59(4), 301–305. https://doi.org/10.1093/gerona/59.4.b301. Trevathan, W. R., McKenna, J. J., & Smith, E. O. (Eds.). (1999). Evolutionary medicine. New York: Oxford University Press. Trevathan, W. R., Smith, E. O., & McKenna, J. J. (Eds.). (2008). Evolutionary medicine and health: New perspectives. New York: Oxford University Press. Trifunovic, A., Wredenberg, A., Falkenberg, M., Spelbrink, J. N., Rovio, A. T., Bruder, C. E., Bohlooly-Y, M., Gidlöf, S., Oldfors, A., Wibom, R., Törnell, J., Jacobs, H. T., & Larsson, N. G. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature, 429(6990), 417–423. https://doi.org/10.1038/nature02517. Varki, A. (2012). Nothing in medicine makes sense, except in the light of evolution. Journal of Molecular Medicine (Berlin, Germany), 90(5), 481–494. https://doi.org/10.1007/s00109-0120900-5. Vogt, C., & Vogt, O. (1946). Age changes in neurones. Nature (Lond), 158, 304. Wallace, A. R. (1865–1870). The action of natural selection in producing old age, decay and death [A note by Wallace written “some time between 1865 and 1870”]. In Weismann A. (Ed.), (1889, 1st ed. 1889, 2nd ed. 1891). English translation: E. B. Poulton, S. Schonland, & A. E. Shipley (Eds.), Essays upon heredity and kindred biological problems (Vol. I). Oxford (UK): Clarendon Press. Warthin, A. S. (1929). Old age, the major involution; the physiology and pathology of the ageing process. New York: Hoeber. Weinert, B. T., & Timiras, P. S. (2003). Invited review: Theories of aging. Journal of Applied Physiology, 95(4), 1706–1716. https://doi.org/10.1152/japplphysiol.00288.2003. Weismann A (1882) Über die Dauer des Lebens. Jena. Weismann A (1889; 1st ed. 1889, 2nd ed. 1891). English translation: In E. B. Poulton, S. Schonland, & A. E. Shipley (Eds.), Essays upon heredity and kindred biological problems (Vol. I). Oxford: Clarendon Press. Weismann, A. (1892). Essays upon heredity and kindred biological problems (Vol. II). Oxford: Clarendon Press. Williams, G. C. (1957). Pleiotropy, natural selection and the evolution of senescence. Evolution, 11, 398–411. https://doi.org/10.2307/2406060. Yang, J. N. (2013). Viscous populations evolve altruistic programmed ageing in ability conflict in a changing environment. Evolutionary Ecology Research, 15, 527–543.

Chapter 2

Evolution and Phenoptosis

2.1

Darwinian Definition of Natural Selection

As aging is certainly harmful to the senescent individual, any hypothesis of an adaptive explanation for aging is in evident contrast with the idea of evolution conceived exclusively as “survival of the fittest” (Darwin 1869). Therefore, it is necessary first to define clearly the concept of “survival of the fittest” and then to emphasize how the idea of supra-individual forms of natural selection makes this concept only a particular case in a more general frame that is compatible with the hypothesis of an adaptive significance of aging. According to Darwin, the evolution of a species is determined by the mechanism of natural selection for which characters determining a higher capacity to survive (i.e., fitness), according to their own definition, allow greater survival for the individuals who have them (Darwin 1859). In modern terms, with the knowledge that the characters of an individual are determined by genes and that the general mechanism of evolution is based on frequency variations of genes and of their variants generated by mutations and other mechanisms, a general formula that shows these frequency variations between one generation and the next, can be the following: Δc / S  P

ð2:1Þ

where: Δc ¼ frequency variation between one generation and the next of a gene C that acts in the individual I; S ¼ advantage/disadvantage (i.e., greater/smaller fitness) for I caused by the gene C; P ¼ residual capacity for reproduction of I at the age when the gene manifests its action (reproductive value).

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0_2

33

34

2.2

2 Evolution and Phenoptosis

Supra-Individual Selection

The natural selection described as “survival of the fittest” individuals, an expression proposed by Spencer (Spencer 1864) and later adopted by Darwin (Darwin 1869), can easily be extended to characters that allow greater reproduction and survival of the offspring (Darwin 1859). However, with this extension, the concept of natural selection that is limited to the idea of individual greater fitness appears incomplete and unsatisfactory. In fact, the case of individuals who transfer part of their energies to newborns (e.g., breastfeeding them) or reduce the possibilities of their survival to increase those of the offspring (e.g., defending them from attacks by others) is not included in the aforementioned formula (2.1) and in the concept from which it derives. A different, broader definition is therefore needed that takes into account the effects of a character not only on the survival of the individual in which the character acts but also on other genetically related individuals (offspring in the first place, but not exclusively). In other words, concerning the genes determining a character, instead of considering only the survival of the individual I where the genes act (i.e., with S regarding only I), it is necessary to consider also the effects of these genes on all the individuals that are genetically related to I, with S that must include the sum of all advantages/ disadvantages both for I and for all individuals related to I. The idea that natural selection could favor characters that are harmful to the individual was not excluded by the Darwinian concept of evolution, as the same Darwin proposed about the possible sacrifice of members of a tribe for its victory or survival (Darwin 1871). However, Darwin did not underline that this was not the same as the concept of “survival of the fittest” individuals. Much later, this inconsistency was solved by the introduction of the idea of “inclusive fitness” (Hamilton 1964, 1970; Trivers 1971; Wilson 1975). By using this concept, the calculation of natural selection considers both the individual I (I1) where a gene C acts and all the individuals genetically related to I (I2, I3, ...) for which the actions of a gene C have any consequence for the survival capacity. Therefore, the frequency variations of the gene C between one generation and the next is described by the formula: Δc /

n X

ð Sx  P x  r x Þ

ð2:2Þ

x¼1

where: n ¼ number of individuals IX (I1, I2, I3, ..., In) genetically related to I1 for which the actions of the gene C have any effect; Sx ¼ advantage/disadvantage (¼ higher/ smaller fitness) for the individual Ix; Px ¼ reproductive value of an individual Ix at the age when the gene C acts; rx ¼ coefficient of relationship between individual Ix and individual I1.

2.2 Supra-Individual Selection

35

Gene C is favored by natural selection (i.e., increases its frequency) when the summation is greater than 0, and the contrary happens when the summation is less than zero. When the gene C acts only on individual I1, as by definition r1 ¼ 1, the formula (2.2) becomes: Δc / S1  P1

ð2:3Þ

which is identical to the formula (2.1). In particular cases, the distinction between kin selection and group selection disappears. E.g., let us consider a species divided into sub-populations (demes), each of them consisting of individuals that are closely related or even have a monoclonal origin. Now, limiting the discussion to monoclonal demes, let us consider a catastrophic event where: – if there is no individual sacrifice, there is a disadvantage for every individual equal to –S; – on the contrary, if, by the action of a gene C, among n individuals having the C gene, some (nd) sacrifice themselves and die (Sd ¼ 1) while the survivors (ns) enjoy an advantage Ss. As in a monoclonal deme rx is always equal to 1 (and disregarding, for simplicity, the reproductive value that is considered equal for all individuals), the C gene will be favored by natural selection if: nd X

nS X

SS > ðSÞ  n

ð2:4Þ

nd  ðSd Þ þ ns  Ss > ðSÞ  n

ð2:5Þ

x¼1

ðSd Þ þ

x¼1

that is:

formula that is a development of (2.2). Now, let us consider the case of a deme consisting of several monoclonal group of individuals (1, 2, .... Z). If C exists in the individuals of clone 1, it will exist in a clone X with a probability equal to the coefficient of kinship of clone X with clone 1 (rx), and the gene C will be favoured by selection if: ½n1,d  ðSd Þ þ n1,s  Ss  þ ½n2,d  r 2  ðSd Þ þ n2,s  r 2  Ss  . . . : þ ½nz,d  rz  ðSd Þ þ nz,s  r z  Ss  > ðSÞ  n

ð2:6Þ

where, in a clone X, nx,d are the individuals that sacrifice themselves and nx,s the survivors (Libertini 2015b).

36

2 Evolution and Phenoptosis

It should be noted that kin selection formula (2.2), which is a general formula that includes also the cases of individual selection, is shown by the last two formulas to be equivalent to particular types of group selection. This means that there is no sharp distinction between individual selection, kin selection and group selection. The kin selection formula explains many unselfish and selfish behaviors, including the parental care and the cases of many species where reproduction is associated with parental death. However, the concept of inclusive fitness/kin selection is not an alternative to the Darwinian classic interpretation of natural selection. Instead, it is a more complete formulation of it, which includes the classic case of the diffusion of a gene C that increases the individual fitness of I without effects on other related individuals. For decades, the concept of inclusive fitness has been used to explain also the eusociality of many Hymenoptera species like ants, wasps and bees, in particular by using the “haplodiploidy hypothesis” (Wilson 1975). However: – formulas based on kin selection become tangled and very difficult when it is necessary to consider multiple synergistic effects among many individuals; – there is eusociality in many non-haplodiploid species (e.g., termites) and “The association between haplodiploidy and eusociality fell below statistical significance.” (Nowak et al. 2010); – “... standard natural selection theory in the context of precise models of population structure represents a simpler and superior approach ...” (Nowak et al. 2010). This highlights the limits of the kin selection approach but also the possibilities of using other population models to explain particular forms of group selection, where supra-individual advantages prevail on individual advantage, as in the interpretation of eusociality. Kin selection concept and opportune population models where supra-individual selection is considered, models that are not described, deepened or discussed here, provide us with ideas that constitute an extension of the classic Darwinian natural selection: – A formula such as (2.1), which describes natural selection only at the individual level, does not in any way justify the existence of a gene whose action is damaging for the individual where the gene acts; – On the contrary, formulas based on kin selection, such as (2.2) or others deriving from it, and appropriate population models, allow explaining the existence of genes that are harmful to the individual in which they act. This does not exclude that most genes without effects on other individuals are favored by natural selection because they increase individual fitness.

2.3 Definition of Phenoptosis

2.3

37

Definition of Phenoptosis

The concepts developed in the previous Section 2.2 – Supra-individual selection clearly indicate that even a gene that causes the death of the individual in which it acts can be favored by natural selection in particular conditions. The idea that “nature” can favor individual sacrifices that are beneficial to collective survival was already expressed, among other things, by a philosopher (Schopenhauer 1819) in terms that somehow anticipated Darwin: “Schopenhauer wrote: The individual is . . . not only exposed to destruction in a thousand ways from the most insignificant accidents, but is even destined for this and is led towards it by nature herself, from the moment that individual has served the maintenance of the species. Today, this statement needs only one specification, i.e., the term ‘species’ should be replaced by ‘species-inherent genetic program’. As a rule, interests of individual coincide with those of the genetic program which requires individual to exist, multiply and evolve. However, in certain cases, these two kinds of interests are opposite, so the genetic program forces individual to operate in a way that is counter-productive for individual. In extreme cases, ... it favours elimination, rather than survival, of an individual.” (Skulachev 2010)

Darwin himself, when he speaks of members of a tribe that sacrifices themselves for the common good as behaviors that would be favored by natural selection (Darwin 1871), in fact, speaks of selection at supra-individual level, but without developing the concept and going over the limit of selection at the individual level only. As it is possible to see in the next sections, the cases in which individuals sacrifice themselves are very frequent in nature and widespread in every part of the living world. Incredibly, however, in the enormous vocabulary of scientific terms concerning biological phenomena, a term describing this type of phenomena was missing. This gap was perhaps explainable by the resistance to fully accepting the idea that natural selection could be an active driving force in favoring genes that determine the death of the individual where they act, in plain contrast with the classic formulation of Darwinism. In 1997 and later, a biochemist, Skulachev, strong of his considerable experience and authority (not in the field of evolutionism!), but less bound by inveterate opinions, coined the neologism “phenoptosis” (Skulachev 1997, 1999), which indicates the programmed death of an individual, i.e., the premature death of an individual somehow determined and regulated by genes present in the individual and therefore necessarily favored by natural selection. A few years later, the same scholar interpreted aging as a form of phenoptosis that, for the slowness with which the phenomenon manifests itself, he defined as “slow phenoptosis” (Skulachev 2002a). Afterward, the definition of phenoptosis was extended to the cases in which, as a result of actions of genes present in an individual, the death of related individuals was determined (“indirect phenoptosis”): “Phenoptosis is the death of an individual caused by its own actions or by actions of close relatives (in particular, the parentcaused death of an offspring or filial infanticide) and not caused primarily by

38

2 Evolution and Phenoptosis

accidents or diseases or external factors, which is determined, regulated or influenced by genes favored by natural selection” (Libertini 2012). Moreover, a distinction was made between obligatory and optional phenoptosis and between the cases of rapid and slow phenoptosis, and so the following general classification of phenoptotic phenomena was proposed (Libertini 2012): (A) (B) (C) (D)

Obligatory and rapid phenoptosis; Obligatory and slow phenoptosis; Optional phenoptosis; Indirect phenoptosis.

2.4

Examples of Phenoptosis and Its Wide Diffusion

The phenomena included in the definition of phenoptosis are innumerable and present everywhere in the living world. Below are a miscellany of examples.

2.4.1

(A) Obligatory and Rapid Phenoptosis

Phenoptosis is obligatory and rapid when it happens in a specific period of life for all the individuals of a species. This type of phenoptotic phenomena was defined by Caleb Finch (Fig. 2.1) as “Rapid senescence and sudden death” (Finch 1990, p. 43). The term “senescence” used by Finch (and other authors) is avoided here because it could easily be confused with the precise definition of aging proposed in the previous Chapter 1 – Introduction (age-related progressive, and not sudden decline of fitness). Fig. 2.1 Caleb E. Finch

2.4 Examples of Phenoptosis and Its Wide Diffusion

39

Fig. 2.2 Agave americana (century plant), a semelparous plant

The definition of rapid phenoptosis does not imply a short lifespan before the phenoptotic event. E.g.: “Various species of the thick-stemmed bamboos (Phyllostachys) have prolonged phases of vegetative growth that last for many years or decades (7, 30, 60, or 120 years) according to the species, before suddenly flowering and dying ...” (Finch 1990, p. 101). For species in which reproduction is followed by sudden senescence triggered by particular physiological signals (Finch 1990), these should not be considered forms of optional phenoptosis (see below) but the temporal modulation of an obligatory and fixed life cycle. It is useful to describe two main subtypes of Obligatory and rapid phenoptosis (Libertini 2012): A-1) Related to the reproductive cycle – A common case in nature is when reproduction occurs only once in an individual’s life (semelparity) and is immediately followed by a very rapid decline in functions and then by death (Figs. 2.2 and 2.3). It is a well-known event for many plant species, in particular monocarpic angiosperms (Finch 1990). Furthermore, it is well known and undisputed that this type of functional decline is a genetically determined and regulated process and not the outcome of random alterations: “Many botanists emphasize that plant senescence is an orderly and active process (Leopold 1961; Noodén 1988a, b, c)” (Finch 1990, p. 98);

40

2 Evolution and Phenoptosis

Fig. 2.3 Octopus maya (Mexican four-eyed octopus) a semelparous animal

Fig. 2.4 Mantis religiosa (European mantis)

– There are also special cases that catch the attention, such as the endotokic matricide shown by some invertebrates. For some animals, in fact, the mother’s death is an obligatory effect of the birth, as “the young kill their mother by boring through her body wall” or cannibalize her body (Finch 1990, p. 102); – Other extraordinary cases are those in which the coupling involves the death of one of the partners. For example, the female of Mantis religiosa (European mantis) kills and eats (or at least tries to kill and eat) the male during copulation or soon after, i.e., the male sacrifices its life to reproduce (Lawrence 1992) (Fig. 2.4).

2.4 Examples of Phenoptosis and Its Wide Diffusion

41

A-2) Deriving in general from characteristics of the life cycle In many insect species, in the larval stage the individual feeds, grows and accumulates energy, while the adult phase serves for reproduction. The adult mainly or exclusively uses the energy reserves accumulated in the previous phase. The most striking case is that of adult insects that are utterly incapable of feeding, a phenomenon defined as aphagy: “Aphagy from defective mouthparts or digestive organs is very common during the adult phases of insects (Weismann 1889, pp. 111–57, Metchnikoff 1915; Norris 1934; Brues 1946; Wigglesworth 1972; Dunlap-Pianka et al. 1977) and is the limiting factor in the adult lifespan of many short-lived species. This phenomenon is, inarguably, programmed senescence.” (Finch 1990, p. 49); “Developmental defects that influence the adult phase also occur in other phyla, including the Protista. One of the best examples is given by male rotifers, which are much shorter-lived than females, surviving only hours to a few days (Hyman 1951, p. 123), with clear exponential increase of mortality ... In contrast to females, male rotifers lack an intestine, anus, or other excretory and digestive organs ... (Tannreuther 1919; Miller 1931; Remane 1932; Hyman 1951; de Beauchamp 1956; Gilbert 1968, 1988; Thane 1974).” (Finch 1990, p. 57).

2.4.2

(B) Obligatory and Slow Phenoptosis

Phenoptosis is obligatory and slow when, for all the individuals of a species there is an age-related progressive decline of fitness, i.e., an increasing probability of death. The expression “slow phenoptosis” was proposed by Skulachev (Skulachev 2002a). There are two crucial subtypes of Obligatory and slow phenoptosis (Libertini 2012): B-1) Duplications-related increasing probability of apoptosis in unicellular eukaryotes In yeast, a unicellular eukaryotic species, the mother cell divides into two cells with different characteristics. The first one is defined as a “daughter” cell, shows intact all the physiological characteristics of the healthy cells of yeast and can be compared to a germ cell of a multicellular organism. The second is defined as a “mother” cell and shows some alterations with respect to those of the progenitor cell. Among them, less resistance to death by a phenomenon defined as apoptosis must be pointed out, because it appears related to the apoptosis of multicellular eukaryotes (Madeo et al. 1997). In the following generations, the phenomenon repeats itself, and so there will be a population divided between daughter cells and mother cells of the first, second, n-th generation. In mother cells, as the number of generations increases, functional decline and vulnerability to death by apoptosis increase following an exponential dynamics (Laun et al. 2007), which is analogous to the increase in the mortality rate of multicellular eukaryotes that show the aging phenomenon. The phenomena that cause functional decline and greater vulnerability to apoptosis in the mother line cells will be discussed in another chapter. However, the

42

2 Evolution and Phenoptosis

Fig. 2.5 Robert E. Ricklefs

phenomenon has been interpreted as having an adaptive value: “apoptosis coupled to chronological and replicative aging limits longevity that would maintain ancient genetic variants within the population and, therefore, favor genetic conservatism.” (Büttner et al. 2006). Lewis disputes this interpretation by the observation that a cell of the mother lineage dies obligatorily by apoptosis after 25–35 duplications (in laboratory conditions (Jazwinski 1993)) and that it is implausible to consider the obligatory death of a single individual among 225–235 ¼ 3.36E+07–3.44E+10 descendants for any hypothesis that wanted to present the phenomenon as favored by natural selection (Lewis 2000). But this argument gives importance to the sure death of an unlikely single individual among innumerable descendants, while what is important is the probability of apoptosis, which grow exponentially after each generation of the mother lineage and determines the quicker generation turnover, thus counteracting the “genetic conservatism” mentioned by Büttner et al. (Büttner et al. 2006). B-2) Age-related increasing mortality in multicellular eukaryotes Many species of multicellular eukaryotes show an “increasing mortality with increasing chronological age in the wild” (Libertini 1988, 2006, 2008), also defined also as “actuarial senescence” (Holmes and Austad 1995), “age-related fitness decline in the wild” (Libertini 2009), and “Gradual senescence with definite lifespan” (Finch 1990). Although in the past its existence under natural conditions has been denied or underestimated (Kirkwood and Austad 2000), the evidence of its existence, in particular reviewed in the works of Robert Ricklefs (Fig. 2.5) (Ricklefs 1998) and of a team guided by Daniel Nussey and Steven Austad (Fig. 2.6) (Nussey et al. 2013), is strong and indisputable. It is intensely debated if this phenomenon is non-adaptive and the result of the accumulation of alterations insufficiently contrasted by natural selection

2.4 Examples of Phenoptosis and Its Wide Diffusion

43

Fig. 2.6 Steven N. Austad

(non-programmed aging paradigm) or if, on the contrary, it is an adaptive phenomenon, favored by natural selection and therefore determined and modulated by genes (programmed aging paradigm) (Libertini 2008, 2015a).

2.4.3

(C) Optional Phenoptosis

Phenoptosis is optional when the death or a behavior that determines a risk of death happens only in particular conditions and are caused or influenced by genetically determined mechanisms. It is useful to define two essential subtypes of Optional phenoptosis: C-1) Determined by biochemical mechanisms – In the unicellular eukaryote world For brevity, the discussion will be limited to the yeast (Saccharomyces cerevisiae), a well-studied eukaryotic unicellular species. In this species, it has been said before that there is a phenomenon defined as apoptosis because akin and phylogenetically correlated with the apoptosis of multicellular eukaryotes (Madeo et al. 1997). Among other things: (i) the overexpression of a particular factor (mammalian BAX) triggers both it in yeast and apoptosis in multicellular eukaryotes (Ligr et al. 1998); and (ii) the overexpression of another factor (human Bcl-2) appears both to delay the mechanisms leading to it in yeast and to inhibit apoptosis in multicellular eukaryotes (Longo et al. 1997). As there is strong evidence of similarity between apoptosis in multicellular eukaryotes and this phenomenon, they deserve the same definition as apoptosis. Moreover, this indicates a common phylogenetic origin (Madeo et al. 1999; Longo et al. 2005; Kaeberlein et al. 2007): “... since the first description of apoptosis in a yeast (Saccharomyces cerevisiae) strain carrying a CDC48 mutation (Madeo et al.

44

2 Evolution and Phenoptosis

1997), several yeast orthologues of crucial mammalian apoptotic proteins have been discovered (Madeo et al. 2002; Fahrenkrog et al. 2004; Wissing et al. 2004; Qiu et al. 2005; Li et al. 2006; Walter et al. 2006), and conserved proteasomal, mitochondrial, and histone-regulated apoptotic pathways have been delineated (Manon et al. 1997; Ligr et al. 2001; Ludovico et al. 2002; Fannjiang et al. 2004; Ahn et al. 2005; Gourlay and Ayscough 2005; Pozniakovsky et al. 2005).” (Büttner et al. 2006). Before we have said that for yeast cells of the mother lineage, an increased vulnerability to apoptosis referred to the number of duplications, can be observed (Laun et al. 2001; Herker et al. 2004; Büttner et al. 2006; Fabrizio and Longo 2008) and the death rate increment follows an exponential dynamics (Laun et al. 2007). In combination with this increasing vulnerability, apoptosis is triggered by: (a) the shortage of nutrients (Granot et al. 2003); (b) harmful chemical alterations (Madeo et al. 1999); (c) unsuccessful mating (Büttner et al. 2006); and also (d) apoptosis triggering toxins secreted by competing yeast tribes (Büttner et al. 2006). An important fact, which is the same for apoptosis both in multicellular eukaryotes and in yeast tribes, is that the parts of the died cells are not harmful to other individuals and, on the contrary, are usefully absorbed or phagocytized by other cells, which “... are able to survive longer with substances released by dying cells.” (Herker et al. 2004). Apoptosis in yeast has been interpreted as adaptive because, in conditions of nutritive deficiency, the sacrifice by apoptosis of part of the population and the use of their cellular components by other individuals allow them to survive and this is useful for the survival of the deme (Skulachev 2002b, 2003; Fabrizio et al. 2004; Herker et al. 2004; Longo et al. 2005; Skulachev and Longo 2005; Mitteldorf 2006). The adaptive interpretation of apoptosis appears plausible as yeast species is divided into small demes, each with one or a few clones. According to this explanation, the increasing vulnerability of the mother lineage individuals, allows to have – even in a monoclonal tribe – subgroups with different degrees of vulnerability to sacrifice in case of need. On the contrary, when apoptosis is triggered by toxins secreted by enemy yeast tribes, the adaptive mechanism appears clearly exploited by the competitors (Büttner et al. 2006). – Among prokaryotes Phenoptosis is not limited to eukaryotic, multicellular or socially organized species. Occasions in which prokaryotic organisms commit suicide in mass are frequent and do not represent a rare curiosity (Lane 2008). Some examples: 1. Mass suicide of bacterial phytoplankton as a defense against the propagation of bactericidal viruses (phages) is well known (Lane 2008); 2. Likewise, it is documented that phage infection activates the bacterial suicide “thereby curtailing viral multiplication and protecting nearby E. coli from infection” (Raff 1998); 3. “In E. coli, three suicide mechanisms that are activated by the appearance of a phage in the cell interior have been described” (Skulachev 2003);

2.4 Examples of Phenoptosis and Its Wide Diffusion

45

4. In E. coli, there is a “built-in suicide module” activated by antibiotics as a defense against the spread of other bacterial strains that produce them (Engelberg-Kulka et al. 2004). The many cases of “programmed death in bacteria” (Skulachev 2003) and “programmed cell death” in phytoplankton (Lane 2008) cannot be a random phenomenon not influenced by selection and it is indeed indispensable that they are favoured by natural selection at the supra-individual level. For prokaryotes, the main causes of natural selection that favor and modulate the activation of phenoptotic mechanisms are probably: (i) defense against the propagation of bactericidal virus (phages) (Raff 1998; Lane 2008); and (ii) elimination of individuals that for some reason are compromised and therefore reduce the resources for other individuals: “Most bacterial species actually do not live as planktonic suspensions in vivo but form complex biofilms, tightly knit communities of cells (Costerton et al. 1999). From this perspective, programmed death of damaged cells may be beneficial to a multicellular bacterial community” (Lewis 2000). In prokaryotes, the phenomena associated with programmed cell death, appear tightly linked to other kinds of specialization and the development of intercellular communication and coordination (in primitive manifestations of “sociality”). Thus, the myxobacteria are characterized by complex cooperative behavior and the formation of collectively feeding colonies on a rich medium. Under stress conditions, and in case of nutrient exhaustion, myxobacteria form fruiting bodies, sometimes involving the cooperation of distinct colonies, both via chemotaxis and contact signaling (Cao et al. 2015). The majority of cells (and, in this case, individual organisms) within fruiting bodies display “altruistic”, and even “self-sacrificing” behavior of cells. They readily share resources and even undergo autolysis for the sake of the others (Wireman and Dworkin 1977). The complex cooperation in myxobacteria, from swarm formation to the programmed death of many cells, assures the availability of resources, otherwise present in the substrate, but inaccessible for a single cell, and an enhanced overall survival and species persistence (Muñoz-Dorado et al. 2016). This example illustrates how costly or even fatal behaviors and processes for a single organism confer populational benefits, exceeding by far the losses at an individual scale. Thus, even in primitive organisms, at the beginning of the evolution of interplays, are developed regulatory mechanisms that put long-term populational interests before the short-term individual ones at appropriate times. In any case, it is necessary to hypothesize mechanisms of supra-individual selection: “As most plankton in a bloom are near identical genetically, from the perspective of their genes, a die-off that creates enough scorched earth to stop the viral advance can make sense” (Lane 2008), overcoming old theoretical arguments that excluded the possibility of group selection mechanisms (Maynard Smith 1964, 1976). The type of mechanism that triggers the phenoptosis in bacteria has been defined as “proapoptosis”. This phenomenon can be considered a kind of phylogenetic precursor of eukaryotic apoptosis (Hochman 1997). In fact, proapoptosis shows

46

2 Evolution and Phenoptosis

various features that are homologous or similar to those shown by apoptosis: “Several key enzymes of the apoptotic machinery, including the paracaspase and metacaspase families of the caspase-like protease superfamily, apoptotic ATPases and NACHT family NTPases, and mitochondrial HtrA-like proteases, have diverse homologs in bacteria, but not in archaea. Phylogenetic analysis strongly suggests a mitochondrial origin for metacaspases and the HtrA-like proteases, whereas acquisition from Actinomycetes appears to be the most likely scenario for AP-ATPases. The homologs of apoptotic proteins are particularly abundant and diverse in bacteria that undergo complex development, such as Actinomycetes, Cyanobacteria and alpha-proteobacteria, the latter being progenitors of the mitochondria.” (Koonin and Aravind 2002). We can consider: (i) apoptosis in unicellular eukaryotes as the evolution of proapoptosis in prokaryotes; and (ii) the organization of eukaryotic multicellular organisms as the result of the evolution of monoclonal colonies of eukaryotic cells in which the cells have progressively assumed differentiated roles. In such a case, under appropriate circumstances, some cells are subject to programmed cell death, a category of phenomena that includes apoptosis. So there is no wonder for the phylogenetic links between proapoptosis and apoptosis. C-2) Determined by behavioral mechanisms In particular conditions, natural selection, in terms of kin selection or supraindividual selection, can favor behaviors that are risky or deadly for the individual that manifest them, but that allow for survival, or increase the survival probabilities, of related individuals. The meaning of the term “behavioral” implies the existence of mechanisms based on nervous system activity, with or without the actions of instincts or intelligence or awareness, whatever they are defined or conceived. – In invertebrates, individual sacrifices in eusocial insect species (ants, bees, termites, etc.) are widespread and well-known (Wilson 1975). – In social vertebrates species, unselfish behaviors that are dangerous for one’s survival but increase the survival probabilities of others are common. For example, the predominant males of Papio cynocephalus (yellow baboons) (Altmann and Altmann 1970) and of Papio ursinus (chacma baboons) (Hall 1960) place themselves, with considerable individual risk, in the most exposed positions to defend from predators their herd. For various species of birds, there are the distraction behaviors shown by parents with significant individual risk to save offspring threatened by predators (Armstrong 1947; Brown 1962; Gramza 1967). – In many cases, the search for a partner and the struggle to overcome rivals is dangerous and sometimes deadly, and this could be considered a form of optional phenoptosis. – For our species, there are countless conditions and cases in which individuals jeopardize or even sacrifice their lives to save the lives of others of their group. These acts of men that jeopardize or sacrifice their life are usually interpreted as

2.4 Examples of Phenoptosis and Its Wide Diffusion

47

expressions of free will, and not as the effect of mechanisms, determined or at least partially influenced by genes. In fact, this phenoptotic interpretation could be understood as a denial of the concept of free will and of some religious and philosophical values. However, both for our species and for social vertebrates, it is possible to maintain that genes determining fixed behaviors under particular conditions are inexistent. At the same time, there are combinations of genes determining a neuroendocrine development and a mixture of hormones (or something analogous) that under particular conditions tend to favor particular stereotyped different strategies. For example, when there is a strong and immediate danger, some will run away without hesitation to save their lives, disregarding the possibility of saving others, while others will try to save others, even if this jeopardizes their lives. The choice between these two opposing behaviors is also strongly influenced by the degree of relationship between the individual who chooses the strategy and the individuals whose lives could be saved. In this delicate choice, the strategy of trying to save someone is more probable if, among the threatened individuals, there are related individuals, in particular offspring. In contrast, the strategy of running away without hesitation is more likely if no related individual is threatened. Simultaneously, in case of danger, except the “runaway” and the “defending of the others” behavioral strategies, a substantial number of individuals may exhibit a different reaction (Herberholz and Marquart 2012). One of them is freezing behavior, which can make most of the group members less provocative for the predator. The behavioral strategy, as well as the decision between “stay still”, “run immediately” or “attack the enemy”, is not unchangeable for the individual. The choice depends on many factors, including age, experience, health, immediate surroundings, and hierarchic place, and has complex neurohumoral regulation (Hashemi et al. 2019). Sick or weaker individuals typically faster shift to “run as fast as you can”, and they have lower chances to escape as the predator approaches. Simultaneously, such action of the “most fearful” individuals usually attracts the predator’s attention and provokes an attack towards them. The escape attempts of the weakest group member seem much less “heroical”, than an aggressive “self-sacrificing” defense (Chakraborty et al. 2020). In many cases, such a run ends up in the same sacrifice for the sake of other group members. Such behavior seems “egoistic”, to all appearances opposite to the distraction behavior displayed by parents, aimed to lead the predator away from offspring. Nevertheless, while the success is often on the side of the strong and healthy parents, which only play an easily accessible prey, in case of the rushing in panic “quitter”, its chances to win are incomparably smaller (Herberholz and Marquart 2012). As a result, in the latter case, the predator is much more likely to capture the prey and lose interest to other group members. Thus, even if “driven only by fear”, the weakest group members’ runaway behavior diminishes the costs of the predator attack for the group, as the highest risk affects a “less precious” (at the moment) member.

48

2 Evolution and Phenoptosis

For non-human species, analogous behavioral choices are interpreted as strongly determined by instincts. However, it is necessary to admit that, in some way, the instincts and as a consequence the behavior have been forged by natural selection. In humans, it is likely that in any behavior there are both instinctive components forged by natural selection as for the animals and components determined by acts of free will. Nevertheless, a more careful analysis should say that the will, the conscience, and every other intellectual quality that makes us very different from any other species, even those that are phylogenetically close to us, are the fruit of natural selection. The result is undoubtedly much more complex and less predictable than that determined by pure instincts, but certainly, it is also the result of natural selection.

2.4.4

(D) Indirect Phenoptosis

Phenoptosis is defined as indirect when an individual, in particular conditions, causes or favors the death of one or more of its close relatives. It is possible to distinguish two main types of indirect phenoptosis: D-1) Determined by biochemical mechanisms – In the mouse, the new partner of a female kills the newborn offspring because they have the previous partner’s genes. When a new male takes over, a female aborts its own young by an internal biochemical mechanism. This saves for the mother time and energy required for continuing the gestation of offspring, which has high chances to be killed after birth, and so the abortion is interpreted as adaptive (Bruce 1959). – In vertebrates, it is of primary importance that the immune system of an individual discriminates between its own antigens and those of the parasites. In fact, the parasites try to go around immunologic defenses by using in their external parts proteins with the same antigens of the host (antigen mimicry). Hosts may oppose the antigen mimicry of the parasites by presenting the highest variability of antigenic formulas so that an antigen mimicry suitable for all the potential hosts becomes impossible. The major histocompatibility complex (MHC) is the main group of alleles that provides to the host organisms the possibility of the greatest antigen variability. While similarities between the antigenic formulas of hosts and parasites originate greater susceptibility to infections, on the contrary, differences determine higher resistance to them. There are known correlations between specific human MHC alleles and susceptibility or resistance to many infective or infection-related diseases (Lechler and Warrens 2000; Shiina et al. 2004). This implies that the most significant antigenic variability characterizes the best progeny. So, two phenoptotic mechanisms increase the antigenic variability of the offspring: (i) MHC-mediated mate choice; and (ii) post-copulatory selection. The first mechanism is documented for several vertebrate taxa (Slev et al. 2006), our species included: (a) The odors of men with different MCH alleles

2.4 Examples of Phenoptosis and Its Wide Diffusion

49

were rated by women college students as being ‘more pleasant’ than those of men with similar MHC alleles (Wedekind et al. 1995; Wedekind and Füri 1997); (b) In an ethnically homogenous and isolate community, fewer couples were found to match at a 16-locus MHC haplotype to a statistically significant extent (Ober et al. 1997; Ober et al. 1999). As regards the second case, known as “post-copulatory selection (also called cryptic female choice)” (Loisel et al. 2008, p. 104), non-pathologic spontaneous miscarriages eliminate the fetuses with lesser antigen variability having a likely reduced resistance to infective diseases (Apanius et al. 1997). The postcopulatory selection or cryptic female choice is well known in animals (Tregenza and Wedell 2000). About our species, a study found an excess of heterozygotes for MHC in newborns of male sex (Dorak et al. 2002). For isolated and ethnically homogenous communities there is evidence that, comparing couples with shared or not shared HLA-DR alleles, can be noted: (1) a greater interval between pregnancies (Ober 1992); (2) a greater pregnancy loss rate (Ober et al. 1998); and (3) significantly fewer children (Ober and van der Ven 1997); were the rule in the case of shared alleles. – The phenomenon defined as the “vanishing twin” (Landy and Keith 1998) is well documented for our species “... sonograms of women in the first trimester of pregnancy reveal that twins are conceived two to four times more often than they are born; in the majority of cases, the smaller of the two foetuses disappears by the third trimester and is apparently reabsorbed by the mother (Robinson and Caines 1977; Varma 1979).” (Hausfater and Hrdy 1984, p. XIX). D-2) Determined by behavioral mechanisms The killing of an offspring by its own parents by direct actions or by abandonment, is defined as filial infanticide. – In the animal world, filial infanticide is widespread and often is followed by cannibalism (Hausfater and Hrdy 1984). – For our species, the filial infanticide, by direct actions or by abandonment, both of healthy newborns and of deformed or very ill newborns, is documented for many primitive societies (Scrimshaw 1984). In this study, the most frequently documented causes of infanticide were: adulterous conception, deformed or very ill newborns, twins, no male support, and mother unwed (Scrimshaw 1984, Table I). These acts, which are present and widespread also in modern societies together with abortion, may be interpreted in evolutionary terms in various ways, in particular by the fact that a newborn with reduced survival possibility subtracts precious resources to other present or future newborns (Eaton et al. 1988). These behaviors and the phenomenon of the “vanishing twin” follow the same evolutionary logic, i.e., scant resources do not allow the successful breeding of two children at the same time or even of a single child.

50

2.5

2 Evolution and Phenoptosis

Phenoptotic Phenomena in our Species

As it is possible to die only once, likely false deductions are: (i) each species can present only one phenoptotic phenomenon; and (ii) the species are divided between phenoptotic and non-phenoptotic ones. To show how these ideas are erroneous, let us examine the case of our species. – Before birth, a fetus can be eliminated in many ways by indirect phenoptosis (in these cases by biochemical or hormonal ways), because (i) the fetus is somehow defective; (ii) it is part of a multiple pregnancy; or (iii) it is with little antigenic variability. – After birth, other mechanisms of indirect phenoptosis (in these cases determined by behavioral mechanisms) can determine the killing of a child. Among the motivations found in 60 different mostly primitive societies reported by Hausfater and Hrdy in “Table I. Circumstances of alleged infanticide in society” (Hausfater and Hrdy 1984, pp. 490–1), we have: Adulterous conception (15 societies), Deformed or very ill (21), Twins (14), Birth too soon or too many (11), No male support (6), Mother dead (6), Mother unwed (14), Economic hardship (3). It could be objected that these events are an expression of the primitive condition of almost all the societies studied. However, in modern societies, a remarkable number of fetuses is eliminated by abortion for a series of similar or identical reasons. – In adulthood, there are innumerable circumstances in which an individual may endanger or even sacrifice his/her life to save or try to save one or more related genetic individuals or even non-genetically related individuals (optional phenoptosis). – For all those who did not die by other causes (including deaths due to indirect or optional phenoptosis), there is the common fate of death due to causes related to aging (obligatory slow phenoptosis). – Furthermore, it should be considered that each individual of our species, as well as those of any eukaryotic multicellular species, is fundamentally an evolved monoclonal colony of eukaryotic cells. In these colonies, only the cells of the germ line reproduce, while for all the others a common destiny is one of several types of programmed cell death (PCD; e.g., apoptosis, cell detachment from mucosal membranes, keratinization and cell detachment of skin cells, etc.). Indeed, without the differentiation of roles between the cells of a multicellular organism and the specific PCD of many cells, the development and survival of a multicellular organism would be unconceivable. The elimination of cells by PCD is not within the definition of phenoptosis but indicates that the origin and organization of any multicellular organism are based in its first constitution on a sort of “phenoptotic pact” between cells from a monoclonal colony. These evaluations, presented here in a concise and incomplete way, could be extended to many other species. They indicate that a distinction between phenoptotic

2.6 Life Tables and Phenoptosis

51

and non-phenoptotic species is impossible or inappropriate and that a species may be subject to a plurality of phenoptotic phenomena. The variety, importance, and implications of phenoptotic phenomena leads to the concept that, in biological terms, to understand life, it is also essential to understand death caused by phenoptotic phenomena.

2.6

Life Tables and Phenoptosis

Phenoptotic phenomena should not be considered only as a series of unusual and curious phenomena of secondary importance that enrich the infinite characteristics of living beings. In fact, for many species, phenoptosis is the primary determinant of the life table (Libertini et al. 2017). The comparative study of life tables of many species shows that they are determined in various ways by different types of phenoptosis. On the contrary, for other species, the life table is relevant because a phenoptotic obligatory end does not determine it. A detailed study of the great variety of life tables existing in nature is not appropriate here. However, it is possible to delineate some main types, especially based on a recent review by Jones (Fig. 2.7) et al. (2014). Here are these main types: Type I – Age-related increasing mortality in the wild. It is the kind of life table that is most familiar to us, and before it has been precisely defined as “aging” and also described as “slow phenoptosis” (Skulachev 2002a). An example of this type of life table is shown by Panthera leo (lion) (Figs. 2.8 and 2.9). Type II – Constant mortality and then the rapid collapse of all vital functions and death. In general, there is reproduction and then death (semelparity) (Fig. 2.10). Fig. 2.7 Owen R. Jones

52

2 Evolution and Phenoptosis

Fig. 2.8 Panthera leo (lion) Fig. 2.9 An example of type I life table, i.e., a species with age-related increasing mortality in the wild (Panthera leo, lion) (small part, redrawn, of Fig. 1 in (Jones et al. 2014)). In this and other analogous figures, the lines indicate standardized mortality (m) and survivorship (s)

This rapid decline of all functions described by Finch for many plants (in particular monocarpic angiosperms) and animals (many Anguilliformes and Salmoniformes, some rodents and dasyurid marsupials, etc.) is defined as “rapid senescence and sudden death” (Finch 1990, p. 43), but the phenomenon should not be interpreted simply and wrongly as an accelerated form of aging. Three examples of this type of life tables are given by Oncorhynchus nerka (Pacific salmon) (Fig. 2.11), Antechinus stuartii (brown antechinus), a marsupial of the family Dasyuridae (Fig. 2.12), and Glycine max (soybeans) (Fig. 2.13). The

2.6 Life Tables and Phenoptosis

53

Fig. 2.10 An example of type II life table, i.e., a semelparous species with constant mortality and then, at a certain age, after reproduction, a rapid increase in mortality and sudden death (in the figure, an ideal life table of a semelparous species as described in (Finch 1990))

Fig. 2.11 Oncorhynchus nerka (Sockeye salmon, Pacific salmon)

concept of the rapid decline of all functions and the consequent death is not at all a synonym of a short life span. A striking example that contradicts this misconception is the species Phyllostachys bambusoides (giant or Japanese timber bamboo) (Fig. 2.14) that blooms after 120 years and then dies, a phenomenon documented in Japan, going back a millennium (Kawamura 1927). Type III – Constant mortality at all ages under natural conditions, with a long life span (Fig. 2.15). In fact, many species, e.g., hydra (Hydra magnipapillata), collared flycatcher (Ficedula albicollis), bivalves as ocean quahog Arctica islandica (Philipp and Abele 2010; Munro and Blier 2012) (Fig. 2.16), rockfish (Fig. 2.17), sturgeon, and possibly lobsters (Fig. 2.18), show “no observable increase in age-specific mortality rate or decrease in reproduction rate after sexual maturity; and ... no observable age-related decline in physiological capacity or disease resistance” (Finch and Austad 2001). These species are defined as non-aging species and the expression animals with “negligible senescence” is also used (Finch 1990, p. 206). Type IV – Mortality that decreases according to age, defined by Vaupel (Fig. 2.19) et al. as “negative senescence“ (“Negative senescence is characterized by a

54

2 Evolution and Phenoptosis

Fig. 2.12 Antechinus stuartii (brown antechinus/Stuart’s antechinus/Macleay’s marsupial mouse) is a small marsupial of the family Dasyuridae. The males die after the breeding season Fig. 2.13 Glycine max (soybeans)

decline in mortality with age after reproductive maturity, generally accompanied by an increase in fecundity. Hamilton (Hamilton 1966) ruled out negative senescence: we adumbrate the deficiencies of his model. We review empirical studies of various plants and some kinds of animals that may experience negative senescence and conclude that negative senescence may be widespread, especially in indeterminate-growth species for which size and fertility increase with age.” (Vaupel et al. 2004)) (Figs. 2.20, 2.21 and 2.22). Indeed, instead of negative senescence, for such species it would be more accurate to speak of a variant of

2.6 Life Tables and Phenoptosis

55

Fig. 2.14 Phyllostachys bambusoides (giant or Japanese timber bamboo)

Fig. 2.15 Two examples of type III life table, i.e., species with a constant mortality at any age with a non-small life span. On the left, Hydra magnipapillata (hydra); on the right, Ficedula albicollis (collared flycatcher). Small parts, redrawn, of Fig. 1 in (Jones et al. 2014)

non-aging species in which some other factor (for example, a growing size with age), reduces mortality from predation (Libertini 2012). Type V – Constant but very high mortality under natural conditions, with a very short life span. Individuals of the same species in protected conditions may show a significantly longer life span and, at ages not present in the wild, an increasing

56

2 Evolution and Phenoptosis

Fig. 2.16 Arctica islandica (ocean quahog)

Fig. 2.17 Rougheye rockfish (Sebastes aleutianus) is probably among the longest-lived marine fish on Earth, living as old as 205 years. For a similar species, yelloweye rockfish (Sebastes ruberrimus), living as old as 118 years, commercially caught off Sitka, Alaska, “16% of the fish going to people’s dinner tables were 50 years of age or older, with several over 100 years old!” (from the site http://www.agelessanimals.org)

age-related mortality. A well-documented example is that of the spider Frontinella pyramitela (“bowl and doily” spider) (Fig. 2.23): in the wild, it is unlikely that it lives more than 30 days while, in protected laboratory conditions and with a restricted diet (1 fly/week), it reaches ages 4–5 times higher and shows an age-related increasing mortality (Austad 1989) (Fig. 2.24). With more significant feeding (2–3 flies/week), survival is reduced and the increase in mortality is accelerated (Austad 1989). For many species of insects, and for many other small invertebrates as the famous C. elegans, the adult phase in the wild has a quite short duration with high and constant mortality. At the same time, in protected

2.6 Life Tables and Phenoptosis

57

Fig. 2.18 “January 2009: A giant lobster named George, estimated to be 140 years old, escaped a dinner-table fate and was released into the Atlantic Ocean after a New York seafood restaurant granted him his freedom” (http://www.cnn. com/2009/US/01/10/maine. lobster.liberated/)

Fig. 2.19 James W. Vaupel

Fig. 2.20 Two examples of type IV life table, i.e., species with mortality that decreases according to age. On the left, Gopherus agassizii (desert tortoise); on the right, Quercus rugosa (netleaf oak). Small parts, redrawn, of Fig. 1 in (Jones et al. 2014)

58

2 Evolution and Phenoptosis

Fig. 2.21 Gopherus agassizii (desert tortoise)

Fig. 2.22 Quercus rugosa (netleaf oak)

conditions, the survival increases significantly, and there is an increase in mortality starting from ages that are non-existent in nature (Finch 1990). For these species, the age-related mortality increase in artificial laboratory conditions is defined as aging with the same term used for other species that show analogous mortality increase under natural conditions, i.e., at ages that exist in the

2.6 Life Tables and Phenoptosis

59

Fig. 2.23 Frontinella pyramitela (“bowl and doily” spider) Fig. 2.24 An example of type V life table: Frontinella pyramitela (“bowl and doily” spider) in the wild (circles) and in the laboratory with a restricted diet (1 fly/week) (squares); data from (Austad 1989)

wild. The distinction between the two phenomena is necessary and important. In fact, the “increasing mortality with increasing chronological age in the wild (IMICAW)” and the “in captivity ... increasing mortality with increasing chronological age ... (IMICAC)” (Libertini 1988) must be clearly distinguished from each

60

2 Evolution and Phenoptosis

other. The first phenomenon, being present in the wild, is influenced by natural selection and can have an adaptive value. In contrast, the second phenomenon, being by definition absent under natural conditions, is only a laboratory artefact, is not influenced by natural selection and cannot have an adaptive value (Libertini 1988). The most evident examples of species of this type of life table that show their differences with the species that age (like ours) may be the insects with the phenomenon of aphagy. In these species, the adult phase presents anatomical defects that make individuals unable to feed and able only to use the accumulated reserves. From this, it follows certain death caused by starvation for individuals that survive death by predation (Finch 1990). Type VI – Very many unicellular prokaryotic and eukaryotic species simply divide into two daughter cells that are indistinguishable from each other, and this phenomenon cannot be defined as aging. A particular different case, exposed elsewhere, is that of species like Saccharomyces cerevisiae (yeast) where there are differences between the two cells deriving from the division, and one can speak of aging in the precise meaning attributed to this term and with the characteristics of type I life table. These types of life tables, and others not mentioned here, show that most species have life tables that are different from aging in the precise meaning that has been given (age-related mortality increase under natural conditions). This shows that the “aging” species are a small minority among all the innumerable living species and demonstrates that the widely held belief that aging is a universal phenomenon, perhaps with some reluctantly admitted exceptions (e.g., hydra and animals with negligible senescence), is erroneous. About the different types of life tables, two considerations are useful and opportune (Libertini et al. 2017): 1. In the evaluations of the scientific world, most life tables are clearly determined and modulated by genes and, therefore, must necessarily be considered as adaptive phenomena (Finch 1990). Aging (type I of life tables) is a conspicuous exception in these evaluations as the prevailing and widely diffused conviction is that it is a phenomenon not determined and not modulated by genes and therefore not adaptive (non-programmed aging paradigm). However, this paradigm in the general context of the interpretation of the life tables represents an unusual and minority position of the biological scientific world. The opposite thesis, namely that aging is determined and modulated by genes and is, therefore, adaptive (programmed aging paradigm), even if it is a minority position, is more consistent with the common interpretation of the evolutionary meaning of all other life tables, which always sees them as the fruit of the forge of natural selection and never as a non-adaptive phenomenon.

2.6 Life Tables and Phenoptosis

61

Fig. 2.25 For the non-programmed aging paradigm, the primary condition is Type I life table (i.e., species that age) and all other life tables are derived. The evolution from Type I to Type III is particularly challenging to explain

2. It is closely related to the previous consideration the evaluation of the likely most primitive or “default” life table, to which a species tends in the absence of specific natural selection, and from which the other types of life tables would then be derived. Here too, there is a different interpretation depending on whether the thesis of the non-programmed aging paradigm or that of the programmed aging paradigm is considered correct. In the first case, the simplest and default condition is that of mortality that grows according to age, and all the other life tables are adaptations modeled by natural selection (Fig. 2.25). In the second case, the simplest and default condition is that of constant mortality at all ages (for example, the one shown by the hydra), and all the other life tables are adaptations modeled by natural selection (Fig. 2.26). It is interesting that in this second case, the basic living being model is the hydra, which among the multicellular species is the one with the simplest structure and is, therefore, more plausible as a more primitive basic model. On the contrary, in the first case, basic living beings would be analogous to the mammals, our species included, which certainly cannot be considered among the most primitive living beings.

62

2 Evolution and Phenoptosis

Fig. 2.26 For the programmed aging paradigm, the primary condition is Type III life table (i.e., species with constant mortality at any age) and the other conditions are derived

References Ahn, S. H., Cheung, W. L., Hsu, J. Y., Diaz, R. L., Smith, M. M., & Allis, C. D. (2005). Sterile 20 kinase phosphorylates histone H2B at serine 10 during hydrogen peroxide-induced apoptosis in S. cerevisiae. Cell, 120(1), 25–36. https://doi.org/10.1016/j.cell.2004.11.016. Altmann, S. A., & Altmann, J. (1970). Baboon ecology: African field research. Chicago: The University of Chicago Press. Apanius, V., Penn, D., Slev, P. R., Ruff, L. R., & Potts, W. K. (1997). The nature of selection on the major histocompatibility complex. Critical Reviews in Immunology, 17(2), 179–224. https://doi. org/10.1615/critrevimmunol.v17.i2.40. Armstrong, E. A. (1947). Bird display and behaviour: An introduction to the study of bird psychology. London: Lindsay Drummond. Reprint (1965): Dover, New York. Austad, S. N. (1989). Life extension by dietary restriction in the bowl and doily spider, Frontinella pyramitela. Experimental Gerontology, 24(1), 83–92. https://doi.org/10.1016/0531-5565(89) 90037-5. Brown, R. G. (1962). The aggressive and distraction behaviour of the Western Sandpiper, Ereunetes mauri. Ibis, 104(1), 1–12. https://doi.org/10.1111/j.1474-919X.1962.tb08624.x. Bruce, H. M. (1959). An exteroceptive block to pregnancy in the mouse. Nature, 184(4680), 105. https://doi.org/10.1038/184105a0.

References

63

Brues, C. T. (1946). Insect dietary. An account for the food habits of insects. Cambridge: Harvard University Press. Büttner, S., Eisenberg, T., Herker, E., Carmona-Gutierrez, D., Kroemer, G., & Madeo, F. (2006). Why yeast cells can undergo apoptosis: Death in times of peace, love, and war. The Journal of Cell Biology, 175(4), 521–525. https://doi.org/10.1083/jcb.200608098. Cao, P., Dey, A., Vassallo, C. N., & Wall, D. (2015). How myxobacteria cooperate. Journal of Molecular Biology, 427(23), 3709–3721. https://doi.org/10.1016/j.jmb.2015.07.022. Chakraborty, D., Bhunia, S., & De, R. (2020). Survival chances of a prey swarm: How the cooperative interaction range affects the outcome. Scientific Reports, 10(1), 8362. https://doi. org/10.1038/s41598-020-64084-3. Costerton, J. W., Stewart, P. S., & Greenberg, E. P. (1999). Bacterial biofilms: A common cause of persistent infections. Science, 284(5418), 1318–1322. https://doi.org/10.1126/science.284. 5418.1318. Darwin, C. R. (1859). On the origin of species by means of natural selection, or the preservation 1of the favoured races in the struggle for life. London: John Murray. Darwin, C. R. (1869). Origin of species (5th ed.). London: John Murray. Darwin, C. R. (1871). The descent of man, and selection in relation to sex. London: John Murray. de Beauchamp, P. (1956). Le développement de Ploesoma hudsoni (Imhof) et l’origine des feuillets chez les rotifers. Bulletin de la Société Zoologique de France, 81(5–6), 374–383. Dorak, M. T., Lawson, T., Machulla, H. K., Mills, K. I., & Burnett, A. K. (2002). Increased heterozygosity for MHC class II lineages in newborn males. Genes and Immunity, 3(5), 263–269. https://doi.org/10.1038/sj.gene.6363862. Dunlap-Pianka, H., Boggs, C. L., & Gilbert, L. E. (1977). Ovarian dynamics in heliconiine butterflies: Programmed senescence versus eternal youth. Science, 197(4302), 487–490. https://doi.org/10.1126/science.197.4302.487. Eaton, S. B., Shostak, M., & Konner, M. (1988). The paleolithic prescription: A program of diet and exercise and a design for living. New York: Harper and Row. Engelberg-Kulka, H., Sat, B., Reches, M., Amitai, S., & Hazan, R. (2004). Bacterial programmed cell death systems as targets for antibiotics. Trends in Microbiology, 12(2), 66–71. https://doi. org/10.1016/j.tim.2003.12.008. Fabrizio, P., & Longo, V. D. (2008). Chronological aging-induced apoptosis in yeast. Biochimica et Biophysica Acta, 1783(7), 1280–1285. https://doi.org/10.1016/j.bbamcr.2008.03.017. Fabrizio, P., Battistella, L., Vardavas, R., Gattazzo, C., Liou, L. L., Diaspro, A., Dossen, J. W., Gralla, E. B., & Longo, V. D. (2004). Superoxide is a mediator of an altruistic aging program in Saccharomyces cerevisiae. The Journal of Cell Biology, 166(7), 1055–1067. https://doi.org/10. 1083/jcb.200404002. Fahrenkrog, B., Sauder, U., & Aebi, U. (2004). The S. cerevisiae HtrA-like protein Nma111p is a nuclear serine protease that mediates yeast apoptosis. Journal of Cell Science, 117(Pt 1), 115–126. https://doi.org/10.1242/jcs.00848. Fannjiang, Y., Cheng, W. C., Lee, S. J., Qi, B., Pevsner, J., McCaffery, J. M., Hill, R. B., Basañez, G., & Hardwick, J. M. (2004). Mitochondrial fission proteins regulate programmed cell death in yeast. Genes & Development, 18(22), 2785–2797. https://doi.org/10.1101/gad.1247904. Finch, C. E. (1990). Longevity, senescence, and the genome. Chicago: University of Chicago Press. Finch, C. E., & Austad, S. N. (2001). History and prospects: Symposium on organisms with slow aging. Experimental Gerontology, 36(4–6), 593–597. https://doi.org/10.1016/s0531-5565(00) 00228-x. Gilbert, J. J. (1968). Dietary control of sexuality in the rotifer Asplanchna brightwelli (Gosse). Physiological Zoology, 41(1), 14–43. www.journals.uchicago.edu/doi/pdfplus/10.1086/ physzool.41.1.30158482. Gilbert, J. J. (1988). Rotifera. In K. G. Adiyodi & R. G. Adiyodi (Eds.), Reproductive biology of invertebrates, , vol. 4, part A, Fertilization, development, and parental care (pp. 177–199). Oxford/New Delhi: Oxford University Press.

64

2 Evolution and Phenoptosis

Gourlay, C. W., & Ayscough, K. R. (2005). Identification of an upstream regulatory pathway controlling actin-mediated apoptosis in yeast. Journal of Cell Science, 118(Pt 10), 2119–2132. https://doi.org/10.1242/jcs.02337. Gramza, A. F. (1967). Responses of brooding nighthawks to a disturbance stimulus. Auk, 84(1), 72–86. www.jstor.org/stable/4083256. Granot, D., Levine, A., & Dor-Hefetz, E. (2003). Sugar-induced apoptosis in yeast cells. FEMS Yeast Research, 4(1), 7–13. https://doi.org/10.1016/S1567-1356(03)00154-5. Hall, K. R. L. (1960). Social vigilance behaviour of the chacma baboon, Papio ursinus. Behaviour, 16(3–4), 261–294. https://doi.org/10.1163/156853960X00188. Hamilton, W. D. (1964). The genetical evolution of social behaviour. II. Journal of Theoretical Biology, 7(1), 1–52. https://doi.org/10.1016/0022-5193(64)90039-6. Hamilton, W. D. (1966). The moulding of senescence by natural selection. Journal of Theoretical Biology, 12(1), 12–45. https://doi.org/10.1016/0022-5193(66)90184-6. Hamilton, W. D. (1970). Selfish and spiteful behaviour in an evolutionary model. Nature, 228 (5277), 1218–1220. https://doi.org/10.1038/2281218a0. Hashemi, M. M., Gladwin, T. E., de Valk, N. M., Zhang, W., Kaldewaij, R., van Ast, V., Koch, S. B. J., Klumpers, F., & Roelofs, K. (2019). Neural dynamics of shooting decisions and the switch from freeze to fight. Scientific Reports, 9(1), 4240. https://doi.org/10.1038/s41598-01940917-8. Hausfater, G., & Hrdy, S. B. (1984). Infanticide: Comparative and evolutionary perspectives. New York: AldineTransaction. Herberholz, J., & Marquart, G. D. (2012). Decision making and behavioral choice during predator avoidance. Frontiers in Neuroscience, 6, 125. https://doi.org/10.3389/fnins.2012.00125. Herker, E., Jungwirth, H., Lehmann, K. A., Maldener, C., Fröhlich, K. U., Wissing, S., Büttner, S., Fehr, M., Sigrist, S., & Madeo, F. (2004). Chronological aging leads to apoptosis in yeast. The Journal of Cell Biology, 164(4), 501–507. https://doi.org/10.1083/jcb.200310014. Hochman, A. (1997). Programmed cell death in prokaryotes. Critical Reviews in Microbiology, 23 (3), 207–214. https://doi.org/10.3109/10408419709115136. Holmes, D. J., & Austad, S. N. (1995). Birds as animal models for the comparative biology of aging: A prospectus. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 50(2), B59–B66. https://doi.org/10.1093/gerona/50a.2.b59. Hyman, L. H. (1951). The invertebrates. Vol. 3, Acantocephala, Aschelmintes, and Entoprocta. The Pseudocoelomate Bilateria. New York: McGraw-Hill. Jazwinski, S. M. (1993). The genetics of aging in the yeast Saccharomyces cerevisiae. Genetica, 91 (1–3), 35–51. https://doi.org/10.1007/bf01435986. Jones, O. R., Scheuerlein, A., Salguero-Gómez, R., Camarda, C. G., Schaible, R., Casper, B. B., Dahlgren, J. P., Ehrlén, J., García, M. B., Menges, E. S., Quintana-Ascencio, P. F., Caswell, H., et al. (2014). Diversity of ageing across the tree of life. Nature, 505(7482), 169–173. https://doi. org/10.1038/nature12789. Kaeberlein, M., Burtner, C. R., & Kennedy, B. K. (2007). Recent developments in yeast aging. PLoS Genetics, 3(5), e84. https://doi.org/10.1371/journal.pgen.0030084. Kawamura, S. (1927). On the periodical flowering of the bamboo. Journal of Japanese Botany, 3, 335–349. Kirkwood, T. B., & Austad, S. N. (2000). Why do we age? Nature, 408(6809), 233–238. https://doi. org/10.1038/35041682. Koonin, E. V., & Aravind, L. (2002). Origin and evolution of eukaryotic apoptosis: The bacterial connection. Cell Death and Differentiation, 9(4), 394–404. https://doi.org/10.1038/sj.cdd. 4400991. Landy, H. J., & Keith, L. G. (1998). The vanishing twin: A review. Human Reproduction Update, 4 (2), 177–183. https://doi.org/10.1093/humupd/4.2.177. Lane, N. (2008). Marine microbiology: Origins of death. Nature, 453(7195), 583–585. https://doi. org/10.1038/453583a.

References

65

Laun, P., Pichova, A., Madeo, F., Fuchs, J., Ellinger, A., Kohlwein, S., Dawes, I., Fröhlich, K. U., & Breitenbach, M. (2001). Aged mother cells of Saccharomyces cerevisiae show markers of oxidative stress and apoptosis. Molecular Microbiology, 39(5), 1166–1173. https://doi.org/10. 1111/j.1365-2958.2001.02317.x. Laun, P., Bruschi, C. V., Dickinson, J. R., Rinnerthaler, M., Heeren, G., Schwimbersky, R., Rid, R., & Breitenbach, M. (2007). Yeast mother cell-specific ageing, genetic (in)stability, and the somatic mutation theory of ageing. Nucleic Acids Research, 35(22), 7514–7526. https://doi. org/10.1093/nar/gkm919. Lawrence, S. E. (1992). Sexual cannibalism in the praying mantid, Mantis religiosa: A field study. Animal Behaviour, 43(4), 569–583. https://doi.org/10.1016/S0003-3472(05)81017-6. Lechler, R., & Warrens, A. (2000). HLA in health and disease. San Diego: Academic. Leopold, A. C. (1961). Senescence in plant development. Science, 134(3492), 1727–1732. https:// doi.org/10.1126/science.134.3492.1727. Lewis, K. (2000). Programmed death in bacteria. Microbiology and Molecular Biology Reviews, 64 (3), 503–514. https://doi.org/10.1128/mmbr.64.3.503-514.2000. Li, W., Sun, L., Liang, Q., Wang, J., Mo, W., & Zhou, B. (2006). Yeast AMID homologue Ndi1p displays respiration-restricted apoptotic activity and is involved in chronological aging. Molecular Biology of the Cell, 17(4), 1802–1811. https://doi.org/10.1091/mbc.e05-04-0333. Libertini, G. (1988). An adaptive theory of the increasing mortality with increasing chronological age in populations in the wild. Journal of Theoretical Biology, 132(2), 145–162. https://doi.org/ 10.1016/s0022-5193(88)80153-x. Libertini, G. (2006). Evolutionary explanations of the “actuarial senescence in the wild” and of the “state of senility”. ScientificWorldJournal, 6, 1086–1108. https://doi.org/10.1100/tsw.2006. 209. Libertini, G. (2008). Empirical evidence for various evolutionary hypotheses on species demonstrating increasing mortality with increasing chronological age in the wild. ScientificWorldJournal, 8, 183–193. https://doi.org/10.1100/tsw.2008.36. Libertini, G. (2009). The role of telomere-telomerase system in age-related fitness decline, a tameable process. In L. Mancini (Ed.), Telomeres: Function, shortening and lengthening (pp. 77–132). New York: Nova Science Publ. Libertini, G. (2012). Classification of Phenoptotic phenomena. Biochem (Mosc), 77(7), 707–715. https://doi.org/10.1134/S0006297912070024. Libertini, G. (2015a). Non-programmed versus programmed aging paradigm. Current Aging Science, 8(1), 56–68. https://doi.org/10.2174/1874609808666150422111623. Libertini, G. (2015b). Phylogeny of aging and related Phenoptotic phenomena. Biochem (Mosc), 80 (12), 1529–1546. https://doi.org/10.1134/S0006297915120019. Libertini, G., Rengo, G., & Ferrara, N. (2017). Aging and aging theories. Journal of Gerontology and Geriatrics, 65, 59–77. http://www.jgerontology-geriatrics.com/wp-content/uploads/2018/ 03/RivJGG_1_17.pdf#page¼62. Ligr, M., Madeo, F., Fröhlich, E., Hilt, W., Fröhlich, K. U., & Wolf, D. H. (1998). Mammalian Bax triggers apoptotic changes in yeast. FEBS Letters, 438(1), 61–65. https://doi.org/10.1016/ s0014-5793(98)01227-7. Ligr, M., Velten, I., Fröhlich, E., Madeo, F., Ledig, M., Fröhlich, K. U., Wolf, D. H., & Hilt, W. (2001). The proteasomal substrate Stm1 participates in apoptosis-like cell death in yeast. Molecular Biology of the Cell, 12(8), 2422–2432. https://doi.org/10.1091/mbc.12.8.2422. Loisel, D. A., Alberts, S. C., & Ober, C. (2008). Functional significance of MHC variation in mate choice, reproductive outcome, and disease risk. In S. C. Stearns & J. C. Koella (Eds.), Evolution in health and disease (2nd ed., pp. 95–108). Oxford: Oxford University Press. Longo, V. D., Ellerby, L. M., Bredesen, D. E., Valentine, J. S., & Gralla, E. B. (1997). Human Bcl-2 reverses survival defects in yeast lacking superoxide dismutase and delays death of wild-type yeast. The Journal of Cell Biology, 137(7), 1581–1588. https://doi.org/10.1083/jcb.137.7.1581. Longo, V. D., Mitteldorf, J., & Skulachev, V. P. (2005). Programmed and altruistic ageing. Nature Reviews. Genetics, 6(11), 866–872. https://doi.org/10.1038/nrg1706.

66

2 Evolution and Phenoptosis

Ludovico, P., Rodrigues, F., Almeida, A., Silva, M. T., Barrientos, A., & Côrte-Real, M. (2002). Cytochrome c release and mitochondria involvement in programmed cell death induced by acetic acid in Saccharomyces cerevisiae. Molecular Biology of the Cell, 13(8), 2598–2606. https://doi.org/10.1091/mbc.e01-12-0161. Madeo, F., Fröhlich, E., & Fröhlich, K. U. (1997). A yeast mutant showing diagnostic markers of early and late apoptosis. The Journal of Cell Biology, 139(3), 729–734. https://doi.org/10.1083/ jcb.139.3.729. Madeo, F., Fröhlich, E., Ligr, M., Grey, M., Sigrist, S. J., Wolf, D. H., & Fröhlich, K. U. (1999). Oxygen stress: A regulator of apoptosis in yeast. The Journal of Cell Biology, 145(4), 757–767. https://doi.org/10.1083/jcb.145.4.757. Madeo, F., Herker, E., Maldener, C., Wissing, S., Lächelt, S., Herlan, M., Fehr, M., Lauber, K., Sigrist, S. J., Wesselborg, S., & Fröhlich, K. U. (2002). A caspase-related protease regulates apoptosis in yeast. Molecular Cell, 9(4), 911–917. https://doi.org/10.1016/s1097-2765(02) 00501-4. Manon, S., Chaudhuri, B., & Guerin, M. (1997). Release of cytochrome c and decrease of cytochrome c oxidase in Bax-expressing yeast cells, and prevention of these effects by coexpression of Bcl-xL. FEBS Letters, 415(1), 29–32. https://doi.org/10.1016/s0014-5793(97) 01087-9. Maynard Smith, J. (1964). Group selection and kin selection. Nature, 201(4924), 1145–1147. Maynard Smith, J. (1976). Group selection. The Quarterly Review of Biology, 51(2), 277–283. https://www.journals.uchicago.edu/doi/abs/10.1086/409311?journalCode¼qrb. Metchnikoff, E. (1915). La mort du papillon du Murier. Un chapitre de thanatologie. Annales de l’Institut Pasteur, 10, 477–497. Miller, H. M. (1931). Alternation of generations in the rotifer Lecane inermis Bryce. 1. Life histories of the sexual and non-sexual generations. Biological Bulletin (Woods Hole), 60(3), 345–381. www.journals.uchicago.edu/doi/abs/10.2307/1536879. Mitteldorf, J. (2006). How evolutionary thinking affects people’s ideas about aging interventions. Rejuvenation Research, 9(2), 346–350. https://doi.org/10.1089/rej.2006.9.346. Muñoz-Dorado, J., Marcos-Torres, F. J., García-Bravo, E., Moraleda-Muñoz, A., & Pérez, J. (2016). Myxobacteria: Moving, killing, feeding, and surviving together. Frontiers in Microbiology, 7, 781. https://doi.org/10.3389/fmicb.2016.00781. Munro, D., & Blier, P. U. (2012). The extreme longevity of Arctica islandica is associated with increased peroxidation resistance in mitochondrial membranes. Aging Cell, 11(5), 845–855. https://doi.org/10.1111/j.1474-9726.2012.00847.x. Noodén, L. D. (1988a). The phenomena of senescence and aging. In L. D. Noodén & A. C. Leopold (Eds.), Senescence and aging in plants (pp. 1–51). San Diego: Academic. Noodén, L. D. (1988b). Abscisic acid, auxin, and other regulations of senescence. In L. D. Noodén & A. C. Leopold (Eds.), Senescence and aging in plants (pp. 329–367). San Diego: Academic. Noodén, L. D. (1988c). Whole plant senescence. In L. D. Noodén & A. C. Leopold (Eds.), Senescence and aging in plants (pp. 391–442). San Diego: Academic. Norris, M. J. (1934). Contributions toward the study of insect fertility. III. Adult nutrition, fecundity, and longevity in the genus Ephestia: Epidoptera, Phycitidea. Proceedings. Zoological Society of London, 1, 333–360. Nowak, A. M., Tarnita, C. E., & Wilson, E. O. (2010). The evolution of eusociality. Nature, 466 (7310), 1057–1062. https://doi.org/10.1038/nature09205. Nussey, D. H., Froy, H., Lemaitre, J. F., Gaillard, J. M., & Austad, S. N. (2013). Senescence in natural populations of animals: Widespread evidence and its implications for bio-gerontology. Ageing Research Reviews, 12(1), 214–225. https://doi.org/10.1016/j.arr.2012.07.004. Ober, C. (1992). The maternal-fetal relationship in human pregnancy: An immunogenetic perspective. Experimental and Clinical Immunogenetics, 9(1), 1–14. Ober, C., & van der Ven, K. (1997). Immunogenetics of reproduction: An overview. In L. B. Olding (Ed.), Reproductive immunology (pp. 1–23). Berlin/Heidelberg: Springer.

References

67

Ober, C., Weitkamp, L. R., Cox, N., Dytch, H., Kostyu, D., & Elias, S. (1997). HLA and mate choice in humans. American Journal of Human Genetics, 61(3), 497–504. https://doi.org/10. 1086/515511. Ober, C., Hyslop, T., Elias, S., Weitkamp, L. R., & Hauck, W. W. (1998). Human leukocyte antigen matching and fetal loss: Results of a 10 year prospective study. Human Reproduction, 13(1), 33–38. https://doi.org/10.1093/humrep/13.1.33. Ober, C., Weitkamp, L. R., & Cox, N. (1999). HLA and mate choice. In R. E. Johnston, D. MüllerSchwarze, & P. W. Sorenson (Eds.), Advances in chemical signals in vertebrates (pp. 189–199). New York: Kluwer Academic Press. Philipp, E. E. R., & Abele, D. (2010). Masters of longevity: Lessons from long-lived bivalves – A mini-review. Gerontology, 56(1), 55–65. https://doi.org/10.1159/000221004. Pozniakovsky, A. I., Knorre, D. A., Markova, O. V., Hyman, A. A., Skulachev, V. P., & Severin, F. F. (2005). Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast. The Journal of Cell Biology, 168(2), 257–269. https://doi.org/10.1083/jcb. 200408145. Qiu, J., Yoon, J. H., & Shen, B. (2005). Search for apoptotic nucleases in yeast: Role of Tat-D nuclease in apoptotic DNA degradation. The Journal of Biological Chemistry, 280(15), 15370–15379. https://doi.org/10.1074/jbc.M413547200. Raff, M. (1998). Cell suicide for beginners. Nature, 396(6707), 119–122. https://doi.org/10.1038/ 24055. Remane, A. (1932). Rotatoria. In H. G. Bronn (Ed.), Dr. HG Bronn’s Klassen und Ordnungen des Tierreichs. Acoela und Rhabdocoelida (Vol. 4, part 2(1):1–576). Leipzig: C. F. Winter. Ricklefs, R. E. (1998). Evolutionary theories of aging: confirmation of a fundamental prediction, with implications for the genetic basis and evolution of life span. Am Nat 152(1), 24–44. https:// doi.org/10.1086/286147 Robinson, H. P., & Caines, J. S. (1977). Sonar evidence of early pregnancy failure in patients with twin conceptions. British Journal of Obstetrics and Gynaecology, 84(1), 22–25. https://doi.org/ 10.1111/j.1471-0528.1977.tb12460.x. Schopenhauer, A. (1819). Die Welt als Wille und Vorstellung: Vier Bücher, nebst einem Anhange, der die Kritik der Kantischen Philosophie enthält. Leipzig: Brockhaus (in English: The World as Will and Representation. Dover Publications, New York, 1969, p. 276). Scrimshaw, S. C. M. (1984). Infanticide in human populations: Societal and individual concerns. In G. Hausfater & S. B. Hrdy (Eds.), Infanticide: Comparative and evolutionary perspectives. New York: Aldine. Shiina, T., Inoko, H., & Kulski, J. K. (2004). An update of the HLA genomic region, locus information and disease associations: 2004. Tissue Antigens, 64(6), 631–649. https://doi.org/ 10.1111/j.1399-0039.2004.00327.x. Skulachev, V. P. (1997). Aging is a specific biological function rather than the result of a disorder in complex living systems: Biochemical evidence in support of Weismann’s hypothesis. Biochemistry (Mosc), 62(11), 1191–1195. http://protein.bio.msu.ru/biokhimiya/contents/v62/full/ 62111394.html. Skulachev, V. P. (1999). Phenoptosis: Programmed death of an organism. Biochemistry (Mosc), 64 (12), 1418–1426. http://protein.bio.msu.ru/biokhimiya/contents/v64/full/64121679.html. Skulachev, V. P. (2002a). Programmed death phenomena: From organelle to organism. Annals of the New York Academy of Sciences, 959, 214–237. https://doi.org/10.1111/j.1749-6632.2002. tb02095.x. Skulachev, V. P. (2002b). Programmed death in yeast as adaptation? FEBS Letters, 528(1–3), 23–26. https://doi.org/10.1016/s0014-5793(02)03319-7. Skulachev, V. P. (2003). Aging and the programmed death phenomena. In T. Nyström & H. D. Osiewacz (Eds.), Topics in current genetics (Model systems in aging) (Vol. 3, pp. 191–238). Berlin/Heidelberg: Springer. Skulachev, V. P. (2010). The talk at the “From Homo sapiens to Homo sapiens liberatus” workshop, 2010, May 26, Moscow (Russia).

68

2 Evolution and Phenoptosis

Skulachev, V. P., & Longo, V. D. (2005). Aging as a mitochondria-mediated atavistic program: Can aging be switched off? Annals of the New York Academy of Sciences, 1057, 145–164. https:// doi.org/10.1196/annals.1356.009. Slev, P. R., Nelson, A. C., & Potts, W. K. (2006). Sensory neurons with MHC-like peptide binding properties: Disease consequences. Current Opinion in Immunology, 18(5), 608–616. https://doi. org/10.1016/j.coi.2006.07.012. Spencer, H. (1864). The principles of biology. London: Williams and Norgate. Tannreuther, G. W. (1919). Studies on the rotifer Asplanchna ebbesbornii, with special reference to the male. The Biological Bulletin, 37(3), 194–208. Thane, A. (1974). Rotifera. In A. C. Giese & J. S. Pearse (Eds.), Reproduction of marine invertebrates (Vol. I, pp. 471–484). New York: Academic. Tregenza, T., & Wedell, N. (2000). Genetic compatibility, mate choice and patterns of parentage: Invited review. Molecular Ecology, 9(8), 1013–1027. https://doi.org/10.1046/j.1365-294x. 2000.00964.x. Trivers, R. L. (1971). The evolution of reciprocal altruism. The Quarterly Review of Biology, 46(1), 35–57. https://doi.org/10.1086/406755. Varma, T. R. (1979). Ultrasound evidence of early pregnancy failure in patients with multiple conceptions. British Journal of Obstetrics and Gynaecology, 86(4), 290–292. https://doi.org/10. 1111/j.1471-0528.1979.tb11258.x. Vaupel, J. W., Baudisch, A., Dölling, M., Roach, D. A., & Gampe, J. (2004). The case for negative senescence. Theoretical Population Biology, 65(4), 339–351. https://doi.org/10.1016/j.tpb. 2003.12.003. Walter, D., Wissing, S., Madeo, F., & Fahrenkrog, B. (2006). The inhibitor-of-apoptosis protein Bir1p protects against apoptosis in S. cerevisiae and is a substrate for the yeast homologue of Omi/HtrA2. Journal of Cell Science, 119(Pt 9), 1843–1851. https://doi.org/10.1242/jcs.02902. Wedekind, C., & Füri, S. (1997). Body odour preferences in men and women: Do they aim for specific MHC combinations or simply heterozygosity? Proceedings of the Biological Sciences, 264(1387), 1471–1479. https://doi.org/10.1098/rspb.1997.0204. Wedekind, C., Seebeck, T., Bettens, F., & Paepke, A. J. (1995). MHC-dependent mate preferences in humans. Proceedings of the Biological Sciences, 260(1359), 245–249. https://doi.org/10. 1098/rspb.1995.0087. Weismann, A. (1889, 1st ed. 1889, 2nd ed. 1891). In: E. B. Poulton, S. Schonland, A. E. Shipley (Eds.), Essays upon heredity and kindred biological problems (Vol. I). Oxford: Clarendon Press. Wigglesworth, V. B. (1972). The principles of insect physiology (7th ed.). London: Chapman and Hall. Wilson, E. O. (1975). Sociobiology, the new synthesis. Cambridge: Harvard University Press. Wireman, J. W., & Dworkin, M. (1977). Developmentally induced autolysis during fruiting body formation by Myxococcus xanthus. Journal of Bacteriology, 129(2), 798–802. Wissing, S., Ludovico, P., Herker, E., Büttner, S., Engelhardt, S. M., Decker, T., Link, A., Proksch, A., Rodrigues, F., Corte-Real, M., Fröhlich, K. U., Manns, J., et al. (2004). An AIF orthologue regulates apoptosis in yeast. Journal of Cell Biology, 1667, 969–974. https://doi.org/10.1083/ jcb.200404138.

Chapter 3

Evolutionary Medicine

3.1

Definition of Evolutionary Medicine

In the same way that in current traditional medicine, it is not conceivable to talk about gerontology and geriatrics without considering the general medical knowledge, similarly, it is not conceivable to discuss evolutionary gerontology and geriatrics regardless of the general concepts of evolutionary medicine. In Chapter 1 – Introduction, evolutionary medicine has already been defined as: “the enterprise of using evolutionary biology to address the problems of medicine” (Nesse 2008). It has also been pointed out that evolutionary medicine is not one of the many unscientific alternative medicines but the integration of current medicine with the concepts of evolutionism and the implications of these concepts. Such reinforcements enrich the scientific basis of medicine as well as other scientific disciplines such as, for example, chemistry and physics, which have enriched and enrich medical scientific bases. On the other hand, denying the possible contribution of evolutionism to medicine means limiting and impairing the full scientific validity of medicine. About the importance of this scientific enrichment, if marginal and of minimal importance or on the contrary fundamental and of great importance, the evidence will provide an answer in this regard.

3.2

A Brief History of Evolutionary Medicine

A “Brief History of Evolution in Medicine” was proposed in 2008 in a book edited by Trevathan, Smith, and McKenna (Fig. 3.1) (Trevathan et al. 2008b, pp. 4–9). In the same book, Nesse (Fig. 3.2) gives other information about this subject (Nesse 2008).

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0_3

69

70

3 Evolutionary Medicine

Fig. 3.1 James J. McKenna

Fig. 3.2 Randolph M. Nesse

Some scientists may be considered precursors of evolutionary medicine for some innovative ideas that anticipate its official birth. Erasmus Darwin (Fig. 3.3), the grandfather of Charles Darwin, may be considered a prophetic forerunner of both evolutionism and evolutionary medicine: “As Randolph Nesse notes (Chapter 23), Erasmus Darwin (1731–1802) was one of the first physicians to think explicitly about change in nature and how changes observed in nature might be paralleled in humans, writing in his two-volume work, Zoonomia, or the Laws of Organic Life (Darwin 1794–1796). The work is divided into three parts, with Part 2 entitled ‘A Catalogue of Diseases Distributed into Natural Classes According to Their Proximate Causes, With Their Subsequent Orders, Genera and Species, and With Their Methods of

3.2 A Brief History of Evolutionary Medicine

71

Fig. 3.3 Erasmus Darwin (1731–1802)

Cure.’ So when we refer to Darwinian medicine, we are, in some sense, referring to both Charles Darwin as well his grandfather. (Trevathan et al. 2008b, p. 5) The first mention of the potential utility of evolution for medicine is found in Darwin, not Charles, but his grandfather, the physician and poet Erasmus Darwin. The preface to his 1796 philosophical poem, Zoonomia, contains a remarkably prescient description of evolution, as well as its potential as a foundation for medicine (Darwin 1794–1796, pp. vii–viii) . . . . (Nesse 2008) The want of a theory, deduced from such strict analogy, to conduct the practice of medicine is lamented by its professors; for, as a great number of unconnected facts are difficult to be acquired, and to be reasoned from, the art of medicine is in many instances less efficacious under the direction of its wisest practitioners . . . . A theory founded upon nature, that should bind together the scattered facts of medical knowledge, and converge into one point of view the laws of organic life, would thus on many accounts contribute to the interest of society . . . it would enable every one of literary acquirements to distinguish the genuine disciples of medicine from those of boastful effrontery, or of wily address; and would teach mankind in some important situations the knowledge of themselves. (Darwin 1794–1796)” (reported in Nesse 2008, p. 420)

Dudley J. Morton (1884–1960) (Morton 1926) is another precursor pointed out by Trevathan et al.: “He recognized that understanding what was a true departure from normal, and hence appropriate for clinical intervention, depended directly on knowledge of what constitutes the normal range of human variation and knowledge of what factors maintain normal conditions. He recognized that in order to maintain normalcy, medicine had to develop practices that reinforced the natural safeguards the body possessed against forces that would disrupt normalcy.” (Trevathan et al. 2008b, p. 6) Trevathan et al. also indicate that a well-known group of studies born from the common trunk of medicine are, in fact, entirely studies of evolutionary medicine

72

3 Evolutionary Medicine

(Trevathan et al. 2008a). For example, Allison demonstrated that, in areas with a high incidence of malaria, individuals with the sickle-cell gene were favored by natural selection (Allison 1954). Again, Livingstone pointed out that with the destruction of large areas of the forest caused by the spread of agriculture, there was the formation of water holes that were breeding grounds for Anopheles gambiae, the vector of Plasmodium falciparum, the protozoan that causes malaria. The heterozygous form of sickle-cell disease gives a relative immunity to malaria, and so, although the homozygote form is deadly, the sickle-cell gene was favored by natural selection (Livingstone 1958). About the idea of human design flaws, Nesse and Williams underlined that: “The prevalence of maladaptive human design features has been recognized for a long time. A 1941 book by George Hoben Estabrooks, Man, The Mechanical Misfit (Estabrooks 1941), describes many of the structural defects and compromises in human anatomy . . .” (Nesse and Williams 1994, p. 131) and, in the pertinent note: “While it [the work of Estabrooks] does describe many design flaws of the human body, its main message is the misfit between that design and the uses to which it is put in modern times.” (Nesse and Williams 1994, p. 263) Their interpretation of Estabrooks’ contribution (Estabrooks 1941) is reported by Lewis (Lewis 2008, p. 400): “as prefiguring the notion of maladaptation to same extent”. Moreover, Lewis points out that Nesse and Williams in their 1994 book disregarded two other works that somehow anticipate concepts of evolutionary medicine, i. e. Haldane’s Disease and Evolution (Haldane 1949) and Krogman’s Scars of Evolution (Krogman 1951). Eaton (Fig. 3.4), Konner (Fig. 3.5), and Shostak (Fig. 3.6) are most often cited in Trevathan et al.’s book (Trevathan et al. 2008b). These authors, who should be considered not forerunners but founders of evolutionary medicine before its official Fig. 3.4 S. Boyd Eaton

3.2 A Brief History of Evolutionary Medicine Fig. 3.5 Melvin J. Konner

Fig. 3.6 Marjorie Shostak (1945–1996) with a !Kung San woman

73

74

3 Evolutionary Medicine

birth, theorized and documented that: “When conditions of life for any animal population deviate from those to which it has genetically adapted, biological maladjustment – discordance – is inevitable. The human species is no exception. For us, discordance between our current lifestyle and the one in which we evolved has promoted the chronic and deadly ‘diseases of civilization’: the heart attacks, strokes, cancer, diabetes, emphysema, hypertension, cirrhosis, and like illnesses that cause 75 percent of all mortality in the United States and other industrialized nations.” (Eaton et al. 1988, p. 5), and coined the term “mismatch” (Eaton et al. 1988). The subsequent history of evolutionary medicine is well known. Williams and Nesse’s 1991 paper (Williams and Nesse 1991) and Nesse and Williams’ 1994 book (Nesse and Williams 1994) mark the official birth of evolutionary medicine. The books edited by Stearns (Fig. 3.7) in 1999 (Stearns 1999), Stearns and Koella in 2008 (Stearns and Koella 2008), Trevathan, Smith and McKenna in 2008 (Trevathan et al. 2008a) are notable points in a long sequence of works dedicated to topics of evolutionary medicine. However, two other works should be considered as precursory, or even more, of evolutionary medicine. The first is the famous book of Price (Fig. 3.8), Nutrition and Physical Degeneration, published in 1939 (Price 1939). Dr. Weston Andrew Price (1870–1948), a Cleveland dentist, was not an evolutionary biologist, and some of his ideas about races and peoples are linked to those prevailing at the time and are obviously wrong or unacceptable in modern times. However, Price went all over the world to study the conditions of the teeth among the Fig. 3.7 Stephen C. Stearns

3.2 A Brief History of Evolutionary Medicine

75

Fig. 3.8 Weston Andrew Price (1870–1948)

primitive peoples still existent in his time in various parts of the world, comparing them with those of Western populations, or in general of “civilized” people. About dental and, in general, health conditions, the book details various ethnographic nutritional observations about disparate cultures, as Native Americans, Pygmies, Polynesians, the Lötschental valley in Switzerland, etc. His imposing research materials include many filmstrips, some 15,000 photographs, and 4000 slides. Price documented that various diseases, as dental caries and tuberculosis, common in “civilized” countries in the 1920s and 1930s, were a rarity or absent in primitive peoples. Moreover, he documented that as these populations abandoned their diets and lifestyles and adopted those of Western nations, they showed streaking increases in the frequency of diseases considered typical of modern countries. He concluded that Western habits, included the preparation and storage of foods that stripped away essential vitamins and minerals, were the cause of these “epidemic” diseases. It is possible and correct to say that Price in his research is partly an amateur, often lacks the rigor of reporting precise numbers and statistical analyses. These and other criticisms are possible, but they do not undermine the core of its results. His research is extraordinary. In large part, it is unrepeatable, as most of the populations he studied lives today in modern conditions. It convincingly documents that teeth health state has passed from a primitive condition, in which the people live according to their ancestral customs, are well adapted to their environment, and show a fundamentally sound teeth, to modern conditions associated with severe and widespread deterioration of dental health (Fig. 3.9). Price expands its considerations to the development of the

76

3 Evolutionary Medicine

Fig. 3.9 In the upper part: natives following ancestral dietary habits (“teeth . . . excellent and free from dental caries” (Price 1939, p. 225)); in the lower part: natives following modern diets (multiple dental caries, pyorrhea, “changes in facial form” (Price 1939, p. 137), “crowding of the teeth” (Price 1939, p. 156)). (Photos from Price 1939)

3.2 A Brief History of Evolutionary Medicine

77

facial bones (essential for proper development of the teeth), to the correct formation of all the skeletal and the general state of health. Price notes that we have progressed from a state of optimal adaptation in primitive conditions to a state of profound imbalance between adaptation and lifestyles that causes severe and/or widespread disease. In short, without skill or technical background in evolutionary biology but with extensive and imposing documentation, Price anticipates a number of conditions that will be later defined as “mismatches”. “Since we have known for a long time that savages have excellent teeth and that civilized men have terrible teeth, it seems to me that we have been extraordinarily stupid in concentrating all of our attention upon the task of finding out why our teeth are so poor, without ever bothering to learn why savage teeth are good.” (From the Foreword of Earnest A. Hooton, Harvard University, November 21, 1938, to Price’s book) (Price 1939, p. XXI) “His travels proved his theory: if you eat your native ethnic diet in an unprocessed form you will have good mental, physical, and dental health. If you eat highly processed foods, which adds questionable agents and removes essential nutrients, your health deteriorates.” (From the comment of Patrick Quillin, former Vice President of Nutrition for Cancer Treatments Centers of America, to the 2011 edition of Price’s book) (Price 1939, p. XXXVII)

In 1950, a review in the journal The Laryngoscope said that “Dr. Price might well be called The Charles Darwin of Nutrition” (Jones et al. 1950). The other work that, together with other arguments, anticipates much of evolutionary medicine was a book proposed in Italian in 1983 and translated into English in 2011 (Libertini 1983). It explicitly anticipates many concepts of evolutionary medicine, and in some respects, after about 38 years (!), it is on positions that appear to be more advanced than those commonly accepted today. The work anticipates the concept that the phenomenon “disease” should absolutely be considered in the context of evolution and not treated as extraneous to evolutionary process: “From an evolutionary point of view, diseases are not something that breaks out of the mould but are, rather, a whole series of categories of phenomena which are evolutionarily ‘predictable’ in their general essence. . . . The evolutionary approach to the concept of disease is the most rational and general one possible. Any other more limited approach, even one which is more useful as regards a single pathological problem, simply because it is more limited and selectively oriented, should not be conceived in terms that run contrary to the theory of evolution.” (Libertini 1983, from the English edition of 2011, p. 83) In the book, a general classification of the diseases in evolutionary terms was proposed. This suggestion was presented as founded on a rational basis and, with some modifications and enrichments, it is the classification that will be introduced in this chapter. “From this formulation, indeed, as spontaneous, natural and empirically confirmable facts, certain categories of events will arise, each with its own distinct definition, but which can be covered by a single, overall definition under the term ‘disease’ . . . Diseases deriving from alterations of the genotype . . . Diseases deriving from alterations of the ecological niche . . . Diseases deriving from the relations with other living beings . . .

78

3 Evolutionary Medicine Diseases deriving from ‘excesses of the ecological niche’ . . .” (Libertini 1983, from the English edition of 2011, pp. 84–9)

The concept of “mismatch” is specifically and explicitly defined: “. . . a random modification of the ecological niche, as it reduces the order of the system, alters, for the most part, the equilibrium between species and ecological niche – read: adaptation -, i.e., entails a lesser aptitude for persistence in the individuals of the species. Lesser fitness means, by definition, damage or the possibility of damage for the individuals of the species. . . . The human species . . . provides significant examples of great modifications in the ecological niche that have led to, either by themselves or in concomitance with other factors, the outbreak of real epidemics. I could mention: (a) Smoking and lung cancer and chronic bronchitis; (b) The high calorie diet and atherosclerotic disease and diabetes mellitus type II; (c) Diets low in vegetable waste and constipation, hemorrhoids, rhagades, anal fistulas, diverticulosis of the colon and, possibly, cancer of the rectum; (d) The gathering of the population in large urban areas and the tremendous infectious epidemics of the pre-industrial era (and the less dramatic ones of modern times); (e) The stress of urban and ‘civilized’ life and mental and psychosomatic diseases; (f) The intake of and contact with drugs, industrial chemical substances, etc. and related pathologies.” (Libertini 1983, from the English edition of 2011, p. 87)

The work anticipates certain issues arising from the relationship between the parasite and the parasitized: in the case of bacteria and host, in reference to the antigenic characteristics of host cell surfaces and the attempt of bacteria to emulate these surfaces evolutionarily with the mechanism of antigen mimicry. The most original issue of the book, a heretical argument for a long time and still today for many, is the interpretation of the aging phenomenon. In fact, from the moment of the official birth of evolutionary medicine by Williams and Nesse, the interpretation of aging for evolutionary medicine is virtually identical to that of traditional medicine. According to this interpretation, which is based mainly on three theories (namely, mutation accumulation hypothesis (Medawar 1952; Hamilton 1966; Edney and Gill 1968; Mueller 1987; Partridge and Barton 1993), antagonistic pleiotropy hypothesis (Williams 1957; Rose 1991), and disposable soma hypothesis (Kirkwood 1977; Kirkwood and Holliday 1979)), aging does not exist as an entity in its own right. For these theories, all widely disavowed by empirical evidence and theoretical arguments (Libertini 2008, 2015), aging is the result of the cumulative effect of harmful genes that are insufficiently eliminated by natural selection, also because they are advantageous at younger ages, or cannot be eliminated due to contrasting needs. For this interpretation, aging is a set of disparate diseases that display their effects more and more as the individual gets older. So, phenomena related to aging must be classified among the diseases, each in a distinct manner depending on the different manifestations. On the contrary, the book proposes a totally different interpretation, namely that aging is a physiological phenomenon with an evolutionary advantage, i.e., favored by natural selection in terms of supra-individual selection. For these reasons, a distinct subcategory was dedicated to the aging phenomenon and its manifestations

3.3 The Concept of Normality in Evolutionary Medicine

79

in the classification of diseases and related phenomena, i.e., within the category of physiological phenomena that cause suffering and damage.

