Epiblast Stem Cells: Methods and Protocols (Methods in Molecular Biology, 2490) 1071622803, 9781071622803

Citation preview

Methods in Molecular Biology 2490

Pierre Osteil Editor

Epiblast Stem Cells Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Epiblast Stem Cells Methods and Protocols

Edited by

Pierre Osteil Swiss Cancer Research Institute, Ecole Polytechnique Fédérale de Lausanne, Lausanne, Switzerland

Editor Pierre Osteil Swiss Cancer Research Institute Ecole Polytechnique Fe´de´rale de Lausanne Lausanne, Switzerland

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-2280-3 ISBN 978-1-0716-2281-0 (eBook) https://doi.org/10.1007/978-1-0716-2281-0 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface In 2007, 26 years after the discovery of embryonic stem cells (ESC), two laboratory groups headed by Vallier and McKay developed a new type of pluripotent stem cell from mouse epiblasts. These pluripotent stem cells were made from embryos at a stage prior to the onset of gastrulation and are hence called Epiblast Stem Cells or EpiSC. This discovery was significant because it unveiled the pluripotency spectrum of the mammalian embryo (i.e., the establishment of the naı¨ve ESC to the primed EpiSC spectrum) and enabled scientists to develop a wide range of studies on pluripotency dismantling, lineage predisposition, and cell fate. Moreover, it appeared that EpiSC shared similar properties with human ESC derived from a blastocyst embryo, thus making EpiSC attractive for modeling early human development. The study of the post-implantation embryo is infamously difficult to achieve, due to its internal development, and it is thanks to the knowledge gained from the use of pluripotent stem cells that this task is now attainable. Although there has been more than a decade of work on EpiSC, bringing with it a plethora of new insights and a wide range of protocols available to establish and maintain them, there have also been problems with heterogeneity and difficulties in reproducing results in the lab. For instance, EpiSC are often confounded with epiblast-like cells (EpiLC) which are established directly from mouse ESC (Chapter 2). The differences between these two cell types must be understood to achieve the appropriate differentiation outcome, like the ability of EpiLC to differentiate into primordial germ cells (PGC—Chapter 16) or gastruloids (Chapter 14). We aim to tackle the reproducibility problem by gathering detailed state-of-the-art protocols to perform comprehensive analyses, enabling the reader to opt for the appropriate cell type to model the epiblast. Finally, the third part of the book will demonstrate some striking examples of how scientists can use the EpiSC to model critical developmental steps (e.g., gastrulation—Chapter 17) using current techniques alongside bioinformatic tools (Chapters 9 and 20). Altogether, this book of methods aims to deliver the most up-to-date protocols in using the EpiSC to answer critical questions on mammal development. Lausanne, Switzerland

Pierre Osteil

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

THE SPECTRUM OF MOUSE PRIMED PLURIPOTENT STEM CELLS

1 Establishment of Mouse Epiblast Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pierre Osteil 2 L-Proline Supplementation Drives Self-Renewing Mouse Embryonic Stem Cells to a Partially Primed Pluripotent State: The Early Primitive Ectoderm-Like Cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hannah J. Glover, Rachel A. Shparberg, and Michael B. Morris 3 Generation of Epiblast-Like Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Federica Cermola, Eduardo J. Patriarca, and Gabriella Minchiotti

PART II

v ix

3

11 25

TOOLKITS TO CHARACTERIZE AND STUDY PRIMED STEM CELLS

4 Identification and Visualization of Protein Expression in Whole Mouse Embryos by Immunofluorescence . . . . . . . . . . . . . . . . . . . . . . . . . 39 V. Pragathi Masamsetti and Patrick P. L. Tam 5 Small Interfering RNA (siRNA) Transfection in Epiblast Stem Cells. . . . . . . . . . . 47 Georgia R. Kafer 6 Measuring Endocytosis and Endosomal Uptake at Single Cell Resolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 Carolyn Sangokoya 7 3D Immunofluorescent Image Colocalization Quantification in Mouse Epiblast Stem Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 Joshua G. Dierolf, Andrew J. Watson, and Dean H. Betts 8 Flow Cytometric Characterization of Pluripotent Cell Protein Markers in Naı¨ve, Formative, and Primed Pluripotent Stem Cells . . . . . . . . . . . . . 81 Joshua G. Dierolf, Kristin Chadwick, Courtney R. Brooks, Andrew J. Watson, and Dean H. Betts 9 Exploring Chromatin Accessibility in Mouse Epiblast Stem Cells with ATAC-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 Nazmus Salehin, Nicole Santucci, Pierre Osteil, and Patrick P. L. Tam 10 A Reproducible and Dynamic Workflow for Analysis and Annotation of scRNA-Seq Data. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101 Nader Aryamanesh 11 Complete Transcriptome Analysis by 50 -End Single-Cell RNA-Seq with Random Priming. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141 Tsukasa Kouno, Piero Carninci, and Jay W. Shin

vii

viii

12

13

Contents

Global Proteomic Profiling of Embryonic Stem Cells Using iTRAQ Isobaric Tags with LC-MS/MS Quantification . . . . . . . . . . . . . . . . . . . . . . 157 Aseel Sharaireh, Anna L. Tierney, and Richard D. Unwin Comprehensive and Comparative Structural Glycome Analysis in Mouse Epiblast-like Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Federico Pecori, Hisatoshi Hanamatsu, Jun-ichi Furukawa, and Shoko Nishihara

PART III 14 15 16

17

18

19

20

PRIMED STEM CELLS TO ENGINEER GASTRULATION MODEL

Generation of Gastruloids from Epiblast-Like Cells . . . . . . . . . . . . . . . . . . . . . . . . . Federica Cermola, Eduardo J. Patriarca, and Gabriella Minchiotti Definitive Endoderm from EpiSC Aggregates in Matrigel. . . . . . . . . . . . . . . . . . . . Hisato Kondoh and Mai Fujii In Vitro Differentiation of Murine Embryonic Stem Cells (ESCs) into Primordial Germ Cell-like Cells (PGCLCs) . . . . . . . . . . . . . . . . . . . . . . . . . . . . Han-Pin Pui and Qiaolin Deng Differentiation of Human-Induced Pluripotent Stem Cells (hiPSCs) into Human Primordial Germ Cell-like Cells (hPGCLCs) In Vitro. . . . . . . . . . . . Ahmed Reda, Jan-Bernd Stukenborg, and Qiaolin Deng Differentiation of EpiLCs on Micropatterned Substrates Generated by Micro-Contact Printing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gae¨l Simon, Jean-Louis Plouhinec, and Benoit Sorre Grafting of Epiblast Stem Cell into the Epiblast and Whole-Embryo Imaging to Unveil Lineage Competence. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pierre Osteil, Joshua B. Studdert, and Patrick P. L. Tam Modeling Epiblast Shape in Implanting Mammalian Embryos . . . . . . . . . . . . . . . . Joel Dokmegang

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

195 203

211

233

249

267 279 297

Contributors NADER ARYAMANESH • Embryology Research Unit, Bioinformatics Group, Children’s Medical Research Institute, University of Sydney, Westmead, NSW, Australia DEAN H. BETTS • Department of Physiology and Pharmacology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada; Department of Obstetrics and Gynecology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada; The Children’s Health Research Institute (CHRI), Lawson Health Research Institute, London, ON, Canada COURTNEY R. BROOKS • Department of Physiology and Pharmacology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada PIERO CARNINCI • RIKEN Center for Integrative Medical Sciences, Yokohama, Japan FEDERICA CERMOLA • Stem Cell Fate Laboratory, Institute of Genetics and Biophysics “A. Buzzati Traverso”, CNR, Naples, Italy KRISTIN CHADWICK • Robarts Research Institute, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada QIAOLIN DENG • Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden; Center for Molecular Medicine, Karolinska University Hospital, Stockholm, Sweden JOSHUA G. DIEROLF • Department of Physiology and Pharmacology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada JOEL DOKMEGANG • NSF-Simons Center for Quantitative Biology, Northwestern University, Evanston, IL, USA; Department of Molecular Biosciences, Northwestern University, Evanston, IL, USA MAI FUJII • Graduate School of Biosciences, Kyoto Sangyo University, Kyoto, Japan JUN-ICHI FURUKAWA • Department of Advanced Clinical Glycobiology, Faculty of Medicine and Graduate School of Medicine, Hokkaido University, Sapporo, Hokkaido, Japan HANNAH J. GLOVER • Bosch Institute and Discipline of Physiology, School of Medical Sciences, University of Sydney, Camperdown, NSW, Australia HISATOSHI HANAMATSU • Department of Advanced Clinical Glycobiology, Faculty of Medicine and Graduate School of Medicine, Hokkaido University, Sapporo, Hokkaido, Japan GEORGIA R. KAFER • School of Health and Behavioural Sciences, University of the Sunshine Coast, Moreton Bay, QLD, Australia; Sunshine Coast Health Institute, Birtinya, QLD, Australia HISATO KONDOH • Biohistory Research Hall, Takatsuki, Osaka, Japan; Institute for Comprehensive Research Kyoto Sangyo University, Kyoto, Japan TSUKASA KOUNO • RIKEN Center for Integrative Medical Sciences, Yokohama, Japan V. PRAGATHI MASAMSETTI • Embryology Unit, Children’s Medical Research Institute, University of Sydney, Westmead, NSW, Australia; Faculty of Medicine and Health, School of Medical Sciences, University of Sydney, Westmead, NSW, Australia GABRIELLA MINCHIOTTI • Stem Cell Fate Laboratory, Institute of Genetics and Biophysics “A. Buzzati Traverso”, CNR, Naples, Italy MICHAEL B. MORRIS • Bosch Institute and Discipline of Physiology, School of Medical Sciences, University of Sydney, Camperdown, NSW, Australia