3.3

The Concept of Normality in Evolutionary Medicine

“Normal” is considered what is usual or more frequent. For example, it is normal for a human being to have two ears, two eyes, a nose, ten fingers in two hands, and so on, while it is abnormal to have a different number of these anatomical parts. In statistics, for a variable with many acceptable values, as indicators of the normality can serve the average value, or the median value. For variables that show the so-called gaussian or normal distribution, it is also possible to define how many of the samples have a value between μ + σ n and μ
σ n (where μ ¼ mean value; σ ¼ standard deviation; n ¼ an integer number) (Fig. 3.10). From this, a value could be defined as normal if it is in the range μ  n σ, where n is arbitrarily chosen. However, all these precise definitions have a logical meaning only if we specify the population from which the samples are drawn and within which we want to define whether something is normal or not. In the fantastic story The Country of the Blind by Herbert George Wells (Wells 1904), the protagonist reaches a valley in the Andes completely isolated for generations and where everyone is blind and with eyes atrophied due to a genetic defect. His ability to see is not believed and his eyes are considered the origin of his madness (Fig. 3.11). The inhabitants want to try to heal him from his abnormality by removing his eyes, which no one has, and so he is forced to flee.

Fig. 3.10 In a gaussian or normal distribution 68% and 95% of the samples are within the range μ  σ and μ  2 σ, respectively (Armitage et al. 2002)

80

3 Evolutionary Medicine

Fig. 3.11 The inhabitants of the Andean valley, who are blind and have atrophied eyes, touch with wonder the anomaly constituted by protagonist’s eyes and believe that they are the source of his inconclusive statements about the ability to “see”

In a cemetery, it is normal to be dead, among the patients of a mental hospital, it is normal to be crazy, while outside of these areas, it is normal to be alive and sane. These paradoxical examples may seem banalities and abstract concepts without any practical importance for medicine. Moreover, an intelligent observer could easily dispute them with the simple observation that it is essential to consider a sufficiently large number of individuals (excluding particular categories!) and not only a fraction of the population with uncommon characteristics. But this solves only the surface of the problem, and a simple example quickly shows it. Forty or fifty years ago, it was usual, even for physicians, to say that the “normal” value of systolic blood pressure was roughly equal to: 100 + age. A study conducted in 1972 on the population of London confirmed this empirical rule, but the same study showed that in a primitive population (the Bushmen or !Kung of Botswana) the arterial systolic pressure was around 120 mmHg at all ages (Truswell et al. 1972) (Fig. 3.12). Therefore, even considering large parts of the human species (i.e., huge populations with modern lifestyles), we obtain questionable results, as surely we cannot consider “normal” in medical terms individual with pressure values that increase with age and so with increasing cardiovascular risks. To escape this contradiction, it is possible to use the concepts of health range (Klimis-Zacas and Wolinsky 2005; Jaminet and Jaminet 2012; McGrady and Moss 2013) or optimal health range (Chaker et al. 2017). These notions define reference ranges based on parameters associated with optimal health or minimal risk of related complications and diseases, rather than the standard range based on the values observed in a population. However, the concept of “health range” is based on practical and not rational evaluations, and to obtain the “normal” value may require many years and generate many controversies (e.g.: see the questions about the definitions of the normal values for arterial pressure and cholesterolemia).

3.3 The Concept of Normality in Evolutionary Medicine

81

Fig. 3.12 Arterial blood pressures in !Kung individuals (dashed lines) and in London citizens (continuous lines). (From Truswell et al. 1972, modified and redrawn)

These statements indicate that it is essential and even indispensable a rational definition of “normality” based on a scientific theory. As a matter of fact, the definition of “normality” is an essential preliminary necessity for the study of the disease phenomenon in evolutionary terms and it can be immediately derived from a fundamental concept of evolutionary theory. A species is adapted at best to its ecological niche (physical habitat, dietary habits, relations with other species, etc.). If the individuals of a species live in the conditions of the ecological niche to which the species is adapted, they should be in the best possible health conditions. So, the statistical values related to the individuals living in the conditions of the ecological niche to which the species is well adapted, are defined as “normal” and the ecological niche serves as criterion of “normality”. Thus, to know the conditions of “normality” for a species and to define any parameter as “normal”, first of all it is essential to study the species in natural conditions or at least as close to the natural ones as possible. By applying such concepts to our species, any characteristic must first be studied in populations that are as primitive as possible, i.e., living as far as possible in the ecological niche to which our species (and the specific population) is adapted. The normal parameters so obtained can subsequently be compared with those of populations living in modern conditions. Only at this point, the parameters obtained in modern populations can be considered whether in the range of normality or outside of normality. This evolutionary definition of normality is not a simple semantic curiosity but a fundamental concept for evolutionary medicine. Let us see three examples of how the use or non-use of this concept has profound consequences in the way we interpret and describe the causes of the disease.

82

3 Evolutionary Medicine

– Example 1 A convenient summary of well-known information about hypertension, shared by authoritative texts (e.g., (Black and Elliott 2007; Bonow et al. 2012)), is as follows: Primary or essential hypertension is the most common form of hypertension. In modern societies, systolic blood pressure rises with aging and hypertension is an age-related characteristic. Hypertension is the effect of a complex interaction between environmental factors and genes. The genetic basis of hypertension is only in part known, although we know various common genetic variants that have small effects on blood pressure and some rare mutants that strongly increase blood pressure. Blood pressure is influenced by many environmental factors. Lifestyle factors that lower blood pressure are: reduced dietary salt intake, low-fat products, increased consumption of fruits, weight loss, exercise and reduced alcohol intake. Lifestyle factors that increase blood pressure are: increased dietary salt intake, highfat products, low consumption of fruits, weight gain, reduced exercise, increased alcohol intake. Other factors such as stress, caffeine consumption, and vitamin D level have a not clear role in the development of hypertension. By using the evolutionary concept of normality and the same evidence expounded in the above-said references, the scientific description would be quite different: High blood pressure is a very rare condition in populations living under normal conditions (i.e., the ecological niche to which our species has adapted). The large and growing prevalence of hypertension in modern societies is a consequence of altered living conditions. The age-related increase in blood pressure is not physiological but part of the consequences of these altered conditions of life. The alterations in lifestyle that lead to hypertension are quite known, although further study is necessary. The onset and evolution of hypertension are influenced by a series of normal genes that are non-pathological under “normal” conditions. These genes are not the primary cause of hypertension but are part of the mechanisms by which the disease is expressed and then worsens. Concerning hypertension, to define them as cause or contributing cause or aggravating cause or, in general, as harmful or pathologic genes is profoundly erroneous because, under normal conditions, they are not at all cause of illness. Indeed, it is likely that they are part of physiological mechanisms that are useful or essential for survival under normal conditions. Only in some rare cases, where a gene causes hypertension under natural conditions (and likely under modified conditions too), the definition of pathological gene is appropriate, and the gene constitutes the primary cause of hypertension. The approach of current medicine, as it is clearly confirmed by literature (Black and Elliott 2007; Bonow et al. 2012), leads to address medical efforts on: (i) drugs to counter hypertension; and (ii) the genetics of the “bad genes” that in various ways

3.3 The Concept of Normality in Evolutionary Medicine

83

contribute to the development of the disease. Moreover, the attention is, in general, focused on treating the disease and its complications and not on its prevention. The approach of evolutionary medicine definitely indicates that the attention of the research must be focused on the primary cause of the disease, namely the changes of the ecological niche that cause the disease, and that the most significant efforts must be devoted to the prevention of the disease by eliminating or somehow compensating for those changes in the ecological niche that are the primary causes of the disease. – Example 2 Sometimes, we try to distinguish between the genetic and environmental causes of a disease by investigating the frequency of the disease in two distinct groups of subjects (A and B) living in different conditions. Let us assume that the frequency of the disease is xA for the group A and xB for the group B, and that xA > xB. According to the traditional schemes, the conclusion could be that the difference between xA and xB (Δx) represents the effects of environmental factors and that xB represents the effects of genetic factors. This comparison is misleading because, if both groups live according to lifestyles that are more or less different from the “normal” conditions, both may suffer from the pathology in varying degrees (in proportion to the alterations of the ecological niche). Pathological genes might cause only a small part of the cases of the disease being studied. Therefore, the correct comparison should be that between two groups, the first (A) living in modern conditions and the other (B) in “normal” conditions. In this case, Δx would represent the portion due to alterations of the ecological niche and xB (which is presumably very small) that due to harmful genes. – Example 3 Sometimes, with the same aim of the previous example, a study tries to obtain a more precise and secure distinction by the observation of twin pairs, one of which (defined as belonging to the group A) lives in certain conditions and the other (group B) under different conditions. Let us define xA and xB as for the previous example. According to traditional schemes, the conclusions could be the same as for the previous example, but with more precise and reliable results as twin pairs and not unrelated individuals are studied. In particular, if the twins are homozygous, the results should have the highest accuracy and reliability. Nevertheless, such comparisons are misleading, since if in both groups the twins live according to lifestyles that are different from the “normal”, both groups may show the pathology without the necessary significant involvement of pathological genes. The correct comparison should be between twins, one living in altered conditions of the ecological niche and the other living in “normal” conditions. By this comparison, Δx would indicate the portion of cases due to non-genetic factors, i.e., the alterations of the ecological niche, and xB the portion of cases due to harmful genes.

84

3.4

3 Evolutionary Medicine

The Concept of Mismatch in Evolutionary Medicine

The adaptation of a species to its ecological niche is a process that takes a long time, or, more precisely, many generations. Moreover, this phenomenon implies a complex and intricate adaptation of the characters of the species (i.e., of the genes that determine them) to the multiple characteristics of the ecological niche. Therefore, the adaptation of a species to its ecological niche represents a very complex and ordered system. A random modification of a complex system causes – as more probable consequence – an alteration of its functionality as much as a random modification of a complex machine (Fig. 3.13). Similarly, any modification of the ecological niche, if not neutral, will be as more probable event a cause of a “mismatch” between the adaptation of the individuals of the species and the new conditions and this will be a probable cause of physiological dysfunctions (Fig. 3.14).

3.5

Diseases Caused by Mismatches

Mismatches between adaptation of a species and new conditions in a modified ecological niche are very common and constitute the leading causes of diseases. Table 3.1 (from (Libertini 2009), modified), shows a small list of alterations of the ecological niche that cause diseases. The incidences of diseases and deaths caused by “mismatches” have been omitted in the table for brevity but they are frightening and increasing. Some particular cases

Fig. 3.13 A random modification of a complex machine is a likely cause of a malfunction

3.6 Diseases Caused by Alterations of the Genotype

85

Fig. 3.14 Evolutionary definition of normality and mismatches between adaptation and modified ecological niche

(obesity and diabetes) are illustrated in Tables 3.2, 3.3 and Figs. 3.15, 3.16. It is useful to highlight that for the few remaining hunter-gatherer populations studied a few years ago, obesity and diabetes were a rarity (Eaton et al. 1988).

3.6

Diseases Caused by Alterations of the Genotype

The genome of an organism is similar to a very sophisticated computer program that determines organism development and all its functions. As a more likely event, we already know that a random modification in a highly complex structure, if not neutral, causes an alteration of the structure and so determines dysfunctions. The transfer of preserved copies of the genome from a generation to the next is essential, and natural selection tries to contrast the spreading of genetic alterations. However, genome modifications are not entirely avoidable, and indeed the existence of a genetic variation is fundamental for the mechanisms of natural selection and evolution. Therefore, in a genome, there will be many genetic alterations, each with a frequency that is minimized by natural selection. The calculation of the equilibrium frequencies between the onset of new harmful mutations and their elimination by natural selection has been expounded elsewhere (Libertini 1983, 2009). Here is given a brief summary and the Appendix should be read for details regarding the achievement of the formulas from 3.1 to 3.7. For a harmful recessive gene C, its equilibrium frequency (Ce) will be given by the formula: Ce ¼

pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffi
v=ð
sÞ ¼ v=½s

ð3:1Þ

where v ¼ mutation rate from an inactive allele (C0 ) to C;
s ¼ damage caused by C (the value is negative as C is harmful); [s] ¼ absolute value of s.

86

3 Evolutionary Medicine

Table 3.1 Some common diseases caused by “mismatches” Excessive ingestion of salt -> hypertension (Eaton et al. 1988; Bragulat and de la Sierra 2002; Rodriguez-Iturbe et al. 2007) (-> heart hypertrophy, congestive heart failure, arrhythmias and sudden death (Morse et al. 2005)) Reduced exposition to natural light -> refractive defects (myopia, astigmatism, hyperopia) (Rose et al. 2008; Dirani et al. 2009) (myopia affects up to 70–90% of a population (Wong et al. 2000). It was estimated that by the year 2020, about 3 billion people will be affected by refractive defects (Kempen et al. 2004)) Excessive ingestion of unsaturated fats, caloric foods, meat with high-fat content -> obesity (-> renal cell carcinoma (Lipworth et al. 2006), heart hypertrophy, congestive heart failure, arrhythmias and sudden death (Morse et al. 2005)), type 2-diabetes and increased vascular risk (-> myocardial infarction, cerebral ischemia, infarcts in all the vascular districts, heart hypertrophy and failure, etc.) (Eaton et al. 1988) Occupational noise, smoking, and high Body Mass Index -> hearing loss (Fransen et al. 2008) Excessive exposure to noise -> hearing loss (Eaton et al. 1988; Daniel 2007) Smoking and/or air pollution -> chronic bronchitis (Viegi et al. 2006), emphysema (Taraseviciene-Stewart and Voelkel 2008) Smoking -> coronary heart disease and other cardiovascular diseases, chronic respiratory diseases, pregnancy complications, and respiratory diseases in children (Giovino 2007), carcinomas of lung (Clavel 2007; Giovino 2007)/larynx (Clavel 2007; La Vecchia et al. 2008)/bladder (Clavel 2007; Janković and Radosavljević 2007)/kidney (Lipworth et al. 2006)/pancreas (Hart et al. 2008), peptic ulcer (Halter and Brignoli 1998; Parasher and Eastwood 2000) Excessive ingestion of simple and refined carbohydrates (in particular sugar) and other dietary modifications -> dental caries, pyorrhea, crowded teeth (Price 1939; Eaton et al. 1988) Scarce ingestion of fibers -> constipation, colon diverticulosis, colon and stomach carcinoma, type 2-diabetes, metabolic syndrome and cardiovascular diseases (Trepel 2004), appendicitis (Arnbjörnsson 1983; Adamidis et al. 2000) Scarce ingestion of calcium and reduced physical activity -> osteoporosis (Eaton et al. 1988; National Institutes of Health 2000), back pain (Eaton et al. 1988) Reduced exposure to natural allergens in childhood -> allergies (Janeway et al. 2001) Exposure to chemical substances artificially synthesized -> allergic diseases (Kirchner 2002) Altered conditions of sociality, the stress of civilized conditions -> mental and psychiatric disorders (Eaton et al. 1988; Nesse and Williams 1994) Many factors -> increased incidence of many types of cancer (Eaton et al. 1988; Greaves 2000) Alcoholism -> hepatic steatosis, steatohepatitis, cirrhosis (Adachi and Brenner 2005), larynx carcinoma (La Vecchia et al. 2008)

If we use Hardy-Weinberg formula (CC + 2 CC0 + C0 C0 ¼ 1), the equilibrium frequency of the phenotype expressing the disadvantageous condition (Pe) will be: Pe ¼ Ce 2 ¼ v=½s

ð3:2Þ

For a harmful dominant gene C, its equilibrium frequency will be given by the formula:

3.6 Diseases Caused by Alterations of the Genotype

87

Table 3.2 Overweight (BMI >¼ 25) and obesity (BMI >¼ 30) in some countries (sex combined where not specified) ((Low et al. 2009) Country Australia Bahrain Brazil Canada Chile China Denmark Germany Hungary India Indonesia Japan Norway Poland Republic of Korea Saudi Arabia Singapore South Africa Switzerland UK USA Zimbabwe

Year of survey 2004–2005 1998–1999 2002–2003 2003 2003 2002 2000 2003 2003–2004 2005–2006 2001 2004*, 2001** 2002 2000–2001 2005*, 1998** 1995–2000 2004 1998 2002 2002 2003–2004 2005

Age range 18–100 19–100 20–100 18–100 17–100 18–100 16–100 18–100 18–100 15–49 15–100 15–100 15–100 19–100 20–100 30–70 18–69 15–100 15–100 15–84 20–100 25–100

Overweight % BMI>¼25 kg/m2 49.0 61.2 40.6 48.2 59.7 18.9 41.7 49.2 53.2 M 9.3; F 12.6 13.4 23.2* 31.5 52.2 31.8* 72.5 32.5 45.0 36.6 61.0 66.3 37.3

Obesity % BMI >¼ 30 kg/m2 16.4 28.9 21.9 14.9 21.9 2.9 9.4 12.9 17.7 M 1.3; F 2.8 2.4 3.1** 6.1 18.0 2.4** 35.6 6.9 24.0 7.7 22.7 32.7 15.7

Data from World Health Organization. Global database on body mass index. Available at: http:// www.who.int/bmi/index.jsp?introPage¼intro_3.html. Accessed June 11, 2008

 pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi Ce ¼ 1
1
3 v=½s =3 ¼ n pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffio n  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffio ¼ 1
1
3 v=½s 1 þ 1
3 v=½s = 3 1 þ 1
3 v=½s ¼ n  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffio ¼ð1
1 þ 3 v=½sÞ= 3 þ 3 1
3 v=½s  ð3 v=½sÞ=ð3 þ 3Þ ¼ 0:5 v=½s ð3:3Þ So, the equilibrium frequency of the phenotype expressing the disadvantageous condition (Pe) will be: Pe ¼ Ce 2 þ 2 Ce ð1
Ce Þ ¼ 2 Ce
Ce 2 ¼ 2 ð0:5 v=½sÞ
ð0:5 v=½sÞ2  v=½s

ð3:4Þ

88

3 Evolutionary Medicine

Table 3.3 International Diabetes Foundation (IDF) regions ranked by age-adjusted prevalence of diabetes in adults (20–79 years) in 2017 (estimates) and 2045 (projections)

Rank 1

6

IDF region North America and the Caribbean The Middle East and North Africa South-East Asia Western Pacific South and Central America Europe

7

Africa

2

3 4 5

Estimates 2017 Age-adjusted comparative diabetes prevalence (%) 11.0 (9.2–12.5)

Raw diabetes prevalence (%) 13.0 (10.8–14.5)

Projections 2045 Age-adjusted comparative diabetes prevalence (%) 11.1 (9.1–12.7)

Raw diabetes prevalence (%) 14.8 (11.7–16.7)

10.8 (7.5–14.2)

9.6 (6.7–12–7)

10.8 (7.4–14.3)

12.1 (8.4–15.9)

10.1 (7.9–12.8)

8.5 (6.5–10.7) 9.5 (8.4–12–0) 8.0 (6.7–9.8)

10.1 (7.9–12.8)

11.1 (8.6–13–9) 10.3 (7.8–12.8) 10.1 (8.3–12.4)

8.8 (7.0–12.0) 3.3 (2.1–6.0)

6.9 (5.5–9.9)

8.6 (7.6–11.0) 7.6 (6.3–9.5)

6.8 (5.4–9.9) 4.4 (2.9–7.8)

7.4 (5.8–9.2) 7.6 (6.2–9.6)

4.3 (2.9–7.7)

10.2 (8.2–13.7) 3.9 (2.6–6.8)

From Table 3.1 in Cho et al. (2018)

Fig. 3.15 Total number of adults (20–79 years) with diabetes mellitus in the period 2000–2017. (From Fig. 3.2 in (Cho et al. 2018), modified and redrawn)

These equilibrium frequencies are illustrated in Figs. 3.17 and 3.18. Phenotypic equilibrium frequencies of recessive and dominant genes are practically identical if v and s are equal. For chromosome alterations, if v is described as the frequency of onset of a chromosome alteration, its equilibrium frequency, which in this case coincides with the phenotypic frequency, will be:

3.6 Diseases Caused by Alterations of the Genotype

89

Fig. 3.16 Number of people with diabetes mellitus (20–79 years) in rural and urban settings, in 2017 (estimates) and 2045 (projections). (From Fig. 3.3 in (Cho et al. 2018), redrawn)

Fig. 3.17 Harmful recessive gene: Ce ¼ equilibrium gene frequency; Pe ¼ equilibrium phenotypic frequency

Pe ¼ Ce ¼ v=½s

ð3:5Þ

If n types of mutations, which we hypothesize with a mean mutation rate equal to v, can transform neutral alleles into C, the equilibrium phenotypic frequency of C will be: Pe ¼ n ðv=½sÞ

ð3:6Þ

These formulas indicate that with small values of v (e.g., v < 0.00001), if [s] is not very small, the predicted frequency of a disease caused by particular alterations of the genotype, i.e., the frequency of its phenotypic manifestation (Pe), will be minimal. This means that harmful alleles are efficaciously removed by natural selection.

90

3 Evolutionary Medicine

Fig. 3.18 Harmful dominant gene: Ce ¼ equilibrium gene frequency; Pe ¼ equilibrium phenotypic frequency

However, if the value of [s] is very small, e.g., when the disadvantageous expression of the gene happens at later ages when only a few individuals survive, and so the remaining expectation of life and the reproductive value is minimal, Pe will be not small. The “mutation accumulation” theory of aging maintains that senescence is caused by this reduced efficiency of natural selection at older ages, but this argument may be easily invalidated (see later). A particular case is when C is disadvantageous in the homozygous condition (s < 0) and advantageous in the heterozygote condition (s0 > 0), where its equilibrium frequency will be given by the formula: Ce ¼


2 s0 2 s0 ¼ 0 s
4s ½ s þ 4 s0

ð3:7Þ

Some genetically determined anemias (thalassemia, sickle cell anemia, G6PD deficiency, etc.), are mildly damaging in the heterozygote condition and deadly in the homozygous condition. The resistance against malaria explains their high frequency in the heterozygote state (Trevathan et al. 2008a). However, disregarding these particular cases, the theoretical prediction is that the individuals of a species will suffer from many diseases caused by alterations of the genotype, each with a very low frequency (higher when many different mutations alter the same gene or the same metabolic pathway) but with an overall frequency not small, as confirmed by the evidence (GARD 2019).

3.7 The Concept of Holobiont

3.7

91

The Concept of Holobiont

We have already seen that in the classical description of evolutionism, the only selection at the individual level was considered, while the explanation of phenomena defined as phenoptotic or that involve more individuals also requires the consideration of selection at supra-individual levels. However, there is a set of phenomena, or rather a whole world, for which this is not enough. Usually, an individual of a species is simplistically considered as something autonomous that lives and thrives regardless of relationships with individuals of other species. By limiting for simplicity the subject to our species, certainly every individual hosts, inside the body and on the body surfaces, or otherwise has close interactions with countless bacteria, viruses, fungi, intestinal parasites, other macroparasites, etc. Taking into account the bacteria alone, the number of which has been estimated to be 3.8*1013, a little greater than the estimated number of our body cells, which is roughly 3*1013 (Sender et al. 2016) (an old estimate proposed a 10:1 ratio (Savage 1977)). Often our cells harbor viruses, and we are subject to bites and stings from many insects (today much less than in the past). “At least as many of the cells, and the vast majority of unique genes, in the human body are microbial . . . As such, we can view ourselves as holobionts . . .” (Charbonneau et al. 2016)

We and the species with which we co-evolved and now live constitute a holobiont (or superorganism/supraorganism (Glendinning and Free 2014) (Fig. 3.19). The holobiont is a set of ecosystems that is incredibly complex in terms of both the number of species and the balanced tangle of countless interactions. “The bestdefined contribution of the microbiota of the GI [gastrointestinal] tract is a metabolic one: these microorganisms have a combined metabolic capacity equivalent to that of the liver, justifying their description as an additional human organ . . .” (Glendinning and Free 2014) It is a popular assessment that these relationships are generally harmful or of no use. Furthermore, even microbes that appear to be harmless can cause illness or even death in conditions of particular vulnerability. Under this popular conception, the

Fig. 3.19 The human holobiont

92

3 Evolutionary Medicine

“ideal” condition would be to live without this myriad of potentially dangerous parasites or commensals. However, we have co-evolved with countless species for a very long time, even before our species took its present form. It is difficult to believe that these ancestral relationships have not created a series of very complex and delicate balances, particularly as regards the immunological system. For the description of diseases caused by mismatches or by genotype alteration, we have already known that a random modification of any complex system (e.g., machines, biological organisms, ecosystems . . .) is a likely cause of dysfunction (Libertini 1983). So, it is probable that any alteration of these balances can lead to pathological conditions and, as we will soon see, this is what happens in an enormous and shocking measure (for example: the eradication of intestinal worms – see below -, and alterations of intestinal microbiome cause autoimmune diseases (Vieira et al. 2014), among which type 1 diabetes (Boerner and Sarvetnick 2011)).

3.8

Immune Disorders in the Interpretation of Evolutionary Medicine

There are two main categories of immune disorders, allergic and autoimmune diseases, whose frequency has enormously increased in modern times while they were practically unknown in the previous periods and are rare or inexistent in people living in primitive conditions (e.g., Ache of Paraguay (Hill and Hurtado 1996)).

3.8.1

The Current “Epidemic” of Allergic Diseases

Allergic diseases encompass a group of widespread chronic, immune-mediated diseases: – Persistent allergic asthma is found in roughly 10% of all children and 5% of adults, with significant variations across geographic regions (Asher et al. 2006); – Hay fever (allergic rhinoconjunctivitis) occurs in roughly 20% of individuals from Western populations (Eriksson et al. 2012); – “Worldwide, respiratory allergic diseases alone, namely asthma and allergic rhinitis, affect nearly 700 million subjects.” (Hendaus et al. 2016); – “About 20% of all children develop symptoms of atopic dermatitis at some point in their lives.” (Thomsen 2015); – “IgE-associated food allergy affects approximately 3% of the population.” (Valenta et al. 2015); – “The impact of allergic diseases is tremendous on affected individuals, their families, and societies. They adversely affect quality of life and increase the

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

93

Fig. 3.20 Sequential rises in three different allergic diseases. (From Platts-Mills 2015, modified and redrawn)

rate of comorbid conditions and risk of death, as noticed in asthma. In addition, the economic burden of these diseases is considerable.” (Hendaus et al. 2016) Although allergic diseases are widespread, they represent a fairly recent epidemic: “Prior to the first description of hay fever in 1870 there was very little awareness of allergic disease, which is actually similar to the situation in pre-hygiene villages in Africa today. . . . there were no clear reports of an increase in pediatric asthma until 1970. Further the current ‘epidemic’ of food allergy does not appear to have started until after 1990.” (Platts-Mills 2015) (Fig. 3.20)

3.8.2

The Current “Epidemic” of Autoimmune Diseases

There are many autoimmune diseases, defined as an abnormal immune response to a normal body part: Achalasia, Addison’s disease, Adult Still’s disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Ankylosing spondylitis, Anti-GBM/Anti-TBM nephritis, Antiphospholipid syndrome, Autoimmune angioedema, Autoimmune dysautonomia, Autoimmune encephalomyelitis, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune urticaria, Axonal & neuronal neuropathy (AMAN), Baló disease, Behcet’s disease, Benign mucosal pemphigoid, Bullous pemphigoid, Castleman disease (CD), Celiac disease, Chagas disease, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic recurrent multifocal osteomyelitis (CRMO), Churg-Strauss Syndrome (CSS) or Eosinophilic Granulomatosis

94

3 Evolutionary Medicine

(EGPA), Cicatricial pemphigoid, Cogan’s syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn’s disease, Dermatitis herpetiformis, Dermatomyositis, Devic’s disease (neuromyelitis optica), Discoid lupus, Dressler’s syndrome, Endometriosis, Eosinophilic esophagitis (EoE), Eosinophilic fasciitis, Erythema nodosum, Essential mixed cryoglobulinemia, Evans syndrome, Fibromyalgia, Fibrosing alveolitis, Giant cell arteritis (temporal arteritis), Giant cell myocarditis, Glomerulonephritis, Goodpasture’s syndrome, Granulomatosis with Polyangiitis, Graves’ disease, Guillain-Barré syndrome, Hashimoto’s thyroiditis, Hemolytic anemia, Henoch-Schonlein purpura (HSP), Herpes gestationis or pemphigoid gestationis (PG), Hidradenitis Suppurativa (HS) (Acne Inversa), Hypogammaglobulinemia, IgA Nephropathy, IgG4-related sclerosing disease, Immune thrombocytopenic purpura (ITP), Inclusion body myositis (IBM), Interstitial cystitis (IC), Juvenile arthritis, Juvenile diabetes (Type 1 diabetes), Juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjunctivitis, Linear IgA disease (LAD), Lupus, Lyme disease chronic, Meniere’s disease, Microscopic polyangiitis (MPA), Mixed connective tissue disease (MCTD), Mooren’s ulcer, Mucha-Habermann disease, Multifocal Motor Neuropathy (MMN) or MMNCB, Multiple sclerosis, Myasthenia gravis, Myositis, Narcolepsy, Neonatal Lupus, Neuromyelitis optica, Neutropenia, Ocular cicatricial pemphigoid, Optic neuritis, Palindromic rheumatism (PR), PANDAS, Paraneoplastic cerebellar degeneration (PCD), Paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg syndrome, Peripheral uveitis, Parsonage-Turner syndrome, Pemphigus, Peripheral neuropathy, Perivenous encephalomyelitis, Pernicious anemia (PA), POEMS syndrome, Polyarteritis nodosa, Polyglandular syndromes type I, II, III, Polymyalgia rheumatica, Polymyositis, Postmyocardial infarction syndrome, Postpericardiotomy syndrome, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progesterone dermatitis, Psoriasis, Psoriatic arthritis, Pure red cell aplasia (PRCA), Pyoderma gangrenosum, Raynaud’s phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Relapsing polychondritis, Restless legs syndrome (RLS), Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sjögren’s syndrome, Sperm & testicular autoimmunity, Stiff person syndrome (SPS), Subacute bacterial endocarditis (SBE), Susac’s syndrome, Sympathetic ophthalmia (SO), Takayasu’s arteritis, Tolosa-Hunt syndrome (THS), Transverse myelitis, Ulcerative colitis (UC), Undifferentiated connective tissue disease (UCTD), Uveitis, Vasculitis, Vitiligo, Vogt-Koyanagi-Harada Disease (AARDA 2020) (Figs. 3.21 and 3.22). “Approximately 50 million Americans, 20 percent of the population or one in five people, suffer from autoimmune diseases. Women are more likely than men to be affected; some estimates say that 75 percent of those affected – some 30 million people – are women. Still, with these statistics, autoimmunity is rarely discussed as a women’s health issue.” (AARDA 2019)

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

95

Fig. 3.21 Some images of autoimmune diseases: (a) Graves’ disease; (b) vitiligo; (c) lupus; (d) psoriasis

The incidence of autoimmune diseases has been rising sharply over the past several decades in the Western industrialized countries, particularly in the USA (Nakazawa 2009). “Prior to the 1950s, there were a grand total of four cases [of transverse myelitis] reported in the medical literature. Currently, my colleagues at the Johns Hopkins Hospital and I hear about or treat hundreds of new cases every year. In the multiple sclerosis clinic, where I also see patients, the number of cases likewise continues to climb.” (Kerr 2009)

In Finland, there are 62.3 new cases of type 1 diabetes per year per every 100,000 children, compared with just 6.2 in Mexico and 0.5 in Pakistan (Platts-Mills 2015). The increase in the frequency of three autoimmune diseases (multiple sclerosis, type 1 diabetes, and Crohn’s disease) is shown in Fig. 3.23.

96

3 Evolutionary Medicine

Fig. 3.22 Other images of autoimmune diseases: (a) thrombocytopenic purpura; (b) scleroderma; (c) transverse myelitis; (d) rheumatoid arthritis Fig. 3.23 Increased frequency of multiple sclerosis, type 1 diabetes, and Crohn’s disease in the period 1950–2000. (Figure from Bach 2002, modified and redrawn)

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

97

“NIH [National Institutes of Health] estimates up to 23.5 million Americans* have an AD [Autoimmune Diseases]. In comparison, cancer affects up to 9 million and heart disease up to 22 million. NIH estimates annual direct health care costs for AD to be in the range of $100 billion (source: NIH presentation by Dr. Fauci, NIAID [National Institute of Allergy and Infectious Diseases]). In comparison, cancer costs are $57 billion (source: NIH, ACS [American Cancer Society]), and heart diseases and stroke costs are $200 billion (source: NIH, AHA [American Heart Association]). NIH research funding for AD in 2003 came to $591 million. In comparison, cancer funding came to $6.1 billion; and heart and stroke, to $2.4 billion (source: NIH). * We at AARDA [American Autoimmune Related Diseases Association] say that 50 million Americans suffer from autoimmune disease. Why the difference? The NIH numbers only include 24 diseases for which good epidemiology studies were available.” (AARDA 2019)

Moreover, there is growing evidence that autism spectrum disorders (“autism”), for which another shocking epidemic is underway, should be classified among the autoimmune diseases (Careaga and Ashwood 2012; Velasquez-Manoff 2012; Gesundheit et al. 2013; Mead and Ashwood 2015). In the USA, in children aged 8 years, the frequency of autism for 2010 was 1:68, and the frequency increased by 78% from 2002 to 2008 (Forrester et al. 2008). “The Autism Speaks organization estimates in the USA that the current costs of ASD [autism spectrum disorder] reach $137 billion per year, a number that has increased more than threefold since 2006.” (Gottfried et al. 2015) The enormous economic costs here reported for autism ($137 billion/year) should be compared with those previously reported for all other autoimmune diseases ($100 billion), cancer ($57 billion), heart diseases, and stroke ($200 billion).

3.8.3

Causes of the Epidemic of Immune Disorders

Let us now examine the case of allergic and autoimmune diseases within the framework of evolutionary medicine. These immune disorders are unknown or very rare under natural conditions, and before the nineteenth century, even in western societies. As their frequency is strikingly increased in 1–2 generations, they cannot have, in general, genetic defects as primary causes: only significant changes in the ecological niche to which our species is adapted and the consequent mismatches can be their primary causes. There are many mismatches between our adaptation and the current conditions of life that can be their primary causes. In particular, the modifications of our ecological niche that may include possible causes of these diseases are: (i) alterations of our microbiomes; (ii) eradication of intestinal worms; (iii) reduced exposure to biological antigenic stimuli; and (iv) contacts with new artificial chemical substances.

98

3 Evolutionary Medicine

– Alterations of our microbiomes Our gut microbiome has changed enormously from that of primitive people by the effect of the modern use of antibiotic substances (Blaser 2014). For example, comparing the gut microbiome of individuals of Hadza people (Tanzania) with those of a population having a modern lifestyle (urban Italians), the great wealth of the microbiome of the Hadza and the extreme impoverishment of the modern population is evident (Schnorr 2015) (Fig. 3.24). The individuals of the modern populations are not considered sick despite the severe alterations of their intestinal microbiome. The definition of “ecological disaster” is usually referred, for example, to the destruction occurring in vast areas of the Amazon (Fig. 3.25). Often, there is a striking contrast between the huge concerning such external ecological disasters and the considerable underestimation, if not total neglecting, of the internal ecological disaster happening within our bodies and of the seriousness of the situation. The alterations of our holobiont are not limited to the intestinal ecosystem or immune system pathologies. There are various diseases caused by alterations of our local ecosystems, generally due to the use of topic antibacterial substances (soaps, shampoos, bactericidal creams, etc.): seborrheic dermatitis and dandruff, perineal candidiasis, intertrigo by Candida albicans, mycosis of the tongue; pityriasis versicolor, submammary and axillary mycosis, etc. (Griffiths et al. 2016) (Fig. 3.26). Alterations of the microbiomes may cause other non-dermatological diseases, e.g., obesity (Turnbaugh et al. 2006), and chorioamnionitis and spontaneous preterm birth (Charbonneau et al. 2016). Fig. 3.24 The extreme impoverishment of the microbiome of a modern population (urban Italians) compared with that of a hunter-gatherer people (Hadza of Tanzania). Each horizontal bar represents the gut microbiome in fecal samples of an individual, and different colors represent different microbe phyla. (Figure from Schnorr 2015, modified and redrawn)

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

99

Fig. 3.25 Top: a virgin area of the Amazon forest; bottom: a deforest area of the Amazon

The alterations of the ecosystems of our holobiont begin from birth. In normal conditions, the microbiome of human infants derives from mother’s fecal, vaginal, and skin microbiomes (Palmer et al. 2007). Childbirth under aseptic conditions or by Caesarean section hinders the healthy colonization of the germ-free bowel of the newborn baby (Fig. 3.27), and this is a cause of serious diseases (Blaser 2014). However, both mother and infant’s internal and external ecosystems are seriously and continuously altered, before and after birth, by the use of antibiotics and bactericidal substances for topical use (Blaser 2014). After birth, the newborn baby is often separated from his mother and taken in a nursery where his ecosystems are abnormally colonized. Breastfeeding is also often missed out on because of this separation. Over the following years, the child’s health is “defended” by repeated

100

3 Evolutionary Medicine

Fig. 3.26 Some dermatological pathologies caused by alterations of the skin’s microbiome. A: seborrheic dermatitis and dandruff; B: perineal candidiasis; C: intertrigo by Candida albicans; D: mycosis of the tongue; E: pityriasis versicolor; F: submammary mycosis; F: axillary mycosis

Fig. 3.27 The normal colonization of the germ-free bowel of a newborn baby begins during childbirth, in particular if aseptic conditions are not respected

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

101

antibiotic treatments. In developed countries, an average child undergoes 10–12 courses of antibiotics before he is 18 years old (Sharland and SACAR Paediatric Subgroup 2007). This is harmful to health because exposure to microbes in physiological forms is essential for the proper development of the infant (Charbonneau et al. 2016). There is an extraordinary proof of the utility of some bacteria. There are special human milk oligosaccharides (HMOs) that may be metabolized by specific bacteria and not by the newborn baby. In the mother’s milk, there are roughly 100 different types of these substances (Wu et al. 2010; Wu et al. 2011). Therefore, through her milk, a mother feeds specific types of bacteria that must be somehow useful to the newborn baby; otherwise, their existence would not be justifiable in evolutionary terms. In our holobiont, countless equilibria occur that are really dangerous to modify: “The indigenous human microbiota is essential to the health of the host.” (Dethlefsen and Relman 2011) Antibiotics cause havoc in our ecosystems. For example: “The effect of [two courses of] ciprofloxacin on the gut microbiota was profound and rapid, with a loss of diversity and a shift in community composition occurring within 3–4 days of drug initiation. By 1 week after the end of each course, communities began to return to their initial state, but the return was often incomplete” (Dethlefsen and Relman 2011). – Eradication of intestinal worms Intestinal worms are almost universally seen as unacceptable parasites. Their eradication is the rule in medical practice and is actively requested by the persons infested by worms or by their close relatives. However, this alters ancestral balances and causes severe or even life-threatening diseases for patients in which worms are eradicated. Helminth presence restrains immune defenses and prevents allergic and autoimmune diseases. Helminthic infestation is a sound explanation for the low incidence of autoimmune diseases and allergies in less developed countries, while the same diseases show an increased incidence in industrialized countries (Pugliatti et al. 2002; Weinstock et al. 2004; Leonardi-Bee et al. 2006; Zaccone et al. 2006): “Epidemiological studies suggest that autoimmune diseases, such as multiple sclerosis (MS), are less frequent in individuals who are helminth carriers. This observation has been tested in murine models of colitis, MS, type 1 diabetes, and asthma. In each case, mice colonized with helminths show protection from disease. This apparent downmodulation of inflammatory response resulting from helminth infection has triggered interest in exploring the potential clinical efficacy of controlled helminth infection in patients suffering from autoimmune diseases.” (Correale 2014) (Fig. 3.28). Helminthic therapy is defined as the treatment of autoimmune diseases and other immune disorders by deliberate infestation with a helminth or its ova. Current experimental research targets are: multiple sclerosis, ulcerative colitis, inflammatory

102

3 Evolutionary Medicine

Fig. 3.28 Distribution of autoimmune diseases and helminth infestation incidence. “Epidemiological data demonstrate: – Various immunological and autoimmune diseases are much less common in the developing world than the industrialize world; – Immigrants to the industrialized world from the developing world increasingly develop immunological disorders in relation to the length of time since arrival in the industrialized world”. (Text and figure, redrawn, from The Environmental Illness Resource 2019)

bowel disease, Crohn’s disease, and allergic asthma (Fleming et al. 2011; Finlay et al. 2014; Broadhurst et al. 2010). Some worms used in helminthic therapy (Necator americanus, Trichuris suis, Hymenolepis diminuta) are shown in Fig. 3.29.

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

103

Fig. 3.29 Some worms used in helminthic therapy. (a) Necator americanus; (b) Trichuris suis; (c) Hymenolepis diminuta (scolex)

– The case of Helicobacter pylori For its complexity and implications, an interesting case is that of the famous bacterium Helicobacter pylori, which, in the early twentieth century, was found in the stomachs of almost all people. Nowadays, because of the extensive use of antibiotics, H. pylori is found in less than 6% of children in the USA, Sweden, and Germany (Blaser 2011). People with the bacterium show a higher incidence of stomach gastritis and cancer, while people without the bacterium are more likely to develop asthma, hay fever and skin allergies in childhood (Chen and Blaser 2007). As H. pylori has disappeared from people’s stomachs, there has also been an increase in gastroesophageal reflux, and its correlated diseases such as Barrett’s esophagus and esophageal cancer (Blaser 2011). However, it was observed that in the populations of sub-Saharan Africa, H. pylori was present in the vast majority of individuals, and was associated with gastritis but not with gastric ulcer and cancer: “Gastritis is very common throughout Africa and shows a strong correlation with H. pylori infection . . . Gastric ulcer is a rare disease in Africa . . . In northern Nigeria duodenal ulcer is uncommon, yet gastric ulcer is six times less common . . . In Nigeria H. pylori gastritis is common, yet gastric cancer is uncommon” (“the African enigma”) (Holcombe 1992). Similar observations were made for Asia (“Asian enigma”), for India (“Indian enigma”), and for Europe in the passage between the eighteenth and the nineteenth century (“European enigma”) (Velasquez-Manoff 2012, p. 157). A possible explanation is that the concomitant infestation with intestinal worms modulates inflammation and gastric immune responses and so protects the organism from the ulcerogenic and carcinogenic effects of H. pylori (Fox et al. 2000; Whary et al. 2005; Velasquez-Manoff 2012). It was also observed that the individuals who had H. pylori in the stomach were less likely to develop active tuberculosis (Perry et al. 2010). This intricate picture is summarized in Table 3.4.

104

3 Evolutionary Medicine

Table 3.4 Relations between infection by H. pylori, infestation by intestinal worms and some diseases Condition H. pylori + intestinal worms

The rule in: Primitive population (normal condition)

H. pylori and no worm

European people in the first half of the nineteenth century Modern civilized populations

No H. pylori and no worm

Effects Asymptomatic gastritis, no increased incidence of gastric and esophageal cancer; increased resistance to active tuberculosis Increased incidence of gastric ulcer and gastric cancer Increased incidence of gastroesophageal reflux, esophagitis, Barrett’s esophagus, esophageal cancer, asthma, hay fever and skin allergies

Fig. 3.30 The primary mechanisms that cause immunological disorders and other diseases in which the holobiont is altered

– Reduced exposure to biological antigenic stimuli Autoimmune and allergic diseases have a complementary or better explanation in the “hygiene hypothesis” (Strachan 1989, 2000). Namely, the abnormally reduced exposure to antigenic stimuli to which our species is adapted determines an abnormal development of the immune system. This causes pathological immunological reactions against foreign substances usually present in the environment (pollen, food, etc.) or against our bodily antigens (Velasquez-Manoff 2012). – Contacts with new artificial chemical substances Part of the immune disorders arises surely from other factors. For example, many allergies are caused by the exposure to countless artificially synthesized chemical substances (Kirchner 2002), which is another large set of modifications of our ecological niche. These concepts are summarized in Fig. 3.30. Medical care for allergies and autoimmune diseases seek to curb the abnormal immunological reactions through antihistamines, corticosteroids, immunosuppressants, and monoclonal antibodies and to counter their harmful effects on body

3.8 Immune Disorders in the Interpretation of Evolutionary Medicine

105

Fig. 3.31 The different main strategies of evolutionary medicine and traditional medicine

functions. These treatments act on pathogenic mechanisms and on the effects of immunological disorders but do not erase or limit the primary causes, namely the serious and multiple alterations of our holobiont. On the contrary, an essential aim of evolutionary medicine is to prevent and counter these alterations (Fig. 3.31). As long as we do not act on these primary causes, allergic and autoimmune diseases will continue to cause suffering and even death of hundreds of millions of people. For traditional medicine, each bacterium, virus, fungus, worm or even any contact with another organism is, to a greater or lesser extent, a danger which must be eliminated, limited, or, at most, tolerated if clearly not dangerous. For evolutionary medicine each of us is a complex set of ecosystems, of which bacteria, viruses, fungi, worms and contacts with other species constitute an integral part. These ecosystems, defined on the whole as a holobiont, are the result of coevolution that is more ancient than the origin of our species. Any modification of these ecosystems is a potential alteration, i.e., a source of disease or even death. Currently, these ecosystems are being continuously and severely altered. These modifications of our ecological niche are the primary cause of the spread of entire groups of diseases, in particular allergies and autoimmune diseases, which are rare or unknown in primitive populations. Of course, we cannot go back to primitive living conditions. But the changes made to the primeval lifestyle to which we are adapted and the alterations of our holobiont must be carefully studied and corrected in the manner and by the means that are possible and useful. The first step is to understand the problem but, unfortunately, today’s medicine has, in general, no knowledge of evolutionary mechanisms and no awareness of the fact that each individual is a complex set of ecosystems. At the same time, evolutionary biologists do not seem to be aware that the major changes in ecosystems do not take place in distant lands or seas but in our bodies; this has been causing, for decades, untold suffering and deaths.

106

3.9

3 Evolutionary Medicine

Non-evolutionary Classification of Diseases

The current International Classification of Diseases (ICD-11) (WHO 2018), like the preceding ones (e.g., ICD-10 (WHO 2016)), classifies the diseases and various similar phenomena empirically: – According to the affected organic systems (e.g.: circulatory, respiratory, digestive, etc.; codes 3–16) – According to particular codes that follow, like those of the first group, the branches of current medical specializations (codes 1, 2, 17–20) – Including in particular codes all that is not included in the others (codes 21–24). The current classification of diseases, reported in its general categories or codes in Table 3.5, mirrors, as the previous ones, the historical development of medicine and its gradual subdivision in various specializations and has no rational justification, i.e., it is not based on scientific criteria. Table 3.5 International Classification of Diseases (ICD)-11 (December 2018) (https://icd.who.int/ browse11/l-m/en) 01 – Certain infectious or parasitic diseases 02 – Neoplasms 03 – Diseases of the blood or blood-forming organs 04 – Diseases of the immune system 05 – Endocrine, nutritional or metabolic diseases 06 – Mental, behavioral or neurodevelopmental disorders 07 – Sleep-wake disorders 08 – Diseases of the nervous system 09 – Diseases of the visual system 10 – Diseases of the ear or mastoid process 11 – Diseases of the circulatory system 12 – Diseases of the respiratory system 13 – Diseases of the digestive system 14 – Diseases of the skin 15 – Diseases of the musculoskeletal system or connective tissue 16 – Diseases of the genitourinary system 17 – Conditions related to sexual health 18 – Pregnancy, childbirth or the puerperium 19 – Certain conditions originating in the perinatal period 20 – Developmental anomalies 21 – Symptoms, signs or clinical findings, not elsewhere classified 22 – Injury, poisoning or certain other consequences of external causes 23 – External causes of morbidity or mortality 24 – Factors influencing health status or contact with health services

3.10

Evolutionary Classification of Diseases

107

Table 3.6 Internal subdivision of Code 12 Upper respiratory tract disorders Certain lower respiratory tract diseases Lung infections Lung diseases due to external agents Respiratory diseases principally affecting the lung interstitium Pleural, diaphragm or mediastinal disorders Certain diseases of the respiratory system Respiratory failure Postprocedural disorders of the respiratory system Neoplasms of the respiratory system Developmental respiratory diseases Symptoms, signs or clinical findings of the respiratory system Pulmonary heart disease or diseases of pulmonary circulation Sleep-related breathing disorders

The ICD is also based on the concept that “aging” does not exist as an independent entity. Aging is implicitly considered only as a term of convenience to group together a large and heterogeneous series of disorders and degenerative phenomena united only by the fact that they increase in frequency and severity with age. So, in the ICD (WHO 2016, 2018) there is no code for aging. This absence complies with the traditional hypotheses about the causes of aging, and, as a paradoxical effect, determines that in official statistics nobody can die from aging (World Ranking Total Deaths 2017): even a centenarian may die from the fatal failure of an organ or a function but never as a consequence of aging. The ICD fails to consider both aging and some phenoptotic phenomena that for completeness should not be excluded from a comprehensive classification of diseases and similar phenomena. The internal subdivision of each code follows a similar logic. An example is shown in Table 3.6, where the subdivision for code 12 is clearly based on anatomical distinctions and other empirical criteria.

3.10

Evolutionary Classification of Diseases

With this premises, as already proposed in 1983 (Libertini 1983), it is proposed again in this work, with some modifications, that the traditional classification of diseases should be replaced by a rational evolutionary classification of diseases and related phenomena based on the primary causes of the diseases in evolutionary terms. The proposed classification of diseases and similar phenomena is shown in Table 3.7. The term “similar phenomena” means a disparate set of phenomena that are not diseases but cause pain/suffering/disability/death.

108

3 Evolutionary Medicine

Table 3.7 Evolutionary classification of diseases and of similar phenomena I – Diseases deriving from alterations of the genotype (A) caused by: DNA abnormalities; chromosomal abnormalities; Mitochondrial abnormalities; harmful genes that are beneficial in certain conditions; II – Diseases deriving from alterations of the ecological niche (A) caused by: alterations of the diet; reduced and/or abnormal physical activity; abuse of particular substances; altered social relations and other problems causing mental diseases; excessive crowding; excessive noise; other alterations of the lifestyle; increased demographic density; (B) caused by: alterations of the holobiont; alterations of the relations with other living beings; III – Diseases deriving from ‘extremes’ of the ecological niche (A) caused by: traumas; burns; downing and asphyxia; etc. IV – Diseases deriving from relations with other living beings (A) caused by: bacteria; viruses; fungi; protozoa; worms; insects, spiders, ectoparasites and other living beings; V – Physiologic phenomena that cause troubles and sufferings (A) Defenses against trauma, infections, toxic substances, etc. (pain, fever, cough, sneezes, nausea, vomit, diarrhea, etc.); (B) Mental and behavioral manifestations (anxiety, fear, depression, jealousy, psychological pain, sadness, etc.) as adaptations to particular situations (Nesse 2019); (C) Pregnancy, childbirth and the puerperium; (D) Phenoptotic phenomena, slow phenoptosis excluded; (E) Slow phenoptosis or aging

Some specifications may be useful. – I and II: These categories of diseases have been already discussed in previous sections; – III: This category does not require particular clarifications; – IV: These diseases should not be confused with the conditions in which alterations of the ecological niche cause an anomalous virulence and spread of an infection or an infestation (for example, increased population density that causes the outbreak of an epidemic, code II). Under normal conditions, bacteria, viruses, and other microbes do not cause relevant diseases but become pathogenic and also a secondary cause of death when the body is weakened. In fact, under certain conditions, the relationship between humans and these microbes is analogous to that between prey and predator: as a rule, the predator fails to kill a prey in good health but easily captures and kills individuals that are weakened, sick or more vulnerable because of age. – V-A: Some phenomena (pain, fever, cough, sneezes, nausea, vomit, diarrhea, etc.) are defenses of the organism and should not be considered as diseases. Their treatment should be recommended only to restrain them when they are considered excessive or too troubling. As an example of this category of phenomena, in pregnant women, it is common to observe, particularly in the first months of gestation, nausea, and refusal of some foods (fish, poultry, meats, eggs, strong-

3.10

Evolutionary Classification of Diseases

109

tasting vegetables, caffeine, alcohol, and in general foods with unusual taste or smell). This ailment, known as morning sickness, was proposed as adaptive in 1992 (Profet 1992) because it may defend the fetus against certain possible damages deriving from infectious agents or potentially teratogenic substances that could be present in particular foods (Flaxman and Sherman 2000): “(i) symptoms peak when embryonic organogenesis is most susceptible to chemical disruption (weeks 6–18), (ii) women who experience morning sickness are significantly less likely to miscarry than women who do not (9 of 9 studies), (iii) women who vomit suffer fewer miscarriages than those who experience nausea alone . . . Animal products may be dangerous to pregnant women and their embryos because they often contain parasites and pathogens, especially when stored at room temperatures in warm climates. Avoiding foodborne microorganisms is particularly important to pregnant women because they are immunosuppressed, presumably to reduce the chances of rejecting tissues of their own offspring . . . As a result, pregnant women are more vulnerable to serious, often deadly infections.” (Flaxman and Sherman 2000) Another particular case is the iron deficiency and the consequent anemia observed in many infectious diseases. Such condition is “rationally” treated with an iron supply, but the evidence shows that this increases the gravity of some diseases and the probability of possible deadly complications: – “Acquiring iron is a fundamental step in the development of a pathogen, and the complexity and redundancy of both host and pathogen mechanisms to acquire iron and control flux and availability illustrate the longstanding and ongoing battle for iron.” (Doherty 2007) – “There is convincing evidence that iron deficiency protects against many infectious diseases such as malaria, plague, and tuberculosis as shown by diverse medical, historical, and anthropologic studies” (Denic and Agarwal 2007). – In Polynesia, in infants with an iron deficit, the administration of iron supplements increased neonatal sepsis cases by gram-negative bacteria. These cases decreased when iron supplements were stopped (Barry and Reeve 1977). – “In a malaria-endemic population of Zanzibar, significant increases in serious adverse events were associated with iron supplementation . . .” (Iannotti et al. 2006) – “Recent evidence from a large, randomized, controlled trial has suggested that the universal administration of iron to children in malaria-endemic areas is associated with an increase in adverse health outcomes.” (Prentice et al. 2007) – “In northeastern Tanzania, where malaria and iron deficiency are common, we found that placental malaria was less prevalent (8.5% vs. 47.3% of women; P < .0001) and less severe (median parasite density, 4.2% vs. 6.3% of placental red blood cells; P < .04) among women with iron deficiency than among women with sufficient iron stores, especially during the first pregnancy. Multivariate analysis revealed that iron deficiency (P < .0001) and multigravidity (P < .002) significantly decreased the risk of placental malaria.” (Kabyemela et al. 2008)

110

3 Evolutionary Medicine

– “Oral iron has been associated with increased rates of clinical malaria (5 of 9 studies) and increased morbidity from other infectious disease (4 of 8 studies). In most instances, therapeutic doses of oral iron were used. No studies in malarial regions showed benefits . . . Experimental studies in laboratory animals uniformly show reversible deleterious effects of iron administration on tests of functional immunity. These may occur even in mild deficiency. . . . Experimental and in vitro animal studies suggest that organisms that spend part of their life cycle intracellularly, such as plasmodia, mycobacteria and invasive salmonellae, may be enhanced by iron therapy. ” (Oppenheimer 2001) – In the 1980s, a randomized, double-blind, placebo-controlled trial, iron supplementation in Papua New Guinea infants was correlated with more frequent clinical malaria, severe lower respiratory infections, measles, and acute otitis media (Oppenheimer 2001) – “Unless the host immune response is impaired by severe iron deficiency, there is rarely an urgency to supplement iron and it is likely to contribute little to host iron status due to the block on absorption associated with inflammation. In the presence of intracellular infections such as tuberculosis or chronic inflammatory or immunosuppressive diseases (e.g., HIV), the decision to supplement iron must be considered on an individual basis, because the potential exists to benefit a pathogen rather than the host.” (Doherty 2007) – “Our bodies have a related defense mechanism, of which most people are unaware and which physicians sometimes unwittingly attempt to frustrate. Here are some clues about how it works. A patient with chronic tuberculosis is found to have a low level of iron in his blood. A physician concludes that correcting the anemia may increase the patient’s resistance, so she gives him an iron supplement. The patient’s infection gets worse.” (Nesse and Williams 1994, p. 29) The evidence shows that blood iron levels are actively reduced by the host organism in the case of infections to reduce the iron that is available to pathogens. – V-B: Certain psychological conditions (for example, anxiety and depression of mood) are a useful defense in particular conditions. Often, however, due to alterations in the ecological niche, these conditions become real diseases (Nesse 2019). – V-C: Pregnancy, childbirth, and puerperium involve various forms of ailment and trouble that are physiological and related to such states. However, the current management of these states is far from normal and is a source of suffering and pathologies. E.g., iron deficiency in pregnancy is physiological and represents a defense against infections, and the “cure” by the administration of heavy iron supplements sometimes is not rational (see above). – V-D: As explained in Chapter 2 – Evolution and phenoptosis, there are various cases in which abortion is physiological and constitutes a form of indirect phenoptosis that should not be considered a disease. – V-E: Aging is included in this subcategory as a possible important cause of a death.

3.11

Meaning and Aims of Evolutionary Medicine

111

The proposed classification is based on the primary causes of the diseases interpreted by the key of evolutionary interpretation. The classification is rational, as it is based on a scientific criterion explicitly stated. The main advantage is that a rational interpretation of the primary causes of the diseases gives a strategy for their prevention, when possible and necessary, and a rational base for the treatment of their manifestations. On the contrary, the current classification is entirely focused on the treatment of the disease by the specialist (or the specialists) who are most pertinent to the affected organs/systems. – Diseases with multiple causes Cases in which a simple and unambiguous classification of a disease is impossible are very common in the current classification of diseases. For example, if a disease affects more than one system, as a rule, the classification is assigned arbitrarily and often reflects the history of which category of specialists has mostly dealt with that disease. The proposed evolutionary classification of diseases also presents potential ambiguities. However, being based on the criterion of the primary cause of the disease, such ambiguities can be resolved according to a rational criterion, the definition of the primary cause, and not following arbitrary or tradition-based choices. Let us analyze a specific case. Anxious and depressive manifestations within certain limits have an adaptive function and should not be considered as diseases but within the category V – Physiologic phenomena that cause trouble and sufferings, subcategory B. When altered lifestyle conditions determine the appearance of these manifestations in cases where there is no adaptive value or increase them above certain levels, we will have diseases that fall within the category II – Diseases deriving from alterations of the ecological niche, subcategory A. In particular, cases, when these manifestations have no adaptive value, and in the absence of particular lifestyle alterations related to them, it is possible to have these disorders at pathological levels. In these cases, especially if they are present in several subjects of the same family, we will have diseases likely falling into the category I – Diseases deriving from alterations of the genotype.

3.11

Meaning and Aims of Evolutionary Medicine

Is evolutionary medicine a new medical discipline or a new medicine? – “Few medical schools have evolutionary biologists on their faculties and none teach evolutionary biology as a basic medical science. Some physicians and medical researchers learn something about evolution before medical school, but few have anywhere near the level of knowledge we demand for other basic sciences. . . . substantially improved evolution education before medical school

112

3 Evolutionary Medicine

is needed, and specific renovations of the medical curriculum are also essential.” (Stearns et al. 2010). – “. . . evolutionary biology is a crucial basic science for medicine. . . . Like other basic sciences, evolutionary biology needs to be taught both before and during medical school. . . . In medical school, evolutionary biology should be taught as one of the basic medical sciences. This will require a course that reviews basic principles and specific medical applications, followed by an integrated presentation of evolutionary aspects that apply to each disease and organ system. Evolutionary biology is not just another topic vying for inclusion in the curriculum; it is an essential foundation for a biological understanding of health and disease.” (Nesse et al. 2010) These authoritative quotes express the point of view of some of the leading scholars in the field of evolutionary medicine. It may be summarized as follows: – Evolutionary medicine should be considered a basic discipline for the study, the development and the applications of medicine; – For these reasons, it must be included in the core curriculum of medicine and not considered a marginal discipline; – The usefulness of evolutionary medicine is clearly demonstrated by a long series of studies and the consequent “specific medical applications” (Nesse et al. 2010). Although this view is authoritative and worthy of the utmost account, it is insufficient to define the meaning and aims of evolutionary medicine. Current medicine should not be simply enhanced, improved, and strengthened by the ancillary discipline of evolutionary medicine. On the contrary, the whole structure of medicine should be redefined and re-founded as evolutionary medicine. This might seem like a simple verbal game or a short-sighted position in favor of a single discipline. Moreover, it is an old story that the scholars of a single subject would like everything to be hinged on that matter. However, the thesis mentioned above is based on rational considerations: – All biology is now focused around and on evolution. The classification of living species, the understanding of their physiology, and every other feature are based on the concepts of evolutionism. The medicine, which is an applicative branch of biology, should also be based on evolution. As already said, if it is true that “Nothing in biology makes sense, except in the light of evolution” (Dobzhansky 1973), why should not it be true that “Nothing in medicine makes sense, except in the light of evolution”? (Varki 2012) – Various categories of diseases and related phenomena are perfectly predictable with deductive reasoning based on the logic of evolution. A comprehensive evolutionary classification of all diseases and related phenomena is perfectly possible (Libertini 1983). This classification is grounded on a rational basis while the current classification is empirical and quite illogical (see the previous section of this chapter). – The definition of diseases in evolutionary terms, which is grounded on their primary causes, is a prerequisite for a medical science focused basically on

3.11

–

–

–

–

Meaning and Aims of Evolutionary Medicine

113

disease prevention. Currently, the medicine is focused on treating the diseases and not on preventing them, but this approach is becoming increasingly ineffective and costly. The central concept of evolutionary medicine is that many diseases, among which the most typical troubles, are caused by changes in our ecological niche to which our species is not adapted. In the transition from current medicine to evolutionary medicine, a large part of medicine should be reformed in accordance with this fact. This transition implies a deep reorganization of health systems that would not be feasible if evolutionary medicine is intended simply as a discipline that is ancillary to current medicine. In the current medicine and also for many evolutionary biologists, aging is interpreted as a sum of random degenerative processes insufficiently constrained by natural selection for various reasons. The interpretation of aging as a physiological process favored by natural selection in terms of supra-individual selection is a critical element of evolutionary medicine with substantial implications for the classification of diseases and related phenomena, for the interpretation of many of them and the prospects for intervention. It is worth pointing out that although world health data show that about two-thirds of the deaths may be attributed to age-related diseases (Lopez et al. 2006), aging as a cause of death is not considered in modern statistics (WorldLifeExpectancy 2017) coherently with the fact that in the current classification of diseases there is no entry for aging. Evolutionary medicine’s scholars have studied a number of specific subjects (e.g.: constraints and trade-offs for natural selection; defenses against various factors, etc.), which are very interesting and often useful, but the limitation of evolutionary medicine to these subjects is an irrational restriction. Evolutionary medicine highlights the importance of the concept of mismatch and the many diseases that are caused by this category of phenomena. There is insufficient consideration of the implications of the fact that the greatest part of the most common diseases is caused by mismatch phenomena. The study, prevention and treatment of these diseases must be rationally grounded on evolutionary bases. This means that most of the diseases must be addressed in evolutionary terms mainly by the national health organizations and not by single doctors or hospitals.

The integration and the sum of these facts and arguments imply that the transformation of the entire medicine in evolutionary medicine is not an unfounded claim based on a one-sided approach but rather a rational need, given huge foreseeable benefits. Its implementation, however, comes up against cultural and organizational inertia and against partisan interest.

114

3 Evolutionary Medicine

References AARDA (American Autoimmune Related Diseases Association). (2019). www.aarda.org/. Accessed 20 Jan 2019. AARDA (American Autoimmune Related Diseases Association). (2020). www.aarda.org/, page Autoimmune Disease List, www.aarda.org/diseaselist/. Accessed 14 Feb 2020. Adachi, M., & Brenner, D. A. (2005). Clinical syndromes of alcoholic liver disease. Digestive Diseases, 23(3–4), 255–263. https://doi.org/10.1159/000090173. Adamidis, D., Roma-Giannikou, E., Karamolegou, K., Tselalidou, E., & Constantopoulos, A. (2000). Fiber intake and childhood appendicitis. International Journal of Food Sciences and Nutrition, 51(3), 153–157. https://doi.org/10.1080/09637480050029647. Allison, A. C. (1954). The distribution of the sickle-cell trait in East Africa and elsewhere, and its apparent relationship to the incidence of subtertian malaria. Transactions of the Royal Society of Tropical Medicine and Hygiene, 48(4), 312–318. https://doi.org/10.1016/0035-9203(54)901017. Armitage, P., Berry, G., & Matthews, J. B. S. (2002). Statistical methods in medical research (4th ed.). Oxford: Blackwell Science. Arnbjörnsson, E. (1983). Acute appendicitis and dietary fiber. Archives of Surgery, 118(7), 868–870. https://doi.org/10.1001/archsurg.1983.01390070076015. Asher, M. I., Montefort, S., Björkstén, B., Lai, C. K., Strachan, D. P., Weiland, S. K., Williams, H., & ISAAC Phase Three Study Group. (2006). Worldwide time trends in the prevalence of symptoms of asthma, allergic rhinoconjunctivitis, and eczema in childhood: ISAAC Phases One and Three repeat multicountry cross-sectional surveys. Lancet, 368(9537), 733–743. https://doi.org/10.1016/S0140-6736(06)69283-0. Bach, J. F. (2002). The effect of infections on susceptibility to autoimmune and allergic diseases. The New England Journal of Medicine, 347(12), 911–920. https://doi.org/10.1056/ NEJMra020100. Barry, D. M., & Reeve, A. W. (1977). Increased incidence of gram-negative neonatal sepsis with intramuscula iron administration. Pediatrics, 60(6), 908–912. Black, H. R., & Elliott, W. J. (Eds.). (2007). Hypertension – A companion to Braunwald’s heart disease. Amsterdam: Elsevier. Blaser, M. J. (2011). Antibiotic overuse: Stop the killing of beneficial bacteria. Nature, 476(7361), 393–394. https://doi.org/10.1038/476393a. Blaser, M. J. (2014). Missing microbes: How killing bacteria creates modern plagues. London: Oneworld Book. Boerner, B. P., & Sarvetnick, N. E. (2011). Type 1 diabetes: Role of intestinal microbiome in humans and mice. Annals of the New York Academy of Sciences, 1243, 103–118. https://doi.org/ 10.1111/j.1749-6632.2011.06340.x. Bonow, R. O., Mann, D. L., Zipes, D. P., & Libby, P. (2012). Braunwald’s heart disease: A textbook of cardiovascular medicine (9th ed.). Amsterdam: Elsevier. Bragulat, E., & de la Sierra, A. (2002). Salt intake, endothelial dysfunction, and salt-sensitive hypertension. Journal of Clinical Hypertension (Greenwich, Conn.), 4(1), 41–46. https://doi. org/10.1111/j.1524-6175.2002.00503.x. Broadhurst, M. J., Leung, J. M., Kashyap, V., McCune, J. M., Mahadevan, U., McKerrow, J. H., & Loke, P. (2010). IL-22+ CD4+ T cells are associated with therapeutic trichuris trichiura infection in an ulcerative colitis patient. Science Translational Medicine, 2(60), ra88. https:// doi.org/10.1126/scitranslmed.3001500. Careaga, M., & Ashwood, P. (2012). Autism spectrum disorders: From immunity to behavior. Methods in Molecular Biology, 934, 219–240. https://doi.org/10.1007/978-1-62703-071-7_12. Chaker, L., Korevaar, T. I. M., Rizopoulos, D., Collet, T.-H., Völzke, H., Hofman, A., Rodondi, N., Cappola, A. R., Peeters, R. P., & Franco, O. H. (2017). Defining optimal health range for thyroid function based on the risk of cardiovascular disease. The Journal of Clinical Endocrinology and Metabolism, 102(8), 2853–2861. https://doi.org/10.1210/jc.2017-00410.

References

115

Charbonneau, M. R., Blanton, L. V., DiGiulio, D. B., Relman, D. A., Lebrilla, C. B., Mills, D. A., & Gordon, J. I. (2016). A microbial perspective of human developmental biology. Nature, 535 (7610), 48–55. https://doi.org/10.1038/nature18845. Chen, Y., & Blaser, M. J. (2007). Inverse associations of helicobacter pylori with asthma and allergy. Archives of Internal Medicine, 167(8), 821–827. https://doi.org/10.1001/archinte.167.8. 821. Cho, N. H., Shaw, J. E., Karuranga, S., Huang, Y., da Rocha Fernandes, J. D., Ohlrogge, A. W., & Malanda, B. (2018). IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Research and Clinical Practice, 138, 271–281. https://doi.org/ 10.1016/j.diabres.2018.02.023. Clavel, J. (2007). Progress in the epidemiological understanding of gene-environment interactions in major diseases: Cancer. Cancer Research Biology, 330(4), 306–317. https://doi.org/10.1016/ j.crvi.2007.02.012. Correale, J. (2014). Helminth/parasite treatment of multiple sclerosis. Current Treatment Options in Neurology, 16(6), 296. https://doi.org/10.1007/s11940-014-0296-3. Daniel, E. (2007). Noise and hearing loss: A review. The Journal of School Health, 77(5), 225–231. https://doi.org/10.1111/j.1746-1561.2007.00197.x. Darwin, E. (1794–1796). Zoonomia, or The laws of organic life. Printed for J. Johnson, 2nd corrected ed., London. Available from Project Gutenberg, http://www.gutenberg.org/files/ 15707/15707-h/15707-h.htm. Denic, S., & Agarwal, M. M. (2007). Nutritional iron deficiency: An evolutionary perspective. Nutrition, 23(7–8), 603–614. https://doi.org/10.1016/j.nut.2007.05.002. Dethlefsen, L., & Relman, D. A. (2011). Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation. Proceedings of the National Academy of Sciences of the United States of America, 108(Suppl 1), 4554–4561. https://doi.org/ 10.1073/pnas.1000087107. Dirani, M., Tong, L., Gazzard, G., Zhang, X., Chia, A., Young, T. L., Rose, K. A., Mitchell, P., & Saw, S. M. (2009). Outdoor activity and myopia in Singapore teenage children. The British Journal of Ophthalmology, 93(8), 997–1000. https://doi.org/10.1136/bjo.2008.150979. Dobzhansky, T. (1973). Nothing in biology makes sense except in the light of evolution. The American Biology Teacher, 35(3), 125–129. Doherty, C. P. (2007). Host-pathogen interactions: The role of iron. The Journal of Nutrition, 137 (5), 1341–1344. https://doi.org/10.1093/jn/137.5.1341. Eaton, S. B., Shostak, M., & Konner, M. (1988). The paleolithic prescription: A program of diet and exercise and a design for living. New York: Harper and Row. Eaton, S. B., Konner, M., & Shostak, M. (1988). Stone agers in the fast lane: Chronic degenerative diseases in evolutionary perspective. The American Journal of Medicine, 84(4), 739–749. https://doi.org/10.1016/0002-9343(88)90113-1. Edney, E. B., & Gill, R. W. (1968). Evolution of senescence and specific longevity. Nature, 220 (5164), 281–282. https://doi.org/10.1038/220281a0. Eriksson, J., Ekerljung, L., Rönmark, E., Dahlén, B., Ahlstedt, S., Dahlén, S. E., & Lundbäck, B. (2012). Update of prevalence of self-reported allergic rhinitis and chronic nasal symptoms among adults in Sweden. The Clinical Respiratory Journal, 6(3), 159–168. https://doi.org/10. 1111/j.1752-699X.2011.00269.x. Estabrooks, G. (1941). Man, the mechanical misfit. New York: Macmillan. Finlay, C. M., Walsh, K. P., & Mills, K. H. (2014). Induction of regulatory cells by helminth parasites: Exploitation for the treatment of inflammatory diseases. Immunological Reviews, 259 (1), 206–230. https://doi.org/10.1111/imr.12164. Flaxman, S. M., & Sherman, P. W. (2000). Morning sickness: A mechanism for protecting mother and embryo. The Quarterly Review of Biology, 75(2), 113–148. https://doi.org/10.1086/393377. Fleming, J. O., Isaak, A., Lee, J. E., Luzzio, C. C., Carrithers, M. D., Cook, T. D., Field, A. S., Boland, J., & Fabry, Z. (2011). Probiotic helminth administration in relapsing-remitting

116

3 Evolutionary Medicine

multiple sclerosis: A phase 1 study. Multiple Sclerosis, 17(6), 743–754. https://doi.org/10.1177/ 1352458511398054. Forrester, J. V., Xu, H., Lambe, T., & Cornall, R. (2008). Immune privilege or privileged immunity? Mucosal Immunology, 1(5), 372–381. https://doi.org/10.1038/mi.2008.27. Fox, J. G., Beck, P., Dangler, C. A., Whary, M. T., Wang, T. C., Shi, H. N., & Nagler-Anderson, C. (2000). Concurrent enteric helminth infection modulates inflammation and gastric immune responses and reduces helicobacter-induced gastric atrophy. Nature Medicine, 6, 536–542. https://doi.org/10.1038/75015. Fransen, E., Topsakal, V., Hendrickx, J. J., Van Laer, L., Huyghe, J. R., Van Eyken, E., Lemkens, N., Hannula, S., Mäki-Torkko, E., Jensen, M., Demeester, K., & Tropitzsch, A. (2008). Occupational noise, smoking, and a high body mass index are risk factors for age-related hearing impairment and moderate alcohol consumption is protective: A European populationbased multicenter study. Journal of the Association for Research in Otolaryngology, 9(3), 264–276. https://doi.org/10.1007/s10162-008-0123-1. GARD (National Institutes of Health, National Center for Advancing Translational Sciences, Genetic and Rare Diseases Information Center). (2019). rarediseases.info.nih.gov/. Accessed 14 Feb 2020. Gesundheit, B., Rosenzweig, J. P., Naor, D., Lerer, B., Zachor, D. A., Procházka, V., Melamed, M., Kristt, D. A., Steinberg, A., Shulman, C., Hwang, P., Koren, G., et al. (2013). Immunological and autoimmune considerations of Autism spectrum disorders. Journal of Autoimmunity, 44, 1–7. https://doi.org/10.1016/j.jaut.2013.05.005. Giovino, G. A. (2007). The tobacco epidemic in the United States. American Journal of Preventive Medicine, 33(6 Suppl), S318–S326. https://doi.org/10.1016/j.amepre.2007.09.008. Glendinning, L., & Free, A. (2014). Supra-organismal interactions in the human intestine. Frontiers in Cellular and Infection Microbiology, 4, 47. https://doi.org/10.3389/fcimb.2014.00047. Gottfried, C., Bambini-Junior, V., Francis, F., Riesgo, R., & Savino, W. (2015). The impact of neuroimmune alterations in autism spectrum disorder. Frontiers in Psychiatry, 6, 121. https:// doi.org/10.3389/fpsyt.2015.00121. Greaves, M. F. (2000). Cancer: The evolutionary legacy. Oxford: Oxford University Press. Griffiths, C., Barker, J., Bleiker, T., Chalmers, R., & Creamer, D. (Eds.). (2016). Rook’s textbook of dermatology (9th ed.). Hoboken: Wiley-Blackwell. Haldane, J. B. S. (1949). Disease and evolution. La Ricerca Scientifica, 19, S68–S76. Halter, F., & Brignoli, R. (1998). Helicobacter pylori and smoking: Two additive risk factors for organic dyspepsia. The Yale Journal of Biology and Medicine, 71(2), 91–99. www.ncbi.nlm. nih.gov/pmc/articles/PMC2578888/. Hamilton, W. D. (1966). The moulding of senescence by natural selection. Journal of Theoretical Biology, 12(1), 12–45. https://doi.org/10.1016/0022-5193(66)90184-6. Hart, A. R., Kennedy, H., & Harvey, I. (2008). Pancreatic cancer: A review of the evidence on causation. Clinical Gastroenterology and Hepatology, 6(3), 275–282. https://doi.org/10.1016/j. cgh.2007.12.041. Hendaus, M. A., Jomha, F. A., & Ehlayel, M. (2016). Allergic diseases among children: Nutritional prevention and intervention. Therapeutics and Clinical Risk Management, 12, 361–372. https:// doi.org/10.2147/TCRM.S98100. Hill, K., & Hurtado, A. M. (1996). Ache life history. New York: Aldine De Gruyter. Holcombe, C. (1992). Helicobacter pylori: The African Enigma. Gut, 33(4), 429–431. https://doi. org/10.1136/gut.33.4.429. Iannotti, L. L., Tielsch, J. M., Black, M. M., & Black, R. E. (2006). Iron supplementation in early childhood: Health benefits and risks. The American Journal of Clinical Nutrition, 84(6), 1261–1276. https://doi.org/10.1093/ajcn/84.6.1261. Jaminet, P., & Jaminet, S. C. (2012). Perfect health diet. New York: Simon and Scuster. Janeway, C. A., Jr., Paul Travers, P., Walport, M., & Shlomchik, M. J. (2001). Immunobiology: The immune system in health and disease (5th ed.). New York/London: Garland Science. Janković, S., & Radosavljević, V. (2007). Risk factors for bladder cancer. Tumori, 93(1), 4–12.

References

117

Jones, I. H., Muckleston, H. S., Lewis, E. R., & Owen, G. R. (1950). Nutrition and the eye, ear, nose and throat (with excerpts from the literature.). The Laryngoscope, 60(12), 1210–1226. Kabyemela, E. R., Fried, M., Kurtis, J. D., Mutabingwa, T. K., & Duffy, P. E. (2008). Decreased susceptibility to Plasmodium falciparum infection in pregnant women with iron deficiency. The Journal of Infectious Diseases, 198(2), 163–166. https://doi.org/10.1086/589512. Kempen, J. H., Mitchell, P., Lee, K. E., Tielsch, J. M., Broman, A. T., Taylor, H. R., Ikram, M. K., Congdon, N. G., O’Colmain, B. J., & Eye Diseases Prevalence Research Group. (2004). The prevalence of refractive errors among adults in the United States, Western Europe, and Australia. Archives of Ophthalmology, 122(4), 495–505. https://doi.org/10.1001/archopht.122. 4.495. Kerr, D. (2009). Foreword. In D. J. Nakazawa (Ed.), The autoimmune epidemic. New York: Touchstone Book. Kirchner, D. B. (2002). The spectrum of allergic disease in the chemical industry. International Archives of Occupational and Environmental Health, 75(Suppl), S107–S112. https://doi.org/ 10.1007/s00420-002-0345-1. Kirkwood, T. B. (1977). Evolution of ageing. Nature, 270(5635), 301–304. https://doi.org/10.1038/ 270301a0. Kirkwood, T. B., & Holliday, R. (1979). The evolution of ageing and longevity. Proceedings of the Royal Society of London – Series B: Biological Sciences, 205(1161), 531–546. https://doi.org/ 10.1098/rspb.1979.0083. Klimis-Zacas, D., & Wolinsky, I. (2005). Nutritional concerns of women. Boca Raton: CRC Press. Krogman, W. M. (1951). Ths scars of human evolution. Scientific American, 185(6), 54–57. https:// www.jstor.org/stable/24950554. La Vecchia, C., Zhang, Z. F., & Altieri, A. (2008). Alcohol and laryngeal cancer: An update. European Journal of Cancer Prevention, 17(2), 116–124. https://doi.org/10.1097/CEJ. 0b013e3282b6fd40. Leonardi-Bee, J., Pritchard, D., & Britton, J. (2006). Asthma and current intestinal parasite infection. Systematic review and meta-analysis. American Journal of Respiratory and Critical Care Medicine, 174(5), 514–523. https://doi.org/10.1164/rccm.200603-331OC. Lewis, S. (2008). Evolution at the intersection of biology and medicine. In W. R. Trevathan, E. O. Smith, & J. J. McKenna (Eds.), Evolutionary medicine and health: New perspectives (pp. 399–415). New York: Oxford University Press. Libertini, G. (1983). Ragionamenti evoluzionistici [Book in Italian]. Naples: Società Editrice Napoletana. English edition (2011): Evolutionary arguments on aging, disease, and other topics. Azinet Press, Crownsville (MD). Libertini, G. (2008). Empirical evidence for various evolutionary hypotheses on species demonstrating increasing mortality with increasing chronological age in the wild. ScientificWorldJournal, 8, 183–193. https://doi.org/10.1100/tsw.2008.36. Libertini, G. (2009). Prospects of a longer life span beyond the beneficial effects of a healthy lifestyle. In J. V. Bentely & M. A. Keller (Eds.), Handbook on longevity: Genetics, diet and disease (pp. 35–95). New York: Nova Science Publ. Libertini, G. (2015). Non-programmed versus programmed aging paradigm. Current Aging Science, 8(1), 56–68. https://doi.org/10.2174/1874609808666150422111623. Lipworth, L., Tarone, R. E., & McLaughlin, J. K. (2006). The epidemiology of renal cell carcinoma. The Journal of Urology, 176(6 Pt 1), 2353–2358. https://doi.org/10.1016/j.juro.2006.07.130. Livingstone, F. B. (1958). Anthropological Implications of Sickle Cell Gene Distribution in West Africa. American Anthropologist, 60(3), 533–562. https://doi.org/10.1525/aa.1958.60.3. 02a00110. Lopez, A. D., Mathers, C. D., Ezzati, M., Jamison, D. T., & Murray, C. J. (2006). Global and regional burden of disease and risk factors, 2001: Systematic analysis of population health data. Lancet, 367(9524), 1747–1757. https://doi.org/10.1016/S0140-6736(06)68770-9.

118

3 Evolutionary Medicine

Low, S., Chin, M. C., & Deurenberg-Yap, M. (2009). Review on epidemic of obesity. Annals Academy of Medicine Singapore, 38(1), 57–59. http://www.annals.edu.sg/pdf/ 38VolNo1Jan2009/V38N1p57.pdf. McGrady, A., & Moss, D. (2013). Pathways to illness, pathways to health. New York: Springer. Mead, J., & Ashwood, P. (2015). Evidence supporting an altered immune response in ASD. Immunology Letters, 163(1), 49–55. https://doi.org/10.1016/j.imlet.2014.11.006. Medawar, P. B. (1952). An unsolved problem in biology. London: H. K. Lewis. Reprinted in: Medawar PB (1957) The uniqueness of the individual. Methuen, London. Morse, S. A., Bravo, P. E., Morse, M. C., & Reisin, E. (2005). The heart in obesity-hypertension. Expert Review of Cardiovascular Therapy, 3(4), 647–658. https://doi.org/10.1586/14779072.3. 4.647. Morton, D. J. (1926). The relation of evolution to medicine. Science, 64(1660), 394–396. https:// doi.org/10.1126/science.64.1660.394. Mueller, L. D. (1987). Evolution of accelerated senescence in laboratory populations of Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 84(7), 1974–1977. https://doi.org/10.1073/pnas.84.7.1974. Nakazawa, D. J. (2009). The autoimmune epidemic. New York: Simon and Schuster. National Institutes of Health, USA. (2000). Osteoporosis prevention, diagnosis, and therapy. NIH Consensus Statement, 17(1), 1–45. Nesse, R. M. (2008). The importance of evolution for medicine. In W. R. Trevathan, E. O. Smith, & J. J. McKenna (Eds.), Evolutionary medicine and health: New perspectives (pp. 416–431). New York: Oxford University Press. Nesse, R. M. (2019). Good reasons for bad feelings: Insights from the frontier of evolutionary psychiatry. New York: Dutton (Penguin Random House LLC.). Nesse, R. M., & Williams, G. C. (1994). Why we get sick: The new science of Darwinian medicine. New York: Times Books. Nesse, R. M., Bergstrom, C. T., Ellison, P. T., Flier, J. S., Gluckman, P., Govindaraju, D. R., Niethammer, D., Omenn, G. S., Perlman, R. L., Schwartz, M. D., Thomas, M. G., Stearns, S. C., & Valle, D. (2010). Evolution in health and medicine Sackler colloquium: Making evolutionary biology a basic science for medicine. Proceedings of the National Academy of Sciences of the United States of America, 107(Suppl 1), 1800–1807. https://doi.org/10.1073/pnas.0906224106. Oppenheimer, S. J. (2001). Iron and its relation to immunity and infectious disease. Journal of Nutrition, 131(2S-2), S616–33. https://doi.org/10.1093/jn/131.2.616S. Palmer, C., Bik, E. M., DiGiulio, D. B., Relman, D. A., & Brown, P. O. (2007). Development of the human infant intestinal microbiota. PLoS Biology, 5(7), e177. https://doi.org/10.1371/journal. pbio.0050177. Parasher, G., & Eastwood, G. L. (2000). Smoking and peptic ulcer in the Helicobacter pylori era. European Journal of Gastroenterology & Hepatology, 12, 843–853. https://doi.org/10.1097/ 00042737-200012080-00003. Partridge, L., & Barton, N. H. (1993). Optimality, mutation and the evolution of ageing. Nature, 362(6418), 305–311. https://doi.org/10.1038/362305a0. Perry, S., de Jong, B. C., Solnick, J. V., de la Luz, S. M., Yang, S., Lin, P. L., Hansen, L. M., Talat, N., Hill, P. C., Hussain, R., Adegbola, R. A., Flynn, J., et al. (2010). Infection with helicobacter pylori is associated with protection against tuberculosis. PLoS One, 5(1), e8804. https://doi.org/ 10.1371/journal.pone.0008804. Platts-Mills, T. A. E. (2015). The allergy epidemics: 1870–2010. The Journal of Allergy and Clinical Immunology, 136(1), 3–13. https://doi.org/10.1016/j.jaci.2015.03.048. Prentice, A. M., Ghattas, H., Doherty, C., & Cox, S. E. (2007). Iron metabolism and malaria. Food and Nutrition Bulletin, 28(4 Suppl), S524–S539. https://doi.org/10.1177/ 15648265070284S406. Price, W. A. (1939). Nutrition and physical degeneration. New York/London: Paul B. Hoeber [Other editions in 1945, 1970, 1989, 1997, 2004, 2006, 2008, 2011; the last edition has been used].

References

119

Profet, M. (1992). Pregnancy sickness as adaptation: A deterrent to maternal ingestion of teratogens. In J. Barkow, L. Cosmides, & J. Tooby (Eds.), The adapted mind: Evolutionary psychology and the generation of culture. Oxford: Oxford University Press. Pugliatti, M., Sotgiu, S., & Rosati, G. (2002). The worldwide prevalence of multiple sclerosis. Clinical Neurology and Neurosurgery, 104(3), 182–191. https://doi.org/10.1016/s0303-8467 (02)00036-7. Rodriguez-Iturbe, B., Romero, F., & Johnson, R. J. (2007). Pathophysiological mechanisms of saltdependent hypertension. American Journal of Kidney Diseases, 50(4), 655–672. https://doi.org/ 10.1053/j.ajkd.2007.05.025. Rose, M. R. (1991). Evolutionary biology of aging. Oxford: Oxford University Press. Rose, K. A., Morgan, I. G., Ip, J., Kifley, A., Huynh, S., Smith, W., & Mitchell, P. (2008). Outdoor activity reduces the prevalence of myopia in children. Ophthalmology, 115(8), 1279–1285. https://doi.org/10.1016/j.ophtha.2007.12.019. Savage, D. C. (1977). Microbial ecology of the gastrointestinal tract. Annual Review of Microbiology, 31, 107–133. https://doi.org/10.1146/annurev.mi.31.100177.000543. Schnorr, S. L. (2015). The diverse microbiome of the hunter-gatherer. Nature, 518(7540), S14–S15. https://doi.org/10.1038/518S14a. Sender, R., Fuchs, S., & Milo, R. (2016). Revised estimates for the number of human and bacteria cells in the body. PLoS Biology, 14(8), e1002533. https://doi.org/10.1371/journal.pbio. 1002533. Sharland, M., & SACAR Paediatric Subgroup. (2007). The use of antibacterials in children: A report of the Specialist Advisory Committee on Antimicrobial Resistance (SACAR) Paediatric Subgroup. Journal of Antimicrobial Chemotherapy, 1, i15–i26. https://doi.org/10.1093/jac/ dkm153. Stearns, S. C. (Ed.). (1999). Evolution in health and disease (1st ed.). Oxford: Oxford University Press. Stearns, S. C., & Koella, J. C. (Eds.). (2008). Evolution in health and disease (2nd ed.). New York: Oxford University Press. Stearns, S. C., Nesse, R. M., Govindaraju, D. R., & Ellison, P. T. (2010). Evolution in health and medicine Sackler colloquium: Evolutionary perspectives on health and medicine. Proceedings of the National Academy of Sciences of the United States of America, 107(Suppl 1), 1691–1695. https://doi.org/10.1073/pnas.0914475107. Strachan, D. P. (1989). Hay fever, hygiene, and household size. BMJ, 299(6710), 1259–1260. https://doi.org/10.1136/bmj.299.6710.1259. Strachan, D. P. (2000). Family size, infection and atopy: The first decade of the ‘hygiene hypothesis’. Thorax, 55(Suppl 1), 2–10. https://doi.org/10.1136/thorax.55.suppl_1.s2. Taraseviciene-Stewart, L., & Voelkel, N. F. (2008). Molecular pathogenesis of emphysema. The Journal of Clinical Investigation, 118(2), 394–402. https://doi.org/10.1172/JCI31811. The Environmental Illness Resource. (2019). www.ei-resource.org/, page http://static.cdnseekingalpha.com/uploads/2012/5/12/1122334-13368327296724055-Iggy-Igette_origin.jpg. Accessed 14 Feb 2020. Thomsen, S. F. (2015). Epidemiology and natural history of atopic diseases. European Clinical Respiratory Journal, 2. https://doi.org/10.3402/ecrj.v2.24642. Trepel, F. (2004). Dietary fibre: More than a matter of dietetics. II. Preventative and therapeutic uses (article in German). Wiener Klinische Wochenschrift, 116(15–16), 511–522. https://doi.org/10. 1007/bf03217703. Trevathan, W. R., Smith, E. O., & McKenna, J. J. (Eds.). (2008a). Evolutionary medicine and health: New perspectives. New York: Oxford University Press. Trevathan, W. R., Smith, E. O., & McKenna, J. J. (2008b). Introduction and overview of evolutionary medicine. In W. R. Trevathan, E. O. Smith, & J. J. McKenna (Eds.), Evolutionary medicine and health: New perspectives (pp. 1–54). New York: Oxford University Press.