ix

x

Contributors

SHOKO NISHIHARA • Laboratory of Cell Biology, Department of Bioinformatics, Graduate School of Engineering, Soka University, Tokyo, Japan; Glycan and Life System Integration Center (GaLSIC), Soka University, Tokyo, Japan PIERRE OSTEIL • Embryology Research Unit, Children’s Medical Research Institute, University of Sydney, Westmead, NSW, Australia; Faculty of Medicine and Health, School of Medical Sciences, University of Sydney, Westmead, NSW, Australia; Swiss Cancer Research Institute (ISREC), School of Life Sciences, Ecole Polytechnique Fe´de´rale de Lausanne (EPFL), Lausanne, Switzerland EDUARDO J. PATRIARCA • Stem Cell Fate Laboratory, Institute of Genetics and Biophysics “A. Buzzati Traverso”, CNR, Naples, Italy FEDERICO PECORI • Laboratory of Cell Biology, Department of Bioinformatics, Graduate School of Engineering, Soka University, Tokyo, Japan JEAN-LOUIS PLOUHINEC • Laboratoire “Matie`re et Syste`mes Complexes” (MSC), UMR 7057 CNRS, Universite´ de Paris, Paris, France HAN-PIN PUI • Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden; Center for Molecular Medicine, Karolinska University Hospital, Stockholm, Sweden AHMED REDA • Department of Physiology and Pharmacology, Karolinska Institutet, Solna, Sweden NAZMUS SALEHIN • Embryology Research Unit, Children’s Medical Research Institute, University of Sydney, Westmead, NSW, Australia; Faculty of Medicine and Health, School of Medical Sciences, University of Sydney, Camperdown, NSW, Australia CAROLYN SANGOKOYA • Department of Pathology, University of California, San Francisco, San Francisco, CA, USA; The Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, Center for Reproductive Sciences, University of California, San Francisco, San Francisco, CA, USA NICOLE SANTUCCI • Embryology Research Unit, Children’s Medical Research Institute, University of Sydney, Westmead, NSW, Australia ASEEL SHARAIREH • Division of Cardiovascular Sciences, School of Medical Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK; Department of Conservative Dentistry, School of Dentistry, University of Jordan, Amman, Jordan JAY W. SHIN • RIKEN Center for Integrative Medical Sciences, Yokohama, Japan RACHEL A. SHPARBERG • Bosch Institute and Discipline of Physiology, School of Medical Sciences, University of Sydney, Camperdown, NSW, Australia GAE¨L SIMON • Institut Jacques Monod, UMR 7592, CNRS, Universite´ de Paris, Paris, France; Institut Curie, Universite´ PSL, Sorbonne Universite´, CNRS UMR168, Laboratoire Physico Chimie Curie, Paris, France BENOIT SORRE • Institut Curie, Universite´ PSL, Sorbonne Universite´, CNRS UMR168, Laboratoire Physico Chimie Curie, Paris, France; Laboratoire “Matie`re et Syste`mes Complexes” (MSC), UMR 7057 CNRS, Universite´ de Paris, Paris, France JOSHUA B. STUDDERT • Embryology Unit, Children’s Medical Research Institute, Westmead, NSW, Australia; Cellular Cancer Therapeutics Unit, Children’s Medical Research Institute, Westmead, NSW, Australia JAN-BERND STUKENBORG • NORDFERTIL Research Lab Stockholm, Childhood Cancer Research Unit, Department of Women’s and Children’s Health, Karolinska Institutet, and Karolinska University Hospital, Solna, Sweden

Contributors

xi

PATRICK P. L. TAM • Embryology Unit, Children’s Medical Research Institute, University of Sydney, Westmead, NSW, Australia; Faculty of Medicine and Health, School of Medical Sciences, University of Sydney, Westmead, NSW, Australia ANNA L. TIERNEY • Division of Cardiovascular Sciences, School of Medical Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK RICHARD D. UNWIN • Division of Cardiovascular Sciences, School of Medical Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK; Stoller Biomarker Discovery Centre, Division of Cancer Sciences, School of Medical Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK ANDREW J. WATSON • Department of Physiology and Pharmacology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada; Department of Obstetrics and Gynecology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, ON, Canada; The Children’s Health Research Institute (CHRI), Lawson Health Research Institute, London, ON, Canada

Part I The Spectrum of Mouse Primed Pluripotent Stem Cells

Chapter 1 Establishment of Mouse Epiblast Stem Cells Pierre Osteil Abstract Epiblast stem cells are made from the epiblast of mouse post-implantation embryo. They have been critical in the understanding of mammalian pluripotent stem cells as they share similar properties, such as their incapability to contribute to the formation of an embryo after injection into blastocyst. The epiblast stem cells (EpiSC) have delineated a novel status of pluripotency called “primed.” How to establish EpiSC from mouse embryo is described in detail in this chapter. Key words Epiblast, Epiblast stem cells, Derivation, Mouse

1

Introduction During the development of the mouse embryo, the cells transition from the blastocyst stage (E3.5) to the epiblast stage (E7.5) [1]. During this critical period the embryo attaches to the uterine wall and becomes almost inaccessible to the eye, which make it challenging to study. While this step leads to major morphogenetic changes the cells of the epiblast retain their pluripotency status. Therefore, as with the inner cell mass (ICM) of the blastocyst, the epiblast of the post-implantation embryo constitutes a source for the isolation of pluripotent stem cells. The ICM gives rise to embryonic stem cells (ESC) [2, 3] and the epiblast to epiblast stem cells (EpiSC) [4, 5]. They differ from their culture condition (addition of LIF versus FGF/Activin A), their morphology (round shaped versus flat colonies) and their transcriptomic signature. More importantly, the ESCs are able to contribute to an embryo when injected back, and form germline competent chimeras [6], which is not achievable with EpiSC [4]. Thus, there is a consensus that these two types of cells are stabilized at different states of pluripotency: naı¨ve and primed. Interestingly, the EpiSC share much of their properties with other mammalian cell lines (Human, monkey, rabbit, etc.) [5]. It is only by manipulating the

Pierre Osteil (ed.), Epiblast Stem Cells: Methods and Protocols, Methods in Molecular Biology, vol. 2490, https://doi.org/10.1007/978-1-0716-2281-0_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

3

4

Pierre Osteil

genome or adding cocktails of small molecules that scientists can achieve naı¨ve pluripotency in other species but, while their transcriptomic signature might be closer to that of ESC, the chimeric contribution of these reprogrammed cells remains to be demonstrated at the time of writing of this manuscript. Nonetheless, the EpiSC represent a fantastic opportunity to study the pluripotency continuum and dismantling in the embryo [7], which is especially critical as these two events are concomitant with the embryo implantation that is tedious to survey. The EpiSC also represent the last stage of pluripotency before the cells undergo gastrulation to form the three primitive germ layers, the endoderm, the ectoderm and the mesoderm [1]. They have been shown to be poised for specific lineages while maintaining their pluripotency status [8, 9]. The EpiSC must be distinguished from their ESC-derived counterpart the Epiblast-like cells (EpiLC) that have been shown to be quite different [10, 11]. Indeed, the EpiLC, as opposed to the EpiSC, can be differentiated into primitive germ cells, form gastruloid and pattern when seeded on confined geometry. This indicates that the EpiSC are more advanced and have lost their plasticity. In this chapter, the method to dissect the epiblast and isolate EpiSC used in current studies [11] will be detailed.

2

Materials

2.1 Epiblast Dissection

1. Tweezers, 3 different sizes (large 1, medium 2 and thin 2), autoclaved. 2. Scissors, 2 different sizes (large with round tip 1, small with pointy tip 1), autoclaved. 3. Acupuncture needles 2, autoclaved. 4. 60 mm plastic dishes. 5. 48-well plates. 6. PB1 medium: • Sodium Chloride, NaCl: measure 9 g into 1 L MilliQ H2O. • Potassium Chloride, KCl: measure 1.15 g into 100 mL MilliQ H2O (protect from light—wrap bottle in foil). • Disodium Hydrogen Phosphate, Na2HPO4: measure 10.924 g in 500 mL MilliQ H2O (protect from light— wrap bottle in foil). • Potassium Phosphate Monobasic KH2PO4: measure 2.1 g in 100 mL MilliQ H2O. • Calcium Chloride Dihydrate, CaCl2. 2H2O: measure 1.62 g in 100 mL MilliQ H2O.

Establishment of Mouse Epiblast Stem Cells

5

• Magnesium Chloride Hexahydrate, MgCl2. 6H2O: measure 3.31 g in 100 mL MilliQ H2O. • Sodium Pyruvate, C3H3O3Na: measure 0.170 g in 20 mL stock solution 1 (NaCl)—make fresh every 2 weeks (replace powder every 1–2 years). • Further dilute: Add 3 mL of above prepared Na pyruvate to a 200 mL measuring cylinder and make up to 150 mL with stock solution 1 (NaCl). • NaHCO3 and Phenol Red: measure 0.258 g NaHCO3 into 14.8 mL MilliQ H2O, add 5.2 mL phenol red—make fresh every 2 weeks. • Penicillin-G solution: 0.599 g in 100 mL stock 1 (NaCl) Glucose (C6H12O6). • Mix according all the above reagents in this order. • Adjust the pH to 7.3–7.4. • Aliquot into 50 mL tubes. Wrap in foil to protect from light and store at 4  C for 2 weeks. Discard after 2 weeks. 7. PBS 1. 8. 70% Ethanol. 2.2

EpiSC Culture

1. EpiSC medium: Knockout-DMEM, 20% Knockout serum, supplemented with 1% nonessential amino acid supplement, 1% Glutamax, 0.1uM 2-Mercaptoethanol, 10 ng/mL recombinant Human basic fibroblast growth factor (carrier free) (see Note 1) and 20 ng/mL recombinant human/mouse/rat Activin A protein (carrier free) (see Notes 1 and 2). Add FGF and Activin A extemporaneously. 2. Mouse embryonic fibroblasts (MEF) medium: DMEM, 10% Fetal Calf Serum (FCS), with 1% nonessential amino acid supplement, 0.1uM 2-Mercaptoethanol. 3. Mouse embryonic available).

fibroblast,

cryovials

(commercially

4. Collagenase. 5. Trypsin. 6. Syringe needle (25 gauge). 7. 4-well plate, IVF grade, with low edges allowing micromanipulation inside the well under a microscope. 8. Centrifuge. 9. Freezing medium.