120

3 Evolutionary Medicine

Truswell, A. S., Kennelly, B. M., Hansen, J. D. L., & Lee, R. B. (1972). Blood pressure of !Kung bushmen in northern Botswana. American Heart Journal, 84(1), 5–12. https://doi.org/10.1016/ 0002-8703(72)90299-2. Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E. R., & Gordon, J. I. (2006). An obesity-associated gut microbiome with increased capacity for energy harvest. Nature, 444 (7122), 1027–1031. https://doi.org/10.1038/nature05414. Valenta, R., Hochwallner, H., Linhart, B., & Pahr, S. (2015). Food allergies: The basics. Gastroenterology 148(6):1120-31.e4. https://doi.org/10.1053/j.gastro.2015.02.006. Varki, A. (2012). Nothing in medicine makes sense, except in the light of evolution. Journal of Molecular Medicine (Berlin, Germany), 90(5), 481–494. https://doi.org/10.1007/s00109-0120900-5. Velasquez-Manoff, M. (2012). An epidemic of absence: A new way of understanding allergies and autoimmune diseases. New York: Simon and Schuster. Viegi, G., Maio, S., Pistelli, F., Baldacci, S., & Carrozzi, L. (2006). Epidemiology of chronic obstructive pulmonary disease: Health effects of air pollution. Respirology, 11(5), 523–532. https://doi.org/10.1111/j.1440-1843.2006.00886.x. Vieira, S. M., Pagovich, O. E., & Kriegel, M. A. (2014). Diet, microbiota and autoimmune diseases. Lupus, 23(6), 518–526. https://doi.org/10.1177/0961203313501401. Weinstock, J. V., Summers, R., & Elliott, D. E. (2004). Helminths and harmony. Gut, 53(1), 7–9. https://doi.org/10.1136/gut.53.1.7. Wells, H. G. (1904). The country of the blind. The Strand Magazine. Whary, M. T., Sundina, N., Bravo, L. E., Correa, P., Quinones, F., Caro, F., & Fox, J. G. (2005). Intestinal helminthiasis in Colombian children promotes a Th2 response to Helicobacter pylori: Possible implications for gastric carcinogenesis. Cancer Epidemiology, Biomarkers & Prevention, 14(6), 1464–1469. https://doi.org/10.1158/1055-9965.EPI-05-0095. WHO, ICD-10. (2016). www.who.int/classifications/apps/icd/icd10online/. Accessed 14 Feb 2020. WHO, ICD-11. (2018). https://icd.who.int/browse11/l-m/en. Accessed 14 Feb 2020. Williams, G. C. (1957). Pleiotropy, natural selection and the evolution of senescence. Evolution, 11, 398–411. https://doi.org/10.2307/2406060. Williams, G. C., & Nesse, R. M. (1991). The dawn of Darwinian medicine. The Quarterly Review of Biology, 66(1), 1–22. https://doi.org/10.1086/417048. Wong, T. Y., Foster, P. J., Hee, J., Ng, T. P., Tielsch, J. M., Chew, S. J., Johnson, G. J., & Seah, S. K. (2000). Prevalence and risk factors for refractive errors in an adult Chinese population in Singapore. Investigative Ophthalmology & Visual Science, 41(9), 2486–2494. World Ranking Total Deaths. (2017). Data from WHO. www.worldlifeexpectancy.com/worldrankings-total-deaths. Accessed 14 Feb 2020. WorldLifeExpectancy. (2017). Causes of death in the world (Data from WHO). www. worldlifeexpectancy.com/world-health-rankings. Accessed 14 Feb 2020. Wu, S., Tao, N., German, J. B., Grimm, R., & Lebrilla, C. B. (2010). Development of an annotated library of neutral human milk oligosaccharides. Journal of Proteome Research, 9(8), 4138–4151. https://doi.org/10.1021/pr100362f. Wu, S., Grimm, R., German, J. B., & Lebrilla, C. B. (2011). Annotation and structural analysis of sialylated human milk oligosaccharides. Journal of Proteome Research, 10(2), 856–868. https:// doi.org/10.1021/pr101006u. Zaccone, P., Fehervari, Z., Phillips, J. M., Dunne, D. W., & Cooke, A. (2006). Parasitic worms and inflammatory diseases. Parasite Immunology, 28(10), 515–523. https://doi.org/10.1111/j.13653024.2006.00879.x.

Chapter 4

The Comparison Between the Two Paradigms

4.1

Introduction

Aging, precisely defined as “increasing mortality with increasing chronological age in populations in the wild” (Libertini 1988), or shortly as “age-related progressive mortality increase (¼ fitness decline) in the wild”, has been and is “explained” by a large number of theories (Comfort 1979; Medvedev 1990; Weinert and Timiras 2003; Libertini 2015b). These theories, despite their number and their differences, are in fact divisible in only two types of interpretations (Libertini 2008), which for the different general principles on which they are based and for the conflicting implications rightly deserve the definition of opposite paradigms in the meaning proposed by Kuhn (1962). The first paradigm, here described as the “non-adaptive aging paradigm”, interprets aging as undoubtedly harmful because it gradually damages and then kills the individual. According to this paradigm, aging is caused by a heterogeneous set of noxious factors that natural selection tries to hinder being less and less effective as age increases. For some theories, natural selection is held back by more pressing physiological or biochemical needs or by the multiple (and sometimes conflicting) actions of some genes, defined as pleiotropic. Aging is considered as something that is always negative and to varying degrees opposed by natural selection, which in the end turns out to be insufficient to oppose aging. In short, in this paradigm, aging is interpreted as a non-adaptive, and so non-programmed, phenomenon, and represents both a natural selection capability limit and a failure of evolution. The theories belonging to this paradigm differ among themselves for the factor, or factors, which cause the damages of aging and for the mechanisms by which these damages are carried out. It should also be pointed out that many theories attributable to this paradigm, especially the older ones, do not pose the problem of natural selection effects and of its failure to oppose the factor or factors that determine aging.

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0_4

121

122

4 The Comparison Between the Two Paradigms

The second paradigm, here described as the “adaptive aging paradigm”, explains aging as something that, on the one hand, is opposed by natural selection at the individual level and, on the other hand, in particular conditions, can be favored by natural selection at the supra-individual level. Such populational benefits lead to the development of specific physiologic mechanisms that determine aging, even if they are detrimental to the individual. In short, aging is interpreted as an adaptive, and therefore programmed, phenomenon, representing both a confirmation of the abilities of natural selection and an achievement of evolution. In the following two sections, 4.2 and 4.3, the main theories, or group of theories that support one or the other paradigm will be briefly explained. In the Section 4.4 – Arguments in support or against the two paradigms, the arguments and the evidence supporting or against the two theses will be discussed.

4.2

The Paradigm of Aging as a Non-adaptive Phenomenon

According to this paradigm, aging, being surely disadvantageous for the individual, can be only opposed by natural selection, while the opposite possibility that aging is favored by natural selection is excluded. Aging is caused by various damaging events and is the result of the insufficiency of natural selection due to various causes. The hypotheses of this paradigm differ in the factors by which aging would be caused and that would restrain natural selection. The theories, or groups of theories, that will be considered are the following: (1) Damage Accumulation hypotheses. For this group of theories, the organism gradually wears and tears itself, and is constantly damaged by various factors. In most of these theories, particularly in older ones, natural selection is not considered at all. In the others, natural selection acts only to curb the damaging phenomena, which by their nature can be countered only partially. This inevitably leads to aging, with rhythms that vary according to the species and the living conditions. The range of hypothetical factors that would cause aging is vast and in fact limited only by the great variety of biological phenomena and by the inventiveness of the proponents. For the older theories it is possible to list among the hypothetical causes: phenomena of “wear and tear” not better specified; wear and alterations of endocrine/nervous/connective/vascular/other organs and tissues; accumulation of various toxic metabolites; toxic substances produced by intestinal bacteria; effects of cosmic rays (Comfort 1979). Less old and new theories propose that aging is the consequence of the oxidative effects of free radicals on mitochondria (Miquel et al. 1980; Trifunovic et al. 2004; Balaban et al. 2005; Sanz and Stefanatos 2008), or on DNA (Bohr and Anson 1995; Weinert and Timiras 2003) or on the whole body (Harman 1956, 1972; Croteau and Bohr 1997; Beckman and Ames; Oliveira et al. 2010). Another theory interprets

4.2 The Paradigm of Aging as a Non-adaptive Phenomenon

123

Fig. 4.1 Equilibrium frequency (Pe) of the phenotypic expression of a damaging (recessive or dominant) allele C in function of the value of [s]. The formula used is Pe ¼ v/[s], where [s] ¼ absolute value of the damage caused by C; v ¼ frequency of mutation in C from neutral alleles (in the calculations v ¼ 0.000001)

aging as the result of the accumulation of chemical damages caused by errors in DNA transcription (Weinert and Timiras 2003). (2) Mutation Accumulation hypothesis. Natural selection removes from populations the deleterious alleles that are continually formed by new mutations. The frequency of equilibrium between the onsets of a damaging allele and its elimination by natural selection is very small if the damage ([s] as absolute value) caused by the allele is large, i.e., the more the value of [s] approaches 1, a value meaning that the mutation is deadly before the individual can begin to reproduce. However, if the damage is carried out at a higher age, when a large part of the reproductive capacity has been carried out, the effect of [s] will be proportionally reduced and the equilibrium frequency will increase. The theoretical increase of the equilibrium frequency of the phenotypic expression of a deleterious allele is shown in Fig. 4.1. The theory of mutation accumulation proposes that aging is caused by the cumulative effect of many deleterious alleles that act at greater ages when few individuals survive and reproductive potential is reduced. Consequently the removal of these alleles by natural selection is reduced and cannot avoid the consequences of the actions of such genes, namely aging (Medawar 1952; Hamilton 1966; Edney and Gill 1968; Mueller 1987; Charlesworth 1990; Partridge and Barton 1993). This theory has the historical merit of being the first theory about aging that takes into account the action of natural selection in a concrete way. However, it has a big logical flaw. In fact, if the number of survivors and the reproductive potential is a function of aging, we will have that the disadvantage caused by the deleterious allele is a function of aging and that aging is a function of the disadvantage, which is a logical circle that cannot support the thesis. Variations of this theory (see below) were developed to overcome this fundamental contradiction.

124

4 The Comparison Between the Two Paradigms

(3) Antagonistic Pleiotropy hypothesis. Antagonistic pleiotropy theory postulates the existence of genes beneficial for the organism in the early stages of life while deleterious in older ages. Therefore they are only partially opposed by natural selection and so their effects determine aging (Williams 1957; Rose 1991). This theory is defined as “antagonistic pleiotropy” because these hypothetical genes have multiple effects (pleiotropy) with opposite (antagonistic) value. The main problem of this theory is that it requires both the existence of antagonistic pleiotropic genes and the non-existence of other genes with the same beneficial effects in the early stages of life but without damaging effects in older ages. Moreover, it does not explain the significant differences in aging rhythms among the species, or the absence of aging in other species, unless we add a further ad hoc hypothesis, which is to say that the rhythms of aging, or the absence of aging, are a function of the number and effects of the hypothesized genes or of their absence. (4) Disposable Soma hypothesis. The basic concept of this theory is that all organisms depend on limited resources (energy, biochemical substances or other not better specified resources), and must optimize their allocation to maximize fitness and reproduction. The primary choice in the adult organism is whether to give priority to body repair and maintenance mechanisms (i.e., longer life span) or reproductive mechanisms (i.e., higher reproductive capacity). As reproduction is essential for the transfer of genes to subsequent generations while, once this transfer is achieved, the body can be sacrificed (i.e., the soma is disposable), the organism gives priority to the needs of reproduction and employs fewer resources for the needs of body repair and maintenance. Therefore, the preservation of an optimal efficiency at greater ages is jeopardized and the organism ages. This theory was proposed in 1977 (Kirkwood 1977) and then deepened and re-proposed shortly after under the name by which it is known (Kirkwood and Holliday 1979). (5) Cessation of Somatic Growth hypothesis. According to this theory, for organisms with a fixed growth, i.e., growth which ends when a determinate size has been attained, senescence starts when the growth of new tissues stops. Conversely, for species where the growth is without limits, as for many lower vertebrates, there is no age-related fitness decline (Minot 1908; Carrel and Ebeling 1921; Brody 1924; Bidder 1932; Lansing 1948, 1951). In particular, Bidder proposed that as indeterminate growth becomes incompatible with an adequate efficiency (e.g., see terrestrial mammals), natural selection favored a mechanism for maintaining a specific size within an error not to impair adequate efficiency. This mechanism was defined as the “regulator” and was essential because “giant trees, cultures of chick cells and of paramecium, measurements of plaice and of sponges, all indicate that an unlimited growth is natural” (Bidder 1932). Moreover, according to Bidder: (i) growth cessation has adverse effects on the soma and reduces the individual fitness; (ii) the “negative growth” determined by the

4.3 The Paradigm of Aging as an Adaptive Phenomenon

125

“regulator” has population benefit and is necessary for the welfare of the species; and (iii) despite this population benefit, the functional decline and subsequent death of the soma was not an effect of natural selection, but an “unimportant by-product” of a mechanism for achieving and maintaining an optimal body size for the survival of the organism (Bidder 1932). (6) Quasi-Programmed Aging hypothesis. “Once a program for development is completed, it is not switched off, even if its continuation is harmful (e.g., senescence). A potential switch that would turn off the developmental program cannot be selected, because most animals die from accidental death before they have a chance to die from senescence. A program for development cannot be switched off, simply because there is no selective pressure against aging. We will refer to an undirected continuation of the program as a quasi-program.” (Blagosklonny 2006) “Repair is costly and limited by energetic resources, and we would allocate resources rationally. But, albeit elegant, this design is fictional. Instead, nature blindly selects for short-term benefits of robust developmental growth. ‘Quasi-programmed’ by the blind watchmaker, aging is a wasteful and aimless continuation of developmental growth, driven by nutrient-sensing, growth-promoting signaling pathways such as MTOR (mechanistic target of rapamycin). A continuous post-developmental activity of such gerogenic pathways leads to hyperfunctions (aging), loss of homeostasis, age-related diseases, non-random organ damage and death. This model is consistent with a view that (1) soma is disposable (2) aging and menopause are not programmed ...” (Blagosklonny 2013)

This theory could be considered a variant of the Disposable Soma hypothesis but also contains elements of affinity with the Cessation of Somatic Growth hypothesis. (7) Historical hypothesis. About the evolutionary cause for sex, it was proposed that the determination of the sexual or asexual condition of a species was mainly a consequence of the sexuality or asexuality of its ancestor species ((Williams 1975); “historical hypothesis [of sex]” (Bell 1982)). In an analogy with the historical hypothesis for sex, it was proposed that a species could be non-aging or more or less precociously aging, in the function of its belonging to a phylum, or to a group of species, where there is the same condition (De Magalhães and Toussaint 2002).

4.3

The Paradigm of Aging as an Adaptive Phenomenon

Some concepts and theories proposed at various times are important for understanding the development of the paradigm that proposes aging as an adaptive phenomenon, determined by specific mechanisms favored by natural selection and therefore definable as a programmed phenomenon:

126

4 The Comparison Between the Two Paradigms

(A) Aging as phenoptotic phenomenon The idea that aging has the hallmarks of an adaptation, i.e., a phenomenon determined and modulated by natural selection, has been highlighted by various authors (Skulachev 1997; Bredesen 2004; Mitteldorf 2004; Longo et al. 2005). Skulachev coined the neologism “phenoptosis” (Skulachev 1997) to indicate the diversified phenomena in which the individual can sacrifice itself by mechanisms favored by natural selection (Skulachev 1997, 1999b). The definition was later extended to analogous mechanisms where close relatives were killed and it was underlined that only natural selection at the supra-individual level could justify them (Libertini 2012). These numberless phenomena were well-known long since (Finch 1990) but were not defined by a unifying term. Skulachev specifically defined aging as a kind of “slow phenoptosis” (Skulachev 2002). There are various theories that try to explain aging as an adaptive phenomenon due to various reasons. However, mostly they propose the hypothesis without discussing mechanisms and consequences, in particular to explain the different aging rhythms and the cases in which there is no evident aging. The subsequent subsections mention the main concepts or hypotheses proposed. (B) Aging is adaptive because it frees space for the next generation Alfred Russell Wallace, author of one the two first papers on evolution by natural selection, proposed that individuals eliminated by the effect of aging were no longer in competition with their offspring and therefore aging was favored by natural selection (Wallace 1865–1870; Skulachev and Longo 2005). In 1889, August Weissmann suggested that aging was beneficial because the death of old individuals liberated space for the next generation and so was evolutionarily useful. However, this was proposed without a clear exposition or any evidence (Weismann 1889; Kirkwood and Cremer 1982), and a few years later Weismann disowned his proposal (Weismann 1892, Kirkwood and Cremer 1982). (C) Aging as increased evolvability factor Following Weismann’s insight, it was proposed that aging is favored by natural selection because it increases the speed of evolution, or evolvability (Goldsmith 2004, 2008). (D) Red Queen hypothesis for aging There is a popular theory, Red Queen hypothesis (van Valen 1973; Hamilton 1975; Levin 1975; Charlesworth 1976; Glesener and Tilman 1978; Glesener 1979; Bell 1982; Bell and Maynard Smith 1987; Ridley 1993; Peters and Lively 1999, 2007; Otto and Nuismer 2004; Kouyos et al. 2007; Salathé et al. 2008; Liow et al. 2011; Brockhurst et al. 2014; Voje et al. 2015), which tries to explain sexual reproduction as evolving “in response to the shifting adaptive landscape generated by the evolution of interacting species.” (Otto and Nuismer 2004); “The Red Queen Hypothesis (RQH) suggests that the coevolutionary dynamics of host-parasite systems can generate selection for increased host recombination. Since host-parasite

4.3 The Paradigm of Aging as an Adaptive Phenomenon

127

Fig. 4.2 Red Queen told Alice: “... it takes all the running you can do, to keep in the same place.” ((Carroll 1871), illustration by John Tenniel). This concept that living beings must continually modify their adaptation, i.e., evolve, just to avoid going extinct, prompted the theory called Red Queen hypothesis about the cause of sex. For possible objections against this theory, see (Bell 1982; Libertini 2017)

interactions often have a strong genetic basis, recombination between different hosts can increase the fraction of novel and potentially resistant offspring genotypes. A prerequisite for this mechanism is that host-parasite interactions generate persistent oscillations of linkage disequilibria ...” (Kouyos et al. 2007)) (Fig. 4.2). In analogy with this theory for sex, it was proposed that aging would limit the spread of diseases caused by other living beings, in a perennial dynamics of host-parasites competition (Mitteldorf and Pepper 2009). (E) Aging caused by mitochondrial oxidative substances hypothesis The damage induced by mitochondrial reactive oxygen species (ROS) has been proposed as the leading cause of senescence conceived as a particular type of phenoptosis (“slow phenoptosis”), i.e., as a phenomenon favored by natural selection (Skulachev and Longo 2005; Skulachev 1999a, 2001). (F) “Chronomeres” and “printomeres” hypothesis It has been proposed the existence of hypothetical “chronomeres” and “printomeres” that would be the pivotal parts of the mechanisms of aging conceived as a programmed phenomenon (Olovnikov 2003, 2015).

128

4 The Comparison Between the Two Paradigms

(G) Aging as an accelerating factor of evolution hypothesis In 1961, a botanist, Aldo Carl Leopold, reiterated Weismann’s intuition that aging favors evolution because it accelerates generation turnover and so the diffusion of favorable genes: “. . . in plants senescence is a catalyst for evolutionary adaptability” (Leopold 1961). In 1983 (in a non-peer-reviewed book) and, in 1988 (in a peer-reviewed article), and later in other papers, observing that an increase in the advantage of a gene or an equivalent reduction of the life span have the same effect on the diffusion of a gene within a species, it was proposed that aging was advantageous in terms of kin selection in spatially structured populations (Libertini 1983, 1988, 2006, 2009a, 2013). Similar theories that showed an evolutionary advantage for aging, and therefore for a form of programmed death, in spatially structured populations were proposed in the years between 2004 and 2014 using complex models (Travis 2004; Martins 2011; Mitteldorf and Martins 2014). (H) In 2008, it was highlighted that there were some common predictions for all the theories that proposed an adaptive meaning for aging: (i) the necessity of the existence of non-aging species, i.e., of species without an age-related increase of mortality in the wild; (ii) among aging species, the prediction not of a direct relation between extrinsic mortality and the proportion of deaths due to senescence, as proposed by non-adaptive aging theories, but of an inverse relation; and (iii) the necessity of the existence of specific mechanisms, determined and regulated by genes, which should determine aging. It was highlighted that many non-adaptive aging theory would have significant or insurmountable difficulties to explain (i), and that (ii) and (iii), if confirmed by evidence, would have been in total contrast with the theories of non-adaptive aging paradigm (Libertini 2008). In the following Section 4.4 – Arguments and evidence in support or against the two paradigms, we will consider the arguments and evidence in support or against the seven previously mentioned theories belonging to the paradigm of non-adaptive aging and, as regards the opposite paradigm, only the theories reported in D (Red Queen hypothesis for aging) and G (Aging as an accelerating factor of evolution hypothesis). This limitation has the following reasons: (A) and (B) express concepts that can be considered preliminary and intrinsic to (G) and do not constitute distinct theories. What stated in (C), namely that aging leads to a greater speed of evolution, expresses an effect of aging that is the same proposed in (G). (E) and (F) are hypotheses concerning the mechanisms that would determine aging and do not represent specific theories about the causes of aging. (H) expresses only plausible predictions that are common to all the theories of the adaptive aging paradigm. It should also be emphasized that within (G), it is possible to distinguish between the various ways by which it appears possible to propose and evaluate the natural selection mechanisms that would favor aging. The mechanism based on kin selection (Libertini 1988), which is easier to explain and does not involve the

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

129

construction of elaborate models based on spatially structured populations, will be described in Section 4.5 – Aging as an accelerating factor of evolution theory. As for the other models, it is advisable to read the respective articles (Travis 2004; Martins 2011; Mitteldorf and Martins 2014). The possible mechanisms of aging will be presented in the next Chapter 5 – Subtelomere-Telomere aging theory.

4.4

Arguments and Evidence in Support or Against the Theories Pertaining to the Two Paradigms

There are some arguments (theoretical considerations) and evidence (documented phenomena) that should be weighed as elements in support or against the theories about aging that have been briefly mentioned before. The following discussion has already been proposed in another work (Libertini 2015a), being presented here with some essential modifications and enrichments.

4.4.1

Absence of Unlikely Postulates

A theory certainly needs to have as a starting point hypotheses from which deductions arise that then require empirical confirmations. However, a theory should never have as a starting point unlikely postulates, which would make any deduction taken from them equally unlikely. Obviously, the evaluation of the likelihood or non-likelihood of a starting hypothesis can be questionable. With this reservation, it should be pointed out that for various theories, some starting hypotheses appear to be unreliable, not easily justifiable and, in any case, not based on empirical evidence, and therefore should be considered as unlikely postulates. It is important to consider that the presence of an unlikely postulate makes invalid or at least unreliable the theory grounded on this postulate. – Damage Accumulation hypotheses implicitly postulate that natural selection is unable to elaborate mechanisms that can oppose the various harmful factors that are hypothesized by each theory as the cause of aging. According to this postulate, natural selection, although with proved power of forging marvels of all kinds, would be unable to develop effective mechanisms that oppose a harmful factor and repair its damage. – Mutation Accumulation h. implicitly postulates that the harmful alleles hypothesized as a cause of aging because insufficiently eliminated by natural selection are present to varying degrees related to the rapidity of aging shown by each species. Furthermore, as part of this postulate, the harmful alleles should not exist or have consequences in non-aging species.

130

4 The Comparison Between the Two Paradigms

– Antagonistic Pleiotropy h. implicitly postulates that the hypothesized pleiotropic genes cannot have, as an alternative, equivalent alleles with the same beneficial effects in the early stages of life but without harmful actions in older ages. It also implicitly postulates that the number and effects of these pleiotropic genes correlate with the rhythms of aging of each specie and that these genes are absent in species that do not age. – Disposable Soma h. explicitly postulates that, since specific resources are limited, the organism is obliged to make a choice for their allocation, in particular between the needs of reproduction and those of body repair and maintenance mechanisms. Moreover, the postulate excludes the possibility that the organism may have resources in such quantity as to satisfy both these needs simultaneously. – Cessation of Somatic Growth h. explicitly postulates that the mechanism blocking the growth when a certain size has been reached (the Bidder’s “regulator”) must necessarily have negative and progressively damaging effects on the organism’s fitness, i.e., determines aging. Moreover, the theory postulates that a regulatory mechanism without these hypothetical harmful effects cannot exist. – Quasi-Programmed Aging h. is based on three explicit postulates: (i) existence of a developmental program that is not switched off and whose continuation is harmful (“Once a program for development is completed, it is not switched off, even if its continuation is harmful [e.g., senescence].” (Blagosklonny 2006)); (ii) impossibility of turning off this harmful developmental program (“... A potential switch that would turn off the developmental program cannot be selected ...” (Blagosklonny 2006)); (iii) limitations in the repair functions caused by limits in energetic resources (“Repair is costly and limited by energetic resources” (Blagosklonny 2013)). The first two postulates are the opposite of the postulate proposed by Cessation of Somatic Growth h.: while for this theory we get older because the development program is interrupted, according to Quasi-Programmed Aging h. the developmental program cannot be interrupted and its continuation is harmful and causes aging. The third postulate is similar to that required by Disposable soma h. – Historical h. proposes that the rhythms of aging, and the non-aging condition, are a function of the characteristics of the ancestors. This theory implicitly postulates that natural selection in the course of evolution is unable to modify the aging characteristic of ancestors. Similarly to what has been said concerning the implicit postulate of Damage Accumulation hypotheses, natural selection, which has proved capable of prodigies of all kinds, when it comes to the features of aging would become ineffective and inadequate for their possible modifications. – Red Queen h. implicitly postulates that outside of the selective pressures deriving from the relationships between different living species (relations that are certainly of extreme importance and not to be underestimated), the selective pressures deriving from other factors may be disregarded. It should be noted that if this

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

131

unnecessary postulate is deleted, the Red Queen h. becomes indistinguishable from the Aging as an accelerating factor of evolution h. Similarly, if this second hypothesis was unduly restricted only to the selective pressures deriving from the relationships between the living species, it would become identical to the Red Queen h.

4.4.2

Non-universality of Aging

It is well known and documented that many species (including many vascular plants, invertebrates and vertebrates) in the wild do not show any age-related increase of mortality and do not have a determinable life span (“Indeterminate Lifespans and Negligible Senescence” (Finch 1990, p. 202)). For some species, even the mortality rate shows an age-related decrease (Vaupel et al. 2004). Indeed, in these cases there is an age-related increase in body size and this reduces the risk of predation by other species and so the mortality. Therefore, instead of defining this phenomenon “negative senescence” (Vaupel et al. 2004), such cases should be considered as examples of negligible senescence with the superposition of another different phenomenon, the increase in body size, which reduces mortality. The existence of species that do not age is foreseen by some theories: – Regarding Cessation of Somatic Growth h., Bidder proposed that there was “some mechanism to stop natural growth so soon as specific size is reached. This mechanism may be called the regulator ... senescence is the result of the continued action of the regulator after growth is stopped” and, in cases where there was no mechanism that blocked growth, such as for many invertebrates and lower vertebrates, there was no senescence (Bidder 1932). – The possibility of non-aging species is also compatible with Historical h. In fact, to explain that there is no aging in a species or a group of species, it would suffice to suppose that their ancestors had the same characteristic. – The existence of species that do not age is also perfectly compatible with Aging as an accelerating factor of evolution h. The general prediction of this theory is that, outside of particular ecological conditions, a species should not show the phenomenon of aging. To put it another way, the simplest and most ancestral condition is non-aging while aging is an evolved adaptive condition that is favored by natural selection in particular cases. As for the other theories: – For Red Queen h., since the conditions that would favor aging are the selective pressures deriving from relationships with other species, as it is not conceivable a species that does not have relations with other species, it appears difficult to explain the non-aging condition.

132

4 The Comparison Between the Two Paradigms

– Mutation Accumulation h. and Antagonistic Pleiotropy h. could explain the existence of species that do not age only with further inadmissible postulates according to which genes harmful to a certain age or aging-causing pleiotropic genes do not exist, or are insufficient in their harmful actions, in non-aging species. – Similarly, Disposable Soma h. and Quasi-Programmed Aging h. should deny the validity of their postulates, or opportunely modify them, for non-aging species. – For theories belonging to Damage Accumulation hypotheses, certainly for the older ones, they do not appear to consider or justify the absence of age-related mortality increase shown in the wild by many species (Comfort 1979). – In general, at least for the theories that want to be compatible with the mechanisms of natural selection, the lack of satisfactory explanations for the condition of non-aging species has been pointed out as a critical point: “The possibility of negligible senescence has not been widely discussed, and may be in conflict with mathematical deductions from population genetics theory” (Finch and Austad 2001).

4.4.3

Variation of Aging Rhythms in the Comparison among Species

For the species that show the aging phenomenon, it is possible to observe a wide variation of aging rhythms even among species of the same phylum (Comfort 1979). – For the theories of non-adaptive aging paradigm, the aging rate should depend on the hypothesized cause for the phenomenon, not disregarding that factors as the body size and brain weight should have a modulating action on the aging rate. However, there is not an unquestioning confirmation of the relationship hypothesized by a theory and sometimes the opposite is even observed (Comfort 1979). For example, the theories linking aging rhythms to metabolic rates are contradicted by the lack of an inverse relationship between metabolism rate and aging rhythms. The most striking case is that of many species of birds that, although with a high metabolic rate, show a long lifespan (Comfort 1979). – Mutation Accumulation h. and Antagonistic Pleiotropy h. do not in any way justify the differences in aging rates. – Disposable Soma h. and Quasi-Programmed Aging h. would lead us to believe that aging rates and reproduction capacities should be inversely correlated but there is no evidence regarding this correlation. – The postulate of Historical h. is contradicted by the considerable variation of aging rates for species within the same group (e.g., among mammals and among birds). – Cessation of Somatic Growth h. could justify some variation of the aging rate as related to growth differences.

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

133

– For Aging as an accelerating factor of evolution h., aging rhythms are in function of the ecological conditions that favor or do not favor aging and therefore the variations of aging rhythms are fully compatible with the theory. A higher body mass and greater capacity for learning increase the advantages of a longer lifespan. Therefore, it is predicted and justified (Libertini 1988) the positive relationship observed between longevity and adult body size in vertebrates (Bourlière 1957, 1960; Sacher 1959) and that between longevity and adult brain weight in mammals (likely related to the ability of learning) (Comfort 1979; Sacher 1959). – However, there are surely other factors, not always well known or studied in depth, which influence the natural selection regarding the lifespan of the species. Implicitly, this ability of evolution to modulate the longevity of the species demonstrates the priority of the determinants of natural selection over the various intrinsic limits postulated by the theories of the non programmed aging paradigm. – An example of this ability is given by some related species of sea urchins, with quite similar living conditions, but significant differences in lifespan (Ebert and Southon 2003; Amir et al. 2020). Thus, the green sea urchin (Lytechinus variegatus) lives around 4–5 years, the purple sea urchin (Strongilocentrotus purpuratus) lives around 50 years, and the red sea urchin (Mesocentrotus franciscanus) appears virtually “immortal” and can live more than 200–300 years without any reduction in reproduction and regeneration capacities, and showing no apparent traits of aging (Ebert and Southon 2003; Amir et al. 2020; Bodnar 2015; Bodnar and Coffman 2016). The main differences between these species, which are likely to determine such different lifespans, lie in their life cycles. The two species with a longer lifespan (S. purpuratus and M. franciscanus) have a more prolonged planktonic stage and attend sexual maturity at a higher age compared to L. variegatus (Albright et al. 2012; Kato and Schroeter 1985; Gaitán-Espitia and Hofmann 2017). Still, the “usefulness” of a further lifespan extension observed in M. franciscanus, appears to be related to the social interactions. The singularity of M. franciscanus consists in the fact that adult sea urchins allow the young urchins, just switched to the benthic stage, to hide between their spines from predators (Nishizaki and Ackerman 2005). The efficiency of youth defense is positively related to adult urchin’s size and age (Nishizaki and Ackerman 2005). In this context, adult red sea urchins show evident altruistic behavior, dedicated to the young individuals of the species with a very low probability of being its offspring, considering migration distances of the planula, and the genetic variations observed (Moberg and Burton 2000). It encounters understandable incommodities related to the necessity to share its food with the young, adjust the locomotion to the little ones’ exigencies, and take care not to lose them before the appropriate time comes. In exchange for all these “troubles” M. franciscanus gets virtual immortality, the latter being not “the end goal of the life” but just a means to assure a better survival of other individuals within the population, favored by natural selection. The molecular changes associated with behavior, sociality, and lifespan control in red sea urchins, are

134

4 The Comparison Between the Two Paradigms

rather complex and involve many molecular pathways, including telomere length control (Polinski et al. 2020; Bodnar 2015). Regarding the higher mammalians, with much more complex behaviors and interaction patterns between individuals within communities than the ones developed at the beginning of metazoan evolution (as in red sea urchins), the lifespan regulation appears considerably more complicated and less univocal. Still, it remains a subject of natural selection as well. With the increase in individual development complexity during evolution, the formation of mechanisms that accurately adjust it becomes even more relevant. On the background of some types of social organization in the wild, it appears even the necessity to regulate the individual’s lifespan and withdraw some individuals from reproduction, still preserving them in the population. For example, this happens in orcas, where postmenopausal females usually have a leading role in the family group and are involved in tradition propagation (Brent et al. 2015; Foster et al. 2012). At the same time, such females gain the possibility of redistributing time and energy from rising offspring at stages of its highest vulnerability, taking care of all the group members, and readily sharing their unique experience. They also gain more freedom in every action, less concerned about their interests and immediate needs (while not pregnant or feeding offspring), and more – about the sake of the community -, improving its overall survival. To some extent, similar things concern the behavior of many primates, with the vast implications of aged adults (both males and females) in the community’s life, often as culture-bearers (Yamamoto et al. 2013; Schofield et al. 2018). Moreover, in such communities, the learning efficiency by younger individuals increases a lot not only if a highly positioned individual shares the experience but also when it has some traits associated with aging (as gray hair in great apes) (Kendal et al. 2015; Estienne et al. 2019; Horner and de Waal 2009). In light of this, the lifespan extension appears tightly related to sociality and the utility of the individual for the whole community. Thus, the expected molecular mechanisms of lifetime control are likely to take into account the signals of such utility. – Red Queen h. does not express particular predictions about the variation of aging rhythms, and also for the evidence exposed in the following subsections. However, if we consider this theory as the same Aging as an accelerating factor of evolution h. with the addition of an unnecessary restriction, we can attribute to Red Queen h. always the same predictions of the other theory, avoiding unnecessary repetitions.

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

4.4.4

135

Consideration of Supra-Individual Natural Selection and Phenoptotic Phenomena

– For the supporters of the non-adaptive aging paradigm, it is unlikely that something harmful to the individual, as surely aging is, could be favored by natural selection: “any hypothetical ‘accelerated ageing gene’ would be disadvantageous to the individual. It is therefore difficult to see how genes for accelerated aging could be maintained in stable equilibrium, as individuals in whom the genes were inactivated by mutation would enjoy a selection advantage” (Kirkwood and Austad 2000); “The anomalous nature of ageing as a putative adaptation is that it is bad for the individual in which the process is exhibited. An animal that grows to maturity and thereafter reproduces indefinitely has, other things being equal, a greater Darwinian fitness than one that grows to maturity and then survives and reproduces for only a fixed period of time” (Kirkwood and Melov 2011). – However, as discussed in Chapter 2 – Evolution and phenoptosis, there are numberless cases in which an individual can sacrifice its life, or put it in grave danger, or kill its kin (Finch 1990). These phenomena, defined as “phenoptosis” (Skulachev 1997, 1999b; Libertini 2012), demonstrate that natural selection can certainly favor phenomena that are disadvantageous at an individual level but somehow advantageous in supra-individual terms (Libertini 2012). The idea that a character harmful for the individual can never be favored by natural selection represents a conception of natural selection that erroneously excludes the possibility that a gene harmful for the individual can be favored by mechanisms of supra-individual selection (Libertini 2012, 2014a). The consideration of supraindividual natural selection and phenoptotic phenomena is the fundamental concept that allows the suggestion of Aging as an accelerating factor of evolution h. – Cessation of Somatic Growth and Historical h. express no consideration about this subject.

4.4.5

Effects of Caloric Restriction on Lifespan

It has been proven for a long time (McCay et al. 1935) and confirmed in recent times (Masoro 2005; Speakman and Mitchell 2011; Mattison et al. 2012; Ribarič 2012; Lee and Min 2013; Longo and Mattson 2014) that animals of diverse origin reared under conditions of caloric restriction (CR) show a longer life span than animals fed ad libitum. For many scholars, this proves a clear relation between CR and life span increase. However, other interpretations have been proposed: (i) Ad libitum feeding is an artificial phenomenon while the normal condition (i.e., that existing in the wild) is CR: “instead of comparing control animals with restricted animals, we are in fact comparing overfed animals with adequately fed ones, and, not surprisingly, the

136

4 The Comparison Between the Two Paradigms

overfed ones die younger.” (Austad 2001); (ii) Ad libitum feeding is hyperalimentation, which reduces the possibility of a long life span because it induces various pathological conditions (Ribarič 2012; Masoro 2005); and (iii) The greater life span is a laboratory artefact because CR in the wild would not increase the longevity (Adler and Bonduriansky 2014). In point of fact, in two controlled studies on humans, (i) calorie restriction protected against the development of obesity, hypertension, cardiovascular diseases, and cancer (Al-Regaiey 2016); and (ii) calorie restriction coupled with high levels of physical activity determined a decrease in blood pressure, insulin and serum cholesterol levels, body weight, and other physiological parameters (Walford et al. 1992). However, these alterations or diseases against which the calorie restriction was effective were rather a result of unhealthy lifestyles to which our species is not adapted. Therefore, these studies showed that a caloric restriction opposed the harmful effects of unhealthy lifestyles but they were by no means sufficient to demonstrate that they could determine a reduction in the rhythms of aging in healthy living conditions. – For Disposable Soma h. aging is the consequence of limited resources that forces an evolutionary choice in the allocation of the resources, which must be divided between the necessities of reproduction and those of body repair and maintenance. An easy deduction is that a reduction in resource availability should determine a reduction of life span. However, the effects of CR are interpreted as an increase, or at least non-reduction, of the life span and, in any case, the evidence contradicts the prediction of life span reduction by Disposable Soma h. In the attempt to solve this discrepancy a particular variant of the theory was proposed (Kirkwood et al. 2000), but this solution has been strongly criticized as inadequate and insufficient (Mitteldorf 2001). – On the contrary, for Aging as an accelerating factor of evolution h., aging is not determined by the availability of metabolic resources and, so, the effects of CR do not contradict this hypothesis. On the one hand, ecological conditions to which a species is not adapted (e.g., overfeeding) can induce pathological conditions and therefore reduce life span (Libertini 2009b). On the other hand, the availability of resources can serve as a complex modulator of an individual’s progression through the life cycle.

4.4.6

Existence of Age-Related Increasing Mortality in the Wild

For many animal species, there is a well-documented age-related mortality increase at ages existing in the wild (Libertini 1983; Ricklefs 1998; Nussey et al. 2013) (Fig. 4.3). In particular, Nussey et al. underlined that aging is commonly detected under wild conditions, as pointed out in 340 studies on 175 animal species (Nussey et al. 2013).

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

137

Fig. 4.3 Life table of hippopotamus (Hippopotamus amphibius) under natural conditions. The first years of life, in which the mortality is higher, have been excluded. (Data from (Ricklefs 1998))

Fig. 4.4 Life table of a human population (Ache people, Paraguay) in the wild. (Data from (Hill and Hurtado 1996))

For our species, the same was documented by the study of a human population (Ache people of Paraguay) in the wild. The fractions of individuals who survived at the ages of 65, 70 and 75 years, were 27%, 20% and 12%, respectively (Fig. 4.4), and, among the individuals not died before age twenty, the survivors at the same ages were 42%, 32% and 18%, respectively (Fig. 4.5) (data from (Hill and Hurtado 1996)). – The existence of age-related increase in mortality in the wild is an essential preliminary condition for any theory that wants to propose an adaptive meaning

138

4 The Comparison Between the Two Paradigms

Fig. 4.5 The same as the previous figure, limited to 20 years old survivors. (Data from (Hill and Hurtado 1996))

for aging. In fact, in the paper that proposed the first adaptive aging theory, necessary attention was devoted to documenting, on the basis of pre-existing studies on animal populations in the wild, that an age-related increase in mortality was well evident under natural conditions (Libertini 1988). Consequently, Aging as an accelerating factor of evolution h. recognizes without hesitation the existence of the aging phenomenon in the wild. – On the contrary, by some supporters of the non-adaptive aging paradigm, the possibility of age-related increasing mortality under wild conditions is minimized or denied as of sufficient magnitude to make sense for the effects of natural selection. For Kirkwood and Austad senescence does not appear to contribute significantly to mortality in the wild and so natural selection cannot directly influence the process of senescence (Kirkwood and Austad 2000). It is interesting to note that Austad is among the authors of another article, already cited (Nussey et al. 2013), which 13 years later documented and pointed out exactly the opposite); “Data on age-related mortality patterns in wild animal populations reveal that, in many species, individuals rarely survive to ages when senescent deterioration becomes apparent (Medawar 1952; Lack 1954; Finch 1990).” (Kirkwood 2005); “senescence-associated increases in age-related mortality are far from ubiquitous, and ..., even where they are observed (Finch 1990; Jones et al. 2008), they contribute only to a relatively small fraction of deaths within the

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

139

population, ...” (Kirkwood and Melov 2011). The denial or underestimation of the existence of aging in the wild perhaps stems from a gross misunderstanding. It is clear and indisputable that individuals in an advanced state of aging (for example the equivalent of a centenarian or of a 90-year-old man) are practically unable to survive in the wild and therefore individuals so old are rarely or never observable under natural conditions. The misunderstanding is to consider the condition of these individuals as a synonym of aging and to forget that aging is defined as the progressive age-related decline in fitness (i.e., increasing mortality) and is not a synonym of the most advanced manifestations of such decline. – The existence of species showing age-related increasing mortality under wild condition is not denied by Cessation of Somatic Growth h. and by Historical h.

4.4.7

In the Comparison Among Species, the Inverse Relation Between Extrinsic Mortality and the Proportion of Deaths Due to Intrinsic Mortality

Among the species that in the wild show an age-related mortality increase (i.e., aging), an inverse relation between extrinsic (or environmental) mortality (m0) and proportion of deaths due to the age-related mortality increase (“proportion of senescent deaths”, Ps (Ricklefs 1998)) is known (Ricklefs 1998). The concept is illustrated in Fig. 4.6). The inclusion of data from a human population studied under

Fig. 4.6 The curve “Real” indicates the real life table of a species that shows an age-related mortality increase. The overall mortality of this life table is given by the sum of extrinsic mortality (m0), considered as constant at all ages (the early ages with higher mortality are excluded) and intrinsic mortality (mi) due to aging and so showing an age-related increase. The curve “Hyp.” indicates a hypothetical life table with the same m0 while mi is equal to zero (i.e., with no age-related mortality increase). The curve Real delimits the area A, the area B is the space between the curves Real and Hyp., and the curve Hyp. delimits the sum of the areas A and B. The term Ps, the proportion of deaths due to aging, indicates the ratio B/(A + B)

140

4 The Comparison Between the Two Paradigms

Fig. 4.7 The figure shows the inverse relationship, in data from some mammal and bird species, between extrinsic mortality (m0) and the proportion of deaths (Ps) due to intrinsic mortality (mi), i.e., the deaths due to aging. Ordinates in logarithmic scale; open rhombs ¼ mammal species; solid rhombs ¼ bird species; open square ¼ Ache people in the wild (data for mammal and bird species from (Ricklefs 1998), data for Ache people from (Hill and Hurtado 1996); figure from (Libertini 2013), redrawn)

natural conditions (Hill and Hurtado 1996) is in accordance with this inverse relationship (Libertini 2013) (Fig. 4.7). – The first theory that proposed an adaptive meaning for aging, also suggested that a high environmental mortality would have reduced the hypothesized advantage of a shorter mean duration of life caused by aging. Therefore, in the comparison among species, the higher environmental mortality was predicted to be associated with a smaller reduction of the life span due to aging (“Methuselah effect” (Libertini 1983, 1988)). This paradoxical effect was proposed on the basis of theoretical arguments without sufficient empirical evidence. Only some years later, in 1998, Ricklefs, while trying to document the direct relation between extrinsic mortality and the “proportion of senescent deaths” (Ps) predicted by non-adaptive aging theories, unexpectedly documented the inverse relation predicted by the aforesaid adaptive aging theory (Fig. 4.7): “Senescence reduces average life span by only 2% when m0 ¼ 1.0 yr-1 but by almost 80% when m0 ¼ 0.01 yr-1” (Ricklefs 1998). The fact that Ricklefs was trying to document a direct relation for supporting the prediction of non-adaptive aging hypotheses but found the opposite of what he was looking for, is clearly demonstrated by the contradiction between the title of his article (“Evolutionary theories of aging: confirmation of a fundamental prediction, with implications for the genetic basis and evolution of life span”) and what the author then declares in the text: “Thus, the observation reported here of increasing senescence-related mortality in populations with progressively older age structure (lower initial mortality rate m0) weighs against two popular hypotheses (mutation accumulation and antagonistic genetic pleiotropy) for the genetic basis of aging in birds and mammals. The

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

141

repair hypothesis of senescence [i.e., Disposable Soma h.] could be consistent with observed patterns of aging-related mortality if genetic variations for repair capabilities decreased with increasing age of expression of physiological deterioration.” (Ricklefs 1998) As a matter of fact, Ricklefs tried to save only the Disposable Soma h. suggesting the necessity of an ad hoc hypothesis that has the taste of an emergency patch. The same inverse relationship between extrinsic mortality and Ps was predicted several years later by a model that showed that aging was advantageous in spatially structured populations (Mitteldorf and Martins 2014). As already hinted in a previous paper (“adaptive hypothesis ... appears indispensable to explain the observed inverse correlation between extrinsic mortality and the proportion of deaths due to intrinsic mortality” (Libertini 2008)), it was observed in the same paper of Mitteldorf and Martins that this inverse relationship, in clear contradiction with the predictions of non-adaptive aging hypotheses, was necessarily a common prediction of all adaptive aging theories: “this complementary relationship between background death and evolved senescence is characteristic of adaptive theories of aging. A high background death rate leads to a longer evolved life span. This contrasts with classical theories, in which a high background death rate leads to a shorter evolved life span.” (Mitteldorf and Martins 2014). – The theories of the non-adaptive aging paradigm maintain that: “The principal determinant in the evolution of longevity is predicted to be the level of extrinsic mortality. If this level is high, life expectancy in the wild is short, the force of selection attenuates fast, deleterious gene effects accumulate at earlier ages, and there is little selection for a high level of somatic maintenance. Consequently, the organism is predicted to be short lived even when studied in a protected environment. Conversely, if the level of extrinsic mortality is low, selection is predicted to postpone deleterious gene effects and to direct greater investment in building and maintaining a durable soma” (Kirkwood and Austad 2000). Therefore, there is a clear contradiction between the prediction of the non-adaptive aging paradigm and the inverse relationship observed between extrinsic mortality and the proportion of deaths due to aging. However, no explanation compatible with non-adaptive aging hypotheses has been ever proposed for the inverse relation mentioned above. – Cessation of Somatic Growth h. and Historical h. do not predict the aforesaid inverse relation and do not appear compatible with it.

142

4.4.8

4 The Comparison Between the Two Paradigms

Impossibility of Explaining Age-Related Fitness Decline as a Consequence of Genes that Are Harmful at a Certain Age

Mutation Accumulation h. proposes that the general decay of physiological functions (i.e., aging) is determined by many harmful genes that express their noxious effects at older ages when few individuals survive and so reproductive value is small. Therefore, since the elimination of these genes by natural selection is insufficient, the consequences of their actions cannot be avoided and the organism ages. A strong theoretical argument against this hypothesis was formulated in the same paper where the first adaptive aging theory was proposed (Libertini 1988) and confirmed in later works (Libertini 2015a; Libertini et al. 2017). Since this argument has never been proved to be invalid and is essential for evaluating the acceptability of the Mutation Accumulation h., it is opportune to briefly mention it here. As a premise it is necessary to remember that the equilibrium frequency of phenotypic expression of a gene (Pe) between a harmful allele (C) and its neutral allele (C0 ) is given by the formulas: Pe ¼ v=½s

ð4:1Þ

Pe  v=½s

ð4:2Þ

if C is recessive, and

if C is dominant (where: v ¼ mutation frequency of C0 - > C, while the reverse mutation, C - > C0 , is disregarded; for these formulas, see the Appendix). Let us define as “t-gene” a hypothetical gene that carries out a damage -s at time t and is neutral before the age t. As any t-gene is harmful only for the survivors at time t (Yt), natural selection is effective in function of (s Yt) and the formulas (4.1) and (4.2) become: Pe  v=ð½s Yt Þ

ð4:3Þ

Now, given a species with a constant death rate (λ) at any age (i.e., which does not age), the question is whether a significant number of t-genes could determine a life table similar to that of a species which shows an age-related mortality increase. The following equation gives the life table of the species without the effects of t-genes: Y tþ1 ¼ Y t ð1  λÞ

ð4:4Þ

If there are m t-genes acting at time 1, as many genes at time 2, and so on, each causing a damage equal to -s (for simplicity all t-genes are assumed to be equally damaging), the survivors at any time t + 1 will be:

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

143

Fig. 4.8 Curve A: ideal life table obtained by formula 4.4 (λ ¼ 0.02). Curve B: effects on curve A of many t-genes, obtained by formula 4.5, with the values λ ¼ 0.02; m ¼ 1000; v ¼ .000001

Y tþ1 ¼ Y t ð1  λ  m s Pe Þ  Y t ð1  λ  m v=Y t Þ

ð4:5Þ

It should be noted that in the Eq. (4.5), s is absent and is therefore irrelevant for the calculation of Yt + 1. Moreover, as the frequency of mutation (v) is presumably very small, the decrease of Yt at each unit of time will be minimal until the value of Yt becomes quite small. Figures 4.8 and 4.9 illustrate the modifications caused by a great number of t-genes on a hypothetical life table with constant mortality. Figure 4.10 shows: A) the real-life table in the wild of a species that ages (Panthera leo); B) the same life table without the mortality increase due to aging, i.e., only with a constant extrinsic mortality; C) curve B plus the effects of many hypothetical t-genes (1000 for each year). The figures show that the effects of a high number of t-genes would not determine a life table similar to that of an aging species. – Mutation Accumulation h. explains aging as the effect of many t-genes, but the argument before described shows that even a great number of t-genes would not determine a life table similar to that of an aging species. – No other theory hypothesizes t-genes as the cause of aging and so the argument is indifferent to them. In short, the suggestion of Mutation Accumulation h. that aging is caused by many t-genes appears totally unacceptable. Nevertheless, there is an interesting corollary. As natural selection cannot eliminate a t-gene that would exert its action at ages not existing in the wild, a species not showing any mortality increase in the wild, under artificial conditions and at ages subsequent to those existing in the wild,

144

4 The Comparison Between the Two Paradigms

Fig. 4.9 Curve A: ideal life table obtained by formula 4.4 (λ ¼ 0.07). Curve B: effects on curve A of many t-genes, obtained by formula 4.5, with the values λ ¼ 0.07; m ¼ 1000; v ¼ 0.000001

Fig. 4.10 Hypothetical effects of many t-genes on the life table of a real species. Curve A ¼ life table in the wild of Panthera leo, with mortality rates described by Weibull’s equation (mt ¼ m0 + α tβ) and the values m0 ¼ 0.032; α ¼ 0.000252; β ¼ 3; obtained from Ricklefs (Ricklefs 1998); Curve B ¼ hypothetical life table showing Curve A without any age-related mortality increase, i.e., only with a constant extrinsic mortality (m0 ¼ 0.032); Curve C ¼ hypothetical life table showing the effects on curve B of a many t-genes (m ¼ 1000; v ¼ 0.000001)

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

145

might show an age-related mortality increase due to t-genes that in no way can be eliminated by natural selection. However, the theoretical prediction of an “increasing mortality with increasing chronological age in captivity (IMICAC)” regards a phenomenon that is different from aging and must not be confused with it (Libertini 1988).

4.4.9

Age-Related Progressive Decline of Cell Turnover Capacities

For this and the following two subsections, concerning the evidence mentioned there, only a short exposition will be proposed, referring to the next Chapter 5 – Subtelomere-Telomere aging theory for a more precise discussion. Cells may die by necrosis (caused by various events such as trauma, infection, ischemia, etc.), or by various types of programmed cell death (PCD), e.g.: (i) keratinization of epidermis and hair cells; (ii) detachment of cells from the mucosae of body cavities; (iii) transformation of erythroblasts in erythrocytes afterwards removed by macrophages; and (iv) apoptosis, an ordinate process of self-destruction where cell parts are not damaging but are used by other cells. Apoptosis, sometimes wrongly used as a synonym of PCD, was differentiated from necrosis observing normal hepatocytes (Kerr et al. 1972). This phenomenon is essential for cell turnover in healthy adult organs and is documented for many tissues and organs (Libertini 2009a). There is a continuous elimination of cells by the action of PCD, which, in a normal young organism, is perfectly balanced by the proliferation of specific stem cells: “Each day, approximately 50 to 70 billion cells perish in the average adult because of programmed cell death (PCD) [i.e., about 690,000 cells per second!]. Cell death in self-renewing tissues, such as the skin, gut, and bone marrow, is necessary to make room for the billions of new cells produced daily. So massive is the flux of cells through our bodies that, in a typical year, each of us will produce and, in parallel, eradicate, a mass of cells equal to almost our entire body weight.” (Reed 1999). The velocity of cell turnover varies greatly depending on cell type and organ: “... bone ... has a turnover time of about ten years in humans ...” (Alberts et al. 2014) and, for the heart, if “dying myocytes were not constantly replaced, the entire organ would disappear in 4.5 years” (Anversa et al. 2006) while in “the intestinal epithelium, ... cells are replaced every three to six days.” (Alberts et al. 2014) (for other cell types see (Richardson et al. 2014)). Cell turnover is the rule in vertebrates, but it is not so for all animals (e.g., the adult stage of the worm Caenorhabditis elegans does not show cell turnover and has a fixed number of cells) (Finch 1990). Cell turnover is restrained by limits in cell replication capacities, for the first time demonstrated by Hayflick (Hayflick and Moorhead 1961, Hayflick 1965).

146

4 The Comparison Between the Two Paradigms

Olovnikov and then Watson suggested that the finite number of duplications could be explained by the fact that DNA molecule shortens at each duplication, which would limit the possible replications (Olovnikov 1971; Watson 1972). Moreover, Olovnikov hypothesized an indispensable enzyme (later called telomerase) that would restore telomere length and allow infinite duplications (Olovnikov 1973). Afterwards, it was shown that the end of the DNA molecule (telomere) was a simple repeated sequence of nucleotides (Blackburn and Gall 1978). As predicted by Olovnikov, the discovery of telomerase, which added other sequences of the nucleotides, was a necessary explanation for cells, as those of germline, capable of numberless divisions (Greider and Blackburn 1985). It was also shown the telomerase regulation by particular proteins (van Steensel and de Lange 1997) and, for many cell types, an age-related telomere shortening (Takubo et al. 2010). Moreover, it was observed that cell types without cell turnover (e.g., retina photoreceptors and the majority of the central nervous system neurons) depend on other cells with a turnover that actively renews their critical parts. The decline of these satellite cells would well explain the decay of the served cells (Libertini 2009a). Aging may be described as the result of the gradual decline of cell turnover, resulting in progressive atrophy of all tissues and organs (Libertini 2009a; Libertini 2014b), associated with the percentage increase of cells (i) in cell senescence or (ii) in gradual cell senescence (s. below). In any case, cell turnover and its gradual decline are clearly subjected to a genetic regulation that is certainly very complex and sophisticated. – Any theory suggesting an adaptive meaning for aging must predict and, indeed, require that aging is genetically determined and regulated. This means the prediction of specific mechanisms that progressively reduce the organism’s efficiency and cause an age-related increasing mortality. Therefore, the phenomena mentioned above do not contradict adaptive aging hypotheses and, on the contrary, are essential for their plausibility (Libertini 2008). – For non-adaptive aging hypotheses the existence of mechanisms, clearly genetically determined and modulated, that progressively alter the functions of the organism and increase the mortality cannot have as an explanation the random accumulation of harmful effects of any kind. Therefore a different and plausible interpretation is absolutely necessary for the possible validity of these theories. It has been proposed that the limits in cell replication capacities are a general defense of the organism against cancer (Campisi 1997, 2003; Troen 2003; Wright and Shay 2005). However, this hypothesis does not explain the species that show no age-related fitness decline (species with negligible senescence), and contemporaneously no age-related decline in telomerase activity and increase in cancer mortality (Klapper et al. 1998, 1998; Libertini 2008). Moreover, for our species studied under natural conditions, as the age-related mortality increase, i.e., aging, kills almost all individuals before cancer can be a significant cause of death, it is

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

147

untenable that a possible defense against cancer kills before the disease begins to be a significant cause of death (Libertini 2013). Other strong objections to this explanation have been highlighted with the clear conclusion that the hypothesis of telomerase restriction to prevent cancer and so increase life span is “certainly false” (Mitteldorf 2013). For this and the following two arguments: – Cessation of Somatic Growth h. proposes a quite different mechanism (Bidder’s “regulator”, which would act when growth stops), but there is no empirical confirmation. – Quasi-Programmed Aging h. propose an opposite mechanism (a developmental program that cannot be switched off and whose continuation is harmful), for which there is no evidence. – Historical h. makes no prediction and any mechanism could be compatible with this hypothesis.

4.4.10 Cell Senescence Program Cells pass from the condition in which they can duplicate (“cycling state”), to a condition in which duplication is not allowed (“non-cycling state”), by a mechanism that is activated with a probability that increases proportionally to telomere shortening (Blackburn 2000). This blockage of replicative capacity together with a general alteration of cell functionality constitutes a specific complex mechanism characterized by stereotyped modifications, a “fundamental cellular program” defined as cell senescence (Ben-Porath and Weinberg 2005). Senescent cells show complex modifications of the transcriptome, which cause alterations of many cell functions. Also, cell secretions in the intercellular milieu are compromised (senescence-associated secretory phenotype, SASP) and this is harmful to other cells and for the functions of the tissues and organs to which the cells belong (Campisi and d’Adda di Fagagna 2007). Moreover, “... human cells induced to senesce by genotoxic stress secrete myriad factors associated with inflammation and malignancy.” (Coppé et al. 2008) and, in mice, the selective elimination of senescent cells has determined: (i) increased lifespan; (ii) fewer age-dependent changes; and (iii), a delayed progression of cancer (Baker et al. 2016). Cell senescence also induces an accumulation of oxidative damage and a lower resistance to oxidative substances. However, the damage caused by oxidation is clearly a consequence and not the cause of cell senescence (Fossel 2004). Moreover, the triggering of cell senescence program and its manifestations, oxidative damage included, is inhibited if the enzyme telomerase is activated (Bodnar et al. 1998; Counter et al. 1998; Vaziri 1998; Vaziri and Benchimol 1998). – For non-adaptive aging hypotheses, the existence of cell senescence program, which is undoubtly determined and regulated by specific genes and contributes

148

4 The Comparison Between the Two Paradigms

actively to aging manifestations, has no plausible explanation. The oncogenic action of cell senescence (Coppé et al. 2008; Baker et al. 2016) makes untenable the possible suggestion that the phenomenon is part of a defense against cancer. The objections before presented against the age-related progressive decline of cell turnover capacities as a defense against cancer should be added to this argument. The absence of an acceptable justification for cell senescence that is compatible with non-adaptive aging hypotheses is a strong argument against their validity. – On the contrary, cell senescence is perfectly compatible with the adaptive aging paradigm, as part of the sophisticated machinery that progressively reduces fitness.

4.4.11 Gradual Cell Senescence In multicellular eukaryotic organisms, the progressive telomere shortening determines the sliding of a heterochromatin ‘hood’ covering the telomere in the adjacent chromosomal portion, defined as subtelomere. This shift causes “an alteration of transcription from portions of the chromosome immediately adjacent to the telomeric complex, usually causing transcriptional silencing, ... These silenced genes may in turn modulate other, more distant genes (or sets of genes).” (Fossel 2004, p. 50). In yeast (Saccharomyces cerevisiae), a unicellular eukaryote, there is an analogous mechanism. In this species, where telomerase is always active, in the cells of the mother lineage there is accumulation at each duplication of extrachromosomal ribosomal DNA circles (ERCs) on the subtelomere (Sinclair and Guarente 1997): “... several lines of evidence suggest that accumulation of ERCs is one determinant of life span ...”, and, proportionally to the number of duplications, increasing metabolic alterations are evident (Lesur and Campbell 2004). Moreover, in yeast tlc1Δ mutants, which are telomerase-deficient, telomeres shorten at each duplication and cells of daughter lineages, which show no ERCs accumulation, have a transcriptome similar to that of non-mutant older individuals of mother lineage (Robin et al. 2014). This phenomenon, defined as “telomeric position effect” (Gottschling et al. 1990), or better as “gradual cell senescence” (Libertini 2015a), will be discussed in detail in the next Chapter 5 – Subtelomere-Telomere aging theory. – For non-adaptive aging theories, since aging is considered always as opposed by natural selection, it is inexplicable and unlikely that nucleotide sequences with essential general regulatory functions are in the subtelomeric position where are most exposed to the repression consequent to telomere shortening with dysregulation of genes that are essential for the cell. Similarly to the age-related progressive decline of cell turnover capacities and to cell senescence, there is no acceptable justification for gradual cell senescence that is compatible with non-adaptive aging theories.

4.4 Arguments and Evidence in Support or Against the Theories Pertaining to. . .

149

– On the contrary, gradual cell senescence, similarly to the age-related progressive decline of cell turnover capacities and to cell senescence, is perfectly compatible with the adaptive aging paradigm, being part of a complex machinery that progressively reduces fitness.

4.4.12 General Evaluation of the Arguments Mentioned earlier The correspondence between the hypotheses considered about aging and the various theoretical arguments or empirical data before presented is summarized in Table 4.1.

Table 4.1 Correspondence between the hypotheses considered and evidence or theoretical arguments 1) Absence of unlikely postulates 2) Non-universality of aging 3) Variation of aging rhythms in the comparison among species 4) Consideration of supra-individual natural selection and of phenoptotic phenomena 5) Effects of caloric restriction on lifespan 6) Existence of age-related increasing mortality in the wild 7) in the comparison among species, the inverse relation between extrinsic mortality and the proportion of deaths due to intrinsic mortality 8) Impossibility of explaining of age-related fitness decline as a consequence of genes that are harmful at a certain age 9) The age-related progressive decline of cell turnover capacities 10) Cell senescence program 11) Gradual cell senescence

DA N N N/  N

MA N N N

AP N N N

DS N N N

CSG N Y Y/

QPA N N N

H N Y N

RQ N N (Y)

AFE Y Y Y

N

N

N

N

N

N

(Y)

Y

–

–

–

N

–

–

–

(Y)

Y

N

N

N

N

Y

N

Y

(Y)

Y

N

N

N

N

N

N

N

(Y)

Y

–

N

–

–

–

–

–

(Y)

Y

N

N

N

N

N

N

–

(Y)

Y

N N

N N

N N

N N

N N

N N

– –

(Y) (Y)

Y Y

Abbreviations: DA Damage Accumulation hypotheses, MA Mutation Accumulation h., AP Antagonistic Pleiotropy h., DS Disposable Soma h., CSG Cessation of Somatic Growth h., QPA QuasiProgrammed Aging h., H Historical h., RQ Red Queen h., AFE Aging as an accelerating factor of evolution h N ¼ not explained or predicted by the hypothesis or in contrast with its predictions – ¼ irrelevant for accepting/rejecting the hypothesis Y ¼ predicted by the hypothesis or compatible with it

150

4 The Comparison Between the Two Paradigms

– Red Queen h. may be considered as a variant of Aging as an accelerating factor of evolution h. with the addition of an unnecessary postulate (see argument 1). Therefore, it will be considered only for arguments 1 (Absence of unlikely postulates) and 2 (Universality of aging) where there are essential differences between the two hypotheses. – All hypotheses, Aging as an accelerating factor of evolution h. excluded, require unlikely postulates. This a strong argument against their plausibility. – Most hypotheses, Cessation of Somatic Growth h., Historical h., and Aging as an accelerating factor of evolution h. excluded, do not offer a sound justification for the existence of non-aging species. – Most hypotheses, Aging as an accelerating factor of evolution h. and perhaps some Damage Accumulation hypotheses excluded, do not offer a sound justification for the variation of aging rates in the comparison among species. Cessation of Somatic Growth h. could justify some variation of the aging rate based on growth differences. – Damage Accumulation Hypotheses, Mutation Accumulation h., Antagonistic Pleiotropy h., Disposable Soma h., Quasi-Programmed Aging h., Cessation of Somatic Growth h., and Historical h. do not consider supra-individual natural selection and phenoptotic phenomena. – The effects of caloric restriction on lifespan contradict the predictions of Disposable Soma h. – The existence of age-related increasing mortality in the wild is minimized or considered too weak to influence aging by most hypotheses, Cessation of Somatic Growth h., Historical h. and Aging as an accelerating factor of evolution h. excluded. – The inverse relationship (in the comparison among species) between extrinsic mortality and proportion of deaths due to intrinsic mortality contradicts the opposite prediction of Damage Accumulation Hypotheses, Mutation Accumulation h., Antagonistic Pleiotropy h., Disposable Soma h., and Quasi-Programmed Aging h. For other two hypotheses, Cessation of Somatic Growth h. and Historical h. there is no opposite prediction but they do not appear compatible with the inverse relationship observed. Only Aging as an accelerating factor of evolution h. predicts the inverse relation mentioned above. – The impossibility of explaining the age-related fitness decline as a consequence of genes that are harmful at a certain age is a strong argument against Mutation Accumulation h. – The existence of the phenomena: (i) age-related progressive decline of cell turnover capacities; (ii) cell senescence program; and (iii) gradual cell senescence; which cause a progressive fitness decline, is against the prediction of Damage Accumulation Hypotheses, Mutation Accumulation h., Antagonistic Pleiotropy h., Disposable Soma h., Quasi-Programmed Aging h. and Cessation of Somatic Growth h. Mechanisms that cause age-related fitness decline are predicted by Aging as an accelerating factor of evolution h., and are essential for this thesis. Moreover, they are not predicted by Historical h., although being not clearly incompatible with this hypothesis.

4.5 Aging as an Accelerating Factor of Evolution Theory

151

On the whole, as general evaluation, only Aging as an accelerating factor of evolution h. appears to be a tenable theory, confirmed by evidence and not invalidated by theoretical arguments (s. Table 4.1). It will be expounded in the next Section 4.5 – Aging as an accelerating factor of evolution theory.

4.5

Aging as an Accelerating Factor of Evolution Theory

The hypothesis that aging is favored by natural selection as it accelerates generation turnover and consequently the pace of evolution has been proposed several times. Apart from the intuitions of Weissmann (Weismann 1889) and Leopold (Leopold 1961), which somehow anticipated the hypothesis, the first finished theory proposing an adaptive value of aging was formulated in the 80’s and was based on kin selection mechanism (Libertini 1983, 1988). In 2004 (Travis 2004) and 2011 (Martins 2011), the hypothesis was proposed again in different forms and using complex models. Travis wrote: “I report results from an individual-based spatial model in which a programmed age of death is allowed to evolve. In a freely mixing population with global dispersal, evolution selects for individuals with ever-increasing life span. However, in a spatially structured population with localized dispersal, a programmed age of death evolves. The exact age of death that evolves depends critically on the scale of dispersal. Within this model, individuals are genetically programmed to die, even though they are still able to reproduce. These results suggest that death can be adaptive and offer an explanation for the evolution of ‘death genes’.” (Travis 2004). Furthermore the author adds: “The result is due to the spatial population structure that arises when dispersal is localized. I suggest that the kin selection (KS) theory and the concept of inclusive fitness provide the likely mechanism, although, as discussed below, further work will be needed to verify this” (Travis 2004). It should be noted that Libertini’s previous model is not mentioned in this work and that the idea was probably developed independently. It should also be noted that the author does not appear to be aware of the radical differences between the proposed theory and the popular Mutation Accumulation h., and Antagonistic Pleiotropy h., and even considers it as a “natural expansion” of these hypotheses: “This spatial population theory for the evolution of aging should not be considered as an alternative to either Peter Medawar’s mutation accumulation theory (Medawar 1946, 1952) or George Williams’ antagonistic pleiotropy theory (Williams 1957), but rather as a natural expansion. Indeed, both of these well-established theories predict the decline in fecundity with age that is required in order for a death gene to evolve through the mechanism described in this article. Future work seeking to unify the mutation accumulation, antagonistic pleiotropy, and KS theories of aging and death is expected to prove valuable” (Travis 2004). In 2011, Martins proposed an adaptive meaning for aging, as it allowed a higher speed of adaptation, through a model based on spatially structured populations: “Here, I will propose a model for aging based on assumptions that are compatible

152

4 The Comparison Between the Two Paradigms

Fig. 4.11 From Fig. 3-B of (Travis 2004), modified and redrawn

with evolutionary theory: i) competition is between individuals; ii) there is some degree of locality, so quite often competition will be between parents and their progeny; iii) optimal conditions are not stationary, and mutation helps each species to keep competitive. When conditions change, a senescent species can drive immortal competitors to extinction. This counter-intuitive result arises from the pruning caused by the death of elder individuals.” (Martins 2011). This author cites Travis’ previous model but does not appear to know the model proposed by Libertini 23 years earlier. A few years later the model of Martins was proposed again by the same author together with Mitteldorf, and it was observed among other things that: “In 2011, one of us proposed the first quantitative model based on this mechanism that robustly evolves a finite, programmed life span. That model was based on a viscous population in a rapidly changing environment. Here, we strip this model to its essence and eliminate the assumption of environmental change. We conclude that there is no obvious way in which this model is unrealistic, and that it may indeed capture an important principle of nature’s workings. We suggest aging may be understood within the context of the emerging science of evolvability.” (Mitteldorf and Martins 2014). These last three theories, apart from the differences in the models and the conclusions, present some common traits: (i) aging is shown as an adaptive phenomenon; (ii) the models require spatially structured populations; and (iii) an inverse correlation between extrinsic mortality and the proportion of deaths due to aging is expected. This inverse relationship, already foreseen in the first theory and defined as “Methuselah effect” (Libertini 1983, 1988), had in 1998 its first confirmation in Ricklefs’ data from natural observation (Ricklefs 1998), as rightly pointed out some years later (Libertini 2006, 2008). It was also predicted in Travis’ model: “Evolution selects for earlier programmed death when the probability of death is lower” (Travis 2004) (Fig. 4.11), and in Martins’ model, as discussed in 2014 (Mitteldorf and Martins 2014) (Fig. 4.12). In the last paper, it was observed that this inverse relation is a logical deduction of any theory that proposes an adaptive meaning for aging: “We found that evolved life span varies directly with mortality m, so that senescent mortality tends to

4.6 Kin Selection Aging Theory

153

Fig. 4.12 From Fig. 3 of (Mitteldorf and Martins 2014), modified and redrawn. The heading of the original figure says “Evolved Senescence Falls as Background Death Rate Rises”, which means: Proportion of senescent deaths falls as extrinsic mortality rises

complement background mortality. Both contribute to the population turnover rate, and thus to evolvability (Fig. 3). Note that this complementary relationship between background death rate and evolved senescence is characteristic of adaptive theories of aging. A high background death rate leads to a longer evolved life span. This contrasts with classical theories, in which a high background death rate leads to a shorter evolved life span.” (Mitteldorf and Martins 2014). Both the model proposed by Travis (Travis 2004) and the one proposed by Martins (Martins 2011) with the subsequent closer examination together with Mitteldorf (Mitteldorf and Martins 2014) are quite complex, not easy to describe and require specific simulation programs. On the contrary, the first model (Libertini 1988) is easy to describe and does not require complicated simulation programs, since, even with a spreadsheet, it is possible to repeat and verify the proposed mechanisms. Consequently only the first model will be described in detail in the next Section 4.6 – Kin selection aging theory, while for the other models it is advisable to read the original works. However, Travis’ model and Martins’ model, despite the differences and the suggestions of unlikely affinities or merging with some popular non-adaptive theories, have essential characteristics in common with the first theory proposed in 1988 (Libertini 1988), as highlighted above.

4.6

Kin Selection Aging Theory

In the exposition of what is here defined as “kin selection aging theory”, the logical order of how the theory was proposed in 1988 will be followed (Libertini 1988).

154

4.6.1

4 The Comparison Between the Two Paradigms

Definitions

Disregarding the early stages of life (development and growth of the individual), which for various reasons usually have a high mortality rate, the phenomenon of an “increasing mortality with increasing chronological age in populations in the wild” is defined as “IMICAW”, or also as “aging”. However, in the following exposition, the term IMICAW will be preferred as it is purely descriptive and avoids possible misunderstandings related to the different meanings sometimes attributed to the term “aging”. IMICAW is a real phenomenon already well documented in 1988 (e.g., life tables of populations studied in the wild reported by (Deevey 1947; Beverton and Holt 1959; Laws 1966, 1968; Laws and Parker 1968; Spinage 1970, 1972)) and that was subsequently documented to a much more extensive extent (Ricklefs 1998; Nussey et al. 2013). If we exclude the early stages of life, the increment of an IMICAW population’s mortality rate is approximately described by the Gompertz-Makeham equation (see (Comfort 1979)): λt ¼ λo  eαt þ B

ð4:6Þ

where λt ¼ mortality rate at time t; λo ¼ mortality at time 0; α ¼ slope constant; B ¼ non-age-specific mortality (“extrinsic mortality”, μe) The term λo  eαt is the age-specific mortality (“intrinsic mortality”, μi), which for the sake of brevity will be referred to as “A”. When the derivative of the mortality rate exceeds an arbitrary threshold value, the time (τ*) at which this occurs will be defined as the beginning of the aging period. The other time, after the early stages of life and before τ*, when the mortality rate is at its lowest value (λmin or λ0) is defined as “τ”. Figure 4.13 illustrates these definitions. A gene that causes a shift to the left of the survival curve and τ*, is said to cause an earlier IMICAW. The species not showing the phenomenon IMICAW (e.g., the species reported in (Deevey 1947; Beverton and Holt 1959; Bourlière 1957; Comfort 1979)) are defined as “non-IMICAW”. The abbreviation “ML” indicates the “mean duration of life in the wild” of the individuals of a population. By definition, a non-IMICAW species has the ML in function only of the extrinsic mortality (B in the Gompertz-Makeham equation). In contrast, an IMICAW species has the ML in function both of intrinsic mortality (λo  eαt, or shortly A in the Gompertz-Makeham equation), and of B. A non-IMICAW species might be considered as an IMICAW species with τ* ¼ 1. The ML of a non-IMICAW species (τ* ¼ 1) is not necessarily longer than the ML of an IMICAW species (τ* < < 1). For example, the ML of the Robin (Turdus migratorius), a non-IMICAW species, is 1.01 years (Deevey 1947), while the ML of the Impala (Aepyceros melampus), an IMICAW species, is 5.8 years (Spinage, 1972).

4.6 Kin Selection Aging Theory

155

Fig. 4.13 Real life table in the wild for elephant (Loxodonta africana). (Data from (Laws 1966)) with the indication of τ and τ*

However, in two IMICAW species with equal extrinsic mortality, that species with lower intrinsic mortality, i.e., with greater τ*, has a longer ML. If a non-IMICAW species in captivity, in artificial conditions of mortality lower than that in the wild, starting from ages never or very rarely observable in nature, shows an age-related increasing mortality, this phenomenon is defined as “increasing mortality with increasing chronological age in captivity”, or shortly “IMICAC”. By definition, IMICAC is inexistent in the wild and, since natural selection, by definition, acts only under natural conditions, IMICAC is not subjected to natural selection and cannot have an adaptive value. Likewise, if an IMICAW species in artificial conditions of mortality rate lower than in the wild shows a shift to the right of the survival curve, neither the shift nor possible physiologic or morphologic alterations found in individuals survived at ages never or very rarely observable in the wild can have an adaptive value.

4.6.2

The Evolutionary Advantage of a Shorter ML

It is possible to describe evolution as the continuous spreading within a species of alleles that somehow present a selective advantage. If we consider two species with different ML, the species with smaller ML, all other things being equal, will show a higher spreading velocity of any favorable allele, and it could be hypothesized that such a species has an “advantage”. This statement is expounded in detail as follows.

156

4 The Comparison Between the Two Paradigms

Fig. 4.14 Spreading of a gene (C) according to the variation of s (while ML is constant, i.e., always equal to 1). The values of s are indicated near each curve

For a change in allele frequency, the succession of a certain number of generations is necessary. In the case of an advantageous allele, favored by natural selection, a transition from a frequency x to a frequency x’ (with x < x’) may occur faster for species with smaller ML. The same is true in the case of a disadvantageous allele for passing from a frequency y to a frequency y’ (with y > y’). As the number of generations in a period is inversely proportional to the ML, and as the ML is in function (in various proportions) of both A (namely of τ*) and B, it is easily deduced that when B is equal for both species, the species with a smaller τ*, having a quicker turnover of generations, takes advantage of a faster diffusion of favorable alleles, and a faster elimination of disadvantageous alleles than the species having a greater τ*. Figure 4.14 illustrates the variation of the spreading velocity within a species, with a constant number of individuals, of a gene C with advantage s according to the variation of the value of s, in comparison with a neutral allele C0 . The value of ML is constant for all the curves (ML ¼ 1). The formula used is: C nþ1 ¼

C n  ð1 þ sÞ C  ð1 þ sÞ ¼ n 1 þ Cn  s C n  ð1 þ sÞ þ C 0 n

ð4:7Þ

where Cn indicates the frequency of C at the nth generation, and the denominator has the function of keeping constant the sum of the frequencies: Cn + C0 n ¼ 1 (for details about this and other formulas see Appendix – Part A). In Fig. 4.15, the formula used is the same (4.7), but the abscissas indicate the time and not the generations. The advantage s has a constant value, arbitrarily chosen

4.6 Kin Selection Aging Theory

157

Fig. 4.15 Spreading of a gene according to the variation of ML (while s is constant, i.e., always equal to 0.01). The values of ML are indicated near each curve

(s ¼ 0.01), for all the five curves, while ML has the values indicated in the figure. The curves are morphologically equal to those in Fig. 4.14. By observing that values of s in the first figure follow the relation: sz ¼ 0:01=MLz

ð4:8Þ

where MLz is the value of ML of the curve with the same z index in the second figure, this shows that a smaller ML or a proportionally greater s have the same effects on the spreading velocity of a favorable gene (for the mathematical details, see the Appendix – Part B). The hypothesis that an increasing mortality with increasing chronological age might have an adaptive value as it increases the turnover of generations, was expressed clearly some years before, although only in qualitative terms and for plants (Leopold 1961).

4.6.3

Effects of IMICAW on ML

The effects of the IMICAW phenomenon, or aging, on the values of the mean duration of life (ML) are strong and well documented by studies on populations in the wild. Table 1.1 (Chapter 1 – Introduction) shows some data available as early as 1988 regarding species studied under natural conditions.

158

4 The Comparison Between the Two Paradigms

Fig. 4.16 Real life table in the wild for zebra (Equus burchelli boehmi). (Data from (Spinage 1972)) and hypothetical life table in absence of intrinsic mortality: τ ¼ 6 years; lowest mortality (λmin) at τ time ¼ 4.63%/y; ML (A) ¼ 8.48 y; HML (B) ¼ 17.23 y; ratio B/A ¼ 2.03; MLτ – τ (C) ¼ 6.73 y; HMLτ – τ (D) ¼ 21.55 y; ratio D/C ¼ 3.20

In the table, the ratio B/A between a hypothetical ML with the absence of intrinsic mortality and the ML observed in the wild ranges from 1.55 to 3.21 (average value ¼ 2.34). Excluding then the first ages of life (which have higher mortality, do not express any reproductive value and are not affected by intrinsic mortality), the ratio D/C between the hypothetical remaining ML in absence of intrinsic mortality and the remaining ML observed in the wild ranges from 2.42 to 5.09 (average value ¼ 3.67). This means that intrinsic mortality, or aging, roughly halves the ML under natural conditions (1/2.34 ¼ 0.427). Furthermore, considering the residual life of the surviving individuals at time τ, aging reduces it to less than a third (1/3.67 ¼ 0.272). In short, the IMICAW phenomenon for many species dramatically reduces the ML and is undoubtedly influenced in some way by natural selection. Figures 4.16 and 4.17 illustrate the data available in 1988 for the zebra (Equus burchelli boehmi) and for the buffalo (Syncerus caffer), respectively.

4.6.4

Evolutionary Steadiness of a Gene Causing IMICAW

The frequency of a gene is here defined as evolutionarily stable when the effects on its frequency by the onset of new mutations and by natural selection regarding advantages and disadvantages due to the gene are balanced. In previous subsections 4.6.2 and 4.6.3, for gene C, which determines a shorter ML, we have disregarded the effects of mutations and natural selection on the

4.6 Kin Selection Aging Theory

159

Fig. 4.17 Real life table in the wild for buffalo (Syncerus caffer). (Data from (Spinage 1972)) and hypothetical life table in absence of intrinsic mortality: τ ¼ 5 years; lowest mortality (λmin) at τ time ¼ 4.23%/y; ML (A) ¼ 5.50 y; HML (B) ¼ 12.16 y; ratio B/A ¼ 2.21; MLτ – τ (C) ¼ 6.80 y; HMLτ – τ (D) ¼ 23.61 y; ratio D/C ¼ 3.46

variation of its frequency within each of the two species. Under this arbitrary and unlikely condition, between two species with different ML, the one with shorter ML, other things being equal, will have a higher speed of evolution and so will be favored. However, this is an argument of group selection and does not prove at all the evolutionary stableness within a species of a gene that causes IMICAW phenomenon. In fact, for individuals with a longer ML, there is the unquestionable advantage of a longer reproductive period and thus higher reproductive capacity, and this means clearly strong natural selection against any gene causing IMICAW. A justification for the stableness of a gene causing IMICAW appears on first thought a difficult or impossible aim. While the advantage of a greater speed of evolution due to a quicker generation turnover would seem valid only in a period of many generations and for the whole population, the advantages of a more extended ML, for individuals non-IMICAW or with a later IMICAW, certainly are for the present individual. It is undisputed that natural selection is determined by present and not by future advantages. Moreover, group selection arguments would appear untenable (Maynard Smith 1964, 1976). So, in the absence of an immediate advantage for an IMICAW-causing gene, the natural selection would surely eliminate a gene that, in any way, limits the ML, and therefore IMICAW as an adaptive phenomenon should be considered as impossible. A likely answer to this question could be given by a central concept of modern evolutionary sociobiology, namely the distinction in the natural selection between the advantage for the individual and the advantage for the gene (Hamilton 1964,

160

4 The Comparison Between the Two Paradigms

Fig. 4.18 Spreading of an “unselfish” gene according to the variation of s2 and r2. Only individuals I1 and I2 are considered (i.e., n ¼ 2) and the reproductive values are disregarded (i.e., Px ¼ 1). The values of C0, s2 and r2 are indicated near each curve. For all curves, s’ (i.e., s1) ¼ 0.01

1970, 1971; Trivers 1971; Wilson 1975; Trivers and Hare 1976). In short, if the effects of a gene C are harmful to the individual I1, where C is present, but are advantageous for other individuals (I2, I3, ... In) genetically related to I1, i.e., with a fraction rx of genes identical to those of the individual I1 (and therefore a probability rx of having C), the spreading or elimination of C is subjected to two contrasting selective actions. If the sum of all these actions is positive, C is favored, though harmful for the individual I1 where the “unselfish” gene is present and acts. A general formula that describes this calculation of overall or “inclusive” fitness of a gene G, in particular, the variation of the frequency of G from a generation to the next (ΔG) might be the following: ΔG /

n X

ðsx  P x  r x Þ

ð4:9Þ

x¼1

where: sx ¼ disadvantage or advantage for the individual Ix determined by the actions of G; Px ¼ reproductive value of Ix; rx ¼ coefficient of relationship between I1 and Ix (clearly, r1 ¼ 1). It should be noted that if G does not affect other individuals (i.e., n ¼ 1) the (4.9) becomes: ΔG / s  P

ð4:10Þ

that is the Darwinian formula of individual fitness. This mechanism of “kin selection” is illustrated in Fig. 4.18, which has been obtained by the following formula:

4.6 Kin Selection Aging Theory

C nþ1

161

P C n ½ 1 þ ðr x  sx Þ  s0  P ¼ 1 þ C n  ðr x  sx Þ

ð4:11Þ

where for simplicity Px has been disregarded and: s’ ¼ disadvantage for I1; sx ¼ advantage for Ix; rx ¼ coefficient of relationship between Ix and I1; and Σ(rx  sx) is an abbreviation of: n X

ðr x  sx Þ

ð4:12Þ

x¼2

Now, if we want to apply the concept of kin selection to a gene C which somehow reduces the mean duration of life (ML), it is necessary to estimate the inclusive fitness of C. Two preliminary conditions are necessary: 1. Numerically stable population. The population must be stable, as a consequence of a limited living space, so that only when an individual dies, is place for a new one become available; 2. Preferential replacement of predeceased individuals. When an individual (I1) dies prematurely as a consequence of the effects of C, it is replaced by other individuals (I2, I3, ... In), which have, on average, a fraction r (coefficient of relationship) of genes equal to those of I1. These conditions will be discussed in the next subsection. With these conditions, we have: (i) C and the inactive allele C0 cause an ML equal to MLC and MLC’, respectively, with MLC’ ¼ 1 unity of time and MLC < MLC’. A shorter ML cause a disadvantage s’ for I1. (ii) For a gene that is spreading within the species, a reduction of ML is equivalent to a proportional increase of the advantage s caused by the gene (see the Subsection 4.6.2 – The evolutionary advantage of a shorter ML and Figs. 4.14 and 4.15). So, for individuals with C0 , as MLC’ ¼ 1: sC0 ¼ s=MLC’ ¼ s

ð4:13Þ

while for individuals with C, being MLC < MLC’: sC ¼ s=MLC > s

ð4:14Þ

If we consider m genes that are spreading within the species (to simplify the calculation, let us hypothesize that for any of these genes sx ¼ s), the overall advantage (SC0 ) for the individuals with the genes C will be:

162

4 The Comparison Between the Two Paradigms

Fig. 4.19 Spreading of a gene causing IMICAW if the dead individual (I1) is substituted by a kin individual, i.e., with r > 0. The value of r for each curve is indicated in the figure. For all curves: SC ¼ 0.1, s0 ¼ 0.001, MLC ¼ 0.7; C0 ¼ 0.1

S C’ ¼

m X

½r  sx  ð1=MLC’ Þ ¼ r  m  s

ð4:15Þ

x¼1

while for the individuals with the gene C, it will be: SC ¼

m X

½r  sx =MLC  ¼ r  m  s=MLC > SC’

ð4:15Þ

x¼1

Therefore, C will be favored by kin selection and will spread within the species if: SC  SC0 ¼ r  m  s  ð1=MLC  1Þ > s0

ð4:16Þ

The spreading, or decay, within a population of a gene C causing a reduced ML, may now be expressed by the recursion formula: Cnþ1 ¼

Cn  ½1 þ SC  s0  1 þ Cn  ½SC  s0 

ð4:17Þ

Figure 4.19 has been obtained from this formula. In the simulations, it has been hypothesized SC » s0 , since SC sums up the advantages of the m genes that are spreading within the species (in the original work: “S » S0 , since S sums up the advantages of the m genes that are spreading within the species” (Libertini 1988)). In short, according to this theory, a gene C would be a particular unselfish gene favored

4.6 Kin Selection Aging Theory

163

by a sort of “hitchhiking” mechanism (Hill and Robertson 1966; Felsenstein 1974) (“hitchhiking effect” (Strobeck et al. 1976)). The fact that SC sums up the advantages of many genes was disregarded in a paper that criticized this model and so wrongly considered it as unlikely: “The equation depends on the selection advantage, S, of the beneficial gene on which C hitchhikes, ... If more realistic values are used, the aging gene C disappears” (Kowald and Kirkwood 2016).

4.6.5

The Preliminary Conditions

The model proposed in the previous subsection for the advantage of IMICAW phenomenon is restrained by two preliminary conditions. 1) Numerically stable population. According to Pianka’s classification (Pianka 1970), there are two main types of populations, K-selected and r-selected. The condition of a numerically stable population is, in general, true with the K-selected population (Leopold 1961). On the contrary, for r-selected species, this condition is unrealistic, and the limits of livingspace for new individuals are of secondary importance with respect to reproductive capacity, which is the crucial factor in evolutionary success for such species. 2) Preferential replacement of predeceased individuals. This is possible for species divided into small populations (demes) with a limited interdemic genetic flow. It is likely that among the individuals of a deme, the coefficient of relationship (r) is higher than the mean r of the whole population, and that a dead individual frees living-space for related individuals of the same deme. This second condition is verified with territorial species, sessile animals, and plants because, for these populations, it is probable that a dead individual is substituted more frequently by genetically related individuals. This second condition, as the other, is likely for K-selected species. These conditions are essential for the model, and so the species that may present the IMICAW phenomenon should be K-selected, divided into small demes, territorial or non-mobile. On the contrary, for r-selected species IMICAW is unlikely. “I believe that such previsions are in accordance with the data of natural observation. That is, only for K-selected species we will have survival curves of type I [characteristic of aging species] (see (Pianka 1970)). Moreover a certain parallelism has to be observed between IMICAW and unselfish and social behaviors ((Wilson 1975), in particular Pianka’s table as modified in chapter IV). This parallelism is not casual since in our theory a gene causing IMICAW is a kind of unselfish gene.” (Libertini 1988). However, for IMICAW species, there are surely some factors that cause a more precocious or a later IMICAW. In fact, individuals with a longer ML have: (i) a lesser incidence on the total length of life of the more vulnerable life period, i.e., the

164

4 The Comparison Between the Two Paradigms

early stages of life (development and growth); (ii) a better development and exploitation of learning abilities. For (i) and (ii), both in the case of an adaptive and of a non-adaptive meaning of IMICAW, such advantages should cause a positive correlation between body mass and ML (Bourlière 1957, 1960; Sacher 1959), as well as between brain weight in mammals (likely related to the ability of learning) and ML (Sacher 1959; Comfort 1979).

4.6.6

Two Possible Objections

There are two possible immediate objections about the hypothesis that aging is determined by a kind of unselfish genes favored by kin selection in K-selected species,. – The first is that, in a deme, for the first individual (or individuals) with an IMICAWcausing C gene, there are not enough copies of C in kin individuals that could enjoy an advantage by its action. However, the same problem exists for the origin of any “unselfish” gene and the helpful answer appears to be the same proposed for unselfish genes, i.e., random and non-selective mechanisms are essential up to a critical frequency (Boorman and Levitt 1973). As a random increase of the frequency of a C gene is plausible in a small population but improbable in a large one, the division of a species in small demes, namely its territoriality, is a necessary condition for the spreading of a C gene in its early phases. – The second objection is that the individuals of many IMICAW species (e.g., cetaceans, peregrine birds, many species of herbivorous, etc.) emigrate each year from an area to another distant zone, and afterward come back to the first area. In the phase of the migration and at least in one of the two zones where they live, there is no territoriality, i.e., conditions that might favor an IMICAW-causing gene are not present. However, in particular periods, e.g., during mating and reproduction, the individuals of migrating species can live in well-defined areas, which are distinct and constant for each group and, therefore, with characters of territoriality. If the habitat is saturated in this phase of territoriality, then in these periods there are conditions of K-selection that may favor the spreading and the stableness of IMICAW-causing genes.

4.6.7

The Methuselah Effect

The phenomenon of an inverse relation between extrinsic mortality and proportion of deaths due to intrinsic mortality in the comparison among species, shortly defined as “Methuselah effect”, has been already discussed in the Subsection 4.4.7 – In the comparison among species, the inverse relation between extrinsic mortality and the proportion of deaths due to intrinsic mortality, and here only some information about its first suggestions will be added.

4.6 Kin Selection Aging Theory

165

This paradoxical phenomenon was proposed in 1988 in the first peer-reviewed paper where an adaptive meaning for aging was hypothesized (Libertini 1988): “6. The ‘Methuselah Effect’ ... Since the ML is determined by the value of both A and B (the age-specific and the nonage-specific mortality, respectively), if B is large, the ML will be small, the term S0 [s’ in this text] will also be large, and consequently the gene C will not be advantaged in the spreading. The paradoxical result is that the species with a high value of B, where B is inaccurately called ‘environmental mortality’ should be non-IMICAW (‘Methuselah effect’). Comfort (Comfort 1979, p. 92) states: «. . . populations of many species of fish, studied in the wild, show an age structure and a pattern of death similar to that found in birds, i.e., a high constant mortality unrelated to age and a virtually constant expectation of life . . .» As examples of non-IMICAW species with a high value of B we cite: Callionymus lyra, Leuresthes tenuis, Leucichthys kiyi, Cottus gobio, Clupea sprattus, Clupea pallasi (Beverton and Holt 1959), the blackbird, the song thrush, the robin, the starling and the lapwing (Deevey 1947). ... 9. Discussion ... An alternative explanation for ‘aging’ is the ‘disposable soma’ theory (Kirkwood 1977, 1981; Kirkwood and Holliday 1979). With the same observations expressed for Medawar et al.’s theory, according to this hypothesis (Kirkwood and Cremer 1982): «. . . a species subject to high environmental mortality will do better not to invest too heavily in each individual soma, which will therefore age relatively soon . . . », that is, in our interpretation, the same prevision of Williams. We think that this common prevision is not sufficiently strengthened by natural observations, while the ‘Methuselah effect’ has clear, though incomplete, confirmations.”

However, the Methuselah effect, together with the hypothesis of aging as an adaptive phenomenon, was proposed for the first time 5 years before, in 1983, in a non-peer-reviewed book (Libertini 1983): “The Methuselah effect A name that smacks of legend might be of considerable help in remembering a particular phenomenon. The somewhat longer, more technical name, might read: ‘the evolutionary effect of longevity increase caused by mortality increase deriving from causes damaging at any age’. From a theoretical point of view, it is demonstrable that mortality due to the aforementioned causes concurs in the determination of longevity in a species.  A certain degree of variability of the ecological niche of a species requires an adequate velocity of evolution of the species. The velocity of evolution has been said to be inversely proportional to the ML of a species. I wish to stress that the ML is, in turn, dependent on: 1) how fast the senile age arrives; 2) the mortality rates by causes damaging at any age. In other words, both (1) and (2) contribute to limiting the ML with the advantage discussed in the preceding paragraphs of a proportionally greater spreading velocity of the genes. Now, let us consider a species where (2) is acquiring greater importance in ML limitation: in such a case (1), namely senescence, should come later and later if ML is to remain constant. That is, the velocity of evolution is, to an ever greater extent, an effect of the increased mortality by causes damaging at any age rather than a consequence of limited longevity. This would be an adequate explanation of the rather high longevity observed for

166

4 The Comparison Between the Two Paradigms

Fig. 4.20 Graphic illustration of the Methuselah effect. 1) Life table of an aging species. There is an initial period AB with high mortality, followed by a segment BC with almost constant mortality determined by the ecological conditions (extrinsic mortality), and then a segment CD with mortality that is high and increasing because of senescence. For the life table there is an optimal value (z) of ML that represents the best balance between the advantages (higher evolution speed) and the disadvantages (s’) caused by a shorter ML; 2) In this second life table, other conditions being equal, there is greater extrinsic mortality (inclination of the segment BC). Such a level of mortality would cause a reduction of z if not compensated by the displacement of point C toward the right, i.e., delayed aging; 3) A substantial increase of the extrinsic mortality determines an unlimited shift to the right of point C, i.e., unlimited longevity

many small animals, which live in conditions of high environmental mortality. Many birds of small size in captivity survive for even 15–20 years, while in the original ecological niche, the ML is much lower because very few reach the age of ‘natural’ death. The study of a significant number of amphibians, fishes, invertebrates, etc. gives analogous data (Comfort 1979). It seems almost excessive to stress that the Methuselah effect if it really exists, will be observable only over a sufficient number of generations; it is by no means to be understood that a variation of the mortality by causes independent of senescence significantly modifies the longevity in the space of one or few generations. For a better expression of the Methuselah effect, see figures II 5-1 and II 5-2 [Figs. 4.20 and 4.21 in this text].”

Explanation of Fig. II 5-2 [here Fig. 4.21]:

4.6 Kin Selection Aging Theory

167

Fig. 4.21 Methuselah effect (theoretical model). In the figure, four theoretical life tables are shown. The value of the ML is equal to 20 units of time. The values for K are near each curve. Kl is obtained from the formula II-36 and is equal to: 0.0487705755

“In the model, the mortality rate (K) for each curve is constant from birth until an instant L, when all surviving individuals die at the same time. L is the ideal equivalent of longevity, and the definition is such that it will be easy to deal with mathematically. The curves are given by the formula: Y t ¼ Y o ð1  K Þt

ðII-33Þ

with: 0  t  L. Yt indicates the fraction of the survivors at time t. From instant L, each curve goes down, parallel to the ordinates, until it meets the abscissas. Let us calculate the ML: ML ¼

0

L

R

Y o ð1  K Þt dt L ¼0 Y0

Z ð1  K Þt dt

  L ð1  K ÞL  1 ¼ ð1=Loge ð1  K ÞÞ ð1  K Þt 0 ¼ Loge ð1  K Þ

ðII-34Þ

Note that if L!1, as K < 1, then it follows that (1K)L!0 and we have the equation: ML ¼ 

1 Loge ð1  K Þ

ðII-35Þ

from which we have: K 1 ¼ 1  e1=ML

ðII-36Þ

where Kl indicates the limit value of K beyond which the equation has no meaning. If we want ML to remain constant, despite of a variation in K, then L must also vary. So, if,

168

4 The Comparison Between the Two Paradigms

ML ¼

ð1  K ÞL  1 ð1  K0ÞL0  1 ¼ Loge ð1  K Þ Loge ð1  K 0 Þ

ðII-37Þ

by solving with regard to L (or, is the same, concerning L0 ), we obtain: ML Loge ð1  K Þ þ 1 ¼ ð1  K ÞL Loga ðML Loge ð1  K Þ þ 1Þ L¼ Loga ð1  K Þ

ðII-38Þ

where is any base. This equation, to the extent that it is possible to verify, is, moreover, meaningless for values of K > Kl. The equations show that, with the condition that ML is constant, an increase in L corresponds to an increase in K. This is so until the value of K ¼ Kl, at which point L reaches its maximal value (¼ 1) and cannot increase further.” (Libertini 1983, pp. 42–6).

4.6.8

IMICAW, IMICAC, and t-genes

In the Subsection 4.4.8 – Impossibility of explaining age-related fitness decline as a consequence of genes that are harmful at a certain age, it has been shown that IMICAW cannot be explained by the effect of t-genes, i.e., genes that are harmful only at a certain age. This argument proves that Mutation Accumulation h. cannot be a tenable justification for the IMICAW phenomenon. Now, it may be interesting to investigate what happens for a non-IMICAW species in artificial conditions of lower mortality rate, i.e., λ0 instead of λ, the mortality rate in the wild (wuth λ0 < λ). The equilibrium frequency of the phenotypic expression of a gene C (Ce) is given by the Eq. (4.3): Pe ’ v/([s] Yt) However, an equilibrium frequency may be reached only after the selection has operated for many generations. If the mortality suddenly changes, as in protected artificial conditions, in formula (4.3) Yt represents the survivors in the wild at time t and not the survivors in the new conditions of lower mortality to which the species is not adapted. This difference significantly changes the effects of t-genes. Figure 4.22 shows the same curves as Fig. 4.9, plus the original curve in conditions of lower mortality (λ0 ¼ 0.03) without and with the effects of t-genes. This might be a theoretical ground for the explanation of the hypothesized phenomenon IMICAC. The distinction between IMICAW, a phenomenon that has been hypothesized as adaptive, and IMICAC, a phenomenon that cannot be adaptive, is important. In fact, if we place individuals of a non-IMICAW species under artificial conditions of low mortality and observe an age-related mortality increase, i.e., IMICAC phenomenon, it is entirely irrational and improper to draw inferences from the IMICAC phenomenon and apply it to the IMICAW phenomenon that is observable in other species.

References

169

Fig. 4.22 Effects of t-genes on the life table of a non-IMICAW species in captivity and with a lower mortality (λ ¼ 0.07; λ’ ¼ 0.03; m ¼ 1000; v ¼ 0.000001)

References Adler, M. I., & Bonduriansky, R. (2014). Why do the well-fed appear to die young?: A new evolutionary hypothesis for the effect of dietary restriction on lifespan. BioEssays, 36(5), 439–450. https://doi.org/10.1002/bies.201300165. Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., Roberts, K., & Walter, P. (Eds.). (2014). Essential cell biology (4th ed.). New York: Garland Science. Albright, R., Bland, C., Gillette, P., Serafy, J. E., Langdon, C., & Capo, T. R. (2012). Juvenile growth of the tropical sea urchin Lytechinus variegatus exposed to near-future ocean acidification scenarios. Journal of Experimental Marine Biology and Ecology, 426–427, 12–17. https:// doi.org/10.1016/j.jembe.2012.05.017. Al-Regaiey, K. A. (2016). The effects of calorie restriction on aging: A brief review. European Review for Medical and Pharmacological Sciences, 20(11), 2468–2473. Amir, Y., Insler, M., Giller, A., Gutman, D., & Atzmon, G. (2020). Senescence and longevity of sea urchins. Genes (Basel), 11(5), 573. https://doi.org/10.3390/genes11050573. Anversa, P., Kajstura, J., Leri, A., & Bolli, R. (2006). Life and death of cardiac stem cells. Circulation, 113(11), 1451–1463. https://doi.org/10.1161/CIRCULATIONAHA.105.595181. Austad, S. N. (2001). Does caloric restriction in the laboratory simply prevent overfeeding and return house mice to their natural level of food intake? Science of Aging Knowledge Environment, 2001(6), pe3. https://doi.org/10.1126/sageke.2001.6.pe3. Baker, D. J., Childs, B. G., Durik, M., Wijers, M. E., Sieben, C. J., Zhong, J., Saltness, R. A., Jeganathan, K. B., Verzosa, G. C., Pezeshki, A., Khazaie, K., Miller, J. D., & van Deursen, J. M. (2016). Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature, 530 (7589), 184–189. https://doi.org/10.1038/nature16932. Balaban, R. S., Nemoto, S., & Finkel, T. (2005). Mitochondria, oxidants, and aging. Cell, 120(4), 483–495. https://doi.org/10.1016/j.cell.2005.02.001. Bell, G. (1982). The masterpiece of nature. The evolution and genetics of sexuality. London: Croom Helm.

170

4 The Comparison Between the Two Paradigms

Bell, G., & Maynard Smith, J. (1987). Short-term selection for recombination among mutually antagonistic species. Nature, 328, 66–68. https://doi.org/10.1038/328066a0. Ben-Porath, I., & Weinberg, R. (2005). The signals and pathways activating cellular senescence. The International Journal of Biochemistry & Cell Biology, 37(5), 961–976. https://doi.org/10. 1016/j.biocel.2004.10.013. Beverton, R. J. H., & Holt, S. J. (1959). A review of the lifespans and mortality rates of fish in nature, and their relation to growth and other physiological characteristics. In W. GEW & M. O’Connor (Eds.), CIBA Foundation colloquia on ageing (Vol. 5, pp. 142–174). London: Churchill. Bidder, G. P. (1932). Senescence. British Medical Journal, 2(3742), 583–585. https://doi.org/10. 1136/bmj.2.3742.583. Blackburn, E. H. (2000). Telomere states and cell fates. Nature, 408(6808), 53–56. https://doi.org/ 10.1038/35040500. Blackburn, E. H., & Gall, J. G. (1978). A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena. Journal of Molecular Biology, 120 (1), 33–53. https://doi.org/10.1016/0022-2836(78)90294-2. Blagosklonny, M. V. (2006). Aging and immortality: Quasi-programmed senescence and its pharmacologic inhibition. Cell Cycle, 5(18), 2087–2102. https://doi.org/10.4161/cc.5.18.3288. Blagosklonny, M. V. (2013). MTOR-driven quasi-programmed aging as a disposable soma theory: Blind watchmaker vs. intelligent designer. Cell Cycle, 12(12), 1842–1847. https://doi.org/10. 4161/cc.25062. Bodnar, A. G. (2015). Cellular and molecular mechanisms of negligible senescence: Insight from the sea urchin. Invertebrate Reproduction & Development, 59(Suppl), 23–27. https://doi.org/10. 1080/07924259.2014.938195. Bodnar, A. G., & Coffman, J. A. (2016). Maintenance of somatic tissue regeneration with age in short- and long-lived species of sea urchins. Aging Cell, 15(4), 778–787. https://doi.org/10. 1111/acel.12487. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B., Harley, C. B., Shay, J. W., Lichtsteiner, S., & Wright, W. E. (1998). Extension of life-span by introduction of telomerase into Normal human cells. Science, 279(5349), 349–352. https://doi.org/10.1126/ science.279.5349.349. Bohr, V. A., & Anson, R. M. (1995). DNA damage, mutation and fine structure DNA repair in aging. Mutation Research, 338(1–6), 25–34. https://doi.org/10.1016/0921-8734(95)00008-t. Boorman, S. A., & Levitt, P. R. (1973). A frequency-dependent natural selection model for the evolution of social cooperation networks. Proceedings of the National Academy of Sciences of the United States of America, 70(1), 187–189. https://doi.org/10.1073/pnas.70.1.187. Bourlière, F. (1957). The comparative biology of ageing: A physiological approach. In G. E. W. Wolstenholme & M. O’Connor (Eds.), Methodology of the study of ageing (CIBA foundation colloquia on ageing) (Vol. 3, pp. 20–38). Boston: Little, Brown and Co.. Bourlière, F. (1960). Species differences in potential longevity of vertebrates and their physiological implications. In B. Strehler (Ed.), The biology of aging (pp. 128–131). Washington, DC: American Institute of Biological Sciences. Bredesen, D. E. (2004). The non-existent aging program: How does it work? Aging Cell, 3(5), 255–259. https://doi.org/10.1111/j.1474-9728.2004.00121.x. Brent, L. J. N., Franks, D. W., Foster, E. A., Balcomb, K. C., Cant, M. A., & Croft, D. P. (2015). Ecological knowledge, leadership, and the evolution of menopause in killer whales. Current Biology, 25(6), 746–750. https://doi.org/10.1016/j.cub.2015.01.037. Brockhurst, M. A., Chapman, T., King, K. C., Mank, J. E., Paterson, S., & Hurst, G. D. (2014). Running with the red queen: The role of biotic conflicts in evolution. Proceedings of the Royal Society B: Biological Sciences, 281(1797), pii:20141382. https://doi.org/10.1098/rspb.2014. 1382. Brody, S. (1924). The kinetics of senescence. The Journal of General Physiology, 6, 245–257.

References

171

Campisi, J. (1997). The biology of replicative senescence. European Journal of Cancer, 33(5), 703–709. https://doi.org/10.1016/S0959-8049(96)00058-5. Campisi, J. (2003). Cancer and ageing: Rival demons? Nature Reviews Cancer, 3(5), 339–349. https://doi.org/10.1038/nrc1073. Campisi, J., & d’Adda di Fagagna, F. (2007). Cellular senescence: When bad things happen to good cells. Nature Reviews of Molecular Cell Biology, 8(9), 729–740. https://doi.org/10.1038/ nrm2233. Carrel, A., & Ebeling, A. H. (1921). Antagonistic growth principles of serum and their relation to old age. The Journal of Experimental Medicine, 38(4), 419–425. https://doi.org/10.1084/jem. 38.4.419. Carroll, L. (1871). Through the Looking-Glass, 1871. Charlesworth, B. (1976). Recombination modification in a fluctuating environment. Genetics, 83 (1), 181–195. Charlesworth, B. (1990). Optimization models, quantitative genetics, and mutation. Evolution, 44 (3), 520–538. https://doi.org/10.1111/j.1558-5646.1990.tb05936.x. Comfort, A. (1979). The biology of senescence. London: Livingstone. Coppé, J.-P., Patil, C. K., Rodier, F., Sun, Y., Muñoz, D. P., Goldstein, J., Nelson, P. S., Desprez, P. Y., & Campisi, J. (2008). Senescence-associated secretory phenotypes reveal cellnonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biology, 6 (12), 2853–2868. https://doi.org/10.1371/journal.pbio.0060301. Counter, C. M., Hahn, W. C., Wei, W., Caddle, S. D., Beijersbergen, R. L., Lansdorp, P. M., Sedivy, J. M., & Weinberg, R. A. (1998). Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proceedings of the National Academy of Sciences of the United States of America, 95(25), 14723–14728. https://doi.org/10.1073/pnas. 95.25.14723. Croteau, D. L., & Bohr, V. A. (1997). Repair of oxidative damage to nuclear and mitochondrial DNA in mammalian cells. The Journal of Biological Chemistry, 272(41), 25409–25412. https:// doi.org/10.1074/jbc.272.41.25409. De Magalhães, J. P., & Toussaint, O. (2002). The evolution of mammalian aging. Experimental Gerontology, 37(6), 769–775. https://doi.org/10.1016/s0531-5565(02)00008-6. Deevey, E. S., Jr. (1947). Life tables for natural populations of animals. The Quarterly Review of Biology, 22(4), 283–314. www.journals.uchicago.edu/doi/abs/10.1086/395888? journalCode¼qrb. Ebert, T. A., & Southon, J. R. (2003). Red Sea urchins (Strongylocentrotus franciscanus) can live over 100 years: Confirmation with A-bomb 14carbon. Fishery Bulletin, 101(4), 915–922. Edney, E. B., & Gill, R. W. (1968). Evolution of senescence and specific longevity. Nature, 220 (5164), 281–282. https://doi.org/10.1038/220281a0. Estienne, V., Robira, B., Mundry, R., Deschner, T., & Boesch, C. (2019). Acquisition of a complex extractive technique by the immature chimpanzees of Loango National Park, Gabon. Animal Behaviour, 147, 61–76. https://doi.org/10.1016/j.anbehav.2018.11.002. Felsenstein, J. (1974). The evolutionary advantage of recombination. Genetics, 78(2), 737–756. Finch, C. E. (1990). Longevity, senescence, and the genome. Chicago: University of Chicago Press. Finch, C. E., & Austad, S. N. (2001). History and prospects: Symposium on organisms with slow aging. Experimental Gerontology, 36(4–6), 593–597. https://doi.org/10.1016/s0531-5565(00) 00228-x. Fossel, M. B. (2004). Cells, aging and human disease. New York: Oxford University Press. Foster, E. A., Franks, D. W., Mazzi, S., Darden, S. K., Balcomb, K. C., Ford, J. K. B., & Croft, D. P. (2012). Adaptive prolonged postreproductive life span in killer whales. Science, 337(6100), 1313. https://doi.org/10.1126/science.1224198. Gaitán-Espitia, J. D., & Hofmann, G. E. (2017). Gene expression profiling during the embryo-tolarva transition in the giant red sea urchin Mesocentrotus franciscanus. Ecology and Evolution, 7(8), 2798–2811. https://doi.org/10.1002/ece3.2850.

172

4 The Comparison Between the Two Paradigms

Glesener, R. R. (1979). Recombination in a simulated predator-prey interaction. American Zoologist, 19(3), 763–771. https://doi.org/10.1093/icb/19.3.763. Glesener, R. R., & Tilman, D. (1978). Sexuality and the components of environmental uncertainty: Clues from geographic parthenogenesis in terrestrial animals. The American Naturalist, 112 (986), 659–673. Goldsmith, T. C. (2004). Aging as an evolved characteristic – Weismann’s theory reconsidered. Medical Hypotheses, 62(2), 304–308. https://doi.org/10.1016/S0306-9877(03)00337-2. Goldsmith, T. C. (2008). Aging, evolvability, and the individual benefit requirement; medical implications of aging theory controversies. Journal of Theoretical Biology, 252(4), 764–768. https://doi.org/10.1016/j.jtbi.2008.02.035. Gottschling, D. E., Aparicio, O. M., Billington, B. L., & Zakian, V. A. (1990). Position effect at S. cerevisiae telomeres: Reversible repression of Pol II transcription. Cell, 63(4), 751–762. https://doi.org/10.1016/0092-8674(90)90141-z. Greider, C. W., & Blackburn, E. H. (1985). Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell, 43(2 Pt 1), 405–413. https://doi.org/10.1016/0092-8674 (85)90170-9. Hamilton, W. D. (1964). The genetical evolution of social behaviour. II. Journal of Theoretical Biology, 7(1), 1–52. https://doi.org/10.1016/0022-5193(64)90039-6. Hamilton, W. D. (1966). The moulding of senescence by natural selection. Journal of Theoretical Biology, 12(1), 12–45. https://doi.org/10.1016/0022-5193(66)90184-6. Hamilton, W. D. (1970). Selfish and spiteful behaviour in an evolutionary model. Nature, 228 (5277), 1218–1220. https://doi.org/10.1038/2281218a0. Hamilton, W. D. (1971). Selection of selfish and altruistic behavior in some extreme models. In J. F. Eisenberg & W. Dillon (Eds.), Man and beast: Comparative social behavior (pp. 57–91). Washington, DC: Smithsonian Institution Press. Hamilton, W. D. (1975). Gamblers since life began: Barnacles, aphids, elms. The Quarterly Review of Biology, 50, 175–180. www.journals.uchicago.edu/doi/abs/10.1086/409043? journalCode¼qrb. Harman, D. (1956). Aging: A theory based on free radical and radiation chemistry. Journal of Gerontology, 11(3), 298–300. https://doi.org/10.1093/geronj/11.3.298. Harman, D. (1972). The biologic clock: The mitochondria? Journal of the American Geriatrics Society, 20(4), 145–147. https://doi.org/10.1111/j.1532-5415.1972.tb00787.x. Hayflick, L. (1965). The limited in vitro lifetime of human diploid cell strains. Experimental Cell Research, 37, 614–636. https://doi.org/10.1016/0014-4827(65)90211-9. Hayflick, L., & Moorhead, P. S. (1961). The serial cultivation of human diploid cell strains. Experimental Cell Research, 25, 585–621. https://doi.org/10.1016/0014-4827(61)90192-6. Hill, K., & Hurtado, A. M. (1996). Ache life history. New York: Aldine De Gruyter. Hill, W. G., & Robertson, A. (1966). The effect of linkage on limits to artificial selection. Genetical Research, 8(3), 269–294. Horner, V., & de Waal, F. B. M. (2009). Controlled studies of chimpanzee cultural transmission. Progress in Brain Research, 178, 3–15. https://doi.org/10.1016/S0079-6123(09)17801-9. Jones, O. R., Gaillard, J. M., Tuljapurkar, S., Alho, J. S., Armitage, K. B., Becker, P. H., Bize, P., Brommer, J., Charmantier, A., Charpentier, M., Clutton-Brock, T., Dobson, F. S., et al. (2008). Senescence rates are determined by ranking on the fast-slow life-history continuum. Ecology Letters, 11(7), 664–673. https://doi.org/10.1111/j.1461-0248.2008.01187.x. Kato, S., & Schroeter, S. (1985). Biology of the Red Sea Urchin, Strongylocentrotus franciscanus, and its fishery in California. Marine Fisheries Review, 47(3). Kendal, R., Hopper, L. M., Whiten, A., Brosnan, S. F., Lambeth, S. P., Schapiro, S. J., & Hoppitt, W. (2015). Chimpanzees copy dominant and knowledgeable individuals: Implications for cultural diversity. Evolution and Human Behavior, 36(1), 65–72. https://doi.org/10.1016/j. evolhumbehav.2014.09.002.

References

173

Kerr, J. F., Wyllie, A. H., & Currie, A. R. (1972). Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. British Journal of Cancer, 26(4), 239–257. https:// doi.org/10.1038/bjc.1972.33. Kirkwood, T. B. (1977). Evolution of ageing. Nature, 270(5635), 301–304. https://doi.org/10.1038/ 270301a0. Kirkwood, T. B. (1981). Repair and its evolution: Survival versus reproduction. In C. R. Townsend & P. Calow (Eds.), Physiological ecology: An evolutionary approach to resource use (pp. 165–189). Oxford: Blackwell Scientific Publications. Kirkwood, T. B. (2005). Understanding the odd science of aging. Cell, 120(4), 437–447. https://doi. org/10.1016/j.cell.2005.01.027. Kirkwood, T. B., & Austad, S. N. (2000). Why do we age? Nature, 408(6809), 233–238. https://doi. org/10.1038/35041682. Kirkwood, T. B., & Cremer, T. (1982). Cytogerontology since 1881: A reappraisal of august Weissmann and a review of modern progress. Human Genetics, 60(2), 101–121. https://doi. org/10.1007/bf00569695. Kirkwood, T. B., & Holliday, R. (1979). The evolution of ageing and longevity. Proceedings of the Royal Society of London – Series B: Biological Sciences, 205(1161), 531–546. https://doi.org/ 10.1098/rspb.1979.0083. Kirkwood, T. B., & Melov, S. (2011). On the programmed/non-programmed nature of ageing within the life history. Current Biology, 21(18), R701–R707. https://doi.org/10.1016/j.cub. 2011.07.020. Kirkwood, T. B., Kapahi, P., & Shanley, D. P. (2000). Evolution, stress, and longevity. Journal of Anatomy, 197(Pt 4), 587–590. https://doi.org/10.1046/j.1469-7580.2000.19740587.x. Klapper, W., Heidorn, H., Kühne, K., Parwaresch, R., & Krupp, G. (1998). Telomerase in ʽimmortal fish’. FEBS Letters, 434(3), 409–412. https://doi.org/10.1016/s0014-5793(98) 01020-5. Klapper, W., Kühne, K., Singh, K. K., Heidorn, K., Parwaresch, R., & Krupp, G. (1998). Longevity of lobsters is linked to ubiquitous telomerase expression. FEBS Letters, 439(1–2), 143–146. https://doi.org/10.1016/s0014-5793(98)01357-x. Kouyos, R. D., Salathé, M., & Bonhoeffer, S. (2007). The Red Queen and the persistence of linkage-disequilibrium oscillations in finite and infinite populations. BMC Evolutionary Biology, 7, 211. https://doi.org/10.1186/1471-2148-7-211. Kowald, A., & Kirkwood, T. B. (2016). Can aging be programmed? A critical literature review. Aging Cell, 15(6), 986–998. https://doi.org/10.1111/acel.12510. Kuhn, T. S. (1962). The structure of scientific revolutions. Chicago: The University of Chicago Press. Lack, D. (1954). The natural regulation of animal numbers. Oxford: Clarendon Press. Lansing, A. I. (1948). Evidence for aging as a consequence of growth cessation. Proceedings of the National Academy of Sciences of the United States of America, 34, 304–310. https://doi.org/10. 1073/pnas.34.6.304. Lansing, A. I. (1951). Some physiological aspects of ageing. Physiological Reviews, 31(3), 274–284. https://doi.org/10.1152/physrev.1951.31.3.274. Laws, R. M. (1966). Age criteria for the African elephant, Loxodonta a. africana. African Journal of Wildlife Research, 4(1), 1–37. https://doi.org/10.1111/j.1365-2028.1966.tb00878.x. Laws, R. M. (1968). Dentition and ageing of the hippopotamus. African Journal of Wildlife Research, 6(1), 19–52. https://doi.org/10.1111/j.1365-2028.1968.tb00899.x. Laws, R. M., & Parker, I. S. C. (1968). Recent studies on elephant populations in East Africa. Symposia of the Zoological Society of London, 21, 319–359. Lee, S. H., & Min, K. J. (2013). Caloric restriction and its mimetics. BMB Reports, 46(4), 181–187. https://doi.org/10.5483/bmbrep.2013.46.4.033. Leopold, A. C. (1961). Senescence in plant development. Science, 134(3492), 1727–1732. https:// doi.org/10.1126/science.134.3492.1727.

174

4 The Comparison Between the Two Paradigms

Lesur, I., & Campbell, J. L. (2004). The transcriptome of prematurely aging yeast cells is similar to that of telomerase-deficient cells. MBC Online, 15(3), 1297–1312. https://doi.org/10.1091/mbc. e03-10-0742. Levin, D. A. (1975). Pest pressure and recombination systems in plants. The American Naturalist, 109, 437–451. www.journals.uchicago.edu/doi/abs/10.1086/283012. Libertini, G. (1983). Ragionamenti evoluzionistici [Book in Italian]. Naples: Società Editrice Napoletana. English edition (2011): Evolutionary arguments on aging, disease, and other topics. Azinet Press, Crownsville (MD). Libertini, G. (1988). An adaptive theory of the increasing mortality with increasing chronological age in populations in the wild. Journal of Theoretical Biology, 132(2), 145–162. https://doi.org/ 10.1016/s0022-5193(88)80153-x. Libertini, G. (2006). Evolutionary explanations of the “actuarial senescence in the wild” and of the “state of senility”. ScientificWorldJournal, 6, 1086–1108. https://doi.org/10.1100/tsw.2006. 209. Libertini, G. (2008). Empirical evidence for various evolutionary hypotheses on species demonstrating increasing mortality with increasing chronological age in the wild. ScientificWorldJournal, 8, 183–193. https://doi.org/10.1100/tsw.2008.36. Libertini, G. (2009a). The role of telomere-telomerase system in age-related fitness decline, a tameable process. In L. Mancini (Ed.), Telomeres: Function, shortening and lengthening (pp. 77–132). New York: Nova Science Publ. Libertini, G. (2009b). Prospects of a longer life span beyond the beneficial effects of a healthy lifestyle. In J. V. Bentely & M. A. Keller (Eds.), Handbook on longevity: Genetics, diet and disease (pp. 35–95). New York: Nova Science Publ. Libertini, G. (2012). Classification of Phenoptotic phenomena. Biochem (Mosc), 77(7), 707–715. https://doi.org/10.1134/S0006297912070024. Libertini, G. (2013). Evidence for aging theories from the study of a hunter-gatherer people (Ache of Paraguay). Biochemistry (Mosc), 78(9), 1023–1032. https://doi.org/10.1134/ S0006297913090083. Libertini, G. (2014a). The concept of phenoptosis and its usefulness for controlling aging. Current Aging Science, 7(1), 32–37. https://doi.org/10.2174/1874609807666140521103706. Libertini, G. (2014b). Programmed aging paradigm: How we get old. Biochemistry (Mosc), 79(10), 1004–1016. https://doi.org/10.1134/S0006297914100034. Libertini, G. (2015a). Non-programmed versus programmed aging paradigm. Current Aging Science, 8(1), 56–68. https://doi.org/10.2174/1874609808666150422111623. Libertini, G. (2015b). Phylogeny of aging and related Phenoptotic phenomena. Biochem (Mosc), 80 (12), 1529–1546. https://doi.org/10.1134/S0006297915120019. Libertini, G. (2017). Sex and aging: A comparison between two Phenoptotic phenomena. Biochemistry (Mosc), 82(12), 1435–1455. https://doi.org/10.1134/S0006297917120045. Libertini, G., Rengo, G., & Ferrara, N. (2017). Aging and aging theories. Journal of Gerontology and Geriatrics, 65, 59–77. http://www.jgerontology-geriatrics.com/wp-content/uploads/2018/ 03/RivJGG_1_17.pdf#page¼62. Liow, L. H., Van Valen, L., & Stenseth, N. C. (2011). Red queen: From populations to taxa and communities. Trends in Ecology & Evolution, 26(7), 349–358. https://doi.org/10.1016/j.tree. 2011.03.016. Longo, V. D., & Mattson, M. P. (2014). Fasting: Molecular mechanisms and clinical applications. Cell Metabolism, 19(2), 181–192. https://doi.org/10.1016/j.cmet.2013.12.008. Longo, V. D., Mitteldorf, J., & Skulachev, V. P. (2005). Programmed and altruistic ageing. Nature Reviews. Genetics, 6(11), 866–872. https://doi.org/10.1038/nrg1706. Martins, A. C. (2011). Change and aging senescence as an adaptation. PLoS One, 6(9), e24328. https://doi.org/10.1371/journal.pone.0024328. Masoro, E. J. (2005). Overview of caloric restriction and ageing. Mechanisms of Ageing and Development, 126(9), 913–922. https://doi.org/10.1016/j.mad.2005.03.012.

References

175

Mattison, J. A., Roth, G. S., Beasley, T. M., Tilmont, E. M., Handy, A. M., Herbert, R. L., Longo, D. L., Allison, D. B., Young, J. E., Bryant, M., Barnard, D., Ward, W. F., et al. (2012). Impact of caloric restriction on health and survival in rhesus monkeys from the NIA study. Nature, 489 (7415), 318–321. https://doi.org/10.1038/nature11432. Maynard Smith, J. (1964). Group selection and kin selection. Nature, 201(4924), 1145–1147. Maynard Smith, J. (1976). Group selection. The Quarterly Review of Biology, 51(2), 277–283. https://www.journals.uchicago.edu/doi/abs/10.1086/409311?journalCode¼qrb. McCay, C. M., Crowell, M. F., & Maynard, L. A. (1935). The effect of retarded growth upon the length of lifespan and upon the ultimate body size. Journal of Nutrition, 10(1), 63–79. https:// doi.org/10.1093/jn/10.1.63. Medawar, P. B. (1946). Old age and natural death. Modern Quarterly, 1, 30–56. Medawar, P. B. (1952). An unsolved problem in biology. London: H. K. Lewis. Reprinted in: Medawar PB (1957) The uniqueness of the individual. Methuen, London. Medvedev, Z. A. (1990). An attempt at a rational classification of theories of ageing. Biological Reviews of the Cambridge Philosophical Society, 65(3), 375–398. https://doi.org/10.1111/j. 1469-185x.1990.tb01428.x. Minot, C. S. (1908). The problem of age, growth, and death; A study of cytomorphosis, based on lectures at the Lowell Institute, March 1907, London (1913). Moderne Probleme der Biologie, Jena. Miquel, J., Economos, A. C., Fleming, J., & Johnson, J. E., Jr. (1980). Mitochondrial role in cell aging. Experimental Gerontology, 15(6), 575–591. https://doi.org/10.1016/0531-5565(80) 90010-8. Mitteldorf, J. (2001). Can experiments on caloric restriction be reconciled with the disposable soma theory for the evolution of senescence? Evolution, 55(9), 1902–1905. https://doi.org/10.1111/j. 0014-3820.2001.tb00841.x. Mitteldorf, J. (2004). Aging selected for its own sake. Evolutionary Ecology Research, 6, 937–953. http://www.evolutionary-ecology.com/issues/v06n07/ccar1520.pdf. Mitteldorf, J. (2013). Telomere biology: Cancer firewall or aging clock? Biochemistry (Mosc), 78 (9), 1054–1060. https://doi.org/10.1134/S0006297913090125. Mitteldorf, J., & Martins, A. C. (2014). Programmed life span in the context of evolvability. The American Naturalist, 184(3), 289–302. https://doi.org/10.1086/677387. Mitteldorf, J., & Pepper, J. (2009). Senescence as an adaptation to limit the spread of disease. Journal of Theoretical Biology, 260(2), 186–195. https://doi.org/10.1016/j.jtbi.2009.05.013. Moberg, P. E., & Burton, R. S. (2000). Genetic heterogeneity among adult and recruit red sea urchins, Strongylocentrotus franciscanus. Marine Biology, 136, 773–784. https://doi.org/10. 1007/s002270000281. Mueller, L. D. (1987). Evolution of accelerated senescence in laboratory populations of Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 84(7), 1974–1977. https://doi.org/10.1073/pnas.84.7.1974. Nishizaki, M. T., & Ackerman, J. D. (2005). A secondary chemical cue facilitates juvenile-adult postsettlement associations in red sea urchins. Limnology and Oceanography, 50(1), 354–362. https://doi.org/10.4319/lo.2005.50.1.0354. Nussey, D. H., Froy, H., Lemaitre, J. F., Gaillard, J. M., & Austad, S. N. (2013). Senescence in natural populations of animals: Widespread evidence and its implications for bio-gerontology. Ageing Research Reviews, 12(1), 214–225. https://doi.org/10.1016/j.arr.2012.07.004. Oliveira, B. F., Nogueira-Machado, J.-A., & Chaves, M. M. (2010). The role of oxidative stress in the aging process. TheScientificWorld Journal, 10, 1121–1128. https://doi.org/10.1100/tsw. 2010.94. Olovnikov, A. M. (1971). Principle of marginotomy in template synthesis of polynucleotides [in Russian]. Dokl Akad Nauk SSSR. 201(6), 1496–1499. English version: Olovnikov AM (1971) Principle of marginotomy in template synthesis of polynucleotides. Doklady Biochemistry 201:394–397.

176

4 The Comparison Between the Two Paradigms

Olovnikov, A. M. (1973). A theory of marginotomy: The incomplete copying of template margin in enzyme synthesis of polynucleotides and biological significance of the problem. Journal of Theoretical Biology, 41(1), 181–190. https://doi.org/10.1016/0022-5193(73)90198-7. Olovnikov, A. M. (2003). The redusome hypothesis of aging and the control of biological time during individual development. Biochemistry (Mosc), 68(1), 2–33. https://doi.org/10.1023/ a:1022185100035. Olovnikov, A. M. (2015). Chronographic theory of development, aging, and origin of cancer: Role of chronomeres and printomeres. Current Aging Science, 8(1), 76–88. Otto, S. P., & Nuismer, S. L. (2004). Species interactions and the evolution of sex. Science, 304 (5673), 1018–1020. https://doi.org/10.1126/science.1094072. Partridge, L., & Barton, N. H. (1993). Optimality, mutation and the evolution of ageing. Nature, 362(6418), 305–311. https://doi.org/10.1038/362305a0. Peters, A. D., & Lively, C. M. (1999). The red queen and fluctuating epistasis: A population genetic analysis of antagonistic coevolution. The American Naturalist, 154(4), 393–405. https://doi.org/ 10.1086/303247. Peters, A. D., & Lively, C. M. (2007). Short- and long-term benefits and detriments to recombination under antagonistic coevolution. Journal of Evolutionary Biology, 20(3), 1206–1217. https://doi.org/10.1111/j.1420-9101.2006.01283.x. Pianka, E. R. (1970). On r- and K-selection. The American Naturalist, 104(940), 592–597. www. journals.uchicago.edu/doi/abs/10.1086/282697?journalCode¼an. Polinski, J. M., Kron, N., Smith, D. R., & Bodnar, A. G. (2020). Unique age-related transcriptional signature in the nervous system of the long-lived red sea urchin Mesocentrotus franciscanus. Scientific Reports, 10(1), 9182. https://doi.org/10.1038/s41598-020-66052-3. Reed, J. C. (1999). Dysregulation of apoptosis in cancer. Journal of Clinical Oncology, 17(9), 2941–2953. https://doi.org/10.1200/JCO.1999.17.9.2941. Ribarič, S. (2012). Diet and aging. Oxidative Medicine and Cellular Longevity, 2012, 741468. https://doi.org/10.1155/2012/741468. Richardson, B. R., Allan, D. S., & Le, Y. (2014). Greater organ involution in highly proliferative tissues associated with the early onset and acceleration of ageing in humans. Experimental Gerontology, 55, 80–91. https://doi.org/10.1016/j.exger.2014.03.015. Ricklefs, R. E. (1998). Evolutionary theories of aging: Confirmation of a fundamental prediction, with implications for the genetic basis and evolution of life span. The American Naturalist, 152 (1), 24–44. https://doi.org/10.1086/286147. Ridley, M. (1993). The red queen. Sex and the evolution of human nature. London: Penguin Books. Robin, J. D., Ludlow, A. T., Batten, K., Magdinier, F., Stadler, G., Wagner, K. R., Shay, J. W., & Wright, W. E. (2014). Telomere position effect: Regulation of gene expression with progressive telomere shortening over long distances. Genes & Development, 28(22), 2464–2476. https://doi. org/10.1101/gad.251041.114. Rose, M. R. (1991). Evolutionary biology of aging. Oxford: Oxford University Press. Sacher, G. A. (1959). Relation of lifespan to brain weight and body weight in mammals. In G. E. W. Wolstenholme & M. O’Connor (Eds.), The lifespan of animals (CIBA Foundation Colloquia on ageing) (Vol. 5, pp. 115–133). Boston: Little, Brown and Co.. Salathé, M., Kouyos, R. D., & Bonhoeffer, S. (2008). The state of affairs in the kingdom of the red queen. Trends in Ecology & Evolution, 23(8), 439–445. https://doi.org/10.1016/j.tree.2008.04. 010. Sanz, A., & Stefanatos, R. K. (2008). The mitochondrial free radical theory of aging: A critical view. Current Aging Science, 1(1), 10–21. https://doi.org/10.2174/1874609810801010010. Schofield, D. P., McGrew, W. C., Takahashi, A., & Hirata, S. (2018). Cumulative culture in nonhumans: Overlooked findings from Japanese monkeys? Primates, 59(2), 113–122. https:// doi.org/10.1007/s10329-017-0642-7. Sinclair, D. A., & Guarente, L. (1997). Extrachromosomal rDNA circles – A cause of aging in yeast. Cell, 91(7), 1033–1042. https://doi.org/10.1016/s0092-8674(00)80493-6.

References

177

Skulachev, V. P. (1997). Aging is a specific biological function rather than the result of a disorder in complex living systems: Biochemical evidence in support of Weismann’s hypothesis. Biochemistry (Mosc), 62(11), 1191–1195. http://protein.bio.msu.ru/biokhimiya/contents/v62/full/ 62111394.html. Skulachev, V. P. (1999a). Mitochondrial physiology and pathology; concepts of programmed death of organelles, cells and organisms. Molecular Aspects of Medicine, 20(3), 139–184. https://doi. org/10.1016/s0098-2997(99)00008-4. Skulachev, V. P. (1999b). Phenoptosis: Programmed death of an organism. Biochemistry (Mosc), 64(12), 1418–1426. http://protein.bio.msu.ru/biokhimiya/contents/v64/full/64121679.html. Skulachev, V. P. (2001). The programmed death phenomena, aging, and the samurai law of biology. Experimental Gerontology, 36(7), 995–1024. https://doi.org/10.1016/s0531-5565(01) 00109-7. Skulachev, V. P. (2002). Programmed death phenomena: From organelle to organism. Annals of the New York Academy of Sciences, 959, 214–237. https://doi.org/10.1111/j.1749-6632.2002. tb02095.x. Skulachev, V. P., & Longo, V. D. (2005). Aging as a mitochondria-mediated atavistic program: Can aging be switched off? Annals of the New York Academy of Sciences, 1057, 145–164. https:// doi.org/10.1196/annals.1356.009. Speakman, J. R., & Mitchell, S. E. (2011). Caloric restriction. Molecular Aspects of Medicine, 32 (3), 159–221. https://doi.org/10.1016/j.mam.2011.07.001. Spinage, C. A. (1970). Population dynamics of the Uganda Defassa Waterbuck (Kobus defassa Ugandae Neumann) in the Queen Elizabeth park, Uganda. The Journal of Animal Ecology, 39 (1), 51–78. www.jstor.org/stable/2889?seq¼1. Spinage, C. A. (1972). African ungulate life tables. Ecology, 53(4), 645–652. https://doi.org/10. 2307/1934778. Strobeck, C., Maynard Smith, J., & Charlesworth, B. (1976). The effects of hitchhiking on a gene for recombination. Genetics, 82(3), 547–558. www.ncbi.nlm.nih.gov/pmc/articles/ PMC1213474/. Takubo, K., Aida, J., Izumiyama-Shimomura, N., Ishikawa, N., Sawabe, M., Kurabayashi, R., Shiraishi, H., Arai, T., & Nakamura, K.-I. (2010). Changes of telomere length with aging. Geriatrics & Gerontology International, 10(Suppl 1), S197–S206. https://doi.org/10.1111/j. 1447-0594.2010.00605.x. Travis, J. M. (2004). The evolution of programmed death in a spatially structured population. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 59(4), 301–305. https://doi.org/10.1093/gerona/59.4.b301. Trifunovic, A., Wredenberg, A., Falkenberg, M., Spelbrink, J. N., Rovio, A. T., Bruder, C. E., Bohlooly-Y, M., Gidlöf, S., Oldfors, A., Wibom, R., Törnell, J., Jacobs, H. T., & Larsson, N. G. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature, 429(6990), 417–423. https://doi.org/10.1038/nature02517. Trivers, R. L. (1971). The evolution of reciprocal altruism. The Quarterly Review of Biology, 46(1), 35–57. https://doi.org/10.1086/406755. Trivers, R. L., & Hare, H. (1976). Haploidiploidy and the evolution of the social insect. Science, 191(4224), 249–263. https://doi.org/10.1126/science.1108197. Troen, B. (2003). The biology of aging. Mount Sinai Journal of Medicine, 70(1), 3–22. van Steensel, B., & de Lange, T. (1997). Control of telomere length by the human telomeric protein TRF1. Nature, 385(6618), 740–743. https://doi.org/10.1038/385740a0. van Valen, L. (1973). A new evolutionary law. Theory of Evolution, 1(1), 1–30. Vaupel, J. W., Baudisch, A., Dölling, M., Roach, D. A., & Gampe, J. (2004). The case for negative senescence. Theoretical Population Biology, 65(4), 339–351. https://doi.org/10.1016/j.tpb. 2003.12.003. Vaziri, H. (1998). Extension of life span in normal human cells by telomerase activation: A revolution in cultural senescence. Journal of Anti-Aging Medicine, 1, 125–130. https://doi. org/10.1089/rej.1.1998.1.125.

178

4 The Comparison Between the Two Paradigms

Vaziri, H., & Benchimol, S. (1998). Reconstitution of telomerase activity in normal cells leads to elongation of telomeres and extended replicative life span. Current Biology, 8(5), 279–282. https://doi.org/10.1016/s0960-9822(98)70109-5. Voje, K. L., Holen, Ø. H., Liow, L. H., & Stenseth, N. C. (2015). The role of biotic forces in driving macroevolution: Beyond the red queen. Proc Biol Sci 282(1808), 20150186. https://doi.org/10. 1098/rspb.2015.0186. Walford, R. L., Harris, S. B., & Gunion, M. W. (1992). The calorically restricted low-fat nutrientdense diet in biosphere 2 significantly lowers blood glucose, total leukocyte count, cholesterol, and blood pressure in humans. Proceedings of the National Academy of Sciences of the United States of America, 89(23), 11533–11537. https://doi.org/10.1073/pnas.89.23.11533. Wallace, A. R. (1865–1870) The action of natural selection in producing old age, decay and death [A note by Wallace written “some time between 1865 and 1870”]. In: Weismann A (1889; 1st ed. 1889, 2nd ed. 1891). English translation: E. B. Poulton, S. Schonland, & A. E. Shipley (Eds.), Essays upon heredity and kindred biological problems (Vol. I). Oxford: Clarendon Press. Watson, J. D. (1972). Origin of concatemeric T7 DNA. Nature New Biology, 239(94), 197–201. https://doi.org/10.1038/newbio239197a0. Weinert, B. T., & Timiras, P. S. (2003). Invited review: Theories of aging. Journal of Applied Physiology, 95(4), 1706–1716. https://doi.org/10.1152/japplphysiol.00288.2003. Weismann, A. (1889, 1st ed. 1889, 2nd ed. 1891). In E. B. Poulton, S. Schonland, & A. E. Shipley (Eds.), Essays upon heredity and kindred biological problems (Vol. I). Oxford: Clarendon Press. Weismann, A. (1892). Essays upon heredity and kindred biological problems (Vol. II). Oxford: Clarendon Press. Williams, G. C. (1957). Pleiotropy, natural selection and the evolution of senescence. Evolution, 11, 398–411. https://doi.org/10.2307/2406060. Williams, G. C. (1975). Sex and evolution. Princeton: Princeton University Press. Wilson, E. O. (1975). Sociobiology, the new synthesis. Cambridge: Harvard University Press. Wright, W. E., & Shay, J. W. (2005). Telomere biology in aging and cancer. Journal of the American Geriatrics Society, 53(9 Suppl), S292–S294. https://doi.org/10.1111/j.1532-5415. 2005.53492.x. Yamamoto, S., Humle, T., & Tanaka, M. (2013). Basis for cumulative cultural evolution in chimpanzees: Social learning of a more efficient tool-use technique. PLoS One, 8(1), e55768. https://doi.org/10.1371/journal.pone.0055768.

Chapter 5

Subtelomere-Telomere Aging Theory

It is suggested to read the definitions of Telomere, Telomerase and Subtelomere in the section Terminology before this chapter.

5.1

Description of the Subtelomere-Telomere Theory

As already discussed in the previous Chapter 4 – The comparison between the two paradigms, the theories that propose an explanation for aging may be divided into two groups: non-adaptive and adaptive aging theories. These two types of theories, which are entirely incompatible with each other, are based on different assumptions, and involve different implications. For these reasons, they deserve the definition of opposing paradigms (Libertini 2015a), in the meaning of the term paradigm defined by Kuhn (1962). Apart from other differences, the main distinction between these two paradigms is the following: – for the non-adaptive (or non-programmed) aging paradigm, senescence is the random cumulative effect of many distinct degenerative processes. Therefore, according to such concepts, it is wholly excluded that aging can be caused by mechanisms that are determined and regulated by specific genes; – for adaptive (or programmed) aging paradigm, senescence is a physiological phenoptotic phenomenon that must necessarily be caused by mechanisms that are determined and regulated by specific genes (Libertini 2015a). In short, for the first paradigm the aforesaid mechanisms do not exist and cannot exist while for the second paradigm such mechanisms exist and must absolutely exist to admit the validity of the paradigm. Frequently, the non-adaptive aging paradigm theories are still presented today as the only ones that can correctly explain aging (Olshansky et al. 2002; Hayflick 2007; Kirkwood and Melov 2011; De Grey 2005; Gladyshev 2016). Still, there are many © The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0_5

179

180

5 Subtelomere-Telomere Aging Theory

qualified papers about genetically determined and modulated mechanisms that in various ways progressively compromise the functionality of cells and organisms and so falsify the hypothesis of aging as deriving from the accidental accumulation of harmful events (for a review, see (Fossel 2004; Libertini 2015a, b)). It should be noted that the authors of these studies do not discuss at all if aging is adaptive or non-adaptive: yet, in fact, the results of their studies show that there are specific mechanisms determined and regulated by genes that cause the alterations of aging and therefore are implicitly in support of the adaptive aging paradigm. The existence of highly-regulated mechanisms that determine the cells to programmed cell death, if appropriate, and able to propagate themselves in next generations, seems to appear early in the evolution. Such mechanisms are observed well before the emergence of eukaryotes and a linear chromosome and telomere development, even in certain prokaryotes, with the onset of intercellular signaling and organization in communities. Myxobacteria can serve as an example of such “prosociality”, at some extent preserving the independence of cells (and organisms), with the emergence of regulated cell death, occurring not as a result of “some stochastic events”, but only if sharply demanded to assure the propagation of at least some individuals from the community (Muñoz-Dorado et al. 2016; Nariya and Inouye 2008). For most eukaryotic orgnisms, the description that appears more coherent and satisfactory about aging mechanisms is that defined as “Telomere Theory of Aging” (Fossel 2015, p. 19) or, more precisely, as “subtelomere-telomere theory” of aging (Libertini et al. 2018), which is based on the Telomere-Subtelomere-Telomerase system (TST system). This theory will be briefly described in the following sections of this paragraph 5.1 and then, in the following paragraphs of this chapter, discussed with regard to the main components of the TST system and some particular questions. In a nutshell, TST system determines the phenomena that constitute the substratum of aging, in particular: (i) gradual cell senescence; (ii) cell senescence; (iii) the slowing down of cellular turnover; and (iv) the atrophic syndrome of all tissues and organs (Fossel 2004; Libertini 2009a, 2015a, b). Other descriptions of aging mechanisms, which are declared by their authors as consistent with the programmed aging paradigm, have been proposed (e.g.: (Olovnikov 2003, 2015; Goldsmith 2008, 2012; Skulachev 2012; Skulachev and Skulachev 2014)). However, in this paper, only the subtelomere-telomere theory will be considered, because the empirical evidence appears to support it actively, and have some verified molecular validation at the moment.

5.1.1

Limits in Cell Duplication Capacities

Before the 1960s, there was a belief that non-germ line cells of a multicellular organism were capable of unlimited duplication. This idea was based on apparently indisputable experiments carried out mainly by Nobel laureate Alexis Carrel

5.1 Description of the Subtelomere-Telomere Theory

181

Fig. 5.1 Leonard Hayflick

(Ebeling 1913; Carrel and Ebeling 1921a, b; Parker 1961). The experiments of Hayflick (Fig. 5.1) showed in vitro that there were limits in normal cell duplication capabilities (Hayflick and Moorhead 1961; Hayflick 1965), and later such limits were also demonstrated in vivo (Schneider and Mitsui 1976). The restrained capacity for cell duplication, later referred to as Hayflick limit, was demonstrated for many different types of normal cells (e.g., human epidermal keratinocytes (Rheinwald and Green 1975), human arterial smooth-muscle cells (Bierman 1978), human lens epithelial cells (Tassin et al. 1979)). It was also shown that cell duplication capacity was: (i) reduced in progeria (Hutchinson-Gilford syndrome) (Goldstein 1969; Martin et al. 1970; Hayflick 1977) and Werner’s syndrome (Martin et al. 1970); (ii) inversely related to the age of the individuals from which the cells were derived. Fetal human diploid fibroblast-like cells (HDF cells) displayed a consistently more significant number of population doublings than normal cells derived from adult tissues (approximately 50 and 20–30, respectively) (Hayflick and Moorhead 1961) and skin HDF cells from donors of different ages showed a reduction of potential doublings of 0.2 doubling/year of life (Martin et al. 1970); (iii) directly related, although approximately, with the longevity of the species (Röhme 1981). “Mice have a lifespan of three years and a Hayflick Limit of fifteen divisions [for fibroblasts], while the Galapagos turtle, which lives for 200 years, has a Hayflick Limit of around 110 divisions. Human fibroblasts have a Hayflick Limit of between forty and sixty divisions.” (Fossel 2015, p. 22). The discovery of physiological limits in the duplication capacity of non-germ line cells had important implications, as well evidenced by Hayflick himself: “The importance of a correct interpretation of this phenomenon cannot be overemphasized since the apparent indefinite multiplication of isolated normal vertebrate cells in

182

5 Subtelomere-Telomere Aging Theory

Fig. 5.2 Alexey M. Olovnikov

culture, as purportedly demonstrated by Carrel, has often been cited as evidence for the thesis that senescence in higher animals is a phenomenon resulting from the effects of events at the supracellular level (Pearl 1922; Bidder 1925; Medawar 1940; Cowdry 1952; Comfort 1964; Maynard Smith 1962). It follows, therefore, that if normal animal cells do indeed have only a limited capacity for division in cell culture, the manifestations of aging might very well have an intracellular basis. Consequently, arguments marshalled against cellular theories of aging that are based on the myth of ‘immortal’ cell cultures must be re-evaluated since those cells that do proliferate indefinitely in vitro are abnormal and often behave like cancer cells. Contrariwise, normal cells in vitro do have a finite life span, as do the animal from which such cells have been taken ...” (Hayflick 1977, p. 163). However, for some time, the cause of the Hayflick limit was not known. In 1975, the mechanism restricting the number of duplication was shown to be in the nucleus (Wright and Hayflick 1975). However, well before this work, in 1971, Olovnikov (Fig. 5.2) predicted that the enzyme capable of duplicating DNA molecule (DNA polymerase) could not replicate a little part of the end of the molecule that therefore would be lost at each duplication and hypothesized this partial replication as the cause of Hayflick limit (Olovnikov 1971). The following year, the hypothesis was proposed again by Watson without citing the previous paper of Olovnikov (Watson 1972) and only for the ends of the phage DNA molecule, without discussing telomeres of eukaryotic cells. Also, the same Olovnikov, since cancer cells and germline cells are capable of very many or unlimited replications, foresaw the existence of an enzyme that should be capable of preventing the shortening of telomeres (Olovnikov 1973). In 1978, in a protozoan species, each end of the DNA molecule, defined as a telomere, was shown to be a simple sequence of nucleotides (TTGGGG) repeated many times (Blackburn and Gall 1978). Some years later, it was shown that telomeres of mammals had the same repeated sequence with a little difference

5.1 Description of the Subtelomere-Telomere Theory

183

Fig. 5.3 Cristopher M. Counter

(TTAGGG) (Moyzis et al. 1988) and that this sequence was the same for trypanosomes, molds, and other non-mammal vertebrates and organisms (Blackburn 1991). Its significant evolutionary conservation, shared even between organisms with very ancient common ancestors indicated with certainty that the structure had pivotal importance. In 1985, the enzyme predicted by Olovnikov in 1973 and capable of restoring the unduplicated part of the DNA molecule was isolated and called telomerase by Greider and Blackburn (1985). Other works confirmed and enriched these results. E.g.: (i) as hypothesized, telomere was proved to shorten during aging in direct proportion to the duplications of human fibroblasts (Harley et al. 1990); (ii) with inactive telomerase in mutated Tetrahymena, cell culture showed a reduction in duplication capacity (Yu et al. 1990); (iii) telomerase activation gave the cell the capacity of unlimited duplications (Bodnar et al. 1998; Counter et al. 1998; Vaziri 1998; Vaziri and Benchimol 1998; de Lange and Jacks 1999) (Fig. 5.3). (iv) regulation of telomerase activity by specific proteins was shown (van Steensel and de Lange 1997); (v) telomerase activity without restrictions was demonstrated in immortal human cell lines (Morin 1989).

184

5.1.2

5 Subtelomere-Telomere Aging Theory

Probabilistic Relation Between Telomere Shortening and Replicative Senescence

While there was a clear relationship between the number of previous duplications and telomere shortening on the one hand and the onset of the blocking of duplication capacities (replicative senescence) on the other hand, the phenomenon raised an important question critically pointed out by Blackburn: “Cellular senescence is commonly described as cells being able to divide a finite number of times, with senescence occurring only when telomeres reach a critical short length. Usually implicit is the idea that the ‘young’ cells, which are all dividing at the beginning of the passaging, are free of ‘aged’ phenotypes until, following a period of telomere shortening during the passaging, critically short telomeres appear in the ‘old’ cells. Implicit is the idea of an inbuilt delay before senescence is reached. But a significant (although infrequently cited) literature dealing with the behavior of individual cells reveals a different picture (for example (Pontèn et al. 1983; Jones et al. 1985); reviewed in (Holliday 1996)).” (Blackburn 2000). As highlighted by Blackburn, the simplistic description of the phenomenon was sharply contradicted by studies on the growth potential of cell populations where at any time, all cells had the same number of previous replications. The decline of the growth potential was not abrupt after a certain number of duplications, but showed a progressive increasing reduction of duplication capacity (Pontèn et al. 1983; Jones et al. 1985). Such dependence indicated that the probability of replicative senescence increased progressively with telomere shortening, but that even for a cell with telomeres having the greatest length, the passage from the “cycling state” (duplication possible) to “noncycling state” (duplication impossible, i.e., replicative senescence) was possible. A likely brilliant solution was proposed by Blackburn in the same work before mentioned (Blackburn 2000). According to this hypothesis the telomere forms with particular molecules (“sequence-specific DNA-binding proteins”) a telomeric “DNA-protein complex” (Blackburn 2000). This nucleoprotein complex oscillates between two states: 1. “capped” telomere, when protein and nucleic components are bound, the telomere is protected, and the cell is resistant to the transition to the non-cycling state; 2. “uncapped” telomere, when protein and nucleic components are at least partly unbound, the telomere becomes unprotected, and the cell becomes vulnerable to the transition to the non-cycling state. Furthermore, the portion of time in which the telomere is uncapped had to be proportional to telomere shortening (Blackburn 2000). Blackburn also indicated that the protein portion of the nucleoprotein complex, i.e., the cap protecting the telomere, had to be a complex set of proteins (Blackburn 2000). Finally, it was implicit that the ability of this cap to bind to the telomere had to be necessarily subject to a regulation dependent on telomere length, i.e., a greater telomere length implied a better ability to bind to the telomere and vice versa (Fig. 5.4).

5.1 Description of the Subtelomere-Telomere Theory

185

Fig. 5.4 According to Blackburn’s hypothesis (Blackburn 2000), telomere oscillates between capped and uncapped conditions. The probability of the uncapped state increases with telomere shortening and, in this condition, the telomere, seen as a broken end of DNA molecule, is vulnerable to replicative senescence (Fig. 6 of (Libertini 2009a), modified and redrawn). Two notes are necessary: (i) about longer/shorter telomere, there is no reference to the absolute initial length of the telomere, but to its relative shortening (this subject is discussed in Subsection 5.1.5 – Absence of relation between longevity and telomere initial length); and (ii) the uncapped state should not be intended as the complete separation between telomere and cap as represented in the figure (this subject is briefly discussed at the end of Section 5.8 – The heterochromatin hood over the telomere)

These phenomena are certainly more complex than as proposed here. The accumulation of evidence concerning the composition and stoichiometry of the shelterin complex components and other proteins and ribonucleoproteins, bound to telomeric and subtelomeric regions at specific time points, the regulation of telomere length and functioning appear more and more complex (Cech 2004; Nandakumar and Cech 2013). Simultaneously, in living organisms and cell cultures, the decisions between proliferation, cell cycle arrest, and switching to the senescent phenotype are not directly dependent on telomere length, being, in contrast, an integration of multiple signals (Victorelli and Passos 2017). The details and critical regulators of these decision interplays, from cellular to tissue and organismal levels, and the particular contexts that influence the realization of such different scenarios, are still to be revealed (Victorelli and Passos 2017; Fujimaki et al. 2019).

5.1.3

Suggestions from the Yeast

Other questions arise from the previous description of the telomere-telomerase system:

186

5 Subtelomere-Telomere Aging Theory

Fig. 5.5 Frank Madeo

(i) telomere shortening is related to a progressive impairment of cellular functions and it is necessary to explain how this phenomenon is determined; (ii) in the comparison among the species (and among different strains of the same species), there is no relation between longevity and initial length of the telomere. It is necessary to explain the absence of a relationship that could also seem a logical consequence of the likely mechanism linking the limit of cell duplication capacity to telomere shortening. Before describing these questions in detail and, with the proper evidence, proposing a possible solution, it is useful and necessary to describe what is observed in a particular unicellular eukaryotic species, the yeast (Saccharomyces cerevisiae), which manifests a phenomenon defined as aging. Two premises are useful: 1. In yeast, a phenomenon closely resembling apoptosis of multicellular eukaryotes was a quite recent finding (Madeo et al. 1997) (Fig. 5.5). It was elicited by the overexpression of a factor (mammalian BAX) that in multicellular eukaryotes triggered apoptosis (Ligr et al. 1998), while the overexpression of another factor that in multicellular eukaryotes inhibited apoptosis (human Bcl-2) determined the delay of the processes leading to it (Longo et al. 1997) (Fig. 5.6). Moreover, there was a significant body of evidence that showed the similarity between this phenomenon and apoptosis in multicellular eukaryotes. These associations suggested a common phylogenetic origin (Madeo et al. 1999; Longo et al. 2005; Kaeberlein et al. 2007). In yeast, there are several orthologues of mammalian apoptotic proteins and conserved mitochondrial, proteasomal, and histone-

5.1 Description of the Subtelomere-Telomere Theory

187

Fig. 5.6 Valter D. Longo

Fig. 5.7 S. Michal Jazwinski

regulated apoptotic pathways (Büttner et al. 2006), and therefore it appeared correct to define this phenomenon as apoptosis. 2. In the wild strains of yeast, telomerase is always active and so telomere length remains the same after each duplication (D’Mello and Jazwinski 1991; Smeal et al. 1996; Maringele and Lydall 2004). The yeast reproduces by the division of a “mother” cell into a “daughter” cell and another “mother” cell. There are differences between these two types of cells: – The cells of daughter lineage may reproduce an unlimited number of times (Maringele and Lydall 2004). – The cells of mother lineage may reproduce only a limited number of times (i.e., 25–35 duplications in about 3 days (Jazwinski 1993) (Fig. 5.7), and show, with

188

5 Subtelomere-Telomere Aging Theory

the number of duplications, increasing functional alterations and susceptibility to replicative senescence and apoptosis (Laun et al. 2001; Lesur and Campbell 2004; Herker et al. 2004; Büttner et al. 2006; Fabrizio and Longo 2008) with a decreasing resistance to sustain stress (Jazwinski 1993). The consequent increase of age-related death rate shows an exponential dynamic (Laun et al. 2007), which is similar to that followed by individuals of aging species (Ricklefs 1998; Nussey et al. 2013). When the limited number of duplications is reached, mother cells end their life by apoptosis (Laun et al. 2001). Apoptosis is also triggered under challenging conditions (Kaeberlein et al. 2007), e.g.: (i) a declining availability of nutrients (Granot et al. 2003); (ii) harmful chemical alterations (Madeo et al. 1999); and (iii) unsuccessful mating (Büttner et al. 2006). Yeast apoptosis, similarly to what happens in multicellular eukaryotes, is the orderly demolition of the cell in parts that are not harmful to other individuals: other cells usefully phagocytize or absorb these parts and, consequently, by using the substances released by individuals died by apoptosis appear able to survive longer (Herker et al. 2004). As for the mechanism that, in yeast cells, determines functional cell decline and increasing vulnerability to apoptosis, the mother cells, in proportion to the number of previous duplications, show progressive accumulation of particular molecules, known as extrachromosomal ribosomal DNA circles (ERCs), on the subtelomere, i.e., that part of DNA adjacent to the telomere (Sinclair and Guarente 1997): “... several lines of evidence suggest that accumulation of ERCs is one determinant of life span ...”, and, in proportion to the number of duplications, increasing metabolic alterations, definable as cell senescence, are evident (Lesur and Campbell 2004). These alterations are a likely consequence of ERCs accumulation, which interferes with gene expression of critical parts of subtelomeric DNA. A fact that confirms this interpretation is that yeast dna2–1 mutants show abnormalities in DNA duplication, increased ERC accumulation, and precocious alterations of gene expression. In particular, for cells of the mother lineage, the transcriptome of young individuals of dna2–1 mutants are similar to those of older wild-type individuals (Lesur and Campbell 2004). However, an exciting fact was observed. A particular strain of yeast mutant (tlc1Δ mutant) was characterized by a deficient telomerase activity and, therefore, for both mother and daughter cells, there was telomere shortening at each duplication. Moreover, cells of the daughter line, while showing no ERC accumulation (as wild strains), manifested, in proportion to the number of previous duplications, a declining resistance to sustain stress and a transcriptome similar to that of mother cells of the wild strain with the same number of duplications (Lesur and Campbell 2004). If, in the mother cells of the wild strain, ERC accumulation repressed the subtelomere causing a series of cellular alterations, the analogous alterations observed in daughter cells of tlc1Δ mutants were probably caused by similar repression of the subtelomere, without accumulation of ERCs. A possible explanation was that the progressive shortening of the telomere in tlc1Δ mutants, due to

5.1 Description of the Subtelomere-Telomere Theory

189

Fig. 5.8 (A): in the daughter cells of wild strains, there is no ERC accumulation and no cell alteration; (B): in the mother cells of wild strains, there is ERC accumulation and cell alterations due to subtelomere repression; (C): in the daughter cells of tlc1Δ mutants, there is no ERC accumulation but telomere shortening and the same cellular alterations due to subtelomere repression shown in B, presumably due to the sliding of a heterochromatin hood that covers the shortened telomere

deficient telomerase activity, caused the sliding on the subtelomere of a sort of heterochromatin “hood” that covered the telomere and that gradually repressed the activity of the subtelomere (Fossel 2004; Libertini 2009a) (Fig. 5.8).

5.1.4

Gradual Cell Senescence and Cell Senescence

In 1990, in the yeast, the proximity of an artificially inserted gene to the telomere was shown to determine reversible repression of the gene (Gottschling et al. 1990) (Fig. 5.9). This phenomenon, called “telomeric position effect” (Gottschling et al. 1990), has been reported for other species (Baur et al. 2004) (Fig. 5.10), ours included (Baur et al. 2001), and is related to telomere shortening (Surace et al. 2014). It has been shown that, in particular conditions, “chromosome looping brings the telomere close to genes up to 10 Mb away from the telomere when telomeres are long and that the same loci become separated when telomeres are short.” (Robin et al. 2014). This phenomenon, described as “telomere position effect over long distances”, has been proposed as “a potential novel mechanism for how telomere shortening could contribute to aging and disease initiation/progression in human

190

5 Subtelomere-Telomere Aging Theory

Fig. 5.9 Daniel E. Gottschling

Fig. 5.10 Joseph A. Baur

cells long before the induction of a critical DNA damage response.” (Robin et al. 2014). However, this mechanism appears too simplistic to explain the many gradual changes in DNA expression dependent on telomere shortening and the related repression of subtelomeric sequences. In the same work, it is highlighted: “Our results demonstrate that the expression of a subset of subtelomeric genes is dependent on the length of telomeres and that widespread changes in gene expression are induced by telomere shortening long before telomeres become rate-limiting for division or before short telomeres initiate DNA damage signaling. These changes include up-regulation and down-regulation of gene expression levels.” (Robin et al. 2014). However, subtelomere repression determines progressive alterations of cell functions, including extracellular secretions, and the name “gradual cell senescence”,

5.1 Description of the Subtelomere-Telomere Theory

191

Fig. 5.11 Michael Fossel

which describes better its effect regarding aging manifestations, was proposed (Libertini 2014, 2015b). A different mechanism was proposed to explain the progressive repression of subtelomeric DNA. In short, Michael Fossel (Fig. 5.11) suggested that the telomere was covered by a heterochromatin “hood” of fixed length and that the progressive telomere shortening caused a proportional sliding of the hood and so the repression of the subtelomeric sequence: “One model of telomere-gene expression linkage is an altered chromosomal structure (Ferguson et al. 1991), such as a heterochromatin ‘hood’ that covers the telomere and a variable length of the subtelomeric chromosome (Fossel 1996; Villeponteau 1997; Wright et al. 1999). As the telomere shortens, the hood slides further down the chromosome (the heterochromatin hood remains invariant in size and simply moves with the shortening terminus) ... the result is an alteration of transcription from portions of the chromosome immediately adjacent to the telomeric complex, usually causing transcriptional silencing, although the control is doubtless more complex than merely telomere effect through propinquity (Aparicio and Gottschling 1994; Singer et al. 1998; Stevenson and Gottschling 1999). These silenced genes may in turn modulate other, more distant genes (or sets of genes). There is some direct evidence for such modulation in the subtelomere ...” (Fossel 2004, p. 50). As hinted by Fossel, this model requires a hood of fixed length, which is defined in the first cell of an organism and afterward must remain unchanged in all subsequent duplications (Libertini and Ferrara 2016). If the hypothesis of a fixed-size hood is true and the hood is made up of the shelterin complexes’ proteins, the total amount of such proteins should be the same in germline cells and cells with shortened telomeres.

192

5 Subtelomere-Telomere Aging Theory

Fig. 5.12 Robert A. Weinberg

On the contrary, if the hypothesis is false and hood size adapts to telomere length, the total amount of proteins in the shelterin complexes should decrease in proportion to telomere shortening. Fossel’s hypothesis appears compatible with the results of one work by the team of Titia de Lange, where they compared cell lines with different telomere length (Takai et al. 2010): “We used quantitative immunoblotting to determine the abundance and stoichiometry of the shelterin proteins in the chromatin-bound protein fraction of human cells. The abundance of shelterin components was similar in primary and transformed cells and was not correlated with telomere length.” This result has been cited as reliable in a recent work (Li et al. 2017a): “Quantification of the protein levels of shelterin show that the abundance of this complex does not change in relation to telomere length (Takai et al. 2010).” In the same work (Li et al. 2017a), the action of a particular protein (TZAP) in removing excess portions of the telomere appears conditioned by a necessarily constant amount of shelterin complexes. This action is also compatible with the functions expected for a fixed-size hood (see Section 5.8 – The heterochromatin hood over the telomere). Another phenomenon related to telomere shortening, and therefore, likely, to the progressive subtelomere repression and the increase of gradual cell senescence manifestations, is a growing probability of the passage to replicative senescence, the “non-cycling” state in the definition of Blackburn (2000), or, to put it in newer terms proposed by Ben-Porath and Weinberg (Fig. 5.12), an increasing probability of activating a particular program, defined as “cell senescence”, a “fundamental cellular program” (Ben-Porath and Weinberg 2005). It is characterized by: (i) block of replication capabilities (replicative senescence); (ii) gradual cell senescence manifestations at the highest level; and (iii) apoptosis resistance (Kirkland and Tchkonia 2017). There is a correlation between (i) telomere shortening; (ii) subtelomere repression; (iii) percent of the time in which the telomere is uncapped and vulnerable; and: (iv) progressive manifestations of gradual cell senescence; and (v) probability of

5.1 Description of the Subtelomere-Telomere Theory

193

Fig. 5.13 Subtelomeric sequences (“r”), which would have general regulatory actions by likely intermediate substances, and their repression by the sliding of telomere cap (or by ERC accumulation in yeast) (Fig. 3 from (Libertini 2017), modified and redrawn)

activation of the cell senescence program. Therefore, as (iv) and (v) appear to be in function of the portion of the subtelomeric sequence that is inhibited, it has been suggested that they are somehow influenced and regulated by subtelomeric sequences. Such components, defined as “r” sequences, would have general and decisive regulatory action over the cell functionality, in particular the functions altered in gradual cell senescence, and over the resistance/vulnerability to cell senescence program activation (Libertini and Ferrara 2016) (Fig. 5.13). Another phenomenon related to telomere shortening, and therefore, likely, to the progressive. If the postulated “r” sequences exist, we should find them in the subtelomere sequences whose progressive repression would cause the characteristic alterations of gradual cell senescence and the increasing vulnerability to the triggering of the cell senescence program. This pivotal topic will be discussed in Section 5.7 – The subtelomere.

194

5.1.5

5 Subtelomere-Telomere Aging Theory

Absence of Relation Between Longevity and Telomere Initial Length

If aging manifestations are a consequence of telomere shortening, it appears rational to predict, in the comparison among species, that longevity should be proportional to the initial telomere length, i.e., to that of the germline cells, and similarly to the mean of telomerase activity. However, this prediction is clearly contradicted by evidence: (i) there is no relationship among the rodents between telomerase activity and longevity (Gorbunova et al. 2008) (Fig. 5.14); (ii) mice and hamsters, although with longer telomeres than our species, age in few years and have much shorter life spans (Slijepcevic and Hande 1999); (iii) two Mus strains, with quite a different telomere length (20 kb and 10 kb), show analogous timing patterns of cell senescence and equal longevity (Fossel 2004, p. 60); (iv) cloned animals derived from somatic cells with telomeres shorter than germline cells of the donor animals, show the same aging rhythms (Kubota et al. 2000; Lanza et al. 2001; Fossel 2004, p. 60); (v) in strains of telomerase knockout (mTR
/
) mice characterized by inactivated telomerase, only when telomeres are very shortened, that is after four (Herrera et al. 1999) to six (Blasco et al. 1997) (Fig. 5.15) generations, it is possible to observe, in protected laboratory conditions, that viability and fertility are compromised; Fig. 5.14 Vera Gorbunova

5.1 Description of the Subtelomere-Telomere Theory

195

Fig. 5.15 Maria Antonia Blasco Marhuenda

(vi) although with a limited lifespan, mice have a baseline activity of telomerase in most somatic cells (Prowse and Greider 1995). In evident contradiction with the prediction above, these phenomena cannot be explained if longevity determination is in function of the initial telomere length. A straightforward explanation is possible if we hypothesize that in the first cell of a multicellular organism, before the first duplication and in a phase that could be defined as the “reset phase”, there is the formation of a heterochromatin hood, or telomere cap, with a size that is proportional to telomere length. This assumption would also be necessary if, as observed (Londoño-Vallejo et al. 2001), in the same cells, there are differences for telomere lengths among the chromosomes and also between the two ends of a single chromosome. Moreover, it is necessary to assume that, in all the subsequent cell replications, “the heterochromatin hood remains invariant in size” (Fossel 2004, p. 50). A fixed length of the hood is also useful to explain how, in cells where telomerase is active, the enzyme restores the initial length of the telomere (likely by using the hood as a bounding marker) and does not elongate it without limits. With these conditions, if the telomere is not elongated by telomerase enzyme after each duplication, there is a progressive telomere shortening. Such a shortening determines the sliding of the hood over the subtelomeric sequence, and all the phenomena mentioned above determined by the progressive repression of the subtelomere. Therefore, for the longevity, the absolute initial “telomere length is irrelevant; telomere loss is critical” (Fossel 2004, p. 36) (of course excluding the case of a

196

5 Subtelomere-Telomere Aging Theory

Fig. 5.16 In (A), subtelomere is shorter, and telomere longer comparing to the case (A). If telomeres, after a certain number of duplications are equally shortened (i.e., the same reduction in the number of nucleic base pairs), there is an equal sliding of the heterochromatin hood over the subtelomere. Simultaneously, the repressed portion of the shorter subtelomere in A is higher (in percent) compared to the subtelomere in B, and this should lead to more precocious aging. If for A, there is also a more significant baseline telomerase activity, which reduces telomere shortening, this may be insufficient to compensate for the greater portion of subtelomere repressed. Altogether, this could be an easy model to explain phenomena (i), (ii), and (vi) (Fig. 5 from (Libertini and Ferrara 2016), modified and redrawn)

telomere length below a critical size (Fossel 2004); “A minimum length of telomeric repeats is necessary for shelterin binding and protection (Blackburn 2001; de Lange 2005).” (Whittemore et al. 2019a, b), see also (Blackburn 2001; de Lange 2005)), while it is decisive telomere shortening, in terms of nucleic base pairs (bps) lost, and the consequent progressive inhibition of subtelomere, whose length is of critical importance (Fossel 2004; Libertini 2015b). The aforementioned phenomena, (i)–(vi), are illustrated and interpreted in Fig. 5.16 for phenomena (i), (ii), and (vi); in Fig. 5.17 for (iii) and (iv); and in Fig. 5.18 for (v). About the phenomenon described in (v), it is necessary to underline that for tissues and organs with quick cell turnover, there are alterations in the earlygenerations: “Subsequent results put the initial data in a different light (Lee et al. 1998; Rudolph et al. 1999; Blasco 2002). Early-generation mice were subtly abnormal and abnormalities increased with age (Herrera et al. 1999). Some first-generation mice had erosive dermatitis. Fertility problems become apparent by the fifth generation and there were no sixth-generation offspring. This was partially attributable to cell losses and organ changes in reproductive systems, but other organs with highly proliferative cells were similarly affected (Blasco 2002). Hematopoetic stem cell renewal diminished in vitro, although non demonstrably in peripheral or marrow histology. Responses to blood loss (Samper et al. 2002), wound healing (Rudolph

5.1 Description of the Subtelomere-Telomere Theory

197

Fig. 5.17 (A) and (B): two Mus strains with telomere length of 20 kb and 10 kb, respectively, while subtelomeres are identical. In case A, telomeres and their caps are longer than in case B, but the progressiveness of gradual cell senescence and the increment of the probability of activation of cell senescence are the same because they are in function of the progressive percent subtelomeric repression, which is the same, and not of the initial telomere length. (A) and (B) may also represent a donor animal and its clones with telomeres that are longer and shorter, respectively. This model may explain phenomena (iii) and (iv) (Fig. 5 from (Libertini 2015b), modified and redrawn)

et al. 1999), immune function (Blasco 2002), angiogenesis, and vascularization (Franco et al. 2002) were impaired. ...” (Fossel 2004, p. 35). So, in the wild, i.e., under unprotected natural conditions, it is likely that fitness would be significantly reduced by telomerase inactivity. It should also be considered that, in the comparison between the species, there is: (i) a direct relationship between initial telomere length and telomere shortening rate measured in bps lost each year in peripheral blood mononuclear cells; and (ii) an inverse relationship between this shortening rate and lifespan (Whittemore et al. 2019a, b) (Fig. 5.19).

198

5 Subtelomere-Telomere Aging Theory

Fig. 5.18 In telomerase knockout (mTR
/
) mice, in the first generation, the lengths of the telomeres and of their caps are equal to that of normal strains. As telomerase is inactive, in the following generations, telomeres and their caps become shorter (after 4–6 generations the telomeres become too short to allow viability). At any generation, the subtelomere length is constant, as it is not influenced by telomerase. For any generation, at each cell replication, the telomere shortens, and the sliding of the telomere cap progressively inhibits the subtelomere. So, as for the preceding figure, the subtelomere repression is a function of telomere shortening (i.e., the number of base pairs that are lost) and not of the initial telomere length (Fossel 2004). This explains phenomenon (v) (Fig. 6 from (Libertini 2015b), modified and redrawn) Fig. 5.19 The inverse relationship between lifespan and rate of telomere shortening (Fig. 5-G from (Whittemore et al. 2019a, b), modified and redrawn)

5.2 Metabolic Changes in Aging Cells

5.2

199

Metabolic Changes in Aging Cells

A series of characteristic alterations of aged cells have long been known. Hayflick in 1977 already reported the following list of metabolic changes observed in normal human fibroblasts aged in vitro (Hayflick 1977, pp. 169–71, Table 4, references omitted): Parameters that increase Glycogen content; Lipid content; Lipid synthesis; Protein content; RNA content; RNA turnover; Lysosomes and lysosomal enzymes; Heterogeneity in the length of division cycle; Heat lability of G6PD and 6 phosphogluconate dehydrogenase; Proportion of RNA and histone in chromatin; Activity of “chromatin-associated enzymes” (RNAase, DNAase, protease, nucleoside triphosphatase, DPN pyrophosphorylase); 5’ MNase activity; Esterase activity; Acid phosphatase band 3; Acid phosphatase; β-glucuronidase activity; Membrane-associated ATPase activity; Cell size and volume; Number and size of lysosomes; Glucose utilization; Prolongation of doubling time; Number of residual bodies; Cytoplasmic microfibrils, constricted and “empty”; Endoplasmic reticulum; Cyclic AMP level/mg protein; Protein component P8; Particulate intracellular fluorescence; Tolerance to sublethal radiation damage Parameters that decrease Glycolytic enzymes; Pentose phosphate shunt; Mucopolysaccharide synthesis; Transaminases; Collagen synthesis; DNA content; DNA synthesis; Nucleic acid synthesis; Collagen synthesis and collagenolytic activity; Lactic dehydrogenase isoenzyme pattern; Ribosomal RNA content; Incorporation of tritiated thymidine; RNA-synthesizing activity of chromatin; Alkaline phosphatase; Specific activity of lactic dehydrogenase; Rate of RNA synthesis; Synchronous division, constancy of interdivision time and motility; Rate of histone acetylation; Numbers of cells in the proliferating pool; Cell saturation density; Population doubling potential as a function of donor age; Proportion of mitochondria with completely transverse cristae; HLA specificities (cloned cells); Adherence to polymerizing fibrin and influence on fibrin retraction; Cyclic AMP level (molar values); Chromatin template activity; Rate of DNA chain elongation; Rate of DNA strand rejoining and repair rate Parameters that do not change

These metabolic alterations, whose list is undoubtedly incomplete (e.g., it is necessary to add the altered cellular secretions associated with cell senescence, known as senescence-associated secretory phenotype or SASP (Xu et al. 2015, b; Coppé et al. 2006)), has been updated in later times (e.g., (Kirkland and Tchkonia 2017)). They are the presumable manifestations of gradual cell senescence and cell senescence of part of the cells in the culture. However, the general interpretation of these alterations appears to be much more important than that of every single alteration. For non-adaptive aging theories, they are the consequence of the primary cause of aging proposed by each theory and are not reversible as a whole. By particular actions, it is possible to aim at partial reversibility of these alterations, or to a restrain in the progress of such alterations, but in general, they represent modifications that it is unlikely to presume as completely reversible. For the adaptive aging paradigm, according to the subtelomere-telomere theory, the mechanisms previously discussed based on the telomere-subtelomere-telomerase

200

5 Subtelomere-Telomere Aging Theory

Fig. 5.20 Different interpretations of metabolic alterations in aged cells for non adaptive and adaptive aging paradigms

system are the cause of these alterations. Furthermore, the alterations caused by the gradual cell senescence are completely reversible through the activation or reactivation of telomerase. Concerning cell senescence, which appears to be reversible only in its first phases (van Deursen 2014) and, afterward, in vitro and through particular artifices (Beauséjour et al. 2003), the elimination of senescent cells (using senolytic drugs) and the restoration of normal levels of cell turnover in principle should eliminate the effects of these alterations (Fig. 5.20).

5.3

Atrophic Syndrome

The telomere-subtelomere-telomerase system determines: (i) a progressive increase of the number of cells with altered functions and secretions due to gradual cell senescence or to cell senescence; (ii) limits in cell duplication capacity with the consequent progressive slowing of cell turnover. The direct and secondary alterations caused by these phenomena determine a progressive decay of all tissues and organs, described with the general term of “atrophic syndrome” and characterized by: “(a) reduced mean cell duplication capacity and slackened cell turnover; (b) reduced number of cells (atrophy); (c) substitution of missing specific cells with nonspecific cells; (d) hypertrophy of the remaining specific cells; (e) altered functions of cells with shortened telomeres or definitively in the noncycling state;

5.4 Limits in Cell Duplication Capacities and Other Effects of the. . .

201

(f) alterations of the surrounding milieu and of the cells depending on the functionality of the senescent or missing cells; (g) vulnerability to cancer because of dysfunctional telomere-induced instability ...” (Libertini 2014). The topic, barely mentioned here, is critically important as it is the root of all the alterations of the elderly persons and therefore will be described in more detail in the following Chapter 6 – Aging in the human species.

5.4

Limits in Cell Duplication Capacities and Other Effects of the Telomere-Subtelomere-Telomerase System Explained as a General Defense Against Cancer

If aging is a non-adaptive phenomenon caused by the cumulative and random effects of many degenerative phenomena, there is no need for mechanisms that progressively compromise the fitness (i.e., increase mortality). Therefore, mechanisms of this kind, if existing, would require specific justification. On the contrary, if aging is an adaptive and programmed phenomenon, mechanisms of this type are justified and absolutely necessary for the validity of this thesis (Libertini 2008). So, the existence of the mechanisms described before, which determine gradual cell senescence (progressive alteration of cell functions), cell senescence (replicative senescence + gradual cells senescence at the highest level), and increasing limits in cell duplication capacities, for non-adaptive (non-programmed) aging paradigm requires a general valid cause. It must be different from that proposed by the opposite (adaptive or programmed) paradigm, i.e., that they are mechanisms specifically defined and shaped by natural selection to determine aging. The question is not marginal or irrelevant. In the absence of such a general justification, the non-adaptive aging paradigm would become untenable and, so, much of what in gerontology and geriatrics is considered valid and accepted by most scholars should be entirely reconsidered. The only explanation proposed by the supporters of non-adaptive aging paradigm for the mechanisms mentioned above, or at least for part of them, is that limits in duplication capacities and decline of cellular functions with the number of duplications would be an important general defense against the uncontrolled proliferation of cells, i.e., against oncological diseases. According to this thesis, aging would only be an unpleasant and damaging collateral damage caused by a fundamental and absolutely necessary defense of the organism (Campisi 1997; Wright and Shay 2005; Rodier and Campisi 2011) (Fig. 5.21). This hypothesis has been more precisely described as a dramatic evolutionary trade-off between aging manifestations and the necessity of opposing cancer by drastic measures (Campisi 2000; Stone et al. 2016; Young 2018). This explanation appears to be consistent with what is proposed by two widespread theories of the non-programmed aging paradigm, i.e., antagonistic

202

5 Subtelomere-Telomere Aging Theory

Fig. 5.21 Woodring Wright (1949–2019) (on the left) and Jerry Shay

pleiotropy theory (Williams 1957; Rose 1991) and disposable soma theory (Kirkwood 1977; Kirkwood and Holliday 1979). Moreover, as modern medicine fights cancer even by crippling amputations and by devastating radiotherapeutic and chemotherapeutic treatment, why should we hesitate to accept the possibility that natural selection will fight oncological danger by aging mechanisms, which have a serious impact of similar gravity? However, various objections have been formulated against this explanation, and they appear to make it completely untenable (Fossel 2004; Libertini 2008, 2009b, 2013, 2019; Milewski 2010; Mitteldorf 2013). Now, it is opportune to describe, study in depth, and consider these objections briefly, given the importance of the implications deriving from their validity or groundlessness: 1. Many species that do not show any age-related increasing mortality at ages existing under natural conditions (e.g., rockfish, sturgeon, bivalve mollusks, turtles, certain perennial trees (Finch 1990)). The animals (or better, the species) without age-related increasing mortality are known as animals with “negligible senescence” (Finch 1990, p. 206). Apart from the fact that the non-programmed aging paradigm does not explain their existence, which appears not compatible with it (Libertini 2015a), it should be noticed that for these species, an increasing oncogenic risk is unlikely, as indirectly demonstrated by their constant mortality at any age. If we accept any of the non-programmed aging theories, we should also explain why a constant (and low) oncogenic risk may coexist with the absence of detectable aging while this is not true for species that show

5.4 Limits in Cell Duplication Capacities and Other Effects of the. . .

2.

3.

4.

5.

6.

203

age-related increasing mortality. This contradictions is an unsolved and robust inconsistency of the non-programmed aging thesis (Libertini 2008). In the wild, young individuals of animals with “negligible senescence” as rockfish species (Black 2002), rainbow trout and lobster (Klapper et al. 1998, b), have the same levels of telomerase activity shown by individuals of the same species with higher ages. As for these species there is a constant mortality rate at any age, an increasing age-related oncogenic risk is unlikely and so the possibility that for these species telomerase activity is oncogenic is implausible (Libertini 2008). “Telomerase is not an oncogene” (Harley 2002): (i) Increased telomerase activity, artificially induced in normal mice, determined increased longevity without a greater oncogenic risk (Bernardes de Jesus et al. 2012); (ii) In mice, the treatment with AAV9-Tert, which induced telomerase reactivation, did not lead to carcinogenesis (Whittemore et al. 2019a, b); and (iii) The absence of a relationship between telomerase activity and oncogenic risk is also demonstrated in other authoritative works (Tomás-Loba et al. 2008; Jaskelioff et al. 2011; MuñozLorente et al. 2018). Telomeres shorten at each duplication if telomerase is inactive. When telomere length reaches a low critical value, there is dysfunctional telomere-induced instability of chromosomal DNA molecules, which increases the vulnerability to cancer (DePinho 2000; Artandi 2002; Wu et al. 2003; Artandi and DePinho 2010; Ma et al. 2011). In subjects affected by Dyskeratosis congenita, a genetic syndrome where telomerase activity is compromised, a high incidence of cancer is observed (Dokal 2000). So, there is evidence that telomerase protects from cancer and is not an oncogenic factor. After the early phases of oncogenesis, it is common to observe an unrestrained telomerase activity, but this comes after and not before the onset of cancer (Fossel 2004): “The role of the telomere in chromosomal stability (Blagosklonny 2001; Campisi et al. 2001; Hackett et al. 2001) argues that telomerase protects against carcinogenesis (Chang et al. 2001; Gisselsson et al. 2002), especially early in carcinogenesis when genetic stability is critical (Elmore and Holt 2000; Kim and Hruszkewycz 2001; Rudolph et al. 2001), as well as protecting against aneuploidy and secondary speciation (Pathak et al. 2002). The role of telomerase depends on the stage of malignancy as well as cofactors (Ohmura et al. 2000); expression is late and permissive, not causal (Seger et al. 2002).” (Fossel 2004, p. 78). Cellular alterations determined by gradual cell senescence and by cell senescence (replicative senescence + gradual cell senescence at the highest level) weaken the capacities of the immune system (Fossel 2004). In a quite recent paper, though the authors proclaim that “Cellular senescence, a state of stable cell cycle arrest in response to cellular stress, is an indispensable mechanism to counter tumorigenesis by halting the proliferation of damaged cells”, they also declare that “However, through the secretion of an array of diverse cytokines, chemokines, growth factors, and proteases known as the senescence-associated secretory phenotype (SASP), senescent cells can paradoxically promote carcinogenesis. Consistent with this, removal of senescent cells delays the onset of cancer and prolongs

204

5 Subtelomere-Telomere Aging Theory

lifespan in vivo, potentially in part through SASP reduction.” (Ghosh and Capell 2016) The efficiency of the immune system manifests inverse relation with cancer incidence (Rosen 1985) and, about the age-related decline of this system (immunosenescence), it is accepted that: “Many changes in the immune system may decrease its capacity to combat the emerging or progressing tumor.” (Fülöp et al. 2013). It is illogical that mechanisms explained as a general defense against cancer weaken the defenses against it (Libertini and Ferrara 2016). Immunosenescence explains many characteristics of aging and of the development of age-related diseases (Fülöp et al. 2016). However, it is unlikely that immunosenescence is the primary cause of aging, as proposed by some authors (Fülöp et al. 2014), and not a consequence of aging mechanisms. 7. Cell senescence is characterized by the alterations of gradual cell senescence at the highest level and by replicative senescence (Fossel 2004). The block of replicative capacity could support the hypothesis that the phenomenon is a defense against cancer, but the senescence-associated secretory phenotype (SASP) increases oncogenic risk (Parrinello et al. 2005; Coppé et al. 2008). However, in mice, the selective elimination of senescent cells counters several age-dependent changes, increases lifespan, and determines a delay in the progression of malignant diseases (Baker et al. 2016). Moreover, “Senescent cells are present in premalignant lesions and sites of tissue damage and accumulate in tissues with age.” (Biran et al. 2017). Here, the supporters of the thesis that cell senescence counters cancer should explain why, well before the onset of cancer, senescent cells accumulate in the tissues of elderly persons and premalignant lesions, with inflammatory effects and an increased risk of cancer. In a recent work (Demaria et al. 2017), though the authors state that “Cellular senescence suppresses cancer by irreversibly arresting cell proliferation”, it is shown that, in anticancer therapies: “several chemotherapeutic drug induce [cell] senescence” but the elimination of these senescent cells induced by the therapy “reduced several short- and long-term effects of the drugs, including ... cancer recurrence ...” (Demaria et al. 2017). In short, cell senescence is hardly justifiable as a defense against cancer and, on the contrary, it is an oncogenic factor, as well underlined by Mitteldorf: “If cellular senescence is designed to cut off cancerous cell lines, why would senescent cells remain alive and toxic? They could, instead, be programmed to be good citizens and dismantle themselves via apoptosis to facilitate recycling of proteins and nutrients. The fact that senescent cells emit poisons is completely consonant with the theory that cellular senescence is a form of programmed organismal death. But from the perspective of the cancer theory, the poisoning of the body must be regarded as an unexplained evolutionary error.” (Mitteldorf 2013) 8. In a human population (the Ache of Paraguay) studied in the life conditions existing before the contact with modern populations, the survivors at age 70 were approximately 15–20% and before that age, no case of cancer was observed (Hill and Hurtado 1996). Only for very few older individuals not killed by other identified diseases, a malignant proliferation, although not reported, could have been a cause of death. While cancer is quite common in modern conditions, the

5.4 Limits in Cell Duplication Capacities and Other Effects of the. . .

205

Fig. 5.22 (A): total death rates for Ache population in the wild (Hill and Hurtado 1996); (B): possible maximal cancer death rates for the same population (figure 8 from (Libertini 2013), modified and redrawn). The causes of the substantial increment of death rates shown in A cannot be a defense against the causes of the much lower mortality shown in B

rarity of malignant disease in populations with ancestral styles of life is confirmed by some anecdotal testimonies by Price (1939): Dr. J. Romig, “a surgeon [of Anchorage] of great skill and with an experience among the Eskimos and the Indians, both the primitives and the modernized . . . stated that in his thirty-six years of contact with these people he had never seen a case of this type of disease among the truly primitive Eskimos and Indians, although it frequently occurs when they become modernized.” (Price 1939, p. 83). Dr. J. R. Nimmo, the government physician in charge for Torres Strait Islands people told Dr. Price that: “in his thirteen years with them he had not seen a single case of malignancy, and seen only one that he had suspected might be malignancy among the entire four thousand native populations. He stated that during this same period he had operated on several dozen malignancies for the white populations, which numbers about three hundred.” (Price 1939, p. 179). In comparing the total death rates of Ache people studied in the wild with the possible death rates by cancer in the same population (Fig. 5.22), it is evident that death rates caused by aging are always much higher than the death rates caused by cancer. Even with the comparison of the total death rates of Ache people in the wild with the non-natural high death rates by cancer in a modern populations (Fig. 5.23), the same observation is true. Therefore, it is strongly implausible that

206

5 Subtelomere-Telomere Aging Theory

Fig. 5.23 (A): total death rates for Ache population in the wild (Hill and Hurtado 1996); (B): observed cancer death rates in a modern population (General Register Office for Scotland 2010) (figure 8 from (Libertini 2013)). The causes of the substantial increment of mortality shown in A cannot be a defense against the causes of the much lower mortality shown in B. Although the death rates by cancer are much higher in modern populations than under natural conditions (due to many alterations of lifestyle and environment), they could not justify the many pre-deceased individuals by the effect of aging conceived as a defense against cancer

a hypothesized defense against cancer causes the death of most individuals before they are affected by an oncological disease (Libertini 2013). 9. For yeast (S. cerevisiae), which is a unicellular organism, the individuals of the mother lineage show a reduced capacity of duplication (not more than about 25–35 duplications (Jazwinski 1993)) and, proportionally to the number of duplications: (i) increasing metabolic alterations (Laun et al. 2001; Herker et al. 2004; Lesur and Campbell 2004; Büttner et al. 2006; Fabrizio and Longo 2008); and (ii) growing vulnerability to replicative senescence and apoptosis (Jazwinski 1993; Fabrizio and Longo 2007; Laun et al. 2007). These phenomena are considered as equivalent to the aging of multicellular organisms and phylogenetic relations have been described (Libertini 2015b). However, in yeast, it is impossible that these phenomena are a defense against cancer, because this is nonexistent in a unicellular species (Libertini 2015b). In short, the hypothesis that aging mechanisms (limits in cell duplication capacity, cell senescence, and gradual cell senescence) are a general defense against cancer is strongly contradicted by evidence. The implications of the untenability of the hypothesis for the soundness of the non-adaptive aging paradigm are underestimated or not discussed by the advocates of this paradigm. There are sporadic attempts to keep this hypothesis alive by dubious arguments:

5.5 The Telomere

207

(i) “The senescence response is widely recognized as a potent tumor suppressive mechanism. However, recent evidence strengthens the idea that it also drives both degenerative and hyperplastic pathologies [i.e., cancer], most likely by promoting chronic inflammation. Thus, the senescence response may be the result of antagonistically pleiotropic gene action” (Campisi 2013). The appeal to unproven phenomena of pleiotropic antagonism appears to be an ultimate resource for defending what is untenable. (ii) In another work, the authors observe, among other things, that: “At first glance, the idea that cellular senescence, an established anticancer mechanism, can promote cancer seems paradoxical. However, the evolutionary theory of antagonistic pleiotropy stipulates that a biological process can be both beneficial and deleterious, depending on the age of the organism ... recent evidence supports the idea that senescent cells can at least in principle fuel cancer, and provides a potential mechanism by which this might occur. ... senescent cells develop a secretory phenotype (SASP) that can affect the behavior of neighbouring cells. Strikingly, many SASP factors are known to stimulate phenotypes associated with aggressive cancer cells.” (Rodier and Campisi 2011) Here again, the pleiotropic antagonism is invoked to resolve evident contradictions, without even attempting to evaluate in quantitative terms the balance between advantages (anticancer effects) and disadvantages (carcinogenic effects, plus other disadvantages) of aging mechanisms. A hard comment on the validity of the thesis above is the following: “The hypothesis that telomerase is restricted to achieve a net increase in lifespan via cancer prevention is certainly false. Were it not for the unthinkability of the alternative – programmed death – the theory would be dead in the water.” (Mitteldorf 2013). The reason for the stubborn defense of the possible primary anticancer role of aging mechanisms by the advocates of the non-adaptive aging paradigm should be discussed. This persistency has been explained as a consequence of philosophical bias and the absence of alternative explanations compatible with the non-adaptive aging paradigm (Milewski 2010).