6

3

Pierre Osteil

Methods

3.1 Epiblast Dissection

1. Mate desired male(s) and female(s) overnight. The following morning is considered E0.5. 2. Spray the tools and the benchtop with 70% Ethanol. 3. Take PB1 out of the fridge and pour some into two 60 mm petri dishes. 4. Cull the mice at the desired time point (see Note 3) by cervical dislocation (see Note 4). 5. Spray 70% ethanol on the belly part (see Note 5). 6. Open the peritoneum with one pair of large scissors while holding up the skin with the large tweezer. Put the tools away (see Note 6). 7. With medium tweezers find the uterine horns and pull them outside. At this stage, deciduae should be visible. 8. Cut each horn, at the top (toward the ovaries), just before the oviduct. 9. With sharper and thinner scissors, put one blade into the opening of the horn, and cut below and around the deciduae (see Note 7). 10. While continuing to hold the uterine wall that is now open, come with another medium tweezer and pick the decidua out, into a 60 mm petri dish with room temperature PB1. 11. With new 2 thin tweezers operate on each decidua to open them and release the embryo. With one tweezer, go through the middle of the decidua and hold it in place. With the second one, cut from the middle to the tip on both sides of the decidua (see Note 8). 12. Hold each half of the decidua with one tweezer and tear apart. The embryo should remain attached to one of them. 13. With one tweezer hold the half containing the embryo down the petri dish and with the other one scoop the embryo out of the decidua (see Note 9). 14. Transfer the embryo into a new 60 mm with PB1 to discard all the cellular debris from the decidua. 15. Take the thinner tweezers or the acupuncture needles to remove the Reichert’s membrane by pealing it out of the embryo (see Note 10). 16. Now the embryo is exposed, the epiblast can be isolated by cutting out the extra-embryonic part. 17. Transfer each epiblast into a well of a 24-well plate with PB1.

Establishment of Mouse Epiblast Stem Cells

3.2 EpiSC Derivation and Maintenance

7

1. 24–72 h before collecting the epiblast, seed inactivated MEF onto a 4-well plate petri dish. 2. Wash the epiblast into a new well of a 24-well plate with 1 PBS. 3. Wash the epiblast into a new well of a 24-well plate with EpiSC medium. 4. Transfer the entire epiblast into the well containing the EpiSC medium (see Note 11). 5. 48–72 h later, the primordial colony should have grown as a flat colony. Take the syringe needle and cut the colony into several clumps. Keep them in the same well. 6. With the needle, push down the colonies onto the MEF to allow them to attach and also spread them in the well. 7. After another 48–72 h, colonies should be ready for their first passage. Add the collagenase, 5 min at 37  C. 8. Mechanically lift the colonies up and transfer them into a 15 mL tube. 9. With pipetting a few times up and down, further dissociate the colonies into very small clumps. 10. Transfer into a new well of a 4-well plate with MEF. 11. For the following passages, treat the colonies with Trypsin, 2 min at 37  C after the collagenase treatment to allow a single cell culture. 12. Add Y-2763 to the medium for the next 24 h. 13. Continue until the obtention of five million cells to freeze them using the freezing medium (see Note 12).

4

Notes 1. Testing FGF and Activin A is absolutely critical for maintaining pluripotent epiblast stem cells. We recommend to test various concentrations around the range proposed here and evaluate which one is the most adequate for maintaining long term culture. 2. Carrier free Activin A is absolutely necessary to prevent spontaneous differentiation of the EpiSC. We have not tested FGF with carrier. 3. Epiblast can be isolated from E5.5 to E8.5. The maximum efficiency is at E7.5 due to the large number of cells within the epiblast compared to E5.5 and the pluripotent nature of the cells compared to E8.5. Younger embryos are more difficult to dissect and the culture condition described here do not allow to isolate cells at E5.5 states rather the EpiSC stabilized at

8

Pierre Osteil

E7.5, sharing higher correlation with the anterior primitive streak epiblast (Kojima 2014). 4. Gas can be used here, but avoid the injection of chemicals to avoid impacting on the quality of the embryos. 5. It could be good to also shave to avoid hair contamination. 6. The tools that are used for skin dissection should be considered contaminated and should not be used in the following steps of the protocol. 7. By doing this step, the decidua will be freely removable from inside the horn. This method saves a considerable amount of time compared to cutting each individual decidua and trying to dissect them out of the uterine wall individually. By getting a firm hold on the wall it is possible to zip through it with the scissor. This technique requires some practice, so if cutting deciduae one by one is preferred it is probably better to do the process one mouse at the time until the epiblast is placed in tissue culture. The longer one waits, the lesser the efficiency of establishing a cell line. 8. This is a general method that can be used for all stages. Although, for younger embryos, it is possible to use microscissors to cut through the entire decidua in one go. Doing so on older decidua might result in damaging the embryo. 9. For older embryo, from E7.5, it is possible to pull the entire structure from the ectoplacental cone. Younger ones are too soft to resist this operation and will be damaged. 10. This can be removed like a glove. The older the embryo, the stronger the membrane so the easier it is to perform this operation. 11. For the first 48–72 h it is not necessary to change the medium. The MEF will condition the medium and release some Activin A necessary to maintaining the pluripotency status of the cells. Doing so will increase the size of the colony for the first passage which might become critical for the successful establishment of the line. 12. Freezing can be done as early as passage 5, but sometimes the cell line can be lost later around passage 10 by spontaneous differentiation. References 1. Tam PPL, Loebel DAF (2007) Gene function in mouse embryogenesis: get set for gastrulation. Nat Rev Genet 8:368–381. https://doi. org/10.1038/nrg2084

2. Evans MJ, Kaufman MH (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292:154–156 3. Martin GR (1981) Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by Teratocarcinoma stem

Establishment of Mouse Epiblast Stem Cells cells. Proc Natl Acad Sci U S A 78:7634–7638. https://doi.org/10.1073/pnas.78.12.7634 4. Brons IG, Smithers LE, Trotter MW, RuggGunn P, Sun B, de Sousa C, Lopes SM, Howlett SK, Clarkson A, Ahrlund-Richter L, Pedersen RA, Vallier L (2007) Derivation of pluripotent epiblast stem cells from mammalian embryos. Nature 448:191–195. https:// doi.org/10.1038/nature05950 5. Tesar PJ, Chenoweth JG, Brook FA, Davies TJ, Evans EP, Mack DL, Gardner RL, McKay RD (2007) New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448:196–199. https://doi. org/10.1038/nature05972 6. Bradley A, Evans M, Kaufman MH, Robertson E (1984) Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309:255–256 7. Kojima Y, Tam OH, Tam PPL (2014) Timing of developmental events in the early mouse embryo. Semin Cell Dev Biol 34:65–75. https://doi.org/10.1016/j.semcdb.2014. 06.010 8. Kaufman-Francis K, Goh HN, Kojima Y, Studdert JB, Jones V, Power MD, Wilkie E,

9

Teber E, Loebel DAF, Tam PPL (2014) Differential response of epiblast stem cells to nodal and Activin signalling: a paradigm of early endoderm development in the embryo. Philos Trans R Soc Lond Ser B Biol Sci 369(1657): 20130550. https://doi.org/10.1098/rstb. 2013.0550 9. Kojima Y, Kaufman-Francis K, Studdert JB, Steiner KA, Power MD, Loebel DAF, Jones V, Hor A, de Alencastro G, Logan GJ, Teber ET, Tam OH, Stutz MD, Alexander IE, Pickett HA, Tam PPL (2014) The transcriptional and functional properties of mouse epiblast stem cells resemble the anterior primitive streak. Cell Stem Cell 14:107–120. https:// doi.org/10.1016/j.stem.2013.09.014 10. Hayashi K, Ohta H, Kurimoto K, Aramaki S, Saitou M (2011) Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146:519–532. https://doi.org/10.1016/j.cell.2011.06.052 11. Osteil P, Studdert J, Wilkie E, Fossat N, Tam PPL (2015) Generation of genome-edited mouse epiblast stem cells via a detour through ES cell-chimeras. Differentiation 91:119–125. https://doi.org/10.1016/j.diff.2015.10.004

Chapter 2 L-Proline Supplementation Drives Self-Renewing Mouse Embryonic Stem Cells to a Partially Primed Pluripotent State: The Early Primitive Ectoderm-Like Cell Hannah J. Glover, Rachel A. Shparberg, and Michael B. Morris Abstract Mouse embryonic stem cells (mESCs) can be grown under a variety of culture conditions as discrete cell states along the pluripotency continuum, ranging from the least mature “ground state” to being “primed” to differentiate. Cells along this continuum are demarcated by differences in gene expression, X chromosome inactivation, ability to form chimeras and epigenetic marks. We have developed a protocol to differentiate “naı¨ve” mESCs to a “partially primed” state by adding the amino acid L-proline to selfrenewal medium. These cells express the primitive ectoderm markers Dnmt3b and Fgf5, and are thus called early primitive ectoderm-like (EPL) cells. In addition to changes in gene expression, these cells undergo a morphological change to flattened, dispersed colonies, have an increased proliferation rate, and a predisposition to neural fate. EPL cells can be used to study the cell states along the pluripotency continuum, periimplantation embryogenesis, and as a starting point for efficient neuronal differentiation. Key words Amino acids, Early primitive ectoderm-like, Embryonic stem cell, L-proline, Pluripotency, Pluripotency continuum

1

Introduction Mouse embryonic stem cells (mESCs) can readily differentiate to the three germ layers of the embryo proper either in a spontaneous or directed manner by suitable manipulation of the in vitro culture conditions [1]. Conventional mESC lines are derived from the ICM of the 3.5–4.5 days post coitum (dpc) mouse blastocyst and are able to self-renew when cultured in the presence of Bone Morphogenetic Protein 4 (BMP4) (added as the pure protein or as present in FBS) [2], and Leukemia Inhibitory Factor (LIF) (added as the pure protein or as present in mouse embryonic fibroblast (MEF)-conditioned medium or by growing the mESCs on a MEF feeder layer) [3, 4]. These cells are pluripotent, and

Pierre Osteil (ed.), Epiblast Stem Cells: Methods and Protocols, Methods in Molecular Biology, vol. 2490, https://doi.org/10.1007/978-1-0716-2281-0_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

11

12

Hannah J. Glover et al.