5.5

The Telomere

Most prokaryotes have circular and non-linear DNA in their chromosomes, and so there is no end for their DNA molecules (Volff and Altenbuchner 2000) (This solves the problem of incomplete end replication as pointed out by Olovnikov (Olovnikov 1971, 1973).) On the contrary, the chromosomal DNA of eukaryotic cells is linear, and so there are two ends for each DNA molecule. They were defined as telomeres (Muller 1938) (from the Greek words τελoς [telos, end] and μερoς [meros, part]), and are constituted by a specific short sequence (motif) repeated many times (Blackburn and Gall

208

5 Subtelomere-Telomere Aging Theory

1978; Moyzis et al. 1988; Blackburn 1991). This sequence is constant in each species and quite conserved in the course of evolution. Indeed, the database of telomeric sequences (Telomerase Database 2019) reports that all vertebrates have the same motif (TTAGGG), identified in 1988 (Moyzis et al. 1988), which is also common to many phylogenetically distant invertebrate species, e.g.: Cassiopeidae sp. (jellyfish) (Ojimi et al. 2009); Argopecten irradians (bay scallop) (Sinclair et al. 2007); Botryllus schlosseri (star ascidian) (Laird and Weissman 2004); Leishmania major (Teixeira and Gilson 2005); Trypanosoma brucei (Blackburn and Challoner 1984); Aspergillus fumigatus (Nierman et al. 2005); Nicotiana tabacum (common tobacco) (Weiss and Scherthan 2002); Othocallis siberica (Siberian squill) (Weiss-Schneeweiss et al. 2004). Slightly different sequences are widespread. For example, the TTAGG motif is present in: Stegobium paniceum (drugstore beetle) (Frydrychová et al. 2004); Bombyx mori (domestic silkworm) (Okazaki et al. 1993); Apis mellifera (honey bee) (Sahara et al. 1999); Manica yessensis (a species of ant) (Okazaki et al. 1993); Giardia lamblia (Morrison et al. 2007). On the contrary, some species have longer and quite different motifs, e.g.: ACGGATGTCTAACTTCTTGGTGT for Candida albicans (McEachern and Blackburn 1994); T(G)2-3(TG)1-6 for Saccharomyces cerevisiae (baker’s yeast) (Shampay et al. 1984). The significant conservation of the telomeric motif during evolution indicates the great physiological importance of the telomere. Unlike the great stability of the telomeric motif, telomere length, which is a function of the number of times the motif is repeated, shows a remarkable variety. In yeast telomere has a length of only about 450 base pairs (Runge and Zakian 1989), while among rodents (Seluanov et al. 2007) and, in general, among mammals (Gomes et al. 2011) telomere length goes from 8 up to 50 kb with considerable differences in telomere length. Moreover, even among individuals of the same species and chromosomes of the same cells there are differences: “... telomere lengths within the same cell are heterogeneous and certain chromosome arms typically have either short or long telomeres.” (Londoño-Vallejo et al. 2001). These differences in telomere length are inherited from the parents: in monozygotic twins, there are highly similar chromosome ends while this similarity is not found in dizygotic twins (Graakjaer et al. 2003; Hjelmborg et al. 2015). Most of the telomere is a double strand, but part of the G-rich strand has an overhang on the 50 -end, with a length from 50 to 280 nucleotides in humans and

5.5 The Telomere

209

Fig. 5.24 Above, scheme of the end part of the telomere drawn in extended form. One strand is rich in G nucleotide and is defined as G-strand, while the other strand, being richer of the complementary nucleotide, is defined as C-strand. The G-strand in its 30 end is longer than the other strand and this is described by saying that it has an overhang. Below, in a two-dimensional scheme, the end part of the telomere forms a particular loop, defined as a t-loop. The overhang of the G-strand creeps into the double strand region, coupling to a stretch of the C-strand, while the dislocated part of this strand forms what is called a d-loop (the lower part of the figure is from (Shubernetskaya and Olovnikov 2019a), Fig. 1, modified and redrawn)

much shorter (12–16 nucleotides) in the lower eukaryotes. The end part of the telomere forms a particular t-loop structure while the 30 -overhang aligns with part of the opposite strand, detaching the corresponding part of its strand and so forming a d-loop structure (Lewis and Wuttke 2012; Doksani et al. 2013) (Fig. 5.24). The 30 -overhang appears to have two essential functions: (i) interaction between telomere and the protein complex (shelterin) that protects telomere end, which is obtained through an oligosaccharide-oligonucleotide fold domain in the shelterin complex (Lewis and Wuttke 2012); and (ii) accessibility of the telomere for telomerase and other telomere-binding proteins, in particular for those that participate in the lengthening of telomeres (de Lange 2005; Lewis and Wuttke 2012; Doksani et al. 2013). The shelterin complex is composed of six proteins. Three of them (TRF1, TRF2, and POT1) interact directly with the telomeric sequence, while the other three (TIN2, TPP1, and Rap1) appear to connect the first three proteins and/or to have regulatory functions. The shelterin complex has two essential roles: (i) protection of telomere end; and (ii) recruitment of telomerase for the subsequent elongation of the telomere; and for these roles the interaction between shelterin proteins and the 30 -overhang appears essential (de Lange 2005; Ishikawa 2013; Jones et al. 2016; Lim et al. 2017) (Fig. 5.25).

210

5 Subtelomere-Telomere Aging Theory

Fig. 5.25 A scheme of the shelterin complex and the end part of the telomere as proposed in (Jones et al. 2016), Fig. 1, modified and redrawn

CST is another protein complex that is essential for telomere protection, duplication and elongation. It consists of a large subunit, CTC1 in humans and Cdc13 in yeast, and two smaller subunits, STN1 and TEN1, and binds to the single-strand DNA of the 30 -overhang in G-strand (Price et al. 2010; Stewart et al. 2012, 2018; Rice and Skordalakes 2016).

5.6

The Telomerase Enzyme

In 1971, Olovnikov pointed out that DNA replication by the enzyme DNA polymerase was incomplete because a small end of the telomere was left unduplicated and this would have led to the progressive shortening of the telomere (Olovnikov 1971). This problem that was subsequently highlighted also by Watson without citing the previous work (Watson 1972). In 1973, the necessity of a cellular mechanism capable of compensating for the shortening of DNA molecule was proposed by Olovnikov (1973). This happy prediction was confirmed – 12 years later – by discovering an enzyme, a ribonucleoprotein complex defined as telomerase, which was able to remedy the incomplete duplication of DNA molecule by repeatedly adding the specific motif of the telomeric sequence (Greider and Blackburn 1985). As a matter of fact, without telomerase action, in human somatic cells, telomeres shorten at a rate of 50–100 bps per population doubling (Harley et al. 1990; Ohki et al. 2001). Telomerase complex, or simply telomerase, is composed of (i) a reverse transcriptase catalytical subunit (TElomerase Reverse Transcriptase, TERT; hTERT for human TERT); (ii) a template-containing RNA component (TElomerase RNA, TER; hTER for human TER), which provides a template for the addition of the motif (TTAGGG for mammals); and (iii) other proteins, which assure proper telomere recognition and have regulatory roles (Blackburn et al. 2006; Nandakumar and Cech 2013; Ishaq et al. 2016; Armstrong and Tomita 2017; Schmidt et al. 2018). The difference among the species in the activity of TERT, the main component of telomerase, depends on the sequence specified in the telomerase RNA (TER) and on the regulatory actions of the other components (Blackburn et al. 2006; Nandakumar and Cech 2013). Some proteins (dyskerin, NOP10, NHP2, TCAB1, and GAR1) appear to be indispensable for telomerase activity in vivo (Lu et al. 2013; Dey and Chakrabarti 2018; Shubernetskaya and Olovnikov 2019b) (Fig. 5.26). Protein TCAB1 is

5.6 The Telomerase Enzyme

211

Fig. 5.26 Structure of the human telomerase complex in the interpretation of (Shubernetskaya and Olovnikov 2019b) (above) and (Dey and Chakrabarti 2018) (below) (figures from these papers have been modified and redrawn). The core of the telomerase complex is constituted by the catalytical subunit TERT and the template of telomerase RNA (TER). Associated factors, which are indispensable for the complex’s functionality, are the proteins dyskerin, NOP10, NHP2, TCAB1, and GAR1. For the protein TCAB1 as described by (Dey and Chakrabarti 2018), see the text

described by (Dey and Chakrabarti 2018) as a critical factor present in the so-called Cajal bodies and is essential for the complete maturation of telomerase RNA. Furthermore, for the formation and activation of the active telomerase complex, other proteins appear indispensable, and among these we have the chaperones P23 and HSP90, and some DNA-dependent ATPases as pontin and reptin (Venteicher et al. 2008; Schmidt and Cech 2015). The catalytic subunit of telomerase, TERT, is a reverse transcriptase that is homologous to other enzymes with a similar function, such as retrotransposon reverse transcriptases, which are widespread in the eukaryotic world, and retroviral reverse transcriptases (Belfort et al. 2011). This analogy has a robust functional confirmation. In fact, in some species which lack the telomerase enzyme (as in the case of Drosophila), there is an alternative mechanism, based on retrotransposon activity, to compensate for the lack of replication of part of the DNA molecule

212

5 Subtelomere-Telomere Aging Theory

(Pardue and DeBaryshe 2003; Belfort et al. 2011; Olovnikov et al. 2016; Kordyukova et al. 2018).

5.7

The Subtelomere

The subtelomeric sequence, or subtelomere, is that part of the chromosomal DNA molecule immediately preceding the telomere. The number of subtelomeres and telomeres is equal (one for each end of a DNA molecule, multiplied by two and by the number of chromosomes; i.e., for our species 2 ∙ 2 ∙ 23 ¼ 92). The subtelomeric sequence begins where the telomere ends, but there is no exact definition of where subtelomere ends and therefore no precise indication to determine subtelomere length. So, much of what is said about the subtelomere has some uncertainty. The definition proposed by Olovnikov et al. is the following: “Subtelomere is a highly variable domain at the end of a chromosomal arm, which is located between telomere and a gene-enriched chromosome body; subtelomere has a relatively small number of genes, but many repeats and segmental duplications and participates in intra- and inter-subtelomeric recombinations, which can spawn genetic diversity of species.” (Olovnikov et al. 2019). A definition of a more functional kind could be that subtelomere is the part of the chromosomal DNA immediately adjacent to the telomere, which is progressively repressed in relation to telomere shortening. As before discussed, it has been suggested that telomere is covered by a heterochromatin hood with a fixed size, which, as telomere shortens, slides over the subtelomere, progressively repressing particular regulatory sequences (Fossel 2004; Libertini 2014, 2015b), defined as “r” sequences (Libertini and Ferrara 2016). According to this definition the subtelomere should have a length that is not greater than the heterochromatin hood, which should be equal to the initial telomere length. However, if it is hypothesized that the “r” sequences trigger further regulations on sequences in a section adjacent to the subtelomere as just defined, the length of the repressed zone – directly or indirectly – in relation to the shortening of the telomere expands and the subtelomere becomes again not precisely defined. For the DNA adjacent to the telomere, in general defined simply as subtelomere, it would perhaps be appropriate to distinguish between (i) a section, immediately near the telomere, with limited length and where the hypothesized “r” sequences would exist; and (ii) a section subsequent to this, of greater length (variable from chromosome to chromosome and between each end of a chromosomal DNA molecule), where there could be further sequences regulated by the transcripts of the previous zone. The distinction between two subtelomeric sections, which for convenience of description could be defined as the Regulatory subtelomere section (“subtelomere R”) and the Amplifier subtelomere section (“subtelomere A”), might seem useless and too much hypothetical. Still, the evidence reported below will show that this distinction describes and allows us to interpret what is observed

5.7 The Subtelomere

213

better than if this distinction is absent. The key to understanding what is reported below is constituted by the following concepts: – The area immediately near the telomere where the hypothesized “r” sequences (TERRA sequences, “T-sequences”, in the following exposition; see below) are present is to be understood as the subtelomere R; – The adjacent section, more prolonged and very variable, which is influenced by the transcripts of “r” sequences (TERRA transcripts, “T-transcripts”, in the following exposition; see below) is to be understood as the subtelomere A. With these limits and premises, we have a series of data and general observations. The first group of them describes subtelomeric sequences without any internal distinction: – Lengths and sequences of subtelomeres differ between the two arms of a chromosome and among the chromosomes and vary according to the species (Olovnikov et al. 2019). – Subtelomeres have an “... unusual structure: patchworks of blocks that are duplicated ...” (Mefford and Trask 2002) and show “... long arrays of tandemly repeated satellite sequences.” (Torres et al. 2011), which have been reported for numerous animal and plant species (Spence et al. 1998; Kojima et al. 2002; Sharma and Raina 2005). – Human subtelomeres show a mosaic of multiple common sequences (more than 40 types), which contain various open reading frames (Riethman et al. 2005; Riethman 2008; Stong et al. 2014). – “Human subtelomeres are polymorphic patchworks of inter-chromosomal segmental duplications at the ends of chromosomes. ... Cytogenetics and sequence analyses reveal that pieces of the subtelomeric patchwork changed location and copy number during primate evolution with unprecedented frequency. Half of known subtelomeric sequence formed recently through human-specific sequence transfers and duplications. Subtelomeric dynamics result in a gene-duplication rate significantly higher than the genome average and could have both advantageous and pathological consequences in human biology.” (Linardopoulou et al. 2005) – “The highly variable subtelomeric repeat regions are filled with recently shuffled genomic segments, many of which contain sequences matching transcripts and transcript fragments; the rapid duplication and combinatorial evolution of these regions have generated an extremely diverse set of subtelomeric alleles in the human species, the complexity and potential significance of which is only beginning to be understood.” (Riethman et al. 2005) – In the study of human subtelomeres, “[o]f the 20.66 Mb of subtelomeric DNA analyzed, 3.01 Mb are subtelomeric repeat sequences (Srpt), and an additional 2.11 Mb are segmental duplications.” (Riethman et al. 2004) – Subtelomeres show a low gene density and in all human subtelomeres the number of single-copy genes does not exceed 300 (Riethman et al. 2004; Riethman 2008).

214

5 Subtelomere-Telomere Aging Theory

Fig. 5.27 Claus M. Azzalin

– Subtelomeric sequences are involved in pivotal cellular activities, including cell cycle regulation (Riethman et al. 2005; Podgornaya et al. 2018) and interactions with processes of uptake of nutrient and ion transportation (Ames et al. 2010; Brown et al. 2010; Bergström et al. 2014; Louis and Becker 2014). “All this taken together underlines the important role of subtelomere, able to function as a factor, which optimizes the work of different cellular systems.” (Olovnikov et al. 2019) In the second group of observations, significant and clarifying data have been obtained from the study of the so-called TERRA sequences (see below): – The first observations about the transcription of subtelomeric/telomeric sequences dates back to 1989 (for Trypanosoma brucei (Rudenko and Van der Ploeg 1989)) and 1994 (for birds’ lampbrush chromosomes (Solovei et al. 1994)). These sequences were defined TElomeric Repeat-containing RNA (TERRA sequences or, shortly, TERRA; for brevity, here, “T-sequences”) and described in our species (Azzalin et al. 2007; Schoeftner and Blasco 2008) (Fig. 5.27), Zebrafish (Schoeftner and Blasco 2008), mouse (Schoeftner and Blasco 2008), yeast (Luke et al. 2008; Bah et al. 2012; Greenwood and Cooper 2012), and plants (Vrbsky et al. 2010). In particular, it was underlined that “... TERRA is evolutionarily conserved in vertebrates.” (Azzalin and Lingner 2008) – In humans, a TERRA transcript (for brevity, here, “T-transcript”) is composed of UUAGGG repeats (the same of DNA TTAGGG telomeric motif where T is substituted by U, as it is the rule for RNA sequences), which is preceded, at its 50 end, by a specific subtelomeric sequence (Diman and Decottignies 2018) (Fig. 5.28). The length of T-transcripts depends on the different lengths of subtelomeric T-sequences 50 ends (Feuerhahn et al. 2010; Porro et al. 2010). “The first human subtelomeric promoters that were identified comprise CpG dinucleotide-rich DNA islands shared among multiple chromosome ends

5.7 The Subtelomere

215

Fig. 5.28 Anabelle Decottignies

(Nergadze et al. 2009). These CpG islands are characterized by the presence of the so-called 61-29-37 repeats located directly upstream of TERRA Transcription Start Site (TSS) and at ~1 kb from the telomeric tract (Brown et al. 1990; Nergadze et al. 2009).” (Diman and Decottignies 2018) – “The pro-terminal DNA sequences associated with the long-arm telomeres of human chromosomes X/Y (Xq/Yq) and 10 (10q) were isolated nearly 20 years ago and named TelBam3.4 and TelSau2.0, respectively (Brown et al. 1990). The two sequences share a conserved repetitive region that extends for about 1.6 kb (nucleotides 2110–3117) and about 1.3 kb (nucleotides 408–1789) until about 280 nucleotides (nt) upstream of the terminal array in TelBam3.4 and TelSau2.0, respectively .... This conserved region contains three different repetitive DNA tracts: the most centromere-proximal tract comprises tandemly repeated 61-basepair (bp) units (five repeats in TelBam3.4 versus six repeats in TelSau2.0); a second, more distal tract comprises 29-bp tandem repeats (nine repeats versus 18 repeats); a third tract comprises five tandemly repeated 37-bp DNA units in both sequences ... We refer to the tandem repeat-containing region as ‘61-29-37 repeats’ and to the about 280 nt comprised between the last 37-bp repeat and the telomeric hexamers as ‘pre-tel’ ” (Nergadze et al. 2009) – In mammals, T-transcripts, which are observed only in cellular nuclear fractions, show telomeric 50 -UUAGGG-30 RNA repeats, with a length that goes from about 100 bases up to more than 9 kilobases (Azzalin et al. 2007; Schoeftner and Blasco 2008). TERRA transcription is operated by RNA polymerase II (RNAPII), which starts from subtelomeric DNA and proceeds toward telomeric repeat sequences, including some of these sequences (Azzalin et al. 2007; Schoeftner and Blasco 2008). – The long noncoding RNAs defined as T-sequences are a general feature of eukaryotic cells and “are emerging as new key players in several important

216

5 Subtelomere-Telomere Aging Theory

Fig. 5.29 Joachim Lingner

biological processes” (Diman and Decottignies 2018). The transcription of T-sequences appears to be originated from subtelomeric promoters located on at least two-thirds of chromosome ends (Nergadze et al. 2009; Deng et al. 2012; Porro et al. 2014; Diman et al. 2016; Feretzaki and Lingner 2017) (Fig. 5.29). – The binding sites of T-transcripts are found outside of subtelomeres and telomeres (mostly in intergenic and intronic sections of the genome), where the transcripts appear to regulate gene expression and play an important role. Moreover, in mouse embryonic stem cells, the depletion of T-transcripts was associated with reduced protection of telomeres (Chu et al. 2017, b) (Fig. 5.30). “TERRA read coverage was high within subtelomeric regions of nearly all chromosomes (Chr), most prominently Chr. 2, 9, 13, 18, and the sex chromosomes, with targets being as much as tens of kilobases away from the telomeric repeat ... TERRA also bound within internal chromosomal regions and within genes, where it favored introns ... TERRA binds chromatin targets throughout the genome. ... TERRA binds both in cis at telomeres and in trans within or near genes” (Chu et al. 2017). There is the demonstration of “... significant changes in expression of TERRA targets relative to non-targets after TERRA depletion ..., indicating that TERRA target genes were more likely to be affected by TERRA depletion. ... Interestingly, subtelomeric target genes were consistently downregulated ... Internal target genes could either be up- or down-regulated ... In the mouse ES [embryonic stem] cell genome, we identified thousands of cis and trans chromatin binding sites” (Chu et al. 2017). “TERRA binds to many genomic loci outside telomeres where the non coding DNA appears to play important regulatory functions related to gene expression (Chu et al. 2017, b).” (Diman and Decottignies 2018) “The vast majority of TERRA-binding sites were

5.8 The Heterochromatin Hood Over the Telomere

217

Fig. 5.30 Hsueh-Ping Chu

found outside of telomeres, mostly in distal intergenic and intronic regions of the genome where TERRA regulates gene expression. Importantly however, TERRA depletion in ES cells was also associated with telomere deprotection, suggesting that TERRA is nevertheless important for mouse telomeric integrity (Chu et al. 2017).” (Diman and Decottignies 2018) – “Cycling endurance exercise, which is associated with AMPK activation, increased TERRA levels in skeletal muscle biopsies obtained from 10 healthy young volunteers. The data support the idea that exercise may protect against aging.” (Diman et al. 2016) Some of these findings are summarized in Figs. 5.31 and 5.32. Since T-sequences are originated mainly from the subtelomeric sequence, their definition as TElomeric Repeat-containing RNA is imprecise and it would be more accurate to say subTElomeric-Repeat-containing RNA. A definition addressed to the description and importance of such sequences could be “subtelomeric cellular primary regulatory sequences”. The great importance of T-sequences has been underlined in a recent review (Libertini et al. 2020).

5.8

The Heterochromatin Hood Over the Telomere

Phenomena related to telomere shortening have some peculiarities that need appropriate explanations: 1. When not repressed, the telomerase complex, lengthens the telomere by adding several times the motif that characterizes the telomere. For example, in a species

218

5 Subtelomere-Telomere Aging Theory

Fig. 5.31 This figure is a new interpretation of Fig. 5.13. The hypothesized “r” sequences are now the T-sequences (TelBam3.4, TelSau2.0 and other possible subtelomeric sequences), which are part of subtelomere R; the intermediate molecules are the T-transcripts, which act (up-regulation) on genes that are near the subtelomere (subtelomere A) (actions 1), or in another part of the chromosome (up- or down-regulation) (actions 2); the hypothesized effect of intermediate molecules on the capped/uncapped state of the telomere is shown to be an effect of T-transcripts on telomere protection (actions 3). These effects are on the same DNA molecule (actions of type a) or on other DNA molecules of the same cell (actions of type b). T-sequences progressive repression causes a reduced action of T-transcripts and thus gradual cell senescence and an increasing probability of cell senescence

with the TTAGGG motif (as in vertebrates (Moyzis et al. 1988)), which has a length of 6 bps, if the duplication of DNA molecule causes a shortening of 60 bps, the telomerase should add 10 times the motif mentioned above to restore the pre-existing length. However, how does the telomerase complex recognize the exact number of motifs that must be added to restore the original length and not operate an unlimited telomere elongationan? 2. Whatever is the mechanism that restrains telomerase activity, it must somehow recognize the previous length of the telomere, which, besides being different depending on the species (e.g., for the differences among mammals, see (Gomes et al. 2011)), is known to have an initial length varying from chromosome to chromosome, between one arm and the other of the same molecule of chromosomal DNA, and between corresponding telomeres of different individuals (Londoño-Vallejo et al. 2001) (Fig. 5.33). 3. It is known that telomere shortening is related to: (i) an increasing probability of replicative senescence (Blackburn 2000), which is part of the cell senescence

5.8 The Heterochromatin Hood Over the Telomere

219

Fig. 5.32 A very simplified diagram of T-sequences’ actions (only three telomeres and few actions of T-sequences are shown)

Fig. 5.33 In a cell, the telomere length may vary between the two arms of the same chromosome and among the chromosomes. The section of DNA adjacent to telomere and repressed in relation to telomere shortening (subtelomere R, where there are the T-sequences) should be not longer than the possible telomere shortening and, likely, of quite uniform length. The subsequent section of DNA (subtelomere A, where there are amplifier sequences activated by T-transcripts) might be of any length and vary from arm to arm of a chromosome and among chromosomes

program (Ben-Porath and Weinberg 2005); (ii) the repression of genes located in the immediate vicinity of the telomere (telomeric position effect) (Gottschling et al. 1990), as also shown by (Surace et al. 2014); and (iii) the increase in alterations of cellular functions, which is in practice a telomeric position effect (Robin et al. 2014) and has been defined as “gradual cell senescence” (Libertini 2014, 2015b). If these effects cause part or all the manifestations of aging, how is it possible to explain that there are analogous rhythms of aging in: (i) two Mus strains with a vast difference in the average initial length of telomeres (10 and 20 kb) (Fossel 2004, p. 60); and (ii) donor animals and animals obtained from clones of donor somatic cells, which have shorter telomeres of the germ cells

220

5 Subtelomere-Telomere Aging Theory

(Kubota et al. 2000; Lanza et al. 2001; Fossel 2004, p. 60)? The effects mentioned above, and aging that is their likely consequence, appear related to telomere shortening (i.e., the number of bps that have been lost) and not to the average initial length of the telomeres. Moreover, the absence of a relationship between longevity and telomere length has been highlighted among the rodents (Seluanov et al. 2007), and an inverse correlation was even shown in subsequent research extended to 60 species of mammals (Gomes et al. 2011). 4. To the phenomena described above, it is essential to add what has been observed in the yeast. For normal (wild) strains of yeast, where telomerase is always perfectly active and therefore there is no telomere shortening, in individuals of the mother lineage, there is the accumulation, related to the number of duplications, of particular molecular complexes (extrachromosomal ribosomal DNA circles, ERCs) on the subtelomere (Sinclair and Guarente 1997). This accumulation appears to determine the progressive alteration of cellular functions and an increasing probability of apoptosis (Lesur and Campbell 2004). Therefore, the alterations mentioned earlier would be associated with the repression of the subtelomere operated by ERCs. In particular yeast mutants (tlc1Δ mutants), telomerase is inactive and the telomere therefore shortens at each generation. In individuals of the daughter lineage of such mutants, in which there is no accumulation of ERCs as for normal strains, in proportion to the number of previous duplications, there are the same alterations observed in the cells of mother lineage of normal strains (Lesur and Campbell 2004). This fact is presumably due to similar repression of the subtelomere. All these phenomena would require a kind of register where the initial lengths of all telomeres in the first cell of the organism are recorded. Subsequently: (A) for the cells where the telomerase is fully active, as the telomeres shorten at each replication, a particular mechanism should count the number of bps lost by each telomere and interact with the telomerase complex, distinctly for each telomere, determining how many motifs must be added to compensate the lost bps. Moreover, if the telomere is excessively elongated, the hypothetical register should indicate how many bps must be removed; (B) for the cells where the telomerase is inactive or partially active, the same mechanism (or another similar) should count the number of bps lost by each telomere and, in proportion to this number, determine (i) the degree of telomeric position effect/gradual cell senescence; (ii) the probability of triggering cell senescence program and so replicative senescence; and (iii) if telomerase is partially active, how many motifs must be added to partially compensate those lost. A possible simpler explanation of all these phenomena is the following. Let us imagine that: 1. in the first cell of a multicellular organism, in a phase that may be defined as “reset phase”, a sort of molecular hood is formed for each telomere of the cell. The size of a hood is proportional to telomere length, which protects and represses

5.8 The Heterochromatin Hood Over the Telomere

221

underlying DNA starting from the end of the telomere and for a length proportional to the size of the hood; 2. at each subsequent cell division, the cap mentioned above is faithfully duplicated and not reduced in its size if the telomere shortens. At the same time, if the telomere is excessively elongated, the size of the hood would indicate how many bps must be removed; 3. as the telomere shortens, the cap – which we have hypothesized to be of fixed size – slides over the subtelomere and gradually covers an increasing portion of it, so causing a progressive inhibition of the subtelomere; 4. the portions of DNA adjacent to the telomeres, each of them defined as a subtelomere A, have sequences with general regulatory actions for the complex of cellular functions; These conditions would allow us to explain the set of phenomena mentioned above. Moreover, in the case of yeast: (i) for normal strains, in cells of the mother lineage, the subtelomeric regulatory sequences are repressed by ERCs; (ii) for tlc1Δ mutant strains, in cells of the daughter lineage, the telomere shortens and the hood represses increasing portions of the subtelomeric regulatory sequences with effects that are identical to those operated by the ERCs. About the hypothesized cap/hood over the telomere: 1. Blackburn suggested that the telomere forms with “sequence-specific DNA-binding proteins” a “telomeric DNA-protein complex”. This complex oscillates between two states. When the telomere is “capped”, i.e., when protein and nucleic components are bound, it is protected from the transition to replicative senescence and the cell remains in the condition defined as “cycling state”. On the contrary, when the telomere is “uncapped”, i.e., when protein and nucleic components are at least partially unbound, it is vulnerable to replicative senescence (“non-cycling state”) (Blackburn 2000). Moreover, Blackburn’s hypothesis implicitly required that the stability of the bond between cap and telomere had to be directly correlated with telomere length, and so that there had to be some regulation influenced by the telomere length. 2. As already highlighted in the Subsection 5.1.4 – Gradual cell senescence and cell senescence, in 2004 Fossel proposed the existence of a “heterochromatin hood” covering the telomere. This hypothetical structure was “invariant in size” and, as the telomere shortened, it slid on part of the subtelomeric sequence causing “an alteration of transcription” of the sequence covered. Moreover, in the subtelomeric sequence, as already cited, the “silenced genes may in turn modulate other, more distant genes (or sets of genes). There is some direct evidence for such modulation in the subtelomere ...” (Fossel 2004, p. 50) There are various theoretical arguments, originated by empirical observations, that manifest the absolute necessity of a heterochromatin hood, which here is not defined in its real structure. Alternatively, it would be necessary to hypothesize a

222

5 Subtelomere-Telomere Aging Theory

Fig. 5.34 Above: possible diagram of the heterochromatin hood. Below: Fig. 1, part B, from (Stewart et al. 2012), which has inspired this suggestion

series of elements or mechanisms that perform the functions mentioned above hypothesized for this hood. At the moment there is no precise idea of the formation and structure of this hypothetical hood. However, it should have some precise features: – The first hood formation, in the “reset phase” of the first cell of an organism, must be modeled proportionally to the length of each telomere. So the number of hoods in a cell is equal to the number of telomeres and the size is different depending on the initial length of each telomere. – In the subsequent replications, each hood is duplicated maintaining its initial size; – When the telomere shortens, the hood progressively represses the subtelomere (precisely the subtelomere R) inhibiting the activity of “r” sequences (i.e., repressing the T-sequences and so the production of T-transcripts); – The effects of T-sequences repression must include the reduction of the bond between hood and telomere, i.e., the protection of the telomere, and so an increasing possibility of activating the cell senescence program. A possible clue for the structure of the heterochromatin hood could be the fact that the telomere is covered by a series of shelterin complexes (as already said, composed of the proteins TRF1, TRF2, RAP1, TIN2, TPP1, and POT1 (Jones et al. 2016)). The main part of the hood could be a chain of shelterin complexes connected by POT1 protein of one complex and TRF1-TIN2 proteins of the next complex, while the last POT1 protein is connected to the 30 -overhang of the G-strand (Fig. 5.34). One fact supporting this hypothesis is that: “Telomere uncapping through either TRF2 shelterin protein knockdown or exposure to telomere G-strand DNA oligonucleotides significantly increases the transcription of TERRA, ...” (Caslini et al. 2009). About the fixed size of a hypothetical hood composed of a chain of shelterin complexes, in subsection 5.1.4 – Gradual cell senescence and cell senescence, evidence supporting this thesis proposed in an authoritative work (Takai et al. 2010) has been point out.

5.8 The Heterochromatin Hood Over the Telomere

223

However, this cover should have a unique duplication mechanism that does not alter the chain’s length. Concerning the inhibition of the subtelomere R, i.e., of T-sequences, it is necessary to consider that: – With regard to the relationship between telomere shortening and subtelomere repression, it is interesting to note that, in mice, telomere shortening is related to changes in methylation conditions of subtelomeric DNA, and to modifications of histones both of subtelomeres and telomeres (Blasco 2007). “Furthermore, the abrogation of master epigenetic regulators, such as histone methyltransferases and DNA methyltransferases, correlates with loss of telomere-length control, and telomere shortening to a critical length affects the epigenetic status of telomeres and subtelomeres.” (Blasco 2007) – In human leukocytes, as telomeres shorten, the methylation levels of many gene promoters in subtelomeric regions appear to decrease (“... shorter telomeres are associated with decreased methylation levels of multiple cytosine sites located within 4 Mb of telomeres ... significant enrichment of positively associated methylated CpG sites in subtelomeric loci (within 4 Mb of the telomere) (P < 0.01)” (Buxton et al. 2014)), determining modifications in gene expression and increasing the risk of age-related diseases (Buxton et al. 2014). – “Both healthy controls and sarcoidosis patients showed that long telomeres (>9.4 kb) decrease and short telomeres ( type-2 diabetes mellitus; lens epithelial cells > cataract; osteocytes -> osteoporosis; various types of derma cells -> skin atrophy and regional atrophy of subcutaneous tissue (Martin and Oshima 2000). While some cell types show rapid turnover and require telomerase activity, “some tissues that have the capacity for cellular replacement, but do not undergo continuous

306

7

The Elderly Subjects and Their Troubles

cell turnover, do not express telomerase in their cellular progenitors. It is these tissues – such as the deep layers of the skin or the lining of the blood vessels – that might be expected to suffer most from age-associated telomere depletion, as they have no ability to regenerate telomeres. These tissues would also be greatly affected by defects in other pathways that maintain telomeres, such as DNA-recombination processes. This might explain why Werner syndrome, in which an enzyme involved in DNA processing is affected, yields a closer version of normal (if premature) ageing than does dyskeratosis congenita. In people with dyskeratosis congenita and in telomerase-deficient mice, it is tissues that normally express telomerase that one would predict to suffer most from its loss, and this proves to be the case.” (Marciniak and Guarente 2001) In short, DC and WS are two model cases of segmental progeria, which is the altered functionality in the duplication physiology of only a part of cell phenotypes (Fossel 2004). E.g., for WS patients, no association is observed with Alzheimer’s disease, which, on the contrary, is common in the elders and the rule in very old subjects. These facts are summarized in Table 7.3.

7.5

Diseases Deriving from ‘Extremes’ of the Ecological Niche and Relations with Other Living Beings

In every period of life there are cases of illness or death related to: (i) traumas; burns; downing and asphyxia; etc., which can be defined as extreme conditions of the ecological niche to which the organism is not adapted (“III – Diseases deriving from ‘extremes’ of the ecological niche”); and (ii) infections, infestations or damages caused by relationships with other living beings (“IV – Diseases deriving from relations with other living beings”). For older individuals, these cases, in comparison with their occurrence in young and mature ages, are characterized by the greater vulnerability to run into such events and the lesser resistance to overcoming their consequences. According to the definition of aging, with increasing age, the organism is less and less efficient in its functions and less and less able to avoid harmful events and tolerate their consequences. However, the greater experience, for certain events and up to a certain point, can compensate partially for the lower efficiency. With age, athletic performance decreases as well as the ability to overcome an opponent in a fight, escape the attack of a wild animal, avoid a ruinous fall, etc. Aging also reduces resistance to infections, harmful food or the attack of a poisonous animal. Due to its lower overall efficiency, the organism is less able to limit and overcome the effects of a harmful event by returning to the pre-existing condition of efficiency. A fall in older age can cause damage, such as fractures, for which there is greater resistance in previous ages. A young or mature individual may easily get over an

7.5 Diseases Deriving from ‘Extremes’ of the Ecological Niche and Relations. . .

307

Table 7.3 Manifestations of aging and of its pathologies

Cell type Alveolar type II cells

Bone marrow Cardiac myocytes Endothelial cells

Epidermis and dermis cells

Manifestations of aging (Tallis et al. 1998; Fillit et al. 2017) Emphysema

Reduction of various cell types Cardiac insufficiency Atherosclerosis (! myocardial infarction and other vascular problems) Skin atrophy

Glomerular cells

Renal insufficiency

Hair

Progressive baldness Hepatic atrophy

Hepatocytes

Intestinal cells Lens epithelial cells

Intestinal atrophy Cataract

Microglia cells

Alzheimer’s diseases (AD)

Myocytes

Muscle atrophy

“Risk factors” and their effects (see section 7.7 – Diseases caused by mismatches that speed up physiological aging) Smoking, chronic inhalation of noxious substances (chronic bronchitis, emphysema);

Werner syndrome (Martin and Oshima 2000)

Dyskeratosis congenita (Marciniak and Guarente 2001) Fibrosis

Failure to produce blood cells Myocarditis (! dilatative cardiomyopathy) Smoking, hypertension, dyslipidemia, diabetes, alcohol abuse (! atherosclerosis)

Atherosclerosis, arteriolosclerosis and atherosclerosis, myocardial infarction Skin atrophy, regional atrophy of subcutaneous tissue, ulcerations in parts exposed to traumas

Abnormal pigmentation, nail dystrophy

The same as for endothelial cells (! renal insufficiency) Premature greying and thinning of hair Chronic hepatitis, alcoholism (! cirrhosis)

Exposure of the eye to radiations (! cataract) The same as for endothelial cells (! AD) Specific genetic defects (! muscular dystrophies)

Alopecia Cirrhosis, hepatic carcinoma Gut disorders

Cataract

Muscle atrophy

(continued)

308

7

The Elderly Subjects and Their Troubles

Table 7.3 (continued)

Cell type Oral cavity

Manifestations of aging (Tallis et al. 1998; Fillit et al. 2017) Atrophy of the mucosa

Osteoblasts Pancreatic β-cells

Osteoporosis Latent or mild diabetes

Retina pigmented cells Testes and ovary

Age-related macular degeneration (AMD) Diminished fertility, testicular atrophy

“Risk factors” and their effects (see section 7.7 – Diseases caused by mismatches that speed up physiological aging)

Unhealthy alimentation (! type 2 diabetes mellitus) The same as for endothelial cells (! AMD)

Werner syndrome (Martin and Oshima 2000)

Dyskeratosis congenita (Marciniak and Guarente 2001) Leukoplakia (precancerous oral lesions)

Osteoporosis Type 2 diabetes mellitus

Diminished fertility, premature testicular atrophy, probably accelerated loss of primordial ovarian follicles

Hypogonadism

From Libertini (2014), modified

infection, while the same infection may be severe or even fatal for elderly persons whose organism has reduced efficiency. When the functionality of the organism drops below critical levels, even slight accidents may cause serious injuries, even fatal ones. The typical case is the disastrous fall of an elderly person that causes a femur fracture. The severe structural weakening of the bones, the atrophy of the muscular masses, and the reduced ability of neuromotor coordination, all alterations that are part of aging manifestations, are certainly the determining cause of the disastrous event. So, it is rational to classify it, and other similar events, not in the category “III – Diseases deriving from ‘extremes’ of the ecological niche” but in the category “V – Physiologic phenomena that causes troubles and sufferings”, subcategory “(E) Slow phenoptosis or aging”. Similarly, it can be argued for an infection that does not cause significant damage in the young while may determine a serious illness and even death in the elderly. Also, in this case, the most rational classification is that of category V, subcategory E. But an important question immediately arises. By definition, aging, i.e., the progressive reduction of fitness, is not an event that, at a certain age, abruptly reduces fitness to critical values. On the contrary, it manifests itself in the beginning with a small and almost imperceptible fitness decline and then with a slowly increasing acceleration of this decline. In our species, fitness reduction can be measured starting from the age of thirty by the observation of mortality increase, both in natural conditions and – to a lesser extent – in modern

7.6 Diseases Caused by Mismatches

309

living conditions, and of the decline in athletic performance, as well observed by Williams a long time ago: “No one would consider a man in his thirties senile, yet, according to athletic records and life tables, senescence is rampant during this decade” (Williams 1957). When, in the initial phases of fitness decline, the reduction in the organism’s efficiency is minimal, the prevailing factor that determines the onset of a disease and its severity is the intensity of the harmful event and not the organism’s impairment. At later ages, when the reduction in efficiency becomes significant and such as to seriously compromise the ability to survive in natural conditions, the decisive factor is the severity of the organism’s impairment and not the intensity of the harmful event. However, the necessary distinction between the two cases is certainly arbitrary. A possible parameter that might act as an arbitrary divide between the two cases is the age when the mortality rate in natural conditions gets the value of 15%/year, which corresponds to a 30% reduction in athletic performance, measured by the available world records. These conditions are reached around 75 years of age (Hill and Hurtado 1996; Wikipedia 2018), with the obvious individual variability characteristic of all biological phenomena. In addition to this parameter, it is also necessary to consider the type and circumstances of the adverse event. For example, in the case of a severe and unpredictable accident that is certainly harmful at any age and where the efficiency of the individual reaction is negligible, it is rational to attribute the pathology to category III for elderly persons too. On the contrary, for troubles or deaths determined by harmful events that are easily avoidable or do not cause significant damage at a young age and, on the contrary, in old age, are frequent for the vulnerability of the subjects and cause significant damage or death, they should be classified in the category V, subcategory E (i.e., aging).

7.6

Diseases Caused by Mismatches

In Chapter 3 – Evolutionary medicine, particularly in Section 3.4 – The concept of mismatch in evolutionary medicine, the concept of disease caused by mismatch was expounded and discussed. This type of illness is a consequence of an unsuitable coupling (mismatch) between living conditions to which a species is adapted and new living conditions (lifestyle, nutrition, working conditions, etc.). In Section 3.5 – Diseases caused by mismatches, the diseases caused by mismatches have been discussed and, in particular, in Table 3.1, a list of some of the diseases caused by mismatch conditions is reported. In Section 3.8 – Immune disorders in the interpretation of evolutionary medicine, the topic of immune system disorders (allergic diseases and autoimmune diseases) was discussed as a consequence of particular conditions of mismatch that lead to ruinous alterations of the organism’s microbiome and parasite eradication, events causing numerous and often serious diseases.

310

7

The Elderly Subjects and Their Troubles

Indeed, many, even dangerous, disabling, or deadly diseases, originate from mismatch conditions. They can occur in pre-senile or senile age, but also when they occur in pre-senile age, they often are protracted and worsen in old age, becoming, in modern conditions, the prevailing burden of that age. For example, type 2 diabetes mellitus, which originates from unhealthy types of modern nutrition to which our species is not adapted, often manifests itself in pre-senile age but over time leads to severe complications (for example, deriving from alterations of the arterial circulation of heart, brain, and other organs) which become common in old age. Under natural conditions, most of the deaths in adults, as it appears in the data from the study of the Ache (Hill and Hurtado 1996), is due to “Violence and accidents” and then to a lesser extent to “Infections/Intoxications” (s. Table 7.1). Under modern living conditions, these causes of death have become secondary, while a series of mismatches between the adaptation of the species and new living conditions have become largely prevalent as the primary cause of disease and death. Table 7.4 shows the causes of death worldwide in 2017, according to WHO data (World Ranking Total Deaths 2017). Extrapolating the data from this table, Table 7.5 shows the number of deaths due to violence or accidents. In modern conditions, they are around 9% while, for the Ache people in the wild, they are about two-thirds of the deaths from the age of 15 onwards (s. Table 7.1). Table 7.6 extrapolates the number of deaths, about 42.35%, due to part of the diseases caused by mismatch conditions, excluding (i) the cases of cancer, and (ii) other pathologies badly distinguishable from more general voices. Table 7.7 extrapolates the cases of death due to neoplasms, approximately 15.01%, largely due to mismatch conditions, a strong statement with its first proof in the minimal incidence of such pathologies in populations living under natural conditions (s. data from Ache people). Summing the values of the mortality incidences in the last two tables, we have an incidence, estimated by default, of about 57% of mortality due to mismatch conditions. The evaluation is by default because among other things: (i) there are autoimmune diseases of various organs, also deriving from mismatch conditions, which are not considered in this sum as they are classified indistinctly under various headings; and (ii) the widespread diffusion and mortality of various infectious diseases is due in part to the strong demographic density in modern times that is not balanced, in many parts of the world, by suitable hygiene measures. This causes, in adulthood, higher mortality from infectious diseases in comparison with people living in primitive conditions (see data of the Ache people). In short, in modern populations, the mortality attributable to mismatch conditions is largely prevalent compared to other causes of illness and can be estimated to more than two-thirds of general mortality. This is also valid for the age of senility because mismatches that often cause diseases starting from pre-senile ages over time continue to determine the onset of new cases, while the previous cases aggravate.

7.6 Diseases Caused by Mismatches

311

Table 7.4 Causes of death, number of deaths, and global incidence according to WHO data (World Ranking Total Deaths 2017) deaths due to neoplasms (caused mainly by mismatch conditions)

deaths due to violence and accidents

Disease Rank Deaths Coronary Heart Disease 1 8,727,670 Stroke 2 6,221,072 Influenza and Pneumonia 3 3,177,204 Lung Disease 4 3,162,054 Lung Cancers 5 1,683,893 Diabetes Mellitus 6 1,570,100 Alzheimer’s/Dementia 7 1,533,855 Diarrheal diseases 8 1,388,418 Tuberculosis 9 1,372,855 Road Traffic Accidents 10 1,339,206 Liver Disease 11 1,154,240 Kidney Disease 12 1,121,214 HIV/AIDS 13 1,059,626 Low Birth Weight 14 1,056,984 Hypertension 15 938,129 Suicide 16 783,407 Liver Cancer 17 777,816 Colon-Rectum Cancers 18 767,280 Stomach Cancer 19 749,806 Birth Trauma 20 690,870 Other Injuries 21 673,501 Congenital Anomalies 22 646,027 Falls 23 644,028 Breast Cancer 24 568,309 Violence 25 466,060 Malaria 26 439,026 Esophagus Cancer 27 413,123 Inflammatory/Heart 28 411,622 Endocrine Disorders 29 411,242 Asthma 30 382,288 Drownings 31 358,957 Pancreas Cancer 32 355,709 Prostate Cancer 33 342,090 Lymphomas 34 341,463 Malnutrition 35 330,105 Oral Cancer 36 315,707 Meningitis 37 314,965 Rheumatic Heart Disease 38 304,792 Maternal Conditions 39 303,269 Leukemia 40 288,470

% 17.17 12.24 6.25 6.22 3.31 3.09 3.02 2.73 2.70 2.63 2.27 2.21 2.08 2.08 1.85 1.54 1.53 1.51 1.47 1.36 1.32 1.27 1.27 1.12 0.92 0.86 0.81 0.81 0.81 0.75 0.71 0.70 0.67 0.67 0.65 0.62 0.62 0.60 0.60 0.57

Disease Cervical Cancer Peptic Ulcer Disease Other Neoplasms Bladder Cancer Fires Drug Use Ovary Cancer War Epilepsy Measles Alcohol Parkinson’s Disease Skin Cancers Poisonings Syphilis Skin Disease Encephalitis Hepatitis B Uterine Cancer Anemia Pertussis Tetanus Rheumatoid Arthritis Appendicitis Dengue Schistosomiasis Multiple Sclerosis Leishmaniasis Schizophrenia Leprosy Chagas disease Trypanosomiasis Upper Respiratory Otitis Media Hepatitis C Ascariasis Diphtheria Iodine Deficiency Oral conditions Chlamydia

deaths due to mismatch conditions (partial) Rank Deaths % 41 278,318 0.55 42 234,134 0.46 43 207,953 0.41 44 184,183 0.36 45 179,766 0.35 46 167,165 0.33 47 161,421 0.32 48 156,238 0.31 49 152,310 0.30 50 139,822 0.28 51 128,513 0.25 52 127,231 0.25 53 111,444 0.22 54 107,549 0.21 55 92,243 0.18 56 91,172 0.18 57 89,272 0.18 58 86,877 0.17 59 82,669 0.16 60 77,896 0.15 61 66,392 0.13 62 63,993 0.13 63 48,094 0.09 64 45,043 0.09 65 34,497 0.07 66 24,058 0.05 67 22,933 0.05 68 21,123 0.04 69 18,562 0.04 70 15,933 0.03 71 7,553 0.01 72 5,411 0.01 73 4,517 0.01 74 3,969 0.01 75 3,185 0.01 76 2,938 0.01 77 2,778 0.01 78 2,088 0.00 79 471 0.00 80 173 0.00 Total: 50,836,339 100.6

These concepts are important because many of the diseases and death cases in old age are not part of the physiological process of aging but are the consequence of mismatches between the adaptation of the species and new, too often unhealthy, living conditions.

312

7

The Elderly Subjects and Their Troubles

Table 7.5 Number of deaths due to violence or accidents

Disease Road Traffic Accidents Suicide Other Injuries Falls Violence Drownings Fires War

Rank 10 16 21 23 25 31 45 48 Total:

Deaths 1,339,206 783,407 673,501 644,028 466,060 358,957 179,766 156,238 4,601,163

% 2.63 1.54 1.32 1.27 0.92 0.71 0.35 0.31 9.05

Table 7.6 Number of deaths due to a part of the mismatch conditions, i.e., with the exclusion of the cases due to cancer and other diseases that cannot be distinguished from more general voices

Disease Coronary Heart Disease Stroke Lung Disease Diabetes Mellitus Hypertension Asthma Peptic Ulcer Disease Drug Use Alcohol Rheumatoid Arthritis Appendicitis Multiple Sclerosis

Rank 1 2 4 6 15 30 42 46 51 63 64 67 Total:

Deaths 8,727,670 6,221,072 3,162,054 1,570,100 938,129 382,288 234,134 167,165 128,513 48,094 45,043 22,933 21,647,195

% 17.17 12.24 6.22 3.09 1.85 0.75 0.46 0.33 0.25 0.09 0.09 0.05 42.35

Table 7.7 Number of deaths due to neoplasms, which are largely caused by mismatch conditions

Disease Lung Cancers Liver Cancer Colon-Rectum Cancers Stomach Cancer Breast Cancer Esophagus Cancer Pancreas Cancer Prostate Cancer Lymphomas Oral Cancer Leukemia Cervical Cancer Other Neoplasms Bladder Cancer Ovary Cancer Skin Cancers Uterine Cancer

Rank 5 17 18 19 24 27 32 33 34 36 40 41 43 44 47 53 59 Total:

Deaths 1,683,893 777,816 767,280 749,806 568,309 413,123 355,709 342,090 341,463 315,707 288,470 278,318 207,953 184,183 161,421 111,444 82,669 7,629,654

% 3.31 1.53 1.51 1.47 1.12 0.81 0.70 0.67 0.67 0.62 0.57 0.55 0.41 0.36 0.32 0.22 0.16 15.01

7.7 Diseases Caused by Mismatches That Speed Up Physiological Aging

313

It is common for an elderly person to suffer and die from hypertension, diabetes mellitus, alterations in the arterial circulation of various organs, various types of cancer, etc., and we usually consider these diseases, currently the main causes of death, as intrinsic to and closely associated with aging. However, the data deriving from the study of primitive populations indicate that these diseases are rare or absent in natural conditions, or, in any case, they are present only in the rare, very old individuals existing under natural conditions. Another concept is important and will be explored in the next section. Namely, certain conditions of mismatch cause a general acceleration of the aging process that must be distinguished from aging in its natural rhythms.

7.7

Diseases Caused by Mismatches That Speed Up Physiological Aging

According to the subtelomere-telomere aging theory, as expounded in detail in Chapter 5– Subtelomere-Telomere aging theory, by the action of the subtelomeretelomere-telomerase system, aging is caused by: (i) accumulation of cells in gradual cell senescence and in cell senescence; and (ii) decline of cellular renewal capacities, which lead progressively to the atrophic syndrome of all tissues and organs. About cell turnover decline, if specific factors damage particular cells and accelerate their turnover to a critical extent, these cells more quickly reach a phase in which there is a slowdown and then exhaustion of their turnover. For example, excessive and prolonged eye exposure to ultraviolet radiation is associated with the early onset of cataract (Miyashita et al. 2019). Such disease could be a consequence of chronic damage and exhaustion of crystalline epithelial cells similarly: (i) to what happens in Werner syndrome where there is early exhaustion of the turnover of these cells (Martin and Oshima 2000), and (ii) to the age-related physiological decline in the turnover capacity of the same cells in normal subjects, a decline known for a long time (Tassin et al. 1979). As we will see below, some factors appear to cause damage both in endothelial cells, with the consequent impairment of blood circulation, and in other types of cells with consequent multiple alterations, which can be described on the whole as an acceleration of the aging phenomenon. In a paper of great importance (Hill et al. 2003), it was shown in 2003 that endothelial progenitor cells (EPCs), a type of cell that allows the turnover of endothelial cells, show a decrease in their number correlated with age. An analogous decrease was also associated with certain factors (diabetes, hypertension, smoking, body mass index, i.e., overweight and obesity), which were well known as risk factors for cardiovascular diseases. In this work, the authors also highlighted that the Framingham risk score (Wilson et al. 1987) and the reduction in EPCs had an equal predictive value for cardiovascular risk. As an explanatory hypothesis for these results, it was suggested that chronically acting harmful factors, which determined

314

7

The Elderly Subjects and Their Troubles

an accelerated turnover of endothelial cells, were the likely cause of EPC decline: “. . . continuous endothelial damage or dysfunction leads to an eventual depletion or exhaustion of a presumed finite supply of endothelial progenitor cells . . . continuous risk-factor-induced injury may lead to eventual depletion of circulating endothelial cells” (Hill et al. 2003). For the authors, this hypothetical pathogenetic mechanism was analogous to that of muscular dystrophy, where a genetic defect caused the precocious death of muscle cells, thus leading to progressive exhaustion of myocyte turnover by muscle stem cells (Webster and Blau 1990; Seale et al. 2001). Moreover, other age-related diseases could be explained by similar mechanisms (Geiger and Van Zant 2002; Tyner et al. 2002). In recent works (Libertini and Ferrara 2016; Libertini 2017, 2019; Libertini et al. 2019), the relationships between some possible “risk factors” (diabetes, obesity/ dyslipidemia, hypertension, smoke, moderate alcohol use, alcohol abuse) and a set of age-related dysfunctions were explored: – There is a positive relationship of endothelial dysfunction with hypertension (Wilson et al. 1987; Hill et al. 2003; Konukoglu and Uzun 2016), diabetes (Wilson et al. 1987; Hill et al. 2003; Emanuel et al. 2017; Shi and Vanhoutte 2017), smoking (Wilson et al. 1987; Centers for Disease Control and Prevention 2014; Vlachopoulos et al. 2015), obesity/dyslipidemia (Wilson et al. 1987; Hill et al. 2003; Kurozumi et al. 2016), and alcohol abuse (Cahill and Redmond 2012; Roerecke and Rehm 2014; Gardner and Mouton 2015; de Gaetano et al. 2016; Tanaka et al. 2016; Oda et al. 2017). While for some studies, the moderate use of alcohol appears to reduce the risk of endothelial dysfunction (Cahill and Redmond 2012; Roerecke and Rehm 2014; Gardner and Mouton 2015; de Gaetano et al. 2016), another work does not confirm this (Oda et al. 2017). – The risk of olfactory dysfunction is positively related to hypertension (Gouveri et al. 2014), diabetes (Heckmann et al. 2009; Gouveri et al. 2014; Sanke et al. 2014; Mehdizadeh et al. 2015; Duda-Sobczak et al. 2017), smoking (Vent et al. 2003; Schubert et al. 2012; Ueha et al. 2016, b), obesity/dyslipidemia (Richardson et al. 2004; Gouveri et al. 2014; Thiebaud et al. 2014; Patel et al. 2015; Duda-Sobczak et al. 2017), and alcohol abuse (Rupp et al. 2003, 2004; Vent et al. 2003; Schubert et al. 2011; Sutherland et al. 2013; Brion et al. 2015). No specific study has been found about the correlation with moderate alcohol consumption. – Age-related macular degeneration is related to hypertension (Klein et al. 2007; Katsi et al. 2015; Shim et al. 2016), diabetes (Klein et al. 2007; Ghaem Maralani et al. 2015), smoking (Fraser-Bell et al. 2006; Klein et al. 2007, 2010; Coleman et al. 2010; Mares et al. 2011; Centers for Disease Control and Prevention 2014; Armstrong and Mousavi 2015; Shim et al. 2016), obesity/dyslipidemia (Klein et al. 2007, 2010; Mares et al. 2011; Munch et al. 2013; Ghaem Maralani et al. 2015; Zhang et al. 2016), and alcohol abuse (Fraser-Bell et al. 2006; Klein et al. 2010; Coleman et al. 2010; Adams et al. 2012). About alcohol abuse, a study in a general population did not confirm this relationship (Boekhoorn et al. 2008). The

7.7 Diseases Caused by Mismatches That Speed Up Physiological Aging

–

–

–

–

315

likelihood that moderate use of alcohol lowers the risk of age-related macular degeneration is disputed (Fraser-Bell et al. 2006; Armstrong and Mousavi 2015). Incidence and gravity of Alzheimer’s disease are increased by hypertension (Gorelick 2004; Qiu et al. 2005; Vogel et al. 2006; Rosendorff et al. 2007; Campdelacreu 2014; de Oliveira et al. 2016; Michel 2016; Tadic et al. 2016), diabetes (Gorelick 2004; Vogel et al. 2006; Rosendorff et al. 2007; Campdelacreu 2014; Michel 2016; Saedi et al. 2016; Zhang et al. 2017), smoking (Gorelick 2004; Rosendorff et al. 2007; Durazzo et al. 2014; Michel 2016), obesity/ dyslipidemia (Gorelick 2004; Vogel et al. 2006; Rosendorff et al. 2007; Campdelacreu 2014; Wanamaker et al. 2015; Michel 2016; Ricci et al. 2017), and alcohol abuse (Rosendorff et al. 2007; Campdelacreu 2014; Heymann et al. 2016). However, a study denied the negative effect of alcohol abuse (Ilomaki et al. 2015). The moderate use of alcohol appears to lower the risk of Alzheimer’s disease (Vogel et al. 2006; Campdelacreu 2014; Berntsen et al. 2015; Ilomaki et al. 2015; Huang et al. 2016), a relationship that is not considered definite in the last study (Huang et al. 2016). Severity and frequency of Parkinson’s disease are positively related to hypertension (Malek et al. 2016), diabetes (Hu et al. 2007; Bohnen et al. 2014; Zhang and Tian 2014), obesity/dyslipidemia (Abbott et al. 2002; Hu et al. 2006; Zhang and Tian 2014), and alcohol abuse (Eriksson et al. 2013). However, the last relationship is disputed in a study (Bettiol et al. 2015), and in another work, no correlation with diabetes, obesity/dyslipidemia, and hypertension has been found (Simon et al. 2007). The risk of Parkinson’s disease and its evolution appear to be opposed by smoking (De Lau and Breteler 2006; Campdelacreu 2014; Hershey and Perlmutter 2014; Li et al. 2015) and moderate alcohol consumption (Ishihara and Brayne 2005; Campdelacreu 2014). There is a positive relationship between hearing impairment and hypertension (Oron et al. 2014; Bener et al. 2016; Lee et al. 2016; Lin et al. 2016; Przewoźny et al. 2016), diabetes (Agrawal et al. 2009; Akinpelu et al. 2014; Oron et al. 2014; Calvin and Watley 2015; Bener et al. 2016; Helzner and Contrera 2016; Kim et al. 2017), smoking (Rosenhall et al. 1993; Cruickshanks et al. 1998; Fransen et al. 2008; Agrawal et al. 2009; Gopinath et al. 2010; Dawes et al. 2014; Oron et al. 2014; Chang et al. 2016; Lee et al. 2016), obesity/dyslipidemia (Fransen et al. 2008; Oron et al. 2014) (a correlation disputed in a study (Lee et al. 2016)), and alcohol abuse (Rosenhall et al. 1993; Verma et al. 2006; Bellé et al. 2007) (a relationship not confirmed in another study (Dawes et al. 2014)). The moderate use of alcohol appears to reduce the risk of hearing impairment (Fransen et al. 2008; Gopinath et al. 2010; Dawes et al. 2014), but this is denied in another study (Curhan et al. 2011). Incidence and severity of emphysema and related diseases are positively related with hypertension (Park et al. 2015), diabetes (Song et al. 2010; Martinez and Han 2012), smoking (Martinez and Han 2012; Centers for Disease Control and Prevention 2014; Vij et al. 2018), and alcohol abuse (Frantz et al. 2014). In animal models, the relationship with moderate alcohol consumption seems to be negative (Balansky et al. 2016). An inverse correlation between emphysema and

316

–

–

–

–

–

–

7

The Elderly Subjects and Their Troubles

obesity/dyslipidemia is reported (Martinez and Han 2012; Gu et al. 2015; Park et al. 2015). In animal models, skin atrophy and diabetes seem to be positively related (Hao et al. 2011). No specific study has been found about the possible relationships of skin atrophy with hypertension, smoking, obesity/dyslipidemia, and alcohol moderate use or abuse. Risk factors for osteoporosis are diabetes (De Pergola et al. 2016; Palermo et al. 2017; Sözen et al. 2017; Walsh and Vilaca 2017), smoking (Centers for Disease Control and Prevention 2014; Sritara et al. 2015; Sözen et al. 2017), obesity/ dyslipidemia (De Pergola et al. 2016; Walsh and Vilaca 2017; Sözen et al. 2017), alcohol abuse (Abukhadir et al. 2013; Coulson et al. 2013; Sözen et al. 2017), and hypertension (Li et al. 2016). However, a study has shown a positive relationship of systolic blood pressure with osteocalcin levels and bone formation, which would mean an inverse relationship between hypertension and osteoporosis (De Pergola et al. 2016). The moderate use of alcohol seems to lower the risk of osteoporosis (Sritara et al. 2015). Excluding olfactory dysfunction, frequency and severity of the atrophy of other sensory neuronal cells with turnover are positively related to diabetes (Dyck et al. 1993; Devlin and Ferguson 1998; Heckmann et al. 2009; Bajaj et al. 2012; Zeng et al. 2017), smoking (EU-Working Group on Tobacco and Oral Health 2000; Reibel 2003), and alcohol abuse (Koike and Sobue 2006; Maiya and Messing 2014; Brion et al. 2015; Zeng et al. 2017). For other possible relationships, no specific study has been found. Risk factors for cataract are hypertension (Gupta et al. 2014), diabetes (Gupta et al. 2014; Li et al. 2014; Sayin et al. 2015; Reitmeir et al. 2017), smoking (Tarwadi and Agte 2011; Centers for Disease Control and Prevention 2014, Gupta et al. 2014, Reitmeir et al. 2017), obesity/dyslipidemia (Habot-Wilner and Belkin 2005; Cheung and Wong 2007), and alcohol abuse (Tarwadi and Agte 2011; Gupta et al. 2014; Gong et al. 2015). About the last relationship, a study found no correlation (Li et al. 2014), and for another work, there is a doubtful positive correlation (Hiratsuka et al. 2009). The risk of cataract appears to be lowered by moderate alcohol consumption (Li et al. 2014). However, a meta-analysis confirms as uncertain this relationship (Gong et al. 2015). For testicular atrophy, there is a positive correlation with diabetes (Wright et al. 1982), obesity/dyslipidemia (Hart et al. 2015; Pinto-Fochi et al. 2016), smoking (Handelsman et al. 1984; Pasqualotto et al. 2004), and alcohol abuse (Handelsman and Staraj 1985; Villalta et al. 1997; Yamauchi et al. 2001; Pasqualotto et al. 2004; Dinis-Oliveira et al. 2015; Silva et al. 2017). No relationship has been found with moderate alcohol consumption (Handelsman et al. 1984; Monoski et al. 2002; Hart et al. 2015), and no specific study was found about a correlation with hypertension. Muscle atrophy is positively related to diabetes (Leenders et al. 2013; Bianchi and Volpato 2016), smoking (Barreiro et al. 2010; Barreiro 2016), obesity/ dyslipidemia (Wannamethee and Atkins 2015; Buch et al. 2016), and alcohol

7.7 Diseases Caused by Mismatches That Speed Up Physiological Aging

–

–

–

–

–

317

abuse (Khayrullin et al. 2016; Souza-Smith et al. 2016). No specific study has been found about relations with hypertension or moderate use of alcohol. Cardiac insufficiency and related diseases appear to be positively correlated to hypertension (Himmelmann 1999; Pfeffer 2017; Tomek and Bub 2017), diabetes (Masoudi and Inzucchi 2007; Cohen-Solal et al. 2008; Choy et al. 2008; Mytas et al. 2009), smoking (Ambrose and Barua 2004; Leone et al. 2008; Centers for Disease Control and Prevention 2014; Leone 2015; Pletcher and Moran 2017), obesity/dyslipidemia (Nikolopoulou and Kadoglou 2012; Bhatheja et al. 2016; Tune et al. 2017), and alcohol abuse (Spies et al. 2001; Di Castelnuovo et al. 2006; Laurent and Edwards 2014; Fernández-Solà 2015; Pankuweit 2016), while there is a negative relationship with moderate alcohol consumption (Di Castelnuovo et al. 2006; Laurent and Edwards 2014; Fernández-Solà 2015; Pankuweit 2016). Although there is a relationship between age and the reduction of various hematic cell types (see Chapter 6 – Aging in the human species), an increase of hematic cell count is observed in hypertension (Nakanishi et al. 2002; Kim et al. 2008; Emamian et al. 2017), diabetes (Shim et al. 2006; Kim et al. 2008; Twig et al. 2013), smoking (Fernández et al. 2012, Higuchi et al. 2016), obesity/ dyslipidemia (Dixon and O’Brien 2006; Kim et al. 2008; Jamshidi and Seif 2017), and alcohol abuse (Ballard 1997; Szabo 1999; Nakanishi et al. 2003). However, in a study, there were contradictory results about the effects of smoking on red blood cell count (Leifert 2008). About the effects of moderate alcohol consumption, a study reported an increase (Nakanishi et al. 2003) and another a decrease (Romeo et al. 2007) of white blood cell count. Risk factors for type 2 diabetes mellitus and impairment of glucose tolerance are hypertension (Gress et al. 2000; Mancia et al. 2009; Cheung and Li 2012), smoking (Manson et al. 2000; Carlsson et al. 2004; Centers for Disease Control and Prevention 2014; Kim et al. 2017), obesity/dyslipidemia (He et al. 2009; Hruby et al. 2016; Schofield et al. 2016), and alcohol abuse (Greenhouse and Lardinois 1996; Cullmann et al. 2012; Kim et al. 2015). However, the last relationship was not found in other studies (Koppes et al. 2005; Rasouli et al. 2013). The risk of type 2 diabetes mellitus appears to be lowered by moderate use of alcohol (Koppes et al. 2005; Cullmann et al. 2012; Rasouli et al. 2013). The risk of hepatic atrophy and related diseases appears to be in a positive relationship with diabetes (El-Serag and Everhart 2002; Hickman and Macdonald 2007; Garcia-Compean et al. 2009), smoking (El-Zayadi 2006; Centers for Disease Control and Prevention 2014; Carter et al. 2015), obesity/dyslipidemia (Suriawinata and Fiel 2004; Garcia-Compean et al. 2009; Niemelä and Alatalo 2010; Horvath et al. 2014; Benedict and Zhang 2017), and alcohol abuse (Niemelä and Alatalo 2010; Singal and Anand 2013; Ingawale et al. 2014; Rocco et al. 2014; Dinis-Oliveira et al. 2015). Regarding possible relationships with hypertension and moderate alcohol consumption no specific study has been found. Risk factors for renal insufficiency are hypertension (Whelton and Klag 1989; Lea and Nicholas 2002; Tedla et al. 2011; Kazancioğlu 2013), diabetes (Lea and

318

7

The Elderly Subjects and Their Troubles

Nicholas 2002; Kazancioğlu 2013; Koye et al. 2017), smoking (Orth et al. 1998; Yacoub et al. 2010; Kazancioğlu 2013; Carter et al. 2015), obesity/dyslipidemia (Ejerblad et al. 2006; Kazancioğlu 2013; Wickman and Kramer 2013; Kovesdy et al. 2017), and alcohol abuse (Vamvakas et al. 1998; Perneger et al. 1999; Schaeffner and Ritz 2012; Kazancioğlu 2013). The moderate use of alcohol appears to reduce the risk (Reynolds et al. 2008; Buja et al. 2011; Schaeffner and Ritz 2012). However, the negative effect of alcohol abuse is contested in another work (Cheungpasitporn et al. 2015), such as the positive effect of moderate use of alcohol (Buja et al. 2014). – Atrophy of oral mucosa and salivary glands is related to diabetes (Devlin and Ferguson 1998; Bajaj et al. 2012; Seifi et al. 2014; Lone et al. 2017; Sahay et al. 2017), smoking (Jalayer Naderi et al. 2015; Petrušić et al. 2015), and alcohol abuse (Feng and Wang 2013; Fernandes et al. 2015). However, for some of these studies the correlations are controversial (Abu Eid et al. 2012; Seifi et al. 2014; Sahay et al. 2017). No specific study has been found about obesity/dyslipidemia, hypertension, and moderate use of alcohol. – Smoking appears to increase the risk of intestinal and gastric atrophy (Ma et al. 1999), while for the other possible risk factors, no specific study has been found. – Alopecia, or baldness, is related to hypertension (Gatherwright et al. 2012), diabetes (Matilainen et al. 2003; Arias-Santiago et al. 2011; Gatherwright et al. 2012), smoking (Su and Chen 2007; Gatherwright et al. 2012, 2013; Fortes et al. 2017), obesity/dyslipidemia (Matilainen et al. 2003; Yi et al. 2012; Fortes et al. 2017), and alcohol abuse (Gatherwright et al. 2013). However, alcohol abstinence appears to increase hair loss (Gatherwright et al. 2013), and this could indicate that moderate use of alcohol reduces the risk of alopecia, although no specific study is available. – Some discrepancies that need clarification Table 7.8 summarizes the results of the studies previously reported. As points of comparison are used the effects described on endothelial cells due to hypertension, diabetes, smoking, obesity/dyslipidemia, moderate alcohol use, and alcohol abuse. Possible relationships for which specific studies are missing or could not be found or have contradictory results are disregarded. From this integration, a remarkable correspondence with the effects manifested for the other organs and disturbances considered can be observed. However, there are some important exceptions, highlighted with colored rectangles in the table, which must be mentioned and briefly discussed: – (T4) Parkinson’s disease (PD) and the beneficial effect of smoking on it. If we except PD, for the other age-related dysfunctions, when there are available studies, they always show a positive correlation with smoking. Only for PD, the relationship is negative, i.e., smoking appears to oppose the disease’s symptoms and evolution. A likely explanation is the known effect of nicotine stimulation on nicotinic acetylcholine receptors (Quik et al. 2009, 2015; Quik and Wonnacott 2011), which is similar to the actions of dopaminergic stimulants used

7.7 Diseases Caused by Mismatches That Speed Up Physiological Aging

319

Table 7.8 Correlations between some age-related dysfunctions and some “risk factors” Part I – With cell turnover of the specific cells Effect on the risk by: Dysfunctions in the elderly

Age Hypertension Diabetes Smoking Code A B C

Endothelial dysfunction Olfactory dysfunction Renal insufficiency Atrophy of oral mucosa salivary glands Intestinal and gastric atrophy

and

Alopecia Emphysema and related diseases Skin atrophy Osteoporosis Atrophy of other sensory neuronal cells with turnover Cataract Testicular atrophy Muscle atrophy Cardiac insufficiency and related diseases Reduction of various hematic cell types Diabetes and impairment of glucose tolerance Hepatic atrophy and related diseases

Obesity/ Moderate Alcohol dyslipidemia alcohol use abuse 5 6 7

1

2

3

4

N

+ + + + + + + + + + + + + +

+ + + +? . + + . + . + . . +

+ + + + . + + + + + + + + +

+ + + + + + + . + + + + + +

+ + + . . + . + . + + + +

. . . +? . . / . -

+ + + + . + + . + + + + + +

O

+

-

-

-

-

?

+

P

+

+

+

+

-

+

Q

+

.

+

+

.

+

D E F G H I J K L M

+

Part II – Without cell turnover of the specific cells Effect on the risk by: Dysfunctions in the elderly Age-related macular degeneration Alzheimer’s disease Parkinson’s disease Hearing impairment

Age Hypertension Diabetes Smoking Code R S T U

1

2

3

4

+ + + +

+ + +/ +

+ + + +

+ + +

Obesity/ Moderate Alcohol dyslipidemia alcohol use abuse 5 6 7

+ + + +

-/ -

+ + + +

Notes: + = risk or protective effect increased; - = risk or protective effect decreased; / = risk or protective effect unaltered; ? = doubtful results; . = no specific study. The documentation regarding the relationships between age and each individual dysfunctions was reported in Chapter 6 - Aging in the human species. As for the other relations, see the text of this chapter.

to treat PD. This pharmacological effect of nicotine on PD symptoms would largely overcome other possible noxious consequences on neurons determined by smoking. – (G5) Inverse relationship between emphysema and obesity/dyslipidemia. It is likely that the large masses of fat, present in obese subjects, squeeze the lungs. In the case of emphysema, this should mask the pulmonary dilatation and explain the observed false inverse correlation. – (O2-O5) Positive relation of white blood cell (WBC) count with hypertension, diabetes, smoking and obesity/dyslipidemia, and smoking. The positive relationship could be determined by the pro-inflammatory effects of these risk factors on

320

7

The Elderly Subjects and Their Troubles

WBC count. On the contrary, the anti-inflammatory effects of statins would cause a reduction of WBC (Liao and Laufs 2005; Horiuchi et al. 2010). – Interpretation of the observed relationships The above-said relationships between some “risk factors” and a series of dysfunctions are interpreted by most studies in terms that are compatible with widespread ideas within the non-programmed aging paradigm. These interpretations explain the relationships above described according to various mechanisms of accumulation of oxidized substances, in perfect coherence with old theories of non-programmed aging that completely neglect any idea or evidence of evolutionism and the great mass of works concerning the subtelomere-telomere-telomerase system. E.g., for – age-related macular degeneration: (Woodell and Rohrer 2014; Bringmann et al. 2016; Das 2016; Marazita et al. 2016; Pujol-Lereis et al. 2016); – Alzheimer’s disease: (Casserly and Topol 2004; Baglietto-Vargas et al. 2016; Nunez et al. 2016; Platt et al. 2016; Rani et al. 2016; Vicente Miranda et al. 2016; Bharadwaj et al. 2017; Martin-Jiménez et al. 2017; Pugazhenthi 2017); – cardiac insufficiency and disease: (Zeng et al. 2015); – diabetes mellitus and impairment of glucose tolerance: (Scheen 2005); – emphysema: (Yun et al. 2017); – endothelial dysfunction: (Walter et al. 2002; Chłopicki and Gryglewski 2005; Soliman et al. 2014; Wang et al. 2014; Camici et al. 2015; Li et al. 2015; Su 2015; Anderson et al. 2016; Flavahan et al. 2016; Nemecz et al. 2016; Mirra et al. 2017; Schinzari et al. 2017); – hearing impairment: (Han et al. 2016); – olfactory dysfunction: (Sutherland et al. 2013; Ueha et al. 2016, b); – osteoporosis: (Yan et al. 2011; Sung et al. 2015; Gibon et al. 2016; Liu et al. 2016; Veldurthy et al. 2016); – muscle atrophy: (Phillips et al. 1992; Carmeli and Reznick 1994; Goodman et al. 2015; Perkisas and Vandewoude 2016; Perry et al. 2016); – Parkinson’s disease: (Lopez-Real et al. 2005; Sonsalla et al. 2013; Muñoz et al. 2014; Santiago and Potashkin 2014; Spielman et al. 2014; Sari and Khalil 2015; Martin-Jiménez et al. 2017). On the contrary, following the programmed aging paradigm, a minority of studies explain the relationships described above as consequences of telomere shortening. E.g., for – Alzheimer’s disease: (Forero et al. 2016); – endothelial dysfunction: (Li et al. 2017b); – hearing impairment: (Falah et al. 2016); – emphysema: (Birch et al. 2015); – intestinal and gastric atrophy: (Lee et al. 1998; Ma et al. 1999; Hao et al. 2005; Armanios et al. 2009; Jonassaint et al. 2013). The interpretation of the subtelomere-telomere theory is summarized in Fig. 7.6. In the absence of mismatches and other disease-causing conditions, the subtelomere-

7.7 Diseases Caused by Mismatches That Speed Up Physiological Aging

321

Fig. 7.6 Scheme of how the subtelomere-telomere-telomerase system determines the aging of the whole organism through “direct” or “indirect” aging of the various cell types and of the tissues/ organs of which they are part (Libertini 2017; Libertini et al. 2018)

322

7

The Elderly Subjects and Their Troubles

telomere-telomerase system, through the age-related mechanisms already exposed, determines: (i) a progressive increase of the cells in gradual senescence; and (ii) a progressive decline in the rate of cellular turnover. These phenomena cause an atrophic syndrome in all the organs and tissues that it is possible to distinguish between “direct” and “indirect” aging, depending on whether the main cells are subject or not subject to turnover (Libertini 2017; Libertini et al. 2018). The atrophic syndrome, depending on the organs and functions affected, manifests itself in various ways that are not at all distinct “diseases” but only different manifestations of the same unitary phenomenon. Among the manifestations of “direct” aging we have: age-related olfactory dysfunction, atherosclerosis and vascular insufficiencies, atrophy of oral mucosa, baldness, cardiac insufficiency, emphysema, hepatic atrophy, intestinal and gastric atrophy, latent or mild diabetes, muscle atrophy, osteoporosis, reduction of various hematic cell types, renal insufficiency, skin atrophy, testicular atrophy and diminished fertility, and functional decline of sensory neuronal cells with turnover. Among the manifestations of “indirect” aging we have: age-related macular degeneration, Alzheimer’s disease, Parkinson’s disease, presbycusis, and cataract.

7.8

Weight of Physiological Aging

Individuals who reach a certain age without being suffering from diseases caused by genetic alterations, mismatches, trauma, etc., which we could call “healthy” elderly persons, constitute a living manual of the progressive alterations caused by aging. These alterations have been described in Chapter 6 – Aging in the human species, and, in summary, can be defined as a progressive atrophic syndrome of all organs and tissues. The decline and alterations of the body’s functions, before they determine a complete incapacity to live, cause a progressive reduction of fitness, i.e., the ability to resist and survive events of any kind. The concept of aging as a gradual phenomenon, which starts from minimal reductions in fitness and is progressively amplified to a critical reduction of fitness that is incompatible with life, is a potential source of two misunderstandings or erroneous deductions: (1) Existence or non-existence of aging under natural conditions By definition, an individual with a very reduced fitness is unable to survive and therefore does not exist in natural conditions. It has already been emphasized that it is essential to avoid the mistake of confusing the aging process with the extreme manifestations of this process, i.e., the “. . . confusion of the process of senescence with the state of senility” (Williams 1957). As a result of this error, it is proclaimed that aging does not exist in natural conditions and therefore cannot be influenced by natural selection (Medawar 1952; Rose 1991; Hayflick 2000; Kirkwood and Austad 2000). On the contrary, the progressive decline of fitness is well documented in

7.8 Weight of Physiological Aging

323

natural conditions (Libertini 1988; Finch 1990; Ricklefs 1998; Nussey et al. 2013), and consequently, the aging process operates in individuals existing in such conditions, obviously before they reach critically low values of fitness. (2) Small or great weight of aging in the suffering of individuals In Section 7.1 – Evolutionary classification of the troubles of the elderly, it has been observed that paradoxically aging is not considered and does not exist among the official causes of death. To overcome this absurdity, in the same section, it has been proposed, for statistical purposes, to consider aging as the leading cause of death for those who are exempt from other diseases and die at ages when, in the wild, mortality reaches and exceeds the value of 15%/year and, in modern conditions, the decline in athletic performance is around 30%. This definition, which is clearly arbitrary for the limits proposed but may be useful for statistical purposes, is different from a correct biological definition and can be a source of misunderstanding. It is necessary to consider first that in the statistical definition of the cause of death, there is an obligation to consider a single main cause of death and to ignore other factors that contribute to the death to varying degrees. Aging is a progressive decline of the organism’s functions that manifests itself through a progressive reduction of the ability to survive, i.e., of the fitness, and this is not described at all with fidelity by defining a main cause of death. For example, when fighting with an antagonist (a wild animal/another individual/a bacterial infection/etc.), if the fitness is optimal, there is the maximum chance of winning and not succumbing. With the progressive decline of fitness, this probability declines until it reaches a zero value. In defining the main cause of death, we are forced to make a choice: if fitness is high (or in any case above an arbitrarily defined value) we will classify the pathogenic noxa as a cause of death; on the contrary, if fitness is below the arbitrarily established critical level, we will classify the fitness decline, i.e., aging, as the cause of death. This approach leads us to classify aging as a cause of death only for those cases in which there is a strong reduction in fitness. This compromise appears necessary, for statistical health purposes, and it would be of little use and very difficult, for example, to classify as causes of a death the decline of fitness for x% and the pathogenic noxa for the remaining part.

– The true biological weight of aging As a matter of fact, a better evaluation of the true biological weight of aging is highlighted not by the definition and classification of the leading causes of death but by the analysis of survival curves. As already reported in Section 1.3 – Aging in natural observation, the study of a human population in the wild (Ache people of Paraguay) showed an average life span (ML) of 38.8 years (Hill and Hurtado 1996). The life table, after the first periods of life characterized by greater mortality, reached its minimum mortality rate (about 0.858%/year) at 20 years and then increased, at first slowly and then with increasing intensity. A hypothetical life table without this age-related increase in mortality from the age of 20 years presented a hypothetical ML (HML) of 87.75 years, with an HML/ML ratio of 2.26. In fact, the age-related increase in mortality about halved the ML (see Fig. 1.4). Moreover, if only individuals surviving at the age of 20 were considered, in the wild, their ML (ML20) was equal to 58.1 years (38.1 after the age of 20). Without an

324

7

The Elderly Subjects and Their Troubles

age-related increase in mortality, the hypothetical ML of the same individuals (HML20) would be equal to 136.55 years (116.55 after the age of 20), with a (HML20 – 20)/(ML20 – 20) ratio of 3.059. This calculation indicated that the age-related increase in mortality, i.e., aging, decreased life expectancy by about two-thirds in subjects who survived at the age of 20 (see Fig. 1.5). In short, under natural conditions, for the survivors at the age of 20, considering the combination of all deaths and all causes of death, the incidence of aging as death cause, in varying degrees for every single case, was around two-thirds. The values just reported for a human population in the wild are analogous to those found for a group of mammals under natural conditions and described in Table 1.1, where the mean for the first ratio was 2.34 while the mean for the second ratio was 3.67. Also, in this case, the incidence of deaths due to aging (the proportion of senescent deaths, Ps, in the definition of Ricklefs (1998)) is equal to more than half considering the entire population and over two-thirds considering only survivors at the age when mortality is minimal. The minimum mortality for the Ache people in the wild (about 0.858%/year) is quite high compared to modern conditions. The curves 2, 3, and 4 in Fig. 7.7 and the values obtained reported in Table 7.9 show how the hypothetical life tables and the values previously defined would change in cases in which the minimum mortality observed in the wild (dw) was reduced to dw/2, dw/3, dw/4, respectively. The curve 5 in Fig. 7.7 and the values obtained reported in Table 7.9 consider the case of a modern population (USA 2017), the life expectancy at the age of 20 (i.e., the ML20) and the hypothetical condition of a mortality rate constant and equal to the

Fig. 7.7 Real life table of Ache people studied in the wild and five hypothetical life tables. Abbreviations: real ¼ real life table observed for Ache people (forest period); d ¼ death rate; dw ¼ minimum death rate observed for Ache people in the wild (at the age of about 20 years) ¼ 0.858%/year; 1 ¼ hypothetical life table with constant death rate equal to dw; 2, 3, 4 ¼ likewise with d ¼ dw/2, dw/3, dw/4, respectively; 5 ¼ likewise with d ¼ dUSA ¼ the death rate in USA, 2017, age 20–25, both sex combined (¼ 0.0944%/year, about dw/9)

7.8 Weight of Physiological Aging

325

Table 7.9 Survival values for some hypothetical life tables

Death rate d dwe ¼ 0.858% dw/2 0.429% ¼ dw/3 0.286% ¼ dw/4 0.2145% ¼ dUSAg 0.0944% ¼

age when survivors 1] ¼ 1/ln(1d); b Formula used: S1000 ¼ (1d)980 * 100; c Formula used: (1d)T ¼ 0.01; therefore T ¼ ln(0.01)/ln(1y); then T is rounded to the next integer; d Formula used: S ¼ (1d)t * 100; e dw ¼ minimum death rate at age 20 observed for Ache people in the wild (forest period); f Value obtained from the study on Ache people (forest period); g dUSA ¼ death rates USA 2017, age 20–24, total (source https://www.statista.com/statistics/ 241572/death-rate-by-age-and-sex-in-the-us/; accessed October 31, 2019); h USA 2016, life expectancy at age 20 (source: https://www.ssa.gov/oact/STATS/table4c6.html, accessed October 31, 2019) a

minimum observed at 20 years (0.0944%/year, about 1/9 of that observed for the Ache people in the wild). The results show a strong increase in HML20 values in the D/C ratio, and in the age in which the survivors fall to below 1%. This increase is particularly strong for the curve 5 (HML20 ¼ 1,058 years; D/C ratio over 17, 4,877 years for the age in which the survivors fall to below 1%!). The importance of the effects of the age-related increase in mortality, which defines aging, can be assessed on the basis of the extraordinary effects of the hypothetical cancellation of this increase. These enormous effects must be compared with the ones potentially achieved with hypothetical optimal prevention and treatment of all the diseases but without any reduction in age-related increase in mortality. Figure 7.8 shows the life tables of a modern country in various periods from 1851 to 2011 and the expected life table for 2031. This figure shows that the mortality reduction obtained from 1851 to 2011 has progressively transformed the life table, making it look more and more like a rectangle with the upper right corner beveled and with a limit on the right side caused by the progressive decline of fitness, i.e., by aging. An ideal perfection in the prevention and treatment of any disease would make the life table even more similar to a rectangle but would only increase the average life span by a few years, at the cost of growing unsustainable impairments and deterioration of the quality of life in the additional years attained.

326

7

The Elderly Subjects and Their Troubles

Fig. 7.8 Life tables for England and Wales (1851–2011) plus the expected life table for 2031. (Data source: Office for National Statistics (ONS) (https://ourworldindata.org/life-expectancy))

This hypothesis must be compared with the picture outlined above with the clear conclusion that, if we want to increase the duration and quality of life significantly, the main objective must be to control the aging process.

References Abbott, R. D., Ross, G. W., White, L. R., Nelson, J. S., Masaki, K. H., Tanner, C. M., Curb, J. D., Blanchette, P. L., Popper, J. S., & Petrovitch, H. (2002). Midlife adiposity and the future risk of Parkinson’s disease. Neurology, 59(7), 1051–1057. https://doi.org/10.1212/wnl.59.7.1051. Abu Eid, R., Sawair, F., Landini, G., & Saku, T. (2012). Age and the architecture of oral mucosa. Age (Dordrecht, Netherlands), 34(3), 651–658. https://doi.org/10.1007/s11357-011-9261-1. Abukhadir, S. S., Mohamed, N., & Mohamed, N. (2013). Pathogenesis of alcohol-induced osteoporosis and its treatment: A review. Current Drug Targets, 14(13), 1601–1610. https://doi.org/ 10.2174/13894501113146660231. Adams, V., Gielen, S., Hambrecht, R., & Schuler, G. (2001). Apoptosis in skeletal muscle. Frontiers in Bioscience, 6, D1–D11. Adams, M. K., Chong, E. W., Williamson, E., Aung, K. Z., Makeyeva, G. A., Giles, G. G., English, D. R., Hopper, J., Guymer, R. H., Baird, P. N., Robman, L. D., & Simpson, J. A. (2012). 20/20 – Alcohol and age-related macular degeneration: The Melbourne Collaborative Cohort Study. American Journal of Epidemiology, 176(4), 289–298. https://doi.org/10.1093/aje/kws004. Agrawal, Y., Platz, E. A., & Niparko, J. K. (2009). Risk factors for hearing loss in us adults: Data from the National Health and nutrition examination survey, 1999 to 2002. Otology & Neurotology, 30(2), 139–145. https://doi.org/10.1097/MAO.0b013e318192483c.