express the core pluripotency genes Oct4, Sox2, and Nanog [5– 8]. Removal of LIF from the culture medium results in loss of pluripotency and spontaneous differentiation of the mESCs to cells of the three germ layers, and beyond [4]. In the decades since mESCs were first isolated, the notion of pluripotency has developed from being a discrete state to a continuum of cell states (Fig. 1a). mESCs grown in LIF and FBS are now known as “naı¨ve” mESCs. mESCs can also grow in the presence of a GSK3 inhibitor and a MEK1 inhibitor (known as 2i) to produce “ground state” mESCs—a cell population which recapitulates an earlier stage of blastocyst development [9, 10]. These cells express genes in the extended pluripotency network such as Stella and Esrrb. in addition to Oct4, Sox2 and Nanog [9, 16]. This chapter explores a third pluripotent state—the early primitive ectoderm-like (EPL) cell, which is a “partially primed” population on the pluripotency continuum (Fig. 1). “Ground state” mESCs, “naı¨ve” mESCs and EPL cells are metastable in the sense that they freely interconvert with one another upon appropriate changes in culture medium. The most mature pluripotent state identified along the mouse pluripotency continuum is the epiblast stem cell (EpiSC), (Fig. 1a). These cells are derived from 5.5 to 6.5 dpc post-implantation embryos, and are considered “primed” to differentiate [12, 13]. They self-renew in the presence of Activin A and bFGF [17–19], the same growth factors used for the self-renewal of human embryonic stem cells (hESCs) [20, 21]. EpiSCs have low expression of markers such as Rex1, and high expression of primitive ectoderm markers such as Dnmt3b, Fgf5, and the primitive streak markers Mixl1 and Brachyury (T) [11–13, 22]. 1.1 The Early Primitive-EctodermLike (EPL) Cell

In the ~4.5 dpc mouse embryo, the extraembryonic visceral endoderm (VE) (Fig. 1a; refs) helps instruct the inner cell mass (ICM) cells of the epiblast to transition to a second pluripotent state, the primitive ectoderm, which is the cellular substrate for gastrulation [23, 24]. MEDII, the conditioned medium generated from the human hepatocarcinoma cell line, HEPG2, performs an analogous function on mESCs, converting them to EPL cells [25]. These MEDII-generated EPL cells represent an intermediate “partially primed” state on the pluripotency continuum between “naı¨ve” mESCs and “primed” EpiSCs (Fig. 1b). Their gene expression profile is analogous in some respects to the in vivo primitive ectoderm, including reduced expression of the ICM markers Rex1 and Gbx2, and increased expression of the primitive ectoderm marker Fgf5 [25, 26]. Compared to mESCs, they form flattened monolayer colonies instead of round dome-shaped colonies, and doubling time is reduced from ~11 h to ~8 h [27]. Both the morphological change and the increase in proliferation are consistent with the changes that occur in vivo as the ICM transitions to

L-Pro Drives mESCs to Early Primitive Ectoderm-Like Cells

A

Trophectoderm

Extraembryonic Ectoderm Parietal Endoderm Visceral Endoderm Primitive Ectoderm

Hypoblast Epiblast 4.0 dpc

13

4.5 dpc

5.0 dpc

5.5 dpc

n

Ground state LIF/MEK1i/GSKi

Naïve mESCs LIF/serum

EPL cells

EpiSCs

LIF/serum/L-pro

bFGF/Act A

B Ground state mESCs

PC2: 24% variance

0.5

2i, LIF + Serum

5 0.25

0

EpiSCs bFGF + ActA

Naïve mESCs LIF + serum -0.25 5

EPL cells LIF + serum + L-pro . -0.2

0

0.2 .

0.4

PC1: 27% variance Fig. 1 Different cell states along the pluripotency continuum. (a) Self-renewing states along the continuum include: (a) “Ground state” mESCs, grown in the presence of 1 μM PD0325901, 3 μM CHIR99021, 1000 U/mL

14

Hannah J. Glover et al.

primitive ectoderm [25, 28]. These EPL cells do not contribute to chimaeras when injected into a blastocyst but do so after reversion to “naı¨ve” ESCs following the removal of MEDII and the retention of LIF [25, 29]. L-proline was shown to be the key bioactive molecule driving the differentiation to EPL cells [30]. mESCs grown in medium containing L-proline, 1000 U/mL LIF and FBS transition to EPL cells on a time-scale similar to that using medium containing 50% MEDII, LIF, and FBS [30]. Casalino et al. [31] use a similar L-proline-containing medium to produce cells called prolineinduced cells (PiCs). Like EPL cells produced using MEDII, Lproline-produced EPL cells/PiCs also show increased proliferation and altered colony morphology [30, 31]. They continue to express the key pluripotency genes Oct4 and Sox2 at levels observed in “naı¨ve” mESCs, but reduce expression of Nanog, the third member of the core pluripotency network [11, 30, 31]. There is also decreased expression of “naı¨ve” markers Rex1, Gbx2, and Crtr1 [30, 31] and increased expression of the primitive ectoderm markers Fgf5, Otx2, and Dnmt3b [11, 30, 31]. EPL cells/PiCs also show other characteristics of “primed” pluripotency cells including increased glycolysis, global DNA methylation, and histone methylation [32, 33]. However, the expression of Mixl1 and Brachyury (T)—a hallmark of “primed” EpiSCs – is suppressed in EPL cells [11]. Analogs of L-proline, including the stereoisomer D-proline, do not induce the transition of mESCs to EPL cells. However, some proline-containing peptides [30], and L-ornithine (which can be metabolized to L-proline), can drive the transition [31]. The mechanisms of action of L-proline in mESCs require its cellular uptake via the SNAT2 transporter [34] followed by acute activation of cell signaling including the mTOR, MEK/ERK and p38 pathways [30, 35, 36], and modulation of metabolic mechanisms including the proline cycle and the aminoacid response pathway [31, 37].

ä Fig. 1 (continued) LIF and 10% FBS [9, 10]. (b) “Naı¨ve” mESCs grown in 1000 U/mL LIF and 10% FBS [1]. (c) “Partially primed” EPL cells, following 4–6 days’ growth in 330 U/mL LIF, 10% FBS and 400 μM Lproline [11]. (d) “Primed” EpiSCs which are derived from the 5.5–6.5 dpc post-implantation embryo and selfrenew in the presence of 10 ng/mL bFGF and 20 ng/mL Activin A [12, 13]. The photomicrographs show representative images of each cell type. Scale bar ¼ 100 μm. (b) Principal component analysis of RNASeq data of the following cell states: A2 mESCs [14] cultured as either “ground state” mESCs or “naı¨ve” mESCs or following L-proline-mediated transition to EPL cells. A2 EpiSCs with the same genomic background as A2 mESCs [15] are also shown. Results are from three independent experiments and indicate that EPL cells lie on the pluripotency continuum between “naı¨ve” mESCs and “primed” EpiSCs

L-Pro Drives mESCs to Early Primitive Ectoderm-Like Cells

15

These results indicate both the novel function of L-proline (and other amino acids) as growth factors, and the emerging role of metabolism in driving developmentally relevant processes [30, 38–42]. The growth factor-like properties of L-proline have also been observed in pre-implantation mouse embryos [43]. While the presence of LIF is not required for the prolinemediated transition of mESCs to EPL cells [40, 44], it appears to be required for EPL-cell self-renewal [31]. On the other hand, too much LIF can completely prevent the transition to EPL cells (unpublished results). The ratio of LIF to L-proline is also important: The original published protocol used 1000 U/mL LIF and 200 μM L-proline [30]. These cells had robust expression of Dnmt3b but inconsistent expression of Fgf5 [30]. In the protocol below, the concentration of LIF is reduced to 330 U/mL, which is sufficient to maintain mESC self-renewal, but routinely results in an increase in the expression of Fgf5 upon addition of 400 μM Lproline, indicating that with this modified approach the cells progress further along the pluripotency continuum. Finally, while “partially primed” EPL cells and “primed” EpiSCs can form cells from all germ layers, L-proline tends to bias cells toward differentiating to neurectoderm [11, 40], whereas EpiSCs generally differentiate to mesendoderm [45]. In addition to being a valuable resource for studying pluripotency, EPL cells can also be used as an in vitro model of development, and as a starting cell population for robust neuronal differentiation.

2

Materials 1. 0.1% (w/v) porcine gelatin prepared in Ca2+-free PBS. Porcine gelatin can be purchased as a sterile solution or in powder form. If using the powder, add gelatin to PBS to a final concentration of 0.1% (w/v) and autoclave to dissolve. Alternatively, dissolve by warming to 37  C and filter sterilize. Store at 4  C for up to 6 months. 2. 0.25% trypsin–EDTA, sterile from manufacturer. Commercial formulations of 0.05% Trypsin-EDTA can also be used. 3. β-mercaptoethanol (β-Me): Make 0.1 M stock by adding 3.5 μL β-Me in 500 μL sterile water. This stock should be stored at 4  C for 1–2 weeks maximum (see Note 1). 4. L-proline: Sterile-filtered 0.1 M stock in water. Keep working stocks at 4  C for 4 weeks or at 20  C for 12 months. 5. Mouse LIF: 106 U/mL working stock in 0.1% BSA/PBS (generally equivalent to 10 μg/mL depending on the manufacturer). Sterile-filter and store at 4  C for 4 weeks or at 20  C for 12 months (see Notes 2 and 3).

16

Hannah J. Glover et al.

Table 1 Cell culture media. This table contains the base medium formulation, and the supplements required to make mESC self-renewal medium, EPL-cell medium and reduced LIF control medium

Base medium

b

Component (final conc.)

Stocka

Volume/100 mL

90% (v/v) DMEM (high glucose) 10% (v/v) FBSc 0.1 mM β-me 1 pen/strep

100% (v/v) 100% (v/v) 0.1 M 100

90 mL 10 mL 100 μL 1 mL

106 U/mL

100 μL

Complete media: 100 mL base medium supplemented with: mESC self-renewal mediumd

1000 U/mL LIF

EPL-cell medium

330 U/mL LIF 400 μM L-proline

10 U/mL 0.1 M

33 μL 400 μL

Reduced LIF control mediumb

330 U/mL LIF

106 U/mL

33 μL

e

6

See Subheading 2 for details Used as a control medium in experiments for converting “naı¨ve” mESCs to EPL cells c See Note 4 on the selection of FBS with appropriate properties d Used for the regular passage of “naı¨ve” mESCs e Used in experiments for converting “naı¨ve” mESCs to EPL cells a

b

6. Penicillin/Streptomycin (Pen/Strep) (100): 5000 U/mL penicillin G sodium salt and 5 mg/mL streptomycin sulfate in PBS. Sterile-filtered. 7. Trypan Blue solution: 0.4 g in PBS, pH 7.2–7.3. 8. Culture media are prepared as per Table 1. Each medium uses the same base components, supplemented with specific concentrations of LIF and/or L-proline.

3

Methods This protocol has been optimized for feeder-free D3 mESCs (wildtype cell line) [46], 46C mESCs (GFP expressed from one allele of Sox1) [47, 48] and A2 mESCs (containing a Tetracycline-inducible transactivator at Rosa26 and Dox-inducible Cre-LoxP in the Hprt gene) [14]. Cells are incubated at 37  C in a humidified incubator with 5% CO2 generally in 60 mm or 100 mm plates, but can be scaled accordingly.

3.1 Routine Passaging Protocol for mESCs and for the Conversion of mESCs to EPL Cells

1. Prepare tissue-culture plates by adding a small volume (~50 μL/cm2) of 0.1% gelatin. Swirl the plate to ensure even coverage, and set aside at room temperature for at least 15 min. (These plates can be kept aside for 1–2 weeks in a draft-free environment).

L-Pro Drives mESCs to Early Primitive Ectoderm-Like Cells

17

2. Prepare appropriate media for either mESC maintenance (i.e., mESC self-renewal medium; Table 1) and/or for experiments involving differentiation to EPL cells (i.e., EPL-cell medium; Table 1) with accompanying controls in reduced LIF control medium and base medium (Table 1). 3. Aspirate gelatin from the plates prepared in step 1 and add appropriate medium made in step 2 to each plate. For a 60 mm plate, use at least 5 mL medium. For a 100 mm plate, use at least 10 mL medium. Set aside. 4. Select a plate containing “naı¨ve” mESCs currently growing with appropriate colony morphology, growth characteristics, and number of passages after thawing from liquid N2 (see Note 5). 5. Aspirate medium from this plate and wash twice with sterilefiltered or autoclaved Ca2+-free PBS (see Note 6). 6. After aspirating the PBS, add 0.25% trypsin-EDTA (350 μL for a 60 mm plate, and 1 mL for a 100 mm plate). Swirl to ensure even distribution. After 20 s, the cells should be lifting from the plate. If using 0.05% Trypsin-EDTA, the incubation time should be extended to 1 min. 7. Deactivate the trypsin with the appropriate medium from step 2 (650 μL for a 60 mm plate, and 1 mL for a 100 mm plate; see Note 6). 8. Use a 1 mL pipette to triturate the cells from the plate, particularly at the junction between the side and base of the plate. Gentle trituration should be sufficient. Excessive shearing can lead to cell clumping and cell lysis. 9. Transfer the cell suspension into a microfuge tube and pulse centrifuge for 10 s. (Alternatively, centrifuge for 2 min at 400  g). 10. Remove the medium, add 1 mL fresh medium made in step 2, and pipette 10–15 times to form a single-cell suspension. 11. Take 10 μL single-cell suspension and mix with either 40 μL or 90 μL Trypan Blue solution. Perform a cell count using a hemocytometer or cell counting device (see Note 7). 12. Calculate the volume of cells required to replate (see Table 2). Add cells to plates prepared as in step 3 and swirl with forward and reverse figure 8 motions to ensure even distribution of the cells across the plate. Cells should adhere within 4 h (see Note 8) and should be monitored for confluency and morphology daily. We recommend re-plating cells at 2.5  104 cells/cm2 to achieve ~70% confluency after 48 h (see Note 9; Table 2). 13. Passage cells every 2 days (see Note 10). “Naı¨ve” mESCs grown in EPL-cell medium will generate EPL cells at days

18

Hannah J. Glover et al.

Table 2 Seeding densities. This table contains the seeding density to guide experimental planning. We suggest passaging cells every 2 days for routine passage and during differentiation Days in culture (days)

Cells/cm2

Cells/100 mm plate

2

2.5  10

4

1.5  106

3

1.7  104

1.0  106

4

9  103

5  105

5

5  103

3  105

6

3.5  103

2  105

4–6. These will have distinct colony morphology (flattened colonies with irregular borders; Fig. 2c, dii), gene expression profile (reduced expression of the early pluripotency marker Rex1 and higher expression of the primitive ectoderm markers Dnmt3b and Fgf5; Fig. 2b, c), and proliferation properties (see Note 9). If desired, further assessment of the position of the EPL cells along the pluripotency continuum can be undertaken by using a spontaneous differentiation assay (see Note 11). See Note 12 for the properties of cells grown in the two control media: reduced LIF control medium and base medium. EPL cells can also be produced from “ground state” mESCs, though we recommend running a time course of qPCR (see Note 13) and flow cytometry (see Note 14) to determine when cells have reached the EPL-cell stage.

4

Notes 1. β-Me is highly toxic with a strong sulfuric odor. Use caution when handling and limit exposure. 2. Mouse LIF is generally sold by weight and should have a specific activity of at least 108 U/mg. Use the manufacturer’s specifications to obtain a 106 U/mL working stock. Avoid repeated freeze-thaw cycles by making aliquots. 3. To confirm potency of a new batch of LIF, we recommend using flow cytometry or a commercially available alkaline phosphatase kit (used according to the manufacturer’s instructions). To test by flow cytometry, grow mESCs in mESC self-renewal medium for three passages and perform flow cytometry using Oct4 and Nanog antibodies (see Note 14). 80% cells should be Oct4+ and Nanog+, and colonies should have appropriate morphology and growth rates (see Note 5). To test for alkaline phosphatase activity, mESCs can be grown in 24- or 48-well

L-Pro Drives mESCs to Early Primitive Ectoderm-Like Cells

A

Day 0 Naïve mESC are plated in medium of choice at 2.5 x 104 cells/cm2

Day 2 Replated in same medium at 2.5 x 104

Day 4

19

Day 6

Replated in same medium at 2.5 x 104

cells for analysis

Cells collected for downstream analysis

B

10

C

EPL cell medium Reduced LIF control medium * Base medium only

5

*

*

*

Log2

0

D

i mESC self renewal medium

-5

* Rex1

ii Reduced LIF control medium iii EPL-cell medium

* Oct4

Dnmt3b

Fgf5

Mixl1

iv Base medium

Fig. 2 Protocol for differentiation of mESCs to EPL cells. (a) Recommended timeline for passaging cells. To differentiate to EPL cells, “naı¨ve” mESCs are passaged at day 0 and placed into EPL-cell medium at 2.5  104 cells/cm2. As controls, the cells can also be cultured in mESC self-renewal medium, reduced LIF control medium, and base medium. At days 2 and 4, cells are passaged and replated in the same medium at the same seeding density. Remaining cells can be used for downstream analyses. At day 6, cells can be collected by passaging and processed for downstream analyses (b) The expected expression of key genes after 6 days of culture. (c) D3 mESCs differentiated for 6 days in each medium and analyzed with qPCR. All samples were normalized to β-Actin as the reference gene and then to “naı¨ve” mESCs (grown in 1000 U/mL LIF). Mean log2 fold changes are shown  SEM (n  3). Data were analyzed using a two-way ANOVA with post hoc Dunnett’s multiple comparison test to “naı¨ve” mESCs. * ¼ P < 0.05. (d) The expected morphology after 6 days of culture in either i. mESC self-renewal medium, ii. Reduced LIF control medium, iii. EPL-cell medium and iv. Base medium. Scale bar ¼ 100 μm

plates in a range of LIF concentrations (e.g., 0–2000 U/mL). After 3 passages in ~250 U/mL LIF or higher, good colony morphology should be maintained and the colonies stain evenly for phosphatase activity. 4. FBS varies between suppliers and also between lots from the same manufacturer. Many offer FBS that has been tested and deemed suitable for mESC culture, at a premium price. However, many “standard” FBS products are perfectly suitable but need to be tested to determine this. To test, grow mESCs in

20

Hannah J. Glover et al.

mESC self-renewal medium for three passages and perform flow cytometry as per Notes 3 and 14. We also recommend checking the concentration of L-proline in the FBS (e.g., using mass spectrometry. 100% FBS should contain 80% GFP positive, whereas only 5–10% of mEpiSC cells (b) are GFP positive. Scale bars ¼ 10 μm

24 h prior to transfection, an approach that we find results in the highest transfection efficiency and best cell recovery. We routinely use a fluorescent transfection marker to indicate transfection efficiency in all experiments. The following protocol describes our use of the fluorescent maker siGLO which we routinely transfect using Lipofectamine RNAiMAX reagents. In our hands these reagents work efficiently with Dharmacon siRNA vectors. It is likely that the protocol will work with other siRNAs made by other means and with other lipid-based RNA delivery methods, but other reagents remain untested. We have tested the protocol described herein with siGLO concentrations up to 100 nM and do not find that concentrations higher than 50 nM result improve transfection efficiencies (Fig. 2). However, we do advocate that siRNA concentrations should be titrated for each new siRNA upon receipt and prior to large scale experimentation to determine optimal siRNA concentrations on a gene by gene basis.