References

327

Akinpelu, O. V., Ibrahim, F., Waissbluth, S., & Daniel, S. J. (2014). Histopathologic changes in the cochlea associated with diabetes mellitus--a review. Otology & Neurotology, 35(5), 764–774. https://doi.org/10.1097/MAO.0000000000000293. Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., Roberts, K., & Walter, P. (Eds.). (2014). Essential cell biology (4th ed.). New York: Garland Science. Ambrose, J. A., & Barua, R. S. (2004). The pathophysiology of cigarette smoking and cardiovascular disease: An update. Journal of the American College of Cardiology, 43(10), 1731–1737. https://doi.org/10.1016/j.jacc.2003.12.047. Anderson, C., Majeste, A., Hanus, J., & Wang, S. (2016). E-cigarette aerosol exposure induces reactive oxygen species, DNA damage, and cell death in vascular endothelial cells. Toxicological Sciences, 154(2), 332–340. https://doi.org/10.1093/toxsci/kfw166. Anversa, P., Kajstura, J., Leri, A., & Bolli, R. (2006). Life and death of cardiac stem cells. Circulation, 113(11), 1451–1463. https://doi.org/10.1161/CIRCULATIONAHA.105.595181. Arboleda, G., Ramírez, N., & Arboleda, H. (2007). The neonatal progeroid syndrome (WiedemannRautenstrauch): A model for the study of human aging? Experimental Gerontology, 42(10), 939–943. https://doi.org/10.1016/j.exger.2007.07.004. Arias-Santiago, S., Gutiérrez-Salmerón, M. T., Buendía-Eisman, A., Girón-Prieto, M. S., & Naranjo-Sintes, R. (2011). Sex hormone-binding globulin and risk of hyperglycemia in patients with androgenetic alopecia. Journal of the American Academy of Dermatology, 65(1), 48–53. https://doi.org/10.1016/j.jaad.2010.05.002. Armanios, M., Alder, J. K., Parry, E. M., Karim, B., Strong, M. A., & Greider, C. W. (2009). Short telomeres are sufficient to cause the degenerative defects associated with aging. American Journal of Human Genetics, 85(6), 823–832. https://doi.org/10.1016/j.ajhg.2009.10.028. Armstrong, R. A., & Mousavi, M. (2015). Overview of risk factors for Age-Related Macular Degeneration (AMD). Journal of Stem Cells, 10(3), 171–191. Artandi, S. E. (2002). Telomere shortening and cell fates in mouse models of neoplasia. Trends in Molecular Medicine, 8(1), 44–47. https://doi.org/10.1016/s1471-4914(01)02222-5. Artandi, S. E., Chang, S., Lee, S. L., Alson, S., Gottlieb, G. J., Chin, L., & DePinho, R. A. (2000). Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature, 406(6796), 641–645. https://doi.org/10.1038/35020592. Baglietto-Vargas, D., Shi, J., Yaeger, D. M., Ager, R., & LaFerla, F. M. (2016). Diabetes and Alzheimer’s disease crosstalk. Neuroscience and Biobehavioral Reviews, 64, 272–287. https:// doi.org/10.1016/j.neubiorev.2016.03.005. Bajaj, S., Prasad, S., Gupta, A., & Singh, V. B. (2012). Oral manifestations in type-2 diabetes and related complications. Indian Journal of Endocrinology and Metabolism, 16(5), 777–779. https://doi.org/10.4103/2230-8210.100673. Balansky, R., Ganchev, G., Iltcheva, M., Nikolov, M., La Maestra, S., Micale, R. T., Steele, V. E., & De Flora, S. (2016). Interactions between ethanol and cigarette smoke in a mouse lung carcinogenesis model. Toxicology, 373, 54–62. https://doi.org/10.1016/j.tox.2016.11.008. Ballard, H. S. (1997). The hematological complications of alcoholism. Alcohol Health and Research World, 21(1), 42–52. Barreiro, E. (2016). Role of protein carbonylation in skeletal muscle mass loss associated with chronic conditions. Proteomes, 4(2), pii:E18. https://doi.org/10.3390/proteomes4020018. Barreiro, E., Peinado, V. I., Galdiz, J. B., Ferrer, E., Marin-Corral, J., Sánchez, F., Gea, J., Barberà, J. A., & ENIGMA in COPD Project. (2010). Cigarette smoke-induced oxidative stress: A role in chronic obstructive pulmonary disease skeletal muscle dysfunction. American Journal of Respiratory and Critical Care Medicine, 182(4), 477–488. https://doi.org/10.1164/rccm. 200908-1220OC. Bellé, M., Sartori Sdo, A., & Rossi, A. G. (2007). Alcoholism: Effects on the cochleo-vestibular apparatus. Brazilian Journal of Otorhinolaryngology, 73(1), 110–116. https://doi.org/10.1016/ s1808-8694(15)31132-0. Benedict, M., & Zhang, X. (2017). Non-alcoholic fatty liver disease: An expanded review. World Journal of Hepatology, 9(16), 715–732. https://doi.org/10.4254/wjh.v9.i16.715.

328

7

The Elderly Subjects and Their Troubles

Bener, A., Al-Hamaq, A. O. A. A., Abdulhadi, K., Salahaldin, A. H., & Gansan, L. (2016). Interaction between diabetes mellitus and hypertension on risk of hearing loss in highly endogamous population. Diabetes and Metabolic Syndrome: Clinical Research and Reviews, 11(Suppl 1), S45–S51. https://doi.org/10.1016/j.dsx.2016.09.004. Berntsen, S., Kragstrup, J., Siersma, V., Waldemar, G., & Waldorff, F. B. (2015). Alcohol consumption and mortality in patients with mild Alzheimer’s disease: A prospective cohort study. BMJ Open, 5(12), e007851. https://doi.org/10.1136/bmjopen-2015-007851. Bettiol, S. S., Rose, T. C., Hughes, C. J., & Smith, L. A. (2015). Alcohol consumption and Parkinson’s disease risk: A review of recent findings. Journal of Parkinson’s Disease, 5(3), 425–442. https://doi.org/10.3233/JPD-150533. Bharadwaj, P., Wijesekara, N., Liyanapathirana, M., Newsholme, P., Ittner, L., Fraser, P., & Verdile, G. (2017). The link between type 2 diabetes and neurodegeneration: Roles for amyloid-β, amylin, and tau proteins. Journal of Alzheimer’s Disease, 59(2), 421–432. https://doi. org/10.3233/JAD-161192. Bhatheja, S., Panchal, H. B., Ventura, H., & Paul, T. K. (2016). Obesity cardiomyopathy: Pathophysiologic factors and Nosologic reevaluation. The American Journal of the Medical Sciences, 352(2), 219–222. https://doi.org/10.1016/j.amjms.2016.05.014. Bianchi, L., & Volpato, S. (2016). Muscle dysfunction in type 2 diabetes: A major threat to patient’s mobility and independence. Acta Diabetologica, 53(6), 879–889. https://doi.org/10.1007/ s00592-016-0880-y. Birch, J., Anderson, R. K., Correia-Melo, C., Jurk, D., Hewitt, G., Marques, F. M., Green, N. J., Moisey, E., Birrell, M. A., Belvisi, M. G., Black, F., Taylor, J. J., et al. (2015). DNA damage response at telomeres contributes to lung aging and chronic obstructive pulmonary disease. American Journal of Physiology. Lung Cellular and Molecular Physiology, 309(10), L1124– L1137. https://doi.org/10.1152/ajplung.00293.2015. Boekhoorn, S. S., Vingerling, J. R., Hofman, A., & de Jong, P. T. (2008). Alcohol consumption and risk of aging macula disorder in a general population: The Rotterdam study. Archives of Ophthalmology, 126(6), 834–839. https://doi.org/10.1001/archopht.126.6.834. Bohnen, N. I., Kotagal, V., Müller, M. L., Koeppe, R. A., Scott, P. J., Albin, R. L., Frey, K. A., & Petrou, M. (2014). Diabetes mellitus is independently associated with more severe cognitive impairment in Parkinson disease. Parkinsonism & Related Disorders, 20(12), 1394–1398. https://doi.org/10.1016/j.parkreldis.2014.10.008. Bonner-Weir, S. (2000). Islet growth and development in the adult. Journal of Molecular Endocrinology, 24(3), 297–302. https://doi.org/10.1677/jme.0.0240297. Bringmann, A., Hollborn, M., Kohen, L., & Wiedemann, P. (2016). Intake of dietary salt and drinking water: Implications for the development of age-related macular degeneration. Molecular Vision, 22, 1437–1454. Brion, M., de Timary, P., Vander Stappen, C., Guettat, L., Lecomte, B., Rombaux, P., & Maurage, P. (2015). Chemosensory dysfunction in alcohol-related disorders: A joint exploration of olfaction and taste. Chemical Senses, 40(9), 605–608. https://doi.org/10.1093/chemse/bjv047. Brown, W. T. (1992). Progeria: A human-disease model of accelerated aging. The American Journal of Clinical Nutrition, 55(6 Suppl), 1222S–1224S. https://doi.org/10.1093/ajcn/55.6. 1222S. Buch, A., Carmeli, E., Boker, L. K., Marcus, Y., Shefer, G., Kis, O., Berner, Y., & Stern, N. (2016). Muscle function and fat content in relation to sarcopenia, obesity and frailty of old age – An overview. Experimental Gerontology, 76, 25–32. https://doi.org/10.1016/j.exger.2016.01.008. Buja, A., Scafato, E., Baggio, B., Sergi, G., Maggi, S., Rausa, G., Basile, A., Manzato, E., Ghirini, S., & Perissinotto, E. (2011). Renal impairment and moderate alcohol consumption in the elderly. Results from the Italian Longitudinal Study on Aging (ILSA). Public Health Nutrition, 14(11), 1907–1918. https://doi.org/10.1017/S1368980011000863. Buja, A., Vinelli, A., Lion, C., Scafato, E., & Baldo, V. (2014). Is moderate alcohol consumption a risk factor for kidney function decline? A systematic review of observational studies. Journal of Renal Nutrition, 24(4), 224–235. https://doi.org/10.1053/j.jrn.2014.03.005.

References

329

Cahill, P. A., & Redmond, E. M. (2012). Alcohol and cardiovascular disease--modulation of vascular cell function. Nutrients, 4(4), 297–318. https://doi.org/10.3390/nu4040297. Calvin, D., & Watley, S. R. (2015). Diabetes and hearing loss among underserved populations. The Nursing Clinics of North America, 50(3), 449–456. https://doi.org/10.1016/j.cnur.2015.05.001. Camici, G. G., Savarese, G., Akhmedov, A., & Lüscher, T. F. (2015). Molecular mechanism of endothelial and vascular aging: Implications for cardiovascular disease. European Heart Journal, 36(48), 3392–3403. https://doi.org/10.1093/eurheartj/ehv587. Campdelacreu, J. (2014). Parkinson disease and Alzheimer disease: Environmental risk factors (Article in English, Spanish). Neurología, 29(9), 541–549. https://doi.org/10.1016/j.nrl.2012. 04.001. Campisi, J. (1997). The biology of replicative senescence. European Journal of Cancer, 33(5), 703–709. https://doi.org/10.1016/S0959-8049(96)00058-5. Campisi, J. (2000). Cancer, aging and cellular senescence. In Vivo, 14(1), 183–188. Carlsson, S., Midthjell, K., Grill, V., & Nord-Trøndelag Study. (2004). Smoking is associated with an increased risk of type 2 diabetes but a decreased risk of autoimmune diabetes in adults: An 11-year follow-up of incidence of diabetes in the Nord-Trøndelag study. Diabetologia, 47(11), 1953–1956. https://doi.org/10.1007/s00125-004-1554-9. Carmeli, E., & Reznick, A. Z. (1994). The physiology and biochemistry of skeletal muscle atrophy as a function of age. Proceedings of the Society for Experimental Biology and Medicine, 206(2), 103–113. https://doi.org/10.3181/00379727-206-43727. Carter, B. D., Abnet, C. C., Feskanich, D., Freedman, N. D., Hartge, P., Lewis, C. E., Ockene, J. K., Prentice, R. L., Speizer, F. E., Thun, M. J., & Jacobs, E. J. (2015). Smoking and mortality — Beyond established causes. The New England Journal of Medicine, 372(7), 631–640. https:// doi.org/10.1056/NEJMsa1407211. Casserly, I., & Topol, E. (2004). Convergence of atherosclerosis and Alzheimer’s disease: Inflammation, cholesterol, and misfolded proteins. Lancet, 363(9415), 1139–1146. https://doi.org/10. 1016/S0140-6736(04)15900-X. Centers for Disease Control and Prevention, National Center for Chronic Disease Prevention and Health Promotion, Office on Smoking and Health. (2014). The health consequences of smoking: 50 years of progress: A report of the Surgeon General. Atlanta: Department of Health and Human Services. www.hhs.gov/surgeongeneral/reports-and-publications/tobacco/index.html, www.ncbi.nlm.nih.gov/books/NBK179276/pdf/Bookshelf_NBK179276.pdf. Accessed 14 Feb 2020. Cerasi, E., Kaiser, N., & Leibowitz, G. (2000). Type 2 diabetes and beta cell apoptosis (article in French). Diabetes & Metabolism, 26(Suppl 3), 13–16. Chang, J., Ryou, N., Jun, H. J., Hwang, S. Y., Song, J. J., & Chae, S. W. (2016). Effect of cigarette smoking and passive smoking on hearing impairment: Data from a population-based study. PLoS One, 11(1), e0146608. https://doi.org/10.1371/journal.pone.0146608. Cheung, B. M., & Li, C. (2012). Diabetes and hypertension: Is there a common metabolic pathway? Current Atherosclerosis Reports, 14(2), 160–166. https://doi.org/10.1007/s11883-012-0227-2. Cheung, N., & Wong, T. Y. (2007). Obesity and eye diseases. Survey of Ophthalmology, 52(2), 180–195. https://doi.org/10.1016/j.survophthal.2006.12.003. Cheungpasitporn, W., Thongprayoon, C., Kittanamongkolchai, W., Brabec, B. A., O’Corragain, O. A., Edmonds, P. J., & Erickson, S. B. (2015). High alcohol consumption and the risk of renal damage: A systematic review and meta-analysis. QJM, 108(7), 539–548. https://doi.org/10. 1093/qjmed/hcu247. Chłopicki, S., & Gryglewski, R. J. (2005). Angiotensin converting enzyme (ACE) and HydroxyMethylGlutaryl-CoA (HMG-CoA) reductase inhibitors in the forefront of pharmacology of endothelium. Pharmacological Reports, 57S, 86–96. Choy, C. K., Rodgers, J. E., Nappi, J. M., & Haines, S. T. (2008). Type 2 diabetes mellitus and heart failure. Pharmacotherapy, 28(2), 170–192. https://doi.org/10.1592/phco.28.2.170.

330

7

The Elderly Subjects and Their Troubles

Cohen-Solal, A., Beauvais, F., & Logeart, D. (2008). Heart failure and diabetes mellitus: Epidemiology and management of an alarming association. Journal of Cardiac Failure, 14(7), 615–625. https://doi.org/10.1016/j.cardfail.2008.04.001. Coleman, A. L., Seitzman, R. L., Cummings, S. R., Yu, F., Cauley, J. A., Ensrud, K. E., Stone, K. L., Hochberg, M. C., Pedula, K. L., Thomas, E. L., Mangione, C. M., & Study of Osteoporotic Fractures Research Group. (2010). The association of smoking and alcohol use with age-related macular degeneration in the oldest old: The study of osteoporotic fractures. American Journal of Ophthalmology, 149(1), 160–169. https://doi.org/10.1016/j.ajo.2009.07. 025. Comfort, A. (1979). The biology of senescence. London: Livingstone. Coulson, C. E., Williams, L. J., Brennan, S. L., Berk, M., Kotowicz, M. A., Lubman, D. I., & Pasco, J. A. (2013). Alcohol consumption and body composition in a population-based sample of elderly Australian men. Aging Clinical and Experimental Research, 25(2), 183–192. https://doi. org/10.1007/s40520-013-0026-9. Cruickshanks, K. J., Klein, R., Klein, B. E., Wiley, T. L., Nondahl, D. M., & Tweed, T. S. (1998). Cigarette smoking and hearing loss: The epidemiology of hearing loss study. JAMA, 279(21), 1715–1719. https://doi.org/10.1001/jama.279.21.1715. Cullmann, M., Hilding, A., & Östenson, C. G. (2012). Alcohol consumption and risk of pre-diabetes and type 2 diabetes development in a Swedish population. Diabetic Medicine, 29 (4), 441–452. https://doi.org/10.1111/j.1464-5491.2011.03450.x. Cunniff, C., Bassetti, J. A., & Ellis, N. A. (2017). Bloom’s syndrome: Clinical Spectrum, molecular pathogenesis, and Cancer predisposition. Mol Syndromol, 8(1), 4–23. https://doi.org/10.1159/ 000452082. Curhan, S. G., Eavey, R., Shargorodsky, J., & Curhan, G. C. (2011). Prospective study of alcohol use and hearing loss in men. Ear and Hearing, 32(1), 46–52. https://doi.org/10.1097/AUD. 0b013e3181f46a2f. Das, U. N. (2016). Diabetic macular edema, retinopathy and age-related macular degeneration as inflammatory conditions. Archives of Medical Science, 12(5), 1142–1157. https://doi.org/10. 5114/aoms.2016.61918. Dawes, P., Cruickshanks, K. J., Moore, D. R., Edmondson-Jones, M., McCormack, A., Fortnum, H., & Munro, K. J. (2014). Cigarette smoking, passive smoking, alcohol consumption, and hearing loss. Journal of the Association for Research in Otolaryngology, 15(4), 663–674. https://doi.org/10.1007/s10162-014-0461-0. Dayalu, P., & Albin, R. L. (2015). Huntington disease: Pathogenesis and treatment. Neurologic Clinics, 33(1), 101–114. https://doi.org/10.1016/j.ncl.2014.09.003. de Gaetano, G., Costanzo, S., Di Castelnuovo, A., Badimon, L., Bejko, D., Alkerwi, A., ChivaBlanch, G., Estruch, R., La Vecchia, C., Panico, S., Pounis, G., Sofi, F., et al. (2016). Effects of moderate beer consumption on health and disease: A consensus document. Nutrition, Metabolism, and Cardiovascular Diseases, 26(6), 443–467. https://doi.org/10.1016/j.numecd.2016.03. 007. de Lange, T., & Jacks, T. (1999). For better or worse? Telomerase inhibition and cancer. Cell, 98(3), 273–275. https://doi.org/10.1016/s0092-8674(00)81955-8. de Lau, L. M., & Breteler, M. M. (2006). Epidemiology of Parkinson’s disease. Lancet Neurology, 5(6), 525–535. https://doi.org/10.1016/S1474-4422(06)70471-9. de Oliveira, F. F., Chen, E. S., Smith, M. C., & Bertolucci, P. H. (2016). Associations of blood pressure with functional and cognitive changes in patients with Alzheimer’s disease. Dementia and Geriatric Cognitive Disorders, 41(5–6), 314–323. https://doi.org/10.1159/000447585. De Pergola, G., Triggiani, V., Bartolomeo, N., Nardecchia, A., Giagulli, V. A., Bruno, I., Caccavo, D., & Silvestris, F. (2016). Independent relationship of Osteocalcin circulating levels with obesity, type 2 diabetes, hypertension, and HDL cholesterol. Endocrine, Metabolic & Immune Disorders Drug Targets, 16(4), 270–275. https://doi.org/10.2174/ 1871530317666170106150756.

References

331

Devlin, H., & Ferguson, M. W. J. (1998). Aging and the Orofacial tissues. In R. C. Tallis, H. M. Fillit, & J. C. Brocklehurst (Eds.), Brocklehurst’s textbook of geriatric medicine and gerontology (5th ed., pp. 789–802). New York: Churchill Livingstone. Di Castelnuovo, A., Costanzo, S., Bagnardi, V., Donati, M. B., Iacoviello, L., & de Gaetano, G. (2006). Alcohol dosing and total mortality in men and women: An updated meta-analysis of 34 prospective studies. Archives of Internal Medicine, 166(22), 2437–2445. https://doi.org/10. 1001/archinte.166.22.2437. Dinis-Oliveira, R. J., Mãgalhaes, T., Queirós, O., Proença, J. B., Moreira, R., de Lourdes, B. M., & Carvalho, F. (2015). Signs and related mechanisms of ethanol hepatotoxicity. Current Drug Abuse Reviews, 8(2), 86–103. https://doi.org/10.2174/1874473708666150916113352. Dixon, J. B., & O’Brien, P. E. (2006). Obesity and the white blood cell count: Changes with sustained weight loss. Obesity Surgery, 16(3), 251–257. https://doi.org/10.1381/ 096089206776116453. Dokal, I. (2000). Dyskeratosis congenita in all its forms. British Journal of Haematology, 110(4), 768–779. https://doi.org/10.1046/j.1365-2141.2000.02109.x. Duda-Sobczak, A., Araszkiewicz, A., Urbas, M., Borucki, L., Kulas, K., Chudzinski, M., Suwalska, A., & Zozulinska-Ziolkiewicz, D. (2017). Impaired olfactory function is related to the presence of neuropathy in adults with type 1 diabetes. Diabetes & Vascular Disease Research, 14(2), 139–143. https://doi.org/10.1177/1479164116679079. Durazzo, T. C., Mattsson, N., Weiner, M. W., & Alzheimer’s Disease Neuroimaging Initiative. (2014). Smoking and increased Alzheimer’s disease risk: A review of potential mechanisms. Alzheimers Dement, 10(3 Suppl), S122–S145. https://doi.org/10.1016/j.jalz.2014.04.009. Dyck, P. J., Kratz, K. M., Karnes, J. L., Litchy, W. J., Klein, R., Pach, J. M., Wilson, D. M., O’Brien, P. C., Melton, L. J., 3rd, & Service, F. J. (1993). The prevalence by staged severity of various types of diabetic neuropathy, retinopathy, and nephropathy in a population-based cohort: The Rochester diabetic neuropathy study. Neurology, 43(4), 817–824. https://doi.org/ 10.1212/wnl.43.4.817. Ejerblad, E., Fored, C. M., Lindblad, P., Fryzek, J., McLaughlin, J. K., & Nyrén, O. (2006). Obesity and risk for chronic renal failure. Journal of the American Society of Nephrology, 17(6), 1695–1702. https://doi.org/10.1681/ASN.2005060638. El-Serag, H. B., & Everhart, J. E. (2002). Diabetes increases the risk of acute hepatic failure. Gastroenterology, 122(7), 1822–1828. https://doi.org/10.1053/gast.2002.33650. El-Zayadi, A. R. (2006). Heavy smoking and liver. World Journal of Gastroenterology, 12(38), 6098–6101. https://doi.org/10.3748/wjg.v12.i38.6098. Emamian, M., Hasanian, S. M., Tayefi, M., Bijari, M., Movahedian Far, F., Shafiee, M., Avan, A., Heidari-Bakavoli, A., Moohebati, M., Ebrahimi, M., Darroudi, S., Zamani, P., et al. (2017). Association of hematocrit with blood pressure and hypertension. Journal of Clinical Laboratory Analysis, 31(6). https://doi.org/10.1002/jcla.22124. Emanuel, A. L., Nieuwenhoff, M. D., Klaassen, E. S., Verma, A., Kramer, M. H., Strijers, R., Vrancken, A. F., Eringa, E., Groeneveld, G. J., & Serné, E. H. (2017). Relationships between type 2 diabetes, neuropathy, and microvascular dysfunction: Evidence from patients with cryptogenic axonal polyneuropathy. Diabetes Care, 40(4), 583–590. https://doi.org/10.2337/ dc16-1690. Entringer, S., de Punder, K., Buss, C., & Wadhwa, P. D. (2018). The fetal programming of telomere biology hypothesis: An update. Philosophical Transaction of the Royal Society of London B Biological Sciences, 373(1741), 20170151. https://doi.org/10.1098/rstb.2017.0151. Eriksson, A. K., Löfving, S., Callaghan, R. C., & Allebeck, P. (2013). Alcohol use disorders and risk of Parkinson’s disease: Findings from a Swedish national cohort study 1972–2008. BMC Neurology, 13, 190. https://doi.org/10.1186/1471-2377-13-190. EU-Working Group on Tobacco and Oral Health. (2000). Tobacco and oral diseases – Report of EU Working Group, 1999. Journal of the Irish Dental Association, 46(1), 12–19. 22.

332

7

The Elderly Subjects and Their Troubles

Faghri, S., Tamura, D., Kraemer, K. H., & Digiovanna, J. J. (2008). Trichothiodystrophy: A systematic review of 112 published cases characterises a wide spectrum of clinical manifestations. Journal of Medical Genetics, 45(10), 609–621. https://doi.org/10.1136/jmg.2008.058743. Falah, M., Najafi, M., Houshmand, M., & Farhadi, M. (2016). Expression levels of the BAK1 and BCL2 genes highlight the role of apoptosis in age-related hearing impairment. Clinical Interventions in Aging, 11, 1003–1008. https://doi.org/10.2147/CIA.S109110. Feng, L., & Wang, L. (2013). Effects of alcohol on the morphological and structural changes in oral mucosa. Pakistan Journal of Medical Sciences, 29(4), 1046–1049. https://doi.org/10.12669/ pjms.294.3696. Fernandes, L. M., Teixeira, F. B., Alves-Junior, S. M., Pinheiro Jde, J., Maia, C. S., & Lima, R. R. (2015). Immunohistochemical changes and atrophy after chronic ethanol intoxication in rat salivary glands. Histology & Histopathology, 30(9), 1069–1078. https://doi.org/10.14670/HH11-604. Fernández, J. A., Prats, J. M., Artero, J. V., Mora, A. C., Fariñas, A. V., Espinal, A., & Méndez, J. A. (2012). Systemic inflammation in 222.841 healthy employed smokers and nonsmokers: White blood cell count and relationship to spirometry. Tobacco Induced Diseases, 10(1), 7. https://doi.org/10.1186/1617-9625-10-7. Fernández-Solà, J. (2015). Cardiovascular risks and benefits of moderate and heavy alcohol consumption. Nature Reviews Cardiology, 12(10), 576–587. https://doi.org/10.1038/nrcardio. 2015.91. Fillit, H. M., Rockwood, K., & Young, J. B. (Eds.). (2017). Brocklehurst’s textbook of geriatric medicine and gerontology (8th ed.). Elsevier: Philadelphia. Finch, C. E. (1990). Longevity, senescence, and the genome. Chicago: University of Chicago Press. Flavahan, S., Chang, F., & Flavahan, N. A. (2016). Local renin-angiotensin system mediates endothelial dilator dysfunction in aging arteries. American Journal of Physiology, Heart and Circulatory Physiology, 311(3), H849–H854. https://doi.org/10.1152/ajpheart.00422.2016. Forero, D. A., González-Giraldo, Y., López-Quintero, C., Castro-Vega, L. J., Barreto, G. E., & Perry, G. (2016). Meta-analysis of telomere length in Alzheimer’s disease. The Journals of Gerontology Series A, Biological Sciences and Medical Sciences, 71(8), 1069–1073. https://doi. org/10.1093/gerona/glw053. Fortes, C., Mastroeni, S., Mannooranparampil, T. J., & Ribuffo, M. (2017). The combination of overweight and smoking increases the severity of androgenetic alopecia. International Journal of Dermatology, 56(8), 862–867. https://doi.org/10.1111/ijd.13652. Fossel, M. B. (2004). Cells, aging and human disease. New York: Oxford University Press. Frank, S. (2014). Treatment of Huntington’s disease. Neurotherapeutics, 11(1), 153–160. https:// doi.org/10.1007/s13311-013-0244-z. Fransen, E., Topsakal, V., Hendrickx, J. J., Van Laer, L., Huyghe, J. R., Van Eyken, E., Lemkens, N., Hannula, S., Mäki-Torkko, E., Jensen, M., Demeester, K., & Tropitzsch, A. (2008). Occupational noise, smoking, and a high body mass index are risk factors for age-related hearing impairment and moderate alcohol consumption is protective: A European populationbased multicenter study. Journal of the Association for Research in Otolaryngology, 9(3), 264–276. https://doi.org/10.1007/s10162-008-0123-1. Frantz, S., Wollmer, P., Dencker, M., Engström, G., & Nihlén, U. (2014). Associations between lung function and alcohol consumption--assessed by both a questionnaire and a blood marker. Respiratory Medicine, 108(1), 114–121. https://doi.org/10.1016/j.rmed.2013.08.041. Fraser-Bell, S., Wu, J., Klein, R., Azen, S. P., & Varma, R. (2006). Smoking, alcohol intake, estrogen use, and age-related macular degeneration in Latinos: The Los Angeles Latino eye study. American Journal of Ophthalmology, 141(1), 79–87. https://doi.org/10.1016/j.ajo.2005. 08.024. Fukuchi, K., Martin, G. M., & Monnat, R. J., Jr. (1989). Mutator phenotype of Werner syndrome is characterized by extensive deletions. Proceedings of the National Academy of Sciences of the United States of America, 86(15), 5893–5897. https://doi.org/10.1073/pnas.86.15.5893.

References

333

[Published erratum appears in Proceedings of the National Academy of Sciences of the United States of America, 86(20), 7994 (1989)]. Garcia-Compean, D., Jaquez-Quintana, J. O., Gonzalez-Gonzalez, J. A., & Maldonado-Garza, H. (2009). Liver cirrhosis and diabetes: Risk factors, pathophysiology, clinical implications and management. World Journal of Gastroenterology, 15(3), 280–288. https://doi.org/10.3748/ wjg.15.280. Gardner, J. D., & Mouton, A. J. (2015). Alcohol effects on cardiac function. Comprehensive Physiology, 5(2), 791–802. https://doi.org/10.1002/cphy.c140046. Gatherwright, J., Liu, M. T., Gliniak, C., Totonchi, A., & Guyuron, B. (2012). The contribution of endogenous and exogenous factors to female alopecia: A study of identical twins. Plastic and Reconstructive Surgery, 130(6), 1219–1226. https://doi.org/10.1097/PRS.0b013e31826d104f. Gatherwright, J., Liu, M. T., Amirlak, B., Gliniak, C., Totonchi, A., & Guyuron, B. (2013). The contribution of endogenous and exogenous factors to male alopecia: A study of identical twins. Plastic and Reconstructive Surgery, 131(5), 794e–801e. https://doi.org/10.1097/PRS. 0b013e3182865ca9. Geiger, H., & van Zant, G. (2002). The aging of lympho-hematopoietic stem cells. Nature Immunology, 3(4), 329–333. https://doi.org/10.1038/ni0402-329. Ghaem Maralani, H., Tai, B. C., Wong, T. Y., Tai, E. S., Li, J., Wang, J. J., & Mitchell, P. (2015). Metabolic syndrome and risk of age-related macular degeneration. Retina, 35(3), 459–466. https://doi.org/10.1097/IAE.0000000000000338. Gibon, E., Lu, L., & Goodman, S. B. (2016). Aging, inflammation, stem cells, and bone healing. Stem Cell Research & Therapy, 7, 44. https://doi.org/10.1186/s13287-016-0300-9. Gimbrone, M. A., Jr. (1999). Endothelial dysfunction, hemodynamic forces, and atherosclerosis. Thrombosis and Haemostasis, 82(2), 722–726. Gong, Y., Feng, K., Yan, N., Xu, Y., & Pan, C. W. (2015). Different amounts of alcohol consumption and cataract: A meta-analysis. Optometry and Vision Science, 92(4), 471–479. https://doi.org/10.1097/OPX.0000000000000558. Goodman, C. A., Pol, D., Zacharewicz, E., Lee-Young, R. S., Snow, R. J., Russell, A. P., & McConell, G. K. (2015). Statin-induced increases in atrophy gene expression occur independently of changes in PGC1α protein and mitochondrial content. PLoS One, 10(5), e0128398. https://doi.org/10.1371/journal.pone.0128398. Gopinath, B., Flood, V. M., McMahon, C. M., Burlutsky, G., Smith, W., & Mitchell, P. (2010). The effects of smoking and alcohol consumption on age-related hearing loss: The Blue Mountains hearing study. Ear and Hearing, 31(2), 277–282. https://doi.org/10.1097/AUD. 0b013e3181c8e902. Gorelick, P. B. (2004). Risk factors for vascular dementia and Alzheimer disease. Stroke, 35 (11 Suppl 1), 2620–2622. https://doi.org/10.1161/01.STR.0000143318.70292.47. Goto, M., Miller, R. W., Ishikawa, Y., & Sugano, H. (1996). Excess of rare cancers in Werner syndrome (adult progeria). Cancer Epidemiology, Biomarkers & Prevention, 5(4), 239–246. https://cebp.aacrjournals.org/content/5/4/239.long. Gouveri, E., Katotomichelakis, M., Gouveris, H., Danielides, V., Maltezos, E., & Papanas, N. (2014). Olfactory dysfunction in type 2 diabetes mellitus: An additional manifestation of microvascular disease? Angiology, 65(10), 869–876. https://doi.org/10.1177/ 0003319714520956. Greenhouse, L., & Lardinois, C. K. (1996). Alcohol-associated diabetes mellitus. A review of the impact of alcohol consumption on carbohydrate metabolism. Archives of Family Medicine, 5(4), 229–233. https://doi.org/10.1001/archfami.5.4.229. Gress, T. W., Nieto, F. J., Shahar, E., Wofford, M. R., & Brancati, F. L. (2000). Hypertension and antihypertensive therapy as risk factors for type 2 diabetes mellitus. Atherosclerosis risk in communities study. The New England Journal of Medicine, 342(13), 905–912. https://doi.org/ 10.1056/NEJM200003303421301.

334

7

The Elderly Subjects and Their Troubles

Gu, S., Li, R., Leader, J. K., Zheng, B., Bon, J., Gur, D., Sciurba, F., Jin, C., & Pu, J. (2015). Obesity and extent of emphysema depicted at CT. Clinical Radiology, 70(5), e14–e19. https:// doi.org/10.1016/j.crad.2015.01.007. Gupta, V. B., Rajagopala, M., & Ravishankar, B. (2014). Etiopathogenesis of cataract: An appraisal. Indian Journal of Ophthalmology, 62(2), 103–110. https://doi.org/10.4103/03014738.121141. Habot-Wilner, Z., & Belkin, M. (2005). Obesity is a risk factor for eye diseases (article in Hebrew). Harefuah, 144(11), 805–809. 821. Han, C., Linser, P., Park, H. J., Kim, M. J., White, K., Vann, J. M., Ding, D., Prolla, T. A., & Someya, S. (2016). Sirt1 deficiency protects cochlear cells and delays the early onset of age-related hearing loss in C57BL/6 mice. Neurobiology of Aging, 43, 58–71. https://doi.org/ 10.1016/j.neurobiolaging.2016.03.023. Handelsman, D. J., & Staraj, S. (1985). Testicular size: The effects of aging, malnutrition, and illness. Journal of Andrology, 6(3), 144–151. https://doi.org/10.1002/j.1939-4640.1985. tb00830.x. Handelsman, D. J., Conway, A. J., Boylan, L. M., & Turtle, J. R. (1984). Testicular function in potential sperm donors: Normal ranges and the effects of smoking and varicocele. International Journal of Andrology, 7(5), 369–382. https://doi.org/10.1111/j.1365-2605.1984.tb00794.x. Hao, L. Y., Armanios, M., Strong, M. A., Karim, B., Feldser, D. M., Huso, D., & Greider, C. W. (2005). Short telomeres, even in the presence of telomerase, limit tissue renewal capacity. Cell, 123(6), 1121–1131. https://doi.org/10.1016/j.cell.2005.11.020. Hao, S. Y., Ren, M., Yang, C., Lin, D. Z., Chen, L. H., Zhu, P., Cheng, H., & Yan, L. (2011). Activation of skin renin-angiotensin system in diabetic rats. Endocrine, 39(3), 242–250. https:// doi.org/10.1007/s12020-010-9428-z. Hart, R. J., Doherty, D. A., McLachlan, R. I., Walls, M. L., Keelan, J. A., Dickinson, J. E., Skakkebaek, N. E., Norman, R. J., & Handelsman, D. J. (2015). Testicular function in a birth cohort of young men. Human Reproduction, 30(12), 2713–2724. https://doi.org/10.1093/ humrep/dev244. Hayflick, L. (2000). The future of ageing. Nature, 408(6809), 267–269. https://doi.org/10.1038/ 35041709. He, Y. H., Jiang, G. X., Yang, Y., Huang, H. E., Li, R., Li, X. Y., Ning, G., & Cheng, Q. (2009). Obesity and its associations with hypertension and type 2 diabetes among Chinese adults age 40 years and over. Nutrition, 25(11–12), 1143–1149. https://doi.org/10.1016/j.nut.2009.04.003. Heckmann, J. G., Höcherl, C., Dütsch, M., Lang, C., Schwab, S., & Hummel, T. (2009). Smell and taste disorders in polyneuropathy: A prospective study of chemosensory disorders. Acta Neurologica Scandinavica, 120(4), 258–263. https://doi.org/10.1111/j.1600-0404.2008. 01151.x. Helzner, E. P., & Contrera, K. J. (2016). Type 2 diabetes and hearing impairment. Current Diabetes Reports, 16(1), 3. https://doi.org/10.1007/s11892-015-0696-0. Hershey, L. A., & Perlmutter, J. S. (2014). Smoking and Parkinson disease: Where there is smoke there may not be fire. Neurology, 83(16), 1392–1393. https://doi.org/10.1212/WNL. 0000000000000896. Heymann, D., Stern, Y., Cosentino, S., Tatarina-Nulman, O., Dorrejo, J. N., & Gu, Y. (2016). The association between alcohol use and the progression of Alzheimer’s disease. Current Alzheimer Research, 13(12), 1356–1362. https://doi.org/10.2174/1567205013666160603005035. Hickman, I. J., & Macdonald, G. A. (2007). Impact of diabetes on the severity of liver disease. The American Journal of Medicine, 120(10), 829–834. https://doi.org/10.1016/j.amjmed.2007.03. 025. Higuchi, T., Omata, F., Tsuchihashi, K., Higashioka, K., Koyamada, R., & Okada, S. (2016). Current cigarette smoking is a reversible cause of elevated white blood cell count: Crosssectional and longitudinal studies. Preventive Medical Reports, 4, 417–422. https://doi.org/10. 1016/j.pmedr.2016.08.009. Hill, K., & Hurtado, A. M. (1996). Ache life history. New York: Aldine De Gruyter.

References

335

Hill, J. M., Zalos, G., Halcox, J. P., Schenke, W. H., Waclawiw, M. A., Quyyumi, A. A., & Finkel, T. (2003). Circulating endothelial progenitor cells, vascular function, and cardiovascular risk. The New England Journal of Medicine, 348(7), 593–600. https://doi.org/10.1056/ NEJMoa022287. Himmelmann, A. (1999). Hypertension: An important precursor of heart failure. Blood Pressure, 8 (5–6), 253–260. https://doi.org/10.1080/080370599439454. Hiratsuka, Y., Ono, K., & Murakami, A. (2009). Alcohol use and cataract. Current Drug Abuse Reviews, 2(3), 226–229. https://doi.org/10.2174/1874473710902030226. Horiuchi, Y., Hirayama, S., Soda, S., Seino, U., Kon, M., Ueno, T., Idei, M., Hanyu, O., Tsuda, T., Ohmura, H., & Miida, T. (2010). Statin therapy reduces inflammatory markers in hypercholesterolemic patients with high baseline levels. Journal of Atherosclerosis and Thrombosis, 17(7), 722–729. https://doi.org/10.5551/jat.3632. Horvath, S., Erhart, W., Brosch, M., Ammerpohl, O., von Schönfels, W., Ahrens, M., Heits, N., Bell, J. T., Tsai, P. C., Spector, T. D., Deloukas, P., Siebert, R., et al. (2014). Obesity accelerates epigenetic aging of human liver. Proceedings of the National Academy of Sciences of the United States of America, 111(43), 15538–15543. https://doi.org/10.1073/pnas.1412759111. Hruby, A., Manson, J. E., Qi, L., Malik, V. S., Rimm, E. B., Sun, Q., Willett, W. C., & Hu, F. B. (2016). Determinants and consequences of obesity. American Journal of Public Health, 106(9), 1656–1662. https://doi.org/10.2105/AJPH.2016.303326. Hu, G., Jousilahti, P., Nissinen, A., Antikainen, R., Kivipelto, M., & Tuomilehto, J. (2006). Body mass index and the risk of Parkinson disease. Neurology, 67(11), 1955–1959. https://doi.org/10. 1212/01.wnl.0000247052.18422.e5. Hu, G., Jousilahti, P., Bidel, S., Antikainen, R., & Tuomilehto, J. (2007). Type 2 diabetes and the risk of Parkinson’s disease. Diabetes Care, 30(4), 842–847. https://doi.org/10.2337/dc06-2011. Huang, W. J., Zhang, X., & Chen, W. W. (2016). Association between alcohol and Alzheimer’s disease. Experimental and Therapeutic Medicine, 12(3), 1247–1250. https://doi.org/10.3892/ etm.2016.3455. Ilomaki, J., Jokanovic, N., Tan, E. C., & Lonnroos, E. (2015). Alcohol consumption, dementia and cognitive decline: An overview of systematic reviews. Current Clinical Pharmacology, 10(3), 204–212. https://doi.org/10.2174/157488471003150820145539. Ingawale, D. K., Mandlik, S. K., & Naik, S. R. (2014). Models of hepatotoxicity and the underlying cellular, biochemical and immunological mechanism(s): A critical discussion. Environmental Toxicology and Pharmacology, 37(1), 118–133. https://doi.org/10.1016/j.etap.2013.08.015. Ishihara, L., & Brayne, C. (2005). A systematic review of nutritional risk factors of Parkinson’s disease. Nutrition Research Reviews, 18(2), 259–282. https://doi.org/10.1079/NRR2005108. Jalayer Naderi, N., Semyari, H., & Elahinia, Z. (2015). The impact of smoking on gingiva: A Histopathological study. Iranian Journal of Pathology, 10(3), 214–220. www.ncbi.nlm.nih. gov/pmc/articles/PMC4539769/. Jamshidi, L., & Seif, A. (2017). Association between obesity, White blood cell and platelet count. Zahedan Journal of Research in Medical Sciences, 19(2), e4955. https://doi.org/10.5812/zjrms. 4955. Jonassaint, N. L., Guo, N., Califano, J. A., Montgomery, E. A., & Armanios, M. (2013). The gastrointestinal manifestations of telomere-mediated disease. Aging Cell, 12(2), 319–323. https://doi.org/10.1111/acel.12041. Katsi, V. K., Marketou, M. E., Vrachatis, D. A., Manolis, A. J., Nihoyannopoulos, P., Tousoulis, D., Vardas, P. E., & Kallikazaros, I. (2015). Essential hypertension in the pathogenesis of age-related macular degeneration: A review of the current evidence. Journal of Hypertension, 33(12), 2382–2388. https://doi.org/10.1097/HJH.0000000000000766. Kazancioğlu, R. (2013). Risk factors for chronic kidney disease: An update. Kidney International. Supplement, 3(4), 368–371. https://doi.org/10.1038/kisup.2013.79. Khayrullin, A., Smith, L., Mistry, D., Dukes, A., Pan, Y. A., & Hamrick, M. W. (2016). Chronic alcohol exposure induces muscle atrophy (myopathy) in zebrafish and alters the expression of

336

7

The Elderly Subjects and Their Troubles

microRNAs targeting the Notch pathway in skeletal muscle. Biochemical and Biophysical Research Communications, 479(3), 590–595. https://doi.org/10.1016/j.bbrc.2016.09.117. Kim, D. J., Noh, J. H., Lee, B. W., Choi, Y. H., Chung, J. H., Min, Y. K., Lee, M. S., Lee, M. K., & Kim, K. W. (2008). The associations of total and differential white blood cell counts with obesity, hypertension, dyslipidemia and glucose intolerance in a Korean population. Journal of Korean Medical Science, 23(2), 193–198. https://doi.org/10.3346/jkms.2008.23.2.193. Kim, J. Y., Lee, D. Y., Lee, Y. J., Park, K. J., Kim, K. H., Kim, J. W., & Kim, W. H. (2015). Chronic alcohol consumption potentiates the development of diabetes through pancreatic β-cell dysfunction. World Journal of Biological Chemistry, 6(1), 1–15. https://doi.org/10.4331/wjbc. v6.i1.1. Kim, J.-H., Noh, J., Choi, J. W., & Park, E. C. (2017). Association of education and smoking status on risk of diabetes mellitus: A population-based Nationwide cross-sectional study. International Journal of Environmental Research and Public Health, 14(6). https://doi.org/10.3390/ ijerph14060655. Kirkwood, T. B., & Austad, S. N. (2000). Why do we age? Nature, 408(6809), 233–238. https://doi. org/10.1038/35041682. Klein, R., Deng, Y., Klein, B. E., Hyman, L., Seddon, J., Frank, R. N., Wallace, R. B., Hendrix, S. L., Kuppermann, B. D., Langer, R. D., Kuller, L., Brunner, R., et al. (2007). Cardiovascular disease, its risk factors and treatment, and age-related macular degeneration: Women’s health Initiative sight exam ancillary study. American Journal of Ophthalmology, 143(3), 473–483. https://doi.org/10.1016/j.ajo.2006.11.058. Klein, R., Cruickshanks, K. J., Nash, S. D., Krantz, E. M., Nieto, F. J., Huang, G. H., Pankow, J. S., & Klein, B. E. (2010). The prevalence of age-related macular degeneration and associated risk factors. Archives of Ophthalmology, 128(6), 750–758. https://doi.org/10.1001/archophthalmol. 2010.92. Koike, H., & Sobue, G. (2006). Alcoholic neuropathy. Current Opinion in Neurology, 19(5), 481–486. https://doi.org/10.1097/01.wco.0000245371.89941.eb. Konukoglu, D., & Uzun, H. (2016). Endothelial dysfunction and hypertension. In S. Islam (Ed.), Hypertension: from basic research to clinical practice (pp. 511–540). Cham: Springer. https:// doi.org/10.1007/978-3-319-44251-8. Koppes, L. L., Dekker, J. M., Hendriks, H. F., Bouter, L. M., & Heine, R. J. (2005). Moderate alcohol consumption lowers the risk of type 2 diabetes: A meta-analysis of prospective observational studies. Diabetes Care, 28(3), 719–725. https://doi.org/10.2337/diacare.28.3.719. Kovesdy, C. P., Furth, S., Zoccali, C., & World Kidney Day Steering Committee. (2017). Obesity and kidney disease: Hidden consequences of the epidemic. Physiology International, 104(1), 1–14. https://doi.org/10.1556/2060.104.2017.1.9. Koye, D. N., Shaw, J. E., Reid, C. M., Atkins, R. C., Reutens, A. T., & Magliano, D. J. (2017). Incidence of chronic kidney disease among people with diabetes: A systematic review of observational studies. Diabetic Medicine, 34(7), 887–901. https://doi.org/10.1111/dme.13324. Kurozumi, A., Okada, Y., Arao, T., & Tanaka, Y. (2016). Excess visceral adipose tissue worsens the vascular endothelial function in patients with type 2 diabetes mellitus. Internal Medicine, 55 (21), 3091–3095. https://doi.org/10.2169/internalmedicine.55.6940. Larizza, L., Roversi, G., & Volpi, L. (2010). Rothmund-Thomson syndrome. Orphanet Journal of Rare Diseases, 5, 2. https://doi.org/10.1186/1750-1172-5-2. Laugel, V. (2013). Cockayne syndrome: The expanding clinical and mutational spectrum. Mechanisms of Ageing and Development, 134(5–6), 161–170. https://doi.org/10.1016/j.mad.2013.02. 006. Laurent, D., & Edwards, J. G. (2014). Alcoholic cardiomyopathy: Multigenic changes underlie cardiovascular dysfunction. Journal of Cardiology & Clinical Research, 2(1) www.ncbi.nlm. nih.gov/pmc/articles/PMC4607291/. Lea, J. P., & Nicholas, S. B. (2002). Diabetes mellitus and hypertension: Key risk factors for kidney disease. Journal of the National Medical Association, 94(8 Suppl), S7–S15. www.ncbi.nlm.nih. gov/pmc/articles/PMC2594170/.

References

337

Lee, H. W., Blasco, M. A., Gottlieb, G. J., Horner, J. W., 2nd, Greider, C. W., & DePinho, R. A. (1998). Essential role of mouse telomerase in highly proliferative organs. Nature, 392(6676), 569–574. https://doi.org/10.1038/33345. Lee, H. Y., Choi, Y. J., Choi, H. J., Choi, M. S., Chang, D. S., Kim, A. Y., & Cho, C. S. (2016). Metabolic syndrome is not an independent risk factor for hearing impairment. The Journal of Nutrition, Health & Aging, 20(8), 816–824. https://doi.org/10.1007/s12603-015-0647-0. Leenders, M., Verdijk, L. B., van der Hoeven, L., Adam, J. J., van Kranenburg, J., Nilwik, R., & van Loon, L. J. (2013). Patients with type 2 diabetes show a greater decline in muscle mass, muscle strength, and functional capacity with aging. Journal of the American Medical Directors Association, 14(8), 585–592. https://doi.org/10.1016/j.jamda.2013.02.006. Lehmann, A. R., McGibbon, D., & Stefanini, M. (2011). Xeroderma pigmentosum. Orphanet Journal of Rare Diseases, 6, 70. https://doi.org/10.1186/1750-1172-6-70. Leifert, J. A. (2008). Anaemia and cigarette smoking. International Journal of Laboratory Hematology, 30(3), 177–184. https://doi.org/10.1111/j.1751-553X.2008.01067.x. Leone, A. (2015). Toxics of tobacco smoke and cardiovascular system: From functional to cellular damage. Current Pharmaceutical Design, 21(30), 4370–4379. https://doi.org/10.2174/ 1381612821666150803145149. Leone, A., Landini, L., Jr., Biadi, O., & Balbarini, A. (2008). Smoking and cardiovascular system: Cellular features of the damage. Current Pharmaceutical Design, 14(18), 1771–1777. https:// doi.org/10.2174/138161208784746699. Li, L., Wan, X. H., & Zhao, G. H. (2014). Meta-analysis of the risk of cataract in type 2 diabetes. BMC Ophthalmology, 14, 94. https://doi.org/10.1186/1471-2415-14-94. Li, Z., Xu, K., Wu, S., Sun, Y., Song, Z., Jin, D., & Liu, P. (2014). Alcohol consumption and visual impairment in a rural Northern Chinese population. Ophthalmic Epidemiology, 21(6), 384–390. https://doi.org/10.3109/09286586.2014.967360. Li, X., Li, W., Liu, G., Shen, X., & Tang, Y. (2015). Association between cigarette smoking and Parkinson’s disease: A meta-analysis. Archives of Gerontology and Geriatrics, 61(3), 510–516. https://doi.org/10.1016/j.archger.2015.08.004. Li, D. W., Li, J. H., Wang, Y. D., & Li, G. R. (2015). Atorvastatin protects endothelial colonyforming cells against H2O2-induced oxidative damage by regulating the expression of annexin A2. Molecular Medicine Reports, 12(6), 7941–7948. https://doi.org/10.3892/mmr.2015.4440. Li, X. S., He, H., Zhao, Y. L., Li, Y., Liu, Z. P., Liu, T., Zhang, Y., Yu, K. J., & Wang, R. T. (2016). Bone mineral density is negatively associated with arterial stiffness in men with hypertension. Journal of Clinical Hypertension, 18(11), 1106–1111. https://doi.org/10.1111/jch.12848. Li, J. S. Z., Fusté, J. M., Simavorian, T., Bartocci, C., Tsai, J., Karsleder, J., & Lazzerini Denchi, E. (2017a). TZAP: A telomere-associated protein involved in telomere length control. Science, 355(6325), 638–641. https://doi.org/10.1126/science.aah6752. Li, W., Du, D. Y., Liu, Y., Jiang, F., Zhang, P., & Li, Y. T. (2017b). Long-term nicotine exposure induces dysfunction of mouse endothelial progenitor cells. Experimental and Therapeutic Medicine, 13(1), 85–90. https://doi.org/10.3892/etm.2016.3916. Liao, J. K., & Laufs, U. (2005). Pleiotropic effects of statins. Annual Review of Pharmacology and Toxicology, 45, 89–118. https://doi.org/10.1146/annurev.pharmtox.45.120403.095748. Libertini, G. (1983). Ragionamenti evoluzionistici [Book in Italian]. Naples: Società Editrice Napoletana. English edition (2011): Evolutionary arguments on aging, disease, and other topics. Azinet Press, Crownsville (MD). Libertini, G. (1988). An adaptive theory of the increasing mortality with increasing chronological age in populations in the wild. Journal of Theoretical Biology, 132(2), 145–162. https://doi.org/ 10.1016/s0022-5193(88)80153-x. Libertini, G. (2006). Evolutionary explanations of the “actuarial senescence in the wild” and of the “state of senility”. ScientificWorldJournal, 6, 1086–1108. https://doi.org/10.1100/tsw.2006. 209.

338

7

The Elderly Subjects and Their Troubles

Libertini, G. (2009). The role of telomere-telomerase system in age-related fitness decline, a tameable process. In L. Mancini (Ed.), Telomeres: Function, shortening and lengthening (pp. 77–132). New York: Nova Science Publ. Libertini, G. (2012). Classification of Phenoptotic phenomena. Biochem (Mosc), 77(7), 707–715. https://doi.org/10.1134/S0006297912070024. Libertini, G. (2014). Programmed aging paradigm: How we get old. Biochemistry (Mosc), 79(10), 1004–1016. https://doi.org/10.1134/S0006297914100034. Libertini, G. (2015). Phylogeny of aging and related Phenoptotic phenomena. Biochem (Mosc), 80 (12), 1529–1546. https://doi.org/10.1134/S0006297915120019. Libertini, G. (2017). The feasibility and necessity of a revolution in Geriatric medicine. OBM Geriatrics, 1(2). https://doi.org/10.21926/obm.geriat.1702002 Libertini, G. (2019). Aging pathology. In D. Gu & M. Dupre (Eds.), Encyclopedia of gerontology and population aging. Cham: Springer. https://doi.org/10.1007/978-3-319-69892-2_33-1. Libertini, G., & Ferrara, N. (2016). Aging of perennial cells and organ parts according to the programmed aging paradigm. Age (Dordrecht, Netherlands), 38(2), 35. https://doi.org/10.1007/ s11357-016-9895-0. Libertini, G., Ferrara, N., Rengo, G., & Corbi, G. (2018). Elimination of senescent cells: Prospects according to the subtelomere-telomere theory. Biochemistry (Mosc), 83(12), 1477–1488. https:// doi.org/10.1134/S0006297918120064. Libertini, G., Corbi, G., Cellurale, M., & Ferrara, N. (2019). Age-related dysfunctions: Evidence and relationship with some risk factors and protective drugs. Biochemistry (Mosc), 84(12), 1442–1450. https://doi.org/10.1134/S0006297919120034. Lin, B. M., Curhan, S. G., Wang, M., Eavey, R., Stankovic, K. M., & Curhan, G. C. (2016). Hypertension, diuretic use, and risk of hearing loss. The American Journal of Medicine, 129(4), 416–422. https://doi.org/10.1016/j.amjmed.2015.11.014. Liu, Y., Kou, X., Chen, C., Yu, W., Su, Y., Kim, Y., Shi, S., & Liu, Y. (2016). Chronic high dose alcohol induces osteopenia via activation of mTOR signaling in bone marrow mesenchymal stem cells. Stem Cells, 34(8), 2157–2168. https://doi.org/10.1002/stem.2392. Lone, M. A., Shaikh, S., Lone, M. M., Afaq, A., & Lone, M. A. (2017). Association of salivary gland hypofunction with diabetes mellitus and drugs among the elderly in Karachi, Pakistan. Journal of Investigative and Clinical Dentistry, 8(2). https://doi.org/10.1111/jicd.12209. Lopez-Real, A., Rey, P., Soto-Otero, R., Mendez-Alvarez, E., & Labandeira-Garcia, J. L. (2005). Angiotensin-converting enzyme inhibition reduces oxidative stress and protects dopaminergic neurons in a 6-hydroxydopamine rat model of Parkinsonism. Journal of Neuroscience Research, 81(6), 865–873. https://doi.org/10.1002/jnr.20598. Ma, L., Wang, H. Y., Chow, J. Y., & Cho, C. H. (1999). Cigarette smoke increases apoptosis in the gastric mucosa: Role of epidermal growth factor. Digestion, 60(5), 461–468. https://doi.org/10. 1159/000007692. Maiya, R. P., & Messing, R. O. (2014). Peripheral systems: Neuropathy. Handbook of Clinical Neurology, 125, 513–525. https://doi.org/10.1016/B978-0-444-62619-6.00029-X. Malek, N., Lawton, M. A., Swallow, D. M., Grosset, K. A., Marrinan, S. L., Bajaj, N., Barker, R. A., Burn, D. J., Hardy, J., Morris, H. R., Williams, N. M., Wood, N., et al. (2016). Vascular disease and vascular risk factors in relation to motor features and cognition in early Parkinson’s disease. Movement Disorders, 31(10), 1518–1526. https://doi.org/10.1002/mds.26698. Mancia, G., Bombelli, M., Facchetti, R., Madotto, F., Quarti-Trevano, F., Grassi, G., & Sega, R. (2009). Increased long-term risk of new-onset diabetes mellitus in white-coat and masked hypertension. Journal of Hypertension, 27(8), 1672–1678. https://doi.org/10.1097/HJH. 0b013e32832be5f9. Manson, J. E., Ajani, U. A., Liu, S., Nathan, D. M., & Hennekens, C. H. (2000). A prospective study of cigarette smoking and the incidence of diabetes mellitus among US male physicians. The American Journal of Medicine, 109(7), 538–542. https://doi.org/10.1016/s0002-9343(00) 00568-4.

References

339

Marazita, M. C., Dugour, A., Marquioni-Ramella, M. D., Figueroa, J. M., & Suburo, A. M. (2016). Oxidative stress-induced premature senescence dysregulates VEGF and CFH expression in retinal pigment epithelial cells: Implications for age-related macular degeneration. Redox Biology, 7, 78–87. https://doi.org/10.1016/j.redox.2015.11.011. Marciniak, R., & Guarente, L. (2001). Human genetics. Testing telomerase. Nature, 413(6854), 370–372. https://doi.org/10.1038/35096663. Mares, J. A., Voland, R. P., Sondel, S. A., Millen, A. E., Larowe, T., Moeller, S. M., Klein, M. L., Blodi, B. A., Chappell, R. J., Tinker, L., Ritenbaugh, C., Gehrs, K. M., et al. (2011). Healthy lifestyles related to subsequent prevalence of age-related macular degeneration. Archives of Ophthalmology, 129(4), 470–480. https://doi.org/10.1001/archophthalmol.2010.314. Martin, G. M. (1990). Segmental and unimodal progeroid syndromes of man. In D. E. Harrison (Ed.), Genetic effects on aging (Vol. II, pp. 493–520). Caldwell: Telford Press. Martin, G. M. (2005). Genetic modulation of senescent phenotypes in Homo sapiens. Cell, 120(4), 523–532. www.sciencedirect.com/science/article/pii/S0092867405001054. Martin, G. M., & Oshima, J. (2000). Lessons from human progeroid syndromes. Nature, 408 (6809), 263–266. https://doi.org/10.1038/35041705. Martin, G. M., Sprague, C. A., & Epstein, C. J. (1970). Replicative life-span of cultivated human cells. Effects of donor’s age, tissue, and genotype. Laboratory Investigation, 23(1), 86–92. Martinez, C. H., & Han, M. K. (2012). Contribution of the environment and comorbidities to chronic obstructive pulmonary disease phenotypes. The Medical Clinics of North America, 96 (4), 713–727. https://doi.org/10.1016/j.mcna.2012.02.007. Martin-Jiménez, C. A., Gaitán-Vaca, D. M., Echeverria, V., González, J., & Barreto, G. E. (2017). Relationship between obesity, Alzheimer’s disease, and Parkinson’s disease: An Astrocentric view. Molecular Neurobiology, 54(9), 7096–7115. https://doi.org/10.1007/s12035-016-0193-8. Masoudi, F. A., & Inzucchi, S. E. (2007). Diabetes mellitus and heart failure: Epidemiology, mechanisms, and pharmacotherapy. The American Journal of Cardiology, 99(4A), 113B– 132B. https://doi.org/10.1016/j.amjcard.2006.11.013. Matilainen, V., Laakso, M., Hirsso, P., Koskela, P., Rajala, U., & Keinänen-Kiukaanniemi, S. (2003). Hair loss, insulin resistance, and heredity in middle-aged women. A populationbased study. Journal of Cardiovascular Risk, 10(3), 227–231. https://doi.org/10.1097/01.hjr. 0000070200.72977.c6. Medawar, P. B. (1952). An unsolved problem in biology. London: H. K. Lewis. Reprinted in: Medawar PB (1957) The uniqueness of the individual. Methuen, London. Mehdizadeh Seraj, J., Mehdizadeh Seraj, S., Zakeri, H., Bidar, Z., Hashemi, S., Mahdavi Parsa, F., & Yazdani, N. (2015). Olfactory dysfunction in Iranian diabetic patients. Acta Medica Iranica, 53(4), 204–206. http://acta.tums.ac.ir/index.php/acta/article/view/4906. Michel, J. P. (2016). Is it possible to delay or prevent age-related cognitive decline? Korean Journal of Family Medicine, 37(5), 263–266. https://doi.org/10.4082/kjfm.2016.37.5.263. Mirra, P., Nigro, C., Prevenzano, I., Procopio, T., Leone, A., Raciti, G. A., Andreozzi, F., Longo, M., Fiory, F., Beguinot, F., & Miele, C. (2017). The role of miR-190a in methylglyoxal-induced insulin resistance in endothelial cells. Biochimica et Biophysica Acta – Molecular Basis of Disease, 1863(2), 440–449. https://doi.org/10.1016/j.bbadis.2016.11.018. Mitchell, J. R., Wood, E., & Collins, K. (1999). A telomerase component is defective in the human disease dyskeratosis congenita. Nature, 402(6761), 551–555. https://doi.org/10.1038/990141. Mitteldorf, J. (2013). Telomere biology: Cancer firewall or aging clock? Biochemistry (Mosc), 78 (9), 1054–1060. https://doi.org/10.1134/S0006297913090125. Miyashita, H., Hatsusaka, N., Shibuya, E., Mita, N., Yamazaki, M., Shibata, T., Ishida, H., Ukai, Y., Kubo, E., & Sasaki, H. (2019). Association between ultraviolet radiation exposure dose and cataract in Han people living in China and Taiwan: A cross-sectional study. PLoS One, 14(4), e0215338. https://doi.org/10.1371/journal.pone.0215338. Monoski, M., Nudell, D. M., & Lipshultz, L. I. (2002). Effects of medical therapy, alcohol, and smoking on male fertility. Contemporary Urology, 14(6), 57–63.

340

7

The Elderly Subjects and Their Troubles

Munch, I. C., Linneberg, A., & Larsen, M. (2013). Precursors of age-related macular degeneration: Associations with physical activity, obesity, and serum lipids in the inter99 eye study. Investigative Ophthalmology & Visual Science, 54(6), 3932–3940. https://doi.org/10.1167/iovs.1210785. Muñoz, A., Garrido-Gil, P., Dominguez-Meijide, A., & Labandeira-Garcia, J. L. (2014). Angiotensin type 1 receptor blockage reduces l-dopa-induced dyskinesia in the 6-OHDA model of Parkinson’s disease. Involvement of vascular endothelial growth factor and interleukin-1β. Experimental Neurology, 261, 720–732. https://doi.org/10.1016/j.expneurol.2014.08.019. Mytas, D. Z., Stougiannos, P. N., Zairis, M. N., Foussas, S. G., Pyrgakis, V. N., & Kyriazis, I. A. (2009). Diabetic myocardial disease: Pathophysiology, early diagnosis and therapeutic options. Journal of Diabetes and its Complications, 23(4), 273–282. https://www.sciencedirect.com/ science/article/abs/pii/S1056872707001511. Nakanishi, N., Sato, M., Shirai, K., Suzuki, K., & Tatara, K. (2002). White blood cell count as a risk factor for hypertension; a study of Japanese male office workers. Journal of Hypertension, 20 (5), 851–857. https://doi.org/10.1097/00004872-200205000-00018. Nakanishi, N., Yoshida, H., Okamoto, M., Matsuo, Y., Suzuki, K., & Tatara, K. (2003). Association of alcohol consumption with white blood cell count: A study of Japanese male office workers. Journal of Internal Medicine, 253(3), 367–374. https://doi.org/10.1046/j.1365-2796.2003. 01112.x. Nance, M. A., & Berry, S. A. (1992). Cockayne syndrome: Review of 140 cases. American Journal of Medical Genetics, 42(1), 68–84. https://doi.org/10.1002/ajmg.1320420115. Navarro, C. L., De Sandre-Giovannoli, A., Bernard, R., Boccaccio, I., Boyer, A., Geneviève, D., Hadj-Rabia, S., Gaudy-Marqueste, C., Smitt, H. S., Vabres, P., Faivre, L., Verloes, A., et al. (2004). Lamin A and ZMPSTE 24 (FACE-1) defects cause nuclear disorganization and identify restrictive dermopathy as a lethal neonatal laminopathy. Human Molecular Genetics, 13(20), 2493–2503. https://doi.org/10.1093/hmg/ddh265. Nemecz, M., Alexandru, N., Tanko, G., & Georgescu, A. (2016). Role of MicroRNA in endothelial dysfunction and hypertension. Current Hypertension Reports, 18(12), 87. https://doi.org/10. 1007/s11906-016-0696-8. Nesse, R. M., & Williams, G. C. (1994). Why we get sick: The new science of Darwinian medicine. New York: Times Books. Niemelä, O., & Alatalo, P. (2010). Biomarkers of alcohol consumption and related liver disease. Scandinavian Journal of Clinical and Laboratory Investigation, 70(5), 305–312. https://doi.org/ 10.3109/00365513.2010.486442. Nikolopoulou, A., & Kadoglou, N. P. (2012). Obesity and metabolic syndrome as related to cardiovascular disease. Expert Review of Cardiovascular Therapy, 10(7), 933–939. https:// doi.org/10.1586/erc.12.74. Nunez, K., Kay, J., Krotow, A., Tong, M., Agarwal, A. R., Cadenas, E., & de la Monte, S. M. (2016). Cigarette smoke-induced alterations in frontal White matter lipid profiles demonstrated by MALDI-imaging mass spectrometry: Relevance to Alzheimer’s disease. Journal of Alzheimer’s Disease, 51(1), 151–163. https://doi.org/10.3233/JAD-150916. Nussey, D. H., Froy, H., Lemaitre, J. F., Gaillard, J. M., & Austad, S. N. (2013). Senescence in natural populations of animals: Widespread evidence and its implications for bio-gerontology. Ageing Research Reviews, 12(1), 214–225. https://doi.org/10.1016/j.arr.2012.07.004. Oda, N., Kajikawa, M., Maruhashi, T., Iwamoto, Y., Kishimoto, S., Matsui, S., Hidaka, T., Kihara, Y., Chayama, K., Goto, C., Aibara, Y., Nakashima, A., et al. (2017). Endothelial function is impaired in relation to alcohol intake even in the case of light alcohol consumption in Asian men; Flow-mediated Dilation Japan (FMD-J) study. International Journal of Cardiology, 230, 523–528. https://doi.org/10.1016/j.ijcard.2016.12.065. Oron, Y., Elgart, K., Marom, T., & Roth, Y. (2014). Cardiovascular risk factors as causes for hearing impairment. Audiology & Neuro-Otology, 19(4), 256–260. https://doi.org/10.1159/ 000363215.

References

341

Orth, S. R., Stöckmann, A., Conradt, C., Ritz, E., Ferro, M., Kreusser, W., Piccoli, G., Rambausek, M., Roccatello, D., Schäfer, K., Sieberth, H. G., Wanner, C., et al. (1998). Smoking as a risk factor for end-stage renal failure in men with primary renal disease. Kidney International, 54(3), 926–931. https://doi.org/10.1046/j.1523-1755.1998.00067.x. Palermo, A., D’Onofrio, L., Buzzetti, R., Manfrini, S., & Napoli, N. (2017). Pathophysiology of bone fragility in patients with diabetes. Calcified Tissue International, 100(2), 122–132. https:// doi.org/10.1007/s00223-016-0226-3. Pankuweit, S. (2016). Alcohol consumption in women and the elderly: When does it induce heart failure? (article in German). Herz, 41(6), 494–497. https://doi.org/10.1007/s00059-016-4462-0. Park, H. Y., Jhun, B. W., Jeong, H. J., Chon, H. R., Koh, W. J., Suh, G. Y., Kim, H., Chung, M. J., Jun, H. J., Choi, Y. H., & Lim, S. Y. (2015). The complex association of metabolic syndrome and its components with computed tomography-determined emphysema index. Metabolic Syndrome and Related Disorders, 13(3), 132–139. https://doi.org/10.1089/met.2014.0117. Pasqualotto, F. F., Lucon, A. M., Sobreiro, B. P., Pasqualotto, E. B., & Arap, S. (2004). Effects of medical therapy, alcohol, smoking, and endocrine disruptors on male infertility. Revista do Hospital das Clinicas; Faculdade de Medicina da Universidade de Sao Paulo, 59(6), 375–382. https://doi.org/10.1590/s0041-87812004000600011. Patel, Z. M., DelGaudio, J. M., & Wise, S. K. (2015). Higher body mass index is associated with subjective olfactory dysfunction. Behavioural Neurology, 2015, 675635. https://doi.org/10. 1155/2015/675635. Perkisas, S., & Vandewoude, M. (2016). Where frailty meets diabetes. Diabetes/Metabolism Research and Reviews, 32(Suppl 1), 261–267. https://doi.org/10.1002/dmrr.2743. Perneger, T. V., Whelton, P. K., Puddey, I. B., & Klag, M. J. (1999). Risk of end-stage renal disease associated with alcohol consumption. American Journal of Epidemiology, 150(12), 1275–1281. https://doi.org/10.1093/oxfordjournals.aje.a009958. Perry, B. D., Caldow, M. K., Brennan-Speranza, T. C., Sbaraglia, M., Jerums, G., Garnham, A., Wong, C., Levinger, P., Asrar Ul Haq, M., Hare, D. L., Price, S. R., & Levinger, I. (2016). Muscle atrophy in patients with type 2 Diabetes mellitus: Roles of inflammatory pathways, physical activity and exercise. Exercise Immunology Review, 22, 94–109. Petrušić, N., Posavac, M., Sabol, I., & Mravak-Stipetić, M. (2015). The effect of tobacco smoking on salivation. Acta stomatologica Croatica, 49(4), 309–315. https://doi.org/10.15644/asc49/4/ 6. Pfeffer, M. A. (2017). Heart failure and hypertension: Importance of prevention. The Medical Clinics of North America, 101(1), 19–28. https://doi.org/10.1016/j.mcna.2016.08.012. Phillips, S. K., Bruce, S. A., Newton, D., & Woledge, R. C. (1992). The weakness of old age is not due to failure of muscle activation. Journal of Gerontology, 47(2), M45–M49. https://doi.org/ 10.1093/geronj/47.2.m45. Pinto-Fochi, M. E., Pytlowanciv, E. Z., Reame, V., Rafacho, A., Ribeiro, D. L., Taboga, S. R., & Góes, R. M. (2016). A high-fat diet fed during different periods of life impairs steroidogenesis of rat Leydig cells. Reproduction, 152(6), 795–808. https://doi.org/10.1530/REP-16-0072. Platt, T. L., Beckett, T. L., Kohler, K., Niedowicz, D. M., & Murphy, M. P. (2016). Obesity, diabetes, and leptin resistance promote tau pathology in a mouse model of disease. Neuroscience, 315, 162–174. https://doi.org/10.1016/j.neuroscience.2015.12.011. Pletcher, M. J., & Moran, A. E. (2017). Cardiovascular Risk Assessment. The Medical Clinics of North America, 101(4), 673–688. https://doi.org/10.1016/j.mcna.2017.03.002. Przewoźny, T., Gójska-Grymajło, A., Kwarciany, M., Graff, B., Szmuda, T., Gąsecki, D., & Narkiewicz, K. (2016). Hypertension is associated with dysfunction of both peripheral and central auditory system. Journal of Hypertension, 34(4), 736–744. https://doi.org/10.1097/HJH. 0000000000000803. Pugazhenthi, S. (2017). Metabolic syndrome and the cellular phase of Alzheimer’s disease. Progress in Molecular Biology and Translational Science, 146, 243–258. https://doi.org/10. 1016/bs.pmbts.2016.12.016.

342

7

The Elderly Subjects and Their Troubles

Pujol-Lereis, L. M., Schäfer, N., Kuhn, L. B., Rohrer, B., & Pauly, D. (2016). Interrelation between oxidative stress and complement activation in models of age-related macular degeneration. Advances in Experimental Medicine and Biology, 854, 87–93. https://doi.org/10.1007/978-3319-17121-0_13. Qiu, C., Winblad, B., & Fratiglioni, L. (2005). The age-dependent relation of blood pressure to cognitive function and dementia. Lancet Neurology, 4(8), 487–499. https://doi.org/10.1016/ S1474-4422(05)70141-1. Quik, M., & Wonnacott, S. (2011). α6β2* and α4β2* nicotinic acetylcholine receptors as drug targets for Parkinson’s disease. Pharmacological Reviews, 63(4), 938–966. https://doi.org/10. 1124/pr.110.003269. Quik, M., Huang, L. Z., Parameswaran, N., Bordia, T., Campos, C., & Perez, X. A. (2009). Multiple roles for nicotine in Parkinson’s disease. Biochemical Pharmacology, 78(7), 677–685. https:// doi.org/10.1016/j.bcp.2009.05.003. Quik, M., Zhang, D., McGregor, M., & Bordia, T. (2015). Alpha7 nicotinic receptors as therapeutic targets for Parkinson’s disease. Biochemical Pharmacology, 97(4), 399–407. https://doi.org/10. 1016/j.bcp.2015.06.014. Rani, V., Deshmukh, R., Jaswal, P., Kumar, P., & Bariwal, J. (2016). Alzheimer’s disease: Is this a brain specific diabetic condition? Physiology & Behavior, 164(Pt A), 259–267. https://doi.org/ 10.1016/j.physbeh.2016.05.041. Rasouli, B., Ahlbom, A., Andersson, T., Grill, V., Midthjell, K., Olsson, L., & Carlsson, S. (2013). Alcohol consumption is associated with reduced risk of type 2 diabetes and autoimmune diabetes in adults: Results from the Nord-Trøndelag health study. Diabetic Medicine, 30(1), 56–64. https://doi.org/10.1111/j.1464-5491.2012.03713.x. Reibel, J. (2003). Tobacco and oral diseases. Update on the evidence, with recommendations. Medical Principles and Practice, 12(Suppl 1), 22–32. https://doi.org/10.1159/000069845. Reitmeir, P., Linkohr, B., Heier, M., Molnos, S., Strobl, R., Schulz, H., Breier, M., Faus, T., Küster, D. M., Wulff, A., Grallert, H., Grill, E., et al. (2017). Common eye diseases in older adults of southern Germany: Results from the KORA-age study. Age and Ageing, 46(3), 481–486. https:// doi.org/10.1093/ageing/afw234. Reynolds, K., Gu, D., Chen, J., Tang, X., Yau, C. L., Yu, L., Chen, C. S., Wu, X., Hamm, L. L., & He, J. (2008). Alcohol consumption and the risk of end-stage renal disease among Chinese men. Kidney International, 73(7), 870–876. https://doi.org/10.1038/sj.ki.5002774. Ricci, G., Pirillo, I., Tomassoni, D., Sirignano, A., & Grappasonni, I. (2017). Metabolic syndrome, hypertension, and nervous system injury: Epidemiological correlates. Clinical and Experimental Hypertension, 39(1), 8–16. https://doi.org/10.1080/10641963.2016.1210629. Richardson, B. E., Vander Woude, E. A., Sudan, R., Thompson, J. S., & Leopold, D. A. (2004). Altered olfactory acuity in the morbidly obese. Obesity Surgery, 14(7), 967–969. https://doi.org/ 10.1381/0960892041719617. Richardson, B. R., Allan, D. S., & Le, Y. (2014). Greater organ involution in highly proliferative tissues associated with the early onset and acceleration of ageing in humans. Experimental Gerontology, 55, 80–91. https://doi.org/10.1016/j.exger.2014.03.015. Ricklefs, R. E. (1998). Evolutionary theories of aging: Confirmation of a fundamental prediction, with implications for the genetic basis and evolution of life span. The American Naturalist, 152 (1), 24–44. https://doi.org/10.1086/286147. Rocco, A., Compare, D., Angrisani, D., Sanduzzi Zamparelli, M., & Nardone, G. (2014). Alcoholic disease: Liver and beyond. World Journal of Gastroenterology, 20(40), 14652–14659. https:// doi.org/10.3748/wjg.v20.i40.14652. Roerecke, M., & Rehm, J. (2014). Alcohol consumption, drinking patterns, and ischemic heart disease: A narrative review of meta-analyses and a systematic review and meta-analysis of the impact of heavy drinking occasions on risk for moderate drinkers. BMC Medicine, 12, 182. https://doi.org/10.1186/s12916-014-0182-6.

References

343

Romeo, J., Wärnberg, J., Nova, E., Díaz, L. E., Gómez-Martinez, S., & Marcos, A. (2007). Moderate alcohol consumption and the immune system: A review. The British Journal of Nutrition, 98(Suppl 1), S111–S115. https://doi.org/10.1017/S0007114507838049. Rose, M. R. (1991). Evolutionary biology of aging. Oxford: Oxford University Press. Rosendorff, C., Beeri, M. S., & Silverman, J. M. (2007). Cardiovascular risk factors for Alzheimer’s disease. The American Journal of Geriatric Cardiology, 16(3), 143–149. https://doi.org/10. 1111/j.1076-7460.2007.06696.x. Rosenhall, U., Sixt, E., Sundh, V., & Svanborg, A. (1993). Correlations between presbyacusis and extrinsic noxious factors. Audiology, 32(4), 234–243. https://doi.org/10.3109/ 00206099309072939. Rupp, C. I., Kurz, M., Kemmler, G., Mair, D., Hausmann, A., Hinterhuber, H., & Fleischhacker, W. W. (2003). Reduced olfactory sensitivity, discrimination, and identification in patients with alcohol dependence. Alcoholism, Clinical and Experimental Research, 27(3), 432–439. https:// doi.org/10.1097/01.ALC.0000057945.57330.2C. Rupp, C. I., Fleischhacker, W. W., Hausmann, A., Mair, D., Hinterhuber, H., & Kurz, M. (2004). Olfactory functioning in patients with alcohol dependence: Impairments in odor judgements. Alcohol and Alcoholism, 39(6), 514–519. https://doi.org/10.1093/alcalc/agh100. Saedi, E., Gheini, M. R., Faiz, F., & Arami, M. A. (2016). Diabetes mellitus and cognitive impairments. World Journal of Diabetes, 7(17), 412–422. https://doi.org/10.4239/wjd.v7.i17. 412. Sahay, K., Rehani, S., Kardam, P., Kumra, M., Sharma, R., & Singh, N. (2017). Cytomorphometric analysis and morphological assessment of oral exfoliated cells in type 2 diabetes mellitus and healthy individuals: A comparative study. Journal of Cytology, 34(1), 27–33. https://doi.org/10. 4103/0970-9371.197594. Sanke, H., Mita, T., Yoshii, H., Yokota, A., Yamashiro, K., Ingaki, N., Onuma, T., Someya, Y., Komiya, K., Tamura, Y., Shimizu, T., Ohmura, C., et al. (2014). Relationship between olfactory dysfunction and cognitive impairment in elderly patients with type 2 diabetes mellitus. Diabetes Research and Clinical Practice, 106(3), 465–473. https://doi.org/10.1016/j.diabres.2014.09. 039. Santiago, J. A., & Potashkin, J. A. (2014). System-based approaches to decode the molecular links in Parkinson’s disease and diabetes. Neurobiology of Disease, 72(Pt A), 84–91. https://doi.org/ 10.1016/j.nbd.2014.03.019. Sari, Y., & Khalil, A. (2015). Monoamine oxidase inhibitors extracted from tobacco smoke as neuroprotective factors for potential treatment of Parkinson’s disease. CNS & Neurological Disorders Drug Targets, 14(6), 777–785. https://doi.org/10.2174/ 1871527314666150325235608. Sayin, N., Kara, N., & Pekel, G. (2015). Ocular complications of diabetes mellitus. World Journal of Diabetes, 6(1), 92–108. https://doi.org/10.4239/wjd.v6.i1.92. Schaeffner, E., & Ritz, E. (2012). Alcohol and kidney damage: A Janus-faced relationship. Kidney International, 81(9), 816–818. https://doi.org/10.1038/ki.2012.14. Scheen, A. J. (2005). Diabetes mellitus in the elderly: Insulin resistance and/or impaired insulin secretion? Diabetes & Metabolism, 31(2), 5S27–5S34. https://doi.org/10.1016/s1262-3636(05) 73649-1. Schinzari, F., Tesauro, M., & Cardillo, C. (2017). Endothelial and perivascular adipose tissue abnormalities in obesity-related vascular dysfunction: Novel targets for treatment. Journal of Cardiovascular Pharmacology, 69(6), 360–368. https://doi.org/10.1097/FJC. 0000000000000469. Schofield, J. D., Liu, Y., Rao-Balakrishna, P., Malik, R. A., & Soran, H. (2016). Diabetes Dyslipidemia. Diabetes Therapy, 7(2), 203–219. https://doi.org/10.1007/s13300-016-0167-x. Schubert, C. R., Cruickshanks, K. J., Klein, B. E., Klein, R., & Nondahl, D. M. (2011). Olfactory impairment in older adults: Five-year incidence and risk factors. Laryngoscope, 121(4), 873–878. https://doi.org/10.1002/lary.21416.

344

7

The Elderly Subjects and Their Troubles

Schubert, C. R., Cruickshanks, K. J., Fischer, M. E., Huang, G. H., Klein, B. E., Klein, R., Pankow, J. S., & Nondahl, D. M. (2012). Olfactory impairment in an adult population: The Beaver Dam offspring study. Chemical Senses, 37(4), 325–334. https://doi.org/10.1093/chemse/bjr102. Seale, P., Asakura, A., & Rudnicki, M. A. (2001). The potential of muscle stem cells. Developmental Cell, 1(3), 333–342. https://doi.org/10.1016/s1534-5807(01)00049-1. Seifi, S., Feizi, F., Moazzezi, Z., Mehdizadeh, M., & Zamani, B. (2014). Evaluation of oral mucosal epithelium in diabetic male patients by exfoliative cytology method. Journal of Diabetes and Metabolic Disorders, 13, 77. https://doi.org/10.1186/2251-6581-13-77. Shi, Y., & Vanhoutte, P. M. (2017). Macro- and microvascular endothelial dysfunction in diabetes. Journal of Diabetes, 9(5), 434–449. https://doi.org/10.1111/1753-0407.12521. Shim, W. S., Kim, H. J., Kang, E. S., Ahn, C. W., Lim, S. K., Lee, H. C., & Cha, B. S. (2006). The association of total and differential white blood cell count with metabolic syndrome in type 2 diabetic patients. Diabetes Research and Clinical Practice, 73(3), 284–291. https://doi.org/10. 1016/j.diabres.2006.02.001. Shim, S. H., Kim, S. G., Bae, J. H., Yu, H. G., & Song, S. J. (2016). Risk factors for progression of early age-related macular degeneration in Koreans. Ophthalmic Epidemiology, 23(2), 80–87. https://doi.org/10.3109/09286586.2015.1129425. Silva, J. V., Cruz, D., Gomes, M., Correia, B. R., Freitas, M. J., Sousa, L., Silva, V., & Fardilha, M. (2017). Study on the short-term effects of increased alcohol and cigarette consumption in healthy young men’s seminal quality. Scientific Reports, 7, 45457. https://doi.org/10.1038/ srep45457. Simon, K. C., Chen, H., Michael, S., & Ascherio, A. (2007). Hypertension, hypercholesterolemia, diabetes, and risk of Parkinson disease. Neurology, 69(17), 1688–1695. https://doi.org/10.1212/ 01.wnl.0000271883.45010.8a. Singal, A. K., & Anand, B. S. (2013). Recent trends in the epidemiology of alcoholic liver disease. Clinical Liver Disease (Hoboken), 2(2), 53–56. https://doi.org/10.1002/cld.168. Skulachev, V. P. (1997). Aging is a specific biological function rather than the result of a disorder in complex living systems: Biochemical evidence in support of Weismann’s hypothesis. Biochemistry (Mosc), 62(11), 1191–1195. http://protein.bio.msu.ru/biokhimiya/contents/v62/full/ 62111394.html. Skulachev, V. P. (1999). Phenoptosis: Programmed death of an organism. Biochemistry (Mosc), 64 (12), 1418–1426. http://protein.bio.msu.ru/biokhimiya/contents/v64/full/64121679.html. Skulachev, V. P. (2002). Programmed death phenomena: From organelle to organism. Annals of the New York Academy of Sciences, 959, 214–237. https://doi.org/10.1111/j.1749-6632.2002. tb02095.x. Soliman, S., Ishrat, T., Pillai, A., Somanath, P. R., Ergul, A., El-Remessy, A. B., & Fagan, S. C. (2014). Candesartan induces a prolonged proangiogenic effect and augments endotheliummediated neuroprotection after oxygen and glucose deprivation: Role of vascular endothelial growth factors A and B. The Journal of Pharmacology and Experimental Therapeutics, 349(3), 444–457. https://doi.org/10.1124/jpet.113.212613. Song, Y., Klevak, A., Manson, J. E., Buring, J. E., & Liu, S. (2010). Asthma, chronic obstructive pulmonary disease, and type 2 diabetes in the women’s health study. Diabetes Research and Clinical Practice, 90(3), 365–371. https://doi.org/10.1016/j.diabres.2010.09.010. Sonsalla, P. K., Coleman, C., Wong, L. Y., Harris, S. L., Richardson, J. R., Gadad, B. S., Li, W., & German, D. C. (2013). The angiotensin converting enzyme inhibitor captopril protects nigrostriatal dopamine neurons in animal models of parkinsonism. Experimental Neurology, 250, 376–383. https://doi.org/10.1016/j.expneurol.2013.10.014. Souza-Smith, F. M., Lang, C. H., Nagy, L. E., Bailey, S. M., Parsons, L. H., & Murray, G. J. (2016). Physiological processes underlying organ injury in alcohol abuse. American Journal of Physiology. Endocrinology and Metabolism, 311(3), E605–E619. https://doi.org/10.1152/ajpendo. 00270.2016. Sözen, T., Özışık, L., & Başaran, N. Ç. (2017). An overview and management of osteoporosis. European Journal of Rheumatology, 4(1), 46–56. https://doi.org/10.5152/eurjrheum.2016.048.

References

345

Spielman, L. J., Little, J. P., & Klegeris, A. (2014). Inflammation and insulin/IGF-1 resistance as the possible link between obesity and neurodegeneration. Journal of Neuroimmunology, 273(1–2), 8–21. https://doi.org/10.1016/j.jneuroim.2014.06.004. Spies, C. D., Sander, M., Stangl, K., Fernandez-Sola, J., Preedy, V. R., Rubin, E., Andreasson, S., Hanna, E. Z., & Kox, W. J. (2001). Effects of alcohol on the heart. Current Opinion in Critical Care, 7(5), 337–343. https://doi.org/10.1097/00075198-200110000-00004. Sritara, C., Thakkinstian, A., Ongphiphadhanakul, B., Pornsuriyasak, P., Warodomwichit, D., Akrawichien, T., Akrawichien, T., Vathesatogkit, P., & Sritara, P. (2015). Work- and travelrelated physical activity and alcohol consumption: Relationship with bone mineral density and calcaneal quantitative ultrasonometry. Journal of Clinical Densitometry, 18(1), 37–43. https:// doi.org/10.1016/j.jocd.2014.04.117. Stearns, S. C. (Ed.). (1999). Evolution in health and disease (1st ed.). Oxford: Oxford University Press. Stearns, S. C., & Koella, J. C. (Eds.). (2008). Evolution in health and disease (2nd ed.). New York: Oxford University Press. Stearns, S. C., Nesse, R. M., Govindaraju, D. R., & Ellison, P. T. (2010). Evolution in health and medicine Sackler colloquium: Evolutionary perspectives on health and medicine. Proceedings of the National Academy of Sciences of the United States of America, 107(Suppl 1), 1691–1695. https://doi.org/10.1073/pnas.0914475107. Su, J. B. (2015). Vascular endothelial dysfunction and pharmacological treatment. World Journal of Cardiology, 7(11), 719–741. https://doi.org/10.4330/wjc.v7.i11.719. Su, L. H., & Chen, T. H. (2007). Association of androgenetic alopecia with smoking and its prevalence among Asian men: A community-based survey. Archives of Dermatology, 143 (11), 1401–1406. https://doi.org/10.1001/archderm.143.11.1401. Sung, I. Y., Park, B. C., Hah, Y. S., Cho, H. Y., Yun, J. W., Park, B. W., Kang, Y. H., Kim, H. C., Hwang, S. C., Rho, G. J., Kim, U. K., et al. (2015). FOXO1 is involved in the effects of cigarette smoke extract on Osteoblastic differentiation of cultured human periosteum-derived cells. International Journal of Medical Sciences, 12(11), 881–890. https://doi.org/10.7150/ijms. 13172. Suriawinata, A., & Fiel, M. I. (2004). Liver pathology in obesity. Seminars in Liver Disease, 24(4), 363–370. https://doi.org/10.1055/s-2004-860865. Sutherland, G. T., Sheahan, P. J., Matthews, J., Dennis, C. V., Sheedy, D. S., McCrossin, T., Curtis, M. A., & Kril, J. J. (2013). The effects of chronic alcoholism on cell proliferation in the human brain. Experimental Neurology, 247, 9–18. https://doi.org/10.1016/j.expneurol.2013.03.020. Sveinsson, O., Halldórsson, S., & Olafsson, E. (2012). An unusually low prevalence of Huntington’s disease in Iceland. European Neurology, 68(1), 48–51. https://doi.org/10.1159/ 000337680. Szabo, G. (1999). Consequences of alcohol consumption on host defence. Alcohol and Alcoholism, 34(6), 830–841. https://doi.org/10.1093/alcalc/34.6.830. Tadic, M., Cuspidi, C., & Hering, D. (2016). Hypertension and cognitive dysfunction in elderly: Blood pressure management for this global burden. BMC Cardiovascular Disorders, 16(1), 208. https://doi.org/10.1186/s12872-016-0386-0. Tallis, R. C., Fillit, H. M., & Brocklehurst, J. C. (Eds.). (1998). Brocklehurst’s textbook of geriatric medicine and gerontology (5th ed.). Churchill Livingstone: New York. Tanaka, A., Cui, R., Kitamura, A., Liu, K., Imano, H., Yamagishi, K., Kiyama, M., Okada, T., Iso, H., & Investigators, C. I. R. C. S. (2016). Heavy alcohol consumption is associated with impaired endothelial function. Journal of Atherosclerosis and Thrombosis, 23(9), 1047–1054. https://doi.org/10.5551/jat.31641. Tardat, M., & Déjardin, J. (2018). Telomere chromatin establishment and its maintenance during mammalian development. Chromosoma, 127(1), 3–18. https://doi.org/10.1007/s00412-0170656-3.

346

7

The Elderly Subjects and Their Troubles

Tarwadi, K. V., & Agte, V. V. (2011). Interrelationships between nutritional status, socioeconomic factors, and lifestyle in Indian cataract patients. Nutrition, 27(1), 40–45. https://doi.org/10.1016/ j.nut.2009.11.015. Tassin, J., Malaise, E., & Courtois, Y. (1979). Human lens cells have an in vitro proliferative capacity inversely proportional to the donor age. Experimental Cell Research, 123(2), 388–392. https://doi.org/10.1016/0014-4827(79)90483-x. Tedla, F. M., Brar, A., Browne, R., & Brown, C. (2011). Hypertension in chronic kidney disease: Navigating the evidence. International Journal of Hypertension, 2011, 132405. https://doi.org/ 10.4061/2011/132405. Thiebaud, N., Johnson, M. C., Butler, J. L., Bell, G. A., Ferguson, K. L., Fadool, A. R., Fadool, J. C., Gale, A. M., Gale, D. S., & Fadool, D. A. (2014). Hyperlipidemic diet causes loss of olfactory sensory neurons, reduces olfactory discrimination, and disrupts odor-reversal learning. The Journal of Neuroscience, 34(20), 6970–6984. https://doi.org/10.1523/JNEUROSCI.336613.2014. Tomek, J., & Bub, G. (2017). Hypertension-induced remodelling: On the interactions of cardiac risk factors. The Journal of Physiology, 595(12), 4027–4036. https://doi.org/10.1113/JP273043. Trevathan, W. R., McKenna, J. J., & Smith, E. O. (Eds.). (1999). Evolutionary medicine. New York: Oxford University Press. Trevathan, W. R., Smith, E. O., & McKenna, J. J. (Eds.). (2008a). Evolutionary medicine and health: New perspectives. New York: Oxford University Press. Trevathan, W. R., Smith, E. O., & McKenna, J. J. (2008b). Introduction and overview of evolutionary medicine. In W. R. Trevathan, E. O. Smith, & J. J. McKenna (Eds.), Evolutionary medicine and health: New perspectives (pp. 1–54). New York: Oxford University Press. Tune, J. D., Goodwill, A. G., Sassoon, D. J., & Mather, K. J. (2017). Cardiovascular consequences of metabolic syndrome. Translational Research, 183, 57–70. https://doi.org/10.1016/j.trsl. 2017.01.001. Twig, G., Afek, A., Shamiss, A., Derazne, E., Tzur, D., Gordon, B., & Tirosh, A. (2013). White blood cells count and incidence of type 2 diabetes in young men. Diabetes Care, 36(2), 276–282. https://doi.org/10.2337/dc11-2298. Tyner, S. D., Venkatachalam, S., Choi, J., Jones, S., Ghebranious, N., Igelmann, H., Lu, X., Soron, G., Cooper, B., Brayton, C., Park, S. H., Thompson, T., et al. (2002). p53 mutant mice that display early ageing-associated phenotypes. Nature, 415(6867), 45–53. https://doi.org/10.1038/ 415045a. Ueha, R., Ueha, S., Kondo, K., Sakamoto, T., Kikuta, S., Kanaya, K., Nishijima, H., Matsushima, K., & Yamasoba, T. (2016). Damage to olfactory progenitor cells is involved in cigarette smoke-induced olfactory dysfunction in mice. The American Journal of Pathology, 186(3), 579–586. https://doi.org/10.1016/j.ajpath.2015.11.009. Ueha, R., Ueha, S., Sakamoto, T., Kanaya, K., Suzukawa, K., Nishijima, H., Kikuta, S., Kondo, K., Matsushima, K., & Yamasoba, T. (2016). Cigarette smoke delays regeneration of the olfactory epithelium in mice. Neurotoxicity Research, 30(2), 213–224. https://doi.org/10.1007/s12640016-9617-5. Ullrich, N. J., & Gordon, L. B. (2015). Hutchinson-Gilford progeria syndrome. Handbook of Clinical Neurology, 132, 249–264. https://doi.org/10.1016/B978-0-444-62702-5.00018-4. Vamvakas, S., Teschner, M., Bahner, U., & Heidland, A. (1998). Alcohol abuse: Potential role in electrolyte disturbances and kidney diseases. Clinical Nephrology, 49(4), 205–213. Veldurthy, V., Wei, R., Oz, L., Dhawan, P., Jeon, Y. H., & Christakos, S. (2016). Vitamin D, calcium homeostasis and aging. Bone Research, 4, 16041. https://doi.org/10.1038/boneres. 2016.41. Vennos, E. M., Collins, M., & James, W. D. (1992). Rothmund-Thomson syndrome: Review of the world literature. Journal of the American Academy of Dermatology, 27(5 Pt 1), 750–762. https:// doi.org/10.1016/0190-9622(92)70249-f.