2

Materials

2.1 Specialized Equipment Required

1. Rotary vial mixer (or similar mixing apparatus). 2. Fluorescent microscope equipped with either 494 nm/520 mn absorption/emission capability (for siGLO green) or with

50

Georgia R. Kafer

Fig. 2 Observed transfection efficiencies and cell survival of mouse epiblast stem cells (mEpiSCs) transfected with a GFP siRNA reporter (siGLO Green (Dharmacon). Healthy, undifferentiated mEpiSC at a density of 2
105 cells were used for either reverse transfection (protocol not described herein but referred to in the introduction) or forward transfection (protocol described herein) with volumes and concentrations of RNAiMAX and siGLO reagent used as indicated. Brightfield images reveal greater cell numbers in mEpiSC cultures following forward transfection relative to reverse transfection. Fluorescent images (GFP) were acquired from the same locations represented in brightfield images. A high (>70%) rate of GFP positive mEpiSCs can be achieved using either 50 or 100 nM of siRNA and 7.5 μl of RNAiMAX reagent. Minimal iMEF transfection occurs with either protocol. Scale bars ¼ 400 μm

Fig. 3 Schematic depicting a suggested timeline for performing siRNA experiments on mEpiSCs

Small Interfering RNA (siRNA) Transfection in Epiblast Stem Cells

557 nm/570 siGLO red). 2.2 Materials Required

mn

absorption/emission

51

capability

(for

1. Specific siRNA targeted to the gene(s) of interest (siRNA form can be lyophilized or pre-suspended. For resuspension of lyophilized siRNA see Subheading 3.1). 2. RNAse/DNAse free water. 3. Inactivated mouse embryonic feeder (iMEF) cells. 4. Healthy and undifferentiated mEpiSCs (2–4
105 cells/well of a 6 well plate to transfect). 5. mEpiSC growth media (20% KnockOut™ serum replacer, 1
MEM NEEA, 1
GlutaMAX™, 0.1 mM 2-Mercaptoethanol in KnockOut™ DMEM, + 20 ng/mL Recombinant Human/ Mouse/Rat Activin A Protein and 10 ng/mL Recombinant Human Basic FGF (146 aa) Protein (FGF2). 6. iMEF media (10% Fetal Bovine Serum in DMEM, 0.1 mM 2-Mercaptoethanol, 1x MEM NEEA, 1x GlutaMAX.). 7. 35 mm tissue culture dishes or 6-well tissue culture plates. 8. Opti-MEM medium. 9. Lipid-based transfection reagent (we use Lipofectamine RNAiMAX). 10. Fluorescent transfection (Dharmacon)).

3

indicator

(we

use

siGLO

Methods Notes prior to starting: Carry out all procedures at room temperature and in a sterile, tissue culture certified biological safety cabinet unless otherwise specified. Based on our experience, siRNA transfection experiments in mEpiSCs require 7 days (see Fig. 2).

3.1 siRNA Preparation

Timeline: Any time prior to transfection 1. Remove vials containing lyophilized siRNA and allow to thaw for 10 min at RT (see Note 1). 2. Centrifuge vials (500
g for 3 min) to concentrate siRNA at the bottom. 3. Resuspend siRNA in RNAse/DNAse free water. We recommend reconstituting at a concentration of 20 μM (see Note 2). For a siRNA amount of 5 nmol, a 20 μM concentration would require 250 μL of water. 4. Gently pipette siRNA solution to mix, and place on a rotary vial mixer for 30 min to achieve complete resuspension.

52

Georgia R. Kafer

5. Centrifuge the reconstituted siRNA vials to collect the siRNA at the bottom (200
g for 3 min) (see Note 3). 6. Aliquot reconstituted siRNA into smaller volumes to store. Reconstituted siRNA can be stored at 4  C for up to 6 weeks and at 20  C for longer periods, avoiding freeze-thaw cycles. 3.2 Preparing mEpiSCs for Transfection

Timeline: -3 to -1 days prior to transfection 1. Up to 3 days prior to mEpiSC passaging: Seed the MEF feeder cells (iMEFs) into gelatin coated wells (35 mm or wells of a 6-well plate) (see Note 4). 2. Day 0: Passage healthy, undifferentiated mEpiSCs at a density of 2–4
105 cells/well of a 6 well plate (see Note 5). Grow mEpiSCs in their routine growth media overnight.

3.3 mEpiSC Transfection

Timeline: Transfection day 0 1. Prepare and replenish mEpiSC cultures with mEpiSC growth media according to well size (1.5 mL for a 35 mm well). 2. Prepare siRNA mixtures according to Table 1 for volumes required for a 35 mm well. 3. Allow reconstituted siRNA reagent to come to room temperature. 4. Dilute required amount of Opti-MEM medium with Lipofectamine RNAiMAX reagent in a tube labeled “A.” Mix gently by pipetting. 5. Dilute reconstituted stock siRNA to the required working transfection concentration (i.e., 50 nM) in Opti-MEM medium in a tube labeled “B.” Mix gently by pipetting. 6. Add the contents of tube “A” to tube “B” in a 1:1 ratio. Mix gently by pipetting. 7. Incubate at room temperature for 20 min. 8. Add the A + B mixture to the mEpiSC and mix by gentle pipetting (see Note 6).

3.4 Evaluating mEpiSC Transfection Efficiency

To measure the efficiency of siRNA knockdown in mEpiSCs, we recommend that the expression of the gene of interest is assayed using either conventional or qualitative qRT-PCR-based approaches. We further recommend that the impact of siRNA gene knockdown on protein levels is validated via conventional western immunoblotting. In addition to these validations, we also strongly suggest that for each experiment, researchers include an extra well to perform a “transfection indicator” control. We use siGLO (Dharmacon) for this indicator. siGLO has a similar oligonucleotide structure to target siRNAs with the addition of a fluorescent tag. siGLO will locate to the nucleus of the cell upon

Small Interfering RNA (siRNA) Transfection in Epiblast Stem Cells

53

Table 1 Recommended volumes and concentrations for mEpiSC siRNA transfection. Space is provided in the last two columns for scaling reactions up if multiple wells (“X”) require transfection. We recommend adding an additional 0.5 well to calculations to account for pipetting errors

Reagent/ Tube Component A

B

A+B

Volume/ Concentration (for 35 mm well/dish)

Total volume

X number of wells (we recommend an additional + 0.5 well for pipetting X total errors) volume

Opti-MEM 150 μL medium Lipofectamine 7.5 μL RNAiMAX

157.5 μL 150 x “X” ¼

156 μL

157.5 μL 156 x “X” ¼

1.5 μL

1.5 x “X” ¼

Opti-MEM medium Reconstituted siRNA (20 μM)

Volume to add per 35 mm well/dish

7.5 x “X” ¼

315 μL

157.5 x “X” ¼ 157.5 x “X” ¼

315 x “X” ¼

successful transfection. The following steps are provided as a simple protocol for performing a stand-alone transfection indicator experiment in a single 35 mm well alongside the biological experiment being performed. We further recommend that this indicator experiment should be performed before target siRNA experiments are performed to check that the procedure is efficient in a chosen mEpiSC line (see Note 7). For the below procedure you must have iMEF and mEpiSC prepared as outlined above (Subheading 3.2). 1. Reconstitute siGLO pellets (pellets can be stored at RT in the dark for up to 4 weeks) at a concentration of 20 μM in RNAse/ DNAse free water (for a 5 nmol amount of siGLO add 250 μL of RNAse/DNAse free water). Use the same day or store aliquots at 80  C (allow siGLO aliquots to come to RT before using if frozen). 2. To a tube labeled “Glo-A” add 150 μL of Opti-MEM and 7.5 μL of Lipofectamine RNAiMAX. Mix gently by pipetting. 3. To a tube labeled “Glo-B” add 156 μL of Opti-MEM and 1.5 μL of reconstituted siGLO. 4. Mix 157.5 μL of Glo-A with 157.5 μL of Glo-B by gentle pipetting. Allow to incubate at RT in the dark for 5–20 min. 5. Add 315 μL Glo mixture to a 35 mm well of mEpiSCs and return cells to the incubator.

54

Georgia R. Kafer

6. Evaluate transfection efficiency after 24 h using a fluorescent microscope (Figs. 1 and 2) where successfully transfected cells will appear green or red under the appropriate excitation settings. siGLO Green requires viewing with a microscope that has a 494 nm/520 mn absorption/emission capability. siGLO Red requires viewing with a microscope that has a 557 nm/570 mn absorption/emission capability (see Note 8).

4

Notes 1. siRNAs are usually shipped as lyophilized product at RT. Lyophilized siRNA can be kept at room temperature for generally 1 month. Unless directed otherwise by the manufacturer, after reconstitution, it is best practice to store siRNAs at 20  C for 99%). 5. HBSS +1% BSA: Hanks Balanced Salt Solution (without Calcium or Magnesium), supplemented with Bovine Serum Albumin. 6. Cell counter or hemocytometer to count cells. 7. Sterile microcentrifuge tubes, microcentrifuge tube rack appropriate for incubation steps. 8. Microcentrifuge capable to spin cells 300
g at 4  C: refrigerated centrifuge preferred.

2.3 Prepare Stock Solutions

1. Prepare stock solutions of the pHrodo-conjugated probes: (a) 1 mg/mL pHrodo-dextran stock solution in sterile water. (b) 5 mg/mL pHrodo-transferrin stock solution in DPBS. 2. Aliquot and keep labeled dextran at 98% viability. Traditional compensation beads will not work with Live/Dead stains.

Flow Cytometric Analysis of the Pluripotency Continuum

89

4. Spectral overlap of fluorophores can confound flow cytometry results depending on the stain and the flow cytometer used. Several spectral overlap calculators are available, and it is highly recommended that all stains be reviewed and applied appropriately to the correct flow cytometry laser configurations. 5. It is often recommended that compensation beads are used with single stains for flow cytometry. However, pluripotent stem cell marker expression will fluoresce brighter in PSCs than current commercially available compensation beads. 6. All samples, except for the unstained controls, are now light sensitive and should always be handled in dim lighting conditions. 7. Fluorochromes such as phycoerythrin (PE) or allophycocyanin (APC) are large protein molecules and will be affected the same way as other proteins by the fixation so try to avoid alcohols. However, small fluorochromes such as AlexaFluor488 or FITC are generally unaffected by whichever fixative is used. 8. Doing this instead of importing the .wsp file containing the experiment will result in the x- and y- axes being flipped. This is a longstanding issue with FlowJo but may be corrected in the future. 9. This population can be refined by setting the x- and y- axes to forward-scatter-area and forward-scatter-height respectively, further gate out the main population of cells. A tightly, set polygonal gate works well (Fig. 1a). 10. This can be especially useful if combining and comparing several cell types or treatments and the pseudo-color display option can’t be selected. See Fig. 2 for a comparison of mESCs, mEpiLCs, and mEpiSCs overlayed. 11. Overlay of flow cytometric plots is best represented with adjunct histograms as pseudo-coloring of the individual events in an overlay is not distinguishable between groups.