References

347

Vent, J., Bartels, S., Haynatzki, G., Gentry-Nielsen, M. J., Leopold, D. A., & Hallworth, R. (2003). The impact of ethanol and tobacco smoke on intranasal epithelium in the rat. American Journal of Rhinology, 17(4), 241–247. Verma, R. K., Panda, N. K., Basu, D., & Raghunathan, M. (2006). Audiovestibular dysfunction in alcohol dependence. Are we worried? American Journal of Otolaryngology, 27(4), 225–228. https://doi.org/10.1016/j.amjoto.2005.09.005. Vicente Miranda, H., El-Agnaf, O. M., & Outeiro, T. F. (2016). Glycation in Parkinson’s disease and Alzheimer’s disease. Movement Disorders, 31(6), 782–790. https://doi.org/10.1002/mds. 26566. Vij, N., Chandramani-Shivalingappa, P., van Westphal, C., Hole, R., & Bodas, M. (2018). Cigarette smoke induced autophagy-impairment accelerates lung aging, COPD-emphysema exacerbations and pathogenesis. American Journal of Physiology, 314(1), C73–C87. https://doi.org/10. 1152/ajpcell.00110.2016. Villalta, J., Ballescà, J. L., Nicolás, J. M., Martínez de Osaba, M. J., Antúnez, E., & Pimentel, C. (1997). Testicular function in asymptomatic chronic alcoholics: Relation to ethanol intake. Alcoholism, Clinical and Experimental Research, 21(1), 128–133. Vlachopoulos, C., Aznaouridis, K., Bratsas, A., Ioakeimidis, N., Dima, I., Xaplanteris, P., Stefanadis, C., & Tousoulis, D. (2015). Arterial stiffening and systemic endothelial activation induced by smoking: The role of COX-1 and COX-2. International Journal of Cardiology, 189, 293–298. https://doi.org/10.1016/j.ijcard.2015.04.029. Vogel, T., Benetos, A., Verreault, R., Kaltenbach, G., Kiesmann, M., & Berthel, M. (2006). Risk factors for Alzheimer: Towards prevention? (article in French). Presse Médicale, 35(9 Pt 2), 1309–1316. https://doi.org/10.1016/s0755-4982(06)74810-2. Vulliamy, T., Marrone, A., Goldman, F., Dearlove, A., Bessler, M., Mason, P. J., & Dokal, I. (2001). The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature, 413(6854), 432–435. https://doi.org/10.1038/35096585. Walker, F. O. (2007). Huntington’s disease. Lancet, 369(9557), 218–228. https://doi.org/10.1016/ S0140-6736(07)60111-1. Walsh, J. S., & Vilaca, T. (2017). Obesity, type 2 diabetes and bone in adults. Calcified Tissue International, 100(5), 528–535. https://doi.org/10.1007/s00223-016-0229-0. Walter, D. H., Rittig, K., Bahlmann, F. H., Kirchmair, R., Silver, M., Murayama, T., Nishimura, H., Losordo, D. W., Asahara, T., & Isner, J. M. (2002). Statin therapy accelerates reendothelialization: A novel effect involving mobilization and incorporation of bone marrow-derived endothelial progenitor cells. Circulation, 105(25), 3017–3024. https://doi.org/ 10.1161/01.cir.0000018166.84319.55. Wanamaker, B. L., Swiger, K. J., Blumenthal, R. S., & Martin, S. S. (2015). Cholesterol, statins, and dementia: What the cardiologist should know. Clinical Cardiology, 38(4), 243–250. https:// doi.org/10.1002/clc.22361. Wang, Y., Li, Y., Shen, Q., Li, X., Lu, J., Li, X., Yin, D., & Peng, Y. (2014). Valsartan blocked alcohol-induced, Toll-like receptor 2 signaling-mediated inflammation in human vascular endothelial cells. Alcoholism, Clinical and Experimental Research, 38(10), 2529–2540. https://doi.org/10.1111/acer.12532. Wang, H., Zhang, K., Liu, Y., Fu, Y., Gao, S., Gong, P., Wang, H., Zhou, Z., Zeng, M., Wu, Z., Sun, Y., Chen, T., Li, S., & Liu, L. (2017). Telomere heterogeneity linked to metabolism and pluripotency state revealed by simultaneous analysis of telomere length and RNA-seq in the same human embryonic stem cell. BMC Biology, 15(1), 114. https://doi.org/10.1186/s12915017-0453-8. Wannamethee, S. G., & Atkins, J. L. (2015). Muscle loss and obesity: The health implications of sarcopenia and sarcopenic obesity. The Proceedings of the Nutrition Society, 74(4), 405–412. https://doi.org/10.1017/S002966511500169X. Webster, C., & Blau, H. M. (1990). Accelerated age-related decline in replicative life-span of Duchenne muscular dystrophy myoblasts: Implications for cell and gene therapy. Somatic Cell and Molecular Genetics, 16(6), 557–565. https://doi.org/10.1007/bf01233096.

348

7

The Elderly Subjects and Their Troubles

Whelton, P. K., & Klag, M. J. (1989). Hypertension as a risk factor for renal disease. Review of clinical and epidemiological evidence. Hypertension, 13(5 Suppl), I19–I27. https://doi.org/10. 1161/01.hyp.13.5_suppl.i19. WHO, ICD-10. (2016). www.who.int/classifications/apps/icd/icd10online/. Accessed 14 Feb 2020. WHO, ICD-11. (2018). https://icd.who.int/browse11/l-m/en. Accessed 14 Feb 2020. Wickman, C., & Kramer, H. (2013). Obesity and kidney disease: Potential mechanisms. Seminars in Nephrology, 33(1), 14–22. https://doi.org/10.1016/j.semnephrol.2012.12.006. Wikipedia. (2018). List of world records in masters athletics. https://en.wikipedia.org/wiki/List_ of_world_records_in_masters_athletics. Accessed 14 Feb 2020. Williams, G. C. (1957). Pleiotropy, natural selection and the evolution of senescence. Evolution, 11, 398–411. https://doi.org/10.2307/2406060. Williams, G. C., & Nesse, R. M. (1991). The dawn of Darwinian medicine. The Quarterly Review of Biology, 66(1), 1–22. https://doi.org/10.1086/417048. Wilson, P. W., Castelli, W. P., & Kannel, W. B. (1987). Coronary risk prediction in adults (the Framingham Heart Study). The American Journal of Cardiology, 59(14), 91–4G. https://doi. org/10.1016/0002-9149(87)90165-2 [Erratum, Am J Cardiol, 1987, 60(13):A11.] Woodell, A., & Rohrer, B. (2014). A mechanistic review of cigarette smoke and age-related macular degeneration. Advances in Experimental Medicine and Biology, 801, 301–307. https://doi.org/10.1007/978-1-4614-3209-8_38. World Ranking Total Deaths. (2017). Data from WHO. www.worldlifeexpectancy.com/worldrankings-total-deaths. Accessed 14 Feb 2020. WorldLifeExpectancy. (2017). Causes of death in the world (Data from WHO). www. worldlifeexpectancy.com/world-health-rankings. Accessed 14 Feb 2020. Wright, J. R., Jr., Yates, A. J., Sharma, H. M., Shim, C., Tigner, R. L., & Thibert, P. (1982). Testicular atrophy in the spontaneously diabetic BB Wistar rat. The American Journal of Pathology, 108(1), 72–79. Wright, W. E., & Shay, J. W. (2005). Telomere biology in aging and cancer. Journal of the American Geriatrics Society, 53(9 Suppl), S292–S294. https://doi.org/10.1111/j.1532-5415. 2005.53492.x. Yacoub, R., Habib, H., Lahdo, A., Al Ali, R., Varjabedian, L., Atalla, G., Kassis Akl, N., Aldakheel, S., Alahdab, S., & Albitar, S. (2010). Association between smoking and chronic kidney disease: A case control study. BMC Public Health, 10, 731. https://doi.org/10.1186/ 1471-2458-10-731. Yamauchi, M., Takeda, K., Sakamoto, K., Searashi, Y., Uetake, S., Kenichi And, H., & Toda, G. (2001). Association of polymorphism in the alcohol dehydrogenase 2 gene with alcoholinduced testicular atrophy. Alcoholism, Clinical and Experimental Research, 25(6 Suppl), 16S– 18S. https://doi.org/10.1097/00000374-200106001-00005. Yan, C., Avadhani, N. G., & Iqbal, J. (2011). The effects of smoke carcinogens on bone. Current Osteoporosis Reports, 9(4), 202–209. https://doi.org/10.1007/s11914-011-0068-x. Yi, S. M., Son, S. W., Lee, K. G., Kim, S. H., Lee, S. K., Cho, E. R., Kim, I. H., & Shin, C. (2012). Gender-specific association of androgenetic alopecia with metabolic syndrome in a middle-aged Korean population. The British Journal of Dermatology, 167(2), 306–313. https://doi.org/10. 1111/j.1365-2133.2012.10978.x. Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., Martin, G. M., Mulligan, J., & Schellenberg, G. D. (1996). Positional cloning of the Werner’s syndrome gene. Science, 272(5259), 258–262. https://doi.org/10.1126/ science.272.5259.258. Yun, J. H., Morrow, J., Owen, C. A., Qiu, W., Glass, K., Lao, T., Jiang, Z., Perrella, M. A., Silverman, E. K., Zhou, X., & Hersh, C. P. (2017). Transcriptomic analysis of lung tissue from cigarette smoke induced emphysema murine models and human COPD show shared and distinct pathways. American Journal of Respiratory Cell and Molecular Biology, 57(1), 47–58. https://doi.org/10.1165/rcmb.2016-0328OC.

References

349

Zeng, H., Vaka, V. R., He, X., Booz, G. W., & Chen, J. X. (2015). High-fat diet induces cardiac remodelling and dysfunction: Assessment of the role played by SIRT3 loss. Journal of Cellular and Molecular Medicine, 19(8), 1847–1856. https://doi.org/10.1111/jcmm.12556. Zeng, L., Alongkronrusmee, D., & van Rijn, R. M. (2017). An integrated perspective on diabetic, alcoholic, and drug-induced neuropathy, etiology, and treatment in the US. Journal of Pain Research, 10, 219–228. https://doi.org/10.2147/JPR.S125987. Zhang, P., & Tian, B. (2014). Metabolic syndrome: An important risk factor for Parkinson’s disease. Oxidative Medicine and Cellular Longevity, 2014, 729194. https://doi.org/10.1155/ 2014/729194. Zhang, Q. Y., Tie, L. J., Wu, S. S., Lv, P. L., Huang, H. W., Wang, W. Q., Wang, H., & Ma, L. (2016). Overweight, obesity, and risk of age-related macular degeneration. Investigative Ophthalmology & Visual Science, 57(3), 1276–1283. https://doi.org/10.1167/iovs.15-18637. Zhang, J., Chen, C., Hua, S., Liao, H., Wang, M., Xiong, Y., & Cao, F. (2017). An updated metaanalysis of cohort studies: Diabetes and risk of Alzheimer’s disease. Diabetes Research and Clinical Practice, 124, 41–47. https://doi.org/10.1016/j.diabres.2016.10.024.

Chapter 8

Prevention and Treatment of the Troubles of the Elderly

8.1

Rationality of the Evolutionary Approach

Modern medicine takes advantage of sophisticated knowledge of physiological and pathological mechanisms and uses equally stylish methodologies, instruments, techniques and drugs. This situation is a source of pride for the modern clinician who compares the current situation with that of the past, even that of a few decades ago. It is also a source of optimistic assessments and forecasts for the future. The objective data present a somewhat different picture. Non-existent or very rare diseases in the past are increasingly common today. Modern medicine often increases its efficacy but struggles against a growing number of types and causes of diseases. A different approach to medicine is needed, which must consider that the prevention of primary causes of diseases must be prioritized. In this logic, care is only a remedy when prevention has failed or is impossible. This approach is feasible only starting from the rational approach of evolutionary medicine. These general considerations are a summary of what has already been described and discussed in Chapter 3 – Evolutionary medicine, which is useful to read about all that is not repeated or only mentioned here. However, these concepts are also valid for old age diseases with the difference that the progressive dysfunctions that constitute aging become more and more significant at older ages. In the evolutionary approach to medicine in old age, it is necessary to distinguish between some categories of disorders: A) Diseases occurring at any age (e.g., due to accidental events and infections). As in old age there is a reduced ability to resist stresses of any kind, these diseases will have different incidence, severity, and course than in previous ages. These diseases are partly preventable and generally curable.

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0_8

351

352

8 Prevention and Treatment of the Troubles of the Elderly

Table 8.1 Categories of troubles in old age

C

Troubles deriving from Accidents, infections Alterations of the genotype Mismatches

D

Aging

A B

Prevention Possible Possible

Cure Necessary Necessary

Overriding

Necessary remedies when prevention has failed –

Impossible

Anti-aging actions – – – Possible

B) Diseases from genotypic alterations. For individuals who reach old age, the consequences of these dysfunctions have become chronic. These conditions are sometimes preventable, and their care is generally difficult or impossible. C) Diseases deriving from mismatches (e.g., diabetes mellitus, hypertension, cardiovascular diseases, allergic and autoimmune diseases, most types of cancer, certain types of infections, mainly if they are epidemic, etc.). These diseases are widespread and can occur before or during old age. They are generally preventable. Their treatment is generally possible but must be considered as a partial remedy for the failure of prevention. D) Alterations caused by aging. Aging is not preventable. A correct lifestyle counteracts accelerated aging or some complications age-related caused by diseases but does not avoid aging. Aging, because a physiological process, cannot be the object of treatment, but only the target of actions aiming to slow down or stop it. These actions must be defined as anti-aging actions to avoid the erroneous definition of cures for aging. These concepts are summarized in Table 8.1.

8.2

Prevention and Treatment of Diseases Identical or Similar at Any Age

There are many conditions (e.g., fights with other individuals of the same species, killings by wild animals, infections, poisonings, other accidents) that can cause suffering or death at any age. By an immediate assessment, their prevention and the cure of their effects are not specific competence of geriatrics or gerontological studies. However, this evaluation overlooks the definition of aging. As already discussed in Chapter 1 – Introduction, aging is defined as an age-related fitness decline, i.e., an increasing mortality rate dependent on a progressive decline in functions (Comfort 1979, p. 7; Libertini 1988; Rose 1991; Kirkwood and Austad 2000). This definition of aging should not be confused with the concept of “senile state”, which is the condition when the decline in biological functions becomes evident (Williams 1957).

8.3 Acceleration of Aging: Prevention and Treatment

353

Under natural conditions, as already discussed in Chapter 7 – The elderly subjects and their troubles, fitness decline contributes to the death of a large part of the population before the altered conditions of senile state are reached. The data obtained from the study of a human population in the wild (Hill and Hurtado 1996) show that, among the survivors at the age of 30, only about half were still alive at the age of 60 (s. Fig. 7.1). Furthermore, the causes of death in this age group are practically only those previously reported, which are possible at any age (s. Table 7.1). Raise in mortality in natural conditions is analogous to the decline in athletic performance: at ages otherwise not considered old, athletes are considered aged because of their reduced ability to set an athletic record or win at an agonistic level. It is no coincidence that the fitness decline under natural conditions is correlated with the decline in maximum athletic performance or rather the ability to win a race (s. Figs. 7.2 and 7.3). This evidence induces to express observations that are apparently paradoxical: – Current geriatrics deals only with the pathological conditions that afflict the elderly, that is, subjects better defined as individuals in senile state (which can be more or less evident or advanced according to its arbitrary delimitation). The decline in biological functions before that age is not the object of attention or care by a geriatrician. An athlete with a decline in performance may ask for the help of a sports doctor but will never require the intervention of a geriatrician. – Although not losing its competence for subjects in the senile state, geriatrics conceived in rational terms should consider as its main objective the decline of biological functions in previous ages, recalling what magnificently was said by Williams many years ago: “No one would consider a man in his thirties senile, yet, according to athletic records and life tables, senescence is rampant during this decade.” (Williams 1957). Future geriatrics will oppose fitness decline before the changes caused by aging become phenotypically manifest. The treatment of individuals in a senile state will be reserved for cases where geriatrics will have failed its primary task. These considerations show us that a rational approach completely modifies the meaning and objectives of geriatrics.

8.3

Acceleration of Aging: Prevention and Treatment

In the previous Chapter 7 – The elderly subjects and their troubles, Section 7.7 – Diseases caused by mismatches that speed up physiological aging, it has been documented that some factors (hypertension, diabetes, smoking, obesity/ dyslipidemia, alcohol abuse), generically defined as “risk factors”, appear to speed up the normal rhythms of aging both for endothelial function (considered as a term of comparison) and for many other functions.

354

8 Prevention and Treatment of the Troubles of the Elderly

The risk determined by these factors derives from situations of mismatch, i.e., lack of adaptation to new conditions for which the species has no evolutionary experience (smoking, alcohol abuse, excessive intake of salt/carbohydrates/fats, etc.). In that section, considering as standard the endothelial dysfunction and the beneficial effects on it by some drugs, it was possible to observe analogous remarkable parallelism between endothelial dysfunction and the dysfunctions of many other tissues and organs both: – (i) for cells with turnover (olfactory dysfunction, renal insufficiency, atrophy of oral mucosa and salivary glands, intestinal and gastric atrophy, alopecia, emphysema and related diseases, skin atrophy, osteoporosis, atrophy of other sensory neuronal cells with turnover, cataract, testicular atrophy, muscle atrophy, cardiac insufficiency, and related diseases, reduction of various hematic cell types, diabetes and impairment of glucose tolerance, hepatic atrophy and related diseases); – and (ii) for cells without a turnover but dependent on other cells with turnover (age-related macular degeneration, Alzheimer’s disease, Parkinson’s disease, hearing impairment). It is possible to observe that some drugs (i.e., HMG-CoA reductase inhibitors [statins], angiotensin-converting enzyme inhibitors [ACE inhibitors], and angiotensin-II-receptor antagonists [sartans]), have somehow general defensive actions against these alterations and, therefore, are defined as “protective drugs” (Libertini et al. 2019). In particular: – The risks and the effects of endothelial dysfunction appear to be countered by statins (Walter et al. 2002; Chłopicki and Gryglewski 2005; Su 2015; Takase et al. 2017), and by ACE inhibitors and sartans (Chłopicki and Gryglewski 2005; Wang et al. 2014; Su 2015); – For olfactory dysfunction, while statins have been shown to counter this condition (Schubert et al. 2011; Kim et al. 2012), no specific or useful study has been found about the possible effects of ACE inhibitors and sartans; – Statins (Sandhu et al. 2006; Sanguankeo et al. 2015; Su et al. 2016), ACE inhibitors and sartans (Aldigier et al. 1998; Orth et al. 1998; Schmieder et al. 2011) appear to have a positive effect on renal insufficiency; – In animal models, statins (Xia et al. 2015; Pinho-Ribeiro et al. 2017) and sartans (Raupach et al. 2011; Podowski et al. 2012) seem to oppose emphysema; – Statins appear to protect from bleomycin-induced skin atrophy (Kandeel and Balaha 2015), and ACE inhibitors have been shown to oppose skin atrophy (Hao et al. 2011). About possible relationships between skin atrophy and hypertension, obesity/dyslipidemia, smoking and alcohol abuse no specific study has been found; – Statins (Zhang et al. 2014; Oryan et al. 2015; An et al. 2017), and sartans (Aoki et al. 2015) have been shown to oppose osteoporosis;

8.3 Acceleration of Aging: Prevention and Treatment

355

– ACE inhibitors and sartans appear to be useful to treat cataract (Jablecka et al. 2009; Choudhary and Bodakhe 2016; Choudhary et al. 2016). For some studies, statins lower the risk (Klein et al. 2006; Dobrzynski and Kostis 2014, while another study shows an increase of the risk (Wise et al. 2014), and a third study has shown no effect (Yu et al. 2017); – Muscle atrophy is countered by ACE inhibitors and sartans (Onder et al. 2006; Sumukadas et al. 2006; Burton and Sumukadas 2010; Burks et al. 2011; Morales et al. 2016), although a study has shown no effect (Shrikrishna et al. 2014). Statins have specific toxicity for myocytes and cause myalgia or even rhabdomyolysis (Harper and Jacobson 2007; Fernandez et al. 2011; Chung et al. 2016), but a study showed that in particular cases simvastatin has a positive effect (Davis et al. 2015); – Many studies show that statins (Fauchier et al. 2008; Mihaylova et al. 2012; Alehagen et al. 2015; Preiss et al. 2015; Bonsu et al. 2017) and ACE inhibitors or sartans (Flather et al. 2000; Demers et al. 2005; Jibrini et al. 2008; Dell’Italia 2011; Senni et al. 2017) have positive effects for the prevention and treatment of cardiac insufficiency and related diseases, although the beneficial effects of statins are disputed in a study (Rain and Rada 2017); – ACE inhibitors and sartans appear to prevent type 2 diabetes mellitus and be effective in some of the diabetic complications (Cordonnier et al. 2001; Amann et al. 2003; Scheen 2004a, b). About the effects of statins on type 2 diabetes mellitus risk, while a metanalysis showed that statins slightly increases the risk (Sattar et al. 2010), another metanalysis found the risk increased only in “Trials with target LDL-c levels of
2.6 mmol/L or LDL-c reduction of 30%” (Cai et al. 2016), and another found no effect (Zhou et al. 2013); – In animal models, ACE inhibitors have shown to counter hepatic atrophy (Yayama et al. 2007, 2008). Statins appear to be detrimental to hepatocytes in a study (Björnsson 2015), but in another report, this harmfulness is doubtful (Rangnekar and Fontana 2011), and in a third study no damage was reported (Herrick et al. 2016); – The effects of sartans on age-related macular degeneration (AMD) risk are unclear. In two studies, sartans appears to increase (Etminan et al. 2008) or decrease (Tsao and Fong 2013) AMD risk, but the results are in both cases dubious (Gehlbach et al. 2016). Equally the ACE inhibitors seem to decrease AMD risk, but the result is presented as dubious (Etminan et al. 2008); – Alzheimer’s disease risk and evolution are countered by statins (Vogel et al. 2006; Ellul et al. 2007; Wanamaker et al. 2015; Geifman et al. 2017), ACE inhibitors or sartans (Vogel et al. 2006; Ellul et al. 2007; Kume et al. 2012; Yasar et al. 2013; Ongali et al. 2016; Yasar et al. 2016); – Various studies have shown that statins reduce the risk and oppose the progress of Parkinson’s disease (Gao et al. 2012; Friedman et al. 2013; Undela et al. 2013; Sheng et al. 2016). In some animal models studies, ACE inhibitors and sartans appear to be likely useful in Parkinson’s disease prevention and treatment (Lopez-Real et al. 2005; Sonsalla et al. 2013; Muñoz et al. 2014);

356

8 Prevention and Treatment of the Troubles of the Elderly

– In some animal model studies, statins (Syka et al. 2007; Park et al. 2012; Hameed et al. 2014; Jahani et al. 2016) and sartans (Meyer zum Gottesberge et al. 2015) have shown to be useful for the prevention or treatment of inner ear difficulties; – Statins are reported to increase the reduction of various hematic cell types (Sivri et al. 2013; Xian-Yu et al. 2015), while no study has been found on the effects of ACE inhibitors/sartans; – No relation has been found between testicular atrophy with the ACE inhibitors effects (Pasqualotto et al. 2004), and no specific study was found on statins as risk factors for testicular atrophy; – About the relationship between (i) atrophy of oral mucosa and salivary glands; (ii) intestinal and gastric atrophy; (iii) alopecia, or baldness; (iv) atrophy of other sensory neuronal cells with turnover; and the effects of statins, ACE inhibitors, and sartans, no specific or useful study has been found. These data are summarized in Table 8.2, which may be considered a completion of Table 7.8 in Chapter 7 – The elderly subjects and their troubles. If we use endothelial dysfunction as a term of comparison, other age-related conditions appear

Table 8.2 Relations between some dysfunctions and some “protective drugs” Part I – With cell turnover of the specific cells Dysfunctions in the elderly Endothelial dysfunction Olfactory dysfunction Renal insufficiency Atrophy of oral mucosa and salivary glands Intestinal and gastric atrophy Alopecia Emphysema and related diseases Skin atrophy Osteoporosis Atrophy of other sensory neuronal cells with turnover Cataract Testicular atrophy Muscle atrophy Cardiac insufficiency and related diseases Reduction of various hematic cell types Diabetes and impairment of glucose tolerance Hepatic atrophy and related diseases

Code A B C D E F G H I J K L M N O P Q

Effect on the risk by: Age 1

+ + + + + + + + + + + + + + + + +

Protective effect by: Statins ACE-i /ARBs 8 9

+ + + . . . + + + . +? . + -/ -/

+ . + . . . + + + . + / + + . + +

Part II – Without cell turnover of the specific cells Dysfunctions in the elderly Age-related macular degeneration Alzheimer’s disease Parkinson’s disease Hearing impairment

Code R S T U

Effect on the risk by: Age 1

+ + + +

Protective effect by: Statins ACE-i /ARBs 8 9

? + + +

-? + + +

Notes: + ¼ risk or protective effect increased;  ¼ risk or protective effect decreased; / ¼ risk or protective effect unaltered; ? ¼ doubtful results; . ¼ no specific study

8.4 Treatment of Physiological Aging

357

to conform to this disorder concerning the effects of statins and ACE-Inhibitors or sartans. Disregarding the possible relationships for which no specific study is available or where only contradictory results are known, there are some important exceptions (highlighted with colored rectangles in Table 8.2) that must be mentioned: – (M8 and Q8) Statin-induced damage to muscle and liver cells. An easy explanation is a specific harmful action of statins on myocytes and, to a lesser extent, hepatocytes (Feingold and Grunfeld 2016); – (O8) Reduction of various hematic cell types caused by statins. This decrease should be a consequence of the anti-inflammatory effects of statins; – (P8) Slight increase in diabetes cases caused by statins. This harmful effect, which appears limited to high doses of statins (Cai et al. 2016) and is largely overcome by the positive effects of statins even on diabetes, has not yet been explained (Feingold and Grunfeld 2016). The primary prevention of the alterations reported in the table is obvious, that is to say, avoiding or at least limiting the lifestyles that constitute conditions to which the species is not adapted. Furthermore, the evidence shows that the use of certain drugs can at least partially counteract the progress of these disorders. It is very important to underline that this means countering the acceleration phenomena of physiological aging and does not mean at all that healthy lifestyles and protective drugs slow down or block the physiological process of aging. In other words, these important actions only held up pathological forms of aging and must not be interpreted or passed off as cures or remedies for physiological aging.

8.4

Treatment of Physiological Aging

It is useful first to consider a general scheme of aging (illustrated in Fig. 8.1). Telomerase is fully active only in germline cells, while in all other cells the enzyme is repressed to varying degrees. The reduced activity of telomerase determines: - in stem cells of the second level and in duplicating somatic cells (low or null telomerase activity): – > progressive shortening of the telomere – > progressive inhibition of the subtelomere, i.e., of T-sequences. – > (i) progressive innumerable alterations of cellular metabolism, including cellular secretions (SASP) (gradual cell senescence); – > (ii) increasing probability of activation of the cell senescence program, characterized by a block of duplication capacities (replicative senescence), gradual cell senescence to the highest degree, and resistance to apoptosis;

358

8 Prevention and Treatment of the Troubles of the Elderly

Fig. 8.1 A general scheme of aging

- in stem cells (with high but not full activity of telomerase): – > (iii) slow increase in the number of stem cells in cell senescence – > slowing of cell turnover Telomerase activation: – (i) returns the telomere to its original length; – (ii) reverses the alterations of the gradual cell senescence; but: – (iii) does not reverse cell senescence program and its effects; – (iv) does not restore the original number of stem cells.

8.4.1

Telomerase Activation

As explained before (see Chapter 5 – Subtelomere-Telomere aging theory, telomere shortening determines the sliding of the telomeric hood on subtelomere causing the repression of T-sequences and therefore: (i) the manifestations of gradual cell senescence; and (ii) an increasing probability of cell senescence activation (replicative senescence + alterations of gradual cell senescence at the highest degree). As telomere shortening is the result of the enzyme telomerase’s insufficient or absent

8.4 Treatment of Physiological Aging

359

activity, a rational objective to counteract the manifestations of aging is the activation or reactivation or stimulation of this enzyme. Apart from technical difficulties, the achievement of this objective must overcome the objections and fears originated by the assumptions and prejudices of the paradigm of aging as a non-adaptive phenomenon. This paradigm tries to explain the cell duplication limitations based on the telomere-subtelomere-telomerase system as a general defense against cancer. For this interpretation, any stimulation of telomerase activity is feared as carcinogenic action and, therefore, must be avoided or at least pursued with utmost attention due to the possible onset of neoplasms. The many arguments and facts existing against these fears have already been widely discussed (see Section 5.4 – Limits in cell duplication capacities and other effects of the telomere-subtelomere-telomerase system as a general defense against cancer). However, it may be useful to reassert that the interpretation of the telomeresubtelomere-telomerase system as a general defense against cancer constitutes an extreme justification for old hypotheses that attempt to deny any adaptive value of lifespan limiting mechanisms. After these premises, it is important to underline the knowledge since 1998 that telomerase reactivation had the important ability to avoid cell senescence by keeping cells in a “phenotypically youthful state” (Bodnar et al. 1998): – “... two telomerase-negative normal human cell types, retinal pigment epithelial cells and foreskin fibroblasts, were transfected with vectors encoding the human telomerase catalytic subunit. In contrast to telomerase-negative control clones, which exhibited telomere shortening and senescence, telomerase-expressing clones had elongated telomeres, divided vigorously, and showed reduced straining for beta-galactosidase, a biomarker for senescence. Notably, the telomerase-expressing clones have a normal karyotype and have already exceeded their normal lifespan by at least 20 doublings, thus establishing a causal relationship between telomere shortening and in vitro cellular senescence.” (Bodnar et al. 1998) – “... expression of the telomerase catalytic subunit (human telomerase reverse transcriptase or hTERT) and subsequent activation of telomerase can allow postsenescent cells to proliferate beyond crisis, the last known proliferative blockade to cellular immortality.” (Counter et al. 1998) – “... reactivation of telomerase in normal human cells leads to restoration of the length of telomeric DNA and to a highly significant increase in cellular life span. These data provide strong evidence consistent with the telomere hypothesis and indicate that elongation of telomere length by genetic manipulation might render normal human cells virtually immortal.” (Vaziri 1998) – “... we expressed hTERT in normal human diploid fibroblasts, which lack telomerase activity, to determine whether telomerase activity could be reconstituted leading to extension of replicative life span. Our results show that retroviral-mediated expression of hTERT resulted in functional telomerase activity in normal aging human cells. Moreover, reconstitution of telomerase activity in vivo led to an increase in the length of telomeric DNA and to extension of

360

8 Prevention and Treatment of the Troubles of the Elderly

cellular life span. These findings provide direct evidence in support of the telomere hypothesis, indicating that telomere length is one factor that can determine the replicative life span of human cells.” (Vaziri and Benchimol 1998) These experimental results were conducted subordinately to the hypothesis that telomerase activity was an oncogenic risk factor and that the inhibition of this enzyme was a target to fight cancer. The contradictions of this view were discussed in an interesting short review of 1999 (de Lange and Jacks 1999). On the one hand, the authors considered that, in already established tumors, there was telomerase activation which allowed the uncontrolled proliferation of cells, and so the inhibition of telomerase could be useful; on the other hand, they observed that before the development of the tumor: “One picture emerges when the early steps in tumorigenesis are considered. Cells with critically shortened telomeres may die due to activation of the p53 checkpoint pathway. However, in cells lacking these checkpoints, telomere loss can result in chromosome instability and this can promote some of the mutations required to achieve cellular transformation. Thus, in this setting, short telomeres can actually enhance early steps in tumor formation, as originally predicted by Hastie and Allshire (Hastie and Allshire 1989), and now borne out by the higher transformation rate of mTR-/-; p53-/- MEFs and the increased incidence of spontaneous tumors in the mTR-/- mice. The message from these findings is that telomerase inhibition could be mutagenic in tumor cells, a lesson that should be held firmly in mind if antitelomerase treatment were being considered as a chemopreventive strategy or were to be used chronically.” (de Lange and Jacks 1999). As Fossel observed a few years later, with the support of a previous study (“... while changes in telomere biology are very likely to be important for the course of natural tumor development, telomere maintenance is not an absolute requirement for the creation of human cancer cells by acute alteration of oncogenes and tumor suppressors. Rather, in our human transformation model, the activation of telomere maintenance strategies becomes important only during prolonged expansion of tumor cells to restore genomic stability to an extent that permits cell survival.” (Seger et al. 2002)), telomerase activity was not a cause of cancer but a late consequence of cancer development (Fossel 2004). Further important studies that strengthened the belief in the importance of telomerase to counteract aging were the following: – At the tissue level, fibroblasts aged in vitro and showing “substantial alterations in gene expression” were treated with telomerase. Then they were “assessed by incorporation into reconstituted human skin”, which appeared to be identical to skin obtained from young fibroblasts (Funk et al. 2000). – At the organismal level, aged mice with artificially blocked telomerase showed short dysfunctional telomeres, increased DNA damage signaling and classical degenerative phenotypes. Telomerase reactivation extended telomeres, reduced DNA damage signaling, allowed resumption of proliferation in quiescent cell types, and eliminated “degenerative phenotypes across multiple organs including testes, spleens, and intestines. Notably, somatic telomerase reactivation reversed neurodegeneration with restoration of proliferating Sox2(+) neural progenitors,

8.4 Treatment of Physiological Aging

361

Dcx(+) newborn neurons, and Olig2(+) oligodendrocyte populations. Consistent with the integral role of subventricular zone neural progenitors in generation and maintenance of olfactory bulb interneurons, this wave of telomerase-dependent neurogenesis resulted in alleviation of hyposmia and recovery of innate olfactory avoidance responses” (Jaskelioff et al. 2011). – Moreover, in normal 1- and 2-year old mice, the induction of telomerase expression by adeno-associated viruses that carried the mouse telomerase reverse transcriptase “... had remarkable beneficial effects on health and fitness, including insulin sensitivity, osteoporosis, neuromuscular coordination and several molecular biomarkers of aging. Importantly, telomerase-treated mice did not develop more cancer than their control littermates ...” (Bernardes de Jesus et al. 2012). All these results demonstrate that telomerase activation and the subsequent restoration of the telomere to its initial length is an important method to combat aging (Fossel 2015). The reported studies show that the retroviral-mediated expression of telomerase reverse transcriptase (TERT) appears to be the best way to induce telomerase expression. However, the possible use of drugs able to stimulate telomerase action is the object of increasing attention (Fossel 2015). Astragalosides, which are substances originated from plants, appear to have some effectiveness in stimulating telomerase activation (Harley et al. 2011; Harley et al. 2013). Unfortunately, their effect is limited, and the substances are quite expensive (Fossel 2015). The search for substances with the ability to stimulate telomerase activity is not limited to astragalosides. A recent review considers several substances with this activity: “This study aimed to investigate the effect of natural compounds on telomerase activity in human peripheral blood mononuclear cells (PBMCs). The tested compounds included Centella asiatica extract formulation (08AGTLF), Astragalus extract formulation (Nutrient 4), TA-65 (containing Astragalus membranaceus extract), oleanolic acid (OA), maslinic acid (MA), and 3 multinutrient formulas (Nutrients 1, 2 and 3) at various concentrations. The mean absorbance values of telomerase activity measured following treatment with some of the above-mentioned formulations were statistically significantly higher compared to those of the untreated cells. In particular, in order of importance with respect to telomerase activation from highest to lowest, 08AGTLF, OA, Nutrient 4, TA-65, MA, Nutrient 3 and Nutrient 2, triggered statistically significant increase in telomerase activity compared to the untreated cells.” (Tsoukalas et al. 2019).

8.4.2

Elimination of Senescent Cells

The selective elimination of senescent cells as a method to counteract aging manifestations is an interesting subject of many studies (e.g., (Zhu et al. 2014; Kirkland and Tchkonia 2015; Vaiserman et al. 2016; Kirkland and Tchkonia 2017; for a brief

362

8 Prevention and Treatment of the Troubles of the Elderly

review see (Conti et al. 2019)) (Figs. 8.2, 8.3, and 8.4) and has been explored in its potentiality in a recent work (Libertini et al. 2018). Cell senescence is a well-defined condition determined by a specific cellular program (Ben-Porath and Weinberg 2005). The activation of this program becomes more probable with telomere shortening (d’Adda di Fagagna et al. 2003), and may be triggered by other conditions such as oxidative stress, altered culture conditions, activated oncogenes, and DNA damage (Collado et al. 2007; Acosta et al. 2008). Cell senescence shows stereotyped alterations: (i) modifications of numberless cell functions (Shelton et al. 1999; Zhang et al. 2003; Campisi and d’Adda di Fagagna 2007; Kirkland and Tchkonia 2017); Fig. 8.2 Yi Zhu

Fig. 8.3 James Kirkland

8.4 Treatment of Physiological Aging

363

Fig. 8.4 Tamara Tchkonia

(ii) as part of (i), alterations of extracellular secretions, defined altogether as senescence-associated secretory phenotype (SASP) (Coppé et al. 2008; Rodier et al. 2009); (iii) inhibition of cell duplication capacities (replicative senescence) (Cristofalo and Pignolo 1993); (iv) resistance to cell death by apoptosis (Wang 1995; Kirkland and Tchkonia 2017). Cell senescence is characterized by a general alteration of cellular genetic activity (“Senescence-related chromatin remodelling leads to profound transcriptional changes.” (van Deursen 2014)), which could be determined by complete repression of T-sequences through a mechanism that should be defined. Cell senescence directly alters the functions of cells in these conditions and indirectly compromises other cells in some way suffering from these altered secretions or functionality. Furthermore the altered secretions cause inflammation phenomena and constitute an oncogenic risk factor (Loo et al. 2019; Kim and Park 2019) (“... cellular senescence or senescent tumor cells can promote carcinogenesis by producing various growth factors, cytokines, and proteases, collectively referred to as senescent-associated secretory phenotypes ...”; “Negative effects [of SASP] include an increased inflammatory response, stimulating the growth of nearby malignant cells, and inducing metastasis of malignant cancer cells ...” (Kim and Park 2019)), which contradicts the old hypothesis that the blockade of cell duplication capacity by cell senescence justifies this phenomenon as a general defense against cancer.

364

8 Prevention and Treatment of the Troubles of the Elderly

In general, cell senescence is interpreted as a one-step phenomenon. However, for cell senescence triggered by certain types of stress, there is a first phase in which the phenomenon is reversible if the stress is reduced or eliminated (van Deursen 2014). In any case, when cell senescence is full-blown, it appears irreversible, but by artificial manipulations in vitro (e.g., by the inactivation of both p53 and p16Ink4a), the reversibility is obtained (Beauséjour et al. 2003). This fact proves that cell senescence cannot be the result of the random accumulation of damage by various causes but a genetically regulated process, i.e., a cellular program (Ben-Porath and Weinberg 2005). Identifying senescent cells by the expression of p16Ink4a, it has been shown that their number increases with age (Krishnamurthy et al. 2014; Childs et al. 2015; Baker et al. 2016). Resistance to apoptosis, which is one of the characteristics of cell senescence, helps to explain the progressive increase in the number of cells in cell senescence and the persistence of the damage caused by them. The increase in the number of senescent cells is clearly related to aging manifestations and age-related diseases (Baker et al. 2004, 2008, 2011). An interesting experiment showed that, in mice, the transplantation of senescent cells around the knee joints determined alterations resembling osteoarthritis, which is a very common illness in the elderly (Xu et al. 2017). Furthermore, the elimination of senescent cells appears to reduce and improve aging manifestations (Baker et al. 2008, 2011; Chang et al. 2016). Based on this evidence, the selective elimination of cells in the senescent state through appropriate agents, defined as “senolytic drugs”, is considered a useful and important goal to counter aging manifestations (Zhu et al. 2015; Chang et al. 2016; Fuhrmann-Stroissnigg et al. 2017). To develop potential senolytic drugs, it is essential to weigh that senescent cells have an altered functionality, which, as a rule, should trigger their physiological elimination by apoptosis. However, cell senescence up-regulates (or activates) various Senescent Cell Anti-apoptotic Pathways (SCAPs), which protect them from apoptosis. These SCAPs, which comprise PI3K/AKT, BCL-2/BCL-XL, p53/p21/ serpines, tyrosine kinases, and may be correlated to each other, are important targets for possible senolytic agents (Kirkland and Tchkonia 2017). The first authors who published promising results about senolytic drugs searched for agents able to induce apoptosis in senescent cells. They found that among the molecules tested in vitro dasatinib and quercetin were the agents with greater effectiveness in eliminating senescent cells (Zhu et al. 2015). These agents act on different SCAPs. Dasatinib, an anticancer drug, inhibits several tyrosine kinases, while quercetin, a natural flavonoid, acts on PI3K and some kinases and serpines (protease inhibitors). Moreover, while dasatinib was a more efficacious apoptosis promoter in senescent preadipocytes, quercetin was more active in eliminating human umbilical vein endothelial cells. So, the authors, considering their different actions and targets, proposed combining the two drugs to

8.4 Treatment of Physiological Aging

365

eliminate a broader range of senescent cells (Zhu et al. 2015). The combined use of dasatinib and quercetin (DQ) was successfully tested in vivo on aged mice to improve their physical functions (muscle strength, walking speed, daily activity, and food intake) (Zhu et al. 2015). DQ was also used in mice to treat idiopathic pulmonary fibrosis, improving pulmonary function and physical health, although lung fibrosis was not modified (Schafer et al. 2017). DQ, which also demonstrated the ability to attenuate various age-associated manifestations (e.g., cardiovascular dysfunction) (Zhu et al. 2015), is now considered as the prototype of senolytic agents and is studied in clinical trials on patients with idiopathic pulmonary fibrosis, chronic kidney disease in diabetic patients and on survivors after hematopoietic stem cell transplantation (Fuhrmann-Stroissnigg et al. 2018). After DQ, some synthetic or natural compounds have been proposed as senolytics (Xu et al. 2018; Conti et al. 2019). Among these agents, navitoclax, the BCL-XL inhibitors, ABT737, A1331852, A1155463, which target the Bcl 2 family of antiapoptotic factors, and fisetin, a quercetin-related flavonoid with less hematological toxicity than navitoclax (Zhu et al. 2016), have been proposed. The use of a senolytic compound (UBX0101) has been tested with positive results in transgenic mice for post-traumatic osteoarthritis (Jeon et al. 2017). In naturally aged mice, in mice with doxorubicin-induced chemotoxicity, and fast-aging XpdTTD/TTD mice, a senolytic FOXO4 peptide that perturbs the FOXO4 interaction with p53 was tested. The agent “neutralized doxorubicin-induced chemotoxicity ... restored fitness, fur density, and renal function” (Baar et al. 2017); The small-molecule ABT-737 and siRNAs, which inhibit the anti-apoptotic proteins BCL-W and BCL-XL, specifically induces apoptosis in senescent cells. These senolytic agents were tested in transgenic p14(ARF) mice, with positive results for lung and epidermis damage (Yosef et al. 2016). Some drugs that inhibit the chaperone Heat Shock Protein 90 (HSP90) have been proposed as senolytics (Fuhrmann-Stroissnigg et al. 2017). The molecular machinery including HSP90 is, among other things, a key regulator of proteostasis in physiological conditions and also under stress conditions (Schopf et al. 2017), and the inhibition of HSP90 appears to reduce the resistance of senescent cells to apoptosis (Trepel et al. 2010), an effect that has also been tested for cancer treatment (Trepel et al. 2010). There is no senolytic drug approved for clinical use, although several clinical trials are ongoing. However, senolytic drugs appear very promising for the treatment of many age-associated diseases and the specific manifestations of physiological aging. The limits of their action, already discussed in (Libertini et al. 2018), will be deepened in the Subsection 8.4.4 – Genetic modifications.

366

8.4.3

8 Prevention and Treatment of the Troubles of the Elderly

Anti-aging Substances and Methods

There are many substances or methods studied for their possible anti-aging effects. Some of them, already discussed in recent reviews (Johnson et al. 2013; Phu et al. 2019; Son et al. 2019), will be outlined in this paragraph. – Caloric restriction The fact that in various animal species caloric restriction increases lifespan under certain conditions has already been discussed (see Subsection 4.4.5 – Effects of caloric restriction on lifespan). Regardless of whether this phenomenon is only the limitation of damages due to unhealthy lifestyles (in particular overfeeding) or, at least in part, an effective slowing down of the rhythm of aging, the mechanism, or mechanisms, by which these effects are obtained is the subject of many studies and careful discussion. Four potential target pathways for the effects of caloric restriction have been proposed (Son et al. 2019): 1. activation of AMP protein kinase enzyme (Canto and Auwerx 2011). The activation of this enzyme increases AMP levels and regulates cellular and whole-body metabolism, particularly by reducing hepatic glucose production, increasing glucose absorption in skeletal muscles and fatty acid oxidation in several tissues (Ruderman and Prentki 2004). Metformin, an important drug for the treatment of type 2 diabetes mellitus that activates AMP protein kinase (Rena et al. 2013), has positive effects among diabetic patients (Bannister et al. 2014), e.g., reduction of cardiovascular disease risk (UK Prospective Diabetes Study 1998), cancer incidence, and all-cause mortality (Wu et al. 2014). 2. inhibition of insulin-like growth factor-1 (IGF-1) signaling (Mitchell et al. 2015). Recent studies have shown that reduced somatotropic activity appears to delay the onset of age-related diseases and to reduce the frailty that characterizes an extended lifespan (Bartke 2009). A reduction in IGF-1 levels, which are stimulated by growth hormone, has shown a protective effect against cancer and diabetes mellitus, and an extension of the lifespan in animal models (Junnila et al. 2013). Pegvisomant, a GH receptor antagonist, used for treating acromegaly, appears to have positive effects on healthy aging and lifespan by increasing insulin sensitivity and lowering the IGF-1 level (Trainer et al. 2000). 3. activation of NAD+ dependent deacetylases (sirtuins, SIRT-1 to  7) (Imai and Guarente 2016). Sirtuins regulate the activity of proteins that are important for energy metabolism, stress resistance, and longevity (Satoh et al. 2013). “Sirtuins, mainly the best-characterized Sirt-1, -3 and -6, regulate a wide range of processes, such as metabolism, inflammation, DNA repair, stress resistance and aging. They deacetylate substrates, very important in the control of bioenergetics and metabolism, such as peroxisome proliferators-activated receptor-γ (PPAR-γ) and its coactivator-1α (PGC-1α) and AMP-activated protein kinase (AMPK), and involved in oxidative stress and inflammation, such as Forkhead box O transcription factors (FOXOs), and NF-κB (Corbi et al. 2012)” (Manzo et al. 2019). In mice, overexpression of Sirt-1 protected from the damaging effects of a high-fat

8.4 Treatment of Physiological Aging

367

diet, improved insulin sensitivity, lowered inflammatory cytokines and increased the activity of antioxidant enzymes (Pfluger et al. 2008). Overexpression of sir2, a homologous of sirtuins, extended the lifespan of yeast, Drosophila, and Caenorhabditis elegans (Wood et al. 2004). Sirtuins could extend lifespan by stimulating autophagy and antioxidant defense, lowering the level of IGF-1, and improving the functions of mitochondria (Morselli et al. 2010). Myricetin, piceatannol, quercetin, and resveratrol are Sirt-1 agonists (Chung et al. 2010), and for this action are the object of many anti-aging researchers. Resveratrol, a plant polyphenol found in high concentrations in red grapes and then in red wines, appears to improve health and lifespan in yeast, Drosophila, and nematodes (Howitz et al. 2003; Wood et al. 2004; Islam et al. 2019). In other animal models and in humans, resveratrol improved motor performance, bone health, Parkinson’s disease, Alzheimer’s disease, and memory performance in the elderly, reduced cardiac failure, and regulated lipid and glucose levels in patients suffering from obesity and type 2 diabetes mellitus (Witte et al. 2004; Baur et al. 2006; Pearson et al. 2008; Karuppagounder et al. 2009; Khan et al. 2010; Yang et al. 2010; Bhatt et al. 2012). Resveratrol and its derivative pterostilbene have been reported to have protective effects against age-related diseases such as atherosclerosis, hypertension, osteoporosis, cardiovascular disease, cancer, cataracts, arthritis, type 2 diabetes mellitus, Alzheimer’s disease, and vascular dementia (Lange and Li 2018; Li et al. 2018). Resveratrol is reported to show activity “against glycation, oxidative stress, inflammation, neurodegeneration, several types of cancer, and aging.” (Galiniak et al. 2019) Indeed, also other natural compounds have shown similar effects on sirtuins pathway activation. In particular, verbascoside, a polyphenol belonging to the phenolic acid subclass, was able to induce Sirt1 activity increase in heart rabbits, and the activation hesitated in reducing all parameters involved in cardiovascular risk composition, such as glycemia, total cholesterol, and LDL cholesterol (Corbi et al. 2018). Moreover, an increase in vitamin A and E was also found, reinforcing the previous evidence of the VB antioxidant capability. A relationship between SIRT1 activity and vitamin E levels was already demonstrated in the hippocampus and cerebral cortex of rodents, in which vitamin E prevented a decrease in SIRT1 expression caused by a high-fat diet (Wu et al. 2006). Also, Zillikens et al. (2010) found an interaction between vitamin E and SIRT1, suggesting that this interaction could be due to the antioxidant function of vitamin E and its role as a regulator of enzymes and gene activity (Brigelius-Flohé 2009). 4. inhibition of the mammalian target of rapamycin (mTOR) (Yang et al. 2014). The mammalian target of rapamycin is a serine/threonine protein kinase and is a component of two protein complexes, mTORC1 and mTORC2 (Caron et al. 2015). The first of these two complexes controls autophagy, protein translation, and other cellular processes. In the presence of sufficient nutrients, mTOR turns off stress resistance and autophagy and subsequently activates translation (Josse et al. 2016). The reduction of mTOR activity determined an extension of lifespan in yeast, Caenorhabditis elegans, Drosophila, and mice and this has stimulated studies in primates and humans (Johnson et al. 2013). Rapamycin, a potent

368

8 Prevention and Treatment of the Troubles of the Elderly

immunosuppressant drug and a strong antagonist of mTOR action, is the main substance used in these studies. Rapamycin is a powerful inhibitor of mTORC1 and shows positive effects on lifespan extension (Arriola Apelo and Lamming 2016). However, the prolonged use of the substance also determines inhibition of mTORC2, and this “... has negative effects on mammalian health and longevity and is responsible for many of the negative side effects of rapamycin.” (Arriola Apelo and Lamming 2016) (e.g., hyperglycemia, insulin resistance, hyperinsulinemia, proliferative defects in hematopoietic lineages (Soefje et al. 2011)). These four pathways summarize the main mechanisms hypothesized to explain the effects of caloric restriction (Saraswat and Rizvi 2017). Although particular studies conducted in humans with great commitment have shown that caloric restriction was feasible, tolerable, safe, and with positive effects (e.g., (Ravussin et al. 2015)), this anti-aging method, despite its proven benefits, is difficult to propose for prolonged treatment in humans. This explains the active search for compounds that mimic the restriction in caloric intake (“calorie restriction mimetics”, CRMs) without the difficulties of a restricted diet (Ingram and Roth 2015): “The CRMs include some polyphenols, especially the well-know Sirt-1 activator resveratrol, rapamycin, and rapalogs (inhibitors of mammalian target of rapamycin, mTOR), α-lipoic acid, 2-deoxy-d-glucose, and other glycolytic inhibitors, and drugs such as metformin and thiazolidinediones.” (Manzo et al. 2019) – Hormonal replacement Age-related decreased activity of adrenals, pituitary gland, and gonads determines the reduction of hormone secretion and progressive changes in health conditions (Zouboulis and Makrantonaki 2012). “Decreased hormone levels are associated with decreases in bone mineral density (BMD), muscle mass, sexual desire, erectile function, and intellectual activity. In this context, hormone supplements have been widely used to help reverse the effects of aging and improve the quality of life in the elderly.” (Son et al. 2019) – Vitamin D Vitamin D production is stimulated by sun exposure, which is insufficient in modern populations to achieve healthy levels of vitamin D (Holick and Chen 2008). “Vitamin D deficiency and insufficiency is a global health issue that afflicts more than one billion children and adults worldwide. The consequences of vitamin D deficiency cannot be underestimated. There has been an association of vitamin D deficiency with a myriad of acute and chronic illnesses including preeclampsia, childhood dental caries, periodontitis, autoimmune disorders, infectious diseases, cardiovascular disease, deadly cancers, type 2 diabetes and neurological disorders.” (Holick 2017). In older people, vitamin D deficiency is associated with loss of muscle mass and function (Janssen et al. 2002), a higher risk of Alzheimer’s disease (Balion et al.

8.4 Treatment of Physiological Aging

369

2012), hypertension, heart failure, and ischemic heart disease (Douglas et al. 1995; Rostand 1997). As vitamin D deficiency is associated with numerous harmful effects in the elderly, it has been hypothesized as a factor that accelerates aging (Berridge 2017). The therapy with supplements of vitamin D has been proposed to treat various ailments in the elderly and as an anti-aging drug in general. Vitamin D therapy in the elderly was shown to improve muscle mass and performance and reduce the rate of falls (Janssen et al. 2002). However, while the skeletal effects of vitamin D are well recognized and described extensively in the literature (Holick et al. 2012), “... its extra-skeletal effects have been subject to some controversy with conflicting data reported, particularly for case-control or epidemiologic vs. prospective and interventional studies.” (Marino and Misra 2019) – Restoration of a healthy gut microbiome Microorganisms of gut microbiome influence many important physiological functions (e.g., maturation of immune function during early development (Vaiserman et al. 2017), resistance to infection, anti-oncogenic activity, autoimmune action repression, regulation of the brain-gut axis (Konturek et al. 2015)). Some peculiarities of the gut microbiome of centenarians appear to indicate that particular microorganisms are important for a greater lifespan (Rampelli et al. 2013; Biagi et al. 2016). Healthy gut microbiome has been suggested to have “a great potential for anti-aging medicine” (Son et al. 2019). – Antioxidant substances According to the old but popular free radical theory of aging (Harman 1956), aging is caused by oxidative stress, i.e., the accumulation of substances mainly derived from oxygen (ROS). In order to counteract oxidative stress, the cells activate a complex series of molecules known as antioxidants (vitamin C, vitamin A, thioredoxin, alpha-lipoic acid, alpha-tocopherols, coenzyme Q, beta carotenoids, catalase, superoxide dismutase, glutathione-peroxidases, etc.) (Ighodaro and Akinloye 2017; Conti et al. 2016). As oxidative stress is a putative cause of aging and age-associated diseases, the use of antioxidant substances has deserved great attention as a possible means for therapeutic intervention (Forte et al. 2016; Corbi et al. 2016). However, “A large part of studies investigating the effectiveness of antioxidant supplementation therapy in humans raised contrasting results.” (Conti et al. 2016) – Physical exercise The idea of physical exercise as an anti-aging tool is a leading concept in gerontology (Aguirre and Villareal 2015; Garatachea et al. 2015; Bray et al. 2016). Physical exercise certainly has positive effects on the health of the entire organism and single organs and systems (e.g., cardiac function (Russomanno et al. 2017), skeletal muscle (Distefano and Goodpaster 2018), immune system (Weyh et al. 2020)). Moreover, there is a positive relationship between physical exercise and telomere length (Arsenis et al. 2017; Balan et al. 2018; Navarro-Ibarra et al. 2019).

370

8 Prevention and Treatment of the Troubles of the Elderly

Nonetheless, as an individual’s lifetime can be much different from the average expected lifespan within a population, the effect of changes in physical activity level on an individual lifespan can vary wildly (Barthold Jones et al. 2018; Colchero et al. 2016; Sasson 2016). Thus, in some rapidly aging animal models, like the ones associated with mitochondrial dysfunction, the increase in physical activity is associated with a substantial increase in longevity and delay of aging (GiosciaRyan et al. 2016; Kim et al. 2017; Mercken et al. 2012; Safdar et al. 2011). Again, as an example of striking differences in physical activity requirements are provided by dog breeds of different specialization. Thus, for sled or gun dog breeds, the appropriate physical activity levels are several times higher than those appropriate for guardian dogs and toy dogs (Grandin 2014; Pickup et al. 2017). Such diversity of the minimal physical activity needs can be observed in humans as well, yet often ignored (Barbieri et al. 2015). Sometimes, an individual’s high physical performance should be regarded simultaneously as an advantage and a weak point, causing a higher vulnerability – especially if the lifestyle does not equilibrate the potential. Appropriate physical activity requirements for men are generally higher than those for women, which is evolutionarily motivated, considering the times when men were mainly involved in hunting and women in the gathering of food (Hawkes et al. 2018; Malina and Little 2008; Raichlen et al. 2017). Nowadays, such differences in roles and the implied physical activity levels are still preserved in particular primitive communities (Malina and Little 2008; Raichlen et al. 2017). However, in the civilized world, with addiction to excessive comfort and sedentary lifestyle, the same features can account for a generally higher men sensitivity to the lack of physical activity and can be listed between the causes of their shorter lifespan comparing to the more sedentary lifestyle resistant women (Colchero et al. 2016; Malina and Little 2008; Mauvais-Jarvis et al. 2020; Park et al. 2020; van Uffelen et al. 2017). Such differences can illustrate the importance of adequate estimation of the individual needs and subsequent lifestyle adjustments, including the level of physical activity, but are often neglected in many general health recommendations (Barha et al. 2017; Box et al. 2019; van Uffelen et al. 2017). Significant differences in quality can be observed if exercise training is just as a monotone routine practice or, in contrast, is a part of an active lifestyle involving associated cultural, esthetic, social, or emotional constituents (Ballesteros et al. 2020; Burtscher et al. 2013; Ekkekakis et al. 2005). Thus, the response to exercise practice in groups and its diversification prove significantly higher due to a synergetic action (Ballesteros et al. 2020). The latter can be observed in many group training, including aerobics, yoga, dancing, team sports or martial arts, and outdoor exercises, from walks and hikes to cultural, touristic trips (Barha et al. 2017; Booth et al. 2012; Burtscher et al. 2013; Ekkekakis et al. 2005; Hopkins et al. 1990; Xing et al. 2020). Such activities can sow pronounced prophylactic and therapeutic effects against certain age-associated conditions, including the inflammatory profile, frailty, sarcopenia, some cognitive impairments, and Parkinson’s disease (Brown et al. 2012; Coelho-Júnior et al. 2021; Gronek et al. 2021; Larsson et al. 2019). If a balanced physical activity is undoubtedly beneficial, the effect of the overtraining and exhaustive exercises can be detrimental and lead to progressive

8.4 Treatment of Physiological Aging

371

telomere attrition and the development of an aged phenotype even in relatively young people (Chilton et al. 2017; Ludlow et al. 2008; Mehrsafar et al. 2020). Certain habits associated with a generally active lifestyle or care for others often show a far more pronounced anti-aging effect than daily sportive routines practiced for themselves (Box et al. 2019; Brown et al. 2012; Lahdenperä et al. 2004). Nevertheless, the latter should not be neglected, especially when other possibilities are not available or as preliminary training to enhance the physical performance before enrolling in other activities (Coelho-Júnior et al. 2021; Katzmarzyk 2010). Still, the common truth that prevention is much more effective and requires a significantly lower expenditure of time and effort than treatment or correction of a trouble becomes even more pronounced in the case of aging and age-associated diseases. Dietary restrictions serve as a classic example of the impacts of early-life habits on the overall longevity or other late-life events, but the same can be seen in exercise training (Colchero et al. 2016). However, it should be pointed up that in natural conditions (e.g., populations living in primitive conditions), there is a considerable physical activity (Hill and Hurtado 1996) and that reduced or minimal physical activity is an abnormal condition in evolutionary terms and therefore a probable cause of certain diseases (s. Chapter 3). Therefore, physical exercise constitutes only the restoration of the normal living conditions to which our species is adapted. While physical exercise is undoubtedly the best advice to cure and prevent many diseases, there is no proof that physical exercise extends the normal life limits of healthy subjects. – Circadian rhythms Circadian rhythms coordinate and synchronize the organism’s physiological functions at a cellular, tissue, and systemic level in the light-dark 24-hour cycle (Arendt 2012). The master circadian clock is the suprachiasmatic nucleus that receives inputs from the retinohypothalamic tract stimulated by environmental light (Welsh et al. 2010). Changes in circadian rhythms and other cyclic processes in the organism occur naturally during the individual development, from the embryonic stage to childhood, maturity, and senility (Bell-Pedersen et al. 2005). The characteristics of cyclic changes and rhythms can serve as markers of the passage through these stages, contributing both to the homeostasis during a stage and to quantitative and qualitative changes, occurring during the passage between them in the course of a lifetime (Duffy et al. 2015; Patke et al. 2020). Concerning age, circadian rhythms show significant changes affecting many functions, including hormone release, energy metabolism, temperature regulation, and cardiovascular, renal, and motor activity. Such changes can be manifested through a reduced amplitude of a given parameter’s cyclical variation, re-ranging, or a shift of the peak of some rhythms, including sleep timing (Froy 2011; Kondratova and Kondratov 2013; Hood and Amir 2017). Substantial rhythm alterations can be associated with inflammatory diseases, emotional disorders such as depression, and external factors, such as light or sound pollution, common in the

372

8 Prevention and Treatment of the Troubles of the Elderly

urban areas (Fisk et al. 2018). Telomerase activity shows “endogenous circadian rhythmicity in humans and mice” (Chen et al. 2014). Alterations of circadian rhythms “appear to accelerate the aging process and contribute to senescence, with some systems being more vulnerable than others.” (Gibson et al. 2009). In some age-related neurodegenerative diseases, such as Alzheimer’s and Parkinson’s, alterations of circadian rhythms constitute an early group of symptoms (Abbott and Videnovic 2016; Mattis and Sehgal 2016). Frequent flying with trans meridian travels, exposure to irregular light-dark conditions, and working in changing swifts are among the harmful conditions that alter circadian rhythms (Khan et al. 2018). These alterations are correlated with increased morbidity for many diseases and higher mortality rates (Tranah et al. 2010; Froy 2011). Still, the causative relationship between the changes in circadian rhythms and aging is not always evident (Duffy et al. 2015). Though, once their cause is eliminated, a return to the initial parameters can be observed. Such cases of the restoration of rhythms along with many other organism parameters to a point, typical to a younger age, as a consequence of chronic stress elimination, emphasize the importance of discrimination between natural aging, and evidence of chronic exposure to harmful factors, not always apparent, but which should be avoided (Diallo et al. 2020; Ruan et al. 2021). Prevention of conditions that cause, or contribute to causing, alterations in circadian rhythms permit indeed to avoid the more significant morbidity and the associated higher mortality. However, no studies are showing that this extends the expected normal life limits of healthy subjects. – Traditional herbal medicines In some traditional medicine, various herbs are used to prevent age-associated diseases and to slow aging. A recent review has examined the phytotherapeutics (“flavonoids, terpenoids, saponins, and polysaccharides, which include astragaloside, ginkgolide, ginsenoside, and gypenoside”) considered to be most effective (Phu et al. 2019). They appear to improve cognitive impairments and resistance to DNA damage, and to reduce cardiovascular risks, and their main targets are “Telomere and telomerase, PPAR-α, GLUTs, FOXO1, caspase-3, BCL-2, along with SIRT1/AMPK, PI3K/Akt, NF-κB, and insulin/insulin-like growth factor-1 pathways” (Phu et al. 2019). – Mediterranean diet The association between diet and shortening of telomeres is currently under investigation, and the importance of telomere maintenance in conferring chromosomal stability and prevention of cell senescence has triggered great interest in the field of human aging. Diet may be either a protective or a detrimental factor for telomere length, depending upon its composition. The positive effects of Mediterranean Diet (MD) seem to lie in its synergy among bioactive nutrients belonging to several food groups (Jacobs Jr et al. 2009), constituting a unique cocktail of multiple

8.4 Treatment of Physiological Aging

373

phytochemicals with remarkable biological properties, including the ability to target telomere maintenance. At a molecular level, the synergistic interaction between these components may exert a multifactorial protective effect that is capable of reducing disease risk through attenuating specific aging mechanisms (i.e., inflammation and oxidative stress) (Mendez and Newman 2018). Recently Davinelli et al. (2019) summarized the human studies investigating the effects of the MD on telomere shortening, showing as this tool may be considered for preserving telomere shortening throughout the lifespan. Because also genetic factors are involved in the regulation of telomere length, polymorphisms associated with telomerase activity and metabolism of nutrients may also modify the effects of dietary factors on telomere structure and function. Thus, although telomere length represents a measurable outcome, a nutrigenetic/nutrigenomic approach may add new information to fill the many gaps in the knowledge on the link between MD and telomere length. – Interpretation of the above reported anti-aging substances and methods The nature and effects of the anti-aging substances and methods previously reported are very diversified. However, some general considerations are possible. Disregarding the cases or conditions in which the relationship between substance/ method and the beneficial effect is not documented or rather does not exist, their actions can be classified in some categories. – In some cases (e.g., astragalosides), their action is carried out at least in part by activation or stimulation of telomerase. Therefore they fall under the topic of Subsection 8.4.1 – Telomerase activation. – In many cases, they counteract the harmful effects of unhealthy substances or lifestyles causing diseases that often can be considered an acceleration of the physiological aging process (s. Section 8.3 – Acceleration of aging: prevention and treatment). Consequently, they cannot be defined as anti-aging in its strict sense. – In other cases, in particular calorie restriction and CRMs, they counteract part of the mechanisms that constitute the aging process (see Fig. 8.5). These mechanisms are subordinated to the repression of T-sequences, i.e., to the inhibition of T-transcripts’ production, and so their actions are better interpretable by the scheme of Fig. 8.6, which represents an integration of Fig. 8.5.

8.4.4

Genetic Modifications

Let us consider the various possible strategies to counteract aging. Telomerase activation or reactivation (Method A) should eliminate the partial alterations of cellular functionality in gradual cell senescence restoring full cellular functionality, and reduce the risk of triggering cell senescence program, but is unable

374

8 Prevention and Treatment of the Troubles of the Elderly

Fig. 8.5 Effects of calorie restriction and some CRMs. The image is a reworking of the scheme proposed in Fig. 1 from (Son et al. 2019)

Fig. 8.6 The diagram of Fig. 8.5 inserted in the wider context of the effects of T-transcripts

8.4 Treatment of Physiological Aging

375

to cancel the condition of cell senescence nor the alterations in cellular functionality characteristic of this condition. The elimination of senescent cells by senolytic drugs (Method B) can improve the overall functionality of tissues and organs. However, it cannot cancel the alterations of cellular functionality of gradual cell senescence and so cannot have the effects of telomerase activation. The combined and repeated application of A and B (Method C) starting from a non-young age would get the advantages of the two methods but could not eliminate the anatomical or functional damages that occurred before the application of these methods. The combined and repeated application of A and B starting from young ages (Method D), for the precocity of the interventions, would limit the pre-existing anatomical or functional damage. However, methods A and B both have an intrinsic limit, which, from a theoretical point of view, prevents them from being proposed as a complete solution for aging. The pool of each type of primary stem cells, as they do not have fully active telomerase, slowly gets depleted, because an age-related increasing fraction of these cells suffers from cell senescence and, therefore, replicative senescence. This depletion could be slowed down but not canceled by early and frequent telomerase activations. A more radical intervention, based on genetic modifications, was proposed in a previous work (Libertini and Ferrara 2016). This hypothetical intervention was based on the insertion of an inert sequence in subtelomere-telomere junction to avoid any subtelomere repression before a certain shortening of the telomere. The concomitant repeated activation of telomerase, which determined telomere elongation, would have kept the telomere’s length within limits that would not have involved the inhibition of the subtelomere. For this approach, apart from the ethical problems (discussed separately) and the technical difficulties, a closer examination raises some important objections: (i) The telomeres in each cell are equal to the number of the ends of DNA molecules (92 in a human cell), and the subtelomere-telomere junctions are not necessarily equal for all ends; (ii) Evidence relating to TERRA subtelomeric sequences shows that there are at least two types of subtelomeric sequences. Furthermore, there may be DNA ends without these sequences and therefore with different nucleotide sequences; (iii) The transcription of T-sequences also includes the transcription of some telomere motifs. This originates some needs: A) First of all, it is necessary to know for all the ends of cellular DNA molecules the sequence and the function of their subtelomeric segments. A different type of intervention is likely essential according to the various types of subtelomeric sequences;

376

8 Prevention and Treatment of the Troubles of the Elderly

B) If an inert sequence is inserted before the first telomere motif, the incomplete T-transcript could be inactive or malfunctioning. It should be verified whether the insertion of an inert sequence after some motifs allows T-transcripts to be perfectly functional; C) It is likely that in the case of T-sequence duplication, the overexpression of the sequence could cause dysfunctions. This is to be verified, as well as to verify the effects of the duplication of a T-sequence together with the deactivation of the original sequence. These considerations highlight that for the implementation of an effective genetic modification with the above-described aims, intense preliminary work is needed to obtain a complete understanding of subtelomeric sequences and their functions and of the effects obtained with various types of genetic modifications. It is clear that, from a theoretical point of view, all this represents a very difficult but not impossible task. These changes would aim to make primary stem cells less vulnerable or resistant to the activation of cell senescence program to slow down or avoid the progressive age-related decline in cell turnover. Only with full control of this decline will it be possible to avoid any anatomical or functional alteration that is the rule to observe in aging. These concepts are summarized in Table 8.3.

Table 8.3 Possible effects of various methods to oppose aging manifestations

Age-related alterations Increasing number of cells in gradual cell senescence Increasing number of cells in cell senescence Decline of cell turnover Irreversible anatomical and functional alterations

Treatments A

B

C

Telomerase activation Y

Elimination of senescent cells –

–

A+B starting from old ages Y

D A+B starting from young ages Y

D + genetic modifications to oppose cell turnover decline Y

Y

Y

Y

Y

Y/

–

Y/

Y/

Y

–

–

–

Y/

Y

(Abbreviations: Y ¼ positive effect;  ¼ null or not relevant effect)

E

8.4 Treatment of Physiological Aging

8.4.5

377

Ethical Problems

The ethical problems related to the use of methods that may slacken or block the aging process have been discussed in two papers (Libertini and Ferrara 2016; Libertini et al. 2018), and the question is deepened in this section. Any experimentation to obtain drugs or methods capable of curing a disease or improving its symptoms requires a due attention to the ethical problems connected with the specific research. Here, there is no wish to debate or even to mention ethical problems that are, to varying degrees, common in biomedical research, but it is highlighted and briefly discussed only the specific ethical problem that exists or could arise regarding the search for methods that may slow down or block aging. In the traditional view of the non-adaptive aging paradigm, senescence is the cumulative result of various degenerative processes. The effects of each of them can be defined as a disease, and their overall result can easily be defined as a syndrome with multifactorial genesis. According to this interpretation, fighting to age is not radically different from actions aimed at opposing any disease. Yet, even in this traditional view, a hypothetical method capable of radically changing the rhythms of aging would be seen as something that strongly changes human nature and, consequently, the social and cultural structure of humankind. Although for the non-adaptive aging paradigm, such a method is considered very improbable or impossible, its great difference compared to the treatment of common diseases is considered evident. It is no coincidence that the only cases in which, in myth or fantasy, man achieves immortality, this is the result of a divine concession or a pact with the devil and philosophical and ethical problems of great importance always follow: “... senescence is the subject of a vast body of edifying matter – literary, philosophical, and religious. One product of this attitude – the belief that it is impious, and must lead to some form of retributive disaster, to tamper with fate or the process of ageing – is with us today” (Comfort 1979, pp. 2–3). Consequently, even in the traditional interpretation of aging, ethical problems exist but are considered unrealistic or completely remote due to the believed impossibility to effectively control a process determined by a chaotic and growing disorder of the organism. For the adaptive aging paradigm, the issue changes radically. In this paradigm, aging is not a disease, and, on the contrary, it is proposed as a physiological process modeled and favored by natural selection. According to this conception, it is impossible to “cure” a non-disease such as aging, while, as a correct description of the action, it is possible to “modify” or even completely control aging as a physiological event. The difference between the two conceptions is by no means a simple semantic question of definitions and implies profound consequences. Certainly, when there are forms of acceleration of the aging process determined by unhealthy life habits or abnormal forms of aging caused by altered genes, it is thoroughly correct to define these phenomena as diseases and to fight them by the energies and forms that are used for any disease without any particular ethical problem.

378

8 Prevention and Treatment of the Troubles of the Elderly

Outside of these cases, that is, considering aging only in its physiological characteristics and rhythms, a modification or a block of the aging process is something profoundly different from the treatment of a disease. Aging could indeed be defined as a disease sui generis because, although it is physiological in its determination and expression, it necessarily involves suffering and death. This would serve to conceal a problem, which, even if apparently canceled, would remain intact in its main nature. We also have varying degrees in which the problem can manifest itself. Let us consider a treatment that delays a manifestation of aging, for example, a method that can limit or avoid the manifestations of Alzheimer’s disease in very elderly people. Although Alzheimer’s disease is the rule in older ages and is part of the manifestations of aging, this method will surely be considered to be the effective treatment of a disease, and no one will want to raise ethical questions. Now, let us consider methods that significantly slow down the aging process, for example, by adding decades of life without the disabling problems of aging. Here, too, we could lie to ourselves by pretending we had defeated a set of diseases. In reality, these methods would modify human physiology and nature. At this point, the ethical problem exists: we can argue that these methods are right and ethically admissible or even argue otherwise, but it is not admissible to maintain that there is no ethical problem. This problem would be even more evident if these methods were able to completely control the aging process or, as an extreme possibility, if they needed manipulation of the human genome. It is clear that a specific ethical issue for the treatment of aging exists, and it would be illusory or superficial to deny or underestimate its importance. It should be noted that here it is highlighted the existence of the problem but that there is no will to investigate it in the terms that it requires. “In short, is it ethically acceptable to pursue the goal of unlimited longevity, even if this aim plausibly involves actions on gene activity or even permanent genetic changes? An easy answer could be that this is acceptable without reserve. The opposite answer could be that there are limits to be observed in a strict way when human nature is modified in one of its essential characteristics (i.e., its natural cycle of life).” (Libertini et al. 2018). The complete control of aging up to the condition shown by species “with negligible senescence” (Finch 1990), i.e., unlimited life span except for death by accidental events, is not a perfect cure of a disease but constitutes a radical change of human nature. In the myths of ancient Greece, a mortal who tried to become immortal by equalling the condition of the gods was guilty of the very serious and unforgivable sin, defined as ύβρις, that is to say, impious and arrogant pride towards the divinity. Furthermore, a religious could object that being man a fruit of divine creation (Genesis 1:26:“Then God said, ‘Let Us make man in Our image, after Our likeness ....”; Genesis 1:27: “So God created man in His own image, in the image of God He created Him ...”), any modification of this creation would be a sacrilege and a form of contempt for divine work.

8.5 Current Geriatrics and Society

379

In our discussion, there is no proposed answer or solution, and, in no way, any answer or solution suggested as originated by scientific considerations. By definition an ethical problem is something for which science may present the terms of the problem. However, the possible answers are the result of evaluations beyond the scientific sphere and pertaining to other fields, which may be religious, philosophical, political, or, in general, ethical.

8.5

Current Geriatrics and Society

Some conditions discussed in Section 8.3 – Acceleration of aging: prevention and treatment (unhealthy lifestyles and their consequences; e.g., diabetes, smoking, hypertension, obesity and dyslipidemia, alcohol abuse) appear to determine a general acceleration of the aging process. It is possible to prevent these conditions and, at least in part, to counter the damage they cause, i.e., to limit the acceleration of aging. The good results obtained for these conditions by preventive and curative measures create the misleading illusion of effective treatment of the aging process or even the idea that with greater preventive and curative measures similar to those already used, it will be possible to achieve greater control of aging. In reality, there is no evidence demonstrating that a healthy lifestyle and the current therapeutic means can slow down or block the physiological rhythms of aging. The study of a human population under natural conditions shows that, despite the absence or irrelevance of the current diseases afflicting or killing a large part of individuals in the modern era, there is a progressive age-related fitness decline up to reach limits incompatible with life (Hill and Hurtado 1996; Libertini 2013). Beyond the triumphant successes of modern medicine, most often against diseases that are absent or very rare in primitive conditions, the sophisticated modern drugs, and advanced diagnostic and therapeutic techniques appear ineffective and useless to counteract physiological aging. In the past, Herodotus, in his Histories (III, 23) (Herodotus V c. b.C.), reported an illusory remedy against aging, namely drinking the miraculous water of the fountain of youth capable of guaranteeing eternal youth and thus immortality. Another myth, perhaps originated from the Chinese sage Wei Po-Yang (second century A.D.), was the so-called philosopher’s stone, which was capable of turning lead into gold and averting the changes caused by aging (Comfort 1979). Over the centuries, myths, fantasies, and laborious searches for substances or means capable of defeating aging have been frequent (Comfort 1979). Today, it is a widespread idea, but not necessarily the truth, that aging is the ineluctable final result of innumerable degenerative processes, which are unavoidable and uncontrollable (Hayflick 2007). However, the possibility of marginal and transient results that can partially oppose the aging process and extend life to several years more is not excluded (De Grey 2005). The prevailing conception, namely the paradigm of non-adaptive aging, is that these degenerative processes do not constitute a unitary process and do not have or cannot have any adaptive value. As a logical

380

8 Prevention and Treatment of the Troubles of the Elderly

consequence, as already said, there is no distinct code for the aging in the International Classification of Diseases (WHO 2016, 2018) and, in the official world statistics, aging as a cause of death is absent (WorldLifeExpectancy 2017; World Ranking Total Deaths 2017). This long history of failures and disappointments about aging is the root of the conception and practice of current geriatrics which defends its utter failure through the concept of the impossibility of any effective treatment of aging: “Geriatrics, if we want to say things without euphemism, is currently the most unsuccessful of medical activities. It is not able to cure aging and, indeed, the incurability of aging is emphasised by the same discipline to justify its failure. Geriatrics, at best, allows us to mitigate the sufferings of the old and to compensate for the deficits caused by them. In other cases, it can only apply palliative treatments and psychological support.” (Libertini et al. 2018). The absence of effective means against aging is not simply a problem only with medical relevance and is indeed something that concerns the social, economic, philosophical, religious, cultural, and political framework of any human civilization profoundly. Every past and present culture is influenced in all its aspects by the progressive senescence of its individuals and by their limited life span. Even when we do not talk directly about aging and its consequences, ideas and acts are conditioned by this reality. The impotence of current geriatrics is not the subject of any protest from patients and family members because this is only the confirmation of a concept that has for a long time pervaded all human cultures.

8.6

Future Geriatrics and Society

Programmed or adaptive aging theory suggests that aging is a physiological phenomenon, “a specific biological function” (Skulachev 1997), which must necessarily be determined and regulated by specific genes. This means that, as aging is not caused by uncontrollable random degenerative processes, in principle, it is possible to conceive actions that could slow down or stop or even reverse the aging process. Excluding groundless hypotheses and deceptive wishes and remaining linked closely to the facts, a series of experiments, reported in the previous chapters and sections, demonstrates that these possibilities are realistic. Within the conception of aging as an adaptive and physiological phenomenon, concrete actions and methods to combat aging are already being tested, and the prospects for effective control of aging are no longer to be considered an idea without scientific bases, i.e., a sort of modern version of the fountain of youth or the philosopher’s stone. In particular, telomerase activation or stimulation and the selective elimination of senescent cells by senolytic drugs have already shown good results and prospects in animal models. There is no theoretical argument against the possible effects of these types of interventions in humans.

8.6 Future Geriatrics and Society

381

The transition from a palliative and ineffective geriatrics to a geriatrics that can radically change or even cancel the aging process is proposable. With the ethical reserves of the case, a revolution in gerontology and geriatrics is, therefore, possible, and geriatrics can be transformed from the greatest failure to the greatest success of medicine (Libertini et al. 2018). In any way, it is necessary to avoid believing or, worse, to propose as a scientific result the idea that the complete control of aging, or a society with individuals who do not age, is only and merely something positive: “... many pains of today would end, but many others would begin. Our descendants would commiserate with us for our limited life span and longevity but would envy us for so many other things. A society composed of individuals with very long longevity cannot be in a simple way the same society of today. All or most would have to change. A very small risk to life considered today acceptable because the expectation of life is a few decades becomes unacceptable if there is a very long expectation of life. Rigorous measures to prevent incidents – with a severity currently unimaginable – would be the rule. Today, procreation is free and one of the rights considered inviolable. The limitation of only one child per family imposed in China seems to most people an unacceptable limitation. In a society with a very long lifespan, births would be regulated and limited in proportion. Children would be a rare exception, cuddled, and protected by whole communities. Motherhood would become a rare privilege. Today, marriage is a life-long oath, and its break is a trauma strongly discouraged. Marriage would be transformed into a temporary engagement with specific rules and limitations. Powerful and/or rich persons would be able to obtain peaks of power and/or wealth today inconceivable. Many rules would be arranged to limit the excesses and to assure turnover in power management. Today, a man studies for a certain period of his life, then works for another period and then retires on a pension, enjoying the fruits of his work. This way of life would not be possible any longer. Perhaps there would be an alternation between periods of work and others of rest or study. The mean level of education would increase enormously, and cases of persons with various degrees and specializations would be frequent as well, because, after a certain period, there would be a psychological demand to change the object of study and work. There would be extreme attention to beautiful, artistic, and poetical things, and there would be supreme examples of lovers of artistic disciplines, but also monstrous examples of egoism and wickedness. But there would be also the spread of what the Romans called taedium vitae, and perhaps suicide would become the main cause of death. The wars – in memory – would become a symbol of extreme madness, but the world would be static and uniform. Our descendants would commiserate with us for our innumerable wars and yet in historical action representations would pursue those emotions that they would lack entirely in everyday life – a little like when we deplore

382

8 Prevention and Treatment of the Troubles of the Elderly

the troubles of the past centuries but are fascinated by representations of warriors fighting with swords, bows and other ancient weapons. And what are we to say of philosophy, religion, politics, poetry, sociology, psychology, etc.? All changes if the expectation of life is immensely great. Cynics and unbelievers would state that God, religion and philosophy are reformulated and adapted to the new society, showing once again to be only creations of the human mind. Mystics and believers would state instead that God, religion and philosophy are unchanged in their essence and that a life unlimited in its duration allows a better level of comprehension because we would be less limited by physical ties. Economics and politics would have radically different aims. Today, we plan for the contemporary generation and a little – if one is farsighted – for the next. In the future, men would think first to the future, as the contemporary generation would have to live in that time.” (Libertini 2009). With progression in the understanding of mechanisms that determine lifespan, more and more instruments, able to influence it, are likely to become available. However, without fundamental changes in the whole species’s biology, from the social interactions to the adjustment of species’s place and role in the ecosystem, sudden lifespan alterations seem questionable, if not dangerous. Even if concerning a small number of “the chosen ones”, substantial lifespan extension is very likely to generate a contrast between the interests of few individuals and the interests and stability of the whole population and even of the species and of the ecosystem. Perhaps Hamlet’s dilemma, the choice between life and death, reformulated as the choice between unlimited and limited life span, will be the main decision the next generations will have to take (Fig. 8.7). In any case, this choice will be beyond the tasks and limits of science.

Fig. 8.7 The new Hamlet’s dilemma: unlimited or limited life span?

References

383

References Abbott, S. M., & Videnovic, A. (2016). Chronic sleep disturbance and neural injury: Links to neurodegenerative disease. Nature and Science of Sleep, 8, 55–61. https://doi.org/10.2147/NSS. S78947. Acosta, J. C., O’Loghlen, A., Banito, A., Guijarro, M. V., Augert, A., Raguz, S., Fumagalli, M., Da Costa, M., Brown, C., Popov, N., Takatsu, Y., Melamed, J., et al. (2008). Chemokine signaling via the CXCR2 receptor reinforces senescence. Cell, 133(6), 1006–1018. https://doi.org/10. 1016/j.cell.2008.03.038. Aguirre, L. E., & Villareal, D. T. (2015). Physical exercise as therapy for frailty. Nestle Nutrition Institute Workshop Series, 83, 83–92. https://doi.org/10.1159/000382065. Aldigier, J. C., Meur, Y. L., & Brunel, P. (1998). Protection of renal function with ACE inhibitors: Experience with benazepril. Clinical Drug Investigation, 16(6), 463–472. https://doi.org/10. 2165/00044011-199816060-00006. Alehagen, U., Benson, L., Edner, M., Dahlström, U., & Lund, L. H. (2015). Association between use of statins and outcomes in heart failure with reduced ejection fraction: Prospective propensity score matched cohort study of 21 864 patients in the Swedish Heart Failure Registry. Circulation. Heart Failure, 8(2), 252–260. https://doi.org/10.1161/CIRCHEARTFAILURE. 114.001730. Amann, B., Tinzmann, R., & Angelkort, B. (2003). ACE inhibitors improve diabetic nephropathy through suppression of renal MCP-1. Diabetes Care, 26(8), 2421–2425. https://doi.org/10. 2337/diacare.26.8.2421. An, T., Hao, J., Sun, S., Li, R., Yang, M., Cheng, G., & Zou, M. (2017). Efficacy of statins for osteoporosis: A systematic review and meta-analysis. Osteoporosis International, 28(1), 47–57. https://doi.org/10.1007/s00198-016-3844-8. Aoki, M., Kawahata, H., Sotobayashi, D., Yu, H., Moriguchi, A., Nakagami, H., Ogihara, T., & Morishita, R. (2015). Effect of angiotensin II receptor blocker, olmesartan, on turnover of bone metabolism in bedridden elderly hypertensive women with disuse syndrome. Geriatrics & Gerontology International, 15(8), 1064–1072. https://doi.org/10.1111/ggi.12406. Arendt, J. (2012). Biological rhythms during residence in polar regions. Chronobiology International, 29(4), 379–394. https://doi.org/10.3109/07420528.2012.668997. Arriola Apelo, S. I., & Lamming, D. W. (2016). Rapamycin: An InhibiTOR of aging emerges from the soil of Easter Island. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 71(7), 841–849. https://doi.org/10.1093/gerona/glw090. Arsenis, N. C., You, T., Ogawa, E. F., Tinsley, G. M., & Zuo, L. (2017). Physical activity and telomere length: Impact of aging and potential mechanisms of action. Oncotarget, 8(27), 45008–45019. https://doi.org/10.18632/oncotarget.16726. Baar, M. P., Brandt, R. M. C., Putavet, D. A., Klein, J. D. D., Derks, K. W. J., Bourgeois, B. R. M., Stryeck, S., Rijksen, Y., van Willigenburg, H., Feijtel, D. A., van der Pluijm, I., Essers, J., et al. (2017). Targeted apoptosis of senescent cells restores tissue homeostasis in response to chemotoxicity and aging. Cell, 169(1), 132–147. https://doi.org/10.1016/j.cell.2017.02.031. Baker, D. J., Jeganathan, K. B., Cameron, J. D., Thompson, M., Juneja, S., Kopecka, A., Kumar, R., Jenkins, R. B., de Groen, P. C., Roche, P., & van Deursen, J. M. (2004). BubR1 insufficiency causes early onset of aging-associated phenotypes and infertility in mice. Nature Genetics, 36 (7), 744–749. https://doi.org/10.1038/ng1382. Baker, D. J., Perez-Terzic, C., Jin, F., Pitel, K. S., Niederländer, N. J., Jeganathan, K., Yamada, S., Reyes, S., Rowe, L., Hiddinga, H. J., Eberhardt, N. L., Terzic, A., & van Deursen, J. M. (2008). Opposing roles for p16Ink4a and p19Arf in senescence and ageing caused by BubR1 insufficiency. Nature Cell Biology, 10(7), 825–836. https://doi.org/10.1038/ncb1744. Baker, D. J., Wijshake, T., Tchkonia, T., LeBrasseur, N. K., Childs, B. G., van de Sluis, B., Kirkland, J. L., & van Deursen, J. M. (2011). Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature, 479(7372), 232–236. https://doi.org/10.1038/ nature10600.

384

8 Prevention and Treatment of the Troubles of the Elderly

Baker, D. J., Childs, B. G., Durik, M., Wijers, M. E., Sieben, C. J., Zhong, J., Saltness, R. A., Jeganathan, K. B., Verzosa, G. C., Pezeshki, A., Khazaie, K., Miller, J. D., & van Deursen, J. M. (2016). Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature, 530 (7589), 184–189. https://doi.org/10.1038/nature16932. Balan, E., Decottignies, A., & Deldicque, L. (2018). Physical activity and nutrition: Two promising strategies for telomere maintenance? Nutrients, 10(12), 1942. https://doi.org/10.3390/ nu10121942. Balion, C., Griffith, L. E., Strifler, L., Henderson, M., Patterson, C., Heckman, G., Llewellyn, D. J., & Raina, P. (2012). Vitamin D, cognition, and dementia: A systematic review and metaanalysis. Neurology, 79(13), 1397–1405. https://doi.org/10.1212/WNL.0b013e31826c197f. Ballesteros, S., Rieker, J. A., Mayas, J., Prieto, A., Toril, P., Jiménez, M. P., & Reales, J. M. (2020). Effects of multidomain versus single-domain training on executive control and memory in older adults: Study protocol for a randomized controlled trial. Trials, 21(1), 404. https://doi.org/10. 1186/s13063-020-04293-3. Bannister, C. A., Holden, S. E., Jenkins-Jones, S., Morgan, C. L., Halcox, J. P., Schernthaner, G., Schernthaner, G., Mukherjee, J., & Currie, C. J. (2014). Can people with type 2 diabetes live longer than those without?: A comparison of mortality in people initiated with metformin or sulphonylurea monotherapy and matched, non-diabetic controls. Diabetes, Obesity & Metabolism, 16(11), 1165–1173. https://doi.org/10.1111/dom.12354. Barbieri, E., Agostini, D., Polidori, E., Potenza, L., Guescini, M., Lucertini, F., et al. (2015). The pleiotropic effect of physical exercise on mitochondrial dynamics in aging skeletal muscle. Oxidative Medicine and Cellular Longevity, 2015, 917085. https://doi.org/10.1155/2015/ 917085. Barha, C. K., Davis, J. C., Falck, R. S., Nagamatsu, L. S., & Liu-Ambrose, T. (2017). Sex differences in exercise efficacy to improve cognition: A systematic review and meta-analysis of randomized controlled trials in older humans. Frontiers in Neuroendocrinology, 46, 71–85. https://doi.org/10.1016/j.yfrne.2017.04.002. Barthold Jones, J. A., Lenart, A., & Baudisch, A. (2018). Complexity of the relationship between life expectancy and overlap of lifespans. PLoS One, 13(7), e0197985. https://doi.org/10.1371/ journal.pone.0197985. Bartke, A. (2009). The somatotropic axis and aging: Mechanisms and persistent questions about practical implications. Experimental Gerontology, 44(6–7), 372–374. https://doi.org/10.1016/j. exger.2009.04.001. Baur, J. A., Pearson, K. J., Price, N. L., Jamieson, H. A., Lerin, C., Kalra, A., Prabhu, V. V., Allard, J. S., Lopez-Lluch, G., Lewis, K., Pistell, P. J., Poosala, S., et al. (2006). Resveratrol improves health and survival of mice on a high-calorie diet. Nature, 444(7117), 337–342. https://doi.org/ 10.1038/nature05354. Beauséjour, C. M., Krtolica, A., Galimi, F., Narita, M., Lowe, S. W., Yaswen, P., & Campisi, J. (2003). Reversal of human cellular senescence: Roles of the p53 and p16 pathways. The EMBO Journal, 22(16), 4212–4222. https://doi.org/10.1093/emboj/cdg417. Bell-Pedersen, D., Cassone, V. M., Earnest, D. J., Golden, S. S., Hardin, P. E., Thomas, T. L., & Zoran, M. J. (2005). Circadian rhythms from multiple oscillators: Lessons from diverse organisms. Nature Reviews. Genetics, 6(7), 544–556. https://doi.org/10.1038/nrg1633. Ben-Porath, I., & Weinberg, R. (2005). The signals and pathways activating cellular senescence. The International Journal of Biochemistry & Cell Biology, 37(5), 961–976. https://doi.org/10. 1016/j.biocel.2004.10.013. Bernardes de Jesus, B., Vera, E., Schneeberger, K., Tejera, A. M., Ayuso, E., Bosch, F., & Blasco, M. A. (2012). Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer. EMBO Molecular Medicine, 4(8), 691–704. https://doi. org/10.1002/emmm.201200245. Berridge, M. J. (2017). Vitamin D deficiency accelerates ageing and age-related diseases: A novel hypothesis. The Journal of Physiology, 595(22), 6825–6836. https://doi.org/10.1113/JP274887.