5

Discussion This protocol is specifically designed to sort naı¨ve, formative, and primed pluripotent stem cell states. Studies examining newly derived or altered PSCs could find such methods useful in validating pluripotent state, calculating transitioning efficiency of generating pluripotent states, or for influencing genetic manipulation [3, 5, 9, 10]. As pluripotency is described as a continuum, this method is invaluable for studying differences between cell types found in the developing epiblast. Originally, these methods have focused on sorting differences between naı¨ve mESCs and primed mEpiSCs [5].

Joshua G. Dierolf et al.

5

10

CD24 - APC (670)

90

CD24H/SSEA1L mESC mEpiLC mEpiSC

CD24H/SSEA1H

4

10

3

10

2

10

0

CD24L/SSEA1L CD24L/SSEA1H 3 4 5 0 10 10 10 SSEA1 - BV421 (450)

Fig. 2 Flow cytometric expression of SSEA1 and CD24 during naı¨ve to primed transitioning in mESCs, mEpiLCs, and mEpiSCs. mESCs, mEpiLCs, and mEpiSCs examined for SSEA1 and CD24 run on a flow cytometry within a single session can be compared within a single flow plot to demonstrate the shifting of transitioning formative state mEpiLCs toward a primed-like pluripotent fate (see Note 11)

Here we uniquely describe how this procedure can be extended to also sort cells designated as the formative stage of pluripotency [5]. As formative state cells are the only known pluripotent cell type capable of primordial germ cell differentiation, this method is applicable and necessary for the investigation of mechanisms controlling the differentiation of naı¨ve, mESCs transitioning to a formative pluripotent state and onward to specialized germ cell-like cells following bone morphogenetic protein (BMP) treatment [3]. Recently, a non-transient formative state has been described in mouse and human embryonic stem cells [9]. With the addition of Fgf/nodal signaling, Dr. Austin Smith’s group, which originally hypothesized the formative pluripotent state, utilized tankyrase inhibitor to inhibit Wnt signaling in cells explanted from the inner cell mass of embryonic day 5.5 mouse embryos [9]. Previously¸ the formative state could only be captured for 24–48 h as a transient population, with this new methodology cells can be passaged for >20 passages maintaining characteristics of the formative state. The protocols outlined in this methodology paper could be applied to this landmark study in generating stable formative pluripotent lines as formative pluripotent stem cells represent the pluripotent interval of germ cell specialization capacitation

Flow Cytometric Analysis of the Pluripotency Continuum

91

[3]. Given proper bone morphogenetic protein stimuli, formative state cells can differentiate into primordial germ-like cells unlike any other pluripotent stem cell stage. Using this flow cytometric method, one can quantify the transitioning efficiency of formative state cells from mESCs compared to explanted formative state cells to determine differences in chemically transitioned and native states in vitro. Traditionally, reprogramming somatic human cells and explanting embryonic stem cells from human embryos results in pluripotent stem cells representing the primed pluripotent state. Recently, naı¨ve and formative state human stem cells have been derived from both embryonic and adult origins [9, 11, 12]. The described methodology should be equally applicable to be utilized in the reverse study of naı¨ve pluripotent reversion from the primed pluripotent state and somatic fates. From the human naı¨ve pluripotent state, it is possible to transition to formative state and capture the transitioning efficiency as well as compare to the traditional primed state as previous studies have compared naı¨ve and primed mouse pluripotent states [5]. The addition of CD40, a cell surface pluripotency marker associated with the primed pluripotent state, could additionally be utilized. Through previous attempts in the mouse system, we observed that CD24 differences were more apparent [5]. Currently, naı¨ve, formative, and primed pluripotency discrimination can be completed through transcript abundance studies, epigenetic landscape differences, differentiation assays, and chimeric contributions [2, 9]. This novel method has the added benefit of potential downstream applications through the option of fluorescently activated cell sorting (FACS) of distinct, purified cell populations. Following FACS, sorted fixed cells can be examined for protein or transcript abundance studies and perhaps single cell analysis or proteomics and live cells can be re-plated into more homogenous populations for expansion and differentiation assays. With the advent of stable formative pluripotent states, the described methodology with the addition of FACS could allow for the study of subpopulations for improved studies into the development of germ cell differentiation. Future improvements to this protocol are likely to be optimized using stable and pure formative state PSC lines. A comparative study examining the transition of mESCs to formative mEpiLCs compared to actual explanted formative state cells and primed mEpiSCs examining the transition throughout the pluripotent spectrum within a smaller time interval would be telling of the developmental changes that take place.

92

Joshua G. Dierolf et al.

Acknowledgments Flow cytometry was completed in at the London Regional Flow Cytometry Facility at Robarts Research Institute of Western University. mESC and mEpiSC pluripotent stem cell lines were graciously gifted from Dr. Janet Rossant. This research was funded by a Canadian Institutes of Health Research operating grants to A.J.W. and D.H.B. and Natural Sciences and Engineering Research Council of Canada grant to D.H.B. The funding sources played no role in design, data collection, analysis, decision to publish, or preparation of this study and manuscript. References 1. Leif RC (1986) Practical flow cytometry. Cytometry 7:111–112. https://doi.org/10.1002/ cyto.990070119 2. Morgani S, Nichols J, Hadjantonakis A-K (2017) The many faces of pluripotency: in vitro adaptations of a continuum of in vivo states. BMC Dev Biol 17:7. https://doi.org/ 10.1186/s12861-017-0150-4 3. Hayashi K, Ohta H, Kurimoto K, Aramaki S, Saitou M (2011) Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146:519–532. https://doi.org/10.1016/j.cell.2011.06.052 4. Solter D, Knowles BB (1978) Monoclonal antibody defining a stage-specific mouse embryonic antigen (SSEA-1). Proc Natl Acad Sci U S A 75:5565–5569. https://doi.org/10. 1073/pnas.75.11.5565 5. Shakiba N, White CA, Lipsitz YY, YachieKinoshita A, Tonge PD, Hussein SMI, Puri MC, Elbaz J, Morrissey-Scoot J, Li M, Munoz J, Benevento M, Rogers IM, Hanna JH, Heck AJR, Wollscheid B, Nagy A, Zandstra PW (2015) CD24 tracks divergent pluripotent states in mouse and human cells. Nat Commun 6 : 7 3 2 9 . h t t p s : // d o i . o r g / 1 0 . 1 0 3 8 / ncomms8329 6. Hahne F, Khodabakhshi AH, Bashashati A, Wong C-J, Gascoyne RD, Weng AP, SeyfertMargolis V, Bourcier K, Asare A, Lumley T, Gentleman R, Brinkman RR (2010) Per-channel basis normalization methods for flow cytometry data. Cytometry A 77A:121–131. https://doi.org/10.1002/ cyto.a.20823

7. Herzenberg LA, Tung J, Moore WA, Herzenberg LA, Parks DR (2006) Interpreting flow cytometry data: a guide for the perplexed. Nat Immunol 7:681–685. https://doi.org/10. 1038/ni0706-681 8. Strober W (1997) Trypan blue exclusion test of cell viability. Curr Protoc Immunol 21:A.3B.1– A . 3 B . 2 . h t t p s : // d o i . o r g / 1 0 . 1 0 0 2 / 0471142735.ima03bs21 9. Kinoshita M, Barber M, Mansfield W, Cui Y, Dietmann S, Nichols J, Smith A (2021) Capture of mouse and human stem cells with features of formative pluripotency. Cell Stem Cell 28(3):453–471.e8 10. Vidal SE, Stadtfeld M, Apostolou E (2015) F-class cells: new routes and destinations for induced pluripotency. Cell Stem Cell 16:9– 10. https://doi.org/10.1016/j.stem.2014. 12.007 11. Ware CB, Nelson AM, Mecham B, Hesson J, Zhou W, Jonlin EC, Jimenez-Caliani AJ, Deng X, Cavanaugh C, Cook S, Tesar PJ, Okada J, Margaretha L, Sperber H, Choi M, Blau CA, Treuting PM, Hawkins RD, Cirulli V, Ruohola-Baker H (2014) Derivation of naive human embryonic stem cells. Proc Natl Acad Sci U S A 111:4484–4489. https://doi.org/ 10.1073/pnas.1319738111 12. Giulitti S, Pellegrini M, Zorzan I, Martini P, Gagliano O, Mutarelli M, Ziller MJ, Cacchiarelli D, Romualdi C, Elvassore N, Martello G (2019) Direct generation of human naive induced pluripotent stem cells from somatic cells in microfluidics. Nat Cell Biol 21:275–286. https://doi.org/10.1038/ s41556-018-0254-5

Chapter 9 Exploring Chromatin Accessibility in Mouse Epiblast Stem Cells with ATAC-Seq Nazmus Salehin, Nicole Santucci, Pierre Osteil, and Patrick P. L. Tam Abstract The assay for transposase-accessible chromatin using sequencing (ATAC-seq) is used to identify open chromatin regions in cells. This can be used to identify putative regulatory regions, determine dynamics and mechanisms of transcription factors when coupled with ChIP-seq and predict interactions between proteins and chromatin. Compared to previous methods, MNase-seq and DNase-seq, ATAC-seq requires only 50,000 cells, orders of magnitude fewer cells. In addition, the ATAC-seq protocol takes one day to progress from cells to sequencing ready libraries. Key words EpiSC, ATAC-seq, Accessibility, Chromatin

1

Introduction The assay for transposase-accessible chromatin using sequencing (ATAC-seq) [1] uses a hyperactive Tn5 transposase preloaded with Illumina sequencing adapters. Within intact nuclei, Tn5 cleaves and inserts (tagments) these adapters at accessible regions of chromatin. Nucleosome bound regions of chromatin are typically protected from the action of Tn5. This unique action of Tn5 allows for assaying accessible regions of chromatin along with the identification of nucleosome occupied locations. We focus here on the first ATAC-seq protocol described [1]; there are modifications of the initial ATAC-seq protocol that use digitonin for permeabilization [2] or reduce mitochondrial reads [3].

Pierre Osteil (ed.), Epiblast Stem Cells: Methods and Protocols, Methods in Molecular Biology, vol. 2490, https://doi.org/10.1007/978-1-0716-2281-0_9, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

93

94

2

Nazmus Salehin et al.