References

385

Bhatt, J. K., Thomas, S., & Nanjan, M. J. (2012). Resveratrol supplementation improves glycemic control in type 2 diabetes mellitus. Nutrition Research, 32(7), 537–541. https://doi.org/10.1016/ j.nutres.2012.06.003. Biagi, E., Franceschi, C., Rampelli, S., Severgnini, M., Ostan, R., Turroni, S., Consolandi, C., Quercia, S., Scurti, M., Monti, D., Capri, M., Brigidi, P., & Candela, M. (2016). Gut microbiota and extreme longevity. Current Biology, 26(11), 1480–1485. https://doi.org/10.1016/j.cub. 2016.04.016. Björnsson, E. S. (2015). Drug-induced liver injury: An overview over the most critical compounds. Archives of Toxicology, 89(3), 327–334. https://doi.org/10.1007/s00204-015-1456-2. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B., Harley, C. B., Shay, J. W., Lichtsteiner, S., & Wright, W. E. (1998). Extension of life-span by introduction of telomerase into Normal human cells. Science, 279(5349), 349–352. https://doi.org/10.1126/ science.279.5349.349. Bonsu, K. O., Owusu, I. K., Buabeng, K. O., Reidpath, D. D., & Kadirvelu, A. (2017). Statin treatment and clinical outcomes of heart failure among Africans: An inverse probability treatment weighted analysis. Journal of the American Heart Association, 6(4), pii:e004706. https://doi.org/10.1161/JAHA.116.004706. Booth, F. W., Roberts, C. K., & Laye, M. J. (2012). Lack of exercise is a major cause of chronic diseases. Comprehensive Physiology, 2(2), 1143–1211. https://doi.org/10.1002/cphy.c110025. Box, A. G., Feito, Y., Brown, C., & Petruzzello, S. J. (2019). Individual differences influence exercise behavior: How personality, motivation, and behavioral regulation vary among exercise mode preferences. Heliyon, 5(4), e01459. https://doi.org/10.1016/j.heliyon.2019.e01459. Bray, N. W., Smart, R. R., Jakobi, J. M., & Jones, G. R. (2016). Exercise prescription to reverse frailty. Applied Physiology, Nutrition, and Metabolism, 41(10), 1112–1116. https://doi.org/10. 1139/apnm-2016-0226. Brigelius-Flohé, R. (2009). Vitamin E: The shrew waiting to be tamed. Free Radical Biology & Medicine, 46(5), 543–554. https://doi.org/10.1016/j.freeradbiomed.2008.12.007. Brown, B. M., Peiffer, J. J., Sohrabi, H. R., Mondal, A., Gupta, V. B., Rainey-Smith, S. R., et al. (2012). Intense physical activity is associated with cognitive performance in the elderly. Translational Psychiatry, 2(11), e191. https://doi.org/10.1038/tp.2012.118. Burks, T. N., Andres-Mateos, E., Marx, R., Mejias, R., Van Erp, C., Simmers, J. L., Walston, J. D., Ward, C. W., & Cohn, R. D. (2011). Losartan restores skeletal muscle remodeling and protects against disuse atrophy in sarcopenia. Science Translational Medicine, 3(82), 82ra37. https://doi. org/10.1126/scitranslmed.3002227. Burton, L. A., & Sumukadas, D. (2010). Optimal management of sarcopenia. Clinical Interventions in Aging, 5, 217–228. https://doi.org/10.2147/cia.s11473. Burtscher, M., Bodner, T., Burtscher, J., Ruedl, G., Kopp, M., & Broessner, G. (2013). Life-style characteristics and cardiovascular risk factors in regular downhill skiers: An observational study. BMC Public Health, 13, 788. https://doi.org/10.1186/1471-2458-13-788. Cai, R., Yuan, Y., Sun, J., Xia, W., Huang, R., Tian, S., Dong, X., Shen, Y., & Wang, S. (2016). Statins worsen glycemic control of T2DM in target LDL-c level and LDL-c reduction dependent manners: A meta-analysis. Expert Opinion on Pharmacotherapy, 17(14), 1839–1849. https:// doi.org/10.1080/14656566.2016.1220539. Campisi, J., & d’Adda di Fagagna, F. (2007). Cellular senescence: When bad things happen to good cells. Nature Reviews of Molecular Cell Biology, 8(9), 729–740. https://doi.org/10.1038/ nrm2233. Canto, C., & Auwerx, J. (2011). Calorie restriction: Is AMPK a key sensor and effector? Physiology (Bethesda), 26(4), 214–224. https://doi.org/10.1152/physiol.00010.2011. Caron, A., Richard, D., & Laplante, M. (2015). The roles of mTOR complexes in lipid metabolism. Annual Review of Nutrition, 35, 321–348. https://doi.org/10.1146/annurev-nutr-071714034355. Chang, J., Wang, Y., Shao, L., Laberge, R. M., Demaria, M., Campisi, J., Janakiraman, K., Sharpless, N. E., Ding, S., Feng, W., Luo, Y., Wang, X., et al. (2016). Clearance of senescent

386

8 Prevention and Treatment of the Troubles of the Elderly

cells by ABT263 rejuvenates aged hematopoietic stem cells in mice. Nature Medicine, 22(1), 78–83. https://doi.org/10.1038/nm.4010. Chen, W. D., Wen, M. S., Shie, S. S., Lo, Y. L., Wo, H. T., Wang, C. C., Hsieh, I. C., Lee, T. H., & Wang, C. Y. (2014). The circadian rhythm controls telomeres and telomerase activity. Biochemical and Biophysical Research Communications, 451(3), 408–414. https://doi.org/10. 1016/j.bbrc.2014.07.138. Childs, B. G., Durik, M., Baker, D. J., & van Deursen, J. M. (2015). Cellular senescence in aging and age-related disease: From mechanisms to therapy. Nature Medicine, 21(12), 1424–1435. https://doi.org/10.1038/nm.4000. Chilton, W., O’Brien, B., & Charchar, F. (2017). Telomeres, aging and exercise: Guilty by association? International Journal of Molecular Sciences, 18(12), 2573. https://doi.org/10. 3390/ijms18122573. Chłopicki, S., & Gryglewski, R. J. (2005). Angiotensin converting enzyme (ACE) and HydroxyMethylGlutaryl-CoA (HMG-CoA) reductase inhibitors in the forefront of pharmacology of endothelium. Pharmacological Reports, 57S, 86–96. Choudhary, R., & Bodakhe, S. H. (2016). Olmesartan, an angiotensin II receptor blocker inhibits the progression of cataract formation in cadmium chloride induced hypertensive albino rats. Life Sciences, 167, 105–112. https://doi.org/10.1016/j.lfs.2016.10.012. Choudhary, R., Kapoor, M. S., Singh, A., & Bodakhe, S. H. (2016). Therapeutic targets of reninangiotensin system in ocular disorders. Journal of Current Ophthalmology, 29(1), 7–16. https:// doi.org/10.1016/j.joco.2016.09.009. Chung, S., Yao, H., Caito, S., Hwang, J. W., Arunachalam, G., & Rahman, I. (2010). Regulation of SIRT1 in cellular functions: Role of polyphenols. Archives of Biochemistry and Biophysics, 501 (1), 79–90. https://doi.org/10.1016/j.abb.2010.05.003. Chung, H. R., Vakil, M., Munroe, M., Parikh, A., Meador, B. M., Wu, P. T., Jeong, J. H., Woods, J. A., Wilund, K. R., & Boppart, M. D. (2016). The impact of exercise on statin-associated skeletal muscle myopathy. PLoS One, 11(12), e0168065. https://doi.org/10.1371/journal.pone. 0168065. Coelho-Júnior, H. J., Uchida, M. C., Picca, A., Bernabei, R., Landi, F., Calvani, R., Cesari, M., & Marzetti, E. (2021). Evidence-based recommendations for resistance and power training to prevent frailty in community-dwellers. Aging Clinical and Experimental Research. https://doi. org/10.1007/s40520-021-01802-5. Colchero, F., Rau, R., Jones, O. R., Barthold, J. A., Conde, D. A., Lenart, A., et al. (2016). The emergence of longevous populations. Proceedings of the National Academy of Sciences of the United States of America, 113(48), E7681–E7690. https://doi.org/10.1073/pnas.1612191113. Collado, M., Blasco, M. A., & Serrano, M. (2007). Cellular senescence in cancer and aging. Cell, 130(2), 223–233. https://doi.org/10.1016/j.cell.2007.07.003. Comfort, A. (1979). The biology of senescence. London: Livingstone. Conti, V., Izzo, V., Corbi, G., Russomanno, G., Manzo, V., De Lise, F., Di Donato, A., & Filippelli, A. (2016). Antioxidant supplementation in the treatment of aging-associated diseases. Frontiers in Pharmacology, 7, 24. https://doi.org/10.3389/fphar.2016.00024. Conti, V., Iannaccone, T., & Filippelli, A. (2019). Senolytic drugs. In D. Gu & M. Dupre (Eds.), Encyclopedia of gerontology and population aging. Cham: Springer. https://doi.org/10.1007/ 978-3-319-69892-2_55-1. Coppé, J.-P., Patil, C. K., Rodier, F., Sun, Y., Muñoz, D. P., Goldstein, J., Nelson, P. S., Desprez, P. Y., & Campisi, J. (2008). Senescence-associated secretory phenotypes reveal cellnonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biology, 6 (12), 2853–2868. https://doi.org/10.1371/journal.pbio.0060301. Corbi, G., Conti, V., Scapagnini, G., Filippelli, A., & Ferrara, N. (2012). Role of sirtuins, calorie restriction and physical activity in aging. Frontiers in Bioscience (Elite Edition), 4, 768–778. https://doi.org/10.2741/417.

References

387

Corbi, G., Conti, V., Davinelli, S., Scapagnini, G., Filippelli, A., & Ferrara, N. (2016). Dietary phytochemicals in Neuroimmunoaging: A new therapeutic possibility for humans? Frontiers in Pharmacology, 7, 364. https://doi.org/10.3389/fphar.2016.00364. Corbi, G., Conti, V., Komici, K., Manzo, V., Filippelli, A., Palazzo, M., Vizzari, F., Davinelli, S., Di Costanzo, A., Scapagnini, G., Ferrara, N., & Casamassima, D. (2018). Phenolic plant extracts induce Sirt1 activity and increase antioxidant levels in the Rabbit’s heart and liver. Oxidative Medicine and Cellular Longevity, 2731289. https://doi.org/10.1155/2018/2731289. Cordonnier, D. J., Zaoui, P., & Halimi, S. (2001). Role of ACE inhibitors in patients with diabetes mellitus. Drugs, 61(13), 1883–1892. https://doi.org/10.2165/00003495-200161130-00001. Counter, C. M., Hahn, W. C., Wei, W., Caddle, S. D., Beijersbergen, R. L., Lansdorp, P. M., Sedivy, J. M., & Weinberg, R. A. (1998). Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proceedings of the National Academy of Sciences of the United States of America, 95(25), 14723–14728. https://doi.org/10.1073/pnas. 95.25.14723. Cristofalo, V. J., & Pignolo, R. J. (1993). Replicative senescence of human fibroblast-like cells in culture. Physiological Reviews, 73(3), 617–638. https://doi.org/10.1152/physrev.1993.73.3. 617. d’Adda di Fagagna, F., Reaper, P. M., Clay-Farrace, L., Fiegler, H., Carr, P., von Zglinicki, T., Saretzki, G., Carter, N. P., & Jackson, S. P. (2003). A DNA damage checkpoint response in telomere-initiated senescence. Nature, 426(6963), 194–198. https://doi.org/10.1038/ nature02118. Davinelli, S., Trichopoulou, A., Corbi, G., De Vivo, I., & Scapagnini, G. (2019). The potential nutrigeroprotective role of Mediterranean diet and its functional components on telomere length dynamics. Ageing Research Reviews, 49, 1–10. https://doi.org/10.1016/j.arr.2018.11.001. Davis, M. E., Korn, M. A., Gumucio, J. P., Harning, J. A., Saripalli, A. L., Bedi, A., & Mendias, C. L. (2015). Simvastatin reduces fibrosis and protects against muscle weakness after massive rotator cuff tear. Journal of Shoulder and Elbow Surgery, 24(2), 280–287. https://doi.org/10. 1016/j.jse.2014.06.048. De Grey, A. (2005). The SENS challenge: $20,000 says the foreseeable defeat of aging is not laughable. Rejuvenation Research, 8(4), 207–210. https://doi.org/10.1089/rej.2005.8.207. de Lange, T., & Jacks, T. (1999). For better or worse? Telomerase inhibition and cancer. Cell, 98(3), 273–275. https://doi.org/10.1016/s0092-8674(00)81955-8. Dell’Italia, L. J. (2011). Translational success stories: Angiotensin receptor 1 antagonists in heart failure. Circulation Research, 109(4), 437–452. https://doi.org/10.1161/CIRCRESAHA.110. 238550. Demers, C., Mody, A., Teo, K. K., & McKelvie, R. S. (2005). ACE inhibitors in heart failure: What more do we need to know? American Journal of Cardiovascular Drugs, 5(6), 351–359. https:// doi.org/10.2165/00129784-200505060-00002. Diallo, A. B., Coiffard, B., Leone, M., Mezouar, S., & Mege, J.-L. (2020). For whom the clock ticks: Clinical chronobiology for infectious diseases. Frontiers in Immunology, 11, 1457. https://doi.org/10.3389/fimmu.2020.01457. Distefano, G., & Goodpaster, B. H. (2018). Effects of exercise and aging on skeletal muscle. Cold Spring Harbor Perspectives in Medicine, 8(3), a029785. https://doi.org/10.1101/cshperspect. a029785. Dobrzynski, J. M., & Kostis, J. B. (2014). Statins and cataracts – A visual insight. Current Atherosclerosis Reports, 17(2), 477. Douglas, A. S., Dunnigan, M. G., Allan, T. M., & Rawles, J. M. (1995). Seasonal variation in coronary heart disease in Scotland. Journal of Epidemiology and Community Health, 49(6), 575–582. https://doi.org/10.1136/jech.49.6.575. Duffy, J. F., Zitting, K.-M., & Chinoy, E. D. (2015). Aging and circadian rhythms. Sleep Medicine Clinics, 10(4), 423–434. https://doi.org/10.1016/j.jsmc.2015.08.002. Ekkekakis, P., Hall, E. E., & Petruzzello, S. J. (2005). Variation and homogeneity in affective responses to physical activity of varying intensities: An alternative perspective on dose-response

388

8 Prevention and Treatment of the Troubles of the Elderly

based on evolutionary considerations. Journal of Sports Sciences, 23(5), 477–500. https://doi. org/10.1080/02640410400021492. Ellul, J., Archer, N., Foy, C. M., Poppe, M., Boothby, H., Nicholas, H., Brown, R. G., & Lovestone, S. (2007). The effects of commonly prescribed drugs in patients with Alzheimer’s disease on the rate of deterioration. Journal of Neurology, Neurosurgery, and Psychiatry, 78(3), 233–239. https://doi.org/10.1136/jnnp.2006.104034. Etminan, M., Brophy, J. M., & Maberley, D. (2008). Use of statins and angiotensin converting enzyme inhibitors (ACE-Is) and the risk of age-related macular degeneration: Nested casecontrol study. Current Drug Safety, 3(1), 24–26. https://doi.org/10.2174/ 157488608783333952. Fauchier, L., Pierre, B., de Labriolle, A., Grimard, C., Zannad, N., & Babuty, D. (2008). Antiarrhythmic effect of statin therapy and atrial fibrillation a meta-analysis of randomized controlled trials. Journal of the American College of Cardiology, 51(8), 828–835. https://doi.org/10.1016/ j.jacc.2007.09.063. Feingold, K. R., & Grunfeld, C.(2016). Cholesterol lowering drugs. In: L. J. De Groot, G. Chrousos, K. Dungan, K. R. Feingold, A. Grossman, J. M. Hershman, et al. (Eds.). SourceEndotext, 2016. www.endotext.org, www.ncbi.nlm.nih.gov/books/NBK395573/ Fernandez, G., Spatz, E. S., Jablecki, C., & Phillips, P. S. (2011). Statin myopathy: A common dilemma not reflected in clinical trials. Cleveland Clinic Journal of Medicine, 78(6), 393–403. https://doi.org/10.3949/ccjm.78a.10073. Finch, C. E. (1990). Longevity, senescence, and the genome. Chicago: University of Chicago Press. Fisk, A. S., Tam, S. K. E., Brown, L. A., Vyazovskiy, V. V., Bannerman, D. M., & Peirson, S. N. (2018). Light and cognition: Roles for circadian rhythms, sleep, and arousal. Frontiers in Neurology, 9, 56. https://doi.org/10.3389/fneur.2018.00056. Flather, M. D., Yusuf, S., Køber, L., Pfeffer, M., Hall, A., Murray, G., Torp-Pedersen, C., Ball, S., Pogue, J., Moyé, L., & Braunwald, E. (2000). Long-term ACE-inhibitor therapy in patients with heart failure or left-ventricular dysfunction: A systematic overview of data from individual patients. ACE-Inhibitor Myocardial Infarction Collaborative Group. Lancet, 355(9215), 1575–1581. https://doi.org/10.1016/s0140-6736(00)02212-1. Forte, M., Conti, V., Damato, A., Ambrosio, M., Puca, A. A., Sciarretta, S., Frati, G., Vecchione, C., & Carrizzo, A. (2016). Targeting nitric oxide with natural derived compounds as a therapeutic strategy in vascular diseases. Oxidative Medicine and Cellular Longevity, 2016, 7364138. https://doi.org/10.1155/2016/7364138. Fossel, M. B. (2004). Cells, aging and human disease. New York: Oxford University Press. Fossel, M. B. (2015). The telomerase revolution. Dallas: BenBella Books. Friedman, B., Lahad, A., Dresner, Y., & Vinker, S. (2013). Long-term statin use and the risk of Parkinson’s disease. The American Journal of Managed Care, 19(8), 626–632. Froy, O. (2011). Circadian rhythms, aging, and life span in mammals. Physiology (Bethesda), 26(4), 225–235. https://doi.org/10.1152/physiol.00012.2011. Fuhrmann-Stroissnigg, H., Ling, Y. Y., Zhao, J., McGowan, S. J., Zhu, Y., Brooks, R. W., Grassi, D., Gregg, S. Q., Stripay, J. L., Dorronsoro, A., Corbo, L., & Tang, P. (2017). Identification of HSP90 inhibitors as a novel class of senolytics. Nature Communications, 8(1), 422. https://doi. org/10.1038/s41467-017-00314-z. Fuhrmann-Stroissnigg, H., Niedernhofer, L. J., & Robbins, P. D. (2018). Hsp90 inhibitors as senolytic drugs to extend healthy aging. Cell Cycle, 17(9), 1048–1055. https://doi.org/10. 1080/15384101.2018.1475828. Funk, W. D., Wang, C. K., Shelton, D. N., Harley, C. B., Pagon, G. D., & Hoeffler, W. K. (2000). Telomerase expression restores dermal integrity to in vitro-aged fibroblasts in a reconstituted skin model. Experimental Cell Research, 258(2), 270–278. https://doi.org/10.1006/excr.2000. 4945. Galiniak, S., Aebisher, D., & Bartusik-Aebisher, D. (2019). Health benefits of resveratrol administration. Acta Biochimica Polonica, 66(1), 13–21. https://doi.org/10.18388/abp.2018_2749.

References

389

Gao, X., Simon, K. C., Schwarzschild, M. A., & Ascherio, A. (2012). A prospective study of statin use and risk of Parkinson disease. Archives of Neurology, 69(3), 380–384. https://doi.org/10. 1001/archneurol.2011.1060. Garatachea, N., Pareja-Galeano, H., Sanchis-Gomar, F., Santos-Lozano, A., Fiuza-Luces, C., Morán, M., Emanuele, E., Joyner, M. J., & Lucia, A. (2015). Exercise attenuates the major hallmarks of aging. Rejuvenation Research, 18(1), 57–89. https://doi.org/10.1089/rej.2014. 1623. Gehlbach, P., Li, T., & Hatef, E. (2016). Statins for age-related macular degeneration. Cochrane Database of Systematic Reviews, 8, CD006927. https://doi.org/10.1002/14651858.CD006927. pub5. Geifman, N., Brinton, R. D., Kennedy, R. E., Schneider, L. S., & Butte, A. J. (2017). Evidence for benefit of statins to modify cognitive decline and risk in Alzheimer’s disease. Alzheimer’s Research & Therapy, 9(1), 10. https://doi.org/10.1186/s13195-017-0237-y. Gibson, E. M., Williams, W. P., 3rd, & Kriegsfeld, L. J. (2009). Aging in the circadian system: Considerations for health, disease prevention and longevity. Experimental Gerontology, 44 (1–2), 51–56. https://doi.org/10.1016/j.exger.2008.05.007. Gioscia-Ryan, R. A., Battson, M. L., Cuevas, L. M., Zigler, M. C., Sindler, A. L., & Seals, D. R. (2016). Voluntary aerobic exercise increases arterial resilience and mitochondrial health with aging in mice. Aging (Albany NY), 8(11), 2897–2914. https://doi.org/10.18632/aging.101099. Grandin, T. (2014). Genetics and the behavior of domestic animals. Elsevier https://doi.org/10. 1016/C2011-0-07148-X. Gronek, P., Haas, A. N., Czarny, W., Podstawski, R., Delabary, M., Do, S., Clark, C. C., et al. (2021). The mechanism of physical activity-induced amelioration of Parkinson’s Disease: A narrative review. Aging Dis, 12(1), 192–202. https://doi.org/10.14336/AD.2020.0407. Hameed, M. K., Sheikh, Z. A., Ahmed, A., & Najam, A. (2014). Atorvastatin in the management of tinnitus with hyperlipidemias. Journal of the College of Physicians and Surgeons–Pakistan, 24 (12), 927–930. https://doi.org/10.2014/JCPSP.927930. Hao, S. Y., Ren, M., Yang, C., Lin, D. Z., Chen, L. H., Zhu, P., Cheng, H., & Yan, L. (2011). Activation of skin renin-angiotensin system in diabetic rats. Endocrine, 39(3), 242–250. https:// doi.org/10.1007/s12020-010-9428-z. Harley, C. B., Liu, W., Blasco, M., Vera, E., Andrews, W. H., Briggs, L. A., & Raffaele, J. M. (2011). A natural product telomerase activator as part of a health maintenance program. Rejuvenation Research, 14(1), 45–56. https://doi.org/10.1089/rej.2010.1085. Harley, C. B., Liu, W., Flom, P. L., & Raffaele, J. M. (2013). A natural product telomerase activator as part of a health maintenance program: Metabolic and cardiovascular response. Rejuvenation Research, 16(5), 386–395. https://doi.org/10.1089/rej.2013.1430. Harman, D. (1956). Aging: A theory based on free radical and radiation chemistry. Journal of Gerontology, 11(3), 298–300. https://doi.org/10.1093/geronj/11.3.298. Harper, C. R., & Jacobson, T. A. (2007). The broad spectrum of statin myopathy: From myalgia to rhabdomyolysis. Current Opinion in Lipidology, 18(4), 401–408. https://doi.org/10.1097/MOL. 0b013e32825a6773. Hastie, N. D., & Allshire, R. C. (1989). Human telomeres: Fusion and interstitial sites. Trends in Genetics, 5(10), 326–331. https://doi.org/10.1016/0168-9525(89)90137-6. Hawkes, K., O’Connell, J., & Blurton Jones, N. B. (2018). Hunter-gatherer studies and human evolution: A very selective review. American Journal of Physical Anthropology, 165(4), 777–800. https://doi.org/10.1002/ajpa.23403. Hayflick, L. (2007). Entropy explains aging, genetic determinism explains longevity, and undefined terminology explains misunderstanding both. PLoS Genetics, 3(12), e220. https://doi.org/10. 1371/journal.pgen.0030220. Herrick, C., Bahrainy, S., & Gill, E. A. (2016). Statins and the liver. Endocrinology and Metabolism Clinics of North America, 45(1), 117–128. https://doi.org/10.1016/j.ecl.2015.09.008. Hill, K., & Hurtado, A. M. (1996). Ache life history. New York: Aldine De Gruyter.

390

8 Prevention and Treatment of the Troubles of the Elderly

Holick, M. F. (2017). The vitamin D deficiency pandemic: Approaches for diagnosis, treatment and prevention. Reviews in Endocrine & Metabolic Disorders, 18(2), 153–165. https://doi.org/10. 1007/s11154-017-9424-1. Holick, M. F., & Chen, T. C. (2008). Vitamin D deficiency: A worldwide problem with health consequences. The American Journal of Clinical Nutrition, 87(4), S1080–S1086. https://doi. org/10.1093/ajcn/87.4.1080S. Holick, M. F., Binkley, N. C., Bischoff-Ferrari, H. A., Gordon, C. M., Hanley, D. A., Heaney, R. P., Murad, M. H., & Weaver, C. M. (2012). Guidelines for preventing and treating vitamin D deficiency and insufficiency revisited. The Journal of Clinical Endocrinology and Metabolism, 97(4), 1153–1158. https://doi.org/10.1210/jc.2011-2601. Hood, S., & Amir, S. (2017). The aging clock: Circadian rhythms and later life. The Journal of Clinical Investigation, 127(2), 437–446. https://doi.org/10.1172/JCI90328. Hopkins, D. R., Murrah, B., Hoeger, W. W., & Rhodes, R. C. (1990). Effect of low-impact aerobic dance on the functional fitness of elderly women. Gerontologist, 30(2), 189–192. https://doi. org/10.1093/geront/30.2.189. Howitz, K. T., Bitterman, K. J., Cohen, H. Y., Lamming, D. W., Lavu, S., Wood, J. G., Zipkin, R. E., Chung, P., Kisielewski, A., Zhang, L. L., Scherer, B., & Sinclair, D. A. (2003). Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature, 425(6954), 191–196. https://doi.org/10.1038/nature01960. Ighodaro, O. M., & Akinloye, O. A. (2017). First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Journal of Medicine, 54(4), 287–293. https://doi.org/10. 1016/j.ajme.2017.09.001. Imai, S. I., & Guarente, L. (2016). It takes two to tango: NAD(+) and sirtuins in aging/longevity control. NPJ Aging and Mechanisms of Disease, 2, 16017. https://doi.org/10.1038/npjamd. 2016.17. Ingram, D. K., & Roth, G. S. (2015). Calorie restriction mimetics: Can you have your cake and eat it, too? Ageing Research Reviews, 20, 46–62. https://doi.org/10.1016/j.arr.2014.11.005. Islam, M. S., Jin, Y. Y., Chung, H. J., Kim, H. J., Baek, S. H., & Hong, S. T. (2019). Effect of the resveratrol rice DJ526 on longevity. Nutrients, 11(8), pii: E1804. https://doi.org/10.3390/ nu11081804. Jablecka, A., Czaplicka, E., Olszewski, J., Bogdanski, P., Krauss, H., & Smolarek, I. (2009). Influence of selected angiotensin-converting enzyme inhibitors on alloxan-induced diabetic cataract in rabbits. Medical Science Monitor, 15(11), BR334–BR338. Jacobs, D. R., Jr., Gross, M. D., & Tapsell, L. C. (2009). Food synergy: An operational concept for understanding nutrition. The American Journal of Clinical Nutrition, 89(5), 1543–158S. https:// doi.org/10.3945/ajcn.2009.26736B. Jahani, L., Mehrparvar, A. H., Esmailidehaj, M., Rezvani, M. E., Moghbelolhossein, B., & Razmjooei, Z. (2016). The effect of atorvastatin on preventing noise-induced hearing loss: An experimental study. International Journal of Occupational Environmental Medicine, 7(1), 15–21. https://doi.org/10.15171/ijoem.2016.627. Janssen, H. C., Samson, M. M., & Verhaar, H. J. (2002). Vitamin D deficiency, muscle function, and falls in elderly people. The American Journal of Clinical Nutrition, 75(4), 611–615. https:// doi.org/10.1093/ajcn/75.4.611. Jaskelioff, M., Muller, F. L., Paik, J. H., Thomas, E., Jiang, S., Adams, A. C., Sahin, E., KostAlimova, M., Protopopov, A., Cadiñanos, J., Horner, J. W., Maratos-Flier, E., & Depinho, R. A. (2011). Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice. Nature, 469(7328), 102–106. https://doi.org/10.1038/nature09603. Jeon, O. H., Kim, C., Laberge, R. M., Demaria, M., Rathod, S., Vasserot, A. P., Chung, J. W., Kim, D. H., Poon, Y., David, N., Baker, D. J., van Deursen, J. M., et al. (2017). Local clearance of senescent cells attenuates the development of post-traumatic osteoarthritis and creates a pro-regenerative environment. Nature Medicine, 23(6), 775–781. https://doi.org/10.1038/nm. 4324.

References

391

Jibrini, M. B., Molnar, J., & Arora, R. R. (2008). Prevention of atrial fibrillation by way of abrogation of the renin-angiotensin system: A systematic review and meta-analysis. American Journal of Therapeutics, 15(1), 36–43. https://doi.org/10.1097/MJT.0b013e31804beb59. Johnson, S. C., Rabinovitch, P. S., & Kaeberlein, M. (2013). mTOR is a key modulator of ageing and age-related disease. Nature, 493(7432), 338–345. https://doi.org/10.1038/nature11861. Josse, L., Xie, J., Proud, C. G., & Smales, C. M. (2016). mTORC1 signalling and eIF4E/4E-BP1 translation initiation factor stoichiometry influence recombinant protein productivity from GS-CHOK1 cells. The Biochemical Journal, 473(24), 4651–4664. https://doi.org/10.1042/ BCJ20160845. Junnila, R. K., List, E. O., Berryman, D. E., Murrey, J. W., & Kopchick, J. J. (2013). The GH/IGF-1 axis in ageing and longevity. Nature Reviews. Endocrinology, 9(6), 366–376. https://doi.org/10. 1038/nrendo.2013.67. Kandeel, S., & Balaha, M. (2015). The possible protective effect of simvastatin and pioglitazone separately and in combination on bleomycin-induced changes in mice thin skin. Tissue & Cell, 47(2), 159–170. https://doi.org/10.1016/j.tice.2015.01.003. Karuppagounder, S. S., Pinto, J. T., Xu, H., Chen, H. L., Beal, M. F., & Gibson, G. E. (2009). Dietary supplementation with resveratrol reduces plaque pathology in a transgenic model of Alzheimer’s disease. Neurochemistry International, 54(2), 111–118. https://doi.org/10.1016/j. neuint.2008.10.008. Katzmarzyk, P. T. (2010). Physical activity, sedentary behavior, and health: Paradigm paralysis or paradigm shift? Diabetes, 59(11), 2717–2725. https://doi.org/10.2337/db10-0822. Khan, M. M., Ahmad, A., Ishrat, T., Khan, M. B., Hoda, M. N., Khuwaja, G., Raza, S. S., Khan, A., Javed, H., Vaibhav, K., & Islam, F. (2010). Resveratrol attenuates 6-hydroxydopamine-induced oxidative damage and dopamine depletion in rat model of Parkinson’s disease. Brain Research, 1328, 139–151. https://doi.org/10.1016/j.brainres.2010.02.031. Khan, S., Nabi, G., Yao, L., Siddique, R., Sajjad, W., Kumar, S., Duan, P., & Hou, H. (2018). Health risks associated with genetic alterations in internal clock system by external factors. International Journal of Biological Sciences, 14(7), 791–798. https://doi.org/10.7150/ijbs. 23744. Kim, Y. H., & Park, T. J. (2019). Cellular senescence in cancer. BMB Reports, 52(1), 42–46. https:// doi.org/10.5483/BMBRep.2019.52.1.295. Kim, H. Y., Kim, J. H., Dhong, H. J., Kim, K. R., Chung, S. K., Chung, S. C., Kang, J. M., Jung, Y. G., Jang, S. Y., & Hong, S. D. (2012). Effects of statins on the recovery of olfactory function in a 3-methylindole-induced anosmia mouse model. American Journal of Rhinology & Allergy, 26(2), e81–e84. https://doi.org/10.2500/ajra.2012.26.3719. Kim, Y., Triolo, M., & Hood, D. A. (2017). Impact of aging and exercise on mitochondrial quality control in skeletal muscle. Oxidative Medicine and Cellular Longevity, 2017, 3165396. https:// doi.org/10.1155/2017/3165396. Kirkland, J. L., & Tchkonia, T. (2015). Clinical strategies and animal models for developing senolytic agents. Experimental Gerontology, 68, 19–25. https://doi.org/10.1016/j.exger.2014. 10.012. Kirkland, J. L., & Tchkonia, T. (2017). Cellular senescence: A translational perspective. eBioMedicine, 21, 21–28. https://doi.org/10.1016/j.ebiom.2017.04.013. Kirkwood, T. B., & Austad, S. N. (2000). Why do we age? Nature, 408(6809), 233–238. https://doi. org/10.1038/35041682. Klein, B. E., Klein, R., Lee, K. E., & Grady, L. M. (2006). Statin use and incident nuclear cataract. JAMA, 295(23), 2752–2758. https://doi.org/10.1001/jama.295.23.2752. Kondratova, A. A., & Kondratov, R. V. (2013). Circadian clock and pathology of ageing brain. Nature Reviews. Neuroscience, 13(5), 325–335. https://doi.org/10.1038/nrn3208. Konturek, P. C., Haziri, D., Brzozowski, T., Hess, T., Heyman, S., Kwiecien, S., Konturek, S. J., & Koziel, J. (2015). Emerging role of fecal microbiota therapy in the treatment of gastrointestinal and extra-gastrointestinal diseases. Journal of Physiology and Pharmacology, 66(4), 483–491.

392

8 Prevention and Treatment of the Troubles of the Elderly

Krishnamurthy, J., Torrice, C., Ramsey, M. R., Kovalev, G. I., Al-Regaiey, K., Su, L., & Sharpless, N. E. (2014). Ink4a/Arf expression is a biomarker of aging. Journal of Clinical Investigation, 114(9), 1299–1307. https://doi.org/10.1172/JCI22475. Kume, K., Hanyu, H., Sakurai, H., Takada, Y., Onuma, T., & Iwamoto, T. (2012). Effects of telmisartan on cognition and regional cerebral blood flow in hypertensive patients with Alzheimer’s disease. Geriatrics & Gerontology International, 12(2), 207–214. https://doi.org/ 10.1111/j.1447-0594.2011.00746.x. Lahdenperä, M., Lummaa, V., Helle, S., Tremblay, M., & Russell, A. F. (2004). Fitness benefits of prolonged post-reproductive lifespan in women. Nature, 428(6979), 178–181. https://doi.org/ 10.1038/nature02367. Lange, K. W., & Li, S. (2018). Resveratrol, pterostilbene, and dementia. BioFactors, 44(1), 83–90. https://doi.org/10.1002/biof.1396. Larsson, L., Degens, H., Li, M., Salviati, L., Lee, Y. I., Thompson, W., Kirkland, J. L., & Sandri, M. (2019). Sarcopenia: Aging-related loss of muscle mass and function. Physiological Reviews, 99(1), 427–511. https://doi.org/10.1152/physrev.00061.2017. Li, Y. R., Li, S., & Lin, C. C. (2018). Effect of resveratrol and pterostilbene on aging and longevity. BioFactors, 44(1), 69–82. https://doi.org/10.1002/biof.1400. Libertini, G. (1988). An adaptive theory of the increasing mortality with increasing chronological age in populations in the wild. Journal of Theoretical Biology, 132(2), 145–162. https://doi.org/ 10.1016/s0022-5193(88)80153-x. Libertini, G. (2009). Prospects of a longer life span beyond the beneficial effects of a healthy lifestyle. In J. V. Bentely & M. A. Keller (Eds.), Handbook on longevity: Genetics, diet and disease (pp. 35–95). New York: Nova Science Publ. Libertini, G. (2013). Evidence for aging theories from the study of a hunter-gatherer people (Ache of Paraguay). Biochemistry (Mosc), 78(9), 1023–1032. https://doi.org/10.1134/ S0006297913090083. Libertini, G., & Ferrara, N. (2016). Possible interventions to modify aging. Biochemistry (Mosc), 81 (12), 1413–1428. https://doi.org/10.1134/S0006297916120038. Libertini, G., Ferrara, N., Rengo, G., & Corbi, G. (2018). Elimination of senescent cells: Prospects according to the subtelomere-telomere theory. Biochemistry (Mosc), 83(12), 1477–1488. https:// doi.org/10.1134/S0006297918120064. Libertini, G., Corbi, G., Cellurale, M., & Ferrara, N. (2019). Age-related dysfunctions: Evidence and relationship with some risk factors and protective drugs. Biochemistry (Mosc), 84(12), 1442–1450. https://doi.org/10.1134/S0006297919120034. Loo, T. M., Miyata, K., Tanaka, Y., & Takahashi, A. (2019). Cellular senescence and senescenceassociated secretory phenotype via the cGAS-STING signaling pathway in cancer. Cancer Science, 111(2), 304–311. https://doi.org/10.1111/cas.14266. Lopez-Real, A., Rey, P., Soto-Otero, R., Mendez-Alvarez, E., & Labandeira-Garcia, J. L. (2005). Angiotensin-converting enzyme inhibition reduces oxidative stress and protects dopaminergic neurons in a 6-hydroxydopamine rat model of Parkinsonism. Journal of Neuroscience Research, 81(6), 865–873. https://doi.org/10.1002/jnr.20598. Ludlow, A. T., Zimmerman, J. B., Witkowski, S., Hearn, J. W., Hatfield, B. D., & Roth, S. M. (2008). Relationship between physical activity level, telomere length, and telomerase activity. Medicine and Science in Sports and Exercise, 40(10), 1764–1771. https://doi.org/10.1249/MSS. 0b013e31817c92aa. Malina, R. M., & Little, B. B. (2008). Physical activity: The present in the context of the past. American Journal of Human Biology, 20(4), 373–391. https://doi.org/10.1002/ajhb.20772. Manzo, V., Conti, V., & Filippelli, A. (2019). Antiaging strategies. In D. Gu & M. Dupre (Eds.), Encyclopedia of gerontology and population aging. Cham: Springer. https://doi.org/10.1007/ 978-3-319-69892-2_36-1. Marino, R., & Misra, M. (2019). Extra-skeletal effects of Vitamin D. Nutrients, 11(7), pii: E1460. https://doi.org/10.3390/nu11071460.

References

393

Mattis, J., & Sehgal, A. (2016). Circadian rhythms, sleep, and disorders of aging. Trends in Endocrinology and Metabolism, 27(4), 192–203. https://doi.org/10.1016/j.tem.2016.02.003. Mauvais-Jarvis, F., Bairey Merz, N., Barnes, P. J., Brinton, R. D., Carrero, J.-J., DeMeo, D. L., et al. (2020). Sex and gender: Modifiers of health, disease, and medicine. Lancet, 396(10250), 565–582. https://doi.org/10.1016/S0140-6736(20)31561-0. Mehrsafar, A. H., Serrano Rosa, M. A., Moghadam Zadeh, A., & Gazerani, P. (2020). Stress, professional lifestyle, and telomere biology in elite athletes: A growing trend in psychophysiology of sport. Frontiers in Psychology, 11, 567214. https://doi.org/10.3389/fpsyg.2020. 567214. Mendez, M. A., & Newman, A. B. (2018). Can a Mediterranean diet pattern slow aging? The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 73(3), 315–317. https://doi.org/10.1093/gerona/gly003. Mercken, E. M., Carboneau, B. A., Krzysik-Walker, S. M., & de Cabo, R. (2012). Of mice and men: The benefits of caloric restriction, exercise, and mimetics. Ageing Research Reviews, 11(3), 390–398. https://doi.org/10.1016/j.arr.2011.11.005. Meyer zum Gottesberge, A. M., Massing, T., Sasse, A., Palma, S., & Hansen, S. (2015). Zucker diabetic fatty rats, a model for type 2 diabetes, develop an inner ear dysfunction that can be attenuated by losartan treatment. Cell and Tissue Research, 362(2), 307–315. https://doi.org/10. 1007/s00441-015-2215-7. Mihaylova, B., Emberson, J., Blackwell, L., Keech, A., Simes, J., Barnes, E. H., Voysey, M., Gray, A., Collins, R., Baigent, C., Cholesterol Treatment Trialists’, et al. (2012). The effects of lowering LDL cholesterol with statin therapy in people at low risk of vascular disease: Metaanalysis of individual data from 27 randomised trials. Lancet, 380(9841), 581–590. https://doi. org/10.1016/S0140-6736(12)60367-5. Mitchell, S. E., Delville, C., Konstantopedos, P., Hurst, J., Derous, D., Green, C., Chen, L., Han, J. J., Wang, Y., Promislow, D. E., Lusseau, D., Douglas, A., & Speakman, J. R. (2015). The effects of graded levels of calorie restriction: II. Impact of short term calorie and protein restriction on circulating hormone levels, glucose homeostasis and oxidative stress in male C57BL/6 mice. Oncotarget, 6(27), 23213–23237. https://doi.org/10.18632/oncotarget.4003. Morales, M. G., Abrigo, J., Acuña, M. J., Santos, R. A., Bader, M., Brandan, E., Simon, F., Olguin, H., Cabrera, D., & Cabello-Verrugio, C. (2016). Angiotensin-(1-7) attenuates disuse skeletal muscle atrophy in mice via its receptor. Disease Models & Mechanisms, 9(4), 441–449. https:// doi.org/10.1242/dmm.023390. Morselli, E., Maiuri, M. C., Markaki, M., Megalou, E., Pasparaki, A., Palikaras, K., Criollo, A., Galluzzi, L., Malik, S. A., Vitale, I., Michaud, M., Madeo, F., et al. (2010). Caloric restriction and resveratrol promote longevity through the Sirtuin-1-dependent induction of autophagy. Cell Death & Disease, 1, e10. https://doi.org/10.1038/cddis.2009.8. Muñoz, A., Garrido-Gil, P., Dominguez-Meijide, A., & Labandeira-Garcia, J. L. (2014). Angiotensin type 1 receptor blockage reduces l-dopa-induced dyskinesia in the 6-OHDA model of Parkinson’s disease. Involvement of vascular endothelial growth factor and interleukin-1β. Experimental Neurology, 261, 720–732. https://doi.org/10.1016/j.expneurol.2014.08.019. Navarro-Ibarra, M. J., Hernández, J., & Caire-Juvera, G. (2019). Diet, physical activity and telomere length in adults. Nutricion hospitalaria, 36(6), 1403–1417. https://doi.org/10.20960/ nh.02673. Onder, G., Vedova, C. D., & Pahor, M. (2006). Effects of ACE inhibitors on skeletal muscle. Current Pharmaceutical Design, 12(16), 2057–2064. https://doi.org/10.2174/ 138161206777442137. Ongali, B., Nicolakakis, N., Tong, X. K., Aboulkassim, T., Imboden, H., & Hamel, E. (2016). Enalapril alone or co-administered with losartan rescues cerebrovascular dysfunction, but not mnemonic deficits or amyloidosis in a mouse model of Alzheimer’s disease. Journal of Alzheimer’s Disease, 51(4), 1183–1195. https://doi.org/10.3233/JAD-150868. Orth, S. R., Stöckmann, A., Conradt, C., Ritz, E., Ferro, M., Kreusser, W., Piccoli, G., Rambausek, M., Roccatello, D., Schäfer, K., Sieberth, H. G., Wanner, C., et al. (1998). Smoking as a risk

394

8 Prevention and Treatment of the Troubles of the Elderly

factor for end-stage renal failure in men with primary renal disease. Kidney International, 54(3), 926–931. https://doi.org/10.1046/j.1523-1755.1998.00067.x. Oryan, A., Kamali, A., & Moshiri, A. (2015). Potential mechanisms and applications of statins on osteogenesis: Current modalities, conflicts and future directions. Journal of Controlled Release, 215, 12–24. https://doi.org/10.1016/j.jconrel.2015.07.022. Park, J. S., Kim, S. W., Park, K., Choung, Y. H., Jou, I., & Park, S. M. (2012). Pravastatin attenuates noise-induced cochlear injury in mice. Neuroscience, 208, 123–132. https://doi.org/10.1016/j. neuroscience.2012.02.010. Park, J. H., Moon, J. H., Kim, H. J., Kong, M. H., & Oh, Y. H. (2020). Sedentary lifestyle: Overview of updated evidence of potential health risks. Korean Journal of Family Medicine, 41 (6), 365–373. https://doi.org/10.4082/kjfm.20.0165. Pasqualotto, F. F., Lucon, A. M., Sobreiro, B. P., Pasqualotto, E. B., & Arap, S. (2004). Effects of medical therapy, alcohol, smoking, and endocrine disruptors on male infertility. Revista do Hospital das Clinicas; Faculdade de Medicina da Universidade de Sao Paulo, 59(6), 375–382. https://doi.org/10.1590/s0041-87812004000600011. Patke, A., Young, M. W., & Axelrod, S. (2020). Molecular mechanisms and physiological importance of circadian rhythms. Nature Reviews. Molecular Cell Biology, 21(2), 67–84. https://doi.org/10.1038/s41580-019-0179-2. Pearson, K. J., Baur, J. A., Lewis, K. N., Peshkin, L., Price, N. L., Labinskyy, N., Swindell, W. R., Kamara, D., Minor, R. K., Perez, E., Jamieson, H. A., Zhang, Y., et al. (2008). Resveratrol delays age-related deterioration and mimics transcriptional aspects of dietary restriction without extending life span. Cell Metabolism, 8(2), 157–168. https://doi.org/10.1016/j.cmet.2008.06. 011. Pfluger, P. T., Herranz, D., Velasco-Miguel, S., Serrano, M., & Tschöp, M. H. (2008). Sirt1 protects against high-fat diet-induced metabolic damage. Proceedings of the National Academy of Sciences of the United States of America, 105(28), 9793–9798. https://doi.org/10.1073/pnas. 0802917105. Phu, H. T., Thuan, D. T. B., Nguyen, T. H. D., Posadino, A. M., Eid, A. H., & Pintus, G. (2019). Herbal medicine for slowing aging and aging-associated conditions: Efficacy, mechanisms, and safety. Current Vascular Pharmacology. https://doi.org/10.2174/ 1570161117666190715121939. Pickup, E., German, A. J., Blackwell, E., Evans, M., & Westgarth, C. (2017). Variation in activity levels amongst dogs of different breeds: Results of a large online survey of dog owners from the UK. Journal of Nutritional Science, 6, e10. https://doi.org/10.1017/jns.2017.7. Pinho-Ribeiro, V., Melo, A. C., Kennedy-Feitosa, E., Graca-Reis, A., Barroso, M. V., CattaniCavalieri, I., Carvalho, G. M. C., Zin, W. A., Porto, L. C., Gitirana, L. B., Lanzetti, M., & Valença, S. S. (2017). Atorvastatin and simvastatin promoted mouse lung repair after cigarette smoke-induced emphysema. Inflammation, 40(3), 965–979. https://doi.org/10.1007/s10753017-0541-5. Podowski, M., Calvi, C., Metzger, S., Misono, K., Poonyagariyagorn, H., Lopez-Mercado, A., Ku, T., Lauer, T., McGrath-Morrow, S., Berger, A., Cheadle, C., Tuder, R., et al. (2012). Angiotensin receptor blockade attenuates cigarette smoke-induced lung injury and rescues lung architecture in mice. The Journal of Clinical Investigation, 122(1), 229–240. https://doi.org/ 10.1172/JCI46215. Preiss, D., Campbell, R. T., Murray, H. M., Ford, I., Packard, C. J., Sattar, N., Rahimi, K., Colhoun, H. M., Waters, D. D., LaRosa, J. C., Amarenco, P., Pedersen, T. R., et al. (2015). The effect of statin therapy on heart failure events: A collaborative meta-analysis of unpublished data from major randomized trials. European Heart Journal, 36(24), 1536–1546. https://doi.org/10.1093/ eurheartj/ehv072. Raichlen, D. A., Pontzer, H., Harris, J. A., Mabulla, A. Z. P., Marlowe, F. W., Josh Snodgrass, J., et al. (2017). Physical activity patterns and biomarkers of cardiovascular disease risk in huntergatherers. American Journal of Human Biology, 29(2). https://doi.org/10.1002/ajhb.22919.

References

395

Rain, C., & Rada, G. (2017). Are statins beneficial for chronic heart failure? First update. Version 2. Medwave, 17(Suppl 2), e6853. https://doi.org/10.5867/medwave.2017.6853. Rampelli, S., Candela, M., Turroni, S., Biagi, E., Collino, S., Franceschi, C., O’Toole, P. W., & Brigidi, P. (2013). Functional metagenomic profiling of intestinal microbiome in extreme ageing. Aging (Albany NY), 5(12), 902–912. https://doi.org/10.18632/aging.100623. Rangnekar, A. S., & Fontana, R. J. (2011). An update on drug induced liver injury. Minerva Gastroenterol Dietol, 57(2):213–229. www.minervamedica.it/it/riviste/gastroenterologicadietologica/articolo.php?cod¼R08Y2011N02A0213. Raupach, T., Lüthje, L., Kögler, H., Duve, C., Schweda, F., Hasenfuss, G., & Andreas, S. (2011). Local and systemic effects of angiotensin receptor blockade in an emphysema mouse model. Pulmonary Pharmacology & Therapeutics, 24(2), 215–220. https://doi.org/10.1016/j.pupt. 2010.12.006. Ravussin, E., Redman, L. M., Rochon, J., Das, S. K., Fontana, L., Kraus, W. E., Romashkan, S., Williamson, D. A., Meydani, S. N., Villareal, D. T., Smith, S. R., Stein, R. I., CALERIE Study Group, et al. (2015). A 2-year randomized controlled trial of human caloric restriction: Feasibility and effects on predictors of health span and longevity. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 70(9), 1097–1104. https://doi.org/10.1093/ gerona/glv057. Rena, G., Pearson, E. R., & Sakamoto, K. (2013). Molecular mechanism of action of metformin: Old or new insights? Diabetologia, 56(8), 1898–1906. https://doi.org/10.1007/s00125-0132991-0. Rodier, F., Coppé, J. P., Patil, C. K., Hoeijmakers, W. A., Muñoz, D. P., Raza, S. R., Freund, A., Campeau, E., Davalos, A. R., & Campisi, J. (2009). Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion. Nature Cell Biology, 11(8), 973–979. https://doi.org/10.1038/ncb1909. erratum 2009, 11, 1272. Rose, M. R. (1991). Evolutionary biology of aging. Oxford: Oxford University Press. Rostand, S. G. (1997). Ultraviolet light may contribute to geographic and racial blood pressure differences. Hypertension, 30(2 Pt 1), 150–156. https://doi.org/10.1161/01.hyp.30.2.150. Ruan, W., Yuan, X., & Eltzschig, H. K. (2021). Circadian rhythm as a therapeutic target. Nature Reviews Drug Discovery. https://doi.org/10.1038/s41573-020-00109-w. Ruderman, N., & Prentki, M. (2004). AMP kinase and malonyl-CoA: Targets for therapy of the metabolic syndrome. Nature Reviews. Drug Discovery, 3(4), 340–351. https://doi.org/10.1038/ nrd1344. Russomanno, G., Corbi, G., Manzo, V., Ferrara, N., Rengo, G., Puca, A. A., Latte, S., Carrizzo, A., Calabrese, M. C., Andriantsitohaina, R., Filippelli, W., Vecchione, C., Filippelli, A., & Conti, V. (2017). The anti-ageing molecule sirt1 mediates beneficial effects of cardiac rehabilitation. Immunity & Ageing, 14, 7. https://doi.org/10.1186/s12979-017-0088-1. Safdar, A., Bourgeois, J. M., Ogborn, D. I., Little, J. P., Hettinga, B. P., Akhtar, M., et al. (2011). Endurance exercise rescues progeroid aging and induces systemic mitochondrial rejuvenation in mtDNA mutator mice. Proceedings of the National Academy of Sciences of the United States of America, 108(10), 4135–4140. https://doi.org/10.1073/pnas.1019581108. Sandhu, S., Wiebe, N., Fried, L. F., & Tonelli, M. (2006). Statins for improving renal outcomes: A meta-analysis. Journal of the American Society of Nephrology, 17(7), 2006–2016. https://doi. org/10.1681/ASN.2006010012. Sanguankeo, A., Upala, S., Cheungpasitporn, W., Ungprasert, P., & Knight, E. L. (2015). Effects of statins on renal outcome in chronic kidney disease patients: A systematic review and metaanalysis. PLoS One, 10(7), e0132970. https://doi.org/10.1371/journal.pone.0132970. Saraswat, K., & Rizvi, S. I. (2017). Novel strategies for anti-aging drug discovery. Expert Opinion on Drug Discovery, 12(9), 955–966. https://doi.org/10.1080/17460441.2017.1349750. Sasson, I. (2016). Trends in life expectancy and lifespan variation by educational attainment: United States, 1990–2010. Demography, 53(2), 269–293. https://doi.org/10.1007/s13524-015-0453-7. Satoh, A., Brace, C. S., Rensing, N., Cliften, P., Wozniak, D. F., Herzog, E. D., Yamada, K. A., & Imai, S. (2013). Sirt1 extends life span and delays aging in mice through the regulation of Nk2

396

8 Prevention and Treatment of the Troubles of the Elderly

homeobox 1 in the DMH and LH. Cell Metabolism, 18(3), 416–430. https://doi.org/10.1016/j. cmet.2013.07.013. Sattar, N., Preiss, D., Murray, H. M., Welsh, P., Buckley, B. M., de Craen, A. J., Seshasai, S. R., McMurray, J. J., Freeman, D. J., Jukema, J. W., Macfarlane, P. W., Packard, C. J., et al. (2010). Statins and risk of incident diabetes: A collaborative meta-analysis of randomised statin trials. Lancet, 375(9716), 735–742. https://doi.org/10.1016/S0140-6736(09)61965-6. Schafer, M. J., White, T. A., Iijima, K., Haak, A. J., Ligresti, G., Atkinson, E. J., Oberg, A. L., Birch, J., Salmonowicz, H., Zhu, Y., Mazula, D. L., Brooks, R. W., et al. (2017). Cellular senescence mediates fibrotic pulmonary disease. Nature Communications, 8, 14532. https://doi. org/10.1038/ncomms14532. Scheen, A. J. (2004a). Renin-angiotensin system inhibition prevents type 2 diabetes mellitus. Part 1. A meta-analysis of randomised clinical trials. Diabetes & Metabolism, 30(6), 487–496. https://doi.org/10.1016/s1262-3636(07)70146-5. Scheen, A. J. (2004b). Prevention of type 2 diabetes mellitus through inhibition of the reninangiotensin system. Drugs, 64(22), 2537–2565. https://doi.org/10.2165/00003495-20046422000004. Schmieder, R. E., Ruilope, L. M., & Barnett, A. H. (2011). Renal protection with angiotensin receptor blockers: Where do we stand. Journal of Nephrology, 24(5), 569–580. https://doi.org/ 10.5301/JN.2011.6445. Schopf, F. H., Biebl, M. M., & Buchner, J. (2017). The HSP90 chaperone machinery. Nature Reviews. Molecular Cell Biology, 18(6), 345–360. https://doi.org/10.1038/nrm.2017.20. Schubert, C. R., Cruickshanks, K. J., Klein, B. E., Klein, R., & Nondahl, D. M. (2011). Olfactory impairment in older adults: Five-year incidence and risk factors. Laryngoscope, 121(4), 873–878. https://doi.org/10.1002/lary.21416. Seger, Y. R., García-Cao, M., Piccinin, S., Cunsolo, C. L., Doglioni, C., Blasco, M. A., Hannon, G. J., & Maestro, R. (2002). Transformation of normal human cells in the absence of telomerase activation. Cancer Cell, 2(5), 401–413. https://doi.org/10.1016/s1535-6108(02)00183-6. Senni, M., Trimarco, B., Emdin, M., & De Biase, L. (2017). Sacubitril/valsartan, a new and effective treatment for heart failure with reduced ejection fraction (article in Italian). Giornale Italiano di Cardiologia, 18(1), 3–11. https://doi.org/10.1714/2654.27228. Shelton, D. N., Chang, E., Whittier, P. S., Choi, D., & Funk, W. D. (1999). Microarray analysis of replicative senescence. Current Biology, 9(17), 939–945. https://doi.org/10.1016/s0960-9822 (99)80420-5. Sheng, Z., Jia, X., & Kang, M. (2016). Statin use and risk of Parkinson’s disease: A meta-analysis. Behavioural Brain Research, 309, 29–34. https://doi.org/10.1016/j.bbr.2016.04.046. Shrikrishna, D., Tanner, R. J., Lee, J. Y., Natanek, A., Lewis, A., Murphy, P. B., Hart, N., Moxham, J., Montgomery, H. E., Kemp, P. R., Polkey, M. I., & Hopkinson, N. S. (2014). A randomized controlled trial of angiotensin-converting enzyme inhibition for skeletal muscle dysfunction in COPD. Chest, 146(4), 932–940. https://doi.org/10.1378/chest.13-2483. Sivri, N., Tekin, G., Yalta, K., Aksoy, Y., Senen, K., & Yetkin, E. (2013). Statins decrease mean platelet volume irrespective of cholesterol lowering effect. Kardiologia Polska, 71(10), 1042–1047. https://doi.org/10.5603/KP.2013.0259. Skulachev, V. P. (1997). Aging is a specific biological function rather than the result of a disorder in complex living systems: Biochemical evidence in support of Weismann’s hypothesis. Biochemistry (Mosc), 62(11), 1191–1195. http://protein.bio.msu.ru/biokhimiya/contents/v62/full/ 62111394.html. Soefje, S. A., Karnad, A., & Brenner, A. J. (2011). Common toxicities of mammalian target of rapamycin inhibitors. Targeted Oncology, 6(2), 125–129. https://doi.org/10.1007/s11523-0110174-9. Son, D. H., Park, W. J., & Lee, Y. J. (2019). Recent advances in anti-aging medicine. Korean Journal of Family Medicine, 40(5), 289–296. https://doi.org/10.4082/kjfm.19.0087. Sonsalla, P. K., Coleman, C., Wong, L. Y., Harris, S. L., Richardson, J. R., Gadad, B. S., Li, W., & German, D. C. (2013). The angiotensin converting enzyme inhibitor captopril protects

References

397

nigrostriatal dopamine neurons in animal models of parkinsonism. Experimental Neurology, 250, 376–383. https://doi.org/10.1016/j.expneurol.2013.10.014. Su, J. B. (2015). Vascular endothelial dysfunction and pharmacological treatment. World Journal of Cardiology, 7(11), 719–741. https://doi.org/10.4330/wjc.v7.i11.719. Su, X., Zhang, L., Lv, J., Wang, J., Hou, W., Xie, X., & Zhang, H. (2016). Effect of statins on kidney disease outcomes: A systematic review and meta-analysis. American Journal of Kidney Diseases, 67(6), 881–892. https://doi.org/10.1053/j.ajkd.2016.01.016. Sumukadas, D., Struthers, A. D., & McMurdo, M. E. (2006). Sarcopenia – A potential target for Angiotensin-converting enzyme inhibition? Gerontology, 52(4), 237–242. https://doi.org/10. 1159/000093656. Syka, J., Ouda, L., Nachtigal, P., Solichová, D., & Semecký, V. (2007). Atorvastatin slows down the deterioration of inner ear function with age in mice. Neuroscience Letters, 411(2), 112–116. https://doi.org/10.1016/j.neulet.2006.10.032. Takase, S., Matoba, T., Nakashiro, S., Mukai, Y., Inoue, S., Oi, K., Higo, T., Katsuki, S., Takemoto, M., Suematsu, N., Eshima, K., Miyata, K., et al. (2017). Ezetimibe in combination with statins ameliorates endothelial dysfunction in coronary arteries after stenting: The CuVIC trial (effect of cholesterol absorption inhibitor usage on target vessel dysfunction after coronary stenting), a multicenter randomized controlled trial. Arteriosclerosis, Thrombosis, and Vascular Biology, 37 (2), 350–358. https://doi.org/10.1161/ATVBAHA.116.308388. Trainer, P. J., Drake, W. M., Katznelson, L., Freda, P. U., Herman-Bonert, V., van der Lely, A. J., Dimaraki, E. V., Stewart, P. M., Friend, K. E., Vance, M. L., Besser, G. M., Scarlett, J. A., et al. (2000). Treatment of acromegaly with the growth hormonereceptor antagonist pegvisomant. The New England Journal of Medicine, 342(16), 1171–1177. https://doi.org/10.1056/ NEJM200004203421604. Tranah, G. J., Blackwell, T., Ancoli-Israel, S., Paudel, M. L., Ensrud, K. E., Cauley, J. A., Redline, S., Hillier, T. A., Cummings, S. R., & Stone, K. L. (2010). Circadian activity rhythms and mortality: The study of osteoporotic fractures. Journal of the American Geriatrics Society, 58 (2), 282–291. https://doi.org/10.1111/j.1532-5415.2009.02674.x. Trepel, J., Mollapour, M., Giaccone, G., & Neckers, L. (2010). Targeting the dynamic HSP90 complex in cancer. Nature Reviews. Cancer, 10(8), 537–549. https://doi.org/10.1038/nrc2887. Tsao, S. W., & Fong, D. S. (2013). Do statins have a role in the prevention of age-related macular degeneration? Drugs & Aging, 30(4), 205–213. https://doi.org/10.1007/s40266-013-0061-4. Tsoukalas, D., Fragkiadaki, P., Docea, A. O., Alegakis, A. K., Sarandi, E., Thanasoula, M., Spandidos, D. A., Tsatsakis, A., Razgonova, M. P., & Calina, D. (2019). Discovery of potent telomerase activators: Unfolding new therapeutic and anti-aging perspectives. Molecular Medicine Reports, 20(4), 3701–3708. https://doi.org/10.3892/mmr.2019.10614. UK Prospective Diabetes Study (UKPDS) Group. (1998). Effect of intensive blood-glucose control with metformin on complications in overweight patients with type 2 diabetes (UKPDS 34). Lancet, 352(9131), 854–865. Undela, K., Gudala, K., Malla, S., & Bansal, D. (2013). Statin use and risk of Parkinson’s disease: A meta-analysis of observational studies. Journal of Neurology, 260(1), 158–165. https://doi.org/ 10.1007/s00415-012-6606-3. Vaiserman, A. M., Lushchak, O. V., & Koliada, A. K. (2016). Anti-aging pharmacology: Promises and pitfalls. Ageing Research Reviews, 31, 9–35. https://doi.org/10.1016/j.arr.2016.08.004. Vaiserman, A. M., Koliada, A. K., & Marotta, F. (2017). Gut microbiota: A player in aging and a target for anti-aging intervention. Ageing Research Reviews, 35, 36–45. https://doi.org/10.1016/ j.arr.2017.01.001. van Deursen, J. M. (2014). The role of senescent cells in ageing. Nature, 509(7501), 439–446. https://doi.org/10.1038/nature13193. van Uffelen, J. G. Z., Khan, A., & Burton, N. W. (2017). Gender differences in physical activity motivators and context preferences: A population-based study in people in their sixties. BMC Public Health, 17(1), 624. https://doi.org/10.1186/s12889-017-4540-0.

398

8 Prevention and Treatment of the Troubles of the Elderly

Vaziri, H. (1998). Extension of life span in normal human cells by telomerase activation: A revolution in cultural senescence. Journal of Anti-Aging Medicine, 1, 125–130. https://doi. org/10.1089/rej.1.1998.1.125. Vaziri, H., & Benchimol, S. (1998). Reconstitution of telomerase activity in normal cells leads to elongation of telomeres and extended replicative life span. Current Biology, 8(5), 279–282. https://doi.org/10.1016/s0960-9822(98)70109-5. Vogel, T., Benetos, A., Verreault, R., Kaltenbach, G., Kiesmann, M., & Berthel, M. (2006). Risk factors for Alzheimer: Towards prevention? (article in French). Presse Médicale, 35(9 Pt 2), 1309–1316. https://doi.org/10.1016/s0755-4982(06)74810-2. Walter, D. H., Rittig, K., Bahlmann, F. H., Kirchmair, R., Silver, M., Murayama, T., Nishimura, H., Losordo, D. W., Asahara, T., & Isner, J. M. (2002). Statin therapy accelerates reendothelialization: A novel effect involving mobilization and incorporation of bone marrow-derived endothelial progenitor cells. Circulation, 105(25), 3017–3024. https://doi.org/ 10.1161/01.cir.0000018166.84319.55. Wanamaker, B. L., Swiger, K. J., Blumenthal, R. S., & Martin, S. S. (2015). Cholesterol, statins, and dementia: What the cardiologist should know. Clinical Cardiology, 38(4), 243–250. https:// doi.org/10.1002/clc.22361. Wang, E. (1995). Senescent human fibroblasts resist programmed cell death, and failure to suppress bcl2 is involved. Cancer Research, 55(11), 2284–2292. Wang, Y., Li, Y., Shen, Q., Li, X., Lu, J., Li, X., Yin, D., & Peng, Y. (2014). Valsartan blocked alcohol-induced, Toll-like receptor 2 signaling-mediated inflammation in human vascular endothelial cells. Alcoholism, Clinical and Experimental Research, 38(10), 2529–2540. https://doi.org/10.1111/acer.12532. Welsh, D. K., Takahashi, J. S., & Kay, S. A. (2010). Suprachiasmatic nucleus: Cell autonomy and network properties. Annual Review of Physiology, 72, 551–577. https://doi.org/10.1146/ annurev-physiol-021909-135919. Weyh, C., Krüger, K., & Strasser, B. (2020). Physical activity and diet shape the immune system during aging. Nutrients, 12(3), 622. https://doi.org/10.3390/nu12030622. WHO, ICD-10. (2016). www.who.int/classifications/apps/icd/icd10online/. Accessed 14 Feb 2020. WHO, ICD-11. (2018). https://icd.who.int/browse11/l-m/en. Accessed 14 Feb 2020. Williams, G. C. (1957). Pleiotropy, natural selection and the evolution of senescence. Evolution, 11, 398–411. https://doi.org/10.2307/2406060. Wise, S. J., Nathoo, N. A., Etminan, M., Mikelberg, F. S., & Mancini, G. B. (2014). Statin use and risk for cataract: A nested case-control study of 2 populations in Canada and the United States. The Canadian Journal of Cardiology, 30(12), 1613–1619. https://doi.org/10.1016/j.cjca.2014. 08.020. Witte, A. V., Kerti, L., Margulies, D. S., & Floel, A. (2004). Effects of resveratrol on memory performance, hippocampal functional connectivity, and glucose metabolism in healthy older adults. The Journal of Neuroscience, 34(23), 7862–7870. https://doi.org/10.1523/JNEUROSCI. 0385-14.2014. Wood, J. G., Rogina, B., Lavu, S., Howitz, K., Helfand, S. L., Tatar, M., & Sinclair, D. (2004). Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature, 430(7000), 686–689. https://doi.org/10.1038/nature02789. World Ranking Total Deaths. (2017). Data from WHO. www.worldlifeexpectancy.com/worldrankings-total-deaths. Accessed 14 Feb 2020. WorldLifeExpectancy. (2017). Causes of death in the world (Data from WHO). www. worldlifeexpectancy.com/world-health-rankings. Accessed 14 Feb 2020. Wu, A., Ying, Z., & Gomez-Pinilla, F. (2006). Oxidative stress modulates Sir2alpha in rat hippocampus and cerebral cortex. The European Journal of Neuroscience, 23(10), 2573–2580. https://doi.org/10.1111/j.1460-9568.2006.04807.x. Wu, J. W., Boudreau, D. M., Park, Y., Simonds, N. I., & Freedman, A. N. (2014). Commonly used diabetes and cardiovascular medications and cancer recurrence and cancer-specific mortality: A

References

399

review of the literature. Expert Opinion on Drug Safety, 13(8), 1071–1099. https://doi.org/10. 1517/14740338.2014.926887. Xia, S., Kang, J., Jiang, Y., Huang, D., Wang, S., & Pang, B. (2015). Simvastatin promotes alveolar epithelial cell proliferation and attenuates cigarette smoke-induced emphysema in rats. Molecular Medicine Reports, 12(4), 5903–5910. https://doi.org/10.3892/mmr.2015.4172. Xian-Yu, J. B., Feng, J. F., Chen, Y. C., & Yang, Y. W. (2015). Effects of simvastatin and atorvastatin on biochemical and hematological markers in patients with risk of cardiovascular diseases. International Journal of Clinical and Experimental Medicine, 8(8), 13983–13989. Xing, Y., Yang, S.-D., Wang, M.-M., Feng, Y.-S., Dong, F., & Zhang, F. (2020). The beneficial role of exercise training for myocardial infarction treatment in elderly. Frontiers in Physiology, 2020, 11. https://doi.org/10.3389/fphys.2020.00270. Xu, M., Bradley, E. W., Weivoda, M. M., Hwang, S. M., Pirtskhalava, T., Decklever, T., Curran, G. L., Ogrodnik, M., Jurk, D., Johnson, K. O., Lowe, V., Tchkonia, T., et al. (2017). Transplanted senescent cells induce an osteoarthritis-like condition in mice. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 72(6), 780–785. https://doi. org/10.1093/gerona/glw154. Xu, M., Pirtskhalava, T., Farr, J. N., Weigand, B. M., Palmer, A. K., Weivoda, M. M., Inman, C. L., Ogrodnik, M. B., Hachfeld, C. M., Fraser, D. G., Onken, J. L., Johnson, K. O., et al. (2018). Senolytics improve physical function and increase lifespan in old age. Nature Medicine, 24(8), 1246–1256. https://doi.org/10.1038/s41591-018-0092-9. Yang, D. L., Zhang, H. G., Xu, Y. L., Gao, Y. H., Yang, X. J., Hao, X. Q., & Li, X. H. (2010). Resveratrol inhibits right ventricular hypertrophy induced by monocrotaline in rats. Clinical and Experimental Pharmacology & Physiology, 37(2), 150–155. https://doi.org/10.1111/j.14401681.2009.05231.x. Yang, F., Chu, X., Yin, M., Liu, X., Yuan, H., Niu, Y., & Fu, L. (2014). mTOR and autophagy in normal brain aging and caloric restriction ameliorating age-related cognition deficits. Behavioural Brain Research, 264, 82–90. https://doi.org/10.1016/j.bbr.2014.02.005. Yasar, S., Xia, J., Yao, W., Furberg, C. D., Xue, Q. L., Mercado, C. I., Fitzpatrick, A. L., Fried, L. P., Kawas, C. H., Sink, K. M., Williamson, J. D., ST, D. K., Carlson, M. C., & Ginkgo Evaluation of Memory (GEM) Study Investigators. (2013). Antihypertensive drugs decrease risk of Alzheimer disease: Ginkgo evaluation of memory study. Neurology, 81(10), 896–903. https://doi.org/10.1212/WNL.0b013e3182a35228. Yasar, S., Schuchman, M., Peters, J., Anstey, K. J., Carlson, M. C., & Peters, R. (2016). Relationship between antihypertensive medications and cognitive impairment: Part I. review of human studies and clinical trials. Current Hypertension Reports, 18(8), 67. https://doi.org/10.1007/ s11906-016-0674-1. Yayama, K., Sugiyama, K., Miyagi, R., & Okamoto, H. (2007). Angiotensin-converting enzyme inhibitor enhances liver regeneration following partial hepatectomy: Involvement of bradykinin B2 and angiotensin AT1 receptors. Biological & Pharmaceutical Bulletin, 30(3), 591–594. https://doi.org/10.1248/bpb.30.591. Yayama, K., Miyagi, R., Sugiyama, K., Sugaya, T., Fukamizu, A., & Okamoto, H. (2008). Angiotensin II regulates liver regeneration via type 1 receptor following partial hepatectomy in mice. Biological & Pharmaceutical Bulletin, 31(7), 1356–1361. https://doi.org/10.1248/bpb. 31.1356. Yosef, R., Pilpel, N., Tokarsky-Amiel, R., Biran, A., Ovadya, Y., Cohen, S., Vadai, E., Dassa, L., Shahar, E., Condiotti, R., Ben-Porath, I., & Krizhanovsky, V. (2016). Directed elimination of senescent cells by inhibition of BCL-W and BCL-XL. Nature Communications, 7, 11190. https://doi.org/10.1038/ncomms11190. Yu, S., Chu, Y., Li, G., Ren, L., Zhang, Q., & Wu, L. (2017). Statin use and the risk of cataracts: A systematic review and meta-analysis. Journal of the American Heart Association, 6(3), pii: e004180. https://doi.org/10.1161/JAHA.116.004180. Zhang, H., Pan, K. H., & Cohen, S. N. (2003). Senescence-specific gene expression fingerprints reveal cell-type-dependent physical clustering of up-regulated chromosomal loci. Proceedings

400

8 Prevention and Treatment of the Troubles of the Elderly

of the National Academy of Sciences of the United States of America, 100(6), 3251–3256. https://doi.org/10.1073/pnas.2627983100. Zhang, Y., Bradley, A. D., Wang, D., & Reinhardt, R. A. (2014). Statins, bone metabolism and treatment of bone catabolic diseases. Pharmacological Research, 88, 53–61. https://doi.org/10. 1016/j.phrs.2013.12.009. Zhou, Y., Yuan, Y., Cai, R. R., Huang, Y., Xia, W. Q., Yang, Y., Wang, P., Wei, Q., & Wang, S. H. (2013). Statin therapy on glycaemic control in type 2 diabetes: A meta-analysis. Expert Opinion on Pharmacotherapy, 14(12), 1575–1584. https://doi.org/10.1517/14656566.2013.810210. Zhu, Y., Armstrong, J. L., Tchkonia, T., & Kirkland, J. L. (2014). Cellular senescence and the senescent secretory phenotype in age-related chronic diseases. Current Opinion in Clinical Nutrition and Metabolic Care, 17(4), 324–328. https://doi.org/10.1097/MCO. 0000000000000065. Zhu, Y., Tchkonia, T., Pirtskhalava, T., Gower, A. C., Ding, H., Giorgadze, N., Palmer, A. K., Ikeno, Y., Hubbard, G. B., Lenburg, M., O’Hara, S. P., LaRusso, N. F., et al. (2015). The Achilles’ heel of senescent cells: From transcriptome to senolytic drugs. Aging Cell, 14(4), 644–658. https://doi.org/10.1111/acel.12344. Zhu, Y., Tchkonia, T., Fuhrmann-Stroissnigg, H., Dai, H. M., Ling, Y. Y., Stout, M. B., Pirtskhalava, T., Giorgadze, N., Johnson, K. O., Giles, C. B., Wren, J. D., Niedernhofer, L. J., et al. (2016). Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors. Aging Cell, 15(3), 428–435. https://doi.org/10.1111/acel.12445. Zillikens, M. C., van Meurs, J. B., Rivadeneira, F., Hofman, A., Oostra, B. A., Sijbrands, E. J., Witteman, J. C., Pols, H. A., van Duijn, C. M., & Uitterlinden, A. G. (2010). Interactions between dietary vitamin E intake and SIRT1 genetic variation influence body mass index. The American Journal of Clinical Nutrition, 91(5), 1387–1393. https://doi.org/10.3945/ajcn.2009. 28627. Zouboulis, C. C., & Makrantonaki, E. (2012). Hormonal therapy of intrinsic aging. Rejuvenation Research, 15(3), 302–312. https://doi.org/10.1089/rej.2011.1249.

Appendices

Appendix: Part A “Gene” is defined as something that is passed on from an individual, or the parental individuals, to the next generation as an exact copy, except unpredictable events defined as “mutations”. A gene modified by a mutation is passed on with equal accuracy. “Generation” is defined as the time needed for there to be N deaths within a population made up of a constant number N of individuals, thereby bringing about a renewal of the entire population (albeit not necessarily during the same period for all individuals).

Haploid Condition Let us assume that, in a hypothetical haploid organism, each individual, in a specific point of the genome, has either the gene C, with a constant phenotypic expression that determines the advantage s (s > 0), or, as the only alternative, the allele C0 that is inactive. If s < 0, it is defined as a disadvantage. In a population with a constant number of individuals, writing at the nth generation the frequency of C and C0 with Cn and C0 n, respectively, the advantage s is described by the following formula: C nþ1 ¼

C n ð1 þ sÞ C n ð1 þ sÞ þ C’n

© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Switzerland AG 2021 G. Libertini et al., Evolutionary Gerontology and Geriatrics, Advances in Studies of Aging and Health 2, https://doi.org/10.1007/978-3-030-73774-0

ðA:1Þ

401

402

Appendices

C0 nþ1 ¼

C0 n Cn ð1 þ sÞ þ C 0 n

ðA:2Þ

The denominator, which is given by the sum of the two numerators, maintains the sum of the frequencies constant: Cx þ C0 x ¼ 1

ðA:3Þ

Considering (A.3), the formula (A.1) becomes: C nþ1 ¼

C n ð1 þ sÞ C ð1 þ sÞ ¼ n Cn þ C0 n þ Cn s 1 þ Cn s

ðA:4Þ

The spreading of a gene according to the variation of the value of s is illustrated in Fig. A.1. The values of Cx are obtained by the iterative use of (A.4). C0 is not calculated nor indicated, as it is immediately obtainable from the formula: C0 x ¼ 1  Cx

ðA:5Þ

If we assume that C at each generation mutates in C0 with frequency u and that the frequency of back-mutation of C0 in C is negligible, we have:

Fig. A.1 Spreading within a species of a gene with advantage s. The values of s for the various curves are indicated near each of them. For all curves: C0 ¼ 0.05

Appendices

403

Cnþ1 ¼

Cn ð1 þ sÞ  C n u D

ðA:6Þ

C0 n þ Cn u D

ðA:7Þ

C 0 nþ1 ¼

where the denominator D is equal to the sum of the numerators. Working out the first formula we obtain: C nþ1 ¼

Cn ð1 þ s  uÞ C ð 1 þ s  uÞ ¼ n 1 þ Cn s C n ð1 þ sÞ  Cn u þ ð1  C n Þ þ C n u

ðA:8Þ

Frequency variations of C according to some values of s and u are illustrated in Fig. A.2. Now, let us also consider the back-mutation C0 -> C which has a frequency v. We have:

Fig. A.2 Frequency variations of C according to some values of s and u, which are indicated near each curve. For all curves: C0 ¼ 0.3. The lower curve shows that if decay u acts with greater intensity than advantage s, the frequency of C decreases. A very low value for s has been assumed to show this effect

404

Appendices

Cnþ1 ¼

C n ð1 þ sÞ  C n u þ C 0 n v C n ð1 þ sÞ  C n u þ C 0 n v þ C 0 n þ C n u  C 0 n v ¼

C n ð1 þ s  uÞ þ ð1  C n Þ v C n ð1 þ sÞ þ ð1  C n Þ ¼

ðA:9Þ

C n ð 1 þ s  u  vÞ þ v 1 þ Cn s

Frequency variations of C according to some values of s, u, and v are illustrated in Fig. A.3. Assuming that both u and v ¼ 0, we have the formulas of Fig. A.1, and assuming that only v ¼ 0, we have the formulas of Fig. A.2. If we hypothesize that there is no advantage (or disadvantage) of C over C0 , i.e., s ¼ 0, from the formula A.9, we obtain: Cnþ1 ¼

C n ð 1 þ s  u  vÞ þ v ¼ C n ð 1  u  vÞ þ v 1 þ Cn s

ðA:10Þ

which, writing Q ¼ 1 – u  v, becomes: Cnþ1 ¼ Cn Q þ v

ðA:11Þ

Fig. A.3 Frequency variations of C according to some values of s, u and v. The values of s, u and v are indicated near each curve. For all curves C0 ¼ 0.3

Appendices

405

If this simple formula must be applied over a great number of generations, the calculation can be simplified, observing that: C nþ2 ¼ C nþ1 Q þ v ¼ ðCn Q þ vÞQ þ v C nþ3 ¼ Cnþ2 Q þ v ¼ ððC n Q þ vÞQ þ vÞQ þ v
 Cn ¼ C o Qn v 1 þ Q1 þ Q2 . . . : þ Qn

ðA:12Þ

and, by applying the formula of the geometrical series: Cn ¼ Co Q þ v

1  Qn 1Q

ðA:13Þ

So, it is possible to obtain a non-iterative formula, i.e., a formula that must be used only once and not n times to calculate the value of C at the nth generation. The decay of a neutral gene, influenced only by the values of u and v, is illustrated in Fig. A.4. Defining then as “equilibrium frequency” (Ce) of a gene C the condition when there is no modification of the frequency of C from a generation to the next, i.e., when:

Fig. A.4 Decay of a neutral gene. The values of u and v are indicated near each curve. For all curves C0 ¼ 1

406

Appendices

Ce ¼ C nþ1 ¼ C n

ðA:14Þ

it is possible to obtain Ce from (A.10): C nþ1 ¼ C n ð1  u  vÞ þ v C e ¼ C e ð 1  u  vÞ þ v C e ð 1  1 þ u þ vÞ ¼ v

Ce ¼

v uþv

ðA:15Þ

This is a familiar formula in genetics and is independent from Co (Srb et al. 1965). Assuming the frequency v of back-mutation C0 -> C equal to zero, and by considering only s and u for the calculation of equilibrium frequency, as given by the formula (A.8): C nþ1 ¼

C n ð 1 þ s  uÞ 1 þ Cn s

since at equilibrium Cn+1 ¼ Cn ¼ Ce, if we divide both members of this formula by Ce (an operation that is valid if Ce 6¼ 0), we obtain: 1¼

1þsu 1 þ Ce s

1 þ Ce s ¼ 1 þ s  u

Ce ¼

su 1u ¼ s s

ðA:16Þ

Using analogous procedures, it is possible to get: C’e ¼ u=s and so, again:

ðA:17Þ

Appendices

407

Fig. A.5 Equilibrium frequencies of a gene with advantage s and decay u. In the abscissas, the difference in the value of s between one cross and the next is equal to 0.0002. The values of u are indicated near each curve

Ce þ C0 e ¼ 1  u=s þ u=s ¼ 1

ðA:18Þ

The equilibrium frequencies for some values of s and u are illustrated in Fig. A.5.

Diploid Condition Firstly, it is necessary to remember the Hardy-Weinberg’s formula (CC + 2 CC0 + C0 C0 ¼ 1) by which, with a simple calculation, we can obtain the frequency of the three possible genotypes of the two alleles, C and C0 : Frequency of genotype CC ¼ C2; Frequency of genotype CC0 ¼ 2 CC0 ¼ 2 C (1  C); Frequency of genotype C0 C0 ¼ C0 2 ¼ (1  C)2. As regards the advantage or advantage of the heterozygous and homozygous conditions, there are three possible cases.

408

Appendices

Case Alpha (Different Effects in Heterozygous and Homozygous Conditions) Gene C, if heterozygous, shows the advantage s0 and, if homozygous, the advantage s. By using Hardy-Weinberg’s formula, we have:
 C nþ1 ¼ Cn þ 2 Cn ð1  C n Þs0 þ C n 2 s  C n u þ C 0 n v =T

ðA:19Þ

C’nþ1 ¼ ðC’n þ 2 Cn ð1  C n Þs0 þ C n u  C 0 n vÞ=T

ðA:20Þ

where T indicates the sum of the two numerators: T ¼ C n þ 2 C n ð1  C n Þ s0 þ Cn 2 s  C n u þ C0 n v þ C 0 n þ 2 C n ð1  Cn Þ s0 þ C n u  C0 n v By simplifying, we obtain: Cnþ1 ¼

Cn ½1 þ 2 s0 þ C n ðs  2 s0 Þ  u  v þ v 1 þ 4 Cn s0 þ Cn 2 ðs  4s0 Þ

ðA:21Þ

Case Beta (Recessive Gene) The gene is recessive, that is, only in the homozygous state it shows the advantage s. This means that using the formula (A.21) and with s0 ¼ 0, we obtain: C nþ1 ¼

C n ð 1 þ C n s  u  vÞ þ v 1 þ Cn 2 s

ðA:22Þ

Case Gamma (Dominant Gene) The gene is dominant and shows an identical advantage s in the heterozygous and the homozygous state. Assuming s0 ¼ s in the formula (A.21), we get: C nþ1 ¼

C n ð 1 þ 2 s  C n s  u  vÞ þ v 1 þ 4 Cn s  3 Cn 2 s

ðA:23Þ

The spreading of recessive or dominant genes in a diploid organism is illustrated in Fig. A.6.

Appendices

409

Fig. A.6 Spreading of a gene C in a diploid organism. If the gene is recessive, the frequency is expressed with a square, otherwise with a cross. The curves, going from top to bottom, illustrate the cases beta, alpha, and gamma described in the text. The values of s for the recessive case and of s and s0 for the dominant case are indicated near each curve. For all curves: C0 ¼ 0.1; u ¼ 0.0001; v ¼ 0.000001.

For the calculation of the equilibrium values, it is necessary to recall that Cn+1 ¼ Cn ¼ Ce. Substituting Cn+1 and Cn with Ce in (A.21), we obtain:   Ce 1 þ 4 C e s0 þ C e 2 ðs  4 s0 Þ ¼ Ce ½1 þ 2 s0 þ C e ðs  2 s0 Þ  u  v þ v ðA:24Þ This is a third-grade equation with long and complex solutions. If it is assumed, as a simplifying condition, that v ¼ 0, the formula (A.24) becomes:   C e 1 þ 4 C e s0 þ C e 2 ðs  4 s0 Þ ¼ C e ½1 þ 2 s0 þ C e ðs  2 s0 Þ  u

Case Alpha (Different Effects in Heterozygous and Homozygous Conditions) The solutions are Ce ¼ 0 and:

ðA:25Þ

410

Appendices

Ce ¼

s  6 s0 

qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ðs  2 s0Þ2  4 u ðs  4 s0 Þ 2 ðs  4 s0 Þ

ðA:26Þ

Case Beta (Recessive Gene) If s0 ¼ 0, the solution becomes: Ce ¼

sþ

pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi s2  4 u s 1 þ 1  4 u=s ¼ 2 2s

ðA:27Þ

Case Gamma (Dominant Gene) If s ¼ s0 , the solution becomes: Ce ¼

5 s þ

pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi s2 þ 12 u s 5  1 þ 12 u=s ¼ 6 6 s

ðA:28Þ

If it is assumed, as a simplifying condition, that u ¼ 0, the formula (A.24) becomes:   C e 1 þ 4 C e s0 þ C e 2 ðs  4 s0 Þ ¼ C e ½1 þ 2 s0 þ C e ðs  2 s0 Þ  v þ v

ðA:29Þ

Case Alpha (Different Effects in Heterozygous and Homozygous Conditions) The solutions are Ce ¼ 0; Ce ¼ 1; and: Ce ¼

s’ 

pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi s’2  v ðs  4 s’ Þ s  4 s’

Case Beta (Recessive Gene) If s0 ¼ 0 and s < 0, the solution becomes:

ðA:30Þ

Appendices

411

pffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffi  v sÞ  v ð½sÞ v ½s pffiffiffiffiffiffiffiffiffi ¼ Ce ¼ ¼ ¼ v=½s s ½s ½ s

ðA:31Þ

Case Gamma (Dominant Gene) If s ¼ s0 and s < 0, the solution becomes: Ce ¼

s 

pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi s2  v ð‐3 sÞ s  s 1 þ 3 v=s 1 þ 1  3 v=½s ¼ ¼ 3 s 3 s 3

ðA:32Þ

In the case of a gene harmful in the recessive condition (s < 0) and advantageous in the heterozygous condition (s0 > 0), with the simplifications u ¼ 0; v ¼ 0, formula (A.24) becomes:   C e 1 þ 4 C e s0 þ C e 2 ðs  4 s0 Þ ¼ C e ½1 þ 2 s0 þ C e ðs  2 s0 Þ

ðA:33Þ

and the solutions are: 1,

2 s0 s  4 s0

ðA:34Þ

The first solution is valid if s > 0 and s0 0. Therefore, discarding solution 1: Ce ¼ 

2 s0 2 s0 ¼ 0 s  4s ½s þ 4 s0

ðA35Þ

If we consider Hardy-Weinberg formula (CC + 2 CC0 + C0 C0 ¼ 1), the equilibrium frequency of the phenotype expressing the disadvantageous condition by the gene C (Pe), if C is recessive, will be: Pe ¼ Ce 2 ¼ v=½s

ðA:36Þ

If C is dominant, the equilibrium frequency of C (Ce) will be given by the formula (A.32) which may be developed in the following way:  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi C e ¼ 1 13v=½sÞ=3¼  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ¼f 1 13v=½sÞ 1þ 13v=½sÞg=f3 1þ 13v=½sÞg¼  pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ¼ ð11þ3v=½sÞ=f3þ 3 13v=½sÞg ð3v=½sÞ=ð3þ3Þ0:5v=½s

ðA:37Þ

So, the equilibrium frequency of the phenotype expressing the condition of a dominant disadvantageous gene (Pe ) will be:

412

Appendices

Pe ¼ C e 2 þ 2 Ce ð1  Ce Þ ¼ 2 C e  C e 2 ¼ 

2ð0:5 v=½sÞ  ð0:5 v=½sÞ2  v=½s

ðA:38Þ

Appendix: Part B For the demonstration that a smaller mean duration of life (ML) or a proportionally greater value of s have the same effects on the spreading velocity of a favorable gene, it is necessary to observe that: C1 ¼

C2 ¼

C3 ¼

Cn ¼

C1  ð1 þ sÞ ¼ 1 þ C1  s

C 0  ð1 þ sÞ 1 þ C0  s

C 0 ð1þsÞð1þsÞ 1þC 0 s 1þC0 ð1þsÞs 1þC 0 s

¼

C 0  ð1 þ sÞ2 1 þ C 0  s þ C 0  s  ð1 þ sÞ

C2  ð1 þ sÞ C 0  ð1 þ sÞ3 ¼ ... ¼ 1 þ C2  s 1 þ C 0  s þ C 0  s  ð1 þ sÞ þ C 0  s  ð1 þ sÞ2

C 0  ð1 þ sÞn 1 þ C0  s þ C 0  s  ð1 þ sÞ þ C 0  s  ð1 þ sÞ2 þ . . . þ C0  s  ð1 þ sÞn1 C0 ð1 þ sÞn h i ¼ 1 þ C0  s  ð1 þ sÞ0 þ ð1 þ sÞ1 þ ð1 þ sÞ2 þ . . . þ ð1 þ sÞn‐1 1

ðB:1Þ Utilizing the formula of the geometric series, we obtain: Cn ffi

C 0  ð1 þ sÞn n

ð1þsÞ 1 þ C 0  S  1 1ð1þsÞ

¼

C 0  ð1 þ sÞn 1  C 0  ½ 1  ð1 þ sÞn 

ðB:2Þ

If n is an integer, using the Newton formula of the binomial and disregarding the terms having s with index superior to 1, which is justifiable because s has been supposed to be small, we get:

Appendices

413

Cn ffi

C 0  ð1 þ n  sÞ C  ð1 þ n  sÞ ¼ 0 1 þ C0  n  s 1  C 0  ð1  1  n  sÞ

ðB:3Þ

Besides, recalling that the number of generations in a period t is inversely proportional to the ML: n ¼ t/ML, and substituting, we obtain: Cn ¼ C 1 u:t: ffi

C 0  ð1 þ s=MLÞ 1 þ C0  s=ML

ðB:4Þ

where the coefficients of C are the time and not the generation, and that prove for integer values of n that smaller values of s and greater values of ML, and vice versa, have the same effects on the spreading velocity of a gene. If we consider that the equality is approximate, by interpolation we can infer that it is valid for fractional values of n, too. Also the exact formula, non-iterative, is: Cn ¼ C 1 u:t: ¼

C 0  ð1 þ sÞ1=ML h i 1  C0  1  ð1 þ sÞ1=ML

ðB:5Þ

Reference Srb, A. M., Owen, R. D., & Edgar, R. S. (1965). General genetics (2nd ed.). San Francisco: W. H. Freeman & Company.