Materials

2.1 General Equipment and Materials

1. 15 mL conical tubes. 2. 1.5 mL nuclease-free tubes, preferably low bind. 3. Refrigerated benchtop centrifuge that can accommodate both 15 mL and 1.5 mL tubes. 4. Phosphate buffered saline (PBS). 5. 100% analysis grade ethanol. 6. Equipment for cell counting. 7. Thermocycler. 8. qPCR machine. 9. 96-well reaction plate suitable for qPCR machine. 10. Magnetic rack suitable for 1.5 mL tubes. 11. PCR Primer 1. Working stock resuspended in TE to 25 μM: AATGATACGGCGACCACCGAGATCTACACTCGTCGG CAGCGTCAGATGTG. 12. Barcoded PCR Primer 2. Working stock resuspended in TE to 25 μM. Pick one primer per sample from: Index

Primer sequence

TAAGGCGA CAAGCAGAAGACGGCATACGAGATTCGCCTTAGT CTCGTGGGCTCGGAGATGT CGTACTAG CAAGCAGAAGACGGCATACGAGATCTAGTACGGT CTCGTGGGCTCGGAGATGT AGGCAGAA CAAGCAGAAGACGGCATACGAGATTTCTGCCTGT CTCGTGGGCTCGGAGATGT TCCTGAGC CAAGCAGAAGACGGCATACGAGATGCTCAGGAGT CTCGTGGGCTCGGAGATGT GGACTCCT CAAGCAGAAGACGGCATACGAGATAGGAGTCCGT CTCGTGGGCTCGGAGATGT TAGGCATG CAAGCAGAAGACGGCATACGAGATCATGCCTAGT CTCGTGGGCTCGGAGATGT CTCTCTAC CAAGCAGAAGACGGCATACGAGATGTAGAGAGGT CTCGTGGGCTCGGAGATGT CAGAGAGG CAAGCAGAAGACGGCATACGAGATCCTCTCTGGT CTCGTGGGCTCGGAGATGT GCTACGCT CAAGCAGAAGACGGCATACGAGATAGCGTAGCGT CTCGTGGGCTCGGAGATGT CGAGGC TG

CAAGCAGAAGACGGCATACGAGATCAGCCTCGGT CTCGTGGGCTCGGAGATGT

AAGAGGCA CAAGCAGAAGACGGCATACGAGATTGCCTCTTGT CTCGTGGGCTCGGAGATGT (continued)

Exploring Chromatin Accessibility in EpiSC with ATAC-Seq

Index

95

Primer sequence

GTAGAGGA CAAGCAGAAGACGGCATACGAGATTCCTCTACGT CTCGTGGGCTCGGAGATGT GTCGTGAT CAAGCAGAAGACGGCATACGAGATATCACGACGT CTCGTGGGCTCGGAGATGT ACCACTGT CAAGCAGAAGACGGCATACGAGATACAGTGGTGT CTCGTGGGCTCGGAGATGT TGGATCTG CAAGCAGAAGACGGCATACGAGATCAGATCCAGT CTCGTGGGCTCGGAGATGT CCGTTTGT CAAGCAGAAGACGGCATACGAGATACAAACGGGT CTCGTGGGCTCGGAGATGT TGCTGGGT CAAGCAGAAGACGGCATACGAGATACCCAGCAGT CTCGTGGGCTCGGAGATGT GAGGGG TT

CAAGCAGAAGACGGCATACGAGATAACCCCTCGT CTCGTGGGCTCGGAGATGT

AGG TTGGG

CAAGCAGAAGACGGCATACGAGATCCCAACCTGT CTCGTGGGCTCGGAGATGT

GTGTGG TG

CAAGCAGAAGACGGCATACGAGATCACCACACGT CTCGTGGGCTCGGAGATGT

TGGGTTTC CAAGCAGAAGACGGCATACGAGATGAAACCCAGT CTCGTGGGCTCGGAGATGT TGGTCACA CAAGCAGAAGACGGCATACGAGATTGTGACCAGT CTCGTGGGCTCGGAGATGT TTGACCCT CAAGCAGAAGACGGCATACGAGATAGGGTCAAGT CTCGTGGGCTCGGAGATGT CCACTCCT CAAGCAGAAGACGGCATACGAGATAGGAGTGGGT CTCGTGGGCTCGGAGATGT

2.2 Preparation of Nuclei: Nuclear Lysis Buffer

10 mM Tris–HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% (v/v) IGEPAL CA-630. Can be stored at 4  C for a week. Keep at 4  C during use.

2.3 Transposition of Nuclei and Library Preparation

1. Illumina Tagment DNA TDE1 Enzyme and Buffer Kit (Illumina, 20034197 or 20034198) (see Note 1). 2. PCR purification kit capable of retaining fragments as small as 100 bp. 3. DNA purification magnetic beads: AMPure XP or SPRIselect. 4. High-fidelity PCR Master Mix suitable for next-generation sequencing library preparation. 5. 25 SYBR Green. 6. Buffer EB: 10 mM Tris-Cl, pH 8.5.

96

3

Nazmus Salehin et al.

Methods

3.1 Preparation of Nuclei from EpiSC

1. Begin with 50,000 cells resuspended in ice-cold PBS (see Note 2). 2. Centrifuge cells 300  g for 5 min and aspirate PBS. 3. Resuspend cells in 50 μL ice-cold PBS and centrifuge 300  g for 5 min. 4. Aspirate PBS and resuspend cells gently in 50 μL of ice-cold nuclear lysis buffer using a P200. 5. Pellet the nuclei by centrifuging at 500  g for 10 min. 6. Aspirate supernatant.

3.2 Tagmentation of Accessible Chromatin

1. For each sample, prepare tagmentation mix containing: 25 μL 2 Tagment DNA (TD) buffer, 2.5 μL TD enzyme I (TDE1 Tagment DNA Enzyme) and 22.5 μL nuclease-free water. 2. Immediately resuspend nuclei in 50 μL of tagmentation mix and incubate at 37  C for 30 min in a thermocycler (see Note 3). 3. Purify tagmented DNA using a column purification kit according to manufacturer protocol (see Note 4), eluting DNA into 10 μL of Buffer EB. This DNA may be stored at 20  C for up to a week.

3.3 Initial PCR Amplification of Transposed DNA

1. Per sample, combine the following in a 0.2 mL PCR tube: 10 μL DNA sample (purified above) 10 μL nuclease-free water 2.5 μL 25 μM PCR Primer 1 2.5 μL 25 μM Barcoded PCR Primer 2 (see Note 5) 25 μL High-Fidelity 2 PCR Master Mix. 2. Thermal cycle as follows: Cycles

Temperature

Duration

1

72  C

5 min

1 5



30 s



10 s 30 s 1 min Hold

98 C 98 C 63  C 72  C 4 C

3. Transfer samples to ice. After this initial amplification, an aliquot of the library is cycled in a qPCR machine (after addition of SYBR) to determine the appropriate number of cycles to remain in the exponential phase of PCR (Fig. 1b).

Exploring Chromatin Accessibility in EpiSC with ATAC-Seq

A

97

B 40

Nuclear isolation

Rn - Relative Fluorescence

Max fluorescence

30

Rep. 1 Rep. 2 Rep. 3

20 1/3 Max fluorescence

10

Remaining cycles

0 1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 Cycles

C Tagmentation

Column purification

Amplification

QC and Sequencing

Fig. 1 (a) Overall scheme for ATAC-seq. Chromatin from nuclei extracted from cells are tagmented with a hyperactive Tn5 transposase to identify regions of chromatin accessibility. Tagmented fragments can then be purified, barcoded, amplified and ready for sequencing within one day. (b) Strategy for identifying optimal cycle numbers for library preparation. The number of cycles required to reach one-third maximum relative fluorescence is ideal. (c) Fragment distribution for final amplified and size selected library. 150 bp periodicity is expected 3.4 Additional Cycle Determination Using qPCR

1. Prepare the following in a 96-well reaction plate: 5 μL of previously PCR-amplified DNA (from Subheading 3.3, step 3) 3.9 μL nuclease-free H2O 0.25 μL 25 μM PCR Primer 1

98

Nazmus Salehin et al.

0.25 μL 25 μM Barcoded PCR Primer 2 0.6 μL 25 SYBR Green 5 μL High-Fidelity 2 PCR Master Mix. 2. In a qPCR machine, cycle as follows. Cycles

Temperature

Duration

1

98  C

30 s

20



98 C 63  C 72  C

10 s 30 s 1 min

3. Calculate the additional number of cycles needed per sample by determining the cycle which corresponds to one-third of the maximum fluorescence intensity (Fig. 1b). The remaining library is then subjected to this calculated number of cycles. 3.5 Final Amplification of Library

1. Run the remaining 45 μL of sample in a thermocyler for the number of cycles determined in Subheading 3.4 step 3. Thermal cycle as follows:

Cycles

Temperature 

Duration

1

72 C

5 min

1

98  C

30 s

N

98  C 63  C 72  C 4 C

10 s 30 s 1 min Hold

Where N is the number of cycles determined for each sample.

3.6 Magnetic BeadAssisted Purification of Amplified Library

1. Bring AMPure XP beads to room temperature. Gently swirl the beads to resuspend evenly (see Note 6). 2. Transfer 45 μL of amplified DNA 1.5 mL tubes containing 22.5 μL AMPure XP beads to remove fragments >1000 bp, pipetting up and down to mix (see Note 7). 3. Incubate at room temperature for 8 min. 4. Place tube on the magnetic rack for 2 min and transfer the supernatant to a new 1.5 mL tube containing 58.5 μL AMPure XP beads to remove fragments ${sample}_${date}.time ${cellranger} count \ --id=${sample}

\

--transcriptome=/PATH/TO/refdata-gex-mm10-2020-A \ --fastqs=/PATH/TO/FASTQ_FOLDER \ --sample=${sample} \ --localcores=24 \ --localmem=256 > ${sample}_${date}.out 2> ${sample}_${date}.err date +%Y-%m-%d.%H:%M:%S >> ${sample}_${date}.time done

104

Nader Aryamanesh

3.2 Setting up General Parameters

Here, we set up the working directory and general parameters (see Note 2). baseDir